Sulfabenzamide promotes autophagic cell death in T-47D breast ...

jcmb.halic.edu.tr

Sulfabenzamide promotes autophagic cell death in T-47D breast ...

Journal of Cell and Molecular Biology 10(1): 41-54, 2012 Research Article 41

Haliç University, Printed in Turkey.

http://jcmb.halic.edu.tr

Sulfabenzamide promotes autophagic cell death in T-47D breast

cancer cells through p53/ DRAM pathway

Raziye MOHAMMADPOUR 1 , Shahrokh SAFARIAN *1 , Soroor FARAHNAK 1 , Sana

HASHEMINASL 1 , Nader SHEIBANI 2

1

School of Biology, College of Science, University of Tehran, Tehran, Iran

2

Department of Ophthalmology and Visual Sciences, School of Medicine and Public Health, University of

Wisconsin, Madison, USA

(* author for correspondence; safarian@ibb.ut.ac.ir )

Received: 26 March 2012; Accepted: 29 May 2012

Abstract

Sulfonamides exhibit their antitumor effects through multiple mechanisms including inhibition of membrane

bound carbonic anhydrases, prevention of microtubule assembly, cell cycle arrest, and inhibition of angiogenesis.

Here, sulfabenzamide’s mechanisms of action on T-47D breast cancer cells were determined. Cells incubated with

sulfabenzamide exhibited negligible levels of apoptosis, necrosis and cell cycle arrest when compared to untreated

cells. These results were confirmed by morphological examinations, DNA fragmentation assays, flow cytometric

and real time RT-PCR analysis. Surprisingly, despite negligible detection of DNA fragmentation, a considerable

increase in caspase-3 activity was observed in cells incubated with sulfabenzamide. The increased expression ratio

of DFF-45/DFF-40 indicated that caspase-3-related DNA fragmentation was blocked and apoptosis symptoms

could not be seen. However, the effects of caspase-3 for PARP1 and DNA-PK deactivation resulted in autophagy

induction. The overexpression of critical genes involved in autophagy, including ATG5, p53 and DRAM, indicated

that in T-47D cells sulfabenzamide-induced antiproliferative effect was mainly exerted through induction of

autophagy. Furthermore, downregulation of AKT1 and AKT2 as well as over expression of PTEN resulted in

attenuation of AKT/mTOR survival pathway showing that death autophagy should be occurred in sulfabenzamide

treatment.

Keywords: Sulfabenzamide, breast cancer, autophagy, apoptosis, p53.

Sülfobenzamid, T-47D meme kanseri hücrelerinde p53/DRAM yolağı aracılığıyla otofajik hücre ölümünü

teşvik eder

Sülfonamidler, membrana bağlı karbonik anhidraz inhibisyonunu, mikrotubül toplanmasının engellenmesini, hücre

siklusunun durdurulmasını ve anjiyogenez inhibisyonunu içeren çoklu mekanizmalarla antitümör etkilerini

göstermektedirler. Burada, T-47D meme kanser hücreleri üzerinde sülfobenzamid mekanizmasının etkisi

belirlenmiştir. Sülfobenzamid ile inkübe edilen hücreler yapılmamış uygulama hücrelerle karşılaştırıldıklarında

önemsenmeyecek seviyede apoptoz, nekroz ve hücre siklusunun durmasını ortaya koymuştur. Bu sonuçlar

morfolojik incelemelerle, DNA fragmantasyon analizleriyle, flow sitometrik ve gerçek zamanlı RT-PCR

analizleriyle doğrulanmıştır. Şaşırtıcı bir şekilde, DNA fragmantasyonunun ihmal edilebilecek tespitine rağmen,

sülfobenzamidle edilmiş inkübe hücrelerde kaspaz 3 aktivitesinde dikkate değer artış bir gözlenmiştir. DFF-45/

DFF-40’ artmış ın ekspresyon oranı, kaspaz 3 ile ilişkili DNA fragmantasyonunun durdurulduğunu ve apoptoz

belirtilerinin görülemeyeceğini işaret etmektedir. Bununla birlikte PARP1 ve DNA-PK deaktivasyonu için kaspaz

3’ün etkileri otofaji indüklenmesiyle sonuçlanmaktadır. ATG5, p53 ve DRAM gibi otofajide yer alan kritik

genlerin aşırı ekspresyonu T-47D sülfobenzamid-indüklenmiş hücrelerinde antiproliferatif etkinin çoğunlukla

otofaji indüksiyonu aracılığıyla uygulandığını belirtmektedir. Ayrıca, PTEN aşırı ekspresyonu gibi AKT1 ve

AKT’’nin azalarak düzenlenmesi, otofaji ölümünün sülfobenzamid uygulamasıyla meydana geldiğini gösteren

sağ AKT1/mTOR kalım yolağının etkisinin azalmasıyla sonuçlanmaktadır.

Anahtar kelimeler: sülfobenzamid, meme kanseri, otofaji, apoptoz, p53.


42 Raziye MOHAMMADPOUR et al.

Introduction

Sulfonamides are synthetic antibacterial agents

with diverse pharmacological effects including

antibacterial, antiviral, antidiabetic, antithyroid, and

diuretic. Their antibacterial effects are contributed

to the interfering with enzyme activities responsible

for folic acid synthesis by competing for para

aminobenzoic acid. These drugs are selectively

toxic for prokaryotes (Owa et al., 1999; Fukuoka et

al., 2001; Yokoi et al., 2002; Supuran 2003). Two

novel sulfonamides, E7070 and E7010, are potently

effective against cancer cells via inhibition of

tubulin polymerization and proliferation. The

matrix metalloprotease (MMP) inhibitory effects of

sulfonamides have been evaluated for treatment of

arthritis and cancer (Fukuoka et al., 2001; Ozawa et

al., 2001; Supuran et al., 2003; Mohan et al., 2006).

Sulfabenzamide, 4-Amino-N-benzoyl-benzenesulfonamide,

is a sulfonamide derivative used for

treatment of specific vaginal infections in

combination with sulfathiazole and sulfacetamide

(Valley and Balmer, 1999).

Knowledge regarding alterations in signaling

pathways and the type of cell death induced by

chemotherapeutic drugs is the first and most

important step in design of effective treatments.

Furthermore, manipulation of autophagy has the

potential to improve anticancer therapeutics.

Studies have shown that autophagy protects cancer

cells against antitumor effects of some drugs by

blocking the apoptotic pathway and maintaining

ATP levels. In contrast, other cancer cells undergo

autophagic cell death (ACD or type II programmed

cell death, PCDII) after anticancer therapies

(Kondo et al., 2005; Kondo and Kondo, 2006).

Various anticancer drugs that activate ACD in

breast cancer cells have been reported including

vitamin D analog, EB1089, Tamoxifen and other

antiestrogen agents (Hoyer-Hansen et al., 2005).

Tamoxifen induced autophagic pathway occurs

through down regulation of AKT activity

(Yokoyama et al., 2009). The 3'-methoxylated

analogue isocannflavin B (IsoB) exhibits an

inhibitory effect on T-47D cell proliferation, which

is accompanied by the appearance of an intense

intracytoplasmic vacuolization of autophagic origin

(Brunelli et al., 2009).

Here, we choose sulfabenzamide for assessing

its antitumor activity in T-47D breast cancer cell

line. Our main objective was to determine whether

this drug can be used as an antitumor drug in

medicine. From this point of view, we could

ascertain that there is a correlation between the

expression level of some critical genes and

induction of death autophagy in T-47D cells.

Materials and methods

Reagents

Culture medium, RPMI 1640, and fetal bovine

serum were from Gibco (England); penicillin

streptomycin solution, DNA laddering kit,

Annexin-V-FLOUS Staining Kit, Propidium

Iodide (PI) kit, caspase-3 fluorometric

immunosorbent enzyme assay kit, 4',6- Diamidino -

2-phenylindole (DAPI) kit were all acquired from

Roche (Germany); MTT was from Sigma

(England); sulfabenzamide and doxorubicin were

from Sina Darou (Iran) and Ebewe Pharma

(Austria), respectively. QuantiFast SYBR Green

PCR master mix and RNeasy plus Mini kit were

provided from Qiagen (USA). RevertAidTM M-

MuLV reverse transcriptase and random hexamer

were purchased from Fermentas (Germany).

Cell culture

Epithelial tumor cell line, T-47D, stemmed from

human ductal breast tissue, was provided from

National Cell Bank of Pasteur Institute (Tehran,

IRAN; ATCC number HTB-133). Cells were

maintained in RPMI 1640 medium supplemented

with heat-inactivated (35 min, 56°C) fetal bovine

serum (10% v/v) and penicillin streptomycin

solution (1% v/v) and incubated in humidified

condition; 95% air and 5% CO2 at 37°C.

Drug preparation and treatments

Regarding the obtained results from MTT assays,

LC50 for sodium sulfabenzamide and doxorubicin

after 48 h were estimated at 10.8 and 0.337×10 -3

mM, respectively. After reaching confluency (~

80%), cells were incubated with freshly prepared

drugs at the LC50 concentrations, harvested by

trypsin-EDTA, washed three times by phosphatebuffered

saline, and stored at -70°C.

Cytotoxicity/Viability assay

In brief, 10 4 cells/well were seeded in a 96 well

culture plate and incubated with different

concentrations of drugs for 24, 48 and 72 h. MTT

was then added to the wells (4 mg/ml or 100

µg/well) and the produced formazan was

systematically assessed using Elisa micro plate


eader at the wavelength of 570 nm. The percent of

cell viability related to each drug concentration was

estimated in relation to the untreated sample. All

assays were done at least three times unless stated

otherwise.

Apoptosis quantification

After washing 10 6 cells with PBS, cell pellets were

re-suspended in 100 µl of ready to use Annexin/PI

buffer (20 µl of each Annexin and PI buffer in 1 ml

incubation buffer) for 10-15 min at 25˚C. Samples

were then diluted in 500 µl of incubation buffer and

analyzed by flow cytometry (Partech Pass, USA)

using FloMax software.

Cell cycle analysis

5×10 5 drug treated cells were incubated with DAPI

solution (10 µg/ml and 6% Triton X-100 in PBS)

for 30 min in the dark at 4ºC. Using a flow

cytometer fluorescent emission of applied indicator

was detected (excitation and emission wavelength

of 359 nm and 461 nm, respectively) and the

analysis was performed using FloMax software.

Morphological studies of the apoptotic cells

Cells were cultured on cover slips coated with Poly

L-lysine and exposed to drugs for 48 h. Following

staining with Annexin V-FITC (20 µg/ml) and PI

(20 µg/ml) in the dark for 10-15 min, samples were

examined using a fluorescent microscope (Carl

Zeiss-Germany) using 450-500 nm excitation and

515-565 nm emission filters.

Measurement of caspase-3 activity

Following drug treatments, cells were harvested

and incubated in lysis buffer on ice for 1 minute.

After centrifugation, sample supernatants were used

for caspase-3 activity measurements using AC-

DEVED-AFC fluorescent substrate as

recommended by the supplier. The concentration of

enzyme-released AFC was estimated using

fluorospectrophotometer (HITACHI model MPF4-

Japan) at 400 nm excitation and 505 nm emission

wavelengths.

DNA laddering assay

2×10 6 drug treated cells were lysed with an equal

volume of binding/lysis buffer for 10 minutes at 15-

25 º C. The obtained extract was processed as

recommended by the supplier. Electrophoresis of

the samples in 1% agarose gel at 75 volt for 90

minutes revealed DNA cleavage pattern of cells

Sulfabenzamide promotes autophagic cell death 43

relative to positive control (DNA extracted

prepared from U937 cells incubated 3h with 4 µM

camptothecin).

Preparation of total RNA, cDNA synthesis and real

time RT-PCR

Total RNA was purified using the RNeasy Qiagen

kit according to the manufacturer’s

recommendation. First strand cDNA was generated

using RevertAidTM M-MuLV reverse transcriptase

and 5µg of RNA with random hexamer primers.

Real time quantitative RT-PCR was performed

using the QuantiFast SYBR Green PCR Master

Mix under the following program: 95˚C for 5 min

followed by 40 cycles (95˚C for 10 sec, annealing

for 25 sec and extension at 72˚C for 30 sec).

Analysis was done using Corbett rotor-gene 6000

software based on the comparative Ct method (or

ΔΔCt method). The relative amount of target

materials was quantified compared to the reference

gene (GAPDH). Primers were prepared by TAG

(Copenhagen, Denmark) and were used to amplify

specific regions of cDNA as listed in Table1.

Statistical analysis

For all methods statistical analysis were performed

by the SPSS version 16 and Excel 2007 softwares.

Statistical analysis for MTT assay, flow cytometry,

caspase-3 activity were performed by one way

ANOVA and real time RT-PCR methods were

carried out by t-test. All results are presented as

mean ± standard deviation (p< 0.05 was considered

statistically significant).

Results

Sulfabenzamide inhibits the proliferation of T-47D

cells

The MTT assay was used to evaluate the viability

of T-47D cells incubated with different

concentrations of sulfabenzamide (0.0-20 mM) or

doxorubicin (0.0-0.6 µM) after 24, 48 and 72 h

(chemical structures are shown in Figure 1A). We

checked toxic effects of doxorubicin on T-47D

since it had been reported that its anticancer effects

on different cell types exerts through distinct

cellular processes (apoptosis or cell cycle arrest).

Thus, it could be utilized as a control in our

experiments. The 50% growth inhibition (LC50)

concentration for sulfabenzamide and doxorubicin

after 48 h, were calculated as 10.8 mM and 0.33

µM, respectively, and utilized in the following

experiments (Figure 1B).


44 Raziye MOHAMMADPOUR et al.

Table 1. List of primers. Forward and reverse primer pairs for PTEN gene were designed to amplify a region which could

not anneal to PTEN pseudogene. Primer for p53 was designed for the mutant form present in T-47D cells.

Gene Accession number primers

F: CCAGGTGGTCTCCTCTGACTTCAACAG

PCR product(bp)

GAPDH NC_000012.11

R: AGGGTCTCTCTCTTCTTCCTCTTGTGCTCT

F: GTGAGATATGGTTTGAATATGAAGGC

218

ATG5 NC_000006.11

R: CTCTTAAAATGTACTGTGATGTTCCAA

F: GGAGAGGAGCCATTTATTGAAACT

122

beclin1 NC_000017.10

R: AGAGTGAAGCTGTTGGCACTTTCTG

F: CTTGGATTGGTGGGATGTTTC

104

DRAM NC_000012.11

R: GATGATGGACTGTAGGAGCGTGT

F: CCAGATGGAAAGACGTTTTTGTG

135

AKT1 NC_000014.8

R: GAGAACAAACTGGATGAAATAAA

F: CTGCGGAAGGAAGTCATCATTGC

106

AKT2 NC_000019.9

R: CGGTCGTGGGTCTGGAAGGCATAC

F: CAAACTTTTTCAGAGGGGATCG

125

caspase-3 NC_000004.11

R: GCATACTGTTTCAGCATGGCAC

F: AAGAAGCTGAGCGAGTGTC

261

bax NC_000019.9

R: GGCCCCAGTTGAAGTTGC

F: ATGGAACTAACTATGTTGGACTATG

157

cyclinB1 NC_000005.9

R: AGTATATGACAGGTAATGTTGTAGAGT

F: AGGGGGAAACACCAGAATCAAGTG

138

bcl-2 NC_000018.9

R: CCCAGAGAAAGAAGAGGAGTTATAA

F: GGTCTTGTGGACAGTAGTTTGCC

113

AIF NC_000023.10

R: TCTCACTCTCTGATCGGATACCA

F:CCTGTGCAGCTGTGGGTTGATTT

115

p53 NC_000017.10

R: AGGAGGGGCCAGACCATCGCTAT

F: TTGGAGTCCCGATTTCAGAG

150

DFF40 NC_000001.10

R: CTGTCGAAGTAGCTGCCATTG

F:TTCTGTGTCTACCTTCCAATACTA

194

DFF45 NC_000001.10

R:CTGTCTGTTTCATCTACATCAAAG

F: TAACATTAGTCTGGATGGTGTAGA

127

PARP1 NC_000001.10

R: TTACCTGAGCAATATCATAGACAAT

F: TGGCATTACAGACATCTTTAGTTT

113

DNA-PK NC_000008.10

R: ACTTTAGGATTTCTTCTCTACATTCA

F: TGGCTAAGTGAAGATGACAATCATG

111

PTEN NC_000010.10

R: GCACATATCATTACACCAGTTCGT

81


Sulfabenzamide promotes autophagic cell death 45

Figure 1. A) Chemical structure of sulfabenzamide and doxorubicin. B) Viability curve of sodium

sulfabenzamide and doxorubicin treated T-47D cells. Percent viability of cells incubated with sodium

sulfabenzamide and doxorubicin was calculated relative to the related untreated controls after 24, 48 and 72

h. Each point relates to the mean value of at least three independent experiments. The related correlation

coefficient (r 2 ) was adjusted until the best fit for the selected mathematical function was used to interpolate

the experimental points.

T-47D cells do not exhibit DNA fragmentation and

apoptotic morphology in the presence of

sulfabenzamide or doxorubicin

Unlike DNA fragmentation patterns observed in

DNA extracted from U937 cells incubated with

camptothecin (as a positive control of DNA

laddering kit), the gel electrophoresis of DNA

prepared from cells incubated with sulfabenzamide

(10.8 mM) or doxorubicin (0.33 µM) showed no

DNA ladder or smear pattern confirming lack of

apoptosis or necrosis in these cells (Figure 2A).

Morphological analysis of sulfabenzamide and

doxorubicin treated cells, double stained with

Annexin-FITC and PI, evaluated by fluorescent

microscopy and confirmed the results of DNA

laddering analysis. There were few cells having

morphological characteristics of apoptotic and

necrotic cells (Figures 2B, 2C). Early (young)

apoptotic cells have rounded shape and shiny green

membrane because PI cannot penetrate into the

cells and Annexin-FITC binds to the externally

membrane-exposed phosphatidylserines (Figures

2B, 2C). Late apoptotic and necrotic cells have

membrane permeability for PI so their nuclei are

stained red (Figure 2C). The main difference

between necrotic and late apoptotic cells is the

potency of late apoptotic cells for simultaneous

staining of nuclei and membrane-exposed

phosphatidylserines with PI and Annexin-FITC,

respectively. Membrane blebbing, which is a

common feature of apoptotic cells was seen in

Figure 2B. Evidently, healthy cells cannot be seen

under fluorescent microscope since they were not

stained with either of the fluorescent dyes (Figure

2E).


46 Raziye MOHAMMADPOUR et al.

Figure 2. A) DNA laddering analysis. 1-3 µg DNA prepared from 2×10 6 cells was resolved by

electrophoresis in a 1% agarose gel. DNA fragmentation was observed only in positive control (camptothecin

treated) cells, but it was not detected in control or cells incubated with doxorubicin or sodium

sulfabenzamide. B) Observation of the morphology of early apoptotic cells using fluorescent microscopy

following double staining with Annexin V-FITC and PI. Morphological characteristics of early apoptotic

cells (rounded green shiny cells showing membrane blebbing) in sulfabenzamide treated cells. C)

Observation of the morphology of late apoptotic and necrotic cells using fluorescent microscopy following

double staining with Annexin V-FITC and PI. Morphological characteristics of late apoptotic (flattened green

shiny cells showing red dense nuclei) and necrotic cells (red dense spheres lacking green shiny membrane) in

sulfabenzamide treated cells. Similar results were observed for doxorubicin (not shown). Living cells due to

lack of staining with dyes are not detectable in fluorescent visual field (E) but are visible using phase contrast

microscopy (D).


Sulfabenzamide promotes autophagic cell death 47

Figure 3. Caspase-3 activity was increased in cells incubated with sulfabenzamide or doxorubicin. Enzyme

activity in the control, sodium sulfabenzamide, or doxorubicin treated cells were 1.308±0.115, 2.07±0.08,

and 2.496±0.11 nM.h -1 , respectively. Standard curve based on emission (Y axis) of different concentration of

free AFC (nM) is plotted (inset). Diagram of free AFC is plotted in 400 nm excitation and 505 nm emission

wavelengths.

Table 2. Numerical results of flow cytometry analysis. Results are the mean value ± SD for at least three

replicated experiments. Each column named with Qi which includes data related to the quadrant that are Q1

(PI + and Annexin V-FITC - ) or Q1+Q2 (Q2 is the region for PI + and Annexin V-FITC + ) indicated percent value

of necrotic cells, and columns Q4 (PI - and Annexin V-FITC + ) or Q2+Q4 show percent values of apoptotic cells

(see text). Column Q3 (PI - and Annexin V-FITC - ) indicates percent value of normal cells. Column of G1, S

and G2/M represent the percent value of the cells placed in each related phase of cell cycle. NC, Dox and SU

are abbreviations for Negative Control, Doxorubicin and Sulfabenzamide, respectively.

Treated

cells

Q3 Q1 Q2 Q4 Q1+Q2 Q2+Q4 G1

S G2

NC 98.94±0.72 0.90±0.46 0.05±0.04 0.35±0.09 0.96±0.50 0.40±0.11 67.06±5.79 16.39±4.27 16.54±3.20

DOX 97.60±1.12 1.33±0.68 0.015±0.02 1.05±0.90 1.34±0.67 1.06±0.90 30.58±1.14 40.55±4.65 28.86±3.51

SU 98.58±0.56 0.27±0.19 0.09±0.08 0.86±0.57 0.37±0.1 0.96±0.54 48.80±4.28 27.47±4.39 22.70±3.79


48 Raziye MOHAMMADPOUR et al.

Caspase-3 activity was increased in the

sulfabenzamide and doxorubicin treated cells

Using caspase-3 specific substrate, subsequent

releasing of the fluorescent product (AFC) was

measured and average enzymatic velocity was

calculated (three independent experiments) as

16.6±1.42, 26.2±1.3 and 38.3±0.85 (∆F.h -1 , ∆F

means fluorescent intensity alteration) for untreated

cell, sulfabenzamide or doxorubicin treated cells,

respectively. Using the standard curve of free AFC,

enzymatic activity was calculated as 1.308±0.115,

2.07± 0.08 and 2.496± 0.11nM.h -1 , respectively

(Figure 3).

Comparing with untreated cells, caspase-3

activity was increased in drug treated samples.

Elevated activity of caspase-3, which is a sign of

apoptosis induction, is in contrast with the DNA

laddering results and is further discussed below.

Sulfabenzamide did not induce apoptosis but

induced a minimal shift from G1 to S and G2/M

phases of the cell cycle

Using flow cytometric analysis and Annexin-FITC

and PI staining, the incidence of apoptosis and

necrosis in untreated, sulfabenzamide, or

doxorubicin treated cells were quantified (Figure

4A and Table 2).

Congruent with graph interpretation methods

applied in most publications, the sum of cell

populations in regions Q2 (PI + and Annexin V-

FITC + ) and Q4 (PI - and Annexin V-FITC + ) were

considered as early and late apoptotic cells (Hsu et

al., 2006; Tyagi et al., 2006; Dowejko et al., 2009;

LaPensee et al., 2009). In addition, regions Q1 (PI +

and Annexin V-FITC - ) and Q3 (PI - and Annexin V-

FITC - ) indicated necrotic and unscathed

populations, respectively. In some publications, cell

percentages located in Q1 and Q2 (Q2 is the region

for PI + and Annexin V-FITC + ) quarters are

considered as necrotic cells (Davis et al., 2000). In

these studies, Q4 quarter (PI - and Annexin V-

FITC + ) represented the percentage of apoptotic

cells. Therefore, in Table 2 determination of

necrotic cells was performed separately via Q1, as

well as Q1+Q2, and the estimation for apoptotic

cells was carried out as Q2+Q4 as well as Q4, in

order to indicate that the low percentages of

apoptotic and necrotic cells observed was not

influenced by the applied analytical methods.

Flow cytometry is useful for calculating the

percentages of cells existing in various stages of the

cell cycle including G1, S and G2/M. To make a

practical use of this technique, cells were stained

with DAPI, which enters the nucleus and binds to

DNA and emanates fluorescent emission.

Although, no significant change in the normal

pattern of cell distribution throughout the cell cycle

was observed for sulfabenzamide treated cells (18%

shift from G1 to S and G2/M) a considerable

transition (37%) was detected from G1 to S (main

transition) and G2/M in cells incubated with

doxorubicin as positive control (Figure 4B and

Table 2).

Alterations in expression of proapoptotic,

prosurvival and autophagic genes in

sulfabenzamide and doxorubicin treated cells

The changes in expression level of apoptotic, cell

survival and autophagic genes were evaluated using

real time RT-PCR. With respect to the results

shown in Figure 5 as well as its insets it can be seen

that in sulfabenzamide treatments some apoptotic

genes (DFF-45 and DNA-PK ) were over expressed

while some others were down regulated (PARP1,

Bax, Bcl-2 and AIF) or retained their expression

level in a constant condition (DFF-40 and caspase-

3). Moreover, some critical genes which are

important in cell survival pathway were also down-

regulated (AKT1 and AKT2) or over expressed

(PTEN). Alterations in gene expression were

evaluated for some autophagic genes such as

ATG5, p53 and DRAM indicating higher amounts

of the related transcripts in drug treated cells

relative to the untreated ones. In doxorubicin

treated cells some apoptotic genes were focused

and their alterations including over expression of

caspase-3, DNA-PK, DFF-45 and Bax; down

regulation of DFF-40 and constant expression of

AIF and PARP1 were evaluated (Figure 5).


Sulfabenzamide promotes autophagic cell death 49

Figure 4. A) Two dimensional plots of Annexin V-FITC against PI related to the flow cytometric

experiments. Two dimensional diagrams from flow cytometric studies showed that the percentage of

apoptotic cells (cells located in the Q4 area or total cells in Q2 + Q4) and necrosis (cell located in Q1 or in

Q1+Q2) do not show dramatic differences compared with control cells. B) Effects of sodium sulfabenzamide

and doxorubicin on the cell cycle distribution. FL4-A indicates the area under the registered electrical signal

of each stained cell. The curves from left to right relate to G1, S, G2/M phases of the cell cycle in control,

doxorubicin or sodium sulfabenzamide treated samples.


50 Raziye MOHAMMADPOUR et al.

Figure 5. Quantitative real time RT-PCR analysis histograms. Real time RT-PCR for the selected genes for

sulfabenzamide (A) and Doxorubicin (B) treated T-47D cells were determined as described in Methods. The

relative amount of target material was quantified compared to the reference gene using the comparative Ct

(ΔΔCt) method. The statistical significant differences are indicated with * and ** for 0.01


independent of changes in the related mRNA level

(Figures 3 and 5). The increased activity of

caspase-3 was negated via overexpression of DFF-

45. DFF-45 is the natural inhibitor of DFF-40

(CAD) (Liu et al., 1997). In addition, the increased

expression of DFF-45, along with a modest

increase (for sulfabenzamide) and a significant

decrease (for doxorubicin) in DFF-40 expression

(Figure 5), indicated that the increased activity of

caspase-3 could be blocked by the increased

expression ratio of DFF-45/DFF-40. This reduces

the level of active DFF-40 to trigger DNA

fragmentation and appearance of apoptotic

symptoms. Furthermore, it has been reported that

caspases are activated during autophagy in dying

cells and are suppressed for apoptosis induction

(Martin et al., 2004; Yu et al., 2004). Therefore, it

can be deduced that during autophagy, the effects

of activated caspase-3 on their downstream

substrates (like DFF-40) should be suppressed by

special factors (e.g. DFF-45 in T-47D cells) only in

those cellular routes which are involved in the

appearance of apoptosis symptoms (e.g. DNA

fragmentation).

Cell cycle arrest, an important cellular target

affected by sulfabenzamide and doxorubicin, was

analyzed using flow cytometry. Incubation of T-

47D cells with 0.33 µM doxorubicin resulted in a

significant accumulation of cells in S phase, and to

a lesser extent in G2/M phase of the cell cycle

(Figure 4B and Table 2). Thus, doxorubicin exerts

its antiproliferative action mainly through cell cycle

arrest. Induced mitotic catastrophe following

increased activation of cyclinB1/Cdc2 may occur

while cells are delayed, particularly in G2 phase of

the cell cycle (Lindqvist et al., 2007). The induced

G2/M arrest along with down regulation of

cyclinB1 expression confirmed that anticancer

activity of doxorubicin is not via mitotic

catastrophe (Figure 5 and Table 2). In contrast to

doxorubicin, minimal cell cycle arrest in S and

G2/M phases (totally 18%) was observed in T-47D

cells incubated with 10.8 mM sulfabenzamide

(Figure 4B and Table2). Thus, cell cycle arrest

could not be mainly responsible for a 50%

reduction in cell viability in the presence of

sulfabenzamide.

As we know, when apoptosis is blocked or

delayed autophagy triggered and vice versa. These

possibilities are consistent with our findings

regarding lack of apoptosis in drug treated cells and

induction of autophagy. The induced

overexpression of ATG5 supported that autophagy

Sulfabenzamide promotes autophagic cell death 51

triggered in the presence of sulfabenzamide (Figure

5). This could be probably occurred through the

increase in Bax activity working on mitochondrial

membrane to result in activation of caspase-3 for

PARP1 and DNA-PK deactivation and autophagy

induction. It has been reported that induction of

autophagy by PUMA (the p53-inducible BH3-only

protein) depends on Bax/Bak and can be

reproduced by overexpression of Bax (Yee et al.,

2009). Here, in doxorubicin treatment, increase in

Bax activity could be occurred in parallel with the

increment of Bax transcripts affecting on the cells

for caspase-3 activation and changing the cell's

destiny toward autophagy (Figure 5). This notion

could be also supplied in sulfabenzamide treatment

aside from the mild decrease in Bax expression

because activation of the existed Bax molecules in

the cells could be happened for caspase-3 activation

and autophagy induction (Figure 5). It has been

also reported that proteolytic cleavage of PARP1,

performed by caspase-3, produces specific

proteolytic cleavage fragments which are involved

in the cell’s decision to change its fate from

apoptosis toward autophagy (Munoz-Gamez et al.,

2009; Chaitanya et al., 2010). Induction of

autophagic cell death is dependent on DNA-PK

inhibition (Daido et al., 2005). Thus, the increased

activity of caspase-3 could finally deactivate

PARP1 (has a decreased and constant expression

level in sulfabenzamide and doxorubicin

treatments, respectively) and DNA-PK (has an

increased and invariable expression level in

sulfabenzamide and doxorubicin treatments,

respectively) until apoptosis was blocked and

autophagy induced (Figures 3 and 5).

Despite the existence of some controversies

regarding the possible role of autophagy in tumor

progression by promoting cell survival, autophagy

can exist as a backup mechanism promoting

cellular death when other mortality mechanisms are

not functional. Hyperactivation of autophagy above

the threshold point leads to unlimited self-eating of

the cells causing autophagy or type II programmed

cell death (Hoyer-Hansen et al., 2005; Maiuri et al.,

2010). Based on our data, downregulation of AKT1

and AKT2 as well as upregulation of PTEN in

sulfabenzamide treated cells indicated that cell

survival pathways were slowed down (Figure 5). In

addition, down regulation of bcl-2 was happened

along with the induction of autophagy (Figure 5). It

has been reported that targeted silencing of bcl-2

expression (an anti-autophagic gene) in human

breast cancer cells with RNA-interference has


52 Raziye MOHAMMADPOUR et al.

promoted autophagic cell death and thus presents a

therapeutic potential (Akar et al., 2008).

p53 is involved in decreasing cell survival

potency through inactivation of AKT/mTOR

pathways, and stimulation of autophagy via

transactivation of DRAM (Maiuri et al., 2007).

Thus, the observed increased expression level of

DRAM and p53 genes support our conclusion that

the repression of AKT/mTOR survival pathway

(via p53 overexpression) and autophagy induction

(via increased DRAM transcripts) are responsible

for reduced viability of T-47D cells and induction

of death inducing autophagy in the presence of

sulfabenzamide (Figure 5). T -47D cells contain

only a single copy of the p53 missense mutation

(Schafer et al., 2000). It has been reported by

various studies that mutant p53 may lose its natural

antitumor activity (Lim et al., 2009). Interestingly,

in the presence of sulfabenzamide the antitumor

activities of mutant form of p53 should return to the

normal activities of the wild type form to induce

autophagic cell death. This is very similar to the

mechanism of action for some antitumor drugs

reactivating mutant p53 to kill cancerous cells

(Lambert et al., 2009).

Evidently, checking of the protein expression

levels using other supplementary methods such as

western blotting could provide us better documents

to support the presented real time RT-PCR data.

But, in our work, we found that the registered

alterations for the level of RNA transcripts were in

a good consistence with the expected cellular

behaviors when the proteins' expression levels or

their activities were theoretically going to become

changed in parallel with the RNA levels in the

cells. Therefore, regardless of some exceptions,

evaluating RNA transcripts could provide us an

adequate image illustrating the changes in the

proteins’ expression levels in the cells.

Conclusions

In summary, we showed that cell cycle arrest (and

possibly autophagy) may play a role in action of

doxorubicin on T-47D cells. However, the

contribution of apoptosis and cell cycle arrest

antiproliferative effect of sulfabenzamide on T-47D

cells is minimal. These observations are in contrast

to many reports in which the mechanism of action

of sulfonamide derivatives on cancer cells

attributed to the conventional processes of

apoptosis and cell cycle arrest. We believe that

induction of autophagic cell death in T-47D cells is

triggered through p53/DRAM pathway (occurred

along with decreasing of Akt/mTOR pathway) and

this is a reasonable cellular axis to justify our

results.

Abbreviations

AKT: v-akt murine thymoma viral oncogene

homolog, mTOR: Mechanistic Target Of

Rapamycin, PTEN: Phosphatase and Tensin

homolog, DRAM: Damage Regulated Autophagy

Modulator, ATG5:Autophagy related gene 5,

Beclin1: Bcl2 Interacting protein 1, PARP1: Poly

ADP-Ribose Polymerase 1, DFF-40/CAD: DNA

Fragmentation Factor 40/ Caspase-Activated

DNase, Bax: Bcl2-Associated X protein, Bcl-2: B-

Cell Lymphoma 2, AIF: Apoptosis Inducing

Factor, DFF-45/iCAD: DNA Fragmentation

Factor 45/inhibitor of Caspase-Activated DNase,

Cdc2: Cell Division Cycle protein 2, ARF: ADP

Ribosylation Factor, GAPDH: Glyceraldehyde-3-

Phosphate Dehydrogenase, ACD: Autophagic Cell

Death, PCDII: type II Programmed Cell Death,

RPMI: Roswell Park Memorial Institute.

Conflict of interest

The authors declare that they have no competing

interest.

Authors' contributions

SS designed the study and experiments, analyzed

and interpreted data and also prepared the

manuscript. RM carried out the experiments and

participated in data analysis as well as writing the

initial draft of the manuscript. SH and SF

participated in performing the experiments. NS

contributed on giving scientific comments and also

carried out final editing of the manuscript.

Acknowledgements

Iran National Science Foundation (INSF) and

Research Council of University of Tehran have

been gratefully appreciated by the authors because

of their foundational supports for this work.

References

Akar U, Chaves-Reyez A, Barria M, Tari A,

Sanguino A, Kondo Y, et al. Silencing of Bcl-2

expression by small interfering RNA induces

autophagic cell death in MCF-7 breast cancer

cells. Autophagy. 4: 669–679, 2008.

Alberts B, Johnson A, Lewis J, Raff M, Roberts K,

Walter P. Molecular Biology of the Cell.


Garland science Taylor & Francis Group, LLC,

UK, 1115-1130, 2008.

Brunelli E, Pinton G, Bellini P, Minassi A,

Appendino G, Moro L. Flavonoid-induced

autophagy in hormone sensitive breast cancer

cells. Fitoterapia. 80: 327-332, 2009.

Chaitanya GV, Steven AJ, Babu PP. PARP-1

cleavage fragments: signatures of cell-death

proteases in neurodegeneration. Cell Commun

Signal. 8:31-41, 2010.

Daido S, Yamamoto A, Fujiwara K, Sawaya R,

Kondo S, Kondo Y. Inhibition of the DNAdependent

protein kinase catalytic subunit

radiosensitizes malignant glioma cells by

inducing autophagy. Cancer Res. 65: 4368-

4375, 2005.

Davis JW, Melendez K, Salas VM, Lauer FT,

Burchiel SW. 2,3,7,8-Tetrachlorodibenzo-pdioxin

(TCDD) inhibits growth factor

withdrawal-induced apoptosis in the human

mammary epithelial cell line, MCF-10A.

Carcinogenesis. 21: 881-886, 2000.

Dowejko A, Bauer RJ, Muller-Richter UDA,

Reichert TE. The human homolog of the

Drosophila headcase protein slows down cell

division of head and neck cancer cells.

Carcinogenesis. 30: 1678-1685, 2009.

Fukuoka K, Usuda J, Iwamoto Y, Fukumoto H,

Nakamura T, Yoneda T, et al. Mechanisms of

action of the novel sulfonamide anticancer

agents E7070 on cell cycle progression in

human non-small cell lung cancer cells. Inves

New Drugs. 19: 219-227, 2001.

Hoyer-Hansen M, Bastholm L, Mathiasen IS,

Elling F, Jaattela M. Vitamin D analog EB1089

triggers dramatic lysosomal changes and Beclin

1-mediated autophagic cell death. Cell Death

Differ. 12: 1297–1309, 2005.

Hsu CL, Yen GC. Induction of cell apoptosis in

3T3-L1 pre-adipocytes by flavonoids is

associated with their antioxidant activity. Mol

Nutr Food Res. 50: 1072-1079, 2006.

Kondo Y, Kanzawa T, Sawaya R, Kondo S. The

role of autophagy in cancer development and

response to therapy. Nat Rev Mol Cell Biol. 5:

726-734, 2005.

Kondo Y, Kondo S. Autophagy and cancer therapy.

Autophagy. 2: 85-90, 2006.

Sulfabenzamide promotes autophagic cell death 53

Lambert JMR, Gorzov P, Veprintsev DB,

Söderqvist M, Segerbäck, D, Bergman J et al.

PRIMA-1 reactivates mutant p53 by covalent

binding to the core domain. Cancer Cell. 15:

376-388, 2009.

LaPensee EW, Schwemberger SJ, LaPensee CR,

Bahassi E, Afton SE, Ben-Jonathan N. Prolactin

confers resistance against cisplatin in breast

cancer cells by activating glutathione-Stransferase.

Carcinogenesis. 30: 1298-1304,

2009.

Lim LY, Vidnovic N, Ellisen LW, Leong C-O.

Mutant P53 mediates survival of breast cancer

cells. Brit J Cancer. 101: 1606 – 1612, 2009.

Lindqvist A, Van Zon W, Karlsson Rosenthal C,

Wolthuis RMF. Cyclin B1–Cdk1 activation

continues after centrosome separation to control

mitotic progression. PLoS Biol. 5: 1127-1137,

2007.

Liu X, Zou H, Slaughter C, Wang X. DFF, a

heterodimeric protein that functions

downstream of caspase-3 to trigger DNA

fragmentation during apoptosis. Cell. 8: 175-

184, 1997.

Maiuri MC, Galluzzi L, Morselli E, Kepp O, Malik

SA, Kroemer G. Autophagy regulation by p53.

Curr Opin Cell Biol. 22: 181–185, 2010.

Maiuri MC, Zalckvar E, Kimchi A, Kroemer G.

Self-eating and self-killing: crosstalk between

autophagy and apoptosis. Nat Rev Mol Cell

Biol. 8: 741-752, 2007.

Martin DN, Baehrecke E. Caspases function in

autophagic programmed cell death in

Drosophila. Development. 131: 275- 284, 2004.

Mohan R, Banerjee M, Ray A, Manna T, Wilson L,

Owa T et al. Antimitotic sulfonamides inhibit

microtubule assembly dynamics and cancer cell

proliferation. Biochemistry. 45: 5440-5449,

2006.

Munoz-Gamez A, Rodriguez-Vargas JM, Quiles-

Perez R, Aguilar-Quesada R, Martin-Oliva D,

de Murcia G et al. PARP-1 is involved in

autophagy induced by DNA damage.

Autophagy. 5: 61-74, 2009.

Owa T, Yoshino H, Okauchi T, Yoshimatsu K,

Ozawa Y, Sugi NH, et al. Discovery of novel

antitumor sulfonamides targeting G1 phase of


54 Raziye MOHAMMADPOUR et al.

the cell cycle. J Med Chem. 42:3789-3799,

1999.

Ozawa Y, Sugi NH, Nagasu T, Owa T, Watanabe

T, Koyanagi N et al. E7070, a novel

sulphonamide agent with potent antitumour

activity in vitro and in vivo. Eur J Cancer. 37:

2275-2282, 2001.

Schafer JM, Lee ES, O'Regan RM, Yao K, Jordan

VC. Rapid development of tamoxifenstimulated

mutant p53 Breast Tumors (T47D) in

athymic mice. Clin Cancer Res. 6: 4373-4380,

2000.

Supuran CT, Casini A, Scozzafava A. Protease

inhibitors of the sulfonamide type: Anticancer,

antiinfammatory, and antiviral agents. Med Res

Rev. 23: 535-558, 2003.

Supuran CT. Indisulam: an anticancer sulfonamide

in clinical development. Expert Opin Investig

Drugs. 12: 283-287, 2003.

Tyagi A, Singh RP, Agarwal C, Agarwal R.

Silibinin activates p53-caspase2 pathway and

causes caspase-mediated cleavage of Cip1/p21

in apoptosis induction in bladder transitionalcell

papilloma RT4 cells: evidence for a

regulatory loop between p53 and caspase 2.

Carcinogenesis. 27: 2269-2280, 2006.

Valley AW, Balmer CM. Pharmacotherapy: A

Pathophysiologic Approach. Appleton &

Lange, CT. 1957-2012, 1999.

Yee KS, Wilkinson S, James J, Ryan KM, Vousden

KH. PUMA and Bax-induced autophagy

contributes to apoptosis. Cell Death Differ. 16:

1135–1145, 2009.

Yokoi A, Kuromitsu J, Kawai T, Nagas T, Sugi

NH, Yoshimatsu K, et al. Profiling novel

sulfonamide antitumor agents with cell-based

phenotypic screens and array-based gene

expression analysis. Mol Cancer Ther. 1: 275-

286, 2002.

Yokoyama T, Kondo Y, Bogler O, Kondo S. Drug

Resistance in Cancer Cells (Mehta, K. and

Siddik, Z.H., eds). Springer Science+Business

Media, LLC: PA. 53-71, 2009.

Yu L, Lenardo MJ, EH Baehrecke Autophagy and

caspases: a new cell death program. Cell Cycle.

3:1124-1126, 2004.

Yu SW, Wang H, Poitras MF, Coombs C, Bowers

WJ, Federoff HJ et al. Mediation of poly (ADPribose)

polymerase-1-dependent cell death by

apoptosis-inducing factor. Science. 297: 259-63,

2002.

More magazines by this user
Similar magazines