QIAGEN News - Rede Pró-Fauna

redeprofauna.pr.gov.br

QIAGEN News - Rede Pró-Fauna

QIAGENNews

Cover Microsatellite analysis of wild boar populations in

Portugal by multiplex PCR 63

New The first universal kit for quantitative, real-time, multiplex PCR 59

New Faster high-throughput manual and automated PCR

cleanup using the MinElute 96 UF PCR Purification Kit 65

RNAi optimization and control experiments 66

Trust QIAGEN plasmid kits — tailor-made for you! 69

New Simultaneous purification of viral DNA and RNA from serum

and plasma using the BioRobot M48 workstation 72

New Accelerate research and discovery using

comprehensive siRNA sets

Ultra-high–throughput gene silencing for rapid,

74

economical functional genomics studies 76

New Automated purification of bacterial DNA from primary

clinical research samples

Automated purification of anthrax DNA from soil for

79

biodefense applications 82

1027989 10/2004

3October

2004

WWW.QIAGEN.COM


What’s New?

Editor

Douglas J. McGarvey, Ph.D.

Assistant editor

Jason Smith, Ph.D.

Writers

Stephen Archibald, Ph.D.

Finola Geraghty, Ph.D.

Simon Liu, Ph.D.

Douglas J. McGarvey, Ph.D.

Elizabeth Scanlan, Ph.D.

Jason Smith, Ph.D.

Graphics and layout

Marion Jaschke

Production management

Roland Stelzer

news.editor@qiagen.com

■ Alexa Fluor ® labeled, non-silencing, negative control siRNA duplexes allow easy monitoring of

siRNA transfection efficiency and routine RNAi control experiments. Alexa Fluor dyes fluoresce

longer, and are brighter and more photostable than other currently available dyes.

Find out how you can use Alexa Fluor labeled siRNA to optimize your RNAi research at

www.qiagen.com/siRNA .

■ Validated Library siRNA Duplexes, designed against a wide range of common target genes,

have been verified for gene silencing efficiency by QIAGEN scientists. Search the online

database for Validated Library siRNA Duplexes and their corresponding QuantiTect ® Gene

Expression Assays to combine high levels of gene knockdown and accurate quantitative RT-PCR

analysis. Find out more about siRNA proven to provide high knockdown efficiency at

www.qiagen.com/siRNA .

■ Automated RNA purification for array analysis and other high-yield applications just got easier!

The new EZ1 RNA Universal Tissue Kit and MagAttract RNA Universal Tissue M48 Kit provide

automated purification of total RNA from all types of human or animal tissue,

including difficult-to-lyse fatty and fiber-rich tissues, or cultured cells. The universal-tissue system

integrates QIAzol lysis and easy automation on the BioRobot EZ1 workstation, for

1–6 samples, or the BioRobot M48 workstation, for up to 48 samples. Visit

www.qiagen.com/goto/EZ1RNAUniversal or www.qiagen.com/goto/M48Universal to find

out more about automated RNA purification from any type of tissue!

■ DNA purification from large amounts of blood is now quicker and easier using new QIAamp

DNA Blood Midi and Maxi protocols for vacuum processing. The new QIAvac 24 Plus enables

parallel processing of up to 24 samples, starting with up to 2 ml (Midi) or 10 ml (Maxi) human

whole blood. Download the new protocols at www.qiagen.com/goto/QAMidiMaxiVacuum !

■ New application packages for the BioRobot M48 workstation provide specialized protocols for

your research area. Each application package is supplied as a CD-ROM containing automated

protocols for the workstation. Application packages are currently available for a wide range of

clinical research areas, including infectious diseases, genotyping, genetic screening, genomic

research, gene expression, forensics, and pathology. Visit www.qiagen.com/goto/M48 to

discover the optimized protocols for your applications.

■ Easy automated purification of virus DNA and RNA on the BioRobot EZ1 workstation is

coming soon. The EZ1 Virus Mini Kit enables automated, simultaneous purification of viral DNA

and RNA from 1–6 serum and plasma samples, with high yields for highly sensitive detection.

Contact QIAGEN Technical Services for more details.

Cover The European wild boar (Sus scrofa) was declared a protected species in Portugal at

the end of the 1960s, mainly as a result of African swine fever and overhunting. Since then

populations have recovered, and the wild boar is common and widespread throughout

Portugal. Coamplification of several genomic markers using the QIAGEN Multiplex PCR Kit

allows researchers to study genetic variations and diversity in wild boar populations. See

page 63 for more information.

58 www.qiagen.com QIAGEN News 2004 Issue 3


New

The first universal kit for quantitative, real-time, multiplex PCR

The QuantiTect ® Multiplex PCR Kit enables accurate real-time quantification of multiple cDNA or genomic DNA targets in a

pre-optimized and easy-to-handle format. Sequence-specific probes compatible with the kit include TaqMan ® probes and

dual-labeled probes from Operon Biotechnologies. The kit also provides a complete solution for quantitative, real-time,

duplex PCR when used together with QuantiTect Gene Expression Assays for target and housekeeping genes.

Benefits of the QuantiTect Multiplex PCR Kit:

■ No optimization required — reagents and protocols are pre-optimized

■ High sensitivity — detection of as few as 10 copies of each target sequence

■ Reliable quantification — target and reference genes are quantified in the same reaction

■ Easy handling — ready-to-use master mix is compatible with a wide range of

real-time block cyclers

Accurate quantification with minimal handling

By using state-of-the-art technology to amplify several targets in the same reaction, the kit avoids the

variability in setting up separate reactions and provides accurate quantification of target and

reference genes. In addition, pipetting tasks are minimized, valuable samples and reagents are

conserved, and throughput is increased.

Pre-optimized reaction conditions

In contrast to current methods for quantitative, real-time, multiplex PCR, the kit eliminates the need for

optimization of the concentrations of primers, Mg2+ , and Taq DNA polymerase. The master mix

supplied with the kit is specifically pre-optimized for quantitative, real-time, multiplex PCR, unlike

master mixes supplied with quantitative, real-time, non-multiplex PCR kits. The pre-optimized master

mix ensures that the PCR products in a multiplex reaction are amplified with the same efficiency and

sensitivity as the PCR products in the corresponding single amplification reactions (Figure 1).

High specificity and sensitivity is achieved through pre-optimization of the following components

of the master mix:

■ QuantiTect Multiplex PCR Buffer: This unique buffer was specifically developed to meet the

demands of quantitative, real-time, multiplex PCR using sequence-specific probes. An optimized

combination of KCl and (NH4) 2SO4 promotes a high ratio of specific to nonspecific primer

binding during each annealing step. In addition, synthetic factor MP, which was developed for

multiplex PCR, increases the local concentration of primers at the template and stabilizes

specifically bound primers, allowing efficient primer annealing and extension. These buffer

components therefore prevent different amplification reactions from affecting each other.

■ HotStarTaq ® DNA Polymerase: Since this polymerase requires incubation at 95ºC for activation,

misprimed products and primer–dimers, which can compete for reactants, are not formed

during reaction setup. Reactions can therefore be set up at room temperature without any risk

of generating nonspecific artifacts.

QIAGEN News 2004 Issue 3 www.qiagen.com 59


Superior Performance in Quantitative, Real-Time, Multiplex PCR

A Duplex PCR, QIAGEN

B

Single PCR, QIAGEN

C Duplex PCR, QIAGEN

D

Single PCR, QIAGEN

Duplex PCR, Supplier AII

Single PCR, Supplier AII

Duplex PCR, Supplier AII

Single PCR, Supplier AII

Figure 1 Two sequences were amplified either together in duplex PCR or in single PCRs on the ABI PRISM ® 7700.

The templates were genomic DNA from the Ramos cell line carrying a t(8;14) translocation (template amounts corresponding

to about 50,000, 5000, 500, 50, or 10 copies of the target region), and 107 copies of a plasmid containing human

GAPDH cDNA sequence. TaqMan probes labeled with FAM or HEX reporter dye plus BHQ quencher were used.

A Duplex or single PCRs using the QuantiTect Multiplex PCR Kit; t(8;14) translocation sequence detected. B Duplex or

single PCRs using reagents from Supplier AII; t(8;14) translocation sequence detected. C Duplex or single PCRs using the

QuantiTect Multiplex PCR Kit; GAPDH sequence detected. D Duplex or single PCRs using reagents from Supplier AII;

GAPDH sequence detected.

60 www.qiagen.com QIAGEN News 2004 Issue 3


Ready-to-run protocols

The handbook supplied with the kit provides tested protocols for various real-time cyclers as well

as valuable information on assay design, reporter dye selection, and data analysis (Table 1).

The protocols provide universal conditions for reaction setup and dependable cycling conditions

to ensure accurate results the first time.

Table 1. Comparable Threshold Cycle (C T) Values Between Triplex PCR and Corresponding Single

Amplification PCRs

Detection of

t(8;14) translocation GAPDH cDNA

NFκB cDNA sequence

(see first column

sequence (20 copies) sequence (106 copies) for copy number)

Triplex PCR with 105 copies of NFκB 34.31 20.37 21.92

Corresponding single PCRs 34.07 20.54 21.83

Triplex PCR with 104 copies of NFκB 34.61 20.62 25.03

Corresponding single PCRs 34.00 20.46 25.19

Triplex PCR with 103 copies of NFκB 35.17 19.94 28.38

Corresponding single PCRs 34.43 20.50 28.65

Three templates were coamplified in a triplex PCR: 10 6 copies of a linearized plasmid containing human GAPDH cDNA

sequence; 140 pg of genomic DNA from the Ramos cell line carrying a t(8;14) translocation (approximately 20 copies of

the target sequence); and 10 5 , 10 4 , or 10 3 copies of a plasmid containing human NFκB cDNA sequence. This simulates

detection of high, low, and variable amounts of target genes in a single sample. These templates were also amplified in

single PCRs. TaqMan probes labeled with FAM, HEX, or Bodipy ® TMR reporter dye plus BHQ quencher were used.

Reactions were performed using the ABI PRISM 7900.

New assays for quantitative, real-time, multiplex PCR

The kit is compatible with the expanding range of QuantiTect Gene Expression Assays, including

the new assays for housekeeping genes. Since the new housekeeping gene assays use a distinct

reporter dye, they can be combined in duplex PCR with other QuantiTect Assays that use FAM

labeled QuantiProbes. The combination of QuantiTect Assays with the QuantiTect Multiplex PCR Kit

provides a complete solution for accurate quantitative real-time duplex PCR of target and reference

genes (Figure 2).

High Performance Using QuantiTect Gene Expression Assays

FAM Detection (EGR1) Yakima Yellow Detection (PGK)

Figure 2 Variable amounts of human EGR1 sequence (50,

5, or 0.5 ng of cDNA from the 293 human cell line) mixed

with constant amounts of human PGK sequence (10 6 copies

of a synthetic nucleic acid containing the target sequence)

were amplified. Duplex PCR and single PCRs of each

template mixture were performed in duplicate using the

QuantiTect Multiplex PCR Kit in combination with the

QuantiTect Gene Expression Assay for EGR1, which uses a

FAM labeled QuantiProbe, and for PGK, which uses a

Yakima Yellow labeled QuantiProbe. The amplification plots

of the duplex and single reactions are overlaid to

demonstrate identical CT values between the 2 types of PCR.

Reactions were performed using the ABI PRISM 7900.

QIAGEN News 2004 Issue 3 www.qiagen.com 61


Ordering Information

Compatibility with many real-time cyclers

The kit is compatible with most real-time cyclers that use a 96- or

384-well block (Table 2). The master mix contains ROX dye, enabling

the kit to be used with real-time cyclers that require ROX dye as passive

reference dye, such as ABI Sequence Detection Systems. For other realtime

cyclers or for assays that use probes labeled with Texas Red ® , ROX,

or other equivalent dye, a kit containing master mix without ROX dye is

also available.

Table 2. Real-Time Cyclers Compatible with the QuantiTect Multiplex

PCR Kit

Conclusion

Compatible with master mix containing

Real-time cycler ROX dye No ROX dye

ABI PRISM 7900 ✔ –

ABI PRISM 7700* ✔ –

ABI PRISM 7000 ✔ –

iCycler † ✔ ✔

Rotor-Gene 3000 † ✔ ✔

Mx4000 ®† ✔ ✔

Mx3000P † ✔ ✔

DNA Engine Opticon ® 2 ‡ ✔ ✔

Smart Cycler ® II † ✔ ✔

* Certain limitations with triplex assays due to the instrument itself.

† Duplex and triplex assays possible with master mix containing ROX dye; 4-plex assays

also possible with master mix containing no ROX dye.

‡ Only duplex assays possible with this instrument.

Using the QuantiTect Multiplex PCR Kit, accurate results in quantitative,

real-time, multiplex PCR can be achieved with the minimum of effort.

Product Contents Cat. no.

QuantiTect Multiplex For 200 x 50 µl reactions: 3 x 1.7 ml QuantiTect 204543

PCR Kit (200) Multiplex PCR Master Mix, RNase-Free Water

QuantiTect Multiplex For 1000 x 50 µl reactions: 25 ml QuantiTect 204545

PCR Kit (1000) Multiplex PCR Master Mix, RNase-Free Water

The supplied master mix contains ROX dye. A QuantiTect Multiplex PCR Kit without ROX dye in the master mix is available; please inquire.

Visit www.qiagen.com/goto/qmpcr to get quantitative, multiplex PCR without the

pre-optimization!

62 www.qiagen.com QIAGEN News 2004 Issue 3


Cover

Microsatellite analysis of wild boar populations in Portugal by

multiplex PCR

Luís Souto*, E. Ferreira, and C. Fonsecat †

*Center for Cell Biology (CBC) † Centre for Environmental and Marine Studies (CESAM) Department of Biology,

Universidade de Aveiro, Aveiro, Portugal

Microsatellite analysis is a widely used tool in the study of genetic variation within populations. Our laboratory is currently

undertaking a genetic study of European wild boar (Sus scrofa) populations in Portugal. Using the QIAGEN ® Multiplex PCR

Kit we were able, without any reaction optimization, to successfully detect multiple genomic markers from blood samples

taken from wild boar. This is in contrast to a “homemade” method, which failed to produce results in multiplex reactions.

Materials and methods

DNA was extracted from 34 wild boar blood samples collected in

several locations throughout Portugal. Four dinucleotide microsatellite

STR markers — SW1701, SW2535, SW828, and SW1517— were

chosen from a panel of pig genome markers (US Pig Genome Mapping

Coordination Program). PCR primers for the respective loci were synthesized

and fluorescently labeled with FAM (SW1701 and SW2535) or

HEX (SW828 and SW1517). The functionality of primers was

confirmed in singleplex PCRs using DNA isolated from wild boar blood

samples as template. Singleplex and “homemade” multiplex reactions

contained 0.2 µM each primer, 200 µM each dNTP, 1.5 mM MgCl2, 1 unit Taq DNA polymerase, and 5 µl template DNA solution. Cycling

conditions were denaturation for 45 seconds at 94°C, annealing for

60 seconds at 58°C, and extension for 60 seconds at 72°C. PCRs were

performed using 26 or 30 cycles.

Multiplex PCRs performed using the QIAGEN Multiplex PCR Kit

contained 1x QIAGEN Multiplex Master Mix, 0.2 µM each primer, and

10 µl template DNA solution. Cycling conditions were as recommended

in the protocol for amplification of microsatellite loci in the QIAGEN

Multiplex PCR Handbook. After an initial activation of HotStarTaq ® DNA

Polymerase by incubation for 15 minutes at 95°C, cycling conditions

were denaturation for 45 seconds at 94°C, annealing for 90 seconds at

58°C, and extension for 60 seconds at 72°C. After 26 or 32 cycles, a

final extension step of 30 minutes at 60°C was performed.

Amplicons were analyzed using an ABI PRISM ® 310 sequence analyzer.

A 1 µl aliquot of each PCR was loaded together with 30 µl deionized

formamide and 0.5 µl ROX-labeled size standards. Electropherograms

were analyzed using ABI PRISM GeneScan ® analysis software.

Efficient Multiplex PCR Amplification of

Genomic Markers

Figure 1 Electropherograms of multiplex PCR of sample

J-134 carried out using A QIAGEN Multiplex PCR Kit or

B “homemade” method. Peaks from the respective locus

are labeled. Blue peaks are FAM-labeled amplicons and

green peaks are HEX-labeled amplicons. Red peaks are

ROX-labeled size standards.

QIAGEN News 2004 Issue 3 www.qiagen.com 63

A

B


Ordering Information

Table 1. Selected Results of Multiplex PCR from the Respective Loci of Wild Boar and Domestic Pig

Blood Samples

Size of amplicons (base pairs)

Sample reference Geographical SW1701 SW2535 SW1517 SW828

number origin (FAM label) (FAM label) (HEX label) (HEX label)

J-6 Mértola 90, 114 186, 186 144, 144 211, 211

J-17 Góis 114, 122 176, 190 134, 134 217, 221

J-25 Ansião 122, 126 176, 186 134, 138 221, 221

J-51 Alfândega da Fé 108, 124 186, 186 134, 142 211, 221

J-57 Carrazeda de Ansiáes 108, 124 186, 190 142, 148 211, 221

J-115 Coruche 108, 114 192, 212 134, 134 211, 221

J-129 Idanha-a-Nova 110, 122 186, 186 136, 136 221, 221

J-134 Silves 114, 120 186, 186 134, 144 211, 221

J-160 Domestic pig 106, 126 188, 188 116, 144 221, 221

Results

Using the primers designed for this study, all 4 markers could be detected in singleplex

experiments. However, in a typical multiplex experiment using the “homemade” method described

above, only single markers could be detected with low sensitivity. In contrast, multiplex PCR using

the QIAGEN Multiplex PCR Kit typically enabled efficient amplification and accurate sizing of both

alleles from all 4 markers (see Table 1, Figure 1). The efficiency of the amplification is reflected in

the high signal intensities obtained for amplicons from all 4 loci (Figure 1A).

The presence of stutter peaks is not unusual in the analysis of dinucleotide repeats, and their

presence did not affect correct genetic typing of samples, as all allele sizes were in agreement with

those obtained in singleplex control experiments.

Conclusions

■ The design of multiplex PCR assays used for analysis of several markers usually requires

extensive optimization. Using the QIAGEN Multiplex PCR Kit, satisfactory results were obtained

using the supplied protocol with no optimization.

■ This robustness increases the speed and convenience of genetic typing, especially where

multiple markers or high numbers of samples are being analyzed.

Product Contents Cat. no.

QIAGEN Multiplex For 100 x 50 µl multiplex PCR reactions: 206143

PCR Kit (100)* 2x QIAGEN Multiplex PCR Master Mix

(providing a final concentration of 3 mM MgCl 2,

3 x 0.85 ml), 5x Q-Solution (1 x 2.0 ml),

RNase-free water (2 x 1.7 ml)

* Larger size available; please inquire.

64 www.qiagen.com QIAGEN News 2004 Issue 3


Coming Soon

Faster high-throughput manual and automated PCR cleanup using

the MinElute ® 96 UF PCR Purification Kit

The MinElute 96 UF PCR Purification Kit provides fast, high-throughput PCR purification, in a simple manual or fully

automated procedure (see flowchart). An optimized ultrafiltration membrane delivers fast flow rates and high, reproducible

recovery, even of smaller DNA fragments (Figure 1). The advanced plates in the kit are designed to allow final elution

volumes as low as 20 µl in the manual procedure, delivering highly concentrated, purified DNA in just 13 minutes. A purple

O-ring in each well allows researchers to see eluates more easily and pipet more accurately.

The MinElute 96 UF PCR Purification Kit offers:

■ Minimal elution volumes — high DNA concentrations in as little as 20 µl

■ Fast, cost-effective procedure — well suited for high-throughput projects

■ Fully automatable processing — walkaway processing on BioRobot ®

workstations and other SBS-compatible automated systems (Figure 2)

■ High, reproducible recovery — for fragments >100 bp

Efficient, high-throughput PCR cleanup

PCR products are loaded into the wells of ultrafiltration plates and a

vacuum is applied. While small molecules such as primers, salts, and

unincorporated nucleotides run through the membrane, PCR products

≥100 bp are retained. Purified PCR products are eluted directly from the

surface of the membrane in small volumes (as little as 20 µl in the manual

procedure), leading to highly concentrated eluates. Purified DNA

fragments are ready for direct use in all applications, including sequencing,

microarray analysis, ligation, and restriction digestion.

MinElute 96 UF PCR Purification Plates conform to SBS (Society for

Biomolecular Screening) standards and offer two convenient handling

options. Plates can be processed manually using a commercial vacuum

manifold (e.g., QIAvac Multiwell, cat. no. 9014579) or on the BioRobot

3000 or 8000 or other automated workstations (Figure 2).

Walkaway Processing

Ordering Information

Product Contents Cat. no.

MinElute 96 UF PCR 4 MinElute 96 UF PCR Purification Plates 28051

Purification Kit (4)*

* Larger kit sizes available: please inquire.

Figure 2 Automated processing on the BioRobot 3000

workstation.

Efficient Purification of Concentrated DNA

m Q M III M Q M III M m

– 500 bp

– 100 bp

Figure 1 DNA fragments (100 bp and 500 bp) were

purified using either MinElute 96 UF PCR Purification Plates

(Q) or ultrafiltration-based kits from other suppliers (Supplier

MIII and Supplier M). Aliquots (5 µl) of the eluate were

analyzed by agarose-gel electrophoresis. m: markers.

QIAGEN News 2004 Issue 3 www.qiagen.com 65


RNAi optimization and control experiments

Christian Korfhage, Peter Hahn, Andreas Meier, Gesa Niemann, Wolfgang Bielke, and Dirk Löffert

QIAGEN GmbH, Hilden, Germany

Important factors in the success of RNAi studies are optimization of transfection and performance of suitable control

experiments that prevent artifactual effects being wrongly interpreted. In this study, we demonstrate that the RNAi

Human/Mouse Control Kit, used with QuantiTect ® Gene Expression Assays for downstream analysis, allows convenient

siRNA transfection optimization and control experiments in both human and mouse cells.

Alexa Fluor Label Allows

Easy Monitoring of Transfection

Figure 1 HeLa S3 cells were transfected with Alexa Fluor

488 labeled, non-silencing control siRNA using RNAiFect

Reagent. Transfection efficiency was determined using

fluorescence microscopy 24 hours after transfection.

QuantiTect Gene Expression Assays Provide

Highly Sensitive Quantitative RT-PCR Results

6

5

4

3

2

1

0

HeLa S3

NIH/3T3

1 10

ng total RNA

100

Figure 2 Total RNA from untransfected HeLa S3 and

NIH/3T3 cells was used in quantitative RT-PCR analysis

with the human and mouse MAPK1 Gene Expression

Assays. Standard curves show CT values obtained from

RNA dilutions normalized against CT values obtained using

100 ng total RNA.

Convenient optimization of transfection and positivecontrol

experiments

The RNAi Human/Mouse Control Kit includes a non-silencing Alexa Fluor ®

488 labeled siRNA for transfection optimization. The long duration of Alexa

Fluor fluorescence, and its intensity in cells transfected with low siRNA concentrations,

mean that it is very useful for optimization of RNAi experiments.

A validated siRNA targeted against a sequence common to both the

human and mouse MAPK1 gene is also provided in the kit. The protein

kinase MAPK1 (also called Erk2 and MAPK2) is highly expressed in a

wide variety of human and mouse cell types. The MAPK1 siRNA almost

eliminates MAPK1 expression in human and mouse cells making it a

highly suitable positive control. RNAiFect Transfection Reagent provides

high siRNA transfection efficiency and is also included in the control kit.

Accurate analysis of knockdown efficiency

Quantitative, real-time RT-PCR is frequently used to analyze the results of

gene silencing experiments. QuantiTect Gene Expression Assays are an

expanding range of functionally validated primer–probe sets that are

ready to use for optimal results in quantitative, real-time RT-PCR on the

majority of real-time cyclers. The assays comprise two gene-specific

primers and a dual-labeled QuantiProbe in a 10x Assay Mix. Optimal

results are guaranteed when QuantiTect Gene Expression Assays are

used in combination with QuantiTect Probe Kits. All QuantiTect Assays

can be used for one-step RT-PCR using the QuantiTect Probe RT-PCR Kit,

or two-step RT-PCR using the QuantiTect Probe PCR Kit. The assays and

kits have been optimized and validated to ensure high PCR efficiency

and accurate quantification of as few as 10 copies of template. Primers

are designed to cross exon-exon boundaries, so that only RNA

sequences are amplified and detected.

Materials and methods

Non-silencing and positive-control siRNA duplexes from the RNAi

Human/Mouse Control Kit were transfected into HeLa S3, HEK 293, or

NIH/3T3 cells. Transfection efficiency of the Alexa Fluor labeled

66 www.qiagen.com QIAGEN News 2004 Issue 3


non-silencing siRNA was examined by fluorescence microscopy. RNA

was purified using the RNeasy ® Mini Kit. MAPK1 knockdown using the

positive control siRNA was determined using MAPK1-specific QuantiTect

Gene Expression Assays. The QuantiTect Hs_MAPK1 Assay and the

QuantiTect Mm_Mapk1 Assay, for human and mouse respectively, were

used with the QuantiTect Probe RT-PCR Kit for one-step RT-PCR or with

Omniscript ® Reverse Transcriptase and the QuantiTect Probe PCR Kit for

two-step RT-PCR.

Results

Transfection of Alexa Fluor 488 labeled, non-silencing siRNA allowed

determination of transfection efficiency by fluorescence microscopy

(Figure 1). The transfection efficiency in HeLa S3 cells was close to

100%. The Alexa Fluor 488 fluorophore is brighter and more

photostable than other fluorescent labels. It is tolerant of pH changes

within a wide range, making it very stable in living cells.

The QuantiTect Assays for MAPK1 were used to generate standard

curves using dilutions of RNA purified from untransfected HeLa S3 and

NIH/3T3 cells respectively (Figure 2). Linear standard curves show that

QuantiTect Gene Expression Assays are highly sensitive and accurate, as

∆CT values correlate closely to RNA amount used.

Human and mouse cell lines transfected with MAPK1 siRNA were

analyzed for gene silencing efficiency using the QuantiTect Assays for

MAPK1. One-step or two-step RT-PCR was carried out on either the ABI

GeneAmp ® 5700 or ABI PRISM ® 7700 real-time cycler (Figure 3). High

levels of MAPK1 mRNA knockdown were achieved, showing that the

MAPK1 siRNA is a highly suitable positive control for gene silencing in

both human and mouse cells. QuantiTect Gene Expression Assays

provided accurate results for both one-step and two-step RT-PCR, and with

both real-time cyclers. This demonstrates the flexibility of QuantiTect

Gene Expression Assays for use with different real-time cyclers and

reaction setups.

Conclusions

■ The RNAi Human/Mouse Control Kit and QuantiTect Gene

Expression Assays for human and mouse MAPK1 can be used as

integrated tools for gene silencing and downstream RT-PCR analysis.

These tools can be routinely used as controls for both the transfection

and downstream analysis stages of RNAi experiments.

■ Standard curves generated using RNA dilutions show that QuantiTect

Gene Expression Assays are highly accurate and sensitive.

■ QuantiTect Gene Expression Assays provided optimal results for both

one- and two-step RT-PCR on different real-time cyclers.

Quantitative Real-Time RT-PCR Shows

MAPK1 Knockdown

QIAGEN News 2004 Issue 3 www.qiagen.com 67

A

Relative MAPK1 mRNA expression (%)

B

Relative MAPK1 mRNA expression (%)

120

100

80

60

40

20

0

120

100

80

60

40

20

0

HeLa S3

Control

One-step, ABI PRISM 7700

Two-step, ABI PRISM 7700

Two-step, GeneAmp 5700

NIH/3T3

HEK 293

Figure 3 A Human cell lines HeLa S3 and HEK 293 and

B mouse cell line NIH/3T3 cells were transfected with nonsilencing

control siRNA or siRNA targeted against MAPK1

mRNA using RNAiFect Reagent. After 48 hours, one-step

or two-step quantitative, real-time RT-PCR analysis was

carried out using the appropriate QuantiTect Gene

Expression Assay and the indicated real-time cycler.


Ordering Information

Product Contents Cat. no.

RNAi Human/Mouse RNAiFect Reagent, siRNA Suspension Buffer, Buffer EC-R, 301698

Control Kit MAPK1 siRNA, non-silencing labeled control siRNA

QuantiTect Gene For 100 x 50 µl reactions (for use in a 96-well plate or Inquire

Expression Assays (100) single tubes) or 250 x 20 µl reactions (for use in a

384-well plate or single capillaries): 0.5 ml 10x QuantiTect

Assay Mix (dyes available: FAM)

QuantiTect Hs_MAPK1 For 100 x 50 µl reactions (for use in a 96-well plate or 241400

Assay (100) single tubes) or 250 x 20 µl reactions ( for use in a

384-well plate or single capillaries): 0.5 ml 10x QuantiTect

Assay Mix (dyes available: FAM)

QuantiTect Mm_Mapk1 For 100 x 50 µl reactions (for use in a 96-well plate or 241401

Assay (100) single tubes) or 250 x 20 µl reactions ( for use in a

384-well plate or single capillaries): 0.5 ml 10x QuantiTect

Assay Mix (dyes available: FAM)

QuantiTect Probe For 200 x 50 µl reactions: 3 x 1.7 ml QuantiTect Probe 204443

RT-PCR Kit (200) RT-PCR Master Mix (providing a final concentration of

4 mM MgCl2), 100 µl QuantiTect RT Mix, 2 x 2.0 ml

RNase-free water

QuantiTect Probe For 200 x 50 µl reactions: 3 x 1.7 ml QuantiTect Probe 204343

PCR Kit (200) PCR Master Mix (providing a final concentration of

4 mM MgCl2), 2 x 2.0 ml RNase-free water

RNeasy Mini Kit (50)*

Related products

50 RNeasy Mini Spin Columns, Collection Tubes

(1.5 ml and 2 ml), RNase-free Reagents and Buffers

74104

Neg. Control siRNA, 5 nmol Alexa Fluor 488 labeled duplex siRNA with no 1022563

Alexa Fluor 488 significant homology to any known mammalian gene;

for use as a non-silencing control in RNAi experiments

Neg. Control siRNA, 5 nmol Alexa Fluor 546 labeled duplex siRNA with no 1027098

Alexa Fluor 546 significant homology to any known mammalian gene;

for use as a non-silencing control in RNAi experiments

Neg. Control siRNA, 5 nmol Alexa Fluor 555 labeled duplex siRNA with no 1027099

Alexa Fluor 555 significant homology to any known mammalian gene;

for use as a non-silencing control in RNAi experiments

Neg. Control siRNA, 5 nmol Alexa Fluor 647 labeled duplex siRNA with no 1027100

Alexa Fluor 647 significant homology to any known mammalian gene;

for use as a non-silencing control in RNAi experiments

HPP Grade siRNA siRNA purified to >90% t available with a range of

modifications including Alexa Fluor dyes


Tag·100 Antibody, 100 µg mouse anti-Tag·100 antibody that recognizes 34680

BSA-free (100 µg) endogenous mammalian MAPK1

RNAiFect Transfection RNAiFect Reagent and buffer, for up to 170 transfections 301605

Reagent (1 ml) ‡ in 24-well plates; up to 500 transfections in 96-well plates

* RNeasy kits are also available on micro, midi, maxi, and 96-well formats; please inquire.

† Available in guaranteed yields of 20 and 40 nmol. Also available in 96-well plates; please inquire.

‡ Larger sizes available; please inquire.

68 www.qiagen.com QIAGEN News 2004 Issue 3


Trust QIAGEN ® plasmid kits — tailor-made for you!

Since not all your applications are the same, QIAGEN offers a range of plasmid kits designed specifically for your needs:

from mini- to gigapreps and from convenient manual formats and walkaway automated procedures to contract plasmid

production services.

Using QIAGEN’s new application-based kit classification system and

selection guide, it is now easier than ever to select the optimal plasmid

kit for your specific application. Optimize your plasmid preps using the

tear-out selection guide accompanying this article or by visiting our

online selection guide at www.qiagen.com/goto/plasmid . QIAGEN’s

extensive range of plasmid kits has been organized into 4 application

grades:

■ Sequencing Grade

■ Molecular Biology Grade

■ Transfection Grade

■ Advanced Transfection Grade

Sequencing Grade

Sequencing Grade DNA is suitable for a range of DNA screening

applications including sequencing, PCR, restriction analysis, and

transformation. High-throughput sequencing and screening applications

require fast, streamlined, and economic DNA purification. QIAGEN

produces a number of reliable plasmid kits — automatable on BioRobot ®

systems — to suit your high-throughput needs. These kits include

cost-effective DirectPrep ® 96 Kits for standard plasmid purification and

R.E.A.L. ® Prep 96 Kits for standard plasmid and BAC purification.

Molecular Biology Grade

Molecular Biology Grade DNA is suitable for low- or medium-throughput

sequencing projects and more demanding high-throughput applications.

DNA prepared using QIAprep ® Kits is suitable for all basic molecular

biology applications, including cloning, in vitro transcription/translation,

and transfection of robust cells. Plasmid DNA is highly purified by

selective adsorption to a silica membrane. QIAprep Kits, which are

recommended by many core sequencing facilities, are available in a

range of formats from spin columns to 96-well manual and

BioRobot automated formats for low-, medium-, and high-throughput

requirements.

Sequencing Grade DNA

GCCTGCA GGT CGACTCTAGA GGATCCCCGGGTACCGAGCT

CGAATTCGTA ATCATGTCAT A GCTGTTTCCTGTGTGAAAT

TGTTATCC GCTCACAATTCCACACAACATA

CGAGCCGGAAGCATAA

AGTG

10 20 30 40 50 60 70 80 90 100 110 120

GTAA AGCCTGGGG

TGCC TAATGAGTGAGCTA

ACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAG

TCGGG AAACCTGTCGTGCCAGCTGCATTAAT

GAATCGGCCAACG

CGCGGG

140 150 160 170 180 190 200 210 220 230 240

GG AG AGGCGGTTTGCGTATTGGGCGCTC

TTCCGCTTCC

TCGCTCACTG

ACTCGCTGCGCTC

GGTCGTTCGGCTGCGGCG

AGCGGTATCAGC

TCACTCAAAGGCGGTAATACGGTTATCCA

260 270 280 290 300 310 320 330 340 350 360

CAGAATCAGGGGATAACGCAG

GAA AGAACATGTGAGCAA

AAGGCCAGCAA

AAGGCCAGGAACC

GTAAAAAG GCCGCGTTGCTGG

CGTTTT TCCATAGGCTCCGCCC

CCC TGACGAGCATCA

CA

380 390 400 410 420 430 440 450 460 470 480 490

AAAAATCGA CGCTCAAGTC AGAGGTGGCGAAACC

CGACA GG ACTATAAAGATACCAGGCGTTTCCCCCT

GGAAGCTCCC TCGTGCGCTC TCCTGTTCCGACCCTGCCGCTTACCGG

ATACC

TGTCCGC

500 510 520 530 540 550 560 570 580 590 600 610

CCTT TCTCCCTTCGGGAAGCGT

GG CGCTTTCT CATAGCTCAC GCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGT

GTGCACGAACCCCCCG

TTCA GCCCGACCGC TGCGCC T

630 640 650 660 670 680 690 700 710 720 730 740

TTATCCGGTAACTA

TCGTCTT GAGTCC

AACCCGGTAAGACACGA

CTTATCGCCACTGG

CAGCAG CCACTGG TAACAGGATTAGC

AGAGCGAGGTATGTA

GGCGG TGCTACAGAG TTCTTG

750 760 770 780 790 800 810 820 830 840 850 860

Figure 1 Typical fluorescent capillary sequencing result

obtained with plasmid DNA purified using the DirectPrep

96 BioRobot Kit and the BioRobot 8000. Plasmid pUC19

was sequenced using BigDye terminator v. 3.1 chemistry

in a cycle sequencing reaction on an ABI PRISM ® 3700

DNA Analyzer. The sequencing reaction was purified using

the DyeEx ® 96 Kit (QIAGEN, cat. no. 63181).

Molecular Biology Grade DNA

Figure 2 Restriction analysis of pBluescript ® DNA purified

with the QIAprep Spin Miniprep Kit. Digestion with the

indicated enzymes (1–5 units) was carried out on 1 µg

plasmid DNA. M: lambda–HindIII.

QIAGEN News 2004 Issue 3 www.qiagen.com 69

M

Undigested

AluI

BamHI

BglI

EcoRI

HindIII

HinfI

HpaII

KpnI

MboII

PstI

PvuII

RsaI

SmaI

TaqI

XbaI

M


Transfection Grade DNA

Figure 3 Expression of green fluorescent protein (GFP) in

HeLa cells. Cells were cotransfected in 6-well plates with

β-galactosidase and GFP reporter plasmids using PolyFect ®

Transfection Reagent and the HeLa cell protocol. Expression

was visualized by fluorescence microscopy 2 days posttransfection.

Advanced Transfection Grade DNA

Figure 4 Cortical neurons 24 hours after transfection with a

plasmid encoding GFP. Cells were stained with anti-MAP2

primary antibodies and Cy ® 3-labeled secondary antibodies

and the images superimposed. Cells were transfected in a

96-well format using 0.3 µg of plasmid DNA and 2 µl of

TransMessenger ® Reagent per well.

Transfection Grade

Although it is possible to use Molecular Biology Grade DNA to transfect

robust cells, for reliable, consistent results with most cell types, we

recommend using Transfection Grade DNA. QIAGEN anion-exchange

chromatography delivers Transfection Grade DNA with significantly

lower levels of endotoxins (i.e., bacterial lipopolysaccharides) and other

contaminants than Molecular Biology Grade DNA. Transfection Grade

DNA is suitable for the majority of demanding applications (e.g.,

transfection and in vitro transcription). All DNA scales are included in the

trusted QIAGEN Plasmid Kit range, from mini- to gigapreps. For even

faster purification the HiSpeed ® range of kits enable midi- and maxi-scale

plasmid DNA preps without centrifugation. For medium-throughput and

automatable high-throughput applications, QIAGEN offers the QIAwell ®

Ultra miniprep range of kits.

Advanced Transfection Grade

Advanced Transfection Grade DNA is suited for the most demanding

applications (e.g., transfection into sensitive or primary cells,

microinjection, vector-based gene silencing, in vivo gene transfer, and

research on gene therapy or vaccination). Plasmid DNA is purified using

anion-exchange chromatography to the highest possible standard. An

additional, integrated, incubation step removes bacterial endotoxins,

which can interfere with gene transfer experiments. QIAGEN EndoFree ®

Kits provide Advanced Transfection Grade DNA in maxi, mega, and

giga formats. The Ultrapure 100 Column and QIAGEN Plasmid Prep

Service provide even larger quantities of plasmid DNA. Based on the

same QIAGEN anion-exchange technology, pAlliance manufacturing

service (www.pAlliance.com) provides CGMP plasmid manufacturing for

clinical applications in gene therapy and genetic vaccination.

QIAGEN’s plasmid DNA grading system and new selection guide make

it easy for you to select the right plasmid kit for your application. Coupled

with QIAGEN’s expert sales team and unrivaled technical support, this

makes QIAGEN the best choice for all your plasmid prep requirements.

Choose from QIAGEN’s trusted range of

plasmid kits using our new online selection guide at

www.qiagen.com/goto/plasmid/ .

70 www.qiagen.com QIAGEN News 2004 Issue 3


Ordering Information

Product Contents Cat. no.

QIAprep Spin 50 QIAprep Spin Columns, Reagents, Buffers, 27104

Miniprep Kit (50)* Collection Tubes (2 ml)

QIAprep 96 Turbo TurboFilter 96 and QIAprep 96 Plates; Flat-Bottom 27191

Miniprep Kit (4)* † Blocks and Lids, Reagents, Buffers,

Collection Microtubes (1.2 ml), Caps

DirectPrep 96 4 DirectPrep 96 Plates, Buffers, Flat-Bottom Blocks 27361

MiniPrep Kit (4) † and Lids, AirPore Tape Sheets, Tape Pads,

Elution Microtubes RS, Caps

R.E.A.L. Prep 96 4 QIAfilter 96 Plates, Square-Well Blocks, Tape Pads, 26171

Plasmid Kit (4)* † Reagents, Buffers

QIAwell 96 Ultra 4 of each: QIAfilter 96, QIAwell 96, and 16191

Plasmid Kit (4) † QIAprep 96 Plates; Reagents, Buffers,

Collection Microtubes (1.2 ml), Caps

HiSpeed Plasmid 25 HiSpeed Midi Tips, 25 QIAfilter Midi Cartridges, 12643

Midi Kit (25) 25 QIAprecipitator Midi Modules plus Syringes,

Reagents, Buffers

HiSpeed Plasmid 10 HiSpeed Maxi Tips, 10 QIAfilter Maxi Cartridges, 12662

Maxi Kit (10)* 10 QIAprecipitator Maxi Modules plus Syringes,

Reagents, Buffers

QIAfilter Plasmid 25 QIAGEN-tip 100, Reagents, Buffers, 12243

Midi Kit (25)* ‡ 25 QIAfilter Midi Cartridges

QIAfilter Plasmid 10 QIAGEN-tip 500, Reagents, Buffers, 12262

Maxi Kit (10)* ‡ 10 QIAfilter Maxi Cartridges

QIAGEN Plasmid 25 QIAGEN-tip 20, Reagents, Buffers 12123

Mini Kit (25)* ‡

QIAGEN Plasmid 25 QIAGEN-tip 100, Reagents, Buffers 12143

Midi Kit (25)* ‡

QIAGEN Plasmid 10 QIAGEN-tip 500, Reagents, Buffers 12162

Maxi Kit (10)* ‡

EndoFree Plasmid 10 QIAGEN-tip 500, Reagents, 12362

Maxi Kit (10) ‡ 10 QIAfilter Maxi Cartridges, Endotoxin-free Buffers

Ultrapure 100 Column § Column (44 mm x 250 mm) containing QIAGEN 11100

Anion-Exchange Resin; for preparation of up to

100 mg plasmid DNA

* Larger kit sizes available, please inquire.

† BioRobot kit formats available, please inquire.

‡ Mega and Giga kit formats available, please inquire.

$ Ultrapure 100 Buffer Set (cat. no. 11500) required.

QIAGEN News 2004 Issue 3 www.qiagen.com 71


New

Simultaneous purification of viral DNA and RNA from serum and

plasma using the BioRobot ® M48 workstation

The MagAttract ® Virus Mini M48 Kit provides a fully automated procedure for simultaneous purification of viral DNA and

RNA from serum and plasma for highly sensitive detection in downstream assays. The kit can be used to purify nucleic acids

from a broad range of DNA and RNA viruses for life science applications.

Detected (%)

100

75

50

25

High Sensitivity for Reliable Detection

M48/400

R/1000

R/200

0

0 40 80

Virus titer (IU/ml)

120 160

Figure 1 Serial dilutions from a negative plasma pool

spiked with an international standard of a typical DNA

virus were processed in replicates of 24, using the

MagAttract Virus Mini M48 Kit with a 400 µl input volume

(M48/400), or using automated kits from Supplier R with a

1000 µl (R/1000) or 200 µl (R/200) input volume.

Samples were analyzed by real-time duplex PCR with an

internal control. The vertical lines show the 95% hit rate,

at which detection by PCR can be expected with a 95%

probability.

Table 1. No Detectable Cross-Contamination

Positive samples Negative samples

Run 1

Positive detection 24 0

Negative detection

Run 2

0 24

Positive detection 24 0

Negative detection 0 24

Negative and positive (10 7 copies/ml armored RNA)

plasma samples arranged in alternating sequence on the

BioRobot M48 worktable were purified using the

MagAttract Virus Mini M48 Kit and analyzed by real-time

RT-PCR. Mean C T value for positive samples was 29.9.

Samples with C T > 60 were regarded as negative.

The MagAttract Virus Mini M48 Kit provides:

■ High sensitivity — high yields even with low viral titers for highly

sensitive detection

■ No detectable cross-contamination — from up to 48 samples

containing RNA or DNA viruses

■ Linear yields — efficient purification over a range of viral titers

■ Walkaway processing — for ease of use and efficient workflows

High sensitivity with low viral titers

The MagAttract Virus Mini M48 Kit enables highly sensitive detection of

a broad range of DNA and RNA viruses. The automated procedure gives

more sensitive detection for the amount of starting material than other

automated systems (Figure 1). Yields are linear, allowing accurate

quantitative analysis for both low and high viral titers.

No detectable cross-contamination

Accurate detection requires cross-contamination–free processing to avoid

false positives. The MagAttract Virus Mini M48 Kit provides parallel

purification of 48 samples on the BioRobot M48 workstation with

no detectable cross-contamination (as shown in Table 1), making it

well-suited for purification of both high and low levels of viral nucleic

acids from the same set of samples.

Walkaway processing with high reproducibility

Fully automated processing on the BioRobot M48 workstation provides

highly reproducible purification, with minimal sample-to-sample or

day-to-day variation (Figure 2). Walkaway purification of 48 samples

requires only 15–20 minutes setup time, allowing quick turnaround and

flexible processing.

72 www.qiagen.com QIAGEN News 2004 Issue 3


Visit www.qiagen.com/goto/virusM48 to discover how automated

viral nucleic acid purification can improve your research!

Ordering Information

Highly Reproducible Purification

A DNA virus

Day 1

Day 2

Day 3

B

C T value

40

30

20

10

0 6 12 18 24

Sample

Figure 2 A negative plasma pool was spiked on each of 3 days with a typical DNA or RNA virus. Viral nucleic acids were purified from 24 aliquots (400 µl each)

of each pool using the MagAttract Virus Mini M48 Kit, with elution in a volume of 125 µl. Pools were spiked with 105 copies/ml of a typical DNA virus.

Purified viral DNA (10 µl of each eluate) was analyzed by real-time PCR using the QuantiTect ® SYBR ® Green PCR Kit, and CT values are shown for 24 samples on

each day. Pools were spiked with 104 A

B

copies/ml of a typical RNA virus. Purified viral RNA (10 µl of each eluate) was analyzed by real-time RT-PCR using the

QuantiTect Probe RT-PCR Kit, and CT values are shown for 24 samples on each day.

Product Contents Cat. no.

MagAttract Virus Mini M48 For 192 virus nucleic acid preps: MagAttract 955336

Kit (192) Suspension B and RNase-Free Reagents and Buffers

BioRobot M48 Robotic workstation for automated purification of 9000708

nucleic acids using MagAttract M48 kits; computer,

installation, 1 year warranty on parts and labor

QIAGEN News 2004 Issue 3 www.qiagen.com 73

C T value

40

30

20

10

RNA virus

Day 1

Day 2

Day 3

0 6 12 18 24

Sample


New

Accelerate research and discovery using comprehensive siRNA sets

QIAGEN ® Human Library siRNA Sets provide hundreds of pre-designed, highly potent siRNA duplexes that are ready to use

for RNAi screening of complete families or classes of genes. The large number of carefully selected genes targeted by Human

Library siRNA Sets enables comprehensive yet detailed study of entire biochemical pathways or processes.

Human Library siRNA Sets provide:

■ Accelerated research and discovery — extensive gene coverage for

efficient screening of entire gene families

■ Cost-effective RNAi screening — optimally designed, pre-synthesized

siRNA sets allow economical, rapid high-throughput studies

■ The Golden Guarantee of 100% satisfaction — effective gene knockdown

with satisfaction guaranteed, or free redesign and replacement

■ Highly potent siRNA generated using the world’s best siRNA design

algorithm — the HiPerformance design algorithm is integrated with a

proprietary homology analysis tool for optimal siRNA design

Sets are currently available for the study of kinases (646 genes), G protein-coupled receptors

(471 genes), and apoptosis-related factors (418 genes). QIAGEN scientists use the most up-to-date

public databases to develop content for Human Library siRNA Sets, including the National Center

for Biotechnology Information (NCBI), Ensembl, Swiss-Prot, the UCSC Genome browser, and

InterPro (European Bioinformatics Institute). Human Library siRNA Sets offer the widest coverage of

gene families available at the time of design. Two highly potent, high-purity siRNA duplexes are

supplied for each gene target. Each plate also includes control wells that contain a scrambled

non-silencing siRNA and an siRNA directed against GFP, and empty wells for customer-defined

controls (e.g., positive controls or mock transfections in the absence of siRNA). Complete,

restriction-free sequence information is provided at no extra cost.

Custom siRNA Set

With Custom siRNA Sets, researchers are free to choose which genes they wish to target. Duplexes

in Custom siRNA Sets come with the Golden Guarantee of 100% satisfaction, are designed using

the same cutting-edge algorithm as Human Library siRNA Sets, and also offer:

■ Flexibility and scalability — target the specific type and number of genes that your research

requires

World’s most advanced siRNA design generates highly potent siRNA

All siRNA duplexes in Human Library and Custom siRNA Sets are designed using the revolutionary

HiPerformance design algorithm licensed from Novartis Pharmaceuticals. This algorithm is based

on the largest independent study of siRNA functionality to date, in which the gene silencing

efficiency was analyzed for over 3300 duplexes directed against 33 targets. The HiPerformance

design algorithm is integrated with a proprietary homology analysis tool and a comprehensive

gene database, delivering siRNA that provides maximum gene silencing efficiency with minimal

off-target effects. The efficacy of the algorithm has been proven by analysis of hundreds of siRNA

duplexes directed against multiple genes (Figure 1).

74 www.qiagen.com QIAGEN News 2004 Issue 3


Relative mRNA expression (%)

150

120

90

60

30

Increased siRNA Potency through Advanced Design

0

0 20

Ordering Information

40 60 80 100

Duplex number

HiPerformance algorithm

Tuschl guidelines

70% knockdown

90% knockdown

Figure 1 100 siRNA duplexes against different targets were

designed using either the HiPerformance design algorithm

or Tuschl guidelines and transfected into HeLa S3 cells

using RNAiFect Transfection Reagent. Knockdown efficiency

was determined by quantitative, real-time RT-PCR. Results

for each algorithm are presented in order of decreasing

knockdown efficiency and independent of target.

Product Contents Cat. no.

Human GPCR 942 HPP Grade siRNA duplexes targeting 471 G protein-coupled 1027092

siRNA Set (2 nmol) receptors, two duplexes per gene. 2 nmol of each duplex,

supplied in 96-well plates. Each plate includes non-silencing

and GFP-22 siRNA controls.

Human Kinase 1292 HPP Grade siRNA duplexes targeting 646 kinase and 1027091

siRNA Set (2 nmol) kinase-associated genes, two HPP Grade duplexes per gene.

2 nmol of each duplex, supplied in 96-well plates. Each plate

includes non-silencing and GFP-22 siRNA controls.

Human Apoptosis 836 HPP Grade siRNA duplexes targeting 418 apoptosis-related 1027093

siRNA Set (2 nmol) genes, two HPP Grade duplexes per gene. 2 nmol of each

duplex, supplied in 96-well plates. Each plate includes

non-silencing and GFP-22 siRNA controls.

Custom siRNA Set, Set of 96 HPP Grade siRNA duplexes targeting 48 1027094

96-well plate customer-specified genes, two HPP Grade duplexes per gene.

(5 nmol)* 5 nmol of each duplex, supplied in 96-well plates.

For an up-to-date list of siRNA sets available, go to www.qiagen.com/siRNA .

Related product

2-for-Silencing Two HPP Grade siRNA duplexes (20 nmol), 1022562

siRNA Duplexes custom-designed by QIAGEN

* Also available in 20 nmol and in tubes; please inquire.

QIAGEN News 2004 Issue 3 www.qiagen.com 75


Ultra-high–throughput gene silencing for rapid, economical

functional genomics studies

Janette Nowakowski and Kurt Herrenknecht

Evotec Technologies GmbH, Düsseldorf, Germany

A major challenge of the post-genomic era is to decipher the role of genes identified by the human genome project with

unknown function. The use of RNAi in cultured mammalian cells has become a powerful tool for functional genomics,

especially when combined with high-throughput technologies. Here we describe an approach for ultra-high–throughput gene

silencing of a G protein-coupled receptor (GPCR) using HPP Grade siRNA duplexes and RNAiFect Transfection Reagent

from QIAGEN, with the Opera high-speed confocal imaging reader, and high-throughput cell-seeding and liquid-handling

stations from Evotec Technologies.

The Opera Confocal Fluorescence

Microplate Reader

Figure 1 The Opera microplate reader allows automated

confocal high-throughput fluorescence imaging and is

compatible with all microplate types from 96 to 2080 wells.

Figure 2 CHO cells that constitutively express the

ETAR–GFP fusion protein were visualized using the Opera

reader. A Unstimulated cells with the ETAR–GFP protein

localized in the membrane; B Cells 3 hours after

stimulation with endothelin-1 show ETAR–GFP protein

localized in endosomes. The cell nuclei and cytoplasm

were stained with Syto59 and are colored red.

High-throughput screening using RNAi

Down-regulation or knockout of a gene of interest is a highly effective

approach for the study of gene function. RNAi allows rapid and

economical gene knockdown and has become the method of choice for

functional genomics research and transcriptome-wide high-throughput

analysis. We describe a high-throughput RNAi approach using a

functional assay for a GPCR (endothelin A) and Evotec Technologies’

ultra-high–throughput screening technology. The receptor used in this

study was a fusion protein of the endothelin A receptor (ETAR) and

enhanced green fluorescent protein (GFP) that was constitutively

expressed in CHO cells, allowing receptor expression to be monitored

with the Opera confocal fluorescence microplate reader from Evotec

Technologies (Figure 1).

Application of RNAi screening to pathway analysis

Endothelin A receptor is a GPCR that recognizes endothelin-1 as its

natural ligand. Endothelin-1 activation of the endothelin A receptor is

involved in a variety of biological effects including smooth muscle

contraction, cardiac inotropism, hormone and cytokine production, and

regulation of mitogenesis. Binding of endothelin-1 to the endothelin A

receptor induces rapid endocytosis of the receptor (1). The receptor

Monitoring Fluorescence Shows Endothelin A Receptor Endocytosis

A B

76 www.qiagen.com QIAGEN News 2004 Issue 3


subsequently dissociates from endothelin-1 and is either recycled back to the cell surface (2) or

degraded. High-throughput RNAi techniques can be combined with monitoring of endocytosis

using a fluorescent marker, for the identification of genes involved in the internalization process

(Figure 2). Similarly, the combination of RNAi techniques with any appropriate assay can be used

for screening large numbers of genes potentially involved in cellular processes.

Materials and methods

HPP (High-Performance Purity) Grade siRNA duplexes from QIAGEN were targeted against either

the ETAR or the GFP portion of the ETAR–GFP fusion protein. The target sequences of the siRNA

duplexes were: ETAR siRNA 5'-AACGCGCTGATAGCCAGTCTT-3', GFP-22 siRNA

5'-CGGCAAGCTGACCCTGAAGTTCAT-3'. The sequence of the non-silencing siRNA duplex was

5'-AATTCTCCGAACGTGTCACGT-3'. siRNA transfections were performed in 96-well or 1536-well

microplates using RNAiFect Transfection Reagent. For transfections in 96-well plates 4 x 103 CHO

cells were seeded per well and allowed to adhere overnight. Cells were transfected with 0.25 µg,

0.5 µg, 0.75 µg, 1 µg, 1.5 µg, or 2 µg siRNA and after 48 hours plates were analyzed on the

Opera imaging reader. Experiments in 1536-well plates were carried out using Evotec

Technologies’ ultra-high–throughput cell seeding and liquid handling stations. Three hundred CHO

cells were seeded per well and allowed to adhere overnight. Cells were transfected with 0.05 µg

GFP-22 siRNA or non-silencing control siRNA. Cells were analyzed 48 hours after transfection.

Plates were read on the Opera imaging reader and the degree of receptor silencing was quantified

by an Opera inherent image analysis algorithm that focuses on membrane fluorescence intensity.

Results

Fluorescence Imaging Shows Effective Gene Silencing

Untransfected 0.25 µg siRNA

1.0 µg siRNA

The gene silencing efficiency of siRNA duplexes targeted against the ETAR–GFP fusion protein was

tested by transfection of ETAR or GFP-22 siRNA duplexes into cells in 96-well plates. The transfection

efficiency was close to 100%. Effective knockdown of the fusion protein was achieved with as little

as 0.25 µg siRNA per well irrespective of whether the ETAR or the GFP-22 siRNA was used

(Figures 3 and 4).

For experiments in 1536-well plates, cells were transfected with GFP-22 siRNA or non-silencing

control siRNA. High-throughput transfection and gene silencing in 1536-well plates was highly

efficient and reproducible, with very little variability across the plate and only small variations in

single-well data (Figure 5). These results clearly demonstrate that RNAi can be used for automated

large-scale gene silencing applications such as screening siRNA libraries for drug discovery or

pathway analysis.

Figure 3 Transfection of

siRNA targeted against the

GFP portion of the fusion

protein resulted in effective

knockdown as shown by

fluorescence imaging.

Effective silencing was

achieved with as little as

0.25 µg siRNA.

QIAGEN News 2004 Issue 3 www.qiagen.com 77


A

B

Highly Efficient Knockdown Effective High-Throughput Knockdown in 1536-Well Plates

Figure 4 Transfection of siRNA targeted against A the GFP

portion or B the ETAR portion of the fusion protein resulted

in effective knockdown as shown by fluorescence imaging.

Effective silencing was achieved with siRNA amounts

ranging from 0.25 to 2 µg. Control transfections were

carried out with medium only, buffer only, siRNA only, and

RNAiFect Reagent only. Transfections were carried out in

96-well plates.

Ordering Information

Figure 5 Ultra-high–throughput RNAi screening using GFP-22 siRNA in 1536-well plates

resulted in effective knockdown with very low variability across the plate as shown by

membrane fluorescence imaging. Non-silencing control siRNA was also transfected.

Conclusions

■ HPP Grade siRNA Duplexes, cell seeding and liquid handling stations,

and the Opera imaging reader were successfully used for highthroughput

gene silencing of endothelin A.

■ RNAiFect Transfection Reagent provided high transfection efficiencies of

close to 100%, even when cells were transfected in a 1536-well format.

■ The results demonstrate how an assay, such as fluorescent monitoring

of endocytosis with the Opera imaging reader, can be combined with

cost-effective, high-throughput RNAi screening for highly efficient

functional genomics research.

References

1. Chun, M., Lin, H.Y., Henis, Y.I., and Lodish, H.F. (1995) Endothelin-induced Endocytosis

of Cell Surface ETA Receptors. J Biol Chem, 270, 10855.

2. Wang J, Chiou W.J., Gagne G.D., and Wu-Wong J.R. (2000) Internalization of type-A

endothelin receptor. J Cardiovasc Pharmacol, 36(5 Suppl 1):S61.

Product Contents Cat. no.

HPP Grade siRNA (20 nmol)* siRNA purified to >90% –

GFP-22 siRNA (5 nmol) 5 nmol GFP-22 siRNA; for use as a positive (silencing) 1022064

control for green fluorescent protein

Negative Control 5 nmol duplex siRNA with no significant homology to 1022076

siRNA (5 nmol) any known mammalian gene; for use as a non-silencing

control in RNAi experiments

RNAiFect Transfection RNAiFect Reagent and buffer, for up to 170 transfections 301605

Reagent (1 ml) † in 24-well plates; up to 500 transfections in 96-well plates

Find out more about Evotec technologies’ solutions for high-throughput RNAi at www.evotec-technologies.com .

* Available in guaranteed yields of 20 and 40 nmol. Also available in 96-well plates; please inquire.

† Larger sizes available; please inquire.

78 www.qiagen.com QIAGEN News 2004 Issue 3


Automated purification of bacterial DNA from primary clinical

research samples

A new application package for the BioRobot ® M48 system — the App. Package, M48, Inf. Dis. — provides a fully

automated protocol for purification of bacterial DNA from primary clinical research samples or bacterial cultures using the

BioRobot M48 workstation and the MagAttract ® DNA Mini M48 Kit. High-quality genomic and plasmid DNA obtained using

the bacterial DNA purification protocol is well-suited for use in sensitive downstream applications, such as real-time PCR.

Separate protocols in the application package enable purification of viral DNA and RNA from serum and plasma

(see related article on page 72).

The bacterial protocol in the application package enables:

■ Purification of high-performance bacterial total DNA — from Gram-negative and Gram-positive

bacteria

■ Flexible processing — from primary clinical research samples, such as swabs and body fluids,

or bacterial cultures and colonies

■ Efficient DNA purification — for inhibition-free PCR and real-time PCR

High-performance DNA for sensitive detection

DNA purified using the bacterial protocol performs well in downstream assays, such as real-time

PCR for detection of pathogens. Automated DNA purification from urine samples using the

BioRobot M48 workstation and real-time PCR of Chlamydia trachomatis DNA were compared with

manual DNA purification and an established, commercial assay (Supplier R). For 130 samples

tested, in duplicate, the 2 systems gave identical results in all cases (1). DNA purified using the

automated system performed well in real-time PCR, demonstrating effective removal of PCR

inhibitors found in urine (Figure 1).

A

Fluorescence

New

10

1

0.1

0.01

0.001

Sensitive and Reproducible PCR Analysis of Samples and Controls

1 10 20 30 40 50

Cycle number

B

Fluorescence

10

1

0.1

0.01

0.001

1 10 20 30 40 50

Cycle number

Figure 1 Amplification of DNA purified from urine samples using the BioRobot M48 workstation and the App. Package,

M48, Inf. Dis. Representative data are shown for 16 out of 130 samples processed (1). Real-time PCR was performed in

duplicate to demonstrate reproducibility. A

5 samples testing positive for C. trachomatis DNA B 11 samples testing negative

for C. trachomatis genomic DNA, but showing positive amplification of control DNA. (Data kindly provided by S.O.

Hjelmevoll and M.E. Olsen, The University Hospital of North Norway, Tromsø, Norway; and T. Fossheim, QIAGEN AS,

Oslo, Norway)

QIAGEN News 2004 Issue 3 www.qiagen.com 79


Table 1. Comparison of Manual and Automated DNA Purification for Quantitative Amplification

of M. pneumoniae DNA by Real-Time PCR

Real-time PCR analysis*

Manual DNA purification Automated DNA purification Automated DNA purification

Sample and in-house PCR: and real-time PCR: and real-time PCR:

number Sample type † M. pneumoniae M. pneumoniae control amplicon

1 NG-swab + + +

2 NG-swab + + +

3 NG-swab + + +

4 NG-swab + + +

5 NG-swab + + +

6 NG-swab + + +

7 NG-fluid + + +

8 Sputum + + +

9 Sputum – – +

10 ET-fluid – – +

11 Positive control + + +

12 Negative control – – +

* + = amplicon detected; – = amplicon not detected.

Figure 2 Real-time PCR of M. pneumoniae DNA using

purified DNA representative of purifications from 3 different

types of respiratory sample containing M. pneumoniae.

Red: 6 x nasopharyngeal swab; Blue: nasopharyngeal

fluid; Green: sputum; Yellow: endotracheal fluid;

Broken lines: 2 x positive control samples isolated with

Bact_200ul protocol on the BioRobot M48 workstation;

Gray: negative controls.

(Data kindly provided by M. Vondracek and K. Fahlander,

Karolinska University Hospital, Solna, Stockholm, Sweden;

and T. Fossheim, QIAGEN AS, Oslo, Norway)

† NG-swab = Nasopharyngeal swab, NG-fluid = Nasopharyngeal fluid, ET-fluid = Endotracheal fluid.

(Data kindly provided by M. Vondracek and K. Fahlander, Karolinska University Hospital, Solna, Stockholm, Sweden; and

T. Fossheim, QIAGEN AS, Oslo, Norway)

Flexible processing of a variety of primary clinical research samples

The bacterial protocol on the BioRobot M48 workstation enables purification of bacterial DNA

from different primary clinical research samples, such as swabs and body fluids, as well as

bacterial cultures and colonies. The procedure enables purification of high-quality bacterial DNA.

For detection of Mycoplasma pneumoniae DNA in 4 different kinds of respiratory research

samples, real-time PCR analysis showed identical results for the automated system compared with

manual DNA purification (Table 1). The automated method provides equivalent sensitivity with less

hands-on time and a more efficient workflow.

Normalized fluorescence

Reliable Amplification of Mycoplasma DNA from Respiratory Samples

10 0

10 -1

10 -2

0 10 20 30

80 www.qiagen.com QIAGEN News 2004 Issue 3

Cycle

Detection threshold

40 50


Efficient DNA purification for inhibition-free PCR

Real-time PCR results (Figures 2 and 3) show that automated DNA purification using the BioRobot

M48 workstation results in high-performance DNA that is well-suited for sensitive, real-time PCR.

M. pneumoniae-specific amplicons were detected in all positive samples, but not in negative

control samples, indicating that purification was free of cross-contamination and that purified DNA

was not degraded (Figure 3).

Normalized fluorescence

Reliable Real-Time PCR Controls Using Inhibitor-Free Purified DNA

10 0

10 -1

10 -2

0 5 10 15 20 25 30 35 40 45

Visit www.qiagen.com/goto/BacteriaM48 to discover more about

automated bacterial DNA purification from clinical research samples!

References

1. Hjelmevoll, S.O., Olsen, M.E., and Fossheim, T. (2004) Automated purification of DNA from urine for sensitive PCR of

Chlamydia trachomatis amplicons. QIAGEN News 2004, e21.

2. Vondracek, M., Fahlander, K., and Fossheim, T. (2004) Automated purification of mycoplasma DNA from respiratory

samples. QIAGEN News 2004, e25.

Related article in this issue

Simultaneous purification of viral DNA and RNA from serum and plasma using the BioRobot M48

workstation (page 72)

Ordering Information

Cycle

Detection threshold

Figure 3 Internal positive control DNA was amplified

efficiently from all samples and no significant variation was

observed in CT values, indicating purified DNA was

consistently free from PCR inhibitors. Red: nasopharyngeal

swab samples; Blue: nasopharyngeal fluid; Yellow:

endotracheal fluid; Green: sputum; Gray: negative controls;

Broken lines: positive control isolated with Bact_200ul

protocol on the BioRobot M48 workstation.

(Data kindly provided by M. Vondracek and K. Fahlander,

Karolinska University Hospital, Solna, Stockholm, Sweden;

and T. Fossheim, QIAGEN AS, Oslo, Norway)

Product Contents Cat. no.

App. Package, M48, Software protocol package for infectious disease 9016145

Inf. Dis. (CD) applications, v. 2.0, on the BioRobot M48 workstation

BioRobot M48 Robotic Workstation for automated purification of nucleic 9000708

acids using MagAttract M48 Kits; Installation,

1-Year Warranty on parts and labor

MagAttract DNA Mini For 192 DNA preps: MagAttract Suspension B, 953336

M48 Kit (192) Buffers, Proteinase K

QIAGEN News 2004 Issue 3 www.qiagen.com 81


Automation

Automated purification of anthrax DNA from soil for biodefense

applications

Anthrax is a serious disease caused by the bacterium Bacillus anthracis. Humans can contract anthrax by exposure to

infected animal products. Anthrax has been used as a terrorist weapon, for example, in the United States in 2001, when

22 people were infected by anthrax spores sent through the postal system. Although no military use of anthrax is

documented, it is suspected that several countries have stockpiled spores at various times for potential military use. Spores

released by a military research facility in Sverdlovsk, USSR in 1979 led to the largest epidemic of inhalational anthrax in

the twentieth century. These incidents strongly corroborate the need for reliable and effective detection strategies (e.g.,

molecular diagnosis). When detecting anthrax DNA while assessing the extent of an affected area, it is essential to use an

efficient procedure for purification of anthrax DNA.

Reference

1. Zoll, G., Grote, G.,

Jaske, C., Maatmann,

I., and Köhne, S.

(2004) Automated

purification of anthrax

DNA from soil for

biodefense

applications. QIAGEN

News 2004, e24.

A recent QIAGEN News electronic article by Gudrun Zoll and coworkers of the Armed Forces

Scientific Institute for Protection Technologies, Munster, Germany (1) demonstrates efficient

automated purification of anthrax DNA from soil samples. The article shows:

■ Soil contains a number of inhibitors of PCR, which must be efficiently removed by the DNA

purification method. After a simple pre-treatment procedure, the BioRobot ® EZ1 system enabled

easy and rapid DNA purification from soil, with efficient removal of contaminants and PCR

inhibitors.

■ B. anthracis DNA was successfully amplified in real-time PCR, with detection in all positive

samples (Figure 1).

■ This system provides an important tool to combat the use of anthrax in bioterrorism and military

situations.

Fluorescence

-1

-1.5

-2

-2.5

-3

0 5 10 15 20

Cycle

25

Detection of Anthrax DNA Purified from Soil

30 35 40

Bacteria CT value

108 20

107 24

106 27

105 32

104 36

0 negative

+ 19

– blank

Figure 1 Soil samples (0.5 g each) were spiked with the indicated number of inactivated B. anthracis bacteria. Samples

were treated as described in the online article (1), and DNA was purified using the EZ1 DNA Tissue Kit and the EZ1 DNA

Tissue Card on the BioRobot EZ1 workstation. Purified DNA was used as a template for real-time PCR using HotStarTaq

DNA Polymerase on a DNA Engine Opticon cycler, with primers and probes specific for the PA (protective antigen) gene.

B. anthracis DNA was successfully detected from as few as 10 4 cells (C T = 36). +: Positive control (10 8 bacteria).

–: Negative control.

Read the full article online at www.qiagen.com/goto/EZ1anthrax and

find out more about easy automation for biodefense applications!

82 www.qiagen.com QIAGEN News 2004 Issue 3


QIA-Hints

RNA stabilization and purification

I am going to use an RNeasy ® Protect Kit to purify total RNA from a tissue sample. How should I handle the sample?

Changes in gene expression and RNA profiles can occur during sample harvest and handling, and during RNA purification.

These changes can occur very rapidly, within seconds of harvest. RNAlater RNA Stabilization Reagent in RNeasy Protect

Kits provides immediate stabilization and protection of RNA in biological samples. Once immersed in the reagent, RNA in

tissue samples is stable for 1 day at 37°C, 7 days at 18 to 25°C, 4 weeks at 2 to 8°C, or for extended periods with archival

storage at –20 or –80°C.

What is the difference between a bead mill and a rotor–stator homogenizer?

Bead mills, such as the TissueLyser from QIAGEN, use the crushing action of solid beads agitated at high speed in the

presence of the sample. A rotor–stator homogenizer is a high-speed rotor that draws a liquid sample in and forces it out at

high speed through a narrow aperture. Bead mills and rotor-stator homogenizers share the characteristic of disrupting and

homogenizing samples. An advantage of the TissueLyser over rotor–stator homogenizers is its capacity for simultaneously

processing multiple (up to 2 x 96) samples. A rotor–stator homogenizer must be thoroughly cleaned after processing of each

sample. Simultaneous processing of multiple samples increases reproducibility and prevents cross-contamination.

How can I homogenize my tissue if I don’t have either of these instruments?

If neither of these instruments is available, you can disrupt a tissue sample by grinding with a mortar and pestle. However,

manual disruption with a mortar and pestle only disrupts the sample. Disruption with a mortar and pestle should always be

followed by a homogenization method using a QIAshredder spin column or passing the material several times through a

narrow-bore needle.

Trademarks: QIAGEN ® , QIAprep ® , QIAwell ® , BioRobot ® , DirectPrep ® , DyeEx ® , EndoFree ® , HiSpeed ® , HotStarTaq ® , MagAttract ® , MinElute ® , Omniscript ® , PolyFect ® , QuantiTect ® , QuantiProbe, R.E.A.L. ® , RNAiFect, RNeasy ® ,

TransMessenger ® (QIAGEN Group); ABI PRISM ® , BigDye, GeneScan ® , FAM, ROX (Applera Corporation or its subsidiaries); Alexa Fluor ® , Bodipy ® , SYBR ® (Molecular Probes, Inc.); Cy ® (Amersham Biosciences); DNA

Engine Opticon ® (MJ Research, Inc.); iCycler (Bio-Rad Laboratories, Inc.); Mx3000P, pBluescript ® (Stratagene, Inc.); Rotor-Gene (Corbett Research); Smart Cycler ® (Cepheid); GeneAmp ® , TaqMan ® (Roche Group); Yakima

Yellow (Epoch Biosciences).

QIAGEN robotic systems are not available in all countries; please inquire. BioRobot workstations and QIAGEN kits are intended as general-purpose devices. No claim or representation is intended for their use in identifying

any specific organism or for a specific clinical use (diagnostic, prognostic, therapeutic, or blood banking). It is the user’s responsibility to validate the performance of BioRobot workstations and QIAGEN kits for any

particular use, since their performance characteristics have not been validated for any specific organism. BioRobot workstations and QIAGEN kits may be used in clinical diagnostic laboratory systems after the laboratory

has validated their complete system as required by CLIA ‘88 regulations in the U.S. or equivalents in other countries.

QIAzol Lysis Reagent is a subject of US Patent No. 5,346,994 and foreign equivalents.

Purchase of QIAGEN products for PCR containing Taq DNA Polymerase, HotStarTaq DNA Polymerase, or ProofStart DNA Polymerase is accompanied by a limited license to use them in the Polymerase Chain Reaction (PCR)

process for research and development activities in conjunction with a thermal cycler whose use in the automated performance of the PCR process is covered by the up-front license fee, either by payment to Applied Biosystems

or as purchased, i.e. an authorized thermal cycler. The PCR process is covered by U.S. Patents 4,683,195 and 4,683,202 and foreign equivalents owned by Hoffmann-La Roche AG. The 5’ nuclease process is covered

by patents owned by Roche Molecular Systems, Inc. and F. Hoffmann-La Roche Ltd. Patents of third parties in certain countries may cover the process of multiplex PCR or of certain applications. A license may be needed to

perform patented assays. Patents of third parties in certain countries may cover the process of multiplex PCR or of certain applications.

QuantiTect Gene Expression Assays and QuantiTect Custom Assays or portions hereof are subject to proprietary rights of Epoch Biosciences, Inc. and are made and sold under license from Epoch under the patents and

patent applications as may be designated by Epoch from time to time set forth, including one or more of the following: U.S. Patent Nos. 5,801,155, 6,084,102, 6,312,894, 6,426,408, and 6,127,121, and applications

currently pending. Purchase of this product carries with it a limited, non-transferable, non-exclusive (without the right to resell, repackage, or sublicense) license under U.S. Patent Nos. 6,030,787; 5,723,591; and 5,876,930,

and corresponding foreign patents. Powered by innovation from Epoch. Manufactured for QIAGEN by Epoch Biosciences.

siRNA technology licensed to QIAGEN is covered by various patent applications, owned by the Massachusetts Institute of Technology, Cambridge, MA, USA and others.

The Black Hole Quenchers and BHQ dyes were developed by and licensed from Biosearch Technologies, Novato, CA. These products are sold exclusively for R&D use by the purchaser. They may not be used for clinical

or diagnostic purposes and they may not be re-sold, distributed, or re-packaged.

“RNAlater ” is a trademark of AMBION, Inc., Austin, Texas and is covered by various U.S. and foreign patents.

© 2004 QIAGEN, all rights reserved.

Australia ■ QIAGEN Pty Ltd ■ Orders 03-9840-9800 ■ Fax 03-9840-9888 ■ Technical 1-800-243-066

Belgium ■ QIAGEN Benelux B.V. ■ Orders 0800-79612 ■ Fax 0800-79611 ■ Technical 0800-79556

Canada ■ QIAGEN Inc. ■ Orders 800-572-9613 ■ Fax 800-713-5951 ■ Technical 800-DNA-PREP (800-362-7737)

France ■ QIAGEN S.A. ■ Orders 01-60-920-920 ■ Fax 01-60-920-925 ■ Technical 01-60-920-930

Germany ■ QIAGEN GmbH ■ Orders 02103-29-12000 ■ Fax 02103-29-22000 ■ Technical 02103-29-12400

Italy ■ QIAGEN S.p.A. ■ Orders 02-33430411 ■ Fax 02-33430426 ■ Technical 02-33430414

Japan ■ QIAGEN K.K. ■ Telephone 03-5547-0811 ■ Fax 03-5547-0818 ■ Technical 03-5547-0811

Luxembourg ■ QIAGEN Benelux B.V. ■ Orders 8002-2076 ■ Fax 8002-2073 ■ Technical 8002-2067

The Netherlands ■ QIAGEN Benelux B.V. ■ Orders 0800-0229592 ■ Fax 0800-0229593 ■ Technical 0800-0229602

Switzerland ■ QIAGEN AG ■ Orders 061-319-30-30 ■ Fax 061-319-30-33 ■ Technical 061-319-30-31

UK and Ireland ■ QIAGEN Ltd. ■ Orders 01293-422-911 ■ Fax 01293-422-922 ■ Technical 01293-422-999

USA ■ QIAGEN Inc. ■ Orders 800-426-8157 ■ Fax 800-718-2056 ■ Technical 800-DNA-PREP (800-362-7737)

QIAGEN News 2004 Issue 3 www.qiagen.com 83


Integrated Solutions — Plasmid DNA Purification

Concentrate on your research —

trust QIAGEN ® plasmid kits!

Thousands of researchers trust QIAGEN plasmid kits to let them focus on getting results!

QIAGEN offers the most comprehensive range of plasmid purification kits: from mini- to gigapreps,

and from convenient manual formats and walkaway automated procedures to contract plasmid

DNA production.

Whatever your downstream application, QIAGEN has the right kit for you!

■ High-efficiency transfection of sensitive cells using DNA purified by EndoFree ® Plasmid Kits or

QIAGEN Plasmid Prep Service

■ Transfection and protein expression using DNA purified with a range of kits, including

HiSpeed ® Plasmid Kits

■ All standard laboratory applications using the QIAprep ® range of kits

■ Streamlined sequencing projects using QIAGEN automated integrated solutions for plasmid

purification, including new, cost-effective DirectPrep ® 96 Kits

Discover Choose the more best about QIAGEN gene kit silencing for you at using www.qiagen.com/siRNA!

our new selection guide,

see page 69!

Trademarks: QIAGEN ® , QIAprep ® , DirectPrep ® , EndoFree ® , HiSpeed ® (QIAGEN Group). AppDPLSall0704B1WW 07/2004 © 2004 QIAGEN, all rights reserved.

High-efficiency primary cell

transfections

Reliable high-throughput

sequencing

WWW.QIAGEN.COM

More magazines by this user
Similar magazines