Toxigenic Staphylococcus aureus Strains - Journal of Clinical ...

jcm.asm.org

Toxigenic Staphylococcus aureus Strains - Journal of Clinical ...

Synthetic exfoliative toxin A and B DNA probes

for detection of toxigenic Staphylococcus

aureus strains.

S Rifai, V Barbancon, G Prevost and Y Piemont

J. Clin. Microbiol. 1989, 27(3):504.

CONTENT ALERTS

Updated information and services can be found at:

http://jcm.asm.org/content/27/3/504

These include:

Receive: RSS Feeds, eTOCs, free email alerts (when new articles

cite this article), more»

Downloaded from http://jcm.asm.org/

on August 27, 2013 by guest

Information about commercial reprint orders: http://journals.asm.org/site/misc/reprints.xhtml

To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/


JOURNAL OF CLINICAL MICROBIOLOGY, Mar. 1989, p. 504-506

0095-1137/89/030504-03$02.00/0

Copyright 1989, American Society for Microbiology

Vol. 27, No. 3

Synthetic Exfoliative Toxin A and B DNA Probes for Detection of

Toxigenic Staphylococcus aureus Strains

SAMER RIFAI,* VIVIANE BARBANCON, GILLES PREVOST, AND YVES PIEMONT

Laboratoire de Toxinologie Bactérienne, Institut de Bactériologie de la Faculté de Médecine, Université Louis Pasteur,

3, rue Koeberlé, 67000 Strasbourg, France

Received 28 June 1988/Accepted 6 December 1988

Two methods for the detection of exfoliative toxin (ET) from Staphylococcus aureus were compared: (i) a

phenotypic assay, electrosyneresis, and (ii) a genotypic assay, staphylococcal DNA hybridization with

oligodeoxynucleotide probes. The probes were chosen from the previously determined sequences of serotype A

and B of ET, one probe for serotype A and another for serotype B. Strains exhibiting ET production in

electrosyneresis always possessed the ET gene(s). Conversely, some strains not exhibiting ET production in

electrosyneresis harbored the ET gene(s). The latter strains produced low levels of ET. ET-negative phage

group 2 strains of S. aureus as well as tested coagulase-negative staphylococci did not possess the ET gene(s).

The sensitivity of the DNA hybridization technique was 106 bacteria or 100 ng of genomic DNA.

Staphylococcal exfoliative toxins (ETs) are responsible

for cutaneous injuries referred to as staphylococcal scalded

skin syndrome. These lesions are often encountered in

hospitalized infants as sporadic cases or as small epidemics

(1, 16). Only 5 to 6% randomly isolated Staphylococcus

aureus strains produce such toxins (5, 14). These strains

belong in most cases to phage group 2, but only 40% of phage

group 2 strains synthesize the toxins (4, 5, 16). At the present

time, two different toxin serotypes, A and B (ETA and

ETB), are known. Strains producing ETA only represent

88% of toxigenic S. aureus, followed by strains producing

both ETA and ETB (8%) and then by strains producing ETB

only (4%) (14). For ETA the structural gene is chromosomally

encoded, whereas for ETB it is carried by a plasmid

(15).

ET-producing strains are detected by several methods

based mostly on the immunological detection of the toxin in

culture fluid: gel immunoprecipitation (2), enzyme-linked

immunosorbent assay (10), or radioimmunological assay (3,

17). The biological assay, the newborn mouse test, is not

easy to handle, and its sensitivity is only 5 p.g of ET per ml.

Among the immunological methods, electrosyneresis is well

adapted to the epidemiological characterization of ET-producing

S. aureus strains, since this method is rapid and can

be used to test simultaneously many strains (12). However,

strains with low ET excretion could be misidentified, since

the sensitivity of the test is only 5 ,ug/ml. We therefore

compared ET detection by electrosyneresis to ET gene

detection by staphylococcal DNA hybridization with DNA

probes. The latter technique allows the detection of ET

gene-harboring strains, whatever expression they have.

MATERIALS AND METHODS

Staphylococcal strains. The staphylococcal strains tested

included separate sets of wild-type strains previously collected:

98 ETA-producing, 22 ETB-producing, and 29 ETAand

ETB-producing S. aureus strains, 51 ET-negative S.

aureus strains, 32 phage group 2 S. aureus strains, and 138

coagulase-negative staphylococcal strains. All S. aureus

strains were isolated in our laboratory from various pathological

samples. The coagulase-negative staphylococci were

*

Corresponding author.

504

obtained from urine samples with more than 105 staphylococci

per ml or from N. El Solh; the species were as follows:

38 S. epidermidis, 29 S. haemolyticus, 20 S. saprophyticus,

27 S. hominis, and 24 S. warneri. The reference S. aureus

strains were, for ETA, strain 50586 isolated in our laboratory

and used in previous studies (10, 11, 13) and, for ETB, strain

TC142 obtained from J. P. Arbuthnott, Trinity College,

Dublin, Ireland.

Electrosyneresis. ET production was assessed by electrosyneresis

(or counterimmunoelectrophoresis) as previously

described (12). Briefly, the strains were cultivated in

0.5 ml of TY medium (6) under an air phase containing 15%

carbon dioxide. Culture supernatant (20 pI) and ETA or ETB

rabbit antisera (20 lI) were used for immunoprecipitation by

electrosyneresis in an electric field of 4 V/cm.

ET production in rabbit peritoneal cavities. Previously

sterilized dialysis bags were filled with phosphate-buffered

saline and seeded with staphylococcal strains. They were

inserted into rabbit peritoneal cavities. After 5 days, the fluid

in the bags was centrifuged and the supernatant was tested

for ET content.

Concentration of culture supernatant. The staphylococci

were grown in 25 ml of TY medium as described above. The

supernatant was placed in a Centricon device (Amicon

Corp.) with a cutoff of 10 kilodaltons and centrifuged for

several hours until a sevenfold concentration was achieved.

DNA probes. The DNA probes were chosen on the basis of

the nucleotide sequences of the ETA and ETB genes (7, 9).

The ETA probe was a 56-mer coding for amino acids -21

through -3 from the signal sequence of the ETA molecule;

it had the following nucleotide sequence: 5'CTGTAGG

AGCTAGTGCATTTTGTTATTCAAGACGAACTGATGC

AAAAAAACCATGC3'. The ETB probe was a 50-mer coding

for amino acids 222 through 238 of the corresponding

protein. It had the following nucleotide sequence: 5'CAC

TCTATTCGGTTGATAATACTTTTGGAGACACTTTGG

GGAACGATTTG3'. The probes were 5' labeled with [-y-32P]

ATP by using T4 polynucleotide kinase (Boehringer Mannheim

Biochemicals) as described by Maniatis et al. (8). The

specific activities were 13 x 106 cpm/,ug for the ETA probe

and 43 x 106 cpm/lpg for the ETB probe.

Dot blots. TY medium (200 pI) was aseptically dispensed

into each of the 96 wells of sterile, round-bottomed micro-

Downloaded from http://jcm.asm.org/ on August 27, 2013 by guest


VOL. 27, 1989

dilution plates. The staphylococcal strains were seeded in

each well with sterile toothpicks and grown overnight at

37°C. The plates were centrifuged for 10 min at 3,000 x g,

and the supernatant was discarded. The pellet was suspended

in 25 ,ul of TE buffer (50 mM Tris, S mM EDTA [pH

8.0]) containing 10 U of lysostaphin and 2 mg of lysozyme

per ml for 60 min at 37°C. Samples (4 ,ul) from each well were

spotted onto nitrocellulose filters (BA 85, 0.45-,um pore

diameter; Schleicher & Schuell, Inc.). The nitrocellulose

sheet was placed onto a 0.5 M NaOH-hydrated bed for 12

min; neutralization was performed with 1 M Tris hydrochloride

(pH 7.4) for 3 min, with 1.5 M NaCI-0.5 M Tris

hydrochloride (pH 7.4) for 3 min, and then with 0.3 M NaCI

for 3 min. The air-dried filters were heated at 80°C for 2 h

under vacuum. The membranes were immersed for 2 h at

55°C in lx SSC buffer (lx SSC is 0.15 M NaCI plus 0.0125

M sodium citrate [pH 7.0]) containing 2 mg of proteinase K

per ml and 0.05 % (wt/vol) sodium dodecyl sulfate. The

filters were washed in 3 x SSC buffer and allowed to air dry.

Prehybridization was carried out for 30 min at 65°C in 6.25 x

SSC. buffer containing 0.5% (wt/vol) bovine serum albumin,

0.5% (wt/vol) polyvinylpyrrolidone, and 1% (wt/vol) sodium

dodecyl sulfate. The filters were transferred into the hybridization

solution (6x SSC buffer containing 1% bovine serum

albumin, 1% polyvinylpyrrolidone, and 1 mM EDTA) containing

0.15 pmol of labeled probe per ml. Hybridization was

performed for 30 min at 65°C, followed by two washes (5 min

each) at 65°C with lx SSC buffer containing 1% sodium

dodecyl sulfate. The filters were exposed to Agfa Curix

X-ray film with an intensifying screen at -70°C for 1 or 2

days.

Sensitivity of DNA hybridization. The sensitivity of DNA

hybridization was assessed in two ways. (i) Dilutions of

purified staphylococcal genomic DNAs from reference

strains 50586 and TC142 were spotted onto nitrocellulose

filters and treated as described above. The DNA quantities

tested ranged from 1 ,ug to 10 pg of ETA- and ETBproducing

strains. (ii) After overnight cultivation, strains

50586 and TC142 were aseptically sonicated for 20 s to

dissociate staphylococcal clusters. CFU were determined by

plating dilutions of the cultures on blood agar, or 200-,ul

culture samples were diluted twofold in phosphate-buffered

saline at 4°C and processed as described above for dot blots.

RESULTS AND DISCUSSION

Both probes produced good hybridization signals with

homologous strains, with negligible background reactions

(Fig. 1). ETA-producing strains did not react with the ETB

probe and vice versa. The probes were therefore specific for

the toxin serotype for which they were constructed. Table 1

reveals an excellent correlation between the phenotypic

detection (electrosyneresis) and genotypic detection (hybridization)

of S. aureus ET. Among 200 S. aureus strains

tested, only 2 discrepancies were noted: 2 strains which

reacted with neither ETA nor ETB antisera harbored sequences

complementary to the ETA probe for the first strain

and to the ETB probe for the second.

In an attempt to increase ET production by these two

discordant strains, we placed them in dialysis bags and

inserted the bags into rabbit peritoneal cavities. In both

cases, ET was detected within the dialysis bags by electrosyneresis.

The ET serotype found agreed with the DNA

hybridization results. The peritoneal dialysis bag technique

may increase ET production for two reasons: (i) the staphylococci

grow in a continuously renewed medium, allowing

2

3

4

5

6

SYNTHETIC ETA AND ETB DNA PROBES 505

71

8

9

10

11 .

..

%4.

A

2

3

4

5

6

7

8

9

10

il

qw «j

_ _ a

FIG. 1. Spotting of 33 different cultured strains of Staphylococcus

spp. onto nitrocellulose filters. (A) DNA hybridization with the

ETA oligonucleotide probe. (B) DNA hybridization with the ETB

oligonucleotide probe. Rows: 1 to 3, ETA-producing S. aureus

strains hybridizing specifically with the ETA probe; 4 to 6, ETBproducing

S. aureus strains hybridizing specifically with the ETB

probe; 7 to 9, ETA- and ETB-producing S. aureus strains hybridizing

specifically with both probes; 10, coagulase-negative Staphylococcus

strains with no hybridization signal; 11, non-ET-producing

S. aureus strains with no hybridization signal.

the achievement of higher bacterial (and hence toxic) concentrations

than those obtained in classical culture media,

and (ii) physicochemical factors achieved in vivo may be

more suitable for ET gene expression. The role of C02, for

example, was monitored in vitro (10): its concentration in the

air phase was critical for ET production in TY medium.

TABLE 1.

.:

1%

N N %

Detection of ET-producing staphylococcal strains by

electrosyneresis and hybridization

No. of strains detected

by:

Species and ET Electro- Hybrd Discrepancies

serotypea (no. of syneresis ybri iza- between methods

strains tested) with probe (no. of strains)

antiserum

A B A B

S. aureus

ETA (98) 98 0 98 0 0

ETB (22) 0 22 0 22 0

ETA + ETB 29 29 29 29 0

(29)

Non-ET 0 0 1 1 2

producer (51)

Coagulase-negative 0 0 0 0 0

staphylococci

(non-ET

producer) (138)

a As determined by electrosyneresis.

B

Downloaded from http://jcm.asm.org/ on August 27, 2013 by guest


506 RIFAI ET AL.

To determine whether the in vitro conditions were suitable

for ET production by these two discordant strains, we

concentrated both culture supernatants. ET was detected in

both concentrates by electrosyneresis. A semiquantitative

estimation showed that, with respect to the reference

strains, the ET concentrations were reduced by about 2 log

units.

Strains with weak ET expression in vitro are difficult to

detect by immunoprecipitation, even with culture conditions,

such as a 15% C02 concentration in the air phase,

favoring ET production. These strains, however, can be

responsible for cutaneous injuries, since ET is significantly

produced in vivo. Staphylococcal DNA hybridization with

probes for ET can detect these fastidious strains.

As the bulk of ET-producing S. aureus strains belong to

phage group 2, we wondered whether all phage group 2

strains harbored the ET gene(s), with or without expression.

Among 32 strains tested belonging to this phage group, only

2 harbored the ETA gene. The same strains (and no others)

expressed this gene, as detected by electrosyneresis; no

hybridization occurred with the ETB probe. These results

indicate that phage group 2 strains do not necessarily possess

the ET gene(s).

Finally, as previously noted with electrosyneresis (14),

hybridization never detected the ET gene in the coagulasenegative

staphylococci tested.

Can such probes be used directly for the detection of

ET-producing strains in pathological samples? To answer

this question, we checked the sensitivity of our method. The

lowest detection limit was 106 lysed bacteria spotted onto

nitrocellulose or 100 ng of purified genomic DNA. This

bacterial number is too high to allow a sensitive diagnosis of

toxigenic staphylococcal infections directly from pathological

samples. The DNA hybridization technique is very

efficient and should be used for the precise study of previously

isolated staphylococcal strains and not for a direct

diagnosis from pathological samples. This method allows the

study of several hundred strains at a time.

ACKNOWLEDGMENTS

This work was supported by grant CRE 861018 from the Institut

National de la Santé et de la Recherche Médicale.

We thank N. El Solh, Centre National de Référence des Staphylocoques,

Institut Pasteur, Paris, France, who generously provided

strains of S. hominis and S. warneri.

LITERATURE CITED

1. Anthony, B. F., D. M. Giuliano, and W. Oh. 1972. Nursery

outbreak of staphylococcal scalded skin syndrome. Am. J. Dis.

J. CLIN. MICROBIOL.

Child. 124:41-44.

2. Arbuthnott, J. P., and B. Billcliffe. 1976. Qualitative and quantitative

methods for detecting staphylococcal epidermolytic

toxin. J. Med. Microbiol. 9:191-201.

3. Baker, D. H., K. D. Wuepper, and J. E. Rasmussen. 1978.

Staphylococcal scalded skin syndrome: detection of antibody to

epidermolytic toxin by a primary binding assay. Clin. Exp.

Dermatol. 3:17-23.

4. Fleurette, J., and J. Ritter. 1980. Prévalence des souches de

Staphylococcus aureus productrices d'exfoliatine dans le

groupe bactériophagique Il. Ann. Microbiol. (Paris) 131B:175-

183.

5. Kapral, F. A. 1975. Staphylococcus aureus exfoliatin, p. 263-

266. In D. Schlessinger (ed.), Microbiology-1975. American

Society for Microbiology, Washington, D.C.

6. Kapral, F. A., and M. M. Miller. 1971. Product of Staphylococcus

aureus responsible for the scalded skin syndrome. Infect.

Immun. 4:541-545.

7. Lee, C. Y., J. J. Schmidt, A. D. Johnson-Winegar, L. Spero, and

J. J. landolo. 1987. Sequence determination and comparison of

exfoliative toxin A and toxin B from Staphylococcus aureus. J.

Bacteriol. 169:3904-3909.

8. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular

cloning: a laboratory manual, p. 122. Cold Spring Harbor

Laboratory, Cold Spring Harbor, N.Y.

9. O'Toole, P. W., and T. J. Foster. 1987. Nucleotide sequence of

the epidermolytic toxin A gene of Staphylococcus aureus. J.

Bacteriol. 169:3910-3915.

10. Piémont, Y., M. Haubensack, and H. Monteil. 1984. Enzymelinked

immunosorbent assays for Staphylococcus aureus exfoliative

toxins A and B and some applications. J. Clin. Microbiol.

20:1114-1121.

11. Piémont, Y., and H. Monteil. 1983. New approach in the

separation of two exfoliative toxins from Staphylococcus aureus.

FEMS Microbiol. Lett. 17:191-195.

12. Piémont, Y., and H. Monteil. 1983. Mise en évidence par

électrosynérèse des deux sérotypes d'exfoliatine produits par

Staphylococcus aureus. Ann. Microbiol. (Paris) 134A:169-175.

13. Piémont, Y., E. Piémont, and D. Gérard. 1986. Fluorescence

studies of thermal stability of staphylococcal exfoliative toxins

A and B. FEMS Microbiol. Lett. 36:245-249.

14. Piémont, Y., S. Rifai, and H. Monteil. 1988. Les exfoliatines de

Staphylococcus aureus. Bull. Inst. Pasteur 86:263-296.

15. Rogolsky, M. 1979. Nonenteric toxins of Staphylococcus aureus.

Microbiol. Rev. 43:320-360.

16. Willard, D., H. Monteil, Y. Piémont, R. Assi, J. Messer, J.

Lavillaureix, R. Minck, and R. Gandar. 1984. L'exfoliatine dans

les staphylococcies néonatales. Nouv. Presse Med. 11:3769-

3771.

17. Wuepper, K. D., D. Haas Baker, and R. L. Dimond. 1976.

Measurement of the staphylococcal epidermolytic toxin: a comparison

of bioassay, radial immunodiffusion, and radioimmunoassay.

J. Invest. Dermatol. 67:526-531.

Downloaded from http://jcm.asm.org/ on August 27, 2013 by guest

More magazines by this user
Similar magazines