Sulfabenzamide promotes autophagic cell death in T-47D breast ...
Journal of Cell and Molecular Biology 10(1): 41-54, 2012 Research Article 41
Haliç University, Printed in Turkey.
http://jcmb.halic.edu.tr
Sulfabenzamide promotes autophagic cell death in T-47D breast
cancer cells through p53/ DRAM pathway
Raziye MOHAMMADPOUR 1 , Shahrokh SAFARIAN *1 , Soroor FARAHNAK 1 , Sana
HASHEMINASL 1 , Nader SHEIBANI 2
1
School of Biology, College of Science, University of Tehran, Tehran, Iran
2
Department of Ophthalmology and Visual Sciences, School of Medicine and Public Health, University of
Wisconsin, Madison, USA
(* author for correspondence; safarian@ibb.ut.ac.ir )
Received: 26 March 2012; Accepted: 29 May 2012
Abstract
Sulfonamides exhibit their antitumor effects through multiple mechanisms including inhibition of membrane
bound carbonic anhydrases, prevention of microtubule assembly, cell cycle arrest, and inhibition of angiogenesis.
Here, sulfabenzamide’s mechanisms of action on T-47D breast cancer cells were determined. Cells incubated with
sulfabenzamide exhibited negligible levels of apoptosis, necrosis and cell cycle arrest when compared to untreated
cells. These results were confirmed by morphological examinations, DNA fragmentation assays, flow cytometric
and real time RT-PCR analysis. Surprisingly, despite negligible detection of DNA fragmentation, a considerable
increase in caspase-3 activity was observed in cells incubated with sulfabenzamide. The increased expression ratio
of DFF-45/DFF-40 indicated that caspase-3-related DNA fragmentation was blocked and apoptosis symptoms
could not be seen. However, the effects of caspase-3 for PARP1 and DNA-PK deactivation resulted in autophagy
induction. The overexpression of critical genes involved in autophagy, including ATG5, p53 and DRAM, indicated
that in T-47D cells sulfabenzamide-induced antiproliferative effect was mainly exerted through induction of
autophagy. Furthermore, downregulation of AKT1 and AKT2 as well as over expression of PTEN resulted in
attenuation of AKT/mTOR survival pathway showing that death autophagy should be occurred in sulfabenzamide
treatment.
Keywords: Sulfabenzamide, breast cancer, autophagy, apoptosis, p53.
Sülfobenzamid, T-47D meme kanseri hücrelerinde p53/DRAM yolağı aracılığıyla otofajik hücre ölümünü
teşvik eder
Sülfonamidler, membrana bağlı karbonik anhidraz inhibisyonunu, mikrotubül toplanmasının engellenmesini, hücre
siklusunun durdurulmasını ve anjiyogenez inhibisyonunu içeren çoklu mekanizmalarla antitümör etkilerini
göstermektedirler. Burada, T-47D meme kanser hücreleri üzerinde sülfobenzamid mekanizmasının etkisi
belirlenmiştir. Sülfobenzamid ile inkübe edilen hücreler yapılmamış uygulama hücrelerle karşılaştırıldıklarında
önemsenmeyecek seviyede apoptoz, nekroz ve hücre siklusunun durmasını ortaya koymuştur. Bu sonuçlar
morfolojik incelemelerle, DNA fragmantasyon analizleriyle, flow sitometrik ve gerçek zamanlı RT-PCR
analizleriyle doğrulanmıştır. Şaşırtıcı bir şekilde, DNA fragmantasyonunun ihmal edilebilecek tespitine rağmen,
sülfobenzamidle edilmiş inkübe hücrelerde kaspaz 3 aktivitesinde dikkate değer artış bir gözlenmiştir. DFF-45/
DFF-40’ artmış ın ekspresyon oranı, kaspaz 3 ile ilişkili DNA fragmantasyonunun durdurulduğunu ve apoptoz
belirtilerinin görülemeyeceğini işaret etmektedir. Bununla birlikte PARP1 ve DNA-PK deaktivasyonu için kaspaz
3’ün etkileri otofaji indüklenmesiyle sonuçlanmaktadır. ATG5, p53 ve DRAM gibi otofajide yer alan kritik
genlerin aşırı ekspresyonu T-47D sülfobenzamid-indüklenmiş hücrelerinde antiproliferatif etkinin çoğunlukla
otofaji indüksiyonu aracılığıyla uygulandığını belirtmektedir. Ayrıca, PTEN aşırı ekspresyonu gibi AKT1 ve
AKT’’nin azalarak düzenlenmesi, otofaji ölümünün sülfobenzamid uygulamasıyla meydana geldiğini gösteren
sağ AKT1/mTOR kalım yolağının etkisinin azalmasıyla sonuçlanmaktadır.
Anahtar kelimeler: sülfobenzamid, meme kanseri, otofaji, apoptoz, p53.
42 Raziye MOHAMMADPOUR et al.
Introduction
Sulfonamides are synthetic antibacterial agents
with diverse pharmacological effects including
antibacterial, antiviral, antidiabetic, antithyroid, and
diuretic. Their antibacterial effects are contributed
to the interfering with enzyme activities responsible
for folic acid synthesis by competing for para
aminobenzoic acid. These drugs are selectively
toxic for prokaryotes (Owa et al., 1999; Fukuoka et
al., 2001; Yokoi et al., 2002; Supuran 2003). Two
novel sulfonamides, E7070 and E7010, are potently
effective against cancer cells via inhibition of
tubulin polymerization and proliferation. The
matrix metalloprotease (MMP) inhibitory effects of
sulfonamides have been evaluated for treatment of
arthritis and cancer (Fukuoka et al., 2001; Ozawa et
al., 2001; Supuran et al., 2003; Mohan et al., 2006).
Sulfabenzamide, 4-Amino-N-benzoyl-benzenesulfonamide,
is a sulfonamide derivative used for
treatment of specific vaginal infections in
combination with sulfathiazole and sulfacetamide
(Valley and Balmer, 1999).
Knowledge regarding alterations in signaling
pathways and the type of cell death induced by
chemotherapeutic drugs is the first and most
important step in design of effective treatments.
Furthermore, manipulation of autophagy has the
potential to improve anticancer therapeutics.
Studies have shown that autophagy protects cancer
cells against antitumor effects of some drugs by
blocking the apoptotic pathway and maintaining
ATP levels. In contrast, other cancer cells undergo
autophagic cell death (ACD or type II programmed
cell death, PCDII) after anticancer therapies
(Kondo et al., 2005; Kondo and Kondo, 2006).
Various anticancer drugs that activate ACD in
breast cancer cells have been reported including
vitamin D analog, EB1089, Tamoxifen and other
antiestrogen agents (Hoyer-Hansen et al., 2005).
Tamoxifen induced autophagic pathway occurs
through down regulation of AKT activity
(Yokoyama et al., 2009). The 3'-methoxylated
analogue isocannflavin B (IsoB) exhibits an
inhibitory effect on T-47D cell proliferation, which
is accompanied by the appearance of an intense
intracytoplasmic vacuolization of autophagic origin
(Brunelli et al., 2009).
Here, we choose sulfabenzamide for assessing
its antitumor activity in T-47D breast cancer cell
line. Our main objective was to determine whether
this drug can be used as an antitumor drug in
medicine. From this point of view, we could
ascertain that there is a correlation between the
expression level of some critical genes and
induction of death autophagy in T-47D cells.
Materials and methods
Reagents
Culture medium, RPMI 1640, and fetal bovine
serum were from Gibco (England); penicillin
streptomycin solution, DNA laddering kit,
Annexin-V-FLOUS Staining Kit, Propidium
Iodide (PI) kit, caspase-3 fluorometric
immunosorbent enzyme assay kit, 4',6- Diamidino -
2-phenylindole (DAPI) kit were all acquired from
Roche (Germany); MTT was from Sigma
(England); sulfabenzamide and doxorubicin were
from Sina Darou (Iran) and Ebewe Pharma
(Austria), respectively. QuantiFast SYBR Green
PCR master mix and RNeasy plus Mini kit were
provided from Qiagen (USA). RevertAidTM M-
MuLV reverse transcriptase and random hexamer
were purchased from Fermentas (Germany).
Cell culture
Epithelial tumor cell line, T-47D, stemmed from
human ductal breast tissue, was provided from
National Cell Bank of Pasteur Institute (Tehran,
IRAN; ATCC number HTB-133). Cells were
maintained in RPMI 1640 medium supplemented
with heat-inactivated (35 min, 56°C) fetal bovine
serum (10% v/v) and penicillin streptomycin
solution (1% v/v) and incubated in humidified
condition; 95% air and 5% CO2 at 37°C.
Drug preparation and treatments
Regarding the obtained results from MTT assays,
LC50 for sodium sulfabenzamide and doxorubicin
after 48 h were estimated at 10.8 and 0.337×10 -3
mM, respectively. After reaching confluency (~
80%), cells were incubated with freshly prepared
drugs at the LC50 concentrations, harvested by
trypsin-EDTA, washed three times by phosphatebuffered
saline, and stored at -70°C.
Cytotoxicity/Viability assay
In brief, 10 4 cells/well were seeded in a 96 well
culture plate and incubated with different
concentrations of drugs for 24, 48 and 72 h. MTT
was then added to the wells (4 mg/ml or 100
µg/well) and the produced formazan was
systematically assessed using Elisa micro plate
eader at the wavelength of 570 nm. The percent of
cell viability related to each drug concentration was
estimated in relation to the untreated sample. All
assays were done at least three times unless stated
otherwise.
Apoptosis quantification
After washing 10 6 cells with PBS, cell pellets were
re-suspended in 100 µl of ready to use Annexin/PI
buffer (20 µl of each Annexin and PI buffer in 1 ml
incubation buffer) for 10-15 min at 25˚C. Samples
were then diluted in 500 µl of incubation buffer and
analyzed by flow cytometry (Partech Pass, USA)
using FloMax software.
Cell cycle analysis
5×10 5 drug treated cells were incubated with DAPI
solution (10 µg/ml and 6% Triton X-100 in PBS)
for 30 min in the dark at 4ºC. Using a flow
cytometer fluorescent emission of applied indicator
was detected (excitation and emission wavelength
of 359 nm and 461 nm, respectively) and the
analysis was performed using FloMax software.
Morphological studies of the apoptotic cells
Cells were cultured on cover slips coated with Poly
L-lysine and exposed to drugs for 48 h. Following
staining with Annexin V-FITC (20 µg/ml) and PI
(20 µg/ml) in the dark for 10-15 min, samples were
examined using a fluorescent microscope (Carl
Zeiss-Germany) using 450-500 nm excitation and
515-565 nm emission filters.
Measurement of caspase-3 activity
Following drug treatments, cells were harvested
and incubated in lysis buffer on ice for 1 minute.
After centrifugation, sample supernatants were used
for caspase-3 activity measurements using AC-
DEVED-AFC fluorescent substrate as
recommended by the supplier. The concentration of
enzyme-released AFC was estimated using
fluorospectrophotometer (HITACHI model MPF4-
Japan) at 400 nm excitation and 505 nm emission
wavelengths.
DNA laddering assay
2×10 6 drug treated cells were lysed with an equal
volume of binding/lysis buffer for 10 minutes at 15-
25 º C. The obtained extract was processed as
recommended by the supplier. Electrophoresis of
the samples in 1% agarose gel at 75 volt for 90
minutes revealed DNA cleavage pattern of cells
Sulfabenzamide promotes autophagic cell death 43
relative to positive control (DNA extracted
prepared from U937 cells incubated 3h with 4 µM
camptothecin).
Preparation of total RNA, cDNA synthesis and real
time RT-PCR
Total RNA was purified using the RNeasy Qiagen
kit according to the manufacturer’s
recommendation. First strand cDNA was generated
using RevertAidTM M-MuLV reverse transcriptase
and 5µg of RNA with random hexamer primers.
Real time quantitative RT-PCR was performed
using the QuantiFast SYBR Green PCR Master
Mix under the following program: 95˚C for 5 min
followed by 40 cycles (95˚C for 10 sec, annealing
for 25 sec and extension at 72˚C for 30 sec).
Analysis was done using Corbett rotor-gene 6000
software based on the comparative Ct method (or
ΔΔCt method). The relative amount of target
materials was quantified compared to the reference
gene (GAPDH). Primers were prepared by TAG
(Copenhagen, Denmark) and were used to amplify
specific regions of cDNA as listed in Table1.
Statistical analysis
For all methods statistical analysis were performed
by the SPSS version 16 and Excel 2007 softwares.
Statistical analysis for MTT assay, flow cytometry,
caspase-3 activity were performed by one way
ANOVA and real time RT-PCR methods were
carried out by t-test. All results are presented as
mean ± standard deviation (p< 0.05 was considered
statistically significant).
Results
Sulfabenzamide inhibits the proliferation of T-47D
cells
The MTT assay was used to evaluate the viability
of T-47D cells incubated with different
concentrations of sulfabenzamide (0.0-20 mM) or
doxorubicin (0.0-0.6 µM) after 24, 48 and 72 h
(chemical structures are shown in Figure 1A). We
checked toxic effects of doxorubicin on T-47D
since it had been reported that its anticancer effects
on different cell types exerts through distinct
cellular processes (apoptosis or cell cycle arrest).
Thus, it could be utilized as a control in our
experiments. The 50% growth inhibition (LC50)
concentration for sulfabenzamide and doxorubicin
after 48 h, were calculated as 10.8 mM and 0.33
µM, respectively, and utilized in the following
experiments (Figure 1B).
44 Raziye MOHAMMADPOUR et al.
Table 1. List of primers. Forward and reverse primer pairs for PTEN gene were designed to amplify a region which could
not anneal to PTEN pseudogene. Primer for p53 was designed for the mutant form present in T-47D cells.
Gene Accession number primers
F: CCAGGTGGTCTCCTCTGACTTCAACAG
PCR product(bp)
GAPDH NC_000012.11
R: AGGGTCTCTCTCTTCTTCCTCTTGTGCTCT
F: GTGAGATATGGTTTGAATATGAAGGC
218
ATG5 NC_000006.11
R: CTCTTAAAATGTACTGTGATGTTCCAA
F: GGAGAGGAGCCATTTATTGAAACT
122
beclin1 NC_000017.10
R: AGAGTGAAGCTGTTGGCACTTTCTG
F: CTTGGATTGGTGGGATGTTTC
104
DRAM NC_000012.11
R: GATGATGGACTGTAGGAGCGTGT
F: CCAGATGGAAAGACGTTTTTGTG
135
AKT1 NC_000014.8
R: GAGAACAAACTGGATGAAATAAA
F: CTGCGGAAGGAAGTCATCATTGC
106
AKT2 NC_000019.9
R: CGGTCGTGGGTCTGGAAGGCATAC
F: CAAACTTTTTCAGAGGGGATCG
125
caspase-3 NC_000004.11
R: GCATACTGTTTCAGCATGGCAC
F: AAGAAGCTGAGCGAGTGTC
261
bax NC_000019.9
R: GGCCCCAGTTGAAGTTGC
F: ATGGAACTAACTATGTTGGACTATG
157
cyclinB1 NC_000005.9
R: AGTATATGACAGGTAATGTTGTAGAGT
F: AGGGGGAAACACCAGAATCAAGTG
138
bcl-2 NC_000018.9
R: CCCAGAGAAAGAAGAGGAGTTATAA
F: GGTCTTGTGGACAGTAGTTTGCC
113
AIF NC_000023.10
R: TCTCACTCTCTGATCGGATACCA
F:CCTGTGCAGCTGTGGGTTGATTT
115
p53 NC_000017.10
R: AGGAGGGGCCAGACCATCGCTAT
F: TTGGAGTCCCGATTTCAGAG
150
DFF40 NC_000001.10
R: CTGTCGAAGTAGCTGCCATTG
F:TTCTGTGTCTACCTTCCAATACTA
194
DFF45 NC_000001.10
R:CTGTCTGTTTCATCTACATCAAAG
F: TAACATTAGTCTGGATGGTGTAGA
127
PARP1 NC_000001.10
R: TTACCTGAGCAATATCATAGACAAT
F: TGGCATTACAGACATCTTTAGTTT
113
DNA-PK NC_000008.10
R: ACTTTAGGATTTCTTCTCTACATTCA
F: TGGCTAAGTGAAGATGACAATCATG
111
PTEN NC_000010.10
R: GCACATATCATTACACCAGTTCGT
81
Sulfabenzamide promotes autophagic cell death 45
Figure 1. A) Chemical structure of sulfabenzamide and doxorubicin. B) Viability curve of sodium
sulfabenzamide and doxorubicin treated T-47D cells. Percent viability of cells incubated with sodium
sulfabenzamide and doxorubicin was calculated relative to the related untreated controls after 24, 48 and 72
h. Each point relates to the mean value of at least three independent experiments. The related correlation
coefficient (r 2 ) was adjusted until the best fit for the selected mathematical function was used to interpolate
the experimental points.
T-47D cells do not exhibit DNA fragmentation and
apoptotic morphology in the presence of
sulfabenzamide or doxorubicin
Unlike DNA fragmentation patterns observed in
DNA extracted from U937 cells incubated with
camptothecin (as a positive control of DNA
laddering kit), the gel electrophoresis of DNA
prepared from cells incubated with sulfabenzamide
(10.8 mM) or doxorubicin (0.33 µM) showed no
DNA ladder or smear pattern confirming lack of
apoptosis or necrosis in these cells (Figure 2A).
Morphological analysis of sulfabenzamide and
doxorubicin treated cells, double stained with
Annexin-FITC and PI, evaluated by fluorescent
microscopy and confirmed the results of DNA
laddering analysis. There were few cells having
morphological characteristics of apoptotic and
necrotic cells (Figures 2B, 2C). Early (young)
apoptotic cells have rounded shape and shiny green
membrane because PI cannot penetrate into the
cells and Annexin-FITC binds to the externally
membrane-exposed phosphatidylserines (Figures
2B, 2C). Late apoptotic and necrotic cells have
membrane permeability for PI so their nuclei are
stained red (Figure 2C). The main difference
between necrotic and late apoptotic cells is the
potency of late apoptotic cells for simultaneous
staining of nuclei and membrane-exposed
phosphatidylserines with PI and Annexin-FITC,
respectively. Membrane blebbing, which is a
common feature of apoptotic cells was seen in
Figure 2B. Evidently, healthy cells cannot be seen
under fluorescent microscope since they were not
stained with either of the fluorescent dyes (Figure
2E).
46 Raziye MOHAMMADPOUR et al.
Figure 2. A) DNA laddering analysis. 1-3 µg DNA prepared from 2×10 6 cells was resolved by
electrophoresis in a 1% agarose gel. DNA fragmentation was observed only in positive control (camptothecin
treated) cells, but it was not detected in control or cells incubated with doxorubicin or sodium
sulfabenzamide. B) Observation of the morphology of early apoptotic cells using fluorescent microscopy
following double staining with Annexin V-FITC and PI. Morphological characteristics of early apoptotic
cells (rounded green shiny cells showing membrane blebbing) in sulfabenzamide treated cells. C)
Observation of the morphology of late apoptotic and necrotic cells using fluorescent microscopy following
double staining with Annexin V-FITC and PI. Morphological characteristics of late apoptotic (flattened green
shiny cells showing red dense nuclei) and necrotic cells (red dense spheres lacking green shiny membrane) in
sulfabenzamide treated cells. Similar results were observed for doxorubicin (not shown). Living cells due to
lack of staining with dyes are not detectable in fluorescent visual field (E) but are visible using phase contrast
microscopy (D).
Sulfabenzamide promotes autophagic cell death 47
Figure 3. Caspase-3 activity was increased in cells incubated with sulfabenzamide or doxorubicin. Enzyme
activity in the control, sodium sulfabenzamide, or doxorubicin treated cells were 1.308±0.115, 2.07±0.08,
and 2.496±0.11 nM.h -1 , respectively. Standard curve based on emission (Y axis) of different concentration of
free AFC (nM) is plotted (inset). Diagram of free AFC is plotted in 400 nm excitation and 505 nm emission
wavelengths.
Table 2. Numerical results of flow cytometry analysis. Results are the mean value ± SD for at least three
replicated experiments. Each column named with Qi which includes data related to the quadrant that are Q1
(PI + and Annexin V-FITC - ) or Q1+Q2 (Q2 is the region for PI + and Annexin V-FITC + ) indicated percent value
of necrotic cells, and columns Q4 (PI - and Annexin V-FITC + ) or Q2+Q4 show percent values of apoptotic cells
(see text). Column Q3 (PI - and Annexin V-FITC - ) indicates percent value of normal cells. Column of G1, S
and G2/M represent the percent value of the cells placed in each related phase of cell cycle. NC, Dox and SU
are abbreviations for Negative Control, Doxorubicin and Sulfabenzamide, respectively.
Treated
cells
Q3 Q1 Q2 Q4 Q1+Q2 Q2+Q4 G1
S G2
NC 98.94±0.72 0.90±0.46 0.05±0.04 0.35±0.09 0.96±0.50 0.40±0.11 67.06±5.79 16.39±4.27 16.54±3.20
DOX 97.60±1.12 1.33±0.68 0.015±0.02 1.05±0.90 1.34±0.67 1.06±0.90 30.58±1.14 40.55±4.65 28.86±3.51
SU 98.58±0.56 0.27±0.19 0.09±0.08 0.86±0.57 0.37±0.1 0.96±0.54 48.80±4.28 27.47±4.39 22.70±3.79
48 Raziye MOHAMMADPOUR et al.
Caspase-3 activity was increased in the
sulfabenzamide and doxorubicin treated cells
Using caspase-3 specific substrate, subsequent
releasing of the fluorescent product (AFC) was
measured and average enzymatic velocity was
calculated (three independent experiments) as
16.6±1.42, 26.2±1.3 and 38.3±0.85 (∆F.h -1 , ∆F
means fluorescent intensity alteration) for untreated
cell, sulfabenzamide or doxorubicin treated cells,
respectively. Using the standard curve of free AFC,
enzymatic activity was calculated as 1.308±0.115,
2.07± 0.08 and 2.496± 0.11nM.h -1 , respectively
(Figure 3).
Comparing with untreated cells, caspase-3
activity was increased in drug treated samples.
Elevated activity of caspase-3, which is a sign of
apoptosis induction, is in contrast with the DNA
laddering results and is further discussed below.
Sulfabenzamide did not induce apoptosis but
induced a minimal shift from G1 to S and G2/M
phases of the cell cycle
Using flow cytometric analysis and Annexin-FITC
and PI staining, the incidence of apoptosis and
necrosis in untreated, sulfabenzamide, or
doxorubicin treated cells were quantified (Figure
4A and Table 2).
Congruent with graph interpretation methods
applied in most publications, the sum of cell
populations in regions Q2 (PI + and Annexin V-
FITC + ) and Q4 (PI - and Annexin V-FITC + ) were
considered as early and late apoptotic cells (Hsu et
al., 2006; Tyagi et al., 2006; Dowejko et al., 2009;
LaPensee et al., 2009). In addition, regions Q1 (PI +
and Annexin V-FITC - ) and Q3 (PI - and Annexin V-
FITC - ) indicated necrotic and unscathed
populations, respectively. In some publications, cell
percentages located in Q1 and Q2 (Q2 is the region
for PI + and Annexin V-FITC + ) quarters are
considered as necrotic cells (Davis et al., 2000). In
these studies, Q4 quarter (PI - and Annexin V-
FITC + ) represented the percentage of apoptotic
cells. Therefore, in Table 2 determination of
necrotic cells was performed separately via Q1, as
well as Q1+Q2, and the estimation for apoptotic
cells was carried out as Q2+Q4 as well as Q4, in
order to indicate that the low percentages of
apoptotic and necrotic cells observed was not
influenced by the applied analytical methods.
Flow cytometry is useful for calculating the
percentages of cells existing in various stages of the
cell cycle including G1, S and G2/M. To make a
practical use of this technique, cells were stained
with DAPI, which enters the nucleus and binds to
DNA and emanates fluorescent emission.
Although, no significant change in the normal
pattern of cell distribution throughout the cell cycle
was observed for sulfabenzamide treated cells (18%
shift from G1 to S and G2/M) a considerable
transition (37%) was detected from G1 to S (main
transition) and G2/M in cells incubated with
doxorubicin as positive control (Figure 4B and
Table 2).
Alterations in expression of proapoptotic,
prosurvival and autophagic genes in
sulfabenzamide and doxorubicin treated cells
The changes in expression level of apoptotic, cell
survival and autophagic genes were evaluated using
real time RT-PCR. With respect to the results
shown in Figure 5 as well as its insets it can be seen
that in sulfabenzamide treatments some apoptotic
genes (DFF-45 and DNA-PK ) were over expressed
while some others were down regulated (PARP1,
Bax, Bcl-2 and AIF) or retained their expression
level in a constant condition (DFF-40 and caspase-
3). Moreover, some critical genes which are
important in cell survival pathway were also down-
regulated (AKT1 and AKT2) or over expressed
(PTEN). Alterations in gene expression were
evaluated for some autophagic genes such as
ATG5, p53 and DRAM indicating higher amounts
of the related transcripts in drug treated cells
relative to the untreated ones. In doxorubicin
treated cells some apoptotic genes were focused
and their alterations including over expression of
caspase-3, DNA-PK, DFF-45 and Bax; down
regulation of DFF-40 and constant expression of
AIF and PARP1 were evaluated (Figure 5).
Sulfabenzamide promotes autophagic cell death 49
Figure 4. A) Two dimensional plots of Annexin V-FITC against PI related to the flow cytometric
experiments. Two dimensional diagrams from flow cytometric studies showed that the percentage of
apoptotic cells (cells located in the Q4 area or total cells in Q2 + Q4) and necrosis (cell located in Q1 or in
Q1+Q2) do not show dramatic differences compared with control cells. B) Effects of sodium sulfabenzamide
and doxorubicin on the cell cycle distribution. FL4-A indicates the area under the registered electrical signal
of each stained cell. The curves from left to right relate to G1, S, G2/M phases of the cell cycle in control,
doxorubicin or sodium sulfabenzamide treated samples.
50 Raziye MOHAMMADPOUR et al.
Figure 5. Quantitative real time RT-PCR analysis histograms. Real time RT-PCR for the selected genes for
sulfabenzamide (A) and Doxorubicin (B) treated T-47D cells were determined as described in Methods. The
relative amount of target material was quantified compared to the reference gene using the comparative Ct
(ΔΔCt) method. The statistical significant differences are indicated with * and ** for 0.01
independent of changes in the related mRNA level
(Figures 3 and 5). The increased activity of
caspase-3 was negated via overexpression of DFF-
45. DFF-45 is the natural inhibitor of DFF-40
(CAD) (Liu et al., 1997). In addition, the increased
expression of DFF-45, along with a modest
increase (for sulfabenzamide) and a significant
decrease (for doxorubicin) in DFF-40 expression
(Figure 5), indicated that the increased activity of
caspase-3 could be blocked by the increased
expression ratio of DFF-45/DFF-40. This reduces
the level of active DFF-40 to trigger DNA
fragmentation and appearance of apoptotic
symptoms. Furthermore, it has been reported that
caspases are activated during autophagy in dying
cells and are suppressed for apoptosis induction
(Martin et al., 2004; Yu et al., 2004). Therefore, it
can be deduced that during autophagy, the effects
of activated caspase-3 on their downstream
substrates (like DFF-40) should be suppressed by
special factors (e.g. DFF-45 in T-47D cells) only in
those cellular routes which are involved in the
appearance of apoptosis symptoms (e.g. DNA
fragmentation).
Cell cycle arrest, an important cellular target
affected by sulfabenzamide and doxorubicin, was
analyzed using flow cytometry. Incubation of T-
47D cells with 0.33 µM doxorubicin resulted in a
significant accumulation of cells in S phase, and to
a lesser extent in G2/M phase of the cell cycle
(Figure 4B and Table 2). Thus, doxorubicin exerts
its antiproliferative action mainly through cell cycle
arrest. Induced mitotic catastrophe following
increased activation of cyclinB1/Cdc2 may occur
while cells are delayed, particularly in G2 phase of
the cell cycle (Lindqvist et al., 2007). The induced
G2/M arrest along with down regulation of
cyclinB1 expression confirmed that anticancer
activity of doxorubicin is not via mitotic
catastrophe (Figure 5 and Table 2). In contrast to
doxorubicin, minimal cell cycle arrest in S and
G2/M phases (totally 18%) was observed in T-47D
cells incubated with 10.8 mM sulfabenzamide
(Figure 4B and Table2). Thus, cell cycle arrest
could not be mainly responsible for a 50%
reduction in cell viability in the presence of
sulfabenzamide.
As we know, when apoptosis is blocked or
delayed autophagy triggered and vice versa. These
possibilities are consistent with our findings
regarding lack of apoptosis in drug treated cells and
induction of autophagy. The induced
overexpression of ATG5 supported that autophagy
Sulfabenzamide promotes autophagic cell death 51
triggered in the presence of sulfabenzamide (Figure
5). This could be probably occurred through the
increase in Bax activity working on mitochondrial
membrane to result in activation of caspase-3 for
PARP1 and DNA-PK deactivation and autophagy
induction. It has been reported that induction of
autophagy by PUMA (the p53-inducible BH3-only
protein) depends on Bax/Bak and can be
reproduced by overexpression of Bax (Yee et al.,
2009). Here, in doxorubicin treatment, increase in
Bax activity could be occurred in parallel with the
increment of Bax transcripts affecting on the cells
for caspase-3 activation and changing the cell's
destiny toward autophagy (Figure 5). This notion
could be also supplied in sulfabenzamide treatment
aside from the mild decrease in Bax expression
because activation of the existed Bax molecules in
the cells could be happened for caspase-3 activation
and autophagy induction (Figure 5). It has been
also reported that proteolytic cleavage of PARP1,
performed by caspase-3, produces specific
proteolytic cleavage fragments which are involved
in the cell’s decision to change its fate from
apoptosis toward autophagy (Munoz-Gamez et al.,
2009; Chaitanya et al., 2010). Induction of
autophagic cell death is dependent on DNA-PK
inhibition (Daido et al., 2005). Thus, the increased
activity of caspase-3 could finally deactivate
PARP1 (has a decreased and constant expression
level in sulfabenzamide and doxorubicin
treatments, respectively) and DNA-PK (has an
increased and invariable expression level in
sulfabenzamide and doxorubicin treatments,
respectively) until apoptosis was blocked and
autophagy induced (Figures 3 and 5).
Despite the existence of some controversies
regarding the possible role of autophagy in tumor
progression by promoting cell survival, autophagy
can exist as a backup mechanism promoting
cellular death when other mortality mechanisms are
not functional. Hyperactivation of autophagy above
the threshold point leads to unlimited self-eating of
the cells causing autophagy or type II programmed
cell death (Hoyer-Hansen et al., 2005; Maiuri et al.,
2010). Based on our data, downregulation of AKT1
and AKT2 as well as upregulation of PTEN in
sulfabenzamide treated cells indicated that cell
survival pathways were slowed down (Figure 5). In
addition, down regulation of bcl-2 was happened
along with the induction of autophagy (Figure 5). It
has been reported that targeted silencing of bcl-2
expression (an anti-autophagic gene) in human
breast cancer cells with RNA-interference has
52 Raziye MOHAMMADPOUR et al.
promoted autophagic cell death and thus presents a
therapeutic potential (Akar et al., 2008).
p53 is involved in decreasing cell survival
potency through inactivation of AKT/mTOR
pathways, and stimulation of autophagy via
transactivation of DRAM (Maiuri et al., 2007).
Thus, the observed increased expression level of
DRAM and p53 genes support our conclusion that
the repression of AKT/mTOR survival pathway
(via p53 overexpression) and autophagy induction
(via increased DRAM transcripts) are responsible
for reduced viability of T-47D cells and induction
of death inducing autophagy in the presence of
sulfabenzamide (Figure 5). T -47D cells contain
only a single copy of the p53 missense mutation
(Schafer et al., 2000). It has been reported by
various studies that mutant p53 may lose its natural
antitumor activity (Lim et al., 2009). Interestingly,
in the presence of sulfabenzamide the antitumor
activities of mutant form of p53 should return to the
normal activities of the wild type form to induce
autophagic cell death. This is very similar to the
mechanism of action for some antitumor drugs
reactivating mutant p53 to kill cancerous cells
(Lambert et al., 2009).
Evidently, checking of the protein expression
levels using other supplementary methods such as
western blotting could provide us better documents
to support the presented real time RT-PCR data.
But, in our work, we found that the registered
alterations for the level of RNA transcripts were in
a good consistence with the expected cellular
behaviors when the proteins' expression levels or
their activities were theoretically going to become
changed in parallel with the RNA levels in the
cells. Therefore, regardless of some exceptions,
evaluating RNA transcripts could provide us an
adequate image illustrating the changes in the
proteins’ expression levels in the cells.
Conclusions
In summary, we showed that cell cycle arrest (and
possibly autophagy) may play a role in action of
doxorubicin on T-47D cells. However, the
contribution of apoptosis and cell cycle arrest
antiproliferative effect of sulfabenzamide on T-47D
cells is minimal. These observations are in contrast
to many reports in which the mechanism of action
of sulfonamide derivatives on cancer cells
attributed to the conventional processes of
apoptosis and cell cycle arrest. We believe that
induction of autophagic cell death in T-47D cells is
triggered through p53/DRAM pathway (occurred
along with decreasing of Akt/mTOR pathway) and
this is a reasonable cellular axis to justify our
results.
Abbreviations
AKT: v-akt murine thymoma viral oncogene
homolog, mTOR: Mechanistic Target Of
Rapamycin, PTEN: Phosphatase and Tensin
homolog, DRAM: Damage Regulated Autophagy
Modulator, ATG5:Autophagy related gene 5,
Beclin1: Bcl2 Interacting protein 1, PARP1: Poly
ADP-Ribose Polymerase 1, DFF-40/CAD: DNA
Fragmentation Factor 40/ Caspase-Activated
DNase, Bax: Bcl2-Associated X protein, Bcl-2: B-
Cell Lymphoma 2, AIF: Apoptosis Inducing
Factor, DFF-45/iCAD: DNA Fragmentation
Factor 45/inhibitor of Caspase-Activated DNase,
Cdc2: Cell Division Cycle protein 2, ARF: ADP
Ribosylation Factor, GAPDH: Glyceraldehyde-3-
Phosphate Dehydrogenase, ACD: Autophagic Cell
Death, PCDII: type II Programmed Cell Death,
RPMI: Roswell Park Memorial Institute.
Conflict of interest
The authors declare that they have no competing
interest.
Authors' contributions
SS designed the study and experiments, analyzed
and interpreted data and also prepared the
manuscript. RM carried out the experiments and
participated in data analysis as well as writing the
initial draft of the manuscript. SH and SF
participated in performing the experiments. NS
contributed on giving scientific comments and also
carried out final editing of the manuscript.
Acknowledgements
Iran National Science Foundation (INSF) and
Research Council of University of Tehran have
been gratefully appreciated by the authors because
of their foundational supports for this work.
References
Akar U, Chaves-Reyez A, Barria M, Tari A,
Sanguino A, Kondo Y, et al. Silencing of Bcl-2
expression by small interfering RNA induces
autophagic cell death in MCF-7 breast cancer
cells. Autophagy. 4: 669–679, 2008.
Alberts B, Johnson A, Lewis J, Raff M, Roberts K,
Walter P. Molecular Biology of the Cell.
Garland science Taylor & Francis Group, LLC,
UK, 1115-1130, 2008.
Brunelli E, Pinton G, Bellini P, Minassi A,
Appendino G, Moro L. Flavonoid-induced
autophagy in hormone sensitive breast cancer
cells. Fitoterapia. 80: 327-332, 2009.
Chaitanya GV, Steven AJ, Babu PP. PARP-1
cleavage fragments: signatures of cell-death
proteases in neurodegeneration. Cell Commun
Signal. 8:31-41, 2010.
Daido S, Yamamoto A, Fujiwara K, Sawaya R,
Kondo S, Kondo Y. Inhibition of the DNAdependent
protein kinase catalytic subunit
radiosensitizes malignant glioma cells by
inducing autophagy. Cancer Res. 65: 4368-
4375, 2005.
Davis JW, Melendez K, Salas VM, Lauer FT,
Burchiel SW. 2,3,7,8-Tetrachlorodibenzo-pdioxin
(TCDD) inhibits growth factor
withdrawal-induced apoptosis in the human
mammary epithelial cell line, MCF-10A.
Carcinogenesis. 21: 881-886, 2000.
Dowejko A, Bauer RJ, Muller-Richter UDA,
Reichert TE. The human homolog of the
Drosophila headcase protein slows down cell
division of head and neck cancer cells.
Carcinogenesis. 30: 1678-1685, 2009.
Fukuoka K, Usuda J, Iwamoto Y, Fukumoto H,
Nakamura T, Yoneda T, et al. Mechanisms of
action of the novel sulfonamide anticancer
agents E7070 on cell cycle progression in
human non-small cell lung cancer cells. Inves
New Drugs. 19: 219-227, 2001.
Hoyer-Hansen M, Bastholm L, Mathiasen IS,
Elling F, Jaattela M. Vitamin D analog EB1089
triggers dramatic lysosomal changes and Beclin
1-mediated autophagic cell death. Cell Death
Differ. 12: 1297–1309, 2005.
Hsu CL, Yen GC. Induction of cell apoptosis in
3T3-L1 pre-adipocytes by flavonoids is
associated with their antioxidant activity. Mol
Nutr Food Res. 50: 1072-1079, 2006.
Kondo Y, Kanzawa T, Sawaya R, Kondo S. The
role of autophagy in cancer development and
response to therapy. Nat Rev Mol Cell Biol. 5:
726-734, 2005.
Kondo Y, Kondo S. Autophagy and cancer therapy.
Autophagy. 2: 85-90, 2006.
Sulfabenzamide promotes autophagic cell death 53
Lambert JMR, Gorzov P, Veprintsev DB,
Söderqvist M, Segerbäck, D, Bergman J et al.
PRIMA-1 reactivates mutant p53 by covalent
binding to the core domain. Cancer Cell. 15:
376-388, 2009.
LaPensee EW, Schwemberger SJ, LaPensee CR,
Bahassi E, Afton SE, Ben-Jonathan N. Prolactin
confers resistance against cisplatin in breast
cancer cells by activating glutathione-Stransferase.
Carcinogenesis. 30: 1298-1304,
2009.
Lim LY, Vidnovic N, Ellisen LW, Leong C-O.
Mutant P53 mediates survival of breast cancer
cells. Brit J Cancer. 101: 1606 – 1612, 2009.
Lindqvist A, Van Zon W, Karlsson Rosenthal C,
Wolthuis RMF. Cyclin B1–Cdk1 activation
continues after centrosome separation to control
mitotic progression. PLoS Biol. 5: 1127-1137,
2007.
Liu X, Zou H, Slaughter C, Wang X. DFF, a
heterodimeric protein that functions
downstream of caspase-3 to trigger DNA
fragmentation during apoptosis. Cell. 8: 175-
184, 1997.
Maiuri MC, Galluzzi L, Morselli E, Kepp O, Malik
SA, Kroemer G. Autophagy regulation by p53.
Curr Opin Cell Biol. 22: 181–185, 2010.
Maiuri MC, Zalckvar E, Kimchi A, Kroemer G.
Self-eating and self-killing: crosstalk between
autophagy and apoptosis. Nat Rev Mol Cell
Biol. 8: 741-752, 2007.
Martin DN, Baehrecke E. Caspases function in
autophagic programmed cell death in
Drosophila. Development. 131: 275- 284, 2004.
Mohan R, Banerjee M, Ray A, Manna T, Wilson L,
Owa T et al. Antimitotic sulfonamides inhibit
microtubule assembly dynamics and cancer cell
proliferation. Biochemistry. 45: 5440-5449,
2006.
Munoz-Gamez A, Rodriguez-Vargas JM, Quiles-
Perez R, Aguilar-Quesada R, Martin-Oliva D,
de Murcia G et al. PARP-1 is involved in
autophagy induced by DNA damage.
Autophagy. 5: 61-74, 2009.
Owa T, Yoshino H, Okauchi T, Yoshimatsu K,
Ozawa Y, Sugi NH, et al. Discovery of novel
antitumor sulfonamides targeting G1 phase of
54 Raziye MOHAMMADPOUR et al.
the cell cycle. J Med Chem. 42:3789-3799,
1999.
Ozawa Y, Sugi NH, Nagasu T, Owa T, Watanabe
T, Koyanagi N et al. E7070, a novel
sulphonamide agent with potent antitumour
activity in vitro and in vivo. Eur J Cancer. 37:
2275-2282, 2001.
Schafer JM, Lee ES, O'Regan RM, Yao K, Jordan
VC. Rapid development of tamoxifenstimulated
mutant p53 Breast Tumors (T47D) in
athymic mice. Clin Cancer Res. 6: 4373-4380,
2000.
Supuran CT, Casini A, Scozzafava A. Protease
inhibitors of the sulfonamide type: Anticancer,
antiinfammatory, and antiviral agents. Med Res
Rev. 23: 535-558, 2003.
Supuran CT. Indisulam: an anticancer sulfonamide
in clinical development. Expert Opin Investig
Drugs. 12: 283-287, 2003.
Tyagi A, Singh RP, Agarwal C, Agarwal R.
Silibinin activates p53-caspase2 pathway and
causes caspase-mediated cleavage of Cip1/p21
in apoptosis induction in bladder transitionalcell
papilloma RT4 cells: evidence for a
regulatory loop between p53 and caspase 2.
Carcinogenesis. 27: 2269-2280, 2006.
Valley AW, Balmer CM. Pharmacotherapy: A
Pathophysiologic Approach. Appleton &
Lange, CT. 1957-2012, 1999.
Yee KS, Wilkinson S, James J, Ryan KM, Vousden
KH. PUMA and Bax-induced autophagy
contributes to apoptosis. Cell Death Differ. 16:
1135–1145, 2009.
Yokoi A, Kuromitsu J, Kawai T, Nagas T, Sugi
NH, Yoshimatsu K, et al. Profiling novel
sulfonamide antitumor agents with cell-based
phenotypic screens and array-based gene
expression analysis. Mol Cancer Ther. 1: 275-
286, 2002.
Yokoyama T, Kondo Y, Bogler O, Kondo S. Drug
Resistance in Cancer Cells (Mehta, K. and
Siddik, Z.H., eds). Springer Science+Business
Media, LLC: PA. 53-71, 2009.
Yu L, Lenardo MJ, EH Baehrecke Autophagy and
caspases: a new cell death program. Cell Cycle.
3:1124-1126, 2004.
Yu SW, Wang H, Poitras MF, Coombs C, Bowers
WJ, Federoff HJ et al. Mediation of poly (ADPribose)
polymerase-1-dependent cell death by
apoptosis-inducing factor. Science. 297: 259-63,
2002.
Change language