Full Journal - Journal of Cell and Molecular Biology - Haliç Üniversitesi

jcmb.halic.edu.tr

Full Journal - Journal of Cell and Molecular Biology - Haliç Üniversitesi

‹STANBUL

1998

VOLUME 4 • NO. 1 • 2005 • ISSN 1303-3646

HAL‹Ç UNIVERSITY

FACULTY OF ARTS AND SCIENCES

Journal of Cell and

Molecular Biology


Haliç University

Faculty of Arts and Sciences

Journal of Cell and Molecular Biology

Founder

Prof. Dr. Gündüz GED‹KO⁄LU

President of Board of Trustee

Owner

Prof. Dr. Ahmet ÇAKIR

Rector

Correspondence Address:

The Editorial Office

Journal of Cell and Molecular Biology

Haliç Üniversitesi, Fen-Edebiyat Fakültesi,

Ahmet Vefik Pafla Cad., No: 1, 34280, F›nd›kzade,

‹stanbul-Turkey

Phone: 90 212 530 50 24

Fax: 90 212 530 35 35

E-mail: jcmb@halic.edu.tr

Journal of Cell and Molecular Biology is

indexed in EBSCO database.

Summaries of all articles in this journal are

available free of charge from www.halic.edu.tr

ISSN 1303-3646

Printed at Yaflar Printing House

Igor ALEXANDROV, Dubna, Russia

Çetin ALGÜNEfi, Edirne, Turkey

Aglaia ATHANASSIADOU, Patras, Greece

fiehnaz BOLKENT, ‹stanbul, Turkey

Nihat BOZCUK, Ankara, Turkey

‹smail ÇAKMAK, ‹stanbul, Turkey

Adile ÇEV‹KBAfi, ‹stanbul, Turkey

Beyaz›t ÇIRAKO⁄LU, ‹stanbul, Turkey

Ayfl›n ÇOTUK, ‹stanbul, Turkey

Fevzi DALDAL, Pennsylvania, USA

Zihni DEM‹RBA⁄, Trabzon, Turkey

Mustafa DJAMGOZ, London, UK

Aglika EDREVA, Sofia, Bulgaria

Ünal EGEL‹, Bursa, Turkey

Erbil ERGENEKON, ‹stanbul, Turkey

Advisory Board

Journal of Cell and

Molecular Biology

Published by Haliç University

Faculty of Arts and Sciences

Editor

Atilla ÖZALPAN

Associate Editor

Narç›n PALAVAN ÜNSAL

Editorial Board

Çimen ATAK

Atok OLGUN

P›nar ÖZKAN

Nihal BÜYÜKUSLU

Nefle AKIfi

Kürflat ÖZD‹LL‹

Damla BÜYÜKTUNÇER

Özge EM‹RO⁄LU

Mehmet Ali TÜFEKÇ‹

Merve ALO⁄LU

Asl› BAfiAR

Secretary

Burçin SARGIN

Aynur GÜREL, ‹zmir, Turkey

Candan JOHANSEN, ‹stanbul, Turkey

As›m KADIO⁄LU, Trabzon, Turkey

Maria V. KALEVITCH, Pennsylvania, USA

Valentine KEFEL‹, Pennsylvania, USA

Michael P. MADAIO, Pennsylvania, USA

Göksel OLGUN, Edirne, Turkey

U¤ur ÖZBEK, ‹stanbul, Turkey

Zekiye SULUDERE, Ankara, Turkey

‹smail TÜRKAN, ‹zmir, Turkey

Mehmet TOPAKTAfi, Adana, Turkey

Meral ÜNAL, ‹stanbul, Turkey

Mustafa YAT‹N, Boston, USA

Ziya Z‹YLAN, ‹stanbul, Turkey


Journal of Cell and

Molecular Biology

Volume 4/2005

Haliç University

Faculty of Arts and Sciences

‹stanbul-TURKEY


Haliç University

Faculty of Arts and Sciences

Journal of Cell and Molecular Biology

Founder

Prof. Dr. Gündüz GED‹KO⁄LU

President of Board of Trustee

Owner

Prof. Dr. Ahmet ÇAKIR

Rector

Correspondence Address:

The Editorial Office

Journal of Cell and Molecular Biology

Haliç Üniversitesi, Fen-Edebiyat Fakültesi,

Ahmet Vefik Pafla Cad., No: 1, 34280, F›nd›kzade,

‹stanbul-Turkey

Phone: 90 212 530 50 24

Fax: 90 212 530 35 35

E-mail: jcmb@halic.edu.tr

Journal of Cell and Molecular Biology is

indexed in EBSCO database.

Summaries of all articles in this journal are

available free of charge from www.halic.edu.tr

ISSN 1303-3646

Printed at Yaflar Printing House

Igor ALEXANDROV, Dubna, Russia

Çetin ALGÜNEfi, Edirne, Turkey

Aglaia ATHANASSIADOU, Patras, Greece

fiehnaz BOLKENT, ‹stanbul, Turkey

Nihat BOZCUK, Ankara, Turkey

‹smail ÇAKMAK, ‹stanbul, Turkey

Adile ÇEV‹KBAfi, ‹stanbul, Turkey

Beyaz›t ÇIRAKO⁄LU, ‹stanbul, Turkey

Ayfl›n ÇOTUK, ‹stanbul, Turkey

Fevzi DALDAL, Pennsylvania, USA

Zihni DEM‹RBA⁄, Trabzon, Turkey

Mustafa DJAMGOZ, London, UK

Aglika EDREVA, Sofia, Bulgaria

Ünal EGEL‹, Bursa, Turkey

Erbil ERGENEKON, ‹stanbul, Turkey

Advisory Board

Journal of Cell and

Molecular Biology

Published by Haliç University

Faculty of Arts and Sciences

Editor

Atilla ÖZALPAN

Associate Editor

Narç›n PALAVAN ÜNSAL

Editorial Board

Çimen ATAK

Atok OLGUN

P›nar ÖZKAN

Nihal BÜYÜKUSLU

Nefle AKIfi

Kürflat ÖZD‹LL‹

Damla BÜYÜKTUNÇER

Özge EM‹RO⁄LU

Mehmet Ali TÜFEKÇ‹

Merve ALO⁄LU

Asl› BAfiAR

Secretary

Burçin SARGIN

Aynur GÜREL, ‹zmir, Turkey

Candan JOHANSEN, ‹stanbul, Turkey

As›m KADIO⁄LU, Trabzon, Turkey

Maria V. KALEVITCH, Pennsylvania, USA

Valentine KEFEL‹, Pennsylvania, USA

Michael P. MADAIO, Pennsylvania, USA

Göksel OLGUN, Edirne, Turkey

U¤ur ÖZBEK, ‹stanbul, Turkey

Zekiye SULUDERE, Ankara, Turkey

‹smail TÜRKAN, ‹zmir, Turkey

Mehmet TOPAKTAfi, Adana, Turkey

Meral ÜNAL, ‹stanbul, Turkey

Mustafa YAT‹N, Boston, USA

Ziya Z‹YLAN, ‹stanbul, Turkey


Journal of Cell and Molecular Biology

CONTENTS Volume 4, No.1, 2005

Review articles

The biochemical fundamentals of angiotensin converting enzyme (ACE) gene

polymorphism in myocardial infarction

Miyokard infarktüsünde angiotensin dönüfltürücü enzim (ADE) gen

polimorfizminin biyokimyasal temelleri

F. E. Kayhan, C. Sesal 1-8

P rogrammend cell death in plants

Bitkilerde programlanm›fl hücre ölümü

N. Palavan-Ünsal, E. D. Büyüktuncer, M. A. Tüfekçi 9-23

Research papers

Effects of captopril, an angiotensin converting enzyme inhibitor on

TAME-ebterase induced contractions in rat aorta strips iinn vviittrroo

In vitro koflullarda s›çan aort striplerinde angiotensini dönüfltüren enzim inhibitörü

kaptoprilin, TAME-esterazin uyard›¤› kas›lmalara etkileri

A. H. Subratty, F. B. H. Gunny 25-29

Metabolic changes and protein patterns associated with adaptation to

salinity in SSeessaammuumm iinnddiiccuumm culvitars

Sesamum indicum kültürlerinde tuzlulu¤a adaptasyonla iliflkili protein profilleri

ve metabolik de¤iflmeler

H. S. Gehlot, A. Purohit, N. S. Shekhawat 31-39

Cytogenetic effect of heavy-metal and cyanide in contaminated waters

from the region of southwest Bulgaria

Bulgaristan’›n güneybat› bölgesindeki kontamine sularda a¤›r metal

ve siyanürün sitogenetik etkileri

T. A. Staykova, E. N. Ivanova, I. G. Velcheva 41-46

Effects of epirubicin and daunorubicin on cell profileration and

cell death in HeLa cells

Epirubisin ve daunorubisinin hücre ço¤almas› ve hücre ölümü üzerine

etkilerinin HeLa hücrelerinde araflt›r›lmas›

G. Ö. Ar›can, N. N. Soy 47-52

Effect of MMP-1 polymorphism on early term osseointegrated dental

implant failure: A pilot study

MMP-1 polimorfizminin erken dönem osseointegre implant baflar›s›zl›¤›na

etkisi: Pilot çal›flma

V. Ar›san, C. Karabuda, T. Özdemir 53-58

Instructions for authors 59-60


Journal of Cell and Molecular Biology 4: 1-8, 2005.

Haliç University, Printed in Turkey.

The biochemical fundamentals of angiotensin converting enzyme

(ACE) gene polymorphism in myocardial infarction

Figen Esin Kayhan 1 * and Cenk Sesal 1

1 Marmara University, Faculty of Arts and Sciences, Department of Biology, Göztepe 81040,

‹stanbul-Turkey (* author for correspondence)

Abstract

Myocardial Infarction (MI) is the most important reason of mortality and morbidity in developed countries. It is

detected that about half of the deaths, no matter what reason is, in the USA is sourced from MI. In recent years, a lot

of scientific studies have increased on some genetic risk factors responsible from the formation of MI. One of the

most popular of these is searching for the relations between the I/D polymorphism in the ACE gene and MI. In this

study, it is assumed that ACE I/D gene polymorphism is a useful indicator in the detection of the risk of

cardiovascular disease, the better control of the people in high risk group and the optimal cure to start at an earlier

stage. By the help of these studies the risk factors of genetic origin, using the genetic indicators and new risk factors,

and supporting the information by some easily performed biochemical experiments would supply great easiness in

diagnosis and cure and save life.

KKeeyy wwoorrddss:: Angiotensin converting enzyme, ACE gene polymorphism, renin-angiotensin system, myokard

infarction

Miyokard infarktüsünde angiotensin dönüfltürücü enzim (ADE) gen polimorfizminin

biyokimyasal temelleri

Özet

Geliflmifl ülkelerde en baflta gelen morbidite ve mortalite nedeni miyokard infarktüsü ve koroner arter hastal›klar›d›r.

Miyokard infarktüsü ABD’de ve di¤er birçok geliflmifl ülkede tüm nedenlere ba¤l› ölümlerin yaklafl›k yar›s›ndan

sorumludur. Son zamanlarda miyokard infarktüsü oluflumundan sorumlu olabilecek baz› genetik risk faktörleri

üzerinde çal›flmalar artm›flt›r. Bunlar›n aras›nda en popüler olanlar›ndan biri Angiotensin Dönüfltürücü Enzim (ADE)

genindeki I/D polimorfizmi ve miyokard infarktüsünün iliflkisini araflt›ran çal›flmalard›r. Miyokard infarktüsü ve

koroner arter hastal›klar›na yol açan genetik belirteçlerin saptanmas›, bu hastal›klar› önleme ve tedavi çal›flmalar›nda

kolayl›k sa¤layabilecektir. Bu genetik belirteçlerin önceden saptanmas› durumunda klinik belirtiler ve

kardiyovasküler komplikasyonlar ortaya ç›kmadan yüksek risk grubundaki kifliler belirlenebilecekler ve uygun

tedavi için takibe al›nabileceklerdir. Tüm bu çal›flmalar ADE gen polimorfizminin kardiyovasküler riskin

tahmininde, yüksek risk gruplar›ndaki hastalara erken ve etkili tedavinin planlanmas› ve önceden belirlenmesinde

›fl›k tutabilece¤i düflüncesinden hareketle sürdürülmektedir.

AAnnaahhttaarr ssöözzccüükklleerr:: Angiotensin dönüfltürücü enzim, ADE gen polimorfizmi, renin-angiotensin sistemi,

miyokard infarktüsü

1


2 Figen Esin Kayhan and Cenk Sesal

The biochemical fundamentals of angiotensin

converting enzyme (ACE) gene polymorphism in

Myocard Infarction (MI)

Cardiovascular diseases especially Myocard

Infarction (MI) is the main cause of death in

developed countries and their relation with certain risk

factors like hypertension, cigarette smoking, obesity,

male gender, hyperlipidemia and diabetes mellitus is

well known. Its prevalence varies among different

populations, epidemiological and familial studies have

shown genetic and environmental factors cooperating

in the pathogenesis of cardiovascular diseases.

MI is a multifactorial disease, influenced by

environmental and genetic factors (Ortega et al.,

2002). These factors differ in each population.

Angiotensin Converting Enzyme (ACE) has an

important impact on cardiovascular structure and

function. ACE has a key role in the production of

angiotensin-II and in the catabolism bradykinin, two

peptides involved in the modulation of vascular tone

and in the proliferation of smooth muscle cells.

Thus the ACE gene is a logical etiological candidate

for MI. Several studies have suggested that the genes

encoding components of the Renin-Angiotensin

System (RAS) are candidate genes for cardiovascular

disease and recently genetic polymorphisms of the

RAS have been associated with cardiovascular

diseases (Cambien et al.,1992; Jeunemaitre et al.,

1997; Fatini et al., 2000).

Renin-Angiotensin System (RAS)

The Renin-Angiotensin System (RAS) plays a key

role in regulation of arterial blood pressure and blood

volume in normal individuals. RAS is one of the major

regulators of blood pressure and fluid and electrolyte

homeostasis. This is mediated through its constrictive

actions on vascular smooth muscle and by its

influence on aldosterone secretion from the adrenal

cortex, electrolyte transport in kidney tubules and on

thirst as well as sodium appetite in the brain (Peach et

al., 1977; Reid et al., 1978).

Angiotensinogen, renin, angiotensin converting

enzyme (ACE), angiotensin-II and angiotensin-II

receptors are primary components of reninangiotensin

system. Genetic variants have been

identified in several components of the RAS. The

reported association of insertion/deletion

polymorphism of the angiotensin converting enzyme

gene with MI and coronary artery disease has thus

generated continuing interest (Arbustini et al., 1995;

Bohn et al., 1993; Cambien et al., 1992; Dzau et al.,

1988; Friedl et al., 1995; Mattu et al.,1995).

Polymorphic markers in angiotensinogen and

angiotensin converting enzyme genes have been found

to be associated with risk for MI. One of the

polymorphisms is associated with risk for MI

especially in subjects carrying the D allele of the ACE

gene. Various studies considered four different

genotypes:

1- The ACE insertion/deletion (I/D) polymorphim

involving a 287-base pair (bp) Alu repeat

sequence in intron 16 of the ACE gene

2- The methionine _ threonine variant at position

235 (M235T) in exon 2 of the AGT gene

3- The threonine _ methionine variant at position

174 (T174M) in exon 2 of the AGT gene and an

A1166 _ C transversion in the 3’ untranslated

region of the AT1R gene (Ganong et al., 1995;

Tiret et al., 1994).

The ACE gene contains a polymorphism based on

the presence (insertion [I]) or absence (deletion [D])

within an intron of a 287-bp nonsense DNA domain,

resulting in three genotypes (DD and II homozygotes,

and ID heterozygotes (Lindhpainther et al., 1995).

The association between the ACE DD genotype and

myocardial infarction, which was first described by

Cambien and colleagues in the European subjects of

the ECTIM study, has been confirmed in several

populations of North American, Japanese, Italian, and

Austrilian descent (Arbustini et al., 1995; Arca et al.,

1998; Cambien et al., 1992; Ludwig et al., 1995).

However several different studies did not show this

association in populations from Austria, Finland,

North America, Denmark, Japan, and New Zealand

and a recent meta-analysis has indicated that besides

ethnic difference and posible selection bias in most of

these studies, a degree of bias towards positive results,

at least in the smaller studies, seems likely (Arca et

al., 1998; Agerholm-Larsen et al., 1997; Friedl et al.,

1995; Katsuya et al., 1995; Lindpainther et al., 1993;

Miettinen et al., 1999; Samani et al., 1996).


Renin

Molecular biological and biochemical measurements

have opened a new era in our understanding of this

important hormonal system ( Murphy et al., 1991;

Sasaki et al., 1991). The main source of rennin is the

juxtaglomerular cells of the afferent arterioles of the

kidney. Rennin is a glycoproteolytic enzyme that is

responsible for the first step in the formation of

angiotensin-II. In contrast the other proteases of this

class, rennin is highly specific for its substrate,

angiotensinogen, and is most active at neutral pH.

Rennin is a single chain aspartyl protease of

molecular weight 37-40 kd and pI 5.2-5.8. Renin’s

primary structure contains double domains; that is, the

amino- and carboxyl- termini contain areas of similar

sequence, forming a two-lobed structure surrounding

the active site. This catalytic region contains two

critical aspartic acid residues, one contributed by each

half of the molecule (Blundell et al., 1983; Dzau and

Pratt et al., 1986; Gomez et al., 1990). The human

renin gene has shown that is encoded by a 12.5

kilobase (kb) DNA sequence at genomic analysis

(Bockxmeer et al., 2000; Caldwell et al., 1976).

Angiotensinogen molecule, in turn, is converted to

angiotensin-II by angiotensin converting enzyme.

Angiotensin-II then binds to its receptor to mediate

many different cellular effects (Canavy et al., 2000;

Philips et al.,1993; Tahmasebi et al., 1999).

Angiotensinogen (Agt)

Angiotensinogen is the major substrate for rennin.

Angiotensinogen is the ultimate precursor of

angiotensin-II. Structurally, it is a globular

glycoprotein of molecular weight 55-65 kd and pI 4.3-

4.9, depending on the degree of glycosylation

(Hansson et al., 1999; Leung and Carlsson, 2001). The

average carbohydrate content is 13-14%. The majority

of the circulating angiotensinogen most likely derives

from the liver, in particular, the pericentral zone of the

liver lobules (Clauser et al., 1989; Doolittle, 1983;

Morris et al., 1979). Analysis of human genomic DNA

indicates that there is a single gene for

angiotensinogen. The gene is composed of five exons

and four introns and encompasses approximately 13

kb of genomic sequence (Clauser et al., 1989; Morris

et al., 1979).

The biochemical fundamentals of angiotensin 3

Angiotensin Converting Enzyme (ACE)

ACE is a dipeptidiyl carboxypeptidase that converts

angiotensin-I to the potent vasoconstrictor

angiotensin-II and inactivates the vasodilator

bradykinin. ACE has a key component within the

RAS, where it hydrolyzes angiotensin-I to generate

angiotensin-II (vasoconstrictor) and the kallikreinkinin

system, where it inactivates bradykinin

(vasodilator). ACE has been extensively characterized

and purified from several sources, including serum,

lung, seminal fluid, and plasma. The molecular weight

ranges from 140-160 kd for the endothelial

angiotensin converting enzyme to 90-100 kd for the

testicular form, depending on the carbohydrate content

of the molecule (Aldermann et al., 1991; Erdos et al.,

1990; Packer et al., 1992; Peach et al., 1977). ACE

appears to influence the cardiovascular system at

many sites and in multiple ways (Erdos et al., 1990;

Dzau et al., 1994). ACE has an important impact on

cardiovascular structure and function. Among other

actions, it catalyzes the conversion of angiotensin-I to

angiotensin-II and the breakdown of bradykinin to

kinin degradation products. Both angiotensin-II and

bradykinin are powerful vasoactive molecules on the

cardiovascular system. Therefore, with its pivotal role

in two important cardiovascular hormonal regulatory

systems, the renin-angiotensin system and the

kallikrein-kinin system (Ehlers and Riordan, 1990;

Erdos, 1990). The angiotensin converting enzyme

(ACE) is an important part of the renin-angiotensin

system. It acts upon the decapeptide angiotensin-I

converting it into the octapeptide angiotensin-II, a

potent vasoconstrictor. It also inactivates the

vasodilator bradykinin. Both angiotensin-II and

bradykinin can influence proliferation of smooth

muscle cells. ACE catalyzes the conversion of

angiotensin-I to angiotensin-II and the breakdown of

bradykinin to kinin degradation products.

Angiotensin-II and bradykinin are powerful

vasoactive molecules with multiple acute and chronic

effects on the cardiovascular system (Bunning and

Riordan, 1987; Das et al., 1977; Ehlers and Riordan,

1983; Oparil, 1983; Soubrier and Corvol, 1990). For

these reasons, the human ACE gene has been a

preferred target in unraveling the molecular

architecture of cardiovascular diseases. Angiotensin

converting enzyme is unusual in that 26-30% of its dry

weight is carbohydrate, in the form of fructose,


4 Figen Esin Kayhan and Cenk Sesal

mannose, galactose, N-asetil –glucosamine, and sialic

acid (Das et al., 1977). Angiotensin converting

enzyme also is a member of the family of zinc

metallopeptidases and contains a molar equivalent of

zinc that functions is the hydrolytic step of the

catalytic reactions (Bunning et al., 1983; Das et al.,

1977; Ehlers and Riordan, 1983). Angiotensin

converting enzyme is a key component within the

RAS and ACE is a dipeptidyl carboxipeptidase that

converts angiotensin-I to the potent vasoconstrictor

angiotensin-II and inactivites the vasodilator

bradykinin (Lindpainther et al., 1995; Mattu et al.,

1995). ACE gene is polymorphic (Cambien et al.,

1992). The ACE gene has been mapped to

chromosome 17q23, and an insertion/deletion (I/D)

polymorphism, involving a 287 base-pair alu repeat

sequence, has been located to intron 16. (Cambien et

al., 1992; Rigat et al., 1990; Samani et al., 1996;

Soubrier et al., 1988, Tiret et al., 1993).

An insertion/deletion (I/D) polymorphism in the

ACE gene results in genotypes II, ID, and DD

(Lindpainther et al., 1995; Rigat et al., 1990). Whereas

those people with DD genotype had the highest ACE

plasma level, those with II genotype had the lowest.

Since people with DD genotype and D allele have a

higher level of angiotensin-II due to the higher level of

ACE in circulation and tissues compared to other

genotypes and alleles, DD genotype and D allele can

be considered as a risk factor for a more severe

cardiovascular damage (Cambien et al., 1992;

Lindpainther et al., 1995; Samani et al., 1996; Tiret et

al., 1993). ACE D allele is considered as the reason

behind a higher ACE activity in both old and young

populations (Frossard et al., 1998). According to the

method of Lindpainther et.al. mistyping of I/D

heterozygotes was controlled using insertion specific

primers (Lindpainther et al., 1995). In 1992 in a

retrospective, multicenter, case-control study,

Cambien et al. reported that the frequency of the DD

genotype was increased in subjects with MI recruited

between 3 and 9 months after the event. Since then,

studies both supporting the finding as well as those

questioning the veracity of the association have been

published (Cambien et al., 1992; Herbert et al., 1985;

Soubrier et al., 1988). The findings in the metaanalysis

are consistent with data linking the D allele to

coronary artey disease risk using other criteria,

particularly the findings in several studies of an

increased familial risk of MI in those carrying the D

allele (Badenhop et al., 1995; Beohar et al., 1995;

Bohn et al., 1993; Evans et al., 1994; Ludwig et al.,

1995; Mattu et al., 1995; Tiret et al., 1994). In a case

control study of four different populations, a

homozygous deletion allele in the gene for ACE was

associated with an increased risk of MI, especially

among individuals with below-average lipid and body

mass (Cambien et al., 1992). The presence (allele I) or

absence (allele D) of the 287 bp Alu repeat in intron 16

of the ACE gene was determined by evaluating the

size of DNA fragments after polymerase chain

reaction amplification, using the primers and PCR

conditions described by Rigat et. al (Cambien et al.,

1992; Mattei et al., 1989; Rigat et al., 1992; Soubrier

et al.,1988). Because 4-5 % of samples with the I/D

genotype were misclassified as DD with older

methods, each sample found to have the DD genotype

was subjected to a second PCR amplification with

insertion-specific primers (5’TGGGACCACAG

CGCCCGCACTAC3’ and 5’TCGCCAGCCCTCC

CATGCCCATAA3’) with 67oC as the annealing

temperature to avoid DD mistyping (Lindpainther et

al., 1995). The ACE genotypes were assessed by PCR

using primer sequences and PCR cycling conditions,

as described previously. According to the absence or

presence of the 287 base pair insertion in the PCR

product, the patients were classified as homozygous

DD or II, or heterozygous ID. To prevent mistyping of

ID as DD genotypes, a second PCR with an insertion

specific primer (5’TTTGAGACGGAGTCTCG

CTC3’) was performed in all samples classified as

homozygous DD in the first PCR. Amplified DNA was

electrophoresed in 2% agarose gels and visualised by

ethidium bromide staining. Subjects with one 490 bp

band on an agarose gel (2%) classified as II

(insertion), subjects with both 490 and 190 bp bands

were classified as ID, and subjects with only a 190 bp

band were classified as DD. The molecular weight of

ACE ranges from 140-160 kd for the endothelial ACE

to 90-100 kd for the testicular form, depending on the

carbohydrate content of the molecule (Ehlers and

Riordan, 1983). Several biologic actions of ACE could

be involved in the pathogenesis of coronary artery

dsiease and myocardial infarction; the activation of

angiotensin_I and the inactivation of bradykinin

potentially result in decreased tissue perfusion, and

angiotensin-mediated promotion of growth may be

involved in the pathogenesis of cardiac diseases

(Fabris et al., 1990; Jandeleit et al., 1991;


Lindpainther et al., 1993; Magrini et al., 1988;

Mochizuki et al., 1992; Ridker et al., 1993). In a study

undertaken by Eicher and his colleagues in USA on a

patient group of 576 male and 124 females, the

relationship between ACE DD genotype and MI was

investigated. The gene frequencies were taken as a

basis in the study and the most common genotype in

the population was detected to be the ID genotype. DD

and II genotypes were detected almost in the same

frequencies. Among the patients with MI, individuals

with an MI history in the family had significantly

higher DD genotype (Eicher et al., 2001). Fatini and

his colleagues claimed that ACE DD genotype is risk

factor for MI patients based on a study on a sample

taken from Italy (Fatini et al., 2000). A study by

Marian et al. DD genotypewas associated with an

excess of parental history of fatal MI. These results

strengthened the hypothesis that genetic variation in

the ACE gene may contribute to an increased risk for

MI. Recently, an association of the D allele with

cardiomyopathy and sudden death has been reported

(Marian et al., 1993). In another recent study, 82

consecutive patients with known ACE genotype were

followed up after percutaneous transluminal

angioplasty. Restonosis was significantly more

frequent among patients carrying the DD genotype

than among those with ID or II genotypes (Bohn et al.,

1993). In contrast to these studies, Fatini and his

colleagues noted that they did not find a statistically

significant relation between ACE I/D gene

polymorphism and MI based on a study conducted

with 304 MI patients in Canarian Islands, Spain

(Ortega et al., 2002). The renin-angiotensin system is

highly regulated and may contribute to the

development of coronary artery disease and

myocardial infarction by several mechanisms. The fact

that ACE insertion/deletion gene polymorphism is not

associated with coronary artery disease and

myocardial infarction in large patient populations does

not exclude interactions of this polymorphism in the

renin-angiotensin system, which have been shown to

increase the risk of coronary artery disease and

myocardial infarction ( Nakauchi et al., 1996; Tiret et

al., 1994). The insertion/deletion I/D) polymorphism

of the angiotensin-converting enzyme (ACE) gene

was studied in patients with coronary heart disease

(CHD) and healthy individuals randomly sampled

from the Moscow population. The ACE gene proved

to be associated with the plasma apolipoprotein B

The biochemical fundamentals of angiotensin 5

(ApoB) content in CHD patients, but not associated

with HCD development in individuals with elevated

serum cholesterol and triglycerides. An association

was not revealed between the alleles of the ACE gene

and hypertension in CHD patients (Shadrina et al.,

2001). Recent evidence suggests that an

insertion/deletion (I/D) polymorphism of the gene

encoding angiotensin-converting enzyme (ACE) is

associated with myocardial infarction and related

cardiovascular diseases. We investigated a possible

association of the ACE polymorphism with essential

hypertension in a total of 263 cases/controls from

among the elderly (age, over 70 years) and middleaged

(age between 30 and 60 years) Japanese

population. The frequency of the I/I homozygote was

significantly higher in hypertensive subjects than in

controls in the elderly age group (33/57 vs 16/46; P =

0.02), but no association was observed in the middleaged

group (25/75 vs 26/85; P = 0.71). Similarly,

having at least one insertion allele was associated with

essential hypertension in the elderly age group (83/114

vs 46/92 in controls; P = 0.001), but not in the middleaged

group (78/150 vs 94/170; P = 0.524). These data

suggest that genetic variation at the ACE locus may be

associated with some determinants for blood pressure

in elderly persons, and imply the involvement of the

ACE insertion/deletion polymorphism in the etiology

of age-related essential hypertension in the Japanese

population (Yoshida et al., 2000). The aim of

Covolo’s study was to investigate whether ACE

genotype is associated with HF by comparing cases

and controls. The study sample consisted of 229 cases

with HF due to coronary heart disease or idiopathic

dilated cardiomyopathy and 230 controls recruited

from the general population. The ACE I/D genotype

was identified using a polymerase chain reaction

assay. No evidence was found to support an

association between ACE genotype and HF (Covolo et

al., 2003). Heart failure (HF) is the final outcome of

virtually all cardiovascular diseases and is a major and

increasingly serious public health problem. The reninangiotensin

system plays an important role in the

pathogenesis of cardiovascular disease.

Insertion/deletion (I/D) polymorphism of the

angiotensin-converting enzyme (ACE) has attracted

significant attention; it has been extensively

investigated in a spectrum of cardiovascular

phenotypes because of its correlation with serum ACE

activity. There is controversy regarding the association


6 Figen Esin Kayhan and Cenk Sesal

of ACE I/D polymorphism with cardiovascular

disease.

References

Agerholm-Larsen B, Nordestgaard BG, Steffensen R,

Sorensen TIA, Jensen G and Tybjaerg-Hansen A. AACE

gene polymorphism: Ischemic heart disease and

longevity in 10 150 individuals. A case-referent and

retrospective cohort study based on the Kopenhagen

City Heart Study. Circulation. 95:2358-2367, 1997.

Aldermann MH, Maddhavan S, Ooi WL, Cohen H, sealey

JE and Laragh JH. Assocition of the renin-sodium

profile with the risk of MI in patients with hypertension.

N Engl J Med. 324:1098-1104,1991.

Arbustini E, Grasso M and Fasani R. Angiotensin converting

enzyme gene deletion allele is independently and

strongly associated with coronary atherosklerosis and

myocardial infarction. Br Heart J. 74:584-591,1995.

Arca M, Panniteri G and Campagna F. ACE gene

polymorphism is not associated with coronary artery

atherosclerosis and MI in a sample of Italian patients.

Eur J Clin Invest. 28:485-490,1998.

Badenhop RF, Wang XL and Wilcken DEL. ACE genotypes

in children and coronary events in their grandparents.

Circulation. 91:1655-1658,1995.

Beohar N, Damaraju S, Prather A, Yu Q-T, Raizner A,

Kleiman NS, Roberts R and Marion AJ. ACE genotyp¤e

DD is a risk factor for coronary artery disease. J Invest

Med. 43:275-280,1995.

Blundell T, Sibanda BL and Pearl L. Three-dimensional

structure, specifity and catalytic mechanism of renin.

Nature. 304:273-275, 1983.

Bockxmeer FM, Mamotte C D and Burke V, Taylor RR.

ACE Gene Polymorphism and Coronary Heart Disease.

Clin. Sci., 99(3), 247-251, 2000.

Bohn M, Berge KE, Bakken A, Eriksen J and Berg K.

Insertion/deletion polymorphism at the locus for ACE

and parental istory of MI. Clin Genet. 44:298-301,1993.

Bohn M, Berge KE, Bakken A, Erikssen J and Berg K.

Insertion/deletion polymorphism at the locus for

angiotensin converting enzyme and myocardial

infarction. Clin Genet. 44:292-297, 1993.

Bunning P and Riordan JF. Sulfate potentiation of the

chloride activation of the ACE. Biochemistry. 26:3374-

3377,1987.

Bunning P, Holmquist B and Riordan JF. Substrate specifity

and kinetic characteristics of angiotensin converting

enzyme. Biochemistry. 22:103-110, 1983.

Caldwell PRB, Seegal BC, Hsu KC, Das M and Soffer RL.

Angiotensin-converting enzyme: vascular endothelial

localization. Science. 191:1050-1051, 1976.

Cambien F, Poirier O and Lecerf L. Deletion polymorphism

in the gene for angiotensin converting enzyme is a

potent risk factor for myocardial infarction. Nature.

359:641-644, 1992.

Canavy I, Henry M, Morange PE, Tiret L, Poirier O,

Ebagosti A, Bory M and Juhan-Vague I. Genetic

Polymorphisms and Coronary Artery Disease in the

South France. Thromb.Haemost. 83(2), 212-216, 2000.

Clauser E, Gaillard I, Wei L and Corvol P. Regulation of

angiotensinogen gene. Am J Hypertens. 2:403-410,

1989.

Covolo L, Gelatti U, Metra M, Donato F, Nodari S, Pezzali

N, Dei Cas L and NardiG. Angiotensin-convertingenzyme

gene polymorphism and heart failure: a casecontrol

study. Biomarkers. 8(5):429-436, 2003.

Das M, Hartley JL and Soffer RL. Serum angiotensin

converting enzyme. J Biol Chem. 252:1316-1319,1977.

Doolittle RF. Angiotensinogen is related to the antitrypsinantithrombin-ovalbumin

family. Science. 222:417-419,

1983.

Dzau VJ, Burt DW and Pratt RE. Molecular biology of the

renin angiotensin system. Am.J.Physiol. 255:563-

573,1988.

Dzau VJ, Pratt RE. Renin-angiotensin system: biology,

pfysiology and pharmacology. Handbook of

Experimental Cardiology. 1631-1661, 1986.

Dzau VJ. Cell biology and genetics in cardiovascular

disease. J Hypertens. 12:3-10,1994.

Ehlers MRW and Riordan JF. ACE: Biochemistry and

molecular biology. Hypertension. Pathophysiology,

Diagnosis and Management. New York, Raven Press.

pp.1217-1231,1990.

Ehlers MRW, Riordan JF. Angiotensin conveting enzyme:

Biochemistry and molecular biology, in Laragh JH,

Brenner BM(eds): Hypertension. Pathophysiology and

treatment. New York, McGraw-Hill. 250-270,1983.

Eichner JE, Chiristiansen VJ, Moore WE, Dunn ST and

Schechter E. Atherosclerosis. 54(3):673-679, 2001.

Erdos EG. Angiotensin I converting enzyme and the changes

in our concepts through the years. Hypertension. 16:363-

370,1990.

Evans AE, Poirier O, Kee F, Lecerf L, McCrum E, Falconer

T, Crane J, O’Rourke DF and Cambien F.

Polymorphisms of the ACE gene in subjects who die

from coronary heart disease. QJM. 87:211-214,1994.

Fabris B, Jackson B, Kohzuki M, Perich R and Johnston CI.

Increased cardiac ACE in rats with chronic heart failure.

Clin Exp Pharmacol Physiol. 17:309-314,1990.

Fatini C, Abbate R, Pepe G, Battaglini B, Gensini GF and

Guazzelli R. Searching for a Better Assesment of the

Individual Coronary Risk Profile: The Role of

Angiotensin II Type1 Receptor and Angiotensinogen

Gene Polymorphisms. Eur. Heart Jour. 21: 633-638,

2000.

Friedl W, Krempler F, Paulweber B, Pichler M and

Sandhofer F. A deletion polymorphism in the


angiotensin converting enzyme gene is not associated

with coronary heart disease in an Ausrian population.

Atherosclerosis. 112:137-143, 1995.

Frossard MP, Lestringant GG, Obineche EN and Hill SH.

Ann Saudi Med. 18(5):389-392, 1998.

Ganong WF. Reproduction and the renin-angiotensin

system. Neuroscience and Biobehavioral Reviews.

19:241-250, 1995.

Gomez RA, Chevalier RL, Carey RM and Peach MJ.

Molecular biology of the renin-angiotensin system.

Kidney Int 38:18-23, 1990.

Hansson L, Lindholm DH, Niskanen L, Lanke J, Hedner T

and Niklason A. Effects of angiotensin converting

enzyme inhibition compared with conventional therapy

on cardiovascular morbidity and mortality in

hypertension. Lancet. 353:611-616, 1999.

Herbert PN, Hyams JS and Bernier DN. Apolipoprotein B-

100 deficiency:intestinal stenosis despite apolipoprotein

B-48 synthesis. J Clin Invest. 76:403-412,1985.

Jandeleit K, Jackson B, Perich R, Paxton D and Johnston CI.

Angiotensin converting enzyme in macroand

microvessels of the rat. Clinical and Experimental

Pharmacology and Physiology. 18:353-356, 1991.

JeunemaitreX, Ledru F, Battaglia S, Guillanneuf MT,

Courbon D, Darmon O, Guize L, Guermonprez JL,

Diebold B and Ducimetiere P. Genetic polymorphisms

of RAS and angiographic extent and severity of

coronary artery disease: The CORGENE STUDY.

Hum.Genet. 99(1)66,1997.

Katsuya T, Koike G, Yee TW and Sharpe N. Association of

angiotensinogen gene T235 variant with increased risk

of coronary heart disease. Lancet. 345(8965):1600-

1603,1995.

Leung PS, Carlsson PO. Tissue renin-angiotensin system: its

expression, localization, regulation and potential role in

the pancreas. Journal of Molecular Endocrinology.

26:155-164, 2001.

Lindpainther K, Lu W and Neidermajer N. Selective

activation of cardiac angiotensinogen gene expression in

post-infarction ventricular remodelling in the rat. J Mol

Cell Cardiol. 25:133-143,1993.

Lindpainther K, Pfeffer MA and Kreutz R. A Prospective

evaluation of an angiotensin converting enzyme gene

polymorphism and the risk of ischemic heart disease. N

Engl J Med. 332:706-711, 1995.

Ludwig E, Corneli PS, Anderson JL, Marshall HW, Lalouel

JM and Ward RH. ACE gene polymorphism is

associated with MI but not development of coronary

stenosis. Circulation. 91:2120-2124,1995.

Magrini F, Reggiani P, Roberts N, Meazza R, Ciulla M and

Zanchetti A. Effects of angiotensin and angiotensin

blockade on coronay circulation and coronary reserve.

Am J Med. 84:55-60,1988.

Marian AJ, Yu Q, Workman R, Greve G and Roberts R.

Angiotensin converting enzyme polymorphism in

The biochemical fundamentals of angiotensin 7

hypertrophic cardiomyopathy and suden cardiac death.

Lancet. 342:1085-1086,1993.

Mattei MG, Hubert C, Alhenc-Gelas F, Roeckal N, Corvol P

and Soubrier F. ACE gene is on chomosome.17.

Cytogenet Cell Genet. 51:1041,1989.

Mattu RK, Needham EW, Galton DJ, Frangos E, Clark AJ

and Caulfield M. A DNA variant at the angiotensin

converting enzyme gene locus associates with coronary

artery disease in the Caerphilly Heart Study. Circulation.

91:270-274, 1995.

Miettinen HE, Korpela K, Hamalainen L and Kontula K.

Polymorphisms of the apolipoprotein and angiotensin

converting enzyme genes in young North Korelian

patients with coronary heart disease. Hum Genet.

94:189-192,1999.

Mochizuki T, Eberli FR, Apstein CS and Lorell BH.

Exacerbetion of ischemic dysfunction by angiotensin-II

in red cell-perfused rabbit hearts:effects on coronary

flow, contractility, and high-energy phosphate

metabolism. J Clin Invest. 89:490-498,1992.

Morris BJ, Iwamoto HS and Reid IA. Localization of

angiotensinogen in rat liver by immunocytochemistry.

Endocrinology. 105:790-796,1979.

Murphy TJ, Alexander R, Griendling KK, Runge MS and

Bernstein KE. Isolation of cDNA encoding the vascular

type 1 angiotensin-II receptor. Nature. 351:233-

236,1991.

Nakauchi Y, Suehiro T and Yamamoto M. Siginificance of

angiotensin-I converting enzyme and angiotensin-II type

1 receptor gene polymorphisms as risk factors for

coronary heart disease. Atherosclerosis. 125:161-169,

1996.

Oparil S: Angiotensin I converting enzyme inhibitors and

analouges of angiotensin II. Hypertension.

Pathophysiology, Diagnosis and Management. New

York, Raven Press. pp. 250-270,1983.

Ortega EH, Fernandez-Aceituno AM., Esparragon F., Perera

O., Nuez F, Espinosa AD, Perez DF, Prieto AA and Perez

JCR.: The Involvement of the Renin-Angiotensin Sytem

Gene Polymorphisms in Coronary Artery Disease. Heart

Disease, 55(2), 2002.

Packer M. Pathophysiology of chronic heart failure. Lancet.

340:88-92, 1992.

Peach MJ. Renin-angiotensin system. Physiol Rev. 57:313-

70,1977.

Phillips MI, Speakman EA and Kimura B. Levels of

angiotensin and molecular biology of the tissue reninangiotensin

system. Regulatory Peptides. 43:1-20, 1993.

Reid IA, Morris BJ and Ganong WF. The renin-angiotensin

system. Annual Review of Physiology. 40:377-410,1978.

Ridker PM, Gaboury CL, Conlin PR, Seely EW, Williams

GH and Vaughan DE. Stimulation of plasminogen

activator in vivo by infusion of angiotensin-II: evidence

of a potential interaction between the renin-angiotensin

system and fibrinolytic function. Circulation. 87:1969-


8 Figen Esin Kayhan and Cenk Sesal

1973,1993.

Rigat B, Hubert C, Alhenc-Gelas F, Cambien F, Corvol P

and Soubrier F. An insertion/deletion polymorphism in

the ACE gene accounting for half the variance of serum

enzyme levels. J Clin Invest. 86:1343-1346,1990.

Rigat B, Hubert C, Corvol P and Soubrier F. PCR detection

of the I/D polymorphism of the human angiotensin

converting gene. Nucleid Acids Res. 20:1433,1992.

Samani N, Thompson JR, O’Toole L, Channer K and Woods

KL. A meta analysis of the association of the deletion

allele of the ACE gene with MI. Circulation. 94:708-

712, 1996.

Sasaki K, Yamano Y, Bardhan S, Iwai N, Murray JJ,

Hasegawa M, Matsuda Y and Inagami T. Cloning and

expression of a complementary DNA encoding a bovine

adrenal angiotensin-II type 1 receptor. Nature. 351:230-

232,1991.

Shadrina MI., Slominskii PA, Miloserdova OV, Perova NV

and Limborskaika SA. Polymorphism of the Angiotenin

Converting Enzyme Gene ‹n Patients with Coronary

Heart Disease from Moscow Population. Genetica.

37(4), 540-544,2001.

Soubrier F and Corvol P. Clinical implications of the

molecular biology of the renin angiotensin system. Eur

Heart J. 11:3-10,1990.

Soubrier F, Alhenc-Gelas F, Hubert C, Alegrini J, John M,

Trager G and Corvol P. Two putative active centres in

human angiotensin I converting enzyme revealed by

molecular cloning. Proc Natl Acad Sci USA. 85:9386-

9390,1988.

Tahmasebi B, Puddefoot JR, Inwang ER and Vinson GP.

The tissue renin-angiotensin system in human pancreas.

Journal of Endocrinology. 161:317-322,1999.

Tiret L, Bonnerdeaux A and Poirier O. Synergistic effects of

ACE and angiotensin-II type 1 receptor gene

polymorphisms on risk of MI. Lancet. 344:910-913,

1994.

Tiret L, Kee F, Poirier O, Nicaud V, Lecerf L, Evans AE,

Cambou JP, Arveiler D, Luc G, Amouyel P, Cambien F.

Deletion polymorphism in the ACE gene associted with

parental history of MI. Lancet. 341:991-992,1993.

Yoshida K, Ishigami T, Nakazawa I., Ohno A, Tamura K,

Fukuoka M, Mizushima S and Umemura S. Association

of Essential Hypertension ‹n Elderly Japanese with I/D

Polymorphism of the ACE Gene. J.Hum.Genet. 45(5),

294, 2000.


Introduction

Journal of Cell and Molecular Biology 4: 9-23, 2005.

Haliç University, Printed in Turkey.

P rogrammed cell death in plants

Narcin Palavan-Unsal*, Elif-Damla Buyuktuncer and Mehmet Ali Tufekci

Halic University, Faculty of Arts and Sciences, Department of Molecular Biology and Genetics,

Findikzade 34280, Istanbul-Turkey (* author for correspondence)

Abstract

Plant development involves the elimination of cell organelles, protoplasts, tissues and organs. Programmed cell death

is a process aimed at the removal of redundant, misplaced or damaged cells and maintenance of multicellular

organisms. In contrast to the relatively well-described cell death pathway in animals, often referred to as apoptosis,

mechanisms and regulation of plant programmed cell death are still well defined. Several morphological and

biochemical similarities between apoptosis and plant programmed cell death have been described, including DNA

laddering, caspase-like proteolytic activity and cytochrome c release from mitochondria. The aim of this study is to

review the examples of programmed cell death through the life cycles of plants and also programmed cell death

detection of methods.

KKeeyy wwoorrddss:: Apoptosis, programmed cell death, plant.

Bitkilerde programlanm›fl hücre ölümü

Özet

Bitki geliflimi, hücre organellerinin, protoplast, doku ve organlar›n eliminasyonunu içermektedir. Programlanm›fl

hücre ölümü gere¤i olmayan, yanl›fl yerleflimi olan ve hasarl› hücrelerin ortadan kald›r›lmas›n› ve çok hücreli

organizmalar›n devaml›l›¤›n› sa¤layan bir olayd›r. Hayvanlarda apoptoz olarak bilinen ve çok iyi tan›mlanm›fl hücre

ölüm yola¤›n›n aksine bitki programlanm›fl hücre ölümünün mekanizmas› ve düzenlenmesi henüz tam olarak

aç›kl›¤a kavuflturulamam›flt›r. Apoptoz ve bitki programlanm›fl hücre ölümü aras›nda DNA fragmentasyonu, kaspazbenzeri

proteolitik aktivite ve mitokondrilerden sitokrom c sal›nmas› gibi baz› morfolojik ve biyokimyasal

benzerliklerin oldu¤u saptanm›flt›r. Bu çal›flmada bitki yaflam› boyunca meydana gelen programl› hücre ölümlerine

örnekler ve ayn› zamanda programlanm›fl hücre ölümünü saptama yöntemlerini derlemek amaç edinildi.

AAnnaahhttaarr ssöözzccüükklleerr:: Apoptoz, programlanm›fl hücre ölümü, bitki

The cells of multicellular organisms are members of

highly organized community. Controlling the rate of

cell division and of cell death strictly regulates the

number of cells in this community. If cells are no more

needed, they die by activating intracellular death

program, for this reason this process named as

p rogrammed cell death (PCD) and more commonly

apoptosis. The term apoptosis comes from plant

kingdom from old Greek apoptosis that originally

means the loss of petals or leaves. Surprisingly,

despite the obvious role of cell death in plants the

concept of PCD is developed and pioneered in animal

and medical sciences.

The amount of apoptosis that occurs in developing

vertebrate nervous system and adult animal system is

astonishing. In the developing vertebrate nervous

9


10 Narcin Palavan-Unsal et al.

system half or more of the nerve cells normally die

soon after the formation. In healthy adult human,

every hour billions of cells die in the bone marrow and

intestine. What is the purpose of this massive cell

death?

A molecular mechanism for eliminating

developmentally unwanted cells is essential for

successful development and growth of complex

multicellular organisms. Therefore in addition to

regulating the rate of cell division, multicellular

organisms such as animals and plants contain a

biochemical pathway to control cell death. By

coordinating the activation of cell division and cell

death, animals and plants may direct a variety of

developmental processes such as generation of

developmental patterns and the shaping of cells,

tissues and organs. However, cell death may not be

limited to development and may also be used in a

number of other processes such as control of cell

populations and defense against invading microbes

(Ellis and Horvitz, 1986; Raff, 1992; Greenberg, 1996;

Jones and Dangl, 1996; Mittler and Lam, 1996).

Molecular mechanism of apoptosis

Cells that die as a result of injury, typically swell and

burst and they spill their content all over the

Table 1: Pathological features of apoptosis and necrosis.

Figure 1: Morphological differences between apoptosis and

necrosis (Studzinski, 1999).

neighbors. This process named as cell necrosis, and it

causes inflammatory response in animals. By contrast,

a cell that undergoes apoptosis dies without damaging

neighbors. The cell shrinks and condenses. The

cytoskeleton collapses, nuclear envelope dissembles

and nuclear DNA breaks up into fragments. Apoptotic

bodies that are formed during apoptosis are engulfed

Apoptosis Necrosis

Pattern of death Single cells Groups of neighboring cells

Cell size Shrinkage

Fragmentation Swelling

Preserved continuity

Plasma membrane Blebbed Smoothing

Phosphatidylserine on surface Early lysis

Increased membrane permeability

Mitochondria Contents released into cytoplasm Swelling Disordered structure

Cytochrome c; Apaf1

Structure relatively preserved

Contracted Swelling

Organelle Shape "Apoptotic bodies" Disruption

Chromatin:

Nuclei Clumps and Fragmented Membrane disruption

Fragmented

Internucleosomal cleavage

DNA Degradation Free 3' ends Diffuse and Random

Laddering on electrophoresis

DNA appears in cytoplasm

Cell Degradation Phagocytosis Inflammation

No inflammation Macrophage invasion


and recycled by neighboring cells or specific

macrophages; therefore complete elimination of the

cell occurs.

The intracellular machinery responsible for

apoptosis seems to be similar in all animal cells. This

machinery depends on a family of proteases that have

a cysteine at their active site, and cleave their target

proteins at specific aspartic acids, therefore they are

called caspases. Caspases are synthesized in the cell as

inactive precursors or procaspases, which are usually

activated by cleavage at aspartic acids by other

caspases. Once activated, caspases cleave and thereby

activate, other procaspases, resulting in an amplifying

proteolytic cascade. Some of the activated caspases

then cleave other key proteins in the cell. For example

some cleave the nuclear lamins and cause irreversible

breakdown. Another cleaves protein that normally

holds a DNA degrading enzyme in an active form,

freeing the DNAase to cut the DNA, thus, cell

dismantles itself quickly.

First, Uren et al. (2000) have identified genes

encoding ancestral caspase-like proteins, the

metacaspases, which are present in plants, fungi and

protozoa. Homology of metacaspases to caspases is

not restricted to the primary sequence, including the

catalytic diad of histidine and cysteine, but extends to

the secondary structure as well. Recently, Bozhkov et

al. (2004) address the question of whether caspase-like

proteolytic activity is involved in the regulation of

plant developmental cell death using Norway spruce

(Picea abies) somatic embryogenesis as the model

system. They showed, for the first time, that VEIDase

is a principal caspase-like activity implicated in plant

embryogenesis. This activity is increased at the early

stages of embryo development, and is directly

involved in the terminal differentiation and death of

the embryo suspensor.

Unlike animal cells, plant cells have walls that may

act as physical barriers preventing the recycling of

cellular material from dead cells via apoptotic bodies.

Therefore, recycling of cellular content from dead

cells may occur by degradation of cell debris to

compounds with low molecular weight and neighbor

cells take them. This kind of process releasing cellular

debris into the intercellular space would have caused

an inflammatory response in animals, but plants are

different from animals, because they have no immune

response. Morphogenesis in plants is primarily

determined by cell division and cell death but no cell

migration unlike animal morphogenesis. Another

aspect of plant life that involves PCD is the interaction

of plants with their environment. Thus the defense of

plants against biotic and abiotic stresses often involves

activation of apoptosis. Therefore function of cell

death is similar but mechanisms concerned are very

different and specific for particular organisms.

Molecular markers of apoptosis

PCD can be subdivided into three stages: Signaling

phase, execution phase and dismantling phase

(Depreatere and Golstein, 1998). The regulation of

apoptosis is mainly known in neoplastic tissues

(Korsmeyer, 1995). Over the past ten years about 30

new molecules have been found that initiate and

regulate apoptosis. 20 other molecules associated with

signaling or DNA replication, transcription or repair

have also been discovered as apoptosis regulators

(Willie, 1998).

One of the signals for apoptosis is a decrease in

mitochondrial transmembrane potential, irrespective

of any apoptosis-inducing stimulus (Kroemer et al.,

1998). Another early marker of apoptosis is aberrant

exposure of phosphatidylserine in the plasma

membrane (Kroemer et al., 1998). These events are

followed by the activation of proteases,

phospholipases and phosphatases. The role of calcium

was also well documented (Schwartzman and

Cidlowski, 1993). The activation of nucleases leads to

cleavage of nuclear DNA (Bayly et al., 1997).

Internucleosomal DNA cleavage results in the

formation of small fragments (Oberhammer et al.,

1993).

Occorunce of apoptosis in plants

Plants eliminate cells, organs and parts during

responses to stress and expression during various

developmental processes:

Apoptosis during reproductive period

Apoptosis in plants 11

Unpollinated flowers are fully thrown away. Ovaries

with fertilized egg cells in ovules on the same plant are

retained forming fruits while the other parts; petals,

sepals or tepals fall off. Stigmas and pistils may also

be eliminated. In apomictic species, the fruits develop


12 Narcin Palavan-Unsal et al.

without fertilization, which means that the ovaries

with ovules are retained forming fruit, but the other

flower parts are eliminated.

Apoptosis is involved in the formation of female

gametes in seed plants. Single meiotic division gives

four haploid megaspore cells, three of them undergo

apoptosis, remaining one have two additional mitotic

division and bring to egg and associated cells of the

embryo (Bell, 1996). Apoptosis is also involved in the

formation of male sexual organs. Tapetum layer is

surrounding the pollen during maturation undergoes

apoptosis (Greenberg, 1996).

Plants developed several mechanisms to avoid

self-pollination. One of these involves inhibition of

germinating pollen dependent on recognition by pistil

tissue. This process is mediated by proteins showing

RNase activity, which is crucial for their function (Kao

and McCubbin, 1996). The growth of the pollen tube

through the pistil is associated by selective cell death.

Therefore pistil cells along the growth way of the

pollen tube undergo apoptosis while the rest of the

tissue stays intact (Wang et al., 1996). Two synergid

cells are present at the entry to the egg sack, one of

them undergoes apoptosis for arriving pollen tube to

enter and release sperm cells.

Apoptosis also occurs during the embryogenesis in

plants. Cell death within the embryo does occur as part

of its normal development and includes the death of

scutellar cells surrounding the developing radicle,

death of suspensor and death of nucellus from which

the egg cell originates. These cell types that undergo

cell death are highly specific and their death is

essential for the final development of the embryo. In

addition, in some species the transient endosperm

undergoes a cell death that is followed by its

reabsorption during embryogenesis that is thought to

facilitate embryo growth, whereas in other species in

which the endosperm is persistent, it survives as a part

of the mature seed.

Apoptosis occurs during the germination of plants

and it is also formed in the seed storage tissues.

Endosperm supplies nutrients to the embryo for

development and germination and undergoes PCD.

This process generally associated with lytic enzyme

activities, for instance α-amylase is secreted from

aleurone layer which surrounds the endosperm

(Brown and Ho, 1987). Using a model system of

barley aleurone protoplasts, Fath et al. (2000) revealed

that this PCD occurs in a gibberellic acid dependent

manner.

Apoptosis in vegetative plant tissues

Generally the structure of most of the leaves is

determined by differential cell and tissue growth, but

in some genus for instance in Monstera a group of

cells die at early stages of leaf development, resulting

in the formation of holes in the mature leaf (Kaplan,

1984; Greenberg, 1996). Sclerenchyma cells are dead

because thick cell walls perform the mechanical

function. Cork is constituted of characteristic cells

with thick suberinised layer of the cell wall. Suberin

combined with lack of intercellular spaces, protects

internal tissues against dessication. The protoplast is

no longer needed, therefore it is eliminated. The

continuous growth of the stem is also result with the

cell death. Cell division in the cambium layer causes

cell death in the cork layer, that is replaced with the

ruptured epidermis and also in parenchyma cells at the

stem pith.

Xylogenesis

Perhaps the most dramatic example of PCD is the

vascular system differentiation in plants. Tracheal

elements (vessels/tracheids) are composed of a series

of hollow dead cells. After the formation of secondary

walls tracheal elements lose their cellular contents to

become empty dead cells. Studies have revealed that

this cell death is under spatial and temporal regulation

(Fukuda, 1996, 2000). Recent progress in the study of

tracheary elements PCD has been made mainly with

an in vitro Zinnia system established by Fukuda and

Komamine (1980a). In this system single mesophyll

cells isolated from Zinnia leaves transdifferentiate

synchronously into tracheary elements at a high

frequency without cell division (Fukuda and

Komamine, 1980a, b).

A number of ultrastructural observations of the

PCD in tracheal element differentiation have been

reported (Obara and Fukuda, 2003). These studies

revealed the rapid and progressive cell-autonomous

degradation of organelles, including nuclei, vacuoles,

plastids, mitochondria and endoplasmic reticulum and

at maturity the loss of plasma membrane and some

parts of the cell walls. Recently, serial observations of

living tracheary elements demonstrated that rapid

nuclear degradation is triggered by vacuolar rupture

(Obara et al., 2001). Nucleoids in chloroplasts are also

degraded rapidly after vacuole rupture. Cytoplasmic

streaming ceases immediately after the disruption of


the vacuole (Groover et al., 1997). All these

observations revealed that one of the most critical

steps in PCD is the irreversible disruption of tonoplast.

Secondary wall lignification is initiated before the

vacuole rupture. It was found recently that

brassinosteroid biosynthetic pathway is activated

before the tracheary element PCD, and the synthesized

brassinosteroids induce PCD and the formation of

secondary cell walls (Yamamoto et al., 2001).

In animals apoptosis usually involves nuclear

shrinkage and fragmentation, cellular shrinkage, DNA

fragmentation, membrane budding, formation of

apoptotic bodies and digestion by macrophages or

adjacent cells (Wyllie et al., 1980). But nuclear

shrinkage and fragmentation do not occur in tracheary

PCD, no prominent chromatin condensation is

established, although the nucleus sometimes exhibits

chromatin condensation near the nuclear envelope

(Lai and Srivastava, 1976; Groover et al., 1997; Obara

et al., 2001). Cellular shrinkage, membrane blebbing

and the formation of apoptotic bodies do not occur in

tracheary element PCD. No DNA ladder has been

detected in differentiating tracheal elements.

Therefore the morphological features of tracheary

elements PCD are different from those of apoptosis.

Rapid nuclear degradation after vacuole ruptures

implies the involvement of a highly active nuclease. In

cultured Zinnia cells at least seven active RNase bands

were detected by gel assay (Thelen and Northcote,

1989). Proteases are also involved in the autolytic

processes of tracheary element PCD. Several protease

activities have been found associated with tracheary

element differentiation in the Zinnia system (Obara

and Fukuda, 2003).

Extracts from Zinnia cells cultured in tracheary

element inductive medium contain cystein protease

activity (Minami and Fukuda, 1995; Beers and

Freeman, 1997). Serine proteases may also be

involved in tracheary element PCD. Serine proteases

of 145 kDa and 60 kDa have been detected

specifically in differentiating tracheary elements

(Beers and Freeman, 1997). Many cell death related

hydrolytic enzymes are expressed during the autolysis

of tracheary elements. These enzymes may be harmful

to the other cells if they leak from dead tracheary cells.

Therefore, the vascular tissue may have some system

by which harmful extracellular enzymes are

detoxified.

Apoptosis in senescence

Apoptosis in plants 13

Senescence in plants can refer to at least two distinct

processes: The aging of various tissues and organs as

the whole plant matures and the process of the whole

plant death that sometimes occurs after fertilization

and called as monocarpic senescence (Nooden, 1988).

Senescence is a genetically controlled developmental

process, which is internally programmed (Nooden and

Guiamet, 1996). Ultrastructural researches showed

that some features of senescence resemble to the

typical markers of PCD. Orzaez and Granell (1997a)

established typical DNA fragmentation during the

senescence of unpollinated pistils of Pisum sativum.

Apoptotic parameters were detected during the petal

senescence by Orzaez and Granell (1997b). Same

researchers also reported the control of DNA

fragmentation by ethylene in connection with

senescence. These results provide direct evidence to

support that the natural senescence of the leaves is

indeed apoptotic process (Yen and Yang, 1998).

Several researches have tried to find out molecular

approaches to identifying genes involved in

senescence control. Several genes termed senescence

associated genes (SAG) that show sequence similarity

to cysteine proteases induced early senescence

(Hensel et al., 1993; Lohman et al., 1994). These plant

proteases are good candidates for cell death initiation

genes. It has also been suggested that RNase (Blank

and McKeon, 1989) and lipoxygenase (Rouet-Mayer

et al., 1992) activities are also might be involved in

senescence control, since the activity of these enzymes

increases during senescence, but no casual link

between these activities and senescence has been

established, yet.

Early researches for genes induced during

senescence were unsuccessful to identify transcription

factors associated with senescence. But in the last few

years with the use of new and powerful techniques,

new senescence-associated genes (SAGs) have been

identified. A number of potential transcription factors

are now known to be associated with senescence

(Yang et al., 2001; Zentgraf and Kolb, 2002).

Receptor like protein kinases has been concerned

in senescence signaling (Robatzek and Somssich,

2002). It is known that receptor like kinases serve as

receivers and transducers of external stimuli, acting

through phosphorylation/dephosphorylation cascades

that lead to changes in gene expression. The


14 Narcin Palavan-Unsal et al.

Figure 2: A summary of the development of tracheal element PCD. As the PCD process progresses tracheal elements accumulate

hydrolytic enzymes in the central vacuole. The transport of organic anions (A-) into the vacuole declines. Tracheal elements

become highly vacuolated and their nuclei are tightly pressed and flattened. Secondary cell walls become visible, the central

vacuoles in tracheal elements collapse, resulting in the release of hydrolytic enzymes. DNA in tracheal elements is rapidly

degraded within 10-20 min of the collapse of the vacuole. After several hours, perforations open at one longitudinal end of each

tracheal element, and tracheal elements lose their cellular contents (adapted from Obara and Fukuda, 2003).

senescence associated kinase receptor gene (SARK)

behaves as typical SAG that is induced by senescenceinducing

factors (ethylene, jasmonate) and repressed

by senescence delaying factors (cytokinin, light). Both

transcript and protein appear prior to onset of

senescence (Hajouj et al., 2000).

Programmed cell death in response to abiotic stress

Plant cells and tissues exposed to variety of abiotic

stresses that ultimately may result in their death.

Abiotic stresses include toxins such as salinity, metals,

herbicides and gaseous pollutants, including reactive

oxygen species (ROS), as well as water deficit and

water logging, high and low temperature and extreme

illumination. Plants show adaptations to the stress

including mechanisms to tolerate the adverse

conditions, to exclude the toxins or to avoid conditions

where the stress is extreme. Abiotic stress may also

result in stunted growth, followed by death of part or

all of the plant. Cell death in abiotic stress may

therefore be part of a regulated process to ensure

survival. Alternatively, it may be due to the

uncontrolled death of cells or tissues killed by

unfavorable conditions. PCD may be a part of an

adaptive mechanism to survive the stress.

Adaptation of plants to environmental conditions

such as high light intensity or low humidity often

involves covering their surfaces with layer of dead

unicellular hairs. These cells are thought to go through

PCD resulting in the formation of a protective layer

that functions to block high irradiance and trap

humidity (Greenberg, 1996).

Aerenchyma is the term given to tissues containing

gas spaces. It is frequently observed in the roots of

wetland species, but may also be formed in some

dryland species in unfavorable conditions. It is formed

either constitutively or because of abiotic stress,

generally originating from water logging. Aerenchyma

has been described in two basic types: Lysigenous and


schizogenous. Lysigenous aerenchyma is formed

when previously formed cell die within a tissue to

create a gas space. Lysigenous earenchyma is found in

rice, wheat, barley and maize (Evans, 2004).

Schizogenous aerenchyma is formed when

intracellular gas spaces form within a tissue as it

develops and without cell death taking place. Spaces

are formed by differential growth of adjacent cells

with cell separating from each other. Wetland species

like Rumex and Sagittaria (Justin and Armstrong,

1987; Schussler and Longstreth, 1996) have

characteristic schizegenous aerenchyma that is not

involved in the cell death.

Recently the plant hormone ethylene was

implicated in regulating cell death processes. It is

known that hypoxia conditions result in the

accumulation of ethylene within the tissue (Jackson et

al., 1985). Aerenchyma formation in a member of

species can be induced by ethylene produced

endogenously (Jackson et al., 1985). This indicates

that metabolic consequences of hypoxia are not major

factors in cortical cell death and suggests the initiation

of a cell death pathway (Gunawardena et al., 2001).

Indeed, both an abiotic factor and an endogenous

hormone can initiate cell death in these tissues.

The first signs of cell death detectable within

maize cells treated with ethylene or low oxygen are an

invagination of plasma membrane, a more electron

dense cytoplasm and shrinkage of plasma membrane

from the cell wall (Gunawardena et al., 2001). The

granular staining of the vacuolar contents and the

Table 2: Ultrastructural changes caused by various abiotic stresses (Evans, 2004).

Abiotic stress Ultrastructural changes

Hypoxia-lysigenous Chromatin condensation and DNA fragmentation

Apoptosis in plants 15

formation of numerous vesicles beneath the plasma

membrane established. These researchers also

revealed wall changes at a very early stage of cell

death. Schussler and Longstreth (2000), observed

nuclear condensation, which are the characteristics of

apoptosis in lysigenous cell death in S. lancifolia. One

of the key characteristics of apoptosis is the formation

of apoptotic bodies in animal cells. Apoptotic bodies

are membrane-bounded inclusions containing

chromatin and organelles that remain intact to a late

stage in cell death. Membrane bounded inclusions

were observed in aerenchyma formation in maize

tissues (Gunawardena et al., 2001). The function of

these membrane inclusions in plants is not known,

they may protect the organelles from lysis or may be

involved in maintaining secretion of the enzymes that

digest the cell wall and the cytoplasmic contents to

form gas spaces. Another characteristic of apoptosis in

animal cells is the fragmentation of nuclear DNA.

Gunawardena et al. (2001) observed TUNEL-positive

(terminal deoxynucleotidyl transferase-mediated

dUTP nick end labelling) nuclei in the cortex of maize

roots induced to form aerenchyma by both ethylene

and hypoxia. Table 2 summarizes the ultrastructural

characterization of PCD in different abiotic stress

conditions.

Programmed cell death in response to biotic stress

Aerenchyma formation Organelle surrounded by membranes

Plasma membrane invagination and tonoplast degradation

Cell wall degradation

Light radiation Oligonucleosomal fragmentation of DNA

Migration of nuclear contents to cell periphery

Many studies have demonstrated the induction of PCD

in plants in response to pathogen attack, indicating that

Mechanical stress TUNEL positive material around nuclear periphery

Oligonucleosomal fragmentation of DNA in chloroplast and nuclei

Cold stress Chloroplast swelling, thylakoids distort and swell, grana unstuck and

chloroplast lyse, nuclei swell, chromatin fragments, ER and golgi

cisternae swell, cytoplasmic condensation occurs


16 Narcin Palavan-Unsal et al.

PCD plays central role in pathogenesis (Goodman and

Novacky, 1994). Recent studies showed that cells

challenged by pathogens initiate an active PCD

response, which is triggered by host-specific signals

and requires synthesis of new proteins and/or

activation of specific metabolic pathways (He et al.,

1994; Greenberg, 1997). At least two types of cell

death occur following the infection of a plant with a

pathogen:

1. The hypersensitive response (HR). A rapid

PCD process that is activated in some plants in

order to inhibit the spread of invading

pathogen.

2. Disease symptoms. This type of cell death

which appears relatively late during the

development of some diseases and is

considered to result from toxins produced by

invading pathogen. But certain mutants were

shown to develop cell death associated disease

symptoms in the absence of pathogen.

HR is activated following perception of attempted

infection by pathogens. In addition to the induction of

PCD, HR constitutes a coordinated plant response to

pathogen attack, which involves: a. oxidative burst, b.

nitrosative burst, c. biosynthesis of phytoalexins, d.

strengthening the cell walls, e. local and systemic

signals for defense reactions in near and distant cells,

respectively.

Phytotoxins that were considered as simply

causing damage to the attacker’s cellular components

or as inhibitors of metabolic pathways were recently

shown to function as inducers of an active PCD

response (Navarre and Wolpert, 1999). Toxins that are

secreted by phytopathogenic fungi were found to

induce PCD in addition to their inhibitory activity of

the host metabolism (Stone et al., 2000).

Production of phytoalexins that are low molecular

weight secondary metabolites is one of the best

defense responses in plants. The specificity of this

compound changes depending on the compounds and

on the pathogens (Dixon et al., 1994). Consequently,

the observed localization of phytoalexin biosynthesis

to the area challenged by pathogens corresponds with

the induction of PCD in the same cells (Dorey et al.,

1997). Phytoalexins are stable compounds and stay in

an active form even after the plant cell die.

The nature of the PCD inducing signals, offer the

possibility to control the PCD response. Several major

signal transduction pathways are initiated immediately

after the pathogen perception. These include calcium

influx, protein phosphorilation, activation of

phospholipases and G proteins. These primary signals

are further propagated by the activity of

phosphoinositides and G-proteins. These secondary

signals lead to the activation of NADPH oxidase.

Furthermore, ROS, in turn, possesses multiple

signaling activities that induce defense reactions on

one hand and PCD on the other hand (Piffanelli et al.,

1999; Hancock et al., 2001).

Recognition of the pathogen avirulence (Avr) gene

products by the plant initiates a signal transduction

cascade that activates the HR. The final stage of the

HR is PCD that play central role in the disease

resistance. Critical steps in the HR are:

1. Interaction of the Avr-gene (X 1, X 2, X 3) with the

Resistance gene (R-gene) (RX 1, RX 2, RX 3),

2. Convergence of the signals from the individual

R genes into a conserved HR pathway;

3. Activation of NADPH oxidase induces the

PCD.

The signaling downstream of the NADPH oxidase

is regular to almost all types of plant PCD, including

developmental PCD and physiological responses to

abiotic stress. Additional signaling molecules such as

calcium and salicylic acid (SA) regulate NADPH

oxidase activation that transforms the extent PCD and

associated defense reactions.

Following the recognition of pathogens by plants,

which is mediated by plant R gene and pathogen Avrgene

interactions, signals need to be transmitted and

distributed to compartments involved in defense

reactions. Application of protein kinase and/or

phosphatase inhibitors indicated that the protein

phosphorilation and dephosphorilation are involved in

a numerous defense responses. Several protein kinases

that participate in the perception of specific induction

of defense responses have been identified and cloned.

SA is a critical signaling molecule in the disease

resistance pathways, including PCD and local and

systemic resistance (Delaney et al., 1994). SA

accumulates more than 100-fold in the challenged

area. Treatment of exogenous SA induces many

defense genes, phytoalexins and promotes ROS

generation and PCD (Shirasu et al., 1997). Many

mutants with altered SA perception and signaling have

been isolated. The majority of these mutants show

corresponding alteration in disease resistance.

Interactions between SA, ROS, nitric oxide (NO),


jasmonic acid (JA) and ethylene and other signaling

molecules further complicate the determination of SAspecific

functions. The effects of SA is related with

activation of the SA-inducible MAP kinase or

interaction with SA-response elements in promoters of

defense genes, and its inhibitory effect on

mitochondria, emphasize the involvement of SA in

diverse signaling pathways within the HR signal

transduction. Similar to SA many defense responses

are modulated by other plant hormones such as

jasmonic acid, ethylene and abscisic acid (ABA)

(Dong et al., 1998; Klessig et al., 2000). These

conclusions are generally based on the analysis of

pathogenesis and PCD in hormone signaling mutants.

Methods to detect programmed cell death

Although a detailed understanding of how plant cells

die is still largely unknown, recent studies have shown

that the apoptotic pathways of the animal and plant

kingdoms are morphologically and biochemically

similar (Greenberg, 1996; Wang et al., 1996).

Specifically, the morphological hallmarks of apoptosis

include cytoplasmic shrinkage, nuclear condensation,

and membrane blebbing (Earnshaw, 1995); the

biochemical events involve calcium influx, exposure

of phosphatidylserine, and activation of specific

proteases and DNA fragmentation, first to large 50-kb

fragments and then to nucleosomal ladders

(McConkey and Orrenius, 1994; Wang et al., 1996;

O'Brien et al., 1998). All of the above-mentioned

phenomena were shown to occur in plant PCD. Also,

the stimuli that activate apoptosis are similar in plant

and animal cells (O'Brien et al., 1998). Although it

should be noted that not all of the events were

demonstrated in the same plant system, taken together

these results infer a common basic cell death process

in plants and animals.

Morphologically, PCD, known as apoptosis, is

generally characterized by a subset of changes such as

chromatin and cytoplasm condensation (Vaux, 1993).

Little is known about apoptosis in plants including the

morphological changes (Danon et al., 2000). Although

some accumulating evidence suggests that some

features of plant apoptosis such as nuclear

disintegration and chromatin condensation triggered

endogenously or environmentally are similar to those

in animals (reviewed by Danon et al., 2000; Vaux and

Korsmeyer, 1999), other features such as cytoplasm

Apoptosis in plants 17

shrinkage, nuclear periphery and the formation of

apoptotic bodies have not been universally identified.

Generally, it seems that chromatin cleavage is the

most characteristic feature of PCD (Gavrieli et al.,

1992). There are some in situ detection methods,

which are dependent on the labelling and detection of

the cleaved fragments. ISEL (in situ end labelling),

TUNEL and ISNT (in situ nick translation) are three

methods that can be used to label these DNA breaks in

various tissues.

Klenow fragment of DNA Polymerase I is used in

the ISEL method to incorporate labelled nucleotides

into the DNA strand breaks which occur during

internucleosomal cleavage. TUNEL method uses TdT

(terminal deoxynucleotidyl transferase) to end label 3'-

OH groups exposed during the cleavage process

(Gorczyca et al., 1993). Although TUNEL-positive

reaction is considered as a good specific criterion of

death by PCD in animals (Kressel and Groscurth,

1994), some researchers using plant tissues have

reported that sample preparation of histological

sectioning including fixation, embedding and

sectioning, can cause sufficient nicking of nuclear

DNA to produce false TUNEL positivity (Wang et al.,

1996). Nevertheless, the TUNEL reaction is more

specific to PCD when associated with morphological

and time-course data, than other death markers such as

fluorescein diacetate (FDA) and Evans Blue.

Additionally, the fixation procedure is simpler when

using a protoplast or cell culture population and has

not been reported to induce false TUNEL positive

labelling (Danon et al., 2000).

Material for current studies of PCD in plants has

been obtained predominantly from two different

systems, protoplast cell culture for in vitro studies and

histological sectioning for in vivo studies (Stein and

Hansen, 1999). On tissue sections, PCD changes can

only be detected at the tissue level without detailed

description in the individual cells unless

ultramicroscopy is used and there exists low

sensitivity due to poor penetration without

pretreatment. The cell wall autofluoresces, resulting in

high background that increases as a result of the

pretreatment process (Wang et al., 1996). It makes

changes in the cells undergoing PCD difficult to

visualize. In addition, it has been reported that section

preparation including fixation, embedding and

sectioning, can cause sufficient nicking of nuclear

DNA to produce false TUNEL positive nuclei.


18 Narcin Palavan-Unsal et al.

Therefore, sectioning techniques should be used very

cautiously in plants (Wang et al., 1996). Most of the

current knowledge about the nature of PCD has come

from the cell culture systems, because cell culture

experiments for PCD are generally sufficient than the

histological sections. However, a question arises as to

whether PCD observed in vitro also occurs in whole

plants (Koukalova et al., 1997)? Also, a hallmark of

PCD, DNA laddering in cell culture may be caused by

mycoplasma endonucleases (Paddenberg et al., 1996).

So, in vivo systems might be more biologically

relevant than in vitro systems. Therefore, it is

necessary to develop more effective techniques for the

detection of in vivo plant PCD, both morphologically

and biochemically. Nowadays more brightful genomic

and proteomic experiments give us a chance to

understand molecular levels of biochemically prooved

reactions. Especially proteomic approaches will solve

the unknowns in protein level.

Originally, to study both forms of cell death,

necrosis and apoptosis, cytotoxicity assays were used.

Generally plant researchers who try to detect PCD in

histological sections use the root tips. The root tip of

various plant species is generally one of the most

sensitive tissues to various environmental impacts

(Katsuhara and Kawasaki, 1996), and has previously

been used for studying PCD induced by external

abiotic factors (Stein and Hansen, 1999). If the

material is going to be originated from in vitro system,

protoplast culture are the most common technique in

plant PCD experiments.

These assays were principally of two types:

- Radioactive and non-radioactive assays that

measure increases in plasma membrane

permeability, since dying cells become leaky.

- Colorimetric assays that measure reduction in

the metabolic activity of mitochondria;

mitochondria in dead cells cannot metabolize

dyes, while mitochondria in live cells can.

However, as more information on apoptosis

became available, researchers realized that both types

of cytotoxicity assays vastly underestimated the extent

and timing of apoptosis. For instance, early phases of

apoptosis do not affect membrane permeability, nor do

they alter mitochondrial activity. Although the

cytotoxicity assays might be suitable for detecting the

later stages of apoptosis, other assays were needed to

detect the early events of apoptosis. In concert with

increased understanding of the physiological events

that occur during apoptosis, a number of assay

methods have been developed for its detection. For

example, these assays can measure one of the

following apoptotic parameters:

- Fragmentation of DNA in populations of cells

or in individual cells, in which apoptotic DNA

breaks into different length pieces.

- Alterations in membrane asymmetry.

Phosphatidylserine translocates from the

cytoplasmic to the extracellular side of the cell

membrane.

- Activation of apoptotic caspases. This family

of proteases sets off a cascade of events that

disable a multitude of cell functions.

- Release of cytochrome c and AIF into

cytoplasm by mitochondria.

DNA fragmentation or laddering method

Apoptosis and cell-mediated cytotoxicity are

characterized by cleavage of the genomic DNA into

discrete fragments prior to membrane disintegration.

Because DNA cleavage is a hallmark for apoptosis,

assays, which measure prelytic DNA fragmentation,

are especially attractive for the determination of

apoptotic cell death. The DNA fragments may be

assayed in either of two ways:

As “ladders” (with the 180 bp multiples as “rungs”

of the ladder) derived from populations of cells: The

biochemical hallmark of apoptosis is the

fragmentation of the genomic DNA, an irreversible

event that commits the cell to die. In many systems,

this DNA fragmentation has been shown to result from

activation of an endogenous Ca 2+ and Mg 2+ dependent

nuclear endonuclease. This enzyme selectively

cleaves DNA at sites located between nucleosomal

units (linker DNA) generating mono- and

oligonucleosomal DNA fragments. These DNA

fragments reveal, upon agarose gel electrophoresis, a

distinctive ladder pattern consisting of multiples of an

approximately 180 bp subunit. Radioactive as well as

non-radioactive methods to detect and quantify DNA

fragmentation in cell populations have been

developed. In general, these methods are based on the

detection and/or quantification of either low molecular

weight (LMW) DNA which is increased in apoptotic

cells or high molecular weight (HMW) DNA which is

reduced in apoptotic cells. The underlying principle of

these methods is that DNA, which has undergone


extensive double-stranded fragmentation (LMW

DNA) may easily be separated from very large,

chromosomal length DNA (HMW DNA), e.g., by

centrifugation and filtration.

For the quantification of DNA fragmentation, most

methods involve a step in which the DNA of the cells

has to be labeled: Prior to the addition of the cell

death-inducing agent or of the effector cells, the

(target) cells are incubated either with the [3H]thymidine

([3H]-dT) isotope or the nucleotide analog

5-bromo-2’-deoxyuridine (BrdU). During DNA

synthesis (DNA replication) these modified

nucleotides are incorporated into the genomic DNA.

Subsequently, those labeled cells are incubated with

cell death-inducing agents or effector cells and the

labeled DNA is either fragmented or retained in the

cell nucleus.

Further, researchers discovered that proteases were

involved in the early stages of apoptosis. The

appearance of these caspases sets off a cascade of

events that disable a multitude of cell functions.

Caspase activation can be analyzed in different ways:

- By an in vitro enzyme assay. Activity of a

specific caspase, for instance caspase 3, can be

determined in cellular lysates by capturing of

the caspase and measuring proteolytic cleavage

of a suitable substrate (Sgonc et al., 1994).

- By detection of cleavage of an in vivo caspase

substrate. For instance caspase 3 is activated

during early stages. Its substrate PARP (Poly-

ADP-Ribose-Polymerase) and the cleaved

fragments can be detected with the anti PARP

antibody.

TUNEL assay

Extensive DNA degradation is a characteristic event

which often occurs in the early stages of apoptosis.

Cleavage of the DNA may yield double-stranded,

LMW DNA fragments (mono- and oligonucleosomes)

as well as single strand breaks (“nicks”) in HMW-

DNA. Those DNA strand breaks can be detected by

enzymatic labeling of the free 3’-OH termini with

modified nucleotides (X-dUTP, X = biotin, DIG or

fluorescein). Suitable labeling enzymes include DNA

polymerase (nick translation) and terminal

deoxynucleotidyl transferase (end labeling).

DNA polymerase I catalyzes the template

dependent addition of nucleotides when one strand of

Apoptosis in plants 19

a double-stranded DNA molecule is nicked.

Theoretically, this reaction (In Situ Nick Translation,

ISNT) should detect not only apoptotic DNA, but also

the random fragmentation of DNA by multiple

endonucleases occurring in cellular necrosis. Terminal

deoxynucleotidyl transferases (TdT) is able to label

blunt ends of doublestranded DNA breaks independent

of a template. The end-labeling method has also been

termed TUNEL (TdT-mediated XdUTP nick end

labeling). The TUNEL method is more sensitive and

faster than the ISNT method. In addition, in early

stages cells undergoing apoptosis were preferentially

labeled by the TUNEL reaction, whereas necrotic cells

were identified by ISNT. Thus, experiments suggest

the TUNEL reaction is more specific for apoptosis and

the combined use of the TUNEL and nick translation

techniques may be helpful to differentiate cellular

apoptosis and necrosis (Gold et al., 1994).

To allow exogenous enzymes to enter the cell, the

plasma membrane has to be permeabilized prior to the

enzymatic reaction. To avoid loss of LMW DNA from

the permeabilized cells, the cells have to be fixed with

formaldehyde or glutaraldehyde before

permeabilization. This fixation crosslinks LMW DNA

to other cellular constituents and precludes its

extraction during the permeabilization step. If free 3’

ends in DNA are labeled with biotin- dUTP or DIGdUTP,

the incorporated nucleotides may be detected in

a second incubation step with (strept)avidin or an anti-

DIG antibody. The immunocomplex is easily visible if

the (strept)avidin or an anti- DIG antibody is

conjugated with a reporter molecule (e.g., fluorescein,

AP, POD). In contrast, the use of fluorescein-dUTP to

label the DNA strand breaks allows the detection of

the incorporated nucleotides directly with a

fluorescence microscope or a flow cytometer. Direct

labeling with fluorescein-dUTP offers several other

advantages. Direct labeling produces less nonspecific

background with sensitivity equal to indirect labeling

and, thus, is as powerful as the indirect method in

detecting apoptosis. Furthermore, the fluorescence

may be converted into a colorimetric signal if an antifluorescein

antibody conjugated with a reporter

enzyme is added to the sample.

Annexin V usage in plant PCD determination

(Membran alteration)

It has been shown that a number of changes in the cell


20 Narcin Palavan-Unsal et al.

surface (membrane) markers occur during apoptosis,

and any one of which may signal “remove now” to the

phagocytes in the animal system. These membrane

changes include:

- Loss of terminal sialic acid residues from the

side chains of cell surface glycoproteins,

exposing new sugar residues.

- Emergence of surface

- Loss of asymmetry in cell membrane

phospholipids, altering both the hydrophobicity

and charge of the membrane surface

In theory, any of these membrane changes could

provide an assay for apoptotic cells. In fact, one of

them has the alteration in phospholipid distribution. In

normal cells, the distribution of phospholipids is

asymmetric, with the inner membrane containing

anionic phospholipids (such as phosphatidylserine)

and the outer membrane having mostly neutral

phospholipids. In apoptotic cells, however, the amount

of phosphatidylserine (PS) on the outer surface of the

membrane increases, exposing PS to the surrounding

liquid. Annexin V, a calcium-dependent phospholipidbinding

protein, has a high affinity for PS. Although it

will not bind to normal living cells, Annexin V will

bind to the PS exposed on the surface of apoptotic

cells. Thus, Annexin V has proved suitable for

detecting apoptotic in animal system. There are many

studies which use conjugated Annexin V for plant

early PCD detection (O’Brien et al., 1997).

When we compare the flow cytometry techniques,

propidum iodide (PI) is the most common dye to

detect apoptosis with cell cycle status in one cell. The

PI, which can only enter into, the nucleus of dead cells

and intercalate with nuclear DNA, resulting in red

fluorescence under ultraviolet light. It also intercalates

into the major groove of double-stranded DNA and

produces a highly fluorescent adducts that can be

excited at 488 nm with a broad emission centred

around 600 nm. Since PI can also bind to doublestranded

RNA, it is necessary to treat the cells with

RNase for optimal DNA resolution. The excitation of

PI at 488 nm facilitates its use on the benchtop

cytometers [PI can also be excited in the U.V. (351-

364 nm line from the argon laser) which should be

considered when performing multicolour analysis on

the multibeam cell sorters]. Hoechst33342 (HO342) is

another DNA fluorochrome which can enter into both

live and dead cells (Darzynkiewicz et al., 1992).

Other flow cytometric based methods include the

TUNEL assay, which measures DNA strand breaks

and Annexin V binding, which detects relocation of

membrane phosphatidyl serine from the intracellular

surface to the extracellular surface. More recently, one

mechanism, which has consistently been implicated in

apoptosis, is CASPASE activity (cysteine proteases),

typically caspase-3, which can be detected using

fluorogenic substrates.

Although there are many choices to determine

PCD in plants, still there are some unknowns for plant

PCD approaches. Well-determined animal system is

key way to understand plant PCD but researchers need

to investigate details about molecular basis of PCD.

Therefore, new genomic and proteomic techniques to

understand this question are remarkable. 2D gel

electrophoresis or Yeast 2 hybrid techniques especially

try to find other related proteins that are still unknown.

Microarray technology is another new approach to

understand gene expressions in different conditions.

We believe that in a short time, new molecules which

identify different stages of cell death will be clarified

and begin to use for determination.

References

Bayly AC, Roberts RA and Dive C. Mechanism of

apoptosis. In: Advences in Molecular and Cell Biology,

Vol 20, Mechanism of Cell Toxicity. Bittar EE and

Chipman JK (eds), Jain Press, Greenwich. 183-229,

1997.

Beers EP and Freeman TB. Proteinase activity during

tracheary element differentiation in zinnia mesophyll

cultures. Plant Physiol. 113: 873-880, 1997.

Bell PR. Megaspore abortion: a consequence of selective

apoptosis? Int. J. Plant Sci. 157: 1-7, 1996.

Blank A and McKeon T.A. Sinlge-strand-preferring nuclease

activity in wheat leaves is increased in senescence and is

negatively photoregulated. Proc. Natl Acad. Sci. USA,

86: 3169-3173, 1989.

Bozhkov PV, Filonova LH, Suarez MF, Helmersson A,

Smertenko AP, Zhivotovsky B and von Arnold S.

VEIDase is a principal caspase-like activity involved in

plant programmed cell death and essential for embryonic

pattern formation. Cell Death and Differatiation. 11:

175-182, 2004.

Brown PH and Ho TD. Biochemical properties and

hormonal regulation of barley nuclease. Eur J. Biochem.

168: 357-364, 1987.

Danon A, Delorme VG, Mailhac N and Gallois P. Plant

programmed cell death: A common way to die. Plant

Physiology and Biochemistry. 38: 647–655, 2000.


Darzynkiewicz Z, Bruno S, DelBino G, Gorczyca W, Hotz

MA, Lassota P and Targanos F. Features of apoptotic

cells measured by flow cytometry. Cytometry. 13: 795-

808, 1992.

Delaney TP, Uknes S, Vernooij B, Friedrich L, Weymann K,

Negrotto D, Gaffney T, Gutrella M, Kessmann H, Ward

E and Ryals J. A central role of salicylic acid in plantdisease

resistance. Science. 266: 1247-1250, 1994.

Depreatere V and Golstein P. Dismantling in cell death:

Molecular mechanisms and relationship to caspase

activation. Scand. J. Immunol. 47: 523-531, 1998.

Dixon RA, Harisson MJ and Lamb CJ. Early events in the

activation of plant defense responses. Annu. Rev.

Phytopathol. 32: 479-501, 1994.

Dong YH, Zhan XC, Kvarnheden A, Atkinson RG, Morris

BA and Gardner RC. Expression of a cDNA from apple

encoding a homologue of DAD1, an inhbitor of

programmed cell death. Plant. Sci. 139: 165-174, 1998.

Dorey S, Baillieul F, Pierrel MA, Saindrenan P, Friting B

and Kauffmann S. Spatial and temporal induction of cell

death, defense genes, and accumilation of salicylic acid

in tobacco leaves reacting hypersensitively to a fungal

glycoprotein elicitor. Mol. Plant-Microbe Interact.

10:646-655, 1997.

Earnshaw WC. Nuclear changes in apoptosis. Curr. Opin.

Cell Biol. 7: 337-343, 1995.

Ellis RE and Horvitz RH. Genetic control of programmed

cell death in the nematode C. Elegans. Cell. 44: 817-829,

1986.

Evans DE. Programmed cell death in response to abiotic

stress. In Programmed Cell Death In Plants, John G

(Eds), Blackwell Publishing, UK. 194-210, 2004.

Fath A, Bethke P, Lonsdale J, Meza-Romero R and Jones R.

Programmed cell death in cereal aleurone. Plant Mol.

Biol. 44: 255-266, 2000.

Fukuda H, and Komamine A. Establishment of an

experimental system for tracheary element

differentiation from single cells isolated from meshopyll

of Zinnia elegans. Plant Physiol. 65:57-60, 1980a.

Fukuda H, and Komamine A. Direct evidence for

cytodifferantiation to tracheary elements without

intervening mitosis in a culture of single cells isolated

from meshopyll of Zinnia elegans. Plant Physiol. 65:61-

64, 1980b.

Fukuda H. Xylogenesis: Initiation, progression and cell

death. Annu. Rev. Plant Physiol. Plant Mol. Biol. 47:

299-325, 1996.

Fukuda H. Programmed cell death of tracheary elements as

a paradigm in plants. Plant Mol. Biol. 44: 245-253, 2000.

Gavrieli Y, Sherman Y and Ben-Sasson SA. Identification of

programmed cell death in situ via specific labelling of

nuclear DNA fragmentation. J. Cell Biol. 119: 493–501,

1992.

Gold R, Schmied M, Giegerich G, Breitschopf H, Hartung

HP, Toyka KV and Lassmann H. Differentiation between

Apoptosis in plants 21

cellular apoptosis and necrosis by the combined use of in

situ tailing and nick translation techniques. Lab. Invest.

71: 219, 1994.

Goodman RN and Novacky AJ. The hypersensitive response

reaction in plants to pathogens, a resistance

phenomenon. St. Paul, Minnesota, American

Phytopathological Society Press. 1994.

Gorczyca W, Gong J and Darzynkiewicz Z. Detection of

DNA strand breaks in individual apoptotic cells by the in

situ terminal deoxynucleotidyl transferase and nick

translation assays. Cancer Res. 53: 1945–1951, 1993.

Greenberg JT. Programmed cell death: a way of life for

plants. Proc. Natl. Acad. Sci. USA. 93:12094-12097,

1996.

Greenberg JT. Programmed cell death in plant-pathogen

interactions. Ann. Rev. Plant Physiol. Plant Mol. Biol.

48: 525-545, 1997.

Groover A, DeWitt N, Heidel A and Jones A. Programmed

cell death of plant tracheary elements differentiating in

vitro. Protoplasma. 196: 197-211, 1997.

Gunawardena A, Pearce DME, Jackson MB, Hawes CR and

Evans DE. Rapid changes in cell wall pectic

polysaccharides are closely associated with early stages

of aerenchyma formation, a spatial localized form of

programmed cell death in roots of maize (Zea mays L.)

promoted by ethylene. Plant Cell Environ. 24: 1369-

1375, 2001.

Hajouj T, Michelis R and Gepstein S. Clonning and

characterization of a receptor-like protein kinase gene

associated with senescence. Plant Physiol. 124(3): 1305-

1314, 2000.

Hancock JT, Desikan R and Neill SJ. Does the redox status

of cytochrome c act as a fail-safe mechanism in the

regulation of programmed cell death? Free Radic. Biol

Med. 31: 697-703, 2001.

He SY, Bauer DW, Collmer A and Beer SV. Hypersensitive

response elicid by Erwinia amylovora harpin requires

active plant methabolism. Mol. Plant Micro Inter. 7:

289-292, 1994.

Hensel LL, Grbic V, Baumgarten DA and Bleecker AB.

Developmental and age-related processes that influence

the longevity and senescence of photosynthetic tissues in

arabidopsis. Plant Cell. 5(5): 553-64, 1993.

Jackson MB, Fenning TM, Drew MC and Saker LR.

Stimulation of ethylene production and gas-space

(aerechyma) formation in adventitious roots of Zea mays

L. by small partial pressures of oxygen. Planta. 165:

486-492, 1985.

Jones AM and Dangl JL. Logjam at Styx: programmed cell

death in plants. Trends Plant Sci. 1: 114-119, 1996.

Justin S and Armstrong W. The anatomical characteristics of

roots and plant responses to soil flooding. New Phytol.

105: 465-495, 1987.

Kao TH and McCubbin AG. How flowering plants

discriminate between self and non-self pollen to prevent


22 Narcin Palavan-Unsal et al.

inbreeding. Proc. Nat Acad. Sci. USA. 93: 12059–12065,

1996.

Kaplan DR. Alternative modes of organogenesis in higher

plants. In: Contemporary problems in plant anatomy.

White RA and Dickson WC (eds): Academic Press, 261-

300, 1984.

Katsuhara M and Kawasaki T. Salt stress induced nuclear

and DNA degradation in meristematic cells of barley

roots. Plant Cell Physiol. 37: 169–173, 1996.

Klessig DF, Durner J, Noad R, Navarre DA, Wendehenne D,

Kumar D, Zhou J, Shah J, Zhang S, Kachroo P, Trifa Y,

Pontier D, Lam E and Silva H. Nitric oxide and salicylic

acid signaling in plant defense. Proc. Natl. Acad. Sci.

U.S.A. 97: 8849-8855, 2000.

Korsmeyer SJ. Regulation of cell death. Trends Genet. 11:

101-105, 1995.

Koukalova B, Kovarik A, Fajkus J and Siroky J. Chromatin

fragmentation associated with apoptotic changes in

tobacco cells exposed to cold stress. FEBS Lett. 414:

289–292, 1997.

Kressel M and Groscurth P. Distinction of apoptotic and

necrotic cell death by in situ labelling of fragmented

DNA. Cell and Tissue Research. 278: 549–556, 1994.

Kroemer G, Dallaporta B and Resche-Rigon M. The

mitochondrial death/life regulator in apoptosis and

necrosis. Ann. Rev. Physiol. 60: 619-642, 1998.

Lai V and Srivastava LM. Nuclear changes during

differentiation of xylem vessel elements. Cytobiologie.

12: 220-243, 1976.

Lohman KN, Gan S, John MC and Amasino RM. Molecular

analysis of natural leaf senescence in Arabidopsis

thaliana. Physiol Plant. 92: 322-328, 1994.

McConkey DJ and Orrenius S. Signal transduction pathways

to apoptosis. Trends Cell Biol. 4: 370-375, 1994.

Minami A and Fukuda H. Transient and specific expression

of a cysteine endopeptidase associated with autolysis

during differantiation of Zinnia mesophyll cells into

tracheary elements. Plant Cell Physiol. 36: 1599-1606,

1995.

Mittler R and Lam E. Sacrifice in the face of foes: Pathogeninduced

programmed cell death in higher plants. Trends

Microbiol. 4: 10-15, 1996.

Navarre DA and Wolpert TJ. Victorin induction of an

apoptotic/senescence–like response in oats. Plant Cell.

11: 237-249, 1999.

Noodén LD and Guiamét JJ. Genetic control of senescence

and aging in plants. In: Handbook of the biology of

aging. Academicpress. 94-118, 1996.

Noodén LD. Phenomena of senescence and aging. In:

Senecence and Aging in plants. Noodén LD and Leopold

AC (eds). Academic Press, San Diego. 2-50, 1988.

Obara K and Fukuda H. Programmed cell death in xylem

differentiation. In: Programmed cell death in plants. J.

Gray (eds.), Sheffield Academic Press, Sheffield. 131-

154, 2003.

Obara K, Kuriyama H and Fukuda H. Direct evidence of

active and rapid nuclear degradation triggered by

vacuole rupture during programmed cell death in Zinnia.

Plant Physiol. 125: 615-626, 2001.

Oberhammer F, Hochegger K, Froschl G, Tiefenbacher R

and Pavelka M. Chromatin condensation during

apoptosis is accompanied by degradation of lamin A+B,

without enhanced activation of cdc2 kinase. J. Cell Biol.

126: 827-837, 1993.

O'Brien IEW, Reutelingsperger CPM and Holdaway KM.

Annexin-V and TUNEL use in monitoring the

progression of apoptosis in plants. Cytometry. 29: 28-33,

1997.

O'Brien, IEW, Baguley BC, Murray BG, Morris BAM and

Ferguson IB. Early stages of the apoptotic pathway in

plant cells are reversible. Plant J. 13: 803-814, 1998.

Orzaez D and Granell A. DNA fragmentation is regulated by

ethylene during carpel senescence in Pisum sativum.

Plant J. 11:137-144, 1997a.

Orzaez D and Granell A. The plant homologue of the

defendeer against apoptotic death gene is downregulated

during senescence of flower petals. FEBS Lett.

404: 275-278, 1997b.

Paddenberg R, Wulf S, Weber A, Heimann P, Beck LA and

Mannherz HG. Internucleosomal DNA fragmentation in

cultured cells under conditions reported to induce

apoptosis may be caused by mycoplasma endonucleases.

Eur. J. Cell Biol. 71: 105–119, 1996.

Piffanelli P, Devoto A and Schulze-Lefert P. Defense

signaling pathway in cereals. Curr. Opin. Plant Biol. 2:

295-300, 1999.

Raff MC. Social control on cell survival and cell death.

Nature. 356: 397-400, 1992.

Robatzek S and Somssich IE. Targets of At WRKY6

regulation during plant senescence and pathogen

defense. Genes Dev. 16 (9): 1139-1149, 2002.

Rouet-Mayer MA, Bureau JM. and Lauriere C.

Identification and characterization of lipoxygenase

isoforms in senescing carnation petals. Plant Physiol.

98: 971–978,1992.

Schussler EE and Longstreth DJ. Aerenchyma develops by

cells lysis in roots and cell seperation in leaf petioles in

Sagittaria lancifolia (Alismataceae). Am. J. Bot.

83:1266-1273, 1996.

Schussler EE and Longstreth DJ. Changes in cell structure

during the formation of root aerechyma in Sagittaria

lancifolia (Alismataceae). Am. J. Bot. 87:12-19, 2000.

Schwartzman, RA and Cidlowski JA. Apoptosis: the

biochemistry and molecular biology of programmed cell

death. Endocrine Revs. 14: 133-151, 1993.

Sgonc R, Boeck G, Dietrich H, Gruber J, Recheis H and

Wick G. Simultaneous determination of cell surface

antigens and apoptosis. Trends Genet. 10: 41-42, 1994.

Shirasu K, Nakajima H, Rajasekhar VK, Dixon RA and

Lamb C. Salicylic acid potentiates an agonist-dependent


gain control that amplifies pathogen signals in the

activation of defense mechanisms. Plant Cell. 9: 261-

270, 1997.

Stein JC and Hansen G. Mannose induces an endonuclease

responsible for DNA laddering in plant cells. Plant

Physiol. 121: 71–80, 1999.

Stone JM, Heard JE, Asai T and Ausubel FM. Stimulation of

fungal-mediated cell death by fumonisin B1 and

selection of fumonisin B1-resistant (fbr) Arabidopsis

mutants. Plant Cell. 12:1811-1822, 2000.

Studzinski GP. Overview of apoptosis. In: Apoptosis A

Practical Approach. Studzinski GP (eds), Oxford

University Press, New York. 1-17, 1999.

Thelen MP and Northcote DH. Identification and

purification of a nuclease from Zinnia elegans L. a

potential marker for xylogenesis. Planta. 179: 181-195,

1989.

Uren AG, O’Rourke K, Aravind L, Pisabarro MT, Seshagiri

Si Koonin EV and Dixit VM. Identification of

paracaspases and metacaspases: two ancient families of

caspase-like proteins, one of which plays a key role in

MALT lymphoma. Mol. Cell. 6: 961-967, 2000.

Vaux DL. Toward an understanding of the molecular

mechanisms of physiological cell death. Proc. Natl.

Acad. Sci. USA. 90: 786–789, 1993.

Vaux DL and Korsmeyer SJ. Cell death in development.

Cell. 96: 245–254, 1999.

Wang H, Li J, Bostock RM and Gilchrist DG. Apoptosis: a

functional paradigm for programmed plant cell death

induced by a host-selective phytotoxin and invoked

during development. Plant Cell. 8: 375-391, 1996.

Willie AH. Cell death. In: Apoptosis and cell proliferation.

2 nd edition. Boehringer, Mannheim. VI-VII, 1998.

Wyllie AH. Glucocorticoid-induced thymocyte apoptosis is

associated with endogenous endonuclease activation.

Nature. 284: 555-556, 1980.

Yamamato R, Fujioka S, Demura T, Takatsuto S, Yoshida S

and Fukuda H. Brassinostreoid levels increase

drastically prior to morphogenesis of tracheary

elements. Plant Physiol. 125: 556-563, 2001.

Yang SH, Berberich T, Sano H and Kusaano T. Specific

assotiation of transcripts of tbzF and tbz17, tomacco

genes encoding basic region lucine zipper-type

transcriptional activators, with guard cells of senecing

leaves and/or flowers. Plant Physiol. 127: 23-32, 2001.

Yen C and Yang C. Evidence for programmed cell death

during leaf senescence in plants. Plant Cell Physiol.

39:922-927, 1998.

Zentgraf U and Kolb D. Analysis of differential gene

expression during leaf senescence using Arabidopsis

high density genome arrays. 13 Conress FESPP, 2002.

Apoptosis in plants 23


Introduction

Journal of Cell and Molecular Biology 4: 25-29, 2005.

Haliç University, Printed in Turkey.

Effects of captopril, an angiotensin converting enzyme inhibitor on

TAME-esterase induced contractions in rat aorta strips iinn vviittrroo.

Anwar Hussein Subratty* and Fawzia B.H.Gunny.

Department of Health and Medical Sciences, Faculty of Science, University of Mauritius, Reduit,

Mauritius, (* author for correspondence)

Abstract

The in-vitro effects of Captopril an angiotensin converting enzyme inhibitor were studied on TAME-esterase, a

component of the Kinin-Kallikrein system, induced contractions on rat aorta strips. Our results showed that

contractile responses induced by TAME (EC 50 6 x 10 -14 M) were significantly attenuated when the aorta strips were

pre-incubated with 1M Captopril (EC 50 1.8 x10 -10 M). Based on our data we concluded that TAME-esterase induced

contractions involve degradation of kinins by kinases.

KKeeyy WWoorrddss:: Kinin, Kallikrein, ACE inhibitor, TAME, aorta.

IInn vviittrroo koflullarda s›çan aort striplerinde angiotensini dönüfltüren enzim inhibitörü

kaptoprilin, TAME-esterazin uyard›¤› kas›lmalara etkileri

Özet

Angiotensini dönüfltüren enzim inhibitörü kaptoprilin in vitro etkileri s›çan aort striplerinin kas›lmas›n› uyaran kininkallikrein

sistemi komponenti olan TAME-esterazda araflt›r›ld›. Sonuçlar›m›z, aort stripleri önceden1M (EC50 1-8 x

10-10m) kaptopril ile inhibe edildi¤i zaman, TAME (EC50 6 x 10-14m) taraf›ndan uyar›lan kas›lma cevaplar›n›n

kayda de¤er bir flekilde azald›¤›n› gösterdi. Verilerimize dayanarak, TAME-esteraz›n uyard›¤›, kas›lman›n kinazlar

taraf›ndan kininlerin y›k›lmas› ile ilgili oldu¤u sonucuna var›ld›.

AAnnaahhttaarr ssöözzccüükklleerr:: Kinin, Kallikrein, ACE inhibitör, TAME, aort

Angiotensin-converting enzyme (ACE) inhibitors

possess anti-ischaemic effects and are used in the

treatment of heart failure (Linz W et al., 1992). It has

been reported that an increase in the generation of

angiotensin II and a decrease in the accumulation of

kinins in tissues that result from an increase in ACE

will have detrimental consequences (Vanhoutte PM et

al., 1993). The latter, however, may be alleviated

during therapy with ACE inhibitors. For example,

kinins mediate the anti-ischaemic actions of

nonsulphurhydryl ACE inhibitors in animal models

(Linz W et al., 1992). Actually during myocardial

ischaemia there is an increase in kinin generation in

the coronary circulation (Hashimoto K, et al., 1978)

Kinins are peptide hormones that are formed as

part of the kinin-kallikrein system (KKS). They were

discovered in 1909 when Abelous reported an acute

fall in blood pressure induced by experimental

injection of urine. Later Frey & Werle discovered that

a high molecular weight, thermolabile constituent was

responsible for this effect. Kallikreins were later

identified as proteases that could cleave off human

25


26 Anwar H. Subratty and Fawzia B. H. Gunny

nonapeptide bradykinin and the human decapeptide

kallidin from the larger kininogen precursors. Kinins

play a significant role as mediators of inflammation,

for example, by provoking pain and oedema

(Scholkens, 1996). Nevertheless, because of their

vasodilatory effects, they have always been suspected

to be involved in cardiovascular regulation as well.

The diuretic and natriuretic effect of kinins in

particular suggests that the renally produced

kallikreins may be significant for the regulation of

blood pressure (Bhoola et al., 1992).

The endothelium controls vascular smooth muscle

tone by secreting relaxing and contracting factors in

response to shear stress and several vasoactive

substances (Furchgott et al., 1980, De Mery et al.,

1990). Kininogens, the precursors of kinins, are

present in the plasma, but can also be produced by

endothelial and vascular smooth muscles (Schmaier et

al. 1988, Figuera et al., 1992). A variety of

kininogenases exist in the blood and in the vascular

tissues with the important varieties being plasma and

tissue kallikreins (Andreas et al., 1999). Plasma

kallikreins is activated by Hageman factor and is

regulated by circulating serine protease inhibitors

(Bhoola et al., 1992). They are secreted as

proenzymes and are activated by proteases in the

submaxillary gland and in the kidney. Certain serine

protease inhibitors also inhibit tissue kallikrein. In

addition to the generation of kinins, tissue kallikreins

may also process other hormones and enzymes

involved in the vascular tone (Bhoola et al., 1992)

N-α-tosyl L-arginine methyl ester [TAME]esterase

has been demonstrated to be an enzyme which

is involved during the sequence of events leading to

the activation of the kinin-kallikrein system (Subratty

& Moonsamy, 1998). Furthermore, we have

previously reported that TAME-esterase induced

contraction in toad ileal strips in-vitro is mediated via

a nitric oxide-citric GMP pathway (Subratty &

Hossany, 1999). Thus our results tend to show that

TAME-esterase activity has a significant contribution

during contraction of smooth muscles in-vitro.

Reports from the literature also describe the major

contribution of ACE in the termination of the action of

bradykinin relative to the other inactivation processes

(including carboxypeptidases and internalization) that

determine the degree of potentiation of the response to

kinins observed with ACE inhibitors. The present

study was undertaken to further elucidate the role of

TAME-esterase as a component of the KKS system

since ACE inhibitors can prevent both the activation of

angiotensin I to angiotensin II and the cleavage of

kinins to inactive fragments. Furthermore, kinins are

hydrolysed by a variety of intracellular and

extracellular petidyl peptideases and ACE is a major

kininase at the surface of endothelial cells.

Materials and methods

Preparation of arterial rings.

Adult male Sprague-Dawley rats weighing between

50-100 g were killed by a severe blow to the head.

From these animals the aorta was carefully dissected,

applying minimal traction to avoid stretching and

taking care not to subject the intima to rubbing either

with instruments or upon itself. After dissection, the

aorta was quickly immersed in a petri dish containing

20 ml of Krebs-Henseleit solution. To prevent blood

clot formation in the dissected aorta, 2 ml of Heparin

(5,000 IU/L) was added to the buffer in the petri dish.

The buffer was maintained at 37 0 C in the organ bath

by a thermostated circulating water bath. All salts

were dissolved in distilled water and the final volume

made up to 1 litre.

Strips of the isolated aorta were prepared and

mounted in-vitro as previously described by Subratty

& Hossany (1999). In brief, before mounting the aorta

strip, the organ bath was filled with 25 ml of Krebs-

Henseleit solution at room temperature. Two stainless

steel hooks were inserted into the lumen of the aorta

strip. This strip was then held horizontally in the organ

bath. One hook was pinned to a fixed point in the

apparatus and the other one was connected to a forcedisplacement

transducer (Model LB-5, Showa Shokki,

Japan) of the apparatus. The transducer was plugged in

a multipen recorder (Rikadenki Model R50; Japan)

capable of recording isometric contractile responses

on a rolling chart. The system was switched on and the

resting tension was adjusted to 1.5g. The strip was first

allowed to equilibrate in the buffer for at least 15

minutes until a baseline tone was achieved.

Bathing solution and drugs.

The bathing solution was Krebs-Henseleit solution of

the following composition (mM): NaCl 118; KCl 4.7;


CaCl 2.H 2O 2.5, MgSO 4.7H 2O; KH 2PO 4 25; Na 2EDTA

9.7 mg/l). Glucose (2g/l) was added to the buffer just

before use and gassed with a 95 % O 2 and 5 % CO 2

mixture, resulting in a pH of 7.45. The buffer was

maintained at 37 0 C in the organ bath by a thermostat

circulating water bath.

Drugs used in this study were N-α-tosyl L-arginine

methyl ester [TAME] and Captopril. All drugs were

prepared as aqueous solutions. A 10 -3 M stock solution

of TAME was prepared by dissolving 0.0038g of

TAME in 10 ml of distilled water. Aliquots of this

stock solution were used to make serial dilutions

ranging from 10 -3 to 10 -17 M respectively. Twelve aorta

strips from 12 rats were used in this series of

experiments. Each strip was challenged with 100 µL

of TAME, beginning with the lowest dilution (10 -17 M).

The procedure was repeated with in order of

increasing concentration to establish a cumulative

dose-response curve after stabilization of the strip

following any contractile responses or after 3 minutes

in case of no observed changes. The final

concentration in the bath was 10 -3 M.

In addition to TAME, the effects of different

concentrations of Captopril, an Angiotensin

Converting Enzyme (ACE) inhibitor were also studied

on rat aorta strips. Aorta strips were pre-incubated

with 500 µl of the respective dilution of the ACE

inhibitor. Each concentration was studied separately

on seven strips.

Control experiments

In each series of experiments, a parallel control strip

was included and challenged with 100 µL of distilled

water added at 3 minutes interval.

Statistics

All data manipulation and statistical analyses were

performed using Excel software. Means and standard

errors were calculated. Statistical differences were

assessed using unpaired Student’s t-test. Differences

were considered as significant for p < 0.05.

Results

EC 50 values for each drug used on the rat aorta strips

were determined form cumulative concentration

curves (Figure 1). Our results (Table 1) showed that

TAME-esterase induced contractions were

significantly inhibited (p < 0.05) when rat aorta strips

were pre-incubated with 1.0 M of the ACE inhibitor

(Captopril). However non-significant inhibition of

contractile responses was noted when the 0.01 & 0.2

M pre-incubated strips were challenged with the

various dilutions of TAME (p>0.05). Figure 2 shows

typical tracings of contractile responses obtained from

the experiments performed.

Discussion

Captopril effects on contractions 27

Table 1: Mean EC 50 values for effects of TAME on rat aorta strips pre-incubated with or without Captopril.

Drugs Mean EC50 (M) P values

TAME (10 -17 -10 -3 M) 6.0 x 10 -14

Captopril (0.01 M) > 0.05

+ 1.8 x 10 -12

TAME (10 -17 -10 -3 M)

Captopril (0.2 M) > 0.05

+ 2.4 x10 -11

TAME (10 -17 -10 -3 M)

Captopril (1.0 M) < 0.05

+ 1.8 x10 -10

TAME (10 -17 -10 -3 M)

The sequence of events leading to contraction of

airway (Subratty et al., 1994) and non-airway smooth

muscles have previously reported elsewhere (Subratty

& Moonsamy, 1998). It is well known that kinins have

vasorelaxation properties. The present study tend to


28 Anwar H. Subratty and Fawzia B. H. Gunny

Figure 1: Cumulative dose response curve showing effects

of ACE inhibitor, captopril (1M) on TAME-induced

contractions on rat aorta.

Figure 2: Tracing showing effects of captopril 0.01 M on

TAME-induced contractions on rat aorta in vitro.

show that contractile responses induced by TAMEesterase

could be the result of degradation of kinins by

kininase. The latter hypothesis is confirmed from

experiments using the ACE inhibitor. Findings from

these experiments have shown that when strips were

pre-incubated with Captopril (1M), there was a

definite significant inhibition of the contractile

responses previously seen with TAME alone.

Based on our findings we thus postulate the

following mechanism for TAME-esterase induced

contractions. During the conversion of high molecular

weight kininogens to kinins in the presence of

kallikreins whereby TAME-esterase is a zymogen,

bradykinin which is released is degraded by a kininase

(kininase II). In the presence of a sufficient dose of a

kininase II inhibitor, namely Captopril, the contractile

effects of the kininase is substantially attenuated to the

extent that no significant contractions were observed.

As mentioned earlier, we have already reported

two different mechanisms by which TAME-esterase

induce contraction in-vitro. Through the present study,

we are describing a third pharmacological pathway

showing that TAME-esterase induced contractions

involve degradation of kinins by kininase.

We conclude that TAME-esterase induced

contractions can be prevented by the use of ACE

inhibitors. However the role of TAME-esterase in

hypertension remains to be established.

Acknowledgement

We are grateful to the Tertiary Education Commission

of Mauritius and the University of Mauritius for

financial support.

References

Bhoola DK, Figueroa CD and Worthy K. Bioregulation of

Kinins, Kallikrein Kininoges and Kinases. Pharmacol.

Rev. 44: 1-80, 1992.

Andreas DA, Wolfrum S and Dominiak A. Pharmaocology

and cardiovascular Implications of the Kinin-Kallikrein

System. Jpn. J.Pharmacol. 79: 403-426, 1999.

DeMery JG, Vanhoutte PM. The Endothelium: Modulator of

cardiovascular Function. Boca Raton: CRC Inc, 1990.

Figuera CD, Gonzales CB, Muller-Esterl W and Bhoola KD.

Cellular Localization of Human Kininogens. Agents

Actions. 38(1): 617-626, 1992.

Furchgott RF and Zawadzki JV. The Obligatory Role of

Endothelial Cells in the relaxations of the arterial

Smooth Muscle by Acetylcholine. Nature. 286: 373-376,

1980.

Hashimoto K, Hamamoto H, Honda Y, Hirose M, Furukawa

S and Kimura E. Changes in Components of Kinin

System and Hemodynamics in Acute Myocardial

Infarction. Am. Heart J. 95: 619-626, 1978.

Linz W and Scholkens B. Role of Bradykinin in the Cardiac

Effects of Angiotensin- Converting enzyme Inhibitors.

J. Cardiovasc. Pharmacol. 20(9): S 83-90, 1992.

Scholkens BA. Kinins in the cardiovascular system.

Immunopharmacol. 33: 209-216, 1996.

Schmaier AH, Kuo A, Lundberg D, Murray S and Clines

DB. The Expression of High Molecular Weight

Kininogen in Human Umbilical Vein Endothelial Cells.

J. Biol. Chem. 263: 16327-16333, 1988.

Subratty AH and Hossany R. Does TAME induced

contraction involve an endothelium nitric oxide-cyclic

GMP mediated pathway? Indian. J. Exp. Biol. 37: 406-


408, 1999.

Subratty AH, Lee Kwai Yan MY and Kok Shun LH.

TAME–esterase activity during a prolonged attack of

asthma. Inter. Clin. Pharmacol Ther. 32(11): 598-599,

1999.

Subratty AH and Moonsamy J. Is TAME a potent constrictor

of non-airway smooth muscles? Indian. J. Exp. Biol. 36:

618-621, 1994.

Vanhoutte PM, Boulanger CM, Vidal MJ and Mombouli JV.

Endothelium-Derived Mediators and the Renin

Angiotensin System. In The Renin- Angiotensin System.

Edited by Robertson JIS, Nicholls MG, London. 71:

291, 1993.

Captopril effects on contractions 29


Journal of Cell and Molecular Biology 4: 31-39, 2005.

Haliç University, Printed in Turkey.

Metabolic changes and protein patterns associated with adaptation to

salinity in SSeessaammuumm iinnddiiccuumm cultivars

Hukam S. Gehlot 1 *, Anila Purohit 1 and Narpat S. Shekhawat 2

1Stress Physiology Laboratory, Dept. of Botany, J. N. Vyas University, Jodhpur-342001, India;

2Biotechnology Unit, Department of Botany, JNV University, Jodhpur- 342 001, India (*author for

correspondence)

Abstract

Sesamum indicum is an important oil seed crop of semi-arid regions. Recently released cultivars of S. indicum were

evaluated for their relative tolerance to sodium chloride (NaCl) salt. Salinity induced alterations in electrophoretic

patterns of proteins and other metabolites were recorded in seeds germinated and grown in presence of different

concentrations of sodium chloride (0, 30, 50 and 70mM). Seedling growth was retarded in cv. RT-125 in presence of

NaCl more than 30mM concentration. Control seedlings of cv. RT-46, RT-54 and RT-127 showed higher levels of

total soluble sugars and sucrose as compared to cv. RT-125. Proline contents of control seedlings of cv. RT-127 was

low as compared to other cultivars. Levels of soluble proteins were higher in RT-125 and RT-127 than in RT-46 and

RT-54 under all experimental conditions. However levels of sugars were higher in salt-treated cvs.RT-127, RT-46 and

RT-54 as compared to RT-125. Salt sensitive cultivar (RT-125), accumulated higher contents of malondialdehyde

(MDA) and proline as compared to the others. On the other hand salt tolerant cultivars RT-54, RT-46 and RT-127

showed higher activity of superoxide-dismutase (SOD) and low MDA content as compared to RT-125.

KKeeyy wwoorrddss:: Malondialdehyde, superoxide-dismutase, salinity, protein profiles, Sesamum indicum.

SSaasseemmuumm iinnddiiccuumm kültürlerinde tuzlulu¤a adaptasyonla iliflkili protein profilleri ve

metabolik de¤iflmeler

Özet

Sesamum inducum, yar› kurak bölgelerin önemli ya¤l› tohumlu bitkisidir. Son y›llarda, S. indicum kültürlerinin

sodyum klorür (NaCI) tuzuna olan nispi frekanslar› de¤erlendirildi. Proteinlerin ve di¤er metabolitlerin

elektroforetik profillerinde tuzlulu¤un uyard›¤› de¤ifliklikler sodyum klorürün farkl› konsantrasyonlar›nda çimlenen

ve büyüyen tohumlar›nda kaydedildi (0,30, 50 ve 70 mM). NaCI ün 30 mM dan daha yüksek konsantrasyonlarda

cv.RT-125 in fide büyümesi gecikti. Cv. Rt-46, RT-54 ve RT-127 lerin kontrol fideleri, cv. RT-125 ile k›yasland›¤›nda

toplam soluble flekerlerin ve sakkarozun yüksek seviyeleri gözlendi. cv. RT-127 kontrol fidelerinin prolin içerikleri

di¤er kültürlerle karfl›laflt›r›ld›¤›nda düflük bulundu. Soluble protein seviyeleri, tüm deneysel koflullarda RT-125 ve

RT-127 de RT-46 ve RT-54 dekinden daha yüksekti. Bununla beraber flekerlerin düzeyi tuz uygulanm›fl cvs. RT-127,

RT-46 ve RT-54 kültürler RT-125 k›yasland›¤›nda daha fazla bulundu. Tuza duyarl› kültürlerin (RT-125) di¤erlerine

oranla daha fazla malondialdehid (MDA) ve prolin biriktirdikleri belirlendi. Di¤er taraftan tuza toleransl› kültürler

RT-54, RT-46 ve RT-127 kültürleri RT-125 ile k›yasland›¤›nda, yüksek süperoksit-dismutaz (SOD) ve düflük MDA

aktivitesi gözlendi.

AAnnaahhttaarr ssöözzccüükklleerr:: melondialdehid, süperoksit dismutaz, tuzluluk, protein profili, Sesamum indicum.

31


32 Hukam S. Gehlot et al.

Introduction

Plants thriving in desert ecosystem often encounter

stresses that adversely affect growth, development and

yield performance (Boyer, 1982). In western

Rajasthan, salinity constitutes a major abiotic stress. In

arid and semi-arid regions, salinity can severely limit

crop production (Shannon, 1998). High salinity lowers

water potential and induces ionic stress, and results in

a secondary oxidative stress (Lin and Kao, 2000,

Shalata et al., 2001, Hernandez et al., 2000). Salt

tolerance in plants is a complex trait and varies widely

among closely related species and between different

varieties or even individuals within a varietal line

(Ashraf, 2002, Mittova et al., 2002, Sreenivasulu et al.,

2000). Differences between closely related plants are

particularly interesting because it may be possible to

identify a small number of factors responsible for

salinity tolerance. Mostly at the cellular level, plants

cope up with salinity by osmotic adjustment involving

vacuolar sequestration of ions and synthesis of

compatible solutes (also known as osmoprotectants) in

the cytoplasm (Yancey et al., 1982, Garg et al., 2002).

Increased osmoprotectant accumulation may protect

plants against damage, helping maintain protein

structure or scavenge reactive oxygen species besides

maintaining balance in osmotic potential in the cytosol

(Parvanova et al., 2004, Smirnoff and Cumbes, 1989,

Ashraf and Harris, 2004). At molecular level, plants

synthesize set of ‘stress proteins’ that may have

diverse functions such as key enzymes of biosynthetic

pathway of osmolytes or directly act as osmolyte such

as late embryogenesis abundant proteins (El-

Shintinawy and El-Shourbagy, 2001, Özturk et al.,

2002, Ashraf and O’Leary, 1999). These may

contribute detoxification pathway in many forms such

as part of scavenging enzyme, or help in the synthesis

of anti-oxidants (Mittova et al., 2002, Hernandez and

Almansa, 2002, Hernandez et al., 2000). Sesamum

indicum is an important oil seed crop of the world and

its oil possesses high anti-oxidant property, low

cholesterol and high proportion of polyunsaturated

fats (Ashri, 1993). This is also one of the major rainfed

oil-seed crops of semi-arid and arid regions of

Indian subcontinent (Ashri, 1993). However, its

cultivation and productivity face constraints of

stresses including salinity. Recently a number of

cultivars of this crop have been bred and released. The

present investigation was carried out to evaluate

biochemical and molecular bases of adaptability and

relative tolerance of newly released cultivars of

Sesamum indicum to salinity.

Materials and methods

Plant growth

Seeds of four cultivars of Sesamum indicum L. (cv. RT-

46, RT-54, RT-125 and RT-127) were obtained from

Agriculture Research Station, Mandore, Jodhpur

(Rajasthan Agriculture University, Bikaner, India).

These were imbibed and germinated on moist filter

paper in petridishes at 30 0 C ± 2, 20-30 µM m -2 S -1

Spectral Flux Photon (SFP) 16 h/d and 80% RH in a

growth chamber. Five-days-old seedlings were used

for the analyses and studies.

Seedlings were subjected to salt stress by

incubating in 30, 50 and 70 mM NaCl for five days. A

set of seedlings germinated and maintained in distilled

water were kept as control.

Measurement of growth

Growth of root and shoot of randomly selected 10

seedlings were measured. The experiment was

repeated three times. Standard deviation was

calculated.

Protein extraction

Cotyledons were frozen in liquid nitrogen and

homogenized in Zivys buffer (30mM Tris-HCl, 1mM

EDTA) pH 8.5 at 4 0 C (Zivy et al., 1983). The proteins

were precipitated using 8 volumes of chilled aceton

containing 10mM β-mercaptoethanol. Precipitated

proteins were solubilized as per Laemmli (1970).

Proteins were quantified by Bradford’s (1976)

method.

Sodium dodecyl sulphate-polyacrylamide gel

electrophoresis (SDS-PAGE)

Precipitated proteins were mixed in loading buffer

(0.0625M Tris-HCl pH 6.5, 5% DTT, 2% SDS,

0.001% Bromophenol blue, 10% glycerol) and 20

microgram protein was resolved on 10% uniform

linear polyacrylamide gel and stained with silver


nitrate as described by Pareek et al., (1995). Standard

protein markers (Sigma, USA) of 118, 79, 47, 33, and

25 kD each of 2 microgram were loaded in a separate

well. The polypeptides in each well of the gel were

characterized for their molecular weight using Gene

Tool Software with SYNGENE (UK) Gel

Documentation and imaging system.

Western detection

Western detection was carried out as suggested by

Towbin et al., (1979) and Singla and Grover (1994).

Stable proteins were resolved on 10% SDS-PAGE and

electroblotted on to nitrocellulose membrane. Blots

were blocked with blocking buffer (5% non-fat milk

protein dissolved in potassium bisulphite). Later blots

were probed with primary antibodies for 2h at room

temperature with a dilution of 1:25000 (Primary

antibodies were raised against rice Hsp 104). Antigen

and antibodies complex were then detected by antirabbit

horse radish peroxidase linked secondary

antibodies (dilution 1:1000). Subsequently the blots

were washed three times with 0.3% mixture of

potassium bisulphate and tween-20 (PBST) and then

in 0.1% PBST respectively. The blots were then

developed using diaminobenzidine solution

containing 1ml of 1% CoCl 2 and 0.1% H 2O 2. Prestained

molecular weight markers (Sigma,USA) were

employed to check the efficiency of protein transfer.

Metabolic changes and protein patterns in salinity 33

Biochemical estimations

Contents of proline, sucrose, total soluble sugars,

malondialdehyde (MDA) and activity of superoxidedismutase

(SOD) were estimated in NaCl stressed and

non-stressed seedlings as described earlier (Gehlot et

al., 1989 and 2003a). The methods used for total

sugars, sucrose and proline were of Mc Cready et al.,

(1950), Sadasivam and Manickam (1992) and Bates et

al., (1973) respectively. MDA contents were

determined using thiobarbutyric acid (TBA) following

the method of Heath and Packer (1968). MDA

contents were calculated using extinction coefficient

of 155 mM -1 cm -1 . The activity of superoxidedismutase

was measured according to the method of

Giannopolitis and Ries (1977).

Results

(i) Growth and metabolism

We evaluated responses of four cultivars (cvs. RT-46,

RT-54, RT-125 and RT-127) of Sesamum indicum to

low and high concentration of NaCl in terms of

seedling growth, alterations in the levels of

cytosolutes, membrane damage and activity of

superoxide scavenging enzyme –superoxidedismutase.

Table-1: Root and shoot length (cm) of Sesamum indicum seedlings under salinity (values with in parenthesis are percent

reduction over control).

Cultivars Root length Shoot length

Control 30 mM 50 mM Control 30 mM 50 mM

RT-46 4.7±0.16 4.0±0.06 2.7±0.12 3.3±0.10 2.3±0.22 1.2±0.10

(100) (15.0) (42.56) (100) (30.31) (57.28)

RT-54 3.2±0.26 3.0±0.88 2.0±0.21 3.2±0.39 2.4±0.16 1.5±0.07

(100) (6.25) (37.5) (100) (25.0) (53.13)

RT-125 2.6±0.58 2.0±0.09 1.4±0.09 2.3±0.37 1.3±0.20 0.78±0.16

(100) (23.00) (46.16) (100) (43.48) (66.09)

RT-127 5.2±0.07 4.9±0.07 3.4±0.12 3.2±0.16 2.5±0.16 1.6±0.12

(100) (5.77) (34.6) (100) (21.8) (50.00)

Values are mean of the ten seedlings which were in triplicate (± values are SD)


34 Hukam S. Gehlot et al.

Figure 1: Effect of NaCI on germination potential of 4

culvitars of sesame.

Figure 3: Effect of NaCI on sucrose content in 4 culvitars of

sesame (bars on data points are ±SE of the mean).

Figure 5: Effect of NaCI on proline content in 4 culvitars of

sesame (bars on data points are ±SE of the mean).

Figure 2: Effect of NaCI on soluble Protein content in 4

culvitars of sesame (bars on data points are ±SE of the

mean)

Figure 4: Effect of NaCI on total soluble sugar content in 4

culvitars of sesame (bars on data points are ±SE of the

mean).

Figure 6: Effect of NaCI on lipid peroxidation in 4 culvitars

of sesame (bars on data points are ±SE of the mean).


Figure 7: Effect of NaCI on activity of superoxidedismutase

in 4 culvitars of sesame (bars on data points are ±

SE of the mean).

Figure 9. (a) Protein Marker (14.5 –20l kD); (b) RT-46

(Control); (c) RT-46 (Heat stress); (d) RT-125 (Control); (e)

RT-125 (NaCl 30 mM); (f) RT-125 (Control); (g) RT-125

(NaCl 30 mM)

NaCl treatment inhibited growth of all the four

cultivars of S. indicum (Table 1). The responses to salt,

however, were genotype specific. Out of four

cultivars, cv. RT-125 showed maximum inhibition in

germination (Figure 1) and reduction in root and shoot

length in response to NaCl (Table 1). Root and shoot

length of RT-125 reduced by 46% and 66%

respectively whereas it was 34% and 50% over control

in RT-127 (Table 1).

Soluble proteins, total soluble sugars, sucrose and

proline contents increased in NaCl-treated seedlings of

all the four cultivars (Figures 2, 3, 4, 5). Soluble

protein levels were found higher in control seedlings

of RT-125 and RT-127 as compared to other two

Metabolic changes and protein patterns in salinity 35

Figure 8. Protein profile of 3 culvitars of Sesamum indicum

seedlings grown ih presence of different concentration

NaCI. Control: Seedlings grown in absence of NaCI

cultivars. Further increase in soluble proteins was 2 to

3 fold in RT-125 and RT-127 and less than two fold in

other two cultivars at 30 and 50mM NaCl (Figure 2).

The total soluble sugar and sucrose contents increased

in plants of all the four cultivars in presence of NaCl

(Figure 3, 4). The salinity-induced increase in total

soluble sugars and sucrose was two fold in RT-127 and

RT-46 under 30 and 50mM NaCl. Salt treatment

induced proline accumulation in all the four cultivars

(Figure 5). RT-54, RT-46 and RT-127 accumulated less

proline at 50mM NaCl as compared to RT-125 that

exhibited more than 2-fold rise in proline level.

Malondialdehyde (MDA) contents increased in

NaCl-treated seedlings of all the cultivars. However,

highest MDA content was noted in cv. RT-125 and the

least in RT-127 (Figure 6).

Control seedling of cv. RT-127 exhibited high

activity of SOD as compared to other cultivars (Figure

7). Seedlings of all four cultivars subjected to NaCl

stress exhibited increased activity of SOD. The

maximum increase (4- to 5-fold over control) in the

activity of SOD was recorded in cv. RT-127 followed

by 3- to 4-fold rise in RT-54 and RT-46 and 2- to 3-fold

in RT-125 at 30 and 50mM NaCl (Figure 7).

(ii) Electrophoretic patterns of proteins under NaCl

stress

All the cultivars of S. indicum subjected to 30 and 50

mM NaCl for five days exhibited alterations in their

protein profiles (Figure 8). The electrophoretically

separated protein in NaCl-treated seedlings as

compared with control revealed (i) quantitative


36 Hukam S. Gehlot et al.

decline in certain proteins, (ii) rise in levels of other

proteins, (iii) some proteins remained unchanged, and

(iv) de novo induction of specific proteins.

Proteins of molecular weights 16.5, 6.5 and 5.8 kD

in RT-46; 12 kD in RT-125 and 23.0, 21.0, 15.0, 12.0,

10.0 and 8.5 kD in RT-54 were not altered by NaCl

induced-stress. Levels (observation based on intensity

of protein bands) of several low and high molecular

weight proteins declined in cultivars RT-46 and RT-54

and not in RT-125 on 30 and 50 mM NaCl. Proteins

induced by NaCl-treatment were, a polypeptide of

65.0 kD in RT-46 at 50 mM NaCl, and polypeptides of

65.0, 62.0, 19.5 kD in RT-125 at 30 and 50 mM NaCl

and 62.0, 45.0 kD in RT-54 at 30 and 50 mM NaCl.

The presence of HSP 100 kD was detected by crossreaction

with anti-rice HSP 100 antibodies on western

blots (Figure 9). Differential accumulation of 100 kD

HSP in control, salt- and high temperature-stressed

seedlings occurred as revealed by antigen-antibody

complex formation with Anti-rabbit horse-radish

peroxidase linked secondary antibodies.

Discussion

All the glycophytes show reduction in growth in

response to NaCl-induced stress. Lowered water

potential and impairment in metabolic processes by

NaCl are ultimately responsible for the inhibition of

the overall growth (Greenway and Munns, 1980).

Difference in sensitivity and response of plants to

NaCl at cultivars level largely depend upon genetic

constitution of the plants (Yeo and Flowers, 1986;

Garcia-Reina et al., 1988; Flowers et al., 1985).

Earlier, we evaluated differences in sensitivity of four

cultivars of the Sesamum to short and long term

exposure of sub-lethal concentrations of NaCl

(Purohit, 2002).

Salinity tolerance of plants depends on several

factors namely, control of salt movement into and

through plants, sequestration of toxic ions, plants

ability to accumulate cytosolutes, efficiency to

scavenge free radicals generated due to stress and

stress- induced alterations in proteins. Organisms

tolerate abiotic-stresses by accumulation of variety of

cytosolutes termed compatible solutes (Delauney and

Verma, 1993; Hanson et al., 1994). Proline is one of

the compatible solutes that accumulate many folds in

stressed plants (Delauney and Verma, 1993).

Proline, sugars and sucrose help osmotic

adjustment during stress (McNeil et. al., 1999; Kameli

and Losel, 1995) and protect native structure of

macromolecules and membranes during extreme

dehydration (Hoekstra et al., 2001; Bolarin et al.,

1995; Prado et al., 2000). Rise in sucrose, total soluble

sugar levels in salt-treated cv. RT-127 may contribute

towards better adaptation to salinity. Alterations in

total soluble proteins did not indicate any correlation

with inhibition in growth and salinity tolerance

characteristics of the various cultivars of Sesamum.

Proline levels were found higher in salt-treated

sensitive cv. RT- 125 as compared to other cultivars.

Reports related to accumulation of high contents of

proline in salt-sensitive as well as in salt-tolerant

cultivars have been documented in the literature.

Salt causes oxidative stress and can generate

reactive oxygen species that damage membranes and

other macromolecules. MDA is an end product of lipid

peroxidation and has been used as a marker for free

radical generation and membrane damage under

abiotic stress conditions (Jouvent et al., 1993,

Parvanova et al., 2004). A considerable increase in

accumulation of MDA contents recorded in RT-125 as

compared to other cultivars indicated saltsensitiveness

of this cultivar to NaCl. Accumulation of

MDA was reported in a number of salt-sensitive plants

(Shalata and Neuman, 2001; Luna et al., 2002;

Mittova et al., 2002; Gehlot et al., 2003a). Superoxidedismutase

enzyme scavenges superoxides. High

activities of SOD and other enzymes involved in

reactive oxygen scavenging have been reported in

chickpea seedlings exposed to 50-200 mM NaCl

(Gehlot et al., 2003b), NaCl-tolerant Lycopersicon

esculentum (Shalata et al., 2001), Pisum sativum

(Hernandez et al., 2000), Setaria italica (Sreenivasulu

et al., 2000), Chloris gayana (Luna et al., 2002) and

Gossypium hirsutum (Gossett et al., 1994). It is

suggested that high activity of SOD in cv. RT-127 as

compared to other cultivars maintains efficient

antioxidant system during salt stress.

These studies suggest that high contents of total

soluble sugars, sucrose as well as high activity of SOD

may contribute towards better salinity adaptation

capabilities of cv. RT-127 as compared to the other

cultivars of Sesamum indicum. Low MDA content in

the cultivar and better growth performance in presence

of NaCl further support our suggestion that among

four cultivars, RT-127 has higher salt tolerance.


The alterations in protein profiles were recorded in

various cultivars of S. indicum subjected to NaCl

stress. Earlier Pareek et al. (1998) reported changes in

protein profiles in response to NaCl in two cultivars of

rice (Lal Nakanda and Pusa-169). In the present

investigation up-regulation of polypeptides of 81, 61,

65 and 80 kD in the salt-sensitive cultivars RT-125

was recorded. Up- regulation of some specific proteins

like 100 kD and 21 kD in tolerant varieties have been

reported (Pareek et al., 1998; Aarati et al., 2003).

Ashraf and O’Leary (1999) reported decline in certain

proteins in NaCl-sensitive cultivar (cv. potohar) of

wheat as compared to tolerant cultivars LU265 and

Kharchia. Up-regulation of 21.5 kD protein in rice

(Pareek et al., 1998) and 21 kD protein in finger millet

were co-related with NaCl-tolerance (Aarati et al.,

2003). Up-regulation of 100 kD HSP family in NaCland

heat stress-treated seedlings of S. indicum was

confirmed by western blotting. Presence of low level

of this protein even in control seedlings suggests its

constitutional expression.The HSPs perform several

vital functions (protein transport, folding, assembly

and disassembly) during growth and development of

plants but their synthesis increased tremendously upon

heat-stress (Cooper and Ho, 1987; Gething and

Sambrook, 1992).

Acknowledgements

This work was supported by UGC-COSIST & UGC-

DSA under SAP. One of us (AP) thanks J.N.Vyas

University, Jodhpur for providing fellowship out of

UGC-unassigned grant. We are also thankful to Prof.

Anil Grover, Department of Plant Molecular Biology,

South Campus, Delhi University) for providing

facilities to conduct electrophoresis related

experiments, western detection and valuable

suggestios. We acknowledge the help provide by Dr.

S.Rama Rao in formatting the ms.

References

Aarati P, Krishnaprasad BT, Ganeshkumar, Sativa M,

Gopalakrishna R, Ramamohan G. and Udayakumar M.

Expression of an ABA responsive 21 kD protein in

finger millet (Eleusine coracana Gaertn.) under stress

and its relevance in stress tolerance. Plant Sci. 164(1):

25-34, 2003.

Metabolic changes and protein patterns in salinity 37

Ashraf M. Salt tolerance of cotton: some new advances. Crit.

Rev. Plant Sci. 21: 1-30, 2002.

Ashraf M and Harris PJC. Potential biochemical indicators

of salinity tolerance in plants. Plant Sci. 166: 3-16, 2004.

Ashraf M and O’ Leary JW. Changes in soluble proteins in

spring wheat stressed with sodium chloride. Biol Plant.

42: 113-117, 1999.

Ashri A. Genetic resources of Sesame: Present and future

perspective. In: Sesame Biodiversity in Asia,

Conservation, Evaluation and Improvement. Proc. Asia

Regional Workshop of Sesame Evaluation and

Improvement Nagpur and Akola, India. Arora, R.K. and

Riley, K.W. (eds.). IPGRI Office for South Asia, New

Delhi, 25-39, 1993.

Bates LSM, Waldern RP and Teare ID. Rapid determination

of proline for water stress studies. Plant and Soil. 39:

205-207, 1973.

Bolarin MC, Santa-Cruz A, Cayuela E, and Perez-Alfocea F.

Short-term solute changes in leaves and roots of

cultivated and wild tomato seedlings under salinity. J.

Plant Physiol. 147: 463-468, 1995.

Boyer JS. Plant productivity and environment. Science. 218:

444-448, 1982.

Bradford M. A rapid and sensitive method for quantification

of microgram quantities of protein utilizing the principle

of protein dye binding. Anal. Biochem. 72: 248-254,

1976.

Cooper P and Ho TDH. Intracellular localization of heat

shock proteins in maize. Plant Physiol. 84: 1197-1207,

1987.

Delauney AJ and Verma DPS. Proline biosynthesis and

osmoregulation in plants. Plant J. 4: 215-223, 1993.

El-Shintinawy F and El-Shourbagy MN. Alleviation of

changes in protein metabolism in NaCl-stressed wheat

seed by thaimine. Biol Plant. 44: 541-545, 2001.

Flowers TJ, Lachno DR, Flowers TJ and Yeo AR. Some

effects of sodium chloride on cells of rice cultured In

vitro. Plant Science. 39: 205-211, 1985.

Garcia-Reina G, Moreno V and Luque A. Selection for NaCl

tolerance in cell culture of three canary island tomato

land races. I. Recovery of tolerant plantlets from NaCltolerant

cell strains. J. Plant Physiol. 133:1-6, 1988.

Garg AK, Kim JK, Owens TG, Ranwala AP, Do Choi Y,

Kochain LV, and Wu RJ. Trehalose accumulation in rice

plants confers high tolerance levels to different abiotic

stresses. Proc. Natl. Acad. Sci. USA. 99:15898-15903,

2002.

Gehlot HS, Sunita M and Purohit A. Role of specific ions on

growth and metabolic patterns in moth bean (C 3) and

pearl millet (C 4) of Indian desert. Indian J. plant Physiol.

8(2): 145-149, 2003.

Gehlot HS, Upadhyaya A, Davis TD and Sankhla N. Growth

and organogenesis in moth bean callus as affected by

paclobutrazol. Plant Cell Physiol. 30(6): 933-936, 1989.

Gehlot HS, Dinesh R, Choudhary R, Joshi S and Sankhla N.


38 Hukam S. Gehlot et al.

In vitro studies on chickpea seedlings: Effect of salt on

growth and antioxidant activity. Proc Plant Growth Reg

Soc Amer. 30: 119-121, 2003b.

Gething MJ and Sambrook J. Protein folding in the cell.

Nature. 355: 33-45, 1992.

Giannopolitis CN and Ries SK. Superoxide dismutases

occurrence in higher plants. Plant Physiol. 59: 309-315,

1977.

Gossett DG, Millhollon EP and Lucas MC. Antioxidant

response to NaCl stress in salt-tolerant and salt-sensitive

cultivars of cotton. Crop Sci. 34: 706-714, 1994.

Greenway H and Munns R. Mechanism of salt tolerance in

non halophytes. Annu. Rev. Plant Physiol. 31: 149-190,

1980.

Hanson AD, Rathinasabapathi B, Rivoal J, Burnet M, Dillon

MO and Gage DA. Osmoprotective compounds in the

Plumbaginaceae: a natural experiment in metabolic

engineering of stress tolerance. Proc Natl Acad Sci USA,

91: 306-310, 1994.

Heath RL and Packer L. Photo-peroxidation in isolated

chloroplasts. Arch Biochem Biophys. 125: 189-198 1968.

Hernandez JA, and Almansa MS. Short-term effects of salt

stress on antioxidant systems and leaf water relations of

pea leaves. Physiol. Plant. 115: 251-257, 2002.

Hernandez JA, Jimenez A, Mullineaux P and Sevilia F.

Tolerance of Pea (Pisum sativum L.) to long-term salt

stress is associated with induction of antioxidant

defenses. Plant Cell and Envir. 23: 853-862, 2000.

Hoekstra FA, Golovina EV and Buitink J. Mechanism of

plant desiccation tolerance. Trends in Plant Sci. 9: 431-

439, 2001.

Jouvent L, Engelmann F, Noirot M and Charrier A.

Evaluation of biochemical markers (Sugar, proline,

malondialdehyde and ethylene) for cold sensitivity in

microcutting of two coffee species. Plant Sci. 91:109-

116, 1993.

Kameli A and Losel DM. Contribution of carbohydrates and

solutes to osmotic adjustment in wheat leaves under

water stress. J. Plant Physiol. 145: 363-366, 1995.

Laemmli UK. Cleavage of structural proteins during the

assembly of the head of bacteriophage T4. Nature, 227:

680-685, 1970.

Lin CC, and Kao CH. Effect of NaCl stress on H 2O 2

metabolism in rice leaves. Plant Growth Regulation. 30:

151-155, 2000.

Luna C, Luca MD and Taleisnik E. Physiological causes for

decreased productivity under high salinity in bom

tetraploid Chloris gayana cultivar. II. Oxidative stress.

Aust J Agric Res. 53(6): 669-674, 2002.

Mc Cready RM, Gujjolz J, Silviers V and Owers, HS.

Determination of starch and amylase in vegetables;

application to peas. Anal Chem. 22: 1156, 1950.

McNeil SD, Nuccio ML and Hanson, AD. Betaines and

related osmoprotectants: targets for metabolic

engineering of stress resistance. Plant Physiol. 120: 945-

949, 1999.

Mittova V, Tal M, Volokita M and Guy M. Salt stress induces

up-regulation of an efficient chloroplast antioxidant

system in the salt-tolerant wild tomato species

Lycopersicon pennellii but not in the cultivated species.

Physiol Plant. 115: 393-400, 2002.

Ozturk ZN, Talame V, Deyholos M, Michalowski CB,

Galbraith DW, Gozukirmizi N, Tuberosa R, and Bohnert

HJ. Monitoring large-scale changes in transcript

abundance in drought and salt stressed barley. Plant Mol

Biol. 48: 551-573, 2002.

Pareek A, Singla SL and Grover A. Immunological evidence

for accumulation of two high molecular weight (104 and

90 kDa) HSPs in response to different stresses in rice

and in responses to high temperature in diverse plant

genera. Plant Mol Biol. 29: 293-301, 1995.

Pareek A, Singla SL and Grover A. Protein alterations

associated with salinity, desiccation, high and low

temperature stresses and abscisic acid application in Lal

nakanda a drought tolerant rice cultivar. Curr. Sci. 75:

1170-1174, 1998.

Parvanova D, Ivanov S, Konstantinova T, Karanov E,

Atanassov A, Tsvetkov T, Alexieva V and Djilianov D.

Transgenic tobacco plants accumulating osmolytes show

reduced oxidative damage under freezing stress. Plant

Physiol and Biochem. 42: 57-63, 2004.

Prado FE, Boero C, Gallardo M and Gonzalez JA. Effect of

NaCl on germination, growth, and soluble sugar content

in Chenopodium quinoa Willd. seeds. Bot Bull Acad Sin.

41: 27-34, 2000.

Purohit A. Physiological and Biochemical studies related to

growth and metabolic pattern of different cultivars of

Sesamum sp. under sub-optimal environment. Ph.D.

Thesis, Department of Botany, JNV University, Jodhpur,

India, 2002.

Sadasivam S and Manickam A. Biochemical methods for

agricultural sciences. Wiley Eastern Ltd. New Delhi,

1992.

Shalata A, Mittova V, Volokita M, Guy M, and Tal M.

Response of the cultivated tomato and its wild salttolerant

relative Lycopersicon pennellii to salt-dependent

oxidative Stress: The root antioxidant system. Physiol

Plant. 112: 487-494, 2001.

Shalata A and Neumann PM. Exogenous ascorbic acid

(vitamin C) increases resitance to salt stress and reduces

lipid peroxidation. J Exp Biol. 2207-2211, 2001.

Shannon MC. Adaptation of plants to salinity. Adv. Agron.

60: 75-119, 1998

Singla SL and Grover A. Detection and quantitation of a

rapidly accumulating and predominant 104 kDa heat

shock polypeptide in rice. Plant Sci. 97: 23-30, 1994.

Smirnoff N, and Cumbes QJ. Hydroxyl radical scavenging

activity of compatible solutes. Phytochem. 28: 1057-

1060, 1989.

Sreenivasulu N, Grimm B, Wobus U and Weschke W.


Differential response of antioxidant compounds to

salinity stress in salt tolerant and salt-sensitive seedlings

of foxtail millet (Setaria italica). Physiol. Plant. 109:

435-442, 2000.

Towbin H, Staehelin T and Gordon J. Electrophoretic

transfer of proteins from polyacrylamide gels to

nitrocellulose sheets: Procedure and some applications.

Proc Natl Acad Sci USA. 76: 4350-4354, 1979.

Yancey PH, Clark ME, Hand SC, Bowlus RD, Somero GN.

Living with water stress: evolution of osmolyte systems.

Science. 217: 1214-1222, 1982.

Yeo AR and Flowers TJ. Salinity resitance in rice (Oryza

sativa L.) and a pyramiding approach to breeding

varieties for saline soils. Aust J Plant Physiol. 13: 161-

73, 1986.

Zivy, M., Thiellement, H., Vienne, D.de and Hofmann, J.P.

Study on nuclear and cytoplasmic genomic expression in

wheat by two-dimentional gel electrophoresis. Theor

Appl Genet, 66: 1-7, 1983.

Metabolic changes and protein patterns in salinity 39


Introduction

Journal of Cell and Molecular Biology 4: 41-46, 2005.

Haliç University, Printed in Turkey.

Cytogenetic effect of heavy-metal and cyanide in contaminated waters

from the region of southwest Bulgaria

Teodora A. Staykova 1 *, Evgeniya N. Ivanova 1 and Iliana G. Velcheva 2

1 Department of Genetics, University of Plovdiv, 24 Tzar Assen Str., Plovdiv 4000, Bulgaria; 2 Department

of Ecology, University of Plovdiv, 24 Tzar Assen Str., Plovdiv 4000, Bulgaria (* autor for correspondence)

Abstract

A study was made on the cytogenetic effect of heavy-metal and cyanide polluted waters from the region of

Panagjurishte – Southwest Bulgaria. A plant test-system Allium cepa in vivo was used. A decreased cell division rate

was established, and deviations from the normal mitosis in the result of chromosome mutations were registered. The

method used is applicable for biological monitoring of waters contaminated with heavy metals and cyanides.

KKeeyy wwoorrddss:: Biomonitoring, heavy metals, cyanides, cytogenetic effect.

Bulgaristan’›n güneybat› bölgesindeki kontamine sularda a¤›r metal ve siyanürün

sitogenetik etkileri

Özet

Panagjurishte-Güneybat› Bulgaristan bölgesinde suyu kirleten a¤›r metal ve siyanürün sitogenetik etkileri

çal›fl›lm›flt›r. In vivo Allium cepa’da bitki test sistemi kullan›lm›flt›r. Sonuç olarak, hücre bölünme h›z›nda bir azalma

ve kromozom mutasyonlar›ndan kaynaklanan normal mitoz bölünmeden sapmalar tespit edilmifltir. Kullan›lan

metod, a¤›r metaller ve siyanür ile kontamine olmufl suyun biyolojik olarak görüntülenmesi için uygulanabilir bir

metodtur.

AAnnaahhttaarr ssöözzccüükklleerr:: Biyolojik görüntüleme, a¤›r metaller, siyanürler, sitogenetik etki.

The region of the town of Panagjurishte (Southwest

Bulgaria), is subjected to the anthropogenic pressure,

associated with the presence of heavy metals in the

environment. The major pollution sources are the

copper ore mining and processing works. According to

Dimov and Hristov (1998), a number of heavy metals

were detected as permanent components in the ground

and surface waters of this region, at levels surpassing

the maximum permissible concentrations, at that.

Ormrod (1988) reported that heavy metals were

amongst the most toxic and environmentally

dangerous pollutants. Different authors studied the

effect of industrial pollution on the fauna of this

region. Mecheva et al. (1987) established reduction

in the number of populations and restriction in species

distribution. There are a number of studies concerning

the problem of the relationship between the increased

heavy-metal amounts in nature and industrial

environment, their mutagenic and cancerogenic

effects and the increased cases of malignant tumour

formations in man (Mitrov and Chernozemski, 1985;

Vodenicharska et al., 1992; Tzonevski et al., 1998;

Bruning and Chronz, 1999; Chernozemski and

Shishkov, 2001). Heavy-metal pollutants have a high

41


42 Teodora A. Staykova et al.

bioaccumulation rate and when fallen into the

organism, they are slowly released, causing a number

of damages. According to Nikolov (1987) the studying

of the mutagenic effect of heavy metals on different

test-objects is of current interest, since increasing

environmental pollution with chemical mutagens

possess a real threat to the presence and future of

mankind. At the same time, the number of studies on

cytotoxic and mutagenic effects of heavy-metal and

cyanide contaminated waters in Southwest Bulgaria is

rather limited. This motivated the present study.

Material and methods

Samples of spring water, used by the local population

for drinking and irrigation, were taken from the region

of Panagjurishte and subjected to chemical analysis.

The contents of copper, arsenic, cadmium, lead, and

cyanides (mg/dm 3 ) were determined using the method

of automatic photometry (apparatus SQ 118 - Merk).

The results for the contents of the heavy metals and

cyanides tested were compared with the hygienic

norms adopted for the country (maximum permissible

concentrations – MPC) according to the Ordinance No

7/1986.

Fiskesjö (1985, 1988, 1995), Sabti (1989) have

been shown that the Allium test to be a useful tool for

the detection of potentially genotoxic substances in air

and water screening programmes. Chang et al. (1997)

have used Allium cepa for testing of genotoxic effect

of a lead-contaminated soil. Moraes and Jordao (2001)

evaluated the cytogenotoxic effects of the waste water

in Allium cepa root meristems, too.

To conduct the cytogenetic analysis, temporary

squash preparations were made from Allium cepa root

meristem. The sprouted roots were fixed in a Clarke’s

fixator (acetic acid glaciale : distilled water = 3:1) for

4 hrs, washed in 96% and 70% ethanol and stored in

70% ethanol in a cold chamber at 4 0 C until making the

microscope slides. Hydrolyzed roots in 3N HCl at

temperature of 24 0 C for 10 min, were treated with

45% CH 3COOH for 30 min and stained for 2 hrs in

acetocarmine. After staining, the root meristems were

separated and squashed in 45% CH 3COOH (Ivanova et

al., 2002). A control sample No1 (rootlets sprouted in

distilled water) and a test sample No2 (rootlets

sprouted in the water tested for heavy-metal and

cyanide amounts) were examined. The microscopic

preparations were analysed to determine the cell

division intensity calculating the mitotic index (MI).

The latter was determined as a ratio between the

number of dividing cells (N') and the total number of

cells analysed (N) in promiles:

N'

MI = 1000 ‰

N

The indices of each phase of actual cell division (I

phase) were also calculated, i.e.: the prophase index (I

prophase), metaphase (I metaphase), anaphase (I

anaphase) and telophase (I telophase) as ratios

between the number of cells in the respective phase

(N'') and the number of dividing cells (N') in per cents:

N''

I phase = 100 %

N'

The mutation frequency, analysed through the

anaphase/telophase and micronucleus test for

mutagenicity, was calculated as percentage of the total

number of analysed cells (N). The microscope

examination was made at magnification 400x.

Results

Chemical water analysis

The lead (Pb) content of the test sample was 0.3

mg/dm 3 , exceeding six times the MPC (0.05). In the

same sample, the contents of heavy metals copper

(Cu), zinc (Zn), cadmium (Cd) and arsenic (As) were

below the PMC values accepted for the country.

The presence of cyanides (CN) in the tested water

sample was established. Their amount was 0.018

mg/dm 3 . According to the hygienic norms for

Bulgarian waters (Ordinance No 7/1986), no cyanide

amounts were permitted in them.

Cytogenetic analysis

To compare cell division rate in determining the

mitotic index, we examined a total of 2876 cells for

the control (No1) and 12334 cells for the test sample

(No2). A lower mitotic index in the test sample was


established as comparing to that in the control (Table

1). The comparative analysis of phase indices showed

a slight decrease in the prophase index and a slight

increase in the metaphase- and anaphase indices in

sample No2. A considerable increase in the telophase

index of the test sample was also established.

The cytogenetic analysis showed the absence of

any mutations in the control and the presence of

chromosome aberrations with a total frequency of

2.231% in the test sample No2 (Table 2). The highest

frequency (1.79%) was shown by micronuclei (Fig.

1a, b). Prophases with chromosome fragments (Fig.

1c) of 0.17% frequency were also observed (Table 2).

Using anaphase analysis, we established anaphaseand

telophase bridges, as well as chromosome

fragments (Fig. 1d, e) with frequencies of 0.11% and

0.097%, respectively (Table 2). Vagrant chromosomes

(Fig. 1f) with frequencies of 0.024% and 0.04% were

also observed in the anaphase and telophase,

respectively (Table 2).

Discussion

Smaka-Kincl et al. (1996), Fiskesjö (1997) ascertained

that the polluted tested waters cause the inhibition of

root growth, decrease of mitotic index, increase of

presence of interphase cells with micronuclei and

Heavy-metal and cyanide effects 43

Table 1: Number of cells examined; mitotic index; prophase, metaphase, anaphase and telophase indices in the analysed samples.

Probe Total Cells in Division Prophase Metaphase Anaphase Telophase

No analysed cells

N number MI % number I prophase number I metaphase number I anaphase number Telophase

N’ N’’ % N’’ % N’’ % N’’ %

1 2876 2505 871 2437 97.29 31 1.24 18 0.719 19 0.758

2 12334 8880 719.96 8472 95.4 129 1.45 81 0.91 198 2.23

Table 2: Frequency of anaphase bridges, telophase bridges, anaphase and telophase with vagrant chromosomes, fragments and

micronuclei in the analysed samples.

Probe Total Praphase with Anaphase Anaphase with Telophase Telophase with Cells with Total frequency

No analysed chromosome bridges and vagrant bridges and vagrant micronuclei of chromosome

cells fragments chromosome chromosomes chromosome chromosomes aberration %

fragments fragments

N number % number % number % number % number % number %

1 2876 0 0 0 0 0 0 0 0 0 0 0 0 0

2 12334 21 0.17 13 0.11 3 0.024 12 0.097 5 0.04 221 1.79 2.231

increase of presence of aberrant cells in comparison to

control test by the Allium cepa testing procedure. The

results from the present experiment supported these

data and showed that the heavy-metal and cyanide

contaminated waters provoked serious anomalies in

the process of cell division and induced chromosome

aberrations in the Allium cepa root meristem.

Suppression of cell reproduction was also observed.

Dimitrova (1993) and Dimitrova and Ivanova

(2003) reported that high lead, zinc, cadmium and

copper concentrations inhibited the growth of

vegetative organs in some plant species. Rank and

Nielsen (1998) reported that the toxicity could be

positively correlated to the industrial load and

concentrations of the heavy metals could partly be

correlated with the toxicity. The mitotic index (MI)

reduction established by us in test sample versus the

control, confirmed these data.

Kovalchuk et al. (2001) reported that pollution

with heavy metal salts induced an increase in the

frequency of intrachromosomal mutations. The results

from the present study are in good agreement with

them. We suggest that the mutagenic effect found by

us was not only due to the increased lead content, but

also to the complex action of heavy metals and

cyanides. These results confirmed also the mutagenic

effect of heavy-metal and cyanide contaminated

waters, established in our previous studies (Ivanova et


44 Teodora A. Staykova et al.

Figure 1: Cytogenetic effect of heavy-metal and cyanide polluted waters in Allium cepa root meristems, x 400. a. Interphase with

micronucleus. b. Prophases with micronuclei. c. Prophase with chromosome fragment. d. Telophase bridge. e. Telophase with

chromosome fragments. f. Telophase with a vagrant chromosome.


al., 2002). In our opinion, the high micronuclei

frequency observed in experimental sample was

induced either by the lagging of whole chromosomes

or the immobility of large acentric fragments. The

formation of acentric fragments resulted from

different chromosome aberrations, and the lagging of

chromosomes was caused by disturbances in the

mitotic spindle or the centromere. We suggest that the

anaphase- and telophase bridges established, as well

as the chromosome fragments resulted from different

types of chromosome aberrations, associated with a

loss of genetic material. Our suggestion corroborated

the data reported by Hoga et al. (1991), who

considered the anaphase bridges as obtained from

structural changes of deficiency- and translocation

type, some of them surviving to late telophase,

indicative of their stability. The increased frequency of

chromosome mutations established by us in sample

No2, agreed with the data reported by Bojadzhiev et

al. (1990), who suggested that lead had embryotoxic

and gonadotoxic effects.

A general conclusion is made that the established

water pollution in the region of the town of

Panagjurishte and its genotoxic effects are a potential

threat to human health. This suggestion supports the

opinion of Ananoshtev et al. (2001) who thought that

the increased cancer rate in the studied region was

associated with the increased contents of lead,

cyanides, arsenic, and cadmium in samples of tap

water and open water sources in the region.

Acknowledgements

This work was financed by the Foundation of

Scientific Investigations of Plovdiv University.

References

Ananoshtev N, Velcheva I, Ivanova E, Staikova T and

Yambolieva Z. Risk factors for the increased frequency

of malignant tumour formations in a region of South

Bulgaria subjected to anthropogenic pressure. Nauchni

trudove na PU “P. Hilendarski”. Plantarum. 6: 89-94,

2001.

Boyadjiev V, Alexieva Ts, Zaprjanov Z, Hadjieva Y, Koleva

M, Tzacheva N, Boyadjieva P and Nikolova P. Heavy

metal poisonings. Medicina i fizkultura. Sofia. 242,

1990.

Bruning T and Chronz C. Occurrence of urinary tract tumors

Heavy-metal and cyanide effects 45

in miners highly exposed to dinitroluene. YOEM. 3: 144-

149, 1999.

Chang L, Meier J and Smith M. Application of plant and

earthworm bioassays to evaluate remediation of a leadcontaminated

soil. Arch. Environ. Contam. Toxicol. 32:

166-171, 1997.

Chernozemski I and Shishkov T. Oncology, SIELA-SOFT.

Sofia. 15-21, 2001.

Dimitrova I. Studies of grass plants under conditions of

industrial pollution with heavy metals and sulphur

dioxide. Author’s summary of Ph.D. Dissertation, “P.

Hilendarski” Plovdiv University, 1993.

Dimitrova I and Ivanova E. Effect of heavy metal soil

pollution on some morphological and cytogenetical

characteristuics of flax (Linum usitatissum L.). J. of

Balkan Ecology. 4: 212-218, 2003.

Dimov S and Hristov S. Analysis of the ecological status and

the opportunities for sustainable development of mining

regions. Minno Delo i Geologija. 1: 28-32, 1998.

Fiskesjö G. The Allium test as a standard in environmental

monitoring. Hereditas. 102: 99 – 112, 1985.

Fiskesjö G. The Allium test – an alternative in environmental

studies: the relative toxicity of metal ions. Mutation

Research. 197: 243 – 260, 1988.

Fiskesjö G. Allium test. Methods in molecular biology. In

vitro toxicity testing protocols. 43: 119 – 127, 1995.

Fiskesjö G. Allium test for screening chemicals; evaluation

of cytological parameters. Plants for environmental

studies. CRC Press LLC – New York. p. 308 – 333.

1997.

Hoga O, Bose S and Sinha S. Vitamin C mediated

minimization of Malathion and Rogor induced

mitoinhibition and clastogeny. Cytology. 3: 389-397,

1991.

Ivanova E, Staikova T and Velcheva I. Mutagenic effect of

water polluted with heavy metals and cyanides on Pisum

sativum plant in vivo. J. Balkan Ecology. 3: 307-310,

2002.

Kovalchuk O, Titov V, Hohn B and Kovalchuk I. A sensitive

transgenic plant system to detect toxic inorganic

compounds in the environment. Nat. Biotechnol. 6: 568-

572, 2001.

Mecheva R, Karapetkova M and Gerasimov S. Heavy metal

accumulation in bioindicator vertebrates in the region of

Srednogorie. In: First National Conference on the

Problems of Biological Monitoring. Inst. Zool. BAS.

Sofia p. 1987.

Mitrov G and Chernozemski I. Nutrition and Cancer.

Medicina i Fizkultura. Sofia. 67-98, 1985.

Moraes D and Jordao B. Evaluation of the genotoxic

potential of municipal waste water discharged into the

Paraguay River during periods of flood and drought.

Environ. Toxicol. 16: 113-116, 2001.

Nikolov H. The chemical mutagens as environmental


46 Teodora A. Staykova et al.

pollutants. Genetika i Selekcija. 1: 77-84, 1987.

Ormrod D. Effect of trace element contamination of plants.

In: Treshow M. ed., Hidrometeoizdat, Leningrad, Air

Pollution and Plant Life. p. 327-356, 1988.

Ordinance No 7, State Newspaper, 1986, No 96. Rank J and

Nielsen M. Genotoxicity testing of waste water sludge

using the Allium cepa anaphase-telophase chromosome

aberration assay. Mutat. Res. 418: 113-119, 1998.

Sabti K Allium test for air and water borne pollution control.

Cytobios. 58: 71-78, 1989.

Smaka-Kinkl V, Stegnar P, Lovka M and Toman M. The

evaluation of waste, surface and ground water quality

using the Allium test procedure. Mutat. Res. 368: 171-

179, 1996.

Tzonevski D, Sapundzhiev K and Vodenicharov E. Studying

the contents of lead and cadmium in the blood of

children up to 15 years old from the region of the Non-

Ferrous-Metal Works near Plovdiv. Higiena i

Zdraveopazvane. 2/3: 20-22, 1998.

Vodenicharska TZ, Petrov I and Razboinikova F. A study for

heavy metal (lead, cadmium, zinc, copper, manganese)

contamination among the population from the 3 rd

Metallurgical Base region. Higiena i Zdraveopazvane. 2:

59-62, 1992.


Introduction

Journal of Cell and Molecular Biology 4: 47-52, 2005.

Haliç University, Printed in Turkey.

Effects of epirubicin and daunorubicin on cell proliferation and cell

death in HeLa cells

Gül Özcan Ar›can* and Nazl› Nazmiye Soy

‹stanbul University, Science Faculty, Biology Department, 34459, Vezneciler, ‹stanbul, Turkey

(* author for correspondence)

Abstract

Epirubicin and daunorubicin, antibiotics which are derivative of anthracyclines, are especially used on widespread

tumors. In this study, effects on cell growth and cell death were examined by MTT method applying in vitro doses

of epirubicin, daunorubicin and epirubicin+daunorubicin to human servical carcinoma derived HeLa cell line.

According to the results obtained from the experiments it was determined that daunorubicin has more cytotoxic effect

than epirubicin depending on the periods of drug exposure. In whole experiment groups, the most effective result

was detected in epirubicin+daunorubicin combination (p< 0.001).

KKeeyy wwoorrddss:: Epirubicin, Daunorubicin, HeLa cells, cell proliferation, cell death, MTT method.

Epirubisin ve daunorubisinin hücre ço¤almas› ve hücre ölümü üzerine etkilerinin HeLa

hücrelerinde araflt›r›lmas›

Özet

Antrasiklin türevi epirubisin ve daunorubisin, özellikle yayg›n tümörlerde s›kl›kla kullan›lan antibiyotiklerdir. Bu

çal›flmada, epirubisin, daunorubisin ve epirubisin+daunorubisinin in vitro dozlar› insan serviks kanseri kökenli HeLa

hücre soyuna uygulanarak, hücre ço¤almas› ve hücre ölümü üzerine olan etkileri MTT yöntemi ile araflt›r›ld›.

Deneylerden elde edilen sonuçlara göre, ilaç uygulama süresine ba¤l› olarak daunorubisinin epirubisinden daha

sitotoksik bir etkiye sahip oldu¤u belirlendi. Tüm deney gruplar› içerisinde en etkili sonuç, epirubisin+daunorubisin

kombinasyonunda elde edildi (p< 0.001).

AAnnaahhttaarr ssöözzccüükklleerr:: Epirubisin, Daunorubisin, HeLa hücreleri, hücre ço¤almas›, hücre ölümü, MTT yöntemi.

Cancer chemotherapy, a third treatment method beside

the surgical operation and radiotherapy, is carried out

applying various drugs to especially widespread

tumors (Zhang et al., 1992). Cancer chemotherapy is

used for dynamics processes related with proliferation

or rate of growing smaller in tumor, considering the

origin of cell groups which form tumor. Beside this, it

should be evaluated action mechanism, toxicity and

side effects of drug. Cytotoxics materials used on

cancer chemotherapy more affect the cell in the

process of division in comparison with the cell in rest

attitude (Robert and Gianni, 1993; Topçul et al., 2002).

In recent years, cancer chemotherapy has largely

utilized of recorded new developings related with cell

kinetics. Results from the studies to explain effects on

cell level of different types of radiations, various

chemicals, hormones and cytotoxic drugs make the

studies concerning cell proliferation and cell death

47


48 Gül Özcan Ar›can and Nazl› Nazmiye Soy

important in direction of establishing period of cell

cycle and periods of phases (Skladanowski and

Konopa, 1993; Chan and Chan, 1999).

Epirubicin (EPI) and Daunorubicin (DAU), the

antitumor antibiotics derivative of anthracyclines, are

often used on especially widespread tumors. Cell

culture studies indicates that EPI and DAU rapidly

diffuse inside the cell, localise in nucleus and inhibit

synthesis of nucleic acid (Greg et al., 1993; Mansilla

et al., 2003; Ralph et al., 2003). In this study, it was

investigated both alone and combined effects of EPI

and DAU on cell growth and cell death on HeLa cells.

It was also aimed that being more understood the

effects of cytotoxic drugs and possessing attributes of

being preliminary study related to using separate or

combined in clinic.

Material and methods

Cell line

Tumoral cell line used in our experiments was HeLa

(CCL 2) cells that was taken from human servical

carcinoma in 1951 and that has been continously

grown in cell culture since that date. These cells were

obtained to our laboratory by Tokio Technology

Institute and was grown regularly by doing passage

twice a week.

Cell culture

Cells were cultured in Minimum Essential Medium

(MEM, Sigma) containing 10% fetal bovine serum

(FBS, Gibco Lab.) and 1% penicillin-streptomycin at

37 0 C in an atmosphere containing 5% CO 2. Culture

medium was changed every 2 or 3 days. Cells were

washed with Hank’s balanced salt solution (HBSS)

and harvested using 5% trypsine (Gibco Lab.)

solution. Then cells were centrifuged at 1500 rpm for

3 minutes. Supernatant was discarded and pellet was

diluted with MEM. Cells were seeded 10.000

cells/well in 96 well plates. After these cells incubate

at 37 0 C for 24 hours, experiments were done.

Experimental design

10 mg EPI (Farmorubicin, Carlo Erba) and 20 mg

DAU (Daunorubicina, Carlo Erba) were dissolved in

MEM as a 1mg/ml stock solution supplemented with

10% FBS. The pH of the drug solution was adjusted to

7.4 with NaOH. All assays testing EPI and DAU were

protected from light. The required final

concentrations (0.01 µg/ml, 0.1 µg/ml, 0.5 µg/ml, 1

µg/ml and 5 µg/ml) were obtained by diluting aliquots

of the stock solution in cell culture medium (MEM)

supplemented with 10% FBS. It was determined

inhibitory concentration 50% (IC 50) doses by applying

above mentioned doses of both EPI and DAU in HeLa

cell culture. The experiments tested by using IC 50

doses were carried out in 4 groups such as Control,

EPI, DAU and EPI+DAU combinations. With this

aim, determined IC 50 doses of drugs were treated to

HeLa cells in the time periods of 0, 2, 4, 8, 16, 24

hours. Each experiment was performed on at least

three separate occasions.

Chemical

EPI (4’-epidoxorubicin), an anthracycline, is a

doxorubicin stereoisomer, possessing the L-arabino

instead of the L-lyxo configuration of the sugar moiety

(Figure 1). In EPI therefore the hydroxyl group on the

sugar moiety, possessing the stable 1 C4 conformation,

has an aquatorial orientation (Ar›can Özcan and

Topçul, 2003).

DAU (4-demethoxydaunorubicin) is meant an

antibiotic of the rhodomycin group, originally isolated

from fermentation broths of Streptomyces peuicetius

and Streptomyces coentleonibidus and its acid

complexes particularly its hydrochloride complex.

DAU is a glycoside formed by a tetracyclic aglycone

daunomycinone and an amino sugar daunosamine

(Keprtova et al., 1993) (Figure 1).

Figure 1: Structural formulae of EPI and DAU.

R1 R2 R3 R4

Daunorubicin: —OCH3 ---H —OH —H


Figure 2: EPI and DAU treatment in dose-dependent

(µg/ml) in HeLa cells for 24 hours.

Figure 4: Effect of different doses of EPI and DAU

treatment on vitality in HeLa cells for 24 hours.

Epirubicin: —OCH3 —OH —H ---OH

MTT analysis

The cell viability was determined by the Mosmann’s

MTT assay with minor modifications (Mosmann,

1983; Fischer et al., 1999; Mc Daid and Johnston,

1999). MTT analysis were applied to identify

cytotoxicity that was formed by drugs in time intervals

for 0-24 hours. Therefore, MTT stock solution (3-(4,5dimethyl-thiazol-2-yl)-2,5-diphenyl

tetrazolium

bromide, Sigma) as a 5 mg/ml was prepared in

phosphate-buffered saline (PBS, Sigma). At the end of

the above mentioned treatment intervals, 20 µl MTT

solution was added to each culture on condition that

using final concentration was 0.5 mg/ml. After 4 hours

incubation, the liquid on cells was removed, and 200

µl dimethyl sulfoxide (DMSO) was added to each well

on formed formazan crystals. To dissolve formazan

crystals formed in cell, 96 well plates was stayed in

shaker incubator for 30 minutes. Absorbances were

measured at 570nm using an UV-160

spectrophotometre (Shimadzu).

Statistical analysis

Effects of antibiotics on cell activities 49

Figure 3: EPI and DAU treatment in dose-dependent

(µg/ml) in HeLa cells for 48 hours.

Figure 5: Effect of different doses of EPI and DAU

treatment on vitality in HeLa cells for 48 hours.


50 Gül Özcan Ar›can and Nazl› Nazmiye Soy

Figure 6: Effect of IC 50 values of EPI and DAU either alone

or in combination in HeLa cells for 0-24 hours.

The statistical significance between the control and

treatment groups was determined by Student-t test. In

all cases, a P value less than 0.001 was considered

significant.

Results

The effects of EPI and DAU on cell proliferation and

cell death were investigated in this study. After 0.01

mg/ml, 0.1 mg/ml, 0.5 mg/ml, 1 mg/ml, 5 mg/ml doses

of EPI were applied to HeLa cells for 24 hours

respectively, the absorbances of drug treated cells 10 -2

were reduced to 7.1x10 -2 , 5.7x10 -2 , 4.8x10 -2 , 3.8x10 -2 ,

2.8x10 -2 compared that of control absorbance as

11.3x10 -2 . With 0.01 µg/ml, 0.1 µg/ml, 0.5 µg/ml, 1

µg/ml, 5 µg/ml doses of DAU treatment for 24 hours

respectively, absorbances of HeLa cells were reduced

to 3.4x10 -2 , 2.4x10 -2 , 1.5x10 -2 ,1.4x10 -2 , 1.2x10 -2

compared that of control absorbance as 10.9x10 -2

(Figure 2).

When HeLa cells were treated with 0.01 µg/ml,

0.1 µg/ml, 0.5 µg/ml, 1 µg/ml, 5 µg/ml doses of EPI

for 48 hours respectively, the absorbances of drugtreated

cells were measured 4.8x10 -2 , 3.55x10 -2 ,

0.25x10 -2 , 0.25x10 -2 and 0.05x10 -2 compared that of

control absorbance as 5.85x10 -2 . After the same doses

of DAU were applied to cells for 48 hours

respectively, the absorbances of HeLa cells were

reduced to 2x10 -2 , 0.4x10 -2 , 0.3x10 -2 , 0.3x10 -2 , 0.15x10 -

Figure 7: Effect of IC 50 values of EPI and DAU either alone

or in combination on vitality in HeLa cells for 0-24 hours.

2 compared that of control absorbance as 5.8x10 -2

(Figure 3).

When the HeLa cells were treated for 24 and 48

hours with 0.01 µg/ml, 0.1 µg/ml, 0.5 µg/ml, 1 µg/ml,

5 µg/ml of EPI and DAU, their growth and viability

were significantly decreased in dose- and timedependent

manners (p< 0.001). It was determined that

IC 50 value of EPI is 0.1 µg/ml, IC 50 value of DAU is

0.01 µg/ml for 24 hours treatment and IC 50 value of

EPI is 0.2 µg/ml, IC 50 value of DAU is 0.008 µg/ml for

48 hours treatment (Figures 4, 5).

Detected IC 50 values of the first experiment of EPI

and DAU were used to establish effect on cell viability

for 0-24 hours. IC 50 values of EPI and DAU (0.1

µg/ml and 0.01 µg/ml, respectively) were applied for

24 hours. Applying these IC 50 values to HeLa cells, it

was provided to decrease cell viability in timedependent

manner (Figure 6). In all experiment

groups, the most effective result was detected in

EPI+DAU treatment. Inhibition percentage of cell

proliferation, which were calculated by taking control

value as 100%, was given in Figure 7. In combined

treatment, cell viability was influenced by >50 %

inhibition at 8 hours and reduced to 20% at 24 hours.

Discussion

EPI and DAU are the anthracycline antibiotics that

have been examined to determine of their cytotoxities

on HeLa cells in this study. Anthracycline antibiotics


have been in use extensively in the treatment of

widespread tumors. It is suggested that they form a

complex with DNA by intercalation between DNA

strands (Piagram et al. 1972), thus inhibiting DNA

replication and transcription (Di Marco et al., 1971;

Glisson and Ross, 1987), and inducing DNA

fragmentation with inhibition of repair (Lee et al.,

1974). Intercalation appears to interfere with the

topoisomerase-DNA ‘cleavable complex’ and is

emerging as a potentially important mechanism of

action of the anthracyclines (Spadari et al., 1986;

Glisson and Ross, 1987; Mouridsen et al., 1990).

Finally, the anthracyclines have been shown to induce

apoptotic cell death (Ling et al., 1993; Jaffrezou et al.,

1996), although this is likely to be the final cellular

reponse to upstream events such as inhibition of

topoisomerase II (Gewirtz, 1999).

EPI is active against a range of tumors and is

widely used in the treatment of women with early or

advanced breast cancer, administered either alone or in

combination with other anticancer agents (Plosker and

Faulds, 1993). DNA synthesis inhibition, free radical

formation and lipid peroxidation, DNA binding and

alkylation, DNA cross-linking, interference with DNA

strand separation and helicase activity, direct

membrane effects, and the initiation of DNA damage

via the inhibition of topoisomerase II are the

mechanisms responsible for the antiproliferative and

cytotoxic effects of the daunorubicin (Gewirtz, 1999).

Maximal lethal effects of EPI were demonstrated in

the S and G 2 phases of the cell cycle in murine and

human tumour cell lines (Hill and Whelan, 1982). EPI

has been shown to inhibit proliferation of all

neuroblastoma cell lines by 69 to 78 % relative to

controls (Rocchi et al., 1987), of a human alveolar

rhabdomyosarcoma cell clone (Lollini et al., 1989),

and of haemopoietic progenitor cells from several

human leukamic cell lines in liquid culture (Bagnara et

al., 1987).

It is demonstrated that inhibition of DNA and RNA

synthesis in HeLa cells over a concentration range of

0.2 through 2 µΜ DAU ( Di Marco et al., 1965). It is

also found that DAU concentrations of at least 4 µΜ

were required before effects on DNA synthesis were

detected in Ehrlich ascites tumor cells (Dano et al.,

1972). IC 50 value was determined as 1 µΜ after a 2 hour

pulse incubation of HL60 cells with DAU followed by

3-day incubation (Masquelier and Vitols, 2004).

In this study we found that DAU’s cytotoxic effect

had more available than EPI’s cytotoxity for HeLa

cells. Besides, we demonstrated that IC 50 doses of EPI

and DAU for 24 hours. Detected IC 50 values referred to

determine cytotoxicity in the time periods of 0, 2, 4, 8,

16, 24 hours. It was found that cell viability decreased

with IC 50 values in time-dependent manner. The most

effective loss of vitality in HeLa cells was found in

EPI+DAU combination. Cell viability in this group

was reduced to 20% at the end of 24 hours. After

conducting more in vivo and in vitro experiments in

various cell groups, the results obtained in this study

could play an important role as a resource when

designing tumor therapy programs.

References

Effects of antibiotics on cell activities 51

Ar›can Özcan G and Topçul M. Effect of epirubicin on

mitotic index in cultured L-cells. J Cell and Mol Biol. 2:

43-48, 2003.

Bagnara GP, Rocchi P and Bonsi L. The in vitro effects of

epirubicin on human normal and leukemic hemopoietic

cells. Anticancer Res. 7: 1197-1200, 1987.

Chan PK and Chan FY. A study of correlation between

NPM-translocation and apoptosis in cells induced by

apoptosis. Biochem Pharmacol. 57(11): 1265-73, 1999.

Dano K, Frederiksen S and Hellung-Larsen P. Inhibition of

DNA and RNA synthesis by daunorubicin in sensitive

and resistant Ehrlich ascites tumor cells in vitro. Cancer

Res. 32: 1307-1314, 1972.

Di Marco A, Silverstrini R, Di Marco S and T Dasdia.

Inhibiting effect of the new cytotoxic antibiotic

daunomycin on nucleic acids and mitotic activity of

HeLa cells. J Cell Biol. 27: 545-550, 1965.

Di Marco A, Zunino F, Silvestrini R, Gambarucci C and

Gambetta RA. Interaction of some derivatives with

deoxyribonucleic asid and their biological activity.

Biochem Pharmacol. 20: 1323-1328, 1971.

Fischer D, Bieber T, Li Y, Elsässer H-P and Kissel T. A novel

non-viral vector for DNA delivery based on low

molecular weight, branched polyethylenimine: Effect of

molecular weight on transfection efficiency and

cytotoxicity. Pharmaceutical Res. 16(8): 1273-1279,

1999.

Gewirtz DA. A Critical evaluation of the mechanism of

action proposed for the antitumor effects of the

anthracycline antibiotics Adriamycin and Daunorubicin.

Biochem Pharmacol. 57: 727-741, 1999.

Glisson BS and Ross WE. DNA topoisomerase II: a primer

on the enzyme and ›ts unique role as a multidrug target

in cancer chemotherapy. Pharmacology and

Therapeutics. 32: 89-106, 1987.

Greg L, Faulds P and Faulds D. Epirubicin. A review of its


52 Gül Özcan Ar›can and Nazl› Nazmiye Soy

pharmacodynamic and pharmacokinetic properties, and

therapeutic use in cancer chemotherapy. Drugs. 45: 788-

856, 1993.

Hill BT and Whelan RDH. A comparison of the lethal and

kinetic effects of doxorubicin and 4’-epidoxorubicin in

vitro. Tumori. 68: 29-37, 1982.

Jaffrezou JP, Levade T, Bettaieb A, Andrieu N, Bezombes C,

Maestre N, Vermeersch S, Rousse A and Laurent G.

Daunorubicin-induced apoptosis: Triggering of

ceramide generation through sphingomyelin hydrolysis.

EMBO J. 15: 2417-2424, 1996.

Keprtova J, Vyhnakova M, Minarova E and Kleinwachter V.

Effects of daunomycin and its macromolecular analog

daunophilin on the proliferation of mammalian cells.

Neoplasma. 40(3): 161-165, 1993.

Lee YC, Byfield JE, Bennet LR and Chan PYM. X-ray

repair replication in L1210 leukemia cells. Cancer

Research. 34: 2624-2633, 1974.

Lollini PL, De Giovanni C and Del Re B. Myogenic

differentiation of human rhabdomyosarcoma cells

induced in vitro by antineoplastic drugs. Cancer Res. 49:

3631-3636, 1989.

Ling YH, Priebe W and Perez Solar R. Apoptosis induced by

anthracycline antibiotics in P388 parent and multidrug

resistant cells. Cancer Res. 53: 1845-1852, 1993.

Mansilla S, Pina B and Portugal J. Daunorubicin- induced

variations in gene transcription; commitment to

proliferation arrest, senesence and apoptosis. J.

Biochem. 372:703-711, 2003.

Masquelier M and Vitols S. Drastic effect of cell density on

the cytotoxicity of daunorubicin and cytosine

arabinoside. Biochemical Pharmacology. 67(9): 1639-

1646, 2004.

Mc Daid HM and Johnston PG. Synergistic interaction

between paclitaxel and 8-chloro-adenosine 3’,5’monophosphate

in human ovarian carcinoma cell lines.

Clin Cancer Res. 5(1): 215-220, 1999.

Mosmann T. Rapid colorimetric assay for cellular growth

and survival: application to proliferation and

cytotoxicity assay. J Immunol Methods. 65: 55-63, 1983.

Mouridsen HT, Alfthan C, Bastholt L, Bergh J and Dalmark

M. Current status of epirubicin (farmorubicin) in the

treatment of solid tumours. Acta Oncologica. 29: 257-

285, 1990.

Piagram WJ, Fuller W and Hamilton LD. Stereochemistry of

intercalation: interaction of daunomycin with DNA.

Nature New Biology. 235: 17-19, 1972.

Plosker GL and Faulds D. A review of its pharmacodynamic

and pharmacokinetic properties, and therapeutic use in

cancer chemotherapy. Drugs. 45: 788-856, 1993.

Ralph LD, Thomson AH, Dobbs NA and Twelves C. A

population model of epirubicin pharmacokinetics and

application to dosage guidelines. Cancer Chemother

Pharmacol. 52: 34-40, 2003.

Robert J and Gianni L. Pharmacocinetics and metabolism of

anthracyclines. Cancer Surv. 17: 219-252, 1993.

Rocchi P, Ferreri AM and Simone G. Epirubicin-induced

differentiation of human neuroblastoma cells in vitro.

Anticancer Research. 7: 247-250, 1987.

Skladanowski A and Konopa J. Adriamycin and daunomycin

induce programmed cell death (apoptosis) in tumour

cells. Biochem Pharmacol. 46 (3): 375-82, 1993.

Spadari S, Pedrali- Noy G, Focher F, Montecucco A and

Bordoni T. DNA polymerases and DNA topoisomerases

as targets for the development of anticancer drugs.

Anticancer Research. 6: 935-940, 1986.

Topçul MR, Ar›can Özcan G, Erensoy N and Özalpan A.

Effect of epirubicin and tamoxifen on labelling index in

FM3A cells. J Cell and Mol Biol. 2: 81-85, 2002.

Zhang W, Zalcberg JR and Cosolo W. Interaction of

epirubicin with other cytotoxic and anti-emetic drugs.

Anticancer Drugs. 3(6): 593-597, 1992.


Introduction

Journal of Cell and Molecular Biology 4: 53-58, 2005.

Haliç University, Printed in Turkey.

Effect of MMP-1 polymorphism on early term osseointegrated dental

implant failure: A pilot study

Volkan Ar›san*, Cüneyt Karabuda and Tayfun Özdemir

*Istanbul University, Faculty of Dentistry, Department of Oral Implantology, Capa-Istanbul-TURKEY

(* author of correspondence)

Abstract

Osseointegrated dental implants are widely used for replacing missing teeth. Despite of reported high success rates,

failures during healing phase of dental implants are still remarkable. Even under strictly controlled cases, sometimes

bone tissue does not attach to titanium implant body or the implant body is lost by acute inflammatory reaction

during healing phase. Genetic polymorphism may be a promoting factor for this phenomenon. Intravenous blood

samples are taken from 11 patients who lost at least one dental implant during healing phase. Genomic DNA was

amplified by polymer chain reaction (PCR) and analyzed by endonucleases. Within the limited results of this study

it may be concluded that MMP-1 gene polymorphism may be associated with failure during healing time of

Osseointegrated dental implants

KKeeyy wwoorrddss:: polymorphism, implant failure, matrix metalloproteinases, early implant loss.

MMP-1 Polimorfizminin Erken Dönem Osseointegre ‹mplant Baflar›s›zl›¤›na Etkisi:

Pilot Çal›flma

Özet

Osseointegre difl implantlar› difl eksikli¤ini giderilmesinde yayg›n olarak kullan›lmaktad›r. Bildirililen yüksek baflar›

oranlar›na ra¤men, iyileflme dönemindeki kay›plar halen sorgulanmaktad›r. S›k› kontrol alt›ndaki vakalarda bile kimi

zaman konak kemik dokusu implant yüzeyine yap›flmamakta veya akut inflemasyon sonucu implant

kaybedilmektedir. Genetik polimorfizmin bunda rolü olabilir. ‹yileflme döneminde en az 1 implant kaybeden 11

hastadan intavenöz kan örnekleri al›nm›flt›r. Genomik DNA polimeraz zincir reaksiyonu (PCR) ile büyütülmüfl ve

endonükleaz enzimleri ile analiz edilmifltir. Bu çal›flma s›n›rlar›nda MMP-1 gen poliformizminin osseointegre difl

imlantlar›n›n iyileflme dönemindeki kay›plar ile iliflkili olabilece¤i düflünülebilir.

AAnnaahhttaarr SSöözzccüükklleerr:: Polimorfizm, implant baflar›s›zl›¤›, matriks metaloproteinaz, erken implant kayb›

Osseointegration is called as direct contact of vital

bone to a load bearing titanium implant surface.

Branemark et al., (1977) demonstrated the utilization

of osseointegrated titanium dental implants for the

rehabilitation of edentulous patients. The results were

quite satisfactory for the patients. Afterwards, various

kinds of applications had published and dental implant

therapy has become a standard therapy for replacing

missing teeth.

In this treatment protocol, implants are inserted

53


54 Volkan Ar›san et al.

surgically in to the alveolar crest and a healing period

of 3- 6 month is proposed for the osseointegration to

occur. After the healing period implants are

functionally loaded by suitable prostheses. Small

amount of implants are lost by infection or can not

osseointegrate during 3- 6 months of healing. This

situation is called as “early implant failure” by some

authors. Besides contributing factors as surgical

trauma, local and systemic factors, genetic heritages as

polymorphisms are investigated at different studies

(Dos Santos et al., 2004; Santos et al., 2004; Grucia et

al., 2004; Shimpuku et al., 2003).

Today, dental implant therapy has become the

ultimate standard for replacing missing teeth. Natural

esthetics and optimal function are established with the

utilization of dental implants and the patient

satisfaction increases as well. Despite of high success

rates reported by various authors, mechanisms of

implant failure is still questionable. Especially so

called early implant failure or implant loss with in the

healing time of implants. Surgical trauma, acute

infection, lack of stability, insufficient

biocompatibility of implant body, smoking and host

response are considered as possible factors of early

implant failure. Beside these important factors

multiple failures seen on same person supports the

idea of genetic factors effecting healing mechanisms

and probably early implant failure. However, little is

known about genetic susceptibility to osseointegrated

implant failure (Kronstrom et al., 2001).

Polymorphism is described as minor genetic

variations in some individuals that can be considered

in the normal biological range. However these

variations may increase tendencies or risks to

particular diseases such as diabetes, cancer and

syndromes. Metalloproteines variations have showed

to be associated with several diseases as coronary

problems, fetus membrane ruptures and different

forms of periodontitis (Birkedal-Hansen., 1993).

Matrix metalloproteins are produced by

inflammatory cells and responsible of extra cellular

matrix metabolism which associated with collagen

Table-1: Parameters of failure and successful groups

processing. A human study by Golub et. al., (1995)

reported elevated levels of MMP at the crevicular fluid

around failing implants and teeth affected by

periodontitis. Fibroblast type collagenase (MMP-1) is

associated with collagen degradation. Collagen types

of I, II, III and IX are degraded by MMP-1, hence

these are the most common protein components of

extracellular matrices (Nomura et al., 2000; Sorsa et

al., 2004). Expression of MMP-1 is normally low but

induced by phorbol esters, growth factor, and

inflammatory cytokinins. If MMP-1 is overexpressed,

some pathological problems has associated with this

overexpression. The guanine insertion at position 1607

of the human MMP-1 gene creates the 2G allele,

which has been shown to increase transcriptional

activity (Santos et al., 2004). The presence of this

allele has been associated with the development of

ovarian cancer and other carcinoma types, changes in

bone mineral density, premature rupture of the fetal

membranes and chronic periodontitis severity

(deSouza et al., 2003; Dos Santos et al., 2004;

Engerbretson et al., 1999; Kiili et al., 2002; Kivela et

al., 2003).

Objective of our study is to investigate the rate of

MMP-1 polymorphism in individuals with early

implant loss to verify the relationship between MMP-

1 and early implant failure.

Material and methods

Patients

32 patients (14 female, 18 male) are included in the

study group. Test group consisted of 11 patients

(failure group) who lost at least one implant in the

healing time. Control group consisted of 21 patients

(successful group) who carry implant supported

prosthesis for at least 6 months. All patients were in

good general oral and systemic condition, nonsmokers

and did not have any following diseases:

uncontrolled diabetes, hepatitis, immunosuppressive

Implants Test group (Implant failure) Control group

Maxillary (%) 12 (%18) 27 (%41)

Mandibular (%) 4 (%6) 22 (%35)


chemotherapy, or any disease known to severely

compromise immune function. None of the patients

went under extensive bone grafting or regenerative

surgery. Mean age for the control group is 37,68

ranged between 65 – 21 and for the test group is 44,36

ranged between 55 – 32. A total of 65 dental implants

placed. (39 maxilla and 26 mandibula) Distribution of

the implants is shown in Table 1.

DNA extraction

Five ml of veneous blood from each subject was

drawn in Vacutainer tubes containing EDTA and

stored at 4°C. Genomic DNA was extracted within one

week after sampling by using proteinase K digestion

followed by a Qiagen Blood DNA isolation kit

according to manufaturer instructions. The amount of

DNA was estimated by measuring the optical density

(OD) at wavelenghts of 260nm and 280nm. 1%

agarose gel containing EtBr was used for DNA bands

visualization.

Polymerase chain reaction

The MMP1 genotypes were determined by

polymerase chain reaction-restriction fragment lenght

polymorphism (PCR-RFLP). The primers used for

amplifying the MMP1 single nucleotid polymorphisim

(SNP) were 5’- TGACTTTTAAAACATAGTCTAT

GTTCA-3’ (forward) and 5’-TCTTGGATTGAT

TTGAGATAAGTATAGC-3’ (reverse). A mutation

from T to G at the second nucleotide close to the 3’ end

of the reverse primer was made to create an Alu1

(AGTC) recognition site in the case of 1G allele. The

PCR reactions were performed in a 25ul volume

containing 100ng of DNA template, 2,5ul of 10x PCR

buffer, 2.0 mM MgCl 2, 2.5U of Taq DNA polymerase,

0.2 mM dNTPs and 0.2uM forward and reverse

primer. The PCR cycling conditions were 5min at

94°C followed by 35 cycles of 30s at 94°C, 30s at

58°C and 30s at 72°C, and with a final step at 72°C for

Table-2: MMP-1 gene polymorphism of failure and successful groups

5 min to allow for the complete extension of all PCR

fragments. An 8ul aliquot of PCR product was

digested overnight 37°C or 4 hours at 65°C in a 10ul

reaction containing 10U of Alu I (New England

Biolabs). After digestion, the products were subjected

to electrophoresis on a 3% agarose gel stained with

EtBr. The MMP1 2G alleles were represented by a

DNA band with size at 269bp, the 1G alleles were

represented by two DNA bands with size 241 abd

28bp, whereas the heterozygotes displayed a

combination of the both alleles (269, 241 and 28bp).

For negative control, distilled water instead of

DNA in the reaction system was used for each panel of

PCR. For 10% of samples, the PCR were repeated

once for quality control.

Statistical analyses were performed using SPSS

11.0 software package. Hardy Weinberg analysis was

performed to compare the observed and expected

genotype frequencies using Chi-Square test. The odds

ratio (OR) and 95% confidence interval (CI) were

calculated using an unconditional logistic regression

odel and adjusted by age and gender accordingly. A

probability level of 5% was considered significant for

all statistic analyses.

Results

Polimorphism in implant failure 55

MMP-1 gene allele was found at 8 patients out of total

11 patients (failure group) who lost at least one

implant during healing time (p= 0,043). Table – 2

Hardy Weinberg equilibrium demonstrated the present

polymorphism (p< 0.05). We have seen a significant

difference in the presence of the different alleles when

we compared the failure vs. successful group (P =

0.0344). In the implant failure group, the 2G allele was

observed with a frequency of 88%, while in healthy

subjects the 2G allele was seen in 45%. When we

compare the groups, with each other, we observed a

difference in the genotypes frequencies between the

failure and successful groups (p = 0.0647). The

Implant Failure Control group

Number of patients 11 21

1G/1G 3(%27) 16 (%76)

2G/2G 8 (%73) 5 (%24)


56 Volkan Ar›san et al.

Table-3: 1G and 2G allele frequencies of failure and successful groups.

Allele frequency Implant failure (n=11) Control group (n=21)

1G (%) (%12) (%55)

2G (%) (%88) (%45)

genotype 2G/2G was found in 73.15% in the group

with implant failure and the frequencies of 24.2%

were observed in success group. In a separated

analysis, we grouped individuals successful vs.

implant failure groups and calculated the risk

associated with individual alleles. Individuals with the

2G allele seem to be approximately three times more

likely to develop the overall implant failure (p = 0.046;

OR = 2.106, 95% Cl = 1.10 4.34). Individuals with the

2G/2G genotype seem to be three times more likely to

develop implant failure than individuals who are

1G/1G homozygous (p = 0.0721, OR = 6.10, 95% CI=

2.3457 24.345) (Table - 3).

Discussion

MMPs are a family of structurally related but

genetically distinct enzymes that degrade extracellular

matrix (ECM) and basement membrane (BM)

components. This group of 23 human enzymes is

classified into collagenases, gelatinases, stromelysins,

membrane-type MMPs and other MMPs, mainly

based on the substrate specificity and molecular

structure. MMPs are involved in physiological

processes such as tissue development, remodelling

and wound healing (Uitto et al., 2003), and play

important roles in the regulation of cellular

communication, molecular shedding and immune

functions by processing bioactive molecules including

cell surface receptors, cytokines, hormones, defensins,

adhesion molecules and growth factors (Sorsa et al.,

2004). MMP activity is controlled by changes in the

delicate balance between the expression and synthesis

of MMPs and their major endogenous inhibitors,

tissue inhibitors of matrix metalloproteinases (TIMPs)

(Nomura et al., 2000). The catalytic competence of

MMPs is controlled through the activation of

proenzymes, and the inhibition of the activation or

activity by TIMPs (Uitto et al., 2003).

As the roles of MMPs in tissue degenerative

diseases have became evident, attempts to control

their activities by pharmacological means have gained

much attention. Although the exact roles of individual

MMPs in various diseases are not fully understood, it

is clear that MMPs are often up-regulated in groups

forming activation cascades both in the inflammatory

and malignant diseases (Uitto et al., 2003).

The story of MMP family members in oral diseases

is far from complete it seems that it has only just

begun. For example, several molecular forms of

MMP-8 isoenzymes and their multiple active forms in

periodontits plaque, GCF and PISF have been

identified (Sorsa et al, 1995; Kiili et al., 2002; Kivelä-

Rajamäki et al., 2003a,b). Future studies should

examine the synthesis, role and inhibition of how these

different MMP-8 isoenzymes function in vivo. The

possibility to use the local MMP inhibition to prevent

dentinal caries progression or loss of adhesive

restorations remains to be studied. Matrix

metalloproteinase-1 seems to play an important role

during the destruction of the extracellular matrix in

periodontal disease. Immunoreactivity for MMP-1

was found in granulation tissue of chronic

periodontitis patients, while only moderate

immunostaining for MMP-8 (neutrophil collagenase)

could be detected (Sorsa et al., 2004). Additionally,

reverse transcriptase-polymerase chain reaction has

shown that mRNA levels of MMP-1 are significantly

increased in inflamed gingival tissue, while only very

low levels of MMP-8 transcripts were detected in

diseased gingival tissue. (Aiba et al., 1996). These

results suggest that MMP-1 rather than MMP-8 seems

to be the major interstitial collagenase present in

inflamed periodontal tissue.

Early term implant loss is still under discussion by

authors because of its multi-factoral ethiology.

Immunological factors were questioned becacause of

elevated local reaction of immune mediators to

implant site seen on some patients. There are few

studies regarding implant treatment at patients with

immune related diseases like aggressive periodontitis

(Yalcin et al., 2001) and Sjogren syndrome (Isidor et

al., 1999). No studies conducted with relation to

implant treatment and polymorphism for this special

patient group. Polymorhisms and different alleles may


also be affecting immune response to dentition and

implants in these patients as well. Process of

osseointegration may probably being effected by the

variations of polymorphic alleles. If activated,

cytokines may initiate an inflamatory response wich

may lead to ostelysis.

Rogers (2002) searched the link between IL-1

genotype polymorphism and late term implant loss

and found no correlation. (Santos et al., 2004)

investigated the the MMP-1, MMP-9 and TGF ß-1

polymorphisms and their effect on early implant

failure. MMP-1 gene, 2G allele was found at 25% of

the patients with sucessfull implants and 50% of the

patients of early implant failure. In our study we found

MMP-1 gene polymorphism in 88% of the the patients

in the test group. This may be due to small number of

investigated patients of the failure group in this study.

Implants in the maxilla has elevated risks for

failure. (Kohavi et al., 2004, Garlini et al., 2003)

Decreased bone quality, wide trabeculation and

improper angulation are assumed for this failure. In

our study 75% of failed implants was installed to

maxilla. However our study group is not big enough to

exclude the exact risks for prolymorphism or

localisation of mandibula versus maxilla.

In this pilot study, patients with polymorphism at

the promoter region of MMP-1 gene and 2G allele was

found to have increased risk for early term implant

failure compared to patients with 1G allele. A larger

group of patients have to be investigated in order to

obtain a more accurate statistical result about MMP-1

gene polymorphism and early implant failure.

In conclusion, our results indicate that the 2G/2G

polymorphism in the promoter of the MMP-1 gene

could be a risk factor for implant failure. With in the

limits of this pilot study it can be concluded that

genetic screening may help to evaluate and discuss

considarable risks with patient before the initiation of

the implant therapy.

References

Aiba T, Akeno N, Kawane T, Okamoto H, Horiuchi N.

Matrix metalloproteinases-1 and-8 and TIMP-1 mRNA

levels in normal and diseased human gingivae. European

Journal of Oral Science. 104: 562 569, 1996.

Birkedal-Hansen H. Role of matrix metaloproteinase in

human periodontal diseases. Journal of Periodontology.

64 (Suppl 5): 474-484, 1993.

Polimorphism in implant failure 57

Brånemark P, Hansson B, Adell R, Breine U, Lindström J,

Hallén O, Öhman A. Osseointegrated implants in the

treatment of the edentulous jaw. Experience from a 10year

period. Scandinavian Journal of Plastic and

Reconstructive Surgery. 11 (suppl 16): 104-119, 1977.

de Souza A, Trevilatto P, Scarel-Caminaga R, Brito R &

Line S. MMP-1 promoter polymorphism: association

with chronic periodontitis severity in a Brazilian

population. Journal of Clinical Periodontology. 30: 154-

158, 2003.

Dos Santos M, Campos M, Souza A, Scarel-Caminaga R,

Mazzonetto R, Line S. Analysis of the transforming

growth factor-beta 1 gene promoter polymorphisms in

early osseointegrated implant failure. Implant Dentistry.

13(3):262-9, 2004.

Engerbretson S, Lamster I, Herrera-Abreu M, Celenti R,

Timms J, Chaudhary A, di Giovine F & Kornman K. The

influence of interleukin gene polymorphism on

expression of interleukin-1 and tumor necrosis factorin

periodontal tissue and gingival crevicular fluid.

Journal of Periodontology. 70: 567-573, 1999.

Golub L, Sorsa T, Lee H, Ciancio S, Sorbi D, Ramamurthy

N, Gruber B, Salo T, Konttinen Y. Doxycycline inhibits

neutrophil (PMN)-type matrix metalloproteinases in

human adult periodontitis gingiva. Journal of Clinical

Periodontology. 22(2):100-9, 1995.

Gruica B, Wang HY, Lang NP, Buser D. Impact of IL-1

genotype and smoking status on the prognosis of

osseointegrated implants. Clinical Oral Implants

Research. 15(4):393-400, 2004.

Kiili M, Cox SW, Chen HW. Collagenase-2 (MMP-8) and

collagnase-3 (MMP-13) in adult periodontitis: molecular

forms and levels in gingival crevicular fluid and

immunolocalization in gingival tissue. Journal of

Clinical Periodontology. 29: 224-232, 2002.

Kivelä-Rajamäki M, Teronen O, Maisi P. Laminin-5

gamma2-chain and collgenase-2 (MMP-8) in human

peri-implant sulcular fluid. Clinical Oral Implants

Research. 14: 158-165, 2003.

Kohavi D, Azran G, Shapira L, Casap N. Retrospective

clinical review of dental implants placed in a university

training program. Journal of Oral Implantolology.

30(1):23-9, 2004.

Isidor F, Brondum K, Hansen HJ, Jensen J, Sindet-Pedersen

S. Outcome of treatment with implant-retained dental

prostheses in patients with Sjogren syndrome.

International Journal of Oral and Maxillofacial

Implants. 14(5):736-43, 1999.

Kronstrom M, Svenson B. Hellman M, Persson GR. Early

implant failures in patients treated with Branemark

System titanium dental implants: a retrospective study.

International Journal of Oral and Maxillofacial

Implants. 16(2):201-7, 2001.

Rogers MA, Figliomeni L, Baluchova K, Tan AE, Davies G,

Henry PJ, Price P. Do interleukin-1 polymorphisms


58 Volkan Ar›san et al.

predict the development of periodontitis or the success

of dental implants? Journal of Periodontal Research. 37-

41, 2002.

Santos MC, Campos MI, Souza AP, Trevilatto PC, Line SR.

Analysis of MMP-1 and MMP-9 promoter

polymorphisms in early osseointegrated implant failure.

International Journal of Oral and Maxillofacial

Implants. 19(1): 38-43, 2004.

Shimpuku H, Nosaka Y, Kawamura T, Tachi Y, Shinohara

M, Ohura K. Bone morphogenetic protein-4 gene

polymorphism and early marginal bone loss around

endosseous implants. International Journal of Oral and

Maxillofacial Implants. 18(4): 500-4, 2003.

Sorsa T, Tjäderhane L, Salo T. Matrix metalloproteinases

(MMPs) in oral diseases. Journal of Oral Diseases.

10(6): 311-318, 2004.

Nomuta T, Ishii A, Shimuzu H, Taguchi N, Yoshie H,

Kusakari H, Hara K. Tissue inhibitor of

metalloproteinases-1, matrix metalloproteinases-1 and -

8, and collagenase activity levels in peri-implant

crevicular fluid after implantation. Clinical Oral

Implants Research. 11(5): 430-440, 2000.

Uitto VJ, Overall CM, McCulloch C . Proteolytic host

enzymes in gingival crevice fluid. Periodontology 2000

31: 77-104, 2003.

Yalcin S, Yalcin F, Gunay Y, Bellaz B, Onal S, Firatli E.

Treatment of aggressive periodontitis by osseointegrated

dental implants. A case report. Journal of Periodontol.

72(3): 411-6, 2001.


Instructions for authors

General

1. Journal of Cell and Molecular Biology

is published biannually (January and July) and

covers all aspects relating to cell biology, molecular

biology, genetics, microbiology and related topics.

2. Manuscripts must be written in English.

Particular attention should be given to

consistency in the use of technical terms

and abbreviations.

3. Manuscripts (in triplicate) should be sent to:

The Editorial Office

Journal of Cell and Molecular Biology,

Haliç Üniversitesi,

Fen-Edebiyat Fakültesi,

Ahmet Vefik Pafla Cad. No :1

34280, F›nd›kzade,

‹stanbul-Turkey

4. Each submitted manuscript will be assessed by a

member of the editorial board and by two expert

referees. Authors will be consulted if the paper is

considered suitable for publication but alterations

are tought desirable. After these alterations have

been included the manuscript must be considered

final.

5. The author is the only responsible person from the

content of manuscript.

Condition for publication

Three types of paper will be published, these are

original research papers, review articles and letters to

the editor. Book reviews are also welcome.

1. Original research papers: Only original

contributions will be accepted which have not been

published previously. Manuscripts should not

exceed 10 paper of printed text, including tables,

figures and references (one page of printed text =

approximately 600 words).

2. Review article: Reviews of recent developments

and ideas will be accepted. Manuscripts should not

exceed 15 papers of printed text.

3. Letters to editor: These include opinions, news and

suggestions. Letters should not exceed 2 papers of

printed text.

P resentation

59

1. Papers should be typed clearly, double-spaced on

only one side of A4 white bond paper, with

approximately 3 cm. wide margins.

2. Manuscript should be prepared using Word

Processor. After final acceptance we will ask you to

submit a revised disk copy of your manuscript,

which will enable us to more efficiently and

accurately prepare proofs.

3. The first page should indicate the title of the

contribution in English and in Turkish, name(s) of

the author(s) and address(es) of the institution, a

short running title of six to eight words, the name

and address of the corresponding author and 5 key

words in English and in Turkish.

4. The title should be as short as possible, but should

contain adequate information regarding the

contents.

5. A brief, informative abstract not exceeding 200

words should be provided in English and in

Turkish.

6. The following sections cover the usual contents:

Introduction, Materials and Methods, Results,

Discussion, Acknowledgements, References (see

below), Tables (see below), Figure legends (see

below).

7. Results of experiments should be provided in either

tabular or diagrammatic form, but not in both.

8. Acknowledgements should follow the text and

precede the reference.

9. All pages must be numbered.

Disk submission

Authors are invited to join to the final

version of their article in diskette. Preferably send as a

3 1/2 disk in Word Processing software.

Tables and figures

1. Each table should be typed on a separate sheet,

numbered with Arabic numerals and accompanied

by a short instructive title line plus an explanatory

caption at the top. Indicate footnotes within tables


60

by superscript small letters and type footnotes

below the table. Each table must be referred to in

the text.

2. Fine drawings can either submitted as original

drawings ready for print or as clean and high

contrast glossy black and white photographs.

3. Photographs must be supplied as black and white,

high contrast, glossy prints, trimmed at right angles.

4. Captions for figures should be typed

double-spaced, on a separate sheet. Each caption

should be identified as Figure 1 etc. and be

complete, clean and concise, so that each figure

and its caption could be understood without

reference to the text. Do not give magnification on

scales in the figure titles; instead draw bar scales

directly on the figures.

5. Each illustration should have the title of the paper

and the figure number written on the back in soft

pencil. The top of the figure should also be

indicated on the back.

6. The approximate position of the tables and figures

should be indicated in the margin of the manuscript.

Units, abbreviations and scientific names

1. Only SI units should be used. Current abbreviations

can be used without explanation. Other must be

explained. In case of doubt always give an

explanation.

2. Latin names should be underlined or typed in italics.

References:

1. Citation in the text should take the form: Smith and

Robinson (1990) or (Smith and Robinson, 1990). If

several papers by the same author in the same

year are cited, they should be lettered in sequence

(1990a), (1990b), etc. When papers are by more

then two authors they should be cited as Smith et

al. (1990) or (Smith et al., 1990).

2. In the list, references must be placed in alphabetical

order. The following models for the reference list

cover all situations. The punctuation given must be

exactly followed.

Redford IR. Evidence for a general relationship

between the induced level of DNA double-strand

breakage and cell killing after X-irradiation of

mammalian cells. Int J Radiat Biol. 49: 611- 620,

1986.

Taccioli CE, Cottlieb TM and Blund T. Ku 80: Product

of the XRCCS gene and its role in DNA repair and

V (D) J recombination. Science. 265: 1442-1445,

1994.

Ohlrogge JB. Biochemistry of plant acyl carrier

proteins. In: The Biochemistry of Plants: A

Comprehensive Treatise. Stumpf PK and Conn EE

(Ed). Academic Press, New York. 137-157, 1987.

Weaver RF. Molecular Biology. WCB/Mc

Graw-Hill.1999.

2. Only papers published or in press should be cited in

the literature list. Unpublished results, including

submitted manuscripts and those in preparation,

should be cited as unpublished in the text.

3. The list of literature must be typed double space

throughout and checked thoroughly before

submission.

P roofs and offprints

1. Page proofs will be sent to the corresponding

author for checking before publication. Corrected

proofs should be sent back to the Editor within

three days of receipt, otherwise Editor reserves the

rights to correct the proofs himself and to send the

material for publication.

2. Contributors receive 25 offprints of their articles

free of charge.


Journal of Cell and Molecular Biology

CONTENTS Volume 4, No.1, 2005

Review articles

The biochemical fundamentals of angiotensin converting enzyme (ACE) gene

polymorphism in myocardial infarction

Miyokard infarktüsünde angiotensin dönüfltürücü enzim (ADE) gen polimorfizminin

biyokimyasal temelleri

F. E. Kayhan, C. Sesal 1-8

Programmend cell death in plants

Bitkilerde programlanm›fl hücre ölümü

N. Palavan-Ünsal, E. D. Büyüktuncer, M. A. Tüfekçi 9-23

Research papers

Effects of captopril, an angiotensin converting enzyme inhibitor on

TAME-ebterase induced contractions in rat aorta strips in vitro

In vitro koflullarda s›çan aort striplerinde angiotensini dönüfltüren enzim inhibitörü

kaptoprilin, TAME-esterazin uyard›¤› kas›lmalara etkileri

A. H. Subratty, F. B. H. Gunny 25-29

Metabolic changes and protein patterns associated with adaptation to

salinity in Sesamum indicum culvitars

Sesamum indicum kültürlerinde tuzlulu¤a adaptasyonla iliflkili protein profilleri

ve metabolik de¤iflmeler

H. S. Gehlot, A. Purohit, N. S. Shekhawat 31-39

Cytogenetic effect of heavy-metal and cyanide in contaminated waters

from the region of southwest Bulgaria

Bulgaristan’›n güneybat› bölgesindeki kontamine sularda a¤›r metal

ve siyanürün sitogenetik etkileri

T. A. Staykova, E. N. Ivanova, I. G. Velcheva 41-46

Effects of epirubicin and daunorubicin on cell profileration and

cell death in HeLa cells

Epirubisin ve daunorubisinin hücre ço¤almas› ve hücre ölümü üzerine

etkilerinin HeLa hücrelerinde araflt›r›lmas›

G. Ö. Ar›can, N. N. Soy 47-52

Effect of MMP-1 polymorphism on early term osseointegrated dental

implant failure: A pilot study

MMP-1 polimorfizminin erken dönem osseointegre implant baflar›s›zl›¤›na

etkisi: Pilot çal›flma

V. Ar›san, C. Karabuda, T. Özdemir 53-58

Instructions for authors 59-60

More magazines by this user
Similar magazines