بررسی تنوع ژنتیکی سویه های مایکوباکتریوم توبرکلوزیس جدا شده ...

mrc.ac.ir

بررسی تنوع ژنتیکی سویه های مایکوباکتریوم توبرکلوزیس جدا شده ...

يها

ي م

يها

يها

ي ريويها

ي ريويها

يها

ي م

يها

يها

يها

يکل

يها

يها

يها

يها

يها

يها

ي م

يها

يها

مجله علمی دانشگاه علوم پزشکی کردستان/‏ دوره چهاردهم/‏ زمستان ۲۹-۳۹ ۱۳۸۸/

بررسي تنوع ژنتيکي سويه

مايکوباکتريوم توبرکلوزيس جدا شده از بيمارستان مسيح

دانشوري تهران با استفاده از تکنيک

MIRU –VNTR

۶

۵

۴

۳

۲

۱

مهدي جعفريان ، پريسا فرنيا ، محمد کارگر ، موئد اغالي ميرزا ، رشيد رمضان زاده ، مجتبي احمدي ، محمد رضا

۸

۷

مسجدي ، علي اکبر ولايتي

۱- دانشجوي کارشناسي ارشد ميکروبيولوژي دانشگاه آزاد اسلامي واحد جهرم ) مؤلف مسؤول)،‏ مرکز تحقيقات مايکوباکتريولوژي،‏ دانشگاه علوم پزشکي و خدمات

پزشکي بهداشتي درماني شهيد بهشتي-‏ تهران،‏ تهران،‏ ايران

تلفن ۰۲۱-۲۶۱۰۹۵۰۵ mehdijafariandormency@gmail.com

۲- دانشيار گروه ميكروبيولوژي،‏ علوم پزشکي و خدمات پزشکي بهداشتي درماني شهيد بهشتي-‏ تهران،‏ مرکز تحقيقات مايکوباکتريولوژي،‏ تهران،‏ ايران

۳- استاديار گروه ميكروبيولوژي،‏ دانشگاه آزاد اسلامي واحد جهرم،‏ تهران،‏ ايران

۴- دانشجوي دوره دکتراي پزشکي،‏ دانشگاه اربيل،‏ اربيل،‏ عراق

۵- استاديار گروه ميكروبيولوژي،‏ دانشگاه علوم پزشکي و خدمات بهداشتي درماني کردستان،‏ تهران،‏ ايران

۶- کارشناس ميکروب شناسي،‏ آزمايشگاه رفرانس سل کشوري،‏ مرکز تحقيقات مايکوباکتريولوژي،‏ تهران،‏ ايران

۷- استاد گروه داخلي،‏ دانشگاه علوم پزشکي و خدمات بهداشتي درماني شهيد بهشتي - تهران،‏ مرکز تحقيقات سل و بيماري

۸- استاد گروه اطفال،‏ دانشگاه علوم پزشکي و خدمات بهداشتي درماني شهيد بهشتي-‏ تهران،‏ مرکز تحقيقات سل و بيماري

چکيده

زمينه و هدف:‏ امروزه پيدايش سويه

در سطح جهاني مطرح است.‏ از سال

نمود.‏

، تهران،‏ ايران

، تهران،‏ ايران

MDR به عنوان يک مشکل جدي در برابر برنامه کنترل بيماري سل در اغلب کشورها و

۱۹۹۰ تاکنون

موارد متعددي از گسترش سل MDR در مناطق مختلف جهان گزارش شده

است،‏ که عمدتا ً به دليل استفاده نابجا و نادرست از داروهاي سل است.‏ از علل اصلي بروز مقاومت داروئي به عنوان يک عارضه

ساخت دست بشر ميتوان به اشتباه در طبقهبندي،‏ عدم پايش حين درمان بيماران و عدم نظارت در مصرف داروهاي ضد سل اشاره

هدف اين مطالعه بررسي

تنوع ژنتيکي

سويه

مايکوباکتريوم توبرکلوزيس

جدا شده

Archive of SID

تکنيک MIRU-VNTR

باشد.‏

روش بررسي:‏ در اين مطالعه از ۹۶ سويه مايکوباکتريوم توبرکلوزيس جدا شده از بيماران مبتلاء به سل ريوي تست

داروئي به عمل آمد و تنوع ژنتيکي سويهها براساس لوکوس

لوکوسها با استفاده از فرمول آماري HGDI بدست آمد.‏

MIRU-VNTR

يافتهها:‏ بررسي الگوي ژنتيکي سويههاي حساس نشان داد که اين سويهها متعلق به خانواده

از بيماران با استفاده از

حساسيت

محاسبه گرديد.‏ اختلاف آللي هر کدام از

،Haarlem ،Dehli/CAS

Caprae ،H37RV ،LAM

خانواده

باشند.‏ در صورتيکه در سويه

Haarlem و LAM به چشم ميخورد.‏ اختلاف آللي لوکوس

مقاوم به داروئي مايکوباکتريوم توبرکلوزيس بيشتر الگوي ژنتيکي

سويه

لوکوسهاس 27 24، 20، 4، 2، به عنوان کمترين اختلاف آللي به ميزان (۳≥ (HGDI و

بيشترين اختلاف آللي به ميزان (۶ ≥ (HGDI را در بين لوکوس ها سويه

نتيجه گيري:‏ نتايج نشان داد که بيشترين تنوع ژنتيکي سويه

تعلق داشتند و تکنيک استفاده شده

سريع،‏ دقيق و ارزان ميباشد و در جمعيت

حساس و مقاوم معنيدار نميباشد.‏ به طور

لوکوس هاي

حساس و مقاوم شناسائي شدند.‏

حساس و مقاوم به دارو

به خانواده

31 ،26 ،16 ،10 و 40

Dhli/CAS و Haarlem

MIRU-VNTR

در اين مطالعه براي بررسي تنوع ژنتيکي سويه

با فراواني بالا به راحتي

توان از اين تکنيک استفاده نمود.‏

کليد واژه ها:‏ مايکوباکتريوم توبرکلوزيس،‏ مولکولار اپيدميولوژي،‏ الگوي ژنتيکي،‏ MIRU-VNTR

وصول مقاله:‏ ۸۸/۹/۳۰

اصلاحيه نهايی:‏ ۸۸/۱۲/۵

پذيرش مقاله:‏ ۸۹/۱/۹

مايکوباکتريوم روشي

www.SID.ir


يدم

يها

يها

يها

يها

يها

يها

يها

يها

يها

يها

يها

يها

يها

يها

يان

٣٠ بررسی تنوع ژنتيکی …

مقدمه

امروزه سل MDR 1 با شيوع روز افزون خود کنترل

سل در دنيا را با مشکل مواجه ساخته است.‏

از يک طرف

فقدان داروهاي جديد ضد سل و از طرف ديگر مقاومت

رو به افزايش به داروهاي ضد سل خط دوم موجود بر

پيچيدگي موضوع افزوده است.‏ لذا تحقيقات گستردهاي

در حال حاضر در دنيا در مورد تشخيص درمان و توليد

داروهاي جديد ضد سل در حال انجام است.‏ انگشت

نگاري DNA از سويه

براي مطالعه اپي

ميباشد.‏

انتشار عفونت

غالبا ً از روش انگشت نگاري

بررسي شيوع عفونت

همچنين مطالعات اپيدميولوژي

ميشود

قطعه

مايکوباکتريوم ابزاري مناسب

ناشي از اين سويه

RFLP 2

براي

سلي در بيمارستانها،‏ زندانها و

در

يک کشور استفاده

Archive of SID

.(۱)

IS6110

اما روش انگشت نگاري RFLP که بر پايه

استوار است،‏

داراي

يک سري

محدوديتهايی از قبيل:‏ کمبود بودن مقدار DNA و کم

بودن تعداد کپي

IS6110 قطعه

.(۲)

در نمونهها ميباشد

با اين که روشهاي زيادي از انگشت نگاري DNA

طي سالهاي اخير براي سويه مايکوباکتريوم توبرکلوزيس

ارائه شده است،‏ اما برخي از اين روشها بيفايده و تنها

تعداد کمي از آنها هستند که در اکثر آزمايشگاه

مورد استفاده قرار ميگيرند

اخيرا ً ارائه شده روشي

.(۳)

تکراري و متغير که تحت عنوان

استوار است.‏ به توالي

يکي از روشهايی که

است که بر پايه توالي

(VNTR 3 )

ميشناسند

تکراري متغير و پراکندهاي که

به طور تصادفي در ژنوم مايکوباکتريوم قرار گرفتهاند،‏

(MIRU)

ميگويند

که الگوي ژنتيکي

.(۴)

بر اساس همين تواليها است

١

هر سويه در تکنيک MIRU-VNTR

مشخص ميشود.‏

هر سويه داراي يک الگوي ژنتيکي

خاص خود ميباشد که به اين ترتيب ميتوان خانواده هر

سويه را مشخص و طبقهبندي

لوکوس

۴۱ تاکنون (۵). نمود

MIRU 4

در ژنوم

مايکوباکتريوم توبرکلوزيس)‏

لوکوس آن قبلا ً توسط دکتر

سال

H37RV

شناسائي

‏(سويه استاندارد

شده است،‏

۲۹

supply

۱۹۹۷

MIRU توالي

و همکارانش در

و مابقي آنها اخيرا ً گزارش شده،‏ لوکوس

۱۰۰ تا ۴۰ حدود

نوکلئوتيدي هستند

که به صورت تصادفي و تکراري در ژنوم مايکوباکتريوم

قرار گرفتهاند (۶). MIRU بر اساس طبقهبندي به

اصلي تقسيم ميشود.‏ نوع اول شامل توالي

نوکلئوتيد نوع دوم و سوم توسط شکافهاي

نوکلئوتيدي به انتهاي

ميشوند.‏

۳ نوع

حدود ۷۷

۲۴ و ۱۵

۳

ً

۵ و

ً

ترکيب ۲ MIRU

توالي

هر دو نوع ميباشند را ميتوان در لوکوس

نوع اول متناظر

و ۳ که شامل شکافهايي از

۸ و ۲۰

.(۷)

ژنهاي

اغلب لوکوس

نواحي

MIRU

با ژنهاي

مجاور

شروع خواندن و کدونهاي

همپوشاني دارند،‏ برخي از اين لوکوس

يافت

يا با

پاي

را MIRU

ميتوان در درون اين نواحي يافت.‏ اطلاعات مربوط به

اين لوکوسها را ميتوان در جدول

هدف از اين

مطالعه

بررسي

۱ مشاهده نمود (۸).

تنوع ژنتيکي

سويه

مايکوباکتريوم جدا شده از بيماران مراجعه به بيمارستان

مسيح دانشوري،‏ با استفاده از تکنيک

بود.‏

MIRU-VNTR

4. Mycobacterial Interspersed Repetitive Unit

1. Multi Drugs Resistance

2. Restrictio Fragment Length Polymorphism

3. Variable Number Tandem Repeat

مجله علمی دانشگاه علوم پزشکی کردستان/‏ دوره چهاردهم/‏ زمستان ۱۳۸۸

www.SID.ir


يها

ي م

يها

يها

يها

يب م

يش م

يها

يها

مهدی جعفريان ٣١

جدول ۱: اطلاعاتي در خصوص ۱۲ لوکوس ، MIRU-VNTR موقعيت لوکوسها،‏ تعداد تکرار و اندازه توالي

اندازه توالي

تکراري بر روي ژنوم سويه

استاندارد H37RV

تکراري bp) (

تعداد تکرارها

موقعيت لوکوس بر

روي ژنومH37RV

آلل لوکوس

نام لوکوس

H37RV 0157-53 bp

H37RV 0580-77 bp

H37RV-0959-53bp

H37RV-1644-53 bp

H37RV-2059-77bp

H37RV-2531-53 bp

H37RV-2387-54 bp

H37RV-2996-51 bp

H37RV-3006-53 bp

H37RV-3192-53bp

H37RV-4348-53bp

H37RV-0802-54 bp

MIRU2

MIRU4

MIRU10

MIRU16

MIRU 20

MIRU23

MIRU24

MIRU26

MIRU27

MIRU31

MIRU39

MIRU40

154111

580546

959868

1644026

2059429

2531560

2684427

2996002

3006875

3192168

4348401

802194

4 ( 1 - 4 )

11( 0-7 , 9 , 11,3)

8( 1-5 , 7-9)

4 ( 1 – 4 )

2

6 ( 1 – 6 )

2 ( 1 – 2 )

10 ( 1- 10 )

5 ( 0 – 4 )

5 ( 2 – 6 )

4 ( 1 – 4 )

6 ( 1- 4 , 6 – 7 )

Archive of SID

53

77

53

53

77

53

52

51

53

53

53

54

روش بررسي

از ۹۴ بيمار سل ريوي که در بين سالهاي

۸۷-۸۸ به

مرکز تحقيقات مايکوباکتريولوژي،‏ آزمايشگاه رفرانس

سل کشوري ‏(بيمارستان مسيح دانشوري)‏ مراجعه کرده

بودند الگوي ژنتيکي MIRU-VNTR مورد بررسي قرار

گرفت.‏ جداسازي اوليه سويه

و %۴ پتروف

حساسيت داروئي

ريفامپين

اتامبوتول

به گروه

با استفاده از محيط

در برابر ايزونيازيد

مايکوباکتريوم با روش

(LJ 1 )

انجام شد.‏

،(%2 µg/ml)

(10µg/ml) استرپتومايسين ،(40µg/ml)

(2µg/ml)

DNA

و

به روش تناسبي انجام شد و سويهها

حساس و مقاوم به دارو تقسيم شدند.‏

که براي

واکنشهاي

استفاده ميشد از محيط کشت حاوي

جداسازي

زنجيرهاي

پليمراز

مايکوباکتريوم

گرديد.‏ به اين طريق که با لوپ از کلني

که بر روي محيط کشت قرار دارد برداشته و درµL 400

TE ،

ميلي

بافري که حاوي

۱۰)

ميلي مولار

۱ ،Tris – Hcl

مولار EDTA

(pH= ۸ با

اضافه ميکرديم.‏ براي

غير فعال کردن باکتريها،‏ آنها به مدت ۲۰ دقيقه در دماي

۸۰ درجه سانتيگراد

قرار داده ميشدند . DNA به وسيله

مراحل چندگانه CTAB استخراج و در

100

ميکروليتر

TE

در

بافر حل ميشد.‏ واکنشهاي

يک حجم

MIRU-NTR

PCR 2

۲۵

ميکروليتر

تهيه ميگرديد

که

ميکروليتر از آن حاوي ،DNA بقيه حجم واکنش را

۱

d

PCR buffer،Mgcl2 ،NTP

MIRU که در جدول

ميداد.‏

مدت

۲

همه واکنشهاي

و پرايمرهاي اختصاصي

نيز نشان داده شده است تشکيل

زنجيرهاي

پليمراز،‏

MIRU

۵

در مدت

مرحله

۱۰

به

denaturizing و مرحله extension را نيز

دقيقه طي

د،‏ کل واکنشهاي

PCR

، MIRU در 35

سيکل انجام ميشد.‏ دماي

که در مدت ۱ دقيقه براي همه لوکوس

به ترتيب لوکوس

annealing

MIRU بوده

،26 ،24 ، 23 ،20 ،16 ،10 ،4 ،2

39 ،31 ،27 و 40 عبارتند از:‏ ،64 ،65 ،67،64 ،60 ،61

63 ،58 ،64،65 و 61

اشد.‏

1. Lowenstein Jensen

2. Polymerase Chain Reaction

مجله علمی دانشگاه علوم پزشکی کردستان/‏ دوره چهاردهم/‏ زمستان ۱۳۸۸

www.SID.ir


يها

يها

يها

يها

يها

٣٢ بررسی تنوع ژنتيکی …

جدول ۲: مشخصات پرايمرهاي مورد استفاده و طول توالي تکثير شونده مطابق با سويه استاندارد H37RV

اندازه محصولات Locus of MIRU Primer sequence ( 5 ’ 3 ’ ) PCR

2

4

10

16

20

23

24

26

27

31

39

40

TGGACTTGCAGCAATGGACCAACT F

TACTCGGACGCCGGCTCAAAA` R

GCGCGAGAGCCCGAACTGC F

GCGCAGCAGAAACGTCAGC R

GTTCTTGACCAACTGCAGTCGTCC F

GCCACCTTGGTGATCAGCTACCT R

TCGGTGATCGGGTCCAGTCCAAGTA F

CCCGTCGTGCAGCCCTGGTAC R

TCGGAGAGATGCCCTTCGAGTTAG F

GGAGACCGCGACCAGGTACTTGTA R

CAGCGAAACGAACTGTGCTATCAC F

CGTGTCCGAGCAGAAAAGGGTAT R

CGACCAAGATGTGCAGGAATACAT F

GGGCGAGTTGAGCTCACAGAA R

CCCGCCTTCGAAACGTCGCT F

TGGACATAGGCGACCAGGCGAATA R

TCGAAAGCCTCTGCGTGCCAGTAA F

GCGATGTGAGCGTGCCACTCAA R

ACTGATTGGCTTCATACGGCTTTA F

GTGCCGACGTGGTCTTGAT R

CGCATCGACAAACTGGAGCCAAAC F

CGGAAACGTCTACGCCCCACACAT R

GGGTTGCTGGATGACAACGTGT F

GGGTGATCTCGGCGAAATCAGATA R

Archive of SID

508 bp

353 bp

643 bp

671 bp

591 bp

873 bp

447 bp

614 bp

657 bp

651 bp

646 bp

408 bp

آناليز آماري سويه

حساس و مقاوم به دارو در

اين مطالعه به وسيله سايت رفرانس MIRU-VNTR plus

انجام شد که در اين مطالعه الگوي ژنتيکي هر سويه به

صورت جداگانه و با ID اختصاصي خود به سايت داده

سايت شد.‏

اساس پارامترهاي

۱۲

رفرانس نيز

الگوي

ژنتيکي

دريافتي

را بر

موجود در خود مقايسه و آناليز

ميكند.‏ همچنين در اين مطالعه اختلاف آللي براي هر

لوکوس

محاسبه گرديد.‏

در فرمول

MIRU

به وسيله فرمول آماري

HGDI 3

: HGDI

:N

تعداد کل سويه

است که مورد مطالعه قرارگرفته.‏

:S

3. Hunater-Gaston Discriminatory Index

تعداد کل نمونه

که الگوي ژنتيک

VNTR آنها با همديگر متفاوت است.‏

MIRU-

:Xj

ميباشد.‏

يافتهها

سال

تعداد سويه

که متعلق به الگوي ژنتيکي

j ام

از ۹۴ بيمار مراجعهکننده به مرکز بيمارستان در بين

مرد بودند.‏

۸۷-۸۸

که ۴۲ نفر از آنها زن و

پس از انجام نمونهگيري

۵۲

و بررسي

نفر از آنها

تست

حساسيت داروئي ۶۱ نفر (%۶۵) از آنها بيماران مقاوم به

دارو و

بررسي

۳۳ نفر (%۳۵)

مقاومت به داروهاي

حساس به دارو تشخيص داده شد.‏

ايزونيازيد،‏ ريفامپين،‏

استرپتومايسين و اتامبوتول نشان داد که از ۶۱ بيمار مقاوم

به دارو همه آنها به داروي ايزونيازيد،‏

داروي

ريفامپين،‏

۶۰ نفر (%۹۸/۳)

نفر ۲۸

(%۴۲/۹)

به

به داروي

مجله علمی دانشگاه علوم پزشکی کردستان/‏ دوره چهاردهم/‏ زمستان ۱۳۸۸

www.SID.ir


يها

يها

يها

يها

يها

يها

يها

يها

يها

يها

مهدی جعفريان ٣٣

استرپتومايسين و

Archive of SID

(%۷۵/۴) نفر ۴۶

به داروي اتامبوتول

مقاوم مي باشند.‏ همچنين اختلاف آللي براي هر لوکوس ميباشد

نيز مطابق با فرمول ذکر شده در قسمت بالا براي هر دو

سويه حساس و مقاوم به دارو محاسبه گرديد که در آن

لوکوس

شماره

آللي را در بين لوکوس

داده بودند

۲۳ ،۲۰ ،۴ ،۲ و

(HGDI ≤۰/۳)

۲۴ کمترين اختلاف

ديگر،‏ به خود اختصاص براي سويه

لوکوس

۳۹ ،۳۱ ،۲۷

و

۴۰

لوکوسهايي هستند که اختلاف آللي حد واسط

(۰/۳≤ HGDI ≤ ۰/۶)

اما لوکوس

،۱۶ ،۱۰

۲۶

بيشترين اختلاف آللي را در بين لوکوسها MIRU

داشتند

(HGDI≥۰/۶)

که در شکل

۱

نمونهاي از

لوکوسهايي که بيشترين و کمترين اختلاف آللي را هم

داده شده است.‏

حساس و هم مقاوم به دارو دارند،‏ نشان

۳۵۳ bp ۵۰۸ bp

۶۵۱bp

۶۴۶bp

C

D

۶۱۴ bp

A

۶۷۱ bp

B

شکل ۱: الکتروفورز محصولات PCR بر روي ژل آگاروز ۱ درصد را نشان ميدهد که در اين تصوير شکل

۴ کمترين اختلاف آللي به مقدار (3 ≤ ،(HGDI شکل C و D لوکوس

۴/) و اشکال E و F لوکوس

۲۶ و ۱۶ با بيشترين پلي فرفيسم آللي در بين لوکوس

A و B به ترتيب لوکوس

۲ و

E

۳۱ و ۳۹ که اختلاف آللي آنها در حد متوسط ميباشد (۶/ ≤ HGDI ≤

MIRU به ميزان /۶) ≥ HGDI ( ميباشد.‏

F

مجله علمی دانشگاه علوم پزشکی کردستان/‏ دوره چهاردهم/‏ زمستان ۱۳۸۸

www.SID.ir


يها

يها

ي م

يپل

يها

ي م

يها

يها

يها

يها

٣٤ بررسی تنوع ژنتيکی …

در بخشي ديگر از اين مطالعه تعداد تکرار آللها در

سويه

حساس و مقاوم که به صورت جداگانه براي

هر لوکوس محاسبه گرديده است را در جدول ۳

توان

مشاهده نمود.‏ مطابق اطلاعات موجود در جدول کمترين

مورفيسم و فراواني آللي،‏ هم براي سويه

و هم براي سويه

و

مقاوم متعلق به لوکوس

حساس

شماره

باشند در حاليکه بيشترين پليمورفيسم به

۱۶ ، ۱۰ و ۲۶ تعلق دارند.‏

۲۴

۴ ،۲

لوکوس

جدول ۳: اين جدول نحوه توزيع پروفايل آللي،‏ سويه

حساس و مقاوم براي هر لوکوس و همچنين اختلاف آللي هر لوکوس را به صورت

جداگانه نشان ميدهد.‏

2 4 10 16 20 23 24 26 27 31 39 40 لوکوس

پروفايل

آللي

M S M S M S M S M S M S M S M S M S M S M S M S

1 1 1 4 2 2 3 61

3

3

3 1

6 3 6 3 1

2 0 3 1 3 8

16 16 2 59 30 2 3 1 1 5 4

1

3

4

5 32 18 2 3 1 1 44 20 41 25

1

4

1

8 10 1 6 7 55 30 40 20 17 12 12 3

1

5

3

8 1 1 6 24 10 2 8 6

6 4 3 55 32 13 1 11 7

7 1 8 9

8 5 6

9 1

HGD

I

0 0 0 0

7

0

%

66

%

64

%

59

%

10.00

%

14%

16

%

10.

00

%

Archive of SID

0.02

%

0

78

%

76

%

17

%

14

%

51

%

آمار نشان داد که تعداد زيادي از سويه های مقاوم

54

%

42

%

52

%

50

%

38

%

به دارو،‏

الگوي

ژنتيکي

آنها به الگوي

ژنتيکي

خانواده Haarlem ،LAM و Dehli/CAS تشابه بيشتري

دارد.‏

در خصوص سويه

حساس به دارو نيز نشان

داده شد که اين سويهها نيز بيشترين تشابهات ژنتيکي را

با خانواده ،NEW-1 Haarlem و خانواده LAM دارند.‏

16.00%

14.00%

12.00%

10.00%

8.00%

6.00%

4.00%

2.00%

0.00%

Haarlem LAM NEW - 1 M. X Beijing

A

Haarlem

LAM

NEW - 1

M. X

Beijing

مجله علمی دانشگاه علوم پزشکی کردستان/‏ دوره چهاردهم/‏ زمستان ۱۳۸۸

www.SID.ir


يها

ي م

يها

يها

يها

مي(‏

يها

یها

يها

يها

ي ديها

يها

يها

يها

يها

يها

مهدی جعفريان ٣٥

B

30.00% Haarlem

25.00%

20.00%

15.00%

10.00%

5.00%

0.00%

LAM

NEW- 1

Uganda I

Dehli / CAS

M. X

Cameroon

Ghana

Beijing

M.S

نمودار : ۱ نمودارهاي A و B هر کدام به ترتيب توژيع فراواني سويه

حساس و مقاوم به داروئي مطالعه شده در اين مقاله را نشان ميدهند که

در هر دو نمونه حساس و مقاوم خانواده Haarlem و LAM بيشترين فراواني توزيع را نسبت به خانواده

بررسي و مقايسه نمودار درختي سويه

حساس و

مقاوم به دارو که در آن الگوي ژنتيکي نمونه به طور

مستقيم به بانک اطلاعاتي داده شده بود با نمودارهاي

جعبهاي شماره ۱ که در آن الگوي ژنتيکي داده شده به

صورت تشابهي

با پروفايل

بانک مورد مقايسه قرار گرفته بودند،‏

اختلاف چنداني

استاندارد موجود در

نشان داد که

بين آنها وجود نداشت و خانواده

پيشنهادي از طرف سايت در هر دو قسمت با همديگر

همخواني دارند.‏

بحث

الگوي ژنتيکي هر سويه در هنگام استفاده از

Archive of SID

۱۲

لوکوس MIRU به صورت يک فايل ۱۲ رقمي استفاده

ميشد

که اين ارقام از

نشاندهنده لوکوس

راست به چپ

،۱۰ ،۴ ،۲

به ترتيب

،۲۴ ،۲۳ ،۲۰ ،۱۶

۳۹ ، ۳۱ ، ۲۷ ،۲۶

و

۴۰ ميباشد.‏

به عنوان مثال الگوي

ژنتيکي که براي سويه استاندارد H37RV ارائه شده

است به ترتيب از راست به چپ عبارتند از

،۲ ،۲ ،۳ ،۲

۲ ،۳ ،۳ ،۳ ،۱ ،۶

(۹). باشد ۱ و

وقتي محصولات

PCR نمونه

گر دارند.‏

آماده شده را بر روي ژل آگاروز انتقال

ميداديم،‏ الگوي ژنتيکي هر سويه را بر اساس موقعيت

قرارگيري باند مورد نظر محاسبه گرديد.‏ انتقال داده

محاسبه شده به سايت

رفرانس

www.MIRU-

VNTRplus.org

پارامترهاي

و بررسي

استاندارد موجود

سايت نشان داد که،‏

%۱۳/۱

%۶/۵۶

%۶/۵۶

خانواده

از سويه

داده

دريافتي

در بانک اطلاعاتي

با

خود

از آنها به خانواده ،LAM

مقاوم به دارو به خانواده ،NEW-1

سويهها به خانواده ،Haarlem

%۸/۲

%۳/۲۸ ،Dehli/Cas

%۱/۶۴

سويه به

به خانواده M.Tb X و

نيز به خانواده Beijing و باقيمانده سويهها نيز

به مقدار کم به سويه

داشتند.‏

سويه

ميزان

بررسي

الگوي

ژنتيکي

Ghana

،canetti

%۵۱

به خانواده

تعلق

با همين روش براي

حساس به دارو نيز نشان داد که اين سويهها به

به خانواده

S ،Haarlem و %۳۰

%۱۲ ،Dehli/CAS

H37RV

%۳) زان

و سويه

به خانواده

از آنها

از سويهها به خانواده

باقيمانده ديگر با درصد پائين به

و Caprae

Beijing تعلق

مجله علمی دانشگاه علوم پزشکی کردستان/‏ دوره چهاردهم/‏ زمستان ۱۳۸۸

www.SID.ir


يها

يها

يها

٣٦ بررسی تنوع ژنتيکی …

داشتند.‏ که نمودار دايرهاي سويه

مقاوم و حساس به

دارو به ترتيب در اشکال A و B تصوير ۲ نشان داده

شده است.‏

A

Archive of SID

B

شکل ۲: قسمت A و : B شجره درختي و نحوه پراکندگي سويه

مقاوم و حساس که بر اساس الگوي ژنتيکي نمونه

MIRU- VNTR plus مقايسه و به گروه هاي خاص خود توزيع شده است را نشان ميدهد.‏

موجود در سايت

مجله علمی دانشگاه علوم پزشکی کردستان/‏ دوره چهاردهم/‏ زمستان ۱۳۸۸

www.SID.ir


يها

يها

يها

يها

يها

يها

يها

يها

يها

يها

يها

يها

یها

يها

يها

يها

يها

يها

مهدی جعفريان ٣٧

پس از بدست آوردن پروفايل ژنتيکي

سايت رفرانس

MIRU-VNTR

هر سويه،‏

اين امکان را فراهم

آورده بود که الگوي ژنتيکي بدست آمده را با الگوهاي

ژنتيکي جمعآوري شده در بانک اطلاعاتي خود مورد

مقايسه قرار دهد که فراواني

الگوي

ژنتيکي سويه

مطابق نمودار ۱ ميباشد.‏

در مطالعه

استفاده از

supply

و

درصد تشابهات

حساس و مقاوم به دارو

و همکارانش در سال

۲۰۰۱

۱۲ لوکوس MIRU براي

۹۰ سويه که از

با

Archive of SID

۳۰

کشور جداسازي شده بود نشان داد که اين متد،‏ روش

کاملا ً اختصاصي و حساس مربوط به

M.tuberculosis

ميباشد.‏ Supply در مقاله خود بيان کرد که از MIRU

ميتوان در بخش

سويه

مختلف براي

مايکوباکتريوم استفاده نمود.‏

تنوع ژنتيکي

همچنين آناليز

الگوي ژنتيکي سويههايي را ميتوان با استفاده از وب

سايتplus MIRU-VNTR

انجام داد.‏

ما نيز در

تحقيقات خودمان پس از بدست آوردن الگوي

ژنتيکي

MIRU-VNTR

سويه

حساس و مقاوم به

دارو الگوي ژنتيکي آنها جهت تشخيص فاميلي سويهها

توسط وب سايت ذکر شده در اين قسمت بررسي

محاسبه گرديد

.(۱۰)

و

در مطالعهاي هم که توسط آقاي kai man kam در

شهر هنگ کنگ انجام شد از مجموع ۳۵۵ نمونهاي که

در بين سالهاي

و ۲۰۰۲

استفاده از MIRU-VNTR

آوردن الگوهاي

متعلق به خانواده

ژنتيکي

۲۰۰۳

۱۲

سويهها،‏

جداسازي

شده بود با

لوکوسي پس از بدست

نمونه ۲۴۳

(۶۸/۵)

Beijing بودند.‏

همچنين در اين مطالعه

نيز اختلاف آللي هر لوکوس با استفاده از فرمول آماري

HGDI

محاسبه گرديد که با نتايج مطالعه ما هماهنگی

داشت.‏ در مطالعه

kai man kam

نيز لوکوس

۱۶

،۱۰

و

لوکوس

۲۶

بيشترين لوکوس

۲۰ ،۴ ،۲ و

دهنده کم معرفي شدند

۲۴ به عنوان لوکوس

.(۱۱)

در مطالعهاي هم که در بين سال

افتراقدهنده و

افتراق

۲۰۰۲ و ۲۰۰۳

توسط اصغرزاده و همکارانش در منطقه شرق آذربايجان

ايران صورت گرفت،‏ نشان داد که از

۱۲۷

۱۲

نمونه که از

بيماران آن منطقه جداسازي کرده بودند،‏ الگوي ژنتيکي

لوکوسي،‏

MIRU-VNTR

آنها تهيه گرديد.‏

۲۱

الگوي ژنتيکي مشترک و ۷۲ الگوي ژنتيکي اختصاصي

جدا گرديد.‏

ايران و

الگوي

ژنتيکي

مشترک بين بيماران

نخجوان نشاندهنده وجود منابع انتشاراتي

مشترک در منطقه ميباشد.‏

سفرهايي

که بين اين دو

منطقه صورت ميگيرد وجود الگوهاي ژنتيکي مشترک

دور از انتظار نميباشد

.(۱۲)

در مطالعهاي که توسط

Sola

و همکارانش در سال

۲۰۰۳ صورت گرفت از ۱۱۶ نمونه جدا شده از بيماران،‏

الگوي

ژنتيکي

سويهها با استفاده از تکنيک

MIRU-

VNTR محاسبه گرديد،‏ که الگوي ژنتيکي حاصل نشان

داد

که بيشتر سويهها به خانواده

،LAM

Haarlem X، و CAS1 تعلق داشتند (۱۳). که در مطالعه

ما نيز در هر دو سويه حساس و مقاوم

خانواده

در مطالعهاي

LAM ،Haarlem به چشم ميخورد

که در سال

.(۱۳)

۲۰۰۸

در کره جنوبي

توسط Won Yun انجام شد نشان داد که اختلاف آللي

که آنها براي

فرمول آماري

لوکوس

MIRU-VNTR

HGDI

صورت گرفته ما لوکوس

لوکوس

به وسيله

بدست آوردند مانند مطالعه

۲۳ ،۱۶ ،۱۰ و

افتراقدهنده بالا و لوکوس

۲۶ به عنوان

۲۰ ،۴ ،۲ و

۲۴

شدهاند

به عنوان لوکوس

.(۱۴)

افتراقدهنده پائين شناسائي

مجله علمی دانشگاه علوم پزشکی کردستان/‏ دوره چهاردهم/‏ زمستان ۱۳۸۸

www.SID.ir


يها

يها

یها

ي م

يها

يها

يها

يها

٣٨ بررسی تنوع ژنتيکی …

Dehli/CAS

Haarlem

،

Mokrousov

Archive of SID

مطالعهاي که

و همکارانش در سال

۲۰۰۴ انجام دادند،‏ نشان داد که لوکوس MIRU توانائي

افتراق سويه

مايکوباکتريوم و

ريشهاي مناطق را از همديگر دارد

همچنين تشخيص

(۱۵). در مطالعهاي هم

که توسط Park و همکارانش در سال ۲۰۰۰ انجام شد،‏

نشان داد با استفاده از تکنيکهايي که بر اساس PCR

ميباشد ميتوان افتراق سويهها را خيلي سريع و آسانتر از

روش RFLP انجام داد و امکان آناليز نمونههايي هم که

داراي مقادير کم IS6110

قبيل MIRU-VNTR انجام داد (۱۶).

نتيجهگيري

نتايج نشان ميدهد که در سويه

باشد با تکنيکهايي

از

مقاوم به دارو

جدا شده از بيماران مسلول مراجعهکننده به بيمارستان

مسيح دانشوري،‏

خانواده

تنوع ژنتيکي

و

آنها متعلق به

Dhli/CAS و

Haarlem

،LAM

سويه

حساس جدا شده از بيماران متعلق به NEW-1

و

بودند.‏

بنابراين ايجاد

مقاومت داروئي ارتباط با خانواده سويه خاصي ندارد و

هر سويه قابليت مقاومت به دارو را ميتواند داشته باشد.‏

از آنجائي که پيدايش سويه

يک معضل در کنترل و درمان بيماري

مقاوم به دارو به عنوان

سل محسوب

ميگردد توصيه ميشود تا حتيالامکان با تشخيص سريع

الگوي

جلوگيري

ژنتيکي

نمود.‏

سويه

مقاوم به دارو از انتشار آنها

امروزه ميتوان با تکنيک

اپيدميولوژي از قبيل MIRU-VNTR انتشار اين سويهها

را تحت کنترل خود داشته باشيم (۱۷).

تشکر و قدردانی

بدينوسيله از همکاري

مرکز تحقيقات

مايکوباکتريولوژي آزمايشگاه رفرانس سل کشوري واقع در

بيمارستان مسيح دانشوري جهت فراهم نمودن منابع مالي و

همچنين از پرسنل آزمايشگاه رفرانس سل کشوري به خاطر

انجام آزمايشهاي روتين تشکر و قدرداني ميگردد.‏

References

1. Caroline Allix, Philip Supply and Maryes Fauville-Dufax. Utility of fast mycobacterial interspersed

repetitive unit-variable number tandem repeat genotyping in clinical mycobacteriological analysis.

CID 2004; 39: 783-9.

2. Ann G Lee, Lynnl H Tang, Irene HK. Lim, Richard Bellamy and Sin-Yew Wong. Discrimination of

single-copy IS6110 DNA fingerprints of mycobacterium tuberculosis isolates by high-resolution

minisatellite-based typing. J Clinical Microbiology 2002; 40: 657-659.

3. Philip Supply, Edith Mazars, Sarah Lesjean, Veronigue Vincent, Brigitte Gicquel and Camille

Locht. Variable human mini satellite-like regions in the mycobacterium tuberculosis genom. J

Molecular Microbiology 2000; 36: 762-771.

4. Filliol I, Ferdinand S, Negroni L, Sola C, Rastogi N. Molecular typing of mycobacterium

tuberculosis based on variable number of tandem DNA repeats used alone and in association with

spoligotyping. J Clin Microbiol 2000; 38: 2520-2524.

5. Philip Supply, Sarah Lesjean, Evqueni Savine, Kristin Kremer, Dick van Soolingen and Camille

Locht. Automated high-throughput genotyping for study of global epidemiology of mycobacterium

tuberculosis based mycobacterial interspersed repetitive unit. JCM 2001; 39: 3563-3571.

6. Mazars E, Warren RM, Van Der Spuy GD, Beyers N, Van Helden PD, Locht C, and et al. Stability

of spoligotyping. J Clin Microbial 2005; 43: 314-320.

7. JW Dale, D Brittain, AA Cataldi, D Cousins, JT CrawFord, T Lille Baek and Spacer

oligonucleotide typing of bacteria of the mycobacterium tuberculosis complex: recommenddation for

standardized nomenclature. J Tuberc Lung Dis, 2001; 5: 216-219.

مجله علمی دانشگاه علوم پزشکی کردستان/‏ دوره چهاردهم/‏ زمستان ۱۳۸۸

www.SID.ir


مهدی جعفريان ٣٩

8. Lu Zhang, Jing chen, Xin shen, Xiaohong Gui, Jian Mei, Kathryn Derimer and, et al. Highly

polymorphic Variable-Number Tandem Repeats loci for differentiating Beijing genotype strains of

mycobacterium tuberculosis in Shanghai, China, FEMS Microbial Lett, 2008; 282: 22-31.

9. MI Romano, AAmadio, F Bigi, L klepp, I Etchechoury, M Nato Liana, and et al. Further analysis of

VNTR and MIRU in the genome of Mycobacterium avium complex, and application to molecular

epidemiology of isolates from south America J Vetmic 2005; 110: 221-237.

10. Philip Supply, Sarah Lesjean, Evgueni Savine, Kristin Kremer, Dick van Soolingen and Camile

Lockt. Automated high-throughput genotyping for study of global epidemiology of mycobacterium

tuberculosis based on mycobacterial interspersed repetitive unit. JCM 2001; 39: 3563-3571.

11. Kai Man Kam, Chi Wai Yip, Lai Wa Tse, Kin Lai Wong, Tak Kam Lam, Kristin Kremer and et al.

Utility of mycobacterial interspersed repetitive unit typing for differentiating multidrug-resistant

mycobacterium tuberculosis isolates of the Beijing family: JCM 2005; 43: 306-313.

12. Mohammad Asgharzadeh,Mansour Khakpour, Taghi Zahraei Salehi and Hossein Samadi Kafil.

Use of mycobacterial interspersed repetitive unit-variable-number tandem repeat Typing to study

mycbacterium tuberculosis isolates from East Azarbaijan province of Iran: Pakistan Journal of

Biological Sciences 2007; 10: 3769-3777.

13. Cowan LS, Diem L, Monson T, Wand P, Temporado D, Oemig TV, and et al. Evaluation of a twostep

approach for large-scale, prospective genotyping of mycobacterium tuberculosis isolates in the

United States. J Clin Microbiol 2005; 43: 688-695.

14. Kyung Won Yun, Eun Ju Song, Go Eun Choi, In Kyung Hwang, Eun Yup Lee. Mycobacterial

interspersed repetitive unit-variable number of tandem repeat. J Clinical Microbiology 2009; 29: 314-

319.

15. Mokrousov I, Narvskaya O, Limeschenko E, Vyazovaya A, Otten T and Vyshnevskiy B: Analysis

of the allelic diversity of the mycobacterial interspersed repetitive units in Mycobacterium tuberculosis

strains of the Beijing family: practical implications and evolutionary considerations. J Clin Microbiol

2004; 42: 2438-2444.

16. Park YK, GH Bai, and SJ Kim. Restriction fragment length polymorphism analysis of

mycobacterium tuberculosis isolated from countries in the western Pacific region. J Clin Microbiol

2000; 38: 191-197.

17. Christophe Sola, Ingrid Filliol, Eric Legrand, Sarah Lesjean, Camille Locht, Philippe Supply and

et al. Genotyping of the mycobacterium tuberculosis complex using MIRUs: association with VNTR

and spoligotyping for molecular epidemiology and evolutionary genetics: infection, genetics and

evolution: 2003; 125-133.

Archive of SID

مجله علمی دانشگاه علوم پزشکی کردستان/‏ دوره چهاردهم/‏ زمستان ۱۳۸۸

www.SID.ir

More magazines by this user
Similar magazines