10 2 Full Volume (PDF) - Journal of Cell and Molecular Biology ...

jcmb.halic.edu.tr

10 2 Full Volume (PDF) - Journal of Cell and Molecular Biology ...

•Circadian rhythm genes in cancer

•Tunneling nanotubes

Journal of Cell and

Molecular Biology

•Genetic screening of Turkish barley genotypes

•Strontium ranelate induces genotoxicity

Volume 10 · No 2 · December 2012

http://jcmb.halic.edu.tr


Journal of Cell and

Molecular Biology

Volume 10 · Number 2

December 2012

İstanbul-TURKEY


Haliç University

Faculty of Arts and Sciences

Journal of Cell and Molecular Biology

Founder

Gündüz GEDİKOĞLU

Our Children Leukemia Foundation

Rights held by

A. Sait SEVGENER

Rector

Correspondence Address:

Journal of Cell and Molecular Biology

Haliç Üniversitesi

Fen-Edebiyat Fakültesi,

Sıracevizler Cad. No:29 Bomonti 34381 Şişli

İstanbul-Turkey

Phone: +90 212 343 08 87

Fax: +90 212 231 06 31

E-mail: jcmb@halic.edu.tr

Journal of Cell and Molecular Biology is

indexed in

ULAKBIM, EBSCO,

DOAJ, EMBASE,

CAPCAS, EMBiology,

Socolar, Index COPERNICUS,

Open J-Gate, Chemical Abstracts

and

Genamics JournalSeek

ISSN 1303-3646

Printed at MART Printing House

Editor-in-Chief

Nagehan ERSOY TUNALI

Editorial Board

M. Baki YOKEŞ

Kürşat ÖZDİLLİ

Nural BEKİROĞLU

Emel BOZKAYA

M.Burcu IRMAK YAZICIOĞLU

Mehmet OZANSOY

Editorial Assistance

Ozan TİRYAKİOĞLU

Özlem KURNAZ

Advisory Board

A. Nur BUYRU, İstanbul, Turkey

Adil Meriç ALTINÖZ, Istanbul, Turkey

Adile ÇEVİKBAŞ, İstanbul, Turkey

Aglaia ATHANASSIADOU, Patras, Greece

Aglika EDREVA, Sofia, Bulgaria

Anne FRARY, İzmir, Turkey

Asım KADIOĞLU, Trabzon, Turkey

Ayla ÇELİK, Mersin, Turkey

Ayşe ÖZDEMİR, İstanbul, Turkey

Beyazıt ÇIRAKOĞLU, İstanbul, Turkey

Canan ARKAN, Munich, Germany

E. Zerrin BAĞCI, Tekirdağ, Turkey

Fatma Neşe KÖK, İstanbul, Turkey

Ferruh ÖZCAN, İstanbul, Turkey

Fevzi DALDAL, Pennsylvania, USA

Gizem DİNLER DOĞANAY, İstanbul, Turkey

Hande ÇAĞLAYAN, İstanbul, Turkey

Hande GÜRER ORHAN, İzmir, Turkey

İlhan YAYLIM ERALTAN, İstanbul, Turkey

İsmail ÇAKMAK, İstanbul, Turkey

İsmail TÜRKAN, İzmir, Turkey

Kemal BÜYÜKGÜZEL, Zonguldak, Turkey

Maria V. KALEVITCH, Pennsylvania, USA

Mehmet TOPAKTAŞ, Adana, Turkey

Meral KENCE, Ankara, Turkey

Meral ÜNAL, İstanbul, Turkey

Müge TÜRET SAYAR, İstanbul, Turkey

Mustafa DJAMGÖZ, London, UK

Nermin GÖZÜKIRMIZI, İstanbul, Turkey

Nevin Gül KARAGÜLER, İstanbul, Turkey

Nihat BOZCUK, Ankara, Turkey

Pınar SAİP, Istanbul, TURKEY

Rezan FAHRİOĞLU YAMACI, Nicosia, Cyprus

Şehnaz BOLKENT, İstanbul, Turkey

Selma YILMAZER, İstanbul, Turkey

Sevtap SAVAŞ, Toronto, Canada

Uğur ÖZBEK, İstanbul, Turkey

Ünal EGELİ, Bursa, Turkey

Valentine KEFELİ, Pennsylvania, USA

Zihni DEMİRBAĞ, Trabzon, Turkey

Ziya ZİYLAN, İstanbul, Turkey


Journal of Cell and Molecular Biology

CONTENTS

Volume 10 · Number 2 · December 2012

Review Articles

Transforming acidic coiled-coil proteins and spindle assembly

S. TRIVEDI

Marker Systems and Applications in Genetic Characterization Studies

Y. ÖZŞENSOY, E. KURAR

Research Articles

COX5B and COX2 gene expressions in Multiple Sclerosis

N. SAFAVIZADEH, S. A. RAHMANI , M. ZAEFIZADEH

Curcumin rendered protection against cadmium chloride induced

testicular damage in Swiss albino mice

P. SINGH, K. DEORA, V. SANKHLA, P. MOGRA

Study of Klebsiella pneumoniae isolates with ESBL activity, from ICU

and Nurseries, on the island of Mauritius

S.K. MUNGLOO-RUJUBALI, M.I. ISSACK, Y. JAUFEERALLY-FAKIM

HIV-1 reverse transcriptase inhibition by Vitex negundo L. leaf extract

and quantification of flavonoids in relation to anti-HIV activity

M. KANNAN, P. RAJENDRAN, V. VEDHA, G. ASHOK, S. ANUSHKA,

P. CHANDRAN RAMACHANDRAN NAIR

Genetic characterization and bottleneck analysis of Korki Jonub

Khorasan goats by microsatellite markers

B. MAHMOUDI, O. ESTEGHAMAT, A. SHARIYAR. M.Sh. BABAYEV

Low-Stringency Single-Specific-Primer PCR as a tool for detection of

mutations in the matK gene of Phaseolus vulgaris exposed to

paranitrophenol

Mohamed R. ENAN

Short Communication

Characterization of Paenibacillus larvae isolates from Brazil

S.S. CHAGAS, R.A. VAUCHER, A. BRANDELLI

Guidelines for Authors

1

11

21

31

39

53

61

71

79

83


Front cover image: “Cell division”

Shutterstock image ID: 4099351


Journal of Cell and Molecular Biology 10(2):1-10, 2012 Review Article 1

Haliç University, Printed in Turkey.

http://jcmb.halic.edu.tr

Transforming acidic coiled-coil proteins and spindle assembly

Seema TRIVEDI*

(* author for correspondence; svtrived@hotmail.com)

Received: 2 January 2012; Accepted: 5 November 2012

Abstract

Transforming acidic coiled-coil proteins (TACC) are essential for mitosis not only by their association

with the centrosome and assembly of spindle microtubules, but also by involvement in cell cycle

checkpoints. In order to stabilize spindle fibers, TACCs interact with other microtubule-associated

proteins (MAPs). Dysregulation of TACCs may lead to abnormal cell division that may result in

chromosomal abnormality or tumorigenesis. This review focuses on facts known so far regarding

TACC proteins, their interactions and their involvement in spindle microtubule stability in higher

eukaryotes.

Keywords: Cancer, microtubules, centrosome, spindle fibers, transforming acidic coiled-coil proteins

Özet

Dönüştürücü asidik sarmalanmış sarmal proteinleri ve iğ iplikçiğinin birleşmesi

Dönüştürücü asidik sarmalanmış sarmal proteinleri (TACC) sadece sentrozomlarla ve iğ iplikçiği

mikrotübülleriyle birleşmesiyle olan ilişkileri açısından değil, ayrıca hücre döngüsü kontrol

noktalarına dahil olmaları açısından da mitoz için gereklidir. İğ iplikçiklerini stabilize etmek amacıyla,

TACC’ler diğer mikrotübül ilişkili proteinlerle (MAP) etkileşime girer. TACC’lerin yanlış

düzenlenmesi kromozomal anormallikler ya da tümörigenez ile sonuçlanan anormal hücre

bölünmelerine neden olabilir. Bu derleme, bugüne kadar TACC proteinleri, etkileşimleri ve yüksek

ökaryotlarda iğ iplikçiği kararlılığına katkıları ile ilgili bilinen gerçekler üzerinde durmaktadır.

Anahtar Kelimeler: Kanser, Mikrotübüller, Sentrozom, İğ iplikçikleri, Dönüştürücü asidik

sarmalanmış sarmal proteinleri

Abbreviations

TACC = Transforming Acidic Coiled-coil, MAP = Microtubule Associated Protein, Msps = Mini

spindles, MT = Microtubule, ch-TOG = Colonic–hepatic Tumour-Overexpressed Gene, AAK =

Aurora A Kinase

Introduction

Transforming acidic coiled-coil protein (TACC) is

a family of the microtubule associated proteins

(MAPs) that is crucial for spindle assembly,

maintaining bipolarity and microtubule (MT)

stability during mitosis (Still et al., 2004; Brittle

and Ohkura, 2005; Pearson et al., 2005). TACCs

are even important in acentrosomal (acentriolar or

anastral) meiosis in females of many animal

species where spindle formation is

chromosome centric (Pearson et al., 2005).

TACCs do not have microtubule

stabilizing activity on their own. Instead,

they form complexes with other MAPs to

stabilize spindle fibers. TACC/MAP

complex provides stable association of MTs

with centrosomes at the minus end (Albee

and Wiese, 2008) possibly after release from


2 Seema TRIVEDI

the nucleation site from kinetochores (reviewed in

Raff, 2002). The complex associates at the plus

ends of the MTs growing out from the centrosome

during nucleation (reviewed in Raff, 2002).

However, the exact mechanism by which TACC

interacts with other MAPs and recruits them to the

centrosome is not clearly understood. In

Drosophila, D-TACC recruits Mini spindles protein

(Msps; a conserved family of MAP) (reviewed in

Raff, 2002) and in Xenopus, maskin (TACC3) form

a complex with XMAP215 (Albee and Wiese,

2008). However, the XMAP215 complex may

associate with both plus and minus ends of the MT.

Similarly, human TACCs and ch-TOG (colonic–

hepatic tumour-overexpressed gene) (homologue of

Msps) possibly form a structural lattice at

centrosomes to maintain the integrity of spindle

poles and to stabilize spindle MTs (reviewed in

Raff, 2002; Gergely et al., 2003). However, it is not

known why in cultured human cells TACC3 and, in

Drosophila D-TACC, these proteins are apparently

not essential for recruitment of XMAP215 analogue

(Brittle and Ohkura, 2005). This review focuses on

genomic locations, protein characteristics and

interactions of TACC proteins in humans and

general aspects of role of TACC proteins in spindle

dynamics in higher eukaryotes.

TACC genes and proteins

Three TACC proteins have been identified in

humans, namely TACC1, 2 and 3. The three human

TACCs are related by ~200-amino-acid C-terminal

region (the ‘TACC domain’), which is predicted to

form a coiled coil domain (reviewed in Raff, 2002).

Besides TACC domain, these proteins share

homology (except Drosophila D-TACC) in the

SDP domain as well (Lauffart et al., 2002; Still et

al., 2004). SDP domain is composed of functionally

conserved repeats of 33 amino acids, though the

numbers of repeats are different in different TACC

proteins. Interaction of SDP domain with

transcription factor GAS41/NuBI1 (also known as

YEATS4) has been established (Lauffart et al.,

2002) but this interaction possibly does not directly

affect spindle formation.

Genomic locations of human TACC

reference gene sequences as per NCBI and

details of proteins obtained from SwissProt

are given in Table 1.

Though implicated in several cancers, no

mutations have been reported in the TACC1

gene (Still et al., 2008). TACC1 mRNA

exon 3 contains a predicted nuclear

localization signal (Still et al., 2008), shows

ubiquitous expression and encodes a

cytoplasmic protein which is mainly

perinuclear protein (molecular mass of 125

kDa) (Conte et al., 2002) but different

isoforms in different cells may be localized

in the cytoplasm as well (Lauffart et al.,

2006).

TACC1 protein does not show

compositional bias whereas TACC2 has

poly-lysine and poly-proline rich regions

and TACC3 has poly-serine regions (Table

1). In addition, different sites in the TACC

proteins show post translational covalent

modifications (Table 2). Phosphotyrosine is

seen only in TACC1, while N6-acetyl lysine

is seen only in TACC3 and

phosphothreonine is not seen in TACC1. It

is also pertinent to note that TACC1

phosphorylation varies in different isoforms

(Still et al., 2008).

TACC2 concentration at the centrosome

has been observed even during interphase

unlike TACC1 and TACC3 proteins

(Gergley et al., 2000a). TACC3, also known

as ERIC1 (Still et al., 2004; Eslinger et al.,

2009) a non-motor MAP, was also identified

as an ARNT interacting protein (Aint1) in

mice (Aitola et al., 2003) and is expressed in

proliferative tissues (Aitola et al., 2003;

reviewed in Hood and Royle, 2011). During

mitosis, TACC3 is localized to centrosome

but during interphase, TACC3 is seen in

cytoplasmic or perinuclear regions (Piekorz

et al., 2002). The TACC3 gene has five

reported mutations: CAG to CGG, TCG to

TTG, CGT to TGT, CAG to TAG and TCA

to TTA (Eslinger et al., 2009).


TACC proteins in spindles 3

Table 1. Human TACC Genomic Location (as per NCBI + ), Introns, mRNA And Splice Variants (as per NCBI AceView + )

and Protein Details (as per SwissProt * ).

Official Symbol TACC1 TACC2 TACC3

Genomic Location 8p11.22 10q26 4p16.3

Genomic Sequence

NC_000008.10

38585704..38710546

NC_000010.10

123748689..124014057

NC_000004.11

1723266..1746898

Number of Introns + 44 49 23

mRNA + 38 (7 unspliced) 35 (7 unspliced) 16 (3 unspliced)

Protein *

TACC1 (O75410

TACC1_HUMAN)

TACC2 (O95359

TACC2_HUMAN)

TACC3 (Q9Y6A5

TACC3_HUMAN)

Length (number of amino acids) 805 2948 838

Number of Isoforms + 27 26 15

Features Description

Coiled coil Potential

Compositional

bias

Domain

Motif

Region

TACC1

610 - 805

Position

TACC2 TACC3

2675 - 2703 637 - 837

2746 - 2947

Poly-Lys 2420 - 2423

Poly-Ser 155 - 160

Pro-rich 1956 - 2016

482 - 549

SPAZ 2315 - 2403

SPAZ 1 215 - 297

SPAZ 2 359 - 507

Bipartite

nuclear

localization

226 - 241

signal 1

Potential

Bipartite

nuclear

localization

455 - 471

signal 2

Potential

Interaction

with CH-TOG

Interaction

with LSM7

and SNRPG

Interaction

with TDRD7

Interaction

with YEATS4

701 - 805

1 - 55

152 - 259

206 - 427

+ Thierry-Mieg and Thierry-Mieg 2006, AceView-Dec 2009


4 Seema TRIVEDI

Table 2. Modification types and positions of modifications in TACC proteins as per SwissProt.*

Protein Position

TACC1

TACC2

TACC3

44

50

52

54

55

57

228

276

406

533

197

201

493

571

575

758

962

1025

1267

1313

1426

1562

1946

1949

2072

2073

2226

2246

2256

2317

2321

2359

2389

2390

2392

2394

2403

2512

2884

N6-acetyl

lysine

Phosphoserine Phosphothreonine Phosphotyrosine

25

59

71

175

317

434

558

*Grey cells indicate presence and blank cells indicate absence or not known.

Spindle assembly and TACC proteins

TACC proteins interact with MTs (particularly at

the minus end) and are mainly associated with

centrosome (Gergely et al., 2000a and 2000b). The

distribution and concentrations of TACC proteins

during spindle formation vary. TACC1

concentration at centrosome is weak and is seen

only during mitosis. TACC2 concentration is strong

at centrosome throughout the cell cycle. TACC3 is

strongly concentrated in a more diffused region

around

centrosomes (during G2 phase) at the minus

end of spindle MTs (Gergely et al., 2000a;

Gergely et al., 2000b; Barr et al., 2010).

Once the spindle has formed, TACC3

protein is not found at astral MTs (reviewed

in Raff, 2002; Hood and Royle, 2011).

TACC3 protein is localized at centrosomes

with γ-tubulin and spindle MTs with αtubulin

(Piekorz et al., 2002, reviewed in

(Raff, 2002; Hood and Royle, 2011),

particularly during S, G2 and M phases of

cell cycle (Piekorz et al., 2002). TACC3/ch-


TOG/clathrin complex increases the stability of Kfibers

during early mitosis. This is achieved by

reduction in MT catastrophe by anchoring to the

spindle and establishing short bridges. Involvement

of TACC proteins in formation of long bridges is

not known but possibly HURP and the kinesinrelated

protein HSET/KIFC1 may be involved in

longer bridges (Booth et al., 2011).

TACC3 depleted cells do not show proper

metaphase alignment; therefore it is possible that

TACC3 protein may be essential for chromosome

alignment (Gregely et al., 2003). TACC3 may also

affect early mitotic checkpoint by associating with

pS939-TSC2 (tuberous sclerosis complex 2) and

regulating its localization at spindle poles and also

possibly affect nuclear envelope (Gomez-Baldo et

al., 2010). TACC3 affects spindle checkpoint by

affecting SAC (spindle assembly checkpoint

assembly) by stabilizing spindle and is important

for microtubule-kinetochore interaction. Depletion

of TACC3 results in activation of the SAC (spindle

assembly checkpoint protein), which prevents

degradation of cyclin B1 and anaphase transition.

Cyclin B1 is present in cells from late G2 to

metaphase and is degraded prior to anaphase.

TACC3 depletion increases the levels of cyclin B1

but not cyclin A (S/G2) (Schneider et al., 2007),

thus presence of TACC3 would affect degradation

of cyclin B1 and help in anaphase transition.

These observations indicate differences in roles

of different types of TACC proteins during mitosis.

For proper assembly and stability of spindle

fibers and minus end of centrosome associate MT,

phosphorylation of TACC is essential which is

mediated by mitotic kinases (e.g. Aurora A kinase

i.e. AAK) (Barros et al., 2005, Peset et al., 2005).

Absence of phosphorylated TACC may result in

either shorter centrosomal MT or absence of these

spindle fibers (Peset et al., 2005, Kinoshita et al.,

2005). Phosphorylation occurs at different sites in

different animals. In Xenopus TACC3/Maskin, at

least two residues (main site is Ser626) are

phosphorylated; in Drosophila D-TACC Ser863 is

phosphorylated exclusively at centrosomes and in

human Ser558 is phosphorylated in TACC3

(reviewed in Raff, 2002; Brittle and Ohkura, 2005;

LeRoy et al., 2007). Phosphorylation of TACCs

may also help G2/M checkpoint by proper

microtubule assembly, thus the control of mitosis

by affecting G2/M transition (Conte et al., 2002;

reviewed in Bettencourt-Dias and Glover, 2007),

TACC proteins in spindles 5

particularly via spindle checkpoint

(Schneider et al., 2007).

However, AAK itself must be activated

prior to being able to phosphorylate the

TACC proteins. In humans, AAK is

activated by binding with TPX2 [Targeting

Protein for Xklp2 (Xenopus plus enddirected

kinesin-like protein)]. AAK-TPX2

binding is activated by HURP (Human

hepatoma up-regulated protein) which is a

MAP protein that can also bind directly to

MTs. However, HURP itself needs

activation by Ran (RAs-related Nuclear

protein) (Sato et al., 2009; Sato and Toda,

2010).

On the other hand, dephosphorylation of

TACC proteins may also affect spindle

stability. In this regard, Mars (a D.

melanogaster sequence homologue of

HURP) mediates spatially controlled

dephosphorylation of TACC for spindle

stability, perhaps only at the centrosome.

Dephosphorylated TACC establishes lateral

interactions with MT or with plus ends

which may be impaired due to TACC

phosphorylation at Ser863 (Tan et al.,

2008).

Spindle fibers and proteins interacting

with TACC proteins

Minimal interactions of TACCs with other

proteins or ligands were determined using

the STRING web interface (Jensen et al.,

2009), and are shown in Figure1. As

previously stated, TACC1 and TACC3 bind

with ch-TOG (clathrin, colonic and hepatic

tumor overexpressed gene) (Conte et al.,

2002; Lauffart et al., 2002); however, from

the interaction shown in Figure 1 it appears

that all three TACC proteins interact with

CKAP5 (homologue XMAP215 or ch-

TOG). The other two common interactions

of the three TACC proteins are YEATS4

(also called YAF9; GAS41; NUBI-1)

(transcription factor, protein located in

nucleoli) and LSM7 (a conserved subfamily

of Sm-like small proteins). LSM7 associates

with U6 snRNPs and plays a role in several

aspects of mRNA processing (Conte et al.,

2002; Lauffart et al., 2002).


6 Seema TRIVEDI

TACC1 may also be involved in gene regulation by

affecting mRNA translation by interaction with

TDRD7 (tudor domain containing 7) (Figure 1).

TDRD7 protein is a part of cytoplasmic RNA

granules involved in mRNA regulation. It is not

known whether the involvement of TACCs in RNA

processing or interaction with transcription factors

has any role in MT dynamics during cell division.

As per Figure 1, TACC1 and 3 also interact

with AURKB and AURKA. These two proteins

also interact with Cyclin B1 (which controls entry

in mitosis) (Conte et al., 2002). Studies have shown

that TACC3 is involved in localization of the

mitotic kinase Aurora B and the checkpoint protein

BubR1 at kinetochores thus affecting MT

attachment (Schneider et al., 2007).

TACC2 protein also directly interacts with

SMYD2 (SET- and MYND-containing protein 2)

(Figure 1). SMYD2 activates TACC2 gene by

methylation of H3K4 in the promoter region of

TACC2 gene besides the involvement of SMYD2

in some protein-protein interactions. These protein

interactions may have roles in centrosomal MT

formation (Abu-Farha et al., 2008) but apparently

not by directly interacting with TACC2 protein.

Phosphorylated TACC3 also directly interacts

with clathrin heavy chain (CLTC) that promotes

accumulation of other complex members at the

mitotic spindle (reviewed in Hood and Royle,

2011). Another direct interaction of TACC3 protein

with septin-7 (SEPT7, CDC10 protein homolog) is

shown in Figure 1. SEPT7 associates with the

mitotic spindle and the kinetochore. It has also been

shown that SEPT7 is needed for stable localization

of CENP-E (centromere-associated protein E) at

kinetochore besides affecting spindle checkpoint

(Zhu et al., 2008). Association of SEPT7 and

MAPs, particularly MAP4, in MT dynamics both

during interphase and mitosis has been established

(Silverman-Gavrila et al., 2008), and it is possible

that similar interaction of SEPT7 with TACC

proteins may affect MT stability.

Expression of TACC3 is high in hematopoietic

tissue unlike TACC1 and TACC2. Apparently

higher levels of TACC3 proteins are not for

proliferation of tissue but for direct or indirect

regulation of p53 levels to prevent apoptosis

although not true for other tissue (Piekorz et al.,

2002). Other study confirmed direct interaction of

TACC3 with p53 (that is also concentrated at

centrosomes) possibly to keep it inactive during

mitosis (reviewed in Raff, 2002) (not seen in

Figure 1).

TACC3 is necessary for proper

localization of phosphorylated TSC2

(Tuberous sclerosis proteins, tuberin) to the

mitotic apparatus and cytokinetic structures.

This interaction may be through the TSC2-

HBD domain (TSC2 hamartin-binding

domain) and result in promotion of

cytoskeletal remodeling (Gómez-Baldó et

al., 2010).

Though little is known about the factors

that control or regulate length of spindle

fibers, TACC3 may be one of the proteins

that control length of MTs and time for

chromosome alignment at metaphase plate

(reviewed in Raff, 2002). AAK may also

regulate MT length, as seen in Drosophila

embryos, where AAK function disturbance

leads to abnormal shortening of centrosomal

MTs. This disturbance also leads to

inefficient concentration of D-TACC at

centrosomes (reviewed in Raff, 2002).

TACCs dysregulation and cancer

Human TACC 1, 2 and 3 are present in

genomic regions that are rearranged in

certain cancer cells (reviewed in Raff, 2002;

Stewart et al., 2004; Still et al., 1999).

Aberrations of TACC genes (TACC3 in

particular) contribute to

tumorigenesis/cancer (reviewed in Raff,

2002; Lauffart et al., 2005).

Since TACC proteins are also involved

in centrosomal dynamics, cell cycle

checkpoints (Schneider et al., 2007) and can

form multiple complexes, any dysregulation

in these proteins may be important during

tumorigenesis (Lauffart et al., 2002). It has

been noted that increase or decrease in

levels of the TACCs can lead to impairment

of spindle functions (reviewed in Raff,

2002). Disruption of spindle function can

then lead to misalignment of chromosomes

and or abnormalities in chromosome

separation. Altered levels of TACC proteins

can lead to abnormal mitosis although next

p53 dependent checkpoint should eliminate

such cells. However, if there is simultaneous

alteration in TACC levels and p53 is either

absent or depleted, then such cells would not


TACC proteins in spindles 7

Figure 1. Predicted functional partnes (minimum interaction) of the three TACC proteins (as per

STRING Jensen et al., 1999)

undergo elimination, resulting in genetic instability

that could contribute to the development of cancer

(reviewed in Raff, 2002).

Some studies show that TACC3 may enhance

stability of tumors. This can be achieved by

TACC3 and ch-TOG in clustering of multipolar

spindles in tumor cells into two poles that may lead

to somewhat ‘normal’ division (reviewed in Hood

and Royle, 2011). However, TACC2 may be a

potential tumour suppressor (reviewed in Raff,

2002) contrary to studies that suggest no role of

TACC2 in tumor suppression (Schuendeln et al.,

2004).

Unanswered questions

Though much is known regarding TACC function

in spindle and microtubule dynamics, there are few

aspects that still remain unknown. These are

summarized below:

Roles of TACCs in regulation/control of

spindle fiber lengths are not fully

understood. Though the levels of TACC and

particularly roles of TACC3 and AAK are

indicated in control of MT length (reviewed

in Raff, 2002), the precise mechanism by

which this is achieved is not known.

Though TACC proteins are present in

cytoplasm during interphase, their fate at the

end of mitosis is not known with respect to

their redistribution to cytoplasm of the

daughter cells. If there is

exclusion/reduction in amount of TACC

proteins from nucleoplasm, the mechanism

remains elusive. Further, it is not known

whether destruction/recycling/decrease in


8 Seema TRIVEDI

expression of all TACCs (like cyclins) is important

for ending anaphase.

It is known that TACC3 associates with

kinetochore MTs (K fibers), but association with

interpolar MTs (reviewed in Hood and Royle,

2011) or astral MTs is not confirmed. It is also not

known whether all three TACCs associate with

kinetochore MTs (K fibers), interpolar MTs and

astral MTs or there are different TACC for each

fiber type.

If different TACCs are involved in K-fibers,

interpolar and astral MTs; it is not known how this

association difference is achieved.

Different interaction partners at different

subcellular locations of each splice variant of

TACC1 protein have been reported during different

stages of embryonic development. This may be

possible due to retention of coiled coil domain in

each splice variant but there are differences in

interaction motifs at N-terminus (Lauffart et al.,

2006). However, it is not known whether different

isoforms of TACC proteins have different roles in

spindle assembly during mitosis.

Conclusion

It is known that TACCs are important in

maintaining bipolarity and stability of spindle fibers

through their association with other

binding/interacting partners. TACCs also play a

role in cell cycle checkpoints due to their

association with centrosomes and p53. However,

there are many unresolved functional and structural

aspects of the three TACC proteins. Further

advancement in studies with respect to the unsolved

facets of these proteins may help in enhancing basic

understanding of spindle MT dynamics and related

disorders.

Acknowledgements

I am extremely indebted to Prof. S. D. Kapoor,

former Head, Department of English, JN Vyas

University, Jodhpur (Raj.) and Emeritus Fellow of

UGC (University Grants Commission) of India, for

correcting the language and expression in the

manuscript.

References

Aitola M, Sadek CM, Gustafsson JA, Pelto-Huikko

M. Aint/Tacc3 is highly expressed in

proliferating mouse tissues during development,

spermatogenesis, and oogenesis. J

Histochem Cytochem. 51(4): 455-69,

2003.

Albee AJ, Wiese C. Xenopus

TACC3/maskin is not required for

microtubule stability but is required for

anchoring microtubules at the

centrosome. Mol Biol Cell. 19(8): 3347-

56, 2008.

Barr AR, Kilmartin JV, Gergely F.

CDK5RAP2 functions in centrosome to

spindle pole attachment and DNA

damage response. J Cell Biol. 189(1):

23–39, 2010.

Barros TP, Kinoshita K, Hyman AA, Raff

JW. Aurora A activates D-TACC-Msps

complexes exclusively at centrosomes to

stabilize centrosomal microtubules. J

Cell Biol. 170(7): 1039-46, 2005.

Bettencourt-Dias M and Glover DM.

Centrosome biogenesis and function:

centrosomics brings new understanding.

Nat Rev Mol Cell Bio. 8(6):451-63,

2007.

Booth DG, Hood FE, Prior IA, Royle SJ. A

TACC3/ch-TOG/clathrin complex

stabilises kinetochore fibers by intermicrotubule

bridging. EMBO J. 30(5):

906-19, 2011.

Brittle AL, Ohkura H. Centrosome

maturation: Aurora lights the way to the

poles. Curr Biol. 15(21): R880-2, 2005.

Conte N, Charafe-Jauffret E, Delaval B,

Adélaïde J, Ginestier C, Geneix J,

Isnardon D, Jacquemier J, Birnbaum D.

Carcinogenesis and translational

controls: TACC1 is down-regulated in

human cancers and associates with

mRNA regulators. Oncogene. 21(36):

5619-30, 2002.

Eslinger MR, Lauffart B, Still IH. 2009.

TACC3 (transforming, acidic coiled-coil

containing protein 3). Atlas Genet

Cytogenet Oncol Haematol. Retrieved

December 25, 2011 from

http://AtlasGeneticsOncology.org/Genes

/TACC3ID42458ch4p16.html


Gergely F, Draviam VM, Raff JW. The ch-

TOG/XMAP215 protein is essential for spindle

pole organization in human somatic cells. Genes

Dev. 17(3): 336-41, 2003.

Gergely F, Karlsson C, Still I, Cowell J, Kilmartin

J, Raff JW. The TACC domain identifies a

family of centrosomal proteins that can interact

with microtubules. Proc Natl Acad Sci USA.

97(26): 14352-7, 2000a.

Gergely F, Kidd D, Jeffers K, Wakefield JG, Raff

JW. D-TACC: a novel centrosomal protein

required for normal spindle function in the early

Drosophila embryo. EMBO J. 19(2): 241-52,

2000b.

Gómez-Baldó L, Schmidt S, Maxwell CA, Bonifaci

N, Gabaldón T, Vidalain PO, Senapedis W,

Kletke A, Rosing M, Barnekow A, Rottapel R,

Capellá G, Vidal M, Astrinidis A, Piekorz RP,

Pujana MA. TACC3-TSC2 maintains nuclear

envelope structure and controls cell division.

Cell Cycle. 9(6): 1143-55, 2010.

Hood FE, Royle SJ. Pulling it together: The mitotic

function of TACC3. Bioarchitecture. 1(3):105-

109, 2011.

Jensen LJ, Kuhn M, Stark M, Chaffron S, Creevey

C, Muller J, Doerks T, Julien P, Roth A,

Simonovic M, Bork P, von Mering C. STRING

8--a global view on proteins and their functional

interactions in 630 organisms. Nucleic Acids

Res. 37(Database issue): D412-6, 2009.

Lauffart B, Dimatteo A, Vaughan MM, Cincotta

MA, Black JD, Still IH. Temporal and spatial

expression of TACC1 in the mouse and human.

Dev Dyn. 235(6):1638-47, 2006.

Lauffart B, Sondarva GV, Gangisetty O, Cincotta

M, Still IH. Interaction of TACC proteins with

the FHL family: implications for ERK

signaling. J Cell Commun Signal. 1(1):5-15,

2007.

Lauffart B, Vaughan MM, Eddy R, Chervinsky D,

DiCioccio RA, Black JD, Still IH. Aberrations

of TACC1 and TACC3 are associated with

ovarian cancer. BMC Womens Health. 5: 8,

2005.

LeRoy PJ, Hunter JJ, Hoar KM, Burke KE, Shinde

V, Ruan J, Bowman D, Galvin K, Ecsedy JA.

Localization of human TACC3 to mitotic

TACC proteins in spindles 9

spindles is mediated by phosphorylation

on Ser558 by Aurora A: a novel

pharmacodynamic method for measuring

Aurora A activity. Cancer Res. 67(11):

5362-70, 2007.

Pearson NJ, Cullen CF, Dzhindzhev NS,

Ohkura H. A pre-anaphase role for a

Cks/Suc1 in acentrosomal spindle

formation of Drosophila female meiosis.

EMBO Rep. 6(11): 1058-63, 2005.

Peset I, Seiler J, Sardon T, Bejarano LA,

Rybina S, Vernos I. Function and

regulation of Maskin, a TACC family

protein, in microtubule growth during

mitosis. J Cell Biol. 170(7):1057-66,

2005

Piekorz RP, Hoffmeyer A, Duntsch CD,

McKay C, Nakajima H, Sexl V, Snyder

L, Rehg J, Ihle JN. The centrosomal

protein TACC3 is essential for

hematopoietic stem cell function and

genetically interfaces with p53-regulated

apoptosis. EMBO J. 21(4): 653-64, 2002.

Raff JW. Centrosomes and cancer: lessons

from a TACC. Trends Cell Biol. 12(5):

222-5, 2002.

Sato M, Okada N, Kakui Y, Yamamoto M,

Yoshida M, Toda T. Nucleocytoplasmic

transport of Alp7/TACC organizes

spatiotemporal microtubule formation in

fission yeast. EMBO Rep. 10(10): 1161-

7, 2009.

Sato M, Toda T. Space shuttling in the cell:

Nucleocytoplasmic transport and

microtubule organization during the cell

cycle. Nucleus. 1(3): 231-6, 2010.

Schneider L, Essmann F, Kletke A, Rio P,

Hanenberg H, Wetzel W, Schulze-

Osthoff K, Nürnberg B, Piekorz RP. The

transforming acidic coiled coil 3 protein

is essential for spindle-dependent

chromosome alignment and mitotic

survival. J Biol Chem. 282(40): 29273-

83, 2007.

Schuendeln MM, Piekorz RP, Wichmann C,

Lee Y, McKinnon PJ, Boyd K,

Takahashi Y, Ihle JN. The centrosomal,


10 Seema TRIVEDI

putative tumor suppressor protein TACC2 is

dispensable for normal development, and

deficiency does not lead to cancer. Mol Cell

Biol. 24(14):6403-9, 2004.

Silverman-Gavrila RV, Silverman-Gavrila LB.

Septins: new microtubule interacting partners.

Scientific World Journal. 8:611-20, 2008.

Stewart JP, Thompson A, Santra M, Barlogie B,

Lappin TR, Shaughnessy J Jr: Correlation of

TACC3, FGFR3, MMSET and p21 expression

with the t(4;14)(p16.3;q32) in multiple

myeloma. British J Haematology. 126(1): 72-

76, 2004.

Still I, Eslinger MR, Lauffart B. TACC1

(transforming, acidic coiled-coil containing

protein 1). Atlas Genet Cytogenet Oncol

Haematol. December 2008. Retrieved

December 25, 2011 URL:

http://AtlasGeneticsOncology.org/Genes/TACC

1ID42456ch8p11.html

Still IH, Hamilton M, Vince P, Wolfman A, Cowell

JK. Cloning of TACC1, an embryonically

expressed potentially transforming coiled coil

containing gene from the 8p11 breast cancer

amplicon. Oncogene. 18(27): 4032-4038, 1999.

Still IH, Vettaikkorumakankauv AK,

DiMatteo A, Liang P. Structure-function

evolution of the transforming acidic

coiled coil genes revealed by analysis of

phylogenetically diverse organisms.

BMC Evol Biol. 4: 16, 2004.

Tan S, Lyulcheva E, Dean J, Bennett D.

Mars promotes dTACC

dephosphorylation on mitotic spindles to

ensure spindle stability. J Cell Biol.

182(1): 27-33, 2008.

Thierry-Mieg D, Thierry-Mieg J. AceView:

a comprehensive cDNA-supported gene

and transcripts annotation, Genome Biol,

7(Suppl 1):S12, 2006.

Zhu M, Wang F, Yan F, Yao PY, Du J, Gao

X, Wang X, Wu Q, Ward T, Li J, Kioko

S, Hu R, Xie W, Ding X, Yao X. Septin

7 interacts with centromere-associated

protein E and is required for its

kinetochore localization. J Biol Chem.

283(27):18916-25, 2008.


Journal of Cell and Molecular Biology 10(2):11-19, 2012 Review Article 11

Haliç University, Printed in Turkey.

http://jcmb.halic.edu.tr

Markör Sistemleri ve Genetik Karakterizasyon Çalışmalarında

Kullanımları

Marker Systems and Applications in Genetic Characterization

Studies

Yusuf ÖZŞENSOY* 1,2 , Ercan KURAR 2

1 Bitlis Eren Üniversitesi Sağlık Yüksekokulu, 13000, Bitlis

2 Selçuk Üniversitesi Veteriner Fakültesi Genetik Anabilim Dalı, 42031, Konya

(* author for correspondence; yusufozsensoy@yahoo.com)

Received: 18 September 2012; Accepted: 20 December 2012

Abstract

Nowadays, owing to the developments in molecular biology, genetic markers are generally used to

describe specific regions of the genome. Three different marker systems, namely, protein and DNA

markers, are used in genome analyses and in various genetic studies. Following the discovery of

polymerase chain reaction (PCR), PCR-based marker systems are widely preferred in genetic studies.

Genetic characterization studies are critically important to determine the level of genetic diversity

between and within populations, origin of domestication and migration and development of

conservation programs. Different biochemical marker systems, alloenzymes, mitochondrial DNA and

Y chromosome are used for genetic characterization studies. DNA markers, especially the

polymorphic microsatellite markers, are the most preferable marker systems in PCR applications.

Recent progresses in molecular biology techniques allow rapid and economical identification of single

nucleotide polymorphisms analyses and their applications along with microsatellites.

Keywords: Genetic Characterization; Marker systems, Microsatellite, SNP, RFLP

Özet

Moleküler biyoloji alanındaki gelişmeler sonucunda günümüzde markörler genel olarak genomun

özgün bir bölgesini tanımlamak amacıyla kullanılmaktadır. Genom analizleri ve genetik çalışmalarda

morfolojik, protein ve DNA markörleri olmak üzere üç tip markör kullanılmaktadır. Polimeraz zincir

reaksiyonunun (PZR) keşfinden sonra genetik çalışmalarda PZR-temelli markörler daha fazla tercih

edilmeye başlanmıştır. Genetik karakterizasyon çalışmaları, popülasyon içi ve popülasyonlar arası

genetik çeşitlilik seviyesinin belirlenmesi, koruma programlarının geliştirilmesi, evcilleştirilme ve göç

yollarının tespiti gibi çalışmalar için oldukça önemlidir. Genetik karakterizasyon çalışmalarında farklı

biyokimyasal markör sistemleri, alloenzimler, mitokondriyal DNA ve Y kromozomuna özgün

markörler kullanılmaktadır. DNA markörleri, özellikle polimorfik mikrosatellit markörleri, PZR

uygulamalarında en çok tercih edilen markör sistemini oluşturmaktadır. Son zamanlarda geliştirilen

yeni moleküler biyoloji teknikleri tek nükleotid polimorfizmleri analizinin daha hızlı ve ekonomik

olarak yapılabilmesine ve mikrosatellitler ile birlikte kullanılmasına olanak sağlamaktadır.

Anahtar Kelimeler: Genetik karakterizasyon, Markör Sistemleri, Mikrosatellit, SNP, RFLP

GİRİŞ

Genomun özgün bir bölgesini tanımlamak amacıyla

birçok markör sistemi kullanılmaktadır. Genom

analizleri ve genetik çalışmalar başta olmak

üzere moleküler çalışmalarda morfolojik,


12 Yusuf ÖZŞENSOY ve Ercan KURAR

protein ve DNA markörleri olmak üzere 3 tip

markör kullanılmaktadır (Liu, 1998).

Morfolojik Markörler

Çok sayıdaki morfolojik markör insan, hayvan ve

bitki genetik çalışmalarında kullanılmaktadır.

Genler ve kromozomlar hakkındaki bilgi

eksikliğinden dolayı ilk çalışmalar, göz rengi, kanat

yapısı, boynuzluluk, deri rengi gibi basit Mendel

kalıtımı gösteren özellikler üzerinde yapılmıştır. Bu

gibi morfolojik karakterler, özgün genler için

güvenilir indikatörler olarak kullanılabilirler ve bu

özellikleri kodlayan genlerin kromozom üzerinde

yerlerinin tanımlanmasında faydalı olmaktadırlar.

Morfolojik markörlerin gözlenmesi kolay olmasına

rağmen alel sayılarının nispeten az olmasından

dolayı kullanımı kısıtlı kalmaktadır (Liu, 1998).

Protein Markörleri

Amino asit bileşimi, moleküler ağırlıkları ve

antikor-antijen ilişkilerindeki farklılıklar nedeniyle

proteinler için farklı aleller bulunabilmektedir.

Moleküler büyüklük ve amino asit bileşimi

farklılıklardan dolayı proteinler, jel elektroforez

yöntemi kullanılarak kolaylıkla ortaya çıkarılabilir

ve genetik markör olarak kullanılabilirler. Genetik

çalışmalarda ilk zamanlarda protein

polimorfizmlerinin araştırılması amacıyla kan

antijenleri ve izoenzim markörleri yaygın olarak

kullanılmıştır. İzoenzimler, bir enzimin alternatif

bir formudur ve aynı enzim aktivitesine sahip

olmalarına rağmen elektroforetik hareketleri

farklılık göstermektedir (Liu, 1998). Genetik

çalışmalarda kan ve doku proteinleri markör olarak

yaygın bir şekilde kullanılmaktadır. Fakat özellikle

kan grubu ve protein markör sistemlerinin genomun

bazı bölgelerinde toplanmış bulunmaları,

polimorfizm değerlerinin nispeten düşük olması,

özgün olarak kan örneklerine gereksinim

duyulması, iş yükünün ağır olması ve analizlerin

uzun zaman alması nedeniyle ve moleküler

biyolojideki gelişmelere bağlı olarak yerini DNA

temelli markörlere bırakmıştır (Kurar, 2001).

DNA Temelli Markörler

DNA markörleri, bir tür içerisindeki farklı

bireylerde dizi polimorfizmi gösteren DNA

bölgeleridir ve varyasyonun belirlenmesinde

günümüzde en sık kullanılan yöntemdir (Liu,

1998). Polimeraz Zincir Reaksiyonunun (PZR)

keşfinden sonra genetik çalışmalarda PZR temelli

markörler daha çok tercih edilmeye

başlanmıştır. Karry Mullis tarafından 1985

yılında ilk kez ortaya konulan bu teknoloji

sayesinde genomun özgün bölgelerinin in

vitro şartlarda çoğaltılabilmesi ve

elektroforez teknikleri ile görüntülenmesi

mümkün hale gelmiştir. DNA teknolojisi ve

moleküler biyolojideki hızlı gelişmeye

paralel olarak daha ekonomik, kolay ve

polimorfik olmalarından dolayı özellikle

PZR temelli DNA markör sistemleri (RFLP,

RAPD, EST, STS, SSCP, AFLP, STR ve

SNP) genetik çalışmalarda daha yaygın

olarak kullanılmaya başlanmıştır (Weber

and May, 1989; Liu, 1998).

Restriksiyon parça uzunluk

polimorfizmleri

Restriksiyon endonükleaz (RE) enzim

kesimleri ile oluşturulan farklı DNA parça

uzunlukları restriksiyon parça uzunluk

polimorfizmleri (RFLP-“Restriction

fragment length polymorphism”) olarak

adlandırılmaktadır. RE’leri, DNA

diziliminde belirli sırayla bulunan

nükleotidlerden kendisine özgü özel tanıma

dizilimi bölgelerini tanıyarak bu dizilimin

belli bir noktasından keserek DNA’yı ikiye

ayırmaktadır. Her bir RE’nin kendisine özel

kesim bölgeleri bulunmaktadır.

RFLP teknolojisi ile DNA dizisinde

bulunan dizilim farklılıkları kolayca tespit

edilebilmektedir. RFLP’lerin

belirlenmesinde DNA öncelikle bir RE

enzimi ile kesilerek DNA parçacıkları

agaroz jel elektroforezinde ayrıştırılır. DNA

dizilim farklılıklarına göre genom

bölgesinde farklı RE kesim alanları ve

dolayısıyla bireyler arasında farklı DNA

fragman profilleri oluşacaktır. Alkali jelde

denatüre olmuş DNA fragmanları Southern

blot yöntemi ile nitroselüloz kâğıdı üzerine

alınır. Radyoaktif işaretli bir DNA probu

kullanılarak özgün DNA fragmanları ve

profili tespit edilebilir (Botstein et al.,

1980).

RFLP markörlerin en önemli avantajı

özgün dizi bilgisine ihtiyaç bulunmamasıdır.

RFLP yöntemi, türler, cinsler hatta büyük

popülasyonların analizinde

kullanılabilmektedir. Polimorfizm oranı çok


yüksek olmasından dolayı aile ağacı ve haritalama

analizlerinde tercih edilen markör sistemi olmuştur.

RFLP markör sisteminin dezavantajları ise; analizin

yapılabilmesi için yeterli miktarda DNA’ya ihtiyaç

duyulması ile birlikte teknolojik olarak pahalı, uzun

ve yorucu bir yöntem olmasıdır (Botstein et al.,

1980).

Tek zincir konformasyon polimorfizmleri

Tek zincir konformasyon polimorfizmi (SSCP-

“Single-strand conformational polymorphism”)

markörleri, bir DNA dizilim bölgesindeki (1000

baz çiftinden daha kısa) dizi varyantları ve

mutasyonları (özellikle nokta mutasyonları)

belirlemede kullanılan bir markör sistemidir (Orita

et al., 1989). PZR ile çoğaltılan bir genom bölgesi,

uygun ısıda denatürasyona tabi tutularak mutasyon

bölgesinde II. ve III. DNA konformasyonlarının

oluşturulması esasına dayanmaktadır. Varyasyona

bağlı olarak oluşan II. ve III. konformasyondaki

DNA molekülleri jel elektroforezinde farklı bant

profilleri oluşturarak varyantların tespitine olanak

sağlamaktadır. Teknoloji olarak basit olmasına

rağmen, her bir mutasyon için farklı ortamların

oluşturulması gerekliliği, bu tekniğin uygulamasını

kısıtlayan en önemli etkendir (Liu, 1998).

Rastgele çoğaltılmış polimorfik DNA

Rastgele çoğaltılmış polimorfik DNA (RAPD-

“Randomly amplified polymorphic DNA”)

markörleri, PZR tabanlı olup ilk kez Williams et

al., (1990) tarafından geliştirilmiştir. Rastgele

nükleotid dizilimine sahip olan tek bir primerin

kullanılmasıyla DNA parçaları çoğaltılmakta ve

oluşan farklı bant profiline göre DNA polimorfizmi

tespit edilebilmektedir. Bu markör kullanılarak

yapılan çalışmalarda, aynı lokustaki iki farklı alel

belirli büyüklükteki bantların varlığıyla ya da

yokluğuyla ayırt edilebilmektedir (Liu, 1998).

RAPD markörlerinin avantajları, DNA dizi

bilgisine ihtiyacın olmaması, diğer markörlere göre

ucuz ve daha az miktarda DNA ile kısa sürede

sonuçlar alınabilmesi olması rağmen en önemli

dezavantajı diğer markörlere göre özelliklede

RFLP’ye göre güvenilirliğinin düşük olmasıdır.

Bundan dolayı genellikle RFLP ile birlikte

değerlendirmeye alınırlar (Williams et al., 1990).

Çoğaltılmış parça uzunluk polimorfizmi

Çoğaltılmış parça uzunluk polimorfizmi (AFLP-

“Amplified fragment length polymorphism”)

Markör Sistemleri 13

tekniği, RE enzimleri ile kesilmiş genomik

DNA parçalarının seçici PZR ile

çoğaltılması temeline dayanmaktadır. Bu

teknik, DNA’nın enzimlerle kesilmesi ve

oligonükleotid adaptörlerin bağlanması,

kesilen bölgelerin seçici PZR yöntemiyle

çoğaltılması ve çoğalan bölgenin

poliakrilamid jelde analiz edilmesi olmak

üzere 3 temel aşamadan meydana

gelmektedir. RE ile kesilen parça bölgeleri

nükleotid dizilimi bilinmeden jel

elektroforez yöntemi ile

görüntülenebilmektedir. Parmak izi

analizlerinde ağırlıklı olarak kullanılan

AFLP markör sistemi, RFLP markörüne

benzer özelliklere sahip olmakla birlikte

RFLP’ye göre analizi daha kolaydır ve daha

az miktarda DNA’ya gereksinim

duymaktadır (Vos et al., 1995).

Tek nükleotid polimorfizmleri

Tek nükleotid polimorfizmleri (SNP-“Single

nucleotide polymorphism”) genomun

herhangi bir bölgesindeki tek nükleotid

dizilim farklılıklarıdır. Genomda oldukça

yaygın bulunan bu markörlere intron ve

ekzon bölgelerinde, 500–1000 bç sıklıkta

rastlanılabilir (Wang et al., 1998).

Genellikle iki alele sahip olan SNP

markörlerinin polimorfizmleri daha düşük

kalmakta, veri tabanı katalog bilgisine ve

polimorfizm dizi bilgisine ihtiyaç

duyulmaktadır (Smigielski et al., 2000).

SNP’ler araştırmacıların ihtiyaçlarına göre

çalışmaları kolaylaştırmak için dizi konumu,

fonksiyonu, türler arası homoloji ve

heterozigotluk derecesi olmak üzere 4 büyük

bilgi ekseni tek veya daha fazlası bir arada

olmak üzere düzenlenebilmektedir

(Smigielski et al., 2000). Genomda bilinen

1.42 milyon SNP’nin her 1.91 Kbç başına 1

SNP yoğunlukta bulunduğu bilinmekle

birlikte ekson gen bölgelerinde 60 000 SNP

bulunduğu ve eksonun %85’inin SNP’nin 5

Kbç yakınında yer aldığı belirlenmiştir (The

International SNP Map Working Group,

2001). SNP bilgilerine ulaşmak için;

GenBank, PubMed, LocusLink ve Genome

Sequence gibi kaynak bilgiler ile NCBI veri

tabanındaki bilgiler kullanılmaktadır

(Smigielski et al., 2000). Geliştirilen yeni


14 Yusuf ÖZŞENSOY ve Ercan KURAR

moleküler biyoloji teknikleri (mikrodizin, gerçek

zamanlı PCR) ile çok sayıda SNP’nin analizi daha

hızlı ve ekonomik olarak yapılabilmektedir.

SNP’ler genetik çeşitlilik, popülasyon yapısı,

kantitatif özellik lokusları (QTL), markör destekli

seleksiyon (MAS) çalışmalarında ve ailesel

ilişkilerin araştırılmasında yaygın kullanılmaktadır.

Mitokondriyal DNA

Maternal kalıtım gösteren mitokondrial DNA

(mtDNA), çift zincirli, halkasal yapıda ve aerobik

solunumu destekleyen genleri içermektedir.

mtDNA toplam genetik materyalin %0.3’ünü

oluşturmaktadır (Rokas et al., 2003; Başaran,

2004). Tipik bir somatik hücre 500-1000

mitokondri içermektedir (Rokas et al., 2003).

mtDNA’da gözlenen mutasyon oranı nükleer

DNA’ya (nDNA) göre daha hızlıdır. Bu durumun

sebebi olarak, mtDNA’da meydana gelen

mutasyonların nDNA’da meydana gelen

mutasyonlardan yaklaşık 10–20 kat daha fazla

olması ve mtDNA’nın tamir mekanizmasının

bulunmaması olduğu gösterilmektedir. Sonuçta

oluşan mutasyon oranı, mtDNA’nın baz diziliminde

çok farklı varyasyonların oluşmasına yol

açmaktadır (Başaran, 2004). mtDNA, canlıların

orjinleri, göç haritalarının çıkarılması, adli tıp,

dejeneratif hastalıkların sebebinin araştırılmasında

ve kanser çalışmalarında kullanılmaktadır. mtDNA,

rekombinasyon eksikliğinin tespiti ve genetik

olarak klonlanan canlıların kalıtımının tespit

edilmesinde yaygın kullanılmaktadır (Rokas et al.,

2003). mtDNA’nın kodlanan bölgesindeki

varyasyonun iyi anlaşılması popülasyonların

genetik sonucunun (filogenetik geçmişinin)

belirlenmesinde yararlı olacaktır (Finnilä et al.,

2001).

Mikrosatellitler

Genomda bir lokusta arka arkaya gelen rastgele

tekrar dizilerine kısa ardışık tekrarlar (STR-“Short

Tandem Repeat”) denilmektedir. STR’lerin 1–6 bç

tekrarlarından oluşmuş markörlere mikrosatellit

markörler veya basit dizi tekrarları (SSR-“Simple

Sequence Repeat”) olarak isimlendirilmektedir

(Weber and May, 1989; Liu, 1998). Genomda 9–

100 bç arasında değişen rastgele dizi tekrarları ise

minisatellit markörler veya değişken ardışık

nükleotid tekrarlar (VNTR-“Variable Number of

Tandem Repeats) olarak tanımlanmaktadır.

Mikrosatellitlerin tekrar sayısı genelde 100’den,

minisatellitlerin tekrar sayısı ise 1000’den

daha azdır (Liu, 1998). Mikrosatellitler

prokaryot ve ökaryot genomun herhangi bir

bölgesinde bulunabilmektedir.

Prokaryotlarda birçok biyolojik fonksiyona

sahip olduğu halde ökaryot hücrelerde rolü

tam olarak bilinmemektedir (Bennett, 2000).

Mikrosatellit markörler, yaygın olarak 2

nükleotidli tekrarlardan [(CA)n] oluşmakla

birlikte farklı formlarda da (AC, AT, AAC,

AAT, CCG vb) bulunabilmektedir (Ellegren

et al., 1997; Orti et al., 1997; Bruford et al.,

2003).

STR markörleri, PZR teknolojisinin

yardımıyla genetik çalışmalarda en çok

tercih edilen markör sistemini

oluşturmaktadır (Weber and May, 1989;

Liu, 1998). Mikrosatellitlerde tekrar

bölgelerini kuşatan DNA dizileri bir türün

bireylerinde aynı olmasına rağmen tekrar

dizilim sayıları bireyler hatta bireyin

homolog kromozomları arasında dahi

farklılık gösterebilmektedir. Üç nükleotid

tekrarlı mikrosatellit bölgelerinin %60

oranında polimorfik olduğu, 2 bç tekrarlı

mikrosatellitlerin ise %100 polimorfik

özelliğe sahip olduğu belirlenmiştir (Metta

et al., 2004). Mikrosatellitler, genomda

yaygın olarak bulunmaları, polimorfizm

oranının yüksek olması ve kullanımının

kolay olması nedeniyle birçok moleküler

biyoloji çalışmasında rahatlıkla kullanımı

tercih edilmektedir.

GENETİK ÇEŞİTLİLİK VE GENETİK

KARAKTERİZASYON

Hayvansal üretimde genetik çeşitlilik, ıslah

programlarının temelini oluşturmaktadır.

Genetik çeşitlilik, belli bir coğrafik bölgeye

uyum sağlamış, ilgili bölgede yaygın olarak

yetiştirilen canlı türlerinin, bu türlere ait

ırkların genetik niteliklerini (kalıtsal bilginin

zenginliğini) ve içinde yaşadıkları

ekosistemde birbirleri ile ilişkilerinin

niteliğini ifade eder. Evcil hayvanlarda

genetik çeşitlilik, ırk içi ve ırklar arası olmak

üzere iki çeşittir.

Genetik karakterizasyon çalışmaları,

ırklar arası ve ırk içi genetik çeşitliliğin

belirlenmesi ve ırkların tanımlanması

amacıyla önemli bir yere sahiptir. Dünyada


ve Türkiye’de 1980’li yıllarda yerli ırkların genetik

yapıları ve bazı verim özellikleri ile olan ilişkileri

kan ve süt protein polimorfizmi (Ceriotti et al.,

2003; Ibeagha-Awemu and Erhardt, 2005)

kullanılarak incelenirken en son gelişmelerle

birlikte mikrosatellit markörler ve SNP’ler (Cañón

et al., 2001; Li et al., 2006; McKay et al., 2008;

Kang et al., 2009; Molaee et al., 2009) daha yaygın

olarak kullanılmaya başlanmıştır.

Irkların kökeni ve evcilleştirilme bölgelerinin

tespit edilmesi amacıyla genetik karakterizasyon ve

arkeolojik çalışmalar yapılmaktadır. Avrupa

ırklarının göç yollarının Tuna Nehri boyunca

Kuzeyden Merkezi Avrupa’ya ve Akdeniz kıyısı

boyunca olmak üzere iki farklı göç yolu izlediği,

sığır, koyun, keçi, domuz ve mandanın iki farklı

Asya Bölgesi’nde ilk evcilleştirilmeye başlandığı

bildirilmektedir (Bruford et al., 2003). Bu

merkezlerden en eski olanı Doğu-Güneydoğu

Anadolu bölgesini kapsamaktadır ve ırkların bu

bölgeden tüm Dünya’ya özellikle Anadolu’dan

Avrupa’ya yayıldığı belirtilmektedir (Loftus et al.,

1994; 1999; Luikart et al., 2001; Troy et al., 2001;

Hiendleder et al., 2002; Cymbron et al., 2005).

Genetik karakterizasyon çalışmalarında

mikrosatellitler, insan (Bowcock et al., 1994; Deka

et al., 1995), sığır (MacHugh et al., 1997; Loftus et

al., 1999; Edwards et al., 2000; Cañón et al., 2001),

keçi (Luikart et al., 2001; Maudet et al., 2002),

koyun (Mukesh et al., 2006; Lawson Handley et

al., 2007; Molaee et al., 2009), köpek (Boyko et al.,

2009; Kang et al., 2009), at (Luís et al., 2007), eşek

(Aranguren-Méndez et al., 2002), domuz (Behl et

al., 2006; Sollera et al., 2009), manda (Flamand et

al., 2003) ve diğer birçok hayvan türlerinde (Cosse

et al., 2007; Vijh et al., 2007; Li et al., 2009)

kullanılmaktadır.

Genetik karakterizasyon çalışmalarında

mikrosatellitler dışında farklı biyokimyasal markör

sistemleri de (Moazami-Goudarzi et al., 1997;

Kantanen et al., 1999; 2000; Ceriotti et al., 2003;

Ibeagha-Awemu and Erhardt, 2005) kullanılmıştır.

AFLP (Negrini et al., 2007), mtDNA (Loftus et al.,

1994; Bradley et al., 1996; Finnilä et al., 2001;

Mannen et al., 2004), Y kromozomuna özgün

mikrosatellitler (Edwards et al., 2000; Cai et al.,

2006; Li et al., 2007; Kantanen et al., 2009)

ağırlıklı olarak kullanılmakla birlikte SNP (Li et

al., 2006; McKay et al., 2008) markörleri de

kullanılmaya başlanmıştır. Ayrıca genetik

karakterizasyon çalışmalarında markör sistemleri

Markör Sistemleri 15

dışında aile ağacı kayıtlarından da

yararlanılmaktadır (Trinderup et al., 1999;

Honda et al., 2006).

Sığır ırkları üzerinde yapılan

mikrosatellit markörler ile yapılan

analizlerinde Taurin ve Zebu karışımı

bulunmamışken diğer markör sistemlerinden

olan Y kromozomu ve mtDNA ile yapılan

çalışmalar birlikte değerlendirildiği zaman Y

kromozomu markörü verilerinde bu ırklarda

Zebu karışımının olduğu belirlenmiştir

(Lirón et al., 2006).

SNP’ler ise bitkiler, deniz ürünleri ve

birçok hayvan türünde moleküler

çalışmalarda aynı anda sayıca fazla miktarda

kullanılmaktadır (Muir et al., 2008;

Matukumalli et al., 2009; Yan et al., 2009;

Zhu et al., 2012).

Sonuç olarak markör sistemlerinde PZR

teknolojisi öncesi birçok markör sistemi

kullanılırken, PZR teknolojisi ile birlikte

mikrosatellitler ağırlıklı kullanılmaya

başlanmıştır. Son yıllarda ise SNP

markörleri üzerinde çalışmalar artmış ve

SNP çipleri oluşturulmaya başlanmıştır.

KAYNAKLAR

Aranguren-Méndez J, Jordana J, Gomez M.

Genetic conservation of five endangered

Spanish donkey breeds. J Anim Breed

Genet. 119(4): 256–263, 2002.

Başaran A. Tıbbi biyoloji ders kitabı. Güneş

& Nobel Tıp Kitapevleri, 7. Baskı.

Bursa. 2004.

Behl R, Sheoran N, Behl J, Vijh RK.

Genetic analysis of Ankamali pigs of

India using microsatellite markers and

their comparison with other

domesticated Indian pig types. J Anim

Breed Genet. 123(2): 131–135, 2006.

Bennett P. Demystified… Microsatellites.

Journal of Clinical Pathology. Mol

Pathol. 53: 177–183, 2000.

Botstein D, White RL, Skolnick M, Davis

RW. Construction of a genetic linkage

map in man using restriction fragment


16 Yusuf ÖZŞENSOY ve Ercan KURAR

length polymorphisms. Am J Hum Genet. 32:

314–331, 1980.

Bowcock AM, Ruiz-Linares A, Tomfohrde J,

Minch E, Kidd JR, Cavalli-Sforza LL. High

resolution of human evolutionary trees with

polymorphic microsatellites. Nature. 368(6470):

455–457, 1994.

Boyko AR, Boyko RH, Boyko CM, Parker HG,

Castelhano M, Corey L, Degenhardt JD, Auton

A, Hedimbi M, Kityo R, Ostrander EA,

Schoenebeck J, Todhunter RJ, Jones P,

Bustamante CD. Complex population structure

in African village dogs and its implications for

inferring dog domestication history. Proc Natl

Acad Sci USA. 106(33): 13903–13908, 2009.

Bradley DG, MacHugh DE, Cunningham P, Loftus

RT. Mitochondrial diversity and the origins of

African and European cattle. Proc Natl Acad

Sci USA. 93(10): 5131–5135, 1996.

Bruford MW, Bradley DG, Luikart G. DNA

markers reveal the complexity of livestock

domestication. Nat Rev Genet. 4(11): 900–910,

2003.

Cai X, Chen H, Wang S, Xue K, Lei C.

Polymorphisms of two Y chromosome

microsatellites in Chinese cattle. Genet Sel

Evol. 38: 525–534, 2006.

Cañón J, Alexandrino P, Bessa I, Carleos C,

Carretero Y, Dunner S, Ferran N, Garcia D,

Jordana J, Laloë D, Pereira A, Sanchez A,

Moazami-Goudarzi K. Genetic diversity

measures of local European beef cattle breeds

for conservation purposes. Genet Sel Evol.

33(3): 311–332, 2001.

Ceriotti G, Caroli A, Rizzi R, Crimella C. Genetic

relationships among taurine (Bos taurus) and

zebu (Bos indicus) populations as revealed by

blood groups and blood proteins. J Anim Breed

Genet. 120: 57–67, 2003.

Cosse M, González S, Maldonado JE. Crossamplification

tests of ungulate primers in the

endangered Neotropical pampas deer

(Ozotoceros bezoarticus). Genet Mol

Res. 6(4): 1118–1122, 2007.

Cymbron T, Freeman AR, Isabel Malheiro

M, Vigne JD, Bradley DG.

Microsatellite diversity suggests

different histories for Mediterranean and

Northern European cattle populations.

Proc Biol Sci. 272(1574): 1837–1843,

2005.

Deka R, Jin L, Shriver MD, Yu LM, DeCroo

S, Hundrieser J, Bunker CH, Ferrell RE,

Chakraborty R. Population genetics of

dinucleotide (dC-dA)n.(dG-dT)n

polymorphisms in world populations.

Am J Hum Genet. 56(2): 461–474, 1995.

Edwards CJ, Gaillard C, Bradley DG,

MacHugh DE. Y-specific microsatellite

polymorphisms in a range of bovid

species. Anim Genet. 31: 127–130, 2000.

Ellegren H, Moore S, Robinson N, Byrne K,

Ward W, Sheldon BC. Microsatellite

evolution-a reciprocal study of repeat

lengths at homologous loci in cattle and

sheep. Mol Biol Evol. 14(8): 854–860,

1997.

Finnilä S, Lehtonen MS, Majamaa K.

Phylogenetic Network for European

mtDNA. Am J Hum Genet. 68: 1475–

1484, 2001.

Flamand JRB, Vankan D, Gairhe KP,

Duong H, Barker JSF. Genetic

identification of wild Asian water

Buffalo in Nepal. Anim Cons. 6: 265–

270, 2003.

Hiendleder S, Kaupe B, Wassmuth R, Janke

A. Molecular analysis of wild and

domestic sheep questions current

nomenclature and provides evidence for

domestication from two different

subspecies. Proc Biol Sci. 269(1494):

893–904, 2002.


Honda T, Fujii T, Nomura T, Mukai F. Evaluation

of genetic diversity in Japanese Brown cattle

population by pedigree analysis. J Anim Breed

Genet. 123: 172–179, 2006.

Ibeagha-Awemu EM, Erhardt G. Genetic structure

and differentiation of 12 African Bos indicus

and Bos taurus cattle breeds, inferred from

protein and microsatellite polymorphisms. J

Anim Breed Genet. 122(1): 12–20, 2005.

Kang BT, Kim KS, Min MS, Chae YJ, Kang JW,

Yoon J, Choi J, Seong JK, Park HC, An J, Lee

MH, Park HM, Lee H. Microsatellite loci

analysis for the genetic variability and the

parentage test of five dog breeds in South

Korea. Genes Genet Syst. 84(3): 245–251, 2009.

Kantanen J, Olsaker I, Adalsteinsson S, Sandberg

K, Eythorsdottir E, Pirhonen K, Holm LE.

Temporal changes in genetic variation of north

European cattle breeds. Anim Genet. 30(1): 16–

27, 1999.

Kantanen J, Olsaker I, Holm LE, Lien S, Vilkki J,

Brusgaard K, Eythorsdottir E, Danell B,

Adalsteinsson S. Genetic diversity and

population structure of 20 North European

cattle breeds. J Hered. 91(6): 446–457, 2000.

Kantanen J, Edwards CJ, Bradley DG, Viinalass H,

Thessler S, Ivanova Z, Kiselyova T, Cinkulov

M, Popov R, Stojanović S, Ammosov I, Vilkki

J. Maternal and paternal genealogy of Eurasian

taurine cattle (Bos taurus). Heredity. 103(5):

404–415, 2009.

Kurar E. Comparative physical and linkage

mapping of bovine chromosome 24 with human

chromosome 18. Doktora Tezi (PhD Thesis).

University of Wisconsin-Madison, 2001.

Lawson Handley L-J, Byrne K, Santucci F,

Townsend S, Taylor M, Bruford MW, Hewitt

GM. Genetic structure of European sheep

breeds. Heredity. 99: 620–631, 2007.

Li J, Wang G, Bai Z. Genetic variability in four

wild and two farmed stocks of the Chinese

Markör Sistemleri 17

freshwater pearl mussel (Hyriopsis

cumingii) estimated by microsatellite

DNA markers. Aquaculture. 287: 286–

291, 2009.

Li MH, Adamowicz T, Switonski M,

Ammosov I, Ivanova Z, Kiselyova T,

Popov R, Kantanen J. Analysis of

population differentiation in North

Eurasian cattle (Bos taurus) using single

nucleotide polymorphisms in three genes

associated with production traits. Anim

Genet. 37(4): 390–392, 2006.

Li MH, Zerabruk M, Vangen O, Olsaker I,

Kantanen J. Reduced genetic structure of

north Ethiopian cattle revealed by Ychromosome

analysis. Heredity. 98:

214–221, 2007.

Lirón JP, Peral-Garcia P, Giovambattista G.

Genetic characterization of Argentine

and Bolivian Creole cattle breeds

assessed through microsatellites. J

Hered. 97(4): 331–339, 2006.

Liu BH. Statistical genomics: Linkage,

mapping, and QTL analysis. CRC Press

LLC, Boca Raton New York. 1998.

Loftus RT, MacHugh DE, Bradley DG,

Sharp PM, Cunningham P. Evidence for

two independent domestications of

cattle. Proc Natl Acad Sci USA. 91(7):

2757–2761, 1994.

Loftus RT, Ertuğrul O, Harba MH, El-

Barody AA, MacHugh DE, Park SDE,

Bradly DG. A microsatellite survey of

cattle from a centre of origin: The Near

East. Mol Ecol. 8: 2015–2022, 1999.

Luikart G, Gielly L, Excoffier L, Vigne JD,

Bouvet J, Taberlet P. Multiple maternal

origins and weak phylogeographic

structure in domestic goats. Proc Natl

Acad Sci USA. 98(10): 5927–5932, 2001.


18 Yusuf ÖZŞENSOY ve Ercan KURAR

Luís C, Juras R, Oom MM, Cothran EG. Genetic

diversity and relationships of Portuguese and

other horse breeds based on protein and

microsatellite loci variation. Anim Genet. 38(1):

20–27, 2007.

MacHugh DE, Shriver MD, Loftus RT,

Cunningham P, Bradley DG. Microsatellite

DNA variation and the evolution, domestication

and phylogeography of taurine and zebu cattle

(Bos taurus and Bos indicus). Genetics. 146(3):

1071–1086, 1997.

Mannen H, Kohno M, Nagata Y, Tsuji S, Bradley

DG, Yeo JS, Nyamsamba D, Zagdsuren Y,

Yokohama M, Nomura K, Amano T.

Independent mitochondrial origin and historical

genetic differentiation in North Eastern Asian

cattle. Mol Phylogenet Evol. 32(2): 539–544,

2004.

Matukumalli LK, Lawley CT, Schnabel RD, Taylor

JF, Allan MF, Heaton MP, O'Connell J, Moore

SS, Smith TPL, Sonstegard TS, Van Tassell CP.

Development and characterization of a high

density SNP genotyping assay for cattle. PLoS

One. 4(4): e5350, 2009.

Maudet C, Miller C, Bassano B, Breitenmoser-

Würsten C, Gauthier D, Obexer-Ruff G,

Michallet J, Taberlet P, Luikart G.

Microsatellite DNA and recent statistical

methods in wildlife conservation management:

Applications in Alpine ibex [Capra ibex(ibex)].

Mol Ecol. 11(3): 421–436, 2002.

McKay SD, Schnabel RD, Murdoch BM,

Matukumalli LK, Aerts J, Coppieters W, Crews

D, Dias Neto E, Gill CA, Gao C, Mannen H,

Wang Z, Van Tassell CP, Williams JL, Taylor

JF, Moore SS. An assessment of population

structure in eight breeds of cattle using a whole

genome SNP panel. BMC Genetics. 9: 37. 2008

from http://www.biomedcentral.com/1471–

2156/9/37

Metta M, Kanginakudru S, Gudiseva N, Nagaraju J.

Genetic characterization of the Indian cattle

breeds, Ongole and Deoni (Bos indicus), using

microsatellite markers – a preliminary study.

BMC Genetics. 5(16): 2004 from

http://www.biomedcentral.com/1471–

2156/5/16

Moazami-Goudarzi K, Laloë D, Furet JP,

Grosclaude F. Analysis of genetic

relationships between 10 cattle breeds

with 17 microsatellites. Anim Genet.

28(5): 338–345, 1997.

Molaee V, Osfoori R, Eskandari Nasab MP,

Qanbari S. Genetic relationships among

six Iranian indigenous sheep populations

based on microsatellite analysis. Small

Rum Res. 84: 121–124, 2009.

Muir WM, Wong GKS, Zhang Y, Wang J,

Groenen MAM, Crooijmans RPMA,

Megens HJ, Zhang H, Okimoto R,

Vereijken A, Jungerius A, Albers GAA,

Lawley CT, Delany ME, MacEachern S,

Cheng HH. Genome-wide assessment of

worldwide chicken SNP genetic

diversity indicates significant absence of

rare alleles in commercial breeds. Proc

Natl Acad Sci USA. 105(45): 17312-

17317, 2008.

Mukesh M, Sodhi M, Bhatia S.

Microsatellite-based diversity analysis

and genetic relationships of three Indian

sheep breeds. J Anim Breed Genet.

123(4): 258–264, 2006.

Negrini R, Nijman IJ, Milanesi E, Moazami-

Goudarzi K, Williams JL, Erhardt G,

Dunner S, Rodellar C, Valentini A,

Bradley DG, Olsaker I, Kantanen J,

Ajmone-Marsan P, Lenstra JA, European

Cattle Genetic Diversity Consortium.

Differentiation of European cattle by

AFLP fingerprinting. Anim Genet. 38(1):

60–66, 2007.

Orita M, Iwahana H, Kanazawa H, Hayashi

K, Sekiya T. Detection of

polymorphisms of human DNA by gel

electrophoresis as single-strand

conformation polymorphisms. Proc Natl

Acad Sci USA. 86: 2766–2770, 1989.


Orti G, Pearse DE, Avise JC. Phylogenetic

assessment of length variation at a

microsatellite locus. Proc Natl Acad Sci USA.

94(20): 10745–10749, 1997.

Rokas A, Ladoukakis E, Zouros E. Animal

mitochondrial DNA recombination revisited.

Trends Ecol Evol. 18(8): 411-417, 2003.

Smigielski EM, Sirotkin K, Ward M, Sherrry ST.

dbSNP: a database of single nucleotide

polymorphisms. Nucl Acids Res. 28(1): 352-

355, 2000.

Sollera BP, Paiva SR, Faria DA, Guimarães SEF,

Castro STR, Egito AA, Albuquerque MSM,

Piovezan U, Bertani GR, Mariante AD. Genetic

diversity of Brazilian pig breeds evidenced by

microsatellite markers. Livest Sci. 123: 8–15,

2009.

The International SNP Map Working Group. A

map of human genome sequence variation

containing 1.42 million single nucleotide

polymorphisms. Nature. 409: 928-933, 2001.

Trinderup M, Jørgensen JN, Hansen M.

Conservation considerations on Danish

Shorthorn Cattle using pedigree analysis. AGRI.

26: 27–33, 1999.

Troy CS, MacHugh DE, Bailey JF, Magee DA,

Loftus RT, Cunningham P, Chamberlain AT,

Sykes BC, Bradley DG. Genetic evidence for

Near-Eastern origins of European cattle. Nature.

410(6832): 1088–1091, 2001.

Vijh RK, Tantia MS, Mishra B, Kumar ST. Genetic

diversity and differentiation of dromedarian

camel of India. Anim Biotechnol. 18(2): 81–90,

2007.

Vos P, Hogers R, Bleeker M, Reijans M, van de

Lee T, Hornes M, Frijters A, Pot J, Peleman J,

Kuiper M, Zabeau M. AFLP: A new technique

for DNA fingerprinting. Nucl Acids Res. 23(21):

4407–4414, 1995.

Markör Sistemleri 19

Wang DG, Fan JB, Siao CJ, Berno A,

Young P, Sapolsky R, Ghandour G,

Perkins N, Winchester E, Spencer J,

Kruglyak L, Stein L, Hsie L, Topaloglou

T, Hubbell E, Robinson E, Mittmann M,

Morris MS, Shen N, Kilburn D, Rioux J,

Nusbaum C, Rozen S, Hudson TJ,

Lipshutz R, Chee M, Lander ES. Largescale

identification, mapping, and

genotyping of single-nucleotide

polymorphisms in the human genome.

Science. 280(5366): 1077–1082, 1998.

Weber JL, May PE. Abundant class of

human DNA polymorphisms which can

be typed using the polymerase chain

reaction. Am J Hum Genet. 44: 388–396,

1989.

Williams JGK, Kubelik AR, Livak KJ,

Rafalski JA, Tingey SV. DNA

polymorphisms amplified by arbitrary

primers are useful as genetic markers.

Nucl Acids Res. 18(22): 6531–6535,

1990.

Yan J, Shah T, Warburton ML, Buckler ES,

McMullen MD, Crouch J. Genetic

characterization and linkage

disequilibrium estimation of a global

maize collection using SNP markers.

PLoS One. 4(12): e8451, 2009.

Zhu C, Cheng L, Tong J, Yu X.

Development and Characterization of

New Single Nucleotide Polymorphism

Markers from Expressed Sequence Tags

in Common Carp (Cyprinus carpio). Int

J Mol Sci. 13(6): 7343-7353, 2012.


Journal of Cell and Molecular Biology 10(2):21-30, 2012 Research Article 21

Haliç University, Printed in Turkey.

http://jcmb.halic.edu.tr

COX5B and COX2 gene expressions in Multiple Sclerosis

Naeimeh SAFAVIZADEH 1 , Seyed Ali RAHMANI 1 , Mohamad ZAEFIZADEH 2*

1 Department of Science, Ahar Branch, Islamic Azad University- Ahar- Iran.

2 Department of Science, Ardabil Branch, Islamic Azad University- Ardabil- Iran.

(* author for correspondence; m.zaefi@gmail.com)

Received: 8 June 2012; Accepted: 14 August 2012

Abstract

Multiple Sclerosis (MS) is an autoimmune inflammatory disease which affects the Central Nervous

System (CNS) and leads to the destruction of myelin and atrophy of the axons. Genetic factors, in

addition to environmental ones, seem to play a role in MS. Numerous studies have reported

mitochondrial defects including a reduction in COX complex function related to the decrease of

mitochondrial gene expression in the cortex tissue of MS patients. This study aimed to assess COX5B

and COX2 gene expression in MS patients and controls. By using Real-Time PCR method, expression

levels of the COX5B and COX2 were determined, with reference to ß-actin and GAPDH. The results

showed that COX5B gene expression is significantly reduced in MS patients compared to control

(P


22 Naeimeh SAFAVIZADEH et al.

Introduction

Multiple Sclerosis (MS) is an inflammatory

demyelinating disease of the central nervous system

with axonal degeneration (Frohman et al., 2006).

The loss of myelin in MS may be the result of

direct damage to myelin through immune mediated

processes and dysfunction of oligodendrocytes

(Vercellino et al., 2009). Approximately 15–20%

of MS patients have a family history of MS, but

large extended pedigrees are uncommon, with most

MS families having no more than two or three

affected individuals. Studies in twins (Calabresi,

2007) and conjugal pairs indicate that much of this

familial clustering was the result of shared genetic

risk factors, while studies of migrants

(Ramagopalan et al., 2010) and apparent epidemics

(Koch et al., 2008) indicated a clear role for

environmental factors. Mitochondrial defects are

known to occur during aging, cancer, heart disease,

and a wide variety of degenerative diseases, such as

Alzheimer’s disease (AD), Parkinson’s disease

(PD), Huntington’s Disease (HD) and MS

(Henchcliffe et al., 2008). Mitochondria contain the

respiratory chain where energy in the form of ATP

is most efficiently produced (Damiano et al., 2010).

The mitochondrial respiratory chain is located in

the inner mitochondrial membrane and consists of

four complexes (complexes I–IV), whilst complex

V is directly involved in ATP synthesis. The

complexes of the mitochondrial respiratory chain

include multiple subunits; all but complex II (which

is entirely encoded by nuclear DNA) contain

proteins encoded by nuclear and mitochondrial

DNA (mtDNA). The final respiratory chain

complex [complex IV or cytochrome-c oxidase

(COX)] is the site at which over 90% of oxygen is

consumed. This complex is also involved in proton

pumping, essential for ATP synthesis (Alston et al.,

2011). The mammalian COX is composed of 13

subunits, of which the three largest are encoded by

the mtDNA and form the catalytic core of the

enzyme. The remaining ten, evolutionary younger,

nuclear-encoded subunits are involved in assembly

and regulation of the enzyme (Zee et al., 2006).

The function of mammalian COX can be

physiologically modulated and the enzyme

represents one of the key regulatory sites of energy

metabolism (Fernandes-Vizarra et al., 2009). COX

transfers electrons from cytochrome-c to molecular

oxygen, which is reduced to water. The electrons

pass from cytochrome-c, binding at subunit II,

through Cu (A) and heme as cofactors, to

the binuclear center buried inside subunit I

and composed of heme a3 and Cu (B), where

the incoming four electrons together with

four protons from the matrix are sequentially

used for oxygen reduction. This exergonic

redox reaction is coupled with proton

pumping across the inner mitochondrial

membrane, but the coupling of the two

processes (H + /e - stoichiometry) can be

modulated. In addition to Mitchell’s

chemiosmotic theory, a “second mechanism

of respiratory control” has been proposed

that involves the binding of adenine

nucleotides to nuclear-encoded COX

subunits. The key event is the

phosphorylation of subunit IV. Activity of

phosphorylated COX is regulated by

ATP/ADP ratio and respiratory rate is

precisely controlled according to the ATP

utilization. The membrane potential is kept

low (100-150 mV) and COX works at high

efficiency of proton translocation (H + /e - = 1).

The COX biosynthesis and assembly is

timely and complicated process involving

several rate-limiting steps reflecting the

sequential incorporation of the subunits

from either the cytosol (nuclearly coded

subunits) or from the mitochondrial matrix

(subunits I, II and III). The majority of COX

defects thus originate from mutations in

nuclear genes (Acin-Perez et al., 2009).

Mutations in the genes encoding several

COX assembly factors have been described

as a frequent cause of mitochondrial

diseases and have been assigned with

specific clinical symptoms. The dysfunction

of COX in these cases is mostly caused by

structural changes rather than by the changes

in amount of the enzyme (Galati et al.,

2009). Cytochrome-c oxidase subunit II,

abbreviated as CoxII, is the second subunit

of cytochrome-c oxidase subunit 2 (CO II)

transfers the electrons from cytochrome-c to

the catalytic subunit 1. It contains two

adjacent transmembrane regions in its Nterminus

and the major part of the protein is

exposed to the periplasmic or to the

mitochondrial intermembrane space,

respectively. CO II provides the substratebinding

site and contains a Cu centre called


Cu(A), probably the primary acceptor in

cytochrome-c oxidase. An exception is the

corresponding subunit of the cbb3-type oxidase

which lacks the Cu(A) redox-centre. Several

bacterial CO II have a C-terminal extension that

contains a covalently bound heme c (Barrientos et

al., 2009). Subunit Vb of mammalian cytochrome c

oxidase is encoded by a nuclear gene and

assembled with the other 12 COX subunits encoded

in both mitochondrial and nuclear DNA. This gene

located on chromosome 2, region cen-q13

(Williams et al., 2005). There is a common

symptom of MS with mitochondrial diseases such

as AD and PD, and also the point mutations in

mtDNA can cause damage to the myelin (DiMauro

et al., 2008). In this study, we compared COX5B

and COX2 gene expression among MS patients

with controls. In regard to the importance of

mitochondria in MS, we mainly centralized our

study on quantifying the expressions of COX5B

and COX2 using Real-Time PCR.

Materials and Methods

Subjects

Thirty-six patients (16 male, 20 female) and 30

controls (14 male, 16 female) took part in this

study. Written informed consent was obtained from

each individual. Peripheral blood samples (5ml)

were obtained from the cubital vein and collected in

cell preparation tubes containing an anticoagulant

(EDTA). Peripheral blood mononuclear cells

(PBMC) were isolated by EDTA density

centrifugation.

Table 1. Sequences of the primers used for RT-PCR

Gene name Primer sequence

COX5B

COX2

GAPDH

ß-actin

Cox Expression in MS 23

RNA Extraction

Total RNA was isolated by using a

RNAeasy kit from Roche (Germany),

according to the manufacturer’s

recommendations. The RNAsamples were

incubated with RNAse-free DNAse I at

37°C for 15 min. RNA samples were

purified with a RNAeasy kit. It is possible to

preserve extracted RNA for months under

−80 °C. Total RNA quality and quantity

were assessed in 2 ways. In the first method,

we estimated the RNA concentration by

ultraviolet absorbance at 260 nm (1

absorbance unit at 260 nm = 40 ng/μL RNA)

and the RNA purity by measuring the ratio

of absorbance at 260 nm and 280 nm (1.8 <

A260/A280


24 Naeimeh SAFAVIZADEH et al.

cDNA Synthesis

Total RNA from each sample was used to generate

cDNA with a Reverse Transcriptase cDNA

synthesis kit (Roche, Germany) with oligo (dT)

primers, according to the manufacturer’s protocol.

Briefly RNA and 1 μL oligo (dT) were mixed and

then heated at 70°C for 5 min. They were chilled on

ice until the other components were added. Then,

we added 2μL dNTP, 4 μL of buffer, and 1 μL of

ribolack (RNase inhibition). The samples were

mixed and incubated at 37°C for 5 min. Then 1 μL

of Reverse Transcriptase was added, and the

samples were mixed and incubated at 42°C for 60

min. The reaction was inactivated at 70°C for 10

min. Finally, cDNA was stored at -20°C.

Quantitative Real-Time PCR

Amplification was performed over 30 cycles on the

MJ Research PTC-200 Gradient Cycler (MJ

Research, Waltham Mass, USA). The annealing

temperature was 54°C, extension occurred at 72°C,

and denaturation occurred at 94°C. After

completion of PCR, the product was separated by

electrophoresis in 1% agarose gel and detected by

ethidium bromide staining. cDNAs testing positive

for ß-actin and GAPDH expression was used in the

Real-Time PCR. Relative expressions of COX2 and

COX5B in the blood samples was carried out by

Real-Time PCR analysis using the ABI PRISM

7700 Sequence Detection System (Applied

Biosystems, Darmastadt, Germany) and the SYBR

Green PCR Kit (Qiagene). The data were evaluated

by the CT method, which measures the

expression level of the target genes normalized to a

reference gene and relative to the expression of the

genes in the calibrator samples. After efficiency

testing, ß-actin and GAPDH were chosen as the

reference housekeeping genes and the same primer

pairs used for the standard PCR were utilized for

the Real-Time PCR. Amplification was performed

over 45 cycles. The annealing temperature was

54°C, extension occurred at 70°C, and denaturation

occurred at 94°C. Every cDNA samples were

measured in four separate preparations to correct

for minor variations. Melting curve analyses were

carried out after completion to confirm the presence

of single amplified species. The transcript levels of

COX2 and COX5B in the samples were normalized

to the transcriptional level of the housekeeping

genes ß-actin and GAPDH, and calculated relative

to the expression levels of the target genes in a

calibrator blood samples. The arithmetic

mean of the relative expression levels of

COX2 and COX5B for each group of

patients and controls were calculated.

Statistical analysis

Statistically significant differences were

calculated by the Student’s t-test, using the

SPSS 18.0 and Excel. Finally a Pvalue0.05

was accepted as the level of significance.

Results

To determine the role of mitochondriaencoded

gene and nuclear-encoded gene in

MS pathogenesis, using quantitative Real-

Time PCR analysis with SYBR-Green

fluorescent dye, we calculated the mRNA

fold change for one mitochondria-encoded

gene in complex IV (COX2) and one

nuclear-encoded gene in complex IV

(COX5B) of oxidative phosphorylation.

Real-Time PCR data analysis for genes

expression

Quantitative measurement of (COX2,

COX5B) gene expression was investigated

in 36 MS patients. Five different standard

concentrations were used to draw a standard

curve (Figure 1). Quantitative measurement

of gene expressions, achieved in the PCR of

the cycles, was done in the progressive

phase. Real-Time PCR Software can

determine the threshold cycle automatically

(Figure 2). In addition, due to temperature

changes in the melting curve analysis, there

is only one peak associated with the COX5B

and COX2 genes, which is a symptom of

lack of cases such as nonspecific products

and primer dimer (Figure 3). Then PCR,

standard curve, as a template standard DNA

of successive dilutions, was plotted for the

COX5B and COX2 genes (Figure 4).

Standard curve for the COX5B gene stands

for index (R 2 )=0.98 and also standard curve

of obtained COX2 gene stands for index

(R 2 )=0.95.


Figure 1. Amplification plots for MS COX5B

Figure 2. Ct values of COX5B in subjects

Cox expression in MS 25

Figure 3. Melting curve for COX 5b gene

Figure 4. Standard curve for COX5B gene

(determination of index R 2 =0.98).


26 Naeimeeh

SAFAVIZAADEH

et al.

Standarddized

results Ct

Accordinng

to the studiies

that were ddone

after Real

Time PCRR

test, the aveerage

of standdardized

Ct in

regard to the state of -actin

and GAPDH

genes in

COX5B among controol

and patientts

affected with

MS are 6.21, 6.71 aand

3.95, 5.446

respectiveely

(Figures 55).

In additionn,

the average of standardizzed

Ct in regard

to state oof

-actin andd

GAPDH gennes

in COX2 among controls

and patiennts

affected with

MS are 4.86,

4.38 and 4.84, 4.12 resspectively.

Figure 5.

The Ct COOX5B

gene, staandardized

wiith

ß-actin

Table

2. COX55B

and COX22

genes expresssion

(Ct) on n based of B-aactin

referencee

gene

GGene

CCompare

COOX5B

CCOX2

Taable

3. COX5BB

and COX2 ggenes

expresssion

(Ct) on based b of GAPPDH

referencee

gene.

Gene

COX5BB

COX22

Patieent

Vs Controll

6.71

Patieent

vs Controll

4.38

Compare

Patiient

vs Controol

Patiient

vs Controol

Means (Ct)

Std. Er rror mean d

6.21

4.86

Comp parison betweeen

the statisttical

analysis

of CO OX5B t-test annd

the resultss

showed that

there are meaningfful

differencees

in COX5B

gene (P0.05). Onn

the other hannd,

decreased

gene expression iin

COX5B wwas

observed

amon ng MS patiennts

rather thhan

controls,

howe ever, the resullts

showed noo

meaningful

differ rences for the COX2 gene. For equality

of va ariances, t-tesst

and Levenee’s

test were

perfo ormed. The results

showed that the data

relate ed to Ct was not significanntly

different

COX X5B gene amoong

patients and control.

Ct comparison c was

performed with t-test in

patien nts and contrrols.

The ressults

showed

that th he measured t is significantt

for COX5B

gene (Pvalue=0.0168)

and (PPvalue=0.005),

while e the data related too

Ct has

signif ficantly diffferent

COX22

gene in

patien nts and contrrol.

Ct commparison

was

perfo ormed with t-teest

in pateintss

and control.

The results showwed

that meeasured

t is

signif ficant for COOX2

gene ( (Pvalue=0.117)

and (Pvalue=0.124)

(

(Table 2, 3) ). Generally,

the re esults showedd

that actin aand

GAPDH

genes s are similaar

among ccontrol

and

patien nts.

0.1 19746

0. 1314

0.88 0

Means

(Ct) Std.Error S meean

df Tva

5.46

3.95

4.12

4.84

1.6

0.89

0.78

1.44

0.69

df Tvalue

664

2.69 00.0168

664

-1.67

Pvalue

0.117

alue

Pvalue

64 2.991

0.005

64 -1. 52 0.124


Determination of changes in gene expression

levels

To determine changes in the expressions COX5B

and COX2 genes Livak formula was used (Livak

and Schmittgen, 2001).

-actin gene: COX5B = 2 -CT = 2 -(6.21- 6.71) = 2 0.5 =

1.41

COX2 = 2 -CT = 2 -(4.86-4.38) = 2 -0.48

GAPDH gene: COX5B = 2 -CT = 2 -(3.95 - 5.46) = 2 1.51 =

2.84

COX2 = 2 -CT = 2 -(4.84-4.12) = 2 -0.72

Total results of the Real-Time PCR

According to the results obtained, it seems that

COX2 gene has no effect on MS patients; but

COX5B gene expression was decreased in MS

patients and this gene could play an important role

in neurodegenerative diseases. Correlation between

COX5B and COX2 gene expression turned out to

be R=0.92 in control. This correlation was R=0.84

in patients, who, despite being significant, was

lower compare to control. This difference, if

verified with further subjects and studies, can be

considered as a hypothesis about this disease.

Discussion

In this study, the expression levels of COX5B and

COX2 genes in MS patients and controls were

compared. The results showed that COX5B gene

expression in MS patients was significantly lower

compared to controls (P=0.0168) and (P=0.005). In

the case of Cox5B gene expression, a highly

significant difference between controls and

patients, despite the low number of samples,

indicates the role of this gene in patients, but it is

not clear that reduced expression of this gene is one

of the causes of disease, or when the disease

induces, the gene expression will be reduced. While

there was no significant differences in the COX2

gene expression between controls and patients,

differences between P=0.117 and P=0.124 was not

significant. One of the reasons that Cox2 gene is

not significant, it can be due to the low number of

samples and low df, it is necessary to consider the

mentioned term to report the more accurate results.

Degeneration of chronically demyelinated axons is

a major cause of the continuous, irreversible

neurological disability that occurs in the chronic

stages of MS (Aschrafi et al., 2008). Microarray

studies from cortical and white matter tissue of

Cox Expression in MS 27

patients with progressive MS showed upregulation

of genes involved in hypoxic

preconditioning and decreased expression of

mRNA for mitochondrial proteins (Lin et

al., 2006). The dominant loss of small axons

in MS lesions suggests energy deficiency as

a major mechanism included in axonal

degeneration (Stys, 2005). The newly

reported research provides evidence that

neurons in MS are respiratory-deficient due

to mtDNA deletions, which are extensive in

GM and may be induced by inflammation.

They propose induced multiple deletions of

mtDNA as an important contributor to

neurodegeneration in MS (Campbell et al.,

2010). This presents a unique challenge to

neurologists wanting to identify, diagnose,

and manage patients and families with

mitochondrial disease (Druzhyna et al.,

2008). Clonally expanded multiple deletions

of mtDNA causing respiratory deficiency

are well recognized in neurodegenerative

disorders and aging. Given the vulnerability

of mtDNA to oxidative damage and the

extent of inflammation in MS, often starting

with a preclinical phase and remaining

throughout the disease course, mtDNA

deletions might be expected in MS

(Nicholas et al., 2009). Repair of damaged

mtDNA rather than oxidative damage to

mtDNA per se is the most likely mechanism

by which mtDNA deletions are formed, and

clonal expansion is regarded as the

mechanism responsible for causing

respiratory deficiency. Where respiratory

deficiency is caused by induced multiple

DNA deletions, cells will have initially

contained deletions with different

breakpoints, one of which then clonally

expands to high levels over time (Krishnan

et al., 2008). Clonally expanded multiple

deletions of mtDNA are reported in

inclusion body myositis, a condition

associated with chronic inflammation.

Decrease in density of respiratory-deficient

neurons in lesions is a likely reflection of

mtDNA deletion-mediated cell loss as well

as increase in susceptibility to other insults

because of the clonally expanded mtDNA

deletions. The extent of mtDNA deletions

identified using long-range PCR on a global


28 Naeimeh SAFAVIZADEH et al.

scale regardless of cell type, and even in neurons

with intact complex IV activity, reflects the

potential of cells in MS to become respiratory

deficient through clonal expansion over the course

of the disease. By isolating individual neurons at a

single time point we identified high levels of

multiple mtDNA deletions within respiratorydeficient

cells. In contrast, mtDNA deletions

detected by long range PCR within respiratoryefficient

neurons in MS and controls were not

expanded to high levels (Micu et al., 2006).

Mitochondrial defects are increasingly recognized

to play a role in the pathogenesis of MS. Energy in

the form of ATP is most efficiently produced by

mitochondria, which also play a role in calcium

handling, production of reactive oxygen species

(ROS), and apoptosis (Lin et al., 2006). It is known

that mitochondria are intrinsically involved in the

cellular production of oxygen radicals and are

believed to play an important part in oxygen

radical-mediated cell damage in neurodegenerative

diseases. The investigations are in complete

agreement with the occurrence of activity defects of

COX in single muscle fibres. The mitochondrial

impairment is not to age or denervation-associated

muscular changes since the functional impairment

of mitochondria (Dutta et al., 2006). While

numerous pathogenetic mutations are routinely

detected in isolated COX deficiencies, the protocols

for characterizing the functional impact of these

mutations are still in early stages of development.

The integrative approach combining multiple

bioenergetic analyses performed in whole cells is

particularly promising, as the best way to

investigate the resulting pathogenetic changes

occurring in situ. The general severity of the

functional changes in COX defects suggests that

the development of effective drugs is very unlikely,

and that only gene therapy might lead to efficient

treatment of these diseases in the future (Smith et

al., 2005). Measurement of the threshold for

specific mtDNA mutations has been performed in

cultured cells elsewhere. The microphotometric

enzyme–assay system for measurement of COX

activity within individual muscle fibers is used in

conjunction with demonstration of myofibrillar

ATPase in serial sections, so that a normal range of

COX activity in individual muscle fibers of each

fiber type is defined in control samples. In previous

studies, a good correlation between

microphotometric enzyme analysis and biochemical

studies has been shown in patients with

Leigh syndrome (Ogbi et al., 2006). The

newly reported four proteins in particular

were responsible for distinguishing diseased

from healthy. Peptide fingerprint mapping

unambiguously identified these

differentially expressed proteins. Three

proteins identified are involved in

respiration including cytochrome c oxidase

subunit 5b (COX5b), the brain specific

isozyme of creatine kinase and hemoglobin

β-chain (Horváth et al., 2005). In previous

studies six genes, involved in energy

metabolism pathways, also had increased

transcript levels in the skeletal muscle of CR

rats compared with muscle of control rats.

These include genes associated with

mitochondrial ATP production, such as six

subunits of cytochrome c oxidase (COX I,

II, III, IV, Va, and VIII) and NADH

dehydrogenase (Kalman et al., 2007). All

mitochondria of the progeny are inherited

from the mother; and all 13 polypeptides

encoded by the mitochondrial genome are

located in the respiratory chain (complexes

I, III, IV and V). These biological principles

are helpful in understanding the clinical

syndromes and patterns of inheritance

associated with the mitochondrial

myopathies and encephalomyopathies

(Broadwater et al., 2011). Cellular injury

often has been associated with disturbances

in mitochondrial function. Interestingly, our

analysis indicated a pronounced increase in

the expression of mitochondrial cytochrome

c oxidase subunits IV and Vb, a finding that

was validated further by RT PCR.

Cytochrome c oxidase has been used

frequently as a marker for neuronal

metabolic activity, especially in pathological

conditions involving oxidative stress.

Neurons subject to oxidative damage show

abnormalities in mitochondrial dynamics

even in the absence of any apparent

indication of degeneration (Hamblet et al.,

2006). Elevations in cytochrome c oxidase

expression or function in vulnerable

neuronal subpopulations in AD, following

traumatic brain injury and preceding

apoptotic death of spinal cord motor neurons

after sciatic nerve avulsion, have been


eported. Thus, an increase in cytochrome c oxidase

expression may reflect aberrant energy metabolism

and oxidative damage in the spinal cord during

EAE (Fukui et al., 2007).

With due attention to the results of correlation

between COX2 and COX5B gene expressions with

nuclear DNA and mitochondrial DNA source, we

can claim that there is an interaction between two

COX gene expressions of genome and

mitochondria source and the effectiveness is of

COX enzymes in the MS patients. While the

number of selected samples were not more than 36,

the state of COX5B between patient and control

groups was meaningful. This means that in a group

of a number of members, there is no impact on its

meaninglessness. In COX2, the main reason for

meaninglessness may relate to the low number of

samples. Therefore, it would be better to reproduce

the experiments with an expanded sample size.

References

Acin-Perez R, Salazar E, Kamenetsky M, Buck J,

Levin LR, Manfredi G. Cyclic AMP Produced

inside Mitochondria Regulates Oxidative

Phosphorylation. Cell Metabolism. 9: 265-76,

2009.

Alston LC, He L, Morris A, Hughes I, Taylor R, et

al. Maternally inherited mitochondrial DNA

disease in consanguineous families. European

Journal of Human Genetics. 19: 1226-29, 2011.

Aschrafi A, Schwechter AD, Mameza MG, Natera-

Naranjo O, Gioio EA, Kaplan BB. MicroRNA-

338 regulates local cytochrome c oxidase IV

mRNA levels and oxidative phosphorylation in

the axons of sympathetic neurons. J Neurosci.

28: 12581-90, 2008.

Barrientos A, Gouget K, Horn D, Soto IC,

Fontanesi F. Suppression mechanisms of COX

assembly defects in yeast and human: insights

into the COX assembly process. Biochim

Biophys Acta. 1793: 97-107, 2009.

Broadwater L, Pandit A, Clements R, Azzam S, et

al. Analysis of the mitochondrial proteome in

multiple sclerosis cortex. Biochem Biophys

Acta. 1812(5): 630-41, 2011.

Calabresi P. Multiple sclerosis and demyelinating

conditions of the central nervous system. In:

Goldman L, Ausiello D, eds. Cecil Medicine.

Cox Expression in MS 29

23rd ed. Philadelphia, Pa: Saunders

Elsevier chap 436, 2007.

Campbell GR, Ziabreva I, Reeve AK,

Krishnan KJ, et al. Mitochondrial DNA

deletions and neurodegeneration in

multiple sclerosis. Ann Neurol. 69: 481-

92, 2010.

Damiano M, Galvan L, Deglon N, Brouillet

E. Mitochondria in Huntington’s disease.

Biochim Biophys Acta. 1802: 52-61,

2010.

DiMauro S, Schon EA. Mitochondrial

disorders in the nervous system. Annu

Rev Neurosci. 31: 91-123, 2008.

Druzhyna NM, Wilson GL, LeDoux SP.

Mitochondrial DNA repair in aging and

disease. Mech Ageing Dev.129: 383-90,

2008.

Dutta R, McDonough J, Yin X, Peterson J,

Chang A, Torres T, et al. Mitochondrial

dysfunction as a cause of axonal

degeneration in multiple sclerosis

patients. Ann Neurol. 59: 478-89, 2006.

Fernandez-Vizarra E, Tiranti V, Zeviani M.

Assembly of the oxidative

phosphorylation system in humans: what

we have learned by studying its defects.

Biochim Biophys Acta. 1793: 200-11,

2009.

Frohman EM, Racke MK, Raine CS.

Multiple sclerosis–the plaque and its

pathogenesis. N Engl J Med. 354: 942-

55, 2006.

Fukui H, Diaz F, Garcia S, Moraes CT.

Cytochrome c oxidase deficiency in

neurons decreases both oxidative stress

and amyloid formation in a mouse model

of Alzheimer's disease. Proc Natl Acad

Sci USA. 104:14163-8, 2007.

Galati G, Srinivasan S, Raza H, Prabu SK,

Hardy M, Chandran K, Lopez M,

Kalyanaraman B, Avadhani NG. Role of

nuclear-encoded subunit Vb in the

assembly and stability of cytochrome c

oxidase complex: implications in

mitochondrial dysfunction and ROS


30 Naeimeh SAFAVIZADEH et al.

production. Biochem J. 420: 439-49, 2009.

Hamblet NS, Ragland B, Ali M, Conyers B,

Castora FJ. Mutations in mitochondrial-encoded

cytochrome c oxidase subunits I, II, and III

genes detected in Alzheimer's disease using

single-strand conformation polymorphism.

Electrophoresis. 27: 398-408, 2006.

Henchcliffe C, Beal MF. Mitochondrial biology

and oxidative stress in Parkinson disease

pathogenesis. Nat Clin Pract Neurol. 4: 600-09,

2008.

Horváth R, Schoser BG, Müller-Höcker J, Völpel

M, Jaksch M, Lochmüller H. Mutations in

mtDNA-encoded cytochrome c oxidase subunit

genes causing isolated myopathy or severe

encephalomyopathy. Neuromuscular Disorders.

15: 851-57, 2005.

Kalman B, Laitinen K, Komoly S. The involvement

of mitochondria in the pathogenesis of multiple

sclerosis. J Neuroimmunol. 188: 1-12, 2007.

Koch M, Uyttenboogaart M, van Harten A, De

Keyser J. Factors associated with the risk of

secondary progression in multiple sclerosis.

Multiple Sclerosis. 14: 799-803, 2008.

Krishnan KJ, Reeve AK, Samuels DC, et al. What

causes mitochondrial DNA deletions in human

cells? Nat Genet. 40: 275-79, 2008.

Lin MT, Beal MF. Mitochondrial dysfunction and

oxidative stress in neurodegenerative diseases.

Nature. 443: 787-95, 2006.

Livak KJ, Schmittgen TD. Analysis of relative gene

expression data using real-time quantitative

PCR and the 2(-Delta DeltaC(T)) Method.

Methods. 25(4): 402-8, 2001.

Micu I, Jiang Q, Coderre E, et al. NMDA receptors

mediate calcium accumulation in myelin during

chemical ischaemia. Nature. 439: 988-92, 2006.

Nicholas A, Kraytsberg Y, Guo X, Khrapko K. On

the timing and the extent of clonal expansion of

mtDNA deletions: evidence from singlemolecule

PCR. Exp Neurol. 218: 316-19,

2009.

Ogbi M, Johnson JA. Protein kinase

Cepsilon interacts with cytochrome c

oxidase subunit IV and enhances

cytochrome c oxidase activity in

neonatal cardiac myocyte

preconditioning. Biochem J. 393: 191-9,

2006.

Ramagopalan SV, Dobson R, Meier UC,

Giovannoni G. Multiple sclerosis: risk

factors, prodromes, and potential causal

pathways. Lancet Neurol. 9: 727-39,

2010.

Smith D, Gray J, Mitchell L, Antholine WE,

Hosler JP. Assembly of Cytochrome-c

Oxidase in the Absence of Assembly

Protein Surf1p Leads to Loss of the

Active Site Heme. J Biol Chem. 280:

17652-56, 2005.

Stys PK. General mechanisms of axonal

damage and its prevention. J NeurolSci.

233: 3-13, 2005.

Vercellino M, Romagnolo A, Mattioda A,

Masera S, et al. Multiple sclerosis

relapses: a multivariable analysis of

residual disability determinants. Acta

Neurologica Scandinavica. 119(2): 126-

30, 2009.

Williams JC, Sue C, Banting GS, Yang H,

Glerum DM, Hendrickson WA, Schon

EA. Crystal structure of human SCO1:

implications for redox signaling by a

mitochondrial cytochrome c oxidase

"assembly" protein. J Biol Chem. 280:

15202-11, 2005.

Zee JM, Glerum DM. Defects in cytochrome

oxidase assembly in humans: lessons

from yeast. Biochem Cell Biol. 84:859-

69, 2006.


Journal of Cell and Molecular Biology 10(2):31-38, 2012 Research Article 31

Haliç University, Printed in Turkey.

http://jcmb.halic.edu.tr

Curcumin rendered protection against cadmium chloride induced

testicular damage in Swiss albino mice

Preeti SINGH * , Kanchan DEORA, Vandana SANKHLA, Priya MOGRA

Department of Zoology, College of Science, M.L.S. University, Udaipur-Rajasthan, 313001 India.

(* author for correspondence; priti1960@yahoo.co.in )

Received: 04 August 2011; Accepted: 01 November 2012

Abstract

Fertility interference, regulation and control have become a matter of global concern in order to maintain adequate,

sustainable and healthy population. Cadmium is known to interfere with reproductive physiology and adversely

affects the process of spermatogenesis, whereas curcumin is known to be a potent, protective herbal derivative,

which renders protection at the physiological, metabolic and cellular levels against numerous toxicants. In the

present research, four groups of Swiss albino mice, each group consisting of six mice, were treated with cadmium

chloride and curcumin. Group 1 was the control group, where mice were administered only vehicle. In the second

group, mice were administered only curcumin. In the third group mice were administered single oral dose of CdCl2,

50mg/kg/animal/day, for a day and were left for 15 days. The fourth group was pre-treated with curcumin

(10mg/animal/day) for 15 days and on the 16 th day they were administered with single oral dose of CdCl2

(50mg/kg/animal). In animals administered only cadmium, significant perturbations were observed in the process of

spermatogenesis. In the seminiferous tubules there is loss of cellular contact and associations, as manifested by loss

of germ cells. In organisms pre-treated with curcumin, marked decline in histopathological damage was observed,

where the loss of germ cells was not so pronounced. Hence, the present research categorically elucidates the

protective effect of curcumin against a single high dose of cadmium chloride induced perturbation in the process of

spermatogenesis .

Keywords: Curcumin, cadmium chloride, testicular damage, spermatogenesis, reproduction

Özet

Zerdeçal Swiss albino farelerde kadmiyum klorür ile indüklenmiş testiküler hasara karşı

koruma sağlar

Fertilitenin engellenmesi, düzenlenmesi ve kontrolü, syeterli, devamlı ve sağlıklı bir populasyonun sağlanması için

dünyanın ilgilendiği bir sorun haline gelmektedir. Kadmiyumun üreme fizyolojisini engellediği ve spermatogenez

sürecini ters olarak etkilediği bilinirken, fizyolojik, metabolik ve hücresel, seviyelerde pek çok toksik maddeye karşı

koruyucu olan zerdeçalın güçlü, koruyucu bir bitki türevi olduğu bilinmektedir. Bu araştırmada, her bir grupta altı

fare bulunan dört grup Swiss albino fareye kadmiyum klorür ve zerdeçal uygulanmıştır. Sadece distile su verilen

Grup1, kontrol grubunu oluşturmaktadır. İkinci grupta farelere sadece zerdeçal verilirken üçüncü gruptaki farelere

bir gün için 50mg/kg/hayvan/gün CdCl2 tek doz oral olarak uygulanmış ve 15 gün boyunca beklenmiştir. Dördüncü

gruba önceden 15 gün boyunca (10mg/hayvan/gün) zerdeçal uygulanmış ve 16. günde farelere tek doz oral olarak

50mg/kg/hayvan CdCl2 uygulanmıştır. Sadece kadmiyum uygulanan hayvanlarda spermatogenez sürecinde belirgin

bir düzensizlik gözlenmiştir ve germ hücre hasarıyla açıkça gösterildiği gibi seminifer tübüllerde hücresel iletişim ve

birliktelik kaybı gözlenmiştir. Önceden zerdeçal uygulanan organizmalarda germ hücre hasarının bildirilmediği

yerlerde histopatolojik hasarlarda belirgin bir düşüş görülmüştür. Bunun sonucu olarak bu araştırma çalışması

yüksek tek doz kadmiyum klorürün spermatogenez sürecindeki düzensizliği indüklemesine karşın, zerdeçalın

koruyucu etkisini kategorik olarak açığa kavuşturmaktadır.

Anahtar Kelimeler: Zerdeçal, kadmiyum klorür, testiküler hasar, spermatogenez, üreme


32 Preeti SINGH et al.

Introduction

In order to maintain adequate, sustainable and

healthy population; fertility interference, regulation

and control have become a matter of global

concern. Exposure to metals is a common

phenomenon due to their environmental

pervasiveness. Some metals are essential for life,

others have unknown biological functions, either

favorable or toxic, and some others have the

potential to cause toxicity (Col et al., 1999; Benoff

et al., 2000; Suwazono et al., 2000). Overexposure

of metals is in fact, one of the oldest environmental

problems since they are widely distributed in the

environmental workplace. Heavy metals are

persistent environmental contaminants since they

cannot be degraded or destroyed easily. These are

chemical elements capable of spreading in the

environmental compartments and circulating

between them. These metals are emitted in to the

atmosphere with the composition of fine particles

or in the gaseous form and are transported by

atmospheric fluxes to considerable distances where

they enter ecosystems of remote regions. However,

many heavy metals are urgently necessary for

functioning of the human body and other living

organisms in small amounts and belong to the range

of nutrients. Others, when passed on to the living

organisms cause poisoning or death (Danielyan,

2010). Some toxic heavy metals are cadmium (Cd),

arsenic (As), nickel (Ni), mercury (Hg), lead (Pb),

zinc (Zn), chromium (Cr) etc. A substantial number

of couples seek fertility treatment due to poor

semen quality and there is evidence in the literature

that male reproductive function seems to have

deteriorated considerably in the past four-five

decades due to multifaceted reasons being

psychological, physical , physiological, or due to

the effect of certain hazardous substances. One of

the hazardous substances is cadmium, the 48 th

element in the periodic table with an atomic weight

of 112.4 and is present in all components of our

environment viz. air, water and soil. It is used in

various industrial processes as an anti-corrosive

agent stabilizer in PVC products, as a color

pigment, and in fabrication of nickel-cadmium

batteries (Friberg et al., 1974; Fox, 1983; Elinder,

1985; Morrow, 1990). It serves no physiological

function within the mammalian system. The

Agency for Toxic Substances and Disease Registry

(ATSDR) has listed cadmium as number 7 in its top

20 list of hazardous substances and International

Agency for Research on Cancer (IARC) has

classified cadmium as a group 1 carcinogen. It has

extremely long biological half-life in mammals,

which is estimated to be about 17 years or longer in

humans (Nordberg, 1972; IARC, 1992)

Cadmium is highly toxic to various biological systems,

e.g. kidney (Friberg et al., 1974; Buchet et al., 1980;

Goyer, 1991), male and female reproductive systems

(Ferm and Carpenter, 1967; Massanyi et al., 2007; Wu et

al., 2008; Monsefi et al., 2010), brain (Beton et al., 1966;

Taylor et al., 1984; Bernard and Lauwerys,1986),

gastrointestinal tract (Sugawara and Sugawara, 1974),

liver , circulatory system (Stowe et al., 1972) and skeletal

system (Kawamura et al., 1978; Blumenthal et al., 1995;

Staessen et al.,1999). Due to the rapid industrialization and

overgrowing urbanization, the toxic effects of cadmium on

male reproduction is to be assessed and monitored and an

effort has to be made to check, counter balance or nullify

its toxicity .

India has a rich history of using plants for

medicinal purposes. Turmeric derived from Curcuma as a

medicine is used as home remedy for various diseases

(Ammon and Wahl, 1991; Eigner and Scholz, 1999).

Curcumin has been considered as a potent healing herbal

formulation, a strong antioxidant, which has been

considered to be more than three hundred times more

potent than vitamin E (Rao et al., 1982; Dikshit et al.,

1995). Curcumin is also reported to have anti-bacterial,

anti-amoebic, antifungal, anti-viral and anti-HIV activities

(Ammon et al., 1992; Azuine and Bhide, 1992; Ruby and

Kuttan, 1995 and Mortellini et al., 2000).

Hence, in the present study an effort has been made to

assess and monitor cadmium-induced reproductive toxicity

as after one single chance exposure and to observe whether

curcumin, derived from Curcuma longa has the potential

to protect and prevent testes from such toxicity.

Materials and methods

32-50 days old adult Swiss albino mice, weighing around

30-40 g, were maintained in plastic cages under controlled

lighting conditions (12 h light/12 h dark regime), relative

humidity (50 ± 5%) and temperature (37 ± 2°C). The

animals were fed on standard mice feed. Food and water

were given ad libitum. Each batch comprised of 6 mice

and their dose protocol was as follows-

Group 1 - Mice were administered the vehicle (distilled

water) for 16 days.

Group 2- Mice were administered curcumin 10mg/animal

for 16 days.

Group 3- Mice were administered single oral dose of

CdCl2 50mg/kg/animal/day for a day and left for 15 days.

Group 4- Mice were pretreated with curcumin

(10mg/animal/day) for 15 days and on the 16 th day mice

were administered with single oral dose of CdCl2

(50mg/kg/animal).

Twenty-four hours after administration of the last dose,

control and experimental animals were sacrificed. Testes

were excised and subsequently fixed in Bouins solutions.

After fixation testes were processed, wax blocks were

made. Wax sections were cut and slides were prepared,


then stained in haematoxylin and eosin for

histopathological studies (Kiernan, 2008).

For statistical evaluation of significance, 100

seminiferous tubules (‘a’ and ‘c’), per group were

assessed and X 2 (Chi Square) test was conducted

using the formula as per the two by two table.

Results

In the present study the testes of cadmium and

curcumin treated animals were assessed using the

following parameters: Changes in morphology,

testicular pathology, and cytostatic and cytotoxic

changes in the germ and Leydig cells.

The testes of control group mice administered only

vehicle showed normal pathology with distinct

seminiferous tubules undergoing different stages of

spermatogenesis. The interstitium was compact

with distinct Leydig cells (Fig.1). Spermatogonial

mother cells, primary and secondary spermatocytes,

maturing spermatids and spermatozoons embedded

in Sertoli cells were clearly visible (Fig.2).

Histopathological evaluation of only curcumin

treated mice testes showed normal structures

similar to control group. Testes of the cadmium

treated animals exhibited hemorrhage of its

vasculature, but the overall shape was not altered.

Seminiferous tubules appeared to lose their typical

spherical shape and tunica propria manifested

thickening and was irregularly and randomly

broken at places. Leydig cells were entrapped in the

degenerated interstitium (Fig. 3). There was general

derangement of morphology of spermatogonia,

Curcumin protects against cadmium chloride 33

where ‘b’ the Observed Frequency for category ‘a’

‘d’ is the Expected Frequency in the corresponding

category ‘c’

This experimental study was done after taking approval

from the Institutional Animal Ethics Committee

(No.Cs\Res\07\759).

a b a+b

c d c+d

a+c b+d N

;

X 2 = N (ad-bc) 2

(a+c ) ( b+d) ( a+b) (c+d)

spermatocytes and differentiating spermatids in the

seminiferous tubules (Fig. 4). In most of the peripheral

seminiferous tubules, the germ cells were seen to break

free end appeared in the lumen as puffs (Fig. 5). The cell

types which appeared to be most affected were

spermatocytes and spermatids. Tubular lumens were filled

with degenerated germ cells and multinucleated spermatid

aggregates (Fig. 3). Vacuolization of the seminiferous

epithelium was also observed (Fig. 6). The results show

that a single dose of cadmium causes a sudden increase in

testicular damage, apparently overpowering this tissue’s

natural defenses. Also, most of the seminiferous tubules of

testes in this group showed complete absence of primary

spermatocytes, secondary spermatocytes, spermatids and

spermatozoa and loss of spermatogenesis process (Fig. 6)

in comparison with normal structure of seminiferous

tubules in control mice. The seminiferous tubules of

experimental group animals pre-treated with curcumin for

15 days and cadmium chloride on 16 th day showed very

slight histopathological damage in the peripheral tubules

and the inner tubules appeared to be normal showing all

stages of spermatogenesis viz. spermatoginal mother cells,

primary and secondary spermatocytes, maturing

spermatids and spermatozoons embedded in Sertoli cells

(Fig.7 and 8).


34 Preeti SINGH et al.

Figure 1. 1) Photomicrograph of testis of control group mice administered only vehicle. Normal seminiferous

tubules (ST) and Leydig cell (LC) are clearly visible (20X). 2) Testis of control group mice administered only

vehicle. Seminiferous tubule with distinct spermatogonial mother cells (SMC), primary spermatocyte (PS),

secondary spermatocytes (SS), maturing spermatids (MS) and spermatozoa (S) are seen (40X). 3) Testis of cadmium

chloride (50mg/kg) treated group mice. Degenerate seminiferous tubules(ST) are clearly visible (20x). 4) Testis of

cadmium chloride(50mg/kg) treated group mice. Degenerated germ cells in lumen of seminiferous tubules are

clearly evident (40x). 5) Testis of cadmium chloride(50mg/kg) treated mice showing exfoliated germ cells(GC) in

tubular lumen (100x). 6) Testis of cadmium chloride (50mg/kg) treated mice. Seminiferous tubules are left with only

vacuolised spermatogonial mother cells (SMC) and Sertoli cell (SC) (100x). 7) Testis of group pre-treated with

curcumin(10mg/kg for 15 days) and then administered cadmium chloride(50mg/kg). Seminiferous tubules (ST)

showing stages of spermatogenesis and pyknotic nuclei in Leydig cells (LC) are clearly evident (40x). 8) Testis of

group pre-treated with curcumin (10mg/kg for 15 days) and then administered cadmium chloride(50mg/kg).

Maturing spermatids (MS) and adhered germ cells are visible (100x)


Discussion

The management of infertility problems is the need

of time. The importance of drugs from plant origin,

as fertility regulating agents for the males has long

been recognized. Medicinal plants present a

repertoire capable of providing varied constituents

which could be helpful in infertility management.

Curcumin, a potent antioxidant compound derived

from turmeric, has been used for centuries as a

natural dye, seasoning and medicine (Huang et al,

1988). In Ayurveda, a 5000 year old system of

medicine originating in India, curcumin in turmeric

has been used to treat dozens of common

conditions. Hence, in the present experiment an

effort has been made to observe ameliorative effect

of curcumin on testicular damage induced by

cadmium chloride. The evidence of the past twenty

years have shown a disturbing trend in male

reproductive health hazards due to careless use of

certain chemicals cadmium being one of them

,which causes detrimental effects on different

organs. Broad-spectrum irreversible toxic actions of

cadmium at the cellular and molecular levels have

been observed mainly on the reproductive system

of humans and experimental animals, by a number

of researchers (Batra et al., 2001; Chowdhury,

2004; Massanyi et al., 2007; Burukog and Bayc,

2008; Almansour, 2009; Obianime and Roberts,

2009). Cadmium has also been reported to cause

testicular damage in Leydig cells and seminiferous

tubules (Massanyi et al., 2007; Burukog and Bayc,

2008; Almansour, 2009; Obianime and Roberts,

2009; De Souza Predes et al., 2009 and Al attar

Curcumin protects against cadmium chloride 35

2011). These observations are similar to the results of the

present study, which has revealed that cadmium chloride

induced severe alterations in histopathological profile of

testes as manifested by disarrangement of morphology of

Leydig cells and 100% seminiferous tubular damage

within which spermatogonia, spermatocytes and

differentiating spermatids were severely affected and were

lost in the luminal space of the tubules culminating in total

suppression of spermatogenesis. There was induction of

azoospermia. The results of present experiment also

correlate well with other reports where cadmium has been

shown to induce testicular damage in rat and mice (Gunn

et al., 1970., Herranz et al., 2010; and Mathur et al.,

2010). Our observations are also similar to the

observations of Monsefi et al., 2008; Chowdhury, 2009

and Adamkovicova et al., 2010 where, similar to our

results cadmium chloride has shown to cause rapid

testicular edema, haemorrhage, necrosis and degeneration

of testicular membrane tissue. Adaikpoh and Obi (2009)

have reported that cadmium increased total cholesterol

levels in the testes and prostate of rats, which affects

Leydig cell function negatively. In the present

experimental design administration of curcumin protected

testis of mice exposed to cadmium as evidenced by

appearance of about 75% normal structures of

seminiferous tubule of testis showing the ongoing process

of spermatogenesis as evidenced by the presence of

spermatids and spermatozoon, and lack of exfoliated cells

in the luminal space. Additionally, the present study

indicated that the exposure to heavy metals produce

testicular damage, which leads to spermatogenic arrest

which is rectified and prevented by curcumin intake.

Table 1. Alterations in the seminiferous germ cells of Swiss albino mice challenged with cadmium chloride and

curcumin

S. No.

Experimental Protocol

1. Control (distilled water as a

vehicle for 16 days)

2. Curcumin (10 mg/animal/day

for 16 days)

3. Cadmium Chloride(50

mg/kg/animal/day for 15 days)

4. Curcumin (10 mg/animal/day

for 16 days) +Cadmium

Chloride(50 mg/kg/animal/day

for 15 days)

Types Of Germ Cells Present (P) And Exfoliated (E)

SMC S C P Sp S Sp S S Z Se C

P P P P P P P

Total

number of

germ cell

layers

9-11

P P P P P P P 9-11

P P E E E E P 2-3*

Χ 2 =4.241

P=0.04

P P E E P E P 6-10

Χ 2 =0.204

P=0.65

SMC – Spermatogonial Mother Cells; SC – Spermatogonial cells ; PSp- Primary Spermatocytes; SSp- Secondary

Spermatocytes; S- Spermatids; SZ- Spermatozoa; SeC- Sertoli Cells *Χ 2 significant at P ≤0.05


36 Preeti SINGH et al.

References

Adaikpoh M A and Obi F O. Prevention of

cadmium –induced alteration in rat testes and

prostrate lipid patterns by ɑ-tocopherol. African

Journal of Biochemistry. 3 (10): 321-325, c

2009.

Adamkovicova M, Toman R, and Cabaj M.

Diazinon and cadmium acute testicular toxicity

in rats examined by histopathological and

morphometrical methods. Slovak J Anim Sci.

43. (3): 134-140, 2010.

Almansour M I. Histological alterations induced by

lead in the testes of the quail Coturnix coturnix.

Res. J. Environ. Toxicol. 3:24-30, 2009.

Ammon HPT and Wahl M A. Pharmacology of

Curcuma longa. Planta Med.57: 1–7, 1991.

Ammon HPT, Anazodo MI, Safayhi H and Dhawan

BN. Curcumin a potent inhibitor of leukotriene

B4 formation in rat polymorphonuclear

neutrophils (PMNL). Planta Med. 67: 1-6,

1992.

Al-Attar AM. Antioxidant effect of vitamin E

treatment on some heavy metals-induced renal

and testicular injuries in male mice. Saudi

Journal of Biological Sciences. 18, 63–72,

2011.

ATSDR (Agency for Toxic Substances and Disease

Registry). Toxicological profile for Cadmium.

ATSDR / US department of Health and Human

Services, Atlanta/, US, 1999.

Azuine M, Bhide S. Chemo preventive effect of

turmeric against stomach and skin tumors

induced by chemical carcinogens in Swiss mice.

Nutr Cancer. 17:77-83,1992.

Batra N, Nehru B, and Bansal M P. Influence of

lead and zinc on rat male reproduction at

‘biochemical and histopathological levels’. J

Appl Toxicol. 21: 507–512,2001.

Benoff S, Jacob A and Hurley I R. Male infertility

and environmental exposure to lead and

cadmium. Hum Reprod. 6: 107-21. Update

2000.

Bernard A and Lauwerys R. Effects of cadmium exposure

in humans. In: Foulkes, E.C. ed. Handbook of

experimental pharmacology. 80:135-177, 1986.

Beton DC, Andrews GS, Davies HJ, et al. Acute cadmium

fume poisoning. Five cases with one death from renal

necrosis. Br J Ind Med. 23:292-301,1966.

Blumenthal NC, Cosma V, Skyler D, LeGeros J, and

Walters M. The effect of cadmium on the formation

and properties of hydroxyl apatite in vitro and its

relationto cadmium toxicity in the skeletal system.

Calcif Tissue Int. 56 (4): 316-22,1995.

Buchet JP, Roels H, Bernard A, et al. Assessment of

renal function of workers exposed to inorganic lead,

cadmium or mercury vapor. J Occup Med. 22: 741-

748,1980.

Burukoglu D and Baycu C. Protective effects of zinc on

testes of cadmium-treated rats. Bull Environ Contam.

81: 521–524, 2008.

Chowdhury AR. Recent Advances in Heavy Metals

Induced Effect on Male Reproductive Function-A

Retrospective. Al Ameen J Med Sci. 2(2): 37 -42,

2009.

Chowdhury AR. Male reproductive toxicity-new

perspective in life science. Chatterjee P and Chanda

AK (Ed). Life Science in Modern Perspective.

University of Calcutta. 97–10,2004.

Col M, Col C, Soran A, et al. Arsenic related Bowen’s

disease, Palmer keratosis, and skin cancer. Environ

Health Perspect. 107:687-9,1999.

Danielyan A. The problem of pollution with heavy metals

and possible risks related to that in watersheds with the

developed metallurgical industry. In: BALWOIS 2010

Conference. Ohrid, Republic of Macedonia. pp. 1–9,

2010.

De Souza Predes F , Diamante MAS and Dolder H.

Testis response to low doses of cadmium in Wistar

rats. Int J Exp Path, 91: 125–131,2009.

Dikshit M, Rastogi L, Shukla R and Srimal RC.

Prevention of ischaemia-induced biochemical changes

by curcumin and quinidine in the cat heart. Indian J

Med Res. 101: 31 - 35, 1995.


Eigner D and Scholz D. Ferula asa-foetida and

Curcuma longa in traditional medicinal

treatment and diet in Nepal. J Ethnopharmacol.

67: 1–6,1999.

Elinder CG. Cadmium: uses, occurrence and intake.

In: Cadmium and Health: A Toxicological and

Epidemiological Appraisal. Vol I: Exposure,

Dose, and Metabolism. Effects and Response

(Friberg L, Elinder CG, Kjellstrom T, Nordberg

GF, eds). Boca Raton, FL: CRC Press, 23-64,

1985.

Ferm VH and Carpenter SJ. Teratogenic effect of

cadmium and its inhibition by zinc. Nature.

216: 1123, 1967.

Fox MRS. Cadmium bioavailability. Federation

Proc. 42: 1726-1729, 1983.

Friberg L, Piscator M, Nordberg G, and Kjellström

T. Cadmium in the environment, 2nd ed.,

Cleveland, Ohio, CRC Press. 248, 1974.

Goyer R. Toxic effects of metals. In: Amdur, MO,

JD Doull, C.D. Klaassen, Eds. Casarett and

Doull's Toxicology. 4th ed. Pergamon Press,

New York. 623-680, 1991.

Gunn SA, Gould TC and Anderson WAD.

Maintenance of the structure and function of the

cauda epididymidis and contained spermatozoa

by testosterone following cadmium-induced

testicular necrosis in the rat. J reprod Fert.

21:443-448,1970.

Herranz LM, Tebaz F, Martin R, et al. Quantitative

Changes in rat Seminiferous Epithelium After

Chronic Administration of low Doses of

Cadmium and Zinc: A sterological study. The

open Andrology Journal. 2:27-36, 2010.

Huang M, Smart RC, Wong C, and Conney AH.

Inhibitory Effect of Curcumin, Chlorogenic

Acid, Caffeic Acid, and Ferulic Acid on Tumor

Promotion in Mouse Skin by 12-O-

Tetradecanoylphorbol-13-acetate. CANCER

RESEARCH 48, 5941-5946,1988.

International Agency for the Research on Cancer

(IARC). Cadmium in the human environment:

toxicity and carcinogenicity. IARC Scientific

publications. No 118. Lyon.1992.

Curcumin protects against cadmium chloride 37

Kawamura J, Yoshida O, Nishino K and Itokawa Y.

Disturbances in kidney functions and calcium and

phosphate metabolism in cadmium-poisoned rats.

Nephrology. 20:101-110,1978.

Kiernan JA. Histological and Histochemical Methods:

Theory and Practice. 4th ed. Bloxham, UK: Scion,

(2008)

Massanyi P, Lukac N, Slivkova J, et al. Mercuryinduced

alterations in rat kidneys and testes in vivo. J

Environ Sci Health A Tox Hazard Subst Environ

Eng. 42:865–870,2007.

Mathur N, Pandey G and Jain GC. Male Reproductive

toxicity of Some Selected Metals :A Review Journal of

biological sciences.10(5):396-404,2010.

Kamel MM , Abd El Razek AH, Ahmed KA and Kamel

GM. Exposure of Adult Male Rats to Cadmium:

Assessment of Sexual Behaviour, Fertility, Aggression

as well as Anxiety like Behaviour with Special

Reference to Biochemical and Pathological

Alterations.Life Science Journal, 2011;8(2)

Monsefi M, Alaee S, Moradshahi A, and Rohani

L.Cadmium-Induced Infertility in Male Mice., 2008.

Monsefi M, Alaee S, Moradshahi A, and Rohani L.

Cadmium-induced infertility in male mice. Environ

Toxicol. 25 (1):94-102, 2010.

Morrow H. Cadmium (Cd), Metals Handbook, 10th

Edition, Volume 2, ASM International, Metals Park,

Ohio, 1990.

Mortellini R, Foresti R, Bassi R, and Green C J.

Curcumin, an antioxidant and anti-inflammatory agent,

induces heme oxygenase-1 and protects endothelial

cells against oxidative stress. Free Radic Biol Med. 28:

1303-1312, 2000.

Nordberg G. Cadmium metabolisms and toxicity. Environ

Physiol Biochem. 2: 7-36, 1972.

Obianime AW and Roberts II . Antioxidants, cadmiuminduced

toxicity, serum biochemical and the

histological abnormalities of the kidney and testes of

the male Wistar rats. Niger. J Physiol Sci. 24: 177–185,

2009.

Rao TS, Basu N and Siddiqui H. Anti-inflammatory

activity of curcumin analogues. Indian J Med Res.


38 Preeti SINGH et al.

75:574-8, 1982.

Ruby AJ, and Kuttan G. Anti-tumour and

antioxidant activity of natural curcuminoids.

Cancer Lett .94:79-8, 1995.

Staessen J A, Roels H A, Emelianov D, et al.

Environmental exposure to cadmium, forearm

bone density, and risk of fractures: Prospective

Population study. Lancet, 353:1140-1144, 1999.

Stowe H D, Wilson M and Goyer R A. Clinical

and morphological effects of oral cadmium

toxicity in rabbits. Arch Pathol. 94: 389-405,

1972.

Sugawara C and Sugawara N. Cadmium toxicity

for rat intestine, especially on the absorption of

calcium and phosphorous. Jpn J Hyg. 28: 511-516,

1974.

Suwazono Y, Kobayashi E, Okubo Y, et al. Renal effects

of cadmium exposure in cadmium non polluted areas in

Japan. Environ Res. 84:44-45, 2000.

Taylor A, Jackson MA, Patil D, et al. Poisoning with

cadmium fumes after smelting lead. Br Med J.

288:1270-1271, 1984.

Wu HM, Lin-Tan DT, Wang ML, et al. Cadmium level in

seminal plasma may affect the pregnancy rate for

patients undergoing infertility evaluation and

treatment. Reproductive Toxicology. 25(4), 481-484,

2008.


Journal of Cell and Molecular Biology 10(1):39-51, 2013 Research Article 39

Haliç University, Printed in Turkey.

http://jcmb.halic.edu.tr

Study of Klebsiella pneumoniae isolates with ESBL activity,

from ICU and Nurseries, on the island of Mauritius

Salima Khurshid MUNGLOO-RUJUBALI 1 , Mohamed Iqbal ISSACK 2 , Yasmina

JAUFEERALLY-FAKIM 1*

1

Department of Biotechnology, University of Mauritius, Reduit, Mauritius.

2

Victoria Hospital, Ministry of Health and Quality of Life, Mauritius.

(* author for correspondence; yasmina@uom.ac.mu)

Received: 11 August 2011, Accepted: 2 November 2012

Abstract

Klebsiella pneumoniae with extended spectrum beta lactamase activity circulate widely among

nosocomial environments. Isolates were collected from hospitalised patients in ICU and nursery units

on the island of Mauritius, over a two year period. They were tested for their resistance/susceptibility

to various antibiotics using the double disc diffusion assay. Following the API biochemical assay their

genus/species were confirmed. Their genetic diversity was determined using RAPD, REP and BOX-

PCR. Among fifty isolates, most were highly diverse by these methods with a clustering into three

groups. No correlation was found among isolates of the same hospital or unit or with dates of

collection. Sequence analysis of parts of the TEM, SHV and CTX-M beta lactamase genes confirmed

the beta lactamase domain and the presence of SHV-11 and SHV-28. CTX-M 15 was found in some

isolates. Furthermore, integrase was PCR-amplified from a few isolates, showing the presence of an

integron-borne gene cassette. This study shows diverse clones of Klebsiella pneumoniae circulating

with ESBL activity.

Keywords: Klebsiella pneumoniae, ESBL, TEM, SHV, genetic diversity, beta lactamase

Özet

Mauritius adasında kreş ve yoğun bakım ünitesinden elde edilen ESBL aktiviteli

Klebsiella pneumoniae izolatlarının çalışması

Geniş spektrumlu beta laktamaz aktivitesi olan Klebsiella pneumoniae nosokomiyal çevrelerde büyük

ölçüde bulunmaktadır. İzolatlar, Mauritius adasındaki yoğun bakım ünitesinde yatan hastalardan ve

kreşlerden iki yıl boyunca toplanmıştır. Çift disk difüzyon testi kullanılarak izolatların çeşitli

antibiyotikler için dirençleri/duyarlılıkları incelenmiştir. Sonrasında API biyokimyasal test ile cins/tür

teyidi yapılmıştır. Genetik farklılıkları RAPD, REP ve BOX-PCR kullanılarak belirlenmiştir. Test

edilen elli kadar izolatın çoğu, üç grupta sınıflandırılan bu metodlar tarafından oldukça farklı

bulunmuştur. Aynı hastane, birimler, ya da aynı tarihlerde toplanan izolatlar arasında herhangi bir

korelasyon bulunmamıştır. TEM, SHV ve CTX-M beta laktamaz genlerinin dizi analizleri beta

laktamaz domeynini ve SHV-11 ile SHV-28 varlığını onaylamıştır. Bazı izolatlarda CTX-M 15

bulunmuştur. Bundan başka, birkaç izolattan PCR-amplifikasyonu yapılmış olan integraz ile, integronkaynaklı

gen kasetinin bulunduğu gösterilmiştir. Bu çalışma ESBL aktivitesiyle dolaşan Klebsiella

pneumoniae’nın farklı klonlarını göstermektedir.

Anahtar Kelimeler: Klebsiella pneumoniae, ESBL, TEM, SHV, genetik çeşitlilik, beta-laktamaz


40 Salima Khurshid MUNGLOO-RUJUBALI et al.

Introduction

Klebsiella pneumoniae is a very common source of

infections in hospital environments and are

particularly of threat to immune-compromised

patients. It is a gram-negative bacillus of the

Enterobacteriaceae family. It is mostly treated with

beta lactams and fluoroquinolones, but over the

years the bacteria have accumulated significant

resistance to many of those. Beta lactamases,

encoded in bacterial sequences, are able to

efficiently hydrolyse the beta lactams of many

antibiotics, thus rendering them inactive. A large

number of studies have demonstrated their wide

occurrence and rapid spread during the era of

widespread antibiotic use for medical applications

culminating in the appearance of extended

spectrum beta lactamases (ESBLs), which are

resistant to third generation cephalosporins

(Nteimam, 2005).

The mode of action of beta lactamases relies on

their ability to bind to enzymes of the bacterial cell

wall biosynthesis process, thereby killing the cells.

They have an active site serine residue. They act on

peptidases that cross-link the penultimate D-alanine

of one peptidoglycan unit to a free amino acid of

diamino pimelic acid (gram negative) or a lysine

residue (Gram positive). The D-alanine-D-alanine

substrate of the peptidoglycan unit has a similar

stereochemistry to the beta lactam moiety thus

competing for binding at the active site of the

peptidases. TEM and SHV beta lactamases were

characterised first, followed by CTX-M. They are

of the Class A enzymes (Ambler, 1980). According

to Hall and Barlow (2004), TEM enzymes have

experienced larger phenotypic evolution, than SHV

and CTX-M. CTX-M ESBLs provide resistance to

Cefotaxime, but usually not to Ceftazidime. The

double disc synergy method using Cefotaxime and

Ceftazidime for detection of ESBLs is the

recommended one by the British Society for Anti

Microbial Chemotherapy (BSAC). ESBLs can

hydrolyse the so-called modern β-lactams that are

cefotaxime, cefuroxime, aztreonam and

ceftazidime.

The last two decades have seen the appearance

of a large number of mutant forms of beta

lactamase genes from diverse organisms. Most

importantly, there seems to be a positive selection

for non-synonymous point mutations, which alter

the binding affinity of the enzyme for its

substrate. Key amino acid substitutions

bring changes in the substrate and inhibitor

binding affinities. Sequence comparisons of

the genes have identified the homology

within the TEM or within the SHV groups

and revealed codon alterations which lead to

different phenotypic profiles. Structural

comparison is useful in understanding the

outcome of nucleotide changes on the 3dimensional

features of the protein. Alleles

TEM 1A and 1F differ by silent mutations;

however derivative variants can arise by

further point mutations or by crossing-over

between two alleles. Examples of

substitutions can be found at www.lahey.org

which lists all the reported variants and their

codon differences. Recent work has

identified key amino acid replacements

which are responsible for phenotypic

changes. Mutations that cause the ESBL

phenotype are known to be R164H (Arg to

His), R164S (Arg to Ser) and G238S (Gly to

Ser). TEM-68, which has a decreased

sensitivity to inhibitors, has a R275L (Arg to

Leu) replacement compared to TEM-1.

Similarly other mutations lead to modulating

effects such as increasing or decreasing

MIC’s (minimum inhibitory concentrations).

β -lactam antibiotics penetrate the outer

membrane of many gram-negative bacteria

through porins, hence antibiotic resistance

can also result from porin loss or deficiency

(Nikaido, 1989). Several reports have

demonstrated that beta lactamase expression

is not the only form of resistance in ESBL

bacteria. Other mechanisms such as porin

loss have been described in many species

(Tsu-Lan et al., 2001).

An understanding of the bacterial

populations carrying ESBLs is essential to

characterise the molecular features

associated with the genes for β-lactamases

and understand their evolution. This study

describes the characterisation of Klebsiella

pneumoniae isolates from hospital sources

to assess their ESBL phenotype and identify

the corresponding gene sequences. The

genetic diversity of the strains carrying this

phenotype was determined to gauge the


extent of occurrence of the ESBL feature.

Materials and Methods

Isolation and characterisation of K. pneumoniae

About fifty isolates of K. pneumoniae were

obtained between March 2003 and January 2005

from six different hospitals (Table 1). These were

collected by the Central Analytical Laboratory of

Table 1. List of K.pneumoniae isolates

K. pneumonia isolates with ESBL activity 41

the Ministry of Health, Mauritius. They

were pre-selected for their ESBL phenotype

by double disk assay. An enlargement of the

inhibition zone of 5 mm in the presence of

clavulanic acid is a confirmation of an ESBL

presence. The isolates were characterised

biochemically using the Analytical Profile

Index (API) system.

ISOLATE DATE ISOLATED SEX AGE HOSPITAL WARD SOURCE

SS01 2.06.04 M 36 A ICU BLOOD

SS02 28.08.04 M 37 A ICU BLOOD

SS03 11.11.04 F 5 DAYS D 2-3 N/A

SS04 3.08.04 M 37 A ICU BLOOD

SS05 9.11.04 F 73 B D4 N/A

SS06 5.12.04 M NEWBORN A NURSERY BLOOD

SS07 23.08.04 F 60 C MICU BLOOD

SS08 27.01.04 F 69 C 1-3 N/A

SS09 14.11.04 F 4 DAYS A NURSERY N/A

SS10 26.03.03 NEONATES E NURSERY N/A

SS11 9.11.04 M 15 DAYS C NICU RECTALS

SS12 9.09.03 F 3 WEEKS C NICU N/A

SS13 24.10.04 NEONATES D NURSERY N/A

SS14 6.02.04 A NURSERY ENV(SINK)

SS15 29.11.04 F 6 DAYS A NURSERY N/A

SS16 23.06.04 M 29 B 04 BLOOD

SS17 19.11.04 M 62 B D4 N/A

SS18 20.10.04 M 11 B RDU VAS.CAT.FLUID

SS19 14.02.04 F 2 C S21 N/A

SS20 28.02.03 7 DAYS F N/A

SS21 22.11.02 4 DAYS B NICU N/A

SS22 3.06.04 M 40 A ICU URINE

SS23 3.06.04 M 40 A ICU URINE


42 Salima Khurshid MUNGLOO-RUJUBALI et al.

SS24 4.06.04 M 40 A ICU URINE

SS25 29.10.03 M 59 ICU CSF

SS26 19.09.04 M 53 D 4 N/A

SS27 11.11.04 M 5 DAYS C NICU RECTALS

SS28 27.10.03 M 67 ICU CSF

SS29 23.01.04 F 15 A ICU N/A

SS30 1.09.04 F 53 E DIALYSIS BLOOD

SS31 31.07.04 M 50 C MICU ET-SECRETION

SS32 26.11.04 F 11 DAYS A NURSERY BLOOD

SS33 14.01.05 M 44 A 2-4 BLOOD

SS34 19.02.04 F 61 E F69 BLOOD

SS35 10.12.04 F 5 WEEKS D NURSERY N/A

SS36 27.09.04 M 37 A 2-4 BLOOD

SS37 26.11.04 F 2 DAYS NURSERY N/A

SS38 14.01.05 M 57 E B1 BLOOD

SS39 20.09.04 M 53 D 4 BLOOD-DIALYSIS

SS40 22.10.03 M 50 C ICU BLOOD

SS41 2.10.03 M 42 C N/A

SS42 21.06.04 F 58 A 1-2 BLOOD

SS 43 18.11.03 F 68 B ICU BURN UNIT N/A

SS44 13.03.03 F 12 DAYS B NURSERY CSF

SS45 27.09.03 F 56 C ICU BLOOD

SS46 21.06.04 F 3 WEEKS D NURSERY BLOOD

SS47 16.06.04 M 44 C MICU N/A

SS48 4.10.04 C CARDIAC ICU ET SECRETION

SS49 30.11.04 M 34 A ICU BLOOD

SS50 29.07.04 M 34 D 1-3 BLOOD

RDU: Renal Dialysis unit, NICU: Neurological intensive care unit, MICU: Medical Intensive care

unit CSF: Cerebro spinal fluid , ET: endotracheal secretion; N/A: Not available

Their sensitivity to the following antibiotics either

alone or in the presence of clavulanic acid was

assessed on Mueller-Hinton agar using the pairs of

Oxoid combination discs: (ceftazidime-30

µg and ceftazidime/clavulanate-30/10 µg;

cefotaxime-30 µg and


cefotaxime/clavulanate - 30/10 µg; cefpodoxime-30

µg and cefpodoxime/clavulanate-30/10µg;

cefpirome-30 µg and cefpirome/clavulanate-

30/10µg).

BOX-PCR and RAPD PCR amplification

For the BOX-PCR, the primer 5’-

CTACGGCAAGGCGACGCTGACG-3’ (Martin et

al, 1992) was used. PCR was carried out in a total

reaction mixture of 25 µl, containing 50 mM buffer,

2 mM MgCl2, 200 µM each deoxynucleoside

triphosphate, 25 pmol of primer, 25 ng of template

DNA and 1 U of Taq DNA polymerase .

Amplifications were performed with a DNA

thermocycler (BIO-RAD) as follows: 1 cycle of 95º

C for 4 minutes, 30 cycles of 94º C for 30 s, 92º C

for 30 s, 50º C for 1 minute, 65º C for 8 minutes

and 1 cycle of 65º C for 8 minutes. The PCR

Table 2. List of primer sequences

K. pneumonia isolates with ESBL activity 43

products were run in 1.5 % agarose gel

stained with EtBr and observed to score for

markers.

Similar reaction was set up for RAPD

except that the annealing temperature was

32º C.

The gel banding patterns were scored and

the data was analysed by NTSYS; and the

tree was generated with Darwin 5.0.

Amplification and sequence analysis of

TEM, SHV and CTX-M genes

Standard PCR reactions were done for the

amplification of beta-lactamase genes using

published primer sequences (Table 2).

Products were purified after amplification

and sequenced. Sequence results were

manually checked and edited.

Primer Name Primer Sequence Reference

SHV A 5- ACT GAA TGA GGC GCT TCC-3

SHV B

SHV A1

5- ATC CCG CAG ATA AAT CAC C-3

5- TCA GCG AA AAC ACC TTG-3

Babini & Livermore, 2000

SHV A2 5 –TCC CGC AGA TAA ATC ACC A-3

SHV A11 5- ATG CGT TAT ATT CGC CTG TG-3

SHV A12 5- GTT AGC GTT GCC AGT GCT CG-3

SHV S1

5- TGG TTA TGC GTT ATA TTC GCC-

3

Gniadkowski et al., 1998

SHV S2 5- GGT TAG CGT TGC CAG TGC T-3

SHV B1 5-ATG CGT TAT ATT CGC CTG TG-3

SHV B2 5- GTT AGC GTT GCC AGT GCT CG-3

TEM D1

5- GGG AAT TCT CGG GGA AAT

GTG CGC GGA AC-3

TEM D2

5- GGG ATC CGA GTA AAC TTG GTC

TGA CAG-3

Bou et al., 2000

TEM A1 5- TAA AAT TCT TGA AGA CG-3

TEM A2 5- TTA CCA ATG CTT AAT CA-3

CTX-M1

CTX-M2

5- CGC TTT GCG ATG TGC AG-3

5- ACC GCG ATA TCG TTG GT-3

Jungmin Kim et al., 2005

INT 2F

INT 2R

5-TCTCGGGTAACATCAAGG -3

5- AAGCAGACTTGACCTGA -3

Mazel et al., 2000

Sequence Analysis

SHV, TEM and CTX-M homologue DNA

sequences were identified with tblastx

(www.ncbi.nlm.nih.gov/blast) search of the nonredundant

National Center for Biotechnology

Information (NCBI) sequence database. First of all

the nucleotide sequence were converted into

contigs using the following web page

http://pbil.univ-lyon1.fr/cap3.php. Tblastx

was carried out with the contigs in NCBI.

The contigs were translated into amino

acids by using the following program:

http://www.biochem.ucl.ac.uk/cgi-


44 Salima Khurshid MUNNGLOO-RUJUUBALI

et al.

bin/mcdoonald/cgina2aaa.pl

The aamino

acid seequence

with no stop coddon

was seleected.

This wwas

then aliigned

with tthe

corresponnding

sequence

that blasteed

well withh

a

low E-value.

The aamino

acid seequences

of SSHV,

TEM aand

CTX-M and their hoomologs

werre

aligned with

MultAliggn.

Results

Biochemmical

characteerisation

The API 20E system indicated thaat

45g negatiive

isolates wwere

identifieed

as Klebsiellla

pneumoniaae,

however these isolates could be classsified

into thrree

groups baased

on the prrofile

obtainedd:

Group I: Profile 52157773

Group II: : Profile 52153373

Group IIII:

Profile 52077773

Group IVV:

Profile 52055773

Group V: Profile 52557773

Group VII:

Profile 52255773

ESBL acctivity

Four out of fifty isolatees

were ESBLL

negative. Thhey

were isolates

SS22, SSS42,

SS45 and SS47. TThe

differencee

in the zone of inhibition was less thann

5

mm for each one oof

them. Thee

remaining 46

isolates wwere

confirmed

as ESBL producers.

The ddouble

disc asssay

revealed, tthat

except for

a

few, mosst

of the isolaates

produced evidence of an

extended spectrum beta lacctamase;

with

Cefot taxime, isolates

SS 35 andd

SS 42 were

susce eptible with a zone of iinhibition

of

about t 20 mm and 25 mm, resppectively,

and

an in ncrease of thiss

zone by > 5 mm in the

prese ence of clavullanate.

Three isolates, SS

17, SS S 31 and SSS

42 were suusceptible

to

Cefta azidime with nno

increase inn

diameter in

the presence of inhibiitor.

With

Cefpo odoxime, SS 442,

SS 45 andd

SS 47 were

susce eptible, whilee

with Cefpirrome

SS 42

and SS S 09 showedd

some susceeptibility

and

just a slight inccrease

of 4 mm in the

prese ence of inhibittor

clavulanatte.

Isolate SS

42 wa as considered a non-ESBL.

BOX X and RAPD PPCR

BOX X-PCR is commonly used for

fingerprinting

baacterial

genoomes

using

prime ers targeting repetitive elements in

interg genic regionns.

The oveerall

results

show wed that isolaates

SS49, SSS42,

SS45,

SS43,

SS44, SS48, , SS46, SS47, , SS50 which

were isolated duriing

the same year, but in

differ rent hospitalss,

were groupped

into one

cluste er (Figures 1, 2, 3). Isoolates

SS42,

SS44 4, SS45, SS477,

SS48, SS449

and SS50

also shared s the samme

API profilee

i.e profile 1

(Figu ures 2 and 5).

Figure 1.

DNA fingerrprint

analysiss

of K pneumooniae

by BOX X-PCR. Lane 42: SS42, Lanne

43: SS43,

Lane 44: SS44, Lane 445:

SS45, Lanne

46: SS46, LLane

47: SS47 7, Lane 48: SS48,

Lane 49:

SS49, Lane

50: SS50.

C: Control, HH:

Hyperladdeer

(11) Biolinne.


K. K pneumonia issolates

with ESBL

activity 45

Figure 2.

Dendogram generated froom

BOX-PCRR

based on Di ice similarity coefficient annd

neighbour

joining cllustering

for tthe

50 isolatess

of Klebsiellaa

pneumoniae e with a copheenetic

correlattion

(r) value

of 0.95299.

Figure 3. . RAPD fingeerprint

of K. pneumoniae

with

primer OP PA12. Lane 1: SS01, Lane 22:SS02,

Lane

3: SS03, Lane 4: SS004,

Lane 5: SS05,

Lane6: SS06, Lane 7: 7 SS07, Lanee

8: SS08, Laane

9: SS09,

Lane10: SS10, Lane 11: SS11, Laane12:

SS12, Lane13: SS1 13, Lane14: SSS14,

Lane 115:

SS15. C:

control, HH:Hyperladderr(11)

Bioline


46 Salima Khurshid MUNNGLOO-RUJUUBALI

et al.

Figure 4.

RAPD fingeerprint

of K .ppneumoniae

wwith

primer OPB O 01. Lane442:

SS42, Lanne

43: SS43,

Lane 44: SS44, Lane455:

SS45, Lanee

46: SS46, Laane47:

SS47, Lane48: SS488,

Lane 49: SSS49,

Lane50:

SS50.C: ccontrol,

H:Hyyperladder(1)

BBioline.

Figure 5.

Dendogram generated froom

RAPD-PCRR

based on Dice D similarity coefficient annd

neighbour

joining cllustering

of RRAPD

for the 550

isolates of f Klebsiella pn neumonia. Forr

both sets of data with the

BOX andd

RAPDs, the clustering of iisolates

was nnearly

the sam me, with three ddiscernable

grroups.


TEM, SHHV

and CTX-M

amplificaation

K. K pneumonia issolates

with ESBL

activity 47

Differentt

size productss

were obtaineed

for each set

of primers. The T TEM A1/ /A2 gave prodducts

slightly

longer thaan

1 kb. The CCTX-M

primeers

amplified a product of 585 5 bp. Both ssets

of SHV AA11

and A12,

and SHVV

B1 and B2 ggave

a producct

of 865 bp. AAmplification

n were detecteed

for thirty seven

isolates

for SHV A11 and SHVV

A12; twentyy

two isolates for SHVB1 and a SHVB2, reespectively.

AAmplification

was achieeved

with twenty-one

isolaates

for TEMM

A1/A2 and twenty eight isolates for TTEM

D1/D2.

There weere

only twelve

isolates, whhich

amplified with CTX-M M to give a product

of 585 bpp.

Figure 6. . Protein blastt

of translated product fromm

isolate SS11 with primer SSHV

A11/A122

Figure 7. . Alignment oof

amino acid sequence fromm

isolate SS11

with SHV-228.

The same wwas

obtained

with isolaate

SS25. Amiino

acid sequeence

from isollate

SS47 alig gned well withh

CTX-M 15.


48 Salima Khurshid MUNGLOO-RUJUBALI et al.

For one isolate, the presence of integrons was assessed using integrase specific primers. It was found

that the INT amplicon from isolate SS02 had the sequence for integrase. The BLAST result returned a

match with Corynebacterium diphtheriae integrase.

The results for integrase from isolate SS02 are shown below.

>2R.INT

QAMKT

ATAPLPPLRS VKVLDQLRER IRYLHYSLRT EQAYVHWVRA FIRFHGVRHP

ATLGSSEVEA FLSWLANERK VSVSTHRQAL AALLFFYGKV LCTDLPWLQE

IGRPRPSRRL PVVLTPDEVV RILGFLEGEH RLFAQLLYGT GMRISEGLQL

RVKDLDFDHG TII

ref|NP_940279.1| integrase [Corynebacterium diphtheriae NCTC ... 331 2e-89

REFSEQ: accession NC_002935.2

KEYWORDS complete genome.

SOURCE Corynebacterium diphtheriae NCTC 13129

ORGANISM Corynebacterium diphtheriae NCTC 13129

PUBMED 14602910

Amino acid sequence

>2int

mktataplpp lrsvkvldql rerirylhys lrteqayvhw vrafirfhgv rhpatlgsse

veaflswlan erkvsvsthr qalaallffy gkvlctdlpw lqeigrprps rrlpvvltpd

evvrilgfle gehrlfaqll ygtgmriseg lqlrvkdldf dhgtiivreg kgskdralml

peslapslre qlsrglcckd wrqsevgcrs apirrllrng g


Figuree

8. Conserveed

domain of integrases.

Discussioon

The Klebbsiella

pneumooniae

isolates

were analyssed

to determmine

their geenetic

relateddness

and moost

came from

ICU (42% %). These isolaates

were testted

by classiical

biochemiical

(growth on media, AAPI

identificaation

and Oxoiid

Combinatioon

disk test) aand

DNA- ba ased methods. . Biochemicall

profiles by tthe

API 20 E system identiified

two grouups.

The pphenotypic

chaaracterisation

of sensitivity to

the anti-microbials

inndicated

thatt

most of tthe

isolates thhat

were colleected

and pree-screened,

weere

in fact EESBLs.

API confirmed thheir

identity as

Klebsiellaa

pneumoniaee.

There are nno

reports of tthe

recent sittuation

regardding

the extent

of spread of

ESBL froom

Klebsiellaa

pneumoniaae

or any othher

resistant bbacterial

pathogens

in Mauuritius.

OPB 01, OPL 07 and OPA12 wwere

the RAPPD

primers ( (Fig 3&4), chhosen

from thee

twenty five or

so primeers

that weree

screened. PPrimer

OPA 12

producedd

more polymoorphic

profilees

than the othher

two and aall

the isolates

were differeent.

With primmer

OPL 07 tthe

same profiile

was obtainned

from isolattes

SS40, SSS41,

SS42, SS43,

SS44, SS445,

SS46, SS447,

SS48, SSS49,

and SS500.

They all haad

only 3 bannds

of sizes ssizes

700bp, 1000 bp and 1200 bp. Theese

same isollates

gave diffferent

patternns

with the othher

two primmers.

The denndrograms

obbtained

with tthe

results oof

BOX-PCRR

and that oof

RAPD booth

producedd

three groups.

Several of thhem

were in tthe

same grouup

for both mmethods.

No coorrelation

wass

found betweeen

hospitals aand

dates of f isolation suuggesting

thaat

the ESBLL

-

K. K pneumonia issolates

with ESBL

activity 49

carrying

strains hhad

originatedd

from very

diverse

sources. Siimilarly,

theree

was little or

no co orrelation fouund

among sammples

of the

same hospitals, pprobably

inddicating

that

there had not beeen

significannt

spread of

ESBL L carrying sstrains

withinn

the same

centre e, although thhe

sampling wwas

primarily

done from patientss.

RAPD andd

PFGE have

been used for typing of f Klebsiella

pneum moniae (Thouuraya

et al., 2003). Both

PFGE E typing and RAPDD

produced

conco ordant resullts

and diiscrimination

betwe een groups off

epidemiologiically

related

strain ns could be maade.

Th he presence oof

the beta-lacttamase

genes

were detected by PCR amplifiication

using

specific

primers fo for TEM, SHVV

and CTX-

M. All A fifty isolates

amplifieed

the TEM

and/o or SHV gennes

while oonly

twelve

produ uced a prodduct

with tthe

CTX-M

specific

primerss

(data noot

shown).

Ampl licons were purified andd

sequenced.

BLAST

results inddicated

that isolates

SS11

and SS25 carried SHV 28 whhereas

SS27

harbo oured SHV 11.

For isolatees

S01, S02,

S25 and S41-49, CTX-M 15 was present.

This variant is kknown

to bee

commonly

found d worldwide. There are fivve

groups of

CTX-M

enzymes, namely CTXX-M

1, 2,3, 4

and 25. ESBLL

carrying strains of

entero obacteria arre

resistant to third

gener ration cephhalosporins

such as


50 Salima Khurshid MUNGLOO-RUJUBALI et al.

cefotaxime, cefdazidime and ceftriaxone; and are

important threats. These enzymes do not affect

cephamycins or imipenems. CTX-M is widely

found in E. coli and Klebsiella isolates worldwide.

CTX-M 15 in Salmonella enterica has also been

shown to be present in stool samples of patients

suffering from acute diarrhoea (Rotimi et al.,

2008). The CTX-M 15 is encoded on large

incompatibility plasmids of sizes varying between

145,5 and 242,5 kb. Many are found as IncFII

together with IncFIA and IncFIB, with one report

showing IncFI not associated with any IncFII

(Mshana et al., 2009). This suggests that the

plasmids contribute to the lateral transfer of the

resistance genes. CTX-M ESBL hydrolyse

cefepime more efficiently than other ESBLs

(Mendonca et al., 2007).

TEM and SHV enzymes have evolved

significantly over the last decade or so and there is

some evidence of positive selection. A list of over

hundred different combinations of amino acid

substitutions have been reported for the 278 long

polypeptide. It is likely that the evolution of the

protein is directed towards finding the mutants that

have enhanced catalytic efficiency and can better

compete with others. Experimental prediction of

how resistance genes evolve in response to

selection pressure has shown that alleles of the

genes will mutate in a similar way as in nature.

Several in vitro experiments using gene shuffling,

or mutagenesis with Taq Polymerase under errorprone

or the use of nucleoside analogs have led to

the appearance of mutants with extreme resistance

(> 64X or to beta-lactamase inhibitor). Interestingly

these in vitro experiments have recovered amino

acid substitutions that are naturally found among

the TEM beta-lactamases. Hall and Barlow (2002)

have used error-prone PCR for assessing the

evolution of TEM-1 under selection pressure.

Mutations were introduced into the genes and the

mutated genes cloned into E.coli. Growth in

increasing concentrations of antibiotic led to the

identification of mutations in the resistance genes

which allowed survival in the highest antibiotic

concentrations. The cycles of mutations and

selection are repeated until there is no further

increase in resistance.

The Barlow-Hall in vitro method recovered

seven out of the nine amino acid substitutions that

had arisen in nature. The same approach has been

used to isolate an allele giving a resistance with a

MIC of 256 µg/ml compared to 0.5 µg ml

for reported, natural form of TEM. Those

resistant alleles had between 2 to 6 amino

acid substitutions. Three of these were

identified that increased the MIC from 0.5 to

2 µg /ml then to 32 µg /ml and finally from

32 µg /ml to 256µg /ml. This would strongly

suggest that there is a “natural evolutionary”

series of replacement leading to the most

resistant allele (Ford and Avison, 2004).

Analysis of a K. pneumoniae genome

sequence (strainMGH78578) reported two

chromosomal blaSHV genes. Closer

comparison of the surrounding sequence

(GC content and other genes) of the two

genes indicated that one had evolved from

within that strain itself. On the other hand

the second one was accompanied by

insertion sequences IS26 suggesting that it

was mobilised most likely from a different

K. pneumoniae strain. Nucleotide sequence

comparison and amino acid replacement at

the active site have pointed to convergent

evolution of ESBLs during the period of

intense cefotaxime use and later that of

ceftazidime.

Beta lactamase genes have been shown

to be vehicled as gene cassettes within

integron sequences. VEB-1 (Vietnamese

Extended Spectrum) and GES-1 (Guyanese

Extended Spectrum) were first described

associated with the intI1 integrase (Poirel et

al 1999., 2000). Being part of the integron

ensures that the resistance genes are rapidly

mobilised for lateral transfer intra- and interspecies.

In this study, one CTX-M 15 from

isolate SS02, was found together with an

integrase (Figure 3c). This could explain its

rapid spread since it was first described.

References

Ambler RP. The structure of betalactamases.

Philosophical Transactions

of the Royal Society of London. Series B:

Biological Sciences. 289: 321–331,

1980.

Babini G and Livermore DM. Are SHV beta

lactamases universal in Klebsiella

pneumonia. Antimicrobial Agents and

Chemotherapy. 44(8): 2230-2230, 2000.


Barlow M and Hall BG. Predicting evolutionary

potential: in vitro evolution accurately

reproduces natural evolution of the TEM -

lactamase. Genetics. 160: 823–832, 2002.

German B and Martinez-Beltran J. Cloning,

Nucleotide Sequencing, and Analysis of the

Gene Encoding an AmpC b-Lactamase in

Acinetobacter baumannii. Antimicrobial Agents

and Chemotherapy. 44(2): 428–432, 2000.

Ford PJ and Avison MB. Evolutionary mapping of

the SHV b-lactamase and evidence for two

separate IS26-dependent blaSHV mobilization

events from the Klebsiella pneumoniae

chromosome. Journal of Antimicrobial

Chemotherapy. 54: 69 – 75, 2004.

Gniadkowski M, Schneider I, Jungwirth R, et al.

Ceftazidime Resistant Enterobacteriaceae

isolates from three Polish Hospitals:

Identification of three novel TEM- and SHV-5

type Extended Spectrum Beta Lactamases.

Antimicrobial Agents and Chemotherapy. 42(3):

514-520, 1998.

Hall BG and Barlow M. Evolution of the serine

beta-lactamases: past, present and future. Drug

Resistance Update.7: 111–123, 2004.

Kim J, Lim Y, Jeong Y and Seol S. Occurrence of

CTX-M-3, CTX-M-15, CTX-M-14, and CTX-

M-9 Extended-Spectrum Beta Lactamases in

Enterobacteriaceae Clinical Isolates in Korea.

Antimicrob Agents Chemother. 49(4): 1572–

1575, 2005.

Mazel D, Dychinco B, Webb VA, and J. Davies.

Antibiotic resistance in the ECOR collection:

integrons and identification of a novel aad gene.

Antimicrob Agents Chemother. 44:1568–1574.

2000.

Mshana SE, Imirzalioglu C, Hossain H, et al.

Conjugative IncFI plasmids carrying CTX-M-

15 among Escherichia coli ESBL producing

isolates at a University hospital in Germany.

BioMedCentral (BMC) Infectious Diseases. 9:

97, 2009.

Mendonça N, Leitão J, Manageiro V, et al. Spread

of extended spectrum b-lactamase CTX-M-

K. pneumonia isolates with ESBL activity 51

producing Escherichia coli clinical

isolates in community and nosocomial

environments in Portugal. Antimicrob

Agents Chemother. 51:1946-1955, 2007.

Nikaido H. Outer membrane barrier as a

mechanism of antimicrobial resistance.

Antimicrob Agents Chemother. 33:1831-

1836, 1989.

Jonathan N. Screening for Extended-

Spectrum Beta-Lactamase-Producing

Pathogenic Enterobacteria in District

General Hospitals. J Clin Microbiol. 43:

1488–1490, 2005.

Poirel L, Naas T, Guibert M, et al.

Molecular and biochemical

characterization of VEB-1, a novel class

A extended-spectrum b-lactamase

encoded by an Escherichia coli integron

gene. Antimicrob Agents Chemother.

43:573–581, 1999.

Poirel L, Le Thomas I, Naas T, et al.

Biochemical sequence analyses of GES-

1, a novel class A extended-spectrum blactamase,

and the class 1 integron In52

from Klebsiella pneumoniae. Antimicrob

Agents Chemother. 44: 622–632, 2000.

Rotimi V, Jamal W, Pal T, et al. Emergence

of CTX-M-15 type extended-spectrum blactamase-producing

Salmonella spp. in

Kuwait and the United Arab Emirates. J

Med Microbiol. 57: 881–886, 2008.

Ben-Hamouda T, Foulon T, Ben cheikh-

Masmoudi A, et al. Molecular

epidemiology of an outbreak of multi

resistant Klebsiella pneumoniae in a

Tunisian neonatal ward. Journal of

Medical Microbiology. 52(5): 427-433,

2003.

Wu TL, Siu LK, Su LH, et al. Outer

membrane protein change combined

with co-existing TEM-1 and SHV-1 beta

lactamases lead to false identification of

ESBL producing Klebsiella pneumoniae.

J Antimicrob Chemother. 47:755-761,

2001.


Journal of Cell and Molecular Biology 10(2):53-59, 2012 Research Article 53

Haliç University, Printed in Turkey.

http://jcmb.halic.edu.tr

HIV-1 reverse transcriptase inhibition by Vitex negundo L. leaf

extract and quantification of flavonoids in relation to anti-HIV

activity

Mohan KANNAN 1* , Paramasivam RAJENDRAN 2 , Veerasami VEDHA 3 ,

Gnanasekaran ASHOK 3 , Shanmugam ANUSHKA 3 , Pratap CHANDRAN

RAMACHANDRAN NAIR 1

1 Department of Biotechnology and Research, K.V.M. College of Engineering and Information

Technology, Kokkothamangalam, Cherthala, Kerala, India.

2 Department of Microbiology, Sri Ramachandra Medical College & Research Institute, Sri

Ramachandra University, Porur, Chennai – 600 116, Tamilnadu, India.

3 Department of Microbiology, Post Graduate Institute of Basic Medical Sciences, University of

Madras, Taramani Campus, Chennai – 600 113, Tamilnadu, India.

(*author for correspondence; kannan.am@gmail.com)

Received: 22 September 2011, Accepted: 08 November 2012

Abstract

This study aimed to determine the activity of ethanolic leaf extract of Vitex negundo L. against HIV-1

Reverse Transcriptase (RT) and to identify and quantify the flavonoids present. The effects of

ethanolic (85%) leaf extract of Vitex negundo L. on RT activity in vitro were evaluated with

recombinant HIV-1 enzyme, using a non-radioactive HIV-RT colorimetric ELISA kit. In addition,

identification and quantification of flavonoids such as Rutin, Luteolin, Myricetin, Quercetin,

Kaempherol, Isorhamnetin and Quercetagetin were analysed using HPLC. The plant Vitex negundo L.

ethanolic leaf extract exhibited the most notable activity of 92.8% against HIV-1 RT at 200 µg/ml

concentration. Phytochemical analysis revealed the presence of steroids, triterpenes, alkaloids,

flavanoids, antroquinone glycosides and amino acids. Among 7 flavonoids tested, 6 were identified in

the decreasing order of quantity as Kaempherol, Myricetin, Quercetin, Quercetagetin, Isorhamnetin

and Luteolin. The study revealed that the plant Vitex negundo L. leaf possess anti-RT substances and

probably the flavonoids act as anti-virus agents.

Keywords: Vitex negundo, flavonoids, HIV-1 reverse transcriptase, phytochemical, anti-HIV activity.

Özet

Vitex negundo L. yaprak özütüyle HIV-1 ters transkriptaz inhibisyonu ve anti-

HIV aktivitesiyle ilişkili flavonoidlerin kantifikasyonu üzerine bir çalışma

Bu çalışmada HIV-1 ters transkriptaza karşı Vitex negundo L. etanolik yaprak özütünün aktivitesini

tespit etmek ve flavonoidlerin varlığını ölçmek amaçlanmıştır. Vitex negundo L. etanolik (%85)

yaprak özütünün in vitro RT aktivitesi üzerinde etkileri, rekombinant HIV-1 enzimi ile radyoaktif

olmayan HIV-RT kolorimetrik ELISA kiti kullanarak ölçülmüştür. Ayrıca, Rutin, Luteolin, Myricetin,

Quercetin, Kaempherol, Isorhamnetin ve Quercetagetin gibi flavonoidlerin tanımlanması ve

kantifikasyonu HPLC kullanılarak analiz edilmiştir. Vitex negundo etanolik yaprak özütü 200 µg/ml

konsantrasyonda HIV-1 RT’e karşı %92,8 aktivite göstermiştir. Fitokimyasal analizler steroidlerin,

triterpenlerin, alkoloidlerin, flavonoidlerin, antrokinon glikoitlerin ve aminoasitlerin varlığını açığa


54 Mohan KANNAN et al.

çıkartmaktadır. Test edilen 7 flavonoidden altısı, azalan miktarlarına göre Kaempherol, Myricetin,

Quercetin, Quercetagetin, Isorhamnetin ve Luteolin olacak şekilde belirlenmiştir. Bu çalışma, Vitex

negundo bitki yaprağının anti-ters transkriptaz özelliği bulunduğunu ve flavonoidlerin retrovirüslere

karşı muhtemelen antivirüs ajan olarak rol oynadıkları ortaya çıkarmaktadır.

Anahtar kelimeler: Vitex negundo, flavonoidler, HIV-1 ters transkriptaz, fitokimyasal, anti-HIV

aktivitesi.

Introduction

Acquired immunodeficiency syndrome (AIDS),

caused by the human immunodeficiency virus

(HIV), results in life-threatening opportunistic

infections and malignancies. HIV leads to the

destruction and functional impairment of the

immune system, subsequently destroying the

body’s ability to fight against infections (Kanazawa

and Matija, 2001). Moreover, the standard antiviral

therapies are too expensive for a common man. In

order to manage this condition alternative

treatments are explored.

Vitex negundo L., a member of Verbenaceae

family, an important medicinal plant is found

throughout India. Though almost all plant parts are

used, the extract from leaves and the roots is the

most important in the field of medicine and is sold

as drugs. The leaf extract is used in Ayurvedic and

Unani systems of medicine for treatment of various

ailments (Kapur et al., 1994). It also has mosquito

repellent activity (Hebbalkar et al., 1992), antiarthritic

effect on rats (Tamhankar et al., 1994),

analgesic activity on mice (Gupta et al., 1999),

hepatoprotective activity (Kapur et al., 1994), antiinflammatory

and anti-allergic activity (Chawla et

al., 1992; Jana et al., 1999). Besides being used as

a traditional medicine, its antiviral property,

especially against HIV, has not yet been explored

much.

Flavonoids have been proven to display a wide

range of biochemical and pharmacological actions

such as anti-carcinogenic, anti-viral, anti-microbial,

anti-thrombotic, anti-inflammatory, and antimutagenic

activities. In addition, flavonoids can act

as free radical scavengers and terminate the radical

chains reaction that occurs during the oxidation of

triglycerides in food system (Turkoglu et al., 2007).

Moreover flavonoid compounds represent an

important natural source of anti-retrovirals for

AIDS therapy due to their significant anti-HIV-1

activity and low toxicity.

One of the possible approaches is the

screening of plants based on their

ethnomedicinal data for inhibition (Vlietinck

et al., 1998). Current strategies for anti-HIV

chemotherapy involve inhibition of virus

adsorption, virus-cell fusion, reverse

transcription, integration, translation,

proteolytic cleavage, glycosylation,

assembly, or release (Moore and Stevenson,

2000; Miller and Hazuda, 2001). Reverse

transcriptase is an enzyme that reads the

sequence of HIV RNA that has entered the

host cell and transcribes the sequence into

complementary DNA. Without reverse

transcriptase, the viral genome cannot be

incorporated into the host cell and as a result

a virus will not replicate. Reverse

transcriptase is therefore the principal target

enzyme of antiretroviral drugs such as

Nevarapine and Delavirpine that are used to

treat HIV infected patients (De Clercq,

2007; Woradulayapinji et al., 2005).

Therefore this study has been designed to

explore the possible anti-HIV activity by RT

enzyme inhibition assay and to quantify the

flavonoids from the leaves of Vitex negundo.

Materials and Methods

Plant material and extraction

The leaves of Vitex negundo L. were

collected from Kolli hills adjoining

downstream areas of Namakkal district,

Tamil Nadu, India and authenticated

(PARC/2010/587) by Dr. Jayaraman, Plant

Anatomy Research Centre, National

Institute of Herbal Science, Chennai, India.

The plant samples were washed, shadedried,

powdered and extracted in 85%

ethanol and filtered. The extracts were then

concentrated to dryness under reduced

pressure and the residue was freshly

dissolved in appropriate buffer on each day


of experiment for the assays. Depending on the

assay, extract that could not dissolve in appropriate

buffer were dissolved in DMSO and later diluted to

different concentration needed for a particular

assay.

HIV-1 RT assay

The effect of the plant extract on RT activity in

vitro was evaluated with recombinant HIV-1

enzyme, using a non-radioactive HIV-1 RT

colorimetric ELISA kit (Roche) (Ayisi, 2003;

Harnett et al., 2005). The concentration of extract

used was 200µg/ml. The extracts, which reduced

activity by at least 50%, were considered as active

Percentage of Inhibition = 100 -

Preliminary phytochemical analysis

The ethanolic leaf extract was subjected to

preliminary phytochemical screening as per the

procedures of Harborne, 1998 and Kokate, 2003.

Quantitative analysis of flavonoids using HPLC

The procedure as described by Lawrence Evans

(2007) was used for the determination of flavonoids

in the plant extracts. The flavonoid standard used in

the study includes Rutin, Luteolin, Myricetin,

Quercetin, Kaempferol, Isorhamnetin and

Quercetagetin (Sigma Chemicals, USA) and were

prepared at 1 mg/ml in methanol. A total of 1g of

plant extract was extracted with 78 ml of extraction

solvent (methanol, water and hydrochloric acid;

50:20:8). Extract was then refluxed at 90 ◦ C for 2 h.

Then extract was cooled and latter 20 ml of

methanol was added and sonicated for 30 minutes.

All solutions were filtered through a 0.45µM

cellulose acetate membrane filter (Paul, USA)

before being injected into the HPLC. Aliquots of

the filtrate (20µl) were injected on to an HPLC

(Lachrom L-7000) column using C18 (Merck) (25

X 0.4 cm, 5µm) separately and eluted with mobile

phase solvent mixture comprising Water:

Methanol: Phosphoric acid (100:100:1, v:v:v) with

a flow rate at 1.5 ml/min. The UV detection was

Anti-HIV property of Vitex negundo L 55

(Woradulayapinji et al., 2005).

Azidothymidine (AZT) was used as a

positive control at 100 µg/ml. The control

(1) only contained the buffer and reaction

mixture (no enzyme and extracts were

added). For the control (2) the enzyme and

reaction mixture were added for the reaction

to take place. The absorbance was read on a

microtitre plate reader at 405 nm with a

reference wavelength of 490 nm. The mean

of the triplicate absorbance were analysed

using the formula:

Mean Sample absorbance X 100

Mean Control-2 absorbance

carried out at 270 nm. The chromatograms

were recorded and the areas measured for

the major peak to quantify the flavonoids in

the tested plant sample.

Results

The results shown in Table 1 indicates the

inhibition percentage of ethanolic leaf

extract of Vitex negundo L. against the

reverse transcriptase (RT) enzyme. The most

notable activity of about 92.8% was detected

against RT at 200µg/ml. The phytochemical

analysis of the plant extract revealed the

presence of steroids, triterpenes, alkaloids,

flavanoids, antroquinone glycosides and

aminoacids. In this study, flavonoids content

of the ethanolic extract of Vitex negundo L.

leaves were evaluated. The HPLC

chromatogram of the flavonoid standard

used and the chromatogram of the tested

plant extract is shown in Figure 1 & 2.

Results revealed that the extract consisted of

different amount of various flavonoid types.

As shown in Figure 1, the retention times of

Rutin, Quercetin, Kaempherol Luteolin,

Isorhamnetin , Myricetin, and Quercetagetin

were at 19.40, 24.80 29.70, 33.80, 38.70,

41.26 and 43.8 min, respectively.


56 Mohan KANNAN et al.

Table 1. Effect of ethanolic leaf extract of Vitex negundo L. on the activity of recombinant HIV-1

reverse transcriptase

Extract/Control Mean absorbance ± SD Percentage of Inhibition

Control 1 0.003 ± 0.01 100

Control 2 1.32 ± 0.01 0

AZT 0.193 ± 0.00 85.37

V. negundo L. 0.094 ± 0.01 92.8

Control 1- buffer and reaction mixture (no enzyme and extract); Control 2- enzyme and reaction

mixture (no extract); AZT – Azidothymidine (Positive control). The plant extract showing percentage

of inhibition greater than 50% has been considered as positive in inhibiting recombinant HIV-1

reverse transcriptase enzyme.

Figure 1. HPLC Chromatogram of the flavonoid standards used in the study. 1. Rutin 2. Quercetin,

3.Kaempherol, 4. Luteolin, 5.Isorhamnetin, 6.Myricetin, 7.Quercetagetin.

Figure 2 exhibits the presence of Quercetin, Kaempherol, Luteolin, Isorhamnetin, Myricetin and

Quercetagetin in Vitex negundo leaf extract as per the retention time. The flavonoid Rutin was not

identified in the chromatogram of the plant sample showing its absence in the plant extract. Amount

of tested flavonoid compounds in the extract were calculated by measuring the area obtained for the

peaks and in the order as Kaempherol (20.61 mg/g) > Myricetin (18.75 mg/g) > Quercetin (14.73

mg/g) > Quercetagetin (12.13 mg/g) > Isorhamnetin (11.01 mg/g) > Luteolin (6.40 mg/g).


Anti-HIV property of Vitex negundo L 57

Figure 2. HPLC chromatogram of Vitex negundo leaves. Probable flavonoids quantity as per area and

Retention time compared with the standard HPLC chromatogram: 1. Kaempherol ; 2. Myricetin ; 3.

Quercetin ; 4. Quercetagetin ; 5. Isorhamnetin ; 6. Luteolin.

Discussion

For centuries water extract of fresh mature leaves

are used in Ayurveda medicine as antiinflammatory,

analgesic and anti-itching agents

internally and externally. However the ethanolic

extract of V. negundo leaves resulted in the

isolation of a new flavones glycoside along with

five known compounds which were evaluated for

their antimicrobial activities by Sathyamoorthy et

al., (2007). However studies on anti-HIV activity of

V.negundo are few. For example the water extracts

of Vitex negundo (aerial part) was shown to have

HIV-1 RT inhibition ratio (% IR) higher than 90%

at a 200µg/ml concentration (Woradulayapinij et

al., 2005). Similarly the present study also showed

that the polar solvent extract of ethanolic leaf

extract of Vitex negundo L. had 92.8% inhibition of

recombinant HIV-1 reverse transcriptase enzyme at

200µg/ml. Previous phytochemical studies on V.

negundo L. had revealed the presence of volatile

oil, triterpenes, diterpenes, sesquiterpenes, lignan,

flavonoids, flavones glycosides, iridoid glycosides,

and steroids as physiologically active compounds

(Azhar and Abdul, 2004; Mukherjee et al., 1981).

For centuries, preparations that contain

flavonoids as the principal physiologically active

constituents have been used by physicians and lay

healers in attempts to treat human diseases

(Havsteen, 1983). Flavonoids are the largest

classes of naturally-occurring polyphenolic

compounds (Geissman and crout, 1969).

Evidence has been presented that substances

closely related to flavonoids inhibit the

fusion of the viral membrane with that of the

lysosome (Miller and Lenard, 1981).

Therefore the many claims from lay medical

practitioners of the prophylactic effects of

flavonoids against viral attack have

substantial support (Beladi et al., 1977).

Although the mechanism of the inhibition

remains unclear, it seems that prostaglandins

participate in the fusion of cell membranes.

Since flavonoids inhibit their formation, a

rationale can be constructed for the

protective effect of flavonoids against viral

diseases (Nagai et al., 1995a, 1995b;

Carpenedo et al., 1969). Moreover from the

previous reports it is clear that certain

naturally occurring flavonoids can inhibit

reverse transcriptases of different origins

(Spedding et al., 1989) From the above

reviews it is clear that the flavonoids have

anti-microbial activity, particularly the

antiviral. Therefore the present study is

focused particularly on flavonoids among

other phytochemicals. Moreover the choice


58 Mohan KANNAN et al.

of flavonoid standards used in this study was based

on those commonly found in herbs and vegetables

which have been studied earlier and evidenced to

possess anti-HIV activity.

Schinazi et al. (1997) showed that the flavonols

such as quercetin, myricetin, and quercetagetin,

which was used as standard control in this study,

have earlier been reported to inhibit certain viruses

in vitro, including the Rauscher murine leukemia

virus and the HIV virus. Among the 17 flavonols

tested by Schinazi et al. (1997) only 3-O-glucosides

of kaempherol, quercetin, and myricetin caused

significant inhibition of HIV-1 at nontoxic

concentrations. At the same time other comparative

studies with other flavonoids revealed that the

presence of both the double bond between positions

2 and 3 of the flavonoids pyrone ring, and the three

hydroxyl groups introduced on positions 5,6 and 7

(ie, baicalein) were a prerequisite for the inhibition

of RT-activity. Removal of the 6-hydroxyl group of

bacalein required the introduction of three

additional hydroxyl groups at position 3,3’ and 4’

(quercetin) to afford a compound still capable of

inhibiting the RT-activity. Quercetagetin which

contains the structures of both baicalein and

quercetin with an additional hydroxyl group on the

5’ position also proved strong inhibitors of RT

activity (Ono et al., 1990). Thus the activity of

Vitex negundo leaf extract against HIV-1 RT in the

present study might be due to the presence of above

mentioned flavonoids particularly due to the

presence of high quantity of Kaempherol, myricetin

and quercetin. However this needs to be explored

and confirmed. Probably this is the first report from

India confirming the possible anti-HIV activity of

Vitex negundo L.

Acknowledgement

We would like to thank Dr. Hannah Raichel

Vasanthi, Former in-charge of Herbal Indian

Medicinal Research laboratory, Sri Ramachandra

Medical College & Research Institute for providing

sophisticated lab facility for successful completion

of this work.

References

Ayisi NK and Nyadedzor C. Comparitive in vitro

effects of AZT and extracts of Ocimum

gratissium, Ficus polita, Clausena arisata,

Alchornea cordifolia and Elaeophorbia

drupifera against HIV-1 and HIV-2

infections. Antiviral Research. 13: 2559-

2562, 2003.

Azhar UH and Abdul M. Enzymes

Inhibiting Lignans from Vitex negundo,

Chemical and Pharmaceutical Bulletin.

52(11):1269-1272, 2004.

Beladi I, Pusztai R, Mucsi I, et al. Activity

of some flavonoids against viruses.

Annuals of the New York Academy of

Sciences. 284: 358–364, 1977.

Carpenedo F, Bortignon C, Bruni A and

Santi R. Effect of quercetin on

membrane-linked activities. Biochem

Pharmacol. 18: 1495– 1500, 1969.

Chawla AS, Sharma AK, Ha SS and Dhar

KL. Chemical investigation and antiinflammatory

activity of Vitex negundo

seeds. J Natl Prod. 55: 163-167, 1992.

De clercq E. Anti HIV drugs.

Verhandelingen-Koninklijke Academie

Geneeskdunde van Belgie. 69: 81-104,

2007.

Spedding G, Ratty A, Middleton E.

Inhibition of reverse transcriptase by

flavonoids. Antiviral Research. 12: 99-

110, 1989.

Geissman TA and Crout DHG. Organic

chemistry of secondary plant

metabolism. Freeman, Cooper &

Company, San-Francisco. 183-230,

1969.

Gupta M, Mazumber UK and Bhawal RS.

CNS activity of vitex negundo Linn. In

mice. Indian J Exptl Biol. 37: 143-146,

1999.

Harborne JB. Phytochemical Methods: A

Guide to Modern Techniques of Plant

Analysis. 3 rd (Ed). Chapman and Hall

Co, New York. 1-302, 1998.

Harnett SM, Oosthuizen V and Van De

Venter M. Anti-HIV activities of organic

and aqueous extracts of Sutherlandia

frutescens and Lobostemon trigonus.

Journal of Ethanopharmacology. 96:

113-119, 2005.


Havsteen B. Flavonoids, a class of natural products

of high pharmacological potency. Biochem

Pharmacol. 32: 1141–1148, 1983.

Hebbalkar DS, Hebbalkar GD and Sharma RN.

Mosquito repellent activity of oils from Vitex

negundo Linn. Leaves. Indian J Med Res. 95:

200-203, 1992.

Jana U, Chattopadhyay RN and Shaw B.

Preliminary studies on anti-inflammatory

activity of Zingiber officinale Rose, Vitex

negundo Linn. and Tinospora cordifolia

(Willid) Miers in albino rats. Indian J

Pharmacol. 31: 232-233, 1999.

Kanazawa S and Matija PB. Repression of MHC

determinants in HIV infection. Microbes Infect.

3: 467–473, 2001.

Kapur V, Pillai KK, Hussain SZ and Balani DK.

Hepatoprotective activity of ‘JIGRINE’ (An

Unani polypharmaceutical herbal formulation

on liver damage and lipid peroxidation caused

by alcohol-carbon tetrachloride and paracetamol

in rats. Indian J Pharm Sci. 56: 160, 1994.

Kokate CK, Purohit AP and Gokhale SB.

Pharmacognosy. Pune. 1-624, 2003.

Lawrence Evans. Pharmacopeial Forum. 28(5):

1545, 2007.

Miller DK and Lenard J. Antihistaminics, local

anaesthetics and other amines as antiviral

agents. Proc Natl Acad Sci. 78: 3605– 3609,

1981.

Miller MD and Hazuda DJ. New antiretroviral

agents: Looking beyond protease and reverse

transcriptase. Curr Opin Microbiol. 4: 535–539,

2001.

Moore JP and Stevenson M. New targets for

inhibitors of HIV-1 replication. Nat Rev Mol

Cell Biol. 1: 40–49, 2000.

Mukherjee KS and Badruddoza S. Chemical

constituents of Dillenia indica Linn. And Vitex

negundo Linn. J Indian Chem Soc. 58: 97,

1981.

Nagai T, Moriguchi R, Suzuki Y, et al. Mode of

action of the anti-influenza virus activity of

plant flavonoid, 5,7,40-trihydroxy-8methoxyflavone,

from the roots of Scutellaria

baicalensis. Antiviral Res 1995a; 26: 11– 25.

Anti-HIV property of Vitex negundo L 59

Nagai T, Suzuki Y, Tomimori T and

Yamada H. Antiviral activity of plant

flavonoid, 5,7,40-trihydroxy-8methoxyflavone,

from the roots of

Scutellaria baicalensis against influenza

A (H3N2) and B viruses. Biol Pharm

Bull. 18: 295–299, 1995b.

Ono K, Nakane H, Fukushima M, Chermann

JC and Barre-Sinoussi F. Differential

inhibitory effects of various flavonoids

on the activities of reverse transcriptase

and cellular DNA and RNA polymerases

Eur J Biochem. 190: 469-476, 1990.

Sathiamoorthy B, Prasoon Gupta, Manmeet

Kumar, Ashok K, Chaturvedi and Shukla

PK. New antifungal flavonoid glycoside

from Vitex negundo. Bioorganic &

Medicinal Chemistry Letters. 17: 239–

242, 2007.

Schinazi RF, Hughes SH and Chen FC. In

vitro anti-HIV activity of biflavonoids

isolated from Rhus succedanea and

Garcinia multiflora. J Nat Prod. 60:

884-888, 1997.

Tamhankar CP and Saraf MN. Anti-arthritic

activity of V. Negundo L. Indian J

Pharm Sci. 56: 154-160, 1994.

Turkoglu A, Duru ME, Mercan N, et al.

Antioxidant and antimicrobial activities

of Laetiporus sulphureous (Bull.)

Murrill. Food Chem. 101(1):267–73,

2007.

Vlietinck, AJ, De Bruyne T, Apers S and

Pieters LA. Plant derived leading

compounds for chemotherapy of human

immunodeficiency virus (HIV) infection.

Planta Med. 64: 97–109, 1998.

Woradulayapinij W, Soonthornchareonnon

N, Wiwat C. In vitro HIV type 1 reverse

transcriptase inhibitory activities of Thai

medicinal plants and Canna indica L.

rhizomes. Journal of

Ethnopharmacology. 101: 84-89, 2005.


Journal of Cell and Molecular Biology 10(2):61-69, 2012 Research Article 61

Haliç University, Printed in Turkey.

http://jcmb.halic.edu.tr

Genetic characterization and bottleneck analysis of Korki

Jonub Khorasan goats by microsatellite markers

Bizhan MAHMOUDI* 1 , Orang ESTEGHAMAT 2 , Ahmad SHAHRIYAR 1 and

Majnun Sh. BABAYEV 3

1 Islamic Azad University, Meshkinshahr Branch, Meshkinshahr, Ardabil, Iran

2 Department of Animal Sciences, Islamic Azad University, Astara Branch, Astara, Gilan, Iran

3 Department of Genetic, Faculty of Biology, Baku State University, Baku, Azerbaijan

(*author for correspondence: bizhan.mahmoudi@gmail.com)

Received: 19 March 2012, Accepted: 14 November 2012

Abstract

The present study was undertaken for population genetic analysis at molecular level to exploit the

breed for planning sustainable improvement, conservation and utilization, which subsequently can

improve the livelihood of its stake holders. Iranian goat populations are recognized as an invaluable

component of the world’s goat genetic resources. The genetic characterization and bottleneck analysis

in Korki Jonub Khorasan (KJK) was analyzed using 13 microsatellite markers. The observed number

of alleles ranged from 3 (OarAE133) to 11 (TGLA122) with a total of 98 alleles and mean of 7.54

alleles across loci. The overall heterozygosity, PIC and Shannon index values were 0.845, 0.76 and

1.759 indicating high genetic diversity. Only 4 out of 13 loci were in Hardy-Weinberg equilibrium.

The mean Fis was -0.059.Only 3 loci had positive Fis values and 10 loci had negative values. Genetic

bottleneck hypotheses were also explored. Our data suggest that the KJK goats have not experienced a

genetic bottleneck in the recent past.

Keywords: Bottleneck, Genetic Diversity, Microsatellites, Korki Jonub Khorasan, Fis.

Özet

Korki Jonub Horasan keçisinin mikrosatellit markörleriyle darboğaz analizi ve

genetik tanımlanması

Bu çalışmada sahiplerinin geçimini arttıracak soyların sürdürülebilir gelişiminin planlanması,

korunması ve faydalanılması için moleküler düzeyde popülasyon genetik analizi yapılması

üstlenilmiştir. İran keçisi popülasyonu dünyanın keçi genetik kaynaklarının çok değerli bir parçası

olarak kabul edilmektedir. Korki Jonub Horasan (KJK)’da genetik tanımlama ve darboğaz analizi 13

mikrosatellit markör kullanılarak yapılmıştır. Gözlemlenen allel sayısı toplam 98 allelden

3(OarAE133) -11(TGLA122) arasında değişmektedir ve lokuslar genelinde ortalama 7,54 allel vardır.

Heterozigotluk, PIC ve Shannon indeks değerleri 0,845, 0,76 ve 1,759 olup yüksek genetik çeşitliliği

işaret etmektedir. 13 lokustan 4’ü Hardy-Weinberg dengesindedir. Ortalama Fis -0,059’dur. Sadece 3

lokusun pozitif ve 10 lokusun negatif Fis değeri vardır. Genetik darboyun analizi ayrıca incelenmiştir.

Verilerimiz KJK keçilerinin yakın geçmişte genetik bir darboğaz ile karşılaşılmadığını öne

sürmektedir.

Anahtar Kelimeler: Darboğaz, Genetik çeşitlilik, Mikrosatellitler, Horasan keçisi, Fis.


62 Bizhan MAHMOUDI et al.

Introduction

Genetic diversity, the primary component of

adaptive evolution, is essential for the long-term

survival probability of a population (Avise, 1995;

Coltman et al., 1998; Harley et al., 2002). Genetic

diversity within domesticated species depends on

several factors such as changing agricultural

practices, breed replacement and cross breeding.

Genetic diversity has been analyzed by using

protein polymorphism, mitochondrial diversity and

microsatellite marker in both domestic and wild

species (Harley et al., 2002;Li and Valenti, 2004;

Tapiio et al., 2006; Pastor et al., 2004; Barker et

al., 2001; Li et al., 2002; Joshi et al., 2004, Rout et

al., 2008). The domestic goat (Capra hircus) is

known for its ability to thrive on paltry fodder and

to with stand harsh environments. From an

agricultural standpoint, the world’s 700 million

goats provide reliable access to meat, milk, skin,

and fiber for small farmers particularly in some

countries like Iran. Iran is bestowed with 8% of

total world’s goat population comprised of 8

recognized and many non-descript populations.

Among them, Korki Jonub Khorasan (KJK) is the

major goat population of Khorasane Jonobi

province and is known for fiber quality, meat and

milk production.

There are several studies on genetic diversity

of goats, based on microsatellite markers, such as

Swiss breeds (Saitbekova et al., 1999), Chinese

indigenous populations (Li et al., 2002), goats from

Europe (includingalso the breeds represented here)

and Middle East (Canon et al., 2006), Mehsana

goat (Aggarwal et al., 2007), Indian domestic goats

(Rout et al., 2008), Barbari goats (Ramamoorthi et

al., 2009) and Iranian native goats (Mahmoudi et

al., 2011).

Microsatellites have been used successfully to

define genetic relationships among different breeds

in Iran. Microsatellites display higher levels of

variation, and consequently, enable population

differentiation to be found more efficiently, so as to

help breeders to implement rational decisions for

conservation and improvement of valuable

germplasm (Mahmoudi et al., 2011).

Bottleneck analysis of KJK population has not been

carried out. Hence, it is essential to genetically

characterize and unfold the genetic diversity of

indigenous breeds.

The aim of our pervious study was to analyze

the genetic diversity and calculation of genetic

distance of three Iranian native goat

populations (Raeini, Korki Jonub Khorasan

and Lori) through the use of microsatellite

markers. Our pervious study demonstrates

that the closest distance was observed

between Raeini and KJK (D = 0.4891) and

the largest between Raeini and Lori (D =

0.6298). The UPGMA tree shows that two

goat populations (KJK and Raeini) are

distinct from the other goat population

(Lori) (Mahmoudi et al., 2011).

But in this study, Microsatellite analysis

was carried out to test for signatures of

recent population bottlenecks in Korki

Jonub Khorasan goat. This analysis was

carried out on 51 DNA samples with 13

microsatellite markers. For these loci,

genetic variation was quantified using

measures of the total number of alleles,

number of polymorphic loci, observed and

expected heterozygosity per locus and allelic

richness. We tested the Hardy-Weinberg

(HW) equilibrium and also calculated the

values of Fis (inbreeding coefficient).

Materials and Methods

51 blood samples were collected in 12

villages in which the population has a major

concentration. Samples were collected from

the individuals exhibiting typical population

characteristics and at least two samples were

collected from each village of Khorasane

Jonobi province in Iran. An effort was made

to collect samples from unrelated

individuals based on information provided

by farmers. Blood samples were collected

from each animal using EDTA vacutainer

and stored at –20 ºC till further use.

Blood samples (5–6 ml) were collected

from the jugular vein of the animal in

vacutainers containing EDTA as

anticoagulant. DNA was extracted from

whole blood using standard protocols

(Sambrook et al., 1989). The DNA isolation

procedure involved lysis of RBCs, digestion

of protein using proteinase K, and

precipitation of protein using phenol:

chloroform: isoamyl alcohol with 25: 24: 1

ratio.

In this study, 13 microsatellite primer

pairs were used, including MAF64,


BM4621, BM121, LSCV36, TGLA122,

OarJMP23, OarFCB304, OarAE133, ILSTS005,

ILSTS022, ILSTS029, ILSTS033 and ILSTS034.

Most of primers used were independent and

belonged to different chromosomes. Typical

polymerase chain reaction (PCR) testing was

carried out under these conditions: 60 ng of target

DNA was used in 25-μl PCR reaction containing

1×PCR buffer, 50 ng of each primer, 200 μM of

dNTPs, 0.5 units of Taq DNA Polymerase and 1.5

mMMgCl2. A Common “Touchdown” PCR profile

included 3 cycles of 45 sec at 95°C, 1 min at 60°C;

3 cycles of 45 sec at 95°C, 1 min at 57°C; 3 cycles

of 45 sec at 95°C, 1 min at 54°C; 3 cycles of 45 sec

at 95°C, 1 min at 51°C and 20 cycles of 45 sec at

92°C, 1 min at 48°C. In all cycles elongation

temperature and time were 72°C and 1 min,

respectively. Alleles were scored using unlabeled

primers with products visualized by silver staining

(Bassam et al., 1991). Genotype of individual

animal at 13 microsatellite loci was recorded by

direct counting.Genotypic data were analyzed using

POPGENE (Yeh and Boyle, 1997) and GenAlex

(Peakall and Smouse, 2006) to calculate the

observed number of alleles, effective number of

alleles, observed heterozygosity, expected

heterozygosity, and to test for Hardy–Weinberg

equilibrium (HWE).Allelic frequencies were

utilized for assessing polymorphic information

content (PIC), a measure of informativeness of a

marker, calculated according to Botstein et al.

(1980) using the given formula,

Where k is the number of alleles and xi and xj are

the frequencies of the ith and jth alleles

respectively.

Heterozygote deficiencies were estimated as Fis =

(Ho −He)/He, where Ho and He are the observed

and expected frequency of heterozygotes

respectively.

The bottlenecks program (Piry et al.,

1999) was used as an alternative measure of genetic

bottlenecks to test for excess gene diversity relative

to that expected under mutation-drift equilibrium.

The heterozygosity excess method exploits the fact

that allele diversity is reduced faster than

heterozygosity during a bottleneck, because rare

alleles are lost rapidly and have little effect on

Bottleneck analysis of KJH goats 63

heterozygosity, thus producing a transient

excess in heterozygosity relative to that

expected in a population of constant size

with the same number of alleles (Cornuet

and Luikart, 1996; Piry et al., 1999). To

determine the population ‘‘genetic reduction

signatures’’ characteristic of recent

reductions in effective population size (Ne),

the Wilcoxon’s heterozygosity excess test

(Piry et al., 1999) , standard differential test,

sign test and the allele frequency

distribution mode shift analysis(Luikart et

al., 1998) were performed using

BOTTLENECK (Piry et al., 1999). The

heterozygosity excess method was used to

analyzed the population and the data for the

heterozygosity excess test were examined

under the two-phased model (TPM;

95%stepwise mutation model with 5%

multi-step mutations and a variance among

multiple steps of 12), which is considered

best for microsatellite data (Piry et al., 1999;

Di Rienzo et al., 1994). We also analyzed

the allele frequency distribution for gaps.

Aqualitative descriptor of allele frequency

distribution (the mode-shift indicator),is

reported to discriminate between

bottlenecked and stable population (Luikart

et al.,1998).

Results

In order to maintain genetic diversity,

breeding strategies that increase effective

population size minimizing genetic drift

effect should be implemented. Microsatellite

markers in combination with recent

statistical methodologies represent a useful

tool for the conservation and management of

endangered breeds. In the present work, the

actual situation concerning genetic diversity

and population structure of this breed has

been evaluated using the molecular

information derived from 13 microsatellites

loci and the use of clustering methods.

13 pairs of highly polymorphic

microsatellite markers were chosen based on

their genomic location (Table 1).Various

measures of genetic variation are presented

in the Table 2. The F-statistics estimates are

presented in Table3. The number of alleles

observed across the microsatellite loci


64 Bizhan MAHMOUDI et al.

studied varied from 3(OarAE133) to 11

(TGLA122) with an overall mean of 7.54 (Table 2).

The observed number of alleles across the loci was

more than the effective number of alleles (2.355 to

6.973). The Shannon information index (I) and

polymorphic Information Content (PIC) showed

that most of the loci were highly informative

indicating the high polymorphism across the loci

with an overall mean of 1.759 and 0.76

Table 1. Details of the microsatellite used in the study

Locus Primer sequence

BM121

BM4621

ILSTS005

ILSTS022

ILSTS029

ILSTS033

ILSTS034

LSCV36

MAF64

OarAE133

OarFCB304

OarJMP23

TGLA122

respectively. The average observed

heterozygosity was more than the expected

(Table 3). The average expected gene

diversity (Nei, 1973) ranged from 0.581

(OarAE133) to 0.865 (TGLA122) with an

overall mean of 0.798. Nine out of total 13

loci studied showed significant deviations

from Hardy Weinberg Equilibrium.

Type of

repeat

Chromosome

No.

TGGCATTGTGAAAAGAAGTAAAA

CTAGCACTATCTGGCAAGCA

CAAATTGACTTATCCTTGGCTG

(TC)18 16

TGTAACATATGGGCTGCATC

GGAAGCAATGAAATCTATAGCC

(CA)14 6

TGTTCTGTGAGTTTGTAAGC

AGTCTGAAGGCCTGAGAACC

(nn)39 10

CTTACAGTCCTTGGGGTTGC

TGTTTTGATGGAACACAGCC

(GT)21 3

TGGATTTAGACCAGGGTTGG

TATTAGAGTGGCTCAGTGCC

(CA)19 3

ATGCAGACAGTTTTAGAGGG

AAGGGTCTAAGTCCACTGGC

(CA)12 12

GACCTGGTTTAGCAGAGAGC

GCACACACATACACAGAGATGCG

(GT)29 5

AAAGAGGAAAGGGTTATGTCTGGA

AATAGACCATTCAGAGAAACGTTGAC

(CA)16 19

CTCATCGAATCAGACAAAAGGTAGG

AGCCAGTAGGCCCTCACCAGG

(TG)13 1

CCAACCATTGGCAGCGGGAGTGTGG

CCCTAGGAGCTTTCAATAAAGAATCGG

(TG)24 Ann

CGCTGCTGTCAACTGGGTCAGGG

GTATCTTGGGAGCCTGTGGTTTATC

(CT)11(CA)15 19

GTCCCAGATGGGAATTGTCTCCAC

AATCACATGGCAAATAAGTACATAC

- 27

CCCTCCTCCAGGTAAATCAGC (CA)21 21


Within population inbreeding estimate (Fis) for

the investigated loci was -0.059. The estimates for

each locus are presented in Table 3. The values

ranged from –0.158 (TGLA122) to 0.047

(ILSTS05). Ten loci revealed negative Fis values.

The heterozygote deficiency may be a result of

inbreeding. The high genetic diversity observed in a

breed could be explained by overlapping

generations, mixing of populations from different

geographical locations, natural selection favoring

heterozygosity or subdivision accompanied by

genetic drift. Isolation, founder effects, genetic drift

and different selection pressures realized by

farmers in each population may have played major

role in differentiation of Iranian goats.

Any population that experienced a recent

bottleneck will show higher than expected

(equilibrium) heterozgosity for a large number of

loci. Microsatellite data were also subjected to

statistical analysis to test whether the populations

have undergone recent genetic bottleneck. Because

historical population sizes and levels of genetic

variation are seldom known, methods for detecting

bottlenecks in the absence of historical data would

be useful. Cornuet and Luikart, (1996) described

the quantitative methods suitable for analysis of

microsatellite data for detection of recent

bottlenecks in (100-200) generations.

Table 2. Number of alleles (Observed and

effective), Shannon's Information index and

Polymorphic Information Content for KJK goats

Locus name Na Ne I PIC

BM121 8 6.375 1.944 0.82

BM4621 9 6.007 1.969 0.81

ILSTS005 8 4.42 1.729 0.75

ILSTS022 7 4.321 1.606 0.73

LSTS029 7 4.579 1.702 0.75

ILSTS033 8 5.742 1.9 0.8

ILSTS034 7 6.267 1.89 0.82

LSCV36 9 6.367 1.988 0.82

MAF64 4 3.272 1.262 0.64

OarAE133 3 2.355 0.929 0.48

OarFCB304 9 6.391 2.014 0.83

OarJMP23 8 4.751 1.775 0.76

TGLA122 11 6.973 2.164 0.84

Mean 7.538 5.217 1.759 0.76

Na: Observed number of alleles; Ne: Effective number of

alleles; I: Shannon's Information index; PIC:

Polymorphic Information Content.

Bottleneck analysis of KJH goats 65

To determine whether a population exhibits

a significant number of loci with gene

diversity excess, there are three tests,

namely a "sign test", a "standardized

differences test" (Cornuet and Luikart,

1996) and a "Wilcoxon sign-rank test"

(Luikart et al., 1997).

Table 3. Observed and expected

heterozygosity with p-value, Fis value for

each microsatellite locus and mean estimate

of different parameters for KJK goats

Locus

Ho He Fis HWE

name

BM121 0.902 0.852 -0.06 ***

BM4621 0.804 0.842 0.045 ***

ILSTS005 0.745 0.781 0.047 NS

ILSTS022 0.863 0.776 -0.113 NS

ILSTS029 0.902 0.789 -0.144 ***

ILSTS033 0.902 0.834 -0.082 ***

ILSTS034 0.941 0.849 -0.11 ***

LSCV36 0.843 0.851 0.01 ***

MAF64 0.725 0.701 -0.035 NS

OarAE133 0.667 0.581 -0.149 NS

FCB304 0.882 0.852 -0.036 ***

OarJMP23 0.804 0.797 -0.008 ***

TGLA122 1 0.865 -0.158 ***

Mean 0.845 0.798 -0.059

NS: Not Significant; ***: Significant at the

0.1% level

All the three models of microsatellite

evaluation Infinite Allele Model (IAM),

Stepwise Mutation Model (SPM) and Two

Phase Model (TPM) were utilized for the

purpose. In a population at mutation-drift

equilibrium (i.e., the effective size of which

has remained constant in the recent past),

there is approximately an equal probability

that a locus shows gene diversity excess or a

gene diversity deficit. The first test suffers

from low statistical power. The second test

is not very useful since it requires at least 20

polymorphic loci. The Wilcoxon test

provides relatively high power and it can be

used with as few as four polymorphic loci

and any number of individuals (15-40

individuals and 10-15 polymorphic loci is

recommend to achieve high power. So, the

null hypothesis was again rejected under

IAM for the sign test. Standard difference


66 Bizhan MAHMOUDI et al.

test (T2 statistics) in this population provided the

significant (p


standardized difference test and Wilcoxon rank test

indicated heterozygosity excess in KJK population.

The Mode-shift indicator test was also utilized as a

second method to detect potential bottlenecks, as

the non-bottleneck populations that are near

mutation-drift equilibrium are expected to have a

large proportion of alleles with low frequency. This

test discriminates many bottlenecked populations

from stable populations (Luikart et al., 1998;

Luikart and Cornuet, 1997). The distribution

followed the normal L-shaped form. The alleles

with low frequencies (0.01–0.1) are the most

numerous and proportion of alleles showed a

normal ‘L’ shaped distribution (figure 1) This

distribution clearly show that the studied population

has not experienced a recent bottleneck.

Figure 1. L-shaped mode-shift graph showing lack

of recent genetic bottleneck in KJK population

Severely bottlenecked populations are important

to identify for conservation, as they are likely to

suffer from inbreeding depression, loss of genetic

variation, fixation of deleterious alleles as well as

increased demographic stochasticity, any of which

can ultimately reduce adaptive potential and the

probability of population persistence (Frankham,

1995).

Li et al. (2002) studied the genetic equilibrium

of 12 Chinese goat population's using17

microsatellite loci, all except three Tibetan

populations showed deviation from the equilibrium.

Tantia et al. (2004) reported heterozygosity excess

and genetic bottleneck in the Indian goat breeds

(Chegu and Black Bengal). Deviation from

mutation-drift equilibrium has been reported in

several populations; however they were mainly

associated with heterozygosity deficiency viz., in

Mehsani goats (Aggarwal et al., 2007). Among all

the seven population of Baltic sheep only Estonian

Bottleneck analysis of KJH goats 67

Ruhnu population showed a slight distortion

in distribution of allelic frequency

(Grigaliunaite et al., 2003).

Discussion

In conclusion, there was substantial genetic

variation and polymorphism across studied

loci in the KJK goat. And this population

was not in Hardy-Weinberg equilibrium at

most of the studied loci. The strong

inference that the KJK of goat has not

undergone bottleneck, as it suggests that any

unique alleles present in this breed may not

have been lost. Therefore, it can be

recommended that within breed diversity is

actively maintained to enable these

extensively unmanaged stocks to adapt to

future demands and conditions and there is

ample scope for further improvement in its

productivity through appropriate breeding

strategies.

Acknowledgments

This work was support by the Islamic Azad

University, Meshkinshahr Branch, Iran.

References

Aggarwal RAK, Dixit SP, Verma NK, et al.

Population genetic analysis of Mehsana goat

based on microsatellite markers. Current

Science. 92 (8):1133–1137, 2007.

Avise JC. Mitochondrial DNA

polymorphism and a connection between

genetics and demography of relevance to

conservation. Conservation Biology. 9: 686–

690, 1995.

Barker JSF, Tan SG, Moore SS, et al.

Genetic variation within and relationship

among populations of Asian goats (Capra

hircus). J Anim Breed Genet. 118:213-233,

2001.

Bassam BJ, Caetano-Anolles G, Gresshoff

M. Fast and sensitive silver staining of DNA

in polyacrylamide gels. Anal Biochem.

196:80-83, 1991.


68 Bizhan MAHMOUDI et al.

Botstein D, White RL, Skolnick M, Davis RW.

Construction of a genetic linkage map in man using

restriction fragment length polymorphisms. Am. J.

Hum Genet 32:314–331, 1980.

Coltman DW, Bowen WD, Wright JM. Birth

weight and neonatal survival of harbour seal pups

are positively correlated with genetic variation

measured by microsatellites. Proceeding Royal

Society of London (Biological Sciences) 265:803–

809, 1998.

Cornuet JM and Luikart G. Description and power

analysis of two tests for detecting recent population

bottlenecks from allele frequency data. Genetics

144: 2001–2014, 1996.

Di Rienzo A, Peterson AC, Garza JC, et al.

Mutational processes of simple-sequence repeat

loci in human populations. Proceeding of National

Academy of Sciences USA. 91:3166–3170, 1994.

Frankham R. Effective population size/adult

population size ratios in wildlife: a review. Genet.

Res. 66:95–107, 1995.

Grigaliunaite I, Haldja MT, Grislis VZ, et al.

Microsatellite variation in the Baltic Sheep breeds.

Veterinarija Ir Zootechnika. 21: 66-73, 2003.

Harley EH. AGARST, version 2.8, a program for

calculating allele frequencies, GST and RST from

microsatellite data. Wild life Genetics Unit,

University of Care Town, South Africa, 2002.

Joshi MB, Rout PK, Mandal A, et al.

Phylogeography and origin of Indian domestic

goats. Molecular Biology Evolution. 21: 454–462,

2004.

Li MH, Wang HS, Wei H, et al. Genetic

relationship among 12 Chinese indigenous goat

populations based on microsatellite analysis.

Genetic Selection and Evolution. 34:729- 744,

2002.

Li SL and Valenti A. Genetic diversity of Chinese

indigenous goat breeds based on microsatellite

markers. J Anim Breed Genet. 121: 350–55, 2004.

Luikart G and Cornuet JM. Empirical

evaluation of a test for identifying recently

bottlenecked populations from allele

frequency data. Conservation Biology. 12:

228-237,1997.

Luikart GL, Allendorf FW, Cornuet JM,

Sherwin WB. Distortion of allele frequency

distributions provides a test for recent

population bottlenecks. Journal of Heredity.

89:238–247, 1998.

Mahmoudi B, Babayev M Sh, Hayeri

Khiyavi F, Pourhosein A and Daliri M.

Breed characteristics in Iranian native goat

populations. Journal of Cell and Animal

Biology. 5: 129-134, 2011.

Nei M. Analysis of gene diversity in

subdivided populations. Proc. Natl. Acad.

Sci. USA 70:3321-3323, 1973.

Piry S, Luikart G, Cornuet JM.

BOTTLENECK: A program for detecting

recent effective population size reductions

from allele frequency data. Journal of

Heredity. 90: 502–503, 1999.

Peakall R and Smouse PE. GENALEX 6:

genetic analysis in Excel. Population genetic

software for teaching and research.

Molecular Ecology Notes. 6: 288-295, 2006.

Ramamoorthi J, Thilagam K, Sivaselvam

SN, Karthickeyan AMK. Genetic

characterization of Barbari goats using

microsatellite markers. Journal of

Veterinary Science. 10:72–76, 2009.

Rout PK, Joshi MB, Mandal A, et al.

Microsatellite-based phylogeny of Indian

domestic goats.BMC Genetics. 9:11, 2008.

Saitbekova N, Gaillard C, Obexer-Ruff G,

Dolf G. Genetic diversity in Swiss goat

breeds based on microsatellite analysis.

Animal Genetics. 30: 36–41, 1999.


Sambrook J, Fritsch EF, Maniatis T. Molecular

cloning: a laboratory manual, 2nd edition. Cold

Spring Harbor LaboratoryPress, Cold Spring

Harbor. 1989.

Tantia MS, Behl R, Sheoran N, et al. Microsatellite

data analysis for conservation of two goat breeds.

Ind J Ani Sci. 74: 761-767, 2004.

Tapiio S, Bennewitz J, Maleviciute E, et al.

Prioritization for Conservation of Northern

Bottleneck analysis of KJH goats 69

European Cattle Breeds Based 468 on

Analysis of Microsatellite Data.

Conservation Biology. 20: 1768–1779,

2006.

Yeh FC and Boyle TJB. Population genetic

analysis of co-dominant and dominant

markers and quantitative traits. Belg. J. Bot.

129: 157, 1997


Journal of Cell and Molecular Biology 10(2):71-77, 2012 Research Article 71

Haliç University, Printed in Turkey.

http://jcmb.halic.edu.tr

Low-Stringency Single-Specific-Primer PCR as a tool for

detection of mutations in the matK gene of Phaseolus vulgaris

exposed to paranitrophenol

Mohamed R. ENAN

Agricultural Genetic Engineering Research Institute (AGERI), Agricultural Research Center (ARC),

Giza, Egypt

(author for correspondence; mohamed.enan@uaeu.ac.ae)

Received: 26 April 2012; Accepted: 08 December 2012

Abstract

Low-stringency single specific primer polymerase chain reaction (LSSP)-PCR was assessed for its

suitability in detecting the genotoxic effect of paranitrophenol (PNP) in the dwarf bean (Phaseolus

vulgaris) exposed to different concentrations of PNP. DNA was extracted from both PNP-treated and

non-treated shoots that was amplified by specific PCR, using universal primers of maturase K

chloroplast DNA. PCR products of approximately 776 bp were subsequently used as a template for

LSSP-PCR analysis. We detected the genotoxic effect based on LSSP-PCR profiles of the DNA

generated in PNP-treated over the non-treated control of bean shoots. A complex electrophoretic

pattern consisting of many bands was obtained from control and treated samples. Surprisingly, DNA

sequencing data revealed that the homology among the maturase gene amplified from PNP-treated vs.

non-treated samples of dwarf beans are comparable. These results showed that the use of LSSP-PCR

analysis is not a proper tool to detect genotoxic effect in bean, at least in bean shoots that were

exposed to PNP.

Keywords: Genotoxicity, LSSP-PCR, Paranitrophenol, Phaseolus vulgaris, maturase K.

Özet

Paranitrofenole maruz kalan Phaseolus vulgaris’te matK geni mutasyonlarının

tespitinde bir araç olarak Düşük Kesinlikte Tek-Özgün Primerli PCR kullanımı

Düşük kesinlikte tek özgün primer lipolimeraz zincir reaksiyonunun (LSSP-PCR), paranitrofenolün

(PNP) sebep olduğu genotoksik etki tespitindeki uygunluğu farklı konsantrasyonlarda PNP’ye maruz

bırakılan bodur fasülyede (Phaseolus vulgaris) değerlendirildi. PNP ile muamele edilmiş veya

edilmemiş filizlerden izole edilen DNA, maturaz K kloroplast DNA’sının evrensel primerleri

kullanılarak özgün PCR ile çoğaltıldı. Hemen akabinde, 776 bç’lık PZR ürünleri LSSP-PCR analizi

için kalıp DNA olarak kullanıldı. PNP ile işlenmiş fasülye filizinden elde edilen DNA üzerindeki

genotoksik etkilerin PNP ile işlenmemiş kontrollere olan kıyasını LSSP-PCR profiline dayanarak

tespit ettik. Kontrol ve işlenmiş örneklerde birçok banttan oluşan karmaşık elektroforetik motifler elde

edildi. Şaşırtıcı bir şekilde DNA dizi analizi verileri PNP ile işlenmiş ve işlenmemiş bodur fasülye

örneklerinde çoğaltılan maturaz geni homolojisinin kıyaslanabilir olduğunu gösterdi. Bu sonuçlar,

LSSP-PCR analizinin fasülyede, en azından PNP ile işlenmiş filizlerde, genotoksik etkinin tespitinde

uygun bir araç olmadığını gösterdi.

Anahtar Kelimeler: Genotoksisite, LSSP-PCR, Paranitrofenol, Phaseolus vulgaris, maturaz K.


72 Mohamed R. ENAN

Introduction

Maturase K (matK) is a chloroplast-encoded gene

which is nested between the 5’ and 3’ exons of

trnK, tRNA-lysine (Sugita et al., 1985). Sequence

analysis indicated that this region displayed

homology to domain X of mitochondrial group II

intron maturases (Sugita et al., 1985; Neuhaus and

Link, 1987). Although maturase K gene (matK)

contains many indels (insertions and deletions)

throughout its reading frame, yet domain X lacks

any of these indels (Hilu and Liang, 1997; Hilu and

Alice, 1999; Hilu et al., 2003). Maturase K is the

only gene found in the chloroplast genome of

higher plants that contains this putative maturase

domain X in its protein (Neuhaus and Link, 1987).

Maturases are considered as splicing factors

because of their ability to splice and fold group II

introns. The coding region of matK is generally

located within intron of the chloroplast trnK gene

(Vogel et al., 1997). matK is very useful in DNA

barcoding to genetically identify plant families (Qiu

et al., 1999; Li and Zhou, 2007).

Genotoxic compounds are those which cause

damage to DNA. Para-nitrophenol is a synthetic

chemical that is used to manufacture drugs,

fungicides, insecticides (Yang et al., 2010).

Pesticides, such as parathion and methyl parathion,

are hydrolyzed and transformed to PNP; which in

turn these pesticides are considered as the main

source of PNP that is released to the environment

(Kitagawa et al., 2004). In vitro assay using CHO

cell PNP was positive for chromosome aberration

at levels of 100 µg/ml (Ohno et al., 2005), proving

the hypothesis that PNP induces chromosomal

aberrations.

The LSSP-PCR is a simple technique that

permits detection of single or multiple mutations in

gene-sized fragments (Pena et al., 1994). This

sensitive and rapid method uses PCR amplification

of a single oligonucleotide primer "driver" that is

specific to one of the extremities of the fragment,

under very low stringency conditions (Pena et al.,

1994). In a sequence-dependent manner, the driver

hybridizes both to the highly specific

complementary extremity, and to the low

specificity of multiple sites within the fragment.

The reaction thus yields a large number of products

that can be resolved by polyacrylamide gel

electrophoresis to give rise to a multiband DNA

fragment "signature" that reflects the underlying

sequence. Changes as small as single base

mutations can drastically alter the multiband

pattern, which ultimately produce new

signatures. LSSP-PCR has been broadly

used for the detection of mutations in human

genetic diseases (Pena et al., 1994),

sequence variations in human mitochondrial

DNA (Barreto et al., 1996) and for genetic

typing of infectious agents such as

papillomavirus (HPV; Villa et al., 1995),

Trypanosoma cruzi (Vago et al., 2006),

Trypanosoma rangeli (Marquez et al.,

2007), and Leishmania infantum (Alvarenga

et al., 2012). The objective of this study was

to describe the potential use of LSSP-PCR

as a molecular biomarker to detect DNA

mutation in maturase K gene in dwarf bean

tissues exposed to paranitrophenol.

Materials and methods

Plant growth and treatment conditions

The dwarf bean (Phaseolus vulgaris) was

used as the plant material in this study. The

selected seeds were sterilized with 75%

(v/v) ethanol for 2 min, followed by 20%

(v/v) sodium hypochlorite for 10 min and

were washed five times in sterile distilled

water. Uniformly three plant seedlings were

transferred to a Magenta box containing MS

(Murashige and Skoog, 1962) liquid

medium (control) or supplemented with

different concentrations of PNP (20, 40, 80,

160, 320, and 640 µg/ml). PNP-treated

seedlings were grown for 10 days in the

growth chamber. Plant growth conditions

was previously described (Enan, 2006).

DNA isolation

DNA was extracted from fresh plant shoots

using DNeasy plant minikit (Qiagen, USA),

following the instruction of the

manufacturer. The final DNA concentration

was determined by agarose gel

electrophoresis against known standards

(Invitrogen, USA).

Specific PCR amplification of matK

fragments

To eliminate any possibility of bacterial

contamination due to the very low-


stringency conditions of the LSSP-PCR reaction,

all experiments were carried out with extreme

precautions. PCR reactions were performed with

specific primers matK472F (5′-

CCCRTYCATCTGGAAATCTTGGTTC-3′) and

matK1248R (5′-

GCTRTRATAATGAGAAAGATTTCTGC-3′) as

described by Yu et al. (2011). Amplification of

specific PCR products was carried out in a volume

of 25 μl containing 30 ng of genomic DNA and a

master mix containing 1.5 mM MgCl2, 200 μM of

each deoxynucleotide (dNPTs), 20 pmol of each

primer, 1.0 U Taq DNA polymerase (Invitrogen-

BRL), in 10 mM Tris–HCl [pH 8.0] and 50 mM

KCl. After an initial denaturation step of 94 °C for

5 min, the specific PCR program consisted of 35

cycles of 94 °C for 30 s, 56 °C for 1 min and 72 °C

for 1 min. The last cycle consisted of an extension

step at 72 °C for 5 min. The PCR products were run

on ethidium bromide-stained gel and the bands

corresponding to the specific fragment (876bp)

generated by universal specific primers were

purified using Purelink PCR purification Kit

(Invitrogen, USA).

LSSP-PCR analysis

For the production of LSSP-PCR signatures,

previously amplified matk fragments were purified

used as a template in the LSSP-PCR (Pena et al.,

1994). LSSP-PCR was also carried out in a 25μl

volume containing 5ng of DNA template, 1.5 mM

MgCl2, 200 μM of the four deoxynucleotide

triphosphates, 120 pmol of matK472F or

matK1248R primer 4.0 U Taq DNA polymerase in

10 mM Tris–HCl [pH 8.0] and 50 mM KCl. After a

denaturation step at 94 °C for 5 min the LSSP-PCR

program consisted of 35 cycles of denaturation at

94 °C for 1 min, annealing at 30 °C for 1 min and

extension at 72 °C for 1 min. Ten microliters of

LSSP-PCR products were analyzed by

electrophoresis on 8% (w/v) polyacrylamide gels

followed by ethidium bromide. The similarity

among the LSSP-PCR profiles of control and those

obtained with the DNA of PNP-treated samples

was analyzed accordingly.

DNA sequencing of PCR products

In order to determine the nucleotide sequence of the

776 fragments generated with universal specific

primers, PCR products of control and PNP-treated

samples were purified and sequenced by Source

BioScience (Nottingham, UK) according to Sanger

matK mutations in Phaselous vulgaris 73

et al. (1977). The sequence was analyzed for

homology with database sequences with

Multiple Sequence Alignment by MultiAlin

(Corpet, 1988).

Results

We used the LSSP-PCR method to detect

mutations in matK gene of dwarf bean

tissues. DNA was amplified (first step)

using universal primers to produce 776 bp

fragments containing the maturase K region

(Figure 1).

Each fragment was isolated by

electroelution and subjected to a second

PCR amplification (second step) using a

single primer annealed under low-stringency

conditions. The generated profiles of the

PCR products of each sample were resolved

and analyzed by non-denaturing

polyacrylamide gel. A complex pattern

consisting of many bands was obtained

which was different depending on the

concentration of PNP. We showed the

LSSP-PCR profiles of DNA obtained from

PNP-treated or PNP-untreated samples

amplified with either matk742 forward

primer (Figure 2) or matk1248R reverse

primer matK1248R primer (Figure 3).

Figure 1. Agarose gel electrophoresis of

PCR amplification of matk fragment with

776 bp obtained in control and treated

samples. Lane M: 100 bp DNA ladder; Lane

C: untreated sample (control); lanes 1-6:

plant samples treated with 20, 40, 80, 160,

320 and 640 µg/ml PNP, respectively.


74 Mohamed R. ENAN

Figure 2. Ethidium bromide-stained

polyacrylamide gel electrophoresis showing gene

signatures obtained by LSSP-PCR with matk742

forward primer. Lanes M: 100 bp DNA ladder;

Lane C: untreated sample; lanes 1-6: plant samples

treated with 20, 40, 80, 160, 320 and 640 µg/ml

PNP, respectively.

Figure 3. Ethidium bromide-stained

polyacrylamide gel showing gene signatures

obtained by LSSP-PCR with matk1248 reverse

primer. Lane M: 100 bp DNA ladder; Lane C:

untreated sample; lanes 1-6: plant samples treated

with 20, 40 80 160, 320 and 640 µg/ml PNP,

respectively.

The LSSP-PCR profiles were unique for each

treatment, suggesting that this technique may be

applicable for the detection of genotoxic impact of

environmental contaminants. The sequence of the

maturase K gene was deposited in Genbank

(accession numbers JQ403111). We also

determined whether these sequence

identities showed similarities between the

different samples treated with PNP (Figure

4). Our sequence alignment data obtained by

MultiAlin indicated that the sequence

identities of all treated samples shared 100%

homology with sequences of untreated

samples (Figure 4). This suggests that a

mutation in the matK gene as a hotspot gene

is not induced by treatment with PNP.

Discussion

To our knowledge, this is the first study to

employ LSSP-PCR for monitoring

biological effects of pollution. Molecular

biomarkers are effective early warning

signals of adverse biological effects. The

purpose of this study was to evaluate the

performance of LSSP-PCR method in the

detection of genotoxic effect of

paranitrophenol (PNP) on dwarf beans

(Phaseolis vulgaris). In the past 25 years,

numerous biomarkers have been developed

with the objective to apply them for

environmental biomonitoring (Sanchez and

Porcher, 2009). Molecular marker

techniques have provided new tools of

detection of mutations in DNA in response

to chemical pollution using DNA sequence

and structure. The alterations in genomic

DNA induced by genotoxic pollutants can

be monitored using different biomarkers’

assays both at the biochemical and the

molecular levels. In the past few years,

several of techniques revealed that

mutations in DNA could be generated and

identified mostly by the polymerase chain

reaction (PCR). Some of the examples of

PCR assays were utilized to detect genotoxic

effects of environmental pollutants arbitraryprimed

PCR (AP-PCR; Welsh and

McClelland, 1990) and randomly amplified

polymorphic DNA (RAPD) (Williams et al.,

1990). One of the main advantages of using

LSSP-PCR for studies related to

genotoxicity is that the signatures were not

unduly sensitive to the concentration of

DNA template.


matK mutations in Phaselous vulgaris 75

Figure 4. DNA sequences of the matK genes from untreated and PNP-treated plant samples aligned

by using MultiAlin.


76 Mohamed R. ENAN

In the present study, genotoxic effect of PNP

was performed using LSSP-PCR that can detect

single or multiple mutations in gene-size DNA

fragments. The chloroplast maturase K gene

(matK) is one of the most variable coding genes of

angiosperms, which has been suggested to be a

“barcode” for land plants (Yu et al., 2011). Good

reproducibility as a solution in the LSSP-PCR

profiles using both forward and reverse primers

was obtained. However, we observed that many of

these bands are larger than the template. Our results

confirm the data obtained from other studies that

PCR products of the first few cycles may

themselves act as primers in further rounds of

amplification (Barreto et al., 1996). In the current

study, the sequenced PCR products of matK

fragment confirmed the results of the specific PCR

(Figure 1). On the other hand, unexpectedly, the

data of sequence alignment quite contradicts that of

the LSSP-PCR signatures. Sequence alignment of

all PNP-treated samples of dwarf bean with the

untreated control samples indicated that there is no

any nucleotide substitution in the matK sequence.

In previous study, Oliveira et al. (2003) described

that, very similar signatures were obtained with

specific primers (G1 and G2) for identification of

Leptospira interrogans serovars. Although the

sequence data of the 285 bp fragments of the three

serovars of L. interrogans indicated the presence of

three nucleotide alterations in these fragments, they

found that identical LSSP-PCR profiles were

obtained for the three serovars with individual

primers of G1 and G2. Barreto et al. (1996)

reported that the variations observed in LSSP-PCR

are attributed to several variables: (i ) the number

of cycles has a marked effect on the signature up to

35 cycles (ii) the ramping speed of thermocyclers (

type of thermo cyclers) had marked effect on the

LSSP-PCR signatures and (iii) changes in the

annealing temperature a range between 25-35◦C

had no marked effect but Ta > 40◦C showed a

deterioration of the signature.

In conclusion, the chloroplast matk used in this

study as a molecular biomarker gene to measure

genotoxicity of PNP using LSSS-PCR, is not

affected by PNP at DNA level but may be down

regulated at transcriptional or post-transcriptional

levels, which should be confirmed in further

studies.

Acknowledgment

The author would like to thank a lot Dr

Synan Abu Qamar, Ph.D, Purdue University

for his critical revising and constructive

comments on the manuscript.

References

Alvarenga JSC, Ligeiro CM, Gontijo CMF,

et al. KDNA genetic signatures obtained

by LSSP-PCR analysis of Leishmania

(Leishmania) infantum isolated from the

new and the old world. PLoS ONE 7:

e43363, 2012

Barreto G, Vago AR, Ginther C, et al.

Mitochondrial D-loop ‘‘signatures’’

produced by low-stringency single

specific primer PCR constitute a simple

comparative human identity test. Am J

Hum Gene.t 58: 609–616, 1966.

Corpet F. Multiple sequence alignment with

hierarchical clustering. Nucl Acids Res.

16: 10881-10890, 1988

Enan MR. Application of random amplified

polymorphic DNA (RAPD) to detect the

genotoxic effect of heavy metals.

Biotechnol. Appl. Biochem. 43: 147–154,

2006.

Hilu KW and Alice LA. Evolutionary

implications of matK indels in Poaceae.

Am J Bot. 86: 1735-1741, 1999.

Hilu KW, Borsch T, Muller K, et al.

Angiosperm phylogeny based on matK

sequence information. Am J Bot. 90:

1758–1776, 2003.

Hilu KW and Liang H. The matK gene:

sequence variation and application in

plant systematics. Am J Bot. 84: 830-

839, 1997.

Kitagawa W, Kimura N, Kamagata Y. A

Novel p-nitrophenol degradation gene

cluster from a gram-positive bacterium,

Rhodococcus opacus SAO101. J

Bacteriol. 186: 4894-4902, 2004.

Li X-X and Zhou ZK. The higher-level

phylogeny of monocots based on matK,

rbcL and 18S rDNA sequences. Acta


Phytotaxonomica Sinica 45: 113–133, 2007.

Murashige T and Skoog FA. A revised medium for

rapid growth and bioassay with tobacco tissue

cultures. Physiol Plant. 15: 473–479, 1962.

Neuhaus H and Link G. The chloroplast tRNA Lys

(UUU) gene from mustard (Sinapis alba)

contains a class II intron potentially coding for a

maturase-related polypeptide. Curr Genet. 11:

251–257, 1987.

Ohno K, Tanaka-Azuma Y, YonedaY, Yamada T.

Genotoxicity test system based on p53R2 gene

expression in human cells: Examination with 80

chemicals. Mutat. Res. 588: 47-57, 2005.

Oliveira MAA, Caballero OLSD, Vago AR, et al.

Low-stringency single specific primer PCR for

identification of Leptospira. J Med Microbiol.

52: 127–135, 2003.

Pena SDJ, Barreto G, Vago AR, et al. Sequencespecific

‘gene signatures’ can be obtained by

PCR with single specific primers at low

stringency. Proc Natl Acad Sci USA, 91: 1946–

1949, 1994.

Qiu, Y L, Lee J, Bernasconi-Quadroni F, et al. The

earliest angiosperms: evidence from

mitochondrial, plastid, and nuclear genomes.

Nature. 402: 404-407, 1999.

Sanchez W and Porcher JM. Fish biomarkers for

environmental monitoring within the Water

Framework Directive of the European Union.

TrAC Trends in Analytical Chemistry. 28: 150-

158, 2009.

Sanger F, Nicklen S, Coulson AR. DNA

sequencing with chain-terminating inhibitors.

Proc Natl. Acad. Sci. USA, 74: 5463–5467,

1977.

Sugita M, Shinozaki K, Sugiura M. Tobacco

chloroplast tRNALys (UUU) gene contains a

matK mutations in Phaselous vulgaris 77

2.5-kilobase-pair intron: an open reading

frame and a conserved boundary

sequence in the intron. Proc Natl Acad

Sci USA. 82:3557-3561, 1985.

Vago AR, Macedo AM, Oliveira RP, et al.

Kinetoplast DNA signatures of

Trypanosoma cruzi strains obtained

directly from infected tissues. Am J

Pathol 149: 2153–2159, 2006.

Villa LL, Caballero OL, Levi JE, et al. An

approach to human papilloma virus

identification using low-stringency

single specific primer PCR. Mol Cell

Probes. 9: 45-48, 1995.

Vogel J, Hübschmann T, Börner T, Hess

WR. Splicing and intron- internal RNA

editing of trnK-matK transcripts in

barley plastids: support for matK as an

essential splicing factor. J Mol Biol. 270:

179–187, 1997.

Welsh J and McClelland M. Fingerprinting

genomes using PCR with arbitrary

primers. Nucleic Acids Res. 19: 861–866,

1990.

Williams JGK, Kubelik AR, Livak KJ, et al.

DNA polymorphisms amplified by

arbitrary primers are useful as genetic

markers. Nucleic Acids Res. 18: 6531-

6535, 1990.

Yang L, Luo S, Li Y, et al. High efficient

photocatalytic degradation of pnitrophenol

on a unique Cu2O/TiO2 p-n

heterojunction network catalyst. Environ

Sci Technol. 44: 7641–7646, 2010.

Yu J, Xue JH, Zhou SL. New universal

matK primers for DNA barcoding

angiosperms. J Syst Evol. 49: 176-181,

2011.


Journal of Cell and Molecular Biology 10(2):79-83, 2012 Short Communication 79

Haliç University, Printed in Turkey.

http://jcmb.halic.edu.tr

Characterization of Paenibacillus larvae isolates from Brazil

Sérgio Salla CHAGAS 1 , Rodrigo Almeida VAUCHER 2 , Adriano BRANDELLI 2,*

1

Laboratório Nacional Agropecuário (LANAGRO/RS), Estrada da Ponta Grossa 3036, Porto Alegre,

Brazil.

2

Laboratório de Bioquímica e Microbiologia Aplicada, Instituto de Ciência e Tecnologia de

Alimentos, Universidade Federal do Rio Grande do Sul, 91501-970 Porto Alegre, Brazil.

(*author for correspondence: abrand@ufrgs.br)

Received: 24 February 2012; Accepted:11 November 2012

Abstract

Paenibacillus larvae is the agent of American Foulbrood disease (AFB), causing the death of the hive

and greatly affecting beekeeping. In Brazil, this bacterium was only isolated in the states of Rio

Grande do Sul and Paraná. The present study aimed to characterize the strains isolated in Brazil,

confirming its identification by molecular diagnosis. Eighty isolates from samples of honey,

honeycomb and pollen collected between 2002 and 2007 from different regions were selected for

analysis. Phenotypical characterization indicates that 77 strains were P. larvae but 3 strains showed

inconclusive results. PCR protocols based on detection of 16S rDNA and metalloproteinase gene

confirmed all strains being P. larvae. The PCR amplicon of 16S rDNA was sequenced, and

phylogenetic analysis was performed. The results indicated that there is high homology among the

strains isolated in Brazil.

Keywords: Paenibacillus larvae, 16S rDNA, metalloproteinase, American foulbrood disease,

phylogenetic analysis

Özet

Brezilya’dan Paenibacillus larvae izolatlarının karakterizasyonu

Paenibacillus larvae kovanın ölümüne sebep olan ve büyük oranda arıcılığı etkileyen Amerikan yavru

çürüklüğü hastalığının (AFB) etkenidir. Brezilya’da bu bakteri sadece Rio Grande do Sul ve Paraná

eyaletlerinde izole edilmiştir. Bu çalışma moleküler tanı ile yapılan identifikasyonu doğrulayarak

Brezilya’da izole edilen suşları karakterize etmeyi amaçlamıştır. Farklı bölgelerden 2002 ve 2007

yılları arasında toplanan bal, petek ve polen örneklerinden elde edilen seksen izolat analiz için

seçilmiştir. Fenotipik karakterizasyon 77 suşun P. larvae olduğunu, fakat 3 suşun yetersiz sonuç

gösterdiğini belirtmektedir. Metalloproteinaz geni ve 16SrDNA’nın saptanmasına dayanan PCR

protokolleri tüm suşların P. larvae olduğunu doğrulamaktadır. 16SrDNA PCR amplikonu

dizilenmiştir ve filogenetik analiz yapılmıştır. Sonuçlar Brezilya’da izole edilen suşlar arasında

yüksek homoloji olduğunu göstermektedir.

Anahtar Kelimeler: Paenibacillus larvae, 16S rDNA; metalloproteinaz; Amerikan yavru çürüklüğü

hastalığı, filogenetik analiz


80 Sérgio Salla CHAGAS et al.

Introduction

The American foulbrood (AFB) is a notifiable

disease of high economic importance and

significant international trade (OIE, 2009). Its

causative agent, Paenibacillus larvae, attacks only

the larval stage of the bee Apis mellifera and other

Apis spp. (Genersch, 2010). P. larvae are only

infective in the form of spores, which are extremely

tenacious and can remain viable for many years

(Genersch, 2008). Infection occurs by ingestion of

spores that germinate and spread after 24 hours,

producing septicemia and death (Allipi, 1992). The

clinical symptoms are typical, and the larvae have

affected to a dark and viscous form. Besides food

with honey containing spores, the introduction of

bees from hives infected and even beekeepers could

help its spread (Genersh, 2010).

In South America, the first isolation of P. larvae

occurred in 1989 in Argentina (Allipi, 1992), and

subsequently in Uruguay (Antunez et al., 2004). In

Brazil, despite efforts to prevent its introduction,

honey contaminated with P. larvae was found in

the state of Rio Grande do Sul in 2002 (Schuch et

al., 2003). More recently, the occurrence of P.

larvae was reported in hives in the state of Paraná

(MAPA, 2006). The aim of this work was to

confirm the presence of P. larvae by molecular

methods and to characterize the strains isolated in

Brazil.

Materials and Methods

This study used 80 isolates of P. larvae, originated

from samples of honey, honeycomb and pollen

collected from different Brazilian regions between

May 2002 and June 2007 by Laboratório Nacional

Agropecuário (LANAGRO/RS, Ministry of

Agriculture, Brazil), for the microbiological

analysis for the detection of spores (Schuch et al.,

2002). Of these 80 isolates, 30 were from suspected

samples and 50 originated from the process of

importation. Aliquots of 20 g of the various

products were diluted to 40 ml of distilled water

and centrifuged at 6000 g for 10 min. The pellet

obtained was resuspended in 1 ml of distilled water,

heated to 80°C for 10 min and seeded on selective

P. larvae agar plates (Schuch et al., 2002). These

plates were incubated at 35°C, and monitored for 5

days.

Isolated colonies were suspended in distilled

water and subjected to bacterial DNA extraction

using phenol-chloroform. P. larvae ATCC 9545

was used as a positive control. Bacillus

cereus ATCC 11778 and Paenibacillus alvei

isolated by LANAGRO/RS (Porto Alegre,

Brazil), were used as negative controls. The

amplification of the 16S rDNA was through

a nested PCR protocol, conducted in the

GeneAmp PCR System 2400 equipment

(Applied Biosystems, Foster City, CA,

USA). The amplification was initially

performed with external primers Ple(F)

TCGAGCGGACCTTGTGT and Ple(R)

CTATCTCAAAACCGCTCAGAG, and

then with the external primers Pli (F)

CTTCGCATGAAGAAGTCATC and

Pli(R) TCAGTTATAGGCCAGAAAGC.

The final concentrations of reagents were

0.2 mM of each primer, 1.25 U Taq DNA

polymerase, 0.2 mM dNTPs, 1.5 mM

MgCl2, 5 μl of DNA (20 ng/μl) in a reaction

volume of 25 μl (Lauro et al. 2003). The

primers MpPl(F)

CGGGCAGCAAATCGTATTCAG and

MpPl(R)

CCATAAAGTGTTGGGTCCTCTAAG

were used for amplification of

metalloproteinase gene. The final

concentrations of reagents was 1 mM of

each primer, 1 U Taq DNA polymerase, 0.2

mM of dNTPs , 2.0 mM MgCl2, 5 μl of

DNA (20 ng/μl) in a reaction volume of 25

μl (Kilwinski et al., 2004). The amplified

DNA was subjected to electrophoresis in 1%

agarose gel stained with ethidium bromide.

The PCR products obtained by

amplification with primers Pli were purified

using the kit PureLink Quick Gel Extraction

(Invitrogen, Carlsbad, CA, USA) and

sequenced. The reaction was carried out

using the sequencing kit Big Dye

Terminator (Applied Biosystems), according

to the manufacturer’s instructions. The

analysis was performed on a 16 capillary

sequencer, model ABI 3130xl (Applied

Biosystems). The sequences of the 16S

rDNA were established, and the BLAST

algorithm was used to find homologous

sequences. The calculation of the distance

and the construction of the phylogenetic tree

were carried out by the neighbor-joining

method, with the help of the software


MegaBACE version 3.1 (Kumar et al., 2004).

Results

When microbial growth was observed on selective

medium, three colonies of each plate were selected

on the basis of colony morphology (hyaline aspect,

flat edges and flat center) and presence of a zone of

Characterization of Paenibacillus larvae 81

proteolysis for confirmatory tests (reaction

to catalase and Gram stain). Most of the

isolates were positive for P. larvae. Two

isolates from honeycomb showed atypical

colony morphology and one isolate from

pollen showed positive catalase reaction and

atypical morphology (Table 1).

Table 1. Evaluation of Paenibacillus larvae isolated from honey, honeycomb and pollen samples

(2002-2007).

Sample n Typical colony

Negative catalase

morphology reaction

Honey 37 37 37 37

Honeycomb 35 33 35 35

Pollen a 8 7 7 8

Total 80 77 79 80

a

The same pollen sample showed atypical colony morphology and positive catalase reaction.

The PCR protocols allowed definitive identification

of P. larvae by observing the specific amplification

of the 16S rDNA and metalloproteinase genes (Fig.

1). All the 80 isolates responded to this approach,

showing the presence of expected PCR fragments

Positive PCR

results

with primers Ple (969 bp), Pli (572 bp) and

MpPl (271 bp). The specificity of amplicons

was checked by sequencing. Amplification

was not observed in the samples of negative

controls.

Figure 1. Agarose gel electrophoresis of PCR products. Bacillus cereus ATCC 11778 (B,C, 16S

rDNA; D, metalloproteinase); Paenibacillus larvae ATCC 9545 (E,F, 16S rDNA; G,

metalloproteinase); Paenibacillus alvei (H, I, 16S rDNA; J, metalloproteinase); Paenibacillus larvae

(K,L, 16S rDNA; M, metalloproteinase); A,N = 100 bp ladder.


84 Sérgio Salla CHAGAS et al.

The sequences were aligned with sequences

obtained from the GenBank database (accession no.

in parentheses) of the following strains:

Paenibacillus brasiliensis (D78476), Paenibacillus

glucanolyticus (D885140), Paenibacillus alvei

(X60604), Paenibacillus koreensis (AF130254),

Paenibacillus larvae (AY030079), Paenibacillus

alginolyticus (D78465), Paenibacillus azotofixans

(AJ 251192) and Paenibacillus polymyxa (AY

3596370). All P. larvae isolates investigated in this

study had >99% identity with the 16S rDNA

sequence of P. larvae (AY030079). These results

are the first sequencing of strains of P. larvae

isolated in Brazil and show that these strains are

highly correlated.

Discussion

Strains of P. larvae isolated from samples of honey,

honeycomb and pollen in Brazil were

characterized. Results from the microbiological

investigation often confirmed the presence of P.

larvae observed by growing in selective medium.

The most common discrepancy was on colony

morphology. Some degree of inconclusive results

from phenotypical characteristics could be expected

since different P. larvae genotypes may present

differences in morphological and physiological

characteristics (Genersch, 2010).

Although the isolation of the microorganism of

interest is often the gold standard for microbial

identification, molecular diagnosis may permit an

early detection of P. larvae, before the clinical

signs of the disease, in time to implement proper

control measures. In addition, some samples

showed inconclusive results in microbiological

testing, thus molecular verification may provide

security to the diagnosis. As an example, PCR

allowed to identify P. larvae in 91% of honey

samples, against 57% observed by cultural methods

(Lauro et al., 2003).

The high similarity among isolates of P. larvae,

together with the fact that until now there was only

one record on the presence of P. larvae in the state

of Rio Grande do Sul and one outbreak notification

in the state of Paraná, may indicate that this

pathogen was recently introduced in Brazil.

Phenotypic and genotypic characterization of P.

larvae isolated in the neighbor country Uruguay

revealed high strain similarity (Antunez et al.,

2007), while samples from Austria and Germany

show higher genetic diversity (Peters et al.,

2006; Loncaric et al., 2009).

The evolution of the disease in South

America (Allipi, 1992; Antunez et al., 2004)

direct to the strong control health deployed

to prevent the introduction of this pathogen

and its spread in the Brazilian territory. The

need for continuous surveillance indicates

that PCR-based methods for rapid detection

of P. larvae may be useful tools to be

adopted by regulatory agencies.

References

Allipi AM. A comparison techniques for the

detection of significant bacteria of the

honey bee, Apis mellifera, in Argentina.

J Apicult Res. 30: 75-80, 1992.

Antunez K, D’Alessandro B, Piccini C, et

al. Paenibacillus larvae spores in honey

samples from Uruguay: a nationwide

survey. J Invertebr Pathol. 86: 56-58,

2004.

Antunez K, Piccini C, Castro-Sowinski S, et

al. Phenotypic and genotypic

characterization of Paenibacillus larvae

isolates. Vet Microbiol. 124: 178-183,

2007.

Genersh E. Paenibacillus larvae and

American Foulbrood - long since known

and still surprising. J Verbr Lebensm. 3:

429-434, 2008.

Genersh E. American Foulbrood in

honeybees and its causative agent,

Paenibacillus larvae. J Invertebr Pathol.

103: S10-S19, 2010.

Kilwinski J, Peters M, Ashiralieva A,

Genersch E. Proposal to reclassify

Paenibacillus larvae subsp. pulvifaciens

DSM 3615 (ATCC 49843) as

Paenibacillus larvae subsp. larvae.

Results of a comparative biochemical

and genetic study. Vet Microbiol. 104:

31-42, 2004.

Kumar S, Tamura K, Nei M. MEGA3:

Integrated software for Molecular

Evolutionary Genetics Analysis and

sequence alignment. Brief Bioinformat.

5: 150-163, 2004.


82 Sérgio Salla CHAGAS et al.

Lauro FM, Favaretto M, Covolo L, et al. Rapid

detection of Paenibacillus larvae subsp. larvae

from honey and hive samples with a novel

nested PCR protocol. Int J Food Microbiol. 81:

195-201, 2003.

Loncaric I, Derakhshifar I, Oberlerchner JT, et al.

Genetic diversity among isolates of

Paenibacillus larvae from Austria. J Invertebr

Pathol. 100: 44-46, 2009.

MAPA. Nota técnica DSA nº52/2006. Ocorrência

de “Cria Pútrida Americana” no município de

Quatro Barra, estado do Paraná-Brasil. Ministry

of Agriculture of Brazil, Brasília, 2006.

OIE. American Foulbrood. Manual of standards for

diagnostic tests and vaccines for lists A and B

diseases of mammals, birds and bees. Office

International des Epizooties, Paris. pp. 687-693,

2009.

Peters M, Kilwinski J, Beringhoff A, et al.

American Foulbrood of the honey bee:

occurrence and distribution of different

genotypes of Paenibacillus larvae in the

administrative district of Arnsberg (North

Rhine-Westphalia). J Vet Med B. 53: 100-104,

2006.

Schuch DMT, Madden RH, Sattler A. An improved

method for the detection and presumptive

identification of Paenibacillus larvae subsp.

larvae spores in honey. J Apicult Res. 40: 59-

64, 2002.

Schuch DMT, Tochetto LG, Sattler A. Relato do

primeiro isolamento oficial de esporos de

Paenibacillus larvae subsp. larvae no Brasil em

colméia sem sinais clínicos de Cria Pútrida

Americana. Pesq Agropec Bras. 38: 441-444,

2003.


Journal of Cell and Molecular Biology - GUIDELINES for AUTHORS

General

Journal of Cell and Molecular Biology

(JCellMolBiol) is an international journal which

covers original works in the field of cell biology,

molecular biology, genetics, microbiology,

neurobiology, bioinformatics and related topics.

The official language of the journal is English,

however manuscripts in Turkish are accepted as

well.

Conditions for publication

This journal publishes research articles, review

articles, short communications, book/software

reviews, case reports and letters to the editor.

Research articles: Only original contributions will

be accepted which have not been published

previously. Manuscripts should not exceed 15

papers of printed text, including tables, figures and

references

Review articles: Reviews of recent developments in

a research field and ideas will be accepted.

Manuscripts should not exceed 15 papers of printed

text. Illustrations are encouraged.

Short communications: These include small-scale

investigations or innovative methods, techniques,

clinical trials and epidemiological studies. It should

not exceed 3 pages.

Letters to editor: These include opinions, news and

suggestions. Letters should not exceed 2 papers of

printed text.

Case Reports: These include individual

observations based on small numbers of subjects.

This type of research cannot indicate causality but

may indicate areas for further research.

REVISED

December, 2011

Manuscripts should be submitted by e-mail to:

Journal of Cell and Molecular Biology

Haliç Üniversitesi

Fen Edebiyat Fakültesi

Moleküler Biyoloji ve Genetik Bölümü

Sıracevizler Cad. No:29

Bomonti-Şişli 34381, İstanbul-TÜRKİYE

Tel: +90 212 343 08 87, Fax: +90 212 231 06 31

E-Mail: jcmb@halic.edu.tr

83

Book/software reviews: Short but concise

description of the book/software, not exceeding a

page. Book/software reviews are not peer reviewed.

Presentation

Papers should be typed clearly, double-spaced with

3 cm wide margins.

Manuscripts should be prepared using Word

Processor.

Cover Letter: You may briefly explain your work

and its contribution to present knowledge.

Title Page: The first page of your manuscript

should be a title page containing the type of paper;

the title; all authors' full names, and affiliations;

and the corresponding author's contact address

(including phone and fax numbers) and e-mail

address. The title should be as short as possible, but

should give adequate information regarding the

contents. Authors should also state a running title

of no more than 50 characters including spaces.

All pages must be numbered.

Full Paper

The full paper should be divided into the following

parts in the order indicated:


84

Abstract: A brief, informative abstract, not

exceeding 200 words, should be provided in

English and in Turkish. For authors who are not

native Turkish speakers, JCellMolBiol can provide

the Turkish abstract.

Keywords: Immediately following the abstract,

authors should provide 5 keywords or phrases that

reflect the content of the article.

Introduction should include theory, hypotheses,

prior work

Material and methods may include subheadings

Results: If the study consists of different parts,

subheadings in this section should be consistent

with subheadings in the methods.

Discussion

Acknowledgements should precede the list of

references

References: Papers cited in the manuscript should

be listed in alphabetical order according to the first

author's surname.

Tables and Figures

• Tables and figures should both be embedded

within the text in their appropriate positions and be

submitted separately.

• Electronically submitted figures are preferred in

*.jpg or *.tiff (min. 300 dpi) formats. Bar scales

should be drawn directly on the figures when

necessary. Figure legends should not be included in

the *jpg or *tif files.

• Each table should be accompanied by a short

instructive title line plus an explanatory caption at

the top. Indicate footnotes within tables by

superscript letters and type footnotes below the

table.

• All the tables and figures must be referred to

within the text.

Units, Abbreviations and Scientific Names

• Only SI units should be used. Current

abbreviations can be used without explanation,

others must be explained.

• All acronyms/abbreviations must be explained

in parenthesis after their first occurrence. If many

unfamiliar acronyms/abbreviations are used, please

compile them in an "Abbreviations" section at the

end of the paper.

• Latin expressions should be typed in italics.

Referencing

• In the text, citations with two authors should

take the form: Smith and Robinson,1990. If several

papers are cited by the same author in the same

year, they should be lettered in sequence (1990a),

(1990b), etc. When papers are by more then two

authors they should be cited as Smith et al.,1990. In

cases where more than one reference is written for

the same sentence, they should appear in ascending

publication order, e.g. (Jones et al., 2005; Smith et

al., 2007; Brown et al., 2009).

• In the list, references must be placed in

alphabetical order. The following models for the

reference list cover all situations. The punctuation

given must be exactly followed. The journal titles

should be abbreviated appropriately.

Redford IR. Evidence for a general relationship

between the induced level of DNA double

strand breakage and cell killing after Xirradiation

of mammalian cells. Int J Radiat

Biol. 49: 611- 620, 1986.

Tccioli CE, Cottlieb TM, Blund T. Product of the

XRCCS gene and its role in DNA repair and

V(D)J recombination. Science. 265: 1442-1445,

1994

Ohlrogge JB. Biochemistry of plant acyl carrier

proteins. The Biochemistry of Plants: A

Comprehensive Treatise. Stumpf PK and Conn

EE (Ed). Academic Press, New York. 137-157,

1987.

Brown LA. How to cope with your supervisor. PhD

Thesis. University of New Orleans, 2005.

Web document with no author: Leafy seadragons

and weedy seadragons 2001. Retrieved

November 13, 2002, from http:// www.

windspeed.net.au/jenny/seadragons/

Web document with author: Dawson J, Smith L,

Deubert K. Referencing, not plagiarism.

Retrieved October 31, 2002 from http:

//studytrekk.lis.curtin.edu.au/

• Only papers published or in press should be

cited in the literature list. Unpublished results,

including submitted manuscripts and those in

preparation, should be indicated as unpublished

data in the text.

Submission Policies and Authorship

REVISED

December, 2011


Upon submission of a manuscript, it is accepted

that all co-authors have approved the contents of

the manuscript and its submission by the

corresponding author, and that the corresponding

author is authorized to represent all co-authors in

pre-publication discussions with JCellMolBiol.

The corresponding author is responsible for

ensuring that all the contributors to the relevant

work are listed as authors and that all authors have

aggreed to the manuscript’s content and its

submission to the JCellMolBiol. In case the Journal

happens to be aware of an authorship dispute,

authorship must be approved in writing by all of the

parties.

Cost

There are no submission fees or page charges.

Criteria for the Selection of Manuscripts

Manuscripts should meet the following criteria: The

study conducted is material is original and ethical,

the writing is clear; the study methods are

appropriate, the data are valid, the conclusions are

reasonable and supported by the data; the

information is important; and the topic is

interesting to our readership.

Editorial Processes

Researchers may request informal feedback from

the editors in a particular manuscript. The

presubmission process aids in the submission

decision for authors.

When JCellMolBiol receives a manuscript, the

Editor-in-Chief will first decide whether the

manuscript meets the formal criteria specified with

“Guidelines for Authors” and whether it fits within

the scope of the Journal. In case of doubt on the

basis of initial review, the Editor-in-Chief will

consult other members of the Editorial Board.

Manuscripts that are found suitable for peer review

will be assigned to two expert reviewers. Reviewers

may either be Editorial/Advisory Board members

or external experts selected by the Editorial Board.

The corresponding author is notified by e-mail

when the editor decides to send a paper for review.

The reviewers will have up to three weeks to

review the submitted article. After peer review, the

editor will contact the author. If the author is

required to submit a revised version, the revised

version has to be submitted by the author within

two weeks. Otherwise, the manuscript will be

REVISED

December, 2011

85

removed from the manuscript submission queue

and will be considered rejected.

In cases where the referees have requested welldefined

changes to the manuscript, editors may

request a revised manuscript that addresses to

referees’ concerns. The revised version is sent back

to the original referees for re-review. In cases

where the referees’ concerns are more wideranging,

editors may reject the manuscript. The

revised manuscript should be accompanied by a

cover letter that includes a point-by-point response

to referees’ comments and an explanation of how

the manuscript has been changed.

As a matter of policy, we do not suppress referees’

reports, any comments directed to authors are

transmitted regardless of what we may think of the

content. On rare occasions, we may edit a report to

remove offensive language or comments to reveal

confidentiality.

The final decision to accept or reject a manuscript

will be made by the Editor-in-Chief. If it becomes

apparent that there are serious problems with the

scientific content or with violations of our

publishing policies, the Editor-in-Chief also

reserves the right to reject a paper even after it has

been accepted.

After acceptance, the Editor-in-Chief may make

further changes to the text and figures so that the

manuscript is readable and clear. Page proofs will

be sent to the corresponding author via email for

checking before publication. Corresponding authors

are sent proofs and are welcome to discuss

proposed changes with the Editor-in-Chief, but

JCellMolBiol reserves the right to make the final

decision about the style. Corrected proofs should be

sent back within three days of receipt, otherwise the

Editor-in-Chief reserves the rights to correct the

proofs himself and to send the material for

publication. In cases where the authors do not

submit the appropriately signed Publication

Agreement Form, the manuscript is drawn from

publication process even if it is accepted.

Appeals

Authors have the right to ask the Editor-in-Chief to

reconsider a rejection decision, which is considered

an appeal. Decisions are reversed only if the Editor

is convinced that the original decision was a serious

mistake. If an appeal merits further consideration,

the Editor may send the author’s response or the

revised paper to one or more referees, or Editor


86

may ask one referee to comment on the concerns

raised by another referee.

Advance Online Publication

JCellMolBiol provides Advance Online Publication

of articles, which benefit authors with an earlier

publication date and allows the readers’ access to

accepted papers several weeks before they appear

in print

Ethical Issues

For manuscripts reporting experiments on live

vertebrates or higher invertebrates, authors must

declare that the study was approved by the

institutional ethics committee. Papers describing

investigations on human subjects must include a

statement that informed consent was obtained from

all subjects.

Plagiarism

If portions of the manuscript have already been

published by the author on other journals or

websites, JCellMolBiol Editorial Board needs to

know which portions of the manuscript have been

previously published and where. The author should

include a note in the cover letter indicating which

portions have been published elsewhere.

In case of any suspicion on scientific misconduct or

dishonesty in research, JCellMolBiol reserves the

right to forward any submitted manuscript to an

appropriate authority for investigation.

Copyright Notice

It is the responsibility of the submitting author to

ensure that the authorship of the paper reflects the

contributions of the authors to the work described,

and that all listed authors have agreed to the

submission of the manuscript in its current form.

Conditions of publication in JCellMolBiol are that

the paper has not already been published elsewhere;

that it is not currently being considered for

publication else-where; all persons designated as

authors should qualify for authorship, and all those

who qualify should be listed. If accepted, Haliç

University and JCellMolBiol have the exclusive

license to publish.

JCellMolBiol is freely available to individuals and

institutions. Copies of this Journal and articles in

this journal may be distributed for research or for

educational purposes free of charge. However,

REVISED

December, 2011

commercial use of articles contained herein is

prohibited without the written consent of the

Editor-in-Chief.

Publication Agreement

The corresponing author is required to assign the

Publication Agreement Form in order to publish the

submitted manuscript in JCellMolBiol.


Journal of Cell and

Volume 10 · No 2 · December 2012

Review Articles

Molecular Biology

Transforming acidic coiled-coil proteins and spindle assembly

S. TRIVEDI

Marker Systems and Applications in Genetic Characterization Studies

Y. ÖZŞENSOY, E. KURAR

Research Articles

COX5B and COX2 gene expressions in Multiple Sclerosis

N. SAFAVIZADEH, S. A. RAHMANI , M. ZAEFIZADEH

Curcumin rendered protection against cadmium chloride induced testicular damage in

Swiss albino mice

P. SINGH, K. DEORA, V. SANKHLA, P. MOGRA

Study of Klebsiella pneumoniae isolates with ESBL activity, from ICU and Nurseries, on the

island of Mauritius

S.K. Mungloo-RUJUBALI, M.I. ISSACK, Y. JAUFEERALLY-FAKIM

HIV-1 reverse transcriptase inhibition by Vitex negundo L. leaf extract and quantification of

flavonoids in relation to anti-HIV activity

M. KANNAN, P. RAJENDRAN, V. VEDHA, G. ASHOK, S. ANUSHKA, P. CHANDRAN

RAMACHANDRAN NAİR

Genetic characterization and bottleneck analysis of Korki Jonub Khorasan goats by

microsatellite markers

B. MAHMOUDI, O. ESTEGHAMAT, A. SHARIYAR. M. Sh. BABAYEV

Low-Stringency Single-Specific-Primer PCR as a tool for detection of mutations in the matK

gene of Phaseolus vulgaris exposed to paranitrophenol

Mohamed R. ENAN

Short Communication

Characterization of Paenibacillus larvae isolates from Brazil

S.S. CHAGAS, R.A. VAUCHER, A. BRANDELLI

Guidelines for Authors 83

1

11

21

31

39

53

61

71

79

More magazines by this user
Similar magazines