Michael Ladisch - Center for Food Safety Engineering - Purdue ...

cfse.purdue.edu

Michael Ladisch - Center for Food Safety Engineering - Purdue ...

11/14/2007

Engineering of Biosystems for Detection

of Listeria monocytogenes in Foods

Michael Ladisch, Arun Bhunia, Rashid

Bashir, Paul Robinson, Richard Linton

Center for Food Safety Engineering

Agricultural and Biological Engineering

Electrical and Computer Engineering

Biomedical Engineering

Food Science

Laboratory of Renewable Resources Engineering

Purdue University

Acknowledgments

Dr. Jim Lindsay, Dr. Shu-I Tu

USDA Cooperative Agreement ARS 1935-42000-035

Eastern Regional Research Center

Center for Food Safety Engineering

Andres Rodriguez, LORRE and ABE

Bruce Applegate, Department of Food Science,

Dr. Mira Sedlak, LORRE, for transforming

L. monocytogenes and E. coli with RFP and GFP genes.

Nate Mosier, ABE

Co-founders of Biovitesse include Michael Ladisch and Rashid Bashir;

Arun Bhunia is a consultant for Biovitesse

Acknowledgements

• All past students and researchers

• Adam Wright, David Suang, Jaeho Shin,

Nathaniel Frank, Peter McKinnis, Thomas kreke,

Xingya (Linda) Liu, Andres Rodriguez

• Ok Kyung Koo, Kristin Burkholder, Balamurugan

Jagadeesan, Sarimar Medina, and Krishna

Mishra

• Priya Banada, Shantanu Bhattacharya, Yi-Shao

Liu, Shuaib Salamat, Demir Akin

Outline

Introduction and Background: Goals

Rapid Cell Concentration and Recovery (CCR)

Membrane Systems: Fouling and bacterial capture

Mammalian cell receptor for capture of pathogens on

biochip/biosensor surface

Microfluidics device design for pathogen detection:

systems Integration of biochip functions

Conclusions/Next steps

Biochip Detection Process

100-250ml fluid 100ul fluid (w. cells) Biochip sensor Readout

Sample Off-chip

Concentration

Detection/

ID

• Water

Food

• Air

• Body Fluids

Sample

100 – 250 ml

Automated Off-Chip

Cell Concentration And

Recovery - 1000X

~ 40 min

On-Chip

Processing

~ 30 min ~ 1- 3 hr

Goal: Total Time less than < 4 hours

Data Analysis/

Results

Electrical Detection

of cell Growth

Bashir et al, 2004

Goals

Detect low levels of foodborne pathogens

in complex and various foods

and in quick and precise way

Achieve rapid sample preparation

Scale-down of bioseparations

couple to specific and rapid detection

Biochip: Buffers, Receptors, Devices

Amplify, detect, identify pathogens

Sample volumes of 100 μL at 10 cell level

1


)

11/14/2007

Benchmarks (Metrics)

Concentrate sample containing bacteria

Final concentration of 10 3 to 10 4 cells / mL

Final viable cell count on chip > 10 cells

Concentrate cells in 30 min

Process samples in 60 min

Maintain cell viability

Introduce samples on chip, detect cells in 3 hr

Membrane Concentration

Recognizing Role of Liquid Film

~700 cells / ml x 50 ml

Syringe holder

Assumption: 1mg=1 μl

Liquid film

Membrane filter

Membrane retains 15 μl of liquid

Liquid film concentrates 10 4 cells into a volume of 15 μl of liquid.

Concentration factor equivalent to 6.7 x 10 6 cells / mL

Challenges: membrane fouling, recovering viable cells after concentration

Chen et al, 2005

Flat Membrane CCR: 100 mL sample volume

Syringe pump

(Harvard)

Air space

Liquid/Sample

47 mm Filter

holder

Screen filter assembly

Waste container

Liu et al, 2005; Banada et al, 2007

Minimum Number of Cells in Sample

for Recovery by CCR

f cells (Log10

Required number of

cfu/mL)

10

3.4 3.9

3.39

2000 cfu / ml

4.5

5.3

51 5.1

5.9

Banada et al, 2007

1

0 2 4 6 8 10

To recover an inital cell number of (Log10 cfu/mL)

6.9

8.1

Larger Volumes = Higher Sensitivity

Cross Flow HF Microfiltration

Flat membranes have limit of 120 mL before flow stops

Moderating loss of permeation rate (flux) and increasing throughput

1. Lipases and proteases may hydrolyze macromolecules

believed to cause pore occlusion; improvement in permeability is small

2. High cross membrane fluid velocity

3. Low trans-membrane pressure drop

Cross flow membrane configurations: hollow fiber, flat membrane

Dead end filtration has limit of 120 mL. Cross flow an alternative option.

– Liquid solution passes through the HF membrane. Particles

retained on the inner HF membrane surface and module surface.

– Permeate flux decreases rapidly.

– A fouling layer build-up causes the system to plug up

2


11/14/2007

Φ = Particle volume fraction

u v = axial velocity

v = transverse velocity

x = axial position

y = transverse position

D = hydrodynamic diffusion

coefficient

Particle Transport

y, v x, u v

∂(

uφ)

∂(

vφ)

∂ ⎛ ∂φ


+ + ⎜ D ⎟ = 0

∂x

∂y

∂y

⎝ dy ⎠

Axial Transverse

Convection Convection

Sheer Induced

Hydrodynamic

Diffusion

Boundary Conditions

• Boundary Condition at Membrane Wall:

• Zero Particle Transport

• Transverse Fluid velocity is a function of

trans-membrane pressure and the cake layer

v = f(TMP,δ) | membrane

• This function is dependant on many system

parameters and is not well characterized for

many systems

Sheer Induced Diffusion

Use the Navier-Stokes Equations to solve

for the flow and pressure field.

Balance particle transport to solve for

particle concentration and cake layer

Particulates transport occurs via convection

and Sheer induced diffusion

Equations coupled because flux is function of

trans-membrane pressure and cake layer.

Sample

inlet

Hollow Fiber Membranes

Tubing

7 inch 3 inch

Hollow fiber

Tee

Permeate side

Retentate

side

Same flowrates, much smaller cross-sectional area

Cross Flow System

Bacterial Recovery

Pump

Initial test was done with E. coli GFP

Use of Hollow Fiber System (HST)

cross-flow, 0.45 µm pore size

Done with hot dog massage

250 ml starting volume

Pressure

Gauge

Valve

Sample

Solution

Hollow Fiber

Permeate

2 filtration steps

prior to concentration

50 to 100% recovery

test milk, vegetables

3


11/14/2007

Processing of Stomached Hot Dog

Pressure, Permeate Volume vs. Time

220 mL Stomached Hot Dog Processed

250

100

90

200

80

Volume (ml)

150

100

70

60

50

40

Pressure (psi)

Volume

Pressure

30

50

20

10

Stomached

Hot dog

Homogenized

Hot Dog

Permeate

Concentrate

Liu et al, 2007

0

Initial Cell

Concentration

(cells/mL)

10 30 50 70 90 110 130 150 170 190 210

% Cell

change

(cells/mL)

Time (min)

Pressure

(PSI)

Leakage

Recovery

viable

cells

0

Total

Captured

Cells

% recovered

E. Coli

190 13 x 10 3 25-29 0.0 610 53 x 10 3 114

Cross flow hollow fiber

SEM Photos of Membrane Fouling:

with Baby Formula (contains fat)

Able to process 250 mL or more

Homogenized hot dog

Dry milk

Vegetables (leafy matter)

Mechanisms being studied

Testing being carried out

wide angle view:

axial cut membrane

Inner surface of

(765)742-9066

clean membrane

Inner Surface

Inner surface after

filtering baby formula

McKinnis, Rodriguez et al, 2007

external surface after

filtering formula.

Axial cut of clean

membrane.

axial view after

filtering formula.

McKinnis, 2007

Stainless Steel Membrane

• Stainless Steel

Construction

• Smooth Inner Surface

• Low Adhesion

• High Chemical

Resistance

• Small Pore Size

0. 1µm

Summary on Cell Concentration

Cell Concentration and recovery should

result in 1000 To 10,000 Cells / mL

CCR for a single large volume is preferred over

replicates of smaller proportions of the same

volume

Cross flow membranes are able to process

homogenized or stomached samples that

block flat membranes

4


11/14/2007

Mammalian cell receptor for

capture of pathogens on sensor

surface

Goal: to investigate if mammalian cell

receptor can be used as a capture

molecule for biosensor application

o LAP (~94 kDa), a membrane bound alcohol acetaldehyde

dehydrogenase enzyme responsible for adhesion to

mammalian cells

o Bi-functional protein: (i) Enzyme (ii) Adhesion

o N-terminal part is ALDH (acetaldehyde dehydrogenase)

o C-terminal end is ADH (alcohol dehydrogenase)

o Interacts with eukaryotic Hsp60 (chaperone protein)

o Hsp60 is present on mammalian cell surface

LAP

Hsp60

Stereographical Representation of

the Molecular Surface of the Complex

LAP and Hsp60

Hsp60 (receptor) immobilization

LAP

LAP

Ribbon model

Hsp60

LAP

Bioreceptor

Biotin

Bacteria

Biotinylated Hsp60

Streptavidint Biotinylated BSA

Hsp60

Sensor surface

K D = 1.68 X 10 -8 M

Surface topography

D. La, D. Kihara, B. Jagadeesan and A. Bhunia - Unpublished

Silicon dioxide chips with microfluidic set up

Koo et al (unpublished)

PDMS

Well area=23.039 mm 2

• Bacteria added: 5x10 7 cfu/well

• Incubate for 2 h at RT

• Wash and stain with propidium iodide

• Count under microscope (area: 130 x 98 μm)

Comparison of MAb C11E9 and Hsp60-mediated

capture of L. monocytogenes cells on silicon dioxide

surface

cell counts/area)

Net binding (c

100.00

90.00

80.00

70.00

60.00

50.00

40.0000

30.00

20.00

10.00

0.00

Receptor

Inoculation concentration

= 5 X 10 7 CFU/well

0.69

C11E9

NET binding (Cell

number/image)

65.56

Hsp60

Estimated total cell

numbers/well

Hsp60 65.56 ± 25.94 1.19E+05 ± 4.69E+04

MAb C11E9 0.69 ± 13.16 1.25E+03 ± 2.38E+04

Koo et al (unpublished)

5


11/14/2007

ance (OD490

Abosrba

3.5

3

2.5

2

15 1.5

1

0.5

0

E-cadherin (InlA)-mediated capture of L.

monocytogenes cells in microtiter plate

Hsp60

Lm counts with

receptor

w receptor

w/o receptor

E-cadherin

Lm counts without

receptor

Hsp60 2.699±0.175 0.764 ± 0.130

E-cadherin 0.463 ± 0.092 0.427 ± 0.058

Schubert et al. 2002. Cell 111:825

Koo et al (unpublished)

Specificity of Hsp60 in capturing Listeria cells with

Hsp60 coated SiO 2 surface

(Cell Number)

NET Binding

Koo et al (unpublished)

160

140

120

100

80

60

40

20

0

initial numbers added 5x10 7

CFU/well

L.monocytogenes

L.ivanovii

L.innocua

L.welshimeri

L.seeligeri

L.grayi

Lm KB208 (lap-)

Captured Listeria cells on Hsp60 coated

SiO 2 chip

L. monocytogenes (185) L. ivanovii (195) L. innocua (15)

Hsp60 mediated capture profile of

Listeria cells on SiO 2 surface

Bacteria NET binding

(counts/image a )

L.

monocytogenes

Initial

CFU/well

Estimated total

cells/well

% Capture

110.93 ± 26.29 5.80E+07 2.01E+05 ± 4.75E+04 0.401 ± 0.095

L. ivanovii 79.46 ± 60.11 4.10E+07 1.44E+05 ± 1.09E+05 0.287 ± 0.217

L. Innocua 4.92 ± 3.44 3.30E+07 8.89E+03 ± 6.22E+03 0.018 ± 0.012

L. welshimeri 1.92 ± 4.27 2.20E+07 3.46E+03 ± 7.71E+03 0.007 ± 0.015

L. seeligeri 4.72 ± 2.96 3.30E+07 8.52E+03 ± 5.35E+03 0.017 ± 0.011

L. grayi 2.52 ± 3.12 2.50E+07 4.55E+03 ± 5.65E+03 0.009 ± 0.011

Lm KB208 (lap-) 12 ± 6.25 4.40E+07 2.17E+04 ± 1.13E+04 0.043 ± 0.023

a The area for each image was 130 x 98μm.

L. welshimeri (12) L. seeligeri (7)

Koo et al (unpublished)

L. grayi (6)

Koo et al (unpublished)

LAP expression assay

Cy5

of 10 5 cells)

% Positive cells (out

6

5

4

3

2

1

0

Anti-LAP MAb

LAP

EM10 MAb

Flow cytometry

Burkholder et al unpublished

Surface LAP expression

Secondary only

Abs490

0.9

0.8

0.7

06 0.6

0.5

0.4

0.3

0.2

0.1

0

HRP

Hsp60 binding assay

Anti-Hsp60 MAb

Hsp60

LAP

Lm F4244

KB208 (lap-)

L. ivanovii

L. innocua

L. seeligeri

Microtiter plate assay

L. welshim

L. grayi

Capture profile of various food-associated microorganisms

on Hsp60-coated SiO 2 surface (Selectivity)

NET Binding (C Cell Numbe

160.00

140.00

120.00

100.00

80.00

60.00

40.00

20.00

0.00

LM: L. monocytogenes, StA: Staphylococcus aureus,

SalE: Salmonella Enteritidis, EC: Escherichia coli O157:H7,

BC: Bacillus cereus, BS: B. subtillits, PV: Proteus vulgaris,

EA: Enterobacter aerogenes, StE: Sta. epidermis

PA: Pseudomonas aeruginosa, SeM: Serretia marcensens,

CF: Citrobacter freundii, HA: Hafnia alvei,

LR: Lactobacillus rhamnosus, LC: Lb.casei,

LeuM: Leuconostoc mesenteroides

LM StA SalE EC BC BS PV EA StE PA SeM CF HA LR LC LeuM

(Inoculation concentration was ~10 7 CFU/well)

6


11/14/2007

Estimation of limit of detection (sensitivity) for Hsp60

using biochip and ELIFA (inset)

NET Binding

450

400

350

300

250

200

150

100

50

0

SiO 2

Indirect

Direct

Direct-mix

Vmax (units per sec

0.250

0.200

0.150

0.100

0.050

0.000

ELIFA

5.00E+07 5.00E+06 5.00E+05 5.00E+04 5.00E+03 5.00E+02

5.00E+07 5.00E+06 5.00E+05 5.00E+04 5.00E+03 5.00E+02

Listeria monocytogenes

ELIFA: enzyme: alkaline phosphatase, substrate: 4-methylumbelliferyl phosphate (MUP);

measurement (Ex/Em): 360/440nm

CFU

Selective capture of L. monocytogenes in the

presence of other bacteria by Hsp60 on Chip

LM SE EC Total Counts LM Counts

% capture

(LM)

1 1 1 15.42 ± 12.95 11.33 ± 10.3 73.48

1 1 0 18.9 ± 11.8 11 ± 6.29 58.2

1 0 1 17.2 ± 11.13 13.2 ± 10.86 76.74

0 1 1 58± 5.8 148 1.48

LM K-12 LbA Total Counts LM Counts

% capture

(LM)

1 1 1 18 ± 7.38 10.18 ± 6.66 56.56

1 1 0 18.6 ± 6.36 11.6 ± 5.27 62.37

1 0 1 14.1 ± 4.01 9.2 ± 3.77 65.25

0 1 1 12 ± 5.93 -- --

LM: L. monocytogenes, SE: Sal. Enteritidis, EC: E. coli

O157:H7; K-12: E. coli K-12, LbA: Lb. acidophilus

Hsp60

coated fiber

Application of Hsp60 for capture

of Listeria on optical waveguide

(Fiber Optic)

Cell Numbe

C11E9

coated fiber

160

140

120

100

80

60

40

20

0

C11E9

Hsp60

Confocal microscopy

Cell

counts/image

Total estimated cell

number/Fiber

Hsp60 92.00 ± 46.56 A 1.71E+05 ± 8.64E+04

C11E9 43.33 ± 15.62 B 8.04E+04 ± 2.90E+04

Next steps with Hsp60

• Determine capture efficiency on

microfluidic chip with or without DEP

• Determine capture efficiency on SPR

• Determine capture efficiency with magnetic

beads

• AFM to examine the binding

strength/patterns

• Determine the interaction domains for LAP

and Hsp60

Microfluidics device design for

pathogen detection: systems

integration of biochip functions

7


700µ

m Pin

In/Out ports

Epoxy adhesive

Glass cover

Cavities/

Wells

11/14/2007

Sample

100 – 250 ml

Overview of Biochip-based Detection

Process

100-250ml fluid 100ul fluid (w. cells) Biochip sensor Readout

Sample Off-chip

Concentration

• Water

Food

• Air

• Body Fluids

Detection/

ID

Data Analysis/

Results

Outline

1. Brief review of prior work

2. PCR in the “Petri Dish on a Chip”

a. Optical Detection

b. Label-Free Electrical Detection

3. Future Work

Automated Off-Chip

Cell Concentration And

Recovery - 1000X

On-Chip

Concentration

1000X

Electrical Detection

of cell Growth

Electronic

Biomolecular

identification

~ 15 - 30 min

~ 30 min ~ 1- 3 hr

~ 1- 3 hr

Lab-on-a-chip for

Detection of Live Bacteria

Liu, Park, Li, Huang, Geng,

Bhunia, Ladisch, Bashir

Dielectrophoresis

Filters an Traps for

Biological Entities

Li, Akin, Bhunia, Bashir

Integrated BioChips for Study of

Microorganisms and Cells

Conc.

Sorting

Trapping/Lysing of

Bacteria/Viruses In

Microfluidic Devices

Park, Akin, Bashir

On-chip

Fluidic Dielectrophoresis

Ports

Abbased

Capture

Selective

Capture

Micro-scale

Impedance

Spectroscopy

Growth

Detection

Nano-Mechanical

Cantilever Sensors for

Detection of Viruses

Gupta, Akin, Broyles,

Ladisch, Bashir

Nano

-probe

Array

Cell

Lysing

Cantilevers,

NanoFETs,

Nano-pores

Mech/Elect.

Detection

DNA, protein

Micro-Mechanical

Cantilevers for Detection

of Spores

Davila, Walter, Aronson,

Bashir

Nanopore Sensors

for DNA Detection

Chang, Andreadakis,

Kosari, Vasmatzis,

Bashir

Silicon Nanowires and

Nanoplates for DNA and

Protein Detection

Elibol, Reddy, Nair,

Bergstrom, Alam, Bsahir

Outline of “PCR in Petri Dish”

Current Work

• PCR reaction with a 508 bp Listeria monocytogenes

prfA gene.

• Calibration of the thin film temperature sensor on chip

using LabView data acquisition.

• Design and realization of automatic thermal cycling on

chip at low average power values.

• Development of a real time PCR protocol for Listeria

monocytogenes on chip

• Direct electrical detection of PCR products

“Lab on a Chip” with microfluidics and micro/nanosensors

On Chip PCR

System and PCR Details

Digital multi-meter for

sensing output signal

from the PMT

Gain voltage for

amplifier in PMT

module

Dual pole power

supply for bias

voltage to PMT

Photo

multiplier

tube module

Gold-plated Heater Temp Sensor

bond pads

Top Al Support

Septum Layer

Glass Cover

Edge

Biochip

Connector

PCB

Bottom Al Support

Peltier Cooler

R. Gomez, D. Morisette, R. Bashir, IEEE/ASME JMEMS, 2005

Inlet

DEP electrodes

Fluid only

(w. Abs and

Fluid and Particles

(low flow, no

growth detection)

(low flow)

particles)

Main

Deviation

Outlet

Outlet

Fluid and

particles

(large flow)

Fluid only

(large flow, no particles)

DEP deviation

electrodes

• Integration of a PMT (photomultiplier tube) module for fluorescence

detection

• 0.5µl/min flow rate at a 20Vpp DEP voltage with frequency 100 KHz in

LCGM

• PCR reagents introduced, cells lysed at 95C, and PCR cycling initiated

– SYBR Green based PCR Assay

– prfA 508 bp segment target for specfic detection of LM

– 5’CGGGATAAAACCAAAACAATTT3’ and R-

5’TGAGCTATGTGCGATGCCACTT3’

Bhattacharya, et al. 2007, Submitted

8


f

11/14/2007

Temperature (Deg. C)

100

80

60

40

20

Signal plot for the onchip

thermal cycle

PCR Thermal Cycling

Temperature (Deg. C)

100

80

60

40

20

6secs

7secs

64secs 64secs

60secs

61secs

T= 94 deg. C

T= 72 deg. C

T= 55 deg. C

Calibration of signal acquisition using SYBR

green based PCR mix

PMT voltage (V)

0.40

0.35

0.30

0.25

0.20

0.15

0.10

.5ng/ microliters at 10cycles

.5ng/ microliters at 20cycles

.5ng/ microliters at 30cycles

.5ng/ microliters at 35cycles

PMT voltage (v)

0.45

0.40

0.35

0.30

0.25

0.20

0.15

0.10

5ng/ microliters afer 10 cycles

5ng/ microliters afer 20 cycles

5ng/ microliters afer 30 cycles

5ng/ microliters afer 35 cycles

0 2000 4000 6000 8000 10000 12000

4000 4100 4200 4300 4400 4500

Time (secs)( ) Time (secs)

0.05

0.00

-005 0.05

5 10 15 20 25 30 35

Time (secs)

0.05

0.00

-0.05

5 10 15 20 25 30 35

Time (secs)

Temperature (deg. C)

100

80

60

Signal plot for active cooling (B)

Signal plot for passive cooling(A)

40 Temperature plots of passive

versus active cooling

20

1.7 °C/sec 5.1 °C/sec

0

2000 2200 2400 2600 2800

Time (secs)

• Average power 2.5 W

• Total time 112 min for active

cooling

• Times at each temperature

can be reduced

Bhattacharya, et al. 2007, Submitted

PMT Volatage (V)

0.70

0.65

0.60

0.55

0.50

0.45

0.40

0.35

0.30

0.25

0.20

0.15

0.10

0.05

0.00

-0.05

50ng/ microliter after 10 cycles

50ng/ microliter after 20cycles

50ng/ microliter after 30 cycles

50ng/ microliter after 35 cycles

5 10 15 20 25 30

Time (secs)

Average PMT Readout from first 3secs of aquisition

0.65

0.60

0.55

0.50

0.45

0.40

0.35

0.30

0.25

0.20

0.15

0.10

.5ng/ microliter initial template

5ng/ microliter initial template

50ng/ mircoliter initial template

10 15 20 25 30 35

# of cycles

End Point PCR Detection Sensitivity

Specificity Trials Without DEP

malized Fluorescence Values

from PMT

Norm

8

7

6

5

4

3

2

1

0

28%

increase

503%

increase

448%

increase

177%

increase 109%

increase

NTC pre PCR

NTC Post PCR

10 8 cells/ml prePCR

10 8 cells/ml postPCR

10 7 cells/ml prePCR

10 7 cells/ml postPCR

10 6 cells/ml prePCR

10 6 cells/ml postPCR

10 5 cells/ml pre PCR

10 5 cells/ml post PCR

Pre and post PCR summary for various cell

concentrations without DEP concentration.

lized Fluorescence Values

from PMT

Normal

5

4

3

2

1

0

109%

increase

339%

increase

220%

increase

10 5 cells/ml

pre PCR

10 5 cells/ml

post PCR

with DEP 10 5 cells/ml

pre PCR

with DEP 10 5 cells/ml

post PCR

with DEP 10 4 cells/ml

pre PCR

with DEP 10 4 cells/ml

post PCR

Pre and post PCR summary for various cell

concentrations with DEP concentration.

10 5 cells/ml, 0.5ul/min for 1.2min, 60 cells 10 4 cells/ml, 0.5ul/min for 12min, 60 cells !

Trial

#

Sample details

Listeria Innocua + E. coli

1

(control)

10

2 8 cells/ml (Listeria

Innocua + E. coli +

Listeria Monocytogenes

V7)

10

3 7 cells/ml (Listeria

Innocua + E. coli +

Listeria Monocytogenes

V7)

10

4 6 cells/ml (Listeria

Innocua + E. coli +

Listeria Monocytogenes

V7)

Bhattacharya, et al. 2007, Submitted

Pre

PCR

Post

PCR

%

incre

ase

1 1.16 16

1 2.67 167

1 1.63 63

1 1.47 47

d Fluorescence Values

from PMT

Normalized

2.5

2.0

1.5

1.0

0.5

0.0

Pre PCR Control

1

16.5%

increase

Post PCR Control

2

Pre PCR Template 1

167%

increase

Post PCR Template 1

Pre PCR Template 2

3 4

63.35%

increase

Post PCR Template 2

0.5ul/min for 1.2min,

10 6 cells/ml 600 cells

Pre PCR Template 3

47.05%

increase

Post PCR Template 3

Towards Label Free Electrical Detection

of PCR Products

Electrical Nature of DNA Molecules

• Polymerase Chain Reaction

– Target molecule doubles every cycle

Cycle # # of Molecules Conc. (#/ul)

1 2

2 4

3 8

4 16

5 32

10 1024 (10 3 ) 10 3 #/ul

20 1048576 (10 6 ) 10 6 #/ul

30 1073741824 (10 9 ) 10 9 #/ul

40 1099511627776 (10 12 ) 10 12 #/ul

• What is the minimum concentration of dsDNA molecules

(e.g. 500bp) that can be directly detected in solution using

impedance measurements ???

Z

Positive counter ions

Negative charged dsDNA backbone

Before applying electrical field

σ

E effective =E - E polarization =

k

ε 0

k ε

Cap.=

0 A

d

Positive counter ions

Negative charged dsDNA backbone

Induced dipole when DNA molecules are

probed electrically in solution

•DNA polarization (dipole effect)

•Dielectric relaxation (Debye relaxation) :

Δ

ε

ε

= ε

∞ +

1 +

j

ωτ

with L(or #)

Cap.

Z

•Counter Ion movement:

Rsol

Z

9


11/14/2007

Dielectric Relaxation of DNA in Solution

ε’

the migration of counter ions

over the entire dimension of

the DNA molecule

Local changes of

Counter-ions around the

phosphate ions

Reorientation of water

molecules around the

DNA

Proof of Concept Experiments

Top View

Side View

ε’’

α relaxation

δ relaxation

γ relaxation

-4 -3 -2 -1 0 1 2 3 4 5 6 7 8 9 10

Log Frequency

(ref: “Electrical Properties and Dielectric Relaxation of DNA in Solution”, James Baker-

Jarvis, Chriss A. Jones, Bill Riddle, NIST Technical Note 1509, 1998.)

Experiment set-up, side and topview

of device. (Measurement

equipments include a LCR meter

(Agilent 4284A), a data acquisition

system (Agilent 34905A), micromanipulators

(Micromanipulator M-

450, M-550), a computer with selfdeveloped

labview control

software.)

PDMS well

PDMS well

Interdigitated Electrodes

Label free DNA detection in DI water

Circuit Model and Parameter Extraction

500 bp dsDNA

10 9 #/µl dsDNA

Z (ohm)

Z

10 5 10 8 #/µl; + DI Control

10 4

10 9 #/µl

10 10 #/µl

10 3 10 11 #/µl

Z (ohm)

105 DI Control

100 bp

10 4

500 bp

1000 bp

10 3 Frequency (Hz)

Z

Rser

Electrolyte

Cdi

Rsol

Zdl

Zdl

Electrode

10 2 10 3 10 4 10 5

Frequency (Hz)

10 2

10 3 10 4 10 5

ε increases with # or L, C increases, Z decreases

Detection limit in DI Water for 500bp DNA = 1e9 #/μl (1.33 nM)

Rser

Zdl

Cdi

Rsol

Zdl

DNA prepared by QIAquick Gel Extraction Kit, QIAGEN, Valencia, CA

os)

1/R sol (mho

Label free DNA detection in PCR Solution

Extracted Solution Conductance

2.50E-02

2.45E-02

2.40E-02

235E02 2.35E-02

2.30E-02

2.25E-02

2.20E-02

2.15E-02

2.10E-02

2.05E-02

2.00E-02

S - 0 cycle S - 30 cycles C - 0 cycle C - 30 cycles

Sample

0 Cycle

30 Cycle

0 Cycle

Control

30 Cycle

Extracted Solution Capacitance

C di (pF)

2.30E+04

2.20E+04

2.10E+04

2.00E+04

1.90E+04

1.80E+04

1.70E+04

S - 0 cycle S - 30 cycles C - 0 cycle C - 30 cycles

Sample

1 μg starting concentration (3e8 bacterial cells)

0 Cycle

sample (PCR mix plus DNA template)

control (PCR mix only)

30 Cycle

0 Cycle

Control

30 Cycle

Cdi (pF)

Cdi (pF)

1.35E+03

1.30E+03

1.25E+03

1.20E+03

1.15E+03

1.10E+03

3.70E+03

3.60E+03

3.50E+03

3.40E+03

3.30E+03

3.20E+03

3.10E+03

Selectivity Measurements

Listeria monocytogenes

30 cycles

0 cycle

0 cycle

E. coli

30 cycles

0 cycle

30 cycles

% Change

Cdi (pF)

Listeria monocytogenes

2.70E+03

2.65E+03

30 cycles

2.60E+03

2.55E+03

2.50E+03

2.45E+03

2.40E+03 0 cycle

2.35E+03

2.30E+03

2.25E+03

Cdi % Change between

PCR 0 cycle & 30 cycles

Listeria

12

monocytogenes

10

8

6

4

2

E. coli

0

1 μg starting concentration (3e8 bacterial cells)

10


11/14/2007

Selectivity Experiment Summary (L. m. & E. coli):

• 10 - 12 % increase in Cdi with L. m. template and L. m. prfA gene primer.

• 0.5 % increase in Cdi with E. coli template and L. m. prfA gene primer.

• If primer-dimers formed, the increase in Cdi is about 9% in Cdi.

• We have to avoid primer-dimers and unspecific amplifications !

• The detection is real, i.e. Cdi will change whenever there are significant DNA

molecules.

Detection Limits

• We used 1 μg of initial genomic DNA 3e8 bacterial

cells (we used 25µl solution) ~1e7 #/µl in PCR mix

• 1e7 #/µl after 30 cycle PCR 1e16 #/µl

• 1e7 #/µl 1e4 #/nl before 30 cycle PCR

Cdi (pF)

E. coli without primer-dimer

3.70E+03

3.60E+03

3.50E+03

3.40E+03

3.30E+03

Cdi (pF)

1.60E+03

1.55E+03

1.50E+03

1.45E+03

E coli with primer-dimer

0 cycle

30 cycles

• Use 1000 cells in 0.1nl

• Mechanical Filter

• On-Chip PCR and

direct electrical

detection

Mechanical slit filter

3.20E+03

0 cycle

30 cycles

1.40E+03

3.10E+03

1.35E+03

Heat Lysing

Next Steps

Isothermal RNA Amplification

• Optimize real time PCR with fluorescence detection for reduced

time

– Also demonstrate for Escherichia coli (in progress) and Salmonella

• On-chip label-free electrical detection of PCR product in

microfluidic device

• Move to RNA detection so as to

– lower the limit of detection

– have the possibility of live/deal information about Bacterium.

• Isothermal RNA (TMA) fluorescence detection off and on chip

• Isothermal RNA amplification (TMA) electrical detection on chip

– To obviate the need for thermal cycling requirement

– To eliminate time loss in ramp up/down

(figure from the Gen-Probe Inc)

• Promoter primer binds to rRNA

target.

• Reverse transcriptase creates a

DNA copy of the rRNA target.

• The RNA - DNA duplex.

• RNAse H activity of the reverse

transcriptase degrades the

rRNA.

• Primer 2 binds to the DNA and

reverse transcriptase creates a

new DNA copy.

• Double stranded DNA template

with a promoter sequence.

Isothermal RNA Amplification

• RNA polymerase initiates

transcription of RNA from the

DNA template.

• 100 to 1000 copies of RNA

amplicon are produced.

• Promoter primer binds to each

RNA amplicon and reverse

transcriptase creates a DNA

copy.

• RNA - DNA duplex.

• RNase H activity of the reverse

transcriptase degrades the

rRNA.

Final Conclusions

• Cell concentration and recovery using large volumes

demonstrated

• Processing of complex samples (baby milk,

vegetables) begun

• Very promising receptor (hsp-60) identified for

capture of Listeria monocytogenes

• Capture demonstrated on biochips and fiber optic

biosensor

• PCR on a Chip with fluorescence detection of 60

cells

• Label-free electrical detection of PCR product on

chip initiated

(figure from the Gen-Probe Inc)

11

More magazines by this user
Similar magazines