Views
3 years ago

Dr. Joseph Irudayaraj - Center for Food Safety Engineering - Purdue ...

Dr. Joseph Irudayaraj - Center for Food Safety Engineering - Purdue ...

11/24/2009 Spectral

11/24/2009 Spectral Resolution comparison Trapping of E. coli using Magnetic Nanoparticles and FTIR detection • Cost: $9000 vs $125000 (Benchtop) • Wt: 3.5lbs; Operation: 15 0 C - 60 0 C Biosensor concept validation in a Portable system Rapid formation of Nanoparticle mediated bacterial clusters – an indirect signal enhancement 30 25 (a) 1005 cm -1 956 cm -1 1058 cm -1 (b) Absorbance (arbitrary unit) 20 15 (c) 10 0.04 5 0 P-O in P-O-C Nucleotide "fingerprints" v(P=O) sym Absorbance (arbitrary unit) 0.03 0.02 0.01 1200 1180 1160 1140 1120 1100 1080 1060 1040 1020 1000 980 960 940 920 900 Wavenumber (cm -1 ) 0.00 900 1000 1100 1200 1300 1400 Wavenumber (cm -1 ) 1500 1600 1700 1800 Portable Mid-IR Biosensor for pathogen detection 0.025 0.02 Separation and detection of multiple pathogens using Magnetic SERS probes Magnetic Nanoprobe concept: b Absorbance (arbitrary unit) 0.015 0.01 0.005005 0 900 Nucleic Acids related peaks 1100 1000 1200 1300 1400 Protein related peaks a 1600 1500 1700 1800 Magnetic nanoparticles are coated by silica to provide better biocompatibility and surface properties SERS Nanoprobes: to detect bacteria with high sensitivity Wavenumber (cm -1 ) Sensitivity : ~ 10 4 CFU/ml Detection time: Less than 30 minutes Samples: Skimmed Milk, 2% Milk, Spinach, etc. R R Antibody Ravindranath et al. 2008. Biofunctionalized magnetic nanoparticle integrated mid‐infrared pathogen sensor for food matrices. Analytical Chem, 81(8):2840‐2846. Simply change the Raman Reporters (RR) and antibody, multiple bacterial identification can be achieved . 4

2200 2000 1800 1600 1400 1200 1000 800 600 400 200 0 200 400 600 800 1000 1200 1400 1600 1800 2000 2200 2000 1800 1600 1400 1200 1000 800 600 400 200 200 400 600 800 1000 1200 1400 1600 1800 2000 11/24/2009 Separation and detection of pathogens in a food matrix Detection in Peanut butter by SERS 2800 blind experiment in peanut butter 2400 1576 Intensity (a.u) 2000 1600 1200 1073 800 400 0 0 200 400 600 800 1000 1200 1400 1600 1800 2000 Raman Shift (cm -1 ) Blind experiment for detection in peanut butter. The spectrum indicates that the pathogen is S. typhimurium. MNPs3 TEM/photographs of MNPs (A) and as-prepared MNPs@SiO 2 (B) Intensity S. Aureus e d c b a Raman Shift (cm -1 ) SERS spectra for S. aureus and S. tyhpimurium in peanut butter (a. 0 cfu/mL; b. 10 3 cfu/mL; c. 10 4 cfu/mL; d. 10 5 cfu/mL; e. 10 6 cfu Intensity S. Tyhpimurium e d c b a Raman Shift (cm -1 ) Single Molecule Quantification Aptamers for Sal. typ. 33 ATGGCGGCGTCACCCGACGGGGACTTGACATTATGACAG 44 GAGGAAAGTCTATAGCAGAGGAGATGTGTGAACCGAGTAA Research Summary Phase II 1.5 fL; 10 μW G() 0.8 .25 nM Aptamer 33 + Salmonella 0.7 Aptamer 33 0.6 Fit 0.5 0.4 0.3 0.2 0.1 0.0 -0.1 1E-3 0.01 0.1 1 10 100 1000 Time (ms) • Portable mid‐infrared biosensor assay conceptualized and demonstrated (2% milk, milk, spinach) • Multiplex detection with a separation step using uv‐vis platform • Multiplex detetcion using Raman (Peanut butter) • Single molecule quantification Quantifying receptor characteristics using single molecule spectroscopy POSTER Overall Deliverables (June 2007 –March 2009) Publications 1) Sandeep, R., Mauer, L., Debroy, C. and Irudayaraj, J. 2008. A portable spectroscopic biosensor for pathogen detection in complex matrices. Analytical Chemistry, 81(8):2840‐ 2846. 2) Wang, C. and J. Irudayaraj. 2008. Gold nanorod probes detects multiple pathogens. Small, 4(12):2204‐2208. 3) Wang, C. and J. Irudayaraj. 2008. Multifunctional nanoprobes for separation, detection, and photothermal h ablation of multiple l foodborne pathogens. Small (In Press) 4) Sandeep, R., Mauer, L., Debroy, C. and Irudayaraj, J. 2009. A cross platform biosensors approach to detect pathogens. (In Preparation). 5) Wang, Y., Sandeep, R., and Irudayaraj, J. 2009. Separation and detection of multiple pathogens in a food matrix by SERS probes. (In Preparation) 6) Wang, Y. and Irudayaraj, J. 2009. Silver nanocrystams for direct fingerprinting of pathogens. (In Review) 7) Irudayaraj, J. 2009. “Pathogen Sensors”, special issue of Sensors. Acknowledgement This work was supported through a cooperative agreement with the Agricultural Research Service of the U.S. Department of Agriculture project number 1935‐42000‐035 and the Center for Food Safety Engineering at Purdue University. 5

Download Report - Center for Food Safety Engineering - Purdue ...
Download Report - Center for Food Safety Engineering - Purdue ...
J. Irudayaraj - Center for Food Safety Engineering - Purdue University
Download Report - Center for Food Safety Engineering - Purdue ...
Michael Ladisch - Center for Food Safety Engineering - Purdue ...
2012 Newsletter - Center for Food Safety Engineering - Purdue ...
Annual Report - Center for Food Safety Engineering - Purdue ...
Dr. Lihan Huang - Center for Food Safety Engineering - Purdue ...
2002 Annual Report - Center for Food Safety Engineering - Purdue ...
Dr. Richard Linton - Center for Food Safety Engineering - Purdue ...
Annual Report - Center for Food Safety Engineering - Purdue ...
Dr. Saumya Bhaduri - Center for Food Safety Engineering
The Pathogen Reduction Act - Center for Food Safety Engineering ...
Download Report - Center for Food Safety Engineering - Purdue ...
Download Report - Center for Food Safety Engineering - Purdue ...
Dr. Joseph Chow, Ryerson Engineering "Sustainable Rail ...
NASA Engineering & Safety Center NESC - NASA Risk ...
Arun Bhunia - Center for Food Safety Engineering - Purdue University
Arun Bhunia - Center for Food Safety Engineering - Purdue University
Dr. Joseph Irudayaraj - Center for Food Safety Engineering - Purdue ...
Dr. Michael Ladisch - Center for Food Safety Engineering - Purdue ...
Microbial Food - Center for Food Safety Engineering - Purdue ...
Multiplex PCR reaction - Center for Food Safety Engineering ...
BARDOT - Center for Food Safety Engineering - Purdue University
Yiping He - Center for Food Safety Engineering
Dr. Xianming Shi - Center for Food Safety Engineering
Research Projects - Center for Food Safety Engineering - Purdue ...
Xianghe Yan - Center for Food Safety Engineering
bhunia talk 1 multi pathogen screening - Center for Food Safety ...
Detection of Viral and Vibrio Pathogens - Center for Food Safety ...