Download PDF (all abstracts) - BioMed Central

BMC Proceedings 2013, Volume 7 Suppl 6 

http://www.biomedcentral.com/bmcproc/supplements/7/S6 

MEETING ABSTRACTS 

23rd European Society for Animal Cell 

Technology (ESACT) Meeting: Better Cells for 

Better Health 

Lille, France. 23-26 June 2013 

Edited by Hansjörg Hauser 

Published: 4 December 2013 

These abstracts are available online at http://www.biomedcentral.com/bmcproc/supplements/7/S6 

Open Access 

INTRODUCTION 

I1 

Better Cells for Better Health: Abstracts of the 23 rd ESACT Meeting 

2013 in Lille 

Hansjörg Hauser 

Helmholtz-Zentrum für Infektionsforschung GmbH, Department of Gene 

Regulation and Differentiation, 38124 Braunschweig, Germany 

E-mail: hansjoerg.hauser@helmholtz-hzi.de 

BMC Proceedings 2013, 7(Suppl 6):I1 

The European Society of Animal Cell Technology (ESACT) is a society that 

brings together scientists, engineers and other specialists working with 

animal cells in order to promote communication of experiences between 

European and international investigators and progress development of 

cell systems in productions derived from them. 

Animal cells are being used as substrates in basic research and also for 

the production of proteins. Tissue engineering, gene and cell therapies, 

organ replacement technologies and cell-based biosensors contribute to 

a considerable widening of interest and research activity based on animal 

cell technology. 

Since its foundation 35 years ago, the ESACT Meeting has developed into 

the international reference event in animal cell technology, building on a 

tradition of combining both basic science and its application into 

industrial biotechnology. 

The abstracts of this supplement are from the 23 rd ESACT meeting that 

was held in Lille, France, June 23 - 26, 2013. The abstracts review the 

presentations from this meeting and should be a useful resource for the 

state-of-the-art in animal cell technology. 

ORAL PRESENTATIONS 

O1 

A novel genotype of MVA that efficiently replicates in single cell 

suspensions 

Ingo Jordan * , Volker Sandig 

ProBioGen AG, 13086 Berlin, Germany 

E-mail: ingo.jordan@probiogen.de 

BMC Proceedings 2013, 7(Suppl 6):O1 

Background: Vectored vaccines based on modified vaccinia Ankara 

(MVA) may lead to new treatment options against infectious diseases and 

certain cancers. MVA is highly attenuated and requires avian cells for 

production. We established avian continuous cell lines (including CR and 

related CR.pIX) and adapted these cells to proliferation in single-cell 

suspension in a chemically defined medium [1,2]. Replication of several 

viruses was efficient in CR suspension cultures [3,4] but yields for MVA 

were low. We suspected that cell-to-cell spread may be an important 

mechanism for MVA replication in agitated suspension cultures and 

developed a production medium that is added at the time of infection to 

induce cell aggregates [2]. MVA (and other host-restricted poxviruses) 

replicate to very high titers with this robust and fully scalable cultivation 

protocol but further improvement may facilitate production for large 

vaccine programs. We now describe a novel genotype of MVA that 

replicates with high efficiency in single-cell suspensions without 

aggregate induction. 

Materials and methods: Motivated to discover new phenotypes, we 

quantified replication of successive MVA passages in aggregated CR 

suspension cultures. Because titers increased slightly within 10 passages, 

viral genomic DNA of early and late passages was sequenced. Of the 

advanced passage, a contiguous sequence of 135 kb was recovered and 

revealed a genotype (which we call MVA-CR) where the structural proteins 

A3L, A9L and A34R (in vaccinia virus nomenclature) each carry a single 

amino acid exchange (Figure 1A). The novel genotype appears to 

accumulate in our system but to completely remove traces of wildtype 

plaque purification was performed. The pure isolate (called MVA-CR19) was 

further characterized and compared to the wildtype. 

Results: The aggregate-based process was developed to facilitate cell-to-cell 

spread, which appears to be an important mechanism for vaccinia virus 

replication. Surprisingly, multiplication of MVA-CR19 appears to be efficient 

also in single-cell avian suspension cultures (Figure 1B) with increased 

infectious titers in the cell-free supernatant. Because of this qualitative 

difference between wildtype and MVA-CR19, we hypothesized that a smaller 

fraction of the MVA-CR isolate remains cell associated and that this capacity 

allows viruses of the novel genotype to spread also in single cell 

suspensions. As one test of our proposed explanation we repeated the 

passaging experiments in adherent cultures. No mutations in the three 

genes that distinguish MVA-CR were detected, suggesting that the 

contribution of host cell properties to the observed changes in the virus 

population recovered from the suspension process may be negligible. 

However, the MVA-CR phenotype is evident also in adherent cells: compared 

to wildtype MVA, plaques formed by MVA-CR19 on CR cell monolayers in 

comet assays appear to be larger and to develop earlier [5]. These results 

are consistent with mechanisms that allow MVA-CR19 to replicate, infect or 

uncoat faster, or be released with greater efficiency from host cells. For 

further characterization of this effect, adherent cells were infected with a 

high multiplicity of 10 and briefly subjected to a pH shift. This is predicted 

© 2013 various authors, licensee BioMed Central Ltd. All articles published in this supplement are distributed under the terms of the 

Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and 

reproduction in any medium, provided the original work is properly cited.



Page 2 of 151 

Figure 1(abstract O1) (A) Schematic of the genomic DNA of MVA-CR. The region covered by next generation sequencing is shown together with the 

mutations (in single letter code for amino acids, e.g. H639Y is His 639 ® Tyr) in the three genes. ITR (viral telomers) and deletion sites in MVA as light gray boxes 

are shown for orientation. (B) CR.pIX single-cell suspension cultures were infected with wildtype (wt) and MVA-CR19. Cells were immunostained for virus 

antigens 48 h post infection and quantified by FACS to investigate differences in the dissemination of infectious units in absence of aggregate induction. 

(C) Cell fusion is induced by wildtpe MVA but less so by MVA-CR19. Red immunofluorescence against MVA antigens serves as a positive control for infection. 

Blue fluorescence of DNA is shown for orientation. MVA-negative cells next to infected cells are shown in the panels where virus was added to a multiplicity 

of infection (MOI) of 0.1. 

to activate the viral fusion apparatus so that cell-associated viruses in a 

confluent cell monolayer can induce formation of syncitia [6]. As shown in 

Figure 1C, cell fusion appears to be less pronounced in cultures infected 

with MVA-CR suggesting that either fewer virions of this genotype remain 

cell associated or that fusion may be less important for entry of such virions. 

A molecular basis for the proposed improved MVA-CR19 dissemination is 

that all three of the observed mutations each target a different 

component of the complex viral particles, the core and the different 

membranes of the mature intracellular and extracellular virions. We are in 

the process of generating various combinations of recombinant MVAs to 

determine whether all three factors need to cooperate to produce the 

observed effects or whether a single gain of function mutation in any 

one or two factors is sufficient. 

Conclusions: Compared to wildtype MVA, plaques formed by MVA-CR19 on 

adherent CR cells appear to be larger and to develop earlier. Titers are 

slightly higher in complete lysates and significantly elevated in cell-free 

supernatants. MVA-CR19 replicates efficiently without aggregate induction 

also in single cell suspension cultures. We hypothesize that a greater fraction 

of MVA-CR19 escapes the hosts for infection of distant targets. In such a 

model the new genotype should not confer a significant advantage 

to viruses spreading in cell monolayers, and indeed we could not generate 

the MVA-CR genotype by passaging in adherent cultures. Attenuation has 

yet to be confirmed for MVA-CR but host cell-restriction appears to have 

been fully maintained for Vero and HEK 293 cells. 

Supply of an injectable vaccine preparation may be facilitated with this 

strain as production in single cell suspension using only a cell proliferation 

medium is less complex compared to the current protocol that requires 

cell aggregate induction by addition of a virus production medium. 

Furthermore, MVA-CR has a tendency to accumulate in the extracellular 

volume. Purification of live virus out of a cell-free suspension may allow



Page 3 of 151 

enhanced purity compared to a process that initiates with a complete 

lysate containing the full burden of unwanted host cell-derived 

components. 

References 

1. Jordan I, Vos A, Beilfuss S, Neubert A, Breul S, Sandig V: An avian cell line 

designed for production of highly attenuated viruses. Vaccine 2009, 

27:748-756. 

2. Jordan I, Northoff S, Thiele M, Hartmann S, Horn D, Höwing K, Bernhardt H, 

Oehmke S, von Horsten H, Rebeski D, Hinrichsen L, Zelnik V, Mueller W, 

Sandig V: A chemically defined production process for highly attenuated 

poxviruses. Biol J Int Assoc Biol Stand 2011, 39:50-58. 

3. Lohr V, Rath A, Genzel Y, Jordan I, Sandig V, Reichl U: New avian 

suspension cell lines provide production of influenza virus and MVA in 

serum-free media: studies on growth, metabolism and virus 

propagation. Vaccine 2009, 27:4975-4982. 

4. Lohr V, Genzel Y, Jordan I, Katinger D, Mahr S, Sandig V, Reichl U: Live 

attenuated influenza viruses produced in a suspension process with 

avian AGE1.CR.pIX cells. Bmc Biotechnol 2012, 12:79. 

5. Jordan I, Horn D, John K, Sandig V: A Genotype of Modified Vaccinia 

Ankara (MVA) that Facilitates Replication in Suspension Cultures in 

Chemically Defined Medium. Viruses 2013, 5:321-339. 

6. Ward BM: Visualization and characterization of the intracellular 

movement of vaccinia virus intracellular mature virions. J Virol 2005, 

79:4755-4763. 

O2 

Electrically modulated attachment and detachment of animal cells 

cultured on an ITO patterning electrode surface 

Sumihiro Koyama 

Institute of Biogeosciences, Japan Agency for Marine-Earth Science and 

Technology, 2-15 Natsushima-cho, Yokosuka, 237-0061, Japan 

E-mail: skoyama@jamstec.go.jp 


Background: Micropatterning techniques of animal cells have been 

reported by numerous groups and fall into 6 major classifications (1). 

There are 1) photolithography, 2) soft lithography, 3) ink jet printing, 4) 

electron beam writing, 5) electrochemical desorption of self-assembled 

monolayers, and 6) dielectrophoresis. These six cell micropatterning 

techniques cannot modulate both the attachment and detachment of 

animal cells iteratively at the same positions, however. The present work 

has demonstrated that a weak electrical potential can modulate the 

attachment and detachment of specifically positioned adhesive animal 

cells using a patterned indium tin oxide (ITO)/glass electrode culture 

system [1], (Figure 1). 

Materials and methods: A patterned indium tin oxide (ITO) optically 

transparent working electrode was placed on the bottom of a chamber 

slide with a counter- (Pt) and reference (Ag/AgCl) electrode. The ITO 

patterning was formed by a reticulate ITO region and arrayed square glass 

regions of varying size. Constant and rectangular potentials were applied 

to the working ITO/glass electrode using the Ag/AgCl reference and the Pt 

counterelectrode (Figure 1). The potentials were delivered via a function 

generator (AD-8624A, A&D Company, Tokyo, Japan) and a potentiostat 

(PS-14, Toho Technical Research, Tokyo, Japan). 

Results: Animal cells suspended in serum or sera containing medium 

were drawn to and attached on a reticulate ITO electrode region to 

which a +0.4-V vs. Ag/AgCl-positive potential was applied. Meanwhile, the 

cells were successfully placed on the square glass regions by -0.3-V vs. Ag/ 

AgCl-negative potential application. 

Animal cells detached not only from the ITO electrode but also from the 

square glass regions after the application of a ± 10 mV vs. Ag/AgCl, 9-MHz 

triangular wave potential in PBS(-) for30-60min.Thetriangularwave 

potential-induced cell detachment is almost completely noncytotoxic, and 

no statistical differences between trypsinization and the high frequency 

wave potential application was observed in HeLa cell growth. 

Conclusions: Using the 3-electrode culture system, the author succeeded 

in modulation of the attachment and detachment of animal cells on the 

working electrode surface. The electrical modulation of specifically 

positioned cell attachment and detachment techniques holds potential 

for novel optical microscopic cell sorting analysis in lab-on-chip devices. 

Reference 

1. Koyama S: Electrically modulated attachment and detachment of animal 

cells cultured on an optically transparent patterning electrode. J Biosci 

Bioeng 2011, 111:574-583, (Erratum in: J Biosci Bioeng 2012, 114: 240-241). 

O3 

Novel strategy for a high-yielding mAb-producing CHO strain 

(overexpression of non-coding RNA enhanced proliferation and 

improved mAb yield) 

Hisahiro Tabuchi 

Chugai Pharmaceutical Co., Ltd., 5-5-1 Ukima, Kitaku, Tokyo, Japan 115-8543 

E-mail: tabuchihsh@chugai-pharm.co.jp 


Background: Innovation in mAb production is driven by strategies to 

increase yield. A host cell line constructed to overexpress TAUT (taurine 

transporter) produced a higher proportion of high-mAb-titer strains [1]. 

From these we selected a single TAUT/mAb strain that remained viable 

for as long as 1 month. Its improved viability is attributed to improved 

metabolic properties. It was also more productive (>100 pg/cell/day) and 

yielded more mAb (up to 8.1 g/L/31 days) than the parent cell line [2]. These 

results suggested that this host cell engineering strategy has great potential 

for the improvement of mAb-producing CHO cells. 

Results: Our present challenge was to achieve a high yield in a shorter 

culture period by modulating events in the nucleus by using non-coding 

RNA (ncRNA). We looked for long ncRNA (lncRNA) that was abnormally 

expressed in high-titer cells. A Mouse Genome 430 2.0 array (Affymetrix) 

identified the lncRNA (Figure 1) as a complementary sequence of the 

3’ non-coding region of mouse NFKBIA (NF-kappa-B inhibitor alpha) mRNA. 

NFKBIA is an important regulator of the transcription factor NFKB, a 

positive regulator of cell growth. Since NFKBIA suppresses NFKB function, 

inhibition of NFKBIA by overexpression of the lncRNA might further 

enhance cell proliferation. We genetically modified the TAUT/mAb strain to 

overexpress part of the lncRNA. The resulting co-overexpression strains 

gave increased yield, and one strain increased yield in a shorter culture 

period (up to 6.0 g/L/14 days from 3.9 g/L/14 days). Interestingly, however, 

this effect might not be due to enhancement of the NFKB-dependent 

promoter activity of the mAb expression plasmid because mAb production 

under EF-1a promoter without an NFKB binding site was also enhanced by 

overexpression of part of the lncRNA. Since overexpression of the partial 

sequence still functions as an antibody production enhancing sequence in 

mAb-producing cell lines, many unexpected functions from ncRNAcontaining 

microRNA might exist. 

Conclusions: 1. We found a lncRNA that was abnormally expressed in hightiter 

cells. It was identified as the antisense RNA of NFKBIA. Overexpression 

of part of the lncRNA suppressed NFKBIA mRNA. 

2. Overexpression of part of the lncRNA improved CHO cell performance. 

The transporter/lncRNA co-overexpressing strain gave increased yield in a 

shorter culture period. 

3. This effect might not be due to enhancement of the NFKB-dependent 

promoter of the mAb expression plasmid. 

References 

1. Tabuchi H, Sugiyama T, Tanaka S, Tainaka S: Overexpression of taurine 

transporter in Chinese hamster ovary cells can enhance cell viability and 

product yield, while promoting glutamine consumption. Biotechnol 

Bioeng 2010, 107:998-1003. 

2. Tabuchi H, Sugiyama T: Cooverexpression of alanine aminotransferase 

1 in Chinese hamster ovary cells overexpressing taurine transporter 

further stimulates metabolism and enhances product yield. Biotechnol 

Bioeng 2013, 110:2208-2215. 

O4 

Improvement in a human IgE-inducing system by in vitro immunization 

Shuichi Hashizume 1* , Hiroharu Kawahara 2 

1 Idea-Creating Lab, Yokohama 236-0005, Japan; 

2 Kitakyushu National College 

of Technology, Kitakyushu 802-0985, Japan 

E-mail: hashizume.shu@nifty.com 

BMC Proceedings 2013, 7(Suppl 6):O4



Page 4 of 151 

Figure 1(abstract O2) Schematic illustration of a patterned ITO/glass electrode culture system. 

Introduction: The immune system, which is the self-defense system of the 

body, occasionally responds in a manner that is harmful to the body. The 

incidence and severity of allergies caused by cedar pollen, house dust, egg 

protein, and many others are increasing and have recently become a 

serious social problem. We have previously developed an original in vitro 

system for inducing human IgE antibody specific to a designated antigen 

that can be used to study various allergic reaction [1]. In this study, we 

attempted to improve this system to stimulate IgE levels in its medium to 

provide a highly sensitive screening method. 

Experimental: The original in vitro IgE-inducing system was established 

using lymphocytes and plasma from donors which were not naturally 

immunized with allergens. The original system contained ERDF supplemented 

with fetal bovine serum (final concentration, 5%) and contained human 

plasma (10%) as an essential component. Human peripheral blood 

lymphocytes and plasma were obtained by density-gradient centrifugation 

at 400 × g for 30 min with cell separation medium, Ficoll-Paque Plus. 

This system also included allergen (100 ng/ml), interleukins (IL-) 2, 4, and 

6 (10 ng/ml each) and muramyl dipeptide (MDP, 10 μg/ml), as described 

previously [2]. Human lymphocytes were cultured in 96- or 24-well plates 

at a final density of 1 × 10 6 cells/ml in the medium and incubated in a CO 2 

incubator at 37°C for 10 days. During the 10 days, IgE was specifically 

secreted into the medium. 

Results and discussion: Effects of human plasma and interleukins on 

human IgE induction: The necessity for inclusions of human plasma and 

interleukins was shown, when human lymphocytes and plasma from donors 

which were not naturally immunized with allergens were used. For the 

induction of IgE, human lymphocytes and plasma obtained from the same 

donor were required [2]. Addition of IL-2, 4 and 6 induced IgE. Elimination of 

each of these three interleukins from the medium resulted in no induction 

of IgE (data not shown). From these results, IL-2, 4 and 6 are considered to 

be essential factors to initially immunize lymphocytes with allergens, when 

lymphocytes and plasma from donors not naturally immunized with 

allergens were used. We next attempted to improve this system to stimulate 

IgE levels in the medium to provide a highly sensitive screening method.



Page 5 of 151 

Figure 1(abstract O3) The lncRNA is an antisense RNA of NFKBIA mRNA. 

Effects of elimination of IL-2 from the medium on human IgE 

production: In this study, the lymphocytes and plasma of donors naturally 

immunized with various allergens were used. Therefore, the IgE level of the 

control was high, i.e., more than 300 ng/ml, as shown in Table 1. Elimination 

of IL-2 from the medium resulted in the induction of higher IgE levels 

compared with medium containing IL-2 (Table 1). These data indicate that 

elimination of IL-2 from the medium induced higher IgE levels when human 

lymphocytes and plasma obtained from naturally immunized donors were 

used. Furthermore, strawberry extract in the media containing Cryj1 and 

Derf2 decreased the secreted IgE levels by 38% and 24%, respectively. There 

is a possibility that strawberries may alleviate allergies. 

In summary, elimination of IL-2 from the IgE-inducing system medium 

increased the IgE induction level when human lymphocytes and plasma 

obtained from donors naturally immunized with allergens were used. The 

level of about 1 μg/ml IgE reported to be secreted in this study may be 

the highest compared with those reported elsewhere. The original and 

improved systems for human IgE production are considered to be of 

profound use for studying allergy mechanisms and surveying allergyalleviating 

products, respectively. 

Table 1(abstract O4) Effects of various additives on IgE 

productivity 

Medium 

IgE productivity (ng/ml) 

Control (ERDF + hPlasma + FBS) 319 ± 19 

+ IL-2 + IL-4 + IL-6 + MDP + Cryj1 356 ± 85 

+ IL-4 + IL-6 + MDP + Cryj1 549 ± 189 

+ IL-4 + IL-6 + MDP + Cryj1 + 341 ± 55 

strawberry extract 

+ IL-4 + IL-6 + MDP + Derf2 660 ± 172 

+ IL-4 + IL-6 + MDP + Derf2 + 499 ± 167 

strawberry extract 

References 

1. Kawahara H, Maeda-Yamamoto M, Hakamata K: Effective induction and 

acquisition of human IgE antibodies reactive with house-dust mite 

extracts. J Immunol Methods 2000, 233:33-40. 

2. Hashizume S, Kawahara H: Inducing of human IgE antibodies by in vitro 

immunization. Proceedings of the 20th Annual Meeting of the European 

Society for Animal Cell Technology (ESACT) Springer Science+Business Media 

B.V: Noll T 2010, 833-836, Dresden, Germany, 2007. 

O5 

First CpG island microarray for genome-wide analyses of DNA 

methylation in Chinese hamster ovary cells: new insights into the 

epigenetic answer to butyrate treatment 

Anna Wippermann 1,2* , Sandra Klausing 1 , Oliver Rupp 2 , Thomas Noll 1,2 , 

Raimund Hoffrogge 1 

1 Cell Culture Technology, Bielefeld University, Bielefeld, Germany; 

2 Center for 

Biotechnology, Bielefeld University, Bielefeld, Germany 

E-mail: anna.wippermann@uni-bielefeld.de 


Background: Optimizing productivity and growth of recombinant Chinese 

hamster ovary (CHO) cells requires insight and intervention in regulatory 

processes. This is to some extent accomplished by several ‘omics’ 

approaches. However, many questions remain unanswered and bioprocess 

development is therefore still partially empirical. In this regard, the analysis 

of DNA methylation as one of the earliest cellular regulatory levels is 

increasingly gaining importance. This epigenetic process is known to 

influence transcriptional events when it occurs at specific genomic regions 

with high CpG frequencies, called CpG islands (CGIs). Being methylated, CGIs 

attract proteins with methyl-DNA binding domains (MBD proteins) that in 

turn can interact with chromatin modifying complexes, thereby leading to a 

transcriptionally inactive state of the associated gene [1]. In CHO cells, DNA 

methylation has yet only been investigated in gene-specific approaches, e.g. 

regarding the CMV promoter [2]. To analyze differential DNA methylation in 

CHO cultures on a genomic scale, we developed a microarray covering



Page 6 of 151 

19,598 CGIs in the CHO genome. We applied it to elucidate the effect of 

butyrate on CHO DP-12 cultures, as this short chain fatty acid (SCFA) is 

known to elicit epigenetic responses by inhibiting histone-deacetylases [3]. 

Materials and methods: Based on the genomic and transcriptomic 

information available for CHO cells [4,5], 21,993 promoter-associated and 

intragenic CGIs were identified in the CHO genome using an algorithm 

according to Takai and Jones [6]. We developed a customized 60 K 

microarray (printed by Agilent Technologies) covering 19,598 (89%) of the 

identified CGIs with an average probe spacing of 500 bp. Genomic DNA of 

each four replicate experimental and reference CHO DP-12 (clone #1934, 

ATCC CRL-12445) batch cultures was phenol-chloroform extracted and 

sheared by sonication. Methylated fragments were enriched using the 

methyl-CpG binding domain of MBD2 protein fused to the Fc tail of IgG1 

(MBD2-Fc protein) coupled to magnetic beads (New England Biolabs). 

Experimental samples prior to treatment with 3 mM butyrate (0 h) as well as 

24 hours and 48 hours after butyrate addition were directly compared to the 

references by two-colour co-hybridizations. Data analysis was carried out 

upon LOWESS normalization by Student’s t-tests with p-values ≤ 0.05 using 

the open source platform EMMA2 [7]. Confirmatory COBRA (combined 

bisulfite restriction analysis) was performed by amplifying a 541 bp fragment 

of the myc proto-oncogene protein-like gene (Gene ID: 100758352) following 

bisulfite treatment of genomic DNA using the primers myc_for 5’-atttggaagg 

atagtaagtatattggaag-3’ and myc_rev 5’- aaataaaactctaactcaccatatctcct-3’ and 

the nested primers myc_for_nested 5’- atagtaagtatattggaaggggagtg-3’ and 

myc_rev_nested 5’- taaaactctaactcaccatatctcctc-3’ (oligonucleotides obtained 

from Metabion). Purified PCR products were digested with BstUI (Fermentas) 

and separated in agarose gels. 

Results: Butyrate treated CHO DP-12 cultures stopped proliferating and 

decreasing viabilities could be detected 24 hours upon addition of the 

SCFA (Figure 1A). Simultaneously, cell specific productivities increased by 

nearly 100% (17 pg/cell/day 48 hours after butyrate addition compared to 

9 pg/cell/day in the reference cultures). Surprisingly, 228 differentially 

methylated genes could be detected in a comparison between the 

experimental cultures and the references even before addition of butyrate 

(Figure 1B), indicating substantial heterogeneity among identically handled 

parallel cultivations. 24 hours after butyrate addition we found a strongly 

increased number of 1221, solely at this point in time, differentially 

methylated genes. Gene ontology classification showed that, amongst 

others, the terms ‘stress response’, ‘chromatin modification’ or ‘signalling 

cascade’ were significantly overrepresented. Pathways such as the Ca 2+ , 

MAPK and Wnt signalling systems were comprised within the latter group 

and showed a large coverage by differentially methylated components. 

48 hours upon butyrate addition the number of differential methylations 

decreased by about 90%. COBRA analysis of the Wnt responsive myc 

proto-oncogene protein-like gene showed clearly detectable cleavage 

products (indicating methylation of the BstUI sites in the original DNA) 

24 hours upon butyrate addition, that completely vanished another 

24 hours later (Figure 1C), confirming the results of the microarray analysis. 

Conclusions: Our first genome-wide screening for differential DNA 

methylation in CHO cells shows that the epigenetic response upon 

butyrate treatment seems to be highly dynamic and reversible. This was 

confirmed by applying the bisulfite-based single-gene method COBRA 

to analyze a region of the myc proto-oncogene protein-like gene. 

Furthermore, detection of differential methylation before butyrate addition 

Figure 1(abstract O5) (A) Viable cell densities, viabilities and cell specific productivities for batch CHO DP-12 reference (blue) and 

butyrate treated (red) cultivations. The green dashed line marks the point of butyrate addition. Error bars represent standard deviations. (B) Venn 

diagram showing the numbers of genes associated with differentially methylated CpG islands before (0 h), 24 hours and 48 hours upon butyrate addition. 

Gene Ontology classification was performed using DAVID [9] with an EASE score ≤ 0.01 (C) COBRA analysis of a part of the CGI (blue) of the myc 

proto-oncogene protein-like gene (green) differential methylation was detected for (red). Cleavage products indicate methylation of BstUI sites in the 

original DNA.



Page 7 of 151 

indicates that heterogeneity in DNA methylation occurs even if cells 

originated from the same preculture and were treated identically. This 

occurrence of differentially methylated genes in parallel cultivations 

strongly fosters the hypothesis that the culture history influences final 

process outcomes [8]. It underlines the importance of DNA methylation 

analyses in CHO cells, especially considering the fact that DNA methylation 

patterns can remain stably anchored over several generations. 

References 

1. Ndlovu MN, Denis H, Fuks F: Exposing the DNA methylome iceberg. 

Trends Biochem Sci 2011, 36:381-387. 

2. Osterlehner A, Simmeth S, Göpfert U: Promoter methylation and transgene 

copy numbers predict unstable protein production in recombinant 

Chinese hamster ovary cell lines. Biotechnol Bioeng 2011, 108:2670-2681. 

3. Mariani MR, Carpaneto EM, Ulivi M, Allfrey VG, Boffa LC: Correlation 

between butyrate-induced histone hyperacetylation turn-over and 

c-myc expression. J Steroid Biochem Mol Biol 2003, 86:167-171. 

4. Xu X, Nagarajan H, Lewis NE, Pan S, Cai Z, Liu X, Chen W, Xie M, Wang W, 

Hammond S, Andersen MR, Neff N, Passarelli B, Koh W, Fan HC, Wang J, 

Gui Y, Lee KH, Betenbaugh MJ, Quake SR, Famili I, Palsson BO, Wang J: The 

genomic sequence of the Chinese hamster ovary (CHO)-K1 cell line. 

Nat Biotechnol 2011, 29:735-741. 

5. Becker J, Hackl M, Rupp O, Jakobi T, Schneider J, Szczepanowski R, Bekel T, 

Borth N, Goesmann A, Grillari J, Kaltschmidt C, Noll T, Pühler A, Tauch A, 

Brinkrolf K: Unraveling the Chinese hamster ovary cell line transcriptome 

by next-generation sequencing. J Biotechnol 2011, 156:227-235. 

6. Takai D, Jones P: The CpG island searcher: a new WWW resource. In silico 

biology 2003, 3:235-40. 

7. Dondrup M, Albaum SP, Griebel T, Henckel K, Jünemann S, Kahlke T, 

Kleindt CK, Küster H, Linke B, Mertens D, Mittard-Runte V, Neuweger H, 

Runte KJ, Tauch A, Tille F, Pühler A, Goesmann A: EMMA 2–a 

MAGE-compliant system for the collaborative analysis and integration 

of microarray data. BMC Bioinformatics 2009, 10:50. 

8. Le H, Kabbur S, Pollastrini L, Sun Z, Mills K, Johnson K, Karypis G, Hu WS: 

Multivariate analysis of cell culture bioprocess data–lactate consumption 

as process indicator. J Biotechnol 2012, 162:210-23. 

9. Huang DW, Sherman BT, Zheng X, Yang J, Imamichi T, Stephens R, 

Lempicki RA: Extracting biological meaning from large gene lists with 

DAVID. Curr Protoc Bioinformatics 2009, Chapter 13, Unit 13.11. 

O6 

Aspects of vascularization in Multi-Organ-Chips 

Katharina Schimek 1 , Reyk Horland 1* , Sven Brincker 1 , Benjamin Groth 1 , 

Ulrike Menzel 1 , Ilka Wagner 1 , Eva-Maria Materne 1 , Gerd Lindner 1 , 

Alexandra Lorenz 1 , Silke Hoffmann 1 , Mathias Busek 2 , Frank Sonntag 2 , 

Udo Klotzbach 2 , Roland Lauster 1 , Uwe Marx 1,3 

1 TU Berlin, Institute of Biotechnology, Faculty of Process Science and 

Engineering, 13355 Berlin, Germany; 

2 Fraunhofer IWS Dresden, 01277 

Dresden, Germany; 

3 TissUse GmbH, 15528 Spreenhagen, Germany 

E-mail: reyk.horland@tu-berlin.de 


Background: Enormous efforts have been made to develop circulation 

systems for physiological nutrient supply and waste removal of in vitro 

cultured tissues. These developments are aiming for in vitro generation of 

organ equivalents such as liver, lymph nodes and lung or even multi-organ 

systems for substance testing, research on organ regeneration or transplant 

manufacturing. Initially technical perfusion systems based on membranes, 

hollow fibers or networks of micro-channels were used for these purposes. 

However, none of the currently available systems ensures long-term 

homeostasis of the respective tissue over months. This is caused by a lack of 

in vivo-like vasculature which leads to continuous accumulation of protein 

sediments and cell debris in the systems. Here, we demonstrate a closed 

and self-contained circulation system emulating the natural blood perfusion 

environment of vertebrates at tissue level. 

Material and methods: The Multi-Organ-Chip (MOC) device accommodates 

two microvascular circuits (Figure 1a). Each circuit is operated by a separate 

peristaltic on-chip micropump, modified from Wu and co-workers [1]. 

Microfluidic 3D channels were formed in PDMS by replica molding from 

master molds and were afterwards closed by bonding to a cover-slip by air 

plasma treatment. To retain PDMS hydrophilicity, channels were filled with 

culture medium immediately after sealing. To emulate the natural blood 

perfusion environment, human dermal microvascular endothelial cells 

(HDMEC) were used. The cells were seeded into the PDMS channels and 

adhered to all channel walls after subsequent static cultivation on each 

channel side. Afterwards cells were cultured up to 14 days in PDMS channels 

under pulsatile flow conditions. 

Figure 1(abstract O6) HDMEC microvasculature in the MOC device. a) Exploded view of the device comprising a polycarbonate CP (blue), 

the PDMS-glass chip accommodating two microvascular circuits (yellow; footprint: 76 mm × 25 mm; height: 3 mm) and a heatable MOC-holder (red). 

b) Calcein AM assay (red) showed viable and evenly distributed HDMEC in all areas of the circulation. Scale bar = 2 mm. c) Image stack taken by 

two-photon laser scanning microscopy. HDMEC were able to cover all walls of the channels forming a fluid tight layer. Functionality of the established 

microvascular vessel system was demonstrated by d) ac-LDL uptake of HDMEC and e) CD31 (red), vWF (green) expression throughout the entire cell 

population. Nuclei were counterstained with Hoechst 33342 (blue). Scale bar = 100 μm.



Page 8 of 151 

Results: A miniaturized circulation system has been established over a 

period of 14 days by fully covering all channels and surfaces of the MOC 

with human microvascular endothelial cells. By injecting 2 × 10 7 cells ml -1 

into the channels, a homogeneous distribution of cells throughout all 

channels was achieved (Figure 1b). During the following static incubation, 

cells adhered well to the air plasma treated channel walls. A peristaltic 

micro-pump was used to create culture medium circulation. After adaption 

to shear stress, HDMEC showed an elongation and alignment parallel to 

the flow direction. Three-dimensional reconstitutions of image stacks 

indicate that cells formed confluent monolayers on all walls of the channels 

(Figure 1c). During the whole cultivation time they maintained adherence 

to the channel walls and were positive for Calcein AM viability staining 

(Figure 1b). After 14 days of culture HDMEC forming the microvascular circuit 

were positive for ac-LDL uptake (Figure 1d) and expressed the endothelialspecific 

marker CD31 and von Willebrand Factor (vWF) (Figure 1e). 

Conclusion: A robust procedure applying pulsatile shear stress has been 

established to cover all fluid contact surfaces of the system with a functional, 

tightly closed layer of HDMEC. 

Long-term cultivation of elongated and flow-aligned HDMEC inside the chipbased 

microcirculation was demonstrated over a period of 14 days. For such 

endothelialized microfluidic devices to be useful for substance testing, it is 

essential to show long-term viability and function in the presence of 

physiological flow rates as shown here. These artificial vessels are an 

important approach for systemic substance testing in Multi-Organ-Chips. 

The miniaturized circulation system creates the conditions for circulation of 

nutrients through the organoid culture chamber, allows for in vivo-like 

crosstalk between endothelial cells and tissues and prevents clumping 

inside the channels. Compared with conventional cell culture techniques, a 

microfluidic-based cell culture may mimic more accurate in vivo-like 

extracellular conditions, as the culture of cells and organ models in perfused 

microfluidic systems can improve their oxygen and nutrient supply. This 

makes it suitable for long-term cultivation and more efficient drug studies. 

In future, such endothelialized bioreactors might be used for testing 

vasoactive substances. Finally, the described system can now be used for 

the establishment of organ-specific capillary networks. Here, we will adhere 

to our recently published roadmap toward vascularized ‘’human-on-a-chip’’ 

models to generate systemic data fully replacing the animals or human 

beings currently used [2]. 

Acknowledgements: The work has been funded by the German Federal 

Ministry for Education and Research, GO-Bio Grant No. 0315569. 

References 

1. Wu M-H, Huang S-B, Cui Z, Cui Z, Lee G-B: A high throughput perfusionbased 

microbioreactor platform integrated with pneumatic micropumps 

for three-dimensional cell culture. Biomedical microdevices 2008, 

10:309-319. 

2. Marx U, Walles H, Hoffmann S, Lindner G, Horland R, Sonntag F, 

Klotzbach U, Sakharov D, Tonevitsky A, Lauster R: “Human-on-a-chip” 

developments: a translational cutting-edge alternative to systemic 

safety assessment and efficiency evaluation of substances in laboratory 

animals and man? Alternatives to laboratory animals: ATLA 2012, 

40:235-257. 

O7 

Rapid construction of transgene-amplified CHO cell lines by cell cycle 

checkpoint engineering 

Kyoungho Lee 1 , Kohsuke Honda 1 , Hisao Ohtake 1 , Takeshi Omasa 1,2* 

1 Department of Biotechnology, Graduate School of Engineering, Osaka 

University, 2-1 Yamadaoka, Suita, Osaka 565-0871, Japan; 

2 Institute of 

Technology and Science, The University of Tokushima, 2-1 Minamijosanjimacho, 

Tokushima 770-8506, Japan 

E-mail: omasa@bio.tokushima-u.ac.jp 


Introduction: Dihydrofolate reductase (DHFR)-mediated gene amplification 

has been widely used to establish high-producing mammalian cell lines 

[1-3]. However, since gene amplification is an infrequent event, in that many 

rounds of methotrexate (MTX) selection to amplify the transgene and 

screening of over several hundred individual clones are required to obtain 

cells with high gene copy numbers [4]. Consequently, the process for DHFRmediated 

gene amplification is a time-consuming and laborious step for cell 

line construction. Here, we present a novel concept to accelerate gene 

amplification through cell cycle checkpoint engineering. In our knowledge, 

there is no previous report which focused on controlling cell cycle 

checkpoint to enhance the efficiency of DHFR gene amplification system. 

Materials and methods: A small interfering RNA (siRNA) expression 

vector against Ataxia-Telangiectasia and Rad3-Related (ATR), a cell cycle 

checkpoint kinase, was transfected into Chinese hamster ovary (CHO) cells. 

The effects of ATR down-regulation on gene amplification and productivity 

in CHO cells producing green fluorescent protein (GFP) and monoclonal 

antibody (mAb) were investigated. 

Results and discussion: Analysis of GFP expression level during gene 

amplification process: The ratio of GFP-expressing cells was evaluated 

by flow cytometry analysis during the gene amplification process at 100-, 

250-, and 500-nM MTX concentrations. In the process of gene amplification 

at all MTX concentrations, the pools of ATR-downregulated cells showed a 

much higher percentage of GFP-positive cells as compared with the pools 

of mock cells. At 100-nM MTX concentration, the percentage of GFPpositive 

cells in the CHO-siATR cell pool was 18.7% of total cells, which 

was approximately twice of the 8.4% in the mock cells. At 250- and 

500-nM MTX concentrations, CHO-siATR cell pools had 28.6 and 39.2% 

GFP-positive cells, respectively, which were up to six times higher than the 

4.6 and 6.8% of the pools of mock cells. 

Comparison of IgG productivity: IgG-producing cell lines were generated 

to confirm the previous results obtained in GFP-producing cell lines. The 

ATR-downregulated cells showed a significant increase in specific production 

rate of an average of 0.08 pg cell −1 day −1 , which was approximately four 

times higher than the average of 0.02 pg cell −1 day −1 in the mock cells. 

The volumetric productivity of each cell line was also investigated to 

evaluate the influence of ATR downregulation. The volumetric productivity 

of ATR knockdown cells was an average of 0.035 mg L −1 day −1 , which was 

approximately three times higher than the average of 0.013 mg L −1 day −1 

of the mock cells, suggesting that ATR knockdown generated the pool of 

higher-producing cells during the gene amplification process. 

Estimation of amplified transgene copy number: Quantitative real-time 

PCR was used to estimate the amplified transgene copy number of GFPproducing 

cell lines during the gene amplification process. The average 

copy number of ATR-downregulated cells was 15.4 ± 0.8, 27.6 ± 0.3, 

and 62.0 ± 2.9 at 100-, 250-, and 500-nM MTX concentrations, respectively. 

These numbers were up to 24 times higher than 3.98 ± 0.09, 2.20 ± 0.03, 

and 2.59 ± 0.07 of the mock cells. Interestingly, the amplified transgene 

copy numbers in the pools of ATR-downregulated cells were increased 

proportionally with the MTX concentration. The amplified transgene copy 

numbers in the IgG-producing cells were also investigated during the gene 

amplification process at 100-nM MTX concentration. The amplified light- and 

heavy-chain copy numbers of the pool of ATR knockdown cells were 13.2 ± 

3.8 and 11.8 ± 1.8, respectively, which were up to seven times higher than 

6.95 ± 0.07 and 1.68 ± 0.04 of the mock cells. The results from both the 

GFP- and IgG-producing cells showed that the pools of ATR-downregulated 

cells had much higher amplified transgene copy numbers as compared with 

the pools of mock cells during the gene amplification process. 

Conclusions: In conclusion, we have demonstrated that gene amplification 

can be accelerated by the downregulation of a cell cycle checkpoint kinase, 

ATR, and a pool of high-producing cells can be rapidly derived in a short 

time after MTX treatment. This novel method focuses on generating more 

high-producing cells in a heterogeneous pool as compared with the 

conventional method and would thus contribute to reducing the time and 

labor required for cell line establishment by increasing the possibility of 

selecting high-producing clones. 

Acknowledgements: This work is partially supported by grants from the 

Program for the Promotion of Fundamental Studies in Health Sciences of 

NIBIO and a Grant-in-Aid for Scientific Research of JSPS. We thank Prof. 

Yoshikazu Kurosawa at Fujita Health University for kindly providing heavyand 

light-chain genes of humanized IgG. 

References 

1. Gandor C, Leist C, Fiechter A, Asselbergs FA: Amplification and expression 

of recombinant genes in serum-independent Chinese hamster ovary 

cells. FEBS Lett 1995, 377:290-294. 

2. Kim JY, Kim YG, Lee GM: CHO cells in biotechnology for production of 

recombinant proteins: current state and further potential. Appl Microbiol 

Biotechnol 2012, 93:917-930. 

3. Wurm FM: Production of recombinant protein therapeutics in cultivated 

mammalian cells. Nat Biotechnol 2004, 22:1393-1398.



Page 9 of 151 

4. Cacciatore JJ, Chasin LA, Leonard EF: Gene amplification and vector 

engineering to achieve rapid and high-level therapeutic protein 

production using the Dhfr-based CHO cell selection system. Biotechnol 

Adv 2010, 28:673-681. 

O8 

1 H-NMR spectroscopy for human 3D neural stem cell cultures metabolic 

profiling 

Daniel Simão 1,2 , Catarina Pinto 1,2 , Ana P Teixeira 1,2 , Paula M Alves 1,2 , 

Catarina Brito 1,2* 

1 iBET, Instituto de Biologia Experimental e Tecnológica, 2780-901 Oeiras, 

Portugal; 

2 Instituto de Tecnologia Química e Biológica, Universidade Nova de 

Lisboa, 2780-157 Oeiras, Portugal 

E-mail: anabrito@itqb.unl.pt 


Background: The current lack of predictable central nervous system (CNS) 

models in pharmaceutical industry early stage development strongly 

contributes for the high attrition rates registered for new therapeutics [1]. 

Thus, there is an increasing need for a paradigm shift towards more human 

relevant cell models, which can closely recapitulate the in vivo cell-cell 

interactions, presenting higher physiological relevance by bridging the gap 

between animal models and human clinical trials. In this context, human 3D 

in vitro models are promising tools with great potential for pre-clinical 

research, as they can mimic some of the main features of tissues, such as 

cell-cell and cell-extracellular matrix (ECM) interactions [2,3]. Moreover these 

complex cell models are suitable for high-throughput screening (HTS) 

platforms, essential in drug discovery pipelines by reducing both costs and 

time in clinical trials [2,4]. However, despite important advances in the 

last years and the increasing clinical and biological relevance, the full 

establishment of human 3D in vitro models in pre-clinical research requires a 

significant increase in the power of the available analytical methodologies 

towards more robust and comprehensive readouts [4]. With the emergence 

of systems biology field and several “-omics” technologies, such as 

metabolomics, it became possible to have a more mechanistic approach in 

the understanding of cellular programs. 1 H-nuclear magnetic resonance 

( 1 H-NMR) spectroscopy is a powerful and widely accepted high resolution 

methodology for a number of applications, including metabolic profiling [5]. 

Despite the low sensitivity when compared with mass spectrometry (MS), 

1 H-NMR profiling presents several advantages, enabling a non-invasive and 

non-destructive quantitative analysis requiring only minimal sample 

preparation [5]. 

In this work we present the development of a robust and optimized 

workflow for the exometabolome profiling of 3D in vitro cultures of human 

midbrain-derived neural progenitor cells (hmNPC). 

Materials and methods: Cell culture: hmNPC were isolated and routinely 

propagated in static conditions, on poly-L-ornithine-fibronectin (PLOF) 

coated plates, in serum-free expansion medium, containing basic fibroblast 

growth factor and epidermal growth factor, as previously reported [6]. 

hmNSC were cultured in stirred systems as neurospheres for 7 days, with a 

50% media changes every at day 3 [7]. All experiments were performed 

in 500 mL shake flasks (80 mL working volume), with orbital shaking at 

100 rpm. Cultures were maintained at 37°C, in 3% O 2 and 5% CO 2 . 

Sample Preparation: Neurospheres harvested at day 7 were plated on 

PLOF-coated plates. A washing step with PBS was performed before adding 

fresh medium (Neurobasal medium (Invitrogen) supplemented with 2% of 

B27, 2 mM of Glutamax (Invitrogen), 100 μM dibutyryl c-AMP (Sigma- 

Aldrich), and 10 μg/mL gentamycin (Invitrogen)) to the culture. Samples of 

supernatant were then collected at 6, 12, 24 and 48 hours after media 

exchange and stored at -20°C. Neurospheres were harvested and total 

protein was quantified with Micro BCA Protein Assay Kit (Pierce), according 

to manufacturer’s instructions. Prior to NMR analysis, samples were thawed 

and filtered using Vivaspin 500 columns (Sigma-Aldrich) at 14,000xg, in 

order to remove high molecular weight proteins and lipids that induce 

baseline distortions and peak broadening due to protein binding. 

To minimize variations in pH, 400 μL of filtered samples were mixed with 

200 μL of phosphate buffer (50 mM, pH 7.4) with 5 mM DSS-d 6 [8]. 

1 H-NMR spectra acquisition and profiling: For NMR analysis, 500 μL of 

the resulting supernatants were placed into 5 mm NMR tubes. All 1 H-NMR 

spectra were recorded at 25°C on a Bruker Avance II+ 500 MHz NMR 

spectrometer. One-dimensional (1D) spectra were recorded using a NOESYbased 

pulse sequence (4 s acquisition time, 1 s relaxation time and 100 ms 

mixing time). Typically, 256 scans were collected for each spectrum. 

All spectra were phase and baseline corrected automatically, with fine 

adjustments performed manually. Spectra analysis was performed using 

Chenomx NMR Suite 7.1, using DSS-d 6 as internal standard for quantification 

of metabolites. 

Results: The approach applied in this study for metabolic profiling of the 

hmNPC cultures using 1 H-NMR enables an accurate screening of a wide 

range of metabolites in the extracellular environment (Figure 1A), 

including amino acids, glucose, lactate, among other substrates and 

by-products. 

Metabolism plasticity has been widely described as closely related with cell 

pluri/multipotency and cell fate. Stemness programs and cell identity 

determination are driven mainly by genetic and epigenetic switches, which 

can modulate cell metabolism, among other cell fate pathways [9]. Thus, 

the transition from pluri/multipotency towards somatic cell lineages is 

accompanied by significant metabolic shifts, mainly at energy metabolism 

levels. In this context, the metabolic study of in vitro cultures of stem cells 

may contribute with valuable knowledge for the mechanistic understanding 

of stemness and differentiation pathways. 

Our results showed that the hmNPC in an undifferentiated state presented 

a highly glycolytic metabolism, with high glucose consumption and lactate 

production rates (Figure 1B), in agreement with previous reports for 

murine NPC [10]. The profiles observed for glucose consumption and 

lactate synthesis suggest an almost complete conversion of pyruvate, 

generated as the final product of glycolysis, to lactate. One key culture 

parameter that can greatly contribute for a low oxidative metabolism is 

the fact that neural stem/progenitor cells are typically cultured under 

physiological low oxygen tension environments. Hypoxic conditions have 

been widely described as critical for maintaining cell viability and selfrenewal, 

while promoting proliferation and influencing cell fate during 

differentiation [11]. Moreover, the consumption and depletion of pyruvate 

present in culture media may suggest not only its conversion to lactate, 

but may also contribute for the observed alanine synthesis. 

Interestingly, even though glutamate could not be detected at significant 

levels, an accumulation of pyroglutamate was observed, which can be 

found as N-terminal modification in many neuronal peptides, including 

pathological accumulating peptides as b-amyloid in Alzheimer’s disease. 

As a free metabolite pyroglutamate can derive both from degradation of 

proteins containing N-terminal residues or from glutamate/glutamine 

cyclization. Although it is still a matter of debate, pyroglutamate 

may act as a reservoir of neural glutamate, which is the main excitatory 

neurotransmitter in CNS and in high levels becomes a major 

neurotoxicant [12]. 

Concerning branched-chain amino acids (BCAA) metabolism it was possible 

to observe the extracellular accumulation of 2-oxoisocaproate and 

methylsuccinate as main by-products, although in low rates. In brain 

metabolism the balance between leucine and 2-oxisocaproate has particular 

relevance through the establishment of a nitrogen turnover cycle where 

astroglia cells catabolize leucine into 2-oxoisocaproate, which is then taken 

up by neurons and converted back into leucine [13,14]. 

Conclusions: The methodology presented in this work, enables a 

straightforward approach for an accurate and reproducible metabolic 

profiling of multipotent hmNPC 3D cultures. This methodology provides a 

robust alternative to an array of laborious analytical methods, by taking 

advantage of the fast and simple sample preparation for NMR spectroscopy 

and the ease of user-friendly software for spectra profiling, which is often a 

challenging and time-consuming process due to peak overlapping in 

complex mixtures such as the mammalian cell culture media. Moreover, this 

approach can be applied to other multi/pluripotent cell sources, not only for 

metabolic profiling of in vitro cultures but also to study the impact of new 

therapeutics or toxicants, contributing to generate invaluable data in drug 

development cascades. 

Acknowledgements: The authors acknowledge Dr J. Schwarz (Technical 

University of Munich, Germany) for the supply of hmNPC, within the 

scope of the EU project BrainCAV (FP7-222992); this work was supported 

by PTDC/EBB-BIO/112786/2009 and PTDC/EBB-BIO/119243/2010, FCT, 

Portugal; BrainCAV (FP7-222992), EU. The NMR spectrometers are part of 

The National NMR Facility, supported by Fundação para a Ciência e a 

Tecnologia (RECI/BBB-BQB/0230/2012). Daniel Simão acknowledges the PhD 

fellowship (SFRH/BD/78308/2011, FCT).



Page 10 of 151 

Figure 1(abstract O8) Typical 1 H-NMR spectra for hmNPC culture at different time points (A). Concentration profiles of the main metabolites quantified 

in the exometabolome of hmNPC cultures that have significantly changed during 48 h of culture (B). 

References 

1. Miller G: Is pharma running out of brainy ideas? Science 2010, 

329:502-504. 

2. Pampaloni F, Reynaud EG, Stelzer EHK: The third dimension bridges the 

gap between cell culture and live tissue. Nat Rev Mol Cell Biol 2007, 

8:839-845. 

3. Griffith LG, Swartz M: Capturing complex 3D tissue physiology in vitro. 

Nat Rev Mol Cell Biol 2006, 7:211-224. 

4. Fennema E, Rivron N, Rouwkema J, van Blitterswijk C, de Boer J: Spheroid 

culture as a tool for creating 3D complex tissues. Trends Biotechnol 2013, 

31:108-115. 

5. Mountford CE, Stanwell P, Lin A, Ramadan S, Ross B: Neurospectroscopy: 

the past, present and future. Chem Rev 2010, 110:3060-3086. 

6. Storch A, Paul G, Csete M, Boehm BO, Carvey PM, Kupsch A, Schwarz J: 

Long-term proliferation and dopaminergic differentiation of human 

mesencephalic neural precursor cells. Exp Neurol 2001, 170:317-325. 

7. Brito C, Simão D, Costa I, Malpique R, Pereira CI, Fernandes P, Serra M, 

Schwarz SC, Schwarz J, Kremer EJ, Alves PM: 3D cultures of human neural 

progenitor cells: dopaminergic differentiation and genetic modification. 

Methods 2012, 56:452-460. 

8. Duarte T, Carinhas N, Silva AC, Alves PM, Teixeira AP: 1H-NMR protocol for 

exometabolome analysis of cultured mammalian cells. Animal Cell 

Biotechnology-Methods and Protocols Springer: Pörtner R , 3 2013 in press. 

9. Folmes CDL, Nelson TJ, Dzeja PP, Terzic A: Energy metabolism plasticity 

enables stemness programs. Ann N Y Acad Sci 2012, 1254:82-89. 

10. Candelario KM, Shuttleworth CW, Cunningham LA: Neural stem/progenitor 

cells display a low requirement for oxidative metabolism independent 

of hypoxia inducible factor-1alpha expression. J Neurochem 2013, 

125:420-429. 

11. Milosevic J, Schwarz SC, Krohn K, Poppe M, Storch A, Schwarz J: Low 

atmospheric oxygen avoids maturation, senescence and cell death of 

murine mesencephalic neural precursors. J Neurochem 2005, 92:718-729.




12. Kumar A, Bachhawat AK: Pyroglutamic acid: throwing light on a lightly 

studied metabolite. Curr Sci 2012, 102:288-297. 

13. Bixel MG, Engelmann J, Willker W, Hamprecht B, Leibfritz D: Metabolism of 

[U-(13)C]leucine in cultured astroglial cells. Neurochem Res 2004, 

29:2057-2067. 

14. Yudkoff M, Daikhin Y, Nelson D, Nissim I, Erecińska M: Neuronal 

metabolism of branched-chain amino acids: flux through the 

aminotransferase pathway in synaptosomes. J Neurochem 1996, 

66:2136-2145. 

O9 

BEAT® the bispecific challenge: a novel and efficient platform for the 

expression of bispecific IgGs 

Pierre Moretti 1* , Darko Skegro 2 , Romain Ollier 2 , Paul Wassmann 2 , 

Christel Aebischer 1 , Thibault Laurent 1 , Miriam Schmid-Printz 3 , 

Roberto Giovannini 3 , Stanislas Blein 2 , Martin Bertschinger 1 

1 Cell Line Development and Protein Expression group, Glenmark 

Pharmaceuticals SA, La Chaux-de-Fonds, 2300, Switzerland; 

2 Antibody 

Engineering group, Glenmark Pharmaceuticals SA, La Chaux-de-Fonds, 2300, 

Switzerland; 

3 Downstream Processing group, Glenmark Pharmaceuticals SA, 

La Chaux-de-Fonds, 2300, Switzerland 

E-mail: pierrem@glenmarkpharma.com 


Background: The binding of two biological targets with a single IgGbased 

molecule is thought to be beneficial for clinical efficacy. However 

the technological challenges for the development of a bispecific platform 

are numerous. While correct pairing of heterologous heavy and light 

chains (Hc and Lc) can be achieved by engineering native IgG scaffolds, 

crucial properties such as thermostability, effector function and low 

immunogenicity should be maintained [1]. The molecule has to be 

expressed at industrially relevant levels with a minimum fraction of 

contaminants and a scalable purification approach is needed to isolate 

the product from potentially complex mixtures. This article introduces a 

novel bispecific platform based on the proprietary BEAT® technology 

(Bispecific Engagement by Antibodies based on the T cell receptor) 

developed by Glenmark. 

Materials and methods: Stable cell lines were generated by co-transfection 

of three proprietary expression vectors pGLEX41_GA/GB coding for the Hc, Lc 

and Fc-scFv under optimized stoichiometric conditions in CHO-S cells. Cell 

lines were selected according to expression and heterodimerization during 

small scale fed-batch cultures performed in TubeSpin bioreactors (TPP, 

Trasadingen, Switzerland). For high throughput (HT) screening, the fraction of 

BEAT® molecule was evaluated using the Caliper LabChip GXII Protein Assay 

(PerkinElmer, Waltham, Ma, USA). Titers were measured by HPLC-PA after 

14 days of culture. The fraction of heterodimer in CHO supernatants was 

measured by CE-CGE on Protein A (ProtA) purified supernatants harvested on 

day 14. The actual BEAT® titer was obtained by multiplying the concentration 

measured by HPLC-PA by the fraction of heterodimer measured by CE-CGE in 

ProtA purified supernatants. The BEAT® was produced in 3 L STR bioreactors 

(Mobius CellReady Bioreactor, Millipore) in fed-batch. Supernatants were 

typically harvested on day 14 by centrifugation and dead-end filtration. 

A single Protein A step was performed for purification, where two 

isocratic steps allowed the selective elution of the bispecific product. The 

thermostability of the BEAT® molecule was measured by differential scanning 

calorimetry (DSC) in PBS. 

Results: The BEAT® bispecific molecule consists of three chains: a heavy 

chain (Hc), a light chain (Lc) and a Fc-scFv (see Figure 1 A). The molecule has 

a fully functional Fc and engages two biological targets by a Fab arm on one 

side and by a scFv on the other. Heterodimerization is achieved by 

a proprietary CH3 interface, mimicking the natural association of the T-cell 

surface receptors a and b between the two CH3 domains of IgG. Lc 

mispairing is avoided by the replacement of one Fab arm of the bispecific 

IgG by a scFv. In addition, the Protein A binding site in the Hc of the 

Figure 1(abstract O9) The BEAT®bispecific platform. In A: secretion profile of a BEAT® secreting CHO clone obtained by Caliper analysis of a 

non-purified supernatant. B: distribution of the heterodimerization level of stable clones at cell line development level. C: BEAT® expression level of 10 

selected stable clones. D: BEAT® purification strategy.




molecule is abrogated to facilitate the isolation of the BEAT®-antibody by 

affinity chromatography (discussed in the following). The DSC analysis of the 

BEAT® indicated a good thermostability within the range of naturally 

occurring antibodies. The BEAT® molecule is expressed in CHO cells. Figure 1 

A shows a typical secretion profile obtained by Caliper Protein Analysis of a 

non-purified CHO supernatant after 14 days in fed-batch culture. It can be 

seen that the asymmetry of the BEAT® format allows an easy characterization 

of the secretion profile of generated clones using HT analytics solely based 

on molecular weight. The example illustrates that a very low level of 

monospecific IgG is secreted and that the main secreted species is the BEAT® 

molecule, the main monospecific contaminant being the scFv-Fc homodimer. 

Figure 1 B shows the distribution of the heterodimerization level of the CHO 

clones screened during cell line development. The median of the distribution 

is approx. 80% indicating that half of the generated clones secreted > 80% of 

heterodimer. The expression level of the best 10 clones selected in small 

scale fed-batches after cell line development can be seen in Figure 1 C. 

Clones secreting 1-2 g/L of BEAT® could be obtained under non-optimized 

fed-batch conditions. Stability studies demonstrated that selected CHO 

clones have a stable level of heterodimerization over long term cultivation 

(75 population doubling level (PDL), data not shown). 

At 3 L bioreactor scale, titers of 3 g/L with 90% of secreted heterodimer 

could be obtained in fed-batch with minimal feeding optimization. After 

harvest the molecule is purified by Protein A (ProtA). For purification 

purposes the BEAT® was designed with a missing ProtA binding site on the 

Hc of the molecule. Consequently, residual monospecific IgG contaminants 

(harboring 2 Hc) do not bind to the ProtA column and are thus easily 

separated from the products of interest. In addition, the BEAT® molecule and 

the homodimeric Fc-scFv contaminant exhibit a different affinity for Protein 

A as the molecules harbor one and two binding sites for ProtA, respectively. 

Thus, the BEAT® molecule can be separated by ProtA via a two-step isocratic 

elution as illustrated in Figure 1 D. Applying this purification strategy for 

harvested bioreactor material, a level of purity of 97% could be obtained 

post ProtA. 

Conclusions: This work introduces a new bispecific IgG format called the 

BEAT®. Glenmark’s BEAT® platform allows the generation of stable clones 

with volumetric productivity of several g/L and a high heterodimerization 

level (> 90% secreted BEAT® in CHO supernatants). Generated clones harbor 

stable product quality profiles, e.g. level of heterodimerization, over at least 

75 PDL. The developed purification strategy allows a purity reaching 97% 

post ProtA. The BEAT® platform combines a unique CH3 interface for 

heterodimerization, an efficient cell line selection strategy and an industrial 

relevant purification process for the production of pure bispecific antibody 

at several g/L. 

Acknowledgements: The authors would like to thank Emilie Vaxelaire 

and Farid Mosbaoui for their contribution to this work. 

Reference 

1. Klein C, Sustmann C, Thomas M, Stubenrauch K, Croasdale R, Schanzer J, 

Brinkmann U, Kettenberger H, Regula J T, Schaefer W: Progress in 

overcoming the chain association issue in bispecific heterodimeric IgG 

antibodies. MAbs 2012, 4:653-663. 

O10 

A quantitative and mechanistic model for monoclonal antibody 

glycosylation as a function of nutrient availability during cell culture 

Ioscani Jiménez del Val 1 , Antony Constantinou 2,3 , Anne Dell 2 , Stuart Haslam 2 , 

Karen M Polizzi 2,3 , Cleo Kontoravdi 1* 

1 Centre for Process Systems Engineering, Department of Chemical 

Engineering, Imperial College London, South Kensington Campus, London, 

SW7 2AZ, UK; 

2 Department of Life Sciences, Imperial College London, South 

Kensington Campus, London, SW7 2AZ, UK; 3 Centre for Synthetic Biology 

and Innovation, Imperial College London, South Kensington Campus, 

London, SW7 2AZ, UK 

E-mail: cleo.kontoravdi@imperial.ac.uk 


Introduction: Monoclonal antibodies (mAbs) are currently the highestselling 

products of the biopharmaceutical industry, having had global sales 

of over $45 billion in 2012 [1]. All commercially-available mAbs contain a 

consensus N-linked glycosylation site on each of the Cg2 domains of their 

constant fragment (Fc). The monosaccharide composition and distribution of 

these N-linked carbohydrates (glycans) has been widely reported to directly 

impact the safety and efficacy of mAbs when administered to patients. 

Many studies have also shown that manufacturing bioprocess conditions 

(e.g. nutrient availability, metabolite accumulation, dissolved oxygen, pH, 

temperature and stirring speed) directly influence the composition and 

distribution of N-linked glycans bound to mAbs and other recombinant 

proteins. Given this tight interconnection between manufacturing process 

conditions, product quality and ensuing safety and therapeutic efficacy, 

mAbs and their glycosylation present a clear opportunity where process 

development can be guided by quality by design (QbD) principles. 

QbD is a conceptual framework that aims to build quality into drug products 

at every stage of process development. Specifically, implementation of QbD 

to pharmaceutical process development requires identifying critical quality 

attributes (CQAs) that define the drug’s safety and therapeutic efficacy. QbD 

then uses all available information on the mechanisms that quantitatively 

relate process inputs with product quality to control the manufacturing 

process so that product CQAs are maintained and end-product quality is 

ensured. Within the QbD context, composition and distribution of the 

glycans present on the Fc of mAbs is defined as a CQA, and thus, the 

processes employed in their manufacture must be controlled so that their 

glycan distribution ensures the required safety and efficacy profiles. 

Under this perspective, we have defined a mathematical model that 

mechanistically and quantitatively describes mAb Fc glycosylation as a 

function of nutrient availability during cell culture. Such a model aims to be 

used for bioprocess design, control and optimisation, thus facilitating the 

manufacture of mAbs with built-in glycosylation-associated quality under 

the QbD scope. 

Materials and methods: The mathematical model consists of three 

distinct modular elements which have been connected to achieve a 

mechanistic description of mAb glycosylation as a function of nutrient 

availability. The first element corresponds to cell culture dynamics and uses 

modified Monod kinetics to describe the growth and death of cells as a 

function of glucose and glutamine availability. This element also describes 

accumulation of metabolites (lactate and ammonia) and mAb synthesis 

throughout cell culture. 

The second element describes the intracellular dynamics of nucleotide sugar 

(NS) metabolism. NSs are the substrates required for protein glycosylation 

and are synthesised via the amino sugar and nucleotide sugar metabolic 

pathway using glucose and glutamine as primary substrates [2]. The full 

metabolic pathway has been heuristically reduced to 8 reactions by 

collapsing sequential reactions along each distinct branch of the pathway 

into a single one, as shown with the coloured arrows in Figure 1. This 

module is linked with the cell culture dynamics one by equations that 

define intracellular glucose and glutamine accumulation as a function of 

their availability in the extracellular environment. 

The pathway shows the synthesis of uridine diphosphate N-acetylglucosamine 

(UDP-GlcNAc), uridine diphosphate N-acetylgalactosamine (UDP-GalNAc), 

uridine diphosphate glucose (UDP-Glc), uridine diphosphate galactose (UDP- 

Gal), guanosine diphosphate mannose (GDP-Man), guanosine diphosphate 

fucose (GDP-Fuc), cytosine monophosphate N-acetylneuraminic acid 

(CMP-Neu5Ac) and uridine diphosphate glucoronic acid (UDP-GlcA) using 

glucose (Glc) and glutamine as substrates. The coloured arrows represent the 

reduced scheme where sequential reactions have been collapsed into a single 

one (e.g. the blue arrow describes a single reaction that produces UDP-GlcNAc 

using glucose and glutamine as substrates). The remaining arrows represent 

the synthesis of the other NSs using glucose and glutamine or other NSs 

as substrates. 

The third element describes mAb Fc glycosylation as a function of mAb 

specific productivity and NS availability. This element approximates the 

Golgi apparatus to a plug-flow reactor and considers the transport of NSs 

from the cytosol, where they are synthesised, into the Golgi, where they are 

consumed in glycosylation reactions [3]. As inputs, this element requires 

intracellular NS availability and mAb specific productivity, and is thus 

coupled to the other two modules. All model simulation was performed 

with gPROMS v. 3.4.0 [4]. 

Experimentally, murine hybridoma cells (CRL-1606, ATCC) were cultured and 

typical data was collected (viable cell density, extracellular glucose, 

glutamine, lactate, ammonia and mAb titre). In addition, the intracellular 

pools of NSs were extracted using perchloric acid and quantified using a 

high performance anion exchange chromatographic method that allows for 

quantification of 8 NSs and 8 nucleotides in under 30 minutes [5]. Finally, 

the mAb glycan profiles were obtained using MALDI mass spectrometry.




Figure 1(abstract O10) Nucleotide sugar metabolic network. 

The obtained experimental data was then used to estimate the unknown 

parameters of the model. Estimation was performed with the maximum 

likelihood formulation available in gPROMS v. 3.4.0, where the values for 

uncertain physical parameters are obtained to maximise the probability that 

the model will predict values from experimental measurements [4]. 

Results: Time-courses for all data were produced, including intracellular 

profiles for six NSs (GDP-Man, GDP-Fuc, UDP-Glc, UDP-Gal, UDP-GlcNAc and 

CMP-Neu5Ac). This, along with data on cell culture dynamics and mAb Fc 

glycosylation were used to estimate the unknown parameters of the model 

as described previously. With the estimated parameters, the mathematical 

model was found to reproduce cell culture dynamics, intracellular NS pools 

and terminal mAb Fc glycan distributions accurately. 

With the obtained parameters, a case study for glutamine depletion 

was simulated. This study showed that under glutamine deprivation, 

intracellular availability of UDP-GlcNAc decreases to a point where mAbs 

with high-mannose (Man5) glycan structures begin accumulating in the 

extracellular environment, a phenomenon that is consistent with previous 

observations [6]. 

Conclusions: We have shown the construction of a mathematical model 

which mechanistically and quantitatively describes mAb Fc glycosylation 

as a function of nutrient availability during cell culture. In addition, 

experimental methods have been developed to generate data which was 

used to estimate the unknown parameters of the model. Finally, the 

model and obtained parameters were found to be capable of reproducing 

previously observed effects of glutamine depletion on protein glycosylation. 

With further validation, this quantitative and mechanistic model could prove 

useful in aiding process development, control and optimisation for the 

manufacture of mAbs with desired glycosylation-associated quality. 

References 

1. World Preview 2013, Outlook to 2018: Returning to Growth. 

EvaluatePharma Report 2013. 

2. Kanehisa M, Goto S, Sato Y, Furumichi M, Tanabe M: KEGG for integration 

and interpretation of large-scale molecular data sets. Nucl Acids Res 2012, 

40(D1):D109-D114. 

3. del Val IJ, Nagy JM, Kontoravdi C: A dynamic mathematical model for 

monoclonal antibody N-linked glycosylation and nucleotide sugar donor 

transport within a maturing Golgi apparatus. Biotechnol Progr 2011, 

27:1730-1743. 

4. Process Systems Enterprise: gPROMS Introductory User Guide. 2009. 

5. Jimenez del Val I, Kyriakopoulos S, Polizzi KM, Kontoravdi C: An optimised 

method for extraction and quantification of nucleotides and nucleotide 

sugars from mammalian cells. Analytical Biochemistry 2013, under review. 

6. Wong DCF, Wong KTK, Goh LT, Heng CK, Yap MGS: Impact of dynamic online 

fed-batch strategies on metabolism, productivity and N-glycosylation 

quality in CHO cell cultures. Biotechnol Bioeng 2005, 89:164-177. 

POSTER PRESENTATIONS 

P1 

Generation of genetically engineered CHO cell lines to support the 

production of a difficult to express therapeutic protein 

Holger Laux 1* , Sandrine Romand 1 , Anett Ritter 1 , Mevion Oertli 1 , Mara Fornaro 2 , 

Thomas Jostock 1 , Burkhard Wilms 1 

1 Novartis Development Integrated Biologic Profiling, 4002 Basel, Switzerland; 

2 Novartis Institutes for Biomedical Research, 4056 Basel, Switzerland 

E-mail: holger.laux@novartis.com 

BMC Proceedings 2013, 7(Suppl 6):P1 

Introduction: Chinese Hamster Ovary (CHO) cells are widely used for the 

large scale production of recombinant biopharmaceuticals. These cells 

have been extensively characterised and approved by regulatory 

authorities for production of biopharmaceuticals. During the last years 

more and more cell-line engineering strategies have been developed to 

enhance productivity and quality. CHO cell line engineering work has 

made remarkable progress in optimizing products or titers by focusing on 

manipulating single genes and selecting clones with desirable traits. In 

this work it is shown how cell line engineering approaches enable the




expression of a challenging to express “novel therapeutic protein”. The 

expression of the “novel therapeutic protein” in CHO cells resulted in 

significant reduced cell growth as well as low productivity. 

Results: Transcriptomics analysis: Using customised CHO specific 

microarrays the gene expression profile of CHO cells expressing the “novel 

therapeutic protein” was analysed. The expression of the “novel therapeutic 

protein” resulted in a significant downregulation of all mitochondria encoded 

genes. The downregulation was more than 40 fold for some of these genes 

(Figure 1A). This massive reduced transcription of mitochondrial encoded 

genes was very likely causing the reduced cell growth and reduced 

expression of the “novel therapeutic protein”. A decrease in mitochondrial 

function reduces overall metabolic efficiency and a change of metabolic 

pathways could also be detected on gene expression level. Additionally the 

expression of “gene A” was detected in the applied CHO cell line, which 

might have the potential to trigger the down regulation of the mitochondrial 

encoded genes in the presence of the “novel therapeutic protein”. 

Gene knockdown using shRNA (short hairpin RNA) technique: A variety 

of cell line engineering approaches were performed to circumvent cell 

growth inhibition caused by down regulation of mitochondrial encoded 

genes with the aim to improve expression of the “novel therapeutic 

protein”. In the first approach the expression of “gene A”, whichwas 

assumed to trigger the down regulation of the mitochondrial encoded 

genes, was repressed more than 10 fold using shRNA technique. shRNA is 

a sequence of RNA that makes a tight hairpin turn that can be used to 

silence target gene expression via RNA interference. Expression of shRNA 

was accomplished by delivery of stable integrated plasmids. Cells with 

reduced expression of “gene A” showed an improved cell growth and 

higher expression of the “novel therapeutic protein” (Figure 1 B). However 

cell growth was still repressed, although to a lower extent, and titers were 

still lower in comparison to other therapeutic protein formats. Despite the 

significant decrease in the expression of “gene A”, the remaining “protein A” 

seemed to be sufficient to trigger these effects although to a lower 

magnitude. 

Gene knockout using zinc finger nucleases (ZFN): To completely 

eliminate the cell growth inhibition a knockout of “gene A” was 

performed using ZFN technique. ZFNs are artificial restriction enzymes 

generated by fusing a zinc finger DNA-binding domain to a DNAcleavage 

domain. Plasmids encoding ZFNs (specifically designed to detect 

and cleave “gene A”) were transiently transfected in the parental CHO cell 

line. ZFN cleaves “gene A” which is then repaired by non-homologous 

end joining. This is often error prone and resulted in the generation of 

mutant alleles. Three clones were identified with mutation in both alleles 

of “gene A” resulting in shifts of the reading frame and therefore only 

nonfunctional premature termination products are encoded. 

Knockout of “gene A” resulted in complete elimination of cell growth 

inhibition and the expression of mitochondria encoded genes (Figure 1D) 

was restored to levels comparable to parental CHO cells. In addition there 

was no change in the expression of genes that are involved in metabolic 

pathways. Most striking is the significant improved cell growth and 

productivity resulting in a 6-7 fold titer increase using this genetically 

engineered knockout cell line (Figure 1B and 1C). 

Conclusion: This example illustrates that transcriptomic analysis can 

support and facilitate the understanding and solving of specific issues 

during the expression of therapeutic proteins. Novel cell line engineering 

methods as ZFN technique are powerful tools to solve definite issues in 

production of therapeutic proteins in biopharmaceutical industry. 

P2 

Expansion of mesenchymal adipose-tissue derived stem cells in a 

stirred single-use bioreactor under low-serum conditions 

Carmen Schirmaier 1* , Stephan C Kaiser 1 , Valentin Jossen 1 , Silke Brill 2 , 

Frank Jüngerkes 2 , Christian van den Bos 2 , Dieter Eibl 1 , Regine Eibl 1 

1 Zurich University of Applied Sciences, Institute of Biotechnology, 

Biochemical Engineering and Cell Cultivation Technique, 8820 Wädenswil, 

Switzerland; 

2 Lonza Cologne GmbH, 50829 Cologne, Germany 

E-mail: *carmen.schirmaier@zhaw.ch 


Background: The need for human mesenchymal stem cells (hMSCs) has 

increased enormously in recent years due to their important therapeutic 

potential. Efficient cell expansion is essential to providing clinically relevant 

cell numbers. Such cell quantities can be manufactured by means of 

scalable microcarrier (MC)-supported cultivations in stirred single-use 

bioreactors. 

Materials and methods: Preliminary tests in disposable-spinners (100 mL 

culture volume, Corning) were used to determine two suitable media and 

MC-types for serum reduced expansions (< 10%) of human adipose tissuederived 

stem cells (hADSCs; passage 2, Lonza). Using such optimized 

media-MC-combinations, hADSCs expanded 30 to 40-fold, which compares 

well with expansion rates in planar culture. Based on computational fluid 

dynamics simulations and suspension analyses in spinners [1], optimal 

operating parameters were determined in a BIOSTAT® UniVessel® SU 2 L 

(2 L culture volume, Sartorius Stedim Biotech). 

Results: In subsequent batch tests with the BIOSTAT UniVessel® SU 2 L, 

expansion rates of between 30 and 40-fold were reached and up to 4.4·10 8 

cells with a cell viability exceeding 98% were harvested. Flow cytometry 

tests demonstrated typical marker profiles following cell expansion and 

harvest. A 40-fold expansion rate delivered a total of 1·10 10 cells in a first 

cultivation with the BIOSTAT® CultiBag STR 50 L (35 L culture volume, 

Sartorius Stedim Biotech). 

Conclusions: In summary, the foundations for successfully expanding 

therapeutic stem cells in truly scalable systems have been laid. Strategies 

ensuring expansion rates between 60 and 70-fold and, thus, generating 

cell amounts over 10 10 are now in preparation. 

Acknowledgements: This work is part of the project “Development of a 

technology platform for a scalable production of therapeutically relevant 

stem cells” (No. 12893.1 VOUCH-LS). It is supported by the Commission for 

Technology and Innovation (CTI, Switzerland). The authors would like to 

thank the CTI for partially financing the investigations presented. 

Reference 

1. Kaiser S C, Jossen V, Schirmaier C, Eibl D, Brill S, van den Bos C, Eibl R: 

Investigations of fluid flow and cell proliferation of mesenchymal 

adipose-derived stem cells in small-scale, stirred, single-use bioreactors. 

Chem Ing Tech 2013, 85:95-102. 

P3 

Evaluating the effect of chromosomal context on zinc finger nuclease 

efficiency 

Scott Bahr * , Laura Cortner, Sara Ladley, Trissa Borgschulte 

CHOZN® Platform Development Team, SAFC/Sigma-Aldrich, St Louis, MO 

63103, USA 

E-mail: scott.bahr@sial.com 


Introduction: Zinc Finger Nuclease (ZFN) technology has provided 

researchers with a tool for integrating exogenous sequences into most cell 

lines or genomes in a precise manner. Using current methods, the 

efficiency of targeted integration (TI) into the host genome is generally low 

and is highly dependent on the ZFN activity at the genomic locus of 

interest. It is unknown if the ZFN binding and cutting efficiency is more 

dependent on the nucleotide recognition sequence or the chromosomal 

context in which the sequence is located. 

We have taken a highly efficient ZFN pair (hAAVS1) from human studies 

and introduced the exogenous DNA sequence into the Chinese Hamster 

Ovary (CHO) genome in an attempt to improve the efficiency of targeted 

integration. A “Landing Pad” comprised of human AAVS1 sequence has 

been integrated into the CHO genome at 3 separate loci to determine if 

the ZFN’s will work across species and if the cutting efficiency is affected 

by chromosomal context. The results of this study will help us to improve 

the overall efficiency of TI by using Landing Pads, particularly for 

genomic targets in which suitable ZFN’s may not be available. 

Methods: 3 CHO Loci were chosen for this study based on previous gene 

expression studies. Rosa26 and Neu3 show consistent but low levels of 

expression while Site #1 appears to have no known coding sequence. 

Additionally, Rosa26 and Site#1 were chosen as potential safe harbor sites 

in CHO. The ZFN cutting efficiency at the endogenous CHO loci Rosa26, 

Site #1 and Neu3 are approximately 15%, 30% and 40% respectively. Based 

on other studies the cutting efficiency of human AAVS1 ZFN’s was as high 

as 50% depending on the human cell line used. A plasmid donor carrying 

the hAAVS1 ZFN recognition sequence Landing Pad was introduced into 

CHO Rosa26, Site #1, and Neu3 via targeted integration (Figure 1).




Figure 1(abstract P1) A highlights the reduced expression of mitochondria encoded genes in CHO cells expressing the “novel therapeutic protein” in 

comparison to parental CHO cells. The y-axis shows the gene expression values in signal intensities. B: Batch culture titers of the “novel therapeutic 

protein” in shake flask are shown. Titer for CHO WT cells are labeled in red, titer for CHO cells with reduced expression of gene A (shRNA approach) are 

labeled in yellow and titer for CHO cells with non-functional gene A (knockout) are labeled in green. C: Cell growth of CHO WT cells and CHO knockout 

(KO) cells with and without “novel therapeutic protein” in shake flasks. Y-axis shows viable cell density and x-axis cultivation time. D: Gene expression of 

mitochondrial encoded genes is not reduced in all three generated CHO KO cell lines with the “novel therapeutic protein”. Hierarchical clustering reveals 

that the “novel therapeutic protein” does not affect the gene expression profile of the KO cell lines. In contrast the “novel therapeutic protein” has a clear 

effect on the WT cell line.




Figure 1(abstract P3) Schematic of ZFN mediated Integration of the hAAVS1 Landing Pad into CHO. 

Results: Clones carrying the exogenous hAAVS1 Landing Pads at Rosa26, Site 

#1 and Neu3 were transfected with hAAVS1 ZFN’s and the cutting efficiency 

was measured. We found that the human AAVS1 ZFN’s wereableto 

successfully cut at their recognition sequence in the Landing Pad at all 3 CHO 

loci to varying degrees (Table 1). ZFN efficiency at each loci was measured by 

Cel1 Assay or direct sequencing of Indels in PCR amplicons. We see 

successful ZFN activity at all 3 loci but with varying efficiency. **The Landing 

Pad integration at Neu3 locus caused phenotypic changes in the cell growth 

and viability following transfection which may explain low ZFN activity. 

Conclusions: These results indicate that the chromosomal context of the 

ZFN recognition sequence has an effect on cutting efficiency. This study 

shows that TI can be performed with Landing Pads across species with high 

efficiency and provide researchers with additional tools for cell line 

engineering. Further development of Landing Pads could create highly 

engineered and multi-functional platforms that would facilitate more 

efficient and more tailored CHO cell modifications. 

P4 

Insights into monitoring changes in the viable cell density and cell 

physiology using scanning, multi-frequency dielectric spectroscopy 

John Carvell 1* , Lisa Graham 2 , Brandon Downey 2 

1 Aber Instruments Ltd, Abersytwyth, UK; 

2 Bend Research Inc., Oregon, USA 

E-mail: johnc@aberinstruments.com 


Table 1(abstract P3) Comparing ZFN activity in CHO 

before and after Landing Pad Integration 

CHO 

Site 

Rosa 

26 

Site 

#1 

ZFN Activity at Endogenous 

CHO Locus 

ZFN Activity at Integrated 

Landing Pad 

16% 18% 

31% 51% 

Neu3 41% 16%** 

Background: Real-time bioprocess monitoring is fundamental for 

maximizing yield, improving efficiency and process reproducibility, 

minimizing costs, optimizing product quality, and full understanding of how 

asystemworks.TheFDA’s Process Analytical Technology initiative (PAT) 

encourages bioprocess workflows to operate under systems that provide 

timely, in-process results. At the same time the demand for ever increasing 

supplies of biological pharmaceuticals, such as antibodies and recombinant 

proteins, has fueled interest in streamlined manufacturing solutions. 

Bioreactors that are monitored continuously and in real-time offer the 

advantage of meeting current and future supply demands with biological 

product of the utmost quality and safety, achieved at the lowest overall cost 

and with least risk. This paper will focus on how one research groups in has 

used scanning multi-frequency dielectric spectroscopy to comparatively 

profile multiple bioreactor runs and elucidatefinedetailsconcerningcell 

viability and mechanism of cell death. The cellular information observed has 

not been available through other technologies. The presentation will also 

focus on how the technology can also be applied to Single use Bioreactors 

in a cGMP environment and on samples down to 1 ml volume. 

Introduction: • Dielectric spectroscopy (DS) is now the most common 

method for estimating the in situ live cell concentration in animal cell 

culture. 

• DS and traditional offline methods for cell counting based on 

Trypan Blue correlate well during the growth phases but with some 

cell lines, deviations are observed during the late growth phase. 

• Scanning multi-frequency DS can detect the physiological changes 

of the cells during the death phase of the culture including changes 

in cell size, membrane capacitance and internal conductivity [1-3]. 

• The concept of using the Area Ratio Algorithm (ARA) looks to be a 

relatively simple and promising method for providing on-line cell 

counts that correlate well with traditional methods for the complete 

cell growth cycle. 

Background of DS and the Futura Biomass Monitor: • DS measures 

the passive electrical properties of cells in suspension through the 

cells’ interaction with RF excitations. 

• Viable cells are composed of a conducting cytoplasm surrounded by a 

non-conducting membrane suspended in a conducting medium. When 

an alternating current is applied to the suspension, each cell becomes 

polarised and behaves electrically as a tiny spherical capacitor.




• The suspensions reaction to the current is expressed as its permittivity 

can be measured by its capacitance and conductivity as a function of 

frequency. Viable cells possess intact membranes which prevent the 

free flow of ions and allow the cells to polarise. Dead, porous cells and 

debris lack an enclosing membrane and are unable to build up charge 

separation. Hence, DS measures only viable cells. 

• The Futura Biomass Monitor (Aber Instruments Ltd, UK) measures the 

capacitance created directly from the cells. The capacitance signature 

of cells is measured between 50 KHz and 20 MHz with readings every 

30 seconds. 

• At low excitation frequencies the cells can fully polarise and the 

capacitance of the suspension is maximised. As the excitation 

increases, the cells lose their ability to fully polarize and the measured 

capacitance drops eventually measuring no polarisation at high 

frequencies. 

Concept of the Area Ratio algorithm: • A novel method for obtaining an 

enhanced prediction of viable cell volume fraction (VCV) compared to 

currently employed methods has been developed, wherein changes in 

cell health are quantified using frequency scanning data. In the novel 

method, cell health is measured by using an area ratio (AR) to quantify 

the shape of the measured dielectric spectrum using the following 

algorithm: AR = ∫ fQfHC(f )df ∫ fLfHC(f )df fH < fQ < fL 

Where: 

AR = area ratio for a given scan 

f H = highest frequency of the scan 

f L = lowest frequency of the scan 

f Q = semi arbitrary chosen frequency between f H and f L 

C(f) = capacitance as a function of frequency 

• The AR is used as a correction factor to correct for the death phase 

divergence in the following manner: VCV(t) = A × (C(t) - B × AR(t) - 

k2) + k1 

Where: 

VCV = predicted viable cell volume fraction 

A and B = fit constants of proportionality relating dielectric 

measurements to offline cell measurements 

k 1 and k 2 = constant offset values 

• Changes in cell health are quantified using frequency scanning data. 

When the ARA is applied to the uncorrected VCV derived from the 

capacitance data, there is a good match with the off-line derived VCV 

(Figure 1). 

Applying multi-frequency scanning DS to single use bioreactors and 

samples off-line: • A single use sensor has been developed by Aber 

Instruments and the early versions utilized stainless steel electrodes. 

This sensor was suitable for single or dual frequency DS and the 

performance has been compared with traditional probes that are used 

on reusable bioreactors [4]. 

• Samples as low as 100 microlitre can be withdrawn from a bioreactor 

and scanning DS can be applied using existing DS probes. An example 

of this is shown in the full version of the poster with distinctly 

different frequency scans for healthy and unhealthy cells. The 

unhealthy cells were generated by treatment with 1 uM staurosporine 

to induce apoptosis. 

Discussions and conclusions: The work presented here shows the utility 

of frequency scanning data to obtain enhanced measurement of VCV using 

non-invasive capacitance sensors in reusable and single use bioreactors. The 

information-rich nature of dielectric frequency scanning allows interrogation 

of biophysical properties of cells. The concept can be extended to samples 

off-line. 

References 

1. Asami K: Characterization of heterogeneous systems by dielectric 

spectroscopy. Prog Polymer Sci 2002, 27:1617-1659. 

2. Cannizzaro C, Gügerli R, Marison I, Von Stockar U: On-line biomass 

monitoring of CHO perfusion culture with scanning dielectric 

spectroscopy. Biotechnol Bioeng 2003, 84:597-610. 

3. Ron A, Singh RR, Fishelson N, Shur I, Socher R, Benayahu D, Shacham- 

Diamand Y: Cell-based screening for membranal and cytoplasmatic 

markers using dielectric spectroscopy. Biophys Chem 2008, 135:59-68. 

4. Carvell JP, Williams J, Lee M, Logan D: On-Line Monitoring of the Live Cell 

Concentration in Disposable Bioreactors (poster). European Society for 

Animal Cell Technology biennial conference, Dublin, Ireland 2009. 

P5 

Multidimension cultivation analysis by standard and omics methods for 

optimization of therapeutics production 

Julia Gettmann 1† , Christina Timmermann 1† , Jennifer Becker 1 , Tobias Thüte 1 , 

Oliver Rupp 2 , Heino Büntemeyer 1 , Anica Lohmeier 1 , Alexander Goesmann 2 , 

Thomas Noll 1,3* 

1 Institute of Cell Culture Technology, Bielefeld University, 33615 Bielefeld, 

Germany; 

2 Bioinformatics Resource Facility, Center for Biotechnology 

(CeBiTec), Bielefeld University, 33615 Bielefeld, Germany; 3 Center for 

Biotechnology (CeBiTec), Bielefeld University, 33615 Bielefeld, Germany 

E-mail: thomas.noll@uni-bielefeld.de 


Background: During the last decades Chinese Hamster Ovary (CHO) cells 

have been extensively used for research and biotechnological applications. 

About 40% of newly approved glycosylated protein pharmaceuticals are 

produced in CHO cells today [1]. Despite the increasing relevance of these 

Figure 1(abstract P4) Implementation of the Area Ratio Algorithm (ARA) yields enhanced prediction of viable cell volume fraction compared 

with uncorrected methods.




cells for biopharmaceutical production little is known about effects of 

intracellular processes on productivity and product quality. 

In the last years supplementation of serum-free media with insulin - more 

and more replaced by IGF-1 and its analogue LongR 3 - was utilized to 

enhance product titer and quality. To compare the intracellular effects of 

these two supplements an antibody producing CHO cell line was cultivated 

in batch mode using insulin, LongR 3 or no growth factor as reference. 

Subsequently, different omics-techniques were applied to analyze medium 

and cell samples. 

Materials and methods: CHO cells producing an antibody were cultured 

in chemically defined serum-free medium TC-BN.CHO (Teutocell AG) with 

addition of 6 mM glutamine. Three cultivations (37°C, pH 7.1, 40% DO, 

120 rpm) were performed in 2l-bioreactor systems with supplementation 

of 10 mg/l insulin or 0.1 mg/l LongR 3 . The third culture was untreated and 

served as reference. Samples were taken every 24 h. 

Viable cell density and cell viability were measured using Cedex (Roche). 

Glucose and lactate were determined via YSI 2300 STAT Plus Glucose & 

Lactate Analyzer (YSI Life Science). Quantitation of antibody production was 

determined using POROS® A columns (Invitrogen). N-Glycan abundance was 

analyzed by HPAEC-PAD method [2]. 

For RNA samples ‘Total RNA NucleoSpin Kit’ (Macherey-Nagel) was used. 

Quality and quantity of RNA were determined using Nano Drop 1000 

(Peqlab) and Bioanalyzer (Agilent). 

An in-house developed customized cDNA microarray with 41,304 probes 

was applied for transcriptome analysis. RNA was labeled using Agilent 

LIQUA Kit, one-color. Processing of microarray data was performed in 

ArrayLims and EMMA2 [3]. Raw data were standardized using Feature 

Extractor (Agilent) and LOWESS normalization. 

Results: Cultivation data illustrated that maximal cell density was higher in 

cultivations with insulin and LongR 3 compared to that without growth 

factor. Additionally, glucose consumption and lactate production was 

slightly higher in cultivations with these supplements but time point of 

glutamine depletion was similar in all reactors after similar cultivation time 

(Figure 1A). Furthermore, product quantity and product quality was not 

influenced by growth factor addition. The most abundant glycoforms after 

7 days of cultivation were G0F with about 50% and G1F with about 40% in 

all cultivation set-ups (Table 1). 

For transcriptome analysis samples on day 5 were compared with those on 

day 3. Therefore, the following settings were used in statistical tests: a twosample 

t-test with a p-value ≤ 0.01, signal intensity ≥ 6(forA1orA2)and 

intensity ratio ≥ 0.6 or ≤ -0.6 (for M1 or M2). Transcriptome data showed 

that LongR 3 supplementation resulted in the highest transcription change 

(1259 up- and 1689 down-regulated). Insulin supplementation resulted in 

second highest transcriptomic change (1026 up- and 1404 downregulated) 

and reference cultivation led to lowest changes (344 up- and 

301down-regulated). Supplemented cultures showed a higher transcription 

change in the selected pathways, like pentose phosphate pathway, TCA 

and glycolysis, than the reference culture, too. In LongR 3 containing 

cultures even more genes from these pathways were higher changed 

(Figure 1B). 

Conclusions: Data on cell growth and productivity as well as omics results 

were brought together to achieve a deeper insight into cellular processes 

and their influence on productivity and product quality. 

Cultivation data showed faster growth, glucose consumption and lactate 

formation for cultivations with insulin and LongR 3 compared to reference 

culture. However, antibody titer and glycan profiles were almost similar in all 

cultures. This indicates that supplementation with insulin or LongR 3 does 

not have an enhancing effect on product quality and quantity in antibody 

production with our CHO-K1 cells. 

Additionally, transcriptome data showed that growth factor supplementation 

resulted in a higher transcription change than in reference cultivation. 

Thus, for more understanding of the influence of insulin or LongR 3 

supplementation on cultured CHO cells, further analysis of pathway 

regulation with full details is required. 

Acknowledgements: The project is co-funded by the European Union 

(European Regional Development Fund - Investing in your future) and the 

German federal state North Rhine-Westphalia (NRW). 

References 

1. Higgins E: Carbohydrate analysis throughout the development of a 

protein therapeutic. Glycoconj J 2010, 2:211-225. 

2. Behan JL, Smith KD: The analysis of glycosylation: a continued need for high 

pH anion exchange chromatography. Biomed Chromatogr 2011, 25:39-46. 

3. Dondrup M, Albaum SP, Griebel T, Henckel K, Junemann S, Kahlke T, 

Kleindt CK, Kuster H, Linke B, Mertens D, Mittard-Runte V, Neuweger H, 

Runte KJ, Tauch A, Tille F, Puhler A, Goesmann A: EMMA 2–a MAGEcompliant 

system for the collaborative analysis and integration of 

microarray data. BMC Bioinformatics 2009, 10:50. 

P6 

Toward a serum-free, xeno-free culture system for optimal growth and 

expansion of hMSC suited to therapeutic applications 

Mira Genser-Nir * , Sharon Daniliuc, Marina Tevrovsky, David Fiorentini 

Biological Industries, Kibbutz Beit Haemek, Israel 

E-mail: mira@bioind.com 


Background: Human mesenchymal stem cells (hMSC) hold great promise 

as a tool in regenerative medicine and cell therapy. Application of hMSC in 

cell therapy requires the elaboration of an appropriate serum-free (SF), 

xeno-free (XF) culture system in order to minimize the health risk of using 

xenogenic compounds, and to limit the immunological reactions in-vivo. 

Besides the well-known disadvantages of serum, in comparison to a SF, XF 

culture system, serum also exhibits poor performance in the context of 

hMSC proliferation. In the present study, a novel SF, XF culture system for 

hMSC suitable for therapeutic applications was developed and evaluated. 

Figure 1(abstract P5) (A) Time chart of viable cell density (VCD), cell viability (CV) and extracellular metabolites [glucose (Glc), lactate (Lac), glutamine 

(Gln)]. (B) Number of significantly up- and down-regulated genes on day 5 in selected pathways (compared to day 3).




Table 1(abstract P5) N-Glycan abundance [%] after 

7 days of cultivation 

Culture G0F G0 G1F G1 G2F G2 

Reference 51,8 4,1 35,6 0,9 7,4 0,2 

Insulin 50,6 3,4 38,6 0,9 6,3 0,2 

LongR 3 52,5 1,4 38,5 0,5 6,9 0,3 

The SF, XF culture system includes specially developed solutions for 

attachment, dissociation, and freezing, as well as a culture medium, MSC 

NutriStem® XF, that enables long-term growth of multipotent hMSC. 

Development of the SF, XF culture system was conducted on hMSC from a 

variety of sources: bone marrow (BM), adipose tissue (AT) and Wharton’s 

jelly (WJ). 

Materials and methods: MSC NutriStem® XF culture medium was 

examined in combination with MSC Attachment Solution (BI, 05-752-1) and 

either Recombinant Trypsin Solution (BI, 03-078-1) or MSC Dissociation 

Solution (BI, 03-075-1). The performance of MSC NutriStem® XF was 

evaluated based on the following parameters: proliferation rate, viability, 

morphology, stemness (estimated from CFU-F), multilineage differentiation 

capability, and phenotypic surface marker profile [1]. 

Cells: hMSC (passage 1-5) from a variety of sources: BM (Lonza, Promocell), 

AT (Promocell, ATCC), and WJ (ATCC, Prof. Mark Weiss - self isolation) were 

used in this study. 

Culture System: hMSC were cultured in a SF, XF expansion medium (MSC 

NutriStem® XF, BI) on pre-coated dishes (MSC Attachment Solution, BI) or 

other media; commercial SF media (Invitrogen; SCT, Promocell), in-house 

serum-containing formulation (Prof. Mark Weiss). Cells were seeded at 

5000-6000 viable cells/cm 2 , and harvested using either MSC Dissociation 

Solution (BI) or recombinant Trypsin Dissociation Solution (BI). 

Medium Performance Evaluation: Medium performance was evaluated 

by conducting a comparison of proliferation rate, cell morphology, 

multilinage differentiation potential into adipocytes, osteocytes, and 

chondrocytes, self-renewal potential and cell immunophenotype. 

Cell Expansion: Cell proliferation was assessed by cell count using a 

trypan blue exclusion assay at each time point. 

Differentiation: hMSC expanded for 3-5 passages in MSC NutriStem® XF 

were tested for maintenance of multilineage differentiation potential (into 

adipocytes, osteocytes, and chondrocytes) using in-house differentiation 

formulations. Undifferentiated control cells were cultured in MSC 

NutriStem® XF. Cells were fixed and stained with Oil Red O, Alizarin Red/ 

von Kossa, and Alcian blue/Masson’s trichrome, respectively. 

CFU-F Assay: hMSC were seeded at low densities (10, 50, and 100 cells/ 

cm 2 ) in MSC NutriStem® XF, cultured for 14 days, and stained with 0.5% 

crystal violet. 

Flow Cytometry: WJ-derived hMSC were cultured for five passages in 

MSC NutriStem® XF, followed by immunophenotype evaluation by flow 

cytometry expression of CD73, CD90, CD105, HLA-ABC (positive), HLA-DR, 

and CD45 (negative). 

Results: An optimized SF, XF culture system for hMSC was developed, 

composed of growth medium, MSC NutriStem® XF, and all the required 

auxiliary solutions for the attachment, dissociation, and freezing of the cells. 

This SF, XF culture system for hMSC, supported optimal expansion of hMSC 

from a variety of sources, and exhibited superior proliferation compared 

with serum-containing media and commercially available SF media. hMSC 

expanded in the SF, XF culture system maintain their typical fibroblast-like 

cell morphology and phenotypic surface marker profile of CD73, CD90, 

CD105, HLA-ABC (all positive), or CD34, CD45, HLA-DR (all negative). hMSC 

differentiated efficiently after expansion in the developed SF, XF culture 

system into osteocytes, chondrocytes, and adipocytes. The self-renewal 

potential was maintained as well, demonstrated by a colony-forming unit 

fibroblast (CFU-F) assay (Figure 1). 

Conclusions: The use of serum is not an option from a regulatory point of 

view. A SF, XF culture system for hMSC was developed and enables longterm 

growth of multipotent hMSC suitable for therapeutic applications. 

The performance of MSC NutriStem® XF medium was proved to be 

superior to serum-containing medium and commercially available SF 

media. MSC NutriStem® XF medium supports long-term culture of hMSC 

from a variety of sources, while retaining the essential hMSC characteristics 

(fibroblast-like morphology, surface markers phenotype, multilineage 

differentiation, and self-renewal potential).The developed SF, XF culture 

system (MSC NutriStem® XF medium, MSC Attachment Solution, either 

MSC Dissociation Solution or Recombinant Trypsin solution, and MSC 

Freezing Solution) supports the expansion of hMSC suitable for clinical 

applications. 

Acknowledgements: We would like to thank Professor Mark L. Weiss, 

Kansas State University, Department of Anatomy and Physiology, 

Manhattan, KS, for his invaluable contribution to this study. 

Reference 

1. Poster: ISCT 2012 Seattle, USA. Identification of optimal conditions for 

generating MSCs for preclinical testing: Comparison of three commercial 

serum-free media and low-serum growth medium. Weiss, Kansas State 

University, Department of Anatomy and Physiology, Manhattan, KS: Yelica 

López, Elizabeth Trevino, Mark L . 

P7 

Highly efficient inoculum propagation in perfusion culture using WAVE 

Bioreactor systems 

Christian Kaisermayer 1* , Jianjun Yang 2 

1 GE Healthcare Life Sciences, Björkgatan 30, 751 84 Uppsala, Sweden; 

2 GE 

China Research and Development Center Co. Ltd. Shanghai, China 

E-mail: Christian.Kaisermayer@ge.com 


Introduction: A perfusion-based process was developed to increase the 

split ratio during the scale-up of CHO-S cell cultures. Fedbatch cultures 

were inoculated with cells propagated in either batch or perfusion 

cultures. All cultures were grown in disposable Cellbag bioreactors using 

the WAVE Bioreactor system. Cell concentrations of 4.8 × 10 7 cells/mL were 

achieved in the perfusion culture, whereas the final cell concentration in 

the batch culture was 5.1 × 10 6 cells/mL. The higher cell concentration of 

the perfusion culture allowed for a more than six-fold increase of the split 

ratio to about 1:30. The method described here, can reduce the number of 

required expansion steps and eliminate the need for one or two 

bioreactors in the seed train. Single-use bioreactors at benchtop scale can 

be used for direct inoculation of production bioreactors. Alternatively, high 

biomass concentrations accumulated in perfusion culture can be used to 

seed production vessels at increased cell concentrations. Thus, the process 

time in these bioreactors, which often is the bottleneck in plant 

throughput, can be shortened. 

Materials and methods: • CHO-S cells (Life Technlologies) 

• Cultivation medium and feed concentrate: T13 and T13-F (Shanghai 

Hankang Biotech Co.) 

• WAVE Biorereactor 20/50 system (GE Healthcare) 

• Cellbag bioreactors (GE Healthcare) 

Batch and fed-batch cultivations were run in Cellbag 10 L bioreactors, 

perfusion cultures in Cellbag 2 L bioreactors. Cultivation conditions: T 37°C, 

pH 7.10, DO > 40%, agitation for all cultures 25 rpm/6°. 

Analytics: Cell concentration and viability, glucose and lactate concentration. 

Perfusion and feed rates were adjusted to maintain the residual glucose 

concentration above 0.5 g/L. 

Results and discussion: CHO cells are the production system of choice for 

complex recombinant proteins. The prevalent mode of production is 

fedbatch cultivation because of the generated titers achieved with limited 

process complexity [1]. Perfusion processes have been reported as an 

alternative strategy that substantially increases volumetric productivity but 

because of the higher process complexity, they are less frequently used in 

manufacturing [2,3]. An alternative strategy is to use perfusion technology in 

the seed train to improve process flexibility and maximize equipment 

utilization [3]. In this comparative study, CHO-S cells were grown in either 

batch or perfusion (Figure 1) culture to generate inocula for subsequent fedbatch 

cultivations. During the initial phase, cell growth in both cultures was 

similar (Figure 1). However, despite high cell viability, the growth rate in the 

batch culture decreased from 0.8 d -1 during the first two days to about 0.3 d -1 

between day 2 and 6 (data not shown). In contrast, the nutrient supply in 

the perfusion culture supported an average growth rate of 0.8 d -1 and an 

exponential growth until day 5 (Figure 1). Inoculum was removed from each 

seed culture while the cells were still growing at their maximum rate and 

while viability was above 95%. The higher cell concentration achieved in the 

perfusion culture was used to seed a subsequent fedbatch culture at an




Figure 1(abstract P6) hMSC Features after culturing in MSC NutriStem® XF. Characterization of hMSC-WJ expanded for 5 passages in MSC 

NutriStem® XF and in-house serum-containing formulation. Immunophenotype using FACS analysis (A), multilineage differentiation into adipocytes (Oil 

Red O), osteocytes (von Kossa), and chondrocytes (Masson’s trichrome) (B), CFU-F assay (C). hMSC cultured in MSC NutriStem® XF maintains the essential 

MSC characteristics; classical profile of MSC markers, multilineage differentiation, and self-renewal potential [1]. 

increased split ratio of 1:30, compared with 1:5 used for the inoculum from 

the batch culture. Cell growth in the two subsequent fed-batch cultures is 

shown in Figure 1. The cultures inoculated from either batch or perfusion 

culture showed comparable growth and no lag phase was observed after 

inoculation. A comparison of the individual culture parameters is presented in 

Table 1. The higher split ratio in the perfusion culture saves at least one step 

in the inoculum propagation as compared with cultivation in batch mode, for 

which two subsequent cultures with a split ratio of 1:5 would be required to 

obtain a similar ratio. Even higher split ratios could be achieved in perfusion 

cultures. On day 6, the cell concentration was 4.06 × 10 7 cells/mL with a 

viability of 96%. (Figure 1). Although the cells were already at the end of the 

exponential growth phase, a split ratio of 1:100 could be achieved at this 

timepoint. The fed-batch culture inoculated from the perfusion culture was 

started at a substantially higher cell concentration than the one inoculated 

from the batch culture and, thus, reached its maximum cell concentration 

about two days earlier (Figure 1). Additionally the viable cell integral was 

increased by about 20% (data not shown). Assuming constant product 

formation during cell growth, this would allow to reach the same amount of 

product two days earlier and, thus, shorten process time in the main 

bioreactor. The use of perfusion cultures for seeding the production 

bioreactor at high cell concentrations has also been reported for an industry 

process at 13,500 L working volume where it resulted in a 20% decrease in 

the occupation of the production vessel [3]. 

Conclusions: • Perfusion culture maintained cells in exponential growth 

phase for an extended period of time compared with batch culture. 

• The high cell concentrations obtained in perfusion culture can 

substantially increase the split ratio, thus, minimizing the number of 

vessels needed in the seed train. 

• Alternatively, the production bioreactor can be inoculated at high cell 

concentration, which can help shortening process time in the 

production vessel and improving facility utilization. 

• One WAVE Bioreactor 20/50 system, run in perfusion mode at the 

maximum operating volume of 25 L, could provide inoculum for a 

2000 L bioreactor. 

References 

1. Shukla A, Thömmes J: Recent advances in large-scale production of 

monoclonal antibodies and related proteins. Trends Biotechnol 2010, 

28:253-261. 

2. Wang L, Hu H, Yang J, Wang F, Kaisermayer C, Zhou P: High yield of 

human monoclonal antibody produced by stably transfected drosophila 

schneider 2 cells in perfusion culture using wave bioreactor. Mol 

Biotechnol 2012, 52:170-179. 

3. Pohlscheidt M, Jacobs M, Wolf S, Thiele J, Jockwer A, Gabelsberger J, 

Jenzsch M, Tebbe H, Burg J: Optimizing capacity utilization by large scale 

3000 L perfusion in seed train bioreactors. Biotechnol Prog 2013, 

29:222-229.




Figure 1(abstract P7) CHO-S cells grown in batch and perfusion. Arrow indicates seed removal for subsequent fedbatch cultures (upper panel). 

Comparison of CHO-S fed-batch cultures inoculated from either batch or perfusion (lower panel). 

P8 

Intact cell MALDI mass spectrometry biotyping for “at-line” monitoring 

of apoptosis progression in CHO cell cultures 

Sebastian Schwamb 1* , Bogdan Munteanu 1 , Björn Meyer 1 , Carsten Hopf 1,2 , 

Mathias Hafner 1,2,3 , Philipp Wiedemann 1,2 

1 Center for Applied Biomedical Mass Spectrometry (ABIMAS), Mannheim, 

Baden-Württemberg, 68163, Germany; 

2 Mannheim University of Applied 

Sciences, Mannheim, Baden-Württemberg, 68163, Germany; 

3 Heidelberg 

University, Institute for Medical Technology, Mannheim, Baden-Württemberg, 

68163, Germany 

E-mail: s.schwamb@hs-mannheim.de 


Background: Mammalian cell cultures, especially Chinese Hamster Ovary 

(CHO), are the predominant host for the production of biologics. Despite 

considerable progress in industry and academia alike (also enforced e.g. 

by the Process Analytical Technology Initiative of the FDA), particularly in 

Table 1(abstract P7) Comparison of fed-batch cultures 

FB seeded from batch 

FB seeded from perfusion 

Cell conc. at cell removal [c/mL] 2.2 × 10 6 2.3 × 10 7 

Split ratio 1:5 1:30 

Inoculum conc. [c/mL] 4.1 × 10 5 7.4 × 10 5 

Process time [d] 14 14 

Peak cell conc. [c/mL] 1.4 × 10 7 1.7 × 10 7 

Av. μ during growth phase [d -1 ] 0.44 0.52 

Inoculum propagated either in batch or perfusion culture




the field of process monitoring there is still a need for innovative 

methods enabling improvement of process monitoring. For optimized 

process control it would be imperative to know as early as possible 

“when a cell needs what”, when it is stressed, running into substrate 

limitations etc., at best in an online or robust at line format. 

Intact cell MALDI mass spectrometry (ICM-MS) biotyping, a method used 

successfully in the field of clinical and environmental microbiology, is 

getting more attention in the context of mammalian cell cultivation. Here 

we report preliminary results of an assessment of a fast and high 

throughput at line capable ICM MS method for cell culture monitoring. As 

a first example, we choose apoptosis monitoring. 

The identification of specific mass spectrometric signatures related to 

early stages of apoptosis using ICM-MS biotyping as reported here could 

be a promising tool for CHO culture. 

Material and methods: An exponentially growing CHO suspension cell 

line was inoculated at a seeding density of 2 × 10 5 cells/ml and an initial 

volume of 30 ml in 125 ml Erlenmeyer flasks. Samples for assessing viabilityand 

apoptosis-progression and for ICM MS biotyping were taken at 48, 72, 

96,120,144,192and240h.Experimentswerecarriedoutasbiological 

triplicates. 

Viability was determined by trypan blue dye exclusion using a ViCell 

(Beckman Coulter, Krefeld, Germany) for automated processing. Apoptosis 

was measured in triplicate for each biological sample by means of caspase-9 

activity (Caspase-Glo®9 assay kit; Promega, Mannheim, Germany) using a 

microplate format (plate reader POLARstar Omega, BMG Labtech, Ortenberg, 

Germany). 

ICM MS biotyping (using a Bruker Autoflex III MALDI-TOF/TOF MS) analysis 

samples were prepared from as little as 2500 cells. The method is 

described in detail by Munteanu et al. (2012) [1]. 

Results: To evaluate the power of ICM MS as an at-line analytical method 

for apoptosis monitoring, batch cultivations of CHO suspension cells were 

analyzed by standard analytical methods and ICM MS in comparison. 

Cell viabilities as assessed by trypan blue remained constant over 120 h of 

batch cultures. A first drop in cell viability was noticed between 120 and 

144 h (Figure 1 a). 

In ICM MS analysis, a total of approx. 160 m/z values was monitored in a 

mass to charge (m/z) range of 4,000 to 30,000. Principle component analysis 

(PCA; Figure 1 c) of ICM MS results showed no clear group discrimination 

during the first 96 h of cultivation. Interestingly, cell samples obtained from 

120 h of cultivation onwards appear as distinct groups in PCA analysis. 

Figure 1(abstract P8) Viability (a), caspase-9 activity (b) and ICM MS biotyping (c) during batch cultivation. FC RLU: Fold change of relative 

luminescence units; PC: Principal component of the respective analysis. (a) and (b): given are means of measurements of three experiments (i.e. n = 3) ±SD; 

(3): each dot represents one ICM MS measurement. Dashed lines illustrate at which point culture alteration is detectable with the respective method.




Table 1(abstract P8) Details of classifying “unknown” 

samples using the CPT model 

“unknown” 

sample [h] 

Drop of 

viability [Y/N] 

Apoptosis 

detection [Y/N] 

48 N N Viable 

(no 

94 

72 N N 

96 N N 

Class PPV [%] 

apoptosis 

signal) 

120 N Y Early apoptotic 

83 

144 Y Y Late apoptotic 

100 

192 Y Y 

240 Y Y 

The concentration of the monitored apoptosis marker (caspase-9 activity; 

Figure 1 b) began to increase between 96 and 120 h, i.e. concomitantly 

with PCA analysis (Figure 1). 

As a result, ICM MS as reported here allowed for rapid detection of cell 

viability changes approx. 24 h earlier than standard culture monitoring 

and concomitant with the detection of an early, not “at-line” applicable 

apoptosis marker. 

Closer data analysis allowed the identification of an apoptosis related 

subset of m/z values. Using the software ClinProTools (CPT; Bruker 

Daltonik) it was possible to develop a classification model which points 

toward classification of unknown samples regarding their viability/ 

apoptosis state (Table 1). The classification power was illustrated as 

positive predictive value (PPV) which is the number of correctly classified 

samples over the total number of classified samples. All biological samples 

were analyzed as 6-8 technical replicates, meaning in theory a PPV > 50% 

is sufficient for classification. 

Conclusion: We introduced a fast and robust ICM MS method for 

predictive cell culture monitoring. Viability changes can be detected up to 

24 h earlier compared to standard methods (e.g. trypan blue). 

We identified a specific MS signature (condensed subset of original 

spectra) of m/z values related to cell stress and apoptosis. 

A model built on the basis of this signature allows classification of unknown 

samples regarding their viability/apoptosis level. 

These results will be substantiated by assessment of further cell lines as well 

as monitoring attributes other than cell stress/apoptosis (e.g. product titer or 

metabolite progression). 

Reference 

1. Munteanu B, von Reitzenstein C, Hänsch GM, Meyer B, Hopf C: Sensitive, 

robust and automated protein analysis of cell differentiation and of 

primary human blood cells by Intact cell MALDI mass spectrometry 

biotyping. Anal Bioanal Chem 2012, 408:2277-2286. 

P9 

Seed train optimization for suspension cell culture 

Tanja Hernández Rodríguez 1 , Ralf Pörtner 2 , Björn Frahm 3* 

1 Department of Mathematics, Bielefeld University, Bielefeld, D-33615, 

Germany; 

2 Institute of Bioprocess and Biosystems Engineering, Hamburg 

University of Technology, Hamburg, D-21073, Germany; 

3 Biotechnology & 

Bioprocess Engineering, Ostwestfalen-Lippe University of Applied Sciences, 

Lemgo, D-32657, Germany 

E-mail: bjoern.frahm@hs-owl.de 


Fields of application: Fields of application are the production of 

biopharmaceuticals (antibodies, proteins for diagnostic and therapeutic 

purposes) based on suspension cell culture and cultivation scales and 

-systems of any kind. 

Introduction: The purpose of a seed train is the generation of an 

adequate number of cells for the inoculation of a production bioreactor. 

This is time- and cost-intensive: From volumes used for cell thawing or cell 

line maintenance the cell number has to be increased. The cells are usually 

run through many cultivation systems which become larger with each 

passage (e.g. T-flasks, roller bottles or shake flasks, small scale bioreactor 

systems and subsequently larger bioreactors. Single-use systems may be 

applied and systems which are inoculated at a partly filled state and 

culture volume is increased afterwards by medium addition). The 

production bioreactor is inoculated out of the largest seed train scale. 

Motivation: A seed train offers space for optimization, e.g. choice of 

optimal points in time for cell passaging from one scale into the larger 

one. Furthermore choice of inoculation cell density as well as culture 

volume at inoculation in bioreactor scales (when inoculation volume is 

below maximum working volume). When designing a new seed train, the 

volumes of the cultivation scales may also be open for optimal choice. 

Results: Tool strucbture: A seed train structure has been programmed in 

Matlab®. The implemented model calculates cell growth, cell death, uptake 

of substrates and production of metabolites. The tool is suitable for 

different cell lines via entering corresponding model parameters, medium 

and seed train information. Seed train optimization is possible regarding 

cell passaging at optimal Space-Time-Yield (STY) or other optimization 

criteria [1]. 

Application example for CHO cell line: Based on three cultivations, cell 

line model parameters have been determined using the simplex algorithm 

by Nelder and Mead. The whole seed train is modeled for cell passaging at 

fixed time intervals (current method, reference) and cell passaging at 

optimal points in time (optimized method). For this, the tool calculates 

Space-Time-Yield-(STY)-courses for every scale and selects the optima. 

As examples, Figure 1 shows an input mask of the seed train starting 

conditions as well as the courses of STY and viability over time during 

growth for flask scale 2: 

Figure 1 indicates that the reference method passages the cells in T-flasks 

and roller bottles when Space-Time-Yield (STY) is already decreasing and 

viability dropping which is too late (beginning of stationary phase, not 

presented). 

The whole optimized seed train is calculated including optimal points in 

time for cell passaging and optimal inoculation volumes and -densities in 

reactor scales. Table 1 gives an example of an output screen. 

In this example, time saving until inoculation of a 5,000 L production 

bioreactor is 108 hours. When the averages of point in time of optimal 

Space-Time-Yield (STY) and point in time of growth rate decreased to 90% 

are taken, time saving is 114 hours. This method also offers a ‘safety’ time 

span between cell passaging and beginning of stationary phase. 

Conclusions: The tool improves seed train understanding and allows seed 

train design and optimization. Time savings as well as increased viabilities 

for passaging are possible. The tool has also been tested using a known 

and manually optimized seed train. Without such time consuming lab 

work, the tool has delivered the same optimized seed train only based on 

data of two batches [2]. 

References 

1. Frahm B: Seed train optimization for cell culture. Animal Cell 

Biotechnology-Methods and Protocols Springer/Humana Press, in print: 

Pörtner R, 3. 

2. Kern S: Model-based design of the first steps of a seed train for cell 

culture processes. BMC Proceedings 2013, 7(6):P11. 

P10 

In vitro safety assessment of nanosilver with improved cell culture 

systems 

Alina Martirosyan * , Madeleine Polet, Yves-Jacques Schneider 

Laboratory of Cellular, Nutritional and Toxicological Biochemistry, Institute of 

Life Sciences & UCLouvain, Croix du Sud, L7.07.03, Louvain-la-Neuve, B1348, 

Belgium 

E-mail: alina_mart@list.ru 


Background: Silver nanoparticles (Ag-NPs) become increasingly 

prevailing in consumer products as antibacterial agents [1] and their 

potential threat on human health makes the risk assessment of utmost 

importance. In order to elucidate the complex interactions of Ag-NPs 

upon digestion in the gastrointestinal tract, an improved in vitro cell 

culture system was used. The model contained, beside the enterocytes,




Figure 1(abstract P9) One input mask of the seed train starting conditions as an example for the tool’s user interface and courses of Space- 

Time-Yield (STY) and viability over time during growth for flask scale 2. 

specialized microfold (M) cells, able to increase the absorption of micro- and 

nanoparticles [2,3]. 

In the current study, different aspects of the toxicity of Ag-NPs on the cell of 

intestinal epithelium were studied, i.e. cytotoxicity, inflammatory response 

and barrier integrity of the epithelial monolayer. 

Materials and methods: The cytotoxic effect of AgNPs < 20 nm (10-90 

μg/ml, Mercator GmbH, DE) was assessed by MTT assay on Caco-2 cells 

(clone 1, from Dr. M. Rescigno, University of Milano-Bicocca, IT). The 

co-culture model was received by co-culturing Caco-2 cells with RajiB cells 

(ATCC, Manassas, VA) in Transwell permeable supports (Corning Inc., NY) 

[1,2]. The inflammatory mediators chemokine IL-8 and nitric oxide (NO) 

levels were analysed in both apical (AP) and basolateral (BL) compartments 

by ELISA (BD Biosciences Pharmingen, San Diego, CA) and by Nitrate/Nitrite 

Colorimetric Assay Kit (Cayman Chemical Company, Ann Arbor, MI), 

respectively, according to the manufacturer’s instructions. 

The expression levels of the IL-8 and iNOS (inducible Nitric Oxide Synthase) 

genes were evaluated by quantitative real-time PCR (qRT-PCR), where the 

primers used were: for IL-8 CTGGCCGTGGCTCTCTTG (sense) and GGGT 

GGAAAGGTTTGGAGTATG (antisense) and for iNOS - TGTGCCACCTC 

CAGTCCAGT (sense) CTTATGGTGAAGTGTGTCTTGGAA (antisense). Levels of 

individual transcripts were normalized to those of glyceraldehyde-3- 

phosphate dehydrogenase (GAPDH). Relative quantification (RQ) values - 

fold change of the target gene expression compared to the untreated 

sample, were calculated by 2 -ΔΔCt method [4]. 

The barrier integrity of the cell monolayers of mono- and co-cultures under 

the influence of AgNPs was evaluated on 21 days fully differentiated




Table 1(abstract P9) Output screen example displaying the whole seed train including inoculation of production bioreactor (reactor scale 4, 

5,000 L). 

cultures in bicameral inserts by measuring the transepithelial electrical 

resistance and the passage of Lucifer Yellow. 

The immunofluorescence staining of two tight junctions (TJs) proteins, i.e. 

occludin and ZO-1 was realized by mouse anti-occludin/anti-ZO-1 as 

primary and Alexa Fluor 488 goat anti-mouse as secondary antibodies 

(Invitrogen). Images were collected by Zeiss LSM 710 confocal microscope. 

Results: Ag-NPs displayed a dose-dependent cytotoxic effect on Caco-2 cells 

starting from 30 μg/ml. The pro-inflammatory chemokine IL-8 levels were 

reduced under the influence of Ag-NPs (Figure 1a) in AP compartments in 

both mono- and co-cultures. In contrast, practically no changes in IL-8 levels 

were observed in the BL compartments. The ELISA analysis data were 

confirmed by qRT-PCR analysis, where the expression levels of the IL-8 gene 

showed a tendency to decrease in both mono- (fold change ≈ 0.86) and 

co-cultures (fold change ≈ 0.7) under the influence of Ag-NPs. 

NO content was increased in both AP and BL compartments in both monoand 

co-cultures (Figure 1b), although more marked in the latter case. In BL 

compartments, the NO levels increase was dependent on the Ag-NPs 

concentration. In contrast to IL-8, there were practically no changes 

observed in the iNOS gene expression levels in Caco-2 cells, indicating that 

Ag-NP-induced NO generation increase is likely independent of the iNOS 

gene expression. 

Immunostaining with confocal microscopy analysis of two TJs proteins, i.e. 

occludin and ZO-1, revealed that, in Ag-NP-treated cells, the continuity of 

both occludin and ZO-1 was disrupted as compared to control and the 

aggregationofbothproteinswasobserved. The Ag-NP-induced dashed 

and degraded distributions of occludin and ZO-1 suggest the opening of 

TJs (not illustrated). The opening of junctions was further confirmed by 

decreased TEER values and increased LY passage rates in Ag-NP-treated 

samples. These effects were less obvious in co-cultures, a more accurate 

model to reflect in vivo conditions, suggesting that the presence of 

M-cells seemingly decreases the toxicity of AgNPs. 

Conclusions: These results suggest that Ag-NPs: (i) are cytotoxic 

for intestinal epithelial cells; (ii) possess anti-inflammatory properties; and 

(iii) mediate the intestinal barrier function disruption. Differences in response 

to Ag-NPs were observed in mono- and co-cultures, where the NPs affected 

less obviously the IL-8 levels and barrier function in co-cultures, while, in 

contrast, led to more marked increase of NO concentration in comparison 

with mono-cultures. These differences demonstrate the advisability of 

application of more complex in vitro models and further need of 

improvement of the model by addition of e.g. mucus producing cells and/or 

dendritic cells that would provide a tool to achieve even more reliable and 

predictive correlations between in vitro studies and in vivo outcomes. 

Acknowledgements: This work was supported by a mobility grant of the 

Belgian Federal Science Policy Office (BELSPO) co-funded by the Marie 

Curie Actions from the European Commission. 

References 

1. Des Rieux A, Ragnarsson EG, Gullberg E, Preat V, Schneider Y-J, Artursson P: 

Transport of nanoparticles across an in vitro model of the human 

intestinal follicle associated epithelium. Eur J of Pharm Sci 2005, 25:455-465. 

2. Des Rieux A, Fievez V, Theate I, Mast J, Preat V, Schneider Y-J: An improved in 

vitro model of human intestinal follicle-associated epithelium to study 

nanoparticle transport by M cells. Eur J of Pharm Sci 2007, 30:380-391. 

Figure 1(abstract P10) IL-8 (a) and NO (b) levels in mono- and co-cultures in AP and BL compartments upon exposure to Ag-NPs (45 μg/ml). 

*samples significantly different from the corresponding control. Means of 3 independent experiments ± SD are given, P < 0.001.




3. The Project on Emerging Nanotechnologies. [http://www.nanotechproject. 

org]. 

4. Livak KJ, Schmittgen TD: Analysis of relative gene expression data using 

real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 

2001, 25:402-408. 

P11 

Model-based design of the first steps of a seed train for cell culture 

processes 

Simon Kern 1,2 , Oscar B Platas 1 , Martin Schaletzky 1 , Volker Sandig 3 , 

Björn Frahm 2 , Ralf Pörtner 1* 

1 Institute of Bioprocess and Biosystems Engineering, Hamburg University of 

Technology, Hamburg, D-21073, Germany; 

2 Biotechnology & Bioprocess 

Engineering, Ostwestfalen-Lippe University of Applied Sciences, Lemgo, D-32657, 

Germany; 

3 ProBioGen AG, Berlin, D-13086, Germany 

E-mail: poertner@tuhh.de 


Concept: Production of biopharmaceuticals for diagnostic and therapeutic 

applications with suspension cells in bioreactors requires a seed train up to 

production scale [1]. For the final process steps in pilot and production 

scale the scale-up steps are usually defined (e.g. a factor of 5 - 10). More 

difficult in this respect are the first steps, the transitions between T-flasks, 

spinnertubes,rollerbottles,shakeflasks,stirredbioreactorsorsingle-use 

reactors, because here often scale-up steps are different. The experimental 

effort to lay these steps out is correspondingly high. At the same time it is 

known that the first cultivation steps have a significant impact on the 

success or failure on production scale. The concept for a model based 

design of the seed train consists of the following steps: 

➢ A simple unstructured kinetic model, where kinetic parameters 

can be obtained from a few experiments only. 

➢ A Nelder-Mead-algorithm to determine model parameters. 

➢ A MATLAB simulation based on this model to determine optimal 

points in time or viable cell concentrations respectively for harvest of 

seed train scales from spinner tubes over shake flasks up to a stirred 

bioreactor based on an optimization criterion. 

Verification: The concept was verified for a suspendable cell line (AGE1. 

HN, ProBioGen AG) grown in serum-free 42-Max-UB medium (Teutocell 

AG, Germany) containing 5 mM-Glutamine. 

Two batch experiments were performed in shake flasks for determination 

of kinetic parameters. 

The average value of time for minimal and maximal Space-Time-Yield for 

cells was used as optimization criterion for cell transfer. 

The concept was tested successfully up to a 5 L scale for 6 scale-up steps 

(Figure 1). 

Conclusions: The concept offers a simple and inexpensive strategy for 

design of the first scale-up steps. The results show that the tool was able 

to perform a seed train optimization only on the basis of two batches, the 

underlying model and its parameter identification. This quick optimization 

led to the same results as the extensive manual optimization carried out in 

the past. 

Acknowledgements: The bioreactor (Labfors 5 Cell) was kindly provided 

by the company Infors AG, the cell line AGE1.HN by ProBioGen AG. 

Reference 

1. Eibl R, Eibl D, Pörtner R, Catapano G, Czermak P: Cell and Tissue Reaction 

Engineering. Springer 2008, ISBN 978-3-540-68175-5. 

P12 

Novel approaches to render stable producer cell lines viable for the 

commercial manufacturing of rAAV-based gene therapy vectors 

Verena V Emmerling 1* , Karlheinz Holzmann 3 , Karin Lanz 3 , Stefan Kochanek 2 , 

Markus Hörer 1 

1 Rentschler Biotechnologie GmbH, Erwin-Rentschler-Straße 21, 88471 

Laupheim, Germany; 

2 Division of Gene Therapy, University of Ulm, Helmholtz 

Str. 8/1, 89081 Ulm, Germany; 

3 Department of Internal Medicine III, University 

Hospital of Ulm, Albert-Einstein-Allee 23, 89081 Ulm, Germany 

E-mail: Verena.Emmerling@rentschler.de 


Figure 1(abstract P11) Time course of simulated and experimentally 

determined viable cell density and cell number during model based 

seed from culture tube to lab-scale-bioreactor. 1: culture tube (0.01 L); 

2: shake flask (0.035 L); 3: shake flask (0.13 L), 4: Vario 1000 (medorex, 0.35 L), 

5: VSF 2000 (Bioengineering, 1 L); 6: Labfors 5 Cell (Infors, 2.5 L). 

Background: Recombinant Adeno-associated virus (rAAV) based vectors 

recently emerged as very promising candidates for viral gene therapy due 

to a large toolbox available including twelvedifferentAAVserotypes, 

natural isolates, designer capsids and library technologies [2]. Furthermore, 

rAAV vectors have favourable properties such as non-pathogenicity of 

AAV, low B-/T-cell immunogenicity against transgenes delivered and longterm 

transgene expression from a non-integrating vector [5,9]. Promising 

data from clinical trials using rAAV-based vectors for the treatment of e.g. 

haemophilia or retinal diseases as well as the recent approval of the first 

gene therapy drug in the European Union, Glybera® to treat lipoprotein 

lipase deficiency, emphasise the potential of rAAV vectors for gene therapy 

approaches in a wide variety of indications [8,7,15]. Thereby, the demand 

for robust and cost-effective manufacturing of those vectors for market 

supply rose steadily. Standard production systems comprise transient 

transfection- and/or infection-based approaches using mammalian cells [3], 

or insect cells [16]. However, high production costs combined with 

considerable regulatory effort and safety concerns gave rise to the 

development of producer cell lines enabling stable rAAV production [3]. 

AAVs are parvoviruses whose productive infection is depending on the 

presence of helper viruses like e.g. adenovirus (AdV). Their singlestranded 

DNA genome carries two genes. The rep gene encodes proteins 

responsible for site-specific integration, viral genome replication as well 

as packging. The cap gene is translated into three structural proteins 

building the capsid shelf. Furthermore, cap encodes a protein required 

for capsid assembly (AAP or assembly-activating protein) that has been 

described recently [13]. The AAV genes are flanked by inverted terminal 

repeat (ITR) sequences constituting the replication, integration and 

packaging signal. In a stable producer cell line with integral helper 

functions, all required genetic elements are stably integrated into the 

genome of the host cell as independent expression constructs: the 

recombinant vector implying a transgene flanked by AAV ITRs, the AAV 

genes rep and cap required for replication and encapsidation, as well as 

adenoviral helper function delivered by sequences encoding genes E1a, 

E1b, E2a, E4orf6 and viral associated (VA) I/II RNA [9]. In a timely regulated 

fashion, viral proteins are expressed and the AAV genome is replicated 

and encapsidated. As some of the gene products arising during rAAV 

production are toxic, an inducible expression of the gene products is 

indispensable for generation of stable production cells. 

The aim of the underlying study is to provide all tools necessary to generate 

a stable and versatile producer cell line In order to circumvent the problems 

triggered by toxic proteins inevitably arising during rAAV formation, one 

objective of the project is to establish stable producer cells where rAAV 

production can be induced by temperature shift at the final production 

scale. To begin with, we first performed some general feasability studies to




Figure 1(abstract P12) (A) Transfection- and infection-based generation of rAAV in HeLa cells at different temperatures. Cells were transfected 

by calcium phosphate using three plasmids encoding the rAAV vector, rep and cap, followed by AdV5 infection and subsequent incubation of the cells 

at three different temperatures. Genomic rAAV titers were determined 96 h post infection as previously described [4]. (B) Investigation of rAAV production 

in a “transfection only approach” applying plasmids encoding rep, cap, vector as well as adenoviral E1 and remaining AdV helper functions. Different 

variants of rep and cap were compared regarding rAAV productivity. 1: Approach implying functionally separated rep and cap genes on different 

plasmids, which are devoid of rep78 expression and lack an artificial Rep Binding Site (RBS) in the pUC19 plasmid backbones [6] (standard plasmids used 

in all preceding experiments). 2: Same rep and cap plasmids but modified to avoid the expression of non-functional and truncated viral gene products by 

deletion of various promoter and potential transcription start sites. Genome titre was analyzed 120 h post infection as previously described [4]. 

investigate whether the generation of stable and inducible producer cell 

lines using proprietary constructs is a viable approach. For this purpose, 

experiments for rAAV manufacturing based on a transient packaging 

approach were conducted. Infection of rep, cap and rAAV vector 

plasmid transfected cells with wildtype Adenovirus was compared with 

co-tranfection of the cells with additional plasmids carrying the Adenoviral 

helper genes. The influence of different cultivation temperatures on 

Adenovirus replication kinetics and rAAV productivity in the transient 

packaging approaches were analyzed. Furthermore, we investigated 

differential gene expression in response to temperature downshifts. 

Results: In the first experiments, a transfection-/infection-based approach 

was chosen to produce rAAV. For this, HeLa cells were co-transfected with 

three plasmids encoding the AAV vector on one side and the rep and cap 

genes delivered on two separate constructs on the other side (trans-split 

packaging system, [6]). Subsequently, cells were infected with a helper virus. 

Cultivation of cells at 32 °C post infection resulted in significantly increased 

rAAV titres compared to 37 °C (Figure 1A). This could arise from an arrest of 

cells in G 2 /M phase, causing enhanced growth but decreased proliferation. 

Hence, cells exhibit enlarged size and elevated protein production, possibly 

supported by avoided degradation of rDNA as previously described for CHO 

cells [14]. Repressed adenoviral replication kinetics may trigger prolonged 

cellular viability and, thereby, further increase rAAV titres. In fact these 

results also suggest that high copy numbers of helper genes are not 

essential for efficient rAAV packaging being an important prerequisite for 

the generation of efficient producer cells by stable integration of only few 

copies of the Adenoviral helper genes. Importantly, rAAV production was 

also possible replacing the adenovirus infection step by co-transfection of 

rep-, cap- and rAAV vector transfected HeLa cells with two more plasmids 

coding for all known adenoviral helper genes. Considering that in such an 

approach cells have to be co-transfected by five different plasmids at the 

same time in order to produce rAAV, the yiels obtained in this “transfection 

only approach” were quite promising. Overall rAAV yields generated with 

the rep/cap trans-split packaging system [6] could be further increased by 

modifications of the rep and cap coding sequences in terms of avoidance of 

production of non-functional byproducts (Figure 1B). 

Differential gene expression analysis of HeLa cells cultivated at different 

temperatures gave rise to the identification of three genes up-regulated 

up to 7-fold and 16 miRNAs likely regulated more than 2-fold at lowered 

temperature (Table 1). Underlying genetic switches are subject to further 

investigations. Appropriate temperature-inducible switches will be used to 

control expression of the adenoviral helper gene E1a, thekeyinducerof 

thewholecascaderequiredforrAAV production. Applied in stable 

producer cells, such a system would allow for timely-regulated induction 

of rAAV production. Making use of a temperature shift as primary switch 

for rAAV production, we would combine the inevitable induction event 

with conditions presumably enhancing rAAV production. 

Conclusions: Taken together, these first data provide the basis for a 

successful generation of temperature inducible stable producer cells 

Table 1(abstract P12) Analysis of differential gene expression in HeLa triggered by different cultivation temperatures 

Name Differential expression at Mode of regulation Microarray analysis RT qPCR 

Gene A 30°C Up 3.2-fold 6.9-fold 

Gene B 30°C Up 2.2-fold 2.6-fold 

Gene C 30°C Up 3.3-fold 2.3-fold 

miRNA A 32°C Up 3.1-fold - 

miRNA B 32°C Down 3.3-fold - 

miRNA C 32°C Up 3.0-fold - 

Cells were seeded at two different densities and cultivated at 37°C for two days. Subsequently, cells were incubated for another 6 hours at 30, 32, and 37°C, 

respectively, before mRNA was isolated from the cells. Microarray analysis (GeneChip® Human Exon 1.0 ST Array, Affymetrics) was performed to identify mRNAs 

differentially expressed more than 2-fold. Validation was done by RT qPCR analysis (EvaGreen® Mastermix, Biorad) and included controls of regulated and nonregulated 

mRNAs [12,11,1]. Differentially expressed miRNAs (>2-fold) were also identified by microarray analysis (GeneChip® miRNA 2.0 Array, Affymetrics). As 

validation is not yet completed, only an excerpt of the most promising miRNA candidates is shown.




carrying all genetic elements required for rAAV production. A versatile 

and high-titre rAAV production platform based on such cells will be 

applicable for industrial-scale manufacturing and thus has the potential to 

open AAV-based gene therapy to a high number of patients. 

References 

1. Ars E, Serra E, de la Luna S, Estivill X, Lázaro C: Cold shock induces the 

insertion of a cryptic exon in the neurofibromatosis type 1 (NF1) mRNA. 

Nucl Acids Res 2000, 28(6):1307-1312. 

2. Asokan A, Schaffer D, Samulski JR: The AAV Vector Toolkit: Poised at the 

Clinical Crossroads. Mol Ther 2012, 20(4):699-708. 

3. Aucoin MG, Perrier M, Kamen AA: Critical assessment of current adenoassociated 

viral vector production and quantification methods. 

Biotechnol Adv 2008, 26(1):73-88. 

4. Aurnhammer C, Haase M, Muether N, Hausl M, Rauschhuber C, Huber I, 

Nitschko H, Busch U, Sing A, Ehrhardt A, Baiker A: Universal real-time PCR 

for the detection and quantification of adeno-associated virus serotype 

2-derived inverted terminal repeats. Hum Gene Ther Methods 2012, 

23(1):18-28. 

5. Ayuso E, Mingozzi F, Bosch F: Production, purification and 

characterization of adeno-associated vectors. Curr Gene Ther 2012, 

10(6):423-436. 

6. Bertran J, Moebius U, Hörer M, Rehberger B: Host cells for packaging a 

recombinant adeno-associated virus (RAAV), method for the production 

and use thereof. World Intellectual Property Organization 2002, WO 02/ 

20748 A2. 

7. Hauswirth WW, Aleman TS, Kaushal S, Cideciyan AV, Schwartz SB, Wang L, 

Conlon TJ, Boye SL, Flotte TR, Byrne BJ, Jacobson SG: Treatment of leber 

congenital amaurosis due to RPE65 mutations by ocular subretinal 

injection of adeno-associated virus gene vector: short-term results of a 

phase I trial. Hum Gene Ther 2008, 19:979-990. 

8. Manno CS, Chew AJ, Hutchison S, Larson PJ, Herzog RW, Arruda VR, Tai SJ, 

Ragni MV, Thompson A, Ozelo M, Couto LB, Leonard DG, Johnson FA, 

McClelland A, Scallan C, Skarsgard E, Flake AW, Kay MA, High KA, Glader B: 

AAV-mediated factor IX gene transfer to skeletal muscle in patients with 

severe hemophilia B. Blood 2003, 101(8):2963-2972. 

9. Matsushita T, Okada T, Inaba T, Mizukami H, Ozawa K, Colosi P: The 

adenovirus E1A and E1B19K genes provide a helper function for 

transfection-based adeno-associated virus vector production. J Gen Virol 

2004, 85(8):2209-2214. 

10. Mingozzi F, High KA: Therapeutic in vivo gene transfer for genetic 

disease using AAV: progress and challenges. Nat Rev Genet 2011, 

12(5):341-355. 

11. Nishiyama H, Higashitsuji H, Yokoi H, Itoh K, Danno S, Matsuda T, Fujita J: 

Cloning and characterization of human CIRP (cold-inducible RNAbinding 

protein) cDNA and chromosomal assignment of the gene. Gene 1997, 

204:115-120. 

12. Sonna LA, Fujita J, Gaffin SL, Lilly CM: Molecular biology of 

thermoregulation invited review: Effects of heat and cold stress on 

mammalian gene expression. J Appl Physiol 2002, 92:1725-1742. 

13. Sonntag F, Schmidt K, Kleinschmidt JA: A viral assembly factor promotes 

AAV2 capsid formation in the nucleolus. Proc Natl Acad Sci USA 2010, 

107(22):10220-10225. 

14. Tait AS, Brown CJ, Galbraith DJ, Hines MJ, Hoare M, Birch JR, James DC: 

Transient production of recombinant proteins by chinese hamster ovary 

cells using polyethyleneimine/DNA complexes in combination with 

microtubule disrupting anti-mitotic agents. Biotechnol Bioeng 2004, 

88(6):707-721. 

15. UniQure BV:[http://www.uniqure.com/news/167/189/uniQure-s-Glybera-First- 

Gene-Therapy-Approved-by-European-Commission.html]. 

16. Urabe M, Ding C, Kotin RM: Insect cells as a factory to produce adenoassociated 

virus type 2 vectors. Hum Gen Ther 2002, 13:1935-1943. 

P13 

Benchmarking of commercially available CHO cell culture media for 

antibody production 

David Reinhart 1* , Christian Kaisermayer 2 , Lukas Damjanovic 1 , Renate Kunert 1 

1 Dept. of Biotechnology, University of Natural Resources and Life Sciences, 

Muthgasse 11, 1190 Vienna, Austria; 

2 GE Healthcare Life Sciences AB, 

Björkgatan 30, 75184 Uppsala, Sweden 

E-mail: david.reinhart@boku.ac.at 


Introduction: Chinese hamster ovary (CHO) cells have become the 

preferred expression system for the production of complex recombinant 

proteins. Several suppliers offer CHO specific cell cultivation media and 

sometimes also media systems, which combine feeds and basal medium. 

We compared eight commercially available CHO cell culture media and feed 

supplements from three different vendors to evaluate their influence on cell 

growth and antibody production of a CHO cell line. In conclusion, ActiCHO 

Media System, with a matching base media and feeds, resulted in the 

highest cell growth and the highest productivity. Further nutrient additions 

did not have a profound effect on the process performance. 

Materials and methods: Cultivation media: 

ActiCHO P (GE Healthcare) 

CD CHO (Life Technologies) 

CD OptiCHO (Life Technologies) 

CD FortiCHO (Life Technologies) 

Ex-Cell CD CHO (Sigma Aldrich) 

ProCHO 5 (Lonza) 

BalanCD CHO Growth A (Irvine Scientific) 

Cellvento CHO-100 (EMD Millipore) 

• Anti-Clumping Agent (Life Technologies) 

• CHO DG44 cells expressing an IgG antibody 

• Cultivation conditions: 37°C, 7% CO 2 , 140 rpm 

• Batch and fed-batch cultivations were run in Erlenmeyer shake flasks 

(Corning, NY). The cultures were grown in a CO 2 incubator shaker 

(Kühner, Switzerland) 

• Batch cultures were run as single experiments, the method 

variability was determined by a triplicate reference experiment in 

ActiCHO P. 

• During fed-batch processes the cultures were fed with the 

corresponding feeds ActiCHO Feed A and Feed B (GE Healthcare), 

BalanCD CHO Feed 1 (Irvine Scientific) or EfficientFeed Aand/or 

FunctionMAX (both Life Technologies) according to the manufacturers 

inctructions [1]. The respective feeding regimens are shown in Table 1. 

• Fed-batch cultures were run in triplicates. The residual glucose 

concentration was maintained above 3 g/L by addition of glucose 

concentrate 

• Analytics: cell concentration, viability, selected metabolites, product 

concentration, amino acid concentrations 

Results and discussion: In batch cultures the highest cell concentrations 

were obtained in ActiCHO P and BalanCD as shown in Figure 1. In ActiCHO P 

the cells initially grew with a slightly higher specific growth rate (data not 

shown) and therefore the maximum cell concentration was reached 3 days 

earlier than in BalanCD. In ProCHO 5, Cellvento CHO-100 and CD OptiCHO, 

cell concentrations of 4 × 10 6 to 5 × 10 6 cells/mL were reached. Although 

initially the growth was similar in all three media, the culture in ProCHO 

5 was terminated on day 7 due to a viability below 60%. In the other two 

media the batch lasted for four days longer. In Ex-Cell CD CHO cells grew to 

2.6 × 10 6 cells/mL which was about 30% of the cell concentration reached in 

ActiCHO P. Finally in CD CHO and CD FortiCHO cells formed small 

aggregates and rather low concentrations of 2.5 × 10 6 and 6.0 × 10 5 cells/ 

mL were obtained, respectively. Cell adaptation in CD FortiCHO during seven 

passages and addition of Anti-Clumping Agent (1:250) did not resolve the 

aggregation problem or improve cell growth (data not shown). The antibody 

production in the different cultures followed the same ranking as the cell 

growth (Figure 1). The highest titers were achieved in ActiCHO P and 

BalanCDCHO.InCDOptiCHO,Ex-Cell CD CHO and Cellvento CHO-100 

product concentrations of about 500 mg/L were reached. The lowest titers 

were generated in ProCHO 5 and CD CHO with 380 mg/L and 330 mg/L, 

respectively. Fed-batch cultivations were then run in selected basal media 

with the respective feeds according to table 1. Again there was a strong 

correlation between cell concentration and antibody production. The highest 

cell and product concentrations were obtained in ActiCHO P (Table 1). 

Compared with the previous batch cultures, the cell concentrations were 

more than doubled and due to the extended process duration the titer 

was increased more than 6 fold, as shown in table 1. Feeding cultures in 

ActiCHO P with Feed A and B alone or additionally with FunctionMAX, 

altered the process only marginally. Supplementing the fed-batch only 

with ActiCHO Feeds A&B resulted in slightly higher cell concentrations and 

the process duration was reduced by 2 days (data not shown). A fed-batch 

culture in BalanCD medium and Feed 1 reached only 80% of the cell 

concentration achieved during the previous batch culture, however,




Table 1(abstract P13) Feeding regimens in fed-batch cultures 

Basal medium ActiCHO Feed A ActiCHO Feed B EfficientFeed A FunctionMAX Feed 1 Peak cell conc. 

[10 6 c/ml] 

Harvest Titer 

[g/L] 

ActiCHO P daily; 3% daily; 0.3% - - 23.9 5.48 

ActiCHO P daily; 3% daily; 0.3% - 3, 5, 7; 3.3% 21.3 5.82 

CD OptiCHO - - 3, 5, 7, 9; 10% - 5.8 0.72 

CD OptiCHO - - 3, 5, 7; 10% - 5.2 0.80 

CD OptiCHO - - 3, 5, 7; 10% 3, 5, 7; 3.3% 6.3 1.74 

CD OptiCHO daily; 3% daily; 0.3% - - 9.0 1.46 

BalanCD CHO - - - - 1, 3, 5; 10% 7.1 1.30 

The time [d] for feed addition and the feed volume in % of the culture volume are indicated. Feed start for the culture in BalanCD CHO was day 1, all other 

cultures were fed from day 3 on. Values for peak cell concentration and harvest titer are mean values of triplicate experiments. 

feeding extended the process by five days and increased the antibody 

concentration by 60% compared with the previous batch culture to a final 

titer of 1.3 g/L (Table 1). Fed-batch cultures in CD OptiCHO achieved about 

40% of the cell concentrations in ActiCHO P. Similar cell concentrations 

were reached when feeding cultures in CD OptiCHO with ActiCHO feeds 

A and B or EfficientFeed A, independent if the feed was added during 7 or 

9 days or if additional feeding with FunctionMAX was performed (Table 1). 

However, the feeding had an impact on the product concentration. 

The lowest one was obtained when feeding cultures in CD OptiCHO with 

EfficientFeed A only. Further supplementation with FunctionMAX or 

feeding with ActiCHO Feed A&B substantially increased the product 

concentration (Table 1). 

Conclusions: • Batch cultivation in the different media resulted in peak 

cell concentrations from 2.5 × 10 6 to 9.0 × 10 6 cells/mL and a 

corresponding antibody titer from 220 to 860 mg/L. ActiCHO P and 

BalanCD CHO performed best in these cultures. 

Figure 1(abstract P13) Cell concentrations (upper panel) and product concentrations (lower panel) obtained in batch experiments with 

different commercially available CHO cell culture media. Titers in CD FortiCHO were not determined due to low cell concentrations. Error bars are 

one standard deviation.




• Fed-batch cultivations substantially improved cell and product 

concentration. Feeding cultures in CD OptiCHO with EfficientFeed A 

and FunctionMAX or with Feed A and Feed B resulted in similar 

antibody concentrations and roughly doubled the antibody 

production compared to feeding with EfficientFeed A only. 

• The highest titer was achieved in ActiCHO P in combination with Feed 

A and Feed B. In this medium a 6.3-fold improvement, compared with 

the previous batch cultivation, was observed. Further addition of 

FunctionMAX to these cultures did not significantly improve the 

antibody production. 

Reference 

1. Barrett S, Boniface R, Dhulipala P, Slade P, Tennico Y, Stramaglia M, Lio P, 

Gorfien S: Attaining Next-Level Titers in CHO Fed-Batch Cultures. 

BioProcess International 2012, 10:56-62. 

P14 

Advanced off-gas measurement using proton transfer reaction mass 

spectrometry to predict cell culture parameters 

Timo Schmidberger 1,2* , Robert Huber 2 

1 Department of biotechnology, University of Natural Resources and Life 

Sciences, 1180 Vienna, Austria; 

2 Sandoz GmbH BU Biopharmaceuticals, 6336 

Langkampfen, Austria 

E-mail: timo.schmidberger@sandoz.com 


Background: Mass spectrometry is a well-known technology to detect O 2 

and CO 2 in the off-gas of cell culture fermentations. In contrast to classical 

mass spectrometers, the proton transfer reaction mass spectrometer (PTR 

MS) enables the noninvasive analysis of a broad spectrum of volatile 

organic compounds (VOCs) in real time. The thereby applied soft 

ionization technology generates spectra of less fragmentation and 

facilitates their interpretation. This gave us the possibility to identify 

process relevant compounds in the bioreactor off-gas stream in addition to 

O 2 and CO 2 . In our study the PTR-MS technology was applied for the first 

time to monitor volatile organic compounds (VOC) and to predict cell 

culture parameters in an industrial mammalian cell culture process. 

Materials and methods: The aptitude of PTR MS for advanced bioprocess 

monitoring was assessed by Chinese hamster ovary (CHO) cell culture 

processes producing a recombinant protein conducted in a modified 7L 

glass bioreactor (Applikon, Shiedam, Netherlands). The PTR MS-hs (Ionicon, 

Innsbruck, Austria) was equipped with a QMS422 quadrupole for mass 

separation and with a secondary electron multiplier detector to measure 

masses ranging from 18 to 200 m/z. The equipment set-up is illustrated in 

Figure 1. On a daily basis the glutamine concentration was determined 

with the BioProfile 100 plus (Nova Biomedical, Waltham, MA) and the 

viable cell density (VCD) was measured with the Vi-Cell XR cell counter 

(Beckham Coulter, Fullerton, CA). Samples for the product quantification 

were pulled daily and analyzed once at the end of a fermentation using 

affinity liquid chromatography. The PTR-MS data was first filtered with an 

adaptive online repeated median filter [1] and then correlated to the cell 

culture parameters with partial least square regression (PLS-R) using the 

software SIMCA P12+ (Umetrics, Umea, Sweden). 

Results: The applicability of the PTR-MS technique was studied using eight 

different fermentations conducted during process optimization to determine 

key cell culture parameters such as viable cell density, product titer and 

glutamine by partial least square regression models. Probably the most 

important parameter in industrial cell culture processes is the viable cell 

density. The R² of the PLS-R model for the VCD was 0.86 and hence, lower 

compared to other methods found in literature (such as 2D fluorescence 

[2]). Especially low values, which were observed only in the first few days of 

the fermentation, showed a high prediction error. At the beginning of the 

fermentation the VOC composition in the off-gas is characterized by VOCs 

from the media preparation (probably impurities of the raw materials used) 

and only a few VOC can be assigned to the cells. The media was prepared 

up to one week before the fermentations started and, depending on the 

storage time, the initial VOC content varied. Within the first days the media 

assigned VOCs were washed out and the cells started to produce VOCs. 

Accordingly the effect of the initial condition was weaker and prediction got 

better. In a second PLS-R model the product concentration was estimated 

based on the PTR-MS data. The model was better compared to the 

estimation of the VCD what is reflected in a R² of 0.94. The effect of the early 

Figure 1(abstract P14) Experimental set-up to monitor VOCs in 

mammalian cell culture. 

process phase on the prediction quality is not very distinct since almost no 

product was produced in the first days. The good model for the titer is a hint 

that producing the product is correlated with metabolic pathways involving 

VOCs. However distinct metabolic pathways could not be revealed within 

this study, since only a few VOC could be assigned to specific compounds 

yet. The third parameter assessed in this study was the glutamine 

concentration. The PLS-R model for glutamine concentration showed the 

lowest R² and Q² of this evaluation. Glutamine was added on demand and 

probably feeding corrupted the correlation. To overcome this problem, the 

glutamine related physiological parameter specific glutamine uptake (qGln) 

was used. The descriptive as well as the predictive power was higher when 

the specific consumption instead of the glutamine concentration was used 

(0.91 and 0.82). An explanation for this result is that the consumption of 

glutamine might be correlated to other metabolic pathways which can 

produce VOCs. In combination with an accurate online VCD measurement, 

the qGln can be used to estimate the overall glutamine demand of the 

culture in real-time. A summary of all PLS-R models is given in Table 1. 

Conclusions: In our study we showed that the VOC profile obtained with 

the PTR-MS can be used to predict important cell culture parameters, but 

compared to other on-line techniques such as near infrared spectroscopy 

the PLS-R models are currently less robust (expressed by a lower R²). 

Moreover the most important VOCs in the PLS-R model could be used to 

get deeper insights into the cellular metabolism. At the moment however, 

this is limited by the lack of identified VOCs and the small literature basis 

reporting of pathways including volatile metabolites. Finally, further 

experiments will be necessary to assess the most influential factors on the 

VOC production and to fully exploit the potential of the PTR-MS. 

Table 1(abstract P14) Summary PLS-R models 

Compound R² Q² 

VCD 0.86 0.76 

Product titer 0.94 0.88 

Glutamine 0.83 0.62 

Specific glutamine uptake 0.91 0.82




Acknowledgements: We want to thank Rene Gutmann from Ionicon for 

the installation and support for the PTR-MS and Karl Bayer for the fruitful 

discussions. 

References 

1. Schettlinger K, Fried R, Gather U: Real-time signal processing by adaptive 

repeated median filters. Int J Adapt Control 2009, 24:346-362. 

2. Teixeira AP, Portugal CA, Carinhas N, Dias JM, Crespo JP, Alves PM, 

Carrondo MJ, Oliveira R: In situ 2D fluorometry and chemometric 

monitoring of mammalian cell cultures. Biotechnol Bioeng 2009, 

102:1098-1106. 

P15 

New peptide-based and animal-free coatings for animal cell culture in 

bioreactors 

Youlia Serikova 1* , Aurélie Joly 1 , Géraldine Nollevaux 1 , Martin Bousmanne 2 , 

Wafa Moussa 2 , Jonathan Goffinet 3 , Jean-Christophe Drugmand 3 , 

Laurent Jeannin 2 , Yves-Jacques Schneider 1 

1 Laboratory of Cellular, Nutritional and Toxicological Biochemistry, Institute of 

Life Sciences, UCLouvain, 1348 Louvain-la-Neuve, Belgium; 

2 Peptisyntha sa, 

1120 Brussels, Belgium; 

3 ATMI, 1120 Brussels, Belgium 

E-mail: youlia.serikova@uclouvain.be 


Background: Anchorage dependent cells require an appropriate 

extracellular matrix for their survival, migration, proliferation, phenotyping 

and/or differentiation [1-3]. These cells interact with extracellular matrix 

proteins, primarily through integrins, which induces focal adhesion 

contacts assembly and activation of signalling pathways thatregulate 

diverse cellular processes [4]. 

Culture supports usually include biochemical components allowing such 

cells to adhere and to reconstitute an extracellular environment close to 

that found in vivo. Currently, this artificial environment is achieved by 

extracellular matrix constituents deposition, adsorption or grafting; among 

them collagens, fibronectin, laminin, artificial lamina propria... [5]. However, 

such animal proteins used in cell culture may induce pro-inflammatory 

stress, be unstable against proteolysis or loose activity after adsorption 

[6,7]. Synthetic microenvironments should be more suitable for clinical 

purposes: (i) improved control of physicochemical and mechanical 

properties, (ii) limited risks of immunogenicity, (iii) increased biosafety 

(animal free) and (iv) facilitated scale-up [1]. 

In this framework, research has recently focused on synthetic peptides or 

peptidomimetics that can mimic the extracellular matrix. Such molecules 

can be immobilized as recognition motifs on the surface of culture 

supports with a greater stability and easier surfaces characterization [5]. 

Self-assembling peptide hydrogels could mimic the chemical and 

mechanical aspects of the natural extracellular matrix [8,9] by undergoing 

large deformations, as in mammalian tissues. They have an inherent 

biocompatibility and should be able to direct cell behaviour [10]. They also 

can be functionalized with various biologically active ligands constituting 

good candidates to a new range of smart biomaterials, able to ensure 

adhesion of different cell types [11-13]. 

The range of biomimetic peptides that direct cell adhesion and are 

recognized by integrins is large. Recognition sequences derived from 

different extracellular matrix proteins include RGD [1], which are specific to 

different cell lines [1,5,6]. 

In this context, this work aims at designing animal-free, chemically defined 

and industrially scalable coatings for animal cell culture, as an alternative 

to collagen, fibronectin or Matrigel® for laboratory and industrial large 

scale applications. These are based on self-assembling short peptides 

bearing adhesion bioactive sequences like RGD-derived or other adhesion 

sequences developed to coat polystyrene or polyethylene terephthalate 

surfaces. Adhesion sequences should be recognized by cells, which should 

favour their anchorage and spreading. 

Experimental: Bioactive self-assembling peptide sequences were 

synthesized in liquid phase, purified, analytically characterised and 

manufactured by Peptisyntha (Brussels, Be) in GMP conditions, as sterile 

coating solutions. They were used to coat polystyrene flasks (Corning Inc., 

NY) in comparison with animal-derived coatings i.e. collagen and fibronectin. 

Human Adipose Derived Stem Cells (hADSC) were purchased from Lonza 

(Verviers, Be); Caco-2, MRC-5 and CHO cells, obtained from ATCC. 

Cells were seeded at 8 000 cells/cm 2 and cultured until 7 days. After 60 h 

or 7 days of culture, cells were harvested and counted on Bürker cell in 

Trypan blue or fixed. Nuclei were then stained with DAPI and actin 

filaments with Rhodamin-Phalloidin. Fluorescence microscopy was used 

to observe cell morphology and NIS software allowed cell-spreading 

determination. 

Results and discussion: The absence of cytotoxicity was assayed with 

necrosis (LDH) and cell metabolic activity (MTT) tests on different cell 

lines (Caco-2, MRC-5, CHO, hADSC). No cytotoxicity was detected. 

Two variants of bioactive self-assembling peptides, both containing RGDderived 

sequences, were compared with animal-derived coatings (collagen 

and fibronectin) in serum-poor of free medium. Cytocompatibility and 

dose dependent response studies revealed that peptides promote cell 

adhesion and growth. 

As for hADSC culture, these cells were first incubated in a serum-free 

medium during 6 to 24 h and the proportion of adherent cells and their 

spreading was evaluated. hADSC cells needed more than 6 h to fully 

adhere to the culture surface and the adhesion effectiveness appeared 

better for collagen and the first variant of peptide than for the other 

substrate coatings. Initial spreading was more marked on fibronectin, but 

then increased from 6 to 24 hours on all coatings. 

A second experiment consisted in a first cell incubation in DMEM 

supplemented with 1% Fetal Bovine Serum (FBS) and, after 24 h, the 

medium was replaced by DMEM supplemented with 10% FBS. After 7 days, 

the best cell growth was observed for substrates coated with collagen and 

peptide 1, fibronectin and peptide 2 being slightly less efficient. In parallel, 

cell spreading decreased or remained constant upon cell proliferation 

(Figure 1). 

As for Caco-2 cells culture, these cells were incubated in a serum-free, 

hormono-defined medium (BDM) during 6 to 24 h and the proportion of 

adherent cells and their spreading were evaluated. These cells required a 

shorter duration than hADSC to adhere on the surface and the adhesion 

effectiveness appeared a little bit better for collagen and fibronectin. 

Initial spreading was more marked on collagen and its importance varies 

between 6 and 24 h on different coatings. 

The second experiment consisted in a first cell incubation in a serum-free 

medium and, after 24 h, the nutritive medium was replaced by a medium 

supplemented with 1% FBS. After 60 h, there was almost no difference 

between the different coatings. Nevertheless, after 7 days, cells cultured 

on peptides reached the same effectiveness as on fibronectin, but slightly 

lower than collagen. As for hADSC, cell spreading decreased upon cells 

proliferation. 

Conclusion: Designed self-assembling bioactive peptides are not cytotoxic 

and are cytocompatible. Cell adhesion and growth on peptide coatings 

appear as effective as on animal-derived coatings and the peptide 

coatings allow easy cell harvesting after culture. 

Globally, the results indicate that self-assembling bioactive peptides 

constitute chemically defined, entirely synthetic and effective promoters of 

cell adhesion, spreading and proliferation. 

Acknowledgements: This work is supported by Innoviris (Brussels 

Region) in the scope of a Doctiris PhD grant. 

References 

1. Petrie TA, Garcia AJ: Extracellular Matrix-derived Ligand for Selective 

Integrin Binding to Control Cell Function. Biol Interact Mater Surf 2009, 

1:133-156. 

2. Hynes RO: The Extracellular Matrix: Not Just Pretty Fibrils. Sci 2009, 

326:1216-1219. 

3. Rahmany MB, Van Dyke M: Biomimetic approaches to modulate cellular 

adhesion in biomaterials: A review. Acta Biomater 2013, 9:5431-5437. 

4. Badami AS, Kreke MR, Thompson MS, Riffle JS, Goldstein AS: Effect of fiber 

diameter on spreading, proliferation, and differentiation of osteoblastic 

cells on electrospun poly(lactic acid) substrates. Biomater 2006, 

27:596-606. 

5. Shin H, Jo S, Mikos AG: Biomimetic materials for tissue engineering. 

Biomater 2003, 24:4353-4364. 

6. Hersel U, Dahmen C, Kessler H: RGD modified polymers: biomaterials for 

stimulated cell adhesion and beyond. Biomater 2003, 24:4385-4415. 

7. Lin CC, Metters AT: Hydrogels in controlled release formulations: Network 

design and mathematical modeling. Adv Drug Deliv Rev 2006, 58:1379-1408. 

8. Wu EC, Zhang S, Hauser CAE: Self-Assembling Peptides as Cell-Interactive 

Scaffolds. Adv Funct Mater 2012, 22:456-468. 

9. Hamilton SK, Lu H, Temenoff JS: Micropatterned Hydrogels for Stem Cell 

Culture. Stud Mechanobiol Tissue Eng Biomater 2010, 2:119-152.




Figure 1(abstract P15) Fluorescence micrographies of hADSC cultivated for 7 days on polystyrene substrates. After incubation and cell fixation, 

nuclei were stained with DAPI and actin filaments with rhodamin-phalloidin. Pictures were taken at the centre of each flask. Upper left: collagen coating; 

upper right: fibronectin. Lower left: peptide 1; lower right: peptide 2. 

10. Jayawarna V, Ali M, Jowitt TA, Miller AF, Saiani A, Gough JE, Ulijn RV: 

Nanostructured Hydrogels for Three-Dimensional Cell Culture Through 

Self-Assembly of Fluorenylmethoxycarbonyl-Dipeptides. Adv Mater 2006, 

8:611-614. 

11. Bhat NV, Upadhyay DJ: Plasma-induced surface modification and 

adhesion enhancement of polypropylene surface. J Appl Polym Sci 2002, 

86:925-936. 

12. Varghese S, Elisseeff JH: Hydrogels for Musculoskeletal Tissue Engineering. 

Adv Polym Sci 2006, 203:95-144. 

13. Tessmar JK, Göpferich AM: Customized PEG-Derived Copolymers for 

Tissue-Engineering Applications. Macromol Biosci 2007, 7:23-39. 

P16 

An integrated synchronization approach for studying cell-cycle 

dependent processes of mammalian cells under physiological 

conditions 

Oscar B Platas 1 , Uwe Jandt 1 , Volker Sandig 2 , Ralf Pörtner 1 , An-Ping Zeng 1* 



2 ProBioGen AG, Berlin, D-13086, 

Germany 

E-mail: aze@tuhh.de 


Introduction: The study of central metabolism and the interactions of its 

dynamics with growth, product formation and cell division is a key issue 

for decoding the complex metabolic network of eukaryotic cells. For this 

purpose, not only the quantitative determination of key cellular molecules 

is necessary, but also the variation of their expression rates in time, e.g. 

during cell cycle. The enrichment of cells within a specific cell cycle phase, 

referred to as cell synchronization, and their further cultivation allow for 

the generation of a cell population with characteristics required for cell 

cycle related dynamic studies. Unfortunately, most of the synchronization 

methods used are not suitable for study under unperturbed physiological 

conditions. 

Physical selective methods appear to be a better choice. Among them, the 

method of countercurrent centrifugal elutriation allows for an efficient 

separation of different cell subpopulations from an asynchronous cell 

population according to the cell size. Within an elutriated cell subpopulation 

high similarity in the size and DNA content of the cells can be achieved. 

Given the reproducibility of this method, high cell numbers can be obtained 

for inoculation of controlled bench-top bioreactors with synchronous cells. 

By integration of this method for synchronous cell generation and a culture 

method for further unperturbed growth, sampling of synchronous cells can 

be performed over many synchronous population doublings. 

Materials and methods: Using the combined approach mentioned 

above, centrifugal elutriation was employed for synchronization in




different cell cycle phases of the industrial human cell line AGE1.HN® 

(ProBioGen AG, Berlin, Germany) and a CHO-K1 cell line (CeBiTec, Bielefeld, 

Germany). Cells were cultivated in bench-top bioreactors with culture 

volumes ranging between 200 mL and 1 L. A dialysis bioreactor 

(Bioengineering AG, Switzerland) with a total volume of 3.8 L was used for 

the cultivation of one cell line in order to allow for a higher number of 

synchronous cell divisions. In this bioreactor cells are separated from the 

conditioning chamber, where pH and DO control takes place. In this way 

cells can’t be damaged neither by increase in stirring rate nor by bubble 

sparging. Furthermore, continuous nutrient exchange takes place through 

the dialysis membrane. Cell density values of 4.2 × 10 7 cells mL -1 have 

been reached in this system with AGE1.HN® cells without noticeable 

change in the cell specific growth rate. 

Results: Our first results had already demonstrated the successful 

separation of a heterogeneous AGE1.HN® cell population into synchronous 

subpopulations [1]. Independently of the targeted cell cycle phase, the 

countercurrent centrifugal elutriation allowed for a reproducible and 

scalable cell synchronization of AGE1.HN and CHO-K1 cells with high 

synchrony degrees, up to 95% in G 1 , 53% in S and 75% in the G 2 /M phases. 

After assessing the reproducibility of elutriation results, the process was 

scaled up successfully for inoculation of a dialysis bioreactor, where 

synchronous unperturbed growth was observed at least for 4 cell 

divisions (Figure 1). A very clear damped oscillation of the cell cycle 

phases could be observed during synchronous growth (Figure 1b and 1c). 

Moreover, a sawtooth-like oscillation of the cell diameters confirmed the 

successful synchronous growth of the cells. Bioreactor culture showed no 

noticeable perturbation in the doubling time of the population. 

Conclusions: With these results, one of the most important requirements 

for population-based research of mammalian cells was fulfilled. The 

dynamic behaviour of the synchronous growing cells was systematically 

studied not only based on cell growth, but also on the distribution of the 

cell size and the DNA content of the cells. Furthermore, dialysis culture 

allowed for a higher number of synchronous cell divisions without 

noticeable perturbations. With this contribution, we present an integrated 

approach for cell synchronization and further unperturbed cultivation 

which is useful for studying cell-cycle dependent processes under 

physiological conditions. 

Acknowledgements: This work is a part of SysLogics (FKZ 0315275A): 

Systems biology of cell culture for biologics, a project founded by the 

German Ministry for Education and Research (BMBF). 

Reference 

1. Platas Barradas O, Jandt U, Hass R, Kasper C, Sandig V, Pörtner R, Zeng AP: 

Physical methods for synchronization of a human production cell line. 

22nd European Society for Animal Cell Technology (ESACT) Meeting on 

Cell Based Technologies, Vienna, Austria.5(Supplement 8), Online: 

http://www.biomedcentral.com/1753-6561/5/S8/P49. 

Figure 1(abstract P16) Synchronous growth of AGE1.HN cells in a dialysis bioreactor. The cultured cells were elutriated with high synchrony in the 

G 2 /M phase. (a): viable cell density and viability, (b): percentage values of the cell cycle phase distribution, (c): distribution of the S phase, exhibiting a 

damped oscillation.




P17 

Evaluation of process parameters in shake flasks for mammalian cell 

culture 

Oscar B Platas 1 , Volker Sandig 2 , Ralf Pörtner 1 , An-Ping Zeng 1* 



2 ProBioGen AG, Berlin, D-13086, 

Germany 

E-mail: aze@tuhh.de 


Introduction: Shake flask cultivation is nowadays a routine technique 

during process development for mammalian cell lines. During shaken 

culture, changes in agitation velocity, shaking diameter or shake flask size 

affect the hydrodynamics in the shake flask. This might be reflected in the 

growth of the cultured cells. 

Process parameters such as power input, mixing time, fluid velocity etc. 

have been determined and described mathematically for shake flasks 

used for microbial cultivation, but onlytosomeextendformammalian 

cell culture. Especially the relationship between these parameters and 

growth characteristics of mammalian cells is still a relatively uncovered 

issue. 

In this work, process parameters like specific power input, mixing time, 

maximum fluid velocity and Reynolds number were determined for four 

different shake flasks (baffled and unbaffled) in a range of shaking velocities 

on a shaking machine. The specific growth rate (μ max ) of the human 

industrial cell line AGE1.HN® (ProBioGen AG, Berlin, Germany) was compared 

to the respective process parameters. 

Determination of process parameters: (1) Power input (P/V) was 

calculated according to experimental data, that have been published in 

correlations with the form of Np = f(Re), where Np is the power number 

and Re the Reynolds number of the culture. The first correlation is 

based on the work by Büchs et al. [1,2], who used a modified Np 

analog to bioreactors, and fited the experimental Np’ data to Re. The 

second correlation used is based on the work of Kato et al. [3]. Here, 

the calculation of the Reynolds number considers the diameter of the 

shaker (d o ) instead of the inner flask diameter (d i ). 

(2) Mixing time (Θ 95 ) was determined by means of the decolourization 

method (I/KI titrated with Na 2 S 2 O 3 ). Decolourization time course was 

video recorded and visually analyzed. 

(3) Maximum fluid velocity (u i ) was calculated at the maximum 

flask’s inner diameter. 

(4) Reynolds number (Re) was calculated as Re = rNd 2 /h, with d = d i , 

and d=d o , for the methods published by Büchs et al., and Kato el al. 

respectively. 

A modified di (d i, mod ) was used for calculations of parameters in baffled 

flasks. This number considers the flask’s depth into the flask circumference. 

The average specific growth rate μ max wasemployedasindicatorfor 

growth performance. 

Relationship between cell growth and process transfer criteria: 

Figure 1 shows the dependency of the average specific growth rate μ max 

of AGE1.HN® cells on the process parameters of the cultures performed in 

shake flasks. A shaking velocity of 200-250 min -1 seems to be optimal for 

the cell growth rate. A maximal specific growth rate was observed in a 

close range of power input at 200-400 W m -3 according to the method of 

Büchs et al. and at 400-1000 W m -3 for the method of Kato et al. used for 

Re calculation. As has been shown for the culture of AGE1.HN® cells in 

bench-top bioreactors [4], a range of mixing time values between 8 and 

13 seconds can be identified here as common for all shake flasks too. The 

process operational windows identified in this work can lead to a 

significant reduction in the growth differences of mammalian cells in the 

context of standardization and reproducibility of shake flask cultures. 

Conclusions: Our results point to regions of the studied parameters, where 

common operation windows can be identified for μ max .Intheseprocess 

windows the cells show a similar μ max in different shake flask, making cell 

growth comparable. These process windows are common for the flasks, 

independently of their size and the number of baffles. 

The data obtained in this work can be used for process standardization and 

comparability of results obtained in shaken systems i.e. to guarantee 

consistency of results generated during laboratory studies with mammalian 

cells. 

Acknowledgements: This work is a part of SysLogics (FKZ 0315275A): 

Systems biology of cell culture for biologics, a project founded by the 

German Ministry for Education and Research (BMBF). 

References 

1. Büchs J, Maier U, Milbradt C, Zoels B: Power consumption in shaking flasks 

on rotary shaking machines: I. Power consumption measurement in 

unbaffled flasks at low liquid viscosity. Biotechnol Bioeng 2000, 68:589-593. 

2. Büchs J, Maier U, Milbradt C, Zoels B: Power consumption in shaking 

flasks on rotary shaking machines: II. Nondimensional description of 

specific power consumption and flow regimes in unbaffled flasks at 

elevated liquid viscosity. Biotechnol Bioeng 2000, 68:594-601. 

3. Kato Y, Hiraoka S, Tada Y, Shirai S, Koh ST, Yamaguchi T: Powerconsumption 

of horizontally shaking vessel with circulating motion. 

Kagaku Kogaku Ronbunshu 1995, 21:365-371. 

4. Platas O, Jandt U, Phan LDM, Villanueva ME, Schaletzky M, Rath A, Freund S, 

Reichl U, Skerhutt E, Scholz S, Noll T, Sandig V, Pörtner R, Zeng AP: 

Evaluation of criteria for bioreactor comparison and operation 

standardization for mammalian cell culture. Eng Life Sci 2012, 

12:518-528. 

P18 

Online glucose-lactate monitoring and control in cell culture and 

microbial fermentation bioprocesses 

Henry Weichert * , Mario Becker 

Sartorius Stedim Biotech GmbH, August-Spindler-Strasse 11, 37079 

Goettingen, Germany 

E-mail: henry.weichert@sartorius-stedim.com 


Introduction: Conventional biopharmaceutical manufacturing is 

characterized by validated process steps and extensive lab testing 

procedures. The FDA PAT-Guidance recommends the use of potential for 

improving development, manufacturing, and quality assurance through 

innovation in product and process development, process analysis and 

process control. 

Measurement of glucose, as a major nutrient during cell cultivation and 

microbial fermentation, has a key role for controlling the status of the 

cultivation process. Together with the amount of lactate and additional 

process parameters, like pH and DO, it gives the possibility to calculate 

specific consumption rates of nutrients. The user gets information about the 

status of the culture and of the cells. 

BioPAT®Trace: Online Glc/Lac Analyser: BioPAT®Trace (Figure 1) is a 

dual-channel analyser for the simultaneously measurement of glucose and 

lactate which is based on an enzymatic detection of the two analytics. 

Special attention has been paid to the ease of use and hygienic issues 

related to cGMP environments. The system follows the plug & plays 

principle, can be fully integrated into all facility environment scenarios and 

is compliant with all relevant regulatory guidelines. 

Wide measuring range: The linear measuring range of the BioPAT 

®Trace extends from 0.01 to 40 g/l glucose and from 0.05 to 5 g/l lactate. 

The deviation from the average measurement value is less than 3% for a 

measurement of 5 g/l glucose and 2.5 g/l lactate. 

Fast measurement frequency: The measurement frequency is up to 60 

analyses per hour depending on the conditions. The service life of the 

sensor system ensures 30 days or 5000 analyses depending on the 

application. The ambient temperature of the BioPAT ®Trace can lie 

between 5 and 35°C due to internal temperature correction. The ambient 

humidity should not exceed 90%. 

Flexible system integration: The BioPAT ®Trace has a number of outputs 

making integration into data recording systems very flexible. Along with a 

standard analog output for signal ranges from 0 to 20 mA, 0 to 10 V or 4 

to 20 mA, the BioPAT ®Trace also has a USB interface, an Ethernet 

connection as well as a serial output for data recording. 

Connection to different fermenter scales by filtration or dialysis 

probes: The on-line analysing system BioPAT®Trace covers the different 

demands of long-term cell culture cultivations and fast microbial processes 

in different scales such as small volume cultivations and FDA-validated large 

scale productions. The sterile sampling systems based on filtration, dialysis 

or ContiTRACE disposable probes provide the perfect solution for reliable 

on-line sampling in bioreactors and bio disposables applied in industrial and 

laboratory facilities.




Figure 1(abstract P17) Relationship between maximum specific growth rate μ max and the process parameters in shake flask culture. 

A) Shaking velocity, B) Power input calculated with the method by Büchs et al., C) Power input calculated by the method by Kato el al., D) Mixing time, 

E) Maximum fluid velocity, F) Reynolds number with d = d o . 

The simplest method is to directly measure a filtered sample of medium. 

However, because reactor medium is used, the range of applications is 

limited to processes for which there’s a sufficient reactor volume or which 

allow continuous-feed. Dialysis sampling is an option when processes are 

involved for which reactor volume does not allow enough sample material. 

This method only removes low molecular substances from the reactor 

medium, without reducing the volume of fluid. 

Automated control loop for glucose feed: Integrated in an automation 

platform enabled with a 2 point glucose controller, e.g. as part of an S88 

recipe module of the BioPAT®MFCS SCADA system, it is possible to realize 

a fully automated control loop for any kind of cultivation process. 

Conclusions: • Real Online system 

Fast & automated measurement 

SU tube sets and sensors 

• Direct culture control (24/7) 

Process knowhow 

Replace offline methods 

Real-time process monitoring 

Automated sampling 

• Setup of control loops and event based actions 

defined by using the S88 module 

• Different connections to automation systems possible 

• Automated feed control 

• Real-time Glucose and Lactate values 

P19 

Study of the improved Sf9 transient gene expression process 

Xiao Shen, David L Hacker, Lucia Baldi, Florian M Wurm * 

Laboratory of Cellular Biotechnology, Faculty of Life Sciences, Ecole 

Polytechnique Fédérale de Lausanne, CH-1015 Lausanne, Switzerland 

E-mail: florian.wurm@epfl.ch 

BMC Proceedings 2013, 7(Suppl 6):P19




Figure 1(abstract P18) BioPAT®Trace equipped with the single use 

Tube set. 

Introduction: Insect cells have been widely used for the production of 

recombinant proteins using recombinant baculovirus for gene delivery [1]. 

To simplify protein production in insect cells, we have previously described 

a method, based on transient gene expression (TGE) with cultures of 

suspension-adapted Sf9 cells using polyethylenimine (PEI) for DNA delivery 

[2]. Expression of GFP has been realized at high efficiency and a tumor 

necrosis factor receptor-Fc fusion protein (TNFR-Fc) was produced at a 

level of 40 mg/L. However, the efficiency of the insect cells TGE system has 

not been studied and further optimization may improve protein titers. 

Here, we studied the efficiency of PEI for plasmid delivery in Sf9 cells. 

Methods: Cell culture: Sf-9 cells were maintained in suspension in 

TubeSpin® bioreactor 600 at 28°C [3]. 

Sf-9 cells Transfection: Sf9 cells were transfected as described before [2] 

using 25 kDa polyethylenimine PEI (Polysciences, Warrington, PA) and an 

expression vector for GFP or TNFR-Fc. GFP-specific fluorescence was 

measured 48 h post-transfection using the GUAVA EasyCyteTM flow 

cytometer (Millipore, Billerica MA, USA). TNFR-Fc was measured by 

sandwich ELISA [4]. 

Estimation of plasmid copy number: Total DNA was isolated using 

DNeasy Blood & Tissue Kit (Qiagen AG, Hombrechtikon, Switzerland) 

according to the manufacturer’s protocol. PCR was executed using the 

Absolute qPCR SYBR Green ROX reaction mix (Axon Lab AG, Baden-Dättwil, 

Switzerland) with total cellular DNA as template. The PCR was performed 

using LightCycler® 480 real-time PCR system (Roche Applied Science, Basel, 

Switzerland). The plasmid copy number was estimated from the standard 

curve according to the threshold cycle (Ct) of each sample [4]. 

Cell cycle analysis: Cells at different times post-transfection were 

centrifuged and washed with PBS before fixation in 70% ethanol. Fixed cells 

were washed with PBS and then stained with Guava Cell Cycle Reagent and 

analyzed by the GUAVA EasyCyteTM flow cytometer. Cells treated with 

nocodazole(50ng/mL,16h)andmimosine(1mM,24h)wereusedas 

references for determining the positions of the G1 and G2/M phases [5]. 

Results: Plasmid delivery efficiency in Sf9 cells: To measure the time 

course of plasmid DNA delivery, cells were transfected with a GFP 

expression vector. At different times post-transfection, a complete medium 

exchange was performed. The percentage of GFP-positive cells was 

determined for all cultures including a control for which a medium 

exchange was not performed. All cultures exhibited similar levels of GFPpositive 

cells meaning that DNA uptake into cells occurred within 10 min of 

DNA addition (Figure 1A). 

To measure the amount of DNA uptake, Sf9 cells were transfected in two 

different ways with a TNFR-Fc expression vector and the amount of 

intracellular plasmid was measured by quantitative PCR. On the day of 

transfection more than 80% of the plasmid DNA was present within cells 

with the control transfection while 40% of the DNA was present within 

cells following a high-density transfection (Figure 1B). It has been reported 

that improved plasmid delivery can result in an increase in specific and 

volumetric productivity for HEK 293 cells transfected at high-density [6]. 

However, in our high-density protocol, plasmid delivery was diminished in 

comparison to the control (Figure 1B). 

Plasmid delivery was not improved, but cell growth was inhibited in 

an optimized TGE process: Improvement in TGE yields from Chinese 

hamster ovary cells was achieved by reducing the cell growth rate [5,7]. 

When the cell growth curve of the optimal TGE process with Sf9 cells was 

compared with that of the control protocol, we observed a significant 

decrease of viable cell number, within 24 h post-transfection (Figure 1C). 

This suggested a deregulation in the cell cycle in the initial phase of 

transfection. The cell cycle distribution was analyzed and an increase of the 

percentage of cells in the G2/M phase was observed for the high-density 

protocol early after transfection (Figure 1D). However, the growth inhibition 

was attenuated by 24 h post-transfection (Figure 1D). Nevertheless, the 

temporary cell growth inhibition contributed to yield improvement in our 

optimal protocol. 

Conclusion: A previously described method for the transient transfection 

of Sf9 cells was improved. The increase in recombinant protein yield was 

not due to an increased plasmid delivery after transfection. However, 

high-density transfection resulted in a significant percentage of cells 

being blocked in the G2/M phase of the cell cycle for the first 24 h posttransfection. 

References 

1. Kost TA, Condreay JP, Jarvis DL: Baculovirus as versatile vectors for 

protein expression in insect and mammalian cells. Nat Biotechnol 2005, 

23:567-575. 

2. Shen X, Michel PO, Xie Q, Baldi L, Wurm FM: Transient transfection of 

insect Sf-9 cells in TubeSpin® bioreactor 50 tubes. BMC Proc 2011, Suppl 

8: P37. 

3. Xie Q, Michel PO, Baldi L, Hacker DL, Zhang X, Wurm FM: TubeSpin 

bioreactor 50 for the high-density cultivation of Sf-9 insect cells in 

suspension. Biotechnol Lett 2011, 33:897-902. 

4. Matasci M, Baldi L, Hacker DL, Wurm FM: The PiggyBac transposon 

enhances the frequency of CHO stable cell line generation and yields 

recombinant lines with superior productivity and stability. Biotechnol 

Bioeng 2011, 108:2141-2150. 

5. Wulhfard S, Tissot S, Bouchet S, Cevey J, De Jesus M, Hacker DL, Wurm FM: 

Mild hypothermia improves transient gene expression yields several fold 

in Chinese hamster ovary cells. Biotechnol prog 2008, 24:458-465. 

6. Backliwal G, Hildinger M, Hasija V, Wurm FM: High-density transfection 

with HEK-293 cells allows doubling of transient titers and removes need 

for a priori DNA complex formation with PEI. Biotechnol Bioeng 2008, 

99:721-727. 

7. Gorman CM, Howard BH, Reeves R: Expression of recombinant plasmids 

in mammalian cells is enhanced by sodium butyrate. Nucleic acids res 

1983, 11:7631-7648. 

P20 

Development of a Drosophila S2 insect-cell based placental malaria 

vaccine production process 

Wian A de Jongh 1 , Mafalda dos SM Resende 2 , Carsten Leisted 1 , 

Anette Strøbæk 1 , Besim Berisha 2 , Morten A Nielsen 2 , Ali Salanti 2 , 

Kathryn Hjerrild 3 , Simon Draper 3 , Charlotte Dyring 1* 

1 ExpreS 2 ion Biotechnologies, Horsholm, Denmark, 2970; 

2 Centre for Medical 

Parasitology, Copenhagen University, Copenhagen, Denmark, 1356; 

3 The 

Jenner Institute, University of Oxford, Oxford, UK, OX3 7DQ 


Background: Malaria during pregnancy is the cause of 1500 neonatal 

deaths a day. Moreover, 40% of all low weight births are caused by 

pregnancy associated malaria. Researchers at Copenhagen University have 

identified the VAR2CSA protein as a potential protective recombinant 

placental malaria vaccine. ExpreS 2 ion Biotechnologies is responsible 

establishment of cell lines expressing VAR2CSA variants and for developing 

the protein production process based on VAR2CSA. 

The ExpreS 2 System is a one-for-all protein expression system based on 

Drosophila S2 cells that is excellent in all phases of Drug Discovery, R&D and 

manufacturing due to high-level transient transfections, easy establishment 

of stable polyclonal pools that provides continuous high protein expression 

levels without selection pressure, and simple cloning procedure. It is a novel, 

non-viral, insect-cell based expression technology applied to the 

development of a critically needed vaccine. The VAR2CSA protein, which the 

vaccine is based on, is hard to express and comparison studies between




Figure 1(abstract P19) Study of the Sf9 TGE process. (A) Sf9 cells were transfected with EGFP-coding plasmid DNA and PEI at a starting cell density of 

4×10 6 cells per ml. Media of the transfected culture were exchanged at 10, 30, 60, 90, 120, 180 minutes post-transfection. EGFP-positive cells were 

measured on day 2. (B) Average intracellular plasmid copy number on day of transfection and day 3 post-transfection of cultures transfected using control 

protocol and high-density TGE protocol were analyzed by quantitative PCR. (C) Cell growth of Sf9 cells transfected using the two different protocols were 

compared. Cell cycle distribution during the first 24 hours post-transfection of those two TGE culture were analyzed (D). C: control transfection at 

4×10 6 cells/mL; H: high-density Sf9 transfection; h: hours. 

insect, bacteria and yeast have shown that an insect cell system is the only 

one leading to a clinically useful immune response. Process optimization is 

also critically important, as the cost of manufacture must be as low as 

possible to allow the vaccine to be used in the countries where it is most 

needed. 

Aim: The choice and cost of a manufacturing platform is one of the most 

important strategic decisions in recombinant subunit vaccine development. 

Furthermore, the geographic distribution of malaria and the philanthropic 

funding sources involved requires production to be as cost-effective as 

possible. Single-use provides manufacturing flexibility and economic 

advantages, both highly desirable in this type of process. We therefore aim 

to develop cost-effective Drosophila S2basedPlacentalandBlood-stage 

malaria vaccine production processes combining the ExpreS 2 constitutive 

insect cell expression system with single-use bioreactor technology. 

Materials and methods: Thirty-four truncation variants of the VAR2CSA 

placental malaria vaccine antigen and full-length PfRh5 were cloned into 

pExpreS 2 vectors and transfected into Drosophila S2 insect cells. Stable cell 

lines were established in three weeks in T-flask culture, which were then 

inoculated at 8E6 cells/ml in shake flasks, or batch or fed-batch production 

in DasGip Bioreactors and harvested after 3 and 7 days respectively. The 

cultures were harvested by centrifugation and filtration, where after the 

proteins were purified using Ni ++ affinity columns and gel filtration. 

Bioreactor optimisation were performed in 1L DasGip mini-bioreactors, 2L 

Braun glass bioreactor, and the single-use CellReady3L bioreactor. 

Alternating Tangential Flow (ATF) technology from Refine was also 

employed for perfusion production tests. The bioreactor conditions were 

25°C, pH6.5, Dissolved Oxygen 20%, 110 rpm stirrer speed using a Marine 

impeller. The perfusion rate was set to 0.5 to 3 Reactor Volumes (RV) per




Table 1(abstract P21) Key compounds supplemented at 

0.01% (w/v) to CD media 

Key compound Specific IgG production (%)* 

Ferulic acid 154 

Syringic acid 194 

Galactarate 153 

Adenine 185 

Trigonelline 141 

SE50MAF-UF 204 

CD media 100 

All values are set relative to CD media (100%). 

Figure 1(abstract P20) Expression yields obtained for Rh5 in batch, 

fed-batch and ATF-perfusion modes. Using perfusion could 

significantly increase yields. 

day, but was increased significantly faster for the CellReady 3L perfusion 

run compared to the Braun runs, with 3 RV per day reached by day 6 vs. 

day 9 for the Braun runs. 

Results: Thirty-four protein variants of VAR2CSA were screened for 

expression level. Further process optimization was performed on the lead 

candidate in glass bioreactors, and >30% yield increase was achieved 

using a fed-batch approach (results not shown). The expression of Rh5 was 

compared in batch, fed-batch and perfusion using both CellReady3L and 

glass bioreactors. There was no significant difference between growth in 

the DasGip bioreactor and the disposable CellReady bioreactor. 

Comparable yields were obtained in both systems whether running in batch, 

fed-batch, or perfusion mode (e.g. Perfusion day 6: 190 vs. 210 mg/L, results 

not shown). Furthermore, 350E6 cells/ml were achieved in concentrated 

perfusion mode using the ATF and CellReady3L. Concentrated perfusion 

lead to final Rh5 yields of 210 mg/L and 500 mg/L after 6 or 9 days 

production runs (see Figure 1). 

Conclusions: The ExpreS 2 platform has demonstrated its robustness of 

expression ability, by expression of two complex malaria antigens; and in 

breadth of hardware adaptability, as it was shown to perform comparably 

in the single use CellReady3L and glass bioreactors. Furthermore, 

extremely high cell counts and yields of Rh5 were achieved in Fed-batch 

and perfusion modes. The results demonstrate how the ExpreS 2 expression 

system in conjunction with single-use technology can be used to produce 

cost-effective malaria vaccines. 

P21 

Understanding the complexity of hydrolysates 

Abhishek J Gupta 1,2 , Kathleen Harrison 2 , Dominick Maes 3* 

1 Laboratory of Food Chemistry, Wageningen University, Wageningen, The 

Netherlands; 

2 FrieslandCampina Domo, Delhi, NY 13753, USA; 

3 FrieslandCampina Domo, Wageningen, The Netherlands 

E-mail: dominick.maes@frieslandcampina.com 


Background: Hydrolysates are complex media supplements composed of 

many as well as different types of compounds. Within Frieslandcampina 

Domo’s Quality by Design project, detailed information of these compounds 

(annotation and quantification) has been generated. This was achieved for 

soy protein hydrolysates (Proyield Soy SE50MAF-UF) using metabolomics 

biochemical profiling. Biochemical profiling, together with peptide 

profiling and analysis of the inorganic compounds, resulted in complete 

characterization of this hydrolysate product. Additionally, these lots of 

Proyield Soy SE50MAF-UF were tested for cell culture performance. 

Results and Discussion: The composition data was natural log transformed 

and functionality data was corrected for experiment-to-experiment 

variation. Consequently, the dataset was analyzed using statistical tools like 

two-mode cluster analysis, bootstrapped stepwise regression and 2D 

correlation analysis. These statistical tools were composed in-house using 

Matlab® R 2009b version 7.9.0.529. 

This resulted in identification of a series of key compounds in the 

hydrolysates that correlated with cell growth or IgG production in a CHO cell 

line. To validate these findings, pure preparations of these key compounds 

were supplemented to the chemically defined medium. Addition of these 

individual key compounds to chemically defined medium, in some cases, 

slightly improved cell growth or IgG production, but the effect was still 

much smaller than the enhancing effect of the complete hydrolysate. The 

specific IgG production of key compounds supplemented to CD media, CD 

media alone, and soy protein hydrolysate supplemented to CD media is 

shown in Table 1. 

This suggests that the effect of a hydrolysate cannot by mimicked by 

adding certain key compounds. Alternatively, this suggests that these key 

compounds are biomarkers, which are interconnected with several other 

compounds, and that presence of all of these compounds is relevant/ 

important for the enhancement in the functionality. 

The 2D correlation analysis reveals this complex network of compounds, 

in which these compounds are positively or negatively correlated with 

each other and with cell growth or IgG production (Figure 1). 

In hydrolysates, these compounds interact with several other compounds in 

a complex biochemical network. This network of compounds is a unique 

and native feature of hydrolysates and non-existent in chemically defined 

media. 

Working in close collaboration with our customers, we gain understanding 

about the relation between the complex composition of hydrolysates and 

their effect on cell growth and titer in the application. 

P22 

Developing a production process for influenza VLPs: a comparison 

between HEK 293SF and Sf9 production platforms 

Christine M Thompson 1,2 , Emma Petiot 1 , Marc G Aucoin 3 , Olivier Henry 2 , 

Amine A Kamen 1,2* 

1 Human Health Therapeutics, Vaccine Program, NRC, Montréal, Québec, H4P 

2R2, Canada; 

2 Department of Chemical Engineering, École Polytechnique de 

Montréal, Montréal, Québec, H3C 3A7, Canada; 

3 Department of Chemical 

Engineering, University of Waterloo, Waterloo, Ontario, N2L 3G1, Canada 

E-mail: amine.kamen@cnrc-nrc.gc.ca 


Background: Influenza virus-like particle (VLP) vaccines are one of the most 

promising approaches to respond to the constant threat of the emergence 

of pandemic strains, as they possess the potentialforhigherproduction 

capabilities compared to traditional vaccines made in egg-based technology. 

VLPs are particles produced in cell culture utilizing recombinant protein 

technology composed of viral antigens that are able to elicit an immune 

response but lack viral genetic material. Thus far, influenza VLPs have been 

produced in mammalian, insect and plant based platforms [1], with 

production in insect cells being the most explored. Baculovirus with 

mammalian promoters (Bacmam) have been shown to efficiently transduce 

mammalian cells and further express genes but are unable to replicate, 

efficiently repressing baculovirus (BV) production that leads to contamination 

downstream [2]. Influenza VLP production was performed in HEK 293SF cells 

using the Bacmam gene delivery system. The proposed system was assessed




Figure 1(abstract P21) 2D correlation map of compounds present in ProYield SE50MAF-UF that significantly influences IgG production by CHO 

cells. These key compounds are interconnected to other compounds of the hydrolysate, forming a complex biochemical network. 

for its ability to produce influenza VLPs composed of Hemagglutinin (HA), 

Neuraminidase (NA) and Matrix Protein (M1) and compared to VLPs 

produced in Sf9 cells through the lens of bioprocessing. 

Materials and methods: VLPs from both systems were characterized using 

currently available influenza quantification techniques such as Single Radial 

Immunodiffusion (SRID) assay, Hemagglutination (HA) assay, Negative 

Staining Electron Microscopy (NSEM) and western blot. 

Results: It was found that VLPs from the HEK 293SF system were present 

in the culture supernatant in a heterogeneous mixture in terms of particle 

shape and size. Particles were spherical and also pleomorphic in shape and 

ranged from sizes of 100-400 nm. Sucrose cushion concentrated samples 

contained broken particles and a lot of debris. Additionally, it was found 

that VLPs were associated with the cell pellet after harvest in relatively the 

same amount as released into the supernatant in the form of unreleased 

VLPs from NSEM and HA assay analysis. This is possibly due to the sticky 

nature of the HA protein or from cell clumping during production that 

worked to trap the VLPs, preventing release into the supernatant. Sf9 cells 

produced more uniformly shaped VLPs that were spherical in shape, 

around 100 nm in size and were found to be mainly in the supernatant, 

not associated with the cell pellet. Sucrose cushion concentrated VLPs 

contained noticeably less debris than VLPs produced from HEK 293SF cells. 

It was found that VLP production in Sf9 cells produced 1.5 logs more VLPs 

than in HEK 293SF cells and had 30× higher HA activity. However, Sf9 

VLP samples contained 20× more baculovirus than VLPs, which can 

contribute to HA activity in both the HA and SRID assays which has to be 

acknowledged during process development stages. This is the first time to 

our knowledge that specific production values for influenza VLPs in terms 

of total particles/ml have been reported. 

Conclusions: From this study, the insect-cell baculovirus system produced a 

more homogeneous population of VLPs compared to its counterpart in HEK 

293SF cells. However, this study also highlights the major problem of 

baculovirus contamination in the Sf9 system, which requires removal for 

final vaccine formulations and to help ease the optimization of process 

production conditions. 

Acknowledgements: The authors would like to thank Dr. Ted M Ross of 

the University of Pittsburgh for kindly donating the Bacmam construct and 

NSERC for providing the Discovery Grant that supported this study. In 

addition, we’d like to thank Johnny Montes for his help with viral stock 

productions and the rest of the ACT group and graduate students at NRC in 

Montréal for their daily support. 

References 

1. Kang SM, Song JM, Quan FS, Compans RW: Influenza vaccines based on 

virus-like particles. Virus research 2009, 143:140-146. 

2. Tang XC, Lu HR, Ross TM: Baculovirus-produced influenza virus-like 

particles in mammalian cells protect mice from lethal influenza 

challenge. Viral immunology 2011, 24:311-319. 

P23 

Dynamic cyclin profiles as a tool to segregate the cell cycle 

David Garcia Munzer 1 , Margaritis Kostoglou 2 , Michalis C Georgiadis 3 , 

Efstratios N Pistikopoulos 1 , Athanasios Mantalaris 1* 

1 Biological Systems Engineering Laboratory, Centre for Process Systems 

Engineering, Department of Chemical Engineering, Imperial College London, 

London, SW7 2AZ, UK; 

2 Department of Chemistry, Aristotle University of 

Thessaloniki, Thessaloniki, 54124 Greece; 

3 Department of Chemical 

Engineering, Aristotle University of Thessaloniki, Thessaloniki, 54124 Greece 

E-mail: amantalaris@imperial.ac.uk 


Background and novelty: Mammalian cells growth, productivity and cell 

death are highly regulated and coordinated processes. The cell cycle is at 

the centre of cellular control and should play a key role in determining 

optimization strategies towards improving productivity [1]. Specifically, cell 

productivity is cell cycle, cell-line and promoter dependant [2]. The cyclins 

are key regulators that activate their partner cyclin-dependent kinases 

(CDKs) and target specific proteins driving the cell cycle. To our knowledge, 

there is no information on cyclin phase-dependent expression profiles of




industrial relevant mammalian cell lines. We use the cyclin profiles as a tool 

to identify and quantify the landmarks of the cell cycle and implement a 

modelling approach to describe the bioprocess. Hereby, we introduce two 

possible experimental approaches to obtain such dynamic cyclin profiles. 

Experimental approach: Cyclin expression (cyclin E - G 1 class and cyclin B 

-G 2 class) was studied in GS-NS0 batch cultures by flow cytometry. Two set 

of experiments were performed: a) culture of cells under perturbed (cell 

arrest) and unperturbed growth (control run) and b) culture of cells for 

DNA labelling to perform a proliferation assay as well as a non-exposed 

cells (control run). The static profiles were obtained by direct cyclin 

staining and the dynamic profiles were reconstructed by either a) tracking 

a partially synchronized population or b) combining the timings from 

proliferation assays with the static profiles. 

Result discussion: Both cyclins showed a clear cell cycle phase-specific 

pattern (cyclin E was 10% higher at G 1 and cyclin B was 40% higher at G 2 ). 

These results were consistent among all the different culture conditions 

and were inferred from the static cyclin profiles. After the arrest release the 

dynamic cyclin profiles can be directly reconstructed by plotting the 

relevant cyclin content from the partially synchronized moving population 

traversing the cycle. An advantage of this approach is a clear view of the 

cyclin accumulation and transition threshold levels. However, this 

approach requires testing using different arrest agents, exposure levels 

and timings, which could have an effect on the cell behaviour. 

A second approach included an indirect dynamic cyclin profile 

reconstruction by combining the acquired proliferation times for different 

cell cycle phases (e.g. G 1 /G 0 ,G 2 /M) with the static cyclin profiles. If the static 

cyclin profiles are considered as the most representative cyclin values (and 

near to the transition threshold level), it is possible to reconstruct the 

dynamic profile by linking the threshold values with the cycling times (from 

the proliferation assay). The advantage of such approach is the ability to 

formulate different dynamic cyclin profiles such as constant functions, piecewise 

linear functions or more elaborated profiles. However, implementation 

of such an approach requires the tuning of the proliferation assay and the 

frequency of sampling since it will affect the quality of the assay. 

The two approaches showed comparable results both for the static cyclin 

profiles (also when compared to the control runs) and the dynamic cyclin 

profiles. 

Conclusions: The different approaches for deriving the dynamic 

cyclin profiles provide a versatile experimental toolbox for cell cycle 

characterization. Cyclins can be used as cell cycle distributed variables and be 

experimentally validated (quantitatively), avoiding the use of weakly 

supported variables (e.g. age or volume). The observed patterns and timings 

provide a blueprint of the cell line’s cell cycle, which can be used for cell cycle 

modelling. The development of these models will aid the systematic study of 

the cell culture system, the improvement of productivity and product quality. 

Acknowledgements: The authors are thankful for the financial support from 

the MULTIMOD Training Network, European Commission, FP7/2007-2013, 

under the grant agreement No 238013 and to Lonza for generously 

supplying the GS-NS0 cell line. 

References 

1. Dutton RL, Scharer JM, Moo-Young M: Descriptive parameter evaluation 

in mammalian cell culture. Cytotechnol 1998, 26:139-152. 

2. Alrubeai M, Emery AN: Mechanisms and Kinetics of Monoclonal-Antibody 

Synthesis and Secretion in Synchronous and Asynchronous Hybridoma 

Cell-Cultures. J Biotechnol 1990, 16:67-86. 

P24 

Development and implementation of a global Roche cell culture 

platform for production of monoclonal antibodies 

Thomas Tröbs 1* , Sven Markert 1 , Ulrike Caudill 1 , Oliver Popp 2 , Martin Gawlitzek 3 

, Masaru Shiratori 3 , Chris Caffalette 3 , Robert Shawley 3 , Steve Meier 3 , 

Abby Pynn 3 , Wendy Hsu 3 , Andy Lin 3 

1 Pharmaceutical Biotech Production & Development PTDE, Roche, 82377 

Penzberg, Germany; 

2 Pharma Research and Early Development pRED, Roche, 

82377 Penzberg, Germany; 

3 Early and Late Stage Cell Culture PTDU, 

Genentech, South San Francisco, CA 94061, USA 

E-mail: thomas.troebs@roche.com 


Introduction: Roche and Genentech both developed their first platform 

cell culture process using chemically-defined media independently. 

This resulted in significantly different processes with regards to operations 

and media formulations. The decision was made to evaluate both and 

decide for one existing platform. Drivers and benefits of a single upstream 

cell culture platform were the maximization of flexibility with regard to 

process development, clinical and commercial manufacturing by execution 

of any process at any network facility with standard transfer effort and by 

minimization of component lists and raw material inventories across sites. 

Furthermore capturing benefits of improvements made by all sites funneled 

into a common knowledge base benefits the whole organization. And 

process characterization and validation data could be leveraged across the 

entire organization what means less resource expenditure for PC/PV. 

The existing independent platforms were evaluated if there is a clear benefit 

in going forward with a given platform or certain aspects of a platform. The 

comparison consisted in a technical (cell culture performance, product 

quality, manufacturability) and a business case evaluation (product titer, 

timelines to launch, costs, IP. In result both platforms are capable of 

achieving sufficient titers for platform process (2-4 g/L) with acceptable 

product quality. There existed no major business driver to select one process 

over the other. 

Development: For development of new basal and feed media knowledge 

from two legacy efforts was leveraged and so potential synergies and 

performance benefits could be achieved (Figure 1). Based on platform 

Figure 1(abstract P24) Schematic diagram of major elements of the two legacy platforms and the optimization of medium and feed respective 

the leveraging of knowledge from two existing legacy platforms.




evaluation results, decision was made to harmonize existent CHO host cell 

line, seed train medium and feeding strategy (chosen from the two 

existing platforms). 

Results: The cell culture media and feed optimization strategy started with 

a paper exercise to compare existing in-house chemically defined media 

formulations and identify components/component groups for further 

evaluation. Subsequently identified conditions were screened in highthroughput 

cell culture systems (HTS-CC) to identify beneficial components 

and remove components that are not required. Optimized best cases were 

confirmed in 2L bioreactors with 6 model cell lines and the final process 

was up-scaled to pilot scale. 

Promising results from HTS-CC media screening were confirmed in a 

2L-bioreactor experiment. The new platform medium and feed were 

finalized after a series of 2L optimization experiments. The process was 

successful up-scaled to 250L single-use bioreactor (SUB) and 400L stainless 

steel bioreactor with two model cell lines. Growth and titer were 

comparable to 2L satellites. 

In the course of the platform implementation four new GMP raw materials 

(dry powders and stock solution) were developed and tested. Raw material 

shelf life stability retesting and extension were initiated. Global specifications 

were established for equipment and site independent platform application 

and the applicability for global production units is given. 

High temperature/short time treatment (HTST) compatibility was tested. 

The sterile hold for liquid media was initiated. 

Summary: New chemically defined platform media (basal and feed) were 

developed by leveraging data and knowledge from the two Genentech 

and Roche legacy platform processes, and through a series of experiments 

including high-throughput systems for cell culture, shake flasks, 

2L bioreactors and pilot-scale bioreactors. An average increase in final titer 

of 30% was achieved compared to the two legacy platforms. 

The final process resulted in product quality attributes (glycans, charge 

variants, size) that were comparable to historical data. No new variants 

were detected. The final and fully harmonized platform process is specified 

and implemented. 

Acknowledgements: Thomas Tröbs on behalf of Technical Team for 

Global Cell Culture Platform development and Christine Jung, Josef 

Gabelsberger, Uli Kohnert, Josef Burg, Ralf Schumacher, Robert Kiss, John 

Joly, Brian Kelley, Alexander Jockwer, Nicola Beaucamp, Christian Walser, 

Carolin Lucia, Peter Harms, Pilot Plant Operations, Analytical Operations. 

P25 

Powerful expression in Chinese Hamster Ovary cells using bacterial 

artificial chromosomes: Parameters influencing productivity 

Wolfgang Sommeregger 1 , Andreas Gili 2 , Thomas Sterovsky 2 , Emilio Casanova 3 , 

Renate Kunert 1* 

1 Vienna Institute of BioTechnology (VIBT), Department of Biotechnology, 

University of Natural Resources and Life Sciences, Vienna, 1190, Austria; 

2 Polymun Scientific Immunbiologische Forschung GmbH, Klosterneuburg, 3400, 

Austria; 3 Ludwig Boltzmann Institute for Cancer Research (LBI-CR), Vienna, 1090, 

Austria 

E-mail: renate.kunert@boku.ac.at 


Background: CHO (Chinese Hamster Ovary) cells are the cell line of choice 

for therapeutic protein production. Although the achieved volumetric titers 

have increased significantly over the past two decades, the establishment of 

well-producing CHO cell lines is still difficult and not always successful [1]. 

Factors influencing productivity are the chosen host cell line, the genetic 

vectors, applied media, the cultivation strategy as well as the product itself. 

Several CHO host strains are available for recombinant protein production, 

however, they are often quite diverse in terms of growth rate, maximal 

achieved cell concentrations and specific productivities. Specific productivity 

is also related to the locus of integration of the transgenes due to positional 

effects caused by the chromatin environment. Previously it was described 

that Bacterial Artificial Chromosomes (BACs) carrying the Rosa26 locus are 

advantageous for the recombinant protein production in CHO cells, 

enhancing the specific productivity compared to plasmid derived 

recombinant CHO cells [2-4]. In this project we aim to identify factors 

influencing volumetric productivity using different CHO hosts, Rosa 26 BACs 

as genetic constructs and suitable cell culture media. First, different 

commonly used CHO host cell lines were analyzed in various cell culture 

media to identify which host strain performs best. Secondly, we generated a 

recombinant cell line, producing the highly glycosylated HIV envelope 

protein gp140 as an example for a difficult to express model protein. Gp140 

expression was compared to an already existing gp140 cell line generated 

by a plasmid vector as expression system. 

Methods: Cell culture: CHO-DUKX-B11 (ATCC-CRL-9096) and CHO-DG44 

(life technologies) were serum-free cultivated in spinner flasks. CHO-K1 

(ATCC-CCL-61) and CHO-S (life technologies) were serum-free cultivated 

in in shaker flasks. 

BAC Recombineering: E.coli carryingtheRosa26BAC(~220kbp)were 

transformed with a plasmid coding for a recombinase. Consecutively, a 

plasmid carrying the gp140 (CN54) gene flanked by homologous regions 

to the BAC was used for the transformation of the recombinase positive 

E.coli cells. BAC positive colonies were selected and the BAC DNA was 

purified (NucleoBond Xtra BAC, Macherey Nagel). 

Transfection and selection: CHO-S host cells were transfected with linearized, 

lipid complexed (Lipofectin) CN54 Rosa26 BAC DNA. Recombinant clone 

selection was performed in 96-well plates using 0.5 mg/mL G418. BAC 

transfected CHO cells are able to express the transgene as well as a 

Neomycin resistance gene within the Rosa26 locus. 

Results: Host cell line comparison: CHO-DUKX-B11, CHO-DG44, CHO-K1 

and CHO-S were analyzed in batch culture in CD-CHO (life technologies), 

ActiCHO (GE-PAA), DMEM/Ham’s F12 (Biochrom) + supplements (Polymun 

Scientific), and CD-DG44 (life technologies) media in spinner and shaker 

flasks. CHO-DUKX-B11 and CHO-DG44 grew best in spinner flasks with 

CD-DG44 media, whereas CHO-K1 and CHO-S grew best in shaker flasks 

with ActiCHO media. The dhfr negative cell lines were growing to much 

lower viable cell densities than K1 and S. CHO-S reached the highest viable 

cell density (1.17 × 10 7 cells/mL) followed by CHO-K1 (8.39 × 10 6 cells/mL) 

(Table 1). 

Gp140 (CN54) recombinant cell lines: CHO-S was chosen for testtransfections 

and recombinant gp140 (CN54) producers were established 

using a Rosa 26 BAC construct carrying the gp140 (CN54) gene. The best 

clone was analyzed in a batch experiment and yielded 77 μg/mL which is 

~10 times the titer achieved with a recombinant plasmid derived CHO- 

DUKX-B11 (Figure 1). This 10-fold increase was related to the higher 

specific productivity (~18-fold) and the higher accumulated cell density 

(3.5-fold) in shorter batch duration. 

Conclusion: CHO-S and CHO-K1 have the potential to grow to high cell 

densities. The used dhfr deficient hosts (DUKX-B11 and DG44) are at least 

without a co-transfection of the dhfr gene not growing to high cell concentrations. 

Rosa 26 BAC derived clones need no amplification as they provide 

their own open chromatin region. Thus, higher specific productivity can be 

achieved by elevated transcript levels compared to conventional plasmid 

clones. The combination of cells growing to high cell densities and the 

transcriptional efficiency of the Rosa26 BAC system leads to accumulation of 

significantly increased volumetric titers for a difficult to express glyco-protein. 

Acknowledgements: This study was partly financed by Polymun Scientific 

Immunbiologische Forschung GmbH, Klosterneuburg, 3400, Austria; BioToP 

PhD Programme, University of Natural Resources and Life Sciences, Vienna, 

1190, Austria and the FWF Austrian Science Fund. 

References 

1. Kim JY, Kim YG, Lee GM: CHO cells in biotechnology for production of 

recombinant proteins current state and further potential. Appl Microbiol 

Biotechnol 2012, 93:917-930. 

2. Mader A, Prewein B, Zboray K, Casanova E, Kunert R: Exploration of BAC 

versus plasmid expression vectors in recombinant CHO cells. Appl 

Microbiol Biotechnol 2013, 97:4049-4054. 

3. Blaas L, Musteanu M, Grabner B, Eferl R, Bauer A, Casanova E: The use of 

bacterial artificial chromosomes for recombinant protein production in 

mammalian cell lines. Methods Mol Biol 2012, 824:581-593. 

4. Blaas L, Musteanu M, Eferl R, Bauer A, Casanova E: Bacterial artificial 

chromosomes improve recombinant protein production in mammalian 

cells. BMC Biotechnol 2009, 9:3. 

Table 1 Maximum achieved viable cell densities in batch 

experiments 

CHO cell line DUKX-B11 DG44 CHO-S CHO-K1 

Max. VCD (cells/mL) 2.00E+06 2.28E+06 1.17E+07 8.39E+06




Figure 1(abstract P25) Titer and specific productivity comparison of a BAC derived recombinant CHO-S cell line producing gp140 (CN54) and 

an already existing recombinant plasmid derived CHO-DUKX-B11 cell line. 

P26 

INVect - a novel polycationic reagent for transient transfection of 

mammalian cells 

Sebastian Püngel 1 , Miklos Veiczi 2 , Tim Welsink 1 , Daniel Faust 1 , Vanessa Vater 1 , 

Derek Levison 2 , Uwe Möller 2 , Wolfgang Weglöhner 1* 

1 InVivo BioTech Services GmbH, 16761 Hennigsdorf, Germany; 

2 emp Biotech 

GmbH, 13125 Berlin, Germany 

E-mail: wegloehner@invivo.de 


Background: For rapid recombinant protein production in small to medium 

size volumes, transient transfection of mammalian cells is still the method of 

choice in biotechnology [1]. However, due to the high costs of commercially 

available lipofectamines or polycationic transfection reagents such as 

polyethylenimine (PEI), the most widely used transfection reagents available 

present a substantial economic bottleneck. While these reagents produce 

seemingly high transient transfection rates [2], there is still a strong desire for 

transfection reagents providing both secure and easy handling and higher 

recombinant protein production. As part of our commitment to excellence, 

InVivo BioTech Services initiated a joint venture with emp Biotech and 

developed a novel polycationic reagent, named INVect, for transient 

transfection and recombinant protein production in mammalian cells. 

Materials and methods: Mammalian cells were cultured in CD-ACF media 

using shake flasks and standard culture conditions. Cells were transfected 

with 10 μg per mL of a GOI harboring plasmid at a cell density of 5 × 10 6 

cells per mL in FreeStyle Medium (Life Technologies) with INVect to DNA 

ratio of 6:1 (w/w) and PEI to DNA ration of 2:1 (w/w). Cultures were 

supplemented with same volume Protein Expression Medium (Life 

Technologies) 2 hours post transfection. GFP and SEAP expression took 

place in 8 mL culture volume in 50 mL bioreactor tubes. Expression of other 

reporter proteins were performed in 150 mL culture volume in 500 mL 

shake flasks. Transfection efficiency was determined 24 hours post 

transfection by counting green fluorescent positive cells using a FACSCalibur 

(Becton, Dickinson and Company). SEAP expression was determined in cell 

culture supernatant on day 6 post transfection by a photometric pNPP turnover 

assay. Quantification of IgG was performed by protein G affinity 

chromatography on day 6 post transfection. Thrombomodulin concentration 

was calculated from cell culture supernatant on day 6 post transfection by 

IMUBIND® Thrombomodulin ELISA Kit (american diagnostica). His-tagged 

recombinant protein was purified on day 6 post transfection by TALON® 

immobilized metal affinity chromatography system. 

Results: Cytotoxicity was tested over a broad range of concentrations. 

Results demonstrate several novel synthetic polymers exhibiting transfection 

efficiencies even higher than common PEIs after optimized ratios of DNA-topolymer 

were applied. Transfection efficiency of INVect was compared to 

PEI, currently the standard transfection reagent for transient gene 

expression. INVect was found to generally give better transfection 

efficiencies of greater 80% in a GFP assay (Figure 1A). Batch-to-batch 

reproducibility was shown on five independent INVect batches. Transfection 

results were highly consistent and in the range of 80-90% (Figure 1B). 

INVect successfully delivers genes to HEK293-F, CHO-S and CAP-T cells as 

shown in a SEAP expression system (Figure 1C). Post-transfection cell 

productivity was determined under TGE manufacturing conditions. 

Thrombomodulin (60 kDa) (Figure 1D), an IgG (144 kDa) (Figure 1E) and a 

HIS-tagged Protein of Interest (~40 kDa) (Figure 1F) were transiently 

expressed using INVect as transfection reagent and conventional 25 kDa PEI 

as control. Cells were transfected with a gene of interest harboring plasmid, 

with product concentration being measured on day 6 post transfection. The 

use of INVect provided a minimum 2-fold increase in protein production 

over PEI (25 kDa) based transfection. 

Conclusions: INVect is a novel polycationic transfection reagent which 

demonstrates low cell toxicity for transient transfection of mammalian cells 

and delivers extremely high transfection efficiencies of up to 90%, 24 h post 

transfection. The use of INVect for transfection under TGE conditions leads 

to exceptionally high levels of protein expression and outperforms 25 kDa 

linear PEI by 2-fold. INVect can be used effectively with all common cell lines 

and is especially suited for HEK293-F and CAP-T cells. 

References 

1. Geisse S: Reflections on more than 10 years of TGE approaches. Protein 

Expr Purif 2009, 64:99-107. 

2. Fischer S, Charara N, Gerber A, Wölfel J, Schiedner G, Voedisch B, 

Geisse S: Transient recombinant protein expression in a human 

amniocyte cell line: the CAP-T® cell system. Biotechnol Bioeng 2012, 

109:2250-2261. 

P27 

Development of a chemically defined cultivation and transfection 

medium for HEK cell lines 

Sebastian Püngel 1 , T Tim Welsink 1 , Penélope Villegas Soto 1 , 

Wolfgang Weglöhner 1 , Tim F Beckmann 2 , Ina Eickmeier 2 , Stefan Northoff 2 , 

Christoph Heinrich 2* 

1 InVivo BioTech Services GmbH, 16761 Hennigsdorf, Germany; 

2 TeutoCell AG, 

33615 Bielefeld, Germany 

E-mail: Christoph.Heinrich@teutocell.de 





Figure 1(abstract P26) Transfection efficiency and 6 day post-transfection cell productivity of INVect. (A) Transfection efficiency of INVect 

compared to PEI. (B) transfection efficiency of 5 independent batches. Transfection efficiency was determined 24 hours post transfection by counting 

green fluorescent positive CAP-T cells using a FACSCalibur (Becton, Dickinson and Company). (C) CHO-S, HEK293-F and CAP-T cells were transfected with 

a SEAP harboring plasmid. Relative SEAP expression was determined in cell culture supernatant by a photometric pNPP turn-over assay. (D) CAP-T cells 

were transfected with a Thrombomodulin harboring plasmid. Thrombomodulin concentration was calculated from cell culture supernatant by IMUBIND® 

Thrombomodulin ELISA Kit (american diagnostica). (E) CAP-T cells were transfected with an IgG harboring plasmid. Antibody concentration was 

determined by protein G affinity chromatography. (F) CAP-T cells were transfected with a His-tagged protein harboring plasmid. Protein of interest was 

purified by TALON® immobilized metal affinity chromatography system.




Background: In the process of generating a production cell, introduction 

of the gene of interest into the host cell can be performed by various 

physical, chemical or biological methods. Because of the greater scalability 

compared to physical methods and no safety concerns or restrictions that 

are associated with the use of viral systems, a transfection using chemical 

methods is of great interest. However, up to now up-scaling is limited by 

the challenge to transfect cells in conditioned media with the widely used 

reagent polyethylenimine (PEI). Considering the upscaling to gram yields, a 

culture medium that allows both, transfection and production is required. 

In this work, the current status in the development of such media 

supporting cell growth, transfection and protein production in HEK cells is 

presented. By this, processes will no longer be limited by media exchange 

prior transient transfection. 

Materials and methods: Transfection was performed according to 

standard protocols described in the literature. Briefly, 5 × 10 6 cells/mL 

were transfected with 2 pg DNA/cell and 25 kDa PEI in 4 mL transfection 

volume. Transfection efficiency was determined 24 hours post transfection 

by counting green fluorescent positive cells using a FACSCalibur (BD 

Biosciences). All cultivations were carried out using shake flasks with 

standard conditions well known in the art. Automated viable cell counting 

was performed by a Cedex (Innovatis). Furthermore, the quantities of 

components like glucose, lactate, amino acids, salts and vitamins in the 

supernatant were measured. Based on this information, single ingredients 

or groups of components from the basal formulation were screened for 

their influence on transfection efficiency. To evaluate the effect of cellular 

proteins in conditioned medium, they were separated by chromatography 

and analyzed via MALDI-TOF/TOF mass spectrometry (MS) (ultrafleXtreme, 

Bruker). SEC was performed using the high resolution gel filtration medium 

Superdex 200 16/60 with the ÄKTAprime system (GE Healthcare). 

Results: Batch growth for an exemplary HEK host cell line in the latest basic 

growth medium formulation reached a maximum viable cell density of 

nearly 1 × 10 7 cells/mL. Direct adaption of three different adherent serumdepending 

host cell lines was also successfully implemented in this medium. 

The screening of basal medium components exhibited no significant 

influence on transient transfection efficiency of HEK cells (overall efficiency 

of 80% +/- 15%), as shown in Figure 1(A). In contrast, depending on the 

level of conditioning, the presence of proteins in the supernatant of these 

media reduced transfection efficiency up to 100% (Figure 1B). 

Separation and analysis of conditioned medium revealed that especially 

high molecular weight components have a negative impact on the 

transfection efficiency. Identification by MALDI-TOF/TOF-MS showed not 

only proteins of the basal lamina but also histones to be present in the 

analyzed high molecular weight fractions 1 and 2 (Table 1). 

Conclusions: The latest medium formulation supports cell growth and easy 

adaption to suspension of the three major HEK host cell lines and several 

producer cell lines originated from those. High transfection efficiencies of up 

to 80% 24 hours post transfection where reached in a basic medium 

formulation. In this context, the major challenge for combining a 

transfection- and growth medium in one formulation is to retain single cell 

growth, while avoiding commonly used anti-aggregation components, 

which are known to impair transfection efficiency. Beyond that, in this study 

basal medium components exhibited no influence on transient transfection, 

whereas high molecular weight fractions of conditioned media reduced 

transfection efficiency. Noticeably, these fractions contained histones which 

might be one factor with negative impact. 

Acknowledgements: This work was partly supported by ZIM (Zentrales 

Innovationsprogramm Mittelstand) and the German Federal Ministry of 

Economics and Technology. 

P28 

Automated substance testing for lab-on-chip devices 

Lutz Kloke 1* , Katharina Schimek 1 , Sven Brincker 1 , Alexandra Lorenz 1 , 

Annika Jänicke 1 , Christopher Drewell 1 , Silke Hoffmann 1 , Mathias Busek 2 , 

Frank Sonntag 2 , Norbert Danz 2 , Christoph Polk 2 , Florian Schmieder 2 , 

Alexey Borchanikov 4 , Viacheslav Artyushenko 4 , Frank Baudisch 3 , Mario Bürger 3 , 

Reyk Horland 1 , Roland Lauster 1 , Uwe Marx 1 

1 Technische Universität Berlin/Germany; 

2 Fraunhofer IWS, Dresden/Germany; 

3 GeSiM mbh, Großerkmannsdorf/Germany; 

4 ART Photonics GmbH, Berlin/ 

Germany 

E-mail: lutz.kloke@tu-berlin.de 


Background: A smartphone-sized multi-organ-chip has been developed 

by TissUse. This platform consists of a microcirculation system which 

contains several fully endothelial-cell-coated micro- channels in which 

organ equivalents are embedded. Briefly, Human 3D organ equivalents 

such as liver and skin could be maintained functional over 28 days and 

treated with chemical entities in this microcirculation system. 

In order to automate the Multi-Organ-Chip (MOC) handling we developed 

with partners a robotic platform. The prototype is capable to maintain 10 

MOCs. Operations can be programmed individually by its user. For example 

OECD guidelines for acute toxicity testing could be performed. The robotic 

platform features also functions such as automatic media supply, sampling 

and storage, temperature control, fluorescence and microscopic monitoring, 

PIV, O2-measurement, etc. To display the functionality we performed a 

toxicity test with RPTEC cells treated with DMSO in different concentrations. 

Proof of concept study: RPTEC cells were used as cellular model system. 

The cells were cultivated in two Generation-4-MOCs as well as in 96-wellplates 

working as reference system. The systems were stained with 

CellTracker Red and cultivated at 37°C and 5% CO 2 saturation. After some 

hours of resting MOCs and MWPs were treated with 10% respectively 20% 

DMSO. Afterwards the fluorescence activity was measured in 20 minute 

intervals in order to detect potential cell death. The cells can be detected 

by the monitoring unit of the robot. A 20 μmol/L CellTracker Red staining 

provides a sufficient signal which can be monitored over time. The 

treatment with 10% DMSO shows a fluorescence signal decline of more 

than 50% and the following recovery of them. 

Summary: This project shows the successful development of a robotic 

platform to handle multi-organ-chips. Maintenance as well as user specific 

protocols, for example toxicity testing, can be accomplished with a 

minimum amount of labor time. The MOCs in combination with the robotic 

platform offer the plug-and-play solution to generate substance interaction 

data on a Lab-on-Chip system. 

Figure 1(abstract P27) A: Screening of media components and different concentrations thereof with regard to transfection efficiency. 

B: Transfection efficiency in conditioned media as well as in fractions from SEC.




Table 1(abstract P27) Proteins identified with at least 2 peptides and a false discovery rate of 0% in up to 

5 biological replicates by MALDI-TOF/TOF-MS in the high molecular weight fractions 1 and 2 

High molecular weight fraction 1 High molecular weight fraction 2 

Group Protein name # Peptides Group Protein name # Peptides 

Histones Histone H2A 3 Histones Histone H2A 4 

Histone H2B 2 Histone H2B 3 

Histone H4 2 Histone H4 4 

Histone H3 3 

Cytoskeleton Tubulin alpha 2 

Tubulin beta 2 Cytoskeleton Tubulin alpha 2 

Actin 3 Tubulin beta 3 

Actin 6 

Other Galectin-3-binding protein 6 

Heat shock 70 kDa protein 1A/1B 5 Extracellular (matrix) Fibrillin-2 2 

Fibronectin 5 

Clusterin 3 

Cochlin 2 

Other Galectin-3-binding protein 10 

Heat shock 70 kDa protein 1A/1B 13 

Golgi membrane protein 1 6 

Alpha-enolase 2 

P29 

NIR-spectroscopy for bioprocess monitoring & control 

Marko Sandor 1 , Ferdinand Rüdinger 1 , Dörte Solle 1 , Roland Bienert 2 , 

Christian Grimm 2 , Sven Groß 2* , Thomas Scheper 1 

1 Institut für Technische Chemie, Leibniz Universität Hannover, Callinstraße 5, 

D-30167 Hannover, Germany; 

2 Sartorius Stedim Biotech GmbH, August- 

Spindler-Straße 11, D-37079 Göttingen, Germany 

E-mail: sven.gross@sartorius-stedim.com 


Introduction: The Quality by Design (QbD) approach shows significant 

benefit in classical pharmaceutical industry and is now on the cusp to a 

stronger influence on biopharmaceutical applications. Monitoring the 

critical process parameters (CPP) applying process analytical technologies 

(PAT) during biotechnological cell cultivations is of high importance in 

order to maintain a high efficiency and quality of a bioprocess. For 

parameters like glucose concentration, total cell count (TCC) or viability a 

robust online prediction is in many applications not yet possible. This gap 

can be closed with the help of NIR spectroscopy (NIRS), which provides 

quantitative prediction of single analytes in real-time. 

For accurate process control based on NIR spectroscopy, special care has to 

be taken while building the calibration model [1,2]. In cell cultivation almost 

all analytes are confounded and show large correlation coefficients. 

Therefore, partial least square (PLS) models are not able to discriminate 

between the signals of the different analytes. Especially, analytes like 

glucose or glutamine which are strongly confounded with cell growth need 

to be evaluated carefully as cell growth is the analyte causing the largest 

changes in NIR spectra throughout a cultivation run. Spiking experiments 

are the most efficient way in order to break correlations between critical 

analytes like glucose and other nutrients or TCC. This strategy should be 

followed in order to build robust calibration models without correlations 

[3,4]. Another very critical issue occurring in cell cultivation are batch-tobatch 

variations. As it is recommended in good modeling practice [5], for 

robust models it is crucial to use several complete batches for validation 

which are not part of the calibration set rather than cross validation [6]. 

Materials and methods: CHO-K01 cells (Cell Culture Technology, 

University of Bielefeld), were cultivated in a BIOSTAT® C plus bioreactor 

(Sartorius Stedim Biotech) with a 7.5 L working volume. In total, eight 

cultivation runs were performed, each lasting six days on average. Sampling 

was performed every three to six hours, and reference analytics of the 

critical process parameters, such as TCC, viability (TC10 automated cell 

counter, Bio-Rad), glucose, lactate, glutamine, etc. (YSI 2700, YSI Inc.) were 

determined in the laboratory. 

Results: Table 1 gives an overview of the models and the accuracy of 

predictions for several analytes investigated. An excellent model could be 

obtained for total cell count (TCC). Viability can be predicted and glucose 

can be predicted as well. Correlations from glucose with other analytes have 

been reduced by spiking of glucose in one cultivation. Predictions for low 

concentration analytes like glutamine seem to be also predictable at the first 

glance, but are strongly related to correlations with other parameters, such 

as TCC. Models based on correlations are not recommended for process 

control since they show a lack of sensitivity to the analyte of interest and 

robustness. Whether a model is based on correlations can be easily 

demonstrated by spiking experiments. Glutamine, for example, was spiked 

in one cultivation at the end of the batch-phase up to 1 g/L. The glutamine 

model was not able to predict the spiking, which proves the strong 

correlation to other analytes. Glutamine cannot be measured directly in this 

Table 1(abstract P29) NIR results for calibration models and validation by external data sets 

Analyte Range No. Cal. No. Val. Batches (Samples) Reg. maths Factors SEC SEP 

TCC (·10 6 cell/mL) 0-16 5 (185) 3 (118) None 2 1.07 0.48 

Viability (%) 10-100 5 (193) 3 (110) None 4 4.2 4.2 

Glucose (g/L) 0-9 5 (198) 3 (105) None 4 1.2 0.48 

Glutamine (g/L) 0-1.1 5 (189) 3 (114) SNV 2 0.16 correlation 

(TCC: total cell count; No.Cal.: Number of batches (samples) of the calibration set. No.Val.: Number of batches (samples) of the validation set; SNV: standard 

normal variate; SEC: standard error of calibration; SEP: standard error of prediction)




concentration range using NIRS. However, qualitative models on overall 

nutrient consumption or metabolite accumulation yield promising results 

(data not shown). 

Additional benefit is generated via MSPC of NIR data. Batch trajectories have 

been generated from major variances of the NIR spectra. The Score values 

have been used and plotted over time using SIMCA 13. Figure 1 (top) shows 

the BEM build for the first principal component of the NIR spectra. Three 

batches contribute to this model, which showed optimal cell growth. 

All batches show almost an identical profile which indicates a high 

batch-to-batch reproducibility, both in terms of process operation and spectra 

acquisition. The mean trajectory (green dashed line) is called golden batch 

and represent the profile of optimal performance. Moreover, process limits 

(red dashed lines) can be defined, which are calculated by three times the 

standard deviation of the batches involved in the model. Other batches can 

be compared to the model. As long as the trajectory of a new batch stays 

within the limits, it can be assigned as statistically identical to the golden 

batch. A relevant process deviation will be notified if the trajectory is outside 

of the limits. Significant process deviations are shown in Figure 1 (middle). 

The trajectory of batch 3 (blue line) surpasses the process limits after 30 h. 

The reason for this was a bacterial contamination during the process. In batch 

2 (black line) a different aeration strategy was applied which resulted in a 

lower cell growth rate. In Figure 1 (bottom) a BEM based on the third 

principal component is shown. The model (dashed lines) is again generated 

from high performance batches as seen in the model above. 

Summary: The Ingold port adaption of a free beam NIR spectrometer is 

tailored for optimal bioprocess monitoring and control. The device shows 

an excellent signal to noise ratio dedicated to a large free aperture and 

thereforealargesamplevolume.Thiscanbeseenparticularlyinthe 

batch trajectories which show a high reproducibility. The robust and 

compact design withstands rough process environments as well as SIP/ 

CIP cycles. 

Robust free beam NIR process analyzers are indispensable tools within 

the PAT/QbD framework for real-time process monitoring and control. 

They enable multiparametric, non-invasive measurements of analyte 

concentrations and process trajectories. Free beam NIR spectrometers are 

an ideal tool to define golden batches and process borders in the sense 

of QbD. Moreover, sophisticated data analysis both quantitative and 

MSPC yields directly to a far better process understanding. Information 

can be provided online in easy to interpret graphs which allow the 

operator to make fast and knowledge-based decisions. This finally leads 

to higher stability in process operation, better performance and less 

failed batches. 

References 

1. Cervera A, Petersen N: Application of near- infrared spectroscopy for 

monitoring and control of cell culture and fermentation. Biotechnology 

Progress 2009, 25:1561-1581. 

2. Rodrigues L, Vieira L, Cardoso J P, Menezes JC: The use of NIR as a multiparametric 

in situ monitoring technique in filamentous fermentation 

systems. Talanta 2008, 75:1356-1361. 

3. Arnold SA, Crowley J, Woods N, Harvey LM, McNeil B: In-situ near infrared 

spectroscopy to monitor key analytes in mammalian cell cultivation. 

Biotechnology and bioengineering 2003, 84:13-19. 

4. Vaidyanathan S, Macaloney G, Harvey LM, McNeil B: Assessment of the 

Structure and Predictive Ability of Models Developed for Monitoring Key 

Analytes in a Submerged Fungal Bioprocess Using Near-Infrared 

Spectroscopy. Applied Spectroscopy 2001, 55:444-453. 

5. Henriques JG, Buziol S, Stocker E, Voogd A, Menezes JC: Monitoring 

Mammalian Cell Cultivations for Monoclonal Antibody Production Using 

Near-Infrared Spectroscopy. Optical Sensor Systems in Biotechnology Place: 

Springer, Berlin, Heidelberg: Rao G 2010, 2010:29-72. 

6. Hakemeyer C, Strauss U, Werz S, Jose GE, Folque F, Menezes JC: At-line NIR 

spectroscopy as effective PAT monitoring technique in Mab cultivations 

during process development and manufacturing. Talanta 2012, 90:12-21. 

P30 

Case study: biosimilar anti TNFalpha (Adalimumab) analysis of Fc 

effector functions 

Carsten Lindemann * , Silke Mayer, Miriam Engel, Petra Schroeder 

EUFETS GmbH, 55743 Idar-Oberstein, Germany 

E-mail: Carsten.Lindemann@eufets.com 


Background: For the development of biosimilar monoclonal antibodies 

or related substances containing the IgG Fc part it is mandatory to fully 

compare immunological properties between originator and biosimilar in a 

“comparability exercise” [1]. The important Fc associated functions 

to mediate antibody dependent cellular cytotoxicity (ADCC) and 

complement dependent cytotoxicity (CDC) need to be characterized 

using both the active substance of the biosimilar and the comparator 

[2,3]. For testing anti TNFalpha antibodies target cells with stable 

expression of membrane TNFalpha (mTNFalpha) is required. Further 

prerequisites are test systems facilitating analysis with high precision and 

accuracy. 

Materials and methods: We generated a human transgenic NK-cell line 

(YTE756.V#26, effector cell line) with stable expression of Fc gammareceptor 

IIIA (CD16, high affinity variant, valine at position 159) and stable 

functional characteristics to replace primary effector cells in ADCC assays. 

Target cells for ADCC and CDC assays were genetically modified for 

stable expression of mTNFalpha without the capability to release soluble 

TNFalpha. Both target and effector cells were generated using retroviral 

vectors to facilitate high and stable transgene expression. Vector particles 

were generated by transient transfection of 293T cells with plasmids 

encoding gag, pol/env and an expression plasmid containing the 

packaging region and the sequences of promotor and the transgenes, i.e. 

selection marker and gene of interest. Multiple gene expression was 

achieved either by using a bicistronic design enabling transcription from 

two promotor sequences, or by using an internal ribosomal entry site. 

Transduction of cells in log phase was followed by a selection of 

transduced cells and clonal selection by limiting dilution. Cell clones were 

expanded for primary and secondary cell banks and further characterised 

with regard to transgene expression and functional characteristics. 

The more complex ADCC assays were developed employing design of 

experiments (DoE). To show assay suitability goodness of fit, ratio of 

upper to lower asymptote, slope and parallelism was determined for each 

dose-response curve compared to a standard. Hypo- and hyperpotent 

samples (50%, 100%, 150% and 200% potency) of Adalimumab and 

Infliximab were analysed in both ADCC and CDC assays to determine 

accuracy and linearity of each method. 

For ADCC assays HT1080 mTNFalpha+ cells were seeded into 96-well plates 

18 - 20 h before start of the assay. Anti TNFalpha dilution series were 

performed in separate plates and transferred into the assay plate together 

with YTE756.V#26 effector cells at an E:T ratio of 10:1 using the effectors 

cell medium as assay medium. After an incubation time of 17 ± 1 h 

effector cells were washed from the adherent target cells. Quantification of 

residual target cells was performed by staining with XTT and photometric 

measurement. Each assay consists of standard (the biosimilar) and sample 

(originator) concentrations ranging from 1000 to 4.69 ng/ml in duplicates. 

Comparison of dose-response curves in a 4 PL model and determination of 

potency was performed using PLA software (Stegmann Systems). 

For CDC assays CHO mTNFalpha+ cells were seeded into 96 well plates 

20 - 25 h before start of the assay. Antibody dilution series were transferred 

into the assay plate using cell culture medium containing 20% native 

human serum pool. After an incubation time of 2 ± 0.5 h medium nonadherent 

cells were removed by washing the MTP. Quantification of residual 

cells was performed as described for ADCC assays. Each assay consists of 

standard and sample (originator or accuracy item) concentrations ranging 

from 5000 to 130 ng/ml in duplicates. Comparison of dose-response curves 

in a 4 PL model and determination of the relative potency was performed 

using PLA software. 

Originator batches and the biosimilar were analysed by monosaccharide 

and sialic acid analysis, N-glycan profiling by MALDI-MS (permethylated 

glycans) and by HILIC-HPLC. N-Glycosylation site determination was done 

by MALDI and/or LC-ESI-MS and MS/MS (1 digestion). 

Results: Both ADCC and CDC assays show good accuracy (relative accuracy 

< 15%) and linearity (r squared < 0.97). Precision of CDC assays (CV < 8%) 

was better than that of the more complex ADCC assays (< 15%). Due to the 

distinctly lower actitivity of Adalimumab compared to that of Infliximab we 

evaluated the most influential factor for gaining a high asymptote ratio by 

DoE.Theincubationtimewasshowntobemostimportantcomparedto 

other factors as effector to target cell ratio and fetal bovine serum content. 

We analysed different batches of originators and a biosimilar candidate 

molecule for functional variability in ADCC and CDC assays (Table 1). In CDC 

assays (n = 3) the three originator batches of Adalimumab showed 

comparable potency in between batches and compared to the biosimilar.




Figure 1(abstract P29) Batch evolution models (BEM) based on NIR spectra. (Top): Batch trajectories from three batches based on the first principal 

component of NIR spectra. The golden batch trajectory is shown in green (mean value of all contributing batches) and the process limits are shown in 

red (three times the standard deviation of the three contributing batches). (Middle): Compared to the BEM other batches show deviations which can be 

assigned to contaminations (blue line) or low cell growth rate (black line). (Bottom): Batch trajectories from three batches based on the third principal 

component of NIR spectra. Compared to the BEM other batches show deviations like contaminations (blue and violet line) or early glucose limitation 

which led to an early drop of viability (black, yellow and violet line).




Table 1(abstract P30) Relative potency (compared to 

biosimilar) of originators in ADCC and CDC assays 

Assay Originator Relative potency CV 

ADCC 2 140% 9.9% 

3 141% 11.1% 

4 135% 16.8% 

CDC 2 92% 15.1% 

3 89% 10.2% 

4 89% 16.7% 

A higher variability of the originators was found in ADCC assays (n = 6) 

besides the potency was higher than that of the Adalimumab biosimilar. 

Major differences between originators with regard to glycosylation were not 

found. The biosimilar showed a high galactose content and consequently a 

higher percentage of galactosylated glycan structures than the originators. 

Conclusions: In summary we show the suitability of an ADCC potency 

assay for investigation of functional comparability of Adalimumab and 

biosimilar candidate substances. Differences between biosimilar and 

originators in glycosylation might contribute to differences found in the 

ADCC potency assay but not with the CDC potency assay. 

References 

1. Guideline in similar biological medicinal products containing 

monoclonal antibodies. , EMA/HCMP/BMWP/403543/2010. 

2. Guideline on development, production, characterisation and 

specifications for mnoclonal antibodies and related products. , EMEA/ 

CHMP/BWP/157653/2007. 

3. ICHQ6B Test procedures and acceptance criteria for biotechnological/ 

biological products. , CMP/ICH/365/96. 

P31 

Cellular tools for biosimilar mAb analysis 

Carsten Lindemann * , Silke Mayer, Miriam Engel, Petra Schroeder 

EUFETS GmbH, 55743 Idar-Oberstein, Germany 

E-mail: Carsten.Lindemann@eufets.com 


Background: For the development of biosimilar monoclonal antibodies 

(mAb) or related substances containing the IgG Fc part it is mandatory to 

fully compare immunological properties between originator and biosimilar 

in a “comparability exercise” [1]. The most complex Fc associated function 

to mediate antibody dependent cellular cytotoxicity (ADCC) needs to be 

characterized using the active substance of the biosimilar and the 

comparator. From a regulatory point of view potency assays should reflect 

the proposed mode of action but in vitro ADCC assays are considered 

difficult to validate due to the variability of the primary effector cells [2,3]. 

The requirement to test for ADCC with high precision and accuracy is 

challenging. Design of cell lines to replace primary cells for effector or 

target cells is a solution to provide tools for standardized and extensive 

biosimilar testing. 

Materials and methods: Retroviral vectors were used to generate cell 

lines with stable genetic modification. Vector particles were generated by 

transient transfection of 293T cells with plasmids encoding gag, pol/env 

and an expression plasmid containing the packaging region and the 

sequences of promotor and the transgenes, i.e. selection marker and gene 

of interest. Multiple gene expression was achieved either by using a 

bicistronic design enabling transcription from two promotor sequences, or 

by using an internal ribosomal entry site. Transduction of cells in log phase 

was followed by a selection of transduced cells and clonal selection by 

limiting dilution. Cell clones were expanded for primary and secondary cell 

banks and further characterised with regard to transgene expression and 

functional characteristics. We developed a human transgenic NK-cell line 

(YTE756.V#26, effector cell line) with stable expression of Fc gammareceptor 

IIIA (CD16, high affinity variant, valine at position 159) and stable 

functional characteristics. Target cell lines were generated similarly using 

different expression plasmid constructs. 

ADCC assays were developed by using design of experiments (DoE) to 

determine experimental factors of importance for assay suitability. To show 

assay suitability goodness of fit, the amplitude of sigmoid curve, slope and 

parallelism was determined for each sample compared to a standard. Hypoand 

hyperpotent samples (50%, 100%, 150% and 200% potency) of 

Rituximab, Trastuzumab, Adalimumab and Infliximab were analysed to 

determine accuracy and linearity of each method. Optimisation of each 

assay requires determining the relative importance of factors including E:T 

ratio, incubation time, target cell density and pre-assay schedules for target 

and effector cells. Analysis of critical factor interaction was performed using 

Minitab software. A list of established ADCC assays is shown in Table 1. 

CD16 expression was analyzed and quantified by flow cytometry. Cells 

were stained using anti-CD16 PE-conjugated antibodies. PE-fluorescence 

was correlated to number of PE-molecules per cell using BD Quantibrite 

beads. Primary NK-cells were isolated using Dynal beads (purity > 95%) 

from 3 healthy donors and used immediately after isolation. 

Results: In order to prove genetic stability of the transgenic NK cell line 

CD16 expression was analysed by flow cytometry for up to 22 passages. 

More than 95% of cells were CD16 positive, viability of cells was >90%. 

CD16 expression level was stable (19.000 - 28.000 CD16 molecules/cell). 

Functional stability of the effector cell line was shown for more than 30 

passages. This was shown by a stable EC50 value obtained for a reference 

antibody in the Trastuzumab ADCC assay. 

The effector cell line was compared with primary NK-cells (purity > 95%) 

from 3 donors in a Trastuzumab ADCC assay. The data show high donor 

variability, mostly incomplete dose-response curves and a killing activity 

with a low dynamic range (baseline to top ratio: 3). For primary NK-cells 

the amplitude of the dose-response curve is dependent on both donor 

variability and the type of target cell. Using the effector cell line this is 

dependent on the target cell only. Assay variability was strongly reduced 

and sample throughput could strongly be increased by using the effector 

cell line in comparison to primary NK-cells. Optimization of each assay by 

DoE required determining the relative importance of various factors 

including effector to target cell ratio, incubation time, target cell density 

and pre-assay culture schedules for target and effector cells. Accuracy of 

these ADCC assays could be shown in between a range of 50% to 200% 

potency. Linearity was shown by a high coefficient of determination 

(>0.97) and other statistical methods. Inter-assay precision of all ADCC 

assays was




Figure 1(abstract P31) Analysis of accuracy and linearity of the Infliximab ADCC assay. Data shown are sample dose response curves (left) 

determined by 4PL analysis and mean rel. potency +/- SD (dot, n = 3) compared to the standard (right). 

For precision analysis the relative potency of a sample was repeatedly 

analyzed on 4 days with 3 assays per day. 

Conclusions: Altogether these data show the feasibility of providing 

suitable tools for validation and routine testing of various mAbs in ADCC 

potency assays scalable to the analytical needs of biosimilar testing. 

References 

1. Guideline in similar biological medicinal products containing 

monoclonal antibodies. EMA/HCMP/BMWP/403543/2010. 

2. Guideline on development, production, characterisation and 

specifications for mnoclonal antibodies and related products. 

EMEA/CHMP/BWP/157653/2007. 

3. ICHQ6B Test procedures and acceptance criteria for biotechnological/ 

biological products. CMP/ICH/365/96. 

P32 

The successful transfer of a modern CHO fed-batch process to different 

single-use bioreactors 

Sebastian Ruhl * , Ute Husemann, Elke Jurkiewicz, Thomas Dreher, 

Gerhard Greller 

Sartorius Stedim Biotech GmbH, D-37079 Göttingen, Germany 

E-mail: sebastian.ruhl@sartorius-stedim.com 


Introduction: Nowadays, single-use bioreactors are widely accepted in 

pharmaceutical industry. This is based on shorter batch to batch times, 

reduced cleaning effort and a significantly lower risk of cross contaminations 

[1,2]. One large field of the application of single-use bioreactors is the seed 

train cultivation of mammalian cells [1]. The focus is further extended to 

perform state of the art fed-batch production processes in such bioreactors. 

In this study an industrial proven CHO fed-batch process is established in 

different single-use and reusable bioreactors. 

Materials and methods: Cell line, medium and process strategy: For 

the fed-batch process the cell line CHO DG44 (Cellca, Germany) secreting 

human IgG1 was used. SMD5 medium (Cellca, Germany) was prepared for 

the seed train and PM5 medium (Cellca, Germany) as a basal medium for 

the fed-batch culture. The feeding procedure comprised the addition of 

three different feeds (feed medium A, feed medium B and concentrated 

glucose solution). After a 3 day batch phase, the 14 day fed-batch phase 

started. The automated discontinuous bolus feed of feed media A and B was 

supplemented by the glucose feed solution to keep the glucose 

concentration above 3 g/L. 

Bioreactors: The process was initially developed in a 5 L stirred glass 

bioreactor therefore the BIOSTAT® B with a UniVessel® 5 L was considered as 

a reference. Single-use bioreactors involved in this study were the stirred 

tank reactor BIOSTAT® STR 50 L with a CultiBag STR 50 L and the rocking 

motion bioreactor BIOSTAT® RM 50 optical with CultiBag RM 50 L. 

Process transfer: The used bioreactors were characterized in terms of 

process engineering [3]. Due to different agitation and gassing principles 

present in the BIOSTAT® STR and RM the k L a and mixing times were 

chosen as a scale-up criteria. The process conditions were specified to 

meet a k L a-value of > 7 h -1 [4] and a mixing time of < 60 s [5]. 

Sampling procedure: A daily sampling procedure was performed before 

the bolus feed. Metabolites like glucose and lactate were analyzed by the 

Radiometer ABL800 basic (Radiometer, Germany). Viable cell density (VCD) 

and viability were determined by the Cedex HiRes (Roche Diagnostics, 

Germany). 

Results: The process transfer is considered successful, if comparable 

cellular proliferation activities and product titers are obtained. 

The initial viable cell density in all systems was 0.3 - 0.4 × 10 6 cells/mL. At the 

start of the fed-batch phase a viable cell density of 4 - 5 × 10 6 cells/mL could 

be achieved. As seen in Figure 1A the viable cell density peak of 27 - 28 × 

10 6 cells/mL was reached in all systems after 8 - 9 days. At the point of 

harvest after 17 days viable cell densities between 12 - 17 × 10 6 cells/mL 

and viabilities of 57 - 82% were reached. The cell broth was harvested for 

further downstream operations. 

A well-controlled pH value is essential for a reproducible cell proliferation. As 

seen in Figure 1B exemplarily shown for the BIOSTAT® STR 50 L small peaks 

occurred due to the daily addition of feed medium B (pH 11). The offline 

measured pCO 2 trend shows a constant decrease during the batch phase 

followed by an increase during the fed-batch phase with a maximum value 

of 135 mmHg.




Figure 1(abstract P32) Process trends. 

Shown in Figure 1D glucose concentration could be kept above 3 g/L in 

the fed-batch phase. Lactate had a peak accumulation of 0.9 g/L at the 

end of the batch phase and remained at low value afterwards. 

The product yield in all cultivations was comparable to the reference 

systems and exceeded 8 g/L IgG (Figure 1C). 

Conclusion: The high cell density CHO fed-batch process with industry 

relevant titers was successfully transfer from a reference bioreactor to a 

variety of single-use bioreactor systems. 

The k L a and mixing time were suitable as a scale-up criteria for systems 

with different agitation principles. 

Acknowledgements: My thanks go to the complete Upstream 

Technology-team at Sartorius Stedim Biotech Göttingen. 

References 

1. Brecht R: Disposable Bioreactors: Maturation into Pharmaceutical 

Glycoprotein Manufacturing. Adv Biochem Engin/Biotechnol 2009, 115:1-31. 

2. Eibl D, Peuker T, Eibl R: Single-use equipment in biopharmaceutical 

manufacture: a brief introduction. Wiley, Hoboken: Eibl R., Eibl D 2010, 

Single-use technology in biopharmaceutical manufacture. 

3. Löffelholz C, Husemann U, Greller G, Meusel W, Kauling J, Ay P, Kraume M, 

Eibl R, Eibl D: Bioengineering Parameters for Single-Use Bioreactors: 

Table 1(abstract P32) Bioreactor Setup and Process Parameters 

BIOSTAT® RM 50 L STR 50 L B 5 L 

Gassing principle Overlay Ring Sparger 

Sensors Single-use optical patches Reusable probes 

Working volume [L] 25 50 5 

Initial volume [L] 13 26 2.6 

pH set point 7.15 

pH control 

CO 2 gassing 

pO 2 set point 

60% sat. 

pO 2 control 

Multi stage cascade comprising N 2 , Air, O 2 - gassing 

Agitation [rpm] 30 @ 10° rocking angle 150 400




Overview and Evaluation of Suitable Methods. Chem Ing Tech 2013, 

85:40-56. 

4. Ruhl S, Dreher T, Husemann U, Greller G: Design space definition for a 

stirred single-use bioreactor family from 50 to 2000 L scale. Poster ESACT 

Lílle 2013. 

5. Lara AR, Galindo E, Ramírez OT, Palomares LA: Living with Heterogeneities 

in Bioreactors. Mol Biotechnol 2006, 34:355-381. 

P33 

Differences in the production of hyperglycosylated IFN alpha in CHO 

and HEK 293 cells 

Agustina Gugliotta, Marcos Oggero Eberhardt, Marina Etcheverrigaray, 

Ricardo Kratje, Natalia Ceaglio * 

Cell Culture Laboratory, School of Biochemistry and Biological Sciences, 

Universidad Nacional del Litoral. Ciudad Universitaria - C.C. 242 - (S3000ZAA) 

Santa Fe, Provincia de Santa Fe, Argentina 

E-mail: nceaglio@fbcb.unl.edu.ar 


Background: IFN alpha is an important cytokine of the immune system. It 

has the ability to interfere with virus replication exerting antiviral activity. 

Moreover, it displays antiproliferative activity and can profoundly modulate 

the immune response. IFN4N (or hyperglycosylated IFN alpha) is an IFNalpha2b 

mutein developed in our laboratory using glycoengineering 

strategies. This molecule contains 4 potential N-glycosylation sites together 

with the natural O-glycosylation site in Thr106 [1]. The resulting N- and 

O-glycosylated protein shows higher apparent molecular mass and longer 

plasmatic half-life compared to the non-glycosylated IFN-alpha produced in 

bacterial systems and used for clinical applications. As a consequence, the 

correct glycosylation of our modified cytokine is very important for its 

in vivo activity. For this reason, it is of great relevance the evaluation of 

different mammalian host cells for its production. While hamster-derived 

CHO cells are widely used for large scale production of recombinant 

therapeutic glycoproteins, human HEK cells are a promising system because 

they are easy to grow and transfect [2]. In this work, we performed a 

comparison between both production systems in terms of cell growth, 

culture parameters and specific productivity of hyperglycosylated IFN alpha. 

Results: Lentiviral vectors containing the sequence of IFN4N were 

assembled and employed for the transduction of CHO-K1 and HEK 293T 

cells. The recombinant cell lines were subjected to a process of selective 

pressure using increasing concentrations of puromycin. The CHO-IFN4N 

and HEK-IFN4N producing cell lines resistant to the highest concentration 

of puromycin showed the highest productivity of IFN4N. In particular, the 

CHO-IFN4N cell line was resistant to 350 μg/ml of puromycin and it 

showed a specific productivity of 817 ± 134 ng.10 6 cell -1 .day -1 ,which 

represents an 8-fold increment compared to the parental line. The 

HEK-IFN4N cell line was resistant to 200 ug/ml of puromycin and 

showed a 15-fold increment in the specific productivity compared to the 

parental line, reaching a value of 1,490 ± 332 ng.10 6 cell -1 .day -1 .Inboth 

cases, complete culture death was achieved at higher puromycin 

concentrations. The specific productivity of IFN4N of HEK 293T cell line 

duplicated the value obtained for the CHO-K1 cell line, and it was 

achieved at a lower concentration of puromycin, making the selection 

process shorter (Figure 1). 

Both cell lines were cloned using the limiting dilution method, and after 

15 days of culture more than 100 clones were screened. To achieve the 

characterization and study both cell lines as recombinant protein expression 

hosts, the 6 best producer clones were isolated and amplified. The adherent 

clones were grown for 7 days in order to construct their growth curves. Cell 

density and viability were determined every 24 h by trypan-blue exclusion 

method and the culture supernatant was collected to determine IFN4N and 

metabolites concentration. The IFN4N production was assessed employing a 

sandwich ELISA assay developed in our laboratory. Glucose consumption 

and lactate production were evaluated using specific Reflectoquant® test 

strips (Merck Millipore) in a RQflex® Reflectometer (Merck Millipore). Levels 

of amonium in the culture supernatant were determined by the Berthelot 

reaction. 

As shown in Table 1, the average specific growth rates of CHO and HEK 

clones were similar. However, CHO clones reached higher maximum cell 

densities (between 7.10 5 -1.5.10 6 cell.ml -1 ) than HEK clones (between 6.10 5 - 

9.10 5 cell.ml -1 ), probably because of space limitation and higher glucose 

consumption, since average q gluc of HEK clones was higher (see Table 1). No 

differences were observed between lactate and ammonium production of 

both groups of clones. In contrast, specific production rate of IFN4N was 

higher for the clones derived from the human cell line. Moreover, higher 

average IFN4N cumulative production for HEK clones was achieved after 

7 days of culture (3,494 versus 5,961 ng.ml -1 ). 

Conclusion: CHO and HEK cells were genetically modified to produce 

IFN4N by using lentiviruses as a tool for the IFN4N gene transfer. Since both 

cell lines expressed high levels of IFN4N, 6 clones were amplified for an 

intensive characterization. Culture and production properties of both groups 

of clones were very different. On the one hand, CHO clones were easy to 

maintain in culture for a long period of time, reaching higher cell densities 

than HEK clones. On the other hand, the best specific productivity of IFN4N 

was achieved employing HEK cells. The behavior of CHO and HEK cells at 

large scale production should be analyzed in order to select the proper 

system for the cytokine’s production. 

Wide differences have been observed between the glycosylation profile 

of the same recombinant therapeutic protein produced in CHO and HEK 

systems [2]. Considering that glycosylation affects protein bioactivity, 

stability, pharmacokinetics and immunogenicity, it would be very 

important to evaluate the characteristics of the IFN4N produced in both 

hosts to determine their efficacy as therapeutic agents. 

Figure 1(abstract P33) Comparison between the specific productivity of the CHO-IFN4N (a) and HEK-IFN4N (b) producing cell lines as a function of 

puromycin concentration.




Table 1(abstract P33) Determination of the specific cell growth rate, specific production rate of lactate, ammonium 

and IFN4N, and specific consumption rate of glucose of CHO-K1 (a) and HEK 293T (b) clones 

a) 

Clones μ(h -1 ) q IFN 

(ng.10 -6 cell.h -1 ) 

q gluc 

(μg.10 -6 cell.h -1 ) 

q lac 

(μg.10 -6 cell.h -1 ) 

q amon 

(nmol.10 -6 cell.h -1 ) 

P4D3 0,0182 ± 0,002 79 ± 8 36 ± 5 40 ± 5 0,027 ± 0,007 

P1E9 0,0196 ± 0,002 35 ± 4 24 ± 4 45 ± 5 0,027 ± 0,003 

P2A9 0,0249 ± 0,001 41 ± 4 30 ± 2 31 ± 1 0,014 ± 0,004 

P1B6 0,0240 ± 0,002 19 ± 3 26 ± 5 49 ± 5 0,013 ± 0,005 

P1B7 0,0191 ± 0,002 41 ± 3 32 ± 4 35 ± 2 0,017 ± 0,006 

P1B8 0,0277 ± 0,002 42 ± 3 21 ± 3 34 ± 2 0,015 ± 0,004 

b) 

Clones μ(h -1 ) q IFN 

(ng.10 -6 cell.h -1 ) 

q gluc 

(μg.10 -6 cell.h -1 ) 

q lac 

(μg.10 -6 cell.h -1 ) 

q amon 

(nmol.10 -6 cell.h -1 ) 

P2A5 0,020 ± 0,001 129 ± 10 56 ± 6 37 ± 4 0,014 ± 0,003 

P2C7 0,015 ± 0,002 122 ± 13 62 ± 11 38 ± 3 0,009 ± 0,003 

P2G11 0,017 ± 0,002 82 ± 6 47 ± 9 31 ± 3 0,008 ± 0,002 

P3B7 0,016 ± 0,002 99 ± 8 55 ± 8 31 ± 3 0,008 ± 0,003 

P3H8 0,027 ± 0,001 82 ± 11 46 ± 6 34 ± 3 0,008 ± 0,001 

P4B4 0,017 ± 0,002 63 ± 5 61 ± 15 32 ± 3 0,009 ± 0,001 

References 

1. Ceaglio N, Etcheverrigaray M, Conradt HS, Grammel N, Kratje R, Oggero M: 

Highly glycosylated human alpha interferon: An insight into a new 

therapeutic candidate. J Biotechnol 2010, 146:74-83. 

2. Croset A, Delafosse L, Gaudry JP, Arod C, Gleza L, Losbergera C, Beguea C, 

Krstanovicb A, Robertb F, Vilboisa F, Chevaleta L, Antonssona B: Differences 

in the glycosylation of recombinant proteins expressed in HEK and CHO 

cells. J Biotechnol 2012, 161:336-348. 

P34 

Developing an upstream process for a monoclonal antibody including 

medium optimization 

Sevim Duvar * , Volker Hecht, Juliane Finger, Matthias Gullans, Holger Ziehr 

Pharmaceutical Biotechnology, Fraunhofer Institute for Toxicology and 

Experimental Medicine (ITEM), Braunschweig, Germany 

E-mail: sevim.duvar@item.fraunhofer.de 


Background: Monoclonal antibodies have been established as important 

therapeutics in cancer and autoimmune diseases. Hence, there is a 

growing interest in the production of monoclonal antibodies in 

pharmaceutical industry. In order to reduce timelines and costs of 

production the process and medium development is of central importance. 

Perfusion processes are well known to achieve higher productivities 

compared with batch or fed batch. Major advantages of perfusion culture 

are that you can keep optimal culture medium conditions for the cells and 

realize higher performance. However, obtaining high performance requires 

the combination of process optimization as well as a well-balanced 

concentrated culture medium. Selecting the best system also depends on 

the shear sensitivity of the cell line, the robustness of the process and the 

scale used. 

In upstream processing batch, fed batch and perfusion mode were applied. 

Design of Experiments (DoE) was used to develop a feed protocol for fed 

batch cultivations. In shake flask experiments the influence of temperature, 

osmolality, and pH to improve antibody yield was examined. 

In a further study we compared different cell retention systems with regard 

to achieve high viable cell densities in a short time like required for a seed 

train application. The best results were achieved with the ATF system with 

cell densities up to 1.3 × 10 8 cells/mland4foldimprovedproduct 

concentration compared to batch culture. 

Materials and methods: A CHO cell line producing the antibody G8.8 

against Epithelial Cell Adhesion Molecule (Ep-CAM) was employed for the 

experiments performed in this study. The fermenters were Sartorius BBI 

Twin-System (2- and 5 L culture volume). We compared five different 

retention systems: SpinFilter (Sartorius BBI Systems), Cell Settler 

(Biotechnology Solutions), Centritech Lab III (Pneumatic Scale), Biosep 

(Applikon) and ATF (Alternate Tangential Flow; Refine Technology). The cell 

count was performed with CEDEX cell counter (Roche Diagnostics). The 

monoclonal antibody was quantified with HPLC-method using Protein A- 

column. Design of Experiments (DoE) was used to develop a feed protocol 

for Perfusion cultivations. In shake flask experiments we examined the 

influence of temperature, osmolality, and pH to improve antibody yield. 

Results: Fed batch development in shake flasks with DoE: For the 

development of fed batch in shake flasks we used D-optimal Design with 

18 runs. The examined factors were: Feed volume, time of feed start, time of 

temperature shift (33°C) and time of Osmolality shift (450 mOsmol/kg). The 

response was maximum antibody titer. The results show that the optimal 

feed volume is 15 ml/d. The time point for feeding start has almost no 

influence. The temperature shift and osmolality shift have negative influence 

(data not shown). 

Comparison of cultivations with different retention systems: We 

compared five different cell retention systems under same cultivation 

conditions. The best results could be achieved with the ATF system with cell 

densities up to 1.3 × 10 8 cells/ml. The next best retention systems were 

the Centrifuge and the Cell Settler with cell densities reached up to 3 × 

10 7 cells/ml. Using BioSep and Spinfilter, cell densities up to 2 × 10 7 cells/ml 

were obtained (data not shown). The Spin filter and BioSep showed break 

through of cells at cell densities > 2 × 10 7 cells/ml. In contrast, the Cell 

Settler had the advantage of simplicity and robustness and no moving parts. 

The advantage of the centrifuge was the high flexibility concerning the 

reactor-volume to be perfused. The Spinfilter and BioSep showed the lowest 

performance. 

Comparison of cultivations with ATF: In a study we compared ATF 

cultivations with 0.2 μm membrane and with 50 kDa membrane. In 

cultivations with the 0.2 μm membrane a maximum cell density with 6.4 × 

10 7 cells/ml could be achieved compared to a maximum cell density of 1.3 × 

10 8 cells/ml with the 50 kDa membrane as shown in Figure 1. The increased 

cell densities resulted in a higher productivity compared to the other cell 

retention systems. Furthermore, the ATF with 50 kDa retended not only the 

cells but also the antibody within the reactor. Therefore, a higher volumetric 

productivity could be achieved with the 50 kDa membrane. The maximum 

titer in the reactor with the 50 kDa membrane was 4 fold higher compared 

with the 0.2 μm membrane. 

Viable cell densities (VCD) and product concentrations of the monoclonal 

antibody (MAB) are shown.




Figure 1(abstract P34) Comparison of cultivations with ATF 0.2 μm and 50 kDa membrane. 

Conclusions: We have demonstrated that perfusion processes have a 

higher productivity compared to batch or fed batch processes. In our 

study the best retention system for perfusion culture was the ATF system 

compared with SpinFilter, Cell Settler, Centritech Lab III and Biosep. With 

the ATF system we realized cell densities up to 1.3 × 10 8 cells/ml and 

4foldimprovedproductconcentration compared to batch culture. Also, 

the ATF with a 50 kDa membrane retended not only the cells but also the 

antibody within the reactor. Therefore, a higher volumetric productivity 

couldbeachievedwiththe50kDamembrane. In perfusion culture the 

cells show constant specific productivity over the whole perfusion phase 

which shows that the cells are well fed. 

P35 

Development and evaluation of a new, specially tailored CHO media 

platform 

Tim F Beckmann * , Christoph Heinrich, Heino Büntemeyer, Stefan Northoff 

TeutoCell AG, Bielefeld, 33613, Germany 

E-mail: Tim.Beckmann@teutocell.de 


Background: Today’s biopharmaceutical industry is under increasing 

pressure considering cost efficient development. Short timeframes rule 

the progress starting from the generation of producer cell lines to the 

establishment of a final production process. Hence, the timescale for 

optimization of cell culture media is small, but on the other hand it 

contains high potential for global process improvement. In this scope, our 

specially tailored media development platform, which allows a fast and 

reliable introduction of high-performance basis media and feeds, 

establishes new perspectives for an efficient process development. 

Materials and methods: For the design and development of TeutoCell’s 

new media platform various cell lines and expression systems were 

comprehensively analyzed and incorporated. The results gained from 

cultivations and extensive analysis of culture supernatant and e.g. product 

glycosylation were integrated in a cyclic development strategy, utilizing 

theoretical and empirical formulation optimizations. Special applications 

like single clone selection were integrated into our platform as well. 

The cell lines used for the development of our media platform include CHO- 

DG44, CHO-GS and CHO-K1 clones. Cultivations were carried out in shaking 

flasks as well as closed-loop controlled 0.5 - 2.0 L bioreactor systems in batch 

und fed-batch mode using standard conditions. An industrially relevant, 

protein-free and chemically defined medium was used as a reference. 

Media development for single clone selection by limited dilution was 

performed with different CHO suspension cells in microtiter plates (from 

96- to 6-wells) up to shaking flaks. Analysis of single clone colonies was 

done with a Cellscreen System.




Samples of a model antibody produced in commercially available CHO 

reference medium and TeutoCell’s platform medium using two different 

producer clones were desalted, denaturated and treated with PNGaseF. 

Glycanswereconcentratedviasolid-phaseextractionandanalyzedby 

MALDI-TOF mass spectrometry. Signal-to-noise ratios of specific masses 

were used for calculations of relative amounts. 

Results: The performance of the platform medium was evaluated using a 

set of eleven different CHO cell lines in comparison to an industrially 

relevant, protein-free and chemically defined medium. For all tested cell 

lines, the maximum viable cell density (vcd) as well as the integrated viable 

cell density (ivcd) and the product titer were higher compared to the 

reference. In numbers, the improvement in vcd ranged between a factor of 

1.7 and 2.5, in ivcd between a factor of 1.2 and 4.2 and in product titer 

between a factor of 1.4 and 2.7 in batch cultures. By this improvement viable 

cell densities of up to 17.53·10 6 cells/mL and product titer of 1015 mg/L 

were reached. An overview of these results is illustrated in Figure 1. 

Furthermore, the potential influence of the utilized medium on product 

glycosylation was examined. For this, antibody harvest from two different 

clones cultivated in reference and platform medium was analyzed. The 

results of relative quantification of glycan structures by mass spectrometry 

showed highly comparable profiles for the reference and platform 

medium. An overview of the glycoanalysis is given in Table 1. 

As an additional application, the platform medium was successfully 

utilized as a basis for a chemically defined cloning medium in limited 

dilution experiments. For different cell lines single cell growth was 

achieved and cells were effectively expanded from 96-well plate format 

up to shaking flask cultures. 

Conclusions: Within this work a chemically defined and animal-component 

free media platform was successfully implemented, which supports high 

performance growth and productivity without supplementation of proteins 

or growth hormones. In addition, its streamlined formulation of less than 

50 components increases the design space for the efficient development of 

custom formulations. The suitability as a platform medium was verified by 

the successful cultivation of a wide range of cell lines including CHO-DG44, 

CHO-GS and CHO-K1 clones and the feature of easy adaption from serum 

containing and commercially available formulations. For all tested cell lines 

stable high performance cultivations with high product yields were 

achieved, with consistent glycosylation profiles. As a further field of 

application, the platform medium provides the basis for single cell growth 

following limited dilution. 

Acknowledgements: Parts of this work were financially supported by the 

German Federal Ministry of Education and Research - BMBF (#031A106). 

Responsibility for the content lies with the author. 

P36 

Streamlined process development using the Micro24 Bioreactor system 

Steve RC Warr * , John PJ Betts, Shahina Ahmad, Katy V Newell, Gary B Finka 

Upstream Process Research, GlaxoSmithKline, Stevenage, SG1 2NY, UK 

E-mail: steve.r.warr@gsk.com 


Introduction: The Pall Micro24 Bioreactor system is one of several 

microbioreactor systems that have been commercialised in recent years 

in response to the demand to reduce costs and shorten process 

development time lines. 

We have previously demonstrated that the Micro24 Bioreactor system can 

be integrated successfully into the later stages of cell line screening 

programmes and that the results correlate well with those from more 

conventional methods [1]. Further process development for these 

selected cell lines traditionally utilises bench top bioreactors to define 

appropriate process conditions giving the desired process outcomes 

Figure 1(abstract P35) Comparison of growth performance (A) and product titer (B) using the reference and platform medium. To illustrate the 

improvement in relation to the reference medium, the mean of 5 producer- and the corresponding parental cell line were normalized to the results 

obtained in the reference medium (C and D). The error bars show the deviation between the different cell lines. The development progress of the 

platform medium is represented by one major interstage.




Table 1(abstract P35) Comparison of the glycosylation pattern of a model antibody produced in two different cell 

lines using the reference medium and the platform medium 

Structure Relative Amount of Glycan Structure [%] 

High Producer 1 High Producer 2 

Reference 

Shaker 

Platform 

Shaker 

Platform 

Bioreactor 

Reference 

Shaker 

Platform 

Shaker 

Platform 

Bioreactor 

Man3 - - - 4 ± 2 1 ± 2 - 

Man5 7 ± 2 3 ± 2 5 ± 2 12 ± 3 9 ± 2 4 ± 1 

G0F-GlcNAc 2 ± 2 2 ± 1 4 ± 2 10 ± 4 5 ± 0 2 ± 2 

G0F 46 ± 2 50 ± 5 47 ± 5 47 ± 5 47 ± 2 47 ± 5 

G1 6±3 6±2 8±2 3±1 9±1 5±1 

G1F 30 ± 3 32 ± 5 29 ± 7 19 ± 2 23 ± 3 35 ± 2 

G2F 9±2 7±2 7±2 5±1 6±1 7±2 

The relative amounts of detected structures are given in % with the standard deviation of four independent analyses. 

although this approach can be time consuming and resource intensive. 

However the Micro24 Bioreactor system allows up to 24 different process 

conditions to be run concurrently thereby facilitating efficient process 

development. 

This work describes the use of the Micro24 Bioreactor system to identify 

improved process conditions for different cell lines and their subsequent 

validation in bioreactors. 

Micro-24 bioreactor system (Pall): This system comprises 24 bioreactors 

(7 ml working volume) each capable of independent temperature, 

dissolved oxygen and pH control. The main limitation of the system is the 

lack of automation meaning that any feed additions or sample removal 

must be made manually and similarly, for mammalian cultures, upwards 

pH control is achieved by the manual addition of NaHCO 3 . 

Engineering characterisation studies carried out at UCL (data not shown) 

have shown how conditions within the individual Micro24 chambers 

compare with those in bioreactors and recent results also indicate that 

the selection of the Micro24 plate type is critical in ensuring good 

correlation with performance in traditional bioreactors. 

Within the Micro24 Bioreactor system cell cultures are carried out in 

presterilised polycarbonate mammalian cell culture cassettes which are 

inoculated manually in a laminar flow cabinet before sealing with Type A 

single use closures and incubation under experimental conditions. 

Methods: Chemically defined medium and feeds were used throughout 

this work. Unless otherwise stated standard experimental conditions were 

used. (35°C, pH 6.95, 30% Dissolved Oxygen (DO)). Viable cell numbers 

and viability were determined using a ViCell Cell Viability Analyser 

(Beckman Coulter) and antibody titres were determined using an Immage 

Immunochemistry System (Beckman Coulter). 

Process optimisation: Typical process relevant factors that can be tested 

in the Micro24 include feed regime, pH, DO and temperature. The effects 

of these types of factors are best tested using a Design of Experiments 

(DoE) approach to assess the effects not only of different factors but also 

of the interactions between them. Such data can then be used to build 

predictive models of process performance to specify the appropriate 

operating conditions in larger scale bioreactors. We have already 

developed and are using a similar approach for microbial dAb processes. 

The data below shows examples of how we have used this system to 

identify improvements to platform processes for specific cell lines. 

Case Study 1 - process conditions: In this experiment the effects of 

changes to the platform process pH and DO set points on the performance 

of a mAb producing cell line were assessed in the Micro24 using a DoE 

approach with different operating conditions in each well. 

This data demonstrated that although the dissolved oxygen level had 

little effect on viable cell numbers, titres and specific productivity, 

operating at a higher pH than the standard platform set point resulted in 

an increase in titre and in specific productivity. There was no significant 

interaction between the factors. 

Bioreactor validation (1) - 2 litre scale: The high pH process identified 

from the Micro24 was run in 2 litre bioreactors and compared to the 

standard platform process. 

At the high pH set point cell numbers during the later stages of the process 

were slightly reduced compared to the control and as in the Micro24 higher 

titres were produced under higher pH conditions. However, as in the 

Micro24 the greatest effect of increased pH was on specific productivity 

which in the bioreactors was increased by approximately 35% compared to 

the control. 

Bioreactor validation (2) - 50 litre scale: Similar results were achieved at 

the50litrescaleforadifferentcelllinerunninginthesameplatform 

process but producing a different molecule (Figure 1). There was little effect 

on the cell numbers but the higher pH condition resulted in increased titre, 

culture duration, volumetric productivity and specific productivity. 

Case study 2 - feeding regime: The Micro24 can be used to investigate 

the effect of different feeding regimes on culture performance. We have 

already demonstrated that the effect of feed addition on culture 

performance in the Micro24 is similar to that in shake flasks [1]; the data 

below (Table 1) shows that for a chemically defined process multiple feed 

additions have a similar effect in 2 litre bioreactors to the Micro24. In both 

systems the addition of the feed results in significant increases in cell 

numbers and titre. Culture duration is increased and the overall specific 

activity is increased by 63% in the Micro24 and 79% in the bioreactors. 

Discussion: Our previous work has demonstrated how the Micro24 system 

can be used for mammalian cell line selection [1] and the data presented 

here extends the application of the Micro24 into mammalian process 

development. The parallel nature of the Micro24 enables process relevant 

factors to be tested in DoE experiments and these data show that 

improved process conditions such as increased pH and feed additions 

identified in the Micro24 can be used to achieve process improvements in 

bioreactors. 

The validation of the Micro24 results in bioreactors suggests that the 

integration of this technology into mammalian process development could 

reduce significantly the numbers of bioreactors required to achieve process 

improvements which could result in reduced resource requirements and 

improved timelines. 

Reference 

1. Warr S, Patel J, Ho R, Newell K: Use of Micro Bioreactor systems to 

streamline cell line evaluation and upstream process development for 

monoclonal antibody production. BMC Proceedings 2011, 5(Suppl 8):P14. 

P37 

Temperature dependency of immunoglobulin production in novel 

human partner cell line 

Galina Kaseko * , Marjorie Liu, Edwin Hoe, Qiong Li, Mercedes Ballesteros, 

Tohsak Mahaworasilpa 

The Stephen Sanig Research Institute, Sydney, NSW, 2015 Australia 

E-mail: g.kaseko@ssri.org.au 


Introduction: A number of immunoglobulin (Ig) secreting human hybrid 

cell lines were created using one-on-one somatic cell hybridization of a 

rare human tumor infiltrating B lymphocyte and a cell of a novel human 

cell line (WTM), developed in house and described earlier [1]. These hybrid 

cell lines secret various amounts of tumor-derived immunoglobulins (Igs) 

of different specificities. Current investigative efforts are directed towards




Figure 1(abstract P36) Effect of pH on cell line performance in 50 litre bioreactors. 

determining the optimal culture conditions to ensure consistent cell 

growth and long-term stabilities of Ig productions by the hybrids. Based 

on previous literature reports [2,3], we investigated an effect of short- and 

long-term mild hypothermic conditions on Ig production, cell growth and 

cell size. 

Results: Three different hybrid cell lines each representing the highest, 

medium and lowest ranges of Ig productions, were subject to culture 

temperature drops from 37°C to 36°C, 35°C or 34°C for up to 168 hours with 

24-hour data point intervals. In case of prolonged mild hypothermia, the cell 

line with Ig production most susceptible to temperature drops was 

maintained at various temperatures below 37°C (e.g. 36°C, 35°C and 34°C) 

for at least 5 passages with each passage lasting 120 hours and the data 

taken at a 24-hour interval. At each data point for each of the hybrid cell 

lines at a given temperature interval, the sample was collected to determine 

cell concentration, cell size and Ig production. 

Whilst there was no observable effect of any of the short-term temperature 

drops on the cell growth or the cell size in any of the three hybrid cell lines, 

the level of Ig concentration consistently increased in all of them, with gains 

ranging from 67% and 320% and with Ig productivity peaking between 48 

and 72 hours after the exposure to lower temperatures (Figure 1). 

In contrast to short-temperature drop conditions, a prolonged exposure 

to mild hypothermic conditions (longer than 1 passage) led to a 

progressive decrease in cell size over 5 passages. This decrease in the cell 

size was accompanied by gradual 10-30% gains of Ig production with 

each passage after the initial 100 to 150% increase in Ig concentration 

immediately upon transfer to lower temperature (Table 1). When cultured 

at 36°C, it seems to generate the highest increase in Ig production. This 

temperature effect was not noticeable at log phase of cell growth. 

Conclusions: In conclusion, whilst lowering temperature in the culture 

resulted in overall increase in Ig concentration, our results suggest that 

Table 1(abstract P36) Comparison of the effect of feed on cell line key performance parameters in Micro24 and 2 litre 

bioreactors 

Effect of Feed on Key Performance Parameters in Micro 24 and 2 L Bioreactors 

Normalised VCC Normalised Culture Duration Normalised Peak Titre Normalised SPR 

Micro 24 Unfed 100 100 100 100 

Fed 147 113 206 163 

2 L Bioreactors Unfed 100 100 100 100 

Fed 171 133 379 179




Figure 1(abstract P37) Effects of short-term temperature drops 

from 37°C to 36°C and 37°C to 35°C on Ig production by hybrid 

cell line 2. 

Table 1(abstract P37) Effects of prolonged mild 

hypothermia on Ig production by hybrid cell line 2 at 

day 5 of each passage over 5 passages 

Passage 

P0 

(ng/ml) 

P1 

(ng/ml) 

P2 

(ng/ml) 

P3 

(ng/ml) 

P4 

(ng/ml) 

P5 

(ng/ml) 

37°C 342 322 388 356 301 348 

36°C 0 712 758 929 1559 928 

35°C 0 605 452 514 586 716 

34°C 0 751 667 535 490 465 

there might be different mechanisms responsible for the increase in Ig 

productivity in response to short temperature drop and prolonged 

hypothermia. 

Acknowledgements: The project was financially supported in part by 

Anthrocell Pty Limited, an Australian biotechnology company located in 

Sydney, Australia. 

References 

1. Kaseko G, Liu M, Li Q, Mahaworasilpa T: Novel partner cell line for 

immortalisation of rare antigen-specific B cells in mAb development. 

BMC Proceedings 2011, 5(Suppl 8):P130. 

2. Chong SL, Mou DG, Ali AM, Lim SH, Tey BT: Cell growth, cell-cycle 

progress, and antibody production in hybridoma cells cultivated under 

mild hypothermic conditions. Hybridoma 2008, 27:107-111. 

3. Lloyd DR, Holmes P, Jackson LP, Emery N, Al-Rubeai M: Relationship 

between cell size, cell cycle and specific protein productivity. 

Cytotechnology 2000, 34:59-70. 

P38 

Strategies for clone detection, selection and isolation in Per.C6 cells - 

case for Rebmab100 

Fernanda P Yeda 1,2 , Mariana L dos Santos 1,2 , Lilian R Tsuruta 1,2 , 

Bruno B Horta 1,2 , André L Inocencio 1 , Oswaldo K Okamoto 2,3 , Maria C Tuma 2 , 

Ana M Moro 1* 

1 Lab. Biofármacos em Células Animais, Instituto Butantan, SP, 05503-900, Brazil; 

2 Recepta-biopharma, SP, 04533-014, Brazil; 3 Depto. Genética e Biologia Evolutiva, 

Instituto de Biociências, Universidade de São Paulo, SP, 05508-900, Brazil 

E-mail: ana.moro@butantan.gov.br 


Background: A successful monoclonal antibody (mAb) cell line development 

requires efficient clone detection and screening. Cloning by limiting dilution 

(LDC) is the traditional method to isolate mAbs expressing clones [1]. 

Although effective, LDC is time-consuming, with limited workflow and 

therefore a critical step of cell line development. To compare to LDC in terms 

of timelines and productivities for Rebmab100 mAb cell line development we 

have implemented ClonePix FL (CP-FL), an automated system for high 

throughput clone detection. The robotic colony picker has the advantages of 

reducing the process time and increasing the probability to isolate highproducing 

clones. Moreover, we have combined these two approaches with 

high throughput screening assays for early detection of high productive 

clones. 

Rebmab100 mAb targets Lewis-Y, a blood group-related antigen expressed 

in over 70% of epithelial cancers, including breast, colon, ovary and lung 

carcinomas. The murine monoclonal 3S193 was generated in BALB/c mice 

by immunization with Le y -expressing cells from the MCF-7 breast carcinoma 

cell line [2]. The humanized version of anti- Le y 3S193 mAb was obtained by 

CDR-grafting method [3]. The hu3S193 (Rebmab 100) mAb has potent 

immune effector function (ADCC and CDC), is rapidly internalized into Le y 

expressing cancer cells, and has been shown to cause significant regressions 

in xenograft models in preclinical studies, alone or in conjunction with 

isotope and toxins [3,4]. Safety and desirable pharmacokinetic profiles of 

Rebmab100 were demonstrated in a Phase I clinical trial in patients with 

epithelial carcinomas [5] and promising results have been obtained in a 

Phase II clinical trial conducted in Brazil [6]. Very importantly, Rebmab100 

was granted orphan-drug status by the FDA for ovary cancer. Aiming the 

next step of Rebmab100 mAb development we generated a new 

Rebmab100 cell line that shows stability and high productivity allowing its 

scale-up to later clinical trials. 

Materials and methods: Suspension Per.C6® cells (Crucell, Netherlands) 

were transfected with a vector containing the genes coding for heavy and 

light chains of Rebmab100 mAb. After selection by G418 the cells from the 

stable pool were cloned by limiting dilution or plated in semi-solid 

medium (Molecular Devices, USA) for ClonePix FL screening. 

Cellular growth was assessed in plates, 96, 24 or 6-well plates, either by 

CloneSelect Imager (Molecular Devices) or Guava EasyCyte cytometer 

(Merck-Millipore). Antibody titers were measured by Biacore T100 (GE 

Healthcare, Sweden). The selected clones were transferred to T-flasks and 

subsequently to shaker flasks (SF). Clones were analyzed in 50 mL and 200 

mL SF fed-batch processes. The stability study was performed for at least 

50 generations in continuous culture and also starting batch runs with 

cells taken at different generations. 

Results: Generation of Rebmab100 stable pool: The transfection of 

Per.C6® cells with a vector containing the genes coding for heavy and light 

chains of Rebmab100 generated a stable pool through G418 selection. 

Cloning using two different approaches: The stable pool was cloned by 

LDC in liquid medium at 0.5 cell/well in 50 96-well plates, resulting in 261 

colonies transferred to 24-well plates in 3-4 weeks after screening with the 

CloneSelect Imager. Concomitantly the same pool was seeded at different 

concentrations (300 to 2000 cells/mL) in semi-solid medium. The plates 

were screened by light and fluorescence images about ten days after 

seeding. A total of 845 colonies were picked, from which 225 were 

transferred to 24-well plates. At the transference step to 24-well plates, 261 

out of 4800 wells seeded in LDC were transferred while 225 colonies out of 

845 colonies picked by CP-FL, representing 5.4% and 26.6% efficiency, 

respectively. Both approaches followed sequential steps as transfer of the 

clones to 6-well plates, T-flasks and SF, selecting them at each step for cell 

growth and productivity related to cell number. 

Fed-batch experiments and stability study: Thirty-one clones adapted 

to suspension cultures were assessed for productivity in fed-batch 

processes, being 15 originated from LDC and 16 from CP-FL. From the fedbatch 

in 50 mL SF 12 clones presented titers ranging from 1.3 to 3.0 g/L 

(Figure 1A). Out of 31 clones, 10 were selected for long-term stability study 

to determine growth and productivity along the time required for mAb 

production during a manufacturing process. The stability study performed 

with 6 LDC and 4 CP-FL originated clones ruled out 3 of them, two from 

LDC and one from CP-FL. Seven clones showed genetic and cellular 

stability (data not shown), 4 from LDC and 3 from CP-FL and were further 

analyzed in fed-batch in 200 mL SF. In this study we compared titers 

obtained after 2 weeks run for all clones, with results ranging from 0.9 to 

1.8 g/L to the maximum productivity attained by each clone, obtained at 

different lengths of culture (Figure 1B). Taken together the data for cell 

growth, productivity, kinetic and functional assays of the purified 

antibodies (data not shown), mainly the immune-effector activity 

characteristically displayed by Rebmab100, we identified 4 lead clones, the 

first and second originated by CP-FL screening. Final ranking will be 

evaluated after bioreactor runs. 

Conclusions: The CP-FL automated picking has the advantage of being 

less labor-intensive and time-consuming, while allowing the chance of




Figure 1(abstract P38) Antibody titer measured by Biacore in SF fed-batch process (g/L). (A) 31 selected Rebmab100 clones measured on the last 

day of a 50 mL SF fed-batch culture. (B) Maximum (grey bars) and 2 weeks (black bars) mAb productivity obtained in a 200 mL SF fed-batch culture for 

the 7 stable Rebmab100 clones. The number above the grey bars indicates the day when maximum mAb productivity occurred. 

picking clones that would not grow isolated in LDC. Both CP-FL and LDC 

procedures proved efficient for generating high productive and stable 

cell clones. Overall productivity for individual clones depends on specific 

productivity, cell density and viability along time, allowing accumulation 

of the antibody. CP-FL clones reached maximum productivity at an earlier 

stage (2 weeks) of the 200 mL SF fed-batch experiment, which represents 

an advantage during the manufacturing process. 

The 4 lead clones will be submitted to bioreactor runs to evaluate the 

most suitable clone for the Rebmab100 mAb to be used in clinical trials 

and eventually to go under production. 

Acknowledgements: We acknowledge the excellent technical support of 

Denis N Aranha and José M Oliveira. WearegratefultoDr.MariaTA 

Rodrigues for logistics support. This work was supported by FAPESP, FINEP, 

CNPq, Fundação Butantan, and Recepta-biopharma. 

References 

1. Browne SM, Al-Rubeai M: Selection methods for high-producing 

mammalian cell lines. Trends Biotechnol 2007, 25:425-432. 

2. Kitamura K, Stockert E, Garin-Chesa P, Welt S, Lloyd KO, Armour KL, 

Wallace TP, Harris WJ, Carr FJ, Old LJ: Specificity analysis of blood group 

Lewis-y (Le(y)) antibodies generated against synthetic and natural Le(y) 

determinants. Proc Natl Acad Sci USA 1994, 91:12957-12961. 

3. Scott AM, Geleick D, Rubira M, Clarke K, Nice EC, Smyth FE, Richards EC, 

Carr FJ, Harris WJ, Armour KL, Rood J. Kypridis A, Kronina V, Murphy R, 

Lee FT, Liu Z, Kitamura K, Ritter G, Laughton K, Hoffman E, Burgess AW, 

Old LJ: Construction, production, and characterization of humanized 

anti-Lewis Y monoclonal antibody 3S193 for targeted immunotherapy of 

solid tumors. Cancer Res 2000, 60:3254-3261. 

4. Kelly MP, Lee FT, Smyth FE, Brechbiel MW, Scott AM: Enhanced efficacy of 

90Y-radiolabeled anti-Lewis Y humanized monoclonal antibody hu3S193 

and paclitaxel combined-modality radioimmunotherapy in a breast 

cancer model. J Nucl Med 2006, 47:716-725. 

5. Scott AM, Tebbutt N, Lee FT, Cavicchiolo T, Liu Z, Gill S, Poon AM, Hopkins W, 

Smyth FE, Murone G, MacGregor D, Papenfuss AT, Chappell B, Saunder TH, 

Brechbiel MW, Davis ID, Murphy R, Chong G, Hoffman EW, Old LJ: A phase I 

biodistribution and pharmacokinetic trial of humanized monoclonal 

antibody Hu3s193 in patients with advanced epithelial cancers that 

express the Lewis-Y antigen. Clin Cancer Res 2007, 13:3286-3292. 

6. Smaletz O, Diz MPD, Carmo CC, Sabbaga J, Cunha GF, Azevedo SJ, 

Maluf FC, Barrios CH, Costa RL, Fontana AG, Alves VA, Moro AM, Scott EW, 

Hoffman EW, Old LJ: Anti-LeY monoclonal antibody (mAb) hu3S193 

(Rebmab100) in patients with advanced platinum resistant/refractory 

(PRR) ovarian cancer (OC), primary peritoneal cancer (PPC), or fallopian 

tube cancer (FTC). ASCO Annual Meeting, 2011, Chicago. J Clin Oncol 2011, 

29:5078. 

P39 

Impact of single-use technology on continuous bioprocessing 

William G Whitford * , Brandon L Pence 

Thermo Fisher Scientific, 925 West 1800 South, Logan, Utah 84321, USA 

E-mail: bill.whitford@thermofisher.com 


Background: Single-use (SU) technologies supply a number of values to 

any mode of bioprocessing, but can provide some specific and enabling 

features in continuous bioprocessing (CB) implementations [1-3]. Most 

every operation in a CB process train is now supported by a commercially 

available single-use, or at least hybrid, solution (Figure 1). First of all, 

many of the SU equipment and solutions being developed for batch 

bioproduction have the same or related application in CB systems. 

Examples here include simple equipment such as tubings and connectors, 

to more complex applications such as the cryopreservation of large 

working stock aliquots in flexible bioprocess containers (BPCs). The list of 

CB-supporting SU technologies being developed is large and growing. 

Results: A SU advantage in process development is its supports of an 

open architecture approach and a number of hybrid designs. Such designs 

include combining reusable and single-use systems, or between divergent 

suppliers of particular equipment. Especially in bioproduction, the many 

flexibilities of SU support a manufacturing platform of exceptional 

efficiency, adaptability, and operational ease. Advances designs in SU 

transfer tubing, manifold design and container porting also supports 

creativity in process design. This is of particular value in designing a 

process with such demands as entirely new flow paths or lot designations, 

such for CB. 

SU systems upstream provide a reduced footprint and eliminate of the need 

for cleaning and sterilization service. This complements perfusion culture’s 

inherently smaller size and independence from cleaning for extended 

periods of time.




Figure 1(abstract P39) Hybrid intensified perfusion-based continuous bioproduction in a Thermo Scientific HyPerforma S.U.B. TK 250L supported 

by yhe Refine Technology ATF System. 

Several newer approaches to formulating process fluids support the concept 

of CB. Single-use mixing systems are typically constructed of a rigid 

containment system with a motor and controls driving radiation-sterilized 

single-use bags equipped with disposable impeller assemblies. From a 

variety of manufacturers there are a number of distinct approaches to 

motor/disposable impeller assembly linkages, tubing lines and connections. 

Also appearing are a number of exciting SU sampling, sensing, and 

monitoring solutions. Single-use powder containers permit seamless transfer 

between powder and liquid formulation steps, and the ridged mixing 

containers are available in jacketed stainless steel for heating and cooling 

requirements. Surprisingly, the “topping-up” of large-scale single-use fluid 

containers with newly prepared buffer to provide a virtually unlimited and 

constant supply of each buffer/media type can be validated for GMP 

manufacturing procedures. 

Process flexibility is a key feature in both SU and CB. CB contributes to 

overall process flexibility in that equipment tends to be easy to clean, 

inspect and maintain − and generally promotes simple and rapid product 

changeover. SU systems can provide similar flexibility and ease product 

changeover because they tend to be more modular and transportable 

than much of the older batch equipment. In fact the size, configuration 

and reduced service requirements of SU systems actually encourage 

diversity of physical location within a suite or plant, as well as re-location 

to other manufacturing sites. 

Due to its inherent demand for immediate process data and control 

capabilities, CB supports initiatives in continuous quality verification (CQV), 

continuous process verification (CPV), and real-time release (RTR). Although 

CB will not be feasible for all products and processes, many implementations 

well-support a “platform” approach, in which a single process 

supports more than one product. CB most always shortens the process 

stream, reduces downtime, and greatly reduces handling of intermediates. 

These features complement the operational efficiencies of SU systems, 

contributing to a greatly reduced cumulative processing time for the API. 

Furthermore, they greatly simplify production trains and inherently facilitate 

application of closed processing approaches to individual operations and 

even processes. Especially in bioproduction, the modularity and integral 

gamma irradiation sterility of SU combined with the sustained operation of 

CB promise the appearance of platforms of unparalleled operational 

simplicity and convenience. 

The heart of a CB approach is the bioreactor. Perfusion bioreactors have 

been successfully employed in bioproduction, even biopharmaceutical 

production, for decades. And, rather remarkably, disposable bioreactors 

have been available for nearly 20 years. At the research scale there have 

even been single-use hollow fiber perfusion bioreactors available from a 

variety of vendors for over 40 years. However, only recently have 

commercially available SU and hybrid production-scale perfusion-capable 

equipment become available. 

The production-scale CB enabling SU bioreactor technologies now 

becoming commercial available include single-use and hybrid perfusioncapable 

reactors (Figure 1); a growing variety of SU and hybrid monitoring 

probes and sensors; SU pumps and fluid delivery automation of various 

design; and automated SU online sampling, interface, valving and feeding 

technologies. Their coordinated implementation in actual production 

settings with appropriate control is now beginning. 

Justified or not, concerns in the implementation of CB include performance 

reliability (incidence of failure), validation complexity, process control and 

economic justification. But for many processes, such previous limitations – 

or their perception – are being alleviated by advances in CB processing 

technology and OpEx driven advances bioprocess understanding, reactor 

monitoring and feedback control. However, while some CB attributes 

inherently provide immediate advantages (such as reduces reactor




residency time) others do present challenges (such as cell-line stability 

concerns). 

Due to the limited contribution of API manufacturing to small-molecule 

pharmaceutical cost, the limited bottom-line financial savings of CB has 

been a concern. However, biopharma is a different animal in general, and 

as such trends as globalization and biosimilars alter the picture even 

further, the financial benefits of CB are becoming even stronger. 

The fact that many SU systems are constructed of standards compliant and 

animal product-free materials supports CB applications in a wide variety of 

product types and classification. In fact, SU systems are available to most 

any process format (eg, microcarriers and suspension), platform (eg, cell 

line, vectors, culture media), mode (eg, dialysis or enhanced perfusion) or 

scale (eg, through rapid, inexpensive scale-out). “Futureproofing”, or 

supporting the sustainability of a new CB process in the face of product 

lifecycle or emerging technology imperative, is supported by many SU 

features. Examples here include SUs low initial facility, service and 

equipment cost and especially SU’s undedicated manufacturing suits and 

ease of process train reconfiguration. 

Conclusion: As advanced single-use solutions are applied to single-use 

perfusion mode-capable reactors, the design of integrated closed, 

disposable and continuous upstream bioproduction systems are finally 

being realized. 

References 

1. Whitford WG: Supporting continuous processing with advanced singleuse 

technologies. BioProcess International 2013, 11:46-52. 

2. Whitford WG: Continued progress in continuous processing for 

bioproduction. Life Science Leader 2012, June:62-64. 

3. Whitford WG: Single-use systems support continuous processing in 

bioproduction. PharmaBioWorld 2012, 10:22-27. 

P40 

Comparison of BHK-21 cell growth on microcarriers vs in suspension at 

2L scale both in conventional bioreactor and single-use bioreactor 

(Univessel® SU) 

Lídia Garcia * , Elisenda Viaplana, Alicia Urniza 

Zoetis Manufacturung & Research Spain, S.L Pfizer Olot S.L.U., Ctra. 

Camprodon s/n, La Riba, 17813 Vall de Bianya (Girona), Spain 

E-mail: Lidia.garcia@zoetis.com 


Background: BHK-21 cells are the most commonly used cells for vaccine 

production. Not all cell lines can be adapted to suspension growth. In 

general, anchorage-dependent cells (must be attached to a substrate to 

grow) will grow in suspension only with the use of microcarrier beads. 

However, some cell lines such as the BHK-21 can be adapted to grow in 

suspension. 

In recent years, the use of disposables in the pharmaceutical industry has 

increased extensively. The aim of this study is to evaluate the influence of 

a single use bioreactor on the final cell production of BHK-21 cells when 

they are growing with microcarriers or in suspension which can do an 

impact on the final product quality. 

Cultivations on conventional 2L-bioreactors were compared with results 

obtained from 2L single use bioreactor (UniVessel® SU). 

Materials and methods: Cell line: Two BHK-21 cell lines were used, BHK- 

21 clone C3 as an anchorage-dependent cell line and SBHK cells adapted 

to grow in suspension. 

Both cell lines were cultivated in MEM Glasgow medium supplemented 

with fetal bovine. 

BHK-21 cells were grown in microcarriers Cytodex-3. 

Cultivation system: The growth using two different bioreactors was 

analyzed: Conventional reusable bioreactor (Autoclaving glass vessel of 2L) 

and the UniVessel® SU as a single use bioreactor 

To control both bioreactors the BIOSTAT® B plus unit was used. 

Parameters as pH, temperature, stirring speed, aeration rate and viable 

cell number were analyzed. 

Cell growth was conducted at the optimal conditions determined previously 

on spinner flasks. Cells were seeded into the bioreactor at the following 

concentration: 

BHK-21: 5 × 10 5 cells/ml with a viability of ≥ 98% 

SBHK: 3 × 10 5 cells/ml with a viability of ≥ 97% 

Cell count: BHK-21 were counted using the crystal violet dye nucleus 

staining method. 

SBHK cells were counted using the NucleoCounter (ChemoMetec A/S). 

Results: Optimization, characterization of BHK cells culture processes and 

evaluation of microcarriers vs non-microcarrier processes at 2L scale were 

done. 

Processperformancewascomparedinconventionalglassvesselsto 

single use bioreactors. 

In Table 1 values of viability and final cell density are shown in single-use 

and conventional bioreactors (3 batches per bioreactor). The results 

obtained demonstrated that at 3 days of culture no significant differences 

were found using both bioreactors. 

BHK-21 attached and grew efficiently on microcarriers. Fully confluency 

and a maximum viable cell density (between 1.2 to 2.9 × 10 6 cells/ml) 

was obtained after 3 days of culture (Table 1, Figure 1). In all the cases, 

the viability was higher than 96.5%. 

SBHK cells reached higher yields comparing with the BHK-21. The 

maximum viable cell density (> 90% of viability) was obtained at 3 days 

of culture reaching a cell concentration between 1.95 to 3.5 × 10 6 cells/ml 

(Table 1, Figure 1). 

The variability on final cell density obtained between the different 

batches was similar in both types of bioreactors (Table 1). 

Conclusions: ✓ Comparable results between conventional glass vessels 

and single use bioreactors: cell density and viability. 

✓ Given the good results obtained with SBHK cells, elimination of 

microcarriers can decrease the cost of a large-scale operation. 

✓ The feasibility of transferring the BHK cells growth from a 

conventional bioreactor to single-use bioreactor has been 

demonstrated. 

✓ Benefits of single-use technology integration: 

• SU Bioreactors can replace conventional bioreactors without 

loss of process efficiency 

• The scale-up for both suspension and attached cell lines in SU 

bioreactors is guarantee. The flexibility and easy of use of this 

SU bioreactors enable rapid scale-up without any loss in 

product quality 

• SU Bioreactors increase easy of handling and offer advantages 

in the areas of cleaning, sterilization, validation, set-up, and 

turn-around time between runs. 

• SU Bioreactors are the best solution when containment is 

required (BL-3 and BL-4 laboratories). 

P41 

Size-dependent antioxidative activity of platinum nanoparticles 

Hidekazu Nakanishi 1* , Takeki Hamasaki 2 , Tomoya Kinjo 1 , Kiichiro Teruya 1,2 , 

Shigeru Kabayama 3 , Sanetaka Shirahata 1,2 

1 Division of Life Engineering, Graduate School of Systems Life Sciences, 

Kyushu University, Fukuoka 812-0053, Japan; 

2 Department of Bioscience and 

Biotechnology, Faculty of Agriculture, Kyushu University, Fukuoka 812-0053, 

Japan; 

3 Nihon Trim Co. Ltd, Osaka 531-0076, Japan 


Background: So far, most of studies on nanometer-sized metal particles 

have focused on biological safety and potential hazards. However, antioxidative 

activity of noble metal nanoparticles (NPs) attracts much 

attention, recently. Platinum nanoparticles (Pt NPs) are one of the most 

important noble metals in nanotechnology because Pt NPs have negative 

surface potential from negative charges and are stably suspended from 

an electric repulsion between the same charged particles [1]. We 

previously reported that Pt NPs of 2-3 nm sizes scavenged reactive 

oxygen species (ROS) such as superoxide anion radical, hydrogen 

peroxide and hydroxyl radical in vitro [2]. Here, we report the cytotoxicity 

and size-dependent antioxidative activity of Pt NPs on rat skeletal muscle 

cell line, L6. 

Materials and methods: Pt NPs were synthesized by a modified citrate 

reduction method of Hydrogen hexachloroplatinate (IV). Particle size and 

concentrations of Pt NPs were determined by a transmittance electron 

microscope (TEM) and ICP-MS, respectively. To find the toxic effect of Pt 

NPs rat myoblast L6 cells were pre-cultured for 24 hours in culture medium 

with a 10 -3 to 10 mg/l of Pt NPs and cell viability was determined by WST-1




Table 1(abstract P40) Cell growth and viability at 3 days culture in a 2L conventional bioreactor and in a single use 

bioreactor 

Univessel SU (2L) 

Conventional Bioreactor (2L) 

BHK-21 SBHK BHK-21 SBHK 

Batch 

Viable Cells 

(cells/ml) 

Viability (%) 

Viable Cells 

(cells/ml) 

Viability (%) 

Viable Cells 

(cells/ml) 

Viability (%) Viable Cells 

(cells/ml) 

1 2.90 × 106 97 2.70 × 106 99.1 2.46 × 106 99 1.96 × 106 92.1 

2 1.20 × 106 96.5 1.95 × 106 90.5 1.80 × 106 98.9 2.36 × 106 98 

3 2.10 × 106 98 3.0 × 106 97 1.90 × 106 98.1 3.50 × 106 99.4 

Mean valors 2.08 × 10 6 97.5 2.55 × 10 6 97 2.05 × 10 6 99 2.61 × 10 6 99.4 

Viability (%) 

assay. To investigate the anti-oxidative effect of Pt NPs on L6 cells, the 

relative amount of intracellular H 2 O 2 was measured with a Bes-H 2 O 2 -AC 

florescent probe, which is designed to detect intracellular H 2 O 2 specifically 

[3]. The intracellular ROS levels when treated with 1 mg/l of Pt NPs for 

2 hours were measured using IN Cell Analyzer 1000. 

Results and conclusions: The particle sizes we synthesized were 

determined to 1-2 nm, 2-3 nm and 4 nm respectively (data not shown). 

Cytotoxicity of Pt NPs of these sizes was not observed at a concentration 

below 10 mg/l (data not shown). Intracellular ROS levels are thought to 

result from a primary response to internalized NPs leading to decreased cell 

viability [4]. Thus, the suppression of excess ROS is of prime importance for 

cell survival. The intracellular ROS levels were decreased significantly by the 

whole sizes of Pt NPs treatment and 2-3 nm of Pt NPs scavenged the ROS 

most efficiently (Figure 1). The relative fluorescence level treated with 2-3 

nm of Pt NPs decreased significantly to about 60% (*** P < 0.001) compared 

with that of non-treated cells. Smaller NPs should be more taken up by the 

cells efficiently and might more scavenge ROS effectively [5]. However, the 

Pt NPs of 1-2 nm less scavenged the intracellular ROS than that of 2-3 nm. 

The one reason might be that 1-2 nm of Pt NPs is rather too small to 

activate intracellular anti-oxidant defense pathways than 2-3 nm of Pt NPs 

because of their less cytotoxicity. However, we have no data to show. 

Therefore, we have to make more effort to investigate the relationship 

between the sizes of Pt NPs and ROS scavenging activity. 

Our results suggest Pt NPs of 2-3 nm sizes have no cytotoxity below 10 mg/l 

and are useful materials to scavenge ROS. In this regard Pt NPs are 

expected as redox regulation factors for suppression of various ROSrelated 

diseases. 

References 

1. Aiuchi T, Nakajo S, Nakaya K: Reducing activity of colloidal platinum 

nanoparticles for hydrogen peroxide, 2,2-diphenyl-1-picrylhydrazyl 

radical and 2,6-dichlorophenol indophenol. Biol Pharm Bull 2004, 

27:736-738. 

2. Hamasaki T, Kashiwagi T, Imada T, Nakamichi N, Aramaki S, Toh K, 

Morisawa S, Shimakoshi H, Hisaeda Y, Shirahata S: Kinetic analysis of 

superoxide anion radical-scavenging and hydroxyl radical-scavenging 

activities of platinum nanoparticles. Langmuir 2008, 24:7354-7364. 

3. Maeda H, Fukuyasu Y, Yoshida S, Fukuda K, Saeki K, Matsuno H, Yamauchi Y, 

Yoshida K, Hirata K, Miyamoto K: Fluorescent probes for hydrogen 

peroxide based on a non-oxidative mechanism. Angew Chem Int Ed Engl 

2004, 43:2389-2391. 

4. Long TC, Tajuba J, Sama P, Saleh N, Swartz C, Parker J, Hester S, Lowry GV, 

Veronesi B: Nanosize titanium dioxide stimulates reactive oxygen species 

in brain microglia and damages neurons in vitro. Environ Health Perspect 

2007, 115:1631-1637. 

5. Hirn S, Semmler-Behnke M, Schleh C, Wenk A, Lipka J, Schäffler M, 

Takenaka S, Möller W, Schmid G, Simon U, Kreyling WG: Particle sizedependent 

and surface charge-dependent biodistribution of gold 

nanoparticles after intravenous administration. Eur J Pharm Biopharm 

2011, 77:407-416. 

P42 

Sampling and quenching of CHO suspension cells for the analysis of 

intracellular metabolites 

Judith Wahrheit * , Elmar Heinzle 

Biochemical Engineering Institute, Saarland University, D-66123 Saarbrücken, 

Germany 

E-mail: j.wahrheit@mx.uni-saarland.de 


Background: Metabolic studies are of fundamental importance in 

metabolic engineering approaches to understand cell physiology and to 

pinpoint metabolic targets for process optimization. Knowledge on 

intracellular metabolites, in particular in combination with powerful dynamic 

metabolic flux analysis methods will substantially expand our basic 

understanding on metabolism, e.g. about metabolic compartmentation [1]. 

Few protocols for quantitative analysis of intracellular metabolites in 

mammalian suspension cells have been proposed in the literature. However, 

due to limited validation of sampling and quenching procedures provided 

in previous publications, we thoroughly investigated the associated critical 

issues, such as (a) cellular integrity, (b) quenching efficiency, (c) cell 

separation at different centrifugation conditions and its influence on cell 

fitness, and (d) different washing procedures to prevent carryover of 

extracellular metabolites. Many metabolites of interest are also contained in 

the medium in large amounts, e.g. amino acids, making their intracellular 

quantification critical. 

Materials and methods: Cell cultivation: Two CHO cell lines were used, 

T-CHO ATIII cells (GBF, Braunschweig, Germany) cultivated in serum-free 

CHO-S-SFM II medium (GIBCO, Invitrogen, Karlsruhe, Germany) and CHO 

Figure 1(abstract P40) Comparison of cell growth and viability at 3 days culture in a 2L conventional bioreactor and in a single use bioreactor.




Figure 1(abstract P41) The scavenging effect of several sized Pt NPs on intracellular hydrogen peroxide in L6 cells. Asterisks donate significant 

difference from the untreated control cells. (***P < 0.001). 

K1 cells (University of Bielefeld, Germany) cultivated in amino acid rich 

TC-42 medium (TeutoCell, Bielefeld, Germany) in baffled shake flasks in a 

shaking incubator. Cell counting and determination of cell diameters 

were performed using an automated cell counter (Invitrogen, Darmstadt, 

Germany). Cell viability was verified using the trypan blue exclusion 

method.Cellrecoverywasdefinedas(totalviablecellnumberafter 

quenching)×100/(total viable cell number in initial sample). 

Determination of the energy charge: ATP, ADP, and AMP were analyzed 

in a luminometer (Promega, Mannheim, Germany) using the CellTiter-Glo, 

the ADP-Glo Kinase, and the AMP-Glo assays (Promega, Mannheim, 

Germany), respectively. For the ADP- and AMP-Glo assays, cells were lysed 

using the CelLytic M reagent (Sigma-Aldrich, Germany) before adding the 

assay reagents. The energy charge value was calculated as ([ATP] + ½ × 

[ADP])/([ATP] + [ADP] + [AMP]). 

Evaluation of different washing procedures and carryover of media 

components: Carryover of extracellular metabolites from the culture 

medium was investigated without washing and after applying different 

washing procedures. Cell pellets were either resuspended in 50 ml 

quenching solution or rinsed once or twice with 50 ml quenching solution 

without re-suspension. After another centrifugation step and re-suspension 

in a small volume PBS, cell numbers were determined and extracellular 

metabolite amounts analyzed via HPLC as described previously [2] and 

related to the initial sample. 

Final protocol: (1) Precooling of 45 ml and 50 ml 0.9% saline quenching 

solution in an ice-water bath to 0°C for at least 1 hour. (2) Adding of 5 ml 

cell suspension to 45 ml 0.9% quenching solution and immediate mixing 

by inverting the tube. (3) Centrifugation at 2000 × g in a precooled 

centrifuge at 0°C for 1 min. (4) Careful decanting of the supernatant 

followed immediately by suction of residual liquid using a vacuum pump 

without touching the cell pellet. (5) Washing once by careful pouring of 

50 ml precooled QS 50 ml on top of the cell pellet without resuspending 

the cells followed by repetition of steps (3) and (4). (6a) Immediate 

freezing by placing the tube in liquid nitrogen or (6b) determination of 

cell recovery. 

Results: Ice-cold 0.9% saline is a suitable quenching solution maintaining 

cellular integrity as reported previously [3]. However, longer incubation 

times at 0°C reduce cellular viability and should be avoided. The time from 

taking the sample (final protocol, step 2) to freezing the cell pellet in liquid 

nitrogen (final protocol, step 6a) is critical and should be kept to a minimum. 

A rapid temperature shift and in addition a significant dilution of extracellular 

metabolites was achieved using a nine-fold excess of quenching 

solution. Efficient inactivation of metabolism was proven by a high and 

representative energy charge value of 0.82 (± 0.01, n =3). 

Separation of cells via centrifugation was incomplete due to required short 

centrifugal times. Thus, it is necessary to determine the cell recovery after 

quenching. However, from the average cell size estimation we conclude that 

centrifugation at short times provides a representative sample, although 

sampling was incomplete. Centrifugation time and speed, total volume and 

even the initial cell density in the cell suspension have an impact on the cell 

recovery after quenching. Centrifugation at 1000 × g and 2000 × g did not 

affect cell integrity. Higher centrifugal accelerations (3000 × g, 4000 × g) 

reduce cell viability. Above 2000 × g no further improvement in the cell 

recovery was obtained. Thus, centrifugation should be limited to 2000 × g to 

prevent unnecessary stress to the cells. Due to highly reproducible 

centrifugation, the cell recovery can be determined from a biological replicate 

(final protocol, step 6b). 

Washing steps further reduce cell recovery. Rinsing the cell pellet affects cell 

recovery only little and much less than resuspending the cell pellet. Cell 

integrity was not impaired by different washing procedures. Reducing the 

carryover of metabolites contained in the medium is a prerequisite for their 

intracellular analysis. Using a nine-fold excess of quenching solution, 

contamination with medium components was very low (less than 0.3% of 

the initial metabolite amount was found for glucose, lactate, pyruvate, citrate, 

and all proteinogenic amino acids). Rinsing the cell pellet without resuspending 

the cells further reduces the carryover of medium components 

efficiently. However, washing cannot completely prevent medium carryover. 

Washing by resuspending does not remove more metabolites than rinsing 

and should be avoided due to substantially reduced cell recovery.




Conclusions: Ice-cold 0.9% saline was shown to be a suitable quenching 

solution maintaining cellular integrity. A rapid temperature shift was 

achieved using a nine-fold excess of quenching solution resulting in 

efficient inactivation of metabolism. The applied conditions result in a very 

low level of medium contamination. Rinsing the cell pellet without 

re-suspending the cells reduced medium carryover effectively. Separation 

of cells via centrifugation was incomplete due to required short centrifugal 

times. Thus, it is necessary to determine the cell recovery after quenching. 

References 

1. Wahrheit J, Nicolae A, Heinzle E: Eukaryotic metabolism: measuring 

compartment fluxes. Biotechnol J 2011, 6:1071-1085. 

2. Strigun A, Wahrheit J, Beckers S, Heinzle E, Noor F: Metabolic profiling 

using HPLC allows classification of drugs according to their mechanisms 

of action in HL-1 cardiomyocytes. Toxicol Appl Pharmacol 2011, 

252:183-191. 

3. Dietmair S, Timmins NE, Gray PP, Nielsen LK, Krömer JO: Towards 

quantitative metabolomics of mammalian cells: Development of a 

metabolite extraction protocol. Anal Biochem 2010, 404:155-164. 

P43 

13 C labeling dynamics of intra- and extracellular metabolites in CHO 

suspension cells 

Judith Wahrheit * , Averina Nicolae, Elmar Heinzle 


Germany 



Background: Isotope labeling techniques have become a most valuable 

tool in metabolomics and fluxomics [1]. In particular the dynamics of label 

incorporation provide rich information about metabolism. A thorough 

understanding of CHO metabolism is crucial for metabolic engineering and 

process optimization. 

Materials and methods: Experimental set-up: CHO-K1 cells were 

cultivated in protein free TC-42 medium (TeutoCell, Bielefeld, Germany) in 

250 ml baffled shake flasks. For the non-stationary experiment the cultures 

were inoculated at a start cell density of 2 × 10 6 cells/ml in a start volume 

of 120 ml. Four parallel cultivations were performed, two with 100% 

[U- 13 C 6 ]glucose and two with 100% [U- 13 C 5 ]glutamine, respectively. 

Extracellular samples were taken from all four cultivations every 6 h for cell 

counting and determination of extracellular metabolite concentrations and 

extracellular labeling dynamics. Intracellular samples were taken alternately 

from the two replicates. After 2 min, 10 min, 20 min, 30 min, 60 min, 2 h, 

4 h, 6 h, 12 h, 18 h, 24 h, 30 h, 36 h, and 48 h, a sample of 5 ml cell 

suspension was quenched in 45 ml ice-cold 0.9% sodium chloride solution, 

centrifuged for 1 min at 2000 × g, washed once by rinsing the cell pellet 

with 50 ml ice-cold 0.9% sodium chloride solution, and frozen in liquid 

nitrogen. Intracellular metabolites were extracted in methanol and water 

by repeated freeze-thaw cycles, as described previously [2]. Extracts were 

dried in a centrifugal evaporator. 

Analytics: Cell counting and viability determination was carried out using 

an automated cell counter (Invitrogen, Darmstadt, Germany). Quantification 

of extracellular glucose, organic acids and amino acids via HPLC was carried 

out as described recently [3]. For determination of extracellular labeling 

dynamics, lyophilized supernatants were resolved in dimethylformamid 

(0.1% pyridine) and derivatized with MBDSTFA (Macherey-Nagel, Düren, 

Deutschland). Dried cell extracts were resolved in pyridine (20 mg/ml 

methoxylamine) and derivatized with MSTFA (Macherey-Nagel, Düren, 

Deutschland). Samples were analyzed by GC-MS. Unique fragments 

containing the whole carbon backbone were chosen for excreted 

extracellular metabolites and selected intracellular metabolites of the central 

metabolism. 

Results: We observed a monotonic cultivation profile during short-term 

cultivation for 48 h. Metabolic steady state was confirmed by exponential 

growth and constant metabolite yields. The two tracers, glucose and 

glutamine, were the major carbon sources. Lactate, alanine, glycine, and 

glutamate were excreted, all other metabolites were consumed. Although 

serine, aspartate, and glutamine were only consumed, we found significant 

extracellular labeling of these metabolites indicating simultaneous 

consumption and excretion. 

Label incorporation into intracellular pyruvate and lactate was very fast on 

[U- 13 C 6 ]glucose (mainly m3). Isotopic steady state in extracellular lactate 

was reached after 12 h. Labeling in pyruvate and lactate was also found 

using [U- 13 C 5 ]glutamine as tracer (mainly m1) indicating a significant reflux 

from TCA cycle via anaplerotic reactions. Label incorporation into alanine 

was slower than for pyruvate and lactate and had a different labeling 

pattern. A significantly higher m2 fraction on labeled glucose indicates 

synthesis after pyruvate has entered the mitochondria. Significant labeling 

of serine and glycine was found on labeled glucose but not on labeled 

glutamine indicating the absence of gluconeogenesis. 

Label incorporation into TCA cycle metabolites was fast on both tracers 

approaching steady state in citrate within 6 h of cultivation. Nearly 

identical labeling patterns were found for fumarate, malate and aspartate 

indicating a tight connection between these metabolite pools. After 24 h a 

metabolic shift takes place. Glutamine was synthesized in significant 

amounts. Labeling in TCA cycle metabolites decreased and labeling in 

pyruvate, lactate, and alanine further increased. 

Conclusions: We present the very first study of 13 Clabelingdynamicsin 

CHO suspension cells. We were able to capture labeling dynamics in 

excreted extracellular metabolites as well as in intracellular organic acids 

and amino acids providing a representative overview of the central 

metabolism in CHO cells. Furthermore, we could draw some first 

qualitative conclusions. These transient labeling data is currently used in a 

non-stationary 13 C metabolic flux analysis in order to obtain an in-depth 

understanding of CHO central metabolism, e.g. about reversibilities and 

the connection between glycolysis and TCA cycle. 

References 

1. Klein S, Heinzle E: Isotope labeling experiments in metabolomics and 

fluxomics. Wiley Interdiscip Rev Syst Biol Med 2012, 4:261-272. 

2. Sellick CA, Hansen R, Stephens GM, Goodacre R, Dickson AJ: Metabolite 

extraction from suspension-cultured mammalian cells for global 

metabolite profiling. Nat Protocols 2011, 6:1241-1249. 

3. Strigun A, Wahrheit J, Beckers S, Heinzle E, Noor F: Metabolic profiling 

using HPLC allows classification of drugs according to their mechanisms 

of action in HL-1 cardiomyocytes. Toxicol Appl Pharmacol 2011, 

252:183-191. 

P44 

Investigation of glutamine metabolism in CHO cells by dynamic 

metabolic flux analysis 

Judith Wahrheit * , Averina Nicolae, Elmar Heinzle 


Germany 



Background: Glutamine metabolism represents one of the major targets in 

metabolic engineering and process optimization due to its importance as 

cellular energy, carbon and nitrogen source. Metabolic flux analysis 

represents a powerful method to investigate the physiology and 

metabolism of cells [1]. Classical metabolic flux analysis methods require 

steady state conditions. However, industrially relevant cultivation conditions, 

i.e. batch and fed-batch cultivations, are characterized by changing 

environmental conditions and metabolic shifts [2]. We used dynamic 

metabolic flux analysis to study the impact of glutamine availability or 

limitation on the physiology of CHO K1 cells capturing metabolic dynamics 

during batch- and fed-batch cultivations. 

Materials and methods: Cell cultivation: CHO-K1 cells were cultivated in 

protein free TC-42 medium (TeutoCell, Bielefeld, Germany) in 50 ml filtertube 

bioreactors (TPP, Trasadingen, Switzerland) at a start cell density of 2 × 

10 5 cells/ml and a start volume of 20 ml. Cell counting and viability 

determination was carried out using an automated cell counter (Invitrogen, 

Darmstadt, Germany). Quantification of glucose, organic acids and amino 

acids via HPLC was carried out as described recently [3]. Ammonia was 

quantified using an ammonia assay kit (Sigma-Aldrich, Steinheim, Germany) 

in 96-well plates. Six different batch cultivations with 0 mM, 1 mM, 2 mM, 

4 mM, 6 mM or 8 mM glutamine start concentration and two different fedbatch 

cultivations starting at 1 mM glutamine and feeding 1 mM every 24 h 

or starting at 2 mM and feeding 2 mM every 48 h were performed. 

Metabolic flux analysis: Splines were fitted to the cell density and the 

extracellular metabolite profile using the SLM curve fitting tool in Matlab




2012b (The Mathworks, Natick, MA, USA). Using a stoichiometric model of 

the CHO metabolism the intracellular fluxes were calculated by flux 

balancing. 

Results: Glutamine has an initial growth stimulating effect. With increasing 

glutamine concentration, the specific growth rate was initially higher but 

dropped earlier. However, increased accumulation of waste products at high 

glutamine levels, e.g. ammonia, inhibited growth later on and decreased 

culture longevity. The highest viable cell densities were reached in the 

1 mM glutamine batch and 8 × 1 mM glutamine fed-batch cultivations. 

Substantial dose-dependent flux rearrangements were observed for 

different glutamine availabilities. Initially, no significant impact on the 

glycolytic fluxes and lactate excretion was found. In later phases, glycolytic 

and lactate excretion rates were higher in the glutamine free cultivation. 

Waste product excretion of ammonia, alanine and glutamate increased 

with increasing glutamine concentration. The highest glutamate excretion 

was, however, found in the glutamine free cultivation. Uptake of pyruvate 

and serine as well as their importance as substrates increased with 

decreasing glutamine concentration and were highest under glutamine 

free conditions. This was accompanied by increasing excretion rates 

for glycine. At high glutamine concentrations, glutamate is converted to 

a-ketoglutarate feeding TCA cycle fluxes from a-ketoglutarate to 

oxaloacetate. However, due to an increased flux from oxaloacetate to 

phosphoenol pyruvate, fluxes from oxaloacetate to a-ketoglutarate were 

only significantly increased at 8 mM glutamine, but not at lower glutamine 

levels. The flux from oxaloacetate to phosphoenol pyruvate was reversed 

(phosphoenol pyruvate to oxaloacetate) at glutamine free conditions, 

resultinginanapleroticfeedingofcarbonintotheTCAcycle.The 

glutamate dehydrogenase flux was reversed (a-ketoglutarate to glutamate) 

at glutamine free conditions to produce glutamate for glutamine synthesis. 

Waste product excretion was reduced in the fed-batch cultivations 

compared to respective batch cultivations with 1, 2, or 8 mM glutamine. 

TCA cycle fluxes decreased over time in cultivations with high glutamine 

start concentrations and increased for cultivations with low initial 

glutamine levels and the glutamine free cultivation. With glutamine 

feeding, less variation of TCA cycle fluxes was observed. 

Conclusions: Dynamic metabolic flux analysis is a suitable method to 

describe the dynamics of growth and metabolism during batch and fedbatch 

cultivations with changing environmental conditions. For the batch 

cultivations, we observed dose-dependent effects of 1 to 8 mM glutamine 

start concentration. The fed-batch cultivations showed an intermediate 

response. The glutamine free cultivation had a very different physiology. 

Feeding of glutamine resulted in a reduced waste product excretion 

compared to respective batch cultivations and TCA cycle fluxes showed 

less variation during the cultivation process. 

References 

1. Niklas J, Heinzle E: Metabolic Flux Analysis in Systems Biology of 

Mammalian Cells. Adv Biochem Eng Biotechnol 2011, 127:109-132. 

2. Niklas J, Schräder E, Sandig V, Noll T, Heinzle E: Quantitative 

characterization of metabolism and metabolic shifts during growth of 

the new human cell line AGE1.HN using time resolved metabolic flux 

analysis. Bioprocess Biosyst Eng 2011, 34:533-545. 

3. Strigun A, Wahrheit J, Beckers S, Heinzle E, Noor F: Metabolic profiling using 

HPLC allows classification of drugs according to their mechanisms of 

action in HL-1 cardiomyocytes. Toxicol Appl Pharmacol 2011, 252:183-191. 

P45 

The optimization of a rapid low-cost alternative of large-scale medium 

sterilization 

Dominique T Monteil 1 , Cédric A Bürki 2 , Lucia Baldi 1,2 , David L Hacker 1 , 

Maria de Jesus 2 , Florian M Wurm 1,2* 

1 Laboratory of Cellular Biotechnology, Faculty of Life Sciences, Ecole 

Polytechnique Fédérale de Lausanne, 1015 Lausanne, Switzerland; 

2 ExcellGene SA, 1870 Monthey, Switzerland 

E-mail: florian.wurm@epfl.ch 


Background: One of the most important unit operations in upstream 

animal cell bioprocesses at scales over 100 L is the preparation and 

sterilization of the medium. This complex, sensitive, and expensive process 

requires a considerable investment in both material and time [1]. 

Traditionally, large-scale medium sterilization is performed with costly 

single-use dead-end filters. To optimize and reduce the cost of this unit 

operation, we investigated the sterilization of mammalian cell culture 

medium at volumes larger than 100 L. 

Materials and methods: In this study, an optimization of the cost and 

time for the sterilization of cell culture medium at volumes larger than 100 L 

was investigated. Pressure-volume diagrams were completed for both a 

positive displacement pump (Watson-Marlow 620, Cornwall, England) and a 

bearingless centrifugal pump (Levitronix PuraLev 600 MU, Zurich, 

Switzerland) to determined optimal pumping speeds and pressures. The 

study was completed using 0.25” ID tubing with a gate valve downstream of 

the pump. The pressure (SciLog SciPres, Madison, WI, USA) and flow 

rate (Equflow flowsensor, Ravenstein, Netherlands) were measured at 

diffeFinarent closures of the valve. Independently, a range of different size 

glass microfiber (GF) pre-filters were tested in combination with and without 

the dead-end filters by measuring the turbidity (TN100, Eutech Instruments, 

Singapore). A range of different 0.2 μm dead-end membrane filter materials 

including polyethersulfone (PES), polyvinylidene fluoride (PVDF), and mixed 

cellulose ester (ME) were tested using a positive displacement pump. In 

addition, tangential flow filtration (TFF) was examined with both PES and ME 

0.2 μm membranes in comparison to the dead-end filters. A mammalian cell 

culture medium was filter sterilized at a starting pressure of 500 mbar. The 

pressure and flow rate were recorded during the filtration until the 

transmembrane pressure increased to 1200 mbar. The filtration was then 

stopped at the pressure limit of the tubing connections. Specific filtered 

medium volume, filter liquid flux rate, and filtrate turbidity were determined 

for each membrane type. 

Results: The pressure-volume diagram displayed a higher flow rate for the 

bearingless centrifugal pump (6 to 7 Lpm) in comparison to the peristaltic 

pump (2.5 Lpm) at the desired pressure of 1000 mbar (data not shown). The 

turbidity for unfiltered, pre-filtered, and filtered medium was 2.5, 0.75, and 

0.2 NTU, respectively, demonstrating the possible benefits of using a prefilter 

(data not shown). The filter liquid flux rates ranged from 3 to 

25 L/min/m 2 for the range of different filters. The PES hollow fiber TFF 

filters (Spectrum Labs, Breda, Netherlands) displayed a flux rate of 10 L/min/m 2 

(Figure 1B). The specific filtered volume for the dead-end filters was up 

to 300 L per m 2 of filter surface, while the TFF filter was able to achieve over 

1000 L of sterilely filtered medium per m 2 of filter surface (Figure 1A). 

Conclusions: The optimization of pumps for the sterile filtration of 

mammalian cell culture was completed. Our results indicate that a 

bearingless centrifugal pump could provide twice the flow rate at the 

desired filtration pressure in comparison to a peristaltic pump. In addition, 

the bearingless centrifugal pump was able to provide a constant flow in 

comparison to the peristaltic pump. Pre-filters were found to clarify the 

medium and thus could further reduce the cost of the filtration. The PES 

hollow fiber TFF filter was able to filter over three times the sterile medium 

volume in comparison to the dead-end filters. The TFF filters displayed a 

similar range of filter liquid flux rates in comparison to the different filters 

types. This study showed that a hollow fiber TFF coupled with the use of a 

bearingless centrifugal pump provides a low-cost technology for the rapid 

large-scale 0.2 μm sterilization of mammalian cell culture medium. 

Acknowledgements: We gratefully acknowledge Stéphane Itart- 

Longueville from Spectrum labs and Juerg Burkart from Levitronic GmbH 

for their considerable support of equipment and material. This work has 

been supported by the KTI-Program of the Swiss Economic Ministry and by 

the Swiss National Science Foundation (SNSF). 

Reference 

1. Zhang X, Stettler M, De Sanctis D, Perrone M, Parolini N, Discacciati M, De 

Jesus M, Hacker D, Quarteroni A, Wurm F: Use of orbital shaken 

disposable bioreactors for Mammalian cell cultures from the milliliterscale 

to the 1,000-liter scale. Adv Biochem Eng Biotechnol 2010, 115:33-53. 

P46 

Improved fed-batch bioprocesses using chemically modified amino 

acids in concentrated feeds 

Ronja Mueller 1 , Isabell Joy-Hillesheim 1 , Karima El Bagdadi 1 , Maria Wehsling 1 , 

Christian Jasper 2 , Joerg von Hagen 1 , Aline Zimmer 1* 

1 Merck Millipore, Pharm-Chemical Solutions - Research & Development 

Upstream, Darmstadt, Germany; 

2 Merck KGaA, Performance Materials - 

Advanced Technologies Synthesis, Darmstadt, Germany 

E-mail: aline.zimmer@merckgroup.com 





Figure 1(abstract P45) The calculated specific filtered volume displayed over the changing transmembrane pressure for a range of different 

filter types (A). The calculated filter liquid flux rate for different filter types (B). The filter pore sizes were as followed: A - PVDF 0.45/0.22 μm, B - PES 

0.2 μm, C - PES/PVDF 0.2/0.1 μm, D - GF/PVDF 0.5/0.2 μm, E - PES 0.8/0.2 μm, and F - PES 0.2 μm. 

Background: Fed-batch culture bioprocesses are essential for the 

production of therapeutic proteins [1]. In these cultures, concentrated 

feeds are added during cultivation to prevent nutrient depletion and to 

extend the growth phase, thus increasing product concentration [2]. One 

limitation arises from the low solubility of some amino acids at high 

concentrations, in particular tyrosine [3]. This amino acid is commonly 

solubilized in separate feeds at basic pH [4] inducing pH spikes and 

precipitation when added in the bioreactor. This work describes the 

evaluation of several chemically modified tyrosines as alternative to 

simplify fed-batch bioprocesses by using single feeding strategies at 

neutral pH. 

Materials and methods: For solubility experiments, increasing concentrations 

of modified tyrosines were solubilized in Merck Millipore proprietary 

feed at pH 7,0 until reaching the maximum solubility. Stability was assessed 

during 6 months in Merck Millipore proprietary medium and amino acids 

(including modified tyrosine) were quantified by ultra performance liquid 

chromatography using ACQ·Tag Ultra reagent (Waters). 

For batch cultures, modified tyrosines were solubilized at a concentration of 

4,5 mM in Merck Millipore proprietary medium depleted in unmodified 

tyrosine. The control medium contained 1 mM tyrosine di-sodium salt. CHO- 

S cells were seeded at 1.10 5 cells/ml in 50 ml spin tubes and incubated at 

37°C, 5% CO 2 , 80% humidity and a rotation speed of 320 rpm. Growth and 

viability were monitored during 11 days using Beckman Coulter ViCell®. 

For fed-batch cultures, CHO-S cells expressing a human monoclonal 

antibody were seeded at 2.10 5 cells/ml in medium containing tyrosine 

di-sodium salt. Feeds were added every other day starting at day 3. In the 

control, tyrosine di-sodium salt was added in a separate feed at pH 11 

whereas modified tyrosines were solubilized in the main feed at pH 7,0. 

Glucose was maintained at 4 g/L using a separate feed. Growth and viability 

were monitored during 14 days using Beckman Coulter ViCell®. 

For antibody analysis, IgG concentrations were determined by a 

turbidometric method using Roche Cedex bio HT®. Intact mass analysis, 

peptide mapping and glycan analyses were performed on samples from 

day 14 using mass spectrometry and 2-aminobenzamide labeling followed 

by ultra performance liquid chromatography. 

Results: Solubility and stability experiments: Chemically modified 

tyrosines demonstrated an increased solubility in concentrated feed at 

neutral pH in comparison with tyrosine or tyrosine di-sodium salt (Table 1). 

The highest solubility was achieved for the modified tyrosine 4 with a value 

of 75 g/L. The stability was assessed by quantification of the modified amino 

acid through ultra performance liquid chromatography. Moreover, no 

precipitation was detected over a 6 months period indicating that the 

chemical modification was stable in the tested conditions. 

Batch and fed-batch cultures: The performance in batch culture was 

determined using tyrosine depleted media and supplementation with the 

different derivates. The growth of CHO-S cells with medium supplemented 

with modified tyrosine 2 reached only 50% of the growth of the control 

indicating that this molecule may not be able to be taken up by the cells 

or to promote growth through alternative mechanisms. This derivate was 

not evaluated further. Both modified tyrosines 3 and 4 induced a growth 

comparable to the control culture until day 6 and were then able to 

extend the growth during 2 additional days indicating that both derivates 

can be used successfully in batch cultures. 

In fed-batch mode, modified tyrosines 3 and 4 were solubilized in a 

single concentrated feed at pH 7,0 and added to the culture every other 

day starting at day 3. The growth of recombinant CHO-S cells obtained 

with the derivates was similar to the control (where tyrosine di-sodium 

salt was added through a separate feed at pH 11) reaching a maximum 

viable cell density of 14.10 6 at day 7 (Figure 1A). The titer obtained after 

14 days was equivalent in the two feeds and the new single feed process 

with final titers around 1,5 g/l (Figure 1B) indicating no negative effect of 

the chemical modification on productivity. 

Impact of modified tyrosines on the monoclonal antibody quality 

attributes: Intact mass, peptide mapping and glycosylation analyses were 

performed on the monoclonal antibody to study the impact of modified 

tyrosines on the final molecule. No significant difference could be established 

in either the intact mass of the antibody or the detailed analysis of the 

tryptic peptides by mass spectrometry. Glycosylation analysis indicated the 

same overall glycosylation pattern with 8,2% GlcNac3Man3Fuc, 72,3% G0F, 

7,4% Man5 and 8,5% G1F glycans. Altogether these data indicated that the 

Table 1(abstract P46) Maximum solubility and stability of tyrosine derivates in Merck Millipore proprietary feed or 

medium at pH 7,0 

Molecule Tyrosine Tyrosine di-sodium salt Modified Tyrosine 2 Modified Tyrosine 3 Modified Tyrosine 4 

Solubility in concentrated Not soluble < 1 g/l 10 g/l 70 g/l 75 g/l 

feed at pH 7,0 

Stability in medium at pH 7,0 - > 6 months > 6 months > 6 months > 6 months




Figure 1(abstract P46) Performance of the modified tyrosines in fed-batch culture. A: Viable cell density and viability during the fed-batch process. 

B. IgG production during the fed-batch culture. 

use of chemically modified tyrosines in concentrated feeds did not induce 

any detectable modification of the monoclonal antibody. 

Conclusions: The chemical modification of tyrosine can improve the 

solubility of the amino acid by up to 70 fold. 

Modified tyrosines are stable in chemically defined media and feeds and can 

be used in batch and fed-batch mode. The use of these modified amino 

acids in fed-batch bioprocesses has no detectable impact on the 

monoclonal antibody or the recombinant protein produced. Altogether, this 

study demonstrates that modified amino acids can be used successfully in 

highly concentrated neutral feeds to improve and simplify next generation 

fed-batch processes. 

References 

1. Butler M, Meneses-Acosta A: Recent advances in technology supporting 

biopharmaceutical production from mammalian cells. Appl Microbiol 

Biotechnol 2012, 96:885-894. 

2. Wlaschin KF, Hu WS: Fedbatch culture and dynamic nutrient feeding. Adv 

Biochem Eng Biotechnol 2006, 101:43-74. 

3. Hitchcock DI: The Solubility of Tyrosine in Acid and in Alkali. J Gen Physiol 

1924, 6(6):747-757. 

4. Yu M, Hu Z, Pacis E, Vijayasankaran N, Shen A, Li F: Understanding the 

intracellular effect of enhanced nutrient feeding toward high titer 

antibody production process. Biotechnol Bioeng 2011, 108:1078-1088. 

P47 

Approaches for automized expansion and differentiation of human 

MSC in specialized bioreactors 

Anne Neumann 1,2* , Antonina Lavrentieva 2 , Dominik Egger 2 , Tim Hatlapatka 1 , 

Cornelia Kasper 1 

1 Department for Biotechnology, University of Natural Resources and Life 

Sciences, 1190 Vienna, Austria; 

2 Institute for Technical Chemistry, Leibniz 

University of Hannover, 30167 Hanover, Germany 

E-mail: anne.neumann@boku.ac.at 


Background and experimental approach: A main challenge in cell 

therapies and other tissue regeneration approaches is to produce a 

therapeutically significant cell number. For expansion of mesenchymal stem 

cells (MSC) the cultivation on 2D plastic surfaces is still the conventional 

procedure, even though the culture conditions differ significantly from the 

3D environment in vivo. Additionally, static amplification of MSC is a labourintensive 

procedure. We therefore used a specialized rotating bed bioreactor 

in order to maximize ex vivo expansion of MSC. MSC were isolated from 

umbilical cord (UC) by explant method approach under xeno-free 

conditions. UC-MSC were thereafter expanded under dynamic conditions in 

a novel rotating bed bioreactor. The bioreactor system was designed to 

enable integration of sensors for online monitoring of various parameters (e. 

g. pH, pO 2 ,pCO 2 ) and hence, allow ensured cultivation under well 

controlled and reproducible conditions. Beside cell expansion, directed 

differentiation of MSC was also achieved in bioreactors. MSC lack the ability 

to grow in 3D direction and build functional tissue in vitro. Thus, it is 

necessary to seed and culture MSC on 3D matrices to obtain functional 

implants. For guided differentiation towards the osteogenic lineage, MSC 

were cultivated on ceramic porous matrices under dynamic conditions. 

Custom-made miniaturized perfusion bioreactors for parallel testing were 

designed and optimized for that purpose. 

Methods: MSC isolation was achieved as described previously [1]. Briefly, 

umbilical cord tissue is cut into pieces (approx. 0.5 cm 2 ) and cultivated for 

10 days in aMEM containing 15% human serum in cell culture flasks. Cells 

grow out of the tissue pieces and adhere to the cell culture plastic. 

Subsequently, cells are harvested and subcultivated in aMEM containing 

10% human serum. 

UC-MSC were expanded in a rotating bed bioreactor (Figure 1A). The 

bioreactor chamber is a cylindrical bioreactor shell, comprising an inlet 

(bed) fixed to a magnet whereas the bioreactor chamber is hold by that 

magnet to an engine. The inlay is rotating, while the shell is fixed. The inlay 

comprises cell culture plastic slides with an all over surface of 2000 cm 2 , 

requiring approximately 130 ml cell culture medium to be completely 

covered. The bioreactor is equipped with a feed circulation for fresh medium 

and removal of waste. An additional circulation to pH and pO 2 sensor 

electrodes enables online monitoring. Sampling is performed through a 

septum in the bioreactor shell. Gas mixture of air and CO 2 is supplied by an 

overlay stream. The whole bioreactor set up is situated in a GMP conform 

breeder, enabling sterile handling as well as an environmental temperature 

of 38°C. The system is connected to a control unit, which comprises gas 

regulation, pumps and software for parameter set up and monitoring. 

UC-MSC were seeded (1,500 cells/cm 2 ) in the bioreactor for 24 h hours 

and expanded for 5 days under dynamic conditions. Medium feed was 

adjusted depending on glucose consumption. After 5 days of cultivations 

UC-MSC were harvested by flushing the bioreactor with accutase for 20 min. 

MSC were counted, examined regarding their senescence (b-galactosidase), 

proliferation capacity (glucose/lactate) and differentiation potential 

(Oil Red O, Alizarin Red, Von Kossa, Alcian Blue), as well as surface markers. 

Perfusion bioreactors consist of a stainless steel tube in which the material is 

inserted and a piston, which closes the reactors (Figure 1B). As the piston 

can be adjusted in height a bioreactor can host materials with a diameter of 

10 mm and a high of max. 10 mm. MSC-seeded ceramic materials (10 mm × 

3 mm) were inserted into the bioreactor. The bioreactors are connected to




Figure 1(abstract P47) A) Rotation bed bioreactor for expansion of MSC and B) Perfusion bioreactors. 

a medium reservoir, equipped with a sterile filter for gas exchange. The 

volume of the bioreactor containing the ceramic material is 1,5 ml, the 

overall volume of medium used for the cultivation is 10 ml. Dynamic 

cultivation was achieved using flow rates of 0.3 and 1.5 ml/min. Viability was 

examined using MTT Assay. Cell distribution throughout the scaffold was 

investigated using DAPI staining. The status of differentiation was examined 

using different histological stainings (e.g. Von Kossa, Calcein, Alizarin Red). 

Results and discussion: UC-MSC isolated using explant method approach 

fulfils MSC criteria, such as adherence to plastic surfaces, specific surface 

marker pattern and differentiation potential towards at least the 

adipogenic, chondrogenic and osteogenic lineage [1]. 

MSC expanded under dynamic conditions in a rotating bed bioreactor 

also fulfil these MSC criteria. Furthermore it could be shown, that MSC 

consume glucose and produce lactate during dynamic cultivation in the 

rotating bed bioreactor and consequently proliferate. After 5 days of 

cultivation MSC were investigated regarding their specific surface marker. 

They express CD44, CD73, CD90 and CD 105 and lack CD 31, CD34 and 

CD45. 

MSC on ceramic materials could be shown to differentiate towards the 

osteogenic lineage under static conditions. Also after dynamic cultivation 

with a medium perfusion of 0.3 ml/min and even 1.5 ml/min cells adhere 

on the macro porous ceramic material, were viable and equally distributed 

throughout the scaffold. Seeding efficiency was found to be approximately 

20%. Osteogenic differentiation could be achieved by cultivation in 

perfusion bioreactors. 

Conclusion: MSC could be successfully isolated from human umbilical 

cord tissue. MSC expansion in the rotation bed bioreactor provides a high 

number of cells, maintaining their stem cell properties such as specific 

surface markers, proliferation capacity and differentiation potential. 

Cultivation of MSC in perfusion bioreactors have been shown to support 

and improve osteogenic differentiation as mechanical plays an important 

role in directing MSC fate. Our results support the argument that the 

application of tailor-made bioreactors are an essential step toward the 

production of stem cell based therapeutics and tissue engineering 

products. 

Reference 

1. Moretti P, Hatlapatka T, Marten D, Lavrentieva A, Majore I, Hass R, Kasper C: 

Mesenchymal Stromal Cells Derived from Human Umbilical Cord Tissues: 

Primitive Cells with Potentisl for Clinical and Tissue Engineering 

Applications. Adv Biomedical Engin/Biotechol 2010, 123:29-45. 

P48 

Cell cycle and apoptosis in PER.C6® cultures 

Sarah M Mercier 1* , Bas Diepenbroek 1 , Dirk E Martens 2 , Rene H Wijffels 2 , 

Mathieu Streefland 2 

1 Crucell, Leiden, The Netherlands; 

2 Bioprocess Engineering, Wageningen 

University, Wageningen, The Netherlands 

E-mail: smercier@its.jnj.com 


Background: PER.C6® is a human cell line designed for virus production, 

which was immortalized by transformation with adenoviral E1A and E1B 

genes. Expression of E1A is known to inhibit negative regulators of cell 

cycle and E1B protein function analogously to an apoptosis inhibitor. As 

changes in cell cycle and apoptosis are likely to affect cell’s ability for 

viral infection and propagation, the study of these parameters in PER.C6® 

cultures is essential to develop optimum virus production processes. 

Materials and methods: Cell cycle distribution and apoptosis were 

measured in batch and perfusion PER.C6® cultures using flow cytometry. 

Propidium iodide was used to measure cell cycle distribution. Three 

methods were used to measure apoptosis: staining of externalized 

phosphatidylserine (PS) using annexinV, staining of activated caspases 

using a fluorochrome-conjugated inhibitor of caspases, and staining of 

fragmented DNA using BrdU incorporation and specific fluorescent 

labeling. 7-ADD was used to stain dead cells with a permeable membrane. 

Results: Significant cell death occurred in 14-days batches, when the main 

carbon sources were depleted. Apoptosis was initially not detected by the 

annexinV staining. However, activated caspases were detected after 6 days, 

suggesting that apoptosis occurred in batch. In perfusion, where the 

required nutrients were constantly supplied, no significant cell death or 

induction of apoptosis occurred, showing that the cultures were maintained 

in healthy conditions. At the end of batches, the portion of cells in S phase 

increased drastically and the one in G0/G1 decreased. In perfusion, cell cycle 

distribution was stable until 10 days, when a similar trend as the end of 

batch was observed. 

This is the first research describing apoptosis and cell cycle distribution in 

PER.C6® batch and perfusion cultures. Our data are in accordance with the 

theoretical effect of immortalization by the E1A/B system, which inhibits 

apoptosis when nutrients are in excess and promotes the entry into the cell 

division cycle.




P49 

Scale-up considerations for monoclonal antibody production process: 

an oxygen transfer flux approach 

Laura Gimenez * , Claire Simonet, Laetitia Malphettes 

BioTech Sciences, UCB Pharma SA, Braine l’Alleud, Belgium 

E-mail: Laura.Gimenez@ucb.com 


Background: When scaling up a monoclonal antibody (mAb) production 

process in stirred tank bioreactor, oxygen transfer is probably one of the 

most challenging parameters to consider. Approaches such as keeping 

constant specific power input or tip speed across the scales are widely 

described in the literature and are often based on the assumption that 

mammalian cells are sensitive to shear stress. 

However, with the high cell densities reachedinmodernprocesses,such 

scale-up strategies can lead to relatively high gas flow rate to compensate 

low agitation speed which could be detrimental to cells in its own right. 

As an alternative, we explored a scale-up strategy based on the overall 

oxygen transfer flux (OTF) required by the cell culture process. OTF was 

defined as directly proportional to oxygen transfer coefficient (k L a) and 

oxygen enrichment in the gas mix. This way the overall gas flow can be 

kept at relatively low values, while satisfying the oxygen requirements of a 

high cell density culture. 

Materials and methods: Process scale-up between 3 different stirred tank 

bioreactors was studied: a 2 L glass bioreactor (Sartorius Stedim Biotech) 

equipped with one 3-segment blade impeller, a 10 L glass bioreactor 

(Sartorius Stedim Biotech) equipped with two 3-segment blade impellers 

and a 80 L stainless steel bioreactor (Zeta Biopharma) equipped with two 

elephant ear impellers. 

Oxygen transfer coefficients (k L a) were determined for the chemically 

defined production medium, using the dynamic technique of oxygen 

adsorption. The statistical analysis software JMP (SAS) was then used in 

order to express k L a’s according to the following equation: k L a = A * (P/V) a 

*Vs b , P/V being volumetric power input [W.m -3 ] and Vs being superficial air 

velocity [m.s -1 ], and to analyze our results. 

Oxygen transfer flux was defined as followed: OTF = k L a*(%O 2 in the 

gas mix/% O 2 in air). 

For cell culture experiments, bioreactors were inoculated with a CHO cell line 

producing a mAb. Cells were cultivated in chemically defined media for a 

14-day fed-batch process. The culture was controlled to maintain the desired 

process parameters (temperature, pH, dO 2 and glucose concentration). dO 2 

level was maintained using a cascade aeration. Viable cell density (VCD) and 

viability were monitored by Trypan blue dye exclusion using a Vicell XR 

(Beckman Coulter). Glucose and lactate concentrations were determined 

using a Nova Bioprofile 400 analyzer (Nova Biomedical). Offline dissolved CO 2 

and osmolality were measured with a Nova Bioprofile pHox (Nova 

Biomedical) and Osmo 2020 (Advanced Instrument) analyzers respectively. 

mAb concentrations were determined by Protein A HPLC. 

Results: k L a mapping of 2 L, 10 L and 80 L bioreactors: The 2 L and 

10 L bioreactors were characterized for a range of superficial gas velocity 

going from 5.0 × 10 -5 to 4.0 × 10 -4 m.s -1 and the 80 L for a range going from 

2.0 × 10 -4 to 1.2 × 10 -3 m.s -1 . Specific power input was ranged from 10 to 

90 W.m -3 for the 2 L bioreactor, 20 to 130 W.m -3 for the 10 L bioreactor and 

5 to 80 W.m -3 for the 80 L bioreactor. Models were generated with JMP and 

gave the following equations for k L a[s -1 ]: 

2 L bioreactor: k L a = 6.37 × 10 -2 * (P/V) 0.28 *Vs 0.59 (R 2 = 0.98, Prob>F: 

F: F:




Figure 1(abstract P49) Cell culture process performance at 2 L, 10 L and 80 L scale. a) Impact of agitation speed on VCD and mAb titer at 2 L scale. 

b) Comparison of VCD, viability and mAb titer obtained in 2 L, 10 L and 80 L bioreactors. c) Comparison of osmolality, glucose and lactate profiles 

obtained in 2 L, 10 L and 80 L bioreactor. d) Online pH and dCO 2 levels obtained in 2 L, 10 L and 80 L bioreactors. 

G3000SWXL, TOSOH), in which the Tris buffer (pH = 7.4) containing 0.05% 

CHAPS was used as elution buffer. 

Results: All batch cultivations were carried out until viable cells become 

equal to zero. Cells grew well at more than 33 °C, however cells didn’t grow 

at 30 °C. Compared to 37 °C-cultivation, lower specific growth rates were 

observed in the lower temperature cultivations. The specific production rate 

of sCR1, q s CR1 , was obtained by the slope of relationship between sCR1 

concentration and time integrated cell concentration within a linear range. 

The q s CR1 at each temperature were the almost same except at 30 °C. 

The final sCR1 concentrations at 33 °C was rather higher than those at 37 

and 35 °C. The cell concentration in stationary phase, X S , at 33 °C was lower 

than those at 37 and 35 °C. Thus the ratio of the final sCR1 concentration to 

X S at 33 °C was the highest in case of more than 33 °C. The final sCR1 

concentration to X S at 30 °C is rather higher than that at 33 °C, however it 

makes no sense because of the extremely low specific growth rate at 30 °C. 

In order to increase the final sCR1 concentration, we proposed a two-stage 

culture that at first cultivation temperature was set to 37 °C and then a 

culture temperature became lower at late logarithm phase. Thus the final 

sCR1 concentration by using a two-stage culture, in which the temperature 

was 37 °C initially and changed to 33 °C after 120 h-cultivation, increased 

by 1.75 and 1.99, compared as a flat temperature culture at 33 °C and 

37 °C, respectively (Figure 1, Table 1). 

Conclusions: The conclusions are as follows: 

1. It was shown that the ratio of the final sCR1 concentration to the cell 

concentration in stationary phase was rather higher at lower temperature 

than that in 37 °C-cultivation. 

2. A two-stage cultivation with temperature change from 37 °C to lower 

temperature was proposed and it was shown that the final product 

concentration was considerably improved. 

References 

1. Yoon SK, Song Ji Y, Lee GM: Effect of low temperature on specific 

productivity, transcription level, and heterogeneity of erythropoietin in 

Chinese hamster ovary cells. Biotechnol Bioeng 2003, 82:289-298. 

2. Kato H, Inoue T, Ishii N, Murakami Y, Matsumura M, Seya T, Wang PC: 

A novel simple method to purify recombinant soluble human 

complement receptor type 1 (sCR1) from CHO cell culture. Biotechnol 

Bioprocess Eng 2002, 7:67-75. 

P51 

HEK293 cell culture media study: increasing cell density for different 

bioprocess applications 

Leticia Liste-Calleja * , Martí Lecina, Jordi Joan Cairó 

Chemical Engineering Department, Universitat Autònoma de Barcelona, 

Cerdanyola del Vallès, 08193, Spain 

E-mail: Leticia.Liste@uab.cat 


Background: The increasing demand for biopharmaceuticals produced in 

mammalian cells has lead industries to enhance bioprocess volumetric 

productivity through different strategies. Among them, media development 

is of major interest [1]. According to the increasing constraints regarding the 

use of animal derived components on industrial bioprocesses but also the 

drawbacks of its depletion from cell culture [2], the main goal of the present 

work was to provide different cell culture platforms which are suitable for a 

wide range of applications depending on the type and the final use of the 

product obtained.




Figure 1(abstract P50) Time courses of cell-cultivation: (a) 37 °C, (b) two-stage cultivation (37 °C to 33 °C after 120 h). 

Table 1(abstract P50) Comparison of culture parameters at various temperatures 

30 °C 33 °C 35 °C 37 °C 37 °C®33 °C 

specific growth rate [h -1 ] >0.0002 0.0072 0.0107 0.0136 - 

q CR1 s [10 9 g cells -1 h -1 ] 0.0304 0.0416 0.0407 0.0446 - 

final sCR1 [mg/mL] (a) 3.04 8.68 8.11 7.67 15.2 

X S [10 6 cells/mL] (b) 0.223 0.788 1.09 1.15 1.20 

(a)/(b) 13.6 11.0 7.43 6.68 12.7 

Materials and methods: The cell line HEK293SF-3F6 employed in this 

studywaskindlyprovidedbyDr.A.Kamen,NRC-BRI.Thebasalmedia 

tested were CDM4HEK293, SFM4HEK293 and SFMTransFx-293 (Hyclone, 

Thermo Scientific) supplemented -when indicated- with FBS (Invitrogen) 

and/or Cell Boost 5 (80 g/L) (Hyclone, Thermo Scientific). Viable cell 

density and viability were determined by trypan blue exclusion method 

and manual counting using an haemocytometer. The adenovirus strain 

HAdV-5(ΔE1/E3) encoding pCMV-GFP was used for infection experiments. 

All infections were carried out at MOI≈1 TOI≈0.5 × 10 6 cell/mL in 6-wellplate. 

Harvesting was performed 48 hpi. 

Viral titration was performed by Flow cytometry on a FACS Canto 

(Becton and Dickinson, Bioscience) by adaption of a protocol previously 

described [3]. 

Results: The first part of this work was focused on screening different 

serum-free cell culture media specifically recommended for HEK293 

cell line. As shown in Figure 1A top panel, cultures performed in HyQ 

SFM4HEK293 and HyQ SFMTransFx-293 showed better cell growth than 

HyQ CDM4HEK293, reaching maximum cell densities of about 3.5 × 10 6 

cell/mL, 2 × 10 6 cell/mL and less than 1 × 10 6 cell/mL respectively. In order 

to evaluate whether the substitution of critical serum components have 

satisfactorily been performed in the media tested without affecting cell 

growth, the addition of fetal bovine serum (FBS) was assessed. FBS 

depletion was acceptable only in HyQ SFM4HEK293 as the other cell media 

reached higher cell densities when FBS was added (up to 7-fold increment 

of Xv max ). Regarding the screening of Animal derived component free 

supplements, three chemically defined supplements were tested but only 

one (Cell Boost 5, onwards CB5) significantly enhanced cell growth. This 

supplement enabled to reach higher cell densities in all media tested: 

2-fold up in HyQ SFM4HEK293 and CDM4HEK293 and 5-fold increment in 

HyQ SFMTransFx-293 (Figure 1A, bottom panel). 

The results obtained so far showed that supplementation of all cell media 

tested is recommended in order to achieve higher cell density cultures. 

Among all the conditions, HyQSFMTransFx-293 was the media which 

supported the highest Xv max with both supplements (FBS and CB5). 

Therefore, this medium was selected for tuning the final concentration 

of each supplement. Among the studied concentration range for FBS 

(2.5-10% v/v) and for CB5 (2.5-20%) it was determined that the best 

conditions were 5% for FBS and 10% for CB5 solution. At these 

concentrations, Xv max achieved were (7.14 ± 0.56*10 6 cell/mL) and (12.63 ± 

1.76*10 6 cell/mL) respectively (Figure 1B). Interestingly, CB5 enabled to 

extend μ max phase while FBS increased μ max value, as previously detected in 

the initial media screening (Table 1). The combination of supplements (5% 

FBS and 10%CB5) resulted in an Xv max as high as 16.77 ± 0.70 × 10 6 cell/mL 

in batch culture, with an increment in specific growth rate of 15% in 

comparison to those cultures in which FBS was deprived. Specific growth 

rate was maintained for 144 h of cell culture. 

From the range of applications in which HEK293 can be used, the work 

carried out in this work was directed to recombinant adenovirus production. 

Hence, the evaluation of the effect of supplementation in the cell media 

selected on adenovirus infection efficiency and final titer obtained was 

evaluated (Figure 1C). Efficiency of infection was around 63% as expected 

for an effective infection [4] in all conditions. In regards to adenovirus 

production, FBS increased it up to fivefold, whereas CB5 supplementation 

did not affect significantly, and the addition of both supplements almost 

doubled the viral production in comparison to basal medium. It is proposed 

that an increment of osmolarity due to the addition of both supplements 

might explain the slight reduction on productivity in comparison to the 

addition of FBS solely [5]. 

Conclusions: Two culture platforms are proposed for two possible 

scenarios in basis of the Xv max reached: (1) HyQSFMTransFx-293 CB5




Figure 1(abstract P51) (A) Comparison of cell growth profiles of HEK293 cell cultures in serum-free cell media (top panel) and in the same cell media 

FBS supplemented (middle panel) or CB5 supplemented (bottom panel). (B) HyQ SFMTransFx-293 cell cultures with the best concentrations encountered 

for FBS and CB5 and combination of supplements. (C) Evaluation of the effect of supplement addition on efficiency of infection and Viral Titer obtained. 

Table 1(abstract 51) Kinetic parameters for HEK293 cell cultures corresponding to the profiles depicted in Figure 1 

HyQ CDM4HEK293 HyQ SFM4HEK293 HyQ SFMTransFx-293 

No adition Xv max (×10 6 cell·mL -1 ) 0.85 ± 0.0 3.53 ± 0.21 2.1 ± 0.12 

μ max (×10 -2 h -1 ) 1.06 ± 0.01 2.46 ± 0.14 2.43 ± 0.03 

t μ (h) 96 74 74 

5% FBS Xv max (×10 6 cell·mL -1 ) 6 ± 0.0 4.67 ± 0.48 7.02 ± 0.06 

μ max (h -1 ) 2.61 ± 0.04 2.8 ± 0.05 2.67 ± 0.01 

t μ (h) 95 71 72 

5%CB5 Xv max (×10 6 cell·mL -1 ) 4.11 ± 0.33 7.29 ± 0.18 9.75 ± 0.25 

μ max (h -1 ) 2.1 ± 0.06 2.06 ± 0.03 2.17 ± 0.03 

t μ (h) 92 69 116 

supplemented -10% v/v- for animal derived component Free required 

bioprocesses (Xv max = 12.6 × 10 6 cell/mL) and (2) HyQSFMTransFx-293 FBS 

and CB5 supplemented -5% and 10% v/v respectively- for animal derived 

component containing bioprocesses (Xv max =16.7×10 6 cell/mL). In both 

cases, μ max and t μ values were preserved or even improved with respect to 

basal media and any of the supplements negatively affected the adenovirus 

production when compared to non-supplemented infections. 

Acknowledgements: We would like to thank Dr. Amine Kamen (BRI-NRC, 

Canada) for kindly providing the HEK 293 cell line. 

References 

1. Burgener A, Butler M: Medium Development. Cell Culture Technology For 

Pharmaceutical And Cell-Based Therapies Boca Ratón, FL: CRC Press: Ozturk S, 

Hu WS, 1 2006, 41-80. 

2. Keenan J, Pearson D, Clypes M: The role of recombinant proteins in the 

development of serum-free media. Cytotechnology 2006, 50:49-56. 

3. Gálvez J, Lecina M, Solà C, Cairó JJ, Gòdia F: Optimization of HEK-293S cell 

cultures for the production of adenoviral vectors in bioreactors using 

on-line OUR measurements. J Biotech 2012, 157:214-222. 

4. Condit RC: Principles of Virology. Fields Virology Lippencott: Williams and 

Wilkins: Knipe DM, Howley PM , 5 2007, 25-58. 

5. Dormond E, Perrier M, Kamen A: From the first to the third generation 

adenoviral vector: what parameters are governing the production yield? 

Biotechnology advances 2009, 27:133-144. 

P52 

Preliminary studies of cell culture strategies for bioprocess 

development based on HEK293 cells 

Leticia Liste-Calleja * , Jonatan López-Repullo, Martí Lecina, Jordi Joan Cairó 

Chemical Engineering Department, Universitat Autònoma de Barcelona, 

Cerdanyola del Vallès, 08193, Spain 

E-mail: Leticia.Liste@uab.cat 


Background: The use of human embryonic kidney cells (HEK293) for 

recombinant protein or virus production has gained relevance along the




last years. They are specially recommended for transient gene expression 

and adenovirus or adeno-associated virus generation [1,2]. To achieve 

high volumetric productivities towards bioprocess optimization, the 

concentration of biocatalizer (i.e. animal cells) must be enhanced. The 

limits for cell growth are mainly related to the accumulation of metabolic 

by-products, or the depletion of nutrients [3]; therefore, cell cultures 

strategies must be developed. In this work, we have explored Punctual 

Feeding and Media Replacement cell culture strategies to over perform 

the limit on Xv max encountered on batch culture mode. Finally, we scaled 

up cell culture in order to control other parameters (i.e. pO 2 )thatcould 

be limiting cell growth. 

Materials and methods: The cell line used in this study was HEK293SF-3F6 

(kindly provided by Dr. A.Kamen, NRC-BRI). The basal medium for all cell 

cultures was SFMTransFx-293 (Hyclone, Thermo Scientific) supplemented 

with 5% (v/v) of FBS and 4 mM GlutaMAX (Gibco, Invitrogen). For Punctual 

Feeding and FedBatch Fementation Cell Boost 5 (Hyclone, Thermo Scientific) 

was used. Batch, media replacement and punctual feeding experiments 

were performed in 125-ml plastic shake flasks (Corning Inc.) shaken at 

110rpminanorbitalshakerat37°C,95%humidity,5%CO 2 incubator. 

FedBatch Fermentation was carried out in Bioreactor Braun-MCD (2 L) with 

mechanical agitation at 80 rpm, pH set point 7.1 and pO 2 set point 50%. 

Viable cell density and viability were determined by trypan blue exclusion 

method and manual counting using a haemocytometer. Glucose and lactate 

were analysed in an automatic analyser, YSI (Yellow Springs Instrument, 

2700 Select). 

Results: Characterization of HEK293 cell culture in batch operation was 

initially performed. It was encountered that cell growth was extended for 

168 h reaching approximately 7·10 6 cell/mL of cell density (Figure 1.1). 

Nevertheless, maximal cell growth rate (μ max ) was only maintained for 

96 h. As glucose and lactate were not at limiting concentrations [4], 

Figure 1(abstract P52) Comparison of HEK293 cell growth, viability, glucose and lactate profiles in different cell culture strategies.




nutrient limitation different from glucose arose as the first hypothesis for 

this decrease on cell growth rate. Therefore, punctual additions of 

nutritional supplement for HEK293 were carried out. Xv max was 

significantly increased in comparison to basal media, reaching cell 

densities as high as 17·10 6 cell/mL (Figure 1.2). Nevertheless, we could not 

overcome this limit on Xv max regardless the number of punctual feedings 

performed. Moreover, nutrient addition did not elongate μ max period (t μ ). 

These results suggested that by-product accumulation different from 

lactate could be limiting cell growth. In order to validate the hypothesis, 

complete media replacement (up to three replacements) was studied 

(Figure 1.3). Although this strategy enabled to extend t μ up to 168 h of cell 

culture, the maximal cell density reached was similar to nutrient addition 

strategy (1MR: 12·10 6 cell/mL; 2MR: 16·10 6 cell/mL; 3MR: 18·10 6 cell/mL). 

This limit on Xv max encountered on shake flask might be related to a 

limitation on pO 2. Thus, the cell culture system was changed towards a 

bioreactor with controlled pO 2 (maintained between 20-60% of air 

saturation). In addition, a continuous feeding using a pre-fixed profile 

addition was implemented. As it can be noticed in Figure 1.4, FedBatch 

operation in bioreactor enabled to beat the limit encountered in shake 

flask system, reaching cell densities of 27·10 6 cell/mL. 

Conclusions: Punctual feeding and media replacement overcame the limit 

of 7·10 6 cell/mL encountered in batch mode operation indicating that 

nutrient depletion was one of the causes of that limit. Nevertheless, the 

elongation of t μ found out performing MR suggests that the accumulation 

of by-products might not be ruled out. 

The new limit on Xv max (≈17-18·10 6 cell/mL) encountered regardless the 

cell culture strategy, was outperformed by transferring O 2 more 

efficiently in bioreactor system, reaching cell densities as high as Xv max = 

27·10 6 cell/mL. The monitoring and control of cell culture parameters (i.e. 

pO 2 , pH) will enable to develop more accurate feeding strategies in 

order to achieve higher cell densities than those presented here (on 

going work). 

Acknowledgements: We would like to thank Dr. Amine Kamen (BRI-NRC, 

Canada) for kindly providing the HEK 293 cell line. 

References 

1. Nadeau I, Kamen A: Production of adenovirus vector for gene therapy. 

Biotechnology advances 2003, 20:475-489. 

2. Geisse S, Fux C: Recombinant protein production by transient gene 

transfer into Mammalian cells. Methods in Enzymology 2009, 

463:223-238. 

3. Butler M: Animal cell cultures:recent achievements and perspectives in 

the production of biopharmaceuticals. Appl Microbiol Biotechnol 2005, 

68:283-291. 

4. Petiot E, Jacob D, Lanthier S, Lohr V, Ansorge S, Kamen A: Metabolic and 

Kinetic analyses of influenza production in perfusion HEK293 cell 

culture. BMC Biotechnol 2011, 11:84-96. 

P53 

Adhesion and colonization of mesenchymal stem cells on polylactide or 

PLCL fibers dedicated for tissue engineering 

Frédérique Balandras 1 , Caroline Ferrari 1 , Eric Olmos 1 , Mukesh Gupta 2 , 

Cécile Nouvel 2 , Jérôme Babin 2 , Jean-Luc Six 2 , Nguyen Tran 3 , 

Isabelle Chevalot 1 , Emmanuel Guedon 1* , Annie Marc 1 

1 CNRS, Laboratoire Réactions et Génie des Procédés, UMR 7274, Université 

de Lorraine-ENSAIA, 2 avenue de la forêt de Haye, TSA 40602, F-54518 

Vandoeuvre-lès-Nancy Cedex, France; 2 CNRS, Laboratoire de Chimie Physique 

Macromoléculaire, FRE 3564, Université de Lorraine-ENSIC, 1 rue Grandville, 

54000 Nancy Cedex, France; 

3 École de Chirurgie, Faculté de Médecine, 

Université de Lorraine, F-54500 -Vandœuvre-lès-Nancy, France 

E-mail: emmanuel.guedon@univ-lorraine.fr 


Background: Tissue engineering covers a broad range of applications 

dedicated to the repair or the replacement of part or whole tissue such as 

blood vessels, bones, cartilages, ligaments, etc [1]. Practically, a bio 

substitute, made with cells cultivated on scaffold, is needed. Mesenchymal 

stem cells (MSC) are generally the most suitable cells for such application 

since they are self-renewable with a great potential for differentiation and 

immuno suppression [2]. However, materials used for bio functional 

scaffold synthesis have to meet several criteria, such as biocompatibility 

and biodegradability. Thus, the aim of the study was to screen several 

Table 1(abstract 53) Composition of co-polymers used in 

this study 

Commercial PLCL 70% L-LA 30% CL 

MKG58 70% D, L-LA 30% CL 

MKG64 - 100% CL 

MKG70 50%L-LA 50% CL 

MKG71 100%D, L-LA - 

MKG74 100%L-LA - 

LA: lactic acid; CL: ε-caprolactone 

biopolymers differing in their composition for their capability to promote 

adhesion and growth of MSC. 

Materials and methods: Porcine MSC were cultivated in a-MEM 

supplemented with 10% serum and FGF2. For cell adhesion experiments, 

6(co)polymers (Table 1) were synthesized and tested. 

Fibres of polymers were electrospun on 4 cm 2 cover glasses. Briefly, the 

polymer solutions are introduced into a syringe with various flow rates and 

an electrical field is applied, resulting in the formation of a polymer jet on 

cover glasses or on any surfaces. Then, cover glasses were put onto 6 wells 

plate before to be seeded with MSC. Then, cell adhesion and colonization 

of polymer fibres were monitored by microscopy and counted using 

Guava Viacount assay after trypsine treatment as already described [3]. 

Results: With the aim of studying and identifying new materials dedicated 

to scaffold manufacturing for tissue ingineering, MSC were cultivated on 

various (co) polymers. These polymers, made with lactic acid (L and/or D) 

and/or caprolactone (blue bars; MKG 58, 64, 70, 71 and 74) in comparison 

with a commercial PLCL (red bars), were electrospun on cover glasses in 

order to functionalize them. Then MSC were cultivated on theses 

functionalized cover glasses at two initial cell seeding (10 000 and 60 000 

cells) during 200 hours (Figure 1). 

Whatever the polymer used and the initial cell seeding, cells were able to 

adhere and to colonize fibres. A cell multiplication factor ranging from 6.5 to 

22 was measured after 200 hours of culture depending on the polymer 

composition and the initial seeding. However, compared to the commercial 

PLCL, the total cell number was strongly increased with MKG 71 (21 and 

50%), MKG 74 (34 and 34%) and MKG 58 (15 and 40%) whereas a moderate 

growth was observed with MKG 64 (9 and 30%) at an initial seeding of 

10 000 and 60 000 cells respectively. MKG 70 did not improve the cell 

growth compared to the commercial polymer (> 5% for both seeding). 

Conclusion: In this study, porcine MSC were cultivated on various (co) 

polymers made with lactic acid (L and/or D) and/or caprolactone. Our results 

demonstrated that composition of these (co)polymers strongly influences 

MSC growth and colonization. Indeed, polymers such as MKG 58, 71 and 74 

appeared to promote MSC growth contrary to other polymers tested, i;e 

MKG 64 and MKG 70, compared to the commercial one. Therefore, MKG 58, 

71 and 74 could be favoured for further scaffold synthesis. 

References 

1. Caplan AI: Adult mesenchymal stem cells for tissue engineering versus 

regenerative medicine. J Cell Physio 2007, 213:341-347. 

2. Chamberlain G, Fox J, Ashton B, Middleton J: Concise review: 

Mesenchymal stem cells: Their phenotype, differentiation capacity, 

immunological features, and potential for homing. Stem Cells 2007, 

25:2739-2749. 

3. Ferrari C, Balandras F, Guedon E, Olmos E, Chevalot I, Marc A: Limiting cell 

aggregation during mesenchymal stem cell expansion on microcarriers. 

Biotechnol Prog 2012, 28:780-787. 

P54 

Cell cycle and apoptosis: a map for the GS-NS0 cell line at the genetic 

level and the link to environmental stress 

Chonlatep Usaku, David Garcia Munzer, Efstratios N Pistikopoulos, 

Athanasios Mantalaris * 

Biological Systems Engineering Laboratory, Centre for Process Systems 

Engineering, Department of Chemical Engineering, Imperial College London, 

London, SW7 2AZ, UK 

E-mail: a.mantalaris@imperial.ac.uk 





Figure 1(abstract P53) Quantitative evaluation of MSC growth on poly lactide/caprolactone polymers. Two initial MSC seeding, 10 000 and 60 000 

cells, were carried out. The red stars indicate a significant increase in final cell number compared to the control (commercial PLCL). 

Background: Large scale mammalian cell culture systems, especially fedbatch 

systems, are currently utilised to manufacture monoclonal 

antibodies (MAbs) in order to meet the continuously growing global 

demand [1]. Nutrient deprivation and toxic metabolite accumulation 

commonly encountered in such systems influence the cell cycle and 

trigger apoptosis, resulting in shorter culture times and a lower final MAb 

titre. Control of the cell cycle has been previously studied in order to 

achieve higher titre through apoptosis inhibition by bcl-2 overexpression 

and cell cycle arrest in G 1 /G 0 by p21 transfection. However, the above 

mentioned strategies have not always been successful; no improvement in 

titre was often observed though bcl-2 over-expression helped prolong the 

culture viability whereby the majority of cells were arrested at G 1 /G 0 to 

avoid apoptosis [2-4]. Thus, a systematic insight of the dynamic relation 

between metabolic stress, cell cycle and apoptosis is still required. To this 

end, we aim to establish a novel map of the dynamic interplay between 

cell cycle and apoptosis at the genetic level, and provide a link with the 

culture conditions at the metabolic level. 

Materials and methods: Batch culture of GS-NS0 producing a cB72.3 

MAb was performed. Cell density and viability was quantified using the 

dye exclusion method. Extracellular glucose, glutamate, lactate and 

ammonium were quantified using Bioprofile 400 (Nova Biomedical, 

Waltham, USA). The extracellular antibody was measured using ELISA. DNA 

staining and Annexin V/PI assay was used to quantify the fraction of cells 

in each cell cycle phase as well as the degree of apoptosis. The 

measurement of both apoptosis and cell cycle related gene expression was 

conducted using real-time PCR. 

Results and discussion: Our results showed a clear link between the 

environmental factors and gene expression. The batch cultures started 

with a high fraction of cells in the G 1 /G 0 phase, which rapidly left this state 

in order to join the proliferating population. Soon after, glutamate 

deprivation occurred at around 50 h of culture, whereby atf5 upregulation 

peaked (50% higher) suggesting that glutamate deprivation is among the 

first factors that introduce metabolic stress, in agreement with previous 

results [5]. The upregulation of atf5 triggered the upregulation of bcl-2 

(which followed at around 90 h). After the batch cultures reached their 

maximum cell density (which occurred roughly the same time as the 

glutamate exhaustion), the onset of an increasing early apoptotic cell 

population was observed - around 10%. Together with the high cell 

density, casp8 was upregulated (100% increase). Consequently, the 

expression of casp3 followed a similar trend with a lag of few hours as its 

protein, caspase-3, is one of downstream targets of caspase-8 and a final 

executor of the apoptosis pathways [6]. In addition, trp53bp2 showed a 

similar trend to casp3. These results suggest that apoptosis could initially 

occur via the death receptor pathway as marked by the casp8 upregulation, 

which might be induced by the glutamate exhaustion and/or the cell 

density peak. However, given that the trp53bp2 upregulation happened later 

than that of casp8 suggests that apoptosis in the later stages of culture 

might also occur through the mitochondrial pathway and it could also be 

triggered by other lethal signals (e.g. high level of lactate accumulation). 

As soon as the onset of apoptosis occurred, the upregulation of p21 was 

also observed (300% increase) and this happened simultaneously with the 

bcl-2 upregulation. Since it was reported that Bcl-2 protein helps facilitate 

cell cycle arrest at G 1 /G 0 phase and an increase in G 1 /G 0 cell fraction was 

observed later in the death phase of culture, this could suggest that 

the bcl-2 upregulation may underlie the p21 upregulation and the cell 

cycle arrest at G 1 /G 0 phase and this could be a mechanism to avoid 

apoptosis [7]. 

Conclusions: These findings set a map of the cell cycle and apoptotic 

timing and magnitudes of the events from the genetic level and their links 

to the environmental conditions, which can be used to gain insight of the 

GS-NS0 cultures. By looking at the map, we can systematically analyse 

cellular responses to the environmental conditions which may have 

detrimental effect on the culture and utilise the result of the analysis to 

tackle the culture issues way before the final executors, but at the genetic 

level. Ultimately, the goal is to utilize mathematical models that will help 

to establish new strategies in order to achieve a longer cultivation period, 

high viability and increased MAb titre. 

Acknowledgements: We would like to thank Lonza Biologics (Slough, 

UK) for kindly providing the cell line and members of Biological 

Systems Engineering Laboratory (BSEL) for help with the analytical 

techniques. 

References 

1. Elvin JG, Couston RG, van der Walle CF: Therapeutic antibodies: Market 

considerations, disease targets and bioprocessing. International Journal of 

Pharmaceutics 2013, 440:83-98. 

2. Simpson NH, Singh RP, Emery AN, Al-Rubeai M: Bcl-2 over-expression 

reduces growth rate and prolongs G1 phase in continuous chemostat 

cultures of hybridoma cells. Biotechnology and Bioengineering 1999, 

64:174-186. 

3. Tey BT, Singh RP, Piredda L, Piacentini M, Al-Rubeai M: Bcl-2 mediated 

suppression of apoptosis in myeloma NS0 cultures. Journal of 

Biotechnology 2000, 79:147-159.




4. Watanabe S, Shuttleworth J, Al-Rubeai M: Regulation of cell cycle and 

productivity in NS0 cells by the over-expression of p21CIP1. 

Biotechnology and Bioengineering 2002, 77:1-7. 

5. Browne SM, Al-Rubeai M: Analysis of an artificially selected GS-NS0 

variant with increased resistance to apoptosis. Biotechnology and 

Bioengineering 2011, 108:880-892. 

6. Hengartner MO: The biochemistry of apoptosis. Nature 2000, 407:770-776. 

7. Janumyan YM, Sansam CG, Chattopadhyay A, Cheng N, Soucie EL, Penn LZ, 

Andrews D, Knudson CM, Yang E: Bcl-xL/Bcl-2 coordinately regulates 

apoptosis, cell cycle arrest and cell cycle entry. EMBO J 2003, 

22:5459-5470. 

P55 

Design space definition for a stirred single-use bioreactor family from 

50 to 2000 L scale 

Thomas Dreher * , Ute Husemann, Sebastian Ruhl, Gerhard Greller 

Sartorius Stedim Biotech GmbH, Göttingen, Germany, D-37079 

E-mail: thomas.dreher@sartorius-stedim.com 


Background: Single-use bioreactors continue to gain large interest in the 

biopharmaceutical industry. They are excessively used for mammalian cell 

cultivations, e.g. production of monoclonal antibodies and vaccines [1]. This 

is motivated by several advantages of these bioreactors like reduced risk of 

cross contaminations or shortening lead times [2]. Single-use bioreactors 

differ in terms of shape, agitation principle and gassing strategy [3]. Hence, a 

direct process transfer or scale-up between different systems can be a 

challenge. Reusable bioreactors are still regarded as gold standard due to 

their well-known and defined geometrical properties. Based on this 

knowledge a stirred single-use bioreactor family from 50 to 2000 L scale was 

developed with similar geometrical ratios like commonly used reusable 

systems. To follow a Quality by Design approach the key process parameters 

for a modern mammalian cell cultivation were specified. Therefore, the k L a- 

value, mixing time and the power input per volume were evaluated by 

using process engineering methods for all scales. 

Stirred single-use bioreactor family: The used stirred single-use 

bioreactor family (BIOSTAT® STR, Sartorius Stedim Biotech, Germany) has 

design criteria similar to conventional reusable systems. The bioreactors 

have a cylindrical cultivation chamber, two impellers mounted on a rigid 

shaft and a submerged sparger. The H/D ratio of 2:1 and the impeller to bag 

ratio of 0.38 was kept constant for all scales [4]. There is the possibility to 

select between the impeller configuration 2 × 3-blade segment impeller 

(downward mixing) and 6-blade disk (bottom) + 3-blade segment (top) 

impeller. For the process engineering characterization 2 × 3-blade segment 

impellers were used. The aeration was performed by a combi sparger, which 

consists a ring sparger part (hole diameter 0.8 mm) and a micro sparger part 

(hole diameter 0.15 mm). 

Process engineering characterisation: Design space approach: The 

field of application of the stirred single-use bioreactor family is the 

cultivation of mammalian cells. To verify the single-use bioreactors a 

modern CHO process was considered with a peak cell density of 27 - 28 × 

10 6 cells/mL. This process defines the key process parameters relevant for 

the design space definition [3,5], which are a moderate shear rates (tip 

speeds < 2.0 m/s), a sufficient oxygen transfer rate (k L a>7h -1 , supply pure 

oxygen assumed), a suitable homogeneity (mixing times < 60 s) and a 

power input per volume (P/V L ) between 10 and 250 W/m 3 (from lab to 

production scale). 

Power input per volume: Energy has to be transferred to a bioreactor to 

ensure cell suspension, homogenization and gas dispersion [6]. For the 

quantification the dimensionless Newton number (Ne) was determined by 

torque measurements [3]. From the results the power input per volume 

was calculated for tip speeds between 0.6 and 1.8 m/s. Ne for the selected 

configuration was 1.3. Figure 1a shows the P/V L characteristics, which 

increased for all scales with the tip speed. With increasing size of the 

CultiBag STR the power input per volume decreases at a defined tip speed. 

Mixing time: Appropriate mixing is important to avoid concentration or 

temperature gradients inside the cultivation chamber. The mixing time of 

the stirred single-use bioreactor was determined by the decolourization 

method [7]. The mixing times as a function of the tip speed are illustrated 

in Figure 1b. As the tip speed increases, expectedly the mixing times 

decrease. For all scales mixing times below 30 s are achieved. 

Oxygen transfer capabilities: The oxygen transfer efficiency of a 

bioreactor can be described by the k L a-value, which was determined by 

the gassing-out method (1xPBS, room temperature) [8]. The aeration was 

carried out through the holes with 0.8 mm (ring sparger part) (Figure 1c) 

and in another trial through the holes with 0.15 mm diameter (micro 

sparger part) (Figure 1d). The volumetric mass transfer coefficients were 

determined as a function of the tip speed for a constant gas flow rate of 

0.1 vvm. With increasing tip speed the k L a-value characteristics increased 

for all scales. For larger scales higher k L a-values were achieved presumably 

due to longer residence times of the gas bubbles. By using aeration 

through the holes with the smaller diameter the k L a-value can be 

significantly increased. 

Conclusions: The main application of the presented single-use bioreactor 

family is the cultivation of mammalian and insect cells. These cells have 

special demands on the cultivation system for their optimal growth. To 

verify the suitability of the bioreactor family different process engineering 

parameters were determined. Based on the results the process 

engineering parameters are in the desired ranges of the defined design 

space regarding the power input per volume, mixing efficiency and the 

k L a-value. This indicates that the stirred single-use bioreactor family is 

suitable for cell culture applications. The design criteria of the CultiBag 

STR family directly relates to those from reusable systems. Therefore, 

existing challenges for a scale-up or process transfer are removed due to 

the improved design. Consequently, this technology represents an 

important step towards further maturity of single-use bioreactors and 

their acceptance. 

References 

1. Brecht R: Disposable Bioreactors: Maturation into Pharmaceutical 

Glycoprotein Manufacturing. Adv Biochem Engin/Biotechnol 2009, 115:1-31. 

2. Eibl D, Peuker T, Eibl R: Single-use equipment in biopharmaceutical 

manufacture: a brief introduction. Single-use technology in 

biopharmaceutical manufacture Wiley, Hoboken: Eibl R, Eibl D 2010, 3-11. 

3. Löffelholz C, Husemann U, Greller G, Meusel W, Kauling J, Ay P, Kraume M, 

Eibl R, Eibl D: Bioengineering Parameters for Single-Use Bioreactors: 

Overview and Evaluation of Suitable Methods. Chem Ing Tech 2013, 

85:40-56. 

4. Noack U, Verhoeye F, Kahlert W, Wilde D de, Greller G: Disposable stirred 

tank reactor BIOSTAT® CultiBag STR. Single-use technology in 

biopharmaceutical manufacture Wiley, Hoboken: Eibl R, Eibl D 2010, 225-240. 

5. Ruhl S, Dreher T, Husemann U, Jurkiewicz E, Greller G: The successful 

transfer of a modern CHO fed-batch process to different single-use 

bioreactors. Poster ESACT Lillé 2013. 

6. Storhas W: Aufgaben eines Bioreaktors. Bioreaktoren und periphere 

Einrichtungen Vieweg & Sohn Verlagsgesellschaft, Braunschweig/Wiesbaden 

1994, 15-86. 

7. Zlokarnik M: Bestimmung des Mischgrades und der Mischzeit. 

Rührtechnik, Theorie und Praxis, Springer-Verlag Berlin Heidelberg New York 

2002, 97-99. 

8. Wise W S: The measurement of the aeration of culture media. J Gen 

Microbiol 1951, 5:167-177. 

P56 

Full transcriptome analysis of Chinese Hamster Ovary cell lines 

producing a dynamic range of Coagulation Factor VIII 

Christian S Kaas 1,2* , Claus Kristensen 1 , Jens J Hansen 1 , Gert Bolt 1 , 

Mikael R Andersen 2 

1 Department of Mammalian cell technology, Novo Nordisk A/S, Maaloev, 

2760, Denmark; 

2 Center for Microbial Biotechnology, Technical University of 

Denmark, Kgs Lyngby, 2800, Denmark 

E-mail: csrk@novonordisk.com 


Background and novelty: Coagulation Factor VIII (FVIII) is an essential 

cofactor in the blood coagulation cascade. Inability to produce functional 

FVIII results in haemophilia A which can be treated with recombinant 

FVIII [1]. Chinese Hamster Ovary (CHO) cells are the most used cell line for 

producing complex biopharmaceuticals due to its ability to perform 

complex post-translational modifications. When mammalian cells 

overexpress a protein like FVIII they will adapt by regulating various proteins 

and pathways to support synthesis/production of this protein. Yields of FVIII 

produced in CHO are low and for this reason a greater understanding of




Figure 1(abstract P55) Process engineering parameters of the CultiBag STR family. (a) Characteristics of the power input per volume, (b) mixing 

time characteristics, (c) k L a-values for the aeration with the ring sparger part, (d) k L a-values for the aeration with the micro sparger part. 

what constitute a high producing cell line is desired. In this study a full 

transcriptome analysis was undertaken in order to analyze the differences 

between high and low producers of FVIII 

Experimental approach: The FVIII gene was introduced into CHO-DUKX- 

B11 cells and a stable pool was generated by selection with MTX. 

A number of subclones were analysed and 3 high producing clones, 

3 medium producers and 3 low (~0) producer clones were isolated. These 

9 clones were grown in shake flasks in batch culture. During the 

cultivation essential metabolites were monitored as well as cell number 

and viability. RNA was extracted after 48 hours of cultivation and 

sequenced using the Illumina HiSeq system. Reads were processed and 

aligned to the CHO-K1 genome [2] using Tophat2 and expression levels 

were deduced using htseq 

Results and discussion: Experiments showed that 48 hours into the 

cultivation cells were seen to grow in the exponential phase in media still 

containing sufficiently high amounts of glutamine and low amounts of 

lactate. Furthermore, a significant difference in FVIII levels was detected 

at this time in the media of cells from the different groups and for this 

reason this time point was chosen for extraction of RNA. 1677 genes 

were found to be differentially expressed in high vs non-producing 

clones. Among these, genes involved in oxidative stress were seen to be 

enriched (p = 1.74 × 10 -6 ). This finding is strengthened by the work by 

Malhotra et al [3] showing that CHO cell lines activate the oxidative stress 

response when producing FVIII, which might induce apoptosis. The non- 

FVIII-producing clones were seen to express predominantly truncated 

FVIII-DHFR mRNAs (Figure 1) explaining the phenotype for growth in 

media containing MTX selection but no functional FVIII expressed. Further 

analyses are ongoing. 

References 

1. Thim L, Vandahl B, Karlsson J, Klausen NK, Pedersen J, Krogh TN, Kjalke M, 

Petersen JM, Johnsen LB, Bolt G, Nørby PL, Steenstrup TD: Purification 

and characterization of a new recombinant factor VIII (N8). 

Haemophilia. The official journal of the World Federation of Hemophilia 

2010, 16:349-359. 

2. Xu X, Nagarajan H, Lewis NE, Pan S, Cai Z, Liu X, Chen W, Xie M, Wang W, 

Hammond S, Andersen MR, Neff N, Passarelli B, Koh W, Fan HC, Wang J, 

Gui Y, Lee KH, Betenbaugh MJ, Quake SR, Famili I, Palsson BO, Wang J: The 

genomic sequence of the Chinese hamster ovary (CHO)-K1 cell line. 

Nature biotechnol 2011, 29:735-741. 

3. Malhotra JD, Miao H, Zhang K, Wolfson A, Pennathur S, Pipe SW, 

Kaufman RJ: Antioxidants reduce endoplasmic reticulum stress and 

improve protein secretion. PNAS 2008, 105:18525-18530.




Figure 1(abstract P56) Depth of sequenced reads at every position of the FVIII gene. It is seen that the 3 non-producing clones transcribe 

5’-truncated RNA species. This would explain the phenotype of no FVIII protein production but growth under MTX selection as the IRES element 

containing DHFR is still transcribed. 

P57 

Production of monoclonal antibody, Anti-CD3 by hybridoma cells 

cultivated in Basket Spinner under free and immobilized conditions 

Elsayed A Elsayed 1,2* , Hoda Omar 3 , Hasnaa R Shahin 4 , Hamida Abou-Shleib 3 , 

Maha El-Demellawy 4 , Mohammad Wadaan 1 , Hesham A El-Enshasy 4,5 

1 Bioproducts Research Chair, Zoology Department, Faculty of Science, King 

Saud University, 11451 Riyadh, Kingdom of Saudi Arabia; 

2 Natural & Microbial 

Products Department, National Research Centre, Dokki, Cairo, Egypt; 

3 Microbiology Department, Faculty of Pharmacy, Alexandria University, Egypt; 

4 City for Scientific Research and Technology Applications, New Burg Al Arab, 

Alexandria, Egypt; 

5 Institute of Bioproducts Development, Universiti 

Teknologi Malaysia, Skudai, Johor, Malaysia 

E-mail: eaelsayed@ksu.edu.sa 


Background: Monoclonal antibodies (Mabs) have been recently used for 

the treatment of virtually every debilitating disease. Packed-bed 

bioreactors have been used for the cultivation and production of a wide 

range of cell lines and biologics including MAbs. The principle behind a 

Packed-bed bioreactor is that the cells are being immobilized within a 

suitable stationary matrix which is represented by the bed. Packed-bed 

bioreactors also have the advantage of being capable of generating high 

cell densities with a low concentration of free cells in suspension; hence, 

simplifying downstream processing. Thepresentworkwasdesignedto 

compare between the cultivation of hybridoma cells as well as the 

production of OKT3 MAb in free and immobilized culture conditions. 

Materials and methods: Hybridoma cell line (OKT3), producing IgG2a 

monoclonal antibodies against CD3 antigen of human T lymphocyte cells 

were adapted to grow in serum free medium. The specificity of the produced 

MAbs was determined through the use of indirect immunofluorescence




staining of T lymphocytes from peripheral blood followed by flowcytometeric 

analysis using cell quest software and FACSCalibur. The MAb was 

continuously produced by the cultivation of hybridoma cells in Basket 

Spinner. The cells were immobilized within the Fibra-Cel® disks. For 

comparison, two Basket Spinners were used in parallel, one of them was 

packed with 5 gm of Fibra-Cel® disks, and the other was used as a control for 

the cultivation of free cells. Samples were daily collected throughout the 

cultivation for the determination of cell viability using Trypan blue exclusion 

method. Glucose/lactate concentrations were determined using automatic 

glucose/lactate analyzer. The concentration of MAb was determined by direct 

ELISA assay. 

Results: Determination of MAb specificity: Secondary fluorescence 

antibodies bounded to the produced antibody which in turn is bound to 

CD3 positive lymphocytes (T-cells) showed a percentage of CD3 positive 

lymphocytes of 76.68%. This was proved using indirect immunofluorescence 

staining of healthy volunteer T lymphocytes from peripheral blood. Forward 

scatter (FSC) versus side scatter (SSC) can allow for the differentiation of 

blood cells in a heterogeneous cell population. 

When the “gated” cells were analyzed for their emitted fluorescence upon 

stimulation by the laser beam, high fluorescence is produced from the 

cells that react with FITC- anti-mouse specific antibody which reflects CD3 

antibody content in the added culture supernatant. Histogram statistics 

showed that there were 2513 events inside the gated lymphocytes; the 

percentage of lymphocytes that were CD3 positive was 76.68%. 

Continuous production of MAb by the cultivation of hybridoma 

cells in Basket spinner: In this work two Basket Spinners were used in 

parallel, one of them was packed with 5 gm of Fibra-Cel disks (Figure 1), and 

the other was used as control without packing (free living cells). For the free 

Basket Spinner, the growth and viability of the hybridoma cells as well as their 

metabolic activities and mAb productivity were determined after 120 h. Viable 

cell concentration increased only during the first 72 h of cultivation reaching 

9.2 × 10 5 Cells mL -1 . On the other hand, mAb production reached its 

maximum concentration of 206.5 mg L -1 also at 72 h. For the immobilized 

Basket Spinner, the growth and viability of the hybridoma cells as well as their 

metabolic activities and mAb productivity were determined for 288 h. The 

Culture medium was perfused through the bed to supply cells with nutrients. 

This allowed the spinner to run as repeated batch, enabling long term 

cultivation of cells. The number of viable, and dead cells determined over the 

12 days of the cultivation corresponded to the cells detached from Fibra-CelR 

disks and does not reflect the actual cell number. On the other hand, the 

mAb titer increased in each batch reaching its maximum concentration of 

298.5 mg L -1 at batch number VI (after 216 h of cell inoculation). 

It was found that the rates of glucose consumption and lactate 

production increased for each batch where the medium was changed 

once after the first 72 h and then the batch time was further reduced to 

only 48 h in the subsequent batches, then once each 24 h over the 

remaining 12 days of the cultivation period. The maximum production of 

lactate was 2.74 g L -1 occurred at batch number VII (after 240 h). 

Upon comparing at 72 h of cultivation, it was found that the produced 

mAb in case of the immobilized Basket Spinner was higher than that 

produced in case of the free Basket Spinner, however, the rate of glucose 

consumption and lactate production at the same time interval for the 

former was lower than the later (2.2, 1.825 g L -1 for glucose and 1.27, 

2.075 g L -1 for lactate, respectively). 

Conclusion: The results obtained revealed that upon using flow cytometry 

and the fluorochrome-conjugated secondary antibody attached specifically 

to MAb present in the supernatant from the cells adapted to serum free 

medium succeeded in sorting 76.8% of the gated cells (lymphocytes). This 

confirmed the binding of MAb of the adapted cells to CD3 positive 

lymphocytes. Which means that, stable hybridoma cells adapted to grow in 

serum free medium (SMIF-6) were successfully obtained. It was also 

observed upon using the backed spinner basket, the MAb titer increased in 

each successive batch to reach to 298.5 mg L -1 after 216 h. This might be 

due to the protection of the cells against shear stress and air/O 2 sparging by 

their immobilization on the microcarriers, promoting the use of serum- or 

protein-free medium. Moreover, the microcarrier is designed to ensure 

sufficient nutrient supply and also to remove toxic metabolites. On the other 

hand, the rate of glucose consumption and lactate production increased for 

each repeated batch. This explains why the decrease in the batch period. 

This indicated the good physiological state of the cells. 

P58 

Using Rice Bran Extract (RBE) as Supplement for Mescenchymal Stem 

Cells (MSCs) in Serum-free Culture 

Rinaka Yamauchi 1 , Ken Fukumoto 1 , Satoko Moriyama 1 , Masayuki Taniguchi 2 , 

Shigeru Moriyama 3 , Takuo Tsuno 3 , Satoshi Terada 1* 

1 University of Fukui, Fukui, 910-8507, Japan; 

2 Niigata University, Niigata, 950- 

2102, Japan; 

3 Tsuno Food Industrial Co., Ltd, Katsuragi-cho, Wakayama, 649- 

7122, Japan 

E-mail: terada@u-fukui.ac.jp 


Figure 1(abstract P57) Kinetics of cell growth, metabolism, and 

MAb production during cultivation of hybridoma cells in packed 

Basket Spinner. 

Introduction: Currently, therapies using multipotent mescenchymal stem 

cells (MSCs) are tested clinically for various disorders, including cardiac 

disease [1]. However, conventional culture media contain fetal bovine 

serum (FBS) and so the concern about amphixenosis remains. Therefore, 

developing animal derived factor-free media are desired [2]. 

We previously reported that rice bran extract (RBE) significantly improved 

the proliferation of various cell lines and the cellular functions. In this 

study, we tested the effect of RBE on MSCs in serum-free culture. 

Materials and methods: Effect of RBE on osteogenic differentiation: 

MSCs obtained from the bone marrow of Wistar rats were cultured under 

conventional a-MEM with 15% FBS medium, supplemented with or without 

RBE for three days at passage 1 - 3. After treatment with RBE for three days, 

the media were replaced by RBE-free osteogenic medium composed of 

a-MEM containing 10% FBS, 10 mM b-glycerol phosphate (Merck, USA), 

0.05 mM L-ascorbic acid 2 phosphate (Sigma, USA), 10 nM dexamethasone 

(Sigma), 1% penicillin-streptomycin solution and the cells were cultured in 

the medium for 24 days. To evaluate the differentiation ability, the cells 

were stained with Alizarin Red S and analyzed by using Image J.




Figure 1(abstract P58) Effect of RBE on osteogenic differentiation. 

Effect of RBE on cell proliferation: After MSCs were cultured in the 

presence of RBE for three days, viable cell number was measured by the 

trypan blue dyeing assay on a hemocytometer. 

Effect of RBE on gene expression after expansion: After treatment 

with RBE for three days, cells were lysed to be analyzed the maintaining 

MSC markers with real-time PCR. Total RNA from the cells was isolated by 

Acid Guanidinium Phenol Chloroform method and cDNA was synthesized 

with supersucriptTM (Invitologen, USA). These cDNAs were analyzed by 

LightCycler R480 (Roche, Germany) using primers: MSC markers, CD44, 

CD105 and CD166, and osteogenic genes, BMP2, ALPL, OCN. The results 

were normalized with respect to GAPDH or HPRT. Relative mRNA quantify 

was calculated using the comparative ΔΔCT. 

Results and discussion: AsshowninFigure1,thresholdarea(%)was 

significantly increased in MSCs expanded in the presence of RBE in 

comparison with in absence (*P < 0.03), suggesting that the cells expanded 

in RBE-containing medium differentiated into bone superior to the negative 

control cells. 

The viable cell densities in the culture with and without RBE were quite 

similar, suggesting that increase in osteogenisis with RBE is not due to the 

population of the cells. Expression levels of MSC markers such as CD44, 

CD105 and CD166, were not up- nor down-regulated in the presence of RBE 

during expansion, whereas that of osteogenic gene BMP2 was remarkably 

reduced. These results suggest that RBE does not induce osteogenesis 

during expansion and imply that RBE could keep MSCs undifferentiatiated. 

Treatment with RBE during expansion up-regulated the expression levels of 

osteogenic genes including ALPL and OCN in MSCs during osteogenic 

differentiation. 

Conclusion: Decreased osteogenic differentiation ability of MSCs after 

expansion could be maintained by addition of RBE into expansion 

medium. RBE is a candidate for the novel supplement for maintaining 

differentiation ability of MSCs in expansion culture. 

References 

1. Amado CLuciano, Saliaris PAnastasios, Schuleri HKarl, St John Marcus , 

Xie Jin-Sheng, Cattaneo Stephen, Durand JDaniel, Fitton Torin, Kuang Jin 

Qiang, Stewart Garrick, Lehrke Stephanie, Baumgartner WWilliam, 

Martin JBradley, Heldman WAlan, Hare MJoshua: Cardiac repair with 

intramyocardial injection of allogeneic mesenchymal stem cells after 

myocardial infarction. PNAS 2005, 102:11474-11479. 

2. Leopold G, Thomas RK, Sonia N, Manfred R: Emerging trends in plasmafree 

manufacturing of recombinant protein therapeutics expressed in 

mammalian cells. Biotechnol J 2009, 4:186-201. 

P59 

Viral vector production in the integrity® iCELLis® single-use fixed-bed 

bioreactor, from bench-scale to industrial scale 

Alexandre Lennaertz * , Shane Knowles, Jean-Christophe Drugmand, Jose Castillo 

ATMI LifeSciences, Brussels, 1120, Belgium 

E-mail: alennaertz@atmi.com 


Introduction: Wild-typeorrecombinantvirusesusedasvaccinesand 

human gene therapy vectors are an important development tool in 

modern medicine. Some have demonstrated high potential such as 

lentivirus, paramyxovirus and adeno-associated-virus (AAV). These vectors 

are produced in adherent and suspension cell cultures (e.g. HEK293T, 

A549, VERO, PER.C6, Sf9) using either transient transfection (e.g PEI, calcium 

phosphate precipitation) or infection (e.g. modified or recombinant viruses) 

strategies. Most of these processes are currently achieved in static mode 

on 2-D systems (Roller Bottles, Cell Factories, etc.) or on suspended microcarriers 

(porous or non-porous). However, these two systems are timeconsuming 

(large numbers of manipulation, preparation of equipment, etc.) 

and hardly scalable. In regards to process simplification and traceability, 

Integrity® iCELLis® bioreactors offer a new solution for scalability and 

monitoring of adherent cell cultures. 

The Integrity iCELLis Bioreactor: Integrity® iCELLis® bioreactors from 

ATMI LifeSciences were designed for adherent cell culture applications 

such as recombinant protein, viral vaccine and gene therapy vector 

production. Using PET carriers trapped into a fixed-bed, cells grow in a 3-D 

environment with temperature, pH and dissolved oxygen controls. The 

iCELLis technology can be used at small-scale (the iCELLis nano from 0.5 to 

4m 2 ) and manufacturing scale (iCELLis 500 from from 66 to 500 m 2 ) which 

eases process scale-up and its overall utilization. 

Materials and methods: All the experiments described here have been 

performed in the bench-scale and pilot scale iCELLis bioreactors 

containing iPack carriers made of 100% pure non-woven PET fibers. 

Crystal violet was used for cell nuclei counts from carriers. 

Recombinant viral vectors production: Some recombinant entities are 

produced in the iCELLis bioreactors using hybrid vectors. For example, 

A549-stable packaging cell line, maintained in Optipro medium + 1% FBS, 

can deliver recombinant AAV vectors frequently used in gene transfer 

applications (Inserm UMR 649, Institut de Recherche Thérapeutique). 

Alternatively, other rAAV vectors are obtained by transient transfection. In 

this case, HEK293-T cells are regularly found to be sensitive to the viral 

DNA and transfection reagent complex (generally polyethylenimine - PEI 

or phosphate calcium precipitate). The transfer of the transfection process 

from static or dynamic systems to the iCELLis bioreactors requires some 

adaptation in order to fully benefit of both technologies. Using a 

fluorescent protein marker, the transfected cells can be observed during 

the culture and the viral vectors can be quantified after the harvest. 

Transfection method using the PEI/DNA complexes is frequently found in 

cell suspension processes due to its high efficiency and adaptability to 

high-throughput systems. The circulation pattern of the medium through 

the fixed-bed of the iCELLis system allows a good contact between cells 

and transfection complexes. 

The transfection by phosphate precipitation is a static method where the 

DNA precipitates settle on the cells. For this reason, it is difficult to apply 

this technic in dynamic conditions. To be able to implement it in the 

iCELLis bioreactor, the agitation speed has to be minimal to get a 

medium circulation through the fixed-bed. This maintains the precipitate 

in suspension while giving the longest contact time between these 

precipitates and the cells. The iCELLis system with its pH regulation and 

low-shear circulation is well adapted for this method sensitive to small 

pH changes and reagent mix. 

Results: Recombinant adeno-associated virus vector production: 

Recombinant AAV vectors were produced in an A549 based stable 

packaging cell line containing the AAV2 rep and cap genes from various 

AAV serotypes. Using a dual adenovirus infection (wild-type Ad5 followed 

by hybrid Ad/AAV) in the iCELLis nano bioreactor under perfusion mode, 

recombinant particles were harvested up to 96 hours post-infection. The 

expression levels of the AAV2 rep and cap genes from various AAV 

serotypes were assessed by western-blot and qPCR. This 8-days process 

demonstrated higher vector particles production in the iCELLis bioreactor 

compared to CS-5 control (4.5 × 10 8 vs 3.1 × 10 8 vg/cm 2 ,72hafterthe 

first infection) (Inserm UMR649, Institut de Recherche Thérapeutique). 

Triple transient transfection using PEI was performed in the iCELLis nano 

system (0.53 m 2 , 40 mL fixed-bed) for the production of serotype 5 AAV 

in HEK 293T cells. Cells were seeded at 80,000 cells/cm 2 in the CS10 and 

the iCELLis bioreactor. Twenty-four hours post-inoculation, the DNA-PEI 

mix containing the GFP gene was added to fresh medium inside the 

bioreactor. Cells were still growing on the carriers after the transfection. 

The expression of GFP by cells demonstrated that the transfection had a 

high efficiency rate in both vessels (FACS analysis on sampled carriers for




• Paramyxovirus production in Vero cells 

• Undisclosed lytic virus in Vero cells 

Transfer and scale-up of a HEK293 cell culture process for 

production of adenovirus: Small Scale Development 

An existing process using HEK293 cells for the production of adenovirus 

was first transferred from multi-tray systems to an iCELLis nano bioreactor 

(0.53 m 2 , 40 ml of fixed-bed) by keeping equivalent cell culture 

parameters: 

• Temperature, pH, DO (% saturation with air) 

• Multiplicity of infection (pfu/cell) 

• Time of infection 

• Cell seeding density (cells/cm 2 and cells/mL) 

• Culture duration 

Figure 1(abstract P59) Comparison of Green Fluorescent Units and 

Viral Genome/cm 2 and VG/GFYU ratio in the CS10 and iCELLis 

nano 0.53 m 2 . 

the iCELLis bioreactor). Green Fluorescent Units (GFU) and Viral Genome 

(VG) were measured for the CS10 control and the iCELLis nano bioreactor. 

Viral particles were harvested using a freeze/thaw method, suboptimal in 

the case of the iCELLis system. The GFU and VG titers/cm 2 in the iCELLis 

bioreactor were about 53% of the control (Figure 1) (Dept of Biochemical 

Eng. - UCL). 

Conclusions: We demonstrated that the iCELLis system could be very 

useful for production of viral vaccine and gene therapy vectors. The 

iCELLis platform facilitates handling and scale-up, high biomass 

amplification and sterile containment within a closed system. Moreover, 

in many cases, the specific culture environment enhances virus 

production yields. 

Specifically, after some optimization of the culture parameters, it was 

demonstrated that rAAV vectors were produced by modified A549 cells in 

high viral level in the 0.53 m 2 iCELLis bioreactor. The maximum viral yield 

achieved in the bioreactor was 4.5 × 10 8 vg/cm 2 , which was higher than 

the yield per cm 2 obtained in a CellSTACK vessel (3.1 × 10 8 vg/cm 2 ). 

Finally, the preliminary results of transfection demonstrated that the 

method using PEI is applicable in the iCELLis bioreactors, with 

optimization of the viral recovery at harvest yet to be performed. This 

also demonstrated that the iCELLis can be considered as a solution for 

transient transfection processes at large scales. 

P60 

Linear scalability of virus production in the integrity® iCELLis® 

single-use fixed-bed bioreactors from bench to industrial scale 

Shane Knowles * , Jean-Christophe Drugmand, Nicolas Vertommen, 

Jose Castillo 

ATMI LifeSciences, Rue de Ransbeek 310, Brussels, 1120, Belgium 

E-mail: sknowles@atmi.com 


Introduction: In order to maximize cell growth within a compact space 

and retain cells for easy medium exchange, the iCELLis bioreactors from 

ATMI LifeSciences contain macro-carriers trapped in a fixed-bed, creating 

a 3-D matrix within which cells adhere and replicate. These bioreactors 

also enable precise temperature, pH and dissolved oxygen control which 

cannot be done in 2-D cultures. 

The iCELLis technology can be used at small and large scales with 

straightforward process scale-up, easy single-use operations and minimal 

space requirement. 

Here we present a summary of adherent cell process development in 

iCELLis bioreactors, including: 

• HEK 293 cell expansion for production of adenovirus 

• MVA virus production in CEF cells 

• Bovine Herpes Virus production in MDBK cells 

• Recombinant Adeno-Associated Virus in A549 cells 

• Adenovirus production in A549 cells 

• Influenza virus production in Vero cells 

Additional experiments were performed with lower cell densities at 

inoculation in order to reduce the number of pre-culture steps at large 

scale. The following parameters were also optimized for cell growth and 

virus productivity: 

• Compaction of carriers inside the fixed-bed (96 g/L or 144 g/L) 

• Linear velocity of medium through the fixed-bed (cm/s). 

• Fixed-bed height (2,4 or 10 cm) 

Industrial scale-up: The scale-up of iCELLis technology is similar to that 

of chromatography columns. The difference in fixed bed geometry from 

small to large scale is that the cross-sectional area increases, while the 

fixed-bed (FB) height remains constant. Therefore, cell seeding, nutrient 

and oxygen delivery throughout the fixed bed are comparable at small 

and large scale. 

After determining optimal parameters at small scale, HEK293 cell culture 

batches were performed in duplicate with small and large scale 

bioreactors. Inoculation density, medium volume ratios, culture duration, 

pH, DO and temperature set points were kept identical. Consistent cell 

densities of 2.7 to 3.8 cells/cm2 were achieved in multiple experiments at 

both small and large scale. Analysis of glucose and lactate (Figure 1) at 

both scales in comparison to a 5-tray Cell Factory control indicated that 

cell metabolism was comparable between small and large scale iCELLis 

bioreactors and the standard 2D process. 

Additional Virus Production Process Development: Results of 

experiments performed for production of several viruses in various cell 

lines at various bioreactor scales are shown in Table 1. Bench scale 

bioreactors were used for each process to determine what conditions and 

feeding strategies sustained the highest growth rates and cell densities. 

Bench scale bioreactors were used for each process to determine what 

conditions and feeding strategies sustained the highest growth rates and 

cell densities. 

For chicken embryonic fibroblasts (CEF) and production of Modified 

Vaccinia Ankara (MVA), a prototype “Artefix” bioreactor (the predecessor 

of iCELLis) with a 0.07 m 2 fixed-bed surface area was tested. 

Intermediate “pilot” scale prototype iCELLis bioreactors with surface areas 

of 20 or 40 m 2 were used to test Vero and MDBK cell processes. 

The Vero cell process was scaled up to a 660 m 2 bioreactor. In this case, 

cells were inoculated at only 3200 cells/cm 2 using two 40-tray Cell 

Factories (2.5 m 2 each), equivalent to fifteen roller bottles (1700 cm 2 

each). With such a low seeding density the seed train required for 

inoculation is simplified extensively compared to standard 2D cell culture 

processes. The Vero cell density reached 2.3 × 10 5 cells/cm 2 for a total 

biomass of 1.5 × 10 12 cells in 11 days. A complete medium exchange was 

then performed, followed by virus infection. Continuous perfusion of 

medium was used during the production phase. While the virus type and 

productivity data is confidential, the results indicated that virus output 

was equivalent or better than expected based on the standard 2D 

process. 

Conclusions: This summary of experiments demonstrates that the fixedbed 

design of the iCELLis bioreactor enables high cell densities to be 

achieved and maintained in both small and large bioreactor volumes. 

Different processes have been easily scaled up by keeping cell culture 

conditions and process parameters identical to the standard 2-D cell 

culture process. 

The iCELLis bioreactor can be inoculated at a very low cell density, 

leading to a dramatic simplification of seed train operations and a 

significant reduction of development timelines.




Figure 1(abstract P60) Comparability of Glucose (Top Panel) and Lactate (Bottom Panel) Profiles of HEK293 culture in iCELLis 133 m 2 (Blue), 

iCELLis nano 1.06 m 2 (Green) and 5-tray Cell Factory (Red). 

In conclusion, large biomass amplification and excellent virus productivities, 

combined with the advantages of a fully closed disposable system with low 

shear stress, make the iCELLis fixed-bed bioreactor a simple and 

straightforward solution for industrial production of viruses. 

P61 

Scale-up of hepatic progenitor cells from multitray stack to 2-D 

bioreactors 

Matthieu Egloff 1* , Florence Collignon 1 , Jean-François Michiels 1 , 

Jonathan Goffinet 1 , Sarah Snykers 2 , Philippe Willemsen 2 , Christophe Gumy 2 , 

Claude Dedry 2 , Jose Castillo 2 , Jean-Christophe Drugmand 1 

1 ATMI LifeSciences, Brussels, Belgium, 1120; 

2 Promethera Biosciences, Mont- 

Saint-Guibert, 1435, Belgium 

E-mail: megloff@atmi.com 


Introduction: Promethera Biosciences (Mont-St-Guibert, BE) is developing 

cell therapies to treat several liver genetic metabolic diseases, such as the 

Crigler-Najjar syndrome. Human heterologous adult liver progenitors cells 

(HHALPCs) were initially cultivated in 2D standard cultivation devices. The 

present study is investigating the feasibility to cultivate HHALPCs in 

Xpansion bioreactors, with the following objectives: 

➢ The process must be closed 

➢ The growth rate and population-doubling level (i.e. the number of 

times the cells in the population has doubled) must be at least 

equivalent to the current process in multilayer trays 

➢ The process must comply to the cGMP rules 

➢ The cells must succeed the quality control (QC) test specifications 

at the end of cultivation, i.e. cells must remain undifferentiated and 

show the presence of HHAPLCs markers, while exhibiting the 

capacity to differentiate toward functional hepatocytes. 

Integrity® Xpansion multiplate bioreactors have been specifically 

designed to enable an easy transfer from existing multiple-tray-stack 

processes by offering the same cell growth environment on 2-D 

hydrophylized Polystyrene (PS) plates in a fully closed system. To make 

the bioreactors compact, the headspace between each plate has been 

reduced to a minimum (1.3 mm). Gas transfer is made through a semipermeable 

silicone tubing mounted in the central column. Additionally, 

critical cell culture parameters such as pH and DO are controlled and the 

cell density is automatically monitored via a specific holographic 

microscope developed by Ovizio 

Materials and methods: Cell culture parameters: ✓ pH set-point: 7.5 

✓ DO regulated > 50% 

✓ No agitation during the first 8 hours after plating 

Table 1(abstract 60) Summary of results of virus production processes tested in various cell lines in iCELLis 

bioreactors (or predecessors) 

Cells Virus Bioreactor Surface 

Area (m 2 ) 

Average Cell Density 

at TOI (cells/cm 2 ) 

Specific Virus 

Productivity 

Total Virus 

CEF Modified Vaccina Ankara Artefix 0.07 3.9E+05 3.0E+06 pfu/cm 2 2.1E+09 pfu 

MDBK Bovine Herpes Virus iCELLis nano 4 1.2E+05 2.2E+07 pfu/cm 2 8.7E+11 pfu 

iCELLis pilot 20 1.4E+05 1.7E+07 pfu/cm 2 3.4E+12 pfu 

iCELLis 500 66 3.3E+05 3.3E+07 pfu/cm 2 2.2E+13 pfu 

A549 rAAV iCeLLis nano 0.53 6.0E+04 5.3E+08 vg/cm 2 2.8E+12 vg 

Adenovirus iCELLis nano 2.67 2.3E+05 1.1E+10 TCID50/cm 2 3.0E+14 TCID50 

Vero Influenza iCELLis nano 4 1.0E+05 3.8E+06 TCID50/cm 2 1.5E+11 TCID50 

iCELLis pilot 20 7.5E+04 2.5E+06 TCID50/cm 2 5.0E+11 TCID50 

Paramyxovirus iCELLis nano 2.67 2.7E+05 6.4E+05 TCID50/cm 2 1.7E+10 pfu 

Vero Undisclosed Lytic Virus iCELLis pilot 40 1.5E+05 Confidential Confidential 

iCELLis 500 133 1.5E+05 

iCELLis 1000 660 2.3E+05




Table 1(abstract 61) Scale-up feasibility of stem cells growth in Xpansion bioreactor 

QUALITY CONTROL TEST 

Xpanion10 

(Five runs) 

Xpansion 50 

(Two runs) 

Xpansion 180 

(Three runs) 

CELL CULTURE SURFACE (CM 2 ) 6.120 30.600 110.160 / 

AVERAGE CELL QUANTITY AT HARVEST 1.8 × 10 8 9×10 8 3.3 × 10 9 / 

VIABILITY ≥90% ≥90% ≥90% ≥90% 

GROWTH PROFILE Normal Normal Normal Normal 

CONFLUENCY √ √ √ √ 

HOMOGENEOUS CELL DISTRIBUTION & 

MORPHOLOGY 

√ √ √ √ 

IDENTITY 

CYP3A4 Activity 

IDENTITY 

Phenotype 

PURITY 

POTENCY 

(Urea secretion) 

POTENCY 

(Bilirubin Conjugation) 

Conform 

>10 -8 pmol/cell/4 h 

Conform 

CD73, CD90>60% 

ALB+, vim+, ASMA+ 

Conform 

CD31+CD133+ 

CD45+CK19 < 15% 

ConforM 

4/5* 

Conform 

4/5* 

Conform 


Conform 

CD73, CD90>60% 


Conform 

CD31+CD133+ 

CD45+CK19 < 15% 

ConforM 

1/2* 

Conform 

2/2 

Conform 


Conform 

CD73, CD90>60% 


Conform 

CD31+CD133+CD45+ 

CK19 < 15% 

Conform 

3/3 

Conform 

(pending) 

In-Line Centrifugation 

Three runs 

Conform 


Conform 

CD73, CD90>60% 


Conform 

CD31+CD133+CD45+ 

CK19 < 15% 

Conform 

3/3 

Conform 

(pending) 

Cell properties are checked throughout the scale-up process and results are expressed in terms of cell viability, confluence, morphology, growth and cell 

characterization (identity/purity/potency). * 1 QC failed in the Xpansion 10 & Xpansion 50 bioreactors but QC were similar to their respective CS control (not 

related to the bioreactor). 

Stem cells expansion and harvesting: ✓ Inoculation: 5,000 cells/cm 2 

✓ Harvest: 20,000-40,000 cells/cm 2 

✓ 10% serum-containing medium 

Results: Xpansion 10 was used to prove feasibility of stem cell growth in 

Xpansion multiplate bioreactor and to optimize cell culture parameters. The 

goal was to perform a simple process transfer from multitray stack (e.g. 

Corning CellStack (CS)) to the Xpansion by mimicking cell culture conditions. 

All Xpansion runs achieved similar results to their control in terms of cell 

density, homogenous distribution, viability and morphology. Additional 

quality control (QC) analysis revealed that cell characteristics were 

maintained (identity/purity/potency) (table 1) 

Scale-up from the Xpansion 10 to the Xpansion 180: Cultures were 

directly transferred from the Xpansion 10 bioreactor to the larger scales 

Xpansion 50 and Xpansion 180 bioreactors, where cells reached similar 

levels of growth and confluence (Table 1). Further analysis of the cultures 

at all scales showed compliancy with the QC specifications. In order to 

keep the process within a closed system, cells harvested from Xpansion 

180 were directly centrifuges. The in-line continuous centrifugation step 

achieved 80% yields while maintaining cells characteristics (Table 1). 

Xpansion bioreactor regulation: Figure 1 shows the pH and DO 

regulation profiles of cultures in Xpansion 10 and Xpansion 180. The 

trends of both bioreactors are highly similar, except that the duration of 

a regulation cycle is longer in the Xpansion 180 compared to the 

Figure 1(abstract P61) Regulation parameters in XP-10 (A) or XP-180 (B) in the course of time, pH (green), D.O. (blue) and T° (red) evolution. 

Set points (dashed lines) were fixed at 7.5 for pH and D.O. >50%. T° peaks are due to Xpansion disconnection for microscopic observation or samplings.




Xpansion10.Thisisduetothelongerhomogenizationtime.Thegas 

diffusion system through the silicone tubing is efficient. 

Cell observation using the holographic microscope - iLine: The iLine 

holographic microscope and the Xpansion bioreactors are designed to 

allow cell observation on the first ten plates of each bioreactor. The 

microscope software enables an automatic cell counting of the cell 

confluency. Cell confluence assessment through DDHM microscope is a 

key element for defining cell harvest time given that cell confluence 

levels are critical to guarantee cell characteristics. 

Conclusions: The Integrity Xansion multiplate bioreactors demonstrated 

their efficiency for the growth of progenitor of hepatocyte cells at large 

scale while keeping the cell therapeutic potency. 

The use of a robust process control system and the iLine microscope 

enabled to record the evolution of the culture: 

➢ Sampling port that can be used for dosing of nutrients, growth 

factors, etc. 

➢ On-line pH and D.O. tracking 

➢ Off-line microscopic observations 

The Xpansion 10 bioreactor proved to be a useful tool for determining 

optimal cell culture parameters. Actually, several runs could be performed 

using this scaled-down, while sparing time and money and extrapolating 

the cell behavior, the pH and DO trends in the Xpansion 50 and 

Xpansion 180. The new Xpansion bioreactor offers a valuable technology 

for large-scale production while meeting GMP compliancy. Moreover, the 

in-line centrifugation step guarantees a closed manufacturing process, 

from seeding to freezing. 

P62 

Characterization and quantitation of fluorescent Gag virus-like particles 

Sonia Gutiérrez-Granados, Laura Cervera, Francesc Gòdia, 

María Mercedes Segura * 

Departament d’Enginyeria Química, Universitat Autònoma de Barcelona, 

Bellaterra, Barcelona, 08193, Spain 

E-mail: mersegura@gmail.com 


Background: Upon expression, the Gag polyprotein of HIV-1 

spontaneously assembles giving rise to enveloped virus-like particles 

(VLPs). These particulate immunogens offer great promise as HIV-1 

vaccines. In order to develop robust VLP manufacturing processes, the 

availability of simple, fast and reliable quantitation tools is crucial. 

Traditionally, commercial p24 ELISA kits are used to estimate Gag VLP 

concentrations. However, this quantitation technique is time-consuming, 

laborious, costly and prone to methodological variability. Reporter 

proteins are frequently used during process development to allow a 

straightforward monitoring and quantitation of labeled products. This 

alternative was evaluated in the present work by using a Gag-GFP fusion 

construct. 

Materials and methods: Generation of fluorescent VLPs was carried out 

by transient transfection of HEK 293 suspension cells with a plasmid 

coding for Gag fused to GFP (NIH AIDS Reagent Program). VLP budding 

from producer cells was visualized by electron microscopy (JEM-1400, Jeol) 

and confocal fluorescence microscopy (Fluoview® FV1000, Olympus, 

Japan). A purified standard of Gag-GFP VLP material was obtained by 

ultracentrifugation through a sucrose cushion and fully characterized. SDS- 

PAGE,Westernblot,size-exclusionchromatography (SEC), nanoparticle 

tracking analysis (NTA, NanoSight®, UK) and transmission electron 

microscopy (TEM) were used for VLP characterization. The standard VLP 

material was used for the development and validation of a Gag-GFP VLP 

quantitation technique based on fluorescence. Viral particle titers 

estimated using this method were compared with those obtained by p24 

ELISA (Innotest®, Innogenetics, Belgium), densitometry, TEM and NTA. 

Results: Upon transfection, Gag-GFP was expressed in the cytoplasm of 

the producer cells and accumulated in the vicinity of the plasma 

membrane where the budding process takes place. Upon staining with 

Cell Mask, co-localization of green (Gag-GFP molecules) and red (lipid 

membrane) fluorescence was observed in yellow (Figure 1A). VLP 

budding was also visualized in TEM images of ultrathin sectionsofHEK 

293 producer cells (Figure 1B). 

A purified Gag-GFP VLP standard material was obtained by harvesting 

VLPs from cell culture supernatants of transfected HEK 293 cells by low 

speed centrifugation followed by VLP pelleting through a 30% sucrose 

cushion. The purity of the standard material was analyzed by SEC. The 

SEC chromatogram showed a single peak eluting in the column void 

volume (V 0 = 44 mL) as determined by UV and fluorescence analyses of 

collected fractions (Figure 1D). The A260/A280 ratio was 1.24 which is 

consistent with reported ratios for purified retroviral particles [1]. The 

standard VLP material was further characterized using different 

techniques. Particle morphology was analyzed by TEM. Roughly spherical 

viral particles surrounded by a lipid envelope and containing an electrodense 

core could be observed (Figure 1C). The mean VLP diameter 

according to TEM analysis was determined to be 141 ± 22 nm (n = 100), 

which is the expected size of Gag-GFP VLPs as they resemble immature 

HIV particles that are larger than wild-type HIV-1 virions [2]. NTA analyses 

of the standard material showed that the most frequent particle size 

value (statistical mode) was 149 ± 5 nm, which is consistent with our 

TEM results. SDS-PAGE analysis of the standard VLP material (Figure 1E) 

was performed. Approximately, 65% of the total protein loaded in the gel 

corresponded to Gag-GFP (Figure 1E, full arrow), the major HIV-1 VLP 

structural protein. The other minor bands should correspond to cellular 

proteins derived from host cells as retroviral particles are known to 

promiscuously incorporate a significant amount of host proteins [3,4]. A 

Gag-GFP band of the expected molecular weight (~81 kDa) was 

specifically detected using an anti-p24 mAb by Western blot analysis 

(Figure 1E, full arrow). The presence of a Gag-GFP fragment (Figure 1E, 

empty arrow), representing only 5% of the total Gag-GFP loaded, was 

also observed in the gel. 

A fluorescence-based quantitation method for Gag-GFP VLPs was 

developed [5]. Validation of the quantitation assay was carried out 

according to International Conference Harmonization (ICH) guidelines [6]. 

The validation parameters evaluated included specificity, linearity, 

quantitation range, limit of detection, precision, and accuracy [5]. All 

validation parameters met the criteria for analytical method validation. 

Some parameters were also studied in parallel for p24 ELISA for 

comparison purposes (Table 1). Both techniques specifically detected 

Gag-GFP. Even though the p24 ELISA assay showed to be more sensitive 

for Gag-GFP detection, the fluorescence-based method was more precise 

and showed to be linear in a wider range. In addition, the developed 

quantitation method required less time and was considerably less 

expensive than the traditional p24 ELISA method used for Gag VLP 

quantitation. Finally, the standard VLP material was quantified using 

several methods. In order to compare the concentration of Gag-GFP in 

μg/mL as determined by the fluorescence-based method, ELISA and 

densitometry with the titers obtained by TEM and NTA analyses which 

are given in particles/mL, it was assumed that a Gag VLP contains 2500 

Gag molecules as previously reported [7]. All concentration values, 

regardless of the quantitation technique used, were in close agreement 

within an expected range. These results support the reliability of the 

fluorescence-based method developed [5]. 

Conclusions: Due to the flexibility of the retrovirus particle assembly 

process, fluorescently tagged Gag VLPs can be easily generated by 

expressing Gag as a fusion construct with GFP. Although fluorescently 

labeled Gag has mainly been used to study retrovirus replication in 

living cells, this attractive feature is exploited in our laboratory to 

facilitate the monitoring and quantitation of Gag VLPs. A purified 

standard VLP material was obtained and fully characterized. VLPs in the 

standard material showed to be of the expected size, morphology and 

with a composition consistent with immature HIV-1 particles. A fast, 

reliable and cost-effective quantitation method based on fluorescence 

was developed and validated using the standard VLP material. The 

fluorescence-based quantification method should facilitate the 

development and optimization of bioprocessing strategies for Gagbased 

VLPs. 

Acknowledgements: We would like to thank Dr. Amine Kamen 

(National Research Council of Canada) for helpful discussions about this 

projectandforkindlyprovidingthecGMPcompliantHEK293SF-3F6 

cell line. The pGag-GFP plasmid was obtained through the NIH AIDS 

reagent program (Cat #11468). The contribution of Dr. Julià Blanco and 

Dr. Jorge Carrillo (IrsiCaixa, Spain) to this work is greatly appreciated. 

This project was financially supported by MINECO-SEIDI, reference 

BIO2012-31251.




Figure 1(abstract P62) Characterization of the purified standard Gag-GFP VLP material. (A) Confocal fluorescence microscopy image of a HEK 293 

producer cell expressing green fluorescent Gag-GFP molecules. The lipid membrane is stained with Cell Mask (red) and the cell nucleus with Hoechst 

(blue). (B) TEM image of an ultrathin section showing VLP budding from HEK 293 producer cells. (C) Negatively stained Gag-GFP VLPs in the purified 

standard material. (D) Size exclusion chromatogram of the standard Gag-GFP VLP material. (E) SDS-PAGE and Western-blot analyses of the standard VLP 

material. Full and empty arrows represent Gag-GFP protein and Gag-GFP fragment, respectively. Abbreviations: MW, molecular weight standard. 

References 

1. McGrath M, Witte O, Pincus T, Weissman IL: Retrovirus purification: 

method that conserves envelope glycoprotein and maximizes infectivity. 

J Virol 1978, 25:923-927. 

2. Valley-Omar Z, Meyers AE, Shephard EG, Williamson AL, Rybicki EP: 

Abrogation of contaminating RNA activity in HIV-1 Gag VLPs. Virol J 

2011, 8:462. 

3. Ott DE: Cellular proteins in HIV virions. Rev Med Virol 1997, 7:167-180. 

4. Segura MM, Garnier A, Di Falco MR, Whissell G, Meneses-Acosta A, 

Arcand N, Kamen A: Identification of host proteins associated with 

retroviral vector particles by proteomic analysis of highly purified vector 

preparations. J Virol 2008, 82(3):1107-1117. 

5. Gutierrez-Granados S, Cervera L, Godia F, Carrillo J, Segura MM: 

Development and validation of a quantitation assay for fluorescently 

tagged HIV-1 virus-like particles. J Virol Methods 2013, 193:85-95. 

6. ICH: Validation of Analytical Procedures:Text and Methodology Q2(R1). 

2005. 

7. Chen Y, Wu B, Musier-Forsyth K, Mansky LM, Mueller JD: Fluorescence 

fluctuation spectroscopy on viral-like particles reveals variable gag 

stoichiometry. Biophys J 2009, 96:1961-1969. 

Table 1(abstract 62) Comparison between the 

fluorescence-based quantitation method and the p24 

ELISA assay 

Fluorescence-based p24 ELISA assay 

method 

Specificity Gag-GFP fusion protein Gag-GFP fusion protein 

Linear range 

7 to 1000 RFU 

(10 to 3600 ng of p24/mL) 

10 to 300 pg of 

p24/mL 

Precision ~2% CV ~10% CV 

Limit of detection 10 ng/mL of p24 10 pg/mL of p24 

Time (96 samples) ~1.5 h ~4 h 

Price (96 samples) ~10 € ~400 € 

RFU: Relative fluorescence units 

CV: Coefficient of variation 

P63 

BI-HEX®-GlymaxX® cells enable efficient production of next generation 

biomolecules with enhanced ADCC activity 

Anja Puklowski, Till Wenger, Simone Schatz, Jennifer Koenitzer, 

Jochen Schaub, Barbara Enenkel, Anurag Khetan, Hitto Kaufmann, 

Anne B Tolstrup * 

Boehringer-Ingelheim, Biberach an der Riss, Germany, 88397 

E-mail: Anne.Tolstrup@boehringer-ingelheim.com 


Background: Despite the succes story of therapeutic monoclonal 

antibodies (mAbs), a medical need remains to improve their efficacy. One 

possibility to achieve this is to modulate important effector functions 

such as the antibody dependent cellular cytotoxicity (ADCC). 

The advantage of highly active biotherapeutic molecules is - apart from 

the enhanced efficacy - the reduction of side effects due to lower 

administered doses. Furthermore, these therapeutic antibodies may




enable treatment of current non-responders, e.g. patients with low 

antigen bearing tumors. Enhancement of the effector functions of 

antibodies can be achieved either by directlymutatingtheantibody’s 

amino acid sequence or by modifying its glycosylation pattern, e.g. by 

using a novel host cell line able to attach a desired glycostructure to the 

product. The latter approach has the advantage of not impacting the 

antibody structure itself, thereby avoiding negative effects on the PK/PD 

of the molecule. During the last decade it has been shown that 

antibodies with a reduced level of glycan fucosylation are much more 

potent in mediating ADCC, a mode of action particularly relevant for 

cancer therapeutics. Therefore, defucosylated antibodies are of major 

interest for biotherapeutics developers. To produce such antibodies, 

Boehringer Ingelheim has inlicensed the GlymaxX® system from 

ProBioGen, Germany. This technology utilises the bacterial protein RMD 

(GDP-6-deoxy-D-lyxo-4-hexulose reductase) which, when stably integrated 

into host cell lines, inhibits fucose de-novo biosynthesis. The enzyme 

deflects the fucosylation pathway by turning an intermediate (GDP-4- 

Keto-6-Deoxymannose) into GDP-Rhamnose, a sugar that cannot be 

metabolised by CHO cells. As a consequence, recombinant antibodies 

generated by such host cells exhibit reduced glycan fucosylation and 

20-100 fold higher ADCC activity. Here, we show the establishment of a 

new host cell line, termed BI-HEX®-GlymaxX® which is capable of 

producing highly active therapeutic antibodies. We furthermore present 

data on the cell line properties concerning cell culture performance (e.g. 

titer, growth, transfection efficiency), process robustness and product 

quality reproducibility. 

Methods: The BI-HEX® host cell line was transfected with the bacterial 

RMD enzyme and stably expressing clones were selected. The presence 

of RMD was confirmed by Western blotting. The clones were analysed for 

stability of RMD expression over time in continous culture (>100 days), 

glycoprofile structure, CD16 binding and ADCC activity of mAbs produced 

by these clones before selection of the final new BI-HEX®-GlymaxX® host 

cell. Furthermore, we examined the growth and cultivation properties of 

the modified BI-HEX®GlymaxX® cells to ensure that the engineered host 

cell maintained the favourable manufacturability properties of BI-HEX® 

and we tested the reproducibility of key product quality attributes of the 

generated antibodies. 

Results: Up to date seven different antibodies were produced in our new 

BI-HEX®-GlymaxX®host cell line. All molecules showed a very significant 

reduction of fucosylation down to 1-3% compared to the control. 

Correlating with the low fucose levels, antibodies produced in BI-HEX®- 

GlymaxX® exhibited a 20-100× increased ADCC activity (Figure 1A). This 

enhancement also correlated well with an increase in CD16 binding. For 

the routine cell line and process development we investigated the 

robustness of the defucosylation and its resulting activity enhancement. 

The results indicated a high reproducibility between independent 

production runs. The ADCC level as well as the CD16 binding was robust 

for all analysed mAbs (Figure 1B). Investigating the cell culture behaviour 

of the BI-HEX®-GlymaxX®and its parental BI-HEX® cell line, we saw 

comparable results for their transfection efficiencies, doubling times, titer 

and production run performance. Depletion studies of RMD showed that 

this enzyme can be efficiently depleted during downstream purification 

of the mAb. 

Conclusions: Our new BI-HEX®-GlymaxX®cell line is capable of producing 

>90% defucosylated antibodies which exhibit a 20-100 fold higher ADCC 

activity compared to a normal CHO production cell line like BI-HEX®. This 

increase in ADCC activity correlated with a stronger CD16 binding in 

those molecules. Furthermore, the BI-HEX®-GlymaxX® cells show the same 

manufacturing properties (transfection efficiency, doubling times, titer, 

peak cell density) to its originator cell line. For the depletion of RMD 

we’ve established a sensitive depletion assay and measured a complete 

reduction of RMD after the first purification step (protein A capture). 

P64 

Effects of perfusion processes under limiting conditions on different 

Chinese Hamster Ovary cells 

Anica Lohmeier 1* , Tobias Thüte 1 , Stefan Northoff 2 , Jeff Hou 3 , Trent Munro 3 , 

Thomas Noll 1,4 

1 Institute of Cell Culture Technology, Bielefeld University, Germany; 

2 TeutoCell AG, Bielefeld, Germany; 

3 The Australian Institute for 

Bioengineering and Nanotechnology (AIBN), University of Queensland, 

Brisbane, Australia; 

4 Center for Biotechnology (CeBiTec), Bielefeld University, 

Germany 

E-mail: anica.lohmeier@uni-bielefeld.de 


Background: The use of perfusion culture to generate biopharmaceuticals 

is an attractive alternative to fed-batch bioreactor operation. The process 

allows for generation of high cell densities, stable culture conditions and a 

short residence time of active ingredients to facilitate the production of 

sensitive therapeutic proteins. 

However, challenges remain for efficient perfusion based production at 

industrial scale, primarily complexity of required equipment and 

strategies adopted for downstream processing. For perfusion systems to 

be industrially viable there is a need to increase product yields from a 

perfusion-based platform. 

We have shown previously that one effective way to enhance the cell 

specific productivity is via glucose limitation [1,2]. The mechanisms leading 

to an increased productivity under these glucose limiting conditions are 

still under investigation. Preliminary studies using proteomic analysis have 

indicated changes in histone acetylation [2]. 

In this work, we investigated the influence of glucose limited conditions on 

the production of two different recombinant proteins in perfusion processes. 

Materials and methods: CHO-MUC2 and CHO-XL99 cell lines were 

cultivated perfusion based in a 2 L pO 2 - and pH-controlled bioreactor 

using an internal spin filter (20 μm) for cell retention. In addition these 

cell lines were cultivated both under limiting and non-limiting glucose 

conditions in fed-batch mode in a four vessel parallel single-use system 

(Bayshake, Bayer Technology Services GmbH). 

Figure 1(abstract P63) A) Comparison of ADCC activity of Rituximab produced in either BI-HEX® or BI-HEX®-GlymaxX®. B) ADCC activity of 3 

different mAbs produced in BI-HEX®-GlymaxX®. Three independent production runs were performed for each mAb. The mAbs were individually purified 

by protein A capture before ADCC activity determination.




Perfusion mode was started three days after inoculation; flow rate was 

adjusted between 0.3 d -1 and 0.6 d -1 . For fed-batch cultivation the 

limiting range for glucose concentration was chosen between 0.2 and 

0.5 g/L. Reference cultivation was performed between 1.5 and 3.0 g/L. 

Both cultures were fed with similar volumes. 

All cultivations were performed in chemically-defined, animal-component 

free CHO growth media (TeutoCell AG). 

Viable cell density and viability were determined using the automated cell 

counting system CEDEX (Roche Diagnostics), glucose and lactate 

concentrations were detected via YSI (YSI life sciences). Amounts of IgG1 

were quantified via Protein A HPLC, anti IL-8 mAb purified from a CHO 

DP-12 cell clone was used as a standard. Mucin-2 quantity was measured 

via photometric quantification of eGFP coupled to the Mucin 2. 

Results: Using perfusion mode with a 20 μm spin filter as cell retention device 

we have reached viable cell densities of 1.4·10 7 cells/mL in a 24 day perfusion 

run of CHO-MUC2 (Figure 1A). During perfusion the average viability remained 

higher than 85% was attained. After 6 days of cultivation glucose reached a 

limiting concentration below 1 mM (Figure 1B). Meanwhile a relative eGFP 

concentration of 5 mg/L was achieved (Figure 1C) and cell specific productivity 

increased by 90% during glucose limitation (data not shown). 

A further 34 day perfusion cultivation using a CHO-XL99 clone reached a 

viable cell density of 2.6·10 7 cells/mL with an average viability of 90% 

(Figure 1A). Glucose and Lactate concentrations of CHO-XL99 were below 

detectable limits on day 8 and 17 post-inoculation respectively (Figure 1B). 

Simultaneously, cells were able to reach an IgG1 titer of 326 mg/L, with 

significant increases in product titer observed after 24 days of culture 

(Figure 1C). Simultaneously, cell specific productivity showed a slight 

increase after 25 days (data not shown). 

Neither the CHO-MUC2, nor the CHO-XL99 cells showed any limitations 

concerning other substrates, e.g. amino acids (data not shown). 

In two parallel fed-batch cultivations of the CHO-XL99 clone the glucose 

limited culture showed similar growth characteristics as the unlimited 

reference culture. Viable cell densities of 1.9·10 7 cells/mL (reference) and 

2.9·10 7 cells/mL (-Glc), respectively, were observed (Figure 1D). The 

limited culture reached an IgG1 concentration of 610 mg/L, in contrast to 

292 mg/L produced by the reference culture (Figure 1D). Under glucose 

limitation the cells consumed lactate while under non-limiting conditions 

lactate accumulated (Figure 1E). 

Conclusions: During perfusion processes under glucose limitation three 

characteristic phases appear: At first glucose concentration is high and 

lactate is below detection limit. Afterwards glucose is metabolized into 

lactate with an increasing lactate formation rate. In the end both 

metabolites are consumed and an increase in product concentration and 

cell specific productivity occurs. 

Reduced lactate formation was observed during the perfusion run as 

CHO-MUC2 cells shift towards a more efficient glucose metabolism. 

Figure 1(abstract P64) A Viable cell counts and cell viabilities for the time course of CHO-MUC2 and CHOXL99 cells during perfusion process; B: glucose 

and lactate concentrations during CHO-XL99 and CHO-MUC2 perfusion cultivation; C: Concentration of IgG1 mAb and eGFP during CHO perfusion 

cultivations; D: Viable cell counts and mAb concentration for the time course of CHO-XL99 fed-batch cultivations; E: Glucose and lactate concentrations 

for the time course of CHO-XL99 under limiting (-Glc) and non-limiting conditions.




Thereby cell specific productivity of CHO-MUC2 cells increased by 90% 

during glucose limitation. 

CHO-XL99 cells showed a similar metabolic shift during perfusion along 

with increased mAb production as well as in fed-batch cultivation. 

Resulting from this fed-batch cultivations allow predictions concerning 

cell behavior under glucose limitation in perfusion. 

To analyse the impact of limiting conditions on transcriptome level of 

CHO cells, a microarray will be used. This proprietary CHO microarray 

contains 41.304 different probes to elucidate reasons for the increase in 

cell specific productivity. 

Acknowledgements: We gratefully acknowledge to the Australian 

Institute for Bioengineering and Nanotechnology, University of 

Queensland-Brisbane, Australia (AIBN) for providing the CHO-XL99 clone. 

We would also thank Bayer Technology Services for providing the 

Bayshake system. 

References 

1. Link T, Bäckström M, Graham R, Essers R, Zörner K, Gätgens J: Bioprocess 

development for the production of a recombinant MUC1 fusion protein 

expressed by CHO-K1 cells in protein-free medium. J Biotechnol 2004, 

110:51-62. 

2. Wingens M, Gätgens J, Hoffrogge R, Noll T: Proteomic characterization 

of a glucose-limited CHO-perfusion process-analysis of metabolic 

changes and increase in productivity. ESACT proceedings Springer: Noll T 

4:265-269. 

P65 

Development of 3D human intestinal equivalents for substance testing 

in microliter-scale on a multi-organ-chip 

Annika Jaenicke 1* , Dominique Tordy 3 , Florian Groeber 3 , Jan Hansmann 3 , 

Sarah Nietzer 4 , Carolin Tripp 4 , Heike Walles 3,4 , Roland Lauster 1 , Uwe Marx 1,2 

1 TU Berlin, Institute for Biotechnology, Faculty of Process Science and 

Engineering, 13355 Berlin, Germany; 

2 TissUse GmbH, 15528 Spreenhagen, 

Germany; 

3 Fraunhofer Institute for Interfacial Engineering and Biotechnology 

IGB, 70569 Stuttgart, Germany; 

4 Chair of Tissue Engineering and 

Regenerative Medicine, Julius-Maximilians-Universität Würzburg, 97070 

Würzburg, Germany 

E-mail: a.jaenicke@tu-berlin.de 


Background: Robust and reliable dynamic bioreactors for long term 

maintenance of various tissues at milliliter-scale on the basis of a 

biological, vascularized matrix (BioVaSc®) have been developed at the 

Fraunhofer IGB in Stuttgart, Germany. As an intestinal in vitro equivalent, 

seeding of the matrix with CaCo-2 cells yielded in the self-assembly of a 

microenvironment with the typical histological appearance of villus-like 

structure and morphology [1]. We modified this matrix (BioVaSc®) - cell 

(CaCo-2) system to some extent with the aim to develop 3D intestinal 

equivalents for systemic preclinical testing of orally applied drug 

candidates in microliter-scale on a human Multi-Organ-Chip (MOC), which 

consists of different organ equivalents important for ADMET (adsorption, 

distribution, metabolism, excretion, toxicity) testing. 

Materials and methods: For the generation of biological, vascularized 

matrices (rBioVaSc®), jejunal segments of the small intestine of Wistar rats 

including the corresponding capillary bed were explanted and decellularized 

by perfusion with 1% sodium deoxycholate. Characterization of the matrix 

wasdonebyhistologicalanalysisaswellas2-photonmicroscopy(2PM) 

and immunofluorescent stainings. After sterilization by g-irradiation, the 

rBioVaSc® could be used to built up a 3D intestinal equivalent. Punch 

biopsies of the matrix were fixed on the frame of a 96-well transwell insert 

and seeded with CaCo-2 cells (2*10^6 cells) on the former luminal side of 

the matrix following static cultivationfor48hoursandintegrationina 

perfused MOC device. Our MOC device consists of an integrated micropump, 

a microfluidic channel system and inserts for the cultivation of 

different organ equivalents (Figure 1e). For the generation of the intestinal 

equivalent, the generated matrix-cell construct was placed in the MOC 

device and perfused for up to one week with cell culture medium 

(supplemented MEM), following histological as well as immunofluorescence 

(IF) analysis of the growth behavior of the cells. As a control, matrix-cell 

constructs were cultivated statically. Daily medium samples have been 

analyzed to monitor metabolic activity and the absorption properties of the 

intestinal equivalent. Immunohistostaining of cryo-preserved tissue slices 

have been analyzed to compare self-assembled organoid tissue structures 

with their corresponding in vivo counterparts. 

Results: Decellularization of jejunal segments of rats together with the 

corresponding capillary bed yielded in a biological, vascularized matrix 

which was free of non-human cells but with the preserved 3D structure 

of the former intestinal extracellular matrix (ECM) (Figure 1a-d). Those 

ECM components were used for the resettlement of human intestinal 

Figure 1(abstract P65) a-d) Characterization of the decellularization procedure. a) Explanted jejunal segment with the preserved capillary bed after 

decellularization. b) H/E staining of the decellularized matrix. c) Feulgen staining of the decellularized matrix. d) immunofluorescent stainings for collagen 

I on rBioVaSc. e) The multi-organ-chip (MOC) device consisting of an integrated micro-pump, a microfluidic .channel system and inserts for the cultivation 

of different organ equivalents. f+g) Characterization of the intestinal in vitro equivalent. f) H/E staining of the recellularized matrix after one week of 

dynamic culture in the MOC device. g) Second Harmonic Generation by 2 PM, nuceli were stained with Hoechst 33342.




cells (CaCo-2) which resulted in the formation of characteristical villus-like 

structures on the matrix after one week of perfused cultivation (Figure 1f+g). 

Cells expressed typical intestinal epithelial markers, e.g. CK8/18, EpCAM and 

Na/K-ATPase. Process parameters, such as nutrient perfusion rate and 

culture time, have been optimized to qualify the system for repeated dose 

testing of orally administered drug candidates. 

Conclusions: Asshownbyhistologicalaswellasimmunofluorescent 

stainings, we succeeded in the development of self-assembled 3D organ 

equivalents which have a characteristical intestinal architecture. Those 

organ equivalents can be used as an in vitro system for the evaluation of 

adsorption properties of orally administered drugs in microliter-scale on a 

multi-organ-chip (MOC). Further improvements of the MOC device are 

necessary, e.g. the integration of a second circulation, representing the 

intestinal lumen. In addition, reseeding the matrix with primary intestinal 

cells as well as co-cultures of epithelial and endothelial cells are planned. 


Ministry for Education and Research, GO-Bio Grand No. 0315569. 

Reference 

1. Pusch J, Votteler M, Göhler S, Engl J, Hampel M, Walles H, Schenke- 

Layland K: The physiological performance of a three-dimensional model 

that mimics the microenvironment of the small intestine. Biomaterials 

2011, 32:7469-7478. 

P66 

A robust RMCE system based on a CHO-DG44 platform enables 

efficient evaluation of complex biological drug candidates 

Thomas Rose 1,2* , Annette Knabe 1 , Rita Berthold 1 , Kristin Höwing 1 , 

Anne Furthmann 1 , Karsten Winkler 1 , Volker Sandig 1 

1 ProBioGen AG, 10439 Berlin, Germany; 

2 Freie Universität Berlin, 14195 Berlin, 

Germany 

E-mail: thomas.rose@probiogen.de 


Background: In early development stages of biologicals there is often 

more than one molecule against a specific target. A careful candidate 

evaluation is crucial to choose an optimal lead variant for further 

development. Complex biologicals are typically produced in CHO cells 

and host cells as well as the process are known to influence important 

molecule features such as glycan patterns or activity. To streamline the 

generation of stable producer cell lines we have established an Flp-based 

RMCE system in our CHO-DG44 platform. RMCE application allows for 

multi-parallel production of candidate material in the host cell and 

process background used for the pharmaceutical cell lines. Therefore, the 

molecular features of this material are expected to match with material 

that will be derived from a future producer cell line. 

Generation of the RMCE host cell line: A replaceable gfp gene cassette 

was established at random chromosomal integration sites in CHO-DG44 

cells. This clone pool was subjected to a primary RMCE with a secreted 

and complex glycosylated alpha1-antitrypsine (A1AT) reporter. Resulting 

cells were screened for A1AT producers that have undergone a successful 

cassette exchange. This strategy allows for selection of a RMCE host cell 

line that combines transgene expression from highly active genomic loci 

with superior processing and secretion capabilities. 

Strategy for routine RMCE application: The selected RMCE host cell 

line is susceptible for cassette exchange with any desired target gene 

and candidate protein. Successful cassette exchange is enforced by 

promoter trap and a well defined selection system (Figure 1A). For RMCE 

application the promoterless target gene encoding for the candidate 

protein is cloned into a target vector where it is linked to a selection 

marker via an IRES element. Upon successful cassette exchange, the 

target and marker gene will be activated by a promoter residing at the 

targeting locus. In addition, a second inactive marker gene (lacking an 

ATG) that resides also at the host genome, but downstream of the 

replaceable gene cassette will be activated. The target vector is 

introduced together with a vector encoding the flp recombinase into the 

RMCE host cell line. The use of heterospecific FRT sites prevents from 

simple re-excision of the gene cassette. 

A robust protocol provides for efficient RMCE: RMCE application 

results in cell populations showing comparable expression levels of the 

newly introduced genes as exemplified for individual RMCEs with a gfp 

reporter and different selection formats (Figure 1B). Also, a homogenous 

expression was observed within the individual RMCE derived populations 

after drug selection. Efficient RMCE application is supported by a fine 

tuned and robust protocol that can be applied in T-flasks or multiwell 

formats. 

Evaluation studies: RMCE application with monoclonal antibody and 

fusion proteins: RMCE was applied to a monoclonal antibody and single 

cell clones have been generated from the RMCE derived population. Those 

clones were analyzed together with the original population in fed batch 

culture using ProBioGen’s chemical defined platform medium and process 

(Figure 1C). The RMCE derived population yielded in harvest titers of 0.5 g/L 

matching the titers obtained for individual clones. Consequently, after drug 

selection the cells can be directly used for material production. Single cell 

cloning is not required! 

In a second study two variants of a soluble receptor-Fc fusion protein 

were analyzed for manufacturability. Over a number of individual RMCEs 

variant #1 was expressed at a ~2-fold higher rate. In a fed batch process 

the difference was maintained yielding in final titers of 1.2 g/L for variant 

#1 (Figure 1D). The 2-3-fold outperformance of variant #1 was confirmed 

in classic cell line development. 

RMCE facilitates streamlined generation of stable cell lines and POC 

material production: At minimal effort RMCE application allows for 

streamlined generation of stable cell lines and production of POC 

material (Figure 1E). Applying a single RMCE within only 2 weeks a 

suspension culture is available for scale-up and production. Compared to 

transient protocols production runs can easily be repeated at any time 

and scale. 

Conclusions: A robust protocol provides for efficient and reproducible 

RMCE application for antibodies and single chain proteins. 

At minimal effort RMCE application enables fast and multi-parallel 

evaluation of complex biological drug candidates. 

RMCE application allows for streamlined production of candidate material 

in the background of ProBioGen’s CHO-DG44 platform. 

P67 

Systems biology of unfolded protein response in recombinant CHO 

cells 

Kamal Prashad Segar, Vikas Chandrawanshi, Sarika Mehra * 

Department of Chemical Engineering, Indian Institute of Technology 

Bombay, Mumbai - 400076, India 

E-mail: sarika@che.iitb.ac.in 


Background: Productivity of recombinant therapeutics is a coordinated 

effort of multiple pathways in the cell [1]. The protein processing 

pathway in endoplasmic reticulum has been the target of many cell 

engineering studies but with mixed results [2]. We have observed the 

induction of UPR genes in recombinant CHO cells (data not shown). In 

this work, we attempt to increase their productivity further by inducing 

ER stress using a known UPR inducer. 

Materials and methods: Cell culture: Suspension CHO cells secreting 

anti rhesus IgG were grown in a media containing 50% PF-CHO 

(Hyclone) and 50% CDCHO (Invitrogen) supplemented with 4 mM L- 

Glutamine (Invitrogen), 0.10% Pluronic (Invitrogen), 600 μg/ml G418 

(Sigma) and 250 nM Methotrexate (Sigma) in a total culture volume of 

20 ml. All cultures were run in replicates in 125 ml Erlenmeyer flasks 

(Corning). Cells were treated with tunicamycin (Sigma) for 12 hours and 

were harvested for RNA isolation. Cell densities and viabilities were 

determined by a hemocytometer using the tryphan blue exclusion 

method. 

Quantitative real time PCR: Primers were designed based on consensus 

sequences from human, mouse and rat and checked against the CHO 

genome database wherever available. Total RNA was isolated using Tri 

reagent (Sigma) and converted to cDNA using the Reverse Transcription 

kit (Thermo). 100 ng of cDNA was used for qPCR to quantify the mRNA 

levels of different UPR genes with Actin as the house keeping genes 

following the ΔΔCT method. 

Antibody quantification: Antibody titres were quantified using the 

protocol as described earlier by Chusainow et.al.,[3] and their specific 

productivities (qP) were also calculated. 

Results: Induction of different ER stress genes was observed at peak 

productivities in these recombinant CHO cell lines (data not shown).




Figure 1(abstract P66) A: RMCE Strategy for routine RMCE application in the selected CHO-DG44 RMCE host cell line. M = selection marker, haat = 

A1AT gene. B: GFP expression of cell populations derived from multiple RMCEs and selection formats. C: RMCE with a monoclonal antibody. Fed batch of 

the direct RCME derived population and three individual RMCE clones derived from original RMCE population. D: RMCE with two variants of a soluble 

receptor-Fc fusion protein. Exemplary fed batch process for the both RMCE derived Fc fusion protein variants. E: Timescale of routine RMCE Application. 

Therefore, we hypothesized that increasing the ER stress to higher levels 

may have an additive effect on IgG productivity in these cell lines. 

Tunicamycin a known ER stress inducer was used to induce ER stress in 

these cells. CHO cells were treated with tunicamycin (2.5 mM) for 12 

hours and harvested for RNA isolation. qPCR was performed to quantitate 

the expression levels of different ER stress genes. IgG HC and LC mRNA 

were also quantified and their fold changes were also calculated. IgG 

titers in the supernatant were quantified using ELISA. 

The IgG titers and cumulative productivities in the tunicamycin treated and 

control cells are presented in Figures 1a and 1b. 12 hours post-treatment 

with tunicamycin, the IgG titers increased to 460 μg/ml. Productivity in 

treated cells was found to be 25 pg/cell/day, corresponding to a 1.7 fold 

increase compared to control cells. Interestingly, both the IgG HC and LC 

mRNA were not induced in treated cells (Figure 1c, d). To elucidate the 

role of UPR pathway in the observed increase in productivity, expression of 

many chaperones and UPR genes was measured. In response to 

tunicamycin, chaperones including GRP78 and GRP94 were induced to a 

maximum of 17-fold (Figures 1e, f). Co-chaperone ERDJ4, involved in 

the translocation of nascent proteins inside ER and activation of ERAD 

pathway [4], was also induced in response to tunicamycin treatment 

indicating increase in ER load. Figure 1g and 1h show the mRNA profiles 

of ERDJ4 and EDEM in control and treated cells. No significant difference 

in expression of UGGT1 mRNA was observed, suggesting that there may 

be negligible mis-folded proteins (Figure 1i) which can be recycled for 

refolding while most of them are continuously degraded by the ERAD 

machinery. Highly active transcription factors of the UPR pathway viz., 

GADD34, CHOP and XBP1s were also induced in response to tunicamycin 

treatment. Figures 1j-1l show the mRNA profiles of different UPR genes. 

GADD34 was induced to 38-folds on treatment while CHOP mRNA 

induced to about 30-folds. Spliced XBP1 mRNA was also induced to a 

maximum of 5.5-folds in treated cells leading to increased expression of 

GRP78 mRNA. 

Conclusion: Engineering cells towards high productivity by exploiting 

their cellular pathways has been gaining importance recently in 

biopharmaceutical industries. The unfolded protein response (UPR) 

pathway has also been targeted to develop a high producing clone. 

However, the results from previous engineering studies on this pathway 

are either cell line or product dependent.




Figure 1(abstract P67) Effect of Tunicamycin on the IgG titres, productivities and mRNA levels of different UPR genes. 

In this study, with prior knowledge on the induction of different UPR genes 

at peak productivities, we attempted to increase productivity by increasing 

ER stress using a known UPR inducer, tunicamycin. Tunicamycin induced 

the expression of chaperones and key UPR transcription factors including 

GADD34 and XBP1s mRNA. 

Increase in the levels of GRP78 and GRP94 mRNA with no change in the 

levels of the UGGT1 mRNA suggests that the treated cells may possess a 

highly active folding pathway. Increase in the productivities with no 

change in the levels of IgG HC and LC mRNA support our hypothesis of 

an increased folding capacity in treated cells. Hence, we suggest that the 

UPR pathway can be modulated to increase the productivity. 

Acknowledgements: This work was partially supported by a grant from 

Department of Biotechnology, Government of India. We would like to 

thank Dr. Miranda Yap and Dr. Niki Wong, Bioprocessing Technology 

Institute, Singapore for providing the CHO cell lines. 

References 

1. Seth G, Charaniya S, Wlaschin KF, Hu WS: In pursuit of a super produceralternative 

paths to high producing recombinant mammalian cells. Curr 

Opin Biotechnol 2007, 18:557-564. 

2. Seth G, Hossler P, Yee JC, Hu WS: Engineering cells for cell culture 

bioprocessing–physiological fundamentals. Adv Biochem Eng Biotechnol 

2006, 101:119-164. 

3. Chusainow J, Yang YS, Yeo JHM, Toh PC, Asvadi P, Wong NSC, Yap MGS: A 

Study of Monoclonal Antibody-Producing CHO Cell Lines: What Makes a 

Stable High Producer? Biotechnology 2009, 102:1182-1196. 

4. Lai CW, Otero JH, Hendershot LM, Snapp E: ERdj4 protein is a soluble 

endoplasmic reticulum (ER) DnaJ family protein that interacts with ERassociated 

degradation machinery. The Journal of biological chemistry 

2012, 287:7969-7978. 

P68 

Chemical chaperone suppresses the antibody aggregation in CHO cell 

culture 

Masayoshi Onitsuka 1 , Miki Tatsuzawa 2 , Masahiro Noda 2 , Takeshi Omasa 1* 

1 Institute of Technology and Science, The University of Tokushima, 

Tokushima, 770-8506, Japan; 

2 Graduate School of Advanced Technology and 

Science, The University of Tokushima, Tokushima, 770-8506, Japan 



Background: Aggregation of therapeutic antibodies could be generated 

at different steps of the manufacturing process, posing the problem for 

quality control of produced antibodies. It has been well known that 

secreted antibodies from recombinant mammalian cells into culture 

medium can aggregate due to the physicochemical stresses such as 

media pH and osmolality, cultivation temperature [1,2]. The antibody 

aggregation during the cell culture process is difficult to suppress 

because the cell culture conditions for antibody production are generally 

optimized for cell culture and growth and not for suppressing the 

aggregateformation.Hereweshowthe novel strategy to suppress the 

antibody aggregation; application of chemical chaperone to the cell 

culture process. It is well established that an addition of some cosolutes 

serves as chemical chaperone to suppress the protein aggregation. 

Trehalose, non-reducing sugar formed from two glucose units with a-1,1 

linkage, is known as an effective chemical chaperone. In this study, we 

investigated the anti-aggregation effect of trehalose in the culture process 

of recombinant Chinese hamster ovary cell (CHO) line producing Ex3- 

humanized IgG-like bispecific single-chained diabody with Fc (Ex3-scDb-Fc).




Table 1(abstract 68) Kinetic parameters of cell culture in 

Erlenmeyer flasks 

Specific growth rate 

(μ; ×10 -2 1/h) 

Specific 

antibody production rate 

(r Ab ; pg/cell/day) 

Without trehalose 3.07 ± 0.18 a 0.39 ± 0.02 a 

150mM trehalose 1.51 ± 0.04 a 1.55 ± 0.03 a 

a Mean ± S.D. (n = 3). 

Ex3-scDb-Fc shows the remarkable anti-tumor activity based on anti-EGFR 

and anti-CD3 bispecificity [3]. However, our in-house results showed that 

Ex3-scDb-Fc shows aggregation tendency, demonstrating the necessity of 

developing a bioprocess for suppressing the aggregation of the bispecific 

diabody. 

Materials and methods: CHO Top-H cell line producing the Ex3-scDb-Fc [4] 

was cultivated in 500mL Erlenmeyer flask and 2L-glass bioreactor with serumfree 

medium containing 150mM trehalose. Viable cell densities and antibody 

concentrations were determined with Vi-Cell XR cell viability analyzer 

(Beckman Coulter) and by ELISA, respectively. Ex3-scDb-Fc was purified with 

Hi-Trap protein A column (GE Healthcare). 1M Arg-HCl (pH4.2) was used as 

eluting solution, which make it possible to prevent the aggregation of the 

antibody in the affinity purification process. Antibody aggregation was 

analyzed by sephacryl S-300 column (GE healthcare). Solution structure of 

Ex3-scDb-Fc was assessed by circular dichroism spectroscopy. 

Results and discussion: Cell culture performance in trehalose 

containing medium: We cultivated CHO Top-H cell line in 150mM 

trehalose containing medium. The media osmolalities with and without 

trehalose (150 mM) were 480 mOsm/kg and 319 mOsm/kg, respectively. 

Estimated kinetic parameters of cell culture are listed in Table 1. Cell 

culture in Erlenmeyer flasks demonstrated that cell growth was strongly 

affected by trehalose; the specific cell growth rate and the maximum cell 

density were decreased compared to those in the absence of trehalose. 

On the other hand, both the specific antibody production rate and 

volumetric production were largely enhanced by trehalose addition. The 

results in Erlenmeyer flask mentioned above were reproduced in 2L-glass 

bioreactor culture. Observed properties of the cell culture in the presence 

of trehaose, suppressed cell growth and enhanced antibody production, 

were similar to those reported for mammalian cell cultures under 

hyperosmotic condition [5], although the underlying mechanisms 

responsible for the enhanced antibody production are largely unknown. 

Anti-aggregation effects by trehalose during the cell culture process: 

The scDb-Fc was purified from the culture supernatant by protein A 

affinity chromatography, and the aggregation states were analyzed by 

size exclusion chromatography. We observed the 3 states of scDb-Fc, 

monomer, dimer, and large aggregates, which were included in the 

culture supernatant when harvested (Figure 1). The peak area of the large 

Figure 1(abstract P68) Size-exclusion chromatography showing the 

aggregation status of Ex3-scDb-Fc. 

aggregates in the presence of trehalose was one-third that in the 

absence of trehalose, indicating that trehalose suppressed the formation 

of large aggregates in the CHO cell culture. Circular dichroism (CD) 

spectroscopy showed that the large aggregates were misfolded state 

with non-native b-strand. Trehalose is expected to suppress the 

accumulation of misfolded state and the intermolecular interactions 

leading to the aggregate formation in cell culture. 

Conclusions: We demonstrated the potential application of chemical 

chaperon in the culture of antibody-producing mammalian cells. Trehalose 

can be incorporated in the culture media for CHO cells, and can suppress 

the antibody aggregation, especially high-order aggregates. In addition, 

trehalose may be involved in the enhancement of antibody production. 

Acknowledgements: This study was supported by the Advanced 

research for medical products Mining Programme of the National Institute 

of Biomedical Innovation (NIBIO). Trehalose was kindly supplied by 

HAYASHIBARA Biochemical Laboratories, Inc. (Okayama, Japan). This work was 

collaboration with Assoc. Prof. Ryutaro Asano and Prof. Izumi Kumagai 

(Tohoku University, Japan). 

References 

1. Cromwell ME, Hilario E, Jacobson F: Protein aggregation and 

bioprocessing. AAPS J 2006, 8:E572-579. 

2. Vázquez-Rey M, Lang DA: Aggregates in monoclonal antibody 

manufacturing processes. Biotechnol Bioeng 2011, 108:1494-1508. 

3. Asano R, Kawaguchi H, Watanabe Y, Nakanishi T, Umetsu M, Hayashi H, 

Katayose Y, Unno M, Kudo T, Kumagai I: Diabody-based recombinant 

formats of humanized IgG-like bispecific antibody with effective 

retargeting of lymphocytes to tumor cells. J Immunother 2008, 

31:752-761. 

4. Onitsuka M, Kim WD, Ozaki H, Kawaguchi A, Honda K, Kajiura H, Fujiyama K, 

Asano R, Kumagai I, Ohtake H, Omasa T: Enhancement of sialylation on 

humanized IgG-like bispecific antibody by overexpression of a2,6- 

sialyltransferase derived from Chinese hamster ovary cells. Appl Microbiol 

Biotechnol 2012, 94:69-80. 

5. Rodriguez J, Spearman M, Huzel N, Butler M: Enhanced production of 

monomeric interferon-beta by CHO cells through the control of culture 

conditions. Biotechnol Prog 2005, 21:22-30. 

P69 

Dynamical analysis of antibody aggregation in the CHO cell culture 

with Thermo Responsive Protein A (TRPA) column 

Masahiro Noda 1 , Masayoshi Onitsuka 2 , Miki Tatsuzawa 1 , Ichiro Koguma 3 , 

Takeshi Omasa 2* 

1 Graduate School of Advanced Technology and Science, The University of 

Tokushima, Tokushima, 770-8506, Japan; 

2 Institute of Technology and 

Science, The University of Tokushima, Tokushima, 770-8506, Japan; 

3 New 

Products Development Department, Asahikasei Medical Co., LTD., Bioprocess 

Division, Fuji, 416-8501, Japan 



Background: Aggregation of therapeutic antibody is generally occurred 

in its manufacturing process, and should be suppressed and removed 

because its potential risk for unexpected immune response [1,2]. Protein 

A affinity chromatography is the first purification step in the monoclonal 

antibody manufacturing. Although the affinity purification is a powerful 

technique, high affinity between protein A and antibody requires acidic 

condition (below pH 3.0) to elute the captured antibody molecules. 

Exposure to acidic condition can induce the denaturation and aggregation 

of antibody molecules, demonstrating the necessity of novel strategy to 

reduce the antibody aggregation in the affinity purification process. Here we 

introduced a novel affinity purification strategy, thermo responsive protein A 

(TRPA) resin. TRPA is an engineered protein A ligand which adopts folded 

structure under 10°C and unfolds at moderate temperature, above 25°C. 

TRPA resin can control capture and elution of antibody by changing column 

temperature, making it possible to elute antibody molecules without low pH 

condition. In this study, we applied the TRPA column to the purification of 

Ex3 humanized IgG-like single-chained bispecific diabody-Fc (Ex3-scDb-Fc) 

[3]. The bispecific diabody is the promising candidate for next-generation 

therapeutic antibody, whereas it shows aggregation tendency. Furthermore, 

we observed the time-dependent formation of antibody aggregation in the




culture process of the recombinant Chinese hamster ovary (CHO) cell line 

with TRPA column. 

Materials and methods: CHO Top-H cell line producing the Ex3-scDb-Fc 

[4] was cultivated in a 1L-glass bioreactor with working volume of 750 mL 

serum-free medium. Viable cell densities and antibody concentrations in 

the medium was determined with Vi-Cell XR cell viability analyzer 

(Beckman Coulter) and by ELISA, respectively. The bispecific diabody was 

purified with conventional protein A (PA) column or thermo responsive 

protein A (TRPA) column, which were connected with AKTA prime plus (GE 

Healthcare). Elution of antibody was performed by acidic pH solution 

(pH2.7) for PA column and by raising column temperature to 45°C for TRPA 

column. Aggregate formation was analyzed with Superdex 200 10/30 GL 

column (GE Healthcare). 

Results and discussion: Performance of TRPA column in the affinity 

purification of bispecific diabody-Fc: We purified the Ex3-scDb-Fc from 

the culture supernatant of CHO Top-H cell line with PA and TRPA column. 

Compared to the conventional protein A column (PA), purification with 

TRPA column showed no precipitation of the aggregated scDb-Fc after the 

elution. Figure 1A is the size exclusion chromatography (SEC) profiles, 

showing that TRPA purification substantially reduced the formation of 

soluble large aggregates as compared to the PA purification including the 

exposure to acidic pH condition. Collectively, the above results demonstrate 

that TRPA column is highly effective in preventing the formation of 

precipitated and soluble aggregates in the affinity purification of the 

bispecific diabody-Fc. 

Dynamical aggregation analysis in the cell culture process: SEC profile 

of TRPA-purified Ex3-scDb-Fc would correctly reflect the status of antibody 

aggregation in CHO cell culture, because no further aggregation was 

induced in the affinity purification process with TRPA column as compared 

with that with conventional PA. Although secreted antibody is known to 

aggregate during cell culture process [1,2], the underlying mechanism is 

still poorly understood due to the lack of observation of the aggregation 

process. We applied the TRPA column to dynamical aggregation analysis of 

Ex3-scDb-Fc in CHO cell culture. Culture supernatants from exponential to 

stationary growth phase in a bioreactor operation were sampled, and the 

bispecific diabody was purified with TRPA column and analyzed by Size 

exclusion chromatography. The procedure makes it possible to observe the 

time-dependent formation of antibody aggregates in CHO cell culture. In 

Figure 1B, the peak areas of large aggregates were plotted as a function of 

cultivation time, showing that after 250 hours the amounts of aggregated 

Ex3-scDb-Fc were abruptly increased in time dependent manner. The 

results suggest a nucleation-dependent aggregation model for antibody 

aggregation, where the accumulation of aggregation nucleus is the rate 

limiting step and then the nucleus induces the formation of large 

aggregates in CHO cell culture. The bispecific diabody in this study has a 

tendency to aggregate during the CHO cell culture process, demonstrating 

the necessity of the novel cell culture strategy to suppress the aggregates 

formation. 

Conclusions: We propose the Thermo Responsive Protein A (TRPA) 

column as a novel strategy to reduce the antibody aggregation in an 

affinity purification process and to analysis the aggregation during the 

cell culture process. 

Acknowledgements: This study was supported by the Advanced 

research for medical products Mining Programme of the National Institute 

of Biomedical Innovation (NIBIO). This work was collaboration with Assoc. 

Prof. Ryutaro Asano and Prof. Izumi Kumagai (Tohoku University, Japan). 

References 

1. Cromwell ME, Hilario E, Jacobson F: Protein aggregation and 

bioprocessing. AAPS J 2006, 8:E572-579. 

2. Vázquez-Rey M, Lang DA: Aggregates in monoclonal antibody 

manufacturing processes. Biotechnol Bioeng 2011, 108:1494-1508. 

3. Asano R, Kawaguchi H, Watanabe Y, Nakanishi T, Umetsu M, Hayashi H, 

Katayose Y, Unno M, Kudo T, Kumagai I: Diabody-based recombinant 

formats of humanized IgG-like bispecific antibody with effective 

retargeting of lymphocytes to tumor cells. J Immunother 2008, 

31:752-761. 

4. Onitsuka M, Kim WD, Ozaki H, Kawaguchi A, Honda K, Kajiura H, Fujiyama K, 

Asano R, Kumagai I, Ohtake H, Omasa T: Enhancement of sialylation on 

humanized IgG-like bispecific antibody by overexpression of a2,6- 

sialyltransferase derived from Chinese hamster ovary cells. Appl Microbiol 

Biotechnol 2012, 94:69-80. 

P70 

Fucoidan extract enhances the anti-cancer activity of chemotherapeutic 

agents in breast cancer cells 

Sanetaka Shirahata 1,2* , Zhonguan Zhang 1 , Toshihiro Yoshida 1 , Hiroshi Eto 3 , 

Kiichiro Teruya 1 

1 Department of Bioscience and Biotechnology, Faculty of Agriculture, Kyushu 

University, Fukuoka 812-8581, Japan; 

2 Yosida Clinic, Osaka 532-0002, Japan; 

3 Daiichi Sangyo Co. Ltd., Osaka 530-0037, Japan 

E-mail: sirahata@grt.kyushu-u.ac.jp 


Background: Fucoidan, a fucose-rich polysaccharide isolated from brown 

alga, is currently under investigation as a new anti-cancer compound 

[1-4]. In the present study, fucoidan extract (FE) from Cladosiphon navaecaledoniae 

Kylin was prepared by enzymatic digestion. We investigated 

whether a combination of FE with chemotherapeutic agents had the 

potential to improve the therapeutic efficacy of cancer treatment. 

Materials and methods: Estrogen receptor (ER)-positive MCF-7 and 

ER-negative MDA-MB-231 breast cancer cells were cultured in DME 

Figure 1(abstract P69) (A) Size-exclusion chromatography showing the elution profiles of Ex3-scDb-Fc purified with TRPA (red) and PA (blue). 

(B) Time-dependent formation of aggregates in CHO cell culture.




medium supplemented with 10% fetal bovine serum in a humidified 

atmosphere of 5% CO 2 at 37 °C. The abalone glycosidase-digested 

fucoidan extract (FE) was obtained from Daiichi Sangyo Corporation (Osaka, 

Japan). The cells were treated with FE and chemotherapeutic agents like 

cisplatin, tamoxifen or paclitaxel. The cell growth was determined by MTT 

assay. Apoptosis was evaluated using annexin V binding assay and flow 

cytometry analysis. Signaling proteins were analyzed by western blot. 

Intracellular reactive oxygen species (ROS) were determined using DCFH-DA 

and determined using IN Cell Analyzer 1000. The reduced glutathione (GSH) 

concentration was measured by the GSH assay kit. 

Results: The co-treatments significantly induced cell growth inhibition, 

apoptosis, as well as cell cycle modifications in MDA-MB-231 and MCF-7 

cells. FE enhanced apoptosis in cancer cells that responded to treatment 

with cisplatin, tamoxifen, or paclitaxel after 48 h of treatment (Figure 1). 

FE enhanced the downregulation of the anti-apoptotic proteins Bcl-xL 

and Mcl-1 by these chemotherapeutic drugs. The combination treatments 

led to an obvious decrease in the phosphorylation of ERK and Akt in 

MDA-MB-231 cells, but increased the phosphorylation of ERK in MCF-7 

cells. In addition, we observed that combination treatments enhanced 

intracellular ROS levels and reduced glutathione (GSH) levels in breast 

cancer cells, suggesting that induction of oxidative stress was an 

important event in the cell death induced by the combination treatments. 

FE protected normal human fibroblast TIG-1 cells from apoptosis by 

cisplatin and tamoxifen, suggesting its favorable characteristic for 

application to cancer therapy. 

Conclusions: • Combination of FE and three chemotherapeutic agents 

exhibit highly synergistic inhibitory effects on the growth of breast 

cancer cells. 

• Combination treatments induced modifications in cell cycle 

distribution. 

Figure 1(abstract P70) Synergistic induction of apoptosis by cotreatmentAnalysis 

of apoptotic cells by annexin/PI double-staining 

using theIN Cell Analyzer 1000. MDA-MB-231 and MCF-7 cells were 

treatedfor different times with 200 μg/mL FE alone or 200 μg/mL FEin 

combination with 5 μM CDDP, 10 μM TAM or 2.5 nM TAXOL after 48 h 

of treatment. All results were obtained from three independent 

experiments. A significant difference from control is indicated by p < 

0.05 (#) or p < 0.01 (##); a significant difference from single treatments is 

indicated by p < 0.05 (*) or p < 0.01 (**). 

• Combination treatments modified the Bcl-2 expression, and ERK 

and Akt phosphorylation induced by FE, demonstrating different 

effects on apoptotic pathways in MDA-MB-231 cells and MCF-7 cells. 

• Generation of intracellular ROS and depletion of GSH are related to 

the cell death in combination treated -breast cancer cells. 

References 

1. Ye J, Li Y, Teruya K, Katakura Y, Ichikawa A, Eto H, Hosoi M, Hosoi M, 

Nishimoto S, Shirahata S: Enzyme-digested fucoidan extracts derived from 

seaweed Mozuku of Cladosiphon novae-caledoniae kylin inhibit invasion 

and angiogenesis of tumor cells. Cytotechnology 2005, 47:117-126. 

2. Zhang Z, Teruya K, Eto H, Shirahata S: Fucoidan extract induces apoptosis in 

MCF-7 Cells via a mechanism involving the ROS-dependent JNK activation 

and mitochondria-mediated pathways. PLoS ONE 2012, 6:e27441. 

3. Zhang Z, Teruya K, Eto H, Shirahata S: Induction of apoptosis by lowmolecular 

weight fucoidan through calcium- and caspase-dependent 

mitochondrial pathways in MDA-MB-231 breast cancer cells. Biosci 

Biotechnol Biochem 2012, 77:235-242. 

4. Zhang Z, Teruya K, Yoshida T, Eto H, Shirahata S: Fucoidan extract 

enhances the anti-cancer activity of chemotherapeutic agents in MDA- 

MB-231 and MCF-7 breast cancer cells. Marine Drugs 2013, 11:81-98. 

P71 

Assessment of troglitazone induced liver toxicity in a dynamically 

perfused two-organ Micro-Bioreactor system 

Eva-Maria Materne 1 , Caroline Frädrich 1 , Reyk Horland 1 , Silke Hoffmann 1 , 

Sven Brincker 1 , Alexandra Lorenz 1 , Mathias Busek 2 , Frank Sonntag 2 , 

Udo Klotzbach 2 , Roland Lauster 1 , Uwe Marx 1 , Ilka Wagner 1* 


Engineering, Gustav-Meyer-Allee 25, 13355 Berlin, Germany; 

2 Fraunhofer IWS 

Dresden, Winterbergstraße 28, 01277 Dresden, Germany 

E-mail: ilka.wagner@tu-berlin.de 


Background: The ever-growing amount of new substances released to the 

market and the limited predictability of current in vitro test systems has led 

to an ample need for new substance testing solutions. Many drugs like 

troglitazone, that had to be removed from the market due to drug 

induced liver injury, show their toxic potential only after chronic long term 

exposure. But for long-term multiple dosing experiments, a controlled 

microenvironment is pivotal, as even minor alterations in extracellular 

conditions may greatly influence the cell physiology. Within our research 

program, we focused on the generation of a micro-engineered bioreactor, 

which can be dynamically perfused by an on-chip pump and combines at 

least two culture spaces for multi-organ applications. This circulatory 

systems better mimics the in vivo conditions of primary cell cultures and 

assures steadier, more quantifiable extracellular signaling to the cells. 

Materials and methods: Liver microtissues (aggregates of HepaRG+human 

hepatic stellate cells) and skin biopsies were cultured in separate inserts of 

a 96-well Transwell® unit (Corning), which were hung inside the chip with 

the membrane fitting directly over the circuit. The tissues were cultivated 

either air/liquid interfaced (skin) or submerged in media (liver equivalent) for 

a culture period of 28 days. Exposing the tissues to troglitazone, the cultures 

were cultured for one day in normal medium and were, subsequently, 

exposed to 0 μM, 5 μM and50μM troglitazone, respectively for further 

6 days. Application of troglitazone was repeated at 12 h intervals 

simultaneously with the medium change. In a further experiment co-cultures 

of liver and skin equivalents were cultured in a fully vascularized chip. 

Therefore, HDMECs isolated from human foreskin were seeded into the 

microfluidic channel system using a syringe. After even cell infusion inside 

thecircuitthedevicewasincubatedin5%CO 2 at 37°C under static 

conditions for 3 h to allow the cells to attach to the channel walls. 

A frequency of 0.476 Hz was applied for continuous dynamic operation, after 

10 days of monoculture, skin and liver tissue were added for co-cultivation 

for another 15 days. 

Results: Co-cultures of human artificial liver microtissues and skin biopsies 

have successfully proven the long-term performance of the novel 

microfluidic multi-organ-chip device. The metabolic activity of the co-culture 

analysed in media supernatants reached a steady state at day 7 of 

co-culture and stayed constant for the rest of the culture period (Figure 1A). 

Furthermore, the co-cultures revealed a dose-dependent response to a 

6-day exposure to the toxic substance troglitazone. Liver microtissues




Figure 1(abstract P71) Multi-tissue culture in the MOC device. (A) Liver and skin tissue performance over 28-day MOC co-culture. Metabolic activity of the 

co-culture analysed in media supernatants. (B) LDH values (C) Real-time qPCR of the cytochrome P450 3A4. Statistical analysis was performed by one-way 

analysis of variance (ANOVA), followed by post-hoc Dunnett’s pairwise multiple comparison test. * P < 0.05 versus control. Data are means ± SEM (n = 4). 

showed sensitivity at different molecular levels. LDH levels measured in the 

media supernatants increased significantly with increasing troglitazone 

concentration (Figure 1B). Furthermore, an induction of Cyp450 3A4 levels 

on RNA level were observed (Figure 1C). In addition, a robust procedure 

applying pulsatile shear stress has been established to cover all fluid contact 

surfaces of the system with a functional, tightly closed layer of HDMECs and 

co-cultivation of liver, skin and endothelial cells for 15 days was successful. 

Conclusion: A unique chip-based tissue culture platform has been 

developed enabling the testing of drugs or chemicals on a set of miniaturized 

human organs. This “human-on-a-chip” platform is designed to generate high 

quality in vitro data predictive of substance safety in humans. Tissue 

co-cultures can be exposed to pharmaceutical substances at regimens 

relevant to respective guidelines, currently used for subsystemic substance 

testing in animals. 



P72 

Dynamic culture of human liver equivalents inside a micro-bioreactor 

for long-term substance testing 

Eva-Maria Materne 1* , Ilka Wagner 1 , Caroline Frädrich 1 , Ute Süßbier 1 , 

Reyk Horland 1 , Silke Hoffmann 1 , Sven Brincker 1 , Alexandra Lorenz 1 , 

Matthias Gruchow 2 , Frank Sonntag 2 , Udo Klotzbach 2 , Roland Lauster 1 , 

Uwe Marx 1,3 


Engineering, Gustav-Meyer-Allee 25, 13355 Berlin, Germany; 

2 Fraunhofer IWS 

Dresden, Winterbergstraße 28, 01277 Dresden, Germany; 

3 TissUse GmbH, 

Markgrafenstraße 18, 15528 Spreenhagen, Germany 

E-mail: eva-maria.materne@tu-berlin.de 


Background: Current in vitro and animal tests for drug development are 

failing to emulate the organ complexity of the human body and, therefore, to 

accurately predict drug toxicity. In this study, we present a self-contained, 

bioreactor based human in vitro tissue culture test system aiming to support 

predictive substance testing at relevant throughput. We designed a 

microcirculation system interconnecting several tissue culture spaces within a 

PDMS-embedded microfluidic channel circuit. The bioreactor is reproducibly 

perfused by a peristaltic on-chip micro-pump, providing a near physiologic 

fluid flow and volume to liquid ratio. 

Materials and methods: Liver microtissue aggregates containing 4.8 × 10 4 

HepaRG cells and 0.2 × 10 4 human hepatic stellate cells (HHSteC) were 

formed in Perfecta3D® 384-Well Hanging Drop Plates (3D Biomatrix, USA). 

After two days of hanging drop culture, 20 aggregates were loaded into a 

single tissue culture compartment of the micro-bioreactor. Each circuit of 

the micro-bioreactor device contained 700 μl medium in total. During the 

first 7 days, a 40% media exchange rate was applied at 12 h intervals. From 

day 8 onwards, a 40% exchange rate was applied at 24 h intervals. Daily 

samples were collected for respective analyses. Experiments were stopped 

at day 14 and 28 and tissues were subjected to immunohistochemical 

stainings and qRT-PCR analyses. Experiments were conducted with four 

replicates. To expose the chip-cultures to troglitazone, liver microtissues 

were cultured for one day in normal medium and were, subsequently,




Figure 1(abstract P72) 14-day tissue performance of the micro-bioreactor culture compared to static control Cell functionality shown by 

immunostaining of (A) phase I enzyme CYP450 3A4 (red) and CYP450 7A1 (green), (B) collagen I (red) and vimentin (green), (C) MRP2, an ABC 

transporter located at the apical membrane, (green) and (D) tight junction protein ZO-1 (red). Cell viability shown by TUNEL KI67 staining of 

(E) liver equivalents cultivated for 28 days in the micro-bioreactor and (F) liver equivalents cultivated for 28 days under static conditions. Nuclei are 

stained with hoechst 33342. Scale bar: 100 μm. 

treated with 0 μM, 5 μM and 50 μM substance, respectively. Application of 

troglitazone was repeated at 12 h or 24 h intervals simultaneously with the 

medium change. 

Results: Cultures of human artificial liver microtissues have successfully 

been cultivated over 28 days in the novel microfluidic bioreactor. Glucose 

consumption and lactate production indicated an aerobic metabolism which 

reached a steady state after 7 days. Immunohistochemical staining revealed 

the expression of phase I metabolic enzymes CYP450 3A4 and CYP450 7A1, 

extracellular matrix component collagen I, apical transporter MRP2 and tight 

junction protein ZO-1 (Figure 1A-D). Cell viability over 28 days was increased 

in the bioreactor culture compared to static control (Figure 1E, F). 

Furthermore, the cultures revealed a dose-dependent response to a 7-day 

exposure to the toxic substance troglitazone. Liver microtissues showed 

sensitivity at different molecular levels. Concentration of LDH released to the 

medium increased with troglitazone concentration and gene expression of 

selected marker genes varied. An induction of CYP450 3A4 by troglitazone 

treatment was also recorded on protein level by immunhistochemistry. 

Conclusion: A promising tool for long term culture of human liver 

equivalents has been developed. The simple MOC design presented, 

assisted the culture of human liver equivalents over a period of up to 

28 days. The cultures, operated at a total on-chip volume of 700 μl medium 

at recirculation rates of 40 μl/minassistedbyanon-chipmicropump, 

stabilize approximately within a week at a metabolic steady state. The 

prediction of toxicology profiles of compounds metabolised by the liver was 

demonstrated possible by exposing the cells to different concentrations of 

troglitazone. This platform is designed to generate high-quality in vitro data 

predictive of substance safety in humans. Tissue cultures can be exposed to 

pharmaceutical substances at regimens relevant to respective guidelines, 

currently used for subsystemic substance testing in animals. 



P73 

Evaluation of the advanced micro-scale bioreactor (ambr) asa 

highthroughput tool for cell culture process development 

Frédéric Delouvroy * , Guillaume Le Reverend, Boris Fessler, Gregory Mathy, 

Mareike Harmsen, Nadine Kochanowski, Laetitia Malphettes 

Cell Culture Process Sciences, Biotech Sciences, UCB Pharma S.A., Chemin du 

Foriest, Braine l’Alleud, Belgium 

E-mail: frederic.delouvroy@ucb.com 


Introduction: Bio-pharmaceutical industries face an increasing demand to 

accelerate process development and reduce costs. This challenge requires 

high throughput tools to replace the traditional combination of shake 

flasks and small-scale stirred tank bioreactors. A conventional and widely 

used process development tool is the stirred tank reactor (STR) ranging 

from approximately 1L to 10L in working volume. Physical culture 

parameters such as pH, temperature and pO 2 can be easily controlled in 

such systems. 

However preparation and operation of these systems are time and resource 

consuming. The ambr system from TAP Biosystems has the capabilities for 

automated sampling, feed addition, and control for pH, dissolved oxygen, 

gassing, agitation, and temperature. 

Here, through the evaluation of parameters including cell growth, 

viability, metabolite concentration and production titer during a fed-batch 

process using CHO cells producing a recombinant mAb, we assessed the 

reproducibility of the ambr system for standard conditions compared to 

2L stirred tank bioreactors and the effects of parameter ranging between 

both culture systems, namely feed rate and pH ranging. 

Material and methods: A CHO cell line expressing a recombinant 

monoclonal antibody was used. Cells were carried out for 14 days in a fedbatch 

mode in a chemically defined medium and fed according to process 

description. 

Culture systems: ambr48 is an automated system with 48 disposable 

microbioreactor vessels. Results of ambr 48 workstation (TAP Biosystems) 

were compared to the results obtained with 2L stirred tank bioreactors 

with Biostat B-DCUII control systems (Sartorius Stedim). 

Commercially available production media and feeds were used as per 

manufacturer’s recommendations. pH (7.0 +/- 0.2 for standard conditions). 

All fed-batch cultures lasted 14 days. 

For the scale down model, parameters were divided in two groups. 1. The 

scale dependent factors: culture start volume, feed volumes that are 

linearly dependent and agitation speed and gazing that are theoretically 

or by experiences determined. 2. The scale independent factors: Media, 

temperature, seeding densities, pH, dissolved O 2 , culture duration. 

Product quality of the monoclonal antibody produced was analyzed as 

follows: Cell culture fluid samples were centrifuged and filtered to remove 

cell debris. The monoclonal antibody was purified by ÄKTA-express (GE 

Healthcare) Protein-A purification. The neutralized eluate was used for 

product quality analysis. 

Sample analysis: Viable Cell Concentration (VCC) and cell viability were 

measured using a ViCell XR cell counter (Beckman Coulter). Metabolite 

concentrations were measured by enzymatic assay using a UV-method




Table 1(abstract P73) Design of the experiment 

pH set point Feed rate Number of replicates in ambr run Number of replicates in 2L bioreactor run 

7.0 -30% 2 0 

7.0 -20% 2 1 

7.0 -10% 2 1 

7.0 Control feed rate 6 1 

7.0 +10% 2 1 

7.0 +20% 2 1 

7 +30% 2 0 



(R-Biopharm) for the ambr vessels and by a BioProfile Analyzer 400 

(Nova Biomedical) for stirred tank bioreactors. For both systems, pH 

measurement was obtained with a BioProfile pHOx pH/Gas Analyzer (Nova 

Biomedical), Osmolality was obtained using a Omometer (Advanced 

Instruments). Production titers were measured throughout the culture 

using an Octet QK (ForteBio) and after 14 days with protein A HPLC 

(Agilent) after purification. 

Design of experiment: A 3x7-factorial design was implemented using JMP 

software (SAS). Parameter ranging included pH (6.9, 7.0, and 7.1) and feed 

rate addition (±30%, ±20% and ±10% compared to standard conditions) 

see Table 1. 

Results and discussion: The ambr run was performed in parallel to a 2L 

bioreactor run. Both experiments were inoculated with the same pool of 

cells, same batches of media and feeds were used in both systems. 

Different pH setpoints and feed rates were assessed to determine the 

impact on cell growth (see Table 1), viability and mAb titers. Each 

condition was tested in duplicates in the ambr minibioreactors and 

singlet in 2L bioreactors. The design of experiment is described in Table 1. 

The aim of this experiment was to test the reproducibility within ambr 

and the comparability between the minibioreactors and the 2L. 

Cell growth and cell viability were monitored daily throughout the cultures 

in2L(controlruns,n=4).Intheambr system, cell density and viability 

were measured every two days to avoid excessive sampling on control runs 

(n = 6). Cell viabilities were maintained at acceptable values (>80%) 

throughout the cultures in the established culture conditions.(Figure 1). Cell 

growth and viability performances observed in the ambr minibioreactors 

and 2L bioreactors were comparable (Figure 1). Final mAb titer obtained 

using ambr showed slightly (15%) lower concentration than the 2L 

bioreactors. Osmolality profiles showed the same trend in 15 mL and 2L 

bioreactors (between and 300 mOsm/kg at the beginning and 420 mOsm/kg 

at the end of the run). Online pH profiles were also comparable in both 

ambr minibioreactors and in 2L bioreactors. 

The impact of different feed rates were assessed and compared between 

2L bioreactors stirred tank bioreactors and ambr minibioreactors. 

Obtained results show similar profiles of viable cell density, cell viability, 

pre-harvest Mab titer at day 14 and osmolality profiles with different feed 

rates. 

High feed rates and low feed rates impact cell growth profiles and 

osmolality profiles. The different feed rates applied do not show any 

significant impact on the final mAb titer. Profiles observed in 2L 

bioreactors and ambr are comparable in both systems, except viability 

at the end of the ambr run due to a lack of glucose. 

The impact of different pH setpoints on cell growth, viability, final mAb 

titer and osmolality didn’t showed significant impact on those parameters 

in both systems. mAb titer at day 14 was comparable in 2L stirred 

bioreactors than in the ambr system. 

Conclusions: Our evaluation of the ambr system showed there is good 

reproducibility within the 6 ambr controls. There is good comparability 

Figure 1(abstract P73) Viable cell concentration (VCC) and viability average comparison between ambr and 2L bioreactors (control runs)




in terms of cell growth, product titer, pH, pO2 and osmolality profiles as 

well as PQA obtained between ambr and bioreactors despite the fact 

ambr used a bolus feeding regimen and the stirred tank bioreactors 

used a continuous feeding strategy. The impact of feed rate on cell 

growth and osmolality upon feed rate ranging was observed in both 

culturing systems, but has no impact on PQA. pH set point ranging did 

not have an impact on the measured output parameters in either scale. 

ambr provides a predictive and resource-efficient tool to do process 

development especially media testing, feeding strategy screening and cell 

culture production conditions. 

P74 

Optimized fermentation conditions for improved antibody yield in 

hybridoma cells 

Martina Stützle 1,2* , Alina Moll 1 , René Handrick 1 , Katharina Schindowski 1 

1 Institute of Applied Biotechnology, University of Applied Sciences Biberach, 

Biberach, 88400, Germany; 2 Medical Faculty, Ulm University, Ulm, 89081, 

Germany 

E-mail: martina.stuetzle@hochschule-bc.de 


Background: Traditionally antibody producing cells like hybridoma cells 

sank into oblivion since other suspension cell lines have captured the 

biopharmaceutical production market. However, they are still of particular 

interest in academic and industrial diagnostic research. Hence, fast and 

sufficient antibody production is needed as proof of concept, for toxicology 

and in vivo studies. Although, hybridoma cultivation in fetal bovine serum 

(FBS) containing animal derived ingredients, like contaminating IgG, is 

undesirable and leads to difficulties in purification. When reducing the 

serum to a minimum other key components of the FBS have to be replaced. 

Therefore, human insulin-like growth factor (IGF) [1] and the surfactant 

Pluronic F68 were supplemented to improve overall cell performance and to 

reduce shear stress during shaking respectively employing Design of 

Experiment (DoE)[2]. Compared to the original basal medium an 

improvement in cell growth, viability and antibody titer was achieved. These 

optimized inoculum conditions were used for subsequent bioreactor 

fermentations. Furthermore, these conditions were used in order to test 

feeding strategies. For this purpose a fed-batch process with a double bolus 

feed was simulated in shake flasks with two different glucose feeding 

strategies - with and without Hyclone Cell Boost 6 (CB6). Finally, the result 

from shake flasks could be verified and improved antibody yield was 

achieved in a controlled 2L fed-batch process. 

Material and methods: DoE approach: DoE (Modde, Umetrics) was 

used to optimize the cultivation medium by varying the three factors, 

FBS (1-10%), IGF (10 - 100 μg/L) and Pluronic (0.2 - 1 g/L). The central 

composite face-centered design was applied to test 24 different medium 

compositions. Cells were cultivated with a seeding density of 2 × 10 5 

cells/mL for five days in these media in 40 mL working volume in 125 mL 

shaker flask. Cell concentration and viability was quantified every day 

using an image-based cell counter (Cedex XS, Roche) and were defined 

as response factors for DoE analysis (table 1). Cultures grown with 

optimized conditions were used as inoculum for subsequent bioreactor 

fermentations. 

Feeding strategy: Cells were seeded with 3 × 10 5 cells/mL in 35 mL 

working volume in 125 mL shake flasks in optimized medium (DMEM, 4.5 g/L 

glucose, 2 mM stable glutamine, 6% FBS, 100 μg/L IGF and 0.2 g/L Pluronic). 

The 1 st triplicate was cultivated without feeding as batch control. The 2 nd 

triplicate was fed with 20 mM glutamine and 20 g/L glucose. The 3 rd 

triplicate was fed with 14 g/L glucose in CB6 (Hyclone, Thermo Scientific) 

instead of usual glucose feeding in medium. Substrates and metabolites, cell 

concentration and antibody titer were measured with a chemical analyzer 

(Konelab, Thermo Scientific), an image-based cell counter (Cedex XS, Roche) 

and Protein A HPLC (Agilent), respectively. 

Fed-batch with and without Cell Boost 6: Both feeding strategies with 

and without CB6 were performed again in a 2L bioreactor. The incolumn 

density was 3 × 10 5 cells/mL. The main parameters were kept constant at 

1 mM glutamine and at 2 g/L glucose. 

Table 1(abstract P74) Central composite face-centered result 

Exp No FBS [%] Pluronic [g/L] IGF [ug/L) Viability [%] Viable cell concentration [cells/mL] 

1 -1 (1) -1 (0.2) -1 (10) 75.8 736000 

2 1 (10) -1 (0.2) -1 (10) 79.1 1.468e+006 

3 -1 (1) 1 (1) -1 (10) 66.6 575000 

4 1 (10) 1 (1) -1 (10) 82 1.401e+006 

5 -1 (1) -1 (0.2) 1 (100) 71.6 696000 

6 1 (10) -1 (0.2) 1 (100) 77.9 1.545e+006 

7 -1 (1) 1 (1) 1 (100) 59.3 554000 

8 1 (10) 1 (1) 1 (100) 78.7 1.319e+006 

9 -1 (1) 0 (0.6) 0 (55) 69.1 632000 

10 1 (10) 0 (0.6) 0 (55) 79.8 1.455e+006 

11 0 (5.5) -1 (0.2) 0 (55) 82.5 1.461e+006 

12 0 (5.5) 1 (1) 0 (55) 78.9 1.442e+006 

13 0 (5.5) 0 (0.6) -1 (10) 79.1 1.326e+006 

14 0 (5.5) 0 (0.6) 1 (100) 81.6 1.336e+006 

15 0 (5.5) 0 (0.6) 0 (55) 81.8 1.27e+006 

16 0 (5.5) 0 (0.6) 0 (55) 80.2 1.194e+006 

17 0 (5.5) 0 (0.6) 0 (55) 81.3 1.188e+006 

18 0 0.6 55 28.5 13300 

19 5.5 0 55 78.4 1.255e+006 

20 5.5 0.6 0 81.25 1.2685e+006 

21 5.5 0.2 100 83.7 1.533e+006 

22 10 0 0 83.6 1.28e+006 

23 6 0 0 81.9 1.305e+006 

24 1 0 0 57.2 464000




Results and discussion: DoE approach: A simple DoE approach with the 

three factors FBS, IGF and Pluronic led to improved hybridoma cultivation 

conditions. In Table 1 viability and viable cell concentration are depicted 

from exponential phase for all 24 media on day 3. Additional controls were 

run to improve the model like zero values for each factor and various FBS 

concentrations. FBS could be reduced from 10% to 6% by adding 100 μg/L 

human insulin-like growth factor and 0.2 g/L Pluronic. Compared to the 

original base medium an improvement in cell growth and viability was 

achieved. 

Three concentration levels for each variable including a maximum (1) a 

minimum (-1) and a center point (0) were used. Values shown in parenthesis 

are concentrations. Exp no 15-17 shows the central points for the medium, 

which were repeated three times. Exp no 18-20 shows the zero controls for 

each factor. Exp no 21-24 are additional controls for FBS at different 

concentrations. The concentrations in the yellow and red box are not in 

brackets. Viability and viable cell concentration were determined as 

response factors and used for fitting and evaluating the model. 

Based on the DoE results, the optimized medium was compared to the 

original culture conditions with FBS (10%, 6% and 1%) subsequently in 

125 mL shake flasks in triplicates. Reduction of FBS without supplementation 

results in decreased viability and cell concentration. The optimized medium, 

compared to 10% FBS supplementation, showed a significant impact in 

viable cell concentration and antibody titer by 1.2 fold. 

Feeding strategy: After optimizing the inoculum conditions, a fed-batch 

process was simulated in 125 mL shake flask due to a daily bolus feed with 

glutamine and glucose. The batch control ended in the death phase at day 3, 

whereas the fed-batch feed led to 6 day cultivation time. The feeding 

strategy with CB6 revealed a slightly improved cell growth. This result could 

be tremendously improved in a controlled 2L bioreactor leading to 

elongated process time (6 to 12 days), an increased viable cell concentration 

(from 1.6 × 10 6 cells/mL to 6.4 × 10 6 cells/mL) and higher antibody titer 

(450 mg/L compared to initial 110 mg/L) (Figure 1). 

Fed-batch was started with optimized medium (DMEM supplemented with 

6% FBS, 100 μg/L IGF and 0.2 g/L Pluronic). Glutamine was hold constant at 

1 mM and glucose at 2 g/L. Substrates and metabolites, cell concentration 

and antibody titer were measured with a chemical analyzer (Konelab, 

Thermo Scientific), an image-based cell counter (Cedex XS, Roche) and 

Protein A HPLC (Agilent) respectively each day. 

Conclusion: This data presents DoE as a powerful and efficient time 

saving tool in process optimization as well as a novel feeding strategy for 

fed-batch hybridoma process for increased IgG production. By employing 

DoE, FBS could be decreased from 10% to 6% by 100 μg/L human IGF and 

0.2 g/L Pluronic F68. For entirely serum-free hybridoma culture further 

critical ingredients like transferrin and albumin have to be replaced. 

However, serum-free media leads to higher production costs and can 

result in antibody yield reduction. Optimized medium was successfully 

used for subsequent bioreactor processes starting with a better cell 

performance. Fed-batch feeding with Hyclone Cell Boost 6 was beneficial 

for cell growth and antibody production compared to the conventional 

feed with glucose in medium. Both the optimized medium as well as the 

Cell Boost 6 feeding strategy led to a prolonged process time and 

increased antibody titer in the fermentation process. 

References 

1. Morris A, Schmid J: Effects of Insulin and LongR3 on Serum-Free Chinese 

Hamster Ovary Cell Cultures Expressing Two Recombinant Proteins. 

Biotechnology progress 2000. 

2. Eriksson L, Johansson E, Kettaneh-Wold N, Wikström C, Wold S: Design of 

Experiments: Principles and Applications Umea: UMETRICS ACADAEMY, 3 

2008, 425. 

P75 

High performance CHO cell line development platform for 

enhanced production of recombinant proteins including 

difficult-to-express proteins 

Pierre-Alain Girod 1* , Valérie Le Fourn 1 , David Calabrese 1 , Alexandre Regamey 1 , 

Deborah Ley 2 , Nicolas Mermod 2 

1 Selexis SA, Plan-Les-Ouates, Switzerland; 

2 University of Lausanne, 

Switzerland 

E-mail: pierre-alain.girod@selexis.com 


Background: In an effort to improve product yield of mammalian cell 

lines, we have previously demonstrated that our proprietary DNA 

elements, Selexis Genetic Elements (SGEs), increase the transcription of a 

given transgene, thus boosting the overall expression of a therapeutic 

protein drug in mammalian cells [1]. However, there are additional cellular 

bottlenecks, notably in the molecular machineries of the secretory 

pathways. Most importantly, mammalian cells have some limitations in 

their intrinsic capacity to manage high level of protein synthesis as well as 

folding recombinant proteins. These bottlenecks often lead to increased 

cellular stress and, therefore, low production rates. 

Material and Methods: Our specific approach involves CHO cell line 

engineering. We constructed CHO-M libraries based upon the CHO-M 

genome and transcriptome and using unique proprietary transposon 

vectors harboring SGE DNA elements to compensate for rate-limiting 

factors [2]. Each CHO-Mplus library displays a diversity of auxiliary 

proteins involved in secretory pathway machineries and cellular 

metabolism. Collectively, the libraries address a broad range of expression 

issues. 

Figure 1(abstract P74) Fed-batch process with double feed - glutamine in medium and glucose (F1: with CB6; F2: without CB6).




Figure 1(abstract P75) The iterative application of the CHO-Mplus libraries enabled >10 fold increase in productivity of ScFv:Fc without 

changes in gene copy number or transcription level of gene of interest. 

Results: Figure 1 shows that our CHO-Mplus libraries enabled the 

selection of a clonal cell line expressing 12 fold more product by 

comparison to the unmodified host cell [3]. 

Conclusions: Our results demonstrate that components of the secretory 

and processing pathways can be limiting, and that engineering of the 

metabolic pathway (’omic’ profiling) improves the secretion efficiency of 

therapeutic proteins from CHO cells. 

References 

1. Girod PA, Nguyen DQ, Calabrese D, Puttini S, Grandjean M, Martinet D, 

Regamey A, Saugy D, Beckmann JS, Bucher P, Mermod N: Genome-wide 

prediction of matrix attachment regions that increase gene expression 

in mammalian cells. Nature Methods 2007, 4:747-753, Epub 2007 Aug 5. 

2. Ley D, Harraghy N, Le Fourn V, Bire S, Girod PA, Regamey A, Rouleux- 

Bonnin F, Bigot Y, Mermod N: MAR Elements and Transposons for 

Improved Transgene Integration and Expression. PLoS One 2013, 8: 

e62784. 

3. Le Fourn V, Girod PA, Buceta M, Regamey A, Mermod N: CHO cell 

engineering to prevent polypeptide aggregation and improve 

therapeutic protein secretion. Metab Eng 2013 [http://www.ncbi.nlm.nih. 

gov/pubmed/23380542], Feb 1. pii: S1096-7176(13)00002-5. doi: 10.1016/j. 

ymben.2012.12.003. [Epub ahead of print]. 

P76 

Enhancement mechanism of antioxidant enzyme gene expression by 

hydrogen molecules 

Tomoya Kinjo 1 , Takeki Hamasaki 2 , Hanxu Yan 1 , Hidekazu Nakanishi 1 , 

Tomohiro Yamakawa 1 , Kiichiro Teruya 1,2 , Shigeru Kabayama 3 , 

Sanetaka Shirahata 1,2* 

1 Graduate School of Systems Life Sciences, Kyushu University, Fukuoka 812- 

8581, Japan; 

2 Department of Bioscience and Biotechnology, Faculty of 

Agriculture, Kyushu University, Fukuoka 812-8581, Japan; 

3 Nihon Trim Co. 

Ltd., Osaka 531-0076, Japan 

E-mail: sirahata@grt.kyushu-u.ac.jp 


Background: Redox regulation system protects our body from oxidative 

stress-injury and keeps redox homeostasis. The hydrogen molecules (H 2 ) 

exist as stable gas in the ordinal temperature and atmosphere. Recent study 

reports H 2 improve ischemia-reperfusion injury, glaucoma, Parkinson’s 

disease and atherosclerosis of animal models. It is supposed from these 

improvement results that H 2 participate in reduction of the oxidation stress, 

however, the reaction mechanism has not been clarified thoroughly. We 

surmised that intracellular redox regulation system is activated by H 2 

thereupon antioxidative activity is generated. Thus, we tried to find the 

effect of H 2 on the Nrf2 pathway, one of the redox regulation systems. 

Materials and methods: HT1080 cells, a human fibrosarcoma cell line, 

were incubated in a gas incubator at an atmosphere of 75%N 2 /20%O 2 /5% 

CO 2 or 75%H 2 /20%O 2 /5%CO 2 for24h.Then,afterthecellsweretreated 

with H 2 O 2 or fixative solution for 30 min or 15 min, the intracellular H 2 O 2 

and Nrf2 were determined by In cell analyzer and Confocal laser microscop 

using a BES-H 2 O 2 or anti-Nrf2 antibody, respectively. Furthermore, after 

extraction of mRNA from the treated HT1080 cells, the gene expressions 

were examined by using Real-time PCR. 

Results: The quantity of intracellular H 2 O 2 increased by hydrogen 

peroxide treatment was significantly decreased by pretreatment of H 2 .H 2 

enhanced the expression of catalase, glultathione peroxidase, Cu/Znsuperoxide 

dismutase, Nrf2 genes and Nrf2 protein. 

Conclusions: It was suggested that H 2 induced the expression level of 

antioxidant enzyme genes like catalase and glutathione peroxidase by 

increasing the expression level of the Nrf2 protein and decreased the 

amount of intracellular H 2 O 2 induced by the H 2 O 2 treatment in HT1080 cells. 

P77 

Evaluation of the impact of matrix stiffness on encapsulated HepaRG 

spheroids 

Sofia P Rebelo 1,2 , Marta Estrada 1,2 , Rita Costa 1,2 , Christophe Chesné 3 , 

Catarina Brito 1,2 , Paula M Alves 1,2* 

1 iBET, Instituto de Biologia Experimental e Tecnológica, 2780-901 Oeiras, 

Portugal; 2 Instituto de Tecnologia Química e Biológica, Universidade Nova de 

Lisboa, 2780-157 Oeiras, Portugal; 3 Biopredic International, Rennes, France (C.C., 

R.L., S.C.) 

E-mail: marques@itqb.unl.pt 


Background: The drug development process is widely hampered by the 

lack of human models that recapitulate liver functionality and efficiently 

predict toxicity of new chemical compounds. Moreover, liver failure is a 

global medical problem, with transplantation being the only effective 

treatment currently available. The bipotent liver progenitor cell line HepaRG 

can be differentiated into cholangiocyte and hepatocyte-like cells that 

express major functions of mature hepatocytes, representing a valuable tool 

to model hepatic function [1]. Current two-dimensional (2D) protocols for 

the differentiation into mature hepatocyte-like cells fail to recapitulate the 

complex cell-cell interactions, which are crucial for maintaining polarity and 

inherent mature hepatic functionality. Herein, we present a threedimensional 

(3D) strategy for the culture of HepaRG cells based on the 

encapsulation of aggregates. The effect of matrix stiffness on expansion and 

differentiation was evaluated through encapsulation with different 

concentrations of alginate (1.1% and 2%). Further characterization of the 

hepatic features will reveal the extent of the hepatic functionality of the 

generated spheroids. 

Materials and methods: HepaRG cells were routinely propagated in static 

conditions as previously described [2]. Briefly, culture medium Williams E 

was supplemented with 1% (v/v) Glutamax, 1% (v/v) pen/strep, 5 μ g/ml 

insulin and 50 μ M hydrocortisone hemissuccinate and 10% (v/v) FBS and 

cultures were maintained at 37 ° C, 5% CO 2 . Spinner vessels with ball impeller 

(Wheaton) were inoculated with inoculums ranging from 5 to 8 × 10 5 cell/mL



Page 100 of 151 

and an agitation ranging from 35 to 45 rpm to attain the desired aggregation 

conditions. Aggregate size was determined by measuring Ferret’s diameter 

using the Image J software (NIH). After 3 days of aggregation, spheroids were 

encapsulated in 1.1% and 2% (w/v) of Ultra Pure MVG alginate (UP MVG 

NovaMatrix, Pronova Biomedical) in NaCl 0.9% (w/v) solution. Encapsulation 

was performed in an electrostatically driven microencapsulation unit VarV1 

(Nisco) and cultures were maintained for 14 days in stirred culture conditions. 

Viability was determined by the double stain viability test - alginate beads 

were collected from stirred cultures, incubated with fluorescein diacetate 

(10 μg/mL) and TO-PRO3 ® (1 μM)andobservedonafluorescence 

microscope (Leica DMI6000) - and by the Trypan blue exclusion method - 

alginate beads were dissociated with a solution of Sodium citrate 50 mM, 

Sodium chloride 104 mM and spheroids were dissociated by incubation with 

Trypsin0.05%-EDTA(Gibco)andcountedtrypanblueexclusiondye.For 

characterization of the cultures, encapsulated spheroids were fixed as 

previously described [3] and incubated with phalloidin and prolong gold with 

DAPI and images were acquired in a confocal microscope (Andor spinning 

disk). 

Results: In 2D cultures, HepaRG cells proliferate until confluence is reached 

and the cell-cell interactions established associated with the spatial 

constriction are postulated to trigger the differentiation program and 

maintain the differentiated state [1,4]. Moreover, the mechanochemical 

environment has been previously shown to strongly influence the liverspecific 

functions [5]. Thus, it was hypothesized that the microenvironment 

created by encapsulation of spheroids with an inert biomaterial with 

different stiffness levels, would promote differential behavior of the 

spheroids, towards differentiation or proliferation. Alginate concentrations 

of 1.1 and 2% (w/v) were used, given the 10 fold difference in stiffness, 

measured by the elastic modulus [6]. Both viability and the growth profile 

were monitored throughout culture time. 

In both culture conditions, the viability was maintained above 85%, 

showing that the alginate concentration does not affect diffusion of 

nutrients or oxygen to supply effectively the cell spheroids (Figure 1 A). 

Moreover, it was observed that the growth profile was comparable for the 

two cultures, with growth arrest after aggregation and no proliferation 

occurring either in both alginate concentrations (Figure 1 B). This suggests 

that the differentiation program is triggered either in softer and stiffer 

microenvironments, being 1.1% alginate concentration sufficient to initiate 

the process. 

The structural organization of the cell spheroids in both stiffness environments 

was characterized by the arrangement of actin filaments, which is 

associated to the tight junctions in highly polarized epithelial cells. As 

showninFigure1C,thecellsaredisposedinahighlypolarizedmanner, 

without necrotic centres. 

Conclusions: In the current work, the encapsulation of liver spheroids 

with different stiffness conditions was evaluated as a strategy to culture 

HepaRG cells. It was observed that the encapsulation with different 

alginate concentrations is compatible with maintenance of highly viable 

cultures of liver spheroids, with growth arrest and cell polarization 

promoted by spatial constriction and the enhanced cell-cell interactions 

in 3D. 

Acknowledgements: This work was supported by PTDC/EBB-BIO/112786/ 

2009 and SFRH/BD/70264/2010 FCT, Portugal. 

References 

1. Guillouzo A, Corlu A, Aninat C, Glaise D, Morel F, Guguen-Guillouzo C: The 

human hepatoma HepaRG cells: a highly differentiated model for 

studies of liver metabolism and toxicity of xenobiotics. Chem Biol Interact 

2007, 168:66-73. 

2. Gripon P, Rumin S, Urban S, Le Seyec J, Glaise D, Cannie I, Guyomard C, 

Lucas J, Trepo C, Guguen-Guillouzo C: Infection of a human hepatoma 

cell line by hepatitis B virus. Proc Natl Acad Sci USA 2002, 99:15655-15660. 

3. Tostoes RM, Leite SB, Serra M, Jensen J, Bjorquist P, Carrondo MJ, Brito C, 

Alves PM: Human liver cell spheroids in extended perfusion bioreactor 

culture for repeated-dose drug testing. Hepatology 2012, 55:1227-1236. 

4. Cerec V, Glaise D, Garnier D, Morosan S, Turlin B, Drenou B, Gripon P, 

Kremsdorf D, Guguen-Guillouzo C, Corlu A: Transdifferentiation of 

hepatocyte-like cells from the human hepatoma HepaRG cell line 

through bipotent progenitor. Hepatology 2007, 45:957-967. 

5. Semler EJ, Ranucci CS, Moghe PV: Mechanochemical manipulation of 

hepatocyte aggregation can selectively induce or repress liver-specific 

function. Biotechnol Bioeng 2000, 69:359-369. 

6. Martinsen A, Skjak-Braek G, Smidsrod O: Alginate as immobilization 

material: I. Correlation between chemical and physical properties of 

alginate gel beads. Biotechnol Bioeng 1989, 33:79-89. 

P78 

Feeding strategy optimization in interaction with target seeding 

density of a fed-batch process for monoclonal antibody production 

Marie-Françoise Clincke 1* , Grégory Mathy 1 , Laura Gimenez 1 , 

Guillaume Le Révérend 1 , Boris Fessler 1 , Jimmy Stofferis 1 , Bassem Ben Yahia 1 , 

Nicola Bonsu-Dartnall 2 , Laetitia Malphettes 1 

1 Cell Culture Process Sciences Group, BioTech Sciences, UCB Pharma S.A., 

Braine L’Alleud, Belgium; 

2 In-Process Analytics Group, BioTech Sciences, UCB 

Celltech, Slough, UK 

E-mail: Marie-Francoise.Clincke@ucb.com 


Background: Current trend towards Quality by Design (QbD) leads the 

process development exercise towards systematic experimentation, 

rational development, process understanding, characterization and control. 

In this study, an example of the application of QbD approach is given. 

Optimization of the feeding strategy and the target seeding density was 

performed and interactions of the two parameters were assessed in order 

to enhance cell growth and MAb productivity. The feeding strategy was 

optimized to take into account daily process performance attributes and 

Figure 1(abstract P77) Characterization of encapsulated cultures of HepaRG spheroids (A) Viability assessed by staining the encapsulated spheroids 

with fluorescein diacetate (live, green) and TO-PRO3 ® (dead, red). Spheroids in 1.1 and 2% (w/v) of alginate after 14 days of culture are represented. 

Scale bar: 100 μm (B) Growth profile of encapsulated cultures of 1.1 and 2% (w/v) of alginate. (C) Immunofluorescence characterization of hepatic 

spheroids (1.1% alginate) after 14 days of culture. Actin filaments - green; Nuclei - blue. Scale bar: 10 μm.



Page 101 of 151 

associated nutrient needs of the culture to maintain a balance between 

metabolism and MAb productivity. For scale up the feed strategy was 

simplified to become independent of daily process performance attributes. 

Feed ranging studies were performed to assess the robustness of the 

process. 

Materials and methods: 2L stirred tank bioreactors were run for 14 days 

in a fed-batch mode in a chemically defined medium. Feed was added 

daily from day 3 onwards. If required, antifoam C was added to the 

bioreactor by manual injections. DO, pH, and temperature were controlled 

at setpoint. DO was controlled using a multi-stage aeration cascade via a 

ring sparger. Viable cell concentration, cell viability, and average cell 

diameter were measured using a ViCell cell counter. The glucose, lactate, 

glutamine and ammonia concentrations were measured with a BioProfile 

Analyzer 400. On the day of harvest, the clarification was performed by 

centrifugation plus depth filtration. Monoclonal Antibody (MAb) 

concentration of the supernatant samples was quantified using Octet QK 

and Protein A high performance liquid chromatography. 

Results: Interaction study between feeding strategy and Target 

Seeding Density (TSD): Previous experiments performed with different 

daily fixed volume feed additions showed a correlation between feeding 

strategy and specific MAb productivity. It was observed that a significant 

decrease in the specific MAb productivity occurred if the feed ratio per the 

projection of a subset of process performance attributes was below a 

specific threshold (data not shown). A feed addition strategy based on the 

projected subset of process performance attributes was then developed. 

Based on previous screening study, feed ratio from 0.004 to 0.006 arbitrary 

units and and TSD from 0.30 to 0.40 arbitrary units were assessed. Custom 

DoE was performed with JMP SAS to study the interactions between both 

parameters. Number of interactions between the factors and the power of 

each factor were both fixed at 2. In total, 12 bioreactors were run. This 

Design of Experiment (DoE) was applied to the process development of a 

cell line 1 producing a monoclonal antibody and led to a 36% increase in 

the monoclonal antibody titer compared to control condition (Figure 1). 

The final feed ratio was based on (i) the improvement of MAb titer 

compared to the control condition, (ii) the scalability of the process 

(Culture start volume high enough to cover the impellers and low enough 

in order for Culture final volume to not exceed the maximum volume of 

the production bioreactor at large scale). TSD was fixed at 0.35 arbitrary 

units, so that a minimum dilution factor of 1:5 between the N-1 passage 

and the production bioreactor is achievable. 

Feeding strategy simplification, mode of feed addition, feeding 

ranging study: The design of the feeding strategy was simplified in order 

to facilitate the process transfer to large scale manufacture. Hence, based 

on the final feed ratio, the feed rates were fixed with a feed volume 

independent of the projected subset of process performance attributes. 

The pH of the feed is highly basic. In our 2L experiments, feed was added 

within less than 5 min, which generates pH excursions above 7.40. 

A strategy of slow bolus addition with a fixed minimum addition 

timeframe and with a fixed maximum flow rate was implemented, leading 

to minor pH-excursions during feeding with only minor CO 2 flows 

necessary to keep the pH within the pH deadband (data not shown). The 

robustness of the process was assessed by performing an experiment with 

over- and underfeeding cultures. Underfeeding at 20% below target had 

no impact on process performance (MAb titer) while feeding 20% above 

target led to a lower MAb titer (Table 1). No impact of underfeeding or 

overfeeding at ± 20% of the feed target was observed on the Acidic Peak 

Group (APG) and aggregate levels. Feeding 20% above target led to an 

increase in Mannose 5 species. 

Conclusions: DoE enabled us to study the impact of the feed addition 

strategy and the impact of the TSD on the Mab titer and PQAs at harvest 

in a time efficient manner. The feeding strategy was simplified to become 

independent of the projected subset of process performance attributes 

and to be scalable to large scale manufacture. The mode of feed addition 

was optimized to minimize pH-excursions during feeding. Feed ranging 

studies showed that underfeeding at 20% below target had no impact on 

MAbtiterandPQAswhilefeeding20%abovetargetledtoalowerMAb 

titer and an increase in Mannose 5 species (glycan). Finally, a 36% increase 

in the MAb titer was achieved in the feed optimized conditions compared 

to control condition at harvest with a feed strategy designed to be robust 

and scalable. 

P79 

Process development and optimization of fed-batch production 

processes for therapeutic proteins by CHO cells 

Marie-Françoise Clincke * , Mareike Harmsen, Laetitia Malphettes 

Cell Culture Process Sciences Group, BioTech Sciences, UCB Pharma S.A., 

Braine L’Alleud, Belgium 

E-mail: Marie-Francoise.Clincke@ucb.com 


Figure 1(abstract P78) Impact of feed ratio and TSD on MAb titer at harvest day as well as one-way Anova study comparing the MAb titer at 

harvest (optimized process vs. baseline process in all runs) 

Table 1(abstract P78) MAb titers and Product Quality Attributes observed during the feed ranging study 

MAb titer (Normalized) APG (Normalized) Aggregate (Normalized) Mannose 5 (Normalized) 

Center point (n = 2) 1.00 1.00 1.00 1.00 

+20% Feed (n = 2) 0.54 0.97 0.95 1.78 

-20°% Feed (n = 2) 1.10 1.01 1.04 0.94



Page 102 of 151 

Figure 1(abstract P79) Viable cell concentration and off-line pH, pCO 2 , osmolality, lactate and ammonia profiles during fed-batch culture (solid 

black line: cell line 2, process 1 strategy, short dash line: cell line 1, process 1, long dash line: cell line 2, process 2) 

Table 1(abstract P79) Comparison of MAb titers 

(normalized) obtained for both cell lines at 2L scale and 

80L scale 

Cell line 1, Process 1 Cell line 2, Process 2 

2L scale 1.00 1.00 

80L scale 0.99 1.09 

Background: In the biopharmaceutical industry, process development and 

optimization is key to produce high quality recombinant proteins at high 

yields. As technologies mature, pressure on cost and timelines becomes 

greater for delivering scalable and robust processes. Overall, process 

development should be viewed as a continuum from the early stages up to 

process validation. Here we outline a lean approach on upstream development 

during the initial phases to optimize yields while maintaining the desired 

product quality profiles. Early-stage process development was designed to



Page 103 of 151 

lead to the establishment of a baseline process and to systematically include 

experiments with input parameters that have a high impact on performance 

and quality. At this stage, potential for pre-harvest titer and yield increases as 

well as product quality challenges were identified. Feed adjustments and 

systematic experiments with top, high, and medium impact parameters have 

then been performed to develop a robust and scalable process. This approach 

was applied to two early stage upstream processes. 

Materials and methods: 2L and 80L stirred tank bioreactors were run for 

14 days in a fed-batch mode in a chemically defined medium. Feed was 

added daily from day 3 onwards. If required, antifoam C was added to 

the bioreactor by manual injections. DO, pH, and temperature were 

controlled at setpoint. DO was controlled using a multi-stage aeration 

cascade via a ring sparger. Viable cell concentration, cell viability, and 

average cell diameter were measured using a ViCell cell counter. The 

glucose, lactate, glutamine and ammonia concentrations were measured 

with a BioProfile Analyzer 400. On the day of harvest, the clarification was 

performed by centrifugation plus depth filtration. Monoclonal Antibody 

(MAb) concentration of the supernatant samples was quantified using 

Protein A high performance liquid chromatography. 

Results: A lean and Quality by Design (QbD) approach on process 

development during the initial phases to optimize yields while maintaining 

the desired product quality profiles was adopted. In this approach, a 

workpackage including the expected high impact parameters (feeding 

strategy, seeding density, pH, temperature and the interaction studies) was 

defined. This workpackage was applied to the process development of a 

cell line 1 producing a monoclonal antibody and led to a 36% increase in 

the monoclonal antibody titer compared to control condition (data not 

shown). Then, the operational process parameters and feeding strategy 

developed for cell line 1 (process 1) were applied to a cell line 2 producing 

a monoclonal antibody fragment. The application of the process 1 strategy 

to a cell line 2 was not the best for cell line 2 and led to high pCO 2 level, 

high ammonia concentration, high osmolalities and low monoclonal 

antibody fragment titers (Figure 1). A feeding strategy was optimized for 

cell line 2 and pH set-point and deadband were also adjusted in order to 

decrease the pCO 2 level. This optimized process for cell line 2 led to higher 

performances (pCO 2 , ammonia concentration, and osmolalities values were 

maintained at a low level) with a 43% increase in the monoclonal antibody 

fragment titer (data not shown). Then both processes were scaled up to 

80L stirred tank bioreactors and comparable monoclonal antibody titers 

were obtained at 2L scale and 80L scale (Table 1). For the cell line 1, 

Product Quality Attributes such as Acidic Peak Group, aggregate and 

Mannose 5 were assessed and were maintained within the expected 

ranges with scale-up (data not shown). 

Conclusions: A similar process development approach was applied to 

both projects where identical high impact parameters were identified. 

Although process optimized for cell line 1 was not the best for cell line 2, 

we were able to use it as a starting point and were able to optimize within 

the tight timelines. For both projects, high titers were achieved following 

our lean approach on process development. The final process 1 optimized 

for a cell line 1 led to a 36% increase in monoclonal antibody titer. The 

final process 2 optimized for a cell line 2 led to a 43% increase in 

monoclonal antibody fragment titer. Comparable titers and product quality 

attributes were observed at 2L scale and 80L scale. Hence the adopted 

feeding strategy proved to be robust and scalable. 

P80 

Characterization of mAb aggregates in a mammalian cell culture 

production process 

Albert Paul * , Friedemann Hesse 

Institute of Applied Biotechnology, University of Applied Sciences Biberach, 

Biberach, 88400, Germany 

E-mail: paul@hochschule-bc.de 


Introduction: Protein aggregation is a major concern during monoclonal 

antibody (mAb) production [1,2]. The presence of aggregates can reduce the 

therapeutic efficacy of mAbs and trigger immunogenic responses upon 

administration [3]. Higher molecular weight (HMW) aggregates can be 

removed during downstream processing (DSP), but prevention of aggregate 

formation upstream could increase process yield [4,5]. Unfortunately, 

detection of aggregates upstream is challenging, since the size of aggregates 

ranges from small oligomers to visible particles and there is no single 

technique capable of measuring the broad range of aggregation phenomena 

[6,7]. For upstream detection of aggregates, all HMW species potentially 

present in the culture broth must be known. Therefore, we established 

methods to generate different types of aggregates and characterized the 

different HMW species using size exclusion high pressure liquid 

chromatography (SE-HPLC), dynamic light scattering (DLS) and UV 

spectroscopy. Furthermore, stability and traceability of the aggregates in cell 

culture medium and Chinese hamster ovary (CHO) DG44 supernatant were 

demonstrated. Finally, the established methods were used to monitor 

aggregate formation in a mAb producing CHO DG44 cell culture. 

Material and methods: Two mAbs produced in CHO DG44 cells and 

stored in 20 mM acetate at pH 3.5 were used for aggregation studies. 

Aggregation was induced using heat stress, pH-shift, high salt concentration 

and freeze-thawing. Heat stress was induced at 65 °C for different time 

periods. For the pH-shift, the antibody was diluted in citrate-phosphate 

buffer containing pH 3-8. NaCl concentrations for salt-induced aggregation 

varied from 50-1500 mM. A freeze-thawing cycle included incubation at 

-80 °C for 15 min followed by thawing at 25 °C for 15 min. The freeze-thaw 

cycle was repeated three times. The presence of small aggregates was 

evaluated using SE-HPLC equipped with a Yarra SEC4000 (Phenomenex) 

column. To identify the different HMW species the molecular weight was 

determined using SEC-MALS (multi-angle light scattering). Moreover, large 

aggregates were characterized using DLS (Zetasizer 3000HS, Malvern 

instruments) and UV spectroscopy (SpectraMax M5 e microplate reader, 

Molecular Devices). The size of large aggregates was displayed by 

the average diameter. The aggregation index (AI) was calculated from UV 

absorbance using the following equation: A 340 × 100/(A 280 -A 340 ). 

Furthermore, stability of induced aggregates in cell culture medium 

(SFM4CHO, Thermo Scientific) and CHO DG44 host cell supernatant was 

investigated. Therefore, freeze-thawed mAb2 was spiked into the culture 

medium as well as CHO DG44 host cell supernatant and analyzed via SE- 

HPLC. Finally, the supernatant of CHO DG44 mAb2 producer cells was 

analyzed directly after inoculation and at the end of cultivation. Based on 

results obtained from spiking aggregated mAb2 into CHO DG44 host cell 

supernatant, aggregate formation in a culture of a mAb producing CHO 

DG44 cell line was monitored. 

Results: All stress methods provoked aggregate formation. The mAbs 

showed formation of different aggregates using the different stress 

methods (Table 1). Heating the antibody only led to formation of large 

aggregates. Despite the loss of mAb2 monomer, no small aggregates were 

detected via SE-HPLC. However, heat induction provoked formation of 

large aggregates, whereby the average size (diameter > 1 μm) and AI 

increased over time at 65 °C. Hence, heat induction can only be used to 

generate large aggregates of the mAbs used in this study. The pH change 

provoked formation of small aggregates (dimer and oligomer) as well as 

large aggregates (diameter > 75 nm). With increasing pH dimer and 

oligomer levels also increased, whereas an increased diameter was only 

observed for pH 5 and 6. Thus, a shift to pH 6 can be used for induction of 

dimers, oligomers and large aggregates. The addition of NaCl provoked 

concentration-dependent formation of dimers and large aggregates 

(diameter>50nm)athigherNaClconcentrations(above500mM).In 

contrast to pH-induction, no oligomers larger than dimer were visible via 

SE-HPLC. Therefore, NaCl can be used for the fast generation of dimers and 

above a concentration of 500 mM for the induction of large aggregates. 

With increasing freeze thaw cycles formation of small aggregates occurred. 

Surprisingly, more aggregates were formed than with all other methods. 

Hence, freeze-thawing was used to study the stability of aggregates under 

culture conditions. 

Table 1(abstract P80) Formation of different HMW 

species using different induction methods 

Induction Method Small aggregates Large aggregates 

Dimer Oligomer 

Heat - - Up to 1 μm 

pH Increase with pH + At pH 5 and 6 

NaCl Increase with NaCl - Above 500 mM 

Freeze-thawing + + -



Page 104 of 151 

Figure 1(abstract P80) Freeze-thawed mAb2 spiked into cell culture medium (A) and supernatant of CHO DG44 mAb producer cells (B). 

For this purpose, freeze-thawed mAb2 was spiked into culture medium 

and analyzed using SE-HPLC (Figure 1, A). Since the retention time of cell 

culture medium components differed from the freeze-thawed antibody, 

monomer and the aggregates were still detectable. Accordingly, freezethawing 

was preferred for the use in cell culture supernatant spiking 

experiments. The investigation of freeze-thawed (3x) mAb2 spiked into CHO 

DG44 host cell supernatant revealed that mAb2 monomers as well as the 

aggregates (22% dimer and 72% oligomer) were still detectable and 

quantifiable via SE-HPLC. Knowing the retention time of different aggregate 

species, the analysis of the supernatant of a CHO DG44 mAb producing cell 

line was performed at the beginning and after 144 h cultivation (Figure 1, B). 

Aggregates and monomer could successfully be detected after 144 h via 

SE-HPLC, whereas after inoculation neither monomer nor aggregates were 

visible. Therefore, the methods established in this work can be used to 

generate different types of aggregates as positive control to evaluate 

aggregate formation in cell culture supernatant. 

Summary: The stress methods used in this work induced different types of 

aggregates. Heating the antibody led to a loss of monomer and only 

formation of large aggregates. Dimers and oligomers were formed with 

increasing pH and large aggregates were formed at pH 5 and 6. A NaCl 

concentration dependent aggregate formation was observed, whereby 

only dimers were visible via SE-HPLC and large aggregates were only 

present at a NaCl concentration above 500 mM. Freeze-thawing induced 

more aggregates as with all other methods and was therefore used for the 

application under cell culture conditions. Spiking experiments of freezethawed 

mAb2 in culture medium and CHO DG44 host cell supernatant 

revealed that aggregates were still detectable and quantifiable under cell 

culture conditions. Finally, this work showed that aggregate formation 

directly in the supernatant of a CHO DG44 mAb producing cell line is 

possible. 

References 

1. Ishikawa T, Ito T, Endo R, Nakagawa K, Sawa E, Wakamatsu K: Influence of 

pH on heat-induced aggregation and degradation of therapeutic 

monoclonal antibodies. Biological & pharmaceutical bulletin 2010, 

33:1413-1417. 

2. Pease LF, Elliott JT, Tsai D-H, Zachariah MR, Tarlov MJ: Determination of 

protein aggregation with differential mobility analysis: application to IgG 

antibody. Biotechnology and bioengineering 2008, 101:1214-1222. 

3. Filipe V, Poole R, Oladunjoye O, Braeckmans K, Jiskoot W: Detection and 

characterization of subvisible aggregates of monoclonal IgG in serum. 

Pharmaceutical research 2012, 29:2202-12. 

4. Gomez N, Subramanian J, Ouyang J, Nguyen MDH, Hutchinson M, 

Sharma VK, Lin Aa, Yuk IH: Culture temperature modulates aggregation of 

recombinant antibody in cho cells. Biotechnology and bioengineering 2012, 

109:125-136. 

5. Jing Y, Borys M, Nayak S, Egan S, Qian Y, Pan S-H, Li ZJ: Identification of 

cell culture conditions to control protein aggregation of IgG fusion 

proteins expressed in Chinese hamster ovary cells. Process Biochemistry 

2012, 47:69-75. 

6. Philo JS: Is any measurement method optimal for all aggregate sizes and 

types? The AAPS journal 2006, 8:E564-E571. 

7. Arakawa T, Philo JS, Ejima D, Tsumoto K, Arisaka F: Aggregation Analysis of 

Therapeutic Proteins, Part 1: General Aspects and Techniques for 

Assessment. 2006, 4:42-43. 

P81 

Identification of process relevant miRNA in CHO cell lines - Process 

profiling reveals interesting targets for cell line engineering 

Fabian Stiefel 1* , Matthias Hackl 2 , Johannes Grilliari 2 , Friedemann Hesse 1 

1 Institute of Applied Biotechnology Biberach, Germany; 

2 University of Natural 

Resources and Life Sciences, Institute for Applied Microbiology, Vienna, 

Austria 

E-mail: stiefel@hochschule-bc.de 


Introduction: MicroRNAs (miRNAs) are small RNAs which function as 

regulators of posttranscriptional gene expression by binding to their mRNA 

targets [1]. MiRNAs are involved in crucial regulations of many signaling and 

metabolic pathways. In difference to other interfering RNAs (RNAi), miRNAs 

can target many mRNA, thus having an increased impact on regulation of 

gene expression. These properties of miRNAs makes them interesting and 

promising targets for biomarkers and cell line engineering [2,3]. Therefore, 

we studied miRNA profiles during different culture phases and process 

conditions and investigated the potential of differentially expressed miRNAs 

as targets for process optimization. This may help to pave the way to 

introduce a new layer of control for cell line engineering. 

Results: For miRNA target selection a strain from Chinese hamster ovary 

cells (CHO-DG44) was cultivated in a 2L bioreactor (Biostat B plus, Sartorius 

Stedim, Germany) in Batch mode and two different process conditions, 

control runs and temperature shift. For the control runs temperature was 

maintained at 37°C all time, while for the temperature shift the temperature 

was reduced to 30°C. Isolated RNA was analyzed using microarray 

technology (PowerScanner and HS 400 Pro Hybridisation station, Tecan, 

Germany and a cross-species chip containing miRNAs from human, mouse 

and rat, University of Graz) and the best differential expressed miRNA were 

cross-validated with qRT-PCR. 

The optimized bioreactor protocol, shown in Figure 1 A, each process 

condition included two independent biological replicates. The control 

runs show good growth behavior to a maximal viable cell concentration 

of 2.9 × 10 6 cells/ml. Reducing temperature from 37°C to 30 °C resulted 

in a clear inhibition of cell growth by sustained viability. From each time 

point of the different culture phases a sample was taken and total RNA 

was purified. 

Purified samples were labeled and then analyzed on a cross species 

miRNA microarray chip. Differential expressionwasalwayscalculated 

between the time points for the respective culture stage compared to 

day zero (shown in Table 1). The temperature shift from 37°C to 30°C



Page 105 of 151 

Figure 1(abstract P81) A) Sample creation with final protocol of CHO-DG44 cells in 2L bioreactors. B) Summary of miRNA targets of microarray 

analysis for validation with qRT-PCR 

after 46 hours had a high impact on the miRNA profile with 22 

differentially expressed miRNAs for the early response from day three 

(D3-D0). In the late response (D5-D0) only three miRNAs and 18 miRNAs 

intheverylateresponse(D7-D0)weredifferentiallyexpressed.Two 

miRNAs were constantly expressed after shifting the temperature. In the 

control run at 37°C the number of differentially expressed miRNA was 

increasing during the course of the cell culture ranging from two miRNAs 

for the early to medium exponential phase, 12 miRNAs for the late 

exponential phase to 28 miRNA in the declining phase. 

To validate microarray normalization and results, differentially expressed 

miRNAs from the microarray analysis were cross-validated with qRT-PCR. 

This validation was conducted for respective miRNA of the time points 

before and after the temperature shift. Fold changes of mmu-miR-207 

(Log 2 FC of microarray was 2.0 and 2.9 for qRT-PCR) and mmu-471-5p 

207 (Log 2 FC of microarray was 4.4 and 5.0 for qRT-PCR) obtained from 

microarray and qRT-PCR technology were very comparable and showed 

same trends. This indicates that the microarray results can be used for a 

deeper analysis of the differentially expressed miRNAs. 

During a batch run, culture parameters are changing. In order to investigate 

the impact of these changes to miRNA profiles, time course of differential 

expression of miRNA during the different cell culture phases were analyzed. 

For the time courses of ten miRNAs in the temperature shift most of the 

miRNAs showed their highest differential expression shortly after the 

reduction of the temperature. Some miRNAs keep their level of differential 

expression, some return to normal levels three days after the temperature 

shift. One miRNA is differential expressed at the end of the observed culture 

phase. In the control run the number of differential expressed miRNAs and 

the fold change of the differential expression is increasing during 

progressing culture phase. 

Figure 1 B shows the differential expression of ten miRNA directly after the 

temperature shift and four miRNAs for the control runs between day zero 

and the declining phase at day seven. For the temperature shift differential 

expression ranges from log 2 FC 1.7 to 5.4 and 2.0 to 4.4 for the control 

Table 1(abstract P81) Summary of differentially 

expressed miRNAs in the control run and the 

temperature shift 

Amount of differentially expressed miRNA 

Control 

Temperature shift 

D2-D0 0 0 

D3-D0 2 22 

D5-D0 12 3 

D7-D0 28 18 

runs. This selection of miRNAs presented here may be interesting 

candidates for further investigation using miRNA overexpression/inhibition 

and phenotype studying. 

Conclusion: As a conclusion, with optimized bioreactor protocols it was 

possible to establish miRNA profiles of CHO-DG44 cells for different culture 

phases on cross species microarray chips. The number of differential 

expressed miRNAs was increasing by progressing of the culture phase. 

Additionally, the impact of a temperature shift on the profiles revealed 

several highly differentially expressed miRNA. Some of these miRNAs were 

already cross-validated with qRT-PCR which confirmed the results from the 

microarray experiment. MiRNA targets of these two experimental 

approaches will help to increase the knowledge of the role of miRNAs 

during a bioreactor process and might pave the way for their use in cell line 

engineering. 

References 

1. Chen K, Rajewsky N: The evolution of gene regulation by transcription 

factors and microRNAs. Nature reviews Genetics 2007, 8:93-103. 

2. Barron N, Sanchez N, Kelly P, Clynes M: MicroRNAs: tiny targets for 

engineering CHO cell phenotypes? Biotechnology letters 2011, 33:11-21. 

3. Hackl M, Jadhav V, Jakobi T, Rupp O, Brinkrolf K, Goesmann A, Pühler A, 

Noll T, Borth N, Grillari J: Computational identification of microRNA gene 

loci and precursor microRNA sequences in CHO cell lines. J biotechnol 

2012, 158:151-155. 

P82 

Introducing a new chemically defined medium and feed for hybridoma 

cell lines 

Christoph Heinrich 1* , Tim F Beckmann 1 , Sandra Klausing 1 , Stefanie Maimann 2 , 

Bernd Schröder 2 , Stefan Northoff 1 

1 TeutoCell AG, Bielefeld, 33613, Germany; 

2 Miltenyi Biotec GmbH, Teterow, 

17166, Germany 

E-mail: Christoph.Heinrich@teutocell.de 


Background: Hybridoma technology was established in the 2nd half of the 

20th century and in the view of current protein production it might seem 

old-fashioned. Despite, it is commonly used to produce monoclonal 

antibodies (mAbs) for R & D, clinical diagnostics or medical applications and 

the demand for mAbs produced by hybridomas is still high. However, 

compared to CHO, only a few serum-free hybridoma media are available 

and even less suppliers for chemically defined products are on the market. 

In this work, a new chemically defined medium and feed were developed to 

bring hybridoma processes to the next level and to target the existing gap 

in the market. 

Materials and methods: HybriMACS CD medium was developed using 

various research and production hybridoma cell lines from Bielefeld



Page 106 of 151 

University (e.g. MF20, 187.1, HB8209) and industrial partners. HybriMACS 

CD medium was supplemented with 8 mM L-Glutamine for routine 

cultivation, batch and perfusion processes. For optimal performance of 

MF20 hybridoma cells (DSHB at the University of Iowa) the HybriMACS 

CD medium was supplemented with insulin (4 mg/L) or IGF (0.04 mg/L). 

All cultivations were carried out using standard conditions. Briefly, 

precultures and batch cultivations were performed in 125 mL and 250 mL 

Erlenmeyer flasks. Incubator conditions were set to 37 °C, 5% CO 2 and a 

relative humidity of 80%. For bioreactor cultivations closed-loop controlled 

2 L benchtop systems were used with parameters set to 37 °C, 40% DO and 

pH 7.1 +/- 0.05. Automated viable cell counting was performed using a 

Cedex (Innovatis). Monoclonal antibody (mAb) concentrations were 

determined with Protein A HPLC or ELISA (MF20 cell line). 

Results: Hybridoma cell growth in HybriMACS CD medium was compared 

to 12 competitor products in the time course of several passages and a 

final batch cultivation. For a mouse-mouse hybridoma cell line, maximum 

viable cell density (vcd) in HybriMACS CD was highest and for a ratmouse 

hybridoma cell line second-highest compared to growth in the 12 

competitor media, as shown in Figure 1 (A). 

Easy adaption from serum-containing medium was verified by direct 

thawing of five different hybridoma cell lines in HybriMACS CD (Figure 1 B). 

Furthermore, long-term stable growth of a hybridoma cell line in HybriMACS 

CD was also confirmed in cultivations for more than 80 days. 

The majority of tested cell lines reached a maximum cell density above 

2.5 to 5.0 × 10 6 cells/mL in uncontrolled and controlled batch processes 

using HybriMACS CD. For uncontrolled fed batch cultivations 1.0 × 10 7 

cells/mL were observed as maximum viable cell density, while controlled 

fed batch processes reached values above 1.5 × 10 7 cells/mL. The final 

antibody titer was increased at least by a factor of 5 in uncontrolled fed 

batches and up to 10 times in controlled fed batch cultivations using 

HybriMACS Feed Supplement. Exemplary results of controlled as well as 

uncontrolled batch and fed batch cultivations are shown in Table 1. 

Conclusions: HybriMACS CD is a chemically-defined, protein-free medium 

composition with no need for growth hormone supplementation. The 

specially designed formulation supports direct adaption of serumdependent 

hybridoma cells, even when starting from a serum-containing 

cell bank. In addition, the developed medium formulation enables stable 

long-term growth of hybridoma cell lines, supporting an unrestricted 

utilization in diverse processes. HybriMACS CD is suitable for bioreactor 

batch and perfusion processes reaching high cell densities and commonly 

accepted amounts of antibody. A specially tailored HybriMACS Feed 

Supplement increased final antibody titer at least by a factor of 5 to 10 for 

all tested hybridoma cell lines. This improvement can be further increased 

by customization of the generic feed regime, while maintaining suitable 

glucose and glutamine concentrations. 

P83 

Comparative study of bluetongue virus serotype 8 production on 

BHK-21 cells in a 50L Biostat® STR single-use bioreactors vs 

roller bottles 

Lídia Garcia * , Mercedes Mouriño, Alicia Urniza 

Zoetis Manufacturing & Research Spain, S.L Pfizer Olot S.L.U., Ctra. 

Camprodon s/n, La Riba, 17813 Vall de Bianya (Girona), Spain 

E-mail: Lidia.garcia@zoetis.com 


Background: Bluetongue is a major disease of ruminant livestock that can 

have a substantial impact on income and animal welfare. Bluetongue virus 

serotype 8 (BTV-8) first emerged in the European Union in 2006, peaking at 

45,000 cases in 2008. Zoetis (formerly Pfizer Animal Health) licensed 

bluetongue vaccines (Zulvac 4 Ovis, Zulvac 1 Ovis, Zulvac 1 Bovis, Zulvac 8 

Ovis and Zulvac 8 Bovis and combinations) able to prevent viremia, 

stressing the role of the vaccine as an aid for the epidemiological control 

of the disease. 

One important issue to be taken into account in the development of 

vaccines is their cost, especially in veterinary use. Vaccine production 

requires high-yield, stable bioproduction systems and implementation of 

new technologies. 

Mammalian cells are the substrate for production of most of the veterinary 

vaccines. BHK-21 cells are commonly used to produce bluetongue 

vaccines. 

Figure 1(abstract P82) (A) Comparison of two different hybridoma cell lines in HybriMACS CD and 12 competitor media. (B) Growth behaviour 

of five serum-dependent hybridoma cell lines in HybriMACS CD directly after thawing. 

Table 1(abstract P82) Exemplary data of batch and fed batch cultivations under controlled (bioreactor) as well as 

uncontrolled (shaker) conditions 

Process 

Maximum vcd 

[10 6 cells/mL] 

IVCD 

[10 6 (cells*d)/mL] 

Shaker Batch 3.7 7.3 56.2 

Fed batch 10.5 39.5 447.5 

Bioreactor Batch 3.7 9.52 61.0 

Fed batch 17.3 107.6 1035.4 

Values represent mean from two biological replicates. 

Final mAb titer 

[mg/L]



Page 107 of 151 

As an example, the use of the BTV-8 vaccine is routinely produced in roller 

bottles (RB). The aim of this study is to investigate Single-Use Bioreactor 

technology as an alternative to RB. This technology combines the basic 

concept of allowing the cells to attach to a surface (microcarriers) with the 

advantages of suspension, which allows a better control of culture 

conditions and systematic and automatic culture process. 

Single use technology can also be an alternative to conventional production 

methods reducing facility complexity, possibility of the rapid expansion of 

the capacity of the production and to avoid the cleaning process and 

reduction of the risk of cross-contamination. Lower culture handling and 

more homogeneity can be achieved. 

Selection of appropriate culture conditions can be important to achieve 

consistent cell culture and virus production across sites and scales. 

Because characteristics like tank geometry and hardware (impellers, 

sparger) are not subject to change during scale-up, the scalability from 

50 L to 1000 L in the BIOSTAT® STR bioreactor can be an easy strategy for 

our production process. 

Materials and methods: Cell line: BHK-21. These cells were used 

because they are permissible to BTV replication. All cells were cultured at 

37°C in MEM-G medium supplemented with serum. 

Virus strain: BTV-8, strain BEL2006/02, supplied by “Veterinary and 

Agrochemical Research Centre” (VAR-CODA-CERVA), Ukkel, Belgium. 

Cultivation system: The growth of the BHK-21 cells and production of 

virus was performed in roller bottles and 50 L single-use bioreactor 

BIOSTAT® STR (Sartorius Stedim Biotech). 

BHK-21 cells were grown in microcarriers Cytodex-3 at 3g/L into the STR 

bioreactor and the cell production was optimized with respect to pH, 

temperature, stirring speed and aeration rate. 

Viable cell number was evaluated using the crystal violet dye nucleus 

staining method. 

Virus infection and titration 

The virus chosen to compare and prove the suitability of Single use 

technology for the production of viral vaccines was BTV-8. 

Confluent cells were infected at a constant MOI and harvesting was done 

at 100% CPE. 

Virus production was calculated according to the Spearman-Kärber method, 

expressing the result in tissue culture infectious doses (50%) (TCID 50 ). 

Cell growth and BTV-8 antigen production in the BIOSTAT® STR bioreactor 

was conducted at the optimal conditions determined previously on 

conventional bioreactors. 

Microcarriers elimination: Taking into account that for vaccine 

formulation microcarriers must be eliminated from the viral suspension, 

filtration through Sartopure PP2 cartridges (from Sartorius Stedim 

Biotech) was performed. 

Results: The final goal is to maximize productivity preserving its quality. 

How? By increasing cell concentration and cell productivity. 

To demonstrate the feasibility of bioreactors for microcarriers cell cultures, 

the growth of BHK-21 cells in roller bottles, and in the BIOSTAT® STR 

bioreactor was evaluated and compared. 

Results prove that when using the 50L BIOSTAT® STR bioreactor, BHK-21 

cells are attached and grow efficiently on microcarriers. Cell concentration 

yield in terms of average was higher than in roller bottles (Figure 1). 

The virus titers reached in the BIOSTAT® STR bioreactor were equal o 

higher than the levels obtained in roller bottles (Figure1). 

Conclusions: ▪ Comparable results between Roller bottles and 50 L 

BIOSTAT® STR bioreactor 

✓ cell density 

✓ productivity 

✓ product quality 

▪ BHK-21 cells grow efficiently on microcarriers. Conditions for cell 

attachment in terms of mixing conditions were optimized. 

▪ BTV-8 antigen with satisfactory yields can be obtained by culturing 

BHK-21 in a 50L BIOSTAT® STR bioreactor. 

▪ As expected, high density of BHK-21 cultures showed increased 

productivity 

▪ Microcarrier filtration causes no significant drop in virus titer. 

▪ With the conditions established with the 50 L BIOSTAT® STR 

bioreactor the reproducibility and the scale-up from 50 L to 1000 L 

can be easily performed. 

▪ Single-Use Bioreactor technology is a good alternative to Roller 

Bottles and is a suitable system for propagation of BTV-8 virus using 

adherent BHK cells on microcarriers. Involving reduction of costs, 

cleaning, sterilization etc. 

P84 

Golgi engineering of CHO cells by targeted integration of 

glycosyltransferases leads to the expression of novel Asn-linked 

oligosaccharide structures at secretory glycoproteins 

Tobias Reinl 1* , Nicolas Grammel 2 , Sebastian Kandzia 3 , Eckart Grabenhorst 1,2,3 , 

Harald S Conradt 1,2,3 

1 Dept. Cell Engineering, Feodor-Lynen-Str. 35, 30625 Hannover, Germany; 

2 Dept. Mass Spectrometry, Feodor-Lynen-Str. 35, 30625 Hannover, Germany; 

3 Dept. Glycosylation Analysis GlycoThera GmbH, Feodor-Lynen-Str. 35, 30625 

Hannover, Germany 

E-mail: reinl@glycothera.de 


Background and novelty: N-glycans constitute an important information 

carrier in protein-driven signaling networks. Amongst others, N-glycans 

contribute to protein folding quality, adjust protein turnover and operate as 

address label for targeting proteins to specific cells and tissues [1]. Hence, 

the composition of N-glycans attached to recombinant glycoprotein 

therapeutics is vital for in-vivo therapeutic efficacy and strongly depends on 

the choice of the expression host [2,3]. Due to absence or silencing of 

glycosyltransferase genes homologue to human enzymes, biotechnologically 

used cell lines are limited by their intrinsic glycosylation machinery and 

produce host specific glycoforms. 

Cetuximab, a therapeutic chimeric mouse/human monoclonal antibody 

(IgG1), is N-glycosylated both at the CH2-domain (Asn299) and at the 

VH-domain (Asn88) (Figure 1A). Sold under the trade name Erbitux®, 

Cetuximab is expressed from a murine myeloma cell line and targets the 

human EGF receptor [4], which is overexpressed in about 1/3 of all 

human cancers. The antibody is highly decorated with the aGal-epitope 

Figure 1(abstract P83) Comparison of cell growth and virus titer in roller bottles and in 50 liter BIOSTAT®CultiBagSTR single-use bioreactor



Page 108 of 151 

Figure 1(abstract P84) (A) Non-reducing terminal oligosaccharide motifs attached to N-glycans of specific human glycoproteins (left side). Scheme of 

model glycoprotein Cetuximab with CH2- and VH-domain N-glycans (right side). (B) NP-HPLC-FLD elution profiles of 2-AB labeled oligosaccharides from 

VH-domain of Cetuximab after co-expression of the indicated glycosyltransferases. 

(Gala1-3Galb1-4GlcNAc) which has been shown to result in fatal allergic/ 

hypersensitivity response in several patients [5]. 

The design of new quality-optimized and functionally improved biopharmaceuticals 

with properties conferred by host cell unrelated N-glycans 

requires a rational Golgi engineering strategy. Here, we apply GET, a system 

that enables the positioning of a desired catalytic glycosyltransferase 

activity into a favorable localization within the intracellular glycosylation 

machinery, to suspension CHO cells developed to secrete suitable amounts 

(200 μg/ml) of Cetuximab as a model glycoprotein. The presented Golgi 

engineering project aims in the extension of the intrinsic glycosylation 

repertoire enabling CHO cells to produce new human-type glycosylation 

motifs as indicated in Figure 1A: (i) GalNAcb1,4GlcNAc-R (LacdiNAc, LDN),(ii) 

GlcNAc in b1,4 linkage to central mannose residue (bisecting GlcNAc, bGN), 

(iii) Galb1,4(Fuca1,3)GlcNAc-R (Lewis X ,Le X )and(iv)NeuAca2,3Galb1,4 

(Fuca1,3)GlcNAc-R (Sialyl-LewisX, sLe X ). To assemble (ii) and (iv), we 

co-express GnT3 and FT7. As shown earlier, the latter enzyme catalyzes 

fucosylation exclusively of (iv). Therefore, we included in our study a variant 

of FT6 that is targeted to the early Golgi compartment with the aim to 

additionally generate structure (iii) [6,7]. The uncommon LDN motif (i) 

which is e.g. detected on lutropin is assembled by human B4GalNT3 [8,9]. 

We analyze oligosaccharides released from the products of genetically 

engineered CHO cells based on the resolution of single glycosylation sites 

of VH- and CH2- glycopeptides by quantitative NP-HPLC-FLD and use our 

comprehensive oligosaccharide standard library to identify novel 

oligosaccharide motifs. 

Experimental approach: Cloning of human glycosyltransferases and 

engineering of VAR FT6 [7] as well as construction of pGET expression 

plasmids encoding either the heavy and light chain of Cetuximab or the 

glycosyltransferase cDNAs was done acc. to standard DNA technologies. 

A stable clone with Cetuximab titers of 200 μg/ml and doubling times of



Page 109 of 151 

25 hours was selected after transfection of pGET-Cetuximab in CHO cells. 

This clone was either mock- or co-transfected with pGET plasmids 

encoding the indicated glycosyltransferases. After shake flask 

subcultivation for 72 h Cetuximab was purified from supernatants, 

digested and applied to RP-HPLC peptide mapping. CH2- and VH-domain 

glycopeptides were separated and oligosaccharides were enzymatically 

released. After 2-AB labeling, the isolated oligosaccharides were subjected 

to quantitative NP-HPLC-FLD and ESI-TOF-MS and MS/MS analysis. 

Oligosaccharide structures were unambiguously identified in comparison 

to GlycoThera’s reference standard oligosaccharide library. 

Results and discussion: In combination with our site specific and 

quantitative micro glycan structure analysis we provide a modular system 

(GET) for the customized assembly of novel CHO unrelated oligosaccharide 

motifs. As exemplified for VH-domain, the NP-HPLC-FLD elution profiles of 

2-AB labeled oligosaccharides after heterologous co-expression of 

Cetuximab and the indicated glycosyltransferases are shown in Figure 1B. 

Quantitative results of all oligosaccharide structures are given in Figure 2. 

The Mock-transfected control approach reveals the intrinsic glycosylation 

repertoire of our stable CHO cell clone. Cetuximab is decorated with 

agalactosylated (35,5%), mono- (50,0%) and di-galactosylated (10,1%) 

diantennary complex-type N-glycans containing proximal a1,6-linked fucose 

at the CH2-domain. VH-domain N-glycans consist of neutral (13,8%), mono- 

(50,3%) and di-sialylated (35,8%) oligosaccharide structures. Whereas 

N-glycans from the market product Erbitux® produced in SP2/0 cells are 

extensively decorated with Gala1,3Gal and NeuGc (data not shown), those 

allergenic structures are not detected in Cetuximab N-glycans from our CHO 

cell clone. 

The heterologous co-expression of wildtype B4GalNT3, GnT3 and FT7 and 

genetically modified FT6 results in the formation of the uncommon 

LacdiNAc motif (ca. 40%), the Lewis X and di-Lewis X structures (ca. 50%) 

and Sialyl-Lewis X (ca. 15%) almost exclusively on oligosaccharides from the 

VH-domain. Relevant modification of both VH-domain (ca. 40%) and CH2- 

domainglycans(ca.30%)isonlyachieved by GnT3 catalyzed attachment 

of bisecting GlcNAc. In addition, glycosyltransferase co-expression leads to 

charge state reduction of oligosaccharides by depletion of suitable 

acceptors for endogenous sialyltransferases. The strongest reduction in the 

content of neuraminic acid at VH-domain was observed by co-expression 

of VAR FT6 (ca. 55% reduction) and WT B4GalNT3 (ca. 50% reduction). 

Figure 2(abstract P84) Amount of oligosaccharide structures detected on CH2- and VH-domain of Cetuximab after heterologous glycosyltransferase 

co-expression (given in% peak area values after integration of NP-HPLC-FLD chromatograms)



Page 110 of 151 

As a conclusion, Golgi engineering endows CHO cells to assemble 

significant amounts of LacdiNAc, bisecting GlcNAc, Lewis X and Sialyl- 

Lewis X to Cetuximab N-glycans (Figure 1B and Figure 2). Therefore, our 

glycosylation engineering strategy provides a tool to produce tailored 

N-glycosylation variants with defined structural motifs. As demonstrated, 

the tailored addition of bisecting GlcNAc to CH2-domain N-glycans 

increases ADCC of an aCD20 therapeutic mAB [10]. We therefore assume 

that the presented structural motifs exhibit novel therapeutic properties 

(ADCC, CDC, tissue specificity, serum half-life). Our strategy represents a 

relevant basis for the development of biotherapeutics and biobetters with 

potentially improved pharmacokinetics, pharmacodynamics, safety 

properties and in vivo therapeutic efficacy. 

References 

1. Varki A, Lowe JB: Biological Roles of Glycans. Essentials of Glycobiology 

Cold Spring Harbor (NY): Cold Spring Harbor Laboratory Press: Varki A, 

Cummings RD, Esko JD, Freeze HH, Stanley P, Bertozzi CR, Hart GW, Etzler 

ME, 2 2009, Chapter 6. 

2. Sinclair AM, Elliott S: Glycoengineering: the effect of glycosylation on the 

properties of therapeutic proteins. J Pharm Sci 2005, 94:1626-1635. 

3. Grabenhorst E, Schlenke P, Pohl S, Nimtz M, Conradt HS: Genetic 

engineering of recombinant glycoproteins and the glycosylation 

pathway in mammalian host cells. Glycoconj J 1999, 16:81-97. 

4. Erbitux® (Cetuximab): Prescribing Information. Bristol-Myers Squibb 

(1236886B3, Rev. March 2013). 

5. Commins SP, Platts-Mills TAE: Allergenicity of Carbohydrates and Their 

Role in Anaphylactic Events. Curr Allergy Asthma Rep 2010, 10:29-33. 

6. Grabenhorst E, Nimtz M, Costa J, Conradt HS: In Vivo Specificity of Human 

a1,3/4-Fucosyltransferases III-VII in the Biosynthesis of Lewis X and Sialyl 

Lewis X Motifs on Complex-type N-Glycans. J Biol Chem 1998, 

273:30985-30994. 

7. Grabenhorst E, Conradt HS: The cytoplasmic, transmembrane, and stem 

regions of glycosyltransferases specify their in vivo functional 

sublocalization and stability in the Golgi. J Biol Chem 1999, 

274:36107-36116. 

8. Sato T, Gotoh M, Kiyohara K, Kameyama A, Kubota T, Kikuchi N, Ishizuka Y, 

Iwasaki H, Togayachi A, Kudo T, Ohkura T, Nakanishi H, Narimatsu H: 

Molecular cloning and characterization of a novel human beta 1,4-Nacetylgalactosaminyltransferase, 

beta 4GalNAc-T3, responsible for the 

synthesis of N, N’-diacetyllactosediamine, galNAc beta 1-4GlcNAc. J Biol 

Chem 2003, 278:47534-47544. 

9. Fiete D, Srivastava V, Hindsgaul O, Baenziger JU: A hepatic 

reticuloendothelial cell receptor specific for SO4-4GalNAc beta 

1,4GlcNAc beta 1,2Man alpha that mediates rapid clearance of lutropin. 

Cell 1991, 67:1103-1110. 

10. Davies J, Jiang L, Pan LZ, LaBarre MJ, Anderson D, Reff M: Expression of 

GnTIII in a recombinant anti-CD20 CHO production cell line: Expression 

of antibodies with altered glycoforms leads to an increase in ADCC 

through higher affinity for FC gamma RIII. Biotechnol Bioeng 2001, 

74:288-294. 

P85 

Characterization of the influence of cultivation parameters on 

extracellular modifications of antibodies during fermentation 

Christian Hakemeyer * , Martin Pech, Gero Lipok, Alexander Herrmann 

Pharma Technical Development, Roche Diagnostics GmbH, Penzberg 

Germany 

E-mail: Christian.hakemeyer@roche.com 


Introduction: The production of protein-based medical agents, like 

monoclonal antibodies (Mabs), by biotechnological processes requires a 

comprehensive quality control. The pharmaceutical industry and national 

health authorities support the complete characterization of therapeutic 

proteins to increase the quality and safety. During numerous and 

different production steps like fermentation, purification and storage, 

various protein modifications on therapeutic products can occur, like 

deamidation of asparagine and glutamine, oxidation of methionine 

tryptophan residues, clipping of terminal amino acids, glycation and 

others. 

During the development of fermentation processes, good growth 

conditions for the cell culture are of primary importance to obtain 

maximal productivity [1]. Until now only few efforts have been made to 

investigate the development of extracellular antibody modifications and 

their sources during fermentation as the first phase of the productions 

process. Already known is the fact that pH-value and temperature can 

induce modifications on monoclonal antibodies [2]. 

Aim of this work is to increase the knowledge about the development of 

extracellular modifications of monoclonal antibodies during the fermentation 

process. Therefore, parameters of fermentation were identified which 

influence modifications during cell-free incubation under common fermentation 

conditions (in shake flask and small scale bioreactor-systems). 

Results: The results from the shake flask experiments showed a different 

degree of changes of the charge isoform pattern (measured by IE-HPLC) 

for five analyzed antibodies during the approx. nine days of cell-free 

incubation. The respective increase of the amount of acidic regionwas 

strongly dependent on the specific protein. At the end of the incubation, 

the amount of the acidic region range from approx. 20 area-% to 

approx.75 area-% depending on the characteristics of the Mab. The 

increase in the acidic region correlated with a decrease of the main peak 

while the basic regionremained unchanged. 

The specific influence of the parameters pH, temperature and dissolved 

oxygen (DO) on the modification of antibodies was further characterized in 

full factorial DoE designed experiments for three Mabs. For this purpose, 

cell broth was taken at an early stage from standard 1.000 L fermentations 

with Chinese Hamster Ovary (CHO) cells and cells were removed by 

centrifugation. The cell-free supernatant was then transferred to small 

scale bioreactors and incubated for approx. ten days under the conditions 

listed in table 1. 

In these experiments, elevated temperature conditions and higher pH 

values led to a faster modification (degradation) for all three investigated 

antibodies during the incubation compared to lower pH and temperature 

conditions, while dissolved oxygen level had no relevant impact on the 

kinetic of antibody degradation. 

The results of the cell-free incubation studies were used to develop a 

mathematical model was to predict the isoform pattern of the Mab during 

standard fermentations with CHO cells from inoculation to harvest. The 

amount of the acidic peak can be predicted, depending on the specific 

antibody characteristics as determined in the previous experiments, the 

concentration of the antibody during the cultivation, and the fermentation 

time and process conditions (pH, DO, temperature). Figure 1 shows an 

actual-by-predicted plot, comparing model predictions against measured 

values for several fermentations of one Mab. The model is well capable of 

predicting the amount of acidic isoform for this molecule. 

Conclusion: In this work, the influence of fermentation parameters (pH, 

DO, temperature) on the extracellular modification of Mabs (in the 

supernatant of cell broth) was examined. Higher temperature and higher 

pH values lead to a significant increase in the formation of the acid region 

species of Mabs compared to lower temperature and pH conditions. The 

impact of these process parameters on the modification kinetics of Mabs 

Table 1(abstract P85) Setup for the small scale 

fermentation experiments 

Experiment pH Temp. [°C] DO [%] 

1 6.7 33.0 45 

2 6.7 40.0 5 

3 7.0 36.5 25 

4 7.0 36.5 25 

5 7.3 33.0 5 

6 7.3 40.0 45 

7 6.7 40.0 45 

8 6.7 33.0 5 

9 7.0 36.5 25 

10 7.0 36.5 25 

11 7.3 33.0 45 

12 7.3 40.0 5



Page 111 of 151 

Figure 1(abstract P85) Correlation of measured versus calculated amount of acidic isoforms 

during cell-free incubation was characterized. Furthermore, additional 

modifications were detected, as oxidation, deamidation, generation of 

pyro glutamic acid, separation of lysin (data not shown). 

The results of the incubation experiments in the small scale fermenter 

system lead to a mathematical prediction model for the increase of the 

acidic peak during a standard fermentation for the production of Mabs with 

CHO cells. This prediction model helps to develop robust fermentation 

processes. 

References 

1. Müthing J, Kemminer SE, Conradt HS, Sagi D, Nimtz M, Kärst U, Peter- 

Katalinic J: Effects of buffering conditions and culture pH on production 

ratesand glycosylation of clinical phase I anti-melanoma mouse IgG3 

monoclonal antibody r24. Biotechnol Bioeng 2003, 83:321-334. 

2. Usami A, Ohtsu A, Takahama S, Fujii T: The effect of pH, 

hydrogenperoxide and temperature on the stability of a human 

monoclonal antibody. J PharmBiomed Anal 1996, 14:1133-1140. 

P86 

Technology transfer and scale down model development strategy for 

biotherapeutics produced in mammalian cells 

Nadine Kochanowski * , Laetitia Malphettes 

Cell Culture Process Sciences Group, Biotech Sciences, UCB Pharma S.A., 

Braine L’Alleud, 1420, Belgium 

E-mail: Nadine.Kochanowski@ucb.com 


Background: The goal of manufacturing process development for drug 

substance and drug product is to establish a commercial process capable of 

consistently producing drug substance/drug product of the intended 

quality. Based on regulatory requirements, the manufacturing process has to 

be characterized prior to process validation. Since performing the 

characterization study at the manufacturing scale is not practically feasible, 

development of a scale down model that represents the performance of the 

commercial process is essential to achieve reliable process characterization. 

The developed scale down model could also be applied for cell line 

selection, process and medium development, raw material evaluation, limit 

of cell age studies, process parameter excursions, etc... Process development 

and commercial production should not be on the critical path to market 

despite the compressed time-to-market expectations. That is why 

Technology Transfer (TT) is a vulnerable time for companies. According to 

World Health Organization, Transfer of technology is defined as “a logical 

procedure that controls the transfer of any process together with its 

documentation and professional expertise between development and 

manufacture or between manufacture sites”. In the pharmaceutical industry, 

Technology Transfer refers to the processes that are needed for successful 

progress from drug discovery to product development to clinical trials to 

full-scale commercialization or it is the process by which a developer of 

technology makes its technology available to commercial partner that will 

exploit the technology. This article describes the strategies and activities 

required to develop a scale down model. It also sketches a Technology 

Transfer approach for bioprocesses by focusing on the upstream part of a 

cell culture based process. 

Results: Scale down model development strategy: “Small-scale models 

can be developed and used to support process development studies. The 

development of a model should account for scale effects and be 

representative of the proposed commercial process. A scientifically justified 

model can enable a prediction of quality, and can be used to support the 

extrapolation of operating conditions across multiple scales and equipment 

[2]. The key elements for designing a scale down model are inputs (raw 

materials and components, cell source, environmental conditions) and 

outputs (performance and product quality metrics, sample handling/ 

storage, analytical methods). A scale down model can be equivalent for 

some outputs but not for all and still be a representative model. It should 

reproduceatsmallscaletheeffect/impactseenatlargescale.The 

acceptability of an observed offset has to be statistically evaluated and 

scientifically understood. 

Technology Transfer strategy: “The goal of Technology Transfer 

activities is to transfer product and process knowledge from development 

to market, and within or between manufacturing sites to support product 

commercialization. This knowledge forms the basis for the manufacturing 

process, control strategy, process validation approach and ongoing 

continual improvement [1]. A dedicated Technology Transfer team has to 

be set up to facilitate and execute the process including experts in



Page 112 of 151 

Figure 1(abstract P86) Technology Transfer (TT) process flow chart. 

Table 1(abstract P86) Technology transfer documentation 

Document 

Bill of materials 

Research and Development reports 

Risk assessment 

Process descriptions 

Content 

List of all components and their step of use (Supplier, grade) 

Historical data of pharmaceutical development of new drug substances and drug products at stage from 

early development to final application of approval - Quality profiles of manufacturing batches (including 

stability data) - Specifications and test methods of drug substances, intermediates, drug products, raw 

materials and components, and their rationale - Change histories of important processes and control 

parameters 

Process flow charts - Scale up - Equipment changes - Media and feed preparation 

Product information - Process step flow diagram - Cell culture steps description (cell line/inoculum/ 

expansion/production bioreactor - Media and feed preparation - Harvest description - Raw materials/ 

equipment) 

Technology transfer file Introduction - Manufacturing process description, process parameters - Equipment - Raw materials - 

Analyses - Safety, environment - Stability (conditions, results) - Packaging (cold chain requirements, etc...) - 

Cleaning - Shipment characteristics and proper validation if needed - Historical data available 

Technology transfer protocol Technology transfer description - Scope - Objective - Responsibilities - Process Description - Equipment list 

(receiving unit) - Raw material list - Reference of Master batch record/number of repetitions and status of 

batches/acceptance criteria/relevant specifications/description of coaching



Page 113 of 151 

Table 1(abstract P86): Technology transfer documentation (Continued) 

Manufacturing and testing description 

of the process 

Routine and non-sampling plans 

Data recording list 

Deviation inventory 

Technology transfer report 

Product information - Process step flow diagram - Cell culture steps description (cell line/inoculum/cell 

expansion/production bioreactor) - Media and feed preparation - Harvest description (holding time/storage 

conditions) - Raw materials - Equipments 

List of all the samplings that should be taken and kept in addition to the in-process control samples listed 

in the manufacturing description 

Online and offline data to be monitored and recorded during the process 

Description in details of the deviations and reporting of the impact on the product titer and quality 

Technology transfer description - Objective - Scope - List of deviations and discussion - Process results and 

comparison to acceptance criteria -, Conclusions 

different fields (production, QA, QC, RA, MSAT, etc...). The whole 

Technology Transfer has to be coordinated by the technology transfer/ 

project leader. Organization for Technology Transfer should be established 

and composed of both party members from both sites, roles and scope of 

responsibilities of each party should be clarified, and adequate 

communication and feedback of information should be ensured. Figure 1 

describes the main steps of the Technology Transfer. Technology Transfer 

can be considered successful if the Receiving Unit can routinely reproduce 

the transferred product, process, or method against a predefined set of 

specifications as agreed with the Sending Unit. The success of a Technology 

Transfer project will be largely dependent on the skill and performance of 

individuals assigned to the project from the Sending Unit and the Receiving 

Unit. The roles and responsibilities of the sending unit and the receiving unit 

have to be clearly defined. The documentation is a key element of 

Technology Transfer: it ensures consistent and controlled procedures for 

Technology Transfer and to run the process. Clear documentation should 

provide assurance of process and product knowledge (Table 1). 

Conclusions: A scale down models is a tool for developing and 

characterizing the process and should be designed and demonstrated as 

appropriate representations of the manufacturing process. The transfer of 

technology from R&D to the commercial production site is a critical 

process in the development and launch of a biotherapeutical product. The 

three primary considerations to be addressed during an effective 

technology transfer are the project plan, the people involved and the 

process. 

References 

1. ICHQ10 guideline: Pharmaceutical Quality System. 

2. ICHQ11 guideline: Development and manufacture of drug substances 

(chemical entities and biotechnological/biological entities). 

P87 

A modular flow-chamber bioreactor concept as a tool for continuous 

2D- and 3D-cell culture 

Christiane Goepfert 1 , Grit Blume 1 , Rebecca Faschian 1 , Stefanie Meyer 1 , 

Cedric Schirmer 1 , Wiebke Müller-Wichards 2 , Jörg Müller 2 , Janine Fischer 3 , 

Frank Feyerabend 3 , Ralf Pörtner 1* 


Technology Hamburg, D-21073, Germany; 

2 Institute of Micro System 

Technology, Hamburg University of Technology, Hamburg, D-21073, 

Germany; 

3 Department of Structural Research on Macromolecules, Institute 

of Materials Research, Helmholtz-Zentrum Geesthacht, Geesthacht, D-21502, 

Germany 

E-mail: poertner@tuhh.de 


Background: Advanced cell culture models, especially long-term 3D 

systems, require bioreactors allowing for cultivation under continuous flow 

conditions. Such culture models are for example tissue engineered implants, 

3D cultures for drug testing, in vitro models of cell growth and migration for 

wound healing studies, cell cultures for biomaterial testing. New challenges 

in drug testing and biomaterial development arise from regulatory 

requirements. Animal trials have to be replaced by cell culture assays, 

preferably by test systems with human material. Standard 2D monolayer 

cultures are often unsatisfactory and therefore tissue-like 3D cultures are 

suggested as an alternative. Here the design of a multi-well flow-chamber 

bioreactor as a tool for manufacturing advanced cell culture models is 

presented. Advantages of this reactor concept can be seen in constant flow 

conditions, removal of toxic reaction products, high cell densities, and 

improved metabolism [1]. The general design of the flow chamber 

bioreactor (FCBR) can easily be modified for different applications and 

analytical requirements. 

Concept: The concept of the flow-chamber bioreactor (FCBR) comprises 

the following features (Figure 1A): Simultaneous cultivation of multiple 

tissue constructs in special inserts; oxygen supply via surface aeration 

directly in the chamber; a uniform and thin medium layer which is created 

by a small barrier at the end of the flow channel to minimize the diffusion 

distance from the gas phase to the tissue constructs; medium supply from 

a reservoir bottle in a circulation loop via peristaltic pumps. 

Two designs are available: A closed system (single flow channel) with 

counter current flow of gas and medium for tissue-engineered constructs 

(Figure 1B), and a 24 well plate-based modular bioreactor (medorex, Nörten- 

Hardenberg, Germany) for miniaturized tissue constructs that permits the 

use of pipetting robots and standard plate readers (Figure 1C). 

For the latter one, the design of the 4 channels can be customized for 

various applications (Table 1). The lid of the plate is connected to tubings 

for medium recirculation. Medium is supplied via the first well and 

removed from the last well of each row (Figure 1C). Therefore 4 wells per 

row are available for construct cultivation. 

The closed system is aerated with humidified pre-mixed gas with optional 

composition. Therefore it can be handled independently from cell culture 

incubator. The 24 well-based system has to be placed in a humidified 

incubator for air supply from the incubator atmosphere. 

Fields of Application: For the above mentioned bioreactor designs, four 

applications are presented in the following. 

Example I: The single flow-channel bioreactor (Figure 1 (B)) was designed for 

the generation of three-dimensional cartilage-carrier constructs [2]. 

The carriers consisting of a bone replacement material were covered with a 

1-2 mm cartilage layer. This reactor was used for long-term cultivation of 

cartilage-carrier-constructs with improved biochemical parameters (e.g. 

content of glycosaminoclycan, collagen type II) under constant conditions. 

Example II: The 24-well design was successfully applied to several cell culture 

models. Hepatocytes on porous 3D carriers were cultivated for 1-3 weeks and 

can be used as a model for drug testing [3]. After prolonged cultivation under 

continuous medium flow, the constructs are separated from each other for 

measurements in static operation mode to conduct viability and activity 

assays similar to procedures done in a standard multi well plate. Viability 

testing using Resazurin was performed repeatedly during cultivation. 

Furthermore, the EROD-assay for liver-specific cytochrome P450 activity was 

carried out at varying time points. Application for the resorption studies 

on magnesium implants is currently investigated by Prof. Willumeit, 

Dr. Feyerabend, HZ Geesthacht. 

Example III: A third layout of the MWFB was realized with four parallel 

flow channels instead of the separate wells. There is also the possibility to 

carry out material tests for cell expansion on specific materials (e.g. 

polymer films, collagen membranes, different coatings etc.). 

Example IV: Proliferation and migration of fibroblasts on collagen coated 

polymer foils integrated into the bioreactor was carried out using design IV 

(Figure 1 C). Electrical stimulation of NIH-3T3 fibroblasts resulted in the 

orientation of the cell cleavage plane perpendicular to the electric field 

vector. The electrodes were inserted into the chamber on a polymer foil 

clamped between the base plate and the 24 well plate equivalent top 

frame. The polymer foil can be removed and processed after the assays for 

staining and microscopic evaluation of the stimulated cells. The bottom



Page 114 of 151 

Figure 1(abstract P87) Flow-chamber bioreactor (FCBR, medorex, Germany)(A) Concept (B) Closed system (single channel) with aeration for 

tissue-engineered constructs (C) 24 well plate-based modular bioreactor (medorex) for miniaturized constructs that permits the use of 

pipetting robots and standard plate readers (D) Flow chamber equipped with electrodes for stimulation. 

Table 1(abstract P87) Bioreactor configuration and applications 

Bioreactor design Potential applications Example 

I. Single channel, 6 variable culture inserts for 3D 

scaffolds transparent cover plate 

active aeration 

II. 

III. 

4 flow channels for perfusion 24 well plate layout 

inserts for 3D scaffolds surface aeration gas supply from 

humidified incubator 

As (II), transparent bottom plate for microscopy flow 

channels instead of separate wells 

IV. As (II) plus integrated of electrodes for electrical 

stimulation and impedance measurement 

Long term cultivation of 3D tissue constructs under flow 

conditions, 

tissue cultivation on implantable biomaterials 

Simultaneous cultivation of four 3D constructs per channel, 4 

channels available, separate functional tests can be carried out 

on single constructs 

Cultivation of shear-responsive cells, integration of biomaterials 

possible (e.g. a collagen membrane) 

Electrical stimulation of cell growth and orientation, impedance 

measurement of cell viability 

Cultivation of 

cartilage-carrier 

constructs [2] 

3D cultures of liver 

cells [3], biomaterial 

testing 

Cultivation of sweatgland 

associated cells 

(current) 

Orientation of mitotic 

axis [5] 

plate was realized in a transparent material for microscopy. The frequency 

of unipolar pulses can be varied between 16 Hz and 2 kHz, the voltage 

between 0 up to 600 mV and stimulation pulse to pause ratios between 

1:1, 1:10 and 1:100 

Conclusions: The flow chamber concept and its different modifications 

can be applied as an easily applicable and versatile tool for advanced cell 

culture models. The 24 well design issuitableforapplicationina 

standard cell culture lab without special bioreactor equipment: For 

medium supply, standard peristaltic pumps with 4 channels can be used. 

The bottom plate can be handled in a similar way as 24 well plates 

allowing for adaptation of standard assays to long-term 3D cultures, 

electrically stimulated cells, or primary cells cultivated on membranes 

consisting of various biomaterials. 

References 

1. Pörtner R, Goepfert C, Wiegandt K, Janssen R, Ilinich E, Paetzhold H, 

Eisenbarth E, Morlock M: Technical Strategies to Improve Tissue 

Engineering of Cartilage Carrier Constructs - A Case Study. Adv Biochem 

Eng/Biotechnol 2009, 112:145-182. 

2. Nagel-Heyer S, Goepfert Ch, Adamietz P, Meenen NM, Petersen JP, 

Pörtner R: Flow-chamber bioreactor culture for generation of threedimensional 

cartilage-carrier-constructs. Bioproc Biosyst Eng 2005, 

27:273-280. 

3. Goepfert C, Scheurer W, Rohn S, Rathjen B, Meyer S, Dittmann A, 

Wiegandt K, Janßen R, Pörtner R: 3D-Bioreactor culture of human 

hepatoma cell line HepG2 as a promising tool for in vitro substance 

testing. BMC Proceedings 2011, 5:P61.



Page 115 of 151 

4. Starbird R, Krautschneider W, Blume G, Bauhofer W: In Vitro 

Biocompatibility Study and Electrical Properties of the PEDOT, PEDOT 

Collagen-Coat, PEDOT Nanotubes and PEDOT Aerogels for Neural 

Electrodes. Biomedical Engineering (BioMed 2013) Proceedings Innsbruck, 

Austria 2013. 

5. Saß W, Blume G, Faschian R, Goepfert C, Müller J: Wachstumsstimulation 

von Fibroblasten mit Platin/PEDOT Elektroden auf hochflexiblen Folien. 

Mikrosystemtechnik Kongress VDE VERLAG BerlinBMBF; VDE; GMM; VDI/VDE-IT 

2012, ISBN 978-3-8007-3367-5. 

P88 

Platform process will give platform product - Can we afford it? 

Rohit Diwakar * , Sunaina Prabhu, Lavanya C Rao, Janani Kanakaraj, Kriti Shukla, 

Saravanan Desan, Dinesh Baskar, Ankur Bhatnagar, Anuj Goel 

Cell Culture Lab, Biocon Research Limited, Bangalore, India 

E-mail: rohit.diwakar@biocon.com 


Introduction: Manufacturing processes for therapeutic monoclonal 

antibodies (mAbs) have evolved immensely in the past two decades 

around two major thrust areas. 

1) Advancements in a) Cell line development-breakthrough and 

incremental knowledge gain in technology b) Media and feed formulation 

strategies c) Advent of Disposables and Instrumentation technologies thus 

offering significant improvements to Process Development (PD). 

2) Establishment of platform processes to leverage faster PD [1,2]. 

A platform process generally consists of a standard i) Cell line development 

technique, ii) Basal medium and feeds, iii) Process parameters and scale-up 

approach. The biggest advantage of using the platform process for the PD 

group is in expediting the project timelines. The platform approach also 

benefits from well-established and validated work flows in Manufacturing, 

QA, QC and Supply-chain groups. 

Certain disadvantages have also been cited for the platform approach. For 

example, modifications in the platform process are generally discouraged 

due to time, cost and efforts required in accommodating such changes. 

Also, as process conditions can substantially impact the product quality 

(PQ) attributes, a platform approach does not allow any significant 

changes in the PQ attributes, if desired. 

Materials and methods: In this study, CHO cell lines were cultured in 

chemically defined medium. Experiments were carried out in 2L stirred 

tank bioreactors and 125mL shake flasks running at 140 rpm in 5% CO 2 

controlled incubator shaker. Cell count and viability were determined 

using haemocytometer. Lactate, glucose, osmolality and IgG concentration 

was also estimated along with glycosylation profiling. 

Results and discussion: Case 1: Multiple cell lines developed using 

same technology expressing different mAbs: Using the same cloning 

technology, cell lines expressing mAbs 1-4 were developed. These cell 

lines when run with the platform process showed very similar growth, titer 

and glycosylation profiles. Glycan profilethusproducedisrepresentedas 

three species; type I, II and III. 

The advantage of platform process was evident from the similarity of glycan 

profiles achieved in all the mAbs run with this process. However, for mAbs 3 

and 4, the target glycan profile was significantly different. The platform 

process gave 20-30% higher glycan type 1 than the respective targets. In 

order to match the targeted glycan profile, a few changes were made: 

i) mAb 3: New feed introduced to reduce glycan type 1; feeding 

strategy was optimized during PD. 

Figure 1(abstract P88) (Clockwise direction) a) Viability comparison between control (mAb1-4) and mAb5 and 6. b) Viability comparison between 

platform and modified process for mAb5 and 6. c) Cell count comparison and d) Lactate comparison between cell line technology 1 and 2. As expected, 

PQ profiles between these two clones were very different.



Page 116 of 151 

ii) mAb 4: In addition to feeding strategy used for mAb3, changes in 

process parameter (pH and DO) set-points were done to achieve 

desired glycosylation profiles. 

Case 2: Difference in lead clone selection criteria - growth vs. 

specific productivity: Clone selection is done by ranking the clones 

based on parameters such as cell growth, titer, specific productivity (PCD) 

and PQ. In this study, the lead clones were shortlisted based on different 

strategies. For mAbs 1-4, the lead clone was shortlisted based on cell 

growth and titer as dominant selection criteria. For mAbs 5 and 6, PCD was 

the dominant selection criterion. The other aspects of the cloning 

technique were same in all cell lines. 

When lead clones for mAb 5 and 6 were run in platform process they 

showed poor growth characteristics (Figure 1a). The early drop in viability 

made these clones unfit for a manufacturing process. Changes in the 

platform process were attempted to overcome this manufacturing concern: 

i) mAb 5: Culture longevity was increased by restricting cell growth. This 

was achieved by reducing nutrient levels in the production medium. 

ii) mAb 6: Lactate and ammonia accumulation was reduced by 

optimizing medium/feed composition and pH, DO control ranges. 

The modified processes significantly improved the culture longevity and 

viability profiles, making them suitable for manufacturing (Figure 1b). 

Case 3: Cell lines expressing the same mAb developed using 

different technology: Two cloning technologies, 1 and 2 were used to 

develop clones expressing the same mAb. The major differences in the 

technologies were i) host cell lines ii) design of vector and its mechanism 

in the genome. Both cell lines were run with the same platform process 

and a two-fold difference in cell count was observed between them 

(Figure 1c). The lactate levels were also markedly different (Figure 1d), 

possibly indicating differences in nutrient metabolism. The lactate 

differences also reflected in the pH profiles. 

Summary: Case 1: The use of platform process enabled accelerated PD 

from cell culture perspective. However, accommodating the specific PQ 

requirements resulted in extended process development, affecting timelines. 

Case 2: Change in clone selection criteria was observed to significantly 

impact culture performance while applying platform process. This almost 

resulted in rejection of these clones, thus extending PD timelines. This 

was prevented by modifying the platform process. 

Case 3: Clones developed using different cloning technologies when run 

with the platform process resulted in different cell culture and PQ 

profiles. Therefore, the type of cloning technique forms an integral part 

of the platform process. 

Though platform process was not suitable in most of the cases discussed 

here, it still offers advantages like expedited project timelines and 

established work flows. These benefits were achieved by establishing four 

versions of the platform process to meet the varied cell culture and PQ 

requirements. Based on the cell line characteristics and target PQ profiles, 

the appropriate version is chosen to initiate PD. These versions retained the 

major advantages of the platform process such as having common media 

and feeds with only changes in their concentrations and set point of main 

process parameters to achieve desired PQ. 

Acknowledgements: Cell Culture Lab - Ruchika Srivastava, Vana Raja S, 

Chandrashekhar K.N 

Characterization Lab - Varshini Priya, Laxmi Adhikari 

Purification Lab - Shashank Sharma 

References 

1. Kelley B: Industrialization of mAb production technology. Landes 

Biosciences 2009, 5:443-452, mAbs 1. 

2. Li F, Vijayasankaran N, Shen A, Kiss R, Amanullah A: Cell culture processes for 

monoclonal antibody production. Landes Biosciences 2010, 5:466-477, mAbs 2. 

P89 

Applications of biomass probe in PAT 

Chandrashekhar K Nanjegowda, Nirmala K Ramappa, Pradeep V Ravichandran, 

Deepak Vengovan, Saravanan Desan, Dinesh Baskar * , Ankur Bhatnagar, Anuj Goel 

Cell Culture Lab, Biocon Research Limited, Bangalore, India 

E-mail: dinesh.baskar@biocon.com 


Introduction: In biologics manufacturing, process consistency is essential to 

produce the desired product quality over the product life cycle. Process 

monitoring is an important tool to achieve consistency and robustness. 

Typical process parameters monitored at upstream are viable cell 

concentration (VCC), viability, titer, nutrient levels, waste metabolites, 

osmolality, pH, DO and pCO 2 . Traditionally pH, DO and pCO 2 are monitored 

using online sensors while others are measured by offline sampling 

methods. With recent advances in sensor technology, probes are now 

available to reliably estimate some of these parameters online. One such 

tool is biomass probe which estimates VCC by measuring capacitance in the 

bioreactor. In this work two cases are presented where biomass probe has 

advantages over traditional offline sampling and can be used as an effective 

PAT tool to monitor and improve process consistency and robustness. 

Experimental Approach: CHO and NS0 cell lines were used to run fed 

batch (70L) and perfusion (1KL) runs. The perfusion bioreactor used two 

Spin filters (SF) as cell retention device that could be switched when 

required. Biomass probe readings were compared to the VCC estimated 

by offline sampling. 

Results and discussions: In Fed Batch runs, offline and online VCC values 

were very comparable during the initial days of the run and deviated with 

increased process duration and drop in cell viability. In the Perfusion Batch, 

the offline and online VCC values were comparable throughout the run. 

The current work focusses on the phases where online biomass probe 

can be reliably used to improve efficiencies of both Fed Batch and 

Perfusion processes. 

Case 1: Improving process efficiency in Fed batch: Inoculum 

propagation and transfer: Inoculum plays a critical role in the process 

performance; therefore inoculum consistency is very important. Inoculum 

development step requires cells to be transferred to the next stage while 

they are in the exponential phase. This is normally done by sampling the 

seed bioreactors, measuring the cell counts and transferring cells to the 

next stage. 

As this requires sampling for cell counting, due to rapid cell growth in this 

phase, generally a wide range of acceptable cell concentration is given for 

practical reasons. Although during this broad range of acceptable cell 

concentration, cells are in their exponential phase, the volume of inoculum 

added into the bioreactor changes the spent media ratio inside the 

production bioreactor considerably. 

By measuring VCC online using a biomass probe, it was possible to transfer 

the inoculum at much precise cell concentration thus achieving consistent 

volumetric inoculum ratios in production bioreactor (Figure 1a).This resulted 

in an improved consistency in the cell culture profiles of the production run. 

Feeding based on online VCCmeasurements:AFedBatchprocess 

requires frequent additions of nutrient feeds to the bioreactor. These feeds 

are generally added either by sampling and measuring concentrations of 

residual nutrients or based on predefined culture time intervals. By feeding 

based on fixed culture duration, nutrients are added at same age but at 

different cell concentration. Feeding based on biomass probe readings 

helped in maintaining the nutrients as per VCC, thus preventing 

accumulation or depletion of nutrients in the process and eliminating batchto-batch 

variations (Figure 1b). 

Case 2: Improving process efficiency in Perfusion: In our process, loss 

in cell-retention in the perfusion device led to decrease in cell conc. and 

productivity. By monitoring retention continuously, corrective actions 

could be taken to reduce these losses. Introducing a biomass probe in the 

perfusate line overcame operational constraints of frequent sampling to 

monitor retention efficiency. 

Effective switching of the retention filters: As the SF clogs, there is a 

drop in perfusate volume being drawn from the filter, which results in 

pressure drop in the harvest line. Whenever the line pressure drops 

significantly, the perfusion is switched to the other filter. Calculations show 

reduction in retention efficiency of the filters from about 90% to 50% 

(Figure 1c). This reduction indicates cell loss through the filter resulting in 

significant drop in bioreactor VCC (Figure 1d). 

To prevent a significant loss of cells from the bioreactor, it was decided to 

switch the filter by monitoring the retention by biomass probe in the 

perfusate line. Two biomass probes were inserted in the bioreactor and 

the perfusion outlet to measure the bioreactor cell concentration and the 

cells lost through the filter during perfusion. The filter was switched when 

the retention efficiency drop below 70%. This helped in preventing 

significant loss of viable cells from the bioreactor due to cell leakage 

through filters.



Page 117 of 151 

Figure 1(abstract P89) (In clockwise direction) a) Inoculum transfer range using offline (±15%) and online (±5%) VCC measurements. b) Feeding 

strategy comparison based on time and online probe readings c) Profiles of batches comparing N. VCC (Normalized VCC) and N. VVD. d) Drop in cell 

retention leading to increased cell leakage through the filter. 

Effective control of perfusion rates: The perfusion rate in a perfusion 

run is generally reported as VVD (volume of medium perfused per 

bioreactor volume per day). As the VCC in the bioreactor increases, VVD is 

increased to provide additional nutrients for the cells. Although increase in 

VVD favours higher cell concentration, a drop in bioreactor VCC is also 

seen occasionally at higher VVD (Figure 1d, batch 1). Upon investigation it 

was evident that in these cases when VVD was increased, cell 

concentration in the bioreactor decreased due to increased cell leakage 

through the filters. Hence it was decided to control the VVD based on cell 

retention values. The VVD in the batch 2 was gradually increased 

considering the retention efficiency of the filter. A higher VCC was 

obtained in this batch compared to batch 1 even at lower VVD, due to 

lower cell loss through the filters. 

Summary: In the current study, effective use of biomass probe was 

demonstrated in applications ranging from direct measurement of VCC to 

indirect applications during perfusion. The probe can be used for these and 

similar applications as an effective PAT tool to improve process consistency 

and robustness. 

Acknowledgements: Manufacturing team: Jiju Kumar, Raghu S, 

Kathiravan N, Santoshkumar Guddad 

Cell culture lab: Rohit Diwakar, Kriti Shukla, Vana Raja S, Abdul Waheed, 

Janani Kanakaraj. 

P90 

Understanding cell behavior in cultivation processes - A metabolic 

approach 

Jonas Aretz 1 , Tobias Thüte 1 , Sebastian Scholz 1 , Klaudia Kersting 1 , 

Thomas Noll 1,2 , Heino Büntemeyer 1* 

1 Institute of Cell Culture Technology, Bielefeld University, Bielefeld, Germany; 

2 Center for Biotechnology (CeBiTec), Bielefeld University, Bielefeld, Germany 

E-mail: heino.buentemeyer@uni-bielefeld.de 


Background: During cultivation cells undergo a tremendous change in 

their metabolism when shifting from one state to another or when 

parameters are changed. To understand the changes in intracellular 

metabolite concentrations and their impact on cell performance we used a 

systematic approach. By employing the chemostat mode at different 

steady state conditions we investigated the alterations of the 

concentrations of key metabolites during cultivations of a human 

production cell line. 

Methods: Chemostat cultivations were performed with the AGE1.hn AAT 

cell line (Probiogen AG, Berlin, Germany) and TC-42 medium (Teutocell AG, 

Bielefeld, Germany) in a fully controlled 2 litre benchtop bioreactor 

(Sartorius, Göttingen, Germany). Different dilution rates of 0.24 d -1 , 0.33 d -1 , 

and 0.40 d -1 and pH values of pH 6.9, pH 7.15, and pH 7.3 were performed 

using the same bioreactor setup. For stopping the cell metabolism an 

established fast filtration method [1] was used for rapid quenching. 

Metabolites were extracted from cells using liquid/liquid extraction. Extracts 

were analyzed by using hydrophilic interaction chromatography (HILIC) and 

ESI-MS/MS mass spectometry. Extracellular amino acids and pyruvate were 

analyzed by pre-column derivatization and RP-HPLC [2], glucose and lactate 

using a YSI 2700 bioanalyser. 

Results: The comparative analysis of the three steady state dilution rates 

shows the great impact of changing extracellular conditions on the 

intracellular metabolite pools which may also lead to an altered 

productivity. For example, as been shown in Figure 1A the specific 

pyruvate consumption rate, qPyr, as well as the intracellular pyruvate pools 

decrease with increasing dilution rates, while qGlc and qGln increase at 

the same time. While some metabolite pools show great differences 

between different dilution rates others remain more or less constant. 

A malonate inhibition of the TCA cycle (Figure 1B) appears mainly at low 

dilution rates, which might be an effect of glucose and/or glutamine 

limitation at those steady states. 

Although qGlc, qPyr as well as qGln decrease with increasing pH values 

(data not shown), the intracellular TCA pools remain constant due to a 

catabolism of further amino acids (Table 1). This may have led to a lower 

waste of ammonia, lactate and glycine at higher pH values. 

The analysis of the intracellular nucleotide pools show that while the 

concentrations of almost all nucleotides dropped with increasing dilution 

rates, they were more or less stable at changing pH values (data not 

shown).



Page 118 of 151 

Figure 1(abstract P90) Metabolite pool sizes in Glycolysis (A) and TCA (B) at different dilution rates. The metabolism at the three different 

dilution rates 0,24 d -1 (left), 0,33 d -1 (middle), 0,4 d -1 (right) is shown. Specific rates are illustrated with filled bars and given in nmol cell -1 d -1 . 

Stripped bars illustrate pool sizes which are given in mM (extracellular) and μM (intracellular), respectively. 

Conclusions: Although more data have to be raised to get a comprehensive 

insight into cell metabolism it could be shown that chemostat cultures 

performed at steady state conditions are a valuable tool for investigating cell 

behaviour on an intracellular basis. A much better data stability can be 

obtained than in batch or fed-batch cultures. 

Acknowledgements: Funding by the BMBF, Germany, Grand Nr. 

0315275A is gratefully acknowledged. 

References 

1. Volmer M, Northoff S, Scholz S, Thüte T, Büntemeyer H, Noll T: Fast 

filtration for metabolome sampling of suspended animal cells. Appl 

Microbiol Biotechnol 2011, 94:659-671. 

2. Büntemeyer H: Methods for off-line analysis in animal cell culture. 

Encyclopedia of Industrial Biotechnology. Bioprocess, Bioseparation, and Cell 

Technology New York: Wiley: Flickinger M 2010.



Page 119 of 151 

Table 1(abstract P90) Correlation of specific rates q xxx 

with the adjusted pH values during steady state 

pH 6,9 pH 7,15 pH 7,3 

q NH3 430 ± 27 243 ± 9 207 ± 19 

q Lac 4751 ± 298 3766 ± 143 3548 ± 325 

q Glc - 3660 ± 230 - 3302 ± 126 - 3301 ± 302 

q Pyr - 155 ± 10 - 121 ± 5 -84 ± 8 

q Gln - 527 ± 33 - 488 ± 19 - 484 ± 44 

q Asp - 63 ± 4 - 123 ± 5 -153 ± 14 

q Glu 66 ± 4 29 ± 1 - 16 ±2 

q Asn - 17 ±1 - 42 ± 2 -45 ± 4 

q Ser -91 ± 6 -198 ± 8 - 191 ± 17 

q His - 13 ± 1 - 23 ± 1 -5 ± 1 

q Gly 32±2 9±0 7±1 

q Thr -26±2 61±2 67±6 

q Arg - 39 ±2 - 97 ± 4 - 109 ± 10 

q Ala 101 ± 6 48 ± 2 99 ± 9 

q Tyr - 10 ± 1 -29 ± 1 29 ± 2 

q Met -20 ± 1 -39 ± 2 - 40 ± 4 

q Val -37 ± 2 -79 ± 3 - 88 ± 8 

q Trp -5±0 -8±0 -9±1 

q Phe - 10 ± 1 -36 ± 1 -36 ± 3 

q Ile -35±2 -68±3 -72±7 

q Leu - 63 ± 4 -111 ± 4 -122 ± 11 

q Lys - 21 ± 1 - 89 ± 3 - 100 ± 9 

The specific rates are given in pmol cell -1 d -1 . (Negative values indicate 

consumed metabolites.) 

P91 

Engineering characterisation of single-use bioreactor technology for 

mammalian cell culture applications 

Akinlolu Odeleye * , Gary J Lye, Martina Micheletti 

Department of Biochemical Engineering, University College London, London, 

WC1E 7JE, UK 

E-mail: akinlolu.odeleye.09@ucl.ac.uk 


Background: The commercial success of mammalian cell-derived 

recombinant proteins has fostered an increase in demand for novel 

single-use bioreactor (SUB) systems, that facilitate greater productivity, 

increased flexibility and reduced costs. Whilst maintaining auspicious 

mixing parameters, these systems exhibit fluid flow regimes unlike those 

encountered in traditional glass/stainless steel bioreactors. With such 

disparate mixing environments between SUBs currently on the market, 

the traditional scale-up procedures applied to stirred tank reactors (STRs) 

are not adequate. The aim of this work is to conduct a fundamental 

investigation into the hydrodynamics of single-use bioreactors at 

laboratory scale to understand its impact upon the growth, metabolic 

activity and protein productivity of an antibody-producing mammalian 

cell culture. 

Materials and methods: This work presents a study characterising the 

macro-mixing, fluid flow pattern, turbulent kinetic energy (TKE), energy 

dissipation rates (EDRs), and shear stresses within these bioreactor 

systems carried out using 2-dimensional Particle Image Velocimetry (PIV). 

PIV enables acquisition of whole-field flow characteristics through 

instantaneous velocity measurements. The SUBs employed in the PIV 

measurements include the 3L CellReady (Merck Millipore), PBS Biotech’s 

PBS 3 bioreactor and the Sartorius 2L BIOSTAT Cultibag RM. 

The CellReady is a stirred tank bioreactor (3 litre volume), housing a 3-bladed 

upward-pumping marine scoping impeller. The PIV study was conducted 

using the actual vessel which has an internal diameter (D T ) of 137 mm and 

height (H T ) of 249 mm. The marine scoping impeller (D I ) is 76.2 mm in 

diameter and is located near the bottom with a clearance of 30mm from the 

base. Measurements were obtained at varying impeller rates from 80 to 

350rpm (corresponding to Re = 8699 to 38057). The PBS 3 is a pneumatically 

driven bioreactor (3 litre volume) whose mixing is induced through the 

buoyancy of bubbles. PIV measurements were again obtained utilising the 

actual PBS 3 vessel in the central vertical plane of the bioreactor at wheel 

speeds of 20, 27, 33 and 38rpm. The Sartorius Cultibag RM is a rocked bag 

bioreactor with a 2 litre total volume. A custom-made Sartorius Cultibag 

mimic and rocking platform was manufactured to enable the required 

optical access for PIV investigations. Measurements were taken at a rocking 

speed of 25 rpm, in the vertical plane 8.5cm from the outer edge of the 

bioreactor. Fluid working volume (wv) was varied at 30, 40, 50 and 60% wv. 

A biological study into the impact of these fluid dynamic characteristics 

on mammalian cell culture performance and behaviour is presented. 

CellReady and Cultibag cell cultures were conducted using the GS-CHO 

cell-line (Lonza) producing an IgG 4 (B72.3) antibody. The impeller speed 

and working volume are used to vary the hydrodynamic environment 

within the CellReady, whilst the rocker speed is the varied parameter in 

the Cultibag RM. 

Results and discussion: The upward-pumping 3-bladed impeller within 

the CellReady engenders compartmentalisation of the fluid flow. This in 

turn contributes to the wide range of turbulence levels conveyed between 

the lower quarter and upper three quarters of the fluid. The maximum 

fluid velocity of 0.25U tip is achieved in the impeller discharge stream (at 

approximately r/R = 0.65 and z/H = 0.15) as shown in Figure 1, whilst the 

peak axial and radial turbulent velocities (ũ) are 0.15U tip and 0.11U tip 

respectively. 

Disparity in cellular growth and viability throughout a range of CellReady 

operating conditions (80 rpm-2.4L, 200rpm-2.4L and 350 rpm-1L) was not 

substantial, although a significant reduction in cell specific productivity 

was found at 350 rpm and 1L working volume. This is considered to be the 

most stressful hydrodynamic environment tested. Cells grown at these 

conditions displayed a metabolic shift from lactate production to net 

lactate consumption, without a reduction in glucose uptake. A possible 

reason for these observations is increased oxidative stress resulting from 

the higher agitation rate and gas entrainment [1,2]. 

The PBS exhibits a greater degree of fluid dynamic homogeneity when 

compared to the CellReady. Although, TKE is more than 10 times lower 

than values observed in the CellReady’s impeller zone (which ranges from 

0.0026 to 0.0455 m 2 /s 2 at the varying impeller rates tested). Whilst TKE in 

the PBS peaks at approximately 0.0022 m 2 /m 2 with a wheel speed of 

38 rpm, the fluid attains velocities of up to 50% of the PBS wheel speed. 

This corresponds to velocities of up to 15 cm/s, which is within a similar 

range to the values observed in the CellReady. 

The Sartorius RM induces fluid velocities of up to 37 cm/s at 25 rpm, 

although fluid velocity and turbulence is dominated by the radial 

component. EDR and TKE remain relatively low at 25 rpm, with mean wholefield 

ensemble-averaged values of up to 0.0044 m 2 /s 3 and 0.0020 m 2 /s 2 

respectively. These measurements are significantly lower than the mean EDR 

values of 0.0052 to 0.14 m 2 /s 3 (over the RPM range of N = 80 to 350 rpm) 

determined in the upper three quarters of the CellReady alone. Cellular 

response to an increase in turbulence within the rocked bag bioreactor 

(25 to 42rpm), results in an increase in stationary phase viable cell 

concentration (VCC) of 20%. In addition, cell metabolic activity and cell 

specific protein productivity remains relatively unchanged. The augmented 

homogeneity and consistency in reference to turbulence and shear stresses 

within the Sartorius RM may enable the cells to adapt to the more rigorous 

mixing, thus maintaining cell specific productivity as well as enhancing VCC. 

Also,cellsgrownintheSartoriusRMexhibitmorethan60%greatercell 

specific productivity levels and up to 37% greater IgG 4 titres compared to 

those grown in the CellReady. Even though IgG 4 productivity increases 

within the Cultibag, investigations into product quality are necessary. 

Given the shifts seen in metabolic behaviour and cell specific productivity, it 

can be concluded that the fluid dynamic environment will impact upon 

cellular performance. Clearly, the range of EDRs and TKEs experienced by 

the culture is just as pertinent as the peak turbulence levels. Therefore, 

determining the critical hydrodynamic parameters applicable to the 

different flow regimes found in SUBs, will enable greater cross-compatibility 

and scalability across the range of SUBs.



Page 120 of 151 

Figure 1(abstract P91) a) Time-resolved mean normalized velocity contour plot obtained at N = 200rpm, Re = 21747, V L =2.4L.b) Time-resolved 

turbulent velocity ( ũij) contour plot obtained at N = 200rpm, Re = 21747, V L = 2.4 L. Resolution of 0.815mm. 

References 

1. Mckenna T: Oxidative stress on mammalian cell cultures during 

recombinant protein expression. Linkoping University Institute of 

Technology 2009, 10. 

2. Sengupta N, Rose ST, Morgan J: Metabolic flux analysis of CHO cell 

metabolism in the late non-growth phase. Biotechnol Bioeng 2011, 

108:82-92. 

P92 

Enhancing cell growth and antibody production in CHO cells by siRNA 

knockdown of novel target genes 

Sandra Klausing 1* , Oliver Krämer 1 , Thomas Noll 1,2 

1 Institute of Cell Culture Technology, Bielefeld University, Bielefeld, Germany; 

2 Center for Biotechnology (CeBiTec), Bielefeld, Germany 

E-mail: Sandra.klausing2@uni-bielefeld.de 


Background: Seven out of the ten top-selling biopharmaceuticals in 2011 

are produced in Chinese Hamster Ovary (CHO) cells [1]. This tremendous 

commercial interest makes the development and application of strategies 

for cell line optimization, like gene overexpression or knockdown to 

enhance cell specific productivity and cellular growth, highly interesting. In 

this work, we investigated the knockdown effect of novel target genes by 

siRNA as a powerful tool for CHO cell line engineering. 

Materials and methods: CHO DP-12 cells (clone #1934, ATCC CRL-12445) 

were used as a model cell line, producing an anti IL-8 antibody. Cultivations 

were performed in 125 mL shaking flasks at 37 °C, 5% CO 2 ,185rpmand 

5 cm shaker orbit. For fed-batch processes, TCx2D feed supplement 

(TeutoCell AG) and a predefined feeding regime were applied identically for 

all cultures. Viable cell densities (vcd) and cell viability were measured by a 

Cedex Sytem (Innovatis). Monoclonal antibody (mAb) concentrations were 

determined via HPLC and a protein A column (Life Technologies). 

Target genes were chosen based on well-known signaling pathways (e.g. 

apoptosis, cell cycle or histone modification) as well as from previous results 

of a CHO cDNA microarray [2]. Mediators of apoptosis Bad and JNK were 

chosen as target genes for evaluation after knockdown, as well as Set, a 

protein involved in histone modification. Mcm5 is involved in DNA 

replication but its regulative role is not completely understood. Finally, 

knockdown of target gene P (patent pending) was investigated. Short 

hairpin RNA (shRNA) sequences were designed and cloned into a shRNA 

expression vector which was stably introduced into CHO DP-12 cells via 

lentiviral gene delivery. After selection with 5 μg/mL puromycin, successful 

siRNA-mediated mRNA knockdown (kd) of the target gene was verified by 

quantitative real-time PCR (qPCR). Transduced cell pools were evaluated in 

batch and fed-batch shaker cultivations with regard to growth performance 

and antibody productivity. 

Results: Through siRNA-mediated RNA interference, a high stable gene 

knockdown in the cell pools was achieved for target gene Set, JNK, Bad and 

P. Transcript levels were reduced by 57% (knockdown of JNK) up to 93% 

(knockdown of P), as shown in Figure 1A. Due to the procedure of lentiviral 

infection and puromycin selection, a slight variation in transcript levels of 

some target genes was observed even for an empty vector control cell pool 

in comparison to untreated CHO DP-12 cells. Unexpectedly, despite 

genomic integration of Mcm5-targeting shRNA, Mcm5 transcription was 

found to be up-regulated in two separate measurements of the respective 

cell pool. 

In batch shaker cultivations, all cells with a stable vector integration 

exhibited higher maximum vcds, compared to the untreated CHO DP-12 

culture. Cells with a stable knockdown of apoptosis mediator Bad reached 

the highest vcd with 121·10 5 cells/mL. However, final antibody titers did 

not exceed the titer of the empty vector control cell pool (data not shown). 

Fed-batch shaker cultivation increased maximum cell densities as well as 

process duration and revealed a strong influence of siRNA mediated gene 

knockdown (Figure 1B and C). The maximum vcd was increased for cells 

with stable expression of a shRNA targeting JNK (by 23%), Bad (by 44%), 

Mcm5 (by 45%) and P (by 74%) compared to empty vector control cells. In 

comparison to this control cell pool, maximum mAb titer was higher for cell 

pools JNK-kd, Mcm5-kd and P-kd. Mean cell specific productivity between 

day 4 and day 8 of the cultivation was increased in cell pools Set-kd as well 

as P-kd. The highest mAb titer of 456 mg/L was detected for cells with a 

stable knockdown of gene P. 

Conclusions: siRNA knockdown of target genes is an effective tool for 

CHO cell engineering in order to achieve higher viable cell densities and 

mAb titers. The stable transduction of shRNA targeting Mcm5 resulted in a 

slight increase of the transcript level, nevertheless, vcd and product titer 

were enhanced. This effect will be further analyzed. Knockdown of target 

gene P led to increased vcd in fed-batch cultivation (by 123%), higher



Page 121 of 151 

Figure 1(abstract P92) (A) Relative mRNA ratio of target genes in cell pools with stable shRNA expression and the empty vector control cell pool 

compared to untreated CHO DP-12 cells. (B) Viable cell density and viability during fed-batch shaker cultivation of cell pools and untreated cells. (C) 

Maximum mAb titer and mean cell specific productivity (csp) between day 4 and 8 for all cultures in fed-batch cultivation. 

maximummAbtiter(by159%)andhighercspbetweenday4and8(by 

70%), compared to untreated CHO DP-12 cells, which makes this target 

gene a highly interesting candidate for cell line engineering. Stable 

transduction with an empty vector also influenced cellular behavior of the 

control cell pool compared to untreated CHO DP-12 cells. This is likely due 

to the random integration of the transfer vector and a selection for more 

robust and faster growing cells during the procedure of lentiviral infection 

and puromycin selection. Further reasons are under investigation. Single 

cell clone isolation for the presented cell pools will most likely result in 

further improvements of viable cell density and product titer. 

References 

1. Huggett B, Lähteenmaki R: Public biotech 2011 - the numbers. Nature 

Biotechnology 2012, 30:751-757. 

2. Klausing S, Krämer O, Noll T: Bioreactor cultivation of CHO DP-12 cells 

under sodium butyrate treatment - comparative transcriptome analysis 

with CHO cDNA microarrays. BMC Proceedings 2011, 5(Suppl 8):P98. 

P93 

Skin and hair-on-a-chip: Hair and skin assembly versus native skin 

maintenance in a chip-based perfusion system 

Ilka Wagner 1* , Beren Atac 1 , Gerd Lindner 1 , Reyk Horland 1 , Matthias Busek 1 , 

Frank Sonntag 2 , Udo Klotzbach 2 , Alexander Thomas 1 , Roland Lauster 1 , 

Uwe Marx 1 

1 Technische Universität Berlin - Berlin, Germany; 

2 Fraunhofer IWS - Dresden, 

Germany 

E-mail: ilka.wagner@tu-berlin.de 


Background and novelty: In recent decades, substantial progress to 

mimic structures and complex functions of human skin in the form of skin 

equivalents has been achieved. Different approaches to generate functional 

skin models were made possible by the use of improved bioreactor 

technologies and advanced tissue engineering. Although various forms of 

skin models are successfully being used in clinical applications, in basic 

research, current systems still lack essential physiological properties for 

toxicity testing and compound screening (such as for the REACH program) 

and are not suitable for high-throughput processes. 

Experimental approach: In particular, further bioengineering is necessary 

for the implementation of adipose tissue, hair follicles and a functional 

vascular network into these models. In addition, miniaturization, nutrient 

and oxygen supply, and online monitoring systems have to be implemented 

in sophisticated culture systems. To become one step closer to the in vivo 

situation, we produced microfollicles as in vitro hair equivalents and 

integrated them into skin models. These microfollicles containing skin 

tissues were cultured under static and dynamically perfused conditions and 

were compared to ex vivo scalp and foreskin skin organ cultures. Dynamic 

cultivation was performed in our Multi-Organ-Chip system (Figure 1 A). 

Results and discussion: The formation of functional neopapillae needs 

more than 48 hours. After the addition of keratinocytes and melanocytes, 

the self-organizing microorganoids follow a stringent pattern of follicularlike 

formation by generating polarized segments, sheath formations and 

the production of a hair shaft-like fiber. We show that the de novo 

formation of human microfollicles in vitro is accompanied by basic hair 

follicle like characteristics. The microfollicles can be used to study 

mesenchymal-epithelial-neuroectodermal interactions and for the in vitro 

testing of hair growth-modulating substances and pigmentary effects. As 

the hair follicle is highly vascularized, it supports penetration of substances 

into the skin and further into the bloodstream. Testing of topically applied 

substances might therefore be performed with significantly enhanced 

validity by the incorporation of a microfollicle into a dynamic chip-based 

bioreactor containing a skin equivalent which mimics a physiological 

penetration route. Commercially available skin equivalent EpiDermFT were 

cultured in the Multi-Organ-Chip for 7 days with subcuteaneous tissue and 

showed better viability and comparable histological results to native skin 

(Figure 1 C-J). Cellular and nutritional effect of the subcueaneous tissue is 

visible even under static conditions. Presence of subcuteaneous tissue 

decreased the expression of Tenascin C in dermis which is a marker for 

inflamation and fibrosis. Integritiy of the epidermis and proliferating cells 

in epidermis kept prominently in combined tissues. Figure 1 B showes the 

staining of a skin equivalent with an successfully inserted microfollicle. 

Conclusion: Perfusion of the combined tissue provides better integration 

and associated to viability of the subcuteaneous tissue. In general, presence 

of subcutaneous tissue increased the longevity of the in vitro skin equivalent 

in both static and especially in Multi-Organ-Chip cultures with improved 

tissue architecture. A skin equivalent with integrated microfollicles and



Page 122 of 151 

Figure 1(abstract P93) Microfluidic device for perfused skin equivalent culture and integrated Microfollicle (A) Dynamic chip-based bioreactor 

for continuous perfusion culture of skin equivalents with integrated microfollicles. (B) PanCytokeratin immunoflourescent staining of a skin 

equivalent with an inserted microfollicle. (C-J) In vitro skin equivalents (MatTek) cultured for 7 days in MOC or static conditions with and without 

subcutaneous tissue (SCT) and compared to ex vivo foreskin. (C-F) H&E staining and (G-J) immunofluorescence staining for epidermal markers Cytokeratin 

10 and 15. Dashed lines mark the border between the skin equivalent and the subecuteaneous tissue. Scale bars indicate 100 μm. 

subcutaneous tissue under dynamic perfusion will be the most suitable 

model for long-term cultivation and more efficient drug studies and one 

step closer to mimic in vivo skin. 



P94 

2D fluorescence spectroscopy for real-time aggregation monitoring in 

upstream processing 

Karen Schwab * , Friedemann Hesse 

Institute of Applied Biotechnology, University of Applied Science Biberach, 

88400 Germany 

E-mail: schwab@hochschule-bc.de 


Introduction: Product aggregation is one side effect of rising yields due to 

process improvement and therefore accompanied with massive product 

loss during downstream processing (DSP). But it is already in literature 

described, that product aggregation also occurs during the fermentation 

process and is caused by various process operations [1]. Real-time 

bioprocess monitoring and thus on-line product quality control during 

upstream processing (USP) enables to address this issue during process 

development. For bioprocess control, 2D fluorescence spectroscopy in 

combination with chemometric modeling based on fluorescence signals 

derived from cells and medium components is a promising tool and 

described in literature [2]. Furthermore extrinsic fluorescence dyes are 

widely used to detect and quantify aggregated protein [3]. In this study, 

2D fluorescence spectroscopy in combination with three different extrinsic 

fluorescence dyes were evaluated, in order to establish a process control 

tool which enables real-time product control during USP. 

Materials and methods: A CHO DG44 cell line producing a monoclonal 

antibody (mAb) was cultivated in a 2 liter bioreactor (Sartorius AG) in 

fed-batch mode. Metabolites and substrate concentrations were determined 

using Konelab 20XT (Thermo Scientific) and cell concentration and 

viability via CEDEX XS system (Innovartis-Roche AG). The product titer was 

determined with protein-A HPLC. Furthermore, culture supernatant samples 

were applied to the size exclusion column Yarra S4000 (Phenomenex) after 

filtration. The intrinsic fluorescence signal at 355nm was recorded with a 

fluorescence detector (Gynkotek), in order to determine the monomer to 

aggregate ratio in the sample. Samples were taken twice a day and 

incubated with ANS, bis-ANS and Thioflavin T at 3 different concentrations 

respectively. Full 2D scans from 270nm to 590nm of these samples were 

taken with the DELTA BioView® sensor. These scans were used as data 

input for chemometric modeling, where the target data was the mAb 

aggregate concentration. 

Results: A common approach to analyze aggregated mAb in cell culture 

comprises the isolation of the mAb by protein A HPLC subsequently 

followed by size exclusion chromatography [1,4]. However, the capture step 

itself may have an influence on product aggregation. Therefore, in this study 

we tried to avoid the capture step by directly applying cell culture 

supernatant onto the size exclusion column after a filtration step. The signal 

derived from the cell culture medium and host cell proteins could be 

separated from mAb monomer and aggregate signal (Figure 1D). This 

allowed direct quantification of mAb aggregates in culture broth via size 

exclusion chromatography (SEC). Fluorescent dyes such as ANS, and its 

dimeric analogon 4,4’-bis-1-anilinonaphthalene-8-sulfonate (Bis-ANS) as well 

as thioflavin T interact noncovalently with hydrophobic regions of the 

aggregated protein [3]. To our knowledge, up to now these dyes were not 

used as additives in mammalian cell cultures. Therefore, a major concern 

was their toxicity towards the CHO production cell line. Toxicity screens in 

microtiter plates (data not shown) revealed that already 4μM bis-ANS as well 

as 4μM thioflavin T reduced the specific growth rate strongly. The in 

literature reported concentrations for these dyes in DSP approaches [3] were 

considerably higher hence their sensitivity limits in cell culture had to be 

evaluated. In order to enable a direct comparison of fluorescence intensity



Page 123 of 151 

Figure 1(abstract P94) PCA score plots for all Bis-ANS (A), thiovlavin T (B) and ANS (C) concentrations, where PC2 is displayed over PC1. T=0 

indicates data of 2D scans taken directly after inoculation. (D) SEC chromatogram of the intrinsic fluorescence emission signal at 355nm. Monomer, dimer 

and oligomer fractions of mAb were detectable; furthermore a separation from the medium and host cell protein signal was possible. 

Table 1(abstract P94) PLS results for selected dye concentrations used in the fed-batch fermentation experiment 

Dye PC’s R-Square RMSE Offset Slope 

w/o dye 3 calibration data set 0.96 1.27 0.43 0.96 

validation data set 0.72 3.62 2.75 0.70 

2μM Bis-ANS 4 calibration data set 0.98 10.9 2.28 0.98 

validation data set 0.93 19.36 -4.20 0.97 

80μM ANS 4 calibration data set 0.98 0.82 0.18 0.98 


25μM Th T 2 calibration data set 0.99 5.18 0.52 0.99 


2D fluorescence scans were taken as x-data and the mAb aggregate concentration was used as target data for chemometric modeling. Validation data sets were 

generated with cross validation.



Page 124 of 151 

increase generated by dye aggregate interaction, the DELTA BioView® sensor 

was used at-line during the fed-batch fermentation. For chemometric 

modeling, fluorescence maps were preprocessed by principal component 

analysis (PCA), in order to capture the data input with the highest variance 

over the cultivation time. PCA results indicated that the sensitivity of Bis-ANS 

and ANS was very high towards aggregated mAb. Furthermore, increasing 

Bis-ANS concentrations increased the score values of PC1 in general (Figure 

1A), contrary to ANS where score values of PC2 increased (Figure 1C). For 

thioflavin T score values differed greatly when low and high dye 

concentrations were compared, starting at one point (Figure 1B). 

Furthermore, the mAb aggregate titer was used as target for partial least 

square regression (PLS) (Table 1) and resulting calibration and validation 

models showed low root square mean error (RMSE) values as well as good 

slopes and R-squares for ANS and Bis-ANS. Besides that, the chemometric 

model computed with 2D scans taken from cell culture without additional 

dye showed a slope of 0.7 and R-square value of 0.72 for the validation data 

set. This indicated that the quality of the chemometic models seemed to be 

improved when an additional fluorescence signal based on dye mAb 

aggregate interaction was generated in the 2D scans. Moreover, only 25μM 

thioflavin T enabled a solid calibration model (Table 1). This raised the 

suspicion, that there might be only weak interactions of dye and aggregated 

mAb. In consequence these preliminary results indicated, that thioflavin T 

which is normally used for detection of fibrils seemed to be less favorable 

for the detection of mAb aggregates. 

Conclusions: Suitable fluorescence dye candidates were selected and 

based on sensitivity and toxicity, ANS and Bis-ANS proved to be 

promising candidates for further work. Direct quantification of mAb 

aggregates in cell culture broth was possible with SE-HPLC based on the 

intrinsic fluorescence of mAb. The fed-batch fermentation experiment, 

where the DELTA BioView® sensor was used at-line, enabled a direct 

comparison of different dye concentrations. Therefore, this experiment 

demonstrated that for bis-ANS even lower concentrations than already 

used might be applicable due to its high sensitivity towards mAb 

aggregates. Moreover, the results indicated that product aggregation is 

not only a side effect of rising titers, because mAb aggregates were also 

present at early fermentations time points. 

References 

1. Gomez N, Subramanian J, Ouyang J, Nguyen M, Hutchinson M, Sharma V, 

Lin A, Yu I: Culture temperature modulates aggregation of recombinant 

antibody in CHO cells. Process Biochem 2012, 47:69-75. 

2. Teixeira A, Portugal C, Carinhas N, Dias J, Crespo J, Alves P, Carrondo M, 

Oliveira R: In situ 2D fluorometry and chemometric monitoring of 

mammalian cell cultures. Biotechnol Bioeng 2009, 102:1098-1106. 

3. Hawe A, Sutter M, Jiskoot W: Extrinsic fluorescent dyes as tools for 

protein characterization. Pharm Res 2008, 25:1487-1499. 

4. Jing Y, Borysa M, Nayakb S, Egana S, Qiana Y, Pana S, Li Z: Identification of 

cell culture conditions to control protein aggregation of IgG fusion 

proteins expressed in Chinese hamster ovary cells. Biotechnol Bioeng 

2012, 109:125-136. 

P95 

Use of microcarriers in Mobius® CellReady bioreactors to support 

growth of adherent cells 

Michael McGlothlen * , Donghui Jing, Christopher Martin, Michael Phillips, 

Robert Shaw 

EMD Millipore Corporation, 80 Ashby Rd, Bedford MA 01730, USA 

E-mail: Michael.mcglothlen@emdmillipore.com 


Mixing: Manufacturer specifications show Cytodex 3 ® and Solohill® 

microcarriers to be similar in density and size. Working with this assumption, 

mixing studies where performed using the Cytodex 3 ® microcarriers in 3L 

Mobius® CellReady and Solohill® Collagen coated in 50L single use 

bioreactor to determine the slowest agitation speed or the just suspended 

mixing power inputs (P/V) js , required to fully suspend the microcarriers so 

that the beads are equally distributed in the bioreactor. 

Microcarrier distribution was assessed by sampling the bioreactor at varying 

depths. Then the dry weight of the microcarrier was used to determine the 

% relative sample weight to the target weight. 

Mixing Results: Data show the (P/V) js to be ~0.6W/m 3 in both the 3L and 

50L single use bioreactors 

100% distribution corresponds to the theoretical concentration of 

microcarriers, which is 3g/L Cytodex 3 ® in 3L bioreactor and 15g/L Solohill® 

Collagen microcarriers in 50L bioreactor 

Cell Growth: Initial cell culture runs were performed with MDCK and 

Human Mesenchymal Stem Cells (hMSCs) to evaluate the bioreactor 

agitation to support cell growth in the 3L Mobius® CellReady single use 

bioreactor. The conditions that showed the best performance could then 

scaled to the 50L Mobius® bioreactor. 

1. Cultured MDCK cells on Cytodex 3 ® microcarriers grew to a peak cell 

density of ~1e6cells/mL using a power input of 0.6W/m 3 with a 2L 

working volume after 3 days. 

2. Cultured hMSCs on Solohill® microcarriers grew to a maximum 

total cell number of 6e6 cells using power input of 0.6-0.8W/m 3 with 

a 2.4L working volume after 12 days. 

Conclusions: 1. Data from the mixing experiments demonstrate the just 

suspended mixing power input was determined to be ~0.6W/m 3 . 

2. Cell growth experiments with hMSCs demonstrate comparable cell 

growth in the 3L and 50L Mobius® CellReady bioreactor with total 

number of hMSCs reaching 4e8 and 9e9 cells after 12 days at a 

agitation power input of 0.6-0.8W/m 3 

3. Initial cell growth experiments with adherent MDCK cells 

demonstrate an agitation power/volume input of 0.6W/m 3 may 

provide the best performance for cell growth with peak cell densities 

~1.0e6 cells/mL after 3 days 

4. Comparable MDCK cell growth is observed: 

Mobius® CellReady Bioreactor 3L 

Mobius® CellReady Bioreactor 50L 

Rocking Bioreactor 20L 

P96 

CHO starter cell lines for manufacturing of proteins with pre-defined 

glycoprofiles 

Karsten Winkler 1* , Michael Thiele 1,2* , Rita Berthold 1 , Nicole Kirschenbaum 1 , 

Marco Sczepanski 1 , Henning von Horsten 1,3 , Susanne Seitz 1 , Norbert Arnold 2 , 

Axel J Scheidig 2 , Volker Sandig 1 

1 ProBioGen AG, D-13086 Berlin, Germany; 

2 Christian-Albrechts-Universität zu 

Kiel, D-24118 Kiel, Germany; 

3 Hochschule für Technik und Wirtschaft Berlin, 

D-10138 Berlin, Germany 

E-mail: michael.thiele@probiogen.de 


Backround: Glycosylation of protein therapeutics is influenced by a 

multifaceted mix of product intrinsic properties, host cell genetics and 

upstream process parameters. Industrial CHO cell lines may have several 

deficits in their glycosylation pattern for some applications, like high fucose 

content (corresponding to a low ADCC profile) and low galactosylation and 

sialylation levels (proposed to decrease activity and/or pharmacokinetics). 

We have successfully applied the GlymaxX® technology [1] abolishing fucose 

synthesis in well-established CHO DG44 and K1 platforms and pre-existing 

producer cell lines (glycan modulator GM1). Here we extend this strategy by 

other engineering approaches to enable production of protein therapeutics 

with desired glycosylation features. Through stable integration of other 

Table 1(abstract P95) 

Physical Characteristics of Microcarriers 

Microcarrier Cytodex 3® Solohill® Collagen Coated 

Density (g/ml) 1.04 1.03 

Hydrated Size (μm) 141-211 125-212 

Concentration (g/ml) 3 15



Page 125 of 151 

Table 2(abstract P95) 

MDCK/Cytodex 3® Microcarriers Process Table 

Variable 

Value 

Cells MDCK hMSCs 

Inoculation 4e5 cells/mL 

5e3 cells/mL 

Density 

Substrate Cytodex 3® Solohill® 

Growth Media DMEM w/4.5g/L Glucose, 2% FBS, 1% NEAA and 2mM L-Glutamine DMEM low glucose, 10% FBS, 8ng/ml bFGF, 2mM 

Glutamine, 1X Pen/Strep 

pH 7 NA 

DO (% 45 NA 

Saturation) 

Feed 1 Day 1: 100% Growth Media Day 6: 1000ml low glucose fresh medium 

Feed 2 Day 3: Drain 50% of the working volume and reefed with equal volume Day 9: 400ml high glucose fresh medium 

of Growth Media 

Batch Duration 7 days 12 days 

Figure 1(abstract P95) Illustrates the attachment of MDCK and hMSCs to Cytodex 3 ® and Solohill® microcarriers 

Figure 2(abstract P95) compares the viable cell density of MDCK cells at increasing power/volume impeller inputs and different bioreactors 

genes for glycosylation enzymes we are able to tune galactosylation (glycan 

modulator GM2) and sialylation (glycan modulator GM3). These glycan 

modulators can specifically be combined to address certain desired 

oligosaccharide patterns. 

We postulate that modulating effects of GM2 and GM3 require a specific 

expression level. In this case the combination of high level target protein 

expression and defined levels of glycan modulators becomes extremely rare. 

Therefore, the characterization of clones with individual stable levels of 

glycanmodulator expression is a prerequisite for industrial application. 

Materials and methods: Two vectors expressing either GM2 alone or GM2 

and GM3 in combination were constructed to evaluate modulator effects. 

This technology was applied to both, CHO-DG44 and K1 cells to generate 

modified host cell pools. Modulator host cell clones were generated out of 

appropriate DG44 pools and characterized for growth and modulator gene 

expression using a 7-day shaker batch culture and RT-qPCR respectively. 

A human IgG and a Fc-Fusion protein carrying a single N-glycosylation side 

in the CH2 domain were chosen as model proteins. After stable transfection 

of human IgG into GM2 and Fc-fusion protein into GM2/3 clones, the



Page 126 of 151 

Figure 3(abstract P95) shows the viable cell density of hMSCs in the 3L and 50L Mobius® CellReady Bioreactor 

resulting test modulator clone pools were analyzed in fed batch shaker 

assays. Harvested culture supernatants were purified and subjected to N- 

Glycan profile analysis performed by Hydrophilic-Interaction-Chromatography 

(HILIC). 

Results: Characterization of modulator host cell clones for proliferation 

and modulator mRNA expression indicated that growth behavior is not 

influenced by modulator expression level. Therefore only GMx-mRNA 

level were used to select five to six clones expressing a broad range of 

either GM2 alone or GM2 and GM3 in combination. Each selected 

modulator host cell clone was transfected with the corresponding model 

protein in duplicates (indicated by A or B). 

Final fed batch assays gave typical clone pool results with growth profiles 

showing high comparability between clone pools expressing the same 

model protein (Table 1). Peak viable cell densities (VCD) of about 3E7 vc/mL 

were reached with maximum titers of 1.2 g/L hum IgG and 2.4 g/L Fc-Fusion 

protein within 12 days, while final viabilities were in most cases above 80%. 

Up to 3 fold different titers between pools A and B of the same starter clone 

were observed depending on selection schemes and process management. 

As it is given by the conveyer like nature of the glycosylation machinery the 

content of a certain glycan structure cannot be increased without 

decreasing the output of the preliminary structures. Therefore the 

hypergalactosylation effect of GM2 should result in a shift towards more 

G2F structures and for the combination of GM2 and GM3 a shift towards 

more G2FS1 structures is anticipated, while even the G2F content could be 

decreased. As shown in Figure 1 the expected shifts were observed, 

demonstrating that the glycan modulators are working in the intended way. 

Additionally, we found a positive correlation between the level of modulator 

gene expression and the degree of glycan modifying effect. Clone pools 

with highest modulator expression levels displayed the highest content of 

the desired structures e.g. G2F for GM2 clones and G2FS1 for GM2/3 clones. 

This reflects a 15 - 20-fold increase of these target structures compared to 

clone pools with low or moderate modulator expression (Table 1). 

Despite substantial differences in productivity and process between A and 

B clone pool duplicates (2 - 3 fold difference in titers) in most cases only 

slight shifts of certain oligosaccharide structures were observed (e.g. clone 

pool 3 - 5 and 8, 9). This indicates that the glycan pattern is more 

Table 1(abstract P96) Data of selected clone pools shown in Figure 1 

Model protein: human IgG 

Model protein: Fc-Fusion protein 

Clone pool no. 1 2 4 6 7 10 

Index A B A B A B A B A B A B 

relative modulator mRNA expression 

GM2 5.8 5.8 2.5 2.5 0.4 0.4 1.5 1.5 3.7 3.7 0.6 0.6 

GM3 3.2 3.2 1.4 1.4 0.3 0.3 

Key process parameter 

Peak VCD (cell/mL) 20 20 31 24 28 24 31 24 29 25 27 25 

Final-vitality (%) 73 82 82 88 87 91 87 87 86 84 89 93 

Titer (g/L) 0.6 0.4 0.9 0.7 1.0 0.6 2.1 1.0 1.8 1.0 2.3 1.1 

N-Glycan analysis 

G0F (%) 2 1 62 55 71 68 37 24 19 19 46 41 

G1F (%) 19 13 23 29 18 21 27 32 35 34 33 38 

G2 (%) 3 4 1 1 1 1 1 1 1 1 1 1 

G2F (%) 61 67 4 6 2 3 3 7 11 10 9 12 

G1FS1 (%) 2 3



Page 127 of 151 

Figure 1(abstract P96) HILIC chromatograms of clone pools with distinct modulator expression levels. A: GM2 clone pools, B: GM2/3 clone pools. 

With increasing GM2 activity a clear shift towards G2F structures can be observed. While the increasing activities of GM2 and GM3 correlates positively 

with the G2FS1 content. 

depended on clone specific modulator gene expression than on 

glycoprotein expression level. 

Conclusions: Expression of GM2 and GM3 in CHO cell lines can effectively 

change the glycosylation pattern of target proteins in a dose dependent 

manner. Growth and productivity characteristics are similar to unmodified 

host cells and maintain their suitability for clinical and commercial 

production. 

The degree of glycomodulation is reproducible and relatively independent 

of target glycoprotein expression level. This allows a prediction of 

glycosylation patterns of glyco-proteins produced in certain host cell 

clones in relation to modulator expression level. 

Finally, a comprehensive set of engineered, biopharmaceutical CHO 

production cell lines were generated and characterized, individually 

optimized for enhanced ADCC activity, adjusted galactosylation or sialylation 

levels of the target proteins. This elaborate cellular toolbox allows the rapid 

and targeted creation of antibody and glycoprotein molecules with specific 

pre-defined glycan profiles. 

Reference 

1. von Horsten HH, Ogorek C, Blanchard V, Demmler C, Giese C, Winkler K, 

Kaup M, Berger M, Jordan I, Sandig V: Production of non-fucosylated 

antibodies by co-expression of heterologous GDP-6-deoxy-D-lyxo-4- 

hexulose reductase. Glycob 2010, 20:1607-1618. 

P97 

Dynamic profiling of amino acid transport and metabolism in Chinese 

hamster ovary cell culture 

Sarantos Kyriakopoulos 1 , Karen M Polizzi 2,3 , Cleo Kontoravdi 1* 

1 Centre for Process Systems Engineering, Department of Chemical 

Engineering and Chemical Technology, Imperial College London, UK; 

2 Division of Molecular Biosciences, Imperial College London, UK; 

3 Centre for 

Synthetic Biology and Innovation, Imperial College London, UK 

E-mail: cleo.kontoravdi98@imperial.ac.uk 


Introduction: Chinese Hamster Ovary (CHO) cells are the most widely used 

industrial hosts for the production of recombinant DNA technology drugs 

[1]. In such processes amino acids (a.a.) are vital nutrients for growth, but 

also building blocks of the recombinant protein (rprotein). Our research aims 

to establish a better understanding of a.a. transport in and out of cells, since 

this could have significant impact on increasing productivity and designing 

feeding strategies during bioprocessing. 

There are about 46 a.a. transporter proteins in mammalian cells, the genes of 

which are presented in Table 1 along with their substrates and all are 

members of the Solute Carriers (SLC) database [2]. A.a. transporters are



Page 128 of 151 

Table 1(abstract P97) Amino acid transporter genes based on the SLC database [2] 

System GENES Substrates Expresion/Type of 

regulation 

A SLC38a1 Ala, Asn, Cys, Gln, His, Ser below detection 

limits 

SLC38a2 Ala, Asn, Cys, Gln, Gly, 

His, Met, Pro, Ser 

System GENES Substrates Expresion/Type 

of regulation 

PAT SLC36a1 Gly, Ala, Pro, b- Ala, 

Tau 

remains stable 

between cell lines b SLC36a2 Gly, Ala, Pro low a 

SLC38a4 Ala, Asn, Cys, Gly, Ser, Thr within cell culture c SLC36a3 putative low a 

ASC SLC1a4 Ala, Ser, Cys, Thr within cell culture c SLC36a4 Ala, Pro, Trp remains stable 

SLC1a5 Ala, Ser, Cys, Thr, Gln, 

Asn 

both d T SLC16a10 Phe, Tyr, Trp low a 

asc 

SLC7a10/ 

SLC3a2 

Ala, Cys, Gly, Ser, Thr low a X - AG SLC1a1 Asp, Glu low a 

B 0 SLC6a19 Pro, Leu, Val, Ile, Met low a SLC1a2 Asp, Glu both d 

SLC6a15 Pro, Leu, Val, Ile, Met remains stable SLC1a3 Asp, Glu between cell lines b 

B 0,+ SLC6a14 basic & neutral a.a. not checked SLC1a6 Asp, Glu below detection 

limits 

b 0,+ 

SLC7a9/ 

SLC3a1 

Arg, Lys, Cystine low a SLC1a7 Asp, Glu below detection 

limits 

b SLC6a6 Tau, b-Ala both d x - c SLC7a11/ 

SLC3a2 

Glu, Cystine 

Gly SLC6a9 Gly within cell culture c y + SLC7a1 Arg, Lys, His both d 

SLC6a5 Gly low a SLC7a2 Arg, Lys, His low a 

SLC6a18 Gly below detection 

limits 

IMINO SLC6a20 Pro low a y + L SLC7a7/ 

SLC3a2 

L 

SLC7a5/ 

SLC3a2 

SLC7a8/ 

SLC3a2 

Cys, Leu, Phe, Trp, Val, 

Tyr, Ile, His, Met 

both d 

neutral a.a., except Pro low a His & small 

peptides 

SLC7a3 Arg, Lys, His low a 

SLC7a6/ 

SLC3a2 

Lys, Arg, Gln, His, Leu, 

Met 

Lys, Arg, Gln, His, Leu, 

Met, Ala, Cys 

within cell culture c 

both d 

remains stable 

SLC15a3 His between cell lines b 

SLC43a1 Leu, Ile, Met, Phe low a SLC15a4 His between cell lines b 

SLC43a2 Leu, Ile, Met, Phe between cell lines b Heavy subunits of 

hetero-meric 

SLC3a1 

various based on 

“partner” 

SLC43a3 putative between cell lines b SLC3a2 various based on 

“partner” 

N SLC38a3 Ala, Asn, Gln, His not checked Not in a system SLC6a7 Pro not checked 

SLC38a5 Gln, Asn, His, Ser both d SLC6a17 neutral a.a. not checked 

SLC7a13 Asp, Glu not checked 

SLC12A8 putative not checked 

The “Expression/Type of regulation” column refers to our results for the CHO cell lines described in the materials & methods section: a low levels-refers to 

fractional copies per cell; b regulation between cell lines-refers to regulation significantly higher than two fold at least at a time point between the different cell 

lines presented; c regulation within cell culture-refers to differential expression (significantly higher than two fold) at least at a time point within cell culture of a 

given cell line; d both types of regulation-refers to a gene presenting both b and c as discussed previously. 

low a 

both d 

subject to different expression profiles among mammalian cells and are 

grouped into more than 18 systems, based on sequence homology and 

function. 

To our knowledge, there is no comprehensive study of a.a. transporters in 

industrially relevant CHO cells in the literature. To that direction, a.a. 

transporter genes were profiled during batch culture of three CHO cell lines 

with varying levels of productivity. In parallel, the intra- and extracellular 

levels of a.a. were quantified. 

Materials and methods: Three cell lines were kindly donated by Lonza 

Biologics. GSn8 cell line was transfected with an empty glutamine synthetase 

(GS) vector. GS35 and GS46 cell lines were both transfected with a GS vector 

that also carries the heavy and light chains of a chimeric IgG4 antibody. The 

specific productivity of cell line GS46, quantified by a commercial ELISA kit 

(Bethyl laboratories, US), is approximately double that of GS35 one. 

Batch cultures were performed in triplicate in 1L Erlenmeyer flasks with a 

working volume of 300mL in CD-CHO medium (Invitrogen, UK) supplemented 

with 25 μM MSX (Sigma, UK). Viable cell concentration was 

determined daily using the trypan blue dye exclusion method. 

40 a.a. transporters were studied in all cell lines using real time 

quantitative reverse transcription polymerasechainreactiononsamples 

from different phases of batch culture. Samples were collected at day 4 

(exponential phase) and day 6 & day 7 (stationary phase) of the growth 

curve for all cell lines (samples were also taken at day 3 for IgG4 producers 

only and day 9 for the null cell line only). Results are reported against the 

housekeeping gene “actb”. Housekeeping genes “vezt” and “hirip3” were 

also well correlated. 

The extracellular and intracellular a.a. profiles were monitored daily using 

high performance liquid chromatography (PicoTag, Waters, UK). Intracellular



Page 129 of 151 

samples were quenched with 0.9% w/v NaCl and extracted with a 50% 

aqueous acetonitrile solution, as described in [3]. 

Results: The results (Table 1) reveal that ~30% of transporters are lowly 

expressed (fractional copies per cell), 9% are below levels of detection, 

whereas 40% are significantly differentially expressed either during batch 

cell culture, or between cell lines, or both. The remaining transporters 

appear to remain stable. 

Regulation within culture: The majority of the transporters are found to 

be upregulated at stationary phase for all cell lines, as also presented in 

Figure 1, where a mapping of a.a. metabolism and transport has been 

illustrated for the null cell line. Specifically, five genes encoding for 

transporters of a.a. relating to the glutathione (GSH) pathway were found 

to be upregulated significantly higher than 2 fold at stationary phase, 

when compared to exponential phase for all cell lines. These genes were: 

slc1a4 (Ala and Cys), slc6a9 (Gly), slc1a2 (Glu and Asp), slc7a11 (Cystine and 

Glu), and heteromeric transporter slc3a2 which partners with slc7a11. GSH 

is a well-known marker of oxidative stress [4], high levels of which have 

been associated with high productivity [5]. 

Regulation between cell lines: In their majority, genes were found to be 

upregulated for protein producing cell lines at all time points. Genes whose 

expression is upregulated significantly (two-fold or higher) in the proteinproducers 

at all time points analyzed were: slc43a2 (system L, leucine and 

branched-chain a.a.) and slc1a2 (system X - AG, glutamate and aspartate). 

However, no genes, apart from slc6a6 (taurine and b-Ala), were found to be 

differentially expressed between high (GS46) and low producer (GS35). We 

find slc6a6 gene differentially expressed early in cell culture (day 3), which 

makesushypothesizethatthegenecould be a candidate for selection 

purposes. The overexpression of this gene in CHO cells has been found to 

significantly enhance growth and productivity [6]. 

Feeding strategy based on order of feeding: The a.a. transporters gene 

expression findings correlate well with the extracellular and intracellular 

concentration profiles of their respective substrates (Figure 1). By analysing 

the differentially expressed genes for a specific cell line a feeding strategy 

can be designed. For example, we find transporter slc7a5, of system L, 

highly upregulated at stationary phase for the null cell line (Figure 1). This 

transporter exchanges an intracellular neutral a.a. with an extracellular 

Figure 1(abstract P97) A map associating the differentially expressed amino acid transporters for the null cell line, their amino acid substrates, 

and the intracellular concentrations (femtomol/cell, in the area designated by the “IN” tag) and extracellular concentrations (mM, in the area 

designated by the “OUT” tag) of the latter. A.a. transport is highlighted by the black box. The expression of the mRNA levels of the differentially 

expressed a.a. transporters (in mRNA copies per cell) at different phases of cell culture, exponential (day 4), stationary (days 6 & 7), and decline (day 9) is 

displayed at the bottom, where stationary phase samples are averaged, since not statistically different (for ease of statistical analysis visualization). The 

relevant energy utilisation mechanisms of each system are also depicted (top). Genes: slc6a9 (glycine), slc1a2 (acidic a.a.), slc7a7 (basic and branched chain 

a.a.) and its heteromeric transporter slc3a2 were also found to be differentially expressed, but are not presented in this figure. Our chosen a.a. analysis 

method was not able to quantify cysteine (L-Cys) levels.



Page 130 of 151 

branched chain one (isoleucine, leucine, valine). Branched chain amino acids 

are associated with the mTor signalling pathway, essential regulator for 

many physiological roles in mammalian cells [7]. Hence, a feeding strategy 

can be proposed, where neutral amino acids are fed first and followed by 

branched chain amino acids, in order for them to be more effectively 

uptaken. A similar type of pre-conditioning was found to significantly 

enhance cellular protein production in another type of mammalian cells [7]. 

Conclusions: Glutathione pathway associated a.a. transporters (slc1a2, 

slc1a4, slc6a9, slc7a11/slc3a2) can be targeted as genetic engineering 

targets, since are all found highly upregulated at stationary phase of cell 

culture. Additionally, transporters slc1a2, slc43a2 are associated with rprotein 

productivity, since all of them are found to be upregulated for producing 

cell lines vs the null. Gene slc6a6, carrying taurine and b-alanine, can be 

associated with high productivity (as also suggested in [6]), as was also 

found to be differentially expressed in the high vs the low producer early in 

cell culture. A feeding strategy can be proposed, based on our results that 

remains to be tested experimentally. Finally, extending this integrative 

approach to the proteome level would help link regulation at the 

transcriptomic level to actual differences in transport capability. 

Acknowledgements: S.K. would like to thank EPSRC & iChemE for 

financialsupport.K.P.wouldliketothankRCUKandC.K.thanksRCUK& 

Lonza Biologics for their Fellowships. 

References 

1. Kyriakopoulos S, Kontoravdi C: Analysis of the landscape of biologicallyderived 

pharmaceuticals in Europe: Dominant production systems, 

molecule types on the rise and approval trends. European journal of 

pharmaceutical sciences: official journal of the European Federation for 

Pharmaceutical Sciences 2012, 48:428-441. 

2. Hediger MA, Romero MF, Peng JB, Rolfs A, Takanaga H, Bruford EA: The 

ABCs of solute carriers: physiological, pathological and therapeutic 

implications of human membrane transport proteins - Introduction. Pflug 

Arch Eur J Phy 2004, 447:465-468. 

3. Dietmair S, Timmins NE, Gray PP, Nielsen LK, Kromer JO: Towards 

quantitative metabolomics of mammalian cells: Development of a 

metabolite extraction protocol. Anal Biochem 2010, 404:155-164. 

4. Selvarasu S, Ho YS, Chong WPK, Wong NSC, Yusufi FNK, Lee YY, Yap MGS, 

Lee DY: Combined in silico modeling and metabolomics analysis to 

characterize fed-batch CHO cell culture. Biotechnol Bioeng 2012, 

109:1415-1429. 

5. Chong WP, Thng SH, Hiu AP, Lee DY, Chan EC, Ho YS: LC-MS-based 

metabolic characterization of high monoclonal antibody-producing 


6. Tabuchi H, Sugiyama T, Tanaka S, Tainaka S: Overexpression of Taurine 

Transporter in Chinese Hamster Ovary Cells Can Enhance Cell Viability 

and Product Yield, While Promoting Glutamine Consumption. Biotechnol 

Bioeng 2010, 107:998-1003. 

7. Nicklin P, Bergman P, Zhang BL, Triantafellow E, Wang H, Nyfeler B, 

Yang HD, Hild M, Kung C, Wilson C, et al: Bidirectional Transport of Amino 

Acids Regulates mTOR and Autophagy. Cell 2009, 136:521-534. 

P98 

Optimized platform medium and feed for rCHO cell lines using the 

CHEF1® expression system 

William Paul 1* , Raymond Davis 2 , Andrew Campbell 1 , Sarah Terkildsen 2 , 

Vann Brasher 2 , James Powell 2 , Blake Engelbert 2 , Howard Clarke 2 

1 Life Technologies Corporation (PD-Direct® Bioprocess Services), 3175 Staley 

Road, Grand Island, NY, 14072 USA; 

2 CMC Biologics, 22021 20th Avenue SE, 

Bothell, WA, 98021 USA 

E-mail: william.paul@lifetech.com 


Chinese Hamster Ovary (CHO) cells are widely used in biomanufacturing and 

biomedical research to produce proteins of clinical significance. The 

environment the cells grow in to produce these proteins is complex and 

varies across the industry. One key variable in production processes is the 

cell culture medium used. Media can include chemically-defined components 

such as amino acids, vitamins, lipids, metal salts, and buffers. In addition, 

undefined components such as proteins, serum, or hydrolysates may be 

added. To reduce complexity, increase consistency, and comply with 

increasing demands from regulatory entities, chemically-defined formulations 

are preferred and can be developed and optimized for a given cell line. 

While a medium and feed can be optimized for every cell line/clone, 

developing a platform system provides a cost-effective option while ensuring 

a high level of growth and productivity. 

In this collaboration, between Life Technologies PD-Direct® and CMC 

Biologics, a single animal origin-free, hydrolysate-free base platform medium 

and three synergistic feed media were developed for use with recombinant 

CHO cell lines engineered using the CHEF1® expression system to produce 

monoclonal antibodies. The CHEF1 expression system utilizes regulatory 

domains from the Chinese hamster elongation factor 1 (EF1a) gene to drive 

production of heterologous proteins [1]. Serum-free, suspension adapted 

CHO DG44 cells were transfected with CHEF1 plasmids harboring 2 different 

IgG1 MAb genes and used as test cell lines to develop a platform feed 

system. A cell culture production platform system (CHEF1, base medium, 

feed media) was developed and optimized using two cell lines that were 

previously grown in an undefined culture system. The new platform growth 

system developed here, showed an average 1.6 fold improvement in titer 

for the two cell lines compared to the performance using the undefined 

culture system. 

Using Design of Experiment (DOE) methods, we performed a Feed 

Mixtures experiment and a 2-Level Categoric experiment in shake flasks 

(culture parameters are shown in Table 1). Cell counts and viabilities were 

determined using a Cedex AS20 automated cell counter (Innovatis Inc.). 

Product titer was measured by Protein A HPLC. Performance data from 

the Feed Mixtures experiment were analyzed using Design Expert® (Stat- 

Ease®). Select spent media samples from the best performing Feed 

Mixtures conditions were analyzed for glucose, amino acids and select 

water-soluble vitamins using immobilized enzyme (YSI Life Sciences), 

UPLC (Waters AccQ-Tag - reverse phase with UV detection) and HPLC 

(ion-pair reverse phase using a UV detection), respectively. The Feed 

mixtures data were used to calculate nutrient consumption rates, which 

in turn were used to develop 3 balanced feeds (at neutral pH). A separate 

Feed Supplement (at high pH) was designed to facilitate delivery of 

components that were needed at levels above solubility limits in a 

neutral solution. These feeds and the Feed Supplement were then tested 

in a 2-Level Categoric experiment, evaluating feed volume, feed schedule, 

and the feed supplement. Performance data from this experiment were 

analyzed using Design Expert. Select spent media samples from the best 

performing conditions were analyzed for glucose, amino acids and select 

water-soluble vitamins. These data demonstrated that the three feeds 

were balanced and, when the feed supplement was included, provided 

nutrients at levels sufficient for continued growth/productivity. The best 

performing feed system (balanced feed [BF1] and feed supplement [FS]) 

was used in a bioreactor confirmatory experiment (culture parameters 

shown in Table 1). In addition, a day 0 feed was designed (BF5 - included 

recombinant growth factors) and tested in the bioreactor. 

Supplementing BF5 at 3% (v/v) prior to inoculation and feeding 4%BF1 on 

day4,5%onday6,3%onday8,2%onday10,and1%(v/v)ondays12 

and 14 and FS at 0.2% (v/v) on alternate days starting on day 3 provided 

an environment for both cell lines that resulted in productivity superior to 

the control condition; cell line #1 reached 1.1 gm/L (control = 0.5 gm/L) 

and cell line #2 reached 2.0 gm/L (control = 1.6 gm/L). 

Since the cost of dry format media is more economical than liquid media at 

GMP scale, the feeds were converted from liquid format to dry formats; BF1 

was converted to Advanced Granulated Technology (AGT) format and the 

Feed Supplement was converted to a dry powder media (DPM). Once 

hydrated, these feeds were tested to confirm equivalency, achieving similar 

growth and productivity patterns as their liquid counterparts. Additionally, 

these feeds have been concentrated to reduce the dilution effect that many 

commercial feeds produce, resulting in an approximate 76% reduction in 

feed volume added over the life of the culture (Figure 1). This is a significant 

reduction in the volume of fluid requiring in-process handling and 

downstream processing; saving time, equipment, and money. This feed 

system development collaboration yielded a 112% improvement (over the 

control condition) in product titer for cell line #1 and a 25% improvement in 

product titer for cell line #2 (Figure 1). The base medium and the newly 

developed final feed system provide an animal origin-free, hydrolysate-free 

growth environment. For the purposes of many commercial cGMP 

processes, this culture system provides an economical solution. Addition of 

a proprietary undefined feed (CMC Biologics), prior to inoculation, on top of 

this balanced feed system has been shown to boost productivity by about 

15% over using just the balanced feed system. Next steps include evaluating 

protein quality and validating at production scale.



Page 131 of 151 

Table 1(abstract P98) Culture Parameter Conditions and Set-Points 

Parameters 

Shake Flask/Culture Volume 125 mL vented Erlenmeyer 30 mL working volume 

Bioreactor/Culture Volume 3 L single-use CellReady bioreactor 2 L working volume 

Seeding Density 

5x10 5 viable cells/mL 

Temperature 37°C ± 0.5°C (days 0 - 4) 34°C ± 0.5°C (day 5 - end) 

CO 2 Level (Shake Flask) 6% ± 1% (days 0 - 4) 2% ± 1% (day 5 - end) 

pH (Bioreactor) 7.0 ± 0.2 

RPM (Shake Flask) 120 ± 5 

RPM (Bioreactor) 200 ± 10 

Dissolved Oxygen (Bioreactor) 60% ± 5% 

Reference 

1. Running Deer J, Allison DS: High-Level Expression of Proteins in 

Mammalian Cells Using Transcription Regulatory Sequences from the 

Chinese Hamster EF-1a Gene. Biotechnol 2004, 20:880-889, Prog. 

P99 

Profiling of glycosylation gene expression in CHO fed-batch cultures in 

response to glycosylation-enhancing medium components 

Ryan Boniface 1* , Jeoffrey Schageman 2 , Brian Sanderson 2 , Michael Gillmeister 1 , 

Angel Varela-Rohena 1 , John Yan 3 , Yolanda Tennico 3 , Shawn Barrett 1 , 

Robert Setterquist 2 , Stephen Gorfien 1 

1 Life Technologies Corporation, 3175 Staley Road, Grand Island, New York, 

USA, 14072; 

2 Life Technologies Corporation, 2130 Woodward, Austin, Texas, 

USA, 78744; 

3 Life Technologies Corporation, 29851 Willow Creek, Eugene, 

Oregon, USA, 97402 

E-mail: Ryan.Boniface@lifetech.com 


Introduction: Characterization of the glycosylation profile of a recombinant 

protein product is an important part of defining product quality in the 

bioproduction industry. Development of a protein with desired characteristics 

would require the capacity to modify and target specific glycosylation 

patterns as well as an understanding of the implications of changes to these 

glycosylation profiles. Previous cell culture studies have demonstrated the 

ability to modulate glycan profiles without negative impact to culture growth 

and product titer through the addition of glycosylation-enhancing medium 

components. With new methods, including increased measurement 

sensitivity and new capabilities in RNA-Seq technology, it is possible to 

develop a glycosylation gene expression profile for CHO cells. Specific 

glycosylation genes can then be tracked to ensure that the addition of these 

compounds will not negatively impact gene expression. Analyses comparing 

growth and titer, glycan distribution, and transcriptome differences can 

present us with potential insight into what changes are taking place on a 

genetic level in the cell in response to changes in medium and culture 

conditions. 

Materials and methods: (All Materials were from Life Technologies unless 

otherwise indicated) 

Cell culture: CHO-S® and DG44 derived recombinant cells expressing the 

same IgG molecule were grown in CD FortiCHO medium supplemented 

with 4mM L-glutamine and 1:100 Anti-Clumping Agent. 

Fed-batch bioreactor: DASGIP bioreactor with 500mL initial working 

volume seeded at 0.3x10 5 viable cells/ml in CD FortiCHO medium. 10% CD 

EfficientFeed C (EFC) feeding on days 3, 5 and 7 for CHO-S® cultures, and 

feedingondays4,6and8forDG44cultures. Glucose concentration was 

maintained above 3g/L. Component A and/or component B were added on 

thefirstdayoffeeding(day3forCHO-S®andday4forDG44cultures). 

Culture conditions were maintained as follows; pH 7.0 +/- 0.05, 50% DO, 37°C, 

110 rpm. Cell densities and viabilities were measured using a Vi-CELL® 

counter (Beckman Coulter). Metabolites (glucose, ammonia, lactate) and IgG 

were measured using a Cedex® Bio HT Instrument (Roche). 

Glycan analysis: Protein supernatant samples were collected and purified 

using POROS® MabCapture® A resin. Samples glycan profiles were analyzed 

on an Applied Biosystems® 3500 Series Genetic Analyzer. 

Transcriptome analysis: RNA was extracted at several time points during 

the culture. A total of 174 potential glycosylation specific gene targets were 

Figure 1(abstract P98) Summary of Optimization Collaboration - Improved titer by 112% (cell line #1), by 25% (cell line #2), and reduced volume 

fed by 76%.



Page 132 of 151 

identified and primers designed to these using reference sequences from 

Chinese hamster ovary, mouse, rat and human. A total of 34 samples were 

multiplexed on a Proton PI chip on the Ion Torrent PGM. 

Results and discussion: The use of components A and B with CHO-S® cells 

in CD FortiCHO medium causes a considerable increase in the level of 

galactosylation of the recombinant IgG (Figure 1) as shown by the shift in 

the glycosylation profile from G0F to G1F and G2F. The use of targeted 

transcriptome analysis revealed that the changes observed in the 

glycosylation profile do not translate to noticeable differences in the 

expression levels of the glycosylation genes. There are changes in gene 

expression levels with culture age but they are not altered by the additions 

of components A and/or B. It was originally theorized that components A 

and B could act as cofactors or substrates within the glycosylation enzymatic 

pathways but this could not be confirmed without an understanding of the 

glycosylation gene profile. The changes in the glycosylation patterns 

combined with the absence of changes in the gene expression data lend 

support to this theory. With this information it is apparent that the additions 

of the glycosylation-enhancing components A and B can increase 

galactosylation of recombinant proteins with no negative effect on growth, 

titer or glycosylation gene expression. 

The comparison between CHO-S® and DG44 cultures without supplementation 

with components A or B revealed the DG44 culture had better 

galactosylation with increased proportions of G1F and G2F. Both cell lines 

express high levels of DDOST, RPN1, DAD1 and SST3A which are all part of 

the oligosaccharyltransferase complex which catalyzes the transfer of high 

mannose oligosaccharides from lipid-linked oligosaccharide donors to the 

asparagines on the Asn-X-Ser/Thr of the polypeptide chain. The DG44 cells 

differ from the CHO-S® cells with increases in: ALG2, ALG3, ALG9 and ALG12 

Figure 1(abstract P99) Glycan analysis data measured as the percentage of total glycans. (A) The glycan profile for the CHO-S® culture with no 

addition of components A and/or B. (B) These data indicate that the addition of component A to the culture results in very little change to the glycan 

profile, only slight increase in the percent of G1F on days 5 and 7. (C) The addition of component B to the culture shifts the glycan profile from primarily 

non-galactosylated G0F to increased G1F (single galactose) and G2F (two galactose) glycoforms. (D) The addition of both components A and B results in 

a change in galactosylation indicated by the increase in both G1F and G2F and an overall reduction of G0F. In every condition, G0F increases with time 

but this is minimized with the addition of both components A and B. The majority of protein glycoforms within this experiment are fucosylated and the 

addition of components A and/or B does not appear to alter this.



Page 133 of 151 

(mannosyltransferases), ALG8 and ALG10 (glucosyltransferases), ALG14 

(acetylglucosaminyltransferase), and B4GALT5 (galactosyltransferase). These 

increases in gene expression in DG44 cells seem to coincide with the higher 

galactosylation profiles observed in the glycan analysis. 

Conclusions: Differences in growth, titer and glycoform distribution were 

observed between CHO-S® and CHO DG44 cells. DG44 cells had higher 

expression of glycosylation transferase genes compared to CHO-S® cells. 

Components A and B had synergistic effects on terminal galactosylation 

(Figure 1), showed no changes in gene expression and could be acting as 

cofactors/substrates with glycosylation enzymes. 

Acknowledgements: The Austin team (Natalie Hernandez, Laura 

Chapman, Angie Cheng, Lea Kristi and Daniel Williams) for library 

preparation and transcriptome analysis. 

P100 

How to assess chemically defined media and feeds from 9 suppliers on 

CHO cells producing mAb 

Aurore Polès-Lahille * , Margaux Paillet, Aurélie Da Silva, Nora Kadi, Eric Basque, 

Flavien Thuet, David Balbuena, Sébastien Ribault 

Merck Biodevelopment, Martillac, France, 33650 

E-mail: aurore.lahille@merckgroup.com 


Introduction: Mammalian cell culture medium development has widely 

evolved in recent years. The use of hydrolysates as serum replacement 

has led to process variability due to lot-to-lot variations. The undefined 

composition of these media could also increase the process optimization 

timelines, sometimes with limited impact on process performances. With 

the reduction of process development activities for preclinical and Phase I 

studies, medium and feed platforms raised. The objective of the media 

was to ensure cell growth only in order to go as fast as possible to 

production bioreactors while the feeds were responsible for productivity 

and production length. Either companies spent several months if not 

years to develop their own generic medium and feed platforms or they 

used commercial ones, sometimes under licenses. The medium and feed 

platform assessment also started earlier in the product development 

process. Clone screening was performed more and more in fed-batch 

conditions rather than batch ones. Thus screening tools, scale-down 

models of bioreactors, with lower and lower working volumes were 

designed. Another cell culture process evolution was the development of 

new expression systems without any selection agents. In order to assess 

our screening scale-down model, between 20 to 35 chemically defined 

platforms from 9 suppliers were screened with 3 CHO host cell lines/ 

expression systems. 

Methods: The following protocol was followed for 3 different CHO cell 

lines producing mAb: 

- CHO host cell 1 - expression system n°1 : mAb I 

- CHO host cell 1 - expression system n°2 : mAb II 

- CHO host cell 2 - expression system n°3 : mAb III 

Each medium was prepared, supplemented according to cell requirements, 

0.2 μm PVDF filtrated and stored into at least 2 separated bottles. A sterility 

test was performed on each bottle before use. Each cell line was thawed 

and amplified during at least one week in its usual medium. Then the cells 

were adapted to each medium for at least 8 passages in either 125 mL 

shake flasks or 50 mL spin tubes in duplicate. Each media was preheated at 

37°C before use and one bottle was used per duplicate in order to reduce 

contamination risk. After cell adaptation, fed-batch platform assessment was 

performed in 50 mL spin tubes at 37°C with a seeding density around 0.25 * 

10 6 viable cells/mL. Every 2 to 3 days, samples were taken to measure pH, 

pO 2 ,pCO 2 , viable cell density, viability, glucose and lactate levels. The 

feeding strategy applied was the same for each cell line and agreed with 

each supplier. The cultures were stopped when the viability was below 60% 

or after 16-17 days. 

Results: The objective of cell culture media is to sustain cell growth in order 

to quickly seed the production bioreactor. Here are the doubling times 

measured on the 3 cell lines (Table 1). 

Despite having the same host cell, cell growth was different between 

mAb I and mAb II. The expression system could have a significant impact 

Table 1(abstract P100) Doubling time of each cell line in 

each medium after adaptation 

mAb I mAb II mAb III 

Cellvento CHO-200 medium 20 h 32 h 17 h 

Supplier A medium 1 23 h 35 h 23 h 



Supplier B medium 1 21 h 20 h 18 h 

Supplier B medium 2 24 h 66 h 24 h 

Supplier C medium 1 26 h 18 h 20 h 

Supplier C medium 2 22 h 18 h 18 h 

Supplier D medium 1 21 h 19 h 18 h 

Supplier E medium 1 26 h 35 h 28 h 

Supplier E medium 2 23 h 20 h 19 h 

Supplier F medium 1 21 h 26 h 17 h 

Supplier G medium 1 21 h 20 h 18 h 

Supplier G medium 2 

19 h 


21 h 


19 h 

Supplier H medium 1 

21 h 

Supplier H medium 2 

21 h 

on cell growth behavior. In order to separate the different platform 

results, a color was assigned to each supplier and platform assessed 

(Figure 1). 

Depending on the CHO host cell and the expression system, each platform 

had different performances. Some platforms seemed to be more robust 

than others in terms of final titer. The lactate metabolism was also 

compared between the different platforms. Most of the platforms had a 

maximum lactate concentration measured around 1 - 1.5 g/L. Some 

platforms went above 2 g/L of lactate, which could be difficult to scale-up 

in bioreactors. The practical aspect was also studied as it can facilitate the 

implementation and the tech transfer. Some platforms assessed had 2 

feeds added everyday while others only had 1 feed added 3 times. 

Molecule quality was also compared between platforms in terms of High 

Molecule Weight and cIEF. 

Conclusions: We have implemented a strong protocol for medium and 

feed screening with up to 70 spin tubes manipulated in parallel. More than 

3000 sterile manipulations were performed under a laminar flow without 

any contaminations. These experiments allow us to define robust platforms 

in terms of cell growth, productivity and metabolism on different CHO host 

cell lines and expression systems. 

P101 

Evaluation of single-use bioreactors for perfusion processes 

Aurore Polès-Lahille * , Flavien Thuet, David Balbuena, Sébastien Ribault 

Merck Biodevelopment, Martillac, France, 33650 

E-mail: aurore.lahille@merckgroup.com 


Introduction: Single-Use Bioreactors are now commonly used for Process 

Development activities, as seeding bioreactors or to produce Drug 

Substances. The advantages of this equipment have been well demonstrated 

over the last years on batch/fed-batch processes. Continuous 

processes were widely applied in the past to increase the overall 

productivity of small bioreactors or for sensitive molecule production. The 

process control, contamination risk and complexity were the main concerns 

of this operation mode. However, the bioprocessing trends and technology 

evolution led to reconsidering the perfusion processes. The aim of this study



Page 134 of 151 

Figure 1(abstract P100) Colors assigned to each supplier. Final mAb I (top right side), mAb II (bottom left side) and mab III (bottom right side) titers 

for all platforms compared to Cellvento CHO-200 medium. 

was to combine standard single-use bioreactors with different perfusion 

technologies and to compare productivity and molecule quality. 

Methods: A CHO cell line producing a mAb was thawed and amplified in 

shake flasks using Cellvento CHO-100 medium. When a sufficient 

amount of cells was reached, 2 Mobius® CellReady 3L bioreactors were 

launched in parallel: one in batch mode and one in perfusion mode 

using Cellvento CHO-100 medium. Two perfusion technologies were 

assessed: the Fibra-Cel® Disks (Eppendorf) and the Alternative Tangential 

Flow (Refine) ones. The Mobius® CellReady 3L bioreactor was not 

modified to perform perfusion processes aseptically transferred into a 

Mobius® CellReady 3L bioreactor through the probe port. Regarding the 

ATF technology, an ATF-2 system was first washed with water then 

autoclaved and welded to the harvest line of a Mobius® CellReady 3L 

bioreactor. The bioreactor conditions were 37°C with pH maintained 

between 6.80- and 7.10. The Dissolved Oxygen set point was 50% and 

stirrer speed 104 rpm. The viable cell density, viability, metabolism and 

titers were measured at least daily. The perfusion was initiated at 0.5 vvm 

when the lactate was above 0.5 g/L and increased daily based on glucose 

and lactate levels up to 1 vvm for the Fibra-Cel ® technology and up to 

2 vvm for the ATF one. In order to increase the oxygen transfer at high 

cell density, a decision tree was applied. For the Fibra-Cel® technology, 

the mAb was collected in harvest bags welded to a side port while for 

the ATF, the molecule remained inside the Mobius® CellReady 3L 

bioreactor with the use of a 50 kDa hollow fiber. In order to measure the 

quality of the mAb produced, samples were collected on day 7, day 

10 and the last bioreactor day. Titers and HCP levels were directly 

measured on harvest while SE-HPLC and cIEF were performed on ProSep® 

Ultra Plus eluates. 

Results: As expected, the cells grew on Fibra-Cel® Disks after 2 days. Thus 

only a few cells were in suspension from day 3 to day 14 (end of the 

bioreactor). Regarding the ATF technology, a maximum cell density of 

33 millions cells/mL was reached (Figure 1). 

The glucose concentration was well maintained between 5 and 6,5 g/L 

while the lactate was not above 1.5 g/L in perfusion bioreactors. A steady 

state was maintained over several days. The global productivity of each 

process mode was calculated and compared to the batch one. The 

perfusion technologies increased the mAb quantity obtained compared to 

abatchmode.TheATF technology increased the final mAb titer by 2.9 

fold and the Fibra-Cel® technology increased the mAb quantity by 1.2 fold 

(Table 1). 

The quality attributes of the mAb obtained in batch and perfusion modes 

were also compared. The molecule produced during the perfusion processes 

was more acid than the ones produced in batch and fed-batch modes. 

Therefore the mAb produced with Fibra-Cel® and ATF technologies in 

Mobius® CellReady 3L bioreactor could have a higher half-life than the 

molecule produced in batch and fed-batch modes. Regarding the Host Cell 

Proteins, Low Molecular Weight and High Molecular Weight overall contents, 

the ATF technology generates more contaminants while the Fibra-Cel® 

reduces them compared to a batch process (Table 1). Finally, the upstream 

cost to reach the ATF quantity was compared between batch and 

perfusion processes at different scales. The ATF technology can reduce 

process cost in disposable bioreactors whatever the scale compared to the 

batch mode while the Fibra-Cel® process cost is higher due to higher 

medium quantity necessary (Table 1). 

Conclusions: Without any modification of the Mobius® CellReady 3L 

bioreactor, we were able to demonstrate the compatibility of this single use 

bioreactor to a mAb perfusion process. Using two different technologies, the 

overall performances, molecule quality, contaminant level and cost were 

compared. This study demonstrates the flexibility of existing disposable 

bioreactors to new bioprocessing technologies.



Page 135 of 151 

Figure 1(abstract P101) Viable cell density in suspension in batch and perfusion processes measured in Mobius® CellReady 3L. 

P102 

Profiling and engineering of microRNAs for enhancing recombinant 

protein productivity in Chinese hamster ovary cells 

Wan Ping Loh 1* , Bernard Loo 1 , Lihan Zhou 2 , Peiqing Zhang 1 , Dong Yup Lee 1,2 

, Yuan Sheng Yang 1 , Kong Peng Lam 1 

1 Bioprocessing Technology Institute, 20 Biopolis Way, #06-01 Centros, 

Singapore 138668; 

2 Department of Biochemistry, National University of 

Singapore, 8 Medical Drive 4, Blk MD7 #05-04, Singapore 117597 


Background: Chinese hamster ovary (CHO) cells have become dominant 

host cells in the biopharmaceutical industry due to their capacity for 

proper protein folding, assembly and post-translational modifications. 

However, low specific productivity (qp) places limitations on yields 

obtained from mammalian host cells. MicroRNAs (miRNAs), a novel class of 

short, non-coding RNAs which negatively regulate target gene expression 

at post-transcriptional levels, have emerged as promising targets for 

engineering of CHO cell factories to enhance recombinant protein 

production. While engineering of miRNAs for enhanced cell growth and 

delayed cell death have been reported, miRNA targets which can enhance 

qp have not been identified to date. 

Materials and methods: To understand the role of miRNAs in conferring 

high qp phenotype in CHO cells, we carried out high throughput 

sequencing of 4 in-house generated IgG-expressing CHO sub-clones of 

varying qps. Reads were mapped to miRBase and 22 miRNAs were found to 

be differentially expressed between the high and low producers. These 

miRNAs were stably transfected into an IgG-expressing sub-clone to assess 

their effects on growth, titer, qp and product quality attributes. 

Results: Over-expression of miRs-17, 19b, 20a and 92a individually and in 

combination resulted in 13-27% increases in titer and 14-24% increases in 

qp in stably transfected pools. No significant alterations in proliferation rates 

were observed. 20-45 single cell clones were randomly selected from each 

of the 5 transfected pools for characterization. Statistical analyses showed 

significant differences in titer/qp between the high- and low-miRNA 

expressing single cell clones. The highest producing single cell clones 

exhibited ~100% increases in titer and qp compared to non-transfected 

cells. A correlation was found between increased miR-19b levels (>1.3-fold) 

and enhanced qp and titer. Over-expression of miR-19b does not appear to 

impact IgG aggregation significantly. 

Table 1(abstract P101) Global productivity, Host cell Proteins, High Molecular Weight and Low Molecular Weight contents 

in perfusion processes compared to batch ones reached in Mobius® CellReady 3L bioreactor in addition to upstream cost 

to reach ATF mAb quantity, in perfusion processes compared to batch one in Mobius® CellReady Family 

Batch mode Fibra-Cel® technology ATF technology 

Final Titer 100% 121% 290% 

Host Cell Proteins 100% 28% 144% 

High Molecular Weight 100% 87% 198% 

Low Molecular Weight 100% 68% 107% 

Upstream cost at 3L GLP Scale 100% 108% 47% 

Upstream cost at 50L GLP Scale 100% 175% 84% 

Upstream cost at 200L GMP Scale 100% 134% 47%



Page 136 of 151 

Conclusions: To our knowledge, this is the first report of enhancement 

of recombinant protein productivity by stable miRNA over-expression. 

The genes and cellular pathways targeted by these miRNAs specific to 

enhancing protein productivity are under investigation and will be 

reported. 

Acknowledgements: This work was supported by the Biomedical 

Research Council/Science and Engineering Research Council of A*STAR 

(Agency for Science, Technology and Research), Singapore. The authors 

would like to thank Faraaz Noor Khan Yusufi, Ju Xin Chin for their 

assistance in processing of next-generation sequencing data, and Corrine 

Wan, Gavin Teo, Daniel Chew, Lyn Chiin Sim, Ce Huang Poo and Kong 

Meng Hoi for their technical assistance in IgG purification, aggregation 

and glycosylation analyses. 

P103 

Designing clinical-grade integrated strategies for the downstream 

processing of human mesenchymal stem cells 

Bárbara Cunha 1,2 , Margarida Serra 1,2 , Cristina Peixoto 1,2 , Marta Silva 1,2 , 

Manuel Carrondo 2,3 , Paula Alves 1,2* 

1 Instituto de Tecnologia Química e Biológica, Universidade Nova de Lisboa, 

Av. da República, 2780-157 Oeiras, Portugal; 

2 iBET, Instituto de Biologia 

Experimental e Tecnológica, Apartado 12, 2780-901 Oeiras, Portugal; 

3 Departamento de Química, Faculdade de Ciências e Tecnologia, 

Universidade Nova de Lisboa, 2829-516 Monte da Caparica, Portugal 

E-mail: marques@itqb.unl.pt 


Background: During the past decade, human stem cells have been the 

focus of an increased interest due to their potential in clinical applications, 

as a therapeutic alternative for several diseases. Within this context, human 

mesenchymal stem cells (hMSCs) have gained special attention due to 

their immune-modulatory characteristics, as well as in secreting bioactive 

molecules with anti-inflammatory and regenerative features [1]. 

In order to face the high demands of hMSCs (from 10 5 to 10 9 cells 

per patient) [2] to be used in therapies, the establishment of robust 

manufacturing platforms that can ensure the efficient production, 

purification and formulation of stem cell-based products is still a challenge. 

Although substantial efforts have been performed on the development of 

clinical-grade bioprocesses for the expansion of hMSCs in microcarrier-based 

stirred culture systems, the incorporation of downstream strategies that 

assure efficient cell-bead separation and consequent hMSC concentration 

(i.e. volume reduction) and washing is required to deliver safe hMSCs to the 

clinic [3,4]. 

Therefore, the main aim of this work was the design of integrated 

methodologies (filtration and membrane technology approaches) [5] for the 

robust and clinical-grade downstream processing of hMSC. 

Materials and methods: Cell culture: hMSCs (STEMCELL Technologies) 

were cultivated in IMDM supplemented with 10% of fetal bovine serum 

(FBS) or in MesenCult®-XF Medium (STEMCELL Technologies) supplemented 

with 2 mM L-glutamine (Life Sciences) at 37°C in a humidified 

atmosphere of 5% CO 2 , according to manufacture recommendations. These 

cells were routinely propagated in static conditions (T-flasks) or on 

microcarriers (SoloHill Engineering, Inc) using stirred culture systems 

(spinner vessels and bioreactors). Cell concentration and viability were 

determined by counting the cells in a hemacytometer using the standard 

trypan blue exclusion method. 

Cell characterization and quality control tests: Standard procedures for the 

analysis of cell surface markers (CD90, CD73, CD45, CD34) using flow 

cytometry tools, as well as cell-based assays for the evaluation of cell 

proliferation capacity (CFU assay - colony-forming unit) and differentiation 

potential (differentiation into osteoblasts and adipocytes) were performed, 

following the manufacturer’s recommendations. 

Downstream processing: After harvesting, the microcarriers were removed 

from the cell suspension using nylon filters (Millipore) with different pore 

sizes (100, 80 and 30 μm). The clarified cell-based materials were 

concentrated by tangential flow filtration (TFF) using polysulfone hollowfiber 

cartridges with 0.45 μm pore size. 

Results: Over the past years, as scale-up platforms for the biomanufacturing 

of hMSCs become robust enough to yield high cell quantities to support 

cell-based therapies, culture media supplemented with FBS are becoming 

less used. This requirement is in line with what is advised by regulatory 

agencies, due to the main drawbacks associated to the use of FBS, such as 

the variability between different lots and suppliers and the risk of 

contamination with animal pathogens, which may trigger an immune 

response upon MSC therapy [5]. Within this context, large efforts have been 

made towards the development of serum- and xeno- free culture medium 

formulations for the expansion of hMSC. Thus, on a first approach, we 

evaluated the feasibility of propagating hMSCs in a serum- and xeno-free 

culture medium, the MesenCult®-XF medium, and further compared cell 

growth profile with standard medium formulation (e.g. IMDM + 10% FBS). 

Our results showed that, hMSC can be successfully expanded in MesenCult®- 

XF medium, presenting a constant population doubling length (PDL) of 

approximately 2 in each cell passage and a cumulative PDL of 12.5 in a total 

of 42 days (Figure 1A). Moreover, hMSCs showed an accelerated cell growth 

and increased lifespan when compared to the hMSC cultivated in standard 

culture medium supplemented with FBS where hMSCs presented limited 

proliferation capacity (Figure 1A). This was an expected outcome since 

MesenCult®-XF medium was design to enhance hMSC expansion from 

primary human bone marrow and cultured-expanded cells, leading to longterm 

cultures. It is important to mention that hMSCs maintained 

their characteristics after expansion in MesenCult®-XF medium, namely 

immunophenotype, proliferation capacity and multipotency (results not 

shown). 

After the expansion of hMSCs in microcarrier-based stirred culture systems, 

different downstream strategies were evaluated for the purification of 

hMSCs. First, the clarification step was carried out to remove the 

microcarriers from the cell suspension. For this purpose, nylon filters were 

used and the effect of the mesh pore size on cell recovery yields and 

viability was evaluated. Our results showed that nylon is a suitable material 

for the clarification step since it ensured efficient removal of microcarriers 

(no beads were detected after filtration processing) without compromising 

cell viability (Figure 1B). Moreover, we demonstrated that higher mesh 

pore sizes yielded higher cell recoveries (Figure 1B). 

For the cell concentration and volume reduction step, preliminary 

experiments were performed with human foreskin fibroblasts (Figure 1C). 

With this cellular system, a concentration factor (in volume) of 10 times was 

successfully achieved using TFF processes, yielding 70-80% of recovered 

cells with high viabilities (Figure 1C). Process validation with hMSCs is 

ongoing but first results were encouraging since we were able to 

concentrate 2 times hMSCs while ensuring high cell recovery yields (96%) 

and viabilities (98%) (Figure 1C). In addition, hMSCs maintained their 

immunophenotype, as well as their proliferation capacity and multilineage 

differentiation potential at the end of all steps of the downstream process 

(results not shown). 

Conclusions: While upstream technologies mature to meet the increasing 

demand of hMSCs, biomanufacturing bottlenecks are now shifting towards 

the downstream processing of stem cells. This work shows our first 

approach to tackle such bottlenecks. More specifically, we demonstrate that 

standard filtration techniques and TFF systems are suitable and robust 

approaches for the downstream processing of hMSCs. Using these strategies 

we were able to ensure efficient removal of the major impurities of the 

cellular suspension (microcarriers) and further concentrate cell-based 

products up to 10 times without compromising their viability and quality. 

However, further improvements in cell concentration and polishing steps 

are still required. Nonetheless, this work provides important insights towards 

the establishment of robust and clinical-grade bioprocesses for the 

purification of hMSCs to be integrated and applied in the biomanufacturing 

of cell-based therapies. 

Acknowledgements: The authors acknowledge the NanoGene project 

(EuroNanoMed ERA-Net initiative) and the project EXPL/BBB-EBI/1003/2012 - 

“Development of a scalable strategy for stem cells purification” funded by 

Fundação para a Ciência e Tecnologia (FCT) for financial support, as well as 

MIT-Portugal program and FCT for the grant SFRH/BD/51940/2012. 

References 

1. Patel A, Genovese J: Potential clinical applications of adult human 

mesenchymal stem cell (Prochymal®) therapy. Stem Cells and Cloning: 

Advances and Applications 2011, 4:61-72. 

2. Chen A, Reuveny S, Oh S: Application of human mesenchymal and 

pluripotent stem cell microcarrier cultures in cellular therapy: 

Achievements and future direction. Biotechnology Advances 2013 in press. 

3. Serra M, Brito C, Correia C, Alves PM: Process engineering of human 

pluripotent stem cells for clinical application. Trends in Biotechnol 2012, 

30:350-359.



Page 137 of 151 

Figure 1(abstract P103) Up- and downstream processing of hMSCs. A) Growth profile of hMSC culture; profile of cumulative PDLs of hMSC cultured 

in MesenCult®-XF (blue line) or in IMDM + 10% FBS (purple line) medium along culture time. B) Microcarriers’ removal using nylon filters with different 

pore sizes (100, 80 and 30 μm). The (blue) bars represent the cell recovery yields, while the (green) line represents cell viability. C) Major outcomes 

achieved after TFF processing of human foreskin fibroblasts and hMSCs. 

4. Pattasseril J, Varadaraju H, Lock L, Rowley J: Downstream Technology 

Landscape for Large-Scale Therapeutic Cell Processing. BioProcess 

International 2013, 11:46-52. 

5. Peixoto C, Ferreira T, Sousa M, Carrondo MJT, Alves PM: Towards 

purification of adenoviral vectors based on membrane technology. 

Biotechnol Prog 2008, 24:1290-1296. 

6. Spees J, Gregory C, Singh H, Tucker H, Peister A, Lynch P, Hsu S, Smith J, 

Prockop D: Internalized antigens must be removed to prepare 

hypoimmunogenic mesenchymal stem cells for cell and gene therapy. 

Mol Ther 2004, 9:747-756. 

P104 

Culture supplement extracted from rice bran for better serum-free 

culture 

Satoshi Terada 1* , Satoko Moriyama 1 , Ken Fukumoto 1 , Yui Okada 1 , 

Rinaka Yamauchi 1 , Yoko Suzuki 1 , Masayuki Taniguchi 2 , Shigeru Moriyama 3 , 

Takuo Tsuno 3 

1 Department of Applied Chemistry and Biotechnology, University of Fukui, 

Fukui, 910-8507, Japan; 

2 Niigata University, Niigata, 950-2102, Japan; 

3 Tsuno 

Food Industrial Co., Ltd, Katsuragi-cho, Wakayama, 649-7122, Japan 



Introduction: In mammalian cell culture, fetal bovine serum (FBS) and 

proteins including albumin (BSA) have been extensively added to culture 

media as growth factor. But mammal-derived factors are potent source of 

various infections such as abnormal prion and viruses, and so alternative 

supplement is eagerly required. The alternative must be chemically defined 

or obtained from plant, as well as should be produced in commercial 

quantities and stably supplied. 

As an alternative supplement, we focused on rice bran extract (RBE), byproduct 

of milling in the production of refined white rice, because rice bran 

contains abundant nutrients and proteins [1] as well as antioxidants [2] and 

because rice is cultivated plant, indicative of huge and stable supply. 

Materials and methods: Preparation of RBE: RBE was extracted in 

alkaline solution and then precipitated with acid. The precipitate was freezedried. 

Effect of RBE on the culture of various cell lines: Mitogenic activity of 

RBE was evaluated using cell lines. Cells were cultured in ASF104 medium 

with or without RBE for several days. Then viable cell densities were counted 

by trypan-blue method and concentration of MoAb was measured by ELISA. 

Effect of RBE on the culture of MSC: Mesenchymal stem cells (MSCs) 

were isolated from male Wistar rats and expanded in purchased serum-free 

medium or conventional medium containing FBS. The expanded cells were 

transferred to differentiation medium into bone. The differentiated cells to 

bone were readily stained. Triplicated culture. 

Effect of RBE on the culture of pancreatic islets: Pancreatic islets were 

obtained from male Lewis rats and cultured in RPMI medium supplemented 

with RBE or FBS for eight days. 

Results and discussion: Effect of RBE on the culture of various cell 

lines: On growth and MoAb production of hybridoma in serum-free 

medium, desired effects of RBE were observed and the effect was superior 

to BSA. 

Similarly, serum-free culture of CHO-DP12 added with RBE exhibited 

increased cell growth and production. 

Growth of HepG2 and HeLa cells in the serum-free medium was also 

improved.



Page 138 of 151 

Together all, RBE had mitogenic activity on various cell lines. 

Effect of RBE on the culture of MSC: As primary cells, MSCs from Wistar 

rat were expanded in serum-free medium with RBE or without and then the 

medium was changed into osteoblast-inducing medium. While MSCs 

expanded in the serum-free medium lost it, the cells expanded in the 

presence of RBE retained the potency, suggesting that RBE contains 

physiologically active substances maintaining potency of differentiation 

during ex vivo serum-free culture. 

Effect of RBE on the culture of pancreatic islets: Pancreatic islets, isolated 

from Lewis rats, were also tested in the presence of RBE. While islets died 

out by one week in basal medium, islets successfully survived in the 

presence of RB. This result supports that RBE could alternate FBS in islets 

culture. 

Conclusion: RBE successfully improved the serum-free culture of four cell 

lines including hybridoma, CHO, HepG2 and HeLa, as well as primary 

culture of MSCs and pancreatic islets. These results indicate that RBE 

would be useful as culture supplement in serum-free media. 

References 

1. Adebiyi AP, Adebiyi AO, Hasegawa Y, Ogawa T, Muramoto K: Isolation and 

characterization of protein fractions from deoiled rice bran. European 

Food Research and Technology 2008, 10. 

2. Adebiyi AP, Adebiyi AO, Yamashita J, Ogawa T, Muramoto K: Purification and 

characterization of antioxidative peptides derived from rice bran protein 

hydrolysates. European Food Research and Technology 2008, 10. 

P105 

Cryopreservative solution using rakkyo fructan as cryoprotectant 

Satoshi Terada 1 , Shinya Mizui 1 , Yasuhito Chida 1 , Masafumi Shimizu 1 , 

Akiko Ogawa 2* , Takeshi Ohura 3 , Kyo-ichi Kobayashi 3 , Saori Yasukawa 4 , 

Nobuyuki Moriyama 4 

1 Department of Applied Chemistry and Biotechnology, University of Fukui, 

3-9-1 Bunkyo, Fukui, 910-8507, Japan; 

2 Department of Chemistry and 

Biochemistry, Suzuka National College of Technology, Shiroko-cho, Suzuka, 

510-0294, Japan; 

3 Fukui Prefectural Food Process, 1-1-1 Maruoka-chotubonouchi, 

Sakai, 910-0343, Japan; 

4 ELLE ROSE CO., Ltd., 4-200 

Saburoumaru, Fukui, 910-0033, Japan 

E-mail: ogawa@chem.suzuka-ct.ac.jp 


Introduction: Cryopreservation of the cells allows great flexible application 

for cell therapy, as well as industrial production of biologics such as 

antibody therapeutics. Conventionally, cryopreservative solution contains 

both of fetal bovine serum (FBS) and dimethyl sulfoxide (DMSO) as a 

cryoprotectant [1]. However, both of them have problems. FBS frequently 

induces differentiation of stem cells and so it should not be used for cell 

therapy. Additionally, FBS has serious concern about zoonotic infections 

such as abnormal prions, pathogen of bovine spongiform encephalopathy 

(BSE) [2,3], indicating necessity of FBS-free cryopreservative solution. DMSO 

has cytotoxicity and often induces stem cells to differentiate [3]. Therefore, it 

is necessary to reduce the concentration of DMSO in cryoprotectant 

solution. In this study, we report that rakkyo fructan, plant-derived 

polysaccharide, significantly improved the viability of the cells frozen in 

DMSO-free solution. 

Materials and methods: Cell line and culture condition: A mouse 

hybridoma 2E3-O [4] was used for this study. 2E3-O was cultured in ASF104 

(Ajinomoto, Tokyo, Japan) with 1 g/L bovine serum albumin (BSA, Wako 

pure chemical industries, Osaka, Japan). 

Polysaccharides and cryopreservative solution: Rakkyo fructan was 

purified by the method in previous study [5]. Low molecular weight inulin 

and high one were produced by Fuji Nihon Seito Co. (Tokyo, Japan). Levan 

was purchased from Wako pure chemical industries. Each polysaccharide 

was solved in phosphate buffer saline (PBS). FBS containing 10% DMSO was 

used as positive control. 

Cryopreservative procedure: 2E3-O cells were pre-cultured until 60-70% 

confluent before cryopreservation. They were collected by centrifugation, 

removed the culture supernatant and then suspended in the cryopreservative 

solution. They were transferred to freezing tubes, placed in a BIOCELL 

container (Nihon freezer, Tokyo, Japan), frozen and stored at -80°C for several 

days. 

Thawing procedure and re-culture: Stored cells were defrosted at 37°C 

rapidly then transferred to the culture medium. The defrosted cells were 

centrifuged in order to the cryopreservative solution. Collected cells were 

suspended by the culture medium again. A part of them was stained with 

trypan blue exclusion method and counted with hemocytometer. The other 

one was re-cultured in a multi well plate for several days. After that, grown 

cells were stained with trypan blue exclusion method and counted with 

hemocytometer. 

Results and discussion: 2E3-O cells stored in 3 w/v%, 10 w/v% or 30 w/v% 

rakkyo fructan solution. After frozen and thawed in 10 w/v% or 30 w/v% 

rakkyo fructan solution, 2E3-O cells successfully survived and proliferated 

(Figure 1). On the other hand, all 2E3-O cells stored in 3 w/v% rakkyo fructan 

solution were dead (data not shown). This result shows that using rakkyo 

fructan will be effective for serum-free cryopreservation without DMSO. 

To compare the effect of rakkyo fructan on cellular protection, other fructans 

such as inulin and levan were also used for cryopreservation. Four fructans 

Figure 1(abstract P104) Effect of RBE on Serum-free Culture of 

Islets. Islets were cultured in RPMI 1640 medium in the presence of RBE 

or FBS as positive control. 

Figure 1(abstract P105) The time curse of viable cell number after 

thawing of frozen cells. 2E3-O cells were stored for three days in 

10 w/v% rakkyo fructan (triangles) or 30 w/v% rakkyo fructan (circles). 

The experiment was four trials.



Page 139 of 151 

Table 1(abstract P105) Viable cell number of 2E3-O cells after frozen-thawing process 

Cryopreservative solution Mean degree of polymerization Viable cell number (×10 6 ) 

30 w/v% rakkyo fructan 390 99.5 

30 w/v% inulin (low molecular weight) 16 64.5 

10 w/v% inulin (high molecular weight) 19 5.0 

1 w/v% levan 1000 0.2 

Positive control - 111 

2E3-O cells were stored for three days. 1.18 × 10 6 cells were frozen. 

were different in molecular weight and solubility. Rakkyo fructan and low 

molecular weight inulin solved in water very much but high molecular 

weight inulin solved in water up to 10 w/v% and levan dissolved in water. 

Rakkyo fructan was the highest viable cell number among fructans (Table 1). 

This result indicates that rakkyo fructan can protect animal cells more 

effectively than other fructans. Using rakkyo fructan has some advantages: 

1) using rakkyo fructan can avoid pathogenic contamination, 2) using rakkyo 

fructan will not be occurred osmotic change of stored cells because 

molecular weight of rakkyo fructan is over 10,000 (i.e. 30 w/v% rakkyo 

fructan is about 0.03 M), and 3) rakkyo fructan is high water soluble, which is 

easy to use. 

Conclusion: In conclusion, the freezing media using rakkyo fructan will be 

extensively used to protect animal cells against freezing stress without 

DMSO. 

References 

1. Seth G: Freezing mammalian cells for production of biopharmaceuticals. 

Methods 2012, 56:424-431. 

2. Tonti GA, Mannello F: From bone marrow to therapeutic applications: 

different behavior and genetic/epigenetic stability during mesenchymal 

stem cell expansion in autologous and foetal bovine sera? Int J Dev Biol 

2008, 52:1023-1032. 

3. Santos NC, Figueira-Coelho J, Martines-Silva J, Saldanha C: Multidisciplinary 

utilization of dimethyl sulfoxide: pharmacological, cellular, and 

molecular aspects. Biochem Pharmacol 2003, 65:1035-1041. 

4. Makishima F, Terada S, Mikami T, Suzuki E: Interleukin-6 is antiproliferative 

to a mouse hybridoma cell line and promotive for its antibody 

productivity. Cytotechnology 1992, 10:15-23. 

5. Kobayashi K, Futigami S, Nishikawa K, Inaki Y, Tsuji Y: Japanese patent 

application H10-158306 1998. 

P106 

Rice bran extract (RBE) as supplement for cell culture 

Satoko Moriyama 1 , Ken Fukumoto 1 , Masayuki Taniguchi 2 , Shigeru Moriyama 3 , 

Takuo Tsuno 3 , Satoshi Terada 1* 


2 Niigata University, Niigata, 

950-2102, Japan; 

3 Tsuno Food Industrial Co., Ltd, Katsuragi-cho, Wakayama, 

649-7122, Japan 



Introduction: In mammalian cell culture, fetal bovine serum (FBS) or 

proteins obtained from mammals are usually supplemented to culture 

media. Since the use of animal-derived components may cause an infection 

of virus and other pathogens, alternative supplement derived from nonmammals 

is eagerly required in cell culture for producing biotherapeutics 

and for cell therapy [1]. As an alternative supplement, we focused on rice 

bran extract (RBE), because several studies have been done and reported 

that RBE has some biological effects such as enhancement of NK cell activity 

and anti-inflammatory effect on mice [2] and antioxidant effect [3]. 

Rice bran, by-product of milling in the production of refined white rice, 

contains abundant nutrients and proteins. In this study, the effect of RBE 

was examined in the serum-free culture. 

Materials and methods: Effect of RBE on several cell lines: RBE was 

extracted from rice bran in an alkaline solution, precipitated with acid, and 

subsequently freeze-dried. The proceeding was performed by Tsuno Food 

Infdustrial Co., Ltd. To test the effect, RBE was supplemented to the culture 

of hybridoma cells, Chinese hamster ovary cells (CHO-DP12), hepatoma 

HepG2 and HeLa. The cells were cultured in 24 well plate (Sumitomo 

Bakelite, Japan) with 1 ml ASF104 medium (Ajinomoto, Japan) containing 

RBE or BSA (Wako, Japan) as positive control. The cell density was estimated 

using a hemacytometer. Viable cells were distinguished from dead cells by 

trypan blue dye exclusion method. The production of antibodies from 

hybridoma and CHO-DP12 cell was measured by ELISA method. 

Fractionation of RBE with UF membrane: In order to identify the 

growth factor(s) in RBE, fractionations were performed using UF 

membranes. RBE was fractionated into the permeable and residual fraction 

with ultrafiltration membrane Amicon Ultra-15 (Merck Millipore, Germany) 

at 4,000 rpm, 40 min and 4°C. The fractions and whole RBE were added to 

the culture of hybridoma and CHO-DP12 cells. 

Results and discussion: Enhanced cell growth and productivity 

using RBE: Figure 1 shows an enhanced proliferation by RBE. On growth 

and monoclonal antibody production of hybridoma cells, RBE had desired 

effect and the effect of RBE was superior to that of BSA. Similarly, to CHO- 

DP12 cells, addition of RBE exhibited increased cell growth and improved 

the productivity of humanized antibody. Growth of HepG2 and HeLa cells 

were also enhanced in the presence of RBE. 

Improvement of fractionated RBE by UF membrane: Fractionated 

RBEs by UF membranes were also tested. The fraction of RBE more than 

60 kDa improved the proliferation of hybridoma cells and the level was 

superior to that of whole RBE, while the fraction less than 60 kDa inhibited 

the proliferation. This results suggest that in RBE, some lower molecular 

inhibitor(s) and higher molecular growth factor(s) would be contained. 

Conclusion: We provide the first evidence that RBE is an attractive culture 

supplement to improve the proliferation and the production of mammalian 

cells. 

References 

1. Leopold G, Thomas RK, Sonia N, Manfred R: Emerging trends in plasmafree 

manufacturing of recombinant protein therapeutics expressed in 

mammalian cells. Biotechnology journal 2009, 4:186-201. 

2. Kim HY, Kim JH, Yang SB, Hong SG, Lee SA, Hwang SJ, Shin KS, Suh HJ, 

Park MH: A polysaccharide extracted from rice bran fermented with 

Lentinus edodes enhances natural killer cell activity and exhibits 

anticancer effects. Journal of medicinal food 2007, 10:25-31. 

3. Elisa R, Consuelo SM, Miramontes E, Juan B, Ana GM, Olga C, Rosa C, 

Juan P: Nutraceutical composition, antioxidant activity and 

hypocholesterolemic effect of water-soluble enzymatic extract from rice 

bran. Food Research International 2009, 42:387-393. 

P107 

Identification of mitogenic factor in rice bran for better mammalian cell 

culture 

Yoko Suzuki 1 , Satoko Moriyama 1 , Masayuki Taniguchi 2 , Shigeru Moriyama 3 , 

Takuo Tsuno 3 , Satoshi Terada 1* 


2 Niigata University, Niigata, 

950-2102, Japan; 

3 Tsuno Food Industrial Co., Ltd, Katsuragi-cho, Wakayama, 

649-7122, Japan 



Introduction: In cell culture for biopharmaceutical production, serum-free 

culture is required in order to avoid the risks associated with components of 

mammal origin such as BSE. Although many serum-free medium have been 

developed, there is yet room for improvement and protein hydrolysates 

from crops are widely used as additives to improve the culture.



Page 140 of 151 

Figure 1(abstract P106) Cell growth in serum-free medium containing RBE. a mouse hybridoma cell, b HeLa. 

We found that rice bran extract (RBE), not hydrolysate, successfully 

improved the proliferation of various cells as well as recombinant protein 

production of CHO cells when RBE was added into serum-free culture. 

Several studies have been done and reported that rice bran has antioxidant 

potential [1,2] and a rice bran 57-kDa protein showed cell adhesion activity 

for murine Lewis lung carcinoma cells [3]. 

RBE contains various components such as proteins and the factors activating 

mammalian cells are not identified yet. In this study, we aim to identify the 

effective factor in RBE. 

Our colleague reports that heavier molecular weight fraction of RBE 

improves the proliferation of various cells. Additionally, protein is the most 

abundant component in RBE. Together with them, some of the proteins in 

RBE would be the effective factor or the mitogen. We first determined 

whether some of the proteins in RBE are the bio-active factor or not, and 

then tried to identify which protein in RBE is the bio-active factor. 

Materials and methods: Effect of heat treatment on RBE: RBE was 

autoclaved at 121°C for 20 minutes. The heated RBE was supplemented 

into the culture of murine hybridoma cell line 2E3-O. Hybridoma cells 

were cultured in 24-well plate (Sumitomo Bakelite, Japan) with 1 ml 

ASF104 medium (Ajinomoto, Japan) in the presence of heated RBE. On 

day 3, viable cell number was determined by trypan blue dye exclusion 

with hemocytometer. 

Effect of trypsin treatment on RBE: RBE was digested with trypsin at 37°C 

for 24 hours. The treated RBE was SDS electrophoresed to confirm RBE was 

digested and to decide the condition. The trypsinized RBE was supplemented 

to the culture of hybridoma cells. On day three, viable cell number was 

determined. 

Proteins in Rice Bran: Two kinds of oryzacystatins are known in rice bran; 

oryzacystatin I and II. Antiserum against both oryzacystatin I and II was 

prepared, and mobilized in HiTrap Protein A column (GE Healthcare, USA). 

Using affinity chromatography, oryzacystatin I and II were eluted with 100 

mM Glycine-HCL (pH 2.9) containing 2 M Urea. All purification steps were 

done at 4°C. 

The purified oryzacystatin was supplemented to the culture of hybridoma 

cells. On day three, viable cell number was determined. 

Results and discussion: Autoclaved RBE lost mitogenic activity: While 

un-heated RBE successfully improved the proliferation, autoclaved RBE 

failed, suggesting that mitogenic factors in RBE would be heat-sensitive. 

Trypsinized RBE lost mitogenic activity: Most of proteins including 31 

kDa protein of RBE were successfully digested with trypsin. Although the 

proliferation of the cells treated with undigested RBE was stimulated, that 

of the cells treated with trypsinized RBE was not, suggesting that 

effective factors in RBE would be some proteins. Effect of trypsinized RBE 

on hybridoma cell growth is shown in Figure 1. 

Purified Oryzacistatin from RBE did not improve the cellular 

proliferation: Oryzacystatin obtained from RBE did not improve the 

culture of hybridoma, suggesting that oryzacystatin would not be mitogen. 

Other proteins in RBE would have mitogenic effects on mammalian cells. 

Conclusions: RBE improves the culture of various cells. Both of autoclaved 

and trypsinized RBE had lost the mitogenic effect, suggesting that bioactive 

factors in RBE would be heat-sensitive ingredients, probably 

proteins. 

Among abundant proteins in rice bran, oryzacystatin was purified from 

RBE and supplemented into the culture, but it failed to improve the 

culture. Other proteins in RBE will be tested to identify bio-active factor 

in RBE. 

References 

1. Adebiyi AP, Adebiyi AO, Hasegawa Y, Ogawa T, Muramoto K: Isolation and 

characterization of protein fractions from deoiled rice bran. European 

Food Research and Technology 2008, 10. 

2. Adebiyi AP, Adebiyi AO, Yamashita J, Ogawa T, Muramoto K: Purification 

and characterization of antioxidative peptides derived from rice bran 

protein hydrolysates. European Food Research and Technology 2008, 10. 

3. Shoji Y, Mita T, Isemura M, Mega T, Hase S, Isemura S, Aoyagi Y: A 

Fibronectin-binding Protein from Rice Bran with Cell Adhesion Activity 

for Animal Tumor Cells. Biosci Biotechnol Biochem 2001, 65:1181-1186. 

Figure 1(abstract P107) Effect of trypsinized RBE on hybridoma cell 

growth. RBE was digested with trypsin at 37°C for 24 hours.



Page 141 of 151 

P108 

Protein folding and glycosylation process are influenced by mild 

hypothermia in batch culture and by specific growth rate in continuous 

cultures of CHO cells producing rht-PA 

Mauricio Vergara 1 , Silvana Becerra 2 , Julio Berrios 1 , Juan Reyes 3 , 

Cristian Acevedo 4 , Ramon Gonzalez 5 , Nelson Osses 3 , Claudia Altamirano 1,2* 

1 Escuela Ingeniería Bioquímica, Pontificia Universidad Católica de Valparaíso, 

Valparaíso, 2362806, Chile; 

2 Centro Regional En Alimentos Saludables 

(CREAS), Valparaíso, 2340025, Chile; 

3 Instituto Química, Pontificia Universidad 

Católica de Valparaíso, Valparaíso, 2340025, Chile; 

4 Centro de Biotecnología, 

Universidad Técnica Federico Santa María, Valparaíso, 2390123, Chile; 

5 Department of Chemical and Biomolecular engineering, RICE University, 

Houston, 77055, USA 

E-mail: Claudia.altamirano@ucv.cl 


Background: CHO cells are the primary host for the production of 

different biopharmaceuticals, including recombinant proteins, monoclonal 

antibodies, vaccines, etc. Primarily due to their ability to perform properly 

folding and glycosylation processes required for these proteins acquire 

adequate biological functionality. 

However, culturing of these cells in the bioreactor still presents a number of 

disadvantages, among which can be mention: nutrient depletion, toxic 

byproducts accumulation, limited oxygen transfer, etc. These issues limit the 

cell growth and early onset of programmed cell death, which restricts the 

longevity of cultures and jointly specific productivity of recombinant protein. 

To overcome these limitations, different approaches have been made to 

maximize the productivity of these cultures. One of these approaches, that 

has gained importance during the last 20 years is the use of mild 

hypothermic temperatures, within a range of 33°C to 30°C. This strategy has 

been demonstrated to reduce the rate of growth and metabolism of cells 

but in turn increases the longevity of cultures and increase in specific 

productivity of a wide range of recombinant proteins in batch cultures [1,2]. 

One possible cause involved in the increase of specific productivity of 

recombinant proteins, is the increase in folding capacity and expression of 

chaperones from endoplasmic reticulum [3,4]. However, the intracellular 

mechanisms underlying the effect of temperature on the stages of posttranslational 

protein synthesis are still poorly understood. 

In this regard, the study of endoplasmic reticulum processes (folding, 

assembly and glycosylation of proteins, and degradation of misfolded 

proteins through ERAD pathway) has reached a high interest in recent 

years [4,5]. Reports show that the expression of several proteins associated 

with the various processes that take place in the ER, are affected under 

conditions of mild hypothermia. However, this phenomenon has not been 

analyzed from a process perspective. 

Thus, this study investigated the effect of mild hypothermic temperatures 

(33°C) on the process of protein folding of rht-PA expressed in CHO cells. 

For this, inhibitors of protein translation, glycosylation and endoplasmic 

reticulum associated degradation pathways (ERAD I: via the ubiquitin/ 

proteasome and ERAD II: autophagosome/Lysosome) were used. Two 

experimental approaches were evaluated: batch culture and continuous 

culture. 

Materials and methods: Batch Culture: CHO cells were cultured in 

HyClone SFM4CHO medium with out glucose, supplemented with 20 mM 

glucose, at 95% relative humidity in an atmosphere of 5% CO2, at 

temperatures of 37°C or 33°C. The inhibitors used to block processes in 

the endoplasmic reticulum were: cycloheximide (Sigma, C4859)-protein 

translation; tunicamycin (Sigma, T7765)-N-glycosylation of proteins, 

MG132 (Merck, 474790)-ERAD I pathway; Pepstatin A (Merck, 516485), 

Leupeptin (Merck, 108976) and E64d (Sigma, E8640)-ERAD II pathway. 

Continuous culture: The bioreactor was inoculated and operated in 

batch-mode during 48 h and it was then supplied with sterile feed 

throughout the period of operation. A series of four experiments was 

performed, in duplicate, at 37°C or 33°C, keeping D, at 0.014 and 0.012 h -1 . 

Cultures were considered to reach steady-state (SS) when, after at least 

four residence times, both, the number of viable cells and lactate 

concentration, were constant in two consecutive samples. 

Cell growth was measured by counting cells by trypan blue method; 

consumption and production of metabolites were measured by biochemical 

analyzer (YSI 2700); protein rht-PA was measured by ELISA (Trinilize tPA 

antigen) and enzymatic activity of the protein was measured by amidolytic 

assay (S-2288 peptide, Chromogenix Italy). The results were analyzed by the 

mathematical technique of PCA (Principal Component Analysis). 

Results: The results of the batch cultures may indicate that the process of 

protein folding is sensitive to mild hypothermia. Inhibition of glycosylation 

process and ERAD pathways (ERAD I or II), under conditions of low 

temperature, promotes the accumulation of intracellular deglycosylated rht-PA 

as shown in Table 1. This response may indicate that the protein folding 

process is attenuated under conditions of mild hypothermia, promoting 

unfolded protein degradation by both ERAD pathways in CHO cells. 

Recent reports [6,7] show that the effect of mild hypothermia condition in 

batch culture is associated predominant with a decrease on specific cell 

growth rate rather a decrease on culture temperature. To evaluate this fact, 

we carried out continuous cultures at different dilution rates. 

These results show that the degradation of the protein would be more 

related to the decrease in specific growth rate than the temperature 

decrease. Also show that the temperature decrease would promote an 

increase in protein folding capacity of the endoplasmic reticulum. This fact is 

clearly observed at low specific growth rate (Table 1). 

The cell behavior was evaluated using the technique of principal component 

analysis (PCA) in both, batch and continuous culture Figure 1. 

Table 1(abstract P108) Intracellular rht-PA content (% of control) on CHO cells by inhibition of translation and 

glycosylation prosesses and ERAD I and II pathways at 37°C and 33°C 

Dilution rate (h -1 ) 

0.014 0.012 

Temperature Temperature Temperature 

Batch Cultures 37°C 33°C Continuous Cultures 37°C 33°C 37°C 33°C 

CC 100 1 100 2 SS 100 3 100 4 100 5 100 6 

TM* 107 140 CHX/ERAD I** 120 117 185 139 

TM/ERAD I* 87 201 CHX/ERAD II** 107 115 242 150 

TM/ERAD II* 79 176 

CC: Control Culture; TM: Culture inhibited glycosylation; TM/ERAD I or II: Culture inhibited glycosylation and ERAD I or II; SS: Steady State; CHX/ERAD I or II: 

Culture inhibited translation and ERAD I or II; *Values at 24 hours after perturbation with inhibitors respect to CC value at 0 h. **At 48 hours after perturbation 

with inhibitors respect to value at SS. 

1 Concentration (8,8 ng/10 6 cells). 





6 Concentration (6,1 ng/10 6 cells).



Page 142 of 151 

Figure 1(abstract P108) First principal plane and Loads of first and second principal component of Batch and Continuous cultures. 

A: First principal plane of Batch culture B: First principal plane of continuous culture; C: Loads of first and second principal component of Batch cultures. 

D: Loads of first and second principal component of Continuous cultures. 

The first principal plane (PC1 axis and PC2 axis) of batch cultures (Figure 

1A) shows that there are only two values whose behavior is significantly 

away from the origin (P < 0,05). These correspond to the behavior of the 

tested batch cultures at 24 h at 37°C and 33°C, respectively. This indicates 

the great influence of culture temperature on cell behavior. The first 

principal plane of continuous culture (Figure 1B) shows the behavior of 

cells organized into two major groups, which are correlated with both 

dilution rates tested. 

PC1 loads of batch cultures (Figure 1C) suggest that low temperature 

reduces the ability of the protein folding; this would explain the 

accumulation of intracellular deglycosylated rht-PA. However, loads of PC1 

from continuous cultures (Figure 1D) shows that increasing of intracellular 

rht-PA content is associated with the reduction in the rate of dilution and is 

not associated with a lower temperature. 

Conclusions: Experimental approach of continuous culture revealed that 

reduction on specific growth rate is associated to an increase ERAD 

activity on rht-PA while the temperature reduction may have a positive 

effect on protein folding. Moreover, PCA analysis indicated that specific 

growth rate is also responsible for general behavior exposed by CHO 

cells. 

References 

1. Yoon SK, Song JY, Lee GM: Effect of low culture temperature on specific 

productivity, transcription level, and heterogeneity of erythropoietin in 


2. Bollati-Fogolín M, Forno G, Nimtz M, Conradt HS, Etcheverrigaray M, 

Kratje R: Temperature reduction in cultures of hGM-CSF-expressing CHO 

cells: effect on productivity and product quality. Biotechnology Progress 

2005, 21:17-21.



Page 143 of 151 

3. Baik JY, Lee MS, An SR, Yoon SK, Joo EJ, Kim YH, Park HW, Lee GM: Initial 

Transcriptome and Proteome Analyses of Low Culture Temperature- 

Induced Expression in CHO Cells Producing Erythropoietin. Biotechnol 

Bioeng 2006, 93:361-371. 

4. Masterton RJ, Roobol A, Al-Fageeh M, Carden M, Smales CM: Post- 

Translational Events of a Model Reporter Protein Proceed With Higher 

Fidelity and Accuracy Upon Mild Hypothermic Culturing of Chinese 

Hamster Ovary Cells. Biotechnol Bioeng 2010, 105:215-220. 

5. Gomez N, Subramanian J, Ouyang J, Nguyen M, Hutchinson M, Sharma VK, 

Lin AA, Yuk IH: Culture Temperature Modulates Aggregation of 

Recombinant Antibody in CHO Cells. Biotechnol Bioeng 2012, 109:125-136. 

6. Becerra S, Berrios J, Osses N, Altamirano C: Exploring the effect of mild 

hypothermia on CHO cell productivity. Biochem Eng J 2012, 60:1-8. 

7. Vergara M, Becerra S, Berrios J, Osses N, Reyes J, Rodríguez-Moyá M, 

Gonzalez R, Altamirano C: Differential effect of culture temperature and 

specific growth rate on CHO cell behavior in continuous culture. Bioch 

Eng J 2013, submitted. 

P109 

The combined use of platinum nanoparticles and hydrogen molecules 

induces caspase-dependent apoptosis 

Takeki Hamasaki 1 , Tomoya Kinjyo 2 , Hidekazu Nakanishi 2 , Kiichiro Teruya 1,2 , 

Sigeru Kabayama 3 , Sanetaka Shirahata 1,2* 

1 Department of Bioscience and Bioengineering, Faculty of Agriculture, 

Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581, Japan; 

2 Graduate School of Systems Life Sciences, Kyushu University, 6-10-1 

Hakozaki, Higashi-ku, Fukuoka 812-8581, Japan; 

3 Nihon Trim Co. LTD., 34-8-1 

Ooyodonaka, Kita-ku, Osaka 531-0076, Japan 

E-mail: sanetaka@grt.kyushu-u.ac.jp 


We previously reported electrochemically reduced water (ERW), produced 

near the cathode by electrolysis, exhibits reductive activity. We also revealed 

that ERW contains Pt nanoparticles (Pt nps) derived from Pt-coated titanium 

electrodes in addition to high concentration of dissolved molecular 

hydrogen (H 2 ) by in vitro assay, and Pt nps exhibit powerful ROS scavenger 

activity and catalysis activity converting H 2 to active hydrogen. Our study 

investigates apoptosis inducibility of H 2 and synthesized Pt nps on human 

promyelocytic leukaemia HL60 cells. Human promyelocytic leukaemia cells 

(HL60) were cultured in RPMI 1640 medium supplemented with 10% FBS, 

2.0 mM l-glutamine, 100 U/ml penicillin and 100 U/ml streptomycin. Cultures 

were incubated in an atmosphere of 75%(v/v) H 2 /20%(v/v) O 2 /5%(v/v) CO 2 , 

75%(v/v) He/20%(v/v) O 2 /5%(v/v) CO 2 atmosphere or 75%(v/v) N2/20%(v/v) 

O 2 /5%(v/v) CO 2 atmosphere for 12-48 hr after incubated with Pt nps for 2 h. 

Untreated cultures were included as controls. Cytotoxicity was determined 

by cell-counter. Apoptosis pathway of HL60 cells was investigated by Sub 

G-1 assay. 

Growth suppression was not observed when cells were treated with Pt nps 

or H 2 only. Analysis of cell cycle and activity of caspase-3 suggested that 

combination use of both Pt nps and H 2 induced apoptosis in HL60 cells. Our 

caspase activity experimentation suggests that apoptosis was caused via 

caspase-8 activation. These results suggested that atomic hydrogen from H 2 

induces caspase-8 dependent apoptosis. The cytotoxicity was not detected 

in Pt nps or H 2 separately treated cells. Apoptosis was determined only 

when cells were treated with both Pt nps and H 2 , suggesaspase-8 

dependent apoptosis was caused by atomic hydrogen produced from H 2 by 

catalyst activity of Pt nps. 

P110 

Rec. ST6Gal-I variants to control enzymatic activity in processes of 

in vitro glycoengineering 

Alfred M Engel 1* , Harald Sobek 1 , Michael Greif 1 , Sebastian Malik 2 , 

Marco Thomann 2 , Christine Jung 2 , Dietmar Reusch 2 , Doris Ribitsch 4 , 

Sabine Zitzenbacher 4 , Christiane Luley 4 , Katharina Schmoelzer 4 , 

Tibor Czabany 5 , Bernd Nidetzky 4,5 , Helmut Schwab 4,6 , Rainer Mueller 3 

1 Professional Diagnostics, Roche Diagnostics GmbH, 82372 Penzberg, 

Germany; 

2 Pharma Biotech Development, Roche Diagnostics GmbH, 82372 


3 Applied Science, Roche Diagnostics GmbH, 82372 


4 ACIB GmbH, 8010 Graz, Austria; 

5 Institute of 

Biotechnology and Biochemical Engineering, Graz University of Technology, 

8010 Graz, Austria; 

6 Institute of Molecular Biotechnology, Graz University of 

Technology, 8010 Graz, Austria 

E-mail: alfred.engel@roche.com 


Background: Glycosylation is an important posttranslational modification 

of proteins influencing protein folding, stability and regulation of the 

biological activity. The sialyl mojety (sialic acid, 5-N-acetylneuramic acid) is 

usually exposed at the terminal position of N-glycosylation and therefore, a 

major contributor to biological recognition and ligand function, e.g. IgG 

featuring terminal sialic acids were shown to induce less inflammatory 

response and increased serum half-life. 

The biosynthesis of sialyl conjugates is controlled by a set of sugar-active 

enzymes including sialyltransferases which are classified as ST3, ST6 and 

ST8 based on the hydroxyl position of the glycosyl acceptor the Neu5Ac is 

transferred to [1]. The ST6 family consists of 2 subfamilies, ST6Gal and 

ST6GalNAc. ST6Gal catalyzes the transfer of Neu5Ac residues to the 

hydroxyl group in C6 of a terminal galactose residue of type 2 disaccharide 

(Galb1-4GlcNAc). 

To our knowledge, the access to recombinant ST6Gal-I for therapeutic 

applications is still limited due to low expression and/or poor activity in 

various hosts (Pichia pastoris, Spodoptera frugiperda and E. coli). 

The present study describes the high-yield expression of two variants of 

human beta-galactoside alpha-2,6 sialyltransferase 1 (ST6Gal-I, EC 2.4.99.1; 

data base entry P15907) by transient gene expression in HEK293 cells with 

yields >100 mg/L featuring distinct mono- (G2+1SA) as well as bi- (G2+2SA) 

sialylation activity. 

Materials and methods: Two N-terminally truncated fragments of human 

ST6Gal-I (delta89, residues 89-406, and delta108, residues 109-406) were 

designed for transient gene expression (TGE): Instead of the natural leader 

sequence and N-terminal residues, both ST6Gal-I coding regions harbor 

the Erythropoietin (EPO) signal sequence in order to ensure correct 

processing of the polypeptides by the secretion machinery. Following 

cloning into pM1MT, expression of the ST6Gal-I coding sequences is under 

control of a hCMV promoter followed by an intron A. 

Sialyltransferase assays: 1. Asialofetuin was used as acceptor and CMP-9F- 

NANA as donor substrate. Enzymatic activity was determined by measuring 

the transfer of 9F-NANA to asialofetuin. 2. Recombinant humanized IgG1 

and IgG4 monoclonal antibodies (mabs), characterized as G2+0SA, as well as 

desialylated EPO were used as targets in sialylation experiments (30 μg 

enzyme/300 μg target protein). Both enzyme variants of ST6Gal-I (delta89 

and delta108) were used under identical reaction conditions and the 

sialylation status was analyzed by mass spectrometry. 

Results: In using the suspension-adapted human embryonic kidney (HEK) 

293-F cell line, a modified serum-free FreeStyle medium platform plus 

transfection by the 293-Free reagent, we were able to install a TGE shaker 

fermentation process with product yields of up to 200 mg/L culture 

supernatant. Both variants delta89 and delta108 could be isolated to >98% 

purity by a simple 2-step purification protocol. 

To our surprise, both variants show a distinct and different sialylation 

activity as shown by sialylation kinetics of a IgG4 molecule (Figure 1). 

Recently, the crystal structure of the delta89 variant could be determined 

as first human ST6Gal-I by SIRAS phasing using an iodide soak as 

derivative I [2]: An elongated glycan from a crystallographic neighbour 

binds to the active site, mimicking a substrate complex. An analysis of 

substrate interactions and comparison to other sialyltransferases allows 

modelling of a Michaelis complex and conclusions on the catalytic 

mechanism. 

Due to their high expression rates and easy purification, both recombinant 

variants (delta89 and delta108) of human ST6Gal-I are available in large 

quantities and high purity. Both variants are active with high molecular 

weight substrates like monoclonal antibodies. To our surprise, they show 

different performance in sialylation experiments using with bi-antennary 

glycans such as mabs as well as tetra-antennary glycans (data not shown) 

as substrate. Under identical reaction conditions, bi-sialylated glycans are 

obtained in using variant delta89, whereas delta108 yields mono-sialylated 

glycans. 

Our findings on variant delta108 are in contradiction to previous studies [3] 

claiming that the conserved QVWxKDS sequence, residues 94-100 of 

human ST6Gal-I, being essential for its catalytic activity.



Page 144 of 151 

Figure 1(abstract P110) Left panel: Variant delta89 yields 88% G2+2SA sialylation. However, after prolonged incubation (24 hrs), the bi-sialylation is 

reduced to a stable mono-sialylation product, presumably by a sialydase activity. Right panel: Variant delta108 yields 70% G2+1SA and 7% G2+2SA 

sialylation. 

To our knowledge, these human ST6Gal-I variants are the first enzymes 

available in large quantities and currently, recombinant alpha-2,3 

sialyltransferase 1 (ST3Gal-I) and beta-1,4 galactosyltransferase 2 (B4Gal-T2) 

are developed in order to strengthen this enzyme portfolio. Together with 

the already available donor substrates (activated sugars), a complete set of 

reagents will be soon available for the commercial glycoengineering of 

proteins. 

References 

1. Weijers CA, Franssen MC, Visser GM: Glycosyltransferase-catalyzed 

synthesis of bioactive oligosaccharides. Biotechnol Adv 2008, 26:436-456. 

2. Kuhn B, Benz J, Greif M, Engel AM, Sobek H, Rudolph MG: Crystal structure 

of human 2,6 sialyltransferase reveals mode of binding of complex 

glycans. Acta Crystallographica 2013, D69:1826-1838. 

3. Donadio S, Dubois C, Fichant G, Roybon L, Guillemot JC, Breton C, Ronin C: 

Recognition of cell surface acceptors by two human alpha-2,6- 

sialyltransferases produced in CHO cells. Biochimie 2003, 85:311-321. 

P111 

Accelerating stable recombinant cell line development by targeted 

integration 

Bernd Rehberger * , Claas Wodarczyk, Britta Reichenbächer, Janet Köhler, 

Renée Weber, Dethardt Müller 

Rentschler Biotechnologie GmbH, 88471 Laupheim, Germany 

E-mail: bernd.rehberger@rentschler.de 


Introduction: Targeted integration (TI) allows fast and reproducible genetic 

modification of well characterized previously tagged host cells thus 

generating producer cells with predictable qualities. Concurrently, timelines 

are cut by 50% compared to random integration (RI) based cell line 

development. In contrast to commonly low productivities of cell lines 

generated by TI, we developed a system for CHO cells leading to 

productivities of more than 1 g/L within weeks using the TurboCell platform. 

The system is based on CHO K1 cells that have been tagged with a GFP 

expression cassette flanked by recombinase recognition sites. Following 

GFP based FACS enrichment and cloning of the tagged cells, over 4000 

clones were screened for growth, productivity, GFP expression stability 

and integration status of the GFP expression cassette. The best clones 

were selected to be used as “Master TurboCell” (MTC) host cell lines for 

recombinant cell line development. 

Generation of producer TurboCell lines: A selected MTC host cell line 

is co-transfected using a TurboCell expression plasmid containing the gene 

of interest (GOI) expression cassette flanked by matching recombinase 

recognition sites together with a plasmid encoding the recombinase enzyme 

required for RMCE. Upon transfection both plasmids enter the MTC’s nucleus 

initiating transient expression of the recombinase which further mediates the 

stable exchange of the GFP expression cassette against the GOI expression 

cassette. Thus, the GOI is stably introduced into the tagged genomic spot 

shortly after the transfection. Cells are cultivated for a few days to recover 

from the transfection procedure and to allow GFP to fade out of RMCE 

positive cells. The transfected pools are thereupon sorted by FACS in order to 

remove the majority of GFP positive cells. The remaining producer 

TurboCell(PTC) pools in general comprise of 90-99% GFP negative, GOI 

expressing cells that are genetically identical due to the conserved locus of 

GOI integration. This allows the production of recombinant protein from PTC 

enriched pools at a very early stage of 3 weeks upon transfection. Due to 

their genetic homogeneity the physiological diversity of the clones within 

the pool is limited thus leading to only small variations in the recombinant 

protein produced. Therefore, material drug candidate screening prepared on 

the parental PTC pool level should only differ slightly from material produced 

from clones thereof. Following FACS sorting, the PTC pools can be cloned, if 

required. Due to the high degree of similarity of all clones, the screening 

effort to find the best clone can be limited to about 10 clones. Recombinant 

protein material from clones can be produced 9 weeks upon transfection. 

Molecular biological analysis of producer TurboCell lines: In order 

to prove successful RMCE reproducibly taking place without additional 

random integration of the remaining plasmid, genomic DNA was prepared 

from clonal PTC for Southern Blot analysis. The genomic DNA was digested 

with a restriction enzyme cutting the correctly integrated targeting vector 

into two pieces, one fragment only comprising internal vector sequences, as 

well as a second fragment also comprising CHO derived sequences of the 

specific integration locus. As both fragments carry sequences of the CMV 

promotor, both can be visualized using one single CMV promoter-specific 

probe. As only two bands occur in case of successful RMCE, cell lines 

showing more than two bands indicate clones with randomly integrated 

targeting vector molecules in addition to RMCE. Statistics of several cell line 

generation projects show that in about 90% of all analyzed clones a correct 

RMCE without additional random integration events takes place. This allows 

for a significant reduction in clone screening efforts to a level of 10 clones 

per project. 

Process characteristics: To show the feasibility of the TurboCell system 

for recombinant protein production in fed batch cultivations, a PTC clone 

producing IgG1 was cultivated in a stirred tank bioreactor. The data of this 

bioreactor were compared to two shake flask fed batch runs performed with 

the same PTC and the same media system (Rentschler’s proprietary media + 

GE Healthcare’s ActiCHO feed) in parallel. Figure 1a shows a comparison of 

viable cell density and product concentration. The better performance in the 

bioreactor indicates that the PTC can be easily transferred from shake flask 

to bioreactor settings. The maximum cell density of 13*10 6 cells/mL, as well 

as the integral of viable cells over the cultivation time, and the maximum 

product titer of more than 1 g/L IgG1 proved the feasibility of the 

TurboCell system for the production of recombinant proteins even in 

larger amounts at a very early stage of a biopharmaceutical development 

project. 

Analysis of Protein Quality: Both amount of glycosylation and glycosylation 

pattern in different Turbo Cell subsets were analyzed 

Figure 1b shows that clones derived from the same parental pool differ 

only slightly regarding their glyco pattern and they are very similar to their 

parental pool. Even if different antibodies are expressed from pools 

derived from the same MTC the variation between the pools is within the 

range of clones compared to each other. Significant variations in the glyco



Page 145 of 151 

Figure 1a(abstract P111) Comparison of cell growth and recombinant protein production in a bioreactor versus shake flask. Figure 1b: 

Comparison of glycopatterns. The first row compares three clones derived from one parental pool of one defined MTC with each other and with the 

relevant parental pool. The second row compares mAb material derived from two PTC pools derived from different, not related MTCs. The third row 

compares two types of IgG1 antibodies expressed from PTC pools derived from the same MTC. 

pattern can only be detected, if antibody material derived from pools 

descendent from different, unrelated MTCs is compared (indicated by 

yellow arrows). 

Conclusions: Within 3 weeks upon transfection and targeted integration, 

producer cell pools were FACS sorted to purities of >95%. These cells were 

suited for high quality recombinant protein material production in fed batch 

runs exceeding 1 g/L IgG1. Clones generated thereof behaved similar to the 

pools in terms of productivity and product quality, cell growth and 

metabolism. From those clones analyzed a mean of about 90% showed 

successful RMCE without unintended random integration. Cellular properties 

and productivities of the clones were as expected and variations between 

different clones were marginal. Thus, the TurboCell system reduces clone 

screening efforts to a minimum allowing the simultaneous production of 

multiple recombinant proteins in stable CHO cells with optimal use of 

resources. This makes the TurboCell system an interesting tool for 

candidatescreeningandearlyphasesmaterialproductioneveninlarge 

scale setups. 

P112 

Differential affects of low glucose on the macroheterogeneity and 

microheterogeneity of glycosylation in CHO-EG2 camelid monoclonal 

antibodies 

Bo Liu 1* , Carina Villacres-Barragan 1 , Erika Lattova 2 , Maureen Spearman 1 , 

Michael Butler 1 

1 Dept of Microbiology, University of Manitoba, Winnipeg, Manitoba, R3T 2N2, 

CA, USA; 

2 Dept of Chemistry, University of Manitoba, Winnipeg, Manitoba, 

R3T 2N2, CA, USA 

E-mail: bo.liu422@gmail.com 


Background: The demand for high yield recombinant protein production 

systems has focused industry on culture media and feed strategies that 

optimize productivity, yet maintain product quality attributes such as 

glycosylation. Minimizing media components such as glucose, reduces the



Page 146 of 151 

production of lactate, but may also affect glycosylation. The first steps in the 

glycosylation pathway involve the synthesis of lipid-linked oligosaccharides 

(LLOs). Glycan macroheterogeneity is introduced by variation in site-specific 

glycosylation with the transfer of the oligo-saccharide to the protein. Further 

modification of the oligosaccharide can occur through processing reactions, 

where some sugars are removed and additional sugars added. This 

produces microheterogeneity of the glycan pool. Both macroheterogeneity 

and microheterogeneity may be affected by fermentation conditions. The 

objective of this study has been to investigate the effect of variable 

concentrations of glucose on the glycosylation patterns of a camelid 

monoclonal antibody produced in Chinese hamster ovary (CHO) cells and to 

further evaluate their effect on components of the N-glycosylation pathway. 

Materials and methods: A CHO cell line recombinantly expressing 

chimeric antibodies EG2 with a camelid single domain fused to human Fc 

regions was used in this study. Cells were inoculated at 2.6 x 10 6 cells/ml 

into 7 shake flasks (250 ml) each containing 80 ml of media with a different 

initial glucose concentration varying from 0 to 25 mM. The cultures were 

maintained and monitored under standard shaking conditions in an 

incubator over a 24 hr period. 

Cells were harvested and quenched to stop any subsequent metabolic 

activities [1]. LLOs were extracted from the cells using a previously 

established method [2]. Mild acid cleaved glycans were labeled with 2- 

aminobenzamide and analyzed by high performance liquid chromatography 

(HPLC) using the technique of hydrophilic interaction liquid chromatography 

(HILIC). The structures were assigned using standard GU values from the 

GlycoBase database (NIBRT.ie) [3] and confirmed by Mass spectrometric 

analysis. 

Antibodies were purified from culture supernatants with a Protein A affinity 

column and run under denaturing conditions on 8-16% SDS-PAGE gels and 

stained with Coomassie Brilliant Blue (CBB). The density ratio between 

upper and lower bands was determined by densitometry. The protein 

bands were removed by scalpel, washed, and treated with Peptide-N- 

Glycosidase F for 18 h to remove the attached glycans. MS analysis was 

carried out on the MALDI-TOF/TOF mass spectrometer to confirm 

aglycosylated Mabs in the lower band, and glycosylated proteins present 

in the upper band. The isolated N-linked glycans were labeled with 2-AB 

[4]. Glycan structures were assigned using standard GU values from HILIC 

analysis in GlycoBase. Structures were confirmed by exoglycosidase 

enzymatic digestion arrays according to method of Royle et al (2010). 

Results: Peaks corresponding to the LLOs from each of the previously 

described cultures with varying glucose concentration cultures were 

compared (Figure 1.A.). Samples from cultures containing 25mM glucose 

displayed a prominent large peak with a GU value of 11.7 representing 

63% of the total LLOs and designated as the Glc3Man9GlcNAc2 a structure 

(Figure 1.A.). Small peaks were designated as Glc2Man9GlcNAc2, 

Glc1Man9GlcNAc2, Man9GlcNAc2, Man5GlcNAc2 and Man2GlcNAc2 

structures. For cells grown at an initial glucose concentration of less than 

15 mM the predominant peak was Man2GlcNAc2 with a significant level of 

the Man5GlcNAc2 structure but the percentage of the Glc3Man9GlcNAc2 

structure was reduced significantly to 2.9% of the overall LLOs. It is 

important to note that these cultures (≤15mM glucose) were under 

conditions of glucose depletion for at least 4 h prior to harvest. 

LLO with a completed glycan structure Glc3Man9GlcNAc2 is an essential 

precursor for N-glycosylation. Thus, the effect of glucose concentration on 

the macroheterogeneity and microheterogeneity of the fully formed 

glycoprotein were examined next. Protein A purified antibodies from cultures 

after 24 h were analyzed on reduced SDS-PAGE gels 1. B. The antibodies 

produced by cells grown in 17.5-25 mM glucose displayed one single strong 

band corresponding to the glycosylated heavy chain. Proteins isolated from 

cell culture with 15 mM initial glucose concentration (Lane 5) showed a faint 

band underneath the predominant gel band. The proportional density of the 

lower band in the 12.5 mM glucose sample was 26% which increased 

gradually to 52% for samples taken from cultures with no added glucose 

(Table 1). The lower protein bands were suspected to be deglycosylated 

proteins due to an estimated 2% weight loss, which corresponds to the 

typical mass of glycan found on IgGs [5]. Samples of antibody showing two 

gel bands were analyzed by MALDI-MS. This showed m/z values of 82,670 

and 79,350 which are the expected masses of the glycosylated and nonglycosylated 

forms, respectively of the complete antibodies. 

To compare the difference in glycosylation profiles of EG2 antibodies 

induced by various glucose concentrations, the glycans were released from 

the Protein A-purified Mabs with PNGase F, and analyzed by HILIC HPLC. 

The glycan pool was separated into six major peaks which eluted between 

33 and 43 minutes with corresponding GU values between 5 and 9 

(Figure 1. C.). Structures were provisionally assigned from GU values with 

reference to the Glycobase and confirmed by a series of exoglycosidase 

enzyme array digestions. This allowed the identification of biantennary 

glycan structures with variable galactosylation, fucosylation and sialylation. 

The predominant glycan structure of antibodies isolated from the 25 mM 

glucose culture was the fully galactosylated biantennary and fucosylated 

structure, Fuc(6)GlcNAc2Gal2 , which comprised 60% of the overall glycans. 

Fuc(6)GlcNAc2Gal0 and Fuc(6)GlcNAc2Gal2 structures were determined at 

6% and 34%, respectively. The structures were found in samples from all 

cultures analyzed but there was a significant shift to lower galactosylation 

and sialylation in samples derived from cultures with lower glucose. 

a Glc, glucose; Man, mannose; GlcNAc, N-acetylglucosamine. 

b Fuc, fucose; Gal, galactose. 

Each glycan pool was assigned a galactosylation index (GI) and a sialylation 

index (SI) based upon the relative peak areas on the HPLC profile. In this 

experiment the GI value changed from 0.35 to 0.72 as the availability of 

glucose increased for the cells. Sialylation is dependent upon prior 

galactosylation of a glycan and consequently shows lower values with 

corresponding SI values from 0.019 to 0.058. There was a strong positive 

correlation between the GI and SI value determined for each sample and 

the time spent by the corresponding cells in glucose deprived media over 

the 24 h experimental period (R2 = 0.965 and 0.936 for the GI and SI 

values respectively; Figure 1.D.). 

Conclusion: N-glycosylation is an important post-translation modification in 

mammalian cells, which is known to impact the quality and efficacy of 

therapeutic recombinant proteins. In this study, we focused on the effect of 

glucose concentration on several aspects in N-glycosylation pathways in 

CHO-EG2 cells. The depletion of glucose as the main carbohydrate source 

during cell culture, can reduce the capacity for N-glycosylation. Reduced 

availability of the full-length LLO precursor occurred by glucose deprivation 

and resulted in the accumulation of truncated dolichol linked glycans. This 

led to reduced glycosylation in the EG2 antibodies. Glucose deprivation also 

led to changes in microheterogeneity with a decrease in galactosylation and 

sialylation. It is concluded that low glucose concentrations in culture altered 

LLO synthesis and N-glycan profiles of the antibody. 

Acknowledgements: This work is supported by the Natural Sciences and 

Engineering Research Council of Canada (NSERC) and MabNet. Author 

would like to thank Dr. Michael Butler at University of Manitoba for 

instructing and all members in Butler’s lab. 

References 

1. Sellick CA, Hansen R, Maqsood AR, Dunn WB, Stephens GM, Goodacre R, 

Dickson AJ: Effective quenching processes for physiologically valid 

metabolite profiling of suspension cultured Mammalian cells. Anal Chem 

2009, 81:174-183. 

2. Gao N, Lehrman MA: Non-radioactive analysis of lipid-linked 

oligosaccharide compositions by fluorophore-assisted carbohydrate 

electrophoresis. Meth Enzymol 2006, 415:3-20. 

3. Royle LL, Campbell MPM, Radcliffe CMC, Rudd PMP, Dwek RAR: GlycoBase 

and autoGU: tools for HPLC-based glycan analysis. Bioinformatics 2008, 

24:1214-1216. 

4. Detailed Structural Analysis of N-Glycans Released From Glycoproteins 

in SDS-PAGE Gel Bands Using HPLC Combined With Exoglycosidase 

Array Digestions. Methods in Molecular Biology 2010, 347:125-143. 

5. Deisenhofer J: Crystallographic refinement and atomic models of a human 

Fc fragment and its complex with fragment B of protein A from Staphylococcus 

aureus at 2.9- and 2.8-A resolution. Biochemistry 1981, 

20:2361-2370. 

P113 

Development and application of an automated, multiwell plate based 

screening system for suspension cell culture 

Sven Markert * , Carsten Musmann, Klaus Joeris 

Roche Diagnostics GmbH, Pharma Biotech Production and Development, 

Penzberg, Germany 

E-mail: Sven.Markert@roche.com 


Introduction: The already presented automated, multiwell plate (MWP) 

based screening system for suspension cell culture is now routinely used in



Page 147 of 151 

Figure 1(abstract P112) The availability of glucose to CHO cells affects the intracellular lipid-linked oligosaccharide distribution, site occupancy 

and the N-glycosylation profile of a monoclonal antibody. A. Lipid-linked oligosaccharide (LLO) profiles. The glycans from each sample were acid 

hydrolyzed from the lipid carriers, 2-AB labeled and detected by HILIC. (Glc Δ Man Ο and GlcNAc ?). B. Separation of EG2 antibodies on reduced 8-16% 

SDS-PAGE gel. The purified antibody in lane 8 was isolated from the culture prior to the 24 h incubation. Upper bands in lanes 1 to 4 correspond to 

glycosylated antibodies, and the lower bands were determined to be non-glycosylated antibodies. C. HPLC profiles of N-glycans isolated from EG2 

antibodies produced by CHO cells with various initial glucose concentrations during a 24 h incubation. D. The effect of exposure time of cells to media 

depleted of glucose on the galactosylation (GI; |) and the sialylation (SI; ?) indices of EG2 antibodies produced by CHO cells. 

process development. It is characterized by a fully automated workflow with 

integrated analytical instrumentation and uses shaken 6-24 well plates as 

bioreactors which can be run in batch and fed-batch mode with a capacity 

of up to 384 reactors in parallel [1]. 

A wide ranging analytical portfolio is available to monitor cell culture 

processes and to characterize product quality. Assays running on the 

screening system comprise the determination of cell concentration and 

viability, quantification of nutrients and metabolites as well as detection of 

apoptosis level and staining of organelles. Additionally a RT-qPCR method 

has been setup to measure gene expression level in a high throughput 

manner. Having a large network in-house to high throughput groups of 

the analytical department a lot of advanced methods can easily be 

Table 1(abstract P112) Quantitative densitometry of Protein A purified EG2 antibodies stained with coomassie blue (n =5) 

Initial glucose concentration (mM) % Glycosylated protein % Non-glycosylation protein 

0 48±1 52±1 

5 60±4 40±4 

10 69 ± 2 31 ± 2 

12.5 74 ± 2 26 ± 2 

15 100 0 

17.5 100 0 

25 100 0 

Control 100 0



Page 148 of 151 

performed like chromatographic and mass spectrometry to characterize 

product quality. 

Current work focuses on expanding the analytical portfolio to develop 

control strategies for automated cell culture processes. Besides setting up 

a robust method for pH measurement we evaluate different spectroscopic 

techniques like Raman, infrared or 2D fluorescence as fast and powerful 

analytical tools. 

Results: Scale-up prediction: The comparability of results obtained with 

multiwell plates and bioreactors had to be verified to develop a screening 

system for the predictive scale-up. 

Using several late stage project cell lines growing in suspension the 

comparability of results obtained with automated, shaken multiwell plates 

and bioreactors with a volume of up to 1.000 L could be verified. The 

effects of process optimization steps on cell culture performance and 

product quality were shown in multiwell plates and bioreactors. Thus, the 

automated cell culture screening system can be used for scale up 

prediction. 

Application of pH measurement and pH control: A fully automated, 

multiwell plate based pH measurement assay and a pH control strategy 

was developed for the screening system. The established assay is based 

on the use of pH sensitive absorption and fluorescent dyes which are 

added to a cell culture sample. The advantages of this method comprise 

a short analytical time and the low sample volume per sample. The assay 

is characterized by a high precision and robustness without any probe 

drift during a cultivation time of up to two weeks. 

The successful application of the developed pH measurement and pH 

control could be confirmed by getting comparable pH profiles from MWP 

and bioreactor under the same conditions and can be kept equal by 

controlling the pH (Figure 1A). 

In a second experiment a pH shift of 0.4 pH values after 72 hours was 

performed (Figure 1B). The target pH was reached exactly and it could be 

controlled at a stable level using the developed pH measurement assay. 

Feasibility of Raman spectroscopy as high throughput analytical 

tool: Raman spectroscopy is a powerful tool for the detection and 

quantification of several components in cell culture processes at once. Using 

this fast and non-invasive analytical technique there will be no reagent costs 

and no sample consumption what this technique makes ideal for small scale 

high throughput systems. 

The feasibility of Raman spectroscopy was shown for the quantification of 

different metabolites and nutrients, i.e.glucose,lactateandglutamine. 

For the quantification of glucose (0 g/L to 20g/L), lactate (0 g/L to 10 g/L) 

and glutamine (0 g/L to 20 g/L) a good correlation with a high prediction 

accuracy could be shown. 

Conclusions and outlook: The developed robotic screening system is 

capable of performing a fully automated workflow consisting of incubation, 

sampling, feeding and near real-time analytics. In the performed experiments 

the scalability from mL scale up to 1000 L scale could be shown. 

Expanding the analytical portfolio a robust and fast pH measurement assay 

was developed to enable pH control in multiwell plates. This assay as well 

as pH control was tested during the cultivation of two late stage project 

cell lines resulting in comparable pH profiles and cell culture performance. 

These results enable the routinely use of the developed pH measurement 

and control strategy. Additionally the proof of concept for Raman 

spectroscopy as a powerful tool for the quantification of metabolites and 

nutrients for the automated screening system could be shown. Further 

spectroscopic techniques using infrared or fluorescence will be evaluated. 

Acknowledgements: The authors would like to thank all internship and 

diploma students (R. Wetzel, K. Moeser, P. Linke, S. Spielmann, K. Müller, 

B. Frommeyer, J. Wisbauer), the Roche Penzberg pilot plant and GMP facility 

team, all Roche Penzberg portfolio project teams and the University of 

Hannover (Prof. Dr. Thomas Scheper, Dr. D. Solle). 

Reference 

1. Markert S, Joeris K: Development of an automated, multiwell plate based 

screening system for suspension cell culture. BMC Proc 2011, 5(Suppl 8): 

O9, Nov 22. 

P114 

Characterization of recombinant IgA producing CHO cell lines by qPCR 

David Reinhart 1 , Wolfgang Sommeregger 1 , Monika Debreczeny 2 , 

Elisabeth Gludovacz 1 , Renate Kunert 1* 

1 Vienna Institute of BioTechnology, Department of Biotechnology, University 

of Natural Resources and Life Sciences, Muthgasse 11, 1190 Vienna, Austria; 

2 Vienna Institute of BioTechnology, Imaging Center, University of Natural 

Resources and Life Sciences, Muthgasse 11, 1190 Vienna, Austria 

E-mail: kunert@boku.ac.at 


Materials and methods: CHO host (ATCC CRL-9096) and recombinant cell 

lines [1] were cultivated in spinner vessels (Techne, UK) with 50 mL medium 

(ProCHO5, Switzerland), at 37°C and 50 rpm. 

Genomic DNA (gDNA) was isolated from 2 × 10 6 cells using the DNA Blood 

Mini Kit (Qiagen, Netherlands) according to the manufacturers’ instructions. 

Quantification was performed spectrophotometrically at an absorbance of 

260 nm and the purity was determined by measuring the ratio at 260 nm 

and 280 nm. gDNA samples were stored at 4°C. Cellular RNA was isolated 

from 5 × 10 6 cells using the Ambion Tri Reagent Solution (Life Technologies, 

CA) according to the manufacturers’ instructions. To remove DNA 

contaminations from extracted RNA the preparation was digested with 3 U 

DNase I (Qiagen, Netherlands) for 30 min at RT together with 160 U RNase 

inhibitor (Life Technologies, CA) and then inactivated for 10 min at 75°C 

before another RNA precipitation step. Purified total RNA was dissolved in 

25 μl RNase free water containing 60 U RNase inhibitor. cDNA was obtained 

Figure 1(abstract P113) (A) Comparability of the pH profile between the MWP reference process and the 2L bioreactor reference process. 

Additionally further pH profile and product concentration under different media compositions. (B) pH sensitive process with pH shift. The target pH, 

before and after the shift, was achieved by pH control.



Page 149 of 151 

by reverse transcription. 1.5 μg RNA,1μg random primers (Promega, WI) 

and12.5nmoldNTPs(NewEnglandBiolabs,MA)wereincubatedina 

reaction volume of 14 μl for 5 min at 70°C and 2 min at room temperature. 

Then, 40 U RNase inhibitor, 200 U M-MLV reverse transcriptase and buffer 

(both Promega, WI) were added to a reaction volume of 20 μl and 

incubated for 30 min at 37°C before denaturation for 5 min at 95°C. 

Real-time PCR (qPCR) analysis was performed on a MiniOpticon qPCR 

device (Biorad, CA). Primers and the fluorogenic hydrolysis probes were 

synthesized by Sigma (MO). Same primers and probes were used for the 

analysis of gDNA and cDNA. The reaction mix included iQ Supermix 

(Biorad, CA), 6 pmol primer and 4 pmol hydrolysis probe for HC, JC and 

ß-actin quantification or 12 pmol primer and 8 pmol hydrolysis probe for 

LC determination in 20 μl reaction volume. 3 ng pre-denatured (99°C, 10 

min) gDNA or 3 μL cDNA from a 1:50 dilution of the reverse transcription 

reaction was used directly for qPCR. Negative controls (NC), no template 

controls (NTC) and no reverse transcriptase controls (NRT) for transcript 

analysis were included in each run. The quantification cycle (Cq) was 

determined by linear regression and baseline subtraction using the CFX 

Manager (Biorad, CA). The mean qPCR efficiencies for HC, LC, JC and 

ß-actin were calculated from raw fluorescence data using the LinRegPCR 

software application, V12.17 [2]. Quantification was done by relative 

quantification with efficiency correction [3] using ß-actin as internal 

reference and expressed as ratios. 

Results and discussion: qPCR was performed in six technical replicates. 

The Cq values and calculated efficiencies were well reproducible 

(Table 1). gDNA analysis revealed an overall higher exogenic GCN for the 

low producer 4B3-IgA than for 3D6-IgA (Figure 1). On the genomic level 

clone 4B3-IgA contained two times more HC, three times more JC and 

four times more LC than 3D6-IgA. Both clones incorporated more HC 

genes than JC than LC. This could be due to the presence of the dhfr 

amplification gene on the HC plasmid, whereas the neomycin resistance 

gene was located on the JC plasmid. No selection marker was included 

on the LC plasmid. 

mRNA levels were additionally quantified by qPCR to exclude any 

misinterpretation of our analysis due to incompletely transfected 

expression cassettes, chromosomal position effects or transgene silencing. 

Despite higher gene copy numbers 4B3-IgA contained only half of HC and 

JC transcripts as compared to 3D6-IgA. LC was transcribed with the same 

range of efficiency and resulted in three times more LC mRNA copies. In 

contrast to gDNA results, LC mRNA content greatly exceeded that of HC 

and JC in both clones (Figure 1). Hence, LC content, which has been 

proposed to be critical for high antibody productivities [4], should not 

have been limited by mRNA. Summarized, the respective mRNA levels 

differed slightly between the two recombinant cell lines, but were 

presumably not sufficient for the low specific productivity of clone 4B3-IgA. 

Conclusions: An overall higher exogenic GCN was determined for the 

low producer 4B3-IgA as compared to 3D6-IgA. Both clones incorporated 

more HC genes than JC than LC. Despite higher GCNs 4B3-IgA contained 

only half of HC and JC mRNA transcripts as compared to 3D6-IgA. LC was 

transcribed with similar efficiencies whereas LC mRNA content greatly 

exceeded that of HC and JC in both clones. All in all, differences in 

specific productivity, intracellular antibody chain content and volumetric 

titers of the cell lines could not sufficiently be explained by qPCR data of 

GCN and mRNA levels. Therefore, bottlenecks are believed to occur 

further upstream in the translational and/or protein processing machinery. 

Acknowledgements: This study was funded by the European Community’s 

Seventh Framework Programme (FP7/2002-2013) under grant agreement N° 

201038, EuroNeut-41 and sponsored by Polymun Scientific Immunbiologische 

Forschung GmbH, Donaustraße 99, 3400 Klosterneuburg, Austria. 

References 

1. Reinhart D, Weik R, Kunert R: Recombinant IgA production: single step 

affinity purification using camelid ligands and product characterization. 

J Immunol Methods 2012, 378:95-101. 

2. Ramakers C, Ruijter JM, Deprez RH, Moorman AF: Assumption-free analysis 

of quantitative real-time polymerase chain reaction (PCR) data. Neurosci 

Lett 2003, 339:62-66. 

3. Pfaffl MW: A new mathematical model for relative quantification in realtime 

RT-PCR. Nucl Acids Res 2001, 29:e45. 

4. Borth N, Strutzenberger K, Kunert R, Steinfellner W, Katinger H: Analysis of 

changes during subclone development and ageing of human antibodyproducing 

heterohybridoma cells by northern blot and flow cytometry. 

J Biotechnol 1999, 67:57-66. 

P115 

Data integration methodology that couples novel bioreactor 

monitoring tools, automated sampling, and applied mathematics to 

redefine bioproduction processes 

Lisa J Graham * , Jeffrey F Breit, Lynn A Davis, Corey C Dow-Hygeland, 

Brandon J Downey 

Bend Research Inc, Bend, OR, USA 

E-mail: lisa.graham@bendresearch.com 


Cell physiology dynamically affects the nutrient requirements of a culture. 

It is critical to obtain data over appropriate time intervals to assess the 

Table 1(abstract P114) Calculated efficiencies (E), Cq and ΔCq values and copies relative to ß-actin for gDNA and 

cDNA derived from clones 3D6-IgA and 4B3-IgA 

GOI Target Clone Cq max. SD [%] E SD (%) ΔCq ß-actin Copies relative to ß-actin 

ß-actin gDNA 3D6-IgA 24.60 0.20 2.07 2.22 n/a n/a 

4B3-IgA 24.21 0.14 2.07 2.22 n/a n/a 

cDNA 3D6-IgA 18.52 0.13 2.03 0.43 n/a n/a 

4B3-IgA 16.25 0.63 2.04 1.33 n/a n/a 

HC gDNA 3D6-IgA 23.56 0.16 1.95 3.32 -1.03 8.28 

4B3-IgA 22.11 0.14 1.95 3.32 -2.11 16.44 

cDNA 3D6-IgA 21.78 0.17 1.91 1.35 3.26 0.38 

4B3-IgA 19.50 0.68 1.97 1.53 3.25 0.20 

JC gDNA 3D6-IgA 24.81 0.03 1.95 0.94 0.22 3.80 

4B3-IgA 22.77 0.10 1.95 0.94 -1.44 11.20 

cDNA 3D6-IgA 24.52 0.23 1.82 0.87 5.97 0.22 

4B3-IgA 20.81 1.54 1.96 0.27 4.56 0.10 

LC gDNA 3D6-IgA 24.90 0.14 2.05 0.59 0.31 0.98 

4B3-IgA 21.50 0.21 2.11 1.21 -2.71 4.40 

cDNA 3D6-IgA 20.26 0.20 1.88 0.75 1.73 1.30 

4B3-IgA 15.02 2.36 1.98 1.30 -1.22 3.93



Page 150 of 151 

Figure 1(abstract P114) Gene copy number and transcript level of recombinant clones expressing 3D6-IgA or 4B3-IgA. The abundance of LC 

( ), JC ( ) and HC ( ) genes was calculated relative to ß-actin. 

impact of process conditions on the cell population. By optimizing 

bioreactor operation, feed strategies and media composition, we can limit 

the number of experiments to obtain the empirical data sets. 

For this poster, we present an emerging process-development methodology 

that is based on applying novel and existing bioreactor monitoring 

technologies, coupled with applied mathematics, to bioreactor processes. This 

approach employs tools like dielectric spectroscopy, aseptic autosamplers, 

and cell-based bioreactor models. We will illustrate how information gained 

from these tools can be coupled through utilization of the proper data 

integration and applied mathematics techniques. 

The knowledge gained using this improved process development 

methodology also supports a less-invasive monitoring and feedback 

system, and can be implemented using a customized bioreactor control 

code. 

P116 

Multicellular tumor spheroids in microcapsules as a novel 3D in vitro 

model in tumor biology 

Elena Markvicheva 1* , Daria Zaytseva-Zotova 1 , Roman Akasov 1 , Sergey Burov 2 , 

Isabelle Chevalot 3 , Annie Marc 3 

1 Shemyakin-Ovchinnikov Inst Bioorg Chem Rus Acad Sci, 117997 Moscow, 

Russia; 

2 Institute of Macromolecular Compounds Rus Acad Sci, 199004 St- 

Petersburg, Russia; 

3 CNRS, Laboratoire Réactions et Génie des Procédés, UMR 

7274, Université de Lorraine, Vandoeuvre-lès-Nancy Cedex, 54505, France 

E-mail: lemarkv@hotmail.com 


Background: Advantages of microencapsulation as a 3D growth system 

are chemically and spatially defined 3D network of extracellular matrix 

components, cell-to-cell and cell-to-matrix interactions governing 

differentiation, proliferation and cell function in vivo. The study is aimed at 

i) optimization of techniques for preparing microcapsules; ii) generation of 

multicellular tumor spheroids (MTS) by culturing tumor cells in the 

microcapsules; iii) study of anticancer treatment effects for both 

photodynamic therapy (PDT) and anti-cancer drug screening. The model 

allows to estimate drug doses or parameters for PDT in vitro before 

carrying out preclinical tests, and thereby to reduce a number and costs of 

experiments with animals commonly used. 

Materials and methods: To form MTS, tumor cell lines (mouse melanoma 

cells M3, human breast adenocarcinoma cells MCF-7, mouse myeloma Sp2/ 

0 cells, human CCRF-CEM and CEM/Cl cell lines, HeLa) were encapsulated 

in polyelectrolyte microcapsules (200-600 μm), and cultivated for 3-4 

weeks [1]. Microcapsules were fabricated from alginate (polyanion) and 

various polycations, namely natural polymers (modified chitosan, DEAEdextran 

etc) and novel smart co-polymers (e.g. chitosan-graft-polyvinyl 

alcohol copolymers) synthesized by a Solid-State Reactive Blending 

technique [2]. The copolymers were characterized by FTIR, GPC and 

elemental analysis. 

Results: MTS based MCF-7 cells were prepared and used to study 

effects of PDT. To study the effect of irradiation parameters on cell 

viability, 2 photosensitizers (PS), namely photosense and chlorine e6 

were used. Phototoxicity of PS depended on PS concentration and light 

energy density in both monolayer culture (MLC) and MTS. Study of cell 

morphology in MLC and MTS before and after PDT revealed that light



Page 151 of 151 

energy density increase within the range of 30-70 J/cm2 resulted in cell 

apoptosis. However, cell survival in MTS was much higher than this in 

the MLC. MTS were also used to test some antitumor therapeutics 

(methotrexate, doxorubicin and their derivatives). An enhanced cell 

resistance in MTS compared to MLC both for normal and Dox-resistant 

cells (MCF-7, MCF-7/DXR, respectively) were observed. MTS were also 

proposed to evaluate cytotoxicity not only of novel therapeutics but 

also nanosized drug delivery systems (liposomes, micelles, nanoparticles 

and nanoemulsions). 

Acknowledgements: The authors are greatful to Dr. T. Akopova 

(Moscow) for synthesis of chitosan-graft-polyvinyl alcohol copolymers 

used in this study. The authors also thank CNRS and Russian foundation 

for basic research for support of the research (PICS-Russia project N° 

5598 - 2010-2012). 

References 

1. Zaytseva-Zotova D, Marc A, Chevalot I, Markvicheva E: Biocompatible 

Smart Microcapsules Based on Chitosan-Poly(Vinyl Alcohol) Copolymers 

for Cultivation of Animal Cells. Adv Eng Mater 2011, 13:B493-B503. 

2. Akopova TA, Moguilevskaia EL, Ozerin AN, Zelenetskii AN, Vladimirov LV, 

Zhorin VA: Proc Int Conf Mechanochemical Synthesis and Sintering Novosibirsk 

2004, 199. 

Cite abstracts in this supplement using the relevant abstract number, 

e.g.: Markvicheva et al.: Multicellular tumor spheroids in microcapsules 

as a novel 3D in vitro model in tumor biology. BMC Proceedings 2013, 7 

(Suppl 6):P116

Download PDF (all abstracts) - BioMed Central

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?