Download - Journal of Cell and Molecular Biology - Haliç Üniversitesi

jcmb.halic.edu.tr

Download - Journal of Cell and Molecular Biology - Haliç Üniversitesi

Journal of Cell and

Molecular Biology

Volume 7 · No 2 & Volume 8 · No 1 · June 2010

http://jcmb.halic.edu.tr

Sensitivity of the human chromosomes to EMS

Y chromosome microdeletions in spontaneous abortions

Genetic diversity of Penicillium species


Journal of Cell and

Molecular Biology

Volume 7 No 2 & Volume 8 No 1

June 2010

İstanbul-TURKEY


Haliç University

Faculty of Arts and Sciences

Journal of Cell and Molecular Biology

Founder

Gündüz GEDİKOĞLU

President of Board of Trustee

Rights held by

Sait SEVGENER

Deputy Rector

Correspondence Address:

The Editorial Office

Journal of Cell and Molecular Biology

Haliç Üniversitesi

Fen-Edebiyat Fakültesi,

Kaptan Paşa Mah. Darülaceze Cad. No: 14 34384

Okmeydanı-Şişli, İstanbul -Turkey

Phone: +90 212 220 96 96

E-mail: jcmb@halic.edu.tr

Journal of Cell and Molecular Biology is

indexed in ULAKBIM, EBSCO, DOAJ,

EMBASE, CAPCAS, EMBiology, and

Index COPERNICUS

ISSN 1303-3646

Printed at MART Printing House

Adil Meriç ALTINÖZ, İstanbul, Turkey

Tuncay ALTUĞ, İstanbul, Turkey

Canan ARKAN, Munich, Germany

Aglaia ATHANASSIADOU, Patras, Greece

Şehnaz BOLKENT, İstanbul, Turkey

Nihat BOZCUK, Ankara, Turkey

A. Nur BUYRU, İstanbul, Turkey

Kemal BÜYÜKGÜZEL, Zonguldak, Turkey

Hande ÇAĞLAYAN, İstanbul, Turkey

İsmail ÇAKMAK, İstanbul, Turkey

Adile ÇEVİKBAŞ, İstanbul, Turkey

Beyazıt ÇIRAKOĞLU, İstanbul, Turkey

Fevzi DALDAL, Pennsylvania, USA

Zihni DEMİRBAĞ, Trabzon, Turkey

Mustafa DJAMGÖZ, London, UK

Aglika EDREVA, Sofia, Bulgaria

Ünal EGELİ, Bursa, Turkey

Advisory Board

Journal of Cell and

Molecular Biology

Published by

Haliç University

Faculty of Arts and Sciences

Editor

Nagehan ERSOY TUNALI

Associate Editor

Mehmet Ali TÜFEKÇİ

Editorial Board

Baki YOKEŞ

Burcu Irmak YAZICIOĞLU

Kürşat ÖZDİLLİ

Aslı BAŞAR

Deniz ERGEÇ, İstanbul, Turkey

Nermin GÖZÜKIRMIZI, İstanbul, Turkey

Ferruh ÖZCAN, İstanbul, Turkey

Füsun GÜMÜŞEL, İstanbul, Turkey

Candan JOHANSEN, İstanbul, Turkey

Asım KADIOĞLU, Trabzon, Turkey

Maria V. KALEVITCH, Pennsylvania, USA

Valentine KEFELİ, Pennsylvania, USA

Meral KENCE, Ankara, Turkey

Uğur ÖZBEK, İstanbul, Turkey

Sevtap SAVAŞ, Toronto, Canada

Müge TÜRET SAYAR, İstanbul, Turkey

İsmail TÜRKAN, İzmir, Turkey

Mehmet TOPAKTAŞ, Adana, Turkey

Meral ÜNAL, İstanbul, Turkey

Selma YILMAZER, İstanbul, Turkey

Ziya ZİYLAN, İstanbul, Turkey


Journal of Cell and Molecular Biology

CONTENTS Volume 7 No 2 & Volume 8 No 1 June 2010

Review Article

DNA repetitive sequences-types, distribution and function: A review

S.R. RAO, S. TREVEDI, D. EMMANUEL, K. MERITA and M. HYNNIEWTA

Research Articles

Genetic diversity of Penicillium species isolated from various sources in Sarawak,

Malaysia

H.A. ROSLAN, C.S. NGO and S. MUID

The sensitivity of the human chromosomes to ethyl methanesulfonate (EMS)

S. BUDAK-DİLER and M. TOPAKTAŞ

Protective effect of pomegranate peel ethanol extract against ferric nitrilotriacetate

induced renal oxidative damage in rats

M.M. AHMED and S.E. ALI

Molecular and cytogenetic evaluation of Y chromosome in spontaneous abortion cases

G. KOÇ, K. ULUCAN, D. KIRAÇ, D. ERGEÇ, T. TARCAN and A.İ. GÜNEY

Do simple sequence repeats in replication, repair and recombination genes of

mycoplasmas provide genetic variability?

S. TRIVEDI

Software Review

Tcoffee ©: Multipurpose sequence alignments program

A. MANSOUR

UCSC: Genome Browser for genomic sequences

A. MANSOUR

Dotlet©: powerful and easy strategy for pairwise comparisons

A. MANSOUR

Instructions for Authors 85

1

13

25

35

45

53

71

75

81


Journal of Cell and Molecular Biology 7(2) & 8(1): 1-11, 2010 Review Article

Haliç University, Printed in Turkey.

http://jcmb.halic.edu.tr

DNA repetitive sequences-types, distribution and function: A review

Satyawada Rama RAO *,1 , Seema TRIVEDI 2 , Deepika EMMANUEL 2 , Keisham MERITA 1

and Marlykynti HYNNIEWTA 1

1 Cytogenetics and Molecular Biology Laboratory, Department of Biotechnology and Bioinformatics, North-

Eastern Hill University, Permanent Campus, Mawkynroh, Umnsing,

Shillong- 793022, Meghalaya (INDIA)

2 Department of Zoology, Jai Narain Vyas University, Jodhpur- 342005, Rajasthan (INDIA)

(* author for correspondence; srrao22@yahoo.com)

Received: 21 September 2009; Accepted: 14 May 2010

Abstract

The development and use of molecular markers for the detection and exploitation of DNA polymorphism is

one of the most significant developments in the field of molecular genetics. DNA based molecular markers

have acted as versatile tools and have found their own position in various fields like taxonomy, physiology,

embryology, genetic engineering etc. A major step forward in genetic identification is the discovery that

about 30-90% of the genome is constituted by regions of repetitive DNA which are highly polymorphic in

nature. Microsatellites are multilocus probes creating complex banding patterns and are usually non-species

specific occurring ubiquitously. They form an ideal marker system and are dominant fingerprinting markers

and co-dominant STMS (sequence tagged microsatellites) markers. Microsatellites markers have been used

successfully to determine the degree of relatedness among individuals or groups of accessions to clarify the

genetic structure or partitioning of variation among individuals, accessions, populations and species.

Repetitive sequences have been widely used for examining genome and species relationships by in situ and

by Southern hybridization.

Keywords: Satellites, microsatellites, minisatellites, retroposons and proretroviral transposons

Tekrarlı DNA dizileri-tipleri, dağılımları ve fonksiyonları

Özet

DNA polimorfizmlerinin tayini ve kullanılması için moleküler belirteçlerin geliştirip kullanılması moleküler

genetik alanındaki en önemli ilerlemelerden bir tanesidir. DNA tabanlı moleküler belirteçler çok amaçlı

kullanım araçlarıdır ve taksonomi, fizyoloji, embriyoloji, genetik mühendisliği gibi çeşitli alanlar arasında

kendi yerlerini bulmuşlardır. Genetik tayine doğru en büyük adım, genomun hemen hemen %30-90’ının

tekrarlanan, doğada yüksek oranda polimorfik olan DNA dizilerinden oluştuğunun keşfidir. Mikrosatelitler

kompleks şerit paterni oluşturan multilokus problardır ve genellikle sıkça bulunup türe spesifik olmazlar.

Bunlar ideal belirteç sistemini oluştururlar ve dominant parmakizi belirteçleri ve kodominant STMS

belirteçleridirler (sequence tagged microsatellites–dizi işaretli mikrosatelitler). Mikrosatellit belirteçler,

bireyler arasında veya katılan gruplar arasında genetik yapının ya da bireyler, gruplar, populasyonlar ve türler

arasındaki varyasyonun gruplandırılmasının aydınlatılması için, yakınlık derecesinin saptanması amaçlı

olarak başarı ile kullanılmıştır. Tekrarlanan diziler, genom ve türlerin ilişkilerinin in situ ve Southern

hibridizasyonu ile incelenmesi için yaygın olarak kullanılmaktadır.

Anahtar Sözcükler: Satelit, mikrosatelitler, minisatelitler, retropozonlar ve proretroviral transpozonlar


2

Satyawada Rama RAO et. al.

Introduction

The analysis of genetic diversity and relatedness

between or within different species, populations

and individuals is a central task for many

disciplines of biological science. Classical

strategies of evaluating genetic variability are

comparative anatomy, morphology, embryology

and physiology. These are complemented by

analysis of chemical constituents like plant

secondary compounds or with specific characterization

of macromolecules and allozymes. In recent

years, focus has been shifted to the development of

molecular markers based on DNA or protein

polymorphism. The importance of these studies lies

in exploitation of uniqueness of DNA sequences

that facilitate research in diverse disciplines such as

taxonomy, phylogeny, ecology, genetics and plant

breeding.

Establishing an individual's identity is one of

the uses of DNA sequence information that

highlight uniqueness of a particular sample. The

methodology focuses on ways to reduce complexity

of DNA into simple patterns that are representative

of the sample. This type of analysis is called

fingerprinting, profiling, genotyping or identity

testing. Jeffreys et al. (1985) introduced this term to

describe a method for the simultaneous detection of

variable DNA loci by hybridization of specific

multilocus probes with electrophoretically separated

restriction fragments. DNA fingerprinting is

useful for forensic identification, determination of

family relationship, linkage mapping, antenatal

diagnosis, localization of disease loci, determination

of genetic variation, molecular archaeology

and epidemiology (Watkins, 1988; Donis-Keller et

al., 1987; Landegren et al., 1988; Paabo, 1989;

Golenberg et al., 1990). Molecular markers have

been used for identification of individuals, clones,

close relatives, paternity testing or in studies of

reproductive behavior and mating success.

Repetitive sequences as molecular markers

A repeat is recurrence of a pattern whereby DNA

exhibits recurrence of many features. The number

of occurrences of a pattern is called copy number.

The number of copies in a particular tandem repeat

region is termed region copy number. The term

genome copy number refers to number of copies of

tandem or interspersed repeats in genome.

The repetitive DNA family(ies) may be widely

distributed in a taxonomic family or a genus, or

may be specific for a species or chromosome.

Repeats may occur in specific locations in a

genome, e.g. in telomeric regions or scattered

throughout the genome. They may acquire large

scale variation in the sequence and copy number

over evolutionary time-scale. The repetitive

elements are under different evolutionary constraints

as compared to the genes. Hybrid

polyploids are excellent models for studying

evolution of repetitive sequences (Kubis et al.,

1998). These variations are the basis of utilization

of repetitive sequences for taxonomic and

phylogenetic studies (Smith and Flavell, 1974).

There are many classifications of repetitive

DNA based on characteristics measured by

different techniques but consolidation of these

systems defines five broad classes: satellites,

microsatellites and minisatellites, retroposons and

proretroviral transposons. The classification

scheme makes a distinction between repetitive

regions exhibiting tandem repetition and interspersed

repetition but is not precise since each class

retains the characteristics of both. Some of these

repeats are described as follows:

Moderately repetitive DNA includes reiterations

of genes like tRNA, rRNA, hemoglobin etc. that

retain similar or nearly similar sequences due to

duplication. Some of these duplications result in

pseudogenes and may have many copies in the

genome. Some repetitive DNA sequences are

transposable elements since they ct not to enhance

the success of the cell (or organism) they reside in,

behave selfishly and also accumulate to the levels

restricted only by the resources available to them.

The selfish DNA hypothesis of Doolittle and

Sapienza, (1980) assumes that repetitive DNA can

behave in a selfish manner because it is not

functional. Indeed, there is some evidence that its

presence can result in losses of fitness of the host

cell due to mutations caused by transposable

elements. However, some moderately-repetitive

DNA has functions for example, in directing

chromosome movement in eukaryotes (Vogt,

1990). Variations in selfish DNA have the potential

for evolutionary changes, especially when it

changes without having any deleterious effects on

the organism (Flavell et al., 1977). Susumo Ohno

(1970) asserted that "natural selection merely

modified while redundancy created". Duplication

of genes can thus be internal source of novelty in


the genome. If repetitive DNA is transposable, it

may create novel genes. Repetitive DNA is

therefore the "Research & Development"

laboratory of genome, creating both redundancy

and novel sequences that may prove valuable for

genome. However, these repetitive sequences are

generally not used for DNA fingerprinting.

Tandem and interspersed repeats

Tandem repetitions are consecutive head-to-tail,

direct, repetition of a pattern due to local

duplication. Interspersed repetitions are recurrence

of patterns that may or may not be proximal,

formed by either non-local duplication or multiple

introductions of the same or similar extraneous

DNA segments. These repeats are dispersed

throughout the genome and have no restriction on

the relative positions of identical occurrences

occurring in tandem locations. Research indicates

that interspersed repeats are inserts since they

resemble either processed RNAs i.e. retroposons, or

viruses i.e. proretroviral transposons. In addition, a

suspected target sequence for insertion occurs at

both ends of these repeats as expected for a circular

DNA crossover insertion. Furthermore, some

repeats actively move within the genome, such as

jumping genes in maize.

DNA repeat patterns also classify as direct,

indirect, complement, reverse complement or

palindrome. A direct or forward repeat is the

.

DNA repetitive sequences

recurrence of a pattern on the same strand in the

same nucleotide order; e.g. ACCG recurs as

ACCG. An indirect, inverse or reverse repeat recurs

on the same strand but the order of the nucleotides

is reverse, e.g. the indirect recurrence of ACCG is

GCCA. Complement repeats are repeats where the

nucleotides are complemented according to Watson

Crick pairing, e.g. the complement of ACCG is

TGGC. A reverse complement repeat recurs on the

same strand but, the nucleotides are complemented

and the order of the nucleotides is reversed; e.g. the

reverse complement of ACCG is CGGT. In DNA,

most repetitions occur as forward or reverse

complement repeats and rarely as reverse or

complement repeats (Grumbach and Tahi, 1994).

Palindrome is a combination of two consecutive

occurrences in opposite orientations and read the

same when read from left to right or vice-versa.

Repetitive DNA sequences, divided into highrepeat

satellite DNA which replicates thousands or

millions of times and "moderate-repeat" minisatellite

and microsatellite DNA which replicates

tens to perhaps a thousand times, account for

varying proportions of the genome of multicellular

eukaryotes. An example of representa-tive data

from eukaryotes has been given in Table 1.

Prokaryotes contain little or no repetitive

sequences. Noncoding repetitive DNA varies from

one group of organisms to another; individual to

individual and therefore used as DNA fingerprinting

tool.

Table 1. Proportion of repetitive sequences of genomic DNA in different eukaryotes.

High repeat

Moderate repeat

Non repetitive

Tandem repeats and Satellite DNA

Drosophila Xenopus Mouse Tobacco

13%

13%

74%

As repeats were discovered in different locations

exhibiting different copy numbers, new terms arose

such as satellite, minisatellite and microsatellite.

Some researchers refer to all types of satellites as

tandem repeats and describe a specific tandem

repeat region according to its location within the

genome, its periodicity, pattern structure and copy

3%

43%

54%

10%

20%

70%

5%

65%

30%

number. These repeats were first identified on a

cesium chloride buoyant density gradient as peaks

separate from the primary DNA peak. The separate

or satellite peaks were composed of array of highly

conserved tandem repeats localized to heterochromatic

regions of chromosomes like

centromeres (Schueler et al., 2001). The structure

of a tandem repeat region has well-conserved

3


4

Satyawada Rama RAO et. al.

pattern but varies in size from less than 20 bp to

several thousand bp.

Structural and functional roles

Tandem repeats play significant structural and

functional roles. They occur in abundance in

structural areas such as telomeres, centromeres and

histone binding regions. They play a regulatory role

near genes and perhaps even within genes.

Transcription

The precise role of tandem repeats in transcription

regulation is not known. Since nucleosomes can

repress or enhance transcription initiation and

elongation (Hartzog and Winston, 1997; Kornberg

and Lorch, 1999) repeats may influence

transcription by affecting nucleosome positioning

and stability. Tighter bonds between the histone

complex and repeats restrict access for RNA

polymerase and regulatory proteins (Dai &

Rothman-Denes, 1999). This may happen by

changing the degree and direction of DNA

supercoiling or forming alternative DNA structures

such as cruciforms and hairpins (Shlyakntenko et

al., 1998; Ohyama, 2001). Tandem repeats having

an alternating purine (R=A or G) pyrimidine (Y=C

or U/T) pattern forms Z-DNA (Yang et al., 1996)

and repeats with a RRY or a YRY pattern form

triplex DNA structures (Grabcyzk and Usdin,

2000). The degree of repression is directly

proportional to repeat length.

Centromeric and subtelomeric satellite DNA

families

The tandem satellite DNA sequences exhibit

characteristic chromosomal locations, usually at

subtelomeric (or intercalary repetitive sequences)

and centromeric regions (Heslop-Harrison et al.,

2003; Jiang et al., 2003). Satellite DNA families

may arise de novo due to molecular mechanisms

like unequal crossing over, rolling circle

amplification, replication slippage and mutation.

Satellite DNA have variable repeat unit length

(sometimes equivalent to micro or minisatellite

length), often forming arrays spanning up to 100

Mb (Charlesworth et al., 1994; Kubis et al., 1998;

Schmidt and Heslop-Harrison, 1998; Vergnaud and

Denoeud, 2000). However, satellite repeat

monomer lengths of 140 – 180 bp and 300 – 360

bp, corresponding to the length of the mono and

dinucleosomes are most the common (Hemleben,

1990; Traut, 1991; Macas et al., 2002).

Centromeric tandem repeats ranging from 150-

200 bp in length (Henikoff et al., 2001) are

essential components of a functional centromere. A

functional centromere has been defined as the DNA

sequence which interacts with the kinetochore

where the interaction between centromere-kinetochore

appears to be mediated by DNA-protein

recognition process (Jiang et al., 2003). The core

sufficient for centromeric function is an alpha

satellite about 3 Mbp long having a 171 bp pattern

recurring in a tandem fashion. (Schueler et al.,

2001; Zhong et al., 2002).

A highly repetitive 180 bps centromeric satellite

DNA family constituting between 2-5% of the

Arabidopsis thaliana genome is the key component

of its centromere/kinetochore complex (Nagaki et

al., 2003a,b). These repeats are occasionally

interrupted by the Athila retrotransposons, although

the latter are mainly clustered in pericentromeric

regions (Heslop-Harrison et al., 1999; Nagaki et al.,

2003a,b). Similarly, centromeric DNA in several

plants species including rice, maize, wheat, Beta

species and Zingeria biebersteiniana mainly

contain satellite sequence repeats and retrotransposons

(Gindullis et al., 2001; Kishii et al.,

2001; Kumekawa et al., 2001; Saunders and

Houben, 2001; Cheng et al., 2002; Nagaki et al.,

2003a,b). A high monomer divergence is observed

within several centromeric repetitive DNA families

thereby indicating presence of chromosome

specific variant sequences (Harrison and Helsop-

Harrison, 1995; Nagaki et al., 1998; Helsop-

Harrison et al., 2003). For example, chromosome

specific 180 bp satellite repeat variants in

Arabidopsis thaliana may be explained by the

possibility that either the repeat sequences on each

chromosome have been homogenizes independently

or specific variants of the satellite sequence have

been amplified on each chromosome (Heslop-

Harrison et al., 1999).

The subtelomeric regions also contain repetitive

sequences (review in Pryde et al., 1997). Not all

species have the same structure but all have

structures containing tandem repeats, interspersed

repeats or both (Pryde et al., 1997). Degenerate

TTAGGG repeats enable alignment other subtelomeric

regions allowing sequence exchange

between subtelomeres (Flint et al., 1997).


Minisatellite and Microsatellite DNA

Hypervariable regions, also known as variable

number of tandem repeats (VNTRs) classified as

minisatellites and microsatellites are regions that

contain a variable copy number. These repeats are

found throughout the genome (Vogt, 1990) but

rarely within genes. Most regions contain short to

moderate region copy number (Jeffreys, 1985).

DNA fingerprinting capitalizes on the differences

between alleles at specific VNTR loci. Various

human diseases are attributed to high copy numbers

associated with some VNTR locus.

Minisatellites are characterized by moderate

length patterns, usually less than 50 bp (Jeffreys,

1985) with an array of 0.5 - 30kb. Two types of

variability are observed, viz., one displays copy

number variation with each replication event

whereas the other displays distinct alleles within a

population such that different alleles contain

different copy numbers.

Microsatellites, also known as simple sequence

repeats (SSRs) or simple tandem repeats (STRs)

have a short well-conserved pattern length of 2 to 6

bp and region copy number of 10 to 40 pattern

copies. Microsatellites have been found in noncentromeric

regions, many of them being located

either near or within genes.

Automatic identification and characterization of

tandem repeats is crucial as genome projects

generate an ever-increasing quantity of sequence

data. Tandem repeats increase the complexity of

genome sequence analysis algorithms. For instance,

the process of generating full chromosome

sequences often utilizes the sequence assembly

procedure; a procedure that stitches short, similar

fragments together to reconstruct a larger sequence.

The consecutive recurrence of a pattern associated

with tandem repeats confuses this process. Some

commercially available algorithms avoid

assembling tandem repeat regions. Others often

assemble moderate-sized tandem repeat regions

improperly. At present, algorithms are being

developed for handling tandem repeat regions.

The mechanism responsible for minisatellite and

simple sequence polymorphisms

Minisatellites and simple sequences are often

characterized by high mutation rates (up to 5%),

which may involve either internal heterogeneity of

repeats or their number. Mutation rates also show

positive correlation with the total size of the array

DNA repetitive sequences

of repeats. In accordance with these observations,

high molecular weight bands within a multilocus

fingerprint are often more variable than bands

occurring in the low molecular weight range. The

molecular basis of both minisatellites and simple

sequence variability is still debatable. Possible

mechanism include replication slippage, transposition,

recombinational events and/or unequal

exchange between sister chromatids or between

homologous chromosomes and gene conversion

(reviewed by Jarman and Wells, 1989; Jeffreys et

al., 1990; Richards and Sutherland 1992; Wolff et

al., 1991.)

The slippage hypothesis implicates mispairing

of slipped-strand during the replication process.

Strand slippage may happen due to shift in origin of

replication especially during lagging strand

synthesis. Strand slippage and mismatch appear to

be nucleotide specific. Differential activities of

mismatch pair of (CAG)n repeats occur but not of

(CTG)n repeats. Certain factors like the length of

the repeats and replication direction play a role in

destabilizing (CAG)n (CTG)n repeat. Such

positioning effects results in loop formation due to

stand slippage and results in expansion or reduction

of repeat during replication.

Several lines of evidence have lent support to

the recombination hypothesis:

• A variety of minisatellite core sequences

share homology of the bacterial recombination

signal chi.

• Minisatellite - like sequences have been

found at sites of meiotic crossing over.

• Both minisatellite and macrosatellites

behave as recombinational hot spots in

transfected mammalian cells.

Wolff et al., (1991) observed no exchange of

flanking markers in a newly created minisatellite

allele, thus ruling out unequal exchange between

homologous chromosomes as a mutational mechanism.

In human minisatellite locus, MS32

(reviewed by Jeffreys et al., 1985), 5’ end of the

array has a strong mutation bias, suggesting

existence of a mutational hot spot. Some mutant

alleles contain segments from both parental alleles,

providing evidence for interallelic exchange. It is

suggested that the major mutational process

involves nonreciprocal transfer of repeats from a

donor allele to the 5’ end of a recipient allele.

Therefore, recombinational processes as well as

replication slippage may contribute to the creation

of minisatellite and simple sequence variability.

However, other (yet unidentified) mechanisms may

5


6

Satyawada Rama RAO et. al.

also be involved, especially in case of the explosive

amplification of microsatellite like trinucleotide

repeats associated with human genetic diseases and

polymorphism. Structural analysis of mutated vs.

parental alleles may help to gain more information

about the mutational mechanisms. In this respect,

transgenic systems will be informative, since

successive deletion of the flanking DNA will allow

precise location of mutational hot spots.

Retroposons

Retroposons resemble processed RNAs and

transpose passively via RNA intermediate (Weiner,

1986). Each element is composed of an A-rich tail

at the 3' end and short target site duplications

(direct repeats of 5-21 bp) flanking the repeat

(Rabin, 1985). Two main subclasses dominate this

class:

Short Interspersed Elements (SINEs)

These are distributed throughout the non-

centromeric regions of genome (over 100,000

copies per genome) (Weiner, 1986). A SINE

contains one or more RNA polymerase III,

promoter sites and an A-rich region. One subfamily

is composed of a head-to-tail catenation of two

promoter site, A-rich region pairs (Weiner, 1986).

Both subfamilies are flanked by short direct repeats

of 5 to 21 bp. Primate specific Alu sequence (5 to 9

kbp) is a SINE with two promoter sites and a

dimer. The uniqueness of Alu sequences provides a

wonderful tool for separating primate DNA from

that of other species. SINEs present challenges to

sequence assembly due to their high genome copy

number (300,000 to 500,000 copies) (Rogers,

1985).

Long Interspersed Elements (LINEs)

LINEs are composed open reading frames (ORFs)

followed by a 3' A-rich region having 20,000 to

50,000 copies per genome (Hutchison et al., 1989;

Weiner, 1986). Direct repeats of 6-15 bp flank the

element. L1 family (primary LINE family) is 6 to 7

kbp long. The consensus structure of the family is

well defined but not well conserved because L1

element can deviate significantly from the structure

such that entire structural components are deleted

or duplicated (Weiner, 1986).

Proretroviral transposons

Proretroviral transposons are mobile elements that

transpose via RNA intermediate (Varmus and

Brown, 1989). Their structure and content

resembles integrated viruses and often contain

genes encoding viral products, e.g. protease,

reverse transcriptase and integrase (Boefe and

Corces, 1989). The LTRs contain transcriptional

signals for initiating and terminating transcripts, a

promoter, an enhancer and a polyadenylation signal

(Temin, 1985; Schmid et al., 1990). Inverse repeats

exist at the ends of each LTR and always begin

with the bases, TG, and end with CA (Temin,

1985). The two LTRs and the genes are flanked by

4 to 6 bp direct repeats.

Other recurring genetic features

DNA contains many recurring features that do not

classify as tandem or interspersed repeat. A gene

cluster is a group of proximal genes having similar

sequence and often, similar structure but, different

function. There may be requirement for multiple

copies of functional genes tRNA or rRNA genes.

Copies of promoters and other regulatory regions

associated with many genes also do not classify as

repetitive DNA.

Telomeres

Telomeric DNA is G-rich consisting of the

3′overhang and adjacent tandem repeat with wide

variation in length across species (reviewed in

Blackburn, 1991; Hemann and Greider, 1999). For

example, length of telomere TTAGGG repeats in

humans is 5 to15 kbp but in mouse (Mus musculus)

it is ~50 kbp. Yeast, Saccharomyces cerevisiae, has

irregular pattern of TG1-3 and repeat length of

~300 bp. A recent model suggests that this region

does a d-loop-t-loop by having the 3′ overhang

invade the tandem repeat (Griffith et al., 1999).

This invasion forms a triplex DNA structure, dloop,

and encloses a large segment of duplex DNA

in a terminal loop or t-loop. Telomere length and

size of loops is species specific (Shore, 2001).

Universal presence of this structure across species

is not clear though there may be telomeres that are

unable to form a t-loop (Griffith et al., 1999).


Nucleosomes

Periodicity of di-nucleotides (TATA-tetrads) or

tandem repeat with a 10 bp pattern of 5’

TATAA(A/C)CG(T/C)C 3’ band DNA and form

association with histone proteins (Widlund et al.,

1997). However, tandem repeats may increase or

decrease nucleosome stability. For example, a

tandem repeat having a CAG (=CTG) pattern

located close to a nucleosome increases its stability

(Wang et al., 1994; Wang and Griffith, 1995;

Godde and Wolffe, 1996). On the other hand,

tandem repeat CGG (=CCG) has no impact unless

it is methylated. Methylated CGG (=CCG) with a

limited copy number increase the nucleosome

stability while those with large copy numbers

decrease nucleosome stability (Godde et al., 1996;

Wang and Griffith, 1996).

Tandem repeats in genes

Tandem repeat hypervariability enables

identification of genes e.g. antifreeze gene and

several degenerative diseases. Repeats may help in

stability of transcripts or proteins but repeat

expansions and instability (particularly of

trinucleotide repeats) lead to neurological disorders

and cancer (Ashley and Warren, 1995; Mitas,

1997). Long stretch of CAG repeats translated into

polyglutamine tracts result in a gain-of-function,

possibly a toxin (Perutz et al., 1994; Baldi et al.,

1999). CGG, AGG and TGG repeats form

quadriplex and GAA repeats form triplex structures

that can block or reduce transcription and DNA

replication (Sinden, 1999). CGG repeats also

destabilize nucleosomes (Sinden, 1999) due to CpG

hypermethylation leading to promoter repression

and lack of gene expression (Nelson 1995, Baldi et

al., 1999). On the other hand, CTG repeats stabilize

nucleosomes and block replication forks in E. coli

(Sinden, 1999).

Evolution

Repeats have a role in genome evolution and

possibly in C-value paradox. Variation in nuclear

DNA amount in higher plants species exemplifies

this. The variation (>2500 fold) in 1C DNA content

in angiosperms ranges from 0.05 picograms in

Cardamine amara to 127.4 picograms in Fritillaria

assyriaca (Bennett, 1985). Part of such variation is

due to the numerical changes in chromosomes but

in many, there is substantial variation resulting

DNA repetitive sequences

from amplification or deletion of DNA sequences.

Chromosomes of many monocot and dicot species

contain fast reassociating highly repetitive fraction,

slow reassociating middle repetitive fraction and

single copy sequences (Britten and Kohne, 1968;

Smith and Flavell, 1974; Flavell et al., 1977;

Katsiotis et al., 2000). These sequences may be

dispersed repetitive sequences including transposeable

elements or tandem repeats. The retroelement

class forms sometimes upto 50% component of

plant genomes (Guidet et al., 1991; Heuros et al.,

1993; Kubis et al., 1998; Bennetzen, 2000;

Katsiotis et al., 2000; Linares et al., 2000; Ananiev

et al., 2002).

References

Ananiev EV, Vales MI, Phillips RL and Rines HW.

Isolation of A/D and C genome specific

dispersed and clustered repetitive DNA

sequences from Avena sativa. Genome. 45: 431-

441, 2002.

Ashley CT and Warren ST. Trinucleotide repeat

expansion and human disease. Annu Rev Genet.

29: 703-728, 1995.

Baldi P, Brunak S, Chauvin Y and Pedersen AG.

Structural basis for triplet repeat disorders: a

computational analysis. Bioinformatics. 15:

918-929, 1999.

Bennett MD. Interspecific variation in DNA

amount and the nucleotypic dimension. In Plant

genetics (UCLA symposium on molecular and

cellular biology), Freeling M (Ed). New York:

Alan R. Liss. 283-302, 1985.

Bennetzen JL. Transposable element contributions

to plant gene and genome evolution. Plant Mol

Biol. 42: 251-269, 2000.

Blackburn EH. Telomeres. Trends Biochem Sci. 16:

378–381, 1991.

Boefe JD and Corces VG. Transcription and

reverse transcription of retroposons. Annu Rev

Microbiol. 43: 403-434, 1989.

Britten RJ and Koehne DE. Repeated sequences in

DNA. Science. 161: 529-540, 1968.

Charlesworth B, Sniegowski P and Stephan W. The

evolutionary dynamics of repetitive DNA in

eukaryotes. Nature. 371: 215-220, 1994.

7


8

Satyawada Rama RAO et. al.

Cheng Z, Dong F, Langdon T, Ouyang S, Buell

CR, Gu M, Blattner FR and Jiang J. Functional

rice centromeres are marked by a satellite repeat

and a centromere-specific retrotransposon.

Plant Cell. 14: 1691-1704, 2002.

Dai X and Rothman-Denes LB. DNA structure and

transcription. Curr Opin Microbiol. 2: 126-130,

1999.

Donis-Keller H, Green P, Helms C, Cartinhour S,

Weiffenbach B, Stephens K, Keith TP, Bowden

DW, Smith DR, Lander ES , Botstein D, Akots

G, Rediker KS, Gravius T, Brown VA, Rising

MB, Parker C, Powers JA, Watt DE, Kauffman

ER, Bricker A, Phipps P, Muller-Kahle H,

Fulton TR, Ng S, Schumm JW, Braman JC,

Knowlton RG, Barker DF, Crooks SM, Lincoln

SE, Daly MJ and Abrahamson J. A genetic

linkage map of the human genome. Cell. 51:

319-337, 1987.

Doolittle WF and Sapienza C. Selfish genes, the

phenotype paradigm and genome evolution.

Nature. 284: 601-603, 1980.

Flavell RB, Rimpau J and Smith DB. Repeated

sequence DNA relationships in four cereal

genomes. Chromosoma. 63: 205-222, 1977.

Flint J, Bates GP, Clark K, Dorman A, Willingham

D, Roe BA, Micklem G, Higgs DR and Louis

EJ. Sequence comparison of human and yeast

telomeres identifies structurally distinct

subtelomeric domains. Hum Mol Genet. 6:

1305-1314, 1997.

Gindullis F, Desel C, Galasso I and Schmidt T. The

large-scale organization of the centromeric

region in Beta species. Genome Res. 11: 253-

265, 2001.

Godde JS and Wolffe AP. Nucleosome assembly

on CTG triplet repeats. J Biol Chem. 271:

15222-15229, 1996.

Godde JS, Kass SU, Hirst MC and Wolffe AP.

Nucleosome assembly on methylated CGG

triplet repeats in the fragile X mental retardation

gene 1 promoter. J Biol Chem. 271: 24325-

24328, 1996.

Golenberg EM, Giannasi DE, Clegg MT, Smiley

CJ, Durbin M, Henderson D and Zurawski G.

Chloroplast DNA sequence from a miocene

Magnolia species. Nature. 344: 656-658, 1990.

Grabczyk E and Usdin K. Alleviating transcript

insufficiency caused by Friedreich’s ataxia

triplet repeats. Nucl Acids Res. 28: 4930-4937,

2000.

Griffith JD, Comeau L, Rosenfield S, Stansel RM,

Bianchi A, Moss H and de Lange T.

Mammalian telomeres end in a large duplex

loop. Cell. 97: 503-514, 1999.

Grumbach S and Tahi F. A new challenge for

compression algorithms: genetic sequences. J

Inform Process Management. 30: 875-886,

1994.

Guidet F, Rogowsky PM, Taylor C, Song W and

Langridge P. Cloning and characterization of a

new rye-specific repeated sequence. Genome.

34: 81-87, 1991.

Harrison GE and Heslop-Harrison JS. Centromeric

repetitive DNA in the genus Brassica. Theor

Appl Genet. 90: 157-165, 1995.

Hartzog GA and Winston F. Nucleosomes and

transcription: recent lessons from genetics. Curr

Opin Genet Dev. 7: 192-198, 1997.

Hemleben V. Molekularbiologie der Pflanzen.

UTB. Gustav Fischer Verlag, Stuttgart. 1990.

Hemann MT and Greider CW. G-strand overhangs

on telomeres in telomerase deficient mouse

cells. Nucl Acids Res. 27: 3964-3969, 1999.

Henikoff S, Ahmad K and Malik HS. The

Centromere Paradox: Stable inheritance with

rapidly evolving DNA. Science. 293: 1098-

1102, 2001.

Heslop-Harrison JS, Murata M, Ogura Y,

Schwarzacher T and Motoyoshi F.

Polymorphisms and genomic organization of

repetitive DNA from centromeric regions of

Arabidopsis chromosomes. Plant Cell. 11: 31-

42, 1999.

Heslop-Harrison JS, Brandes A and Schwarzacher

T. Tandemly repeated DNA sequences and

centromeric chromosomal regions of

Arabidopsis species. Chromosome Res. 11: 241-

253, 2003.

Hueros GY and Ferrer E. A structural and

evolutionary analysis of a dispersed repetitive

sequence. Plant Mol Biol. 22: 635-643, 1993.


Hutchison III CA, Hardies SC, Loeb DD, Shehee

WR and Edgell MH. LINEs and related

retroposons: Long interspersed repeated

sequences in the eukaryotic genome. In Mobile

DNA. Berg DE and Howe MM (Ed). American

Society for Microbiology, Washington D.C.,

593-617, 1989.

Jarman AP and Wells RA. Hypervariable

minisatellites, recombinators or innocent

bystanders? Trends Genet. 5: 367-371, 1989.

Jeffreys AJ, Wilson V and Thein SL. Hypervariable

“minisatellite” regions in human DNA. Nature.

314: 67-73, 1985.

Jeffreys AJ, Neumann R and Wilson V. Repeat unit

sequence variation in minisatellites: a novel

source of DNA polymorphism for studying

variation and mutation by single molecule

analysis. Cell. 60: 473-485, 1990.

Jiang J, Birchler JA, Parrott WA and Dawe RK. A

molecular view of plant centromeres. Trends

Plant Sci. 8: 570-575, 2003.

Katsiotis A, Loukas M and Heslop-Harrison JS.

Repetitive DNA, genome and species

relationships in Avena and Arrhenatherum

(Poaceae). Ann Bot. 86: 1135–1142, 2000.

Kishii M, Nagaki K and Tsujimoto H. A tandem

repetitive sequence located in the centromeric

region of common wheat (Triticum aestivum)

chromosomes. Chromosome Res. 9: 417-428,

2001.

Kornberg RD and Lorch Y. Twenty-five years of

the nucleosome fundamental particle of the

eukaryote chromosome. Cell. 98: 285-294,

1999.

Kubis S, Schmidt T and Heslop-Harrison JS.

Repetitive DNA elements as a major component

of plant genomes. Ann Bot. 82: 45-55, 1998.

Kumekawa N, Hosouchi T, Tsuruoka H and Kotani

H. The size and sequence organization of the

centromeric region of Arabidopsis thaliana

chromosome 4. DNA Res. 8: 285–290, 2001.

Landegren U, Kaiser R, Caskey CT and Hood L.

DNA diagnostics-molecular techniques and

automation. Science. 242: 229-237, 1988.

Linares C, Irigoyen ML and Fominaya A.

Identification of C-genome chromosomes

involved in intergenomic translocations in

DNA repetitive sequences

Avena sativa L., using cloned repetitive DNA

sequences. Theor Appl Genet. 100: 353-360,

2000.

Macas J, Meszaros T and Nouzova M. PlantSat: a

specialized database for plant satellite repeats.

Bioinformatics. 18: 28-35, 2002.

Mitas M. Trinucleotide repeats associated with

human disease. Nucl Acids Res. 25: 2245-2254,

1997.

Nagaki K, Song J, Stupar RM, Parokonny AS,

Yuan Q, Ouyang S, Liu J, Hsiao J, Jones KM,

Dawe RK, Buell CR and Jiang J. Molecular and

cytological analyses of large tracks of

centromeric DNA reveal the structure and

evolutionary dynamics of maize centromeres.

Genetics.163: 759-770, 2003a.

Nagaki K, Talbert PB, Zhong CX, Dawe RK,

Henikoff S and Jiang J. Chromatin

immunoprecipitation reveals that the 180-bp

satellite repeat is the key functional DNA

element of Arabidopsis thaliana centromeres.

Genetics. 163: 1221-1225, 2003b.

Nagaki K, Tsujimoto H and Sasakuma T. A novel

repetitive sequence of sugar cane, SCEN

family, locating on centromeric regions.

Chromosome Res. 6: 295-302.

Nelson DL (1995). The fragile X syndromes.

Seminars in Cell Biology. 6: 5-11, 1998.

Ohyama T. Intrinsic DNA bends: an organizer of

local chromatin structure for transcription.

BioEssays. 23: 708–715, 2001.

Paabo S. Ancient DNA: extraction,

characterization, molecular cloning, and

enzymatic amplification. Proc Natl Acad Sci

U.S.A. 86(6): 1939-1943, 1989.

Perutz MF, Johnson T, Suzuki M and Finch JT.

Glutamine repeats as polar zippers: their

possible role in inherited neurodegenerative

diseases. Proc Natl Acad Sci U.S.A. 91: 5355-

5358, 1994.

Pryde FE, Gorham HC and Louis EJ. Chromosome

ends: all the same under their caps. Curr Opin

Genet Dev. 7: 822-828, 1997.

Rabin M. In "Discovering Repetitions in Strings,"

Combinatorial Algorithms on Words.

9


10

Satyawada Rama RAO et. al.

Apostolico and Galil (Ed). NATO ASI Series.

12: 279-288, 1985.

Richards RI and Sutherland GR. Simple repeat

DNA is not replicated simply. Nat Genet. 6:

114-116, 1994.

Rogers JH. Long interspersed sequences in

mammalian DNA: Properties of newly identified

specimens. Biochim Biophys. 824: 113-120,

1985.

Saunders VA and Houben A. The pericentromeric

heterochromatin of the grass Zingeria

biebersteiniana (2n = 4) is composed of

Zbcen1-type tandem repeats that are

intermingled with accumulated dispersedly

organized sequences. Genome. 44: 955-961,

2001.

Schmid CW, Wong EF and Deka N. Single copy

sequences in galago DNA resembles a repetitive

human retrotransposon-like family. J Mol Evol.

31: 92-100, 1990.

Schmidt T and Heslop-Harrison JS. Genomes,

genes and junk: the large-scale organization of

plant chromosomes. Trends Plant Sci. 3: 195-

199, 1998.

Schueler MG, Higgins AW, Rudd MK, Gustashaw

K and Willard HF. Genomic and genetic

definition of a functional human centromere.

Science. 294: 109-115, 2001.

Shlyakhtenko LS, Potaman VN, Sinden RR and

Lyubchenko YL. Structure and dynamics of

supercoil-stabilized DNA cruciforms. J Mol

Biol. 280: 61-72, 1998.

Shore D. Telomeric chromatin: replicating and

wrapping up chromosome ends. Curr Opin

Genet Dev. 11: 189-198, 2001.

Sinden RR. Human genetics ’99: trinucleotide

repeats - Biological implications of the DNA

structures associated with disease-causing

triplet repeats. Am J Hum Genet. 64: 346-353,

1999.

Smith DB and Flavell RB. The relatedness and

evolution of repeated nucleotide sequences in

the genomes of some Gramineae species.

Biochem Genet. 12: 243-256, 1974.

Susumu O. Evolution by gene duplication.

Springer-Verlag, New York, NY. ISBN 0-04-

575015-7, 1970.

Temin HM. Reverse transcription in the eukaryotic

genome: retroviruses, pararetroviruses, retrotransposons,

and retrotranscripts. Mol Biol Evol.

2: 455-468, 1985.

Traut W. Chromosomen Klassische and molekulare

Cytogenetik. Springer-Verlag, Berlin, 1991.

Varmus HE and Brown PO. Retroviruses. In

Mobile DNA. Berg D E and Howe M M (Ed)

ASM Publications, New York. 35-56, 1989.

Vergnaud G and Denoeud F. Minisatellites:

Mutability and genome architecture. Genome

Res.10: 899-907, 2000.

Vogt P. Potential genetic functions of tandem

repeated DNA sequence blocks in the human

genome are based on a highly conserved

“chromatin folding code”. Hum Genet. 84: 301-

336, 1990.

Wang YH, Amirhaeri S, Kang S, Wells RD and

Griffith JD. Preferential nucleosome assembly

at DNA triplet repeats from the myotonic

dystrophy gene. Science. 265: 669-671, 1994.

Wang YH and Griffith J. Expanded CTG triplet

blocks from the myotonic dystrophy gene create

the strongest known natural nucleosome

positioning elements. Genomics. 25: 570-573,

1995.

Wang YH and Griffith J. Methylation of expanded

CCG triplet repeat DNA from fragile X

syndrome patients enhances nucleosome

exclusion. J Biol Chem. 271: 22937-22940,

1996.

Watkins PC. Restriction Fragment Length

Polymorphism (RFLP): application in human

chromosome mapping and genetic disease

research. Biotechniques. 6: 310-320, 1988.

Weiner AM, Deininger PL and Efstratiadis A.

Nonviral retroposons: genes, pseudogenes, and

transposable elements generated by the reverse

flow of genetic information. Annu Rev Biochem.

55: 631-661, 1986.

Widlund HR, Cao H, Simonsson S, Magnusson E,

Simonsson T, Nielsen PE, Kahn JD, Crothers

DM and Kubista M. Identification and

characterization of genomic nucleosomepositioning

sequences. J Mol Biol. 267: 807-

817, 1997.


Wolff RK, Plaeke R, Jeffreys AJ and White R.

Unequal crossing over between homologous

chromosomes is not the major mechanism

involved in the generation of new alleles at

VNTR loci. Genomics. 5: 382-384, 1991.

Yang CF, Kim JM, Molinari E and DasSarma S.

Genetic and topological analyses of the bop

promoter of Halobacterium halobium:

stimulation by DNA supercoiling and non-B-

DNA structure. J Bacteriol. 178: 840-845,

1996.

Zhong CX, Marshall JB, Topp C, Mroczek R, Kato

A, Nagaki K, Birchler JA, Jiang J and Dawe

RK. Centromeric retroelements and satellites

interact with Maize kinetochore protein

CENH3. Plant Cell. 14: 2825-2836, 2002.

DNA repetitive sequences

11


Journal of Cell and Molecular Biology 7(2) & 8(1): 13-23, 2010 Research Article

Haliç University, Printed in Turkey.

http://jcmb.halic.edu.tr

Genetic diversity of Penicillium species isolated from various sources

in Sarawak, Malaysia

Hairul Azman ROSLAN *, 1 , Chua Suk NGO 1 and Sepiah MUID 2

1 Department of Molecular Biology, Faculty of Resource Science and Technology, Universiti Malaysia

Sarawak, 94300 Kota Samarahan, Sarawak Malaysia

2 Department of Plant Sciences and Environmental Ecology, Faculty of Resource Science and

Technology, Universiti Malaysia Sarawak, 94300 Kota Samarahan, Sarawak Malaysia

(* author for correspondence; rhairul@frst.unimas.my )

Received: 26 December 2008; Accepted 30 December 2009

Abstract

Borneo Island is one of the megadiversity centres of the world and contain vast amount of flora and fauna.

The Penicillium species are among the most commonly occurring and economically important members of

micro-fungi family. In this study, morphological and random amplification polymorphic DNA (RAPD)

molecular methods were used to group and determine genetic variability and relationship among twenty

Penicillium isolates from various locations in Western part of Borneo Island that was maintained in the pure

culture collection of University Malaysia Sarawak. Comparison between morphological and molecular

method using M13 and OPD10 primers were undertaken and showed that in some cases, the groupings of

isolates based on morphological method were consistent with molecular groupings with a few exceptions.

Molecular analysis also indicated genotype variability between the isolates with little correlation with either

the origin of soil or geographical location.

Keywords: Penicillium species, morphology, RAPD, M13, variation

Malezya Sarawak’ta Farklı Kaynaklardan Elde Edilen Penicillium Türlerinin

Genetik Çeşitliliği

Özet

Borneo adası dünyanın en çok çeşitliliğe sahip merkezlerinden bir tanesidir ve büyük miktarda flora ve

faunaya sahiptir. Penicillium (küf) türleri mikro-mantar ailesinin en sık rastlanan ve ekonomik olarak önemli

üyeleri arasındadır. Bu çalışmada Borneo’nun batı bölgelerinden elde edilip Malezya Sarawak

Üniversitesi’ndeki saf kültür koleksiyonlarında muhafaza edilen yirmi Penicillium izolatını gruplamak ve

aralarındaki genetik çeşitliliği ve ilişkiyi belirlemek için, morfolojik ve polimorfik DNA’nın rastgele

amplifikasyonu (RAPD) metodu kullanılmıştır. M13 ve OPD10 primerleri kullanılarak morfolojik ve

moleküler metodlar arasında kıyaslama yapılmış ve birkaç istisna ile bazı durumlarda, izolatların morfolojik

metodlara dayanarak gruplandırılmalarının moleküler gruplandırılmalar ile uyumlu olduğu gösterilmiştir.

Moleküler analiz aynı zamanda izolatlar arasında, toprağın kaynağı veya coğrafi bölge ile az korelasyon

göstermesine rağmen, genotip varyasyonu göstermiştir.

Anahtar Sözcükler: Penicillium türleri, morfoloji, RAPD, M13, varyasyon


14

Hairul Azman ROSLAN et al.

Introduction

Fungi and bacteria are the principal decomposers

that release carbon, nitrogen and other elements

that otherwise would become tied up in organic

matter (Carlile et al., 2001). Fungi play an

important role in decomposing forest litter or dung,

fruits or other organic materials. Farms fruits and

crops are vulnerable to fungal attack and 10% to

50% of the world’s harvested fruit is lost each year

due to fungal attack (Campbell and Reece, 2002).

However, fungi also have a number of practical

uses for humans. The distinctive flavours of certain

kinds of cheeses, including Roqueorti and blue

cheese, come from the fungi used to ripen them.

The soft drink industry uses Aspergillus niger to

produce citric acid. Beside that, a family of

unicellular fungi, Saccharomyces cerevisiae is the

most important fungi used in the food industries

such as in baking, alcohol brewing and wine

making. Apart from food industries, fungi are

medically valuable as antibiotic producers used to

treat infections (Thom, 1945). The Penicillium spp

are among the most commonly occurring and

economically important members of microfungi

family. Although much is known about Penicillium

physiology and mycotoxin chemistry, one of the

main challenges is in the area of rapid and reliable

identification of Penicillium in many settings

including community health care, occupational

health and food safety (Scott, 1977; Cruz-Perez et

al., 2001; Meklin et al., 2004; Portnoy et al., 2004).

Sarawak is one of the centres of mega- if not gigadiversity

region and possesses a vast potential of

undiscovered organisms including Penicillium spp.

We have isolated a number of Penicillium from

various location and sources within Sarawak. Here

we report the genotyping of Penicillium spp from

UNIMAS pure culture collections.

Materials and Methods

Collection and maintenance of fungal isolates

Twenty Penicillium isolates were obtained from

Universiti Malaysia Sarawak (UNIMAS) culture

collection. The fungi collection was isolated from

various sources in Sarawak such as from mangrove

soil, leaf litter, peat soil, soy sauce, karas and

rambutan (Table 1). A map of Sarawak state is

shown in Figure 1, indicating the sampling

locations. Fungi from stock culture were recultured

on Malt Extract Agar (MEA) and Czapek

Yeast Agar (CYA) in Petri dishes. Each isolate was

inoculated at three-points on each media in petri

dishes. The inoculated plates were kept at room

temperature (22-25ºC) for seven days.

Figure 1. Map of Sarawak state in Malaysia indicating sampling sites. 1: Karangas

Forest, 2: Mixed Dipterocarp Forest, 3: Riverine Forest, Samunsam; 4: Sematan; 5:

Kuching; 6: Kampung Bako; 7:Bako Island; 8: Kota Samarahan; 9: Bintulu


Genetic diversity of Penicillium species in Sawarak, Malaysia 15

Table 1 List of fungal collection, the substrate it was extracted from and location of the fungal (*numbers in

superscript indicate origin of isolate corresponding to Figure 1)

Fungal

UFI

Substrate Origin

isolates (Unimas Fungi Index)

P1 1433 Mangrove soil

6

Kampung Bako

P2 1435 Mangrove soil

6

Kampung Bako

P3 0646 Leaf litter

1

Karangas Forest, Samunsam

P4 0687 Karas

8

Samarahan

P5 1439 Soy sauce

8

Samarahan

P6 1443 Soy sauce

8

Samarahan

P7 1434 Mangrove soil

6

Kampung Bako

P8 1440 Soy sauce

5

Kuching

P9 0338 Leaf litter

2

Mixed Dipterocarp Forest, Samunsam

P10 1445 Karas

8

Samarahan

P11 1446 Peat soil

8

Samarahan

P12 1436 Mangrove soil

4

Sematan

P13 1438 Soy sauce

8

Samarahan

P14 0630 Leaf litter

1

Karangas Forest, Samunsam

P15 1437 Peat soil

9

Bintulu

P16 0650 Leaf litter

3

Riverine Forest, Samunsam

P17 1441 Mangrove soil

7

Bako Island

P18 1447 Rambutan

8

Samarahan

P19 1442 Mangrove soil

7

Bako Island

P20 1444 Soy sauce

Morphological study

A small tuft of mycelium and conidiophores were

lifted from a fairly young section of the colony and

placed on a drop of acid fuschin on a glass slide. A

cover slip was gently lowered on the specimen.

Slides were sealed with Canada balsam.

Identification of the fungi was based on culture

characteristics and conidiophore structure. Cultural

characteristics such as colony colour, texture,

colony growth, exudates, odour, zonation and

pigmentation were examined. Conidiophore

structure that includes its length, phialides, branching

system and conidia were also examined. Images

were taken by using Nikon digital camera. Notes of

International Mycological Institute (IMI)

descriptions were used as reference for the

identification.

Molecular study

Isolation of DNA

DNA was extracted using a rapid extraction method

as introduced by Taylor and Natvig (1987). Genetic

5 Kuching

material was also taken directly from mycelia

growing on CYA using clean, autoclaved tips. The

genetic materials were then mixed with 25-30μl of

Tris-EDTA (TE) buffer and then vortexed. The

DNA was kept in -20ºC until required.

RAPD-PCR amplification

Two PCR primers, M13 (5’-

TTATGTAAACGACGGCCAGT -3’) and OPD10

(5’-GTGATCGCAG-3’), were used to amplify 20

Penicillium isolates. A negative control was

included in each amplification process. The PCR

mixture used for the RAPD in this study consisted

of 2.5μl of 10X PCR buffer (Vivantis), 2.5µl of

2mM dNTPs (Vivantis), 10 pmol/μl M13 or 5

pmol/μl OPD-10, 2 U Taq polymerase (Vivantis)

and 2.5μl DNA template. Sterile distilled water was

added to total up the PCR reaction volume to 25 µl.

Amplification was conducted using Biometra T-

Gradient (Biometra) with the following temperature

profile (Table 2):


16

Hairul Azman ROSLAN et al.

Table 2. PCR amplification parameters using the M13 primers and OPD-10

Separation of DNA fragments by gel

electrophoresis

Parameters Temperature and Reaction time

Initial denaturation 94ºC for 3 minutes

Denaturation 84ºC for 30 seconds

Annealing 46ºC / 30ºC for 1 minute (M13 /

OPD10)

Extension 72ºC for 2 minutes

Number of cycles 35

Final extension 72ºC for 7 minutes

The amplicons were separated using 1.3 % (w/v)

agarose gel electrophoresis in 1X TAE (Tris-Acetic

acid-EDTA) buffer. The electrophoresis was

performed at 100V for 90 minutes. The gel was

visualised using ethidium bromide under UV

transilluminator and documented using Gel

Documentation System (BioRad).

Construction of phylogenetic relationships

Each individual RAPD band was considered as

equivalent independent characters and all the bands

were scored as present or absent for each isolate.

Banding patterns were converted into binary tables.

The data was analyzed using genetic data analysis

software, Numerical Taxonomy and Multivariate

Analysis System (NTSYSpc) version 2.2. The data

was quantified by similarity index, Jij = Cij / (ni +

nj – Cij), where Jij= the number of individuals i and

j, ni= the number of bands in individual i, nj= the

number of bands in individual j. A dendogram was

generated using Unweighted Pair-Group Method

with Arimethrical Averages (UPGMA) as

described by Sneath and Sokal (1973).

Results and Discussion

Morphological groupings of Penicillium isolates

All the isolates were initially identified based on

the cultural characteristics and structure of

conidiophores using stereo and compound

microscopes. Among the 20 isolates, 4 isolates

were grouped as Clade 1, 2 isolates were grouped

as Clade 2, 3 isolates were grouped as Clade 3, 2

isolates were grouped as Clade 4, 4 isolates were

grouped as Clade 5, 2 isolates were grouped as

Clade 6, and one isolate each for Clade 7, Clade 8

and Clade 9 respectively. Table 3 shows the clades

based on morphological characters, isolate name,

substrate it was found and origin of the isolates.

The detailed morphological classifications of

selected isolates are presented in Figures 2 to 7

below representing Clade 1 to Clade 6.


Table 3 Morphological groupings of Penicillium isolates.

Genetic diversity of Penicillium species in Sawarak, Malaysia 17

Clade Fungal isolates Substrate Origin

1 P1 Mangrove soil Kampung Bako

P7 Mangrove soil Kampung Bako

P14 Leaf litter Karangas Forest, Samunsam

P16 Leaf litter Riverine Forest, Samunsam

2 P2 Mangrove soil Kampung Bako

P12 Mangrove soil Sematan

3 P3 Leaf litter Karangas Forest, Samunsam

P9 Leaf litter Mixed Dipterocarp Forest,

Samunsam

P15 Peat soil Bintulu

4 P4 Karas Samarahan

P13 Soy sauce Samarahan

5 P5 Soy sauce Samarahan

P8 Soy sauce Kuching

P17 Mangrove soil Bako Island

P19 Mangrove soil Bako Island

6 P6 Soy sauce Samarahan

P20 Soy sauce Kuching

7 P10 Karas Samarahan

8 P11 Peat soil Samarahan

9 P18 Rambutan Samarahan

Figure 2. Clade 1 Penicillium P7 isolate. (a) Colony surface on CYA, (b) Colony reverse on

CYA colour, (c) Colony surface on MEA, (d) Colony reverse on MEA, (e) Conidiophore

structure (Bi-Asymmetrical), (f) Conidia globose shape


18

Hairul Azman ROSLAN et al.

Figure 3. Clade 2 Penicillium P2 isolate. (a) Colony surface on CYA, (b) Colony reverse on

CYA, (c) Colony surface on MEA, (d) Colony reverse on MEA, (e) Conidiophore structure at

100X magnification (Monoverticillata), (f) Conidia globose shape

Figure 4. Clade 3 Penicillium P15 isolate. (a) Colony surface on CYA, (b) Colony reverse on

CYA, (c) Colony surface on MEA, (d) Colony reverse on MEA, (e) Conidiophore structure at

100X magnification, arrow showing swollen apex, (f) Conidiophore structure at 40X

magnification (Monoverticillata), (g) Conidia globose shape


Genetic diversity of Penicillium species in Sawarak, Malaysia 19

Figure 5. Clade 4 Penicillium P13 isolate. (a) Colony surface on CYA, (b) Colony reverse on

CYA, (c) Colony surface on MEA, (d) Colony reverse on MEA, (e) Conidiophore structure at

100X magnification (f) Conidiophore structure at 40X magnification (Bi-asymmetrical), (g)

Conidia globose shape

Figure 6. Clade 5 Penicillium P17 isolate. (a) Colony surface on CYA, (b) Colony reverse on

CYA, (c) Colony surface on MEA, (d) Colony reverse on MEA, (e) Conidiophore structure at

100X magnification, arrow showing lanceolate phialides, (f) Conidiophore structure at 40X

magnification (Bi-asymmetrical), (g) Conidia globose shape


20

Hairul Azman ROSLAN et al.

Figure 7. Clade 6 Penicillium P6 isolate. (a) Colony surface on CYA, (b) Colony reverse on

CYA, (c) Colony surface on MEA, (d) Colony reverse on MEA, (e) Conidiophore structure at

40X magnification (Terverticillata), (f) Conidia elliptical shape.

Molecular groupings of Penicillium isolates

Single, simple repetitive PCR primers have been

designed to amplify the microsatelite regions of

chromosomal DNA. In most applications these

primers have provided similar levels of specificity

to those seen with RAPD, and the results have been

used to group fungi at species level (Meyer et al.,

1992; Schlick et al., 1994; Bridge et al., 1997).

Two sets of primers were used, M13 and OPD-10

primers to analyse the variations between the 20

isolates of Penicillium spp. Six isolates were

excluded from the molecular study because either

the DNA could not be isolated or amplification was

not reproducible. Each sample was repeated at least

two times to determine its reproducibility and

consistency. Bands were scored for each primer

based on the presence (1) or absence (0) of

amplicon migration in the gel. Figure 8 and Figure

9 represent the RAPD profile of M13 and OPD-10

respectively. Figure 10 is a dendogram generated

from M13 data.


Genetic diversity of Penicillium species in Sawarak, Malaysia 21

Figure 8. RAPD band profile generated using M13 primer visualized on 1.3% (v/v) agarose. The

lane markings correspond to the isolate number. Lane M: 1kbp DNA ladder (Fermentas) and

Lane N: 100bp DNA ladder (Seegene)

Figure 9. RAPD band profile generated using OPD10 primer visualized on 1.3% (v/v) agarose

gel. The lane markings correspond to the isolate number. Lane M: 1kbp DNA ladder (Fermentas)

and Lane N: 100bp DNA ladder (Seegene)


22

Hairul Azman ROSLAN et al.

Figure 10. Dendrogram showing relationships among 14 isolates of Penicillium species. Genetic

distances were obtained using M13 primer.

The study compared the classification

generated from morphological data and molecular

data. Comparison of the two datasets indicated that

the RAPD banding patterns were generally

consistent with morphological data. Combination of

morphological and molecular data can be used to

increase the confidence that the isolates were

grouped correctly. Previous study carried out by

Lutzoni and Vilgalys (1995) integrated molecular

and morphological data sets in order to estimate

fungal phylogenies in lichenized and nonlichenized

Omphalina species. They found that

homogeneity testing of the 28S large subunit

ribosomal DNA sequences and the morphological

characters showed that the two data sets were

sampling the same phylogenetic history. In this

study, the dendrogram generated from

amplification with M13 primer gives approximately

79% correlation with morphological data as 11 out

of 14 isolates were observed to give similar

groupings. As in the case of OPD10, there was

approximately 69% correlation with morphological

data as 9 out of 13 isolates were observed to

correlate with morphological groupings. Molecular

analysis has shown that two isolates that were

initially grouped in different cluster based on the

morphological characterization, appeared to be

identical at the genetic levels when characterized

with RAPD analysis. For isolates P5 (peat soil) and

P19 (mangrove soil), showed minor differences in

their morphological characteristics but showed to

be identical at the genetic levels.

The dendogram generated from M13 primer

(Figure 10) also showed little correlation between

isolates isolated from the same soil type for

example isolates isolated from mangrove soil P1

and P2 are grouped into Clade 1 while P2 and P12

in Clade 5. Apart from that, geographical origin

also showed little correlation as seen in isolates

isolated from soy sauce from Samarahan area P13

and P5 found in Clade 6 and Clade 7 respectively,

indicating a wide variation of Penicillium that can

be found throughout the sampling area. Spatial

variations in microfungi communities is quite

common and have been shown to be attributed to

various factors such as soil chemistry, plant

composition such as the alpine and birch


communities (Lumley et al., 2001; Mclean and

Huhta 2002; Bellis et al., 2007).

Conclusion

In this study, most isolates showed correlation and

consistency in morphological and molecular data.

Molecular analysis was also able to show that in the

instance of P5 and P19 to be genetically identical

when characterized with RAPD compared to

morphological analysis. The study also indicated

that the isolates showed considerable genotypic

variations within Penicillium spp isolated from a

wide area in Sarawak and little correlation to both

the type of soil they originated from and also

geographical location.

Acknowledgement

This work is supported by Unimas Fundamental

Research Grant.

References

Bellis TD, Kernaghan G, Widden P. Plant

community influences on soil microfungal

assemblages in boreal mixed-wood forests.

Mycologia. 99(3):356-367. 2007.

Bridge PD, Prior C, Sagbohan J, Lomer CJ, Carey

M and Buddie A. Molecular characterization of

isolates from locusts and grasshoppers.

Biodiversity and Conservation. 6:177-189.

1997.

Campbell NA, Reece JB. Biology sixth edition. pp

616-630. 2002.

Carlile MJ, Watkinson SC and Graham WG. The

Fungi. Second edition. San Diego, California:

Academic Press; 2001.

Cruz-Perez P, Buttner MP and Stetzenbach LD.

Specific detection of Stachybotrys chartarum in

pure culture using quantitative polymerase

chain reaction. Mol. Cell. Probes. 15 (23), pp.

129–138. 2001.

Lumley TC, Gignac LD and Currah RS.

Microfungus communities of white spruce and

trembling aspen logs at different stages of decay

in disturbed and undisturbed sites in the boreal

mixedwood region of Alberta. Canadian J Bot.

79:76–92. 2001.

Lutzoni F and Vilgalys R. Integration of

morphological and molecular data sets in

estimating fungal phylogenies. Canadian J Bot.

73(suppl. 1):S49-659. 1995.

Genetic diversity of Penicillium species in Sawarak, Malaysia 23

Mclean MA and Huhta V. Microfungal community

structure in anthropogenic birch stands in

central Finland. Biology and Fertility of Soils.

35:1–12. 2002.

Meklin T, Haugland RA, Reponen T, Varma M,

Lummus Z, Bernstein D, Wymer LJ and Vesper

SJ. Quantitative PCR analysis of house dust can

reveal abnormal mold conditions. J. Environ.

Monit. 6 pp. 615–620. 2004.

Meyer W, Moraywetz R, Borner T and Kubicek

CP. The use of DNA fingerprint analysis in the

classification of some species. Curr Genet.

21:27-30. 1992.

Portnoy JM, Barnes CS and Kennedy K. Sampling

for indoor fungi. J. Allergy Clin. Immunol. 113

pp. 189–198. 2004.

Schlick A, Kuhls K, Meyer W, Lieckfeldt E,

Borner T and Messner K. Fingerprinting reveals

gamma-ray induced mutations in fungal DNA:

implications for identification of patent strains

of Trichoderma harzianum. Curr Genet. 26: 74-

78. 1994.

Scott PM. Penicillium mycotoxins. In "Mycotoxic

Fungi, Mycotoxins, Mycotoxicoses, an

Encyclopedic Handbook. Vol. 1. Mycotoxigenic

Fungi' eds. T.D. Wyllie and L.G. Morehouse.

New York: Marcel Dekker. pp. 283-356. 1977.

Sneath PHA and Sokal RR. Numerical Taxonomy.

W.H. Freeman, San Francisco; 1973.

Taylor JW and Natvig D. Isolation of fungal DNA.

In: Fuller, M.S. and Jaworski, A. (eds)

Zoosporic Fungi in Teaching and Research.

South-eastern Publishing Corporation, Athens,

Georgia. pp. 252-258. 1987.

Thom C. Mycology presents penicillin. Mycologia.

37:460-475. 1945.


Journal of Cell and Molecular Biology 7(2) & 8(1): 25-34, 2010 Research Article

Haliç University, Printed in Turkey.

http://jcmb.halic.edu.tr

The sensitivity of the human chromosomes to ethyl methane

sulfonate (EMS)

Songül BUDAK DİLER *,1 , Mehmet TOPAKTAŞ 2

1 University of Niğde, Department of Science and Letters, Niğde, 51200, Turkey

2 University of Cukurova, Department of Science and Letters, Adana, 01330 Turkey

(* author for correspondence; budakdiler@gmail.com)

Received: 03 March 2009; Accepted 19 March 2010

Abstract

The aim of this study was to determine the chromosomal susceptibility to breakages by the mutagen Ethyl

methanesulfonate (EMS). For this reason, human peripheral blood lymphocytes were treated with varying

concentrations of EMS (5x10 -4 M, 10 -3 M and 2x10 -3 M) for 24 and 48 hours. The percentages of chromosomal

fragmentations in EMS-treated and untreated (control) cells were found to be statistically significant. In

addition, the extent of breakages of the same chromosomes correlated with the concentrations of the chemical.

The chromosomes that were fragmented most as a result of EMS-treatment in descending order were 1, 2, 6,

4, X, 7, 3, 5, 9, and 8.

Keywords: Ethyl methanesulfonate (EMS), human lymphocytes, chromosome damage, lymphocyte culture.

Etil Metansulfonat (EMS)’ye İnsan Kromozomlarının Hassasiyeti

Özet

Bu çalışmanın amacı, mutajen Etil metansulfonat (EMS)’nin insan kromozomlarında oluşturduğu kromozom

kırıklarını incelemek ve en çok kırılan kromozomları saptamaktır. Bu amaç için hücreler, 5x10 -4 M, 10 -3 M ve

2x10 -3 M konsantrasyonlardaki EMS ile 24 ve 48 saat muamele edilmiştir. 24 ve 48 saat EMS ile muamele

edilen insan periferal lenfositlerinde kontrolde ve aynı dozda, farklı kromozomlarda görülen kromozom

kırılma yüzdeleri bir birleriyle karşılaştırılmış ve aralarındaki farkın istatistik bakımında önemli olduğu

bulunmuştur. Ayrıca aynı kromozomun farklı dozlardaki kırılma yüzdeleri kontroldeki kırılma yüzdeleriyle

karşılaştırılmış, aradaki farkın önemli olduğu saptanmıştır. EMS ile muamele sonucu en fazla kromozom

kırılması 1., 2., 6., 4., X, 7., 3., 5., 9., ve 8. kromozomlarda tespit edilmiştir.

Anahtar Sözcükler: Etil metansulfonat (EMS), insan kromozomları, kromozom kırığı, lenfosit kültürü.

Introduction

Ethyl methanesulfonate (EMS) is a colorless liquid.

When heated to decomposition, EMS emits toxic

fumes of sulfur oxides. EMS is reasonably

anticipated to be a human carcinogen based on

sufficient evidence of carcinogenicity in

experimental animals. EMS is used experimentally

as a mutagen, teratogen, and brain carcinogen and

as a research chemical (IARC 1974, IARC 1987,

HSDB 2000, Merck The Merck Index 1989). When

administered as a single intraperitoneal injection,

EMS induced lung tumors in male mice and lung

adenomas in mice of both sexes. Three

intraperitoneal injections of EMS in arachis oil

induced lung and kidney tumors in male mice. In a

similar study, EMS induced renal carcinomas in


26

Songül Budak DİLER and Mehmet TOPAKTAŞ

female rats and a variety of benign and malignant

tumors, including lung carcinomas, in rats of both

sexes (Ueo et al., 1981).

The tests sister chromatid exchange (SCE) and

chromosome aberrations (CA) are used to assess

the genotoxicicity of mutagenic and carcinogenic

chemicals (Perry and Evans, 1975). It was also

established that in fish cells, EMS increased SCE

and CA in a concentration dependent manner but

had no effect on their replicative index (RI)

(Maddock et al., 1986). Furthermore, Adhikari and

Grover showed that EMS caused CA in the rat bone

marrow cells (Adhikari and Grover, 1988). In 1990,

it was established that EMS enhanced SCE in the

peripheral leukocytes of humans in a concentration

dependent manner and decreased the RI in a doseindependent

manner (Topaktaş and Speit, 1990).

The sensitivities and clastogenicities of human

chromosomes with high gene density (1, 19 and 20)

and with low gene density (4 and 18) to

combinations of EMS and cytosine arabinoside

(Ara-C) were measured and the high gene density

chromosomes were found to be sensitive (Surralles

et al.,1997). Human peripheral blood lymphocytes

were treated with EMS (1,5x10 -4 M and 1,5x10 -3 M)

and MMS (1,5x10 -5 M and 1,5x10 -4 M) and the

treatment resulted in enhanced SCE compared to

untreated corresponding cultures (Harish et al.,

1998). it was demonstrated that the chemical EMS

enhanced SCE in whole blood and lymphocyte

cultures (During, 1985). In addition, EMS

treatment at various concentrations (5x10 -4 M, 10 -

3 M and 2x10 -3 M) of human peripheral blood

lymphocytes enhanced CA (Rencüzoğullari and

Topaktaş, 2000). Therefore, we aimed at

investigating the degree of sensitivity of human

chromosomes to EMS by employing the

mutagenicity tests mentioned above.

Materials and Methods

In this study, we used peripheral blood and

lymphocytes from healthy donors, two males (23

and 24 years old), and two females (23 years old).

EMS (Sigma M-0880) was used as a test substance.

The preparation of chromosome was performed in

accordance with Evans 1984. In addition, this study

was prepared according to IPCS guidelines

(Albertini et al., 2000). Whole blood (0.2 ml) from

four healthy donors (two male and two female,

nonsmokers, aged: 23 and 24) was added to 2.5 ml

chromosome medium B (Biochrom, F5023). The

cultures were incubated at 37°C for 72 h. The cells

were treated with concentrations of 5x10 -4 M, 10 -3 M

and 2x10 -3 M of EMS for 24 h (EMS was added 48

h after initiating the culture) and 48 h (EMS was

added 24 h after initiating the culture). The test

substance EMS was dissolved in ethanol (50%).

There was clear evidence that ethanol was not a

bacterial or mammalian cell mutagen in vitro

assays for chromosome aberration. Reported tests

for chromosome aberration induction in vivo were

all negative and only a minority of micronucleus

tests were positive (Phillips and Jenkinson, 2001).

Colchicine (0.06µg/ml, Sigma C 9754) was added

for the last 2 h of culture. To collect the cells, the

cultures were centrifuged (1200 rpm, 15 min),

treated with hypotonic solution (0.4% KCl) for 13

min at 37 o C, and then fixed in cold methanol:

glacial acetic acid (3: 1) for 20 min at room

temperature. The treatment with fixative was

repeated three times. Then the cells were spread on

glass slides and air dried. The slides were stained

with giemsa (5%). Well spread metaphases per

donor were examined 1000× magnification for

occurrence of different types of chromosome

aberration (CA). 100 metaphase cells with

chromosomes aberrations were examined in each

treated groups and control groups. Karyotyping was

performed using Olympus BX50 microscope and

Cytovision 3.00 Windows NT Applied Imaging

software. For statistical analysis, the ONE WAY

ANOVA and DUNCAN test was used and the

results were tabulated.

Results

In this study, the sensitivity of human

chromosomes to EMS was revealed by observing

the chromosomal breakages in each of the

chromosomes. The percentage of chromosomal

fragmentation varied among chromosomes in the

control groups. In the control groups (24h),

chromosomes 1, 2, 6, X, and 4 were found to be

sensitive to first degree fragmentation whilst

chromosomes 22, 20, 19, 18, and 11 were

insensitive (Table 1). In the solvent control groups

(ethanol, 50%) while chromosomes 2, 1, 6, 3 and 4

were sensitive to first degree fragmentation,

chromosomes 22 and 18 were completely

insensitive (Table 1).

In cells that had been treated with 5x10 -4 M of

EMS for 24 h, chromosomes 1 and 2 were the most

sensitive and chromosomes 22, 19 and 20 were the

least sensitive to fragmentation (Table 1). In those

that were treated with 10 -3 M of EMS for 24 h,

chromosomes 1 and 2 were the most fragile while

chromosomes 17, 11, 18, 21, 22, 19 and 20 were


the least sensitive (Table 1) (Figure1). Karyotyping

and fragmentation of human chromosomes 1, 2,

and 10. At the 2x10 -3 M concentration of EMS for

the same duration, chromosomes 6 and 1 were

sensitive to first degree while chromosomes X, 2, 5,

and 4 were less fragile. In the same cultures,

chromosomes 18, 19, 22, 20 and 21 remained

completely insensitive to the chemical (Table 1). In

cultures that had been treated for 24 h with varying

concentrations of EMS, and in all concentrations

tested, the fragmentation observed in chromosomes

2, 5-11, 13 and 16-8 was higher than that in the

control group and in the solvent control group. On

the other hand, the breakages of chromosomes 3, 12

and 19 were significant only in comparison to the

control groups. While the 4th chromosome showed

significant fragmentation at all of the concentrations

tested in comparison to the controls, this was

significant only at 5x10 -4 M and 10 -3 M EMS

concentrations in comparison to the solvent

controls. The fragmentation of chromosomes 14, 15

and X at EMS concentrations of 5x10 -4 M and 2x10 -

3 M was significantly higher than the control groups

and the solvent control groups. On the other hand,

there was no increase in breakages of chromosomes

1, 20 – 22 as a result of EMS treatment (Table 1).

As a result of treatment with EMS for 24 hours, the

Chromosomal fragmentation by EMS

chromosomal fragmentation observed in

comparison to control groups and solvent control

groups was found to be dose independent (Table 1).

In the solvent control groups chromosomes 2

and 1 are the most susceptible to breakages. There

was no breakages observed on chromosomes 22, 21,

20, 18 and 17 (Table 2).In cultures that had been

treated with 5x10 -4 M of EMS for 48 h,

chromosomes 1, 2 and 4 were the most sensitive to

fragmentation. The least sensitive were

chromosomes 20, 18 and 17, with chromosome 22

never showing fragmentation (Table 2). There was

no statistical significance in the observed breakages

among chromosomes treated with 10 -3 M of EMS

for 48 h (Table 2, Figure 2). At 2x10 -3 M

concentration of EMS chromosomes 1 and 2 are

susceptible to the first degree, with the least

sensitive being 22 and 20 (Table 2). In cultures

treated with different concentrations of EMS for 48

h, there was significant fragmentation of

chromosomes 10 and 11 while at these concentrations

chromosomes 17, 18 and 21 showed more

fragmentation in comparison to the control group.

On the other hand, chromosomes 1-9, 12-14, 19, 20,

22 and X did not any show any significant

fragmentation the control group (Table 2).

27


28

Songül Budak DİLER and Mehmet TOPAKTAŞ

Figure 1. Karyotyping and fragmentation of Human Chromosomes 1, 2, and 10 (10 -3 M EMS Treatment for

24h,♀).


Chromosomal fragmentation by EMS

Table 1. Comparison of percentages of chromosomal fragmentations of human peripheral lymphocytes that

were treated with different concentrations of EMS for 24 h.

Chromoso

me

Control group Solvent Control

group

5x10 -4 M 10 -3 M 2x10 -3 M Sig

1 3.0±1.0a 3.7±1.0ab 11.7±2.0a 9.2±1.4a 9.0±2.7ab

2 2.5±0.9abB 4.2±1.4aB 10.7±0.9aA 8.7±1.9aA 8.0±0.4abcA **

3 1.0±0.7bcdefB 3.0±1.4abcdAB 5.0±0.7bcdA 5.0±0.4bcdA 4.7±1.1cdefA *

4 1.7±0.7abcdC 2.5±0.5abcdBC 7.0±1.4bcA 6.7±0.4bcA 6.5±0.9abcdAB ***

5 1.5±0.6abcdeB 1.0±0.7cdefB 5.0±1.0bcdA 5.0±0.7bcdA 6.5±0.9abcdA **

6 2.2±0.4abB 3.0±1.0abcB 7.0±0.7bA 7.2±0.4bA 9.2±0.7aA ***

7 1.2±0.4abcdeB 2.2±0.7abcdeB 5.0±0.7bcdA 6.7±0.9bcdA 4.2±0.7defA ***

8 1.2±0.2abcdeB 1.2±0.2abcdefB 4.2±0.4bcdeA 5.5±0.8bcdeA 3.7±0.4defA ***

9 1.2±0.4abcdeB 1.0±0.7cdefB 4.5±0.6bcdeA 5.5±0.6bcdeA 3.5±0.5defghA **

10 0.2±0.2efB 0.7±0.4cdefB 3.7±0.6bcdefA 4.5±0.2bcdefA 3.5±0.9defghA ***

11 0.0±0.0fC 0.5±0.5fC 2.2±0.8efghB 4.7±0.4efghA 2.7±0.7efghAB ***

12 0.7±0.2bcdefB 1.5±0.5abcdefA

B

3.0±0.4defgA 4.0±0.7defgA 3.0±1.0efghAB *

13 0.5±0.2defB 1.2±0.4bcdefB 4.0±1.2bcdefA 3.5±0.2bcdefA 5.2±0.7bcdeA **

14 0.7±0.4cdefB 0.7±0.4cdefB 3.7±1.1cdefA 2.2±0.6cdefgA

B

3.0±0.5efgA *

15 0.2±0.2efB 0.2±0.2fB 3.0±0.7defgA 1.2±0.7defgA

B

3.0±0.7efgA **

16 1.0±0.7bcdefB 0.2±0.2fB 3.5±0.8defA 3.5±0.5defA 3.5±0.2defgA ***

17 0.2±0.2efB 0.2±0.2fB 2.0±0.7efghA 1.5±0.2efghA 2.0±0.4efghA **

18 0.0±0.0fB 0.0±0.0fB 1.2±0.6ghıA 0.7±0.2ghıA 1.2±0.2ghıjA **

19 0.0±0.0fB 0.5±0.2fAB 0.7±0.2hıA 1.0±0.0hıA 1.0±0.4hıjA *

20 0.0±0.0f 0.2±0.2f 0.2±0.2ı 0.7±0.2ı 0.7±0.4ıj

_

21 0.2±0.2ef 1.0±0.7cdef 1.5±0.2fgh 2.2±0.6fgh 0.5±0.2j

22 0.0±0.0f 0.0±0.0f 0.7±0.4hı 1.0±0.5hı 0.7±0.5ıj

X 2.0±0.5abcdB 1.7±0.8abcdefB 5.2±0.6bcdA 6.0±0.4bcdAB 8.0±1.0abcA ***

Sig. *** *** *** *** ***

Key: *** P


30

Songül Budak DİLER and Mehmet TOPAKTAŞ

Figure 2. Karyotyping and fragmentation of human chromosomes 1, 2, 3, 8, 9 and 21 (10 -3 M EMS Treatment

for 48h, ♀).


Chromosomal fragmentation by EMS

Table 2. Comparison of percentages of chromosomal fragmentations of human peripheral lymphocytes that

were treated with different concentrations of EMS for 48 h.

Chromosome Control

group

Solvent

Control

group

5x10 -4 M 10 -3 M 2x10 -3 M Sig

1 3.0±1.0a 4.7±2.1ab 8.0±1.9a 8.5±2.9 10.2±1.3a _

2 2.5±0.9ab 5.7±1.3a 6.7±2.0a 8.0±2.8 8.2±1.8ab _

3 1.0±0.7bcdef 2.0±0.7cdefg 3.7±2.2cde 3.2±1.4 4.0±0.9cdef _

4 1.7±0.7abcd 3.2±0.4abc 6.5±1.5ab 5.2±2.0 5.5±0.6bcd _

5 1.5±0.6abcde 2.7±0.4bcd 4.0±0.4abcd 2.5±1.3 3.0±1.0def _

6 2.2±0.4abc 3.2±0.4abc 5.2±0.7abc 6.0±2.0 7.2±0.8abc _

7 1.2±0.4abcde 1.2±0.9efghıj 4.0±0.7abcd 3.2±1.1 3.7±0.6def _

8 1.2±0.2abcde 2.0±0.4bcdef 2.7±0.2bcde 2.7±1.1 3.5±0.2def _

9 1.2±0.4abcde 1.5±0.2cdefgh 2.5±0.2cde 2.5±0.8 3.2±0.2def _

10 0.2±0.2efB 1.2±0.2cdefgh

AB

1.2±0.6efgAB 2.5±1.0A 3.2±0.4defA *

11 0.0±0.0fB 1.2±0.4defghı

AB

1.7±0.4defA 2.7±1.1A 3.5±0.6defA **

12 0.7±0.2bcdef 0.5±0.5hıj 1.7±0.4def 2.2±0.7 2.7±0.7def _

13 0.5±0.2def 1.7±0.4cdefg 2.5±0.6cdef 3.2±1.7 4.7±1.0bcde _

14 0.7±0.4cdef 1.2±0.2cdefghı 1.2±0.6efg 2.2±1.0 0.3±0.7def _

15 0.2±0.2efB 0.2±0.2ıjB 1.0±0.4efgAB 1.0±0.4AB 2.5±0.9efgA *

16 1.0±0.7bcdef 0.7±0.4fghıjB 2.7±0.6cdeA 2.5±0.9AB 4.0±0.7cdeA *

B

B

17 0.2±0.2efB 0.0±0.0jB 0.2±0.2fgB 2.0±0.7A 2.5±0.6efgA **

18 0.0±0.0fC 0.0±0.0jC 0.2±0.2fgBC 1.0±0.4B 2.2±0.6efgh

A

***

19 0.0±0.0f 0.5±0.2fghıj 1.0±0.0efg 1.0±0.7 1.7±0.8fgh _

20 0.0±0.0f 0.0±0.0j 0.5±0.5fg 1.0±0.5 0.7±0.4h _

21 0.2±0.2efB 0.0±0.0jB 1.0±0.5efgAB 1.5±0.6A 2.2±0.4efgh

A

**

22 0.0±0.0f 0.0±0.0j 0.0±0.0g 1.5±0.6 1.0±0.7gh _

X 2.0±0.5abcd 2.2±0.4bcde 4.7±1.2abcd 4.7±1.7 5.0±0.5bcde _

Sig *** *** ***

_

***

31


32

Songül Budak DİLER and Mehmet TOPAKTAŞ

Discussion

The sensitivity of human chromosomes to EMS

treatment was measured by determining the

breakages of each chromosome. In cultures treated

with different concentrations of EMS for 24 h and

48 h, the chromosomal breakage percentages were

statistically significant compared to control groups.

In addition, the percentage of fragmentation of each

chromosome at different concentrations of EMS

was significantly higher the controls. 24h EMS

treatment caused more fragmentation than 48h

treatment due to repair of damaged cells after 24h

treatment (Franke et al., 2006). Similar findings

also reported by several groups (Çakmak et al.,

2004, Rencüzoğulları et al., 2004, Bayram and

Topaktaş 2008).

In the control groups, chromosomes 1, 2, 6, X,

4 and 5 are susceptible to breakages to the first

degree. As can be seen, those chromosomes that are

tend to (natural) breakages in the control groups are

also susceptible to fragmentation in EMS-treated

cultures.

These results illustrate that the clastogens

cause more fragmentation of those chromosomes

that are prone to natural breakages. It has been

proposed that there may be a correlation between

the length of chromosomes and degree of

susceptibility to breakages. However, in this study,

in cultures treated with EMS, exception to this

assumption was discovered. For instance,

chromosome 3 fell into the second degree

susceptibility category in both untreated and EMS

treated cultures. This finding suggests that

chromosomal susceptibility to fragmentation may

correlate with its length as well as its composition.

Some investigators have discovered mutations

in some of the chromosomes derived from some

malignant cells, which we have found to be

sensitive to EMS treatment. The chromosomes we

found to be susceptible (chromosomes 1, 2, 3, 4, 5,

6, X, 7 and 8) were also found to be sensitive in

other studies. For instance, Bayani et al. showed by

spectral karyotyping that chromosomes 8, 7 and 20

were fragmented and rearranged in bone marrow

malignancies (Bayani et al.,2003). In cell lines

derived from stomach cancers, found that the p arm

of chromosome 17 showed partial deletion whilst

the q arm demonstrated partial duplication (Chun et

al., 2000). Selzer et al. studied neroblastomas and

their cell line derivatives, and discovered that there

was a loss in 3p and 11q whilst 17q showed

enlargement (Selzer et al., 2005). Gorunova et al.

showed that in gull bladder carcinomas,

chromosome 7 was the most frequently rearranged

one, followed by chromosomes 1, 3, 11, 6, 5 and 8.

(Gorunova et al., 1999). Morrissette et al.

discovered aberrations of chromosome 18 in

patients with partial mosaic tiresome (Morrissette et

al., 2005).

From these findings, it can be deduced that the

EMS test may prove to be indicative in some types

of cancer. Honma et al. compared the mutagenic

and cytotoxic response of the p53 tumor suppressor

gene in normal cells (TK6) and in cells with a

mutated p53 gene (WTK-1), both of which were

derived from he same ancestor. These two cell lines

were subjected to treatment with X-rays, EMS,

MMS and MMC. They found that the WTK-1 cells

were more resistant to induced cytotoxicity than the

TK6 cells, whiles their thymidine kinase (tk) gene

was more susceptible to mutation due to loss of

heterozygosity (LOH). These studies shows that

EMS can cause malignancies not only by the

cytogenetically specified chromosomal fragmentations

but also by alterations at the genetic level

(Honma et al., 1997).

In our study EMS caused chromosomal

breakages that are similar to the ones described by

these investigators. It can be argued that EMS may

constitute a risk factor in malignant transformations

due to its effect on chromosomal stability.

Acknowledgments

This study was supported by the C.U. Research

Fund. Project No. FBE2002D117.

References

Adhikari N and Grover IS. Genotoxic effects of

same systemic pesticides: In vivo chromosomal

aberrations in bone marrow cells in rats.

Environmental and Molecular Mutagenesis 12:

235-242, 1988.

Albertini RJ, Anderson D, Douglas GR et al., IPCS

Guidelines for the Monitoring of Genotoxic

Effects of Carcinogenes in Humans. Mutat Res

463: 111-172, 2000.

Bayani J, Zielenska M, Pandita A et al. Spectral

Karyotyping Identifies Recurrent Complex

Rearrangements of Chromosomes 8, 17 and 20


in Osteosarcomas. Genes Chromosomes Cancer

36(1): 7-16, 2003.

Bayram S and Topaktaş M. Confirmation of the

Chromosome Damaging effects of Lamivudine

in in vitro Human Peripheral Blood

Lymphocytes. Environmantal and Molecular

Mutagenesis 49: 328-333, 2008.

Çakmak T, Topaktaş M and Kayraldiz A. The

Induction of Chromosomal Aberration by Tetra

Antibiotic in Bone Marrow Cells of Rats in vivo.

Russian Journal of Genetics 40(8): 867-870,

2004.

Chun YH, Kil JI, Suh YS et al. Characterization of

Chromosomal Aberrations in Human Gastric

Carcinoma Cell Lines Using Chromosome

Painting. Cancer Genet. Cytogenet. 119(1): 18 –

25, 2000.

During R. Vergleichende Untersuchungen zur

Induktion von Schwester-chromatidaustauschen

(SCEs) in Menschlichen Lymphozyten in vitro

Nach Kultivierung von Vollblut oder Isolierten

Lymphozyten. Dissertation zu Erlangung des

Doktorgrades der Medizin der Fakültät für

Theoretische Medizin der Universität Ulm, 80s.

1985.

Evans HJ. Human peripheral blood lymphocytes

fort he analysis of chromosome aberrations in

mutagen tests, Handbook of Mutagenicity Test

Procedures: Kilbey, B.J., Legator, M., Nichols,

W., Ramel, C. (eds.), Second edition, Elsevier

Science Publishers, BV. pp. 405-427, 1984.

Franke SI, Pra D, Giulian R et al. Influence of

orange juice in the levels and in the

genotoxicity of iron and copper. Food-Chem-

Toxicol 44(3): 425-35, 2006.

Gorunova L, Parada LA, Limon J et al. Nonrandom

Chromosomal Aberrations and Cytogenetic

Heterogeneity in Gallbladder Carcinomas.

Genes Chromosomes Cancer 26(4): 312-321,

1999.

Harish SK, Guruprasad KP, Mahmood R et al.

Adaptive Response to Low Dose of EMS or

MMS in Human Peripheral Blood Lymphocytes.

Indian J Exp Biol 36: 1147-50, 1998.

Honma M, Hayashi M, Sofuni T. Cytotoxic and

Mutagenic Responses to X-Rays and Chemical

Mutagens in Normal and p53-Mutated Human

Lymphoblastoid Cells. Mutat. Res. 4;374(1):

89-98. 1997.

HSDB Hazardous Substances Data Base. National

Library of Medicine.

Chromosomal fragmentation by EMS

http://toxnet.nlm.nih.gov/cgi-bin/sis/htmlgen?

HSDB, 2000.

IARC Same Anti-thyroid and Related Substances,

Nitrofurans and Industrial Chemicals. IARC

Monographs on the Evaluation of Carcinogenic

Risk of Chemicals to Humans, Lyon, France:

International Agency for Research on Cancer,

vol.7. pp 326, 1974.

IARC. Overall Evaluations of Carcinogenicity.

IARC Monographs on the Evaluation of

Carcinogenic Risk of Chemicals to Humans,

Lyon, France: International Agency for

Research on Cancer. Supplement 7. pp 440,

1987.

Maddock ML, Northrup H, Ellingham TJ.

Induction of Sister-Chromatid Exchange and

Chromosomal Aberrations in Hematopoietic

Tissue of a Marine Fish Following ın vivo

Exposure to Genotoxic Carcinogens. Mutat Res

29: 145-147, 1986.

Merck The Merck Index, 11th ed. Rahway, NJ:

Merck&Company, Inc. 1989.

Morrissette JJ, Medne L, Bentley T et al. A Patient

with Mosaic Partial Trisomy 18 Resulting From

Dicentric Chromosome Breakage. Am J. Med.

Genet. A. 30;137(2): 208-212, 2005.

Perry P and Evans HJ. Cytological Detection of

Mutagen-Carcinogen Exposure by Sister

Chromatid Exchange. Nature 258: 121-125,

1975.

Phillips BJ and Jenkinson P. Is Ethanol Genotoxic?

A Review of the Published Data. Mutagenesis

16(2): 91-101, 2001.

Rencüzoğullari E and Topaktaş M. Chromosomal

Aberrations in Cultured Human Lymphocytes

Treated with the Mixtures of Carbosulfan, Ethyl

Carbamate and Ethyl Methanesulfonate.

Cytologia 65: 83-92, 2000.

Rencüzoğulları E, İla HB, Kayraldiz A et al. The

Genotoxic Effect of the New Acaricide

Etoxazole. Russian Journal of Genetics 40(11):

1300-1304, 2004.

Selzer RR, Richmond TA, Pofahl NJ et al. Analysis

of Chromosome Breakpoints in Neuroblastoma

at Sub-kilobase Resolution Using Fine-tiling

Oligonucleotide Array CGH. Genes

Chromosomes Cancer 44(3): 305-19, 2005.

Surralles J, Sebastian S and Natarajan AT.

Chromosomes with High Gene Density are

Preferentially Repaired in Human Cells.

Mutagenesis 12: 437-442, 1997.

33


34

Songül Budak DİLER and Mehmet TOPAKTAŞ

Topaktaş M and Speit G. Sister Chromatid

Exchange (SCE) Test Make Use of Detemine in

the Mutagen and Carcinogen. C.U. Sağlık Bil

Der 5: 73-84, 1990.

Ueo HR, Takaki HY, K. Sugimachi. Mammary

carcinoma induced by oral administration of

ethyl methanesulphonate. Determination of

some of the parameters affecting tumor

induction. Carcinogenesis 2(12): 1223-8, 1981.


Journal of Cell and Molecular Biology 7(2) & 8(1): 35-43, 2010 Research Article

Haliç University, Printed in Turkey.

http://jcmb.halic.edu.tr

Protective effect of pomegranate peel ethanol extract against ferric

nitrilotriacetate induced renal oxidative damage in rats

Mahgoub Mohammed AHMED *, 1 and Safaa Eid ALI 2

1

Molecular Drug Evaluation Department, National Organization for Drug Control and Research

(NODCAR), Giza, Egypt

2

Food Technology Research Inst., Agricultural Research Center (ARC), Giza, Egypt

(* author for correspondence; dr_mahgoub1@yahoo.com )

Received: 18 December 2009; Accepted: 02 April 2010

Abstract

Pomegranate is an important source of bioactive compounds. The nephroprotective effect of pomegranate

peel ethanol extract against ferric nitrilotriacetate (Fe-NTA)-induced renal oxidative stress was studied. The

results showed that Fe-NTA enhances renal lipid peroxidation with reduction in renal glutathione content,

antioxidant enzymes, viz., glutathione peroxidase, catalase, glutathione reductase and phase-II metabolizing

enzyme, glutathione-S-transferase. It also enhances serum urea and creatinine. Treatment of rats orally with

pomegranate peel extract (100 and 200 mg/kg/day, for seven days) resulted in significant decrease in lipid

peroxidation and serum urea and creatinine levels. Renal glutathione content, glutathione-S-transferase and

antioxidant enzymes were also recovered to a significant level (P


36

Mahgoub Mohammed AHMED and Safaa Eid ALI

Introduction

Pomegranate (Punica granatum L., Punicaceae), is

one of the oldest known drug. It is mentioned in the

Ebers papyrus of Egypt written in about 1550 BC

(Ross, 1999). Dried fruit peel is used for diarrhea

and to treat respiratory and urinary tract infections.

Also, pomegranate fruit peel exerted diverse

pharmacological functions as antioxidant activity

(Yunfeng et al., 2006 and Thring et al., 2009),

antifertility effect (Gujraj et al., 1960), cytotoxic

activity (Sato, 1990 and Kulkarni et al., 2007),

hepatoprotective activity (Murthy, 2002) and

hypoglycemic activity (Dhawan et al., 1977 and

Hontecillas et al., 2009). Also, pomegranate peel

ethanol extract (500 mg/kg b.wt.) has ameliorative

effect against chlorpyrifos-ethyl-induced oxidative

stress in rats (Ahmed and Zaki, 2009). Pomegranate

peel contains substantial amounts of polyphenols

such as ellagic tannins, ellagic acid and gallic acid

(Naser et al., 1996).

Iron is the most abundant metal in the human

body. Although iron is an essential nutritional

element for all life forms, iron overload may lead to

various diseases (De Freitas and Meneghini, 2001).

The iron complex of the chelating agent

nitrilotriacetic acid is nephrotoxic (Khan and

Sultana, 2005). Intraperitoneal injection of Fe-NTA

induces renal proximal tubular damage associated

with oxidative damage that eventually leads to a

high incidence of renal cell carcinoma in rodents

after repeated administration (Okada and

Midorikawa, 1982). Intraperitoneally injected of

ferric nitrilotriacetate (Fe-NTA) is absorbed into

portal vein through mesothelium and passes into

circulation via the liver (Umemura et al., 1990).

The low molecular weight Fe-NTA is easily filtered

through the glomeruli into the lumen of the renal

proximal tubules where Fe 3+ -NTA is reduced to

Fe 2+ -NTA by the glutathione degradation products

cysteine or cysteinylglycine (Taso and Curthoys,

1980). In the brush border surface of the renal

proximal convoluted tubules, γ-glutamyl

transpeptidase hydrolyses glutathione to

cysteinylglycine that is rapidly degraded to cysteine

and glycine by dipeptidase (Khan and Sultana,

2005). Cysteinylglycine and cysteine are the

proposed thiol reductants that reduce Fe 3+ -NTA to

Fe 2+ -NTA. The auto-oxidation of Fe 2+ -NTA

generates superoxide radicals (O .- 2) which

subsequently potentiate the iron catalysed Haber-

Weiss reaction to produce hydroxyl radical (OH . ),

leading to induction of lipid peroxidation and

oxidative DNA damage (Umemura et al, 1990 and

Khan and Sultana, 2005).

For the present study, we prepared the ethanol

extract (80%) of the pomegranate peel which

exerted the highest antioxidant effect in vitro. The

objective of the study was to determine the possible

effect of prophylactic treatment with pomegranate

peel extract on Fe-NTA induced renal oxidative

damage in rats.

Materials and methods

Plant material

Pomegranate fruit peel purchased from local market

was dried and powdered before extraction.

Plant extract

Powdered plant material (500g) was repeatedly

extracted with 2000 ml solvents of increasing

polarity starting with benzene, chloroform, ethyl

acetate, ethanol (80%) and distilled water. The

percolation time for each solvent was 24h. The

extracts were filtered, concentrated and freeze

dried. The residues yielded for each solvent were

stored at 4 o C. The ethanol extract (80%) was used

for further study after preliminary in vitro tests viz.

lipid peroxidation, deoxyribose and DPPH assays.

Chemicals

Ferric nitrate, NTA disodium salt, reduced

glutathione, 1-chloro-2,4-dinitrobenzene (CDNB),

bovine serum albumin, 1,2-dithio-bis-nitrobenzoic

acid (DTNB) and thiobarbituric acid (TBA) were

obtained from Sigma Chemical (St Louis, USA).

All solvents used were HPLC grade (Merck,

Darmstadt, Germany).

Total phenolics

Total phenolics in the pomegranate peel ethanol

extract were determined according to

Jayaparakashsa et al. (2001) using Folin-Ciocalteu

reagent. Four hundred microlitres of sample were

taken in test tubes; 1.0 ml of Folin–Ciocalteu

reagent (diluted 10-fold with distilled water) and

0.8 ml of 7.5% sodium carbonate were added. The

tubes were mixed and allowed to stand for 30 min


and the absorption at 765 nm was measured against

a blank, which contained 400 µl of ethanol in place

of sample. The total phenolic content was

expressed as gallic acid equivalents in mg/g of

ethanol extract.

Animals

Albino male rats (170±30 g) were used in the

present study. The rats were obtained from the

animal house of the National Organization for Drug

Control and Research (NODCAR), Egypt. The

animals were kept under standard laboratory

conditions of light/dark cycle (12/12h) and

temperature (25±2˚C). The rats were allowed food

and water ad libitum. They were provided with a

nutritionally adequate standard laboratory diet.

Animals’ diet

The basal diet consists of casein 10%, cotton seed

oil 4%, salt mixture 4%, vitamin mixture 1%,

carbohydrates (sucrose, starch 1:1) 80.8% and

choline chloride 0.2% (American Institute of

Nutrition, 1980).

Preparation of Fe-NTA solution

The Fe-NTA solution was prepared as described in

Deiana et al. (2001) and Khan and Sultana (2005),

ferric nitrate and NTA disodium salt were dissolved

in distilled water to form a 300 and 600 mM

solution, respectively. The two solutions were

combined in a volume ratio of 1:2 with magnetic

stirring at room temperature and the pH was

adjusted to 7.4 with sodium bicarbonate.

Experimental design

Thirty albino rats were randomly allocated to five

groups of six rats each:

Group 1 received only saline injection

intraperitoneally at a dose of 10 ml/kg body weight.

Group 2 received only a single intraperitoneal

injection of Fe-NTA solution at a dose of nine mg

Fe/kg body weight (Athar and Iqbal 1998).

Group 3 received pomegranate peel extract by

gavage once daily for seven days at a dose of 100

mg body weight, p.o. (Parmar and Kar, 2008).

Group 4 received pomegranate peel extract once

daily for seven days at a dose of 200 mg/kg body

weight, p.o. (Parmar and Kar, 2008).

Pomegranate peel extract against renal oxidative damage 37

After the last treatment with pomegranate peel

extract, the animals of group 2, 3 and 4 received a

single intraperitoneal injection of Fe-NTA at a dose

level of 9mg Fe/kg body weight.

Group 5 received pomegranate peel extract orally

once daily for seven days at a dose of 200 mg/kg

body weight (Parmar and Kar, 2008). We used the

high dose of pomegranate peel ethanol extract (200

mg/kg b.w. p.o.) to study its effect on kidney.

All rats were sacrificed 12 h after the treated

with Fe-NTA. Blood was collected and the

separated serum was used for the estimation of

creatinine (Bartless et al., 1972) and urea (Patton

and Crouch, 1977).

Post-mitochondrial supernatant and microsomal

fraction preparation

Kidneys were removed quickly and washed in cold

isotonic saline. The kidneys were homogenized in

50 mM phosphate buffer (pH 7) using an electronic

homogenizer to prepare 10% w/v homogenate. The

homogenate was centrifuged at 3000 rpm for 10

min at 4 o C by cooling ultracentrifuge (model Sigma

3K 30) to separate the nuclear debris. The aliquot

so obtained was used at 12000 rpm for 20 min at

4 o C to obtain post-mitochondrial supernatant

(PMS), which was used as a source of enzymes

(Khan and Sultana, 2005). A portion of the PMS

was centrifuged for 60 min at 34000 rpm at 4 o C.

The pellet was washed with phosphate buffer (50

mM pH 7).

Estimation of reduced glutathione (GSH) in PMS

Reduced GSH in mitochondria was determined by

measuring the rate of formation of chromophoric

product in a reaction between 5,5́-dithiobis-2-

(nitrobenzoic acid) (DTNB) and free sulphydryl

groups, such as GSH, at 412 nm as described by

Ellman (1959).

Estimation of Lipid peroxidation (LPO) in

micrososmal fraction

The measurement of microsomal fraction lipid

peroxide by a colorimetric reaction with

thiobarbituric acid was done as described by

Okhawa et al. (1979), and the determined lipid

peroxide is referred to as malondialdehyde. Briefly,

in a test tube, 2.5 ml of 20% trichloroacetic acid

solution and 1ml of 0.67% thiobarbituric acid

solution were added to the samples. The color of

thiobarbituric acid pigment was developed in a


38

Mahgoub Mohammed AHMED and Safaa Eid ALI

water bath at 100 ◦ C for 30 min. After cooling with

tap water to room temperature, 4ml n-butanol was

added and shaken vigorously. After centrifugation,

the color of butanol layer was measured at 535 nm.

Assay for glutathione-S-transferase (GST) activity

in PMS

Glutathione-S-transferase activity was assayed by

the method of Habig et al. (1974). The method is

based on the rate of conjugate formation between

GSH and 1-chloro-2,4-dinitrobenzene (CDNB).

The absorbance change was recorded at 340 nm

and the enzyme activity calculated as nmol CDNB

conjugates formed/min/mg protein.

Assay for glutathione peroxidase (GPx) activity in

PMS

Glutathione peroxidase activity was assayed by the

method of Mohandas et al. (1984). The change in

absorbance was recorded spectrophotometrically at

340 nm. GPx activity was expressed as nmol

NADPH oxidized/min/mg protein.

Assay for glutathione reductase (GR) activity in

PMS

Glutathione reductase activity was determined by

the method of Carlberg and Mannervik (1975). GR

was assayed by following the oxidation of NADPH

at 340 nm at 37 o C. GR activity was expressed as

nmol NADPH oxidized/min/mg protein.

Assay for catalase (CAT) activity in PMS

CAT activity measurement in PMS was measured

by the method of Takahara et al. (1960). The

reduction rate of H2O2 was followed at 240 nm for

30 s at room temperature. CAT activity was

expressed in nmol H2O2 consumed/min/mg protein.

Assay for glucose-6-phosphate dehydrogenase

(GPD) activity in PMS

The activity of glucose-6-phosphate dehydrogenase

was determined according to the method of Zaheer

et al. (1965). The changes in absorbance were

recorded at 340 nm and enzyme activity was

calculated as nmol NADP reduced/min/mg protein.

Estimation of protein concentration

The protein concentration in all samples was

determined by the method of Lowry et al. (1951).

Statistical analysis

The results are expressed as Mean±SEM. The

collected data were statistically analyzed by the

least significant differences (LSD) at the level 5%

of the probability procedure according to Snedecor

and Cochran (1980).

Results

Effect of pomegranate peel extract on renal toxicity

markers

The effect of pre-treatment of rats with

pomegranate peel extract on Fe-NTA-induced

enhancement in the level of serum creatinine and

urea are shown in Table (1). Fe-NTA treatment

leads to about 147% and 303% enhancement in the

values of creatinine and urea, respectively, as

compared with saline-treated group. Prophylaxis

with pomegranate peel extract at both doses

resulted in 28-45% and 48-88% reduction in the

values of serum creatinine and urea respectively as

compared with Fe-NTA-treated group.

Effect of pomegranate peel extract on glutathione

metabolism

Table (2) shows the effect of pretreatment of

rats with pomegranate peel extracts on Fe-NTAmediated

renal glutathione content and on the

activities of its metabolizing enzymes, viz,

glutathione-S-transferase and glutathione reductase.

Treatment with Fe-NTA alone resulted in the

depletion of renal glutathione and reduction in the

activities of glutathione-S-transferase and

glutathione reductase by 48%, 55% and 46%

respectively, as compared with saline-treated

group. However, pretreatment of animals with

pomegranate peel extract at 100 and 200 mg/kg

body weight resulted in the recovery by 79-83%,

46-73% and 40-72% respectively, as compared

with Fe-NTA-treated group.


Pomegranate peel extract against renal oxidative damage 39

Table 1. Effect of pomegranate peel ethanol extract on Fe-NTA-induced enhancement of serum

creatinine and urea in rats Values Mean±SEM (n=6 animals). a p


40

Mahgoub Mohammed AHMED and Safaa Eid ALI

Table 3. Effect of pomegranate peel ethanol extract on Fe-NTA-induced reduction in the activity of

renal antioxidant enzymes (CAT, GPx and GPD) and enhancement in the level of microsomal lipid

peroxidation (LPO) in rats Values are Mean±SEM (n=6 animals). a p


often metabolized to proximate toxicants by phase I

enzymes, e.g., cytochrome P450 which catalyze

oxidative reactions. The oxidized metabolites of

potentially toxic xenobiotics are then detoxified by

Phase II metabolizing enzymes into the forms that

are relatively inert and more easily excreted

(Talalay et al., 1995).

GSH depletion increases the sensitivity of organ

to oxidative and chemical injury. Studies with a

number of models show that the metabolism of

xenobiotics often produced GSH depletion

(Mitchell et al., 1973 and Ahmed and Zaki, 2009).

The depletion of GSH, also, seems to be the prime

factor that permits lipid peroxidation in the Fe-

NTA treated group. Pretreatment of pomegranate

peel extract reduced the depletion of GSH levels

and provided protection to the kidney. The

protection of GSH is by forming the substrate for

GPx activity that can react directly with various

aldehydes produced from the peroxidation of

membrane lipid. Pomegranate peel extract

pretreatment also reduced the elevated levels of

serum urea and ceatinine that are marker

parameters of kidney toxicity.

In conclusion, we can say that, the high

antioxidant and nephropreventive effect of the

pomegranate peel extract appeared to be attributed

to its high phenolics content. The mechanism of

action of pomegranate peel extract may be through

induction of various antioxidant and phase II

enzymes, and scavenging reactive oxygen species.

Thus our data suggest that pomegranate peel

ethanol extract is a potent nephropreventive agent.

Further work is required for the isolation and

characterization of individual phenolic compounds

present in peel ethanol extract and to determine the

mechanisms involved in the nephropreventive

effect of pomegranate peel extract.

References

Ahmed MM and Zaki NI. Assessment the

ameliorative effect of pomegranate and rutin on

chlorpyrifos-ethyl-induced oxidative stress in

rats. Nature and Science. 7(10): 49-61, 2009.

Ahmed MM. Biochemical studies on

nephroprotective effect of carob (Ceratonia

siliqua L.) growing in Egypt. Nature and

Science. 8 (3): 41-47, 2010.

Ajaikumar K.B, Asheef, M, Babu BH and

Padikkala J. The inhibition of gastric mucosal

injury by Punica granatum L. (pomegranate)

Pomegranate peel extract against renal oxidative damage 41

methanolic extract. Journal of Ethnopharma.

96: 171–176, 2005.

American Institute of Nutrition. Report of the

American Institute of Nutrition. Ad Hoc

Committee J Nutr. 110: 1340-1348, 1980.

Aruoma OI. Methodological considerations for

characterizing potential antioxidant actions of

bioactive components in plant foods. Mutation

Research. (523-524): 9-20, 2003.

Athar M and Iqbal M. Ferric nitrilotriacetate

promotes N-diethylnitrosamine-induced renal

tumorigenesis in the rat: implications for the

involvement of oxidative stress.

Carcinogenesis. 19 (6):1133-1139, 1998

Ayrton AD, Lewis DF, Waker R. and Ioannides C.

Antimutagenicity of ellagic acid towards the

food mutagen IQ: investigation into possible

mechanisms of action. Food and Chemical

Toxicology, 3D: 289-295, 1992.

Bartles H, Bohmer M and Heieri C. Serum

keratinin bestmmung ohno enteeissen. Clinical

Chimca Acta. 37: 139-197, 1972.

Bu-Abbas A, Clifford MN, Walker R and Ioannides

C. Marker antimutagenic potential of aquous

green tea extracts: Mechanism of action.

Mutagenesis. 9: 325-331, 1994.

Carlberg I and Mannervik B. Glutathione level in

rat brain. J Biological Chemistry. 250: 4480-

4575, 1975.

De Flora S and Ramel C. Mechanism of inhibition

of mutagenesis and carcinogenesis: classification

and overview. Mutation Research. 202:

285-306, 1988.

De Freitas JM and Meneghini R. Iron and its

sensitive balance in the cell. Mutation Research.

475: 153-159, 2001.

Deiana M, Aruma OI, Rosa A, Crobu V, Piga R

and Derri MA. The effect of ferricnitrilotriacetic

acid on the profile of

polyunsaturated fatty acids in the kidney and

liver of rats. Toxicol Letters. 123: 125-133,

2001.

Dhawan BN, Patnaik GK, Rastogi RP, Singh KK

and Tandon JS. Screening of Indian plants for

biological activity. Indian J. Exp. Biol. 15: 208-

219, 1977.

Ellman GL. Tissue sulfhydryl groups. Arch

Biochem Biophys. 82: 70-77, 1959.

Gil MI, Tomas-Barberan FA, Hess Pierce B,

Holcroft, DM. and Kader AA. Antioxidant


42

Mahgoub Mohammed AHMED and Safaa Eid ALI

activity of pomegranate juice and its

relationship with phenolic composition and

processing. Journal of Agricultural and food

chemistry. 48: 4581-4589, 2000.

Goldstein RS and Mayor GH. The nephrotoxicity

of cisplatin. Life Sci. 32: 685-690, 1983.

Gujraj ML, Varma DR and Sareen KN. Oral

contraceptives. Part 1. Preliminary observations

on the antifertility effects of some indigenous

drugs. Indian J Med Res. 48: 46-51, 1960.

Habig WH, Pabst MJ and Jakoby WB. Glutathione-

S-transferase. The first enzymatic step in

mercapturic acid formation. J Biol Chem. 249:

7130-7139, 1974.

Halliwell, B. and Gutteridge, J.M.C. Iron and free

radicals: two aspects of antioxidant protection.

Trends Biochem. Sci. 11: 372-375, 1986.

Hontecillas R, O'Shea M, Einerhand A, Diguardo

M, Bassaganya-Riera J. Activation of PPAR

gamma and alpha by punicic acid ameliorates

glucose tolerance and suppresses obesity-related

inflammation. J Am Coll Nutr. 28(2):184-95,

2009.

Khan N and Sultana S. Chemomodulatory effect of

Ficus racemosa extract against chemically

induced renal carcinogenesis and oxidative

damage response in Wistar rats. Life Sciences.

77(11):1194-210, 2005.

Kulkarni AP, Mahal HS, Kapoor S, Aradhya SM.

In vitro studies on the binding, antioxidant, and

cytotoxic actions of punicalagin. J Agric Food

Chem. 55(4):1491-500, 2007.

Li Y, Guo C, Yang J, Wei J, Xu J and Cheng S.

Evaluation of antioxidant properties of

pomegranate peel extract in comparison with

pomegranate pulp extract. Food Chemistry. 96:

254-260, 2006.

Lowry OH, Roseborough. NJ, Farr AL, and

Randall RL. Protein measurement with phenol

reagent. Journal of Biological Chemistry. 193

(1): 265-275, 1951.

Mitchell JR, Jollow DJ, Potter WZ, Gillete JR and

Brodie BB. Acetaminophen induced hepatic

necrosis. Protective role of glutathione. J.

Pharmacol. Exp. Ther. 187: 211-215, 1973.

Mohandas M, Marshall JJ, Duggin, GG, Hovath JS

and Tiller D. Differential distribution of

glutathione and glutathione related enzymes in

rabbit kidney. Cancer Research. 44: 586-5091,

1984.

Murthy KN, Jayaprakasha GK and Singh RP.

Studies on antioxidant activities of pomegranate

peel extract using in vivo models. J Agri Food

Chem. 50: 4791-4795, 2002.

Nasr CB, Ayed N and Metche M. Quantitative

determination of polyphenolic content of

pomegranate peel. Zeitschrzfi fur lebensmittel

unterschung und forschung. 203: 374-378,

1996.

Ohkawa H, Ohishi N and Nagi K. Assay of lipid

peroxides in animal tissue by thiobarbituric acid

reaction. Anal Biochem. 95: 251-358, 1979.

Okada S and Midorikawa O. Induction of rat renal

adenocarcinoma by ferric nitrilotriacetate (Fe-

NTA). Japanese Archives of International

Medicine. 29: 485-491, 1982.

Parmar HS, Kar A. Medicinal values of fruit peels

from Citrus sinensis, Punica granatum, and

Musa paradisiaca with respect to alterations in

tissue lipid peroxidation and serum

concentration of glucose, insulin, and thyroid

hormones. J Med Food. 11(2):376-381, 2008.

Patton CJ and Crouch SR. Spectrophotometric and

kinetics investigation of the Berthelot reaction

for the determination of ammonia. Analytical

Chemistry. 49: 464-469, 1977.

Ross IA. Medicinal plants of the world. Humana

Press, Totowa, New Jersey. 273-281, 1999.

Sato A. Cancer chemotherapy with oriental

medicine. 1. Antitumor activity of crude drugs

with human tissue cultures, in In vitro

screening. Int J Orient Med. 15 (4): 171-183,

1990.

Snedecor GW and Cochran WG. Statistical

methods. 7th ed . IOWA Stat Univ. Press, IOWA,

USA. 420, 1980.

Takahara S, Hamilton BM, Nell JV, Ogura, Y and

Nishimura ET. Hypocatalasemia, a new genetic

carrier state. J Clin Invest. 29: 610-619, 1960.

Talalay P, Fahey JW, Holtzclaw WD, Prestera, T

and Zhang Y. Chemoprotection against cancer

by phase II enzyme induction. Toxicology

Letters. (82-83): 173-179, 1995.

Thring TS, Hili P, Naughton DP. Anti-collagenase,

anti-elastase and anti-oxidant activities of

extracts from 21 plants. BMC Complementary

and Alternative Medicine. 9: 17-27, 2009.

Tsao B and Cuthoys NP. The absolute asymmetry

of prientation of gamma glutamyl

transpeptidase and amino-peptidase on the

external surface of the rat renal brush border


membrane. J Biological Chemistry. 255: 7708-

7711, 1980.

Umemura T, Sai K, Takagi, A, Hasegawa R and

Kurokawa Y. Oxidative DNA damage, lipid

peroxidation and nephrotoxicity induced in the

Pomegranate peel extract against renal oxidative damage 43

kidney after ferric nitilotriacetate administration.

Cancer Letter. 54(1-2): 95-100, 1990.

Zaheer N, Tiwari KK and Krishnan PS. Exposure

and solubilization of hepatic mitochondrial

shunt dehydrogenases. Archive of Biochemistry

and Biophysics. 109: 646-648, 1965.


Journal of Cell and Molecular Biology 7(2) & 8(1): 45-52, 2010 Research Article

Haliç University, Printed in Turkey.

http://jcmb.halic.edu.tr

Molecular and cytogenetic evaluation of Y chromosome in

spontaneous abortion cases

Gülşah KOÇ 1 , Korkut ULUCAN *,1 , Deniz KIRAÇ 2 , Deniz ERGEÇ 1 , Tufan TARCAN 3

and A. İlter GÜNEY 1 .

1 Marmara University, Faculty of Medicine, Department of Medical Genetics, Istanbul, Turkey.

2 Yeditepe University, Faculty of Medicine, Department of Biochemistry, Istanbul Turkey.

3 Marmara University, Faculty of Medicine, Department of Urology, Istanbul, Turkey.

(* author for correspondence; korkutulucan@hotmail.com)

Received: 21 April 2010; Accepted: 05 May 2010

Abstract

Infertility is defined as not being able to get pregnant despite having frequent, unprotected sex for at least a year.

Several conditions contribute to infertility and 50% is considered to be caused by a male-related factor.

Spontaneous abortion (SAB) is noninduced embryonic or fetal death or passage of products of conception before

the 20th week of pregnancy and is the most common complication of early pregnancy. SAB can occur by

teratogenic factors, advanced maternal age, genetic factors such as Y chromosome microdeletions and

chromosomal anomalies. In order to investigate the etiology of recurrent pregnancy loss (RPL) and to develop an

appropriate therapeutic strategy, it is necessary to ascertain the molecular and cytogenetic basis of these defects. In

this study, we aimed to reveal the relations between male infertility, Y chromosome microdeletions and SAB.

Thirty couples with a spontaneous abortion history and thirty fertile men were recruited to the study. All the

women were 46, XX and men were 46, XY. We couldn’t detect any Y chromosome microdeletion that could be the

reason for SAB. In order to evaluate effect of chromosome anomalies and Y chromosome microdeletions on SAB,

further studies with increased number of cases and controls need to be carried on.

Keywords: Infertility, spontaneous abortion, Y chromosome microdeletions.

Spontan düşük vakalarında Y kromozomunun moleküler ve sitogenetik incelemesi

Özet

Çiftlerin çocuk sahibi olma isteklerine ve düzenli cinsel ilişkiye rağmen, bir yıl içerisinde gebelik elde

edilmemesine infertilite (kısırlık) adı verilmektedir. İnfertiliteye etki eden birçok faktör bulunmaktadır ve bunların

%50’sinde etken erkek infertilitesidir. Gebeliğin ilk 20 haftası içinde, dışarıdan herhangi bir müdahale olmadan,

doğal nedenlerle, embriyo veya fetus ve eklerinin tamamının veya bir kısmının uterus kavitesi dışına atılması

olayına spontan düşük (abortus) denilmektedir ve gebeliğin erken döneminde en çok gözlenen komplikasyondur.

Spontan düşükler, teratojenik faktörler, ileri anne yaşı gibi nedenlerin yanında, Y kromozomu mikrodelesyonları ve

kromozomal anomaliler gibi genetik faktörlere bağlı olarak da oluşabilmektedir. Tekrarlayan gebelik kayıplarının

etyolojisini belirlemek ve uygun bir tedavi yöntemi geliştirmek için bu defektlerin moleküler ve sitogenetik

temellerinin incelenmesi gerekmektedir. Bu çalışmada, erkek infertilitesi, Y kromozom mikrodelesyonları ve

spontan düşükler arasındaki ilişkinin ortaya çıkarılması amaçlanmıştır. Spontan düşük hikayesi bulunan 30 çift ve

fertil 30 erkek çalışmaya dahil edilmiştir. Çalışmaya dahil olan bireylerin kromozom analizi sonuçlarına göre, tüm

kadınlar 46,XX ve erkekler ise 46,XY‘dir. Çalışmamızda spontan düşüklere neden olabilecek herhangi bir Y

kromozom mikrodelesyonu belirlenememiştir. Kromozom anomalilerinin ve Y kromozomu mikrodelesyonlarının

spontan düşükler üzerindeki etkisinin değerlendirilebilmesi için vaka ve kontrol sayılarının arttırılarak başka

çalışmalar yapılması gerekmektedir.

Anahtar Sözcükler: İnfertilite, spontan düşük, Y kromozom mikrodelesyonu.


46

Gülşah Koç et. al.

Introduction

Infertility is the inability of being pregnant after

one year of unprotected sexual intercourse.

Infertility comprises up to 15% of couples of

reproductive age in which 50% is caused by a male

factor (Noordam and Repping, 2006). Several

factors contribute to male infertility, such as gene

defects, hormonal milieu, chromosomal aberrations

and genital infections (Stipoljev et al., 2006).

Genetic factors are considered to affect almost 30%

of severe male infertility cases (Noordam and

Repping, 2006). The diagnosis of male infertility

include anamnesis, physical examination, semen

analysis, hormonal screening and genetic factors of

somatic cells (Stipoljev et al., 2006).

Spontaneous abortion (SAB) is the expulsion of

an embryo or fetus due to accidental trauma or

natural causes before approximately 22 nd week of

gestation. It effects up to 15% clinically recognized

pregnancies and considered to be the most common

adverse outcome of pregnancy. Although several

studies tried to explain the etiology of SAB, the

results are still controversial. Beside the teratogenic

factors and advanced maternal age, genetic factors

such as Y chromosome microdeletions and

chromosomal anomalies are considered to be the

main reason of SAB (Dewan et al., 2006; Pryor et

al., 1997).

Y chromosome is essential not only for human

sex determination but also for maintenance of sex

cells and sex cell development. Y chromosome

(Yq) microdeletions represent the most frequent

molecular genetic cause of severe infertility,

observed with a prevalence of 10-15% in nonobstructive

azoospermia and severe oligozoospermia

(Sinclair et al.,1990). The regions

responsible for male infertility of Y chromosome

are located on the long arm of chromosome and are

termed as AZFa, AZFb, AZFc (AZF: Azoospermia

Factor) ( Burgoyne, 1998) (Stouffs et al., 2009).

The AZFa locus is located on proximal Yq11

(Yq11.21), while AZFb and AZFc are located on

distal Yq11 (Yq11.23). These AZF genes code

RNA binding proteins and may be involved in the

regulation of gene expression, RNA metabolism,

RNA packaging and RNA transportation from

nucleus to cytoplasm (Li et al., 2008). Deletions of

these regions result in spermatogenic arrest and are

associated with oligozoospermia, azoospermia and

also with a extended testis histological profile range

from Sertoli cell only (SCO), maturation arrest and

hypospermatogenesis (Vollrath, 1992) (Vogt et al.,

1996) (Briton-Jones and Haines, 2000).

The prevalence of the Y chromosome

microdeletions in the proximal AZFc region was

found higher in men from recurrent pregnancy loss

(RPL) couples than from fertile or infertile couples.

Although these patients are from a tertiary referral

center that may not reflect the population

informations, one may consider proximal AZFc

region detecting in the evaluation of RPL couples

when all other tests fail to reveal the etiology

(Dewan et al., 2006).

Before performing a molecular test, cytogenetic

analysis is necessary for an accurate approach to

elucidate the causes of spontaneous abortion.

Chromosomal anomalies which may cause male

infertility can be determined by cytogenetic

techniques. It is also known that approximately

50% of recurrent spontaneous abortions in the first

trimester is caused by chromosomal anomalies.

Besides these, recent data show that Y chromosome

microdeletions can also be a major factor in these

cases. These findings suggest a potential relation

between RPL and microdeletions in AZF regions.

In order to investigate the etiology of RPL and

to develop an appropriate therapeutic strategy, it is

necessary to ascertain the molecular and

cytogenetic basis of these defects. So in this study,

we aimed to reveal the relations between male

infertility, Y chromosome microdeletions and

recurrent spontaneous abortions.

Material and methods

Patient and Control Groups

Thirty couples that applied to Marmara University,

Department of Urology and Kartal Education and

Research Hospital with a spontaneous abortion

history were recruited to the study. Thirty fertile

men, at least having one child, were examined as

the control group. Written informed consent was

taken from all cases.

Chromosome Analyses from Peripheral Blood

Cell Culture

Lymphocytes from 400 µl peripheral blood were

cultured for 72 hours at 37ºC culture medium

containing 8.5 ml RPMI, 1.5 ml fetal bovine serum,


200 µl L-Glutamin, 20 µl penicillin- streptomycin

and 200 µl phytohaemagglutinin. After incubation

at 37ºC for 72 hours, 200 µl Colchicine was added

to arrest the cells at metaphase. Following an

additional incubation at 37ºC for 30 minutes and

centrifugation at 20ºC for 8 min. at 1500 rpm the

supernatant was removed. The pellet was resuspended

with up to 10 ml hypotonic solution

(0.4% KCl solution) vortexed immediately. All the

samples were kept at 37ºC for 20 minutes and

again centrifuged at the same condition. After

removing supernatant from the samples, the pellet

which contains cells at metaphase, was

homogenised. Fixative solution (methanol and

acetic acid mixed with 3:1 ratio) was added and the

tubes were vortexed for the fixation of

chromosomes. Then samples were centrifuged after

adding up to 5 ml of fixative solution. Supernatant

was discarded from the samples and fresh fixative

solution was added to the tubes. This procedure

was repeated until the samples were clarified.

According to the cell density, up to 0.5 ml fixative

solution was added to the samples. Then samples

were homogenized and cells were lied onto slide

glasses, which were kept at 4ºC in distilled water

till they are used. After spreading the cells on the

slides, the samples were dried at room temperature

and kept overnight at 60ºC.

Y chromosome microdeletions in spontaneous abortions

Karyotyping

GTG (Giemsa-Trypsin) banding technique was

performed. When the banding of the chromosomes

was not successful, the protocol was repeated.

After staining, at least 20 metaphase plaques were

analysed for each sample (Figure 1).

Detection of Y chromosome microdeletions

DNA isolation from blood

DNA was extracted from 200 µl peripheral blood by

using High Pure PCR Template Preparation Kit

(Roche-Germany) according to the manufacturer’s

protocol.

Multiplex polymerase chain reaction

(multiplex PCR)

Table 1. Primers used for multiplex PCR and the length of amplicons.

MIX1 Amlicon

length (bp)

MIX2 Amlicon

length (bp)

For detection of Y chromosome microdeletions,

isolated DNA was amplified by multiplex PCR. AB

ANALITICA–The AZF Extension Kit, which is

recommended by European Andrology Association

was used in multiplex PCR. By using this kit, 13

different regions could be investigated at the same

time by performing 3 multiplex PCRs for each

sample. Three primer sets, each containing primers

that is unique to ZFX/Y locus which also exist in X

chromosome are shown in Table 1.

MIX3 Amlicon

length (bp)

ZFX/Y 495 ZFX/Y 495 DBY 689

SRY 472 SRY 472 ZFX/Y 495

sY 254 380 sY 95 303 SRY 472

sY 86 320 sY 117 262 sY 84 326

sY 127 274 sY 125 200 sY 134 301

sY 255 120 DFFRY 155

47


48

Gülşah Koç et. al.

In addition to the mixtures which are found in

the AZF Extension Kit, 0.3µl Taq DNA polymerase

and 8µl DNA sample were added to each tube

during multiplex PCR. The conditions of PCR

amplification were as follows: a denaturation step at

94˚C for 5 min followed by 35 cycles at 94˚C for 1

min, 60˚C for 1 min, 72˚C for 1 min and a final

extension at 72˚C for 7 min and stop at 4˚C. After

multiplex PCR, products were electrophoresed on

2% agarose gel.

Results

Karyotyping

Figure 1. Karyotype analyses of a male (46, XY) patient.

After performing lymphocyte cell culture,

metaphase plaques were analyzed for the detection

of karyotypes of patient and control groups.

According to karyotype analyses, all the males and

females were found as 46, XY and 46, XX

respectively in the patient group, whereas all the

males were found as 46, XY in the control group

(Figure 1).

Detection of Y chromosome microdeletions

After multiplex PCR, PCR products were examined

by electrophoresis on 2% agarose gel. Y

chromosome microdeletions were not found in

patient and control groups.


Y chromosome microdeletions in spontaneous abortions

Figure 2. Multiplex PCR analyses of Y chromosome microdeletions (M: 50 bp ladder (Fermentas,

Germany); Mix1a, Mix1b and Mix1c: 3 sets of PCR reactions that amplify different loci on Y chromosome

for sample a; Mix1b, Mix2b, Mix3b for sample b; boxes indicate the region and the length of the amplicons.

Discussion

Chromosomal abnormalities, including translocations

and deletions, are higher in infertile men and

are recognized as one of the main causes of

spontaneous abortions with an estimated frequency

of 50–70% (Svetlana et al., 2005)

In couples experiencing RPL, the incidence of

chromosomal translocations is higher than the

incidence present in newborn series (De Braekeleer

and Dao 1991). There is also evidence which

indicates that the presence of translocations

changes the spermatogenic process. It has been

found that the incidence of reciprocal translocation

carriers is seven times more than in newborn series.

As a general rule reciprocal translocation carriers

produce more unbalanced sperm than normal or

balanced sperm. The proportion of unbalanced

forms depends on the characteristics of the

reorganization. Also deletions which remove Y

chromosomal genes required for spermatogenesis

may effect infertility and susceptibility of RPL

(Byrne and Ward, 1994) (Simpson, 1981). As the

severity of the spermatogenic defect increases, the

frequency of the microdeletions also increases.

In this study, primarily, cytogenetic evaluation

was performed from peripheral blood samples of

the couples in spontaneous abortion cases. 30

couples who had a spontaneous abortion history

were karyotyped to detect the chromosome

anomalies. According to karyotype analyses, all the

women and men were found to be 46, XX and 46,

XY, respectively. In our study we couldn’t detect

any numerical and structural chromosome

anomalies that can be detected by karyotype

analyses. Other genetic abnormalities such as Y

chromosome microdeletions may effect spermatogenesis,

fertilization and post-zygotic metabolism

and may influence male infertility and RPL.

49


50

Gülşah Koç et. al.

So we used multiplex PCR for the detection of

microdeletions on the long arm of the Y

chromosome.

In this study, “AB ANALITICA–The AZF

Extension Kit” used for the analysis of

microdeletions rather than AZF-MX Extension kit.

Diagnostic sensitivity is considered to be the

capacity of the device to correctly identify the

deleted samples with reference to AZF locus under

investigation. The results obtained from an

experimental investigation show that the diagnostic

sensitivity of the system is 100%.

The kit is in premix format as all the reagents

for the amplification are pre-mixed and aliquoted in

single dose tubes in which only additional Taq

polymerase and the extracted DNA should be

added. This premix format allows the reduction of

the manipulation in preamplification steps, with

considerable time saving for the operator, the

repeated freezing/thawing of reagents (that could

alter the products’ performances) is avoided and,

above all, this form minimizes the risk of sample

contamination and the risk of false positive results.

The amplified regions of the Y chromosome are

not polymorphic and are well known to be deleted

specifically in men affected by oligo/azoospermia

according to the known, clinically relevant

microdeletion pattern (Viswambharan, 2007).

Based on the experience of many laboratories and

the results of external quality control and

considering the multiplex PCR format, the first

choice of STS primers recommended in the first

version of the guidelines remains basically valid.

These primers include the regions:

For AZFa: sY84, sY86

For AZFb: sY127, sY134

For AZFc: sY254, sY255

The usage of this primer set will enable the

detection of almost all the clinically relevant

deletions and of over 95% of the deletions reported

in the literature in the three AZF regions and is

sufficient for routine analysis (Simoni, 2004).

In this study, the set of PCR primers as best

choice for the diagnosis of microdeletion of the

AZFa, AZFb and AZFc region (sY14 (SRY),

ZFX/ZFY, sY84, sY86, sY127, sY134, sY254,

sY255) used in multiplex PCR reactions. We

couldn’t detect any Y chromosome microdeletions

in AZFa, AZFb and AZFc regions.

Genes that are located on Y chromosome and

responsible from spermatogenesis have a mosaic

structure at somatic and/or germ cells. When

leukocytes from blood were used, usually the

results can not be suitable for Y chromosome

microdeletion analysis because there may have

been deletions in germ cells (Martin, 2008).

There may be a mosaicism between

seminiferous tubules in terms of the expression of

genetic material. Some seminiferous tubules have

aplasia whereas some tubules can be normal or

mutant arrest at testes. In the identification of

deletions this situation may show different

outcomes when cells from blood or semen were

used. When fibroblasts or leukocytes are used in

genetic analysis, the proportion of a detection of Y

chromosome microdeletion is slightly low because

the deletions occuring in germ line cells have an

independent nature from other tissues.

In this study, we used peripherial blood

leukocytes for the detection of Y chromosome

microdeletions, however we couldn’t find any

deletions. But the possibility of having deletions in

germline cells shouldn’t be omitted. We are looking

forward to extend our study by adding spermial Y

chromosome microdeletion analysis from the same

individuals.

Dewan et al. (2006) reported the relation

between RPL and proximal AZFc deletions and

found a significant correlation. Although, they

detected proximal Y chromosome AZFc

microdeletions in 14 of 17 patients (82%), they

couldn’t find any deletion in control group.

Karaer et al. (2008) reported 43 infertile men

among which 7 of them have sY 220 (AZFb)

deletions (16%) of the 4 examined region, stating

the importance of AZF deletions in the aetiology of

RPL.

In the previous studies, sequenced tagged site

(STS) numbers which were selected for detection

of Y chromosome microdeletions are different from

each other. After physical mapping of Y

chromosome, more than 300 STS were produced. It

was stated that, analysing of low number of STS

can be insufficient for detection of deletion regions

also high number of STS can give false-positive

results as polymorphic regions may identified as

deletions (Simoni, 2001).

One of the most important criteria for the

detection of Y chromosome microdeletions is the

selected STS. For this reason, European Andrology

Association and European Molecular Genetics


Quality Network improved a standardization to

distinguish the differences of deletion proportions

between different laboratories. So they proposed 6

STS for detecting of AZFa, AZFb ve AZFc regions.

In the present study, although 13 STS including 6

STS which were suggested by European Molecular

Genetics Quality Network were analyzed, we

couldn’t detect any microdeletions on Y

chromosome. We propose the evolution of the

results by increasing the analysed STS.

Due to limited knowledge of the metabolism

and the progress of the genes on Y chromosome,

we can not predict the answers of the questions

including Y chromosome microdeletion’s effect on

RPL. For this reason researches should be focused

on the relationship of Y chromosome microdeletions,

male infertility and RPL.

References

Briton-Jones C, Haines CJ. Microdeletions on the

long arm of the Y chromosome and their

association with male-factor infertility. HKMJ

6: 184-9, 2000.

Burgoyne PS. The mammalian Y chromosome: A

new perpective. Bioassays, 20:3636, 1998.

Byrne J.L.B, Ward K. Genetic Factors in Recurrent

Abortion. Clinical Obstetircs and Gynecology,

37 (3): 693-704, 1994.

De Braekeleer M, Dao TN. Cytogenetic studies in

male infertility: a review. Hum Reprod. 6:245-

50, 1991.

Dewan S, Puscheck EE, Coulam CB, Wilcox AJ,

Jeyendran RS. Y-chromosome microdeletions

and recurrent pregnancy loss Andrology

Laboratory Services Inc., Chicago, Illinois,

USA. Fertil Steril.;85(2):441-5, 2006.

Genetics and male infertility. Verh K Acad

Geneeskd Belg.; 71(3):115-39. Review. Dutch.,

2009.

Karaer A, Karaer K, Ozaksit G, Ceylaner S, Percin

EF. Y chromosome azoospermia factor region

microdeletions and recurrent pregnancy loss.

Am J Obstet Gynecol.;199(6):662.e1-5, 2008.

Li Z., Haines CJ., HanY. Micro-deletions of the

human Y chromosome and their relationship

with male infertility. J. Genet. Genomics 35,

193−199, 2008.

Y chromosome microdeletions in spontaneous abortions

Martin R.H. Cytogenetic determinants of male

fertility. Human Reproduction Update, 14 (4):

379-390, 2008.

Noordam M.J., Repping S. The human Y

chromosome: a masculine chromosome, Current

Opinion in Genetics & Development, 16: 225-

232, 2006.

Pryor JL, Kent-First M, Muallem A. Prospective

analysis of Y chromosome microdeletions in

200 consecutive male infertility patients. N Engl

J Med 336: 534-539, 1997

Simoni M. Molecular diagnosis of Y chromosome

microdeletions in Europa: state-of-the-art and

quality control. Human Reprod, 16(3): 402-409,

2001.

Simoni M., Bakker E., Krausz C. EAA/EMQN

best practice guidelines for molecular diagnosis

of y-chromosomal microdeletions. international

journal of andrology, 27:240–249, 2004.

Simpson J.L. Antenatal Diagnosis of Cytogenetics

Abnormalities. Clinical Obstetrics and

Gynecology, 24: 1024-1039, 1981

Sinclair AH, Berta P, Palmer MS, Hawkins JR,

Griffits BL, Smith MJ. A gene from the human

sex-determining region encodes a protein with

homology to a conserved DNA-binding motif.

Nature, 346:240-4, 1990.

Stipoljev F., Vujisic S., Parazajder J., Hafner D.,

Jezˇek D., Sertic J. Cytogenetic analysis of

azoospermic patients: karyotype comparison of

peripheral blood lymphocytes and testicular

tissue European Journal of Obstetrics &

Gynecology and Reproductive Biology 124

197–203, 2006.

Stouffs K, Vandermaelen D, Tournaye H, Liebaers

I, Van Steirteghem A, Lissens W.

Svetlana G. Vorsanova, Alexei D. Kolotii, Ivan Y.

Iourov, Viktor V. Monakhov, Elena A.

Kirillova, Ilia V. Soloviev, and Yuri B. Yurov.

Evidence for High Frequency of Chromosomal

Mosaicism in Spontaneous Abortions Revealed

by Interphase FISH Analysis Journal of

Histochemistry & Cytochemistry. 53(3): 375-

380, 2005.

Viswambharan N, Suganthi R, Simon A M,

Manonayaki S. Male infertility: polymerase

chain reaction-based deletion mapping of genes

on the human chromosome. Singapore Med J;

48 (11): 1140.2007.

51


52

Gülşah Koç et. al.

Vogt, PH, Edelman A, Kirsch S, Henegariu O,

Hirschmann P, Keisewetter. Human Y

chromosome azospermic factors (AZF) mapped

to different subregions in Yq11. Hum Mol

Genet 5: 933-45, 1996.

Vollrath D, Foote S, Hilton A. The human Y

chromosome: A 43 interval map based on

naturally occuring deletions. Science. 258:52-9,

1992.


Journal of Cell and Molecular Biology 7(2) & 8(1): 53-70, 2010 Research Article

Haliç University, Printed in Turkey.

http://jcmb.halic.edu.tr

Do simple sequence repeats in replication, repair and recombination

genes of mycoplasmas providing genetic variability?

Seema TRIVEDI

Computational Biology Lab., Department of Zoology, JN Vyas University, Jodhpur

(Rajasthan), India

(author for correspondence; svtrived@hotmail.com)

Received: 25 December 2009; Accepted: 14 May 2010

Abstract

Simple sequence repeats (SSRs) or microsatellites are mono to hexa-nucleotide tandem repeats of DNA that

are ubiquitous in intergenic regions and coding regions of genomes. SSRs may be essential for any genome

as these repeats are found even in organisms like mycoplasmas (class Mollicutes) that have small genome

size. Mollicutes cause different diseases in vertebrates including humans, insects and plants. Antibiotics have

been developed against membrane proteins and replication related proteins like gyrase and topoisomerase.

However, some pathogens have developed immunity against these drugs. Mycoplasmas can evade host

immune response in which SSRs variations in membrane proteins play an important role. The present study

seeks presence of di- to penta-nucleotide repeats in genes associated with DNA replication, repair and

recombination in thirteen mycoplasma genomes. Association of SSRs with these genes may have potential to

provide variability for evading antibiotics against replication, repair and recombination proteins. In the

present study SSRs are present in few genes but among the repeats found, maximum repeats are present in

methylase, DNA polymerase, excinuclease and topoisomerase genes. Maximum number of repeat types are

dinucleotides but present only in M. pulmonis. Pentanucleotide repeats are present in three mycoplasmas but

tetranucleotide repeats are present in eight mycoplasmas.

Keywords: Microsatellites, Mycoplasma, repair, replication, simple sequence repeats

Mikoplazmanın replikasyon, tamir ve rekombinasyon genlerindeki basit dizi tekrarları

genetik çeşitlilik mi sağlıyor?

Özet

Basit dizi tekrarları (SSR) veya mikrosatelitler, genomun intergenik bölgelerinde ve kodlanan bölgelerinde

sıkça rastlanan, DNA’nın birden (mono) altıya (hekza) kadar ard arda gelen nükleotit tekrarlarıdır. Bu

tekrarlar mikoplazma (Mollicutes sınıfı) gibi küçük genom büyüklüğüne sahip bir organizmada bile

bulunduğundan, SSR’ler herhangi bir canlı için elzem olabilir. Mollicutes, insan, böcek ve bitkileri de içeren

omurgalılarda çeşitli hastalıklara yol açarlar. Zar proteinlerine ve giraz, topoizomeraz gibi replikasyonla

alakalı proteinlerine karşı antibiyotikler geliştirilmiştir. Ancak, bazı patojenler bu ilaçlara karşı bağışıklık

kazanmışlardır. Zar proteinlerindeki SSR varyasyonlarının mikoplazmaların konakçı hücrenin bağışıklık

tepkisinden kaçmalarında önemli bir rolü olabilir. Bu çalışma, onüç mikoplazma genomunda DNA

replikasyonu, tamiri ve rekombinasyonu ile ilgili genlerdeki ikiliden (di-) beşliye (penta-) kadar olan

nükleotit tekrarlarını araştırır. Bu genlerin SSR’ler ile ilişkisi, replikasyon, tamir ve rekombinasyon

proteinlerine karşı geliştirilen antibiyotiklerden kaçmaları için çeşitlilik sağlamada potansiyele sahip olabilir.

Bu çalışmada, SSR’ler birkaç gende mevcuttur, ama bulunan tekrarlar arasında en fazla tekrar metilaz, DNA

polimeraz, ekzinükleaz ve topoizomeraz genlerinde vardır. Tekrar tiplerinden en fazla sayıda bulunanlar

dinükleotitlerdir ancak sadece M. Pulmonis’de bulunur. Pentanükleotit tekrarları üç mikoplazmada, ama

tetranükleotit tekrarları sekiz mikoplazmada mevcuttur.

Anahtar Sözcükler: Mikrosatelitler, mikoplazma, tamir, replikasyon, basit dizi tekrarları


54

Seema TRIVEDI

Introduction

Simple sequence repeats (SSRs) or microsatellites

are mono to hexa-nucleotide tandem repeats of

DNA that are ubiquitous in all genomes studied

so far. SSRs are present not only in intergenic

regions of a genome, but may also be found in

introns and exons of coding regions (Karlin et al.,

1997; Bachtrog et al., 1999; Bachtrog et al., 2000;

Butcher et al., 2000; Chambers and MacAvoy,

2000; Toth et al., 2000). It is possible that SSRs

are essential part of any genome as these repeats

are present even in organisms like mycoplasmas

that have small genome size (Hancock, 1996a).

These repetitive DNA may be involved in

different functions like chromatin organization,

gene regulation, evading host-immune responses,

recom bination hotspots and facilitating genome

rearrangements, affecting protein structure thus

possibly protein-protein interactions etc. (Mrázek,

2006). Interestingly, it has also been found that

SSRs may provide variability to host for evading

pathogens. This is reported in case of house

finches (Carpodacus mexicanus) that show

multilocus heterozygosity that could result in

reduced susceptibility to Mycoplasma

gallisepticum infection (Hawley et al., 2005).

Similarly, Porcine C3 gene (high homology with

human C3) involved in phagocytosis, inflamema

tion and immunoregulation to destroy infectious

micro-organisms, possess Tn SSR in the

3’flanking region which may be helpful in

resisting infections (Mekchay et al., 2003).

Mycoplasmas (class Mollicutes) are parasites

or commensals that may cause different diseases

in vertebrates including humans, insects and

plants. Repetitive sequences like RepMp and

MgPar elements are involved in homologous

recombination of parts of P1, P40, P90 and P110

proteins of Mycoplasma pneumoniae and Myco

plasma genitalium. Recombination events

mediated with help of MPN490- and MG339encoded

proteins (RecA homo logs) in genes of

immunogenic adhesion proteins result in

variations that may play eminent roles in immune

evasive strategies (Sluijter et al., 2009). Repeated

sequences, DR-1 and DR-2, within the putative

cytadhesin pvpA gene of M. gallisepticum are

present in isolates from Chinese poultry farms.

Approximately 30 or more proline residue repeats

and 7-10 repeats of the tetrapeptide motif may

affect functionality of PvpA as an adhesin molecule

(Jiang et al., 2009). Similarly, insertion sequences

(IS3, IS4 and IS30) in Mycoplasma bovis

(Lysnyansky et al., 2009) and variable-number

tandem-repeats (VNTRs) associated with coding

sequences that can provide genetic diversity are

present in Mycoplasma hyopneumoniae strains,

Mycoplasma agalactiae type strain PG2,

Mycoplasma mycoides subspecies mycoides. These

IS and VNTRs possibly code for amino acid repeats

and can affect cell adhesion and interactions with the

host immune system (de Castro et al., 2006;

McAuliffe et al., 2007; McAuliffe et al., 2008).

Tandem amino acid repeats in M. pneumoniae

RepMP1-containing genes and Myco plasma

pulmonis Vsa proteins may have regulatory functions

(Simmons and Dybvig, 2007; Musatovova et al.,

2008). Amino acid repeats that may affect antigenic

response are present in haemagglutinins (immuno

genic, variably expressed, surface proteins) of M.

synoviae (VlhA) (Bencina, 2002).

Though SSRs have been investigated in

mycoplasmas, the focus of studies has not been

replication, repair and recombination genes. This

study was undertaken to seek answer to questions

like whether replication, repair and recombination

genes in mycoplasmas are associated with SSRs.

How can SSRs association with these genes be

beneficial to these organisms? The present study on

SSRs in replication, repair and recombination genes

in thirteen mycoplasmas may indicate mutational

hotspots that may help these organisms evade

antibiotics against these genes. On the other hand,

these mutational hotspots may prove to be target sites

for developing drugs to prevent such evasive

strategies of the organisms.

Method

Obtaining sequences and genome information

Replication, repair and recombination related gene

sequences (total numbers given in Table-1) of

thirteen myco plasmas (Mycoplasma arthritidis

158L3-1, Mycoplasma capricolum subsp capricolum

California kid ATCC 27343, Mycoplasma

gallisepticum strain R, Mycoplasma genitalium G-37,

Mycoplasma hyopneumoniae 232, Mycoplasma

hyopneumoniae 7448, Mycoplasma hyopneumoniae

J, Mycoplasma mobile 163K, Mycoplasma mycoides

SC PG1, Mycoplasma penetrans HF-2, Mycoplasma

pneumoniae M129, Mycoplasma pulmonis UAB


CTIP and Mycoplasma synoviae 53) were

downloaded from “The Comprehensive Microbial

Resource” (CMR http://cmr.jcvi.org/cgi-bin/

CMR/CmrHomePage.cgi). Total genome length,

CG richness, coding percentage and number of

Table 1. List of mycoplasmas and genome details

Organism

Genome

length

nt

Genome

CG%

Coding

%

SSRs in Mycoplasma replication genes

protein coding genes for each Mycoplasma were

downloaded from NCBI (http://www.ncbi.nlM.

nih.gov/sites/entrez?db=genome&cmd=Retrieve&do

pt=Overview&list_uids=) (Table 1).

Total

protein

genes

Total

replication

and repair

genes

% of

genes

with

repeats

Mycoplasma

arthritidis 158L3-1 820453 30 88 631 32 3.13

Mycoplasma

capricolum subsp

capricolum California

kid ATCC 27343

Mycoplasma

1010023 23 88 812 45 8.89

gallisepticum strain R

Mycoplasma

996422 31 87 726 30 3.33

genitalium G-37

Mycoplasma

580076 31 90 475 28 3.57

hyopneumoniae 232

Mycoplasma

892758 28 89 691 34 2.94

hyopneumoniae 7448

Mycoplasma

920079 28 85 657 35 2.86

hyopneumoniae J

Mycoplasma mobile

897405 28 87 657 34 2.94

163K

Mycoplasma mycoides

777079 24 90 633 39 5.13

SC PG1

Mycoplasma penetrans

1211703 23 81 1016 51 1.96

HF-2

Mycoplasma

1358633 25 88 1037 76 2.63

pneumoniae M129

Mycoplasma pulmonis

816394 40 87 689 36 5.56

UAB CTIP 963879 26 89 782 53 9.43

Mycoplasma synoviae

53 799476 28 88 659 36 8.33

55


56

Seema TRIVEDI

SSR search

Replication, repair and recombination related

gene sequences of all thirteen mycoplasmas were

subjected to repeat search programme SPUTNIK

(http://espressosoftware.com/sputnik/index.html).

SPUTNIK looks for di-, tri-, tetra- and pentanucleotide

repeats; tolerates insertions, mismatch

es and deletions but these affect the overall score.

Repeats found through this search were not

grouped i.e. the 5’ to 3’ or vice-a versa and the

complements were not put together. For example,

dinucleotide repeat CA was not grouped with AC,

TG or GT. Hence, each repeat was treated as

separate motif.

SSR CG richness and length

Length of an SSR was measured in nucleotides

(base pairs). However, repeat length given as

output from SPUTNIK was adjusted to nearest

divisible value i.e. dinucleotide repeat length

should be divisible by 2, trinucleotide by 3,

tetranucleotide repeat by 4 and pentanucleotide

repeat by 5. For example, if repeat length for

dinucleotide repeats was indicated as 11nt by

SPUTNIK output; this was adjusted to 10nt, for

trinucleotide repeats if the length was 14nt it was

adjusted to 15nt or if it was 16nt or 17nt it was

considered as 15nt.

Statistical analysis

For statistical analysis, SPSS (Version 16.0) was

used. One way ANOVA followed by Tukey’s

HSD at 95% confidence level was done to seek

significant difference in between the thirteen

species repeat number as well different replica

tion, repair and recombination genes.

Pearson’s ‘r’ two tailed correlation analysis of

genome size and CG richness, sequence lengths

of replication, repair and recombination genes and

CG richness vis-à-vis repeat numbers, length and

.

CG richness of total repeats and repeat types was

done.

Results

Total SSRs, repeat types and motifs in thirteen

mycoplasmas replication, repair and recombination

genes

Figure 1 shows total numbers of SSRs and repeat

types present in replication, repair and recombination

genes in genomes of thirteen mycoplasmas where M.

pulmonis has the maximum number of repeats

followed by M. capricolum and M. synoviae (5, 4

and 3 respectively).

Among repeat types, dinucleotides (five) are

present only in M. pulmonis. Maximum numbers of

tri nucleotides are in M. capricolum. Presence of

other repeat types in replication, repair and

recombination genes of mycoplasmas are given in

Figure 1.

There is diversity in repeat motifs found in the

present study among which maximum frequency

(four) is of tetranucleotide repeat ATTT followed by

dinucleotide repeat motifs AG (Table-2).

Total replication, repair and recombination genes

associated with SSRs in mycoplasmas

Methylase genes have maximum number of total

repeats (eight) followed by DNA polymerase,

excinuclease and topoisomerase genes (three in each)

among replication, repair and recombination genes in

thirteen mycoplasmas (Figure 2). Among repeat

types total dinucleotide followed by tetra nucleotide

repeats as well as the motifs AG and ATTT have

maximum frequency (all in methylase genes)

(Figures 2 and 3).

Comparison of total repeats and repeat types in

replication, repair and recombination genes of each

Mycoplasma is given in Figure 4 and motifs in Table

3, where once again methylase genes in M. pulmonis

have maximum repeats.


SSRs in Mycoplasma replication genes

Figure 1. Total SSRs and SSR types in thirteen mycoplasmas replication, repair and recombination genes.

Di: Dinucleotides, Tri: Trinucleotides, Tetra: Tetranucleotides, Penta: Pentanucleotides, Total: Total Repeats.

Figure 2. Total SSRs and SSR types in total replication, repair and recombination genes of mycoplasmas. Di:

Dinucleotides, Tri: Trinucleotides, Tetra: Tetranucleotides, Penta: Pentanucleotides, Total: Total Repeats.

57


58

Seema TRIVEDI

Table 2. SSR motifs and motif numbers in total replication, repair and recombination genes of thirteen

mycoplasmas. Di: Dinucleotide, Tri: Trinucleotide, Tetra: Tetranucleotide, Penta: Pentanucleotide.

Repeat

Name

Di

Tri

Tetra

Penta

Length of repeats

Organism Motifs

AG CA GA

M. pulmonis 3 1 1

Grand Total 3 1 1

AAG AAT AGA GAA TGA TGT

M. arthritidis 1

M. capricolum 1 1 1

M. mobile 1

M. penetrans 1

M. synoviae 1

Grand Total 1 2 1 1 1 1

AATT ATTT TTTA TTTC

M. capricolum 1

M. genitalium 1

M. hyopneumoniae 232 1

M. hyopneumoniae 7448 1

M. hyopneumoniae J 1

M. mobile 1

M. mycoides 1

M. penetrans 1

Grand Total 1 4 2 1

AAAAT AAAGC AATTG ACCAA CAAAC

M. gallisepticum strain R 1

M. pneumoniae 1 1

M. synoviae 1 1

Grand Total 1 1 1 1 1

Repeats in thirteen mycoplasmas are not very

long as maximum repeat lengths are 28nt and

26nt which are in methylase genes (dinucleotide

CA and GA respectively in M. pulmonis)

followed by 24nt which are in methylase and

gyrase genes (dinucleotide AG in M. pulmonis

and trinucleotide AAG in M. arthritidis

respectively) (Figure 5 and Table 4).

CG richness of SSRs

There is variation (0% to 50%) in CG richness of

SSRs in replication, repair and recombination genes

of mycoplasmas (Table 5). CG% differs in the same

gene group among different Mycoplasma. For

example, DNA polymerase shows different CG

richness in different Mycoplasma (0% in M.

synoviae, 33.33% in M. mobile and 40% in M.

pneumoniae).


SSRs in Mycoplasma replication genes

Figure 3. SSR motifs in total replication, repair and recombination genes in mycoplasmas. legends represent

the motifs as per the bar chart.

59


60

Seema TRIVEDI

Figure 4. Total SSRs and SSR Types In Replication, Repair and Recombination Genes In Thirteen Mycoplasmas. Di: Dinucleotides, Tri:

Trinucleotides, Tetra: Tetranucleotides, Penta: Pentanucleotides, Total: Total Repeats.


SSRs in Mycoplasma replication genes

Table 3. Number of SSR motifs in replication, repair and recombination genes of thirteen

mycoplasmas.

Organism Motif

Conserved

Hypothetical Protein

DNA Polymerase

Endonuclease

Excinuclease

M. arthritidis AAG 1

Gyrase

Ligase

Methylase

Methyltransferase

P35 Lipoprotein

Homolog

AGA 1

M. capricolum

TGA

TGT 1

1

TTTA 1

M. gallisepticum ACCAA 1

M. genitalium AATT 1

M. hyopneumoniae 232 ATTT 1

M. hyopneumoniae 7448 ATTT 1

M. hyopneumoniae J ATTT 1

M. mobile

GAA

ATTT

1

1

M. mycoides TTTA 1

M. penetrans

AAT

TTTC 1

1

M. pneumoniae

AAAGC

CAAAC 1

1

AG 3

M. pulmonis

CA 1

GA 1

AAT 1

M. synoviae

AAAAT 1

AATTG 1

Replication Initiator

SSBP

Topoisomerase

61


62

Seema TRIVEDI

Figure 5. Lengths of total SSRs and SSR type in total replication, repair and recombination genes of mycoplasmas. SSR lengths in

number of nucleotides (nt).


SSRs in Mycoplasma replication genes

Table 4. Repeat lengths (nt) in total SSR types and SSR motifs in replication, repair and recombination genes

of thirteen mycoplasmas. Di: Dinucleotides, Tri: Trinucleotides, Tetra: Tetranucleotides, Penta:

Pentanucleotides, Total: Total Repeats.

.

Gene Organism SSR Motif

SSR

Length

Conserved Hypothetical Protein M. synoviae Penta AATTG 10

DNA Polymerase

M. mobile Tri GAA 12

M. pneumoniae Penta CAAAC 10

M. synoviae Tri AAT 12

Endonuclease M. penetrans Tetra TTTC 12

Excinuclease

M. capricolum Tri AGA 12

M. pneumoniae Penta AAAGC 15

M. synoviae Penta AAAAT 10

Gyrase M. arthritidis Tri AAG 24

Ligase M. genitalium Tetra AATT 12

Methylase

M. hyopneumoniae 232 Tetra ATTT 12

M. hyopneumoniae 7448 Tetra ATTT 12

M. hyopneumoniae J Tetra ATTT 12

M. pulmonis Di GA 26

CA 28

14

AG 16

24

Methyltransferase M. mobile Tetra ATTT 12

P35 Lipoprotein Homolog M. penetrans Tri AAT 18

Replication Initiator M. capricolum Tri TGT 12

SSBP M. capricolum Tri TGA 12

Topoisomerase

M. capricolum Tetra TTTA 12

M. gallisepticum Penta ACCAA 10

M. mycoides Tetra TTTA 12

63


64

Seema TRIVEDI

Table 5. CG richness of SSRs and motifs in replication, repair and recombination genes in thirteen

mycoplasmas. Di: Dinucleotide, Tri: Trinucleotide, Tetra: Tetranucleotide, Penta: Pentanucleotide

SSR

CG%

0

Gene Name Repeat Motif Organism

SSR

Number

DNA Polymerase Tri AAT M. synoviae 53 1

Excinuclease Penta AAAAT M. synoviae 53 1

Ligase Tetra AATT M. genitalium G-37 1

Methylase Tetra ATTT M. hyopneumoniae 232 1

M. hyopneumoniae 7448 1

M. hyopneumoniae J 1

Methyltransferase Tetra ATTT M. mobile 163K 1

P35 Lipoprotein

Homolog

Tri AAT

M. penetrans HF-2 1

Topoisomerase Tetra TTTA M. capricolum 1

M. mycoides 1

20 Conserved

Hypothetical Protein

Penta AATTG

M. synoviae 53 1

25 Endonuclease Tetra TTTC M. penetrans HF-2 1

33.33 DNA Polymerase Tri GAA M. mobile 163K 1

Excinuclease Tri AGA M. capricolum 1

Gyrase Tri AAG M. arthritidis 158L3-1 1

Replication Initiator Tri TGT M. capricolum 1

40

SSBP Tri TGA M. capricolum 1

DNA Polymerase Penta CAAAC M. pneumoniae M129 1

Excinuclease Penta AAAGC M. pneumoniae M129 1

Topoisomerase Penta ACCAA M. gallisepticum strain R 1

50 Methylase Di AG M. pulmonis 3

CA M. pulmonis 1

Discussion

SSRs in genomes of virus, prokaryotes and

eukaryotes are present not only in intergenic

regions but also in introns and exons of coding

sequences (Hancock, 1996a and b; Karlin et al.,

1997; Bachtrog et al., 1999; Bachtrog et al., 2000;

Butcher et al., 2000; Toth et al., 2000; Trivedi,

2003, 2004, 2006; Mrázek et al., 2007). Studies in

different genomes have also shown associations

GA M. pulmonis 1

of SSRs with replication, repair and recombination

genes, housekeeping genes or membrane proteins

(Trivedi, 2003; Mrázek et al., 2007; Guo and

Mrázek, 2008). Antigenic variations facilitated by

SSRs in host-adapted pathogens like mycoplasmas

have been reported (Guo and Mrázek, 2008).

However, studies have so far not focused on


association of SSRs with replication, repair and

recombination genes.

Total repeats

Mycoplasmas have small genomes possibly due

to genome reduction. It is possible that some

SSRs may have played a role in Mycoplasma

evolution (Hancock, 1996a; Rocha and

Blanchard, 2002) which could be due to

mutational bias towards SSR reduction instead of

expansion if not maintained by selection (Metzgar

et al., 2002).

The present study shows few repeats in total

replication, repair and recombination genes which

corresponds to studies in whole genome studies

on mycoplasmas (Mrázek et al., 2007) but with

some differences from the reported number of

repeats in these genes in M. hyopneumoniae (Guo

and Mrázek, 2008). This difference is possibly

due to difference in the algorithms used in the

present study and the analysis criteria. ANOVA

does not show any significant difference between

the thirteen mycoplasmas nor between genes of

each Mycoplasma in the present study. Besides

this, present study does not show any correlation

of genome length with any parameter as indicated

in the material and method section. This is

consistent with some studies (Hancock, 2002;

Lim et al., 2004) but contrary to studies done

earlier in eukaryotes and prokaryotes (Hancock,

1996b; Primmer et al., 1997; Achaz et al., 2002;

Trivedi, 2004 and 2006; Mrázek et al., 2007).

Though the focus of present study is on specific

genes, this lack of correlation of genome size may

indicate confirmation of the fact that genome size

is not expanding and possibly SSRs (in total

genomes) that are so few in number are playing a

role in genome reduction in Mycoplasma

(Hancock 1996a; Mrázek et al., 2007; Guo and

Mrázek, 2008).

Genome CG% show significant positive

correlation only with penta nucleotide number

and length. Similarly, significant positive

correlation of average CG% of total replication,

repair and recombination genes with pentanucleo

tide lengths (P< 0.05, 0.587*) is seen in the

present study. There is significant positive

correlation (P< 0.01, 0.931**) of total SSR

number with percentage of total replication, repair

and recombination genes with repeats. Total SSR

numbers show significant positive correlation

with total dinucleotide number (P< 0.01, 0.700**)

and total tetranucleotides show significant

SSRs in Mycoplasma replication genes

negative correlation with pentanucleotide number

(P< 0.05, -0.659*).

This data is not sufficient to draw conclusion that

positive correlation of percentage of genes having

repeats with total repeats may be an indication of

probable increase in repeat number in these genes in

other pathogens as well. It would be interesting to

investigate repeats in those micro-organisms as well

against which antibiotics are being used. Antibiotic

treatment would alter environment and these

pathogens may develop different strategies to evade

these challenges. These evasive strategies may

involve the membrane proteins or replication, repair

and recombination related genes or gene products

depending on the target proteins of antibiotics.

SSR average length

Many organisms studied so far have shown

differences in not only abundance of SSRs but also in

tolerance for length of SSRs. For example, archaea

like Methanosarcina mazei strain Goe1,

Methanobacterium thermoautotrophicum DH,

Helicobacter pylori have some SSRs that are long

compared to other species (Field and Wills, 1998;

Trivedi, 2006). Among vertebrates, cold-blooded

vertebrates like turtles have long repeats (Chambers

and MacAvoy, 2000); whereas humans have longer

SSRs compared to homologues in chimps (Cooper et

al., 1998).

Long SSRs have not been found in the present

study including other studies in M. penetrans, M.

mobile, and M. synoviae. Short A(n) and T(n) repeats

are abundant in M. hyopneumoniae and M. pulmonis

(Mrázek, 2006). The present study shows significant

positive correlation between total SSR average

length with dinucleotide number and length as well

as tetranucleotide CG% (P< 0.05, 0.563*, 0.563* and

P< 0.01, 1.000** respectively). Dinucleotide average

length has significant positive correlation with total

SSR as well as dinucleotide numbers and CG% of

total SSRs (P< 0.01, 0.700**, 1.000** and 0.870**

respectively). Significant positive correlation of

trinucleotide length is seen with trinucleotide number

but negative correlation with pentanucleotide CG%

(P< 0.05, 0.672* and P< 0.01,-1.000** respectively).

Tetranucleotide average length has positive

correlation with tetranucleotide number but negative

correlation with pentanucleotide number as well as

length (P< 0.01, 1.000**, P< 0.05, -0.659* and P<

0.01, -0.688** respectively). There is positive

correlation of pentanucleotide average length with

pentanucleotide number (P< 0.01, 0.963**).

65


66

Seema TRIVEDI

Reports have suggested that in prokaryote

genomes, significantly long SSRs are generally

rare but association of long mono-, di-, tri-, and

tetranucleotides are mostly restricted to hostadapted

pathogens. Besides this, a number of long

SSRs are also associated with housekeeping

genes, including rRNA and tRNA genes, genes

encoding ribosomal proteins, amino acyl-tRNA

synthetases, chaperones, and important metabolic

enzymes. Statistically significant associa tions

between SSRs and gene functional classifications

suggest that most long SSRs are not related to a

particular cellular function or process (Guo and

Mrázek, 2008). This conclusion may be true for

many organisms and particularly prokaryotes, but

pilot study on silkworm genes has indicated

biased association of SSRs with genes associated

with replication and repair process though length

of SSRs was not focus of the study (Trivedi,

2003). In Mycobacterium leprae long SSRs are

mostly associated with pseudogenes and may be

contributing to gene loss following the adaptation

to an obligate pathogenic lifestyle. The authors

speculate that LSSRs may have played a similar

role in genome reduction of other host-adapted

pathogens (Guo and Mrázek, 2008). Similarly in

M. gallisepticum SSRs are biased towards

deletion unlike eukaryotic genomes where they

are biased towards expansion (Metzgar et al.,

2002).

Among prokaryotes, it is proposed that the

differences could be due to functional nature of

these repeats or because some of these genomes

lacks mismatch repair (Field and Wills, 1998).

However, the latter reason does not apply to

eukaryotes and particularly to differentces

between chimpanzee and human SSRs.

SSR average CG%

Total SSRs CG% show positive correlation with

total SSR and dinucleotide number (P


epeats. Frame-shift mutations caused in either di-

or tetra-nucleotide (of the present study) repeats

in these genes may facilitate altered methylation

patterns and influence gene expression thus may

indirectly contribute to antigenic variations that

could help in evasion of host immune response

(Rocha and Blanchard, 2002; Mrázek, 2006; Guo

and Mrázek, 2008).

DNA polymerase, excinuclease, gyrase and

topoisomerase

Among replication, repair and recom bination

genes; M. mobile, M. pneumoniae, M. synoviae

have repeats in DNA polymerase. Excinuclease

genes have SSRs in M. capricolum, M.

pneumoniae and M. synoviae and topoisomerase

genes have SSRs in M. capricolum, M.

gallisepticum and M. mycoides. However, gyrase

genes have SSR only in M. arthritidis 158L3-1

and single strand binding proteins (SSBP) only in

M. capricolum. SSRs association with DNA

polymerase, gyrase and SSBP genes besides other

essential as well as housekeeping genes has also

been reported in other prokaryotes including

mycoplasmas. Guo and Mrázek (2008) speculate

that variation in essential genes like replication,

repair and recombination genes (except

methylase) in prokaryotes may not be helpful but

possibly these SSRs affect transcription initiation.

However, there is a possibility that these SSRs

are once again providing most of these pathogens

opportunity to evade antibiotics. This hypothesis

gets its support from the fact that many

prokaryotes including mycoplasmas are becoming

resistant to fluoroquinolones that are broadspectrum

antibiotics like ofloxacin (OFX),

ciprofloxacin (CFX) and sparfloxacin (SFX)

targeted against proteins like topoisomerase II

family, DNA gyrase and topoisomerase IV. Some

mycoplasmas have developed resistance against

these drugs due to mutations in target regions of

these enzymes (Bébéar et al., 1998). Therefore it

is suggested that those drugs would be more

effective that would target at least two

proteins/genes simultaneously to block of slow

down DNA replication. This is because two

mutations simultaneously in two genes to evade

antibiotics would be rare and hence it may be

more effective as it has been suggested in studies

done on Staphylococcus aureus (Fournier et al.,

2000).

Similarly, there are mutants against antibiotics

that target Mycoplasma ribosomes (Pereyre et al.,

SSRs in Mycoplasma replication genes

2002). It is possible that SSRs in the rRNA genes

(Guo and Mrázek, 2008) (but not part of this study)

may be providing genetic variability to the pathogen

to evade altered living environment due to antibiotics

against their ribosomes.

Functions of SSRs

SSRs may play diverse roles in genomes of different

organisms. Some of these repeats act as contingency

loci in association with families of surface antigens

in pathogens, affect DNA supercoiling, gene

expression or recombination hotspots. M.

gallisepticum major surface protein pMGA

expression switching from pMGA1.1 to pMGA1.2 is

associated with (GAA)(12) repeat and variations in

length (Glew et al., 2000; Liu et al., 2000; Liu et al.,

2002). M. pneumoniae, M. genitalium, Ureaplasma

urealyticum and M. pulmonis have recombination

potentials in different genomic regions. In particular

M. pulmonis has illegitimate recombination at the vsa

locus. M. pneumoniae and M. genitalium adhesins

have large distant repeats that may be responsible for

homologous recombination for variation (Rocha and

Blanchard, 2002). However, M. hyopneumoniae have

fewer repeats compared to other mycoplasma.

Therefore, it is intriguing how M. hyopneumoniae

evades host immune response and establishes chronic

infection in absence of repeats (Minion et al., 2004).

Not all SSRs may be related with these functions.

For example, repeats in M. hyopneumoniae may not

be contingency loci as these appear independent of

location upstream or downstream of genes. Further,

among 3 M. hyopneumoniae strains study shows that

the An and Tn repeats may be rarely involved in

genome rearrangements (Mrázek, 2006).

Conclusion

The diversity of repeat numbers and motifs may be

due to diversity of host environments and selection

pressures that different mycoplasmas live in. It is

also possible that SSRs are present in regions of

those segments where the amino acid coded by SSRs

may help in flexibility of protein fold (disordered

region). This may enable the protein to be more

flexible in terms of protein-protein interactions and

may have multiple partners, hence making them

possible hubs of protein interaction networks

(Mrázek, 2006). However, in the present study, the

possible role of SSRs in these genes/proteins

involves DNA binding capacity. Any mutation in

these SSRs or other regions of the protein may affect

67


68

Seema TRIVEDI

DNA-protein interaction and hence affect

replication efficiency. Since there are antibiotics

targeted against replication enzymes, these SSRs

may be involved in providing platform for small

mutations that are not large enough to totally

affect functions of DNA replication, repair and

recombination but are efficient enough to evade

the antibiotics.

Acknowledgements

The author is grateful to Department of

Biotechnology (DBT, Ministry of Science and

Technology, India) for funding this work.

References

Achaz G, Rocha EPC, Netter P and Coissac E.

Origin and fate of repeats in bacteria. Nucleic

Acids Res. 30: 2987-2994, 2002.

Bachtrog D, Agis M, Imhof M and Schlotterer C.

Microsatellite varia bility differs between

dinucleotide repeat motifs - evidence from

Drosophila melanogaster. Mol Biol Evol. 17:

1277-1285, 2000.

Bachtrog D, Weiss S, Zangerl B, Brem G and

Schlotterer C. Distribution of dinucleotide

microsatellites in the D. melanogaster

genome. Mol Biol Evol. 16: 602-610, 1999.

Bébéar CM, Renaudin H, Charron A, Bové JM,

Bébéar C and Renaudin J. Alterations in

Topoisomerase IV and DNA gyrase in

quinolone-resistant mutants of Mycoplasma

hominis obtained In Vitro. Antimicrob Agents

Chemotherapyapy. (42)9:2304-2311, 1998.

Bencina D. Haemagglutinins of pat-hogenic avian

mycoplasmas. Avian Pathol. 6: 535-47, 2002.

Butcher RD, Hubbard SF and Whitfield WG.

2000. Microsatellite frequency and size

variation in the part henogenetic parasitic

wasp Venturia canescens (Gravenhorst)

(Hymen optera: Ichneumonidae). Insect Mol

Biol. 9: 375-384.

Chambers KG and MacAvoy ES. Microsatellites:

Consensus and cont roversy. Comp Biochem

Physio (Part B). 126: 455-476, 2000.

Cooper G, Rubinsztein DC and Amos W.

Ascertainment bias cannot entirely account for

human microsatellites being longer than their

chimpanzee homologues. Hum Mol Genet. 7:

1425-9, 1998.

de Castro LA, Rodrigues Pedroso T, Kuchiishi SS,

Ramenzoni M, Kich JD, Zaha A, Henning

Vainstein M and Bunselmeyer Ferreira H.

Variable number of tandem amino acid repeats in

adhesion-related CDS products in Mycoplasma

hyopneu moniae strains. Vet Microbiol. (4): 258-

69, 2006.

Fabre E, Dujon B and Richard GF. Transcription and

nuclear transport of CAG/CTG trinucleotide

repeats in yeast. Nucleic Acids Res. 30(16): 3540-

7, 2002.

Field D and Wills C. Abundant microsatellite

polymorphism in Saccharomyces cerevisiae, and

the different distributions of micro satellites in

eight prokaryotes and S. cerevisiae, result from

strong mutation pressures and a variety of

selective forces. Proc Natl Acad Sci USA. 95:

1647–1652, 1998.

Fournier B, Zhao X, Lu T, Drlica K and Hooper DC.

Selective targeting of Topoisomerase IV and

DNA gyrase in Staphylococcus aureus: different

patterns of quinolone-induced inhi bition of DNA

synthesis. Antimicrob Agents Chemotherapy.

44(8): 2160–2165, 2000.

Glew MD, Browning GF, Markham PF and Walker

ID. pMGA phenotypic variation in Mycoplasma

gallisep ticum occurs in vivo and is mediated by

trinucleotide repeat length variation. Infect

Immun. 68(10): 6027-33, 2000.

Guo X and Mrázek J. Long simple sequence repeats

in host-adapted pathogens localize near genes

encoding antigens, housekeeping genes, and

pseudogenes. J Mol Evol. 67(5): 497-509, 2008.

Hancock JM and Santibanez-Koref MF.

Trinucleotide expansion diseases in the context of

micro- and minisatellite evolu tion. EMBO J. 17:

5521-5524, 1998.

Hancock JM. Genome size and accumulation of

simple sequence repeats: implications of new data

from genome sequencing projects. Genetica. 115:

93-103, 2002.

Hancock JM. Simple sequences and the expand ing

genome. Bioessays. 18: 421-425, 1996b.

Hancock JM. Simple sequences in a “minimal”

genome. Nat Genet. 14: 14-15, 1996a.

Hartenstine MJ, Goodman MF and Petruska J. Base

stacking and even/odd behavior of hairpin loops

in DNA triplet repeat slippage and expansion

with DNA polymerase. J Biol Chem. 275: 18382-

18390, 2000.


Hawley DM, Sydenstricker KV, Kollias GV and

Dhondt AA. Genetic diversity predicts

pathogen resistance and cell-mediated

immunocompetence in house finches. Biol

Lett. 1(3): 326-9, 2005.

Jiang HX, Chen JR, Yan HL, Li XN, Chen ZL

and Zeng ZL. Molecular variability of DR-1

and DR-2 within the pvpA gene in

Mycoplasma gallisepticum isolates. Avian Dis.

53(1): 124-8, 2009.

Karlin S, MrázekJ and Campbell AM. Compo

sitional biases of bacterial genomes and

evolutionary impli cations. J Bacteriol. 179:

3899-3913, 1997.

Katti MV, Ranjekar PK and Gupta VS.

Differential distribution of simple sequence

repeats in eukaryotic genome sequences. Mol

Biol Evol. 18: 1161-1167, 2001.

Kruglyak S, Durrett R, Schug D and Aquadro CF.

Distribution and abun dance of micro satellites

in the yeast genome can be explained by a

balance between slippage events and point

mutations. Mol Biol Evol. 17(8): 1210-1219,

2000.

Li Y, Korol AB, Fahima T, Beiles A and Nevo E.

Microsatellites: genomic distribution, puta tive

functions and mutational mechanisms: a

review. Molec Eco. 11: 2453-2465, 2002.

Lim S, Notley-McRobba L, Lim M and Carter

DA. A comparison of the nature and

abundance of micro satellites in 14 fungal

genomes. Fungal Genet Biol. 41: 1025-1036,

2004.

Liu L, Dybvig K, Panangala VS, van Santen VL

and French CT. GAA trinucleotide repeat

region regulates M9/pMGA gene expression

in Mycoplasma gallisepticum. Infect Immun.

68(2): 871–876, 2000.

Liu L, Panangala VS and Dybvig K. Trinucleotide

GAA repeats dictate pMGA gene expression

in Mycoplasma gallisepticum by affect ing

spacing between flanking regions. J Bacteriol.

184(5): 1335–1339, 2002.

Lysnyansky I, Calcutt MJ, Ben-Barak I, Ron Y,

Levisohn S, Methé BA and Yogev D.

Molecular characterization of newly identified

IS3, IS4 and IS30 insertion sequence-like

elements in Mycoplasma bovis and their

possible roles in genome plasticity. FEMS

Micro Biol Lett. 294(2): 172-82, 2009.

SSRs in Mycoplasma replication genes

McAuliffe L, Ayling RD and Nicholas RA.

Identification and charac terization of variablenumber

tandem -repeat markers for the molecular

epidemiological analysis of Mycoplasma

mycoides subspecies mycoides SC. FEMS Micro

Biol Lett. 276(2): 181-8, 2007.

McAuliffe L, Churchward CP, Lawes JR, Loria G,

Ayling RD and Nicholas RA. VNTR analysis

reveals un expected genetic diversity within

Mycoplasma agalactiae, the main causative agent

of contagious agalactia. BMC Microbiol. 8: 193,

2008.

Mekchay S, Ponsuksili S, Schellander K and

Wimmers K. Association of the porcine C3 gene

with haemolytic complement activity in the pig.

Genet Sel Evol. 35(Suppl 1): S83-96, 2003.

Metzgar D, Bytof J and Wills C. Selection against

frameshift muta tions limits microsatellite

expansion in coding DNA. Genome Res. 10: 72-

80, 2000.

Metzgar D, Liu L, Hansen C, Dybvig K and Wills C.

Domain-level differences in micro satellite distri

bution and content result from different relative

rates of insertion and deletion mutations. Genome

Res. 12(3): 408-13, 2002.

Minion FC, Lefkowitz EJ, Madsen ML, Cleary BJ,

Swartzell SM and Mahairas GG. The genome

sequence of Mycoplasma hyopneumoniae strain

232, the agent of swine mycoplasmosis. J

Bacteriol. 186(21): 7123-33, 2004.

Mrázek J, Guo X and Shah A. Simple sequence

repeats in prokaryotic genomes. Proc Natl Acad

Sci USA. 104(20): 8472-7, 2007.

Mrázek J. Analysis of distribution indicates diverse

functions of simple sequence repeats in

Mycoplasma genomes. Mol Biol Evol. 23(7):

1370-85, 2006.

Musatovova O, Kannan TR and Baseman JB.

Genomic analysis reveals Mycoplasma

pneumoniae repetitive element 1-mediated

recombination in a clinical isolate. Infect Immun.

76(4): 1639-48, 2008.

Pereyre S, Gonzalez P, De Barbeyrac B, Darnige A,

Renaudin H, Charron A, Raherison S, Bébéar C

and Bébéar CM. Mutations in 23S rRNA account

for intrinsic resistance to macrolides in

Mycoplasma hominis and Mycoplasma

fermentans and for acquired resistance to

macrolides in M. hominis. Antimicrob Agents

Chemotherapy. 46(10): 3142-50, 2002.

69


70

Seema TRIVEDI

Primmer CR, Raudsepp T, Chowdhary BP,

Moller AP and Ellegren H. Low frequency of

microsatellites in the avian genome. Genome

Res. 7: 471-482, 1997.

Rocha EP, Blanchard A. Genomic repeats,

genome plasticity and the dynamics of

Mycoplasma evolution. Nucleic Acids Res.

30(9): 2031-42, 2002.

Simmons WL and Dybvig K. Biofilms protect

Mycoplasma pulmonis cells from lytic effects

of complement and gramicidin. Infect Immun.

75(8): 3696-9, 2007.

Sluijter M, Spuesens EB, Hartwig NG, van

Rossum AM and Vink C. The Mycoplasma

pneumoniae MPN490 and Mycoplasma

genitalium MG339 genes encode reca

homologs that promote homologous DNA

strand exchange. Infect Immun. 77(11): 4905-

11, 2009.

Toth G, Gaspari Z and Jurka J. Microsatellites in

different eukaryo tic genomes: survey and

analysis. Genome Res. 10: 967-981, 2000.

Trivedi S. Comparison of simple sequence repeats

in 19 Archaea. Genet Mol Res. 5(4): 741-72,

2006.

Trivedi S. Do Microsatellites Have Biased

Associations? The Nucleus. 46(1,2): 61-76,

2003.

Trivedi S. Microsatellites (SSRs): Puzzles within

puzzle. Indian J Biotech. 3: 331-347, 2004.


Journal of Cell and Molecular Biology 7(2) & 8(1): 71-72, 2010 Software Review

Haliç University, Printed in Turkey.

http://jcmb.halic.edu.tr

Tcoffee ©: Multipurpose sequence alignments program

Authors: C. NOTREDAME, L. HOLME D.G. HIGGINS, J. HERINGA, O.

O'SULLIVAN, K SUHRE, C. ABERGEL

License: Open source freeware

Tcoffee at a glance

T-Coffee stands for Tree based Consistency

Objective Function for Alignment Evaluation. It is

a recent program for making multiple sequence

alignments. It yields more accurate alignments at

the cost of a slightly longer running time than other

programs. Although it uses a progressive alignment

method like ClustalW, it compares segments across

the entire sequence set, which means aligning all

the sequences at the same time. The main

difference between Tcoffee and ClustalW is that

Tcoffee doesn’t directly use substitution matrices to

align sequences. It has many different applications

and modules such as the main EXPRESSO for

aligning sequences and structures, CORE for

evaluating the accuracy of an alignment, Mcoffee

for combining many alternative multiple sequence

alignments into one. Briefly, Tcoffee could be

described as a collection of tools for computing,

evaluating and manipulating multiple alignments of

DNA, RNA and protein sequences and structures.

Tcoffee and its contribution to research

Recently, many researchers in the field of

molecular biology have used Tcoffee modules in

building, computing, evaluating and manipulating

multiple sequence alignments during their original

research. Although Tcoffee has been produced and

developed few years ago, it has been cited in many

peer reviewed articles. However the number of

citations is still not comparable to ClustalW. Beside

its quick ability to produce results, the open source

freeware license and its efficient multifunctional

modules make Tcoffee one of the most useful

programs for making multiple sequence alignments.

Advantages and disadvantages of Tcoffee

Advantages

- It produces more accurate alignments than the

other methods.

- It is equipped with many different tools and

modules such as CORE, Mcoffee and

-

EXPRESSO for structure alignment, evaluation

and combining alignments.

Tcoffee can deal with many input formats,

including FASTA, Swiss-Prot and PIR (Protein

Information Resource).

- Tcoffee produces sequence alignment in various

formats so that it can be used as an input for

another program. It also produces a colorized

alignment where every residue appears on a

background that indicates the quality of this

alignment in (.html) and (.pdf) format.

- It can produce true phylogenetic tree in Newick

format by using the Neighbor Joining method.

- It can work with list of DNA, RNA or protein

sequences.

- Tcoffee can evaluate the quality of any multiple

sequence alignments using CORE server.

Disadvantages

- It takes longer time to align multiple sequences

than other programs.

- It has been cited in limited number of peer

reviewed journals compared to ClustalW.

However, this number is increasing rapidly

every day.


72

Software design

T-Coffee is an open source freeware. It can

generate multiple sequence alignment for a given a

set of sequences (Protein, RNA or DNA). The latest

version of T-Coffee is 5.65. It runs on UNIX or

Microsoft Windows/Cywin. Version 2.00 and

higher can combine sequences and structures. It

uses bioperl in the design. The interface is self

explanatory with no complicated terms and

expression. EXPRESSO aligns the structures using

SAP, a program from Taylor and Orengo, and it

aligns sequences and structures using FUGUE, a

threading package from Kenji Mizuguchi

(developed in Tom Blundell’s lab at Cambridge

University). CORE server on www.tcoffee.org can

evaluate the quality of any multiple sequence

alignments with any of the most common formats

(MSF, ALN, FASTA, and PIR).

Limitations in use

- The input for Tcoffee is limited to a maximum

number of sequences of 50 and the maximum

length of sequences of 2000.

- The data will remain available on the server for

only nine days. Then it will be deleted.

- It is very important to cite the Tcoffee authors

when using its resources. For instance, if you

use the local version of Tcoffee, cite the

following paper:-

Notredame, D. Higgins, J. Heringa . T-Coffee: A

novel method for multiple sequence alignments.

Journal of Molecular Biology, Vol 302, pp205-

217,2000.

Otherwise, cite the paper that corresponds to the

server you have been using (click on the "cite"

button associated with every server on

www.tcoffee.org).

New features, flavors and tools of Tcoffee

Alignment

TCOFFEE (Regular or advanced): Computes a

multiple sequence alignment and the associated

phylogenetic tree.

EXPRESSO (3DCoffee) (Regular or advanced):

This server computes structure based Multiple

Sequence Alignments.

MCOFFEE (Regular or advanced): Computes a

multiple sequence alignment and the associated

phylogenetic tree by combining the output of

several multiple sequence alignment packages

(PCMA, Poa, Mafft, Muscle, T-Coffee,

ClustalW, ProbCons, DialignT).

COMBINE (Regular or advanced): combines two

(or more) multiple sequence alignments into a

single one.

RCOFFEE (Regular or advanced): Multiple

Sequence Alignment of Non Coding RNA

Sequences using RNAplfold predicted

secondary structures.

Evaluation

CORE (Regular or advanced): evaluates your

Alignment and outputs a colored version where

bad portions are in blue and the good ones in

red. Your alignment must contain at least four

sequences

iRMSD-APDB (Regular or advanced): Evaluates

your Multiple Sequence Alignment using

APDB which estimates the proportion of

columns correctly aligned in a pairwise or a

multiple alignment of sequences with known

structures.

List of Tcoffee servers availability around

the world

- www.tcoffee.org

- http://tcoffee.vital-it.ch/cgibin/Tcoffee/tcoffee_cgi/index.cgi

- http://www.es.embnet.org/Services/MolBio/tcoffee/

- http://www.ebi.ac.uk/t-coffee/

Ahmed MANSOUR

Genetics Department,

Faculty of Agriculture,

Zagazig University, Egypt

(author for correspondence; amansour@zu.edu.eg)

Received: 27 March 2008; Accepted: 11 December 2009


Tcoffee © : Çok amaçlı dizi hizalama programı

Yazarlar: C. NOTREDAME, L. HOLME D.G. HIGGINS, J. HERINGA, O.

O'SULLIVAN, K SUHRE, C. ABERGEL

Lisans: Açık kaynak, ücretsiz yazılım

Tcoffee’ye kısa bir bakış

T-coffee "Ağaç Bazlı Tutarlılık Uyum Amaç

Fonksiyonunun Değerlendirilmesi" anlamına

gelmektedir. Çoklu dizi hizalaması yapmak için

kullanılan yeni bir programdır. Biraz daha uzun

çalışma zamanı pahasına diğer programlardan daha

kesin hizalama sağlamaktadır. ClustalW gibi

progresif bir program kullanmasına rağmen aynı

zamanda hizalanmış bütün sekansları ifade eden

bütün sekans setiyle karşılaştırmaktadır. Tcoffee

sekansları hizalamak için matris yer değişimini

direkt olarak kullanmamasıdır. Tcoffee ve

ClustalW arasındaki ana fark Tcoffee'nin sekansları

hizalamak için matris yer değişimini direkt olarak

kullanmamasıdır.. Başlıca dizi ve yapıların

hizalanması için EXPRESSO, bir hizalamanın

kesinliğini değerlendirmek için CORE, birçok

alternatif çoklu dizi hizalamalarını tek olarak

birleştirmek için Mcoffee gibi çok farklı

uygulamalar ve modüllere sahiptir. Kısaca, Tcoffee

DNA, RNA ve protein dizileri ve yapılarının çoklu

dizi hizalamasını kullanma, hesaplama ve

değerlendirme için bir alet topluluğuymuş gibi

tanımlanabilir.

Tcoffee ve araştırmaya katkısı

Son zamanlarda, moleküler biyoloji alanındaki

birçok araştırmacı orijinal araştırmaları süresince

çoklu dizi hizalaması yapmak, manipüle etmek,

hesaplamak ve değerlendirmek için Tcoffee

modüllerini kullanmaktadır. Tcoffee birkaç yıl önce

üretilmiş ve geliştirilmiş olmasına rağmen, birçok

derlenmiş eşdüzey makalede atıfta bulunulmuştur.

Ancak atıf sayısı hala ClustalW ile karşılaştırılamaz.

Sonuçları hızlı elde etme özelliğine ilaveten,

73

açık kaynak ücretsiz yazılım lisansı ve çok

fonksiyonlu etkili modülleri, Tcoffee’yi çoklu dizi

hizalaması için en kullanışlı programlardan biri

yapar.

Tcoffee’nin avantajları ve dezavantajları

Avantajları

- Diğer metodlardan daha kesin karşılaştırmalar

ortaya koyar.

- Yapı hizalama, hesaplama ve hizalamaları

birleştirme için CORE, Mcoffee ve EXPRESSO

gibi birçok farklı aletle ve modülle donatılmıştır.

- Tcoffee; FASTA, Swiss-Prot ve PIR (Protein

Information Resource, Protein bilgi kaynağı) da

dahil birçok input formatını düzenlemek için

açabilir.

- Tcoffee çeşitli fomatlarda dizi hizalaması yapar.

Bundan dolayı başka bir program için bir input

olarak kullanılabilir. Ayrıca (.html) ve (pdf)

formatında bu hizalamanın kalitesini belirten bir

arka plan üzerinde her kalıntının göründüğü

yerde renklendirilmiş bir hizalama yapar.

- Neighbor Joining metodunu kullanarak Newick

formatında doğru filogenetik ağaç oluşturabilir.

- DNA, RNA veya Protein dizileri listesiyle

çalışabilir.

- Tcoffee CORE sunucusunu kullanarak herhangi

çoklu dizi hizalamasının kalitesini değerlendirebilir.

Dezavantajları

- Çoklu dizileri karşılaştırmada diğer

programlardan daha uzun zaman alır.

- ClustalW’e göre sınırlı sayıda derlenmiş

eşdüzey dergide atıfta bulunulmuştur. Ancak bu

sayı her gün hızlıca artmaktadır.


74

Yazılım Dizaynı

T-Coffee bir açık kaynak ücretsiz yazılımdır.

Verilen bir dizi seti (Protein, DNA ya da RNA) için

çoklu dizi hizalaması oluşturmaktadır. Tcoffee’nin

en son versiyonu 5.65’tir. UNIX ya da Microsoft

Windows/Cywin ile çalışır. Sürüm 2.00 ve üzeri

yapıları ve dizileri birleştirebilir. Bu dizaynda

Bioperl kullanır. Arabirim karmaşık olmayan terim

ve anlatımlarla kendiliğinden anlaşılır.

EXPRESSO, Taylor ve Orengo tarafından yazılan

bir program olan SAP’ı kullanarak yapıları hizaya

sokar. Dizileri ve yapıları Kenji Mizuguchi’den bir

dizi paketi (Cambridge üniversitesinde Tom

Blundell’s Laboratuarında geliştirilen) olan

FUGUE’yi kullanarak hizaya sokar.

www.tcoffee.org üzerinde CORE sunucusu en

yaygın formatların (MSF, ALN, FASTA ve PIR)

herhangi biriyle çoklu dizi hizalama kalitesini

değerlendirebilir.

Kullanımda sınırlamalar

- Tcoffee için input maksimum dizi sayısı 50 ve

maksimum dizi uzunluğu 2000’e kadar

sınırlandırılmıştır.

- Veriler sunucu üzerinde sadece dokuz gün

kullanılabilir olarak kalacaktır. Sonra

silinecektir.

- Kaynaklarını kullanırken Tcoffee yazarlarına

atıfta bulunmak önemlidir. Örneğin,

Tcoffee’nin sınırlı sürümünü kullanırsanız

belirtilen makaleye atfedin:-

Notredame, D. Higgins, J. Heringa . T-Coffee: A

novel method for multiple sequence alignments.

Journal of Molecular Biology, Vol 302, pp205-

217, 2000.

Aksi takdirde, kullandığınız sunucuya karşılık

gelen makaleye atıfta bulunun

(www.tcoffee.org üzerindeki her sunucuyla

alakalı “cite” tuşuna tıklayarak).

Tcoffee’nin aygıtları, belirli özellikleri ve

yeni özellikler

Hizalama

TCOFFEE (normal ya da gelişmiş düzeyde): Çoklu

dizi hizalama ve ilişkilendirilmiş filogenetik

ağacı hesaplar.

EXPRESSO (3DCoffee) (normal ya da gelişmiş

düzeyde): Bu sunucu yapı temelli Çoklu Dizi

Hizalamalarını hesaplar.

MCOFFEE (normal ya da gelişmiş düzeyde):

Birkaç çoklu dizi hizalama paketininin (PCMA,

Poa, Mafft, Muscle, T-Coffee, ClustalW,

ProbCons, DialignT) output’unu (çıkış)

birleştirerek çoklu dizi hizalama ve ilişkilendirilmiş

filogenetik ağacı hesaplar.

COMBINE (normal ya da gelişmiş düzeyde): iki

(veya daha fazla) çoklu dizi hizalamalarını tek

bir tanesinde birleştirir.

RCOFFEE (normal ya da gelişmiş düzeyde):

RNAplfold tarafından oluşturulan tahmini

ikincil yapıları kullanarak Kodlanmayan RNA

Dizilerinin Çoklu Dizi Hizalaması.

Değerlendirme

CORE (normal ya da gelişmiş düzeyde):

Hizalamanızı ve kötü kısımlarının mavi iyi

olanların kırmızı olduğu renkli çıktılarınızı

değerlendirir. Hizalamanız en azından dört dizi

içermelidir.

iRMSD-APDB (normal ya da gelişmiş düzeyde):

İkili olarak doğru bir şekilde hizalanmış ya da

yapıları bilinen dizilerin çoklu hizalamasında

sütunların oranını tahmin eden APDB

kullanarak Çoklu Dizi Hizalamasını değerlendirir.

Dünya çapında kullanılabilir Tcoffee

sunucuları listesi

- www.tcoffee.org

- http://tcoffee.vital-it.ch/cgibin/Tcoffee/tcoffee_cgi/index.cgi

- http://www.es.embnet.org/Services/MolBio/tcoffee/

- http://www.ebi.ac.uk/t-coffee/

Ahmed MANSOUR

Genetik Bölümü,

Ziraat Fakültesi,

Zagazig Üniversitesi, Mısır


Journal of Cell and Molecular Biology 7(2) & 8(1): 75-77, 2010 Software Review

Haliç University, Printed in Turkey.

http://jcmb.halic.edu.tr

UCSC: Genome Browser for genomic sequences

Authors: UCSC Genome Bioinformatics Group led by David Haussler and Jim Kent,

Center for Biomolecular Science & Engineering, University of California

License: Free for academic, non-profit, and personal use. A license is required for

commercial use.

Genome browser at a glance

Genome Browser is a tool for collecting all relevant

genomic sequence data in one site and provides

rapid, reliable, and simultaneous display of any

requested portion of genomes at any scale in a

graphical design. The UCSC Genome Browser

resource contains the reference (or official) public

DNA sequences and working draft assemblies for

human and a large collection of other genomes.

There are a number of tools within this site that

provides access to the sequences themselves, and

many other useful genome features to add context

to the genomic information. Researchers can use

this site to find genes and gene predictions,

expression information, SNPs and variations, crossspecies

comparative data, and many more.

Moreover, the UCSC provide the ability to search

for markers and sequences, to extract annotations

for specific regions or for the whole genome, and to

act as a central starting point for genomic research.

It also provides a portal to the ENCODE project.

UCSC genome browser contribution to

research

Molecular biologists use UCSC genome browser

modules during their original research tools such

"Genome Browser", "Gene Sorter", 'Blat", "Table

Browser", "VisiGene" and "Genome Graphs" all of

which allow the user to navigate, sort, blast,

visualize and analyzes genomic data for reliable

annotation.

Moreover, researchers can learn more about

the object (e.g., known genes, conservation, or

SNPs, etc.) via researching by simply position the

mouse over information line and click, then a new

web page will appear with important details and

information. The Page Index box usually includes

sequences, microarray data, mRNA secondary

structure, protein domain structure, homologues in

other species, gene ontology descriptions, mRNA

descriptions and pathways, etc. This wealth of

information is more than enough for a molecular

biologist as a start point for genomic research.

Colours language in UCSC genome browser

Colors have important meanings in UCSC genome

browser. For instance, the Black color in gene track

indicates a protein data bank (PDB) structure entry

for this genome fragment. Dark blue indicates

NCBI-reviewed sequence, while light blue

corresponds to provisional sequences. In addition,

SNP types are also color-coded. More information

about any specific color representation and

annotation or descriptive information can be

obtained by clicking the hyperlink of the track.

Advantages and disadvantages of UCSC

genome browser

Advantages

- UCSC Genome Browser is very easy to use and

free of charge online.

- UCSC uses the same interface and display for

each of the species listed.

- In addition, UCSC can run on (almost) any

computer that has access to internet and can

return the results online or by e-mail.

- The Genome Viewer page provides several

options to make changes

- Text search strategy can be used by typing in

gene name, gene symbol, or ID, etc.

- "Automatic Zoom" and "Recenter Action" are

handy features to automatically re-center the

image where you click


76

- The Custom Track hyperlink on the UCSC

home page allows the user to create custom

tracks of his data.

Limitations

- The number of available genomes are limited,

especially plant genomes.

- Different species have different annotation

tracks depending on the availability of data

assembly.

- "Automatic Zoom" can only zoom three folds.

- Not all the genes have the same levels of detail,

and not every species has all the information.

- BLAT allows to paste up to 25,000 bases,

10,000 amino acids, and up to a total of 25

sequences in the common FASTA

- Custom tracks are only persistent for 8 h and

needs to be re-done after 8 h if you have not

downloaded the file.

- The configuration options of the output format

offered by Protein Duster program are limited.

UCSC genome viewer tracks

The Genome Viewer section features have the

following tracks:

(1) Mapping and Sequencing Tracks;

(2) Phenotype and Disease Associations;

(3) Genes and Gene Prediction Tracks;

(4) mRNA and EST Tracks;

(5) Expression and Regulation;

(6) Comparative Genomics, Variation, and Repeats;

(7) ENCODE Regions and Genes;

(8) ENCODE Transcript Levels;

(9) ENCODE Chromatin Immunoprecipitation;

(10) ENCODE Chromosome, Chromatin, and DNA

Structure; and ENCODE Comparative.

Different Genome browsers online

UCSC genome browser (http://genome.ucsc.edu/)

Ensembl genome browser

(http://www.ensembl.org)

VISTA (http://genome.lbl.gov)

NCBI MapViewer

(http://www.ncbi.nlm.nih.gov/mapview/)

ECR Browser (http://ecrbrowser.dcode.org)

Combo

(http://www.broad.mit.edu/annotation/argo/)


Genomics and ENCODE Variation

UCSC Genome Browser website tools

TOOL NAME FUNCTION

Genome Browser

Gene Sorter

Zooms and scrolls over chromosomes, showing the work of annotators

worldwide

Shows expression, homology and other information on groups of genes

that can be related in many ways.

Blat Quickly maps your sequence to the genome.

Table Browser Provides convenient access to the underlying database

VisiGene

Lets you browse through a large collection of in situ mouse and frog

images to examine expression patterns

Genome Graphs Allows you to upload and display genome-wide data sets

77

Ahmed MANSOUR

Genetics Department,

Faculty of Agriculture,

Zagazig University, Egypt

(author for correspondence; amansour@zu.edu.eg)

Received: 01 September 2008; Accepted: 11 December 2009


78

UCSC: Genomik diziler için Genom Tarayıcısı

Yazarlar: David Haussler ve Jim Kent liderliğinde UCSC Genom Biyoenformatiği grubu,

Biyomoleküler Bilim ve Mühendislik Merkezi, Kaliforniya Üniversitesi

Lisans: Akademik, kişisel ve kar amacı gütmeyen durumlarda kullanımı ücretsizdir. Ticari

amaçla kullanımı için lisans gereklidir.

Bir bakışta Genom Tarayıcı

Genom tarayıcı bir genomik dizi ile alakalı tüm

bilgileri bir sayfada toplayan ve genomun herhangi

bir bölgesinin istenilen her ölçüde görsel bir dizayn

ile güvenilir ve hızlı bir şekilde görüntülenmesini

sağlayan bir araçtır. UCSC genom tarayıcısı

kaynağı, insan genomu ve diğer birçok organizma

genomu için resmi, referans veya taslak DNA

dizilerini içermektedir. Sayfada dizilere erişim

sağlayan araçların yanı sıra bu dizilere dair

genomik enformasyona ilave yapabilen birçok

özellik de vardır. Araştırmacılar bu sayfayı bilinen

gen dizilerine, tahmini gen dizilerine,

ekspresyonları ile ilgili bilgilere, türler arası

karşılaştırmalı bilgiye, tek nükleotid

polimorfizmlerine ve varyasyonlarına ve daha

birçok bilgiye erişmek amacıyla kullanabilirler.

UCSC ayrıca markör dizi aranmasına, belirli bir

bölge veya tüm genom hakkında açıklama elde

edilmesine olanak sağlayarak genom

araştırmalarında başlangıç noktası olarak işlev

görmektedir. ENCODE projesine de bağlantı

sağlamaktadır.

UCSC Genom Tarayıcının Araştırmalara

Katkısı

Moleküler biyologlar UCSC genom tarayıcı

modüllerini dizileri düzenlemeye, BLAST araması

yapmaya, görüntülemeye ve güvenilir bilgi için

genomik verilerin analiz edilmesine olanak

sağlayan ''Genome Browser'', ''Gene Sorter'',

''BLAT'', ''Table Browser'',''VisiGene'' ve ''Genome

Graphs'' gibi esas araştırma araçları ile beraber

kullanmaktadırlar. Buna ek olarak araştırmacılar,

araştırma konuları ile (örneğin; bilinen genler,

korunum, tek nükleotid polimorfizmleri vb) ilgili

ek bilgilere fare imlecinin ''information'' kutusunun

üzerine getirilip tıklanmasıyla açılan ve önemli

bilgi ve detayları barındıran yeni sayfa aracılığı ile

ulaşabilirler. Sayfa indeks kutusu genellikle dizileri,

mikroarray verilerini, ikincil mRNA yapısını,

protein yapılarını, diğer türlerle olan homolojileri,

gen ontolojisi ile ilgili açıklamaları ve araştırılan

gen ile alakalı yolakları içerir. Bu bilgi zenginliği,

genomik araştırmaya başlangıç noktası olarak bir

moleküler biyolog için fazlasıyla yeterlidir.

UCSC Genom Tarayıcıda Renklerin Dili

UCSC genom tarayıcıda renklerin önemli anlamları

vardır. Örneğin gen girdisindeki siyah renk, protein

bilgi bankasında (PDB) ilgili genom parçası için

protein yapısına dair bir girdi olduğunu belirtir.

Koyu mavi renk NCBI tarafından onaylanmış

dizileri belirtirken açık mavi doğruluğu

onaylanmamış dizileri belirtir. Tek nükleotid

polimorfizmi çeşitleri de renklerle kodlanmıştır.

Belirli bir renk koduna dair bilgi, girdinin üst

bağlantısına tıklanarak elde edilebilir.

UCSC Genom Tarayıcının Avantajları ve

Dezavantajları

Avantajları

- UCSC Genom Tarayıcıyı kullanmak kolay ve

bedavadır.

- Listelenen bütün türler için aynı arayüz ve

görünüm kullanılmaktadır.

- Ayrıca UCSC, internet erişimi olan neredeyse tüm

bilgisayarlarda çalıştırılabilir ve sonuçlar internet

üzerinden veya e-posta yoluyla elde

edilebilmektedir.

- ''Genome Viewer'' sayfası, değişiklik yapmak için

birçok olanak sağlamaktadır.

- Gen ismi, sembolü veya kodu girilerek metin

araması yapılabilmektedir.

- "Automatic Zoom" ve "Recenter Action" özellikleri

tıklanan noktada görüntüyü ortalamak için


oldukça kullanışlıdır.

- UCSC ana sayfasındaki ''Custom Track'' üst

bağlantısı kullanıcıya konu ilgili kendi kişisel

girdilerini oluşturma imkanı vermektedir.

Dezavantajlar

- Erişilebilir genomların özellikle de bitki

genomlarının sayısı oldukça sınırlıdır.

- O türe dair bilgilerin erişilebilirliğine bağlı olarak,

farklı türlere ilişkin farklı açıklama girdileri

bulumaktadır.

- "Automatic Zoom" özelliği görüntüyü yalnızca 3

kat yaklaştırabilmektedir.

- Her gen için aynı bilgi detayı ve her tür için bütün

bilgiler yoktur.

- ''BLAT'' 25000 baz, 10000 amino asit ve FASTA

formatında 25 sekansın yüklenmesine izin

verebilmektedir.

- Kişisel girdiler yalnızca sekiz saat için geçerlidir

ve dosya indirilmediği takdirde yeniden

oluşturulmaları gerekmektedir.

- ''Protein Duster'' yazılımı tarafından sunulan çıktı

formatlarının yapılandırma ayarları sınırlıdır.

UCSC Genom Görüntüleyici Girdileri

Genom Görüntüleyici bölümünde aşağıdaki girdi

79

kategorileri bulunmaktadır:

(1) Haritalama ve Dizileme Girdileri;

(2) Fenotip ve Hastalık İlişkileri;

(3) Genler ve Tahmini Gen Girdileri;

(4) mRNA ve EST girdileri;

(5) Ekspresyon ve Regülasyon;

(6) Karşılaştırmalı Genomik, Çeşitlilik ve

Tekrarlar;

(7) ENCODE Bölge ve Genleri;

(8) ENCODE Transkript Seviyeleri;

(9) ENCODE Kromatin İmmünoprespitasyon;

(10) ENCODE Kromozom, Kromatin ve DNA

yapısı; ve Karşılaştırmalı ENCODE

Çeşitli Genom Tarayıcıları

UCSC genome browser (http://genome.ucsc.edu/)

Ensembl genome browser

(http://www.ensembl.org)

VISTA (http://genome.lbl.gov)

NCBI MapViewer

(http://www.ncbi.nlm.nih.gov/mapview/)

ECR Browser (http://ecrbrowser.dcode.org)

Combo

(http://www.broad.mit.edu/annotation/argo/)


80

UCSC Genom Tarayıcı web sayfası araçları

ARAÇ İŞLEVİ

Genome Browser

Gene Sorter

Kromozom bölgelerini yakınlaştırmak, gezinmek, açıklamaları

görebilmek.

Çeşitli şekillerde ilişkilendirilebilecek gen gruplarına dair ekspresyon,

homoloji ve diğer bilgileri göstermek.

Blat Araştıılan diziyi genoma hızlı bir şekilde haritalamak.

Table Browser Temel veritabanına erişim sağlamak.

VisiGene

Ekspresyon kalıplarının incelenebilmesi için in situ fare ve kurbağa

görüntülerini taramak.

Genome Graphs Genom çapında verileri yüklemek ve görüntülemek.

Ahmed MANSOUR

Genetik Bölümü,

Ziraat Fakültesi,

Zagazig Üniversitesi, Mısır


Journal of Cell and Molecular Biology 7(2) & 8(1): 81-82, 2010 Software Review

Haliç University, Printed in Turkey.

http://jcmb.halic.edu.tr

Dotlet©: powerful and easy strategy for pairwise comparisons

Authors: Marco PAGNI & Thomas JUNIER, form the Swiss Institute of Bioinformatics in

Epalinges, Switzerland.

License: Freeware

Dotlet at a glance

For a molecular biologist, making dot plots are the

simplest means for comparing two sequences. This

is because dot or matrix plots provide an easy and

powerful means of sequence analysis (Junier and

Pagni, 2000). For instance, it is very useful in

searching out regions of similarity between two

sequences and repeats regions within a single

sequence. In this regard, Dotlet is one of the most

user-friendly dot-plot programs available over the

internet. Dotlet program is a very convenient tool

for making dot plots because of it is free of charge,

easy to use, doesn’t need any installation, and can

run on any computer that has access to internet.

Recently, it has been extensively used to build

pairwise comparisons in many peer-reviewed

scientific articles.

Dotlet history

The authors described the reason why they wrote

dotlet as they needed a diagonal plot tool during

their practical sessions in bioinformatics, in

December 1998, at the Institute of Biochemistry in

Switzerland. At that time, they needed a program

that would run in a web browser based on the

World-Wide Web. To my knowledge, this program

was the first dot plots software based on the

internet then.

Dotlet contribution to research

Many researchers in the field of Molecular biology

have used Dotlet modules in building Pairwise

Comparisons during their original research. With

many hundreds of citations, Dot let is widely cited

bioinformatic programs in biology. The freeware

license and its efficient modules beside its quick

ability to produce results make it one of the most

popular programs for making Pairwise

Comparisons nowadays.

Advantages and disadvantages of Dot plot

Advantages

- Dotlet is very easy to use and free of charge.

- Dotlet is an internet-based program that runs on

(almost) any computer that has access to the

internet.

- Dotlet is not a server but a Java applet which

means that everything Dotlet does, it does on

your own computer offline.

- Dotlet is safe to use because each sequence you

compare with Dotlet stays on your computer

- Dotlet can compare DNA, RNA and protein

sequences.

Disadvantages

- It needs some training and good experience to

interpret Dotlet results. In other words one must

learn how to fine-tune Dotlet to yield an

informative dot plot

- Dotlet cannot work with long sequences (more

than 10,000 amino acids or nucleotides).

- The speed of the program depends on your own

computer. The faster your computer, the faster

Dotlet runs. Differences become apparent with

sequences longer than 1.000 residues.

Software Design

- Dotlet is an open source freeware. It can

generate pairwise comparison for a given a

couple of sequences of proteins or DNA. It has

been built as a JAVA applet. The Dotlet source

code is available free of charge for academic

users.


82

The distribution is in

ftp://ftp.isrec.isb-sib.ch/pub/software/java/dotlet.

Limitations in use

Dotlet is an ideal pairwise comparisons tool for

sequences with lengths of less than 10,000 amino

acids or nucleotides. So, it can be helpful for most

proteins sequences but is restricted to small DNA

sequences.

Dotlet availability online

(IBM users): http://myhits.isb-sib.ch/cgi-bin/dotlet

(Mac users):

http://www.isrec.isb-sib.ch/java/dotlet/Dotlet.html

Other online dot plot programs

Dnadot

This program can use a range of 100,000 long

characters of either proteins or DNA sequences and

it has been designed using Java language. Dnadot is

available online on the following URL:

http://arbl.cvmbs.colostate.edu/molkit/dnadot/

http://www.vivo.colostate.edu/molkit/dnadot/

Dotter

This program can use as long as 100.000 characters

of either proteins or DNA sequences like Dnadot,

However, it is designed to use Unix, Linux and

Windows as a platform. It is available online on the

following URL:

http://www.cgr.ki.se/cgr/groups/sonnhammer/Dotte

r.html

Dottup

Although this program is also using the same range

of DNA as the previous program, it can also be

used for complete genomes. It also uses Unix and

Linux as a platform. It is available online as a

useful integrated module in emboss package.

URL: http://emboss.sourceforge.net/

References

Junier T. and Pagni M. (2000) Dotlet: diagonal

plots in a web browser. Bioinformatics.

16(2):178-9.

Ahmed MANSOUR

Genetics Department,

Faculty of Agriculture,

Zagazig University, Egypt

(author for correspondence; amansour@zu.edu.eg)

Received: 01 September 2008; Accepted: 11 December 2009


Dotlet©: İkili karşılaştırmalar için güçlü ve kolay strateji

Yazarlar: Marco PAGNI & Thomas JUNIER, the Swiss Institute of Bioinformatics,

Epalinges, Switzerland

Lisans: Ücretsiz

Kısa Bir Bakışla Dotlet

Bir moleküler biyolog için, iki diziyi eşleştirmenin

en basit yolu dot blot yapmaktır. Çünkü dot ya da

matriks blotlar dizi analizini kolay ve güçlü şekilde

sağlar. Örneğin, iki dizi arasındaki benzer

bölgelerin ve bir dizideki tekrarlayan bölgelerin

araştırılmasında çok kullanışlıdır. Bu bakımdan

Dotlet internet yoluyla ulaşılabilen dot-plot

programlarının en kullanıcı dostu olanıdır. Dotlet

programı ücretsiz ve kolay kullanımlı olduğu,

kuruluma ihtiyacı olmadığı ve internete girilebilen

her bilgisayarda çalışabildiği için dot plotları

yapmak için çok uygun bir araçtır. Son günlerde

çok sayıda benzer bilimsel makalede ikili

eşleştirmeleri yapmak için yaygın olarak

kullanılmaktadır.

Dotletin Tarihi

Yazarlar, dotlet programını yazmalarının sebebini

Aralık 1998’de İsviçre’deki Biyokimya

Enstitüsünde kendi biyoinformatik çalışmaları

sırasında diyagonal bir plota ihtiyaç duymaları

olarak açıkladılar. Bu arada world-wide web tabanlı

web tarayıcısında çalışabilen bir programa da

ihtiyaçları vardı. Bildiğim kadarıyla bu program o

zamanlarda internet tabanlı ilk dot plot yazılımıydı.

Dotletin Araştırmalara Katkısı

Moleküler biyolojinin bu sahasındaki çoğu

araştırmacı kendi orijinal araştırmaları süresince

ikili karşılaştırmaların yapılandırılmasında Dotlet

modüllerini kullanmıştır. Yapılan yüzlerce atıfla

Dotlet biyolojideki biyoinformatik programları

arasındaki yerini almıştır. Bu günlerde ücretsiz

yazılım lisansı ve onun etkili modülleri dışında

83

sonuç üretme yeteneğinin çabukluğu onu, ikili

karşılaştırmaları yapmak için en popüler program

haline getirmiştir.

Dot Plot’ın Avantajları ve Dezavantajları

Avantajları

‐ Dotlet’in kullanımı kolay ve ücretsizdir.

‐ Dotlet internet tabanlı bir program olup

internete

çalışabilir.

bağlanabilen her bilgisayarda

‐ Dotlet sunucu bir program değildir ama

bilgisayarınız kapalıyken Dotlet’in yapabildiği

her şeyi yapan bir Java uygulamasıdır.

‐ Dotlet’in kullanımı Dotlet ile karşılaştırdığınız

her dizi bilgisayarınızda kaldığı için güvenlidir.

‐ Dotlet DNA, RNA ve protein dizilerini

karşılaştırabilir.

Dezavantajları

‐ Dotlet sonuçlarını yorumlamak için biraz

alıştırma ve iyi bir deneyim gerekmektedir.

Başka bir deyişle, bilgi verici bir dot plot

sağlamak için Dotlet’e nasıl ince ayar

yapılacağı öğrenilmelidir.

‐ Dotlet uzun diziler (10,000 amino asit ya da

nükleotitten daha fazlası) ile çalışmayabilir.

‐ Programın hızı bilgisayarınıza bağlıdır.

Bilgisayarınız ne kadar hızlıysa dotlet o kadar

hızlı çalışır. 1000 rezidüden daha uzun diziler

ile belirgin farklılıklar oluşabilir.

Yazılım Dizaynı

Dotlet açık kaynaklı bedava bir yazılımdır. Verilen

bir çift protein ya da DNA dizisi için ikili

karşılaştırmalar üretebilir. Java uygula-macığı

olarak yapılandırılmaktadır. Dotlet kaynak kodu

akademik kullanıcılar için ücretsiz olarak

erişilebilir.


84

Dağıtım:

ftp://ftp.isrec.isb-sib.ch/pub/software/java/dotlet

Kullanım Sınırlamaları

Dotlet 10,000 amino asit ya da nükleotitten daha

kısa uzunluktaki diziler için ideal bir ikili

karşılaştırma aracıdır. Böylece çoğu protein dizileri

için yardımcı olabilir ama ufak DNA dizileri için

sınırlanmıştır.

Çevrimiçi Dotlet Erişilebilirliği

IBM users): http://myhits.isb-sib.ch/cgibin/dotlet

(Mac users): http://www.isrec.isbsib.ch/java/dotlet/Dotlet.html

Diğer Çevrimiçi Dot Plot Programları

Dnadot

Bu program protein ya da DNA dizilerinin 100,000

uzunluğundaki bir dizi karakterini kullanabilir ve

Java dilini kullanarak dizayn edilebilir. Dnadot’a

aşağıdaki URL ile çevrimiçi ulaşılabilir:

http://arbl.cvmbs.colostate.edu/molkit/dnadot/

http://www.vivo.colostate.edu/molkit/dnadot/

Dotter

Bu program da protein ya da DNA dizilerinin

100,000 uzunluğundaki bir dizi karakterini Dnadot

gibi kullanabilir. Bununla birlikte, platform olarak

Unix, Linux ve Windows kullanılarak dizayn

edilebilir. Aşağıdaki URL ile çevrimiçi erişilebilir:

http://www.cgr.ki.se/cgr/groups/sonnhammer/Dotte

r.html

Dottup

Bu program önceki program gibi DNA’nın aynı

aralığını kullanmasına rağmen tüm genom için de

kullanılabilir. Platform olarak Unix ve Linux

kullanabilir. “Emboss” paketinde kullanışlı

birleştirilmiş bir modül olarak çevrimiçi ulaşılabilir.

URL: http://emboss.sourceforge.net/

Kaynaklar

Junier T. ve Pagni M. (2000) Dotlet: web

tarayıcısındaki diyagonal plotlar. Biyoinformatik.

16(2):178-9.

Ahmed MANSOUR

Genetik Bölümü,

Ziraat Fakültesi,

Zagazig Üniversitesi, Mısır


Journal of Cell and Molecular Biology - GUIDELINES for AUTHORS

(Revised: May 17, 2010)

General

Journal of Cell and Molecular Biology

(JCellMolBiol) is an international journal which

covers original works in the field of cell biology,

molecular biology, genetics, microbiology,

neurobiology, bioinforma-tics and related topics.

The official language of the journal is English,

but manuscripts in Turkish are accepted as well.

Conditions for publication

This journal publishes research articles, review

articles, short communications, book/software

reviews, case reports and letters to the editor.

Research articles: Only original contributions will

be accepted which have not been published

previously. Manuscripts should not exceed 15

papers of printed text, including tables, figures and

references

Review articles: Reviews of recent developments in

a research field and ideas will be accepted.

Manuscripts should not exceed 15 papers of printed

text. Illustrations are encouraged.

Short communications: These include small-scale

investigations or innovative methods, techniques,

clinical trials and epidemiological studies. It should

not exceed 3 pages.

Letters to editor: These include opinions, news and

suggestions. Letters should not exceed 2 papers of

printed text.

Case Reports: These include individual

observations based on small numbers of subjects.

This type of research cannot indicate causality but

may indicate areas for further research.

REVISED

May 17, 2010

Manuscripts should be submitted on a CD or by email

to:

Journal of Cell and Molecular Biology

Haliç University

Faculty of Arts and Sciences,

Department of Molecular Biology and Genetics

Kaptan Paşa Mah. Darülaceze Cad. No: 14

Okmeydanı-Şişli 34384, İstanbul-TÜRKİYE

Tel: +90 212 220 96 96 Ext. 155

E-Mail: jcmb@halic.edu.tr

Book/software reviews: Short but concise

description of the book/software, not exceeding a

page. Book/software reviews are not peer reviewed.

Presentation

Papers should be typed clearly, double-spaced with

3 cm wide margins.

Manuscripts should be prepared using Word

Processor.

Cover Letter: You may briefly explain your work

and its contribution to present knowledge.

Title Page: The first page of your manuscript

should be a title page containing the type of paper;

the title; all authors' full names, and affiliations;

and the corresponding author's contact address

(including phone and fax numbers) and e-mail

address. The title should be as short as possible, but

should give adequate information regarding the

contents. Authors should also state a running title

of no more than 50 characters including spaces.

All pages must be numbered.

Full Paper

The full paper should be divided into the following

parts in the order indicated:

85


86

Abstract: A brief, informative abstract, not

exceeding 200 words, should be provided in

English and in Turkish. For authors who are not

native Turkish speakers, JCellMolBiol can provide

the Turkish abstract.

Keywords: Immediately following the abstract,

authors should provide 5 keywords or phrases that

reflect the content of the article.

Introduction should include theory, hypotheses,

prior work

Material and methods may include subheadings

Results: If the study consists of different parts,

subheadings in this section should be consistent

with subheadings in the methods.

Discussion

Acknowledgements should precede the list of

references

References: Papers cited in the manuscript should

be listed in alphabetical order according to the first

author's surname.

Tables and Figures

Tables and figures should be embedded within

the text in their appropriate positions.

Each table should be accompanied by a short

instructive title line plus an explanatory caption at

the top. Indicate footnotes within tables by

superscript letters and type footnotes below the

table.

Electronically submitted figures are preferred

in *.jpg or *.tiff (min. 300 dpi) formats. Each figure

should be supplied with a short instructive title line.

Do not give magnification on scales in the figure

titles; instead draw bar scales directly on the

figures.

All the tables and figures must be referred to

within the text.

Units, Abbreviations and Scientific Names

Only SI units should be used. Current

abbreviations can be used without explanation,

others must be explained.

All acronyms/abbreviations must be explained

in parenthesis after their first occurrence. If many

unfamiliar acronyms/abbreviations are used, please

REVISED

May 17, 2010

compile them in an "Abbreviations" section at the

end of the paper.

Latin expressions should be underlined or typed

in italics.

Referencing

Citation in the text should take the form: (Smith

and Robinson,1990).

If several papers are cited by the same author in

the same year, they should be lettered in sequence

(1990a), (1990b), etc. When papers are by more

then three authors they should be cited as (Smith et

al.,1990).

In the list, references must be placed in

alphabetical order. The following models for the

reference list cover all situations. The punctuation

given must be exactly followed.

Redford IR. Evidence for a general relationship

between the induced level of DNA double

strand breakage and cell killing after Xirradiation

of mammalian cells. Int J Radiat

Biol. 49: 611- 620, 1986.

Tccioli CE, Cottlieb TM and Blund T. Product of

the XRCCS gene and its role in DNA repair and

V(D)J recombination. Science. 265: 1442-1445,

1994

Ohlrogge JB. Biochemistry of plant acyl carrier

proteins. The Biochemistry of Plants: A

Comprehensive Treatise. Stumpf PK and Conn

EE (Ed). Academic Press, New York. 137-157,

1987.

Weaver RF. Molecular Biology. WCB/Mc Graw-

Hill.1999.

Brown LA. How to cope with your supervisor. PhD

Thesis. University of New Orleans, 2005.

Web document with no author: Leafy seadragons

and weedy seadragons 2001. retrieved

November 13, 2002, from http:// www.

windspeed.net.au/jenny/seadragons/

Web document with author: Dawson J, Smith L and

Deubert K. Referencing, not plagiarism.

Retrieved October 31, 2002 from http:

//studytrekk.lis.curtin.edu.au/

Only papers published or in press should be

cited in the literature list. Unpublished results,

including submitted manuscripts and those in

preparation, should be indicated as unpublished

data in the text.


Submission Policies and Authorship

Upon submission of a manuscript, it is accepted

that all co-authors have approved the contents of

the manuscript and its submission by the

corresponding author, and that the corresponding

author is authorized to represent all co-authors in

pre-publication discussions with JCellMolBiol.

The corresponding author is responsible for

ensuring that all the contributors to the relevant

work are listed as authors and that all authors have

aggreed to the manuscript’s content and its

submission to the JCellMolBiol. In case the Journal

happens to be aware of an authorship dispute,

authorship must be approved in writing by all of the

parties.

Cost

There are no submission fees or page charges.

Criteria for the Selection of Manuscripts

Manuscripts should meet the following criteria: the

study conducted is material is original and ethical,

the writing is clear; the study methods are

appropriate, the data are valid, the conclusions are

reasonable and supported by the data; the

information is important; and the topic is

interesting to our readership.

Editorial Processes

Researchers may request informal feedback from

the editors in a particular manuscript. The

presubmission process aids in the submission

decision for authors

When JCellMolBiol receives a manuscript, the

Editor and Associate Editor will first decide

whether the manuscript meets the formal criteria

specified with “Guidelines for Authors” and

whether it fits within the scope of the Journal. In

case of doubt on the basis of initial review, the

editor will consult other members of the Editorial

Board.

Manuscripts that are found suitable for peer

review will be assigned to two expert reviewers.

Reviewers may either be Editorial Board members

or external experts selected by the Editorial Board.

The corresponding author is notified by e-mail

when the editor decides to send a paper for review.

The reviewers will have up to three weeks to

review the submitted article. After peer review, the

REVISED

May 17, 2010

editor will contact the author. If the author is

required to submit a revised version, the revised

version has to be submitted by the author within

two weeks. Otherwise, the manuscript will be

removed from the manuscript submission queue

and will be considered rejected.

In cases where the referees have requested welldefined

changes to the manuscript, editors may

request a revised manuscript that addresses to

referees’ concerns. The revised version is sent back

to the original referees for re-review. In cases

where the referees’ concerns are more wideranging,

editors may reject the manuscript. The

revised manuscript should be accompanied by a

cover letter that includes a point-by-point response

to referees’ comments and an explanation of how

the manuscript has been changed.

As a matter of policy, we do not suppress

referees’ reports, any comments directed to authors

are transmitted regardless of what we may think of

the content. On rare occasions, we may edit a report

to remove offensive language or comments to

reveal confidentiality.

The final decision to accept or reject a

manuscript will be made by the Editor. If it

becomes apparent that there are serious problems

with the scientific content or with violations of our

publishing policies, the Editor also reserves the

right to reject a paper even after it has been

accepted

After acceptance, the Editor may make further

changes to the text and figures so that the

manuscript is readable and clear. Page proofs will

be sent to the corresponding author via email for

checking before publication. Corresponding authors

are sent proofs and are welcome to discuss

proposed changes with the Editor, but

JCellMolBiol reserves the right to make the final

decision about the style. Corrected proofs should be

sent back to the Editor within three days of receipt,

otherwise the Editor reserves the rights to correct

the proofs himself and to send the material for

publication.

Appeals

Authors have the right to ask the Editor to

reconsider a rejection decision, which is considered

an appeal. Decisions are reversed only if the Editor

is convinced that the original decision was a serious

mistake. If an appeal merits further consideration,

the Editor may send the author’s response or the

revised paper to one or more referees, or Editor

87


88

may ask one referee to comment on the concerns

raised by another referee.

Advance Online Publication

JCellMolBiol provides Advance Online Publication

of articles, which benefit authors with an earlier

publication date and allows the readers’ access to

accepted papers several weeks before they appear

in print

Ethical Issues

For manuscripts reporting experiments on live

vertebrates or higher invertebrates, authors must

declare that the study was approved by the

institutional ethics committee. Papers describing

investigations on human subjects must include a

statement that informed consent was obtained from

all subjects.

Plagiarism

If portions of the manuscript have already been

published by the author on other journals or

websites, JCellMolBiol Editorial Board needs to

know which portions of the manuscript have been

previously published and where. The author should

include a note in the cover letter indicating which

portions have been published elsewhere.

In case of any suspicion on scientific misconduct or

dishonesty in research, JCellMolBiol reserves the

right to forward any submitted manuscript to an

appropriate authori-ty for investigation.

Copyright Notice

It is the responsibility of the submitting author to

ensure that the authorship of the paper reflects the

contributions of the authors to the work described,

and that all listed authors have agreed to the

submission of the manuscript in its current form.

Conditions of publication in JCellMolBiol are

that the paper has not already been published

elsewhere; that it is not currently being considered

for publication else-where; all persons designated

as authors should qualify for authorship, and all

those who qualify should be listed. If accepted,

Haliç University and JCellMolBiol have the

exclusive license to publish.

JCellMolBiol is freely available to individuals

and institutions. Copies of this Journal and articles

in this journal may be distributed for research or for

REVISED

May 17, 2010

educational purposes free of charge. However,

commercial use of articles contained herein is

prohibited without the written consent of the editor.

Publication Agreement

The corresponing author is required to assign the

Publication Agreement Form in order to publish the

submitted manuscript in JCellMolBiol.


Journal of Cell and

Review Article

Molecular Biology

DNA repetitive sequences-types, distribution and function: A review

S.R. RAO, S. TREVEDI, D. EMMANUEL, K. MERITA and M. HYNNIEWTA

Research Articles

Genetic diversity of Penicillium species isolated from various sources in Sarawak, Malaysia

H.A. ROSLAN, C.S. NGO and S. MUID

The sensitivity of the human chromosomes to ethyl methanesulfonate (EMS)

S. BUDAK-DİLER and M. TOPAKTAŞ

Protective effect of pomegranate peel ethanol extract against ferric nitrilotriacetate

induced renal oxidative damage in rats

M.M. AHMED and S.E. ALI

Molecular and cytogenetic evaluation of Y chromosome in spontaneous abortion cases

G. KOÇ, K. ULUCAN, D. KIRAÇ, D. ERGEÇ, T. TARCAN and A.İ. GÜNEY

Do simple sequence repeats in replication, repair and recombination genes of mycoplasmas

provide genetic variability?

S. TRIVEDI

Software Reviews

Tcoffee ©: Multipurpose sequence alignments program

A. Mansour

UCSC: Genome Browser for genomic sequences

A. Mansour

Dotlet©: powerful and easy strategy for pairwise comparisons

A. Mansour

Instructions for authors

see page 1

see page 13

see page 25

see page 35

see page 45

see page 53

see page 71

see page 75

see page 81

see page 85

More magazines by this user
Similar magazines