ANNUAL ACTIVITY REPORT - Instituto de Biologia da UFRJ

ANNUAL ACTIVITY REPORT 

ISSN 2177-918X 

National Institute of Science and Technology 

Antarctic Environmental Research

General Coordinator 

Yocie Yoneshigue Valentin – IB/UFRJ 

Vice-coordinator 

Rosalinda Carmela Montone – IO/USP 

Thematic Area 1 (Antarctic Atmosphere) – Team Leader 

Neusa Paes Leme – INPE 

Thematic Area 2 (Antarctic Terrestrial Environment) – Team Leader 

Antonio Batista Pereira – UNIPAMPA 

Thematic Area 3 (Antarctic Marine Environment) – Team Leader 

Helena Passeri Lavrado – IB/UFRJ 

Thematic Area 4 (Environmental Management) – Team Leader 

Cristina Engel de Alvarez – UFES 

Annual Activity Report 2010 

Expedient 

Editors Yocie Yoneshigue Valentin – IB/UFRJ 

Adriana Galindo Dalto – IB/UFRJ 

Helena Passeri Lavrado – IB/UFRJ 

Production Editora Cubo 

Management Rafael Mozeto and Larissa Orlandi 

Proofreader Yocie Yoneshigue Valentin – IB/UFRJ 


Geyze Magalhães de Faria – IB/UFRJ 

Caio Amitrano de Alencar Imbassahy – IB/UFRJ 

Collaboration Geyze Magalhães de Faria – IB/UFRJ 

Caio Amitrano de Alencar Imbassahy – IB/UFRJ 

Photograph Courtesy Adriana Galindo Dalto (Backgrounds: Cover, Expedient, Summary, Presentation, 

Introduction, Science Highlights, Thematic Area 3, Facts and Figures) 

Andre Monnerat Lanna (Background: Thematic Area 1, Thematic Area 4, 

Education and Outreach Activities, Publications, Email) 

Luiz Fernado Wurdig Roesch (Background: Thematic Area 2) 

The editors express their gratitude to the INCT-APA colleagues that contribute to this edition. 

This document was prepared as an account of work done by INCT-APA users and staff. Whilst the document is believed to 

contain correct information, neither INCT-APA nor any of its employees make any warranty, expresses, implies or assumes 

any legal responsibility for the accuracy, completeness, or usefulness of any information, apparatus, product, or process 

disclosed within. As well, the use of this material does not infringe any privately owned copyrights. 

Instituto Nacional de Ciência e Tecnologia 

Antártico de Pesquisas Ambientais (INCT-APA) 

INCT-APA Headquarters Instituto de Biologia, Centro de Ciências da Saúde (CCS) 

Universidade Federal do Rio de Janeiro (UFRJ) 

Av. Carlos Chagas Filho, 373 - Sala A1-94 - Bloco A 

Ilha do Fundão, Cidade Universitária - CEP: 21941-902 

Rio de Janeiro - RJ, Brazil 

Telephone/ Fax +55 21 2562-6322 / +55 21 2562-6302 

E-mail inctapa@gmail.com 

Home Page www.biologia.ufrj.br/inct-antartico 

Management Committee 

Support 

Collaborations 

Production 

Education and Outreach Activities – Team Leader 

Déia Maria Ferreira – IB/UFRJ 

International Scientific Assessor 

Lúcia de Siqueira Campos – IB/UFRJ 

Project Manager Assessor 


Executive Office 

Carla Maria da Silva Balthar – IB/UFRJ 

Finance Technical Support 

Maria Helena Amaral da Silva – IBCCF/UFRJ 

Marta de Oliveira Farias – IBCCF/UFRJ

National Institute of Science and Technology 

Antarctic Environmental Research

I59a 

Cataloguing Card 

National Institute of Science and Technology Antarctic Environmental Research 

Annual Activity Report / National Institute of Science and Technology Antarctic 

Environmental Research = Instituto Nacional de Ciência e Tecnologia Antártico de 

Pesquisas Ambientais (INCT-APA). – 2009– . – Rio de Janeiro : INCT-APA, 2010–. 

240 p. 

ISSN 2177-918X 

1. Environmental research. 2. Antarctica. I. Title. 

CDD 363.7

4 Presentation 

10 Introduction 

13 Science Highlights 

228 Education and Outreach Activities 

232 Facts and Figures 

234 Publications 

238 E-mails 

SUMMARY

PRESENTATION 

National Institute of Science and Technology – 

Antarctic Environmental Research 

Instituto Nacional de Ciência e Tecnologia – Antártico de Pesquisas Ambientais (INCT-APA) 

e importance of Antarctica Research 

Antarctica is the most preserved region of the planet and 

one of the most vulnerable to global environmental changes. 

For this reason, alterations in the Antarctic environment, 

natural or caused by humans, has the potential to provoke 

biological, environmental and socio-economic impacts, 

which can a ect the terrestrial system as a whole. Because 

it is an essential part of the global environmental system, 

the Antarctic region not only sends out climate signals that 

a ect global climate, but also absorbs global climatic signals. 

Anthropic environmental impacts occurring on the planet 

are re ected in Antarctica, including those that emanate 

from South America. 

For this reason, the scienti c research in the Polar 

Regions is of great environmental and economic importance, 

since it contributes to the comprehension of climatic and 

environmental changes observed in these regions. 

e monitoring of terrestrial, marine and atmospheric 

systems is fundamental for the evaluation of such changes, 

which means collecting environmental data on a continuous 

basis, with quality control and for a long period of time, 

registered in a long temporal series, thus permitting a more 

precise evaluation of future implications, o ering support 

to decision-making. 

e protection of the environment of Antarctica is 

one of highest priorities of all the nations that operate 

on the Antarctic continent. For this reason the region 

should continue to be the most preserved of the planet, 

harmonizing the presence of man and the attendance of 

mankind’s needs related to the mitigation of environmental 

impact of an ecosystem which is highly fragile. 

In 1991, the concerns over the consequences of human 

activity in the Antarctic environment became a reality 

through the Protocol of the Treaty of Antarctica for the 

4 | Annual Activity Report 2010 

Protection of the Environment, which came into force in 

1998. is protocol established directives and procedures, 

which should be adopted in the undertaking of activities in 

Antarctica. e monitoring of the environmental impact of 

Brazilian activities in Antarctica is a commitment assumed 

by the Brazilian Government through the rati cation of the 

Madrid Protocol. 

What is the INCT – Antarctic 

Environmental Research? 

The National Institute of Science and Technology - 

Antarctic Environmental Research (abbreviated as INCT in 

Brazilian Portuguese used in this document as INCT-APA 

hitherto) were created by the Brazilian Ministry of Science 

and Technology (Ministério de Ciência e Tecnologia 

(MCT) in search of excellence in scienti c activities at an 

international level in strategic areas de ned by the Action 

Plan 2007-2010 of the Science Programme, Technology and 

Innovation for Antarctica, by means of programmes and 

instruments made operational by CNPq and by FAPERJ 

(Research support Foundations at di erent levels). e 

referred initiative has the view to implement a network 

of atmospheric, terrestrial and marine monitoring, in the 

Antarctic region. 

Who are we? 

INCT-APA consists of more than 70 researchers who 

in an integrated manner evaluate the local and global 

environmental impacts in the atmospheric, terrestrial 

and marine areas of Maritime Antarctica systems and 

in addition are involved in the related educational and 

scienti c outreach of their activities. e research developed

y INCT-APA will contribute to influence initiatives 

concerning biological diversity and environmental 

protection of Antarctica, principally in the scope of the 

Ministry of Science and Technology and the Ministry of 

the Environment. Furthermore it assists in educational 

processes with the purpose of divulging Antarctica research 

to the public in general. 

Mission 

To valorise the region of Antarctica as an opportunity for 

development of transdisciplinary scienti c investigations, 

promoting education and divulging information and 

environmental management. 

Aims 

To be an institute of reference in Antarctic environmental 

research and in the preservation of this continent as an 

asset for humanity. 

e purpose of INCT-APA: 

• To develop scienti c investigations in marine, terrestrial 

and atmospheric environments in the Antarctic region; 

• To structure and operate a local and global environmental 

management system; and 

• To promote the education and the diffusion of 

information committed to the construction of a global 

environmental conscience. 

Presentation | 

5

6 | Annual Activity Report 2010

e activities of this institute will contribute to in uence 

initiatives concerning biological diversity and protection of 

the Antarctic environment, especially in the sphere of the 

Ministry of Science and Technology and the Ministry of the 

Environment, including the development of educational, 

formative and informative processes directly related to 

Antarctica. 

See more at: www.biologia.ufrj.br/inct-antartico 

Contact: inctapa@gmail.com 

INCT-APA MANAGEMENT COMMITTEE 

GENERAL COORDINATION 

Prof. Yocie Y Yoneshigue 

Y Valentin V (IB/UFRJ) 

Prof. Rosalinda Carmela Montone (IO/USP) 

General team leader of INCT T – A PA P 

Vice-team leader of INCT – APA 

Dr. Neusa Paes Leme (INPE) 

Thematic Area 1 - Team Leader 

Prof. Antonio Batista Pereira (UNIPAMPA) 


THEMATIC AREA TEAM LEADERS 

ASSESSORS 

Prof. Lúcia de Siqueira Campos (IB/UFRJ) 

Coordination Executive Office and International Science 

Dr. Adriana Galindo Dalto (IB/UFRJ) 

Project Manager Assessor 

Prof. Helena Passeri Lavrado (IB/UFRJ) 


Prof. Cristina Engel de Alvarez (UFES) 


Prof. Déia Maria Ferreira (IB/UFRJ) 

Outreach and Education Assessor 

THEMATIC AREA 1 THEMATIC AREA 2 THEMATIC AREA 3 THEMATIC AREA 4 

UNIVERSIDADE FEDERAL DO RIO GRANDE DO NORTE 

INCT- Antarctic Environmental Research 

(INCT- Antártico de Pesquisas Ambientais) 

INCT-APA is based at the Federal University of Rio de 

Janeiro — Universidade Federal do Rio de Janeiro (UFRJ), 

Institute of Biology, under the coordination of Professor 

Yocie Yoneshigue Valentin (Botany Department - Institute 

of Biology/ UFRJ). e team consists of approximately 

200 people, amongst them fully certified researchers, 

undergraduation and graduate students, belonging to 16 


7

universities and other research institutes distributed in eight 

Brazilian states: Rio de Janeiro, São Paulo, Espírito Santo, Rio 

Grande do Norte, Goiás (Brasília), Paraná, Santa Catarina 

and Rio Grande do Sul. 

INCT-APA – Objectives: 

1. To know and monitor Antarctica’s atmosphere and its 

environmental impact on South America; 

2. To know and monitor the impact of global changes on 

Antarctic terrestrial environment; 

ematic Research Areas 

Adriana G. Dalto Adriana G. Dalto 

ematic Area 1 


Antarctic Atmosphere and 

Environmental Impacts in 

South America 

Operated through the knowledge and monitoring of 

Antarctica’s atmosphere and its environmental impacts 

on South America 

Objectives: 

1. To monitor and evaluate: 

• e regions of movement of Antarctic Cold Fronts 

as far as South America, especially Brazil; 

• e greenhouse e ect perceived in Antarctica; 

• e chemical alterations of the atmosphere and their 

in uence on the climate, involving: the interaction 

Sun - Earth, the temperature of the mesosphere and 

the hole in the ozone layer; 

2. To o er supporting information to numeric models 

of climate and weather forecasting. 

3. To know and monitor the impact of human activities 

on Antarctic marine environment; 

4. To develop an integrated management model 

for monitoring and evaluating local and global 

environmental changes; 

5. To valorise Antarctic science for Brazilian society, 

promoting education and outreach. 

e objectives of INCT-APA related to Environmental 

Research are portrayed in the thematic modules described 

below: 

ematic Area 2 

Global Changes on Terrestrial 

Antarctic Environment 

Operated through the study and monitoring of the 

impact of global, natural and anthropogenic origins in 

the Antarctic terrestrial environment. 

Objectives: 

1. To measure the alterations to vegetation cover 

and the alteration to the diversity of vegetation 

communities; 

2. To evaluate the fluctuation and distribution of 

seabird populations.

Marcio M. B. Tenório 

Adriana G. Dalto Andre M. Lanna 

ematic Area 3 

Impact of Human Activities 

on the Antarctic Marine 

Environment 

Operate in the study and monitoring of the impact 

of global, natural and anthropogenic origins in the 

Antarctic marine environment. 

Objectives: 

1. To study the e ects of the environmental impact 

(natural and anthropogenic) on the comprehension 

of the ecosystemic processes which require longer 

temporal series, by means of monitoring of the 

marine environment; 

2. To supplement the processes and environmental 

management instruments, following the example 

of Admiralty Bay Management Plan (Plano de 

Manejo da Baia do Almirantado), with information 

acquired from studies described in objective 1 of 

this module. 

3. To identify the presence of exotic marine species 

and de ne possible endemic species. 

ematic Area 4 

Environmental Management 

Operated through the development of integrated 

environmental management for the Antarctic region, 

especially for the Admiralty Bay. Furthermore, in the 

development of tools to valorise Antarctic science for 

Brazilian society, promoting education, dissemination 

of scienti c information. 

Objectives: 

1. To develop an environmental management system 

for the Antarctic region, especially Admiralty Bay, 

encompassing diagnostic, planning, decisionmaking, 

implementation, accompaniment and 

permanent evaluation of the Antarctic environment; 

2. To organize a system with the existing environmental 

indicators and integrate them in the form of a model 

DPSIR (Drive Forces) 

3. To operate a permanent monitoring and evaluation 

system. 

Marcio M. B. Tenório Andre M. Lanna 


9

INTRODUCTION 

Antarctica Environmental Research: 

Global Approach 

Yocie Yoneshigue Valentin – General Coordinator 

e central focus of the activities of the National Institute 

of Science and Technology-Antarctica Environmental 

Research (INCT-APA) is the Antarctica Biocomplex 

Ecosystem. e concept of “Biocomplexity” incorporates the 

study of several biotic compartments of the Antarctica and, 

principally, its structural and functional inter-relationships, 

as well as the actions of abiotic factors (wind, temperature, 

salinity, tides, ultraviolet radiation, ozone layer, solar 

interaction, the earth, etc) which act positively or negatively 

on the biota. To complete the framework of inter-relations 

between the biota and the environment, the atmospheric 

variables should be analysed concomitantly, as well as the 

anthropic activities. us, it is a question of investigating 

the complex network of inter-relationships in this important 

and peculiar biome of our planet, basing ourselves on a 

conceptual model which will be presented in continuity in 

a simpli ed form (Figure 1). 

The biocomplexity will be subject of study in the 

terrestrial and marine environments, with a view to 

studying the inherent communities. The vegetation 

and the top predators, as well as the seabirds, make up 

the two axis of the terrestrial community studies. eir 

relationships will be investigated, together with the 

increase of ultraviolet radiation, which might possibly 

cause harm to the chlorophyll molecules of algae and 

plants. Furthermore, the UVB radiation represents 1.5%, 

of the total spectrum that reaches the terrestrial surface. 

is radiation is the most damaging, being able to cause 

negative e ects alike to aquatic organisms as to terrestrial, 

including human activity in the Antarctica region, by 

means of the introduction of contaminants such as 

petroleum hydrocarbons, present in the surroundings 

of the Antarctica Research Bases. e receding of the 

glaciers is another relevant factor to be considered, 


since the increase of ice free areas, exposing rocks and 

soil, favours the colonization of these areas by small size 

vegetation, such as, mosses, lichens and some angiosperms, 

which in turn contribute to the formation of new areas of 

nidi cation of seabirds, such as the Brown Skua, penguins 

and others seabirds. 

In the marine environment, two systems and their 

relationships shall be considered, the Pelagic and the 

Benthic. e Pelagic consists of plankton (phytoplankton, 

zooplankton) and nekton (fish and other swimming 

organisms) and the benthic system considering the 

phytobenthic (micro and macroalgae) and zoobenthic. 

e marine ora and fauna are well adapted to the extreme 

climatic conditions with very low temperatures (including 

below zero) the e ect of the ice, prolonged freezing of 

expanses of sea, and the extreme variations in the periods 

of solar radiation between summer and winter. Studies 

concerning the vital processes of some abundant animals 

and species of vegetation in the circumpolar region of 

Antarctica are being undertaken with the purpose of 

understanding the survival of these organisms in relation 

to freezing, melting, and consequently, the reduction of salt 

in the water. It is known that natural alterations in relation 

to climate a ect biological communities and forms, as well 

as those stemming from human activity. ese factors 

are of fundamental importance for the conservation and 

preservation of these environments. 

To give due credit to Antarctica Science it is necessary 

to promote education on the subject and to disseminate 

scienti c information by means of tools which have a 

broad capacity of propagation throughout society. e 

multi-disciplinary themes investigated by INCT-APA 

promote the formation and consolidation of human 

resources directed to research in the Polar Regions. All

these activities converge on the integrated environmental 

management of Admiralty Bay and the surrounding 

regions, being the principal areas of study of this Institute. 

With the development of this set of research studies 

articulated around the biocomplexity of the Antarctic 

PLANKTON 

PHYTO ZOO 

ATMOSPHERE 

MARINE 

COMMUNITIES 

PELAGOS BENTHOS 

NECTON 

PHYTO ZOO 

ecosystem, we intend to achieve an integrated vision of 

the processes that lead to how this environment functions 

and to how it is structured, which in essence is the overall 

objective of INCT-APA. 

BIOCOMPLEXITY 

VEGETATION 

Figure 1. Conceptual model of the inter-relations between biota and environment. (Illustration: Edson Rodrgues). 

ANTHROPIC 

ACTIVITY 

TERRESTRIAL 

COMMUNITIES 

TOP PREDATORS 

(Ex. Birds) 

Introduction | 

11

SCIENCE HIGHLIGHTS 

14 ematic Area 1 

ANTARCTIC ATMOSPHERE AND ENVIRONMENTAL 

IMPACTS IN SOUTH AMERICA 


GLOBAL CHANGES ON TERRESTRIAL ANTARCTIC 

ENVIRONMENT 


IMPACT OF HUMAN ACTIVITIES ON THE 

ANTARCTIC MARINE ENVIRONMENT 


ENVIRONMENTAL MANAGEMENT

THEMATIC AREA 1 

ANTARCTIC ATMOSPHERE AND 

ENVIRONMENTAL IMPACTS IN SOUTH 

AMERICA 

20 Monitoring of Atmospheric Changes Related to Sun-Earth Interactions 

27 Studies of Gravity Waves at Ferraz Station (62° S) and Recent Observations 

33 Infl uence of the Antarctic Ozone Hole Over the South of Brazil in 2008 and 2009 

38 Atmospheric SO Measurements at the Brazilian Antarctic Station 

2 

44 Monitoring Greenhouse Gases in Comandante Ferraz Antarctic Station, King George Island 

48 Considering New Parameters in the Study of Atmospheric Impacts at Admiralty Bay 


Introduction 

The monitoring of the Antarctic atmosphere and its 

influence on South America is being built using solid 

foundations from the studies that for decades have been 

undertaken by Brazilian researchers in the Antarctic region. 

e proposal is to continue these studies, which require 

long term series of data for a greater understanding and 

monitoring of environmental changes. e information 

obtained also o ers support to numerical models of weather 

and climate forecasts, which can thus become more reliable. 

In all, the research already undertaken and presently 

underway represents more than two decades of continuous 

research of the in uence of cold fronts from the Antarctic 

on Brazilian climate, monitoring of the ozone hole, variation 

of UV radiation and other highly relevant studies. 

e monitoring of the impacts of solar phenomena 

in the Antarctic atmosphere is designed to identify the 

contribution of activity and changes in the medium and 

long term (solar cycle) in the upper atmosphere. us 

we can establish the connection between changes in 

the interplanetary medium and the terrestrial climate, 

considering the sociological and coupling of the various 

layers of the atmosphere. 

e observations of chemical emissions on top of the 

Antarctic mesosphere (80-100 km altitude) are used in 

studies of the dynamics of atmospheric waves that propagate 

toward the upper atmosphere. Accompanying these 

movements will allow greater understanding of the e ects 

of the Antarctic polar vortex and the transport of energy 

into the upper atmosphere. is issue stands out as one of 

the main topics in understanding the processes responsible 

for global climate variations. 

Coordinator 

Dr. Neusa Maria Paes Leme – INPE/CRN 

Vice-Coordinator 

Dr. Emília Correia – INPE/CRAAM 

The increase in greenhouse gases (carbon dioxide, 

methane, etc.), at the bottom of the atmosphere (up to 30 km 

altitude) can cause a drop in temperature of the mesosphere 

between the 80 and 90 km altitude. e decline in the 

concentration of the ozone layer causes the temperature 

of the stratosphere (between the 15 and 50 km area) to 

decrease. us temperature measurement is an important 

parameter to monitor changes on the long term. 

A new issue has arisen with the temperature change 

in the region of the ozone layer. What will happen to the 

connection between the layers and the equilibrium with 

the lowering of the temperature of the upper atmosphere 

and increased temperature on the ground? e variations 

of temperature and UV radiation will produce changes in 

both the chemistry and the dynamics of the layers of the 

atmosphere. 

e atmospheric aerosols play an important role in 

global radiation balance and their importance on the sub- 

Antarctic is not yet completely understood. e Antarctic 

Peninsula region is strongly in uenced by di erent sources 

of aerosols, such as aerosols of marine origin due to the 

high primary productivity of ocean regions adjacent to the 

Patagonian desert dust, volcanic activity of the southern 

Andes and long distance transport from urban areas and 

forest res in South America. For this reason, there is the 

intention to simultaneously monitor aerosols in two seasons 

in Patagonia (Punta Arenas) and King George Island. 

Furthermore, the e ect of local anthropogenic pollution 

resulting from human settlement areas in the Antarctic 

region as well as the contribution of bio-aerosols is still 

unknown. Thus, monitoring of aerosols will have two 

purposes: to diagnose the impact of local human presence, 

Science Highlights - Thematic Area 1 | 

15

model the dynamics of plumes of pollutants from local 

sources, and investigate the long-distance transport, with 

emphasis on the in uence on South America. 

Goals 

Monitor and evaluate 

• e region where cold fronts move toward Brazil and 


the respective changes and variations to the climate; 

• e greenhouse e ect seen in Antarctica; 

• Changes in chemistry and physics of the atmosphere 

and its in uence on climate, involving: the interaction 

Sun-Earth, the temperature in the mesosphere and 

Figure 1. Thematic Area 1 fl owchart. (Illustration: Edson Rodrigues). 

the region of the ozone layer, especially during the 

occurrence of the “hole in the ozone layer.” 

• e impact of solar radiation on the environment. 

• Modelling the spatial atmospheric impact due to local 

sources to study the atmospheric transport between 

South America and Antarctic Peninsula. 

O er subsidies to numerical models of weather 

and climate 

Over the past 65 years, average annual air temperatures 

in Admiralty Bay show an average warming of +0.23 °C. 

However, one must consider that in this region climatological 

measurements were only standardized in the last 30 years

and the data from this period does not indicate a warming 

climate. Over the past 14 years, the average annual air 

temperatures recorded in EACF showed a downward trend 

(≈ –0.6 °C / decade, Setzer et al., 2009). According to these 

researchers from the weather team, the winters of 2007 

and 2009 were very severe, freezing the two lakes that feed 

EACF and the expanse of ice covering Admiralty Bay peaked 

with frozen sea to the vicinity of the Polish station, near the 

entrance to the Bay. January and February 2010 were the 

coolest summers on record at EACF in 37 years (mean air 

temperature +1.0 °C + 0.2 °C in January and February). 

Measurements of ozone concentration obtained by Brazilian 

researchers, from 1990 to date have shown a large variation 

in annual gures for Keller Peninsula region (King George 

Island, Antarctica). e latter, ranging from 70% in 2006 

to 55% in 2010 compared to the normal concentration, 

before 1980, when observations were rst made, by which 

time the ozone layer was declining over the South Pole. 

Furthermore the time of ozone recovery has also changed 

showing reductions in the month of December, which due 

to high temperatures the atmosphere is already showing 

a scenario of normalizing the previous destruction. e 

ozone hole occurs only in very cold atmosphere (typical of 

the south pole) and every year when summer arrives in the 

Antarctic, the hole recovers (in December), but not on par 

with the year of 1980 which is the benchmark for what we 

consider as normal. 

One consequence of this decrease in concentration of 

the ozone layer is increased UV radiation. is increase in 

radiation is con rmed by extreme events over Antarctica 

and South America, including southern Brazil where in 

2010 we observed a reduction of 25% of the concentration 

of ozone. The southern region of Brazil is subject to 

reductions of ozone in October and November, which 

could be called side e ects of the Antarctic ozone hole. is 

shows that there is still a lot of chloro uorocarbon (CFC) 

in the Antarctic atmosphere, and its annual variability 

is due to the temperature in the stratosphere (the region 

between 15 to 50 km altitudes) in the Antarctic winter. 

e monitoring of the ozone layer has also shown that 

the decrease of the same causes change in temperature of 

the stratosphere and a ects the chemical makeup of some 

greenhouse gases like CO and ozone surface forming a line 

2 

to the Rio Grande South excessively increasing the incidence 

of UV-B radiation and contributing to the increase in the 

number of cases of glaucoma, skin cancer and damage to 

DNA in this region of the country, as well as damage to the 

chlorophyll molecules in plants and algae. In large urban 

areas increased UV radiation alters the photochemistry of 

the atmosphere enhancing the e ect of greenhouse gases 

at ground level. 

e studies of the dynamics of the Sun-Earth system 

and monitoring of ultraviolet radiation and ozone on the 

Antarctic Peninsula, Punta Arenas (Chile) and in southern 

Brazil have shown the influence to wind patterns and 

intensity of UV radiation that reaches the earth’s surface, 

cloud cover and precipitation. Continuous measurements 

of UV-A and UV-B in these regions have shown an increase 

in radiation during the occurrence of the ozone hole. In 

2009 and 2010 in the terrain around EACF an increase 

in UV radiation above 150% compared to the normal 

concentration was recorded, without the presence of the 

ozone hole. 

From 11 to 30 November 2009 the Antarctic vortex was 

located just south of the southern tip of South America 

rather than at its climatological position over Antarctica. 

Analysis of 30 years of assimilated total O column and 

3 

UV index measurements shows that this 20 day event was 

unique in the history of the ozone hole for these latitudes. 

During this period, small total O columns and large 

3 

UV index values were observed over the southern tip of 

South America. Comparison of ground based and satellite 

measurements of total O columns and satellite based 

3 

calculations of the UVI index – never designed nor validated 

for such extreme Southern Hemisphere conditions – show 

excellent consistency. (de Laat et al., 2010 ). 

e e ect of UV and its potentially harmful e ect to 

marine life may also enhance the toxic e ects of some 

contaminants such as petroleum hydrocarbons, commonly 

present in the vicinity of research stations. A recent study 

has demonstrated that the mortality of marine amphipod 

crustacean Gondogeneia Antarctica, submitted to the e ects 


17

of anthracene, increased signi cantly in the presence of UV 

(Gomes et al., 2009), reinforcing the importance of knowing 

the biological responses of species to the synergistic action 

(the various natural and anthropogenic environmental 

factors). 

e variability observed in the ozone layer and in the 

ground intensity of the UV-A and UV-B radiation, in the 

last years, was accompanied by changes in the ionized layer 

of our atmosphere, the ionosphere. Study of the ionosphere 

behaviour done in the Brazilian Antarctic Station in the last 

six years con rmed it is controlled by the solar radiation, 

showing variations in close association with the decreasing 

activity of the 23rd solar cycle. Furthermore, during 

the local wintertime (April to October in the southern 

hemisphere), the ionosphere behaviour was strongly a ected 

by meteorological processes from below in all of the years. 

e dynamic processes of the lower-lying atmospheric levels 

are associated with the generation of waves, particularly 

the gravity waves (period of minutes/hours) and planetary 

waves (period of days), amongst others. is study showed 

that during the wintertime the planetary waves can strongly 

a ect the lower ionosphere (Correia, 2011), evidencing 

the coupling between the di erent atmospheric layers. 

In addition to the effect of the planetary waves in the 

References 


lower ionosphere, the study also suggested an interannual 

behaviour, which has been observed in physical atmospheric 

parameters, and is attributed to the interaction between the 

atmospheric waves and winds. 

One of the most important properties of the atmosphere 

is its ability to withstand movement of waves. e gravity 

waves are well known to play an important role in Earth’s 

atmosphere, for example, their in uence on the thermal state 

and the atmospheric circulation. Observations of gravity 

waves have been performed on a large scale in regions of 

low and mid latitudes. However, at high latitudes, as in 

Antarctica, these observations are sparse and little is known 

of the characteristics of waves. Studies are being conducted 

on them in the Comandante Ferraz Antarctic Station 

(62° S and 58° W), with campaigns of observations with 

airglow imagers at di erent latitudes (Bageston et al., 2009). 

e study of planetary waves and gravity waves can identify 

and better assist with the understanding of the dynamics 

of the neutral upper atmosphere (mesosphere) and their 

interaction with the other layers of the atmosphere. e 

observation of the dynamics from Antarctica to Ecuador will 

identify the various processes of transport and connection 

and how it a ects the atmosphere. 

de Laat, A.T.J.; van der A., R.J.; Allaart, M.A.F.; van Weele, M.; Benitez, G.C.; Casiccia, C.; Paes Leme, N.M.; Quel, E.; 

Salvador, J. & Wolfram, E. (2010). Extreme sunbathing: Three weeks of small total O 3 columns and high UV radiation 

over the southern tip of South America during the 2009 Antarctic O 3 hole season, Geophysical Research Letters, 37, 

L14805, doi:10.1029/2010GL043699. 

Bageston, J. V.; Wrasse, C. M.; Gobbi, D.; Tahakashi, H. & Souza, P. (2009). Observation of mesospheric gravity waves at 

Comandante Ferraz Antarctica Station (62°S). Annales Geophysicae, 27: 2593-8. 

Correia, E. (2011). Study of Antarctic-South America connectivity from ionospheric radiosoundings. Oecologia Australis, 

15: 10-17. 

Gomes, M. S. (1999). Determinação de elementos metálicos em sedimentos da Baía do Almirantado, Ilha Rei George, 

Península Antártica. Dissertação de Mestrado. 193 p. Universidade de São Paulo. 

Gomes, V.; Passos, M.J.A.C.R.; Leme, N.M.P.; Santos, T.C.A.; Campos, D.Y.F.; Hasue, F.M. & Phan, V.N. (2009). Photo-induced 

toxicity of anthracene in the Antarctic shallow water amphipod, Gondogeneia antarctica. Polar Biology, 32(7): 1009–21. 

Setzer, A.; Villela, F.N.J. & Deniche, A.G.P. (2009). Antarctic Metereology. Annual Activity Report of National Institute of Science 

and Technology Antarctic Environmental Research, p. 20-21.


19

1 MONITORING 

OF ATMOSPHERIC CHANGES RELATED TO 

SUN-EARTH INTERACTIONS 


Emília Correia 1,2,* , Jean Pierre Raulin 2 , Pierre Kaufmann 2 , Fernando C.P. Bertoni 2 , Juliano Moro 1 

1 Instituto Nacional de Pesquisas Espaciais, São José dos Campos, SP, Brazil 

2 Centro de Rádio Astronomia e Astrofísica Mackenzie, Escola de Engenharia, 

Universidade Presbiteriana Mackenzie, São Paulo, SP, Brazil 

*e-mail: ecorreia@craam.mackenzie.br 

Abstract: Our upper atmosphere is a ected by solar forcing, whose main sources are the ionizing radiation and space weather. e 

solar ionizing radiation changes in association with the 11-year solar cycle, 27-day rotation and solar ares. VLF soundings have 

con rmed the solar Lyman-alpha as responsible through the formation and maintenance of the ionized layer of our atmosphere, 

the ionosphere, which shows variations in close association with the 11-year solar cycle. Excess of X-ray radiation produced 

during the solar ares, when the solar radiation can increase in order of magnitude, strongly disturbs the lower ionosphere. 

Ionosphere studies using VLF technique have identi ed that even very weak solar ares (B2 as X-ray classi cation from GOES 

satellite) can be enough to a ect the ionosphere during the minimum of solar activity, but this limit increases as the Sun becomes 

more active. e ionosphere is also a ected by forcing coming from the lower-lying atmospheric layers. e in uence of the 

planetary waves of neutral atmosphere origin has been observed, and it is dominant during the local wintertime. e studies 

have shown the in uence of the Sun-earth interaction in the chemistry and dynamics of our atmosphere, and also the exchange 

of energy between the di erent atmospheric layers, which might a ect the terrestrial and marine environment, especially in the 

polar region. 

Keywords: atmosphere, sun-earth interaction, atmospheric radio sounding 

Introduction 

e earth´s upper atmosphere is basically controlled by 

solar forcing from above, the solar ionizing radiation being 

responsible through the formation and maintenance of the 

ionosphere, the atmospheric layer being between about 

60 km and 1000 km in height. e variability of the solar 

ionizing radiation is mainly due to the 11-year solar cycle, 

27-day rotation and solar ares. e lower ionosphere 

(

e ionosphere is also disturbed by forcing from below, 

which is mainly due to the upward propagating gravity and 

planetary waves originated in the neutral atmosphere. e 

e ects of the neutral atmospheric waves in the ionosphere 

have been observed particularly during the wintertime 

(Lastovicka, 2006). e low ionosphere presents a complex 

and extremely variable behaviour due to these two external 

competitive forcings (Lastovicka, 2009), of difficult 

characterization. e base of the ionosphere (~60-70 km) is 

not accessible to in situ measurements, being only accessible 

by rockets or by ground-based soundings, which results in 

the ionospheric region being less understood. 

e upper atmosphere is maintained and controlled 

by solar forcing from above, but it is also a ected by the 

wave activity from the lower-lying layers, which shows 

a coupling between the di erent atmospheric layers in a 

wide range of heights (30 km to 300 km) from troposphere 

to the mesosphere. is coupling between the di erent 

atmospheric layers shows the Sun-Earth interactions that 

a ect the upper atmosphere, can also indirectly/directly 

a ect the lower atmosphere. us, the monitoring of the 

upper atmosphere is important to de ne the in uence of 

the solar forcing on it, and how that can a ect the lower- 

lying layers, which can help us to understand how they can 

a ect the terrestrial and marine environment, especially in 

the polar region. 

To improve our understanding of the external forcing in 

the ionosphere, simultaneous and integrated observations 

are desirable to evaluate the coupling processes with the 

magnetosphere, as well with the lower-lying atmospheric 

layers. The atmospheric studies at higher latitudes are 

especially important because there the signatures of the 

interplanetary space processes are footprinted. In the 

following we present the current capabilities for probing 

the ionosphere at Comandante Ferraz Brazilian Antarctic 

Station (EACF) and in South America, and some recent 

scienti c results showing the response of the ionosphere 

to external forcing. 

Material and Methods 

e ionosphere at EACF (62.11° S and 58.41° W) has been 

probed by various radio sounding techniques, which give 

information about the ionospheric disturbances. 

VLF technique is used to study the lower ionosphere, 

D-region, which is between 60 and 85 km. It consists in 

detecting signals at frequencies between 1 and 50 kHz, 

propagating over long distances inside the earth–ionosphere 

waveguide. e conductivity gradient and the reference height 

changes in the low ionosphere can be detected as amplitude 

and phase variations of the VLF signals. Since 2006, the VLF 

measurements at EACF have been done with an Atmospheric 

Weather Electromagnetic system for Observation, Modelling 

and Education receiver - AWESOME (Scherrer et al. 2008), 

which detects the VLF amplitude and phase with 20 ms time 

resolution of de ned stations, as well as broad-band data in 

all frequency ranges. e VLF measurements at EACF are 

complemented with measurements done at Itapetinga Radio 

Observatory in Atibaia/SP (23.21° S and 46.51° W) using 

another AWESOME receiver, and by the South America VLF 

Network (SAVNET, Raulin et al., 2009) that is operating with 

six receivers in South America, three of them in Brazil. e 

most powerful VLF transmitter stations tracked are from 

US Navy, which permits the study of di erent ionospheric 

paths, some of them inside the South Atlantic Magnetic 

Anomaly (SAMA). 

e Total Electron Content (TEC) of ionosphere can be 

obtained from GPS measurements done with dual frequency 

receivers. is technique is based on the property that dual 

frequency radio signals (L1: 1.6 GHz and L2: 1.2 GHz) 

propagating through the ionosphere are subjected to a 

di erential phase change due to the dispersive nature of 

the plasma. As a rst–order approximation the di erential 

phase shi s is directly proportional to the TEC, which is 

de ned as the line integral of the electron concentration 

along the path from a satellite to a receiver. e ionosphere 

has been monitored at EACF since 2004 using a dual 

frequency Javad GPS receiver with best time resolution of 

1s. e GPS measurements at EACF are complemented with 

data from the Brazilian GPS network (Rede Brasileira de 

Monitoramento Contínuo, RBMC) of the Instituto Brasileiro 


21

de Geogra a e Estatística (IBGE), which nowadays has 

more than 60 operational receivers covering almost all the 

Brazilian territory (IBGE, 2010), and permits the study of 

the latitudinal extension of the ionospheric disturbances, 

from Antarctica to equatorial regions. 

e lower ionosphere has being also probed using a 

relative ionospheric opacity meter (riometer) that monitors 

the background cosmic radio noise at 20-50 MHz received 

on the ground a er crossing the ionosphere. At EACF, 

since the beginning of 2009, three 1-channel riometers 

at 30 and 38 MHz are operating. ey consist of a simple 

dipole antenna that receives cosmic radio noise with a broad 

beam (>60o ), two are for measuring intensity and one for 

polarization. is technique is based on the comparison of 

the received signal with a Quiet Day Curve (QDC) obtained 

during geomagnetically undisturbed days, which gives the 

attenuation of the signal and hence the cosmic radio noise 

absorption (CNA) at the monitored frequency. Most of 

the absorption occurs in the D-layer due the variations 

of the electron density produced by external forcing. e 

riometers at EACF are elements of the South America 

Riometer Network (SARINET - an International Scienti c 

Cooperation between Japan, Brazil, Argentina and Chile) 

that is operating with an array of 11 riometers (1-channel 

and imaging) in operation in South America, four of them 

in Brazil. 

We also used one ionosonde that consists of one 

transmitter at frequencies between 1 and 20 MHz, and one 

receiver that detects the re ected signals. e echoes of the 

signal re ected by the F and E regions of the ionosphere 

provide a pro le of re ection frequency versus virtual 

height (ionogram), which gives the electron density (directly 

related to the re ection frequency) pro le as a function of 

actual height (Piggott & Rawer, 1972). e vertical sounding 

plays a crucial role in understanding the temporal and 

spatial evolution of the ionosphere, as well the study of the 

coupling between di erent atmospheric layers. At EACF, 

in March 2009, a Canadian Advanced Digital Ionosonde 

(CADI), (MacDougall, 1997) with dri ing measurements 

started to operate, which produces ionograms every 

5 minutes and dri measurements every 2.5 minutes. 


Results 

e in uence of the solar forcing in the ionosphere during 

the last long minimum of solar activity (2006-2008) was 

analyzed from the sudden phase anomalies (SPAs) of the 

VLF signal detected by the SAVNET network. SPAs are 

produced by the excess f the X-ray emission produced 

during solar ares. is study showed that 100% of the 

solar X-ray events with peak ux above 5 × 10 –7 W/m2 in 

the 0.1-0.8 nm wavelength range produce a signi cant SPA, 

but a weak X-ray event with ux of about 2.7 × 10 –7 W/m2 can be enough to a ect the lower ionosphere in 20% of the 

cases (Figure 1), (Raulin et al., 2010). 

e solar forcing in the ionosphere was also studied 

using preterit daytime VLF amplitude from 2003 to 2009. 

e study considered the VLF signal from NPM transmitter 

detected at EACF. is data analysis, which covered the decay 

of the 23rd solar cycle, showed an overall decrease of about 

–0.63 dB/year in the VLF amplitude in close association with 

the Lyman-alpha emission decrease (Figure 2a), similarly 

the behaviour found during the decay of the 22nd solar cycle 

( omson & Clilverd, 2000). is behaviour during the 

decay of solar activity is explained by the reduction of the 

ionizing solar Lyman-alpha radiation, which ionizes the 

nitric oxide (NO) molecules (Nicolet & Aikin, 1960). e 

daytime VLF amplitude also shows an annual variation, 

Figure 1. Solar fl are probability detection P, as a function of the soft X-ray 

peak fl ux Px for the long NPM - ATI VLF propagation path, and for solar 

zenith angle greater (dashed line) or lower (full line) than 40 degrees. 

Figure adapted from Raulin et al. (2010).

Figure 2. a) NPM Daytime VLF amplitude as received at EACF from 1/1/2003 to 31/12/2008 (NPM trace) compared with 27-day smoothed solar Lyman-alpha 

radiation (Ly-alpha irradiance trace) and the stratosphere temperature measured at southern midlatitudes (temperature trace). b) Wavelet analysis of daytime 

VLF amplitude for 2007. 

decreasing from April to October, which can be explained 

by the reduction of solar illumination during the wintertime 

in the southern hemisphere (Figure 2b). During wintertime 

of all the years, the VLF amplitude showed pronounced fast 

increases, which in 2007 had a well de ned 16-day period 

(Correia et al., 2011a, b) as obtained from a wavelet analysis. 

is periodicity is typical of planetary waves of neutral 

atmosphere origin as observed by Day & Mitchell (2010) 

during the same period, and is in agreement with previous 

works (e.g. Lastovicka, 2006). 

e impact of space weather in the ionosphere was also 

studied during the geomagnetic storm of 4 September 2008. 

During geomagnetic storms the magnetic eld lines of the 

Earth changes and allows an increase in energetic particles, 

which can increase the radiation belts population, and in 

turn, in special conditions can precipitate and a ect the 

ionosphere. e e ects of these precipitating particles in 

the ionosphere were studied using the imaging riometer 

operating at Southern Space Observatory in São Martinho/ 

RS. is riometer is an element of the SARINET network, 

which consists of 4 × 4 antenna dipoles at 38 MHz covering 

an area of 330 × 330 km at a height of 100 km, and is inside 

the South Atlantic Anomaly. e geomagnetic storm had 

an intensity of about –51 nT, which is considered to be 

moderate intensity, and was accompanied by increases in 

the Auroral Electrojet (AE) index of about 1500 nT (box 

in Figure 3a). The QDC was obtained considering the 

geomagnetically quiet days of September. Figure 3b shows 

the daily intensity of the cosmic noise (blue) from 3 to 8 for 

one central antenna of the array and the QDC curve (red) 

which shows an increase of absorption of cosmic noise 

during the geomagnetic storm. e preliminary results of 

the absorption imaging are in Figure 3c, which shows that 

the cosmic noise absorption started in the main phase of 

the geomagnetic storm, becomes stronger on 5th September, 

and suggests a northeastward dri during the recovery 

phase (Moro et al., 2010). is ionospheric absorption can 

be attributed to the precipitation of energetic electrons in 

the SAMA region during the geomagnetic storm, which is 

in agreement with past riometer observations (Abdu et al., 

1973), as well from observations using ionosonde (Batista 

& Abdu, 1977) and VLF technique (Abdu et al., 1981). 

ese recent studies con rmed that the ionosphere is 

controlled by the 11-year variation of the solar ionizing 

radiation, by the space weather impacts, as well as by the 

forcing from below of lower-lying atmospheric layers. 


23

Discussion and Conclusion 

e Sun is our main source of energy, and is responsible for 

life on Earth. But, it is also true that if the atmosphere did 

not exist, life conditions here would be very di erent. e 

atmosphere is responsible for ltering the solar radiation 

that is nocive to terrestrial and marine life, especially the 

X-rays and ultraviolet. e solar radiation changes following 


a b 

Figure 3. a) Geomagnetic indices for September 2008 (http://wdc.kugi.kyoto-u.ac.jp/wdc/Sec3.html). In the black box is shown the geomagnetic storm that 

disturbed the ionosphere as observed by imaging riometer at SSO/RS. b) Comparison of the daily intensity of the cosmic noise (blue) with the QDC curve 

(red) during the geomagnetic storm. c) Time series of the absorption images at every 2 hours for 3-7 September 2008. 

the 11-year solar cycle, so it is desirable to understand how 

our atmosphere responds to solar variations. 

e ionospheric studies done during the decay of the 

last solar cycle improved our understanding about the main 

drivers a ecting our atmosphere. ey con rmed that solar 

ionizing radiation is the main driver of the ionosphere 

changes on an 11-year scale. Variations in shorter time 

c

scales (minutes to hours) occur in close association with 

the solar ares, when the excess of X-ray emission strongly 

a ects the lower ionosphere. As the Sun becomes more 

active, the stronger are the solar ares and they can be 

accompanied by particle events, which increase the impacts 

in our atmosphere a ecting lower heights especially in the 

polar region. On the other hand, the wave activity of the 

troposphere and stratosphere can also propagate upward 

and a ect the ionosphere. 

ese results show there is a strong coupling between 

all atmospheric layers. So it is desirable to simultaneously 

monitor all the atmospheric layers to understand the 

energy exchange from the upper to the low atmosphere 

to characterize the in uence of Sun-Earth interaction in 

the actual climate changes, which a ect the terrestrial and 

marine environment. In the next few years, this monitoring 

References 

will be very important because the Sun has just started to 

become active a er a long minimum. e actual solar cycle 

is the 24th , which really started in January 2008, and some 

strong solar ares have been reported (SolarCycle24, 2010). 

Acknowledgements 

This work was partially sponsored by the Brazilian 

Antarctic Program (PROANTAR/MMA, CNPq process 

nº.: 52.0186/06-0), SECIRM, INPE and INCT-APA 

(Instituto Nacional de Ciência e Tecnologia Antártico de 

Pesquisas Ambientais, CNPq process nº 574018/2008-5 

and FAPERJ process n° E-16/170.023/2008). EC would 

like to thank CNPq (Procs: 300710/2006-2) for their partial 

support, and the technicians Armando Hadano and José 

Roberto Chagas from INPE, for the support in Antarctica. 

Abdu, M.A.; Ananthakrishnan, S.; Coutinho, E.F.; Krishnan, B.A. & Reis, S. (1973). Azimutal Drift and Precipitation of Electrons 

into the South Atlantic Geomagnetic Anomaly and SC Magnetic Storm. Journal of Geophysical Research, 78:5830-36. 

Abdu, M.A.; Batista, I.S.; Piazza, L.R. & Massambani, O. (1981). Magnetic storm associated enhanced particle precipitation 

in the South Atlantic anomaly: Evidence from VLF phase measurements. Journal of Geophysical Research, 86: 7533-42. 

Batista, I.S. & Abdu, M.A. (1977). Magnetic storm associated delayed sporadic E enhancements in the Brazilian geomagnetic 

anomaly. Journal of Geophysical Research, 82(29): 4777-83. 

Correia, E. (2011a). Study of Antarctic-South America connectivity from ionospheric radio soundings. Oecologia Australis, 

15: 10-17. 

Correia, E.; Kaufmann, P.; Raulin, J. P.; Bertoni, F. C.; Gavilán,H. R. (2011b). Analysis of daytime ionosphere behavior between 

2004 and 2008 in Antarctica. Journal of Atmospheric and Solar-Terrestrial Physics, 73: 2272-2278. 

Day, K.A. & Mitchell, N.J. (2010). The 16-day wave in the Arctic and Antarctic mesosphere and lower thermosphere. Atmospheric 

Chemistry and Physics, 10: 1461-72. 

IBGE – Instituto Brasileiro de Geografi a e Estatística (2010) - Available from: accessed in december, 2010. 

Lastovicka, J. (2006). Forcing of the ionosphere by waves from below. Journal of Atmospheric and Solar-Terrestrial Physics, 

68: 479-97. 

Lastovicka, J. (2009). Lower ionosphere response to external forcing: A brief review. Advances in Space Research, 43(1): 1-14. 

MacDougall, J.W. (1997). Canadian Advanced Digital Ionosonde Users Manual. University of Western Ontario, Scientifi c 

Instrumentation. Ltd. 90p. 

McRae, W.M. & Thomson, N.R. (2004). Solar fl are induced ionospheric D-region enhancements from VLF phase and amplitude 

observations. Journal of Atmospheric and Terrestrial Physics, 66: 77-87. 


25

Moro, J.; Correia, E.; Denardini, C.M.; Abdu, M.A.; Makita, K.; Schuch, N.J.; Resende, L.C.; Almeida, P.D. & Guizelli, L.M. 

(2010). The analysis of ionospheric absorption of galactic radio noise in three geomagnetic disturbed periods using 

imaging riometer. Eos Trans. AGU, 91(26), The Meeting of the Americas, Suppl., Abstract SA33A-08. 

Nicolet, M. & Aikin, A.C. (1960). The Formation of the D-Region of the Ionosphere. Journal of Geophysical Research, 65(5): 

1469-83. 

Piggott, W.R. & Rawer, K. (1972). U.R.S.I. Handbook of Ionogram Interpretation and Reduction,World Data Center A for 

Solar-Terrestrial Physics. NOAA, Boulder, CO. 90p. 

Raulin, J.-P.; Abe Pacini, A.; Kaufmann, P., Correia, E.; Aparecida, G. & Martinez, M. (2006). On the detectability of solar X-ray 

fl ares using very low frequency sudden phase anomalies. Journal of Atmospheric and Terrestrial Physics, 68: 1029-35. 

Raulin, J.-P.; David, P.; Hadano, R.; Saraiva, A.C.V.; Correia, E. & Kaufmann, P. (2009). The South America VLF NETwork 

(SAVNET). Earth, Moon and Planets, 104: 247-61. 

Raulin, J-P.; Bertoni, F.C.P.; Gavilán, H.R.; Guevara-Day, W.; Rodriguez, R.; Fernandez, G.; Correia, E.; Kaufmann, K.; Pacini, 

A.; Stekel, T.R.C.; Lima, W.L.C.; Schuch, N.J.; Fagundes, P.R. & Hadano, R. (2010). Solar fl are detection sensitivity using 

the South America VLF Network (SAVNET). Journal of Geophysical Research, 115: A07301, doi:10.1029/2009JA015154 

Scherrer, D.; Cohen, M.; Hoeksema, T.; Inan, U.; Mitchell, R. & Scherrer, P. (2008). Advances in Space Research, 42: 1777-85. 

SolarCycle24 (2010) – Available from: , accessed in december, 2010. 

Thomson, N.R. & Clilverd, M.A. (2000). Solar cycle changes in daytime VLF subionospheric attenuation. Journal of Atmospheric 

and Solar-Terrestrial Physics, 62: 601-8. 


STUDIES OF GRAVITY WAVES AT FERRAZ STATION (62° S) 

AND RECENT OBSERVATIONS 

José Valentin Bageston 1,* , Paulo Prado Batista 1 , Cristiano Max Wrasse 2 , Delano Gobbi 1 , 

Neusa M. Paes Leme 1 , Robert Hibbins 3,4 , David Fritts 5 

1 Instituto Nacional de Pesquisas Espaciais, São José dos Campos, SP, Brazil 

2 Vale Soluções em Energia, São José dos Campos, SP, Brazil 

3 British Antarctic Survey, Cambridge, United Kingdom 

4 Norwegian University of Science and Technology, Trondheim, Norway 

5 Colorado Research Associates, Boulder, United States of America 

*e-mail: bageston@gmail.com 

Abstract: In this study we will present a brief review of mesospheric gravity waves that have been observed at Comandante 

Ferraz Antarctica Station, EACF (62.1° S and 58.4° W). First, we will show the main results of a campaign conducted from April 

to October of 2007, with more than 230 events. e main characteristics of the gravity waves are presented as follows: horizontal 

wavelengths between 10 and 65 km; periods between 5 and 35 minutes, and phase speed ranging from 5 to 120 m/s. Later, we 

will show the recent advances related to the observations of temperature, winds and gravity waves in the Mesosphere and Lower 

ermosphere (MLT) over Ferraz station. In this sense, examples of temperature and wind data will be presented. Finally, we will 

show the partial conclusions and future prospects. 

Keywords: airglow, gravity waves, temperature, winds 

Introduction 

The middle atmosphere is a region rich in chemical 

interactions and with a large variability in terms of 

dynamics. A wide variety of structures are found in this 

region, amongst which can be pointed out the airglow 

layers, metals layers and, at high latitudes a special type of 

phenomena known as noctilucent clouds. Recent studies 

suggest that the increase in the concentration of CO and 

CH during this century can result in signi cant changes in 

temperature, density and composition of the atmosphere. 

us, the middle atmosphere has received considerable 

attention mainly due to the circulation system and global 

climate change (Gardner, 1995). Considerable progress has 

been made in the last decades in the study and understanding 

of the phenomenon of gravity waves in the middle 

atmosphere (Fritts & Alexander, 2003). Gravity waves are 

found primarily in the lower atmosphere, and can propagate 

through the atmosphere until they reach the region of 

the mesosphere and lower thermosphere (70-100 km 

height). ese waves occur as a result of a displacement 

of air masses, caused by cold fronts, winds blowing over 

mountains or by jet streams in the stratosphere. Gravity 

waves are well known and studied in the meteorology eld. 

However, this phenomenon has received great attention 

due to its important role in the transporting of energy 

and momentum from the lower to the upper atmosphere, 

varying the thermal structure and general circulation in 

the middle and upper atmosphere (Takahashi et al., 1999). 

Among the several techniques available for the observation 

of gravity waves in the middle atmosphere, we can mention 

meteoric and medium frequency radars, laser techniques, 


2 

27

in-situ observations by rockets, optical measurements from 

the ground and from satellites. However, each technique 

has its own limitation related to the observation of gravity 

waves and only a fraction of the spectrum of these waves can 

be solved within a wide spectrum of frequencies and wave 

number (Nakamura et al., 1999). us, the combination of 

observational methods is very important in order to study 

the characteristics of gravity waves (Taylor & Gardner, 

1998). is paper presents results from a campaign of 

atmospheric gravity waves conducted in 2007 at Ferraz 

station (62.1° S, 58.4° W). We will also show and discuss 

brie y some examples of temperature and winds observed 

at Comandante Ferraz station. 

Data and Methodology 

e main data used in this study was from the airglow 

images, from which it was possible to identify the gravity 

wave activity in the atmosphere at the altitudes where the 

airglow emissions occur. In this study, the observed airglow 

emission is the hydroxyl in the near infrared spectrum 

(OH NIR, 715-930 nm), with emission peak around 87 km 

high. Recently, a meteor radar that operates at a frequency 

of 36.90 MHz was installed at Comandante Ferraz station 

with the aim of observing and studying the wind eld over 

the King George Island in the MLT altitude range. e 

installation and operation of this radar is a collaborative 

e ort between National Institute for Space Research (INPE), 

Brazil, and Colorado Research Associates (CoRA), United 

States of America. Simultaneous observations of wind 

and gravity waves will be valuable to better understand 

the dynamics of the MLT region on King George Island, 

and consequently in the Antarctic Peninsula region. 

Furthermore, the temperature structure in the Mesopause 

region (~87 km high) has been monitored at Comandante 

Ferraz station since 2002. Since 2005 an airglow CCD camera 

that observes the OH(6-2) emission through an annular eld 

of view of 22.6° centred at the zenith has been in use. 


e methodology used to extract the wave parameters 

was based on analysis of the airglow all-sky images. is 

analysis uses the well established Fast Fourier Transform 

(FFT) technique, but prior to the application of this analysis 

it was necessary to see the images in an animation (“.avi” 

le format) to identify the gravity waves occurrence, and 

subsequently select a time interval and a spatial region on 

the images where each wave was identi ed. Furthermore, 

a er this pre-visualization, it was necessary to apply a 

pre-processing of the images before the application of the 

FFT. e pre-processing basically consists of a rotation in the 

images in order to align the top to the geographic north, and 

then mapping the image at the height of the airglow emitting 

layer to correct the e ects of distortion in the images due 

to the optical system e ects. is process is known as 

linearization, and the corrected images are called unwarp 

images. e next step is the removal of the stars, followed by 

a ltering in the images, and nally the FFT analysis can be 

applied to a chosen region on the image, portion on which 

a gravity wave event is occurring (identi ed previously in 

the “.avi” animation). e details of this methodology can 

be found in the thesis work of Bageston (2010) and in the 

pertinent references. 

Results and Discussion 

The main results already obtained are related to the 

characterization of gravity waves for those observed in 

2007. We will also show some recent observations of winds 

and gravity waves. e waves characteristics observed at 

Comandante Ferraz during 2007 were obtained from the 

analysis of the images observed trough the NIR OH airglow 

emission, including a total of 234 wave events. Figure 1 

shows the observed parameters, that is, the horizontal 

wavelength, period and phase speed for these waves. e 

intrinsic parameters were also inferred and showed a 

similar behaviour to the observed characteristics, but with 

a maximum occurrence slightly shi ed due to the wind 

e ect (Doppler shi ). 

The horizontal wavelengths were distributed from 

10 to 65 km, with a maximum occurrence between 

20 and 40 km. e observed periods were mainly distributed 

between 5 and 35 minutes, but the maximum concentration 

was between 5 and 15 minutes. e observed phase speed 

has a distribution that extends from 5 to 120 m/s. e 

majority of the waves had velocities between 10 and 70 m/s.

e results presented in Figure 1 are very similar to 

the observations reported in the literature, especially 

considering the results of observations conducted at other 

Antarctica stations: Halley (76° S and 27° W) (2000-2001) 

and Rothera (68° S and 68° W) (2002-2003) (Nielsen, 

2007; Nielsen et al., 2009). e horizontal propagation 

directions showed an anisotropic behaviour during the 

winter (Bageston et al., 2009), with similarities to the 

observations conducted at Rothera and Halley, i.e., with 

preferential propagation direction to southwest and south 

(Nielsen, 2007). 

Temperature in the MLT region has been monitored 

at Comandante Ferraz since 2002, and from 2005 with a 

airglow camera, in order to study e ects of gravity waves in 

this parameter and also to investigate, in the future, the long 

term variability in the Mesopause region. Figures 2 (a) and 

(b) shows one example of temperature and airglow intensity, 

respectively, during one entire night during 2007. e small 

scale variability in the temperature and OH intensity during 

a b 

Figure 1. Histogram plots of the gravity wave characteristics observed at Comandante Ferraz station in 2007. The panels show, from top to bottom, the 

horizontal wavelength, observed period and horizontal phase speed. 

c 

the night could be related to small scale gravity waves. e 

large and abrupt decrease in the OH(6-2) intensity and 

temperature, denoted by the arrows, were related to the 

passage of a mesospheric wall (extensive gravity wave event) 

above Ferraz (Bageston et al., 2011). 

Recently, gravity wave and wind observations at 

Comandante Ferraz station are registering good quality 

recordings, and this data will be used soon for a detailed 

investigation of the dynamics of the MLT region over 

Comandante Ferraz. However, this data, including 

temperature data, are still in Antarctica, and will be 

sent to Brazil by the end of this year. Fortunately, some 

examples of winds data were obtained remotely from 

Comandante Ferraz. Figure 3 shows one example of winds 

observed during two days, 12-13 September 2010. e 

main characteristic observed from Figure 3 is the well 

de ned semi-diurnal tide, that is, oscillations in the zonal 

and meridional wind components over a period of about 

12 hours. In addition, it is possible to identify that the winds 


29

Figure 2. Temperature and OH(6-2) airglow intensity observed at Comandante Ferraz by an imaging spectrometer on 16-17July 2007. 

in the upper altitudes (94 km) are more intense than at lower 

altitudes (85 km). 

Gravity wave activity observed last year, by analysing 

some observed nights, seems to be similar to the activity 

observed in 2007, but with less useful data in 2010 in 

comparison to the observations carried out in 2007. 

Conclusions and Future Prospects 

In summary, the present study has shown the main 

characteristics of the gravity waves observed at Comandante 

Ferraz station in 2007, which were consistent with 

previous observations in Antarctica, in particular to 

the wave parameters obtained from the observations at 

Rothera. Currently, three instruments are in operation 

at Comandante Ferraz with the objective of studying the 


dynamics and the thermal structure of the mesosphere and 

lower thermosphere over the King George Island. e most 

recent instrument installed at Comandante Ferraz, at the 

beginning of last year, was the meteor radar that is currently 

in operation through a collaborative e ort between the 

Colorado Research Associates (CoRA), from United States, 

and National Institute for Space Research (INPE), from 

Brazil. e primary objective of this radar is to observe the 

wind structure between 80 and 100 km altitude. Besides the 

radar, other two airglow cameras (which belong to INPE) 

are in operation with the aim of monitoring the gravity 

wave activity in the mesosphere, and then characterize these 

waves, and observe the mesopause temperature structure. By 

using temperature observations it is possible to monitor the 

long term variability of the thermal structure, and conduct 

a 

b

Figure 3. Examples of winds observed on 12-13 September 2010 by the meteor radar installed at Comandante Ferraz station in March 2010. 

studies to identify signature of waves of di erent scales in 

the temperature and in its day-to-day variability. Future 

investigation will include the use of local winds, as observed 

by the meteor radar, to study the wave ltering process due 

to the background winds. Moreover, these winds also will 

be useful in investigations of the gravity wave sources with 

the reverse ray tracing modelling. 


J. V. Bageston thanks to FAPESP for the post-doctorate 

fellowship under the process nº 2010/06608-2. is work 

was partially sponsored by the Brazilian Antarctic Program 

(PROANTAR/MMA, CNPq process nº: 52.0186/06-0), and 

INCT-APA (CNPq process n° 574018/2008-5 and FAPERJ 

process n° E-16/170.023/2008). 


31

References 

Bageston, J.V. (2010). Caracterização de ondas de gravidade mesosféricas na Estação Antártica Comandante Ferraz. Tese 

em Geofísica Espacial, Instituto Nacional de Pesquisas Espaciais. Available from: 

Bageston, J.V.; Wrasse, C.M.; Gobbi, D.; Tahakashi, H. & Souza, P. (2009). Observation of mesospheric gravity waves at 

Comandante Ferraz Antarctica Station (62°S). Annales Geophysicae, 27(s/n): 2593-8. 

Bageston, J.V.; Wrasse, C.M.; Hibbins R.E.; Batista, P.P.; Gobbi, D.; Tahakashi, H. Fritts, D.C.; Andrioli, V.F.; Fechine, J.; 

& Denardini, C.M. (2011). Case study of a mesospheric wall event over Ferraz Station, Antarctica (62° S). Annales 

Geophysicae, 29(s/n): 209-19. 

Fritts, D. C. & Alexander, M.J. (2003). Gravity wave dynamics and effects in the middle atmosphere. Reviews of Geophysics, 

41(1): 1-46. 

Gardner, C. S. (1995). Introduction to aloha/anlc-93 - the 1993 airborne lidar and observations of the Hawaiian airglow airborne 

noctilucent cloud campaigns. Geophysical Research Letters, 22(20): 2789-92. 

Nakamura, T.; Higashikawa, A.; Tsuda, T. & Matsushita, Y. (1999). Seasonal variations of gravity wave structures in oh airglow 

with a CCD imager at Shigaraki. Earth Planets Space, 51(7-8): 897-906. 

Nielsen, K. (2007). Climatology and case studies of mesospheric gravity waves observed at polar latitudes. PhD Thesis, 

Utah State University. 

Nielsen, K.; Taylor, M.; Hibbins, R. & Jarvis, M. (2009). Climatology of short-period mesospheric gravity waves over Halley, 

Antarctica (76°S, 27°W). Journal of Atmospheric and Solar-Terrestrial Physics, 71(s/n): 991-1000. 

Takahashi, H., Batista, P.P.; Buriti, R.A.; Gobbi, D.; Tsuda, N.T. & Fukao, S. (1999). Response of the airglow OH emission, 

temperature and mesopause wind to the atmospheric wave propagation over Singaraki, Japan. Earth Planets and Space, 

51(7-8): 863-75. 

Taylor, M. & Gardner, C.S. (1998). Observational limits for lidar, radar, and airglow imager measurements of gravity wave 

parameters. Journal of Geophysical Research, 103 (D6):6427-37. 


INFLUENCE OF THE ANTARCTIC OZONE HOLE OVER THE 

SOUTH OF BRAZIL IN 2008 AND 2009 

Damaris Kirsch Pinheiro 1,* , Neusa Paes Leme 2 , Lucas Vaz Peres 1 , Elenice Kall 1 

1 Laboratório de Ciências Espaciais de Santa Maria – LACESM, Departamento de Engenharia Química, 

Universidade Federal de Santa Maria – UFSM, Camobi, Santa Maria, RS, Brazil 

2 Centro Regional do Nordeste, Instituto Nacional de Pesquisas Espaciais – CRN/INPE, Natal, RN, Brazil 

*e-mail: damaris@ufsm.br 

Abstract: e Antarctic Ozone Hole is a cyclical phenomenon which occurs over the Antarctic region from August to November 

each year. e polar vortex turns it into a restricted characteristic dynamics for this region. However, when the polar vortex 

begins to weaken in October, air masses with low ozone concentration could escape and reach regions of lower latitudes. is 

study presents the in uence of the Antarctic Ozone Hole over the South of Brazil in the years 2008 and 2009. To verify the events 

of in uence, data of ozone total column from Brewer Spectrophotometer installed at the Southern Space Observatory (29.42° S, 

53.87° W), in São Martinho da Serra, South of Brazil was used, and OMI Spectrometer overpass data for the same location. In 

addition to Brewer and OMI data, potential vorticity maps using GrADS (Grid Analysis and Display System) generated with 

the NCEP data reprocessed, and backward trajectories of air masses, using the HYSPLIT model of NOAA, were analysed. Ozone 

total column for the days with lower ozone were compared with the climatological average of twenty years for September and 

October. For statistical reasons, only the days with ozone total column lower than climatological monthly average minus 1.5 times 

the standard deviation, were analysed. Considering only the days with less ozone, increased absolute potential vorticity and 

backward trajectories indicating the origin of polar air masses, 3 events in 2008 and 2 events in 2009, with an average decreased 

about 9.7 ± 3.3% when compared with climatological means, were observed. 

Keywords: mid-latitude, potential vorticity, backward trajectories, Antarctic ozone hole 

Introduction 

In the Antarctic continent, a signi cant decrease in total 

ozone content has been detected from August to November 

each year. is decrease is known as the Antarctic ozone 

hole (Farman et al., 1985; Solomon, 1999). e atmosphere 

in the southern hemisphere at high latitudes has undergone 

marked changes over the past recent decades. According 

to Hansen (2010), a record of the Antarctic Ozone Hole 

area occurred during the spring of 2006, reaching a size of 

10.6 million square miles. Because of the polar vortex, this 

is restricted to the region. However, when the polar vortex 

begins to weaken in late September and October, ozonepoor 

air masses can escape and reach regions of lower 

latitudes (Prather & Ja e, 1990; Semane et al., 2006). ese 

events of the Antarctic Ozone Hole which have an in uence 

on the South of Brazil were rst observed by Kirchho et al. 

(1996). e study developed here presents the events for the 

years of 2008 and 2009. 

Methodology 

To verify Antarctic ozone hole influence over South 

of Brazil, ozone total column data from Brewer MKIII 

Spectrophotometer #167 installed at the Southern 

Space Observatory - OES/CRS/CIE/INPE - MCT 

(29.42° S and 53.87° W), in São Martinho da Serra, Brazil 


3 

33


a 

Figure 1. Event of 26 October 2008. a) Maps showing of the increase of the absolute potential vorticity at the level of 620 K from 24 to 26 October, 

b) backward trajectory generated with the HYSPLIT model showing the polar origin of the air mass over Southern Space Observatory and c) image generated 

using data from OMI spectrophotometer. 

and OMI Spectrometer overpass data for the same location, 

were used. To verify the Antarctic influence, potential 

vorticity (PV) maps on isentropic surfaces generated using 

GrADS, with NCEP reanalysis data, were used. Danielsen 

(1968) found a good correlation between ozone mixing 

ratio and potential vorticity (PV) and demonstrated that 

PV can be used as a tracer of stratospheric ozone. Similar 

methodology using ozone and PV correlation was used 

by Semane et al. (2006) and Narayana Rao et al. (2003), 

over the Southern Hemisphere and Northern Hemisphere, 

respectively. In this study, analysis of atmospheric backward 

trajectories of air masses, using the HYSPLIT model (Hybrid 

c 

b

Figure 2. Event of 05 September 2009. a) Maps showing of the increase of the absolute potential vorticity at the level of 620 K from 04 to 05 September, 

b) backward trajectory generated with the HYSPLIT model showing the polar origin of the air mass over Southern Space Observatory and c) image generated 

using data from OMI spectrophotometer. 

Single-Particle Lagrangian Integrated Trajectory) developed 

by NOAA and Australia’s Bureau of Meteorology, was also 

used. Ozone total column for the days with lower ozone was 

compared with the climatological average of twenty years for 

September and October. For statistical reasons, only the days 

with ozone total column lower than climatological average 

minus 1.5 times the standard deviation for the years 2008 

and 2009, were analysed. 


a 

c 

35

Table 1. Events of the Antarctic ozone hole infl uence over Southern Space Observatory with corresponding reduction of ozone. 

Results 

Climatological averages of ozone total column measured by 

Brewer Spectrophotometer at Southern Space Observatory 

from 1992 to 2009 were 295,6 ± 10,2 DU for September 

and 291,5 ± 8,9 DU for October. e days of 2008 and 2009 

with ozone total column lower than these climatological 

averages minus 1.5 times the standard deviation was 

analyzed according to the methodology described above. 

e examples of 26 October 2008 and 05 September 2009 

are shown in Figure 1 and Figure 2, respectively, where an 

increase of absolute potential vorticity at the level of 620 K 

(a), the backward trajectories of air masses poor of ozone 

(b) and OMI data (c) are represented showing the in uence 

of Antarctic Ozone Hole over South of Brazil. Considering 

only the days with decreased ozone measured at Southern 

Space Observatory, increased absolute potential vorticity 

shown at GRADS maps and HYSPLIT backward trajectories 

indicating the origin of polar air masses, it was observed 

3 events in 2008 and 2 events in 2009 presented at Table 1, 

References 


Events days Ozone (DU) Reduction (%) 

28/09/2008 275.2 6.9 

12/10/2008 267.8 8.1 

26/10/2008 266.5 8.5 

05/09/2009 261.2 11.6 

06/09/2009 249.9 15.5 

01/10/2009 270.2 7.3 

Average 265.1 ± 8.8 9.7 ± 3.3 

with an average decreased about 9.7 ± 3.3% when compared 

with climatological means. 

Conclusion 

e analysis of all days with decrease of ozone total column at 

Southern Space Observatory showed the in uence of Antarctic 

Ozone Hole over South of Brazil. 3 events in 2008 and 2 events 

in 2009, with an average decreased about 9.7 ± 3.3% when 

compared with climatological means, were observed. 


e authors would like to express their thanks to ATMANTAR 

Project for International Polar Year, process n° 52.0182/2006- 

5, PROANTAR/MCT/CNPq, Instituto Nacional de Ciência e 

Tecnologia Antártico de Pesquisas Ambientais, CNPq process 

n° 574018/2008-5 and FAPERJ process n° E-16/170.023/2008. 

Acknowledgements also to PIBIC/UFSM-CNPq/MCT and 

PIBIC/INPE-CNPq/MCT for fellowships and NASA/TOMS 

and NCEP/NCAR for use of the data. 

Danielsen, E.F. (1968). Estratospheric-tropospheric exchange based on radioactivity, ozone and potential vorticity. Journal 

of Atmospheric Science, 25: 502-18. 

Farman, J.C.; Gardiner, B.G. & Shanklin, J.D. (1985). Large losses of total ozone in Antarctica reveal seasonal ClOx/NOx 

interaction. Nature, 315: 207-210. 

Hansen, K. (2010). 2008 Ozone Hole Maximum Announced. (Accessed: 05 sep. 2010).

Kirchhoff, V.W.J.H.; Schuch, N.J.; Pinheiro, D.K.; Harris, J.M. (1996). Evidence for an ozone hole perturbation at 30º south. 

Atmospheric Environment, 33(9):1481-8. 

Narayana Rao, T.; Kirkwood, S.; Arvelius, J.; von der Gathen, P. & Kivi, R. (2003). Climatology of UTLS ozone and the 

ratio of ozone and potential vorticity over northern Europe. Journal of Geophysical Research, 108(D22): 4703, 

doi:10.1029/2003JD003860. 

Prather, M. & Jaffe, H. (1990). Global impact of the Antarctic ozone hole: chemical propagation. Journal of Geophysical 

Research, 95: 3413-92. 

Semane, N.; Bencherif, H.; Morel, B.; Hauchecorne, A. & Diab, R.D. (2006). An unusual stratospheric ozone decrease in 

Southern Hemisphere subtropics linked to isentropic air-mass transport as observed over Irene (25.5º S, 28.1º E) in 

mid-May 2002. Atmospheric Chemistry and Physics, 6: 1927-36. 

Solomon, S. (1999). Stratospheric ozone depletion: a review of concepts and history. Reviews of Geophysics, 37(3): 275-316. 


37

4 ATMOSPHERIC 

SO2 MEASUREMENTS AT THE BRAZILIAN 

ANTARCTIC STATION 


Ericka Voss Chagas Mariano 1,* , Neusa Maria Paes Leme 2 , Plinio Carlos Alvalá 3 

1 Programa de Pós-Graduação em Geofísica Espacial, 

Instituto Nacional de Pesquisas Espaciais – INPE, São José dos Campos, SP, Brazil 

2 Centro Regional do Nordeste, Instituto Nacional de Pesquisas Espaciais – CRN/INPE, Natal, RN, Brazil 

3 Centro de Ciência do Sistema Terrestre – CCST, Instituto Nacional de Pesquisas Espaciais – INPE, São José dos Campos, SP, Brazil 

*e-mail: erickavoss@gmail.com 

Abstract: For a better comprehension of the atmospheric chemical and radiative properties, it is necessary to understand the 

behaviour of trace gases and aerosols; some of these gas types have not been deeply studied. Sulphur dioxide (SO ) is found in 

2 

the troposphere, as a result of both natural and anthropogenic emissions. To study the behaviour of this gas in the Antarctic 

continent, the data collected by the Brewer Spectrophotometer installed in the Brazilian Antarctic Station Comandante Ferraz 

(62° 05’ S and 58° 24’ W) was used. With this ground-based instrument, the total column of SO was measured from the 

2 

beginning of springtime, to the start of summer, during the years 2003 to 2009. It was possible to observe that the total columns 

of SO did not show any di erences in the time of the development of the ozone hole, as compared to other periods. e main 

2 

sources of anthropogenic SO pollution in this region are the generation of energy, the operations with ships, and the burning 

2 

of garbage, being a punctual impact. e natural generation of SO in this region is mainly related to the conversion of DMS 

2 

(dimethyl sul de) emitted by the ocean. In a few days, the SO total column exceeded the values considered normal for remote 

2 

regions (>2 UD), and these high concentrations must have their sources identi ed and monitored. 

Keywords: atmospheric chemistry, sulfur dioxide, Brewer Spectrophotometer 

Introduction 

Antarctica is the coldest, windiest, and driest continent on 

Earth, with a remote location far from the major centres 

of population. Yet as one of the two heat sinks in the 

global climate system it plays a crucial role in the general 

circulation of the atmosphere and has a profound e ect on 

the atmospheric and oceanic conditions across the Southern 

Hemisphere (Turner, 2003). 

The study of the changes in the atmospheric SO2 concentration is important because this gas has e ects 

in the atmospheric chemistry and in the radiation eld, 

with climatic consequences. In this case, the climate and 

atmosphere research requires continuous SO observations 

2 

(Fioletov et al., 1998). SO is emitted in the atmosphere as 

2 

a result of natural phenomena as well as anthropogenic 

activities, such as fossil fuel combustion, volcanic eruptions, 

biomass burning and the oxidation of organic materials 

in soil and of dimethyl sul de (DMS) over oceans. e 

sulfur dioxide (SO ) found in the Antarctic region is 

2 

mostly originated from DMS. SO also plays an important 

2 

role in cloud formation physics, leading to clouds of high 

re ectivity. In the stratosphere SO is also oxidized and 

2 

combines with water to form sulfate aerosols (Bekki, 1995). 

ese aerosols scatter solar radiation and absorb long-wave 

radiation, causing heating in the stratospheric region and 

net cooling at the Earth’s surface (Georgoulias et al., 2009).

In regions where the air pollution is small, the SO 2 

concentration is lower than 2 DU, whereas in polluted 

regions this value reaches 4 to 6 DU (Fioletov et al., 1998), 

and in extreme cases reaching 20 DU or higher, as in the 

case of volcanic eruption events (De Muer & De Backer, 

1992). Cappellani and Bieli (1994) state that SO 2 in the air 

vertical column is concentrated in the low troposphere, 

mainly trapped in the mixture layer. De Muer & De Backer 

(1992) say that, occasionally, higher amounts of SO 2 in 

the stratosphere, resulting from volcanic eruptions, may 

be observed. However, the conclusions presented by these 

authors work show that, in general, almost every SO 2 in the 

vertical is found in the lower troposphere. 

Several methods have been developed for measuring 

not only near surface concentrations but also the total 

atmospheric content using ground-based instruments 

(Georgoulias et al., 2009). e Brewer spectrophotometer 

was developed at the beginning of the 1980s to precisely 

measure ozone (O 3 ) (Kerr et al., 1981), and also measures 

sulphur dioxide (SO 2 ), nitrogen dioxide (NO 2 ) and spectral 

irradiance in the ultraviolet band. is instrument is widely 

used by the Global Atmosphere Watch (GAW) program of 

the World Meteorological Organization (WMO) to measure 

the O 3 columns. Today, there are more than 180 instruments 

installed around the globe (Fioletov et al., 2005). 

Materials and Methods 

Brewer spectrophotometer 

The Brewer spectrophotometer is a ground based 

instrument which makes measurements of solar radiation, 

allowing the measurement of the total column of the 

following atmospheric gases: ozone (O 3 ), sulphur dioxide 

(SO 2 ) and nitrogen dioxide (NO 2 ). It can also measure the 

solar global radiation in the band ultraviolet B (UVB). is 

instrument uses the Dobson unit (DU) to express the total 

columns of O 3 , NO 2 and SO 2 . 

e Brewer spectrophotometer is totally automated and 

made up of three parts: tripod, tracker (a system that traces 

the sun) and the spectrophotometer itself. e instrument 

contains a microprocessor, responsible for the equipment’s 

internal operations. is microprocessor is connected to a 

computer that, through the Brewer so ware, controls the 

functioning of the instrument, and the data reduction and 

storage. e ve wavelengths of operation are located in the 

ultraviolet band of the O and SO absorption spectrum, 

3 2 

which have a strong and variable absorption in this region: 

306.3; 310; 313.5; 316.8; 320 nm. 

e measurement of the total column of an atmospheric 

gas made by a ground based instrument is based on the 

principle of absorption of radiation that penetrates a 

quantity of matter. Surface based methods use radiance 

measurements of an external source, such as the Sun or 

the moon, a er the radiation had been extinguished, as a 

result of atmospheric absorption, molecular scattering and 

aerosol (particle) scattering, all of them dependant on the 

wavelength (Whitten & Prasad, 1985). 

Data collection and treatment 

The Ozone Laboratory, that belongs to the National 

Institute for Space Research, has a network of Brewer 

Spectrophotometers in South America. e data presented 

here was obtained in the Brazilian Antarctic Station 

Comandante Ferraz, from 2003 to 2009 through the Direct 

Sun method, using the direct solar beam as a radiation 

source. e data collected by the Brewer required reducing 

in order to be evaluated. This process is undertaken 

by an analysis program developed specially for the 

instrument - the Brewer Spectrophotometer B Data Files 

Analysis Program. is program reads the Brewer les 

according to the calibration data of each instrument. Since 

each instrument has a distinct calibration, this stage of 

the data treatment takes longer to be completed. For the 

analysis of the data collected for this research, techniques 

of Descriptive Statistics were used. 


It is possible to notice a great variability in the data 

(Figure 1), including negative results, which are due 

to the Brewer SO algorithm and must be considered 

2 

corresponding to very low total columns. When the total 

column increases, on isolated days, it is not likely that this is 


39

Figure 1. Daily average of the SO 2 total column for the Brazilian Antarctic 

Station from August to December, from 2003 to 2009. 

Table 1. Annual average of the SO 2 total columns for the Brazilian 

Antarctic station. 

associated with an increase of SO 2 in the stratosphere, unless 

when this is related to volcanic eruptions, which is not the 

case in this study. In the Antarctic region, the main natural 

contribution to the maintenance of the SO column (even 

2 

in low concentrations) is the conversion of organic material 

from the soils, and the oxidation of DMS over the ocean. 

It was possible to observe an increase in the average 

total SO column over the years for each annual period 

2 

evaluated (Table 1). From 2006, the average turned positive. 

is coincides with the beginning of the construction of the 

expansion of the station, which may indicate an increase 

in the emission of pollutants. As the Antarctic region is a 

remote location, total columns above 2 DU can already be 


Year Average 

2003 –0,9 

2004 –1,7 

2005 –0,9 

2006 0,9 

2007 2,5 

2008 1,6 

2009 3,0 

Figure 2. Number of days with SO 2 total column higher than 2 Dobson 

Units DU for the period studied. 

Figure 3. Correlation between the SO 2 total column and Wind speed for 

the studied period. 

Figure 4. Correlation between the SO 2 total column and solar radiation 

for the studied period.

Figure 5. Correlation between the SO 2 total column and the O 3 total 

column for the studied period. 

Figure 6. Predominant Wind direction for the days with SO 2 higher than 

2 Dobson Units. 

Figure 7. Map of the King George Island, showing the main stations. Adapted from http://hs.pangaea.de/Images/Maps/King_George_Island/King_George_ 

Island_Map.pdf. 


41

considered relatively high, taking into account the level of 

local natural pollution. e maximum value of 9.9 DU was 

observed in 2007, a rate comparable with that seen in cities 

like Cubatão, known for its high levels of pollution. 

It is possible to see in Figure 2 the increase in the 

number of days with total column higher than 2 DU from 

the year 2006. In all years, 145 days were observed with 

total column above this value, and in 2006 the number of 

days was more than three times higher than the previous 

year. In Antarctica, the most signi cant anthropogenic 

contributions are related to power generation, operations 

with ships, and waste burning, being a punctual impact. 

When analyzing the graph with the number of days with 

SO higher than 2 DU (Figure 2), it is possible to see that 

2 

from 2006 this number increased dramatically, possibly due 

to the expansion of the Antarctic Brazilian station. 

With respect to wind speed (Figure 3), a correlation of 

0.08 between the observed data was found, i.e., no signi cant 

correlation. e same was seen for solar radiation (Figure 4), 

with a correlation coe cient of –0.10, indicating a weak 

correlation. Also, for O , no signi cant correlation was 

3 

found (Figure 5). 

Evaluating the wind direction when the total column 

exceeds 2 DU (Figure 6), it is possible to note that the 

preferred directions of wind are west, north and east, in 

that order. Looking at the map with the positioning of 

the weather station and the Brewer spectrophotometer 

with respect to the Comandante Ferraz Antarctic Station 

(Figure 7), it is possible to see that the increase in the 

total column of SO occurs when the wind blows from the 

2 

Keller Peninsula, the Brazilian station, and the Martel inlet, 

References 


respectively. e energy generator is adjacent to the station, 

and the contribution coming from the Martel inlet may be 

related to operations with ships. 

Few studies on the SO total column were carried out in 

2 

Antarctica. Chakrabarty and Peshin (2007) found a pattern 

in the total column of SO di erent from that found in 

2 

this study. In the case of the Brazilian station Comandante 

Ferraz, the data appears more scattered, while at Maitri 

(70.7° S and 11.7° E) the distribution is approximately 

normal. ey also found a correlation with UV-B radiation, 

which was not shown by this study. 

Conclusions 

SO total columns present a somewhat scattered behaviour, 

2 

which indicates the source as being anthropogenic activities. 

No correlation was found between SO total column with 

2 

solar radiation, wind speed and O total column. Wind 

3 

direction indicates contribution from the Martel Inlet and 

the Brazilian Antarctic station. is work is a previous 

treatment as part of an e ort to establish a methodology for 

the use of SO data from the Brewer Spectrophotometer . 

2 

Acknowledgments 

This work was partially sponsored by the Brazilian 

Antarctic Program (PROANTAR/MCT/CNPq process 

nº.: 52.0182/2006-5), SECIRM, INPE and INCT-APA 

(Instituto Nacional de Ciência e Tecnologia Antártico de 

Pesquisas Ambientais, CNPq process nº 574018/2008-5 and 

FAPERJ process n° E-16/170.023/2008 and the technicians 

Armando Hadano and José Roberto Chagas from INPE, for 

the support in Antarctica. 

Bekki, S. (1995). Oxidation of volcanic SO 2 : a sink for stratospheric OH and H 2 O. Geophysical Research Letters, 22(8): 913-6. 

Cappellani, E. & Bielli, A. (1994). Correlation between SO 2 and NO 2 measured in an atmospheric column by a Brewer 

spectrophotometer and at ground-level by photochemical techniques. Environmental Monitoring and Assessment, 

35(2): 77-84. 

Chakrabarty, D.K. & Peshin, S.K. (2007). Effect of stratospheric O 3 depletion on tropospheric SO 2 column in Antarctica. 

Journal of Atmospheric and Solar-Terrestrial Physics, 69(12): 1377-87. 

De Muer, D. & De Backer, H. (1992). Revision of 20 years of Dobson total ozone data at Uccle (Belgium) - Fictitious Dobson 

total ozone trends induced by sulfur dioxide trends. Journal of Geophysical Research, 97(D5): 5921-37.

Fioletov, V.E.; Griffi oen, E.; Kerr, J.B. & Wardle, D.I. (1998). Infl uence of volcanic sulfur dioxide on spectral UV irradiance as 

measured by Brewer spectrophotometers. Geophysical Research Letters, 25(10): 1665-8. 

Fioletov, V.E.; Kerr, J.B.; McElroy, C.T.; Wardle, D.I.; Savastiouk, V. & Grajnar, T.S. (2005). The Brewer Reference Triad. 

Geophysical Research Letters, 32(20): 1-4. 

Georgoulias, A.K.; Balis, D.; Koukouli, M.E.; Meleti, C.; Bais, A. & Zerefos, C. (2009). A study of the total atmospheric sulfur 

dioxide load using ground-based measurements and the satellite derived Sulfur Dioxide Index. Atmospheric Environment, 

43(9): 1693-701. 

Kerr, J.B.; McElroy, C.T. & Olafson, R.A. (1981). Measurements of ozone with the Brewer spectrophotometer, In: London, J. (ed.). 

Proceedings of the Quadrennial International Ozone Symposium. Natl. Cent. for Atmos. Res., Boulder, Colo. pp. 74-79, 

Turner, J. (2003). The Antarctic climate. In: Holton, J.R.; Curry, J.A. & Pyle, J.A. (eds.). Encyclopedia of Atmospheric Sciences. 

Academic Press. 

Whitten, R.C. & Prasad, S.S. (1985). Ozone photochemistry in the stratosphere. In: Whitten, R.C.; Prasad, S.S. (eds.). Ozone 

in the free atmosphere. New York: Van Nostrand Reinhold. p. 81-122. 


43

5 MONITORING 


GREENHOUSE GASES IN COMANDANTE 

FERRAZ ANTARCTIC STATION, KING GEORGE ISLAND 

Luciano Marani 1,* , Plínio Carlos Alvalá 1,** 

1 Instituto Nacional de Pesquisas Espaciais – INPE, São José dos Campos, SP, Brazil 

e-mail: * lmarani@gmail.com; ** plino@dge.inpe.br 

Abstract: is document presents the results of the monitoring of Greenhouse Gases (GHG) at Brazilian Antarctic Station 

Comandante Ferraz (EACF). e samples were taken near the Ozone and Meteorology Modules, weather conditions, such as 

direction and intensity of the wind, being annotated. For measurements of the concentration of GHG, a collection system that 

used a diaphragm pump, with samples of air being stored in stainless steel cylinders, was used. Concentrations of gases of interest 

in the samples collected were determined by the ozone gas chromatography laboratory, in São José dos Campos/SP. Furthermore, 

a continuous infrared monitor (model LI-820 Licor Gas Analyzer) was installed in the Ozone Module. ere was great stability 

of the concentration values obtained by liquor, in that the average for these records were 378.8 ± 2.0 ppm (parts per million by 

volume), very close to that reported at NOAA’s (National Oceanic and Atmospheric Administration) polar station (385 ppm). 

Analyses of nitrous oxide (N O) collected in the cylinders in the months of January to March 2010 resulted in an average of 

2 

334.7 ± 2.0 ppb (parts per billion by volume), very close to that reported by NOAA as a global average (323 ppb), however it 

was noted that this value was virtually constant in all samples, which re ected in low standard deviation, revealing an o set 

in our pattern to be given in subsequent samples. Samples collected in cylinders in the same period and analyzed for methane 

showed an average 1,791.4 ± 38.0 ppb. is value is higher than expected for the region (1,750 ppbv). However there was a wide 

variability in the samples (represented by the standard deviation) re ecting local sample point, mainly in the samples collected 

near the station. CO data did not pass in the validation tests, mainly due to their long storage time. As the CO is reactive and can 

undergo alteration inside the cylinder through other compounds, the storage time led to reactions inside the cylinders, causing 

the invalidation of the samples for this gas. 

Keywords: greenhouse e ect, carbon dioxide, carbon monoxide, methane, Antarctica 

Introdution 

e Earth can be considered a body in thermal equilibrium, 

so the radiation absorbed by the surface must be distributed 

by it so that the balance is maintained. e Earth’s surface, 

heated, re-emits the absorbed radiation through wavelengths 

greater in the infrared range, called planetary radiation. On 

its way into space, some of this radiation is absorbed by the 

atmosphere, warming it. Only 6% of the radiation emitted 

from the surface escapes directly into space, especially in 

the spectral region known as the “atmospheric window” 

between 7 and 14 µm, where the absorption by CO and 2 

water vapour is weak (Vianello & Alves, 1991). e heated 

atmosphere emits radiation in all directions and a fraction of 

this radiation is absorbed by the surface again, contributing 

to further warming, the greenhouse e ect. 

Among the various greenhouse gases, the main ones are 

carbon dioxide (CO ), which is responsible for more than 

2 

60% of the increase of temperature, methane (CH ), nitrous 

4 

oxide (N O), and CFCs 11 and 12. e GWP of a gas is an 

2

index that expresses how e ective this is for the greenhouse 

e ect. It is measured in terms of the e ect of the introduction 

of a molecule in the atmosphere (or gram) of gas over 

the e ect of the introduction of a molecule (or gram) of 

CO 2 , calculated for a certain time period (integration 

period). is calculation also takes into account indirect 

e ects, such as chemical reactions that act as sink for gas, but 

that generate other greenhouse gases. For carbon dioxide, 

GWP is set to 1. us to say that the GWP of CFC-12, for 

an interval of 100 years, is 10,600, is equivalent to saying 

that the addition of a molecule of CFC-12 is equivalent to 

adding 10,600 molecules of CO 2 . 

e increase in the concentration of the gases responsible 

for global radiation absorption, called greenhouse gases, is 

causing a further rise in temperature, which can lead to an 

environmental imbalance. It is estimated that the increased 

concentrations of some gases (such as carbon dioxide, 

methane, nitrous oxide and CFCs) is responsible for a rise 

of about 0.3 °C in average global temperature per decade 

(with an uncertainty of 0.2 to 0.5 °C per decade), maintained 

their current growth rates (Cotton & Pielke, 1995). 

Besides the natural variations of the atmosphere, 

there are variations in the concentrations of certain gases 

by interference of man. e most typical example is the 

case of the stratospheric ozone layer and the increase of 

Greenhouse gases. Arti cially produced chemicals and 

greenhouse gases emitted in the industrial era just reacting 

and dramatically a ecting the chemistry and dynamics of 

the atmosphere, producing environmental impacts such 

as a slow and progressive reduction of the concentration 

of ozone at all latitudes and the increase of the surface 

temperature of the Earth. 

However, in the current frame of Global Changes, 

other complementary information about the variation 

of atmospheric parameters is necessary to measure the 

impact of these changes in the atmosphere and so that the 

environment can be assessed and quanti ed. 

e Antarctic environment is in the region of lowest 

global human impact. Due to its condition and its remote 

low-impact feature, this region is taken as reference for 

studies of global dispersal of pollutants and products from 

the earth’s crust, oceans and volcanic eruptions. Thus, 

maintenance of natural conditions in this region is of vital 

importance for understanding the impact of large scale 

impacts occurring in various continents and potentially 

those that have an in uence on the Antarctic region. 

e gases CO, CH , N O and CO are greenhouse gases 

4 2 2 

and their monitoring is essential over time. Moreover, these 

gases may be used for monitoring environmental pollution 

produced in the region of Antarctic Station Comandante 

Ferraz (EACF). 


For the measurements of concentration of greenhouse gases, 

which began in November 2009, a system of collection 

with a diaphragm compressor pump was used, with air 

samples being stored in stainless steel cylinders using an 

electropolishing procedure. Figure 1 shows the process of 

collections in the vicinity of EACF (62.11° S and 58.41° W). 

e frequency of sampling was weekly and the sampling 

was done in pairs, with two cylinders being pressurized in 

sequence. e pairs of samples collected were considered 

valid only when the di erence in the mixing ratios between 

the two cylinders was at most 5%. At the time of sampling, 

the weather conditions, like the wind direction and intensity, 

were recorded. e detailed meteorological data at the 

time of collection, such as wind speed, temperature and 

humidity were obtained through the address www.cptec. 

inpe.br/antartica. 

e samples were brought to the Ozone Laboratory 

at the National Institute for Space Research (INPE) to 

be analysed. To determine the mixing ratio of methane a 

chromatograph Shimadzu GC-14A equipped with a ame 

ionization detector (FID) and two columns of stainless 

steel 1/8 inch in diameter, were used. e rst column, 

2.5 m, was lled with silica gel and was used to minimize 

the total analysis time for the retention of water vapour, 

CO and carbon compounds heavier than methane. e 

2 

second was a column packed with zeolite 5Å molecular 

sieve (5 angstrom), 3.0 m in length, which was responsible 

for the gas chromatographic separation of the sample. e 

standard gas used was purchased from NOAA (National 


45

Figure 1. Collect the air samples using stainless steel cylinders with electropolishing internal pressurized to 2 atm, near (left, on the beach) and far from the 

station (right). 

Oceanic and Atmospheric Administration), and showed a 

concentration of 1749.4 ± 4.5 ppbv. e sample was injected 

through a sampling loop of 2.2 mL. e speakers operated 

at 100 °C and the detector at 120 °C. e chromatographic 

gases used for the FID(H , N and synthetic air) had a high 

2 2 

purity (99.999%). e relative accuracy obtained in the 

analysis of three aliquots of each sample was 0.7% or better 

(Alvalá et al., 2004; Marani & Alvalá, 2007). A detector of 

oxide of mercury was used for determining the mixing ratio 

of CO, with a relative precision of 3.5% or better for analysis 

of three aliquots (Kirchho et al., 2003). To determine the 

mixing ratio of N O and CO a gas chromatograph equipped 

2 2 

with electron capture detector (ECD), with relative accuracy 

of 0.7% or better, was used. All standard gases used were 

obtained from NOAA. 

In addition, a continuous infrared carbon dioxide 

monitor (model LI-820 Gas Analyzer) was installed near the 

ozone module (100 m distant from EACF), which provided 

instantaneous concentrations of gas and that should 

remain at the station performing the monitoring of the 

concentration of atmospheric CO . e Licor determines the 

2 

concentration of CO every second, but for this monitoring, 

2 

the daily averages were chosen. 


Results and Conclusions 

Because it is monitoring work, its continuation is necessary 

so that the behaviour of greenhouse gases can be duly 

studied. e monitoring is important because it may give 

indications of the impact of human presence in this region of 

Antarctica. In terms of results already obtained, we observed 

a greater stability of CO concentration values obtained 

2 

by the Licor, and the average for these observations were 

378.8 ± 2.0 ppm (parts per million by volume), very close 

to that observed in polar station NOAA (385 ppm). ere 

were problems with pump parts in June 2010 and a new 

pump was planned to reach EACF by November 2010 for 

monitoring to continue. Figure 2 shows the daily averages of 

CO obtained in EACF using cylinders (between December 

2 

2009 and January 2010), while in April, May and June, the 

data corresponds to daily averages obtained using the Licor 

equipment. 

e analysis of nitrous oxide (N O) in the cylinders 

2 

collected from January to March 2010 resulted in an average 

of 334.7 ± 2.0 ppb (parts per billion by volume). is value 

was found to be 10 ppb above the global average of NOAA 

(323 ppb), but observed that this value was almost constant 

in all samples, which resulted in low standard deviation, 

revealing a shi in our pattern to be given for the next 

samples.

Figure 2. CO 2 (March 2009 to January 2010), obtained from samples 

collected in drums (purple) and those obtained by continuous monitoring 

(blue). 

The samples collected in cylinders in the same 

period and analyzed for methane exhibited an average of 

1791.4 ± 38.0 ppb. is value is higher than expected for the 

region (1750 ppbv). However there was a large variability in 

References 

the samples (represented by standard deviation) re ecting 

the local sampling, mainly in samples collected near a station 

with favourable wind. 

e CO data did not pass the validation tests, mainly due 

to long storage time. As the CO is reactive and can undergo 

alteration inside the cylinder through other compounds, 

the storage time led to reactions inside the cylinders, 

characterizing the samples as invalid for this gas. As a result, 

one of the di culties was to perform the analysis of samples 

in smaller time intervals. Delays and changes in ight dates 

to support the work and di culty in dispatch, resulted in 

cylinders being collected from São José dos Campos at 

shorter intervals, particularly during winter. 


To PROANTAR, SECIRM, INPE, INCT-APA (National 

Institute of Science and Technology Antarctic Environmental 

Research), FAPERJ (process n° E-16/170.023/2008), CNPq 

(process nº 574018/2008-5) and ATMANTAR/IPY/ MCT/ 

CNPq, (process n° 52.0182/2006-5). We would also like to 

thank Dr. Neusa Paes Leme and technicians José Roberto 

Chagas, and William Jose Ferreira of Ozone Laboratory 

(INPE) for their support in Antarctica. 

Alvalá, P.C.; Boian, C. & Kirchhoff, V.W.J.H. (2004). Measurements of CH 4 and CO during ship cruises in the South Atlantic. 

Atmospheric Environment, 38(27), 4583–8. 

Cotton, W.R. & Pielke, R.A. (1995). Human impacts on weather and climate. Cambridge: Cambridge University Press, 288p. 

Kirchhoff, V.W.J.H.; Aires, C.B. & Alvalá, P.C. (2003). An experiment to determine atmospheric CO concentrations of tropical 

South Atlantic air samples. Quarterly Journal of the Royal Meteorological Society.129(B), 1891–903. 

Marani, L. & Alvalá, P.C. (2007). Methane emissions from lakes and fl oodplains in Pantanal, Brazil. AtmosphericEnvironment, 

41(8): 1627-33. 

Vianello, R.L. & Alves, A.R. (1991). Meteorologia básica e aplicações. Viçosa: Universidade Federal de Viçosa, Imprensa 

Universitária. 449p. 


47

6 CONSIDERING 


NEW PARAMETERS IN THE STUDY OF 

ATMOSPHERIC IMPACTS AT ADMIRALTY BAY 

Eduardo Delfi no Sodré 1 , Heitor Evangelista 1,* , Lavínia Brito 1 , Sergio Machado Corrêa 2 

1 Laboratório de Mudanças Globais e Radioecologia –DBB, Instituto de Biologia Roberto Alcântara Gomes –IBRAG, 

Universidade Estadual do Rio de Janeiro – UERJ, Rio de Janeiro, RJ, Brazil 

2 Departamento de Química e Ambiental, Faculdade de Tecnologia, 

Universidade Estadual do Rio de Janeiro –UERJ, Resende, RJ, Brazil 

*e-mail: evangelista.uerj@gmail.com 

Abstract: e purpose of this research is to deepen the investigation of atmospheric impact as a result of aerosol and gas emissions 

at Comandante Ferraz Brazilian Antarctic Base (henceforth EACF). As a consequence of a campaign during 2009/2010 summer 

and re-analysis of 1998 lters (whereby there became available an annual set of continuous samples), levoglucosan (the product 

cellulose pyrolysis) as an indicator of burning of organic material by the Brazilian Station was veri ed. e numeric model of 

atmospheric dispersion used for Admiralty Bay was suitable for study of the impact on the atmosphere in Admiralty Bay and 

in zoned areas of biological importance within the Antarctic Specially Managed Area of King George Island, using a simulation 

with stations and ships operating simultaneously. e preliminary results of the chemical analyses for carbonyls and BTEX have 

shown that the direct atmospheric impact zone of EACF, due to these chemicals, is restricted to a radius of a maximum of 400 m, 

falling sharply in all directions 

Keywords: King George Island, atmospheric impact, air polution, levoglucosano, BETEX 

Introduction 

An Antarctic Specially Managed Area (ASMA) of greater 

interest for the Brazilian Antarctic Programme has been 

delineated around Admiralty Bay and covers the location 

of 2 permanent research stations: EACF (Brazil) and 

Arctowski (Poland) and 2 of a smaller size, which operate 

only during the austral Summer: Machu Picchu (Peru) and 

Pieter J. Lenie-Copacabana (U.S.A), (Weber & Montone, 

2006). All these stations have power generating systems 

operated on the basis of the burning of fossil fuels (with 

the exception of Copacabana) and also incinerate organic 

waste. ese operational pattern make the stations sources 

of research related to local pollution. e Brazilian base is 

the one which sustains a greater amount of human activity 

due to the great number of research scientists and technical 

support professionals, who are based there every year, 

together with their logistical maintenance support systems, 

personnel transport carriers, and materials. Admiralty Bay 

also receives several tourist ships that contribute to the 

increase of the local atmospheric pollution. e orography 

of the region is characterised by fjords surrounded by 

mountainous areas, which results in a large basin area 

making di cult the dispersion of pollutants generated there, 

especially during periods of high atmospheric stability. In 

this research work, we present the results of new simulations 

using the mathematical model of atmospheric dispersion 

presently in use, ISCST3 (Industrial Source Complex - 

Short Term Version 3), and the employment of chemical 

markers (levoglucosan, total BTEX and total carbonyls) 

representative of the anthropic activities at ASMA.

Figure 1. A modelled scenario of atmospheric dispersion using multiple 

sources in the interior of Admiralty Bay/King George Island. 

Preliminary Results 

Atmospheric dispersion model 

The mathematical atmospheric pollutant dispersion 

models are important tools for understanding the 

behaviour of some gaseous and particle pollutants 

using data from the study of topography, emissions 

and meteorology. These models estimate the impact 

of one or more sources on the air quality of a certain 

region. The dispersion model used in this research was 

the ISCST3 (Industrial Source Complex - Short Term 

Figure 2. (Upper) seasonal average of global fi re spots; (bottom) inter-annual concentrations of Levoglucosan in 1998 measured at EACF. 


49

Figure 3. Back-trajectory model (Hyspit/NOAA), during the the increase of Levoglucosan levels over the King George Island in January 1998. 

Version 3), a Gaussian Plume Model in a steady-state 

condition that can be used in the evaluation of pollutant 

concentrations and/or in the deposition fluxes from a 

great variety of complex sources (Vidal, 2008). In this 

study, the plume model was configured for a critical 

scenario whereby 3 scientific stations and 4 ships were 

operating simultaneously in Admiralty Bay. The result is 

shown in Figure 1 and considers an average distribution 

of local wind, topoghaphy and the predominant classes of 

stability. It can be observed that in these circumstances, 


apart from local impacts, an important part of Admiralty 

Bay receives the combined atmospheric impact of these 

pollutants sources. 

Chemical tracers: Levoglucosan 

Levoglucosan (1,6 anhydro-β-D-glucopyranose), the 

product of cellulose pyrolysis, has been studied as a forest 

and agricultural biomass burning tracer due to its resistance 

to weathering and its dispersion in the atmosphere during 

occurrences of slash-and-burn. Another potential source 

of levoglucosan in Antarctica is the practice of organic

Figure 4. Spatial distribution of the atmospheric samples during the fi rst phase of the 2009/2010 summer at EACF. The dotted contour line indicates where 

signifi cant increases of BTEX and Carbonylic compounds were observed. The lower square close up detail, to the right, shows EACF and the reserve fuel 

tanks. 

waste incineration by the research stations. An analysis 

undertaken concerning the lter samples in 1998, whose 

monitoring spanned a complete annual sequence, showed 

that the level of greater concentration of levoglucosan 

coincided with the period of greatest human activity at 

EACF, at which moments the incinerator is used with greater 

frequency. From the seasonal point of view, the peaks of 

Levoglucosan di er from the occurrence of peaks of the 

forest slash-and-burn, not only in South America/Africa, 

but also in terms of worldwide slash-and-burn, according to 

the database of the European Space Agency – ESA, Figure 2. 

Considering that the displacement time of the plumes of 

smoke from slash-and-burn between South America and 

the Antarctic Peninsula occur in approximately 7-15 days, 

the time lag observed does not justify a continental origin 

for the levoglucosan, making the incineration of organic 

waste at EACF the most probable cause. 

Trying to corroborating the hypothesis concerning 

the relevance of the local sources related to levoglucosan, 

regarding long distance displacement, the Hysplit/NOAA 

model was used with in order to investigate the nature of the 

back-trajectories of the air masses, referring to the sample 

dates that show high concentrations. A typical structure 

is shown in Figure 3, calculated for January 2008. In this 

case, it was veri ed that during the periods of high level of 

Levoglucosan, the air masses that prevailed over the King 

George Island were basically from polar-oceanic nature, 

justifying, in principle, the in uence of forest slash-andburn 

over that region. 

Carbonylic and monoaromatic hydrocarbons 

In general the main carbonylic compounds in the 

troposphere are formaldehyde, acetaldehyde and acetone, 

and the first is considered carcinogenic by IARC. The 

monitoring of these compounds is an American regulatory 

ruling by USEPA. In the vicinity of EACF, 14 air samples 


51

Figure 5. a) Total BTEX and b) Total Carbonyl. The colored rectangles distinct the samples with higher values and the environmental levels. The identifi cation 

of the samples refers to Figure 4. Sampling station A19 was set close to the emission point. 

were collected and analysed according to USEPA(1997) 

methodology. e results showed the presence of these 

compounds, mainly inside a 200-400 m radius from EACF 

(Figures 4 and 5). e same occurred for BTEX, aromatic 

hydrocarbons present in diesel and with high resistance 

to environmental degradation and and high volatility. In 

sub-polar environments the latter form becomes more 

persistent, since the low temperatures delay their degrading 

process. Among the 21 air samples analysed for BTEX, an 

analogue spatial distribution behaviour for the carbonylic 

compounds was observed. 

A cluster analysis between the results of the atmospheric 

chemical pollutants and meteorological data obtained 

in situ (in the case, pressure, humidity, wind intensity, air 

temperature and solar radiation), indicated the presence of 

3 groups when a tolerance limit of 0.35 was adopted; that 

is, a rst group that relates pressure and relative humidity 


b 

Figure 6. Cluster analysis of Carbonylic Compounds and meteorological 

data for the 2009 summer around EACF. 

a

which illustrates the dynamism of the frontal systems in 

the region, which carry oceanic humidity to King George 

Island. A second group that relates the air temperature and 

global solar radiation, as a result of heating up of the local 

atmosphere through the direct e ect of solar radiation, and a 

third group that concentrates the greater part of its chemical 

compounds (with exception to propionaldehyde) grouped 

together with wind intensity which is a meteorological 

modulating parameter of the air concentrations. e result 

of the cluster (Figure 6) indicates the nature of the local 

emissions. 

As a nal remark, the EACF is potentially a source of 

fugitive emissions from fuel tanks. ese refer to unintended 

release of gases from defective, vents, connections and 

pressure valves, the latter being a big problem for the 

petrochemical industry. eir control is usually associated 

to maintenance. In the case of storage and fuel supply, the 

question refers to the escape of gases through the vents and 

fuel tank entrances. In many European countries there is an 

environmental requirement that at the time of fuel transfers 

the saturated gases in the storage tanks shall be collected. 

References 

e fuel transfer into the storage tanks at EACF occur 

between the end of spring and the beginning of summer. 

Conclusion 

e samples analysed up to the present, clearly demonstrate 

an existing impact due to the use of fossil fuel and 

incineration of organic waste. However, this impact, from 

the atmospheric point of view, seems to be restricted, 

signicantly, to the occupational and infrastructure zones 

(~200-400 m around EACF). e reason is probably the 

persistent strong local winds and the atmospheric stability 

pattern, important in the process of dispersion of gases and 

particulate material emitted by the EACF. 

Aknowledgments 

We kindly thank the Instituto Nacional de Ciência 

e Tecnologia Antártico de Pesquisas Ambientais 

(INCT-APA) and the grants CNPq/574018/2008-5 and 

FAPERJ/E-16/170.023/2008 that made possible this work. 

Also Dr. Neusa Paes Leme/INPE for her great help in the 

logistics and invitation to join INCT-APA. 

USEPA. Compendium Method TO-11A. (1997). Determination of Formaldehyde in Ambient Air Using Adsorbent Cartridge 

Followed by High Performance Liquid Chromatography (HPLC). EPA-625/R-96/010b. Cincinnati, OH: U.S. Environmental 

Protection Agency. 

Vidal, C.M.C. (2008). Descrição da Metodologia do Cálculo da Dispersão de Plumas Aplicada a um Complexo industrial - 

Dissertação de Mestrado- Instituto de Química - UERJ. 

Weber R.R. & Montone, R.C. (2006). Gerenciamento Ambiental da Baía do Almirantado, Ilha Rei George- Antártica - Rede 2 

– MMA. 


53


GLOBAL CHANGES ON TERRESTRIAL 

ANTARCTIC ENVIRONMENT 

58 Plant Communities from Ice-Free Areas of Demay Point, King George Island, Antarctica 

63 Global Patterns in Soil Bacterial Community Composition Across a Continental Scale 

68 Conservation Status of Plant Communities at Ulmann Point and Comandante Ferraz Antarctic 

Station Area, Admiralty Bay, King George Island, Antarctica, Based on the Index of Ecological 

Signifi cance 

73 Insecticidal Effects of Antarctic Algae Prasiola Crispa Extract in the Adult Fruit Fly Drosophila 

Melanogaster 

78 Penguin Colonies and Weather in Admiralty Bay in a Colder Year 

82 Distance Associations Among Antarctic and Subantarctic Seabirds 

87 Topographical Characteristics Used by Southern Giant Petrel Macronectes Giganteus at Stinker 

Point, Elephant Island 

91 Factors Infl uencing Brown Skua Reproductive Success at Elephant Island – Antarctica 

95 Nest Attendance of Southern Giant Petrel (Macronectes Giganteus) on Elephant Island 


e thematic module “Global Changes Impact on Antarctic 

Environment” was proposed with the aim of researching 

Antarctic ice-free areas through the study of biologic 

communities looking for relationships among plants, 

seabirds and soil microorganism communities. We intend 

to implement an environmental network to monitor ice- 

free area communities through the study of the entire 

ecosystem. Monitoring terrestrial ecosystems as a whole 

is essential to detect and comprehend how global changes 

a ect the Antarctica Continent, particularly the plants and 

the seabirds, as they are the most representative populations 

and also the most susceptible to global changes. 

Since vegetal communities are closely related to seabird 

colonies, it is important to develop studies that take into 

consideration this previous association. Some vegetal 

species are classified as ornitocoprophilous and some 

as ornitocoprophobous. In the same way that seabirds 

and plants are found to be interconnected, plants can be 

associated to soil microorganisms, hence, it is also important 

that they are studied and understood. 

To achieve our goals we will focus our research on: 

1 - Plant cover; 2 – Biodiversity; 3 – Seabird reproductive 

colonies distribution; 4 – Seabird colonies size variation 

and distribution; 5 – Seabird reproductive success. All those 

research branches will be investigated in relation to global 

climatic changes, ice-free areas and anthropogenic impact. 

Here we present a group of studies developed at 

Admiralty Bay, South Shetlands, with ice-free areas 

biological communities. In order to obtain vegetation 

and microorganism community data, field work was 

simultaneously under taken. us, the study “Plant from ice- 

free areas of Demay Point, King George Island, Antarctica” 

Coordinator 

Antonio Batista Pereira 

Vice-coordinator 

Maria Virginia Petry 

was written taking into consideration soil and seabird 

populations as crucial factors for the presence or absence 

of certain plant populations which characterize vegetation 

communities. 

e study “Conservation status of plant communities 

in Ullmann Point and Comandante Ferraz Base Area, 

Admiralty Bay, King George Island, Antarctica based on 

the index of ecological significance” is one of the first 

studies written based on Antarctic plant population and 

is important because it brings together relevant data, 

which will be decisive to evaluate environmental impacts, 

in complementation of seabird and soil microorganism 

communities. 

e study “Global patterns in soil bacterial community 

composition across a continental scale” is new in the way 

that its aim is to put together information that enables 

checking the methodology of soil microbial community 

studies in ice-free areas compared to what has been carried 

out in Brazil. 

Over the length of millions of years of isolation, 

Antarctic organisms have evolved particular characteristics 

as a response to environmental pressure. ose characteristic 

variations are registered in their genes, which can 

be considered an Antarctic treasure. With the study 

“Insecticidal e ects of Antarctic algae Prasiola crispa extract 

in the adult fruit y Drosophila melanogaster” we aim to 

obtain better comprehension of Antarctic plant species and 

explain the fragility and peculiarity of this environment’s 

populations. 

Seabird breeding colonies annual variation is evaluated 

through mapping all species breeding colonies year 

upon year. The study “Penguin Colonies and Weather 


55

Figure 1. Thematic Area 2 fl owchart. (Illustration: Edson Rodrigues). 

Suzana Seibert 

Figure 2. Petrel in carpet moss communities. 


Suzana Seibert 

Figure 3. Prasiola crispa communities in a Penguin colony.

Rodrigo Machado 

Figure 4. Skua in carpet moss communities. 

in Admiralty Bay, King George Island, in a Colder Year” 

exemplifies such an approach. By making area and 

distribution measurements every year we are able to detect 

ne variations in population density. It will be possible to 

correlate those variations to environmental data (mainly 

climatic variables and the annual sea-ice caps) through long 

term data sampling. 

Antarctic seabird population parameters can also be 

a ected by local factors. e local landscape parameters 

are in uential in the decision of where the birds will place 

their nests. e paper “Topographical characteristics used by 

the Southern Giant Petrel Macronectes giganteus in Stinker 

Point, Elephant Island” makes a preliminary evaluation of 

the Southern Giant Petrels nest distribution by application 

of GIS and exploratory analyses. The comparison of 

topography between nests and random points demonstrated 

that the choice of nesting is not random. On the other hand, 

the paper “Factors in uencing Brown Skua reproductive 

success at Elephant Island – Antarctica” evaluates the 

in uence of inter- and intra-speci c interaction over the 

breeding success, thus, exemplifying the importance of 

biotic local factors for seabird demography. e paper titled 

“Nest attendance of Southern Giant Petrel (Macronectes 

giganteus) on Elephant Island” applies a tracking method 

with radio transmitters to monitor the nest attendance of 

Southern Giant Petrels. e nest attendance depends on 

the environmental factors. Years with climatic extremes 

and low food availability in uence the decision of birds on 

when to begin and eventually when to abort breeding. We 

expect di erences in parental investment between genders 

in species such as the Southern Giant Petrel whose sexual 

dimorphism is marked, being able to shi as a response to 

climatic conditions as well. 

Since local factors can in uence population breeding, 

furthermore oceanic factors during the non-breeding 

season are important to determine survival and returning 

rates of the breeding colonies. Seabirds are a ected in the 

open ocean by productivity, temperature and weather 

fronts. Such in uences can be driven by the interaction 

among species. Seabirds interact to optimize their food 

detection by a constant monitoring of each other’s 

behaviour in the sea. e paper “Association distances 

among Antarctic and Sub-Antarctic seabirds” measures 

such associations. is is a rst e ort to evaluate seabirds 

and environmental interactions in the open ocean. Seabird 

species are sampled every year at the beginning and end of 

their breeding seasons of Antarctic and Brazilian waters, so 

we will be able to detect wide interactions of non-breeding 

seabirds with weather conditions and ocean productivity 

during their non-breeding movements, and thus make 

inferences of how much such interaction is determinant 

on breeding seasons. 


57

1 PLANT 

COMMUNITIES FROM ICE-FREE AREAS OF DEMAY 

POINT, KING GEORGE ISLAND, ANTARCTICA 


Antonio Batista Pereira 1,* , Márcio Rocha Francelino 2 , Valdir Marcos Stefenon 1 , 

Adriano Luis Schünemann 1 , Luiz Fernando Wurdig Roesch 1 

1 Universidade Federal do Pampa – UNIPAMPA, São Gabriel, RS, Brazil 

2 Universidade Federal Rural do Rio de Janeiro – UFRRJ, Seropédica, RJ, Brazil 

*e-mail: anbatistape@gmail.com 

Abstract: is research presents the study of plant communities in ice-free areas of Demay Point, which is located at the south 

of the Admiralty Bay, King George Island, Antarctica. e aim of this research was to collect data about the plant coverage, 

classi cation and distribution of plant communities, contributing with the evaluation of possible environmental impacts of 

anthropogenic or natural origin, following the evolution of such communities over the length of time. e study started with the 

classi cation and description of the plant communities based mainly on the plant physiognomy, biodiversity and the relation 

with local abiotic factors. Each community was mapped with an Astech Promark II DGPS and the data was processed using 

AstechSolutions so ware to obtain sub-metric accuracy. Seven plant communities were identi ed and described as: 1 Grass 

and cushion chamaephyte formation; 1.2 Deschampsia and mosses subformation; 2 Moss carpet formation; 3 Moss hummock 

formation; 4 Moss tu formation; 5 Fruticose lichen and moss tu formation and 6 Fell eld communities. ese plant communities 

are shown in a map, with their description. 

Keywords: vegetation, plant coverage, King George Island, Antarctica 

Introduction 

Demay Point is an ice-free area located in the south of 

Admiralty Bay, within the SSSI 8, being delimited by the 

Baranowski Glacier to the North and by Windy Glacier 

to the South. Since it is located within an area of scienti c 

interest, very important for preservation and rich in plant 

communities, it constitutes an excellent ecosystem for 

monitoring plant communities. 

Regarding the study of plant communities of Antarctica, 

one of the rst attempts of describing the plant populations 

occurring in ice-free areas of this continent was made by 

Skottsberg (1912), who identi ed and classi ed some lichens 

and moss communities, based mainly on the physiognomy of 

the plant formations. A further piece of research describing 

the plant formations from Antarctica – performed by 

Allison and Lewis-Smith (1973), using mainly quantitative 

characters from the populations – was completed just six 

decades a er the work of Skottsberg. Lewis-Smith (1988) 

was one of the rst to present a classi cation for population 

groups of the plant communities of Antarctica, clustering 

them in formations and sub-formations. Pereira and Putzke 

(1994) presented a study of the plant communities of Stinker 

Point, Elephant Island, Antarctica, in which they classi ed 

the plant communities based mainly on the work of Lewis- 

Smith and Gimingham (1976). Putzke and Pereira (1998) 

presented a study of the moss communities of the Rip Point, 

Nelson Island, Antarctica, using the quadrat method. 

In addition to these studies, there is the work of 

Pereira et al. (2007), presenting a map with the description

and distribution of the plant communities of the Keller 

Peninsula, King George Island, and the work of Victoria et al. 

(2009), about the composition and distribution of the 

moss formations in ice-free areas near the Polish Station 

Arctowski, King George Island, South Shetlands. 

e present study had the purpose of collecting and 

registering data about the diversity and the plant coverage 

of ice-free areas in Antarctica, given that these aspects are 

outstanding indicators of environmental changes. Because it 

is an area of environmental protection, this data is important 

for an evaluation of the environmental impacts of both, 

anthropogenic and natural origin. 

Material and Method 

e study of the vegetation of ice-free areas in Demay 

Point started with the identification of the most 

representative populations (Figures 1 and 2). e studies of 

Putzke and Pereira (2001) and Ochyra (1998) were used for 

Figure 1. Location of study area. 

the identi cation of moss and the research work of Øvstedal 

and Lewis-Smith (2001) and of Redón (1985), for the 

identi cation of lichens. In some areas, the quadrat method, 

modi ed from Braun-Blanquet (1964), was employed. Based 

on the data collected, the plant communities were identi ed 

and classi ed according to Pereira and Putzke (1994) and 

Lewis-Smith and Gimngham (1976). 

The plant communities were geo-referenced and 

mapped utilizing the Astech Promark II® DGPS, which 

is able to obtain sub-metric accuracy a er processing the 

data with Astech Solutions® so ware, based on data from 

the active GPS station of the Comandante Ferraz Brazilian 

Antarctic Base. 


is is the rst study on vegetation cover and distribution 

of plant communities at Demay Point, hence there is no 

historical data to be discussed and compared for this area. 


59

Figure 2. Spatial disitribution of vegetation communities in Demay Point, King George Island, Anarctica. 

Based primarily on the biodiversity and physiognomy, it 

was possible to recognize six plant formations and one 

subformation (Figure 2), which can be clearly identi ed 

and delimited: 

Grass and cushion chamaephyte formation 

ese formations were present in two areas situated close 

to the beach. In these communities, the soil is usually 

deep, originating mainly from the sediments carried by the 

water from the melting process. e oristic composition 

is formed mostly by dense populations of Deschampsia 

antarctica Desv. (Poaceae) and rare grass turf of Colobanthus 

quitensis (Kunth.) Bart. (Caryophylaceae). The moss is 

represented by small and rare populations of Sanionia 

uncinata Hedw. Loeske. Populations of Bryum spp. occur 

in wet places, mostly along the drainage lines. 


Deschampsia and moss subformation 

These subformations were represented by a small, 

discontinuous formation located near the beach, in the 

central part of the studied region (Figure 2). is is an area 

with relatively well-di erentiated soil, originated mostly 

from the decomposition of sediments carried by the water 

from the defrosting process. e vegetation is composed 

of Deschampsia antarctica associated with Colobanthus 

quitensis. e moss populations are more representative 

than in the Deschampsias communities. Among the moss 

species, Sanionia uncinata, Bryum spp. and Polytrichastrum 

alpinum (Hedw.) G.L.Sm. represent the higher biomass. 

Moss carpet formation 

e moss carpet formations were usually located in fairly 

at areas, in the coastal region, formed by jackstone or by

small rock fragments. In this substrate, the species with 

higher biomass are mainly Sanionia uncinata, with rare grass 

turf of Deschampsia antarctica. In sites where there is soil or 

deposit of thin sediments, the most abundant populations 

are formed by Polytrichum juniperinum in areas without 

the in uence of guano. Where guano is present, the most 

common Politrichaceae is Polytrichastrum alpinum, both 

associated with Bryum spp. and Syntrichia spp.. 

Moss hummock formation 

ese communities were very similar to the Deschampsia 

and moss communities. e main di erence is the higher 

biomass and higher biodiversity of moss associated with 

flowering plants. The most frequent moss populations 

were of Polytrichastrum alpinum, Polytrichum juniperinum 

Hedw. and Syntrichia princeps (De Not.) Mitt. Populations of 

Bryum spp. occured in wet areas and along drainage lines. 

ese communities can be found frequently in areas with 

soil, represented by large formations along the beach in the 

central region of Demay Point. 

Moss tu formation 

e moss tu formations are characterized primarily by a 

oristic composition where moss populations predominate, 

without forming carpets or cushions, since the populations 

usually are isolated in small, more or less discontinuous 

spots. e biodiversity depends mainly on the presence 

of soil and the in uence of guano. While Polytrichastrum 

alpinum, which is ornithocoprophilic, occurs primarily 

in areas near the bird colonies, Polytrichum juniperinum, 

which is ornithocoprophobous, grows in regions distant 

from the guano. Other moss species like Syntrichia spp. 

and Bryum spp. are frequent. Deschampsia antarctica and 

Colobanthus quitenses are represented by small and rare 

grass turf. In Demay Point, this community is represented 

in the north extremity, by a small area. 

Fruticose lichen and moss tu formation 

The Fruticose lichen and moss tuft formations are 

characterized mainly by the predominance of Usnea 

aurantiaco-atra (Jacq.) Bory and Usnea antarctica Du Rietz. 

populations. Other species of fruiticulous lichens usually 

associated with lichen communities of the region are less 

representative in these areas. ese communities occur in 

areas with predominance of big blocks of rock or of rocky 

outcrops, without soil formation. Moss populations are 

less frequent. Populations made up of representatives of 

the genus Pohlia can appear in wet locations among the 

rocks with soil decomposition. Populations of Sanionia 

uncinata and Polytrichum juniperinum can occur in other 

places. Polytrichastrum alpinum can happen in places of 

bird nesting. 

Fell eld communities 

In Demay Point, fell eld communities occupy the biggest 

areas in terms of extension. In these areas, the substrate 

available for the plant populations are areas with deposition 

of rock fragments or coarse non-consolidate sediments 

frequently moved and washed by the water from the 

defrosting process. e vegetation is usually represented 

by rare and small grass turf of Colobanthus quitensis and 

Deschampsia antarctica. e most representative mosses 

are small populations of Sanionia uncinata, Syntrichia spp. 

and Bryum spp., among others. 

Conclusion 

e vegetation of Demay Point is apparently a continuity 

occurring in the region of Copacabana and in the coastal 

areas of Punta omas. However, it di ers from the last ones 

by the little in uence of the guano, since the population 

of birds is much smaller. Since it is located at the entrance 

of Admiralty Bay, the vegetation is different from the 

vegetation occurring in other areas with lower in uence of 

the guano, like the Keller Peninsula and Hannequim Point, 

due to the fact that these areas face towards the interior of 

the bay, free of the action of the humidity from the winds 

of the open sea. 

The total vegetation cover on the studied areas is 

described as follows: Glass and cushion chamaephyte 

formation represents 2.43%, Deschampsia and moss subformations 

0.09%, Moss carpet formations 2.52%, Moss 

hummock formations 1.69%, Fruticose lichen and moss 

tu formations 11.53% and Fell eld communities 81.73%. 


61


is work was supported by the Brazilian Antarctic Program 

through the CNPq (process nº. 574018/2008), FAPERJ 

(process E-26/170.023/2008), Ministry of Environment – 

MMA, Ministry of Science and Technology – MCT and 

CIRM. 

References 

Allison, S.E. & Lewis-Smith, R.I. (1973). The vegetation of Elephant Island, South Shetland Island. British Antarctic Survey 

Bulletin, 33-34: 185-212. 

Braun-Blanquet, J. (1964). Plant Sociology: The study of plant communities. New York, McGraw-Hill. 

Lewis-Smith, R.I. (1988). Classifi cation and ordination of cryptogamic communities in Wilkes Land, Continental Antarctica. 

Vegetatio 76: 155-66. 

Lewis-Smith, R.I. & Gimingham, C.H. (1976). Classifi cation of cryptogamic communities in the maritime Antarctic. British 

Antarctic Survey Bulletin, 33-34: 89-122. 

Ochyra, R. (1998). The moss fl ora of King George Island Antarctica. Polish Academy of Sciences. Cracow, 198 p. 

Øvstedal, D.O. & Lewis-Smith, R.I. (2001). Lichens of Antarctica and South Georgia – A guide to their identifi cation and 

ecology. Studies in Polar Research. Cambridge University Press. 411p. 

Pereira, A.B, & Putzke, J. (1994). Floristic composition of Stinker Point. Elephant Island, Antarctica. Korean Journal of Polar 

Research, 5(2): 37-47. 

Pereira, A.B.; Spielmann, A.A.; Martins, M.F.N. & Francelino, M. R. (2007) Plant Communities from ice-free areas of Keller 

Peninsula, King George Island, Antarctica. Oecologia Brasiliensis, 10(1): 14-22. 

Putzke, J. & Pereira, A.B. (1998). Moss communities of Rip Point in Northern Nelson Island, Antarctica. Pesquisa Antártica 

Brasileira, 3(1): 104-15. 

Putzke J. & Pereira, A.B. (2001). The Antarctic Moss with special reference to the Shetland Island. Canoas. Ed. ULBRA. 

Redón, J. (1985). Líquenes Antárticos. Instituto Antártico Chileno (INACH), Santiago de Chile. 123p. 

Skottsberg, C.J.E. (1912). Einigi Bemerkung über die Vegetationsverhaltnisse des Grahamlandes. Wissenchaftliche Ergebnisse 

der Schwedischen Südpolar Expedition - 1901-1903, 4(13):1-16. 

Victoria, F.C.; Pereira, A.B. & Costa, D.P. (2009). Composition and distribution of moss formations in the ice-free areas adjoining 

the Arctowski region, Admiralty Bay, King George Island, Antarctica. Iheringia Série Botânica, 64(1): 81-91. 


GLOBAL PATTERNS IN SOIL BACTERIAL COMMUNITY 

COMPOSITION ACROSS A CONTINENTAL SCALE 

Leandro Nascimento Lemos 1 , Afnan Khalil Ahmad Suleiman 1 , 

Antônio Batista Pereira 1 , Luiz Fernando Wurdig Roesch 1,* 

1 Universidade Federal do Pampa – UNIPAMPA, Campus São Gabriel, São Gabriel, RS, Brazil 

*e-mail: luizroesch@unipampa.edu.br 

Abstract: Although patterns of variation regarding macroorganisms have been studied extensively, the links between microbial 

biogeography and the environmental factors that shape microbial communities are largely unexplored. Here we tested the Baas 

Becking hypothesis for microbial community distribution by analysing the soil bacterial community from the Brazilian Pampa 

and King George Island, Antarctica. e genetic community structure was assessed by automated ribosomal intergenic spacer 

analysis (ARISA ngerprint). Bacterial patterns were quanti ed by using hierarchical clustering and by the detection of the 

shared taxonomic unities between the environments. Geographical patterns in bacterial community structure were detected by 

broad-spectrum (between samples from di erent geographic locations) and speci c-spectrum (within samples from di erent 

geographic locations), suggesting that microbial communities exhibit biogeographic patterns at di erent scales and that, at least, 

some taxonomic unities have a wide distribution. ese preliminary results support the idea that “everything is everywhere, but, 

the environment selects”. 

Key words: Antarctica, Brazilian Pampa, biodiversity, culture-independent technique 

Introduction 

Biogeography is the study of the distribution of biodiversity 

over space and time, which describes general trends 

and location of populations and their attributes into a 

geographic context (Lomolino et al., 2006). Although 

patterns of variation with respect to macroorganisms 

have been studied extensively, the links between microbial 

biogeography and the environmental factors (e.g. vegetation 

cover, latitude, climate, temperature, and animal abundance) 

that shape microbial communities are largely unexplored. 

Some research studies support the idea that microbial 

communities di er in di erent places and the extent of 

this spatial variation is due to contemporary environmental 

factors and historical contingencies. is is the so-called Baas 

Becking hypothesis for microbial community distribution: 

“everything is everywhere, but, the environment selects” 

(de Wit & Bouvier, 2006; Martiny et al., 2006). It implies that 

di erent contemporary environments maintain distinctive 

microbial assemblages but also implies that microorganisms 

have such enormous dispersal capabilities that they rapidly 

erase the e ects of past evolutionary and ecological events. 

This is especially important for monitoring and better 

understanding the impact of global changes on the Antarctic 

terrestrial environment. 

Our understanding of the spatial distribution patterns 

of microbial diversity is narrow because most studies are 

limited to local scales (for example, Chow et al., 2002; 

Hackl et al., 2004; Lamarche et al., 2007; Yergeau et al., 

2010). In this work we tested the Baas Becking hypothesis 

by analysing the bacterial community across a broad 

continental scale. Soils from two sites across the southern 


2 

63

hemisphere were chosen and samples included from 

two continents, Antarctica (King George Island) and the 

Americas (Rio Grande do Sul, Brazil). 


Samples were collected from three distinct environments 

across a broad geographical scale and included a well- 

preserved gallery forest and anthropogenic grassland under 

severe degradation in the Brazilian Pampa and soil samples 

from ice-free areas located in the northwest side of the Keller 

Peninsula at 1,300 m from the Brazilian Antarctic Base at 

King George Island, Antarctica (Table 1). 


Bacterial community composition was assessed by 

ARISA, a culture-independent technique for constructing 

bacterial community fingerprints based on the length 

heterogeneity of the intergenic transcribed spacer region of 

bacterial rRNA operons (Fisher & Triplett, 1999). A set of 

21 soil samples (Table 1) were collected from the top 10 cm 

of the surface and microbial DNA was extracted directly 

from the soil samples using the MoBio Power Soil extraction 

kit (MoBio, Carlsbad, CA, USA). PCR was performed 

with the GoTaq PCR core system (Promega, Madison, WI, 

USA). e mixtures contained 5 ml of PCR bu er, 200 mM 

dNTPs, 100 mM of each primer, 2.5 U of Taq polymerase 

and approximately 100 ng of DNA template in a nal volume 

of 50 µL. e primers used were S-D-Bact- 1522-b-S-20 

and L-D-Bact-132-a-A-18 (Ranjard et al., 2001). Reaction 

mixtures were held at 94 °C for 3 minutes, followed by 

30 cycles of ampli cation at 94 °C for 45 seconds, 55 °C for 

1 minutes and 72 °C for 2 minutes and a nal extension of 

72 °C for 7 minutes. 

e ampli cation product fragments were then resolved 

on a 2% agarose gel. Size standards were also resolved in 

separate wells to estimate the size of each PCR product. 

e Bray–Curtis similarity index was calculated to assess 

the degree of similarity among the samples and produce 

a similarity matrix. e resulting matrices with pairwise 

similarities were used to group samples that represented 

similar bacterial community composition. Hierarchical 

clustering was calculated by using complete linkage 

algorithm and the results were represented by a dendrogram 

with the x axis representing the full set of samples and the 

y axis de ning a similarity level at which two samples were 

considered to have fused. All data analyses for the ARISA 

bands were conducted using the so ware PRIMER 6 version 

6.1.9 (PRIMER-E Ltd, Luton, UK). e overall fraction of 

taxonomic unities shared between the microbiome detected 

in the Brazilian Pampa and the Antarctica was determined 

by assessing the presence/absence of speci c ARISA bands. 

Results 

Table 1. Origin of the soil sample, location, elevation and number of samples collected in each environment analyzed. 

e rst step in assessing habitat distributions for bacteria 

was to determine the degree of similarity among samples 

and group them based on the communities composition. 

e dendrogram depicting this cluster analysis is shown 

in Figure 1a. Bacterial communities were more similar 

within the Brazilian Pampa and Antarctica sites and least 

similar between both environments. Nevertheless the 

samples presented a high overall variability clustering 

at low similarity even within the samples from the same 

geographical location. Cluster III made up of ve samples 

collected from Antarctica was fused at 30% similarity while 

Cluster I made up of most of the samples from the Brazilian 

Origin of soil Latitude/longitude Elevation Number of samples 

Gallery forest, Brazilian Pampa 

Grassland, Brazilian Pampa 

King George Island, Antarctica 

30° 24’ 09.3” S 

53° 52’ 59.1” W 

30° 24’ 08.9” S 

50° 53’ 05.9” W 

62° 03’ 51.1” S 

58° 24’ 47.5” W 

140 m 10 

230 m 5 

32 m 6

Pampa was fused at 25% similarity. is result indicates a 

large spatial variability even between samples from similar 

environments. On the other hand, the dendrogram also 

shows a single cluster (Cluster IV) with 40% similarity 

among samples made up of representatives from each 

environment analysed denoting that there is a link between 

bacterial community composition. 

e cluster analysis encouraged us to examine bacterial 

diversity more directly using the ARISA bands to detect 

taxonomic unities that were in common between the 

Brazilian Pampa and the Antarctica samples. e results 

of this analysis are summarized in a Venn diagram, which 

presents the fraction of taxonomic unities that are unique 

and shared between both environments (Figure 1b). Several 

taxonomic unities were distinct to habitats (14.3 and 

42.8% found only in Antarctica and the Brazilian Pampa 

respectively), while 42.8% of the taxonomic unities appeared 

to be shared between environments. 

Discussion 

a b 

Figure 1. a) Dendrogram illustrating the arrangement of the clusters based on the presence/absence of ARISA fragments using DNA samples from gallery 

forest and grassland soil samples from the Brazilian Pampa and soil samples from defrosting areas in the King George Island, Antarctica. b) Venn diagram 

showing overall overlap of taxonomic unities between two microbial communities Antarctica and the Brazilian Pampa. The numbers are expressed in 

percentage of taxonomic unities. 

Since microbial composition affects ecosystem 

processes (McGrady-Steed et al., 1997), the motivation 

for understanding microbial biogeography extends 

beyond drawing and interpreting a map of microbial 

diversity. Even under similar environmental conditions, 

microbial communities from di erent environments might 

function di erently. erefore, a better understanding of 

microbial biogeography is essential to predict such e ects 

(Martiny et al., 2006). 

In this study, ARISA profiles were assumed to be 

indicative of bacterial community composition, and 

differences in ARISA profiles were assumed to reflect 

variation in the composition of the respective bacterial 

communities. Although this technique lacks resolution and 

can bias the identi cation of potentially important groups 

across the environment, the data collected allowed us to 

map the co-occurrence of microbial groups within two 

distinct environments separated by more than 3,700 km 


65

and presenting distinct vegetation cover and climate. On 

the other hand, examples of bacterial endemism have been 

found among many research studies. Fulthorpe et al. (1998) 

found regional endemisim of 3-chlorwobenzoate degrading 

soil bacteria sampled from six geographic regions at the level 

of REP genotype (whole genome ngerprinting), but not at 

the ARDRA (16S rRNA) level. Cho & Tiedje (2000) used the 

same soil collection to isolate widely dispersed uorescent 

Pseudomonads, and also found no geographic pattern at the 

ARDRA level, some at the ITS level, but strong endemicity 

at BOX genotype level. More recently, Wawrik et al. (2007) 

demonstrated the distinctiveness of New Jersey versus 

Uzbekistan actinomycete populations by looking at their 

polyketide synthase (PKS) genes. 

ese studies demonstrate that geographic location and 

environmental conditions exert strong selection pressure on 

species composition. However the Taxonomic units found 

in our work were not extant and ubiquitous; at least 40% of 

them were in fact present in the 21 samples tested. 

Conclusions 

Geographical patters in bacterial community structure were 

detected at broad-spectrum (between samples from di erent 

geographic locations) and specific-spectrum (within 

References 


samples from di erent geographic locations), suggesting 

that microbial communities exhibit biogeographic patterns 

at different scales and that, at least, some taxonomic 

units have a wide distribution. ese preliminary results 

support the idea that “everything is everywhere, but, the 

environment selects”. Larger sampling and more powerful 

approaches would help to resolve the biases in studies 

involving molecular methods to determine the diversity 

of microorganisms and better understand the importance 

of the environmental and spatial factors in driving the 

composition of microbial communities. 


is work was supported by the Fundação de Amparo a 

Pesquisa do Estado do Rio Grande do Sul – FAPERGS 

(grant number 0901855) and the Instituto Nacional de 

Ciência e Tecnologia Antártico de Pesquisas Ambientais 

- INCT-APA (CNPq process no. 574018/2008-5, FAPERJ 

E-26/170.023/2008, the Ministry of Science and Technology, 

and the secretariat for the Marine Resources Interministerial 

Committee (SECIRM). LFW Roesch and LN Lemos receive 

research fellowships from the CNPq (process number 

503370/2009-6). 

Cho, J.C. & Tiedje, J.M. (2000). Biogeography and degree of endemicity of fl uorescent Pseudomonas strains in soil. Applied 

and Environmental Microbiology, 66(12): 5448-56. 

Chow, M.L.; Radomski, C.C.; McDermott, J.M.; Davies, J. & Axelrood, P.E. (2002). Molecular characterization of bacterial 

diversity in Lodgepole pine (Pinus contorta) rhizosphere soils from British Columbia forest soils differing in disturbance 

and geographic source. FEMS Microbiology Ecology, 42(3): 347-357, 2002. 

de Wit, R. & Bouvier, T. (2006). ‘Everything is everywhere, but, the environment selects’; what did Baas Becking and Beijerinck 

really say? Environmental Microbiology, 8(4): 755-8. 

Fisher, M.M. & Triplett, E.W. (1999). Automated approach for ribosomal intergenic spacer analysis of microbial diversity and 

its application to freshwater bacterial communities. Applied and Environmental Microbiology, 65(10): 4630-36. 

Fulthorpe, R.R.; Rhodes, A.N. & Tiedje, J.M. (1998). High levels of endemicity of 3-chlorobenzoate-degrading soil bacteria. 

Applied and Environmental Microbiology, 64(5): 1620-27. 

Hackl, E.; Zechmeister-Boltenstern, S.; Bodrossy, L. & Sessitsch, A. (2004). Comparison of diversities and compositions of 

bacterial populations inhabiting natural forest soils. Applied and Environmental Microbiology, 70(9): 5057-65.

Lamarche, J.; Bradley, R.L.; Hooper, E.; Shipley, B.; Beaunoir, A.M.S. & Beaulieu, C. (2007). Forest fl oor bacterial community 

composition and catabolic profi les in relation to landscape features in Quebec’s Southern Boreal Forest. Microbial 

Ecology, 54(1): 10-20. 

Lomolino, M.V.; Riddle, B.R. & Brown, J.H. (2006). Biogeography. Third edition. Sinauer Associates. 

Martiny, J.B.H.; Bohannan, B.J.M.; Brown, J.H.; Colwell, R.K.; Fuhrman, J.A.; Green, J.L.; Horner-Devine, M.C.; Kane, M.; 

Krumins, J.A.; Kuske, C.R.; Morin, P.J.; Naeem, S.; Ovreas, L.; Reysenbach, A.L.; Smith, V.H. & Staley, J.T. (2006). Microbial 

biogeography: putting microorganisms on the map. Nature Reviews Microbiology, 4: 102-12. 

McGrady-Steed J.; Harris, P.M. & Morin, P.J. (1997). Biodiversity regulates ecosystem predictability. Nature, 390: 162-5. 

Ranjard, L.; Poly, F.; Lata, J.-C.; Mougel, C.; Thioulouse, J. & Nazaret, S. (2001). Characterization of bacterial and fungal soil 

communities by automated ribosomal intergenic spacer analysis fi ngerprints: Biological and methodological variability. 

Applied and Environmental Microbiology, 67(10): 4479-87. 

Wawrik, B.; Kudiev, D.; Abdivasievna, U.A.; Kukor, J.J.; Zystra, G.J. & Kerkhof, L. (2007). Biogeography of actinomycete 

communities and type II polyketide synthase genes in soils collected in New Jersey and Central Asia. Applied and 

Environmental Microbiology, 73(9): 2982-9. 

Yergeau, E.; Bezemer, T.M.; Hedlund, K.; Mortimer, S.R.; Kowalchuk, G.A. & Van Der Putten, W.H. (2010). Infl uences of space, 

soil, nematodes and plants on microbial community composition of chalk grassland soils. Environmental Microbiology, 

12: 2096-106. 


67

3 

CONSERVATION STATUS OF PLANT COMMUNITIES AT 

ULMANN POINT AND COMANDANTE FERRAZ ANTARCTIC 

STATION AREA, ADMIRALTY BAY, KING GEORGE ISLAND, 

ANTARCTICA, BASED ON THE INDEX OF ECOLOGICAL 

SIGNIFICANCE 

Introduction 

Considering the physiognomy and the oral composition 

of plant communities of the Admiralty Bay ice-free areas 

(62° 03’ 40” – 62° 05’ 40” S and 58° 23’ 30”– 58° 24’ 30” W), 

evidence has been found that these communities are very 

di erent from those identi ed in other islands of Maritime 

Antarctica. In Antarctica, summer is short and cold, 

with a maximum temperature around zero °C. During 

this period, permanent rainy periods and strong snow 

precipitations are common (Rakusa-Suszczewski et al., 

1993). For Pereira and Putzke (1994), these conditions, 

along with those imposed by a long dark winter, also create 

limitations for the occurrence of plant species in the region, 


Filipe de Carvalho Victoria 1,* , Margéli Pereira de Albuquerque 2 , Antonio Batista Pereira 2 

1Plants Genomics Center, Universidade Federal de Pelotas – UFPel, Capão do Leão, RS, Brazil 

2Universidade Federal do Pampa – UNIPAMPA, São Gabriel, RS, Brazil 

*e-mail: fi lipevictoria@gmail.com 

Abstract: e aim of this study has been to research the conservation status of the plant communities in ice-free areas of Ullmann 

Point and Comandante Ferraz Antarctic Station vicinities, Admiralty Bay, King George Island, Antarctica. e study started 

with the classi cation and description of the plant communities based primarily on phytosociological and biodiversity data. 

e coverage degree and frequency of each species found was used to calculate the index of ecological signi cance. At Ullmann 

Point 12 plant species were found in higher frequency, when at Ferraz beach only 9 highly frequent species were found. e most 

important species in both studied areas were Sanionia uncinata (Hedw.) Loeske. Syntrichia princeps and Bryum pseudotrichetrum 

were found associated with the most important species at Ullmann Point and Ferraz Station beach respectively. ese results have 

demonstrated the fragility of plant communities in Maritime Antarctica, based on the low frequency and coverage of moss species 

known in this area. 

Keywords: Antarctic mosses conservation, ice-free areas, plant communities 

especially owering plants, since such conditions inhibit 

the reproductive cycle. For this reason, only two species 

of owering plants are known in Antarctica, Deschampsia 

antarctica Desv. and Colobanthus quitensis Kunth. On the 

other hand, moss and lichen species are more adaptable, so 

much so that they have developed well in polar conditions 

being the main representative plants of Antarctica (Putzke 

& Pereira, 2001). e moss formations are most expressive 

and complex in ice-free areas, occurring mainly in tu s 

and carpets at lower levels such as beach and drainage lines 

(Victoria et al., 2009), but moss cushion species can be 

observed on rocky outcrops of marine emerged tablelands

(Schae er, 2004) as well on rocks next to bird colonies 

(Pereira & Puztke, 1994). 

In order to complement the knowledge of plant 

communities in the ice-free areas of Admiralty Bay, 

communities of lichens and mosses observed during a 

phytosociologic study of the region are described. A status 

of conservation of these species based on the coverage 

and frequency of most representative species sampled are 

presented. 


During the 2004/2005 austral summer, plant communities 

in the vicinities of Comandante Ferraz Station, beside the 

Cousteau Whale’s, and at Ullmann Point beach were studied. 

This study started from the phytosociological survey, 

using Braun-Blanquet (1932) quadrats method, adapted 

to Antarctic conditions (Kanda, 1986). A er throwing c.a 

160 quadrats of 25 × 25 cm, within an altitude gradient 

varying from sea level up to about 150 m high. Whenever 

possible, samples of lichens with highly developed ascomas 

(presence of apothecia or perithecia) were made. Saxicolous 

species were collected with the help of a geologists’ hammer, 

and muscicolous and/or terricolous species, with the help 

of a knife, to guarantee that individuals would collect 

them with some substrate. High coverage moss species or 

dominant lichen species were also sampled. Identi cation 

of the species was based on the work of Redon (1985), 

Ochyra (1998), Pereira and Putzke (1994) and Putzke and 

Pereira (1990). e index of ecological signi cance (IES) 

was calculated based in the Lara and Mazimpaka (1998), as 

follows: IIE = F(1 + C), where: F is the relative frequency of 

the species in the area or habitat (generated by the number 

of occurrences (x) divided by the total number of samples 

considered (n): F = 100x/n. C is the average coverage of 

the specie in the samples: C = Σ(ci)/x; where ci is the cover 

class and x, the number of sampling points in which the 

species occur. 


It was possible to verify the occurrence of 4 moss species in 

the adjoining area of Comandante Ferraz Station (Table 1) 

and 9 moss species at Ullmann Point beach (Table 2) such 

as the most frequent species considering the 58 moss species 

found in Admiralty Bay. e lichen Psoroma cinnamomeum 

Malme was veri ed as being the most frequent lichen. e 

two owering plants know in Antarctica were observed at 

lower frequencies when compared with the most frequent 

species found in both studied areas. 

However with the IES of each species it was possible to 

verify that most of them can be easily seen in the area, in 

despite of the lower coverage (IES > 50). Compared with 

other initiatives these two areas are less complex, with a 

lower number of species in higher abundance and coverage 

(Ochyra, 1998; Victoria et al., 2009). ese results can be 

representative of the sensibility of these plant communities 

to environmental changes, since this species was found in 

Table 1. The most frequent species found in Comandante Ferraz Antarctic Station vicinities. C = average coverage. F = frequency for each species in all 

samples. IES= Index of ecological signifi cance. 

Species C ( * ) F (%) IES 

Bryum pseudotriquetrum (Hedw.) Schwaegr. 1 68.18 136.36 

Hennediella heimii (Hedw.) Zand. 0.28 22.72 27.89 

Syntrichia saxicola (Card.) Zand. 0.09 9.09 9.91 

Sanionia uncinata (Hedw.) Loeske 3.59 95.45 438.22 

Deschampsia antarctica Desv. 0.36 36.36 49.58 

Colobanthus quitensis Kunth. 0.09 13.63 14.87 

Leptogium sp. 0.02 4.54 4.64 

Psoroma cinnamomeum Malme 0.18 18.18 21.48 

*Coverage classes - 1(1-10%), 2(11-25%), 3(26-50%), 4(51-75%) and 5(75-100%). 


69

Table 2. The most frequent species found at Ulmann Point. C = average coverage. F= frequency for each species in all samples. IES= Index of ecological 

signifi cance. 

small patches and populations, indicating lower resistance 

and resilience. Whenever the relationships within the 

organisms was reduced (Schaefer et al. 2004), the impacts 

in these species were subject to irreversibility (Victoria & 

Pereira, 2007). 

For example, we can cite the most frequent Bryum 

species found. Bryum pseudotriquetrum (Hedw.) Schwaegr. 

and Bryum orbiculatifolium Card. Et Broth. Depends 

on ice melting found in the water lines in the austral 

summer (Allison & Lewis-Smith 1973; Kanda 1986). 

B. pseudotrichetrum showed a high abundance in our 

samples and can be considered a lower degree threatened 

species compared to B. orbiculatifolium. The size of 

B. pseudotrichetrum population provides a better response 

in the case of fast environmental changes, perhaps indicating 

better adaptative success related of a higher coverage level 

(Lewis-Smith 2001). 

Ochyra (1998) reports Sanionia uncinata (Hedw.) Loeske 

and Polytrichastrum alpinum (Hedw.) G.L.Smith as the most 

abundant moss species in the Maritime Antarctic, being 

at lower risk of threats compared with other moss species 

in this area. For Ullmann Point and Comandante Ferraz 

beach the latter was also observed only for rst species. S. 

uncinata occurred in higher frequency and coverage, in the 


Species C (*) F(%) IES 

Bryum dichotomum Hedw. 0.03 5 5.18 

Bryum orbiculatifolium Card. Et Broth. 0.15 15 17.25 

Bryum pseudotriquetrum (Hedw.) Schwaegr. 0.63 32.5 53.21 

Brachythecium austrosalebrosum (C. Muell.) Kindb. 0.05 5 5.25 

Polytrichastrum alpinum (Hedw.) G.L.Smith 0.27 17.5 22.31 

Syntrichia princeps (De Not.) Mitt 0.91 60 114.75 

Syntrichia saxicola (Card.) Zand. 0.17 10 11.75 

Sanionia uncinata (Hedw.) Loeske 1.82 70 197.75 

Deschampsia antarctica Desv 0.57 40 63 

Polytrichum juniperinum Hedw 0.07 7.5 8.06 

Colobanthus quitensis Kunth. 0.21 22.5 27.28 

Psoroma cinnamomeum Malme 0.41 30 42.37 

*Coverage classes - 1(1-10%), 2(11-25%), 3(26-50%), 4(51-75%) and 5(75-100%). 

proximity of Ferraz this species being the most frequent 

in the plant communities, occurring in 95% of samples 

and having an average of 50% coverage in each sample. At 

Ullmann Point this species occurs with a 70% frequency 

and has a mean coverage of 25% per sample. For this 

reason this species can be considered the most important 

in studied plant communities (IES/Ferraz = 438.22; 

IES/Ullmann = 197.75). ese results were also encountered 

by Victoria and Pereira (2007) for the Arctowski region 

and Hennequin Point (IES = 215.20 and IES = 153.54, 

respectively). P. alpinum was found in other areas of 

Admiralty Bay being the second most important species 

(Ochyra, 1998; Victoria & Pereira 2007; Victoria et al., 

2009), but in the present study the latter did not occur, in 

that these species were encountered only at Ullmann Point 

in a lower frequency (17%). B. pseudotrichetrum, for Ferraz 

beach, and Syntrichia princeps (De Not.) Mitt, for Ullmann 

Point were recorded as the second most important species 

for each area (IES = 136.36 and IES = 114.75, respectively), 

perhaps because of the lower complexity of these two plant 

communities sampled, whereby these communities consist 

mainly of fell eld species, like these two species mentioned 

(Victoria et al., 2004).

The others frequent moss species were found as 

important species for the plant communities at Hennequin 

Point and in the Arctowski region (Victoria & Pereira, 

2007), except for Hennediela heimii (Hedw.) Zand, which 

was encountered in higher frequency in Ferraz beach in the 

present study compared with other areas. 

All moss species, as well as the land biota found 

in Admiralty Bay, were directly and indirectly a ected 

by human presence. e maintenance of scientists and 

military personnel inside and outside of research stations, 

shelters and camps, involves a high consumption of fossil 

References 

combustibles and produces high amounts of residues, 

creating unclear impacts in Antarctica wildlife (ATCPs 

1993; Olech 1996). 

is study demonstrates the fragility of moss formation 

in the in ice-free areas of Maritime Antarctica. A descriptive 

data bank can collaborate towards the continued monitoring 

of plant communities, contributing to the conservation of 

plant species in Admiralty Bay area. e phytossociological 

studies can contribute to the management of scienti c 

activities related to the Brazilian Antarctic Program. 

Allison, J.S. & Lewis-Smith, R.I. (1973). The vegetation of Elephant Island, South Shetland Islands. British Antarctic Survey 

Bulletin, 33-34: 185-212. 

ATCPs. (1993). Protocol on Environmental Protection to the Antarctic Treaty, with Annexes. Polar Record, 29(170): 256-75. 

Braun-Blanquet, J. (1932). Plant Sociology: The study of plant communities. New York, McGraw-Hill. 

Kanda, H. (1986). Moss communities in some ice-free areas along the Söya Coast, East Antarctica. Memoirs of Natural. 

Institute of Polar Research, Special Issue. 44: 229-40. 

Lara, F. & Mazimpaka, V. (1998). Sucession of epiphytic bryophytes in a Quercus pyrenaica forest from Spanish Central 

Range (Iberian Peninsula). Nova Hedwigia, 67: 125-38. 

Lewis-Smith, R. I. (2001). Plant Colonisation Response to climate change in the Antarctic. Folia Fac. Sci. nat. Univ. Masarykianae 

Brunensis, Geográica, 25: 19-33. 

Ochyra, R. (1998). The moss ora of King George Island Antarctica. Polish Academy of Sciences. Cracow. 

Olech, M. (1996). Human impact on terrestrial ecosystems in West Antarctica. Proccedings of NIPR Symposium on Polar 

Biology, 9: 299-306. 

Pereira, A.B. & Putzke, J. (1994). Floristic composition of Stinker Point. Elephant Island, Antarctica. Korean Journal of Polar 

Research, 5(2): 37-47. 

Putzke, J. & Pereira, A.B. (1990). Mosses of King George Island. Pesquisa Antártica Brasileira. 2(1): 17-71. 

Putzke, J. & Pereira, A.B. (2001) The Antarctic Mosses with special reference to the Shetland Island. Canoas, Ed. ULBRA. 

Rakusa-Suszczewski, S.; Mietus, M. & Piasecki, J. (1993). Weather and Climate. In: Rakusa-Suszczewski, S. (Ed.) The 

Maritime Antarctic Coastal Exosystem of Admiralty Bay, Departamente of Antarctic Biology, Polish Academy of Sciences. 

Redón, J. (1985). Líquenes Antárticos. Instituto Antártico Chileno (INACH), Santiago de Chile. 

Schaefer, C.E.G.R.; Dias, L.E.; Albuquerque, M.A.; Francelino, M.R.; Costa, L.M. & Ribeiro, J.R.E.S. (2004). Monitoramento 

ambiental e avaliação dos impactos nos ecossistemas terrestres da Antártica Marítima: Princípios e aplicação. In: Schaefer, 

C.E.G.R.; Simas, F.N.B.; Filho, M.R.A. (Eds.). Ecossistemas costeiros e monitoramento ambiental da Antártica Marítima. 

Baía do Almirantado, Ilha Rei George. Viçosa, NEPUT. 


71

Victoria, F.C. & Pereira, A.B. (2007). Índice de valor ecológico (IES) como ferramenta para estudos fi tossociológicos e 

conservação das espécies de musgos na Baia do Almirantado, Ilha Rei George, Antártica Marítima. Oecologia Brasiliensis, 

11(1): 50-55. 

Victoria, F.C.; Pereira, A.B. & Costa, D.P. (2004). Characterization of plant communities in ice-free areas adjoining the Polish 

Station H. Arctowski, Admiralty Bay, King George Island, Antarctic. Actas del V° Simposio Argentino y I° Latinoamericano 

sobre Investigaciones Antárticas 2004, Resúmen Expandido N° 202BB. 

Victoria, F.C.; Pereira, A.B. & Costa, D.P. (2009). Composition and distribution of mos formations in the ice-free areas adjoining 

the Arctowski region, Admiralty Bay, King George Island, Antarctica. Iheringia Série Botânica, 64(1): 81-91. 


INSECTICIDAL EFFECTS OF ANTARCTIC 

ALGAE Prasiola crispa EXTRACT IN THE ADULT 

FRUIT FLY Drosophila melanogaster 

Thaís Posser 1,* , Betina Kappel Pereira 2 , Ana Paula Pegoraro Zemolin 1 , Cháriston André Dal Belo 1 , 

Antonio Batista Pereira 3 , Jeferson Luis Franco 1 

1 Centro Interdisciplinar de Pesquisas em Biotecnologia, Universidade Federal do Pampa –UNIPAMPA, São Gabriel, RS, Brazil 

2 Colégio Cristo Redentor, Universidade Luterana do Brasil –ULBRA, Canoas, RS, Brasil 

3 Universidade Federal do Pampa –UNIPAMPA, São Gabriel, RS, Brazil 

*e-mail: thaisposser@unipampa.edu.br 

Abstract: In the present study, we aimed to investigate the toxic e ects of Prasiola crispa extract on a fruit y (Drosophila 

melanogaster) model. Toxicity was assessed as % mortality, negative geotaxis behaviour and acetylcholine esterase (AchE), 

glutathione S-transferase (GST), catalase (CAT) activities as well as glutathione content (GSH) and hydroperoxide formation. 

Administration of algae extract (2 mg/mL) to ies for 24 hours resulted in a massive increase in mortality (7.6 fold increase, 

compared to control). A signi cant increase in climbing performance, indicating an alteration in negative geotaxis behaviour, 

was also observed. e AchE activity was unchanged a er algae extract treatment for 24 hours. However, GST activity was 

signi cantly increased a er Prasiola crispa administration. e CAT activity was signi cantly diminished in ies that received 

algae extract for 24 hours. Glutathione levels and hydroperoxide formation remained unchanged. Our results show for the rst 

time the toxic e ects of an Antarctic algae extract in Drosophila melanogaster. e insecticide action of Prasiola crispa may be 

related to changes on vital antioxidant systems. Further studies are necessary to elucidate the exact mechanisms of toxicity of this 

Antarctic alga to Drosophila melanogaster. 

Keywords: Prasiola crispa, toxicity, Drosophila melanogaster, Antarctica 

Introduction 

e insecticidal properties of a number of plants have been 

investigated for thousands of years, and some of the plants 

can substitute many synthetic means of control (Sujatha, 

2010). In this respect, it is important to emphasize that 

natural agents are environmentally less harmful than 

synthetic pesticides. Moreover, natural agents can act in 

many insects in di erent ways (Sujatha, 2010). 

Prasiola crispa is a terrestrial eukaryotic green alga 

from Antarctica continent. Although there are no studies 

targeting the biological e ects of this algae, interesting 

characteristics, like adhesive properties has been described 

for plant of the genus Prasiola sp. (Mostaert et al., 2006), 

highlighting the biotechnological importance of this 

organism. A study carried out with three Antarctic plant 

species (Deschampsia antarctica Desv., Colobanthus quitensis 

(Kunth) Bartl., and Polytrichum juniperinum Hedw), have 

demonstrated low toxic e ects for mammalian and nonmammalian 

cells, associated with protective e ects against 

UV-induced damage (Pereira et al., 2009). 

It has been recognized that organisms living in Polar 

Regions, are subject to extreme environmental conditions. 

is fact has led to the development of natural strategies 


4 

73

that enable the survival of these organisms under the most 

extreme environmental conditions on Earth. Among these 

strategies of adaptation is the production of photoprotective 

compounds, such as mycosporine-like amino acids, 

scytonemim secreted by cyanobacteria and flavonoids 

secreted by plants (Pereira et al., 2009). is fact emphasizes 

the importance of studies concerning the biological e ects 

of these organisms, which may present in its constitution a 

combination of chemical compounds normally not found 

in other organisms. 


In this respect, the main aim of this study was 

to evaluate the effects of the extract of the terrestrial 

eukaryotic green alga from Antarctica, Prasiola crispa on 

survival of adult D. melanogaster, and in parallel, to verify 

a possible modulation of antioxidant enzymes activity 

and locomotor performance in response to the exposure 

of this organism to the Prasiola crispa extract. e fruit 

y Drosophila melanogaster, belongs to the order Diptera 

and family Drosophilidae. is model is recognized for its 

high sensitivity to toxic substances, thus being considered a 

bioindicator for detection of pollutants and also to test the 

biological action of natural substances. 


Plant material 

Prasiola crispa (Lightfoot) Kützing (1843) was collected 

in the ice-free areas near Arctowski Polish Base Region, 

Admiralty Bay, King George Island (61° 50’ - 62° 15’ S and 

57° 30’ - 59° 00’ W), Antarctica. e plants were dried in 

a dark chamber with circulating air at 40 °C and stored 

in dark bags in a freezer. e dried and powdered plant 

material (about 100 g) was submitted to extraction using 

methanol (powder/solvent ratio = 1:10 w/v) by maceration 

at room temperature. A er 24 hours of extraction the sample 

was ltered through Whatman number 1 lter paper and 

the same plant material was extracted again with another 

1000 mL of methanol. is procedure was repeated for 

3 days, a er which the methanolic solutions were combined 

and evaporated to dryness under reduced pressure by rotary 

evaporator at 40-50 °C to obtain the methanolic extracts. 

Drosophila culture and Prasiola crispa extract 

treatment 

Flies were maintained at 25 °C on a standard diet 

(Golombieski et al., 2008). For P. crispa extract exposition 

experiments, 60 male adult flies were placed in a vial 

containing cotton wool soaked in 2 M sucrose with or 

without dissolved Prasiola crispa extract (2 mg/mL). e 

ies were maintained under these conditions up to 24 hours. 

Finished the period of treatment, 15 individual ies were 

submitted to behavioural test and a total of 45 ies were 

homogenized for biochemical analysis. Each experiment 

was repeated 3 times using di erent y cultures. 

Flies mortality 

Finished the treatments, the number of dead ies were 

counted and plotted as percent of total ies. 

Negative geotaxis and response to ight test 

Locomotor ability was determined though the negative 

geotaxis assay as described by Bland et al. (2009), with some 

modi cations. For the assays, 15 adult ies were anesthetized 

and placed separately in a vertical glass column (length, 

25 cm; diameter, 1.5 cm) (Jimenez-Del-Rio et al., 2010). e 

assays were repeated three times at 1 minute intervals. A er 

30 minutes recovery, individual ies were gently tapped to the 

bottom of the column and the time required to reach 8 cm 

in the columns was registered. To test the response to ight 

of the insects, the ies were gently tapped to the bottom of a 

glass ask. A er 30 seconds, the numbers of ies remaining 

in the base and in the top of the ask were counted. 

Biochemical measurements 

Flies were homogenized in 0.1 M phosphate buffer 

pH 7.0 and centrifuged at 1000 g for 5 minutes (4 °C). 

e supernatant was isolated and an aliquot separated for 

determination of acetylcholinesterase activity, glutathione 

and hydroperoxide content based on protocols previously 

described (Franco et al., 2009). e remaining supernatant 

was then centrifuged at 20,000 g for 30 minutes. e resulted 

supernatant was used for determination of glutathione 

S-transferase (GST) and catalase (CAT) activity according 

to methods described earlier (Franco et al., 2009).

Table 1. Enzyme activities, glutathione and hydroperoxide levels. 

Results 

Treatment of ies with 2 mg/mL of Prasiola crispa extract 

resulted in a substantial increase (7.6 fold increase, p < 0.05) 

in mortality a er 24 hours (Figure 1a). An increase in 

neurolocomotor activity, assessed by negative geotaxis 

behaviour was also observed. In this task, ies that received 

algae extract were signi cantly more e cient (p < 0.05) in 

climbing performance (Figure 1b). Fly response was not 

altered by algae extract administration during 24 hours 

(Figure 1c). 

Acetylcholine esterase activity (AchE), glutathione 

levels (GSH) and hydroperoxide formation (LPO) was 

not changed a er Prasiola crispa extract administration to 

Drosophila melanogaster for 24 hours (Table 1). However, 

it was possible to observe a signi cant increase (p < 0.05) 

in glutathione S-transferase (GST) activity while catalase 

(CAT) was signi cantly inhibited (p < 0.05) in ies treated 

with 2 mg/mL of algae extract (Table 1). 

Discussion 

AchE 

(mU/mg protein) 

GST 


Commercial insecticides and repellents with lower 

mammalian toxicity are desirable and studies focusing the 

CAT 


GSH 

(µmol/mg protein) 

Hydroperoxides 

(nmol/mg protein) 

Control 30.1 ± 5.0 92.9 ± 15.5 159.4 ± 8.3 0.20 ± 0.03 0.26 ± 0.001 

Extract 27.2 ± 0.4 141.1 ± 13.3* 128.2 ± 12.8* 0.23 ± 0.001 0.24 ± 0.004 

Statistical signifi cance was assessed by Student’s t-test. *p


Glutathione S-transferase is an important antioxidant 

enzyme and is involved in phase II detoxi cation systems 

(Sau et al., 2010). e observed increased GST activity 

in Drosophila melanogaster exposed to Prasiola crispa 

extract may be related to an adaptive response related 

to an increased elimination of toxic plant derivatives. 

e inhibition of CAT activity may also be an important 

mechanism of toxicity of the extract, since this enzyme has 

a crucial role in the clearance of hydrogen peroxide from 

cells (Aebi, 1984). e disruption of cell defence antioxidant 

systems has been pointed out as a central mechanism 

of action in a variety of models of investigation of drug/ 

compound toxicity (Franco et al., 2009). 

Conclusion 

In conclusion, our results show preliminary data on the 

insecticidal e ects of Prasiola crispa extract in a Drosophila 

melanogaster model. e exact mechanisms of toxicity 

References 

Aebi, H. (1984). Catalase in vitro. Methods in Enzymology, 105:121-6. 

still remain to be elucidated, however, interaction with 

antioxidant systems may be pointed out as a clue in further 

studies. 

is study comprehends part of the work of Brazilian 

researchers from the “Instituto Nacional de Ciência 

e Tecnologia Antártico de Pesquisas Ambientais - 

INCT-APA” related to Antarctic plant chemistry and its 

biotechnological applications. It is believed that knowledge 

on the biotechnological potentials of Antarctic plants, in 

addition to research on plant/communities biology and 

evolving processes are essential to the preservation of these 

natural resources. 


Authors acknowledge the “Instituto Nacional de Ciência e 

Tecnologia Antártico de Pesquisas Ambientais - INCT-APA”, 

CNPq (574018/2008-5) and FAPERJ (E-16/170.023/2008). 

Bell, A.E.; Fellows, L.E. & Simmonds, S.J. (1990). Natural products from plants for the control of insect pests. In: Hodgson, 

E. & Kuhr, R.J., (Eds.). Safer insecticide development and use. Marcel Dekker. USA. 

Bland, N.D.; Robinson, P.; Thomas, J.E.; Shirras, A.D.; Turner, A.J. & Isaac, R.E. (2009). Locomotor and geotactic behavior 

of Drosophila melanogaster over-expressing neprilysin 2. Peptides 30:571-4. 

Franco, J.L.; Posser, T.; Mattos, J.J.; Trevisan, R.; Brocardo, P.S.; Rodrigues, A.L.; Leal, R.B.; Farina, M.; Marques, M.R.; 

Bainy, A.C. & Dafre, A.L. (2009). Zinc reverses malathion-induced impairment in antioxidant defenses. Toxicology Letters, 

187:137-43. 

Golombieski, R.M.; Graichen, D.A.; Pivetta, L.A.; Nogueira, C.W.; Loreto, E.L. & Rocha, J.B. (2008). Diphenyl diselenide 

[(phse)2] inhibits Drosophila melanogaster delta-aminolevulinate dehydratase (delta-ala-d) gene transcription and enzyme 

activity. Comparative Biochemistry and Physiology - Part C: Toxicology & Pharmacology, 147(2):198-204. 

Jimenez-Del-Rio, M.; Guzman-Martinez, C. & Velez-Pardo, C. (2010). The effects of polyphenols on survival and locomotor 

activity in Drosophila melanogaster exposed to iron and paraquat. Neurochemical Research, 35(2):227-238. 

Kiran, S.R.; Devi, P.S. & Reddy, K.J. (2007). Bioactivity of essential oils and sequiterpenes of Chloroxylon swietenia DC against 

the Helicoverpa armigera. Current Science, 93:544-8. 

Mostaert, A.S.; Higgins, M.J.; Fukuma, T.; Rindi, F. & Jarvis, S.P. (2006). Nanoscale mechanical characterisation of amyloid 

fi brils discovered in a natural adhesive. Journal of Biological Physics, 32(5): 393-401. 

Ndemah, R.; Gounou, S. & Schulthess, F. (2002). The role of wild grasses in the management of lepidopterous stem-borers 

on maize in the humid tropics of Western Africa. Bulletin of Entomological Research, 92(6): 507-19.

Pereira, B.K.; Rosa, R.M.; da Silva, J.; Guecheva, T.N.; Oliveira, I.M.; Ianistcki, M.; Benvegnu, V.C.; Furtado, G.V.; Ferraz, 

A.; Richter, M.F.; Schroder, N.; Pereira, A.B. & Henriques, J.A. (2009). Protective effects of three extracts from antarctic 

plants against ultraviolet radiation in several biological models. Journal of Photochemistry and Photobiology B: Biology, 

96(2):117-29. 

Sau, A.; Pellizzari, T.F.; Valentino, F.; Federici, G. & Caccuri, A.M. (2010). Glutathione transferases and development of new 

principles to overcome drug resistance. Archives of Biochemistry and Biophysics, 500(2): 116-22. 

Sujatha, S. (2010). Essential oil and its insecticidal activity of medicinal aromatic plant Vetiveria zizanioides (L.) against the 

red fl our beetle Tribolium castaneum (Herbst). Asian Journal of Agricultural Sciences 2(3):84-8. 


77

5 


PENGUIN COLONIES AND WEATHER 

IN ADMIRALTY BAY IN A COLDER YEAR 

Maria Virginia Petry 1,* , Rafael Gomes de Moura 1 , Lucas Krüger 1 

1 Laboratório de Ornitologia e Animais Marinhos – LOAM, Universidade do Vale do Rio dos Sinos – UNISINOS, 

São Leopoldo, Rio Grande do Sul, Brazil 

*e-mail: vpetry@unisinos.br 

Abstract: Climate change will a ect many species in the next decades. Antarctic seabirds are of special concern given their 

dependence on the balance of sea ice-caps. e objective of this paper is to present information about weather and penguin 

colonies in the last extreme cold summer of 2009/2010. We veri ed the average temperature in November (beginning of seabird 

breeding) which was lower than for most years since 1987 with a slight tendency to decline, and thus the number of snow days 

was also high in relation to the period average, with a tendency to increase in time. e Adelie Penguin has the biggest colony 

area followed by Chinstrap Penguin, while Gentoo Penguin has the smallest area. As seabirds breed on ice-free areas, the joint 

e ect of lower temperatures and enhanced precipitation in Spring can a ect habitat availability for nesting, potentially disrupting 

reproduction timing and the future breeding population and success. 

Keywords: air temperature, climate change, ice-fre areas, Pygoscelids genus 

Introduction 

Climate change may a ect a great number of species in 

the next decades (Walther et al., 2002; Thomas et al., 

2004). Antarctic seabirds may be particularly sensitive to 

climate change since they rely on sea ice cap dynamics, 

which is the factor behind the Antarctic food web balance 

(Smetacek et al., 1990). e penguins remain on the edge 

of sea ice caps during the winter months, depending on 

the Antarctic resources even then, thus they are still more 

a ected by severe weather variations (Ballerini et al., 2009; 

Dugger et al., 2010) more than ying Antarctic Seabirds 

(Santora et al., 2009). In the last 2009/2010 summer, the 

temperature conditions and ice-free areas were limiting 

factors for most penguin colonies in Admiralty Bay. e 

enhanced snow accumulation, as a consequence of a 

rigorous winter registered by the Instituto Nacional de 

Pesquisas Espaciais (INPE, 2010), lasted until mid-February, 

when most areas were expected to be ice-free. is weather 

phenomenon was characterized by the lowest temperatures 

in the last 40 years (INPE, 2010). e aim of this study is to 

describe this phenomenon and evaluate its potential e ect 

on the area of penguin colonies at Admiralty Bay. 


The study was conducted in all the ice-free areas of 

Admiralty Bay, King George Island, South Shetlands in 

the 2009/2010 summer. e summer was characterized by 

lower temperatures than the average for previous years. e 

average summer temperature in Admiralty bay between 

1987 and 2009 was 1.7 °C, while the average in 2009/2010 

was 0.6 °C (INPE, 2010). e average temperature at the 

beginning of seabird breeding (November) was even lower 

than in most years (Figure 1a), and also snow days were 

relatively high (Figure 1b). e e ect of higher precipitation 

with lower temperatures was the reason for late snow

accumulation. e areas were visited by boat or on foot, 

and all the periphery of penguin colonies were mapped 

through GPS receivers. 

Figure 1 shows that there has been a slight declining 

trend in average temperature since the 80’s, and a slight 

trend of enhancement in the number of days with snow 

precipitation, despite the greater annual variation below 

the average. 

Results 

We found a total of 10 colonies of the three Pygoscelis species: 

Gentoo (P. papua, Figure 2a), Adelie (P. adelie, Figure 2b) 

and Chinstrap (P. antarctica, Figure 2c) (Table 1). Adelie 

Penguins showed the greatest amount of occupied area 

in Admiralty Bay, while Gentoo Penguins occupied the 

smallest amount of area. We found colonies of Gentoo and 

Adelie only at Point omas, while Gentoo occurred in two 

points, Chabrier Rock and Demay Point (Figure 3). 

Discussion 

Our results aim only to describe the colonies during 

the especially cold weather event without assuming any 

trend, but the distribution of colonies and their analyzed 

dimensions in the last summer have provided strong 

indications of how penguins will answer to predicted 

weather in Admiralty Bay. e ice-free lands are the most 

Temperature on 

beginning of season (°C) 

Snow day on 

beginning of season 

2 

1 

0 

–1 

–2 

–3 

20 

15 

10 

5 

0 

1987 

Figure 1. Weather at the beginning of the seabird breeding season 

(November) in Admiralty Bay: monthly average temperature (a) and 

cumulative number of days with snow precipitation. The average 

temperature in these years is –0.1 °C ± 1.2, and the average snow days 

are 11.9 ± 5. Thus, 2009/2010 summer was a relatively cold season 

(–2.2 °C) with snow days above average (17). 

a b c 

Figure 2. Pygoscelids species that breed at Admiralty Bay: (a) Gentoo P. papua, (b) Adelie P. adeliae, and (c) Chinstrap P. antarctica. 

1989 

1982 

1984 

1989 

1988 

2000 

Year 

2002 

2004 

2006 

2008 


a 

b 

2010 

79

used locations by these species, and the joint e ect of greater 

precipitation and lower temperatures has an immediate 

disrupting e ect on the future reproduction of these species 

of penguin. We can not justify the e ects of temperature on 

population trends, but the e ect of weather is indicative, 

veri ed by climate research (Doran et al., 2002; Turner et al., 

2005), related to penguins. e several research studies 

Table 1. Number of Breeding Groups and total colony areas of each 

Pygoscelis species at Admiralty Bay in the 2009/2010 breeding season. 

Penguin 

species 


Number of 

breeding groups 

Total area 

(m 2 ) 

Chinstrap 7 2469 

Adelie 1 7704 

Gentoo 2 47 

Figure 3. Penguin Colonies at Admiralty Bay in the 2009/2010 breeding season. 

indicate a cooling in Antarctica in di erent seasons, and 

although the peninsula tends to warming, South Shetlands 

average temperature, in particular, is showing a slight decline 

in Spring. is season is fundamental for breeding seabirds 

as it is the moment they start reproduction, choosing nesting 

places and re-establishing their colonies. Seabirds rely on the 

ice-free areas available at this time and lack of availability 

can delay the start of reproduction lowering the average 

success of a colony (Barbraud &Weimerskirch, 2006). Also, 

late snow-storms and cold fronts can cause greater egg loss 

and nest abandonment by adults (Mallory et al., 2009), 

as observed in our eld samples at Admiralty Bay and in 

Elephant Island as well. Other studies provide evidence of 

the negative e ect of enhanced cold for penguins, a ecting 

success, adult survival and size of the breeding population

(Croxall et al., 2002; Ballerini et al., 2009; Lescröel et al., 

2009; Dugger et al., 2010). 

Conclusion 

Extreme weather events can potentially affect seabird 

population parameters and colony dynamics. As is expected 

by weather in Admiralty Bay, the possible scenarios are not 

favourable in an a priori assumption. Our analysis must in 

the future include the timing between ice-free areas and 

penguin breeding, plus the variation of colony areas and 

References 

breeding populations to ice and temperature variation as 

well; in this way enabling that our expectations can be tested. 


Brazilian data sampling received support from INCT- 

APA (CNPq Process no. 574018/2008-5, FAPERJ 

E-26/170.023/2008), WCS (Wildlife Conservation Society) 

and supported by the Ministry of Environment, Ministry of 

Science and Technology, and the Secretariat for the Marine 

Resources Interministerial Committee (SECIRM). 

Ballerini, T.; Tavecchia, G.; Olmastroni, S.; Pezzo, F. & Focardi, S. (2009). Nonlinear effects of winter sea ice on the survival 

probabilities of Adélie Penguins. Oecologia, 161: 253-65. 

Barbraud, C. & Weimerskirch, H. (2006). Antarctic birds breed later in response to climate change. PNAS, 103: 6248-51. 

Croxall, J.P., Trathan, P.N.; & Murphy, E.J. (2002). Environmental change and Antarctic seabird populations. Science, 

297:1510–14. 

Doran, P.T.; Priscu, J.C.; Lyons, W.B.; Walsh, J.E.; Fountain, A.G.; McKnight, D.M.; Moorhead, D.L.; Virginia, R.A.; Wall, 

D.H.; Clow, G.D.; Fritsen, C.H.; McKay, C.P. & Parsons, A.N. (2002). Antarctic climate cooling and terrestrial ecosystem 

response. Nature, 415: 517- 20. 

Dugger, K.M.; Ainley, D.G.; Lyver, P.O´B.; Barton, K. & Ballard, G. (2010) Survival differences and the effect of environmental 

instability on breeding dispersal in an Adélie Penguin meta-population. PNAS, 107: 12375-80. 

INPE (2010) Instituto Nacional de Pesquisas Espaciais. www.antartica.cptec.inpe.br; accessed in: 04/27/2010. 

Lescroël, A.; Dugger, K.M.; Ballard, G.; & Ainley, D.G. (2009). Effects of individual quality, reproductive success and 

environmental variability on survival of a long-lived seabird. Journal of Animal Ecology, 78: 798-806. 

Mallory, M.L.; Gaston, A.J.; Forbes, M.R. & Gilchrist, H.G. (2009). Infl uence of weather on reproductive success of northern 

fulmars in the Canadian High Arctic. Polar Biology, 32: 529-538. 

Santora, J.A.; Reiss, C.S.; Cossio, A.M. & Veit, R.R. (2009). Interannual spatial variability of krill (Euphausia superba) infl uences 

seabird foraging behavior near Elephant Island, Antarctica. Fisheries Oceanography, 18(1): 20-35. 

Smetacek, V.; Scharek, R. & Nöthig, E. M. (1990). Seasonal and regional variation in the pelagial and its relationship to 

the life history cycle of krill. In: Kerry, K.R. & Hempel, G. Antarctic Ecosystems: ecological change and conservation. 

Springer-Verlag, Berlin. 

Thomas, C.D.; Cameron, A.; Green, R.E.; Bakkernes, M.; Beaumont, L.J.; Collingham, Y.C.; Erasmus, B.F.N.; Siqueira, M.F.; 

Grainger, A.; Hannah, L.; Hughes, L.; Huntley, B.; Van Jaarsveld, A.S.; Midgley, G.F.; Miles, L.; Ortega-Huerta, M.A.; 

Peterson, A.T.; Phillips, O.L. & Williams, S.E. (2004). Extinction risk from climate change. Nature, 427: 145- 148. 

Turner, J.; Colwell, S.R.; Marshall, G.J.; Lachlan-Cope, T.A.; Carleton, A.M.; Jones, P.D.; Lagun, V.; Reid, P.A. and Iagovkina, S. 

(2005). Antarctic climate change during last 50 years. International Journal of Climatology, 25: 279-294. 

Walther, G.R.; Post, E.; Convey, P.; Menzel, A.; Parmesan, C.; Beebee, T.J.C.; Fromentin, J.M.; Hoegh-Guldberg, O. & Bairlein, F. 

(2002). Ecological responses to recent climate change. Nature, 416: 389-95. 


81

6 DISTANCE 


ASSOCIATIONS AMONG ANTARCTIC AND 

SUBANTARCTIC SEABIRDS 

Maria Virginia Petry 1,* , Elisa de Souza Petersen 1 , Lucas Krüger 1 

1 Laboratório de Ornitologia e Animais Marinhos – LOAM, Universidade do Vale do Rio dos Sinos – UNISINOS, São Leopoldo, RS, Brazil 

*e-mail: vpetry@unisinos.br 

Abstract: Seabirds seek environmental cues for nd food at sea. One of the cues is the behaviour of other seabirds. e present 

study aims to demonstrate through spatial correlation analysis, the distance at which species of seabirds are able to associate. 

Seabird counting was conducted onboard the Brazilian Polar Ship NPo Almirante Maximiano between Southern Argentina and 

South Shetland Islands, Antarctica. Birds were counted during 10 minutes censuses at intervals of one and half hours during 

the whole day. Abundances of Daption capense, Macronectes giganteus, alassarche melanophrys, Petrels and Albatrosses in 

spatial correlations were used. We tested if there were any intra-speci c associations (autocorrelation) and/or any inter-speci c 

associations (cross-correlation). e coe cients of auto and cross-correlation were used in linear regression with average distance 

lags to estimate the distance at which seabirds in uence each other. All the Autocorrelation coe cients of the evaluated species 

were negatively related with lag average distance, that is, the further away the seabirds are the less they are able to detect each 

other. Even so, there were marked di erences among species, since R² varied from 0.3 (all petrels added together) and close to 

0.9 for Southern Giant Petrels. But the inter-speci c association does not appear to be related with distance, since from the nine 

possible pairs, for only three, were the spatial cross-correlations related with the distance. 

Keywords: Antarctic seabirds, environmental cues, feeding behaviour 

Introduction 

Seabirds develop mechanisms to override the di culty for 

food detection imposed by the homogeneity of the sea. 

e mechanisms rely on detection using olfactive cues 

(Nevitt, 2008), and sight cues, despite the apparent absence 

of detectable spatial heterogeneity on the ocean surface 

(Silvermann et al., 2004). Seabirds use morphological and 

physiological mechanisms to search for odours at over 

great distances (Nevitt, 1999; Nevitt, 2008; Van Buskirk & 

Nevitt, 2008). Greater and more aggressive seabirds may 

detect odours that indicate foraging by other seabirds, 

while smaller species detect the krill foraging upon 

phytoplankton (Nevitt, 2008). Seabirds respond to low 

prey visual detectability by monitoring other individuals 

for optimizing food detection. Veit (1999) veri ed that 

Cape Petrels Daption capense and Southern Giant Petrels 

Macronectes giganteus change ight pattern when they 

nd food spots, they continuously change ight direction 

and they land on the water. Hence individuals associate 

to enhance their individual capacity for food searching 

on wide and homogenous landscapes (Silvermann & Veit, 

2001).Both the sensorial strategies (olfaction and sight) 

are simultaneously applied (Nevitt, 2008). Despite the 

evidence for such multimodal hypothesis for foraging, 

the olfaction strategy is more testable to test. Diomedea 

albatrosses, however, o en use visual searching, since they 

are less attracted to odours than other species (Nevitt et al., 

2004; Mardon et al., 2010). Silvermann et al., (2004) 

points out there is a lack of information describing seabird

association feeding flocks, and data of how seabirds 

search for prey at sea is scarce. Hence, the present study 

aims to demonstrate the distances that seabird species are 

able to associate, and demonstrate the distances detected 

when seabirds are involved in intra and/or interspeci c 

associations. e way seabirds are engaged in associations 

have consequences on distribution, food detection and, 

hence, on adult survival, an important demographic 

parameter for seabird populations. 


Seabird counting was conducted aboard the Brazilian Polar 

Ship NPo Almirante Maximiano in October 2009. Seabirds 

were counted during the ship’s deployment between southern 

Argentina and South Shetlands, Antartica, including here 

Drake Passage. Birds were counted during 10 minutes 

censuses at intervals of one and half hours during the whole 

day, using the ship’s side opposed to the sun. Ship-Following 

birds were excluded from the analysis. Abundances of 

Daption capense (Cape Petrel), Macronectes giganteus 

(Southern Giant Petrel), alassarche melanophrys (Black 

Browed Albatrosses), Petrels and Albatrosses were used 

in spatial correlations. Additive Ln transformations were 

conducted before running the spatial correlations. We tested 

if there were intra-speci c association (autocorrelation) 

and inter-specific association (cross-correlation). The 

coe cients of auto and cross-correlation were used in linear 

regression with average distance lags to estimate the distance 

seabirds in uence one another. 

Results 

All the Autocorrelation coe cients of the evaluated species 

were negatively related with lag average distance, that is, the 

farther the seabirds are from each other the less they are able 

to detect each other. Although there were marked di erences 

among species, since R² varied from 0.3 (all petrels added 

together) and close to 0.9 for Southern Giant Petrels 

(Table 1, Figure 1). e Southern Giant Petrels seems to be 

the species that is able to detect its own species behavior at 

long distances, followed by Albatrosses, and Cape Petrels 

who seem to be limited to smaller distances (Table 1). 

But the inter-speci c association does not appear to be 

related with distance, since from the nine possible pairs, 

the spatial cross-correlations related with the distance 

only for three species. ey were Cape Petrels and Black 

Browed Albatrosses, Cape Petrels and Albatrosses, Black 

Browed Albatrosses and Petrels (Figure 2), all pairs with 

low R-squares (Table 2). is indicates seabirds may opt 

for use of their own species as sight cues when foraging at 

greater distances, while they may use other species as cue 

when they are near available. 

Discussion 

Greater associations occur among individuals from the 

same species, which has also been established in other 

studies (Silvermann & Veit, 2001; Silvermann et al., 

2004). Silvermann et al., (2004) showed that albatrosses 

are indicators of environmental cues for other species by 

their conspicuousness. e latter has not been entirely 

discarded from our results since the greater inter-speci c 

correlations were those in which Albatrosses were involved. 

Table 1. R², P and equation parameters (a and b) of linear regression Between Autocorrelation coeffi cient and estimated average lag distance, for each 

seabird species between Argentina and South Shetlands Island. 

Especies R² P A B 

Cape Petrel 0.34 0.018 0.902 –0.108 

Black Browed Albatross 0.551 0.001 1.123 –0.132 

Southern Giant Petrel 0.857

The association between Cape Petrels and Albatrosses 

suggests the Black Browed Albatross is a major contributor, 

mainly due to its abundance in the sampled region. On the 

other hand, some cross-correlation tended to be negative 

(however non-signi cant), and an indication that there is 

a certain level avoidance between some species, i.e. Cape 

Petrel and other Small Petrels do not seem to interact 

with Giant Petrels, a potential predator, in accordance 

with the available literature (Silvermann & Veit, 2001), 

Figure 1. Spatial Autocorrelation coeffi cients in response to estimated 

average lag distance for species. Cape Petrels (CP), Black Browed 

Albatrosses (BBA), Southern Giant Petrel (SGP), Sum of Albatrosses 

(ALB) and sum of Petrels (PTR). 

Table 2. R², P and equation parameters (a and b) of linear regression Between cross-correlation coeffi cient and estimated average lag distance, for each 

pair of seabird species between Argentina and South Shetland Island. The equation parameters presented are from signifi cant regressions with R² greater 

than 0.2. 


which is even found in the olfactory strategies adopted by 

smaller species (Nevitt, 1999; Nevitt et al., 2004).Although, 

available literature about sight association between seabirds 

sampled mainly marine areas close to breeding colonies 

within the breeding season when the birds are engaged in 

breeding activities (Silvermann et al., 2004), our sample 

was madeat the beginning of breeding season when 

most birds were just starting to breed. e energy inputs 

required at the peak of reproduction justi es a change in 

Figure 2. Spatial cross-correlation coeffi cients in response to estimated 

average lag distance for pairs of species. Cape Petrels and sum of 

Albatrosses (CP-ALB), Cape Petrel and Black Browed Albatrosses 

(CP-BBA), Black Browed Albatrosses and sum of other Albatrosses 

(BBA-ALB). 

Pairs R² P A B 

Cape Petrels and other Petrels 0.054 0.195 - - 

Cape Petrels and Southern Giant Petrels 0.04 0.265 - - 

Cape Petrels and Black Browed Albatrosses 0.297 0.001 0.476 –0.039 

Cape Petrels and Albatrosses 0.351

the foraging habits of seabirds (Markones et al., 2010). e 

interaction di erences may also exist as intrinsic factors 

of the communities as a response to abiotic gradients in 

the hydrographic, bathymetric and climatic characteristics 

(Woehler et al., 2010). Yet our responses suggest similarities 

with Silvermann et al. (2004). 

Due to restrictions in segregation of sampling space 

and time, in order that our model could be validated it is 

necessary to inform that in the span of a short time interval 

(up to 24 hours), one individual remained in a similar 

latitude, that is, its position being able to vary longitudinally, 

just because our samples were spatialized in a latitudinal 

gradient. Hyrenbach et al. (2007) demonstrates that between 

a set of spatial variables, there is an association of many 

species with longitudinal gradients. 

Associations may therefore be an important process 

in the foraging behaviour, and so the effect on the 

foraging success is obvious. e successful detection of 

food will allow a bird to ful l its energy requirements 

(Markones et al., 2010) and survive. Adult survival is the 

most important demographic parameter driving population 

dynamics of seabirds (Rolland et al., 2009). 

By accepting that seabirds are strongly associated with 

productive ocean currents (Bost et al., 2009), our model 

References 

can be considered valid. In this case, the area we sampled is 

crossed by the Antarctic Circumpolar Current, suggesting 

the longitudinal movements of the seabirds. 

Conclusion 

e association between birds in open sea is a sparsely 

explored eld of research in ornithology. ere are few 

evaluations of seabird species association related to sight, 

principally in the pelagic environment, and the e orts on the 

theme are justi ed. On the other hand, the relation of birds 

regarding weather and productivity as a response to climatic 

changes is an actual and expanding topic in marine ecology. 

Further research on the deviation of bird associations as a 

response to the biotic and abiotic environment would allow 

a broader understanding of the changes on the Antarctic 

Environment. 


Brazilian data was provided through projects nanced by 

INCT-APA (CNPq Process no. 574018/2008-5, FAPERJ 

E-26/170.023/2008), and supported by the Ministry of 

Environment, Ministry of Science and Technology, and 

the Secretariat for the Marine Resources Interministerial 

Committee (SECIRM). 

Bost, C.A.; Cotté, C.; Bailleul, F.; Cherel, Y.; Charassin, J.B.; Guinet, C.; Ainley, D.G. & Weimerskirch, H. (2009). The importance 

of oceanographic fronts to marine birds and mammals of the southern ocean. Journal of Marine Systems, 78: 363-76. 

Hyrenbach, K.D.; Veit, R.R.; Weimerskirch, H.; Metzl, N. & Hunt, G.L. (2007). Community structure across a large-scale 

ocean productivity gradient: Marine bird assemblages of the Southern Indian Ocean. Deep Sea Research I, 54: 1129-45. 

Mardon, J.; Nesterova, A.P.; Traugott, J.; Saunders, S.M. & Bonadonna, F. (2010). Insight of scent: experimental evidence of 

olfactory capabilities in the wandering albatross (Diomedea exulans). The Journal of Experimental Biology, 213: 558-63. 

Markones, N.; Dierschke, V. & Garthe, S. (2010). Seasonal differences in at-sea activity of seabirds underline high energetic 

demands during the breeding period. Journal of Ornithology, 151: 329-36. 

Nevitt, G. A. (2008). Sensory ecology on the high seas: the odor world of the procellariiform seabirds. The Journal of 

Experimental Biology, 211: 1706-13. 

Nevitt, G.; Reid, K. & Trathan, P. (2004). Testing olfactory foraging strategies in an Antarctic seabird assemblage. Journal of 

Experimental Biology, 207: 3537-44. 

Nevitt, G. (1999). Olfactory foraging in Antarctic seabirds: a species-specifi c attraction to krill odors. Marine Ecology Progress 

Series, 177: 235-41. 


85

Rolland, V.; Nevoux, M.; Barbraud, C. & Weimerskirch, H. (2009) Respective impact of climate and fi sheries on the growth 

of an Albatross population. Ecological applications 19: 1336-46. 

Silvermann, E.D.; Veit, R.R. & Nevitt, G.A. (2004). Nearest neighbors as foraging cues: information transfer in a patchy 

environment. Marine Ecology Progress Series, 277: 25-35. 

Silvermann, E.D. & Veit, R.R. (2001). Association among Antarctic seabirds in mixed-species feeding fl ocks. Ibis, 143:51-62. 

Van Buskirk, R.W. & Nevitt, G.A. (2008). The infl uence of developmental environment on the evolution of olfactory foraging 

behavior in procellariiform seabirds. Journal of Evolutionary Biology, 21: 67-76. 

Veit, R.R. (1999). Behavioral responses by foraging petrels to swarms of Antarctic krill Euphausia superba. Ardea, 87: 41-50 

Woehler, E. J.; Raymond, B.; Boyle, A.; & Stafford, A. (2010). Seabird assemblages observed during the Broke-west survey 

of the Antarctic coastline (30°E-80°E), January – March 2006. Deep-Sea Research II, 57: 982-91. 


TOPOGRAPHICAL CHARACTERISTICS USED BY 

SOUTHERN GIANT PETREL Macronectes giganteus 

AT STINKER POINT, ELEPHANT ISLAND 

Maria Virginia Petry 1,* , Lucas Krüger 1 , Rafael Gomes de Moura 1 



* e-mail: vpetry@unisinos.br 

Abstract: e choice of breeding site is important for a seabird with consequences on the successful raising of its chicks. Seabirds 

may choose a breeding site taking into account many environmental and biological factors. is study aims to test the association 

of Southern Giant Petrel nests with topographical parametersat Stinker Point, Elephant Island. 33 Southern Giant Petrel nests 

were identi ed using a GPS receptor, and generated 33 random points. e points were plotted on a raster DEM and variables 

were extracted. We veri ed the nests were associated with terrain slope and altitude, and that Petrels were using the intermediary 

elevations (below 90 m) in plain terrains at Stinker Point. As there are also other variables that can in uence habitat use, further 

analysis is needed to establish the exact role of topography on nesting habitat selection. 

Keywords: digital elevation model, habitat selection, habitat use, nesting 

Introduction 

Habitat selection is a hierarchical process of behavioural 

responses that result in the disproportional use of one or 

few habitat attributes in relation to others, such di erences 

in use may positively a ect the breeding success (Jones, 

2001). Decisions on which habitat is preferable for a 

bird are in uenced by many parameters of the chosen 

location itself and by parameters of the populations and 

communities occupying them, habitat includes as broad 

parameters as size, quality, structure, accessibility, resource 

availability and so on, while population and communities 

impose that birds make choices to avoid competition and 

predation (Guthrie & Moorhead, 2002). For a seabird, the 

choice of nesting ground plays a fundamental role on the 

reproductive success, most species breed in colonies with 

a hundred to a thousand individuals, but the only resource 

for wich they compete in colonies is area. Choosing a good 

place for nesting implies in occupying places protected from 

wind, snow, from excessive or insu cient insulation, and 

protection from predators (Danchin & Wagner, 1997). Birds 

may use the information of conspeci c success for choosing 

their own nesting site, it is, the presence of an experienced 

breeder in one site is the indicative that this site can provide 

suitable habitat for reproduction (Forbes & Kaiser, 1994), 

so, thus, enhancing the importance of local characteristics 

from the analytical point of view.The objective of the 

present paper is to evaluate topographical characteristics to 

which Southern Giant Petrels are nest-associated at Stinker 

Point, Elephant Island, in an attempt to understand factors 

explaining colony distribution. 


e study was conducted at Stinker Point, Elephant Island, 

South Shetland Island on the austral summer of 2009/2010. 

At Stinker point there are two main colonies of Southern 


7 

87

Giant Petrel (SGP), and during this season 931 breeding 

pairs were counted. We accompanied 33 nests of SGP which 

adults were incubating in December 2009. We marked the 

georreferences of the 33 nests with a GPS receptor. Random 

points were generated through random function using 

Microso O ce Excel 2007. e random points were used 

for accessing the entire variation of topography a priori 

available to birds. A Digital Elevation Model (DEM) was 

elaborated from an altimetry satellite image through Arc- 

Gis So ware (Figure 1). e DEM allowed us to extract the 

following topographical parameters: Elevation (meters), 

Slope (terrain inclination), and Aspect (direction of terrain 

inclination). To evaluate the association of nests with the 

topographical parameters we used Principal Component 

Analysis. 


Results 

Figure 1. Stinker Point DEM, Elephant Island, classifi ed in elevation intervals, with sampling points plotted. 

e SGPs nested at Stinker Point in areas from 13 to 86 metres 

above sea level with terrain face directed from South (180°) 

to Southwest (240°) and Slope variation between 0.006° and 

0.021° (Table 1). e Principal Component Analysis resulted 

in three components (Table 2), both Component 1 and 

Component 2 explained 76% of data variance. Component 

1 is explained by Elevation and Slope, while Component 2 

is explained by Aspect (Table 3). e PCA shows that the 

SGPs were breeding in a habitat that was a fraction of the 

potentially available area at Stinker Point, that is, the nests 

represented only a small group in the middle of the random 

points (Figure 2). 

Two distinct groups existed within the nests, however, 

one occupied the South face (negative association

Table 1. Descriptive Statistics of Topographical parameters. 

Parameters Range Minimum Maximum Mean Std. Deviation 

Elevation (m) 72.40 13.77 86.17 45.38 18.96 

Slope (°) 0.02 0.006 0.021 0.013 0.01 

Aspect (°) 59.04 180.00 239.04 209.78 23.02 

Table 2. Eigenvalue and percentage of variance explained by the three 

Principal Components (PC). 

with Component 2), and the other Southwest (positive 

association with Component 2). Component 1 revealed 

that both groups were established at lower Elevations and 

Lower Slopes, however, South groups tended to occur in 

small numbers athigh elevations and ata fewer number of 

the smaller slopes than the Southwest group (Figure 2). 

Discussion 

PC Eigenvalue % 

1 1.26 42.06 

2 1.03 34.18 

3 0.71 23.75 

Table 3. Correlation of each topographical variable with the Principal 

Components. 

Variable PC1 PC2 PC3 

Aspect –0.14 0.96 0.26 

Elevation 0.81 –0.13 0.58 

Slope 0.77 0.31 –0.56 

Southern Giant Petrels seems to be adapted to nest at a 

very speci c habitat in Stinker Point, at Elevations below 

90 m on almost at terrains. e direction to which these 

at areas were pointed (Aspect) was not selected by the 

SGPs, it seemedonly to be a consequence of the topography 

selected by SGPs than for any other reason, while Elevation 

and Slope played a more explicit role in in uencing nest 

position at Stinker Point. However, there were a lot of other 

Figure 2. Principal Components plot with the two fi rst components 

explaining 76% of the data variation. Blue circles are the Southern Giant 

Petrel nests, and green circles are the random points. Component 1 is 

explained by Elevation and Slope, while Component 2 is explained by 

Aspect. 

non-measured factors that could contribute to the presence 

of seabird colonies in a given place, such as solar incidence, 

wind exposure, ice-free land, distance from predators 

(Brown Skuas in Stinker Point), inter- and intra-speci c 

competition, density and parasites (Rönkä et al., 2008). 

Potentially, there are others places where a colony was 

expected to be seen, mainly areas of Glacier retraction (MVP 

pers. comm.), which could be placed among those speci c 

reliefs used by SGP. One explanation is social attraction 

(Danchin et al., 1998; Parejo et al., 2006), that is, the previous 

observation of conspeci c success being indicative of site 

quality for breeding. In other words, where one experienced 

bird chose to breed would probably be a good location, 

hence younger birds and rst breeders would tend to use 

such places through this socially available information. 


89

Conclusion 

More profound analyses are still needed to understand the 

observed trend. GIS is a very useful tool for the development 

of models for explaining the colonies distribution. 

Incorporating a wide range of topographic, abiotic and 

biotic information can cause the emergence of a coherent 

understanding of why SGPs at Stinker Point are using at 

areas below 90 m from sea level, and if there is any e ect of 

those characteristics on tness, so they can be seen as true 

Habitat Selection parameters. 

References 



Brazilian data was provided through projects nanced by 

INCT-APA (CNPq Process no. 574018/2008-5, FAPERJ 

E-26/170.023/2008)], and supported by the Ministry of 

Environment, Ministry of Science and Technology, and 

the Secretariat for the Marine Resources Interministerial 

Committee (SECIRM). 

Danchin, E. & Wagner, R. (1997). The evolution of coloniality: the emergence of new perspectives. Trends in Ecology and 

Evolution, 12:342-7. 

Danchin, E., Boulinier, T. & Massot, M. (1998). Conspecifi c reproductive success and breeding habitat selection: implications 

for the study of coloniality. Ecology 79(7): 2415-28. 

Forbes, L.S. & Kaiser, G.W. (1994). Habitat choice in breeding seabirds: when to cross the information barrier. Oikos, 70: 377-84. 

Guthrie, C.G. & Moorhead, D.L. (2002). Density-dependent habitat selection: evaluating isoleg theory with a Lotka-Volterra 

model. Oikos, 97:184-94. 

Jones, J. (2001). Habitat selection studies in avian ecology: a critical review. The Auk, 118(2): 557-62. 

Parejo, D., Oro, D. & Danchin, E. (2006). Testing habitat copying in breeding habitat selection in a species adapted to variable 

environments. Ibis, 148: 146-54. 

Rönkä, M., Tolvanen, H., Lehikoinen, E., Numers, M. & Rautkari, M. (2008) Breeding habitat preferences of 15 bird species 

on South-western Finnish archipelago coast: applicability of digital spatial data archives to habitat assessment. Biological 

Conservation, 141:402-16.

FACTORS INFLUENCING BROWN SKUA REPRODUCTIVE 

SUCCESS AT ELEPHANT ISLAND – ANTARCTICA 

Suzana Seibert 1,* , Adriando Duarte 1 , Maria Virginia Petry 1 



*e-mail: suzanaseibert@gmail.com 

Abstract: e objective of the present study is to evaluate how some variables could in uence breeding successes of Brown Skua 

(Catharacta lonnbergi) at Stinker Point, Elephant Island, Antarctica. Variables measured were Intra-speci c Nearest Neighbour 

Distance (NND), Penguin Colony Distance (PCD) and egg laying date per breeding pair. Variables that could in uence Chick 

Survival Probability were analysed through logistic regression (forward). Data was collected during the 2009/10 austral summer. 

e studied population consisted of 37 breeding pairs, from which 23.7% (n = 9) successfully raised chicks to edging. NND and 

PCD signi cantly a ected chick survival (Nagelkerke R2 = 0.21, p < 0.001 and Nagelkerke R2 = 0.54, p < 0.05, respectively), 

showing that chicks have lower survival probability among closer nests and among the nests that are near penguin colony. ere 

is a positive and signi cant relation between NND and PCD (Linear R2 = 0.38, p < 0,001). ere was no signi cant relationship 

between the chick survival and egg laying date. Analysis showed di erent tendencies from those presented in other studies where 

chick survival probability was lower in nests near the penguin colony and an early egg laying date did not re ect a higher chick 

survival probability as expected. e last one probably caused by severe weather during the beginning of the studied breeding 

season and many nests were covered by snow, which caused the loss of many eggs resulting in very low reproductive success. 

Keywords: Catharacta lonnbergi, chick, near neighbour, spatial distribution 

Introduction 

Brown Skua (Catharacta lonnbergi) is a top-predator seabird, 

mainly found in the Southern Oceans and the Antarctic 

Continent (Watson, 1975). Reproductive success is one of 

the measures used to monitor bird populations. Finding 

out how many breeding pairs have successfully raised their 

chicks and knowing what factors can be determining for 

some specific population’s reproductive success, offers 

information whether a population is growing, declining or 

stable and what forces can guide one or other condition. 

Researchers have suggested some factors influencing 

breeding success, such as distance from the nest to the 

nearest breeding penguin group (Pezzo et al., 2001), egg 

laying date (Phillips et al., 2004), hatching date (Hahn & 

Peter, 2003; Ritz et al., 2005) and adult quality (Phillips et al., 

1998; Ritz et al., 2005). In some populations, Brown 

Skua individuals defend feeding territory in a penguin 

colony. Hagelin and Miller (1997) suggested that Skuas 

breeding near penguin colonies select their territories to 

be su ciently close to penguin colonies to have accessible 

resources, but su ciently far from penguin colonies to 

avoid egg and chick loss due to penguin deployments and 

to avoid other skua territories and intra-speci c predation, 

but not evaluating if this habitat selection could in uence 

breeding success. e number of near neighbours and 

the distances from them can play an important factor on 


8 

91

chick body-condition, which in uence breeding success 

(Phillips et al., 1998). 

One biological characteristic that many studies show to be 

very important for reproductive success is egg laying date 

and hatching date. Breeding pairs that lay their eggs earlier 

have higher chick survival probability (Phillips et al., 2004), 

which is a common characteristic in bird reproductive 

ecology (Pezzo et al., 2001). e potential advantage of 

individuals occupying di erent nest locations within the 

colony and their individual biological characteristics can be 

studied by comparing the characteristics of successful and 

unsuccessful nests. e objective of the present study is to 

evaluate the e ect of conspeci c nearest neighbour distance, 

distance from breeding pairs to the nearest penguin colony 

and, egg laying date on breeding successes of Brown Skua 

population (Catharactalonnbergi) in Elephant Island, 

Antarctica. 


e eld work was carried out at Stinker Point (61° 13’ S 

and 55° 22’ W), Elephant Island, South Shetland, Antarctic 

Peninsula during the 2009/10 austral summer. Brown 

Skua population consisted of 37 breeding pairs. Variables 

measured for each breeding pair were the mean of three 

conspeci c Nearest Neighbour Distance (NND), Penguin 

Colony Distance (PCD) and egg laying date. To access the 

breeding success and egg laying date, the nests were visited 

every three days. Chicks were assumed to have edged 

if they had survived until the end of the study period 

(age ± 34 days). Nest positions were recorded with a hand- 

held GPS receiver (60CSx, Garmim). e parameters NND 

and PCD were calculated by means of GIS so ware ArcView. 

Logistic regression (forward) was used in order to analyze 

the in uence of variables over Chick Survival Probability. 

Results 

From the 37 Brown Skua breeding pairs 24.3% (n = 9) 

successfully raised chicks to fledging, which meant 

0.24 chick edged per breeding pair. Mean Skua Nearest 

Neighbour Distance (NND) was 51 ± 71 m (ranging from 

3.1 to 407.3 m). Variables in uencing Chick Survival 


Probability were NND (Nagelkerke R 2 = 0.52; P < 0.001) 

and PCD (Nagelkerke R 2 = 0.22; P < 0,01). Results indicate 

that the further nests are from each other, the higher is 

chick survival probability (Figure 1). e same tendency 

was con rmed for PCD. A positive relationship was found 

between NND and PCD (Linear R2 = 0.38, P 0,05) (Figure 2), which 

ranged between 13 December of 2009 and 5 January of 

2010. 

Figure 1. Distance to near neighbour – Catharacta lonnbergi chick 

survival predicted probability in relation to the mean distance of three 

nearest conspecifi c neighbours, Elephant Island, Antarctica. 

Figure 2. Egg laying date – Catharacta lonnbergi chick survival predicted 

probability in relation to egg laying date, where date 0 is time (t) of fi rst egg 

recording, Elephant Island, Antarctica.

Discussion 

One of the causes of breeding failure in Brown Skua 

populations is conspeci c predation (Osborn, 1985), what 

can be higher within closer nests. e mean distance from 

one nest to three nearest neighbours informs how dense or 

spread is the nest distribution around each studied breeding 

pair, so that, the greater the nest density, the greater chicks 

chances of conspeci c predation, which may be one of the 

causes of higher chick death among closer nests (Figure 1). 

Skuas are known to be a territorial species, hence 

establishing and maintaining a territory usually includes 

costs for the owners in terms of defence e orts, such as being 

alert to detect and expel intruders (Hahn & Bauer, 2008). 

Furthermore this behaviour results in energy wasting and 

consequently tness loss. Individuals whose nests are far 

away from others will not have to waste so much energy 

on holding territory as individuals that have closer nests. 

In this way, adults that have distant nests are supposed to 

spend more energy on feeding than protecting chicks. On 

the other hand, closer nests were also those located closer 

to a penguin colony, a fact that could add some bene ts to 

parents and chicks. Pezzo et al. (2001) also found a higher 

nest aggregation around penguin colonies, and states that 

the key factor for successful breeding in their study seemed 

to be the proximity to penguins, since mean edging success 

was higher in nests located less than 15 m from penguins. 

According to Young and Millar (1999), the opportunity to 

gain food quickly (having a territory near a penguin colony) 

has important implications for skua breeding, it bene ts the 

chicks in two ways: rst, through higher nest attendance, 

they should be better protected against other skuas; and 

second, chicks are less likely to su er intense hunger than 

those with parents foraging at sea or among few penguins 

- a ecting survival directly or through stimulating sibling 

aggression. 

Despite these arguments, analysis showed an opposite 

tendency whereby nests near the penguins showed lower 

probabilities of fledging chicks successfully. This may 

happen because, nests close to penguins are densely 

distributed, which increases the potential competition 

among breeding skuas and potentially increases intraspeci 

c predation. Many studies show a high relation of 

chick condition, or probability to survive, to egg laying date 

and chick hatching (Pezzo et al., 2001; Hahn & Peter, 2003; 

Ritz et al., 2005; Phillips et al., 1998). Egg laying date and 

hatching is o en an index for adult quality (including age, 

experience, structural size and condition) rather than a date 

hatching factor in uencing chick growth (Ritz et al., 2005). 

e egg laying date analysis was not signi cant (Figure 2), 

but it does not reveal inexperienced adult population 

because there are many other facts involved, such as climate. 

ere is evidence that worsening environmental factors 

within a season are responsible for a decreasing chick 

growth performance and survival. Severe weather occurred 

during the beginning of the studied breeding season and 

many nests were covered with snow, which in itself caused 

the loss of many eggs or later as a consequence of snow 

melting. e loss of eggs is revealed through the very low 

number of edged chicks (0.24 chick edged per breeding 

pair), which is much below the gures recorded in studies 

(Phillips et al., 2004; Pezzo et al., 2001), but has already been 

registered in a similar way in the study of Ensor (1979). is 

signi cant chicks loss can a ect Elephant Island Brown Skua 

population some years from now. If in the next few seasons 

the number of young skuas does not increase, the population 

could reach a limit of individuals below recoverable. 

Conclusion 

Analysis showed di erent tendencies from those presented 

in other studies. Chick survival probability was lower in 

nests near a penguin colony and an early egg laying date did 

not re ect a higher chick survival probability as expected. 

Although those tendencies can be explained, there is a huge 

need for more eld data to monitor population trends in 

the coming years. 


We are very grateful to National Science and Technology 

Institute- Antarctic of Environmental Research (INCT- 

APA) (CNPq Process no. 574018/2008-5, FAPERJ 

E-26/170.023/2008) who nancially supported the project, 

to the Brazilian Ministry of Environment, the Ministry 

of Science and Technology, the Secretariat for the Marine 

Resources Interministerial Committee (SECIRM) and all 

friends who helped with eld work. 


93

References 

Ensor, P.H. (1979). The effect of storms on the breeding success of South Polar Skuas at Cape Bird, Antarctica.Notornis 26: 

349-52 

Hagelin, J.C. & Miller, G.D. (1997). Nest site selection in south polar skuas: balancing nest safety and access to resources. 

Auk 114: 638-45. 

Hahn, S. & Bauer, S. (2008). Dominance in feeding territories relates to foraging success and offspring growth in brown skuas 

Catharacta antarctica lonnbergi. Behavior Ecology Sociobiology 62: 1149-57. 

Hahn, S. & Peter, H-U. (2003). Feeding territoriality and the reproductive consequences in brown skuas Catharacta antarctica 

lonnbergi. Polar Biology 26(8): 552-9. 

Osborn, B. C. (1985). Aspects of the breeding biology and feeding behavior of the Brown Skua Catharacta lonnbergi on Bird 

Island, South Georgia. British Antarctic Survey Bulletin. 66: 57-71. 

Pezzo, F.; Olmastroni, S.; Crosolini, S. & Focardi, S. (2001). Factors affecting the breeding success of south polar skua 

Catharacta maccormicki at Edmonson Point, Victoria Land, Antarctica. Polar Biology 24: 389-93. 

Phillips, R.A.; Furness, E.W. & Stewart, F.M. (1998).The infl uence of territory on the vulnerability of Arctic skuas Stercorarius 

parasiticus to predation. Biological Conservation 86: 21-31. 

Phillips, R.A.; Phalan, B. & Forster, I.P. (2004). Diet and long-term changes in population size and productivity of brown skuas 

Catharacta antarctica lonnbergi at Bird Island, South Georgia. Polar Biology 27(9): 555-61. 

Ritz, M. S.; Hahn, S. & Peter, H-U. (2005). Factors affecting chick growth in the South Polar Skua (Catharacta maccormicki): 

food supply, weather and hatching date. Polar Biology 29(1): 53-60. 

Watson, G.E. (1975). Skuas and Jaegers: Stercorariidae. In: Birds of the Antarctic and Sub-Anterctic. Richmond: The William 

Byrd Press Inc. 

Young, E.C. & Millar, C.D. (1999).Skua (Catharacta sp.) foraging behavior at the Cape Crozier Adelie Penguin (Pygoscelisadeliae) 

colony, Ross Island, Antarctica, and implications for breeding. Notornis 46:287-97. 


NEST ATTENDANCE OF SOUTHERN GIANT PETREL 

(Macronectes giganteus) ON ELEPHANT ISLAND 

Introduction 

Uwe Horst Schulz 1,* , Lucas Krüger 1 , Maria Virginia Petry 1 

1Universidade do Vale do Rio Sinos –UNISINOS, São Leopoldo, Rio Grande do Sul, Brazil 

*e-mail: uwe@unisinos.br 

Abstract: According to expressive size dimorphism between Southern Giant Petrel genders, di erences in foraging and nest 

attendance are expected between female and male petrels. is study aims to investigate di erences in nest attendance duration 

and frequency. 14 Adults were tagged with radio-transmitters, seven females and seven males, of which ve were breeding pairs, 

in Stinker Point, Elephant Island. e radio signals were registered by an Automatic Listening Station between December 2009 

and February 2010. Females attend more o en the nest than males (binominal test, Chi2 = 799.3; P < 0.001), although the mean 

number of days each gender attended the nest was not di erent (F = 0.01; P = 0.92). Our results suggest a higher breeding e ort 

in females while larger males may trade o reproduction success in favor of own survival, at least in anomalous summers. Under 

severe climatic conditions like the austral summer of 2009/2011 males tend to abandon the nest earlier than females. 

Keywords: behavior, nesting, radio-transmitters, telemetry 

e Southern Giant Petrel (Macronectes giganteus) is a 

circumpolar cold-water seabird of the southern oceans and 

the Antarctic (Onley & Sco eld, 2007). It is a long-lived 

species that undertakes long-distance migrations between 

the breeding periods (Harrison, 1983). e breeding period 

is a key element in the bird’s lifecycle. Several studies 

focus on the behavior of the parents during the breeding 

process. In species with sex size dimorphism di erences in 

provision frequency and duration of foraging trips between 

genders can be expected. Gender related di erences in 

foraging behavior were reported for several albatross 

species (Weimerskirch et al., 1993; Phillips et al., 2004). 

Size di erences between female and male giant albatrosses 

are expressive. Males are up to 20% heavier than females 

(Gonzáles-Sólis et al., 2000a) and sex related di erences in 

foraging duration and frequency can be expected. Studies 

of Gonzáles-Sólis et al. (2000a,b) and Gonzáles-Sólis 

(2004) concentrated particularly on Northern Giant Petrel 

(Macronectes halli). ey found substantial segregation 

between males and females in relation to foraging strategies, 

foraging areas and feeding resources. Males made shorter 

trips than females, principally feeding on penguin and 

seal carrion on the beaches close to the breeding sites. 

Females were encountered more frequently in pelagic 

habitats than males and fed more o en on marine prey. 

Gonzáles-Solís et al. (2002) reported two types of trips 

by satellite tracking in Giant Petrels: pelagic with mean 

duration of 15 days and coastal trips of median durations of 

eight days. Unfortunately, the author’s do not di erentiate 

results nor for species neither for genders. e objectives 

of our study were a) to perform a radio tagging pilot study 

to test the deployment of unattended Automatic Listening 

Stations (ALS) in a pilot study on Elephant Island and b) 

investigate sex related di erences in nest attendance during 

the breeding period of Giant Southern Petrel and to describe 

presence / absence patterns of both sexes. 


9 

95


Study area 

e tagging experiment was conducted at Stinker point on 

Elephant Island, South Shetland Islands (Figure 1). 95% 

of the island is under permanent ice cover. All colonies 

of seabirds are concentrated on the remaining 5% which 

may be ice free at late Antarctic summer. Mean annual 

temperature is –2 °C, mean summer temperature 1 °C 

(Instituto Hidrogra co de la Armada Chile, 1989). Even 

in the austral summer snowstorms and low visibility due 

to fog are frequent. 

Tagging 

For tagging digitally coded transmitters (LOTEK; type 

MCTF-3A weight 16 g, 149 MHz) were used. Burst rate was 

Figure 1. Antarctic Elephant Island. The rectangle indicates the study area at Stinker Point. 


set to 5s, expected transmitter life 641d. Tagging procedure 

extended 7 days, due to the weather conditions with 

temperatures at –5 °C and gust winds of up to 35 miles h-1 . 

We tagged seven females and seven males on nine nests, of 

which ve were occupied by couples (Table 1). 

All individuals were tagged when sitting on the nest. 

One leg was gently extended without securing the body of 

the bird. e transmitter, glued on a piece of so foam, was 

attached to the tarsus-metatarsus by 3M Silver tape, the whip 

antenna extending in the direction of the foot (Figure 2). 

Some individuals, mostly males, had to be secured holding 

the body. When these individuals were released after 

tagging, they escaped ying. Usually they returned to nest 

in less than two minutes. 

The radio signals were registered by an Automatic 

Listening Station (ALS) which consisted of a SRX 400

Table 1. Tagging date, digital transmitter code, gender and nest number 

of tagged individuals. Note that nest number 1, 3, 5 and 14 were occupied 

by one tagged parent only. 

Date Hour Code Female Male Nest 

04-DEC-09 11.00 102 X 1 

04-DEC-09 11.00 103 X 3 

04-DEC-98 12.00 105 X 5 

06-DEC-09 10.00 114 X 14 

04-DEC-09 11.00 101 X 2 

05-DEC-09 12.00 104 X 2 

03-DEC-09 16.00 107 X 7 

05-DEC-09 12.00 106 X 7 

03-DEC-09 16.00 108 X 8 

05-DEC-09 12.00 109 X 8 

03-DEC-09 16.00 110 X 10 

04-DEC-09 12.00 112 X 10 

06-DEC-09 10.00 111 X 11 

09-DEC-09 11.00 113 X 11 

receiver with data logger function (LOTEK, Canada) 

equipped with a standard omnidirectional whip antenna. 

Time partition was set to 30 minutes to optimize data 

logger memory capacity of 524288 bytes. e power was 

supplied by the internal batteries of the receiver, which were 

automatically recharged in a 12 hours rhythm by the electric 

generator of the research unit. Birds were tagged in two 

di erent breeding groups at 170 m distance to the receiver. 

e tracking period extended from 03 December 2009 to 

10 February 2010. Between 07 January and 10 February 

the equipment was le unattended. During this period 

power was supplied by a 300 Ah truck battery. Data from 

the ALS was downloaded in three days intervals. During 

the absence of the research team data accumulated for 

approximately one month in the internal receiver memory. 

When necessary data were ln-transformed to meet the 

criteria of homogeneity of variances for ANOVA, tested 

by Levene´s statistic. Binominal test was used to test for 

di erences in presence data between genders. Signi cance 

level in all tests was set to P < 0.05. e dispersion measure 

is the standard error (s.e.). 

Figure 2. Leg mounted radiotransmitters on Southern Giant Petrel. 

Results 

During the three month period of tracking two technical 

problems occurred. The first was power supply, which 

accidentally disconnected and caused a data loss of two days. 

e second was related to false absence data. On several 

occasions the presence of a tagged bird was con rmed by 

visual observation but the ALS did not receive the signal. 

All tagged individuals remained in the study area and 

their signals were registered throughout the investigation 

period (Figure 3). A total of 8086 events of radio signals 

were registered by the ALS, of which 5314 were produced 

by the presence of females and 2772 by males. This 

di erence in presence of both genders is highly signi cant 

(multinominal test, Chi2 = 799.3; P < 0.001). Of all 14 tagged 

petrels 11 resumed breeding activities a er tagging. ree 

individuals did not: a male without tagged partner (nest 1) 

and a couple (nest 11). e breeding individuals produced 

distinct presence/absence patterns (Figure 3, Table 1). 

Although females were present during 18 periods (min. 

3 days, max. 9 days) and males only 5 periods (min. 2, max. 

13 days) mean nest attendance (females 6.4 days ± 0.56; 

males 6.8 ± 1.3) was not signi cantly di erent in both sexes 

(F = 0.01; P = 0.92). All nests were abandoned during the 

study period. e rst was nest 8 on 18 December, the last 

nest 10 on 23 January. e attendance pattern of codes 

110 (female) and 112 (male; Figure 3) show, that the male 

ceases breeding on 27 December. At this date occurred a 

switch in nest attendance. e departing male was registered 


97

Figure 3. Nest attendance periods of tagged Giant Southern Petrel. Codes on the left refer to individuals of Table 1. Numbers on the left inside the fi gure 

refer to nests. 

the last time at 12.30 hours and the arriving female at 

12.36 hours. Since then the female remained for a period of 

eight days on the nest and le for four. She le and returned 

three times, with decreasing periods of nest attendance until 

the nest was abandoned ultimately on 23 January. 

Discussion 

e results of our study showed, that the deployment of 

unattended ALS is technically viable under the severe 

climatic conditions of Elephant Island. Signal reception 

problems may be reduced in future experiments by the 

use of directional antennas. Tagging data revealed that the 

signal count of tagged females is signi cantly higher than 

for males. is means, that female Petrel presence in the 


breeding colony is far more intensive. e higher number 

of uninterrupted attendance periods (18) reinforces this 

result, although mean attendance duration did not di er 

from males. ese results indicate a higher breeding e ort 

in females while larger males may trade o reproduction 

success e ort in favor of own survival (Bijleveld & Mullers, 

2009). Adult survival is a principal demographic parameter 

that drives the population dynamics in long-lived seabirds 

(Rolland et al., 2009). Further tagging experiments, which 

are planned for the season 2011/2012 have to con rm the 

present tendency on a broader data base. De Villiers et al. 

(2006) documented high stress levels in congeneric 

Northern Giant Petrel when disturbed. is stress sensitivity 

may have caused the interruption of the breeding process in 

three individuals as consequence of the tagging procedure.

All other individuals initially continued breeding and 

abandoned the nests later. No chick hatched in nests 

where one or both parents were tagged. Most probably 

the unusual extreme weather conditions of the 2009/2010 

austral summer caused the reproduction failures. Heavy 

snow precipitation and gust winds of 90 km h –1 occurred 

frequently at the beginning of the tracking period. Snow 

cover extended until mid December. When the research 

team returned on 13 February, census data showed, that 

only 5.8% of pairs successfully raised a edge. 

Conclusions 

e deployment of unattended ALS is technically viable 

for a period of up to ve weeks. ree out of 14 individuals 

References 

abandoned their nests probably as consequence of tagging 

stress. During the tracking period, female Giant Petrel 

displayed a higher breeding e ort than males. Under severe 

climatic conditions like the austral summer of 2009/2011 

males tended to abandon the nest earlier than females. 

Acknoledgements 

e study had nancial support from INCT-APA (CNPq 

Process n° 574018/2008-5), FAPERJ (E-26/170.023/2008), 

WCS (Wildlife Conservation Society) and supported 

by the Ministry of Environment, Ministry of Science 

and Technology and the Secretary of Marine Resources 

(SECIRM). 

Bijleveld, A.I. & Mullers, R.H.E. (2009). Reproductive effort in biparental care: an experimental study in long lived Cape 

gannets. Behavioral Ecology, 20(4): 736-44. 

De Villiers, M.; Bause, M.; Giese, M. & Fourie, A. (2006). Hardly hard-hearted: heart rate responses of incubating Northern 

Giant Petrels (Macronectes halli) to human disturbance on sub-Antarctic Marion Island. Polar Biology, 29(8): 717-20. 

Gonzáles-Solís, J.; Croxall, J.P. & Wood, A.G. (2000a). Sexual dimorphism and sexual segregation in foraging strategies of 

northern giant petrels Macronectes halli during incubation. Oikos, 90: 390-98. 

Gonzáles-Solís, J.; Croxall, J.P. & Wood, A.G. (2000b). Foraging partitioning between giant petrels Macronectes spp. And its 

relationship with breeding population changes at Bird Island, South Georgia. Marine Ecology Progress Series, 204: 279-88 

Gonzáles-Solís, J.; Croxall, J. P. & Briggs, D. R. (2002). Activity patterns of giant petrels, Macronectes spp., using different 

foraging strategies. Marine Biology, 140: 197-204. 

Gonzáles-Sólis, J. (2004). Sexual sixe dimorphism in northern giant petrels: ecological correlates and scaling. Oikos, 105: 

247-54. 

Harrison, P. (1983). Seabirds, an identifi cation guide. Boston: Houghton Miffl in. 

Instituto Hidrografi co de la Armada Chile. (1989). Derrotero de la costa de Chile. 2 ed. Santiago, I.H.A pub. 3006, v. 6, 251 

pages. 

Onley, D. & Scofi eld, P. (2007). Albatrosses, petrels and shearwaters of the world. New Jersey: Princeton University Press. 

Phillips, R. A.; Silk, J. R. D.; Phalan, B.; Catry, P. & Croxall, J. P. (2004). Seasonal sexual segregation in two Thallassarche 

albatross species: competitive exclusion, reproductive role specialization or foraging niche divergence. Proceedings of 

the Royal Society of London - Series B - Biological Science, 271: 1283–91. 

Rolland, V.; Novoux, M.; Barbraud, C. & Weimerskirch, H. (2009). Respective impact of climate and fi sheries on the growth 

of an Albatross population. Ecological Applications, 19: 1336-46. 

Weimerskirch, H.; Salamolard, M.; Sarrazin, F. & Jouventin, P. (1993). Foraging strategy of wandering albatrosses through 

the breeding season: a study using satellite telemetry. Auk, 110: 325-42. 


99


IMPACT OF HUMAN ACTIVITIES ON THE 

ANTARCTIC MARINE ENVIRONMENT 

108 Plankton Structure a in Shallow Coastal Zone at Admiralty Bay, King George Island, West Antarctic 

Peninsula (Wap): Pico, Nano and Microplankton and Chlorophyll Biomass 

115 Plankton Structure a in Shallow Coastal Zone at Admiralty Bay, King George Island, West Antarctic 

Peninsula (Wap): Chlorophyll Biomass and Size-Fractionated Chlorophyll During Austral Summer 

2009/2010 

121 Plankton Structure a in Shallow Coastal Zone at Admiralty Bay, King George Island West Antarctic 

Peninsula (Wap): Composition of Phytoplankton and Infl uence of Benthic Diatoms 

126 Effect of Temperature, Salinity and Fluoride on the Plasmatic Constituents Concentration of Antarctic 

Fish Notothenia rossii (Richardson, 1844) 

131 Arginase Kinetic Characterization of the Gastropod Nacella concinna and its Physiological Relation 

with Energy Requirement Demand and the Presence of Heavy Metals 

137 Arsenic, Copper and Zinc in Marine Sediments from the Proximity of the Brazilian 

Antarctic Base, Admiralty Bay, King George Island, Antartica 

141 Molecular Differentiation of Two Antarctic Fish Species of the Genus Notothenia (Notothenioidei: 

Nototheniidae) by Pcr-Rfl p Technique 

145 Distribution of Sterols In Sediment Cores from Martel Inlet, Admiralty Bay, King George Island, Antarctica 

150 Background Values and Assessment of Fecal Steroids Discharged into Two Inlets 

(Mackelar And Ezcurra) in Admiralty Bay, King George Island, Antarctica 

155 The Role of Early Diagenesis in the Sedimentary Steroids around Penguin Island, Antarctica 

162 Occurrence of Microbial Faecal Pollution Indicators in Sediment and Water Samples at Admiralty Bay, 

King George Island, Antarctica 

167 Aspects of Population Structure of Nacella concinna (Strebel, 1908) (Gastropoda – Nacellidae) at 

Admiralty Bay, King George Island, Antarctica 

171 Monitoring the Impact of Human Activities in Admiralty Bay, King George Island, Antarctica: 

Preliminary Results of the Meiofauna Community 

176 Role of Meteorological Events on the Macrofauna Community and Sediment Composition of the 

Shallow Waters of Martel Inlet (Admiralty Bay, Antarctica) 

182 Monitoring the Impact of Human Activities in Admiralty Bay, King George Island, Antarctica: Isotopic 

Analysis of C And N in the Summer of 2005/2006 

188 Associated Fauna of Prasiola crispa (Chlorophyta) Related to Penguin Rookery at Arctowski (King 

George Island, South Shetland Islands, Maritime Antarctic) 

194 Assessing Non-Native Species in the Antartic Marine Benthic Environment 


The Antarctic Specially Managed Area (ASMA #1) of 

Admiralty Bay encompasses the scienti c facilities of ve 

countries (Brazil, Ecuador, Peru, Poland and U.S.A). e 

marine topography is similar to that of ords and has been 

subject to a strong impact from the global climate changes 

recorded in the last decades. 

The importance of the continuous environmental 

monitoring of Antarctica became evident with the approval 

of the Environmental Protection Protocol (Madrid 

Protocol) through the consultative parties of the Antarctica 

Treaty in 1991. e subsequent technical and scienti c 

meetings undertaken in the sphere of COMNAP (Council 

of Managers of National Antarctic Programs) and SCAR 

(Scienti c Committee on Antarctic Research) resulted in 

a technical manual with standard methodologies for the 

physical and chemical monitoring of environmental factors 

(COMNAP, 2000). However, this protocol does not include 

the biota monitoring and its biological responses as a way of 

predicting natural and anthropic impacts on the Antarctic 

ecosystems. 

e rst long-term environmental monitoring initiative 

in Admiralty Bay, King George Island, Antarctica, was 

conceived in the 70’s by the researcher Wa yne Z. Trivelpiece, 

of Seabird Research, U.S. Antarctic Marine Living Resources 

Division (Trivelpiece et al., 1987), with focus on the 

monitoring of bird populations in the region. In 2001, 

under the title of “Environmental management of Admiralty 

Bay, King George Island, Antarctica (Network 2)”, the 

Brazilian Antarctic Programme (Proantar) implemented a 

broader proposal of environmental monitoring, supported 

by the National Council for Scienti c and Technological 

Development (CNPq) and the Brazilian Ministry of the 

Environment (MMA). e proposal included the addition 

Coordinator 

Dr. Helena Passeri Lavrado 

Vice-Coordinator 

Dr. Edson Rodrigues 

of biological information to the data generated from the 

physical and chemical monitoring of the marine, terrestrial 

and atmospheric environment. is initiative was recognised 

by the international scienti c community and rati ed the 

Brazilian commitment to the Madrid Protocol. With the 

creation of INCT-APA (National Institute for Science and 

Technology-Antarctic Environmental Research) by the 

Brazilian Ministry of Science and Technology (MCT), in 

2008, the monitoring programme originally proposed by 

Network 2 was broadened and consolidated. 

The Thematic Area 3 of INCT- APA is responsible 

for the long-term ecological programme of the ASMA#1 

marine environment and aggregates information of the 

atmospheric and terrestrial environments (Figure 1). Long 

term climate series with records of solar radiations (ultra- 

violet, for example), speed and direction of winds, air 

temperature and atmospheric phenomena (Correia et al., 

2010; Marani & Alvalá, 2010; Pinheiro et al., 2010) have 

contributed to the comprehension of the climatic e ects in 

the behaviour of the terrestrial and marine biota. Data of 

the vegetation and the bird populations are also essential to 

evaluate the transfer of energy between the terrestrial and 

marine environments. Di erent from what occurs in the 

marine environment of tropical and subtropical regions, the 

seasonality of the photoperiod in Antarctica signi cantly 

reduces sea primary production during winter and imposes 

long periods of food restrictions (Brockington, 2001). 

However, during summer, the photoperiod is much longer 

o ering a true explosion of life in the Antarctic seas. e 

phytoplankton studies undertaken in the summer of the 

Brazilian Antarctic Expedition XXVIII (2009/2010) revealed 

that the benthic microalgae and diatoms have an important 

role in the primary productivity of the pelagic coastal region 


101

of Admiralty Bay (Tenenbaum et al., 2010b), with some 

changes in phytoplankton community structure over the 

summer (Tenenbaum et al., 2010a) and with relatively low 

and spatially heterogeneous concentrations of chlorophyll 

(Tenório et al., 2010). 


Di erently to subtidal zones, which present high thermal 

stability, the intertidal zones su er the direct seasonal e ect 

of the terrestrial climate. e frequent emersion of this 

region exposes the organisms to desiccation, solar radiation 

and to relatively high temperatures during the Antarctic 

summer. In winter, however, the challenges are of another 

nature, with the presence of foot ice and low temperatures 

favouring freezing conditions. e lixiviation of the volcanic 

rocks by melt waters transports high concentrations of 

heavy metals to the intertidal and shallow subtidal zones 

(Ahn et al., 1996). Besides the natural stress, the intertidal 

organisms are subject to pollution from the scientific 

stations, ships and small vessels used to load and unload 

material/personnel on the beaches (Naveen et al., 2001). 

e gastropod Nacella concinna is the most conspicuous 

macroinvertebrate of the intertidal zone and has been 

postulated as the sentinel organism for heavy metals 

monitoring (Ahn et al., 2002). Preliminary data of 

Figueiredo and Lavrado (2010) reveal that the Brazilian 

presence in the region apparently does not interfere in the 

population dynamics of this gastropod in Admiralty Bay. 

Figure 1. The connections (interrelations) of the long-term ecological programme on the marine environment of Admiralty Bay, King George Island, 

Antarctica (Thematic Area 3 of INCT-APA). The scientifi c activities developed in the sphere of the marine environment includes information of the water column 

(hydrology, phytoplankton and zooplankton), the benthic system (phytobenthos and zoobenthos), the physical-chemical and microbiological composition of 

the sediment (POPs, MOPEs, metals, etc), the biological responses to natural and anthropic impacts (biochemical, cellular and histopathological biomarkers) 

and the trophic web. The information on the atmospheric environment is complementary to the marine environmental studies. The exchange of scientifi c 

information between the marine and terrestrial environments facilitates the comprehension of the energy transfer processes. Finally, the scientifi c data 

generated in the sphere of the marine environment offers support to the environmental management module. (Illustration: Edson Rodrigues).

e di erences found between the sampling sites seem to be 

related to natural causes and not with the pollution e ects 

of the Brazilian station. Studies about energy metabolism 

modulation of this gastropod, showed that L-arginine 

metabolism has a fundamental role in the thermal stress 

recovery (Pörtner et al., 1999). In this respect, the arginases 

have been postulated as key-enzymes in the control of the 

cellular levels of L-arginine in non-ureotelic animals and 

in the extra-hepatic tissues of ureotelics (Jenkinson et al., 

1996). Arginase kinetic characterization of the N. 

concinna foot muscle and gills was undertaken during the 

Brazilian Antarctic Expedition XXVIII, with specimens 

collected in the intertidal zone near the diesel oil tanks 

of the Comandante Ferraz Antarctic Station (EACF) as a 

preliminary evaluation of the biomarker potential of this 

enzyme (Rodrigues et al., 2010b). 

Studies concerning the contamination of the marine 

environment around the Antarctic scienti c stations of 

McMurdo (Ross Island), Casey (East Antarctica), Rothera 

(Adelaide Island) and Comandante Ferraz (King George 

Island) revealed that the contamination by metals and 

hydrocarbons, derived from human activities, can have a 

signi cant impact on the benthic communities. High levels 

of heavy metals and coliform bacteria have been detected 

in sediments close to the sewage outfall. Several variables, 

including the composition of the marine sediments (total 

organic carbon, grain size, heavy metals, amongst others), 

have been correlated with the biological communities found 

in the region (Lohan et al., 2001; Montone et al., 2010; 

Stark et al., 2003). 

e detection of high levels of the bacteria Escherichia 

coli and Clostridium perfringens in samples from EACF 

suggest that the contamination is persistent, with small 

impact and did not increase when compared to the results 

of the previous years (Ushimaru et al., 2010). Analyses 

of sterols present in the marine sediments of Admiralty 

Bay is also contributing to the comprehension of the 

environmental changes caused by natural and anthropic 

factors (Wisnieski et al., 2010). e ratio between stanol/ 

stenol concentrations has been used to indicate the degree 

of redox potential in anaerobic environments and in the 

understanding of cycles involving the organic matter in the 

sediments (Ceschim et al., 2010). e low level of anthropic 

impact in Admiralty Bay also became evident in the analysis 

of arsenic, copper and zinc in marine sediments of locations 

close to EACF (Ribeiro et al., 2010). 

e energy transfer of the water column productivity to 

higher trophic levels seems to be more e cient in the marine 

environments of high latitudes. Although several ecological 

studies have revealed a high benthic biomass in the coastal 

region of Admiralty Bay, the rst estimate of energy transfer 

over the trophic web in that region, on the basis of isotopic 

analysis δ13C, was undertaken by Corbisier et al. (2004). In 

a recent study, concerning the benthic meiofauna in front 

of EACF, Corbisier et al. (2010b) veri ed a possible impact 

of human activity in the marine environment. However, the 

results of isotopic δ 13C, comparing the beginning and end of 

summer, did not indicate an increase of the sewage in uence 

on the structure of the trophic web (Corbisier et al., 2010a). 

On the other hand, it becomes important to monitor 

simultaneously the e ects of natural phenomena in the 

structure of benthic communities, in order to distinguish 

natural impacts from those caused by human activities. e 

e ect of strong and moderate winds on the hydrodynamics of 

this coastal region, for example, can change the composition 

of the sediment and cause a signi cant short-term variation 

in the density of the macrofauna (Monteiro et al., 2010), 

masking the e ects of human activities in the region. 

e use of shes in monitoring programmes presents 

some advantages, such as easy species identi cation, the 

species distribution in di erent trophic levels and their 

long life cycle, which allows the generation of a long time 

series of biological data (Whit eld & Elliott, 2002). e 

Antarctic ichthyofauna is dominated by the suborder 

Notothenioidei which is made up of eight families and 

101 described species. e endemism is high (88%) being 

at least three times greater than any other isolated marine 

environment (Eastman, 2005). e Antarctic sh Notothenia 

rossii and Notothenia coriiceps were selected as targetorganisms 

for biochemical and histopathological biomarker 

studies considering their distribution and abundance in 

Admiralty Bay. However, the species N. coriiceps described 


103

y Richadson, in 1884, and Notothenia neglecta, described 

by Nybelin in 1951, were considered the same species by 

DeWitt (1966) motivating systemic doubts. e study with 

mitochondrial DNA, conducted by Machado et al. (2010), 

using samples of these notothenioids collected in Admiralty 

Bay, con rm them to be one sole species. e identi cation 

of metabolic responses as potential biomarkers of natural 

and anthropic impacts in Antarctic sh in Admiralty Bay 

has taken into account the e ects of climate warming, 

low salinity and of the trophic uoride availability. In this 

respect, there exists evidences that the temperature increase 

leads to a reduction in the levels of chloride and magnesium 

in the blood of Antarctic sh N. rossii, and the low salinity 

(20 psu) reduces in a signi cant way the plasmatic levels 

of calcium (Rodrigues et al., 2010a), which may have 

References 


signi cant e ects on the physiology and biology of this 

species over the time. 

Lastly, anthropic impacts may not be restricted just to 

local human activities. e risk of introducing exotic species 

in a pristine environment like Antarctica, with a high level 

of endemic species, has increased in the last decades. is 

is due t o not only the intensi cation of human activities in 

the Antarctic region, such as research and tourism, but also 

to an expansion of the geographic distribution of the species 

from slightly warmer regions, due to the gradual increase 

of the temperature in the Antarctic region (Frenot et al., 

2005). Recent data shows that information on the benthic 

Antarctic biota which could allow an accurate risk analysis 

of bioinvasion (Bastos & Junqueira, 2011) are really scarce, 

indicating the urgency for an up-to-date marine biota survey 

in order to identify possible introduced species. 

Ahn, I.-Y.; Lee, S.H.; Kim, K.T.; Shim, J.H. & Kim, D.-Y. (1996). Baseline heavy metal concentrations in the Antarctic clam, 

Laternula elliptica in Maxwell Bay, King George Island, Antarctica. Marine Pollution Bulletin, 32: 592-8. 

Ahn, I.Y.; Kim, K.W. & Choi, H.J. (2002). A baseline study on metal concentrations in the Antarctic limpet Nacella concinna 

(Gastropoda: Patellidae) on King George Island: Variations with sex and body parts. Marine Pollution Bulletin, 44(5): 424-31. 

Bastos, A.C.F. & Junqueira, A.O.R. (2011). Assessing non-native species in Antarctic marine benthic environment, in: W. 

INCT-APA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN. 

Brockington, S. (2001). The seasonal energetics of the Antarctic bivalve Laternula elliptica (King and Broderip) at Rothera 

Point, Adelaide Island. Polar Biology, 24(7): 523-30. 

Ceschim, L.M.M.; Montone, R.C. & Martins, C.C. (2010). Role of early diagenesis in the sedimentary steroids around Penguin 

Island, Antarctica, in: W. INCT-APA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN. 

COMNAP (2000). Antarctic Environmental Monitoring Handbook. COMNAP and SCAR, Hobart Tasmania. 

Corbisier, T.; Petti, M.V.; Skowronski, R.P. & Brito, T.S. (2004). Trophic relationships in the nearshore zone of Martel Inlet (King 

George Island, Antarctica): d13C stable-isotope analysis. Polar Biol. 27, 75-82. 

Corbisier, T.N.; Bromberg, S.; Gheller, P.F.; Piera, F.E. & Petti, M.A.V. (2010a). Monitoring the impact of human activities in 

Admiralty Bay, King George Island: Isotopic analysis of C and N in summer 2005/2006, in: W. INCT-APA (Ed.). Instituto 

Nacional de Pesquisas Espaciais (INPE), Natal - RN. 

Corbisier, T.N.; Gheller, P.F.; Ujikawa, M.C.U.; Bromberg, S. & Petti, M.A.V. (2010b). Monitoring the impact of human activities 

in Admiralty Bay, King George Island: Preliminary results of the meiofauna community, in: W. INCT-APA (Ed.). Instituto 

Nacional de Pesquisas Espaciais (INPE), Natal - RN. 

Correia, E.; Raulin, P.J.; Kaufmann, P. & Bertoni, F.C.P. (2010). Studies of lower ionosphere response to external forcing, in: 

W. INCT-APA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN.

DeWitt, H.H., (1966). A revision of the Antarctic and southern genus Notothenia (Pisces, Notothenidae) Stanford University, 

Palo Alto, 469. 

Eastman, J.T. (2005). The nature of the diversity of Antarctic fi shes. Polar Biology, 28(2): 93-107. 

Figueiredo, M.I.S. & Lavrado, H.P. (2010). Aspectos of population structure of Nacella concinna (Strebel, 1908) (Gastropoda 

- Nacellidae) at Admiralty Bay, King George Island, Antarctica, in: W. INCT-APA (Ed.). Instituto Nacional de Pesquisas 

Espaciais (INPE), Natal - RN. 

Frenot Y, Chown S. L, Whinam J, Selkirk P. M, Convey P, Skotnicki M, Bergstrom D. M. Biological invasions in the Antarctic: 

extent, impacts and implications. Biological Reviews, 80:45–72.doi:10.1017/S1464793104006542 [PubMed] 2005. 

Jenkinson, C.P.; Grody, W.W. & Cederbaum, S.D. (1996). Comparative properties of arginases. Comparative Biochemistry 

and Physiology Part B: Biochemistry and Molecular Biology, 114(1): 107-32. 

Lohan, M.; Statham, P. & Peck, L. (2001). Trace metals in the Antarctic soft-shelled clam Laternula elliptica: implications for 

metal pollution from Antarctic research stations. Polar Biology, 24(11): 808-17. 

Machado, C.; Shimada, M.K.; Fragoso, S.P.; Fanta, E.; Kawall, H.G;, Rodrigues, E. & Donatti, L. (2010). Molecular differentiation 

of two Antarctic fi sh species of the genus Notothenia (Notothenioidei: Nototheniidae) by PCR-RFLP tecnhique, in: W. 

INCT-APA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN. 

Marani, L. & Alvalá, P.C. (2010). Monitoriamento de gases do efeito estufa na Estação Antártica Comte Ferraz, in: W. INCT- 

APA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN. 

Monteiro, G.S.; Petti, M.A.V.; Santos, M.C.E.R.; Grotto, B.W.; Gheller, P.F.; Nonato, E.F. & Corbisier, T.N. (2010). Role of 

meteorological events on the macrofauna community and sediment composition at the shallow waters of Martel Inlet 

(Admiralty Bay, Antarctica), in: W. INCT-APA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN. 

Montone, R.C.; Martins, C.C.; Bícego, M.C.; Taniguchi, S.; Albuquerque Moreira da Silva, D.; Campos, L.S. & Weber, R.R. 

(2010). Distribution of sewage input in marine sediments around a maritime Antarctic research station indicated by 

molecular geochemical indicators. Science of the Total Environment, 408(20): 4665-71. 

Naveen, R.; Forrest, S.C.; Dagit, R.G.; Blight, L.K.; Trivelpiece, W.Z. & Trivelpiece, S.G. (2001). Zodiac landings by tourist 

ships in the Antarctic Peninsula region, 1989-99. Polar Record, 37: 121-32. 

Pinheiro, D.K.; Leme, N.P.; Peres, L.V. & Kall, E. (2010). Infl uence of the Antarctic ozone hole over south of Brazil in 2008 and 

2009, in: W. INCT-APA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN. 

Pörtner, H.O.; Peck, L.; Zielinski, S. & Conway, L.Z. (1999). Intracellular pH and energy metabolism in the highly stenothermal 

Antarctic bivalve Limopsis marionensis as a function of ambient temperature. Polar Biology, 22(1): 17-30. 

Ribeiro, A.P.; Figueira, R.C.L.; Martins, C.C.; Silva, C.R.A.; França, E.J.; Bícego, M.C.; Mahiques, M.M. & Montone, R.C. (2010). 

Arsenic, copper and zinc in marine sediments from the proximity of brazilian Antarctic station, Admiralty Bay, King George 

Island, Antarctica, in: W. INCT-APA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN. 

Rodrigues, E.; Donatti, L.; Suda, C.N.K.; Rodrigues Júnior, E.; Feijós de Oliveira, M.; Carvalho, C.S. & Vani, G.S. (2010a). 

Effect of temperature, salinity and fl uoride on the plasmatic constituents concentration of Antarctic fi sh Notothenia rossii 

(Richardson, 1844), in: W. INCT-APA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN. 

Rodrigues, E.; Lavrado, H.P.; Donatti, L.; Suda, C.N.K.; Rodrigues Júnior, E.; Feijós de Oliveira, M. & Vani, G.S. (2010b). Arginase 

kinetic characterization of the gastropod Nacella concinna and its physiological relation with energy requirement demand 

and the presence of heavy metals, in: W. INCT-APA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN. 

Stark, J.S.; Riddle, M.J.; Snape, I. & Scouller, R.C. (2003). Human impacts in Antartic marine soft-sediment assemblages: 

correlations between multivariate biological patterns and environmental variables at Casey Station. Estuarine, Coastal 

and Shelf Science, 56(3-4): 717-34. 


105

Tenenbaum, D.R.; Barreira-Alba, J.J.; Duarte, R.B. & Tenório, M.M.B. (2010a). Plankton structure of shallow coastal zone 

at Admiralty Bay, King George Island, West Antarctic Peninsula (WAP): pico, nano and microplankton and chlorophyll 

biomass, in: W. INCT-APA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN. 

Tenenbaum, D.R.; Lange, P.; Fernandes, L.; Calixto, M.; Barreira-Alba, J.J. & Garcia, V.M.T. (2010b). Plankton structure of 

shallow coastal zone at Admiralty Bay, King George Island, West Antarctic Peninsula (WAP): composition of phytoplankton 

an infl uence of benthic diatoms, in: W. INCT-APA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN. 

Tenório, M.M.B.; Duarte, B.R.; Barreira-Alba, J.J. & Tenenbaum, D.R. (2010). Plankton structure of shallow zone at Admiralty 

Bay, King George Island: chlorophyll biomass and size-fractionated chlorophyll during austral summer 2009/2010, in: 

W. INCT-APA (Ed.). Instituto Nacional de Pesquisas Espaciais (INPE), Natal - RN. 

Trivelpiece, W.Z.; Trivelpiece, S.G. & Volkman, N.J. (1987). Ecological segregation of Adelie, gentoo, and chinstrap penguins 

at King George Island, Antarctica. Ecology, 68(2): 351-61. 

Ushimaru, P.I.; Nakayama, C.R.; Vilella, D. & Pellizari, V.H. (2010). Occurrence of microbial faecal pollution indicators in 

sediment and water samples at Admiralty Bay, King George Island, Antarctica, in: W. INCT-APA (Ed.). Instituto Nacional 

de Pesquisas Espaciais (INPE), Natal - RN. 

Whitfi eld, A.K. & Elliott, M. (2002). Fishes as indicators of environmental and ecological changes within estuaries: A review 

of progress and some suggestions for the future. Journal of Fish Biology, 61(Suppl. A): 229-50. 

Wisnieski, E.; Ceschim, L.M.M.; Aguiar, S.N. & Martins, C.C. (2010). Distribution of sterols in sediment cores from Martel 

Inlet, Admiralty Bay, King George Island, Antarctic Peninsula, in: W. INCT-APA (Ed.). Instituto Nacional de Pesquisas 

Espaciais (INPE), Natal - RN. 



107

1 PLANKTON 

STRUCTURE A IN SHALLOW COASTAL 

ZONE AT ADMIRALTY BAY, KING GEORGE ISLAND, 

WEST ANTARCTIC PENINSULA (WAP): PICO, NANO AND 

MICROPLANKTON AND CHLOROPHYLL BIOMASS 


Denise Rivera Tenenbaum 1,* , José Juan Barrera-Alba 1,** , 

Renatha Barboza Duarte 1 , Márcio Murilo Barboza Tenório 1,*** 

1 Laboratório de Fitoplâncton Marinho, Instituto de Biologia, Universidade Federal do Rio de Janeiro – UFRJ, Rio de Janeiro, RJ, Brazil 

e-mail: *deniser@biologia.ufrj.br; **juanalba@biologia.ufrj.br; ***marcio.tenorio@biologia.ufrj.br 

Abstract: e phytoplankton composition and biomass are being monitored in Admiralty Bay, Antarctic Peninsula since 2002 to 

detect possible interannual changes on a long-term perspective. In this report, we present the preliminary results of the 2009/2010 

monitoring program regarding phytoplankton size-structure and biomass. Even if mean microplankton densities were similar 

between December 2009 and February 2010, diferent phytoplankton groups dominated each sampling period. Pennate diatoms 

showed highest contribution in December, whereas athecate dino agellates were the most abundant microplanktonic group in 

February. Pico and nanoplankton were only detailed during the second sampling period, and results showed that phytoplankton 

were dominated by cells

y epi uorescence microscopy, and furthermore through 

a higher sampling frequency effort. Additionally, the 

composition of microphytobenthos species will be carried 

out to study the e ects of environmental changes on this 

community in the nearshore Antarctic ecosystem. 

In the present study we show preliminary results during 

the OPERANTAR XXVIII, between December 2009 and 

February 2010. 

Materials and methods 

Study area 

Admiralty Bay (62° 03’-12’ S and 58° 18’-38’ W), located at 

King George Island, is a deep ord-like embayment with 500 

m maximum depth at its centre (Rakusa-Suszczewski et al., 

1993). e waters from the bay mix with the deep oceanic 

waters from Bellingshausen and Weddell Seas at its southern 

opening, which connects to the Brans eld Strait (Rakusa- 

Suszczewski, 1980; Lipski, 1987). e maximum depth 

varies between 60 m along the shores and 500 m in the 

centre of the bay. Deep currents generated by tides, frequent 

upwellings, vertical mixing of the entire water column and 

current velocities of 30-100 cm.s −1 in the 0-100 m surface 

stratum are characteristic of the bay (Rakusa−Suszczewski, 

1993). In the context of water column production, Admiralty 

Bay at nearshore can be considered as “high nutrient – low 

chlorophyll” (HNLC) Platt et al. (2003) showing high 

inorganic dissolved nitrogen (16.6-46.9 µM) and phosphate 

(0.2-9.9 µM) concentrations, while chlorophyll levels are 

lower than 1.7 µg.L –1 (Lange et al., 2007). 

Sampling 

The analysis of microplankton and chlorophyll was 

performed from aliquots of the 5 L water samples collected 

with a Van Dorn bottle from surface, middle water column 

and near the bottom (≈30m) at ve stations in December 

2009 and in February 2010. e fractionation analysis 

of pico- and nanoplankton was performed only at three 

stations (AR, MP and CF) in February 2010, when three 

surveys were done. e Admiralty Bay location and the 

position of the sampling stations are shown in Figure 1. 

At the same time, temperature and salinity 

measurements were carried out by the Laboratório 

de Química Orgânica Marinha (LabQOM), Instituto 

Oceanográ co da Universidade de São Paulo ( e Marine 

Organic Chemistry Laboratory of the Oceanographic 

Institute of the University of São Paulo). 

Fixation and preparation of samples 

For microplankton (>20 µm), 1 L aliquots were xed with 

bu ered formaldehyde (2% f.c.). In the laboratory, samples 

were analysed using the settling technique (Utermöhl, 

1958) in an Olympus IX70® inverted microscope at 400x 

magni cation. 

For pico- (

Figure 1. Study area (modifi ed from Moura, 2009) with the position of the sampling sites: Ferraz Station (CF), Botany Point (BP), Machu Picchu (MP), Point 

Thomas (PT), Arctowski (AR). 

stations were tested by a One-Way ANOVA with a Kruskal- 

Wallis test (p < 0.05). Spearman’s correlation factor was also 

calculated. 

Results 

Microplankton and total chlorophyll biomass 

between early and late summer 

Although salinity showed little variation between sampling 

periods, values were on average lower in February 

2010 (33.9 ± 0.2) than in December 2009 (34.2 ± 0.1). 

During the early summer, the water was relatively colder 

(–0.13 ± 0.11 °C) than during late summer (0.68 ± 0.25 °C). 

Although no great di erences in salinity and temperature 

between sampling stations during each period, on Machu 

Picchu (MP) the lowest salinity and temperature were 

observed in December 2009, while at EACF the lowest 

values for both variables were registered in January 2010 

(Figures 2a, b). Total chlorophyll biomass was on average 


higher in early summer (0.34 µg.L –1 ) than in late summer 

(0.20 µg.L –1 ), no significant differences were observed 

among sampling stations inside each sampling period 

(Figures 2c, d). 

An average cellular density of 3 x 103 ± 0.3 x 103 cells.L –1 

was observed for microplankton, with little variation 

between sampling periods (≈103 cells.L –1 ). e contribution 

is shared by the diatoms (mainly at the beginning of 

summer with 56%) and dino agellates (at the end of the 

summer with 68%). Among diatoms the pennate type 

was predominant (90% in December 2009 and 70% in 

February 2010). Athecate forms, especially heterotrophs, 

were more abundant among dinoflagellates during 

February (69%), while thecate forms representing ~70% of 

total dino agellates in December. Among sampling sites, 

microplankton registered maximum cellular density at 

MP due to the predominance of pennate diatoms during 

December 2009 (Figure 2e).

Pico and Nanoplankton abundance and 

size-fractioned chlorophyll in late summer 

During February 2009 pico- and nanoplankton densitiy 

did not show signi cant di erences among sampling sites, 

but di erences were observed among sampling periods 

(p < 0.01). Chla concentrations varying between 0.18 and 

0.74 µg.L –1 were observed, with the size-fraction 75%) and 2-10 µm 

a 

b 

c 

Figure 2. Results of salinity (continuous line), temperature (dotted line), chlorophyll a concentration (µg.L –1 ) and microplankton density (cells.L –1 ) at December 

2009 (a, b and c) and February 2010 (d, e and f). 

size-fraction, while the picoplankton was dominated by 

heterotrophs (~99%). Despite autotrophic cells represented 

only

1970s, 1980s and 1990s, when densities of 10 5 cells.L –1 were 

usually registered (i.e. Kopczynska, 1981; Brandini, 1993; 

Kopczynska, 2008). However densities were similar to those 

observed by Lange et al. (2007) in a study developed during 

the austral summer 2002/2003. 

Dominance of diatoms over dinoflagellates in the 

microplankton fraction has been usually observed for 

Admiralty Bay (Lange et al., 2007; Kopczynska, 2008), 

but a diminished percentage of contribution of diatoms 

in the phytoplankton assemblages was observed in a study 

developed in 2003-2005 (Kopczynska, 2008). Our results 

showed that the contribution of diatoms decrease especially 

during late summer, while at the same time heterotrophic 

dino agellates (i.e. Gyrodinium lachryma) became more 

abundant. 

Pico and Nanoplankton abundance and 

size-fractioned chlorophyll in late summer 

Phytoplankton community at Admiralty Bay during the 

late summer of 2009/2010 was dominated by pico- and 


a b 

c d 

Figure 3. Results at the different sampling periods during February 2010: a) salinity (continuous line) and temperature (dotted line); b) size-fractioned 

chlorophyll a concentration (µg.L –1 ); c) picoplankton density (autotrophs in 10 7 L –1 cells; heterotrophs in 10 9 cells.L –1 ); d) nanoplankton density (10 6 cells.L –1 ). 

nanoplankton, both in abundance and chlorophyll biomass. 

In previous studies the dominance of nano agellates and 

monads for this region had been observed (i.e. Kopczynska, 

1980; Kopczynska, 1981; Brandini, 1993; Kopczynska, 

2008). Maxima of agellates at Admiralty Bay in windless 

days and little variation in atmospheric pressure was 

reported, which resulted in an increase of water column 

stability (Kopczynska, 1981). Although Kopczynska (2008) 

showed the co-dominance of picoplankters from inverted 

microscope cell counting technique at Admiralty Bay, this 

was the rst attempt to quantify the real contribution of 

picoautotrophs to total phytoplankton density and biomass, 

and densities were in the same range of those observed in 

other Antarctic regions (i.e. Umani et al., 2005; Delille et al., 

2007). In the nearshore coastal waters along the Antarctic 

Peninsula, a recurrent shi in phytoplankton community 

structure, from diatoms to cryptophytes, has been 

documented due to high temperatures along the Peninsula 

increasing the extent of coastal melt-water zones promoting

seasonal prevalence of cryptophytes (Moline et al., 2004). 

e dominance of pico and nano-size cells in phytoplankton, 

which are not grazed e ciently by Antarctic krill, will likely 

cause a shi in the spatial distribution of krill and may 

allow also for the rapid asexual proliferation of carbon poor 

gelatinous zooplankton, salps in particular (Moline et al., 

2004), and probably the dominance of heterotrophic 

dino agellates observed during the late summer period of 

this study. 

Conclusion 

In the context of the regional warming trend of WAP, 

preliminary results of the present study showed a shi 

in Admiralty Bay plankton community, with signi cant 

variability both in short- and medium-term scales, from 

day to day and months. Low microplankton densities, 

dominance of dino agellates, mainly heterotrophs, and high 

References 

contribution of autotrophs pico- and nanoplankton to total 

density and biomass in late summer, suggest that changes 

could be occurring in Admiralty Bay food web. us, it is 

necessary to continue the long-term monitoring program 

and the implementation of microvariation sampling 

e ort to identify the factors that are actually in uencing 

phytoplankton populations in this environment. 


To the Instituto Nacional de Ciência e Tecnologia Antártico 

de Pesquisas Ambientais, contracts CNPq n° 574018/2008-5 

and FAPERJ n° E-16/170.023/2008, Laboratório de 

Química Orgânica Marinha (LabQOM- USP), Instituto 

Oceanográfico (USP), Ministério do Meio Ambiente 

(MMA), Ministério de Ciência e Tecnologia (MCT) and 

Comissão Interministerial para os Recursos do Mar (CIRM). 

Also to Rafael Bendayan de Moura for Admiralty Bay map. 

Brandini, F.P. (1993). Phytoplankton biomass in an Antarctic coastal environment during stable water conditions - implications 

for the iron limitation theory. Marine Ecology Progress Series, 93: 267-75. 

Delille, D. (2004) Abundance and function of bacteria in the Southern Ocean. Cellular and Molecular Biology, 50(5): 543-51 

Delille D.; Gleizon, F. & Delille, B. (2007). Spatial and temporal variations of bacteria and phytoplankton in a subAntarctic 

coastal area (Kerguelen Archipelago). Journal of Marine Systems, 68(3-4): 366-80 

Kopczynska, E.E. (1980). Small scale vertical distribution of phytoplankton in Ezcurra Inlet, Admiralty Bay, South Shetland 

Islands. Polish Polar Research, 1: 77-96. 

Kopczynska, E.E. (1981). Periodicity and composition of summer phytoplankton in Ezcurra Inlet, Admiralty Bay, King George 

Island, South Shetland Islands. Polish Polar Research, 2: 55-70. 

Kopczynska, E.E. (2008). Phytoplankton variability in Admiralty Bay, King George Island, South Shetland Islands: six years 

of monitoring. Polish Polar Research, 29(2): 117-139. 

Lange, P.K.; Tenenbaum, D.R.; Braga, E.S.B. & Campos, L.S. (2007). Microphytoplankton assemblages in shallow waters at 

Admiralty Bay (King George Island, Antarctica) during the summer 2002-2003. Polar Biology, 30(11): 1483-92. 

Lipski, M. (1987). Variations of physical conditions, nutrients and chlorophyll a contents in Admiralty Bay (King George Island, 

South Shetland Islands). Polish Polar Research, 8: 307-32. 

Marshall G.J.; Lagun V. & Lachlan-Cope T.A. (2002). Changes in Antarctic Peninsula tropospheric temperatures from 1956 

to 1999: a synthesis of observations and reanalysis data. International Journal of Climatology, 22(3): 291-310. 

Martinussen, I. & Thingstad. T.F. (1991). A simple double-staining method for enumeration of autotrophic and heterotrophic 

nano- and picoplankton. Marine Microbial Food Webs, 5: 5-11. 

Moline, M.A.; Claustre, H.; Frazer, T.K.; Schofi eld, O. & Vernet, M. (2004). Alteration of the food web along the Antarctic Peninsula 

in response to a regional warming trend. Global Change Biology, 10: 1973-1980, doi: 10.1111/j.1365-2486.2004.00825.x 


113

Moura, R.B. (2009). Estudo taxonômico dos Holothuroidea (Echinodermata) das Ilhas Shetland do Sul e do Estreito de 

Bransfi eld, Antártica. Dissertação de Mestrado, Museu Nacional, Universidade Federal do Rio de Janeiro. 

Neveux, J. & Lantoine, F. (1993). Spectrofl uorometric assay of chlorophylls and phaeopigments using the least squares 

approximation technique. Deep-Sea Research I, 40(9): 1747-65. 

Platt T.; Broomhead D.S.; Sathyendranath S.; Edwards A.M. & Murphy E.J. (2003). Phytoplankton biomass and residual 

nitrate in the pelagic ecosystem. Proceedings of the Royal Society A, 459: 1063-73. 

Rakusa-Suszczewski, S. (1980) Environmental conditions and the functioning of Admiralty Bay (South Shetland Islands) as 

part of the near shore Antarctic ecosystem. Polish Polar Research, 1(1):11-27. 

Rakusa-Suszczewski S.; Mietus M. & Piasecki, J. (1993). Weather and climate. In: Rakusa-Suszczewski, S. (ed.) The maritime 

coastal ecosystem of Admiralty Bay. Warsaw: Polish Academy of Science, pp 19-25. 

Umani, F.S.; Monti, M.; Bergamasco, A.; Cabrini, C.; De Vittor, C.; Burba, N. & Del Negro, P. (2005). Plankton community 

structure and dynamics versus physical structure from Terra Nova Bay to Ross Ice Shelf (Antarctica). Journal of Marine 

Systems, 55(1-2): 31-46. 

Utermöhl H. (1958). Zur Vervollkommung der quantitativen Phytoplankton-Methodik. Mitteilungen der Internationale Vereinigung 

für Teoretische und Angewandte Limnologie, 9: 1-38. 


PLANKTON STRUCTURE A IN SHALLOW COASTAL 

ZONE AT ADMIRALTY BAY, KING GEORGE ISLAND, WEST 

ANTARCTIC PENINSULA (WAP): CHLOROPHYLL BIOMASS 

AND SIZE-FRACTIONATED CHLOROPHYLL DURING 

AUSTRAL SUMMER 2009/2010 

Márcio Murilo Barboza Tenório 1,* , Renatha Barboza Duarte 1 , 

José Juan Barrera-Alba 1,** , Denise Rivera Tenenbaum 1,*** 


e-mail: * marcio.tenorio@biologia.ufrj.br; ** juanalba@biologia.ufrj.br; *** deniser@biologia.ufrj.br 

Abstract: Chlorophyll a concentration and size structure of the phytoplankton community were studied in Admiralty Bay in 

early and late summer of 2009/2010, using spectro uorometry chlorophyll analysis. Chlorophyll a biomass was generally low 

(


Study area 

Admiralty Bay (62° 03’-12’ S and 58° 18’-38’ W), located 

at King George Island (Figure 1), is a deep fjord-like 

embayment with 500 m maximum depth at its centre 

(Rakusa-Suszczewski et al., 1993). e waters from the bay 

mix with the deep oceanic waters from the Bellingshausen 

and Weddell Seas at its southern opening, which connects 

to the Brans eld Strait (Rakusa-Suszczewski, 1980; Lipski, 

1987). e maximum depth varies between 60 m at the 

shores and 500 m in the centre of the bay. Deep currents 

generated by tides, frequent upwellings, vertical mixing 

and current velocities of 30-100 cm.s –1 in the 0-100 m 

surface stratum are characteristic of the bay (Rakusa- 

Suszczewski et al., 1993). 

Sampling 

e fractionate analysis of chlorophyll a was performed 

from splits of the 5 L water sample collected using a Niskin 


bottle from the surface, middle water column and near the 

bottom (≈30 m) at ve stations in December 2009 and in 

February 2010. At the same time temperature and salinity 

analyses were carried out by the Laboratório de Química 

Orgânica Marinha (LabQOM), Instituto Oceanográ co da 

Universidade de São Paulo. 

Chlorophyll a and phaeophytin a 

Water samples (2 L) were ltered onto Whatman® GF/F 

(Ø 47 mm) for total pigment analyses, while 0.8-2 L were 

used for the size structure study. In the latter case, during 

late summer sampling at CF, MP and AR stations (Figure 1), 

water sampled at 3 depths was fractionated by serial 

ltration on 10 µm and 2 µm polycarbonate lters and GF/F 

(Ø 47 mm). e lters were folded, placed into a 1.2 mL 

cryotube and immediately quick-frozen in liquid nitrogen 

(–196 °C) and stored at −80 °C. For pigment extraction, 

GF/F lters were dipped in 5.4 mL of 100% acetone ( nal 

concentration ≈90% acetone taking into account water 

retention by the lter (≈0.621 ± 0.034 mL) and ground 

Figure 1. Study area (modifi ed from Moura, 2009) with the position of the sampling sites: Ferraz Station (CF), Botany Point (BP), Machu Picchu (MP), Thomas 

Point (TP), Arctowski (AR).

with the freshly broken end of a glass rod, and le in the 

dark at 4 °C for a 12 hours extraction. Polycarbonate lters, 

on the other hand, were just le in the dark at 4 °C for a 

24 hours in 5 mL of 90% acetone. Following extraction, 

the tubes were centrifuged for 5 minutes at 3500 rpm and 

the extracted uorescence was measured with a Varian 

Cary Eclipse® spectrofluorometer. Concentrations of 

chlorophyll-a and phaeophytin-a were assessed using a 

modi ed version of Neveux and Lantoine’s (1993) method. 

e modi cations were as follows: 1) data acquisition was 

performed by recording the uorescence emission spectra 

for each of 15 excitation wavelengths (3-nm increments 

from 390 to 432 nm), emission spectra were recorded at 

4 nm intervals from 659-715 nm, yielding 29 data points 

for each spectrum. Pigment concentrations were estimated 

from the resulting 435 data points, and 2) where the least 

squares approximation technique was constrained to discard 

negative solutions. 

Statistical analyses 

Di erences among surveys and sampling stations were 

tested using a One-Way ANOVA with a Kruskal-Wallis test 

(p < 0.05). Spearman’s correlation factor was also calculated. 

Results 

ermohaline structure 

During the sampling period, water temperature was 

characterized both by spatial and vertical homogeneity. Early 

summer presented colder waters (0.09 ± 0.44 °C, n = 60) 

than those observed during late summer (0.81 ± 0.23 °C, 

n = 45). Negative values were observed during early summer 

and increased throughout the season (Figure 2a). Although 

salinity decreased during the sampling period, mean values 

were similar between early summer (34.2 ± 0.1, n = 60) and 

late summer (34.1 ± 0.2, n = 45) (Figure 2b). During late 

summer, inner sampling stations (CF, BP and MP) showed 

the greatest changes in surface salinity, mainly on 13th and 

19th February (Figure 2b). 

Chlorophyll a biomass and size structure 

Chlorophyll-a (Chla) biomass was often low, and varied 

from 0.34 µg.L-1 (± 0.07, n = 60) to 0.47 µg.L-1 (±0.21, 

n = 45) during early and late summer, respectively, with 

no great variability observed among stations and vertical 

profi les during each period. Values lower than 0.5 µg.L-1 were observed in 93% and 56% of the samples during late 

and early summer, respectively. Chla increased in both 

periods, especially during late summer, when biomass 

varied from 0.24 to 0.65 µg.L-1 (Figure 3a). The increasing 

in Chla biomass in late summer was positively correlated 

with water temperature (r = 0.39; p < 0,05). In late summer, 

picoplanktonic fraction (10 µm accounted on average for only 19% 

(± 8.6, n = 36); and this contribution decreased over 50% 

towards the end of the sampling period, mainly due to the 

a b 

Figure 2. Temporal variation of water temperature °C (a) and salinity (b) in Admiralty Bay during December 2009 and February 2010. 


117

increase of picoplankton contribution. As observed for total 

Chla biomass, the vertical and spatial variability of size 

fractionated Chla was not signifi cantly different. 

Discussion 

Hidrology 

Early and late summer values of temperature and salinity 

observed in the present study were similar to those reported 

in previous studies (Brandini, 1993; Lange et al., 2007). e 

greatest variability in surface salinity observed during late 

summer at the most inner stations (CF, BP and MP) was 

mainly due to the in ow of freshwater, which increased 

from melting snow and glacial ice as a consequence of the 

rise in temperature. 

Chlorophyll-a, an indicator of overall phytoplankton 

abundance and chlorophyll a size structure 

Low Chla biomass (10 μm 

represented only 19% of the Chla biomass. Previous studies 

in the same area have reported nano-size cell dominance 

on phytoplankton (Brandini, 1993; Kopczynska, 2008). 

Size-class distribution in the present study were similar to 

those observed in the vicinity of Elephant Island (Weber & 

El-Sayed, 1987), where the contribution to total Chla ranged 

between 39-98% for nanoplankton and between 5-74% for 

picoplankton. Moreau et al. (2010) also observed a piconanoplankton 

dominance and microplankton in very low 

abundances at Melchior Archipelago (Antarctic Peninsula) 

during a spring-season study. 

Phytoplankton biomass and growth in the water column 

at Admiralty Bay can be strongly in uenced by wind-driven 

turbulence (Brandini & Rebello, 1994). In coastal areas wind

driven turbulence may have a positive e ect, leading to a 

phytoplankton biomass accumulation as a consequence of 

benthic diatoms (generally larger than 10 µm) resuspension, 

and, consequently, a ecting secondary production. In this study 

they observed Chla increasing during a low wind and water 

column stabilization period a er an intense upwelling event 

promoted by wind stress. e low biomass and low contribution 

of cells >10 µm to Chla observed in the present study suggest 

a long low-wind period; however, this will need to be checked 

later in our studies. 

e temperature sensitivity of planktonic organisms 

suggests that Southern Ocean plankton communities may 

be particularly sensitive to global warming (Wright et al., 

2009). In the nearshore coastal waters along the Antarctic 

Peninsula, a recurrent shi in phytoplankton community 

structure, from diatoms to cryptophytes, has been 

documented (Moline et al., 2004). A change in the size 

spectrum of Southern Ocean phytoplankton would be 

expected to have serious consequences for krill and 

other herbivores that are adapted to a diet of nano- and 

microplankton, and would also a ect the dynamics of the 

microbial loop and the transport of carbon to the deep 

ocean (Wright et al., 2009). ese observations highlight 

the importance of a long-term monitoring study of Chla 

size fraction data in this region. 

References 

Conclusion 

The preliminary results of the present study showed a 

relatively spatial homogeneity in chlorophyll a concentration. 

Temporal variation presented a significant variability 

between early and late summer and among the three 

samplings during late summer, highlighting that a shortterm 

temporal variation study is necessary to understand 

the environmental e ects on phytoplankton organisms. 

Phytoplankton populations were co-dominated by nano and 

picoplanktonic cells, which represented more than 80% of 

chlorophyll a concentrations. Chlorophyll a biomass and 

size fractionated studies in the Admiralty Bay proved to 

be a good tool for monitoring the global e ect of changes 

on the region. 




and FAPERJ n° E-16/170.023/2008, Laboratório de Química 

Orgânica Marinha (LabQOM- USP), Instituto Oceanográ co 

(USP), Ministério do Meio Ambiente (MMA), Ministério de 

Ciência e Tecnologia (MCT) and Comissão Interministerial 

para os Recursos do Mar (CIRM). To FAPERJ/CAPES for the 

post-doctoral scholarship to M.M.B. Tenório. 

Brandini, F.P. & Kutner, M.B.B. (1986). Composition and distribution of summer phytoplankton in the Bransfi eld Strait, Antarctica. 

Anais da Academia Brasileira de Ciências, 58: 1-11. 

Brandini, F.P. (1993). Phytoplankton biomass in an Antarctic coastal environment during stable water conditions - implications 

for the iron limitation theory. Marine Ecology Progress Series, 93: 267-75. 

Brandini, F.P. & Rebello, J. (1994). Wind fi eld effect on hydrography and chlorophyll dynamics in the coastal pelagial of 

Admiralty Bay, King George Island, Antarctica. Antarctic Science, 6(4): 433-42. 

Hewes, C.D.; Reiss, C.S. & Holm-Hansen, O. (2009). A quantitative analysis of sources for summer time phytoplankton 

Variability over 18 years in the South Shetland Islands (Antarctica) region. Deep-Sea Research I, 56(8):1230–41. 

Jacques, G. & Panouse, M. (1991). Biomass and composition of size fractionated phytoplankton in the WeddelI-Scotia 

Confl uence area. Polar Biology, 11(5): 315-28. 

Kang, S. & Lee, S. (1995). Antarctic phytoplankton assemblages in the western Bransfi eld Strait region, February 1993: 

composition, biomass, and mesoscale distributions. Marine Ecology Progress Series, 129: 253-67. 


119

Kopczynska, E.E. (2008). Phytoplankton variability in Admiralty Bay, King George Island, South Shetland Islands: six years 

of monitoring. Polish Polar Research, 29(2): 117-39. 

Lange, P.K.; Tenenbaum, D.R.; Braga, E.S.B & Campos, L.S. (2007). Microphytoplankton assemblages in shallow waters at 


Lipski, M. (1987). Variations of physical conditions, nutrients and chlorophyll a contents in Admiralty Bay (King George Island, 

South Shetland Islands). Polish Polar Research, 8: 307-32. 

Marrari, M.; Kendra, L.D. & Hu, C. (2008). Spatial and temporal variability of SeaWiFS chlorophyll a distributions west of the 

Antarctic Peninsula: Implications for krill production. Deep-Sea Research II, 55(3-4): 377-92. 

Moline, M.A.; Claustre, H.; Frazer, T. K.; Schofi eld, O. & Vernet, M. (2004). Alteration of the food web along the Antarctic 

Peninsula in response to a regional warming trend. Global Change Biology, DOI: 10.1111/j.1365-2486.2004.00825.x 

Montes-Hugo, M.; Doney, S.C.; Ducklow, H.W.; Fraser, W.; Martinson, D.; Stammerjohn, S.E. & Schofi eld, O. (2009). Recent 

changes in phytoplankton communities associated with rapid regional climate change along the western Antarctic 

Peninsula. Science, 323: 1470-73. 

Moreau, S.; Ferreyra, G.A.; Mercier, B.; Lemarchand, K.; Lionard, M.; Roy, S.; Mostajir, B.; Roy, S.; van Hardenberg, B. & 

Demers, S. (2010). Variability of the microbial community in the western Antarctic Peninsula from late fall to spring during 

a low ice cover year. Polar Biology, DOI: 10.1007/s00300-010-0806-z 

Moura, R. B. (2009). Estudo taxonômico dos Holothuroidea (Echinodermata) das Ilhas Shetland do Sul e do Estreito de 

Bransfi eld, Antártica. Dissertação de Mestrado, Museu Nacional, Universidade Federal do Rio de Janeiro. 

Neveux, J.; Tenório, M.M.B.; Jacquet, S.; Torréton, J.-P.; Douillet, P.; Ouillon, S. & Dupouy, C. (2009). Chlorophylls and 

phycoerythrins as markers of environmental forcings including Cyclone Erica effect (March 2003) on phytoplankton 

in the South west Lagoon of New Caledonia and oceanic adjacent area. International Journal of Oceanography, 

DOI:10.1155/2009/232513. 

Neveux, J. & Lantoine, F. (1993). Spectrofl uorometric assay of chlorophylls and phaeopigments using the least squares 

approximation technique. Deep-Sea Research I, 40(9): 1747-65. 

Platt T.; Broomhead D.S.; Sathyendranath S.; Edwards A.M. & Murphy E.J. (2003). Phytoplankton biomass and residual 

nitrate in the pelagic ecosystem. Proceedings of the Royal Society A, 459:1063-73. 

Rakusa-Suszczewski, S. (1980). Environmental conditions and the functioning of Admiralty Bay (South Shetland Islands) as 

part of the near shore Antarctic ecosystem. Polish Polar Research, 1(1):11-27. 

Rakusa-Suszczewski S.; Mietus M. & Piasecki, J. (1993). Weather and climate. In: Rakusa-Suszczewski, S. (ed.) The maritime 

coastal ecosystem of Admiralty Bay. Warsaw: Polish Academy of Science, pp 19-25. 

Rodriguez, V. & Guerrero, F.J. (1994). Chlorophyll a size-fractionated summer phytoplankton blooms at a coastal station in 

Málaga Bay, Alboran Sea. Estuarine, Coastal and Shelf Science, 39(4):413-9. 

Weber, L.H. & El-Sayed, S.Z. (1987). Contributions of the net, nano- and picoplankton to the phytoplankton standing crop 

and primary productivity in the Southern Ocean. Journal of Plankton Research, 9(5): 973:94. 

Wright, S.W.; Ishikawa, A.; Marchant, H.J.; Davidson, A.T.; van den Enden, R.L. & Nash, G.V. (2009). Composition and 

signicance of picophytoplankton in Antarctic waters. Polar Biology, 32(5): 797-808. 


PLANKTON STRUCTURE A IN SHALLOW 

COASTAL ZONE AT ADMIRALTY BAY, KING GEORGE 

ISLAND WEST ANTARCTIC PENINSULA (WAP): 

COMPOSITION OF PHYTOPLANKTON AND 

INFLUENCE OF BENTHIC DIATOMS 

Denise Rivera Tenenbaum 1,* , Priscila Lange 1,3 , Luciano F. Fernandes 2 , 

Mariana Calixto-Feres 2 , José Juan Barrera-Alba 1 , Virgínia M. T. Garcia 3 


2 Departamento de Botânica, Setor de Ciências Biológicas, Universidade Federal do Paraná – UFPR, Curitiba, PR, Brazil 

3 Laboratório de Fitoplâncton e Microorganismos Marinhos, Instituto de Oceanografi a, 

Universidade Federal do Rio Grande – FURG, Rio Grande, RS, Brazil 

*e-mail: deniser@biologia.ufrj.br 

Abstract: e phytoplankton composition and biomass are being monitored in Admiralty Bay, Antarctic Peninsula since 2002 to 

detect possible interannual changes on a long-term monitoring perspective. In this report, we present the results of the 2009/2010 

monitoring program regarding the phytoplankton composition during the PROANTAR XVIII operation. e community 

was dominated by both planktonic and benthic diatoms. A total of 140 species were found, many of them awaiting further 

morphological studies to determine their speci c identity. A preliminary assessment of habitat preferences was made, showing 

that the diatoms in the Admiralty Bay came from distinct substrates like ice, rocks, sediments, plankton and macroalgae. ese 

results indicate that benthic microalgae, particularly diatoms, play an important role in primary productivity of the pelagic 

community in inshore waters. e next steps will be to re ne identi cation to analyse the whole water samples and to relate the 

results with the environmental and hydrographical features in Admiralty Bay. 

Keywords: phytoplankton, monitoring, Admiralty Bay, Antarctic Peninsula 

Introduction 

Phytoplankton is the main contributor to primary 

production in the Antarctic food web, making the 

organic carbon available to most of the higher trophic 

level consumers; for instance, the krill Euphausia superba 

(Knox, 1994). Summer phytoplankton blooms, are usually 

composed of diatoms (e.g. Fragilariopsis, Nitzschia, Porosira 

and Corethron), particularly when the preceding winter is a 

long one, and the ice cover is greater, o ering more substrate 

for diatoms apart from the water column, which is, in turn, 

dominated by Asteromphalus, Chaetoceros, alassiosira (El- 

Sayed & Fryxell, 1993). A er the decaying of diatom bloom, 

the prymnesiophyte Phaeocytis predominates. In warmer 

winters cryptophytes become also important a ecting small 

zooplankton consumers such as krill and microcrustaceans 

(Moline et al., 2004). e Antarctic phytoplankton, like 

other marine organisms, have been a ected by the recent 

global climate changes registered over the past three 

decades. e main physical and chemical consequences to 

the water column are: 1) the progressive delay in ice covering 

during autumn and the earlier ice melting in Spring; 


3 

121

2) the warming of seawater southward; 3) the freshening 

of saltwater in neritic regions; and 4) alterations in nutrient 

concentrations. Moreover, the ozone depletion has led to a 

dramatic increase of damaging ultra violet radiation, which 

has been shown to induce photoinhibition of photosynthesis 

in phytoplankton. erefore, the phytoplankton community 

can be used as indicator of global changes, especially when 

long term data is gathered in monitoring stations, providing 

more consistent results and allowing for the prediction 

of future negative effects from human interference. 

Indeed, some studies have already detected a shi ing in 

phytoplankton communities due to climate changes along 

the Western Antarctic Peninsula (WAP). In the northern 

region, phytoplankton is being replaced by temperate, ice 

avoiding non-diatom species, with a concurrent decline 

of primary production, while in the southern sector the 

phytoplankton has increased in biomass contribution, 

becoming diatom based and displaying higher production 

(Montes-Hugo et al., 2009). These strong latitudinal 

shi s at the base of the food web can be the cause of the 

observed reorganization of the biota in the Northern 

region of the Antarctic Peninsula in recent years, especially 

the krill Euphausia superba and the Antarctic silver sh 

Pleurogramma antarcticum. A phytoplankton monitoring 

program was established in 2002 at Admiralty Bay, aiming 

to record the composition, biomass and its relationship 

with environmental parameters in shallow waters (

Figures 1-23. Common species found in Admiralty Bay, Antartic Peninsula: 1) Fragilaria striatula; 2, 3) Synedropsis recta; 4) Licmophora belgicae; 

5) L. antarctica; 6) Licmophora sp.; 7, 8) Achnanthes brevipes; 9, 10) Cocconeis sp.; 11) Cocconeis sp.; 12) Cocconeis "antiqua"; 13, 14) Cocconeis sp.; 

15) Cocconeis sp.; 16) Navicula sp.; 17) Navicula cf directa; 18) Pseudogomphonema kamtschaticum; 19) Amphora sp.; 20) Fragilariopsis obliquecostata; 

21) Fragilariopsis curta; 22) Fragilariopsis cylindrus; 23) Pseudo-nitzschia sp. Scale bar: 10 µm. 


123

Table 1. List of genera (number of species) and habitat preference of commonly found diatoms in Admiralty Bay during 2002-2010 monitoring program of 

phytoplankton. 

Achnanthes (4) B Diploneis (1) P,Ep,El Hantzschia (1) Ep Pinnularia (1) P Stauroneis (1) P 

Actinocyclus (2) P Entomoneis (1) Ep,El Haslea (1) E, B Plagiotropsis (1) P Stellarima (1) P 

Amphora (4) B, P Ephemera (1) P Licmophora (6) B Pleurosigma (2) Ep,El,P Surirella (10) El, B 

Asteromphalus (1) P Eucampia (1) P Manguinea (1) P Porosira (2) P Synedra (1) E, El 

Chaetoceros (7) P Fragilaria (1) Ep,Ep Melosira (2) P Proboscia (1) P Synedropsis (2) B 

Cocconeis (12) B Fragilariopsis (10) Ep Membraneis (1) P Pseudogomphonema (2) B Tabularia (1) B 

Corethron (2) Ep, P Gephyria (1) E Navicula (12) B,P Pseudo-nitzschia (2) P Thalassionema (1) P 

Coscinodiscus (3) P Gomphonema (3) B Nitzschia (7) B Rhizosolenia (2) P Thalassiosira (6) P 

Cylindrotheca (1) Ep Grammatophora (1) B Odontella (3) P Rhoicosphenia (1) B Thalassiothrix (1) P 

Dactyliosolen (1) P Gyrosigma (1) Ep,El Parlibellus (1) El Rhopalodia (1) B 

B: benthic anywhere; E: epiphytic; Ep: eponthic; El: epilithic; P: planktonic. 

all of them in the water column. During the phytoplankton 

analysis based on whole water samples used in the 

monitoring program, many species could not be identi ed 

(Lange et al., 2007). is problem was partially solved when 

light microscope slides were prepared. Even so, many species 

still remained unidenti ed until more advanced techniques 

were used, like electron microscopy. 

Discussion 

A fairly high diversity of phytoplankton was found during 

the 2002-2010 monitoring, especially taking into account 

the contribution of benthic community to the water 

column. Usually diatoms dominated the composition 

and the biomass of the plankton community. Other 

research programs on phytoplankton monitoring, near 

the Polish Station have found similar results. Kopczynska 

(2008) reviewed the outcomes of plankton monitoring 

in Admiralty Bay and found the diatoms Fragilariopsis, 

Pseudo-nitzschia and alassiora to be abundant in inshore 

locations while Proboscia and alasiosira species were 

found at other sites. In our study, many microalgae (like 

Cocconeis and Pseudogomphonema) are known to live 

associated to a substrate in some way. It is becoming clear 

that they play an important role in the pelagic primary 

production during the austral summer. Several authors 

found that microphytobenthic diatoms were as important 


as the planktonic species, and even surpassed its biomass, 

in shallow areas and inlets around the Antarctic Peninsula 

(Ahn et al., 1994, 1997; Kang et al., 1997). e relevance 

of the origin of benthic diatoms as regards their substrate 

a nity has been emphasized, except for ice algae (s. review 

of Medlin & Priddle, 1990). ere are four recent studies 

that specifically focus on benthic species other than 

originating from ice (Everett & omas, 1986; Kloser, 1998; 

Al-Handal & Wul , 2009a, b). e authors analyzed the 

composition of microalgae growing on di erent substrates 

such as sediments and various macroalgae species in Potter 

Cove, Antarctic Peninsula, recording some preference for 

substrate among the diatoms, as well the large dominance 

of some genera like Licmophora, Cocconeis, Pleurosigma 

and Pseudogomphonema. All these authors claimed that 

the investigations on taxonomy and ecology of diatoms 

are urgently needed, especially because they have become 

scarce, and they can provide background data to evaluate 

the impacts of global changes over phytoplankton and 

microphytobenthos (Wul et al., 2009). In this preliminary 

examination of phytoplankton samples, some taxonomic 

and nomenclatural problems have been detected, which 

will be dealt with through electronic microscopy and 

closer examination of the literature. Despite taxonomical 

di culties, it was possible in this research to underline the 

role of benthic diatoms in biodiversity and habitat ecology 

in the studied Antarctic environment.




and FAPERJ n° E-16/170.023/2008. e Center of Electron 

Microscopy of UFPR for making available the laboratory 

References 

facilities and the electron microscopes. Ministério do Meio 

Ambiente (MMA), Ministério de Ciência e Tecnologia 

(MCT) and Comissão Interministerial para os Recursos do 

Mar (CIRM). M. C.- F. is supported by the UFPR/Botany 

graduate program and the REUNI system. 

Al-Handal, A. & Wulff, A. 2009a. Marine epiphytic diatoms from the shallow sublittoral zone in Potter Cove, King George 

Island, Antarctica. Botanica Marina 51(5): 411-35. 

Al-Handal, A. & Wulff, A. 2009b. Marine benthic diatoms from Potter Cove, King George Island, Antarctica. Botanica Marina, 

51(1): 51-68. 

Ahn, I.Y.; Chung, H.; Kang, J.S. & Kang, S.H. (1994). Preliminary studies on the ecology of neritic marine diatoms in Maxwell 

Bay, King George Island, Antarctica. The Korean Society of Phycology, 9: 37-45. 

Ahn, I.Y.; Chung, H.; Kang, J.S. & Kang, S.H. (1997). Diatom composition and biomass variability in nearshore waters of 

Maxwell Bay, Antactica, during the 1992/1993 austral summer. Polar Biology, 17(2): 123-30. 

El-Sayed, S.Z. & Fryxell, G.A. (1993). Phytoplankton. In: Friedmann, E.I. Antarctic Microbiology. New York: Willey-Liss p. 65-122. 

Hasle, G.R. & Fryxell, G.A. (1970). Diatoms: cleaning and mounting for light and electron microscope. Transactions of 

American Microscopical Society, 89: 469-474. 

Hasle, G.R. & Syvertsen, E.E. (1997). Marine Diatoms. In Tomas,C.R. (ed.), Identifying marine phytoplankton. Academic 

Press a division of Harcourt Brace and Company, San Diego, USA, 2:5-385. 

Kang, J.S.; Kang, S.H.; Lee, J.H.; Chung, K.H. & Lee, M.Y. (1997). Antarctic Micro- and Nano-sized phytoplankton assemblages 

in the surface water of Maxwell Bay during the 1997 austral summer. Korean Journal of Polar Research, 8: 35-45. 

Kloser, H. (1998). Habitats and distribution patterns of benthic diatoms in Potter Cove (King George Island, Antarctica) and 

its vicinity. Berichte zur Polarforschung, 299: 105. 

Knox, G.A. (1994). The biology of the Southern Ocean. Cambridge University Press. 193: 220. 

Kopczynska, E. (2008). Phytoplankton variability in Admiralty Bay, King George Island, South Shetland Islands: six years of 

monitoring. Polish Polar Research, 29(2): 117-39. 

Lange, P.K.; Tenenbaum, D.R.; Braga, E.S.B. & Campos, L.S. (2007). Microphytoplankton assemblages in shallow waters at 


Medlin, L.K. & Priddle, J. (1990). Polar marine diatoms. British Antarctic Survey/NERC. 

Moline, M.A.; Claustre, H.; Frazer, T.K.; Schofi eld, O. & Vernet, M. (2004). Alteration of the food web along the Antarctic 

Peninsula in response to a regional warming trend. Global Change Biology, 10: 1973-80. 

Montes-Hugo, M.; Doney, S.C.; Ducklow, H.W.; Fraser, W.; Martinson, D.; Stammerjohn, S.E. & Schofi eld, O. (2009). Recent 

changes in phytoplankton communities associated with rapid regional climate change along the western Antarctic 

Peninsula. Science, 323: 1470- 73. 

Round, F.E.; Crawford, R.M. & Mann, D.G. (1990). Diatoms: Biology & Morphology of the genera. Cambridge University 

Press: 747pp. 

Utermöhl, H. (1958). Perfeccionamento del método cuantitativo de fi toplancton. Comun. Assoc. Int. Limnol. Teor. Apl. 9: 1-89. 

Wulff, A.; Iken, K.; Quartino, M.L.; Al-Handal, A.; Wiencke, C. & Clayton, M.N. (2009). Biodiversity, biogeography and zonation 

of marine benthic micro- and macroalgae in the Arctic and Antarctic. Botanica Marina, 52(6): 491–507. 


125

4 EFFECT 

OF TEMPERATURE, SALINITY AND FLUORIDE 

ON THE PLASMATIC CONSTITUENTS CONCENTRATION 

OF ANTARCTIC FISH Notothenia rossii 

(Richardson, 1844) 


Edson Rodrigues 1,* , Lucélia Donatti, Cecília N. K. Suda 1 , Edson Rodrigues Júnior 2 , 

Mariana Feijó de Oliveira 1 , Cleoni dos Santos Carvalho 3 and Gannabathula Sree Vani 1 

1 Departamento de Biologia, Instituto Básico de Biociências, Universidade de Taubaté – UNITAU, 

Campus do Bom Conselho, Taubaté, SP, Brazil 

2 Programa de Pós-graduação em Biologia Molecular e Celular, Centro Politécnico, 

Universidade Federal do Paraná – UFPR, Curitiba, PR, Brazil 

3 Departamento de Biologia, Universidade Federal de São Carlos – UFSCar, Campus Sorocaba, Sorocaba, SP, Brazil 

*e-mail: rodedson@gmail.com 

Abstract: e Antarctic marine environment has unique characteristics such as isolation, low and even temperatures, as well 

as high levels of uoride in the trophic web. e objective of the present study is to verify the e ect of temperature, salinity 

and dietary uoride in the diet on the levels of plasma constituents of the sh Notothenia rossii. e sample collection and 

the bioassay were conducted at Antarctic scienti c station Comandante Ferraz. e sh were acclimated in an aquarium at 

temperatures of 0 and 4 °C; salinity of 35 and 20 psu, using feed with and without uoride. e combination of these variables 

resulted in 8 experimental groups. e calcium serum levels were reduced in hyposaline stress and temperature elevation reduced 

the plasmatic levels of magnesium and chloride. e trophic uoride isolatedly was not capable of changing the non-protein 

electrolytes levels. 

Keywords: Antarctica, biomarker, blood, Nothothenia rossii 

Introduction 

e compiled ichthyofauna data of the south Antarctic 

Polar Frontier shows the existence of 322 species distributed 

in 50 families dominated by benthonic sh (70%) of the 

Notothenioidei family (Eastman, 2005). Even though the 

marine sh are represented by approximately 16,764 species, 

the Antarctica ichthyofauna is only 1.9% of this species 

(Eschmeyer et al., 2010). e low Antarctic sh diversity has 

been correlated with, the tectonic events which physically 

isolated this region, low temperatures and the probable 

alterations occurred in the trophic structure during the 

Miocene (Eastman, 2005). 

e Antarctic demerso-pelagic sh Notothenia rossii 

is one of the four dominant species of the South Shetland 

Islands (Casaux et al., 1990) and can be easily captured 

using a sh hook. Its diet is very diversi ed and includes 

sh, krill, gastropods, polychaetes among other organisms 

(Barrera-Oro, 2002). e vertical migration during summer 

permits its feeding through pelagic organisms (Casaux et al., 

1990), especially krill, this explains the high levels of bone 

tissue uoride, even though the uoride tolerance is in 

study (Camargo, 2003). e thermal metabolic plasticity 

limit of Antarctic sh has raised questions about the high

temperature impact in the adaptation of this ichtyofauna 

(Mark et al. , 2005). 

Considered as the most pristine region of the planet, 

the increase in antrophic activity (scienti c and tourism) 

in Antarctica is a factor of questioning for the scientists. 

Admiralty Bay in the King George Island, South Shetland 

Islands Archipelago, has a narrow cove similar to ords 

(Barnes et al., 2006) with inshore surface water salinity 

values uctuating between 16.4 to 34.2 psu (Romão et al,. 

2001). Admiralty Bay is an Antarctic Specially Managed 

Area (ASMA) and shelters five countries scientific 

stations (Brazil, Ecuador, Poland, Peru and USA).The 

monitoring of Admiralty Bay ASMA is the main scope of 

the National Institute of Antarctic Science, Technology 

and Environmental Research (INCT-APA) of the Brazilian 

Antarctic Program. Using a long time series of the 

physical, chemical and biological processes, INCT-APA 

is interested in understanding the natural and anthropic 

impacts on the region. The studies about biomarker 

responses to environmental pollution integrate the activities 

of INCT-APA. The biomarkers research for ASMA of 

Admiralty bay has the objective of identifying su ciently 

sensible biological responses to di erentiate the natural 

impact for those caused by pollutants. e aim of the present 

study was to investigate how warming, salinity reduction 

and the wide uoride distribution in the Antarctic trophic 

web will be inducing biochemical responses in the blood 

of N. rossii Antarctic sh. 


Animals 

Specimens of N. rossii were collected using sh hooks, in 

Punta Plaza (62º 05' 35.8" S and 58º 24' 11.8" W) and Glacier 

Ecology (62º 10' 11.9" S and 58º 27' 17.2" W), Admiralty Bay, 

King George island, Antarctica, at depths of 10-20 m, during 

the summer of 2009-2010. A total of 8 experiments were 

carried out in the Commandante Ferraz Antarctic Station. 

e control conditions were 0 °C, 35 psu and a uoride 

free diet. e remaining experiments were done with a 

combination of conditions: temperature (0 °C and 4 °C), 

salinity (35 and 20 psu) and diet a with/without uoride 

(15 mg/kg sh). Each bioassay was performed on eight sh 

specimens, all of similar size (475 g ± 350 g) (media ± SD) 

and kept in experimental conditions for 11 days. At the 

end of the experiment, the caudal vein was punctured and 

the blood collected with heparin, centrifuged at 2000 rpm 

for 5 minutes and the plasma frozen in liquid nitrogen. In 

the same manner blood samples were collected from ve 

specimens of N. rossii, directly from Punta Plaza (PP) and 

Glacier Ecology (ECO), which are respectively, farther away 

and close to Arctowski Penguin Rookeries. In this case, the 

caudal vein puncture was undertaken aboard boat as soon 

as the sh was taken from the water to register the closest 

physiological condition. 

Plasma assay 

e plasmatic electrolytes chloride, magnesium, calcium 

and inorganic phosphate were assay spectrophotometrically 

by methods of the mercuric thiocyanate, xylidyl blue, 

O-cresolphthalein complexone, phosphomolybdate, 

respectively (Burtis & Ashwood, 1994). The 

spectrophotometer reading was carried out in 384 wells 

micro plates using the micro plate reader Fluostar of BMG. 

Statistical analysis 

e di erences between the control (0 °C and 35 psu) and 

the experimental group as well as the nature controls were 

tested at 5% signi cance levels using t-test with Welch’s 

correction. 


e concentration of the plasmatic constituents of the 

specimens of N. rossii from bioassays, as well as for the 

control of the nature from Punta Plaza (PP) and the Glacier 

Ecology (ECO) are summarized in Figure 1. 

Independently, the uoride was not able to change 

the plasmatic levels of calcium, inorganic phosphate, 

magnesium and chloride. Directly or indirectly all the 

Antarctic vertebrates consume krill, so consequently are 

exposed to high levels of uoride present in this euphausiid 

exoskeleton. e apparent lack of symptoms for uorosis, 

rouse questions about the protective adaptive mechanisms 


127

Figure 1. Plasma levels of chloride, inorganic phosphate, magnesium, and calcium in the Antarctic fi sh Notothenia rossii subjected to thermal and salinity 

stress. Fluoride was supplied by trophic pathway. Results expressed as mean ± standard error of the mean. 

against the toxic effect of fluoride (Yin et al., 2010). 

Di erences were also not observed between the means 

values of controls, experimental and nature (PP and ECO) 

groups. e choice of ECO and PP was taken into account 

considering the probable e ect of uoride present in high 

concentrations in the soils and sediments near the Penguin 

Rookeries (Xie & Sun, 2003), on the plasmatic levels of 

non-protein electrolytes. 

The low salinity expressively decrease the levels of 

plasmatic calcium, whereas chloride and magnesium levels 

were reduced by thermal stress. Fluoride was capable to 

induce reduction of chloride plasmatic levels, only under 

thermal and salinity stress. It is well known that warming 


tends to reduce the blood osmolality of Antarctic sh, 

without an increase in cortisol or hematocrit, indicating 

that the acclimatization to warming is not mediated by 

stress response (Hudson et al., 2008). As the osmolality 

is principally maintained by NaCl (Dobbs III & DeVries, 

1974), chloride reduction in the N. rossii blood should 

be expected by warming (Figure 2), even though studies 

with Notothenia neglecta showed that low salinity did not 

signi cantly change the levels of Na + and Cl- in the blood 

a er 10 days exposure to ≅ 16 psu (Romão et al., 2001). 

Calcium and magnesium have a key role in a large range 

of physiological processes. e renal tissue of Antarctic 

sh is capable of excreting magnesium and chloride in the

Figure 2. Interrelation between hyposmotic acclimation, drinking ratio, osmolality and serum levels of calcium, chloride and sodium. The metabolic answer of 

hyposaline and thermal acclimation effect of Antarctic fi sh Notothenia rossii is shown on the left. The warm acclimation effect on osmolality and drinking ratio 

of Trematomus bernacchii is shown on the right (data from Petzel (2005) and fi sh images from (Fischer & Hureau, 1985)). 

urine against a gradient concentration as part of control 

mechanisms evolved in maintenance of blood osmolality 

(Dobbs III & DeVries, 1974). In warm acclimation of 

Antarctic fish, Petzel (2005) observed that the blood 

osmolality reduction was accompanied by a rise in drinking 

ratio and reduction of chloride and sodium serum levels 

(Figure 2). 

e calcium entrance to the blood in marine teleosts 

is basically through intestine (drinking). Gills and kidneys 

have a central role in calcaemia control and are capable of 

actively excreting this metallic cation (Pinto et al., 2010). 

e hypocalcaemia of N. rossii acclimated a 0 °C e 20 psu 

can be due to low calcium concentration in the seawater 

at 20 psu. Although in warm and hyposaline acclimation 

(4 °C e 20 psu), N. rossii calcaemia was maintained close to 

control levels (0 °C e 35 psu). In this case, the thermic stress 

(4 °C) could be causing reduction of blood osmolality and 

increase the drinking rate of N. rossii compensating the low 

calcium concentration in the 20 psu seawater through a rise 

in drinking volume (Figure 2). 

Conclusion 

e present study revealed that warming, hyposalinity 

and trophic uoride interfere with plasmatic non protein 

electrolytes levels of Antarctic sh N. rossi. Considering 

the variables studied and blood parameters analyzed the 

plasmatic calcium stand out as an excellent biochemical 

biomarker of hyposaline stress. 


is study was sponsored by INCT-APA (CNPq Process 

No. 574018/2008-5, FAPERJ E-26/170.023/2008)], and 

supported by Environmental Ministry (MMA), the 

Secretariat for the Marine Resources Interministerial 

Committee (SECIRM) and Ministry of Science and 

Technology (MCT). 


129

References 

Barnes, D.K.A.; Fuentes, V.; Clarke, A.; Schloss, I.R. & Wallace, M.I. (2006). Spatial and temporal variation in shallow seawater 

temperatures around Antarctica. Deep-Sea Research Part II: Topical Studies in Oceanography, 53(8-10): 853-65. 

Barrera-Oro, E. (2002). The role of fi sh in the Antarctic marine food web: differences between inshore and offshore waters 

in the southern Scotia Arc and west Antarctic Peninsula. Antarctic Science, 14(4): 293-309. 

Burtis, C.A. & Ashwood, E.R. (1994). Tietz Textbook of Clinical Chemistry. Second. Saunders Company, Philadelphia, 

Pennsylvania. 2326p. 

Camargo, J.A. 2003. Fluoride toxicity to aquatic organisms: a review. Chemosphere, 50(3): 251-64. 

Casaux, R.J.; Mazzotta, A.S. & Barrera-Oro, E.R. (1990). Seasonal aspects of the biology and diet of nearshore nototheniid 

fi sh at Potter Cove, South Shetland Islands, Antarctica. Polar Biology, 11(1): 63-72. 

Dobbs III, G.H. & DeVries, A.L. (1974). Renal function in Antarctic teleost fi shes: Serum and urine composition. Marine 

Biology, 29(1): 59-70. 

Eastman, J.T. (2005). The nature of the diversity of Antarctic fi shes. Polar Biology, 28(2): 93-107. 

Eschmeyer, W.N.; Fricke, R.; Fong, J.D. & Polack, D.A. (2010). Marine fi sh diversity: history of knowledge and discovery 

(Pisces). Zootaxa, 2525: 19-50. 

Fischer, W. & Hureau, J.C. (1985). FAO Species identifi cation sheets for fi shery purposes. Rome: FAO. 470p. 

Hudson, H.A.; Brauer, P.R.; Scofi eld, M.A. & Petzel, D.H. (2008). Effects of warm acclimation on serum osmolality, cortisol 

and hematocrit levels in the Antarctic fi sh Trematomus bernacchii. Polar Biology, 31(8): 991-7. 

Mark, F.; Hirse, T. & Pörtner, H. (2005). Thermal sensitivity of cellular energy budgets in some Antarctic fi sh hepatocytes. 

Polar Biology, 28: 805-14. 

Petzel, D. (2005). Drinking in Antarctic fi shes. Polar Biology, 28(10): 763-8. 

Pinto, P.I.S.; Matsumura, H.; Thorne, M.A.S.; Power, D.M.; Terauchi, R.; Reinhardt, R. & Canário, A.V.M. (2010). Gill transcriptome 

response to changes in environmental calcium in the green spotted puffer fi sh. BMC Genomics, 11: 476. 

Romão, S.; Freire, C.A. & Fanta, E. (2001). Ionic regulation and Na+,K+-ATPase activity in gills and kidney of the Antarctic 

aglomerular cod icefi sh exposed to dilute sea water. Journal of Fish Biology, 59: 463-8. 

Xie, Z. & Sun, L. 2003. Fluoride content in bones of Adelie penguins and environmental media in Antarctica. Environmental 

Geochemistry and Health, 25(4): 483-90. 

Yin, X.; Chen, L.; Sun, L.; Wang, M.; Luo, H.; Ruan, D.; Wang, Y. & Wang, Z. 2010. Why do penguins not develop skeletal 

fl uorosis? Fluoride, 43: 108-18. 


ARGINASE KINETIC CHARACTERIZATION OF THE 

GASTROPOD Nacella concinna AND ITS PHYSIOLOGICAL 

RELATION WITH ENERGY REQUIREMENT DEMAND AND 

THE PRESENCE OF HEAVY METALS 

Edson Rodrigues 1,* ,Helena Passeri Lavrado 2 , Lucélia Donatti, Cecília N. K. Suda 1 , 

Edson Rodrigues Júnior 3 , Mariana Feijó de Oliveira 1 , Gannabathula Sree Vani 1 

1 Departamento de Biologia, Instituto Básico de Biociências, Universidade de Taubaté – UNITAU, 

Campus do Bom Conselho, Taubaté, SP, Brazil 

2 Departamento de Biologia Marinha, Universidade Federal do Rio de Janeiro – UFRJ, Rio de Janeiro, RJ, Brazil 

3 Programa de Pós-graduação em Biologia Molecular e Celular, Centro Politécnico, 

Universidade Federal do Paraná – UFPR, Curitiba, PR, Brazil 

*e-mail: rodedson@gmail.com 

Abstract: Arginases are metalloenzymes broadly distributed in nature. ese enzymes catalyze the L-arginine hydrolyses 

to L-ornithine and urea. e aim of the present work is to determine the tissue levels of arginase, its kinetic properties and 

subcellular localization. In December 2009, specimens were collected in Admiralty Bay, King George Island near the Brazilian 

Research Station. e argininolytic speci c activity of foot muscle, gills and pool of other tissues was 87.0 ± 15.1; 9.8 ± 1.8 and 

3.8 ± 1.0 mU/mg protein, respectively. Mainly localized in the cytosol, gills and muscular arginase Km values for L-arginine 

were 57.0 ± 10.5 and 66.2 ± 14.6 mM, respectively. High arginase levels in gills could be related to the systemic control of 

L-arginine concentrations, which is vital for energetic metabolism of phospho-L-arginine and of polyamines in the control of cell 

proliferation though the probable physiologic metal cation is Mn2+ , some arginases are activated by Co2+ and Ni2+ . e muscle 

Nacella concinna arginases were activated by Mn2+ and Co2+ and inhibited by Cd2+ whereas; gills arginase was activated only 

by Mn2+ and inhibited by Cd2+ and Zn2+ . 

Keywords: Antarctica, arginase, Nacella concinna, heavy metal 

Introduction 

The organisms that inhabit the intertidal zone on the 

coasts of the Antarctic Peninsula and adjacent Islands are 

periodically exposed to the thermal regime of the terrestrial 

environment as well as summer melt waters. e melt water 

creates micro environments with low salinity and elevated 

levels of heavy metals derived from lithogenic sources 

(Ahn et al. 1999, 2002). In addition, microphytobenthos 

are considered the principal food source and are also an 

important natural source of heavy metals, particularly 

Cd2+ (Ahn et al., 2004; Keil et al., 2008). Intertidal zones 

are also most vulnerable to anthropogenic pollutants. e 

gastropod Nacella concinna, is the most conspicuous macro 

invertebrate in the Antarctic intertidal zone, which has been 

used in the biomonitoring, for example in the diesel fuel 

spill from the vessel, Bahia Paradise, in Arthur Harbour 

(Kennicutt II & Sweet, 1992). 

Arginases are metalloenzymes that need a divalent cation 

to attain maximum activity. e probable physiological 


5 

131

cation is Mn 2+ , though Co 2+ and Ni 2+ have the capacity 

to activate some arginases (Carvajal et al., 1995). In non 

ureotelic organisms, the central physiological role of 

arginases is the control of the levels of the amino acid 

L-arginine (Jenkinson et al., 1996). 


e metabolism of the essential amino acid L-arginine, 

has been studied in different classes of organisms. In 

general, the L-arginine participates as a substrate in various 

metabolic processes such as synthesis of nitric oxide, protein 

and phospho-L-arginine, as well as, of polyamines indirectly 

through the non-protein amino acid L-ornithine (Figure 1) 

(Wu & Morris Junior, 1998; Pellegrino et al., 2004). 

In N. concinna a probable importance of argininolytic 

metabolism is the control of phospho-L-arginine levels. 

When this invertebrate is subjected to thermal stress, the 

phospho-arginine is used to produce ATP from ADP, 

followed by a reduction in the levels of L-arginine (Figure 1) 

(Pörtner et al., 1999; Ahn et al., 2004). In this case, the 

reduction in the L-arginine concentration could be related 

to tissue argininolytic activity, so studies about arginase 

are important for understanding some of the physiological 

activities of this Antarctic invertebrate. Arginase had been 

used as biomarker of many mammal pathological processes 

(Mielczarek-Puta et al. 2008). e present study aims to 

characterize tissue distribution, subcellular localization 

and kinetic properties of N. concinna arginase as a potential 

biomarker of the intertidal zone pollution. 


Specimens of N. concinna (n = 5) were collected on 

December 2009, in the Keller Peninsula, Admiralty 

Bay, King George Island, Antarctica. The tissues were 

homogenized in 20 mM bu er Tri-HCL, pH 7.4, containing 

1 mM trimethylamin-N-oxide, 5 mM of potassium 

phosphate, 0.5 mM EDTA, 250 mM sucrose, sonicated for 

30 seconds and centrifuged at 14000 g for 10 minutes. All 

kinetic studies were conducted at 0 °C using supernatant. 

e L-ornithine formed in the reaction was measured using 

a spectrophotometer a er reacting with ninhydrin and 

the activity expressed in mmol of L-ornithine formed per 

minute. e reaction systems used for kinetic studies are 

Figure 1. Conceptual diagram illustrating the pathways of L-arginine 

metabolism and production of phospho-L-arginine and its utilization in 

thermal stress involving L-arginine pools. 

described in the gures. e statistical di erences between 

the treatments and controls were obtained using one-way 

ANOVA followed by Tukey’s post-tests. 


e argininolytic activity of the gills was 9 to 23 times higher 

than that of the foot muscle and the pool of the other tissues 

respectively (Figure 2a). At subcellular level, the cytosol 

concentrates most of the arginase activity, both in gills 

(99%) and foot muscle (86.4%). Carvajal et al. (2004) also 

veri ed that gill cells of Semele solida had 91% of the arginase 

activity in cytosolic fraction. Most of the studies dealt with 

tissue levels rather than subcellular levels. e high levels 

of gills arginase activity could be related to the excretion 

of urea arising from the hydrolysis of L-arginine for the 

systemic control of this amino acid. e levels of arginase 

in the foot muscle could be related to the control of energy 

metabolism of phospho-L-arginine. As the presence of 

arginase in muscle tissue is uncommon, arginase in muscle 

tissue of Chiton latus has been associated with the removal of 

arginine to accelerate the utilization of phospho-L-arginine 

(Carvajal et al., 1988). 

e km values (Michaelis constant) for arginase in the 

foot muscle and gills were 57.0 ± 10.5 and 66.2 ± 14.6 mM, 

respectively. The L-arginine activity was inhibited by 

L-arginine concentrations above 80 and 100 mM in the foot 

muscle and gills, respectively (Figure 2b). e km values

and the inhibition by substrate L-arginine are similar to 

the arginase of polyplacophoran Chiton latus, which also 

has relatively high levels of arginase activity in the foot 

muscle and gills (Carvajal et al. 1988). Tormanen (1997) 

also observed arginase inhibition with high concentrations 

of substrate L- arginine in Zebra mussel. 

e e ects of heavy metals on the arginase activity 

in the foot muscle and gills are summarized in Figure 3. 

Similar to the arginases in other organisms, the gills and 

the foot muscle arginases of N. concinna, were activated in 

the presence of Mn2+ , con rming that Mn2+ is the probable 

physiological cation necessary for the activation of this 

enzyme. On the other hand, the foot muscle arginase was 

also activated by Co2+ , the same activation was not observed 

in gills tissue (Figure 3a, b). Cations like Co2+ have also 

been reported to activate some arginases, Carvajal et al. 

(1984, 1988) observed activation of arginase by Co2+ in 

gills and foot muscle arginase of Chiton latus, gills arginase 

of Concholepas concholepas, whereas Tormanen (1997) 

observed the same activation in arginase of Zebra mussel. 

a 

Figure 2. Tissue levels of arginase (a) and the effect of L-arginine concentration on the gills argininolytic activity of N. concinna (b). Results expressed as 

mean ± standard error of the mean. 

Zn2+ is one of the metals released by the combustion of 

coal, oil and gasoline. is metal can also be released from 

lead battery. It is also present in soils near stations which 

have used brass, steel coated nails and paints (Claridge et al., 

1995; Webster et al., 2003), leaching of volcanic rocks also 

results in high levels of Fe3+ and Zn2+ (Ahn et al., 1999; 

Weihe et al., 2010). Arginase activity in the presence of Zn2+ and Fe3+ alone or combined with Mn2+ in foot muscle did 

not show any signi cant alteration, whereas, gills arginase 

was inhibited by Zn2+ and Fe3+ alone or combined with Mn2+ (Figure 4a, b). Carvajal et al. (1984, 1988, 1994) observed 

inhibition of arginases by Zn2+ in gills and foot muscle of 

Chiton latus, gills of Concholepas concholepas and gills of 

Semele solida whereas Tormanen (1997) observed same 

inhibition by Zn2+ in Zebra mussel. 

Foot muscle and gill arginase is also inhibited by Cd2+ . 

e same inhibition is not present in gills arginase of Semele 

solida (Carvajal et al., 1994). High concentrations of Cd2+ in surface waters of the Southern ocean is referred to as 

“Cd anomaly”, during the austral summer the upwelling 

of waters favours uptake of Cd2+ by primary consumers 

b 


133

Figure 3. Effect of metallic cations on the foot muscle arginase activity of N. concinna. The activities were determined in 20 mM of Hepes buffer, pH 7.4, 

containing 30 mM of L arginine. The control activity (C) was determined in a reaction system without the addition of metallic cations. The isolated effect of 

1 mM metallic cations (a) and combined effect of 1 mM Mn 2+ with a second 1 mM metallic cation (b). Differences between control activity of arginase and the 

arginase activity with metals were signifi cant for p < 0.05 (*) and p < 0.001(***). 


a b 

a b 

Figure 4. Effect of metallic cations on the gills arginase in N. concinna. The activity was determined in 20mM of Hepes buffer, pH 7.4 containing 30 mM of 

L-arginase. The control activity (C) was determined in a reaction system without the addition of metallic cations. The isolated effect of 1 mM metallic cations 

(a) and combined effect of 1 mM Mn 2+ with a second 1 mM metallic cation (b). Differences between control activity of arginase and the arginase activity with 

metals were signifi cant for p < 0.05 (**) and p < 0.001(***).

and high availability of this metal in the food chain. High 

concentration of this metal is found in digestive glands and 

kidneys of some Antarctic mollusks, this indicating binding 

of these metals with metallothioneins which are associated 

with detoxifying role (Bargagli et al., 1996; Lohan et al., 

2001; Keil et al., 2008). 

Conclusion 

Gills and foot muscle of N. concinna express arginases with 

distinct kinetic properties. e presence of arginase in the 

foot muscle supports the hypothesis that argininolytic 

activity can be involved in control of phopho-L-arginine 

metabolism. e gills and muscular argininolytic activity 

of N. concinna is basically in the cytosolic faction. e 

References 

cations Mn2+ and Co2+ were capable of activating foot 

muscle arginase, where as Zn2+ , Fe3+ and Cd2+ did not inhibit 

signi cantly. e gills arginase showed a distinct behaviour, 

was activated by Mn2+ and inhibited by Zn2+ , Fe3+ and Cd2+ . 

e di erent behaviour of gills and foot muscle arginase of 

N. concinna can have a relation to the entry of heavy metals 

to these tissues. 


is study was sponsored by INCT-APA (CNPq Process No. 

574018/2008-5, FAPERJ E-26/170.023/2008), and supported 

by Environmental Ministry (MMA), the Secretariat for the 

Marine Resources Interministerial Committee (SECIRM) 

and Ministry of Science and Technology (MCT). 

Ahn, I.Y.; Chung, K.H. & Choi, H.J. (2004). Infl uence of glacial runoff on baseline metal accumulation in the Antarctic limpet 

Nacella concinna from King George Island. Marine Pollution Bulletin, 49(1-2): 119-27. 

Ahn, I.Y.; Kang, J. & Kim, D.Y. (1999). Preliminary Study on Heavy metals in the Antartctic limped, Nacella cocinna (Strebel, 

1908) (Gastropoda: Patellidae) in an Intertidal Habitat on King George Island. Korean journal of Polar Reasearch, 10(1): 108. 

Ahn, I.Y.; Kim, K.W. & Choi, H.J. (2002). A baseline study on metal concentrations in the Antarctic limpet Nacella concinna 

(Gastropoda: Patellidae) on King George Island: Variations with sex and body parts. Marine Pollution Bulletin, 44(5): 424-31. 

Bargagli, R.; Nelli, L.; Ancora, S. & Focardi, S. (1996). Elevated cadmium accumulation in marine organisms from Terra Nova 

Bay (Antarctica). Polar Biology, 16(7): 513-20. 

Carvajal, N.; Bustamante, M.; Hinrichsen, P. & Torres, A. (1984). Properties of arginase from the sea mollusc Concholepas 

concholepas. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 78(3): 591-4. 

Carvajal, N.; Kessi, E.; Bidart, J. & Rojas, A. (1988). Properties of arginase from the foot muscle of Chiton latus. Comparative 

Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 90(2): 385-8. 

Carvajal, N.; Orellana, M.S.; Borquez, J.; Uribe, E.; Lopez, V. & Salas, M. (2004). Non-chelating inhibition of the H101N variant 

of human liver arginase by EDTA. Journal of Inorganic Biochemistry, 98(8): 1465-9. 

Carvajal, N.; Torres, C.; Uribe, E. & Salas, M. (1995). Interaction of arginase with metal ions: studies of the enzyme from 

human liver and comparison with other arginases. Comparative Biochemistry and Physiology Part B: Biochemistry and 

Molecular Biology, 112(1): 153-9. 

Carvajal, N.; Uribe, E. & Torres, C. (1994). Subcellular localization, metal ion requirement and kinetic properties of arginase 

from the gill tissue of the bivalve Semele solida. Comparative Biochemistry and Physiology Part B: Biochemistry and 

Molecular Biology, 109(4): 683-9. 

Claridge, G.G.C.; Campbell, I.B.; Powell, H.K.J.; Amin, Z.H. & Balks, M.R. (1995). Heavy metal contamination in some soils 

of the McMurdo Sound reg ion, Antarctica. Antarctic Science, 7(1): 9-14. 

Jenkinson, C.P.; Grody, W.W. & Cederbaum, S.D. (1996). Comparative properties of arginases. Comparative Biochemistry 

and Physiology Part B: Biochemistry and Molecular Biology, 114(1): 107-32. 


135

Keil, S.; de Broyer, C. & Zauke, G.-P. (2008). Signifi cance and Interspecifi c Variability of Accumulated Trace Metal Concentrations 

in Antarctic Benthic Crustaceans. International Review of Hydrobiology, 93(1): 106-126. 

Kennicutt II, M.C. & Sweet, S.T. (1992). Hydrocarbon contamination on the Antarctic peninsula: III. The Bahia Paraiso - Two 

years after the spill. Marine Pollution Bulletin, 25(9-12): 303-6. 

Lohan, M.; Statham, P. & Peck, L. (2001). Trace metals in the Antarctic soft-shelled clam Laternula elliptica: implications for 

metal pollution from Antarctic research stations. Polar Biology, 24(11): 808-17. 

Mielczarek-Puta, M.; Chrzanowska, A.; Graboń, W. & Barańczyk-Kuz´ma, A. 2008. New insights into arginase. Part II. Role in 

physiology and pathology. Postepy higieny i medycyny doswiadczalnej, 62: 214-221. 

Pellegrino, D.; Palmerini, C.A. & Tota, B. (2004). No hemoglobin but NO: the icefi sh (Chionodraco hamatus) heart as a 

paradigm. Journal of Experimental Biology, 207(22): 3855-3864. 

Pörtner, H.O.; Peck, L.; Zielinski, S. & Conway, L.Z. (1999). Intracellular pH and energy metabolism in the highly stenothermal 

Antarctic bivalve Limopsis marionensis as a function of ambient temperature. Polar Biology, 22(1): 17-30. 

Tormanen, C.D. (1997). The effect of metal ions on arginase from the zebra mussel Dreissena polymorpha. Journal of Inorganic 

Biochemistry, 66(2): 111-8. 

Webster, J.; Webster, K.; Nelson, P. & Waterhouse, E. 2003. The behaviour of residual contaminants at a former station site, 

Antarctica. Environmental Science and Technology, 123(2): 163-179. 

Weihe, E.; Kriews, M. & Abele, D. (2010). Differences in heavy metal concentrations and in the response of the antioxidant 

system to hypoxia and air exposure in the Antarctic limpet Nacella concinna. Marine Environmental Research, 69(3): 127-35. 

Wu, G. & Morris, S.M., JR. (1998). Arginine metabolism: nitric oxide and beyond. Biochemical Journal, 336: 1-17. 


ARSENIC, COPPER AND ZINC IN MARINE SEDIMENTS 

FROM THE PROXIMITY OF THE BRAZILIAN 

ANTARCTIC BASE, ADMIRALTY BAY, 

KING GEORGE ISLAND, ANTARTICA 

Andreza Portella Ribeiro 1,* , Rubens César Lopes Figueira 1 , César de Castro Martins 2 , 

Charles Roberto de Almeida Silva 1 , Elvis Joacir de França 1 , Márcia Caruso Bícego 1 , 

Michel Michaelovitch de Mahiques 1 , Rosalinda Carmela Montone 1 

1 Instituto Oceanográfi co da Universidade de São Paulo, São Paulo, SP, Brazil 

2 Centro de Estudos do Mar da Universidade Federal do Paraná, Pontal do Sul, Pontal do Paraná, PR, Brazil 

*e-mail: andrezpr@usp.br 

Abstract: Marine sediments collected, in March/2010, close to the Comandante Ferraz Base, located in Admiralty Bay, Antarctica, 

were analyzed to determine arsenic (As), copper (Cu) and zinc (Zn) levels, in order to indicate the impact of the Brazilian 

activities in the study area. Labile concentrations of As ranged from 6 to 10 μg.kg –1 , Cu and Zn content ranged from 80 to 91 and 

50 to 57 μg.kg –1 , respectively. e preliminary results indicated a slight increase of As with depth. Nonetheless, no relevant trace 

element inputs were observed, according to the chemical analysis adopted in the present research study. 

Keywords: arsenic, metals, sediments, Comandante Ferraz Base-Antarctica 

Introduction 

Brazilian activities in the Antarctic Continent are coordinated 

by the Brazilian Antarctic Program (PROANTAR), in which 

scientific researchers are concentrated at the Brazilian 

Antarctic Base “Comandante Ferraz” (geographical 

coordinates of 62° 08' S and 58° 40' W), Admiralty Bay, 

Peninsula Keller, King George Island, Antarctic Peninsula 

(Feitosa, 2009). 

Antarctica is linked to other regions of the world 

through the circulation of the atmosphere and the oceans. 

e huge di erence between the Equator distance and the 

temperature of this Continent drives the poleward heat 

transport and the general circulation of the air masses, 

turning Antarctica into the main heat sink of the Southern 

Hemisphere. Considering the complexity of the air mass 

circulation, Antarctica plays an impressive role in the 

global climate system, as well as acts as a sink for persistent 

atmospheric pollutants (Bargagli, 2005). Moreover, local 

emissions from Scientific Stations and tourism also 

contribute to the dispersing of contaminants, thereby 

concentrating and accumulating pollutants in sediments. 

ere are few studies underlying chemical substances 

and trace elements present in sediments from the proximity 

of Comandante Ferraz Base. For example, Santos et al., 

(2005) investigated the heavy metal contamination in 

32 sediments and 14 soil samples. Total and bioavailable 

contents of 16 elements (including Cu and Zn) were 

determined by ICP OES technique. According to the 

authors, the results showed an increase of bioavailability 

of soils in comparison to the sediments, probably due 

to the di erent redox properties of soils and sediments. 

e total average concentrations of metals in the samples 

presented no important temporal (during the summer 


6 

137

2002/2003) and depth-related variability. Total metals were 

extracted with an adaptation of methods extensively used in 

literature, in which the sample is digested with aqua-regia 

and hydro uoric acid. 


A recent study with ve sediment pro les from the 

Admiralty Bay has suggested a slight increase of As levels, 

since 1985. According to the authors, the increase of As 

content may be associated with the Brazilian activities in the 

bay (Ribeiro et al., 2010). Otherwise, there is no evidence 

of relevant impact to the ecosystem due to trace element 

sources in the region (Santos et al., 2005; Martins et al., 

2005). Nevertheless, the studies that have been concerned 

with determining inorganic contaminants, in Antarctica, 

are still scarce. Accordingly, this work was undertaken to 

evaluate the real anthropogenic impact of potentially toxic 

elements (As, Cu and Zn) in the Admiralty Bay, Antarctica. 


Sampling 

Sediment samples were taken using a mini-box corer 

(MBC), especially designed for sampling so sediments 

and benthic macrofauna (Filgueiras et al., 2007). MBC 

presents 0.0625 m 2 of sampling area, 25 x 25 x 55 cm box, 

55 kg weight (Filgueiras et al., 2007; Martins et al., 2010). 

Samples were placed into pre-cleaned recipients and stored 

at -20 °C. Sediments were freeze-dried; further, they were 

carefully homogenized in mortar and stored in polyethylene 

bags until laboratory analysis. 

ICP OES 

Sediment test portions of 500 mg were transferred into 

100 mL cleaned glass beakers and chemically digested using 

the reagent mixture of HNO 3 , H 2 O 2 and HCl, according to 

the Method 3050A (USEPA, 1996). Filtered digest solution 

were analyzed by ICP OES using a Varian spectrometer, 

model 710ES, for determining As, Cu, and Zn. All reagents 

were of a comparable pure grade. Geological certified 

reference materials SCP Science EnviroMat SS-1 and SS-2 

were analyzed together the samples to assess the quality of 

the analytical procedure for the chemical analysis. 


Certi ed reference materials (CRM) 

Experimental data for the CRM presented relative standard 

deviation lower than 6%. The agreement between the 

observed and the certi ed concentrations of As, Cu and 

Zn were better than 9%f, indicating the precision and the 

accuracy for the methodology employed in the chemical 

analysis. 

Trace elements 

Table 1 shows the range contents of As, Cu and Zn 

determined in 18 samples, representing the sediments 

collected close to the Comandante Ferraz Base, in Admiralty 

Bay, King George Island, Antarctic Peninsula. Table 1 also 

presents the data comparison with literature values available 

elsewhere for trace elements in Antarctic sediments. 

According to the results, the highest concentration 

values were observed for Cu and Zn (ranging from 80 to 91 

and 50 to 57 mg.kg –1 , respectively). In fact, high Cu content 

in Admiralty Bay sediments could be explained by the 

mineralogy of studied sediments, which were mainly 

produced by glacier erosion of volcanic rocks such as 

basalt and andesite. ese rocks are respectively composed 

primarily by olivine and pyroxene and by plagioclase and 

pyroxene (Fourcade, 1960). Salomons & Förstner (1984) 

Table 1. Trace element ranges (mg.kg –1 , expressed in dry weight) 

determined in the Antarctic sediments and compared with literature 

values. 

Site As Cu Zn 

Admiralty Bay 1 6 - 10 80 - 91 50 - 57 

Ferraz Station 2 8 - 33 - 87 - 134 

Botany Point 2 4 - 6 - 81 - 95 

Ferraz Station 3 - 92 89 

Admiralty Bay 4 2-12 - - 

Mc Murdo Station 5 4 - 5 31 - 100 114 - 156 

Princess Regnheld Station 6 4 - 7 - 26 - 134 

Ross Sea 7 - 10 - 38 52 - 144 

Potter Cove 8 - 73 - 156 46 - 63 

1 This study; 2,3 Santos et al. (2007); 4 Ribeiro et al. (2010) ; 5 Negri et al. 

(2006); 6 Waheed et al. (2001); 7 Ianni et al. (2010); 8 Andrade et al. 

(2001).

Figure 1. As contents (mg.kg –1 ) in the sediment from the proximity of 

Ferraz Station, Admiralty Bay. 

have reported that, during magmatic differentiation, 

Cu is incorporated – among others metals, such as Zn 

– into olivine, pyroxene and plagioclase. Copper mean 

concentrations in these mineral are 115 mg.kg –1 , 120 mg.kg –1 

and 62 mg.kg –1 , respectively. According to Machado et al. 

(2001), the high levels of Cu in sediments may be associated 

with the widespread mineralization of chalcopyrite in the 

area. 

e data comparison with literature indicated that the 

trace elements levels were in the same order of magnitude 

of previous contents already obtained in di erent periods 

and Antarctic regions. Moreover, contents of As, Cu, and Zn 

were in conformity with those determined by Santos et al. 

(2005, 2007) in sediments from Admiralty Bay. 

Figures 1 to 3 show the mean contents with depth. 

Likewise previous work (Ribeiro et al., 2010), the results 

indicated a slight decrease of As with depth (Figure 1), 

suggesting that the human activities may be contributing 

to the As enrichment in the study site. e data set suggests 

the natural sources are the main inputs for Cu and Zn 

(Figures 2 and 3) in the Antarctic ecosystem. Even though, 

in order to understand the geochemical distribution of 

the trace elements in the surface sediments, a study of 

geochemical partitioning of As, Cu and Zn is necessary and 

will be developed in the near future. 

Figure 2. Cu contents (mg.kg –1 ) in the sediment from the proximity of 


Figure 3. Zn contents (mg.kg –1 ) in the sediment from the proximity of 


Conclusions 

This work presented its preliminary results related to 

the As, Cu, and Zn in sediments from the proximity of 

Brazilian Antarctic Base, in the Admiralty Bay. e study 

provided some baseline information on trace elements of 

environmental interest for the Antarctic region. In general, 

chemical composition of sediments was in accordance 

with the literature values, thereby suggesting a low level 

of environmental contamination in the areas of human 

activities in the Admiralty Bay region. Continuous 

environmental monitoring, determination of baseline levels, 

chemical speciation methods will be essential for controlling 

and preventing pollution in the Antarctic Continent. 


139


e authors would like to thank the Instituto Nacional de 

Ciência e Tecnologia Antártico de Pesquisas Ambientais 

(CNPq no 574018/2008-5 and FAPERJ no 16/170.023/2008) 

and the Programa Antártico Brasileiro (PROANTAR) for 

the nancial support through the bursary provided by 

References 


the Conselho Nacional de Desenvolvimento Cientí co e 

Tecnológico (CNPq) and the logistical support from the 

Comissão Interministerial para Recursos do Mar (CIRM), 

Ministério da Ciência e Tecnologia (MCT) and Ministério 

do Meio Ambiente (MMA). 

Andrade, S., Poblet, A., Scagliola, M., Vodopivez, C., Curtosi, A., Pucci, A. & Marcovecchio, J. (2001) Distribution of heavy 

metals in surface sediments from an Antarctic marine ecosystem. Environmental Monitoring and Assessment, 66: 147-158. 

Bargagli, R. (2005) Antarctic Ecosystems Environmental Contamination: Climate Change, and Human Impact. Springer: 

Ecological Studies. 

Feitosa G.L. (2009). Brazil contributes to research in the Antarctic. Hobeco Ltda - Rio de Janeiro/Brazil, Available on: 

http://www.vaisala.com/fi les/Brazil_contributes_to_research_in_the_Antarctic.pdf. 

Filgueiras, V.L.; Campos, L.S.; Lavrado, H.P.; Frensel, R. & Pollery, R.C.G. (2007). Vertical distribution of macrobenthic infauna 

from the shallow sublittoral zone of Admiralty Bay, King George Island, Antarctica. Polar Biology, 30(11): 1439-47. 

Fourcade N. H. (1960). Estudio geológico y petrográfi co de Caleta Potter, isla 25 de Mayo, Islas Shetland del Sur, Instituto 

Antártico Argentino, Publicación N 8, 115 p. 

Ianni, C., Magi, E., Soggia, F., Rivaro, P. & Frache, R. (2010) Trace metal speciation in coastal and off-shore sediments from 

Ross Sea (Antarctica), Microchemical Journal, 96(2): 203-212. 

Machado A.; Lima E.F.; Chemale Jr. F.; Liz J.D. & Ávila J.N. (2001) Química mineral de rochas vulcânicas da Península Fildes 

(Ilha Rei George), Antártica. Revista Brasileira de Geociências, 31(3): 299–306. 

Martins C.C.; Montone R.C.; Gamba R.C. & Pellizari V.H. (2005) Sterols and fecal indicator microorganisms in sediments 

from Admiralty Bay, Antarctica. Brazilian Journal of Oceanography, 53(1/2): 1-12. 

Martins, C.C., Bícego, M.C., Rose, N.L., Taniguchi, S., Lourenço, R.A., Figueira, R.C., Mahiques M.M. & Montone, R.C. (2010). 

Historical record of polycyclic aromatic hydrocarbons (PAHs) and spheroidal carbonaceous particles (SCPs) in marine 

sediment cores from Admiralty Bay,King George Island, Antarctica. Environmental Pollution 158(1): 192-200. 

Negri, A., Burns, K., Boyle, S., Brinkman, D. & Webster, N. (2006) Contamination in sediments, bivalves and sponges of 

McMurdo Sound, Antarctica. Environmental Pollution 143(3): 456-67. 

Ribeiro, A.P., Figueira, R.C.L., Martins, C.C., Silva, C.R.A., França, E.J., Bícego, M.C., Mahiques, M.M. & Montone, R.C. (2010) 

Arsenic content in fi ve sediment profi le from Admiralty Bay, King George Island, Antarctica., National Institute of Science 

and Technology Antarctic Environmental Research-Annual Activity Report, 1: 52-57. 

Salomons W. & Förstner U. (1984). Metals in the hydrocycle. Springer-Verlag, Berlin. 

Santos, I.R, Silva-Filho, E.V., Schaefer, C.E.G.R., Albuquerque-Filho, M.R. & Campos, L.S., (2005) Heavy metal contamination 

in coastal sediments and soils near the Brazilian Antarctic Station, King George Island. Marine Pollution Bulletin, 50(2): 

185-94. 

Santos, I.R, Fávaro, D.I.T, Schaefer, C.E.R.G & Silva-Filho, E.V. (2007) Sediment geochemistry in coastal maritime Antarctica 

(Admiralty Bay, King George Island): Evidence from rare earths and other elements. Marine Chemistry, 107(4): 464-74. 

USEPA (1996). United States Environmental Protection Agency. Method 3050B. Acid digestion of sediments, sludges and 

soil. Revision 2. December. 

Waheed, S., Ahmad, S., Rahman, A. & Qureshi, I.H. (2001) Antarctic marine sediments as fi ngerprints of pollution migration. 

Journal of Radioanalytical and Nuclear Chemistry, 250(1): 97-107.

MOLECULAR DIFFERENTIATION OF TWO ANTARCTIC 

FISH SPECIES OF THE GENUS Notothenia 

(NOTOTHENIOIDEI: NOTOTHENIIDAE) 

BY PCR-RFLP TECHNIQUE 

Cintia Machado 1 , Marcia Kiyoe Shimada 2 , Stênio Perdigão Fragoso 2 , Edith Fanta 1 , 

Helena G. Kawall 1 , Edson Rodrigues 3 , Lucélia Donatti 1,* 

1 Departamento de Biologia Celular, Setor de Ciências Biológicas, Universidade Federal do Paraná – UFPR, Curitiba, PR, Brazil 

2 Fundação Oswaldo Cruz, Instituto Carlos Chagas – ICC, Paraná, Curitiba, PR, Brazil 

3 Laboratório de Bioquímica, Instituto Básico de Biociências – IBB, Universidade de Taubaté – UNITAU, Taubaté, SP, Brazil 

*e-mail: donatti@ufpr.br 

Abstract: e Antarctic sh Notothenia rossii and Notothenia coriiceps were selected as target organisms for studies of biomarker 

responses of environmental monitoring research of Admiralty Bay, King George Island. In this case, molecular taxonomy 

analysis of the referred population became an important study subject in order to increase the knowledge of especies diversity. 

e taxonomy of Antarctic sh has been predominantly based on morphological characteristics rather than on genetic criteria. 

A typical example is the Notothenia group, which consists of N. coriiceps, N. neglecta and N. rossii. e Polymerase Chain 

Reaction and Restriction Fragment Length Polymorphism (PCR-RFLP) technique was used to determine whether N. neglecta 

and N. coriiceps are di erent or whether they are the same species with morphological, physiological and behavioural variability. 

N. rossii was used as control. Mitochondrial DNA (mtDNA) was isolated from muscle specimens of N. neglecta, N. coriiceps 

and N. rossii, which were collected in Admiralty Bay, King George Island. e DNA was used to amplify a fragment (690 base 

pairs) of the coding region of the mitochondrial gene for NADH subunit 2. Further, the amplicon was digested with following 

restriction enzymes: DdeI, HindIII and RsaI. e results showed a variation of the digestion pattern of the fragment ampli ed 

between N. rossii and N. coriiceps or N. neglecta species. No di erences were found between N. coriiceps and N. neglecta 

specimens. 

Keywords: Notothenia species, DNA mitochondrial, NADH-2, PCR-RFLP 

Introduction 

e Antarctic sh Notothenia rossii and Notothenia coriiceps 

were selected as target organisms for studies of biomarker 

responses of environmental monitoring research proposed 

in Module 3 INCT-APA (Instituto Nacional de Ciência 

e Tecnologia Antártico de Pesquisas Ambientais) for 

Admiralty Bay, King George Island (Rodrigues et al., 2009). 

In this case, molecular taxonomy analysis of the referred 

population became an important study subject to increase 

the knowledge of the diversity of this species. 

e species Notothenia coriiceps was rst described by 

Richardson in 1844. Nybelin (1951) described N. neglecta 

as a new species of the genera, contested in 1966 by DeWitt 

who considered N. neglecta a subspecies of N. coriiceps. 

Fischer and Hureau (1988) supported the hypotheses that 

N. coriiceps and N. neglecta are distinct species, presenting 

di erences in the number of n rays of the pectoral and 

second dorsal ns, interorbital width and head length. 

Nowadays, most authors consider that N. coriiceps and 


7 

141

N. neglecta are the same species (Kock, 1992; Eastman, 1993; 

Eastman & Eakin, 2000). 


Mitochondrial DNA has been used in research at the 

population level as well as in studies on molecular taxonomy. 

e present work used Polymerase Chain Reaction and 

Restriction Fragment Length Polymorphism (PCR-RFLP) 

techniques of a region of NADH dehydrogenase subunit 

2 gene of the mitochondrial DNA (Meyer, 1993), with the 

purpose of analysing the polymorphism among Notothenia 

species to assess the existence of N. neglecta and N. coriiceps 

separate species. 

Methods 

Specimen collection and DNA extraction 

Specimens of Notothenia coriiceps Richardson, 1844, 

N. neglecta Nybelin, 1951 and N. rossii Richardson, 1844 

were collected at di erent localities near the Comandante 

Ferraz Brazilian Station (62° 05’ S and 58° 24’ W) in Admiralty 

Bay, King George Island, South Shetland Islands. Notothenia 

rossii, a phylogenetically close species was used as control. 

irty-six specimens were used for molecular analyses: 11 

N. coriiceps, 11 N. neglecta and 14 N. rossii specimens. Counts 

of meristic characters and morphometric measurements 

from the specimens examined in this study following 

procedures by Fischer and Hureau (1988) (Table 1). 

A fragment of muscle tissue (1 cm 3 ) of the tail region 

was collected and preserved in absolute ethanol until 

processing. The Easy-DNA kit extraction (Invitrogen, 

Carlsbad, CA) was used for DNA extraction, according to 

the manufacturer’s instructions. 

Ampli cation reaction 

e coding region of the mitochondrial gene for subunit 2 of 

the NADH (ND2) was ampli ed using the following primer 

pairs: ND2F (5’ - ACCACCCCCGGGCAGTTGAAG - 3’) and 

ND2R (5’ - GCGGTGGGAGCTAGCTCTTGTTTA - 3’). 

These primers were designed from conserved regions 

obtained from the alignment of the sequences of the ND2 

gene of Antarctic sh deposited in GenBank (NCBI, 2004). 

PCR-RFLP technique 

e amplicons of the ND2 were digested with 5 U of the 

following restriction enzymes: DdeI, HindIII and RsaI 

(New England BioLabs, Beverly, MA). e treated samples 

were subjected to electrophoresis in 10% acrylamide gel. 

Molecular size of restriction DNA fragments were estimated 

by comparison with 1 Kb Plus Ladder (Invitrogen). 

Results 

Digestion pro les of ND2 ampli ed fragments showed 

that N. rossii does not possess a site for restriction enzymes 

HindIII and RsaI, whereas the amplicon of N. coriiceps 

and N. neglecta exhibited one restriction site for HindIII 

and RsaI (Figure 1b, c). e fragment patterns produced 

by digestion with restriction enzyme DdeI indicated three 

restriction sites in N. rossii and two for N. coriiceps and 

N. neglecta (Figure 1a). 

e molecular di erentiation between N. rossii and 

N. coriiceps was possible using the NADH2 gene of the 

mitochondrial DNA by PCR-RFLP technique. However, 

no di erence was found within N. coriiceps and N. neglecta 

Table 1. Meristic counts and morphometric measurements of the Notothenia specimens (n = 36) captured from Admiralty Bay, with sample separated by 

species according Fischer and Hureau (1988). Numbers of specimens are 11 for N. coriiceps, 11 for N. neglecta and 14 for N. rossii. 

Characteristics Species 

N. rossii N. coriiceps N. neglecta 

N° of fi rst dorsal fi n rays 4 - 7 4 - 6 3 - 7 

N° of second dorsal fi n rays 32 - 35 35 - 37 37 - 40 

N° of pectoral fi ns rays 22 - 24 16 - 18 16 - 19 

N° of anal fi n rays 27 - 30 27 - 30 29 - 32 

interorbital width / head length 29 - 31 23 - 25 26 - 33

specimens, by the digestion pro le obtained for the DdeI, 

HindIII and RsaI restriction enzymes (Figure 1). 

Discussion 

e species N. coriiceps, described by Richardson 1844, is 

largely distributed in shallow waters of the Southern Ocean 

and found in high densities in Admiralty Bay. It presents 

a great deal of morphological variation. Nybelin (1951) 

described N. neglecta as a new species of the genera. Fischer 

and Hureau (1988) considered N. coriiceps and N. neglecta as 

a b 

Figure 1. Digestion profi le of a fragment (690 base pairs) of the coding region amplifi ed of the mitochondrial gene of the subunit 2 of the NADH using 

PCR-RFLP technique. a) Amplicon digested by restriction enzyme DdeI. Lines 1 and 2 corresponding to N. rossii specie. Lines 3 and 4: N. coriiceps. 

Lines 5 and 6: N. neglecta; b) Amplicon digested by restriction enzyme HindIII. Lines 1 and 2 corresponding to N. rossii specie. Lines 3 and 4: N. coriiceps. 

Lines 5 and 6: N. neglecta; c) Amplicon digested by restriction enzyme RsaI. Lines 1 and 2 corresponding to N. coriiceps specie. Lines 3 and 4: N. neglecta. 

Lines 5 and 6: N. rossii. M: 1kb Plus Ladder (Invitrogen). 

a distinct species, showing di erences in the number of n 

rays of the pectoral and second dorsal ns, interorbital width 

and head length. In 1966, DeWitt considered N. neglegta as 

a subspecies of N. coriiceps justifying that Nybelin had used 

a small number of samples to present its classi cation (Gon 

& Heemstra, 1990). 

Conclusion 

c 

e results of the study presented here con rmed that 

N. coriicepsis genetically di erent to N.rossii, being two 


143

distinct species, while there was no evidence of genetic 

divergence between N. neglecta and, N. coriiceps. However, 

additional information on independent genetic loci (nuclear 

markers) will be required to reject the hypothesis of Nybelin 

that these two morphotypes are separate species. 

Also, in addition to the information from Meyer 

(1993), we have shown that the gene ND2 is a good gene 

to di erentiate the species of sh of the same genus. In the 

comparison between N. coriiceps and N. rossi, by the RFLP 

technique, the bands pattern was clear and presented good 

reproducibility. 

References 



Eastman, J.T. (1993). Antarctic fi sh biology. San Diego: Academic Press, 322 pp. 

e authors wish to thank the Conselho Nacional de Pesquisa 

e Desenvolvimento (CNPq) for nancial support to the 

Projects nº 52.0125/2008-8 (API), 57.4018/2008-5 (INCT- 

APA) and a Productivity in Research stipend for L. Donatti 

nº 305562/2009-6; Fundação de Amparo à Pesquisa do 

Estado do Rio de Janeiro (FAPERJ) nº E-26/170.023/2008; 

REUNI/SESU for a Doctorate Stipend to C. Machado; the 

PROANTAR/SECIRM of the Brazilian Navy, and the sta 

of the Brazilian Antarctic Station Comandante Ferraz for 

all their logistical support. 

Eastman, J.T. & Eakin, R.R. (2000).An updated species list for notothenioid fi sh (Perciformes; Notothenioidei), with comments 

on Antarctic species. Archive of Fishery and Marine Research. 48(1), 11-20. 

Fischer, W. &Hureau, J.C. (1988). Oceano austral. 1985. Vol II. Roma: Organizacion de lasNaciones Unidas para Alimentacion 

e la Agricultura, 471 pp. 

Gon, O.& Heemstra, P.C. (1990). Fishes of the Southern Ocean.J. L. B. Smith Institute of Ichthyology. South Africa: 

Grahamstown, 462 pp. 

Kock, K.H. (1992). Antarctic fi sh and fi sheries; studies in polar research. Cambridge: Cambridge University Press, 359 pp. 

Meyer, A. (1993). Evolution of mitochondrial DNA in fi shes. In: Hochachka and Mommsen, Biochemistry and molecular 

biology of fi shes, vol.2. Elsevier Science Publishers, New York, pp. 1-38. 

NCBI - National Center for Biotechnology Information (2004). Available from: . Accessed in August 

11 th 2004. 

Rodrigues, E.; Donatti, L.; Vani, G.S.; Lavrado, H.P.; Rios, F.S.; Suda, S.N.K.; Piechnik, C.A.; Machado, D.; Rodrigues 

Junior, E.; Oliveira, M. F.; Silva, F.B.V. & Cettina, L.B. 2009. Natural and anthropic impact assessment on biochemical 

and histopathological biomarkers of fi shes and invertebrates at coastal region of Admiralty Bay – King George Island. 

Annual Activity Report of Institute of Science and technology Antarctic Environmental Research. São Carlos, pp. 44-49.

DISTRIBUTION OF STEROLS IN SEDIMENT CORES FROM 

MARTEL INLET, ADMIRALTY BAY, KING GEORGE ISLAND, 

ANTARCTICA 

Edna Wisnieski 1,* , Liziane Marcella Michelotti Ceschim 2 , Sabrina Nart Aguiar 1 ,César de Castro Martins 1,** 

1 Centro de Estudos do Mar, Universidade Federal do Paraná – UFPR, Pontal do Paraná, PR, Brazil 

2 Laboratório de Química Orgânica Marinha, Instituto Oceanográfi co, Universidade de São Paulo – USP, São Paulo, SP, Brazil 

e-mail: * ednawisnieski@gmail.com; ** ccmart@ufpr.br 

Abstract: In the present study, sterols organic markers were applied to identify the sources of organic matter in Admiralty Bay. For 

this purpose, sediment samples were extracted using a Soxhlet system, clean up with column chromatography and injected into a 

gas chromatograph. Measurable levels of all sterols analyzed con rm the multiplicity of sources of sedimentary organic matter. In 

BTN and STH,the most abundant sterol was the colest-5-en-3β-ol (cholesterol) with 2.24 µg.g –1 and 4.12 µg.g –1 , respectively, while 

in FER, itwas the 24-metil-colest-5-en-3β-ol (campesterol) with 1.83 µg.g –1 . e saturated sterols have smaller concentrations 

in relation to parental unsaturated, which may indicate a low rate of bacterial and hydrogenation processes. A generic pro le 

of the vertical distribution representing all 15 sterols studied was obtained by Principal Component Analysis (PCA). In three 

cores, the vertical distribution pattern of organic material presented the smallest values in the bottomdepth layers, re ecting the 

organic matter already immobilized while in the upper layers values showed a gradual increase towards the top, representing the 

recentdeposition of organic matter. 

Keywords: sediments, sterols, organic matter, Antarctica 

Introduction 

Organic markers, such as sterols, are chemical compounds 

with characteristics of degradation resistance and speci city 

according to their origin. ey can be used as indicators of 

events and processes in the environment on a time scale 

(Colombo et al., 1989). Particularly, sterols have been 

widely used as indicators of sources, bacterial reworking 

and diagenetic transformations of organic matter deposited 

in the marine sediment, such as an indicator of sewage 

introduction into the marine environment (Green & 

Nichols, 1995; Hughes & ompson, 2004; Volkman, 2005; 

Yunker et al., 2005). 

Sterols represent a small proportion of biogenic organic 

matter, however, they are essential to marine organisms, 

because they are key components of cell membranes 

and for the regulation of specific metabolic processes 

(Laureillard et al., 1997). Particulate organic matter, living 

organisms and sediment show the presence ofsterols, thus 

the determination of these organic markers helps in the 

understanding of sources and fate of organic matter into 

the marine environment, as well as ngerprints of primary 

production (Hudson et al., 2001). 

In marine organic matter the main sterols that can 

be found are:4α,23,24-trimetil-colesta-22E-en-3β-ol 

(dinosterol - photosynthetic dino agellates), colest-5-en-3βol, 

(cholesterol - to and zooplankton), 24-etil-colest-5-en- 

3β-ol (sitosterol), 24-metil-colest-5-en-3β-ol(campesterol) 


8 

145

(algae and bacteria) and 24-metil-colesta-5,22E-dien-3β-ol 

(brassicasterol - diatoms). e saturated sterols such as 

5α-colestan-3β-ol (cholestanol), 24-metil-colesta-22E-en- 

3β-ol (campestanol) and 24-etil-colestan-3β-ol (sitostanol), 

are also present in di erent marine organisms and can 

be formed as result of diagenetic processes and bacterial 

hydrogenation of unsaturated sterols (Volkman, 2005). 


Currently, the organic geochemical aspects related to 

the contribution and the conversion of sedimentary organic 

matter indicated by sterols in a given time scale in the 

Antarctic environment has been barely investigated. e 

distribution of these compounds in sediment cores may 

be useful for the understanding of the temporal and local 

environmental changes based on natural and anthropogenic 

events in the recent past. 

e aim of this research has been to study the temporal 

distribution of sterols as indicators of origin, input, 

40° 

50° 

60° 

70° 

80° 

Antarctico 

Bransfield Strait 

South 

America 

Map - 02 

Map - 01 

Map - 02 

62° 

4’ 

5’ 

6’ 

7’ 

8’ 

9’ 

10’ 

11’ 

12’ 

13’ 

14’ 

15’ 

16’ 

N 

W E 

S 

preservation or degradation of marine organic matter in 

sediment cores of Martel Inlet, Admiralty Bay, Antarctica. 


Study area 

e study area was the Martel Inlet, in Admiralty Bay, 

King George Island located in the South Shetland Islands, 

Antarctic Peninsula (62° 02’ S and 58° 21’ W) (Figure 1). 

Admiralty Bay has an area of 131 km², reaches depths of 

up to 530 m and has a coastline with many bays (Santos et al., 

2007), the largest bay being at King George Island, one of 

the South Shetlands Islands. ere are three large inlets in 

Admiralty Bay: Martel, Mackelar and Ezcurra and each of 

them possesses a research station. e Mackelar and Martel 

Inlets form the northern part of the Bay while the Ezcurra 

Inlet is in the west (Bromberg et al., 2000). Comandante 

Macchu Pichu 

Station 

Thomas Point 

C 

Arctowski 

Station 

Ferraz Station Steinhouse 

(A) Martel Inlet 

(B) Mackelar Inlet 

(C) Enzcurra Inlet 

Hennequin Point 

Admiralty Bay 

Botany 

Point 

0 1 2 3 4 km 

40’ 38’ 36’ 34’ 32’ 30’ 28’ 26’ 24’ 22’ 20’ 18’ 16’ 

58° 

Figure 1. Sampling stations at Admiralty Bay, King George Island, Antarctica. (1): ComandanteFerraz Brazilian Antarctic Station (FER); (2): Steinhouse 

Glacier (STH); (3): Botany Point (BTN). 

B 

1 2 

A 

3

Ferraz Antarctic Station (EACF), the Brazilian station, is 

located in Martel Inlet. 

Sampling 

Sampling was carried out during the austral summer of 

2007/08, in three di erent points in Martel Inlet named: 

Ferraz Station (FER), Steinhouse Glacier (STH) and Botany 

Point (BTN). e cores were obtained from a box core 

sampler, and sub-sampled into sections of 1 cm. 

Analytical procedure 

e analytical method used for the analysis of sterols in 

sediments is described in Kawakami and Montone (2002). 

Around 20 g of sediment from each site were extracted 

using a Soxhlet system for 8 hours with 70 mL of ethanol. 

The surrogate, 5α-cholestane was added before each 

extraction. e ethanol extract was reduced to c. 2 mL by 

rotoevaporation and submitted to a clean up with column 

chromatography using 2 g of 5% deactivated alumina and 

elution with 15 mL of ethanol. e extracts were evaporated 

to dryness and derivatized to form trimethylsilyl ethers 

using BSTFA (bis(trimethylsilyl)tri uoroacetamide) with 

1% TMCS (trimethylchlorosilane) for 90 minutes at 65 °C. 

e mixture of TMS-sterols derivatives was determined by 

the injection of 2 µL into a gas chromatograph equipped 

with a ame ionization detector (GC-FID). Instrumental 

details are described by Montone et al. (2010). 


The most abundant compound in BTN and STH was 

the colest-5-en-3β-ol (cholesterol) (2.24 µg.g –1 and 

4.12 µg.g –1 , respectively), producedby various organisms 

that inhabit the region, including seals, whales, phyto and 

zooplankton (Volkman, 2005).In FER, the 24-metil-colest- 

5-en-3β-ol (campesterol) (1.83 µg.g –1 ), biosynthesized by 

Prymnesiophycean algae (Phaeocystissp) and cyanobacteria 

(Volkman, 2005) was the most abundant sterol. The 

detected concentrations of 15 di erent sterols analyzed 

are evidence of the variety of sources of composition of 

sedimentary organic matter in Martel inlet. e presence of 

saturated sterols in the sediment indicates the occurrence of 

diagenic process although they are not commonly found in 

signi cant abundance in organisms (Hassett & Lee, 1977). 

However, the lower concentrations of saturated sterols in 

relation to the unsaturated homologue may indicate low 

rate of bacterial and hydrogenation diagenetic processes. 

A generic profile of the vertical distribution of all 

sterols analyzed was obtained by Principal Component 

Analysis (PCA), using the concentration of each compound 

according to di erent depth sections of sediment cores. 

a b c 

Figure 2. Vertical profi lesobtained by Principal Component Analysis (PCA) to BTN, STH and FER sites. 


147


As expected, the general profile of the three sites 

(Figure 2) showed highest concentrations in the upper 

layers. e sterol levels decreased with depth, suggesting 

degradation a er depositional and little changes in sources 

of organic matter in the recent past (Hudson et al., 2001). 

In BTN (Figure 2a), a constant behavior can be visualized 

in depth sections up to 10-11 cm, indicating the immobilized 

organic matter (Muri & Wakeham, 2006). e lowest value 

at ~10 cm suggesting declines in productivity or uxes of 

poor-sterol material at this point (Hudson et al., 2001). A 

more signi cant peak can be seen between 15 and 16 cm and 

it may be associated with large inputs of organic matter to 

the bottom sediments of Martel Inlet as a result of natural 

events (period of increased melting, signi cant uctuations 

in populations of marine organisms or changes in sediment 

particle size) (Hudson et al., 2001). From sections 9-10 cm 

up to surface layers, the increased values are compatible with 

the recent organic matter deposition, weakly transformed in 

the water column and by post depositional processes. 

In the cores STH (Figure 2b) and FER (Figure 2c), a 

similar distribution to BTN was found, except for a peak at 

2 and 3 cm (STH) and from 1 to 3 cm (FER), which may have 

been due to the presence of ne grained particles (visual 

observation) in these sections resulting in high organic 

matter accumulation and strong accumulation of sterols 

due to physical adsorption(Meyers, 1994). 

Conclusions 

Based on the results obtained from this work, a multiplicity 

of sources of marine organic matter to sediments of Martel 

Inlet could be veri ed, due to all sterols analyzed having 

shown detectable concentrations in most of the sections of 

the three cores analyzed, despite of evident degradation in 

down-core sections. 

e vertical pro les generated by PCA presented lower 

values in the depth layers, re ecting the organic matter 

already immobilized while in the upper layers values showed 

increased concentrations, representing the recent inputs of 

organic matter. 

e results of this research can contribute to a better 

understanding of the processes related to contribution and 

the transformation of organic matter in Martel Inlet, serving 

as a basis for other environmental studies, in development 

in the region. 


Edna Wisnieski expresses gratitude forthe scholarship 

granted by (FundaçãoAraucária – PR). Liziane M. M. 

Ceschim expresses gratitude for the DTI-3 scholarship 

(CNPq 382434/2009-9) related to Brazilian “National Science 

and Technology Institute on Antarctic Environmental 

Research” (INCT-APA, CNPq 574018/2008-5 and FAPERJ 

E-16/170023/2008). C.C. Martins expresses gratitude 

for the PQ-2 Grant (CNPq 307110/2008-7). e authors 

thank the nancial support obtained from the Ministério 

do Meio Ambiente (MMA), Ministério de Ciência e 

Tecnologia (MCT) and Conselho Nacional de Pesquisa 

(CNPq - GEOLs Project 550014/2007-1) and the logistical 

support from Comissão Interministerial para os Recursos 

do Mar (CIRM).

References 

Bromberg, S.; Nonato, E.F.; Corbisier, T.N. & Petti, M.A.V. (2000) Polychaete distribution in the near-shore zone of Martel inlet, 

Admiralty Bay (King George Island, Antarctica). Bulletin of Marine Science, 67(1): 175-88. 

Colombo, J.C.; Pelletier, E.; Brochu, C.; Khalil, M. & Catoggio, J.A.(1989). Determination of hydrocarbon sources using 

n-alkane and polyaromatic hydrocarbon distribution indexes. Case study: Rio de la Plata Estuary, Argentina. Environmental 

Science Technology, 23(7): 888-94. 

Green, G. & Nichols, P.D. (1995). Hydrocarbons and sterols in marine sediments and soils at Davis Station, Antarctica: a 

survey for human-derived contaminants. Antarctic Science, 7(2): 137-44. 

HassetJr, J.P.& Lee, G.F. (1977).Sterols in natural water and sediment. Water Research, 11(11): 983-9. 

Hudson, E.D.; Parrish, C.C. & Helleur, R.J.(2001).Biogeochemistry of sterols in plankton, settling particles and recent sediments 

in a cold ocean ecosystem (Trinity Bay, Newfoundland). Marine Chemistry, 76(4): 253-70. 

Hughes, K.A. & Thompson, A. (2004). Distribution of sewage pollution around a maritime Antarctic research station indicated 

by faecal coliforms, Clostridium perfringens and faecal sterol markers. Environmental Pollution, 127(3): 315-21. 

Kawakami, S.K. & Montone, R.C. (2002).An effi cient ethanol-based analytical protocol to quality fecal steroids in marine 

sediments.Journal of Brazilian Chemical Society, 13(2): 226-32. 

Laureillard, J.; Pinturier, L.; Fillaux, J. & Saliot, A.(1997). Organic geochemistry of marine sediments of the Subantarctic Indian 

Ocean sector: Lipid classes – sources and fate. DeepSea Research II, 44(5): 1085-108. 

Meyers, P.A. (1994). Preservation of elemental and isotopic source identifi cation of sedimentary organic matter. Chemical 

Geology, 114(3-4): 289-302. 

Montone, R.C.; Martins, C.C.; Bícego, M.C.; Taniguchi, S.; Silva, D.A.M.; Campos, L.S. & Weber, R.R. (2010). Distribution 

of sewage input in marine sediments around a maritime Antarctic research station indicated by molecular geochemical 

indicators. Science of the Total Environment, 408(20): 4665-71. 

Muri, G. & Wakeham, S.G. (2006). Organic matter and lipids in sediments of Lake Bled (NW Slovenia): Source and effect of 

anoxic and oxic depositional regimes. OrganicGeochemistry, 37(12): 1664-79. 

Santos, I.R.; Fávaro, D.I.T.; Schaefer, C.E.G.R. & Silva-Filho, E.V. (2007). Sediment geochemistry in coastal maritime Antarctica 

(Admiralty Bay, King George Island): Evidence from rare earths and other elements. Marine Chemistry, 107(4): 464-74. 

Volkman, J.K. (2005). Sterols and other triterpenoids: source specifi ty and evolution of biosynthetic pathways. Organic 

Geochemistry, 36(2): 139-59. 

Yunk er, M.B.; Belicka, L.L.; Harvey, H.R. & Macdonald, R.W. (2005).Tracing the inputs and fate of marine and terrigenous 

organic matter in Arctic Ocean sediments: A multivariate analysis of lipid biomarkers.Deep Sea Research II, 52(24-26): 

3478-508. 


149

9 BACKGROUND 


VALUES AND ASSESSMENT OF FECAL 

STEROIDS DISCHARGED INTO TWO INLETS 

(MACKELAR AND EZCURRA) IN ADMIRALTY BAY, 

KING GEORGE ISLAND, ANTARCTICA 

Sabrina Nart Aguiar 1,* , Liziane Marcella Michelotti Ceschim 2 , Edna Wisnieski 1 , César de Castro Martins 1,** 

1 Centro de Estudos do Mar, Universidade Federal do Paraná – UFPR, Pontal do Paraná, PR, Brazil 


e-mail: * sabrina.oceano@gmail.com; ** ccmart@ufpr.br 

Abstract: Steroids are e cient geochemical markers of natural and anthropogenic environmental events, because they present 

stability and resistance to the degradation process, keeping a record of their signature origin, allowing interpretations about the 

organic matter sources. e Antarctic region is considered one of the best preserved environments in the world; however human 

activities have resulted in changes in this pristine location. Sampling was collected during the 2006/07 austral summer at three 

points: Refuge II (REF) (Mackelar Inlet), omas Point (PTH) and Barrel Point (BAR) (Ezcurra Inlet). A er Soxhlet extraction, 

clean up using adsorption column and derivatization, steroids concentrations were determined by gas chromatography with 

ame ionization detector (GC-FID). Concentrations of fecal sterols (coprostanol and epicoprostanol) in all locations studied 

were

Bay environment is subjected to little human in uence 

and fecal steroids can be associated to marine mammals, 

the determination of background values of these organic 

markers in di erent Antarctic regions are important for 

future studies, especially in places where scienti c stations 

are established (Montone et al., 2010). us, background 

values of fecal steroids, based on the concentration of these 

markers, were obtained from three short sedimentary 

columns, which were sampled at Mackelar and Ezcurra Inlet. 


Admiralty Bay is situated in King George Island, in the 

South Shetland Islands. Human occupation in the Bay is 

represented by the presence of three main stations and 

some refuges. Martel Inlet is the location of Brazilian 

Ferraz Station and two refuges; Mackelar Inlet is the base 

of the Peruvian Macchu Picchu station, located near Crepin 

Point, while the Polish Henryk Arctowski station is located 

at Ezcurra Inlet, on the western side of the Admiralty Bay. 

Two cores were collected in Ezcurra Inlet, near the 

omas Point and Barrel Point; both at 30 m deep, and the 

third core was collected on the opposite side of Macchu 

Pichu station, near the Brazilian refuge, at 20 m deep, in 

Mackelar Inlet. e sampling was undertaken using a box 

corer between December 2006 and January 2007. 25 mm 

diameter wide aluminum tubes were introduced into the 

box, and cores of approximately 20 cm were sampled and 

sectioned at 1 cm intervals. 

Steroid analysis was based on a method described by 

Kawakami and Montone (2002). More than 20 g of sediment 

from each site were extracted using a Soxhlet system for 

8 hours with 70 mL of ethanol. e surrogate, 5α-cholestane, 

was added before each extraction. e ethanol extract was 

reduced to c. 2 mL by rotoevaporation. e concentrated 

ethanol extract was submitted to a clean up with column 

chromatography using 2 g of 5% deactivated alumina and 

elution with 15 mL of ethanol. e extracts were evaporated 

to dryness and derivatized to form trimethylsilyl ethers 

using BSTFA (bis(trimethylsilyl)tri uoroacetamide) with 

1% TMCS (trimethylchlorosilane) for 90 minutes at 65 °C. 

e mixture of TMS-sterols derivatives was determined by 

the injection of 2 µL into a gas chromatograph equipped 

with a ame ionization detector (GC-FID). Instrumental 

details are described by Montone et al. (2010). 


e sedimentation rates used in this work to determine 

the time scale indicated by the cores were calculated by 

Martins et al. (2010). BAR presented 0.13 cm.y –1 . For other 

cores (REF and PTH), we used a mean value between several 

sites in Admiralty Bay (0.22 cm.y –1 ). 

Among the most widely used sterols, coprostanol and 

epicoprostanol (named fecal sterols) are found in sediments 

contaminated by sewage (Venkatesan & Kaplan, 1990; 

Venkatesan & Santiago, 1989), because they are associated 

primarily with human feces (Grimalt et al., 1990). However, 

feces of marine animals, such as some species of whales, 

seals, sea lions, contributes with large quantities of these 

compounds to the Antarctic environment (Venkatesan et al., 

1986; Venkatesan & Santiago, 1989) and it is assumed as 

“natural contribution”. e same sources can be assigned 

to ketone coprostanone (Martins et al., 2002; Venkatesan 

& Kaplan, 1990). González-Oreja and Saiz-Salinas (1998) 

proposed limits to coprostanol in order to de ne natural 

input or sewage contribution, where values below 0.50 µg.g –1 

may be related pristine environments. 

In REF, the coprostanol presented values between 

0.01 and 0.06 μg.g –1 and the epicoprostanol between 

0.01 and 0.04 μg.g –1 (Table 1). ese values are below the 

established limit, suggesting an introduction related to 

marine mammals, despite of this point being located on 

the opposite side to a research station (Macchu Pichu). 

To the PTH, the values of coprostanol and epicoprostanol 

were also below the limit, between 0.01 and 0.04 μg.g –1 and 

0.01 and 0.09 μg.g –1 , respectively (Table 1). As well as in REF, 

the maximum values for each fecal sterol are lower than 

the limit established by González-Oreja and Saiz-Salinas 

(1998). ese values suggest that although variations occur 

throughout the pro le, the introduction of these compounds 

seems to be from natural sources, despite the proximity of 

these sites to human activities. As veri ed in other points, 

the coprostanol and epicoprostanol were also low in BAR 


151

Table 1. Concentration (in µg.g –1 ) of fecal sterols and ketone coprostanone in cores collected at REF, PTH and BAR. Mean value and standard deviation (SD) were calculated for all sections of each core. 

Refuge II 

14-15 

cm 

13-14 

cm 

12-13 

cm 

11-12 

cm 

Section 0-1 cm 1-2 cm 2-3 cm 3-4 cm 4-5 cm 6-7 cm 8-9 cm 10-11 

cm 


Mean SD 

1939- 

1943 

1943- 

1948 

1948- 

1952 

1952- 

1957 

1957- 

1962 

1966- 

1971 

1975- 

1980 

1984- 

1989 

1989- 

1993 

1993- 

1998 

1998- 

2002 

Date 2002- 

2007 

Coprostanol 0.04 0.05 0.03 0.04 0.04 0.05 0.06 0.05 0.03 0.01 0.03 0.03 0.04 0.01 

Epicoprostanol 0.04 0.02 0.04 0.02 0.04 0.03

and associated to natural contribution. Values observed for 

these compounds are 0.01 to 0.02 μg.g –1 (coprostanol) and 

0.01 to 0.03 μg.g –1 (epicoprostanol) (Table 1). 

Concentrations of coprostanone also can be attributed to 

natural contribution, since it is assigned to marine mammal 

feces, such as fecal sterols. Higher values (>0.50 μg.g –1 ) in 

the most recent layers are found at REF (0.69 – 3.62 μg.g –1 ) 

and PTH (0.32 – 0.52 μg.g –1 ). Coprostanone from sewage 

input in these sites was not expected as none of the stations 

located in the two inlets discharge sewage in the region 

(Martins et al., 2002). 

In order to minimize the ambiguity of sources for these 

compounds, the use of numerical ratio involving fecal 

sterols are important tools in the di erentiation of the 

sources of fecal organic matter. Venkatesan and Santiago 

(1989) have proposed speci c indexes as the ratio between 

the concentration of coprostanol and epicoprostanol, 

as a way to distinguish the places studied in relation to 

the contribution of fecal sterols from human or marine 

mammals, speci cally to the Antarctic environment. Values 

below 2.50 may indicate natural contribution, while values 

above 2.50 are strongly related to sewage. REF did not show 

values exceeding 2.50 in any section (1.67 ± 0.71), suggesting 

that the main source of sterols are marine mammals. e 

same results occurred to the sediment cores from Ezcurra 

Inlet (1.24 ± 0.57 – PTH; and 0.86 ± 0.40 – BAR) (Table 1). 

The results of this ratio showed that the source of 

sedimentary fecal steroids is from natural contributions. At 

which point, background values can be determined, which 

are useful to evaluate a hypothetical sewage discharge in these 

regions. In Martel Inlet, the background values related to 

natural sources of fecal sterols (coprostanol+epicoprostanol) 

have been established as 0.19 μg.g−1 (Montone et al., 2010). 

Considering the mean value obtained for each three 

cores, the background values to the sum of coprostanol 

and epicoprostanol, the purpose of this study are: 

(0.06 ± 0.02) μg.g−1 (REF), (0.04 ± 0.03) μg.g−1 (PTH) and 

(0.03 ± 0.01) μg.g−1 (BAR). Coprostanone did not present 

a regular distribution according to the depth, showing 

increased concentrations in the top layers and low levels 

in the bottom cores, in that it is difficult to establish 

background values to this compound. In this case, it is 

necessary to consider the degradation processes in top 

sections and unusual inputs in speci c layers of REF and 

PTH. 

Conclusions 

Concentrations of fecal sterols (coprostanol and 

epicoprostanol) in all locations studied were

References 

Colombo, J.C.; Pelletier, E.; Brochu, C.; Khall, M. & Catoggio, J.A. (1989) Determination of Hydrocarbon Sources Using n-Alkane 

and Polyaromatic Hydrocarbon Distribution Indexes. Case Study: Rio de La Plata Estuary, Argentina. Environmental 

Science & Technology, 23(7): 888-94. 

González-Oreja, J.A. & Saiz-Salinas, J.I. (1998). Short-term spatio-temporal changes in urban pollution by means of faecal 

sterols analysis. Marine Pollution Bulletin, 36(11): 868-75. 

Green, G. & Nichols, P.D. (1995). Hydrocarbons and sterols in marine sediments and soils at Davis Station, Antarctica: a 

survey for human-derived contaminants. Antarctic Science, 7(2): 137-44. 

Grimalt, J.O.; Fernandez, P.; Bayona, J.M. & Albaiges, J. (1990). Assessment of fecal sterols and ketones as indicator of 

urban sewage inputs to coastal waters. Environmental Science & Technology, 24(3): 357-63. 

Hughes, K.A. (2004). Reducing sewage pollution in the Antarctic marine environment using a sewage treatment plant. Marine 

Pollution Bulletin, 49(9-10): 850-53. 

Hughes, K.A. & Thompson, A. (2004). Distribution of sewage pollution around a maritime Antarctic research station indicated 

by faecal coliforms, Clostridium perfringens and faecal sterol markers. Environmental Pollution, 127(3): 315-21. 

Kawakami, S.K. & Montone, R.C. (2002) An effi cient ethanol-based analytical protocol to quality fecal steroids in marine 

sediments. Journal of the Brazilian Chemical Society, 13(2): 226-32. 

Martins, C.C.; Venkatesan, M.I. & Montone, R.C. (2002). Sterols and linear alkylbenzenes in marine sediments from Admiralty 

Bay, King George Island, South Shetland Islands. Antarctic Science, 14(3): 244-52. 

Martins, C.C.; Montone, R.C.; Gamba, R.C. & Pellizari, V.H. (2005). Sterols and fecal indicator microorganisms in sediments 

from Admiralty Bay, Antarctica. Brazilian Journal of Oceanography, 53(1/2): 1-12. 

Martins, C.C.; Bícego, M.C.; Rose, N.L.; Taniguchi, S.; Lourenço, R.A.; Figueira, R.C.L.; Mahiques, M.M. & Montone, R.C. 

(2010). Historical record of polycyclic aromatic hydrocarbons (PAHs) and spheroidal carbonaceous particles (SCPs) 

in marine sediment cores from Admiralty Bay, King George Island, Antarctica. Environment Pollution, 158(1): 192–200. 

Montone, R.C.; Martins, C.C.; Bícego, M.C.; Taniguchi, S.; Silva, D.A.M.; Campos, L.S. & Weber, R.R. (2010). Distribution 

of sewage input in marine sediments around a maritime Antarctic research station indicated by molecular geochemical 

indicators. Science of the Total Environment, 408(20): 4665–71. 

Venkatesan, M.I.; Ruth, E. & Kaplan, I.R. (1986). Coprostanols in Antarctic marine sediments: A biomarker for marine mammals 

and not human pollution. Marine Pollution Bulletin, 17(12): 554-7. 

Venkatesan, M.I. & Santiago C.A. (1989). Sterols in oceans sediments: novel tracers to examine habitats of cetaceans, 

pinnipeds, penguins and humans. Marine Biology, 102: 431-7. 

Venkatesan, M.I. & Kaplan, I.R. (1990). Sedimentary Coprostanol as an index of sewage addition in Santa Monica Basin, 

southern California. Environmental Science & Technology, 24(2): 208-14. 


THE ROLE OF EARLY DIAGENESIS IN THE SEDIMENTARY 

STEROIDS AROUND PENGUIN ISLAND, ANTARCTICA 

Liziane M. M. Ceschim 1,2,* , Rosalinda C. Montone 2 , César C. Martins 1,** 

1 Centro de Estudos do Mar, Universidade Federal do Paraná, Pontal do Paraná, PR, Brazil 


e-mail: * lceschim@usp.br; ** ccmart@ufpr.br 

Abstract: e role of lipids in polar environments is of primary importance for understanding the cycling of carbon organic 

and associated elements. us, the knowledge of the nature and quality of organic matter is necessary to evaluate the overall 

impact in this area and to model the carbon cycle. e aim of this study was to determine the transformations of organic matter 

in the marine environment by analysis of a speci c group of lipid biogeochemical markers, the sedimentary steroids. Sediment 

cores were collected during the 2007/08 austral summer in the vicinity of the Penguin Island (2 cores). In general, the cores 

were sectioned at 1 cm intervals and the steroids analyzed by gas chromatography with ame ionization detection (GC-FID), 

a er Soxhlet extraction, adsorption column chromatography and derivatization. e results showed that organic matter had 

been subjected to extensive degradation and transformation with depth in the two corers and the general increase of the stanol/ 

stenol ratio may have represented the progressive reduction of stenols to stanols within the deepest sediment layers. According 

to the linear regression (R2 ) applied, the process at Penguin Island is governed by a natural supply, and a random pattern in the 

concentration values with increasing depth. ese results contribute to the understanding of the current processes of organic 

matter transformation in this important region of Antarctic environment. 

Keywords: steroids, sediments, organic matter, Antarctica 

Introduction 

Advanced studies about biogeochemical cycles in the 

relatively unpolluted areas of the world, such as Antarctica, 

have been of great interest. Thus, the Southern Ocean 

appears an attractive region due to the distance from major 

sources of human pollution, very cold average temperatures, 

a strong seasonality and the almost complete absence of 

higher plants (Laureillard et al., 1997). 

e role of lipids in polar environments is of primary 

importance for understanding the cycling of carbon organic 

and associated elements. Knowledge of the nature and 

quality of organic matter, assemblages of organisms and 

relative rates of primary production for those communities 

in the ocean and its interactions with chemical and 

biological systems is important to evaluate the overall 

impact in this area and modeling the world carbon cycle 

(Mudge & Norris, 1997; Villinski et al., 2008). 

Based on this expectation, this work has the purpose 

to investigate di erent organic compounds in the marine 

sediments to determine the transformations of organic 

matter in the Antarctic environment by analysis of a speci c 

group of lipid biogeochemical markers, the sedimentary 

steroids. 

10 


155


Study area 

Penguin Island (62° 06’ S and 57° 54’ W; area 1.7 km 2 ) is 

situated on the southeastern side of King George Island, 

South Shetland Islands, Antarctica (Figure 1). It lies within 

a belt of inactive volcanoes that developed in the Brans eld 

Strait (Birkenmajer, 1982). 


Almost all this island is dominated by species of birds 

and according to Sander et al. (2007) nine bird species 

nest on Penguin Island, among them Pygoscelis antarctica 

(chinstrap penguin) and Pygoscelis adeliae (adélie penguin). 

ese populations contribute signi cantly to a large amount 

of guano, in uencing strongly the physical and chemical 

properties of local soils, producing ornithogenic soil 

(Michel et al., 2006; Zhu et al., 2009). 

Sampling 

Sediment cores were taken by mini-box corer (25 × 25 × 55 cm) 

during the 2007/08 austral summer. In general, the cores 

were sectioned on board to a resolution of 1-2 cm prior to 

sub-sampling for chemical and physical characterization, 

and placed into pre-cleaned aluminum foil and stored at 

–20 °C until analyzed in laboratory. 

Extraction and fractioning of sterols 

In the present study, all samples were analyzed for 

17 di erent steroids, including 15 sterols and 2 ketones. e 

laboratory procedure was based on a method described by 

Kawakami and Montone (2002). is consists of analysis 

by gas chromatography with ame ionization detection 

(GC-FID), a er Soxhlet extraction, adsorption column 

chromatography and derivatization with BSTFA/TCMS. 

Data was subject to quality control procedures, like 

the analysis of spiked samples (4 replicates), precision 

tests (4 replicates) and evaluation of the instrumental 

performance (response factors). Analysis of procedural 

blanks (6 replicates) indicated minor amounts of 

dehidrocholesterol and cholesterol, which were subtracted 

from the samples. Surrogate recoveries (5α-cholestane) 

ranged from 66-132%. Sediment and blank samples 

were spiked with a mixture of steroids and the standard 

recoveries ranged from 99-139 %. Detection limits (DL) 

were < 0.01 µg.g –1 for all compounds analyzed. 


e ratio between stanol/stenol has been used to indicate 

microbial reduction in anaerobic environments. Studies 

about redox effects on organic matter degradation/ 

preservation have shown that the residence times for organic 

compounds present in marine sediments can vary as a result 

of environmental conditions such as bioturbation, physical 

mixing and the presence or absence of oxygen and other 

electron acceptors (Wakeham & Canuel, 2006). 

Stanols may be formed within the sediments by bacterial 

reduction of stenols in highly or permanently anoxic 

sediments (Nishimura & Koyama, 1977). Consequently, 

the stanol/stenol ratio has been used to describe the 

redox conditions of the sediments (Gagosian et al., 1980). 

Since stanols are synthesized by some plankton, notably 

dinoflagellates (Robinson et al., 1984) and diatoms 

(Barrett et al., 1995), changes in the distribution of marine 

phytoplankton through time may provide an additional 

source of variability in the sedimentary stanol/stenol ratio. 

Sterols undergo a variety of chemical and microbial 

reactions in the surface layers of marine sediments. It is 

seems evident that they have been subjected to degradation 

and transformation with depth in the two corers (Figure 2), 

mainly PGI-2. e general increase of the stanol/stenol 

ratio may illustrate the progressive reduction of stenols to 

stanols within the deepest sediment layers (Shanchun et al., 

1994; Fernandes et al., 1999), showing that the rates of sterol 

degradation in sediments are a group of several processes, 

which the hydrogenation appears to be relatively more 

important (Volkman et al., 1987). 

Once the most energetically favorable metabolic 

pathways for bacteria involve oxygen as the electron 

acceptor, the organic carbon degradation (and preservation) 

in sediments is strongly controlled by the average time that 

organic matter is exposed to oxygen (Wakeham & Canuel, 

2006). Hence, it is feasible that stanols are relatively less 

abundant at the surface than at the bottom sections of the 

PGI-1 and PGI-2 corers.

Figure 1. Location of sampling stations (PGI-1 and PGI-2) in the Antarctic continent and the South Shetland Islands. 


157

Figure 2. Mean value of four pairs of stanol/stenol rate in PGI-1 and PGI-2. 


is process occurs in opposition to the progressive 

input of stanols from potentially new sources of biogenic 

saturated molecules being identi ed by di erent studies, 

such as dinoflagellates, diatoms and some species of 

invertebrates, usually represented by low values in the ratio 

(Hudson et al., 2001; Ternois et al., 1998). 

According to Wakeham and Canuel (2006), values of the 

stanol/stenol ratio varied between 0.1 and 0.2 for oxic water 

columns and between 0.6 and 1.2 in sub-oxic and anoxic 

interfaces in the water column from the Cariaco Trench 

(Caribbean shelf) and Black Sea. In the present study, the 

ratio varied from 0.33 to 0.57 (0.43 ± 0.07) (PGI-1) and 

0.11 to 0.57 (0.39 ± 0.12) (PGI-2) indicating well oxygenated 

sediments. e results also show that the redox conditions 

of sediment appear to have been potentially modi ed, 

as is noted by the reduction and increase in the values at 

several depths of both corers. is variation may re ect the 

change of water chemistry of the site at the time of sediment 

deposition due to a general renewal of bottom water and 

thus its re-oxygenation (Pinturier-Geiss et al., 2002). 

Jeng et al. (1997) analyzing sediment cores of the coast of 

Taiwan, found that the rate of degradation of sterols follows 

a typical kinetic mechanism of 1st order reaction. To this 

evaluation, the linear relation between the natural logarithm 

(ln) of total sterols concentration and depth (along the 

cores) was determined. In order to complement the results 

obtained, graphs of linear regression (R2 ) for both cores 

(Figure 3) were done. It is possible to observe a decrease in 

the concentration of sterols toward the lower depth layers, 

for most points in the sedimentary columns. ese results

Figure 3. Sterol degradation model indicated by linear regression between Ln stigmasterol concentration vs depth to PGI-1 and PGI-2 sediment cores. 

con rm the trend of degradation over the preservation of 

organic compounds and, consequently, of sedimentary 

organic matter, which is of fundamental importance for 

understanding the processes prevailing in this environment. 

In both corers, the linear regression values showed that 

the degradation occurs according to kinetic mechanism of 

1st order (R2 < 0.75). Fluctuations in the natural supply of 

sterols and over the years may change the regular pattern 

with increased depth, which explains the absence of a perfect 

linear correlation, especially in PGI-1. e degradation can 

be de ned as the decrease of compound concentration by 

transformation into other molecules (such as conversion of 

stenols to stanols), decomposition into smaller molecules, or 

incorporation into high molecular weight components. As 

all processes are related with removal of extractable sterols 

from the sediments (Jeng et al., 1997), the results suggest 

that the diagenesis of organic matter in sediments around 

Penguin Island is an important environment process of 

organic matter transformation. 

Conclusion 

According to the values found for the stanol/stenol ratio, 

the sediments around Penguin Island are well oxygenated. 

However, some changes were detected along the sedimentary 

column and may have resulted by change of water chemistry 

related to the time-scale of sediments deposition and the 

general renewal of bottom water and thus its re-oxygenation. 

Linear regression analysis con rmed the degradation trend 

over the preservation of sedimentary organic matter. is 

information helps a better understanding of the processes 

related to contribution and the transformation of organic 

matter around Penguin Island. 


159


Liziane M. M. Ceschim expresses gratitude for DTI-3 

scholarship (CNPq 382434/2009-9) related to Brazilian 

“National Science and Technology Institute on Antarctic 

Environmental Research” (INCT-APA, CNPq 574018/2008-5 

and FAPERJ E-16/170023/2008). C.C. Martins expresses 

gratitude for the PQ-2 Grant (CNPq 307110/2008-7). 

References 


e authors thank the nancial support obtained from 

the Ministério do Meio Ambiente (MMA), Ministério de 

Ciência e Tecnologia (MCT) and Conselho Nacional de 

Pesquisa (CNPq - GEOLs Project 550014/2007-1) and the 

logistical support from Comissão Interministerial para os 

Recursos do Mar (CIRM). 

Barrett, S.M.; Volkman, J.K.; Dunstan, G.A. & LeRoi, J.M. (1995). Sterols of 14 species of marine diatoms (Bacillariophyta). 

Journal of Phycology, 31(1): 360-69. 

Birkenmajer, K. (1982). The Penguin Island Volcano, South Shetland Island (Antarctica): It’s structure and succession. Studia 

Geologica Polonica, 74(3): 155-73. 

Fernandes, M.B.; Sicre, M.A.; Cardoso, J. N. & Macedo, S. J. (1999). Sedimentary 4-desmethyl sterols and n-alkanols in na 

eutrophic urban estuary, Capibaribe River, Brazil. The Science of the Total Environment, 231(1): 1-16. 

Gagosian, R.B.; Smith, S.O.; Lee, C.; Farrington, J.W. & Frew, N.M. (1980). Steroid transformations in recent marine sediments. 

In: Douglas A.G. & Maxwell, J.R. (Editors). Advances in Organic Geochemistry. Oxford: Pergamon, pp. 407-419. 

Hudson, E.D.; Parrish, C.C. & Helleur, R.J. (2001) Biogeochemistry of sterols in plankton, settling particles and recent sediments 

in a cold ocean ecosystem (Trinity Bay, Newfoundland). Marine Chemistry, 76(4): 253-70. 

Jeng, W.L.; Huh, C.A. & Chen, C.L. (1997). Alkanol and sterol degradation in a sediment core from the continental slope off 

Southwestern Taiwan. Chemosphere, 35(11): 2515-23. 

Kawakami, S.K. & Montone, R.C. (2002). An effi cient ethanol-based analytical protocol to quality fecal steroids in marine 

sediments. Journal of the Brazilian Chemical Society. 13(2): 226-32. 

Laureillard, J.; Pinturier, L.; Fillaux, J. & Saliot, A. (1997). Organic geochemistry of marine sediments of the Subantarctic Indian 

Ocean sector: Lipid classes – sources and fate. Deep-Sea Research. II, 44(5): 1085-108. 

Michel, R.F.M.; Schaefer, C.E.G.R.; Dias, L.; Simas, F.N.B.; Benites, V. & Mendonça, E.S. (2006). Ornithogenic gelisols 

(cryosols) from Maritime Antarctica: pedogenesis, vegetation and carbon studies. Soil Science Society of America 

Journal, 70(1): 1370-76. 

Mudge, S. M. & Norris, C. E. (1997). Lipid biomarkers in the Conwy Estuary (North Wales, U. K.): a comparison between fatty 

alcohols and sterols. Marine Chemistry, 57(1-2): 61-84. 

Nishimura M. & Koyama T. (1977). The occurrence of stanols in various living organisms and the behaviour of sterols in 

contemporary sediments. Geochimica et Cosmochimica Acta, 41(1): 379-385. 

Pinturier-Geiss, L.; Mejanelle, L.; Dale, B. & Karlsen, D.A. (2002). Lipids as indicators of eutrophication in marine coastal 

sediments. Journal of Microbiological Methods, 48(2): 239-57. 

Robinson, N.; Cranwell, P.A.; Finlay, B.J. & Eglinton, G. (1984). Lipids of aquatic organisms as potential contributors to 

lacustrine sediments. Organic Geochemistry, 6(2): 143-52.

ANNUAL ACTIVITY REPORT - Instituto de Biologia da UFRJ

Create successful ePaper yourself