Molekulare Evolution & Phylogenierekonstruktion - Goethe-Universität

user.uni.frankfurt.de

Molekulare Evolution & Phylogenierekonstruktion - Goethe-Universität

Molekulare Evolution

&

Phylogenierekonstruktion

Eine Einführung

Markus Pfenninger

Abt. Ökologie & Evolution, J.W.Goethe-Universität,

BioCampus Siesmayerstraße, 60054 Frankfurt am Main


Gliederung

• DNA – Grundlage der Vererbung

• Veränderung der DNA

• Baumschule

Phylogenierekonstruktion mit molekularen Markern

• Genbäume in Populationen


•DNA – Grundlage der Vererbung

•DNA ist Träger der Erbinformation

•Untersuchungen von Veränderungen der DNA

erlaubt Rückschlüsse auf ihre Evolution


•DNA – Grundlage der Vererbung

Mitochondrium

ca. 16.000 bp

Kodierende DNA

(~90%)

13 Protein

kodierende Gene

(70%)

2 rRNA Gene

(~15%)

Kontrollregion

(


•DNA – Grundlage der Vererbung

Verpackung der DNA


•DNA – Grundlage der Vererbung

Pyrimidin-Basen Purin-Basen

T

Thymin

Z

P

Z

P

C

Cytosin

C

T

A

G

A

Adenin

Z

P

Z

P

G

Guanin


Veränderung der DNA

CAGTGATTGAAGTAGCCATGAT

GTCACTAACTTCATCGGTACTA

CAGTGATTGAAGTAGCCATGAT

GTCACTAACTTCATCGGTACTA

Replikationsfehler

CAGTGATTGAAGTAGCCATGAT

GTCACTAACTTCATCGGTACTA

CAGTGATTGTAGTAGCCATGAT

GTCACTAACTTCATCGGTACTA

CAGTGATTGAACTAGCCATGAT

GTCACTAACTTCATCGGTACTA

UV-Strahlung

Radioaktivität

Chemische Stoffe


Veränderung der DNA

Somatische Mutation

Krankheit

Alter

Tod

Keimbahn Mutation

Evolution


Veränderung der DNA

Transition

Transversion

Thymin

T

A

Adenin

Pyrimidin-Basen

Purin-Basen

Cytosin

C

G

Guanin

Transitionen werden häufiger beobachtet als Transversionen


Veränderung der DNA

Zeit in

Generationen


Veränderung der DNA

Alle Substitutionen

Korrekturkurve

(Jukes Cantor)

Beobachtete Substitutionen


Veränderung der DNA

•Mutation ist ein stochastischer Prozess

•Mutationen sind an jeder Stelle der DNA gleich

wahrscheinlich


Veränderung der DNA

Effekte von Mutationen:

Positiv – Fixierung durch positive Selektion

Negativ – Verschwinden durch Selektion

Neutral – Kein Effekt auf die Fitness

Der größte Teil der Mutationen ist selektiv neutral

-nicht kodierende Bereiche (>95% des Genoms)

-3. Codon Base (Redundanz des genetischen Codes)


Veränderung der DNA

Gen

Histon 3

Histon 4

α-Globulin

Myoglobin

β-Globulin

Länge in

Aminosäuren

135

101

141

153

144

Nicht

synonyme

Substitutionen

/ 1 Milliarde

Jahre

0.00±0.00

0.00 ±0.00

0.55±0.11

0.56±0.10

0.80±0.13

Synonyme

Substitutionen

/ 1 Milliarde

Jahre

6.38±1.19

6.12±1.32

5.14±0.90

4.44±0.82

3.05±0.56


Polytomie

Baumschule

Ungewurzelter Baum Gewurzelter Baum

Innerer Knoten

Innerer Ast

Endständiger Knoten

äußerer Ast

Innerer Knoten

Zeit

Innerer Ast

Letzter

gemeinsamer

Vorfahre


Baumschule

Cladogramm

Zeit

A

B

D

C

E

E

C

D

Phylogramm

Evolutionärer Wandel

A

B


Baumschule

Gorilla

Schimpanse

Mensch

Monophyletische

Gruppe


Baumschule

Vögel

Krokodile

Eidechsen

Schildkröten

Paraphyletische Gruppe


Baumschule

Neuwelt - Geier

Störche

Raubvögel

Altwelt - Geier

Polyphyletische Gruppe


Baumschule

A

B

C

D

A B

C D

A

B

A

C

C

D

D

B

=

B

C

A

D

=

((A,C)(B,D))

((A,D)(C,B))

B A

D C

A B

= = ((A,B)(C,D))

D C


Baumschule

4 Taxa = 3 mögliche Bäume

5 Taxa = 15 mögliche Bäume

.

.

.

22 Taxa = 3,2 x 10 23 mögliche Bäume

Allgemeine Formel für n Taxa:

B (n) = 1 x 3 x 5 ..... (2n – 5)


GCTAGGTCA

GCAAGGTACA

#

#

A

#

#

C

#

#

A

#

#

T

#

#

#

G

#

#

#

G

#

#

A

#

#

A

#

#

C

#

#

#

G

A

C

T

G

G

A

T

C

G

GCTAGGT-CA

GCAAGGTACA

..*....-..

Phylogenierekonstruktion mit molekularen Markern


Phylogenierekonstruktion mit molekularen Markern

123

A CAG

B CTA

C CAG

D GCA

A B

C D

A

B

A

C

C

D

D C

B

1

C C

C G

C

C

C

C

G

G

C

2

A T

A C

A

T

A

A

A

C

C

T

3

G A

G A

Maximale Parsimonie (Sparsamkeit)

G

A

G

G

G

A

A

A

6 Schritte

5 Schritte

6 Schritte


Phylogenierekonstruktion mit molekularen Markern

C

C

A

C

A n

123

A CAG

B CTA

C CAG

D GCA

1

1 2

3

4 5

B 1

C

G

D

B

Modell der Sequenzevolution:

z.B. Jukes-Cantor Modell

P xx(d) = (1/4) + (3/4) x e -4d/3 (Nukleotid unverändert)

P xy(d) = (1/4) - (1/4) x e -4d/3 (verändert)

P 1(CCCG|CC) = ¼ P CC(k 1)P CC(k 2)P CC(k 3)P CC(k 4)P CG(k 5)}

P 1 = P 1 (CCCG) = ¼ {Σ P 1 (CCCG|xy)}

P tot = (A n |B 1 , k 1 ...k 5 ) = P 1 x P 2 x.....x P n

Maximum Likelihood


G

T

T

C

C

A

A

G

C

D

C

A

T

C

T

A

C

G

C

C

G

A

G

C

T

G

C

T

A

B

C

A

G

C

C

G

C

G

A

A

9

8

7

6

5

4

3

2

1

A B

C D

G

G

G

C

T

T

T

A

A

D

G

C

G

T

T

A

A

A

C

C

T

G

T

T

G

A

A

G

C

B

G

C

G

C

G

A

A

G

C

A

2

9

2

5

7

8

8

4

3

A

B

C

D

Pseudoreplikat

.

.

. 100-10000x

A B

C D

90

87

Bootstrap (Münchhausen) Analyse

Phylogenierekonstruktion mit molekularen Markern


Phylogenierekonstruktion mit molekularen Markern

Hygromiidae

Helicidae

Systematische

Forschung

Vergleichende

Studien mit

phylogenetischem

Hintergrund


A GGTCAGT

B .C.....

C ...G...

D .C..T..

E .C.T.C.

Parsimonisches

Netzwerk

E

A

B

C

D

E

A

-

1

1

2

3

D

B

-

2

1

2

C

-

3

4

D

-

3

E

-

B A C


Literaturempfehlungen:

von Haeseler & Liebers (2003) Molekulare

Evolution. S.Fischer Verlag, Frankfurt.

Page & Holmes (1998) Molecular Evolution: A

phylogenetic approach. Blackwell, Oxford.

Weitere Magazine dieses Users
Ähnliche Magazine