Polymerization and Sequence

uic.edu

Polymerization and Sequence

Polymerization and Sequence

Storage of information and function are

based on very large molecules

(macromolecules) built from sequentially

added subunits (each of which is a

moderately sized molecule).

Lecture 6 Exam 1

UIC BioS 101 Nyberg 1


Reading Assignment

►I I have assigned chapters 3 & 4 as the

reading for this lecture. There is a lot of info

in those chapters (most(

most is also covered in BioS 100).

►I I recommend concentrating your studying

on the understanding the significance of the

sequence order in nucleic acids and

proteins.

Lecture 6 Exam 1 UIC BioS 101 Nyberg 2


The basics

►Reading and storing biological information is

done linearly and directionally.

►Linear means that there are no branches or

switch points.

►There is a beginning and an end in

biological information expression.

Lecture 6 Exam 1 UIC BioS 101 Nyberg 3


Building Macromolecules

►Biologically important macromolecules are

polymers built through linking of subunits,

called polymerization.

►In biological polymers the order of the

subunits (parts) is critical. Biological

‘information’ is read linearly and

directionally (like written language).

Lecture 6 Exam 1 UIC BioS 101 Nyberg 4


Major Biological Polymers

►DNA

and RNA are nucleic acids that store

information in the sequence of bases

attached to the ‘backbone’ of a chain.

►A Protein is a specific sequence of amino

acids linked together linearly. The sequence

of amino acids is known as the primary

structure of the protein.

Lecture 6 Exam 1 UIC BioS 101 Nyberg 5


Nucleic Acids

►The

nucleotide is the subunit of nucleic

acids.

►A A single nucleotide has 3 parts:

• one Nitrogenous base

• one 5 carbon sugar

• Phosphate (1 to 3)

►The subunits are linked together with a

repeating sugar-phosphate(

phosphate(-sugar-

phosphate) ‘backbone’.

Lecture 6 Exam 1 UIC BioS 101 Nyberg 6


Nucleotides

►All nucleotides have a nitrogenous base

attached to the sugar and a phosphate

attached to the sugar at a different place.

►The sugar in DNA is different than RNA

• DNA sugar is deoxyribose

• RNA sugar is ribose

►The nitrogenous bases are of two types,

purines and pyrimidines.

Lecture 6 Exam 1 UIC BioS 101 Nyberg 7


Nucleotide Pairing

►DNA has only four different nitrogenous

bases: Cytosine (C)(

) and Thymine (T)(

) are

pyrimidines, , Adenine (A)(

) and Guanine (G)(

are purines.

►DNA is actually two very long molecules

held together by many hydrogen bonds

between a purine on one strand and a

pyrimidine on the other.

►A pairs with T; G pairs with C

Lecture 6 Exam 1 UIC BioS 101 Nyberg 8


A segment of DNA

►ATCGCTACATGAT

TAGCGATGTACTA

a DNA double strand

Each line represents consecutive bases in a strand

(=molecule) of DNA. The two strands are held

together by hydrogen bonds.

The strands have a direction when one looks at the

chemical details. By convention the top strand is

5’ to 3’ 3 and the bottom strand is therefore 3’ 3 to 5’. 5

Lecture 6 Exam 1 UIC BioS 101 Nyberg 9


Complementarity

►Because of base pairing, knowing the

sequence of one strand tells one the

sequence of the other DNA strand, so often

the sequence of only one is given (5’ to left).

►When the strands match they are said to be

complementary.

►The two strands of double stranded DNA will

separate (melt) when the temperature is

raised (75 to 80° C). They match up perfectly

when the temp is slowly cooled.

Lecture 6 Exam 1 UIC BioS 101 Nyberg 10


Sequence Combinations

►Question: How many different DNA

sequences are there that are 5 bases long?

►There are 4 ‘letters’ in the DNA ‘alphabet’.

►Like languages the letters are read in a

direction (AT is different than TA)

►Solution: 4 possible choices for 1 st position,

4 possible for 2 nd , etc., so 4x4x4x4x4=1024

= 4 5 = 2 10 .

Lecture 6 Exam 1 UIC BioS 101 Nyberg 11


Long Sequences

won’t t match by chance

►If one has a sequence 20 bases long, there

are 4 20 different possible sequences, or

somewhat more than 10 12 , or a thousand

billion.

►Only one out of the 10 12 possible will be an

exact match to that sequence. Only 60

sequences (20 positions x 3 possible nonmatches

per position) will have one nonmatch.

Lecture 6 Exam 1 UIC BioS 101 Nyberg 12


Comparing DNA sequences

► Species B GGGTACCTATGCGAATATTCAT

BC different ** * *

► Species C CAGTGCCTAAGCGAATATTCAT

AC different * * *

► Species A CGGTACCTATGCGAATATTCAT

AB different *

Among these 3 species, A & B are closest.

Their sequences differ only at position 1.

Lecture 6 Exam 1 UIC BioS 101 Nyberg 13


Long Similar Sequences

►Long sequences in different organism that

are similar probability have a common

origin. The probabilities that two sequences

are similar through chance (independent

origins) are very low.

►Phylogeny is inferred by measuring

sequence similarity.

Lecture 6 Exam 1 UIC BioS 101 Nyberg 14


Probing for a match

►The ability to take a piece of known sequence

and mix it with diverse pieces and then

determine if any piece in the mix is an exact

match is the source of the power of DNA

technology.

►Ability to find exact complement out of

billions of combinations allows one to find ‘a

needle in a haystack’.

Lecture 6 Exam 1 UIC BioS 101 Nyberg 15


Human Genetic Uniqueness

► Though we share most sequences with all other

humans, each individual can be uniquely identified

genetically (with the exception of identical twins).

► DNA survives outside of the body and usually

some long pieces can be recovered from bits of

tissue a 100 years old.

► DNA testing has resulted in the exoneration of

many individuals convicted of crimes based on

techniques available before it was possible to run

DNA tests (especially true in rape cases).

Lecture 6 Exam 1 UIC BioS 101 Nyberg 16


Separating DNA by size

►The phosphate groups in the DNA backbone

have a negative charge.

►Gel electrophoresis separates DNA pieces by

their length. Shorter lengths migrate more

quickly through the ‘maze’ of gel strands.

►The nucleic acid molecule migrate toward

the positive pole of an electrical gradient.

Lecture 6 Exam 1 UIC BioS 101 Nyberg 17


RNA, another nucleic acid

►RNA has the ribose sugar instead of

deoxyribose.

►RNA has Uracil (U)) in place of Thymine as a

pyrimidine.

►The most important difference is that RNA

molecules are normally single stranded

rather than double stranded like DNA.

Lecture 6 Exam 1 UIC BioS 101 Nyberg 18


Types of RNA

►Messenger RNA carries the information

necessary to build a protein.

►Transfer RNA is connected to amino acids

and assures the order of amino acids as the

message is translated.

►Ribosomal RNA is the major component of

the ribosome, the organelle on which

translation takes place.

Lecture 6 Exam 1 UIC BioS 101 Nyberg 19


Folding single strands

►Single-stranded RNA often has regions (6-

12 bases long) in different places that would

be complementary if the molecule folded

back on itself.

►The folds create double-stranded regions

and allow a greater diversity of shape in

RNA (compared to DNA).

►RNA molecules are shorted than DNA and

take on diverse shapes and configurations.

Lecture 6 Exam 1 UIC BioS 101 Nyberg 20


The Central Dogma

►DNA makes DNA = replication

►DNA makes RNA = transcription

►RNA makes protein = translation

►DNA stores information and allows it to be

transmitted.

►Proteins perform function.

Lecture 6 Exam 1 UIC BioS 101 Nyberg 21


Proteins

►As with DNA, proteins are made up as a

sequence of subunits. The order of the

amino acids determines the properties of

the protein.

►Though the first molecules sequenced were

proteins, today it is much easier to

sequence nucleic acids. The amino acid

sequence can be determined from the DNA.

Lecture 6 Exam 1 UIC BioS 101 Nyberg 22


Amino acids

►All amino acids have a central carbon that is

attached to:

• A hydrogen

• An amino group –NH

2

• A carboxyl acid group –COOH

• A ‘side chain’ of which there are 20 different

types.

Lecture 6 Exam 1 UIC BioS 101 Nyberg 23


Protein Function

►The 3D shape of the protein is what enables

the protein to perform specialized functions.

►The side chains of amino acids have

diversity in polarity, charge and elemental

composition. That diversity is what creates

the possibility of fine adjustments to shape.

Lecture 6 Exam 1 UIC BioS 101 Nyberg 24


Problem

►If there are 20 possible amino acids per

position, what is the minimum length of a

polypeptide (# of units) that would have

over 1 million possible different sequences?

Lecture 6 Exam 1 UIC BioS 101 Nyberg 25


Vocabulary

► ‘Backbone’

► Base pairing

► Combinations

► Complementary

► Consecutive

► Directional

► Electrophoresis

► Genetic uniqueness

► Position

► Primary structure

► Probability

Sequence

Lecture 6 Exam 1 UIC BioS 101 Nyberg 26

More magazines by this user
Similar magazines