Identifikation neuer Zielgene von Eomes mithilfe einer ... - FreiDok

freidok.uni.freiburg.de

Identifikation neuer Zielgene von Eomes mithilfe einer ... - FreiDok

Aus der Medizinischen Universitätsklinik

Abteilung Innere Medizin IV

Schwerpunkt: Nephrologie und Allgemeinmedizin

der Albert-Ludwigs-Universität Freiburg im Breisgau

Direktor: Prof. Dr. Gerd Walz

Expressionsanalyse neu identifizierter potenzieller Zielgene von

Eomesodermin während der Maus-Gastrulation

Inaugural-Dissertation

zur Erlangung des Medizinischen Doktorgrades

der Medizinischen Fakultät der Albert-Ludwigs-Universität

Freiburg im Breisgau

vorgelegt 2012

von Sarah Dräger

geboren in Freiburg im Breisgau


Dekan: Prof. Dr. Dr. h.c. mult. Hubert E. Blum

Erster Gutachter: Dr. Sebastian J. Arnold

Zweiter Gutachter: Prof. Dr. Heike L. Pahl

Jahr der Promotion: 2013


.

PUBLIKATION

Ita Costello, Inga-Marie Pimeisl, Sarah Dräger, Elizabeth K. Bikoff, Elizabeth J. Robertson

and Sebastian J. Arnold. The T-box transcription factor Eomesodermin acts upstream of

Mesp1 to specify cardiac mesoderm during mouse gastrulation, Nature Cell Biology 2011.


Inhaltsverzeichnis

INHALTSVERZEICHNIS

1. EINLEITUNG ..................................................................................................................... 1

1.1 Allgemeine Einleitung ............................................................................................... 1

1.2 Frühe Entwicklung der Maus .................................................................................... 2

1.3 Entwicklung des Mausembryos von E5.0 bis E5.5 .................................................... 3

1.4 Gastrulation .............................................................................................................. 5

1.5 Die Rolle von Eomesodermin während der Gastrulation ........................................... 7

1.5.1 Familie der T-Box-Transkriptionsfaktoren ..................................................... 7

1.5.2 Expression von Eomes während der embryonalen Entwicklung ................... 7

1.5.3 Funktion von Eomes während der frühen Mausentwicklung ......................... 8

1.5.4 Funktion von Eomes während der Zellmigration ........................................... 9

2. FRAGESTELLUNG UND ZIELE DER ARBEIT ................................................................ 10

3. MATERIAL UND METHODEN......................................................................................... 11

3.1 Material ................................................................................................................... 11

3.1.1 Chemikalien ................................................................................................ 11

3.1.2 Enzyme und Proteine ................................................................................. 12

3.1.3 Gebrauchsmaterialien ................................................................................. 12

3.1.4 Kits ............................................................................................................. 12

3.1.5 Bakterien und Vektor .................................................................................. 13

3.1.6 Primer ......................................................................................................... 13

3.1.7 Puffer und Lösungen für PCR, Transformation und Transkription ............... 13

3.1.8 Puffer und Lösungen für Whole mount in situ Hybridisierungen (WISH) ..... 14

3.1.9 Technische Geräte ..................................................................................... 14

3.1.10 Unternehmen ............................................................................................ 15

3.1.11 Mausstämme ............................................................................................ 16

3.2 Methoden ............................................................................................................... 17

3.2.1 Reverse Transkription von mRNA zu cDNA ................................................ 17

3.2.2 Polymerase-Kettenreaktion (PCR).............................................................. 17

3.2.3 Agarosegel-Gelelektrophorese von DNA-Fragmenten ................................ 18

3.2.3.1 Isolierung von DNA-Fragmenten aus Agarosegelen ....................... 19

3.2.4 Schneiden von Plasmid-DNA mit Restriktionsenzymen .............................. 19


Inhaltsverzeichnis

3.2.5 Ligation von DNA in den pBluescript (pBS)-Klonierungsvektor ................... 19

3.2.6 Bakterielle Transformation .......................................................................... 19

3.2.7 Mini-, Midi- und Maxi-Präparation ............................................................... 20

3.2.8 Bestimmung der DNA-Konzentration mithilfe des NanoDrop ...................... 21

3.2.9 DNA-Sequenzierung ................................................................................... 21

3.2.10 Linearisierung von Plasmid-DNA .............................................................. 21

3.2.11 Phenol/ Chloroform-Extraktion .................................................................. 22

3.2.12 Transkription DIG-markierter RNA-Sonden ............................................... 22

3.2.13 Lithium-Chlorid-Präzipitation von RNA ...................................................... 23

3.2.14 Präparation der Embryonen ...................................................................... 23

3.2.15 Fixierung der Embryonen .......................................................................... 24

3.2.16 Whole mount in situ Hybridisierung (WISH) .............................................. 24

3.2.17 Paraffinschnitte ......................................................................................... 27

3.2.18 Eosinfärbung von Paraffinschnitten .......................................................... 28

4. ERGEBNISSE ................................................................................................................. 29

4.1. Expressionsanalysen potenziell durch Eomes regulierter Gene ............................. 29

4.1.1 Auswahl potenziell Eomes-regulierter Zielgene während der Gastrulation .. 29

4.1.2 Herstellung 42 verschiedener RNA-Sonden ............................................... 30

4.2 Expressionsmuster potenziell Eomes-regulierter Gene ........................................... 33

4.2.1 Genexpressionsmuster in den Wildtyp-Embryonen zum Zeitpunkt E7.5 ..... 33

4.2.2 Genexpressionsmuster in den Eomes-Mutanten zum Zeitpunkt E7.5 ......... 34

4.3 Genexpressionsmuster nach Expressionsdomänen geordnet aufgeführt ................ 36

4.3.1 Ausschließlich mesodermal exprimierte Gene ............................................ 36

4.3.2 Expression im Mesoderm, im PS und vereinzelt im Ektoderm .................... 37

4.3.3 Ektodermal exprimierte Gene mit zusätzlichen Expressionsarealen ........... 38

4.3.4 Gene ohne Expression im embryonalen Gewebe ....................................... 39

4.3.5 Unspezifische Expressionsmuster .............................................................. 40

4.4. Spezifische Expressionsanalysen von 37 differenziell exprimierten Genen ........... 41

4.4.1 Kelch-like 6 (Klhl6)...................................................................................... 41

4.4.2 Wingless-related MMTV integration site 2 (Wnt2) ....................................... 43

4.4.3 Calpain6 (Capn6) ....................................................................................... 46


Inhaltsverzeichnis

4.4.4 SwItch/Sucrose NonFermentable (SWI/SNF) related matrix associated actin

dependent regulator of chromatin, subfamily d, member 3 (Smarcd3) ................. 49

4.4.5 Kardiales Troponin T (cTnT/ Tnnt2) ............................................................ 51

4.4.6 Zytoplasmatisches Retinolsäure-bindendes Protein 1 (Crabp1).................. 53

4.4.7 Platelet-derived growth factor receptor A (Pdgfr) ...................................... 55

4.4.8 Ets variant gene 2 (Etsrp71/ ER71) ............................................................ 57

4.4.9 Ras guanyl releasing protein3 (Rasgrp3).................................................... 60

4.4.10 Forkhead (winged helix) box-Transkriptionsfaktor 1a (Foxf1a).................. 62

4.4.11 V-set and transmembrane domain containing 2B (Vstm2b) ...................... 65

4.4.12 Pleckstrin homology-like domain family A member 2 (Phlda2).................. 67

4.4.13 Forkhead box C1 (Foxc1) ......................................................................... 69

4.4.14 Uridin Phosphorylase1 (Upp1).................................................................. 72

4.4.15 Leucine-rich repeat G protein-coupled receptor 5 (Lgr5/ GPR4) ............... 75

4.4.16 NK1 transcription factor related, locus 2 (Nkx1.2) ..................................... 78

4.4.17 Serin-Peptidase-Inhibitor, Kazal Typ 3 (Spink3)........................................ 81

4.4.18 Proto-oncogene serine/threonine-protein kinase 1 (Pim1) ........................ 83

4.4.19 Class E basic helix-loop-helix protein 40 (Bhlhb2/Stra13) ......................... 85

4.4.20 Rho guanine nucleotide exchange factor 3 (Arhgef3) ............................... 87

4.4.21 Spindlin family, member 2 (Spin2) ............................................................ 89

4.4.22 Arginase1 ................................................................................................. 90

4.4.23 Pepsinogen 5 (Pga5) ................................................................................ 92

4.4.24 Endothelial cell-specific molecule 1 (Esm1) .............................................. 93

4.4.25 Small proline-rich protein 2A (Sprr2a)....................................................... 94

4.4.26 Transmembrane protein 63a (Tmem63a) ................................................. 96

5. DISKUSSION .................................................................................................................. 98

5.1. Allgemeine Auswertung der Ergebnisse ................................................................ 98

5.1.1 Eomes reguliert die embryonale Herzentwicklung ...................................... 98

5.1.2 Eomes beeinflusst die Entwicklung der Blutgefäße ................................... 101

5.1.3 Ursache des Migrationsdefekts in den Eomes-Mutanten bleibt unklar ...... 101

5.1.4 Wird Eomes für die Entwicklung des VE benötigt? ................................... 102


Inhaltsverzeichnis

6. ZUSAMMENFASSENDE DARSTELLUNG .................................................................... 104

7. ABKÜRZUNGSVERZEICHNIS ...................................................................................... 105

8. LITERATURVERZEICHNIS ........................................................................................... 112

9. ABBILDUNGS- UND TABELLENVERZEICHNIS ........................................................... 125

9.1. Abbildungen......................................................................................................... 125

9.2. Tabellen ............................................................................................................... 126

10. LEBENSLAUF ............................................................................................................. 127

11. DANKSAGUNG ........................................................................................................... 128


Einleitung 1

1. EINLEITUNG

1.1 Allgemeine Einleitung

Die Entwicklung einer befruchteten Eizelle bis zum adulten Organismus wird durch eine

Handvoll verschiedener Signale und deren intrazellulären Fortleitung gesteuert. Diese

regulieren die Spezifizierung und Differenzierung von Zellen ausgehend von pluripotenten

Stammzellen, bis hin zu den ausdifferenzierten Zelltypen des erwachsenen Körpers.

Die Gastrulation stellt einen wesentlichen Prozess während der Embryogenese der Maus dar

und beginnt am sechsten Tag nach Befruchtung der Eizelle (6.0 dpc (days post coitum) =

E6.0). Bei diesem Vorgang entstehen die drei Keimblätter Endoderm, Mesoderm und

Ektoderm, aus denen sich alle weiteren Zell- und Gewebetypen entwickeln. Darüber hinaus

werden bereits während der Gastrulation das grundlegende Muster und der Bauplan des

späteren Organismus angelegt (reviewed von Arnold et al., 2009a).

Bislang ist noch nicht hinreichend erklärt, wie die unterschiedlichen Signalmoleküle und

-wege die Spezifizierung der drei Gewebetypen hervorrufen. Vor allem durch genetische

Studien in klassischen Modellsystemen wie dem Frosch und der Maus ist bekannt, dass die

Spezifizierung verschiedener Zelltypen während der Gastrulation durch das Zusammenspiel

von Signalmolekülen aus den Familien der Wnts, Nodal/ Transforming growth factor (Tgf)

- Familie und Fibroblast growth factor (Fgf) - Familie reguliert wird (reviewed von Beddington

und Robertson, 1999; Tam et al., 2007; reviewed von Arnold et al., 2009a). Die genetische

Manipulation dieser Signalwege führt zu dem Verlust spezifischer Zelltypen und kann

morphogenetische Defekte hervorrufen. Trotz der grundsätzlichen Kenntnisse über die

intrazelluläre Fortleitung der einzelnen Signale, sind wesentliche Fragen zur intrazellulären

Signalverarbeitung und der darauf folgenden Steuerung genetischer Programme, die

schließlich zur Spezifizierung der Zellen führen, noch nicht geklärt.

Eomesodermin (Eomes), ein Transkriptionsfaktor der T-Box-Familie, hat sich in der

Gastrulation als zentraler Regulator bei der Entstehung des definitiven Endoderms (DE),

dem Vorläufergewebe des primitiven Darmrohres, und des Mesoderms erwiesen (Arnold et

al., 2008a).


Einleitung 2

1.2 Frühe Entwicklung der Maus

Nach der Befruchtung der Eizelle kommt es zu rasch hintereinander ablaufenden

Zellfurchungen. Die Eizelle entwickelt sich über das 2-Zell-, 4-Zell- und 8-Zell-Stadium, in

drei Tagen zur Morula (Abb.1). Einen halben Tag später, der Embryo wird nun Blastozyste

genannt, entsteht ein Hohlraum innerhalb des Embryos, der als Blastozoel bezeichnet wird.

Durch die Bildung des Blastozoels wird die sogenannte Innere Zellmasse (ICM) an einen Pol

der Blastozyste gedrängt (Gardner et al., 1983). Dadurch entsteht die proximo-distale (P-D)-

Achse, mit der ICM an deren proximalen Pol (reviewed von Beddington und Robertson,

1999). Die Zellen, die den äußeren Saum der Blastozyste bilden, werden als Trophektoderm

(TE) bezeichnet (Abb.1). In der Entwicklung des jungen Embryos sind somit zwei

Zellpopulationen entstanden, die sich zu verschiedenen Geweben mit unterschiedlichen

Eigenschaften weiterentwickeln (Gardner et al., 1983). Aus den Zellen des TEs gehen

Anteile des Trophoblast und das extraembryonale Ektoderm (ExE) hervor. Aus dem ExE

entstehen später die ektodermalen Anteile des Dottersacks und der embryonale Teil der

Plazenta. Die ICM hingegen entwickelt sich zu den verschiedenen Gewebetypen des

Embryos, zum extraembryonalen Mesoderm und zum primitiven Endoderm (PE) weiter

(Gardner et al., 1983).

Abbildung 1: Die frühe Entwicklung der Maus von E2.5 bis E4.5. Nach dem 8-Zell und dem 16-Zell-Stadium

entsteht an E3.5 die Blastozyste (a). Sie besitzt nach Ausbildung des Blastozoels die erste erkennbare Achse des

Embryos. Sie besteht aus dem Trophektoderm (TE) und der proximal-liegenden Inneren Zellmasse (ICM). An

E4.5 differenziert sich das primitive Endoderm (PE) aus (b). Verschiedene Gene sind an der Differenzierung der

Zellen beteiligt (Illustration aus Arnold et al., 2009a; Literaturangaben im Fließtext).


Einleitung 3

Das PE entsteht an E4.0 und bildet eine Zellschicht, die der ICM aufliegt und später zur

Entstehung des extraembryonalen Endoderms beiträgt. Die darunterliegenden Zellen der

ICM werden nun als Epiblast bezeichnet, der die Quelle aller Zelltypen des späteren

Embryos darstellt (Abb.1) (Gardner et al., 1983). Um E4.5 findet die Implantation der

Blastozyste in die Uterusschleimhaut der Mutter statt. Kurz danach bildet sich eine Höhle

innerhalb des Epiblast und der Embryo beginnt sich entlang der P-D-Achse zu strecken. Das

ExE bildet eine kelchförmige Ansammlung von Epithelzellen an der proximalen Seite des

Embryos. Das viszerale Endoderm (VE), das aus dem PE hervorgeht, formt eine

einschichtige Zelllage, die dem Epiblast und dem ExE aufliegt. Durch Wachstumsfaktoren

wie beispielsweise der Tgf-Familie, wie Nodal und Bone morphogenic protein 4 (Bmp4), der

Wnt- und der Fgf-Familie stehen die verschiedenen Zelltypen miteinander in Verbindung

(Tam et al., 2007; reviewed von Beddington und Robertson, 1999).

1.3 Entwicklung des Mausembryos von E5.0 bis E5.5

Ab etwa E5.0 können erste Unterschiede in der Expressionsstärke von Genen entlang der P-

D-Achse des Embryos detektiert werden. Hierzu gehören die Signalmoleküle Nodal, Bmp4

und Wnt3. An E5.0 wird Nodal, das für ein Tgf-Signalmolekül kodiert, im gesamten Epiblast

exprimiert (Norris et al., 1999). Einen halben Tag später ist jedoch ein Gradient dieses

Signals entlang der P-D-Achse nachweisbar, so dass Nodal nun im proximalen Epiblast

vermehrt exprimiert wird. Die Ursache liegt in zwei voneinander unabhängigen Feedforward-

Schleifen, die beide für die Steigerung der Nodal-Expression im proximalen Epiblast

verantwortlich sind (Abb.2) (Ben-Haim et al., 2006).

Einerseits wird das Tgf-Molekül Pro-Nodal am Übergang von embryonalem zu

extraembryonalem Gewebe, durch die katalytisch aktive Pro-Protein-Konvertase Furin

aktiviert. Furin wird im ExE exprimiert und steigert die Expression von Nodal im

darunterliegenden Epiblast (Ben-Haim et al., 2006). Nodal stimuliert seinerseits die

Expression von Bmp4 im ExE, das wiederherum die Expression von Wingless-related MMTV

integration site 3 (Wnt3) im Epiblast aktiviert (Ben-Haim et al., 2006). Der Nodal Proximale

Epiblast Enhancer (PEE) ist ein direktes Ziel des Wnt/ -catenin Signalwegs, so dass Nodal

ein direktes Zielgen von Wnt3 darstellt. Durch die gesteigerte Wnt3-Expression durch Bmp4

kommt es zu einer vermehrten Aktivierung des PEE und damit zu einer verstärkten

Expression von Nodal. Nodal kann seinerseits Bmp4 aktivieren. Diese Feedforward-Schleife

führt zu einer schnellen und starken Erhöhung der Nodal-Expression im proximo-posterioren

Epiblast (Abb.2) (Ben Haim et al., 2006; reviewed von Arnold et al., 2009a).


Einleitung 4

Darüber hinaus entsteht im distalen viszeralen Endoderm (DVE) eine kleine Gruppe

spezialisierter Zellen, die extrazelluläre Nodal- und Wnt-Inhibitoren, wie beispielsweise

Cerberus-like-1 (Cer1) und Left-right determination factor 1 (Lefty1), exprimieren. Hierdurch

wird die Expression von Nodal im darunterliegenden Epiblast gehemmt und somit die

Ausbildung des proximo-distalen Nodal-Gradienten etabliert (Abb.2) (Perea-Gomez et al.,

1999; reviewed von Arnold et al., 2009a).

An E6.0 beginnt das DVE in Richtung der zukünftigen anterioren Seite des Embryos zu

wandern und wird dann als anteriores viszerales Endoderm bezeichnet (AVE). Durch diese

Migration verlagert sich die Expression der Nodal- und Wnt-Inhibitoren nach proximo-anterior

und führt folglich zu einer Abnahme der dortigen Nodal-Expression. Im proximo-posterioren

Pol des Embryos wird Nodal jedoch weiterhin exprimiert. Hierdurch erfährt die ehemals

proximo-distale Achse eine Rotation um 90°, so dass in der Folge eine anterior-posteriore

(A-P)-Achse definiert werden kann. Diese wird ebenfalls durch Gradienten von Nodal- und

Wnt-Signalen festgelegt und aufrechterhalten (Abb.2) (Thomas et al., 1996; Beddington et

al., 1999; Lu et al., 2001). Ab E6.0 beginnen einige Zellen des Epiblast in Richtung des

proximo-posterioren Pols zu wandern und dort starke morphologische Veränderungen

hervorzurufen (Lawson et al., 1991). Die Gastrulation beginnt.

Abbildung 2: Die Entstehung der P-D-Achse an E5.5. Für die Ausbildung der P-D-Achse ist ein

Expressionsgradient von Nodal verantwortlich. Durch Furin wird Pro-Nodal am Übergang von embryonalem zu

extraembryonalem Gewebe aktiviert. Nodal aktiviert seinerseits Bone morphogenic protein 4 (Bmp4) im ExE, das

die Expression von Wingless-related MMTV integration site 3 (Wnt3) im Epiblast fördert. Der Nodal Proximale

Epiblast Enhancer (PEE) ist ein direktes Ziel des kanonischen Wnt/ -catenin-Signalwegs. Durch diese

Feedforward-Schleife kommt es zu einer vermehrten Nodal-Expression im proximo-posterioren Epiblast (a).

Distale Zellen des viszeralen Endoderms (VE) (rot) beginnen die extrazellulären Inhibitoren des Nodal- und Wnt-

Signals, Cerberus-like-1 (Cer1) und Left-right determination factor 1 (Lefty1), zu exprimieren. Diese zweite,

negative Signalschleife führt zu einer Verstärkung des Nodal-Gradienten entlang der P-D-Achse (b). (Illustration

aus Arnold et al., 2009a; Literaturangaben im Fließtext).


Einleitung 5

1.4 Gastrulation

Während der Gastrulation entstehen die drei Keimblätter Endoderm, Mesoderm und

Ektoderm, aus denen sich alle weiteren Gewebetypen des Embryos entwickeln. An E5.5

besteht der Embryo aus dem Epiblast und dem VE. Bis zu diesem Zeitpunkt behält er

morphologisch seine radiale Symmetrie bei, die mit dem Beginn der Gastrulation

durchbrochen wird (Abb.3) (reviewed von Arnold et al., 2009a).

An E6.0 beginnen Zellen des Epiblasts zum proximo-posterioren Pol des Embryos zu

wandern und dort eine Zellverdichtung auszubilden, die als Primitivstreifen (PS) bezeichnet

wird (Lawson et al., 1991). Die Epiblastzellen, die lateral und kranial dieser Zellverdichtung

liegen, wandern in den PS ein, unterlaufen hierbei die epithelial-mesenchymale Transition

(EMT) und erlangen mesenchymalen Charakter. Diese Zellen schieben sich anschließend

aktiv zwischen die Zellen des VE und des Epiblast, der von nun an Ektoderm genannt wird,

und migrieren zur anterioren Seite des Embryos. Es entsteht eine neue Zellschicht, die als

Mesoderm bezeichnet wird (Abb.3) (reviewed von Arnold et al., 2009).

Abbildung 3: Die Entwicklung des Embryos von E5.5 bis E7.5. An E6.0 beginnen Zellen des Epiblast in

Richtung des proximo-posterioren embryonalen Pols zu wandern, um dort den Primitivstreifen (PS), zu bilden.

Dieser verlängert sich in den folgenden Stunden zum distalen Ende des Embryos. Seine anterioren Zellen formen

den Primitivknoten (PK), ein wichtiges Signalzentrum während der embryonalen Entwicklung. Umliegende Zellen

wandern in den PS ein, unterlaufen die epithelial-mesenchymale Transition (EMT), und erhalten somit die

Merkmale von mesenchymalen Zellen (Illustration aus Beddington und Robertson, 1999; Literaturangaben im

Fließtext).

In den nächsten 12 bis 24 Stunden verlängert sich der PS zum distalen Ende des Embryos

(reviewed von Beddington und Robertson, 1999). Er lässt sich in verschiedene Abschnitte

unterteilen. Aus dem frühesten, am weitesten posterior gelegenen Anteil entwickelt sich das


Einleitung 6

extraembryonale Mesoderm (Kirstie et al., 1991). Aus diesem entstehen die mesodermalen

Zellschichten des Chorions und des Dottersacks. Es ist in der weiteren Entwicklung an der

dortigen Ausbildung der Blutinseln beteiligt. Aus der intermediären Region des PS entstehen

das Seitenplattenmesoderm, das paraxiale Mesoderm und zu Teilen das kardiale Mesoderm.

Der anteriore Teil des PS entwickelt sich zur Notochord, zum kardialen Mesoderm und zum

DE weiter. Am distalen Ende des anterioren PS differenziert sich eine Zellpopulation aus, die

als Primitivknoten (PK) bezeichnet wird und während der weiteren Entwicklung ein wichtiges

embryonales Signalzentrum darstellt (Abb.4) (reviewed von Beddington und Robertson,

1999; reviewed von Arnold et al., 2009a). Die Zellen des anterioren PS, die sich zum DE

weiterentwickeln, wandern an E6.5 durch den PS und verdrängen das VE in den proximalen,

extraembryonalen Bereich. Einige VE-Zellen verbleiben jedoch im DE und können dort

vereinzelt aufgefunden werden. Sie sind während der späteren Entwicklung im Darmgewebe

nachweisbar, das aus dem DE hervorgeht (Kwon et al., 2007).

Abbildung 4: Die Morphologie des Wildtyp-Embryos an E7.5. Der Embryo besitzt einen dreischichtigen

Aufbau. Er besteht aus dem DE (gelb), dem Mesoderm (dunkelrosa) und dem Ektoderm (orange), das aus dem

Epiblast (rosa) hervorgeht. Das extraembryonale Mesoderm (lila) entsteht aus dem posterioren PS. Das DE

(gelb) geht aus dem VE (grün) hervor, indem es die Zellen des VE nach extraembryonal verdrängt (rot). Die

Zellen des anterioren Epiblast, die nicht durch den PS hindurchwandern, entwickeln sich zum Neuroektoderm

(orange). Am anterioren Pol des PS entsteht der PK (hellblau) (Illustration aus Arnold et al., 2009a;

Literaturangaben im Fließtext).


Einleitung 7

1.5 Die Rolle von Eomesodermin während der Gastrulation

1.5.1 Familie der T-Box-Transkriptionsfaktoren

Eomesodermin (Eomes) gehört zur Familie der T-Box-Transkriptionsfaktoren, die aus 17

Genen besteht, die in allen Vertebraten nachgewiesen werden können. Sie kodieren für T-

Box-Proteine, die eine für sie charakteristische, hochkonservierte T-Box DNA-Bindedomäne

besitzen. Brachyury war das erstentdeckte Mitglied dieser Familie und das erste Gen, bei

dem die T-Box-DNA-Bindedomäne identifiziert werden konnte (Herrmann et al., 1990).

Nahezu alle T-Box-Gene werden für die Embryonalentwicklung benötigt und üben ihre

Funktion hauptsächlich bei Zell-Spezifizierungsschritten aus (Horb und Thomsen, 1999;

Lamolet et al., 2001; reviewed von Showell et al., 2004). Infolgedessen führen Mutationen

von Mitgliedern dieser Genfamilie in vielen Fällen zu schweren embryonalen

Entwicklungsstörungen (Naiche et al. 2005).

1.5.2 Expression von Eomes während der embryonalen Entwicklung

Das T-Box-Gen, das während der Entwicklung des Mausembryos am frühesten exprimiert

wird, ist Eomes (Bulfone et al., 1999; Ciruna und Rossant, 1999; Hancock et al., 1999). Zu

Beginn der embryonalen Entwicklung ist die Eomes-Expression auf die extraembryonale

Zelllinie des TE und VE beschränkt. Bereits im Blastozystenstadium wird Eomes im TE

exprimiert. Nach der Implantation der Blastozyste in die Uterusschleimhaut, wird es in den

TE-Derivaten des ExE exprimiert. Es wird vermutet, dass Eomes hierbei die Stammzellen

des TE markiert. Nach E5.5 findet sich ein weiteres Expressionsareal in den Zellen des VE

(Kwon et al., 2007).

Mit Beginn der Gastrulation, um E6.25, wird Eomes im PS, im neu entstehenden Mesoderm,

im DVE und im AVE exprimiert. Kurze Zeit später beschränkt sich das Expressionsareal auf

den anterioren PS und die ihm anliegenden mesodermalen Zellen, in denen Eomes bis etwa

E7.5 nachweisbar bleibt (Ciruna und Rossant, 1999).

An E7.5 vermindert sich die Eomes-Expression schlagartig (Ciruna und Rossant, 1999;

Hancock et al., 1999; Russ et al., 2000). Erst an E10.5 kann wieder eine Expression

detektiert werden. Zu diesem Zeitpunkt wird Eomes in neuronalen Vorläuferzellen des

zerebralen Kortex (Bulfone et al., 1999; Ciruna und Rossant, 1999; Hancock et al., 1999;

Russ et al., 2000; Ryan et al., 1998; Englund et al., 2005) und in den Mitralzellen des Bulbus

olfactorius exprimiert (Ciruna und Rossant, 1999). In den Extremitätenknospen findet sich ein

weiteres, kleines Expressionsareal (Hancock et al., 1999).


Einleitung 8

Zwischen E12.5 und E18.5 wird Eomes verstärkt in den intermediären Progenitorzellen der

Subventrikulärzone im Telenzephalon exprimiert (Kwon et al., 2007). Im Kleinhirn wird

Eomes in den unipolaren Bürstenzellen exprimiert, die in der inneren Körnerzellschicht des

adulten Kleinhirns liegen (Englund et al., 2006; Fink et al., 2006). Postnatal finden sich

Transkripte in den Zellen der adulten Subventrikulärzone und des Hippocampus, die die Orte

der adulten Neurogenese darstellen, sowie in Progenitorzellpopulationen verschiedener T-

Zelllinien (Kwon et al., 2007).

1.5.3 Funktion von Eomes während der frühen Mausentwicklung

Embryonen, in denen Eomes deletiert wurde, arretieren in ihrer Entwicklung kurz nach der

Implantation der Blastozyste in die Uterusschleimhaut der Mutter. Es wird vermutet, dass

Eomes ein essentieller Transkriptionsfaktor für die Aufrechterhaltung der Trophoblast-

Stammzellen ist, da die genetische Deletion von Eomes zu einem frühen Verlust dieser

Stammzellen und zur Störung der TE-Entwicklung führt (Russ et al., 2000; Stumpf et al.,

2005; Niwa et al., 2005). Die Embryonen sterben infolgedessen kurz nach der Implantation

und noch vor Beginn der Gastrulation.

Um die Funktion von Eomes innerhalb des Epiblast untersuchen zu können, wurde ein

konditionales Allel von Eomes hergestellt (Arnold et al., 2008a). Damit lässt sich Eomes

selektiv im Epiblast deletieren. Im TE wird es jedoch weiterhin exprimiert. Die Implantation

des Embryos kann somit stattfinden, während die Entwicklung des Epiblast unter dem

Verlust von Eomes stattfindet. Diese selektive Deletion wird mit der Sox2.Cre-Deleter-Maus-

Linie erreicht (Hayashi et al., 2002). Es kommt zu einer volständig ungestörten Entwicklung

der mutanten Embryonen bis zu dem Zeitpunkt der Gastrulation (E6.5), wenn normalerweise

die Eomes-Expression in der Region des PS einsetzt (Arnold et al., 2008a).

Zwischen E6.5 bis E7.0 weisen die Eomes-mutanten Embryonen erste Veränderungen auf.

Eine vollständige Gastrulation (s. Kapitel 1.4) findet nicht statt. Die Zellen des Epiblast

weisen zwar eine normale Morphologie auf und wandern zu Beginn der Gastrulation initial

zum proximo-posterioren Pol, dort erfahren sie jedoch nur teilweise die EMT. Aufgrund von

Migrationsdefekten akkumulieren die Zellen im PS und es entsteht keine mesodermale

Zellschicht (Arnold et al., 2008a). In den mutanten Zellen kann eine Expression posteriorer

(Brachyury, Bmp4) und intermediärer mesodermaler Marker (T-box 6 (Tbx6) und MIX1

homeobox-like 1 (Mixl1)), nachgewiesen werden. Die Marker des anterioren PS (Cer1, Sonic

hedgehog (Shh), Forkhead box A2 (Foxa2)) fehlen hingegen völlig (Arnold et al., 2008a).

Demzufolge benötigt der anteriore PS Eomes für seine Entwicklung. Aus diesem Bereich

gehen normalerweise der PK, die Notochord, die präkordiale Platte, das DE und die

kardialen Progenitorzellen hervor. Es konnte gezeigt werden, dass ein Teil dieser Strukturen,


Einleitung 9

insbesondere das DE, in den Eomes-Mutanten nicht ausgebildet werden. Demnach besitzen

Eomes-Mutanten an E7.5 einen zweischichtigen Aufbau. Sie bestehen aus dem verdickten

Epiblast/ Ektoderm und dem VE (Arnold et al., 2008a).

Eine spezifische Deletion von Eomes im sich entwickelnden Gehirn, führt zu schweren

Entwicklungsstörungen des Kortex. Es kommt zur Ausbildung eines Mikrozephalus und zu

Verhaltensauffälligkeiten (Arnold et al., 2008b; Sessa et al., 2008).

1.5.4 Funktion von Eomes während der Zellmigration

Die mesodermalen Zellen der Eomes-Mutante weisen Migrationsdefekte auf, die bisher noch

nicht verstanden sind. Voraussetzungen für die Zellmigration sind die Lockerung der Zell-

Zell-Kontakte, die Ablösung der Zellen von der Basalmembran und morphologische

Zytoskelettveränderungen. Ein Protein, das eine wichtige Rolle bei der Zelladhäsion spielt,

ist E-cadherin. Wird es vermindert exprimiert, kommt es zu einer Lockerung der Zell-Zell-

Kontakte, wird es hingegen vermehrt exprimiert, haften die Zellen stärker aneinander

(Vleminckx et al., 1991; Perl et al., 1998; Shiozaki et al., 1996). Eine verminderte Expression

von E-cadherin führt zu einer mesenchymalen Umwandlung der Zellen und zu einer

gesteigerten Migration von Mesodermzellen (reviewed von Takeichi, 1995; Huber et al.,

1996). Während der Gastrulation konnte Snail als Repressor der E-cadherin-Transkription

identifiziert werden (Batlle et al., 2000; Cano et al., 2000). Die Aktivierung des Fibroblast

growth factor receptor 1 (Fgfr1) durch die verstärkte Expression von Fibroblast growth factor

4 (Fgf4) und Fibroblast growth factor (Fgf8) im entstehenden Mesoderm, führt zu einer

vermehrten Expression von Snail (Ciruna und Rossant 2001).

In den migrationsgestörten Zellen des mutanten PS kann eine deutlich erhöhte E-cadherin-

Expression nachgewiesen werden, obwohl Snail und Fgf8 in diesen Zellen nicht vermindert

exprimiert werden. Vor allem Snail scheint dabei seine hemmende Wirkung auf die E-

cadherin-Transkription verloren zu haben (Arnold et al., 2008a). Die Ursache dieser

Fehlregulation ist bisher noch nicht bekannt.


Fragestellung und Ziele der Arbeit 10

2. FRAGESTELLUNG UND ZIELE DER ARBEIT

Eomes spielt eine Schlüsselrolle bei der Gastrulation. In früheren Arbeiten konnte gezeigt

werden, dass Eomes notwendig für die Spezifizierung und Morphogenese des definitiven

Endoderms und des Mesoderms ist. Damit konnten die generellen Funktionen von Eomes

während der Embryogenese bereits beschrieben werde. Die Details, wie Eomes seine

embryonalen Funktionen genau ausübt und wie es transkriptionelle Programme genau

reguliert, sind hingegen nach wie vor unbekannt.

Um die Funktionen von Eomes genauer zu untersuchen, wurden in der vorliegenden Arbeit

potenzielle Zielgene von Eomes charakterisiert. Hierzu wurden genomweite

Expressionsprofile von Eomes-Mutanten und Wildtyp-Embryonen mithilfe von Microarray-

Experimenten an E7.0 erstellt und verglichen.

In der Embryologie erschließt sich die Funktion eines Gens unter anderem durch sein

Expressionsmuster. Für Gene, die im Microarray der Mutanten eine stark verminderte oder

verstärkte Expression aufweisen, somit potenziell direkt oder indirekt durch Eomes reguliert

werden, wurden deshalb Whole mount in situ Hybridisierungen durchgeführt, die das

Expressionsmuster dieser Gene in den Wildtyp-Embryonen und in den mutanten Embryonen

zum Zeitpunkt E7.5 aufzeigen. Es wurden die Expressionsmuster von 37 Genen untersucht.

Im Folgenden werden sie einzeln, nach Expressionsdomänen geordnet, aufgeführt. Über

jedes Gen wurden mittels einer ausführlichen Literaturrecherche Informationen seiner

Eigenschaften und Funktionen während der Embryogenese eingeholt. Der Vergleich der

schon bekannten Informationen mit den in dieser Arbeit identifizierten Expressionsmustern

soll helfen die genaue Funktion des Gens und dessen Regulation durch Eomes während der

Gastrulation aufzuzeigen.


Material und Methoden 11

3. MATERIAL UND METHODEN

3.1 Material

3.1.1 Chemikalien

Chemikalien Hersteller Katalognummer

Agarose Sigma-Aldrich A9539

Ampicillin Roth K029.1

Azeton Sigma-Aldrich 179124

BM-Purple Roche 1442074

Böhringer Blocking Reagent (BBR) Roche 1096176

Bromophenol Blau Sigma-Aldrich B5525-5G

Chloroform Sigma-Aldrich C2432

Dimethylsulfoxid (DMSO) Sigma-Aldrich D2650

Dinatriumhydrogenphosphat (Na 2 HPO 4 ) Sigma-Aldrich S7907

Entellan Merck 1.07961.0500

Eosin Sigma-Aldrich 9859

Ethanol (EtOH) Sigma-Aldrich E7023

Ethidiumbromid Roth 2218.2

Ethylendiamintetraacetat (EDTA) Sigma-Aldrich E6758

Formaldehyd BDH 437533W

Formamid (Hybridisierungslösung) Sigma-Aldrich 47671

Formamid (Waschlösung) Sigma-Aldrich 47670

Glutaraldehyd Sigma-Aldrich G-6257

Glycerol Roth 3783.1

Glycin Sigma-Aldrich G-7403

Hefe tRNA Roche 1 010 922 3001

Heparin Sigma-Aldrich H-3393-50KU

Histoclear National Diagnostics HS-200

Kaliumchlorid (KCl) Sigma-Aldrich P9333

Kaliumdihydrogenphosphat (KH₂PO₄) Merck 1.04873.0250

Kalziumchlorid (CaCl₂) Sigma-Aldrich 223506

Levamisol Sigma-Aldrich L-9756

Lithiumchlorid 8M (LiCl) Sigma-Aldrich L7027

Maleinsäure Sigma-Aldrich M-0375

Methanol (MeOH) Sigma-Aldrich 32213

MilliQ-Wasser Grad 1

Millipore

Natriumacetat (NaAc) Sigma-Aldrich S2889

Natriumchlorid (NaCl) Sigma-Aldrich S7653

Natriumhydrogencarbonat (NaHCO₃) Sigma-Aldrich S5761

Natriumlaurylsulfat (SDS) ThermoFisher Scientific BP166-100

Natronlauge (NaOH) VWR International 102525P

Paraffin-Pastillen Roth 6642.5

Paraformaldehyd (PFA) Sigma-Aldrich P6148

Phenol Sigma-Aldrich P1037

Phosphatgepufferte Salzlösung (PBS)-

Tabletten

Sigma-Aldrich P-4417


Material und Methoden 12

Polysorbat (Tween-20) Sigma-Aldrich P1379

Salzsäure (HCl) Sigma-Aldrich H1758

Trinatriumzitrat Sigma-Aldrich C8532

Tris pH 8.5 Böhringer 604205

Tris-Buffered Saline Tween-20 (TBST) Sigma-Aldrich T-9039

Wasserstoffperoxid (H₂O₂), 30% in H₂O Sigma-Aldrich 216763

Zitronensäure Sigma-Aldrich 27488

3.1.2 Enzyme und Proteine

Enzyme und Proteine Hersteller Katalognummer

Anti-Digoxigenin Antikörper Roche 11093274910

Bovines Serumalbumin (BSA) 10x New England Bio Labs B9001S

DNaseI Roche 4716728001

Proteinase K Roche 3115879001

Restriktionsenzyme SpeI New England Bio Labs R0133L

Restriktionsenzyme XhoI New England Bio Labs R0146S

Superasin (RNase) Invitrogen 1111021

Schafserum Sigma-Aldrich S-2263

T3 RNA-Polymerase Roche 11031171001

T4-DNA-Ligase New England Bio Labs M0202S

3.1.3 Gebrauchsmaterialien

Gebrauchsmaterialien Hersteller Katalognummer

12-Loch-Platte Costar 3513

15ml Reagenzgefäß Greiner Bio-one 188271

50ml Reagenzgefäß Falcon Greiner Bio-one 227261

Bakterienreagenzgefäße 10ml Greiner Bio-one 191161

Deckgläschen Roth H878

Eppendorf-Reagenzgefäß 1,5ml Eppendorf 0030 120.086

Eppendorf-Reagenzgefäß 2ml Eppendorf 0030120.094

Glasfläschchen Sigma-Aldrich 186311B

Netzeinsätze 74µm Costar 3477

Objektträger (25x75x1 mm) VWR international 48311-703

PCR-Reagenzgefäß 0,2ml Alpha laboratories LW2235

Pinzetten

Dumont, Fine Science Tools

3.1.4 Kits

Kits Hersteller Katalognummer

QIAfilter Plasmid Maxi Kit Qiagen 12262

Qiagen OneStep RT-PCR-Kit Qiagen 210210

Qiagen Plasmid Midi Kit Qiagen 12143

QIAquick Gel Extraction Kit Qiagen 28704

QIAquick PCR Purification Kit Qiagen 28104


Material und Methoden 13

3.1.5 Bakterien und Vektor

Material

Hersteller

E. coli DH10 Invitrogen

pBluescript-Vektor

Fermentas

3.1.6 Primer

Die Primer sind in 4.1.2 tabellarisch aufgeführt.

3.1.7 Puffer und Lösungen für PCR, Transformation und Transkription

1.1x ReddyMixᵀᴹ

PCR

6x Ladepuffer

1 kb DNA-Marker

Gelelektrophorese

50x TAE-Puffer

Puffer 2

Restriktionsverdau

10x Ligasepuffer

SOC-Medium

enthält 1,25 Einheiten ThermoPrime Plus DNA-Polymerase; 75 mM

Tris-HCl (pH 8,8 bei 25°C); 20 mM (NH₄)₂SO₄; 1,5 mM MgCl₂;

0,01% (v/v) Tween-20; je 0,2 mM dATP, dCTP, dGTP, dTTP,

Präzipitant und Ladepuffer für die GelelektrophoreseThermo

Science, Katalognummer: AB0785.

50% Glycerol; 1 mM Na 2 EDTA; 0,4% Bromophenol Blau in DEPC-

H 2 O

enthält 7 Banden von 100 bis 850 Basenpaaren (bp) und 12 Banden

von 1000 bis 12.000 bp. Invitrogen, Katalognummer: 10787026.

enthält 242 g Tris Basen; 57,1 ml Zitronensäure, 18,61 g

Na₂EDTA·2H₂O; auf 1l destilliertes H₂O. National Diagnostics.

Katalognummer: EC872.

enthält 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl₂, 1 mM

Dithiothreitol, pH 7.9 bei 25°C. New England BioLabs, Kat.nr.:

B7002S.

enthält 400 mM Tris-HCl, pH 7,8, 100 mM MgCl₂, 100 mM DTT, 5

mM ATP; New England Bio Labs, Katalognummer: B0202S.

SOB-Medium: Hefeextrakt 0,5 % (w/v) (5 g/l), Trypton 2 % (w/v) (20

g/l), NaCl 10 mM (0,6 g/l), KCl 2,5 mM (0,2 g/l), MgCl₂ 10 mM,

Magnesiumsulfat 10 mM, dem 20 mM Glucose zugesetzt wurde.

P1-Resuspension-

50 mM Tris-HCl pH 8,0, 10 mM EDTA pH 8,0, 100 mg/ml RNaseA.

Puffer

P2-Lysepuffer 200 mM NaOH, 1 % SDS.

P3-Puffer 3 M KAc pH 5,5.

enthält Transkriptionspuffer 10x:0,4 M Tris-HCl, pH 8,0 (20°C);

Labelling mix: NTP; Nukleotid-Mix: 10 mM ATP, 10 mM CTP, 10 mM

DIG RNA Labelling GTP, 6,5 mM UTP; 3,5 mM Fluorescein-12-UTP, pH 7.5 (20°C)), 1

Mix

µl 10x Puffer (0.4 M Tris-HCl, pH 8.0 (20°C), 60 mM Mg Cl2, 100

mM Dithiothreit, 20 mM Spermidin. Roche, Katalognummer:

1277073.


Material und Methoden 14

3.1.8 Puffer und Lösungen für Whole mount in situ Hybridisierungen (WISH)

Tris(hydroxymetyl)-

aminomethan

2 M Tris HCl, pH 7.5,

Mol.gewicht = 121.1

PBS

PBT (DEPC)

4% PFA/PBT

SSC (Saline-sodium

citrate) 20x

Hybridisierungspuffer

Waschlösung I

Waschlösung II

MAB-Puffer

NTMT (AP-Puffer)

2% BBR/MAB

Blocklösung

Embryopulver

10 mM Tris.HCl, pH 8,0; 1mM EDTA, pH 8

für 100 ml 24,22 g Tris base in 60 ml ddH₂O lösen, mit HCl auf pH

7,5 einstellen, danach ddH₂O bis Volumen von 100ml zugeben.

Böhringer. Katalognummer: 604205.

8 g NaCl; 0,2 g KCl; 1,44 g Na₂HPO₄, 0,24 g KH₂PO₄, auf 1 l mit

ddH₂O auffüllen, als 10x Lösung, pH 6,8, für 12 Stunden rühren,

dann autoklavieren.

PBS mit 0,1% Tween-20.

für 50ml: 2g PFA mit 40 ml ddH₂O mischen, 10µl NaOH zugeben, in

65°C Wasserbad stellen, gelegentliche schütteln, wenn vollständig

gelöst, 5 ml 10x PBT hinzugegeben und bis 50 ml mit H₂O auffüllen.

3 M NaCl, 300 mM Trinatriumzitrat, pH Einstellung auf pH 7,0 mit

HCl.

250 ml Formamid, 125 ml 20x SSC (DEPC) pH 5,0; 2,5 ml 20 %

SDS; 2,5 ml Hefe-tRNA (10 mg/ml). 500 ml Heparin (50 mg/ml); 30

ml 1 M Zitronensäure; 500 µl Tween-20; 89 ml DEPC-H2O .

250 ml Formamid; 125 ml 20x SSC pH 5,0; 25 ml 20 % SDS; 30 ml

1 M Zitronensäure; 70 ml DEPC-H₂O.

250 ml Formamid; 50 ml 20x SSC pH 5,0; 5 ml 20 % SDS; 500 ml

Tween-20; 182,5 ml DEPC-H₂O.

11,61 g Maleinsäure; 17,4 g 5 M NaCl, 7,3 g NaOH Pellets; 1 ml

Tween-20; 960 ml H₂O; mit 5 M NaOH-Lösung den pH auf 7,5

einstellen.

5 ml 2 M Tris-Hcl pH 9,5; 2 ml 5 M NaCl; 5 ml 1 M MgCl₂; 100ml

Tween-20; 82,9 ml ddH₂O.

für 50 ml: 1g Böhringer Blocking Reagent (BBR) und 50 ml MAB, auf

70°C Im Wasserbad aufwärmen, gelegentlich schütteln bis BBR

vollständig gelöst ist. Vor Anwendung auf Raumtemperatur abkühlen

lassen.

5ml/ Loch. Inaktivierung des Schafserums für 30 Minuten bei 70°C,

gelegentliche schütteln; 0,5 ml werden zu 4,5 ml 2% BBR/MAB

hinzugegeben.

Embryos werden in wenig PBS homogenisiert; 4x Volumen kaltes

Azeton hinzugeben, micshen und für 30 min auf Eis inkubieren.

Dann bei 10.000 rpm für 10 min zentrifugieren, Überstand

verwerfen. Pellet mit kaltem Azeton waschen und erneut

zentrifugieren. Pellet auf ein Filterpapier auftragen, bei

Raumtemperatur trocknen, luftverschlossen bei 4°C aufbewahren.

3.1.9 Technische Geräte

Geräte

Hersteller, Produktname

Bunsenbrenner

Integra Bioscience

Computer Software

Adobe-Photoshop, Adobe-Illustrator. Microsoft-

Word, Mivcrosoft-Excel, Leica Camera

Einbettstation, Leica Leica EG 1160

Gelkammer mit 14-Taschen Kamm Peqlab

Hybridisierungsofen

Hybaid

Inkubationskammer 37°C

Memmert


Material und Methoden 15

Inkubator, schüttelnd

Innova 4300, New Brunswick Scientific

Mikrotom Leica RM 2165

Mikrowelle

Samsung

Nano-Drop

ND-1000 Spectrophotometer, ThermoScientific

Nutator

VWR International

PCR-Thermozykler

Biorad

pH-Meter

Knick

Pipetboy ACU

Integra Bioscience

Pipetten

Gilson

Pipettenspitzen

Corning incorporated

Polaroid Gelkamera

Alpha Innotech, H6Z0812M

Rühr-/ Heizblock

IKA Labortechnik

Schnittbildmikroskop Zeiss Axioskop 2

Schnittbildmikroskopkamera

Axiocam

Stereomikroskop

Leica M165C

Stereomikroskopkamera DFC 425

UV-Lampe (366nm)

Peqlab

Vortex

Heidolph Reax top

Waage

Sartorius

Wärmeplatte

Medax

Wasserbad für Paraffinschnitte

New Brunswick Scientific Tespa WB693

Zentrifuge, Reagenzgefäße Vol. 1,5 ml Eppendorf 5417R

Zentrifuge, Reagenzgefäße Vol. 50 ml Sorvall RC5C Plus, Thermo Scientific

3.1.10 Unternehmen

Unternehmen

alpha laboratories

Biorad

Boehringer

Corning incorporated

Costar

Dumont

Eppendorf

Fermentas

GATC Biotech AG

Gilson

Greiner Bio-one

Heidolph Reax

Hybaid

IKA Labortechnik

Integra Bioscience

Invitrogen

Knick

Leica

Medax

Memmert

Merck

National Diagnostics

New Brunswick Scientific

New England Bio Labs

Peqlab

Sitz

Hampshire, UK

Hercules, CA, USA

Mannheim, Deutschland

Schiphol-Rijk, Niederlande

Austin, USA

Schweiz

Hamburg, Deutschland

St. Leon-Rot, Deutschland

Konstanz, Deutschland

Middleton, USA

Frickenhausen, Deutschland

Schwabach, Deutschland

Darmstadt, Deutschland

Staufen, Deutschland

Fernwald, Deutschland

Karlsruhe, Deutschland

Berlin, Deutschland

Bensheim, Deutschland

Kiel, Deutschland

Schwabach, Deutschland

Darmstadt, Deutschland

Georgia, Atlanta, USA

Nürtingen,Deutschland

Frankfurt am Main, Deutschland

Erlangen, Deutschland


Material und Methoden 16

Qiagen

Roche

Roth

Samsung

Sartorius

Sigma-Aldrich

Thermo Scientific

ThermoFisher Scientific

VWR international

Hilden, Deutschland

Mannheim, Deutschland

Karlsruhe, Deutschland

Schwalbach, Deutschland

Göttingen, Deutschland

Steinheim, Deutschland

Langenselbold, Deutschland

Braunschweig, Deutschland

Fontenay sous Bois, Frankreich

3.1.11 Mausstämme

Durch die Verpaarung von Männchen und Weibchen aus einem CD1-Stamm wurden

Wildtyp-Embryonen gewonnen. Dieser Stamm ist besonders robust und zeichnet sich

dadurch aus, dass nicht verwandte Mäuse miteinander gekreuzt werden, um möglichst

gesunde Nachkommen zu erzeugen. Für die Erzeugung von Eomes-defizienten Embryonen

(Eo N/CA ;Sox2.Cre) werden Eo N/+ ;Sox2.Cre - Männchen mit Eo CA/CA - Weibchen gekreuzt. In

den Nachkommen kann nun das Cre-Enzym, eine Rekombinase, an einer vorgegebenen

Stelle der DNA, selektiv Eomes im embryonalen Epiblast deletieren.


Material und Methoden 17

3.2 Methoden

3.2.1 Reverse Transkription von mRNA zu cDNA

Mit einem speziellen Enzym, der reversen Transkriptase, ist es möglich die komplementäre

cDNA zu einem bereits vorhandenen RNA-Strang herzustellen. Bei der reversen

Transkription-Polymerase-Kettenreaktion (RT-PCR) wird zunächst ein einzelsträngiger, zur

RNA komplementärer cDNA-Strang synthetisiert. Dieser wird anschließend mit Hilfe der PCR

amplifiziert. Das Resultat ist eine doppelsträngige cDNA. Für dieses Verfahren wird das

Qiagen OneStep RT-PCR-Kit benutzt. Die Synthese der DNA-Stränge wird in einem

Thermozykler durchgeführt. Als Ausgangs-RNA für die Herstellung von DNA-Strängen wird

RNA verwendet, die aus 7.5 - 8.5 Tage alten Mäuseembryonen extrahiert wurde. Die

eingesetzten Primer werden zuvor anhand vorhandener Sequenzinformationen in „Ensembl“

(http://www.ensembl.org) entworfen und enthalten die Restriktionsschnittstellen für SpeI und

XhoI, mit deren Hilfe die DNA später geschnitten und gerichtet kloniert wird. Es wird RNasin

hinzugegeben, das noch vorhandene RNasen abbauen soll. Der Reaktionsansatz für die RT-

PCR: 9,5 µl Wasser; 3,0 µl 5xBuffer (enthält 12,5 mM MgCl 2 ); 1,0 µl Primer-Mix; 0,6 µl

Enzyme-Mix; 0,6 µl dNTP-Mix (enthält je 10 mM von dTTP, dATP, dGTP, dCTP); 0,15 µl

RNA; 0,15 µl RNasin; Gesamtvolumen: 15 µl.

Reaktionsablauf:

Zu Beginn wird der Ansatz in den auf 50°C aufgeheizten Thermozykler für 30 Minuten

inkubiert. Hierbei findet die reverse Transkription statt. Danach erfolgt die Aktivierung der

HotStarTaq DNA-Polymerase bei 95°C für 15 Minuten. Im Anschluss erfolgt der Zyklus aus

Denaturierung des DNA-Stranges bei 94°C für 30 Sekunden, Annealing der Primer bei 60°C

für 30 Sekunden und die Synthese des DNA-Stranges bei 72°C für eine Minute. Dieser

Zyklus wird 35 Mal wiederholt, bevor abschließend die unvollständigen Synthesestücke bei

72°C für 10 Minuten komplettiert werden. Anschließend werden je 3 µl jedes

Reaktionsansatzes zur Kontrolle auf ein zweiprozentiges Agarosegel aufgetragen und

elektrophoretisch aufgetrennt. Enthalten sie die gewünschten Fragmente, können sie mit

dem Qiagen-PCR-Purification-Kit aufgereinigt werden.

3.2.2 Polymerase-Kettenreaktion (PCR)

Die Polymerase-Kettenreaktion (PCR) ist heutzutage eine gängige Methode um bestimmte

Nukleinsäuresequenzen zu amplifizieren. In dieser Arbeit wird sie für die Vervielfältigung der

cDNA eingesetzt, die später zum Klonieren und danach für die Herstellung der


Material und Methoden 18

Hybridisierungssonden benötigt wird. Hierfür werden Primer benutzt, die Schnittstellen für die

Enzyme SpeI und XhoI besitzen. Der Reaktionsansatz für die PCR: 1 µl DNA; 1,5 µl Primer-

Mix; 18,5 µl Reddymix PCR.

Reaktionsablauf:

Zuerst wird die DNA bei 94°C für drei Minuten denaturiert. Es sollte darauf geachtet werden,

den PCR-Thermozykler rechtzeitig aufzuheizen. Danach wird folgender Zyklus 25 Mal

wiederholt: Denaturierung bei 94°C für 30 Sekunden, Primer-Annealing bei 60°C für 30

Sekunden und Synthese des DNA-Stranges bei 72°C für 30 Sekunden.

Abschließend verlängert man die Synthese-Phase auf 10 Minuten, um noch unvollständige

Synthese-Produkte endgültig fertig zu stellen. Um das Ergebnis der PCR-Reaktion zu

überprüfen trägt man 3 µl jedes Reaktionsansatzes auf ein zweiprozentiges Agarosegel auf,

und trennt sie elektrophoretisch auf. Enthalten sie die gewünschten Fragmente, werden sie

mit Hilfe des Qiagen-PCR-Purification-Kits aufgereinigt. Hierbei werden überflüssige Reste

der Primer und der restlichen Reagenzien entfernt.

3.2.3 Agarosegel-Gelelektrophorese von DNA-Fragmenten

Die Gelelektrophorese ist eine Methode, um DNA-Fragmente entsprechend ihrer Größe

aufzutrennen. Dabei macht man sich den Effekt zunutze, dass kleine Fragmente schneller in

einem Agarosegel wandern als große Fragmente. Durch die gleichzeitige Auftrennung von

DNA-Standards (sogenannten Markern) mit bekannter Fragmentgröße und

Nukleinsäuremenge, ist eine relativ genaue Bestimmung der Größe und der Menge der

gewünschten DNA-Fragmente möglich.

Die Konzentration des Agarosegels variiert von 1 - 2,5% in 1xTAE-Puffer, je nachdem

welche Größe die zu erwartenden DNA-Stücke haben. Zu einer genauen Auftrennung

kleinerer Stücke ist es sinnvoll ein hochprozentiges Gel zu verwenden. Agarose und 1xTAE-

Puffer werden in der Mikrowelle so lange zum Kochen gebracht bis sich die Agarose

vollständig gelöst hat. Anschließend werden 5 µl/ 100ml Ethidiumbromid zugegeben, das die

Banden im Gel sichtbar macht. Das flüssige Gel wird nun in eine dafür vorgesehene

Gelkammer gegossen. Durch das Einhängen eines Kamms werden Taschen ausgespart, in

die nun die Proben eingefüllt werden können. Vor dem Befüllen muss den Proben jedoch ein

Zehntel des Volumens 6x DNA-Ladepuffer zugegeben werden.

Normalerweise werden die DNA-Fragmente durch das Anlegen einer Spannung von 120-

140V elektrophoretisch über die Dauer von 20 Minuten bis zu einer Stunde aufgetrennt. Die

entstandenen Fragmente lassen sich dann unter einer UV-Lampe (366nm) als

fluoreszierende Bande nachweisen. Mit einer elektronischen Sofortbildkamera lassen sich

hiervon Bilder zur Dokumentation schießen.


Material und Methoden 19

3.2.3.1 Isolierung von DNA-Fragmenten aus Agarosegelen

Auf Agarosegelen können DNA-Fragmente nach ihrer Größe aufgetrennt werden. Unter UV-

Licht werden die entstehenden Banden mit einem Skalpell möglichst eng ausgeschnitten und

anschließend mit dem QIAquick Gel Extraction Kit aufgereinigt.

3.2.4 Schneiden von Plasmid-DNA mit Restriktionsenzymen

Plasmid-DNA lässt sich mithilfe von Restriktionsenzymen mit Endonukleaseaktivität

hydrolytisch spalten. Diese Spaltung geschieht an palindromischen Sequenzen und ist

notwendig für die spätere Klonierung des Fragments in einen Vektor. Die hier verwendeten

Enzyme sind SpeI und XhoI.

Der Restriktionsverdau hat ein Gesamtvolumen von 20 µl bzw. 30 µl. Er besteht aus 6-20 µl

DNA, 2 µl 10x Puffer 2, 0,2 µl BSA, 0,5 µl SpeI, 0,5 µl XhoI und wird mit Wasser auf 20 µl

aufgefüllt. Die Enzymaktivität beträgt 10-20 U pro Enzym. Dabei wird ein U definiert als die

Menge Enzym, die bei optimalen Bedingungen 1 µl definierte Substrat-DNA vollständig

verdaut. Der Verdau wird nun bei der für die Enzyme optimalen Temperatur von 37°C für

mindestens eine Stunde inkubiert. Der gesamte Reaktionsansatz wird dann auf ein

Agarosegel aufgetragen und elektrophoretisch aufgetrennt. Die Gelstücke, die die

geschnittenen DNA-Fragmente enthalten, werden ausgeschnitten und schließlich mit dem

QIAquick Gel Extraction Kit aufgereinigt.

3.2.5 Ligation von DNA in den pBluescript (pBS)-Klonierungsvektor

Die Ligation von DNA-Fragmenten in den pBS-Klonierungsvektor wird mit der T4-DNA-

Ligase aus E.coli durchgeführt. Nach Kontrolle der DNA-Mengen mithilfe einer Agarosegel-

Elektrophorese werden circa 25-30 ng an durch SpeI und XhoI geschnittener pBS-Vektor-

DNA und das 2- bis 10-fache molare Verhältnis an DNA-Fragmenten eingesetzt. Dem

Ansatz werden 2 µl 10x Ligasepuffer, 1 µl T4-DNA-Ligase und eine ausgleichende Menge an

Wasser hinzugesetzt, um auf einen Reaktionsansatz von 20 µl zu kommen. Danach werden

die Ansätze bei 15°C über Nacht, oder bei Raumtemperatur für zwei Stunden inkubiert.

3.2.6 Bakterielle Transformation

Die Transformation dient dazu, gezielt gewünschte DNA in ein Bakterium einzubringen, um


Material und Methoden 20

diese danach in ihnen zu amplifizieren. Zu Beginn werden 50 µl chemisch kompetenter

DH10 Bakterien und je 10 µl DNA der Ligationsansätze zusammengegeben und fünf

Minuten auf Eis gestellt. In dieser Zeit kann sich die DNA an die Bakterien anlagern. Damit

sie in die Bakterien eindringen kann, müssen diese für 30 Sekunden bei 42°C inkubiert

werden. Durch diesen Hitzeschock wird die Zellmembran der Bakterien für die Plasmid-DNA

kurzfristig durchgängig. Nach einer weiteren zweiminütigen Inkubation auf Eis wird dem

Ansatz 300 µl SOC-Medium zugegeben (= SOB-Medium: Hefeextrakt 0,5 % (w/v) (5 g/l),

Trypton 2 % (w/v) (20 g/l), Natriumchlorid 10 mM (0,6 g/l), Kaliumchlorid 2,5 mM (0,2 g/l),

Magnesiumchlorid 10 mM, Magnesiumsulfat 10 mM, dem 20 mM Glucose zugesetzt wurde)

und für 30 Minuten, bei 37°C und auf einem Schüttler bei 600 rpm gemischt. Abschließend

werden die Bakterien, die eine Ampicillinresistenz auf ihrem Plasmid tragen, auf einer

vorgewärmten ampicillinhaltigen Agarplatte mit einem Spatel ausgestrichen und über Nacht

bei 37°C inkubiert. Nur erfolgreich transformierte Bakterien können somit auf diesen Platten

wachsen. Am nächsten Tag pickt man mit Hilfe von Pipettenspitzen zwei Kolonien pro Platte

und gibt sie in je ein Reagenzgefäß mit je 3 ml ampicillinhaltigem (100 µg/ml) LB-Medium.

Die angeimpften Bakterien werden nun für 8-10 Stunden bei 37°C langsam rotierend

inkubiert. Eine Trübung der Flüssigkeit zeigt an, dass sich die Bakterien suffizient vermehrt

haben.

3.2.7 Mini-, Midi- und Maxi-Präparation

Dieses Verfahren dient der Vermehrung der DNA. Bei der Durchführung der

Schnellpräparation (sogenannte Mini-Präparation) werden 2 ml der Bakterienkulturen in ein

Eppendorf-Reagenzgefäß überführt, und bei 14000 rpm für eine Minute zentrifugiert. Der

Überstand wird abgesaugt und das Bakterienpellet in 250 µl P1-Puffer resuspendiert. Durch

Zugabe von P2-Lysepuffer (200 mM NaOH, 1 % SDS) werden die Bakterien durch

mehrfaches sorgsames Wenden lysiert. Zuletzt wird der P3-Puffer hinzugegeben, der

einerseits den Reaktionsansatz neutralisiert, und andererseits, zusammen mit dem SDS aus

Puffer 2, die Ausfällung der Proteine und der organischen DNA unterstützt. Nun werden die

Proben bei 14000 rpm für 10 Minuten zentrifugiert. Die ausgefällten Proteine lagern sich nun

am Boden des Reagenzgefäßes ab. Der Überstand, von dem 500 µl in ein anderes

Reagenzgefäß überführt werden, enthält nun die gewünschte Plasmid-DNA. Zur Fällung der

DNA werden zu diesen 500 µl 1 ml 100% Ethanol (EtOH) gegeben und bei 14000 rpm 10

Minuten lang zentrifugiert. Der Überstand wird abgesaugt ohne das entstandene Pellet zu

berühren. Eine anschließende Zugabe von 1 ml 70% EtOH sorgt für die Reinigung des DNA-

Pellets. Der Ansatz wird noch einmal für 5 Minuten bei 14000 rpm zentrifugiert und der

Überstand abgesaugt. Das Pellet wird nun für 20 Minuten luftgetrocknet und schließlich in 40


Material und Methoden 21

µl Tris (pH 8,0 10 mM) resuspendiert.

Die durch dieses Verfahren gewonnene Plasmid-DNA kann zum Beispiel für einen

Restriktionsverdau oder für Sequenzierungsreaktionen verwendet werden. Die Ausbeute der

Mini-Präparation liegt bei circa 2-10 µg DNA. Wenn größere Mengen an DNA gewonnen

werden sollten, steht das Verfahren der Midi- oder Maxi-Präparation zur Verfügung. Sie

funktionieren nach dem gleichen Prinzip, die Ausbeute liegt jedoch bei bis zu 1 mg DNA. Bei

diesen beiden Verfahren kommt es zu einer noch gründlicheren Aufreinigung der DNA, da

hierfür Anionenaustauschsäulen verwendet werden und mehrere zusätzliche Waschschritte

hinzugefügt werden, um eine möglichst hohe Sauberkeit der DNA zu erreichen. Für diese

Reaktionsschritte wird das Plasmid-Midi Kit von Qiagen benutzt. Es wird nach dem Protokoll

des Herstellers vorgegangen.

3.2.8 Bestimmung der DNA-Konzentration mithilfe des NanoDrop

Mit dem NanoDrop kann die Menge der DNA in einer Probe bestimmt werden. Nach

verschiedenen Reaktionsschritten, wie der Durchführung der Midi-Präparationen oder der

Linearisierung der DNA wurde die Menge an extrahierter und resuspendierter DNA

gemessen.

3.2.9 DNA-Sequenzierung

Nach dem Durchführen der Maxi-Präparation wird die gewonnene Plasmid-DNA zum

Sequenzieren zur GATC Biotech AG geschickt. Dieses Unternehmen bestimmt die

Basenabfolge der Plasmid-DNA mithilfe der Didesoxy-Methode nach Sanger. Bei diesem

Verfahren werden Didesoxy-Nukleotide, anstelle der normalerweise für die Synthese der

DNA-Stränge benötigten Desoxy-Nukleotide verwendet. Der Einbau der zweifachdeoxygenierten

Nukleotide führt dazu, dass sich keine weiteren Nukleotide anlagern können.

Folglich kommt es zum Strangabbruch. Je nachdem an welcher Stelle der DNA die

Didesoxy-Nukleotide eingebaut werden, erfolgt der Strangabbruch früher oder später in der

Synthese der DNA. Dadurch entstehen unterschiedlich lange Fragmente, an denen man nun

die Sequenz der DNA ablesen kann.

3.2.10 Linearisierung von Plasmid-DNA

Nachdem das gewünschte DNA-Fragment in das Plasmid kloniert worden ist, ist es für die


Material und Methoden 22

Herstellung der RNA-Sonde erforderlich, den zirkulären Vektor zu linearisieren. Nur dann ist

es möglich, das gewünschte Fragment mithilfe der T3-Polymerase zu transkribieren. Die

Linearisierung wird mit SpeI durchgeführt. Zum Einsatz kommen 10 µg DNA. Das

erforderliche Volumen kann mithilfe der Ergebnisse des NanoDrops bestimmt werden und

wird mit Wasser auf 100 µl aufgefüllt. Um auf einen Reaktionsvolumen von 200 µl zu

kommen, werden pro Reaktionsansatz 5 µl SpeI, 2 µl BSA, 20 µl Puffer 2 und 73 µl Wasser

zugegeben. Diese Ansätze werden bei 37°C für mindestens drei Stunden inkubiert.

Danach werden 5 µl DNA zusammen mit 5 µl Ladepuffer auf ein einprozentiges Agarosegel

aufgetragen, um die Effizienz des Verdaus zu überprüfen. Es sollte pro Bahn nur eine Bande

komplett linearisierter Plasmid-DNA sichtbar sein.

3.2.11 Phenol/ Chloroform-Extraktion

Um nach der Linearisierung des Vektors noch in der Nukleinsäurelösung vorhandene

Verunreinigungen, vor allem Proteine wie beispielsweise RNasen, zu eliminieren, führt man

eine Phenol/ Chloroform-Extraktion durch. Es sollte hierbei RNase-frei gearbeitet werden. Zu

Beginn werden den Reaktionsansätzen ein äquivalentes Volumen (200 µl)

Phenol/Chloroform zugefügt und gut gemischt. Anschließend werden sie bei 13.000 rpm für

5 Minuten zentrifugiert. Die obere wässrige Phase wird, unter Vermeidung der Mitnahme der

Interphase, in ein separates Reagenzgefäß überführt. In einem zweiten Schritt werden

diesem Überstand nun 200 µl Chloroform hinzugegeben. Danach werden die Ansätze wie

oben gemischt und zentrifugiert. Dann wird auch hier die obere wässrige Phase

abgenommen und in ein separates Reagenzgefäß überführt. Anschließend wird die DNA

durch Zugabe von 20 µl Natriumacetat und 500 µl 100% EtOH ausgefällt, danach mit 200 µl

70% EtOH gewaschen und schließlich in 10 µl RNase-freiem Wasser resuspendiert.

3.2.12 Transkription DIG-markierter RNA-Sonden

Für die Darstellung der Expressionsdomänen verschiedener Gene in Mausembryonen durch

Whole mount in situ Hybridisierung, werden DIG (Digoxygenin) – markierte, komplementäre,

antisense RNA-Sonden durch in vitro Transkription hergestellt. Die DIG-markierten RNA-

Sonden können nach der Hybridisierung in den Embryonen durch Anti-DIG-Antikörper und

anschließend farbreaktiv nachgewiesen werden. Für die Transkription werden die in den

pBS-Vektor gerichtet klonierten genspezifischen cDNAs benutzt.

Der pBS-Vektor besitzt eine T3 Primer-Bindungsstelle, an die sich die T3-RNA-Polymerase

anlagern kann. Sie kann von dort aus die gewünschte RNA des Zielgenabschnittes von


Material und Methoden 23

nach 3´ synthetisieren. Es ist notwendig RNase-frei zu arbeiten, da eine Verunreinigung mit

RNase zum Abbau der hergestellten RNA führen kann.

Zu 1 µl DNA gibt man 1 µl DIG RNA-Labeling-Mix 10x (10x konz. NTP Markierungsmix: 10

mM ATP, 10 mM CTP, 10 mM GTP, 6.5 mM UTP, 3.5 mM Fluorescein-12-UTP, pH 7.5

(20°C)), 1 µl 10x Puffer (0.4 M Tris-HCl, pH 8.0 (20°C), 60 mM Mg Cl 2 , 100 mM Dithiothreit,

20 mM Spermidin) 1 µl T3-Polymerase, 0,2 µl RNasin und 5,8 µl Wasser. Der Ansatz wird

nun für mindestens zwei Stunden bei 37°C inkubiert.

Die Kontrolle der Transkription erfolgt durch das Auftragen von 1µl des Reaktionsansatzes

und 7 µl Ladepuffer auf ein einprozentiges Agarosegel. Es wird eine Spannung von 200 mV

über 15 Minuten angelegt. Es sollten zwei Banden auf dem Gel zu sehen sein. Eine Bande

entspricht dem linearisierten Plasmid, die andere stellt die neusynthetisierte RNA dar.

Um nun das linearisierte DNA-Plasmid zu entfernen, werden 1 µl DNase zu jedem Ansatz

hinzugegeben und der Ansatz bei 37°C für 30 Minuten inkubiert.

3.2.13 Lithium-Chlorid-Präzipitation von RNA

Um die RNA zu isolieren und die Reaktionsansätze von überflüssigen Reagenzien zu

befreien, wird eine Lithium-Chlorid-Präzipitation der RNA durchgeführt. Jedem

Reaktionsansatz werden 8 µl 8 M LiCl, 90 µl Wasser und 250 µl 100% EtOH hinzugefügt.

Anschließend werden die Reaktionsansätze für 30 Minuten bei -20°C eingefroren. Um die

RNA auszufällen, werden sie danach für 30 Minuten bei 13.000 rpm zentrifugiert. Der

Alkohol wird abgenommen. Im Anschluss wird die RNA mehrfach mit 100 µl 70% EtOH

gewaschen. Nach Zugabe des Alkohols werden die Ansätze bei 13.000 rpm für 5 Minuten

zentrifugiert. Anschließend wird der Überstand abgenommen und die gefällte RNA in 42 µl

RNase-freiem Wasser resuspendiert.

3.2.14 Präparation der Embryonen

Ist ein vaginaler Plugg bei der Mutter nachweisbar, wird von einer erfolgreichen Befruchtung

ausgegangen. Da diese Überprüfung normalerweise morgens stattfindet und da von einer

nächtlichen Befruchtung ausgegangen wird, wird bei einem Plugg-Nachweis das Alter der

Embryonen auf E0.5 geschätzt. Nach weiteren sieben Tagen werden die Embryonen aus

den Müttermäusen entnommen und in kalter PBS-Lösung unter dem Stereomikroskop nach

Standardtechnik nach Hogan herauspräpariert (Hogan et al., 1994).


Material und Methoden 24

3.2.15 Fixierung der Embryonen

Die präparierten Embryonen werden über Nacht in vierprozentiger Paraformaldehyd (PFA)

/PBS bei 4°C fixiert und danach drei Mal für 10 Minuten in DEPC-PBT gewaschen.

Anschließend werden die Embryonen in einer aufsteigenden Methanol-PBT-Reihe (25%,

50%, 75%) in 100% Methanol überführt. Die Embryonen sollten in jeder Lösung mindestens

fünf Minuten belassen werden. Abschließend werden sie vier bis fünf Mal in 100% Methanol

gewaschen. Die fixierten Embryonen können nun bei -20°C in 100% Methanol gelagert

werden.

3.2.16 Whole mount in situ Hybridisierung (WISH)

Mit der In situ Hybridisierung werden anhand von DIG-markierten Hybridisierungssonden

komplementäre RNA-Stränge in Geweben nachgewiesen. Diese kann einerseits auf

histologischen Schnitten (In situ Hybridisierung) oder auf ganzen Embryonen durchgeführt

werden (Whole mount in situ Hybridisierung). Zur Darstellung der Genexpressionsdomänen

werden Digoxin-markierte, zu der jeweiligen RNA komplementäre Hybridisierungssonden

eingesetzt. An das Digoxin bindet ein Digoxin-Antikörper, der das Enzym Alkalische

Phosphatase (AP) gebunden hat. Nach Zugabe einer Färbelösung kann die AP eine

Farbreaktion auslösen, die die Expressionsdomäne des Genes sichtbar macht.

Um die Expressionsmuster der einzelnen Gene an verschiedenen Zeitpunkten der

embryonalen Entwicklung untersuchen zu können, wurden die WISHs mit Embryonen im

Alter zwischen E6.0 und E9.5 durchgeführt. Das Protokoll dauert 4 Tage.

3.2.16.1 1. Tag: Prozessierung, Vorhybridisierung, Hybridisierung

Benötigte Reaktionslösungen:

2 Liter DEPC-PBT

6% Wasserstoffperoxid (H 2 O 2 )-Lösung in PBT (circa 3 ml/ Loch)

10 µg/ml Proteinase K (RNase-frei) in PBT (2,5 ml/ Loch)

2mg/ml Glycin in PBT (2,5 ml/ Loch)

4% PFA/ 0,2% Glutaraldehyd in PBT (3 ml/ Loch)

7,5 ml Hybridsierungslösung pro Loch

50-100ng (1 µg/ml) DIG-markierte RNA-Sonden

Die in Methanol gelagerten Embryonen werden in einer absteigenden Methanolreihe (75%,

50%, 25% MeOH/PBT) für je 5 Minuten, und abschließend in PBT rehydriert. Anschließend


Material und Methoden 25

werden sie in sechsprozentigem Wasserstoffperoxid für 10 Minuten gebleicht und danach

drei Mal in PBT gewaschen. Um überschüssige RNA-assoziierte Proteine zu eliminieren,

werden die 7.5 Tage alten Embryonen je nach Größe für 4-9 Minuten mit der Proteinase K

verdaut.

Alter der Embryonen Inkubationszeit in Proteinase K/ PBT

E6.5 4 Minuten

E7.5 5 Minuten

E8.5 6 Minuten

E9.5 7 Minuten

Der Verdau wird mit einer Zugabe von 2 mg/ml Glycin und PBT abgestoppt. Anschließend

werden die Embryonen zwei Mal in PBT gewaschen. Um sie zu fixieren, werden sie für 20

Minuten in eine 4% PFA/ 0,2% Glutaraldehyd-Lösung gegeben. Nach einem weiteren

Waschschritt in PBT werden die Embryonen in eine 12-Loch-Platte mit Netzeinsätzen

sortiert. Danach werden sie in die 1:1 PBT/Hybridisierungspuffer-Mischung überführt. Dort

werden sie für 10 Minuten belassen. Anschließend gibt man sie in die Hybridisierungslösung

und stellt sie in einen auf 70°C vorgewärmten Hybridisierungsofen. Nach zwei Stunden ist

die Prähybridisierung beendet. Die erste Hybridisierungslösung wird durch eine frische

ersetzt. Gleichzeitig werden 50-100 ng der circa 1 µg/ml DIG-markierten RNA-Sonde

hinzugegeben und über Nacht unter ständiger Bewegung hybridisiert.

3.2.16.2 2. Tag: Post-Hybridisierungswaschungen und Antikörper-Inkubation

Benötigte Reaktionslösungen:

vorgewärmte (68°C) Prähybridisierungslösung vom Vortag (3 ml/ Loch)

vorgewärmte (68°C) Waschlösung 1 (9 ml/ Loch)

vorgewärmte (65°C) Waschlösung 2 (12 ml/ Loch)

1 Liter Maleinsäure-Puffer (MAB)

5 ml/ Loch 2% Boehringer Mannheim Blocking Reagent (BBR)/ MAB

Blocklösung: BBR/ MAB mit 10% hitzeinaktiviertes Schafserum (2,5 ml/ Loch)

Embryopulver

Durch die Verwendung verschiedener Waschlösungen werden nicht spezifisch gebundene

RNA-Sonden entfernt. Zu Beginn werden die Embryonen einmal in der

Prähybridisierungslösung (s. 1. Tag) gewaschen. Danach erfolgen drei Waschschritte bei

70°C mit je 3 ml Waschlösung 1. Der erste Waschschritt erfolgt über 5 Minuten, der zweite

über 30 Minuten und der dritte ebenfalls über 30 Minuten. Beim dritten Waschschritt wird die

Temperatur auf 65°C gesenkt. Im Folgenden werden die Embryonen vier Mal in je 3 ml

Waschlösung 2 bei 65°C gewaschen. Der erste und zweite Waschschritt dauert je 30


Material und Methoden 26

Minuten, der dritte und vierte je 60 Minuten. Danach sollten die Embryonen bei

Raumtemperatur abkühlen, bevor sie drei Mal 5 Minuten in je 3 ml MAB gewaschen werden.

Anschließend werden sie für mindestens 90 Minuten in 10% Schafserum in 2% Blocklösung/

MAB gegeben. Über Nacht werden sie dann mit zuvor geblocktem Antikörper bei 4°C und

unter ständiger Bewegung inkubiert.

Für die Herstellung der Antikörperlösung werden pro Loch 0,1 g BBR in 5 ml MAB durch

Erhitzen auf 65°C und mehrmaliges Schütteln gelöst. Danach wird die Lösung auf

Raumtemperatur abkühlen lassen. Gleichzeitig wird eine kleine Menge Embryopulver (eine

Messerspitze) in 1 ml der 2 % BBR/MAB-Mischung gegeben, erhitzt, und unter ständigem

Rotieren bei 70°C für 30 Minuten gelöst. Dadurch wird der Antikörper präabsorbiert.

Anschließend wird die Mischung gut gemischt und auf Eis gestellt. Danach werden 5 µl

Schafserum und 1 µl DIG AP-Konjugat pro Loch hinzugefügt und für mindestens eine Stunde

bei 4°C unter ständiger Bewegung inkubiert. Schließlich wird das Embryopulver wieder

abzentrifugiert und der Überstand mit 2,5 ml 2 % BBR/MAB Lösung und 20 µl Schafserum

pro Loch gemischt. Dieser Ansatz wird nun bei 4°C und unter ständiger Bewegung über

Nacht inkubiert.

3.2.16.3 3. Tag: Waschungen in MAB nach der Antikörperinkubation

Benötigte Reaktionslösungen:

MAB (siehe Vortag)

Levamisol (30 µl/ Loch)

Nach der nächtlichen Inkubation mit der Antikörperlösung werden die Embryonen nun bei

Raumtemperatur und unter ständiger Bewegung in immer weiter auseinander liegenden

Zeitabschnitten in je 3 ml MAB gewaschen. Über Nacht werden die Embryonen schließlich in

3 ml MAB/Levamisol pro Loch (hierbei werden 3 ml MAB mit 30 µl Levamisol gemischt)

gegeben und unter Bewegung bei 4°C inkubiert.

3.2.16.4 4.Tag: Farbentwicklung

Benötigte Reaktionslösungen:

Alkalische Phosphatase (AP) - Puffer (NTMT) (9 ml/ Loch)

Färbelösung: BM-Purple (2,5 ml/ Loch)

Abstoplösung 2mM EDTA/ PBT (3 ml/ Loch)

Fixierungslösung 4 % PFA/ 0,1 % Glutaraldehyd in PBT

Bevor die Embryonen gefärbt werden können, müssen sie drei Mal in jeweils 3 ml AP-Puffer

gewaschen werden. Danach werden sie in je 2,5 ml Färbelösung (BM-Purple; Roche)


Material und Methoden 27

inkubiert. Durch die an den Antikörper gebundenen Peroxidase findet daraufhin eine

Farbreaktion statt, die zu einer Blaufärbung der Region im Embryo führt, in der das jeweilige

Gen exprimiert wird. Die Embryonen werden bei Raumtemperatur in Dunkelheit unter

dauerhafter Bewegung für mehrere Stunden inkubiert. Die Färbung der Embryonen sollte in

regelmäßigen Abständen unter dem Mikroskop beurteilt werden, um eine entstehende

Hintergrundfärbung zu kontrollieren. Soll bei ausreichender Färbung die Reaktion gestoppt

werden, werden die Embryonen für 5 Minuten in 2 mM EDTA gegeben. Für die Fixation

werden sie für mindestens eine Stunde in einer Mischung aus 4 % PFA/ 0,1 % Glutaraldehyd

in PBT inkubiert. In der PBT-Lösung können die Embryonen bei 4°C dauerhaft gelagert

werden. Abschließend werden mit einer Mikroskopkamera (Leica M165C, Objektiv: Plan Apo

1,0; Kamera: DFC 425, Software: Leica Application Suit 4.1) Fotos der Embryonen

angefertigt.

3.2.17 Paraffinschnitte

Mithilfe der WISH können die Expressionsareale einzelner Gene in Mäuseembryonen

aufgezeigt werden. Aufgrund der Dreidimensionalität der Embryonen kann jedoch nicht

beurteilt werden in welcher Zellschicht des Embryos sich das Expressionsareal eines Gens

befindet. In histologischen Schnitten lässt sich die genaue Lokalisation des

Expressionsareals besser beurteilen und eine Zuordnung zur endodermalen, mesodermalen

oder ektodermalen Zellschicht erreichen.

Es werden Paraffinschnitte der durch die WISH angefärbten Embryonen angefertigt. Hierzu

werden die in PBT gelagerten Embryonen über eine aufsteigende EtOH-Reihe entwässert

und anschließend in Paraffin eingebettet. Die Embryonen müssen sehr langsam entwässert

werden, da es bei einer zu schnellen Änderung der EtOH-Konzentration zu einer osmotisch

bedingten Schädigung der Embryonen kommen kann. Aufgrund dessen beginnt die

Entwässerung in einer Mischlösung aus 25 % EtOH und 75 % PBS. Es schließen sich 50 %

EtOH/ 50 % PBS, 50 % EtOH/ 50% H 2 O, 75 % EtOH/ 25 % H 2 O, 80 % EtOH/ 20 % H 2 O, 85

% EtOH/ 15 % H 2 O, 90 % EtOH/ 10 % H 2 O, 95 % EtOH/ 5 % H 2 O, und 100 % EtOH an. Die

Embryonen sollten etwa eine Stunde in jeder der EtOH-Lösungen verbleiben, bevor sie in die

Lösung mit der nächsthöheren Konzentration überführt werden.

Der 95 % EtOH-Lösung werden einige Tropfen Eosin hinzugefügt. Eosin färbt die

Embryonen orange. Dies erleichtert ihr Wiederauffinden in den Paraffinblöcken. Nach der

Färbung sollten die Embryonen zunächst in der 95 % EtOH-Lösung, und anschließend

mehrmals in der 100 % EtOH-Lösung gewaschen werden. Mögliche Eosinfarbreste können

damit entfernt werden. Abschließend sollte die 100 % EtOH-Lösung weitere acht Mal

gewechselt werden, um selbst kleinste Eosin- und Wasserreste zu entfernen.


Material und Methoden 28

Dann wird ein Großteil des EtOH abgenommen und 0,5 ml Histoclear hinzugegeben. Dieses

wird nach 45 Minuten durch frisches ersetzt. Anschließend werden 2 ml flüssiges Paraffin für

15 Minuten hinzugegeben. Die Mischung aus Histoclear und Paraffin wird abgenommen und

die Embryonen anschließend in reines Paraffin gebettet. Das Paraffin wird nach einer Stunde

gewechselt. Nun werden die Embryonen mithilfe einer Pipette einzeln in wachsgefüllte

Plastik-Träger umgesetzt. Diese lässt man über Nacht bei 4°C erkalten, bevor sie an einem

Mikrotom geschnitten werden. Es werden Schnitte von 8 µm Dicke angefertigt, die

anschließend auf Objektträger aufgezogen werden und auf einer Wärmeplatte bei 42°C für

mehrere Stunden trocknen. Schlussendlich werden sie mit Eosin gegengefärbt und zur

Lagerung eingedeckelt.

3.2.18 Eosinfärbung von Paraffinschnitten

Das Gewebe der Embryonen, das durch die WISH nicht gefärbt wurde, stellt sich auf den

Schnittbildern farblos dar. Da es sich aufgrund dessen nicht gut zur Kontrastierung eignet,

wird es mit Eosin orange gefärbt.

Zu Beginn werden die Objektträger, auf die die Schnitte aufgezogen wurden, in Histoclear

entwachsen. Dort werden sie für sieben Minuten belassen, bevor sie ein weiteres Mal für

sieben Minuten in frisches Histoclear getaucht werden. Danach werden sie für zwei Mal drei

Minuten in eine Lösung aus 100 % EtOH und ein Mal für drei Minuten in Lösungen aus je 96

% EtOH, 70 % EtOH und Eosin gegeben. Anschließend werden sie 1 ½ Minuten in 96 %

EtOH getaucht, bevor sie schließlich drei Mal in 100 % EtOH gewaschen werden.

Abschließend werden sie für 10 Minuten in Histoclear gelegt. Zum Eindeckeln wird ein

Tropfen Entellan auf die noch nassen Schnitte gegeben und der Objektträger mit einem

Glasplättchen abgedeckt. Sie können in Objektträgerkästen gelagert werden. Abschließend

werden von den Schnitten Bilder mit einer Mikroskopkamera angefertigt.


Ergebnisse 29

4. ERGEBNISSE

4.1. Expressionsanalysen potenziell durch Eomes regulierter Gene

Ziel dieser Arbeit ist es, neue, potenzielle Zielgene von Eomes zu identifizieren und zu

charakterisieren. Diese Gene sollen helfen die phänotypischen Veränderungen der Eomes-

Mutante während der Gastrulation besser verstehen zu können. Eomes ist durch seine

Eigenschaft als Transkriptionsfaktor an der Expressionsregulation anderer Gene direkt

beteiligt. Die Gene, die für diese Arbeit mittels der Microarray-Ergebnisse ausgewählt

wurden, weisen in den Eomes-Mutanten, im Vergleich zu den Wildtyp-Embryonen, eine

deutliche Veränderung ihres Expressionsniveaus auf. Die Auswahl umfasst 37 verschiedene

Gene, die im Folgenden näher beschrieben, und im Zusammenhang mit den jeweiligen,

bereits publizierten Daten diskutiert werden.

4.1.1 Auswahl potenziell Eomes-regulierter Zielgene während der Gastrulation

In Vorarbeiten der Arbeitsgruppe wurden genomweite Expressionsanalysen von Eomesmutanten

Embryonen und den vergleichbaren Wildtyp-Kontrollen durchgeführt. Hierzu

wurden jeweils drei Gruppen von E7.0 Eomes-mutanten Embryonen und den

entsprechenden Wildtyp-Embryonen aus denselben Würfen isoliert, einzeln genotypisiert

und dem Entwicklungsstadium entsprechend in Gruppen eingeteilt. Die Embryonen wurden

exakt an der Grenze zwischen dem embryonalen Anteil inklusive des Epiblast und dem

extraembryonalem Ektoderm in zwei Teile geteilt und der extraembryonale Anteil zur

Genotypisierung verwendet. Jeweils zehn Embryonen wurden anschließend zusammen

geführt und hieraus etwa ein bis drei µg Gesamt-RNA isoliert. Die Erstellung der RNA-

Expressionsprofile Eomes-mutanter und Kontroll-Embryonen wurden durch quantitative

Hybridisierung auf 32K Illumina-Microarray Plattformen durchgeführt. Nach Normalisierung

der verschiedenen Array-Datensätze wurden Genlisten entsprechend der Unterschiede in

Expressionsstärke und den P-Werten zwischen Eomes-mutanten und Kontroll-Embryonen

erstellt.

In weiteren Microarray-Experimenten wurden Expressionsprofile von Eomes-mutanten und

Wildtyp Embryonalen Stammzellen (ES-Zellen) erstellt, die für die Dauer von drei Tagen

nach einem Protokoll zur Differenzierung von DE behandelt wurden. Während dieses

Protokolls exprimieren die differenzierenden ES-Zellen typischerweise am dritten Tag


Ergebnisse 30

Eomes, so dass durch den Vergleich von Eomes-mutanten ES-Zellen und Wildtyp Kontrollen

potenzielle Zielgene von Eomes gefunden werden konnten.

In dieser Arbeit werden Gene analysiert, die eine Änderung im Expressionsniveau

(Foldchange (FC)) von zumeist >1,5x aufweisen. Nur Spink3, Arhgef3, Pga5 und Pim1

besitzen eine geringere FC. Bei den Microarray-Ergebnissen der Zellen gibt es neun Gene

mit einer FC von >1.5x und 32 Gene mit einer FC < 1.5x. Von Tnnt2 sind keine FCs bekannt.

Von sieben der 37 Gene sind bisher noch keine Expressionsanalysen während der

Embryonalentwicklung durchgeführt worden.

4.1.2 Herstellung 42 verschiedener RNA-Sonden

Um die Genexpressionsdomänen mit der WISH nachweisen zu können, wurden in dieser

Arbeit 42 RNA-Sonden von 37 verschiedenen Genen kloniert und WISHs in Wildtyp- und

Eomes-defizienten Embryonen zwischen E6.5 und E9.5 durchgeführt. Die Gene sind in der

unten stehenden Tabelle aufgeführt (Tabelle.1). Sie sind fortlaufend nummeriert und

namentlich aufgelistet. Die dritte Spalte enthält die Primernummern, die ebenfalls fortlaufend

vergeben werden. Die vierte Spalte listet die Primersequenzen auf.

Die eingesetzten Primer wurden für jedes der 37 Gene mit „Ensembl“

(http://www.ensembl.org) und „primer3“ (http://www.bioinformatics.nl/cgibin/primer3plus/primer3plus.cgi/)

entworfen. Die Primer enthalten die Schnittstellen für die

Restriktionsenzyme SpeI und XhoI und haben eine Länge von ungefähr 30 Basenpaaren

(Bp). Die in der Tabelle farbig markierten Basen entsprechen der Schnittstellensequenz von

SpeI (AAACTAGT/ rot) und XhoI (AACTCGAG/ rosa). Die entstehenden Genfragmente

haben eine Größe zwischen 128 und 592 Bp. Die Fragmentlokalisation gibt an, gegen

welchen Abschnitt des Gens die Sonde gerichtet ist. Die Primer sind meist gegen das

3’UTR-Ende des Gens oder gegen ein randständiges Exon gerichtet, von dem keine

Splicevariante bekannt ist. Das 3’UTR-Ende stellt in der Regel einen wenig konservierten

Genabschnitt dar, da es einen nicht-kodierenden Genabschnitt enthält. Verschiedene

Mitglieder einer Genfamilie sind sich in ihrer Gensequenz und ihrer Struktur sehr ähnlich.

Richtet sich die Sonde gegen einen Abschnitt des kodierenden Bereichs, wäre es möglich,

dass die Sonde ebenfalls an andere Mitglieder der Genfamilie binden kann und

infolgedessen keine spezifische Reaktion möglich ist.

Die in der Tabelle 1 aufgeführte Referenz-Sequenz entspricht der offiziellen Gen-

Bezeichnung. Die Nukleotide geben an, an welcher exakten Position des Gens das

gewünschte Fragment liegt. Die Foldchanges zeigen auf, um welches Verhältnis das Gen

verstärkt (positiver Wert) oder vermindert (negativer Wert) im Microarray der mutanten

Embryonen oder der Eomes-defizienten Zellen exprimiert wird.


Ergebnisse 31

Sämtliche in dieser Arbeit erfolgten Klonierungen wurden erfolgreich in dem pBluescript-

Vektor (pBS) durchgeführt. Bei fünf der 37 Gene (Etsrp71, Trim67, Nkx1.2, Esm1, Lgr5)

wurden je zwei Sonden gegen zwei Genregionen hergestellt.

In der Tabelle 1 sind sieben Gene aufgelistet, bei denen zum Teil keine Daten erhoben

werden konnten. Sie sind mit dem Kürzel „k.A.“ (keine Angabe) versehen. Bei Esm1, Nkx1.2,

Trim67, Dkk4, Lgr5, Cxcr4 war entweder die Klonierung nicht erfolgreich oder es kam zu

einer unspezifischen Färbung in der WISH. Für Esm1, Trim67 und Lgr5 wurde ein neues

Primerpaar entworfen. Für Nkx1.2 und Cxcr4 wurde auf Klone der cDNA-Bank „I.M.A.G.E.“

(„integrated molecular analysis of genomes and their expression“). zurückgegriffen. Es

konnte hieraus erfolgreich eine RNA-Sonde für Nkx1.2 hergestellt werden. Für Cxcr4 gelang

dies, trotz mehrerer Versuche, nicht. Zu Foxf1a kann keine weitere Information über die

Sonde gefunden werden.

Tabelle 1: Übersicht über die 37 untersuchten Gene, die Primer, die RNA-Sonden und die Foldchanges (Werte

auf zwei Dezimale gerundet). Frag.gr.-Fragmentgröße, Frag. Lokal.-Fragmentlokalisation, Ref-Sequenz-

Referenzsequenz, FC E.-Foldchange Embryo, FC.Z.-Foldchange Zellen; Bp-Basenpaare.

N° Gen Primernr. Primer-Sequenz Frag.gr. Frag. Lokal. Pl.-Nr. Ref-sequenz Nukleotide FC E. FC Z.

1 Etsrp71 9090303 AAACTAGTGACTGGACAGACCTGGGATG 472 Bp - pSJA1 XM_001479243 333-805 -3,46 -1,97

9090304 AACTCGAGGGTCGCACAGCTGGAACT

2 Arginase1 9090305 I AAACTAGTCAAGACAGGGCTCCTTTCAG 543 Bp exon7-8 pSJA2 NM_007482 897-1439 2,51 4,4

9090305 II AACTCGAGCATCTTTTGAACAGCGTGGA

3 Esm1 9090306 AAACTAGTGAGGGACAGAACAGGGTGAA 551 Bp k.A. pSJA3 k.A. k.A. 3,45 1,3

9090307 AACTCGAGTCACAACTCTGTTGGCAAGG

4 Upp1 9090308 AAACTAGTACTTCAGGCGGGATAGGTCT 504 Bp exon8-10 pSJA4 NM_001159402 673-1177 -2,83 -7,73

9090309 AACTCGAGGTCCCAGGCTCTTCTTGATG

5 Rasgrp3 9090310 AAACTAGTTTGAGCTCCTTTGTGTGTGC 587 Bp - pSJA5 NM_001166493 2872-3460 -3,18 1,14

9090311 AACTCGAGGAAGGGTGGGGAAGAAGAAG

6 Nkx1.2 9090312 AAACTAGTCGACGTTTCAAGCAACAGAA 511 Bp exon3 pSJA6 NM_001146198 578-1099 1,99 4,24

9090313 AACTCGAGCAGATGGGATAGGCTGGAGA

7 Foxd4 9090314 AAACTAGTGCAACTATTGGAGCCTGGAC 592 Bp exon1 pSJA7 NM_008022 996-1588 -3,66 -1,18

9090315 AACTCGAGTGCGGACATGTGAAACAAAG

8 Vstm2b 9090316 AAACTAGTTGACACTCAGGAGCACAAGG 528 Bp exon4-5 pSJA8 NM_021387 495-1023 -2,88 -6,85

9090317 AACTCGAGCTTCATGCTTCCCTCAGTCC

10 Sprr2a 9090320 AAACTAGTGGCACCTGGGTACAGTTGAT 524 Bp exon2 (3'UTR) pSJA10 NM_001164787 2831-3355 2,62 20,43

9090321 AACTCGAGCTGTCCCCTTTAGCCCTTTC

11 Trim67 9090322 AAACTAGTAGCCGAGTCTTCCTTCTTCC 508 Bp - pSJA11 NM_198632 4251-4759 3,16 4,76

9090323 AACTCGAGAGATGGAGCTGTGAGCCACT

12 Klhl6 9090324 AAACTAGTCCCTGCAACAACAAGCTGTA 533 Bp exon7 pSJA12 NM_183390 1703-2237 -3,34 -3,81

9090325 AACTCGAGTGCTTCCTGAGAGACCCACT

13 Phlda2 9090326 AAACTAGTCATCCTCAAGGTGGACTGCG 448 Bp exon1-2 pSJA13 NM_009434 226-675 -8,12 -2,12

9090327 AACTCGAGCGGAATGGTGGGTTGGAAGC

14 Spink3 9090328 AAACTAGTGGAAGCACCCTGTATAGTTCT 366 Bp exon1-4 pSJA14 NM_009258 41-406 1,04 -132

9090329 AACTCGAGGTTCAGATGCATTTATTCAAC

17 Bhlhb2 9090334 AAACTAGTGGCATGTCTCGGTAGTGGTT 571 Bp exon5 pSJA17 NM_011498 2064-2634 1,98 5,76

9090335 AACTCGAGCAAGCAGAGTGCATTTGGAA

18 Pdgfr 9090336 AAACTAGTAGGACTTGGGTGATGTGGAG 450 Bp exon24-3'UTR pSJA18 NM_011058 3538-3985 -2,72 -2,25

9090337 AACTCGAGGACGGTTCCAGTACCTTCCA

19 Arhgef3 9090338 AAACTAGTGGCCTAGTTCCCTCTGTTCC 543 Bp exon11 pSJA19 NM_027871 1770-2300 1,34 -3,22

9090339 AACTCGAGTGGCAACTGCTTTTGTCTTG

20 Cxcr4 9090340 AAACTAGTTGTCTAGGCAGGACCTGTGG 212 Bp exon2 pSJA20 NM_009911 1383-1607 -3,06 -15,38

9090341 AACTCGAGCCATCACACAGCATAACCAAA

21 Mkx 9090342 AAACTAGTCTAGAGTGGCCAGGAAGTGC 444 Bp exon7 pSJA21 NM_177595 1298-1742 2,07 4,64

9090343 AACTCGAGTCTGGGCTGAACAGATTTCC

23 Bmper 9090346 AAACTAGTGACATGCAAGAGCCAGTGAA 545 Bp exon1 pSJA23 NM_028472 2669-3214 -2,13 -1,89

9090347 AACTCGAGCCGTGGCAACTATCCAGTTT


Ergebnisse 32

24 Pga5 9090348 AAACTAGTCATCAACACCCTGCCTGATA 319 Bp - pSJA24 NM_021453 1033-1352 1,07 -61,14

9090349 AACTCGAGGGGATCAGCTCTCTGGATGA

26 Etsrp71 9090352 AAACTAGTACAGACCTGGGATGCAACA 439 Bp - pSJA26 XM_001479243 322-762 -3,46 -1,97

9090353 AACTCGAGGGTCGCACAGCTGGAACT

27 Nkx1.2 9090354 AAACTAGT TCTCCAGCCTATCCCATCTG k.A. ex3-UTR pSJA27 k.A. k.A. 1,99 4,24

9090355 I AACTCGAG GGTTGAATTTGCTTGGCTGT

28 Trim67 9090355 II AAACTAGT CACCTTTTGTTTCCGGCTTA 562 Bp k.A. pSJA28 NM_198632 3425-3987 3,16 4,76

9090356 AACTCGAG CAGCAATTTCTGTGGAAGCA

29 Crabp1 9090357 AAACTAGT GATGTGGTGTGCACAAGAATTT 269 Bp exon1-2 pSJA29 NM_013496 472-741 -2,87 1,02

9090358 AACTCGAG GCAGCCAACCAGTTTAATGA

30 Foxc1 12090359 AAACTAGTTTCCCTGCCAGTCAGTCTCT 486 Bp 3’UTR pSJA30 NM_008592 2158-2645 -2,26 1,43

9090360 AACTCGAGTCCCGTTCTTTCGACATAGG

31 Esm1 12090361 AAACTAGTTGCTTTGAATGGAAATGCTG 574 Bp exon1-2 pSJA31 NM_023612 1277-1850 3,45 1,3

9090362 AACTCGAGCGGGTAAAAACTCAGGTCCA

32 Pim1 12090363 AAACTAGTCCAGCAAGTAGCAGCCTTTC 337 Bp Exon 1-4 pSJA32 NM_008842 1029-1366 1,13 1,02

9090364 AACTCGAGCCATCTTGGTGACCCAGTCT

33 Tnnt2 12090365 AAACTAGTCCTGCAGGAAAAGTTCAAGC 273 Bp Exon1-9 pSJA33 NM_011619 822-1095 k.A. k.A.

9090366 AACTCGAGGCATAGGGGTCAGGCAGAGT

35 Grrp1 12090369 AAACTAGTATTGGACATCCAGCGACAG 329 Bp

9090370 AACTCGAGTACCCGTTTCCACAGTCCTC

Ex1-2 forward

3+ UTR

pSJA35 NM_001099296 799-1128 -2,11 -3,27

38 Lars2 12090375 AAACTAGT GTTGCCATGGTAATCCTGCT 407 Bp Exon1-3 3'UTR pSJA38 NM_153168 3364-3771 -2,56 1,05

9090376 AACTCGAG CATGATCCTCCTTCCTCAGC

40 Spin2 12090379 AAACTAGTGGCAAGGTCATTCACCAAGT 270 Bp Exon1-2 pSJA40 NM_001005370 928-1197 -2,31 -1,25

9090380 AACTCGAGAGGTCATGTCCACAGACTGG

41 Foxf1a 12090381 AAACTAGTACGCCGTTTACTCCAGCTCT 356 Bp k.A. pSJA41 k.A. k.A. -2,6 1,13

9090382 AACTCGAGCACACACGGCTTGATGTCTT

42 Frzb 12090383 AAACTAGTACCGATTGTTTACCGCAGAC 438 Bp Exon6 3´UTR pSJA42 NM_011356 1620-2057 -2,19 -3,55

9090384 AACTCGAGTTCCTGGTGTTGGGCTACTC

43 Wnt2 12090385 AAACTAGTCATGGACAGCTGCGAAGTTA 444 Bp Exon 5 3`UTR pSJA43 NM_023653 1058-1501 -2,56 -1,03

9090386 AACTCGAGTGTCATGCCATTTCCAAAAA

44 Capn6 12090387 AAACTAGTGCAAGGTCACATCAGCTTCA 464 Bp Exon13 pSJA44 NM_007603 2092-2556 -2,25 -3,12

9090388 AACTCGAGAGCTGGGATGTCAGGCTAGA

45 Smarcd3 12090389 AAACTAGTACACCTAGGAGCCCGTGAAC 128 Bp Exon13 pSJA45 NM_025891 1589-1716 -1,59 1,51

9090390 AACTCGAGCGTGACCTTTAATCCATCCAG

46 Dkk4 12090391 AAACTAGTCAGAATCAATCCCTGGCACT 433 Bp k.A. pSJA46 k.A. k.A. 2,27 1,24

9090392 AACTCGAGCTGTGTCCGGGCTGTTTTAT

47 Tmem63a 12090393 AAACTAGTTTGTGGCCAAGATCATGTGT 422 Bp Exon 23 3´UTR pSJA47 NM_144794 2810-3233 1,67 1,1

9090394 AACTCGAGCCAGCCCAGTGGGTACTTTA

48 Nrp 12090395 AAACTAGTTTCTGGACCGACAGGAAGTC 462 Bp Exon 15 pSJA48 NM_181848 1837-2298 -2,42 -11,53

9090396 AACTCGAGTCACTCTTCCCACACCTTCC

49 Gpx2 12090397 AAACTAGTGGAGATCCTGAACAGCCTCA 401 Bp Exon2 pSJA49 NM_030677 419-819 -2,17 -3,46

9090398 AACTCGAGACACTGAGCCCTGAGGAAGA

50 Lgr5 12090399 AAACTAGTTTGGAGAAAGGAGAGCTGGA 429 Bp k.A. pSJA50 k.A. k.A. -1,59 -3,47

9090400 AACTCGAGAGTCATGGGGTAAGCTGGTG

51 Lgr5 12090401 AAACTAGTCCAACTGGTCTCCAACTGGT 401 Bp k.A. pSJA51 k.A. 2935-3336 -1,59 -3,47

9090402 AACTCGAGTCGTGAGTCGAGAACACACC


Ergebnisse 33

4.2 Expressionsmuster potenziell Eomes-regulierter Gene

28 der 37 untersuchten Gene, zeigen an E7.5 sowohl in den Wildtyp- Embryonen als auch in

den Eomes-Mutanten ein spezifisches Expressionsmuster. Neun Gene weisen eine

unspezifische Färbung auf. Bei 22 Genen wird das Expressionsmuster nicht nur zum

Zeitpunkt E7.5, sondern ebenfalls in jüngeren und/ oder älteren (von E6.5 - E9.5) Embryonen

untersucht.

4.2.1 Genexpressionsmuster in den Wildtyp-Embryonen zum Zeitpunkt E7.5

Die unten angeführte Übersichtstabelle (Tabelle 2) zeigt auf, in welcher Struktur oder in

welchem Gewebe ein Gen zum Zeitpunkt E7.5 in den Wildtyp-Embryonen exprimiert wird.

Sieben Gene, Klhl6, Wnt2, Capn6, Smarcd3, Tnnt2, Crabp1 und Pdgfr, werden

ausschließlich im embryonalen Mesoderm exprimiert werden. Etsrp71, Rasgrp3 und Foxf1a

sind im Mesoderm und im PS nachweisbar. Vstm2b, Phlda2 und Foxc1 sind über das

Mesoderm und den PS hinaus noch im embryonalen Ektoderm zu finden.

Upp1 und Lgr5, werden sowohl im embryonalen Mesoderm als auch im embryonalen

Ektoderm exprimiert. Nkx1.2 wird ebenfalls im Ektoderm und darüber hinaus im PS

exprimiert, ist im Mesoderm jedoch nicht nachzuweisen. Pim1 und Sprr2a werden nur im

Ektoderm exprimiert. Spink3 weist eine Expressionsdomäne im embryonalen Ektoderm und

Endoderm auf.

Vier Gene, Arhgef3, Spin2, Arginase1 und Mkx, werden nur in der extraembryonalen Region

exprimiert und können in embryonalen Geweben nicht nachgewiesen werden. Für zwei

Gene, Tmem63a und Pga5, ist hingegen gar keine Expressionsdomäne in den Wildtyp-

Embryonen, sondern nur in den Eomes-Mutanten nachweisbar.

Bei neun Genen konnte weder in den Wildtyp-Embryonen noch in den Eomes-Mutanten ein

spezifisches Expressionsmuster nachgewiesen werden und es zeigt sich lediglich eine

diffuse Blaufärbung. Zu diesen Genen gehören Bmper, Cxcr4, Dkk4, Esm1, Foxd4, Gpx2,

Grrp1, Lars2 und Trim67.

Für Frzb und Nrp konnte weder in den Wildtyp-Embryonen noch in den Eomes-Mutanten ein

Expressionsmuster nachgewiesen werden. Aus der Literatur ist jedoch bekannt, dass Frzb

ab E9.5 in Wildtyp-Embryonen exprimiert wird (Lee et al., 2000). In dieser Arbeit ist jedoch

keinerlei Färbung der Embryonen zu beobachten, so dass gegebenenfalls von sehr geringen

Expressionslevels der Gene oder einer nur schwachen Bindung der RNA-Sonden

ausgegangen werden muss.


Ergebnisse 34

Tabelle 2: Übersicht über die Genexpressionsmuster in den Wildtyp-Embryonen zum Zeitpunkt E7.5.

Abkürzungen: PS – Primitivstreifen, PK – Primitivknoten, nur extraembr. – nur extraembryonal, keine Expr. –

keine Expression, unspez. – unspezifisch, k.A. – keine Angabe.

Ektoderm Mesoderm Endoderm

PS

Klhl6

x

Wnt2

x

Capn6

x

Smarcd3

x

Tnnt2

x

Crabp1

x

Pdgfr

x

Etsrp71 x x

Rasgrp3 x x

Foxf1a x x

Vstm2b x x x

Phlda2 x x x

Foxc1 x x x

Upp1 x x

Lgr5 x x

Nkx1.2 x x

Spink3 x x

Pim1

x

Sprr2A x

Bhlhb2 k.A.

Arhgef3

Spin2

Arginase1

Mkx

Tmem63a

Pga5

Bmper

Cxcr4

Dkk4

Esm1

Foxd4

Gpx2

Grrp1

Lars2

Trim67

Frzb

Nrp

nur

extraembr.

x

x

x

x

keine Expr. unspez.

x

x

x

x

x

x

x

x

x

x

x

keine

Färbung

x

x

4.2.2 Genexpressionsmuster in den Eomes-Mutanten zum Zeitpunkt E7.5

Die unten angeführte Übersichtstabelle (Tabelle 3) zeigt auf, in welcher Struktur oder in

welchem Gewebe ein Gen zum Zeitpunkt E7.5 in den Eomes-mutanten Embryonen

exprimiert wird. 16 der 37 Gene zeigen ein Expressionsmuster im mutanten PS (Tabelle 3).

Darunter gibt es fünf Gene, Phlda2, Nkx1.2, Pim1, Sprr2a und Tmem63a, die darüber hinaus

noch ein Expressionsdomäne in den Zellen des Epiblast aufweisen. Eine extraembryonale

Expressionsdomäne zeigen Smarcd3, Pdgfr, Phlda2, Upp1, Pim1, Sprr2a und Arhgef3.

Ausschließlich im viszeralen Endoderm werden Spink3 und Arhgef3 exprimiert.

Fünf Gene, Wnt2, Etsrp71, Vstm2b, Bhlhb2 und Spin2 werden in den Mutanten gar nicht

exprimiert. Dkk4, Esm1, Foxd4 und Grrp1 werden in den Eomes-Mutanten unspezifisch


Ergebnisse 35

exprimiert. Von neun Genen wurde keine WISH in den Mutanten durchgeführt. Sie werden in

der Tabelle mit „k.A.“ (keine Angabe) markiert.

Tabelle 3: Übersicht über die Genexpressionsmuster in den Eomes-Mutanten an E7.5. Abkürzungen: PS –

Primitivstreifen, VE – Viszerales Endoderm, keine Expr. – keine Expression, k.A. – keine Angabe.

PS Epiblast VE keine Expr. extraembryonal unspezifisch

Klhl6 x

Wnt2

x

Capn6 x

Smarcd3 x x

Tnnt2 k.A.

Crabp1 x

Pdgfr x x

Etsrp71

x

Rasgrp3 x

Foxf1a x

Vstm2b

x

Phlda2 x x x

Foxc1 x

Upp1 x x

Lgr5

x

Nkx1.2 x x

Spink3

x

Pim1 x x x

Sprr2A x x x

Bhlhb2

x

Arhgef3 x x x

Spin2

x

Arginase1 x

Mkx k.A.

Tmem63a

x

Pga5

x

Bmper k.A.

Cxcr4 k.A.

Dkk4

x

Esm1

x

Foxd4

x

Gpx2 k.A.

Grrp1

x

Lars2 k.A.

Trim67 k.A.

Frzb k.A.

Nrp k.A.


Ergebnisse 36

4.3 Genexpressionsmuster nach Expressionsdomänen geordnet aufgeführt

In der Embryologie erschließt sich die Funktion eines Gens vor allem durch sein

embryonales Expressionsmuster. Um dieser Vorstellung gerecht zu werden, werden die in

dieser Arbeit untersuchten Gene, nach ihren Expressionsdomänen in den Wildtyp-

Embryonen geordnet, aufgeführt. Die Gene, die in gleichen Gewebetypen exprimiert werden,

werden in den Bilddokumenten von Kapitel 4.3.1 bis Kapitel 4.3.5 gemeinsam abgebildet. Da

sich die Expressionsmuster deutlich voneinander unterscheiden (vgl. Tab. 2), ist es nicht

immer möglich homogene Gruppen zu bilden. Es erfolgt deshalb in Kapitel 4.4 eine

detaillierte Aufstellung der einzelnen Gene. Die Ergebnisse der Literaturrecherche und die

Bildresultate der WISH werden dabei jeweils zusammengestellt und in direktem

Zusammenhang diskutiert. Diese Zusammenstellung soll helfen, die Funktion der Gene

während der Embryonalentwicklung besser verstehen zu können. Die Fotos wurden mit einer

Mikroskopkamera aufgenommen (Leica 165C). In der Abbildung 5A ist der Maßstab mit

einem Balken angegeben, der für die weiteren Bilder ebenfalls Gültigkeit hat.

4.3.1 Ausschließlich mesodermal exprimierte Gene

Abbildung 5: Gene, die ausschließlich im embryonalen Mesoderm exprimiert werden. Klhl6, Wnt2, Capn6,

Smarcd3, Tnnt2, Crabp1 und Pdgfr werden im Mesoderm exprimiert (A,C,E,G,I,J,L). Die Eomes-Mutanten

zeigen entweder gar keine Expression, wie bei Wnt2, oder sie färben Zellen des mutanten PS wie bei Klhl6,

Capn6, Smarcd3, Crabp1 und Pdgfr (B,D,F,H,K,M). Maßstabsbalken Abb. A: 500 µm.

Sieben Gene, Klhl6, Wnt2, Capn6, Smarcd3, Tnnt2, Crabp1 und Pdgfr werden in der

embryonalen Region ausschließlich im Mesoderm exprimiert (Abb. 5A,C,E,G,I,J,L). Wnt2,

Tnnt2 und Smarcd3 sind aus der Literatur als frühe (Wang et al., 2001; Lickert et al., 2004),

Capn6 als später Herzmarker (Dear et al., 1999) bekannt. Klhl6 ist ein Marker für

embryonale Blutgefäße (Kroll et al., 2005). Crabp1 wird für die Zelldifferenzierung (Lane et

al., 2008) und Pdgfr für die Vaskulogenese benötigt (Review Claesson-Welsh, 1994;


Ergebnisse 37

Kazlauskas, 1994). In den Eomes-Mutanten wird Wnt2 gar nicht exprimiert (Abb. 1B). Klhl6,

Capn6, Smarcd3, Crabp1 und Pdgfrwerden in den Mutanten hingegen vermindert

exprimiert (Abb. 5B,F,H,K,M).

4.3.2 Expression im Mesoderm, im PS und vereinzelt im Ektoderm

Abbildung 6: Gene, die im Mesoderm, im PS und vereinzelt im Ektoderm exprimiert werden. An E7.5

werden Etsrp71, Rasgrp3 und Foxf1a im Mesoderm und im PS exprimiert (A,C,E). Vstm2b, Phlda2 und Foxc1

sind zusätzlich zum Mesoderm und PS im Ektoderm zu finden (G,I,K). In den Eomes-Mutanten werden Etsrp71

und Vstm2b gar nicht, Rasgrp3, Foxf1a, Phlda2 und Foxc1 hingegen in Zellen des mutanten PS exprimiert

(B,D,F,H,J,L).

Etsrp71, Rasgrp3 und Foxf1a werden sowohl im embryonalen Mesoderm, als auch im PS

exprimiert (Abb. 6A,C,E). Etsrp71 und Rasgrp3 sind aus der Literatur als Marker für

embryonale Blutgefäße bekannt (Lee et al., 2008; Roberts et al., 2004). Foxf1a wird für die

Vaskulogenese und die Organogenese vom Darm abstammender Organe benötigt

(Mahlapuu et al., 2001). In den Eomes-Mutanten wird Etsrp71 nicht exprimiert, wohingegen

Rasgrp3 und Foxf1a in einigen Zellen des mutanten PS nachweisbar sind (Abb. 6B,D,F).

Vstm2b, Phlda2 und Foxc1 werden im embryonalen Mesoderm, Ektoderm und im PS

exprimiert (Abb. 6G,I,K). Über die Funktion von Vstm2b ist bisher nichts bekannt. Es wird in

den Eomes-Mutanten nicht exprimiert (Abb. 6H). Phlda2 ist an der Bildung der Plazenta

beteiligt (Frank et al., 2002) und ist in den Mutanten in proximal gelegenen Zellen des

mutanten PS und im extraembryonalen Gewebe zu finden (Abb. 6J). Foxc1 ist ein Vertreter

der Forkhead-Transkriptionsfaktoren, der für die Entwicklung der Blutgefäße und die

Differenzierung der Osteoblasten benötigt wird (Sasaki et al., 1993; Rice et al., 2005). In den

Mutanten wird es in Zellen des mutanten PS exprimiert (Abb. 6L).


Ergebnisse 38

4.3.3 Ektodermal exprimierte Gene mit zusätzlichen Expressionsarealen

Abbildung 7: Gene, die unterschiedliche Expressionsmuster aufweisen. Upp1 und Lgr5 werden im

Mesoderm und im Ektoderm exprimiert (A,C). Nkx1.2 ist im embryonalen Ektoderm und im PS nachweisbar (E).

Spink3 ist im Ektoderm und Endoderm zu finden (G). Pim1 und Sprr2a werden im Ektoderm exprimiert (I,K,). In

den Eomes-Mutanten wird Upp1 in Zellen des mutanten PS und in extraembryonalen Geweben exprimiert (B).

Lgr5 ist nur in einem sehr kleinen Areal im posterioren extraembryonalen Gewebe zu finden (D). Nkx1.2, Spink3,

Pim1 und Sprr2a werden im Ektoderm der Mutanten exprimiert (F,H,J,L). Bhlhb2 wird in den embryonalen und

extraembryonalen Geweben exprimiert (M). In den Eomes-Mutanten sind keinerlei Transkripte nachweisbar (N).

Upp1, ein Enzym des Pyrimidinstoffwechsels (el Kouni et al., 1993), und Lgr5, ein

Stammzellmarker (Barker et al., 2007), werden sowohl im embryonalen Mesoderm als auch

im embryonalen Ektoderm exprimiert (Abb. 7A,C). In den Eomes-Mutanten wird Upp1 im PS

und in extraembryonalen Geweben (Abb. 7B), Lgr5 in einem sehr kleinen Areal im

extraembryonalen Gewebe, exprimiert (Abb. 7D).

Nkx1.2, ein Transkriptionsfaktor, der für die neuronale Differenzierung benötigt wird

(Schubert et al., 1995), wird im embryonalen Ektoderm und im PS exprimiert (Abb. 7E).

Spink3, ein Enzym des Verdauungssystems (Kazal et al. 1948), ist im embryonalen

Ektoderm und im embryonalen Endoderm zu finden (Abb. 7G). Pim1, ein Apoptoseregulator

(Bachmann et al., 2005), und Sprr2a, ein Migrationsinduktor (Demetris et al., 2008), werden

im embryonalen Ektoderm exprimiert (Abb. 7I,K). Bhlhb2, das für die Differenzierung von

Trophoblaststammzellen benötigt wird, wird im embryonalen und extraembryonalen Gewebe

exprimiert (Abb. 7M).

In den Eomes-Mutanten weisen sowohl Nkx1.2, als auch Spink3, Pim1 und Sprr2a ein

deutlich verstärktes ektodermales Expressionsmuster auf (Abb. 7F,H,J,L). Bhlhb2 wird in den

Eomes-Mutanten nicht exprimiert (Abb. 7N).


Ergebnisse 39

4.3.4 Gene ohne Expression im embryonalen Gewebe

Abbildung 8: Gene, die im extraembryonalen Gewebe oder gar nicht exprimiert werden. Arhgef3, Spin2,

Arginase1 und Mkx werden an E7.5 ausschließlich in extraembryonalen Geweben exprimiert (A,C,E,G).

Tmem63a und Pga5 werden in den Wildtyp-Embryonen gar nicht exprimiert (H,J). Die Eomes-Mutanten

exprimieren Arhgef3 im VE und in Zellen des mutanten PS (B). Spin2 wird in ihnen hingegen gar nicht exprimiert

(D). Arginase1 ist im mutanten PS nachweisbar (F). Tmem63a ist im Ektoderm (I) und Pga5 in einem eng

umschriebenen Areal im anterio-distalen VE zu finden (K).

Vier Gene, Arhgef3, Spin2, Arginase1 und Mkx, werden nur in den extraembryonalen

Geweben exprimiert (Abb. 8A,C,E,G). Arhgef3 ist wahrscheinlich an der Bildung enterischer

Nervenfasern beteiligt (Heanue et al., 2006). Über Spin2 ist bisher nichts bekannt. Arginase1

ist ein Enzym des Harnstoffwechsels (Iyer et al., 1998), das erst nach E7.5 stärker exprimiert

wird. In den Eomes-Mutanten werden Arhgef3 im Endoderm und im PS (Abb. 8B), Spin2 gar

nicht (Abb. 8D), und Arginase1 (Abb. 8F) in akkumulierenden Zellen des PS exprimiert. Die

Expression von Mkx wurde in den Eomes-Mutanten nicht untersucht.

Tmem63a, über das bisher nichts Genaues bekannt ist, und Pga5, ein Enzym des

Verdauungssystems (reviewed von Foltmann, 1981), werden an E7.5 nicht exprimiert (Abb.

8H,J). In den Eomes-Mutanten sind Tmem63a im Ektoderm und Pga5 in einem eng

umschriebenen Areal im anterio-distalen VE zu finden (Abb. 8I,K).


Ergebnisse 40

4.3.5 Unspezifische Expressionsmuster

Abbildung 10: Unspezifische Expressionsmuster von neun Genen zum Zeitpunkt E7.5 (A-M). Von neun

verschiedenen Genen, Bmper, Cxcr4, Dkk4, Esm1, Foxd4, Gpx2, Grrp1, Lars2 und Trim67, kann nur ein

unspezifisches Expressionsmuster sowohl in den Wildtyp-Embryonen als auch in den Eomes-Mutanten

nachgewiesen werden (A-M). Bei Bmper, Cxcr4, Gpx2, Lars2 und Trim67 wurden die WISHs nicht mit Eomes-

Mutanten durchgeführt.

Von neun der untersuchten Gene, Bmper, Cxcr4, Dkk4, Esm1, Foxd4, Gpx2, Grrp1, Lars2

und Trim67, konnte kein spezifisches Expressionsmuster, weder in den Wildtyp-Embryonen

noch in den Eomes-Mutanten, nachgewiesen werden (Abb. 10A-M). Als Ursache für eine

ubiquitäre Färbung kann sowohl eine tatsächliche ubiquitäre Genexpression, oder aber eine

unspezifisch hybridisierende RNA-Sonde in Frage kommen. Möglicherweise konnten die

Sonden, die für diese Gene generiert wurden, nicht spezifisch an die gewünschte m-RNA

binden.

Cxcr4 ist aus der Literatur als Marker des DE bekannt (Yasunaga et al., 2005). Auch mit

mehreren verschiedenen Sonden ist es in dieser Arbeit nicht möglich gewesen eine

spezifische Genexpression nachzuweisen.


Ergebnisse 41

4.4. Spezifische Expressionsanalysen von 37 differenziell exprimierten Genen

Die 37 untersuchten Gene werden im Folgenden nach ihren Expressionsdomänen geordnet

aufgeführt und einzeln analysiert. Sie werden in direkten Zusammenhang mit den aus der

Literatur bekannten Daten diskutiert. Auf den Abbildungen sind die Wildtyp-Embryonen von

links nach rechts nach aufsteigendem Alter angeordnet. Die 7,5 Tage alte Eomes-Mutante,

ist stets rechts neben dem gleichaltrigen Wildtyp-Embryo abgebildet. Viele

Expressionsmuster sind bisher noch nicht beschrieben worden und über einige Gene ist

bisher noch nichts bekannt.

Alle Gene werden nach einem gleichen Schema Weise besprochen. Zu Beginn wird das Gen

kurz beschrieben. Es werden Informationen über die Funktion, bereits beschriebene

Expressionsmuster während der Embryonalentwicklung, durchgeführte genetische

Deletionen und Zellexperimente aufgeführt. Es schließt sich die Beschreibung der

abgebildeten Expressionsmuster an. Schlussendlich werden die gesammelten Daten in

direktem Anschluss nochmals zusammenfassend analysiert und diskutiert.

4.4.1 Kelch-like 6 (Klhl6)

Wildtyp Eomes-Mutante Wildtyp

Abbildung 11: Die Klhl6-Expression von E7.0 bis E8.0 in den Wildtyp-Embryonen (A-B’,D-E’) und an E7.5

in der Eomes-Mutante (C). An E7.0 wird Klhl6 nicht exprimiert (A). Erst einen halben Tag später sind Transkripte

im proximo-posterioren Mesoderm nachweisbar (B,B’). Zum Zeitpunkt E7.75 wird Klhl6 in der frühen Herzanlage

exprimiert (D). An E8.0 ist die Expressionsdomäne von Klhl6 im Herz deutlich zu erkennen (E,E’). In der Eomes-

Mutante wird das Gen in Zellen des mutanten PS exprimiert (C) (B' Transversalschnitt durch B;E’ Sagittalschnitt

durch E).

4.4.1.1 Kurzbeschreibung

Funktion von Klhl6

Klhl6 kodiert für ein Broad-Complex, Tramtrack and Bric a brac (BTB)-kelch Protein (Kroll et

al., 2005), das zwei unterschiedliche Domänen, die BTB - Domäne und die kelch-Domäne,

besitzt (Adams et al., 2000).

In der Literatur beschriebenes Expressionsmuster von Klhl6

Klhl6 wird in embryonalen Gefäßendothelzellen exprimiert. In reifen Gefäßen der adulten

Maus können hingegen keine Transkripte nachgewiesen werden (Kroll et al., 2005).


Ergebnisse 42

Genetische Deletion von Klhl6

Klhl6 -/- - Mäuse sind lebensfähig, weisen jedoch Defekte in der Entwicklung des

Immunsystems auf (Kroll et al., 2005). Ihre Milz ist verkleinert und die Zahl der reifen B-

Zellen ist erniedrigt. Immunreaktionen laufen eingeschränkt ab. In den Lymphfollikeln werden

kleinere Keimzentren gebildet und weniger B-Zellen aktiviert. Die Reaktion der B-

Gedächtniszellen ist abgeschwächt und die Signaltransduktion durch den B-Zell-Antigen-

Rezeptor ist vermindert. Es können keine Defekte der Blutgefäßbildung nachgewiesen

werden (Kroll et al., 2005).

4.4.1.2 Embryonale Expressionsanalyse von Klhl6

Expressionsmuster von Klhl6 im Wildtyp-Embryo

An E7.0 wird Klhl6 nicht exprimiert (Abb. 11A). An E7.5 zeigt sich eine starke Expression im

proximo-posterioren embryonalen Mesoderm lateral des PS (Abb. 11B,B'). Eine schwächere

Expression ist im embryonalen proximo-anterioren und lateralen Mesoderm zu erkennen

(Abb. 11B'). Im extraembryonalen Gewebe wird Klhl6 im distalen Mesoderm, im Amnion, in

der Allantois und im Chorion exprimiert (Abb. 11B). An E7.75 sind Transkripte in der frühen

Herzanlage des anterioren Mesoderms nachweisbar (Abb. 11D). Im lateralen embryonalen

Mesoderm und in der Allantois wird Klhl6 weiterhin exprimiert (Abb. 11D). An E8.0 zeigen

sich Expressionsareale im posterioren und im anterioren paraxialen Mesoderm (Abb. 11E)

und nach wie vor in den Zellen des Kopfmesoderms und des Herzens (Abb. 11E). Hier

exprimieren vor allem die Endokardzellen Klhl6 (Abb. 11E'). Im extraembryonalen Gewebe

ist Klhl6 im posterioren extraembryonalen Mesoderm, in der Allantois und im Amnion

nachweisbar (Abb. 11E).

Expressionsmuster von Klhl6 in der Eomes-Mutante

An E7.5 wird Klhl6 vor allem in den proximalen und zum Coelom hin gelegenen Zellen des

mutanten PS exprimiert (Abb. 11C). In einigen, weiter mittig gelegenen Zellen des mutanten

PS sind ebenfalls Transkripte nachweisbar (keine Abbildung).

4.4.1.2 Zusammenfassende Darstellung von Klhl6

Eomes ist ein positiver Regulator von Klhl6. Wird Eomes nicht exprimiert, ist die Expression

von Klhl6 im Embryo um das 3,34-fache reduziert. Klhl6 ist ein Blutgefäßendothelzellmarker

(Kroll et al., 2005). In dieser Arbeit konnte er als Herzmarker identifiziert werden, der zum

Zeitpunkt E7.5 in den kardialen Vorläuferzellen und ab E7.75 in der frühen Herzanlage

exprimiert wird (Abb. 11B,D). Die verminderte Klhl6-Expression und die verkleinerte

Expressionsdomäne in den Eomes-Mutanten bestätigen, dass Eomes für die Regulation der


Ergebnisse 43

Klhl6-Expression benötigt wird. Bei den gefärbten Zellen des mutanten PS handelt es sich

wahrscheinlich um Zellen, aus denen das extraembryonale Mesoderm hervorgeht. Ihre

Entstehung ist in den Mutanten nicht gestört. Der Migrationsdefekt hindert sie daran in ihre

Zielregion auszuwandern. Es kann sich hierbei nicht um kardiale Vorläuferzellen handeln, da

diese in den Mutanten nicht gebildet werden.

Die Deletion von Klhl6 führt zu einer Funktionseinschränkung des Immunsystems (Kroll et

al., 2005). Eomes ist ebenfalls an der Regulation immunologischer Vorgänge beteiligt

(Intlekofer et al., 2008; Pearce et al., 2003). Da Eomes die Expression von Klhl6 reguliert,

könnte es möglich sein, dass Eomes über Klhl6 auf die Funktion des Immunsystems Einfluss

nimmt.

4.4.2 Wingless-related MMTV integration site 2 (Wnt2)

Wildtyp Eomes-Mutante Wildtyp

Abbildung 12: Die Expression von Wnt2 in den Wildtyp-Embryonen an E7.5 und E7.75 (A,A’,C,C’) und in

der Eomes-Mutante an E7.5 (B). An E7.5 wird Wnt2 vor allem im posterio-proximalen (A,A’) und im anterioproximalen

Mesoderm exprimiert (A). An E7.75 sind Transkripte in der frühen, halbmondförmigen Herzanlage

nachweisbar (C,C’). Die Eomes-Mutante exprimiert kein Wnt2 (B) (A’,C’ jeweils Transversalschnitte durch A,C).

4.4.2.1 Kurzbeschreibung

Funktion von Wnt2

Wnt2 übt seine Funktion über den kanonischen Wnt-/ß-catenin-Signaltransduktionsweg aus

(Goss et al., 2009). Es wird von der Zelle sezerniert (Monkley et al., 1996), bindet an den

Frizzled-Rezeptor und löst damit eine Signalkaskade aus, infolge derer es zu einer

Aktivierung von intrazellulärem ß-catenin kommt. ß-catenin reguliert in Kombination mit

anderen Transkriptionsfaktoren die Expression von Wnt-Zielgenen. Über diesen Signalweg

reguliert Wnt2 die Entwicklung des Einflusstraktes des Herzens (Tian et al. 2010). Wnt2 ist

ein direktes Zielgen von Gata binding protein 6 (Gata6) (Alexandrovich et al., 2006; Tian et

al. 2010), ein Transkriptionsfaktor, der in der frühen Herzentwicklung benötigt wird (reviewed

von Molkentin, 2000).


Ergebnisse 44

In der Literatur beschriebenes Expressionsmuster von Wnt2

Wnt2 konnte als kardialer Marker in der frühen Herzentwicklung identifiziert werden (Monkley

et al., 1996). Es wird vor allem im posterioren Herz exprimiert und ist dort an der Ausbildung

und der Differenzierung der Vorhöfe, der Pulmonalvenen und des atrioventrikulären Kanals

beteiligt (Monkley et al., 1996; Tian et al. 2010).

Von E7.5 bis E8.5 wird Wnt2 im präkardialen Mesoderm und in den Herzvorläuferzellen

exprimiert (Monkley et al., 1996). An E7.75 beschränkt sich die Expression auf ein

halbmondförmiges, der Vorderdarmtasche aufliegendes Areal. Wnt2 wird hier vor allem in

den lateralen Bereichen exprimiert, aus der der mesodermale Anteil des Herzfeldes, der

Sinus venosus, Teile der Vorhöfe und Teile des atrioventrikulären Kanals hervorgehen

(Monkley et al., 1996; Goss et al., 2009; Tian et al., 2010). Von E8.5 bis E10.5 bleibt das

Expressionsareal, das an den Einflusstrakt des entstehenden Herzens grenzt, unverändert

(Goss et al., 2009; Tian et al., 2010). Zum Zeitpunkt E9.5 können weitere

Expressionsdomänen zwischen dem Vorhof und dem Sinus venosus (Alexandrovich et al.,

2006) und im Septum transversum nachgewiesen werden (Monkley et al., 1996).

In den extraembryonalen Geweben ist von E7.5 bis E8.5 eine schwache Expression von

Wnt2 in der Allantois zu detektieren, die stärker wird, sobald Allantois und Chorion zur

chorioallantoischen Platte verschmelzen (Monkley et al., 1996). Von E8.5 bis E10.5 wird

Wnt2 im fetalen Anteil der Plazenta und im Nabel exprimiert. Die Expression ist auf den

allantoischen Teil der hämochorialen Plazenta beschränkt, aus der die Vorläuferzellen der

fetalen Blutgefäße und Kapillaren hervorgehen (Monkley et al., 1996). Ab E9.5 wird Wnt2 in

der Lunge exprimiert (Bellusci et al., 1996).

Genetische Deletion von Wnt2

Wnt2 -/- - Mäuse sterben entweder perinatal oder werden mit einer deutlich verminderten

Körpergröße geboren. Die Plazenta weist ab E14.5 strukturelle Veränderungen auf. In der

Labyrinthzone manifestieren sich Geweberisse, -ödeme und Blutgefäßdefekte, die zum

Austritt mütterlichen Blutes aus den Gefäßen in das Gewebe und zu einer Mangelversorgung

des Embryos führen können (Monkley et al., 1996).

Die Herzen der Wnt-defizienten Embryonen beginnen an E8.0 zu schlagen, weisen jedoch

hauptsächlich posteriore Entwicklungsdefekte auf, die sich morphologisch meist ab E10.5

manifestieren (Monkley et al., 1996; Tian et al. 2010). Die Proliferation der posterioren

sekundären Progenitorzellen des Herzfeldes ist vermindert. Die Vorhofwände sind

ausgedünnt und die Ventrikel und die atriumnahen Wände der Pulmonalvenen sind schwach

ausgebildet. Die Entwicklung des atrioventrikulären Kanals ist gestört und Teile des

Myokards, das primäre atriale Septum und die aufliegende mesenchymale Kappe, aus der

Anteile des atrioventrikulären Kissens hervorgehen, werden unvollständig oder gar nicht

ausgebildet. Die Deletion von Wnt2 führt zu einer gestörten EMT, die für die Entwicklung der


Ergebnisse 45

Endokardkissen notwendig ist (Tian et al. 2010). Histologisch kann in den Vorhofmyozyten

eine Reduktion von organisierten Z-Banden beobachtet werden. Die Expression des

Kardialen Troponin I ist hier um mehr als 90% vermindert, die des Fibroblast growth factor 10

(Fgf10), von Gata6, Sal-like 1 (Sall1) und Sal-like 3 (Sall3) ist ebenfalls erniedrigt. Fgf10 ist

ein direktes Zielgen des Wnt/-catenin-Signalweges (Cohen et al., 2007). Die Expression

des Fibroblast growth factor 8 (Fgf8) ist erhöht (Tian et al. 2010).

Wnt2 -/- - Mäuse besitzen eine hypoplastische Lunge, in der Blutgefäßdefekte nachgewiesen

werden können. NK2 homeobox 1 (Nkx2.1), der früheste Lungenendodermmarker, wird nicht

exprimiert (Goss et al., 2009).

Expressionsanalyse von Wnt2 in Zellkultur

Die Expression von Wnt2 ist vor allem während der Differenzierung von Zellen in Fetal liver

kinase-1 (Flk1) + - Zellen deutlich erhöht. Flk1 + - Zellen werden als gemeinsame Vorläuferzelle

von Endothel-, Blut- und muralen Zellen angesehen. Flk1 stellt den frühesten molekularen

Marker (Wang et al., 2007) dieser als Hämangioblast bezeichneten Zellen dar (Shalaby et

al., 1995; Shalaby et al., 1997; Eichmann et al., 1997; Nishikawa et al., 1998).

Embroid Bodies (EB) sind Aggregate aus Stammzellen, die in Suspension kultiviert werden.

In ihnen können frühembryonale Entwicklungsschritte zum Teil in vitro nachempfunden

werden und eignen sich daher als Modell für die frühe Entwicklung des Mausembryos.

Wnt2 -/- - EBs bilden eine erhöhte Anzahl an Flk1 + - Zellen und an Kolonie-formenden Zellen

und exprimieren vermehrt Flk1. In älteren EBs sind sowohl die Endothelzell- als auch die

terminale Kardiomyozytendifferenzierung gestört. Gene, die vor allem an der frühen

Differenzierung hämatopoietischer Stammzellen beteiligt sind, werden vermehrt exprimiert.

Die Anzahl hämatopoietischer Vorläuferkolonien ist erhöht (Wang et al., 2007).

4.4.2.2 Embryonale Expressionsanalyse von Wnt2

Expressionsmuster von Wnt2 im Wildtyp-Embryo

Zum Zeitpunkt E7.5 wird Wnt2 im proximo-posterioren Mesoderm und im anterio-proximalen

Mesoderm exprimiert (Abb. 12A,A'). Im distalen embryonalen Bereich zeigt sich eine

Expressionsdomäne im posterioren und lateralen Mesoderm (Abb. 12A). Weder der PS,

noch das embryonale Endoderm oder das Ektoderm exprimieren Wnt2. Im

extraembryonalen Gewebe können wenige Transkripte im Mesoderm, im Chorion und in der

Allantois nachgewiesen werden (Abb. 12A). An E7.75 wird Wnt2 in der halbmondförmigen

frühen Herzanlage und in der Allantois exprimiert (Abb. 12C,C').

Expressionsmuster von Wnt2 in der Eomes-Mutante

In der Eomes-Mutante wird Wnt2 an E7.5 nicht exprimiert (Abb. 12B).


Ergebnisse 46

4.4.2.3 Zusammenfassende Darstellung von Wnt2

Eomes scheint die Expression von Wnt2 positiv zu regulieren. Wird Eomes nicht exprimiert,

ist die Expression von Wnt2 im Embryo um das 2,56-fache reduziert. Dieses Microarray-

Ergebnis lässt sich mit der WISH bestätigen, in der keine Expression von Wnt2 in den

Eomes-Mutanten nachweisbar ist (Abb. 12B). Wnt2 wird ab E7.5 in den kardialen

Vorläuferzellen exprimiert (Monkley et al., 1996, Abb. 12A,A'), die aus dem anterioren PS

hervorgehen und die in den Eomes-Mutanten nicht gebildet werden (Arnold et al., 2008a).

Folglich entstehen in den Eomes-defizienten Embryonen keine Zellen, die Wnt2 exprimieren

könnten.

Zusätzlich wird Wnt2 in mesodermalen, extraembryonalen Geweben exprimiert. Diese Zellen

gehen aus dem posterioren PS hervor, dessen Entstehung in den Mutanten nicht

beeinträchtigt ist. Infolgedessen wäre in den Eomes-Mutanten mit einer Wnt2-Expression im

posterioren PS zu rechnen. In den Eomes-defizienten Embryonen sind jedoch keine Zellen

gefärbt. Die Wnt2-Expression scheint durch Eomes so stark inhibiert zu werden, dass

keinerlei Wnt2-Transkripte mehr nachweisbar sind.

4.4.3 Calpain6 (Capn6)

Wildtyp Eomes-Mutante Wildtyp

wt

mut

Wildtyp

Abbildung 13: Die Expression von Capn6 von E7.5 bis E9.5 in den Wildtyp-Embryonen (A,A’,C-F) und in

der Eomes-Mutante an E7.5 (B,B’). Capn6 wird an E7.5 in den anterioren, mesodermalen Zellen exprimiert

(A,A’,C,C’). Im weiteren Verlauf ist vor allem im Herz eine Expression von Capn6 nachzuweisen (E,E’,F). In den

Eomes-Mutanten wird Capn6 in einigen Zellen des mutanten PS exprimiert (B,B’) (A’,E’ jeweils

Transversalschnitt durch A,E; B’,C’,D’ jeweils Sagittalschnitte durch B,C,D).


Ergebnisse 47

4.4.3.1 Kurzbeschreibung

Funktion von Capn6

Capn6 gehört zur Familie der Kalzium-abhängigen Zystein-Proteasen (Dear et al., 1999). Es

ist ein zytoplasmatisches Protein (Molinari et al., 1997), das kalziumabhängig aktiviert wird

(Dear et al., 1997). Die typischen Calpaine werden ubiquitär exprimiert und beeinflussen die

Migration, die Apoptose, das Zellwachstum und den Zellzyklus. Es wurde als

mikrotubulistabilisierendes Protein identifiziert (Tonami et al., 2007).

Capn6 gehört nicht zu den typischen Calpains, da es als einziges seiner Familie kein aktives

Zentrum besitzt (Tonami et al., 2007). Es übt seine Funktion, ebenso wie Capn5, unabhängig

von Kalzium aus (Dear et al., 1997) und wird durch Endothelin1 (Et-1) positiv reguliert

(Tonami et al., 2007).

In der Literatur beschriebenes Expressionsmuster von Capn6

An E11.5 und E12.5 wird Capn6 in den Somiten, im ersten Bronchialbogen und im

Herzmuskel exprimiert. Weitere Transkripte sind im Mandibularbogen, im sich entwickelnden

Skelettmuskel, im Epithel des vierten Ventrikels, in den Lobärbronchien, in der Lungen- und

Nierenkapsel und in der Chorionplatte der Plazenta zu finden (Dear et al., 1999).

Genetische Deletion von Capn6

Bisher ist keine gerichtete Deletion von Capn6 durchgeführt worden.

Expressionsanalyse von Capn6 in Zellkultur

Durch eine vermehrte Capn6-Expression in Zellkultur kommt es zu einer Verzögerung oder

einem Abbruch der Zellteilung und zur Entstehung multinukleärer Zellen. Es entstehen

stabile Mikrotubuli-Bündel, die verstärkt azetyliertes -Tubulin enthalten und resistent

gegenüber der Depolimerisierungsaktivität des Nocodazols sind (Tonami et al., 2007).

Eine verminderte Expression von Capn6 in Zellkultur führt zu einem Verlust an azetyliertem

-Tubulin. Infolgedessen kommt es zu einer Mikrotubuliinstabilität und zu einer

Neuorganisation des intrazellulären Aktins. Die Zellen beginnen Lamellipodien auszubilden.

4.4.3.2 Embryonale Expressionsanalyse von Capn6

Expressionsmuster von Capn6 im Wildtyp-Embryo

An E7.5 wird Capn6 im embryonalen proximalen anterio-lateralen Mesoderm exprimiert

(Abb. 13A,A'). Im extraembryonalen Bereich können Transkripte im distalen Mesoderm, im

Amnion, in der Allantois und im Chorion nachgewiesen werden (Abb.13A). An E7.75 hat sich

die anteriore, mesodermale Expressionsdomäne auf weiter lateral gelegene Bereiche

ausgeweitet und ist deutlicher sichtbar, wohingegen das bereits beschriebene

Expressionsareal unverändert bleibt (Abb. 13C,C'). An E8.0 ist in der frühen Herzanlage, in


Ergebnisse 48

der Allantois, im Amnion und im Chorion eine verstärkte Expression von Capn6 nachweisbar

(Abb. 13D,D'). An E8.5 wird Capn6 im Herz, in der Allantois, im posterioren Mesoderm und

im Kopfmesoderm exprimiert (Abb. 13 E,E'). Im Herzen sind Transkripte im Bulbus cordis

und im primitiven Ventrikel zu finden (Abb. 13E').

An E9.5 wird Capn6 im zentralen Bereich der Somiten und im Herz exprimiert (Abb. 13F). In

der unteren und oberen Extremitätenanlage sind Transkripte in den randständigen Zellen

nachweisbar (Abb. 13F). Eine schwächere Expression ist im paraxialen Mesoderm und im

posterioren intermediären Mesoderm zu erkennen (keine Abbildung). Weiter kranial wird

Capn6 im lateralen Kopfmesoderm, in den Bronchialbögen und im Darmepithel exprimiert.

Das Darmepithel exprimiert umso mehr Capn6, je weiter kranial es gelegen ist (keine

Abbildung).

Expressionsmuster von Capn6 in der Eomes-Mutante

Capn6 wird an E7.5 vor allem in den proximal gelegenen Zellen des mutanten PS exprimiert

(Abb. 13B). In Mittsagittalschnitten ist zu erkennen, dass die Capn6-exprimierenden Zellen

die Form eines Halbmondes einnehmen, dessen Scheitel am proximalen Pol des PS liegt

(Abb. 13B'). In Zellen des ektoplazentaren Kegels sind ebenfalls Transkripte nachweisbar

(Abb. 13B,B').

4.4.3.3 Zusammenfassende Darstellung von Capn6

Wird Eomes nicht exprimiert, ist die Expression von Capn6 im Embryo um das 2,25-fache

reduziert. In der WISH erscheint die Expression von Capn6 an E7.5 ebenso stark wie in den

Wildtyp-Embryonen. Dies kann mit der Akkumulation Capn6-exprimierender Zellen im

proximalen Bereich des mutanten PS erklärt werden, die die Expressionsdomäne

ausgedehnt erscheinen lässt (Abb. 13A,A',B,B'). Spätestens an E7.75 ist jedoch zu

erkennen, dass das Expressionsareal in den Wildtyp-Embryonen deutlich größer als in den

Eomes-Mutanten ist (Abb. 13C,C'). Capn6 stellt hauptsächlich einen späteren Herzmarker

dar, da es, im Gegensatz zum weiterentwickelten Herz, in den frühen kardialen

Vorläuferzellen weniger stark exprimiert wird (Abb. 13A,A').

Capn6 wird in einem kleinen Areal im mutanten PS exprimiert (Abb. 13B,B'). Warum kommt

es, ähnlich wie bei Wnt2, das ebenfalls ein Herzmarker darstellt, zu keiner vollständigen

Suppression der Capn6-Expression? Bei den gefärbten, proximo-posterior gelegenen Zellen

des mutanten PS handelt es sich wahrscheinlich um mesodermale Zellen, die sich zu

extraembryonalem Mesoderm weiterentwickeln. Ihre Entstehung ist in den Mutanten nicht

gestört, ihre Migrationsfähigkeit ist jedoch beeinträchtigt, so dass sie im PS verbleiben.

Capn6 konnte als mikrotubulistabilisierendes Protein identifiziert werden (Tonami et al.,

2007). Wird Capn6 vermindert exprimiert, sind Zellen dazu fähig Lamellipodien auszubilden.


Ergebnisse 49

Diese sind Zellplasmaausstülpungen, die unter anderem für die Migration benötigt werden.

Die Migrationsfähigkeit der mesodermalen Zellen ist in den Eomes-Mutanten gestört. Da

Capn6 in den Eomes-Mutanten vermindert exprimiert wird und demnach Migrationsvorgänge

gefördert werden, kann die Regulation von Capn6 durch Eomes nicht für dieses

Migrationsdefizit verantwortlich sein.

4.4.4 SwItch/Sucrose NonFermentable (SWI/SNF) related matrix associated

actin dependent regulator of chromatin, subfamily d, member 3 (Smarcd3)

Wildtyp Eomes-Mutante Wildtyp

Wildtyp

Abbildung 14: Die Expression von Smarcd3 in Wildtyp-Embryonen von E7.5 bis E8.5 (A,C-F) und in der

Eomes-Mutante an E7.5 (B,B’). Smarcd3 wird zwischen E7.5 und E7.75 in den mesodermalen kardialen

Progenitorzellen exprimiert (A,C). Von E8.25 bis E8.5 beschränkt sich seine Expression auf die Herzanlage (D-F).

In der Eomes-Mutante wird Smarcd3 in einigen wenigen Zellen des mutanten PS exprimiert (B,B’). (B’

Sagittalschnitt durch B; D’ Transversalschnitt durch D).

4.4.4.1 Kurzbeschreibung

Funktion von Smarcd3

Smarcd3 kodiert für eine 60 kDa große Untereinheit des BRG1/brm-associated factor (BAF) -

Komplexes (Wang et al., 1996), die unter anderem für Umbauvorgängen der

Chromatinstruktur und für die Größenentwicklung des Herzens benötigt wird (de la Serna et

al., 2006; Cai et al., 2003; von Both et al., 2004). Sie bindet ligandenunabhängig an

verschiedene nukleäre Rezeptoren (Debril et al., 2004) und ermöglicht

Transkriptionsfaktoren Zugang zu den genregulierenden Enhancer-Einheiten zu erhalten

(Narlikar et al., 2002; Martens et al., 2003).


Ergebnisse 50

In der Literatur beschriebenes Expressionsmuster von Smarcd3

An E7.5 ist die Smarcd3-Expression auf das sich entwickelnde Herz beschränkt. Von E8.5

bis E9.0 wird es im Herzschlauch und in den Bereichen des Herzens exprimiert, aus denen

anterior der Ausflusstrakt und posterior das Atrium hervorgehen (Lickert et al., 2004). Ab

E9.5 sind zusätzlich Transkripte in den Myotomen der Somiten, im dorsalen Neuralrohr und

im Mesenchym der Extremitätenknospen zu finden (Lickert et al., 2004; Wang et al., 1996;

Debril et al., 2004). In der adulten Maus wird Smarcd3 im zentralen Nervensystem (ZNS)

exprimiert (Debril et al., 2004).

Genetische Deletion von Smarcd3

Bisher ist keine gerichtete Deletion dieses Gens durchgeführt worden, jedoch wurden

embryonale small hairpin RNA (shRNA) - vermittelte Knock-down Ansätze für die

Funktionsanalyse von Smarcd3 durchgeführt (siehe unten) (Lickert et al., 2004).

ShRNA vermittelte Verminderung der Smarcd3-Expression

Mithilfe von shRNA kann die Expression von Smarcd3 im Embryo vermindert werden. Es

kommt zu Störungen der Herzentwicklung, der Herz- und Skelettmuskeldifferenzierung, der

Verschmelzung der Vorderhirnanlagen und der Somitenbildung. Die Embryonen sterben

zwischen E10 und E13 (Lickert et al., 2004).

Expressionsanalyse von Smarcd3 in Zellkultur

Eine vermehrte Expression von Smarcd3 in Zellkultur fördert die Interaktion des BAF-

Komplexes mit kardialen Transkriptionsfaktoren, die somit ihr Zielgene aktivieren (Lickert et

al., 2004).

Eine verminderte Expression von Smarcd3 in Zellkultur führt zu einer unverändert hohen

Expression von Genen, wie Myogenic factor 5 (Myf5), die die Expression von Smarcd3

regulieren. Zielgene von Smarcd3, wie Myocyte enhancer factor 2C (Mef2c), Myogenin oder

Actin, alpha, cardiac muscle 1 (Actc1), werden vermindert exprimiert (Lickert et al., 2004).

4.4.4.2 Embryonale Expressionsanalyse von Smarcd3

Expressionsmuster von Smarcd3 im Wildtyp-Embryo

Zum Zeitpunkt E7.5 wird Smarcd3 im anterio-proximalen Mesoderm, im Amnion und in der

Allantois exprimiert (Abb. 14A). An E7.75 sind Transkripte in dem anterioren, den Kopffalten

von ventral aufliegenden, embryonalen Mesoderm nachzuweisen (Abb. 14C). Diese Zellen

formieren sich zur halbmondförmigen primären Herzanlage. Im Amnion und in der Allantois

wird Smarcd3 weiterhin exprimiert (Abb. 14C). Wenige Zellen des ektoplazentaren Kegels

exprimieren ebenfalls Smarcd3 (Abb. 14C). An E8.25 beschränkt sich das Expressionsareal

auf die Herzanlage und das sie umgebende Mesoderm (Abb. 14D,D'). An E8.5 wird Smarcd3

nur noch im Herz exprimiert (Abb. 14E,F).


Ergebnisse 51

Expressionsmuster von Smarcd3 in der Eomes-Mutante

Smarcd3 wird in mittig gelegenen und an das Coelom angrenzende Zellen des mutanten PS

und im ektoplazentaren Kegel exprimiert (Abb. 14B,B').

4.4.4.3 Zusammenfassende Darstellung von Smarcd3

Wird Eomes nicht exprimiert, ist die Expression von Smarcd3 in den Embryonen um das

1,59-fache reduziert. Eomes scheint Smarcd3, das für Herzentwicklung benötigt wird (Lickert

et al., 2004), positiv zu regulieren, und damit Einfluss auf die kardiale Entwicklung zu

nehmen.

Die Ergebnisse der WISH entsprechen der erwarteten und schon bekannten Expression von

Smarcd3 (Lickert et al., 2004) in den kardialen Vorläuferzellen an E7.5 (Abb. 14A) und im

Herz ab E8.25 (Abb. 14D,D',E,F). In den Eomes-Mutanten ist die Expression von Smarcd3

auf einige wenige Zellen des PS beschränkt (Abb. 14B,B'). Es handelt sich hierbei nicht um

kardiale Vorläuferzellen, sondern am ehesten um Zellen, die sich zum extraembryonalen

Mesoderm weiterentwickeln und deren Entstehung in den Mutanten nicht gestört ist.

4.4.5 Kardiales Troponin T (cTnT/ Tnnt2)

Wildtyp

Abbildung 15: Die Tnnt2-Expression in den Wildtyp-Embryonen von E7.0 bis E9.5 (A-D’’). Die erste

Expression von Tnnt2 ist an E7.5 im anterio-proximalen Mesoderm zu beobachten (A-B’). An E7.75 wird Tnnt2 in

der frühen halbmondförmigen Herzanlage (C), in den 9,5 Tage alten Embryonen, im Herz und in den Somiten

exprimiert (D-D’’). (B’ Sagittalschnitt durch B; D’ Transversalschnitt durch D; D’’ Tangentialschnitt durch D).

4.4.5.1 Kurzbeschreibung

Funktion von Tnnt2

Tnnt2 ist als Bestandteil des Troponin (Tn)-Komplexes an der Regulation der kardialen

Muskelkontraktion beteiligt. Dieser Komplex besteht aus drei verschiedenen Proteinen, dem

Kalzium-bindenden Troponin C (TnC), dem inhibitorischen Troponin I (TnI) und dem

Tropomyosin (Tm)-bindenden Troponin T (TnT). CTnT verankert dabei TnI und TnC an Tm.

Dieser Tn-Komplex erstreckt sich entlang der Aktinfilamente (Ohtsuki et al. 1986).


Ergebnisse 52

In der Literatur beschriebenes Expressionsmuster von Tnnt2

Tnnt2 wird zum ersten Mal an E7.5 im präkardialen Mesoderm exprimiert. An E8.5 sind

Transkripte im entstehenden Myokard und an E10.5 zusätzlich in den Somiten zu finden.

Später wird es zusätzlich im Skelettmuskel und in den glatten Muskelzellen der Harnblase

exprimiert (Wang et al., 2001).

Genetische Deletion von cTnT

CTnT -/- - Mäuse sind nicht lebensfähig und sterben zumeist an E10.0. Die Herzentwicklung ist

gestört, so dass es bis E10.0 nur zu vereinzelten Herzschlägen kommt. Diese reduzierte

Herzaktion kann keine ausreichende Blutzirkulation gewährleisten. Ab E8.75 zeigt sich das

Herzgewebe blasenartig aufgetrieben. Die endokardialen Kissen werden nicht angelegt

(Nishii et al., 2008), die Ventrikelwände sind ausgedünnt, die Schleifenbildung ist gestört und

es sind Perikardergüsse nachweisbar (Ahmad et al., 2008).

Histologisch zeigt sich in den cTnT -/- - Mäusen eine ungerichtete Anordnung der Filamente im

Zytoplasma, die zu einer Beeinträchtigung der Kontraktionsfähigkeit der Kardiomyozyten

führt (Nishii et al., 2008). Die Entwicklung des Membranerregungssystems und das

intrazelluläre Kalzium-Regulationssystem sind nicht gestört (Nishii et al., 2008).

Tnnt2-Heterozygotie

Tnnt2 +/- - Mäuse haben eine normale Lebenserwartung und weisen keine strukturellen oder

funktionalen kardialen Auffälligkeiten auf (Nishii et al., 2008; Ahmad et al., 2008). Sie können

eine dilatative Kardiomyopathie entwickeln, deren Schwere negativ proportional von der

Restmenge des produzierten Tnnt2 abhängt (Ahmad et al., 2008).

4.4.5.2 Embryonale Expressionsanalyse von Tnnt2 im Wildtyp-Embryo

In den 7,0 Tage alten Embryonen wird kein Tnnt2 exprimiert (Abb. 15A). Ab E7.5 sind

Transkripte im embryonalen anterio-proximalen Mesoderm nachweisbar (Abb. 15B,B'). An

E7.75 wird Tnnt2 in der halbmondförmigen Herzanlage exprimiert (Abb. 15C). An E9.5 sind

Transkripte im Herzen und in den Zentren der Somiten zu finden (Abb. 15D,D',D'').

4.4.5.3 Zusammenfassende Darstellung von Tnnt2

Tnnt2 ist aus der Literatur als Herzmarker bekannt und wird für die Herzentwicklung benötigt.

(Nishii et al., 2008; Ahmad et al., 2008). Das bereits beschriebene Expressionsmuster

konnte mit der in dieser Arbeit durchgeführten WISH nachvollzogen werden.


Ergebnisse 53

4.4.6 Zytoplasmatisches Retinolsäure-bindendes Protein 1 (Crabp1)

Wildtyp Eomes-Mutante Wildtyp

Wildtyp

Abbildung 16: Die Expression von Crabp1 in den Wildtyp-Embryonen von E7.5 bis E9.5 (A-E’) und in der

Eomes-Mutante an E7.5 (B). An E7.5 wird Crabp1 in proximal gelegenen mesodermalen Zellen exprimiert

(A,A’). An E8.0 sind Transkripte im embryonalen Mesoderm und in den Neuralfalten nachweisbar (C,C’). An E8.5

zeigt sich ein Expressionsmuster im Oberflächenektoderm der Kopffalten, des anterioren Neuralrohrs und des

paraxialen Mesoderms (C,D). An E9.5 wird Crabp1 im Oberflächenektoderm des Telenzephalons, des ersten und

zweiten Bronchialbogens, der Ohranlage, des Stammes und im paraxialen Mesoderm exprimiert (E,E’). In den

Eomes-Mutanten exprimieren einige Zellen des mutanten PS Crabp1 (B). (A’,E’ jeweils Sagittalschnitte durch

A,E; C’ Transversalschnitt durch C).

4.4.6.1 Kurzbeschreibung

Funktion von Crabp1

Retinolsäure ist Ligand der zytoplasmatischen Retinolsäure-bindenden Proteine 1 und 2

(Crabp1 und Crabp2) und bindet mit hoher Affinität an ihren Rezeptor (Morriss-Kay et al.,

1993; Ong et al., 1984; Ong et al., 1982; Lane et al., 2008). Retinolsäure gehört zur Familie

der Retinoide, die in ihrer Struktur dem Vitamin A (Retinol) sehr ähnlich sind. Retinol ist an

der Zelldifferenzierung während der Embryonalentwicklung, dem Sehvorgang und der

Reproduktion beteiligt (Lane et al., 2008).

Bindet Retinolsäure an einen Crabp, kommt es zur Verminderung der freien

Retinolsäurekonzentration. Die Zelle wird dadurch vor deren differenzierungsfördernden

Effekt geschützt (Lane et al., 2008). Im Zellkern kann Retinolsäure mit dem Retinolsäure-

Rezeptor (RAR) interagieren und die Transkription verschiedener Gene aktivieren (Lane et

al., 2008).

In der Literatur beschriebenes Expressionsmuster von Crabp1

Ab E9.5 wird Crabp1 im Kleinhirn exprimiert. In der weiteren Entwicklung kommen


Ergebnisse 54

Expressionsareale im Bulbus olfactorius, im Striatum, im Hippocampus und im Neokortex

hinzu (Parenti et al., 2004).

Genetische Deletion von Crabp1

Crabp1 -/- - Mäuse sind lebensfähig, zeigen keine Auffälligkeiten in ihrer Entwicklung und

haben eine normale Lebenserwartung. Das Fehlen von Crabp1 wird nicht durch eine

vermehrte Expression von Crabp2 kompensiert (Gorry et al., 1994).

4.4.6.2 Embryonale Expressionsanalyse von Crabp1

Expressionsmuster von Crabp1 im Wildtyp-Embryo

An E7.5 wird Crabp1 im proximalen embryonalen Mesoderm und in der Allantois exprimiert

(Abb. 16A,A'). An E8.0 sind Transkripte in den Neuralfalten, in Teilen des posterioren und

distalen Ektoderms, im embryonalen Mesoderm, einschließlich des Kopfmesoderms, in der

Allantois und im Amnion zu finden (Abb. 16C,C'). Zum Zeitpunkt E8.5 ist eine Expression

von Crabp1 im Oberflächenektoderm der Kopffalten und im anterioren Neuralrohr zu

beobachten (Abb. 16D). Das paraxiale Mesoderm exprimiert ebenfalls Crabp1 (Abb. 16D).

An E9.5 bleibt die Expression im paraxialen Mesoderm erhalten (Abb. 16E). Im

Oberflächenektoderm des Telenzephalons, des ersten und zweiten Bronchialbogens, der

Ohranlage, des Stammes und der Schwanzspitze ist eine Crabp1-Expression ebenfalls

nachweisbar (Abb. 16E,E'). Im Herz wird Crabp1 nicht exprimiert (Abb. 16E,E').

Expressionsmuster von Crabp1 in der Eomes-Mutante

Es ist eine dezente Crabp1-Expression in den proximo-posterioren Zellen des mutanten PS

zu erkennen (Abb. 16B).

4.4.6.3 Zusammenfassende Darstellung von Crabp1

Wird Eomes nicht exprimiert, ist die Expression von Crabp1 im Embryo um das 2,87-fache

reduziert. Die WISH bestätigt dieses Ergebnis, da in den Eomes-Mutanten nur eine

schwache Crabp1-Expression nachweisbar ist (Abb. 16B). Bei den hier gefärbten Zellen

handelt es sich wahrscheinlich um mesodermale, migrationsgehemmte Zellen, die

normalerweise die mesodermalen Strukturen bilden, die in den Wildtyp-Embryonen Crabp1

exprimieren (Abb. 16A,A'). In der weiteren embryonalen Entwicklung wird Crabp1 vor allem

in neuronalen Strukturen exprimiert.

Crabp1 hat einen differenzierungshemmenden Effekt (Lane et al., 2008). Da es in den

Eomes-Mutanten vermindert exprimiert wird, müsste die Differenzierung von Zellen in den

Eomes-defizienten Embryonen gefördert werden.


Ergebnisse 55

4.4.7 Platelet-derived growth factor receptor A (Pdgfr

Wildtyp

Eomes-Mutante

Abbildung 17: Die Expression von Pdgfr im Wildtyp-Embryo (A,A’) und in der Eomes-Mutante (B) an

E7.5. Pdgfr wird im Wildtyp-Embryo an E7.5 im embryonalen Mesoderm exprimiert (A,A’). In den Eomes-

Mutanten ist seine Expression in Zellen des mutanten PS nachweisbar (B). (A’ Transversalschnitt durch A).

4.4.7.1 Kurzbeschreibung

Funktion von Pdgfr

Pdgfrist eine Tyrosinkinase, die den Platelet-derived growth factor (Pdgf) als Ligand besitzt

(Seifert et al., 1989). Pdgfs sind an der Regulation des Zellwachstums, der Zellerhaltung, der

Zellmigration, der Vaskulogenese und an Zellstrukturveränderungen beteiligt (Review

Claesson-Welsh, 1994; Kazlauskas, 1994). Sie fördern die Zellproliferation während der

Embryonalentwicklung und in der adulten Maus (Ross et al., 1986).

Die Aktivierung des Pdgfr führt unter anderem zur Aktivierung weiterer Signalmoleküle wie

der Ras (Rat sarcoma)/ Mitogen-activated protein (Map)-Kinasen, der Inositoltrisphosphat

(Pi 3 ) Kinase/ Protein Kinase B (Akt) und des Phospholipase C (Plc)/ Proteinkinase C (Pkc)-

Signalwegs (Olson et al., 2009).

In der Literatur beschriebenes Expressionsmuster von Pdgfr

An E6.5 wird Pdgfr im viszeralen extraembryonalen Endoderm exprimiert. Nach der

Gastrulation sind Transkripte in mesodermalen Derivaten wie den Somiten, den

Extremitätenknospen und den Bronchialbögen zu finden (Orr-Urtreger et al., 1992; Orr-

Urtreger und Lonai et al., 1992; Schatteman et al., 1992).

Genetische Deletion von Pdgfr

Pdgfr -/- - Mäuse sind nicht lebensfähig und sterben spätestens an E16.0. Ab E8.0 sind

Defekte in der Neuralrohrentwicklung nachweisbar. Zum Zeitpunkt E8.5 kommt es zu

Störungen der embryonalen Drehung und 25% der Embryonen sind zu diesem Zeitpunkt in

ihrem Größenwachstum retardiert. Sie weisen subepidermale, blutgefüllte Blasen in der

Region des Kopfes und entlang des Neuralrohrs auf. Das Perikard ist dilatiert und es kommt

zu Störungen der Blutgefäßentwicklung des Dottersacks. An E13.0 sterben die ersten

Embryonen aufgrund von intrazerebralen und entlang der Wirbelsäule auftretenden

Hämorrhagien. Bei den überlebenden Embryonen sind zwischen E13.0 und E15.0


Ergebnisse 56

Fehlbildungen des Skelettsystems nachweisbar (Soriano, 1997).

Gewebespezifische Deletion von Pdgfr

Die Deletion von Pdgfr in Zellen der Neuralleiste führt zu kraniofazialen

Entwicklungsdefekten und zu einer fehlerhaften Entwicklung des Aortenbogens (Tallquist et

al., 2003).

4.4.7.2 Embryonale Expressionsanalyse von Pdgfr

Expressionsmuster von Pdgfrim Wildtyp-Embryo

An E7.5 zeigt sich eine Expressionsdomäne von Pdgfr im gesamten embryonalen

Mesoderm mit Ausnahme der anterio-distalen Region (Abb. 17A,A'). Weder im Ektoderm

noch im DE ist eine Expression von Pdgfr nachweisbar (Abb. 17A'). Im extraembryonalen

Gewebe exprimieren die Allantois und das an sie angrenzende laterale Mesoderm Pdgfr

(Abb. 17A').

Expressionsmuster von Pdgfrin der Eomes-Mutante

Die posterior gelegenen Zellen des proximalen und intermediären mutanten PS exprimieren

Pdgfr (Abb. 17B). Weiter medial liegende Zellen weisen nur eine schwache Färbung auf

(keine Abbildung). Im extraembryonalen VE sind ebenfalls Transkripte zu finden (Abb. 17B).

4.4.7.3 Zusammenfassende Darstellung von Pdgfr

Wird Eomes nicht exprimiert, ist die Pdgfr-Expression im Embryo um das 2,7-fache

reduziert. Pdgfrwird im embryonalen Gewebe ausschließlich im Mesoderm exprimiert (Abb.

17A,A'). Bei den gefärbten Zellen des mutanten PS handelt es sich am ehesten um Zellen,

die sich zum extraembryonalen Mesoderm und zum Seitenplattenmesoderm entwickeln und

aufgrund ihres Migrationsdefektes nicht auswandern können (Abb. 17B).

Aus dem Mesoderm gehen unter anderem das Bindegewebe, die Blutgefäße und die

Knochen hervor. Diese Gewebe weisen in den Pdgfr-deletierten Embryonen

Entwicklungsdefekte auf (Soriano, 1997). Interessanterweise ist die Entwicklung des

Neuralrohrs, das aus dem Ektoderm hervorgeht und das zum Zeitpunkt E7.5 kein

Pdgfrexprimiert, in diesen Embryonen ebenfalls gestört. Eine mögliche Ursache könnte in

einer gestörten Signalinteraktion zwischen Mesoderm und Ektoderm liegen, so dass die

fehlerhafte Entwicklung des Mesoderms die Fehlbildungen des Neuralrohrs begünstigt.


Ergebnisse 57

4.4.8 Ets variant gene 2 (Etsrp71/ ER71)

Wildtyp Eomes-Mutante Wildtyp

Abbildung 18: Die Etsrp71-Expression im Wildtyp-Embryo von E7.5 bis E7.75 (A,A’,C-C’’) und in der

Eomes-Mutante an E7.5 (B). Etsrp71 wird an E7.5 im proximal gelegenen Mesoderm und im PS exprimiert

(A,A’). An E7.75 sind Transkripte im Kopfmesoderm, im posterio-lateralen Mesoderm und im proximo-lateralen

Mesoderm, das an den Dottersack grenzt (C’,C’’), und in den ersten sich bildenden Blutinseln (C’,C’’)

nachweisbar. In der Eomes-Mutante wird Etsrp71 in einigen Zellen des mutanten PS exprimiert (B). (A’,C’ jeweils

Transversalschnitt durch A,C).

4.4.8.1 Kurzbeschreibung

Funktion von Etsrp71

Etsrp71 gehört zur Familie der E-twenty six (Ets)-Transkriptionsfaktoren und ist den anderen

Mitgliedern seiner Familie nur in seiner DNA-Bindestelle, der Ets-Domäne, gleich (Brown et

al., 1992; de Haro et al., 2005). Etsrp71 ist zu dem Gen Etsrp homolog, das im Zebrafisch an

der Regulation der Blutzellentwicklung beteiligt ist (Sumanas et al., 2008).

Etsrp71 wurde als Zielgen des Homedomain Proteins NK2 transcription factor related, locus

5 (Nkx2-5) identifiziert. Nkx2-5 bindet an ein evolutionär erhaltenes Nkx2-5 response

Element im Etsrp71-Promotor und induziert damit die Transkription von Etsrp71. Dieser

Vorgang ist sowohl in vivo als auch in vitro nachweisbar (Ferdous et al., 2009). Nkx2-5 ist

einer der ersten Transkriptionsfaktoren, der im embryonalen Herzen exprimiert wird (Lyons

et al., 1995). Während der kardialen Entwicklung wird Nkx2-5 in den multipotenten

Progenitorzellen exprimiert (Kattmann et al., 2006; Wu et al., 2006; Moretti et al., 2006).

Etsrp71 wird durch Bmp-, Notch- und Wnt-Signalwege reguliert (Lee et al., 2008). Eine

Inhibition dieser Signalwege führt zu einer verminderten Expression von Etsrp71 und zu

einer verminderten Bildung von Flk1 + -Mesoderm. Flk1 ist ein Regulator der Vaskulogenese

und der Hämatopoiese (Carmeliet et al.,1996; Ferrara et al., 1996), besitzt eine Ets-

Bindestelle und kann somti durch Etsrp71 reguliert werden (Kappel et al., 2000; Elvert et al.,

2003).

In der Literatur beschriebenes Expressionsmuster von Etsrp71

Zum Zeitpunkt E7.5 ist die Expression von Etsrp71 auf den PS, das embryonale Mesoderm,

das Amnion, die Allantois und die Blutinseln des Dottersacks beschränkt (Lee et al., 2008).

Von E7.75 bis E9.5 sind Transkripte vorübergehend im Endokard/ Endothel zu finden, bevor

es ab E11.5 nicht mehr exprimiert wird (Ferdous et al., 2009).


Ergebnisse 58

Ein etwas davon abweichendes Expressionsmuster wurde von Lee et al. beschrieben. Hier

wurde zwischen E8.25 und E9.5 eine Expression von Etsrp71 im Herzen, in den großen

Blutgefäßen (dorsale Aorta) und in den Bronchialbögen nachgewiesen (Lee et al., 2008). In

adulten Mäusen wird Etsrp71 in den Hoden exprimiert (Brown et al., 1992).

Genetische Deletion von Etsrp71

Etsrp -/- - Mäuse sind nicht lebensfähig und sterben zwischen E9.0 und E10.5 (Ferdous et al.,

2009) aufgrund von schweren Blut-, Gefäß- und Endokarddefekten (Lee et al., 2008).

Ab E9.0 finden weder die Ausbildung der Blutinseln im Dottersack, noch die Bildung des

Endokards oder die Formierung der dorsalen Aorta statt (Lee et al., 2008). Die Angioblasten

differenzieren sich nicht aus, ihre Migrationsfähigkeit ist gestört und vaskuläre Marker

werden nicht exprimiert (Sumanas et al., 2008). Gene, die für die Herzentwicklung benötigt

werden, werden hingegen vermehrt exprimiert (Lee et al., 2008).

Flk1 wird in den Etsrp -/- - Mäuse an E7.5 weder im PS, noch in den Blutinseln, in der Allantois

oder im Amnion exprimiert, wo es zu diesem Zeitpunkt normalerweise nachweisbar ist. Auch

in der späteren Entwicklung ist die Flk1-Expression deutlich vermindert. Phänotypisch sind

sich Etsrp -/- - Embryonen und Flk1 -/- - Embryonen sehr ähnlich (Lee et al., 2008).

Etsrp71-Heterozygotie

Etsrp71-heterozygote Mäuse sind lebensfähig, fertil und phänotypisch nicht von ihren

homozygoten Geschwistern zu unterscheiden (Lee et al., 2008).

Expressionsanalyse von Etsrp71 in embryonalen Stammzellen (ES)

Die Expression von Etsrp71 in ES-Zellen beginnt gleichzeitig mit der Expression von

Brachyury (Kattmann et al., 2006) und geht der frühesten Expression von Flk1 voraus. Sie ist

vier Tage nach der Differenzierung der ES-Zellen nicht mehr nachweisbar (Lee et al., 2008).

Eine vermehrte Expression von Etsrp-RNA in ES-Zellen induziert die Expression von

vaskulären Endothelmarkern, wie Platelet/endothelial cell adhesion molecule 1 (Pecam1),

Tie2, Cadherin 5 und Hämangioblastmarkern, wie GATA binding protein 1 (Gata1), GATA

binding protein 2 (Gata2), T cell acute lymphocytic leukemia 1 (Scl), und kann zur Bildung

von ektopen Knochenmarkszellen führen (Sumanas et al., 2008; Lee et al., 2008). Es kommt

zu einer vermehrten Bildung von Flk1-produzierendem Mesoderm. Weder Brachyury, ein

früher Mesodermmarker, noch Foxa2, ein Endodermmarker, oder Eurogenic differentiation 1

(NeuroD), ein Ektodermmarker, sind in ihrer Expression verändert (Lee et al., 2008).

Expressionsanalyse von Etsrp71 in Zellkultur

Wird Etsrp in Zellkultur vermindert exprimiert, werden keine Knochenmarkszellen

ausgebildet. Etsrp71 beeinflusst ihre Bildung über Scl, einem Transkriptionsfaktor und

Regulator der Knochenmarks-, Erythrozyten- und Gefäßentwicklung (Sumanas et al., 2008).


Ergebnisse 59

4.4.8.2 Embryonale Expressionsanalyse von Etsrp71

Expressionsmuster von Etsrp71 im Wildtyp-Embryo

An E7.5 wird Etsrp71 im lateralen posterio-proximalen Mesoderm und im proximalen PS

exprimiert (Abb. 18A,A'). Im Gegensatz zur rechtslateralen mesodermalen

Expressionsdomäne breitet sich die linkslaterale bis in den anterioren Bereich aus (Abb.

18A'). Im extraembryonalen Gewebe wird Etsrp71 in der Allantois und im Mesoderm

exprimiert (Abb. 18A). An E7.75 ist ein gepunktetes Expressionsmuster vor allem im

proximalen Kopfmesoderm und im proximo-posterio-lateralen Mesoderm detektierbar (Abb.

18C,C'). Im extraembryonalen Gewebe exprimieren die Allantois und das extraembryonale

Mesoderm weiterhin Etsrp71 (Abb. 18C).

Expressionsmuster von Etspr71 in der Eomes-Mutante

Zum Zeitpunkt E7.5 exprimiert die Eomes-Mutante kein Etsrp71 (Abb. 18B).

4.4.8.3 Zusammenfassende Darstellung von Etsrp71

Wird Eomes nicht exprimiert, ist die Expression von Etsrp71 im Embryo um das 3,46-fache

reduziert. Etsrp71 scheint durch Eomes positiv reguliert zu werden. Etsrp71 wird

hauptsächlich im Mesoderm exprimiert (Abb. 18A,A'), das in den Mutanten nicht regelrecht

gebildet wird. In der WISH ist keine Etsrp71-Expression in den Eomes-Mutanten

nachweisbar, das die Ergebnisse des Microarrays bestätigt (Abb. 18B).

Etsrp71 ist ein Transkriptionsfaktor, der für die Entwicklung der Blutinseln benötigt wird, aus

denen die primitiven Blutgefäße hervorgehen (Lee et al., 2008). Die Entstehung der

Blutgefäße wird durch Etsrp71, das seinerseits die Expression von Flk1 reguliert, gefördert

(Kappel et al., 2000). Die Entwicklung des Herzens wird durch Etsrp71 hingegen gehemmt

(Lee et al., 2008). Im anterioren Mesoderm fördert Eomes die Differenzierung zu kardialem

Gewebe. Es ist möglich, dass Eomes die Expression von Etsrp71 in anderen Zellen aktiviert,

um dort deren Differenzierung zu kardialen Zellen zu inhibieren.


Ergebnisse 60

4.4.9 Ras guanyl releasing protein3 (Rasgrp3)

Wildtyp

Eomes-Mutante

Wildtyp

Abbildung 19: Die Expression von Rasgrp3 in den Wildtyp-Embryonen von E7.0 bis E9.5 (A-B’,D-E’’’) und

in der Eomes-Mutante an E7.5 (C,C’). Von E7.0 bis E7.5 wird Rasgrp3 im Mesoderm und im PS exprimiert (A-

B’). An E7.75, wenn die Kopffalten sichtbar werden, findet sich vor allem eine Expression im posterio-lateralen

Mesoderm (D,D’). An E9.5 zeigt sich ein sehr spezifisches Expressionsmuster in den Blutgefäßen des Kopfes

und des Stamms (E-E’’’). In der Eomes-Mutante wird Rasgrp3 in proximal gelegenen Zellen des mutanten PS

exprimiert (C,C’). (B’, C’, D’ jeweils Transversalschnitt durch B,C,D).

4.4.9.1 Kurzbeschreibung

Funktion von Rasgrp3

Rasgrp3 ist ein Mitglied der Rat sarcoma (Ras)-Aktivatoren-Familie und ist an der Regulation

von intrazellulären Signaltransduktionsvorgängen beteiligt (Coughlin et al., 2005).

Die Mitglieder der RAS guanyl releasing protein 1 (Rasgrp)-Familie bestehen aus vier

konservierten Domänen, von denen eine mit dem membrangebundenen Diacylglycerol

(DAG) interagiert. Dieses entsteht durch Hydrolysierung von Phosphatidylinositol-4,5-

bisphosphat (PIP 2 ) durch die Phospholipase c-y (PLC-y). PLC-y ist eine Zielstruktur von

Tyrosinkinasen, wie dem Vascular Endothelial growth factor receptor (Vegfr), der bei der

Entstehung von Blutgefäßen benötigt wird (Takahashi et al., 1997; Roberts et al., 2004).

Endotheliales Rasgrp3 ist ein Zielgen von Vegf (Roberts et al., 2004).

Rasgrp3 gehört zu den Guanin-Nukleotid-Austauschfaktoren (GEFs), die die Reaktion von

RasGDP zu RasGTP katalysieren. Rasgrps aktivieren Ras und weitere kleine GTPasen

(Roberts et al., 2004). Die Aktivierung von Ras führt zur Stimulation verschiedener

intrazellulärer Signalkaskaden, wie des RasGRP-Ras-Raf-Midkine (Mek)- Extracellular-signal

Regulated Kinase 1 (Erk)-Signalwegs, deren Zielproteine an der Zellproliferation, der

Differenzierung und an der Apoptose beteiligt sind (Strasser et al., 2005; Willis et al., 2005;

Hughes et al., 2006; Stang et al., 2009). In vitro kann die Aktivierung von Ras einen


Ergebnisse 61

angiogenetischen Phänotyp in Endothelzellen hervorrufen (Meadows et al. 2001) und die

Bildung von Blutgefäßen stimulieren (Roberts et al., 2004).

In der Literatur beschriebenes Expressionsmuster von Rasgrp3

Zwischen E9.5 und E10.5 wird Rasgrp3 in den intersomitischen Blutgefäßen, in den

kranialen Blutgefäßen und in der dorsalen Aorta exprimiert. Im Perikard, im Myotom der

Somiten, in den Kardinalvenen und im perineuralen Gefäßplexus des Rückenmarks sind

ebenfalls Transkripte nachweisbar. In der adulten Maus wird Rasgrp3 im Gehirn, in der Milz

und in den Glomeruli der Niere exprimiert. In adulten Blutgefäßen wird es nicht mehr

vermehrt exprimiert. Nur während der Schwangerschaft und der Tumorgenese wird es in neu

entstehenden Blutgefäßen exprimiert (Roberts et al., 2004).

Genetische Deletion von Rasgrp3

Rasgrp3 -/- - Mäuse sind lebensfähig und weisen keine Defekte der Blutgefäßentstehung

(Roberts et al., 2004), jedoch der Entwicklung des Immunsystems auf (Coughlin et al., 2005).

Die Tumorrate ist erhöht (Roberts et al., 2004). Son-of-Sevenless (Sos), ein Protein, das mit

Rasgrp3 an der Signaltransduktion über den Ras/ Mitogen-activated protein (Map)-Kinase-

Signalweg beteiligt ist, kann den Ausfall von Rasgrp3 teilweise kompensieren (Oh-hora et al.,

2003).

4.4.9.2 Embryonale Expressionsanalyse von Rasgrp3

Expressionsmuster von Rasgrp3 im Wildtyp-Embryo

An E7.0 wird Rasgrp3 in den lateralen posterio-proximalen Mesodermzellen und in der

Allantois exprimiert (Abb. 19A). An E7.5 sind nicht nur Transkripte im proximalen, sondern

ebenfalls im distalen, lateralen Mesoderm nachweisbar (Abb. 19B,B'). Weiter proximal weitet

sich die Expression auf die gesamte Zirkumferenz und auf den PS aus, wobei der anteriore

Pol ausgespart bleibt (Abb. 19B,B'). Im extraembryonalen Gewebe exprimieren die Allantois

und das distale Mesoderm Rasgrp3 (Abb. 19B). An E7.75 wird Rasgrp3 im distalen und im

lateralen Mesoderm exprimiert (Abb. 19D,D'). Obwohl die mesodermale Färbung mit dem

Auftreten der Kopffalten im anterioren Bereich abnimmt, bleibt eine dezente, punktförmige

Expression im Kopfmesoderm bestehen (Abb. 19D'). Proximal beschränkt sich das

Expressionsareal auf das posterio-laterale Mesoderm und den PS (keine Abbildung). Im

extraembryonalen Bereich exprimieren das anteriore Mesoderm und die Allantois Rasgrp3

(Abb. 19D). An E9.5 wird Rasgrp3 in den intersomitischen und in den kranialen Blutgefäßen

exprimiert (Abb. 19E,E',E'',E''').

Expressionsmuster von Rasgrp3 in der Eomes-Mutante

An E7.5 exprimieren vor allem die posterio-distalen und die posterio-proximalen Zellen des

mutanten PS Rasgrp3 (Abb. 19C,C'). Im mittleren Abschnitt des PS sind in mittig gelegenen


Ergebnisse 62

Zellen ebenfalls Transkripte nachweisbar (Abb. 19C').

4.4.9.3 Zusammenfassende Darstellung von Rasgrp3

Wird Eomes nicht exprimiert, ist die Expression von Rasgrp3 im Embryo um das 3,18-fache

reduziert. Rasgrp3 wird durch Eomes positiv reguliert.

Bei den Rasgrp3-exprimierenden Zellen des mutanten PS handelt es sich am ehesten um

Zellen, aus denen das laterale, das paraxiale und das extraembryonale Mesoderm

hervorgehen. Diese werden in den Eomes-Mutanten gebildet, weisen jedoch einen

Migrationsdefekt auf, der sie daran hindert in ihr Zielgewebe auszuwandern (Abb. 19C).

Rasgrp3 ist als Blutgefäßmarker bekannt (Roberts et al., 2004) und ein Zielgen von Vegf,

einem Wachstumsfaktor, der ebenfalls an der Vaskulogenese beteiligt ist (Carmeliet et al.,

1996). Rasgrp3 scheint jedoch nicht essentiell für die Entwicklung des Embryos zu sein, da

Mäuse, in denen Rasgrp3 deletiert wurde, lebensfähig sind (Roberts et al., 2004).

Die frühembryonale Rasgrp3-Expression ist bisher noch nicht untersucht worden. Es ist

anzunehmen, dass es sich bei den Rasgrp3-exprimierenden, mesodermalen Zellen um

vaskuläre Progenitorzellen handelt, deren Expression in den Eomes-Mutanten deutlich

reduziert ist (Abb. B,B',C,C'). Die Blutgefäßentwicklung scheint von Eomes positiv reguliert

zu werden.

4.4.10 Forkhead (winged helix) box-Transkriptionsfaktor 1a (Foxf1a)

Wildtyp

Eomes-Mutante

Abbildung 20: Die Expression von Foxf1a im Wildtyp-Embryo (A,A’) und in der Eomes-Mutante (B,B’) zum

Zeitpunkt E7.5. Foxf1a wird im proximalen Mesoderm und im PS exprimiert (A,A’). In der Eomes-Mutante sind

vor allem in den proximal gelegenen Zellen des mutanten PS Transkripte zu finden (B,B’). (A’ Transversalschnitt

durch A; B’ Sagittalschnitt durch B).

4.4.10.1 Kurzbeschreibung

Funktion von Foxf1a

Foxf1a ist ein Mitglied der Familie der Forkhead (winged helix) box-Transkriptionsfaktoren

(Clark et al., 1993; Lai et al., 1993), die die Transkription von Genen, die an der


Ergebnisse 63

Zellproliferation (Garry et al., 1997), der Zelldifferenzierung (Baxter et al., 2002), der

metabolischen Homöostase (Kaestner et al., 2000) und der Tumorentwicklung (Barr et al.,

2001) beteiligt sind, regulieren. Foxf1a ist ein Regulator der Vaskulogenese (Mahlapuu et al.,

2001b). Der Foxf1a-Promotor enthält hochaffine Bindestellen für die Transkriptionsfaktoren

Forkhead box protein A (FoxA), One cut domain, family member 1 (Hnf-6), CCAAT

enhancer-binding protein β (C/EBP), Nkx2.5 und Gata (Kim et al., 2005).

In der Literatur beschriebenes Expressionsmuster von Foxf1a

Zum Zeitpunkt E6.5 wird Foxf1a im extraembryonalen Mesoderm, in der Allantoisanlage und

im lateralen Mesoderm exprimiert (Mahlapuu et al., 2001b; Peterson et al., 1997). An E7.0 ist

eine zusätzliche Expressionsdomäne im posterioren PS nachweisbar (Peterson et al., 1997).

An E8.5 wird Foxf1a weiterhin im posterioren PS, im Seitenplattenmesoderm und im

extraembryonalen Mesoderm der Allantois, des Amnions und des Dottersacks exprimiert

(Mahlapuu et al., 2001b; Peterson et al., 1997). Ab E8.5 sind Transkripte im mesodermalen

Anteil der Splanchnopleura zu finden (Mahlapuu et al., 2001b) Im Septum transversum, dem

Vorläufer des Diaphragmas, wird Foxf1a ebenfalls exprimiert (Lim et al., 2002). Das Foxf1aexprimierende

Mesoderm der Splanchnopleura wird für die mesenchymal-epitheliale

Induktion des Darms, und der vom Darm abstammenden Organe wie die Leber, die

Gallenblase, die Lunge und der Magen, benötigt (Peterson et al., 1997; Mahlapuu et al.,

1998; Kalinichenko et al., 2002). An E9.0 wird Foxf1a im Mesenchym, das das anteriore

Darmrohr umgibt, im Notochord und im ventralen Teil des Neuralrohrs, hier vor allem in der

Bodenplatte, exprimiert (Sato et al., 2008). An E9.5 sind weiterhin Transkripte im das

Darmrohr umgebenden viszeralen Mesoderm zu finden (Lim et al., 2002). Hinzu kommen

Expressionsareale in den großen Blutgefäßen des Dottersacks, in den Sklerotomen und in

den umbilikalen Gefäßen (Mahlapuu et al., 2001b).

In der weiteren Entwicklung wird Foxf1a unter anderem im ZNS, im Darmrohr, in der

Lungenknospe (Sato et al., 2008), im Magen (Sato et al., 2008; Lim et al., 2002), in der

Leberkapsel (Mahlapuu et al., 1998; Mahlapuu et al., 2001b), in arteriellen Blutgefäßen (Lim

et al., 2002), in den Sternzellen der Leber, in der Gallenblase (Malin et al., 2007) und bei

Schwangerschaft in der Plazenta exprimiert (Pierrou et al., 1994).

Genetische Deletion von Foxf1a

Foxf1a -/- - Embryonen sind nicht lebensfähig und sterben aufgrund von mesodermalen

Differenzierungs- und Zelladhäsionsdefekten um E10.0 (Mahlapuu et al., 2001b).

Das Amnion manifestiert sich als festes, starres Gewebe, das den Embryo einschnürt und

ihn an E8.5 an seiner Drehung hindert. Es kommt zu Deformationen des Kopfes und zu

Entwicklungsverzögerungen im posterioren Bereich des Embryos (Mahlapuu et al., 2001b),

die unter anderem durch eine lokal verminderte Bmp4-Expression hervorgerufen werden.

Auch im Seitenplattenmesoderm und im Dottersack wird Bmp4 vermindert exprimiert


Ergebnisse 64

(Mahlapuu et al., 2001b; Astorga et al., 2007). Die Blutgefäßentwicklung (Peterson et al.,

1997; Astorga et al., 2007) und die mesodermale Proliferation im PS sind gestört, und die

Somitenbildung ist verzögert. Der Mitteldarm wird nicht angelegt (Mahlapuu et al., 2001b).

In der Allantois kommt es zu Zelladhäsionsdefekten aufgrund einer erhöhten Expression des

Vascular cell adhesion molecule (Vcam1) (Gurtner et al., 1995; Kwee et al., 1995; Yang et

al., 1995; Mahlapuu et al., 2001b) und seines Liganden 4-Integrin (Elices et al., 1990) und

folglich zu Entwicklungsstörungen der chorioallantoischen Platte. Weitere

Zelladhäsionsdefekte treten zwischen viszeralem und somatischem Mesoderm auf, wo es zu

einer Fehlregulation von Iroquois related homeobox (Irx), kommt (Mahlapuu et al., 2001b).

Im Dottersack und in der Allantois ist die Expression von Flk1, das für die Entwicklung der

Blutgefäße benötigt wird, und von Genen, die die Hämatopoiese regulieren, vermindert.

Gefäßplexusse werden unter anderem aufgrund von intramesodermalen Adhäsionsdefekten

nicht gebildet. Vascular endothelial growth factor (Vegf), ein Regulator der

Blutgefäßentwicklung, Pecam1, ein Oberflächenmarker von Endothelzellen und Vascular

smooth muscle -actin (Actvs), ein Marker für glatte Muskulatur von Blutgefäßen werden

jedoch normal exprimiert.

Foxf1a-Heterozygotie

Foxf1a +/- - Mäuse weisen bei der Geburt Entwicklungsdefekte im Mesenchym der Lunge, der

Gallenblase, des Ösophagus und der Trachea auf (Mahlapuu et al., 2001a). Innerhalb der

ersten sechs Wochen sterben 55 % der Neugeborenen zumeist aufgrund von alveolären

Hämorrhagien. Die restlichen Mäuse haben eine normale Lebenserwartung, die proportional

zu der verbleibenden Foxf1a-Expression ist (Kalinichenko et al., 2001).

Expressionsanalyse von Foxf1a in Zellkultur

Foxf1a bindet an den Promotor von Integrin-3 (Itg3), das somit ein direktes Zielgen von

Foxf1a darstellt (Malin et al., 2007).

4.4.10.2 Embryonale Expressionsanalyse von Foxf1a

Expressionsmuster von Foxf1a im Wildtyp-Embryo

An E7.5 wird Foxf1a im proximo-posterio-lateralen Mesoderm und im PS exprimiert (Abb.

20A,A'). Im extraembryonalen Gewebe sind Transkripte im distalen Mesoderm, in der

Allantois, im Dottersack, im Amnion und im Chorion nachweisbar (Abb. 20A).

Expressionsmuster von Foxf1a in der Eomes-Mutante

Zum Zeitpunkt E7.5 wird Foxf1a vor allem in den proximo-posterioren Zellen und in den

posterioren Zellen des intermediären mutanten PS exprimiert (Abb. 20B,B'). In den zum

Coelom hin gelegenen Zellen des Epiblast sind ebenfalls Transkripte nachweisbar (Abb.

20B,B').


Ergebnisse 65

4.4.10.3 Zusammenfassende Darstellung von Foxf1a

Wird Eomes nicht exprimiert, ist die Expression von Foxf1a im Embryo um das 2,6-fache

reduziert. Foxf1a scheint von Eomes positiv reguliert zu werden.

Das Expressionsmuster von Foxf1a ist aus der Literatur weitestgehend bekannt und konnte

mit der hier durchgeführten WISH nachvollzogen werden. Foxf1a ist ein Marker des

Mesoderm und des PS (Abb. 20A,A'). Diese Zellen werden in den Eomes-Mutanten gebildet,

sind jedoch migrationsgestört, so dass eine Expression von Foxf1a in den akkumulierenden

Zellen des PS nachweisbar sind (Abb. 20B,B').

Foxf1a wird für die Entstehung der Blutgefäße benötigt (Mahlapuu et al., 2001), die aus dem

Mesoderm hervorgehen. Der VEGF-Rezeptor Flk1 wird in den Foxf1a-defizienten

Embryonen vermindert exprimiert. Flk1 ist ein wichtiger Regulator der Vaskulogenese und

der Hämatopoiese (Carmeliet et al., 1996; Ferrara et al., 1996) und wird durch Etsrp71

reguliert (Kappel et al., 2000; Elvert et al., 2003). Eomes ist Mitregulator der Vaskulogenese,

indem es unter anderem die Expression von Foxf1a und Etsrp71 aktiviert.

Foxf1a aktiviert die Expression von Itg3, einem Rezeptor für extrazelluläre Matrix-Proteine

wie beispielsweise Fibronektin, Vitronektin, Thrombospondin oder Kollagen (Hynes et al.,

2002; Ruegg et al., 2004). In den Eomes-Mutanten wird weniger Foxf1a und folglich weniger

Itg3 exprimiert, das für die Migration benötigt wird (Hynes et al., 1992). Die reduzierte Itg3-

Expression könnte für den Migrationsdefekt der mesodermalen Zellen in den Eomes-

Mutanten mitverantwortlich sein.

4.4.11 V-set and transmembrane domain containing 2B (Vstm2b)

Wildtyp Eomes-Mutante Wildtyp

Abbildung 21: Die Expression von Vstm2b im Wildtyp-Embryo von E7.5 bis E8.5 (A,A’,C,D,D’) und in der

Eomes-Mutante an E7.5 (C). Vstm2b wird vor allem im proximalen Mesoderm und Ektoderm exprimiert (A,A’).

An E7.75 ist eine Expression im lateralen Mesoderm, in den anterioren Kopffalten und im posterioren Ektoderm

und Mesoderm zu finden (C). An E8.5 wird Vstm2b im ventralen Neuralrohr und in einem Teil des Mesoderms

unterhalb des posterioren Darmrohrs exprimiert (D,D’). Die Eomes-Mutante exprimiert kein Vstm2b (B). (A’

Transversalschnitt durch A; D’ Frontalschnitt durch D).


Ergebnisse 66

4.4.11.1 Kurzbeschreibung

Funktion von Vstm2b

Über Vstm2b ist bisher nichts bekannt.

4.4.11.2 Embryonale Expressionsanalyse von Vstm2b

Expressionsmuster von Vstm2b im Wildtyp-Embryo

Zum Zeitpunkt E7.5 wird Vstm2b im proximalen embryonalen Ektoderm exprimiert (Abb.

21A). Die Expression weist ein punktförmiges Muster auf (Abb. 21A'). Im Bereich des

embryonalen-extraembryonalen Übergangs exprimieren zusätzlich das Mesoderm und der

PS Vstm2b (Abb. 21A,A'). Im Mesoderm ist die Expression auf zwei kleine Areale rechtsund

linkslateral des PS beschränkt (keine Abbildung). Die Expressionsstärke nimmt im

proximalen Bereich des Embryos zu. Im extraembryonalen Gewebe sind Transkripte im

Mesoderm und in der Allantois zu finden (Abb. 21A). An E7.75 wird Vstm2b im lateralen

Mesoderm und im anterio-lateralen und posterioren Ektoderm, aus dem die Kopffalten

hervorgehen, exprimiert (Abb. 21C). In Mittsagittalschnitten konnte gezeigt werden, dass sich

die Expression hier auf das posteriore, proximale Mesoderm, die Allantois und das anteriore

Ektoderm der Kopffalten beschränkt (keine Abbildung). Weitere Transkripte sind im Amnion

und im extraembryonalen Mesoderm zu finden (Abb. 21C). An E8.5 exprimieren das ventrale

Neuralrohr und ein kleiner Teil des lateralen Mesoderms unterhalb des posterioren

Darmrohrs Vstm2b (Abb. 21D,D').

Expressionsmuster von Vstm2b in der Eomes-Mutante

In der Eomes-Mutante wird Vstm2b zum Zeitpunkt E7.5 nicht exprimiert (Abb. 21B).

4.4.11.3 Zusammenfassende Darstellung von Vstm2b

Wird Eomes nicht exprimiert, ist die Vstm2b-Expression im Embryo um das 2,88-fache

reduziert. In der WISH zeigt sich in den Mutanten keinerlei Expression von Vstm2b (Abb.

21B). Bisher wurde noch keine Expressionsanalyse von Vstm2b durchgeführt. Auch über

seine Funktion ist bisher nichts bekannt. Es könnte an der neuronalen Entwicklung beteiligt

sein, da es in den älteren Embryonen verstärkt im Neuralrohr exprimiert wird (Abb. 21D,D').


Ergebnisse 67

4.4.12 Pleckstrin homology-like domain family A member 2 (Phlda2)

Wildtyp

Eomes-Mutante

Abbildung 22: Die Expression von Phlda2 in den Wildtyp-Embryonen von E7.0 bis E7.5 (A-B’) und in der

Eomes-Mutante an E7.5 (C,C’). Phlda2 wird an E7.0 im proximalen Mesoderm und im PS exprimiert (A). Bis

E7.5 hat sich die Expression bis zum distalen Pol des Embryos ausgebreitet (B). Nur im anterioren und im

anterio-lateralen embryonalen Gewebe ist keine Phlda2-Expression nachweisbar (B,B’). In der Eomes-Mutante

wird Phlda2 im proximalen Epiblast und in den proximal gelegenen Zellen des mutanten PS exprimiert (C,C’). (B’

Transversalschnitt durch B; C’ Sagittalschnitt durch C).

4.4.12.1 Kurzbeschreibung

Funktion von Phlda2

Phlda2 kodiert für ein 16 kDa großes zytoplasmatisches Protein, das eine pleckstrinhomologe

(PH)-like Domäne besitzt, die aus 120 Aminosäuren besteht (Shaw et al., 1996;

Frank et al., 2002). Sie kann an zelluläre Phosphoinositide, vor allem an

Phosphatidylinositolphosphat (PIP), binden (Saxena et al., 2002). Die PH-Domäne ist in

Proteinen zu finden, die an der Regulation von intrazellulären Signaltransduktionsprozessen,

von intrazellulären vesikulären Transportvorgängen und an der Zytoskelettorganisation

beteiligt sind (Frank et al., 2002; Dunwoodie et al., 2002).

In der Literatur beschriebenes Expressionsmuster von Phlda2

An E5.5 wird Phlda2 im extraembryonalen Ektoderm und in den Vorläuferzellen der

Spongiotrophoblastzellen des ektoplazentaren Kegels exprimiert (Cross et al., 2000;

Dunwoodie et al., 2002). Ab E6.5 sind Transkripte in den posterior gelegenen Zellen des PS

nachweisbar (Dunwoodie et al., 2002). An E7.5 wird Phlda2 zusätzlich im proximalen

Mesoderm exprimiert. Im weiteren Verlauf beschränkt sich die Expression auf das laterale

viszerale und auf das somatische Mesoderm. Im extraembryonalen Geweben wird Phlda2 im

Mesoderm, Endoderm und Ektoderm und in den mesodermalen Komponenten des Amnions,

des Chorions, des Dottersacks und der Allantois exprimiert (Dunwoodie et al., 2002).

Zwischen E7.5 und E8.0 beschränkt sich die Phlda2-Expression auf den posterioren PS, das

frühe Herzmesoderm und die ventrolateralen Zellen des PK (Dunwoodie et al., 2002).

Zwischen E8.0 und E8.5 wird Phlda2 im Dottersackendoderm, im Seitenplattenmesoderm

und im ventralen DE exprimiert (Hou et al., 2007). Ab E8.5 sind Transkripte im Perikard und

im Oberflächenektoderm nachweisbar (Dunwoodie et al., 2002). In der weiteren Entwicklung

wird Phlda2 in den Trophoblastzellen der Plazenta exprimiert (Frank et al., 2002).


Ergebnisse 68

Genetische Deletion von Phlda2

Phlda2 -/- - Mäuse sind lebensfähig und fertil. Während ihrer Entwicklung ist ab E12.5 eine

vergrößerte Plazenta nachweisbar. Die Mäuse können ein vermindertes Größenwachstum

aufweisen (Frank et al., 2002).

4.4.12.2 Embryonale Expressionsanalyse von Phlda2

Expressionsmuster von Phlda2 im Wildtyp-Embryo

Zum Zeitpunkt E7.0 wird Phlda2 im embryonalen proximo-lateralen Mesoderm exprimiert

(Abb. 22A). In der Nähe des embryonalen-extraembryonalen Übergangs weitet sich die

Expression auf den PS aus (keine Abbildung). Im extraembryonalen Gewebe ist eine

Expression im Mesoderm, in der Allantois, im Chorion, im Dottersack und im ektoplazentaren

Kegel zu erkennen (Abb. 22 A). An E7.5 weitet sich die mesodermale Expression nach distal

aus (Abb. 22B). Im proximalen Bereich wird Phlda2 in der gesamten Zirkumferenz des

Mesoderms exprimiert (Abb. 22B). In der distalen Region sind Transkripte in den posterioren

und lateralen mesodermalen Zellen zu finden (Abb. 22B,B'). Der anterio-distale Bereich

bleibt von der Phlda2-Expression ausgespart (Abb. 22B,B'). In dieser Region befindet sich im

darüberliegenden Endoderm das AVE. Am Übergang der embryonalen zu den

extraembryonalen Geweben wird Phlda2 im posterio-lateralen Ektoderm und in der

posterioren Region des PS exprimiert (keine Abbildung). Im extraembryonalen Gewebe ist

eine Expression weiterhin im extraembryonalen Mesoderm, in der Allantois, im Chorion, im

Dottersack, im ektoplazentaren Kegel und zusätzlich im Amnion zu finden (Abb. 22B).

Expressionsmuster von Phlda2 in der Eomes-Mutante

An E7.5 wird Phlda2 im proximalen Epiblast, in den proximalen Zellen des mutanten PS und

im extraembryonalen Ektoderm exprimiert (Abb. 22C,C'). Im PS sind vor allem im proximalen

Bereich Transkripte nachweisbar (Abb. 22C,C').

4.4.12.3 Zusammenfassende Darstellung von Phlda2

Das Expressionsmuster von Phlda2 ist bereits aus der Literatur bekannt (Dunwoodie et al.,

2002) und konnte mit der in dieser Arbeit durchgeführten WISH nachvollzogen werden (Abb.

22). Phlda2 wird von Eomes positiv reguliert. Wird Eomes nicht exprimiert, ist die Expression

von Phlda2 im Embryo um das 8,12-fache reduziert und ist damit nach Mesp1 das am

stärksten vermindert exprimierte Gen im Microarray der Embryonen. Trotzdem kann eine

Expression von Phlda2 in den Eomes-Mutanten nachgewiesen werden (Abb. 22C,C'). Bei

den gefärbten Zellen des mutanten PS scheint es sich um mesodermale Zellen zu handeln,

die sich zu extraembryonalem Mesoderm weiterentwickeln und deren Entstehung in den


Ergebnisse 69

Eomes-Mutanten nicht beeinträchtigt ist.

Für die Phlda2-Expression im Ektoderm scheint die Eomes-Deletion keine zentrale Rolle zu

spielen. Diese Zellen entstammen dem Epiblast, der in den Eomes-Mutanten ebenfalls

Phlda2 exprimiert. Bei den gefärbten Zellen des mutanten PS handelt es sich am ehesten

um Zellen, die sich zu extraembryonalem Mesoderm entwickeln und deren Entstehung in

den Eomes-Mutanten nicht beeinträchtigt ist. Da die extraembryonalen Gewebe von der

Eomes-Deletion nicht betroffen sind, sind hier keine Expressionsunterschiede zwischen

Wildtyp- und Eomes-defizienten Embryonen zu erwarten und auch nicht nachweisbar.

Phlda2 wird in Zellen des ektoplazentaren Kegels exprimiert, aus dem die Plazenta

hervorgeht und die bei einer Phlda2-Deletion Entwicklungsdefekte aufweist (Frank et al.,

2002).

Phlda2 wird in den Wildtyp-Embryonen in Zellen der frühen Herzanlage exprimiert

(Dunwoodie et al., 2002). Die kardialen Progenitorzellen entstehen im anterioren PS, der in

den Mutanten jedoch nicht gebildet wird.

4.4.13 Forkhead box C1 (Foxc1)

Wildtyp Eomes-Mutante Wildtyp

wt

mut

Abbildung 23: Die Expression von Foxc1 in den Wildtyp-Embryonen von E7.5 bis E8.0 (A,A’,C,D) und in

der Eomes-Mutante an E7.5 (B,B’). Foxc1 wird im distal gelegenen Mesoderm, Ektoderm und im PS exprimiert

(A,A’). An E7.75 ist eine Expressionsdomäne in den Kopffalten und im posterioren Mesoderm nachweisbar (C).

An E8.0 bleibt das Expressionsmuster weitgehend unverändert (D). In der Eomes-Mutante wird Foxc1 in Zellen

des mutanten PS exprimiert (B,B’). (A’,B’ jeweils Transversalschnitte durch A,B).

4.4.13.1 Kurzbeschreibung

Funktion von Foxc1

Foxc1 gehört zur Familie der Forkhead/winged-Transkriptionsfaktoren (Kaestner et al., 1993)

und ist an der Regulation der Osteoblastendifferenzierung (Rice et al., 2005), der

Kartilagogenese, des Wundverschlusses und der Entwicklung des hämatopoietischen,

gonadalen und nervalen Systems beteiligt (Ara et al., 2003; Ara et al., 2005; Ma et al., 1998;

Nagasawa et al., 1996; Tachibana et al., 1998; Zou et al., 1998). Zusammen mit Forkhead

box C2 (Foxc2) wird er zur Kontrolle der Angiogenese benötigt (Hayashi et al., 2008; Kume


Ergebnisse 70

et. al., 2001; Seo und Fujita et al., 2006).

Regulation von Signalwegen durch Foxc1

Foxc1 und Foxc2, zwei nah verwandte Fox-Transkriptionsfaktoren, können die Expression

von Chemokine (C-X-C motif) receptor 4 (Cxcr4), dem Rezeptor von Chemokine (C-X-C

motif) ligand 12 (Cxcl12), direkt induzieren. Cxcl12 wird für die chemotaktische Zellmigration

der Endothelzellen benötigt (Hayashi et al., 2008). In Arterien reguliert Vegf die Expression

von Foxc1 und Cxcr4 (Hayashi et al., 2008; Seo und Fujita et al., 2006). Während der

Angiogenese regulieren Foxc1 und Foxc2 die Expression von Notch und von Delta-like 4

(Dll4), dem Liganden von Notch (Seo und Fujita et al., 2006).

In der Literatur beschriebenes Expressionsmuster von Foxc1

Zum Zeitpunkt E6.5 wird Foxc1 lateral des PS exprimiert. An E7.5 ist eine Expression im

paraxialen Mesoderm und in den endothelialen und mesenchymalen Zellen der

entstehenden Blutgefäße zu finden (Sasaki et al., 1993; Hayashi et al., 2008). An E7.75 wird

Foxc1 im Endothel des zweiten Herzfeldes, im Proepikardium, im endokardialen Kissen und

im Ektomesenchym exprimiert (Kume et al., 1998; Seo und Kume et al., 2006). Das

Ektomesenchym und das endokardiale Kissen gehen aus den Neuralleistenzellen hervor

(Gitler et al., 2003). An E8.5 sind Transkripte im präsomitischen Mesoderm, im

Kopfmesoderm und in den kranialen Neuralleistenzellen des ersten Bronchialbogens zu

finden. Ab E9.5 wird Foxc1 in den Somiten und später in verschiedenen Knochen exprimiert

(Kume et al., 1998; Rice et al., 2003). Ab E10.5 sind unter anderem Transkripte im

Mesenterium des Dickdarms, in den Somazellen der Keimleiste, im Wolffschen und im

Müllerschen Gang, in der submandibulären Drüse, im periokulären Mesenchym und in der

Kornea nachweisbar (Kume et al., 1998, Rice et al., 2003).

Genetische Deletion von Foxc1

Foxc1 -/- - Mäuse sterben bei der Geburt aufgrund von multiplen skelettalen Fehlbildungen, die

durch eine Störung der desmalen und der chondralen Ossifikation hervorgerufen werden

(Kume et al., 1998; Hong et al., 1999; Kume et al., 2000). Ab E11.5 kommt es, aufgrund von

Entwicklungsdefekten zerebraler Blutgefäße, zur Ausbildung eines hämorrhagischen

Hydrozephalus (Kume et al., 1998). Weitere kardiovaskuläre Entwicklungsdefekte, wie die

Unterbrechung des Aortenbogens, Ventrikelseptumdefekte oder Aorten- und

Pulmonalklappendefekte sind ebenfalls nachweisbar (Kidson et al., 1999; Kume et al., 2001).

Die Differenzierung der meningealen Arachnoidzellen, die Augenentwicklung (Kume et al.,

1998) und die Entwicklung des Urogenitalsystems sind ebenfalls gestört (Mattiske et al.,

2006). Die Keimzellen weisen Migrationsdefekte auf, so dass sie, anstatt in die Gonaden

auszuwandern, im Dickdarm verbleiben (Mattiske et al., 2006).

Genetische Doppel-Deletion von Foxc1 und Foxc2

Eine Doppel-Deletion von Foxc1 und Foxc2 führt zu arteriovenösen, kardialen und


Ergebnisse 71

lymphatischen Fehlbildungen (Seo und Kume et al., 2006; Seo und Fujita et al., 2006).

Arterielle Marker werden vermindert, venöse Marker, wie Nuclear receptor subfamily 2,

group F, member 2 (Coup-TfII) werden hingegen unverändert exprimiert (Seo und Fujita et

al., 2006). Die Neuralleistenzellen weisen während der Migration eine erhöhte Apoptoserate

auf (Seo und Kume et al., 2006).

Expressionsanalyse von Foxc1 in Zellkultur

Eine gesteigerte Expression von Foxc1 in embryonalen Endothelzellen in vitro führt zu einer

vermehrten Expression von arteriellen Markern wie Dll4, Notch1, Notch4, EphrinB2 und

Hairy/enhancer-of-split related with YRPW motif 2 (Hey2). Venöse Marker, wie Coup-TfII und

Eph receptor B4 (EphB4), weisen keine Veränderungen ihrer Expression auf (Seo und Fujita

et al., 2006). Die Expression von Cxcr4 ist um das 3,5-fache erhöht (Hayashi et al., 2008).

Eine verminderte Expression von Foxc1 führt zu einer reduzierten Expression von Cxcr4 und

nach Zugabe von Cxcl12, zu einer gestörten Zellmigration in vitro (Hayashi et al., 2008).

4.4.13.2 Embryonale Expressionsanalyse von Foxc1

Expressionsmuster von Foxc1 im Wildtyp-Embryo

An E7.5 wird Foxc1 im embryonalen Mesoderm exprimiert (Abb. 23A,A'). Im distalen Bereich

nimmt die Expression beinahe die gesamte Zirkumferenz, mit Aussparung des anterioren

Pols, ein (Abb. 23A'). In der proximalen Region wird Foxc1 am posterioren Pol zusätzlich im

Ektoderm und im PS exprimiert (keine Abbildung). Am Übergang vom embryonalen zum

extraembryonalen Gewebe kommt es zu einer verminderten Expression im lateralen

Mesoderm und im unterliegenden Ektoderm (Abb. 23A). Im extraembryonalen Gewebe wird

Foxc1 im Mesoderm und in der Allantois exprimiert (Abb. 23A). An E7.75 und an E8.0 sind

Transkripte im Kopfmesoderm und im posterioren Mesoderm nachweisbar (Abb. 23C,D).

Expressionsmuster von Foxc1 in der Eomes-Mutante

An E7.5 wird Foxc1 im proximalen PS exprimiert (Abb. 23B). Es können Transkripte in den

posterior und mittig gelegenen Zellen nachgewiesen werden (Abb. 23B'). Am Übergang vom

embryonalen zum extraembryonalen Gewebe beschränkt sich das Expressionsareal auf die

posterioren Zellen des mutanten PS (Abb. 23B').

4.4.13.3 Zusammenfassende Darstellung von Foxc1

Wird Eomes nicht exprimiert, ist die Expression von Foxc1 im Embryo um das 2,26-fache

reduziert. Foxc1 wird durch Eomes positiv reguliert. Das Expressionsmuster ist bereits aus

der Literatur bekannt und kann mit der in dieser Arbeit durchgeführten WISH nachvollzogen

werden (Abb. 23).


Ergebnisse 72

Die Expression von Foxc1 beschränkt sich auf das weiter distal gelegene embryonale

Mesoderm. Aus dem Mesoderm gehen das Knochen- und das Knorpelgewebe hervor, für

deren Entwicklung Foxc1 benötigt wird (Kume et al., 1998; Hong et al., 1999; Kume et al.,

2000; Eswarakumar et al., 2002). Die Bildung des Ektoderms, das aus dem Epiblast

entsteht, ist in den Eomes-Mutanten nicht gestört. Demnach sollte in den Mutanten ein

ektodermales Expressionsmuster nachweisbar sein. In den Eomes-Mutanten wird Foxc1

jedoch nicht im Ektoderm exprimiert (Abb. 23B,B'), was wahrscheinlich auf die fehlende

Aktivierung der Foxc1-Expression durch Eomes zurückzuführen ist.

Im mutanten PS exprimieren die posterioren, proximalen und intermediären Zellen Foxc1

(Abb. 23B,B'). Es handelt sich wahrscheinlich um migrationsgestörte Zellen, aus denen das

extraembryonale Mesoderm hervorgeht, das in den Eomes-defizienten Embryonen keine

Entwicklungsdefekte aufweist.

Cxcr4 ist an der Regulation der Angiogenese und an der chemotaktischen Migration von

Endothelzellen beteiligt. Seine Expression wird durch Foxc1 direkt induziert (Hayashi et al.,

2008). In den Eomes-Mutanten werden Foxc1, und folglich Cxcr4, vermindert exprimiert. Die

Fehlregulation von Cxcr4 könnte zu der mesodermalen Migrationsstörung in den Eomes-

Mutanten beitragen. Über Foxc1, das für die Entwicklung der arteriellen Blutgefäße benötigt

wird (Seo und Fujita et al., 2006), und demnach über Cxcr4, könnte Eomes Einfluss auf die

Angiogenese nehmen.

4.4.14 Uridin Phosphorylase1 (Upp1)

Wildtyp

Eomes-Mutante

wt

mut

Wildtyp

Abbildung 24: Die Expression von Upp1 von E7.0 bis E9.5 in den Wildtyp-Embryonen (A-B’,D-F) und in


Ergebnisse 73

der Eomes-Mutante an E7.5 (C,C’). An E7.0 wird Upp1 vor allem in den extraembryonalen Geweben exprimiert.

Im embryonalen Teil finden sich Transkripte im posterio-distalen Ektoderm und Mesoderm (A). An E7.5 ist die

Expression in der extraembryonalen Region unverändert (B). Im embryonalen Bereich kommt es zu einer

dezenten Expression im anterio-distalen und anterio–proximalen Mesoderm und zu einer Expression im posteriodistalen

Ektoderm und im posterio–proximalen Mesoderm (B,B’). An E8.0 und E8.5 wird Upp1 in den anterioren

Kopffalten, im anterio-distalen Mesoderm und in einem kleinen, distal gelegenen Teil der Herzanlage exprimiert.

Die vordere Darmtasche (Foregut-pocket) exprimiert ebenfalls Upp1 (D-E, D’: Pfeil). Im 9.5 Tage alten Embryo

ist eine Expression in der Ohranlage und in einem kleinen Bereich des zerebralen Ektoderms nachweisbar (F).

Die Eomes-Mutante weist eine deutliche Expression im mutanten PS, im extraembryonalen Ektoderm und im

ektoplazentaren Kegel auf (C,C’). (B’,C’ jeweils Transversalschnitte durch B,C; D’ Sagittalschnitt durch D).

4.4.14.1 Kurzbeschreibung

Funktion von Upp1

Upp1 ist ein Enzym des Pyrimidin-Nukleotidmetabolismus, das die reversible Reaktion von

Pyrimidin(deoxy)ribosid zu einer Pyrimidinbase und (Deoxy)ribose-1-phosphat katalysiert.

Upp1 kann Uridin, ein Nukleosid und Ausgangsstoff im Pyrimidinstoffwechsel (Shambaugh et

al., 1979) zu Uracil, und Thymidin zu Thymin spalten (el Kouni et al., 1993). Erythrozyten, die

Leber und die Nieren stellen Pyrimidine her, die über den „salvage pathway“ im Blutplasma

zu anderen Geweben transportiert werden und deren Versorgung mit Pyrimidinen

gewährleisten (Traut et al., 1996).

In der Literatur beschriebenes Expressionsmuster von Upp1

Bisher wurde das embryonale Expressionsmuster von Upp1 nicht untersucht.

Genetische Deletion von Upp1

Upp1 -/- - Mäuse sind lebensfähig und überleben bis zu 2 Jahre nach ihrer Geburt, weisen

jedoch einen gestörten Nukleotidmetabolismus auf. Im Blutplasma sind erhöhte Thymidinund

Uridinkonzentration nachweisbar (Haraguchi et al., 2002). Die Uridinkonzentrationen in

der Lunge, im Darm, in der Leber, in der Niere und im Urin sind ebenfalls erhöht. Die

Uridinhalbwertszeit ist verlängert (Cao et al., 2005).

Genetische Doppel-Deletion von Upp1 und Thymidine phosphorylase (Tp)

Upp1 -/- /Tp -/- - Mäuse sind lebensfähig, fertil und überleben bis zu 16 Monaten postnatal. Fünf

Wochen nach Geburt ist die Thymidinkonzentration im Blutplasma deutlich erhöht

(Haraguchi et al., 2002), ab dem fünften Lebensmonat kommt es zur Ausbildung einer

Kyphose der Wirbelsäule (Lopez et al., 2009). Sie weisen Entwicklungsdefekte der

Myelinscheiden auf (Haraguchi et al., 2002) und tragen ein erhöhtes Risiko einer

Leukenzephalopathie. Im Alter von 14 bis 18 Monaten sind Defekte in den

Atmungskettenkomplexen I und IV nachweisbar (Lopez et al., 2009).

4.4.14.2 Embryonale Expressionsanalyse von Upp1

Expressionsmuster von Upp1 im Wildtyp-Embryo

An E7.0 wird Upp1 im embryonalen posterioren Mesoderm und Ektoderm exprimiert (Abb.


Ergebnisse 74

24A). Am Übergang vom embryonalen zum extraembryonalen Gewebe beschränkt sich die

Expression auf das embryonale Ektoderm (keine Abbildung). Im extraembryonalen

Mesoderm und im ektoplazentaren Kegel sind ebenfalls Transkripte nachweisbar (Abb. 24A).

An E7.5 Tag wird Upp1 dezent in je einem kleinen Areal im anterio-distalen Mesoderm, im

posterio-distalen Ektoderm, im proximo-posterioren Mesoderm und im proximo-anterioren

und lateralen Mesoderm exprimiert (Ausschnitte: Abb. 24B,B') Im extraembryonalen Bereich

exprimieren das Mesoderm, das Chorion und der ektoplazentare Kegel Upp1 (Abb. 24B). An

E8.0 und an E8.5 wird Upp1 im anterioren Ektoderm der Kopffalten, im anterio-distalen

Mesoderm und in einem kleinen distal gelegenen Anteil der Herzanlage exprimiert (Abb.

24D,D',E). Im extraembryonalen Gewebe bleibt die Expression im Chorion und im

ektoplazentaren Kegel an E8.0 bestehen, eine weitere Domäne ist in der Allantois

detektierbar (Abb. 24D). Es sind Transkripte im distalen und im apikalen Teil des

entstehenden Darmrohrs (Foregut-Pocket) nachweisbar (Abb. 24E). An E9.5 wird Upp1 in

der Ohranlage und in einem kleinen Areal des entstehenden Gehirns exprimiert (Abb. 24F).

Der Embryo weist zu diesem Zeitpunkt eine eher unspezifische Färbung auf (Abb. 24F).

Expressionsmuster von Upp1 in der Eomes-Mutante

Zum Zeitpunkt E7.5 exprimieren sowohl Zellen des mutanten PS als auch das

extraembryonale Ektoderm und der ektoplazentare Kegel Upp1 (Abb. 24 C,C'). Im

proximalen PS wird Upp1 im gesamten Querschnitt exprimiert (Abb. 24 C,C'), wohingegen im

distalen Bereich vor allem die posterior gelegenen Zellen Upp1 exprimieren (Abb. 24C).

4.4.14.3 Zusammenfassende Darstellung von Upp1

Wird Eomes nicht exprimiert, ist die Expression von Upp1 im Embryo um das 2,8-fache

reduziert. Die Expression von Upp1 wird durch Eomes positiv reguliert. Erstaunlicherweise

zeigt sich in der WISH eine vermehrte Upp1-Expression in den Eomes-Mutanten (Abb.

24C,C').

Da die extraembryonalen Gewebe von der Eomes-Deletion nicht betroffen sind,

unterscheidet sich das Expressionsmuster zwischen den Wildtyp- und den Eomesdefizienten

Embryonen in diesen Geweben nicht.

Die ektodermalen Zellen, die in den Wildtyp-Embryonen Upp1 exprimieren, weisen in den

Mutanten keine Expression auf. Der Eomes-Mangel und die folglich verminderte Aktivierung

der Upp1-Expression scheinen die Transkription in diesem Gewebe zum Erliegen zu

bringen. Bei den proximal-gelegenen, Upp1-exprimierenden Zellen des mutanten PS handelt

es sich am ehesten um Zellen des extraembryonalen Mesoderms, deren Entstehung in den

Eomes-Mutanten nicht gestört ist und die in den Wildtyp-Embryonen eine starke Expression

von Upp1 aufweisen. An E8.0 wird Upp1 spezifisch im apikalen Teil des entstehenden


Ergebnisse 75

Darmrohrs, der Foregut-Pocket, exprimiert, die sich zum Rachenboden entwickelt (Abb.

24D': Pfeil,E).

Eine Deletion von Upp1 ist mit dem Leben vereinbar. Obwohl Upp1 im ektoplazentaren

Kegel, aus dem die Plazenta hervorgeht, vermehrt exprimiert wird, weist diese keine

Entwicklungsdefekte in den Upp1 -/- - Mutanten auf (Haraguchi et al., 2002). Die Funktion von

Upp1 scheint entweder nicht überlebensnotwendig für den Organismus zu sein, oder kann

durch ein anderes Enzym kompensiert zu werden.

4.4.15 Leucine-rich repeat G protein-coupled receptor 5 (Lgr5/ GPR4)

Wildtyp Eomes-Mutante Wildtyp

Wildtyp

Abbildung 25: Die Expression von Lgr5 von E7.5 bis E9.5 in den Wildtyp-Embryonen (A,A’,C-E’’) und in

der Eomes-Mutante an E7.5 (B). Lgr5 wird an E7.5 in einem eng umschriebenen Areal im anterioren Mesoderm

und am Übergang des embryonalen zum extraembryonalen Gewebe im posterio-lateralen Mesoderm und

Ektoderm exprimiert (A,A’). Im extraembryonalen Gewebe sind Transkripte im anterioren Mesoderm, im Chorion

und in der Allantois nachweisbar (A,A’). An E7.75 wird Lgr5 im anterioren Kopfmesoderm, im ihm aufliegenden

Ektoderm und im posterio-lateralen Mesoderm und Ektoderm exprimiert. Im extraembryonalen Bereich ist eine

Expression im posterioren Dottersack, in der Allantois, im Amnion und in einem Teil des Chorions nachweisbar

(C,C’). An E8.0 ist Lgr5 weiterhin in den Kopffalten, im posterioren und im distalen Mesoderm sowie im Chorion

nachweisbar (D). An E9.5 wird Lgr5 im distalen Neuralrohr, im Prosenzephalon, in den Augenbläschen und in der

Ohranlage exprimiert (E-E’’). Im distal gelegenen lateralen Mesoderm, im Kopfmesoderm und im posterioren,

intermediären Mesoderm ist eine Expressionsdomäne von Lgr5 nachweisbar (E-E’’). In den Darmepithelzellen

und in der Notochord wird es ebenfalls exprimiert (E-E’’). In den Eomes-Mutanten wird Lgr5 an E7.5 in einem

kleinen Areal im posterioren extraembryonalen Gewebe exprimiert (B). (A’ Transversalschnitt durch A; C’

Sagittalschnitt durch C; E’ Koronarschnitt durch E).

4.4.15.1 Kurzbeschreibung

Funktion von Lgr5

Lgr5 ist den Rezeptoren der Glykoprotein Hormonrezeptor Familie strukturell sehr ähnlich


Ergebnisse 76

(Hsu et al., 1998), zu der die Gonadotropin- und die Thyreoidea-stimulierendes Hormon

(TSH)-Rezeptoren gehören (Hsu et al., 2000; Hsu et al., 1998). Die Liganden von Lgr5 sind

bislang unbekannt (Morita et al., 2004).

In der Literatur beschriebenes Expressionsmuster von Lgr5

Das Expressionsmuster von Lgr5 ist in der frühen embryonalen Entwicklung bisher noch

nicht untersucht worden. Ab E11.5 wird es in der Mandibularspalte, in der Zunge (Morita et

al., 2004), im Darmeptihel (Garcia et al., 2009), im Magen, im Kolon und in der Haut

exprimiert (Barker et al., 2007). In adulten Mäusen sind Transkripte im Darm, in den

Haarfollikeln, im Auge, im Gehirn, in der Brustdrüse, in den reproduktiven Organen und im

Magen zu finden (Shackelton et al., 2006).

Im Darm, in der Brustdrüse (Barker et al., 2007), in den Schneidezähnen (Suomalainen et

al., 2010) und in Haaren (Jaks et al., 2008) konnte Lgr5 als Stammzellmarker identifiziert

werden. Es scheint sich bei Lgr5 um einen allgemeinen Stammzellmarker zu handeln

(Barker et al., 2007).

Genetische Deletion von Lgr5

Die Deletion von Lgr5 führt innerhalb der ersten 24 Stunden nach der Geburt zum Tod. Die

Neugeborenen weisen ein Ankyloglosson auf, das sie an einer Nahrungsaufnahme hindert

(Morita et al., 2004) und ein Verschlucken von Luft begünstigt. Dies verursacht eine

Dilatation des Gastrointestinal-Traktes (Barker et al., 2007) und die Mäuse sterben aufgrund

von Nahrungsmangel und erniedrigter Sauerstoffzufuhr durch die Kompression der Lungen

durch den erhöhten intraabdominellen Druck (Morita et al., 2004; Barker et al., 2007).

Die Deletion von Lgr5 geht mit einer frühzeitigen Differenzierung der Panethzellen und einer

verminderten Expression anderer Stammzellmarker, wie Integral membrane protein 2A

(Itm2A) oder Insulin-like growth factor binding protein 5 (Igfbp5), einher (Garcia et al., 2009).

Genetische Insertion von Lgr5

Nach der genetischen Insertion von Lgr5 kommt es zu einer Expression von Lgr5 in den

Zylinderepithelzellen, den Crypt base columnar (CBC)-Zellen, des Darms. Bei ihnen scheint

es sich um Stammzellen des Dünn- und Dickdarms zu handeln (Barker et al., 2007).

4.4.15.2 Embryonale Expressionsanalyse von Lgr5

Expressionsmuster von Lgr5 im Wildtyp-Embryo

An E7.5 wird Lgr5 in einem eng umschriebenen Areal im embryonalen, anterioren, rechtsund

linkslateralen Mesoderm und im anterioren Pol exprimiert (Abb. 25A,A'). Am Übergang

des embryonalen zum extraembryonalen Gewebe sind Transkripte in zwei kleinen Bereichen

im links- und rechtslateralen posterioren Mesoderm zu finden (Abb. 25A). Das

darunterliegende Ektoderm exprimiert hier ebenfalls Lgr5 (keine Abbildung). Im


Ergebnisse 77

extraembryonalen Gewebe sind eine kräftige Expression im linkslateralen anterioren

Mesoderm und eine schwächere Expression in der Allantois und im Chorion nachweisbar

(Abb. 25A). An E7.75 wird Lgr5 im anterioren Kopfmesoderm und im Ektoderm der

Neuralfalten exprimiert (Abb. 25C,C'). Im posterioren Bereich sind Transkripte im Mesoderm,

Ektoderm und Endoderm nachzuweisen (Abb. 25C). Der Dottersack, die Allantois, das

Amnion, zwei kleine, eng umschriebene Areale des Chorions und ein kleiner Bereich des

ektoplazentaren Kegels exprimieren ebenfalls Lgr5 (Abb. 25C). Zum Zeitpunkt E8.0 wird

Lgr5 in den Neuralfalten, im posterioren und im distalen embryonalen Mesoderm und im

Chorion exprimiert (Abb. 25D). Zum Zeitpunkt E9.5 wird Lgr5 im distalen Neuralrohr, im

Prosenzephalon, in den Augenbläschen und in den Ohranlagen exprimiert (Abb. 25E,E',E'').

Das distale laterale Mesoderm, das Kopfmesoderm und das posteriore, intermediäre

Mesoderm exprimieren ebenfalls Lgr5 (Abb. 25E,E'). Auch in den Darmepithelzellen der

proximalen und distalen Darmabschnitte sind Transkripte nachweisbar (Abb. 25E',E''). Im

proximalen Darmrohr wird Lgr5 in dem der Notochord zugewandten Bereich exprimiert

(keine Abbildung). Es scheint, dass das Notochord ebenfalls Lgr5 exprimiert (Abb. 25E,E'').

Expressionsmuster von Lgr5 in der Eomes-Mutante

Zum Zeitpunkt E7.5 wird Lgr5 in einem kleinen Areal in der Allantois exprimiert (Abb. 25B).

4.4.15.3 Zusammenfassende Darstellung von Lgr5

Wird Eomes nicht exprimiert, ist die Expression von Lgr5 im Embryo um das 1,59-fache

reduziert. Die Expression von Lgr5 scheint durch Eomes positiv reguliert zu werden.

Die anterior gelegenen Zellen, die an E7.5 Lgr5 exprimieren, befinden sich in dem Bereich

des Mesoderms, in dem sich im darüber liegenden Endoderm das AVE befindet (Abb.

25A,A'). Die mesodermalen Zellen gehen aus dem intermediären PS hervor, dessen

Entstehung in den Eomes-Mutanten nicht beeinträchtigt ist. Im mutanten PS müsste

demnach eine Expression von Lgr5 nachweisbar sein. Interessanterweise ist in ihm jedoch

keinerlei Färbung zu erkennen (Abb. 25B). Die Expression von Lgr5 scheint durch das

Fehlen von Eomes fast vollständig zum Erliegen zu kommen. Nur ein sehr kleines Areal in

der Allantois exprimiert Lgr5 (Abb. 25B). Da es sich bei Lgr5 um einen Stammzellmarker

handelt, ist anzunehmen, dass es sich hierbei um einige verbliebene Stammzellen handelt.

Ursache dieses nur wenig ausgedehnten Expressionsareals könnte eine frühzeitige

Stammzelldifferenzierung in den Eomes-Mutanten sein.

Lgr5 konnte unter anderem im Darm als Stammzellmarker identifiziert werden (Blanpain et

al., 2004; Barker et al., 2007; Morris et al., 2007). An E7.75 wird Lgr5 in wenigen Zellen des

posterioren Endoderms exprimiert (Abb. 25C), aus dem das Darmrohr hervorgeht, in dem an

E9.5 (Abb. 25 E',E'') ebenfalls Transkripte nachweisbar sind. Es ist anzunehmen, dass Lgr5


Ergebnisse 78

schon an E7.75 intestinale Stammzellen markiert.

Interessanterweise wird Lgr5 an E9.5 nicht nur im Darm, sondern auch im Neuralrohr, im

Mesoderm, in den Augenanlagen, im Gehirn und im Notochord exprimiert. Weitere

Untersuchungen müssen sich anschließen, um nachzuweisen, ob es sich bei den gefärbten

Zellen um Stammzellen handelt, oder ob Lgr5 hier noch eine weitere, bisher unbekannte

Funktion ausübt.

4.4.16 NK1 transcription factor related, locus 2 (Nkx1.2)

Wildtyp

Eomes-Mutante

Wildtyp

Abbildung 26: Die Expression von Nkx1.2 in den Wildtyp-Embryonen von E7.0 bis E8.5 (A-B’,D-F’) und in

der Eomes-Mutante an E7.5 (C,C’).. An E7.0 wird Nkx1.2 halbmondförmig im embryonalen Ektoderm exprimiert

(A). An E7.5 breitet sich diese halbmondförmige Expressionsdomäne nach distal aus und es ist zusätzlich der PS

gefärbt (B,B’). An E7.75 bleibt die Expression auf das posteriore Mesoderm und Ektoderm beschränkt (D). Zum

Zeitpunkt E8.0 hat sich das Expressionsmuster nicht geändert (E,E’). An E8.5 ist eine Expression von Nkx1.2 im

Neuralrohr und in der Notochord zu finden (F,F’). Nkx1.2 wird in Teilen des Oberflächenektoderms, im lateralen

Mesoderm und in den dorsalen Anteilen der Somiten exprimiert (F,F’). In der Eomes-Mutante wird Nkx1.2 an

E7.5 im gesamten Epiblast exprimiert (C,C’). (B’,C’,F’ jeweils Transversalschnitte durch B,C,F; E’ Sagittalschnitt

durch E).

4.4.16.1 Kurzbeschreibung

Funktion von Nkx1.2

Nkx1.2 wird für die frühe neuronale Differenzierung benötigt (Schubert et al., 1995).

In der Literatur beschriebenes Expressionsmuster von Nkx1.2

An E7.0 wird Nkx1.2 zum ersten Mal, im lateral des PS gelegenen Ektoderm, exprimiert. An

E7.5 nimmt die Expression an Stärke zu und breitet sich bis posterior des PK und in die

Neuralplatte aus. An E8.0 ist die stärkste Expression in dem noch offenen Neuralrohr


Ergebnisse 79

nachzuweisen. Die ektodermalen Zellen, die sich zu epidermalen Zellen weiterentwickeln,

exprimieren kein Nkx1.2. Die Zellen, die im ventralen Bereich des Neuroepithels gelegen

sind, und der Notochord anliegen, weisen eine schwache Expression auf. Zum Zeitpunkt

E9.0 bleibt die Expression von Nkx1.2 im Neuralrohr bestehen, nimmt jedoch auf Höhe des

letzten Somitenpaares ab. Die Zellen, die gerade mit der Gegenseite zum Neuralrohr

fusionieren, exprimieren jedoch kein Nkx1.2.

An E9.5 wird Nkx1.2 im Rückenmark, im Rhombenzephalon, im Mittelhirn und im Vorderhirn

exprimiert. Eine stärkere Expression ist im ersten Rhombomer und im Pretektum zu

erkennen. In der weiteren Entwicklung wird Nkx1.2 weiterhin im Neuralrohr, im dorsalen

Mesenchym der Schwanzknospe, im Rhombenzephalon, im Rückenmark und in weiteren

Bereichen des ZNS exprimiert (Schubert et al., 1995).

In Embryonen, in denen Brachyury deletiert wurde, kommt es aufgrund starker

morphologischen Veränderungen in ihrem posterioren Bereich, nach E8.0 zu einer

verminderten Expression von Nkx1.2 (Schubert et al., 1995).

Genetische Deletion von Nkx1.2

Eine genetische Deletion von Nkx1.2 wurde bisher nicht durchgeführt.

Expressionsanalyse von Nkx1.2 in Zellkultur

Nkx1.2 wird während der frühen, nicht jedoch während der späten neuronalen

Differenzierung exprimiert. In undifferenzierten P19-Zellen ist Nkx1.2 in vitro nicht

nachweisbar (Schubert et al., 1995).

4.4.16.2 Embryonale Expressionsanalyse von Nkx1.2

Expressionsmuster von Nkx1.2 im Wildtyp-Embryo

Zum Zeitpunkt E7.0 ist die Expression von Nkx1.2 auf das proximale Ektoderm beschränkt

und beschreibt dort eine halbmondförmige Expressionsdomäne (Abb. 26A). Die Expression

auf der linken Seite ist stärker als die auf der rechten (keine Abbildung). Die zum Coelom hin

liegenden Zellen des linkslateralen Ektoderms und die äußersten, am posterioren Pol

liegenden Zellen, weisen proximal eine schwächere Expression auf (keine Abbildung).

An E7.5 bleibt das an E7.0 beschriebene halbmondförmige Expressionsmuster

weitestgehend bestehen (Abb. 26B). Es breitet sich im posterioren Bereich auf den PS aus

und reicht nun vom proximo-posterioren Pol bis hin zum distalen Bereich (Abb. 26B,B').

Weiter proximal schwächt sich die Expression im PS ab (keine Abbildung). Im

extraembryonalen Bereich wird Nkx1.2 in der Allantois und im Mesoderm exprimiert (Abb.

26B). An E7.75 beschränkt sich die Nkx1.2-Expression weiterhin auf den posterioren Bereich

(Abb. 26D). Nkx1.2 wird in den posterior gelegenen Zellen des Mesoderms, im distalen

Ektoderm, in den anterioren Zellen des Neuralrohrs und in der Allantois exprimiert (Abb.


Ergebnisse 80

26D). An E8.0 bleibt das Expressionsmuster im posterioren Mesoderm und Ektoderm

bestehen (Abb. 26E,E'). Es kommt ein Expressionsareal im distalen lateralen Mesoderm

hinzu (keine Abbildung). An E8.5 wird Nkx1.2 im Neuralrohr und im Notochord exprimiert

(Abb. 26F,F'). Es sind Transkripte in den posterior gelegenen Zellen des posterioren und im

noch nicht verschlossenen Neuralrohr zu finden (Abb. 26F,F'). Das Oberflächenektoderm,

das dem Neuralrohr anliegt, und das, das den Somiten dorsal aufliegt, weisen eine

schwächere Expression auf. Das benachbarte lateral-distale Mesoderm und die dorsalen

Anteilen der Somiten weisen ebenfalls eine schwache Expression auf (keine Abbildung).

Expressionsmuster von Nkx1.2 in der Eomes-Mutante

An E7.5 wird Nkx1.2 in der gesamten Zirkumferenz des Epiblast und im PS exprimiert (Abb.

26C,C'). Es exprimieren vor allem die weiter außen liegenden Zellen des Epiblast Nkx1.2

(Abb. 26C'). Im PS wird Nkx1.2 in den mittig gelegenen Zellen schwächer exprimiert (Abb.

26C'). In den posterior und den zum Coelom hin gelegenen Zellen, im viszeralen Endoderm

und im extraembryonalen Gewebe ist keine Nkx1.2-Expression nachzuweisen (Abb. 26C,C').

4.4.16.3 Zusammenfassende Darstellung von Nkx1.2

Das schon aus der Literatur bekannte Expressionsmuster von Nkx1.2 konnte mit der in

dieser Arbeit durchgeführten WISH nachvollzogen werden. Wird Eomes nicht exprimiert, ist

die Expression von Nkx1.2 im Embryo um das 1,99-fache erhöht. Da Nkx1.2 für die frühe

neuronale Differenzierung benötigt wird (Schubert et al., 1995), scheint Eomes

normalerweise hemmenden Einfluss auf diese zu nehmen. Die neuronalen Gewebe gehen

aus dem Ektoderm hervor, in denen schon an E7.0 eine Expression von Nkx1.2 nachweisbar

ist (Schubert et al., 1995; Abb. 26A). Da die ektodermale Zelllinie durch die Deletion von

Eomes in ihrer Entwicklung nicht gestört ist, bleibt Nkx1.2 in den Epiblastzellen der Eomes-

Mutante weiterhin nachweisbar (Abb. 26C,C'). In der weiteren embryonalen Entwicklung

bleibt die Expression von Nkx1.2 in verschiedenen neuronalen Geweben bestehen (Abb.

26F,F').

Bei den im mutanten PS gefärbten Zellen (Abb. 26C,C') handelt es sich wahrscheinlich um

migrationsgehemmte Zellen, die bereits im Wildtyp-PS Nkx1.2 exprimieren und um Zellen

des extraembryonalen Mesoderms und der Allantois, in denen Nkx1.2 normalerweise

ebenfalls exprimiert wird (Abb. 26B).


Ergebnisse 81

4.4.17 Serin-Peptidase-Inhibitor, Kazal Typ 3 (Spink3)

Wildtyp Eomes-Mutante Wildtyp

Abbildung 27: Die Expression von Spink3 in den Wildtyp-Embryonen von E7.5 bis E9.5 (A,A’,C-C’’’) und in

der Eomes-Mutante an E7.5 (B). Spink3 wird an E7.5 im proximalen embryonalen und im extraembryonalen VE

exprimiert (A,A’). An E9.5 sind Transkripte im Mittel- und Enddarm (C’’’), im Ektoderm des Prosenzephalons (C’’)

und in der Ohranlage nachweisbar (C,C’). In der Eomes-Mutante wird Spink3 an E7.5 beinahe im gesamten VE

exprimiert. Nur im anterio-distalen Bereich zeigt sich eine verminderte Expression (B). (A’ Transversalschnitt

durch A; C’’,C’’’ jeweils Koronarschnitt durch C’,C).

4.4.17.1 Kurzbeschreibung

Funktion von Spink3

Spink3 ist ein Enzym des Verdauungstraktes (Kazal et al. 1948), das die Aktivität von

Trypsin durch direkte Bindung hemmen kann (Ohmuraya et al., 2005). Es scheint die Zelle

vor luminalen Proteasen zu schützen (Wang et al., 2008). Strukturell hat Spink3 Ähnlichkeit

mit dem Epidermal growth factor (EGF) (Scheving, 1985). Wahrscheinlich wird Spink3 für

Wachstums- und Differenzierungsvorgänge und für die Proliferation von Zellen benötigt

(Niinobu et al., 1990; Ogawa et al., 1985; Wang et al., 2008).

In der Literatur beschriebenes Expressionsmuster von Spink3

Zwischen E8.0 und E8.5 wird Spink3 im Ektoderm, im DE und im Dottersackendoderm

exprimiert (Hou et al., 2007). An E9.5 sind Transkripte im Mitteldarm, im Enddarm und im

Neuroepithel des Vorder- und Mittelhirns zu finden (Wang et al., 2008). In der weiteren

Entwicklung wird Spink3 im Dickdarm, in der Niere, in den Azinuszellen des Pankreas, in den

Epithelzellen des Verdauungstraktes, in den Epithelzellen des Urogenitaltraktes und im ZNS

exprimiert (Ohmuraya et al., 2005; Wang et al., 2008).

Genetische Deletion von Spink3

Spink3 -/- - Mäuse sind lebensfähig, sterben jedoch 14,5 Tage nach ihrer Geburt aufgrund von

Entwicklungsdefekten des Pankreas und des Darmes. Ab E15.5 kommt es im Pankreas zur

Degeneration und Autophagozytose der Azinuszellen, wovon die duktalen Zellen und die

Inselzellen postnatal ebenfalls betroffen sind. Die Duktuszellen beginnen das Pancreatic

duodenal homedomain-containing protein1 (Pdx1), ein Marker für pankreatische

Stammzellen, zu exprimieren, ohne dass eine Regeneration der Zellen zu beobachten ist.

Die pankreatischen Stromazellen weisen ebenfalls Entwicklungsdefekte auf. Auch im

Duodenum und im Dünndarm kommt es nach der Geburt zu einem vermehrten

Zelluntergang (Ohmuraya et al., 2005).


Ergebnisse 82

Spink3-Heterozygotie

Spink +/- - Mäuse zeigen keinen auffälligen Phänotyp, obwohl die Expression von Spink3 um

etwa 50% vermindert ist (Ohmuraya et al., 2005).

4.4.17.2 Embryonale Expressionsanalyse von Spink3

Expressionsmuster von Spink3 im Wildtyp-Embryo

An E7.5 wird Spink3 im proximalen embryonalen und im extraembryonalen VE exprimiert

(Abb. 27A,A'). Im distalen Bereich können keine Transkripte nachgewiesen werden (Abb.

27A). An E9.5 wird Spink3 im Mittel- und Enddarm, im Ektoderm des Prosenzephalons und

in der Ohranlage exprimiert (Abb. 27C,C',C'',C''').

Expressionsmuster von Spink3 in der Eomes-Mutante

An E7.5 wird Spink3 beinahe im gesamten VE exprimiert (Abb. 27B). Es findet sich nur ein

kleines Areal im anterio-distalen Anteil des VE, in dem keine Transkripte nachgewiesen

werden können (Abb. 27B).

4.4.17.3 Zusammenfassende Darstellung von Spink3

Wird Eomes nicht exprimiert, ist die Expression von Spink3 im Embryo beinahe unverändert

(Foldchange: 1,04). Interessanterweise wird Spink3 im Microarray der Zellkultur jedoch um

das 132-fache vermindert exprimiert. Diese unterschiedlichen Ergebnisse sind dadurch zu

erklären, dass den beiden Microarrays verschiedene Versuchsansätze zugrunde liegen. In

dem Microarray der Embryonen wird zur Durchführung das embryonale Gewebe der Eomes-

Mutanten verwendet. Eomes ist in den Mutanten im embryonalen Epiblast, nicht jedoch im

VE deletiert. Folglich wird Eomes weiterhin im Endoderm exprimiert. Da Spink3 ebenfalls im

Endoderm exprimiert wird, ist zwischen den Wildtyp- und den Eomes-Mutanten kein

Expressionsunterschied zu erwarten. Die WISH bestätigt dies, da Spink3 in der Mutante

weiterhin im Endoderm exprimiert wird (Abb. 27B).

Für den Microarray der Zellen werden Zellen verwendet, in denen die Eomes-Transkription

vollständig supprimiert wurde. Hier kommt es aufgrund des Fehlens von Eomes zu einer

erheblichen Reduktion der Spink3-Expression, die vermuten lässt, dass Spink3 im Endoderm

ein direktes Zielgen von Eomes darstellen könnte.

Spink3 wird in der adulten Maus vor allem in den vom Endoderm abstammenden Organen

wie dem Pankreas oder dem Darm exprimiert (Ohmuraya et al., 2005; Wang et al., 2008).

Schon an E7.5 ist die Spink3-Expression auf das Endoderm beschränkt (Abb. 27A,A').

Normalerweise wird das VE zu einem großen Teil vom entstehenden DE nach proximal

verdrängt, und ersetzt dort das extraembryonale VE. In den Eomes-Mutanten findet keine


Ergebnisse 83

Bildung des DE statt, folglich kann das embryonale VE nicht in die extraembryonale Region

vordringen und das dortige Endoderm ersetzen. Das Expressionsmuster in den Mutanten

muss somit auf das embryonale VE beschränkt bleiben, welches mit der WISH bestätigt

werden kann (Abb. 27B).

4.4.18 Proto-oncogene serine/threonine-protein kinase 1 (Pim1)

Wildtyp Eomes-Mutante Wildtyp

Abbildung 28: Die Expression von Pim1 in den Wildtyp-Embryonen von E7.5 bis E8.5 (A,C-D’) und in der

Eomes-Mutante an E7.5 (B,B’). An E7.5 wird Pim1 im proximalen, posterioren Ektoderm, in der Allantois und

dem ihm anliegenden extraembryonalen Mesoderm exprimiert (A). An E8.0 und an E8.5 sind Transkripte im

gesamten Embryo zu finden (C-D’). An E7.5 wird Pim1 in der Eomes-Mutante im PS und in den an ihn

angrenzenden Epiblastzellen exprimiert (B,B’). (B’,C’ jeweils Transversalschnitte durch B,C; D’ Sagittalschnitt

durch D).

4.4.18.1 Kurzbeschreibung

Funktion von Pim1

Die Familie der Proto-oncogene serine/threonine-protein kinase (Pim)-Gene besteht aus drei

Mitgliedern: Proto-oncogene serine/threonine-protein kinase (Pim1), Proto-oncogene

serine/threonine-protein kinase 2 (Pim2) und Proto-oncogene serine/threonine-protein kinase

3 (Pim3). Sie kodieren für eine Serin/Threonin-Kinase, sind an der Regulation des

Zellwachstums und der Apoptose beteiligt (Bachmann et al., 2005) und werden durch

Zytokine und Wachstumsfaktoren stimuliert (Aksoy et al., 2007). Sie können das

proapoptotische Protein BCL2-associated agonist of cell death (Bad) inaktivieren und somit

den programmierten Zelltod verhindern (White et al., 2003; Aho et al., 2004; Li et al., 2006;

Adam et al., 2006). Pim1 kann zusammen mit Pim2 mit Myelocytomatosis oncogene (Myc),

einem Protoonkogen, interagieren (Allen et al., 1996; Allen et al., 1997; Shirogane et al.,

1999). Die Expression von Pim1 kann durch die Aktivierung von Signal transducer and

activator of transcription 3 (Stat3) und Signal transducer and activator of transcription 5

(Stat5), die direkt an den Pim1-Promotor in Eosinophilen binden können, induziert werden

(Shirogane et al., 1999; Stout et al., 2004).

Pim1 konnte als Zielgen von Foxa2 identifiziert werden (Tamplin et al., 2008).

In der Literatur beschriebenes Expressionsmuster von Pim1


Ergebnisse 84

Zum Zeitpunkt E7.5 wird Pim1 im PS und im PK exprimiert. An E8.5 ist eine Expression

ubiquitär im Embryo nachzuweisen (Tamplin et al., 2008). Später wird Pim1 in

hämatopoietischen Organen und in den Gonaden exprimiert (Sorrentino et al., 1988; Amson

et al., 1989; van Lohuizen et al., 1989; Wingett et al., 1992)

Genetische Deletion von Pim1

Pim1 -/- - Mäuse sind lebensfähig, gesund und fertil, weisen jedoch eine Mikroerythrozytose

auf (Laird et al., 1993).

Expressionsanalyse von Pim1 in Zellkultur

Pim1 wird in undifferenzierten ES-Zellen exprimiert. Sobald Zellen anfangen zu

differenzieren, ist eine abrupte Verminderung der Pim1-Expression (Aksoy et al., 2007), noch

bevor es zu einer Expressionsreduktion von POU domain, class 5, transcription factor 1 (Oct-

4), einem Pluripotenzmarker, kommt, zu beobachten (3. bis 4. Tag) (Nichols et al., 1998).

Eine vermehrte Expression von Pim1 in ES-Zellen führt zu einer gesteigerten Bildung

undifferenzierter, größerer Zellkolonien und zu einer Verminderung der sich spontan

differenzierenden Zellen (Aksoy et al., 2007). Eine verminderte Expression von Pim1 und

Pim3 in Zellkultur erhöht hingegen die Anzahl der sich spontan differenzierenden Zellen. Der

Zellzyklus ist verlängert (Savatier et al., 1996).

4.4.18.2 Embryonale Expressionsanalyse von Pim1

Expressionsmuster von Pim1 im Wildtyp-Embryo

Zum Zeitpunkt E7.5 wird Pim1 im proximalen, posterioren Ektoderm, in der Allantois und in

dem ihm anliegenden extraembryonalen Mesoderm exprimiert (Abb. 28A). An E8.0 und an

E8.5 ist die Pim1-Expression ubiquitär im Embryo nachweisbar (Abb. 28C,C',D,D').

Expressionsmuster von Pim1 in der Eomes-Mutante

Zum Zeitpunkt E7.5 wird Pim1 im mutanten PS, im Epiblast und im ektoplazentaren Kegel

exprimiert (Abb. 28B,B'). Im proximalen Bereich ist die Expression in den zentral gelegenen

Zellen des PS abgeschwächt (Abb. 28B'). Vor allem die ihm anliegenden Epiblastzellen

exprimieren Pim1 (Abb. 28B'). Im Bereich des embryonalen-extraembryonalen Übergangs

breitet sich das Expressionsmuster der Epiblastzellen nach anterior aus (Abb. 28B). Im

distalen Bereich sind einige wenige Transkripte in linkslateralen Epiblastzellen nachweisbar

(keine Abbildung). Die weitere distale Region exprimiert kein Pim1 (Abb. 28B).

4.4.18.3 Zusammenfassende Darstellung von Pim1

Wird Eomes nicht exprimiert, ist die Expression von Pim1 im Embryo um das 1,13-fache

erhöht. In den WISHs der Eomes-Mutanten scheint die Expression von Pim1 zum Zeitpunkt


Ergebnisse 85

E7.5 jedoch deutlich erhöht zu sein. Da Pim1 vermehrt in undifferenzierten Zellen exprimiert

wird (Aksoy et al., 2007), muss es in den Eomes-Mutanten zu einer erheblichen Zunahme an

undifferenzierten Zellen kommen. Bei den gefärbten Zellen handelt es sich jedoch um Zellen,

die keinen pluripotenten Charakter mehr haben, sondern bereits zu mesodermalen Zellen

differenziert sind. Auch wird Pim1 in den Wildtyp-Embryonen in bereits differenzierten Zellen

des Ektoderms und des extraembryonalen Mesoderms exprimiert. Pim1 kann zu diesem

Zeitpunkt der Embryonalentwicklung nicht mehr als Pluripotenzmarker angesehen werden.

Warum es zu einer solchen Zunahme der Pim1-Expression in den Eomes-Mutanten kommt,

kann weder durch das Ergebnis des Microarrays, noch durch die bereits bekannte Funktion

von Pim1 erklärt werden.

Auch stimmt das Expressionsmuster der Wildtyp-Embryonen nicht mit der bereits bekannten

Expression aus Tamplin et al. überein (Tamplin et al., 2008). Es kann weder eine Expression

im PS, noch im PK zum Zeitpunkt E7.5 beobachtet werden (Abb. 27A,C).

4.4.19 Class E basic helix-loop-helix protein 40 (Bhlhb2/Stra13)

Wildtyp

Eomes-Mutante

Abbildung 29: Die Expression von Bhlhb2 im Wildtyp-Embryo (A) und in der Eomes-Mutante (B) an E7.5.

Bhlhb2 wird im embryonalen und extraembryonalen Gewebe exprimiert (A). In der Eomes-Mutante sind keine

Transkripte nachweisbar (B).

4.4.19.1 Kurzbeschreibung

Funktion von Bhlhb2

Bhlhb2 gehört zur Familie der Basic helix-loop-helix-Transkriptionsfaktoren (Boudjelal et al.,

1997) und ist Hairy and enhancer of split 1 (Hes1) strukturell ähnlich, das für die neuronale

Entwicklung und die T-Zelldifferenzierung benötigt wird (Ishibashi et al., 1995; Tomita et al.,

1999). Bhlhb2 hemmt die Transkription von Brain-derived neurotrophic factor (Bdnf) (Jiang et

al., 2008), das zu den Neutrophinen gehört und hauptsächlich in Neuronen des Kortex und

des Hippocampus exprimiert wird (Ernfors et al., 1990; Phillips et al., 1990; Yan et al., 1997).

Es kontrolliert die Entwicklung des ZNS und die Entstehung synaptischer Verknüpfungen

(Thoenen, 1995; Katz and Shatz, 1996; Lu and Figurov, 1997; Chao, 2003).


Ergebnisse 86

In der frühen Mausentwicklung wird Bhlhb2 für die Differenzierung von

Trophoblaststammzellen zu Trophoblastriesenzellen benötigt. Bhlhb2 kann zusammen mit

Heart and neural crest derivatives expressed transcript 1 (Hand1) und glial cells missing

homolog 1 (Gcm1) die Zellproliferation hemmen und die Zelldifferenzierung stimulieren

(Hughes et al., 2004). Bhlhb2 wird nach Stressreizen (Hypoxie), nach Stimulation mit

Zytokinen und bei der Immunabwehr verstärkt exprimiert (Sun et al., 2000; Ivanova et al.,

2001; Ivanova et al., 2004; Yun et al., 2002).

Genetische Deletion von Bhlhb2

Bhlhb2 -/- - Mäuse sind lebensfähig, fertil und zeigen in den ersten zwei bis drei Monaten keine

morphologischen Auffälligkeiten (Sun et al., 2001). Die neuronale Erregbarkeit ist jedoch

erhöht und die zerebrale Krampfschwelle ist erniedrigt (Jiang et al., 2008). Die Expression

von Bdnf ist erhöht (Jiang et al., 2008), die von Protein 53 (p53), einem

Tumorsuppressorgen, vermindert (Thin et al., 2007). Immunologische Defekte machen sie

anfällig für Autoimmunerkrankungen (Sun et al., 2001).

4.4.19.2 Embryonale Expressionsanalyse von Bhlhb2

Expressionsmuster von Bhlhb2 im Wildtyp-Embryo

An E7.5 wird Bhlhb2 im embryonalen und extraembryonalen Gewebe exprimiert (Abb. 29A).

Expressionsmuster von Bhlhb2 in der Eomes-Mutante

In der Eomes-Mutante wird Bhlhb2 an E7.5 nicht exprimiert (Abb. 29B).

4.4.19.3 Zusammenfassende Darstellung von Bhlhb2

Wird Eomes nicht exprimiert, ist die Expression von Bhlhb2 im Embryo um das 1,98-fache

erhöht. Interessanterweise ist jedoch keine Expression von Bhlhb2 in den Eomes-Mutanten

nachweisbar (Abb. 29B). Da die ektodermalen Zellen in den Eomes-Mutanten in ihrer

Entstehung nicht beeinträchtigt sind, wäre eine Bhlhb2-Expression in ihnen zu erwarten.

Bhlhb2 ist über die Regulation von Bdnf an der Entwicklung von Neuronen beteiligt

(Thoenen, 1995; Katz and Shatz, 1996; Lu and Figurov, 1997; Chao, 2003), die aus dem

Ektoderm hervorgehen. Schnittbilder durch den Embryo müssen zeigen, ob es sich bei den

Bhlhb2-exprimierenden Zellen um ektodermale Zellen handelt, die eventuell neuronale

Vorläuferzellen darstellen könnten. Das Expressionsmuster ähnelt der Expression von

Nkx1.2, einem weiteren Regulator der Neurogenese (Schubert et al., 1995), der in den

Eomes-Mutanten ebenfalls vermehrt exprimiert wird. Bisher ist nicht bekannt ob Eomes zu

einem solch frühen Zeitpunkt der Entwicklung Einfluss auf die Neurogenese nimmt.


Ergebnisse 87

4.4.20 Rho guanine nucleotide exchange factor 3 (Arhgef3)

Wildtyp Eomes-Mutante Wildtyp

Abbildung 30: Die Expression von Arhgef3 in den Wildtyp-Embryonen von E7.5 bis E7.75 (A.C,C’) und in

der Eomes-Mutante an E7.5 (B,B’). An E7.5 und an E7.75 wird Arhgef3 im extraembryonalen VE, in der

Allantois, im Chorion und im ektoplazentaren Kegel exprimiert (A,C,C’). In der Eomes-Mutante wird Arhgef3 in

den Zellen des mutanten PS und im anterioren und posterioren embryonalen VE exprimiert (B,B’). (B’,C’ jeweils

Sagittalschnitt durch B,C).

4.4.20.1 Kurzbeschreibung

Funktion von Arhgef3

Arhgef3 wird für die Regulation von intrazellulären Signaltransduktionen benötigt. Es befindet

sich im Zytoplasma und reguliert die Aktivität der Rho-ATPasen (Bloch-Gallego et al., 2005;

Schmidt et al., 2002) und ist an der Zelladhäsion, an der Migration und am Axonwachstum

beteiligt (Bloch-Gallego et al., 2005).

Ret-Protoonkogen (Ret) -/- - Mäuse weisen eine Aganglionose des Darmes und eine 6,19-fach

verminderte Expression von Arhgef3 auf. Es scheint, dass Arhgef3 durch Ret aktiviert wird

und dass beide Gene an der Ausbildung des enterischen Nervensystems beteiligt sind

(Heanue et al., 2006).

In der Literatur beschriebenes Expressionsmuster von Arhgef3

Das embryonale Expressionsmuster von Arhgef3 wurde bisher noch nicht untersucht.

Genetische Deletion von Arhgef3

Bisher ist keine Deletion dieses Gens durchgeführt worden. Das Wellcome Trust Sanger

Institute hat eine gezielte Arhgef3-Mutation in ES-Zellen durchgeführt.

4.4.20.2 Embryonale Expressionsanalyse von Arhgef3

Expressionsmuster von Arhgef3 im Wildtyp-Embryo

Zum Zeitpunkt E7.5 wird Arhgef3 ausschließlich in den extraembryonalen Geweben

exprimiert (Abb. 30A). Es sind Transkripte im extraembryonalen Endoderm, in der Allantois,

im Chorion und im ektoplazentaren Kegel nachweisbar (Abb. 30A). An E7.75 ist das

Expressionsmuster bis auf die Expressionsdomäne im Chorion, unverändert (Abb. 30C,C').

Expressionsmuster von Arhgef3 in der Eomes-Mutante

An E7.5 wird Arhgef3 im PS und im VE exprimiert (Abb. 30B,B'). Im PS können Transkripte


Ergebnisse 88

in den proximal und in den latero-distal gelegenen Zellen nachgewiesen werden (Abb. 30B').

Im VE exprimieren einige anterior gelegene und einige posterior liegende Zellen Arhgef3

(Abb. 30B'). Im extraembryonalen Gewebe wird Arhgef3 im ektoplazentaren Kegel exprimiert

(Abb. 30B,B').

4.4.20.3 Zusammenfassende Darstellung von Arhgef3

Wird Eomes nicht exprimiert, ist die Expression von Arhgef3 im Embryo um das 1,34-fache

erhöht. Interessanterweise kommt es im Microarray der Zellen zu einer 3,22-fach

verminderten Expression von Arhgef3. Wie schon bei Spink3 erläutert, liegen den

Microarrays unterschiedliche Reaktionsansätze zugrunde, die zu einem derartigen

Expressionsunterschied führen können. Es scheint, dass Eomes die Expression von Arhgef3

im VE hemmt.

Arhgef3 wird zwischen E7.5 und E7.75 ausschließlich im extraembryonalen Gewebe

exprimiert (Abb. 30A,C). Das extraembryonale Endoderm geht aus dem embryonalen VE

hervor. Nach der Gastrulation ersetzt das DE das VE und verdrängt es nach extraembryonal.

In den Eomes-Mutanten entsteht kein DE, folglich wird das VE nicht verdrängt. Es wäre

demnach eine Expression von Arhgef3 im gesamten Endoderm der Eomes-Mutanten zu

erwarten. Stattdessen exprimieren jedoch nur wenige Zellen des VE, einige Zellen des

proximalen PS und des ektoplazentaren Kegels Arhgef3 (Abb. 30B,B').

Bei den Arhgef3-exprimierenden Zellen des mutanten PS (Abb. 30B,B') handelt es sich am

ehesten um mesodermale Zellen, die sich zu extraembryonalen mesodermalen Strukturen,

wie dem mesodermalen Anteil der Allantois und des Chorions weiterentwickeln.

Falls Arhgef3 an der Entstehung des enterischen Nervensystems beteiligt ist, wäre am

ehesten ein ektodermales Expressionsmuster zu erwarten, da Nervenzellen aus dem

Ektoderm hervorgehen. Möglicherweise wird Arhgef3 jedoch erst in der späteren

Entwicklung in Neuronen exprimiert, worüber eine Expressionsanalyse in älteren Embryonen

Aufschluss geben könnte.


Ergebnisse 89

4.4.21 Spindlin family, member 2 (Spin2)

Wildtyp Eomes-Mutante Wildtyp

Abbildung 31: Die Expression von Spin2 in den Wildtyp-Embryonen von E7.5 bis E7.75 (A,C,C’) und in der

Eomes-Mutante an E7.5 (B). Spin2 wird an E7.5 nur im extraembryonalen Mesoderm, in der Allantois und im

Amnion exprimiert (A). An E7.75 sind Transkripte in der Allantois, im Amnion und im Chorion zu finden (C,C’). In

der Eomes-Mutante wird Spin2 nicht exprimiert (B). (C’ Transversalschnitt durch C).

4.4.21.1 Kurzbeschreibung

Funktion von Spin2

Über die Funktion von Spin2 ist bisher noch nichts bekannt.

4.4.21.2 Embryonale Expressionsanalyse von Spin2

Expressionsmuster von Spin2 im Wildtyp-Embryo

An E7.5 wird Spin2 in der Allantois, im Amnion und im extraembryonalen Mesoderm

exprimiert (Abb. 31A). An E7.75, wenn sich die Kopffalten entwickeln, ist die stärkste

Expression in der Allantois zu finden (Abb. 31C,C'). Eine schwächere Expression zeigt sich

im Amnion, im Chorion und im extraembryonalen Mesoderm (Abb. 31C,C').

Expressionsmuster von Spin2 in der Eomes-Mutante

Zum Zeitpunkt E7.5 wird Spin2 in den Eomes-Mutanten nicht exprimiert (Abb. 31B).

4.4.21.3 Zusammenfassende Darstellung von Spin2

Wird Eomes nicht exprimiert, ist die Expression von Spin2 im Embryo um das 2,31-fache

vermindert. Eomes muss demnach ein positiver Regulator von Spin2 sein.

Spin2 ist ein Protein, das zwischen E7.5 und E7.75 ausschließlich in den extraembryonalen

Geweben der Allantois, des Mesoderms und des Amnions exprimiert wird (Abb. 31A,C). An

E7.75 konzentriert sich das Expressionssignal auf die Allantois (Abb. 31C). Das

extraembryonale Mesoderm und die mesodermalen Anteile der Allantois und des Amnions

gehen aus dem posterioren Bereich des PS hervor, dessen Entwicklung in den Eomes-

Mutanten nicht gestört ist. Demnach wäre in den Eomes-Mutanten eine Expression von

Spin2 in einigen Zellen des mutanten PS zu erwarten. Diese exprimieren an E7.5 jedoch


Ergebnisse 90

kein Spin2 (Abb. 31B). Ursächlich könnte der Mangel an Eomes sein, das normalerweise für

die Aktivierung der Spin2-Expression benötigt wird.

4.4.22 Arginase1

Wildtyp Eomes-Mutante Wildtyp

E7.5

wt

E7.5

mut

Abbildung 32: Die Expression von Arginase1 in den Wildtyp-Embryonen von E7.5 bis E9.5 (A,A’,C-D) und

in der Eomes-Mutante an E7.5 (B,B’). Arginase1 wird an E7.5 in einem sehr kleinen Areal an der Basis der

Allantois exprimiert (A,A’). An E7.75 sind Transkripte im anterio-distalen und lateralen Kopfmesoderm und im

posterioren Mesoderm nachweisbar (C-C’’). Im PS und im PK wird Arginase1 nicht exprimiert (C,C’’). An E9.5

exprimieren die Somiten und das sie umgebende Mesenchym Arginase1 (D). Weitere Expressionsdomänen sind

im Kopfmesoderm, im Oberflächenektoderm, das dem kranialen Darmabschnitt anliegt, und im kranialen

Darmepithel zu erkennen (D). In der Eomes-Mutante wird Arginase1 an E7.5 in Zellen des mutanten PS

exprimiert (B,B’). (A’,B’,C’ jeweils Transversalschnitte durch A,B,C; C’’ Sagittalschnitt durch C).

4.4.22.1 Kurzbeschreibung

Funktion von Arginase1

Arginase1 ist das fünfte und damit letzte Enzym des Harnstoffzyklus, der hauptsächlich in

der Leber und in den Nieren abläuft. Es übt seine Funktion im Zytoplasma aus und wird für

den Abbau von Arginin zu Ornithin und Harnstoff benötigt, der anschließend über die Niere

ausgeschieden werden kann (Iyer et al., 1998). Das Ornithin dient als Ausgangsprodukt für

die Polyamin-Synthese. Diese werden zur Kontrolle der DNA-, RNA-, und Proteinsynthese

und während des Zellwachstums und der Zelldifferenzierung benötigt (Fozard et al., 1980).

In der Literatur beschriebenes Expressionsmuster von Arginase1

Zwischen E8.0 und E8.5 wird Arginase1 in den drei Keimblättern exprimiert (Hou et al.,

2007). Ab E13.0 sind Transkripte im peripheren Nervensystem (PNS), im ZNS, in der Leber,

im Pankreas, in den Speicheldrüsen, im Ösophagus, im Magen, im Dünndarm, in der Niere,

in der Lunge, in den Lymphknoten, im Thymus und in Leukozyten zu finden (Yu et al., 2002).

Genetische Deletion von Arginase1

Arginase1 -/- - Mäuse sind lebensfähig, leiden jedoch unter einer starken Hyperammonämie,

die zwischen dem zehnten und vierzehnten Tag postnatal zum Tod führt (Iyer et al., 2002).

Die Mäuse sind lethargisch, zeigen einen hochfrequenten Tremor der Extremitäten und des

Schwanzes, besitzen eine Hepatomegalie und eine gestörte Hepatozytenentwicklung (Iyer et

al., 1998; Iyer et al., 2002). Das Gehirn zeigt keine Auffälligkeiten (Iyer et al., 1998).


Ergebnisse 91

4.4.22.2 Embryonale Expressionsanalyse von Arginase1

Expressionsmuster von Arginase1 im Wildtyp-Embryo

An E7.5 wird Arginase1 in einem kleinen Areal am Fuße der Allantois exprimiert (Abb.

32A,A'). An E7.75 ist eine kräftige Expression im anterio-distalen und lateralen embryonalen

Kopfmesoderm zu erkennen (Abb. 32C,C',C''). Das posterio-distale und das posteriore

Mesoderm exprimieren ebenfalls Arginase1 (Abb. 32C,C',C''). Im Bereich des PS und des

PK ist die Expression stark abgeschwächt (Abb. 32C',C''). Am Übergang vom embryonalen

zum extraembryonalen Gewebe, ist eine zusätzliche Expressionsdomäne im embryonalen

Ekto- und Mesoderm nachweisbar (keine Abbildung). Im extraembryonalen Gewebe ist

weiterhin ein kleines Expressionsareal an der Basis der Allantois zu erkennen (Abb. 32C).

An E9.5 können Transkripte bis in die distal gelegenen Somiten der Schwanzregion und im

anliegenden Mesenchym nachgewiesen werden (Abb. 32D). Das Kopfmesoderm und das

aufliegende Oberflächenektoderm lateral des kranialen Darmabschnittes exprimieren

ebenfalls Arginase1 (keine Abbildung). In weiter kranial gelegenen Abschnitten ist eine

Expression im Darmepithel zu erkennen (keine Abbildung).

Expressionsmuster von Arginase1 in der Eomes-Mutante

An E7.5 wird Arginase1 im mutanten PS exprimiert (Abb. 32B,B'). Im distalen Bereich sind

Transkripte vor allem in den posterior gelegenen Zellen nachweisbar (keine Abbildung). In

weiter proximal gelegenen Abschnitten weitet sich die Expression auf die mittig gelegenen

Zellen und auf die zum Coelom hin liegenden Zellen des PS aus (Abb. 32B').

4.4.22.3 Zusammenfassende Darstellung von Arginase1

Wird Eomes nicht exprimiert, ist die Expression von Arginase1 im Embryo um das 2,51-fache

erhöht. Dieses Microarray-Ergebnis lässt sich mit der WISH bestätigen, in der ein deutlich

größeres Expressionsareal in den Eomes-Mutanten nachweisbar ist (Abb. 32B).

Da Eomes die Transkription von Arginase1 hemmt, ist an E7.5 nur ein sehr kleines

Expressionsareal in den Embryonen nachweisbar. Nach E7.5 wird Eomes normalerweise nur

noch vermindert exprimiert (Ciruna und Rossant, 1999; Hancock et al., 1999; Russ et al.,

2000). Die Arginase1-Expression wird daraufhin deutlich stärker (Abb. 32C).

Bei den Arginase1-exprimierenden Zellen des mutanten PS handelt es sich wahrscheinlich

um mesodermale Zellen des intermediären und posterioren PS, deren Entwicklung in den

Eomes-Mutanten nicht gestört ist und aus dem unter anderem das laterale Mesoderm

hervorgeht, in dem Arginase1 normalerweise exprimiert wird (Abb. 32C,C').

Arginase1 ist direkt an der Proteinsyntheseregulation und an Zelldifferenzierungsvorgängen

beteiligt. Ohne Eomes scheinen diese beiden Vorgänge gefördert zu werden.


Ergebnisse 92

Tamplin et al. hat bereits 2008 eine Expressionsanalyse von Arginase1 durchgeführt, deren

Ergebnis nur teilweise dem in dieser Arbeit identifizierten Expressionsmuster an E9.5

entspricht. Laut Tamplin et al. ist keine Expression von Arginase1 im distalen Bereich des

Embryos zu beobachten. In dieser Arbeit sind jedoch Transkripte bis in die Schwanzregion

nachweisbar (Abb. 32D).

4.4.23 Pepsinogen 5 (Pga5)

Wildtyp Eomes-Mutante Wildtyp

Abbildung 33: Die Expression von Pga5 in den Wildtyp-Embryonen von E7.5 bis E9.5 (A,C,D) und in der

Eomes-Mutante an E7.5 (B,B’). An E7.5 wird Pga5 nicht exprimiert (A). An E8.0 und an E9.5 zeigt sich eine

diffuse Expression im gesamten Embryo (C,D). In der Eomes-Mutante wird Pga5 an E7.5 in einem eng

umschriebenen Areal im anterio-distalen VE exprimiert (B,B’). (B’ Transversalschnitt durch B).

4.4.23.1 Kurzbeschreibung

Funktion von Pga5

Pga5 ist ein Proenzym des aktiven Pepsins, einem Verdauungsenzym des Magens

(reviewed von Foltmann, 1981). Es gehört zur Gruppe der Pepsinogen A-Pepsinproenzymen

und ist eine Aspartat-Proteinase. Die Umwandlung von Pepsinogen zu Pepsin erfolgt bei

saurem pH-Wert durch eine autokatalytische Reaktion. Pepstatin, ein Pentapeptid der

Streptomyceten, und ein Protein der Spülwürmer, können diese Reaktion inhibieren

(Kageyama et al., 2002).

In der Literatur beschriebenes Expressionsmuster von Pga5

Pga5 wird hauptsächlich in der Darmmukosa von Vertebraten exprimiert (Kageyama et al.,

2002). In der frühen Entwicklung ist bisher keine Expressionsanalyse durchgeführt worden.

Genetische Deletion von Pga5

Es ist bisher noch keine gerichtete Deletion von Pga5 durchgeführt worden.

4.4.23.2 Embryonale Expressionsanalyse von Pga5

Expressionsmuster von Pga5 im Wildtyp-Embryo

An E7.5 wird Pga5 nicht exprimiert (Abb. 33A). An E8.0 und an E9.5 ist eine diffuse,


Ergebnisse 93

ubiquitäre Expression im Embryo zu erkennen (Abb. 33 C,D).

Expressionsmuster von Pga5 in der Eomes-Mutante

An E7.5 wird Pga5 in einem kleinen Areal im anterio-distalen VE exprimiert (Abb. 33B,B').

4.4.23.3 Zusammenfassende Darstellung von Pga5

Wird Eomes nicht exprimiert, ist die Expression von Pga5 im Embryo um das 1,07-fache

erhöht. Im Microarray der Zellen wird Pga5 jedoch 61,14-fach vermindert exprimiert.

Wie schon bei Spink3 und Arhgef3 erläutert, kommt dieser Expressionsunterschied durch die

verschiedenen Ausgangsmaterialien der Microarrays zustande. Eomes scheint für die

Expression von Pga5 benötigt zu werden. In den Eomes-Mutanten wird Pga5 in einem

kleinen Areal im anterioren VE exprimiert (Abb. 33B,B'). Im gesamten VE ist Eomes nicht

deletiert, so dass sich die Expressionsdomänen zwischen Wildtyp- und Eomes-defizienten

Embryonen in diesem Gewebe nicht unterscheiden dürften. Erstaunlicherweise wird Pga5 in

den Wildtyp-Embryonen jedoch überhaupt nicht exprimiert (Abb. 33A). Woher die Aktivierung

der Pga5-Expression in diesem kleinen, eng umschriebenen Areal kommt, bleibt ungeklärt.

Obwohl Pepsinogen A ein Enzym des Magens ist, der aus dem Endoderm hervorgeht, ist in

den Wildtyp-Embryonen keine Expression von Pga5 in diesem Gewebe nachweisbar.

4.4.24 Endothelial cell-specific molecule 1 (Esm1)

Wildtyp Eomes-Mutante Wildtyp

Abbildung 36: Die Expression von Esm1 in den Wildtyp-Embryonen an E7.5 und an E9.5 (A,C) und in der

Eomes-Mutante an E7.5 (B). In den Wildtyp-Embryonen kommt es an E7.5 und an E9.5 zu einem

unspezifischen Expressionsmuster (A,C). Zum Zeitpunkt E7.5 wird Esm1 in der Eomes-Mutante ebenfalls

ubiquitär exprimiert (B).

4.4.24.1 Kurzbeschreibung

Funktion von Esm1

Esm1 konnte als Zielgen von Hematopoietically expressed homeobox (Hhex) identifiziert

werden. Es inhibiert die Esm1-Transkription, so dass es beispielsweise zu Störungen der


Ergebnisse 94

Blutgefäßentwicklung kommen kann (Cong et al., 2006).

Genetische Deletion von Esm1

Eine gezielte Deletion von Esm1 ist bisher nicht durchgeführt worden. ES-Zellen mit einer

Esm1-Deletion wurden von Velocigene hergestellt.

4.4.24.2 Embryonale Expressionsanalyse von Esm1

Expressionsmuster von Esm1 im Wildtyp-Embryo

An E7.5 und an E9.5 zeigt sich eine unspezifische Expression von Esm1 (Abb. 36A,C).

Expressionsmuster von Esm1 in der Eomes-Mutante

An E7.5 ist eine ubiquitäre Expression von Esm1 nachweisbar (Abb. 36B).

4.4.24.3 Zusammenfassende Darstellung von Esm1

Wird Eomes nicht exprimiert, ist die Expression von Esm1 im Embryo um das 3,45-fache

erhöht und gehört somit zu den Genen, deren Expression in den Eomes-Mutanten mit am

stärksten erhöht ist. In der WISH konnte sowohl in den Wildtyp-Embryonen (Abb. 36A,C) als

auch in den Eomes-Mutanten (Abb. 36B) nur ein unspezifisches Expressionsmuster

nachgewiesen werden.

4.4.25 Small proline-rich protein 2A (Sprr2a)

Wildtyp Eomes-Mutante Wildtyp

Abbildung 37: Die Expression von Sprr2a in den Wildtyp-Embryonen an E7.5 und an E8.0 (A,A’,C) und in

der Eomes-Mutante an E7.5 (B). An E7.5 wird Sprr2a im Ektoderm (A’), im extraembryonalen Mesoderm, in der

Allantois, im Chorion und im ektoplazentaren Kegel exprimiert (A). An E8.0 sind Transkripte im Kopfmesoderm, in

den Neuralfalten, im posterioren Mesoderm und Ektoderm, in der Allantois und im Chorion zu finden (C). In der

Eomes-Mutante wird Sprr2a an E7.5 im gesamten Epiblast exprimiert (B) (A’ Transversalschnitt durch A).

4.4.25.1 Kurzbeschreibung

Funktion von Sprr2a

Sprr2a gehört zu einer Familie von vier verschiedenen Small proline-rich (Sprr) - Genen, die


Ergebnisse 95

alle eine 170 kb große Domäne des Epidermal differentiation complex (EDC) besitzen, sich

jedoch in ihrer zentralen, prolinreichen Domäne unterscheiden (Cabral et al., 2001). An diese

können beispielsweise Mitglieder der Src-Kinase-Familie (SFK) und abl, ein Protoonkogen,

binden, die in den Epithelzellen an der Entwicklung von Zell-Zell-Kontakten und an

Zellstrukturveränderungen beteiligt sind (Avizienyte et al., 2004). Sprr-Gene werden bei

Entzündungen, Stressreizen und Infektionen vermehrt exprimiert und induzieren

Epithelumstrukturierungen. Sprr2a wird zusammen mit anderen Mitgliedern seiner Familie

bei der Entwicklung des Darms, der Prostata, des Uterus, des Kolons oder der weiblichen

Brust benötigt (Demetris et al., 2008).

In der Literatur beschriebenes Expressionsmuster von Sprr2a

Bisher wurde noch keine embryonale Expressionsanalyse von Sprr2a durchgeführt.

Genetische Deletion von Sprr2a

Bisher ist keine gezielte Deletion von Sprr2a durchgeführt worden.

Expressionsanalyse von Sprr2a in Zellkultur

Biliäre Epithelzellen (BECs), in denen Sprr2a vermehrt exprimiert wird, weisen

morphologische Veränderungen auf, die typisch für "Front row"-Zellen sind. Es handelt sich

dabei um Epithelzellen, die sich nahe dem Rand einer offenen Wunde befinden und für einen

raschen Wundverschluss verantwortlich sind. Sie müssen fähig sein zu migrieren und sich

Strukturveränderungen zu unterziehen. In den Sprr2a-überexprimierenden BECs kommt es

zur Dendritenbildung, zu Zellvergrößerungen, zu Verlusten von Zell-Zell-Kontakten und zu

einer partiellen EMT. E-cadherin, das für die Aufrechterhaltung von Zell-Zell-Kontakten

benötigt wird, und Cytokeratin 19 (CK-19), ein Zellstrukturprotein, werden vermindert

exprimiert (Demetris et al., 2008).

4.4.25.2 Embryonale Expressionsanalyse von Sprr2a

Expressionsmuster von Sprr2a im Wildtyp-Embryo

An E7.5 wird Sprr2a in den Zellen des embryonalen Ektoderms exprimiert (Abb. 37A,A'). Nur

im distalen Ektoderm bleibt der posteriore Pol von der Expression ausgespart (keine

Abbildung). Im extraembryonalen Gewebe wird Sprr2a im proximalen Mesoderm, in der

Allantois, im Chorion und im ektoplazentaren Kegel exprimiert (Abb. 37A). An E7.75 sind

Transkripte im Kopfmesoderm, in den anliegenden Neuralfalten und im posterioren

Mesoderm und Ektoderm nachweisbar (Abb. 37C). Im extraembryonalen Gewebe ist

weiterhin eine Expression in der Allantois und im Chorion zu erkennen (Abb. 37C).

Expressionsmuster von Sprr2a in der Eomes-Mutante

An E7.5 wird Sprr2a im gesamten Epiblast des Embryos exprimiert (Abb. 37B).


Ergebnisse 96

4.4.25.3 Zusammenfassende Darstellung von Sprr2a

Wird Eomes nicht exprimiert, ist die Expression von Sprr2a im Embryo um das 2,62-fache

erhöht. Im Microarray der Zellen ist die Expression sogar 20,34-fach erhöht. Sprr2a ist somit

das Gen, dessen Expression in den Eomes-defizienten Zellen am stärksten erhöht ist.

An E7.5 wird Sprr2a nur im embryonalen Ektoderm exprimiert (Abb. 37A,A'). Die Zellen des

Ektoderms gehen aus dem Epiblast hervor. Die Entwicklung dieser Zelllinie ist in den

Eomes-Mutanten nicht beeinträchtigt, weshalb Sprr2a hier weiterhin exprimiert wird (Abb.

37B). Wird Sprr2a vermehrt exprimiert, kommt es zu einer verminderten Expression von E-

cadherin und zu einer Lockerung der Zell-Zell-Kontakte (Demetris et al., 2008). Die Zellen

erlangen die Fähigkeit zu migrieren. Eomes scheint die Expression von Sprr2a

normalerweise zu hemmen, da es sowohl in den Eomes-defizienten Embryonen als auch in

den Eomes-defizienten Zellen verstärkt exprimiert wird und die Zellmigration in den Mutanten

somit gefördert wird. Diese Regulation von Sprr2a kann demnach nicht den Migrationsdefekt

der Mesodermzellen in den Eomes-Mutanten erklären.

4.4.26 Transmembrane protein 63a (Tmem63a)

Wildtyp

Eomes-Mutante

Abbildung 38: Die Expression von Tmem63a im Wildtyp-Embryo und in der Eomes-Mutante an E7.5. An

E7.5 wird Tmem63a im Wildtyp-Embryonen nicht exprimiert (A). An E7.5 können in der Eomes-Mutante

Transkripte im embryonalen Gewebe nachgewiesen werden (B).

4.4.26.1 Kurzbeschreibung

Funktion von Tmem63a

Bisher ist über die Funktion von Tmem63a nichts bekannt.

4.4.26.2 Embryonale Expressionsanalyse von Tmem63a

Expressionsmuster von Tmem63a im Wildtyp-Embryo

An E7.5 wird Tmem63a in den Wildtyp-Embryonen nicht exprimiert (Abb. 38A).


Ergebnisse 97

Expressionsmuster von Tmem63a in der Eomes-Mutante

An E7.5 wird Tmem63a in embryonalen Geweben der Eomes-Mutante exprimiert (Abb. 38B).

4.4.26.3 Zusammenfassende Darstellung von Tmem63a

Wird Eomes nicht exprimiert, ist die Expression von Tmem63a im Embryo 1,58-fach erhöht.

Die Ergebnisse der WISH bestätigen die Resultate des Microarrays, da Tmem63a in der

Eomes-Mutante (Abb. 38B) im Gegensatz zu den Wildtyp-Embryonen (Abb. 38A) verstärkt

exprimiert wird.


Diskussion 98

5. DISKUSSION

5.1. Allgemeine Auswertung der Ergebnisse

In dieser Arbeit konnte gezeigt werden, dass Gene, die an der Herz- und

Blutgefäßentwicklung beteiligt sind, in den Eomes-Mutanten deutlich vermindert exprimiert

werden. Die Annahme, Eomes sei direkt an der Entwicklung dieser aus dem Mesoderm

hervorgehenden Gewebe beteiligt, konnte mit weiteren, zeitgleich durchgeführten

genetischen Versuchen und Zellexperimenten der Arbeitsgruppe von Dr. Sebastian Arnold

bestätigt werden. Die Resultate der hier durchgeführten WISHs waren maßgeblich daran

beteiligt nachzuweisen, dass Eomes für die Entstehung des kardialen und vaskulären

Mesoderms essentiell benötigt wird. Diese Ergebnisse wurden in Costello et al., 2011

veröffentlicht.

5.1.1 Eomes reguliert die embryonale Herzentwicklung

In den Eomes-Mutanten werden Gene, die für die Herzentwicklung benötigt werden,

vermindert (Klhl6, Capn6, Smarcd3) oder gar nicht (Wnt2) exprimiert. Es konnten zwei neue,

frühe Herzmarker, Klhl6 und Capn6, identifiziert werden. Sie werden ab E7.5 in den

kardialen Progenitorzellen exprimiert. Klhl6 war bisher nur als Blutgefäßmarker bekannt

(Kroll et al., 2005), wohingegen Capn6 bereits als später Herzmarker (E11.5) beschrieben

wurde (Dear et al., 1999). Smarcd3 und Wnt2 sind aus der Literatur als Herzmarker bekannt,

die bereits ab E7.5 in den kardialen Vorläuferzellen exprimiert werden (Lickert et al., 2004;

Monkley et al., 1996). Diese vier Gene werden im Microarray der Eomes-defizienten

Embryonen vermindert exprimiert, wobei Klhl6 die höchste Foldchange (-3,34) unter ihnen

aufweist. Warum wird gerade Klhl6 zum Zeitpunkt E7.5 in einigen Zellen des mutanten PS

exprimiert, wohingegen keinerlei Expression von Wnt2 (Foldchange -2,56) in den Eomes-

Mutanten nachweisbar ist? Wnt2 wird an E7.5 in den kardialen Progenitorzellen exprimiert,

die in den Mutanten nicht gebildet werden. Folglich kann keinerlei Wnt2-Expression in den

Eomes-defizienten Embryonen nachgewiesen werden.

In Wildtyp-Embryonen wird Klhl6 zu diesem Zeitpunkt der Entwicklung, ebenso wie Capn6

und Smarcd3, nicht nur in den kardialen Progenitorzellen, sondern ebenfalls in Zellen des

extraembryonalen Mesoderms exprimiert (Abb. 5). In den Eomes-Mutanten werden diese

Gene in Zellen des mutanten PS exprimiert (Abb. 5). Die Expressionsdomänen sind jedoch


Diskussion 99

kleiner als in den Wildtyp-Embryonen, da die kardiovaskulären Progenitorzellen, in denen

Klhl6, Capn6 und Smarcd3 normalerweise exprimiert werden, in den Eomes-defizienten

Embryonen nicht gebildet werden. Folglich handelt es sich bei diesen gefärbten Zellen am

ehesten um Zellen, aus denen das extraembryonale Mesoderm hervorgeht. Ihre Entstehung

ist in den Mutanten nicht gestört. Ein Migrationsdefekt hindert sie jedoch daran in ihre

Zielregion auszuwandern.

Da nachgewiesen werden konnte, dass Eomes für die Entstehung der gemeinsamen

kardialen/ vaskulären Progenitorzelle benötigt wird (Costello et al., 2011), könnte es sich im

Fall von Klhl6 bei den im mutanten PS gefärbten Zellen nicht, wie vermutet, um Zellen des

extraembryonalen Mesoderms, sondern um vaskuläre Progenitorzellen handeln, die nicht an

der Herzentwicklung beteiligt sind, folglich in den Eomes-Mutanten weiterhin gebildet werden

und Klhl6 exprimieren können.

Das Herz ist das erste Organ, das während der Organogenese entsteht (Saga et al., 2000).

Seine Entwicklung beginnt um E6.5. Die frühen mesodermalen kardialen Progenitorzellen

gehen aus dem Mesoderm des anterioren PS hervor und werden bereits sehr früh während

der Gastrulation spezifiziert. Diese Progenitorzellen wandern durch den PS und migrieren

zusammen mit dem kranialen Mesoderm zum anterioren Pol des Embryos (Saga et al.,

2000). Die kardialen Vorläuferzellen werden zunächst bilateral symmetrisch im PS angelegt,

treffen anterior in der Mittellinie aufeinander, und bilden zusammen die halbmondförmige

primäre Herzanlage, aus der der Herzschlauch gebildet wird. Dieser führt anschließend eine

Drehung durch, aus der nach einer Interseptierung eine viergekammerte Herzstruktur

hervorgeht. Es gibt verschiedene zentrale Regulatoren, wie Nkx2.5 (Lints et al., 1993), FMSlike

tyrosine kinase 1 (Flt1) (Yamaguchi et al., 1993), Mef2B/C (Molkentin et al., 1996),

Gata4 (Heikinheimo et al., 1994; Kuo et al., 1997), dHand/eHand-Gene (Srivastava et al.,

1995), Mesoderm posterior 1 (Mesp1) und Mesoderm posterior 2 (Mesp2) (Saga et al.,

2000), die an der Kardiogenese beteiligt sind.

In der Arbeit von Costello et al. wurden Analysen zur Markierung von Zelllinien während der

Entwicklung durchgeführt. Eomes-positive Zellen aus dem PS wurden durch die Expression

von Cre im Eomes-Locus (Eomes Cre ) in Kombination mit dem Cre-induzierbaren -

Galaktosidase (LacZ) - Reporter (ROSA26 R ) genetisch markiert. Interessanterweise kommt

es in den Eomes Cre ; ROSA26 R -Embryonen zum Zeitpunkt E8.5 und E9.5 zu einer Expression

von LacZ im Kopfmesenchym, im kardialen Mesoderm und im DE, aus dem das primitive

Darmrohr hervorgeht. In den Somiten, im intermediären Mesoderm und im

Seitenplattenmesoderm ist hingegen kaum LacZ-Aktivität nachweisbar. Durch Analysen von


Diskussion 100

Eomes-mutanten Embryonen konnte ebenfalls gezeigt werden, dass Eomes für die Bildung

des DE und des kardialen Mesoderms benötigt wird (Costello et al., 2011).

Werden Eomes-defiziente ES-Zellen in ROSA26 LacZ Blastozysten eingebracht, entstehen

chimäre Embryonen. Sie besitzen LacZ + Wildtyp-Zellen und LacZ - Eomes -/- -Zellen. In diesen

chimären Embryonen kann durch eine Färbung untersucht werden, ob Faktoren zellautonom

für die Entwicklung bestimmter Zelltypen benötigt werden. Die Gewebe des Darmrohrs und

des Herzens entstehen in diesen chimären Embryonen ausschließlich aus Eomes-Wildtyp-

Zellen, so dass gefolgert werden kann, dass Eomes zellautonom für die Bildung dieser

Gewebe benötigt wird (Costello et al., 2011).

Im Microarray der Embryonen konnte gezeigt werden, dass Mesp1 das Gen mit der

höchsten Reduktion der Expressionsstärke in den Eomes-Mutanten ist (Foldchange: -17,23).

Mesp1 gehört zur Familie der Basic helix-loop-helix (Bhlh) Transkriptionsfaktoren und ist

einer der Hauptregulatoren in der Spezifizierung von multipotenten, kardiovaskulären

Progenitorzellen. Es wird in den kardialen Progenitorzellen exprimiert, die sich zum Myokard

und Endokard entwickeln (Saga et al., 1998; Saga et al., 1999; Kitajima et al., 2000). Mesp1

ist als frühester kardiovaskulärer Marker identifiziert worden, wird zu Beginn der Gastrulation

(E6.5) im entstehenden PS exprimiert und markiert hier die kardialen Progenitorzellen. An

E7.5 sinkt seine Expression abrupt ab (Saga et al., 1999).

Mesp1 -/- - Embryonen bilden zwar kardiales Mesoderm, die Morphogenese des Herzens ist

jedoch gestört (Saga et al., 1998; Saga et al., 1999). In vivo kann die Funktion von Mesp1

teilweise durch Mesp2 ersetzt werden (Saga et al., 1998). In den Mesp1 -/- - Embryonen ist

eine gesteigerte Mesp2-Expression ausreichend, um die Ausprägung der kardialen

Entwicklungsstörungen zu reduzieren. Die kardialen Progenitorzellen werden zu einem

etwas späteren Zeitpunkt gebildet (Kitajima et al., 2000). Mesp1;Mesp2-Doppelmutanten

hingegen arretieren in ihrer Entwicklung im Stadium der Gastrulation. Sie sind dem Phänotyp

der Eomes -/- - Embryonen sehr ähnlich (Arnold et al., 2008a; Kitajima et al., 2000).

In Eomes-defizienten Embryonen wird Mesp1 zum Zeitpunkt E7.0 nicht exprimiert (Costello

et al., 2011). An E7.25 zeigt sich eine sehr schwache Expression von Mesp1 in nur einigen

wenigen Mutanten. Mesp2 wird hingegen nicht exprimiert (Saga et al., 1997). Mit qRT-PCR-

Experimenten ist nachweisbar, dass die Expressionen von Mesp1 und von Mesp2 in den

Eomes-Mutanten deutlich vermindert sind. Zusätzlich konnte gezeigt werden, dass Eomes in

seiner Funktion als Transkriptionsfaktor an regulatorische Enhancer-Elemente von Mesp1

und Mesp2 binden, und ihre Expression somit regulieren kann. Eomes nimmt somit direkten

Einfluss auf die Entstehung des Herzens (Costello et al., 2011).


Diskussion 101

5.1.2 Eomes beeinflusst die Entwicklung der Blutgefäße

Die Entwicklung des Herzens ist eng mit der Entstehung der Blutgefäße verbunden. Wu et

al. konnte zeigen, dass es für Kardiomyozyten und vaskuläre Zellen eine gemeinsame

Vorläuferzelle gibt (Wu et al., 2006). Vier Blutgefäßmarker, Rasgrp3, Etsrp71, Foxf1a und

Foxc1, die in dieser Arbeit untersucht wurden, werden in den Eomes-defizienten Embryonen

deutlich vermindert exprimiert. Die Expression von Klhl6, einem Herz- und Blutgefäßmarker

ist in den Eomes-Mutanten ebenfalls reduziert, wohingegen ausschließlich kardial

exprimierte Gene in den Eomes-Mutanten gar nicht mehr nachweisbar sind.

Klhl6, Rasgrp3, Etsrp71, Foxf1a und Foxc1 werden in den Mutanten weniger stark

exprimiert. Ein vollständiges Ausbleiben der Expression ist jedoch bei keinem dieser Gene

zu beobachten. Um welchen Zelltyp handelt es sich bei den gefärbten Zellen des mutanten

PS? Um diese Frage beantworten zu können, müssten sich weitere Zellexperimente

anschließen. Es konnte jedoch nachgewiesen werden, dass die Expression von Genen, die

als Blutgefäßmarker identifiziert werden konnten, in den Eomes-defizienten deutlich

vermindert exprimiert werden. Für die Differenzierung dieser Zellen wird Eomes benötigt. Es

stellt sich die Frage, ob es neben der gemeinsamen kardialen/ vaskulären Vorläuferzelle, die

in den Eomes-Mutanten nicht gebildet wird, noch weitere vaskuläre Vorläuferzellen gibt, die

nicht zur Herzentwicklung beitragen, nicht durch Eomes reguliert werden und somit weiterhin

in den Eomes-defizienten Embryonen exprimiert werden.

5.1.3 Ursache des Migrationsdefektes in den Eomes-Mutanten bleibt unklar

In den Eomes-defizienten Embryonen weisen die akkumulierenden Zellen des PS einen

Migrationsdefekt auf, der bisher mechanistisch noch nicht ausreichend erklärt werden

konnte. Eine mögliche Ursache besteht in der fehlerhaften Regulation der E-cadherin-

Transkription in den Eomes-Mutanten, die zu einer dysregulierten Zelladhäsion führen

könnte.

In dieser Arbeit konnten Gene identifiziert werden, die an der Aktivierung der Zellmigration

beteiligt sind, in den Eomes-Mutanten weniger stark exprimiert werden und somit an den

Migrationsstörungen der mesodermalen Zellen mitverantwortlich sein könnten. Es handelt

sich beispielsweise um Phlda2 (Zytoskelettorganisation (Frank et al., 2002; Dunwoodie et al.,

2002)), Foxf1a (Zellmigration), Foxc1 (Zellmigration (Mattiske et al., 2006)) und Capn6

(Mikrotubulistabilität (Tonami et al., 2007)).

Sprr2a, ein Protein, das Migrationsvorgänge aktiviert (Demetris et al., 2008), wird im

Microarray der Eomes-defizienten Zellen 20-fach vermehrt exprimiert und ist somit das Gen,


Diskussion 102

dessen Expression am stärksten erhöht ist. In den Eomes-defizienten Embryonen wird

Sprr2a ebenfalls vermehrt exprimiert (Foldchange: +2,62). Normalerweise hemmt Sprr2a die

Expression von E-cadherin. In den Eomes-Mutanten müsste es aufgrund der gesteigerten

Sprr2a-Expression zu einer verminderten E-cadherin-Expression kommen. Zell-Zell-Kontakte

müssten sich auflösen und die Migration müsste gefördert werden. Diese Regulation steht im

Widerspruch zu den nachweislich migrationsgehemmten Zellen des mutanten PS. Die

erhöhte Expression von Sprr2a kann demnach nicht für die gestörte Zellmigration und die

erhöhte Expression von E-cadherin in den Eomes-Mutanten verantwortlich sein.

Die uneinheitliche Expression der Migrationsregulatoren macht es unmöglich, ein für den

Migrationsdefekt hautpverantwortliches Gen zu identifizieren. Es scheint, dass sich dieser

Migrationsdefekt auf andere genetische Fehlregulationen begründet. Es müssen sich weitere

Untersuchungen anschließen, um die Regulation der Zellmigration im mutanten PS im Detail

zu verstehen.

5.1.4 Wird Eomes für die Entwicklung des VE benötigt?

In dieser Arbeit wurden drei Gene, Spink3, Pga5 und Arhgef3, identifiziert, die im Microarray

der Zellen stark vermindert exprimiert werden, im Microarray der Embryonen jedoch keine

Änderung ihrer Expressionsstärke zeigen. Spink3 wird normalerweise im embryonalen

Ektoderm und Endoderm exprimiert (Abb.27). Pga5 zeigt keine Expressionsdomäne in den

Wildtyp-Embryonen (Abb. 33) und Arhgef3 wird nur im extraembryonalen Gewebe exprimiert

(Abb. 30). Interessanterweise werden alle drei Gene in den Eomes-Mutanten im VE

exprimiert.

Der Unterschied in den Expressionsstärken entsteht durch die verschiedenen

Ausgangsmaterialen, die für die Microarrays benutzt wurden. Durch die Sox2.Cre-Deleter-

Linie ist die Deletion von Eomes im Embryo auf den Epiblast beschränkt, wohingegen es im

VE und in den extraembryonalen Geweben weiterhin exprimiert wird. Gene, die in diesen

beiden Geweben normalerweise exprimiert werden, wie beispielsweise Spink3 und Arhgef3,

sind somit nicht von der Eomes-Deletion betroffen und werden in den Eomes-Mutanten

folglich unverändert exprimiert. Im Microarray der Embryonen ist demnach kein großer

Expressionsunterschied zwischen den Wildtyp-Embryonen und den Eomes-defizienten

Embryonen zu erkennen (Foldchanges: Spink3: 1,04; Pga5: 1,07; Arhgef3: 1,11). In den

WISHs ist erkennbar, dass sowohl Spink3 als auch Arhgef3 in ähnlich großen Arealen in den

Wildtyp- und in den Eomes-defizienten Embryonen exprimiert wird. Interessanterweise wird

Pga5 in den Eomes-Mutanten in einem eng umschriebenen Areal im anterioren viszeralen

Endoderm exprimiert, zu dem kein Korrelat in den Wildtyp-Embryonen nachweisbar ist (Abb.


Diskussion 103

33 A,B). Warum es zu einer derartigen Aktivierung der Pga5-Expression in dieser Region

kommt, bleibt ungeklärt.

Für den Microarray der Zellen werden Zellkulturen verwendet, in denen keinerlei Transkripte

von Eomes nachweisbar sind. Spink3, Pga5 und Arhgef3 werden hier stark vermindert

exprimiert (Foldchanges: Spink3: -132; Pga5: -61,14; Arhgef3: -3,22). Da Eomes ein

Transkriptionsfaktor ist, ist es möglich, dass es die Transkription dieser drei Gene direkt

aktivieren kann. Es kann spekuliert werden, ob Eomes für die regelrechte Gentranskription

im VE benötigt wird. Eine gezielte Deletion von Eomes im VE könnte Aufschluss darüber

geben in wieweit die Entstehung dieses Gewebetyps durch Eomes reguliert wird.


Zusammenfassende Darstellung 104

6. ZUSAMMENFASSENDE DARSTELLUNG

Das Ziel dieser Arbeit war es, neue, direkte oder indirekte Zielgene von Eomes zu

identifizieren, um die embryonalen Funktionen von Eomes während der Gastrulation besser

verstehen zu können. Mit der Expressionsanalyse von 37 Genen im Gastrulationsstadium

konnte gezeigt werden, dass Eomes auf die Expression von funktionell unterschiedlichen

Genen Einfluss nimmt. Von herausragender Bedeutung ist dabei, dass gezeigt werden

konnte, dass Eomes in der frühen embryonalen Entwicklung (um E7.5) nicht nur für die

Entstehung des definitiven Endoderms, sondern ebenfalls für die Entwicklung der

kardiovaskulären Progenitorzellen benötigt wird. Klhl6 und Capn6 konnten dabei als neue,

frühe (ab E7.5) kardiale Marker identifiziert werden. Diese Ergebnisse sind kongruent zu der

Beobachtung, dass die Expression von Mesp1, dem frühesten bekannten Herzmarker, direkt

durch Eomes reguliert wird. Weitere Arbeiten müssen sich anschließen, um zu klären, ob

Eomes die Expression der neu entdeckten Herzmarker ebenfalls direkt oder aber indirekt

reguliert. Dass Eomes eine regulatorische Funktion in der Herz- und Blutgefäßentwicklung

ausübt, konnte anhand weiterer genetischer Experimente und Zellversuche gezeigt werden

und wurde in Costello et al. 2011 veröffentlicht.


Abkürzungsverzeichnis 105

7. ABKÜRZUNGSVERZEICHNIS

Abb.

Abbildung

Actc1 Actin, alpha, cardiac muscle 1

Actvs

Vascular smooth muscle a-actin

Akt

Protein Kinase B

AP

Alkalische Phosphatase

A-P-Achse

Anterior-Posteriore Achse

Arhgef3 Rho guanine nucleotide exchange factor 3

Bad

BCL2-associated agonist of cell death

Baf

BRG1/brm-associated factor

BBR

Böhringer Blocking Reagent

Bdnf

Brain-derived neurotrophic factor

BEC

Biliäre Epithelzelle

Bhlh

Basic helix-loop-helix

Bhlhb2 Class E basic helix-loop-helix protein 40

Bmp

Bone morphogenic protein

Bmper

BMP-binding endothelial regulator

Bp

Basenpaar

BRG1

SWI/SNF related, matrix associated, actin dependent

regulator of chromatin, subfamily a, member 4

Brm

SWI/SNF related, matrix associated, actin dependent

regulator of chromatin, subfamily a, member 2

BSA

Bovines Serumalbumin

BTB

Broad-Complex, Tramtrack and Bric a brac

C/EBP

CCAAT enhancer-binding protein β

C1-Domäne

Phorbol esters/diacylglycerol binding-Domäne

CA

Konditionales Allel

Capn5

Calpain5

Capn6

Calpain6

CBC

Crypt base columnar

CDC25

Cell division cycle 25 homolog

cDNA

komplementäre DNA

Cer1

Cerberus-like-1

CK-19 Cytokeratin 19

Coup-TfII Nuclear receptor subfamily 2, group F, member 2

Crabp1 Zytoplasmatisches Retinolsäure-bindendes Protein 1


Abkürzungsverzeichnis 106

Crabp2 Zytoplasmatisches Retinolsäure-bindendes Protein 2

Crbp

Cellular retinol binding proteins

Cre

cAMP Response Element

cTnT

Kardiales Troponin T

Cxcl12 Chemokine (C-X-C motif) ligand 12

Cxcr4 Chemokine (C-X-C motif) receptor 4

CYP26A1 Cytochrome P450, family 26, subfamily a, polypeptide 1

DAG

Diacylglycerol

DEPC

Diethyldicarbonat

DIG

Digoxygenin

Dkk4 Dickkopf homolog 4

Dll4 Delta-like 4

DMSO

Dimethylsulfoxid

DNA

Desoxyribonukleinsäure

Dnase

Desoxyribonuklease

DVE

Distales viszerales Endoderm

E.coli

Escherichia coli

EB

Embroid body

EDC

Epidermal differentiation complex

EDTA

Ethylendiamintetraacetat

EGF

Epidermal growth factor

EMT

Endotheliale-mesenchymale Transformation

Eomes

Eomesodermin

EphB4

Eph receptor B4

Erk

Extracellular-signal Regulated Kinase

Esm1 Endothelial cell-specific molecule 1

ES-Zelle

Embryonale Stammzelle

et al.

et altera

Et-1

Endothelin1

EtOH

Ethanol

Ets

E-twenty six

Etsrp71 Ets variant gene 2

ExE

Extraembryonales Ektoderm

Expr.

Expression

FC

Foldchange

Fgf

Fibroblast growth factor

Fgf 2 Fibroblast growth factor 1


Abkürzungsverzeichnis 107

Fgf4 Fibroblast growth factor 4

Fgf8 Fibroblast growth factor 8

Fgf 10 Fibroblast growth factor 10

Fgfr1 Fibroblast growth factor receptor 1

Flk1

Fetal liver kinase-1

Flt1 FMS-like tyrosine kinase 1

Foxa

Forkhead box protein A

Foxa2

Forkhead box A2

Foxc1

Forkhead box C1

Foxc2

Forkhead box C2

Foxd4

Forkhead box D4

Foxf1a

Forkhead (winged helix) box-Transkriptionsfaktor 1a

Frag. Lokal.

Fragmentlokalisation

Frag.gr.

Fragmentgröße

Frzb

Frizzled-related Protein

Galnt4

UDP-N-acetyl-alpha-D-galactosamine:

polypeptide N-acetylgalactosaminyltransferase 4

Gata1 GATA binding protein 1

Gata2 GATA binding protein 2

Gata6 GATA binding protein 6

Gef

Guanin-Nukleotid-Austauschfaktoren

Gpx2 Glutathione peroxidase 2

Grrp1 Glycine/arginine rich protein 1

GTP

Guanosintriphosphat

Hand1 Heart and neural crest derivatives expressed transcript 1

Hba-x

Hemoglobin X, alpha-like embryonic chain in Hba complex

Hes1 Hairy and enhancer of split 1

Hey2 Hairy/enhancer-of-split related with YRPW motif 2

Hhex

Hematopoietically expressed homeobox

Hnf-6 One cut domain, family member 1

ICM

Innere Zellmasse

Igfbp5 Insulin-like growth factor binding protein 5

IP 3

Inositoltrisphosphat

Irx

Iroquois related homeobox

Itg3

Integrin3

Itm2A

Integral membrane protein 2A

k.A.

keine Angabe


Abkürzungsverzeichnis 108

kb

Kilobase

kDa

KiloDalton

Klhl6 Kelch-like 6

LacZ

ß-Galaktosidase

Lars2

Leucyl-tRNA synthetase, mitochondrial

Lefty1 Left right determination factor 1

Lgr5 Leucine-rich repeat G protein-coupled receptor 5

MAB

Maleinsäure-Puffer

Map

Mitogen-activated protein

Map

Mitogen-activated protein

Mef2c

Myocyte enhancer factor 2C

Mek

Midkine

MeOH

Methanol

Mesp1 Mesoderm posterior 1

Mesp2 Mesoderm posterior 2

Mixl1 MIX1 homeobox-like 1

Mkx

Mohawk homeobox

ml

Milliliter

mM

Millimolar

mRNA

messenger-RNA

Msx2 Homeobox, msh-like 2

Myc

Myelocytomatosis oncogene

Myf5 Myogenic factor 5

NeuroD Eurogenic differentiation 1

ng

Nanogramm

Nkx1.2 NK1 transcription factor related, locus 2

Nkx2.1 NK2 homeobox 1

Nkx2-5 NK2 transcription factor related, locus 5

Nrp

Neural regeneration protein

Oct-4 POU domain, class 5, transcription factor 1

p53 Protein 53

pBS

pBluescript

PBS

Phosphate buffered saline

PCR

Polymerasekettenreaktion

P-D-Achse

Proximo-distale-Achse

Pdgf

Platelet-derived growth factor

Pdgf

Platelet derived growth factor


Abkürzungsverzeichnis 109

Pdgfb

Platelet derived growth factor, B polypeptide

Pdgfc

Platelet-derived growth factor, C polypeptide

Pdgfr

Platelet-derived growth factor receptor

PE

Primitives Endoderm

Pecam1 platelet/endothelial cell adhesion molecule 1

PEE

Proximale Epiblast Enhancer

PFA

Paraformaldehyd

Pga5 Pepsinogen 5

Ph

Patch

PH

Pleckstrin-homolog

Phlda2 Pleckstrin homology-like domain family A member 2

Pi 3

Inositoltrisphosphat

Pim

Proto-oncogene serine/threonine-protein kinase

Pim1 Proto-oncogene serine/threonine-protein kinase 1

Pim2 Proto-oncogene serine/threonine-protein kinase 2

Pim3 Proto-oncogene serine/threonine-protein kinase 3

PIP

Phosphatidylinositolphosphat

PIP 2

Phosphatidylinositol-4,5-bisphosphat

PK

Primitivknoten

Pkc

Proteinkinase C

Plc

Phospholipase C

PLC-y

Phospholipase C-y

PNS

Peripheres Nervensystem

PS

Primitivstreifen

P-Wert

Probability-Wert

qRT-PCR

Real time quantitative PCR

Raf

Rat fibrosarcoma

RAR-Rezeptor

Retinolsäure-Rezeptor

Ras

Rat sarcoma

Ras

Resistance to audiogenic seizures

Rasgrp RAS guanyl releasing protein 1

Rasgrp3

Ras guanyl releasing protein3

Ref-Sequenz

Referenzsequenz

REM

Ras exchange motive

Ret

Ret-Protoonkogen

RNA

Ribonukleinsäure

Rnase

Ribonuklease


Abkürzungsverzeichnis 110

rpm

round per minute

RT-PCR

Reverse Transkriptase-Polymerase-Kettenreaktion

s. siehe

Sall1 Sal-like 1

Sall3 Sal-like 3

Scl T cell acute lymphocytic leukemia 1

SFK

Src-Kinase-Familie

Shh

Sonic hedgehog

shRNA

small hairpin RNA

Smarcd3

SWI/SNF related matrix associated actin dependent

regulator of chromatin, subfamily d, member 3

Sos

Son-of-Sevenless

Sox2 SRY-box containing gene 2

Spin2 Spindlin family, member 2

Spink3 Serin-Peptidase-Inhibitor, Kazal Typ 3

Sprr

Small proline-rich

Sprr2a

Small proline-rich protein 2A

Stat1 Signal transducer and activator of transcription 1

Stat3 Signal transducer and activator of transcription 3

Stat5 Signal transducer and activator of transcription 5

SWI/SNF

SwItch/Sucrose NonFermentable

SZ

Stammzelle

Tab.

Tabelle

Tbx6 T-box 6

TE

Trophektoderm

Tgf

Transforming growth factor

Tgf

Transforming growth factor

Tgf1

Transforming growth factor, 1

Tie2

Endothelial-specific receptor tyrosine kinase

Tm

Tropomyosin

Tmem63a

Transmembrane protein 63a

Tn

Troponin

TnC

Troponin C

TnI

Inhibitorischen Troponin I

Tnnt2

Kardiales Troponin T

TnT

Tropomyosin-bindenden Troponin T

Tp

Thymidine phosphorylase


Abkürzungsverzeichnis 111

Trim67 Tripartite motif-containing 67

TSH

Thyreoidea-stimulierendes Hormon

unspez.

unspezifisch

Upp1

Uridin Phosphorylase1

UTR

Untranslatierte Region

UV

Ultraviolett

Vcam1

Vascular cell adhesion molecule

VE

Viszerales Endoderm

Vegf

Vascular endothelial growth factor

Vegfr

Vascular endothelial growth factor

Vstm2b

V-set and transmembrane domain containing 2B

WISH

Whole mount in situ Hybridisierung

Wnt

Wingless-related MMTV integration site

Wnt2 Wingless-related MMTV integration site 2

ZNS

zentrales Nervensystem


Literaturverzeichnis 112

8. LITERATURVERZEICHNIS

Adam M, Pogacic V, Bendit M, Chappuis R, Nawijn MC, Duyster J, Fox CJ, Thompson CB,

Cools J, Schwaller J (2006), Targeting PIM kinases impairs survival of hematopoietic

cells transformed by kinase inhibitor-sensitive and kinase inhibitor-resistant forms of

Fms-like tyrosine kinase 3 and BCR/ABL. Cancer Res. 66(7):3828-35.

Adams J, Kelso R, Cooley L (2000), The kelch repeat superfamily of proteins: propellers of

cell function. Trends Cell Biol. 10(1):17-24.

Ahmad F, Banerjee SK, Lage ML, Huang XN, Smith SH, Saba S, Rager J, Conner DA,

Janczewski AM, Tobita K, Tinney JP, Moskowitz IP, Perez-Atayde AR, Keller BB,

Mathier MA, Shroff SG, Seidman CE, Seidman JG (2008), The role of cardiac troponin T

quantity and function in cardiac development and dilated cardiomyopathy. PLoS One.

3(7):e2642.

Aho TL, Sandholm J, Peltola KJ, Mankonen HP, Lilly M, Koskinen PJ (2004), Pim-1 kinase

promotes inactivation of the pro-apoptotic Bad protein by phosphorylating it on the

Ser112 gatekeeper site. FEBS Lett. 571(1-3):43-9.

Aksoy I, Sakabedoyan C, Bourillot PY, Malashicheva AB, Mancip J, Knoblauch K,

Afanassieff M, Savatier P (2007), Self-renewal of murine embryonic stem cells is

supported by the serine/threonine kinases Pim-1 and Pim-3. Stem Cells. 25(12):2996-

3004.

Alexandrovich A, Arno M, Patient RK, Shah AM, Pizzey JA, Brewer AC (2006), Wnt2 is a

direct downstream target of GATA6 during early cardiogenesis. Mech Dev. 123(4):297-

311.

Allen JD, Berns A (1996), Complementation tagging of cooperating oncogenes in knockout

mice. Semin Cancer Biol. 7(5):299-306.

Allen JD, Verhoeven E, Domen J, van der Valk M, Berns A (1997), Pim-2 transgene induces

lymphoid tumors, exhibiting potent synergy with c-myc. Oncogene. 15(10):1133-41.

Amson R, Sigaux F, Przedborski S, Flandrin G, Givol D, Telerman A (1989), The human

protooncogene product p33pim is expressed during fetal hematopoiesis and in diverse

leukemias. Proc. Natl. Acad. Sci. U S A. 86(22):8857-61.

Ara T, Nakamura Y, Egawa T, Sugiyama T, Abe K, Kishimoto T, Matsui Y, Nagasawa T

(2003), Impaired colonization of the gonads by primordial germ cells in mice lacking a

chemokine, stromal cell-derived factor-1 (SDF-1). Proc. Natl. Acad. Sci. U S A.

100(9):5319-23.

Ara T, Tokoyoda K, Okamoto R, Koni PA, Nagasawa T (2005), The role of CXCL12 in the

organ-specific process of artery formation. Blood. 105(8):3155-61.

Arnold SJ, Hofmann UK, Bikoff EK, Robertson EJ (2008a), Pivotal roles for eomesodermin

during axis formation, epithelium-to-mesenchyme transition and endoderm specification

in the mouse. Development. 135(3):501-11.

Arnold SJ, Huang GJ, Cheung AF, Era T, Nishikawa S, Bikoff EK, Molnár Z, Robertson EJ,

Groszer M (2008b), The T-box transcription factor Eomes/Tbr2 regulates neurogenesis

in the cortical subventricular zone. Genes Dev. 22(18):2479-84.

Arnold SJ, Robertson EJ (2009a), Making a commitment: cell lineage allocation and axis

patterning in the early mouse embryo. Nat Rev Mol Cell Biol. 10(2):91-103.

Arnold SJ, Sugnaseelan J, Groszer M, Srinivas S, Robertson EJ (2009), Generation and

analysis of a mouse line harboring GFP in the Eomes/Tbr2 locus. Genesis. 47(11):775-

81.

Astorga J, Carlsson P (2007), Hedgehog induction of murine vasculogenesis is mediated by

Foxf1 and Bmp4. Development. 134(20):3753-61.

Avizienyte E, Fincham VJ, Brunton VG, Frame MC (2004), Src SH3/2 domain-mediated

peripheral accumulation of Src and phospho-myosin is linked to deregulation of E-

cadherin and the epithelial-mesenchymal transition. Mol Biol Cell. 15(6):2794-803.


Literaturverzeichnis 113

Bachmann M, Moroy T (2005), The serine/threonine kinase Pim-1. Int J Biochem Cell Biol.

37(4):726-30.

Barker N, van Es JH, Kuipers J, Kujala P, van den Born M, Cozijnsen M, Haegebarth A,

Korving J, Begthel H, Peters PJ, Clevers H (2007), Identification of stem cells in small

intestine and colon by marker gene Lgr5. Nature. 449(7165):1003-7.

Barr FG (2001), Gene fusions involving PAX and FOX family members in alveolar

rhabdomyosarcoma. Oncogene. 20(40):5736-46.

Batlle E, Sancho E, Franci C, Dominguez D, Monfar M, Baulida J, García De Herreros A

(2000), The transcription factor snail is a repressor of E-cadherin gene expression in

epithelial tumour cells. Nat Cell Biol. 2(2):84-9.

Baxter RM, Brissette JL (2002), Role of the nude gene in epithelial terminal differentiation. J

Invest Dermatol. 118(2):303-9.

Beddington RS, Robertson EJ (1999), Axis development and early asymmetry in mammals.

Cell. 96(2):195-209.

Bellusci S, Henderson R, Winnier G, Oikawa T, Hogan BL (1996), Evidence from normal

expression and targeted misexpression that bone morphogenetic protein (Bmp-4) plays

a role in mouse embryonic lung morphogenesis. Development. 122(6):1693-702.

Ben-Haim N. Lu C, Guzman-Ayala M, Pescatore L, Mesnard D, Bischofberger M, Naef F,

Robertson EJ, Constam DB (2006), The nodal precursor acting via activin receptors

induces mesoderm by maintaining a source of its convertases and BMP4. Dev. Cell.

11(3):313–323.

Blanpain C, Lowry WE, Geoghegan A, Polak L, Fuchs E (2004), Self-renewal, multipotency,

and the existence of two cell populations within an epithelial stem cell niche. Cell.

118(5):635-48.

Bloch-Gallego E, Causeret F, Ezan F, Backer S, Hidalgo-Sanchez M (2005), Development of

precerebellar nuclei: instructive factors and intracellular mediators in neuronal migration,

survival and axon pathfinding. Brain Res Brain Res Rev. 49(2):253-66.

Boudjelal M, Taneja R, Matsubara S, Bouillet P, Dolle P, Chambon P (1997), Overexpression

of Stra13, a novel retinoic acid-inducible gene of the basic helix-loop-helix family, inhibits

mesodermal and promotes neuronal differentiation of P19 cells. Genes Dev.

11(16):2052-65.

Brown TA, McKnight SL (1992), Specificities of protein-protein and protein-DNA interaction of

GABP alpha and two newly defined ets-related proteins. Genes Dev. 6(12B):2502-12.

Bulfone A, Martinez S, Marigo V, Campanella M, Basile A, Quaderi N, Gattuso C,

Rubenstein JL, Ballabio A (1999), Expression pattern of the Tbr2 (Eomesodermin) gene

during mouse and chick brain development. Mech Dev. 84(1-2):133-8.

Cabral A, Voskamp P, Cleton-Jansen AM, South A, Nizetic D, Backendorf C (2001),

Structural organization and regulation of the small proline-rich family of cornified

envelope precursors suggest a role in adaptive barrier function. J Biol Chem.

276(22):19231-7.

Cai CL, Liang X, Shi Y, Chu PH, Pfaff SL, Chen J, Evans S (2003), Isl1 identifies a cardiac

progenitor population that proliferates prior to differentiation and contributes a majority of

cells to the heart. Dev Cell. 5(6):877-89.

Cano A, Perez-Moreno MA, Rodrigo I, Locascio A, Blanco MJ, del Barrio MG, Portillo F,

Nieto MA (2000), The transcription factor snail controls epithelial-mesenchymal

transitions by repressing E-cadherin expression. Nat Cell Biol. 2(2):76-83.

Cao D, Leffert JJ, McCabe J, Kim B, Pizzorno G (2005), Abnormalities in uridine homeostatic

regulation and pyrimidine nucleotide metabolism as a consequence of the deletion of the

uridine phosphorylase gene. J Biol Chem. 280(22):21169-75.

Carmeliet P, Ferreira V, Breier G, Pollefeyt S, Kieckens L, Gertsenstein M, Fahrig M,

Vandenhoeck A, Harpal K, Eberhardt C, Declercq C, Pawling J, Moons L, Collen D,

Risau W, Nagy A (1996), Abnormal blood vessel development and lethality in embryos

lacking a single VEGF allele. Nature. 380:435–439.

Chao MV (2003), Neurotrophins and their receptors: a convergence point for many signalling

pathways. Nat Rev Neurosci. 4(4):299-309.

Ciruna BG, Rossant J (1999), Expression of the T-box gene Eomesodermin during early


Literaturverzeichnis 114

mouse development. Mech Dev. 81(1-2):199-203.

Claesson-Welsh L (1994), Platelet-derived growth factor receptor signals. J Biol Chem. 269:

32023-6

Clark KL, Halay ED, Lai E, Burley SK (1993), Co-crystal structure of the HNF-3/fork head

DNA-recognition motif resembles histone H5. Nature. 364(6436):412-20.

Cohen ED, Wang Z, Lepore JJ, Lu MM, Taketo MM, Epstein DJ, Morrisey EE (2007),

Wnt/beta-catenin signaling promotes expansion of Isl-1-positive cardiac progenitor cells

through regulation of FGF signaling. J Clin Invest. 117(7):1794-804.

Cong R, Jiang X, Wilson CM, Hunter MP, Vasavada H, Bogue CW (2006), Hhex is a direct

repressor of endothelial cell-specific molecule 1 (ESM-1). Biochem Biophys Res

Commun. 346(2):535-45.

Costello I, Pimeisl IM, Dräger S, Bikoff EK, Robertson EJ, Arnold SJ (2011), The T-box

transcription factor Eomesodermin acts upstream of Mesp1 to specify cardiac mesoderm

during mouse gastrulation. Nat Cell Biol. 13(9); 1084-1091.

Coughlin JJ, Stang SL, Dower NA, Stone JC (2005), RasGRP1 and Rasgrp3 regulate B cell

proliferation by facilitating B cell receptor-Ras signaling. J Immunol. 175(11):7179-84.

Cross JC (2000), Genetic insights into trophoblast differentiation and placental

morphogenesis. Semin Cell Dev Biol. 11(2):105-13.

De Haro L, Janknecht R (2005), Cloning of the murine ER71 gene (Etsrp71) and initial

characterization of its promoter. Genomics. 85(4):493-502.

De la Serna IL, Ohkawa Y, Imbalzano AN (2006), Chromatin remodelling in mammalian

differentiation: lessons from ATP-dependent remodellers. Nat Rev Genet. 7(6):461-73.

Dear N, Matena K, Vingron M, Boehm T (1997), A new subfamily of vertebrate calpains

lacking a calmodulin-like domain: implications for calpain regulation and evolution.

Genomics. 45(1):175-84.

Dear TN, Boehm T (1999), Diverse mRNA expression patterns of the mouse calpain genes

Capn5, Capn6 and Capn11 during development. Mech Dev. 89(1-2):201-9.

Debril MB, Gelman L, Fayard E, Annicotte JS, Rocchi S, Auwerx J (2004), Transcription

factors and nuclear receptors interact with the SWI/SNF complex through the BAF60c

subunit. J Biol Chem. 279(16):16677-86.

Demetris AJ, Specht S, Nozaki I, Lunz JG, 3rd, Stolz DB, Murase N, Wu T (2008), Small

proline-rich proteins (SPRR) function as SH3 domain ligands, increase resistance to

injury and are associated with epithelial-mesenchymal transition (EMT) in

cholangiocytes. J Hepatol. 48(2):276-88.

Dunwoodie SL, Beddington RS (2002), The expression of the imprinted gene Ipl is restricted

to extra-embryonic tissues and embryonic lateral mesoderm during early mouse

development. Int J Dev Biol. 46(4):459-66.

Eichmann A, Corbel C, Nataf V, Vaigot P, Breant C, Le Douarin NM (1997), Liganddependent

development of the endothelial and hemopoietic lineages from embryonic

mesodermal cells expressing vascular endothelial growth factor receptor 2. Proc Natl

Acad Sci U S A. 94(10):5141-6.

El Kouni MH, el Kouni MM, Naguib FN (1993), Differences in activities and substrate

specificity of human and murine pyrimidine nucleoside phosphorylases: implications for

chemotherapy with 5-fluoropyrimidines. Cancer Res. 53(16):3687-93.

Elices MJ, Osborn L, Takada Y, Crouse C, Luhowskyj S, Hemler ME, Lobb RR (1990),

VCAM-1 on activated endothelium interacts with the leukocyte integrin VLA-4 at a site

distinct from the VLA-4/fibronectin binding site. Cell. 60(4):577-84.

Elvert G, Kappel A, Heidenreich R, Englmeier U, Lanz S, Acker T, Rauter M, Plate K,

Sieweke M, Breier G, Flamme I (2003), Cooperative interaction of hypoxia-inducible

factor-2alpha (HIF-2alpha ) and Ets-1 in the transcriptional activation of vascular

endothelial growth factor receptor-2 (Flk-1). J Biol Chem. 278(9):7520-30.

Englund C, Fink A, Lau C, Pham D, Daza RA, Bulfone A, Kowalczyk T, Hevner RF (2005),

Pax6, Tbr2, and Tbr1 are expressed sequentially by radial glia, intermediate progenitor

cells, and postmitotic neurons in developing neocortex. J Neurosci. 25(1):247-51.

Englund C, Kowalczyk T, Daza RA, Dagan A, Lau C, Rose MF, Hevner RF (2006), Unipolar

brush cells of the cerebellum are produced in the rhombic lip and migrate through


Literaturverzeichnis 115

developing white matter. J Neurosci. 26(36):9184-95.

Ernfors P, Wetmore C, Olson L, Persson H (1990), Identification of cells in rat brain and

peripheral tissues expressing mRNA for members of the nerve growth factor family.

Neuron. 5(4):511-26.

Eswarakumar VP, Monsonego-Ornan E, Pines M, Antonopoulou I, Morriss-Kay GM, Lonai P

(2002), The IIIc alternative of Fgfr2 is a positive regulator of bone formation.

Development. 129(16):3783-93.

Ferdous A, Caprioli A, Iacovino M, Martin CM, Morris J, Richardson JA, Latif S, Hammer RE,

Harvey RP, Olson EN, Kyba M, Garry DJ (2009), Nkx2-5 transactivates the Ets-related

protein 71 gene and specifies an endothelial/endocardial fate in the developing embryo.

Proc. Natl. Acad. Sci. U S A. 106(3):814-9.

Ferrara N, Carver-Moore K, Chen H, Dowd M, Lu L, O'Shea KS, Powell-Braxton L, Hillan KJ,

Moore MW (1996), Heterozygous embryonic lethality induced by targeted inactivation of

the VEGF gene. Nature. 380(6573):439-42.

Fink AJ, Englund C, Daza RA, Pham D, Lau C, Nivison M, Kowalczyk T, Hevner RF (2006),

Development of the deep cerebellar nuclei: transcription factors and cell migration from

the rhombic lip. J Neurosci. 26(11):3066-76.

Foltmann B (1981), Gastric proteinases--structure, function, evolution and mechanism of

action. Essays Biochem. 17:52-84.

Fozard JR, Part ML, Prakash NJ, Grove J, Schechter PJ, Sjoerdsma A, Koch-Weser J

(1980), L-Ornithine decarboxylase:an essential role in early mammalian embryogenesis.

Science. 208(4443):505-8.

Frank D, Fortino W, Clark L, Musalo R, Wang W, Saxena A, Li CM, Reik W, Ludwig T, Tycko

B (2002), Placental overgrowth in mice lacking the imprinted gene Ipl. Proc. Natl. Acad.

Sci. U S A. 99(11):7490-5.

Garcia MI, Ghiani M, Lefort A, Libert F, Strollo S, Vassart G (2009), LGR5 deficiency

deregulates Wnt signaling and leads to precocious Paneth cell differentiation in the fetal

intestine. Dev Biol. 331(1):58-67.

Garry DJ, Yang Q, Bassel-Duby R, Williams RS (1997), Persistent expression of MNF

identifies myogenic stem cells in postnatal muscles. Dev Biol. 188(2):280-94.

Gitler AD, Lu MM, Jiang YQ, Epstein JA, Gruber PJ (2003), Molecular markers of cardiac

endocardial cushion development. Dev Dyn. 228(4):643-50.

Gorry P, Lufkin T, Dierich A, Rochette-Egly C, Decimo D, Dolle P, Mark M, Durand B,

Chambon P (1994), The cellular retinoic acid binding protein I is dispensable. Proc. Natl.

Acad. Sci. U S A. 91(19):9032-6.

Goss AM, Tian Y, Tsukiyama T, Cohen ED, Zhou D, Lu MM, Yamaguchi TP, Morrisey EE

(2009), Wnt2/2b and beta-catenin signaling are necessary and sufficient to specify lung

progenitors in the foregut. Dev Cell. 17(2):290-8.

Gurtner GC, Davis V, Li H, McCoy MJ, Sharpe A, Cybulsky MI (1995), Targeted disruption of

the murine VCAM1 gene: essential role of VCAM-1 in chorioallantoic fusion and

placentation. Genes Dev. 9(1):1-14.

Hancock SN, Agulnik SI, Silver LM, Papaioannou VE (1999), Mapping and expression

analysis of the mouse ortholog of Xenopus Eomesodermin. Mech Dev. 81(1-2):205-8.

Haraguchi M, Tsujimoto H, Fukushima M, Higuchi I, Kuribayashi H, Utsumi H, Nakayama A,

Hashizume Y, Hirato J, Yoshida H, Hara H, Hamano S, Kawaguchi H, Furukawa T,

Miyazono K, Ishikawa F, Toyoshima H, Kaname T, Komatsu M, Chen ZS, Gotanda T,

Tachiwada T, Sumizawa T, Miyadera K, Osame M, Yoshida H, Noda T, Yamada Y,

Akiyama S (2002), Targeted deletion of both thymidine phosphorylase and uridine

phosphorylase and consequent disorders in mice. Mol Cell Biol. 22(14):5212-21.

Hayashi H, Kume T (2008), Forkhead transcription factors regulate expression of the

chemokine receptor Cxcr4 in endothelial cells and CXCL12-induced cell migration.

Biochem Biophys Res Commun. 367(3):584-9.

Hayashi S, Lewis P, Pevny L, McMahon AP (2002), Efficient gene modulation in mouse

epiblast using a Sox2Cre transgenic mouse strain. Mech Dev. 119 Suppl 1:S97-S101.

Heanue TA, Pachnis V (2006), Expression profiling the developing mammalian enteric

nervous system identifies marker and candidate Hirschsprung disease genes. Proc.


Literaturverzeichnis 116

Natl. Acad. Sci. U S A. 103(18):6919-24.

Heikinheimo M, Scandrett JM, Wilson DB (1994), Localization of transcription factor GATA-4

to regions of the mouse embryo involved in cardiac development. Dev Biol. 164(2):361-

73.

Herrmann BG, Labeit S, Poustka A, King TR, Lehrach H (1990), Cloning of the T gene

required in mesoderm formation in the mouse. Nature. 343(6259):617-22.

Hogan B, Beddington R, Constantini F, Lacy E (1994), Manipulating the mouse embryo: A

Laboratory Manual, 2. Edition, Cold Spring Harbor Laboratory Press, NY, USA.

Hong HK, Lass JH, Chakravarti A (1999), Pleiotropic skeletal and ocular phenotypes of the

mouse mutation congenital hydrocephalus (ch/Mf1) arise from a winged helix/forkhead

transcriptionfactor gene. Hum Mol Genet. 8(4):625-37.

Horb ME, Thomsen GH (1999), Tbx5 is essential for heart development. Development.

126(8):1739–1751.

Hou J, Charters AM, Lee SC, Zhao Y, Wu MK, Jones SJ, Marra MA, Hoodless PA (2007), A

systematic screen for genes expressed in definitive endoderm by Serial Analysis of

Gene Expression (SAGE). BMC Dev Biol. 7:92.

Hsu SY, Kudo M, Chen T, Nakabayashi K, Bhalla A, van der Spek PJ, van Duin M, Hsueh AJ

(2000), The three subfamilies of leucine-rich repeat-containing G protein-coupled

receptors (LGR): identification of LGR6 and LGR7 and the signaling mechanism for

LGR7. Mol Endocrinol. 14(8):1257-71.

Hsu SY, Liang SG, Hsueh AJ (1998), Characterization of two LGR genes homologous to

gonadotropin and thyrotropin receptors with extracellular leucine-rich repeats and a G

protein-coupled, seven-transmembrane region. Mol Endocrinol. 12(12):1830-45.

Huber O, Bierkamp C, Kemler R (1996), Cadherins and catenins in development. Curr Opin

Cell Biol. 8(5):685-91.

Hughes M, Dobric N, Scott IC, Su L, Starovic M, St-Pierre B, Egan SE, Kingdom JC, Cross

JC (2004), The Hand1, Stra13 and Gcm1 transcription factors override FGF signaling to

promote terminal differentiation of trophoblast stem cells. Dev Biol. 271(1):26-37.

Hughes P, Bouillet P, Strasser A (2006), Role of Bim and other Bcl-2 family members in

autoimmune and degenerative diseases. Curr Dir Autoimmun. 9:74-94.

Hynes RO (1992), Integrins: versatility, modulation, and signaling in cell adhesion. Cell.

69(1):11-25.

Hynes RO (2002), Integrins: bidirectional, allosteric signaling machines. Cell. 110(6):673-87.

Intlekofer AM, Banerjee A, Takemoto N, Gordon SM, Dejong CS, Shin H, Hunter CA, Wherry

EJ, Lindsten T, Reiner SL (2008), Anomalous type 17 response to viral infection by

CD8+ T cells lacking T-bet and eomesodermin. Science. 321(5887):408-11.

Ishibashi M, Ang SL, Shiota K, Nakanishi S, Kageyama R, Guillemot F (1995), Targeted

disruption of mammalian hairy and Enhancer of split homolog-1 (HES-1) leads to upregulation

of neural helix-loop-helix factors, premature neurogenesis, and severe neural

tube defects. Genes Dev. 9(24):3136-48.

Ivanova AV, Ivanov SV, Danilkovitch-Miagkova A, Lerman MI (2001), Regulation of STRA13

by the von Hippel-Lindau tumor suppressor protein, hypoxia, and the UBC9/ubiquitin

proteasome degradation pathway. J Biol Chem. 276(18):15306-15.

Ivanova AV, Ivanov SV, Zhang X, Ivanov VN, Timofeeva OA, Lerman MI (2004), STRA13

interacts with STAT3 and modulates transcription of STAT3-dependent targets. J Mol

Biol. 340(4):641-53.

Iyer R, Jenkinson CP, Vockley JG, Kern RM, Grody WW, Cederbaum S (1998), The human

arginases and arginase deficiency. J Inherit Metab Dis. 21 Suppl 1:86-100.

Iyer RK, Yoo PK, Kern RM, Rozengurt N, Tsoa R, O'Brien WE, Yu H, Grody WW,

Cederbaum SD (2002), Mouse model for human arginase deficiency. Mol Cell Biol.

22(13):4491-8.

Jaks V, Barker N, Kasper M, van Es JH, Snippert HJ, Clevers H, Toftgård R (2008), Lgr5

marks cycling, yet long-lived, hair follicle stem cells. Nat Genet. 40(11):1291-9.

Jiang X, Tian F, Du Y, Copeland NG, Jenkins NA, Tessarollo L, Wu X, Pan H, Hu XZ, Xu K,

Kenney H, Egan SE, Turley H, Harris AL, Marini AM, Lipsky RH (2008), Bhlhb2 controls

Bdnf promoter 4 activity and neuronal excitability. J Neurosci. 28(5):1118-30.


Literaturverzeichnis 117

Kaestner KH, Lee KH, Schlöndorff J, Hiemisch H, Monaghan AP, Schütz G (1993), Six

members of the mouse forkhead gene family are developmentally regulated. Proc. Natl.

Acad. Sci. U S A. 90(16):7628-31.

Kaestner KH (2000), The hepatocyte nuclear factor 3 (HNF3 or FOXA) family in metabolism.

Trends Endocrinol Metab. 11(7):281-5.

Kageyama T (2002), Pepsinogens, progastricsins, and prochymosins: structure, function,

evolution, and development. Cell Mol Life Sci. 59(2):288-306.

Kalinichenko VV, Lim L, Stolz DB, Shin B, Rausa FM, Clark J, Whitsett JA, Watkins SC,

Costa RH (2001), Defects in pulmonary vasculature and perinatal lung hemorrhage in

mice heterozygous null for the Forkhead Box f1 transcription factor. Dev Biol.

235(2):489-506.

Kalinichenko VV, Zhou Y, Bhattacharyya D, Kim W, Shin B, Bambal K, Costa RH (2002),

Haploinsufficiency of the mouse Forkhead Box f1 gene causes defects in gall bladder

development. J Biol Chem. 277(14):12369-74.

Kappel A, Schlaeger TM, Flamme I, Orkin SH, Risau W, Breier G (2000), Role of SCL/Tal-1,

GATA, and ets transcription factor binding sites for the regulation of flk-1 expression

during murine vascular development. Blood. 96(9):3078-85.

Kattman SJ, Huber TL, Keller GM (2006), Multipotent flk-1+ cardiovascular progenitor cells

give rise to the cardiomyocyte, endothelial, and vascular smooth muscle lineages. Dev

Cell. 11(5):723-32.

Katz LC, Shatz CJ (1996), Synaptic activity and the construction of cortical circuits. Science.

274(5290):1133-8.

Kazal LA, Spicer DS, Brahinsky RA (1948), Isolation of a crystalline trypsin inhibitoranticoagulant

protein from pancreas. J Am Chem Soc. 70(9):3034-40.

Kazlauskas A (1994), Receptor tyrosine kinases and their targets. Curr Opin Genet Dev 4: 5-

14

Kidson SH, Kume T, Deng K, Winfrey V, Hogan BL (1999), The forkhead/winged-helix gene,

Mf1, is necessary for the normal development of the cornea and formation of the anterior

chamber in the mouse eye. Dev Biol. 211(2):306-22.

Kim IM, Zhou Y, Ramakrishna S, Hughes DE, Solway J, Costa RH, Kalinichenko VV (2005),

Functional characterization of evolutionarily conserved DNA regions in forkhead box f1

gene locus. J Biol Chem. 280(45):37908-16.

Kirstie A, Lawson, Juanito J, Meneses, Roger A, Pedersen (1991), Clonal analysis of

epiblast fate during germ layer formation in the mouse embryo. Development

113(3):891-911.

Kitajima S, Takagi A, Inoue T & Saga Y (2000), MesP1 and MesP2 are essential for the

development of cardiac mesoderm. Development 127(15):3215-26.

Kroll J, Shi X, Caprioli A, Liu HH, Waskow C, Lin KM, Miyazaki T, Rodewald HR, Sato TN

(2005), The BTB-kelch protein Klhl6 is involved in B-lymphocyte antigen receptor

signaling and germinal center formation. Mol Cell Biol. 25(19):8531-40.

Kume T, Deng K, Hogan BL (2000), Murine forkhead/winged helix genes Foxc1 (Mf1) and

Foxc2 (Mfh1) are required for the early organogenesis of the kidney and urinary tract.

Development. 127(7):1387-95.

Kume T, Deng KY, Winfrey V, Gould DB, Walter MA, Hogan BL (1998), The forkhead/winged

helix gene Mf1 is disrupted in the pleiotropic mouse mutation congenital hydrocephalus.

Cell. 93(6):985-96.

Kume T, Jiang H, Topczewska JM, Hogan BL (2001), The murine winged helix transcription

factors, Foxc1 and Foxc2, are both required for cardiovascular development and

somitogenesis. Genes Dev. 15(18):2470-82.

Kuo CT, Morrisey EE, Anandappa R, Sigrist K, Lu MM, Parmacek MS, Soudais C, Leiden JM

(1997), GATA4 transcription factor is required for ventral morphogenesis and heart tube

formation. Genes Dev. 11(8):1048-60.

Kwee L, Baldwin HS, Shen HM, Stewart CL, Buck C, Buck CA, Labow MA (1995), Defective

development of the embryonic and extraembryonic circulatory systems in vascular cell

adhesion molecule (VCAM-1) deficient mice. Development. 121(2):489-503.

Kwon GS, Hadjantonakis AK (2007), Eomes::GFP-a tool for live imaging cells of the


Literaturverzeichnis 118

trophoblast, primitive streak, and telencephalon in the mouse embryo. Genesis.

45(4):208-17.

Lai E, Clark KL, Burley SK, Darnell JE, Jr (1993), Hepatocyte nuclear factor 3/fork head or

"winged helix" proteins: a family of transcription factors of diverse biologic function. Proc.

Natl. Acad. Sci. U S A. 90(22):10421-3.

Laird PW, van der Lugt NM, Clarke A, Domen J, Linders K, McWhir J, Berns A, Hooper M

(1993), In vivo analysis of Pim-1 deficiency. Nucleic Acids Res. 21(20):4750-5.

Lamolet B, Pulichino AM, Lamonerie T, Gauthier Y, Brue T, Enjalbert A, Drouin J (2001), A

pituitary cell-restricted T-box factor, Tpit, activates POMC transcription in cooperation

with Pitx homeoproteins. Cell 104(6):849–859.

Lane MA, Xu J, Wilen EW, Sylvester R, Derguini F, Gudas LJ (2008), LIF removal increases

CRABPI and CRABPII transcripts in embryonic stem cells cultured in retinol or 4-

oxoretinol. Mol Cell Endocrinol. 280(1-2):63-74.

Lawson KA, Meneses JJ, Pedersen RA (1991), Clonal analysis of epiblast fate during germ

layer formation in the mouse embryo. Development.113(3):891-911.

Lee CS, Buttitta LA, May NR, Kispert A, Fan CM (2000), SHH-N upregulates Sfrp2 to

mediate its competitive interaction with WNT1 and WNT4 in the somitic mesoderm.

Development. 127(1):109-18.

Lee D, Park C, Lee H, Lugus JJ, Kim SH, Arentson E, Chung YS, Gomez G, Kyba M, Lin S,

Janknecht R, Lim DS, Choi K (2008), ER71 acts downstream of BMP, Notch, and Wnt

signaling in blood and vessel progenitor specification. Cell Stem Cell. 2(5):497-507.

Li YY, Popivanova BK, Nagai Y, Ishikura H, Fujii C, Mukaida N (2006), Pim-3, a protooncogene

with serine/threonine kinase activity, is aberrantly expressed in human

pancreatic cancer and phosphorylates bad to block bad-mediated apoptosis in human

pancreatic cancer cell lines. Cancer Res. 66(13):6741-7.

Lickert H, Takeuchi JK, Von Both I, Walls JR, McAuliffe F, Adamson SL, Henkelman RM,

Wrana JL, Rossant J, Bruneau BG (2004), Baf60c is essential for function of BAF

chromatin remodelling complexes in heart development. Nature. 432(7013):107-12.

Lim L, Kalinichenko VV, Whitsett JA, Costa RH (2002), Fusion of lung lobes and vessels in

mouse embryos heterozygous for the forkhead box f1 targeted allele. Am J Physiol Lung

Cell Mol Physiol. 282(5):L1012-22.

Lints TJ, Parsons LM, Hartley L, Lyons I, Harvey RP (1993), Nkx-2.5: a novel murine

homeobox gene expressed in early heart progenitor cells and their myogenic

descendants. Development. 119(2):419-31.

Lopez LC, Akman HO, Garcia-Cazorla A, Dorado B, Marti R, Nishino I, Tadesse S, Pizzorno

G, Shungu D, Bonilla E, Tanji K, Hirano M (2009), Unbalanced deoxynucleotide pools

cause mitochondrial DNA instability in thymidine phosphorylase-deficient mice. Hum Mol

Genet. 18(4):714-22.

Lu B, Figurov A (1997), Role of neurotrophins in synapse development and plasticity. Rev

Neurosci. 8(1):1-12.

Lu CC, Brennan J, Robertson EJ (2001), From fertilization to gastrulation: axis formation in

the mouse embryo. Curr Opin Genet Dev. 11(4):384-92.

Lyons I, Parsons LM, Hartley L, Li R, Andrews JE, Robb L, Harvey RP (1995), Myogenic and

morphogenetic defects in the heart tubes of murine embryos lacking the homeo box

gene Nkx2-5. Genes Dev. 9(13):1654-66.

Ma Q, Jones D, Borghesani PR, Segal RA, Nagasawa T, Kishimoto T, Bronson RT, Springer

TA (1998), Impaired B-lymphopoiesis, myelopoiesis, and derailed cerebellar neuron

migration in Cxcr4- and SDF-1-deficient mice. Proc. Natl. Acad. Sci. U S A. 95(16):9448-

53.

Mahlapuu M, Enerback S, Carlsson P (2001a), Haploinsufficiency of the forkhead gene

Foxf1, a target for sonic hedgehog signaling, causes lung and foregut malformations.

Development. 128(12):2397-406.

Mahlapuu M, Ormestad M, Enerback S, Carlsson P (2001b), The forkhead transcription

factor Foxf1 is required for differentiation of extra-embryonic and lateral plate mesoderm.

Development. 128(2):155-66.

Mahlapuu M, Pelto-Huikko M, Aitola M, Enerback S, Carlsson P (1998), FREAC-1 contains a


Literaturverzeichnis 119

cell-type-specific transcriptional activation domain and is expressed in epithelialmesenchymal

interfaces. Dev Biol. 202(2):183-95.

Malin D, Kim IM, Boetticher E, Kalin TV, Ramakrishna S, Meliton L, Ustiyan V, Zhu X,

Kalinichenko VV (2007), Forkhead box F1 is essential for migration of mesenchymal

cells and directly induces integrin-beta3 expression. Mol Cell Biol. 27(7):2486-98.

Martens JA, Winston F (2003), Recent advances in understanding chromatin remodeling by

Swi/Snf complexes. Curr Opin Genet Dev. 13(2):136-42.

Mattiske D, Kume T, Hogan BL (2006), The mouse forkhead gene Foxc1 is required for

primordial germ cell migration and antral follicle development. Dev Biol. 290(2):447-58.

Meadows KN, Bryant P, Pumiglia K (2001), Vascular endothelial growth factor induction of

the angiogenic phenotype requires Ras activation. J Biol Chem. 276(52):49289-98.

Molinari M, Carafoli E (1997), Calpain: a cytosolic proteinase active at the membranes. J

Membr Biol. 156(1):1-8.

Molkentin JD, Firulli AB, Black BL, Martin JF, Hustad CM, Copeland N, Jenkins N, Lyons G,

Olson EN (1996), MEF2B is a potent transactivator expressed in early myogenic

lineages. Mol Cell Biol. 16(7):3814-24.

Molkentin JD (2000), The zinc finger-containing transcription factors GATA-4, -5, and -6.

Ubiquitously expressed regulators of tissue-specific gene expression. J Biol Chem.

275(50):38949-52.

Monkley SJ, Delaney SJ, Pennisi DJ, Christiansen JH, Wainwright BJ (1996), Targeted

disruption of the Wnt2 gene results in placentation defects. Development. 122(11):3343-

53.

Moretti A, Caron L, Nakano A, Lam JT, Bernshausen A, Chen Y, Qyang Y, Bu L, Sasaki M,

Martin-Puig S, Sun Y, Evans SM, Laugwitz KL, Chien KR (2006), Multipotent embryonic

isl1+ progenitor cells lead to cardiac, smooth muscle, and endothelial cell diversification.

Cell. 127(6):1151-65.

Morita H, Mazerbourg S, Bouley DM, Luo CW, Kawamura K, Kuwabara Y, Baribault H, Tian

H, Hsueh AJ (2004), Neonatal lethality of LGR5 null mice is associated with

ankyloglossia and gastrointestinal distension. Mol Cell Biol. 24(22):9736-43.

Morris RJ, Liu Y, Marles L, Yang Z, Trempus C, Li S, Lin JS, Sawicki JA, Cotsarelis G

(2004), Capturing and profiling adult hair follicle stem cells. Nat Biotechnol. 22(4):411-7.

Morriss-Kay G (1993), Retinoic acid and craniofacial development: molecules and

morphogenesis. Bioessays. 15(1):9-15.

Nagasawa T, Hirota S, Tachibana K, Takakura N, Nishikawa S, Kitamura Y, Yoshida N,

Kikutani H, Kishimoto T (1996), Defects of B-cell lymphopoiesis and bone-marrow

myelopoiesis in mice lacking the CXC chemokine PBSF/SDF-1. Nature. 382(6592):635-

8.

Naiche LA, Harrelson Z, Kelly RG, Papaioannou VE (2005), T-box genes in vertebrate

development. Annu Rev Genet. 39:219-39.

Narlikar GJ, Fan HY, Kingston RE (2002), Cooperation between complexes that regulate

chromatin structure and transcription. Cell. 108(4):475-87.

Nichols J, Zevnik B, Anastassiadis K, Niwa H, Klewe-Nebenius D, Chambers I, Schöler H,

Smith A (1998), Formation of pluripotent stem cells in the mammalian embryo depends

on the POU transcription factor Oct4. Cell. 95(3):379-91.

Niinobu T, Ogawa M, Murata A, Nishijima J, Mori T (1990), Identification and characterization

of receptors specific for human pancreatic secretory trypsin inhibitor. J Exp Med.

172(4):1133-42.

Nishii K, Morimoto S, Minakami R, Miyano Y, Hashizume K, Ohta M, Zhan DY, Lu QW,

Shibata Y (2008), Targeted disruption of the cardiac troponin T gene causes sarcomere

disassembly and defects in heartbeat within the early mouse embryo. Dev Biol.

322(1):65-73.

Nishikawa SI, Nishikawa S, Hirashima M, Matsuyoshi N, Kodama H (1998), Progressive

lineage analysis by cell sorting and culture identifies FLK1+VE-cadherin+ cells at a

diverging point of endothelial and hemopoietic lineages. Development. 125(9):1747-57.

Niwa H, Toyooka Y, Shimosato D, Strumpf D, Takahashi K, Yagi R and Rossant J (2005),

Interaction between Oct3/4 and Cdx2 determines trophectoderm differentiation. Cell.


Literaturverzeichnis 120

123, 917-929.

Norris DP, Robertson EJ (1999), Asymmetric and node-specific nodal expression patterns

are controlled by two distinct cis-acting regulatory elements. Genes Dev. 13(12):1575-

88.

Ogawa M, Tsushima T, Ohba Y, Ogawa N, Tanaka S, Ishida M, Mori T (1985), Stimulation of

DNA synthesis in human fibroblasts by human pancreatic secretory trypsin inhibitor. Res

Commun Chem Pathol Pharmacol. 50(1):155-8.

Oh-hora M, Johmura S, Hashimoto A, Hikida M, Kurosaki T (2003), Requirement for Ras

guanine nucleotide releasing protein 3 in coupling phospholipase C-gamma2 to Ras in B

cell receptor signaling. J Exp Med. 198(12):1841-51.

Ohmuraya M, Hirota M, Araki M, Mizushima N, Matsui M, Mizumoto T, Haruna K, Kume S,

Takeya M, Ogawa M, Araki K, Yamamura K (2005), Autophagic cell death of pancreatic

acinar cells in serine protease inhibitor Kazal type 3-deficient mice. Gastroenterology.

129(2):696-705.

Ohtsuki I, Maruyama K, Ebashi S. Regulatory and cytoskeletal proteins of vertebrate skeletal

muscle (1986), Adv Protein Chem. 38:1-67.

Olson LE, Soriano P (2009), Increased Pdgfralpha activation disrupts connective tissue

development and drives systemic fibrosis. Dev Cell 16: 303-13

Ong DE (1982), Purification and partial characterization of cellular retinol-binding protein

from human liver. Cancer Res. 42(3):1033-7.

Ong DE (1984), A novel retinol-binding protein from rat. Purification and partial

characterization. J Biol Chem. 259(3):1476-82.

Orr-Urtreger A, Bedford MT, Do MS, Eisenbach L, Lonai P (1992), Developmental

expression of the alpha receptor for platelet-derived growth factor, which is deleted in

the embryonic lethal Patch mutation. Development 115: 289-303

Orr-Urtreger A, Lonai P (1992), Platelet-derived growth factor-A and its receptor are

expressed in separate, but adjacent cell layers of the mouse embryo. Development 115:

1045-58

Parenti R, Cicirata F (2004), Retinoids and binding proteins in the cerebellum during lifetime.

Cerebellum. 3(1):16-20.

Pearce EL, Mullen AC, Martins GA, Krawczyk CM, Hutchins AS, Zediak VP, Banica M,

DiCioccio CB, Gross DA, Mao CA, Shen H, Cereb N, Yang SY, Lindsten T, Rossant J,

Hunter CA, Reiner SL (2003), Control of effector CD8+ T cell function by the

transcription factor Eomesodermin. Science. 302(5647):1041-3.

Perea-Gomez A, Shawlot W, Sasaki H, Behringer RR, Ang S (1999), HNF beta and Lim1

interact in the visceral endoderm to regulate primitive streak formation and anterior–

posterior polarity in the mouse embryo. Development 126(20):4499–4511.

Perl AK, Wilgenbus P, Dahl U, Semb H, Christofori G (1998), A causal role for E-cadherin in

the transition from adenoma to carcinoma. Nature. 392(6672):190-3.

Peterson RS, Lim L, Ye H, Zhou H, Overdier DG, Costa RH (1997), The winged helix

transcriptional activator HFH-8 is expressed in the mesoderm of the primitive streak

stage of mouse embryos and its cellular derivatives. Mech Dev. 69(1-2):53-69.

Phillips HS, Hains JM, Laramee GR, Rosenthal A, Winslow JW (1990), Widespread

expression of BDNF but not NT3 by target areas of basal forebrain cholinergic neurons.

Science. 250(4978):290-4.

Pierrou S, Hellqvist M, Samuelsson L, Enerback S, Carlsson P (1994), Cloning and

characterization of seven human forkhead proteins: binding site specificity and DNA

bending. EMBO J. 13(20):5002-12.

Rice R, Rice DP, Olsen BR, Thesleff I (2003), Progression of calvarial bone development

requires Foxc1 regulation of Msx2 and Alx4. Dev Biol. 262(1):75-87.

Rice R, Rice DP, Thesleff I (2005), Foxc1 integrates Fgf and Bmp signalling independently of

twist or noggin during calvarial bone development. Dev Dyn. 233(3):847-52.

Roberts DM, Anderson AL, Hidaka M, Swetenburg RL, Patterson C, Stanford WL, Bautch VL

(2004), A vascular gene trap screen defines Rasgrp3 as an angiogenesis-regulated

gene required for the endothelial response to phorbol esters. Mol Cell Biol.

24(24):10515-28.


Literaturverzeichnis 121

Ross R, Raines EW, Bowen-Pope DF (1986), The biology of platelet-derived growth factor.

Cell 46: 155-69

Ruegg C, Dormond O, Mariotti A (2004), Endothelial cell integrins and COX-2: mediators and

therapeutic targets of tumor angiogenesis. Biochim Biophys Acta. 1654(1):51-67.

Russ AP, Wattler S, Colledge WH, Aparicio SA, Carlton MB, Pearce JJ, Barton SC, Surani

MA, Ryan K, Nehls MC, Wilson V, Evans MJ (2000), Eomesodermin is required for

mouse trophoblast development and mesoderm formation. Nature. 404(6773):95-9.

Ryan K, Butler K, Bellefroid E, Gurdon JB (1998), Xenopus eomesodermin is expressed in

neural differentiation. Mech Dev. 75(1-2):155-8.

Saga Y, Miyagawa-Tomita S, Takagi A, Kitajima S, Miyazaki J, Inoue T (1999), MesP1 is

expressed in the heart precursor cells and required for the formation of a single heart

tube. Development 126, 3437-3447.

Saga, Y (1998), Genetic rescue of segmentation defect in MesP2-deficient mice by MesP1

gene replacement. Mech. Dev. 75, 53-66.

Saga Y, Hata N, Koseki H & Taketo MM (1997), Mesp2: a novel mouse gene expressed in

the presegmented mesoderm and essential for segmentation initiation. Genes Dev. 11,

1827-1839.

Saga Y, Kitajima S, Miyagawa-Tomita S (2000), Mesp1 expression is the earliest sign of

cardiovascular development. Trends Cardiovasc Med. 10(8):345-52.

Sasaki H, Hogan BL (1993), Differential expression of multiple fork head related genes

during gastrulation and axial pattern formation in the mouse embryo. Development.

118(1):47-59.

Sato H, Murphy P, Giles S, Bannigan J, Takayasu H, Puri P (2008), Visualizing expression

patterns of Shh and Foxf1 genes in the foregut and lung buds by optical projection

tomography. Pediatr Surg Int. 24(1):3-11.

Savatier P, Lapillonne H, van Grunsven LA, Rudkin BB, Samarut J (1996), Withdrawal of

differentiation inhibitory activity/leukemia inhibitory factor up-regulates D-type cyclins and

cyclin-dependent kinase inhibitors in mouse embryonic stem cells. Oncogene.

12(2):309-22.

Saxena A, Morozov P, Frank D, Musalo R, Lemmon MA, Skolnik EY, Tycko B (2002),

Phosphoinositide binding by the pleckstrin homology domains of Ipl and Tih1. J Biol

Chem. 277(51):49935-44.

Schatteman GC, Morrison-Graham K, van Koppen A, Weston JA, Bowen-Pope DF (1992),

Regulation and role of PDGF receptor alpha-subunit expression during embryogenesis.

Development 115: 123-31

Scheving LA (1983), Primary amino acid sequence similarity between human epidermal

growth factor-urogastrone, human pancreatic secretory trypsin inhibitor, and members of

porcine secretin family. Arch Biochem Biophys. 226(2):411-3.

Schmidt A, Hall A (2002), The Rho exchange factor Net1 is regulated by nuclear

sequestration. J Biol Chem. 277(17):14581-8.

Schubert FR, Fainsod A, Gruenbaum Y, Gruss P (1995), Expression of the novel murine

homeobox gene Sax-1 in the developing nervous system. Mech Dev. 51(1):99-114.

Seifert RA, Hart CE, Phillips PE, Forstrom JW, Ross R, Murray MJ, Bowen-Pope DF (1989),

Two different subunits associate to create isoform-specific platelet-derived growth factor

receptors. J Biol Chem 264: 8771-8

Seo S, Fujita H, Nakano A, Kang M, Duarte A, Kume T (2006), The forkhead transcription

factors, Foxc1 and Foxc2, are required for arterial specification and lymphatic sprouting

during vascular development. Dev Biol. 294(2):458-70.

Seo S, Kume T (2006), Forkhead transcription factors, Foxc1 and Foxc2, are required for the

morphogenesis of the cardiac outflow tract. Dev Biol. 296(2):421-36.

Sessa A, Mao CA, Hadjantonakis AK, Klein WH, Broccoli V (2008), Tbr2 directs conversion

of radial glia into basal precursors and guides neuronal amplification by indirect

neurogenesis in the developing neocortex. Neuron. 60(1):56-69.

Shalaby F, Ho J, Stanford WL, Fischer KD, Schuh AC, Schwartz L, Bernstein A, Rossant J

(1997), A requirement for Flk1 in primitive and definitive hematopoiesis and

vasculogenesis. Cell. 89(6):981-90.


Literaturverzeichnis 122

Shalaby F, Rossant J, Yamaguchi TP, Gertsenstein M, Wu XF, Breitman ML, Schuh AC

(1995), Failure of blood-island formation and vasculogenesis in Flk-1-deficient mice.

Nature. 376(6535):62-6.

Shambaugh GE 3 rd (1979), Pyrimidine biosynthesis. Am J Clin Nutr. 32(6):1290-7.

Shaw G (1996), The pleckstrin homology domain: an intriguing multifunctional protein

module. Bioessays. 18(1):35-46.

Shiozaki H, Oka H, Inoue M, Tamura S, Monden M (1996), E-cadherin mediated adhesion

system in cancer cells. Cancer. 77(8 Suppl):1605-13.

Shirogane T, Fukada T, Muller JM, Shima DT, Hibi M, Hirano T (1999), Synergistic roles for

Pim-1 and c-Myc in STAT3-mediated cell cycle progression and antiapoptosis. Immunity.

11(6):709-19.

Showell C, Binder O, Conlon FL (2004), T-box genes in early embryogenesis. Dev Dyn.

229(1):201-18.

Soriano P (1997), The PDGF alpha receptor is required for neural crest cell development and

for normal patterning of the somites. Development 124: 2691-700

Sorrentino V, McKinney MD, Giorgi M, Geremia R, Fleissner E (1988), Expression of cellular

protooncogenes in the mouse male germ line: a distinctive 2.4-kilobase pim-1 transcript

is expressed in haploid postmeiotic cells. Proc. Natl. Acad. Sci. U S A. 85(7):2191-5.

Srivastava D, Cserjesi P, Olson EN (1995), A subclass of bHLH proteins required for cardiac

morphogenesis. Science. 270(5244):1995-9.

Stang SL, Lopez-Campistrous A, Song X, Dower NA, Blumberg PM, Wender PA, Stone JC

(2009), A proapoptotic signaling pathway involving RasGRP, Erk, and Bim in B cells.

Exp Hematol. 37(1):122-34.

Stout BA, Bates ME, Liu LY, Farrington NN, Bertics PJ (2004), IL-5 and granulocytemacrophage

colony-stimulating factor activate STAT3 and STAT5 and promote Pim-1

and cyclin D3 protein expression in human eosinophils. J Immunol. 173(10):6409-17.

Strasser A (2005), The role of BH3-only proteins in the immune system. Nat Rev Immunol.

5(3):189-200.

Sumanas S, Gomez G, Zhao Y, Park C, Choi K, Lin S (2008), Interplay among Etsrp/ER71,

Scl, and Alk8 signaling controls endothelial and myeloid cell formation. Blood.

111(9):4500-10.

Sun H, Lu B, Li RQ, Flavell RA, Taneja R (2001), Defective T cell activation and autoimmune

disorder in Stra13-deficient mice. Nat Immunol. 2(11):1040-7.

Sun H, Taneja R (2000), Stra13 expression is associated with growth arrest and represses

transcription through histone deacetylase (HDAC)-dependent and HDAC-independent

mechanisms. Proc. Natl. Acad. Sci. U S A. 97(8):4058-63.

Suomalainen M, Thesleff I (2010), Patterns of Wnt pathway activity in the mouse incisor

indicate absence of Wnt/beta-catenin signaling in the epithelial stem cells. Dev Dyn.

239(1):364-72.

Tachibana K, Hirota S, Iizasa H, Yoshida H, Kawabata K, Kataoka Y, Kitamura Y,

Matsushima K, Yoshida N, Nishikawa S, Kishimoto T, Nagasawa T (1998), The

chemokine receptor Cxcr4 is essential for vascularization of the gastrointestinal tract.

Nature. 393(6685):591-4.

Takahashi T, Shibuya M (1997), The 230 kDa mature form of KDR/Flk-1 (VEGF receptor-2)

activates the PLC-gamma pathway and partially induces mitotic signals in NIH3T3

fibroblasts. Oncogene. 14(17):2079-89.

Takeichi M (1995), Morphogenetic roles of classic cadherins. Curr Opin Cell Biol. 7(5):619-

27.

Tallquist MD, Soriano P (2003), Cell autonomous requirement for Pdgfralpha in populations

of cranial and cardiac neural crest cells. Development 130: 507-18

Tam PP, Loebel DA (2007), Gene function in mouse embryogenesis: get set for gastrulation.

Nat Rev Genet. 8(5):368-81.

Tamplin OJ, Kinzel D, Cox BJ, Bell CE, Rossant J, Lickert H (2008), Microarray analysis of

Foxa2 mutant mouse embryos reveals novel gene expression and inductive roles for the

gastrula organizer and its derivatives. BMC Genomics. 9:511.

Thin TH, Li L, Chung TK, Sun H, Taneja R (2007), Stra13 is induced by genotoxic stress and


Literaturverzeichnis 123

regulates ionizing-radiation-induced apoptosis. EMBO Rep. 8(4):401-7.

Thoenen H (1995), Neurotrophins and neuronal plasticity. Science. 270(5236):593-8.

Thomas P, Beddington R (1996), Anterior primitive endoderm may be responsible for

patterning the anterior neural plate in the mouse embryo. Curr Biol. 6(11):1487-96.

Tian Y, Yuan L, Goss AM, Wang T, Yang J, Lepore JJ, Zhou D, Schwartz RJ, Patel V,

Cohen ED, Morrisey EE (2010), Characterization and in vivo pharmacological rescue of

a Wnt2-Gata6 pathway required for cardiac inflow tract development. Dev Cell.

18(2):275-87.

Tomita K, Hattori M, Nakamura E, Nakanishi S, Minato N, Kageyama R (1999), The bHLH

gene Hes1 is essential for expansion of early T cell precursors. Genes Dev. 13(9):1203-

10.

Tonami K, Kurihara Y, Aburatani H, Uchijima Y, Asano T, Kurihara H (2007), Calpain 6 is

involved in microtubule stabilization and cytoskeletal organization. Mol Cell Biol.

27(7):2548-61.

Traut TW, Jones ME (1996), Uracil metabolism--UMP synthesis from orotic acid or uridine

and conversion of uracil to beta-alanine: enzymes and cDNAs. Prog Nucleic Acid Res

Mol Biol.;53:1-78.

Van Lohuizen M, Verbeek S, Krimpenfort P, Domen J, Saris C, Radaszkiewicz T, Berns A

(1989), Predisposition to lymphomagenesis in pim-1 transgenic mice: cooperation with c-

myc and N-myc in murine leukemia virus-induced tumors. Cell. 56(4):673-82.

Vleminckx K, Vakaet L Jr, Mareel M, Fiers W, van Roy F (1991), Genetic manipulation of E-

cadherin expression by epithelial tumor cells reveals an invasion suppressor role. Cell.

66(1):107-19.

Von Both I, Silvestri C, Erdemir T, Lickert H, Walls JR, Henkelman RM, Rossant J, Harvey

RP, Attisano L, Wrana JL (2004), Foxh1 is essential for development of the anterior

heart field. Dev Cell. 7(3):331-45.

Wang H, Gilner JB, Bautch VL, Wang DZ, Wainwright BJ, Kirby SL, Patterson C (207), Wnt2

coordinates the commitment of mesoderm to hematopoietic, endothelial, and cardiac

lineages in embryoid bodies. J Biol Chem. 282(1):782-91.

Wang J, Ohmuraya M, Hirota M, Baba H, Zhao G, Takeya M, Araki K, Yamamura K (2008),

Expression pattern of serine protease inhibitor kazal type 3 (Spink3) during mouse

embryonic development. Histochem Cell Biol. 130(2):387-97.

Wang Q, Reiter RS, Huang QQ, Jin JP, Lin JJ (2001), Comparative studies on the

expression patterns of three troponin T genes during mouse development. Anat Rec.

263(1):72-84.

Wang W, Xue Y, Zhou S, Kuo A, Cairns BR, Crabtree GR (1996), Diversity and

specialization of mammalian SWI/SNF complexes. Genes Dev. 10(17):2117-30.

White E (2003), The pims and outs of survival signaling: role for the Pim-2 protein kinase in

the suppression of apoptosis by cytokines. Genes Dev. 17(15):1813-6.

Willis SN, Adams JM (2005), Life in the balance: how BH3-only proteins induce apoptosis.

Curr Opin Cell Biol. 17(6):617-25.

Wingett D, Reeves R, Magnuson NS (1992), Characterization of the testes-specific pim-1

transcript in rat. Nucleic Acids Res. 20(12):3183-9.

Wu SM, Fujiwara Y, Cibulsky SM, Clapham DE, Lien CL, Schultheiss TM, Orkin SH (2006),

Developmental origin of a bipotential myocardial and smooth muscle cell precursor in the

mammalian heart. Cell. 127(6):1137-50.

Yamaguchi TP, Dumont DJ, Conlon RA, Breitman ML, Rossant J (1993), flk-1, an flt-related

receptor tyrosine kinase is an early marker for endothelial cell precursors. Development.

118(2):489-98.

Yamanaka Y, Tamplin OJ, Beckers A, Gossler A, Rossant J (2007), Live imaging and

genetic analysis of mouse notochord formation reveals regional morphogenetic

mechanisms. Dev Cell. 13(6):884-96.

Yan Q, Rosenfeld RD, Matheson CR, Hawkins N, Lopez OT, Bennett L, Welcher AA (1997),

Expression of brain-derived neurotrophic factor protein in the adult rat central nervous

system. Neuroscience. 78(2):431-48.

Yang JT, Rayburn H, Hynes RO (1995), Cell adhesion events mediated by alpha 4 integrins


Literaturverzeichnis 124

are essential in placental and cardiac development. Development. 121(2):549-60.

Yasunaga M, Tada S, Torikai-Nishikawa S, Nakano Y, Okada M, Jakt LM, Nishikawa S,

Chiba T, Era T, Nishikawa S (2005), Induction and monitoring of definitive and visceral

endoderm differentiation of mouse ES cells. Nat Biotechnol. 23(12):1542-50.

Yu H, Iyer RK, Yoo PK, Kern RM, Grody WW, Cederbaum SD (2002), Arginase expression

in mouse embryonic development. Mech Dev. 115(1-2):151-5.

Yun Z, Maecker HL, Johnson RS, Giaccia AJ (2002), Inhibition of PPAR gamma 2 gene

expression by the HIF-1-regulated gene DEC1/Stra13: a mechanism for regulation of

adipogenesis by hypoxia. Dev Cell. 2(3):331-41.

Zou YR, Kottmann AH, Kuroda M, Taniuchi I, Littman DR (1998), Function of the chemokine

receptor Cxcr4 in haematopoiesis and in cerebellar development. Nature.

393(6685):595-9.


Abbildungs- und Tabellenverzeichnis 125

9. ABBILDUNGS- UND TABELLENVERZEICHNIS

9.1. Abbildungen

Abb. 1: Die frühe Entwicklung der Maus von E2.5 bis E4.5 (Arnold et al.,2009a).................... 7

Abb. 2: Entstehung der P-D-Achse an E5.5 (Arnold et al., 2009a)........................................... 9

Abb. 3: Entwicklung des Embryos von E5.5 bis E7.5 (Beddington u. Robertson, 1999)........ 10

Abb. 4: Die Morphologie des Wildtyp-Embryos an E7.5 (Arnold et al., 2009a)...................... 11

Abb. 5: Gene, die ausschließlich im embryonalen Mesoderm exprimiert werden.................. 41

Abb. 6: Gene, die im Mesoderm, im PS und vereinzelt im Ektoderm exprimiert werden........42

Abb. 7: Gene, die unterschiedliche Expressionsmuster aufweisen........................................ 43

Abb. 8: Gene, die im extraembryonalen Gewebe oder gar nicht exprimiert werden.............. 44

Abb. 10: Unspezifische Expressionsmuster von neun Genen zum Zeitpunkt E7.5................ 45

Abb. 11: Das Expressionsmuster von Klhl6............................................................................ 46

Abb. 12: Das Expressionsmuster von Wnt2........................................................................... 48

Abb. 13: Das Expressionsmuster von Capn6......................................................................... 52

Abb. 14: Das Expressionsmuster von Smarcd3..................................................................... 55

Abb. 15: Das Expressionsmuster von Tnnt2.......................................................................... 58

Abb. 16: Das Expressionsmuster von Crabp1........................................................................ 60

Abb. 17: Das Expressionsmuster von Pdgfr......................................................................... 62

Abb. 18: Das Expressionsmuster von Etsrp71....................................................................... 65

Abb. 20: Das Expressionsmuster von Foxf1a........................................................................ 71

Abb. 21: Das Expressionsmuster von Vstm2b....................................................................... 75

Abb. 22: Das Expressionsmuster von Phlda2........................................................................ 77

Abb. 23: Das Expressionsmuster von Foxc1.......................................................................... 79

Abb. 24: Das Expressionsmuster von Upp1........................................................................... 84

Abb. 25 Das Expressionsmuster von Lgr5............................................................................ 86

Abb. 26: Das Expressionsmuster von Nkx1.2.........................................................................90

Abb. 27: Das Expressionsmuster von Spink3......................................................................... 92

Abb. 28: Das Expressionsmuster von Pim1............................................................................95

Abb. 29: Das Expressionsmuster von Bhlhb2........................................................................ 97

Abb. 30: Das Expressionsmuster von Arhgef3....................................................................... 99

Abb. 31: Das Expressionsmuster von Spin2.........................................................................101

Abb. 32: Das Expressionsmuster von Arginase1................................................................. 102

Abb. 33: Das Expressionsmuster von Pga5..........................................................................104


Abbildungs- und Tabellenverzeichnis 126

Abb. 36: Das Expressionsmuster von Esm1........................................................................ 106

Abb. 37: Das Expressionsmuster von Sprr2a....................................................................... 107

Abb. 38: Das Expressionsmuster von Tmem63a..................................................................110

9.2 Tabellen

Tab. 1: Übersicht über die 37 untersuchten Gene............................................................ 36-37

Tab. 2: Übersicht über die Genexpressionsmuster in den Wildtyp-Embryonen an E7.5........ 39

Tab. 3: Übersicht über die Genexpressionsmuster in den Eomes-Mutanten an E7.5........... 40


Lebenslauf 127

10. LEBENSLAUF

Die Seiten 127 und 128 (Lebenslauf und Danksagung) enthalten persönliche Daten. Sie sind

deshalb nicht Bestandteil der Online – Veröffentlichung.


Danksagung 128

11. DANKSAGUNG

Die Seiten 127 – 128 (Lebenslauf und Danksagung) enthalten persönliche Daten. Sie sind

deshalb nicht Bestandteil der Online – Veröffentlichung.

Weitere Magazine dieses Users
Ähnliche Magazine