t - JUWEL - Forschungszentrum Jülich

juwel.fz.juelich.de

t - JUWEL - Forschungszentrum Jülich

Inhaltsverzeichnls

Abkurzungen

I.

II.

1.

2.

4.

5.

6.

7.

8.

Einleitung

Material und Methoden

Chemikalien und Enzyme

Organismen und Plasmide

Nahrmedien und Kultivierungsbedingungen

Bestimmung des Bakterienwachstums

Zellernteund Zellaufschlufsmethoden

5.1 Zellernte

5.2 Zellaufschluls

5.3 Zellextraktion mit Perchlorsaure

Quantitative Bestimmung von Substraten und Produkten

6.1 HPLC-Bestimrnung von organischen Sauren

6.2 HPLC-Bestimmungvon Zuckern

6.3 Enzymatische Bestimmung von Nikotinamid Adenindinukleotiden

Bestimmung von Enzymaktivitaten und Proteinkonzentrationen

7.1 Bestimmungder 5-Ketoglukonat reduzierenden Aktivitaten

7.2 Bestimmung der Glukonat oxidierenden Aktivitaten

7.3 Bestimmung der NADPH-Oxidase-Aktivitat

7.4 BestLm---!!1nng der Enzymaktivitaten im Elektrophoresegel

7.5 Proteinbestimmung

Polyacrylamidgelelektrophoretische Auftrennung von Makromolekulen

8.1 SDS-Polyacrylm:nidgelelektrophorese

8.2 Native Polyacrylamidgelelektrophorese

Isolierung von Enzymen

9.1 Isolierung der Polyol: NADP'-5-Oxidorednktase aus G. oxydans

9.2 Isolierung der Glukonat; NADP'-5-Oxidoreduk".ase aus G. oxydans

9.3 Isolierung rekombinanter Glukonat: NADP+-5-0xidorednktase aus E. coli

10. Charakterisierung der Enzyme

10.1 Bestimmung der nativen Molekulargewichte

10.2 Bestimmung des Isoelektrischen Punktes

10.3 Aminoterminale Sequenzierung

1

7

7

8

9

11

12

12

12

13

13

13

14

15

16

16

16

17

17

17

18

18

19

19

19

20

21

22

22

23

24


5.

6.

Expression des Gens fur die NADPH-Oxidase aus

Saccharomyces carlsbergensis in G. oxydans

Charakterisierung der rekombinanten G. o.rydans-Stiimme

6.1 5-Ketoglukonatproduktivitittder rekombinanten Stamme

6.2 Bestimmung des intrazellularen 5-Ketoglukonatgehaltes

6.3 Bestimmung der NADP+/NADPH-Verllaltnisse

IV. Dlskussion

V. Zusammenfassung

VI. Llteraturverzeichnis

71

75

75

77

78

79

90

91


I. Einleitung

Die Gattung Gluconobacter besteht aus gram negativen, strikt aeroben, 0,5 - 0,8 11m breiten

und 0,9 - 4,2 11m langen, stabchenformigen Bakterien (De Ley und Swings, 1984). Sie gehort

wie die Gattung Acetobacter zur Familie der Essigsaurebakterien (De Ley und Frateur, 1970;

Swings, 1992) und beinhaltet nur eine Spezies, Gluconobacter oxydans, die sich ihrerseits in

funf Subspezies unterteilt: oxydans, industrius, suboxydans, melanogenes und sphaericus (De

Ley und Swings, 1984). Gluconobacter unterscheidet sich von Acetobacter durch einen

unvollstandigen Tricarbonsaure-Zyklus (Greenfield und Claus, 1972), so dafl Acetat durch

Gluconobacter nicht verwertet werden kann, L?} der Natur kommt Gluconobacter in stark

zuckerhaltigen Medlen wie Blutennektar und Fruchten vor (De Ley und Swings, 1984).

Gluconobacter oxydans besitzt Enzyme, die diesen Organismus fur die Biotechnologie sehr

interessant machen. Besondere Bedeutung haben hierbeiDehydrogenasen, die in der Lage sind,

nichtphosphorylierte Alkohole (Adachi et al., 1978) und Aldehyde (Adachi et al., 1980) zu oxi­

dieren, Bei der Umsetzung von Ethanol zu Essigaure (Takeda und Shimizu, 1992), bei der

Oxidation von D-Sorbit zu L-Sorbose fur die industrielle Ascorbinsauresynthese (Reichstein

una Grussner, 1934) und bei der Herstellung des Braunungsmittels Dihydroxyaceton aus

Glycerin (Claret et al., 1992) wird dieser Organismus eingesetzt,

Gluconobacter oxydans oxidiert Zucker tiber zwei verschiedene Stoffwechselwege, Nach

Phosphorylierung kann Glukose oder auch Glukonat tiber den Pentose-Phosphat-Weg zu CO 2

umgesetzt werden (Kitos et al., 1958). Der zweite Weg der oxidativen Glukoseumsetzung er­

folgt ohne Phosphorylierung und fuhrt uber Glukonat zur Bildung von 2-Ketoglukonat und 5­

Ketoglukonat (Olijve und Kale, 1979 a). Die Bildung von 2-Ketoglukonat erfolgt ebenso wie

die Bildung von Glukonat vorwiegend extrazellular durch membrangebundene, atmungsket­

tengekoppelte Dehydrogenasen (Pronk et al., 1989). Die entsprechenden Enzyme, eine Pyr-

rolochinolinchinon (pQQ)-abhangige Glukose Dehydrogenase (Ameyama et al., 1981) und die

2-Ketoglukonat bildende Glukonat Dehydrogenase (Shinagawa et al., 1976, 1984) konnten

isoliert und charakterisiert werden, Neben den membrangebundenen Enzymen besitzt

Gioxydans auch cytoplasmatische Aktivitaten, die in den Glukonat- und Ketoglukonatstoff­

wechsel involviert sind. Die Bildung von Glukonat mit der NADP+-abhangigen Glukose De­

hydrogenase (Pronk et al., 1989) und die Bildung von 2-Ketoglukonat durch die 2-Keto­

glukonat Reduktase (De Ley und Stouthamer, 1959) sowie die Bildung von 5-Ketoglukonat

durch die 5-Ketoglukonat Reduktase (Okamoto, 1963) wurden nachgewiesen, Die cyto­

plasmatischen, Ketoglukonat bildenden Enzyme wurden in der Literatur als Ketoglukonat

Reduktasenbezeichnet, da in vitro die Gleichgewichte der von ihnen katalysierten Reaktionen

1


Glucose DB:

KataJase

Abbildung 3: Zyklisches System zur Kofaktorregenerierung bei der 5-Ketoglukonatbildung durch G.

oxydans.

6 L Einleltang


5-Ketoglukonatproduktion mit G. oxytkrm

Die Produktion von 5-Ketoglukonat mit G. oxydans erfoIgte in 500 mL Schiittelkolben mit

100 mL Mineralsalzmedium, pH 6,0. Nach Anzucht von G. oxydans in Vollmedium bei 30°C

wurde die OD 600 bestimmt und das Produktionsmedium mit 20 % Vorkultur angeimpft, An­

schliefiend erfoIgte die Inkubationzur 5-Ketoglukonatprodllktion in Schuttelkolben bei 30°C.

Produktion bakterieller Zellmasse im 200 Liter MaI3stab

Zur Gewinnung grofserer Mengen Zellmasse fur die Isolierung der Enzyme aus G. oxydans

wurden Fermentationen im 200 Liter Mabstab durchgefuhrt, Dazu stand eine Fermentations­

einheit der Firma Chemap zur Verfugung, bestehend aus einem 30 Liter- und einem 300 Liter­

Fennenter, die uber eine sterilisierbare Transferleitung miteinander verbunden waren, Rei

beiden Fermentern konnten die Kulturparameter iiber eine separate Steuereinheit kontroiliert

und geregelt werden. Die Anzucht von G. oxydans DSM 3503 erfoIgte auf'Vollmedium mit 10

% Glukose, Der pH-Wert des Mediums wurde mit HCI aufpH 5,0 eingestellt und wahrend cler

Fermentation reguliert. Die Fermentationsbedingungen wurden wie folgt eingesteIlt:

Arbeitsvolumen:

pH-Titrationsmittel:

Antischaummittel:

Luftbegasung:

20 L (Vorfermenter)

200 L (Hauptfermenter)

5 M Phosphorsaure

10MNaOH

4 % Polypropylenglykol

500Upm

0,5vvm

Der Vorfermenter wurde mit 10 % Vorkultur angeimpft und nach 8 h Inkubation bei 30°C in

den Hauptfermenter uberfuhrt, Die Hauptkultur wurde nach 16 h Inkubation bei 30°C geemtet.

TriJbungsrnessUnl:!

Das Wachstum der Bakterienkultur wurde durch Bestimmung der optischen Dichte bei 600 urn

(Spektralphotometer UV-160, Shimadzu, Duisburg) verfolgt. Bei einer Extinktion tiber 0,5

wurden die Proben mit Wasser verdunnt, umdie.Proportionalitat zwischen Extinktion und

Zellkonzentration zu gewahrleisten.

II. Materiall!lld .Methoden 11


Die Bestirnmung der Extinktionsanderung bei 570 run erfolgte bei 30°C tiber den Zeitraum von

7 min. Eine interne Standardisierung erfolgte durch Zugabe von NADP+-Standardlosung (20­

50 J.1L 5 J.lM) zu den Extrakten.

Die quantitative Bestimmung von Enzymaktivitaten erfolgte mit Rohextrakten und gereinigtem

Enzym. Die photometrischen Messungen wurden bei der jeweils angegebenen Temperatur in

Glaskuvetten mit einer Schichtdicke von 1 cm (Spektralphotometer UV-160, Shimadzu, Duis­

burg) und in einem Reaktionsvolumen von 1 mL durchgefuhrt, Die Reaktionen wurden durch

Zugabe von Rohextrakt bzw. gereinigtem EI'.zyID gestartet. Die Extinktionsanderung durch

Umsetzung von Nikotinamid Adenindinukleotiden wurde bei 340 run mit dem Spektralphoto­

meter gemessen, Die spezifischen Enzymaktivitaten wurden in U/mg Protein angegeben, wobei

eine Enzymeinheit (l U) der Bildung von 1 umol Produkt pro Minute entsprach.

7.1 Bestimmang del' 5-Ketoglukonat reduzierenden Aktivititen

Bei der enzymatisch katalysierten Reduktion von 5-Ketoglukonat zu Glukonat wurde NADPH

zu NA..DP+ oxidiert. Der Reaktionsansatz im Testsystem setzte sich wie folgt zusammen

(Levering et al., 1988):

Testansatz

Kaliumphosphat-Puffer, pH 5

5-Ketogiukonat

NADPH

Enzymprobe

7.2 Bestimmung del' Glukonat exidlerenden Aktivitaten

Endkonz.

100mM

100 liM

150 JlM

Bei der enzymatisch katalysierten Oxidation von Glukonat zu 5-Ketoglukonat wurde NADP+

zu NADPH reduziert. Der Reaktionsansatz im Testsystem setzte sich wie .folgt zusammen

(Okamoto, 1963):

16

Testansatz

Natriumkarbonat-Puffer, pH 10

Glukonat

NADP+

Enzymprobe

Temperatur: 30°C

Endkonz,

100mM

300mM

0,5 rnM

n. Material und Method.n


Testansatz: Probe (0,2 - 1,5 mg Protein/ml.)

Reagenz A (Alkalische Kupfer-Tartrat-Losung)

Reagenz B (verdunntes FoIin-Reagenz)

25 ilL

125 ilL

1.000 ilL

Nach Inkubation des Gemisches (15 min, RT) wurde die Extinktion bei 750 nm bestimmt. Die

Extinktion blieb bis zu 1 h stabil.

8.1 SD8-Poiyacrylamid Gelelektrophorese

Die Auftrennung von Proteinen aus Rohextrakten und einzelnen Reinigungsschritten erfolgte

elektrophoretisch in SDS-Polyacrylamidgelen nach der Methode von Lammli (1970). Als Puf­

fersystem diente dabei Tris-Glycin (50 mM Tris, 384 mM Glycin, 0,1% SDS). Die Elektropho­

rese wurde bei konstanter Spannung (100 V) tiber den Zeitraum von 1 - 2 h durchgefuhrt. Als

Elektrophoreseapparatur wurde die V..ini-Protean-Zelle (Bio-Rad, Munchen) verwendet. Die

Probenvorbereitung erfolgte nach der Methode von Lammli (1970) und die Anfarbung der

Proteinbanden nach der Methode von Schagger und von Jagow (1987).

SDS-PAGE mit dem Phast-System (pharmacia. Freiburg)

Fur die routinemaliige, qualitative Auftrennung und den Nachweis von Proteinen wurde das

Phast-System sowie Phast-Fertiggele (Pharmacia, Freiburg) verwendet, Die Anftrennung

erfolgte nach dem Prinzip derdiskontinuierlichen Elektrophorese (Wyckoff et al., 1977) tiber

einen Zeitraum von zu min, Es wurden Phast-Gele mit Gradient (10 -15 %) una homogene

Phast-Gele (7,5 % und 12,5 %) verwendet, Die Farbung der Proteine erfolgte in der Farbe­

kammer des Phast-Systems.

Gel-Puffersystem: 0,112 M Acetat, 0,112 M Tris, pH 6,4

SDS-Pufferstreifen: 0,2 M Tricine, 0,2 M Tris, 0,55% SDS, pH 7,5

Die Proteinproben wurden nach der Methode von Lammli (1970) vorbereitet und enthielten

20- 30ngProtei.-!fIlL fur die anschliefiende Coomassie-Farbung (Neuhoff, 1985)oderO,5 0

1,5 ng Protein/llLfiir die empfindlichere Silberfarbung (Heukeshoven und Demick, .1985).

18 ll. Material und Methoden


10.3 Aminoterminale Sequenzierung

Fur die aminoterminale Aminosauresequenzierung wurden jeweils 100 ug der gereinigten Pro­

teine in Pro-Spin-CartridgesTM (Applied Biosystems) gefullt. Diese Ultrafiltrationseinheiten

waren so aufgebaut, daB Proteinlosungen ultrafiltriert werden konnten, tiber der Dialyse­

membran jedoch noch eine Polyvenylidenfluorid-Membran angebracht war, die Proteine binden

konnte und als Tragermaterial fur die spatere Sequenzierung diente. Die Proteine wurden

zunachst ultrafiltriert und mit 2 mL Aqua bidest gespult, urn Salzreste aus vorangegangenen

Chromatographieschritten zu entfernen. Durch Zentrifugation wurde das Protein quantitativ

auf die Membran transferiert. Diese Mernbran wurde aus der Ultrafiltrationseinheit ausge­

schnitten und einer aminoterminalen Aminosauresequenzierung (Edman und Begg, 1967) mit

einem Gasphasen-Sequenator (Applied Biosystems, model 470A) unterzogen. Der Nachweis

der abgespaltenen Aminosaurederivate (Phenylthiohydantoine) erfolgte durch HPLC.

11. Immunologfseher Nachweis der Polyel: NADP+-5-0xidoreduktase

Gewin.imng polyklonaler Antikorper

Zur Gewinnung von spezifischen Antikorpem gegen die Polyol: NADP+-5-0xidoreduktase

wurde nach der Methode von Harlow und Lane (1988) verfahren, Zur Immunisierung des

Kaninchens wurde die aus einern SDS-Polyacrylamidgel ausgeschnittene Proteinbande mittels

X-Press (Bachhofer) emulgiert und 1 : 1 mit abgetoteten Mycobacterium tuberculosis-Zeeea

(l mglmL) enthaltendem Freund's Adjuvant in sterilen Spritzen hornogenisiert. Diese Pro­

teinemulsion wurde dem Kaninchen subcutan injiziert (0,5 mL). Nach zweimaligem

Nachimpfen in einem Zeitraum von 8 Wochen wurde das Tier unter Betaubung ausgeblutet,

Das Serum v....urde nach der von Harlow und Lane (1988) besch.riebenen Methode

autgearbeitet, aliquotiert und bei -20°C ge!agert.

'V/estem Blot'

Der immunologische Nachweis der Polyol: NADP+-5-0xidoreduktase in durch SDS-PAGE

aufgetrennten Rohextrakten erfolgte im 'Western Blot' ITJt spezifischen Antikorpern. Der

Proteintransfer von einern SDS-Polyacrylamidgel auf eine Nitrocellulosemembran (BA 85;

0,45 urn, Schleicher & Schull, Dassel) wurde im Semi-Dry-Blot-Verfahren nach Kyhse-Ander­

sen (1984) mit einer Semi-Dry-Blot-Apparatur (Fast Blot B33, Fa. Biometra) durchgefuhrt,

Transferbedingungen: 25 mM Tris, 192 rrdv! Glycin, pH 8,3

konstante Stromstarke von 5 mA/cm 2 Gel, Zeit: 20 min

24 II. Moterial und Methode"


12.3 Isolierung von DNA-Fragmenten aus Agarosegelen

Zur Isolierung definierter DNA-Fragmente aus Agarosegelen wurde fur die gelektrophore­

tische Auftrennung das TAE-Puffersystem verwendet (Maniatis et al., 1989), da das komplex­

bildende Borat im TBE-Puffersystem die DNA-Bindung an konventionelle DNA-Isolier­

systeme hemmt. Die gesuchte DNA-Bande wurde nach der Elektrophorese aus dem Gel ausgeschnitten,

Die DNA wurde bei Fragmentlangen uber 500 bp mit dem Gene-Clean'e'-System

(Dianova, Hamburg), bei kurzeren Fragmenten mit dern Mermaidw-System (Dianova, Ham­

burg) direkt aus der geschmolzenen Agarose isoliert, Die Durchfiihrung erfolgte nach den

Angaben des Herstellers und beruhte auf der Methode von Vogelstein und Gillesspie (1979).

Die Elution der isoliertenDNA-Fragmente erfolgte stets in sterilemAqua bidest.

12.4 Oligonukl.eotidsyntbese una Amplifikation von DNA


12.10 Plasmidstabilitatstest

Zur Uberprufung der Stabilitat von Plasmiden in den transkonjuganten G. 0lYlUmS-Stammen

wurde ein Stabilitatstest nach Afendra und Dramas (1987) durchgefuhrt. Die rekombinanten

Bakterienstamme wurden hierzu taglich nach der Bestimmung der Generationszahl in Voll­

medium uberimpft. Aliquots wurden auf Vollmediumplatten ohne Antibiotika ausplattiert.

Einzelkolonien wurde auf Selektivmedien transferiert und bei 30°C inkubiert. Das Verhaltnis

aus insgesamt gepickten Kolonien und den auf antibiotikahaltigen Vollmediumplatten ge­

wachsenen Kolonien war ein Mill fur die Plasmidstabilitat. Aus resistenten Kolonien der zu­

letzt untersuchten Generation wurde die Plasmid-DNA isoliert. Nach Spaltung mit Restrik­

tionsendonukleasen wurde das Fragmentmuster mit dem ursprunglichen Muster verglichen,

32 II. Material und Methaden


III. Ergebnisse

1. Reinigung una Charakterisierung der Polyol: NADP+-5-0xidoreduktase

aus G. oxydans

1.1. Reinigung' der Po/yol: NADI>+-5-0xidoreduktase

Die Reinigung der Polyol: NADI>+-5-Oxidoreduktase erfolgte nach dem in Abbildung 4 dar­

gestelltenSchema.

IOOg Feuchtzellen

Aufschlull derZellen mit einerkontinuierlichenKugelmuhle

G1asperll D:0,3 mm

Zentrifugationzur Entfernnnggaozer Zellen

30 min, 20.000xg, JAI4

1

Zentrifugationzur EntfernungvonMembranfragmenten

90 min, 180.00Oxg, Ti45

Dialyse des Uberstandes vs. 10 mMKaliumphosphatPuffer pH 6

1

DEAE8ephacelAnionenaustauscher

Elution derAktivitatmit 100mMNaGI

Dialyse deraktiven Fraktionenvs. 10 mMKaliumphosphat Puffer pH 6

1

DyeMatrex RedATAlAffinitatssaule

Elution derAktivitat mit 200 mMNael

Ultrafiltration

1

Sephacryl 8-100 HRTM

Gelfiltration

Abbildung 4: Reinigungsschema zur Isolierung der Polyol: NADP+-5-0xidoreduktase aus G. oxydans.

Nach dem Zellaufschluf erfolgte die Trennung des loslichen Proteins von Zellresten durch

Ultrazentrifiigation. Durch diesen Schritt konnten bereits 75 % der Ausgangsproteinmenge

entfernt werden, ohne die Gesamtaktivitat wesentlich zu beeinflussen. Vor der Ausarbeitung

weiterer Reinigungsschritte wurde zunachst das pH-abhangige Bindungsverhalten des Enzyms

TIL Ergebnisse 33


zu einem Anionenaustauscher untersucht. Dazu wurde jeweils 500 JlL Anionenaustauscherma­

terial in einem Eppendorf-Reaktionsgefaf mit 5 mg Rohextrakt bei unterschiedlichen pH­

Werten inkubiert (30 min, 4°C). Als pH-Bereich wurde 3 - 8 bei Schritten von 0,5 gewahlt.

Anschlieflend wurde das Saulenmaterial abzentrifugiert und der Uberstand auf Enzymaktivitat

untersucht, Darnit lieB sich feststellen unter welchen pl-I-Bedingungen das Enzym durch das

Saulenmaterial gebunden wurde und in welchem pH-Bereich der Isoelektrische Punkt (PI) lag.

Nachdem gezeigt wurde, daB der pl zwischen pH 5 und pH 5,5 lag, wurde zur weiteren

Aufreinigung ein Anionenaustauscher (DEAE-SephaceFM) bei pH 6 eingesetzt. Durch diesen

Schritt konnten 90 % des Fremdproteins entfernt werden, wahrend die Polyol: NADP+-5­

Oxidoreduktase quantitativ an das Saulenmaterial gebunden wurde. Vom Anionenaustauscher

wurde das Enzym mit einem steigenden Naf'l-Gradienten (0 - 500 mM) bei 100 rnM NaG

eluiert. Die aktiven Fraktionen wurden vereinigt und fur den nachfolgenden Farbstoff

Affinitatschromatographieschritt dialysiert. Nach Applikation auf das Affinitatsmedium wurde

das Enzym wie erwartet von der Saulenmatrix gebunden und durch Anlegen eines NaCl­

Gradienten (0 - 400 ll'.M) eluiert. Dabei wurde bei annahernd gleichbleibender Gesamtaktivitat

die Gesamtproteinmenge auf 30 % reduziert, Nach Aufkonzentrierung der aktiven Fraktionen

wurde der letzte saulenchromatographische Schritt, die Gelfiltration, durchgefiihrt, Hierbei

ka111 es zum Verlust von 20 % der Enzymaktivitat, Nach diesem Schlitt lag das Enzyrn in ho­

mogener Form vor. Die Polyol: NADP+-5-0xidoreduktase wurde aus dem Zellaufschlufi 109­

fach angereichert. Aus 5 g Gesamtprotein wurden 30 mg homogenes Protein isoliert. Die

spezifische Aktivitat des gereinigten Enzyms lag bei 17,8 U/mg. Eine Ubersicht tiber die

Reinigung der Polyol: NADP+-5-0xidoreduktase aus G. oxydans ist in Tabelle 3 dargestellt.

Tabelle 3: Reinigung der Polyol: NADP+-5-0xidoredl1lctase aus 100 g Feuchtmasse von Gluconobacter

oxydans DSM 3503. Die Aktivitat des Enzyms wurde tiber die Rate lief 5-Ketoglukonatreduktion

bestimmt.

Reinigungsschritt Aktivitat Protein

. S pez. Akt.

.,

[U] [mg] [U/mg] [%]

Ausbeute Faktor

Rohextrakt 1013 4979 0,2 100 1

Ultrazentrifugation 910 1323 0,7 90 3,5

Anionenaustauscher 825 124 6,6 81 33

Affinitatsmedium 802 37 21,8 79 109

Gelfiltration 642 30 17,8 63

34 ill. Ergebnisse


ves Molekulargewicht von 55.600 ergab und aus der Massenspektroskopie, die ein.Moleku­

largewicht von 54.300 anzeigte, bestatigten die monornere Struktur.

1000

1.2 1.3 1.4 1.5 1.6 1.7

Abbildung 6: Molekulargewichtsbestimmung der Polyol: NADF+-S-Oxidoreduktase aus G. oxydans

durch Gelfiltration mit Sephacryl 5-100 HRTM. Elutionspuffer: 100 rnM Kaliumpbosphat-Puffer, 100

rnM NaC!, 1 rnM MPD, pH 6. Flullrate: 0,25 mL/min. Aufgetragene Probe: 2 mg Protein in 0,5 ml.,

Die AusschluBvolumenbestllr.mung erfolgte mit Dextran Elan. Proteinstandards: Aldolase (158 kDa),

Rinderserumalbumin (68 kDa), Eialbumin (45 kDa), Chymotrypsinogen A (25 kDa) und Cytochrom c

(12,5 kDa).

Isoelektrischer Punkt

Der Isoelektrische Punkt (PI) des Enzyrns wurde durch Chrornatofokussierung bestimmt. Der

pH der aktiven Fraktion, der dem pl entsprach, wurde mit der pH-Elektrode gemessen,

Demnach ergab sich ein pI von 5,1.

pH-Optima

Die enzymatische Aktivitat des Enzyms wurde in Abhangigkeit vom plf-Wert untersucht. Da­

m wurden die Puffer in den fur die Enzymbestimmungen beschriebenen Testsystemen durch

die i.'TI folgenden aufgelisteten Puffer ersetzt:

36

pH-Bereich

2,5 - 5,5

5,5 - 6,5

6,5 - 8,5

8,5 - 10,0

10,0 - 11,0

Puffer (100 mM)

CitratIKOH

Kaliumphosphat

MOPS

Natriumkarbonat

CHAPS

III. Ergebnisse


nisse sind in Tabelle 5 dargestellt. Das Enzym zeigte Oxidation des Kofaktors NADPH in

Gegenwart der Substrate Fruktose, 5-Ketoglukonat, Sorbose und Erythrulose. Reduktion des

Kofaktors NADP+ erfolgte in Gegenwart der Substrate Mannit, Sorbit, Fruktose, Sorbose und

Glukonat. Die Polyole Glyzerin, Sedoheptulose, Mannoheptulose, Xylose, Mannose, Glukose,

2-KetogIukonat und Galaktose bewirkten keine Umsetzung des Kofaktors.

Bei den umgesetzten Substraten wurden die resultierenden Produkte durch HPLC identifiziert.

Es wurde gezeigt, dafi Umsatz von Mannit zu Fruktose, von Sorbit zu Sorbose, von Fruktose

zu 5-Ketofiuktose sowie von Glukonat zu 5-Ketoglukonat und jeweils umgekehrt, erfolgte

(Tabelle 6).

Weiterhin wurde die Substrataffinitat des Enzyms in Bezug auf die umgesetzten Substrate

untersucht. Es wurde gezeigt, daf das Enzym die hochste Affinitst zu den Substraten Mannit

und Fruktose hat (Tahelle 7). Der K M - Wert fur G!ukonat war nicht bestimmbar, da das Enzym

in. Gegenwart von Glukonat als Substrat kein Sattigungsverhalten zeigte, was auf eine sehr

niedrige Substrataffinitat hindeutete,

Tabelle 5: Enzymatische Aktivitaten der Polyol: NADP+-S-Oxidoreduktase aus G. oxydans mit verschiedenen

Polyolen als Substrat. Bestimmt wurde die reduzierende Aktivitat in Gegetrwart von

NADPH sowie die oxidierende Aktivitat in Gegenwart von NADP+. Die relativen Aktivitaten sind auf

die spezifische 5-Kewglukonatreduzierende Aktivitat bezogen,

ill Ergebnisse

Substrat relative Enzymaktivitat [%]

Glukonat

5-Ketoglukonat

Mannit

Sorbit

Fruktose

Sorbose

Erythrulose

2-Ketoglukonat

oxidativ

2

o

335

263

23

15

o

o

reduktiv

o

100

o

o

199

72

20

o

39


1.4 Vorkommen der Pelyol: NADI*-5-0xidoreduktase innerhalb der Spezies

Gluconobacter

Die bislanguntersuchten Gluconobacter Stamme bilden bei Wachstum auf Glukose ausnahms­

los 5-Ketoglukonat (Weenk et al., 1984). Urn die Bedeutung der Polyol: NADP+-5-0xido­

reduktase fur die 5-Ketoglukonatbildung zu untersuchen, sollten verschiedene Gluconobacter

Stamme auf Existenz dieses Proteins uberpruft werden. Dazu wurden spezifische polyklonale

Antikorper eingesetzt, urn eine hohe Nachweisempfindlichkeit zu erzielen. Die Stamme Gluco­

nobacter gluconicus IFO 12528, G. melanogenus DSM 50049, G. suboxydans ATCC 23773,

G. suboxydans DSM 2003, G. suboxydans DSM 2343 und G. oxydans DSM 3503 wurden

nach Anzucht in der Kugelmuhle aufgeschlossen, Die so erhaltenen Rohextrakte wurden durch

10 %-ige SDS-PAGE aufgetrennt und einer Proteinfarbung unterzogen oder auf eine

Nitrozellulosemembran transferiert und mit spezifischen Antikorpern behandelt. Die Detektion

erfolgte immunochemisch.

Es wurde gezeigt, daB die Polyol: Nft.DP+-5-0xidoreduktase in allen untersuchten Glucono­

bacter Stammen existent war (Abbildung 12). Dieses Ergebnis belegte die weite Verbreitung

und die phylogenetische Stabilitat des Proteins innerhalb der Gattung Gluconobacter, gab

jedoch keine weiteren Informationen daruber, ob dieses Enzym fur die Bildung von 5-Keto­

gIukonat durch diesen Organismus notwendig war.

A B

1234567887654321

Abbildung 12: Western-Blot-Analyse von verschiedenen Gluconobacter Stammen mit Anti-Polyol:

NADP+-5-Oxidorednktase Antikorpern. Die Proteine wurden durch 10 o/o-ige SDS-PAGE aufgetrennt

una A: mit Coomassie-Blau angefarbt, II: auf eine Nitrozellulosemembran ubertragen und immunechemisch

durch Aktivitat der Alkalische Phosphatase Konjugate nachgewiesen, 1: SDS-7B gefarbter

Molekulargewichtsmarker [kDaJ, 2: G. gluconicus lFO 12528, 3: G. melanogenus DSM 50049, 4: G.

suboxydans ATCC 23773, 5: G. suboxydans DSM 2003, 6: G. suboxydans DSM 2343, 7: G. oxydans

DSM 3503,8: gereinigte Polyol: NADP+-5-0xidoreduk'-LaSe aus G. oxydansDSM 3503.

44 Ill. Ergebnisse


2. Iselierung und Charakterisierung der Glukonat: NADP+-5-0xidoreduktase

aus G. oxydans

2.1 Jsolierung de, Giukonat: NAD:i'*-5-0xido,eduktase

Die Charakterisierung der Polyol: NADP+-5-Oxidoreduktase zeigte, daf das Enzym die Oxi­

dationsreaktion von Glukonat zu 5-Ketoglukonat nur mit geringen Umsatzraten katalysiert.

Das Enzym hat bei einem breiten Substratspektrum nur eine geringe Substrataffinitat fur Glu­

konat. Die Isolierung eines weiteren EI'.zyIDs aus G. oxydans, das die Umsetzung von Glukonat

zu 5-Ketoglukonat katalysiert, erfolgte nach dem in Abbildung 13 dargestellten Schema.

loog Feuchtzellen

AufschlullderZellen mit einer kontinuierlichenKugelmnhle

GlaspeTll D:0,3 mm

Zentrifugationzur Entfemungganzer Zellen

30 min, 20.000xg, JAl4

1

ZentrifugationzurEntfernungvonMembranfragmenten

90 min, 180.000xg, Ti45

Dialyse des Dberstandes vs. 10 mM Kaliumphosphatpuffer pH 6

1

DEAE Tentakel Anionenausteuscher

Elution der Aktivitatmit 350 mM NaCI

Dialyse des Uberstandes vs. 10 mM Kaliumphosphatpuffer pH 6

1

BlueSepharcsew Affinitatssaule

Elution derAktivitar mit300m1vI NaCl

1

Chromatofokussierung I auf:Mono-PTM

25 Illi"iHistidin-C1T5,6 - PB74 pH 4,0

Sephacryl 8-100 HR'"

Gelfiltration

1

ChrcmatcfckussierungITaufMono-PTM

25 mM Acetat-OH pH 4,8 - PB74 pH 4,0

Abbildung 13: Reinigungsschemazur .Isolierungder Glukonat: NADP+c5-0xidoreduktase ausG.

oxydans.

Ill. Ergehnisse 45


Glukonat: NADP+-5-0xidoreduktase nach der Reinigungsprozedur als homogenes Protein mit

einem Molekulargewicht von 33.000 vorlag (Abbildung 14).

Tabelle 8: Reinigung der Glukonat: NADP'-5-Oxidoreduktase aus 100 g Feuchtmasse von Gluconobacter

oxydans DSM 3503. Die Aktivitat des Enzyms wurde tiber die Rate der Glukonatoxidation bestimmt,

Reinigungsschritt Aktivitat Protein Spez. Akt, Ausbeute Faktor

flJ1 [mg] fLJ/mg] [%]

Rohextrakt 387 5135 0,08

Anionenaustauscher 213 386 0,55 100 6,9

Farbstoff Affinitat 152 100 1,5 71 18,8

Chromatofokussierung I 90 32 2,8 42 35

Gelfiltration 19 6 3,2 9 40

Chromatofokussierung II 16 0,4 40 8 500

234 5 6 7

Abbildung 14: SDS-Polyacrylamidgel zur Darstellung der Effizienz der einzelnen Reinigungsschritte

im Rahmen der Isolierung der Glukonat: NADP'-5-Oxidoreduktase aus G. oxydans. FUr die Auftrennung

der Proteine wurde ein 10 'Yo-iges SDS-Gel verwendet. Die Proteinbanden wurden durch Coomassiefarbung

nachgewiesen, 1: SDS-Gr6Benlnarker von Boehringer [kDaJ, 2: Rohextrakt nach Ultrazentrifugation,

3: Eluat nach dem Anionenaustauscher, 4: Eluat nach der Affinitatssaule, 5: Eluat nach del"

Chromatofokussierung I, 6: Eluat nach der Gelfiltration, 7: Eluat nach der Chromatofokussierung Il,

ill Ergebnlsse 47

..ik;di-


setzt. Fur die umgesetzten Substrate wurden die entsprechenden Produkte durch HPLC analy­

siert. Es wurde gezeigt, dafl Glukonat zu 5-Ketoglukonat umgesetzt wurde.

Die Substrataffinitat des Enzyms fur die Kofaktoren und Glukonat SOWle 5-Ketoglukonat

wurde ebenfalls untersucht (Tabelle 11).

Tabelle HI: EnzymatischeAktivitatender Glukonat: NADP'"-S-Oxidoreduktase aus G. oxydans mit verschiedenenSubstraten,

Bestimmtwurde die reduzierende Aktivitat in Gegenwart von NADPH sowie die

oxidierende Aktivitat in Gegenwart von NADP'". Die relativen Aktivitaten sind auf die Glukonat oxidierendeAktivitat

bezogen.

Substrat relative Enzymaktivitat [%]

Glukonat

5-Ketoglukonat

Fruktose

Glukose

Mannit

Mannose

Sorbit

Sorbose

2-Ketoglukonat

oxidativ

100

o

o

o

o

o

O

o

o

reduktiv

Tabelle 11: Michaelis-Menten-Konstanten der Glukonat: Np.,J)P'"-5-0xidoreduktase aus G. oxydans fur

die katalytisch umgesetztenSubstrate und Kofaktoren.

mErgebnisse

Substrat

NADP+

Glukonat

NADPH

5-Ketoglukonat

73 X 10-5

,

206 X 10- 3

,

,

,

26 X 10-5

125 x 10-3 o

26

3

o

o

o

o

o

o

51


1 2 3 1

Abbildung 19: Polyacrylamidgelelektrophoretische Auftrennung der PCR-Produkte nach der Reaktion

von Glukonat: NADF+-5-Oxidoreduktasespezifischen Primem mit chromosomaler DNA aus G.

oxydans. 1: Plasmid pBR322-Haeill geschnitten rop], 2: PCR-Reaktionsansatz, 3: PeR-Fragment nach

Ligation in pUC19 und erneuter Restriktion mit EcoRlfSacI. Die Auftrennung erfolgte in einem 15 0/0igen

Gel bei 100V.

Das 66 bp Fragment wurde nach praparativer, 4 %-iger Agarosegelelektrophorese isoliert

und mit den Restriktionsendonukleasen EcoRI und Sad geschnitten. Nach Ligation des vor­

bereiteten Fragmentes wit entsprechend gesdLtlJttenernPiasmidpUC19wurde esinE.coli

kloniert. Das 66 bp PeR-Fragment wurde sequenziert, urn eine nichtdegenerierte, den amino­

terminalen Bereich des Proteins kodierende DNA-Sequenz zu ermittelnDas Sequenzieren

von rekombinanter Plasmid-Dl'Is, aus drei verschiedenen E. coli Klonen ergab jeweils unter­

schiedliche Dbl.A-Sequenzen.rdie .sich .jedoch alle·.. der .. ermittelten.Peptidsequenz.· zuordnen

lieBen (Abbildung 20). In dem neusynthetisierten Bereich gab es Leserastermutationen, die

auf die fehlende Korrekturfunktion (3'-75'-Exonuklease) der Taq-DNA-Polymerase zuruck­

zufuhren sind (Tindall und Kunkel, 1988). Die Fehlpaarungenim Bereichder Primerhaben

ihrenGrund im hohen Degenerierungsgrad der Primer. Aus dem sequenziertenPf'RiFrag­

ment wurde einBereich ermittelt, der bei einer Lange von45 bp dem GC-Gehalt von G.

oxydans (60 - 65 %, De Ley und Frateur, 1970) entsprach, Diese Sequenzwurde als Muster

fur die Synthese einer gnOcGensonde verwendet,

m Ergebnisse 53


3.1 Erstellung einer Restriktionskarte des gno-Gens

Aufder Basis der Ergebnisse der PCR-Experirnente wurde eine gno-Gensonde konstruiert und

nach Digoxigeninmarkierung in Southern-Blot Experimenten eingesetzt. Dazu wurde chromo­

sornale DNA aus G. oxydans mit 24 Restriktionsendonukleasen (BamBI, BglI, Bgffi, Clar,

Drar, DraIT, EcoRl, EcoRV, HindIT, HindITI, Nder, NotI, PstI, PvuI, PvuII, Sad, SadI, SalI,

Scar, SmaI, SphI, Stul, XbaI, ..ThoI), deren Erkennungssequenz mindestens sechs Nukleotide

beinhaltete, geschnitten. Solche Restriktionsendonukleasen sollten statistisch bevorzugt DNA­

Fragmente zwischen 1 und 5 kb generieren, Nach Auftrennung der Restriktionsansatze durch

Agarosegelelektrophorese wurde die DNA aufeine Nylonmembran transferiert. Nach Hybridi­

sierung mit der Gensonde zeigte sich pro Balm jeweils nur eine deutliche Bande, deren G-roBe

bestimmt wurde.

Urn in weiteren Hybridisierungsversuchen eine detaillierte Restriktionskarte des chromoso­

malen Bereichs urn das gno-Gen zu erhalten, wurden Restriktionsendonukleasen, die in Ein­

fachrestriktionsexperimenten hybridisierende Fragmente bis zu 4,5 kb generierten (BamBI,

BglI, DraII, £CoRl, HindII, PvuI, SacII, SmaI), in Doppelrestriktionsexperimenten eingesetzt,

Die Auswahl dieser Fragmente beruhte auf der Kenntnis der voraussichtlichen GroBe des gno­

Gens (33 illa Protein werden durch -900 bp DNA kodiert). Dadurch Iieflen sich neben dem

kodierenden auch flankierende Bereiche kartieren, Durch ein Southern-Blot Experiment unter

Einsatz jeweils doppelt geschnittener, chromosomaler DNA aus G. oxydans mit der gno-Gen­

sonde wurde die Fragmentlangeninformation erhalten, die die Darstellung einer detaillierten

Restriktionskarte des gno-Gens ermoglichte (Abbildung 21). Die Karte legte die Position der

Gensonde im Gesamtgenom auf einen Bereich von 250 bp fest. Zudem war.bekannt, daB die

sondenhomologe chromosomale RegionidemS-Bereichs desgao-Gens entsprach, (fa die

Sonde fur den Aminoterminus des Proteins kodierte. Die Karte enthielt die Information, die es

rIieren.

3.2 Klonierung des gno-Gens

Aus der Restriktionskarte des chromosomalen Bereichs um das gso-Gen von G. oxydans

wurden Fragmente ausgewahlt, mit denen das gesamte Gen isoliert werden konnte, Diese

sollten basierend auf der Kenntnis der Position der Gensonde aufdem gno-Gen (auflerer.Ami­

noterminus ides Proteins unddamit 5'-Bereich des Gens) ein Fragmentendehahen,das

unmittelbar neben dem der Sonde homologen Bereich auf dem Chromosom lag. Zudem sollte

jedes Fragment mit seiner Grolle das gesa.'l1te gno-Genabdecken konnen (33lc.DaProtein

ill. Ergebnisse 55


werden kodiert dureh -900 bp DNA). Die Anforderungen wurden von einem 2,9 kb HindU

und von einem 3,4 kb BamHI-Fragment erfullt (Abbildung 21).

PvuI

: HindU

II

i

2000

I

4000

i

Droll

I

3.4 kb BamHI-Fragment

Abbi!dung 21: Restriktionskarte des chromosomalen Bereichs urn das Gen fitr die Glukonat: NADP+­

5-Oxidoreduktase aus G. oxydans und die Strategic zur Klonierung des gno-Gens. Durch Auswertung

von Fragmentgrobeninformationen aus Einfach- und Doppelrestriktionen mit Southern-Blot Experimenten

wurde das Restriktionsmuster ermittelt, Die Position der verwendeten Gensonde ist durch ein

Kastchen markiert, Die relative Ausrichtung der Sonde auf der Karle war nicht bekannt. Die Klonierungsstrategie

wurde auf der Basis der erwarteten GengroBe von 900 bp fur das 33 kDa Protein entworfen.

Die zu klonierenden Fragmentewurden so ausgewahlt, daf sic unmittelbar im Bereich clef Sondenposition

begannen und lang genug waren, das gesamte Genzu beinhalten, Als Ziel wurdedie Klonierung

eines chromosomalen 3,4 kb BamHIund eines 2,9 kb HindJl Fragmentes festgelegt.

Um diese Fragmente zu isolieren, wurden partielle Genbanken ire Plasmid pUC19 hergestellt

und illE. coli kloniert. Durch Koloniehybridisierung mit der gno-Gensonde wurden die Klone

detektiert, die die gesuchten Fragmente trugen, Abhangig von der Orientierung der Fragmente

in dem Vektor konnten bei der Herstellung der partiellen Genbanken zweiKonstrukte pro

Fregmententstehen Nach Identifizierung der so erhaltenen Konstrukte wurden die ent­

sprechenden E. coliStiimme auf Glukonat: NADP+-5-0xidoreduktase-Aktivitat untersucht,

Dabei zeigte sich, daB die enzymatische Funktion auf dem BamHI-Fragment lokalisiert war

und daB Expression nur unter der Kontrolle des plasrnideigenen lac-Promotors auf dern Plas­

mid pUC-BamHI+ erfolgte (Tabelle 12). Damit wurde die relative Position und Ausrichtung

des gno-Gens aufdem G. oxydans Chromosom aufgeklart.

56 I1I. Ergebnisse

6000

I


3.5 Charakterisierung der rekombinanten Glukonat: NAD:I*-5-0xidoreduktllse

aus E. coli

Zum Nachweis der Identitat des rekombinanten Polypeptids mit dem urspnmglich aus G.

oxydans gereinigten Protein wurde es aus E. coli bis zur Homogenitat gereinigt. Dazu wurde

das g"flo-Gen zunachst durch PCR endstandig so modifiziert, daf es mit dem Expressions­

vektor pQE30, der dem Gen sechs Histidinreste vorschaltet, ligiert werden konnte. Die His­

tidinreste fuhren zur Chelatbildung rekombinanter Proteine mit Chromatographiesaulenmate­

rialien fur die Metallchelat Affinitatschromatographie, Es wurden PCR-Primer hergestellt, die

das gesamte gno-Gen auf dem chromosomalen 3,4 kb BamHI-Fragment einschlossen, die

Ligation in das Plasmid pQE30 erlaubten und vor dem Aminoterminus des Gens noch eine

Peptidasespaltstelle (Enterokinase) einbauten, urn eine spatere Abspaltung der Histidinreste zu

ermoglichen (Abbildung 25).

GNOEXI GC GOATCC GATGACGATGACAAA TCCCATCCCGATCTTTTTTC

BamBI Enterokinase gno-Gen

GNOEX2 TT GAGCTC CTTGTCAGCCGGCATAC

Sad

Abbildung 25: PeR-Primer fur die Klonierung des gno-Gens im Expressionsplasmid pQE30. Der Primer

GNOEXI enthielt eine BamID Restriktionsschnittstelle und kodierte fur eine Enterokinase Peptidasespaltstelle

unci fitr den Aminoterminus des gnoe&ns ohne das Startmethionin. Der Primer GNOEX2 enthielt

eine Sac! Restriktionsschnittstelle undentsprach dem 3'-flankierenden Bereich des gi1O-Gens.

Die peR Reaktion ergab ein 1,1 kb DNA Fragment, das mit den Restriktionsendonukleasen

BamHI und Saci geschnittenund mit entsprechend restringiertem Plasmid pQE30 ligiert

wurde. Nach Transformation des Plasmids pQE30-g110 (Abbildung 27) in E. coli JM109und

Repression des Expressionssystems durch Glukose(2 %) warden positive Klone nach DNp....

Analyse isoliert, Zur Expression des gno-Gens wurde ein positiver Klon zunachst unter Glu­

koserepression angezogen und anschliefiend mit IPTG induziert. Nach Ernte und Aufschlufs

der Zellen, sowie der Trennung von Zellfragmenten vom loslichen Protein wurde das rekom­

binante Enzym in. einem Schritt durch Metallchelat Affinitatschromatographie isoliert (Tabelle

13). .Das Enzymwurdebei nur .geringem Aktivitatsverlust und 31-facher Anreicherung

aufgereinigt. Das gereinigteProtein.hatte eine spezifische Aktivitat von 46 U/mg.Die

Homogenitat des Proteins wurde durch SDS-PAGEgezeigt (Abbildung 26). Dasgereinigte

Protein wurde wie die Glukonat: NADP+-5-0xidoreduktaseaus G. oxydans .charakterisiert.

Die Ergebnisse der Charakterisierung wurden in Tabelle 14 zusammengefaflt, Es wurde

gezeigt, daB sich das rekombinante Protein in seinen biochemischen Eigenschaften nicht von

der Glukonat: NADP+-S-Oxidoreduktase aus G. oxydans unterschied.

62 ill Ergebnisse


Tabelle 13: Reinigung rekombinanter Glukonat: NADP'-5-Oxidoreduktase aus E. coli JM109 pQE30gno

mit der Darstellung der einzelnen Schritte. Die Aktivitat des Enzyms wurde iiber die Rate der Glukonatoxidation

bestirnrnt.

Reinigungsschritt Aktivitat Protein Spez. Akt, Ausbeute Faktor

Rohextrakt

MetallchelatAffinitat

1

[U]

211

205

2

[mg]

141

3,7

3

[U/mg]

Abbildung 26: Reinigung rekombinanter Glukonat: NADP'-5-Oxidoredu.."tase wit der Metallchelat

Affinitatschromatographic. I: SDS-Moiekulargewichtsrnarker (Boehringer) [kDa], 2: Rohextrakt E. coli

TMI09pQE3()..giU) (reprimiert), 3: RohextraktE. coli JM109pQE30-gno (induziert), 4: gereinigtes Protein.

ill Ergebnisse 63

4

1,5

46

[%]

100

97

1

31


4. Expression des gno-Gens in G. oxydans

4.1 Etablierung eines Geatransfersystems fik G. oxydans

Urn das Gen fur die Glukonat: NADP+-5-0xidor€lduktase in G. oxydans zu exprimieren war es

notwendig, fur diesen Organismus geeignete Vektoren mit funktionalen Kontrollelementen

(Promotoren etc.) zu erhalten. Weiterhin war es erforderlich ein Gentransfersystem zu erarbei­

ten, das den Transfer von rekombinanter Plasmid DNA in G. oxydans erlaubte.

Als Plasmid DNA wurden Derivate des Plasmids RSF I010 gewahlt, da das Replikon auf die­

sem Plasmid die Replikation der DNA in einem breiten Spektrum gram-negativer Bakterien

erlaubte (priefer et al., 1985) und da durch die Wahl heterologer DNA das Rekombinations­

risiko minimiert wurde. Untersuchungen zur Antibiotikaresistenz von G. oxydans zeigten, daB

der Organismus empfindlich auf Kanamycin (>10 mg/L), Streptomycin (> 10 rng/L) und Te­

trazyklin (>5 mg/L) reagierte. Als Basis fur weitere Untersuchungen zum Gentransfer in G.

oxydans wurde das Plasmid pRS20! (KmR, [Sm R ]) und das Derivat pRS201P R (Abbildung 28

a) sowie das Plasmid pSUPI04 (Tet R ) verwendet. Die Transformation mitder klassischen

Calciumchlorid-Methode, wie sie bereits bei Acetobacter specs. zum Gentransfer eingesetzt

wurde, fuhrte zu keinem positiven Ergebnis (Inoue et aI.,1985; Fukaya et al., 1985 b; Okumura

et al., 1985). Ebenso konnte durch Elektroporation mit fur Acetobacter xylinum etablierten

Methoden kern rekombinanter G. oxydans erhalten werden (Hall et al., 1992). Der Ansatz des

triparentalen, konjugativen Transfers fuhrte zum Erfolg, Dabei wurde mobilisierbare Plasmid

DNA aus einem E. coli Stamm, der selbst nicht zur Konjugation in der Lage war durch einen

konjugationsfahigen Helferstamm mobilisiert und in einen dritten konjugationsfahigen

Organismus ubertragen, Die Effizienzen der einzelnen Konjugationsansatze unterschieden sich

in Abhangigkeit vom verwendeten Plasmid (Tabelle 15).

Es zeigte sich fur das Plasmid pRS201 und sein Derivat eine sehr hohe Transfereffizienz, die

vier Grobenordnungen tiber den bislang veroffentlichten Daten lag und bislang noch mit kei­

nero anderen System erreicht werden konnte (Condon et al., 1991; Murooka et al., 1981). Die

relativ niedrige Konjugationseffizienz mit dem Plasmid pSUPI04 lag im Bereich der aus der

Literatur bekannten Daten. Aufgrund der hohen Effizienz wurden weitere Klonierungsschritte

im Plasmid pRS201 bzw. seinen Derivaten durchgefuhrt,

Das Plasmid pRS20!P R enthielt neben dem A-Promotor such das Gen fur em temperatursensi­

tives Derivat des AcI-Repressors (cI857), der den Promotor regulierte. Der Repressor verhin­

derte bei 30°C die Expression dahinter geschalteter Gene. Erst durch Inkubation bel 37 - 42°C

kam es zur Denaturierung des Repressors. Unter diesen Bedingungen erfolgtedie Expression

nachgeschalteter Gene (Queen, 1983). Urn fur eine maximaleExpressionin G.oXYdansauch

unter Standardkulturbedlngungen (30°C) maximale Genexpression zu ermoglichen, wurde ein

Ill. Ergebnisse 65


Nach dem Nachweis der Funktionalitat wurden die Plasmide pRS201P R-gno und pRS201P­

gno durch Konjugation auf G. oxydans ubertragen. Bei Experimenten mit G. oxydans wurde

mit einer Kultivierungstemperatur von 30°C gearbeitet, da es die fur die 5-Ketoglukonatbil­

dung optimale Ternperatur war. Nach 20 h Inkubation wurden die Zellen geemtet, aufge­

schlossen und die Glukonat: NADP+-5-0xidoreduktase-Aktivitat gemessen (Tabelle 17). Es

wurde gezeigt, daf der intakte cI857 Repressor auf dem Plasmid pRS201P R-gno die gno­

Genexpression nicht verhinderte, jedoch einschrankte. Das entsprach nicht den Brgebnissen

von Schroder et al. (1991), die in Acetobacter keine Funktionalitat des Repressors nachweisen

konnten. Der G. oxydans Stamm mit dem Plasmid pRS201PR-gno zeigte das 6,5-fache der

Enzymaktivitat des Wildtyps und damit auch eine Expression der plasmidkodierten Glukonat:

NADP+-5-0xidoreduktase linter in E. coli reprimierten Bedingungen. Der deregulierte G.

oxydans pRS201P-gno zeigte das 85-fache cler Enzymaktivitat des G. oxydans Wildtyps. Zum

elektrophoretischen Nachweis der Identitat des rekombinanten Proteins in G. oxydans mit der

aus G. oxydans isolierten Glukonat: NADP+-5-Oxidorecluktase wurden Proteinextrakte aus

den rekornbinanten G. oxydans Stammen sowohl nativ als auch SDS-denaturiert im Polyacryl­

amidgel aufgetrennt. FUr den Grollennachweis in der SDS-PAGE wurden die Proteinextrakte

zusammen mit einem Molekulargewichtsstandard aufgetrennt und durch Coomassiefarbung

nachgewiesen (Abbildung 30). Bei dem Stamm G. oxydans pRS201P-gno war die Verstarkung

einer Proteinbande, die aufdie Expression des gno-Gens zuruckzufuhren war und das Moleku­

largewicht des Proteins aus G. oxydans Wildtyp zeigte, deutlich erkennbar, Nach der nativen

PAGE wurde das Elektrophoresegel geteilt und teils einer Proteinfarbung, teils einer Glukonat:

NADP+-5-0xidoreduktase-Aktivitatsfarbung unterzogen (Abbildung 31). Die G. oxydans

Stamme, die das gno-Gen zusatzlich plasmidkodiert exprimierten, zeigten neben einer

Verstarkung des Proteinsignals auch eine deutliche Verstarknng des Aktivitatssignals, Dabei

zeigte das Signal, das aus der Wildtypexpression resultierte, die gleiche elektrophoretische

Mobilitat wie das rekombinante Protein,

Tabelle 17: Expressiondes gl1o-Gens in G. oxydans DSM 3503 unter Kontrolle des A Promoters in den

Plasmiden pRS20lP R-gno una pRS20IP-gI10 und die resultierende Glukonat: NADP+-5-0xidoreduktase-Aktivitat.

Die Enzymaktivitat wurde nach 20 h Inkubation bei 30°C bestimmt,

TIl. Ergebnisse

Gi oxydans

G.oxydanspRS201P R

G.oxydanspRS201P

G.oxydar,spRS20IP R -g'tlO

G. oxydans pRS201P-gno

Enzymaktivitat [Uzrng]

0,08

0,08

0,08

0,52

6,80

69


Tabelle 19: Koexpression des oye-Gens aus S. carlsbergensis und des gno-Gens aus G. oxydans in G.

oxydans unter Kontrolie des A Promotors in den Plasmiden pRS201P-oye und pRS201P-gno und die

resultierenden Enzymaktivitaten. Die Aktivitaten wurden nach 20 h Inkubation bei 30°C bestimmt,

Stamm Enzymaktivitaten [U/mg]

Glukonat: NADP+ NADPH

5-0xidoreduktase Oxidase

Gi oxydans wt 0,08 0,00

Gi oxydans pRS201P 0,08 0,00

G.oxydaus pRS201P-oye

{\ {\Q 0,09

v,vu

Gi oxydans pRS201P-gno 6,80 0,00

Gi oxydans pRS201P-oye

pRS201P'-gno 4,15 0,05

1 2 3 4 1 2 3 4

Abbildung 34: Natives Polyacrylamidgel zum Nachweis der rekombinanten NADPH-Oxidase aus S.

carlsbergensis und der Glukonat: NADP+-S-Gxidoreduktase aus G. oxydans nach Expression in G.

oxydans. a: Proteinfarbung. b: Aktivitatsfarbung. I: G. oxydans Wildtyp. 2: G. oxydans pRS201P-gno.

3: G. oxydar.spRS20IP-oye. 4: G. oxydans pRS201P'-gno/pRS201P-oye. Fiir die Auftrennung der

Proteine wurde ein 12o/o-iges Gel verwendet, Die Proteinbanden wurden durch Coomassiefarbung nachgewiesen.

Die NADPH oxidierenden Aktivitaten wurden durch Fluoreszenzverlust nach Inkubation mit

5-Ketoglnkonat und Luftsauerstofferkennbar.

74 ill Ergebnisse


6.3 Bestimmung der NADP+/NADPH-Verbliltnisse

Urn zu untersuchen, ob durch die Uberexpression des gna-Gens in G. oxydans Limitierungen

auf der Ebene der Reduktionsaquivalente erfolgten und daraus auch eine Limitierung der 5­

Ketoglukonatproduktivitat des Organismus hervorging, sollten die intrazellularen Nikotinamid

Adenindinukleotidphosphatmengen in den rekombinanten Zellen bestimrnt werden. Dazu WUf­

den me fur die Ansatze zur 5-Ketoglukonatproduktion Fermentationen in 50 mL Mineralsalz­

medium durchgefuhrt. In Vollmedium angezogene G. oxydans Zellen wurden zu einer OD 6oo =

1 in Mineralsalzmedium inokuliert und im Inkubationsschuttler bei 30°C inkubiert. Wiihrend

der Hauptproduktionsphase fur 5-Ketoglukonat wurden in Dreifachansatzen Zellenausjeweils

3,5 II'L Kultur durch alkalische bzw, same Extraktion zur Isolierung von reduziertem und oxi­

diertem Nikotinamid Adenindinukleotidphosphat aufgeschlossen. Die Extrakte wurden im

Testsystem zur Bestimmung von Nikotinamid Adenindinukleotiden quantitativ analysiert

(Tabelle 22).

Es wurde gezeigt, daf die Uberexpression des gna-Gens in G. oxydans groBen Einfluli auf die

Redoxverhaltnisse in diesem Organismus harte. Durch die Uberexpression des gna-Gens kam

es zu einer drastischen Verringerung der NADP+-Menge in der Zelle zugunsten des NADPH.

Diese Verschiebung der Nikotinamid AdenindinukleotidphosphatverhaItnisse konnte dabei

durch Koexpression des Gens fur die NADPH-Oxidase aus S. carlsbergensis nicht beeinflufst

werden, Die singulare Expression des Gens fur die NADPH-Oxidase hatte ebenfalls keinen

Einfluf auf das NADP+/NADPH-Verhaltnis. Das Ergebnis deutete darauf bin, daB die

NADPH-Oxidase in vivo nicht aktiv war und daB daraus eine NADPH-Akkumulation resul­

tierte, durch die eine Limitierung der 5-Ketoglukonatbildung erklart werden konnte.

Tabelie 22: Bestimmung der zellinternen Nikotinamid Adenindinukleotidphosphatmengen bei G.

oxydans wahrend der 5-Ketoglukonatproduktionsphase nach zweitagiger Fermentation in Mineralsalzmedill,n.

Be! den Werten handelt es sich urn Mittelwerte aus Dreifachbestimmungen.

78

Stamm NADP+ NP.J)PH

[nmol x mg TG-I]

G. oxydans 'lit 0,75 0,63

G. oxydans pRS201P 0,81 0,71

G. oxydans pRS201P-gno 0,23 1,26

G. oxydans pRS201P-oye 0,82 0,68

G. oxydans pRS20IP-gna/pRS20IP-oye 0,19 1,18

III. Ergebnisse


Tabelle 23: Vergleich der Charakteristika der Polyol- und der Glukonat: NADP+-5-0xidoreduktase aus

G. oxydans mit den 5-Ketoglukonat Reduktasenaus Gluconobacter specs. Die Enzymaktivitaten sind in

prozentueller Relation zu den Glukonat Oxidations- und 5-Ketoglukonat Reduktionsraten dargestellt.

Die Einflusse der Effektoren sind in prozentueller Beziehung zu effektorfrei untersuchtem Enzym

angegeben. Effektorkonzentration 1 mM. n.b.: nicht bestimmtbzw. nicht bestimmbar.

Autoren DieseArbeit Diese Arbeit Ameyama et al., 1974 Adachi et al., 1979

Stamm G. oxydans G. oxydans G. liquefaciens G. suboxydans

Enzym Glukonat: NADP+ Polyol: NADP+ 5-Keiog!u..1conal Reduktasen

-5-Oxidoreduktase -5-Oxidoreduktase

Moleiru!argewichte fKDaj

SDS-Untereinheit 33 56 n.b. 25

Natives Protein 75 57 110 110

pH-Optima

Reduktion 5 5 7,5 5,5

Oxidation 10 10 10 10

KM!MI

Glukonat 2,0 x 10-2 n.b. 18xlO-2 2,0 X 10-2 ,

NADP+ 7,3 x 10-5 1,3 X 10-5 16 , X 10-5 20 , X 10-5

5-Ketoglukonat 12,5 x 10-3 191,0 x 10-3 09 X 10-3 0,9 X 10-3 ,

NADPH 26 x 10-5 06xlO-5 1 1 X 10-5 06 X 10-5 , , , ,

Weitere Substrate [°/01

Fructose (Red.) 10 199 42 0

Sorbitol (Ox.) 0 263 10 0

Mannitol (Ox.) 0 335 n.o. n.b.

Effektoren [%1

Cu2+ 40 18 100 Inhibition

Mn2+ 127 105 100 Stimulation

EDTA 100 125 182 n.d,

Isolierung o.md Charakterisierung des Gen§ fUr die Gh.dilll!l.at: NADP+-5­

Oxidllredukta§e aus G. oxydans

Mit der Isolierung des Gens fur die Glukonat: NADP+-5-0xidoreduktase wurde das erste, am

Ketoglukonatstoffwechsel von G. oxydans beteiligte Protein molekularbiologisch zuganglich.

Das g-ao-Gen kodiert mit einer Lange von 768 bp fur ein Polypeptid aus 256 Aminosauren mit

einem Molekulargewicht von 27.300. Dieser Wert weicht urn 17 % von dem durch SDS-

IV. Dlskusslca 81


Charakterisierung der rekombinanten G. oxydans Stamme

Ziel der Isolierung und Charakterisierung der Enzyme des 5-Ketoglukonatstoffwechse1s, sowie

der Uberexpression des gno-Gens und der Etablierung eines NADPH-Regenerationssystems

durch die NADPH-Oxidase aus S. carlsbergensis in G. oxydans war die Verbesserung der 5­

Ketoglukonatproduktivitat durch diesen Organismus. Untersuchungen zur 5-Ketoglukonat­

produktivitat rekombinanter G. oxydans Stamme zeigten eine Steigerung der 5-Ketoglu­

konatbildung urn 11 %. Dieser Grad der Produktivitatserhohung war auf die Uberexpression

des gno-Gens zuruckzufnhren, fuhrte jedoch nicht zu einer optimalen Verwertung des lin

Rahmen der Glukoseoxidation durch G. oxydans gebildeten Glukonates. 57 % des Glukonates

wurden nicht weiteroxidiert, so dafi die 5-Ketoglukonatausbeute bei den rekombinanten

Stammen 16 %, gemessen an der eingesetzten Glukose, nicht uberstieg. Die Verbesserung der

5-Ketoglukonatbildung beschrankte sich auf die Wachstumsphese von G. oxydans. In der

stationaren Phase kam es zu keiner weiteren Steigerung der 5-Ketoglukonatbildung lin Ver­

gleich zum Wildtyp. Die Bildung von 2-Ketoglukonat blieb unbeeinflufst von der Uberex­

pression des gno-Gens und der Expression des Gens fur die NADPH-Oxidase. Da die 2-Keto­

glukonatbildung vorwiegend tiber einen Nikotinamid Adenindinukleotid unabhangigen Me­

chanismus, membrangebunden und gekoppelt an die Atmungskette erfolgt, war eine Anderung

nicht zu erwarten (Shinagawa et al., 1976). Die Steigerung der 5-Ketoglukonatprodulctivitat

urn 11 % nach 85-facher Uberexpression des gno-Gens und der Expression des G-ens fur die

N.A...DPH..Oxidase deutete aufweitere Limitierungen der 5-Ketoglukonatbildung in G. oxydans

bin. Als denkbarer Begrenzungsfaktor kamhierfur eine limitierteTranslokation des 5-Ketoglu­

konates tiber die Cytoplasmamembran von G. oxydans und die damit verbundene zellinterne

Akkumulation von 5-Ketoglukonat bei Glukonat: NADP+-5-0xidoreduktase-lJ"'berproduzenten

in Betracht, Untersuchungen zu den moglichen Limitierungen der 5-Ketoglukonatbildung

durch rekombinante G. oxydans Stamme zeigten, daf die Uberexpression des gno-Gens keine,

vom Wildtyp··abweichende, zellinterne Akkumulation des Produktes 5-Ketoglukonat verur-

sachte, und daB demnach keine Limitierung der 5-Ketoglukol1atbildul1gauf der Ebene der

Translokation des Produktes tiber die Cytoplasmamembran bestand. Wie der Transport des 5­

Ketoglukonates aus dem Cytoplasma ins Medium erfolgt ist unbekannt, Membranproteine mit

Transportfunktion fur Metabolite wurden bei G. oxydans bislang nicht untersucht..Transport-

systeme fur 5-Ketoglukonat aus anderen Organismen sind bislang nicht untersucht, obwohl

gezeigt werden konnte, daB E. coliul1d Erwinia-Stfunme 5-Ketog1ukol1at verwerten konnen

(Gargan et al., 1982; Truesdell et al., 1991). Die Mechanismen des 5-Ketoglukonattransportes

ins Cytoplasma dieser Organismen wurden nicht untersucht.

Eine weitere Moglich....keit der Limitierung der ..5-Ketoglukonatbildungwar eine eventuell unzu­

reichendeRegenerierung des Kofaktors NADP+ und die damit verbundene zeilinteme Akku 7

IV. Diskussion 87


mulation von reduziertem Nikotinamid Adenindinuldeotid. Dies konnte zu einer feed-back In­

hibition der 5-Ketoglukonat Bildungsreaktion durch den reduzierten Kofaktor bzw. durch

Limitierung der Reaktion durch Kosubstratmangel fuhren, Da von der 5-Ketoglukonatbildung

bekannt ist, daf sie durch Zugabe von CaC0 3 ins Medium aufgrund der geringen Loslichkeit

von Ca-f-Ketoglukonat beeinfluflt werden kann (Stadler-Szoke et al., 1980), ist davon auszu­

gehen, daB es sich bei der Reaktion zur Bildung von 5-Ketoglukonat urn eine Gleichgewichts­

reaktion handelt, deren Verlauf durch Anderung der Konzentrationen der Reaktionspartner

verandert werden Kanno Wird das Reaktionsprodukt NADPH nicht reoxidiert, so steht es wei­

terhin der Ruckreaktion zur Verfugung und es kommt nicht zum effektiven Umsatz von Glu­

konat zu 5-Ketoglukonat. Untersuchungen zum Kofaktor der 5-Ketoglukonat bildenden Reak­

tion zeigten, daf es durch die Uberexpression des gno-Gens bei Wachstum auf Glukose zu

einer Akkumulation des Reaktionsproduktes NADPH kam. Gluconobacter oxydans hat kein

eigenes, vom Zentralstoffwechsel unabhangiges NADPH-Oxidationssystem (Eagon, 1963;

Mowshowitz, 1972). Urn diese potentielle Limitierung aufzuheben, wurde das Gen fur die

NADPH-Oxidase aus S. carlsbergensis gemeinsam mit dem gno-Gen in G. oxydans exprimiert.

Untersuchungen zu den Redoxverhaltnissen in rekombinanten G. oxydans Stammen zeigten,

daB dieses Enzym die NADPH-Akkumulation, die durch die Glukonat: NADP+-S-Oxldoreduk­

tase-Aktivitat hervorgerufen wurde, nicht aufheben konnte. Der Nachweis der NADPH-Oxida­

se-Aktivitat im in-vitro-Test und bei der nativen PAGE zeigte, daB das Enzym in G. oxydans

aktiv exprimiert wurde. Die Hemmung der NADPH-Oxidationsreaktion in-vivo konnte durch

einen Mangel an Sauerstoff als Elektronenak..zeptor im Cytoplasms von G. oxydans erklart

werden, Gluconobacter oxydans hat eine starke Atmungskette, die bei Wachstum auf Glukose

ohne ausreichende Sauerstoffzufuhr zu einer Anaerobisierung des Mediums fuhrt (Buseet al.,

1992). Dies konnte dazu fuhren, daB die Sauerstoffkonzentration im Cytoplasma von G.

oxydans soweit sinkt, daf die bei der Oxidation von NADPH durch die NADPH-Oxidase

anfallenden Elektronen nicht weitergeleitetwerden konnen und als Folge davon die Reaktion in

chanismen fur die Regenerierung des bei der 5-Ketoglukonatbildung anfallenden .reduzierten

Nikotinamid Adenindinukleotids in G. oxydans zu etablieren.

In .der vorliegendenArbeit wurden mit der Uberexpression desgno-G-ens die Voraussetzungen

fur eine verbesserte 5-Ketoglukonatproduktion durch G. oxydans geschaffen, Durch Erhohung

der spezifischen Aktivitat des 5-Ketoglukonat bildenden Enzymsystems kam es zur Verbes­

serung derc-Ketoglukonatbildung, aber auch zur Ausbildung einer Limitierung auf der Ebene

der Kofaktoren, die durch heterologe Expression des Gens fur die NADPH-Oxidase aus S.

carlsbergensis nicht aufgehoben werden konnte. Ein weiteres Zie! ist es nun, durch alternative

NADPH-Oxidationssysteme auch diese Limitierung aufzuheben und die 5-Ketogiukonat­

bildungdurch G. oxydans weiter zu steigem. Die Ergebnisse dieser Arbeit erfordem eine neue

88 IV. Diskus§ion


V. Zusammenfassung

Gluconobacter oxydans bildet bei Wachstum aufGlukose 5-Ketoglukonat, das zur Herstellung

von L-(+)-Weinsaure verwendet werden kann, Ziel dieser Arbeit war es, das fur die 5-Keto­

glukonarbildung verantwortliche Enzymsystem zu isolieren, zu charakterisieren und nach Iso­

lierung des entsprechenden Gens einen G. oxydans Stamm mit verbesserter 5-Ketoglukonat­

produktivitat zu konstruieren.

LI Es wurden zwei 5-Ketoglukonat bildende Enzyme aus G. oxydans DSM 3503 isoliert

und charakterisiert. Die Polyol: NADP+-s-Oxidoreduktase zeigte bei sehr breitem

Substratspektrum e111e Glukonat oxidierende Aktivitat von 9 mU/mg. Die Glukonat:

NADP+-5-0xidoreduktase oxidiert Glukonat bei hoher Substratspezifitat und einer A.1


De Ley, J. und J. Frateur. 1970. The status ofthe generic name Gluconobacter. Int. J. Syst,

Bact. 20:83-95.

De Ley, J. und J. Swings. 1984. Genus Gluconobacter. In Bergey's manual of systematic

bacteriology. (N.R. Krieg und J.G. Holt, Ed.) Williams & Wilkins, Baltimore, USA

1:275-278.

Dothie, J.M., J.R. Giglio, CH. Moore, S.S. Taylor, RS. Harney. 1985. Ribitol dehydrogenase

ofKlebsiellaaerogenes. Biochem. J. 230:569-578.

Dunker, AoK una R.R Rueckert 1969. Observations on molecular weight determinations

on polyacrylamide gels. J. Biol, Chern. 244:5074-5080.

Eagon, R.G. 1963. Rate limiting effects of pyridine nucleotides on carbohydrate catabolic

pathways ofmicroorganisms. Biochem, Biophys. Res. Comm. 12:121-126.

Edman, P. und G. Begg, 1967. A Protein Sequenator. Eur, J. Biochem. 1:80-91

Ensor, CM. und H-H. Tal. 1991. Site-directed mutagenesis ofthe conserved tyrosine 151 of

human placental NAD+-dependent 15-hydroxyprostaglandin dehydrogenase yields a

catalytically inactive enzyme. Biochem. Biophys, Res. Comm. 176:840-845.

Figursld, D.H. und D.R. Helinski. 1979. Replication of an origin containing derivative of

plasmid RK2 dependent on a plasmid function provided in trans. Proc. Natl. Acad, Sci.

USA 76:1648-1652.

Fjservik, E., K. Frydenlund, S. Valla, Y. Huggirat, M. Benziman, 1991. Complementation

of cellulose-negative mutants ofAcetobacter xylinum by the cloned structural gene for

phosphoglucomutase. FEMS Microbiol Lett. 77:325-330.

Fujiwara, A., T. Hoshino, M. Shinjoh, 1989. Novel enzyme (L-sorbosone dehydrogenase

from Gluconobacter oxydans). World Patent Pub. No. 89/06688.

Fujiwara, M., K. Fukushi, M. Takai, J. Hayashi, M. Fukaya, H. Okumura, Y.

Kawamura. 1992. Construction ofshuttle vectors derived from Acetobacterxylinum for

cellulose-producing bacteriumAcetobacterxylinum. Biotechnol. Lett. 14:539-542.

Fukaya, M., T. Iwata, E. Entani, "IT. Masa], T. Uezumi, T. Beppa, 1985 a. Distribution and

characterization ofplaswids Lt1 acetic acid bacteria. Agric, Biol, Chern. 49:1349-1355.

Fukaya, M; K. Tayama, H, Okumura, It Masai, To Uozu.:mi, T.. Beppu, 1985 b.

Improved transformation method for Acetobacterwith plasmid DNA. Agric, Biol. Chern.

49:2091-2097.

Fukaya, M., H. Okumura, H. Masai, T. Uozumi, T.Beppu. 1985 c. Development of a

host-vector system for Gluconobacter suboxydans. Agric, Biol. Chern. 49:2407-2411.

Fukaya, M., K. Tayama, T. Tamaki, H. Tagami, H. Okumura, Y. Kawamura, T. Beppu,

1989. Cloning of the membrane-bound aldehyde dehydrogenase gene ofAcetobacter

polyorogenes and improvement of acetic acid. production .by use of the cloned. gene.

Appl. Env, Microbiol, 55:171-176.

Gabriel, O. und D.M. Gersten, 1992. Staining for-enzymatic activity after gel electrophoresis

I. Anal. Biochem. 203: 1-21.

Gargan, R, W. Brumfitt, J.M.T. Hamilton-Miller. 1982. A concise biotyping system for

differentiating strains ofEscherichiacoli. J. Clin, Pathol. 35:1366-1369.

VI. Literaturverzeichnis 93


Hochuli, E., H. Ddbeli, A. Schacher. 1987. New metal chelate adsorbents selective for

proteins and peptides containing neighbouring histidine residues. J. Chromo 411:177-184.

Hoekema, A., RA. Kastelein, M. Vasser, H.A. de Boer. 1987. Codon replacement in the

PGKI gene of Saccharomyces cerevisiae: experimental approach to study the role of

biased codon usage in gene expression. Mol. Cell. Biol, 7:2914-2924.

Hungerbiihler, E., D. Seebach. 1981. Chirale elektrophile Synthesebausteine mit vier verschiedenen

funktionellen Gruppen aus Weinsaure, 2,3- und 3,4-Epoxybutandiolderivate

in allen vier stereoisomeren Formen. Helv. Chim, Acta 64:687-702.

Ikemura, T. 1981. Correlation between the abundance ofEscherichia coli transfer RNAs and

the occurence ofthe respective codons in protein genes. J. Mol. Biol. 151:389-409.

Inoue, T., M. Fukada, K Yano. 1985. Efficient introduction ofvector plasmids into Acetic

Acid Bacteria. J. Ferment. Technol, 63:1-4.

Irie, S., S. Doi, T. Yorifuji, M. Takagi, K Yano, 1987. Nucleotide sequencing and characterization

ofthe genes encoding benzene oxidation enzymes ofPseudomonas putida.

J. Bacteriol. 169:5174-5179.

Jiimva!l, H., H. von Bahr-Lindstrdm, K-D. Jany, W. Ulmer, M. Frdschle, 1984.

Extended superfamily of short alcohol-polyol-sugar dehydrogenases: structure similarities

between glucose and ribitol dehydrogenases, FEBS Lett. 165:190-196.

Kahn, M.S., RF. Manning. 1988. Process for the preparation of'ketogulonic acid. European

Patent Pub. No. 276 832.

Kersters, K, W.A. Wood, J. de Ley. 1965. Polyol dehydrogenases of Gluconobacter

oxydans. J. Bio!. Chern. 240:965-974.

Kyhse-Andersen, J. 1984. Electroblotting ofmultiple gels a simple apparatus \::vlthout buffer

tank for rapid transfer of proteins from polyacrylamide to nitrocellulose. Biochem. Biophys.

Methods 10: 203-209.

Kitos, P.A., C.H. Wang, B.A. Mohler, T.E. King, V.H. Cheldelia, 1958. Glucose and

Gluconate Dissimilation in Acetobacter suboxydans. J. Biol. Chern. 233:1295-1298.

Klasen, R..,S. Bringer-]\1eyer, It Sahm.. 1992. Incapabilit"j of Gluconoba.cter oxydans to

Produce Tartaric Acid. Biotechnol. Bioeng. 40:183-186.

Klingenberg, M., Co Cox, K Wulff. 1985. Nicoti. ..iamide-adenine dinucleotides and

dinucleotide phosphates. In Methods of enzymatic analysis, (FLU. Bergmeyer, J. Bergmeyer,

M. GraBl, Ed.) Verlag Chemie, Weinheim. 7:251-283.

Kodama, T., D. Kotera, K Yamada. 1972. Induction ofmutants from the tartrate producing

bacterium Gluconobacter oxydans and their properties. Agric, Biol, Chern, 36: 1299­

1305.

Kotera, D., K Umehara, T. Kodama, K Yamada. 1972 a. Isolation method ofhighly tartaric

acid producing mutants ofGluconobactersuboxydans. Agric.Biol. Chern. 36: 1307­

1313.

Kotera, D., T. Kodama, Y. Mineda, K Yamada. 1972 b. Isolation and chemical structure

of new oxidation product of 5-ketogiuconic acid, and a hypothetical pathway from

glucose to tartaric acid through this new compound. Agric. BioI. Chern. 36: 1315-1325.

VI. Literarurverzetchnis 95


Schroder, R A. Maassen, A. Lippolt, T. Borner, R von Baehr, P. Dobrowolski. 1991.

Expression ofthe core antigen of hepatitis B virus (HBV) in Acetobacter methanolicus

using broad-host-range vectors. Appl. Microbiol. Biotechnol. 35:631-637.

Schwedt, G. 1986. Unser taglich Brot: Inhaltsstoffe der Lebensmittel. Kosmos/Franck - Stuttgart:

97-107.

Scopes, RK. 1987. Separation by adsoption on specific adsorbents: Dye ligand chromatography.

In Protein purification, 2nd edition:141-156.

Scrutton, N.S., A. Berry, RN. Perham. 1990. Redesign of the coenz-yme specificity of a

dehydrogenase by protein engineering. Nature. 343:38-43.

Seymour, J.L. und RA. Lazarus. 1989. Native gel activity stain and preparative electrophoretic

method for the detection and purification ofpyridine nucleotide-linked dehydrogenases.

Anal. Biochem, 178: 243-247.

Shinagawa, Eo, T. Chiyonobu, O. Adachi, M. Ameyama, 1976. Distribution and solubilization

of particulate gluconate dehydrogenase and particulate 2-ketogluconat dehydrogenase

in acetic acid bacteria. Agric. Biol. Chern. 40:475-483.

Shinagawa, E., T. Chiyoncbu, K. Matsushita, O. Adachi, M. Ameyama, 1978. Distribution

ofgluconate dehydrogenase and ketogluconat reductases in aerobic bacteria. Agric,

BioI. Chern. 42:1055-1057.

Shinagawa, E., K. Matsushita, O. Adachi, M. Ameyama. 1981. Purification and characterization

of 2-keto-D-gluconate dehydrogenase from Gluconobacter melanogenus.

Agric. Biol. Chern. 45:1079-1085.

Shinagawa, Eo, K. Matsushita, O. Adachi, M. Ameyama, 1984. D-Gluconate Dehydrogenase,

2-Keto-D-gluconate Yielding, from Gluconobacter dioxyacetonicus: Purification

and Characterization. Agric. Biol, Chern. 48:1517-1522.

Shine, J. und L. Dalgarno. 1974. The 3'-terminal sequence ofEscherichia coli 16S ribosomal

RNA: complementarity to nonsense triplets and ribosome bindii.g sites. Fmc. Natl, Acad.

Sci. USA 71:1342-1346.

Simon, R, U. Priefer, A. Piihler. 1983. Vector plasmids for in vivo and in vitro manipulations

of gram-negative bacteria. In Molecular genetics of the bacteria-plant interaction.

(A Puhler, Ed.) Springer Verlag, Berlinirleidelberg. 98-106.

Sluyterman, L.A.i.E. und O. Elgersma. 1978. Chromatofocussing: isoelectric focussing on

ion exchange columns. I. General principles. J. Chromo 150:17-30.

Smith, R.D., J.A. Loc, e.G. Edmonds, C.J. Barinaga, H.R. Udseth, 1990. New developments

in biochemical mass spektrometry: electrospray ionization. Anal. Chern.

62:882-899.

Soltzberg, S. 1945. Process for the preparation oftartaric .acid values. US Patent Pub. No.2

380196.

Sonoyama, T., B. Kageyama, T. Honjo. 1975. Process for producing 2-keto-L-gulonic acid.

US Patent Pub. No.3 922 194.

Vl Literaturverzelchnls 99


Sonoyama, T. und K. Kobayashi. 1987. Purification and properties of two 2,5-diketo-Dgluconate

reductases from a mutant strain derived from Corynebacterium sp. J. Ferment.

Techno!. 65:311-317.

Southern, E.M. 1975. Detection of specific sequences among DNA fragments seperated by

gel electrophoresis. J. Mo!' BioI. 8:503-517.

Stadler-Szoke, A.., L. Nyeste, J. Hollo. 1980. Studies on the factors affecting gluconic acid

and 5-ketogluconic acid formation by Acetobacter. Acta Aliment, 9: 155-172.

Stryer, L. 1991. Biochemie. Spektrum Akad, Verlag G-mbH, Heidelberg, Berlin, New York.

Swings, J. 1992. The Genera Acetobacter and Gluconobacter. In The Prokaryotes: a handbook

on the biology ofbacteria: ecophysiology, isolation, identification, applications. (A.

Balows, Ed.) Springer Verlag, Berlin/Heidelberg. 2268-2286.

Tabor, S, und e.,e., FJcnardson. 1987. DNA sequence analysis with a modified bacteriophage

T7 DNA polymerase. Proc, Nat!. Acad, Sci. USA 84: 4767-4771.

Takeda, Y. und T. Shimizu. 1991. Cloning and Sequencing of the Gene Encoding Cytochrome

c-553 (CO) from Gluconobacter oxydans. J. Ferment.Bioeng. 72:1-6.

Takeda, Y. und T. Shimizu. 1992. Expression of Cytochrome c-553 (CO) gene that

complements the second subunit deficiency of membrane-bound alcohol dehydrogenase

in Gluconobacter suboxydans subsp. C/. J. Ferment.Bioeng. 73:89-93.

Tamaki, T., H. Takemura, K. Tayama, M. Fukaya, H. Okumura, Y. Kawamura. 1991.

Structural gene ofmembrane-bound alcohol dehydrogenase complex, plasmid containing

the same and transformed acetic acid bacteria. Eur. Patent Pub. No. 444 969.

Thatcher, D.R 1980. The complete amino acid sequence of three alcohol dehydrogenase

alleloenrjI11es (Adh N - 11 , Adh S mid ADHUF) from the fruitfly Drosophila melanogaster.

1980. Biochem. J. 187:875-883.

Tindal!, KR und T.A. Kunkel. 1988. Fidelity ofDNA synthesis by the Thermus aquaticus

DNA polymerase. Biochem. 27:6008-6013.

Towbln, H. T. Staehelin, J. Gordon. 1979. Electrophoretic transfer of proteins from polyacrylamide

gels to nitrocellulose sheets: procedure and some applications. Proc, Natl,

Acad. Sci. USA 76:4350-4354.

Truesdell, S.J., J.C. Sims, P.A. Boerman, J.L. Seymour, RA. Lazarus, 1991. Pathways

for metabolism ofketoaldonic acids in an Erwinia sp. J. Bacteriol. 173:6651-6656.

Tung, J.-S. und CA. Knight. 1971. Effect of Charge on the Determination of Molecular

Weight of Proteins by Gel Electrophoresis in SDS. Biochern. Biophys. Res.Comm.

42:1117-1121.

Un Rigo, L., M. Nakano, L.A. Veiga, D.S. Feingold. 1976. LsRhemnose dehydrogenase of

Pullulariapullulans. Biochim. Biophys, Acta. 445:286-293.

Vieira, J. und J. Messing. 1982. The pUC plasmids, and M13mp7-derived system for insertion

mutagenesis and sequencing with synthetic universal primers. Gene 19: 259-268.

Viikari, L. 1984. Formation oflevan and sorbitol from sucrose by Zymomonas mobilis. Appl.

Microbiol, Biotechnol. 19: 252-255.

100 VI. Literaturverzelehnis


Vogelstein, R und J. Gillesspie. 1979. Preparative and analytical purification ofDNA from

agarose. Proc. Nat!. Acad. Sci. USA 76:615-619.

Weber, K. und M. Osborn. 1975. Proteins and sodium dodecyl sulfate: molecular weight

determination on polyacrylamide gels and related procedures. In The Proteins, 3rd

edition. (Fl. Neurath und RL. Hill, Ed.) Academic Press, New York. 179-223.

Weenk, G., W. Olijv!:, W. Harder. 1984. Ketogluconate formation by Giuconobacter

species. Appl. Microbiol. Biotechnol. 20:400-405.

Wie,enga, R.K., M.C.H. De Maeye" W.G.J. Hoi. 1985. Interaction of pyrophosphate

moieties with a-helixes in dinucleotide binding proteins. Biochemistry 24:i346-1357.

Wyckoff, M. 1977. Polyacrylamide gel electrophoresis in sodium dodecyl sulfate-containing

buffers using multiphasic buffer systems: Properties ofthe stack, valid R,measurement,

and optimized procedure. Anal. Biochem, 78:459-482.

Yamada, K., T. Kodama, T. Obata, N. Takahashi. 1971. Microbial formation of tartaric

acid from glucose. J. Ferment. Technol. 49:85-92.

Yanisch-Perron, C, J. Vieira, J. Messing. 1985. Improved M13 phage cloning vectors and

host strains: nucleotide sequences of the M13 mpS and pUC19 vectors. Gene 33:103­

119.

Yin, S.-J., N. Vagelopoulos, G. Lundquist, H. Jiirnva!l. 1991. Pseudomonas 3-hydroxysteroid

dehydrogenase. Eur. J. Biochem. 197:359-365.

Yoshimoto, M. und M. Laskowski Sr. 1982. Large scale purification of iso-inhibitors of

trypsin from swine colostrum using zinc chelate chromatography and chromatofocussing.

Prep. Biochem. 12:235-254.

VI. Lttereturveraetchnls 101


Die vorliegende Arbeit wurde am Institut fur Biotechnologie 1 des Forschungszentrums

Julich GmbH angefertigt.

Herrn Prof. Dr. H. Sahm danke ich fur die Uberlassung des Themas, die groszttgige Unter­

stutzung und sein groBes Interesse am Fortgang der Arbeit,

Bei Herrn Prof. Dr. C. P. Hollenberg bedanke ieh mich fur die freundliehe Ubemahme des

Korreferates,

Vor allem mochte ieh mieh bei Frau Dr. S. Bringer-Meyer fur we standige Diskussions­

bereitschaft und fur die Ratschlage, die diese Arbeit begleitet haben, bedanken,

Allen Mitarbeitern des Instituts fllr Bioteehnologie gilt mein Dank fur ihre Hilfsbereitschaft.

Besonders herzlieh danke ich Cornelia Conzen, Silke Horbach, Heidi Loos und Doris

Rittmann fur die freundsehaftliehe Unterstutzung und die kollegiale Zusammenarbeit,

Fur die photographischen Arbeiten mochte ieh mich bei Herrn S. Peters und semen Mit­

arbeitern bedanken,

Mein Dank gilt auch Herrn H. Paschold, IBT-2, KFA Julich fur die Unterstutzung bei

Grofifermentationen mit G. oxydans, Herrn A. Lustig, Biozentrurn Basel, Schweiz fur die

Durchfuhrung der analytischen Ultrazentrifugation, Herrn M. Resch, Shimadzu, Duisburg ftir

die Aufnahme der MALDI-TOF Massenspektren und Herrn Dr. T. Meyer, BASF AG,

Ludwigshafen fur die Kooperation bei der aminoterminalen Sequenzierung der Glukonat:

NADP+-5-0xidoreduktase. Schliefilich danke ich auch Herrn Dr. P. Dobrowolski, Universitat

Leipzig fur die Bereitstellung von Plasmidkonstrukten und Herrn Prof. V. iviassey, Ann

P...rbor Medical School. US.A:>- fur die Bereitstellung des Gens fnr die NAnpH Oxidase aus

Saccharomyces carlsbergensis.


JiiI-300"l

De;gember 1994­

Druck Mare;: 11995

ISSN 0944-2952

Weitere Magazine dieses Users
Ähnliche Magazine