pSAT vectors: a modular series of plasmids for - Stony Brook ...

stonybrook.edu

pSAT vectors: a modular series of plasmids for - Stony Brook ...

507

(A)

PI-PspI

AgeI

2X35S

PI-PspI

NcoI* XbaI NotI

EGFP

EYFP

TL ECFP ter pSAT6-AFP-C1

Citrine

DsRed2

MCS

stop

TAC AAG TCC GGA CTC AGA TCT CGA GCT CAA GCT TCG AAT TCT GCA GTC GAC GGT ACC GCG GGC CCG GGA TCC ACC TAG TCT AGA

AFP

BglII XhoI SacI HindIII EcoRI PstI* SalI KpnI SacII ApaISmaI BamHI XbaI

(B)

PI-PspIPI-

AgeI

NcoI*

XbaI NotI

PspI

EGFP

EYFP

2X35S

TL

MCS

ECFP

Citrine

ter

pSAT6-AFP-N1

DsRed2

Met

GCC ATG GTC CGG ACT CAG ATC TCG AGC TCA AGC TTC GAA TTC TGC AGT CGA CGG TAC CGC GGG CCC GGG ATC CTG ATG GTG

AFP

NcoI*

BglII XhoI SacI HindIII EcoRI PstI* SalI KpnI SacII ApaI SmaI BamHI

(C)

PI-PspI

AgeI

NcoI XbaI NotI

PI-PspI

2X35S

TL

MCS

ter

pSAT6-MCS

GCC ATG GTC CGG ACT CAG ATC TCG AGC TCA AGC TTC GAA TTC TGC AGT CGA CGG TAC CGC GGG CCC GGG ATC CAC CTA GTC TAG AGT

NcoI

BglII XhoI SacI HindIII EcoRI PstI SalI KpnI SacII ApaI SmaI BamHI

XbaI

(D)

(E)

pSAT1

pSAT2

pSAT3

pSAT4

pSAT5

pSAT6

pSAT7

AscI

I-PpoI

I-PpoI

I-SceI

I-CeuI

PI-PspI

PI-Tli I

AgeI

expression cassette

pSAT1 ...GCC

pSAT2 ...GCC

pSAT3 ...GCC

pSAT4 ...GCC

pSAT5 ...GCC

GGCGCGCC

GCTACCTTAAGAGAG

GCTACCTTAAGAGAG

ATTACCCTGTTATCCCTA

TCGCTACCTTAGGACCGTTATAGTTA

ACCGGT...//...CGCGGCCGC

ACCGGT...//...CGCGGCCGC

ACCGGT...//...CGCGGCCGC

ACCGGT...//...CGCGGCCGC

ACCGGT...//...CGCGGCCGC

GGCGCGCC

GGCGCGCC

GCTACCTTAAGAGAG

ATTACCCTGTTATCCCTA

TCGCTACCTTAGGACCGTTATAGTTA

GTA...

GTA...

GTA...

GTA...

GTA...

pSAT6 ...GCC ACCCATAATACCCATAATAGCTGTTTGCCA ACCGGT...//...CGCGGCCGC ACCCATAATACCCATAATAGCTGTTTGCCA GTA...

pSAT7 ...GCC CATAAAGCCGTCAGTGTCCGCATAAAGAACCACCGGT...//...CGCGGCCGCCATAAAGCCGTCAGTGTCCGCATAAAGAACCGTA...

NotI

AscI

AscI

I-PpoI

I-SceI

I-CeuI

PI-PspI

PI-Tli I

(F)

AscII- PpoII- SceII- CeuIPI- PspIPI- Tli I

pPZP-RCS1 RB LB

(G)

rare cutter

expression cassette replacement

or multi-cassette assembly

marker gene replacement

NcoI

XbaI

rare cutter

AscII- PpoII- SceII- CeuIPI- PspIPI- Tli I

pPZP-RCS2 LB RB

MCS

2X35S TL AFP ter

XbaI NotI

AgeI

NcoI terminator

promoter replacement replacement

pSAT6-AFP-C1/N1

MCS

AFP

C- or N-terminal AFP fusion

More magazines by this user
Similar magazines