Download - Journal of Cell and Molecular Biology - Haliç Üniversitesi

Journal of Cell and 

Molecular Biology 

Volume 7 · No 2 & Volume 8 · No 1 · June 2010 

http://jcmb.halic.edu.tr 

Sensitivity of the human chromosomes to EMS 

Y chromosome microdeletions in spontaneous abortions 

Genetic diversity of Penicillium species



Volume 7 No 2 & Volume 8 No 1 

June 2010 

İstanbul-TURKEY

Haliç University 

Faculty of Arts and Sciences 

Journal of Cell and Molecular Biology 

Founder 

Gündüz GEDİKOĞLU 

President of Board of Trustee 

Rights held by 

Sait SEVGENER 

Deputy Rector 

Correspondence Address: 

The Editorial Office 


Haliç Üniversitesi 

Fen-Edebiyat Fakültesi, 

Kaptan Paşa Mah. Darülaceze Cad. No: 14 34384 

Okmeydanı-Şişli, İstanbul -Turkey 

Phone: +90 212 220 96 96 

E-mail: jcmb@halic.edu.tr 

Journal of Cell and Molecular Biology is 

indexed in ULAKBIM, EBSCO, DOAJ, 

EMBASE, CAPCAS, EMBiology, and 

Index COPERNICUS 

ISSN 1303-3646 

Printed at MART Printing House 

Adil Meriç ALTINÖZ, İstanbul, Turkey 

Tuncay ALTUĞ, İstanbul, Turkey 

Canan ARKAN, Munich, Germany 

Aglaia ATHANASSIADOU, Patras, Greece 

Şehnaz BOLKENT, İstanbul, Turkey 

Nihat BOZCUK, Ankara, Turkey 

A. Nur BUYRU, İstanbul, Turkey 

Kemal BÜYÜKGÜZEL, Zonguldak, Turkey 

Hande ÇAĞLAYAN, İstanbul, Turkey 

İsmail ÇAKMAK, İstanbul, Turkey 

Adile ÇEVİKBAŞ, İstanbul, Turkey 

Beyazıt ÇIRAKOĞLU, İstanbul, Turkey 

Fevzi DALDAL, Pennsylvania, USA 

Zihni DEMİRBAĞ, Trabzon, Turkey 

Mustafa DJAMGÖZ, London, UK 

Aglika EDREVA, Sofia, Bulgaria 

Ünal EGELİ, Bursa, Turkey 

Advisory Board 



Published by 


Faculty of Arts and Sciences 

Editor 

Nagehan ERSOY TUNALI 

Associate Editor 

Mehmet Ali TÜFEKÇİ 

Editorial Board 

Baki YOKEŞ 

Burcu Irmak YAZICIOĞLU 

Kürşat ÖZDİLLİ 

Aslı BAŞAR 

Deniz ERGEÇ, İstanbul, Turkey 

Nermin GÖZÜKIRMIZI, İstanbul, Turkey 

Ferruh ÖZCAN, İstanbul, Turkey 

Füsun GÜMÜŞEL, İstanbul, Turkey 

Candan JOHANSEN, İstanbul, Turkey 

Asım KADIOĞLU, Trabzon, Turkey 

Maria V. KALEVITCH, Pennsylvania, USA 

Valentine KEFELİ, Pennsylvania, USA 

Meral KENCE, Ankara, Turkey 

Uğur ÖZBEK, İstanbul, Turkey 

Sevtap SAVAŞ, Toronto, Canada 

Müge TÜRET SAYAR, İstanbul, Turkey 

İsmail TÜRKAN, İzmir, Turkey 

Mehmet TOPAKTAŞ, Adana, Turkey 

Meral ÜNAL, İstanbul, Turkey 

Selma YILMAZER, İstanbul, Turkey 

Ziya ZİYLAN, İstanbul, Turkey


CONTENTS Volume 7 No 2 & Volume 8 No 1 June 2010 

Review Article 

DNA repetitive sequences-types, distribution and function: A review 

S.R. RAO, S. TREVEDI, D. EMMANUEL, K. MERITA and M. HYNNIEWTA 

Research Articles 

Genetic diversity of Penicillium species isolated from various sources in Sarawak, 

Malaysia 

H.A. ROSLAN, C.S. NGO and S. MUID 

The sensitivity of the human chromosomes to ethyl methanesulfonate (EMS) 

S. BUDAK-DİLER and M. TOPAKTAŞ 

Protective effect of pomegranate peel ethanol extract against ferric nitrilotriacetate 

induced renal oxidative damage in rats 

M.M. AHMED and S.E. ALI 

Molecular and cytogenetic evaluation of Y chromosome in spontaneous abortion cases 

G. KOÇ, K. ULUCAN, D. KIRAÇ, D. ERGEÇ, T. TARCAN and A.İ. GÜNEY 

Do simple sequence repeats in replication, repair and recombination genes of 

mycoplasmas provide genetic variability? 

S. TRIVEDI 

Software Review 

Tcoffee ©: Multipurpose sequence alignments program 

A. MANSOUR 

UCSC: Genome Browser for genomic sequences 

A. MANSOUR 

Dotlet©: powerful and easy strategy for pairwise comparisons 

A. MANSOUR 

Instructions for Authors 85 

1 

13 

25 

35 

45 

53 

71 

75 

81

Journal of Cell and Molecular Biology 7(2) & 8(1): 1-11, 2010 Review Article 

Haliç University, Printed in Turkey. 



Satyawada Rama RAO *,1 , Seema TRIVEDI 2 , Deepika EMMANUEL 2 , Keisham MERITA 1 

and Marlykynti HYNNIEWTA 1 

1 Cytogenetics and Molecular Biology Laboratory, Department of Biotechnology and Bioinformatics, North- 

Eastern Hill University, Permanent Campus, Mawkynroh, Umnsing, 

Shillong- 793022, Meghalaya (INDIA) 

2 Department of Zoology, Jai Narain Vyas University, Jodhpur- 342005, Rajasthan (INDIA) 

(* author for correspondence; srrao22@yahoo.com) 

Received: 21 September 2009; Accepted: 14 May 2010 

Abstract 

The development and use of molecular markers for the detection and exploitation of DNA polymorphism is 

one of the most significant developments in the field of molecular genetics. DNA based molecular markers 

have acted as versatile tools and have found their own position in various fields like taxonomy, physiology, 

embryology, genetic engineering etc. A major step forward in genetic identification is the discovery that 

about 30-90% of the genome is constituted by regions of repetitive DNA which are highly polymorphic in 

nature. Microsatellites are multilocus probes creating complex banding patterns and are usually non-species 

specific occurring ubiquitously. They form an ideal marker system and are dominant fingerprinting markers 

and co-dominant STMS (sequence tagged microsatellites) markers. Microsatellites markers have been used 

successfully to determine the degree of relatedness among individuals or groups of accessions to clarify the 

genetic structure or partitioning of variation among individuals, accessions, populations and species. 

Repetitive sequences have been widely used for examining genome and species relationships by in situ and 

by Southern hybridization. 

Keywords: Satellites, microsatellites, minisatellites, retroposons and proretroviral transposons 

Tekrarlı DNA dizileri-tipleri, dağılımları ve fonksiyonları 

Özet 

DNA polimorfizmlerinin tayini ve kullanılması için moleküler belirteçlerin geliştirip kullanılması moleküler 

genetik alanındaki en önemli ilerlemelerden bir tanesidir. DNA tabanlı moleküler belirteçler çok amaçlı 

kullanım araçlarıdır ve taksonomi, fizyoloji, embriyoloji, genetik mühendisliği gibi çeşitli alanlar arasında 

kendi yerlerini bulmuşlardır. Genetik tayine doğru en büyük adım, genomun hemen hemen %30-90’ının 

tekrarlanan, doğada yüksek oranda polimorfik olan DNA dizilerinden oluştuğunun keşfidir. Mikrosatelitler 

kompleks şerit paterni oluşturan multilokus problardır ve genellikle sıkça bulunup türe spesifik olmazlar. 

Bunlar ideal belirteç sistemini oluştururlar ve dominant parmakizi belirteçleri ve kodominant STMS 

belirteçleridirler (sequence tagged microsatellites–dizi işaretli mikrosatelitler). Mikrosatellit belirteçler, 

bireyler arasında veya katılan gruplar arasında genetik yapının ya da bireyler, gruplar, populasyonlar ve türler 

arasındaki varyasyonun gruplandırılmasının aydınlatılması için, yakınlık derecesinin saptanması amaçlı 

olarak başarı ile kullanılmıştır. Tekrarlanan diziler, genom ve türlerin ilişkilerinin in situ ve Southern 

hibridizasyonu ile incelenmesi için yaygın olarak kullanılmaktadır. 

Anahtar Sözcükler: Satelit, mikrosatelitler, minisatelitler, retropozonlar ve proretroviral transpozonlar

2 

Satyawada Rama RAO et. al. 

Introduction 

The analysis of genetic diversity and relatedness 

between or within different species, populations 

and individuals is a central task for many 

disciplines of biological science. Classical 

strategies of evaluating genetic variability are 

comparative anatomy, morphology, embryology 

and physiology. These are complemented by 

analysis of chemical constituents like plant 

secondary compounds or with specific characterization 

of macromolecules and allozymes. In recent 

years, focus has been shifted to the development of 

molecular markers based on DNA or protein 

polymorphism. The importance of these studies lies 

in exploitation of uniqueness of DNA sequences 

that facilitate research in diverse disciplines such as 

taxonomy, phylogeny, ecology, genetics and plant 

breeding. 

Establishing an individual's identity is one of 

the uses of DNA sequence information that 

highlight uniqueness of a particular sample. The 

methodology focuses on ways to reduce complexity 

of DNA into simple patterns that are representative 

of the sample. This type of analysis is called 

fingerprinting, profiling, genotyping or identity 

testing. Jeffreys et al. (1985) introduced this term to 

describe a method for the simultaneous detection of 

variable DNA loci by hybridization of specific 

multilocus probes with electrophoretically separated 

restriction fragments. DNA fingerprinting is 

useful for forensic identification, determination of 

family relationship, linkage mapping, antenatal 

diagnosis, localization of disease loci, determination 

of genetic variation, molecular archaeology 

and epidemiology (Watkins, 1988; Donis-Keller et 

al., 1987; Landegren et al., 1988; Paabo, 1989; 

Golenberg et al., 1990). Molecular markers have 

been used for identification of individuals, clones, 

close relatives, paternity testing or in studies of 

reproductive behavior and mating success. 

Repetitive sequences as molecular markers 

A repeat is recurrence of a pattern whereby DNA 

exhibits recurrence of many features. The number 

of occurrences of a pattern is called copy number. 

The number of copies in a particular tandem repeat 

region is termed region copy number. The term 

genome copy number refers to number of copies of 

tandem or interspersed repeats in genome. 

The repetitive DNA family(ies) may be widely 

distributed in a taxonomic family or a genus, or 

may be specific for a species or chromosome. 

Repeats may occur in specific locations in a 

genome, e.g. in telomeric regions or scattered 

throughout the genome. They may acquire large 

scale variation in the sequence and copy number 

over evolutionary time-scale. The repetitive 

elements are under different evolutionary constraints 

as compared to the genes. Hybrid 

polyploids are excellent models for studying 

evolution of repetitive sequences (Kubis et al., 

1998). These variations are the basis of utilization 

of repetitive sequences for taxonomic and 

phylogenetic studies (Smith and Flavell, 1974). 

There are many classifications of repetitive 

DNA based on characteristics measured by 

different techniques but consolidation of these 

systems defines five broad classes: satellites, 

microsatellites and minisatellites, retroposons and 

proretroviral transposons. The classification 

scheme makes a distinction between repetitive 

regions exhibiting tandem repetition and interspersed 

repetition but is not precise since each class 

retains the characteristics of both. Some of these 

repeats are described as follows: 

Moderately repetitive DNA includes reiterations 

of genes like tRNA, rRNA, hemoglobin etc. that 

retain similar or nearly similar sequences due to 

duplication. Some of these duplications result in 

pseudogenes and may have many copies in the 

genome. Some repetitive DNA sequences are 

transposable elements since they ct not to enhance 

the success of the cell (or organism) they reside in, 

behave selfishly and also accumulate to the levels 

restricted only by the resources available to them. 

The selfish DNA hypothesis of Doolittle and 

Sapienza, (1980) assumes that repetitive DNA can 

behave in a selfish manner because it is not 

functional. Indeed, there is some evidence that its 

presence can result in losses of fitness of the host 

cell due to mutations caused by transposable 

elements. However, some moderately-repetitive 

DNA has functions for example, in directing 

chromosome movement in eukaryotes (Vogt, 

1990). Variations in selfish DNA have the potential 

for evolutionary changes, especially when it 

changes without having any deleterious effects on 

the organism (Flavell et al., 1977). Susumo Ohno 

(1970) asserted that "natural selection merely 

modified while redundancy created". Duplication 

of genes can thus be internal source of novelty in

the genome. If repetitive DNA is transposable, it 

may create novel genes. Repetitive DNA is 

therefore the "Research & Development" 

laboratory of genome, creating both redundancy 

and novel sequences that may prove valuable for 

genome. However, these repetitive sequences are 

generally not used for DNA fingerprinting. 

Tandem and interspersed repeats 

Tandem repetitions are consecutive head-to-tail, 

direct, repetition of a pattern due to local 

duplication. Interspersed repetitions are recurrence 

of patterns that may or may not be proximal, 

formed by either non-local duplication or multiple 

introductions of the same or similar extraneous 

DNA segments. These repeats are dispersed 

throughout the genome and have no restriction on 

the relative positions of identical occurrences 

occurring in tandem locations. Research indicates 

that interspersed repeats are inserts since they 

resemble either processed RNAs i.e. retroposons, or 

viruses i.e. proretroviral transposons. In addition, a 

suspected target sequence for insertion occurs at 

both ends of these repeats as expected for a circular 

DNA crossover insertion. Furthermore, some 

repeats actively move within the genome, such as 

jumping genes in maize. 

DNA repeat patterns also classify as direct, 

indirect, complement, reverse complement or 

palindrome. A direct or forward repeat is the 

. 

DNA repetitive sequences 

recurrence of a pattern on the same strand in the 

same nucleotide order; e.g. ACCG recurs as 

ACCG. An indirect, inverse or reverse repeat recurs 

on the same strand but the order of the nucleotides 

is reverse, e.g. the indirect recurrence of ACCG is 

GCCA. Complement repeats are repeats where the 

nucleotides are complemented according to Watson 

Crick pairing, e.g. the complement of ACCG is 

TGGC. A reverse complement repeat recurs on the 

same strand but, the nucleotides are complemented 

and the order of the nucleotides is reversed; e.g. the 

reverse complement of ACCG is CGGT. In DNA, 

most repetitions occur as forward or reverse 

complement repeats and rarely as reverse or 

complement repeats (Grumbach and Tahi, 1994). 

Palindrome is a combination of two consecutive 

occurrences in opposite orientations and read the 

same when read from left to right or vice-versa. 

Repetitive DNA sequences, divided into highrepeat 

satellite DNA which replicates thousands or 

millions of times and "moderate-repeat" minisatellite 

and microsatellite DNA which replicates 

tens to perhaps a thousand times, account for 

varying proportions of the genome of multicellular 

eukaryotes. An example of representa-tive data 

from eukaryotes has been given in Table 1. 

Prokaryotes contain little or no repetitive 

sequences. Noncoding repetitive DNA varies from 

one group of organisms to another; individual to 

individual and therefore used as DNA fingerprinting 

tool. 

Table 1. Proportion of repetitive sequences of genomic DNA in different eukaryotes. 

High repeat 

Moderate repeat 

Non repetitive 

Tandem repeats and Satellite DNA 

Drosophila Xenopus Mouse Tobacco 

13% 

13% 

74% 

As repeats were discovered in different locations 

exhibiting different copy numbers, new terms arose 

such as satellite, minisatellite and microsatellite. 

Some researchers refer to all types of satellites as 

tandem repeats and describe a specific tandem 

repeat region according to its location within the 

genome, its periodicity, pattern structure and copy 

3% 

43% 

54% 

10% 

20% 

70% 

5% 

65% 

30% 

number. These repeats were first identified on a 

cesium chloride buoyant density gradient as peaks 

separate from the primary DNA peak. The separate 

or satellite peaks were composed of array of highly 

conserved tandem repeats localized to heterochromatic 

regions of chromosomes like 

centromeres (Schueler et al., 2001). The structure 

of a tandem repeat region has well-conserved 

3

4 


pattern but varies in size from less than 20 bp to 

several thousand bp. 

Structural and functional roles 

Tandem repeats play significant structural and 

functional roles. They occur in abundance in 

structural areas such as telomeres, centromeres and 

histone binding regions. They play a regulatory role 

near genes and perhaps even within genes. 

Transcription 

The precise role of tandem repeats in transcription 

regulation is not known. Since nucleosomes can 

repress or enhance transcription initiation and 

elongation (Hartzog and Winston, 1997; Kornberg 

and Lorch, 1999) repeats may influence 

transcription by affecting nucleosome positioning 

and stability. Tighter bonds between the histone 

complex and repeats restrict access for RNA 

polymerase and regulatory proteins (Dai & 

Rothman-Denes, 1999). This may happen by 

changing the degree and direction of DNA 

supercoiling or forming alternative DNA structures 

such as cruciforms and hairpins (Shlyakntenko et 

al., 1998; Ohyama, 2001). Tandem repeats having 

an alternating purine (R=A or G) pyrimidine (Y=C 

or U/T) pattern forms Z-DNA (Yang et al., 1996) 

and repeats with a RRY or a YRY pattern form 

triplex DNA structures (Grabcyzk and Usdin, 

2000). The degree of repression is directly 

proportional to repeat length. 

Centromeric and subtelomeric satellite DNA 

families 

The tandem satellite DNA sequences exhibit 

characteristic chromosomal locations, usually at 

subtelomeric (or intercalary repetitive sequences) 

and centromeric regions (Heslop-Harrison et al., 

2003; Jiang et al., 2003). Satellite DNA families 

may arise de novo due to molecular mechanisms 

like unequal crossing over, rolling circle 

amplification, replication slippage and mutation. 

Satellite DNA have variable repeat unit length 

(sometimes equivalent to micro or minisatellite 

length), often forming arrays spanning up to 100 

Mb (Charlesworth et al., 1994; Kubis et al., 1998; 

Schmidt and Heslop-Harrison, 1998; Vergnaud and 

Denoeud, 2000). However, satellite repeat 

monomer lengths of 140 – 180 bp and 300 – 360 

bp, corresponding to the length of the mono and 

dinucleosomes are most the common (Hemleben, 

1990; Traut, 1991; Macas et al., 2002). 

Centromeric tandem repeats ranging from 150- 

200 bp in length (Henikoff et al., 2001) are 

essential components of a functional centromere. A 

functional centromere has been defined as the DNA 

sequence which interacts with the kinetochore 

where the interaction between centromere-kinetochore 

appears to be mediated by DNA-protein 

recognition process (Jiang et al., 2003). The core 

sufficient for centromeric function is an alpha 

satellite about 3 Mbp long having a 171 bp pattern 

recurring in a tandem fashion. (Schueler et al., 

2001; Zhong et al., 2002). 

A highly repetitive 180 bps centromeric satellite 

DNA family constituting between 2-5% of the 

Arabidopsis thaliana genome is the key component 

of its centromere/kinetochore complex (Nagaki et 

al., 2003a,b). These repeats are occasionally 

interrupted by the Athila retrotransposons, although 

the latter are mainly clustered in pericentromeric 

regions (Heslop-Harrison et al., 1999; Nagaki et al., 

2003a,b). Similarly, centromeric DNA in several 

plants species including rice, maize, wheat, Beta 

species and Zingeria biebersteiniana mainly 

contain satellite sequence repeats and retrotransposons 

(Gindullis et al., 2001; Kishii et al., 

2001; Kumekawa et al., 2001; Saunders and 

Houben, 2001; Cheng et al., 2002; Nagaki et al., 

2003a,b). A high monomer divergence is observed 

within several centromeric repetitive DNA families 

thereby indicating presence of chromosome 

specific variant sequences (Harrison and Helsop- 

Harrison, 1995; Nagaki et al., 1998; Helsop- 

Harrison et al., 2003). For example, chromosome 

specific 180 bp satellite repeat variants in 

Arabidopsis thaliana may be explained by the 

possibility that either the repeat sequences on each 

chromosome have been homogenizes independently 

or specific variants of the satellite sequence have 

been amplified on each chromosome (Heslop- 

Harrison et al., 1999). 

The subtelomeric regions also contain repetitive 

sequences (review in Pryde et al., 1997). Not all 

species have the same structure but all have 

structures containing tandem repeats, interspersed 

repeats or both (Pryde et al., 1997). Degenerate 

TTAGGG repeats enable alignment other subtelomeric 

regions allowing sequence exchange 

between subtelomeres (Flint et al., 1997).

Minisatellite and Microsatellite DNA 

Hypervariable regions, also known as variable 

number of tandem repeats (VNTRs) classified as 

minisatellites and microsatellites are regions that 

contain a variable copy number. These repeats are 

found throughout the genome (Vogt, 1990) but 

rarely within genes. Most regions contain short to 

moderate region copy number (Jeffreys, 1985). 

DNA fingerprinting capitalizes on the differences 

between alleles at specific VNTR loci. Various 

human diseases are attributed to high copy numbers 

associated with some VNTR locus. 

Minisatellites are characterized by moderate 

length patterns, usually less than 50 bp (Jeffreys, 

1985) with an array of 0.5 - 30kb. Two types of 

variability are observed, viz., one displays copy 

number variation with each replication event 

whereas the other displays distinct alleles within a 

population such that different alleles contain 

different copy numbers. 

Microsatellites, also known as simple sequence 

repeats (SSRs) or simple tandem repeats (STRs) 

have a short well-conserved pattern length of 2 to 6 

bp and region copy number of 10 to 40 pattern 

copies. Microsatellites have been found in noncentromeric 

regions, many of them being located 

either near or within genes. 

Automatic identification and characterization of 

tandem repeats is crucial as genome projects 

generate an ever-increasing quantity of sequence 

data. Tandem repeats increase the complexity of 

genome sequence analysis algorithms. For instance, 

the process of generating full chromosome 

sequences often utilizes the sequence assembly 

procedure; a procedure that stitches short, similar 

fragments together to reconstruct a larger sequence. 

The consecutive recurrence of a pattern associated 

with tandem repeats confuses this process. Some 

commercially available algorithms avoid 

assembling tandem repeat regions. Others often 

assemble moderate-sized tandem repeat regions 

improperly. At present, algorithms are being 

developed for handling tandem repeat regions. 

The mechanism responsible for minisatellite and 

simple sequence polymorphisms 

Minisatellites and simple sequences are often 

characterized by high mutation rates (up to 5%), 

which may involve either internal heterogeneity of 

repeats or their number. Mutation rates also show 

positive correlation with the total size of the array 


of repeats. In accordance with these observations, 

high molecular weight bands within a multilocus 

fingerprint are often more variable than bands 

occurring in the low molecular weight range. The 

molecular basis of both minisatellites and simple 

sequence variability is still debatable. Possible 

mechanism include replication slippage, transposition, 

recombinational events and/or unequal 

exchange between sister chromatids or between 

homologous chromosomes and gene conversion 

(reviewed by Jarman and Wells, 1989; Jeffreys et 

al., 1990; Richards and Sutherland 1992; Wolff et 

al., 1991.) 

The slippage hypothesis implicates mispairing 

of slipped-strand during the replication process. 

Strand slippage may happen due to shift in origin of 

replication especially during lagging strand 

synthesis. Strand slippage and mismatch appear to 

be nucleotide specific. Differential activities of 

mismatch pair of (CAG)n repeats occur but not of 

(CTG)n repeats. Certain factors like the length of 

the repeats and replication direction play a role in 

destabilizing (CAG)n (CTG)n repeat. Such 

positioning effects results in loop formation due to 

stand slippage and results in expansion or reduction 

of repeat during replication. 

Several lines of evidence have lent support to 

the recombination hypothesis: 

• A variety of minisatellite core sequences 

share homology of the bacterial recombination 

signal chi. 

• Minisatellite - like sequences have been 

found at sites of meiotic crossing over. 

• Both minisatellite and macrosatellites 

behave as recombinational hot spots in 

transfected mammalian cells. 

Wolff et al., (1991) observed no exchange of 

flanking markers in a newly created minisatellite 

allele, thus ruling out unequal exchange between 

homologous chromosomes as a mutational mechanism. 

In human minisatellite locus, MS32 

(reviewed by Jeffreys et al., 1985), 5’ end of the 

array has a strong mutation bias, suggesting 

existence of a mutational hot spot. Some mutant 

alleles contain segments from both parental alleles, 

providing evidence for interallelic exchange. It is 

suggested that the major mutational process 

involves nonreciprocal transfer of repeats from a 

donor allele to the 5’ end of a recipient allele. 

Therefore, recombinational processes as well as 

replication slippage may contribute to the creation 

of minisatellite and simple sequence variability. 

However, other (yet unidentified) mechanisms may 

5

6 


also be involved, especially in case of the explosive 

amplification of microsatellite like trinucleotide 

repeats associated with human genetic diseases and 

polymorphism. Structural analysis of mutated vs. 

parental alleles may help to gain more information 

about the mutational mechanisms. In this respect, 

transgenic systems will be informative, since 

successive deletion of the flanking DNA will allow 

precise location of mutational hot spots. 

Retroposons 

Retroposons resemble processed RNAs and 

transpose passively via RNA intermediate (Weiner, 

1986). Each element is composed of an A-rich tail 

at the 3' end and short target site duplications 

(direct repeats of 5-21 bp) flanking the repeat 

(Rabin, 1985). Two main subclasses dominate this 

class: 

Short Interspersed Elements (SINEs) 

These are distributed throughout the non- 

centromeric regions of genome (over 100,000 

copies per genome) (Weiner, 1986). A SINE 

contains one or more RNA polymerase III, 

promoter sites and an A-rich region. One subfamily 

is composed of a head-to-tail catenation of two 

promoter site, A-rich region pairs (Weiner, 1986). 

Both subfamilies are flanked by short direct repeats 

of 5 to 21 bp. Primate specific Alu sequence (5 to 9 

kbp) is a SINE with two promoter sites and a 

dimer. The uniqueness of Alu sequences provides a 

wonderful tool for separating primate DNA from 

that of other species. SINEs present challenges to 

sequence assembly due to their high genome copy 

number (300,000 to 500,000 copies) (Rogers, 

1985). 

Long Interspersed Elements (LINEs) 

LINEs are composed open reading frames (ORFs) 

followed by a 3' A-rich region having 20,000 to 

50,000 copies per genome (Hutchison et al., 1989; 

Weiner, 1986). Direct repeats of 6-15 bp flank the 

element. L1 family (primary LINE family) is 6 to 7 

kbp long. The consensus structure of the family is 

well defined but not well conserved because L1 

element can deviate significantly from the structure 

such that entire structural components are deleted 

or duplicated (Weiner, 1986). 

Proretroviral transposons 

Proretroviral transposons are mobile elements that 

transpose via RNA intermediate (Varmus and 

Brown, 1989). Their structure and content 

resembles integrated viruses and often contain 

genes encoding viral products, e.g. protease, 

reverse transcriptase and integrase (Boefe and 

Corces, 1989). The LTRs contain transcriptional 

signals for initiating and terminating transcripts, a 

promoter, an enhancer and a polyadenylation signal 

(Temin, 1985; Schmid et al., 1990). Inverse repeats 

exist at the ends of each LTR and always begin 

with the bases, TG, and end with CA (Temin, 

1985). The two LTRs and the genes are flanked by 

4 to 6 bp direct repeats. 

Other recurring genetic features 

DNA contains many recurring features that do not 

classify as tandem or interspersed repeat. A gene 

cluster is a group of proximal genes having similar 

sequence and often, similar structure but, different 

function. There may be requirement for multiple 

copies of functional genes tRNA or rRNA genes. 

Copies of promoters and other regulatory regions 

associated with many genes also do not classify as 

repetitive DNA. 

Telomeres 

Telomeric DNA is G-rich consisting of the 

3′overhang and adjacent tandem repeat with wide 

variation in length across species (reviewed in 

Blackburn, 1991; Hemann and Greider, 1999). For 

example, length of telomere TTAGGG repeats in 

humans is 5 to15 kbp but in mouse (Mus musculus) 

it is ~50 kbp. Yeast, Saccharomyces cerevisiae, has 

irregular pattern of TG1-3 and repeat length of 

~300 bp. A recent model suggests that this region 

does a d-loop-t-loop by having the 3′ overhang 

invade the tandem repeat (Griffith et al., 1999). 

This invasion forms a triplex DNA structure, dloop, 

and encloses a large segment of duplex DNA 

in a terminal loop or t-loop. Telomere length and 

size of loops is species specific (Shore, 2001). 

Universal presence of this structure across species 

is not clear though there may be telomeres that are 

unable to form a t-loop (Griffith et al., 1999).

Nucleosomes 

Periodicity of di-nucleotides (TATA-tetrads) or 

tandem repeat with a 10 bp pattern of 5’ 

TATAA(A/C)CG(T/C)C 3’ band DNA and form 

association with histone proteins (Widlund et al., 

1997). However, tandem repeats may increase or 

decrease nucleosome stability. For example, a 

tandem repeat having a CAG (=CTG) pattern 

located close to a nucleosome increases its stability 

(Wang et al., 1994; Wang and Griffith, 1995; 

Godde and Wolffe, 1996). On the other hand, 

tandem repeat CGG (=CCG) has no impact unless 

it is methylated. Methylated CGG (=CCG) with a 

limited copy number increase the nucleosome 

stability while those with large copy numbers 

decrease nucleosome stability (Godde et al., 1996; 

Wang and Griffith, 1996). 

Tandem repeats in genes 

Tandem repeat hypervariability enables 

identification of genes e.g. antifreeze gene and 

several degenerative diseases. Repeats may help in 

stability of transcripts or proteins but repeat 

expansions and instability (particularly of 

trinucleotide repeats) lead to neurological disorders 

and cancer (Ashley and Warren, 1995; Mitas, 

1997). Long stretch of CAG repeats translated into 

polyglutamine tracts result in a gain-of-function, 

possibly a toxin (Perutz et al., 1994; Baldi et al., 

1999). CGG, AGG and TGG repeats form 

quadriplex and GAA repeats form triplex structures 

that can block or reduce transcription and DNA 

replication (Sinden, 1999). CGG repeats also 

destabilize nucleosomes (Sinden, 1999) due to CpG 

hypermethylation leading to promoter repression 

and lack of gene expression (Nelson 1995, Baldi et 

al., 1999). On the other hand, CTG repeats stabilize 

nucleosomes and block replication forks in E. coli 

(Sinden, 1999). 

Evolution 

Repeats have a role in genome evolution and 

possibly in C-value paradox. Variation in nuclear 

DNA amount in higher plants species exemplifies 

this. The variation (>2500 fold) in 1C DNA content 

in angiosperms ranges from 0.05 picograms in 

Cardamine amara to 127.4 picograms in Fritillaria 

assyriaca (Bennett, 1985). Part of such variation is 

due to the numerical changes in chromosomes but 

in many, there is substantial variation resulting 


from amplification or deletion of DNA sequences. 

Chromosomes of many monocot and dicot species 

contain fast reassociating highly repetitive fraction, 

slow reassociating middle repetitive fraction and 

single copy sequences (Britten and Kohne, 1968; 

Smith and Flavell, 1974; Flavell et al., 1977; 

Katsiotis et al., 2000). These sequences may be 

dispersed repetitive sequences including transposeable 

elements or tandem repeats. The retroelement 

class forms sometimes upto 50% component of 

plant genomes (Guidet et al., 1991; Heuros et al., 

1993; Kubis et al., 1998; Bennetzen, 2000; 

Katsiotis et al., 2000; Linares et al., 2000; Ananiev 

et al., 2002). 

References 

Ananiev EV, Vales MI, Phillips RL and Rines HW. 

Isolation of A/D and C genome specific 

dispersed and clustered repetitive DNA 

sequences from Avena sativa. Genome. 45: 431- 

441, 2002. 

Ashley CT and Warren ST. Trinucleotide repeat 

expansion and human disease. Annu Rev Genet. 

29: 703-728, 1995. 

Baldi P, Brunak S, Chauvin Y and Pedersen AG. 

Structural basis for triplet repeat disorders: a 

computational analysis. Bioinformatics. 15: 

918-929, 1999. 

Bennett MD. Interspecific variation in DNA 

amount and the nucleotypic dimension. In Plant 

genetics (UCLA symposium on molecular and 

cellular biology), Freeling M (Ed). New York: 

Alan R. Liss. 283-302, 1985. 

Bennetzen JL. Transposable element contributions 

to plant gene and genome evolution. Plant Mol 

Biol. 42: 251-269, 2000. 

Blackburn EH. Telomeres. Trends Biochem Sci. 16: 

378–381, 1991. 

Boefe JD and Corces VG. Transcription and 

reverse transcription of retroposons. Annu Rev 

Microbiol. 43: 403-434, 1989. 

Britten RJ and Koehne DE. Repeated sequences in 

DNA. Science. 161: 529-540, 1968. 

Charlesworth B, Sniegowski P and Stephan W. The 

evolutionary dynamics of repetitive DNA in 

eukaryotes. Nature. 371: 215-220, 1994. 

7

8 


Cheng Z, Dong F, Langdon T, Ouyang S, Buell 

CR, Gu M, Blattner FR and Jiang J. Functional 

rice centromeres are marked by a satellite repeat 

and a centromere-specific retrotransposon. 

Plant Cell. 14: 1691-1704, 2002. 

Dai X and Rothman-Denes LB. DNA structure and 

transcription. Curr Opin Microbiol. 2: 126-130, 

1999. 

Donis-Keller H, Green P, Helms C, Cartinhour S, 

Weiffenbach B, Stephens K, Keith TP, Bowden 

DW, Smith DR, Lander ES , Botstein D, Akots 

G, Rediker KS, Gravius T, Brown VA, Rising 

MB, Parker C, Powers JA, Watt DE, Kauffman 

ER, Bricker A, Phipps P, Muller-Kahle H, 

Fulton TR, Ng S, Schumm JW, Braman JC, 

Knowlton RG, Barker DF, Crooks SM, Lincoln 

SE, Daly MJ and Abrahamson J. A genetic 

linkage map of the human genome. Cell. 51: 

319-337, 1987. 

Doolittle WF and Sapienza C. Selfish genes, the 

phenotype paradigm and genome evolution. 

Nature. 284: 601-603, 1980. 

Flavell RB, Rimpau J and Smith DB. Repeated 

sequence DNA relationships in four cereal 

genomes. Chromosoma. 63: 205-222, 1977. 

Flint J, Bates GP, Clark K, Dorman A, Willingham 

D, Roe BA, Micklem G, Higgs DR and Louis 

EJ. Sequence comparison of human and yeast 

telomeres identifies structurally distinct 

subtelomeric domains. Hum Mol Genet. 6: 

1305-1314, 1997. 

Gindullis F, Desel C, Galasso I and Schmidt T. The 

large-scale organization of the centromeric 

region in Beta species. Genome Res. 11: 253- 

265, 2001. 

Godde JS and Wolffe AP. Nucleosome assembly 

on CTG triplet repeats. J Biol Chem. 271: 

15222-15229, 1996. 

Godde JS, Kass SU, Hirst MC and Wolffe AP. 

Nucleosome assembly on methylated CGG 

triplet repeats in the fragile X mental retardation 

gene 1 promoter. J Biol Chem. 271: 24325- 

24328, 1996. 

Golenberg EM, Giannasi DE, Clegg MT, Smiley 

CJ, Durbin M, Henderson D and Zurawski G. 

Chloroplast DNA sequence from a miocene 

Magnolia species. Nature. 344: 656-658, 1990. 

Grabczyk E and Usdin K. Alleviating transcript 

insufficiency caused by Friedreich’s ataxia 

triplet repeats. Nucl Acids Res. 28: 4930-4937, 

2000. 

Griffith JD, Comeau L, Rosenfield S, Stansel RM, 

Bianchi A, Moss H and de Lange T. 

Mammalian telomeres end in a large duplex 

loop. Cell. 97: 503-514, 1999. 

Grumbach S and Tahi F. A new challenge for 

compression algorithms: genetic sequences. J 

Inform Process Management. 30: 875-886, 

1994. 

Guidet F, Rogowsky PM, Taylor C, Song W and 

Langridge P. Cloning and characterization of a 

new rye-specific repeated sequence. Genome. 

34: 81-87, 1991. 

Harrison GE and Heslop-Harrison JS. Centromeric 

repetitive DNA in the genus Brassica. Theor 

Appl Genet. 90: 157-165, 1995. 

Hartzog GA and Winston F. Nucleosomes and 

transcription: recent lessons from genetics. Curr 

Opin Genet Dev. 7: 192-198, 1997. 

Hemleben V. Molekularbiologie der Pflanzen. 

UTB. Gustav Fischer Verlag, Stuttgart. 1990. 

Hemann MT and Greider CW. G-strand overhangs 

on telomeres in telomerase deficient mouse 

cells. Nucl Acids Res. 27: 3964-3969, 1999. 

Henikoff S, Ahmad K and Malik HS. The 

Centromere Paradox: Stable inheritance with 

rapidly evolving DNA. Science. 293: 1098- 

1102, 2001. 

Heslop-Harrison JS, Murata M, Ogura Y, 

Schwarzacher T and Motoyoshi F. 

Polymorphisms and genomic organization of 

repetitive DNA from centromeric regions of 

Arabidopsis chromosomes. Plant Cell. 11: 31- 

42, 1999. 

Heslop-Harrison JS, Brandes A and Schwarzacher 

T. Tandemly repeated DNA sequences and 

centromeric chromosomal regions of 

Arabidopsis species. Chromosome Res. 11: 241- 

253, 2003. 

Hueros GY and Ferrer E. A structural and 

evolutionary analysis of a dispersed repetitive 

sequence. Plant Mol Biol. 22: 635-643, 1993.

Hutchison III CA, Hardies SC, Loeb DD, Shehee 

WR and Edgell MH. LINEs and related 

retroposons: Long interspersed repeated 

sequences in the eukaryotic genome. In Mobile 

DNA. Berg DE and Howe MM (Ed). American 

Society for Microbiology, Washington D.C., 

593-617, 1989. 

Jarman AP and Wells RA. Hypervariable 

minisatellites, recombinators or innocent 

bystanders? Trends Genet. 5: 367-371, 1989. 

Jeffreys AJ, Wilson V and Thein SL. Hypervariable 

“minisatellite” regions in human DNA. Nature. 

314: 67-73, 1985. 

Jeffreys AJ, Neumann R and Wilson V. Repeat unit 

sequence variation in minisatellites: a novel 

source of DNA polymorphism for studying 

variation and mutation by single molecule 

analysis. Cell. 60: 473-485, 1990. 

Jiang J, Birchler JA, Parrott WA and Dawe RK. A 

molecular view of plant centromeres. Trends 

Plant Sci. 8: 570-575, 2003. 

Katsiotis A, Loukas M and Heslop-Harrison JS. 

Repetitive DNA, genome and species 

relationships in Avena and Arrhenatherum 

(Poaceae). Ann Bot. 86: 1135–1142, 2000. 

Kishii M, Nagaki K and Tsujimoto H. A tandem 

repetitive sequence located in the centromeric 

region of common wheat (Triticum aestivum) 

chromosomes. Chromosome Res. 9: 417-428, 

2001. 

Kornberg RD and Lorch Y. Twenty-five years of 

the nucleosome fundamental particle of the 

eukaryote chromosome. Cell. 98: 285-294, 

1999. 

Kubis S, Schmidt T and Heslop-Harrison JS. 

Repetitive DNA elements as a major component 

of plant genomes. Ann Bot. 82: 45-55, 1998. 

Kumekawa N, Hosouchi T, Tsuruoka H and Kotani 

H. The size and sequence organization of the 

centromeric region of Arabidopsis thaliana 

chromosome 4. DNA Res. 8: 285–290, 2001. 

Landegren U, Kaiser R, Caskey CT and Hood L. 

DNA diagnostics-molecular techniques and 

automation. Science. 242: 229-237, 1988. 

Linares C, Irigoyen ML and Fominaya A. 

Identification of C-genome chromosomes 

involved in intergenomic translocations in 


Avena sativa L., using cloned repetitive DNA 

sequences. Theor Appl Genet. 100: 353-360, 

2000. 

Macas J, Meszaros T and Nouzova M. PlantSat: a 

specialized database for plant satellite repeats. 

Bioinformatics. 18: 28-35, 2002. 

Mitas M. Trinucleotide repeats associated with 

human disease. Nucl Acids Res. 25: 2245-2254, 

1997. 

Nagaki K, Song J, Stupar RM, Parokonny AS, 

Yuan Q, Ouyang S, Liu J, Hsiao J, Jones KM, 

Dawe RK, Buell CR and Jiang J. Molecular and 

cytological analyses of large tracks of 

centromeric DNA reveal the structure and 

evolutionary dynamics of maize centromeres. 

Genetics.163: 759-770, 2003a. 

Nagaki K, Talbert PB, Zhong CX, Dawe RK, 

Henikoff S and Jiang J. Chromatin 

immunoprecipitation reveals that the 180-bp 

satellite repeat is the key functional DNA 

element of Arabidopsis thaliana centromeres. 

Genetics. 163: 1221-1225, 2003b. 

Nagaki K, Tsujimoto H and Sasakuma T. A novel 

repetitive sequence of sugar cane, SCEN 

family, locating on centromeric regions. 

Chromosome Res. 6: 295-302. 

Nelson DL (1995). The fragile X syndromes. 

Seminars in Cell Biology. 6: 5-11, 1998. 

Ohyama T. Intrinsic DNA bends: an organizer of 

local chromatin structure for transcription. 

BioEssays. 23: 708–715, 2001. 

Paabo S. Ancient DNA: extraction, 

characterization, molecular cloning, and 

enzymatic amplification. Proc Natl Acad Sci 

U.S.A. 86(6): 1939-1943, 1989. 

Perutz MF, Johnson T, Suzuki M and Finch JT. 

Glutamine repeats as polar zippers: their 

possible role in inherited neurodegenerative 

diseases. Proc Natl Acad Sci U.S.A. 91: 5355- 

5358, 1994. 

Pryde FE, Gorham HC and Louis EJ. Chromosome 

ends: all the same under their caps. Curr Opin 

Genet Dev. 7: 822-828, 1997. 

Rabin M. In "Discovering Repetitions in Strings," 

Combinatorial Algorithms on Words. 

9

10 


Apostolico and Galil (Ed). NATO ASI Series. 

12: 279-288, 1985. 

Richards RI and Sutherland GR. Simple repeat 

DNA is not replicated simply. Nat Genet. 6: 

114-116, 1994. 

Rogers JH. Long interspersed sequences in 

mammalian DNA: Properties of newly identified 

specimens. Biochim Biophys. 824: 113-120, 

1985. 

Saunders VA and Houben A. The pericentromeric 

heterochromatin of the grass Zingeria 

biebersteiniana (2n = 4) is composed of 

Zbcen1-type tandem repeats that are 

intermingled with accumulated dispersedly 

organized sequences. Genome. 44: 955-961, 

2001. 

Schmid CW, Wong EF and Deka N. Single copy 

sequences in galago DNA resembles a repetitive 

human retrotransposon-like family. J Mol Evol. 

31: 92-100, 1990. 

Schmidt T and Heslop-Harrison JS. Genomes, 

genes and junk: the large-scale organization of 

plant chromosomes. Trends Plant Sci. 3: 195- 

199, 1998. 

Schueler MG, Higgins AW, Rudd MK, Gustashaw 

K and Willard HF. Genomic and genetic 

definition of a functional human centromere. 

Science. 294: 109-115, 2001. 

Shlyakhtenko LS, Potaman VN, Sinden RR and 

Lyubchenko YL. Structure and dynamics of 

supercoil-stabilized DNA cruciforms. J Mol 

Biol. 280: 61-72, 1998. 

Shore D. Telomeric chromatin: replicating and 

wrapping up chromosome ends. Curr Opin 

Genet Dev. 11: 189-198, 2001. 

Sinden RR. Human genetics ’99: trinucleotide 

repeats - Biological implications of the DNA 

structures associated with disease-causing 

triplet repeats. Am J Hum Genet. 64: 346-353, 

1999. 

Smith DB and Flavell RB. The relatedness and 

evolution of repeated nucleotide sequences in 

the genomes of some Gramineae species. 

Biochem Genet. 12: 243-256, 1974. 

Susumu O. Evolution by gene duplication. 

Springer-Verlag, New York, NY. ISBN 0-04- 

575015-7, 1970. 

Temin HM. Reverse transcription in the eukaryotic 

genome: retroviruses, pararetroviruses, retrotransposons, 

and retrotranscripts. Mol Biol Evol. 

2: 455-468, 1985. 

Traut W. Chromosomen Klassische and molekulare 

Cytogenetik. Springer-Verlag, Berlin, 1991. 

Varmus HE and Brown PO. Retroviruses. In 

Mobile DNA. Berg D E and Howe M M (Ed) 

ASM Publications, New York. 35-56, 1989. 

Vergnaud G and Denoeud F. Minisatellites: 

Mutability and genome architecture. Genome 

Res.10: 899-907, 2000. 

Vogt P. Potential genetic functions of tandem 

repeated DNA sequence blocks in the human 

genome are based on a highly conserved 

“chromatin folding code”. Hum Genet. 84: 301- 

336, 1990. 

Wang YH, Amirhaeri S, Kang S, Wells RD and 

Griffith JD. Preferential nucleosome assembly 

at DNA triplet repeats from the myotonic 

dystrophy gene. Science. 265: 669-671, 1994. 

Wang YH and Griffith J. Expanded CTG triplet 

blocks from the myotonic dystrophy gene create 

the strongest known natural nucleosome 

positioning elements. Genomics. 25: 570-573, 

1995. 

Wang YH and Griffith J. Methylation of expanded 

CCG triplet repeat DNA from fragile X 

syndrome patients enhances nucleosome 

exclusion. J Biol Chem. 271: 22937-22940, 

1996. 

Watkins PC. Restriction Fragment Length 

Polymorphism (RFLP): application in human 

chromosome mapping and genetic disease 

research. Biotechniques. 6: 310-320, 1988. 

Weiner AM, Deininger PL and Efstratiadis A. 

Nonviral retroposons: genes, pseudogenes, and 

transposable elements generated by the reverse 

flow of genetic information. Annu Rev Biochem. 

55: 631-661, 1986. 

Widlund HR, Cao H, Simonsson S, Magnusson E, 

Simonsson T, Nielsen PE, Kahn JD, Crothers 

DM and Kubista M. Identification and 

characterization of genomic nucleosomepositioning 

sequences. J Mol Biol. 267: 807- 

817, 1997.

Wolff RK, Plaeke R, Jeffreys AJ and White R. 

Unequal crossing over between homologous 

chromosomes is not the major mechanism 

involved in the generation of new alleles at 

VNTR loci. Genomics. 5: 382-384, 1991. 

Yang CF, Kim JM, Molinari E and DasSarma S. 

Genetic and topological analyses of the bop 

promoter of Halobacterium halobium: 

stimulation by DNA supercoiling and non-B- 

DNA structure. J Bacteriol. 178: 840-845, 

1996. 

Zhong CX, Marshall JB, Topp C, Mroczek R, Kato 

A, Nagaki K, Birchler JA, Jiang J and Dawe 

RK. Centromeric retroelements and satellites 

interact with Maize kinetochore protein 

CENH3. Plant Cell. 14: 2825-2836, 2002. 


11

Journal of Cell and Molecular Biology 7(2) & 8(1): 13-23, 2010 Research Article 



Genetic diversity of Penicillium species isolated from various sources 

in Sarawak, Malaysia 

Hairul Azman ROSLAN *, 1 , Chua Suk NGO 1 and Sepiah MUID 2 

1 Department of Molecular Biology, Faculty of Resource Science and Technology, Universiti Malaysia 

Sarawak, 94300 Kota Samarahan, Sarawak Malaysia 

2 Department of Plant Sciences and Environmental Ecology, Faculty of Resource Science and 

Technology, Universiti Malaysia Sarawak, 94300 Kota Samarahan, Sarawak Malaysia 

(* author for correspondence; rhairul@frst.unimas.my ) 

Received: 26 December 2008; Accepted 30 December 2009 

Abstract 

Borneo Island is one of the megadiversity centres of the world and contain vast amount of flora and fauna. 

The Penicillium species are among the most commonly occurring and economically important members of 

micro-fungi family. In this study, morphological and random amplification polymorphic DNA (RAPD) 

molecular methods were used to group and determine genetic variability and relationship among twenty 

Penicillium isolates from various locations in Western part of Borneo Island that was maintained in the pure 

culture collection of University Malaysia Sarawak. Comparison between morphological and molecular 

method using M13 and OPD10 primers were undertaken and showed that in some cases, the groupings of 

isolates based on morphological method were consistent with molecular groupings with a few exceptions. 

Molecular analysis also indicated genotype variability between the isolates with little correlation with either 

the origin of soil or geographical location. 

Keywords: Penicillium species, morphology, RAPD, M13, variation 

Malezya Sarawak’ta Farklı Kaynaklardan Elde Edilen Penicillium Türlerinin 

Genetik Çeşitliliği 

Özet 

Borneo adası dünyanın en çok çeşitliliğe sahip merkezlerinden bir tanesidir ve büyük miktarda flora ve 

faunaya sahiptir. Penicillium (küf) türleri mikro-mantar ailesinin en sık rastlanan ve ekonomik olarak önemli 

üyeleri arasındadır. Bu çalışmada Borneo’nun batı bölgelerinden elde edilip Malezya Sarawak 

Üniversitesi’ndeki saf kültür koleksiyonlarında muhafaza edilen yirmi Penicillium izolatını gruplamak ve 

aralarındaki genetik çeşitliliği ve ilişkiyi belirlemek için, morfolojik ve polimorfik DNA’nın rastgele 

amplifikasyonu (RAPD) metodu kullanılmıştır. M13 ve OPD10 primerleri kullanılarak morfolojik ve 

moleküler metodlar arasında kıyaslama yapılmış ve birkaç istisna ile bazı durumlarda, izolatların morfolojik 

metodlara dayanarak gruplandırılmalarının moleküler gruplandırılmalar ile uyumlu olduğu gösterilmiştir. 

Moleküler analiz aynı zamanda izolatlar arasında, toprağın kaynağı veya coğrafi bölge ile az korelasyon 

göstermesine rağmen, genotip varyasyonu göstermiştir. 

Anahtar Sözcükler: Penicillium türleri, morfoloji, RAPD, M13, varyasyon

14 

Hairul Azman ROSLAN et al. 

Introduction 

Fungi and bacteria are the principal decomposers 

that release carbon, nitrogen and other elements 

that otherwise would become tied up in organic 

matter (Carlile et al., 2001). Fungi play an 

important role in decomposing forest litter or dung, 

fruits or other organic materials. Farms fruits and 

crops are vulnerable to fungal attack and 10% to 

50% of the world’s harvested fruit is lost each year 

due to fungal attack (Campbell and Reece, 2002). 

However, fungi also have a number of practical 

uses for humans. The distinctive flavours of certain 

kinds of cheeses, including Roqueorti and blue 

cheese, come from the fungi used to ripen them. 

The soft drink industry uses Aspergillus niger to 

produce citric acid. Beside that, a family of 

unicellular fungi, Saccharomyces cerevisiae is the 

most important fungi used in the food industries 

such as in baking, alcohol brewing and wine 

making. Apart from food industries, fungi are 

medically valuable as antibiotic producers used to 

treat infections (Thom, 1945). The Penicillium spp 

are among the most commonly occurring and 

economically important members of microfungi 

family. Although much is known about Penicillium 

physiology and mycotoxin chemistry, one of the 

main challenges is in the area of rapid and reliable 

identification of Penicillium in many settings 

including community health care, occupational 

health and food safety (Scott, 1977; Cruz-Perez et 

al., 2001; Meklin et al., 2004; Portnoy et al., 2004). 

Sarawak is one of the centres of mega- if not gigadiversity 

region and possesses a vast potential of 

undiscovered organisms including Penicillium spp. 

We have isolated a number of Penicillium from 

various location and sources within Sarawak. Here 

we report the genotyping of Penicillium spp from 

UNIMAS pure culture collections. 

Materials and Methods 

Collection and maintenance of fungal isolates 

Twenty Penicillium isolates were obtained from 

Universiti Malaysia Sarawak (UNIMAS) culture 

collection. The fungi collection was isolated from 

various sources in Sarawak such as from mangrove 

soil, leaf litter, peat soil, soy sauce, karas and 

rambutan (Table 1). A map of Sarawak state is 

shown in Figure 1, indicating the sampling 

locations. Fungi from stock culture were recultured 

on Malt Extract Agar (MEA) and Czapek 

Yeast Agar (CYA) in Petri dishes. Each isolate was 

inoculated at three-points on each media in petri 

dishes. The inoculated plates were kept at room 

temperature (22-25ºC) for seven days. 

Figure 1. Map of Sarawak state in Malaysia indicating sampling sites. 1: Karangas 

Forest, 2: Mixed Dipterocarp Forest, 3: Riverine Forest, Samunsam; 4: Sematan; 5: 

Kuching; 6: Kampung Bako; 7:Bako Island; 8: Kota Samarahan; 9: Bintulu

Genetic diversity of Penicillium species in Sawarak, Malaysia 15 

Table 1 List of fungal collection, the substrate it was extracted from and location of the fungal (*numbers in 

superscript indicate origin of isolate corresponding to Figure 1) 

Fungal 

UFI 

Substrate Origin 

isolates (Unimas Fungi Index) 

P1 1433 Mangrove soil 

6 

Kampung Bako 


6 

Kampung Bako 

P3 0646 Leaf litter 

1 

Karangas Forest, Samunsam 

P4 0687 Karas 

8 

Samarahan 

P5 1439 Soy sauce 

8 

Samarahan 


8 

Samarahan 


6 

Kampung Bako 


5 

Kuching 


2 

Mixed Dipterocarp Forest, Samunsam 

P10 1445 Karas 

8 

Samarahan 

P11 1446 Peat soil 

8 

Samarahan 


4 

Sematan 


8 

Samarahan 


1 

Karangas Forest, Samunsam 

P15 1437 Peat soil 

9 

Bintulu 


3 

Riverine Forest, Samunsam 


7 

Bako Island 

P18 1447 Rambutan 

8 

Samarahan 


7 

Bako Island 


Morphological study 

A small tuft of mycelium and conidiophores were 

lifted from a fairly young section of the colony and 

placed on a drop of acid fuschin on a glass slide. A 

cover slip was gently lowered on the specimen. 

Slides were sealed with Canada balsam. 

Identification of the fungi was based on culture 

characteristics and conidiophore structure. Cultural 

characteristics such as colony colour, texture, 

colony growth, exudates, odour, zonation and 

pigmentation were examined. Conidiophore 

structure that includes its length, phialides, branching 

system and conidia were also examined. Images 

were taken by using Nikon digital camera. Notes of 

International Mycological Institute (IMI) 

descriptions were used as reference for the 

identification. 

Molecular study 

Isolation of DNA 

DNA was extracted using a rapid extraction method 

as introduced by Taylor and Natvig (1987). Genetic 

5 Kuching 

material was also taken directly from mycelia 

growing on CYA using clean, autoclaved tips. The 

genetic materials were then mixed with 25-30μl of 

Tris-EDTA (TE) buffer and then vortexed. The 

DNA was kept in -20ºC until required. 

RAPD-PCR amplification 

Two PCR primers, M13 (5’- 

TTATGTAAACGACGGCCAGT -3’) and OPD10 

(5’-GTGATCGCAG-3’), were used to amplify 20 

Penicillium isolates. A negative control was 

included in each amplification process. The PCR 

mixture used for the RAPD in this study consisted 

of 2.5μl of 10X PCR buffer (Vivantis), 2.5µl of 

2mM dNTPs (Vivantis), 10 pmol/μl M13 or 5 

pmol/μl OPD-10, 2 U Taq polymerase (Vivantis) 

and 2.5μl DNA template. Sterile distilled water was 

added to total up the PCR reaction volume to 25 µl. 

Amplification was conducted using Biometra T- 

Gradient (Biometra) with the following temperature 

profile (Table 2):

16 


Table 2. PCR amplification parameters using the M13 primers and OPD-10 

Separation of DNA fragments by gel 

electrophoresis 

Parameters Temperature and Reaction time 

Initial denaturation 94ºC for 3 minutes 

Denaturation 84ºC for 30 seconds 

Annealing 46ºC / 30ºC for 1 minute (M13 / 

OPD10) 

Extension 72ºC for 2 minutes 

Number of cycles 35 

Final extension 72ºC for 7 minutes 

The amplicons were separated using 1.3 % (w/v) 

agarose gel electrophoresis in 1X TAE (Tris-Acetic 

acid-EDTA) buffer. The electrophoresis was 

performed at 100V for 90 minutes. The gel was 

visualised using ethidium bromide under UV 

transilluminator and documented using Gel 

Documentation System (BioRad). 

Construction of phylogenetic relationships 

Each individual RAPD band was considered as 

equivalent independent characters and all the bands 

were scored as present or absent for each isolate. 

Banding patterns were converted into binary tables. 

The data was analyzed using genetic data analysis 

software, Numerical Taxonomy and Multivariate 

Analysis System (NTSYSpc) version 2.2. The data 

was quantified by similarity index, Jij = Cij / (ni + 

nj – Cij), where Jij= the number of individuals i and 

j, ni= the number of bands in individual i, nj= the 

number of bands in individual j. A dendogram was 

generated using Unweighted Pair-Group Method 

with Arimethrical Averages (UPGMA) as 

described by Sneath and Sokal (1973). 

Results and Discussion 

Morphological groupings of Penicillium isolates 

All the isolates were initially identified based on 

the cultural characteristics and structure of 

conidiophores using stereo and compound 

microscopes. Among the 20 isolates, 4 isolates 

were grouped as Clade 1, 2 isolates were grouped 

as Clade 2, 3 isolates were grouped as Clade 3, 2 

isolates were grouped as Clade 4, 4 isolates were 

grouped as Clade 5, 2 isolates were grouped as 

Clade 6, and one isolate each for Clade 7, Clade 8 

and Clade 9 respectively. Table 3 shows the clades 

based on morphological characters, isolate name, 

substrate it was found and origin of the isolates. 

The detailed morphological classifications of 

selected isolates are presented in Figures 2 to 7 

below representing Clade 1 to Clade 6.

Table 3 Morphological groupings of Penicillium isolates. 


Clade Fungal isolates Substrate Origin 

1 P1 Mangrove soil Kampung Bako 

P7 Mangrove soil Kampung Bako 

P14 Leaf litter Karangas Forest, Samunsam 

P16 Leaf litter Riverine Forest, Samunsam 

2 P2 Mangrove soil Kampung Bako 

P12 Mangrove soil Sematan 

3 P3 Leaf litter Karangas Forest, Samunsam 

P9 Leaf litter Mixed Dipterocarp Forest, 

Samunsam 

P15 Peat soil Bintulu 

4 P4 Karas Samarahan 

P13 Soy sauce Samarahan 

5 P5 Soy sauce Samarahan 

P8 Soy sauce Kuching 

P17 Mangrove soil Bako Island 

P19 Mangrove soil Bako Island 

6 P6 Soy sauce Samarahan 

P20 Soy sauce Kuching 

7 P10 Karas Samarahan 

8 P11 Peat soil Samarahan 

9 P18 Rambutan Samarahan 

Figure 2. Clade 1 Penicillium P7 isolate. (a) Colony surface on CYA, (b) Colony reverse on 

CYA colour, (c) Colony surface on MEA, (d) Colony reverse on MEA, (e) Conidiophore 

structure (Bi-Asymmetrical), (f) Conidia globose shape

18 



CYA, (c) Colony surface on MEA, (d) Colony reverse on MEA, (e) Conidiophore structure at 

100X magnification (Monoverticillata), (f) Conidia globose shape 



100X magnification, arrow showing swollen apex, (f) Conidiophore structure at 40X 

magnification (Monoverticillata), (g) Conidia globose shape




100X magnification (f) Conidiophore structure at 40X magnification (Bi-asymmetrical), (g) 

Conidia globose shape 



100X magnification, arrow showing lanceolate phialides, (f) Conidiophore structure at 40X 

magnification (Bi-asymmetrical), (g) Conidia globose shape

20 




40X magnification (Terverticillata), (f) Conidia elliptical shape. 

Molecular groupings of Penicillium isolates 

Single, simple repetitive PCR primers have been 

designed to amplify the microsatelite regions of 

chromosomal DNA. In most applications these 

primers have provided similar levels of specificity 

to those seen with RAPD, and the results have been 

used to group fungi at species level (Meyer et al., 

1992; Schlick et al., 1994; Bridge et al., 1997). 

Two sets of primers were used, M13 and OPD-10 

primers to analyse the variations between the 20 

isolates of Penicillium spp. Six isolates were 

excluded from the molecular study because either 

the DNA could not be isolated or amplification was 

not reproducible. Each sample was repeated at least 

two times to determine its reproducibility and 

consistency. Bands were scored for each primer 

based on the presence (1) or absence (0) of 

amplicon migration in the gel. Figure 8 and Figure 

9 represent the RAPD profile of M13 and OPD-10 

respectively. Figure 10 is a dendogram generated 

from M13 data.


Figure 8. RAPD band profile generated using M13 primer visualized on 1.3% (v/v) agarose. The 

lane markings correspond to the isolate number. Lane M: 1kbp DNA ladder (Fermentas) and 

Lane N: 100bp DNA ladder (Seegene) 

Figure 9. RAPD band profile generated using OPD10 primer visualized on 1.3% (v/v) agarose 

gel. The lane markings correspond to the isolate number. Lane M: 1kbp DNA ladder (Fermentas) 

and Lane N: 100bp DNA ladder (Seegene)

22 


Figure 10. Dendrogram showing relationships among 14 isolates of Penicillium species. Genetic 

distances were obtained using M13 primer. 

The study compared the classification 

generated from morphological data and molecular 

data. Comparison of the two datasets indicated that 

the RAPD banding patterns were generally 

consistent with morphological data. Combination of 

morphological and molecular data can be used to 

increase the confidence that the isolates were 

grouped correctly. Previous study carried out by 

Lutzoni and Vilgalys (1995) integrated molecular 

and morphological data sets in order to estimate 

fungal phylogenies in lichenized and nonlichenized 

Omphalina species. They found that 

homogeneity testing of the 28S large subunit 

ribosomal DNA sequences and the morphological 

characters showed that the two data sets were 

sampling the same phylogenetic history. In this 

study, the dendrogram generated from 

amplification with M13 primer gives approximately 

79% correlation with morphological data as 11 out 

of 14 isolates were observed to give similar 

groupings. As in the case of OPD10, there was 

approximately 69% correlation with morphological 

data as 9 out of 13 isolates were observed to 

correlate with morphological groupings. Molecular 

analysis has shown that two isolates that were 

initially grouped in different cluster based on the 

morphological characterization, appeared to be 

identical at the genetic levels when characterized 

with RAPD analysis. For isolates P5 (peat soil) and 

P19 (mangrove soil), showed minor differences in 

their morphological characteristics but showed to 

be identical at the genetic levels. 

The dendogram generated from M13 primer 

(Figure 10) also showed little correlation between 

isolates isolated from the same soil type for 

example isolates isolated from mangrove soil P1 

and P2 are grouped into Clade 1 while P2 and P12 

in Clade 5. Apart from that, geographical origin 

also showed little correlation as seen in isolates 

isolated from soy sauce from Samarahan area P13 

and P5 found in Clade 6 and Clade 7 respectively, 

indicating a wide variation of Penicillium that can 

be found throughout the sampling area. Spatial 

variations in microfungi communities is quite 

common and have been shown to be attributed to 

various factors such as soil chemistry, plant 

composition such as the alpine and birch

communities (Lumley et al., 2001; Mclean and 

Huhta 2002; Bellis et al., 2007). 

Conclusion 

In this study, most isolates showed correlation and 

consistency in morphological and molecular data. 

Molecular analysis was also able to show that in the 

instance of P5 and P19 to be genetically identical 

when characterized with RAPD compared to 

morphological analysis. The study also indicated 

that the isolates showed considerable genotypic 

variations within Penicillium spp isolated from a 

wide area in Sarawak and little correlation to both 

the type of soil they originated from and also 

geographical location. 

Acknowledgement 

This work is supported by Unimas Fundamental 

Research Grant. 

References 

Bellis TD, Kernaghan G, Widden P. Plant 

community influences on soil microfungal 

assemblages in boreal mixed-wood forests. 

Mycologia. 99(3):356-367. 2007. 

Bridge PD, Prior C, Sagbohan J, Lomer CJ, Carey 

M and Buddie A. Molecular characterization of 

isolates from locusts and grasshoppers. 

Biodiversity and Conservation. 6:177-189. 

1997. 

Campbell NA, Reece JB. Biology sixth edition. pp 

616-630. 2002. 

Carlile MJ, Watkinson SC and Graham WG. The 

Fungi. Second edition. San Diego, California: 

Academic Press; 2001. 

Cruz-Perez P, Buttner MP and Stetzenbach LD. 

Specific detection of Stachybotrys chartarum in 

pure culture using quantitative polymerase 

chain reaction. Mol. Cell. Probes. 15 (23), pp. 

129–138. 2001. 

Lumley TC, Gignac LD and Currah RS. 

Microfungus communities of white spruce and 

trembling aspen logs at different stages of decay 

in disturbed and undisturbed sites in the boreal 

mixedwood region of Alberta. Canadian J Bot. 

79:76–92. 2001. 

Lutzoni F and Vilgalys R. Integration of 

morphological and molecular data sets in 

estimating fungal phylogenies. Canadian J Bot. 

73(suppl. 1):S49-659. 1995. 


Mclean MA and Huhta V. Microfungal community 

structure in anthropogenic birch stands in 

central Finland. Biology and Fertility of Soils. 

35:1–12. 2002. 

Meklin T, Haugland RA, Reponen T, Varma M, 

Lummus Z, Bernstein D, Wymer LJ and Vesper 

SJ. Quantitative PCR analysis of house dust can 

reveal abnormal mold conditions. J. Environ. 

Monit. 6 pp. 615–620. 2004. 

Meyer W, Moraywetz R, Borner T and Kubicek 

CP. The use of DNA fingerprint analysis in the 

classification of some species. Curr Genet. 

21:27-30. 1992. 

Portnoy JM, Barnes CS and Kennedy K. Sampling 

for indoor fungi. J. Allergy Clin. Immunol. 113 

pp. 189–198. 2004. 

Schlick A, Kuhls K, Meyer W, Lieckfeldt E, 

Borner T and Messner K. Fingerprinting reveals 

gamma-ray induced mutations in fungal DNA: 

implications for identification of patent strains 

of Trichoderma harzianum. Curr Genet. 26: 74- 

78. 1994. 

Scott PM. Penicillium mycotoxins. In "Mycotoxic 

Fungi, Mycotoxins, Mycotoxicoses, an 

Encyclopedic Handbook. Vol. 1. Mycotoxigenic 

Fungi' eds. T.D. Wyllie and L.G. Morehouse. 

New York: Marcel Dekker. pp. 283-356. 1977. 

Sneath PHA and Sokal RR. Numerical Taxonomy. 

W.H. Freeman, San Francisco; 1973. 

Taylor JW and Natvig D. Isolation of fungal DNA. 

In: Fuller, M.S. and Jaworski, A. (eds) 

Zoosporic Fungi in Teaching and Research. 

South-eastern Publishing Corporation, Athens, 

Georgia. pp. 252-258. 1987. 

Thom C. Mycology presents penicillin. Mycologia. 

37:460-475. 1945.




The sensitivity of the human chromosomes to ethyl methane 

sulfonate (EMS) 

Songül BUDAK DİLER *,1 , Mehmet TOPAKTAŞ 2 

1 University of Niğde, Department of Science and Letters, Niğde, 51200, Turkey 

2 University of Cukurova, Department of Science and Letters, Adana, 01330 Turkey 

(* author for correspondence; budakdiler@gmail.com) 

Received: 03 March 2009; Accepted 19 March 2010 

Abstract 

The aim of this study was to determine the chromosomal susceptibility to breakages by the mutagen Ethyl 

methanesulfonate (EMS). For this reason, human peripheral blood lymphocytes were treated with varying 

concentrations of EMS (5x10 -4 M, 10 -3 M and 2x10 -3 M) for 24 and 48 hours. The percentages of chromosomal 

fragmentations in EMS-treated and untreated (control) cells were found to be statistically significant. In 

addition, the extent of breakages of the same chromosomes correlated with the concentrations of the chemical. 

The chromosomes that were fragmented most as a result of EMS-treatment in descending order were 1, 2, 6, 

4, X, 7, 3, 5, 9, and 8. 

Keywords: Ethyl methanesulfonate (EMS), human lymphocytes, chromosome damage, lymphocyte culture. 

Etil Metansulfonat (EMS)’ye İnsan Kromozomlarının Hassasiyeti 

Özet 

Bu çalışmanın amacı, mutajen Etil metansulfonat (EMS)’nin insan kromozomlarında oluşturduğu kromozom 

kırıklarını incelemek ve en çok kırılan kromozomları saptamaktır. Bu amaç için hücreler, 5x10 -4 M, 10 -3 M ve 

2x10 -3 M konsantrasyonlardaki EMS ile 24 ve 48 saat muamele edilmiştir. 24 ve 48 saat EMS ile muamele 

edilen insan periferal lenfositlerinde kontrolde ve aynı dozda, farklı kromozomlarda görülen kromozom 

kırılma yüzdeleri bir birleriyle karşılaştırılmış ve aralarındaki farkın istatistik bakımında önemli olduğu 

bulunmuştur. Ayrıca aynı kromozomun farklı dozlardaki kırılma yüzdeleri kontroldeki kırılma yüzdeleriyle 

karşılaştırılmış, aradaki farkın önemli olduğu saptanmıştır. EMS ile muamele sonucu en fazla kromozom 

kırılması 1., 2., 6., 4., X, 7., 3., 5., 9., ve 8. kromozomlarda tespit edilmiştir. 

Anahtar Sözcükler: Etil metansulfonat (EMS), insan kromozomları, kromozom kırığı, lenfosit kültürü. 

Introduction 

Ethyl methanesulfonate (EMS) is a colorless liquid. 

When heated to decomposition, EMS emits toxic 

fumes of sulfur oxides. EMS is reasonably 

anticipated to be a human carcinogen based on 

sufficient evidence of carcinogenicity in 

experimental animals. EMS is used experimentally 

as a mutagen, teratogen, and brain carcinogen and 

as a research chemical (IARC 1974, IARC 1987, 

HSDB 2000, Merck The Merck Index 1989). When 

administered as a single intraperitoneal injection, 

EMS induced lung tumors in male mice and lung 

adenomas in mice of both sexes. Three 

intraperitoneal injections of EMS in arachis oil 

induced lung and kidney tumors in male mice. In a 

similar study, EMS induced renal carcinomas in

26 

Songül Budak DİLER and Mehmet TOPAKTAŞ 

female rats and a variety of benign and malignant 

tumors, including lung carcinomas, in rats of both 

sexes (Ueo et al., 1981). 

The tests sister chromatid exchange (SCE) and 

chromosome aberrations (CA) are used to assess 

the genotoxicicity of mutagenic and carcinogenic 

chemicals (Perry and Evans, 1975). It was also 

established that in fish cells, EMS increased SCE 

and CA in a concentration dependent manner but 

had no effect on their replicative index (RI) 

(Maddock et al., 1986). Furthermore, Adhikari and 

Grover showed that EMS caused CA in the rat bone 

marrow cells (Adhikari and Grover, 1988). In 1990, 

it was established that EMS enhanced SCE in the 

peripheral leukocytes of humans in a concentration 

dependent manner and decreased the RI in a doseindependent 

manner (Topaktaş and Speit, 1990). 

The sensitivities and clastogenicities of human 

chromosomes with high gene density (1, 19 and 20) 

and with low gene density (4 and 18) to 

combinations of EMS and cytosine arabinoside 

(Ara-C) were measured and the high gene density 

chromosomes were found to be sensitive (Surralles 

et al.,1997). Human peripheral blood lymphocytes 

were treated with EMS (1,5x10 -4 M and 1,5x10 -3 M) 

and MMS (1,5x10 -5 M and 1,5x10 -4 M) and the 

treatment resulted in enhanced SCE compared to 

untreated corresponding cultures (Harish et al., 

1998). it was demonstrated that the chemical EMS 

enhanced SCE in whole blood and lymphocyte 

cultures (During, 1985). In addition, EMS 

treatment at various concentrations (5x10 -4 M, 10 - 

3 M and 2x10 -3 M) of human peripheral blood 

lymphocytes enhanced CA (Rencüzoğullari and 

Topaktaş, 2000). Therefore, we aimed at 

investigating the degree of sensitivity of human 

chromosomes to EMS by employing the 

mutagenicity tests mentioned above. 

Materials and Methods 

In this study, we used peripheral blood and 

lymphocytes from healthy donors, two males (23 

and 24 years old), and two females (23 years old). 

EMS (Sigma M-0880) was used as a test substance. 

The preparation of chromosome was performed in 

accordance with Evans 1984. In addition, this study 

was prepared according to IPCS guidelines 

(Albertini et al., 2000). Whole blood (0.2 ml) from 

four healthy donors (two male and two female, 

nonsmokers, aged: 23 and 24) was added to 2.5 ml 

chromosome medium B (Biochrom, F5023). The 

cultures were incubated at 37°C for 72 h. The cells 

were treated with concentrations of 5x10 -4 M, 10 -3 M 

and 2x10 -3 M of EMS for 24 h (EMS was added 48 

h after initiating the culture) and 48 h (EMS was 

added 24 h after initiating the culture). The test 

substance EMS was dissolved in ethanol (50%). 

There was clear evidence that ethanol was not a 

bacterial or mammalian cell mutagen in vitro 

assays for chromosome aberration. Reported tests 

for chromosome aberration induction in vivo were 

all negative and only a minority of micronucleus 

tests were positive (Phillips and Jenkinson, 2001). 

Colchicine (0.06µg/ml, Sigma C 9754) was added 

for the last 2 h of culture. To collect the cells, the 

cultures were centrifuged (1200 rpm, 15 min), 

treated with hypotonic solution (0.4% KCl) for 13 

min at 37 o C, and then fixed in cold methanol: 

glacial acetic acid (3: 1) for 20 min at room 

temperature. The treatment with fixative was 

repeated three times. Then the cells were spread on 

glass slides and air dried. The slides were stained 

with giemsa (5%). Well spread metaphases per 

donor were examined 1000× magnification for 

occurrence of different types of chromosome 

aberration (CA). 100 metaphase cells with 

chromosomes aberrations were examined in each 

treated groups and control groups. Karyotyping was 

performed using Olympus BX50 microscope and 

Cytovision 3.00 Windows NT Applied Imaging 

software. For statistical analysis, the ONE WAY 

ANOVA and DUNCAN test was used and the 

results were tabulated. 

Results 

In this study, the sensitivity of human 

chromosomes to EMS was revealed by observing 

the chromosomal breakages in each of the 

chromosomes. The percentage of chromosomal 

fragmentation varied among chromosomes in the 

control groups. In the control groups (24h), 

chromosomes 1, 2, 6, X, and 4 were found to be 

sensitive to first degree fragmentation whilst 

chromosomes 22, 20, 19, 18, and 11 were 

insensitive (Table 1). In the solvent control groups 

(ethanol, 50%) while chromosomes 2, 1, 6, 3 and 4 

were sensitive to first degree fragmentation, 

chromosomes 22 and 18 were completely 

insensitive (Table 1). 

In cells that had been treated with 5x10 -4 M of 

EMS for 24 h, chromosomes 1 and 2 were the most 

sensitive and chromosomes 22, 19 and 20 were the 

least sensitive to fragmentation (Table 1). In those 

that were treated with 10 -3 M of EMS for 24 h, 

chromosomes 1 and 2 were the most fragile while 

chromosomes 17, 11, 18, 21, 22, 19 and 20 were

the least sensitive (Table 1) (Figure1). Karyotyping 

and fragmentation of human chromosomes 1, 2, 

and 10. At the 2x10 -3 M concentration of EMS for 

the same duration, chromosomes 6 and 1 were 

sensitive to first degree while chromosomes X, 2, 5, 

and 4 were less fragile. In the same cultures, 

chromosomes 18, 19, 22, 20 and 21 remained 

completely insensitive to the chemical (Table 1). In 

cultures that had been treated for 24 h with varying 

concentrations of EMS, and in all concentrations 

tested, the fragmentation observed in chromosomes 

2, 5-11, 13 and 16-8 was higher than that in the 

control group and in the solvent control group. On 

the other hand, the breakages of chromosomes 3, 12 

and 19 were significant only in comparison to the 

control groups. While the 4th chromosome showed 

significant fragmentation at all of the concentrations 

tested in comparison to the controls, this was 

significant only at 5x10 -4 M and 10 -3 M EMS 

concentrations in comparison to the solvent 

controls. The fragmentation of chromosomes 14, 15 

and X at EMS concentrations of 5x10 -4 M and 2x10 - 

3 M was significantly higher than the control groups 

and the solvent control groups. On the other hand, 

there was no increase in breakages of chromosomes 

1, 20 – 22 as a result of EMS treatment (Table 1). 

As a result of treatment with EMS for 24 hours, the 

Chromosomal fragmentation by EMS 

chromosomal fragmentation observed in 

comparison to control groups and solvent control 

groups was found to be dose independent (Table 1). 

In the solvent control groups chromosomes 2 

and 1 are the most susceptible to breakages. There 

was no breakages observed on chromosomes 22, 21, 

20, 18 and 17 (Table 2).In cultures that had been 

treated with 5x10 -4 M of EMS for 48 h, 

chromosomes 1, 2 and 4 were the most sensitive to 

fragmentation. The least sensitive were 

chromosomes 20, 18 and 17, with chromosome 22 

never showing fragmentation (Table 2). There was 

no statistical significance in the observed breakages 

among chromosomes treated with 10 -3 M of EMS 

for 48 h (Table 2, Figure 2). At 2x10 -3 M 

concentration of EMS chromosomes 1 and 2 are 

susceptible to the first degree, with the least 

sensitive being 22 and 20 (Table 2). In cultures 

treated with different concentrations of EMS for 48 

h, there was significant fragmentation of 

chromosomes 10 and 11 while at these concentrations 

chromosomes 17, 18 and 21 showed more 

fragmentation in comparison to the control group. 

On the other hand, chromosomes 1-9, 12-14, 19, 20, 

22 and X did not any show any significant 

fragmentation the control group (Table 2). 

27

28 


Figure 1. Karyotyping and fragmentation of Human Chromosomes 1, 2, and 10 (10 -3 M EMS Treatment for 

24h,♀).


Table 1. Comparison of percentages of chromosomal fragmentations of human peripheral lymphocytes that 

were treated with different concentrations of EMS for 24 h. 

Chromoso 

me 

Control group Solvent Control 

group 

5x10 -4 M 10 -3 M 2x10 -3 M Sig 

1 3.0±1.0a 3.7±1.0ab 11.7±2.0a 9.2±1.4a 9.0±2.7ab 

2 2.5±0.9abB 4.2±1.4aB 10.7±0.9aA 8.7±1.9aA 8.0±0.4abcA ** 

3 1.0±0.7bcdefB 3.0±1.4abcdAB 5.0±0.7bcdA 5.0±0.4bcdA 4.7±1.1cdefA * 

4 1.7±0.7abcdC 2.5±0.5abcdBC 7.0±1.4bcA 6.7±0.4bcA 6.5±0.9abcdAB *** 

5 1.5±0.6abcdeB 1.0±0.7cdefB 5.0±1.0bcdA 5.0±0.7bcdA 6.5±0.9abcdA ** 

6 2.2±0.4abB 3.0±1.0abcB 7.0±0.7bA 7.2±0.4bA 9.2±0.7aA *** 

7 1.2±0.4abcdeB 2.2±0.7abcdeB 5.0±0.7bcdA 6.7±0.9bcdA 4.2±0.7defA *** 

8 1.2±0.2abcdeB 1.2±0.2abcdefB 4.2±0.4bcdeA 5.5±0.8bcdeA 3.7±0.4defA *** 

9 1.2±0.4abcdeB 1.0±0.7cdefB 4.5±0.6bcdeA 5.5±0.6bcdeA 3.5±0.5defghA ** 

10 0.2±0.2efB 0.7±0.4cdefB 3.7±0.6bcdefA 4.5±0.2bcdefA 3.5±0.9defghA *** 

11 0.0±0.0fC 0.5±0.5fC 2.2±0.8efghB 4.7±0.4efghA 2.7±0.7efghAB *** 

12 0.7±0.2bcdefB 1.5±0.5abcdefA 

B 

3.0±0.4defgA 4.0±0.7defgA 3.0±1.0efghAB * 

13 0.5±0.2defB 1.2±0.4bcdefB 4.0±1.2bcdefA 3.5±0.2bcdefA 5.2±0.7bcdeA ** 

14 0.7±0.4cdefB 0.7±0.4cdefB 3.7±1.1cdefA 2.2±0.6cdefgA 

B 

3.0±0.5efgA * 

15 0.2±0.2efB 0.2±0.2fB 3.0±0.7defgA 1.2±0.7defgA 

B 

3.0±0.7efgA ** 

16 1.0±0.7bcdefB 0.2±0.2fB 3.5±0.8defA 3.5±0.5defA 3.5±0.2defgA *** 

17 0.2±0.2efB 0.2±0.2fB 2.0±0.7efghA 1.5±0.2efghA 2.0±0.4efghA ** 

18 0.0±0.0fB 0.0±0.0fB 1.2±0.6ghıA 0.7±0.2ghıA 1.2±0.2ghıjA ** 

19 0.0±0.0fB 0.5±0.2fAB 0.7±0.2hıA 1.0±0.0hıA 1.0±0.4hıjA * 

20 0.0±0.0f 0.2±0.2f 0.2±0.2ı 0.7±0.2ı 0.7±0.4ıj 

_ 

21 0.2±0.2ef 1.0±0.7cdef 1.5±0.2fgh 2.2±0.6fgh 0.5±0.2j 

22 0.0±0.0f 0.0±0.0f 0.7±0.4hı 1.0±0.5hı 0.7±0.5ıj 

X 2.0±0.5abcdB 1.7±0.8abcdefB 5.2±0.6bcdA 6.0±0.4bcdAB 8.0±1.0abcA *** 

Sig. *** *** *** *** *** 

Key: *** P

30 


Figure 2. Karyotyping and fragmentation of human chromosomes 1, 2, 3, 8, 9 and 21 (10 -3 M EMS Treatment 

for 48h, ♀).


Table 2. Comparison of percentages of chromosomal fragmentations of human peripheral lymphocytes that 

were treated with different concentrations of EMS for 48 h. 

Chromosome Control 

group 

Solvent 

Control 

group 

5x10 -4 M 10 -3 M 2x10 -3 M Sig 

1 3.0±1.0a 4.7±2.1ab 8.0±1.9a 8.5±2.9 10.2±1.3a _ 

2 2.5±0.9ab 5.7±1.3a 6.7±2.0a 8.0±2.8 8.2±1.8ab _ 

3 1.0±0.7bcdef 2.0±0.7cdefg 3.7±2.2cde 3.2±1.4 4.0±0.9cdef _ 

4 1.7±0.7abcd 3.2±0.4abc 6.5±1.5ab 5.2±2.0 5.5±0.6bcd _ 

5 1.5±0.6abcde 2.7±0.4bcd 4.0±0.4abcd 2.5±1.3 3.0±1.0def _ 

6 2.2±0.4abc 3.2±0.4abc 5.2±0.7abc 6.0±2.0 7.2±0.8abc _ 

7 1.2±0.4abcde 1.2±0.9efghıj 4.0±0.7abcd 3.2±1.1 3.7±0.6def _ 

8 1.2±0.2abcde 2.0±0.4bcdef 2.7±0.2bcde 2.7±1.1 3.5±0.2def _ 

9 1.2±0.4abcde 1.5±0.2cdefgh 2.5±0.2cde 2.5±0.8 3.2±0.2def _ 

10 0.2±0.2efB 1.2±0.2cdefgh 

AB 

1.2±0.6efgAB 2.5±1.0A 3.2±0.4defA * 

11 0.0±0.0fB 1.2±0.4defghı 

AB 

1.7±0.4defA 2.7±1.1A 3.5±0.6defA ** 

12 0.7±0.2bcdef 0.5±0.5hıj 1.7±0.4def 2.2±0.7 2.7±0.7def _ 

13 0.5±0.2def 1.7±0.4cdefg 2.5±0.6cdef 3.2±1.7 4.7±1.0bcde _ 

14 0.7±0.4cdef 1.2±0.2cdefghı 1.2±0.6efg 2.2±1.0 0.3±0.7def _ 

15 0.2±0.2efB 0.2±0.2ıjB 1.0±0.4efgAB 1.0±0.4AB 2.5±0.9efgA * 

16 1.0±0.7bcdef 0.7±0.4fghıjB 2.7±0.6cdeA 2.5±0.9AB 4.0±0.7cdeA * 

B 

B 

17 0.2±0.2efB 0.0±0.0jB 0.2±0.2fgB 2.0±0.7A 2.5±0.6efgA ** 

18 0.0±0.0fC 0.0±0.0jC 0.2±0.2fgBC 1.0±0.4B 2.2±0.6efgh 

A 

*** 

19 0.0±0.0f 0.5±0.2fghıj 1.0±0.0efg 1.0±0.7 1.7±0.8fgh _ 

20 0.0±0.0f 0.0±0.0j 0.5±0.5fg 1.0±0.5 0.7±0.4h _ 

21 0.2±0.2efB 0.0±0.0jB 1.0±0.5efgAB 1.5±0.6A 2.2±0.4efgh 

A 

** 

22 0.0±0.0f 0.0±0.0j 0.0±0.0g 1.5±0.6 1.0±0.7gh _ 

X 2.0±0.5abcd 2.2±0.4bcde 4.7±1.2abcd 4.7±1.7 5.0±0.5bcde _ 

Sig *** *** *** 

_ 

*** 

31

32 


Discussion 

The sensitivity of human chromosomes to EMS 

treatment was measured by determining the 

breakages of each chromosome. In cultures treated 

with different concentrations of EMS for 24 h and 

48 h, the chromosomal breakage percentages were 

statistically significant compared to control groups. 

In addition, the percentage of fragmentation of each 

chromosome at different concentrations of EMS 

was significantly higher the controls. 24h EMS 

treatment caused more fragmentation than 48h 

treatment due to repair of damaged cells after 24h 

treatment (Franke et al., 2006). Similar findings 

also reported by several groups (Çakmak et al., 

2004, Rencüzoğulları et al., 2004, Bayram and 

Topaktaş 2008). 

In the control groups, chromosomes 1, 2, 6, X, 

4 and 5 are susceptible to breakages to the first 

degree. As can be seen, those chromosomes that are 

tend to (natural) breakages in the control groups are 

also susceptible to fragmentation in EMS-treated 

cultures. 

These results illustrate that the clastogens 

cause more fragmentation of those chromosomes 

that are prone to natural breakages. It has been 

proposed that there may be a correlation between 

the length of chromosomes and degree of 

susceptibility to breakages. However, in this study, 

in cultures treated with EMS, exception to this 

assumption was discovered. For instance, 

chromosome 3 fell into the second degree 

susceptibility category in both untreated and EMS 

treated cultures. This finding suggests that 

chromosomal susceptibility to fragmentation may 

correlate with its length as well as its composition. 

Some investigators have discovered mutations 

in some of the chromosomes derived from some 

malignant cells, which we have found to be 

sensitive to EMS treatment. The chromosomes we 

found to be susceptible (chromosomes 1, 2, 3, 4, 5, 

6, X, 7 and 8) were also found to be sensitive in 

other studies. For instance, Bayani et al. showed by 

spectral karyotyping that chromosomes 8, 7 and 20 

were fragmented and rearranged in bone marrow 

malignancies (Bayani et al.,2003). In cell lines 

derived from stomach cancers, found that the p arm 

of chromosome 17 showed partial deletion whilst 

the q arm demonstrated partial duplication (Chun et 

al., 2000). Selzer et al. studied neroblastomas and 

their cell line derivatives, and discovered that there 

was a loss in 3p and 11q whilst 17q showed 

enlargement (Selzer et al., 2005). Gorunova et al. 

showed that in gull bladder carcinomas, 

chromosome 7 was the most frequently rearranged 

one, followed by chromosomes 1, 3, 11, 6, 5 and 8. 

(Gorunova et al., 1999). Morrissette et al. 

discovered aberrations of chromosome 18 in 

patients with partial mosaic tiresome (Morrissette et 

al., 2005). 

From these findings, it can be deduced that the 

EMS test may prove to be indicative in some types 

of cancer. Honma et al. compared the mutagenic 

and cytotoxic response of the p53 tumor suppressor 

gene in normal cells (TK6) and in cells with a 

mutated p53 gene (WTK-1), both of which were 

derived from he same ancestor. These two cell lines 

were subjected to treatment with X-rays, EMS, 

MMS and MMC. They found that the WTK-1 cells 

were more resistant to induced cytotoxicity than the 

TK6 cells, whiles their thymidine kinase (tk) gene 

was more susceptible to mutation due to loss of 

heterozygosity (LOH). These studies shows that 

EMS can cause malignancies not only by the 

cytogenetically specified chromosomal fragmentations 

but also by alterations at the genetic level 

(Honma et al., 1997). 

In our study EMS caused chromosomal 

breakages that are similar to the ones described by 

these investigators. It can be argued that EMS may 

constitute a risk factor in malignant transformations 

due to its effect on chromosomal stability. 

Acknowledgments 

This study was supported by the C.U. Research 

Fund. Project No. FBE2002D117. 

References 

Adhikari N and Grover IS. Genotoxic effects of 

same systemic pesticides: In vivo chromosomal 

aberrations in bone marrow cells in rats. 

Environmental and Molecular Mutagenesis 12: 

235-242, 1988. 

Albertini RJ, Anderson D, Douglas GR et al., IPCS 

Guidelines for the Monitoring of Genotoxic 

Effects of Carcinogenes in Humans. Mutat Res 

463: 111-172, 2000. 

Bayani J, Zielenska M, Pandita A et al. Spectral 

Karyotyping Identifies Recurrent Complex 

Rearrangements of Chromosomes 8, 17 and 20

in Osteosarcomas. Genes Chromosomes Cancer 

36(1): 7-16, 2003. 

Bayram S and Topaktaş M. Confirmation of the 

Chromosome Damaging effects of Lamivudine 

in in vitro Human Peripheral Blood 

Lymphocytes. Environmantal and Molecular 

Mutagenesis 49: 328-333, 2008. 

Çakmak T, Topaktaş M and Kayraldiz A. The 

Induction of Chromosomal Aberration by Tetra 

Antibiotic in Bone Marrow Cells of Rats in vivo. 

Russian Journal of Genetics 40(8): 867-870, 

2004. 

Chun YH, Kil JI, Suh YS et al. Characterization of 

Chromosomal Aberrations in Human Gastric 

Carcinoma Cell Lines Using Chromosome 

Painting. Cancer Genet. Cytogenet. 119(1): 18 – 

25, 2000. 

During R. Vergleichende Untersuchungen zur 

Induktion von Schwester-chromatidaustauschen 

(SCEs) in Menschlichen Lymphozyten in vitro 

Nach Kultivierung von Vollblut oder Isolierten 

Lymphozyten. Dissertation zu Erlangung des 

Doktorgrades der Medizin der Fakültät für 

Theoretische Medizin der Universität Ulm, 80s. 

1985. 

Evans HJ. Human peripheral blood lymphocytes 

fort he analysis of chromosome aberrations in 

mutagen tests, Handbook of Mutagenicity Test 

Procedures: Kilbey, B.J., Legator, M., Nichols, 

W., Ramel, C. (eds.), Second edition, Elsevier 

Science Publishers, BV. pp. 405-427, 1984. 

Franke SI, Pra D, Giulian R et al. Influence of 

orange juice in the levels and in the 

genotoxicity of iron and copper. Food-Chem- 

Toxicol 44(3): 425-35, 2006. 

Gorunova L, Parada LA, Limon J et al. Nonrandom 

Chromosomal Aberrations and Cytogenetic 

Heterogeneity in Gallbladder Carcinomas. 

Genes Chromosomes Cancer 26(4): 312-321, 

1999. 

Harish SK, Guruprasad KP, Mahmood R et al. 

Adaptive Response to Low Dose of EMS or 

MMS in Human Peripheral Blood Lymphocytes. 

Indian J Exp Biol 36: 1147-50, 1998. 

Honma M, Hayashi M, Sofuni T. Cytotoxic and 

Mutagenic Responses to X-Rays and Chemical 

Mutagens in Normal and p53-Mutated Human 

Lymphoblastoid Cells. Mutat. Res. 4;374(1): 

89-98. 1997. 

HSDB Hazardous Substances Data Base. National 

Library of Medicine. 


http://toxnet.nlm.nih.gov/cgi-bin/sis/htmlgen? 

HSDB, 2000. 

IARC Same Anti-thyroid and Related Substances, 

Nitrofurans and Industrial Chemicals. IARC 

Monographs on the Evaluation of Carcinogenic 

Risk of Chemicals to Humans, Lyon, France: 

International Agency for Research on Cancer, 

vol.7. pp 326, 1974. 

IARC. Overall Evaluations of Carcinogenicity. 

IARC Monographs on the Evaluation of 

Carcinogenic Risk of Chemicals to Humans, 

Lyon, France: International Agency for 

Research on Cancer. Supplement 7. pp 440, 

1987. 

Maddock ML, Northrup H, Ellingham TJ. 

Induction of Sister-Chromatid Exchange and 

Chromosomal Aberrations in Hematopoietic 

Tissue of a Marine Fish Following ın vivo 

Exposure to Genotoxic Carcinogens. Mutat Res 

29: 145-147, 1986. 

Merck The Merck Index, 11th ed. Rahway, NJ: 

Merck&Company, Inc. 1989. 

Morrissette JJ, Medne L, Bentley T et al. A Patient 

with Mosaic Partial Trisomy 18 Resulting From 

Dicentric Chromosome Breakage. Am J. Med. 

Genet. A. 30;137(2): 208-212, 2005. 

Perry P and Evans HJ. Cytological Detection of 

Mutagen-Carcinogen Exposure by Sister 

Chromatid Exchange. Nature 258: 121-125, 

1975. 

Phillips BJ and Jenkinson P. Is Ethanol Genotoxic? 

A Review of the Published Data. Mutagenesis 

16(2): 91-101, 2001. 

Rencüzoğullari E and Topaktaş M. Chromosomal 

Aberrations in Cultured Human Lymphocytes 

Treated with the Mixtures of Carbosulfan, Ethyl 

Carbamate and Ethyl Methanesulfonate. 

Cytologia 65: 83-92, 2000. 

Rencüzoğulları E, İla HB, Kayraldiz A et al. The 

Genotoxic Effect of the New Acaricide 

Etoxazole. Russian Journal of Genetics 40(11): 

1300-1304, 2004. 

Selzer RR, Richmond TA, Pofahl NJ et al. Analysis 

of Chromosome Breakpoints in Neuroblastoma 

at Sub-kilobase Resolution Using Fine-tiling 

Oligonucleotide Array CGH. Genes 

Chromosomes Cancer 44(3): 305-19, 2005. 

Surralles J, Sebastian S and Natarajan AT. 

Chromosomes with High Gene Density are 

Preferentially Repaired in Human Cells. 

Mutagenesis 12: 437-442, 1997. 

33

34 


Topaktaş M and Speit G. Sister Chromatid 

Exchange (SCE) Test Make Use of Detemine in 

the Mutagen and Carcinogen. C.U. Sağlık Bil 

Der 5: 73-84, 1990. 

Ueo HR, Takaki HY, K. Sugimachi. Mammary 

carcinoma induced by oral administration of 

ethyl methanesulphonate. Determination of 

some of the parameters affecting tumor 

induction. Carcinogenesis 2(12): 1223-8, 1981.




Protective effect of pomegranate peel ethanol extract against ferric 

nitrilotriacetate induced renal oxidative damage in rats 

Mahgoub Mohammed AHMED *, 1 and Safaa Eid ALI 2 

1 

Molecular Drug Evaluation Department, National Organization for Drug Control and Research 

(NODCAR), Giza, Egypt 

2 

Food Technology Research Inst., Agricultural Research Center (ARC), Giza, Egypt 

(* author for correspondence; dr_mahgoub1@yahoo.com ) 

Received: 18 December 2009; Accepted: 02 April 2010 

Abstract 

Pomegranate is an important source of bioactive compounds. The nephroprotective effect of pomegranate 

peel ethanol extract against ferric nitrilotriacetate (Fe-NTA)-induced renal oxidative stress was studied. The 

results showed that Fe-NTA enhances renal lipid peroxidation with reduction in renal glutathione content, 

antioxidant enzymes, viz., glutathione peroxidase, catalase, glutathione reductase and phase-II metabolizing 

enzyme, glutathione-S-transferase. It also enhances serum urea and creatinine. Treatment of rats orally with 

pomegranate peel extract (100 and 200 mg/kg/day, for seven days) resulted in significant decrease in lipid 

peroxidation and serum urea and creatinine levels. Renal glutathione content, glutathione-S-transferase and 

antioxidant enzymes were also recovered to a significant level (P

36 

Mahgoub Mohammed AHMED and Safaa Eid ALI 

Introduction 

Pomegranate (Punica granatum L., Punicaceae), is 

one of the oldest known drug. It is mentioned in the 

Ebers papyrus of Egypt written in about 1550 BC 

(Ross, 1999). Dried fruit peel is used for diarrhea 

and to treat respiratory and urinary tract infections. 

Also, pomegranate fruit peel exerted diverse 

pharmacological functions as antioxidant activity 

(Yunfeng et al., 2006 and Thring et al., 2009), 

antifertility effect (Gujraj et al., 1960), cytotoxic 

activity (Sato, 1990 and Kulkarni et al., 2007), 

hepatoprotective activity (Murthy, 2002) and 

hypoglycemic activity (Dhawan et al., 1977 and 

Hontecillas et al., 2009). Also, pomegranate peel 

ethanol extract (500 mg/kg b.wt.) has ameliorative 

effect against chlorpyrifos-ethyl-induced oxidative 

stress in rats (Ahmed and Zaki, 2009). Pomegranate 

peel contains substantial amounts of polyphenols 

such as ellagic tannins, ellagic acid and gallic acid 

(Naser et al., 1996). 

Iron is the most abundant metal in the human 

body. Although iron is an essential nutritional 

element for all life forms, iron overload may lead to 

various diseases (De Freitas and Meneghini, 2001). 

The iron complex of the chelating agent 

nitrilotriacetic acid is nephrotoxic (Khan and 

Sultana, 2005). Intraperitoneal injection of Fe-NTA 

induces renal proximal tubular damage associated 

with oxidative damage that eventually leads to a 

high incidence of renal cell carcinoma in rodents 

after repeated administration (Okada and 

Midorikawa, 1982). Intraperitoneally injected of 

ferric nitrilotriacetate (Fe-NTA) is absorbed into 

portal vein through mesothelium and passes into 

circulation via the liver (Umemura et al., 1990). 

The low molecular weight Fe-NTA is easily filtered 

through the glomeruli into the lumen of the renal 

proximal tubules where Fe 3+ -NTA is reduced to 

Fe 2+ -NTA by the glutathione degradation products 

cysteine or cysteinylglycine (Taso and Curthoys, 

1980). In the brush border surface of the renal 

proximal convoluted tubules, γ-glutamyl 

transpeptidase hydrolyses glutathione to 

cysteinylglycine that is rapidly degraded to cysteine 

and glycine by dipeptidase (Khan and Sultana, 

2005). Cysteinylglycine and cysteine are the 

proposed thiol reductants that reduce Fe 3+ -NTA to 

Fe 2+ -NTA. The auto-oxidation of Fe 2+ -NTA 

generates superoxide radicals (O .- 2) which 

subsequently potentiate the iron catalysed Haber- 

Weiss reaction to produce hydroxyl radical (OH . ), 

leading to induction of lipid peroxidation and 

oxidative DNA damage (Umemura et al, 1990 and 

Khan and Sultana, 2005). 

For the present study, we prepared the ethanol 

extract (80%) of the pomegranate peel which 

exerted the highest antioxidant effect in vitro. The 

objective of the study was to determine the possible 

effect of prophylactic treatment with pomegranate 

peel extract on Fe-NTA induced renal oxidative 

damage in rats. 

Materials and methods 

Plant material 

Pomegranate fruit peel purchased from local market 

was dried and powdered before extraction. 

Plant extract 

Powdered plant material (500g) was repeatedly 

extracted with 2000 ml solvents of increasing 

polarity starting with benzene, chloroform, ethyl 

acetate, ethanol (80%) and distilled water. The 

percolation time for each solvent was 24h. The 

extracts were filtered, concentrated and freeze 

dried. The residues yielded for each solvent were 

stored at 4 o C. The ethanol extract (80%) was used 

for further study after preliminary in vitro tests viz. 

lipid peroxidation, deoxyribose and DPPH assays. 

Chemicals 

Ferric nitrate, NTA disodium salt, reduced 

glutathione, 1-chloro-2,4-dinitrobenzene (CDNB), 

bovine serum albumin, 1,2-dithio-bis-nitrobenzoic 

acid (DTNB) and thiobarbituric acid (TBA) were 

obtained from Sigma Chemical (St Louis, USA). 

All solvents used were HPLC grade (Merck, 

Darmstadt, Germany). 

Total phenolics 

Total phenolics in the pomegranate peel ethanol 

extract were determined according to 

Jayaparakashsa et al. (2001) using Folin-Ciocalteu 

reagent. Four hundred microlitres of sample were 

taken in test tubes; 1.0 ml of Folin–Ciocalteu 

reagent (diluted 10-fold with distilled water) and 

0.8 ml of 7.5% sodium carbonate were added. The 

tubes were mixed and allowed to stand for 30 min

and the absorption at 765 nm was measured against 

a blank, which contained 400 µl of ethanol in place 

of sample. The total phenolic content was 

expressed as gallic acid equivalents in mg/g of 

ethanol extract. 

Animals 

Albino male rats (170±30 g) were used in the 

present study. The rats were obtained from the 

animal house of the National Organization for Drug 

Control and Research (NODCAR), Egypt. The 

animals were kept under standard laboratory 

conditions of light/dark cycle (12/12h) and 

temperature (25±2˚C). The rats were allowed food 

and water ad libitum. They were provided with a 

nutritionally adequate standard laboratory diet. 

Animals’ diet 

The basal diet consists of casein 10%, cotton seed 

oil 4%, salt mixture 4%, vitamin mixture 1%, 

carbohydrates (sucrose, starch 1:1) 80.8% and 

choline chloride 0.2% (American Institute of 

Nutrition, 1980). 

Preparation of Fe-NTA solution 

The Fe-NTA solution was prepared as described in 

Deiana et al. (2001) and Khan and Sultana (2005), 

ferric nitrate and NTA disodium salt were dissolved 

in distilled water to form a 300 and 600 mM 

solution, respectively. The two solutions were 

combined in a volume ratio of 1:2 with magnetic 

stirring at room temperature and the pH was 

adjusted to 7.4 with sodium bicarbonate. 

Experimental design 

Thirty albino rats were randomly allocated to five 

groups of six rats each: 

Group 1 received only saline injection 

intraperitoneally at a dose of 10 ml/kg body weight. 

Group 2 received only a single intraperitoneal 

injection of Fe-NTA solution at a dose of nine mg 

Fe/kg body weight (Athar and Iqbal 1998). 

Group 3 received pomegranate peel extract by 

gavage once daily for seven days at a dose of 100 

mg body weight, p.o. (Parmar and Kar, 2008). 

Group 4 received pomegranate peel extract once 

daily for seven days at a dose of 200 mg/kg body 

weight, p.o. (Parmar and Kar, 2008). 

Pomegranate peel extract against renal oxidative damage 37 

After the last treatment with pomegranate peel 

extract, the animals of group 2, 3 and 4 received a 

single intraperitoneal injection of Fe-NTA at a dose 

level of 9mg Fe/kg body weight. 

Group 5 received pomegranate peel extract orally 

once daily for seven days at a dose of 200 mg/kg 

body weight (Parmar and Kar, 2008). We used the 

high dose of pomegranate peel ethanol extract (200 

mg/kg b.w. p.o.) to study its effect on kidney. 

All rats were sacrificed 12 h after the treated 

with Fe-NTA. Blood was collected and the 

separated serum was used for the estimation of 

creatinine (Bartless et al., 1972) and urea (Patton 

and Crouch, 1977). 

Post-mitochondrial supernatant and microsomal 

fraction preparation 

Kidneys were removed quickly and washed in cold 

isotonic saline. The kidneys were homogenized in 

50 mM phosphate buffer (pH 7) using an electronic 

homogenizer to prepare 10% w/v homogenate. The 

homogenate was centrifuged at 3000 rpm for 10 

min at 4 o C by cooling ultracentrifuge (model Sigma 

3K 30) to separate the nuclear debris. The aliquot 

so obtained was used at 12000 rpm for 20 min at 

4 o C to obtain post-mitochondrial supernatant 

(PMS), which was used as a source of enzymes 

(Khan and Sultana, 2005). A portion of the PMS 

was centrifuged for 60 min at 34000 rpm at 4 o C. 

The pellet was washed with phosphate buffer (50 

mM pH 7). 

Estimation of reduced glutathione (GSH) in PMS 

Reduced GSH in mitochondria was determined by 

measuring the rate of formation of chromophoric 

product in a reaction between 5,5́-dithiobis-2- 

(nitrobenzoic acid) (DTNB) and free sulphydryl 

groups, such as GSH, at 412 nm as described by 

Ellman (1959). 

Estimation of Lipid peroxidation (LPO) in 

micrososmal fraction 

The measurement of microsomal fraction lipid 

peroxide by a colorimetric reaction with 

thiobarbituric acid was done as described by 

Okhawa et al. (1979), and the determined lipid 

peroxide is referred to as malondialdehyde. Briefly, 

in a test tube, 2.5 ml of 20% trichloroacetic acid 

solution and 1ml of 0.67% thiobarbituric acid 

solution were added to the samples. The color of 

thiobarbituric acid pigment was developed in a

38 


water bath at 100 ◦ C for 30 min. After cooling with 

tap water to room temperature, 4ml n-butanol was 

added and shaken vigorously. After centrifugation, 

the color of butanol layer was measured at 535 nm. 

Assay for glutathione-S-transferase (GST) activity 

in PMS 

Glutathione-S-transferase activity was assayed by 

the method of Habig et al. (1974). The method is 

based on the rate of conjugate formation between 

GSH and 1-chloro-2,4-dinitrobenzene (CDNB). 

The absorbance change was recorded at 340 nm 

and the enzyme activity calculated as nmol CDNB 

conjugates formed/min/mg protein. 

Assay for glutathione peroxidase (GPx) activity in 

PMS 

Glutathione peroxidase activity was assayed by the 

method of Mohandas et al. (1984). The change in 

absorbance was recorded spectrophotometrically at 

340 nm. GPx activity was expressed as nmol 

NADPH oxidized/min/mg protein. 

Assay for glutathione reductase (GR) activity in 

PMS 

Glutathione reductase activity was determined by 

the method of Carlberg and Mannervik (1975). GR 

was assayed by following the oxidation of NADPH 

at 340 nm at 37 o C. GR activity was expressed as 

nmol NADPH oxidized/min/mg protein. 

Assay for catalase (CAT) activity in PMS 

CAT activity measurement in PMS was measured 

by the method of Takahara et al. (1960). The 

reduction rate of H2O2 was followed at 240 nm for 

30 s at room temperature. CAT activity was 

expressed in nmol H2O2 consumed/min/mg protein. 

Assay for glucose-6-phosphate dehydrogenase 

(GPD) activity in PMS 

The activity of glucose-6-phosphate dehydrogenase 

was determined according to the method of Zaheer 

et al. (1965). The changes in absorbance were 

recorded at 340 nm and enzyme activity was 

calculated as nmol NADP reduced/min/mg protein. 

Estimation of protein concentration 

The protein concentration in all samples was 

determined by the method of Lowry et al. (1951). 

Statistical analysis 

The results are expressed as Mean±SEM. The 

collected data were statistically analyzed by the 

least significant differences (LSD) at the level 5% 

of the probability procedure according to Snedecor 

and Cochran (1980). 

Results 

Effect of pomegranate peel extract on renal toxicity 

markers 

The effect of pre-treatment of rats with 

pomegranate peel extract on Fe-NTA-induced 

enhancement in the level of serum creatinine and 

urea are shown in Table (1). Fe-NTA treatment 

leads to about 147% and 303% enhancement in the 

values of creatinine and urea, respectively, as 

compared with saline-treated group. Prophylaxis 

with pomegranate peel extract at both doses 

resulted in 28-45% and 48-88% reduction in the 

values of serum creatinine and urea respectively as 

compared with Fe-NTA-treated group. 

Effect of pomegranate peel extract on glutathione 

metabolism 

Table (2) shows the effect of pretreatment of 

rats with pomegranate peel extracts on Fe-NTAmediated 

renal glutathione content and on the 

activities of its metabolizing enzymes, viz, 

glutathione-S-transferase and glutathione reductase. 

Treatment with Fe-NTA alone resulted in the 

depletion of renal glutathione and reduction in the 

activities of glutathione-S-transferase and 

glutathione reductase by 48%, 55% and 46% 

respectively, as compared with saline-treated 

group. However, pretreatment of animals with 

pomegranate peel extract at 100 and 200 mg/kg 

body weight resulted in the recovery by 79-83%, 

46-73% and 40-72% respectively, as compared 

with Fe-NTA-treated group.


Table 1. Effect of pomegranate peel ethanol extract on Fe-NTA-induced enhancement of serum 

creatinine and urea in rats Values Mean±SEM (n=6 animals). a p

40 


Table 3. Effect of pomegranate peel ethanol extract on Fe-NTA-induced reduction in the activity of 

renal antioxidant enzymes (CAT, GPx and GPD) and enhancement in the level of microsomal lipid 

peroxidation (LPO) in rats Values are Mean±SEM (n=6 animals). a p

often metabolized to proximate toxicants by phase I 

enzymes, e.g., cytochrome P450 which catalyze 

oxidative reactions. The oxidized metabolites of 

potentially toxic xenobiotics are then detoxified by 

Phase II metabolizing enzymes into the forms that 

are relatively inert and more easily excreted 

(Talalay et al., 1995). 

GSH depletion increases the sensitivity of organ 

to oxidative and chemical injury. Studies with a 

number of models show that the metabolism of 

xenobiotics often produced GSH depletion 

(Mitchell et al., 1973 and Ahmed and Zaki, 2009). 

The depletion of GSH, also, seems to be the prime 

factor that permits lipid peroxidation in the Fe- 

NTA treated group. Pretreatment of pomegranate 

peel extract reduced the depletion of GSH levels 

and provided protection to the kidney. The 

protection of GSH is by forming the substrate for 

GPx activity that can react directly with various 

aldehydes produced from the peroxidation of 

membrane lipid. Pomegranate peel extract 

pretreatment also reduced the elevated levels of 

serum urea and ceatinine that are marker 

parameters of kidney toxicity. 

In conclusion, we can say that, the high 

antioxidant and nephropreventive effect of the 

pomegranate peel extract appeared to be attributed 

to its high phenolics content. The mechanism of 

action of pomegranate peel extract may be through 

induction of various antioxidant and phase II 

enzymes, and scavenging reactive oxygen species. 

Thus our data suggest that pomegranate peel 

ethanol extract is a potent nephropreventive agent. 

Further work is required for the isolation and 

characterization of individual phenolic compounds 

present in peel ethanol extract and to determine the 

mechanisms involved in the nephropreventive 

effect of pomegranate peel extract. 

References 

Ahmed MM and Zaki NI. Assessment the 

ameliorative effect of pomegranate and rutin on 

chlorpyrifos-ethyl-induced oxidative stress in 

rats. Nature and Science. 7(10): 49-61, 2009. 

Ahmed MM. Biochemical studies on 

nephroprotective effect of carob (Ceratonia 

siliqua L.) growing in Egypt. Nature and 

Science. 8 (3): 41-47, 2010. 

Ajaikumar K.B, Asheef, M, Babu BH and 

Padikkala J. The inhibition of gastric mucosal 

injury by Punica granatum L. (pomegranate) 


methanolic extract. Journal of Ethnopharma. 

96: 171–176, 2005. 

American Institute of Nutrition. Report of the 

American Institute of Nutrition. Ad Hoc 

Committee J Nutr. 110: 1340-1348, 1980. 

Aruoma OI. Methodological considerations for 

characterizing potential antioxidant actions of 

bioactive components in plant foods. Mutation 

Research. (523-524): 9-20, 2003. 

Athar M and Iqbal M. Ferric nitrilotriacetate 

promotes N-diethylnitrosamine-induced renal 

tumorigenesis in the rat: implications for the 

involvement of oxidative stress. 

Carcinogenesis. 19 (6):1133-1139, 1998 

Ayrton AD, Lewis DF, Waker R. and Ioannides C. 

Antimutagenicity of ellagic acid towards the 

food mutagen IQ: investigation into possible 

mechanisms of action. Food and Chemical 

Toxicology, 3D: 289-295, 1992. 

Bartles H, Bohmer M and Heieri C. Serum 

keratinin bestmmung ohno enteeissen. Clinical 

Chimca Acta. 37: 139-197, 1972. 

Bu-Abbas A, Clifford MN, Walker R and Ioannides 

C. Marker antimutagenic potential of aquous 

green tea extracts: Mechanism of action. 

Mutagenesis. 9: 325-331, 1994. 

Carlberg I and Mannervik B. Glutathione level in 

rat brain. J Biological Chemistry. 250: 4480- 

4575, 1975. 

De Flora S and Ramel C. Mechanism of inhibition 

of mutagenesis and carcinogenesis: classification 

and overview. Mutation Research. 202: 

285-306, 1988. 

De Freitas JM and Meneghini R. Iron and its 

sensitive balance in the cell. Mutation Research. 

475: 153-159, 2001. 

Deiana M, Aruma OI, Rosa A, Crobu V, Piga R 

and Derri MA. The effect of ferricnitrilotriacetic 

acid on the profile of 

polyunsaturated fatty acids in the kidney and 

liver of rats. Toxicol Letters. 123: 125-133, 

2001. 

Dhawan BN, Patnaik GK, Rastogi RP, Singh KK 

and Tandon JS. Screening of Indian plants for 

biological activity. Indian J. Exp. Biol. 15: 208- 

219, 1977. 

Ellman GL. Tissue sulfhydryl groups. Arch 

Biochem Biophys. 82: 70-77, 1959. 

Gil MI, Tomas-Barberan FA, Hess Pierce B, 

Holcroft, DM. and Kader AA. Antioxidant

42 


activity of pomegranate juice and its 

relationship with phenolic composition and 

processing. Journal of Agricultural and food 

chemistry. 48: 4581-4589, 2000. 

Goldstein RS and Mayor GH. The nephrotoxicity 

of cisplatin. Life Sci. 32: 685-690, 1983. 

Gujraj ML, Varma DR and Sareen KN. Oral 

contraceptives. Part 1. Preliminary observations 

on the antifertility effects of some indigenous 

drugs. Indian J Med Res. 48: 46-51, 1960. 

Habig WH, Pabst MJ and Jakoby WB. Glutathione- 

S-transferase. The first enzymatic step in 

mercapturic acid formation. J Biol Chem. 249: 

7130-7139, 1974. 

Halliwell, B. and Gutteridge, J.M.C. Iron and free 

radicals: two aspects of antioxidant protection. 

Trends Biochem. Sci. 11: 372-375, 1986. 

Hontecillas R, O'Shea M, Einerhand A, Diguardo 

M, Bassaganya-Riera J. Activation of PPAR 

gamma and alpha by punicic acid ameliorates 

glucose tolerance and suppresses obesity-related 

inflammation. J Am Coll Nutr. 28(2):184-95, 

2009. 

Khan N and Sultana S. Chemomodulatory effect of 

Ficus racemosa extract against chemically 

induced renal carcinogenesis and oxidative 

damage response in Wistar rats. Life Sciences. 

77(11):1194-210, 2005. 

Kulkarni AP, Mahal HS, Kapoor S, Aradhya SM. 

In vitro studies on the binding, antioxidant, and 

cytotoxic actions of punicalagin. J Agric Food 

Chem. 55(4):1491-500, 2007. 

Li Y, Guo C, Yang J, Wei J, Xu J and Cheng S. 

Evaluation of antioxidant properties of 

pomegranate peel extract in comparison with 

pomegranate pulp extract. Food Chemistry. 96: 

254-260, 2006. 

Lowry OH, Roseborough. NJ, Farr AL, and 

Randall RL. Protein measurement with phenol 

reagent. Journal of Biological Chemistry. 193 

(1): 265-275, 1951. 

Mitchell JR, Jollow DJ, Potter WZ, Gillete JR and 

Brodie BB. Acetaminophen induced hepatic 

necrosis. Protective role of glutathione. J. 

Pharmacol. Exp. Ther. 187: 211-215, 1973. 

Mohandas M, Marshall JJ, Duggin, GG, Hovath JS 

and Tiller D. Differential distribution of 

glutathione and glutathione related enzymes in 

rabbit kidney. Cancer Research. 44: 586-5091, 

1984. 

Murthy KN, Jayaprakasha GK and Singh RP. 

Studies on antioxidant activities of pomegranate 

peel extract using in vivo models. J Agri Food 

Chem. 50: 4791-4795, 2002. 

Nasr CB, Ayed N and Metche M. Quantitative 

determination of polyphenolic content of 

pomegranate peel. Zeitschrzfi fur lebensmittel 

unterschung und forschung. 203: 374-378, 

1996. 

Ohkawa H, Ohishi N and Nagi K. Assay of lipid 

peroxides in animal tissue by thiobarbituric acid 

reaction. Anal Biochem. 95: 251-358, 1979. 

Okada S and Midorikawa O. Induction of rat renal 

adenocarcinoma by ferric nitrilotriacetate (Fe- 

NTA). Japanese Archives of International 

Medicine. 29: 485-491, 1982. 

Parmar HS, Kar A. Medicinal values of fruit peels 

from Citrus sinensis, Punica granatum, and 

Musa paradisiaca with respect to alterations in 

tissue lipid peroxidation and serum 

concentration of glucose, insulin, and thyroid 

hormones. J Med Food. 11(2):376-381, 2008. 

Patton CJ and Crouch SR. Spectrophotometric and 

kinetics investigation of the Berthelot reaction 

for the determination of ammonia. Analytical 

Chemistry. 49: 464-469, 1977. 

Ross IA. Medicinal plants of the world. Humana 

Press, Totowa, New Jersey. 273-281, 1999. 

Sato A. Cancer chemotherapy with oriental 

medicine. 1. Antitumor activity of crude drugs 

with human tissue cultures, in In vitro 

screening. Int J Orient Med. 15 (4): 171-183, 

1990. 

Snedecor GW and Cochran WG. Statistical 

methods. 7th ed . IOWA Stat Univ. Press, IOWA, 

USA. 420, 1980. 

Takahara S, Hamilton BM, Nell JV, Ogura, Y and 

Nishimura ET. Hypocatalasemia, a new genetic 

carrier state. J Clin Invest. 29: 610-619, 1960. 

Talalay P, Fahey JW, Holtzclaw WD, Prestera, T 

and Zhang Y. Chemoprotection against cancer 

by phase II enzyme induction. Toxicology 

Letters. (82-83): 173-179, 1995. 

Thring TS, Hili P, Naughton DP. Anti-collagenase, 

anti-elastase and anti-oxidant activities of 

extracts from 21 plants. BMC Complementary 

and Alternative Medicine. 9: 17-27, 2009. 

Tsao B and Cuthoys NP. The absolute asymmetry 

of prientation of gamma glutamyl 

transpeptidase and amino-peptidase on the 

external surface of the rat renal brush border

membrane. J Biological Chemistry. 255: 7708- 

7711, 1980. 

Umemura T, Sai K, Takagi, A, Hasegawa R and 

Kurokawa Y. Oxidative DNA damage, lipid 

peroxidation and nephrotoxicity induced in the 


kidney after ferric nitilotriacetate administration. 

Cancer Letter. 54(1-2): 95-100, 1990. 

Zaheer N, Tiwari KK and Krishnan PS. Exposure 

and solubilization of hepatic mitochondrial 

shunt dehydrogenases. Archive of Biochemistry 

and Biophysics. 109: 646-648, 1965.




Molecular and cytogenetic evaluation of Y chromosome in 

spontaneous abortion cases 

Gülşah KOÇ 1 , Korkut ULUCAN *,1 , Deniz KIRAÇ 2 , Deniz ERGEÇ 1 , Tufan TARCAN 3 

and A. İlter GÜNEY 1 . 

1 Marmara University, Faculty of Medicine, Department of Medical Genetics, Istanbul, Turkey. 

2 Yeditepe University, Faculty of Medicine, Department of Biochemistry, Istanbul Turkey. 

3 Marmara University, Faculty of Medicine, Department of Urology, Istanbul, Turkey. 

(* author for correspondence; korkutulucan@hotmail.com) 

Received: 21 April 2010; Accepted: 05 May 2010 

Abstract 

Infertility is defined as not being able to get pregnant despite having frequent, unprotected sex for at least a year. 

Several conditions contribute to infertility and 50% is considered to be caused by a male-related factor. 

Spontaneous abortion (SAB) is noninduced embryonic or fetal death or passage of products of conception before 

the 20th week of pregnancy and is the most common complication of early pregnancy. SAB can occur by 

teratogenic factors, advanced maternal age, genetic factors such as Y chromosome microdeletions and 

chromosomal anomalies. In order to investigate the etiology of recurrent pregnancy loss (RPL) and to develop an 

appropriate therapeutic strategy, it is necessary to ascertain the molecular and cytogenetic basis of these defects. In 

this study, we aimed to reveal the relations between male infertility, Y chromosome microdeletions and SAB. 

Thirty couples with a spontaneous abortion history and thirty fertile men were recruited to the study. All the 

women were 46, XX and men were 46, XY. We couldn’t detect any Y chromosome microdeletion that could be the 

reason for SAB. In order to evaluate effect of chromosome anomalies and Y chromosome microdeletions on SAB, 

further studies with increased number of cases and controls need to be carried on. 

Keywords: Infertility, spontaneous abortion, Y chromosome microdeletions. 

Spontan düşük vakalarında Y kromozomunun moleküler ve sitogenetik incelemesi 

Özet 

Çiftlerin çocuk sahibi olma isteklerine ve düzenli cinsel ilişkiye rağmen, bir yıl içerisinde gebelik elde 

edilmemesine infertilite (kısırlık) adı verilmektedir. İnfertiliteye etki eden birçok faktör bulunmaktadır ve bunların 

%50’sinde etken erkek infertilitesidir. Gebeliğin ilk 20 haftası içinde, dışarıdan herhangi bir müdahale olmadan, 

doğal nedenlerle, embriyo veya fetus ve eklerinin tamamının veya bir kısmının uterus kavitesi dışına atılması 

olayına spontan düşük (abortus) denilmektedir ve gebeliğin erken döneminde en çok gözlenen komplikasyondur. 

Spontan düşükler, teratojenik faktörler, ileri anne yaşı gibi nedenlerin yanında, Y kromozomu mikrodelesyonları ve 

kromozomal anomaliler gibi genetik faktörlere bağlı olarak da oluşabilmektedir. Tekrarlayan gebelik kayıplarının 

etyolojisini belirlemek ve uygun bir tedavi yöntemi geliştirmek için bu defektlerin moleküler ve sitogenetik 

temellerinin incelenmesi gerekmektedir. Bu çalışmada, erkek infertilitesi, Y kromozom mikrodelesyonları ve 

spontan düşükler arasındaki ilişkinin ortaya çıkarılması amaçlanmıştır. Spontan düşük hikayesi bulunan 30 çift ve 

fertil 30 erkek çalışmaya dahil edilmiştir. Çalışmaya dahil olan bireylerin kromozom analizi sonuçlarına göre, tüm 

kadınlar 46,XX ve erkekler ise 46,XY‘dir. Çalışmamızda spontan düşüklere neden olabilecek herhangi bir Y 

kromozom mikrodelesyonu belirlenememiştir. Kromozom anomalilerinin ve Y kromozomu mikrodelesyonlarının 

spontan düşükler üzerindeki etkisinin değerlendirilebilmesi için vaka ve kontrol sayılarının arttırılarak başka 

çalışmalar yapılması gerekmektedir. 

Anahtar Sözcükler: İnfertilite, spontan düşük, Y kromozom mikrodelesyonu.

46 

Gülşah Koç et. al. 

Introduction 

Infertility is the inability of being pregnant after 

one year of unprotected sexual intercourse. 

Infertility comprises up to 15% of couples of 

reproductive age in which 50% is caused by a male 

factor (Noordam and Repping, 2006). Several 

factors contribute to male infertility, such as gene 

defects, hormonal milieu, chromosomal aberrations 

and genital infections (Stipoljev et al., 2006). 

Genetic factors are considered to affect almost 30% 

of severe male infertility cases (Noordam and 

Repping, 2006). The diagnosis of male infertility 

include anamnesis, physical examination, semen 

analysis, hormonal screening and genetic factors of 

somatic cells (Stipoljev et al., 2006). 

Spontaneous abortion (SAB) is the expulsion of 

an embryo or fetus due to accidental trauma or 

natural causes before approximately 22 nd week of 

gestation. It effects up to 15% clinically recognized 

pregnancies and considered to be the most common 

adverse outcome of pregnancy. Although several 

studies tried to explain the etiology of SAB, the 

results are still controversial. Beside the teratogenic 

factors and advanced maternal age, genetic factors 

such as Y chromosome microdeletions and 

chromosomal anomalies are considered to be the 

main reason of SAB (Dewan et al., 2006; Pryor et 

al., 1997). 

Y chromosome is essential not only for human 

sex determination but also for maintenance of sex 

cells and sex cell development. Y chromosome 

(Yq) microdeletions represent the most frequent 

molecular genetic cause of severe infertility, 

observed with a prevalence of 10-15% in nonobstructive 

azoospermia and severe oligozoospermia 

(Sinclair et al.,1990). The regions 

responsible for male infertility of Y chromosome 

are located on the long arm of chromosome and are 

termed as AZFa, AZFb, AZFc (AZF: Azoospermia 

Factor) ( Burgoyne, 1998) (Stouffs et al., 2009). 

The AZFa locus is located on proximal Yq11 

(Yq11.21), while AZFb and AZFc are located on 

distal Yq11 (Yq11.23). These AZF genes code 

RNA binding proteins and may be involved in the 

regulation of gene expression, RNA metabolism, 

RNA packaging and RNA transportation from 

nucleus to cytoplasm (Li et al., 2008). Deletions of 

these regions result in spermatogenic arrest and are 

associated with oligozoospermia, azoospermia and 

also with a extended testis histological profile range 

from Sertoli cell only (SCO), maturation arrest and 

hypospermatogenesis (Vollrath, 1992) (Vogt et al., 

1996) (Briton-Jones and Haines, 2000). 

The prevalence of the Y chromosome 

microdeletions in the proximal AZFc region was 

found higher in men from recurrent pregnancy loss 

(RPL) couples than from fertile or infertile couples. 

Although these patients are from a tertiary referral 

center that may not reflect the population 

informations, one may consider proximal AZFc 

region detecting in the evaluation of RPL couples 

when all other tests fail to reveal the etiology 

(Dewan et al., 2006). 

Before performing a molecular test, cytogenetic 

analysis is necessary for an accurate approach to 

elucidate the causes of spontaneous abortion. 

Chromosomal anomalies which may cause male 

infertility can be determined by cytogenetic 

techniques. It is also known that approximately 

50% of recurrent spontaneous abortions in the first 

trimester is caused by chromosomal anomalies. 

Besides these, recent data show that Y chromosome 

microdeletions can also be a major factor in these 

cases. These findings suggest a potential relation 

between RPL and microdeletions in AZF regions. 

In order to investigate the etiology of RPL and 

to develop an appropriate therapeutic strategy, it is 

necessary to ascertain the molecular and 

cytogenetic basis of these defects. So in this study, 

we aimed to reveal the relations between male 

infertility, Y chromosome microdeletions and 

recurrent spontaneous abortions. 

Material and methods 

Patient and Control Groups 

Thirty couples that applied to Marmara University, 

Department of Urology and Kartal Education and 

Research Hospital with a spontaneous abortion 

history were recruited to the study. Thirty fertile 

men, at least having one child, were examined as 

the control group. Written informed consent was 

taken from all cases. 

Chromosome Analyses from Peripheral Blood 

Cell Culture 

Lymphocytes from 400 µl peripheral blood were 

cultured for 72 hours at 37ºC culture medium 

containing 8.5 ml RPMI, 1.5 ml fetal bovine serum,

200 µl L-Glutamin, 20 µl penicillin- streptomycin 

and 200 µl phytohaemagglutinin. After incubation 

at 37ºC for 72 hours, 200 µl Colchicine was added 

to arrest the cells at metaphase. Following an 

additional incubation at 37ºC for 30 minutes and 

centrifugation at 20ºC for 8 min. at 1500 rpm the 

supernatant was removed. The pellet was resuspended 

with up to 10 ml hypotonic solution 

(0.4% KCl solution) vortexed immediately. All the 

samples were kept at 37ºC for 20 minutes and 

again centrifuged at the same condition. After 

removing supernatant from the samples, the pellet 

which contains cells at metaphase, was 

homogenised. Fixative solution (methanol and 

acetic acid mixed with 3:1 ratio) was added and the 

tubes were vortexed for the fixation of 

chromosomes. Then samples were centrifuged after 

adding up to 5 ml of fixative solution. Supernatant 

was discarded from the samples and fresh fixative 

solution was added to the tubes. This procedure 

was repeated until the samples were clarified. 

According to the cell density, up to 0.5 ml fixative 

solution was added to the samples. Then samples 

were homogenized and cells were lied onto slide 

glasses, which were kept at 4ºC in distilled water 

till they are used. After spreading the cells on the 

slides, the samples were dried at room temperature 

and kept overnight at 60ºC. 


Karyotyping 

GTG (Giemsa-Trypsin) banding technique was 

performed. When the banding of the chromosomes 

was not successful, the protocol was repeated. 

After staining, at least 20 metaphase plaques were 

analysed for each sample (Figure 1). 

Detection of Y chromosome microdeletions 

DNA isolation from blood 

DNA was extracted from 200 µl peripheral blood by 

using High Pure PCR Template Preparation Kit 

(Roche-Germany) according to the manufacturer’s 

protocol. 

Multiplex polymerase chain reaction 

(multiplex PCR) 

Table 1. Primers used for multiplex PCR and the length of amplicons. 

MIX1 Amlicon 

length (bp) 

MIX2 Amlicon 

length (bp) 

For detection of Y chromosome microdeletions, 

isolated DNA was amplified by multiplex PCR. AB 

ANALITICA–The AZF Extension Kit, which is 

recommended by European Andrology Association 

was used in multiplex PCR. By using this kit, 13 

different regions could be investigated at the same 

time by performing 3 multiplex PCRs for each 

sample. Three primer sets, each containing primers 

that is unique to ZFX/Y locus which also exist in X 

chromosome are shown in Table 1. 

MIX3 Amlicon 

length (bp) 

ZFX/Y 495 ZFX/Y 495 DBY 689 

SRY 472 SRY 472 ZFX/Y 495 

sY 254 380 sY 95 303 SRY 472 

sY 86 320 sY 117 262 sY 84 326 

sY 127 274 sY 125 200 sY 134 301 

sY 255 120 DFFRY 155 

47

48 


In addition to the mixtures which are found in 

the AZF Extension Kit, 0.3µl Taq DNA polymerase 

and 8µl DNA sample were added to each tube 

during multiplex PCR. The conditions of PCR 

amplification were as follows: a denaturation step at 

94˚C for 5 min followed by 35 cycles at 94˚C for 1 

min, 60˚C for 1 min, 72˚C for 1 min and a final 

extension at 72˚C for 7 min and stop at 4˚C. After 

multiplex PCR, products were electrophoresed on 

2% agarose gel. 

Results 

Karyotyping 

Figure 1. Karyotype analyses of a male (46, XY) patient. 

After performing lymphocyte cell culture, 

metaphase plaques were analyzed for the detection 

of karyotypes of patient and control groups. 

According to karyotype analyses, all the males and 

females were found as 46, XY and 46, XX 

respectively in the patient group, whereas all the 

males were found as 46, XY in the control group 

(Figure 1). 

Detection of Y chromosome microdeletions 

After multiplex PCR, PCR products were examined 

by electrophoresis on 2% agarose gel. Y 

chromosome microdeletions were not found in 

patient and control groups.


Figure 2. Multiplex PCR analyses of Y chromosome microdeletions (M: 50 bp ladder (Fermentas, 

Germany); Mix1a, Mix1b and Mix1c: 3 sets of PCR reactions that amplify different loci on Y chromosome 

for sample a; Mix1b, Mix2b, Mix3b for sample b; boxes indicate the region and the length of the amplicons. 

Discussion 

Chromosomal abnormalities, including translocations 

and deletions, are higher in infertile men and 

are recognized as one of the main causes of 

spontaneous abortions with an estimated frequency 

of 50–70% (Svetlana et al., 2005) 

In couples experiencing RPL, the incidence of 

chromosomal translocations is higher than the 

incidence present in newborn series (De Braekeleer 

and Dao 1991). There is also evidence which 

indicates that the presence of translocations 

changes the spermatogenic process. It has been 

found that the incidence of reciprocal translocation 

carriers is seven times more than in newborn series. 

As a general rule reciprocal translocation carriers 

produce more unbalanced sperm than normal or 

balanced sperm. The proportion of unbalanced 

forms depends on the characteristics of the 

reorganization. Also deletions which remove Y 

chromosomal genes required for spermatogenesis 

may effect infertility and susceptibility of RPL 

(Byrne and Ward, 1994) (Simpson, 1981). As the 

severity of the spermatogenic defect increases, the 

frequency of the microdeletions also increases. 

In this study, primarily, cytogenetic evaluation 

was performed from peripheral blood samples of 

the couples in spontaneous abortion cases. 30 

couples who had a spontaneous abortion history 

were karyotyped to detect the chromosome 

anomalies. According to karyotype analyses, all the 

women and men were found to be 46, XX and 46, 

XY, respectively. In our study we couldn’t detect 

any numerical and structural chromosome 

anomalies that can be detected by karyotype 

analyses. Other genetic abnormalities such as Y 

chromosome microdeletions may effect spermatogenesis, 

fertilization and post-zygotic metabolism 

and may influence male infertility and RPL. 

49

50 


So we used multiplex PCR for the detection of 

microdeletions on the long arm of the Y 

chromosome. 

In this study, “AB ANALITICA–The AZF 

Extension Kit” used for the analysis of 

microdeletions rather than AZF-MX Extension kit. 

Diagnostic sensitivity is considered to be the 

capacity of the device to correctly identify the 

deleted samples with reference to AZF locus under 

investigation. The results obtained from an 

experimental investigation show that the diagnostic 

sensitivity of the system is 100%. 

The kit is in premix format as all the reagents 

for the amplification are pre-mixed and aliquoted in 

single dose tubes in which only additional Taq 

polymerase and the extracted DNA should be 

added. This premix format allows the reduction of 

the manipulation in preamplification steps, with 

considerable time saving for the operator, the 

repeated freezing/thawing of reagents (that could 

alter the products’ performances) is avoided and, 

above all, this form minimizes the risk of sample 

contamination and the risk of false positive results. 

The amplified regions of the Y chromosome are 

not polymorphic and are well known to be deleted 

specifically in men affected by oligo/azoospermia 

according to the known, clinically relevant 

microdeletion pattern (Viswambharan, 2007). 

Based on the experience of many laboratories and 

the results of external quality control and 

considering the multiplex PCR format, the first 

choice of STS primers recommended in the first 

version of the guidelines remains basically valid. 

These primers include the regions: 

For AZFa: sY84, sY86 

For AZFb: sY127, sY134 

For AZFc: sY254, sY255 

The usage of this primer set will enable the 

detection of almost all the clinically relevant 

deletions and of over 95% of the deletions reported 

in the literature in the three AZF regions and is 

sufficient for routine analysis (Simoni, 2004). 

In this study, the set of PCR primers as best 

choice for the diagnosis of microdeletion of the 

AZFa, AZFb and AZFc region (sY14 (SRY), 

ZFX/ZFY, sY84, sY86, sY127, sY134, sY254, 

sY255) used in multiplex PCR reactions. We 

couldn’t detect any Y chromosome microdeletions 

in AZFa, AZFb and AZFc regions. 

Genes that are located on Y chromosome and 

responsible from spermatogenesis have a mosaic 

structure at somatic and/or germ cells. When 

leukocytes from blood were used, usually the 

results can not be suitable for Y chromosome 

microdeletion analysis because there may have 

been deletions in germ cells (Martin, 2008). 

There may be a mosaicism between 

seminiferous tubules in terms of the expression of 

genetic material. Some seminiferous tubules have 

aplasia whereas some tubules can be normal or 

mutant arrest at testes. In the identification of 

deletions this situation may show different 

outcomes when cells from blood or semen were 

used. When fibroblasts or leukocytes are used in 

genetic analysis, the proportion of a detection of Y 

chromosome microdeletion is slightly low because 

the deletions occuring in germ line cells have an 

independent nature from other tissues. 

In this study, we used peripherial blood 

leukocytes for the detection of Y chromosome 

microdeletions, however we couldn’t find any 

deletions. But the possibility of having deletions in 

germline cells shouldn’t be omitted. We are looking 

forward to extend our study by adding spermial Y 

chromosome microdeletion analysis from the same 

individuals. 

Dewan et al. (2006) reported the relation 

between RPL and proximal AZFc deletions and 

found a significant correlation. Although, they 

detected proximal Y chromosome AZFc 

microdeletions in 14 of 17 patients (82%), they 

couldn’t find any deletion in control group. 

Karaer et al. (2008) reported 43 infertile men 

among which 7 of them have sY 220 (AZFb) 

deletions (16%) of the 4 examined region, stating 

the importance of AZF deletions in the aetiology of 

RPL. 

In the previous studies, sequenced tagged site 

(STS) numbers which were selected for detection 

of Y chromosome microdeletions are different from 

each other. After physical mapping of Y 

chromosome, more than 300 STS were produced. It 

was stated that, analysing of low number of STS 

can be insufficient for detection of deletion regions 

also high number of STS can give false-positive 

results as polymorphic regions may identified as 

deletions (Simoni, 2001). 

One of the most important criteria for the 

detection of Y chromosome microdeletions is the 

selected STS. For this reason, European Andrology 

Association and European Molecular Genetics

Quality Network improved a standardization to 

distinguish the differences of deletion proportions 

between different laboratories. So they proposed 6 

STS for detecting of AZFa, AZFb ve AZFc regions. 

In the present study, although 13 STS including 6 

STS which were suggested by European Molecular 

Genetics Quality Network were analyzed, we 

couldn’t detect any microdeletions on Y 

chromosome. We propose the evolution of the 

results by increasing the analysed STS. 

Due to limited knowledge of the metabolism 

and the progress of the genes on Y chromosome, 

we can not predict the answers of the questions 

including Y chromosome microdeletion’s effect on 

RPL. For this reason researches should be focused 

on the relationship of Y chromosome microdeletions, 

male infertility and RPL. 

References 

Briton-Jones C, Haines CJ. Microdeletions on the 

long arm of the Y chromosome and their 

association with male-factor infertility. HKMJ 

6: 184-9, 2000. 

Burgoyne PS. The mammalian Y chromosome: A 

new perpective. Bioassays, 20:3636, 1998. 

Byrne J.L.B, Ward K. Genetic Factors in Recurrent 

Abortion. Clinical Obstetircs and Gynecology, 

37 (3): 693-704, 1994. 

De Braekeleer M, Dao TN. Cytogenetic studies in 

male infertility: a review. Hum Reprod. 6:245- 

50, 1991. 

Dewan S, Puscheck EE, Coulam CB, Wilcox AJ, 

Jeyendran RS. Y-chromosome microdeletions 

and recurrent pregnancy loss Andrology 

Laboratory Services Inc., Chicago, Illinois, 

USA. Fertil Steril.;85(2):441-5, 2006. 

Genetics and male infertility. Verh K Acad 

Geneeskd Belg.; 71(3):115-39. Review. Dutch., 

2009. 

Karaer A, Karaer K, Ozaksit G, Ceylaner S, Percin 

EF. Y chromosome azoospermia factor region 

microdeletions and recurrent pregnancy loss. 

Am J Obstet Gynecol.;199(6):662.e1-5, 2008. 

Li Z., Haines CJ., HanY. Micro-deletions of the 

human Y chromosome and their relationship 

with male infertility. J. Genet. Genomics 35, 

193−199, 2008. 


Martin R.H. Cytogenetic determinants of male 

fertility. Human Reproduction Update, 14 (4): 

379-390, 2008. 

Noordam M.J., Repping S. The human Y 

chromosome: a masculine chromosome, Current 

Opinion in Genetics & Development, 16: 225- 

232, 2006. 

Pryor JL, Kent-First M, Muallem A. Prospective 

analysis of Y chromosome microdeletions in 

200 consecutive male infertility patients. N Engl 

J Med 336: 534-539, 1997 

Simoni M. Molecular diagnosis of Y chromosome 

microdeletions in Europa: state-of-the-art and 

quality control. Human Reprod, 16(3): 402-409, 

2001. 

Simoni M., Bakker E., Krausz C. EAA/EMQN 

best practice guidelines for molecular diagnosis 

of y-chromosomal microdeletions. international 

journal of andrology, 27:240–249, 2004. 

Simpson J.L. Antenatal Diagnosis of Cytogenetics 

Abnormalities. Clinical Obstetrics and 

Gynecology, 24: 1024-1039, 1981 

Sinclair AH, Berta P, Palmer MS, Hawkins JR, 

Griffits BL, Smith MJ. A gene from the human 

sex-determining region encodes a protein with 

homology to a conserved DNA-binding motif. 

Nature, 346:240-4, 1990. 

Stipoljev F., Vujisic S., Parazajder J., Hafner D., 

Jezˇek D., Sertic J. Cytogenetic analysis of 

azoospermic patients: karyotype comparison of 

peripheral blood lymphocytes and testicular 

tissue European Journal of Obstetrics & 

Gynecology and Reproductive Biology 124 

197–203, 2006. 

Stouffs K, Vandermaelen D, Tournaye H, Liebaers 

I, Van Steirteghem A, Lissens W. 

Svetlana G. Vorsanova, Alexei D. Kolotii, Ivan Y. 

Iourov, Viktor V. Monakhov, Elena A. 

Kirillova, Ilia V. Soloviev, and Yuri B. Yurov. 

Evidence for High Frequency of Chromosomal 

Mosaicism in Spontaneous Abortions Revealed 

by Interphase FISH Analysis Journal of 

Histochemistry & Cytochemistry. 53(3): 375- 

380, 2005. 

Viswambharan N, Suganthi R, Simon A M, 

Manonayaki S. Male infertility: polymerase 

chain reaction-based deletion mapping of genes 

on the human chromosome. Singapore Med J; 

48 (11): 1140.2007. 

51

52 


Vogt, PH, Edelman A, Kirsch S, Henegariu O, 

Hirschmann P, Keisewetter. Human Y 

chromosome azospermic factors (AZF) mapped 

to different subregions in Yq11. Hum Mol 

Genet 5: 933-45, 1996. 

Vollrath D, Foote S, Hilton A. The human Y 

chromosome: A 43 interval map based on 

naturally occuring deletions. Science. 258:52-9, 

1992.




Do simple sequence repeats in replication, repair and recombination 

genes of mycoplasmas providing genetic variability? 

Seema TRIVEDI 

Computational Biology Lab., Department of Zoology, JN Vyas University, Jodhpur 

(Rajasthan), India 

(author for correspondence; svtrived@hotmail.com) 

Received: 25 December 2009; Accepted: 14 May 2010 

Abstract 

Simple sequence repeats (SSRs) or microsatellites are mono to hexa-nucleotide tandem repeats of DNA that 

are ubiquitous in intergenic regions and coding regions of genomes. SSRs may be essential for any genome 

as these repeats are found even in organisms like mycoplasmas (class Mollicutes) that have small genome 

size. Mollicutes cause different diseases in vertebrates including humans, insects and plants. Antibiotics have 

been developed against membrane proteins and replication related proteins like gyrase and topoisomerase. 

However, some pathogens have developed immunity against these drugs. Mycoplasmas can evade host 

immune response in which SSRs variations in membrane proteins play an important role. The present study 

seeks presence of di- to penta-nucleotide repeats in genes associated with DNA replication, repair and 

recombination in thirteen mycoplasma genomes. Association of SSRs with these genes may have potential to 

provide variability for evading antibiotics against replication, repair and recombination proteins. In the 

present study SSRs are present in few genes but among the repeats found, maximum repeats are present in 

methylase, DNA polymerase, excinuclease and topoisomerase genes. Maximum number of repeat types are 

dinucleotides but present only in M. pulmonis. Pentanucleotide repeats are present in three mycoplasmas but 

tetranucleotide repeats are present in eight mycoplasmas. 

Keywords: Microsatellites, Mycoplasma, repair, replication, simple sequence repeats 

Mikoplazmanın replikasyon, tamir ve rekombinasyon genlerindeki basit dizi tekrarları 

genetik çeşitlilik mi sağlıyor? 

Özet 

Basit dizi tekrarları (SSR) veya mikrosatelitler, genomun intergenik bölgelerinde ve kodlanan bölgelerinde 

sıkça rastlanan, DNA’nın birden (mono) altıya (hekza) kadar ard arda gelen nükleotit tekrarlarıdır. Bu 

tekrarlar mikoplazma (Mollicutes sınıfı) gibi küçük genom büyüklüğüne sahip bir organizmada bile 

bulunduğundan, SSR’ler herhangi bir canlı için elzem olabilir. Mollicutes, insan, böcek ve bitkileri de içeren 

omurgalılarda çeşitli hastalıklara yol açarlar. Zar proteinlerine ve giraz, topoizomeraz gibi replikasyonla 

alakalı proteinlerine karşı antibiyotikler geliştirilmiştir. Ancak, bazı patojenler bu ilaçlara karşı bağışıklık 

kazanmışlardır. Zar proteinlerindeki SSR varyasyonlarının mikoplazmaların konakçı hücrenin bağışıklık 

tepkisinden kaçmalarında önemli bir rolü olabilir. Bu çalışma, onüç mikoplazma genomunda DNA 

replikasyonu, tamiri ve rekombinasyonu ile ilgili genlerdeki ikiliden (di-) beşliye (penta-) kadar olan 

nükleotit tekrarlarını araştırır. Bu genlerin SSR’ler ile ilişkisi, replikasyon, tamir ve rekombinasyon 

proteinlerine karşı geliştirilen antibiyotiklerden kaçmaları için çeşitlilik sağlamada potansiyele sahip olabilir. 

Bu çalışmada, SSR’ler birkaç gende mevcuttur, ama bulunan tekrarlar arasında en fazla tekrar metilaz, DNA 

polimeraz, ekzinükleaz ve topoizomeraz genlerinde vardır. Tekrar tiplerinden en fazla sayıda bulunanlar 

dinükleotitlerdir ancak sadece M. Pulmonis’de bulunur. Pentanükleotit tekrarları üç mikoplazmada, ama 

tetranükleotit tekrarları sekiz mikoplazmada mevcuttur. 

Anahtar Sözcükler: Mikrosatelitler, mikoplazma, tamir, replikasyon, basit dizi tekrarları

54 

Seema TRIVEDI 

Introduction 

Simple sequence repeats (SSRs) or microsatellites 

are mono to hexa-nucleotide tandem repeats of 

DNA that are ubiquitous in all genomes studied 

so far. SSRs are present not only in intergenic 

regions of a genome, but may also be found in 

introns and exons of coding regions (Karlin et al., 

1997; Bachtrog et al., 1999; Bachtrog et al., 2000; 

Butcher et al., 2000; Chambers and MacAvoy, 

2000; Toth et al., 2000). It is possible that SSRs 

are essential part of any genome as these repeats 

are present even in organisms like mycoplasmas 

that have small genome size (Hancock, 1996a). 

These repetitive DNA may be involved in 

different functions like chromatin organization, 

gene regulation, evading host-immune responses, 

recom bination hotspots and facilitating genome 

rearrangements, affecting protein structure thus 

possibly protein-protein interactions etc. (Mrázek, 

2006). Interestingly, it has also been found that 

SSRs may provide variability to host for evading 

pathogens. This is reported in case of house 

finches (Carpodacus mexicanus) that show 

multilocus heterozygosity that could result in 

reduced susceptibility to Mycoplasma 

gallisepticum infection (Hawley et al., 2005). 

Similarly, Porcine C3 gene (high homology with 

human C3) involved in phagocytosis, inflamema 

tion and immunoregulation to destroy infectious 

micro-organisms, possess Tn SSR in the 

3’flanking region which may be helpful in 

resisting infections (Mekchay et al., 2003). 

Mycoplasmas (class Mollicutes) are parasites 

or commensals that may cause different diseases 

in vertebrates including humans, insects and 

plants. Repetitive sequences like RepMp and 

MgPar elements are involved in homologous 

recombination of parts of P1, P40, P90 and P110 

proteins of Mycoplasma pneumoniae and Myco 

plasma genitalium. Recombination events 

mediated with help of MPN490- and MG339encoded 

proteins (RecA homo logs) in genes of 

immunogenic adhesion proteins result in 

variations that may play eminent roles in immune 

evasive strategies (Sluijter et al., 2009). Repeated 

sequences, DR-1 and DR-2, within the putative 

cytadhesin pvpA gene of M. gallisepticum are 

present in isolates from Chinese poultry farms. 

Approximately 30 or more proline residue repeats 

and 7-10 repeats of the tetrapeptide motif may 

affect functionality of PvpA as an adhesin molecule 

(Jiang et al., 2009). Similarly, insertion sequences 

(IS3, IS4 and IS30) in Mycoplasma bovis 

(Lysnyansky et al., 2009) and variable-number 

tandem-repeats (VNTRs) associated with coding 

sequences that can provide genetic diversity are 

present in Mycoplasma hyopneumoniae strains, 

Mycoplasma agalactiae type strain PG2, 

Mycoplasma mycoides subspecies mycoides. These 

IS and VNTRs possibly code for amino acid repeats 

and can affect cell adhesion and interactions with the 

host immune system (de Castro et al., 2006; 

McAuliffe et al., 2007; McAuliffe et al., 2008). 

Tandem amino acid repeats in M. pneumoniae 

RepMP1-containing genes and Myco plasma 

pulmonis Vsa proteins may have regulatory functions 

(Simmons and Dybvig, 2007; Musatovova et al., 

2008). Amino acid repeats that may affect antigenic 

response are present in haemagglutinins (immuno 

genic, variably expressed, surface proteins) of M. 

synoviae (VlhA) (Bencina, 2002). 

Though SSRs have been investigated in 

mycoplasmas, the focus of studies has not been 

replication, repair and recombination genes. This 

study was undertaken to seek answer to questions 

like whether replication, repair and recombination 

genes in mycoplasmas are associated with SSRs. 

How can SSRs association with these genes be 

beneficial to these organisms? The present study on 

SSRs in replication, repair and recombination genes 

in thirteen mycoplasmas may indicate mutational 

hotspots that may help these organisms evade 

antibiotics against these genes. On the other hand, 

these mutational hotspots may prove to be target sites 

for developing drugs to prevent such evasive 

strategies of the organisms. 

Method 

Obtaining sequences and genome information 

Replication, repair and recombination related gene 

sequences (total numbers given in Table-1) of 

thirteen myco plasmas (Mycoplasma arthritidis 

158L3-1, Mycoplasma capricolum subsp capricolum 

California kid ATCC 27343, Mycoplasma 

gallisepticum strain R, Mycoplasma genitalium G-37, 

Mycoplasma hyopneumoniae 232, Mycoplasma 

hyopneumoniae 7448, Mycoplasma hyopneumoniae 

J, Mycoplasma mobile 163K, Mycoplasma mycoides 

SC PG1, Mycoplasma penetrans HF-2, Mycoplasma 

pneumoniae M129, Mycoplasma pulmonis UAB

CTIP and Mycoplasma synoviae 53) were 

downloaded from “The Comprehensive Microbial 

Resource” (CMR http://cmr.jcvi.org/cgi-bin/ 

CMR/CmrHomePage.cgi). Total genome length, 

CG richness, coding percentage and number of 

Table 1. List of mycoplasmas and genome details 

Organism 

Genome 

length 

nt 

Genome 

CG% 

Coding 

% 

SSRs in Mycoplasma replication genes 

protein coding genes for each Mycoplasma were 

downloaded from NCBI (http://www.ncbi.nlM. 

nih.gov/sites/entrez?db=genome&cmd=Retrieve&do 

pt=Overview&list_uids=) (Table 1). 

Total 

protein 

genes 

Total 

replication 

and repair 

genes 

% of 

genes 

with 

repeats 

Mycoplasma 

arthritidis 158L3-1 820453 30 88 631 32 3.13 

Mycoplasma 

capricolum subsp 

capricolum California 

kid ATCC 27343 

Mycoplasma 

1010023 23 88 812 45 8.89 

gallisepticum strain R 

Mycoplasma 

996422 31 87 726 30 3.33 

genitalium G-37 

Mycoplasma 

580076 31 90 475 28 3.57 

hyopneumoniae 232 

Mycoplasma 

892758 28 89 691 34 2.94 

hyopneumoniae 7448 

Mycoplasma 

920079 28 85 657 35 2.86 

hyopneumoniae J 

Mycoplasma mobile 

897405 28 87 657 34 2.94 

163K 

Mycoplasma mycoides 

777079 24 90 633 39 5.13 

SC PG1 

Mycoplasma penetrans 

1211703 23 81 1016 51 1.96 

HF-2 

Mycoplasma 

1358633 25 88 1037 76 2.63 

pneumoniae M129 

Mycoplasma pulmonis 

816394 40 87 689 36 5.56 

UAB CTIP 963879 26 89 782 53 9.43 

Mycoplasma synoviae 

53 799476 28 88 659 36 8.33 

55

56 

Seema TRIVEDI 

SSR search 

Replication, repair and recombination related 

gene sequences of all thirteen mycoplasmas were 

subjected to repeat search programme SPUTNIK 

(http://espressosoftware.com/sputnik/index.html). 

SPUTNIK looks for di-, tri-, tetra- and pentanucleotide 

repeats; tolerates insertions, mismatch 

es and deletions but these affect the overall score. 

Repeats found through this search were not 

grouped i.e. the 5’ to 3’ or vice-a versa and the 

complements were not put together. For example, 

dinucleotide repeat CA was not grouped with AC, 

TG or GT. Hence, each repeat was treated as 

separate motif. 

SSR CG richness and length 

Length of an SSR was measured in nucleotides 

(base pairs). However, repeat length given as 

output from SPUTNIK was adjusted to nearest 

divisible value i.e. dinucleotide repeat length 

should be divisible by 2, trinucleotide by 3, 

tetranucleotide repeat by 4 and pentanucleotide 

repeat by 5. For example, if repeat length for 

dinucleotide repeats was indicated as 11nt by 

SPUTNIK output; this was adjusted to 10nt, for 

trinucleotide repeats if the length was 14nt it was 

adjusted to 15nt or if it was 16nt or 17nt it was 

considered as 15nt. 

Statistical analysis 

For statistical analysis, SPSS (Version 16.0) was 

used. One way ANOVA followed by Tukey’s 

HSD at 95% confidence level was done to seek 

significant difference in between the thirteen 

species repeat number as well different replica 

tion, repair and recombination genes. 

Pearson’s ‘r’ two tailed correlation analysis of 

genome size and CG richness, sequence lengths 

of replication, repair and recombination genes and 

CG richness vis-à-vis repeat numbers, length and 

. 

CG richness of total repeats and repeat types was 

done. 

Results 

Total SSRs, repeat types and motifs in thirteen 

mycoplasmas replication, repair and recombination 

genes 

Figure 1 shows total numbers of SSRs and repeat 

types present in replication, repair and recombination 

genes in genomes of thirteen mycoplasmas where M. 

pulmonis has the maximum number of repeats 

followed by M. capricolum and M. synoviae (5, 4 

and 3 respectively). 

Among repeat types, dinucleotides (five) are 

present only in M. pulmonis. Maximum numbers of 

tri nucleotides are in M. capricolum. Presence of 

other repeat types in replication, repair and 

recombination genes of mycoplasmas are given in 

Figure 1. 

There is diversity in repeat motifs found in the 

present study among which maximum frequency 

(four) is of tetranucleotide repeat ATTT followed by 

dinucleotide repeat motifs AG (Table-2). 

Total replication, repair and recombination genes 

associated with SSRs in mycoplasmas 

Methylase genes have maximum number of total 

repeats (eight) followed by DNA polymerase, 

excinuclease and topoisomerase genes (three in each) 

among replication, repair and recombination genes in 

thirteen mycoplasmas (Figure 2). Among repeat 

types total dinucleotide followed by tetra nucleotide 

repeats as well as the motifs AG and ATTT have 

maximum frequency (all in methylase genes) 

(Figures 2 and 3). 

Comparison of total repeats and repeat types in 

replication, repair and recombination genes of each 

Mycoplasma is given in Figure 4 and motifs in Table 

3, where once again methylase genes in M. pulmonis 

have maximum repeats.


Figure 1. Total SSRs and SSR types in thirteen mycoplasmas replication, repair and recombination genes. 

Di: Dinucleotides, Tri: Trinucleotides, Tetra: Tetranucleotides, Penta: Pentanucleotides, Total: Total Repeats. 

Figure 2. Total SSRs and SSR types in total replication, repair and recombination genes of mycoplasmas. Di: 

Dinucleotides, Tri: Trinucleotides, Tetra: Tetranucleotides, Penta: Pentanucleotides, Total: Total Repeats. 

57

58 

Seema TRIVEDI 

Table 2. SSR motifs and motif numbers in total replication, repair and recombination genes of thirteen 

mycoplasmas. Di: Dinucleotide, Tri: Trinucleotide, Tetra: Tetranucleotide, Penta: Pentanucleotide. 

Repeat 

Name 

Di 

Tri 

Tetra 

Penta 

Length of repeats 

Organism Motifs 

AG CA GA 

M. pulmonis 3 1 1 

Grand Total 3 1 1 

AAG AAT AGA GAA TGA TGT 

M. arthritidis 1 

M. capricolum 1 1 1 

M. mobile 1 

M. penetrans 1 

M. synoviae 1 

Grand Total 1 2 1 1 1 1 

AATT ATTT TTTA TTTC 

M. capricolum 1 

M. genitalium 1 

M. hyopneumoniae 232 1 


M. hyopneumoniae J 1 

M. mobile 1 

M. mycoides 1 

M. penetrans 1 

Grand Total 1 4 2 1 

AAAAT AAAGC AATTG ACCAA CAAAC 

M. gallisepticum strain R 1 

M. pneumoniae 1 1 

M. synoviae 1 1 

Grand Total 1 1 1 1 1 

Repeats in thirteen mycoplasmas are not very 

long as maximum repeat lengths are 28nt and 

26nt which are in methylase genes (dinucleotide 

CA and GA respectively in M. pulmonis) 

followed by 24nt which are in methylase and 

gyrase genes (dinucleotide AG in M. pulmonis 

and trinucleotide AAG in M. arthritidis 

respectively) (Figure 5 and Table 4). 

CG richness of SSRs 

There is variation (0% to 50%) in CG richness of 

SSRs in replication, repair and recombination genes 

of mycoplasmas (Table 5). CG% differs in the same 

gene group among different Mycoplasma. For 

example, DNA polymerase shows different CG 

richness in different Mycoplasma (0% in M. 

synoviae, 33.33% in M. mobile and 40% in M. 

pneumoniae).


Figure 3. SSR motifs in total replication, repair and recombination genes in mycoplasmas. legends represent 

the motifs as per the bar chart. 

59

60 

Seema TRIVEDI 

Figure 4. Total SSRs and SSR Types In Replication, Repair and Recombination Genes In Thirteen Mycoplasmas. Di: Dinucleotides, Tri: 

Trinucleotides, Tetra: Tetranucleotides, Penta: Pentanucleotides, Total: Total Repeats.


Table 3. Number of SSR motifs in replication, repair and recombination genes of thirteen 

mycoplasmas. 

Organism Motif 

Conserved 

Hypothetical Protein 

DNA Polymerase 

Endonuclease 

Excinuclease 

M. arthritidis AAG 1 

Gyrase 

Ligase 

Methylase 

Methyltransferase 

P35 Lipoprotein 

Homolog 

AGA 1 

M. capricolum 

TGA 

TGT 1 

1 

TTTA 1 

M. gallisepticum ACCAA 1 

M. genitalium AATT 1 

M. hyopneumoniae 232 ATTT 1 

M. hyopneumoniae 7448 ATTT 1 

M. hyopneumoniae J ATTT 1 

M. mobile 

GAA 

ATTT 

1 

1 

M. mycoides TTTA 1 

M. penetrans 

AAT 

TTTC 1 

1 

M. pneumoniae 

AAAGC 

CAAAC 1 

1 

AG 3 

M. pulmonis 

CA 1 

GA 1 

AAT 1 

M. synoviae 

AAAAT 1 

AATTG 1 

Replication Initiator 

SSBP 

Topoisomerase 

61

62 

Seema TRIVEDI 

Figure 5. Lengths of total SSRs and SSR type in total replication, repair and recombination genes of mycoplasmas. SSR lengths in 

number of nucleotides (nt).


Table 4. Repeat lengths (nt) in total SSR types and SSR motifs in replication, repair and recombination genes 

of thirteen mycoplasmas. Di: Dinucleotides, Tri: Trinucleotides, Tetra: Tetranucleotides, Penta: 

Pentanucleotides, Total: Total Repeats. 

. 

Gene Organism SSR Motif 

SSR 

Length 

Conserved Hypothetical Protein M. synoviae Penta AATTG 10 

DNA Polymerase 

M. mobile Tri GAA 12 

M. pneumoniae Penta CAAAC 10 

M. synoviae Tri AAT 12 

Endonuclease M. penetrans Tetra TTTC 12 

Excinuclease 

M. capricolum Tri AGA 12 

M. pneumoniae Penta AAAGC 15 

M. synoviae Penta AAAAT 10 

Gyrase M. arthritidis Tri AAG 24 

Ligase M. genitalium Tetra AATT 12 

Methylase 

M. hyopneumoniae 232 Tetra ATTT 12 

M. hyopneumoniae 7448 Tetra ATTT 12 

M. hyopneumoniae J Tetra ATTT 12 

M. pulmonis Di GA 26 

CA 28 

14 

AG 16 

24 

Methyltransferase M. mobile Tetra ATTT 12 

P35 Lipoprotein Homolog M. penetrans Tri AAT 18 

Replication Initiator M. capricolum Tri TGT 12 

SSBP M. capricolum Tri TGA 12 

Topoisomerase 

M. capricolum Tetra TTTA 12 

M. gallisepticum Penta ACCAA 10 

M. mycoides Tetra TTTA 12 

63

64 

Seema TRIVEDI 

Table 5. CG richness of SSRs and motifs in replication, repair and recombination genes in thirteen 

mycoplasmas. Di: Dinucleotide, Tri: Trinucleotide, Tetra: Tetranucleotide, Penta: Pentanucleotide 

SSR 

CG% 

0 

Gene Name Repeat Motif Organism 

SSR 

Number 

DNA Polymerase Tri AAT M. synoviae 53 1 

Excinuclease Penta AAAAT M. synoviae 53 1 

Ligase Tetra AATT M. genitalium G-37 1 

Methylase Tetra ATTT M. hyopneumoniae 232 1 


M. hyopneumoniae J 1 

Methyltransferase Tetra ATTT M. mobile 163K 1 

P35 Lipoprotein 

Homolog 

Tri AAT 

M. penetrans HF-2 1 

Topoisomerase Tetra TTTA M. capricolum 1 

M. mycoides 1 

20 Conserved 

Hypothetical Protein 

Penta AATTG 

M. synoviae 53 1 

25 Endonuclease Tetra TTTC M. penetrans HF-2 1 

33.33 DNA Polymerase Tri GAA M. mobile 163K 1 

Excinuclease Tri AGA M. capricolum 1 

Gyrase Tri AAG M. arthritidis 158L3-1 1 

Replication Initiator Tri TGT M. capricolum 1 

40 

SSBP Tri TGA M. capricolum 1 

DNA Polymerase Penta CAAAC M. pneumoniae M129 1 

Excinuclease Penta AAAGC M. pneumoniae M129 1 

Topoisomerase Penta ACCAA M. gallisepticum strain R 1 

50 Methylase Di AG M. pulmonis 3 

CA M. pulmonis 1 

Discussion 

SSRs in genomes of virus, prokaryotes and 

eukaryotes are present not only in intergenic 

regions but also in introns and exons of coding 

sequences (Hancock, 1996a and b; Karlin et al., 

1997; Bachtrog et al., 1999; Bachtrog et al., 2000; 

Butcher et al., 2000; Toth et al., 2000; Trivedi, 

2003, 2004, 2006; Mrázek et al., 2007). Studies in 

different genomes have also shown associations 

GA M. pulmonis 1 

of SSRs with replication, repair and recombination 

genes, housekeeping genes or membrane proteins 

(Trivedi, 2003; Mrázek et al., 2007; Guo and 

Mrázek, 2008). Antigenic variations facilitated by 

SSRs in host-adapted pathogens like mycoplasmas 

have been reported (Guo and Mrázek, 2008). 

However, studies have so far not focused on

association of SSRs with replication, repair and 

recombination genes. 

Total repeats 

Mycoplasmas have small genomes possibly due 

to genome reduction. It is possible that some 

SSRs may have played a role in Mycoplasma 

evolution (Hancock, 1996a; Rocha and 

Blanchard, 2002) which could be due to 

mutational bias towards SSR reduction instead of 

expansion if not maintained by selection (Metzgar 

et al., 2002). 

The present study shows few repeats in total 

replication, repair and recombination genes which 

corresponds to studies in whole genome studies 

on mycoplasmas (Mrázek et al., 2007) but with 

some differences from the reported number of 

repeats in these genes in M. hyopneumoniae (Guo 

and Mrázek, 2008). This difference is possibly 

due to difference in the algorithms used in the 

present study and the analysis criteria. ANOVA 

does not show any significant difference between 

the thirteen mycoplasmas nor between genes of 

each Mycoplasma in the present study. Besides 

this, present study does not show any correlation 

of genome length with any parameter as indicated 

in the material and method section. This is 

consistent with some studies (Hancock, 2002; 

Lim et al., 2004) but contrary to studies done 

earlier in eukaryotes and prokaryotes (Hancock, 

1996b; Primmer et al., 1997; Achaz et al., 2002; 

Trivedi, 2004 and 2006; Mrázek et al., 2007). 

Though the focus of present study is on specific 

genes, this lack of correlation of genome size may 

indicate confirmation of the fact that genome size 

is not expanding and possibly SSRs (in total 

genomes) that are so few in number are playing a 

role in genome reduction in Mycoplasma 

(Hancock 1996a; Mrázek et al., 2007; Guo and 

Mrázek, 2008). 

Genome CG% show significant positive 

correlation only with penta nucleotide number 

and length. Similarly, significant positive 

correlation of average CG% of total replication, 

repair and recombination genes with pentanucleo 

tide lengths (P< 0.05, 0.587*) is seen in the 

present study. There is significant positive 

correlation (P< 0.01, 0.931**) of total SSR 

number with percentage of total replication, repair 

and recombination genes with repeats. Total SSR 

numbers show significant positive correlation 

with total dinucleotide number (P< 0.01, 0.700**) 

and total tetranucleotides show significant 


negative correlation with pentanucleotide number 

(P< 0.05, -0.659*). 

This data is not sufficient to draw conclusion that 

positive correlation of percentage of genes having 

repeats with total repeats may be an indication of 

probable increase in repeat number in these genes in 

other pathogens as well. It would be interesting to 

investigate repeats in those micro-organisms as well 

against which antibiotics are being used. Antibiotic 

treatment would alter environment and these 

pathogens may develop different strategies to evade 

these challenges. These evasive strategies may 

involve the membrane proteins or replication, repair 

and recombination related genes or gene products 

depending on the target proteins of antibiotics. 

SSR average length 

Many organisms studied so far have shown 

differences in not only abundance of SSRs but also in 

tolerance for length of SSRs. For example, archaea 

like Methanosarcina mazei strain Goe1, 

Methanobacterium thermoautotrophicum DH, 

Helicobacter pylori have some SSRs that are long 

compared to other species (Field and Wills, 1998; 

Trivedi, 2006). Among vertebrates, cold-blooded 

vertebrates like turtles have long repeats (Chambers 

and MacAvoy, 2000); whereas humans have longer 

SSRs compared to homologues in chimps (Cooper et 

al., 1998). 

Long SSRs have not been found in the present 

study including other studies in M. penetrans, M. 

mobile, and M. synoviae. Short A(n) and T(n) repeats 

are abundant in M. hyopneumoniae and M. pulmonis 

(Mrázek, 2006). The present study shows significant 

positive correlation between total SSR average 

length with dinucleotide number and length as well 

as tetranucleotide CG% (P< 0.05, 0.563*, 0.563* and 

P< 0.01, 1.000** respectively). Dinucleotide average 

length has significant positive correlation with total 

SSR as well as dinucleotide numbers and CG% of 

total SSRs (P< 0.01, 0.700**, 1.000** and 0.870** 

respectively). Significant positive correlation of 

trinucleotide length is seen with trinucleotide number 

but negative correlation with pentanucleotide CG% 

(P< 0.05, 0.672* and P< 0.01,-1.000** respectively). 

Tetranucleotide average length has positive 

correlation with tetranucleotide number but negative 

correlation with pentanucleotide number as well as 

length (P< 0.01, 1.000**, P< 0.05, -0.659* and P< 

0.01, -0.688** respectively). There is positive 

correlation of pentanucleotide average length with 

pentanucleotide number (P< 0.01, 0.963**). 

65

66 

Seema TRIVEDI 

Reports have suggested that in prokaryote 

genomes, significantly long SSRs are generally 

rare but association of long mono-, di-, tri-, and 

tetranucleotides are mostly restricted to hostadapted 

pathogens. Besides this, a number of long 

SSRs are also associated with housekeeping 

genes, including rRNA and tRNA genes, genes 

encoding ribosomal proteins, amino acyl-tRNA 

synthetases, chaperones, and important metabolic 

enzymes. Statistically significant associa tions 

between SSRs and gene functional classifications 

suggest that most long SSRs are not related to a 

particular cellular function or process (Guo and 

Mrázek, 2008). This conclusion may be true for 

many organisms and particularly prokaryotes, but 

pilot study on silkworm genes has indicated 

biased association of SSRs with genes associated 

with replication and repair process though length 

of SSRs was not focus of the study (Trivedi, 

2003). In Mycobacterium leprae long SSRs are 

mostly associated with pseudogenes and may be 

contributing to gene loss following the adaptation 

to an obligate pathogenic lifestyle. The authors 

speculate that LSSRs may have played a similar 

role in genome reduction of other host-adapted 

pathogens (Guo and Mrázek, 2008). Similarly in 

M. gallisepticum SSRs are biased towards 

deletion unlike eukaryotic genomes where they 

are biased towards expansion (Metzgar et al., 

2002). 

Among prokaryotes, it is proposed that the 

differences could be due to functional nature of 

these repeats or because some of these genomes 

lacks mismatch repair (Field and Wills, 1998). 

However, the latter reason does not apply to 

eukaryotes and particularly to differentces 

between chimpanzee and human SSRs. 

SSR average CG% 

Total SSRs CG% show positive correlation with 

total SSR and dinucleotide number (P

epeats. Frame-shift mutations caused in either di- 

or tetra-nucleotide (of the present study) repeats 

in these genes may facilitate altered methylation 

patterns and influence gene expression thus may 

indirectly contribute to antigenic variations that 

could help in evasion of host immune response 

(Rocha and Blanchard, 2002; Mrázek, 2006; Guo 

and Mrázek, 2008). 

DNA polymerase, excinuclease, gyrase and 

topoisomerase 

Among replication, repair and recom bination 

genes; M. mobile, M. pneumoniae, M. synoviae 

have repeats in DNA polymerase. Excinuclease 

genes have SSRs in M. capricolum, M. 

pneumoniae and M. synoviae and topoisomerase 

genes have SSRs in M. capricolum, M. 

gallisepticum and M. mycoides. However, gyrase 

genes have SSR only in M. arthritidis 158L3-1 

and single strand binding proteins (SSBP) only in 

M. capricolum. SSRs association with DNA 

polymerase, gyrase and SSBP genes besides other 

essential as well as housekeeping genes has also 

been reported in other prokaryotes including 

mycoplasmas. Guo and Mrázek (2008) speculate 

that variation in essential genes like replication, 

repair and recombination genes (except 

methylase) in prokaryotes may not be helpful but 

possibly these SSRs affect transcription initiation. 

However, there is a possibility that these SSRs 

are once again providing most of these pathogens 

opportunity to evade antibiotics. This hypothesis 

gets its support from the fact that many 

prokaryotes including mycoplasmas are becoming 

resistant to fluoroquinolones that are broadspectrum 

antibiotics like ofloxacin (OFX), 

ciprofloxacin (CFX) and sparfloxacin (SFX) 

targeted against proteins like topoisomerase II 

family, DNA gyrase and topoisomerase IV. Some 

mycoplasmas have developed resistance against 

these drugs due to mutations in target regions of 

these enzymes (Bébéar et al., 1998). Therefore it 

is suggested that those drugs would be more 

effective that would target at least two 

proteins/genes simultaneously to block of slow 

down DNA replication. This is because two 

mutations simultaneously in two genes to evade 

antibiotics would be rare and hence it may be 

more effective as it has been suggested in studies 

done on Staphylococcus aureus (Fournier et al., 

2000). 

Similarly, there are mutants against antibiotics 

that target Mycoplasma ribosomes (Pereyre et al., 


2002). It is possible that SSRs in the rRNA genes 

(Guo and Mrázek, 2008) (but not part of this study) 

may be providing genetic variability to the pathogen 

to evade altered living environment due to antibiotics 

against their ribosomes. 

Functions of SSRs 

SSRs may play diverse roles in genomes of different 

organisms. Some of these repeats act as contingency 

loci in association with families of surface antigens 

in pathogens, affect DNA supercoiling, gene 

expression or recombination hotspots. M. 

gallisepticum major surface protein pMGA 

expression switching from pMGA1.1 to pMGA1.2 is 

associated with (GAA)(12) repeat and variations in 

length (Glew et al., 2000; Liu et al., 2000; Liu et al., 

2002). M. pneumoniae, M. genitalium, Ureaplasma 

urealyticum and M. pulmonis have recombination 

potentials in different genomic regions. In particular 

M. pulmonis has illegitimate recombination at the vsa 

locus. M. pneumoniae and M. genitalium adhesins 

have large distant repeats that may be responsible for 

homologous recombination for variation (Rocha and 

Blanchard, 2002). However, M. hyopneumoniae have 

fewer repeats compared to other mycoplasma. 

Therefore, it is intriguing how M. hyopneumoniae 

evades host immune response and establishes chronic 

infection in absence of repeats (Minion et al., 2004). 

Not all SSRs may be related with these functions. 

For example, repeats in M. hyopneumoniae may not 

be contingency loci as these appear independent of 

location upstream or downstream of genes. Further, 

among 3 M. hyopneumoniae strains study shows that 

the An and Tn repeats may be rarely involved in 

genome rearrangements (Mrázek, 2006). 

Conclusion 

The diversity of repeat numbers and motifs may be 

due to diversity of host environments and selection 

pressures that different mycoplasmas live in. It is 

also possible that SSRs are present in regions of 

those segments where the amino acid coded by SSRs 

may help in flexibility of protein fold (disordered 

region). This may enable the protein to be more 

flexible in terms of protein-protein interactions and 

may have multiple partners, hence making them 

possible hubs of protein interaction networks 

(Mrázek, 2006). However, in the present study, the 

possible role of SSRs in these genes/proteins 

involves DNA binding capacity. Any mutation in 

these SSRs or other regions of the protein may affect 

67

68 

Seema TRIVEDI 

DNA-protein interaction and hence affect 

replication efficiency. Since there are antibiotics 

targeted against replication enzymes, these SSRs 

may be involved in providing platform for small 

mutations that are not large enough to totally 

affect functions of DNA replication, repair and 

recombination but are efficient enough to evade 

the antibiotics. 

Acknowledgements 

The author is grateful to Department of 

Biotechnology (DBT, Ministry of Science and 

Technology, India) for funding this work. 

References 

Achaz G, Rocha EPC, Netter P and Coissac E. 

Origin and fate of repeats in bacteria. Nucleic 

Acids Res. 30: 2987-2994, 2002. 

Bachtrog D, Agis M, Imhof M and Schlotterer C. 

Microsatellite varia bility differs between 

dinucleotide repeat motifs - evidence from 

Drosophila melanogaster. Mol Biol Evol. 17: 

1277-1285, 2000. 

Bachtrog D, Weiss S, Zangerl B, Brem G and 

Schlotterer C. Distribution of dinucleotide 

microsatellites in the D. melanogaster 

genome. Mol Biol Evol. 16: 602-610, 1999. 

Bébéar CM, Renaudin H, Charron A, Bové JM, 

Bébéar C and Renaudin J. Alterations in 

Topoisomerase IV and DNA gyrase in 

quinolone-resistant mutants of Mycoplasma 

hominis obtained In Vitro. Antimicrob Agents 

Chemotherapyapy. (42)9:2304-2311, 1998. 

Bencina D. Haemagglutinins of pat-hogenic avian 

mycoplasmas. Avian Pathol. 6: 535-47, 2002. 

Butcher RD, Hubbard SF and Whitfield WG. 

2000. Microsatellite frequency and size 

variation in the part henogenetic parasitic 

wasp Venturia canescens (Gravenhorst) 

(Hymen optera: Ichneumonidae). Insect Mol 

Biol. 9: 375-384. 

Chambers KG and MacAvoy ES. Microsatellites: 

Consensus and cont roversy. Comp Biochem 

Physio (Part B). 126: 455-476, 2000. 

Cooper G, Rubinsztein DC and Amos W. 

Ascertainment bias cannot entirely account for 

human microsatellites being longer than their 

chimpanzee homologues. Hum Mol Genet. 7: 

1425-9, 1998. 

de Castro LA, Rodrigues Pedroso T, Kuchiishi SS, 

Ramenzoni M, Kich JD, Zaha A, Henning 

Vainstein M and Bunselmeyer Ferreira H. 

Variable number of tandem amino acid repeats in 

adhesion-related CDS products in Mycoplasma 

hyopneu moniae strains. Vet Microbiol. (4): 258- 

69, 2006. 

Fabre E, Dujon B and Richard GF. Transcription and 

nuclear transport of CAG/CTG trinucleotide 

repeats in yeast. Nucleic Acids Res. 30(16): 3540- 

7, 2002. 

Field D and Wills C. Abundant microsatellite 

polymorphism in Saccharomyces cerevisiae, and 

the different distributions of micro satellites in 

eight prokaryotes and S. cerevisiae, result from 

strong mutation pressures and a variety of 

selective forces. Proc Natl Acad Sci USA. 95: 

1647–1652, 1998. 

Fournier B, Zhao X, Lu T, Drlica K and Hooper DC. 

Selective targeting of Topoisomerase IV and 

DNA gyrase in Staphylococcus aureus: different 

patterns of quinolone-induced inhi bition of DNA 

synthesis. Antimicrob Agents Chemotherapy. 

44(8): 2160–2165, 2000. 

Glew MD, Browning GF, Markham PF and Walker 

ID. pMGA phenotypic variation in Mycoplasma 

gallisep ticum occurs in vivo and is mediated by 

trinucleotide repeat length variation. Infect 

Immun. 68(10): 6027-33, 2000. 

Guo X and Mrázek J. Long simple sequence repeats 

in host-adapted pathogens localize near genes 

encoding antigens, housekeeping genes, and 

pseudogenes. J Mol Evol. 67(5): 497-509, 2008. 

Hancock JM and Santibanez-Koref MF. 

Trinucleotide expansion diseases in the context of 

micro- and minisatellite evolu tion. EMBO J. 17: 

5521-5524, 1998. 

Hancock JM. Genome size and accumulation of 

simple sequence repeats: implications of new data 

from genome sequencing projects. Genetica. 115: 

93-103, 2002. 

Hancock JM. Simple sequences and the expand ing 

genome. Bioessays. 18: 421-425, 1996b. 

Hancock JM. Simple sequences in a “minimal” 

genome. Nat Genet. 14: 14-15, 1996a. 

Hartenstine MJ, Goodman MF and Petruska J. Base 

stacking and even/odd behavior of hairpin loops 

in DNA triplet repeat slippage and expansion 

with DNA polymerase. J Biol Chem. 275: 18382- 

18390, 2000.

Hawley DM, Sydenstricker KV, Kollias GV and 

Dhondt AA. Genetic diversity predicts 

pathogen resistance and cell-mediated 

immunocompetence in house finches. Biol 

Lett. 1(3): 326-9, 2005. 

Jiang HX, Chen JR, Yan HL, Li XN, Chen ZL 

and Zeng ZL. Molecular variability of DR-1 

and DR-2 within the pvpA gene in 

Mycoplasma gallisepticum isolates. Avian Dis. 

53(1): 124-8, 2009. 

Karlin S, MrázekJ and Campbell AM. Compo 

sitional biases of bacterial genomes and 

evolutionary impli cations. J Bacteriol. 179: 

3899-3913, 1997. 

Katti MV, Ranjekar PK and Gupta VS. 

Differential distribution of simple sequence 

repeats in eukaryotic genome sequences. Mol 

Biol Evol. 18: 1161-1167, 2001. 

Kruglyak S, Durrett R, Schug D and Aquadro CF. 

Distribution and abun dance of micro satellites 

in the yeast genome can be explained by a 

balance between slippage events and point 

mutations. Mol Biol Evol. 17(8): 1210-1219, 

2000. 

Li Y, Korol AB, Fahima T, Beiles A and Nevo E. 

Microsatellites: genomic distribution, puta tive 

functions and mutational mechanisms: a 

review. Molec Eco. 11: 2453-2465, 2002. 

Lim S, Notley-McRobba L, Lim M and Carter 

DA. A comparison of the nature and 

abundance of micro satellites in 14 fungal 

genomes. Fungal Genet Biol. 41: 1025-1036, 

2004. 

Liu L, Dybvig K, Panangala VS, van Santen VL 

and French CT. GAA trinucleotide repeat 

region regulates M9/pMGA gene expression 

in Mycoplasma gallisepticum. Infect Immun. 

68(2): 871–876, 2000. 

Liu L, Panangala VS and Dybvig K. Trinucleotide 

GAA repeats dictate pMGA gene expression 

in Mycoplasma gallisepticum by affect ing 

spacing between flanking regions. J Bacteriol. 

184(5): 1335–1339, 2002. 

Lysnyansky I, Calcutt MJ, Ben-Barak I, Ron Y, 

Levisohn S, Methé BA and Yogev D. 

Molecular characterization of newly identified 

IS3, IS4 and IS30 insertion sequence-like 

elements in Mycoplasma bovis and their 

possible roles in genome plasticity. FEMS 

Micro Biol Lett. 294(2): 172-82, 2009. 


McAuliffe L, Ayling RD and Nicholas RA. 

Identification and charac terization of variablenumber 

tandem -repeat markers for the molecular 

epidemiological analysis of Mycoplasma 

mycoides subspecies mycoides SC. FEMS Micro 

Biol Lett. 276(2): 181-8, 2007. 

McAuliffe L, Churchward CP, Lawes JR, Loria G, 

Ayling RD and Nicholas RA. VNTR analysis 

reveals un expected genetic diversity within 

Mycoplasma agalactiae, the main causative agent 

of contagious agalactia. BMC Microbiol. 8: 193, 

2008. 

Mekchay S, Ponsuksili S, Schellander K and 

Wimmers K. Association of the porcine C3 gene 

with haemolytic complement activity in the pig. 

Genet Sel Evol. 35(Suppl 1): S83-96, 2003. 

Metzgar D, Bytof J and Wills C. Selection against 

frameshift muta tions limits microsatellite 

expansion in coding DNA. Genome Res. 10: 72- 

80, 2000. 

Metzgar D, Liu L, Hansen C, Dybvig K and Wills C. 

Domain-level differences in micro satellite distri 

bution and content result from different relative 

rates of insertion and deletion mutations. Genome 

Res. 12(3): 408-13, 2002. 

Minion FC, Lefkowitz EJ, Madsen ML, Cleary BJ, 

Swartzell SM and Mahairas GG. The genome 

sequence of Mycoplasma hyopneumoniae strain 

232, the agent of swine mycoplasmosis. J 

Bacteriol. 186(21): 7123-33, 2004. 

Mrázek J, Guo X and Shah A. Simple sequence 

repeats in prokaryotic genomes. Proc Natl Acad 

Sci USA. 104(20): 8472-7, 2007. 

Mrázek J. Analysis of distribution indicates diverse 

functions of simple sequence repeats in 

Mycoplasma genomes. Mol Biol Evol. 23(7): 

1370-85, 2006. 

Musatovova O, Kannan TR and Baseman JB. 

Genomic analysis reveals Mycoplasma 

pneumoniae repetitive element 1-mediated 

recombination in a clinical isolate. Infect Immun. 

76(4): 1639-48, 2008. 

Pereyre S, Gonzalez P, De Barbeyrac B, Darnige A, 

Renaudin H, Charron A, Raherison S, Bébéar C 

and Bébéar CM. Mutations in 23S rRNA account 

for intrinsic resistance to macrolides in 

Mycoplasma hominis and Mycoplasma 

fermentans and for acquired resistance to 

macrolides in M. hominis. Antimicrob Agents 

Chemotherapy. 46(10): 3142-50, 2002. 

69

70 

Seema TRIVEDI 

Primmer CR, Raudsepp T, Chowdhary BP, 

Moller AP and Ellegren H. Low frequency of 

microsatellites in the avian genome. Genome 

Res. 7: 471-482, 1997. 

Rocha EP, Blanchard A. Genomic repeats, 

genome plasticity and the dynamics of 

Mycoplasma evolution. Nucleic Acids Res. 

30(9): 2031-42, 2002. 

Simmons WL and Dybvig K. Biofilms protect 

Mycoplasma pulmonis cells from lytic effects 

of complement and gramicidin. Infect Immun. 

75(8): 3696-9, 2007. 

Sluijter M, Spuesens EB, Hartwig NG, van 

Rossum AM and Vink C. The Mycoplasma 

pneumoniae MPN490 and Mycoplasma 

genitalium MG339 genes encode reca 

homologs that promote homologous DNA 

strand exchange. Infect Immun. 77(11): 4905- 

11, 2009. 

Toth G, Gaspari Z and Jurka J. Microsatellites in 

different eukaryo tic genomes: survey and 

analysis. Genome Res. 10: 967-981, 2000. 

Trivedi S. Comparison of simple sequence repeats 

in 19 Archaea. Genet Mol Res. 5(4): 741-72, 

2006. 

Trivedi S. Do Microsatellites Have Biased 

Associations? The Nucleus. 46(1,2): 61-76, 

2003. 

Trivedi S. Microsatellites (SSRs): Puzzles within 

puzzle. Indian J Biotech. 3: 331-347, 2004.

Journal of Cell and Molecular Biology 7(2) & 8(1): 71-72, 2010 Software Review 




Authors: C. NOTREDAME, L. HOLME D.G. HIGGINS, J. HERINGA, O. 

O'SULLIVAN, K SUHRE, C. ABERGEL 

License: Open source freeware 

Tcoffee at a glance 

T-Coffee stands for Tree based Consistency 

Objective Function for Alignment Evaluation. It is 

a recent program for making multiple sequence 

alignments. It yields more accurate alignments at 

the cost of a slightly longer running time than other 

programs. Although it uses a progressive alignment 

method like ClustalW, it compares segments across 

the entire sequence set, which means aligning all 

the sequences at the same time. The main 

difference between Tcoffee and ClustalW is that 

Tcoffee doesn’t directly use substitution matrices to 

align sequences. It has many different applications 

and modules such as the main EXPRESSO for 

aligning sequences and structures, CORE for 

evaluating the accuracy of an alignment, Mcoffee 

for combining many alternative multiple sequence 

alignments into one. Briefly, Tcoffee could be 

described as a collection of tools for computing, 

evaluating and manipulating multiple alignments of 

DNA, RNA and protein sequences and structures. 

Tcoffee and its contribution to research 

Recently, many researchers in the field of 

molecular biology have used Tcoffee modules in 

building, computing, evaluating and manipulating 

multiple sequence alignments during their original 

research. Although Tcoffee has been produced and 

developed few years ago, it has been cited in many 

peer reviewed articles. However the number of 

citations is still not comparable to ClustalW. Beside 

its quick ability to produce results, the open source 

freeware license and its efficient multifunctional 

modules make Tcoffee one of the most useful 

programs for making multiple sequence alignments. 

Advantages and disadvantages of Tcoffee 

Advantages 

- It produces more accurate alignments than the 

other methods. 

- It is equipped with many different tools and 

modules such as CORE, Mcoffee and 

- 

EXPRESSO for structure alignment, evaluation 

and combining alignments. 

Tcoffee can deal with many input formats, 

including FASTA, Swiss-Prot and PIR (Protein 

Information Resource). 

- Tcoffee produces sequence alignment in various 

formats so that it can be used as an input for 

another program. It also produces a colorized 

alignment where every residue appears on a 

background that indicates the quality of this 

alignment in (.html) and (.pdf) format. 

- It can produce true phylogenetic tree in Newick 

format by using the Neighbor Joining method. 

- It can work with list of DNA, RNA or protein 

sequences. 

- Tcoffee can evaluate the quality of any multiple 

sequence alignments using CORE server. 

Disadvantages 

- It takes longer time to align multiple sequences 

than other programs. 

- It has been cited in limited number of peer 

reviewed journals compared to ClustalW. 

However, this number is increasing rapidly 

every day.

72 

Software design 

T-Coffee is an open source freeware. It can 

generate multiple sequence alignment for a given a 

set of sequences (Protein, RNA or DNA). The latest 

version of T-Coffee is 5.65. It runs on UNIX or 

Microsoft Windows/Cywin. Version 2.00 and 

higher can combine sequences and structures. It 

uses bioperl in the design. The interface is self 

explanatory with no complicated terms and 

expression. EXPRESSO aligns the structures using 

SAP, a program from Taylor and Orengo, and it 

aligns sequences and structures using FUGUE, a 

threading package from Kenji Mizuguchi 

(developed in Tom Blundell’s lab at Cambridge 

University). CORE server on www.tcoffee.org can 

evaluate the quality of any multiple sequence 

alignments with any of the most common formats 

(MSF, ALN, FASTA, and PIR). 

Limitations in use 

- The input for Tcoffee is limited to a maximum 

number of sequences of 50 and the maximum 

length of sequences of 2000. 

- The data will remain available on the server for 

only nine days. Then it will be deleted. 

- It is very important to cite the Tcoffee authors 

when using its resources. For instance, if you 

use the local version of Tcoffee, cite the 

following paper:- 

Notredame, D. Higgins, J. Heringa . T-Coffee: A 

novel method for multiple sequence alignments. 

Journal of Molecular Biology, Vol 302, pp205- 

217,2000. 

Otherwise, cite the paper that corresponds to the 

server you have been using (click on the "cite" 

button associated with every server on 

www.tcoffee.org). 

New features, flavors and tools of Tcoffee 

Alignment 

TCOFFEE (Regular or advanced): Computes a 

multiple sequence alignment and the associated 

phylogenetic tree. 

EXPRESSO (3DCoffee) (Regular or advanced): 

This server computes structure based Multiple 

Sequence Alignments. 

MCOFFEE (Regular or advanced): Computes a 

multiple sequence alignment and the associated 

phylogenetic tree by combining the output of 

several multiple sequence alignment packages 

(PCMA, Poa, Mafft, Muscle, T-Coffee, 

ClustalW, ProbCons, DialignT). 

COMBINE (Regular or advanced): combines two 

(or more) multiple sequence alignments into a 

single one. 

RCOFFEE (Regular or advanced): Multiple 

Sequence Alignment of Non Coding RNA 

Sequences using RNAplfold predicted 

secondary structures. 

Evaluation 

CORE (Regular or advanced): evaluates your 

Alignment and outputs a colored version where 

bad portions are in blue and the good ones in 

red. Your alignment must contain at least four 

sequences 

iRMSD-APDB (Regular or advanced): Evaluates 

your Multiple Sequence Alignment using 

APDB which estimates the proportion of 

columns correctly aligned in a pairwise or a 

multiple alignment of sequences with known 

structures. 

List of Tcoffee servers availability around 

the world 

- www.tcoffee.org 

- http://tcoffee.vital-it.ch/cgibin/Tcoffee/tcoffee_cgi/index.cgi 

- http://www.es.embnet.org/Services/MolBio/tcoffee/ 

- http://www.ebi.ac.uk/t-coffee/ 

Ahmed MANSOUR 

Genetics Department, 

Faculty of Agriculture, 

Zagazig University, Egypt 

(author for correspondence; amansour@zu.edu.eg) 

Received: 27 March 2008; Accepted: 11 December 2009

Tcoffee © : Çok amaçlı dizi hizalama programı 

Yazarlar: C. NOTREDAME, L. HOLME D.G. HIGGINS, J. HERINGA, O. 

O'SULLIVAN, K SUHRE, C. ABERGEL 

Lisans: Açık kaynak, ücretsiz yazılım 

Tcoffee’ye kısa bir bakış 

T-coffee "Ağaç Bazlı Tutarlılık Uyum Amaç 

Fonksiyonunun Değerlendirilmesi" anlamına 

gelmektedir. Çoklu dizi hizalaması yapmak için 

kullanılan yeni bir programdır. Biraz daha uzun 

çalışma zamanı pahasına diğer programlardan daha 

kesin hizalama sağlamaktadır. ClustalW gibi 

progresif bir program kullanmasına rağmen aynı 

zamanda hizalanmış bütün sekansları ifade eden 

bütün sekans setiyle karşılaştırmaktadır. Tcoffee 

sekansları hizalamak için matris yer değişimini 

direkt olarak kullanmamasıdır. Tcoffee ve 

ClustalW arasındaki ana fark Tcoffee'nin sekansları 

hizalamak için matris yer değişimini direkt olarak 

kullanmamasıdır.. Başlıca dizi ve yapıların 

hizalanması için EXPRESSO, bir hizalamanın 

kesinliğini değerlendirmek için CORE, birçok 

alternatif çoklu dizi hizalamalarını tek olarak 

birleştirmek için Mcoffee gibi çok farklı 

uygulamalar ve modüllere sahiptir. Kısaca, Tcoffee 

DNA, RNA ve protein dizileri ve yapılarının çoklu 

dizi hizalamasını kullanma, hesaplama ve 

değerlendirme için bir alet topluluğuymuş gibi 

tanımlanabilir. 

Tcoffee ve araştırmaya katkısı 

Son zamanlarda, moleküler biyoloji alanındaki 

birçok araştırmacı orijinal araştırmaları süresince 

çoklu dizi hizalaması yapmak, manipüle etmek, 

hesaplamak ve değerlendirmek için Tcoffee 

modüllerini kullanmaktadır. Tcoffee birkaç yıl önce 

üretilmiş ve geliştirilmiş olmasına rağmen, birçok 

derlenmiş eşdüzey makalede atıfta bulunulmuştur. 

Ancak atıf sayısı hala ClustalW ile karşılaştırılamaz. 

Sonuçları hızlı elde etme özelliğine ilaveten, 

73 

açık kaynak ücretsiz yazılım lisansı ve çok 

fonksiyonlu etkili modülleri, Tcoffee’yi çoklu dizi 

hizalaması için en kullanışlı programlardan biri 

yapar. 

Tcoffee’nin avantajları ve dezavantajları 

Avantajları 

- Diğer metodlardan daha kesin karşılaştırmalar 

ortaya koyar. 

- Yapı hizalama, hesaplama ve hizalamaları 

birleştirme için CORE, Mcoffee ve EXPRESSO 

gibi birçok farklı aletle ve modülle donatılmıştır. 

- Tcoffee; FASTA, Swiss-Prot ve PIR (Protein 

Information Resource, Protein bilgi kaynağı) da 

dahil birçok input formatını düzenlemek için 

açabilir. 

- Tcoffee çeşitli fomatlarda dizi hizalaması yapar. 

Bundan dolayı başka bir program için bir input 

olarak kullanılabilir. Ayrıca (.html) ve (pdf) 

formatında bu hizalamanın kalitesini belirten bir 

arka plan üzerinde her kalıntının göründüğü 

yerde renklendirilmiş bir hizalama yapar. 

- Neighbor Joining metodunu kullanarak Newick 

formatında doğru filogenetik ağaç oluşturabilir. 

- DNA, RNA veya Protein dizileri listesiyle 

çalışabilir. 

- Tcoffee CORE sunucusunu kullanarak herhangi 

çoklu dizi hizalamasının kalitesini değerlendirebilir. 

Dezavantajları 

- Çoklu dizileri karşılaştırmada diğer 

programlardan daha uzun zaman alır. 

- ClustalW’e göre sınırlı sayıda derlenmiş 

eşdüzey dergide atıfta bulunulmuştur. Ancak bu 

sayı her gün hızlıca artmaktadır.

74 

Yazılım Dizaynı 

T-Coffee bir açık kaynak ücretsiz yazılımdır. 

Verilen bir dizi seti (Protein, DNA ya da RNA) için 

çoklu dizi hizalaması oluşturmaktadır. Tcoffee’nin 

en son versiyonu 5.65’tir. UNIX ya da Microsoft 

Windows/Cywin ile çalışır. Sürüm 2.00 ve üzeri 

yapıları ve dizileri birleştirebilir. Bu dizaynda 

Bioperl kullanır. Arabirim karmaşık olmayan terim 

ve anlatımlarla kendiliğinden anlaşılır. 

EXPRESSO, Taylor ve Orengo tarafından yazılan 

bir program olan SAP’ı kullanarak yapıları hizaya 

sokar. Dizileri ve yapıları Kenji Mizuguchi’den bir 

dizi paketi (Cambridge üniversitesinde Tom 

Blundell’s Laboratuarında geliştirilen) olan 

FUGUE’yi kullanarak hizaya sokar. 

www.tcoffee.org üzerinde CORE sunucusu en 

yaygın formatların (MSF, ALN, FASTA ve PIR) 

herhangi biriyle çoklu dizi hizalama kalitesini 

değerlendirebilir. 

Kullanımda sınırlamalar 

- Tcoffee için input maksimum dizi sayısı 50 ve 

maksimum dizi uzunluğu 2000’e kadar 

sınırlandırılmıştır. 

- Veriler sunucu üzerinde sadece dokuz gün 

kullanılabilir olarak kalacaktır. Sonra 

silinecektir. 

- Kaynaklarını kullanırken Tcoffee yazarlarına 

atıfta bulunmak önemlidir. Örneğin, 

Tcoffee’nin sınırlı sürümünü kullanırsanız 

belirtilen makaleye atfedin:- 

Notredame, D. Higgins, J. Heringa . T-Coffee: A 

novel method for multiple sequence alignments. 

Journal of Molecular Biology, Vol 302, pp205- 

217, 2000. 

Aksi takdirde, kullandığınız sunucuya karşılık 

gelen makaleye atıfta bulunun 

(www.tcoffee.org üzerindeki her sunucuyla 

alakalı “cite” tuşuna tıklayarak). 

Tcoffee’nin aygıtları, belirli özellikleri ve 

yeni özellikler 

Hizalama 

TCOFFEE (normal ya da gelişmiş düzeyde): Çoklu 

dizi hizalama ve ilişkilendirilmiş filogenetik 

ağacı hesaplar. 

EXPRESSO (3DCoffee) (normal ya da gelişmiş 

düzeyde): Bu sunucu yapı temelli Çoklu Dizi 

Hizalamalarını hesaplar. 

MCOFFEE (normal ya da gelişmiş düzeyde): 

Birkaç çoklu dizi hizalama paketininin (PCMA, 

Poa, Mafft, Muscle, T-Coffee, ClustalW, 

ProbCons, DialignT) output’unu (çıkış) 

birleştirerek çoklu dizi hizalama ve ilişkilendirilmiş 

filogenetik ağacı hesaplar. 

COMBINE (normal ya da gelişmiş düzeyde): iki 

(veya daha fazla) çoklu dizi hizalamalarını tek 

bir tanesinde birleştirir. 

RCOFFEE (normal ya da gelişmiş düzeyde): 

RNAplfold tarafından oluşturulan tahmini 

ikincil yapıları kullanarak Kodlanmayan RNA 

Dizilerinin Çoklu Dizi Hizalaması. 

Değerlendirme 

CORE (normal ya da gelişmiş düzeyde): 

Hizalamanızı ve kötü kısımlarının mavi iyi 

olanların kırmızı olduğu renkli çıktılarınızı 

değerlendirir. Hizalamanız en azından dört dizi 

içermelidir. 

iRMSD-APDB (normal ya da gelişmiş düzeyde): 

İkili olarak doğru bir şekilde hizalanmış ya da 

yapıları bilinen dizilerin çoklu hizalamasında 

sütunların oranını tahmin eden APDB 

kullanarak Çoklu Dizi Hizalamasını değerlendirir. 

Dünya çapında kullanılabilir Tcoffee 

sunucuları listesi 

- www.tcoffee.org 

- http://tcoffee.vital-it.ch/cgibin/Tcoffee/tcoffee_cgi/index.cgi 

- http://www.es.embnet.org/Services/MolBio/tcoffee/ 

- http://www.ebi.ac.uk/t-coffee/ 

Ahmed MANSOUR 

Genetik Bölümü, 

Ziraat Fakültesi, 

Zagazig Üniversitesi, Mısır





Authors: UCSC Genome Bioinformatics Group led by David Haussler and Jim Kent, 

Center for Biomolecular Science & Engineering, University of California 

License: Free for academic, non-profit, and personal use. A license is required for 

commercial use. 

Genome browser at a glance 

Genome Browser is a tool for collecting all relevant 

genomic sequence data in one site and provides 

rapid, reliable, and simultaneous display of any 

requested portion of genomes at any scale in a 

graphical design. The UCSC Genome Browser 

resource contains the reference (or official) public 

DNA sequences and working draft assemblies for 

human and a large collection of other genomes. 

There are a number of tools within this site that 

provides access to the sequences themselves, and 

many other useful genome features to add context 

to the genomic information. Researchers can use 

this site to find genes and gene predictions, 

expression information, SNPs and variations, crossspecies 

comparative data, and many more. 

Moreover, the UCSC provide the ability to search 

for markers and sequences, to extract annotations 

for specific regions or for the whole genome, and to 

act as a central starting point for genomic research. 

It also provides a portal to the ENCODE project. 

UCSC genome browser contribution to 

research 

Molecular biologists use UCSC genome browser 

modules during their original research tools such 

"Genome Browser", "Gene Sorter", 'Blat", "Table 

Browser", "VisiGene" and "Genome Graphs" all of 

which allow the user to navigate, sort, blast, 

visualize and analyzes genomic data for reliable 

annotation. 

Moreover, researchers can learn more about 

the object (e.g., known genes, conservation, or 

SNPs, etc.) via researching by simply position the 

mouse over information line and click, then a new 

web page will appear with important details and 

information. The Page Index box usually includes 

sequences, microarray data, mRNA secondary 

structure, protein domain structure, homologues in 

other species, gene ontology descriptions, mRNA 

descriptions and pathways, etc. This wealth of 

information is more than enough for a molecular 

biologist as a start point for genomic research. 

Colours language in UCSC genome browser 

Colors have important meanings in UCSC genome 

browser. For instance, the Black color in gene track 

indicates a protein data bank (PDB) structure entry 

for this genome fragment. Dark blue indicates 

NCBI-reviewed sequence, while light blue 

corresponds to provisional sequences. In addition, 

SNP types are also color-coded. More information 

about any specific color representation and 

annotation or descriptive information can be 

obtained by clicking the hyperlink of the track. 

Advantages and disadvantages of UCSC 

genome browser 

Advantages 

- UCSC Genome Browser is very easy to use and 

free of charge online. 

- UCSC uses the same interface and display for 

each of the species listed. 

- In addition, UCSC can run on (almost) any 

computer that has access to internet and can 

return the results online or by e-mail. 

- The Genome Viewer page provides several 

options to make changes 

- Text search strategy can be used by typing in 

gene name, gene symbol, or ID, etc. 

- "Automatic Zoom" and "Recenter Action" are 

handy features to automatically re-center the 

image where you click

76 

- The Custom Track hyperlink on the UCSC 

home page allows the user to create custom 

tracks of his data. 

Limitations 

- The number of available genomes are limited, 

especially plant genomes. 

- Different species have different annotation 

tracks depending on the availability of data 

assembly. 

- "Automatic Zoom" can only zoom three folds. 

- Not all the genes have the same levels of detail, 

and not every species has all the information. 

- BLAT allows to paste up to 25,000 bases, 

10,000 amino acids, and up to a total of 25 

sequences in the common FASTA 

- Custom tracks are only persistent for 8 h and 

needs to be re-done after 8 h if you have not 

downloaded the file. 

- The configuration options of the output format 

offered by Protein Duster program are limited. 

UCSC genome viewer tracks 

The Genome Viewer section features have the 

following tracks: 

(1) Mapping and Sequencing Tracks; 

(2) Phenotype and Disease Associations; 

(3) Genes and Gene Prediction Tracks; 

(4) mRNA and EST Tracks; 

(5) Expression and Regulation; 

(6) Comparative Genomics, Variation, and Repeats; 

(7) ENCODE Regions and Genes; 

(8) ENCODE Transcript Levels; 

(9) ENCODE Chromatin Immunoprecipitation; 

(10) ENCODE Chromosome, Chromatin, and DNA 

Structure; and ENCODE Comparative. 

Different Genome browsers online 

UCSC genome browser (http://genome.ucsc.edu/) 

Ensembl genome browser 

(http://www.ensembl.org) 

VISTA (http://genome.lbl.gov) 

NCBI MapViewer 

(http://www.ncbi.nlm.nih.gov/mapview/) 

ECR Browser (http://ecrbrowser.dcode.org) 

Combo 

(http://www.broad.mit.edu/annotation/argo/)

Genomics and ENCODE Variation 

UCSC Genome Browser website tools 

TOOL NAME FUNCTION 

Genome Browser 

Gene Sorter 

Zooms and scrolls over chromosomes, showing the work of annotators 

worldwide 

Shows expression, homology and other information on groups of genes 

that can be related in many ways. 

Blat Quickly maps your sequence to the genome. 

Table Browser Provides convenient access to the underlying database 

VisiGene 

Lets you browse through a large collection of in situ mouse and frog 

images to examine expression patterns 

Genome Graphs Allows you to upload and display genome-wide data sets 

77 

Ahmed MANSOUR 





Received: 01 September 2008; Accepted: 11 December 2009

78 

UCSC: Genomik diziler için Genom Tarayıcısı 

Yazarlar: David Haussler ve Jim Kent liderliğinde UCSC Genom Biyoenformatiği grubu, 

Biyomoleküler Bilim ve Mühendislik Merkezi, Kaliforniya Üniversitesi 

Lisans: Akademik, kişisel ve kar amacı gütmeyen durumlarda kullanımı ücretsizdir. Ticari 

amaçla kullanımı için lisans gereklidir. 

Bir bakışta Genom Tarayıcı 

Genom tarayıcı bir genomik dizi ile alakalı tüm 

bilgileri bir sayfada toplayan ve genomun herhangi 

bir bölgesinin istenilen her ölçüde görsel bir dizayn 

ile güvenilir ve hızlı bir şekilde görüntülenmesini 

sağlayan bir araçtır. UCSC genom tarayıcısı 

kaynağı, insan genomu ve diğer birçok organizma 

genomu için resmi, referans veya taslak DNA 

dizilerini içermektedir. Sayfada dizilere erişim 

sağlayan araçların yanı sıra bu dizilere dair 

genomik enformasyona ilave yapabilen birçok 

özellik de vardır. Araştırmacılar bu sayfayı bilinen 

gen dizilerine, tahmini gen dizilerine, 

ekspresyonları ile ilgili bilgilere, türler arası 

karşılaştırmalı bilgiye, tek nükleotid 

polimorfizmlerine ve varyasyonlarına ve daha 

birçok bilgiye erişmek amacıyla kullanabilirler. 

UCSC ayrıca markör dizi aranmasına, belirli bir 

bölge veya tüm genom hakkında açıklama elde 

edilmesine olanak sağlayarak genom 

araştırmalarında başlangıç noktası olarak işlev 

görmektedir. ENCODE projesine de bağlantı 

sağlamaktadır. 

UCSC Genom Tarayıcının Araştırmalara 

Katkısı 

Moleküler biyologlar UCSC genom tarayıcı 

modüllerini dizileri düzenlemeye, BLAST araması 

yapmaya, görüntülemeye ve güvenilir bilgi için 

genomik verilerin analiz edilmesine olanak 

sağlayan ''Genome Browser'', ''Gene Sorter'', 

''BLAT'', ''Table Browser'',''VisiGene'' ve ''Genome 

Graphs'' gibi esas araştırma araçları ile beraber 

kullanmaktadırlar. Buna ek olarak araştırmacılar, 

araştırma konuları ile (örneğin; bilinen genler, 

korunum, tek nükleotid polimorfizmleri vb) ilgili 

ek bilgilere fare imlecinin ''information'' kutusunun 

üzerine getirilip tıklanmasıyla açılan ve önemli 

bilgi ve detayları barındıran yeni sayfa aracılığı ile 

ulaşabilirler. Sayfa indeks kutusu genellikle dizileri, 

mikroarray verilerini, ikincil mRNA yapısını, 

protein yapılarını, diğer türlerle olan homolojileri, 

gen ontolojisi ile ilgili açıklamaları ve araştırılan 

gen ile alakalı yolakları içerir. Bu bilgi zenginliği, 

genomik araştırmaya başlangıç noktası olarak bir 

moleküler biyolog için fazlasıyla yeterlidir. 

UCSC Genom Tarayıcıda Renklerin Dili 

UCSC genom tarayıcıda renklerin önemli anlamları 

vardır. Örneğin gen girdisindeki siyah renk, protein 

bilgi bankasında (PDB) ilgili genom parçası için 

protein yapısına dair bir girdi olduğunu belirtir. 

Koyu mavi renk NCBI tarafından onaylanmış 

dizileri belirtirken açık mavi doğruluğu 

onaylanmamış dizileri belirtir. Tek nükleotid 

polimorfizmi çeşitleri de renklerle kodlanmıştır. 

Belirli bir renk koduna dair bilgi, girdinin üst 

bağlantısına tıklanarak elde edilebilir. 

UCSC Genom Tarayıcının Avantajları ve 


Avantajları 

- UCSC Genom Tarayıcıyı kullanmak kolay ve 

bedavadır. 

- Listelenen bütün türler için aynı arayüz ve 

görünüm kullanılmaktadır. 

- Ayrıca UCSC, internet erişimi olan neredeyse tüm 

bilgisayarlarda çalıştırılabilir ve sonuçlar internet 

üzerinden veya e-posta yoluyla elde 

edilebilmektedir. 

- ''Genome Viewer'' sayfası, değişiklik yapmak için 

birçok olanak sağlamaktadır. 

- Gen ismi, sembolü veya kodu girilerek metin 

araması yapılabilmektedir. 

- "Automatic Zoom" ve "Recenter Action" özellikleri 

tıklanan noktada görüntüyü ortalamak için

oldukça kullanışlıdır. 

- UCSC ana sayfasındaki ''Custom Track'' üst 

bağlantısı kullanıcıya konu ilgili kendi kişisel 

girdilerini oluşturma imkanı vermektedir. 

Dezavantajlar 

- Erişilebilir genomların özellikle de bitki 

genomlarının sayısı oldukça sınırlıdır. 

- O türe dair bilgilerin erişilebilirliğine bağlı olarak, 

farklı türlere ilişkin farklı açıklama girdileri 

bulumaktadır. 

- "Automatic Zoom" özelliği görüntüyü yalnızca 3 

kat yaklaştırabilmektedir. 

- Her gen için aynı bilgi detayı ve her tür için bütün 

bilgiler yoktur. 

- ''BLAT'' 25000 baz, 10000 amino asit ve FASTA 

formatında 25 sekansın yüklenmesine izin 

verebilmektedir. 

- Kişisel girdiler yalnızca sekiz saat için geçerlidir 

ve dosya indirilmediği takdirde yeniden 

oluşturulmaları gerekmektedir. 

- ''Protein Duster'' yazılımı tarafından sunulan çıktı 

formatlarının yapılandırma ayarları sınırlıdır. 

UCSC Genom Görüntüleyici Girdileri 

Genom Görüntüleyici bölümünde aşağıdaki girdi 

79 

kategorileri bulunmaktadır: 

(1) Haritalama ve Dizileme Girdileri; 

(2) Fenotip ve Hastalık İlişkileri; 

(3) Genler ve Tahmini Gen Girdileri; 

(4) mRNA ve EST girdileri; 

(5) Ekspresyon ve Regülasyon; 

(6) Karşılaştırmalı Genomik, Çeşitlilik ve 

Tekrarlar; 

(7) ENCODE Bölge ve Genleri; 

(8) ENCODE Transkript Seviyeleri; 

(9) ENCODE Kromatin İmmünoprespitasyon; 

(10) ENCODE Kromozom, Kromatin ve DNA 

yapısı; ve Karşılaştırmalı ENCODE 

Çeşitli Genom Tarayıcıları 

UCSC genome browser (http://genome.ucsc.edu/) 

Ensembl genome browser 

(http://www.ensembl.org) 

VISTA (http://genome.lbl.gov) 

NCBI MapViewer 

(http://www.ncbi.nlm.nih.gov/mapview/) 

ECR Browser (http://ecrbrowser.dcode.org) 

Combo 

(http://www.broad.mit.edu/annotation/argo/)

80 

UCSC Genom Tarayıcı web sayfası araçları 

ARAÇ İŞLEVİ 

Genome Browser 

Gene Sorter 

Kromozom bölgelerini yakınlaştırmak, gezinmek, açıklamaları 

görebilmek. 

Çeşitli şekillerde ilişkilendirilebilecek gen gruplarına dair ekspresyon, 

homoloji ve diğer bilgileri göstermek. 

Blat Araştıılan diziyi genoma hızlı bir şekilde haritalamak. 

Table Browser Temel veritabanına erişim sağlamak. 

VisiGene 

Ekspresyon kalıplarının incelenebilmesi için in situ fare ve kurbağa 

görüntülerini taramak. 

Genome Graphs Genom çapında verileri yüklemek ve görüntülemek. 

Ahmed MANSOUR 








Authors: Marco PAGNI & Thomas JUNIER, form the Swiss Institute of Bioinformatics in 

Epalinges, Switzerland. 

License: Freeware 

Dotlet at a glance 

For a molecular biologist, making dot plots are the 

simplest means for comparing two sequences. This 

is because dot or matrix plots provide an easy and 

powerful means of sequence analysis (Junier and 

Pagni, 2000). For instance, it is very useful in 

searching out regions of similarity between two 

sequences and repeats regions within a single 

sequence. In this regard, Dotlet is one of the most 

user-friendly dot-plot programs available over the 

internet. Dotlet program is a very convenient tool 

for making dot plots because of it is free of charge, 

easy to use, doesn’t need any installation, and can 

run on any computer that has access to internet. 

Recently, it has been extensively used to build 

pairwise comparisons in many peer-reviewed 

scientific articles. 

Dotlet history 

The authors described the reason why they wrote 

dotlet as they needed a diagonal plot tool during 

their practical sessions in bioinformatics, in 

December 1998, at the Institute of Biochemistry in 

Switzerland. At that time, they needed a program 

that would run in a web browser based on the 

World-Wide Web. To my knowledge, this program 

was the first dot plots software based on the 

internet then. 

Dotlet contribution to research 

Many researchers in the field of Molecular biology 

have used Dotlet modules in building Pairwise 

Comparisons during their original research. With 

many hundreds of citations, Dot let is widely cited 

bioinformatic programs in biology. The freeware 

license and its efficient modules beside its quick 

ability to produce results make it one of the most 

popular programs for making Pairwise 

Comparisons nowadays. 

Advantages and disadvantages of Dot plot 

Advantages 

- Dotlet is very easy to use and free of charge. 

- Dotlet is an internet-based program that runs on 

(almost) any computer that has access to the 

internet. 

- Dotlet is not a server but a Java applet which 

means that everything Dotlet does, it does on 

your own computer offline. 

- Dotlet is safe to use because each sequence you 

compare with Dotlet stays on your computer 

- Dotlet can compare DNA, RNA and protein 

sequences. 

Disadvantages 

- It needs some training and good experience to 

interpret Dotlet results. In other words one must 

learn how to fine-tune Dotlet to yield an 

informative dot plot 

- Dotlet cannot work with long sequences (more 

than 10,000 amino acids or nucleotides). 

- The speed of the program depends on your own 

computer. The faster your computer, the faster 

Dotlet runs. Differences become apparent with 

sequences longer than 1.000 residues. 

Software Design 

- Dotlet is an open source freeware. It can 

generate pairwise comparison for a given a 

couple of sequences of proteins or DNA. It has 

been built as a JAVA applet. The Dotlet source 

code is available free of charge for academic 

users.

82 

The distribution is in 

ftp://ftp.isrec.isb-sib.ch/pub/software/java/dotlet. 

Limitations in use 

Dotlet is an ideal pairwise comparisons tool for 

sequences with lengths of less than 10,000 amino 

acids or nucleotides. So, it can be helpful for most 

proteins sequences but is restricted to small DNA 

sequences. 

Dotlet availability online 

(IBM users): http://myhits.isb-sib.ch/cgi-bin/dotlet 

(Mac users): 

http://www.isrec.isb-sib.ch/java/dotlet/Dotlet.html 

Other online dot plot programs 

Dnadot 

This program can use a range of 100,000 long 

characters of either proteins or DNA sequences and 

it has been designed using Java language. Dnadot is 

available online on the following URL: 

http://arbl.cvmbs.colostate.edu/molkit/dnadot/ 

http://www.vivo.colostate.edu/molkit/dnadot/ 

Dotter 

This program can use as long as 100.000 characters 

of either proteins or DNA sequences like Dnadot, 

However, it is designed to use Unix, Linux and 

Windows as a platform. It is available online on the 

following URL: 

http://www.cgr.ki.se/cgr/groups/sonnhammer/Dotte 

r.html 

Dottup 

Although this program is also using the same range 

of DNA as the previous program, it can also be 

used for complete genomes. It also uses Unix and 

Linux as a platform. It is available online as a 

useful integrated module in emboss package. 

URL: http://emboss.sourceforge.net/ 

References 

Junier T. and Pagni M. (2000) Dotlet: diagonal 

plots in a web browser. Bioinformatics. 

16(2):178-9. 

Ahmed MANSOUR 





Received: 01 September 2008; Accepted: 11 December 2009

Dotlet©: İkili karşılaştırmalar için güçlü ve kolay strateji 

Yazarlar: Marco PAGNI & Thomas JUNIER, the Swiss Institute of Bioinformatics, 

Epalinges, Switzerland 

Lisans: Ücretsiz 

Kısa Bir Bakışla Dotlet 

Bir moleküler biyolog için, iki diziyi eşleştirmenin 

en basit yolu dot blot yapmaktır. Çünkü dot ya da 

matriks blotlar dizi analizini kolay ve güçlü şekilde 

sağlar. Örneğin, iki dizi arasındaki benzer 

bölgelerin ve bir dizideki tekrarlayan bölgelerin 

araştırılmasında çok kullanışlıdır. Bu bakımdan 

Dotlet internet yoluyla ulaşılabilen dot-plot 

programlarının en kullanıcı dostu olanıdır. Dotlet 

programı ücretsiz ve kolay kullanımlı olduğu, 

kuruluma ihtiyacı olmadığı ve internete girilebilen 

her bilgisayarda çalışabildiği için dot plotları 

yapmak için çok uygun bir araçtır. Son günlerde 

çok sayıda benzer bilimsel makalede ikili 

eşleştirmeleri yapmak için yaygın olarak 

kullanılmaktadır. 

Dotletin Tarihi 

Yazarlar, dotlet programını yazmalarının sebebini 

Aralık 1998’de İsviçre’deki Biyokimya 

Enstitüsünde kendi biyoinformatik çalışmaları 

sırasında diyagonal bir plota ihtiyaç duymaları 

olarak açıkladılar. Bu arada world-wide web tabanlı 

web tarayıcısında çalışabilen bir programa da 

ihtiyaçları vardı. Bildiğim kadarıyla bu program o 

zamanlarda internet tabanlı ilk dot plot yazılımıydı. 

Dotletin Araştırmalara Katkısı 

Moleküler biyolojinin bu sahasındaki çoğu 

araştırmacı kendi orijinal araştırmaları süresince 

ikili karşılaştırmaların yapılandırılmasında Dotlet 

modüllerini kullanmıştır. Yapılan yüzlerce atıfla 

Dotlet biyolojideki biyoinformatik programları 

arasındaki yerini almıştır. Bu günlerde ücretsiz 

yazılım lisansı ve onun etkili modülleri dışında 

83 

sonuç üretme yeteneğinin çabukluğu onu, ikili 

karşılaştırmaları yapmak için en popüler program 

haline getirmiştir. 

Dot Plot’ın Avantajları ve Dezavantajları 

Avantajları 

‐ Dotlet’in kullanımı kolay ve ücretsizdir. 

‐ Dotlet internet tabanlı bir program olup 

internete 

çalışabilir. 

bağlanabilen her bilgisayarda 

‐ Dotlet sunucu bir program değildir ama 

bilgisayarınız kapalıyken Dotlet’in yapabildiği 

her şeyi yapan bir Java uygulamasıdır. 

‐ Dotlet’in kullanımı Dotlet ile karşılaştırdığınız 

her dizi bilgisayarınızda kaldığı için güvenlidir. 

‐ Dotlet DNA, RNA ve protein dizilerini 

karşılaştırabilir. 


‐ Dotlet sonuçlarını yorumlamak için biraz 

alıştırma ve iyi bir deneyim gerekmektedir. 

Başka bir deyişle, bilgi verici bir dot plot 

sağlamak için Dotlet’e nasıl ince ayar 

yapılacağı öğrenilmelidir. 

‐ Dotlet uzun diziler (10,000 amino asit ya da 

nükleotitten daha fazlası) ile çalışmayabilir. 

‐ Programın hızı bilgisayarınıza bağlıdır. 

Bilgisayarınız ne kadar hızlıysa dotlet o kadar 

hızlı çalışır. 1000 rezidüden daha uzun diziler 

ile belirgin farklılıklar oluşabilir. 

Yazılım Dizaynı 

Dotlet açık kaynaklı bedava bir yazılımdır. Verilen 

bir çift protein ya da DNA dizisi için ikili 

karşılaştırmalar üretebilir. Java uygula-macığı 

olarak yapılandırılmaktadır. Dotlet kaynak kodu 

akademik kullanıcılar için ücretsiz olarak 

erişilebilir.

84 

Dağıtım: 

ftp://ftp.isrec.isb-sib.ch/pub/software/java/dotlet 

Kullanım Sınırlamaları 

Dotlet 10,000 amino asit ya da nükleotitten daha 

kısa uzunluktaki diziler için ideal bir ikili 

karşılaştırma aracıdır. Böylece çoğu protein dizileri 

için yardımcı olabilir ama ufak DNA dizileri için 

sınırlanmıştır. 

Çevrimiçi Dotlet Erişilebilirliği 

IBM users): http://myhits.isb-sib.ch/cgibin/dotlet 

(Mac users): http://www.isrec.isbsib.ch/java/dotlet/Dotlet.html 

Diğer Çevrimiçi Dot Plot Programları 

Dnadot 

Bu program protein ya da DNA dizilerinin 100,000 

uzunluğundaki bir dizi karakterini kullanabilir ve 

Java dilini kullanarak dizayn edilebilir. Dnadot’a 

aşağıdaki URL ile çevrimiçi ulaşılabilir: 

http://arbl.cvmbs.colostate.edu/molkit/dnadot/ 

http://www.vivo.colostate.edu/molkit/dnadot/ 

Dotter 

Bu program da protein ya da DNA dizilerinin 

100,000 uzunluğundaki bir dizi karakterini Dnadot 

gibi kullanabilir. Bununla birlikte, platform olarak 

Unix, Linux ve Windows kullanılarak dizayn 

edilebilir. Aşağıdaki URL ile çevrimiçi erişilebilir: 

http://www.cgr.ki.se/cgr/groups/sonnhammer/Dotte 

r.html 

Dottup 

Bu program önceki program gibi DNA’nın aynı 

aralığını kullanmasına rağmen tüm genom için de 

kullanılabilir. Platform olarak Unix ve Linux 

kullanabilir. “Emboss” paketinde kullanışlı 

birleştirilmiş bir modül olarak çevrimiçi ulaşılabilir. 

URL: http://emboss.sourceforge.net/ 

Kaynaklar 

Junier T. ve Pagni M. (2000) Dotlet: web 

tarayıcısındaki diyagonal plotlar. Biyoinformatik. 

16(2):178-9. 

Ahmed MANSOUR 




Journal of Cell and Molecular Biology - GUIDELINES for AUTHORS 

(Revised: May 17, 2010) 

General 


(JCellMolBiol) is an international journal which 

covers original works in the field of cell biology, 

molecular biology, genetics, microbiology, 

neurobiology, bioinforma-tics and related topics. 

The official language of the journal is English, 

but manuscripts in Turkish are accepted as well. 

Conditions for publication 

This journal publishes research articles, review 

articles, short communications, book/software 

reviews, case reports and letters to the editor. 

Research articles: Only original contributions will 

be accepted which have not been published 

previously. Manuscripts should not exceed 15 

papers of printed text, including tables, figures and 

references 

Review articles: Reviews of recent developments in 

a research field and ideas will be accepted. 

Manuscripts should not exceed 15 papers of printed 

text. Illustrations are encouraged. 

Short communications: These include small-scale 

investigations or innovative methods, techniques, 

clinical trials and epidemiological studies. It should 

not exceed 3 pages. 

Letters to editor: These include opinions, news and 

suggestions. Letters should not exceed 2 papers of 

printed text. 

Case Reports: These include individual 

observations based on small numbers of subjects. 

This type of research cannot indicate causality but 

may indicate areas for further research. 

REVISED 

May 17, 2010 

Manuscripts should be submitted on a CD or by email 

to: 



Faculty of Arts and Sciences, 

Department of Molecular Biology and Genetics 

Kaptan Paşa Mah. Darülaceze Cad. No: 14 

Okmeydanı-Şişli 34384, İstanbul-TÜRKİYE 

Tel: +90 212 220 96 96 Ext. 155 

E-Mail: jcmb@halic.edu.tr 

Book/software reviews: Short but concise 

description of the book/software, not exceeding a 

page. Book/software reviews are not peer reviewed. 

Presentation 

Papers should be typed clearly, double-spaced with 

3 cm wide margins. 

Manuscripts should be prepared using Word 

Processor. 

Cover Letter: You may briefly explain your work 

and its contribution to present knowledge. 

Title Page: The first page of your manuscript 

should be a title page containing the type of paper; 

the title; all authors' full names, and affiliations; 

and the corresponding author's contact address 

(including phone and fax numbers) and e-mail 

address. The title should be as short as possible, but 

should give adequate information regarding the 

contents. Authors should also state a running title 

of no more than 50 characters including spaces. 

All pages must be numbered. 

Full Paper 

The full paper should be divided into the following 

parts in the order indicated: 

85

86 

Abstract: A brief, informative abstract, not 

exceeding 200 words, should be provided in 

English and in Turkish. For authors who are not 

native Turkish speakers, JCellMolBiol can provide 

the Turkish abstract. 

Keywords: Immediately following the abstract, 

authors should provide 5 keywords or phrases that 

reflect the content of the article. 

Introduction should include theory, hypotheses, 

prior work 

Material and methods may include subheadings 

Results: If the study consists of different parts, 

subheadings in this section should be consistent 

with subheadings in the methods. 

Discussion 

Acknowledgements should precede the list of 

references 

References: Papers cited in the manuscript should 

be listed in alphabetical order according to the first 

author's surname. 

Tables and Figures 

Tables and figures should be embedded within 

the text in their appropriate positions. 

Each table should be accompanied by a short 

instructive title line plus an explanatory caption at 

the top. Indicate footnotes within tables by 

superscript letters and type footnotes below the 

table. 

Electronically submitted figures are preferred 

in *.jpg or *.tiff (min. 300 dpi) formats. Each figure 

should be supplied with a short instructive title line. 

Do not give magnification on scales in the figure 

titles; instead draw bar scales directly on the 

figures. 

All the tables and figures must be referred to 

within the text. 

Units, Abbreviations and Scientific Names 

Only SI units should be used. Current 

abbreviations can be used without explanation, 

others must be explained. 

All acronyms/abbreviations must be explained 

in parenthesis after their first occurrence. If many 

unfamiliar acronyms/abbreviations are used, please 

REVISED 

May 17, 2010 

compile them in an "Abbreviations" section at the 

end of the paper. 

Latin expressions should be underlined or typed 

in italics. 

Referencing 

Citation in the text should take the form: (Smith 

and Robinson,1990). 

If several papers are cited by the same author in 

the same year, they should be lettered in sequence 

(1990a), (1990b), etc. When papers are by more 

then three authors they should be cited as (Smith et 

al.,1990). 

In the list, references must be placed in 

alphabetical order. The following models for the 

reference list cover all situations. The punctuation 

given must be exactly followed. 

Redford IR. Evidence for a general relationship 

between the induced level of DNA double 

strand breakage and cell killing after Xirradiation 

of mammalian cells. Int J Radiat 

Biol. 49: 611- 620, 1986. 

Tccioli CE, Cottlieb TM and Blund T. Product of 

the XRCCS gene and its role in DNA repair and 

V(D)J recombination. Science. 265: 1442-1445, 

1994 

Ohlrogge JB. Biochemistry of plant acyl carrier 

proteins. The Biochemistry of Plants: A 

Comprehensive Treatise. Stumpf PK and Conn 

EE (Ed). Academic Press, New York. 137-157, 

1987. 

Weaver RF. Molecular Biology. WCB/Mc Graw- 

Hill.1999. 

Brown LA. How to cope with your supervisor. PhD 

Thesis. University of New Orleans, 2005. 

Web document with no author: Leafy seadragons 

and weedy seadragons 2001. retrieved 

November 13, 2002, from http:// www. 

windspeed.net.au/jenny/seadragons/ 

Web document with author: Dawson J, Smith L and 

Deubert K. Referencing, not plagiarism. 

Retrieved October 31, 2002 from http: 

//studytrekk.lis.curtin.edu.au/ 

Only papers published or in press should be 

cited in the literature list. Unpublished results, 

including submitted manuscripts and those in 

preparation, should be indicated as unpublished 

data in the text.

Submission Policies and Authorship 

Upon submission of a manuscript, it is accepted 

that all co-authors have approved the contents of 

the manuscript and its submission by the 

corresponding author, and that the corresponding 

author is authorized to represent all co-authors in 

pre-publication discussions with JCellMolBiol. 

The corresponding author is responsible for 

ensuring that all the contributors to the relevant 

work are listed as authors and that all authors have 

aggreed to the manuscript’s content and its 

submission to the JCellMolBiol. In case the Journal 

happens to be aware of an authorship dispute, 

authorship must be approved in writing by all of the 

parties. 

Cost 

There are no submission fees or page charges. 

Criteria for the Selection of Manuscripts 

Manuscripts should meet the following criteria: the 

study conducted is material is original and ethical, 

the writing is clear; the study methods are 

appropriate, the data are valid, the conclusions are 

reasonable and supported by the data; the 

information is important; and the topic is 

interesting to our readership. 

Editorial Processes 

Researchers may request informal feedback from 

the editors in a particular manuscript. The 

presubmission process aids in the submission 

decision for authors 

When JCellMolBiol receives a manuscript, the 

Editor and Associate Editor will first decide 

whether the manuscript meets the formal criteria 

specified with “Guidelines for Authors” and 

whether it fits within the scope of the Journal. In 

case of doubt on the basis of initial review, the 

editor will consult other members of the Editorial 

Board. 

Manuscripts that are found suitable for peer 

review will be assigned to two expert reviewers. 

Reviewers may either be Editorial Board members 

or external experts selected by the Editorial Board. 

The corresponding author is notified by e-mail 

when the editor decides to send a paper for review. 

The reviewers will have up to three weeks to 

review the submitted article. After peer review, the 

REVISED 

May 17, 2010 

editor will contact the author. If the author is 

required to submit a revised version, the revised 

version has to be submitted by the author within 

two weeks. Otherwise, the manuscript will be 

removed from the manuscript submission queue 

and will be considered rejected. 

In cases where the referees have requested welldefined 

changes to the manuscript, editors may 

request a revised manuscript that addresses to 

referees’ concerns. The revised version is sent back 

to the original referees for re-review. In cases 

where the referees’ concerns are more wideranging, 

editors may reject the manuscript. The 

revised manuscript should be accompanied by a 

cover letter that includes a point-by-point response 

to referees’ comments and an explanation of how 

the manuscript has been changed. 

As a matter of policy, we do not suppress 

referees’ reports, any comments directed to authors 

are transmitted regardless of what we may think of 

the content. On rare occasions, we may edit a report 

to remove offensive language or comments to 

reveal confidentiality. 

The final decision to accept or reject a 

manuscript will be made by the Editor. If it 

becomes apparent that there are serious problems 

with the scientific content or with violations of our 

publishing policies, the Editor also reserves the 

right to reject a paper even after it has been 

accepted 

After acceptance, the Editor may make further 

changes to the text and figures so that the 

manuscript is readable and clear. Page proofs will 

be sent to the corresponding author via email for 

checking before publication. Corresponding authors 

are sent proofs and are welcome to discuss 

proposed changes with the Editor, but 

JCellMolBiol reserves the right to make the final 

decision about the style. Corrected proofs should be 

sent back to the Editor within three days of receipt, 

otherwise the Editor reserves the rights to correct 

the proofs himself and to send the material for 

publication. 

Appeals 

Authors have the right to ask the Editor to 

reconsider a rejection decision, which is considered 

an appeal. Decisions are reversed only if the Editor 

is convinced that the original decision was a serious 

mistake. If an appeal merits further consideration, 

the Editor may send the author’s response or the 

revised paper to one or more referees, or Editor 

87

88 

may ask one referee to comment on the concerns 

raised by another referee. 

Advance Online Publication 

JCellMolBiol provides Advance Online Publication 

of articles, which benefit authors with an earlier 

publication date and allows the readers’ access to 

accepted papers several weeks before they appear 

in print 

Ethical Issues 

For manuscripts reporting experiments on live 

vertebrates or higher invertebrates, authors must 

declare that the study was approved by the 

institutional ethics committee. Papers describing 

investigations on human subjects must include a 

statement that informed consent was obtained from 

all subjects. 

Plagiarism 

If portions of the manuscript have already been 

published by the author on other journals or 

websites, JCellMolBiol Editorial Board needs to 

know which portions of the manuscript have been 

previously published and where. The author should 

include a note in the cover letter indicating which 

portions have been published elsewhere. 

In case of any suspicion on scientific misconduct or 

dishonesty in research, JCellMolBiol reserves the 

right to forward any submitted manuscript to an 

appropriate authori-ty for investigation. 

Copyright Notice 

It is the responsibility of the submitting author to 

ensure that the authorship of the paper reflects the 

contributions of the authors to the work described, 

and that all listed authors have agreed to the 

submission of the manuscript in its current form. 

Conditions of publication in JCellMolBiol are 

that the paper has not already been published 

elsewhere; that it is not currently being considered 

for publication else-where; all persons designated 

as authors should qualify for authorship, and all 

those who qualify should be listed. If accepted, 

Haliç University and JCellMolBiol have the 

exclusive license to publish. 

JCellMolBiol is freely available to individuals 

and institutions. Copies of this Journal and articles 

in this journal may be distributed for research or for 

REVISED 

May 17, 2010 

educational purposes free of charge. However, 

commercial use of articles contained herein is 

prohibited without the written consent of the editor. 

Publication Agreement 

The corresponing author is required to assign the 

Publication Agreement Form in order to publish the 

submitted manuscript in JCellMolBiol.


Review Article 



S.R. RAO, S. TREVEDI, D. EMMANUEL, K. MERITA and M. HYNNIEWTA 

Research Articles 

Genetic diversity of Penicillium species isolated from various sources in Sarawak, Malaysia 

H.A. ROSLAN, C.S. NGO and S. MUID 

The sensitivity of the human chromosomes to ethyl methanesulfonate (EMS) 

S. BUDAK-DİLER and M. TOPAKTAŞ 

Protective effect of pomegranate peel ethanol extract against ferric nitrilotriacetate 

induced renal oxidative damage in rats 

M.M. AHMED and S.E. ALI 

Molecular and cytogenetic evaluation of Y chromosome in spontaneous abortion cases 

G. KOÇ, K. ULUCAN, D. KIRAÇ, D. ERGEÇ, T. TARCAN and A.İ. GÜNEY 

Do simple sequence repeats in replication, repair and recombination genes of mycoplasmas 

provide genetic variability? 

S. TRIVEDI 

Software Reviews 


A. Mansour 


A. Mansour 


A. Mansour 

Instructions for authors 

see page 1 

see page 13 

see page 25 

see page 35 

see page 45 

see page 53 

see page 71 

see page 75 

see page 81 

see page 85

Download - Journal of Cell and Molecular Biology - Haliç Üniversitesi

Create successful ePaper yourself

Delete template?

Save as template?