Advances in Rice Genetics - IRRI books - International Rice ...

Advances in Rice Genetics
Edited by
G.S. Khush, D.S. Brar, and B. Hardy
2003
INTERNATIONAL RICE RESEARCH INSTITUTE

The International Rice Research Institute (IRRI) was established
in 1960 by the Ford and Rockefeller Foundations with
the help and approval of the Government of the Philippines.
Today IRRI is one of 15 nonprofit international research
centers supported by the Consultative Group on International
Agricultural Research (CGIAR – www.cgiar.org).
IRRI receives support from several CGIAR members,
including the World Bank, European Union, Asian Development
Bank, International Fund for Agricultural Development,
International Development Research Centre,
Rockefeller Foundation, and agencies of the following governments:
Australia, Belgium, Canada, People’s Republic
of China, Denmark, France, Germany, India, Islamic Republic
of Iran, Japan, Republic of Korea, The Netherlands,
Norway, Philippines, Spain, Sweden, Switzerland, Thailand,
United Kingdom, United States, and Vietnam.
The responsibility for this publication rests with the
International Rice Research Institute.
Suggested citation:
Khush GS, Brar DS, Hardy B, editors. 2003. Advances in
rice genetics. Supplement to Rice genetics IV. Proceedings
of the Fourth International Rice Genetics Symposium, 22-
27 October 2000, Los Baños, Philippines. Los Baños (Philippines):
International Rice Research Institute. 642 p.
Copyright International Rice Research Institute 2003
Mailing address: DAPO Box 7777, Metro Manila,
Philippines
Phone: +63 (2) 580-5600, 845-0563,
844-3351 to 53
Fax: +63 (2) 580-5699, 891-1292,
845-0606
Email: irri@cgiar.org
Home page: www.irri.org
Riceweb: www.riceweb.org
Rice Knowledge Bank:
www.riceknowledgebank.org
Courier address: Suite 1009, Pacific
Bank Building 6776 Ayala Avenue,
Makati City, Philippines
Tel. (63-2) 891-1236, 891-1174,
891-1258, 891-1303
Cover design: Juan Lazaro IV
Print production coordinator: George R. Reyes
Layout and design: Ariel Paelmo
Figures and illustrations: Ariel Paelmo
ISBN 971-22-0199-6

Contents
PREFACE
ACKNOWLEDGMENTS
xvii
xix
Genetics and breeding of agronomic traits
Comparing agronomic performance of breeding populations derived 3
from anther culture and single-seed descent in rice
H.P. Moon, K.H. Kang, I.S. Choi, O.Y. Jeong, H.C. Hong, S.H. Choi,
and H.C. Choi
Advances in breeding salt-tolerant rice varieties 5
B. Mishra, R.K. Singh, and D. Senadhira
Breeding for salt tolerance in rice 8
R. Ansari, A. Shereen, S.M. Alam, T.J. Flowers, and A.R.Yeo
Genetic analysis and prediction of heterosis 10
C.H.M. Vijayakumar, M. Ilyas Ahmed, B.C. Viraktamath, M.S. Ramesha,
and A. Jauhar Ali
Relationship of parental genetic diversity with heterosis in two-line and three-line 12
Philippine rice hybrids
L.S. Moreno, S.A. Ordoñez, I.A. Dela Cruz, and E.D. Redoña
Stable high-yielding ability of japonica-indica hybrid rice 15
T. Takita, K. Terashima, N. Yokogami, and T. Kataoka
Inheritance of fertility restoration of WA cytoplasm in sodic-tolerant rice hybrids 17
A. Jauhar Ali, S.E. Naina Mohammed, R. Rajagopalan,
and C.H.M. Vijayakumar
Genetic analysis of temperature-sensitive genic male sterility in rice 19
A. Jauhar Ali, S.E. Naina Mohammed, R. Rajagopalan,
and C.H.M. Vijayakumar
Complexity of inheritance of thermosensitive genic male sterility in rice 20
R.B. Li and M.P. Pandey
Characterizing tropical japonicas with wide compatibility based on isozyme 24
pattern in rice
S.S. Malik, D.S. Brar, and G.S. Khush
Effects of cytoplasm and cytoplasm-nucleus interaction in breeding japonica rice 27
D. Tao, F. Hu, G. Yang, J. Yang, P. Xu, J. Li, C. Ye, and L. Dai
Genetic analysis of hybrid breakdown in a japonica/indica cross of rice 30
T. Kubo and A. Yoshimura
Induction and use of japonica rice mutant R917 with broad-spectrum 33
resistance to blast
Mingxian Zhang, Jianlong Xu, Rongting Luo, De Shi, and Zhikang Li
Partial resistance to rice blast in the tropics 35
H. Kato, H. Tsunematsu, L.A. Ebron, M.J.T. Yanoria, D.M. Mercado,
and G.S. Khush
Developing near-isogenic lines for blast resistance in two genotypes 36
of indica rice, IR24 and IR49830-7-1-2-2
L.A. Ebron, Y. Fukuta, H. Kato, T. Imbe, M.J.T. Yanoria, H. Tsunematsu,
D.L. Adorada, and G.S. Khush
Contents
iii

Developing near-isogenic lines for rice blast resistance 39
H. Tsunematsu, M.J.T. Yanoria, L.A. Ebron, N. Hayashi, I. Ando,
D.M. Mercado, H. Kato, Y. Fukuta, and T. Imbe
Improving field resistance to blast and eating quality in Japanese rice varieties 41
Y. Uehara
Inheritance of resistance to bacterial blight in rice 45
D. Sharma
Genetic analysis of resistance to bacterial blight in rice 46
K.-S. Lee and G.S. Khush
Breeding bacterial blight–resistant rice cultivars at the Philippine Rice 49
Research Institute
R.E. Tabien and L.S. Sebastian
Inheritance and allelic relationships of rice gall midge resistance genes 51
in some new donors
Arvind Kumar, M.N. Shrivastava, R.K. Sahu, B.C. Shukla,
and S.K. Shrivastava
Genetics of submergence tolerance in rainfed rice: line × tester analysis 54
O.N. Singh, Sanjay Singh, R.K. Singh, and S. Sarkarung
Diallel analysis for cold tolerance at the germination stage in rice 56
R.P. dela Cruz, S.C.K. Milach, L.C. Federizzi, A.F. de Rosso
Inheritance of nitrogen efficiency under aluminum stress in upland rice lines 58
Y. Jagau, A. Makmur, H. Aswidinnoor, and S.H. Sutjahjo
Genetic mechanism of variegation of a chlorophyll mutant originated from 60
the cross between distantly related rice varieties
M. Maekawa and K. Noda
Major genes controlling spikelet number per panicle in rice 63
R. Mishra and M.P. Janoria
Genetic relationship between red pericarp and fertility restoration in rice 64
S. Leenakumari, R. Gopakumar, and G. Uma
Genetic analysis of morphological and related taxonomic traits in rice 67
Qian Qian, He Ping, Zheng Xianwu, Chen Ying, and Zhu Lihuang
Performance of backcrossed doubled-haploid lines of rice under contrasting 69
moisture regimes: root system and grain yield components
M. Toorchi, H.E. Shashidhar, and S. Hittalmani
Developmental genetics of internodal elongation in floating rice 72
T. Jishi and Y. Sano
Genetic divergence in photoperiod-insensitive autumn rice germplasm 74
of northeast India
R.P. Borkakati, P. Borah, and P.C. Deka
The relationship between number of nitrogen-fixing rhizobacteria and growth 77
pattern of rice varieties
K. Hirano, T. Sugiyama, A. Kosugi, I. Nioh, T. Asai, and H. Nakai
Genotype by environment interaction across normal and delayed planting 79
in rainfed lowland rice environments of eastern India
S. Singh, S. Sarkarung, O.N. Singh, R.K. Singh,
V.P. Singh, and C.B. Pandey
Using rice cultivar LGC-1 as a dietary food for patients with kidney disease 83
M. Nishimura, N. Horisue, T. Imbe, M. Sakai, and M. Kusaba
Characterization of a rice mutant showing an abnormal morphology 85
T. Kawai and H. Kitano
Genetic diversity, evolution, and alien introgression
RAPD variation in carbonized rice aged 13,010 and 17,310 years 89
H.S. Suh, J.H. Cho, Y.J. Lee, and M.H. Heu
Diphyletic origin of cultivated rice based on genetic analysis and archaeology 91
Y.I. Sato, S. Yamanaka, and Y. Fukuta
Evolutionary and molecular genetic studies at the waxy locus in cultivated 94
rice and wild relatives
S. Yamanaka, I. Nakamura, H. Nakai, and Y.I. Sato
iv
Advances in rice genetics

PCR-RFLP analysis of cpDNA and mtDNA in Oryza 96
L.J. Chen, D.S. Lee, and H.S. Suh
Evolutionary significance of varietal groups resistant to bacterial leaf blight in rice 99
T. Ogawa, N. Endo, G.A. Busto Jr., R.E. Tabien, S. Taura, and G.S. Khush
Advances in rice chromosome research, 1995-2000 103
K. Fukui
Achievements in rice cytogenetics 106
Hsin-Kan Wu and Ming-Hong Gu
Advanced cytogenetics in Oryzeae 109
S.A. Jackson, Z. Cheng, J. Jiang, and R.L. Phillips
Cell-cycle synchronization and flow karyotyping in rice 111
J.H. Lee, Y.S. Chung, D.H. Kim, K.Y. Kim, J.W. Kim, O.C. Kwon,
and J.S. Shin
High-resolution fluorescence in situ hybridization (FISH) for gene mapping 115
and molecular analysis of rice chromosomes
N. Ohmido and K. Fukui
Analysis of meiosis in rice after mutagenic treatment 117
N.A. Khailenko, A.I. Sedlovskiy, and L.N. Tyupina
Genomic relationships of the AA genome Oryza species 118
B.R. Lu, M.E.B. Naredo, A.B. Juliano, and M.T. Jackson
Characterizing hybrid and backcross derivatives of O. sativa × O. minuta 122
using species probes
S.C. Tong, M.M. Clyde, Z. Zamrod, K. Narimah, and A.L. Mariam
Genetic variation for perenniality in O. sativa/O. rufipogon derivatives 123
E.J. Sacks, K.M. McNally, L. Liu, R. Lafitte, and T. Sta. Cruz
Genetic population structures of Oryza glumaepatula and O. grandiglumis 126
distributed in the Amazon flood area
M. Akimoto and H. Morishima
Oryza glumaepatula Steud. introgression lines in rice: identification of genes 128
for reproductive barriers
Sobrizal, Y. Matsuzaki, K. Ikeda, P.L. Sanchez, K. Doi, H. Yasui,
E.R. Angeles, G.S. Khush, and A. Yoshimura
Advanced backcross analysis for transferring QTLs from O. rufipogon 130
S.N. Ahn, K.H. Kang, J.P. Suh, S.J. Kwon, H.P. Moon, H.C. Choi,
and S.R. McCouch
Wild-QTL-allele effect in the background of japonica Nipponbare 133
and indica (IR36) cultivars
T. Ishii, N.S. Bautista, K. Shimadzutsu, N. Kobayashi, N. Uchida,
and O. Kamijima
Trait-improving wild QTL alleles identified using advanced backcross QTL 135
analysis from a cross between cultivated rice, Oryza sativa,
and wild rice, O. rufipogon
N.S. Bautista, K. Shimadzutsu, T. Teranishi, S. Takamatsu,
N. Kobayashi, N. Uchida, O. Kamijima, and T. Ishii
Using new alleles from wild rice Oryza rufipogon to improve cultivated 138
rice (O. sativa) in Latin America
C.P. Martínez, P. Moncada, J. López, A. Almeida, G. Gallego, J. Borrero,
M.C. Duque, W. Roca, S.R. McCouch, C. Bruzzone, and J. Tohme
A new gene for resistance to bacterial blight from Oryza rufipogon 143
Qi Zhang, S.C. Ling, B.Y. Zhao, C.L. Wang, W.C. Yang, K.J. Zhao,
L.H. Zhu, D.Y. Li, and C.B. Chen
Identifying blast resistance in Oryza species and its introgression 145
into U.S. rice cultivars
G.C. Eizenga, T.H. Tai, F.N. Lee, and J.N. Rutger
Evaluation of O. sativa × O. glaberrima–derived lines using microsatellite markers 147
M.-N. Ndjiondjop, J. Coburn, M.P. Jones, and S. McCouch
Contents
v

Genetic analysis of pollen sterility loci found in hybrid progeny between 149
Oryza sativa and O. glabberima
K. Doi, K. Taguchi, and A. Yoshimura
A rhizomatous individual obtained from interspecific BC 1
F 1
progenies 151
between Oryza sativa and O. longistaminata
D. Tao, F. Hu, Y. Yang, P. Xu, J. Li, E. Sacks, K.L. McNally, and P. Sripichitt
Identifying late heading genes in rice using Oryza glumaepatula introgression 153
lines
P.L. Sanchez, Sobrizal, K. Ikeda, H. Yasui, and A. Yoshimura
Genetic variability of tolerance for iron toxicity in different species of Oryza 154
and their derivatives
R.D. Mendoza, J.A. Moliñawe, G.B. Gregorio, C.Q. Guerta, and D.S. Brar
Identifying subspecies-specific DNA markers in rice 157
J.H. Chin and H.J. Koh
Identifying RAPD markers to classify rice germplasm as indica or japonica 160
R.P. da Cruz, M.C.B. Lopes, S.C.K. Milach, and S.I.G. Lopes
DNA fingerprinting and phylogenetic analysis of Indian aromatic high-quality rice 162
germplasm using panels of fluorescent-labeled microsatellite markers
S. Jain, S.E. Mitchell, R.K. Jain, S. Kresovich, and S.R. McCouch
Fingerprinting of Indian scented rice by RAPD markers 166
T. Stobdan, V.K. Khanna, U.S. Singh, and R.K. Singh
Relationship between heterosis in F 1
hybrids and genetic similarity among 170
parents as measured by RAPD, SSR, and co-ancestry analysis
in japonica rice
H.J. Koh, C.W. Park, and J.H. Lee
Reproductive barriers between japonica and indica crosses 173
Y. Harushima, M. Nakagahra, M. Yano, T. Sasaki, and N. Kurata
Genetic basis of F 1
hybrid sterility and gamete formation in rice 176
R. Suzuki, N. Sawamura, T. Okazawa, Khin-Thidar, and Y. Sano
Developmental cytology on gametic abortion caused by induced 178
complementary genes gal and d60 in japonica rice
M. Tomita, H. Yamagata, and T. Tanisaka
Molecular diversity and its geographical distribution in core rice germplasm 182
W.J. Xu, S.B. Yu, S. Singh, J. Domingo, H. Bhandari, Y.F. Lu,
C.H.M. Vijayakumar, P. Bagali, S. Sarkarung, S.S. Virmani,
G.S. Khush, and Z.K. Li
Phenotypic diversity in embryo mutants induced by tissue culture in rice 184
T. Iwamoto, S.K. Hong, H. Imai, M. Matsuoka, and H. Kitano
Genetic diversity in Korean japonica rice cultivars 186
S.J. Kwon, S.N. Ahn, C.I. Yang, H.C. Hong, Y.K. Kim, J.P. Suh,
H.G. Hwang, H.P. Moon, and H.C. Choi
Genetic diversity based on isozyme pattern of rice germplasm in China 188
S.X. Tang, Y.Z. Jiang, X.H. Wei, D.S. Brar, and G.S. Khush
Differential patterns of isozyme loci of Adh and Ldh between upland 192
and lowland rice varieties
L.J. Chen, D.S. Lee, and H.S. Suh
Genetic diversity in seed storage proteins of Bangladeshi rice cultivars 194
M.S. Jahan, T. Kumamaru, H. Satoh, and A. Hamid
Genetic variation in storage protein and storage endosperm starch in local 196
rice cultivars of Myanmar
P.P. Aung, T. Kumamaru, and H. Satoh
Variation in seed storage proteins of Pakistani rice germplasm 198
S.U. Siddiqui, H. Satoh, and T. Kumamaru
Genetic diversity in rainfed lowland rice genotypes as detected by RAPD primers 200
S. Singh, S. Sarkarung, R.K. Singh, O.N. Singh, A.K. Singh, V.P. Singh,
H.S. Bhandari, W. Xu, and Z. Li
vi
Advances in rice genetics

Marker-based estimation of coefficient of coancestry in rice 203
D.A. Tabanao, L.S. Sebastian, A.L. Carpena, J.E. Hernandez,
A.I.N. Gironella, and R.N. Bernardo
Molecular cytological studies on a poly-egg rice mutant AP IV strain 207
Y. Lu and X. Liu
Molecular markers, QTL mapping, and marker-assisted selection
The application of molecular markers in rice 213
M. Christopher, S. Garland, R. Reinke, and R. Henry
Application of molecular markers in rice breeding in the Mekong Delta 216
of Vietnam
Bui Chi Buu and Nguyen Thi Lang
Converting rice RFLP markers to PCR-based markers by the dCAPS method 221
T. Komori, T. Yamamoto, and N. Nitta
DNA markers to assess genetic purity of rice hybrids 223
R.V. Sonti, J. Yashitola, T. Thirumurugan, R.M. Sundaram,
M.S. Ramesha, and N.P. Sarma
RAPD markers from mitochondrial DNA can distinguish male sterile and fertile 226
cytoplasm in indica rice
D.L. Hong, M. Ichii, Y. Ohara, C.M. Zhao, and S. Taketa
Fine mapping of the F 1
pollen sterility loci S-a and S-c in rice using 228
PCR-based markers
Guiquan Zhang and Zemin Zhang
Map-based cloning of the Hd1 gene controlling photoperiod sensitivity in rice 230
M. Ashikari, Y. Katayose, U. Yamanouchi, L. Monna, T. Fuse, T. Sasaki,
and M. Yano
Response of QTLs for heading date in rice at different sites from tropical 233
to temperate regions
Y. Fukuta, S. Kobayashi, H. Tsunematsu, L.A. Ebron, H. Kato,
T. Umemoto, S. Morita, T. Sato, T. Yamaya, T. Nagamine,
T. Fukuyama, H. Sasahara, I. Ashikawa, K. Tamura, H. Nemoto,
H. Maeda, K. Hamamura, T. Ogata, Y. Matsue, K. Ichitani,
and A. Takagi
Mapping quantitative trait loci controlling heading date in rice 238
K. Fujino, T. Sato, H. Kiuchi, H. Kikuchi, Y. Nonoue, Y. Takeuchi,
S.Y. Lin, and M. Yano
QTL analysis for heading date using recombinant inbred lines in rice 240
M. Oda, H. Yasui, and A. Yoshimura
Molecular mapping of Hwc-2, one of the complementary hybrid weakness 243
genes in rice
K. Ichitani, Y. Fukuta, K. Koba, S. Taura, and M. Sato
Molecular markers for detecting bacterial blight resistance genes 245
in maintainer lines of rice hybrids
L. Borines, E. Redoña, B. Porter, F. White, C. Vera Cruz, and H. Leung
Identifying major genes and QTLs for field resistance to neck blast in rice 248
S. Hittalmani, Srinivasachary, P. Bagali, and H.E. Shashidhar
Mapping QTLs for partial resistance to blast in rice 250
M.Z.I. Talukder, C. Leifert, and A.H. Price
Marker-assisted selection for transferring resistance to blast in high-yielding 253
but susceptible Jyothi
L. Babujee, B. Venkatesan, S. Kavitha, S.S. Gnanamanickam,
S. Leenakumari, S. McCouch, and S. Leong
Using microsatellite markers to select blast resistance in U.S. rice breeding lines 255
R.G. Fjellstrom, C. Conaway, W.D. Park, M.A. Marchetti, and A.M. McClung
Mapping a recessive gene conferring resistance to rice yellow mottle virus 257
M.N. Ndjiondjop-Nzenkam, L. Albar, D. Fargette, C. Brugidou,
M.P. Jones, and A. Ghesquiere
Contents
vii

Partial resistance to rice yellow mottle virus: QTL identification, genetic model, 259
and QTL efficiency analysis after marker-assisted introgression
N. Ahmadi, L. Albar, G. Pressoir, M. Lorieux, D. Fargette ,
and A. Ghesquière
Constructing linkage maps of brown planthopper resistance genes Bph1, bph2, 263
and Bph9 on rice chromosome 12
H. Murai, P.N. Sharma, K. Murata, Z. Hashimoto, Y. Ketipearachi,
T. Shimizu, S. Takumi, N. Mori, S. Kawasaki, and C. Nakamura
Molecular mapping and marker-aided selection of a gene conferring 265
resistance to an Indian biotype of brown planthopper in rice
K.K. Jena, I.C. Pasalu, Y. Varalaxmi, Y. Kondala Rao, K. Krishnaiah,
G. Kochert, and G.S. Khush
Mapping QTLs for brown planthopper (BPH) resistance introgressed from 268
Oryza officinalis in rice
H. Hirabayashi, R. Kaji, M. Okamoto, T. Ogawa, D.S. Brar,
E.R. Angeles, and G.S. Khush
RFLP mapping of antibiosis to rice green leafhopper 270
M. Kadowaki, A. Yoshimura, and H. Yasui
Mapping of a gene ovicidal to whitebacked planthopper Sogatella furcifera 272
Horváth in rice
M. Yamasaki, A. Yoshimura, and H. Yasui
Molecular marker association for yellow stem borer resistance in rice 274
A. Selvi, P.S. Shanmugasundaram, J.A.J. Raja, and S. Mohankumar
Chromosome blocks are involved in adaptive gene complexes 276
in rice landraces
B.V. Ford-Lloyd, P.S. Virk, M.T. Jackson, and H.J. Newbury
Drought tolerance in rice: QTLs, marker-assisted selection, and environmental 279
interactions
A. Price
Identifying traits and molecular markers associated with components 282
of drought tolerance in rice
H.E. Shashidhar, N. Sharma, M. Ashoka, V. Rao, M. Toorchi,
and S. Hittalmani
Genes/QTLs affecting flood tolerance in rice 284
K. Sripongpankul, G.B.L. Posa, D. Senadhira, N. Huang, D.S. Brar,
G.S. Khush, and Z. Li
Mapping genes that control traits related to submergence tolerance in rice 287
M. Seanglew, A. Vanavichit, S. Tragoonrung, and S. Sarkarung
Identifying QTLs for cold tolerance–related traits in a Korean weedy rice 291
J.P. Suh, S.N. Ahn, H.S. Suh, H.P. Moon, and H.C. Choi
Mapping QTLs for salt tolerance in rice 294
Nguyen Thi Lang, S. Masood, S. Yanagihara, and Bui Chi Buu
Quantitative trait loci analysis of aluminum tolerance in rice 298
V.T. Nguyen, H.T. Nguyen, B.T. Le, T.D. Le, and A.H. Paterson
Mapping QTLs for ozone resistance in rice 302
J.K. Sohn, J.J. Lee, K.M. Kim, Y.S. Kwon, and M.Y. Eun
Fine mapping of genes controlling intermediate amylose content in rice 304
using bulked segregant analysis
J. Lanceras, S. Tragoonrung, A. Vanavichit, and O. Naivikul
Association between amylose content and a microsatellite marker across 307
exotic rice germplasm
C.J. Bergman, R.G. Fjellstrom, and A.M. McClung
Molecular genetic analysis of quantitative trait loci related to rice grain quality 309
J.H. Lee, Y.S. Cho, K.H. Jung, M.T. Song, S.J. Yang, H.Y. Kim,
and H.C. Choi
Leaf senescence of a newly induced stay-green mutant and mapping of 312
the gene in rice
K.W. Cha, Y.J. Won, and H.J. Koh
viii
Advances in rice genetics

Mapping the rt (root growth-inhibiting) gene of rice by RFLP markers 314
M. Miwa, Y. Inukai, K. Satoh, M. Itoh, Y. Katayama, M. Ashikari,
M. Matsuoka, and H. Kitano
Tagging and mapping of a new elongated-uppermost-internode gene—eui2(t) 317
—using AFLP, RFLP, and SSR techniques
S.L. Yang, R.C. Yang, X.P. Qu, H.L. Ma, Q.Q. Zhang, S.B. Zhang,
and R.H. Huang
Map-based cloning of Ps1, a gene for pollen abortion in rice 319
S.Y. Lin, T. Takashi, T. Sasaki, and M. Yano
Sequence-tagged site marker diagnostics for the CMS fertility-restoring 321
gene Rf-3 in rice
Nguyen Thi Lang, S.S. Virmani, N. Huang, D.S. Brar, Z. Li,
and B.C. Buu
Genetics and mapping of the nuclear fertility restorer gene for Honglian-type 324
cytoplasmic male sterility in rice
Yinguo Zhu, Qingyang Huang, Yuqing He, and Runchun Jing
Molecular mapping and identification of QTLs for some agronomic traits in rice 326
S.J. Kwon, S.N. Ahn, J.P. Suh, Y.C. Cho, H.C. Hong, Y.G. Kim,
H.G. Hwang, H.P. Moon, and H.C. Choi
Mapping QTLs associated with tolerance for enhanced ultraviolet-B 328
radiation in rice
T. Sato, Y. Fukuta, M. Yano, and T. Kumagai
Genetic systems of cross-incompatibility as pre- and postfertilization 330
barriers in rice
K. Matsubara, R. Suzuki, Khin-Tidar, K. Okuno, and Y. Sano
Relationship between genetic distance and heterosis under different fertilizer 332
applications in rice
Z.Z. Piao, Y.I. Cho, and H.J. Koh
Isolating and characterizing molecular markers associated with seedling-stage 336
cold tolerance in rice
K.M. Kim, I.K. Chung, T.S. Kwak, and J.K. Sohn
QTL analysis for discoloration of flag leaves during the ripening period in rice 338
M. Obara, Y. Fukuta, M. Yano, T. Yamaya, and T. Sato
QTL analysis of root vitality in a doubled-haploid population derived 340
from anther culture of indica/japonica rice
Teng Sheng, Zeng Dali, Zheng Xianwu, K. Yasufumi, Qian Qian,
and Zhu Lihuang
Genomics
Rice functional genomics via cDNA microarray analysis 345
J. Yazaki, N. Kishimoto, F. Fujii, K. Nakamura, J. Wu, K. Yamamoto,
K. Sakata, T. Sasaki, and S. Kikuchi
Developing genomics approaches for crop trait improvement 350
H. Sakai, G. Taramino, N. Nagasawa, Guo-Hua Miao, J. Vogel,
and S. Tingey
A gene machine for rice 352
N.M. Upadhyaya, X.-R. Zhou, Q.-H. Zhu, A. Eamens, K. Ramm,
L. Wu, R. Sivakumar, S. Kumar, K.K. Narayanan, G. Thomas,
T. Kato, D.-W. Yun, W.J. Peacock, and E.S. Dennis
Comparative genomics in the Oryzeae 355
S.A. Jackson, J.W. Lilly, R.L. Phillips, W.C. Kennard, and R.A. Porter
T-DNA as a potential insertional mutagen in rice 358
C. Sallaud, D. Meynard, J.P. Brizard, M. Bès, C. Gay, M. Raynal,
E. Bourgeois, H. Hoge, M. Delseny, and E. Guiderdoni
New Ac/Ds-based constructs for efficient gene and enhancer trapping in rice 362
X.-R. Zhou, K. Ramm, L. Wu, R. Sivakumar, E.S. Dennis,
and N.M. Upahdyaya
Contents
ix

Ac/Ds-mediated gene trap systems for functional genomics in rice 365
B.I. Je, C.M. Kim, Su Hyun Park, Sung Han Park, Y.J. Na, J.J. Lee,
B.G. Oh, N.M. Hee, G.H. Yi, H.Y. Kim, and C.D. Han
A rice retrotransposon, Tos17, as a tool for gene tagging 367
K. Murata, A. Miyao, K. Tanaka, M. Yamazaki, S. Takeda, K. Abe,
K. Onosato, A. Miyazaki, Y. Yamashita, T. Sasaki, and H. Hirochika
Structural polymorphism found in RMU1 (rice mutator class 1) transposable 369
elements in rice
K. Miura, R. Ishikawa, Y. Miyashita, M. Senda, S. Akada, T. Harada,
and M. Niizeki
Isolating and characterizing cold-responsive gene-trapped lines from rice 370
S.C. Lee, S.H. Kim, S.J. Kim, H.S. Choi, M.Y. Lee, J.Y. Kim, K. Lee,
S.H. Jeon, J.S. Jeon, G. An, and S.R. Kim
Constructing a physical map of the rice genome 372
A.C. Sanchez, B. Fu, R. Maghirang, C. Aquino, J. Mendoza,
J. Talag, S. Yu, J.R. Domingo, K.L. McNally, P. Bagali,
G.S. Khush, and Z.K. Li
Centromere structure of rice chromosome 5 375
K.I. Nonomura and N. Kurata
Genic interaction between mutant genes related to morphogenesis 377
of panicle and spikelet in rice
I. Takamure, T. Aida, and S. Niikura
Oryzabase: an integrated rice science database 380
Y. Yamazaki, A. Yoshimura, Y. Nagato, and N. Kurata
RiceGenes 5.0: an online genomic resource for the rice community 384
A.M. Baldo, G.A. DeClerck, T.G. Cargioli, I.V. Yap, C.M. Larota,
S. Cartinhour, and S.R. McCouch
CD-ROM for PC version of RiceGenes, a rice-specific ACEDB 386
Y.C. Shin, T.H. Lee, M.Y. Eun, and B.H. Nahm
Performing line × tester analysis with the SAS ® system 389
V.I. Bartolome and G.B. Gregorio
Gene isolation and function
One super-mutator transposon family found in rice 395
R. Ishikawa, K. Miura, M. Ashida, M. Senda, S. Akada, T. Harada,
and M. Niizeki
A maize MuDR-like tranposable element transcribed in the rice genome 397
S. Yoshida, N. Asakura, R. Ootani, and C. Nakamura
Transcriptional analysis of the Mu-like element Tnr2 in rice 400
F. Myouga, S. Tsuchimoto, H. Ohtsubo, and E. Ohtsubo
Chloroplast targeting signal regulates transgene expression in rice 403
I.C. Jang, K.H. Lee, B.H. Nahm, and J.K. Kim
Isolation and functional characterization of the DREB family of genes in rice 406
J.G. Dubouzet, Y. Sakuma, E.G. Dubouzet, S. Miura,
K. Yamaguchi-Shinozaki, and K. Shinozaki
Characterization and expression of rice monosaccharide transporter 409
genes, OsMST1–3
K. Toyofuku, T. Takeda, J. Yamaguchi, and M. Kasahara
Functional analysis of R2R3-Myb genes in rice 411
J.W. Lee, S.K. Sung, S.K. Yi, and G. An
Functional analysis of MADS-box genes expressed preferentially in vegetative 414
tissues
S.Y. Lee, S.H. Jang, S.H. Jun, and G.H. An
Functional analysis of protein phosphatase 2C in rice 416
K. Yang, D.H. Jeong, and G. An
Functions of mitochondrial aldehyde dehydrogenase in rice under 418
anaerobic conditions
M. Nakazono, Y. Li, H. Tsuji, N. Tsutsumi, and A. Hirai
x
Advances in rice genetics

Identification of differentially expressed genes during disease resistance 421
response from rice by cDNA arrays
Bin Zhou, Kaiman Peng, Zhaohui Chu, Shiping Wang, and Qifa Zhang
Rice transcript RIM2 accumulates in response to Magnaporthe grisea 423
and its predicted protein shares similarity with proteins encoded
by CACTA transposons
J.X. Dong, H.T. Dong, Z.H. He, and D.B. Li
Chimeric receptor kinases for plant disease resistance engineering in rice 425
Zuhua He, Zhiyong Wang, Qun Zhu, Jianming Li, C. Lamb, J. Chory,
and P. Ronald
Jasmonic acid- and salicylic acid-mediated defense signal transduction in rice 429
Y. Yang, M. Qi, M.-W. Lee, and L. Xiong
Alternative splicing bestows capacity for nuclear expression and mitochondrial 431
targeting in rice
K. Kadowaki and N. Kubo
Transferring the ribosomal protein S10 gene from the mitochondrion to 434
the nucleus in rice
N. Kubo, X. Jordana, K. Harada, and K. Kadowaki
Hypothetical model of genetic regulation of the glutelin biosynthesis pathway 436
Y. Takemoto, M. Ogawa, T. Kumamaru, T.W. Okita, and H. Satoh
The alk locus controls amylopectin structure and starch synthase 439
activity in rice
T. Umemoto, M. Yano, H. Satoh, A. Shomura, K. Okamoto,
K. Kobayashi, and Y. Nakamura
Biosynthesis of rice S-poor and S-rich prolamins is regulated by 441
an independent genetic system
H. Matsusaka, T. Kumamaru, M. Ogawa, and H. Satoh
Differential expression of rice genes in response to iron 444
L. Hillebrand, P.S. Carmona, and M.G. Moraes
Isolating and characterizing a cDNA encoding the iron-storage protein in rice 446
Kwon Kyoo Kang and Yong Gu Cho
Identifying a novel superoxide dismutase isoform: a biological marker 449
for evaluating drought-tolerant varieties of rice
K.N. Singh and S. Sadasivam
Inducing dehydration tolerance in rice by regulated expression of genes 451
for transcription factors
S.J. Oh, E.H. Kim, S.Y. Kim, S.I. Song, S. Daughhetee, J.K. Kim,
and B.H. Nahm
Molecular cloning of the salt-responsive gene in rice 454
M. Arumugam Pillai and S. Yanagihara
Developmental changes of phyllochron in the life cycle of rice 457
Y. Itoh, S. Sato, and Y. Sano
Effect of starch-branching enzyme IIb on amylopectin structure 459
and gelatinization property
A. Nishi, Y. Nakamura, and H. Satoh
Analyses of sugar transport via the vascular system in rice 462
C. Matsukura, T. Saitoh, T. Hirose, R. Ohsugi, and J. Yamaguchi
Alteration of rice floral organ identity by ectopic expression of the rice 465
MADS-box gene
S. Lee, J.S. Jeon, Y.H. Moon, Y.Y. Chung, and G. An
Expression analyses of the OsPNH1 gene in rice leaf development 468
A. Nishimura, M. Ito, H. Kitano, and M. Matsuoka
Gene expression pattern of cell division/elongation factors in rice dwarf mutants 470
H. Tobina, S. Uozu, M. Matsuoka, H. Kitano, and K. Hattori
Expressed sequence tag analysis of developing seed coat and characterization 473
of the Ran gene in rice
M.J. Han, S.H. Jun, S.R. Kim, and G. An
Contents
xi

Complex organization of the rice Purple leaf locus involved in tissue-specific 475
accumulation of anthocyanin
W. Sakamoto, M. Murata, and M. Maekawa
Slender rice mutant is caused by null mutation of the SLR gene, an ortholog of 478
the height- regulating gene GAI/RGA/RHT/D8
A. Ikeda, M. Ueguchi-Tanaka, Y. Sonoda, H. Kitano, Y. Futsuhara,
M. Matsuoka, and J. Yamaguchi
Characterizing a slender mutant with constitutive gibberellin-response in rice 480
A. Ikeda, H. Kitano, Y. Sonoda, Y. Futsuhara, and J. Yamaguchi
Molecular basis of 5-methyltryptophan-resistant rice 482
Y. Ishikawa, H. Kisaka, M. Kisaka, H.-Y. Lee, A. Kanno, and T. Kameya
Positional cloning of candidates for Xa4 in rice 485
Wenxue Zhai, Wenming Wang, Xianwu Zheng, and Lihuang Zhu
Antifreeze proteins: a molecular approach for developing cold-tolerant rice 488
H.K. Khanna and G. Daggard
Arresting sexual embryo development in rice using DMC1 and REE5 genes 490
A. Kathiresan, G.S. Khush, and J. Bennett
Assessing the genetic propensity of rice for nodulation 492
P.M. Reddy, J.K. Ladha, R.J. Hernandez-Oane, and V.S. Sreevidya
Tissue culture and transformation
Production of allohexaploid somatic hybrid plants by electrofusing mesophyll 497
protoplasts of Porteresia coarctata (Roxb.) Tateoka and cell
suspension-derived protoplasts of Oryza sativa L.
N.B. Jelodar, N.W. Blackhall, T.P.V. Hartman, D.S. Brar, G. Khush,
M.R. Davey, E.C. Cocking, and J.B. Power
Enhancing salinity tolerance in rice using sexual and somatic hybrids 500
of Oryza sativa and Porteresia coarctata
E.C. Cocking, N.W. Blackhall, M.R. Davey, J.B. Power, D.S. Brar,
and G.S. Khush
Protoplast fusion for developing novel sources of rice cytoplasmic male sterility 501
N.W. Blackhall, J.P. Jotham, M.R. Davey, J.B. Power, and E.C. Cocking
Improved methods for anther and pollen culture in rice 503
R. Gill, N. Kaur, A.S. Sindhu, T.S. Bharaj, and S.S. Gosal
Androgenesis in aromatic rice hybrids 506
M. Sakila, S.M. Ibrahim, A. Kalamani, S. Lakshmi Narayanan,
N. Nadarajan, and P. Rangasamy
Effect of maltose on anther culture of Tongil and indica rice 508
G.H. Yi, M.H. Nam, B.G. Oh, and H.Y. Kim
Selection of high green-plant regenerating lines through rice anther culture 509
T. He, K. Luo, S.H. Han, and X.X. Guo
Developing restorer lines in rice through anther culture 512
J.S. Ryu, H. Ri, T.-S. Ri, and S.-C. Hwang
Developing blast-resistant lines in rice through tissue culture methods 513
J.-S. Ryu, J.-M. Choi, Y.-H. Kang, and S.-Y. Kim
Induction and use of somatic embryogenesis in rice improvement 514
N.M. Ramaswamy and M.K. Rajesh
Histological analysis of cell proliferation in early stages of rice seed culture 517
J. Motoda and K. Hattori
Factors influencing callus induction and plant regeneration from young 518
panicles of rice
S.G. Fan, C.Y. Liang, and H.X. Liu
Tissue culture studies on japonica × indica crosses in rice 520
P.C. Deka, D. Sarma, and B.K. Konwar
Identifying molecular markers associated with tissue culture performance 522
in diverse rice germplasm
M.D. Raven, H.J. Newbury, and B.V. Ford-Lloyd
xii
Advances in rice genetics

In vitro selection and rapid screening of high-lysine mutants in rice 526
G.H. Yi, M.H. Nam, B.G. Oh, and H.Y. Kim
Producing stable androclonal variants with improved agronomic traits 527
in indica rice
N.V. Desamero, C.L. Diaz, Y.A. Dimaano, M.V. Chico, S.S. Macabale,
L.G. Domingo, E.R. Corpuz, T.F. Padolina, R.E. Tabien, J.M. Niones,
G.B. Amar, H.R. Rapusas, M.V. Romero, and P.S. Bonilla
Somaclonal restorable variation in cytoplasmic male sterile lines with 531
cytoplasm from two wild species of Oryza
D.H. Ling and Z. Ma
Studies on the cryopreservation of cell suspension cultures of Iranian indica 533
and japonica rice cultivars
N.B. Jelodar, M.R. Davey, and E.C. Cocking
Clean DNA transformation: co-integration and expression analysis 536
of five minimal transgene cassettes in rice
P.K. Agrawal, P. Christou, and A. Kohli
Effects of matrix attachment regions (MARs) on transgene expression levels 538
and stability in rice
V. James, B. Worland, J. Snape, and P. Vain
Double-right-border (DRB) binary vectors for producing selectable marker-free 541
transgenic rice
H. Lu, X.-R. Zhou, L. Wu, J. Gorden, K. Ramm, X.-R. Shen, Z-X. Gong,
and N.M. Upadhyaya
Transforming rice with multiple plasmids 544
Somen Nandi, Liying Wu, Lifang Chen, R.L. Rodriguez, and Ning Huang
Construction of three transgenic rice populations by maize transposable 547
element Ac/Dc mutagenesis via Agrobacterium tumefaciens
Zongxiu Sun, Yaping Fu, Zhengge Zhu, Han Xiao, Jingliu Zhang,
Hongxin Zhang, Guocheng Hu, Yonghong Yu, Huamin Si,
and Menming Hong
Transgene structure and expression in a large population of rice plants 550
and their progenies
P. Vain, V. James, B. Worland, and J.W. Snape
Organ-specific gene expression and genetic transformation for improving rice 552
A.K. Tyagi, J.P. Khurana, A.K. Sharma, A. Mohanty, A. Dhingra,
S. Raghuvanshi, A. Mukhopadhyay, V. Gupta, S. Anand,
H. Kathuria, S. Bhushan, J. Thakur, and D. Kumar
Rice transformation for resistance to stem borer 555
I. Hanarida Somantri, A.D. Ambarwati, A. Apriana, E. Listanto,
I.S. Dewi, T. Santoso, D. Damayanti, and I. Altosaar
Introducing the CryIA(c) gene into basmati rice and transmitting transgenes 558
to R 3
progeny
S.S. Gosal, R. Gill, A.S. Sindhu, H.S. Dhaliwal, and P.I. Christou
Wound-inducible expression of the Bacillus thuringiensis Cry1B gene 560
in transgenic rice
J.C. Breitler, V. Marfà, D. Meynard, L. Vila, I. Murillo,
M.J. Domínguez Rodríguez, M. Royer, B. San Segundo,
J.A. Martínez-Izquierdo, J. Messeguer, J.M. Vassal, and E. Guiderdoni
Inheritance of cry1A(b) and snowdrop lectin gna genes in transgenic javanica 565
rice progenies and bioassays for resistance to brown planthopper
and yellow stem borer
I.H. Slamet-Loedin, Novalina, Satoto, D. Damayanti, Sutrisno,
E.S. Mulyaningsih, P. Christou, and H. Aswidinoor
Insect bioassays of transgenic indica rice carrying a synthetic Bt toxin 567
gene, cry1A(c)
S.K. Raina, H.K. Khanna, D. Talwar, A. Tiwari, and U. Kumar
Contents
xiii

Genotype screening of japonica rice cultivars for Agrobacterium- 570
mediated transformation
K.H. Kang, S.H. Choi, H.P. Moon, Y.S. Chung, I.S. Choi, O.Y. Jeong,
and H.Y. Ryu
Transgenic IR72 lines resistant to nine Philippine races of Xanthomonas 573
oryzae pv. oryzae
R.R. Aldemita, L.S. Gueco, G.Y. Ilar, E.S. Avellanoza, Z. Shiping,
and C. Fauquet
Characterizing blast-tolerant transgenic rice constitutively expressing 575
the chitinase of the beta-glucanase gene
Y. Nishizawa, K. Nakazono, M. Saruta, M. Kamoshita, E. Nakajima,
M. Ugaki, and T. Hibi
Blast-resistant transgenic rice with a phytoalexin gene 577
Z. Tang, W. Tian, L. Ding, S. Cao, S. Dai, S. Ye, C. Chu, and L. Li
Production of abiotic stress-tolerant transgenic rice plants 579
A. Grover, S. Katiyar-Agarwal, M. Agarwal, C. Sahi, O. Satya Lakshmi,
H. Dubey, S. Agarwal, and A. Kapoor
Genetic engineering of salt and drought tolerance in rice cultivars 582
M. Jacobs, N. Roosens, D.T. Hien, B. Alemany, C. Montesinos,
J.M. Mulet, R. Serrano, E. Guiderdoni, J. Van Boxtel, H.H. Zheng,
L.T. Binh, and T.T. Thu 582
Improved transgene expression systems and dehydration-tolerant transgenic 584
rice plants
J.K. Kim
Rice histone deacetylase: characterization and expression in transgenic 587
rice plants
I.C. Jang, N.J. Kim, B.H. Nahm, and J.K. Kim
Transgenic rice resistant to imidazolinone herbicides 590
J. Peng, L. Hirayama, and C. Lochetto
Producing transgenic Basmati rice with the potato protease inhibitor II 593
(PinII) gene by Agrobacterium-mediated transformation
R.K. Jain, J.S. Rohilla, S. Bhutani, S. Jain, V.K. Chowdhury,
J.B. Chowdhury, and R. Wu
Genetic analysis and field testing of elite rice cultivars transformed with 596
the antisense waxy gene
Qiao-quan Liu, Xiu-hua Chen, Shu-zhu Tang, Zong-yang Wang,
Xiu-lin Cai, and Ming-hong Gu
Transforming indica rice cultivars grown in Vietnam using Agrobacterium 598
tumefaciens or particle bombardment
B.B. Bong, T.T. Cuc Hoa, T.K. Hodges, and P. Christou
Manipulation of ADP-glucose pyrophosphorylase in starch biosynthesis during 601
rice seed development
C. Sakulsingharoj, S.-B. Choi, and T.W. Okita
Modification of starch branching degree in transgenic rice 604
W.S. Kim, K.M. Jun, J.S. Kim, S.I. Song, J.K. Kim, and B.H. Nahm
Molecular breeding of rice by modulating gibberellin metabolic pathway 607
H. Tanaka, H. Itoh, T. Sakamoto, T. Kayano, Y. Koga-Ban, M. Kobayashi,
and M. Matsuoka
Molecular tools for manipulating rice development: markers for cell proliferation 610
M.K. Mishra, M.R. Fowler, A.C. McCormac, S. Devi, D.J. Blackley,
S.M. Daskalova, N.W. Scott, A. Slater, and M.C. Elliott
Function of Cre/lox site-specific recombination system in the rice genome 612
and its implication
Tran Thi Cuc Hoa, E. Huq, J.R. Vincent, H.K. Hodges, B.B. Bong,
and T.K. Hodges
xiv
Advances in rice genetics

Genetics of rice pathogens
Developing and using SCAR (sequence characterized amplified regions) 619
to analyze Magnaporthe grisea populations pathogenic to rice
D. Tharreau, O. Soubabère, M.H. Lebrun, and J.L. Notteghem
Genetics of host range in Magnaporthe grisea 621
A.S. Kotasthane and U.S. Singh
Genetic analysis of interaction between rice and the blast pathogen in Thailand 624
P. Sirithunya, T. Toojinda, T. Veerapraditsin, S. Pimpisitthavorn,
S. Sriprakhorn, J. Luangsa-ard, and E. Roumen
Diversity of Pyricularia grisea populations in Thailand 627
S. Sriprakhon, T. Veerapraditsin, S. Pimpisitthavorn, J. Laungsa-ard,
E. Roumen, and P. Sirithunya
Relation between molecular profile and avirulence pattern of Thai isolates of 630
the rice blast pathogen
S. Pimpisitthavorn, E. Roumen, K. Poomputsa, S. Sriprakhon,
T. Veerapraditsin, J. Luangsa-ard, and P. Sirithunya
Molecular genetic characterization of the rice blast (Pyricularia grisea) 633
population in Thailand
T. Veerapraditsin, T. Toojinda, S. Sriprakhon, S. Pimpisithavorn,
E. Roumen, and P. Sirithunya
Pathogenicity of blast isolates in rice 637
M.J.T. Yanoria, T. Imbe, H. Tsunematsu, L. Ebron, D. Mercado,
Y. Fukuta, and H. Kato
Race differentiation of bacterial leaf blight of rice in DPR, Korea 640
M.G. Ri, C.S. Jong, and Y.A. Jo
Contents
xv

Preface
During the last few decades, major progress has been made in increasing rice productivity.
World rice production has more than doubled from 257 million tons in
1966 to 589 million tons in 2003. This has mainly been achieved through the application
of principles of Mendelian genetics and conventional plant breeding methods.
The present world population of 6.1 billion is likely to reach 8.0 billion by 2030. To
meet the growing food need and overcome malnutrition, rice varieties with higher
yield potential and multiple resistance to biotic and abiotic stresses with improved
nutritional quality are needed. Recent advances in genetics offer new opportunities
to achieve these objectives.
From being a poor cousin to maize, wheat, and tomato for genetic knowledge,
as recently as the 1980s, rice has become a model plant for molecular genetic research.
Numerous scientists in laboratories worldwide have helped make rice a favored
higher plant for molecular and cellular genetic studies. Notable examples include
genome sequencing of both indica and japonica rice and isolation and characterization
of genes governing various agronomic traits. These advances covered in
this book open new avenues to apply new tools of genomics and reverse genetics to
understand the function of rice genes. Manipulation of such genes would be a breakthrough
in rice genetics and breeding.
This book, Advances in Rice Genetics, is the supplementary volume of Rice
Genetics IV and it contains 241 research papers presented at the 4th International
Rice Genetics Symposium held in 2000 at IRRI. The book has been divided into seven
sections: (1) genetics and breeding of agronomic traits, (2) genetic diversity, evolution,
and alien introgression, (3) molecular markers, QTL mapping, and marker-assisted
selection, (4) genomics, (5) gene isolation and function, (6) tissue culture and
transformation, and (7) genetics of rice pathogens.
In the first section, 35 papers cover the genetic analysis and inheritance of
various agronomic traits such as male sterility; fertility restoration; hybrid breakdown;
resistance to bacterial blight, blast, and gall midge; and submergence and cold
tolerance. Forty-six papers describe the use of molecular markers in the analysis of
genetic diversity, the evolution of cultivated rice, monitoring of alien introgression,
and identification of wild species alleles/QTLs for improving rice, including advances
in rice cytogenetics through FISH techniques. More than 45 papers highlight the
application of molecular markers in tagging major genes and in marker-assisted selection.
Several papers deal with the identification of QTLs for heading date; blast
resistance; tolerance of drought, flood, and cold; aluminum tolerance; ozone resistance;
and amylose content. As many as 56 papers cover the advances made in
genomics and isolation and function of genes. Some highlights include T-DNA, Tos17,
and the Ac-Ds system as resources for functional genomics and isolation and characterization
of DREB genes, MADS-box genes, transporter genes, a mechanism for
defense signal transduction, biosynthesis of prolamins, and the genetic propensity
for nodulation. Forty-seven papers describe advances in tissue culture and transformation
of rice carrying genes for resistance to biotic and abiotic stresses, clean DNA
transformation, and matrix attachment regions for stability of transgene expression.
The last section covers in eight papers the genetic structure of blast populations.
Contents
xvii

We hope that this book will be a valuable reference for the scientific community
engaged in genetics and breeding of rice, with emphasis on both forward and reverse
genetics and to apply new tools of genomics in rice improvement.
xviii
Advances in rice genetics

Acknowledgments
We would like to thank the following members of the organizing committee for the
Fourth International Rice Genetics Symposium: John Bennett, Swapan Datta, Mike
Jackson, Zhikang Li, and Hei Leung. We would also like to give special thanks to
Ronald P. Cantrell, Ren Wang, and William Padolina for their scientific and financial
support. Financial support provided by the Rockefeller Foundation is gratefully acknowledged.
We also thank Yollie Aranguren, Elma Nicolas, Emily Alcantara, George
Reyes, and Diane Martinez for secretarial help and processing of the manuscripts.
We appreciate the valuable services provided by different teams in the following
areas: Communication and Publications Services, Food and Housing Services, Visitors
and Information Services, Physical Plant Services, and a secretarial pool.
Contents
xix

Genetics and breeding
of agronomic traits

2 Advances in rice genetics

Comparing agronomic performance of breeding populations
derived from anther culture and single-seed descent in rice
H.P. Moon, K.H. Kang, I.S. Choi, O.Y. Jeong, H.C. Hong, S.H. Choi, and H.C. Choi
This experiment was conducted to compare the breeding efficiency of anther culture (AC) and single-seed
descent (SSD) methods. A total of 380 AC lines and 916 F 6
SSD lines derived from Ilpumbyeo/Nonganbyeo were
evaluated for field performance of yield-related traits, including grain quality. No significant difference was found
in mean comparisons of yield components between the two methods. There was a wide range of trait variation,
and high transgressive segregation for each trait was detected among the populations derived from either the AC
or SSD method. Regardless of breeding method, a high frequency of the desirable transgressive lines was found
for the three traits (panicle length, number of grains per panicle, and fertility), indicating that selecting superior
recombinants of these traits could be possible by either the AC or SSD method. The mean performance of
agronomic traits in 45 selected elite lines and the five top-ranking lines did not differ significantly between the
two breeding methods. Overall, the AC method produced a considerable extent of genetic variation and superior
rice genotypes in the cross we used, implying that the AC method can be reliably used for the rice breeding
program.
Anther culture and single-seed descent are two important breeding
methods to speed up the breeding cycle. In the Korean
program, anther culture plays an important role in rice breeding.
It is possible to reliably obtain large numbers of inbred
lines for selection from anther culture of japonica crosses, although
there are still some problems in indica genotypes. A
total of 15 varieties have been developed by anther culture
breeding since the first anther-derived variety, Hwaseongbyeo,
was released in 1985. These varieties currently account for
around 25% of the rice-growing area in Korea. Despite the
practical use of the technique in rice breeding, there is still a
limited understanding of the potential for cultivar development
via anther culture because of its inherent factors, such as genotypic
dependence of androgenesis, the deleterious effect of
somaclonal variation (Oono 1983), distortion in segregation
by gametic selection during androgenesis (Murigneux et al
1993), and only one chance of recombination before fixation
in the F 1 system (Snape 1976). These factors can influence
genetic variation and the creation of desirable recombinants
in the breeding lines derived from anther culture. In this study,
we aimed to compare the breeding lines derived from anther
culture and the single-seed descent method for field performance
and to determine the extent of genetic variation and
transgressive phenomenon for yield-related traits and quality
characteristics.
Materials and methods
F 1 plants of Ilpumbyeo/Nonganbyeo and the parental genotypes
were used to develop anther culture (AC) and singleseed
descent (SSD) lines. The parents differ in agronomic plant
characteristics. Anther culture was used with F 1 plants two times
from 1993 to 1995. Vacuum-anther-plating was used according
to the method of Moon et al (1994). Haploids and sterile
plants were discarded and seed harvesting was done on fertile
diploid plants. The R 1 generation was grown for seed multiplication
in the rice field and a total of 381 lines of the R 2 generation
were reserved for the population to be tested.
In the SSD method, 1,500 F 2 plants from 10 bulked F 1
seeds of the same cross above were grown in the field in 1994.
Six hundred plants were randomly selected and a single seed
was taken from each plant and advanced to the F 3 generation.
SSD was done to reach the F 5 generation. All seeds were harvested
from each F 5 plant (F 6 seed) and 916 lines of the F 6
generation were produced.
In 1996, the agronomic performance of AC and SSD
lines for yield-related traits in AC and SSD populations was
evaluated in the field. The physio-chemical traits of rice quality,
including grain morphology, white core, white center, alkali
digestion value, and amylose content, were assessed in
the laboratory. We selected 45 superior lines with good agronomic
traits by visual selection in the field from each AC and
SSD population. In 1997, yield trials of selected lines were
conducted in a randomized complete block design with three
replications. The middle 10 plants were used for data collection.
Heading date, culm length, panicle length, number of
panicles, number of spikelets per panicle, fertility, and yield
per plant were investigated and statistically analyzed.
Results and discussion
Agronomic traits and transgressive segregation
of AC and SSD populations
The mean and range for yield and yield components of AC
and SSD populations are shown in Table 1. The AC and SSD
populations did not differ significantly in mean comparison
for each trait except for number of spikelets per panicle. However,
the AC population in actual value showed a slightly higher
mean yield and a tendency of increased growth duration, tall
height, and good fertility. The mean values of those traits in
Genetics and breeding of agronomic traits 3

Table 1. Mean and range for yield and yield components for lines derived from anther culture (AC) and single-seed descent
(SSD).
Trait
AC SSD Mean of parents
M ± SE Range M ± SE Range D√ a Ilpumbyeo MP Nonganbyeo
Days to heading 117 ± 8.6 96–138 114 ± 9.4 94–141 3 ns 123 118 113
Culm length (cm) 78 ± 7.9 21–91 75 ± 7.9 25–114 3 ns 80 79 78
Panicle length (cm) 23 ± 2.3 12–31 23 ± 2.3 11–36 0 ns 22 23 23
Panicles plant –1 (no.) 14 ± 2.5 8–24 13 ± 2.8 6–32 1 ns 18 17 15
Spikelets panicle –1 (no.) 55 ± 38.7 36–260 161 ± 41.1 27–282 6* 156 151 146
Fertility (%) 88.7 ± 9.7 27–99 84.3 ± 20.5 10–99 4.4 ns 89 88 86
1,000-grain weight (g) 22 ± 2.8 12.5–25.9 21 ± 2.5 9.8–27.0 1 ns 22 21 20
Yield plant –1 (g) 32 ± 8.5 6–55 29 ± 10.4 2–55 3 ns 39 36 33
a D√ = difference of mean between AC and SSD. ns and * indicate not significant and significant at the 5% level.
Table 2. Percentage of transgressive lines for yield and yield components in anther culture (AC) and single-seed descent (SSD) lines. a
Days to Culm Panicle Panicles Grains Fertility 1,000-grain Yield
Breeding heading length length plant –1 panicle –1 weight plant –1
method
EH LH SC TC SP LP LPN HPN LGN GN LF HF LG GW LYD YD
AC 23 6 22 5 4 18 32 1 22 34 13 2 7 31 36 5
SSD 60 12 60 17 4 50 43 2 12 43 41 16 14 26 55 7
χ 2 0.3 ns 0.2 ns 1.9 ns 0.1 ns 4.0 ns 1.4 ns 2.7 ns 0.2 ns
a EH = early heading, LH = late heading, SC = short culm, TC = tall culm, SP = short panicle, LP = long panicle, LPN = low panicle number, HPN = high panicle number, LGN
= low grain number, HGN = high grain number, LF = low fertility, HF = high fertility, LGW = low 1,000-grain weight, HGW = high 1,000-grain weight, LYD = low yield, HYD = high
yield.
the AC population are closer to the mid-parental value. The
standard deviations and ranges indicate that AC lines are distributed
closer to the mean. In the SSD population, the mean
agronomic value was lower than the mid-parental value, with
a wider ranger of variation in the population, indicating a
greater proportion of lines with negative extremes than in the
AC population. Table 2 shows the appearances of transgressive
lines for each trait within each AC and SSD population.
There was a clear trend of transgression according to the traits
regardless of breeding method. The absolute number of transgressive
lines was higher in the SSD population.
Also, a significant difference was not noted between the
two methods in grain morphology, including grain length,
width, thickness, and physio-chemical traits such as white core
and center, alkali digestion value, and amylose content (data
not shown).
From the viewpoint of practical breeding, the appearance
of superior recombinants in a population is the most important
criterion for determining that a certain breeding or selection
method could be effectively used in the breeding program.
The above results suggest that either the AC or SSD
method seems equally effective in obtaining desirable transgressive
genotypes, although genetic variation and the absolute
number of transgressive lines in the AC population were
smaller than in the SSD population. The primary factor for
successful anther culture breeding depends on the establishment
of an appropriate breeding population. Wenzel et al
(1995) reported that 100 AC lines from a cross are sufficient
to obtain superior lines. Alternatively, the probability of obtaining
the best recombinant can be enhanced by producing
doubled-haploid (DH) lines from plants in later generations.
An F 2 -derived DH population may contain up to 50% more of
the best recombinants than the F 1 system.
Yield test of selected AC and SSD lines
Forty-five elite lines were selected visually from each AC and
SSD population in the field. Selections were made on lines
with desirable traits such as good plant type, moderate plant
height, long and good panicle shape, and high fertility. Table 3
shows the mean yield and yield components of 45 selected
lines and the top five high-yielding lines from each breeding
method. No significant difference in mean agronomic performance
was detected between AC and SSD within each selected
group, while the mean of the top five high-yielding lines consistently
exceeded that of the 45 selected lines. When comparing
the mean yield of the basic population from which selection
was made in the previous year (Table 1), the 45 selected
lines showed an increased yield of 12% in the AC method and
24% in the SSD method, although direct comparison is difficult
because of different climatic conditions between the two
years. Although visual selection is not considered to be accurate
for quantitative traits such as yield-related traits, yield
improvement was mainly achieved by selection, and not breeding
method, in the cross used in this study.
AC and SSD are two important breeding methods to
speed up the breeding cycle and to save labor and space. The
4 Advances in rice genetics

Table 3. Mean for yield and yield components of 45 selected lines and the top five
high-yielding lines among AC and SSD populations.
Trait
45 selected lines Best 5 lines
AC SSD AC SSD
Days to heading 119 ± 7.3 121 ± 4.9 125 ± 5.0 128 ± 2.7
Culm length (cm) 75 ± 5.3 73 ± 4.4 84 ± 2.0 87 ± 3.0
Panicle length (cm) 23 ± 1.5 22 ± 1.3 26 ± 1.6 25 ± 0.7
Panicles plant –1 (no.) 15 ± 1.9 15 ± 1.9 18 ± 0.7 16 ± 1.2
Spikelets panicle –1 (no.) 151 ± 30.2 152 ± 39.4 179 ± 15.6 175 ± 15.8
Fertility (%) 82.0 ± 9.1 80 ± 11.7 95.3 ± 0.9 96 ± 0.7
1,000-grain weight (g) 22.3 ± 1.3 22 ± 1.5 22.3 ± 0.9 22.1 ± 1.0
Yield plant –1 (g) 36 ± 28.3 36 ± 24.5 44 ± 2.4 44 ± 2.5
AC method certainly has a clear time-saving advantage over
the SSD method. In this study, it took only 4.5 years from crossing
to a yield trial, whereas SSD took 6 years. However, for
overall agronomic performance, including yield-related traits
and rice quality, the AC and SSD methods were similar in terms
of genetic variation, appearance of transgressive lines, and
agronomic performance of selected breeding lines. In this context,
anther culture can also be effectively used in a breeding
program. In this experiment, only one cross was used. Therefore,
more extensive and diverse research is necessary to understand
the breeding efficiency of anther culture.
References
Moon HP, Kang KH, Cho SY. 1994. Aseptic mass collection of anthers
for increasing efficiency of anther culture in rice breeding.
Int. Rice Res. Notes 19(1):30.
Murigneux A, Band S, Beckert M. 1993. Molecular and morphological
evaluation of doubled-haploid lines in maize. 2. Com-
parison with single-seed descent lines. Theor. Appl. Genet.
87:278-287.
Oono K. 1983. Genetic variability in rice plants regenerated from
cell culture. In: Institute of Genetics, Academia Sinica and
International Rice Research Institute, editors. Proceedings of
the Symposium on Tissue Culture Techniques, Cereal Crops
Improvement. Beijing, China. p 95-105.
Snape JW. 1976. A theoretical comparison of diploidized haploid
and single-seed descent populations. Heredity 36:275-277.
Wenzel G, Friel U, Jahoor A, Graner A, Foroughi-Wehr B. 1995.
Haploids: an integral part of applied and basic research. In:
Terz M et al, editors. Current issues in plant molecular and
cell biology. Berlin (Germany): Kluwer Publishing. p 127-
135.
Notes
Authors’ address: National Crop Experiment Station, RDA, Suwon
441-100, Korea.
Advances in breeding salt-tolerant rice varieties
B. Mishra, R.K. Singh, and D. Senadhira
Major progress has been made in breeding salt-tolerant high-yielding rice varieties for various inland saline,
coastal saline, and alkaline soils of fragile ecosystems. Of 32 salt-tolerant rice varieties developed by the Central
Soil Salinity Research Institute (CSSRI), CSR10 was the first dwarf high-yielding salt-tolerant early-maturing rice
variety released. Varieties CSR10 and CSR11 are popular as biological amendments for resource-poor farmers.
CSR13 is a fine-grain salt-tolerant rice variety adapted to alkaline and inland saline soils and CSR27 possesses
dual tolerance of coastal salinity and sodicity. Both varieties have been released across India. CSR27 possesses
high tissue tolerance and high K + and phosphorus-mining ability. We have successfully induced basmati qualities
along with salt tolerance in CSR30, the first export-quality basmati rice. It has long slender, highly scented
grains with good head rice recovery, high kernel elongation on cooking, intermediate gelatinizing temperature,
and intermediate amylose content. A wide spectrum of rice germplasm (indigenous and exotic) has been evaluated
and categorized for tissue tolerance, Na + exclusion, K + and P uptake, and reproductive-stage tolerance.
We have combined different physiological mechanisms into one genetic background and these progenies show
increased mining of P, K, and Zn and enhanced salt tolerance. However, no single physiological mechanism was
found to be responsible for absolute salt tolerance. No correlation was observed for vegetative-stage salinity
score with reproductive-stage salinity score and grain yield. Both additive and nonadditive gene effects for
salinity tolerance, K + , and Na + /K + ratio have been detected. Varieties CSR10, CSR1, CSR13, and CSR 27 were
the best combiners for salinity and alkalinity tolerance and related traits.
Genetics and breeding of agronomic traits 5

Breeding for salt tolerance is a more promising, energy-efficient,
economical, and socially acceptable approach than major
engineering processes and soil amelioration, which are
beyond the reach of marginal farmers. Rice is the most preferred
and adapted crop for salt-affected soils because of its
inherent genetic variability for salt tolerance. Using this genetic
diversity, breeding from a much broader base has been
followed at CSSRI, Karnal, aiming for significant improvements
that can be easily adapted by resource-poor farmers.
Germplasm improvement and varietal development
Rice is recommended as the first crop during the reclamation
of alkali soils. It is monocropped in coastal saline areas and
grown in inland saline soils wherever water is available. CSSRI
first identified the traditional salt-tolerant variety CSR1
(Damodar) as a donor because grain yield reduction was less
than 50% at soil pH as high as 10.3 (ESP 85), whereas other
varieties showed a very poor performance or failed to survive.
The first dwarf high-yielding salt-tolerant and earlymaturing
rice variety, CSR10, was developed by CSSRI (M40-
431-24-114/Jaya) for cultivation in alkali and inland saline
soils. It can withstand high alkalinity (pH 9.8–10.2) and salinity
(ECe 6–11) under the transplanted, irrigated management
system. Its yield potential is 5–6 t ha –1 in normal soils and 3–
5 t ha –1 in highly alkali soils. Under moderate stress, it yields
5.0–5.5 t ha –1 . Resource-poor farmers who are unable to afford
chemical amendments are using CSR10 as a biological
amendment (Mishra et al 1992). The slender-grain rice variety
CSR13, derived from the three-way cross CSR 1/Bas 370/
/CSR 5, was released in 1999 for irrigated alkaline (sodic),
inland, and coastal saline soils across zones. It is 100–105 cm
tall and tolerant of alkaline (pH 9.2–10.0) and saline (ECe
approx. 9) stresses. Grain yield ranges from 5.5 to 6.7 t ha –1
under nonstress soil conditions and from 4.0 to 5.0 t ha –1 in
salt-affected soils (Mishra and Singh 1999). Another salt-tolerant
high-yielding slender-grain rice variety, CSR27, released
by CVRC in 1999 for alkaline and coastal saline soils of the
country, was derived from the cross Nona Bokra/IR5657-33-
2. It is tolerant of alkaline (pH 9.6–9.9) as well as saline (ECe

additive and nonadditive effects, and the former showed greater
importance in the inheritance of the traits.
In a study undertaken at CSSRI, significant heterosis over
the mid-parent and better parent was observed for almost all
the characters studied. Grain yield is the prime concern of
breeders. Out of 15 F 1 s, crosses Pokkali/IR28 (79.87), CSR10/
IR28 (67.18), CSR13/IR28 (54.58), and CSR1/IR28 (48.56)
indicated a positive and significant heterotic response over the
mid-parent and cross Pokkali/IR28 (49.31) over the better
parent in alkali soil, whereas CSR13/IR28 (35.17) and CSR10/
CSR13 (26.72) over the mid-parent and only one cross (CSR10/
CSR13, 24.53) over the better parent in saline soil exhibited
better heterotic effects.
Recombination breeding
Breeding following multiple crosses between contrasting parents
from the different groups for the pyramiding of various
physiological traits in one genetic background is in progress
and populations have been generated to further enhance salt
tolerance. The genotypes are grouped into five categories: (1)
tissue-tolerant, (2) Na + excluders, (3) K + accumulators, (4)
traditional salt-tolerant varieties and landraces, and (5) highyielding
and fine-grain varieties.
If one genotype turns out to be good for two mechanisms,
then its hybridization is attempted with another group
of varieties differing in mechanisms. Some proven salt-tolerant
varieties, native types, and landraces are also being used
for wide-scale crossing. This is a shifting type of gene pool
arrangement for a crossing strategy (Singh et al 2000). The
ideal high-yielding salinity-tolerant variety should possess the
following traits: ability to withstand a high amount of Na + (tissue-tolerant),
minimum per-day uptake of Na + (takes more days
for LC 50 stage), high uptake of K + per day, good initial vigor,
and agronomic superiority with high yield potential.
Ideally, one should develop a variety having combinations
of a high degree of Na + exclusion from CSR10, CSR18,
CSR19, Bas385, PR108, and MI-48; a higher uptake of K +
than Na + from Pac831, Achhi, Muskan, CSR19, and PR108;
high tissue tolerance from IR4630-22-2-5-1-3, CSR21, and
SR26B; and tolerance for a longer time for Na + uptake from
Bas370, CSR10, CSR19, and Pokkali.
Conclusions and suggested future research
We conclude that
l None of the individual physiological mechanisms of
salt tolerance explains the absolute level of salinity
tolerance.
l Plant growth under salinity is the best indicator of
the level of salt tolerance of the genotype.
l Tolerance could be increased by pooling the positive
salt-tolerance mechanisms of the proven tolerant donors
into one genetic background by recombination.
We suggest that future research involve
l Marker-aided selection for DNA polymorphism for
different salt-tolerance mechanisms.
l F 1 anther culture-derived doubled-haploid populations.
l Transfer of salt-tolerant genes from wild types such
as Porteresia coarctata.
References
Griffing B. 1956. Concept of general and specific combining ability
in relation to diallel crossing systems. Aust. J. Biol. Sci. 9:463-
493.
Mishra B. 1994. Breeding for salt tolerance in crops. In: Rao et al,
editors. Salinity management for sustainable agriculture—25
years of research at CSSRI. Karnal (India): Central Soil Salinity
Research Institute. p 226-259.
Mishra B, Singh RK. 1999. Fine-grain salt-tolerant rice varieties
developed and released. Salinity Newsletter, CSSRI, Karnal
10:2.
Mishra B, Akbar M, Seshu DV. 1990. Genetics studies on salinity
tolerance in rice towards better productivity in salt-affected
soils. Rice Research Seminar, International Rice Research
Institute, Los Baños, Philippines, 12 July.
Mishra B, Singh RK, Bhattacharya RK. 1992. CSR10, a newly released
dwarf rice for salt-affected soils. Int. Rice Res. Notes
17(1):19.
Singh RK, Mishra B. 1997. Stable genotypes of rice for sodic soils.
Ind. J. Genet. 547(4):431-438.
Singh RK, Mishra B, Flowers TJ, Yeo AR. 2000. Screening rice
genotypes for salinity tolerance based on physiological traits.
In: Proceedings of the Indo-UK (CSSRI-Sussex) workshop
on Salt-Affected Soils and Breeding for Salt-Resistant Crops
held at CSSRI, Karnal, 12-14 October 1999. 27 p.
Notes
Authors’ address: B. Mishra and R.K. Singh, Division of Crop Improvement,
Central Soil Salinity Research Institute (CSSRI),
Karnal 132 001, India; D. Senadhira, deceased, former senior
rice breeder, IRRI, Philippines.
Genetics and breeding of agronomic traits 7

Breeding for salt tolerance in rice
R. Ansari, A. Shereen, S.M. Alam, T.J. Flowers, and A.R.Yeo
Soil salinity, submergence, and drought are major abiotic factors that affect the growth of rice. Of these, salinity
poses a major threat because most rice is grown in areas with saline or salt-prone soils. Efforts to breed for
increased salt tolerance have generally had only limited success. There is a need to integrate knowledge gained
on physiological traits with the desirable characters from the breeder’s point of view to combine salt tolerance
with economic yield. Mortality during early seedling growth, survival of seedlings after transplanting, ratios of leaf
chlorophyll a/b, low sodium accumulation in the shoot, selective absorption of potassium leading to a favorable
Na/K ratio, and distribution of sodium among leaves are factors evident at early growth stages that may determine
the ultimate crop response under saline conditions.
Widespread salinity is a major factor in world agriculture that
limits crop productivity. Rice is an important crop and experimental
evidence suggests that most rice varieties exhibit salt
sensitivity, but that varietal differences tend to manifest themselves
only at moderate salt concentrations, that is, 50 mM
NaCl (Yeo and Flowers 1984). The grain yield of many varieties
is reduced by half at an EC of 6 mS cm –1 equivalent to an
osmotic potential of about –0.23 MPa or 50 mM NaCl in solution
cultures under controlled conditions. In spite of this sensitivity,
a wide range of variation exists among different rice
cultivars.
The level of salt tolerance found so far in rice is inadequate,
however, and the transfer of this trait from existing
cultivars to combine desirable characters has had only limited
success because knowledge of the genetic basis of salt tolerance
is limited. The main expectation from plant physiologists
is the identification of “salinity markers” as defined by Epstein
et al (1979). Such markers include characters that are associated
with salt stress, are easily identified, and can be used for
screening salt-tolerant plants in large breeding populations.
There is a need to evolve rapid screening methods to
evaluate promising strains and subsequently be able to combine
desirable characters, and to identify at an early stage of
development some markers that play an important role, and in
many cases a decisive one, in performance at later growth
stages. Some characters were thus identified, which manifest
themselves at an early stage but are directly related to later
performance of plants under saline conditions.
Leaf mortality
Rapid leaf senescence is a well-known symptom of stress and
it indicates leaf tissue death resulting from the excessive accumulation
of ions. This can serve as an indicator of salt tolerance
even at a very early stage of plant development. Twoweek-old
rice seedlings grown in Hoagland solution were salinized
and leaf mortality was recorded 1–2 wk later. The data
show that the injurious effects of salt were less pronounced at
1 wk but became more severe with time. All the cultivars were
affected adversely after 2 wk of growth at 100 mM and some
did not survive at all, whereas others underwent a drastic reduction
in growth. The response at this stage agrees well with
the ultimate yield, that is, those that did better at this stage
such as IR6, Shadab, and Shua-92 had low leaf mortality after
2 wk of growth at 100 mM and high yield (data not given)
compared with their counterparts.
Seedling survival
For transplanted rice, initial survival is crucial in determining
later performance. Seedlings that survive at this stage are expected
to produce grain although spike sterility cannot be ruled
out. Seedling survival after planting could, to some extent, be
compensated for by using old seedlings (8 wk old, for instance,
versus 6 wk old, Ansari et al 1994), but initial seedling survival
also reflects upon the performance of a particular line in
terms of yield. In a study, cultivars Ganja White, Nona Bokra,
IR6, and Shua-92 had better seedling survival, whereas IR28
and Basmati had the lowest seedling survival (Table 1). These
cultivars had a more or less similar ranking in straw or grain
weight (data not given).
Leaf chlorophyll
Chlorophyll degradation leading ultimately to leaf death has
often been reported in many plants, including rice grown in
saline conditions (Yeo et al 1990). Under similar conditions
and in some cases, however, an increase in chlorophyll per
Table 1. Survival % of 8-wk-old seedlings 18 d after transplanting.
Cultivars
Salinity (%)
Control 0.2 0.3 0.4 0.5
Pokkali 83 75 67 42 13
Ganja White 100 96 79 48 46
Nona Bokra 100 96 71 46 42
IR6 100 96 96 54 63
Shadab 100 100 79 46 29
IR8 100 96 54 38 17
Shua-92 100 96 84 83 84
IR28 96 88 54 38 17
Basmati 100 92 38 33 0
8 Advances in rice genetics

unit area has also been reported because of reduced size and
tightly packed mesophyll cells under saline conditions. In any
case, the ratio of chlorophyll a/b can be an important indicator
of salt tolerance. In one of our studies, chlorophyll contents
increased or showed no reduction in rice plants grown under
salinity, irrespective of their salt tolerance, but the ratio of chlorophyll
a/b seemed to correlate with their salt tolerance (Table
2). This ratio decreased with an increase in salinity, but a high
a/b ratio was generally observed to contribute to better tolerance
for salinity.
Table 2. Ratio of chlorophyll a/b in rice leaves 18 d after transplanting.
Cultivars
Salinity (%)
Control 0.2 0.3 0.4 0.5
IR6 1.084 1.057 0.981 0.809 0.941
Shadab 1.194 1.094 0.986 0.703 0.963
IR8 1.213 1.136 1.243 0.659 0.573
Shua-92 1.195 1.145 1.175 0.769 0.998
Basmati 370 1.172 0.792 0.605 – –
Basmati S.C. 0.567 0.641 0.807 – –
Jajai-77 1.047 1.014 0.501 – –
Jajai L.G. 1.222 1.164 0.474 0.498 –
IET 4094 0.955 0.986 0.772 0.647 0.936
IR2053 0.976 1.022 0.925 0.826 0.941
Table 3. Effect of salinity on ion uptake (µM g –1 ) and Na/K ratio in
two rice cultivars (Shua-92/IR8-C) salinized at 18 d of growth in
solution culture.
Harvest
Salinity (mM NaCl)
(wk after
salinization) Control 25 50 100
Na
2 22/19 768/898 1,173/1,651 1,551/1,315
3 41/22 532/1,110 976/– 1,252/–
4 16/16 450/1,551 817/– 932/–
K
2 1,036/1,036 884/929 769/830 703/811
3 975/961 742/835 710/– 706/–
4 925/1,088 735/752 623/– 564/–
Na/K
2 2.21/0.018 0.882/0.967 1.525/1.989 2.206/1.622
3 0.042/0.023 0.717/1.329 1.375/– 1.773/–
4 0.017/0.015 0.611 1.311/– 1.653/–
Sodium uptake and Na/K ratio
The accumulation of salts, especially of sodium under saline
conditions in excess of that which could be used for osmotic
adjustment, has harmful effects on plant growth. Large interand
intravarietal differences exist in rice lines for this trait and
these can be exploited for desirable results. Plants capable of
maintaining a balance between sodium and potassium accumulation
in their shoot perform better under saline conditions
than those that are unable to do so. This trait can also be used
as a useful indicator of salt tolerance at the reproductive stage.
In one of our studies where 2-wk-old seedlings of Shua-92
and IR8C were harvested 2, 3, or 4 wk after salinization, it
was observed (Table 3) that sodium uptake increased and potassium
decreased with increasing salinity, but that sodium
seemed to have an unrestricted flow in the sensitive IR8C,
whereas the tolerant Shua-92 managed to control this buildup
inside its tissue. The Na/K ratio increased with time but decreased
in the more tolerant cultivar Shua-92.
Distribution of sodium between leaves
Regulation of the transport and distribution of ions in the various
organs of the plant and within the cell is an important factor
in the salt tolerance mechanism. The xylem transport of
sodium is generally much lower in young leaves than in old
ones. This is advantageous for salt tolerance since the salts
accumulate in older leaves, leaving the younger leaves protected
from salt effects for normal metabolic activities. Table
4 shows the time course of sodium concentration in individual
leaves of two varieties with contrasting salt tolerance. The
sodium concentration increased rapidly in older leaves, whereas
at the early stages the young leaves had lower salts. This was
more evident in the resistant Pokkali, in which older leaves
filled up progressively with sodium, whereas the younger ones
remained comparatively low in salts. The sensitive IR28, in
contrast, was unable to maintain sodium concentration in any
leaf below 100 mM kg –1 dry weight after 3–4 d, although the
tolerant variety achieved this for a much longer period. These
results suggested that sodium localization in leaves is correlated
with varietal salt tolerance and that it could be used as a
criterion for evaluating tolerance at the seedling stage, which
holds true for performance at the reproductive stage.
Table 4. Sodium concentration in leaves of IR28/Pokkali (sensitive/tolerant) cultivars
at 3, 6, 9, and 12 d after salinization with 50 mM NaCl at 14 d.
Leaf
Days after salinization
0 3 6 9 12
1 200/100 1,600/1,150 2,000/1,400 2,200/1,600 –/1,400
2 100/50 1,100/300 2,200/2,000 2,300/2,000 –/1,700
3 100/50 200/100 2,000/500 3,400/2,300 –/2,500
4 – –/50 1,300/200 2,000/1,400 –/1,800
5 – – – –/450 –/450
Genetics and breeding of agronomic traits 9

References
Ansari R, Khanzada AN, Naqvi SSM. 1994. Studies on salt tolerance
in rice. In: Naqvi SSM, Ansari R, Flowers TJ, Azmi AR,
editors. Current developments in salinity and drought tolerance
in plants. Tandojam (Pakistan): AEARC. p 207-239.
Epstein E, Kingsbury RW, Norlyn JD, Rush DW. 1979. Production
of food crops and other biomass by seawater culture. In:
Hollaender A, Aller JC, Epstein E, San Pietro A, Zaborsky
OR, editors. The biosaline concept: an approach to the utilization
of underexploited resources. New York: Plenum. p 77-
79.
Yeo AR, Flowers TJ. 1984. Mechanisms of salinity resistance in rice
and their role as physiological criteria in plant breeding. In:
Staples RC, Toenniessen GH, editors. Salinity tolerance in
plant strategies for crop improvement. New York: John Wiley
& Sons. p 151-170.
Yeo AR, Yeo ME, Flowers SA, Flowers TJ. 1990. Screening of rice
(Oryza sativa L.) genotypes for physiological characters contributing
to salinity resistance and their relationship to overall
performance. Theor. Appl. Genet. 79:377-384.
Notes
Genetic analysis and prediction of heterosis
C.H.M. Vijayakumar, M. Ilyas Ahmed, B.C. Viraktamath, M.S. Ramesha, and A. Jauhar Ali
Authors’ address: R. Ansari, A. Shereen, S.M. Alam, Nuclear Institute
of Agriculture, Tandojam, Pakistan; T.J. Flowers and A.R.
Yeo, School of Biological Sciences, University of Sussex,
Brighton, UK.
Selection of suitable parents to realize the high heterotic potential of hybrids and to predict heterosis is a major
component of heterosis breeding. Results on (1) grouping of parents and their relationship with heterosis and (2)
genetic enhancement of heterosis are described. In the first experiment, 116 restorers whose hybrid combinations
have been evaluated in national tests were evaluated in the field for 2 y. Data collected were used to group
the restorers based on DMRT followed by joint scoring over traits. Restorers were grouped as high, medium, and
low based on mean and standard deviation of joint scores. More than 75% of the entries were found in the same
groups in both years, implying a very high reproducibility and repeatability of the grouping method. Only 50
restorers out of 116 were found to give heterotic hybrids with a yield advantage of 1.0 t ha –1 over the best inbred
check at one or more of the test locations. Interestingly, a great majority of the restorers (>86%) showing
heterosis were from the medium group, emphasizing the need to select restorers from this group to develop
heterotic hybrids. In another experiment, 28 F 6
lines derived from a cytoplasmic male sterile (CMS)-based
hybrid, IR62829A/WGL 3962, were crossed with IR62829A to assess the potential of newly developed
isocytoplasmic restorers. The F 1
crosses were evaluated along with the original hybrid, IR62829A/WGL 3962.
Data on yield, yield traits, and spikelet fertility were recorded for 29 hybrids, including the original hybrid. Results
indicated that only 32% of the restorers were able to restore complete fertility in hybrids, implying that the
restoration is governed by more than one gene. Nearly 14% of the crosses involving new restorers showed
significant heterosis over the original hybrid from which they were derived, indicating that heritable genetic
factors are responsible for heterosis.
The genetic gains in yield and yield stability offered by heterosis
have prompted the use of hybrids in several crops. The
magnitude of heterosis depends on the choice of appropriate
parental lines. Selection of suitable donors to improve parents
for heterotic potential and to predict the performance of hybrids
based on the parents has always been a primary objective
in all hybrid crop breeding programs, including rice. Only
a few cytoplasmic male sterile (CMS) lines could be used for
developing commercial rice hybrids. This underscores the need
for emphasizing the selection of male parents (restorers). Several
methods, such as per se performance, combining ability,
Mahalanobis’s generalized distance, and others, were employed
using pedigree information, morphological traits, biochemical
data, and DNA-based markers to study the genetic diversity
among parents and heterosis (Melchinger 1997) and to
select prospective parents. The results, however, have not been
consistent. There are no recognized heterotic groups in rice.
Therefore, the development of a method for choosing potential
parents before making all possible crosses and their field
evaluation could improve the efficiency of hybrid breeding.
The genetic mechanisms underlying heterosis are largely
unknown. We report on the relationship between the distribution
of restorers and heterosis and also on the inheritance of
genes responsible for heterosis from the heterotic hybrid to its
progenies in selfed generations.
Materials and methods
The materials for the first set of experiments comprised 116
known restorers whose hybrid combinations have been evaluated
over the years in national tests in various network centers
in India. The 116 restorers were evaluated in the field in a
randomized block design during the 1995 and 1996 wet seasons
(WS). Each entry was planted in a single row, 3 m long,
and spaced 20 cm between rows and 15 cm between plants. At
maturity, grain yield m –2 and observations on several yield traits
10 Advances in rice genetics

Table 1. Distribution of 116 restorers into different categories and their comparison
between years. a SYP PY m –2
Group
1995 1996 % common 1995 1996 % common
High 17 (14.7) 16 (13.8) 47.1 16 (13.8) 19 (16.4) 31.2
(m – σ)
≤(m + σ)
Low 17 (14.7) 15 (12.9) 29.4 14 (12.1) 17 (14.7) 21.4
>(m + σ)
m 0.61 0.57 – 0.61 0.58 –
σ 0.11 0.13 – 0.11 0.13 –
a Numbers in parentheses indicate percent values. m = mean, σ = standard deviation.
were recorded from five randomly selected plants. Data collected
on eight traits—plant height (HT), panicle number
plant –1 (PN), panicle length (PL), number of fertile spikelets
(FS), spikelet fertility percent (SFP%), 100-grain weight (TW),
seed yield plant –1 (SYP), and plot yield m –2 (PY m –2 )—were
used to classify the restorers. Initially, overlapping groups of
restorers were obtained for each trait based on Duncan’s multiple
range test (DMRT). Then, a joint score over seven traits
(involving either SYP or PY m –2 in combination with other
traits) was computed for each line following a method detailed
by Arunachalam and Bandyopadhyay (1984). Using mean and
standard deviation of joint scores, three groups—high, medium,
and low—were formed. Data on the evaluation of hybrids
in the national testing program were used to identify promising
restorers (whose hybrid combinations showed commercial
yield heterosis). The percentage of promising restorers
was calculated for each group.
The materials for the second set of experiments comprised
a CMS-based hybrid, IR62829A/WGL 3962R, and 28
F 1 crosses made between recombinant inbred lines (RILs) (derived
from IR62829A/WGL 3962R) and their female parent,
IR62829A. All the F 1 crosses, including the original hybrid
(IR62829A/WGL 3962R), were evaluated in a randomized
block design (RBD) during the 1997 WS. Each entry was
planted in three 3-m-long rows with a row-to-row spacing of
20 cm and between-plant spacing of 15 cm. Data on yield,
yield traits, and spikelet fertility were collected from five plants
in each entry. Data on grain yield and spikelet fertility were
used to identify heterotic hybrids.
Results and discussion
Table 1 presents the distribution of restorers based on DMRT
followed by joint scores. To validate the results for the large
sample size, PY m –2 was used in place of SYP in combination
with six other traits that were common to both SYP and PY
m –2 . A majority (69–74%) of the restorers were found to be in
the medium group. Restorers in the high and low groups accounted
for 13.8–16.4% and 12.1–14.7%, respectively. Differences
between years and between SYP and PY m –2 were
marginal for the distribution percentages. These results confirmed
our earlier findings (Vijayakumar et al 1999), where
29 parents were used for the study. When SYP was used for
the analysis, nearly 75% of the restorers that were found in the
medium group in 1995 also appeared in the same group in
1996. This was common for both traits, because slight variations
in estimates of standard deviation caused the genotypes
to move in or out of the medium group. Such an interchange
never occurred between the high and low groups.
Of 116 restorers, only 50 showed standard heterosis with
a yield advantage of 1.0 t ha –1 or more over the highest-yielding
variety in national tests in one or more locations. Of these
50, as many as 36 restorers appeared in the same group during
both years of testing, indicating 72% reproducibility. These
36 included 31 from the medium group alone, with four from
the high group and one from the low group, accounting for
86.1%, 11.1%, and 2.8%, respectively. These findings, based
on 2-y data, were similar to our earlier observations
(Vijayakumar et al 1999). A careful look at the hybrid evaluation
data further revealed that most of the hybrids that exhibited
heterosis in many test locations or over years had restorers
from the medium group. Although the restorers found in
the high category gave hybrid combinations with standard heterosis,
their frequency was low. These were mostly superior in
performance (Table 2). The mean values of those in the high
category for all traits were always higher, followed by the
medium group (Table 2). This meant that most of the lines that
were selected based on their performance need not show heterosis
in their hybrids. Contrary to our earlier results, one restorer
belonging to the low group showed standard heterosis.
Table 3 shows the results on the performance of new
isocytoplasmic restorers compared with their paternal parent.
Only 32% or 9 out of 28 lines restored normal fertility in their
hybrids, whereas the remaining 68% showed only partial fertility.
This implied that fertility restoration was controlled by
more than one gene, since normal fertile plants were selected
in all the segregating generations to develop new lines. If the
fertility restoration was monogenically controlled, it is expected
that all the crosses would restore normal fertility because the
plants were already selected in the wild abortive (WA) cyto-
Genetics and breeding of agronomic traits 11

Table 2. Mean comparison of three categories for various traits
(frequency %).
1995 1996
Trait a High Medium Low High Medium Low
HT 105.6 95.1 85.6 99.1 90.4 83.4
PN 7.9 7.8 7.7 9.0 8.5 8.2
PL 26.0 25.2 25.0 24.8 23.4 21.7
FS 133.3 112.4 94.1 126.5 106.7 86.5
SFP 90.1 85.8 82.5 89.5 86.4 83.2
TW 2.6 2.4 2.2 2.5 2.4 2.1
SYP 20.9 15.6 13.3 20.2 15.2 10.8
PY m –2 608.6 521.8 461.7 562.8 411.6 270.1
a HT = plant height, PN = panicle number plant –1 , PL = panicle length, FS = number
of fertile spikelets, SFP = spikelet fertility percent, TW = 100-grain weight, SYP =
seed yield plant –1 , PY = plot yield m –2 .
Table 3. Performance comparison of newly developed isocytoplasmic
restorers with their paternal parent for heterotic potential.
Particulars
.Test hybrids Performance of
the original hybrid
No. % Range for (IR62829A/
trait WGL 3962R)
Hybrids showing normal 9 32.1 75.7–91.7 73.0
spikelet fertility (%)
Hybrids showing yield 5 17.8 14.4–29.9 12.4
advantage over the
original (g plant –1 )
Hybrids showing 4 14.3 23.1–29.9 –
significant heterosis
(g plant –1 )
plasm background. Fertility restoration of WA cytoplasm is
controlled by two dominant genes, Rf-3 (Rf-WA-1) and Rf-4
(Rf-WA-2), located on chromosomes 7 and 10, respectively
(Bharaj et al 1995). Interestingly, the occurrence of 32% restorers
among the derived lines is still higher than the normal
frequency observed in conventional testcrosses involving varieties
and elite breeding lines, which ranges from 20% to 25%.
Nearly 17% of the hybrid combinations (5 out of 28) tested
showed a yield advantage over the original hybrid, IR62829A/
WGL 3962R. These observations had many implications for
hybrid breeding. First, the isolation of restorers from CMSbased
heterotic hybrids, otherwise called isocytoplasmic restorers,
can be considered as an effective method for developing
new restorers. Second, the observation that the derived
lines are more heterotic than their paternal parent indicated
that the gene or gene combinations responsible for heterosis
were inherited from the hybrid and their progenies down the
selfing generations.
Bharaj TS, Virmani SS, Khush GS. 1995. Chromosomal location of
fertility restoring genes for ‘wild abortive’ cytoplasmic male
sterility using primary trisomics in rice. Euphytica 83:169-
173.
Melchinger A. 1997. Genetic diversity and heterosis. In: Coors JG,
Pandey S, editors. Genetics and exploitation of heterosis in
crops. Proceedings of the International Symposium on Genetics
and Exploitation of Heterosis in Crops, 17-22 August
1997, CIMMYT, Mexico. p 99-118.
Vijayakumar CHM, Ilyas Ahmed M, Viraktamath BC, Ramesha MS.
1999. Selection of parents and prediction of heterosis in rice.
Indian J. Genet. 59(3):295-300.
Notes
Authors’ addresses: C.H.M. Vijayakumar, M. Ilyas Ahmed, B.C.
Viraktamath, M.S. Ramesha, Directorate of Rice Research,
Rajendranagar, Hyderabad 500 030; and J. Ali, Agricultural
College and Research Institute, Thiruchirapalli 620 009, India.
References
Arunachalam V, Bandyopadhyay A. 1984. A method to make decisions
jointly on a number of dependent characters. Indian J.
Genet. 44(3):419-424.
Relationship of parental genetic diversity with heterosis
in two-line and three-line Philippine rice hybrids
L.S. Moreno, S.A. Ordoñez, I.A. Dela Cruz, and E.D. Redoña
Heterosis in rice has been acknowledged to be associated with the genetic divergence of the parents used in
hybridization. We investigated the nature and extent of the correlation between microsatellite marker heterozygosity
and heterosis for some quantitative traits in 48 three-line and 13 two-line F 1
rice hybrids. The parental
lines used represented the breadth of genetic diversity in the Philippine hybrid rice gene pool. F 1
heterozygosity
was deduced from parental genotypes at 43 to 108 microsatellite loci spanning the 12 rice chromosomes.
Results revealed simple sequence repeat (SSR) heterozygosity and heterotic performance (measured as the
superiority over the male parent) to be significantly correlated at the 1% probability level for the number of
12 Advances in rice genetics

productive tillers per plant (r = 0.41**) and leaf area index (r = 0.39**), whereas grain yield (r = –0.30*) was
correlated with heterosis at the 5% probability level in the three-line F 1
hybrids. When the analysis was based on
hybrids with positive heterosis, significant correlations were observed for leaf area index (r = 0.45*), number of
productive tillers per plant (r = 0.40*), and harvest index (r = 0.77*) at the 5% probability level. SSR heterozygosity
in the two-line hybrids ranged from 0.43 to 0.66, suggesting a moderate extent of genotypic divergence
among the parental cultivars. Heterotic performance of the hybrids was highest for grain yield and percent
spikelet fertility at 62% and 25.6%, respectively. However, the relationship between heterosis and molecular
genetic diversity was usually weak for most of the traits studied in the two-line hybrids.
Rapid progress in genomics research and the development of
new and simpler DNA-based markers have stimulated efforts
to predict the performance of hybrids based on molecular data
of their parents, thus speeding up the selection process in hybrid
breeding programs. Microsatellites or simple sequence
repeats (SSRs) are powerful DNA markers that can serve as
tools in assessing the diversity of parental cultivars at the DNA
level, yielding much more information than if diversity assessment
were based on phenotype alone.
In the Philippines, exploitation of heterosis in rice to
increase production and attain self-sufficiency has been increasingly
recognized by both the public and private sectors. Predicting
the performance of a hybrid using molecular techniques
could expedite the development of highly heterotic combinations
for commercial cultivation in farmers’ fields. However,
the relationship between marker heterozygosity and heterosis
has varied in different germplasm used (Saghai Maroof et al
1997, Liu and Wu 1998). The linear relationship between
molecular divergence of the parents and heterosis in three-line
and two-line hybrids in the Philippine hybrid rice gene pool is
unreported.
Materials and methods
Twenty-five parental cultivars consisting of 5 cytoplasmicgenetic
male sterile (CMS) lines, 10 restorer (R) lines, 4
thermosensitive genetic male sterile (TGMS) lines, and 6 popular
Philippine inbred varieties were used to develop 48 threeline
and 13 two-line F 1 hybrids. The CMS lines were earlier
shown to be genetically diverse based on 222 amplified fragment
length polymorphism (AFLP), SSR, and random amplified
polymorphic DNA (RAPD) markers (Redoña et al 1998).
Heterotic performance of the hybrids was evaluated in the field
following a systematic plot arrangement and randomized complete
block design with four check varieties—inbreds PSBRc28
and PSBRc18, and the hybrids PSBRc26H or Magat and
PSBRc72H or Mestizo. Three to five plants were examined
for 10 vegetative and reproductive characters—plant height,
maturity, leaf area index (LAI), root length, root weight, number
of productive tillers, harvest index, grain yield, panicle
length, and percent seed fertility.
One hundred eight and 45 SSR primers were used to
amplify SSR loci as described by Yang et al (1994) in the parental
cultivars of the two-line and three-line F 1 hybrids, respectively.
Distinct DNA fragments that were separated in a
5% denaturing polyacrylamide gel and detected using silver
RM255
RM164
Fig. 1. Microsatellite polymorphism as detected by short tandem
repeats at selected loci.
staining were scored as individual alleles representing a particular
locus (Fig. 1). Marker heterozygosity of the F 1 s or the
genetic distance between the parents was measured as the percentage
difference of marker genotypes across SSR loci between
the two parents of each cross combination. Cluster analysis
was performed following the UPGMA procedure and the
computer program NTSYS-PC (Rohlf 1990).
Results and discussion
Forty-three of 45 SSR primers detected polymorphism among
the parental cultivars used to develop the three-line hybrids.
Cluster analysis using the polymorphic loci separated the CMS
and R lines into two and eight groups, respectively, at a 75%
level of genetic similarity (Fig. 2), indicating the presence of
substantial genetic variation in the parental cultivars that could
be exploited to develop hybrids with a wide genetic base.
However, heterosis levels in the F 1 s derived from the crosses
of these parents showed low to intermediate heterosis for plant
height, maturity, harvest index, and grain yield. In contrast,
heterosis was high for LAI, root length, root weight, and number
of tillers plant –1 .
Correlation between SSR heterozygosity based on 43
marker loci and heterotic performance in the 48 three-line hybrids
was significant for number of productive tillers per plant
(r = 0.41**), LAI (r = 0.39**), and grain yield (r = –0.30*)
when all F 1 s were used in the analysis (Table 1). When only
Genetics and breeding of agronomic traits 13

0.66 0.69 0.72 0.75 0.78 0.81 0.84 coefficient
Similarity
PR1A
Fig. 2. Dendrogram of 15 parental lines used to develop 3-line hybrids based on 45
SSR marker variants.
Bo A
913 A
Zhangyu
PR28127
PR2A
SN62 a
IR58025 A
E2-208
SN45 b
O-71
Toyosake
E2-50
1xS-24
1xS-30
Table 1. Correlation between parental genetic distance and heterosis for eight
traits in 48 three-line F 1 hybrid combinations (average data of 1998 wet and
dry seasons).
Trait
Male parent PSBRc28 PSBRc72H
I II I II I II
Plant height –0.15 0.01 –0.10 0.24 –0.10 –0.19
Maturity –0.08 0.27 –0.15 –0.19 –0.15 None
Leaf area index 0.39** 0.45* –0.17 0.11 –0.21 –0.12
Root length 0.10 –0.06 0.10 –0.12 0.10 0.02
Root weight 0.13 0.05 0.05 0.03 0.05 0.002
No. of tillers plant –1 0.41** 0.40* 0.04 0.03 0.03 0.21
Harvest index –0.26 0.77* –0.26 None –0.29* –0.66
Yield –0.30* –0.03 –0.29* –0.43 –0.30* –0.81
a Correlations based on 48 F 1 hybrid combinations. b Correlations based on F 1 hybrid combinations
with positive heterosis.
Table 2. Correlation between marker
heterozygosity (general) and heterosis
for seven traits in 13 two-line hybrid
combinations.
Trait
r values a
Yield –0.28
Maturity 0.29
Plant height –0.34
No. of productive tillers –0.09
Panicle length –0.28
Number of spikelets –0.17
% spikelet fertility –0.20
a r values were insignificant at the 0.05 probability
level.
hybrids with positive heterosis for each trait were included in
the analysis, significant correlations were observed for LAI (r
= 0.45*), number of productive tillers per plant (r = 0.40*),
and harvest index (r = 0.77*) at the 0.05 probability level.
Although marker heterozygosity or parental genetic distance
has been reported to be associated with expression of heterosis
for some quantitative traits in the F 1 (Saghai Maroof et al
1997), the relationship observed with the germplasm used in
the study was generally low for most of the traits evaluated
when the correlation analysis was based on all the markers
used (general heterozygosity).
Among the parental lines used in developing the twoline
hybrids, microsatellite heterozygosity ranged from 0.43
to 0.66. Heterotic performance of the F 1 s was highest for grain
yield and percent spikelet fertility at 62% and 25.6%, respec-
tively. Hence, molecular divergence as well as heterosis levels
appeared to be substantial in this set of two-line hybrid
germplasm. However, insignificant correlations were mostly
observed between parental genetic distance and heterosis for
the quantitative traits analyzed (Table 2). Hence, at least in
this set of germplasm, results confirm the previous findings of
Liu and Wu (1998) that neither molecular genetic diversity of
parental lines nor heterozygosity in the F 1 appear to be good
parameters for heterosis and selection of parental lines for use
in hybrid breeding.
Several factors appear to influence the complex relationship
of molecular diversity data and heterosis in rice. Zhang et
al (1996) suggested that the use of DNA markers closely linked
to specific traits such as yield to determine specific heterozygosity
may be more effective in predicting heterotic perfor-
14 Advances in rice genetics

mance. However, this would require prior knowledge of the
chromosomal location of the genes controlling the traits of
interest through quantitative trait loci (QTL) analysis and this
information may not be readily available in many crop breeding
programs. Furthermore, QTL expression could vary with
both genetic background and environment (Redoña and Mackill
1996). Hence, hybrid rice breeders would be required to work
on a specific set of germplasm, under a given environment,
thereby limiting the general usefulness and applicability of
marker data for heterosis prediction in rice.
References
Liu XC, Wu JL. 1998. SSR heterogenic patterns of parents for marking
and predicting heterosis in rice breeding. Mol. Breed.
4:263-268.
Redoña ED, Mackill DJ. 1996. Quantitative trait locus analysis of
rice seedling vigor in japonica and indica genetic backgrounds.
Int. Rice Res. Notes 21:16-17.
Redoña ED, Ocampo TD, Hipolito LR, Sebastian LS. 1998. Classification
of cytoplasmic male-sterile rice lines based on RAPDs,
SSRs, and AFLPs. In: Larkin PJ, editor. Agricultural biotechnology:
laboratory, field and market. Proceedings of the 4th
Asia-Pacific Conference on Agricultural Biotechnology.
Canberra (Australia): UTC Publishing. p 87-89.
Rohlf FJ. 1990. NTSYS-pc. New York (USA): Applied Biostatistics,
Inc.
Saghai Maroof MA, Yang GP, Zhang Q, Gravois KA. 1997. Correlation
between molecular marker distance and hybrid performance
in U.S. southern long grain rice. Crop Sci. 37:145-
150.
Yang GP, Saghai Maroof MA, Xu CG, Zhang Q, Biyashev RM. 1994.
Comparative analysis of microsatellite DNA polymorphism
in landraces and cultivars of rice. Mol. Gen. Genet. 24:187-
194.
Zhang Q, Zhou ZQ, Yang GP, Xu CG, Liu KD, Saghai Maroof MA.
1996. Molecular marker heterozygosity and hybrid performance
in indica and japonica rice. Theor. Appl. Genet.
93:1218-1224.
Notes
Authors’ address: Plant Breeding and Biotechnology Division, Philippine
Rice Research Institute (PhilRice), Maligaya, Muñoz,
Nueva Ecija 3119, Philippines.
Stable high-yielding ability of japonica-indica hybrid rice
T. Takita, K. Terashima, N. Yokogami, and T. Kataoka
This report proves the stable high-yielding ability of japonica-indica hybrid rice. We developed japonica line TML1
with the S-5 n gene from a combination of Kyukei 890/Nekken 2, which efficiently reduced spikelet sterility of the
japonica-indica hybrid. THR1 and THR3 hybrids were developed by crossing japonica CMS line ms-TML1 and
indica cultivars Habataki and Ukei 581. THR1 had the highest yield of brown rice over 3 y, averaging 37% higher
than that of the japonica check Nipponbare. Heterobeltiosis was observed in panicle weight and straw weight.
THR3 showed similar trends with 17% higher yield than the japonica check Haenuki in tests over 2 y. Under high
N, THR3 yielded 8.2 t ha –1 , 19% higher than the highest-yielding check, Fukuhibiki. The yield of the paternal
indica line Ukei 581 was almost the same as that of the japonica variety. The japonica-indica hybrids showed
good plant type, large panicles, and large sink size like the paternal indica variety. In addition, they showed
strong lodging resistance and late leaf and panicle senescence like the maternal japonica variety. The japonicaindica
hybrids were high-yielding, with combined good characteristics of both japonica and indica varieties.
Hybrid rice is expected to be high-yielding. Since indica rice
is not well adapted in Japan and significant hybrid vigor is not
observed in japonica hybrids, japonica-indica hybrids may thus
be suitable in the country (Maruyama 1989). Although hybrid
sterility has been a problem in japonica-indica hybrids, it has
been solved by the discovery of the S-5 n gene, which efficiently
reduces spikelet sterility (Ikehashi and Araki 1986). Hence,
hybrids can have normal grain ripening when one of the parents
has the S-5 n gene. Kabaki et al (1992) found that japonicaindica
hybrids have the potential to achieve super high yield.
However, stable super high yields have not been achieved in
hybrids so far. So, we first developed high-yielding japonicaindica
hybrids and then examined the factors affecting the stability
of high yield.
Materials and methods
We first developed an improved japonica line—TML1 with
the S-5 n gene from Kyukei 890/Nekken 2. Kyukei 890 is a
japonica-type line from Suweon 258/Tainung 67, whereas
Nekken 2 is a japonica line with the S-5 n gene, which was
developed by Ikehashi and Araki (1986). We then produced
the male sterile line ms-TML1 by using a cytoplasmic male
sterile (CMS) line developed by Shinjo (1975). The CMS line
had the cytoplasm of Chinsurah Boro II and the nucleus of the
japonica line TML1. Japonica-indica hybrids THR1 and THR3
were developed by crossing ms-TML1 and indicas Habataki
and Ukei 581, respectively. The paternal indica Habataki is a
very high-yielding variety developed in Japan. In contrast, the
Genetics and breeding of agronomic traits 15

paternal indica Ukei 581 is a breeding line developed from a
combination between Chinese indica varieties.
Yield trials were conducted for THR1 in 1994-96 in
Miyazaki and for THR3 in 1998-99 in Omagari with two replications
using a standard cultivation method (N level: 90 kg
ha –1 ). In addition, yield trials were conducted under very high
N (150 kg ha –1 ) in 1999.
Results and discussion
THR1 had the highest brown rice yield every year in tests over
3 y with an average yield 37% higher than that of the japonica
check Nipponbare (Table 1). In contrast, the paternal indica
variety Habataki showed a 15% higher yield than the japonica
variety, with almost the same yield as the japonica under cool
weather. Heterobeltiosis was observed in panicle weight and
straw weight.
Table 1. Yield (t ha –1 ) of japonica-indica hybrid THR1. a
Variety Type 1994 1995 1996 Av (%)
THR1 (P 1 /P 2 ) Hybrid 7.2 7.2 6.6 7.0 (137)
Habataki (P 2 ) Indica 6.3 6.3 5.1 5.9 (115)
Nipponbare (check) Japonica 4.9 5.6 5.1 5.1 (100)
a N level = standard (90 kg ha –1 ), ripening condition for 1994 = hot, 1995 = medium,
1996 = cool.
Table 2. Yield (t ha –1 ) of japonica-indica hybrid THR3. a
Variety Type 1998 1999 Av (%)
THR3 Hybrid 55.6 62.8 59.2 (117)
Ukei 581 Indica 43.6 58.3 51.0 (101)
Haenuki (check) Japonica 47.1 54.0 50.6 (100)
a N level = standard (90 kg ha –1 ). THR3 = ms-TML1/Ukei 581 (japonica-indica hybrid).
Ripening condition for 1998 = cool, 1999 = hot.
THR3 also had high yields, which were 17% higher than
that of the japonica check Haenuki in 2-y tests (Table 2). The
yield of paternal indica Ukei 581 was obviously lower in a
cool-weather year and higher in a hot-weather year and was
almost the same as that of the japonica variety on average.
Under high-N conditions, the yield of THR3 was extraordinarily
high and reached 8.2 t ha –1 or 19% higher than
that of the highest-yielding check, Fukuhibiki (Table 3). The
yield of the paternal indica line Ukei 581 was almost the same
as that of the japonica variety.
The japonica-indica hybrids showed good plant type,
large panicles, and large sink size before and during heading.
These hybrids also exhibited strong lodging resistance and late
leaf and panicle senescence. It can be concluded that japonicaindica
hybrids can be high-yielding because of the combination
of good characteristics of both japonica and indica varieties
(Table 4).
References
Ikehashi H, Araki H. 1986. Genetics of F 1 sterility in remote crosses
of rice. Proceedings of the International Rice Genetics Symposium.
Los Baños (Philippines): International Rice Research
Institute. p 119-130.
Kabaki N, Hasegawa H, Yamaguchi H, Kon T. 1992. Growth and
yield of japonica-indica hybrid rice. Bull. Hokuriku Natl.
Agric. Exp. Stn. 34:111-139.
Maruyama K. 1989. Hybrid rice breeding. Nogyo Gijutsu 44:183-
188. (In Japanese.)
Shinjo C. 1975. Genetic studies of cytoplasmic male sterility and
fertility restoration in rice. Sci. Bull. Coll. Univ. Ryukyus 22:1-
57.
Notes
Authors’ address: Tohoku National Agricultural Experiment Station,
Omagari 014-0102, Japan.
Table 3. High-yielding ability of THR3 at high N level. a
Heading Culm Panicles Total 1,000-grain % of Yield
Variety time length m –2 weight weight ripened (t ha –1 )
(date) (cm) (no.) (t ha –1 ) (g) grains
THR3 2 Aug 86 336 20.9 23.5 75 8.2 (119)
Ukei 581 6 Aug 83 281 18.5 21.7 76 6.7 ( 98)
Fukuhibiki 2 Aug 88 380 17.5 22.7 77 6.9 (100)
(check)
a Transplanting date = 17 May, N level = 150 kg ha –1 , Fukuhibiki = very high-yielding japonica.
Table 4. Combination of important traits in japonica-indica hybrids. a
Type Tolerance for Plant Sink Grain- Leaf Yielding
low temperature type size ripening period senescence ability
Hybrid (J/I) ◦ tolerant ◦ ◦ ◦ long ◦ late stable
Japonica (J) ◦ tolerant ◦ long ◦ late
Indica (I) susceptible ◦ ◦ short early
a = very good, ◦ = good, = moderate, = bad.
16 Advances in rice genetics

Inheritance of fertility restoration of WA cytoplasm
in sodic-tolerant rice hybrids
A. Jauhar Ali, S.E. Naina Mohammed, R. Rajagopalan, and C.H.M. Vijayakumar
A study was conducted on fertility restoration of wild abortive (WA) cytoplasm under reclaimed sodic soils of five
promising sodic-tolerant hybrids. These selected sodic-tolerant hybrids were screened in sodic soils with pH 9.2
and EC 0.25 dS m –1 before they were studied for the F 2
inheritance pattern under reclaimed sodic soils. The
male sterile lines IR58025A and Pusa 5A, which were moderately sodic-tolerant when screened under sodic
soils with pH 9.0 and EC 0.25 dS m –1 , were found to be one of the common female parents of all the sodictolerant
hybrids studied. Pollen fertility percentage was worked out on an individual plant basis for each cross
separately by staining the pollen with IKI (1%) and observing samples under the microscope. The F 2
segregation
pattern for all the crosses fitted well for 15 fertile:1 sterile by chi-square analysis, indicating a duplicate dominant
epistasis involving two genes similar to earlier findings. Sodic-tolerant restorers are being identified, male
sterile lines are being converted in the background of sodic-tolerant varieties, and they are being used to
develop sodic-tolerant rice hybrids.
Hybrid rice cultivation in problem soils was first attempted in
1995 under sodic soils but with little success since tolerance
of sodicity is a complex problem. Most of the genes for sodicity
tolerance complement each other in the early phase, but fail to
complement each other in the last phase, that is, from flowering
to maturity, when yield levels fall drastically (Ali et al 1996).
In India, the area under problem soils is nearly 11 million ha,
with about 0.42 million ha in Tamil Nadu. Hybrid rice technology,
if especially tailored to meet the requirements, can be
extended to sodic soils. Sodic-tolerant hybrid rice can be developed
by making both parents, A (male sterile) and R (restorer),
sodic-tolerant (Ali et al 1996, 1998). Only certain hybrid
combinations were found to be suitable for sodic soils,
especially those that could complement their sodicity tolerance
traits favorably. Stable sodic-tolerant, male sterile maintainer
and restorer lines are needed. The restoration of male
fertility in the F 1 is an important phenomenon by which the
success of the hybrid ultimately depends. Therefore, studies
on the genetics of fertility restoration can lead to proper understanding
of this important phenomenon, especially when
the search is for sodic-tolerant restorer lines.
Materials and methods
A total of 26 male sterile lines representing diverse cytoplasmic
male sterility sources, such as wild abortive, O. perennis,
and MS 577A, were screened under sodic soils with pH 9.2
and EC 0.25 dS m –1 during the 1998 wet season. Sodicity tolerance
was scored for phenotypic acceptability (PACP) immediately
after sowing, that is, at germination (3–5 d after
emergence), seedling, tillering, flowering, and harvest (maturity),
using a 0–9 scale, with 9 being the most susceptible reaction
in terms of poor germination, seedling vigor, tillering,
flowering, and maturity (spikelet fertility) and 1 indicating that
plants are sodic-tolerant.
Five highly sodic-tolerant experimental hybrids were
selected based on high pollen and spikelet fertility from 120
testcrosses screened under sodic soils with pH 9.2 and EC 0.25
dS m –1 . Pollen fertility was tested by staining the pollen in 1%
potassium iodide (IKI) from five random spikelets of individual
plants. Other unstained or partially stained shriveled or round
pollen types were considered as sterile. For each hybrid combination,
the segregation pattern was studied individually by
plant and chi-square analysis was carried out to test the segregation
ratios.
Results and discussion
Among the CMS and maintainer lines screened, IR58025A,
IR62829A, IR66707A (O. perennis cytoplasm), IR68281A,
IR68890A, IR68891A, IR68895A, IR68899A, Pusa 5A, and
their respective maintainer lines were found to be moderately
tolerant in all five stages—germination, seedling, tillering,
flowering, and harvest (maturity). The phenotypic acceptability
score was 3, which was comparable with that of the local
sodic-tolerant check, TRY 1. There was no significant difference
between male sterile lines and their respective maintainer
lines except in PMS 3A, which showed better sodicity tolerance
than its maintainer line, clearly indicating no cytoplasmic
influence on either susceptibility or resistance (Table 1).
Male sterile IR66707A (O. perennis cytoplasm) and its maintainer
line showed moderate tolerance for sodicity, whereas
MS 37A (MS 577A cytoplasm) and its maintainer line were
not tolerant of sodicity.
Of the 120 testcrosses (IR58025A and Pusa 5A, with a
sodic-tolerant source nursery) that were screened under sodic
soils with pH 9.2 and EC 0.27 dS m –1 , only the five most promising
F 1 hybrid combinations with high yields under sodicity
stress were selected for their F 2 segregation pattern. The F 2
segregation for the restoration of WA cytoplasm for all five
superior hybrids fitted well for a 15 fertile:1 sterile (Table 2),
Genetics and breeding of agronomic traits 17

Table 1. Screening of different cytoplasmic male sterile lines and their maintainer
lines under sodic soils.
Phenotypic
acceptability score
over five stages
CMS and maintainer lines a
3 IR58025A/B, IR62829A/B, IR66707A*/B, Pusa 5A/B, IR68281A/
B, IR68899A/B, IR68890A/B, IR68891A/B, IR68895A/B, PMS
5A/B, PMS 3A, TRY 1 (check)
5 PMS 3B
7 IR67683A/B, PMS 8A/B, DRR 3A/B, PMS 9B, PMS 10B, V20B,
IR68275B, IR68280B
9 MS 37A**/B, IR68902A/B, IR68897A/B, IR68888A/B,
IR68887A/B, IR68279A/B, ZS 97A/B, IR64607A/B, PMS 9A,
PMS 10A, V20A, IR68275A, IR68280A
a *= O. perennis sterile cytoplasm. ** = MS577A sterile cytoplasm.
Table 2. Pollen and spikelet fertility in F 1 s and F 2 s derived from crosses of CMS lines (WA cytoplasm) with
different restorers.
Fertility (%) in F 1 F 2 plants (no.)
Hybrid Cross Expected Probability
Pollen Spikelet Fertile Sterile ratio
pollen pollen
TRYRH 98019 IR58025A/NSASN 2434 76.5 95.8 78 5 15:1 0.93
TRYRH 98045 IR58025A/IR55178-B-B-B-25-1 70.8 86.0 90 8 15:1 0.43
TRYRH 98067 IR58025A/C 20 R 79.3 90.3 29 1 15:1 0.51
TRYRH 98198 Pusa 5A/IR55178-B-B-B-2-1 70.0 84.1 29 1 15:1 0.51
TRYRH 98210 Pusa 5A/C 20 R 70.5 85.4 28 2 15:1 0.93
indicating a duplicate dominant epistasis involving two genes.
Several workers have reported that fertility restoration of WA
cytoplasm is controlled by two dominant genes (Zhou et al
1983, Virmani et al 1986, Govinda Raj and Virmani 1988). Of
the two genes, one is stronger than the other for fertility restoration.
Allelic studies between sodic-tolerant and susceptible
restorers thus need to be carried out. To develop sodic-tolerant
rice hybrids, apart from identifying sodic-tolerant restorers,
conversion of male sterile lines in the background of sodictolerant
varieties is being carried out.
References
Ali AJ, Rangaswamy M, Rajagopalan R, Mohammed SEN,
Manickam TS. 1998. TNRH 16: a salt-tolerant rice hybrid.
Int. Rice Res. Notes 23(2):22.
Ali AJ, Rangaswamy M, Rajagopalan R, Naina Mohammed SE. 1996.
Hybrid rice for salt-affected soils. TNAU Newsl. 25(12):2.
Govinda Raj K, Virmani SS. 1988. Genetics of fertility restoration
of WA-type cytoplasmic male sterility in rice. Crop Sci. 28:787-
792.
Virmani SS, Govinda Raj K, Casal C, Dalmacio RD, Aurin PA. 1986.
Current knowledge of and outlook on cytoplasmic genetic male
sterility and fertility and restoration in rice. In: Rice genetics.
Manila (Philippines): International Rice Research Institute.
p 633-647.
Zhou TL, Shen JH, Ye FC. 1983. A genetic analysis on the fertility
of Shan-type hybrid rice with wild rice cytoplasm. Acta Agron.
Sin. 9(4):241-247.
Notes
Authors’ addresses: A. Jauhar Ali, S.E. Naina Mohammed, and R.
Rajagopalan, Agricultural College and Research Institute,
Tamil Nadu Agricultural University, Tiruchirapalli 620 009;
C.H.M. Vijayakumar, Directorate of Rice Research, Hyderabad
500 030, India.
18 Advances in rice genetics

Genetic analysis of temperature-sensitive genic
male sterility in rice
A. Jauhar Ali, S.E. Naina Mohammed, R. Rajagopalan, and C.H.M. Vijayakumar
Crosses were made between two TGMS lines, ID24 × SM5 and IC10 × JPs4. The F 1
s had completely normal
pollen and spikelet fertility under high temperature (35 °C day/26 °C night). The F 2
s showed a 9 fertile:7 sterile
ratio, indicating that the character is governed by two separate genes. Pollen sterility in the F 2
ranged from
completely sterile to 27% sterility, indicating the effect of modifier genes under high-temperature regimes (during
April 1998 at Tiruchirapalli, India). Testcrosses made between TGMS and non-TGMS lines were used to
determine the F 2
segregation pattern under higher temperature. The eight most promising F 1
s based on their
yield performance were selected and F 2
segregation under high temperature was carried out for pollen fertility.
The F 2
segregated into a 3 fertile:1 sterile (TGMS) ratio under high temperature (>35.5 °C day and >25.6 °C
night), indicating that the TGMS trait is governed by a single gene.
The discovery of environment-sensitive genic male sterility
(EGMS) in rice led to the development of a simple and highly
efficient two-line hybrid breeding system. Different sources
of photoperiod-sensitive genic male sterility (PGMS) and
thermosensitive genic male sterility (TGMS) have been developed
in various countries—China, Japan, India, and the
Philippines (IRRI). The TGMS system is more useful than the
PGMS system in the tropics, where daylength differences are
marginal. TGMS lines grown under high temperature (i.e., >30
°C day/>24 °C night) become completely male sterile. When
raised under lower temperature regimes (such as 24 °C day/
>16 °C night temperatures), they become fertile. TGMS lines
are sensitive to such temperatures during stages II to IV of the
panicle developmental phase (16–24 d before heading). The
TGMS-based two-line approach for producing hybrid seed
does not require any class of restorers since 95% of the varieties
restore the fertility of the F 1 . Furthermore, the cytoplasm is
not involved in the sterility expression, thus reducing the risk
of potential genetic vulnerability. The PGMS in Nongken 58s
and its derivative lines was found to be governed by a pair of
recessive genes, whereas the TGMS trait in 5460s (Sun et al
1989), R59TS (Yang et al 1990), H89-1 (Norin PL 12)
(Maruyama et al 1991), and SA 2 (Ali 1996, Ali et al 1995)
was controlled by a single recessive gene. Information on inheritance
of the TGMS trait is limited to a few sources. This
study was undertaken using a larger number of hybrid combinations
(TGMS × non-TGMS) with different TGMS sources
and also to examine the allelic relationships among certain
TGMS sources.
Materials and methods
Four TGMS lines—ID24, IC10, SM5, and JPs4—from the
Directorate of Rice Research, Hyderabad, India, were used to
study allelic relationships. Crosses were made by treating these
lines under natural temperatures during the sensitive stage (i.e.,
16 to 24 d before heading during November and December
when the temperatures at Tiruchirapalli, India, were about 29
°C day/23 °C night). This resulted in ID24 and IC10 becoming
completely pollen sterile and SM5 and JPs4 becoming
partially pollen fertile. The critical sterility point (CSP) of ID24
and IC10 was relatively lower than that of SM5 and JPs4. The
F 1 s were raised during the wet season in separate rows. Likewise,
the F 2 generation of the two crosses was raised under
high temperature (>32 °C day/>26 °C night ) during April and
May. Pollen fertility was examined by smearing anthers of five
spikelets with 1% IKI stain under a light microscope.
Of 116 testcrosses made between TGMS and non-TGMS
lines, only eight were selected based on their high pollen and
spikelet fertility and yield per plant (averaged over 10 plants)
in the F 1 . Sources such as JP2, SM5, Xiang 125-5-11, IR68945,
TS 10/1, and TS 012 were used. Likewise, the F 2 was raised
during April and May, when the temperatures were high (>32
°C day/>26 °C night). Pollen fertility was studied for each individual
segregating plant in the F 2 .
Results and discussion
When crosses were made between TGMS × TGMS lines (i.e.,
ID24 × SM5 and IC10 × JPs4), the F 1 s were completely normal
for pollen and spikelet fertility under high-temperature
conditions (Table 1). For both crosses, the F 2 showed a ratio
of 9 fertile:7 sterile (probability % 0.50–0.30), indicating that
the character is governed by two separate genes. Since ID24
carries the tms 1 allele (Reddy 1997), SM5 must carry a different
allele. Likewise, IC10 is already known to carry tms 3 , fur-
Table 1. Pollen and spikelet fertility in F 1 and F 2 derived from crosses
of two TGMS parents.
Cross
F 1 fertility F 2 with plants
(%) (no.)
Expected Probability
Pollen Spikelet Fertile Sterile ratio
pollen pollen
ID24/SM5 95.0 85.0 39 25 9:7 0.95
IC10/JPs4 99.5 87.0 42 27 9:7 0.44
Genetics and breeding of agronomic traits 19

Table 2. Genetic analysis of pollen and spikelet fertility in F 1 and F 2 derived from
crosses of TGMS × non-TGMS parents.
F 1 fertility (%) F 2 with plants (no.)
Cross combination Expected Probability
Pollen Spikelet Fertile Sterile ratio
pollen pollen
Xiang 125-5-11/ 91.0 89.0 56 19 3:1 0.95
IR37255-21-3-3-2
JP2/Pokkali 82.0 80.0 59 17 3:1 0.60
JP2/Lunishree 90.0 88.0 58 17 3:1 0.72
IR68945/CSR11 92.0 86.0 56 19 3:1 0.95
SM5/AS89044 87.0 90.0 55 17 3:1 0.78
JP2/CR1009 88.0 91.0 55 20 3:1 0.72
TS10/1 × ADT 49 92.0 85.0 52 16 3:1 0.78
TS12/AD 9018 91.0 84.0 56 16 3:1 0.78
ther indicating that JPs4 carries a different allele. Pollen sterility
in F 2 segregants ranged from completely sterile to 27%
pollen sterility, indicating the effect of modifier genes under
high-temperature regimes (35 °C day/26 °C night temperatures)
during April 1998 at Tiruchirapalli. The identification
of different TGMS genes in rice provides hybrid rice breeders
with diverse sources for developing two-line rice hybrids.
The eight most promising F 1 s based on yield performance
were selected and their F 2 segregation patterns under
high temperature were studied by analyzing pollen fertility.
The chi-square test revealed that the F 2 segregation fitted well
with a ratio of 3 fertile:1 sterile (Table 2) under high temperature
(>35.5 °C day and >25.6 °C night). This indicated that
the TGMS trait was governed by a single gene following a
monogenic inheritance pattern similar to earlier findings (Sun
et al 1989, Yang et al 1990, Maruyama et al 1991, Ali 1996).
This confirmed that, in most TGMS sources studied, the trait
is governed by a single recessive gene.
References
Ali J. 1996. Studies on temperature sensitive genetic male sterility
and chemical-induced sterility towards development of twoline
hybrids in rice (Oryza sativa L.). PhD thesis. Indian Agricultural
Research Institute, New Delhi, India.
Ali J, Siddiq EA, Zaman FU, Abraham MJ, Ahmed IM. 1995. Identification
and characterization of temperature sensitive genic
male sterile sources in rice (Oryza sativa L.). Indian J. Genet.
55:243-259.
Maruyama K, Araki H, Kato H. 1991. Thermosensitive genetic male
sterility induced by irradiation. In: Rice genetics II. International
Rice Research Institute, Los Baños, Philippines. p 227-
235.
Reddy OUK. 1997. Physiological and molecular characterization and
genetics of temperature sensitive genic male sterile sources
for heterosis breeding in rice. PhD thesis. Osmania University,
Hyderabad, India.
Sun ZX, Xiong ZM, Min SK, Si HM. 1989. Identification of the
temperature-sensitive male sterile rice. Chinese J. Rice Sci.
3(2):49-55.
Yang RC, Wang NY, Mang K, Chan Q, Yang RR, Chen S. 1990.
Preliminary studies on application of indica photo (thermo)
sensitive genic male sterile 5460 S in hybrid rice breeding.
Hybrid Rice 1:32-34.
Notes
Authors’ addresses: A. Jauhar Ali, S.E. Naina Mohammed, R.
Rajagopalan, Agricultural College and Research Institute,
Tamil Nadu Agricultural University, Tiruchirapalli 620 009;
C.H.M. Vijayakumar, Directorate of Rice Research, Hyderabad
500 030, India.
Complexity of inheritance of thermosensitive genic
male sterility in rice
R.B. Li and M.P. Pandey
Thermosensitive genic male sterility (TGMS) in rice is a critical trait for exploiting heterosis, especially of an
intersubspecific nature, using the two-line system. In contrast to the reports of its simple and monogenic inheritance,
the trait is complexly inherited. Hybrids of TGMS line UPRI 95-140TGMS with 44 normal male fertile lines
offered evidence that the genetic background modified the segregation ratios and at least three pairs of major
genes were involved in TGMS expression. Detailed studies showed that most of the monogenic (3F, fertile:1S,
sterile) and digenic (15F:1S) segregation ratios could be resolved into 12 fertile:3 partially sterile:1 completely
20 Advances in rice genetics

sterile, whereas some of the digenic segregations were resolved into a 60F:3PS:1CS ratio. A nonidentical effect
of the three pairs of independent recessive genes on inducing male sterility was observed. None of the single
genes conferred complete male sterility. Effects of the corresponding dominant genes to recover male fertility
were observed and the magnitude of the first gene was 1.7 to 2.1 times that of the second gene, and the third
gene was the weakest. In conclusion, the complexity of the TGMS inheritance pattern and gene expression was
due to the cumulative effect of the trigenic nature of inheritance and its interaction with the genetic background
and environmental temperature.
Thermosensitive genic male sterility (TGMS) is an important
tool for developing two-line rice hybrids. This system is more
advantageous in that it uses simpler and more economical hybrid
seed production and a broader choice of male parents for
enhancing yield potential because the maintainer and restorer
genes employed in the current three-line hybrid breeding system
are not required. The trait has shown monogenic inheritance
and three independent genes, tms 1 (Yang et al 1992), tms 2
(Maruyama et al 1991), and tms 3 (Borkakati and Virmani
1996), were reported. Few other TGMS sources have been
reported. Recently, a new TGMS source, UPRI 95-140TGMS,
was identified in our hybrid breeding program (Pandey et al
1998). The trait in the line has displayed digenic inheritance
(Li and Pandey 1998, 1999). However, further investigations
have revealed a more complicated inheritance pattern of the
trait and these new findings are reported here.
Inheritance pattern of TGMS in UPRI 95-140TGMS
Segregation for different fertility types
The TGMS line UPRI 95-140TGMS, a spontaneous mutant
with known fertility-sterility transformation behavior under
thermosensitive temperature (Pandey et al 1998), was studied
for the inheritance of its TGMS trait. F 2 populations from
crosses between the TGMS line and 44 lines having normal
male fertility were grown in the 1998 wet season (WS) at
28.55–28.72 °C of mean 15-d thermosensitive temperature (15-
dTT) in which the female TGMS line was completely male
sterile. Results revealed three kinds of segregation when 80%
of the spikelet fertility criterion was adopted to ascertain fertile
and sterile plants. The three segregation ratios had a goodness
of fit to the expected monogenic (3F:1S), digenic
(15F:1S), and trigenic (63F:1S) ratios.
Resolution of sterility segregation
Four pairs of TGMS near-isogenic lines (NILs) in elite genetic
backgrounds were developed and pair-crossed. The parental,
F 1 , F 2 , and TC 1 generations were space-planted under
mean 15-dTT of 28.61 °C. At heading, some of the panicles in
each plant were removed to promote late tiller formation and
heading at different dates to meet the condition of different
environmental temperatures.
Results indicated distinct groups of fertile plants from
sterile plants in the F 2 populations of crosses UPTRI 95-
140TGMS/UPRI 95-140NIL, UPTRI 95-141NILTGMS/UPRI
95-141, and UPTRI 95-140TGMS/UPRI 95-141. Observed
segregations were in the ratios of 167F:48S, 93F:27S, and
166F:59S, respectively. These fitted the expected ratio of
3F:1S, indicating monogenic segregation in fertility/sterility.
Similarly, the observed ratios, 57F:63S, 26F:19S, and 59F:61S
in the TC 1 generation of the three crosses, had a goodness of
fit to the expected ratio of 1:1, confirming monogenic inheritance.
Since the variation in fertility within the sterility group
of the three crosses had been very large, it was further resolved
into complete sterility (identical to that of the female parent
with fertility 5 but

Table 1. Segregation patterns for pollen fertility in F 2 and testcross (TC) generations of the crosses.
Plants a (no.)
Expected
Cross combination Generation ratio X 2 P value
Total F PS CS
UPRI 95-140TGMS/ F 2 225 166 44 15 12:3:1 0.185 0.90–0.95
UPRI 95-141 TC 1 120 59 33 28 2:1:1 0.495 0.70–0.90
UPRI 95-140TGMS/ F 2 215 167 33 15 12:3:1 1.713 0.25–0.50
UPRI 95-140NIL TC 1 120 57 32 31 2:1:1 0.317 0.70–0.90
UPRI 95-140TGMS/ F 2 358 337 14 7 60:3:1 0.804 0.50–0.70
RL 253-3 TC 1 135 100 17 18 6:1:1 0.091 0.95–0.99
UPRI 95-141NILTGMS/ F 2 120 93 20 7 12:3:1 0.411 0.70–0.90
UPRI 95-141 TC 1 45 26 9 10 2:1:1 1.133 0.50–0.70
UPRI 95-117NILTGMS/ F 2 165 152 – 13 15:1 0.747 0.25–0.50
UPRI 95-117 TC 1 120 92 – 28 3:1 0.178 0.50–0.70
RL 253-3NILTGMS/ F 2 348 340 – 8 63:1 1.227 0.25–0.50
RL 253-3 TC 1 267 232 – 35 7:1 0.090 0.70–0.90
UPRI 95-140TGMS/ F 2 120 114 – 6 15:1 0.320 0.50–0.70
UPRI 95-117 TC 1 120 88 – 32 3:1 0.178 0.50–0.70
a F = fertile, PS = partially sterile, and CS = completely sterile plants.
Table 2. Segregation patterns for fertility in F 3 generations of crosses.
Progenies (no.)
Cross Group Expected X 2 P value
of F 3 Total True- Segre- True- ratio
progenies a breeding gating breeding
(fertile) (sterile)
UPRI 95-140TGMS/UPRI I 80 23 57 – 4:8 0.756 0.25–0.50
95-140NIL II 30 – 21 9 2:1 0.150 0.50–0.75
III 10 – 0 10 – – –
UPRI 95-140TGMS/UPRI I 88 38 50 0 7:8 0.357 0.50–0.75
95-117 III 12 – 0 12 – – –
UPRI 95-140TGMS/UPRI I 80 24 56 – 4:8 0.400 0.50–0.75
95-141 II 40 – 28 12 2:1 0.312 0.50–0.75
III 15 – 0 15 – – –
UPRI 95-117NILTGMS/ I 60 29 31 – 7:8 0.067 0.70–0.90
UPRI 95-117 III 15 – 0 15 – – –
UPRI 95-141NILTGMS/ I 80 28 52 – 4:8 0.100 0.70–0.90
UPRI 95-141 II 30 – 19 11 2:1 0.150 0.50–0.70
III 8 – 0 8 – – –
a Groups I, II, and III are the progenies from fertile, moderately sterile, and completely sterile F 2 plants, respectively.
population did not give any Group II progenies and Group I
segregated for 7 true-breeding fertile:8 segregating. However,
for UPTRI 95-140TGMS/UPRI 95-141 and UPTRI 95-
141NILTGMS/UPRI 95-141, differential expression of two
dominant genes for male fertility was observed. The PS plants
in the F 2 possessed only a single major but weaker dominant
gene, and the fertile plants were either both homozygous dominant
or with one major and stronger dominant gene and another
weaker homozygous recessive gene. Therefore, in the F 3
generation, the Group II and Group I progenies segregated 2
segregating:1 true-breeding sterile progenies and 4 true-breeding
fertile:8 segregating progenies, respectively (Table 2).
Effect of different genes on male fertility
It was assumed that the TGMS trait of UPRI 95-140TGMS,
the female parent, was under the control of three pairs of recessive
genes, tms 5 (t 5 ), tms 6 (t 6 ), and tms 7 (t 7 ), and had the
genotype t 5 t 5 t 6 t 6 t 7 t 7 with the gene effect t 5 >t 6 >t 7 for male sterility
and the corresponding genes T 5 >T 6 >T 7 for male fertility.
In the TC 1 and F 2 populations of UPRI 95-140TGMS/UPRI
95-140NIL and UPRI 95-140TGMS/UPRI 95-141, the genotype
t 5 t 5 t 6 t 6 was completely sterile and could be distinguished
from other fertile classes (PS, MF, and F) at 28.61/25.25 °C of
the mean/minimum 15-dTT. The genotypes t 5 t 5 t 6 t 6 T 7 t 7 and
t 5 t 5 t 6 t 6 t 7 t 7 were indistinct from each other at this temperature
since both were completely sterile, but they were distinct at
the relatively lower temperature of 27.10/23.57 °C, whereas
the former genotype was partially fertile and the latter completely
sterile. In this way, different genotypes in different
crosses were identified and their genotypic and genic effects
could be analyzed.
It was observed that, at the mean/minimum temperature
of 28.61/25.25 °C of 15-dTT, the gene T 7 had no influence on
22 Advances in rice genetics

Table 3. Estimation of mean genotypic effects on fertility in the TC 1 generation at different 15-d
thermosensitive temperatures.
Phenotype a at
Pollen fertility (%) at 15-dTT
Cross Genotype 28.61/25.25 °C (°C mean/minimum)
(mean/minimum
15-dTT) 28.61/25.25 27.10/23.57 25.84/21.59
UPRI 95-140TGMS// t 5 t 5 t 6 t 6 CS 0.0 ± 0.0 51.1 ± 23.5 80.3 ± 8.2
UPRI 95-140TGMS/ t 5 t 5 t 6 t 6 t 7 t 7 CS 0.0 ± 0.0 0.0 ± 0.0 7.6 ± 4.4
UPRI 95-140NIL t 5 t 5 t 6 t 6 T 7 t 7 CS 0.0 ± 0.0 53.3 ± 12.5 83.0 ± 4.5
t 5 t 5 T 6 t 6 PS 45.5 ± 31.8 92.2 ± 5.1 95.4 ± 4.0
T 5 t 5 t 6 t 6 MF 96.0 96.9 94.8
T 5 t 5 t 6 t 6 , F (MF+HF) 97.3 ± 2.1 97.9 ± 1.8 96.3 ± 2.9
T 5 t 5 T 6 t 6
UPRI 95-140TGMS// t 5 t 5 t 6 t 6 CS 1.07 ± 1.65 58.4 ± 26.7 72.8 ± 22.3
UPRI 95140-TGMS/ t 5 t 5 T 6 t 6 PS 48.7 ± 26.7 85.5 ± 12.3 90.4 ± 8.6
UPRI 95-141 T 5 t 5 t 6 t 6 MF 93.0 91.7 91.4
T 5 t 5 t 6 t 6 ,
T 5 t 5 T 6 t 6 F (MF+HF) 95.4 ± 2.6 94.7 ± 3.8 94.2 ± 4.4
UPRI 95-140TGMS// t 5 t 5 t 6 t 6 t 7 t 7 CS 0.8 ± 0.3 72.7 ± 31.8 84.9 ± 5.1
UPRI 95-140TGMS/ t 5 t 5 t 6 t 6 T 7 t 7 PS 68.5 ± 34.2 90.6 ± 5.5 92.2 ± 3.8
RL 253-3 T 5 t 5 T 6 t 6 , F (MF+HF) 95.6 ± 3.2 95.0 ± 3.8 94.7 ± 4.0
t 5 t 5 T 6 t 6 ,
T 5 t 5 t 6 t 6
a CS = completely sterile, PS = partially sterile, F = fertile, MF = moderately fertile, HF = highly fertile.
fertility as compared with the nil effect of t 5 t 5 t 6 t 6 t 7 t 7 ; therefore,
the effects of genes t 5 , t 6 , t 7 , and T 7 on male fertility were
all equal to zero. The effects of genotypes t 5 t 5 T 6 - and T 5 -t 6 t 6
on pollen fertility were recorded in the range of 45.5–49.6%
and 92.8–97.4%, respectively. Thus, the expression of T 5 on
male fertility was 1.5 to 2.1 times larger in magnitude compared
with that of the T 6 gene (Table 3).
A similar analysis in the cross UPRI 95-140TGMS/RL
253-3 for the F 2 and TC 1 generations revealed the effects of
genes t 5 , t 6 , and t 7 on pollen fertility to be zero, whereas the
effect of T 7 ranged from 59.4% to 68.5%. The cumulative effects
of T 6 and T 5 were close to normal fertility since the plants
with the genotypes t 5 t 5 T 6 - and T 5 -t 6 t 6 were not distinguishable
from the normal fertility class (Table 3).
References
Borkakati RP, Virmani SS. 1996. Genetics of thermosensitive genic
male sterility in rice. Euphytica 88:1-7.
Li Rongbai, Pandey MP. 1998. Genetics of the thermosensitive genic
male sterility trait in rice. Int. Rice Res. Notes 23(2):9-10.
Li Rongbai, Pandey MP. 1999. Genetics and breeding behaviour of
thermosensitive genic male sterility in rice (Oryza sativa L.).
J. Genet. Breed. 53:11-17.
Maruyama K, Araki H, Kato H. 1991. Thermosensitive genic male
sterility induced by irradiation. In: Rice genetics II. Manila
(Philippines): International Rice Research Institute. p 227-
235.
Pandey MP, Li Rongbai, Singh JP, Mani SC, Singh H, Singh S. 1998.
The identification and nature of a new thermosensitive genic
male sterility source, UPRI 95-140 in rice. Cereal Res.
Commun. 26(3):265-269.
Yang RC, Liang K, Wang N, Chen S. 1992. A recessive gene in
indica rice 5406S for thermosensitive genic male sterility. Rice
Genet. Newsl. 9:56-57.
Notes
Authors’ addresses: R.B. Li, Guangxi Academy of Agricultural Sciences,
Nanning 530007, China; M.P. Pandey, Department of
Genetics and Plant Breeding, G.B. Pant University of Agriculture
and Technology, Pantnagar 263145, India.
Genetics and breeding of agronomic traits 23

Characterizing tropical japonicas with wide
compatibility based on isozyme pattern in rice
S.S. Malik, D.S. Brar, and G.S. Khush
During the 1970s, an indica-japonica hybridization program was launched in India, Indonesia, Malaysia, and
some other Asian countries with the help of FAO to get high heterosis. However, only limited progress could be
made because of the F 1
sterility in indica-japonica crosses. Some varieties showed normal fertility in F 1
in indicajaponica
crosses, and these were designated as wide compatibility varieties (WCV). The sterility genes S 5 located
between C + (chromogen for apiculus color) and Wx (waxy endosperm) loci with the S 5n allele for WCV, S 5i
for indica, and S 5j for japonica varieties were identified. Genotypes with S 5n /S 5i or S 5n /S 5j were fertile but genotypes
with S 5i /S 5j were semisterile because of partial abortion of gametes carrying S 5j alleles.
To find wide compatibility varieties (WCV), 85 bulu varieties
from Indonesia were crossed to indica (IR36) and japonica
(T65) testers. Pollen and spikelet fertility of the F 1 s and their
parents were analyzed (Table 1). Pollen fertility of the parents
varied from 71% to 93%, with a mean of 84.8%, but variability
in the F 1 with the indica (IR36) tester was 35–91% and 38–
90% in the japonica (T65) tester, with a mean of 71.5% and
62.5%, respectively. Spikelet fertility of the parents varied from
65% to 97%, with a mean of 84.9%. In the F 1 s, it ranged from
41% to 91% in the indica (IR36) tester and from 59% to 96%
in the japonica (T65) tester, with a mean of 63.4% and 83.0%,
respectively.
The variety with low pollen fertility did not necessarily
have low spikelet fertility or vice versa. This meant that pollen
semisterility does not seem to lower the spikelet fertility of F 1
hybrids. These results agreed with those obtained by Ikehashi
and Araki (1984) and Ikehashi and Wan (1998). The variety
with more than 70% spikelet fertility in the F 1 with both testers
was considered to be widely compatible. Of 85 bulu varieties,
21 showed F 1 fertility (>70%) with both testers, which were
considered to be WCV.
Identifying tropical japonicas in rice germplasm
through isozyme analysis
Glaszmann (1986), based on isozyme polymorphism of five
loci (Pgi-1, Pgi-2, Amp-1, Amp-2, and Amp-3), classified 6,532
traditional rice germplasm accessions from the Philippines
(1,624) and Thailand (4,908) into different groups. For the
Philippine germplasm, four groups were identified: 595
(36.6%) in group I (indica), 3 (0.2%) in group V, 1,013
(62.34%) in group VI (japonica), and 13 (0.80%) lines were
intermediate types (O). In the Thai rice germplasm, 4,058
(82.7%) genotypes fell in group I (indica), 2 (0.04%) in group
V, 836 (17.03%) in group VI (japonica), and 12 (0.24%) were
intermediate types. In the two countries, 1,013 and 836 lines,
respectively, were identified as tropical japonicas.
Identifying WC lines based on the Amp-3 marker
To identify the WC lines based on the Amp-3 2 marker, the same
data were used. Of 1,013 tropical japonica lines from the Philippines
and 836 from Thailand, 882 (87%) and 445 (53.22%),
respectively, consisted of allele 2 of Amp-3. Hence, these 1,327
lines could be marked as widely compatible tropical japonicas
and could be used in a new plant type hybrid rice breeding
program.
Tagging the WC gene with isozyme markers
All the bulu varieties were analyzed for Amp-3. All the WCV
showed allele 2, whereas all the non-WCV showed allele 1 of
Amp-3. The F 2 population of WCV Azucena and non-WCV
IR36 consisting of 250 plants was analyzed for isozyme loci
of Amp-3, Est-2, Pgi-2, and Cat-1, which are located on chromosome
6. Cosegregation analysis of WC and isozyme loci in
the F 2 showed the tight linkage of WC with Amp-3 and Est-2
(Tables 2 and 3).
It appeared that allele 2 of Amp-3 was conserved under
WCV of bulu rice of Indonesia, which may show some advantage
of this system for maintaining fertility in natural crosses
involving indica and japonica germplasm.
References
Glaszmann JC. 1986. A varietal classification of Asian cultivated
rice (Oryza sativa L.) based on isozyme polymorphism. In:
Rice genetics I. Manila (Philippines): International Rice Research
Institute. p 83-90.
Ikehashi H, Araki H. 1984. Varietal screening for compatibility types
revealed in F 1 fertility of distant crosses in rice. Jpn. J. Breed.
34:304-313.
Ikehashi H, Wan J. 1998. The wide compatibility system: current
knowledge of its genetics and use for enhanced yield heterosis.
In: Virmani SS, Siddiq EA, Muralidharan K, editors.
Advances in hybrid rice technology. Manila (Philippines):
International Rice Research Institute. p 67-77.
24 Advances in rice genetics

Table 1. Pollen and spikelet fertility of parents and their F 1 s with indica (IR36) and
japonica (T65) testers.
Pollen fertility (%) Spikelet fertility (%)
Variety a Parent F 1 with Allele of F 1 with
Amp-3 Parent
IR36 T65 IR36 T65
tester tester tester tester
Ase Balong Kamandi 87 68 38 1 69 55 86
Abang Busur 73 82 78 1 93 49 92
Ase Bandong 78 80 67 1 97 56 74
Ase Lotang 81 80 73 1 96 61 81
Ase Mandi 80 64 72 1 96 51 80
Azucena 87 81 59 2 95 85 78
Bali Ontjer 88 82 50 1 81 59 72
Banda 84 70 45 2 82 70 83
Beak Balok Loas 91 65 55 1 78 63 73
Benong-130 93 88 85 1 95 61 85
Beton berik 81 58 65 1 93 54 75
Bomalsang 84 85 60 2 86 80 70
Bonjo 73 76 74 1 95 50 80
Bulu Gampolan 85 70 45 1 90 61 82
Buyugaw Daykat 88 75 65 2 91 78 78
Cicih Beronol 79 75 70 1 87 63 91
Cicih Kapuk 85 71 55 1 89 60 68
Dangge 86 71 79 1 91 52 92
Dejawa Serut 83 75 70 1 93 66 76
Dendek Rebiaq 74 64 70 1 81 56 85
Djoro One 79 69 42 1 86 66 66
Gendjah Gampol 87 35 52 2 79 85 78
Gendjah Wangkal 85 68 72 2 82 87 90
Genjah Rante 86 73 68 2 83 81 90
Genjah Urang 80 65 75 1 88 41 95
Goak 88 35 65 2 86 85 83
Gropak 86 76 73 1 83 51 71
Gundil Kuning 92 73 42 1 80 62 79
Hawarah Langgari 89 74 68 1 82 54 73
Huma Pasir-1 84 75 76 2 86 91 86
Jelean 84 72 75 1 94 49 90
Jimbrug 80 85 65 2 85 79 76
Jokodolok 88 73 63 1 89 43 93
K. Rondo Marong 85 61 38 1 96 59 90
Kamandi Pance 88 73 50 1 65 67 60
Kaprit 78 68 40 1 73 62 74
Karang Sarang-55 91 90 71 1 92 55 84
Ketan Apel 84 68 66 1 67 53 92
Ketan Aram 93 89 38 1 85 59 78
Ketan Bandang 81 36 72 1 75 61 87
Ketan Geude 77 60 68 1 93 56 70
Ketan Gubat 91 62 61 1 67 59 92
Ketan Lombok 93 83 32 1 66 63 67
Ketan Lumbu 82 53 42 1 85 64 89
Ketan Menah 90 39 40 1 75 54 94
Ketan Montor 89 75 63 1 86 64 88
Ketan Slawi 84 71 60 1 83 56 90
Ketan Welut 83 71 57 1 87 62 95
Kopo 83 88 52 1 90 67 92
Leci Gogo 83 69 42 2 81 80 85
Lembang 71 68 40 1 77 55 73
Leri 87 65 72 1 81 68 94
Loas Gendjah 88 63 48 2 77 74 83
Manong Tjinde 77 66 62 1 94 56 91
Mauni 80 65 64 1 76 57 90
Menco Manurum 84 78 63 1 80 59 91
continued on next page
Genetics and breeding of agronomic traits 25

Continued from page 25
Pollen fertility (%) Spikelet fertility (%)
Variety a Parent F 1 with Allele of F 1 with
Amp-3 Parent
IR36 T65 IR36 T65
tester tester tester tester
P.B.B. Harum 84 85 65 2 93 83 75
Padi Buring Gogo 81 68 63 1 82 68 79
Pae Umbala 83 55 66 2 85 70 90
Paedai Nadimo 78 73 38 1 92 63 88
Paedai Nodowatu-2 85 83 70 2 88 71 80
Palangan 85 65 74 1 88 54 94
Pare Bogor 88 61 66 2 73 70 77
Pare Minar 88 80 50 1 86 65 59
Gendjah Urang 80 65 75 – 88 41 95
Pasak Jalan 80 74 78 1 77 51 96
Pring 81 84 53 2 92 83 77
Pulut Cenarana 90 73 75 1 95 55 92
Pulut Jawa 74 58 61 1 84 50 96
Pulut Taddaga 86 73 73 1 97 53 87
Pulut Tembahan 88 70 58 1 88 52 92
Putus Tolo 76 77 70 1 88 54 95
R.S. 91 65 54 2 95 84 78
Ribon 92 76 88 1 62 59 81
Rodjolele 80 80 62 1 87 68 83
Sampang Atal 92 78 83 1 94 62 69
Sarimahi 92 91 83 2 90 71 78
Sengkeu 90 58 90 1 81 58 73
Serendeh 91 82 69 1 81 68 71
Sokoni 90 79 45 2 91 70 73
Soponjono 89 86 70 1 84 58 80
Sri Kuning 91 82 62 1 75 60 83
Tulak Bala 92 81 84 1 93 68 74
Tundus 91 68 81 1 72 63 78
Turpan-2 86 68 52 1 94 68 85
Zaitun 86 91 78 2 82 78 78
a Varieties in boldface are WCV with allele 2 of Amp-3.
Table 2. Cosegregation of various isozyme loci on chromosome no. 6.
Parents Amp3- Amp3- Amp3- Est2- Est2- Cat1-
Est2 Cat1 Pgi2 Cat1 Pgi2 Pgi2
IR36 11 22 11 11 11 22 22 11 22 22 11 22
Azucena 22 11 22 22 22 11 11 22 11 11 22 11
F 1 12 12 12 12 12 12 12 12 12 12 12 12
F 2 allelic combination
12 12 148 72 100 75 96 73
22 11 57 13 26 14 3 18
11 22 36 3 24 18 5 14
12 22 1 40 16 39 16 22
22 12 4 31 29 20 10 34
12 11 3 40 37 39 40 27
11 12 1 20 10 28 32 30
22 22 0 17 5 3 24 10
11 11 0 14 3 13 24 22
26 Advances in rice genetics

Table 3. Allelic combination of isozyme loci with WC
gene.
Allelic comb. Plants (no.) WC + WC –
12 151 147 4
22 62 61 1
11 37 1 36
Notes
Authors’ addresses: S.S. Malik, D.S. Brar, and G.S. Khush, International
Rice Research Institute, DAPO Box 7777, Metro Manila,
Philippines; S.S. Malik, current address: Division of Plant
Exploration, NBPGR, Pusa, New Delhi 110012, India.
Effects of cytoplasm and cytoplasm-nucleus interaction
in breeding japonica rice
D. Tao, F. Hu, G. Yang, J. Yang, P. Xu, J. Li, C. Ye, and L. Dai
Long-term breeding practices indicate that some sources of cytoplasm have become more important, but the
reasons for this need to be explained. Thus, five major cytoplasm sources in japonica—Xinan 175, Reimei,
Keqing No. 3, Todorokiwase, and Toride No. 1—that constituted 75% of the cytoplasm of cultivars bred in
Yunnan, China, were used as female parents to hybridize with three distinct japonica rice varieties—8-126,
Lijiangxintuanheigu, and Norinmoti No. 20. Then, seven backcrosses using the male parent as the recurrent
parent were made. Fifteen crosses of BC 7
F 2
and their parents were sown in Jinghong in the late 1999 season
(July-October) for agronomic evaluation. Meanwhile, all materials were screened for low-temperature tolerance
based on two methods in Kunming (1,916 m): natural field conditions and low-temperature water-cycling (19
°C) irrigation at the booting stage. Spikelet fertility was used as an indication of low-temperature tolerance.
Under the fixed model, effects of cytoplasm on yield, width and angle of flag leaf, and low-temperature tolerance
were significant or very significant. Effects of cytoplasm-nucleus interaction on yield, spikelet number panicle –1 ,
plant height, and low-temperature tolerance were significant. This indicated that among materials studied,
genetic differences existed in japonica rice yield, low-temperature tolerance, and important agronomic traits
controlled by cytoplasm and/or cytoplasm-nucleus interaction. The role of cytoplasm-nucleus interaction was
significant for yield, plant height, spikelet number panicle –1 , and spikelet fertility under natural conditions in
Kunming, and for spikelet fertility under low-temperature water-cycling irrigation. The contribution of cytoplasmnucleus
interaction to these traits was 5.7%, 9.1%, 1.4%, 1.1%, and 20.6%, respectively. These results indicated
that cytoplasm-nucleus interaction plays an important role in yield, low-temperature tolerance, and important
agronomic traits in japonica rice. In future rice breeding, the role of cytoplasm and cytoplasm-nucleus
interaction should be given more attention.
Genetic uniformity, or lack of genetic diversity, is of major
concern in plant breeding. Genetic uniformity is now considered
to increase the potential vulnerability of the crop to biotic
and abiotic constraints (Chatel et al 1996).
Xinan 175, Reimei, Keqing 3, Todorokiwase, and Toride
No. 1 are core parents of japonica cultivars developed in
Yunnan (Yang 1992). Ninety percent of the cytoplasm of hybrid
rice was from the wild abortive (WA) type (Lin and Min
1991). The genetic base of the more traditional Brazilian upland
IAC cultivars is made up of six landraces (Chatel et al
1996). The major parents of IRAT upland rice cultivars are
63-83, Moroberekan, and IAC 25 (Hu et al 1997).
Asian cultivated rice has a narrow cytoplasm genetic
base. The cytoplasm of Aizizhan, Nantehao, Shenglixian, and
Cina accounts for 66% of the cytoplasmic sources for 529 indica
cultivars developed from 1950 to 1984 in southern China
(Gu et al 1986). Most of the IR varieties also carry Cina cytoplasm.
Cina is the ultimate maternal parent of 62% of the new
(post-IR8) varieties in Bangladesh, 74% in Indonesia, 60% in
Korea, 75% in Sri Lanka, and 25% in Thailand. More than
half of the rice land in the Philippines was planted to maternal
derivatives of Cina (Hargrove et al 1979). Eight of 11 common
irrigated varieties in Latin America had Cina as the maternal
source (CIAT 1991). The cytoplasmic similarity of modern
varieties, while posing no immediate practical problem,
does not help to break the yield plateau and sustain adaptation
and resistance or tolerance. WA cytoplasm was solely infected
by blast isolate 90-2 (Liu et al 1992). Interaction between the
nucleus and cytoplasm affected the expression of bacterial
blight (Yang 1987). Low-temperature tolerance was reported
to be cytoplasmic-inherited (Ratho and Pradhan 1992). It is
necessary to study the effects of cytoplasm, nucleus, and interaction
between the nucleus and cytoplasm of core parents used
in breeding. To isolate a purely cytoplasmic effect, a long series
of backcrosses to recurrent parents is necessary to develop
nucleus substitution lines in an alien cytoplasm.
Genetics and breeding of agronomic traits 27

Table 1. Variance analysis of yield and agronomic traits (F value).
Model Source Yield a Panicle 1,000-grain Panicle Panicles Spikelets Filled-grains Spikelet
of variation exsertion weight length plant –1 panicle –1 panicle –1 fertility
Random Cytoplasm 1.226 0.789 2.050 0.833 0.381 0.538 0.990 0.692
Nucleus 28.068 ** 82.634 ** 74.784 ** 347.541 ** 37.753 ** 150.798 ** 160.083 ** 49.695 **
Interaction 3.971 ** 1.469 0.808 0.448 1.831 2.164 1.768 1.264
Fixed Cytoplasm 4.867 ** 1.158 1.656 0.374 0.698 1.274 1.751 0.875
Nucleus 111.467 ** 121.368 ** 60.411 ** 155.795 ** 69.127 ** 326.376 ** 283.030 ** 62.820 **
Interaction 3.971 ** 1.469 0.808 0.448 1.831 2.164 1.768 1.264
a ** = significant at the 1% level.
Materials and methods
Five major cytoplasm sources in japonica rice—Xinan 175,
Reimei, Keqing No. 3, Todorokiwase, and Toride No.1—were
used as female parents in crosses with three japonica varieties—8-126,
Lijiangxintuanheigu, and Norinmoti No. 20. Seven
backcrosses were made using the recurrent parent as the male
parent. Fifteen combinations in the BC 7 F 2 and their parents
were sown on 5 July and transplanted on 17 July 1999 in the
Jinghong late season (July-October) for agronomic evaluation,
including yield plot –1 (kg), panicle exsertion (cm), 1,000-grain
weight (g), panicle length (cm), panicle number plant –1 , spikelet
number panicle –1 , filled-grain number panicle –1 , spikelet
fertility (%), plant height (cm), heading (d), length (cm), width
(cm), and angle of flag leaf, and length and width of the second
and third leaf below the flag leaf. The plot size was 1.75 ×
1.6 m 2 , with a spacing of 16 × 25 cm, and with four replications.
All materials were screened for low-temperature tolerance
in Kunming (1,916 m) based on two methods: natural
evaluation and low-temperature (19 °C) water-cycling irrigation
at the booting stage (Dai et al 1999). Spikelet fertility was
used as an indication of low-temperature tolerance. Except for
yield plot –1 and heading time, all data were taken from observations
from 10 individuals plot –1 . Plot averages were used to
make variance analysis. Fixed and random model variance
analyses were used to detect the difference and contribution of
the nucleus, cytoplasm, and interaction between the cytoplasm
and nucleus, respectively. When calculated, the contribution
of phenotypic variance = nucleus variance + cytoplasm variance
+ interaction variance between nucleus and cytoplasm +
environment variance. The contribution of interaction between
cytoplasm and nucleus = interaction variance between nucleus
and cytoplasm/phenotype × 100%.
Results and discussion
Difference of cytoplasm and interaction between
cytoplasm and nucleus
Under the fixed model, effects of cytoplasm on yield, width
and angle of flag leaf, and low-temperature tolerance were significant.
The effects of cytoplasm-nucleus interaction on yield,
plant height, and low-temperature tolerance were significant.
This indicated that among materials studied, genetic differences
existed in japonica rice yield, low-temperature tolerance,
Table 2. Yield difference among different cytoplasm sources.
Cytoplasm Yield (kg plot –1 ) 5% significance 1% significance
Xinan 175 0.58 A A
Todorokiwase 0.55 A AB
Reimei 0.46 B B
Keqing No. 3 0.46 B B
Toride No. 1 0.45 B B
Table 3. Variance analysis of low-temperature tolerance.
Model Source of Kunming natural Low-temperature
variation evaluation a water-cycling irrigation
Random Cytoplasm 1.560 1.000
Nucleus 208.809 ** 17.906 **
Interaction 4.494 ** 28.826 **
Fixed Cytoplasm 7.009 ** 28.826 **
Nucleus 938.460 ** 516.162 **
Interaction 4.494 ** 28.826 **
a ** = significant at the 1% level.
and some important agronomic traits controlled by the cytoplasm
and/or cytoplasm-nucleus interaction (Table 1).
Xinan 175 is the most popular donor of japonica cultivars
in Yunnan, China. The effect of the cytoplasm of Xinan
175 on yield was different from that of Reimei, Keqing No. 3,
and Toride No. 1 (Table 2). There was no significant difference
between Xinan 175 and Todorokiwase.
Genotypes with different cytoplasm had different yield
(data not shown). The effect of the interaction between nucleus
and cytoplasm on yield was evident. Significant differences
existed in angle and width of the flag leaf among the various
sources of cytoplasm. The interaction between the nucleus and
cytoplasm had a significant effect on plant height.
In Jinghong, there was no damage because of low temperature,
and the effects of cytoplasm and the interaction between
the nucleus and cytoplasm on spikelet fertility were not
significant (Table 1). But, in Kunming, under the two methods
of evaluating low-temperature tolerance, the effects of cytoplasm
and the interaction between the nucleus and cytoplasm
on low-temperature tolerance were very significant (Table 3).
Toride No. 1 is a Japanese cultivar with blast resistance,
wherein the effect of cytoplasm on low-temperature tolerance
28 Advances in rice genetics

Table 4. Spikelet fertility difference under Kunming conditions and
low-temperature water cycling.
Spikelet fertility (%) Spikelet fertility (%)
Cytoplasm under natural conditions a under low-temperature
sin –1 √p water cycling
sin –1 √p
Toride No. 1 51.4 a 17.1 a
Xinan 175 44.0 b 5.2 c
Todorokiwase 43.3 b 15.8 a
Reimei 42.1 b 11.1 b
Keqing No. 3 40.7 b 6.2 c
a Numbers followed by a common letter are statistically nonsignificant.
was significantly different from that in others but not in
Todorokiwase under Kunming conditions (Table 4). Low-temperature
water-cycling irrigation is a more appropriate method
for evaluating spikelet fertility, which showed that the cytoplasm
of Toride No. 1 differed significantly from that of Reimei,
Keqing No. 3, and Xinan 175. Meanwhile, the effect of the
interaction between the cytoplasm and nucleus on low-temperature
tolerance was detected, but it was not so common
(Table 5).
Interaction between nucleus and cytoplasm
The role of cytoplasm-nucleus interaction was significant for
yield, plant height, and spikelet fertility under both natural
conditions and low-temperature water-cycling irrigation. The
contribution of cytoplasm-nucleus interaction under low-temperature
water-cycling irrigation was greater than that of natural
low-temperature evaluation because of high sterility under
low-temperature cycling irrigation. These results indicated that
cytoplasm-nucleus interaction plays an important role in yield,
plant height, and low-temperature tolerance.
In future rice breeding and genetic germplasm resources,
the role of cytoplasm should be given attention (Pham 1991).
In breeding for high yield and low-temperature tolerance, if
one important source of cytoplasm for high yield or low-temperature
tolerance could be found, and used as the female parent,
fixed or stable genetic progress would be attained.
The interaction between the cytoplasm and nucleus might
be another way to use and fix hybrid vigor in rice, because
even under the random model, the contributions of cytoplasmnucleus
interaction to yield, plant height, and low temperature
were not high.
References
Chatel M, Guimarães E, Ospina Y, Borrero J. 1996. Improvement of
upland rice using gene pools and populations with recessive
male-sterility gene. In: Piggin C, Courtois B, Schmit V, editors.
Upland rice research in partnership. IRRI Discussion
Paper Series No. 16. Manila (Philippines): International Rice
Research Institute. p 284-298.
CIAT (Centro Internacional de Agricultura Tropical). 1991. Rice
program 1986-1989 report. Working Document No. 92. Cali,
Colombia. 404 p.
Table 5. Interaction difference between nucleus and cytoplasm under
Kunming natural conditions and low-temperature water cycling.
Spikelet fertility (%) Spikelet fertility (%)
Interaction between under natural under lowcytoplasm
and nucleus conditions a temperature
sin –1 √p water cycling
Toride No. 1/ Lijiangxintuanheigu 67.4 a 51.4 a
Reimei/Lijiangxintuanheigu 67.1 a 33.4 b
Todorokiwase/ Lijiangxintuanheigu 66.3 a 47.3 a
Xinan 175/ Lijiangxintuanheigu 65.4 a 0.0 c
Keqing No. 3/ Lijiangxintuanheigu 62.4 a 18.5 c
Toride No. 1/8-126 35.3 b 0.0 d
Xinan 175/8-126 22.5 c 15.6 c
Todorokiwase/8-126 20.2 c 0.0 d
Keqing No. 3/8-126 19.1 c 0.0 d
Reimei/8-126 17.1 c 0.0 d
a Numbers followed by a common letter are statistically nonsignificant.
Dai L, Ye C, Xu F, Zeng Y, Liang B, Wen G. 1999. Genetic analysis
on cold tolerance characteristics of Yunnan rice landrace
(Oryza sativa L.) Kunmingxiaobaigu. Chinese J. Rice Sci.
13(2):73-76.
Gu MH, Pan XB, Li X. 1986. Genetic analysis of the pedigrees of
the improved cultivars in Oryza sativa L. subsp. Hsien in South
China. Sci. Agric. Sin. 1:41-48.
Hargrove TR, Coffman WR, Cabanilla VL. 1979. Genetic interrelationships
of improved rice varieties in Asia. IRRI Research
Paper Series 23. Manila (Philippines): International Rice
Research Institute. 34 p.
Hu F, Tao D, Yang G, Yang J. 1997. Genealogical analysis of IRAT
upland rice varieties. In: Poisson C, Rakotoarisoa J, editors.
Rice cultivation in highland areas. Proceedings of the CIRAD
conference held on 29 March-5 April 1996 at Antananarivo,
Madagascar. p 181-184.
Lin SC, Min SK, editors. 1991. Rice varieties and their genealogy
in China. Shangshai Science and Technology Press. p 8.
Liu KM, Wang LS, Wei JK, Zhu XY, Wu QA. 1992. Reaction of
rice male sterile cytoplasm of wild abortion type to the infection
of Pyricularia oryzae. Sci. Agric. Sin. 25(2):92.
Pham JL.1991. Genetic diversity and intervarietal relationships in
rice (Oryza sativa L.) in Africa. Rice genetics II. Manila (Philippines):
International Rice Research Institute. p 55-65.
Ratho SN, Pradhan SB. 1992. Cytoplasmically controlled cold tolerance
in a cytoplasmic-genetic male sterile line of rice.
Euphytica 58:241-244.
Yang RC. 1987. Susceptibility of A lines and B lines to bacterial
blight (BB). Int. Rice Res. Newsl. 12(6):7.
Yang SX. 1992. Rice in Yunnan. In: Xiong ZM, Cai HF, Min SK, Li
BC, editors. 1992. Rice in China. Beijing (China): China
Agricultural Science and Technology Press. p 421-436.
Notes
Authors’ addresses: D. Tao, F. Hu, G. Yang, J. Yang, P. Xu, and J.
Li, Food Crops Research Institute; C. Ye and L. Dai, Crop
Genetic Germplasm Resources Institute, Yunnan Academy of
Agricultural Sciences, Kunming 650205, China.
Acknowledgment: This research was partly funded by the Foundation
of China Rice Science Development and Yunnan Natural
Science Foundation.
Genetics and breeding of agronomic traits 29

Genetic analysis of hybrid breakdown in a japonica/indica
cross of rice
T. Kubo and A. Yoshimura
Two genes causing hybrid breakdown were identified. Hybrid breakdown, F 2
sterility, and F 2
weakness were
observed in the backcross progeny of a cross between japonica and indica varieties. A set of two genes, hsa1
and hsa2, was responsible for F 2
sterility. The donor parent, IR24, has the recessive sterile alleles hsa1 and the
normal alleles hsa2 + . In contrast, the recurrent parent, Asominori, has the dominant normal alleles hsa1 + and
the sterile alleles hsa2. The hybrid progeny with hsa1hsa1hsa2hsa2 genotype showed high spikelet sterility.
Linkage analysis showed that hsa1 and hsa2 were linked to restriction fragment length polymorphism markers
G148 on chromosome 12 and G104 on chromosome 8, respectively. Similarly, the F 2
weakness was due to a set
of two genes designated as hwe1 and hwe2, which were tightly linked to C443 on chromosome 12 and C955 on
chromosome 1, respectively. The genotype of the double recessive homozygous hwe1hwe1hwe2hwe2 caused
hybrid weakness. IR24 has the recessive alleles of hwe1, whereas Asominori has the recessive alleles of hwe2.
The findings provide a clear evidence of the complementary gene system underlying hybrid breakdown in rice.
Reproductive barriers often arise in varietal crosses of cultivated
rice. Several kinds of reproductive barriers in F 1 hybrids
such as F 1 sterility (Oka 1974) and F 1 weakness (Oka 1957)
have been observed. The genetic basis of these F 1 abnormalities
has been well analyzed. However, little is known regarding
the genetic basis of hybrid breakdown in F 2 or later generations
because of the complex mode of its inheritance.
A series of indica chromosome substitution lines with a
japonica genetic background through repeated backcrossing
and marker-assisted selection was developed in our previous
study (Kubo et al 1999). In the backcrossed progenies, hybrid
breakdown, F 2 sterility, and F 2 weakness were found. We identified
sets of two complementary genes responsible for F 2 sterility
and F 2 weakness and located these genes on the restriction
fragment length polymorphism (RFLP) linkage map.
Materials and methods
To develop chromosome segment substitution lines, recombinant
inbred lines derived from a cross between Asominori
(japonica) and IR24 (indica) (Tsunematsu et al 1996) were
backcrossed with Asominori (Kubo et al 1999). The BC 3 F 2
and BC 3 F 3 populations were used for genetic analysis of hybrid
breakdown. RFLP genotypes of BC 3 F 1 observed in the
previous study were used as reference data. Linkage analyses
were carried out using the BC 3 F 3 populations. The BC 1 F 3 population
derived from the crosses Asominori/IR24//Asominori
was also used for linkage analysis. RFLP analysis was performed
by using the DNA clones on the framework map of
Harushima et al (1998).
Results and discussion
F 2
sterility
We conducted backcrossing to produce chromosome segment
substitution lines of indica rice with japonica background
(Kubo et al 1999). We observed monogenic or digenic segregation
of hybrid sterility in BC 3 F 2 . All BC 3 F 1 plants producing
the sterile segregants commonly possessed an IR24 segment
in a region around RFLP marker G148 on chromosome
12, suggesting the existence of a causal gene at the region of
chromosome 12. Detailed genetic analysis for the hybrid sterility
was done using BC 3 F 3 populations. The selfed progeny
of a fertile BC 3 F 2 plant, 131-22 (see graphical genotype of
BC 3 F 1 131, Fig. 1A), segregated into two fertility classes, fertile
(60–100%) and sterile (5–40%) with a total of 70 and 31
plants, respectively (Fig. 1B). The segregation ratio fitted to
3:1 (χ 2 = 1.75). The sterile plants carried IR24 homozygous
alleles, whereas the fertile plants carried heterozygous or
Asominori homozygous alleles at G148 on chromosome 12.
These results indicated that the hybrid sterility was specifically
F 2 sterility and attributed to a single recessive gene near
G148. The gene was designated as hsa1 and mapped on chromosome
12 (Fig. 2). Indica donor parent IR24 carries the recessive
hsa1 allele and the recurrent parent Asominori carries
the dominant hsa1 + allele.
The BC 3 F 2 plant 15-7 showed partial sterility, even
though it was homozygous for the hsa1 alleles (Fig. 1C). The
self progeny of BC 3 F 2 15-7 exhibited three discrete phenotypic
classes: fertile (85–100%), semi-sterile (45–70%), and
sterile (10–20%) with a total of 54, 39, and 5 plants, respectively
(Fig. 1D). Each phenotype of fertile, semi-sterile, and
sterile corresponded to IR24 homozygous and heterozygous
alleles and Asominori homozygous alleles, respectively, at
G104 on chromosome 8. These results demonstrated that
Asominori alleles at the sterility locus linked to G104 were
complementary to hsa1 recessive alleles from IR24. This gene
for F 2 sterility was designated as hsa2 and located between
G104 and C347 on chromosome 8 (Fig. 2). It was clear that
the hsa1hsa1hsa2hsa2 genotype caused high sterility, as the
parental genotypes were shown by hsa1 + hsa1 + hsa2hsa2 for
Asominori and hsa1hsa1hsa2 + hsa2 + for IR24.
The pollen grains from the sterile plants stained well with
acetocarmine, indicating that they were normal. In addition,
30 Advances in rice genetics

A
1 2 3 4 5 6 7 8 9 10 11 12
C
1 2 3 4 5 6 7 8 9 10 11 12
hsa2
hsa2
hsa2 +
G104
hsa2
G148
hsa1 hsa1 +
hsa1
hsa1
Asominori chromosome
IR24 chromosome
BC 3
F 1
131
Self
BC 3
F 2
131-22
Self
B
Number of plants
25
D
30
25
N = 98
BC 3
F 2
15-7
Self
N = 101
20
20
15
15
10
5
0
0 20 40 60 80 100
10
5
Spikelet fertility (%)
0
0 20 40 60 80 100
Fig. 1. Graphical F 2 genotypes
derived from BC 3 F 1 131 (A) and
F 3 derived from BC 3 F 2 15-7 (C)
and frequency distribution of
spikelet fertility in their progenies
(B, D). = homozygous for
Asominori, = heterozygous,
= homozygous for IR24, at
RFLP markers G148 (B) and G104
(D).
normal seed setting was observed when pollen sterile plants
were used to pollinate Asominori, whereas seed setting was
low when sterile plants were pollinated by Asominori. Therefore,
this F 2 sterility seemed to be female sterility.
In BC 3 F 3 15-7, hsa2 heterozygous plants
(hsa1hsa1hsa2 + hsa2) showed semi-sterility. Furthermore, hsa2
allele was transmitted at low frequency (hsa2 + :hsa2 = 147:49).
It was possible that the hsa2 gene acted gametophytically,
bringing about abortion of gametes carrying the hsa2 allele in
heterozygous plants.
Oka and Doida (1962) and Yokoo (1984) reported similar
F 2 sterility. In their studies, F 2 sterility was assumed to be
due to a complementary gene from both parents. Our results
supported the complementary gene system based on DNA
marker analysis.
F 2
weakness
F 2 weakness was also found in the BC 3 F 2 progeny. Weak plants
were characterized by a small number of tillers, short culm
and panicle, pale green leaf, and complete sterility. The frequency
of weak plants in each segregating population was lower
(2.7–17.4%) than the normal frequency of 25%, except in one
population. Similarly, we attempted to map the causal genes
for F 2 weakness on an RFLP linkage map. We found that F 2
weakness was due to a set of two independent genes, hwe1
and hwe2. The hwe1 was derived from IR24 and closely linked
to C443 on chromosome 12 (Fig. 2). Another recessive gene,
hwe2, was derived from Asominori and closely linked to C955
on chromosome 1 (Fig. 2). The recombinant plants carrying
the double recessive genotype, hwe1hwe1hwe2hwe2, caused
hybrid weakness. The double recessive gene for F 2 weakness
(giving a ratio of 15 normal:1 weak in F 2 ) was newly identified
in this study, though a complementary recessive gene (11
normal:5 weak in F 2 ) has already been reported (Oka 1957,
Fukuoka et al 1998).
The results show two loci responsible for hybrid breakdown
in japonica-indica hybrid progenies.
References
Fukuoka S, Namai H, Okuno K. 1998. RFLP mapping of the genes
controlling hybrid breakdown in rice (Oryza sativa L.). Theor.
Appl. Genet. 97:446-449.
Genetics and breeding of agronomic traits 31

1 8 12
R3192
R1869
18.0
hwe2
CEN
2.1
2.6
G104
hsa2
C347
CEN
2.3
2.4
hwe1
C443
S1436
CEN
C955
7.5
R1709
11.2
R727
6.4
C1211
3.5
hsa1
G148
C1069
Fig. 2. Linkage map showing the location of hybrid breakdown genes in the cross of Asominori and
IR24. RFLP framework maps of chromosomes 1, 8, and 12 (left) are quoted from Harushima et al
(1998). The chromosomes are oriented with the short arm on top. Linkage maps of hsa1 and hsa2
responsible for F 2 sterility and of hwe1 and hwe2 responsible for F 2 weakness are shown on the
right. Map distances are given in centiMorgan (cM). CEN = centromere.
Harushima Y, Yano M, Shomura A, Sato M, Shimano T, Kuboki Y,
Yamamoto T, Lin SY, Antonio BA, Parco A, Kajiya H, Huang
N, Yamamoto K, Nagamura Y, Kurata N, Khush GS, Sasaki
T. 1998. A high-density rice genetic linkage map with 2275
markers using a single F 2 population. Genetics 148:479-494.
Kubo T, Nakamura K, Yoshimura A. 1999. Development of a series
of indica chromosome segment substitution lines in japonica
background of rice. Rice Genet. Newsl. 16:104-106.
Oka HI. 1957. Phylogenetic differentiation of cultivated rice. XV.
Complementary lethal genes in rice. Jpn. J. Genet. 32:83-87.
Oka HI. 1974. Analysis of genes controlling F 1 sterility in rice by
the use of isogenic lines. Genetics 77:521-534.
Oka HI, Doida Y. 1962. Phylogenetic differentiation of cultivated
rice. XX. Analysis of the genetic basis of hybrid breakdown
in rice. Jpn. J. Genet. 37:24-35.
Tsunematsu H, Yoshimura A, Harushima Y, Nagamura Y, Kurata N,
Yano M, Sasaki T, Iwata N. 1996. RFLP framework map using
recombinant inbred lines in rice. Breed. Sci. 46:279-284.
Yokoo M. 1984. Female sterility in an indica-japonica cross of rice.
Jpn. J. Breed. 34:219-227.
Notes
Authors’ address: Plant Breeding Laboratory, Faculty of Agriculture,
Kyushu University, Fukuoka 812-8581, Japan.
Acknowledgment: This study was supported in part by the Biooriented
Technology Research Advancement Institution
(BRAIN), Japan.
32 Advances in rice genetics

Induction and use of japonica rice mutant R917
with broad-spectrum resistance to blast
Mingxian Zhang, Jianlong Xu, Rongting Luo, De Shi, and Zhikang Li
R917, a japonica rice mutant with broad-spectrum resistance to blast, was isolated from an irradiated population.
It was resistant to 136 of 138 isolates collected from different regions in China. The mutant showed a single
dominant gene for resistance to races ZB13, ZC15, and ZE3, and was nonallelic to genes present in Chengte
232 and Xiushui 37. After inoculation with seven Japanese differential strains, R917 showed the same reaction
pattern as Toride 1 and differed from the other differential varieties. An allelism test indicated that the resistance
genes between R917 and Toride 1 were nonallelic to Chinese races ZC15 and ZE3. R917 was a semidwarf with
strong stem, narrow and erect leaf, and monogenic broad-spectrum resistance to blast. Several lines newly bred
using R917 as a donor of blast resistance had the same broad-spectrum resistance to blast as R917 and
desirable agronomic traits, indicating no linkage drag between the resistance gene and other important agronomic
traits. Recently, R917 has been used as a donor in many rice breeding programs in China.
The exploitation of resistance genes with a broad spectrum,
accumulation of multiple genes or polygenes, and a combination
of major genes is considered an effective method against
blast damage. Induced mutation is considered an important
supplement to natural genetic variability. Many kinds of mutations,
including semidwarfism, resistance to diseases and insects,
and early maturity, have been induced by radiation. Many
laboratories in different rice-growing countries have tried to
induce blast resistance by radiation. In general, irradiated materials
had higher resistance than the original (Yamasaki and
Kawai 1968, Marie and Tinarelli 1972), but there are few reports
on a high level and broad spectrum of blast resistance
induced by radiation. In 1993, we began to select blast resistance
mutant R917 in the progeny derived from the F 1 radiated
by 10 krad 60 Co γ-ray of the cross Chengte 232/Xiushui
37. This study was undertaken to select the resistant mutant, to
test its blast resistance spectrum, and to analyze its inheritance
and allelism to the known blast resistance genes.
Materials and methods
We screened the M 2 population and isolated a blast-resistant
mutant. It was grown from M 2 to M 8 and screened for blast
reaction.
A combined identification of nine different regions of
Zhejiang Province was carried out for leaf blast resistance and
panicle blast resistance in 1991 and 1992. To detect the resistance
spectrum, 138 isolates collected from many cultivars in
the Tai-Hu rice region of China were used to inoculate R917
and its parents for leaf blast resistance in 1992.
To analyze the inheritance of resistance to blast, Nonghu
6, a japonica cultivar highly susceptible to blast, was used as a
female in the crosses with the resistant mutant R917 and its
parents Chengte 232 and Xiushui 37 for producing F 1 and F 2
generations. The crosses between R917 and both Chengte 232
and Xiushui 37 were to test their resistance allelism. Three
races, ZB13 (strain 90-3), ZC15 (strain 90-84), and ZE3 (strain
90-86), virulent to Nonghu 6 and not to R917, Chengte 232,
and Xiushui 37, were genetically stable and were used for genetic
analysis of resistance.
To test the allelic relationships between R917 and the
13 known resistance genes, R917 and 13 Japanese differential
varieties were inoculated using seven Japanese differential
strains. In view of the same reaction pattern to the seven differential
strains between R917 and Toride 1, the cross R917/
Toride 1 was made to verify the allelism of their resistance
after inoculating ZE3 (strain 90-86) and ZC15 (strain 90-84),
which are avirulent to them.
All materials for genetic analysis were sowed in trays
and inoculated using the spraying method at the seedling stage.
The disease reaction was scored and evaluated 6–7 days after
inoculation according to the standard evaluation system. Two
groups of resistance (score 1–3) and susceptibility (score 5–
9) were classified in the segregating progeny for genetic analysis.
Results and discussion
A combined identification of nine different regions in Zhejiang
Province indicated that the mean scores of R917 were 2.71
and 2.2 for leaf blast and 0.89 and 1.0 for panicle blast. Inoculating
with multiple isolates showed that R917 was resistant
to 136 of 138 isolates. Furthermore, R917 was resistant to
isolates 91-223, 91-225, 91-267, etc., from different races,
and the opposite was true for Chengte 232 and Xiushui 37.
The results showed that R917 had additional resistance genes
with broad-spectrum resistance different from that of the two
parents.
Three F 1 of Nonghu 6 crossed with R917, Chengte 232,
and Xiushui 37 all showed resistance to ZB13, ZC15, and ZE3
(Table 1), indicating that resistant cultivars had genes with
dominant resistance to the three races. The F 2 population of
Nonghu6/R917 showed a 3:1 ratio, suggesting that R917 had
a dominant gene with resistance to the three races. The F 2
Genetics and breeding of agronomic traits 33

Table 1. Segregation for blast resistance in the progenies of Nonghu 6 crossed with R917 and its two
parents. a No. of resistant and χ 2
Cross Race susceptible plants in F 2 P
3:1 15:1 63:1
Resistant Susceptible
Nonghu 6/R917 ZB13 246 89 0.3592 0.50–0.75
ZC15 256 76 0.6787 0.25–0.50
ZE3 210 63 0.4408 0.50–0.75
Nonghu 6/Chengte 232 ZB13 388 24 0.0647 0.75–0.90
ZC15 308 6 0.0730 0.75–0.90
ZE3 324 5 0.0247 0.75–0.90
Nonghu 6/Xiushui 37 ZB13 310 23 0.1459 0.50–0.75
ZC15 282 17 0.0805 0.75–0.90
ZE3 304 20 0.0033 >0.90
a F 1 in each cross was resistant.
Table 2. Segregation for blast resistance in the progenies of R917 crossed with its two parents. a
No. of resistant and χ 2
Cross Race susceptible plants in F 2 P
15:1 63:1
Resistant Susceptible
R917/Chengte 232 ZB13 377 4 0.3603 0.50–0.75
ZC15 280 1 0.1469 0.50–0.75
ZE3 323 2 0.0420 0.75–0.90
R917/Xiushui 37 ZB13 302 6 0.0988 0.75–0.90
ZC15 307 4 0.0270 0.75–0.90
ZE3 279 7 0.9380 0.25–0.50
a F 1 in each cross was resistant.
population of Nonghu 6/Chengte 232 showed 15:1 and 63:1
ratios of resistance to susceptibility to races ZB13, and ZC15
and ZE3, respectively, indicating the Chengte 232 had two
duplicate genes with dominant resistance to ZB13 and three
duplicate genes with dominant resistance to ZC15 and ZE3.
Resistance segregation in the F 2 of Nonghu6/Xiushui 37 all
had a 15:1 ratio of resistance to susceptibility, suggesting that
Xiushui 37 had two duplicate genes with dominant resistance
to the three races. The F 2 population of R917/Chengte 232
showed resistance segregation with 63:1 and 255:1 ratios to
ZB13, and ZC15 and ZE3, respectively (Table 2), suggesting
that the gene of R917 was nonallelic to those of Chengte 232
to the three races. The F 2 population of R917/Xiushui 37
showed a 63:1 ratio of resistance to susceptibility to the three
races, indicating that the genes between R917 and Xiushui 37
were also nonallelic.
Genotype of resistance can be inferred by the reaction
to seven Japanese differential strains after inoculating Japanese
differential varieties (Kiyosawa 1972). Only the Pizt gene
from Toride 1 is highly resistant to all seven Japanese differential
strains. After inoculation with the seven differential
strains, R917 showed the same reaction pattern as Toride 1
and a difference from the other differential varieties, indicat-
ing that the resistance gene of R917 was different from the
genes of the 12 differential varieties.
However, we found that R917 was different from Toride
1 in its reaction to seven Chinese races. For instance, Chinese
isolates 89125, G9408, G9418, C9419, and C9434 were virulent
to Toride 1 but not to R917, and the opposite was true for
isolates S9407 and C9433. To test the allelism of resistance
genes between R917 and Toride 1, an F 2 population of R917/
Toride 1 was developed. R917, Toride 1, and their F 1 were all
resistant to races ZC15 and ZE3, but the F 2 showed 15:1 segregation,
suggesting that the resistance genes between R917
and Toride 1 were nonallelic.
R917 is a semidwarf japonica mutant with strong stem,
narrow and erect leaf, and monogenic broad-spectrum resistance
to blast. Several new lines such as R9421, R9425, R9427,
R9784, and R9485 were bred from the cross Bing 861/R917.
After inoculation with 18 Chinese and Japanese isolates or
strains, R9425, R9427, and R9484 were resistant to all 18 isolates
or strains and R9421, R9485, and the donor R917 were
resistant to 17 isolates or strains, indicating that it is easy to
transfer the blast resistance gene of R917. Some important agronomic
traits of the newly bred lines are better than those of
R917, indicating that there is no linkage drag between the blast
resistance gene and other important agronomic traits in R917.
34 Advances in rice genetics

References
Kiyosawa S. 1972. Genetics of blast resistance. In: Rice breeding.
Los Baños (Philippines): International Rice Research Institute.
p 203-225.
Marie R, Tinarelli A. 1972. Rice mutants with resistance to blast
disease. Riso 21:21-24.
Yamasaki Y, Kawai T. 1968. Artificial induction of blast-resistant
mutations in rice. In: Rice breeding with induced mutations.
Tech. Rep. Ser. No. 86. Vienna (Austria): International Atomic
Energy Agency. p 17-24.
Notes
Authors’ addresses: Mingxian Zhang, Jianlong Xu, Rongting Luo,
and De Shi, Zhejiang Academy of Agricultural Sciences,
Shiqiao Road 198, Hangzhou 310021, Zhejiang Province,
China; Zhikang Li, Plant Breeding, Genetics, and Biochemistry
Division, IRRI.
Partial resistance to rice blast in the tropics
H. Kato, H. Tsunematsu, L.A. Ebron, M.J.T. Yanoria, D.M. Mercado, and G.S. Khush
Partial resistance to rice blast has not been clearly distinguished from complete resistance in the tropics. At the
International Rice Research Institute (IRRI), several major genes for complete resistance to blast were identified
in IR cultivars. Consequently, suitable blast isolates were selected to eliminate the effect of these major genes
for evaluating partial resistance to blast under field conditions. Seventy-two varieties and lines were inoculated
with three blast isolates for two seasons. Partial resistance was clearly distinguished from complete resistance
and the differences between moderate levels of resistance conferred by major genes and partial resistance were
noted. The level of partial resistance varied in rice varieties: high in IR36, moderate in IR60 and IR36, and low in
IR50 and CO 39. These results were consistent with the results of sequential planting done at IRRI. Partial
resistance levels of several Japanese varieties observed at IRRI were also consistent with evaluation results in
Japan. Significant positive correlations observed among partial resistance to the three isolates indicate that
partial resistance in the tropics is horizontal.
Rice blast is recognized as the most important and potentially
damaging disease of rice. Therefore, developing rice varieties
with durable resistance is the most feasible and environmentfriendly
approach. Complete and partial resistance are known
in rice and other crops. Complete resistance is a resistance identified
as the incompatibility between the host resistance gene
and the avirulence gene of the pathogen. Partial resistance is a
resistance that reduces the extent of pathogen reproduction
within the context of a compatible interaction.
Partial resistance to blast in the tropics is not well understood
for two reasons. First, most of the studies concerning
partial resistance were done in Japan and published in Japanese
language (Naito and Yaegashi 1997). Second, partial resistance
of the variety has to be evaluated under the conditions
where the type and number of complete resistance genes are
known. Until recently, complete resistance genes in tropical
varieties and the reactions of natural or laboratory blast isolates
to the resistance genes (pathogenicity) were not known.
Such information is necessary to eliminate the effect of complete
resistance before partial resistance can be evaluated.
Studies on partial resistance in the tropics
Wang et al (1994) tried to identify partial resistance in the tropics.
They used Moroberekan and CO 39 recombinant inbred
lines. Unfortunately, they could not obtain the virulent blast
isolates against Moroberekan because this variety possesses
many complete resistance genes. Moreover, they used blast
isolate PO6-6 to distinguish between complete resistance
(plants with no disease symptoms) and partial resistance (plants
with small, moderate-type lesions). However, the isolate they
used showed moderate resistant reactions to Pii, Pi3, Piz, Piz-
5, and Pish (Imbe et al in press). These moderately resistant
reactions are synonymous to complete resistance because the
reactions are specific between PO6-6 and genes for complete
resistance. As a result, partial resistance could not be distinguished
from complete resistance.
Recently, the type and number of genes governing complete
resistance to blast were analyzed in IR cultivars under an
IRRI-Japan special collaborative project. The pathogenicity
of Philippine blast isolates against known complete resistance
genes was then identified. By using this information and materials,
we tried to identify the partial resistance of IR varieties
in the tropics. We prepared the plots by surrounding them with
2-m-high plastic fence to prevent the migration of blast spores
from natural populations. The spreader row (first row in the
plot) was inoculated with one blast isolate. Disease intensity
was evaluated using the Standard evaluation system for rice
(SES) and the measurement of leaf area affected. Seventy-two
varieties and lines were inoculated with blast isolates PO6-6,
BN111, and M36-1-3-10-1. The experiment was carried out
in two seasons.
Genetics and breeding of agronomic traits 35

Partial resistance in the tropics
We used the SES data obtained after the 3rd to 6th generations
of fungus after inoculation. Resistance was calculated as the
difference between the scores of each variety and those of the
adjacent susceptible control (IR50). This sorted out partial resistance
from complete resistance. Based on the results of our
experiment, even moderate reactions from complete resistance
genes showed a higher level of resistance than that of partial
resistance. In the tropics, this is the first report to clearly distinguish
partial resistance from complete resistance.
Partial resistance is synonymous with horizontal resistance
(Naito and Yaegashi 1997). In this experiment, correlation
coefficients for partial resistance to different blast isolates
in different seasons were always positive. These results strongly
indicate that partial resistance is also horizontal in the tropics.
There was significant positive correlation between partial resistance
during different seasons and isolates, but there were
large differences among the average score for seasons and isolates.
By using regression equations, we transformed the partial
resistance of BN111, PO6-6 (observed in December), and
M36 to the equivalent of the partial resistance of PO6-6 observed
in February. During a durable blast resistance study in
sequential plantings (IRRI 1994), IR64 was reported to have
lower disease severity in all 15 sequential crop cycles. Moderate
levels of infection on IR36 and IR60 were maintained
throughout the whole cycle of planting. CO 39 and IR50 had
higher disease severity. These results are quite comparable with
the results of this study. Among the 50 varieties and lines evaluated,
IR64 was highly resistant (7th in rank). IR60 and IR36
were moderately resistant (31st and 35th), respectively, for level
of partial resistances. IR50 and CO 39 had the lowest level of
partial resistance (Table 1). Aichi Asahi and US-2 are known
for a very low level of partial resistance in Japan. Yashiromochi
was known to have low and Reiho slightly low partial resistance.
The ranking of Yashiromochi and Reiho is largely comparable
with the results of our study. We conclude that the results
of our study are quite consistent with partial resistance
evaluations done in the past.
In this experiment, a very high blast infection was induced
and most of the susceptible plants died within 1 mo after
inoculation. This could be attributed to shading provided with
nets, irrigation that kept high humidity in the plots, and application
of large amounts of fertilizer.
A breeding strategy for developing rice varieties with durable
resistance to blast
To breed varieties with durable resistance to rice blast, it is
necessary to identify complete and partial levels of resistance
on parents. First, the pathogenicity of isolates should be identified
by using recently bred differential lines that have only
one gene for complete resistance (Tsunematsu et al 2000). Second,
genes for complete resistance in each variety should be
identified using these isolates. Finally, by using the information
about the complete resistance genes of each variety, partial
resistance can be measured. However, it is possible that
unknown blast-avirulent genes may exist in other countries.
Therefore, a study of pathogenicity of blast races and development
of “new” differential lines for each country is necessary.
References
Imbe T, Tsunematsu H, Kato H, Khush GS. n.d. Genetic analysis of
blast resistance in IR varieties and resistant breeding strategy.
In: Proceedings of the 2nd International Rice Blast Conference.
(In press.)
IRRI (International Rice Research Institute). 1994. Durable blast
resistance in sequential plantings. In: Program report for 1993.
Manila (Philippines): International Rice Research Institute.
p 134-136.
Naito H, Yaegashi H. 1997. Rice blast: research and control. Tokyo
(Japan): Nihon Bayer Agrochem.
Tsunematsu H, Yanoria MJT, Ebron LA, Hayashi N, Ando I, Kato H,
Imbe T, Khush GS. 2000. Development of differential lines
with single different gene for blast resistance in rice. Breed.
Sci. 50:229-234.
Wang GL, Mackill DJ, Bonman JM, McCouch SR, Champoux MC,
Nelson RJ. 1994. RFLP mapping of genes conferring complete
and partial resistance to blast in a durably resistant rice
cultivar. Genetics 136:1421-1434.
Notes
Authors’ addresses: H. Kato, H. Tsunematsu, L.A. Ebron, M.J.T.
Yanoria, D.M. Mercado, and G.S. Khush, Plant Breeding,
Genetics, and Biochemistry Division, International Rice Research
Institute, DAPO Box 7777, Metro Manila, Philippines;
H. Kato, current address: Tohoku National Agricultural Experimental
Station, Yotsuya, Omagari, Akita 014-0102, Japan;
H. Tsunematsu, current address: Faculty of Agriculture,
Kyushu University, Fukuoka 812-8581, Japan.
Developing near-isogenic lines for blast resistance
in two genotypes of indica rice, IR24 and IR49830-7-1-2-2
L.A. Ebron, Y. Fukuta, H. Kato, T. Imbe, M.J.T. Yanoria, H. Tsunematsu, D.L. Adorada, and G.S. Khush
36 Advances in rice genetics
Near-isogenic lines (NILs) for blast resistance were developed in two indica rice genotypes, IR24 and IR49830-
7-1-2-2. Eleven major resistance genes have been transferred in each cultivar following the backcross breeding
method. Twelve donor parents and seven Philippine blast isolates were used for the selection of the target genes.
Ten resistance genes, Pii, Pik, Pi1, Pi3, Pi5(t), Pi7(t), Pi9(t), Pita-2, Piz, and Piz-5 are common in both back-

grounds. Piz-t and Pita genes were incorporated into IR49830-7-1-2-2 and IR24, respectively. The NILs of IR24
and IR49830-7-1-2-2 are being used for genetic analysis of blast resistance and developing multilines to
reduce damage caused by blast.
Blast, caused by Pyricularia grisea, is one of the most serious
diseases of rice. Breeding blast-resistant cultivars is a desirable
means for controlling blast. Therefore, information on
the genetic resistance of the host cultivars is required.
Genetic studies on blast resistance have revealed at least
16 major genes at nine loci (Nagato and Yoshimura 1998).
Eight of these genes were identified in Japan. Little information
is available on the number of resistance genes in tropical
rice varieties. The lack of suitable differentials for identifying
genes with resistance to blast isolates may account for this
limitation. A set of near-isogenic lines (NILs) is ideal as differentials
for pathogenicity tests of a pathogen useful in analyzing
the genetic constitution of resistance in a rice cultivar.
In Japan, NILs with japonica-type genetic backgrounds,
Nipponbare, Sasanishiki, and Toyonishiki, have been developed
using many kinds of resistance genes. Mackill et al (1988)
developed four kinds of NILs with an indica-type genetic background,
CO 39, for the tropics. In Japan also, several resistance
genes have been introduced into some genetic backgrounds,
but the number and kinds of genetic background available
for use in the tropics are limited.
We report on the development of new NILs in two indica
rice genotypes, IR24 and IR49830-7-1-2-2.
Materials and methods
Two indica-type cultivars, IR24 and IR49830-7-1-2-2, were
used as genetic backgrounds for NIL development, which began
in 1994. IR24, a cultivar for the irrigated ecosystem, is
estimated to have three resistance genes, Pi20, Pib, and Pik-s.
IR49830-7-1-2-2 is an elite line with a submergence tolerance
gene and is estimated to have Pib and Pik-s genes with resistance
to rice blast (unpublished data).
Twelve donor parents, each having known single genes,
and seven Philippine blast isolates were used for selecting the
target genes (Table 1). Five japonica-type varieties, Kusabue,
Fujisaka 5, Pi No. 4, Fukunishiki, and Toride 1, which are
Japanese differentials, were used as donor parents of resistance
genes. Four indica-type lines—C101LAC, C101PKT,
C104PKT, and C101A51—which are NILs with the indicatype
variety CO 39 genetic background (Mackill et al 1988),
were also used. RIL29 and RIL249 are two recombinant inbred
lines derived from a cross between CO 39 and
Moroberekan (Wang et al 1994). WHD-IS-75-1-127 is an introgression
line developed from Oryza minuta as a donor of
Pi9(t) (Brar and Khush 1997).
Table 1. Near-isogenic lines with IR24 and IR49830-7-1-2-2 genetic background, 1999 dry season,
IRRI.
Designation Resistance Donor Generation Isolate for
gene
selection
IR24 NILs
IRBLi-F5/24 Pii Fujisaka 5 BC 6 F 5 PO6-6
IRBL3-CP4/24 Pi3 C104PKT BC 6 F 5 PO6-6, PO3-82-51
IRBL5-M/24 Pi5(t) RIL249 BC 6 F 5 PO6-6
IRBLk-Ku/24 Pik Kusabue BC 6 F 5 PO6-6
IRBL1-CL/24 Pi1 C101LAC BC 6 F 5 PO6-6
IRBL7-M/24 Pi7(t) RIL29 BC 6 F 5 PO6-6
IRBLta-CP1/24 Pita C101PKT BC 6 F 5 IK81-3
IRBLta2-Pi/24 Pita-2 Pi No. 4 BC 6 F 5 IK81-3
IRBLz5-CA/24 Piz-5 C101A51 BC 6 F 5 PO6-6, IK81-3
IRBLz-Fu/24 Piz Fukunishiki BC 6 F 3 M64-1-3-9-1, IK81-25
BC 6 F 2 PO6-6
IRBL9-W/24 Pi9(t) WHD-IS-75-1-127 BC 6 F 5 PO6-6
IR49830-7-1-2-2 NILs
IRBLi-F5/RL Pii Fujisaka 5 BC 6 F 5 PO6-6, BN111, PO3-82-51
IRBL3-CP4/RL Pi3 C104PKT BC 6 F 4 PO6-6
IRBL5-M/RL Pi5(t) RIL249 BC 6 F 4 PO6-6
IRBLk-Ku/RL Pik Kusabue BC 6 F 5 PO6-6
IRBL1-CL/RL Pi1 C101LAC BC 6 F 3 PO6-6
IRBL7-M/RL Pi7(t) RIL29 BC 6 F 4 PO6-6
IRBLta2-Pi/RL Pita-2 Pi No. 4 BC 6 F 5 JMB8401, BN111
IRBLz-Fu/RL Piz Fukunishiki BC 6 F 5 PO6-6, JMB8401
IRBLz5-CA/RL Piz-5 C101A51 BC 6 F 4 PO6-6, JMB8401
IRBLzt-T/RL Piz-t Toride 1 BC 6 F 5 JMB8401
IRBL9-M/RL Pi9(t) WHD-IS-75-1-127 BC 6 F 4 PO6-6
Genetics and breeding of agronomic traits 37

Recurrent
parent
X
Donor
parent
ence of resistance genes, BC 6 F 3 and BC 6 F 4 lines were inoculated
with representative isolates.
In the evaluation of blast resistance, scoring for disease
was done using a 0–5 scale based on the Standard evaluation
system for rice (IRRI 1998).
BC 6 F 1
BC 3 F 1
Resistant
plants
BC 6 F 2
BC 6 F 3
BC 6 F 4
BC 2 F 1
Resistant
plants
BC 1 F 1
Resistant
plants
F 1
Inoculate and select
resistant plants
Inoculate and select
resistant plants
Inoculate and select
resistant plants
Grow
Grow and check for similarity with
recurrent parent
Inoculate and check similarity with
recurrent parent
Inoculate and check similarity with
recurrent parent
Fig. 1. Scheme for NIL development by the backcross
method.
The backcross progenies were screened for resistance
by inoculating them with an incompatible isolate. Selected
plants were then used in the next backcrossing cycle (Fig. 1).
This procedure was repeated until the sixth backcross. The
BC 6 F 2 progenies were grown and selected based on their morphological
similarity to the recurrent parent. To verify the pres-
Results and discussion
Eleven kinds of major resistance genes were transferred into
each background of IR24 and IR49830-7-1-2-2 following the
backcross breeding method until 1999 (Table 1, Fig. 1). The
designation of each NIL was based on the introduced resistance
gene, donor, and genetic background. For instance,
IRBLi-F5/24 is a NIL with resistance gene Pii from Fujisaka 5
as the donor parent developed in the IR24 background.
Seven of the 11 NILs developed in the background of
IR24 consisted of Pi1, Pi5(t), Pi7(t), Pi9(t), Pita, Pita-2, and
Piz-5; these genes showed a resistant reaction to the incompatible
isolate. The three NILs—IRBLi-F5/24, IRBL3-CP4/
24, and IRBLz-Fu/24—that carry the resistance genes Pii, Pi3,
and Piz, respectively, showed a resistant to moderately resistant
reaction. The NIL IRBLta-CP1/24, with Pita, was developed
in the background of IR24 only.
NILs in the background of IR49830-7-1-2-2 consisted
of 11 lines that had the resistance genes Pii, Pi1, Pi3, Pi5(t),
Pi7(t), Pi9(t), Pik, Pita-2, Piz, Piz-5, and Piz-t.
In the tropics, resistance to blast in rice cultivars is controlled
by several genes (Mackill et al 1985), which made the
identification of genes for blast resistance difficult. Through
allelic tests using these NILs and Japanese differentials, Inukai
et al (1994) identified four resistance genes, Pi1, Pi2(t) (allelic
or closely linked to Piz), Pi3, and Pi4-a(t) (allelic or
closely linked to Pita). Such a set of NILs would be easier to
cross with indica cultivars for use in gene identification. IR24
is a cultivar grown in several tropical Asian regions, whereas
IR49830-7-1-2-2 is an elite line suitable for the rainfed lowland
ecosystem. The IR24 and IR49830-7-1-2-2 NILs will be
good sources of resistance genes because each major gene, in
addition to already existing genes in the host, can be transferred
easily to desired indica backgrounds by backcross breeding.
Each NIL of IR49830-7-1-2-2 and IR24 has at least three
or four genes for blast resistance. The pyramided genes may
provide extra protection from blast to the host when grown in
the field. Single-gene resistance breaks down easily, especially
against a highly variable pathogen such as the blast fungus.
These NILs can be used to confirm the effect of gene
pyramiding on the number of genes and their complementary
effect.
Moreover, these NILs will be useful for developing
multilines to reduce damage caused by blast. When some of
these NILs carrying single genes are combined, the genetic
diversity present in the plant population may help reduce the
amount of inoculum needed for blast development. Field trials
with multilines will be carried out for the first time in the
tropics.
38 Advances in rice genetics

References
Brar DS, Khush GS. 1997. Alien introgression in rice. Plant Mol.
Biol. 35:35-47.
Inukai T, Nelson RJ, Zeigler RS, Sarkarung S, Mackill DJ, Bonman
JM, Takamure I, Kinoshita T. 1994. Allelism of blast resistance
genes in near-isogenic lines of rice. Phytopathology
84:1278-1283.
IRRI (International Rice Research Institute). 1998. Standard evaluation
system for rice. Los Baños (Philippines): International
Rice Research Institute. 52 p.
Mackill DJ, Bonman JM, Suh HS, Srilingam R. 1985. Genes for
resistance to Philippine isolates of the rice blast pathogen.
Rice Genet. Newsl. 2:80-81.
Mackill DJ, Bonman JM, Tenorio PD, Vergel de Dios TI. 1988. Nearisogenic
indica rice lines with blast resistance genes. Rice
Genet. Newsl. 5:98-101.
Nagato Y, Yoshimura A. 1998. Report of the Committee on Gene
Symbolization, Nomenclature and Linkage Groups. Rice
Genet. Newsl. 15:13-74.
Wang GL, Mackill DJ, Bonman JM, McCouch SR, Champoux MC,
Nelson RJ. 1994. RFLP mapping of genes conferring complete
and partial resistance to blast in a durably resistant rice
cultivar. Genetics 136:1421-1434.
Notes
Authors’ addresses: L.A. Ebron, Y. Fukuta, M.J.T. Yanoria, H.
Tsunematsu, D.L. Adorada, G.S. Khush, Plant Breeding, Genetics,
and Biochemistry Division, IRRI, DAPO Box 7777,
Metro Manila, Philippines; H. Kato, Tohoku National Agricultural
Experimental Station, Yotsuya, Omagari, Akita 014-
0102; T. Imbe, Rice Breeding Laboratory, National Agricultural
Research Center, Tsukuba 305-8666, Japan.
Developing near-isogenic lines for rice blast resistance
H. Tsunematsu, M.J.T. Yanoria, L.A. Ebron, N. Hayashi, I. Ando, D.M. Mercado, H. Kato, Y. Fukuta, and T. Imbe
To develop near-isogenic lines (NILs) for genetic and pathological studies of rice blast, we have begun to incorporate
all the known blast resistance genes into the same genetic background using the backcross breeding
method. Varieties and lines with known genes for resistance were used as donors. Lijiangxintuanheigu (LTH)
(japonica, highly susceptible) and CO 39 (indica with Pia, broadly susceptible) were used as recurrent parents.
BC 1
F 1
plants with a single resistance gene were selected with an avirulent isolate and backcrossed. These plants
were inoculated and resistant plants were backcrossed until the BC 6
F 1
. The resistant BC 6
F 1
plants were selfpollinated
and BC 6
F 2
families were obtained. These BC 6
F 2
families were selected for their morphological similarity
to their respective recurrent parent and self-pollinated. BC 6
F 3
lines were inoculated and resistant homozygous
lines were selected. These BC 6
F 3
lines were selected in the field for their similarity to the recurrent parent and for
the uniformity of the morphological traits in each line. Finally, it was confirmed that each line has a single and
homozygous resistance gene in the BC 6
F 4
. To date, we developed 22 NILs for 17 known resistance genes with
the LTH genetic background and 22 NILs for 17 known genes with the CO 39 genetic background. A set of NILs
with the LTH background could be suitable for use as differentials for rice blast. The NILs we developed in indica
and japonica backgrounds would contribute to genetic and pathological studies of rice blast.
Blast is one of the most destructive diseases of rice in both
temperate and tropical regions. Breeding varieties resistant to
blast is the most effective way to control the disease. Information
about resistance genes in rice cultivars and pathogenicities
of blast isolates is important for breeding, genetic, and
pathological studies of rice blast. The use of near-isogenic lines
(NILs) with a single blast resistance gene offers several advantages
for researchers studying rice blast. A set of NILs is
ideal as differentials for pathogenicity tests of a pathogen (Flor
1956). The genetic constitution of resistance genes in a rice
cultivar would be known through allelic tests with NILs. We
tried to incorporate all the known blast resistance genes into
the same genetic background using the backcross breeding
method at the International Rice Research Institute (IRRI).
Selection and confirmation of the existence of Pia, Pik-s, and
Pish in the lines were carried out at the National Agriculture
Research Center (NARC) in Japan through the Japan-IRRI
shuttle research project.
Plant material
To develop two sets of NILs, we applied the backcross breeding
method. Varieties and lines with known genes for resistance
were used as donors. Rice cultivar Lijiangxintuanheigu
(LTH) and CO 39 were used as recurrent parents. LTH, a
japonica variety from Yunnan Province in China, is highly susceptible
to rice blast. No complete resistance gene for rice blast
has been identified in LTH. CO 39 is an indica variety having
Pia and it has shown broadly susceptible reactions to Philippine
blast isolates.
Twenty-one and 19 resistance donors were crossed with
LTH and CO 39, respectively. Each F 1 plant was then backcrossed
to the respective recurrent parent. BC 1 F 1 plants were
inoculated with an avirulent isolate to select the plants with a
single resistance gene at IRRI. Some of the BC 1 F 1 plants were
self-pollinated and the derived BC 1 F 2 families were inoculated
with suitable isolates at both IRRI and NARC. BC 1 F 2 families
Genetics and breeding of agronomic traits 39

with a single resistance gene in the heterozygous condition
were selected. The selected BC 1 F 2 plants were backcrossed to
the respective recurrent parent. BC 1 F 1 plants were inoculated
and resistant plants were backcrossed until the BC 6 F 1 . The
resistant BC 6 F 1 plants were self-pollinated and BC 6 F 2 families
were obtained. These BC 6 F 2 families were selected for
their morphological similarity to the recurrent parent and selfpollinated.
BC 6 F 3 lines were inoculated with an avirulent isolate
and resistant homozygous lines were selected. These BC 6 F 3
lines were observed in the field and selected for their similarity
to the recurrent parent and for uniformity of morphological
traits in each line. Finally, it was confirmed that each line has
a single and homozygous resistance gene in the BC 6 F 4 . All of
the materials with the LTH genetic background were planted
under long-day treatment to extend the growing period because
most of the lines probably carry photosensitivity inherited from
LTH. A 30-min interruption of the dark period was performed
as a long-day treatment from 21 d after seeding (DAS) to 70–
75 DAS.
Inoculation method
A maximum of 20 pregerminated seeds of a line was used.
Inoculation was performed at the 4.0- to 4.9-leaf seedling stage
by using the spraying method (Inukai et al 1994, Hayashi et al
1998). Each seedling was examined 5–7 d after inoculation
using a modified classification based on a 0–5 scale (Mackill
and Bonman 1992). All the isolates of Pyricularia grisea used
at IRRI were either maintained as stock cultures at its Entomology
and Plant Pathology Division or were isolated from
its blast nursery. All the isolates used at NARC were maintained
at the NARC Rice Pathology Laboratory.
Development of the lines
Only one resistance gene was transferred from a donor having
more than one resistance gene. As an example, Aichi Asahi,
one of the Japanese differential varieties, carries two blast resistance
genes, Pia (Yamasaki and Kiyosawa 1966) and Pi19(t)
(Hayashi et al 1998). Aichi Asahi was used as a donor for Pia
with the genetic background of LTH. We have not found any
isolate incompatible to Pi19(t) at IRRI and the existence of
the gene was determined at NARC. Aichi Asahi was crossed
and backcrossed with LTH. The BC 1 F 1 plants were selfed and
the BC 1 F 2 families were inoculated with Ina72 (Av-a and Av-
19+) and CHNOS58-3-1 (Av-a+ and Av-19) at NARC. For
selecting the NIL with Pia, a family that showed segregation
for resistance to Ina72 and a susceptible reaction to CHNOS58-
3-1 was selected. This family was expected to be heterozygous
for Pia but lacked Pi19(t). The same BC 1 F 2 families were
inoculated with B90002 (Av-a and Av-19+) and C923-49 (Ava
and Av-19+) at IRRI. The segregation pattern of Pia in these
lines was identical at both NARC and IRRI. The resistant plants
(regarded as the resistant BC 1 F 1 plants) in the selected BC 1 F 2
family were backcrossed with LTH. Backcross plants were
inoculated with B90002 and resistant plants were backcrossed
Table 1. Near-isogenic lines for blast resistance with LTH background.
NIL Resistance Donor Generation
gene
IRBLa-A/LT Pia Aichi Asahi BC 6 F 5
IRBLa-Ze/LT Pia Zenith BC 6 F 4
IRBLks-S/LT Piks Shin 2 BC 6 F 4
IRBLks-B4/LT Piks B40 BC 6 F 4
IRBLk-Ka/LT Pik Kanto 51 BC 6 F 4
IRBLkp-K60/LT Pikp K60 BC 6 F 4
IRBLkh-K3/LT Pikh K3 BC 6 F 4
IRBLz-Ze/LT Piz Zenith BC 6 F 4
IRBLz5-CA /LT Piz-5 C101A51 BC 6 F 6
IRBLzt-T/LT Piz-t Toride 1 BC 6 F 5
IRBLta-Ta/LT Pita Tadukan BC 6 F 4
IRBLta-K1/LT Pita K1 BC 6 F 4
IRBLta-CP1/LT Pita C101PKT BC 6 F 6
IRBLta-CT2/LT Pita C105TTP2L9 BC 6 F 6
IRBLb-B/LT Pib BL1 BC 6 F 4
IRBLsh-Fu/LT Pish Fukunishiki BC 6 F 5
IRBL1-CL/LT Pi1 C101LAC BC 6 F 6
IRBL3-CP4/LT Pi3 C104PKT BC 6 F 6
IRBL5-M/LT Pi5(t) RIL249 a BC 6 F 6
IRBL7-M/LT Pi7(t) RIL29 a BC 6 F 6
IRBL9-W/LT Pi9(t) WHD-1S-75-1-127 BC 6 F 6
IRBL11-Zh/LT Pi11(t) Zhaiyeqing 8 BC 6 F 4
a Recombinant inbred lines from a cross of CO 39 and Moroberekan.
Source: Wang et al (1994).
with LTH. This procedure was repeated until BC 6 F 1 . The resistant
BC 6 F 1 plants were self-pollinated and the BC 6 F 2 families
were obtained.
These BC 6 F 2 families were selected for their morphological
similarity to LTH and self-pollinated. The BC 6 F 3 lines
were inoculated with B90002. The lines that were homozygous-resistant
to the isolate were selected. Thus, these selected
lines were homozygous-resistant to Pia but did not carry
Pi19(t). The morphological traits of the selected BC 6 F 3 lines
were observed and selected for their similarity to LTH and for
uniformity in each line. The selected BC 6 F 3 lines were selfpollinated.
The BC 6 F 4 lines were inoculated with B90002, and
it was confirmed that each line has Pia in the homozygous
condition.
To develop other lines, selection with suitable isolates
and backcrossing procedures were carried out in the same way
as for Aichi Asahi. For the NILs with the genetic background
of LTH, a total of 22 NILs with 17 resistance genes were developed
from the 21 resistance donors (Table 1). For NILs
with the genetic background of CO 39, a total of 22 NILs with
17 resistance genes were developed from the 19 resistance
donors. These NILs were designated as IRBL, followed by
the resistance gene and an abbreviation for the resistance donor
with the genetic background. For example, IRBLa-A/LT
is the NIL with Pia developed from Aichi Asahi with the LTH
genetic background. NILs with only the major resistance genes
were developed and genes conferring partial resistance were
not considered in this study.
40 Advances in rice genetics

The NILs we developed would contribute to genetic and
pathological studies of rice blast. A set of NILs with the LTH
background could be used as differential varieties for rice blast.
Two sets of NILs would be appropriate for the genetic studies
and breeding of blast-resistant japonica and indica varieties.
Development of the NILs with the remaining resistance genes
is under way.
Wang GL, Mackill DJ, Bonman JM, McCouch SR, Champoux MC,
Nelson RJ. 1994. RFLP mapping of genes conferring complete
and partial resistance to blast in a durably resistant rice
cultivar. Genetics 136:1421-1434.
Yamasaki Y, Kiyosawa S. 1966. Studies on inheritance of resistance
of rice varieties to blast. 1. Inheritance of resistance of Japanese
varieties to several strains of the fungus. Bull. Natl. Inst.
Agric. Sci. D14:39-69. (In Japanese with English summary.)
References
Flor HH. 1956 The complementary genetic systems in flax and flax
rust. Adv. Genet. 8:29-54.
Hayashi N, Ando I, Imbe T. 1998. Identification of a new resistance
gene to a Chinese blast fungus isolate in the Japanese rice
cultivar Aichi Asahi. Phytopathology 88:822-827.
Inukai T, Nelson RJ, Zeigler RS, Sarkarung S, Mackill DJ, Bonman
JM, Takamure I, Kinoshita T. 1994. Allelism of blast resistance
genes in near-isogenic lines of rice. Phytopathology
84:1278-1283.
Mackill DJ, Bonman JM. 1992. Inheritance of blast resistance in
near-isogenic lines of rice. Phytopathology 82:746-749.
Notes
Authors’ addresses: H. Tsunematsu, Plant Breeding Laboratory,
Kyushu University, Fukuoka 812-8581, Japan; M.J.T. Yanoria,
L.A. Ebron, D.M. Mercado, and Y. Fukuta, Plant Breeding,
Genetics, and Biochemistry Division, International Rice Research
Institute, DAPO Box 7777, Metro Manila, Philippines;
N. Hayashi, Aichi-ken Agricultural Research Center, Aichi
441-2513, Japan; I. Ando, HNAES, Hokkaido 062-8555, Japan;
H. Kato, TNAES, Akita 014-0102, Japan; T. Imbe,
NARC, Tsukuba 305-8666, Japan.
Improving field resistance to blast and eating quality
in Japanese rice varieties
Y. Uehara
Eating quality of grains is the most important character in Japanese rice cropping because of consumer needs
and producers’ rice price. Disease and insect resistance is also an important character because of environmental
protection and health care. Blast resistance, especially field resistance, is a major objective of rice breeding
in Japan. One of the best-tasting varieties, Koshihikari, is the leading variety in Japan, cropped on 539,000 ha
in 1999 (it occupied 34.6% of the rice-cropping area in Japan). But as Koshihikari lodges easily and is sensitive
to blast disease, breeding of new superior-tasting varieties with resistance to blast and tolerance of lodging is
required. So far, we released a superior-tasting variety, Kinuhikari, in 1989, which had tolerance of lodging. This
variety originated from IR8 and a short-culm mutation line of Kinuhikari, Doktokoi, was released in 1995 by
improving Kinuhikari, and a new superior-tasting variety will be released soon. Using Kinuhikari as a parent, its
progeny lines with a short culm were tolerant of lodging; thus, many good-tasting varieties, such as Dontokoi,
Yumetukushi, Yumehitachi, Awaminori, and so on, were selected from its progeny. As Dontokoi is resistant to
blast and tolerant of lodging, has a high yielding ability, and tolerates sprouting compared with Kinuhikari, it
should be possible to release the succeeding variety of Koshihikari early by using Dontokoi as a parent.
Eating quality of grains is the most important character in Japanese
rice. Blast resistance, especially field resistance, is a major
objective of rice breeding in Japan. One of the best-tasting
varieties, Koshihikari, is the leading variety in Japan, occupying
34.6% of the rice-cropping area in the country. Koshihikari,
however, is susceptible to blast and also to lodging; thus, breeding
for new superior-tasting varieties with resistance to blast
and tolerance for lodging is necessary. We released a superior-tasting
variety, Kinuhikari (Koga et al 1989), with tolerance
for lodging, and with a short culm, originating from IR8
and its improved short-culm mutant line, Dontokoi (Uehara et
al 1995). A new superior-tasting variety was released in 2000
by improving Dontokoi. Currently, few varieties have superior
taste, resistance to blast, and tolerance for lodging.
Materials and methods
Japanese varieties Toyonishiki (TN), Koganenishiki (KN),
Yoneshiro (YS), Hownenwase (HW), Sasanishiki (SN),
Inabawase (IW), Koshihikari (KHI), and Koshihomare (KHO)
were used as parents. These were different from leaf-blastresistant
varieties; TN and KN are resistant, YS is moderately
resistant, HW and SN are moderately susceptible, and KHI
and KHO are susceptible. These varieties were used in diallel
Genetics and breeding of agronomic traits 41

Table 1. Disease rating index for evaluating varietal field resistance to leaf blast
in rice.
Disease rate Disease reaction Lesion area (%)
(index)
0 No sensitive lesion 0
1 A few sensitive lesions 1
2 Apparently sensitive lesions 2
3 Much more sensitive lesions 5
4 Many sensitive lesions 10
5 Many sensitive lesions or a few dead seedlings 20
6 Apparently dead seedlings 40
7 About 50% of seedlings dead 60
8 Many seedlings dead 80
9 Almost all seedlings dead 90
10 All seedlings dead 100
crosses, F 3 lines were tested for leaf blast resistance in the
upland nursery, disease rate was studied (Table 1), and broadsense
heritability was evaluated. This testing method in the
upland nursery (upland late sowing or ULS method) is commonly
used for evaluating field resistance to blast of varieties
and lines in Japan sown later, and is used when conditions are
favorable since blast occurs during the rainy season.
IW was crossed with TN, KN, YS, HW, SN, KHI, and
KHO and F 3 progenies from these crosses were sown in the
upland nursery. One crossing occupied a 3-m 2 area planted to
100 g (about 4,000–4,300 grains) of seeds. Survival from blast
infection in the upland nursery was determined by counting
the number of heading plants, sterile plants (caused by panicle
blast or cool damage), and immature plants (caused by late
heading).
The F 4 bulk population of IW/YS was sown in a 1.5-m 2
area in the upland nursery (mass selection plot) and flooded
nursery (control), respectively, to examine in the advanced
generation the effects of mass selection on field resistance of
blast in early generations. In these nurseries, one ripening
panicle was picked from surviving plants. Panicles of F 5 lines
were selected randomly and 400 and about 500 panicle-row
lines were planted in the mass selection plot and in the control
nursery, respectively. F 6 lines—221 lines in the mass selection
plot and 423 lines in the control—were tested for leaf blast
resistance by the ULS method.
F 3 progenies of KHI/Shu 3810 were sown on a 1.5-m 2
area in a flooded nursery established in a blast location. The
F 4 progenies were planted as a single-plant selection and were
selected by stand observation and by grain quality. F 5 progenies
were planted to evaluate cultivated characteristics and
eating quality by single pedigree, and were evaluated for field
resistance to blast with parental and check varieties by the ULS
method.
In addition, 609 F 5 progenies of 14 crosses with Dontokoi
as a parent were planted to evaluate eating quality by single
pedigree and field resistance to blast.
Results and discussion
Heritability of field resistance to blast in the F 3
The genotype for rice blast of TN and SN is Pia, and that of
YS, IW, and KHO is Pii. KN, HW, and KHI do not possess
any resistance genes for blast. Since pathogenic fungi (code:
007) for blast disease in the test nursery could injure all test
varieties, the disease rate of parental varieties was used to reflect
their field resistance to rice blast. The mean disease rate
of F 3 progenies indicated middle values, but these were lower
than the mean among parents in many crosses and lower than
that of resistant parents in some crosses (Table 2).
Broad-sense heritabilities in diallel crosses for leaf blast
ranged from 0.107 to 0.840 and were high. In cases where
differences in blast resistance between parents were small, such
as in crosses between resistant and moderately resistant varieties,
and between susceptible and moderately susceptible varieties,
broad-sense heritabilities were comparatively low.
Broad-sense heritabilities in some crosses were also low in
crosses where KHI was used as a parent (Table 2).
Mass selection for field resistance to blast in early
generations
Surviving plants in the upland nursery were grown until maturity.
Since it was hot and there was less rainfall after the rainy
season in Japan, the development of blast lesions stopped. Test
materials survived because of proper water management. About
20–50% of the F 3 progenies of IW (susceptible to blast) and
seven varieties with various resistance levels survived and
achieved heading from late August to early September. Some
panicles were injured by panicle blast and the cold, and did
not mature until the cutting deadline (end of October).
Crosses among susceptible varieties KHI/IW and KHO/
IW are 20.3% and 20.8% of seeds sown individually, whereas
crosses using resistant varieties TN/IW and KN/IW are 41.1%
and 40.4% of seeds sown individually. Sterility because of
panicle blast was observed in 6–11% of the F 3 progenies; sterility
because of cool temperature and immaturity was rarely
found except in KN (late-maturing variety) used as a parent.
42 Advances in rice genetics

Table 2. Disease rate (index) in upland nursery and heritability in F 3 lines.
Cross a
Number of test
Mean of disease rate
Heritability b
F 3 P 1 P 2 F 3 P 1 P 2 (h B2 )
KN/TY 200 16 16 4.51 4.56 4.94 0.264
TN/YS 200 16 16 4.73 4.38 5.50 0.107
TN/HW 100 10 10 3.96 4.10 4.68 0.168
TN/SN 200 16 16 5.15 3.81 5.63 0.424
TN/IW 200 16 16 4.73 4.00 7.06 0.579
KHI/TN 90 9 9 5.15 6.93 4.18 0.543
KHO/TN 120 10 10 5.07 6.30 4.03 0.585
KN/YS 200 16 16 4.11 4.31 4.50 0.264
KN/HW 100 10 10 4.83 5.03 5.55 0.136
KN/SN 100 10 10 4.81 4.80 5.87 0.548
KN/IW 99 10 10 5.00 4.45 6.15 0.784
KN/KHI 100 10 10 5.03 4.43 7.27 0.193
KN/KHO 101 10 10 5.40 3.93 7.14 0.617
HW/YS 99 10 10 3.86 4.85 3.85 0.309
SN/YS 120 10 10 6.23 6.27 5.34 0.840
IW/YS 200 12 12 4.81 7.00 3.42 0.522
KHI/YS 100 10 10 5.01 8.17 3.87 0.136
KHO/YS 120 12 12 5.08 6.58 4.50 0.314
SN/HW 100 10 10 4.18 5.28 4.30 0.158
IW/HW 100 10 10 5.23 6.33 4.83 0.579
KHI/HW 100 10 10 6.08 7.93 5.27 0.481
KHO/HW 120 12 12 5.90 6.92 4.69 0.433
SN/IW 200 12 12 5.76 5.42 6.83 0.207
KHI/SN 200 16 16 6.71 7.06 6.31 0.175
KHO/SN 120 12 12 6.82 7.06 5.36 0.469
KHI/IW 200 16 16 6.40 6.81 7.25 0.148
KHO/IW 120 12 12 6.40 6.58 6.00 0.666
KHI/KHO 120 12 12 6.82 7.06 5.36 0.469
a TN = Toyonishiki, KN = Koganenishiki, YS = Yoneshiro, HW = Hownenwase, SN = Sasanishiki, IW =
Inabawase, KHI = Koshihikari, KHO = Koshihomare. b h B
2
= (V F3 – (V P1 + V P2 )/2) × V F3 .
Selection rates in ripening plants ranged from 13% to 40%
(Table 3).
One of seven crosses, IW/YS, was also selected by the
same method (mass selection in the early generation by the
ULS method) in the F 4 progenies. Almost no difference was
observed between mass selection plots and control plots for
F 5 lines for culm length, panicle length, panicle number, grain
quality, and other characters. Since ripening seeds by mass
selection could not produce enough seeds for the blast-resistance
test, F 6 lines were tested by the ULS method. Many lines
resistant and moderately resistant to blast in the mass selection
plots were observed (Fig. 1). About 25.3% of the F 6 lines
in the mass selection plots and 9.9% of the F 6 lines in the control
were selected individually.
Effects of blast resistance and eating quality in
advanced generation by mass selection
For mass selection, a flooded nursery was established in a blastendemic
location for easier water management and to produce
enough seeds for the next generation. In the flooded nursery,
disease rates of F 3 progenies of KHI/Shu 3810, KHI (P 1 ), Shu
3810 (P 2 ), Todorokiwase (check, resistant), HW (check, moderate),
and Akinishiki (check, susceptible) were 6, 8, 3, 2, 6,
and 8, respectively. Ripening plants were selected for the next
single-plant selection. The selection rate for F 3 progenies of
KHI/Shu 3810 was estimated to be 20.1%; 228 g of F 4 seeds
were obtained from the 1.5-m 2 flooded nursery. This amount
of F 4 seeds was enough for single-plant selection and 3,300
plants of the F 4 progenies were planted for single-plant selection;
169 plants were selected by stand observation (selection
rate: 5.1%). Of these, 105 plants were selected for grain quality
(selection rate: 3.2%).
Many lines had long culms and the early heading time of
KHI in the F 5 progenies. Twenty-one lines, based on stand
observation and eating quality, were selected for short culm,
lodging, degree of fixation, and other traits. Disease rates
showed that many selected lines are resistant or moderately
resistant in the field. The eating quality of selected F 5 lines
showed that many selected lines had very good taste (similar
to that of KHI) or good taste (similar to that of Shu 3810).
Thus, many lines with resistance to blast also had very good
taste.
No new variety or Hokuriku Number Line was selected
in advanced lines of Koshihikari/Shu 3810 because of lodging,
yielding ability, grain size, and other traits, in spite of the
short culm, resistance to blast, good appearance and quality,
and good taste.
Genetics and breeding of agronomic traits 43

Table 3. Selection rate of mass selection for field resistance to rice
blast in the upland nursery in the F 3 population.
Sterile plants (%)
Cross a Heading Immature Selection
plants Panicle Cool plants rate b
(%) blast damage (%) (%)
TN/IW 41.1 10.7 0.0 0.2 30.0
KN/IW 40.4 10.3 8.9 8.2 13.0
IW/YS 36.2 8.7 0.0 0.0 27.5
IW/HW 49.4 8.4 0.0 0.4 40.5
IW/SN 28.0 11.8 0.0 0.0 16.2
KHI/IW 20.3 6.1 0.0 0.4 13.8
KHO/IW 20.8 6.5 0.0 0.5 13.8
a TN = Toyonishiki, KN = Koganenishiki, YS = Yoneshiro, HW = Hownenwase, SN =
Sasanishiki, IW = Inabawase, KHI = Koshihikari, KHO = Koshihomare. b Selection
rate (%) = ripening plants/sowing seeds.
Frequency (%)
Inferior Eating qualityGood
2.0
1.5
1.0
0.5
0.0
Dontokoi
Koshihikari
Hitomebore
3 4 5 6 7
Disease rate of
Resistant
leaf blast
Sensitive
Figure 2. Disease rate of leaf blast and eating quality for selected
F 5 lines of several crosses using Dontokoi as a parent. = F 5 line,
= parental and check variety.
40
30
20
Yoneshiro
Mass selection plot
Inabawase
Control
Dontokoi as a parent were resistant to blast and were very good
tasting (Fig. 2). Hokuriku 189 and Hokuriku 190 were released
from these crosses in 2000, and a new variety, Itadaki, was
released from another cross using Dontokoi as a parent.
Breeding of these varieties should increase efficiency in
two steps. First, progenies of crosses are selected for blast resistance
in an earlier generation. Second, progenies of crosses
are selected for eating quality in an earlier generation, and many
samples are tested at one time. The selection of the parent is
very important in breeding.
10
0
1 2 3 4 5 6 7 8 9 10
Disease rate of leaf blast
Figure 1. Frequency of disease rate in mass selection plot
(F 6 lines of Inabawase/Yoneshiro). F 4 population underwent
mass selection for field resistance to rice blast in the upland
nursery.
= mean and variance of parental
varieties.
Eating quality and blast resistance of a single
pedigree using new variety Dontokoi as a parent
Dontokoi was crossed to further improve eating quality and
resistance to blast. Sixty-five lines from these crosses were
selected by stand observation (selection rate was 10.7%) and
tested for eating quality. Many lines in these crosses using
References
Koga K, Uchiyamada H, Samoto S, Ishizaka S, Fujita Y, Okuno K,
Uehara Y, Nakagahra M, Horiuchi H, Miura K, Maruyama K,
Yamada T, Yagi T, Mori K. 1989. Breeding a new rice cultivar,
Kinuhikara. Bull. Hokuriku Natl. Agric. Exp. Stn. 30:1-
24.
Uehara Y, Kobayashi A, Koga K, Uchiyamada H, Miura K, Fukui
K, Shimizu H, Ohta H, Fujita Y, Okuno K, Ishizaka S, Horiuchi
H, Nakagahra M. 1995. Breeding a new rice cultivar, Dontokoi.
Bull. Hokuriku Natl. Agric. Exp. Stn. 37:107-131.
Notes
Authors’ address: Hokuriku National Agricultural Experiment Station,
Inada 1-2-1, Joetsu, Niigata 943-0193, Japan.
44 Advances in rice genetics

Inheritance of resistance to bacterial blight in rice
D. Sharma
A highly virulent and prevalent pathotype, B-1, of Xanthomonas oryzae. pv. oryzae in the Balaghat rice region of
Madhya Pradesh, India, has been identified. A set of 140 accessions was screened against B-1 pathotype. The
inheritance of resistance to this pathotype in 19 genotypes in the F 1
, F 2
, and F 3
generations was studied. The
resistance was governed by dominant genes in 14 genotypes, while two genotypes had one recessive gene and
the other genotypes had two complementary dominant genes.
Bacterial blight (BB), caused by Xanthomonas oryzae pv.
oryzae (Ishiyama) Dye (Xoo), is one of the most important
diseases of rice. The success of a resistance breeding program
lies in the identification of resistant donors specific to the prevalent
pathogenic race(s) and their genetic analyses to identify
different resistance genes. A highly virulent and prevalent
pathotype of Xoo in the Balaghat rice region of Madhya Pradesh
has been identified and designated as B-1 (Kumar et al 1999).
We report the results on the genetic analysis of resistance to
BB for the virulent B-1 pathotype.
Materials and methods
From the large collection of indigenous germplasm material
of Indira Gandhi Agricultural University, Raipur (IGAU), 140
accessions found to be resistant in a previous screening to a
mixed inoculum were screened against pathotype B-1 (Kumar
et al 1999). Nineteen genotypes resistant to pathotype B-1 were
crossed with the susceptible variety Taichung Native-1 (TN-
1) to obtain F 1 , F 2 , and F 3 generations. Seven parents with a
single dominant resistance gene were crossed with each other
to determine the allelic relationship. Four-meter-long single
rows of the F 1 s, 15 rows of F 2 s, and one row each of all F 2
progenies were planted simultaneously under field conditions.
The procedure used by Kumar et al (1994) was followed to
prepare inoculum. Artificial inoculation was made using the
method of Kauffman et al (1973). The IRRI (1988) Standard
evaluation system for rice was followed to measure disease
reaction. Data were processed using a standard statistical procedure.
Results and discussion
Out of 140 rice accessions found to be resistant to a mixed
inoculum in an earlier study (Anonymous 1993), 42 were found
to be resistant, 75 moderately resistant, 20 moderately susceptible,
and 3 susceptible to pathotype B-1. This showed that the
mixed inoculum used in the past screening did not contain
pathotype B-1. These results also indicate that accessions found
to be resistant to the Xoo races are represented in the mixed
inoculum and that they also had additional gene(s) with resistance
to pathotype B-1.
The inheritance of resistance to pathotype B-1 of Xoo in
19 resistant genotypes was studied in the F 1 , F 2 , and F 3 generations
resulting from the hybridization with TN-1, the susceptible
parent (Table 1). Results showed that resistance was
controlled by a single dominant gene in 14 genotypes, including
Kotaki, Ramjira, Chhatri, Kubri Mohar, Assamchudi
(A:680), Jhilli, Cross-116, Nirguni, Bogachudi, Pandri,
Kanthichudi, Noni, Badshah Bhog, and Assamchudi (A:707);
by a single recessive gene in Khushipari Deshi and Kanakchudi;
and by two complementary dominant genes in the parents
Nagpuri Gurmatia and Chind Mori. However, two complementary
dominant genes were found to control susceptibility in
the cross involving one resistant parent, Kanak.
Tests for allelism were carried out only in seven parents
that possessed a dominant gene for resistance. Results (data
not given) showed that Chhatri, Pandri, and Jhilli possessed
different dominant genes for resistance. Jhilli, Bogachudi,
Cross-116, Badshah Bhog, and Assamchudi (A:707) had the
same dominant resistance gene.
Conclusions
The resistance to pathotype B-1 in rice genotypes was found
to be simply inherited. The presence of different dominant
genes for resistance in seven parents analyzed, coupled with
varied genetic control of resistance in the other 12 resistant
parents, indicated the presence of considerable genetic diversity
for resistance. These materials constitute valuable resources
of genetic resistance to bacterial blight.
References
Anonymous. 1993. Annual report. Department of Plant Pathology.
Raipur (India): Indira Gandhi Agricultural University. p 1-
16.
IRRI (International Rice Research Institute). 1988. Standard evaluation
system for rice testing programme (IRTP), rice manual.
3rd ed. Manila (Philippines): IRRI. p 19.
Kauffman HE, Reddy APK, Hsieh SPY, Merca SD. 1973. An improved
technique for evaluating resistance of rice varieties to
Xanthomonas oryzae. Plant Dis. Rep. 57(6):537-541.
Kumar SM, Singh HS, Sharma D. 1999. Survey of disease and pathogenic
reaction of Xanthomonas oryzae pv. oryzae in Balaghat
region of M.P., India. Ann. Plant Prot. Sci. 7(1):91-119.
Genetics and breeding of agronomic traits 45

Table 1. Inheritance of resistance to bacterial leaf blight in 19 rice genotypes. a
Reaction F 2 plant (no.) P value of F 3 families
Cross of F 1 x 2 P value x 2 P value
R S Total R:S R Seg. S Total R:S
Single dominant gene for resistance
TN1/Kotaki (K:1039) R 435 130 565 3:1 1.194 0.25–0.10 30 55 25 110 1:2:1 0.45 0.90–0.75
TN1/Ramjira (R:397) R 220 66 286 3:1 0.564 0.50–0.25 23 50 27 100 1:2:1 0.32 0.90–0.75
TN1/Chhatri (C:802) R 382 116 498 3:1 0.773 0.50–0.25 6 53 27 106 1:2:1 0.02 >0.99
TN1/Kubri Mohar (K:1292) R 196 54 250 3:1 1.541 0.25–0.10 25 51 28 104 1:2:1 0.21 0.90–0.75
TN1/Assamchudi (A:680) R 405 119 524 3:1 1.465 0.25–0.10 28 54 26 108 1:2:1 0.07 0.99–0.95
TN1/Jhilli (J:126) R 430 128 558 3:1 1.264 0.25–0.10 25 56 30 111 1:2:1 0.45 0.90–0.75
TN1/Cross-116 (C:615) R 398 114 512 3:1 2.040 0.25–0.10 21 44 26 91 1:2:1 0.65 0.75–0.50
TN1/Nirguni (N:548) R 335 98 433 3:1 1.002 0.50–0.25 24 51 25 100 1:2:1 0.60 0.99–0.95
TN1/Bogachudi (B:1345) R 440 129 569 3:1 1.645 0.25–0.10 26 54 22 102 1:2:1 0.67 0.75–0.50
TN1/Pandri (P:409) R 450 135 585 3:1 1.153 0.25–0.10 27 58 26 111 1:2:1 0.24 0.90–0.75
TN1/Kanthichudi (K:197) R 350 103 453 3:1 1.236 0.50–0.25 20 45 28 93 1:2:1 1.36 0.75–0.50
TN1/Noni (N:717) R 401 124 525 3:1 0.533 0.50–0.25 21 52 23 96 1:2:1 0.75 0.75–0.50
TN1/Badshah Bhog (B:214) R 297 105 402 3:1 0.268 0.75–0.50 24 44 28 96 1:2:1 1.00 0.75–0.50
TN1/Assamchudi (A:707) R 258 88 346 3:1 0.034 0.90–0.75 29 48 30 107 1:2:1 1.15 0.50–0.25
Detection of recessive resistance genes
TN1/Khushipari Deshi S 102 294 396 1:3 0.121 0.75–0.50 24 53 27 104 1:2:1 0.21 0.90–0.75
(K:100-I)
TN1/Kanakchudi (K:49) S 98 338 436 1:3 1.480 0.25–0.10 23 52 25 100 1:2:1 0.24 0.90–0.75
Detection of two complementary dominant genes
TN1/Nagpuri Gurmatia R 262 226 448 9:7 1.300 0.50–0.25 10 60 40 110 1:8:7 2.80 0.25–0.10
(N:473)
TN1/Chind Mori (C:159) R 265 225 490 9:7 0.936 0.50–0.25 9 60 40 109 1:8:7 2.50 0.50–0.25
Detection of two complementary dominant genes controlling susceptibility
TN1/Kanak (K:1381) S 206 306 512 7:9 2.571 0.25–0.10 45 66 10 121 7:8:1 2.48 0.50–0.25
a R = resistant, S = susceptible, Seg. = segregating.
Notes
Author’s address: Department of Plant Breeding and Genetics, Indira
Gandhi Agricultural University, Raipur, Madhya Pradesh, India.
Genetic analysis of resistance to bacterial blight in rice
K.-S. Lee and G.S. Khush
The mode of inheritance and allelic relationships of the genes for resistance to bacterial blight, caused by
Xanthomonas oryzae pv. oryzae, for 12 cultivars of rice was studied. The results showed that four cultivars have
at least two recessive genes and one dominant gene for resistance. Seven cultivars have two recessive genes
and one cultivar has one recessive and one dominant gene for resistance. The reaction of F 1
and F 2
populations
from the crosses of 11 cultivars with xa5 revealed that all cultivars are allelic to xa5, while resistance in Sada
diga is inherited independently of xa5. The additional dominant gene for resistance to race 1 in four cultivars with
xa7 is under investigation. Similarly, the recessive genes for resistance to race 6 in 11 cultivars are nonallelic to
xa13. The dominant gene for resistance to race 6 in Sada diga is inherited independently of xa13.
Bacterial blight (BB) caused by Xanthomonas oryzae pv.
oryzae (Xoo), which prevails mainly in the rice-growing countries
of Asia, has also been reported to occur in Australia, the
United States, Latin America, and Africa. Grain yield losses
from bacterial blight in tropical and subtropical countries range
from 10% to 60% depending on variety, severity of infection,
season, and time of infection, but can reach 80% in highly
susceptible varieties.
46 Advances in rice genetics

Table 1. Reaction to race 1 of F 1 and F 2 populations from the crosses of the resistant
cultivars with TN1.
Reaction to race 1 of Xoo
F 1
Cross plants a F 2 population
Resistant Susceptible Ratio X 2 P-value
TN1/ARC 10376 S 68 166 1:3 2.057 0.10–0.25
TN1/Kali Haitya S 225 65 13:3 2.555 0.10–0.25
TN1/Kala Manik MR 193 62 13:3 0.985 0.25–0.50
TN1/AC10-38 S 57 162 1:3 0.123 0.50–0.75
TN1/Bazail 197 S 74 197 1:3 0.769 0.25–0.50
TN1/Kalimekri 391 S 81 218 1:3 0.697 0.25–0.50
TN1/ARC 10313 MR 242 64 13:3 0.942 0.25–0.50
TN1/Raital S 67 175 1:3 0.931 0.25–0.50
TN1/Aus 355 MR 206 56 13:3 1.184 0.25–0.50
TN1/Laksmijota S 77 200 1:3 1.156 0.25–0.50
TN1/Aswina S 87 231 1:3 0.943 0.25–0.50
TN1/Sada diga S 120 341 1:3 0.261 0.50–0.75
a R = resistant, MR = moderately resistant, S = susceptible.
The genetics of resistance to BB has been extensively
investigated. Twenty-four major genes for BB resistance have
been identified (Lin et al 1996, Zhang et al 1998, Khush and
Angeles 1999). Several of these genes have already been incorporated
into improved rice varieties that are now widely
grown in many rice-growing countries. However, new races of
the pathogen continue to evolve that can overcome the resistance
conveyed by major genes (Mew 1989). This study was
conducted to analyze and identify the genes for resistance to
bacterial blight.
Materials and methods
Twelve rice cultivars originating from India and Bangladesh
that were previously reported to be resistant to one or more
Philippine races of Xoo were used. Varieties with resistance to
six races of BB were classified to belong to a distinct group
(Ogawa et al 1991). Two races of Xoo, race 1 (PXO61) and
race 6 (PXO99), were employed in genetic analysis. Test varieties
were crossed to a susceptible variety, TN1. They were
also crossed to BB-resistant near-isogenic lines, IRBB5 and
IRBB13, for allele tests. IRBB5 has xa5, which confers resistance
to races 1, 2, 3, and 5 and a moderate level of resistance
to race 4. IRBB13 has xa13, which confers resistance to race
6. The F 1 and F 2 progenies from the crosses of the test varieties
with TN1 and two testers were evaluated for Xoo reaction
by the inoculation method developed by Kauffman et al (1974).
Results
Table 1 lists the bacterial blight reactions to race 1 of 12 F 1
and F 2 populations from the crosses of cultivars with TN1. F 1
hybrids of four cultivars showed a dominant reaction and the
F 2 populations of those hybrids segregated into 13 resistant to
3 susceptible. These results indicate that a single dominant
gene and a recessive gene govern resistance to race 1 in these
cultivars. F 1 hybrids of eight cultivars showed a susceptible
reaction and F 2 populations of those hybrids segregated into 1
resistant to 3 susceptible. These results indicate that a single
recessive gene governs resistance to race 1 in these cultivars.
Table 2 shows the bacterial blight reaction to race 6 in
12 F 1 and F 2 populations from the crosses of cultivars with
TN1. F 1 hybrids of 11 cultivars showed a susceptible reaction
and the F 2 populations of those hybrids segregated into 1 resistant
to 3 susceptible, indicating that those cultivars have a
single recessive gene governing resistance to race 6. The F 1
hybrid of Sada diga showed a dominant reaction and the F 2
population segregated into 3 resistant to 1 susceptible, indicating
that Sada diga has a single dominant gene governing resistance
to race 6 of Xoo.
The reactions to race 1 of F 1 hybrids and F 2 populations
from the crosses of 12 cultivars with a near-isogenic line of
IRBB5 were recorded. The F 1 hybrids from the crosses of
IRBB5 carrying xa5 with 11 cultivars were found to be resistant
and the F 2 populations of these crosses did not segregate
for susceptibility. These results indicate that the single recessive
gene governing resistance to race 1 in these cultivars is
allelic to xa5. The F 1 hybrid of Sada diga was susceptible and
the F 2 population segregated into 7 resistant to 9 susceptible,
indicating that a single recessive gene governing resistance to
race 1 in Sada diga is different from and segregated independently
of xa5.
Table 3 shows the reactions to race 6 of F 1 hybrids and
F 2 populations from the crosses of 12 cultivars with IRBB13
carrying xa13. The F 1 hybrids of 11 cultivars were susceptible
and the F 2 populations segregated into 7 resistant to 9 susceptible.
These results show that a single recessive gene governing
resistance to race 6 in 11 cultivars is nonallelic to xa13.
The F 1 hybrid of Sada diga was resistant and the F 2 population
segregated into 13 resistant to 3 susceptible, indicating that a
Genetics and breeding of agronomic traits 47

Table 2. Reaction to race 6 of F 1 and F 2 populations from the crosses of the resistant
cultivars with TN1.
Reaction to race 1 of Xoo
F 1
Cross plants a F 2 population
Resistant Susceptible Ratio X 2 P-value
TN1/ARC 10376 S 70 164 1:3 3.015 0.05–0.10
TN1/Kali Haitya MR 67 223 1:3 0.556 0.25–0.50
TN1/Kala Manik S 72 173 1:3 2.526 0.10–0.25
TN1/AC10-38 S 59 185 1:3 0.617 0.25–0.50
TN1/Bazail 197 S 80 191 1:3 2.953 0.05–0.10
TN1/Kalimekri 391 S 80 218 1:3 0.696 0.25–0.50
TN1/ARC 10313 MS 75 213 1:3 0.039 0.75–0.90
TN1/Raital S 64 177 1:3 0.446 0.50–0.75
TN1/Aus 355 MS 72 190 1:3 0.855 0.25–0.50
TN1/Laksmijota S 67 218 1:3 0.613 0.25–0.50
TN1/Aswina S 72 247 1:3 1.004 0.25–0.50
TN1/Sada diga R 332 94 1:3 2.133 0.10–0.25
a R = resistant, MR = moderately resistant, MS = moderately susceptible, S = susceptible.
Table 3. Reaction to race 6 of F 1 and F 2 populations from the crosses of the
resistant cultivars with IRBB13 (xa13).
Reaction to race 1 of Xoo
F 1
Cross plants a F 2 population
Resistant Susceptible Ratio X 2 P-value
IRBB13/ARC 10376 S 150 181 7:9 0.331 0.50–0.75
IRBB13/Kali Haitya S 191 232 7:9 0.339 0.50–0.75
IRBB13/Kala Manik S 153 187 7:9 0.215 0.50–0.75
IRBB13/AC10-38 S 176 216 7:9 0.210 0.50–0.75
IRBB13/Bazail 197 S 156 206 7:9 0.063 0.75–0.90
IRBB13/Kalimekri 391 S 151 204 7:9 0.213 0.50–0.75
IRBB13/ARC 10313 S 165 244 7:9 1.930 0.10–0.25
IRBB13/Raital S 126 174 7:9 0.373 0.50–0.75
IRBB13Aus 355 S 120 171 7:9 0.747 0.25–0.50
IRBB13/Laksmijota S 155 213 7:9 0.397 0.50–0.75
IRBB13/Aswina S 168 183 7:9 2.413 0.10–0.25
IRBB13/Sada diga R 285 54 13:3 1.769 0.10–0.25
a R = resistant, S = susceptible.
single dominant gene governing resistance to race 6 in Sada
diga is different from and inherited independently of xa13.
Discussion
Genetic analysis showed that four cultivars out of 12 investigated
had two recessive genes and one dominant gene governing
resistance. Two of these genes confer resistance to race 1
as a dominant and a recessive gene, and the other recessive
gene confers resistance to race 6. Seven cultivars carried two
recessive genes for resistance. These genes confer resistance
to races 1 and 6. Cultivar Sada diga has a recessive gene that
conveys resistance to race 1 and a dominant gene that conveys
resistance to race 6.
Allele tests showed that the recessive genes for resistance
to race 1 in 11 cultivars are allelic to xa5. The recessive
gene for resistance to race 1 in Sada diga is nonallelic to xa5.
The allelic relationships of this gene with xa8, another recessive
gene for resistance to race 1, are under investigation. The
dominant gene for resistance to race 1 in four cultivars with
xa7 is also under investigation.
The recessive genes for resistance to race 6 in 11 cultivars
are nonallelic to xa13. The allelic relationships of the recessive
genes for resistance to race 6 in 11 cultivars with xa24(t)
(Khush and Angeles 1999) need to be investigated. The dominant
gene for resistance to race 6 in Sada diga is inherited
independently of xa13. This variety needs to be tested with
Xa21. We hope that the dominant gene in Sada diga will not
be nonallelic to Xa21 and thus confer resistance to race 6.
48 Advances in rice genetics

References
Kauffman HE, Reddy APK, Hsieh SPY, Merca SD. 1974. An improved
technique for evaluating resistance of rice varieties to
Xanthomonas oryzae. Plant Dis. Rep. 57:537-541.
Khush GS, Angeles ER. 1999. A new gene for resistance to race 6 of
bacterial blight in rice, Oryza sativa L. Rice Genet. Newsl.
16:92-93.
Lin XH, Zhang DP, Xie YF, Gao HP, Zhang Q. 1996. Identifying
and mapping a new gene for bacterial blight resistance in rice
based on RFLP markers. Phytopathology 86:1156-1159.
Mew TW. 1989. An overview of the world bacterial blight situation.
In: Bacterial blight of rice. Los Baños (Philippines): International
Rice Research Institue. p 742.
Ogawa T, Busto GA, Tabien RE, Romero GO, Endo N, Khush GS.
1991. Grouping of rice cultivars based on reaction pattern to
Philippine races of bacterial blight pathogen (Xanthomonas
campestris pv. oryzae). Jpn. J. Breed. 41:109-119.
Zhang I, Lin SC, Zhao BY, Wang CL, Yang WC, Zhou YL, Li DY,
Chen CB, Zhu LH. 1998. Identification and tagging of a new
gene for resistance to bacterial blight (Xanthomonas oryzae
pv. oryzae) from O. rufipogon. Rice Genet. Newsl. 15:138-
142.
Notes
Authors’ addresses: K.-S. Lee, Kyehwa Substation, National Honam
Agricultural Experiment Station, RDA, 579-820, Buan,
Cheonbuk, Korea; G.S. Khush, International Rice Research
Institute, Los Baños, Philippines.
Breeding bacterial blight–resistant rice cultivars
at the Philippine Rice Research Institute
R.E. Tabien and L.S. Sebastian
At PhilRice, known genes for bacterial blight (BB) resistance are being incorporated into elite lines and varieties.
Both conventional and molecular marker-assisted procedures are being used to facilitate the development of a
new rice variety with BB resistance. For a single major gene, classical backcrossing is currently under way while,
for gene combinations, marker-assisted selection is being practiced. Elite lines from both methods having a
single gene, such as xa5 or Xa21, and a combination of xa5 and Xa21 have been developed and were entered
in various yield trials. Yields were comparable with those of the recipient parent, but several lines were highyielding.
Lines developed through marker-aided and classical backcrossing and selection have retained morphological
features of the recurrent parent. To pyramid several genes, crosses between and among promising lines
have been made to combine the three genes. Donors for tungro and blast resistance will be used later to
increase the spectrum of resistance of the lines. The elite lines are currently being evaluated in farmers’ fields in
a hot-spot area for BB in the country.
Bacterial blight (BB) is one of the major diseases of rice in the
Philippines. It can cause yield losses of 20–30% in severely
affected fields (Ou 1985) and losses could reach 50–80% in
some cases. Eight genes have been found effective against BB
races in the Philippines (Endo et al 1992). Most of the rice
varieties in the Philippines having genes for BB resistance are
effective against only a few races of the pathogen. The Xa4
and/or xa5 gene are not effective against the predominant and
virulent races in the country. New genes can be identified and
used to minimize loss from the disease. These genes can be
deployed in time and by location, thus avoiding or lessening
the shift in population structure. Another way to delay resistance
breakdown is gene stacking, as genes can be combined.
Several reported genes have been mapped and close linkage
with DNA markers has been reported. Such markers can be
used in backcross breeding and gene pyramiding.
Reaction of PSB Rc (Philippine Seed Board rice)
varieties to nine races of BB
Twenty-three PSB Rc varieties, IR24 (susceptible check), and
IRBB 21 (resistant check) were evaluated for resistance to nine
races of BB. Seeds were sown in small plots inside the greenhouse
and the seedlings were kept for 30 days before and after
inoculation. At inoculation, seedlings in rows were equally
divided into nine sections, one for each race. The clipping
method following Kauffman et al (1973) was used at inoculation
time. Inoculum was prepared from Xanthomonas oryzae
pv. oryzae (Xoo) kept for 48 h and suspended at 10 7 –10 8 cells
mL –1 . Evaluation was done 30 d after inoculation. Most of the
Rc varieties were susceptible to races PXO86 and PXO79,
but most had an intermediate to resistant reaction to PXO99,
the most virulent race of BB. Only PSB Rc82 had a reaction
similar to that of IRBB 21, the isoline with the Xa21 gene.
Some varieties had a differential reaction relative to known
genes and thus could be new genes. Table 1 shows the reaction
of the 23 PSB Rc varieties to nine races of BB. Based on these
Genetics and breeding of agronomic traits 49

Table 1. Reaction of PSB Rc rice varieties to nine races of bacterial blight (BB).
Reaction to BB isolates
PXO PXO PXO PXO PXO PXO PXO PXO PXO
61 86 79 71 112 99 145 280 87
IR24 b 47 26 34 37 21 26 20 5 –
IRBB 21 c 5 5 3 5 6 6 5 6 6
PSB Rc2 5 26 19 9 5 9 4 11 15
PSB Rc4 10 20 20 12 8 4 3 14 12
PSB Rc6 19 22 25 23 21 14 18 19 17
PSB Rc8 21 22 27 19 11 19 11 17 17
PSB Rc10 12 19 19 21 22 22 19 16 21
PSB Rc18 10 20 19 15 6 7 7 12 14
PSB Rc20 6 8 20 14 10 10 12 12 6
PSB Rc22 7 11 12 12 7 11 18 18 10
PSB Rc28 11 25 24 15 25 19 18 14 19
PSB Rc30 17 33 28 17 9 11 8 9 9
PSB Rc32 11 28 21 14 9 9 12 11 13
PSB Rc34 5 25 21 9 4 7 9 10 8
PSB Rc52 6 27 15 9 4 10 8 6 11
PSB Rc54 6 25 17 15 12 10 12 13 8
PSB Rc56 11 22 14 9 8 14 7 8 9
PSB Rc58 8 9 13 15 5 6 11 4 8
PSB Rc64 4 11 15 8 5 5 4 6 10
PSB Rc66 6 14 15 6 6 5 6 6 7
PSB Rc72H 19 28 24 21 7 13 4 4 14
PSB Rc74 27 30 20 29 11 25 24 29 18
PSB Rc78 8 18 18 6 5 5 4 5 7
PSB Rc80 3 15 19 9 6 7 5 6 8
PSB Rc82 5 6 8 14 5 5 4 7 5
a Average of 3 uppermost leaves 10 plants –1 (lesion in cm). b Susceptible check. c Resistant check.
reactions, crosses with IR24 were produced and some F 2 populations
were developed.
Transfer of the Xa21 gene to popular rice varieties and elite
lines
Some of the most popular rice varieties in the Philippines have
no resistance gene for BB. A new gene such as Xa21 was not
available during their development; thus, these varieties can
be improved by incorporating a new trait or gene. IRBB 21,
the donor of Xa21, was crossed to C4-63G, IR64, and BPI Ri-
10, elite and popular varieties in the country. The materials
were advanced through the F 2 -derived method. Elite lines from
the four crosses were evaluated in replicated trials for four
seasons in a 6-row plot with 11 hills. Seedlings were transplanted
21 days after sowing using 20 × 20 cm plant spacing.
Based on phenotypic acceptability, several lines were
kept from the crosses. During the dry season of 1998, 14 lines
yielded at least 10 t ha –1 . Most of the high-yielding lines originated
from IR64. Across four seasons, lines in crosses involving
C4-63G had the highest average yield but most of the elite
lines were obtained from IR64 crosses (Table 2). C4-63G has
been a popular parent in the crossing program but plant breeders
had difficulty in producing elite lines (H. de la Cruz, personal
communication). The same observation was noted from
this cross. Most of the lines were at the lower rank among the
136 lines evaluated. IR64 is a good donor for it produced the
most elite lines with high yield and good grain quality. Some
elite lines are now in selected farmers’ fields.
Marker-aided backcrossing and selection
A single gene can easily be transferred to a recipient but a
combination of genes effective against a common race cannot
be identified using classical inoculation. Through a series of
backcrossing and DNA marker-aided selection, xa5 and Xa21
were transferred to BPI Ri-10, IR64, and PSB Rc14. Markers
associated with these genes were used to identify desired plants
and the selected genotypes were evaluated using 10 RAPD
primers. Lines with a genotype close to the recurrent parent
and with the two genes were advanced and evaluated in yield
trials.
In the yield trial conducted during the 2000 dry season,
two lines with IR64 background were advanced to the general
yield test (Table 3). These lines yielded 6.3 and 5.8 t ha –1 .
From these crosses, BPI Ri-10-derived lines had the most desirable
phenotype and grain quality. Although 17 loci from 10
RAPD primers were used to select plants close to the recurrent
parent, most of the progenies were similar to the parent. The
markers used were effective in selecting lines with pyramided
genes. These lines are now being evaluated in farmers’ fields
like those with a single gene.
50 Advances in rice genetics

Table 2. Yield and some agronomic traits of six promising lines developed by
the classical transfer method of a single gene for bacterial blight resistance.
Parents Line Yield Days to Height Kernel
(kg ha –1 ) maturity (cm) quality
C4-63G/IRBB 21 LI-4-221 7,024 121 117 Good
IR64/IRBB 21 LI-62-241 6,919 123 108 Fair
IRBB5/Rc4//TI 11-8 LI-5-16 6,847 122 116 Good
IR64/IRBB 21 LI-62-260 6,845 116 111 Good
IRBB21/IR64//TI 11-8 LI-21-271 6,802 115 101 Fair
IR64/IRBB 21 LI-62-266 6,758 121 124 Fair
Table 3. Yield performance of marker-aided derived lines for bacterial blight resistance
in the preliminary yield trial.
Parents Line Yield Days to Height Kernel
(kg ha –1 ) maturity (cm) quality
IR64//IRBB5-21/PSB Rc14 AR32-19-3-2 a 5,690 92 115 Excellent
IR64//IRBB5-21/PSB Rc14 AR32-19-3-3 a 5,824 86 115 Good
BPI Ri10/IRBB5-21 AR32-4-5-3 4,852 75 111 Excellent
BPI Ri10/IRBB5-21 AR32-4-58-2 5,445 75 109 Fair
IR64//IRBB5-21/PSB Rc14 AR32-19-3-4 a 6,341 89 113 Good
Check IR72 5,775 84 119
a Elevated to the general yield trial.
Lines with pyramided BB genes will be crossed with the
BB resistance gene introgressed from Oryza minuta in the same
genetic background to combine the three genes. Progenies of
these crosses will be crossed with donors having blast and
tungro resistance genes to combine genes for multiple pathogens.
References
Endo N, Ogawa T, Khush GS. 1992. Genetic analysis of Myanmar
rice cultivars for resistance to bacterial blight. Jpn. J. Breed.
42:341-352.
Kauffman H, Reddy APK, Hsieh SPY, Merca SD. 1973. An improved
technique for evaluating resistance of rice varieties to
Xanthomonas oryzae. Plant Dis. Rep. 57:537-541.
Ou SH. 1985. Rice diseases (revised edition). Kew, Surrey (England):
Commonwealth Mycological Institute. p 61-68.
Notes
Authors’ address: Plant Breeding and Biotechnology Division, Philippine
Rice Research Institute, Maligaya, Muñoz 3119, Nueva
Ecija, Philippines.
Acknowledgments: The authors wish to thank the Asian Rice Biotechnology
Network (ARBN) for funding the gene pyramiding
study, and M. Abalos, J. Casayuran, D. Tabanao, M. Padilla,
and Y. Dimaano for their assistance in conducting the above
studies.
Inheritance and allelic relationships of rice gall
midge resistance genes in some new donors
Arvind Kumar, M.N. Shrivastava, R.K. Sahu, B.C. Shukla, and S.K. Shrivastava
The Asian rice gall midge, Orseolia oryzae Wood Mason (Diptera: Cecidomyiidae), is a major pest of rice in
several South and Southeast Asian countries. The maggots feed internally on the growing tips of the tillers and
transform them into tubular, onion-like structures called “silvershoots,” resulting in severe yield loss to the rice
crop. We studied the mode of inheritance and allelic relationships of resistance against gall midge in four
resistant donors—Abhaya, ARC 5984, RP2068-18-3-5, and RP2333-156-8. The segregation behavior of F 1
,
F 2
, and F 3
confirmed the presence of a single dominant gene for resistance in Abhaya, ARC 5984, and RP2333-
156-8 and a single recessive gene for resistance in RP2068-18-3-5. Allelic relationship studies with known
genes for resistance (Gm1, Gm2) and among themselves confirmed the presence of nonallelic genes for resis-
Genetics and breeding of agronomic traits 51

tance in Abhaya, ARC 5984, RP2068-18-3-5, and RP2333-156-8. The recessive gall midge resistance gene
present in donor RP2068-18-3-5 could be designated as gm3. The dominant genes for gall midge resistance
present in donors Abhaya, ARC 5984, and RP2333-156-8 can be designated as Gm4, Gm5, and Gm7, respectively.
The Asian rice gall midge, Orseolia oryzae Wood Mason
(Diptera: Cecidomyiidae), is a major pest of rice in several
South and Southeast Asian countries, causing up to 100% yield
losses under severe infestation (Tan et al 1993). The maggots
feed internally on the growing tips of the tillers and transform
them into tubular, onion-like structures called “silvershoots.”
Changes in the biotypic population have enabled this insect to
overcome host resistance. Systematic studies at Indira Gandhi
Agricultural University in Raipur have led to the identification
of two independent genes for gall midge resistance, Gm1
and Gm2, present in cultivars Samridhi and Surekha, respectively
(Chaudhary et al 1986). In this paper, we report on the
identification of three independent new genes for gall midge
resistance.
Materials and methods
Crosses were made between cultivars differing in gall midge
resistance (Tables 1 and 2). Screening was done under natural
conditions at the research farm of IGAU, Raipur, which is
known to be a hot spot for gall midge occurrence. The test
populations were flanked on both sides by purple-color highly
susceptible line R 2270. Artificial light was provided at night
from 1900 to 400 to attract midge adults to settle and oviposit
on test plants. Fields were heavily fertilized with 150 kg N and
80 kg P 2 O 5 ha –1 .
F 1 plants of each cross were grown in single rows. F 2
populations were grown family-wise (as the product of a single
F 1 plant) in paired rows spaced 20 cm apart. From each F 2
population, seed of 110 randomly selected plants was harvested
to be advanced to F 3 . In the F 3 , each of the 110 lines was sown
as a single line with 100 plants in each line. Observations were
recorded when susceptible parents developed 100% infestation
on a per plant basis. The presence of a single silvershoot
was taken as an index of susceptibility. The X 2 test was used
to derive appropriate conclusions.
Results and discussion
Natural infestation of gall midge in wet seasons was very high.
Cultivars Abhaya, ARC5984, RP2068-18-3-5, Samridhi, Asha,
Ruchi, R302-111, Phalguna, and IET 6286 were found to be
resistant, whereas Duokang I, Tulsi, Cheptigurmatia, Ratna,
Shyamla, Kranti, Annada, and R2270 were susceptible to gall
midge. All F 1 populations involving Abhaya as one parent were
found to be resistant (Table 1). The F 2 populations with parents
possessing Gm1 (Samridhi, Ruchi, and R 302-111) and
Gm2 (Phalguna) genes gave a 15R:1S ratio. Abhaya was thus
found to possess one dominant gene. The F 3 progenies of
Abhaya with susceptible parents segregated into a 1:2:1 ratio
(Table 2). Similarly, progenies involving Abhaya with resistant
parents could be classified into a 7:8:1 ratio as true resistance,
segregating, and breeding, respectively. The additional
data on Abhaya crosses with ARC 5984 further confirmed the
independent and dominant nature of the gene. This gene was
therefore designated as Gm4.
ARC 5984 gave a 3:1 ratio in the F 2 in crosses with Kranti
and Shyamla (Table 1) and 15:1 with parents possessing Gm1
(Samridhi), Gm2 (Phalguna), and Gm4(t) (Abhaya) (Table 1).
The gene present in ARC 5984 therefore appears to be a new
gene. ARC 5984, which in earlier studies (Sahu et al 1990)
was found to possess a recessive gene (designated as gm3)
now instead appears to have a dominant gene. This discrepancy
appears to be due to the source of seed material used in
two studies. The F 2 population obtained from crosses of ARC
5984 with RP 2068-18-3-5 segregated in a 13:3 ratio. The F 2
population obtained from crossing RP 2068-18-3-5 with RP
2068-18-3-5 (previously labeled as ARC 5984) did not show
any segregation (Table 2). Based on these data, the resistance
gene present in ARC 5984 was designated as Gm5 (Kumar et
al 1998). Since the gene of ARC 5984 has proved to be dominant
and independent of all other hitherto known genes, it can
be designated as Gm5.
The F 1 population of RP 2068-18-3-5 with susceptible
parent Annada showed a susceptible reaction, indicating the
presence of a recessive gene. The F 2 confirmed that a single
recessive gene governs resistance in RP 2068-18-3-5 (Table
2). The crosses involving RP 2068-18-3-5 and parents possessing
dominant genes for resistance—Gm1 (Samridhi, Asha,
Ruchi), Gm2 (Phalguna, IET 6286) (Chaudhary et al 1986),
and Gm4(t) (Abhaya) (Shrivastava et al 1993)—segregated
into 13:3 in the F 2 and 7:8:1 in the F 3 generation (Table 2).
This clearly indicated that the recessive gene present in
RP2068-18-3-5 is nonallelic to Gm1, Gm2, and Gm4 and segregates
independently. The recessive gene present in RP 2068-
18-3-5 is nonallelic to the new dominant gene Gm5 identified
in ARC 5984. Therefore, the recessive gene for resistance
present in RP 2068-18-3-5 is tentatively designated as gm3.
All F 1 populations involving RP2333-156-8 as one parent
were found to be resistant (Table 2). The three F 2 populations
involving RP 2333-156-8 and the susceptible parents R
2270, Ratna, and Shymala segregated into 3:1, indicating the
presence of a single dominant resistance gene in RP2333-156-
8. The F 3 progenies segregated into a 1:2:1 ratio, confirming
the F 2 segregation data. The F 2 populations of RP 2333-156-8
with parents possessing Gm1 (Samridhi, Ruchi, and Asha),
Gm2 (Phalguna), RP2068-18-3-5, Gm4(t) (Abhaya), and ARC
5984 genes segregated into a 15:1 ratio, indicating the nonallelic
nature of the gene present in RP 2333-156-8, RP2068-
18-3-5, Gm4(t) (Abhaya), and ARC 5984 gall midge resis-
52 Advances in rice genetics

Table 1. Reaction of F 1 , F 2 , and F 3 populations of Abhaya and ARC 5984 with
susceptible and resistant cultivars. a
Cross
Reaction of F 2 plants (no.)
F 1 R S Ratio X 2
Abhaya × Tulsi R 584 191 3:1 0.052
Abhaya × Annada R 375 104 3:1 2.762
Abhaya × Cheptigurmatia R 411 117 3:1 2.273
Abhaya × Ratna R 449 150 3:1 0.001
Abhaya × Samridhi R 581 33 15:1 0.810
Abhaya × Ruchi R 621 39 15:1 0.931
Abhaya × R302-111 R 753 50 15:1 0.001
Abhaya × Phalguna R 510 36 15:1 0.110
ARC 5984 × Kranti R 246 73 3:1 0.762
ARC 5984 × Shyamla R 359 123 3:1 0.069
ARC 5984 × Samridhi R 361 19 15:1 1.013
ARC 5984 × Phalguna R 92 6 15:1 0.003
Abhaya × ARC 5984 R 184 12 15:1 0.001
ARC 5984 × RP2068-18-3-5 R 250 72 13:3 2.755
ARC 5984 × ARC 5984 (old) R 450 116 13:3 1.131
RP2068-18-3-5 × ARC 5984 (old) R 391 – – –
a R = resistant, S = susceptible.
Table 2. Reaction of F 1 , F 2 , and F 3 populations of RP2068-18-3-5 and RP2333-
156-8 with susceptible and resistant cultivars. a
Reaction of F 2 plants (no.)
Cross Reaction
of F 1 R S Ratio X 2
RP 2068-18-3-5/Annada S 75 198 1:3 0.890
RP 2068-18-3-5/Samridhi R 489 95 13:3 2.363
RP 2068-18-3-5/Asha R 255 72 13:3 2.293
RP 2068-18-3-5/Ruchi R 222 58 13:3 0.709
RP 2068-18-3-5/Phalguna R 168 32 13:3 0.993
RP 2068-18-3-5/IET6286 R 57 16 13:3 0.762
RP 2068-18-3-5/Abhaya R 482 98 13:3 1.308
ARC 5984/RP 2068-18-3-5 R 250 72 13:3 2.755
RP 2333 × Shyamla R 312 98 3:1 0.263
RP 2333 × R 2270 R 209 84 3:1 2.103
RP 2333 × Ratna R 273 104 3:1 1.345
RP 2333 × Samridhi R 338 27 15:1 0.819
RP 2333 × Ruchi R 175 14 15:1 0.432
RP 2333 × Asha R 1,139 72 15:1 0.192
RP2333 × Phalguna R 614 48 15:1 1.131
RP 2333 × RP 2068-18-3-5 R 390 74 13:3 1.894
RP 2333 × Abhaya R 541 32 15:1 0.433
RP 2333 × ARC 5984 R 454 26 15:1 0.302
a R = resistant, S = susceptible.
tance genes. The reaction of F 3 families also confirmed the
nonallelic nature of the gene present in RP 2333-156-8 with
Gm1, Gm2, RP2068-18-3-5, Gm4(t) (Abhaya), and ARC 5984
gall midge resistance genes. The Gm6 gall midge resistance
gene identified in Chinese variety Duokang 1 (Yang et al 1997)
was found to be susceptible against gall midge biotype 1 prevalent
in Madhya Pradesh. Therefore, the gene present in RP
2333-156-8 is a new gall midge resistance gene and is proposed
to be designated as Gm7.
References
Chaudhary BP, Shrivastava PS, Shrivastava MN, Khush, GS. 1986.
Inheritance of resistance to gall midge in some cultivars of
rice. Rice genetics. Manila (Philippines): International Rice
Research Institute. p 523-528.
Kumar Arvind, Shrivastava MN, Sahu RK 1998. Genetic analysis
of ARC 5984 for gall midge resistance: a reconsideration. Rice
Genet. Newsl. 15:142-143.
Genetics and breeding of agronomic traits 53

Sahu VN, Mishra R, Chaudhary BP, Shrivastava PS, Shrivastava
MN. 1990. Inheritance of resistance to gall midge in rice. Rice
Genet. Newsl. 7:118-121.
Shrivastava MN, Kumar Arvind, Shrivastava SK, Sahu RK. 1993.
A new gene for resistance to gall midge in rice variety Abhaya.
Rice Genet. Newsl. 10:79-80.
Tan Yujuan, Pan Ying, Zhang Yang. 1993. Resistance to gall midge
(GM) Orseolia oryzae in Chinese rice varieties compared with
varieties from other countries. Int. Rice Res. Notes 18:13.
Yang Zhang, Yujuan Tan, Bingchao Huang, Jianwei Chen, Lixia
Zhao, Yankang Xu.1997. The inheritance of resistance to gall
midge in rice variety Duokang 1. Rice Genet. Newsl. 14:67-
69.
Notes
Authors’ addresses: A. Kumar, Indira Gandhi Agricultural University,
Regional Agricultural Research Station,Bilaspur 495 001,
Madhya Pradesh, India; M.N. Shrivastava, R.K. Sahu, and
B.C. Shukla, Department of Plant Breeding and Genetics,
Indira Gandhi Agricultural University, Raipur 492 012,
Madhya Pradesh, India; S.K. Shrivastava, Department of Entomology,
Indira Gandhi Agricultural University, Raipur 492
012, Madhya Pradesh, India.
Acknowledgments: This study was supported by Indira Gandhi Agricultural
University, Raipur, India, and the Rockefeller Foundation,
USA.
Genetics of submergence tolerance in rainfed rice:
line × tester analysis
O.N. Singh, Sanjay Singh, R.K. Singh, and S. Sarkarung
A study was conducted with three submergence-tolerant (TCA-48, FRG-7, Madhukar) and two susceptible genotypes
(Mahsuri and IR42) used as testers, and nine lines consisting of six submergence-tolerant improved
selections and three released varieties—Jal-Lahri (moderately tolerant), Rajshree (susceptible), and Sabita
(tolerant). The 45 F 1
s derived from 5 × 9 line-tester crosses and 14 parents were direct-sown. Twenty-one-dayold
seedlings were submerged for 14 days under 80-cm water depth. The water was allowed to recede and, on
the third day and tenth day of desubmergence, plant height was measured, a survival count made, and elongation
computed. During the wet season of 1999, the F 2
s along with their parents were direct-sown and a similar
submergence test was performed. On the basis of phenotypic scores on F 1
s and parents, statistical analysis was
performed. Line × tester analysis was carried out and general and specific combining ability of the parents and
their crosses were determined. Various types of gene effects were also estimated. Analysis of data suggested
significant variation among lines, testers, crosses, parents vs crosses, and line × tester interaction. Among
tolerant parents (testers), only TCA 48 was found to be a good general combiner, whereas Madhukar and FRG-
7 were poor combiners. Crosses involving tolerant × tolerant, tolerant × susceptible, susceptible × susceptible,
and moderately tolerant × susceptible behaved differently for submergence tolerance. Results and their implications
for breeding rainfed lowland rice are discussed.
Rainfed lowlands account for about 25 million ha of rice area
in South and Southeast Asia. India has the largest area, about
17 million ha, mostly distributed in eastern India. Submergence
caused by flash flood is a key factor limiting the yield
of lowland rice. Flash floods are highly unpredictable and can
occur at any growth stage of the rice crop, resulting in yield
loss of 10% to 100% depending on water depth, duration of
submergence, temperature, turbidity of water, light intensity,
and age of the crop, etc. (Setter et al 1997). A few studies in
the past reported dominance of tolerance over nontolerance
and involvement of both major and minor genes in the inheritance
(Mohanty and Khush 1985, Mohanty et al 2000). Mandal
et al (1998) found both additive and nonadditive gene effects
responsible for inheritance of submergence tolerance, the
former being predominant. We studied the nature and magnitude
of genetic variation of submergence tolerance.
Materials and methods
For 9 × 5 line × tester analysis, three submergence-tolerant
genotypes (TCA48, FRG7, Madhukar) and two susceptible
genotypes (Mahsuri and IR42) were used as testers, besides
six submergence-tolerant improved selections from the shuttle
breeding project and three released varieties—Jal-Lahri (moderately
tolerant), Rajshree (susceptible), and Sabita (tolerant).
Of the two susceptible testers, Mahsuri is tall and IR42 is an
improved semidwarf variety. Of the nine lines, six are improved
semidwarf selections, two are semidwarf (Jal-Lahri and
Rajshree), and one is a tall improved variety (Sabita). The 45
F 1 s derived from 9 × 5 line × tester crosses and 14 parents
were direct-sown each in one row 4 m long, with three replications
and row-to-row spacing of 30 cm and plant-to-plant spacing
of 20 cm. When the seedlings were 21 days old, the number
of plants/genotypes was counted and the seedlings were
subsequently submerged for 14 days under 80-cm water depth.
The water was then allowed to recede and, on the tenth day of
54 Advances in rice genetics

Table 1. Mean parental score and their array means for submergence tolerance in a 9 × 5 line × tester cross.
Lines NDRSB NDRSB NDRSB NDRSB NDRSB NDRSB Jal Lahri Rajshree Sabita Array
96004 96005 96006 930004 9730015 9730020 mean
Testers 2.86 2.32 2.07 3.42 3.87 4.16 5.82 5.98 3.16 –
TCA 48 1.78 1.87 2.52 2.47 2.60 1.66 3.22 2.66 3.87 1.87 2.56
FRG 7 2.04 4.16 3.87 2.92 3.42 4.32 4.04 3.84 4.32 1.56 3.61
Madhukar 2.86 2.06 1.96 2.14 3.27 4.16 4.04 4.15 2.08 1.93 2.87
Mahsuri 8.64 5.68 6.14 3.24 2.86 5.85 6.62 7.84 7.32 5.38 5.66
IR42 8.93 8.01 4.32 5.01 3.47 6.85 6.42 7.85 7.37 4.67 6.55
Array mean 4.36 4.36 3.56 3.12 4.57 4.87 5.27 4.39 3.10 R = 0.62
Table 2. General combining ability (GCA) and specific combining ability (Sij) effects in a 9 × 5 line × tester cross in rice. a
Lines NDRSB NDRSB NDRSB NDRSB NDRSB NDRSB Jal Lahri Rajshree Sabita GCA
96004 96005 96006 9730004 9730015 9730020 (L 7 ) (L 8 ) (L 9 ) (testers)
Testers (L 1 ) (L 2 ) (L 3 ) (L 4 ) (L 5 ) (L 6 )
TCA 48 –1.822** –1.382** 1.649** 1.432** –1.211** –0.624* –0.521* –0.628* 0.856* –1.422**
(T 1 )
FRG 7 –1.469** 1.382** 0.011 –0.067 0.100 1.522** –0.785* –0.102 0.132 –1.163**
(T 2 )
Madhukar 0.856* –0.867* –1.278** 0.523* 0.049 0.273 0.123 1.678** –1.342** 0.408*
(T 3 )
Mahsuri 1.326** 1.537** 0.237 0.056 0.132 2.253** 1.427** 0.306 0.432* 1.522**
(T 4 )
IR42 0.527* 0.136 1.465** 0.047 0.532* 0.976* 1.653** 0.017 2.324** 0.781*
(T 5 )
GCA 0.386* –1.264** –1.621** 2.542** 0.976* 0.743* 0.658* 0.776* 1.128**r(s) = 0.80
(lines)
a r(s) = rank correlation between the per se performance of the parents and their GCA effects. *, ** = significant at 5% and 1% probability level.
desubmergence, a survival count was made. During the wet
season of 1999, the selected F 2 s along with their parents were
direct-sown and a similar submergence test was performed.
On the basis of phenotypic scores on F 1 s and parents, line ×
tester analysis was performed following Kempthorne (1957).
Results and discussion
Among testers, TCA 48, FRG 7, and Madhukar were the most
tolerant, and among lines, NDRSB96006, NDRSB96005, and
NDRSB96004 were found to be the most tolerant (Table 1).
Rajshree was found to be the most susceptible. The scores for
F 1 s differed greatly from one cross to another depending on
the level of tolerance of the parents used in the cross. A high
relationship between parental means and their array means (r
= 0.62) suggests a high prepotency of the parents in transmitting
submergence tolerance to their offspring. Mohanty and
Khush (1985) also reported a high correlation (0.88) between
the parental means and their array means. ANOVA indicated
highly significant variances for all the treatments. The significance
of line × tester showed a high interaction. Similarly, the
performance of the crosses differed significantly from that of
the parents, with the testers showing a larger variation than the
lines.
FRG 7 and TCA 48 appeared to be the best combiners,
while Mahsuri was the poorest (Table 2). Among lines,
NDRSB96005 and NDRSB 96006 proved to be the best general
combiners. TCA 48, when crossed with NDRSB96004
and NDRSB96005, produced the best cross combinations. The
other good combinations included the cross between
NDRSB96004 and NDRSB96005 and Madhukar.
Out of five crosses between the most susceptible and
most tolerant lines, four showed a clear-cut 3:1 ratio, indicating
involvement of a single locus (Table 3). However, the cross
NDRSB6006 × IR42 did not fit into this ratio. This clearly
shows that tolerant parents such as Sabita, NDRSB96005, and
NDRSB 96006 possessed the dominant gene, while IR42 and
Mahsuri possessed the recessive gene for susceptibility to submergence.
Mohanty and Khush (1985) also reported the dominance
of tolerance over nontolerance. Similar observations
were made by Mandal et al (1998). The survival of the tolerant
parent ranged from 87% to 92% vis-à-vis 6% for IR42 and
11% for Mahsuri.
A high level of rank correlation (r = 0.8) was observed
between the per se performance of the parents and their general
combining ability. From the study, it is clear that, besides
well-known submergence-tolerant parents such as TCA 98 and
FRG 7, the newly developed semidwarf lines—NDRSB96004,
NDRSB96005, and NDRSB96006—could also be good candidates
for breeding submergence-tolerant varieties. It will be
worthwhile to explore whether these lines had the same gene.
Such information will be useful in gene pyramiding for a higher
Genetics and breeding of agronomic traits 55

Table 3. Reaction of tolerant and susceptible progenies to submergence tested in
the field.
F 2 population Tolerant Susceptible Expected ratio χ 2 Probability
(tolerant:susceptible)
Sabita/IR42 118 43 3:1 0.911 0.25–0.25
Sabita/Mahsuri 111 34 3:1 1.628 0.10–0.25
NDRSB96005/IR42 144 52 3:1 0.517 0.50–0.75
NDRSB96006/IR42 108 27 4:1 – –
NDRSB96006/Mahsuri 151 47 3:1 2.154 0.10–0.15
level of submergence tolerance. Submergence-tolerant cultivars
such as FR13A, Kurukamppan, and BKNFR have been
reported to possess the same dominant gene (Mishra et al 1996,
Setter et al 1997).
Line × tester analysis helped to identify a few lines
(NDRSB96005, NDRSB96004, NDRSB96006) that were tolerant
and also good combiners for submergence. They made
good combination among themselves as well as with the known
tolerant varieties TCA 98, FRG 7, and Madhukar. The segregation
pattern of F 2 data showed a 3 tolerant:1 susceptible ratio,
confirming monogenic inheritance of the trait.
Mishra SB, Senadhira D, Manigbas NL. 1996. Genetics of submergence
tolerance in rice (Oryza sativa L). Field Crops Res. 46:
77-182.
Mohanty HK, Khush GS. 1985. Diallel analysis of submergence tolerance
in rice, Oryza sativa L. Theor. Appl. Genet. 70:467-
473.
Mohanty HK, Mallik S, Grover Anil. 2000. Prospects of improving
flooding tolerance in lowland rice varieties by conventional
breeding and genetic engineering. Curr. Sci. 78(2):132-137.
Setter L, Ellis M, Laurels EV, Ella ES, Senadhira D, Mishra SB,
Sarkarung S, Datta S. 1997. Physiology and genetics of submergence
tolerance in rice. Ann. Bot. 79:67-77.
References
Kempthorne O. 1957. An introduction to genetic statistics. New York
(USA): John Wiley and Sons, Inc., and London (UK):
Chapman and Hall, Ltd.
Mandal N, Roy K, Gupta S. 1998. Nature of genetic control of submergence
tolerance in rice. Indian J. Genet. Plant Breed.
58:285-290.
Diallel analysis for cold tolerance
at the germination stage in rice
R.P. dela Cruz, S.C.K. Milach, L.C. Federizzi, A.F. de Rosso
Notes
Authors’ addresses: O.N. Singh, Crop Research Station, Masodha,
P.O. Dabhasemar, Faizabad, Uttar Pradesh; R.K. Singh, IRRI-
India Office, C-18, Friends Colony (East), New Delhi 110
065, India; Sanjay Singh and S. Sarkarung, IRRI, Los Baños,
Philippines.
In Rio Grande do Sul in southern Brazil, temperatures below 20 °C affect the rice crop during plant establishment
and initial development, and during microsporogenesis and flowering. Three cold-tolerant and three cold-sensitive
genotypes were crossed in a diallel excluding reciprocals. Seeds were incubated under two conditions: 13 °C
for 28 d and 28 °C for 7 d; after these periods, coleoptile length was measured. Cold tolerance was expressed
as a percentage reduction in coleoptile length because of cold compared with normal conditions. The combining
ability analysis showed highly significant effects because of general combining ability (GCA) and specific combining
ability (SCA) for cold tolerance in the genotypes studied. The quadratic component associated with SCA was
much higher than that associated with GCA, indicating nonadditive effects as the most important. Estimates of
GCA effects indicate that Quilla 66304 is a promising parent for breeding cold-tolerant genotypes.
Rice is cultivated on nearly 1 million ha under irrigated conditions
every year in Rio Grande do Sul (RS) in southern Brazil.
The growing season extends from September to April, but on
average the crop is sown in October and harvested in late
March. The average temperature during this period is 25 °C,
but cool temperatures occur in February, when the crop is in
the reproductive stage, thus lowering rice yields. Early sowing
is recommended to avoid cool temperature when the plant is
in the reproductive stage. However, in some regions, cool temperatures
in early October limit germination and field establishment,
leading to poor stands and poor plant development,
and hindering the benefits of this practice. For this reason, it is
necessary to have cold-tolerant genotypes at the germination
stage.
56 Advances in rice genetics

Table 1. Analysis of variance for combining ability
for cold tolerance at the germination stage in rice.
Source of variation df Mean squares
Treatment 20 70.64**
GCA 5 122.52**
SCA 15 53.35**
Error 40 8.07
Φ
a g 14.31
Φ s 45.28
a
Quadratic component. GCA = general combining ability, SCA
= specific combining ability. ** = significant at P = 0.01.
Table 2. General and specific combining ability effects for cold tolerance at the germination
stage in 15 F 1 hybrids and their parents.
Genotype
SCA effects a
GCA
IRGA 417 IR8 Quilla Diamante Quilla effects
66304 64117
E-Taim –0.39 14.7** –8.04** –9.12** –8.18** 0.30
IRGA 417 0.0 –3.24 4.28 –9.28** –1.20
IR8 –3.65 –5.03 –0.99 7.41**
Quilla 66304 9.53** 5.37 –4.15**
Diamante 4.00 –1.08
Quilla 64117 –1.31
a ** = significant at P = 0.01.
Breeding rice for cold tolerance at the germination stage
has been done under field conditions, but the lack of enough
uniform selection pressure and interaction with other abiotic
and biotic stresses make it difficult to select for this trait in
such conditions. Selection can be done in the laboratory, where
many seeds can be tested under the same selection pressure.
Many screening methods have been described (Bertin et al
1996, Sthapit and Witcombe 1998) and these confirm the efficacy
of this strategy for selecting superior genotypes for germination
under cool temperatures. Chilling tolerance during
germination was reported to be controlled by four or more
dominant genes (Sasaki et al 1973) and heritabilities ranging
from 0.7 to 0.9 were obtained by Sthapit and Witcombe (1998).
Rice genotypes cultivated in RS, Brazil, belong mainly to the
indica subspecies and in general are cold-sensitive in all developmental
stages. A study conducted on 26 indica and
japonica genotypes indicated that, although japonica genotypes
are generally more tolerant, the trait varies among the indicas
(Cruz and Milach 1999).
This study aimed to determine the combining ability of
six rice genotypes for low-temperature tolerance at the germination
stage.
Materials and methods
Six rice genotypes were crossed in a partial diallel, excluding
reciprocals—three cold-tolerant japonica types (Quilla 66304,
Quilla 64117, and Diamante) and indica cultivars, including
cold-sensitive IR8, E-Taim, and IRGA 417, which represent
the agronomic type cultivated in RS. The female parent in
crosses between indica and japonica genotypes was always
the indica genotype.
Seeds were surface-sterilized in 70% ethanol for 30 sec
and 5% sodium hypoclorite for 20 min and then rinsed six
times with sterilized distilled water. Twenty seeds from each
parent and 10 F 1 seeds per cross were used, with three replications
per experiment. Two experiments were conducted, one
in which the seeds were kept at 28 °C for 7 d to serve as a
control and another in which the seeds were kept at 13 °C for
28 d. Experiments were conducted in a randomized block design
in which each replication constituted a different shelf in
the incubation chamber. At the end of the period, coleoptile
length was measured and cold tolerance was expressed as the
percentage reduction in coleoptile length because of the cold
compared with normal conditions. A combining ability analysis
was performed using method 2, model 1 of Griffing (1956).
Since the number of genotypes crossed was small and they
did not represent a broad range of variation, a fixed model
was adopted.
Results and discussion
The combining ability analysis (Table 1) showed highly significant
mean squares because of general and specific combining
ability (GCA and SCA), revealing that both additive
and nonadditive gene action are involved in low-temperature
tolerance at the germination stage. The quadratic component
associated with SCA is three times greater than the one associated
with GCA, indicating the relative importance of SCA
for cold tolerance at the germination stage in rice and suggesting
that the nonadditive type of gene action is the main one.
This type of gene action has also been verified for cold tolerance
at the seedling stage in rice, although simple inheritance
has also been demonstrated (Kwak et al 1984).
Table 2 presents estimates of GCA effects of parents
and SCA effects of crosses. Only two parents showed significant
GCA effects, Quilla 66304 (a highly significant negative
one) and IR8 (a highly significant positive one). In this study,
negative effects were desirable because they expressed less
percentage reduction in coleoptile length caused by cold temperature.
Hence, Quilla 66304 was the best parent and IR8 the
poorest for breeding for this trait.
Four crosses showed highly significant negative SCA
effects (Table 2); three of them involved the susceptible E-
Taim and the three tolerant japonica genotypes, and one involved
the susceptible IRGA 417 and Quilla 64117. Among
these, the population E-Taim × Quilla 66304 was the most
appropriate for selecting cold-tolerant genotypes, as shown
by the highly significant GCA effect of the tolerant parent
(Table 2). Three populations present highly positive SCA ef-
Genetics and breeding of agronomic traits 57

fects, demonstrating that they involve poor combining genotypes
for germination-stage low-temperature tolerance. The
other crosses did not show significant SCA effects.
The genetics of cold tolerance at the germination stage
for Brazilian rice genotypes is poorly understood. Results demonstrated
that it was possible to differentiate among genotypes
and their F 1 progenies under such conditions. A previous study
indicated a high level of genetic variability for low-temperature
tolerance at the germination stage (Cruz and Milach 1999).
Current data indicated that, among the genotypes tested, this
variability was mostly related to the nonadditive type of gene
action. Among the genotypes studied, Quilla 66304 was the
best parent for increasing the level of cold tolerance at the
germination stage in rice.
References
Bertin P, Kinet JM, Bouharmont J. 1996. Evaluation of chilling sensitivity
in different rice varieties: relationship between screening
procedures applied during germination and vegetative
growth. Euphytica 89:201-210.
Cruz RP de la, Milach SCK. 1999. Variabilidade genética em arroz
irrigado (Oryza sativa L.) para tolerância ao frio durante a
germinação. In: Proceedings of the 45° Congresso Nacional
de Genética, 3-6 October 1999, Gramado, Brazil. p 699.
Griffing B. 1956. Concept of general and specific combining ability
in relation to diallel crossing systems. Austr. J. Biol. Sci. 9:463-
493.
Kwak TS, Vergara BS, Nanda JS, Coffman WR. 1984. Inheritance
of seedling cold tolerance in rice. SABRAO J. 16:83-86.
Sasaki T, Kinoshita T, Takahashi MT. 1973. Estimation of the number
of genes in germination ability at low temperature in rice—
genetical studies in rice plant. LVII. J. Fac. Agric. Hokkaido
Univ. 57:301-312.
Sthapit BR, Witcombe JR. 1998. Inheritance of tolerance to chilling
stress in rice during germination and plumule greening. Crop
Sci. 38:660-665.
Notes
Authors’ addresses: R.P. de la Cruz, S.C.K. Milach, L.C. Federizzi,
Department of Crop Plants, Rio Grande do Sul Federal University,
P.O. Box 776, 91501-970, Porto Alegre; A.F. de Rosso,
Rio Grande do Sul Rice Institute, P.O. Box 29, 94930-030,
Cachoeirinha, RS, Brazil.
Inheritance of nitrogen efficiency under aluminum
stress in upland rice lines
Y. Jagau, A. Makmur, H. Aswidinnoor, and S.H. Sutjahjo
Four upland rice lines differing in nitrogen (N) efficiency, Krowal and Banih Kuning (N-efficient lines)
and CT6510-24-1-3 and Grogol (N-inefficient lines), were used in crosses. Six generations (P 1
, P 2
, F 1
,
F 2
, BC 1
, and BC 2
) of each cross-combination were grown simultaneously in Yoshida nutrient solution
with 5 ppm N and 45 ppm Al. After 14 d, seedling dry weight and tissue N content were measured.
Seedling and dry weight N-use efficiency (NUE) were controlled by nuclear genes (no maternal effect).
The variability for both characters was controlled by the effect of additive [d], dominance [h], additive
× additive interaction [i], and dominance × dominance interaction [l]. The environmental effect for
both characters was high, whereas the broad-sense heritability values were low. Based on narrowsense
heritability, although the variability of both characters was controlled by the additive, dominance,
and interaction effects, the additive effect had a higher effect than the others. The higher
additive effect for both characters allows selection of N-efficient lines, but the selection must be done
in later generations.
The upland area in Indonesia is estimated to be about 48.3
million ha. This area is dominated by Ultisols with some chemical
constraints to plant growth, such as high soil acidity, aluminum
toxicity, and low nutrient availability (Marschner 1995).
Aluminum is one of the dominant constraints that limit plant
growth. It inhibits N uptake and assimilation in plants, so it
can influence N efficiency (Jagau 2000). Since upland rice
lines have varied reactions to Al toxicity and low N availability
(Noor-Farid et al 1997), a variety that is able to cope with
these constraints needs to be developed. Inheritance of N efficiency
under non-Al-stress conditions was reported, but not
under Al-stress conditions. This study was therefore conducted
to understand the genetic control of N efficiency under aluminum-stress
conditions.
Materials and methods
Four upland rice lines selected from 150 lines were used in
this study (Noor-Farid et al 1997, Jagau 2000). Two Al-tolerant
and N-efficient lines (Krowal and Banih Kuning) and two
Al-tolerant and N-inefficient lines (CT6510-24-1-3 and
Grogol) were crossed in all combinations. P 1 , P 2 , F 1 , and their
58 Advances in rice genetics

eciprocals, and BC 1 , BC 2 , and F 2 populations were developed
from each cross-combination. Three-day-old seedlings
were grown on a nylon net in an 800-mL plastic container with
Yoshida nutrient solution (Yoshida et al 1976) with 5 ppm N
and 45 ppm Al (Noor-Farid et al 1997). The solution pH was
maintained at 4.0. Individual containers were placed randomly
in a screenhouse. Fourteen days after transplanting, all plants
were harvested and dried in a 70 °C oven for 3 d. Seedling dry
weight (SDW) was measured and total N was analyzed by
persulfate digestion. Nitrogen-use efficiency (NUE) was calculated
according to Siddiqi and Glass (1981) as SDW per N
concentration in tissue.
A generation mean analysis was made using the joint
scaling test described by Mather and Jinks (1971), which estimates
the midparent, genetic components, and digenic interaction
genetic components. The genetic components consisted
of the additive component [d] and the dominance component
[h]. Interaction components were the additive × additive component
[i], additive × dominance component [j], and dominance
× dominance component [l]. These estimates were used
to fit the data to eight genetic models: (1) m [d]; (2) m [d] [h];
(3) m [d] [h] [i]; (4) m [d] [h] [j]; (5) m [d] [h] [l]; (6) m [d] [h]
[i] [j]; (7) m [d] [h] [i] [l]; and (8) m [d] [h] [j] [l]. The model
was considered appropriate if the chi-square test probability
level was 0.05 or greater. Individual genetic components were
tested for significance using Student’s t-test. Genetic components
estimated to be different from zero at P

References
Jagau Y. 2000. Physiology and inheritance of nitrogen efficiency
under aluminum stress condition in upland rice lines in Indonesia.
PhD thesis. Bogor Agricultural Institute, Bogor. 139 p.
Makmur A, Gerloff GC, Gabelman WH. 1978. Physiology and inheritance
of efficiency in potassium utilization in tomatoes
grown under potassium stress. J. Am. Soc. Hort. Sci.
103(4):545-549.
Marschner H. 1995. Mineral nutrition of higher plants. 2nd ed. San
Diego, Calif. (USA): Academic Press. p 6-78, 596-625.
Mather K, Jinks JL. 1971. Biometrical genetics. London (UK):
Chapman and Hall Ltd. 382 p.
Noor-Farid S, Asfaruddin, Trikoesoemaningtyas, Jagau Y, Sopandie
D, Makmur A. 1997. Preliminary study on variability of nutrient
element efficiency under aluminium stress condition in
upland rice (Oryza sativa L.). Paper presented at the International
Symposium on Plant Responses to Ionic Stress: Aluminium
and Other Ions, September 1997, Kurashiki, Japan.
O’Sullivan J, Gabelman WH, Gerloff GC. 1974. Variation in efficiency
of nitrogen utilization in tomatoes (Lycopersicum
esculentum Mill.) grown under nitrogen stress. J. Am. Soc.
Hort. Sci. 99:543-547.
Siddiqi MY, Glass ADM. 1981. Utilization index: a modified approach
to estimation and comparison of nutrient utilization
efficiency in plants. J. Plant Nutr. 4:289-302.
Yoshida S, Forno DA, Cock JA, Gomez KA. 1976. Laboratory manual
for physiological studies of rice. 3rd ed. Los Baños (Philippines):
International Rice Research Institute. 83 p.
Notes
Authors’ addresses: Y. Jagau, Department of Agronomy, Faculty of
Agriculture, University of Palangka Raya, Central Kalimantan;
A. Makmur, H. Aswidinnoor, and S.H. Sutjahjo, Department
of Agronomy, Faculty of Agriculture, Bogor Agricultural
University, Bogor, West Java, Indonesia.
Genetic mechanism of variegation of a chlorophyll
mutant originated from the cross between distantly
related rice varieties
M. Maekawa and K. Noda
A variegated yellow leaf mutant (yl-v) was obtained spontaneously in the F 2
in a cross between an indica native
variety, C-5052, and a japonica marker line, H-126. This mutant segregates variegated (yl-v) and stable (yl-stb)
phenotypes and germinal revertants, indicating that it is unstable. The effects of gamma rays or 5-azacytidine
and genetic factor(s) on the induction of variegation in a yl-stb near-isogenic line (NIL) were studied. In the M 1
population treated with 0.3 mM 5-azacytidine, 50.5% of all yl-stb plants showed variegation, while no variegated
yl plants were observed in M 1
plants treated with 300 Gy gamma rays. Although most M 2
plants derived from
variegated yl plants in M 1
showed stable yellow leaf phenotypes, only 1% of the M 2
plants showed variegated
phenotypes. This suggested that yl-stb phenotypes may have arisen because the genetic factor was inactivated
through methylation. In the F 2
of the cross of yl-stb NIL with H-126, variegated yl plants were observed. The
frequency of yl-v to yl plants (yl-stb and yl-v) was 77.4%, suggesting that H-126 carries a dominant factor
responsible for the variegation. In contrast, the F 2
populations from crosses between yl-stb NIL and marker lines,
except for H-126, segregate into normal and yl-stb plants. These results suggest that yl-stb is caused by a
methylation-inactivated factor inserted and variegation of yl is caused by a factor reactivated through demethylation.
Further, H-126 likely carries a genetic factor that induces demethylation.
Transposable elements are very powerful genetic tools for gene
isolation (Walbot 1992). The maize Ac/Ds system for
transposon tagging has been used in many plant species
(Sundaresan 1996). If endogenous active transposons like Ac/
Ds in maize were discovered and cloned in rice, large-scale
screening for tagged mutants could be easily conducted and
rapid progress in gene cloning by transposon tagging could be
made in rice. However, no endogenous active transposons in
rice have been found yet. Genetic variegations not controlled
by cytoplasmic inheritance are often conferred by excising a
DNA transposable element. The genetic analysis of a variegated
mutant could lead to the first finding of a DNA transposable
element that can transpose in an intact rice genome. A
variegated yellow leaf (yl) mutant was obtained spontaneously
in the F 2 of the cross between an indica native variety, C-5052,
and a japonica marker line, H-126. This mutant produced germinal
revertants and stable phenotypes. Furthermore, a heterozygous
plant for the yl gene showed aberrant segregation
of yl with panicles. This yl gene is unstable and is possibly
controlled by a transposon. We produced a near-isogenic line
(NIL) showing stable yellow leaf (yl-stb) with the genetic background
of the japonica variety Taichung 65 (T-65). To determine
the genetic factor(s) responsible for the variegation of
the yellow leaf mutant, we examined the effects of gamma rays
or 5-azacytidine and genetic factor(s) on the induction of variegation
in a yl-stb NIL plant.
60 Advances in rice genetics

Table 1. Aberrant segregation of the yl character in F 2 and F 3 derived from a single F 1 plant of
the cross Shiokari yl-v NIL/T-65.
F 2 segregation
Primary Panicle#1 Panicle#2 F 3 segregation from panicle#2
branch
Green yl-stb yl-v Green yl-stb yl-v Green fixed yl seg. yl fixed
1st a 7 1 2 10 0 0 10 0 0
2nd 11 0 1 13 0 0 13 0 0
3rd 4 1 2 16 0 0 14 0 0
4th 6 0 3 19 0 0 13 0 0
5th 12 3 2 15 0 3 8 7 2
6th 8 1 3 9 0 0 8 0 0
7th 5 1 1 16 0 0 15 0 0
8th 6 0 3 8 0 0 7 0 0
Total 59 7 17 106 0 3 88 7 2
a
The primary branch is numbered from the top to the lower branches.
Characterization of yl mutant
A variegated yl mutant was obtained in 148 F 2 plants of the
cross between H-126 and C-5052, an indica variety. This variegated
yl character was introduced into Shiokari, a variety in
Hokkaido, Japan, and T-65 by the crossing-selfing cycling
method; a mutant that survived in the F 2 of the cross between
the mutant and Shiokari or T-65 was crossed with Shiokari or
T-65. A surviving mutant was obtained in the F 2 derived from
selfed F 1 of the cross. Thus, we produced Shiokari yl-v (variegated
yl) and yl-stb (stable yl) and T-65 yl-stb NILs.
A yl-stb plant produces only yl-stb progenies. In contrast,
a yl-v plant produces yl-v, yl-stb, and revertants. The frequency
of occurrence of yl-v progenies and revertants ranged
from 13.9% to 61.2% and from 0% to 86.1%, respectively.
Furthermore, it was confirmed that revertants derived from ylv
plants fixed with a frequency of 35%. This result indicated
that revertants obtained in yl-v progenies were germinal and
the yl gene became normal in male and female gametes with
similar frequencies. Genetic analysis for the yl character, including
yl-v and yl-stb, revealed that the yl character is governed
by a single recessive gene and not by cytoplasmic inheritance.
However, the frequency of yl plants varied in the panicles
of a single F 1 plant of the cross Shiokari yl-v NIL/T-65 (Table
1). Every branch of panicle#1 of the F 1 produced yl progenies
with frequencies ranging from 8.3% to 43%. However, in
panicle#2, only the fifth branch segregated for yl plants with a
frequency of 17%; the other branch did not segregate for any
yl plants. In the F 3 , normal green plants were fixed, with normal
green-fixed, yl-segregated, and yl-fixed lines derived only
from the fifth branch. This result suggested that the yl gene
reverted to normal at the primary branch differentiation stage.
These results showed that the yl-v gene is mutable. The
mutability of the gene could be attributed to a transposable
element.
Induction of variegation in yl-stb by mutagen treatments
If the yl-v phenotype is induced by an active transposable element,
the yl-stb phenotype is hypothesized to be induced by
the inactivation of the transposable element or footprint left
after its excision at the yl locus. Thus, yl-stb heterozygous plants
were treated with 300 Gy gamma rays and 0.3 mM 5-
azacytidine because yl-stb homozygous plants are sublethal
and large amounts of seeds of yl-stb homozygous plants could
not be obtained. As a result, 50.5% of the yl plants showed
clear variegated phenotypes in the M 1 population treated with
5-azacytidine; 1.9% showed vague variegated types in the M 1
treated with gamma rays (Table 2). In contrast, the same vague
variegated phenotypes (1.7%) as those in the M 1 treated with
gamma rays were observed in progenies derived from yl-stb
heterozygous plants. The frequency of variegated M 1 plants
obtained from the 5-azacytidine treatment was much higher
than that in variegated M 1 plants treated with gamma ray irradiation
or variegated progenies obtained by selfing. Variegation
was induced by 5-azacytidine.
Inheritance of yl-v in M 1 plants treated with 5-azacytidine
was examined. Almost all M 2 plants from yl-v plants in M 1
showed the yl-stb phenotype (Table 3). Only 28 of 2,699 plants
examined showed a clear yl-v phenotype in M 2 . This indicated
that most yl-v phenotypes in M 1 were transient. In contrast, ylstb
plants in M 1 produced only one yl-v progeny, which was of
the vague type. Since 5-azacytidine induces demethylation of
DNA (Razin and Riggs 1980), part of the yl-stb phenotypes
possibly resulted from the inactivation of the genetic factor(s)
through methylation.
Induction of variegation in yl-stb by a genetic factor
To determine the genetic factor(s) responsible for inducing
variegation in yl-stb, we conducted a genetic analysis of the
progenies from crosses of the yl-stb NIL with marker lines C-
5052 and H-126. T-65 yl-stb BC 3 F 1 and BC 4 F 1 plants segregated
for yl-v plants with frequencies of 1.7% and 0.9%, re-
Genetics and breeding of agronomic traits 61

Table 2. Frequency of variegated yl plants in the M 1 generation of mutagen-treated T-65 yl-stb BC 3 F 1 .
M 1 generation
Strain Mutagen Treated % of % of
seeds % Normal yl-stb yl-v Total yl-stb + yl-v b
(no.) germination yl-v a
T-65 yl-stb BC 3 F 1 5-azacytidine 3,003 95.0 1,846 498 509 c 2,853 35.3 50.5
T-65 897 99.2 890 0 0 890 0.0 0.0
T-65 yl-stb BC 3 F 1 γ-irradiation 6,986 69.4 3,272 1,546 30 d 4,848 32.5 1.9
T-65 3,312 46.5 1,540 0 0 1,540 0.0 0.0
T-65 yl-stb BC 3 F 1 Control 756 93.4 468 234 4 d 706 33.7 1.7
T-65 120 96.7 116 0 0 116 0.0 0.0
a % of yl-stb + yl-v = no. of yl-stb and yl-v plants × 100/total plants observed. b % of yl-v = no. of yl-v plants × 100/no. of yl-stb and yl-v plants.
c Clear variegation. d Vague variegation.
Table 3. Frequency of occurrence of variegated yl phenotype in M 2 plants derived from yl-stb and yl-v
plants in M 1 treated with 5-azacytidine.
Transplanted Plants that M 2 generation % of
Phenotype in M 1 plants survived yl-v a
(no.) (no. and %) Normal yl-stb yl-v Total
yl-v 290 200 (69.0) 2 2,669 28 b 2,699 1.1
yl-stb 330 48 (14.8) 0 592 1 c 593 0.2
T-65 yl-stb BC 3 F 2 (control) 220 31 (14.1) 0 331 0 331 0.0
a % of yl-v = no. of yl-v plants × 100/total plants observed. b Clear variegation. c Vague variegation.
Table 4. Segregation into yl-stb and yl-v in F 2 s of crosses between T-65 yl-stb and
marker lines.
F 2 segregation % of % of
Cross combination Total (yl-stb + yl-v) yl-v a
Norm. yl-stb yl-v
T-65 yl-stb BC 3 F 2 /CI-6 152 27 0 179 15.1 0.0
A-28/T-65 yl-stb BC 4 F 2 171 103 0 274 37.6 0.0
H-126/T-65 yl-stb BC 4 F 2 196 19 65 b 280 30.0 77.4
H-138/T-65 yl-stb BC 4 F 2 152 97 0 249 39.0 0.0
T-65 yl-stb BC 3 F 1 468 234 4 c 706 33.7 1.7
T-65 yl-stb BC 4 F 1 235 114 1 c 350 32.9 0.9
a No. of yl-v plants/(total no. of yl-stb plants and yl-v plants) × 100. b Clear variegation. c Vague variegation.
spectively (Table 4). However, all the yl-v plants that appeared
in the BC 3 F 2 and BC 4 F 2 had vague variegation seen only in
the leaves. The F 2 populations from crosses between T-65 ylstb
BC 3 F 2 or BC 4 F 2 plants and marker lines, except those from
the cross H-126/T-65 yl-stb BC 4 F 2 plants, segregated into
normal and yl-stb plants. In contrast, the cross H-126/T-65 ylstb
BC 4 F 2 produced yl-v plants in addition to normal and ylstb
plants. All the yl-v plants of this cross showed clear variegations
on many leaves. The frequency of yl-v to yl plants (ylstb
and yl-v) was 77.4%, suggesting that H-126 carries a dominant
factor responsible for the variegation through
demethylation.
These results suggested that the yl-v mutant obtained in
F 2 s of the cross C-5052/H-126 may have been induced by a
transposable element and that the yl-stb phenotype was probably
controlled by the inactivation of the transposable element
through methylation.
References
Razin A, Riggs AD. 1980. DNA methylation and gene function.
Science 210:604-610.
Sundaresan V. 1996. Horizontal spread of transposon mutagenesis:
new uses for old elements. Trends Plant Sci. 1:184-190.
Walbot V. 1992. Strategies for mutagenesis and gene cloning using
transposon tagging and T-DNA insertional mutagenesis. Annu.
Rev. Plant Physiol. Plant Mol. Biol. 43:49-82.
Notes
Authors’ address: Research Institute for Bioresources, Okayama
University, Kurashiki 710-0046, Japan.
Acknowledgments: This work was supported partly by a grant-inaid
(No. 10556002) from Monbusho, Japan.
62 Advances in rice genetics

Major genes controlling spikelet number per panicle in rice
R. Mishra and M.P. Janoria
The inheritance of spikelets panicle –1 , spikelets primary branch –1 , and spikelets secondary branch –1 was studied
in the cross IR58025A/R704. The F 2
distribution for each of these characters gave a good fit with a 63 low:1 high
ratio. These results indicated that three independent loci with complete dominance were involved in each case
and that the dominant allele at each locus produced a similarly low number of spikelets without a cumulative
effect. The three characters showed a highly significant correlation with one another, indicating that the same
three loci may be involved in pleiotropic control of the three characters.
Spikelet number per panicle is important because this, together
with the number of panicles m –2 and average grain weight,
determines the grain yield potential of rice. Rice scientists have
recently focused attention on increasing the number of spikelets
panicle –1 to enhance the genetic yield potential of rice.
Thus, the new plant type of rice for the irrigated ecosystem
targets 200 to 250 grains panicle –1 (IRRI 1989), which is equal
to 235 to 295 spikelets panicle –1 at 85% filling. In contrast,
current commercial cultivars possess around 100 spikelets
panicle –1 .
Available literature on the genetics of this important determinant
of yield potential is limited and is concerned with
various estimations of quantitative genetic parameters (Janoria
et al 1991, Khaleque et al 1978, Shrivastava and Seshu 1983,
Sivasubramaniam and Madharamenon 1973).
Materials and methods
We studied the inheritance of spikelets panicle –1 from the cross
IR58025A/R704. IR58025A is a widely used IRRI-bred cytoplasmic
male sterile (CMS) line. R704 is a breeding line developed
at Indira Gandhi Agricultural University, Raipur,
Madhya Pradesh, India. Parental and F 2 populations were
grown using 20 × 20-cm spacing and 120 kg N ha –1 and 60 kg
P 2 O 5 ha –1 in soils rich in K. Spikelet counts were made on
panicles from the main culms of 10 random plants from each
parent and 104 random F 2 plants. Data were subjected to standard
statistical and genetic analysis.
Results and discussion
The F 2 distribution showed a good fit with a 63 low:1 high
ratio and an intervening break between the two classes (Table
1). The 27:9:9:9:3:3:3:1 ratio was modified into 36:1 if the
dominant alleles of all three loci produced the same phenotype
without a cumulative effect. Thus, our tentative model
assumes complete dominance for low spikelet number panicle
–1 at each of the three loci involved and that the dominant
allele at each locus produces a similar low number of spikelets
panicle –1 without a cumulative effect. Triple recessives constitute
the high spikelet number class.
We also studied the inheritance of spikelet number
primary branch –1 (PB –1 ) and spikelet number secondary
branch –1 (SB –1 ) in the same cross. In both cases, the F 2 data
showed a good fit to the 63 low:1 high ratio (Tables 2 and 3).
A close examination of the F 2 distributions for all three char-
Table 1. Distribution of spikelet number panicle –1 in parents and F 2 from the cross IR580025A/R704.
Plants with spikelet number panicle –1 (no.) χ 2
Population (63:1)
151–200 201–250 251–300 301–350 351–400 401–450 451–500
IR58025A 2 6 2 – – – – 0.09
R704 1 5 4 – – – – –
F 2 12 23 45 17 5 – 2 P>0.75
Table 2. Distribution of spikelet number primary branch –1 in parents and F 2 from the cross IR580025A/R704.
Plants with spikelet number primary branch –1 (no.)
Population χ 2
16– 18– 20– 22– 24– 26– 28– 30– 32– 34– 36– 38– (63:1)
17 19 21 23 25 27 29 31 33 35 37 39
IR58025A – 3 4 3 – – – – – – – – 0.09
R704 – – 1 3 2 3 1 – – – – – P>0.75
F 2 4 8 14 18 17 25 11 4 1 – 1 1
Genetics and breeding of agronomic traits 63

Table 3. Distribution of spikelet number secondary branch –1 in parents and F 2 from the cross IR580025A/R704.
Plants with spikelet number secondary branch –1 (no.)
Population c 2
3.21– 3.41– 3.61– 3.81– 4.01– 4.21– 4.41– 4.61– 4.81– 5.01– 5.21– (63:1)
3.40 3.60 3.80 4.00 4.20 4.40 4.60 4.80 5.00 5.20 5.40
IR58025A – – 2 4 4 – – – – – – 0.09
R704 – – 2 – 3 3 2 – – – – P>0.75
F 2 1 2 9 16 27 20 16 5 6 – 2
Table 4. Estimates of character correlation coefficients. a
Character pairs
Estimates of correlation
coefficients
Number of spikelets panicle –1 and 0.79**
number of spikelets primary branch –1
Number of spikelets panicle –1 and 0.74**
number of spikelets secondary branch –1
Number of spikelets primary branch –1 and 0.86**
number of spikelets secondary branch –1
a n = 104. ** = significant at the 1% level.
acters revealed that the three high spikelet number classes contained
the same two plants. Similarly, other individual plants
forming a class in one character showed a tendency to fall
together in the same or a neighboring class in the case of the
other two characters. These results led us to suspect possible
pleiotropic control of all three characters by the same three
gene pairs. Pleiotropy, if present, would be expected to result
in a high correlation between spikelets panicle –1 and spikelets
PB –1 , spikelets panicle –1 and spikelets SB –1 , and spikelets
PB –1 and spikelets SB –1 . Estimates of correlation coefficients
for all character pairs were highly significant (Table 4) and
support the hypothesis that the same three pairs pleiotropically
controlled the three characters.
References
IRRI (International Rice Research Institute). 1989. IRRI towards
2000 and beyond. Los Baños (Philippines): IRRI.
Janoria MP, Rhodes AM, Shrivastava MN. 1991. Determination of
characters for panicle yield in early maturing semidwarf varieties
of rice under two fertility environments. Indian J. Genet.
51:102-106.
Khaleque MA, Joarder A, Eunus AM, Islam AKMN. 1978. Nature
of gene interaction in the inheritance of yield and yield components
in some rice crosses. Oryza 5:157-172.
Shrivastava MN, Seshu DV. 1983. Combining ability for yield and
associated characters in rice. Crop Sci. 23:741-744.
Sivasubramaniam S, Madharamenon P. 1973. Combining ability in
rice. Madras Agric. J. 60:1777-1778.
Notes
Genetic relationship between red pericarp
and fertility restoration in rice
S. Leenakumari, R. Gopakumar, and G. Uma
Authors’ address: Department of Plant Breeding and Genetics, J.N.
Agricultural University, Jabalpur 482 004, India.
The frequency of restorers for wild-abortive cytoplasmic male sterile (WA CMS) lines was low among rice genotypes
with red pericarp. Progenies with dark red pericarp derived from crosses involving white-pericarp restorer
parents and red-pericarp mutants of white restorers also failed to restore the fertility of WA CMS lines completely,
indicating a possible relationship between the gene(s) for dark red pericarp (Rc) and the gene(s) for
fertility restoration (Rf). The fertility of F 2
and testcross progenies carrying the Rc gene differed from that of
crosses involving restorers with white/light red kernels. The segregating population from a cross involving the
CMS line IR58025A (white pericarp) and PTB50, which is a partial restorer for IR58025A with dark red pericarp,
deviated from the normal ratios, indicating that the Rc gene responsible for dark red pericarp interacts with the
restorer gene(s). This resulted in varied expression of fertility. Crosses involving PTB53 (Mangala Mahsuri, dark
red pericarp selection from Mahsuri) with a restorer with white pericarp also showed similar segregation.
64 Advances in rice genetics

Pericarp color is an important trait that influences the market
value of rice. Rice with white pericarp is preferred in the world
market, but rice with red pericarp is also popular in other parts
of the world. Unlike in most states of India, red rice is grown
extensively in Kerala, and this has a higher market value than
white rice. In the search among red pericarp restorers for WA
cytoplasm, the frequency of restorers among the red-pericarp
genotypes was noted to be much less than that of partial restorers
and maintainers (Leena Kumari et al 1998). Out of 60
genotypes with red/light red pericarp used for crossing with
WA CMS lines to produce 107 hybrids, only two genotypes
with light red pericarp could restore the fertility of the CMS
lines completely. The red-pericarp genotype PTB50, derived
from the cross between restorer variety IR36 and partial restorer
MO.6, as well as PTB53, which is a red-rice variant of
Mahsuri, a restorer for WA CMS lines, failed to restore the
fertility of WA CMS lines completely. Genotypes KAU9412-
8-1 and IR50138, identified as restorers for WA cytoplasm,
had light red pericarp vis-à-vis the dark red pericarp of the
other varieties. We studied the association between red pericarp
and fertility restoration in rice.
Materials and methods
The study was carried out during four seasons from the 1997
dry season to 1999 wet season at the Regional Agricultural
Research Station in Pattambi. The materials are composed of
IRRI-derived CMS line IR58025A and elite genotypes IR36,
IR1552, Mahsuri, KAU9412-8-1, PTB39, PTB46, PTB50, and
PTB53. Seeds were collected from the restored combinations
of IR58025A/IR36, IR58025A/Mahsuri, and IR58025A/KAU
9412-8-1 and from partially restored combinations of
IR58025A/PTB46, IR58025A/PTB50, and IR58025A/PTB53.
Seeds of topcross combinations were collected from
(IR58025A/PTB 39)//IR36 and (IR58025A/IR1552)//IR36.
The pollen and spikelet fertility of each plant in the F 2 and
testcross progenies and the topcross hybrids were determined.
Individual plants in the F 2 and testcross progenies were classified
into sterile, partially fertile, and fertile. The pericarp color
of filled spikelets from three panicles of each plant was observed.
Results and discussion
Segregation for pollen fertility
The pollen fertility of F 1 hybrids obtained from crossing CMS
line IR58025A with IR36, Mahsuri, and KAU9412-8-1 ranged
from 80.4% to 84.3%, while that of hybrids involving male
parents PTB46, PTB50, and PTB53 ranged from 29.0% to
34.0%. Hybrids between IR58025A and male parents such as
PTB39 and IR1552 were completely sterile (Table 1). Accordingly,
the genotypes of the parents with respect to fertility restoration
are assumed to be (Li and Yuan 1986)
r 1 r 1 r 2 r 2 R 1 R 1 R 2 R 2 R 1 R 1 r 2 r 2 /r 1 r 1 R 2 R 2
IR58025 A Mahsuri PTB46
PTB39 KAU9412-8-1 PTB50
IR1552 IR36 PTB53
Segregation for pollen fertility in the F 2 and testcross
progenies of crosses involving IR36 and Mahsuri followed
the 12:3:1 and 2:1:1 (fertile:partially fertile:sterile plants) patterns,
indicating the presence of two pairs of genes for fertility
restoration that exhibited epistasis with complete dominance.
Segregation for fertility in the F 2 and testcross progenies of
IR58025A/KAU9412-8-1 had 9:6:1 and 1:2:1, respectively.
This suggests epistasis with incomplete dominance between
the two gene pairs for fertility restoration carried by the pollen
parent KAU9412-8-1 (Table 2).
PTB46 was found to carry only one pair of genes for
fertility restoration as reflected in the segregation ratio of 3
partially fertile:1 sterile in the F 2 of the semi-restored combination
IR58025A/PTB46. Crosses involving PTB50 and
PTB53, on the other hand, gave a different segregation ratio
in the F 2 as well as in the testcross generations. The deviation
from the 3:1 ratio and the presence of completely fertile plants
in the F 2 indicate that these two genotypes carried more than
one pair of genes for fertility restoration.
Segregation for pericarp color
Fertile plants in the F 1 hybrids involving IR36, Mahsuri, and
PTB 46 had white pericarp, whereas crosses involving PTB50
and PTB53 had dark red pericarp. The F 1 progenies of the
cross with KAU9412-8-1 had light red pericarp. The F 2 progenies
of the crosses between CMS line IR58025A and IR36,
Mahsuri, and PTB46 all had white pericarp, suggesting that
both male and female parents in these crosses carried identical
gene pairs for pericarp color. Segregation for pericarp color
of the fertile and partially fertile progenies of crosses
IR58025A/KAU 9412-8-1, IR58025A/PTB50, and
IR58025A/PTB53 followed a 3:1 ratio of red (dark or light as
the case may be):white, showing that the male and female parents
in these crosses differed only with respect to one gene
pair (Table 3). Therefore, the genotypes of the parents, based
on phenotypic characteristics, are described as follows
(Takahashi 1972):
RcRc RdRd Rc s Rc s RdRd rcrc RdRd
PTB50 KAU9412-8-1 IR58025A
PTB53
IR36
PTB46
Mahsuri
Joint segregation for pollen fertility and pericarp
color
The test for independent segregation between the genes for
fertility restoration and pericarp color revealed a linkage relationship
between the two characters (Table 4). The location of
Genetics and breeding of agronomic traits 65

oth genes on the same chromosome (1, 3) also points to this
possibility. But the segregation ratio in the F 2 of crosses
IR58025A/PTB50 and IR58025A/PTB53 was found to be different
from that observed in IR58025A/KAU9412-8-1. The
fertile progenies in the F 2 were much less than the expected
number and all the fertile progenies had white pericarp. No
completely fertile dark red progenies were observed among
the segregating progenies of both hybrids, even though both
pollen parents carried the genes for dark red kernel color. This
indicated a possible interaction of the Rc genes with the genes
for fertility restoration. The presence of Rc genes in the F 2
Table 1. Pollen fertility and pericarp color of F 1 hybrids obtained
from crosses of IR58025A with some elite rice genotypes.
Hybrid combination Pollen fertility (%) Pericarp color
IR58025A/IR36 81.2 White
IR58025A/IR1552 0.0 –
IR58025A/Mahsuri 84.3 White
IR58025A/PTB39 0.0 –
IR58025A/PTB46 32.2 White
IR58025A/PTB50 34.0 Dark red
IR58025A/PTB53 29.9 Dark red
IR58025A/KAU9412-8-1 80.4 Light red
genotypes possibly inhibited the expression of one of the two
gene pairs for fertility restoration, resulting in varied expressions
of fertility and a deviation from the expected ratios.
References
Leena Kumari S, Valarmathi G, Tessy Joseph, Kanakamony MT,
Nayar NK. 1998. Rice varieties of Kerala as restorers and
maintainers for wild abortive cytoplasmic male sterile lines.
Int. Rice Res. Notes 22(2):11-12.
Li YC, Yuan LP. 1986. Genetic analysis of fertility restoration in
male sterile lines of rice. In: Rice genetics II. Manila (Philippines):
International Rice Research Institute. p 617- 632.
Takahashi M, Mori T, Kinoshita T, Mori K. 1972. Genetical studies
on rice plants. I. Genetic constitution of red colouration in
rice grains of the Indian variety Surjamukhi. Res. Bull. Univ.
Farm Hokkaido Univ. 18:47-53.
Notes
Authors’ address: Regional Agricultural Research Station, Pattambi,
Kerala 679-306, India.
Acknowledgments: The authors gratefully acknowledge ICAR for
financial assistance (in the form of ICAR CESS Fund) and
the Regional Agricultural Research Station, Pattambi, for providing
the facilities.
Table 2. Segregation for pollen fertility restoration in the F 2 and testcross progenies.
Plants Fertility class a
Cross studied Genetic χ 2 P
(no.) F PF S ratio
IR58025A/IR36 362 272 64 20 12:3:1 0.99 0.80
BC 1 126 65 30 31 2:1:1 0.14 0.99
IR58025A/Mahsuri 396 300 70 26 12:3:1 0.29 0.96
BC 1 192 93 49 50 2:1:1 0.10 0.99
IR58025A/KAU9412-8-1 460 264 166 30 9:6:1 0.40 0.93
BC 1 164 40 86 36 1:2:1 0.83 0.76
IR58025A/PTB46 402 – 296 106 3:1 0.40 0.93
BC 1 178 2 96 80 1:1 1.96 0.60
IR58025A/PTB50 384 60 240 84 9:6:1 326.7** 0.60
(1.69) b
BC 1 162 20 84 58 1:2:1 18.05** 0.96
(0.23) c
IR58025A/PTB53 484 70 320 94 9:6:1 390.9** 0.96
(0.26) b
BC 1 146 15 77 54 1:2:1 21.27** 0.80
(0.81) c
a F = fertile, PF = partially fertile, S = sterile. b χ 2 for 9:42:13. c χ 2 for 1:4:3.
Table 3. Segregation for pericarp color in the F 2 and testcross progenies of fully restored
combinations.
Plants Pericarp color a Genetic Probability
Cross studied ratio χ 2 (P)
(no.) R LR W
IR58025A/KAU9412-8-1 430 – 320 110 3:1 0.11 0.99
IR58025A/PTB50 306 216 – 90 3:1 3.17 0.30
IR58025A/PTB53 390 280 – 110 3:1 2.13 0.49
a R = dark red, LR = light red, W = white.
66 Advances in rice genetics

Table 4. Joint segregation for fertility and pericarp color in the F 2 progenies of three combinations involving IR58025A and pollen
parents KAU94-12-8-1, PTB50, and PTB53.
Plants belonging to each class a (no.)
Plants
Probability
Cross studied Fertile Partially fertile Sterile Genetic ratio χ 2 (P)
(no.)
R LR W R LR W
IR58025A/KAU9412-8-1 46 – 180 84 – 104 62 30 27:9:18:6:4 20.08 **
IR58025A/PTB50 364 – – 60 214 – 38 84 27:9:18:6:4 391.5**
9:36:6:13 1.25 ns 0.85
IR58025A/PTB53 484 – – 70 270 – 50 94 27:9:18:6:4 511.89**
9:36:6:13 0.17 ns 0.99
a R = red, LR = light red, W = white.
Genetic analysis of morphological and related
taxonomic traits in rice
Qian Qian, He Ping, Zheng Xianwu, Chen Ying, and Zhu Lihuang
A doubled-haploid (DH) population derived from anther culture of an indica-japonica F 1
hybrid from the cross
ZYQ8/JX17 was used. Quantitative trait loci (QTL) for morphological traits were investigated in 121 DH lines. Two
major QTLs for leaf hairiness (LH), three QTLs for length/width of grain (L/W), one QTL for color of hull when
heading (CHH), one QTL for hairiness of hull (HH), two QTLs for length of the first and second panicle internode
(LPI), and one major QTL and two minor QTLs for phenol reaction (PH) were detected. Four QTLs for morphological
index (MI) were also identified on chromosomes 1, 3, 4, and 6. Three of them, which were on chromosomes
1, 3, and 6, were found in the same chromosome regions where some QTLs for related taxonomic traits were
located.
Two thousand years ago, the Chinese realized that rice could
be classified into indica and japonica. Kato et al (1928) were
the first to differentiate the two types of rice into indica and
japonica. Since then, many researchers have studied the classification
and differentiation of indica/japonica. Oka (1958)
evaluated the reliability of classifying indica or japonica by
grain shape, hairiness of hull (HH), hairiness of leaf (LH), and
reaction to phenol (PH) and potassium hypochlorite. Cheng et
al (1984) found that many microdifferences exist between indica
and japonica, and formulated a method of morphological
indexing. This method for identifying multicharacters has been
widely used in classifying indica or japonica and in hybrid
breeding between subspecies because it is simple, rapid, and
reliable (Zhou et al 1988).
Because the morphological indices and related taxonomic
traits were studied as a whole in this method, it was difficult to
identify the effect of a single gene and chromosome region
related to the gene by using the traditional genetic method,
and even more difficult to locate the accurate position of the
related loci on the chromosome. To find the molecular basis
for classifying indica/japonica, a doubled-haploid (DH) population
derived from anther culture of ZYQ 8/JX 17, a typical
indica and japonica hybrid, and its molecular linkage map were
used in genetic analysis and QTL location for morphological
and related taxonomic traits.
Materials and methods
A typical indica variety (ZYQ 8) and a typical japonica variety
(JX 17) were used as parents for crossing. More than 150
pure DH lines were obtained after anther culture of F 1 hybrids.
Of these, 121 were selected for study.
The experiment was conducted on the farm of Academia
Sinica, Beijing. For each DH line, two rows with 20 plants
each were sown, and one row for each parent was planted as a
check for every 10 lines. According to Wang et al (1987), leaf
hairiness, hairiness of hull, color of hull when heading (CHH),
length of the first and second panicle internode (LPI), and
length/width of grain (L/W) were recorded in the field and
phenol reaction was determined in the laboratory. The traits
were evaluated and calculated according to a 0–4 scale.
Based on the constructed linkage map of the DH population,
interval QTL mapping was used to analyze the QTLs
for morphological index (MI), LH, CHH, LPI, L/W, and PH
by using the software Mapmaker/QTL. The presence of QTLs
was determined with a threshold LOD score of 2.0. The varia-
Genetics and breeding of agronomic traits 67

Table 1. QTLs a for morphological index and six taxonomic traits.
Traits Locus Chromosome Marker LOD Variation Additive
interval score (%) effect
Morphological qMI-1 1 CT380A-GA594 5.05 19.8 3.40
index qMI-3 3 C746-GA505 2.21 10.2 2.44
qMI-4 4 C513-G271 2.16 13.4 2.86
qMI-6 6 G1314B-GA216 3.74 17.1 3.16
Leaf hairiness qLH-6a 6 G1314B-K9D2D7D 20.38 40.0 3.26
qLH-6b 6 K9D2D7D-GA216 33.83 58.2 3.56
Color of hull qCHH-1 1 GA594-R210 4.95 18.2 0.92
when heading
Hairiness of hull QHH-6 6 RG433-G342 2.15 14.5 –0.67
Length of the first and qLPI-1 1 RG541-RG101 2.76 10.2 0.62
second panicle internode qLPI-3 3 C746-CA5 3.11 16.4 0.79
qLWR-1 1 R210-CT44 2.61 9.7 0.54
Length/width of grain qLWR-2 2 GA120-G35 4.61 18.3 0.74
qLWR-3 3 C63-CT125 3.65 13.4 0.64
Phenol reaction qPH-1 1 R210-CT441 3.51 14.9 1.41
qPH-4a 4 G177-CT206 37.63 94.6 3.54
qPH-4b 4 CT404-CT500 7.65 29.5 1.98
a QTL nomenclature followed that of McCouch et al (1997).
tion and additive effect of each QTL for relative characters
were also calculated. QTL nomenclature followed that of
McCouch et al (1997).
Results and discussion
Performance of Cheng’s index and taxonomic traits
in the DH population
ZYQ 8 and JX 17 are popular in South and North China. According
to Cheng’s index and its related taxonomic traits, the
female parent ZYQ 8 is a typical indica variety with an index
of 4, whereas the male parent JX 17 is a typical japonica variety
with an index of 21. The morphological indices of 121 DH
lines fell in a normal distribution. The indica (index: 4–8) and
japonica lines (index: 18–22) both accounted for 14%, indicacline
(index: 9–13) and japonica-cline (index: 14–17) lines
accounted for 38% and 33.9%, respectively. The distribution
of CHH, LPI, and L/W was continuous, with several transgressive
types for every characteristic, whereas LH, HH, and
PH showed a bimodal distribution.
QTL detection
A rice restriction fragment length polymorphism (RFLP) linkage
map was constructed by using this DH population; 243
markers were evenly distributed over all 12 rice chromosomes.
Table 1 shows the results of QTL detection of morphological
and related taxonomic traits from 121 DH lines. Two major
QTLs for LH were found on chromosome 6, accounting for
40.0% and 58.2% variation. One QTL for CHH (qCHH-1)
explaining 18.2% of the variation and positive additive effects
was located on chromosome 1. One QTL (qHH-6) for HH
explaining 14.5% of the variation and negative additive effects
from ZYQ 8 was identified on chromosome 6. Three
QTLs (qLWR-1, qLWR-2, and qLWR-3) for L/W were located
on chromosomes 1, 2, and 3, respectively. For PH, one
major QTL (qPH-4a) on chromosome 4 and two minor QTLs
(qPH-1 and qPH-4b) on chromosomes l and 4, respectively,
were identified. They all explained positive additive effects.
The major QTL qPH-4a, located on chromosome 4, explained
a high variation of 94.6%. Two other QTLs (qPH-1 and qPH-
4b) located on chromosomes 1 and 4, respectively, explained
14.9% and 29.5%. Four QTLs for MI, explaining 60.5% of
the variation and positive additive effects from JX 17, were
identified on chromosomes 1, 3, 4, and 6.
QTLs qMI-1, qPH-1, qL/W-1, and qCHH-1 were almost
in the same region on chromosome 1; qMI-3 and qLPI-3 were
in the same region on chromosome 3; and qMI-6 and qLH-6b
were also in the same region on chromosome 6.
Results showed that heredity concerned with the classification
of indica or japonica was mainly controlled by minor
genes. Four QTLs for Cheng’s index located in this study were
distributed on four different chromosomes. They were all related
to some QTLs for taxonomic traits.
In this study, two major genes for LH were adjacent on
chromosome 6. Kinoshita and Takahashi (1968) found that two
dominant genes controlled LH. HL-a was located on chromosome
6 using the marker gene method. PH has a bimodal distribution
and a major gene was located on chromosome 4.
Another two minor genes for PH with a LOD score of 7.65 on
chromosome 4 and 3.51 on chromosome 1 were also detected.
Except for the related taxonomic traits of Cheng’s index,
significant differences in other traits exist between indica
and japonica. By using a DH population, Qian et al (1999)
located the QTLs for cold tolerance. A minor gene related to
green plantlet differentiation frequency and green plantlet yield
frequency was in the same interval of RG541-RG101 on chromosome
1 as the minor gene for LPI. A minor gene for callus
induction frequency, a minor gene for Cheng’s index, and two
68 Advances in rice genetics

major genes for LH were all in the same or adjacent interval
of G1314B-K9D2D7D on chromosome 6. Among the four
QTLs, one was in the interval of C63-CT125 on chromosome
3 as was the QTL for L/W. The other three were tightly linked
with the QTL for LPI on chromosome 1, for L/W on chromosome
2, and for Cheng’s index on chromosome 4 (Qian et al
1999). Anther culture response and cold tolerance were also
related to the differentiation of indica or japonica.
References
Cheng KS, Zhou JW, Lu YX, Luo J, Hang NW, Liu GR. 1984. Studies
on the indigenous rice in Yunnan and their utilization: a
revised classification of Asian culture rice. Acta Agron. Sin.
10(4):271-280.
Kato S, Kosaka H, Hara S. 1928. On the affinity of rice varieties as
shown by fertility of hybrid plants. Rep. Bull. Sci. Fac. Agric.
Kyushu Univ. 3:132-147(J).
Kinoshita T, Takahashi M. 1968. A supplementary report on genes
responsible for pubescence of glumes and leaves in rice plants.
XXXII Memoirs Fac. Agric. Hokkaido Univ. 6:364-370(J).
McCouch SR, Cho YG, Yano M, Paul E, Blinstrub M, Morishima
H, Kinoshita T. 1997. Report on QTL nomenclature. Rice
Genet. Newsl. 14:11-13.
Oka HI. 1958. Variation and classification of cultivated rice. Ind. J.
Genet. Plant Breed. 18:79-89.
Qian Q, Zeng DL, He P, Zheng XW, Chen Y, Zhu LH. 1999. The
QTL analysis of seedling cold tolerance in a double haploid
population derived from anther culture of hybrid of indica/
japonica. Chin. Sci. Bull. 44(22):2402-2407.
Wang XK, Cheng KS, Wang NW, Luo J, Lu YX, Liu GR. 1987.
Study on two important rice types concerning the origin and
differentiation of Asian cultivated rice. Acta Genet. Sin.
14(4):262-270.
Zhou H, Glaszmann JC, Cheng KS, Shi XQ. 1988. A comparison of
methods in classification of cultivated rice. Chin. J. Rice Sci.
2(1):1-7.
Notes
Authors’ addresses: Qian Qian, He Ping, Zheng Xianwu, Chen Ying,
and Zhu Lihuang, Institute of Genetics, Chinese Academy of
Sciences, Beijing 100101; Qian Qian, China National Rice
Research Institute, Hangzhou 310006, China.
Performance of backcrossed doubled-haploid lines of rice
under contrasting moisture regimes: root system and grain
yield components
M. Toorchi, H.E. Shashidhar, and S. Hittalmani
BC 1
F 1
plants involving nine transgressant doubled-haploid lines from an IR64 × Azucena mapping population
along with parents and checks were evaluated for root morphology and yield-related characters under contrasting
moisture regimes. True backcrossed plants were identified using RAPD markers. Marked genotypic differences
were observed across three samplings by individual as well as combined ANOVA. Significant G × E
interaction was observed for the traits studied. In sampling at 80 d after sowing and at harvest, root-to-shoot dry
weight ratio exhibited a significant increase under severe low-moisture stress conditions. Grain yield showed the
most reduction (28%) under severe stress conditions. Multiple regression revealed total dry weight to be the
most significant variable under well-watered conditions, explaining up to 30% of the variability in grain yield,
whereas, under severe stress conditions, root dry weight explained 20% of the variability in grain yield. The
influence of the root system on grain yield was quantified using canonical correlation. Among the nine backcrosses
studied, P331 × IR64 and P124 × IR64 were selected to identify near-isogenic lines (NILs) for finemapping
of QTLs for root morphological characters. Selection for developing NILs was based on performance of
the backcrosses in terms of maximum root length and grain yield under both well-watered and low-moisture
stress conditions.
Root morphology and stress-induced response form important
components of drought tolerance in rice. Among root traits,
maximum root length, root diameter, and root-to-shoot dry
weight ratio were found to be associated with drought tolerance
in upland conditions (O’Toole and Soemartono 1981).
Shoot growth has been shown to be more inhibited than root
growth when soil water was limiting. This differential response/
sensitivity of root and shoot growth to low water potential has
been considered as a means of avoiding excessive dehydration
(Hemamalini et al 2000). Increased root:shoot ratio and
high total root length enable plants to maintain relatively high
water uptake (rates) under water-stress conditions.
Despite ample genetic variation for many root-related
parameters, genetic improvement of root characteristics in rice
using conventional selection has been difficult (Ekanayake et
al 1985). Molecular markers have enabled the dissection of
complex traits. As a prelude to developing near-isogenic lines
(NILs) for specific components of root morphological traits
Genetics and breeding of agronomic traits 69

in rice and to assessing their effects on grain yield (GY) and
its components, we produced nine backcross populations involving
doubled-haploid (DH) lines. The objectives were to
quantify root morphological characters and their influence on
GY components at three developmental stages involving lowmoisture
stress during the peak vegetative stage.
Materials and methods
Five deep-rooted and four shallow-rooted transgressant lines
chosen from the DH mapping population of IR64/Azucena
were backcrossed to IR64. The nine BC 1 F 1 s, their parents (nine
DH lines and IR64), Azucena, Moroberekan, IR20, CO39, and
Jaya constituted the materials for this study. To identify true
backcrosses, DNA from the parents and all BC 1 F 1 plants was
extracted using the miniprep protocol.
Twenty-four genotypes were grown in 1-m-long polyvinyl
chloride cylinders in a randomized complete block design
with 10 replications. Two moisture regimes—well-watered
(WW) and severe stress (SS)—were imposed. In the WW condition,
all the entries were watered daily throughout the cropping
period. In the SS treatment, moisture stress was imposed
from 65 d after sowing (DAS) up to 80 DAS by withholding
irrigation and preventing rainwater using a rainout shelter.
Sampling in both WW and SS conditions was done at three
stages: (1) at 65 DAS (before imposition of stress) for two
randomly selected replications, (2) at 80 DAS (when stress
was relieved) for four randomly selected replications, and (3)
at maturity for the remaining four replications.
Observations comprised maximum root length (MRL)
in cm, number of roots (RN), root dry weight (RDW) in g,
shoot dry weight (SDW) in g, root:shoot dry weight ratio
(RDW/SDW), and total dry weight (RDW + SDW; TDW) in
g. Further, root volume in cc (RV), root thickness at the crown
region measured in mm (RT), and root:shoot length ratio (MRL/
PH) were computed at the third sampling. At harvest, observations
on grain yield plant –1 (GY), panicle length in cm (PL),
panicle number (PN), tiller number (TN), 200-seed weight in
g (SW), plant height in cm (PH), days to 50% flowering (DF),
chaffiness percent (Ch), and harvest index percent (HI) were
recorded or computed.
Individual and combined ANOVA over two moisture
regimes using SAS (SAS Institute, Inc. 1989) was done.
Stepwise multiple linear regression and canonical correlation
for root and yield-related characters considered as two sets of
variables were computed using PROC REG and PROC
CANCORR, respectively.
Results and discussion
Random amplified polymorphic DNA (RAPD) markers were
used for distinguishing true BC 1 F 1 plants based on male-specific
bands. Highly significant genotypic differences were observed
for all the characters across samplings. In the 80 DAS
sampling, RDW, SDW, and TDW were significantly reduced
for SS compared with WW, whereas MRL and RN remained
unchanged and the RDW/SDW ratio increased from 0.82
(WW) to 1.01 (SS). Under stress, Sharp et al (1988) reported
a greater reduction in SDW than in RDW as well as an increase
in the RDW/SDW ratio in maize. At 80 DAS, backcrosses
involving P192, P210, P331, and P124 showed a significant
increase in RDW under SS. Not all of these showed
significant reductions in SDW, although the most interesting
seem to be the backcrosses involving P331 and P124.
In the sampling done at maturity, mean values for all the
characters except RN and SDW increased significantly from
WW to SS conditions. The differential increase in RDW was
probably due to the effect of the enhanced rate of root elongation
on alleviating stress 80 DAS. Backcrosses involving P331
and P333 showed significant increases in RDW and RDW/
SDW under stress. Neither of these or the backcross involving
P124 showed a significant reduction in SDW. This showed
that an increase in RDW, rather than a reduction in SDW, contributes
mainly to increasing RDW/SDW. The mean values of
GY, PN, SW, PH, and HI decreased significantly under SS
conditions. However, DF and Ch showed an opposite trend
and contributed to a GY reduction. GY showed its maximum
reduction (25.9%) under SS, signifying the cumulative influence
of other traits. Ribaut et al (1997) observed marked reductions
in the F 3 family mean for yield-related traits from
WW to SS conditions in maize.
MRL was significantly and positively correlated with
PL and PH, and negatively correlated with PN and TN under
both WW and SS conditions. Traits related to an increase in
length (PH, PL, and MRL) seem to be correlated positively to
one another, suggesting a common control of events related to
cell division and elongation. The multiple regression approach
showed that, under WW conditions, TDW was the most significant
variable, explaining about 30% of the variability in
GY, followed by RN (17%) and MRL/PH (7%). These three
characters together explain about 53% of the variability in GY.
A virtually similar trend was observed under SS conditions, in
which RDW as one component of TDW explains 20% of the
variability in GY, followed by RN (8%); together, these two
explain about 28% of the variability. Mugo et al (1999) suggested
that no secondary trait appeared to confer a high level
of drought tolerance on its own and that a combination of
multiple drought-adaptive traits through a suitable index would
be most effective in a breeding program.
Four out of the nine possible canonical correlations between
the dependent (yield components) and independent (rootrelated
characters) set of variables were statistically significant.
The standardized canonical coefficients for the criterion
variables suggested that the variables GY, PH, and HI were
more influential in forming the first canonical variate. Standardized
canonical coefficients based on X variables have given
a greater and equal weight, but in a reciprocal direction, to
both MRL and MRL/PH variables in the formation of the first
and second canonical variates. The loadings for the Y variables
showed that PH and TN were the most influential variables
in forming the first and second canonical variates, respectively.
The structural correlations for the X variables
70 Advances in rice genetics

Standardized grain yield
A
3
P210 ´ IR64 P124 ´ IR64
2
P333 ´ IR64
1
P331 ´ IR64
0
–2.0 –1.5 –1.0 –0.5 0 0.5 1.0 1.5
P442 ´ IR64
P107 ´ IR64 –1
P163 ´ IR64
P467 ´ IR64 –2
P192 ´ IR64
–3
Standardized maximum root length
3.5
3.0
2.5
2.0
1.5
1.0
0.5
P163 ´ IR64
0.0
–0.5
P210 ´ IR64
P333 ´ IR64–1.0
P192 ´ IR64 –1.5
–2.0
B
P331 ´ IR64
P442 ´ IR64
P124 ´ IR64
–2.0 –1.5 –1.0 –0.5 0 0.5 1.0 2.5
1.5 2.0
P107 ´ IR64
P487 ´ IR64
Standardized maximum root length
Fig. 1. The z value of grain yield and maximum root length of nine transgressant backcrosses involving doubledhaploid
lines and IR64 under (A) well-watered and (B) severe water-stress conditions.
Standardized grain yield
showed SDW as the most important variable in forming both
the first and second canonical variates, which were followed
by both MRL and TDW in the case of the first and only TDW
in the case of the second canonical variate. Consequently, the
first canonical variate for Y variables represented GY obtained
mainly from PH. Similarly, based on the canonical coefficients
and loadings of the predictor variables, SDW was the most
influential variable in forming the first and second canonical
variates.
In conclusion, the mean values of MRL and GY were
converted to z values for comparison (Fig. 1). The two backcrosses
involving DH lines P124 and P331 fall in positive coordinates
and showed an advantage in grain yield as well as
MRL under both WW and SS conditions (Fig. 1). P331, a longrooted
DH line, maintained its ability to tolerate drought even
after crossing with IR64 in such a way that its MRL increased
relatively with a GY similar to that under WW conditions.
However, the backcross P124 × IR64 was stable under both
conditions. These two crosses seem to be important for studying
drought tolerance and grain yield.
References
Ekanayake IJ, O’Toole JC, Garrity DP, Masajo TN. 1985. Inheritance
of root characters in rice and their relation to drought
resistance in rice. Crop Sci. 25:927-933.
Hemamalini GS, Shashidhar HE, Hittalmani S. 2000. Molecular
marker-assisted tagging of morphological and physiological
traits under two contrasting moisture regimes at peak vegetative
stage in rice (Oryza sativa L.). Euphytica 112:69-78.
Mugo SN, Banziger M, Edmeades GO. 1999. Prospects of using
ABA in selection for drought tolerance in cereal crops. In:
Molecular approaches for the genetic improvement of cereals
for stable production in water-limited environments. International
workshop, June 1999, CIMMYT, Mexico.
O’Toole JC, Soemartono. 1981. Evaluation of a simple technique
for characterizing rice root systems in relation to drought resistance.
Euphytica 30:283-290.
Ribaut JM, Jiang C, Gonzales de Leon D, Edmeades GO, Hoisington
DA. 1997. Identification of quantitative trait loci under drought
conditions in tropical maize. 2. Yield components and markerassisted
selection strategies. Theor. Appl. Genet. 94:887-896.
SAS Institute. 1989. SAS/STAT user’s guide: version 6, Vol. 2, 4th
ed. Cary, N.C. (USA): SAS Institute Inc.
Sharp RE, Silk WK, Hsiao TC. 1988. Growth of the maize primary
root at low water potentials. I. Spatial distribution of expansive
growth. Plant Physiol. 87:50-57.
Notes
Authors’ addresses: M. Toorchi, H.E. Shashidhar, Department of
Genetics and Plant Breeding, College of Agriculture, University
of Agricultural Sciences, GKVK, Bangalore, 560 065,
India; S. Hittalmani, Department of Agronomy, Faculty of
Agriculture, Tabriz University, Tabriz, Iran; E-
mail:maslab@satyam.net.in.
Genetics and breeding of agronomic traits 71

Developmental genetics of internodal elongation
in floating rice
T. Jishi and Y. Sano
The most distinct feature of floating rice is its ability to elongate in response to flooding. To examine this trait’s
genetic basis, a floating rice, Habiganj Deepwater 8 from Bangladesh, was investigated. We previously introduced
dw3 from deepwater-tolerant wild rice into an intolerant line by backcrosses. The near-isogenic line with
dw3 (T65dw3) revealed that dw3 enables intolerant plants to elongate their internodes in response to submergence,
allowing them to survive under deepwater conditions, although multigenic control of internode elongation
had been assumed. T65dw3/HD8 F 1
was backcrossed with T65dw3 and we selected a line (BC 2
F 3
) that showed
elongation at an early stage under nonsubmerged conditions. The trait was found to be controlled by a dominant
gene. When grown under submerged conditions, the line showed internode elongation at an earlier stage as well
as a higher rate of elongation than did T65dw3. Histological observations revealed that the line formed intercalary
meristems in the lower internodes from the base, suggesting that the developmental stages in the formation
of intercalary meristems play a significant role in establishing floating ability.
Although the genetic basis of floating ability might be complex
(Morishima et al 1962), physiological studies of deepwater
tolerance showed that enhanced internode elongation might
result from the action of plant hormones as well as expansion
(Raskin and Kende 1984, Cho and Kende 1997). We successfully
introduced dw3 from deepwater-tolerant wild rice into
intolerant line T65 (japonica type) by backcrosses (Eiguchi et
al 1993). The resultant near-isogenic line (NIL) with dw3
(T65dw3) survived under deepwater conditions, showing that
elongation is suppressed in the intolerant line. In most grass
species, internodal elongation is driven by cell division and
cell elongation in intercalary meristems (IM) and cell maturation
within the internode is basipetal. This paper shows that
developmental stages in the formation of IM also play a significant
role in conferring floating ability.
Floating ability in rice cultivar Habiganj Deepwater 8
A deepwater rice, Habiganj Deepwater 8 (HD8 from
Bangladesh), showed vigorous growth in comparison with
T65dw3 under 2-m deepwater conditions. This means that a
high degree of floating ability is achieved not only by dw3.
HD8 carried dw3 since all F 2 plants of T65dw3/HD8 survived
under submerged conditions, suggesting that HD8 might carry
additional genes for floating ability. As reported by Inouye
and Hagiwara (1981), even under air-grown conditions, HD8
showed internode elongation earlier (the 7th or 8th internode
from the base) than nondeepwater line T65.
To examine genes for early elongation, T65dw3/HD8
F 1 was backcrossed with T65dw3. A true-breeding line showing
early elongated internode (EEI) was selected from BC 2 F 3 .
EEI as well as HD8 showed internode elongation before floral
initiation under air-grown conditions, whereas T65dw3 and
T65 did not until floral initiation (Fig. 1A). The lowest posi-
A
10th
9th
8th
10th
9th
10th
9th
B
10th
HD8 EEI T65dw3 T65 EEI T65dw3
Fig. 1. (A) The positions of elongated internodes in four strains—
HD8, EEI, T65dw3, and T65—at 10.5-leaf age under air-grown conditions.
(B) The lowest position of the intercalary meristem (shown
by arrows) formed in EEI and T65dw3. The region of the intercalary
meristem was estimated from frequent cell divisions. Bars
show 2.0 cm (A) and 1.0 mm (B), respectively.
9th
72 Advances in rice genetics

tion of the elongated internodes was compared among the four
lines under submerged and air-grown conditions (Table 1). The
plants underwent 4-wk submergence from 5 wk after germination.
Elongated internodes were defined in this experiment as
those longer than 5 mm in length. The results showed that the
9th internode from the base elongated in EEI, while the 11th
or 12th internode did so in the recurrent parent (T65dw3). In
contrast, the 7th or 8th internode elongated in HD8, suggesting
a higher degree of floating ability. Elongated internodes
were also observed at maturity without submerged treatments.
EEI and HD8 showed elongation in the lower positions under
submerged conditions, but no difference was detected in
T65dw3.
Histological observations of intercalary meristems
In most grass species, elongation of the internode is a result of
the activity of an IM in which cell division and cell elongation
occur. Information is limited regarding how the initiation of
the IM varies with genotype in rice. Since the formation of the
IM is a prerequisite to elongation, the lowest internode with
the IM was examined in the NIL and the parents. Tissues containing
young internodes were sampled at various stages, fixed
in formalin acetic acid (FAA), sectioned longitudinally, and
stained by toluidine blue. EEI and HD8 formed the IM in lower
internodes than in T65dw3 and T65, showing a similar tendency
to achieve the lowest position of elongated internode
Table 1. The lowest position of elongated internode and the formation
of intercalary meristem on the main culm in the NILs and the
parents. a
Strain
Elongated internode
Submerged
Air-grown
Intercalary meristem
T65 Not elongated 11.9 ± 0.1 11.0 ± 0.0
T65dw3 11.3 ± 0.5 11.5 ± 0.3 10.5 ± 0.6
EEI 9.0 ± 0.0 10.7 ± 0.5 9.0 ± 0.0
HD8 7.8 ± 0.2 9.0 ± 0.0 8.3 ± 0.5
a More than five plants were examined in each treatment. The position of internodes
was counted from the base. Plants underwent submergence (50 cm) in a deepwater
tank from 5 to 9 wk after germination. Average of water temperatures was about 20
°C. Elongated internodes were examined at maturity under air-grown conditions.
under submerged conditions (Table 1). This indicated that a
response to submergence at an earlier stage in EEI resulted
from the formation of the IM at an earlier stage.
The genetic base for early elongated internode
EEI was expected to carry an additional gene(s) that caused
elongated internodes in response to submergence at an earlier
stage than did T65dw3 and T65. Segregation patterns were
investigated in a 50-cm deepwater tank. When 52 F 2 plants of
EEI/T65dw3 underwent submergence, 45 had the 9th or 10th
internode elongated, whereas the rest had the 11th internode
elongated (Table 2). Since T65dw3 had an elongated 11th internode,
the early elongated internode seemed to be simply
inherited at a 3:1 ratio. In contrast, F 2 plants of EEI/T65 had a
ratio of 9:6:1, including plants such as T65. This implied that
two dominant genes acting additively were involved and one
of them was dw3. The study also indicated that developmental
stages in the formation of the IM play a significant role in
attaining floating ability as well as regulating biochemical processes
during internode elongation.
References
Cho H-T, Kende H. 1997. Expression of expansion genes is correlated
with growth in deepwater rice. Plant Cell 9:1661-1671.
Eiguchi M, Sano R, Hirano H-Y, Sano Y. 1993. Genetic and developmental
bases for phenotypic plasticity in deepwater rice. J.
Hered. 84:201-205.
Inouye J, Hagiwara T. 1981. Effects of some environmental factors
on the position of the lowest elongated internode of three floating
rice varieties. Jpn. J. Trop. Agric. 25:115-121.
Morishima H, Hinata K, Oka HI. 1962. Floating ability and drought
resistance in wild and cultivated species of rice. Indian J.
Genet. Plant Breed. 22:1-11.
Raskin I, Kende H. 1984. Role of gibberellin in the growth response
of submerged deep water rice. Plant Physiol. 76:947-950.
Notes
Authors’ address: Faculty of Agriculture, Hokkaido University,
Sapporo 060-8589, Japan.
Table 2. Segregation for the lowest position of elongated internode (LPEI) under submerged
conditions in F 2 populations of two crosses between EEI and T65dw3. a
Cross Segregation for LPEI Fitness
9th– 11th Not No. of Ratio df c 2
10th elongated plants
EEI × T65 34 20 3 57 9:6:1 2 0.29 ns b
EEI × T65dw3 (parents) 45 7 – 52 3:1 1 3.69 ns b
EEI 4 – – 4
T65dw3 – 4 – 4
T65 – – 4 4
a All ns plants underwent submergence (50 cm deep) for 2 wk from about 8.5-leaf age. b ns = not significant.
Genetics and breeding of agronomic traits 73

Genetic divergence in photoperiod-insensitive autumn rice
germplasm of northeast India
R.P. Borkakati, P. Borah, and P.C. Deka
Two hundred eight photoperiod-insensitive rice genotypes consisting of indigenous rice germplasm of northeast
India and a few improved varieties were raised as transplanted autumn rice under irrigated conditions during the
1998 dry season. Genetic divergence among the genotypes was analyzed using Mahalanobis’s D 2 statistic.
Genotypes were grouped into clusters following Tocher’s method. Differences among the genotypes were significant
for all seven characters studied. The wide range of D 2 values indicated the presence of enormous diversity
in the material studied. Based on genetic distances, the 208 genotypes were grouped into 11 clusters. The
pattern of distribution of genotypes was independent of geographical isolation. An analysis of the contribution of
different characters revealed that 100-grain weight and yield per plant contributed the highest to total divergence.
The intracluster distance varied from 1.26 (cluster III) to 2.39 (cluster VII). Maximum intercluster divergence
was observed between genotypes As 180/2 and Sattari. Cluster X showed a higher magnitude of intercluster
distance with other clusters. Clusters VI and X showed the highest divergence. Considerable variation was
observed among the cluster means for various characters. Results indicated that intercrossing of genotypes from
clusters I, V, VI, VII, IX, and X showing a good mean performance may help to select early maturing, dwarf, and
high-yielding recombinants for developing rice varieties for the autumn season.
Rice is the principal field crop of northeast India. The indigenous
rice in the region is rich in genetic diversity. However,
there are few high-yielding autumn rice varieties in the region.
Hence, it is necessary to screen the available germplasm to
identify suitable parents for use in hybridization to develop
better varieties of transplanted autumn rice, thus increasing
cropping intensity and raising productivity in the region. Das
et al (1981) evaluated some traditional and modern ahu varieties
and grouped them according to categorization of characters
into low, intermediate, and high levels. It is important to
evaluate the available ahu rice germplasm collected from different
states of northeast India since it has been maintained for
a long time and is a source of valuable breeding material. This
study was undertaken to evaluate 208 photoperiod-insensitive
rice genotypes for genetic divergence.
Materials and methods
The 208 photoperiod-insensitive rice genotypes consisted of
indigenous and improved varieties of northeast India that were
classified as ahu (autumn rice). Seeds of the entries were grown
in nursery beds during the 1998 dry season and transplanted in
5-row plots. The experiment was laid out in a randomized block
design with two replications. Observations on days to flowering,
days to maturity, plant height, panicle length, panicle number,
100-grain weight, and yield per plant were recorded. Five
randomly selected plants per plot excluding border rows were
used to record the observations. Analysis of variance (ANOVA)
was performed for seven characters studied. The analysis of
genetic divergence was determined by Mahalanobis’s D 2 statistic
as described by Rao (1952). Based on genetic distance,
the genotypes were grouped into 11 clusters according to
Tocher’s method.
Results and discussion
The 208 genotypes used originated from various agroclimatic
zones of Assam and other states of northeast India as well as
improved genotypes from different parts of India, China, and
the Philippines. Of these, 159 stocks were traditional photoperiod-insensitive
varieties and 11 genotypes were traditionaltype
improved varieties developed through pure-line selection.
Thirty-eight genotypes were improved varieties with modern
plant type, which included Lachit, Chilarai, Rongdoi, and
Madhab developed for Assam.
The ANOVA revealed highly significant differences
among the genotypes for all the characters, indicating genetic
diversity among the genotypes used (Table 1). Maximum variability
was observed for panicle number (39.2%), followed by
yield per plant (34.0%). The character days to maturity (8.4%)
was found to be the least variable.
The 208 genotypes used in this study were grouped into
11 clusters (Table 2). The wide range of D 2 values (0.34 to
3,840.06) revealed the presence of enormous genetic diversity
in the genotypes. Cluster III was the largest, with 51 genotypes,
followed by cluster VIII. The genotypes of cluster I were
found to be the earliest, which included both traditional and
improved varieties. Cluster VII had eight genotypes, two improved
traditional types, and one improved variety, Jaya. Yield
per plant was found to be the highest among all the clusters.
Developed varieties with dwarf stature were mostly included
in cluster IX. Cluster X had eight genotypes that were of the
late type and had the longest panicles. The pattern of distribution
of genotypes into different clusters was independent of
geographical isolation. Similar results of genetic diversity and
geographical distribution were reported for brown planthopper
resistance (Rao et al 1981) and for yield components (Vairavan
74 Advances in rice genetics

Table 1. Analysis of variance and phenotypic coefficient of variation (PCV) for seven
characters.
Character
Sources of variation a
Replication (1) Genotype (107) Error (107) PCV (%)
Days to flowering 143.25 165.02** 8.21 10.07
Days to maturity 1,267.00 198.94** 9.83 8.39
Plant height 10.00 894.39** 56.57 18.97
Panicle length 4.78 12.60** 7.34 14.27
Panicle number 129.95 23.83** 16.26 39.21
100-grain weight 2.59 0.20** 0.10 19.36
Yield plant –1 6.47 33.15** 0.22 34.04
a ** = significant at P = 0.01. Numbers in parentheses are degrees of freedom.
Table 2. Distribution of 208 photoperiod-insensitive rice genotypes in different clusters.
Cluster Number of Genotypes
genotypes
I 14 As 313, Kathiamaya ahu, As 208, Manipuri Dumai, As 320, Koniahu, Rongadoria, Kosamoni,
Lakhi, Kanua, IET 7511, Bala, Sattari, IET 9217
II 10 Basantbahar, Majenichembi, Morenchemkol, Naga ahu, Saraituni, Soruranga ahu, As 491,
Maibee, Begunbichi, Dimararu
III 51 Ulka ahu, As 180, As 47, As 305, As 36/20, Herapoa ahu 1, Guniahu 2, As 1866-67, As
36/30, Kajoli ahu 1, As 327, As 326, As 323, As 317, Sariahdooli, As 329, Ahu 2, As 66/
67, Ac 313/11, Dubaichenga, Rangadoria 2, As 56/21, Kajoliahu, Poroma ahu, Malbhog
ahu, Nenow ahu, Bengenagutia ahu, Kola Bengenagutia ahu, Raja ahu, Soru Kolameghi,
Borkola ahu 1, Bahmori ahu, Garem ahu 2, Ikoraguni, Meghi ahu, Herapoa ahu, Kehong
ahu, Borkola ahu 2, Tinimohia ahu, Sarimohia ahu, Koijapori, Nilaji 1, Ch 63, Chapali,
Gunidhan, Rikhojoi 1, Nilaji -2, Rangajuli, Bangaloni Tezpur, Dagaranga, Jubali
IV 14 Aijuri, IR36, IR56, HFC Jorhat, Duhiguni, Govind, IET 6148, Ratna, Chilarai, Rongdoi, Madhab,
IR60, NR 166, NR 162
V 24 As 36, As 1195, As 314, As 325, As 324, Gunidhan, As 330, As 69-70, Kolagoria ahu,
Goalbhog, Garupetia ahu, Kola ahu, Soholia ahu, Bengali ahu, Kola meghi, Rikhojoi ahu,
Boga bengenagutia, Gubar guni, Koijapori 2, Koijapori 3, Rikhojoi 2, Pusa 2-21, Ikora guni
Jorhat, Kolamanik
VI 12 As 310, As 206, As 178/3, As 1196, As 289, As 36/14, Rongadoria 1, Guniahu 1, As 305/
2, 64-65, Guniahu, Kalinga III
VII 8 Fapori 3, Ahu 1, Fapori 1, As 292, As 328, As 180/2, Sarimohia ahu 2, Jaya
VIII 32 As 90, As 312, As 315, As 321, As777 21 C, As 36/13, As 180/4, As 195, Bangaloni, 69-
70, 64-65(ahu 5), Bangaloni 3, Bairing, Bijor 1, Bijor 2, Chidon, Chenga ahu, Cheni ahu,
Bilcha ahu, Begunbishi 1, Iharsal ahu, Bongal dhari, Rongadoria, Hafa, Panjasali ahu,
Boga ahu, Ahu joha, Ranga ahu, Rangajira ahu, Bogibor ahu, Laujuli, Roso
IX 21 Cauvery, Krishna, Kanchi, As 490, As 192, As 489, IR58, IR9729-673, Jaibungla, Area old
seed, Hasakumura, AD 8500, Pusa 593, Pusa 677, IET 6223, IET 3629, Rasi, Subhadra,
Lachit, IR50, Kalinga II
X 8 Bijor 3, Podumonimahu, IR26, IR46, IR10781-143-2-3, IR30, IR8, Therru
XI 14 As 1194, As 1224, As 144, As 193/1, Boga betguti, Garem ahu 1, 69-70(ahu 3), As 91/2,
Koimurali, As 55, Shishemthat, Dusri ahu, Bengaloni 2, Basmati (Culture-1)
el al 1973, De et al 1992, Reddy and Mohana 1992). Geographical
isolation is not the only factor causing genetic diversity
in ahu rice. Singha et al (1991) reported that geographical
diversity may not always be a useful index of genetic diversity
in rice.
The relative contribution of different characters revealed
that 100-grain weight and yield plant –1 contributed the highest
to total divergence. These two characters, along with panicle
length and panicle number, contributed 98.7% of the total divergence,
indicating their relative importance for genetic divergence
among the genotypes under study. The intracluster
distance varied from 1.26 in cluster III to 2.39 in cluster VII
(Table 3). Maximum intercluster divergence was observed
between genotypes As 180/2 and Sattari, followed by As 180
and As 180/2. It was interesting to note that cluster X, which
included both traditional and improved genotypes, showed a
higher magnitude of intercluster divergence than other clusters.
Clusters VI and X showed the highest divergence. Hence,
the genotypes under these clusters can be used as parents in a
crossing program to isolate desirable segregants since more
Genetics and breeding of agronomic traits 75

Table 3. Mean intra- (in bold) and intercluster distance (D 2 ) in 208 genotypes.
Cluster I II III IV V VI VII VIII IX X XI
I 1.94 4.56 2.42 4.25 2.62 2.44 3.93 4.32 2.56 6.94 4.56
II 1.52 2.63 3.49 3.80 4.81 4.55 2.39 4.12 4.90 3.15
III 1.26 2.99 1.35 3.21 3.14 2.20 2.56 5.10 2.86
IV 1.57 3.08 4.45 2.72 2.18 2.26 3.02 3.41
V 1.57 3.21 2.44 2.50 2.51 5.10 2.96
VI 1.79 3.61 4.25 3.26 7.06 4.17
VII 2.39 2.85 2.70 4.90 2.90
VIII 1.51 3.37 3.47 2.30
IX 1.56 5.07 3.63
X 2.02 4.86
XI 1.78
Table 4. Cluster means for different characters of 208 genotypes. a
Cluster Days to Days to Plant Panicle Panicle 100-grain Yield
flowering maturity height length number weight per plant
I 80.68 100.36 92.14 18.40 12.54 2.07 7.71
II 99.10 128.70 124.44 22.20 8.15 1.35 6.80
III 89.55 119.06 119.96 21.29 9.79 2.01 8.14
IV 103.00 132.29 92.90 22.76 11.50 2.03 14.93
V 87.69 117.00 124.75 21.69 11.23 2.32 10.93
VI 82.08 109.33 106.43 20.24 19.74 1.88 9.38
VII 90.12 120.62 121.93 21.81 13.90 2.12 19.79
VIII 100.58 130.84 133.98 23.12 11.31 1.90 11.56
IX 89.67 117.81 76.59 21.92 11.86 2.09 13.67
X 117.12 148.62 111.13 26.42 8.94 2.27 15.04
XI 89.46 119.57 137.52 26.23 11.25 1.66 14.06
a Numbers in bold are maximum and minimum mean values for a particular character.
variability is expected from divergent parents.
Considerable variation was observed among the cluster
means for different parameters (Table 4). The early maturing
genotype with 100-d duration was grouped under cluster I.
Plant height was the lowest (76.59 cm) in cluster IX. Panicle
length varied from 18.40 cm (cluster I) to 26.42 cm (cluster
X). Panicle number was the highest in cluster VI (19.74). Wide
variation in 100-grain weight was also observed, ranging from
1.35 g (cluster II) to 2.32 g (cluster V). The highest yield per
plant was observed in cluster VII (18.79 g). These observations
indicated that intercrossing of parents from clusters I, V,
VI, VII, IX, and X with good mean performance may help to
select early maturing, dwarf, and high-yielding recombinants
for identifying modern varieties. Thus, information will be
useful for developing high-yielding ahu rice varieties for Assam
and the northeastern region of India for hybridization.
References
Das GR, Ahmed T, Battacharyya HC, Borthakur BC. 1981. J. Res.
Assam Agric. Univ. 2(2):56-164.
De RN, Reddy JN, Surya Rao AV, Mohanty KK. 1992. Genetic divergence
in early rice under two situations. Indian J. Genet.
52:225-229.
Rao CR. 1952. Advanced statistical methods in biometrical research.
New York: John Wiley and Sons, Inc. 390 p.
Rao AV, Prasad ASR, Krishna TS, Seshu DV, Srinivasan TE. 1981.
Genetic divergence among some brown planthopper-resistant
rice varieties. Indian J. Genet 41:179-185.
Reddy JN, Mohana NK.1992. Divergence analysis in short-duration
rice. Crop Improve. 9:34-37.
Singha PK, Chauhan VS, Prasad K, Chauhan JS. 1991. Genetic divergence
in indigenous upland rice. Indian J. Genet. 51:47-
50.
Vairavan S, Siddiq EA, Arunachalam V, Swaminathan MS. 1973. A
study on the nature of genetic divergence in rice for Assam
and Northeast Himalayas. Theor. Appl. Genet. 43:213-221.
Notes
Authors’ address: Regional Agricultural Research Station, Assam
Agricultural University, Titabar 785 630, Assam, India.
76 Advances in rice genetics

The relationship between number of nitrogen-fixing
rhizobacteria and growth pattern of rice varieties
K. Hirano, T. Sugiyama, A. Kosugi, I. Nioh, T. Asai, and H. Nakai
This study was conducted to evaluate the adaptability of rice varieties to nature farming. Nature farming refers to
sustainable agriculture without the use of agricultural chemicals, including fertilizers. Four rice varieties were
grown in fields under nature and conventional (control) farming conditions. The number of N 2
-fixing rhizobacteria,
dry matter content, and nitrogen content of the plants were measured in each growth stage. In both farming
conditions, the number of N 2
-fixing rhizobacteria was found to be associated with the growth stage of rice in
relation to a change in dry matter and N content of the plants. The number of N 2
-fixing rhizobacteria in nature
farming was higher than that in conventional farming. In nature farming, varieties with a higher number of N 2
-
fixing rhizobacteria in the late growth stages showed higher grain yields than in conventional farming. We suggest
that varieties with a higher number of N 2
-fixing rhizobacteria in the late growth stages be used for breeding highyielding
varieties under nature farming. The Japanese native J195 line used in this experiment may be a useful
material for this purpose.
The development of high-yielding, fertilizer-responsive varieties
during the last few decades has brought major increases
in food production. But it has raised various environmental
concerns such as erosion of soils and depletion of germplasm.
In such situations, sustainable agricultural systems with a focus
on environmental protection need to be developed. This
study was conducted to evaluate the adaptability of rice varieties
under nature farming, a typical example of sustainable
agriculture that does not use any agricultural chemicals (Okada
1953). The relationship between the function of N 2 -fixing
rhizobacteria and the growth of rice plants was determined
under nature and conventional (control) farming situations.
Materials and methods
Two sets of experiments were conducted. In the first set, four
rice varieties (Koshihikari, Nihonmasari, J195, and J235) were
grown using nature farming. In the second, Koshihikari and
J195 were grown using conventional farming methods in
Shimada City and Yaizu City, Shizuoka Prefecture, Japan. No
chemical pesticides and chemical fertilizers were used in nature
farming (Nature Farming International Research Foundation
1987). Rice bran (3,000 kg ha –1 ) and rape cake (1,000 kg
ha –1 ) were applied as organic manure for the nature farming
experiment in Shimada City. Rape cake (1,300 kg ha –1 ) was
used as organic manure and Chinese milk vetch was grown
and then plowed into the soil before planting in Yaizu City.
Using the method described by Watanabe et al (1979), the
number of N 2 -fixing rhizobacteria on three rice plants of each
variety was determined at the following growth stages: planting
(1 June), tillering (5 July), maximum tillering (26 July),
heading (16 August), and maturity (16 September). Dry matter
and N content were also measured in each growth stage.
Grain yield was recorded after harvest.
Results and discussion
The number of N 2 -fixing rhizobacteria was found to change
with the growth stage of rice varieties as it reflects changes in
dry matter weight and N content of the plants in both nature
and conventional farming (Fig. 1). The varieties with a higher
number of N 2 -fixing rhizobacteria in the early growth stages
(planting to maximum tillering) showed a higher increase in
the ratio of dry matter weight to N content of plants in the
early and late growth stages. In nature farming, varieties with
a higher number of N 2 -fixing rhizobacteria in the late growth
stages showed higher grain yields than those in conventional
farming (Fig. 2, Table 1). This implies that varieties with a
higher number of N 2 -fixing rhizobacteria in the late growth
stages may be used in breeding for high yield in nature farming.
The Japanese native J195 line used in this experiment
showed more N 2 -fixing rhizobacteria in the late growth stages
and had a higher yield under nature-farming conditions.
In nature farming, the growth stage when the number of
N 2 -fixing rhizobacteria was high differed, depending on location.
That growth stage was early in Yaizu but late in Shimada.
The reason for the different experimental results may be the
kind of organic manure used in each place. The rice bran applied
in Shimada resulted in a high C/N ratio compared with
that of Chinese milk vetch applied in Yaizu, which showed a
slower effect of organic manure on the plants. It must be noted
that the kind of organic manure applied is an important factor
in breeding rice varieties adaptable to nature farming.
References
Okada M. 1953. Shizennouhou-kaisetsu. Atami (Japan): Eikousha.
236 p. (In Japanese.)
Watanabe I, Barraquio WL, De Guzman MR, Cabrera DA. 1979.
Nitrogen-fixing (acetylene reduction) activity and population
Genetics and breeding of agronomic traits 77

Number of N 2 -fixing rhizobacteria (log number g –1 )
Yaizu City
7
J195
7
6
6
5
Nature farming
Conventional farming
5
Koshihikari
0 25 50 75 100 125
0 25 50 75 100 125
Shimada City
7
J195
7
Koshihikari
6
6
5
5
0 25 50 75 100 125
0 25 50 75 100 125
7
6
5
J235 7
6
5
4
4
Nihonmasari
0 20 40 60 80 100 120 0 20 40 60 80 100 120
Days after transplanting
Fig. 1. Changes in number of N 2 -fixing
rhizobacteria with growth stage of rice
varieties grown under nature and conventional
farming.
Difference in grain yield
(Nature farming – conventional farming) (kg ha –1 )
76 d after transplanting (heading stage)
400
Nihonmasari
200
J195
0
–200
107 d after transplanting (maturity stage)
400
Nihonmasari
200
J195
0
–200
–400
–600
–800
–1,000
0
J235
Koshihikari
r = 0.894
–400
–600
–800
Koshihikari
J235
r = 0.930
–1,000
0.5 1.0 1.5 2.0 0 0.5 1.0 1.5
Difference in number of N 2 -fixing rhizobacteria (nature farming –
conventional farming) (log number g –1 )
Fig. 2. Correlation between
number of N 2 -fixing
rhizobacteria and grain yield
of rice varieties grown under
nature and conventional farming.
Table 1. Grain yield and straw weight a of rice varieties grown under nature and conventional
farming.
Agronomic Farming system J195 J235 Koshihikari Nihonmasari
character
Grain yield Nature 7,270 ± 52 5,560 ± 122 6,130 ± 31 4,970 ± 49
(kg ha –1 ) Conventional 7,110 ± 5 6,020 ± 31 6,940 ± 53 4,770 ± 63
Straw weight Nature 7,860 ± 21 5,890 ± 116 6,030 ± 41 5,870 ± 49
(kg ha –1 ) Conventional 9,080 ± 20 5,960 ± 33 6,150 ± 67 5,290 ± 77
Grain-straw ratio Nature 0.92 0.93 1.03 0.84
Conventional 0.78 1.01 1.14 0.91
a Values show mean ± S.E.
78 Advances in rice genetics

of aerobic heterotrophic nitrogen-fixing bacteria associated
with wetland rice. Appl. Environ. Microbiol. 37:813-819.
Nature Farming International Research Foundation. 1987.
Shizennnouhou-gijutsufukyuu-youkou. (In Japanese.)
Notes
Authors’ addresses: K. Hirano, The United Graduate School of Agricultural
Science, Gifu University, Gifu 501-1193, Japan; T.
Sugiyama, A. Kosugi, I. Nioh, T. Asai, H. Nakai, and K.
Hirano, Faculty of Agriculture, Shizuoka University, Shizuoka
422-8529, Japan; I. Nioh, present address: Nodai Research
Institute, Tokyo University of Agriculture, Tokyo 156-8502,
Japan.
Genotype by environment interaction across normal
and delayed planting in rainfed lowland rice environments
of eastern India
S. Singh, S. Sarkarung, O.N. Singh, R.K. Singh, V.P. Singh, and C.B. Pandey
Genotype by environment interaction (G × E) in rainfed lowland rice was examined using 4 y of data from two
planting dates of 15 genotypes grown at eight locations during 1996 to 1999. Thirty-day-old and 60-d-old
seedlings were used for normal and delayed planting, respectively. G × E interaction accounted for 32.2% of the
total mean sum of squares, with environments and genotypes accounting for 62.7% and 5.1% of the variation,
respectively. More than 53% of the total mean sum of squares was captured by seven genotypes and by seven
environment groups. Environment groups included shallow lowlands, early drought, late drought, and tolerant for
cold and submergence. Grouping of genotypes could be explained by their performance under these conditions.
PSR1119-13-3-1 had high yield potential and performed well in all environments, whereas IR67471-8-M-1-1-
1 had high yield potential in both normal and delayed planting conditions. Six genotypes—IR66366-7-M-1-1-1,
IR67471-8-M-1-1-1, IR66876-11-M-1-1-1, IR67440-1-M-1-1-1, IR67495-M-2-1-1-1, and PSR1119-13-1—
and a local check performed well under both normal and delayed planting conditions in the rainfed lowland rice
system. While Masodha and Cuttack are good areas for both late and normal planting, Chinsurah, Raipur, and
Ranital are not fit for late planting; early varieties will be better for these locations.
A large area—about 17 million ha—is grown to rice in the
rainfed lowlands of South and Southeast Asia; about 13 million
ha are grown to rice in eastern India alone. Because of
frequent flood and drought, crop yields are adversely affected.
Early drought and flood cause delayed planting, resulting in
further yield declines. Aside from seasonal variation, the region
is characterized by high spatial heterogeneity over soil
types, topographic sequences, and hydrological conditions.
Genotype × environment (G × E) interaction is therefore very
high. Hence, in addition to a low yield of

Table 1. Characteristics of 15 genotypes evaluated for adaptation in 64 environments.
Genotypes Code Parents Days to 50% Yield
flowering (t ha –1 )
IR66876-11-M-1 G1 19 IR40931-33-1-3-2/IR55008-33-3-2-1 118 3.7
IR66366-M-7-1 G2 19 KDML105/IR53519-26-4-2-1-3 129 3.7
IR67471-M-8-1 G3 3 KDML105/IR49804-UBN-8-B-1-1 130 4.1
IR67440-M-5-1 G4 19 CN1539/IR53479-B-45-3-2-3 131 3.9
IR6745-M-2-1 G5 19 IR60290-CPA-5-1-1-1-1/IR54094-B-2-2-1-3 122 3.9
PSR119-13-3-1 G6 6 IR8/Barogar 123 4.3
RAU83-82-4 G7 23 IET3236/IR9890-150 121 3.6
RAU79-22-1 G8 19 Pankaj/C64-117 127 3.6
CN1035-60 G9 23 Pankaj/Patnai23 120 3.5
CR333-10 G10 23 Jagannath/Mahsuri 130 3.6
KMJ-1-17-1 G11 21 Manoharsali/IR8 129 3.5
KMJ-1-19-1 G12 20 Manoharsali/IR8 121 3.2
Sabita G13 21 Boyan(Selection) 130 3.4
Rajshree G14 21 Jaya/Mahsuri 122 3.0
Local check G15 15 Local germplasm 121 3.7
Table 2. Details of test locations, planting dates, and yield in 64 environments, Rainfed Lowland Rice Consortium, 1996-99.
1996 1997 1998 1999
Test
location Code a Gmp Yield Code Gmp Yield Code Gmp Yield Code Gmp Yield
code (t ha –1 ) code (t ha –1 ) code (t ha –1 ) code (t ha –1 )
Normal
Masodha N1 118 4.9 N17 118 5.0 N33 118 4.9 N49 118 5.0
RAU N2 120 3.9 N18 112 4.4 N34 112 4.3 N50 112 4.4
Titabar N3 111 4.3 N19 111 4.2 N35 111 4.3 N51 111 4.3
Bhawani Patna N4 118 5.0 N20 118 5.0 N36 118 5.0 N52 118 5.2
CRRI (Cuttack) N5 120 4.4 N21 120 4.5 N37 120 4.4 N53 120 4.2
Ranital N6 120 4.1 N22 120 4.6 N38 120 4.2 N54 120 4.2
Chinsurah N7 110 4.7 N23 110 5.0 N39 110 4.8 N55 110 4.7
Raipur N8 112 4.2 N24 112 4.6 N40 120 4.2 N56 112 4.3
Late
Masodha D9 118 3.3 D25 118 3.4 D41 118 3.4 D57 118 3.7
RAU D10 114 1.1 D26 114 1.0 D42 114 1.0 D58 114 1.1
Titabar D11 111 2.8 D27 111 2.6 D43 114 2.8 D59 111 2.7
Bhawani Patna D12 120 3.4 D28 118 3.3 D44 118 3.5 D60 118 3.7
CRRI (Cuttack) D13 120 3.4 D29 120 3.6 D45 120 3.6 D61 120 3.6
Ranital D14 114 1.4 D30 114 1.2 D46 111 1.3 D62 114 1.4
Chinsurah D15 121 3.0 D31 121 3.1 D47 121 3.3 D63 121 3.4
Raipur D16 121 2.8 D32 121 3.0 D48 121 3.2 D64 121 3.1
a N = normal planting, D = delayed planting, Gmp = germplasm.
Mean yields for the common set of 15 genotypes over
64 environments were used for combined analysis of variance
(ANOVA). G × E interaction was analyzed using pattern analysis
(DeLacy et al 1996, McLaren 1996).
Results and discussion
On an overall mean basis, yield varied from 3.0 t ha –1 for
Rajshree to 4.3 t ha –1 for PSR119-13-3-1 (Table 1). However,
yield varied largely from environment to environment (Table
2). Means for delayed planting ranged from 1.0 t ha –1 at RAU
to 3.5 t ha –1 for Masodha Faizabad compared with 4.2 t ha –1 at
RAU and 5.1 t ha –1 at Bhawani Patna for normal planting.
Yield varied more among locations under delayed planting than
under normal planting. For late planting, varietal performance
was better at Masodha, Bhawani Patna, and the Cuttack Rice
Research Institute (CRRI) (Cuttack) than at RAU, Titabar, and
Ranital. Since the varieties tested were medium- to late-duration
types, low yield at these sites could be explained by lower
temperatures, which affect grain filling.
The ANOVA showed the largest variability because of
environment (62.7%). Genotype × environment accounted for
80 Advances in rice genetics

Table 3. Grain yield (t ha –1 ) of seven genotypic groups across seven environment
groups.
Environment
group
Genotype group
23 3 6 19 20 15 21
Mean
118 3.6 6.1 5.1 5.0 3.2 4.5 2.9 4.4
120 4.3 4.4 5.0 4.4 3.4 3.4 3.3 4.0
121 3.2 2.9 3.8 3.0 3.2 3.0 2.9 3.1
111 4.9 3.2 3.8 3.3 4.8 3.2 3.3 3.8
114 1.7 0.2 1.7 0.7 1.2 2.1 2.1 1.4
110 5.0 6.6 4.4 6.0 5.0 6.0 4.5 5.3
112 6.6 4.5 5.2 4.3 3.7 5.9 4.0 4.9
Mean 4.2 4.0 4.1 3.8 3.5 3.4 3.3
the second highest variability (32.2%), whereas the genotype
was responsible for only 5.1% of the variability (Table 2). Planting
dates played the most important role, accounting for more
than 39% of the variability, followed by site effects with about
16%. Among the G × E interactions, site × genotype interaction
was the most prominent (16%). Courtois et al (2001) also
reported high site and site × genotype interactions in rainfed
lowlands, which could be attributed to high hydrological variability
in eastern India (Singh et al 1999).
A biplot of the first two ordination scores for standardized
grain yield was examined. Scores on the first (IPCA 1)
and second PCA axes (IPCA 2) accounted for 34.1% and
17.4%, respectively, of the G × E-SS. Genotypes close to the
center of the biplot were considered more stable. Accordingly,
the most stable genotypes were G5, G7, G13, G14, G6, G2,
and many others. In general, genotype groups 6, 19, and 21
were the most stable across environments. Among the least
stable groups were 20, 3, 15, and 23, with the exception of
genotype group 7. These groups showed specific adaptation
to particular environment groups by mapping far away from
the center of the biplot. For example, group 20 had a positive
response in environment groups 121 and 111, but a negative
response in the remaining environment groups. Similarly, group
3 performed better and hence showed a positive response in
four out of seven environment groups, with exceptionally good
performance in environment group 118 (Masodha and Bhawani
Patna) and 110 (Chinsurah), while it faired poorly in environment
group 114. Our earlier results also showed that late- to
medium-duration varieties perform equally well at these locations
(Singh and Dwivedi 1997).
At the lowest fusion level, two groups were identified.
The first was environment group 110, composed of normalsown
Chinsurah environment which were characterized by high
yields ranging from 4.4 to 6.6 t ha –1 and a mean yield of 5.3 t
ha –1 (Table 3). The second group (112) also consisted of normal-sown
environments of RAU (Pusa) and Raipur. In this
group, yields ranged from 3.7 to 6.6 t ha –1 , with a mean of 4.9
t ha –1 . The third group (118), with a slightly higher fusion level,
included 15 environments, both normal and late-sown, of
Masodha and Bhawani Patna. This indicated that there were
no significant differences between normal and late-planted
materials over different years at these two locations. It further
suggested that the breeding lines developed at these two locations
were more or less similar. This is also the third highest
yielding group of environments, with yields ranging from 2.9
to 6.1 t ha –1 and a mean of 4.4 t ha –1 .
The next three groups (111, 114, and 121) had the same
level of fusion. Of these, group 111 consisted of normal and
late-sown environments of Titabar, indicating no significant
difference between normal and late-sown materials. Yield in
this group ranged from 3.2 to 4.9 t ha –1 , with a mean of 3.8 t
ha –1 (Table 3). Group 114 consisted of materials from lateplanted
environments of RAU and Ranital, indicating similarities
between these two locations. This was the lowest yielding
group (mean yield: 1.4 t ha –1 ; yield ranged from 0.2 to 2.1
t ha –1 ). Similarly, group 121 included late-planted environments
of Chinsurah and Raipur, showing similarities between them.
This is the second lowest yielding group; yield ranged from
2.9 to 3.8 t ha –1 . The last group (120) was as large as group
118, with 15 normal and late-planted environments of CRRI
and the normal-sown environments of Ranital, and normalsown
and late-planted environments of RAU and Bhawani
Patna.
Overall, there seems to be two broad groups, one consisting
of 110, 111, 112, and 114, and the other of 118, 120,
and 121. In the latter group, 118 formed a separate group from
120 and 121. Based on yield data over 64 environments, the
genotypes could be clustered into seven groups at a fusion level
of about 2.55 (Fig. 1). At the lowest fusion level, group 19
consisted of four NDR lines and one RAU line, with yields
ranging from 0.8 to 6.0 t ha –1 . Environment group 110 performed
best, followed by 118. Environment group 114 fared
badly, with a mean yield of 0.8 t ha –1 at RAU and Ranital in
late-sown conditions. The second group (20) consisted of two
Titabar varieties, KMJ-1-17-1 and KMJ-1-119-1, with yields
ranging from 1.2 t ha –1 (environment 114) to 5.0 t ha –1 (environment
110); the latter was under the normal-sown environment
of Chinsurah. Groups 21 and 23 were at the same level
of fusion (2.76).
Group 21 contained two well-known varieties—Sabita
and Rajshree—of the lowest yielding group (3.3 t ha –1 ). However,
these two varieties gave the highest mean yield in envi-
Genetics and breeding of agronomic traits 81

Year Location Code Groups
99 Masodha D57
99 Bhawani Patna D60 118
98 Masodha D41
97 Masodha D25
96 Masodha D9
98 Bhawani Patna D28
99 Bawani Patna D44
99 Bhawani Patan N52
96 Masodha N17
98 Masodha N49
98 Masodha N33
98 Bhawani Patna N36
97 Bhawani Patna N20
96 Masodha N1
96 Bhawani Patna N4
98 Ranital N38
99 Raintal N54 120
97 CRRI N21
98 CRRI N37
99 CRRI N53
98 Raipur N40
99 CRRI D61
97 CRR D29
98 CRRI D45
98 CRRI N5
97 Ranital N22
97 Bhawani Patna D12
96 CRRI D13
96 RAU (Pusa) N2
96 Ranital N6
96 Chinsurah D15
99 Chinsurah D63 121
97 Chinshurah D31
98 Chinsurah D47
99 Raipur D16
97 Raipur D32
98 Raipur D48
99 Raipur D64
96 Titabar N3
97 Titabar N19 111
97 Titabar N35
97 Titabar D27
98 Ranital D46
99 Titabar D59
96 Titabar D11
99 Titabar N51
96 Ranital D14
99 RAU (Pusa) D58 114
97 RAU (Pusa) D26
98 RAU (Pusa) D42
96 RAU (Pusa) D10
99 Ranital D62
97 Ranital D30
98 Ranital D46
96 Chinsurah N7
99 Chinsurah N55 110
97 Chinsurah N23
98 Chinsurah N39
97 RAU (Pusa) N18
97 Raipur N24 112
96 Raipur N8
99 Raipur N56
98 RAU (Pusa) N34
99 RAU (Pusa) N50
–2 5 12 19 26
Fusion level
Fig. 1. Dendrogram for seven environment groups involving normal and delayed planting
conditions. N = normal planting, D = delayed planting.
ronment group 21, indicating their greater stability under latesown
harsh environments. Group 23 consisted of three lines:
one each from RAU, Chinsurah, and CRRI. It was the highest
yielding group (av = 4.2 t ha –1 ), with a maximum yield of 6.6
t ha –1 in environment group 112 (normal-sown rainfed, RAU),
followed by group 110 (normal-sown Chinsurah: 5.0 t ha –1 ).
The lowest yield of 1.7 t ha –1 in environment group 114 indicated
varietal sensitivity to delayed planting, particularly at
Ranital and RAU. Groups 3, 6, and 15 each had one line. PSR
1119-13-3-1 (group 6) was closer to group 19 (the NDR lines),
whereas the local check of group 15 showed proximity with
group 21 (i.e., Sabita and Rajshree).
Overall, there appeared to be two broad clusters, one
consisting of groups 20, 15, and 21, and another composed of
groups 23, 3, 6, and 19. Generally, for normal planting,
Chinsurah, Raipur, RAU, and Ranital proved to be the best
locations. However, these were the poorest environments for
delayed planting. For planting late at these locations, early
varieties should be used. Areas around N.D. University of
Agriculture and Technology and CRRI seem to be good for
both normal and late planting, of course, within a reasonable
time. For poor environments, the long-tested Sabita, Rajshree,
and local check proved to be better than the new test materials.
Based on the overall mean, PSR119-13-3-1—a recently
82 Advances in rice genetics

eleased variety—was found to be the best (4.3 t ha –1 ), followed
by NDR 96005 (4.1 t ha –1 ), and NDR 96006 and NDR
96007 (3.9 t ha –1 ).
References
Courtois B, Bartolome B, Chaudhury D, Paris T, Piggin C, Prasad
K, Sahu RK, Sarkarung S, Singh HN, Singh S, Singh RK,
Thakur R. 2001. Comparing farmers’ and breeders’ rankings
in varietal selection for low-input environments: a case study
of rainfed rice in eastern India. Euphytica 122(3):537-550.
DeLacy IH, Basford KE, Cooper M, Bull JK, McLaren CG. 1996.
Analysis of multi-environment trials—a historical perspective.
In: Cooper M, Hammer GL, editors. Plant adaptation
and crop improvement. Wallingford (UK): CAB International.
p 39-124.
IRRI (International Rice Research Institute). 1992. Challenges and
opportunities in a less favorable ecosystem: rainfed lowland
rice. IRRI Information Series No. 1. Los Baños (Philippines):
IRRI.
Mackill DJ, Coffman WR, Garrity DP. 1996. Rainfed lowland rice
improvement. Manila (Philippines): International Rice Research
Institute. 242 p.
McLaren CG. 1996. A comparison between pattern analysis conducted
on environment standardized data and AMMI models
for analysis of data from multi-environment trials. In: Cooper
M, Hammer GL, editors. Plant adaptation and crop improvement.
Wallingford (UK): CAB International. Los Baños (Philippines):
International Rice Research Institute. Patancheru
(India): International Crops Research Institute for the Semi-
Arid Tropics. p 225-242.
Singh RK, Dwivedi JL. 1997. Rice improvement for rainfed lowland
ecosystem: breeding methods and practices in eastern
India. In: Fukai S, Cooper M, Salisbury J, editors. Breeding
strategies for rainfed lowland rice in drought-prone environments.
Proceedings of the International Workshop held at
Ubon Ratchathani, Thailand. ACIAR Proceedings 77:50-57.
Singh S, Singh ON, Singh RK, Sarkarung S. 1998. A shuttle breeding
approach to rice improvement for rainfed lowland ecosystem
in eastern India. UK: James and James (Science Publishers)
Ltd. p 105-115.
Singh VP, Singh RK, Sastri ASRAS, Baghel SS, Chaudhury JL. 1999.
IRRI-IGAU publication. p 76.
Notes
Using rice cultivar LGC-1 as a dietary food
for patients with kidney disease
M. Nishimura, N. Horisue, T. Imbe, M. Sakai, and M. Kusaba
Authors’ addresses: S. Singh, S. Sarkarung, R.K. Singh, V.P. Singh,
International Rice Research Institute, Los Baños, Philippines;
O.N. Singh and C.P. Pandey, N.D. University of Agriculture
and Technology, Kumarganj, Faizabad, Uttar Pradesh, India.
The steep rise in medical expenses has become a public concern because of the increase in number of the
elderly population. In particular, the high cost of blood dialysis is a very important consideration for patients with
kidney disease. The number of patients who receive a blood dialysis is estimated to be about 15,000 persons
per year. Limiting protein intake is one effective treatment. A rice cultivar with a low protein content in the
endosperm is required to help as a dietary cure. The major proteins, glutelin and prolamin, accumulate separately
in two different protein bodies. Glutelin is stored in protein body type II (PB-II) and prolamin in protein body
type I (PB-I). PB-I is indigestible in the human body, whereas PB-II can be easily digested. LGC-1 is a low-glutelin
and high-prolamin cultivar originating from a rice mutant. It can be used as a low-digestible-protein rice. This
study was conducted to clarify the efficiency of LGC-1 as a main dietary food. Patients suffering from kidney
disease before blood dialysis in two hospitals had 90% milled rice of LGC-1 for 6 mo. In patients who ate more
LGC-1, the protein content in the blood and the total protein intake decreased significantly. Moreover, the scores
for 1/creatinine standing to gauge the ability of the kidney to function improved. On the other hand, in patients
who ate less LGC-1, these scores did not improve. Some cultivars were developed using LGC-1 as a cross
parent. They also had low glutelin content and thus are suitable as a low-protein rice. From these results, we
recommend cultivars with low glutelin content as a dietary food for patients with kidney disease. To use LGC-1 as
a dietary food, it is important to consult a doctor or a dietitian since the effectiveness of LGC-1 showed differences.
In Japan, the increasing cost of medical expenses has become
an important public concern. In particular, the cost of blood
dialysis among elderly patients with kidney disease has
emerged as an important issue. The number of new patients
receiving blood dialysis therapy is estimated to be about 15,000
per year in Japan alone. Diet therapy is based on low protein
and high energy. To follow a strict diet therapy, it is necessary
to use specially formulated low-protein foods. So far,
hyperpolished rice is recommended to patients to restrict their
protein intake. However, this is quite expensive compared with
ordinary rice. Therefore, rice cultivars with genetically low
protein content in the endosperm are required for a dietary
Genetics and breeding of agronomic traits 83

NM67
Nihonmasari
LGC-1
kDa
76
Reciprocal of serum creatinine
1.0
Beginning of diet therapy
With diet therapy
57
0.5
α Glutelin
Globulin
β Glutelin
Albumin
Prolamin
37–39
26
22–23
16
13
With no diet therapy
0.1
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
Month
Fig. 2. Progression of renal failure.
Table 1. Percentage of each protein in the milled rice of LGC-1 and Nihonmasari.
Fig. 1 SDS-PAGE analysis of total protein
in brown rice.
Cultivar 57–76 kDa 37–39 kDa 26 kDa 22–23 kDa 16 kDa 13 kDa
α Glutelin Globulin β Glutelin Albumin Prolamin
Nihonmasari 18.5 27.3 9.8 21.3 7.7 15.4
LGC-1 20.7 13.0 13.7 9.8 10.9 32.0
cure. This study was conducted to clarify the efficiency of a
low-glutelin cultivar, LGC-1, as a main dietary food.
Materials and methods
Rice seed protein consists of two major proteins, glutelin and
prolamin, that accumulate separately in two different protein
bodies. Glutelin is stored in protein body type II (PB-II) and
prolamin in protein body type I (PB-I). PB-I is indigestible in
the human body, whereas PB-II can be easily digested. The
seed protein of LGC-1, a derivative of the rice mutant NM67
obtained from cv. Nihonmasari treated with ethylene-imine,
consists of low glutelin and high prolamin. Therefore, LGC-1
could be made available as a low-digestible-protein rice, although
it contains the same amount of total protein in the endosperm
as the original cultivar (Fig. 1, Table 1).
Twenty-three outpatients with chronic renal failure who
had not yet undergone blood dialysis in two hospitals were
placed on the low-protein diet during the prestudy period (mean
of 10 mo). Subsequently, they were given the same diet using
90% milled rice of LGC-1 as the staple food during the study
period (mean of 7 mo).
Results and discussion
Protein intake and the slope of the reciprocal of serum creatinine
(a waste product of metabolism in the human body; see
Fig. 2) did not differ between before and during LGC-1 intake
in all patients. Results showed that, among 23 patients, nine
consumed rice mainly as a staple food (120–180 g d –1 as polished
rice = rice group). In the rice group, protein intake de-
Table 2. Change in the slope of the serum creatinine
reciprocal.
Before
1/S-Cr slope
During
All patients –3.10 ± 3.62 –1.69 ± 2.95
Rice group –4.59 ± 4.33 –1.47 ± 3.51
Nonrice group –2.05 ± 2.94 –1.82 ± 2.79
creased and the slope of the reciprocal of serum creatinine
decreased significantly during the study period compared with
the prestudy period. On the other hand, among patients who
had less opportunity to eat LGC-1 (

Table 3. Comparison of LGC-1 and an ordinary rice variety.
Item Choices LGC-1 (90%) LGC-1 (80%)
Eating quality 1. Tasty 30 59
2. Untasty 70 41
Diet therapy 1. Variable 48 77
2. No change 52 23
Long-term use 1. Possible 100 100
2. Impossible 0 0
Appetite 1. No change 96 100
2. Reduced 4 0
Notes
Authors’ addresses: M. Nishimura, M. Kusaba, Institute of Radiation
Breeding, National Institute of Agricultural Resources;
N. Horisue, Tohoku National Agricultural Experiment Station;
T. Imbe, M. Sakai, National Agricultural Research Center,
Japan.
Characterization of a rice mutant showing
an abnormal morphology
T. Kawai and H. Kitano
A rice recessive mutant, KA-902, showing an abnormal morphology was induced from M 2
progenies of Taichung
65 (T65) treated with N-methyl-N-nitrosourea (MNU). This mutant expressed an extremely miniature plant phenotype
in the early juvenile stage. Histological observations on shoot morphology of the mutant revealed that the
cell elongation of both leaf and stem was clearly reduced although its shoot apical meristem seemed nearly
normal in structure. When the wild type (T65) was germinated under dark condition, the shoot was greatly
spindled. The mutant grown under such a condition was critically reduced and, moreover, the base of the shoot
was swollen. Paraffin sections of the dark brown shoots showed that this swelling of the mutant was not caused
by an increase in cell number but by auxesis of the cell in the mesocotyl to the upper nodal regions. Such
obvious morphological characteristics of the mutant expressed under light and dark conditions could not be
corrected by gibberellin (GA 3
) treatment.
How do plants achieve different morphologies This is a common
question of botanists. Morphologically abnormal mutants
are one of the most useful tools to elucidate such genetic programs.
Recent developments of molecular biology using a
model plant, Arabidopsis thaliana, gave important information
on many useful materials contained in such malformed
mutants. Unfortunately in rice, many mutants had been discarded
due to the perceived lack of practical value in plant
breeding. We screened some mutants showing abnormal shoot
morphologies, and focused on a recessive mutant, KA-902,
with an extremely miniature plant size and an abnormal morphology
in the early juvenile stage.
Materials and methods
We screened a recessive mutant from M 2 progenies of T65
treated with MNU. KA-902 had a miniature-sized plant phenotype
in the early juvenile stage (Fig. 1). The homozygous
plants of the mutant could continue their growth for over 2 mo
but subsequently aborted their growth. Accordingly, phenotypic
analyses of the mutants were carried out using progenies
segregated from heterozygous plants.
Seeds of KA-902 set on the heterozygous plants and T65
were germinated and grown in growth chambers at 30 °C under
continuous light and continuous dark conditions. Seedlings
of the mutant grown under light condition were transplanted
in a pot for growth analysis. Homozygous plants of KA-902
and T65 at 10 d after germination were fixed with FAA
(formaldehyde:acetic acid:70% ethyl alcohol = 1:1:18). Longitudinal
and transverse thin sections of the shoot were prepared
with the paraffin sectioning method. Histological observations
were done on specimens stained with toluidine blue
1.0% solution.
Seeds of KA-902 and T65 were germinated and grown
in 0 and 10 ppm gibberellin (GA 3 ) water solutions in the growth
chamber at 30 °C under continuous light condition. The length
of the second leaf sheath of this mutant and T65 seedlings
were measured 14 d after germination.
Results
Characteristics of the mutant phenotype
Under light condition, the mutant was extremely small and the
plant was less than 2.0 cm even 2 wk later. The root of the
mutant was also shortened and seemed to be stouter compared
with those of T65. Seedlings of the mutant continued their
growth for 2 mo after transplanting in the soil, but the plants
aborted subsequently.
Wild-type seedlings grown under the continuous dark
condition were etiolated and greatly spindled. However, seed-
Genetics and breeding of agronomic traits 85

lings of the mutant grown under the same condition were etiolated
but failed to elongate. Furthermore, the base of the shoot
was extremely swollen.
Histological observation
Cell elongation of both leaf and stem was critically reduced
although the shoot apical meristem and differentiation of the
leaf primordia seemed nearly normal.
The longitudinal section of the mutant revealed that the
upper regions of the mesocotyl and first internode were swollen.
Transverse sections showed that this swelling of the
mesocotyl in the mutant was caused by enlargement of cells
since lateral cell numbers from the vascular bundle to the epidermal
layer between the mutant and wild type were not significantly
different. The epidermis of the mesocotyl and vascular
bundle showed an abnormal morphology in the mutant.
The second leaf sheath of the mutant treated with 10
ppm GA 3 hardly elongated. The plant height of the mutant did
not recover, unlike the wild type, which grew normally.
Discussion
Swelling was observed in the basal shoot of the mutant grown
under dark condition. This swelling, induced by shielding the
light, was caused by auxesis of cells in the basal region of the
shoot. The Bri1 mutant in Arabidopsis thaliana, which is a
brassinosteroid-insensitive mutant, shows a remarkable feature
of photomorphogenesis (deetiolation) under dark condition
(Clouse et al 1996). Recently, a homologous mutant of
Bri1 in Arabidopsis was found in rice (Yamamuro et al 2000).
The shoot of this mutant (d61, osbri1) failed to elongate under
dark condition and did not swell as KA-902 did under dark
condition.
The Ctr1 mutant in A. thaliana constitutively exhibits
an abnormal phenotype under both light and dark conditions.
The abnormal phenotype under dark condition had triple responses—inhibition
of root and hypocotyl elongation, tightening
of the apical hook, and swelling of the hypocotyl as shown
in the wild-type plants treated with ethylene (Kieber et al 1993).
This phenotype of the mutant is similar to KA-902 in root and
hypocotyl response. However, a rice plant treated with ethylene
did not respond like the dicot.
The gene function of the mutant examined in this study
is still obscure. Further analysis of the mutant is in progress.
References
Clouse SD, Langford M, McMorris TC. 1996. A brassinosteroidinsensitive
mutant in Arabidopsis thaliana exhibits multiple
defects in growth and development. Plant Physiol. 111:671-
678.
Kieber JJ, Rothenberg M, Roman G, Feldmann KA, Ecker JR. 1993.
CTR1, a negative regulator of the ethylene response pathway
in Arabidopsis, encodes a member of the Raf family of protein
kinases. Cell 72:427-441.
Yamamuro C, Ihara Y, Wu X, Noguchi T, Fujioka S, Takatsuto S,
Ashikari M, Kitano H, Matsuoka M. 2000. Loss of function
of a rice brassinosteroid insensitive 1 homolog prevents internode
elongation and bending of the lamina joint. Plant Cell
12:1-16.
Notes
Authors’ address: Graduate School of Bioagricultural Sciences,
Nagoya University, Japan. E-mail: i002014m@
mbox.media.nagoya-u.ac.jp.
86 Advances in rice genetics

Genetic diversity, evolution,
and alien introgression

88 Advances in rice genetics

RAPD variation in carbonized rice aged 13,010
and 17,310 years
H.S. Suh, J.H. Cho, Y.J. Lee, and M.H. Heu
A few pieces of carbonized rice hull were excavated from two peat-soil layers in Sorori Village located in the middle part of
South Korea. The upper peat-soil layer, where the carbonized rice hull was excavated, was evaluated to be about 13,010 ±
190 years old by carbon isotope dating in Geochron Laboratories, Massachusetts, USA. The lower layer, where the carbonized
quasi-rice was excavated, was estimated to be 17,310 ± 310 years old. Variation in randomly amplified polymorphic DNA
(RAPD) of four samples of carbonized rice and two samples of carbonized quasi-rice was studied using four DNA primers (A32,
OPK-14, OPO-15, and OPN-16). Among the carbonized rice aged 13,010 years, 34.1% of the RAPD bands were the same as
those of current rice and 65.9% were specific to carbonized rice. Among the carbonized quasi-rice aged 17,310 years, 38.7%
of the RAPD bands were the same as those of current rice, 48.4% were the same as those of carbonized rice, and 12.9% were
specific to carbonized quasi-rice. The carbonized rice and quasi-rice showed at least more than one RAPD band common to the
current, indica, japonica, weedy, and wild rice. By cluster analysis based on RAPD variation, the carbonized rice and quasi-rice
were classified into the same group and the current rice was categorized into another group. Genetic similarity between the
ancient carbonized rice and the current rice group was around 57%.
Only a few reports are available on the evolutionary pattern of
rice. In these reports, genetic diversity is based on morphological
traits and isozyme and molecular divergence involving
nuclear, chloroplast, and mitochondrial genes. In this paper,
variation was detected using random amplified polymorphic
DNA (RAPD) markers.
Materials and methods
DNA was extracted from four pieces of carbonized rice hull
excavated from a peat-soil layer aged 13,010 ± 190 years and
from two pieces of carbonized quasi-rice hull excavated from
the layer aged 17,310 ± 310 years.
A total volume of 25 mL reaction mix was completed
with 2.5 mL of 10X polymerase chain reaction (PCR) buffer,
0.2 mol primer, 0.2 mmol dNTPs, 1 unit of Taq DNA polymerase
(Promega), and 2 mL of ancient DNA from the carbonized
rice and/or carbonized quasi-rice hull. Four primers—
A32 (5-CTTGTCATGTGT-3), OPK-14 (5-CCCGCTACAC-
3), OPO-15 (5-TGGCGTCCTT-3), and OPN-16 (5-
AAGCGACCTG-3)—were used for DNA amplification. The
reaction mix was subjected to the Perkin Elmer 2400 thermal
cycler for 45 cycles consisting of 1 min at 94 °C, 1 min at 37
°C, and 2 min at 72 °C, followed by an extension of 5 min at
72 °C. Five mL of the first PCR product underwent a second
PCR with the same process. Amplified DNA fragments were
analyzed by 1.4% agarose gel electrophoresis, followed by
ethidium bromide staining.
Four kinds of carbonized rice samples (carbonized rice
1, 2, 3, and 4) excavated from the peat-soil layer aged 13,010
years, two kinds of carbonized quasi-rice samples (quasi-rice
1 and quasi-rice 2) excavated from the layer aged 17,310 years,
and five genotypes of rice— IR36 (indica), T65 (japonica),
Hapcheon 3 (short-grain weedy rice), Kyongsan 2 (long-grain
weedy rice), and W1944 (japonica inclined wild rice)—were
compared using four primers. Genetic similarity was analyzed
using Nei’s formula (1987).
Results and discussion
Comparison of RAPD between carbonized
and current rice
DNA from the ancient carbonized rice samples (Fig. 1) could
be amplified twice by PCR and clear RAPD bands could be
detected from the ancient carbonized rice hulls excavated from
the peat-soil layers aged 13,010 and 17,310 years (Fig. 2).
The minimum number of bands detected with the four
primers was 1 in the carbonized quasi-rice and 2 with primer
A32. The maximum number was 10 in carbonized rice 1 with
primer OPN-16. The total number of bands detected from the
four carbonized rice samples was 85 and that from the two
carbonized quasi-rice was 31 (Table 1). Twenty-nine RAPD
bands among 85 detected in the four carbonized rice samples
were the same as those in the current rice. Fifty-six bands were
different from those of the current rice. This result showed
that 34.1% of the bands in the four carbonized rice samples
were the same as those in the current rice (Table 2). In contrast,
in the two carbonized quasi-rice, 12 of 31 bands were
the same as those in the current rice, 15 bands were the same
as those in the carbonized rice, and 4 bands were specific to
the carbonized quasi-rice. The results showed that 38.7% of
the bands tested in the two quasi-rice samples were the same
as those in the current rice, 48.4% were the same as those in
the carbonized rice, and 12.9% were specific to the carbonized
quasi-rice (Table 2).
All the ancient carbonized rice samples showed one to
three bands common to the current, indica, japonica, weedy,
and wild rice. Carbonized rice 1 had three bands common to
the current, indica, japonica, weedy, and wild rice. However,
carbonized rice 2 showed a weedy rice-specific band; carbon-
Genetic diversity, evolution, and alien introgression 89

M 1 2 3 4 5 6 7 8 9 10 11 12 M
A
B
C
Fig. 1. Hull shape of carbonized
rice from soil layer aged
13,010 years (A), carbonized
quasi-rice from soil aged
17,310 years (B), and current
japonica rice (C).
Fig. 2. RAPD bands of ancient carbonized rice samples and current
rice tested with primer OPO-15. Lane 1: T65 (japonica), lane
2: IR36 (indica), lane 3: carbonized rice 1, lane 4: carbonized rice
2, lane 5: carbonized rice 3, lane 6: carbonized rice 4, lane 7:
carbonized quasi-rice 1, lane 8: carbonized quasi-rice 2, lane 9:
Hapcheon 3 (weedy rice), lane 10: Kyongsan 2 (long-grain weedy
rice), lane 11: W1944 (wild rice), lane 12: control, M: marker DNA/
EcoT141.
Table 1. Number of RAPD bands amplified in the
four carbonized rice samples with primers A32,
OPK-14, OPO-15, and OPN-16.
Table 2. Number of RAPD bands amplified in the two carbonized
quasi-rice samples with primers A32, OPK-14, OPO-15,
and OPN-16.
Primer
Number of bands
Primer
Number of bands
Specific to Specific to Total
current rice carbonized rice
Specific to Specific to Specific to Total
current rice carbonized rice quasi-rice
A32 11 6 17
OPK-14 3 8 11
OPO-15 7 16 23
OPN-16 8 26 34
Total 29 56 85
(34.1%) (65.9%) (100%)
A32 1 1 1 3
OPK-14 3 2 1 6
OPO-15 4 5 1 10
OPN-16 4 7 1 12
Total 12 15 4 31
(38.7%) (48.4%) (12.9%) (100%)
Table 3. Number of RAPD bands specific to the current and carbonized rice amplified from four carbonized
rice and two carbonized quasi-rice samples with primers A32, OPK-14, OPO-15, and OPN-16.
Material
tested
Number of bands
Common Specific to Specific Specific Specific Specific
to current rice indica to japonica to weedy to wild to ancient
(IR36) (T65) rice rice rice
Carbonized rice 1 3 0 0 0 0 18
Carbonized rice 2 3 0 0 1 0 9
Carbonized rice 3 2 1 1 2 0 15
Carbonized rice 4 3 1 2 2 1 14
Carbonized quasi-rice 1 2 1 2 2 0 12
Carbonized quasi-rice 2 1 1 0 1 0 7
Total 14 4 5 8 1 75
ized rice 3 had indica-, japonica-, and weedy rice-specific
bands; and carbonized rice 4 had indica-, japonica-, weedy-,
and wild rice-specific bands in addition to the common bands
(Table 3). Carbonized quasi-rice 1 showed indica-, japonica-,
and weedy rice-specific bands and carbonized quasi-rice 2 had
indica- and weedy rice-specific bands in addition to the common
bands (Table 3).
Even though the shape of the ancient carbonized rice
was similar to that of the current japonica rice, the genetic
basis of these materials was different. Therefore, we could not
conclude whether the ancient carbonized rice belonged to the
indica, japonica, weedy, or wild form. The ancient carbonized
rice might be a primitive form of rice.
90 Advances in rice genetics

Genetic similarity
0.6 0.7 0.8 0.9 1.0
Quasi-rice 2
Carbonized rice 3
Carbonized rice 2
Carbonized rice 1
Quasi-rice 1
Carbonized rice 4
W1944 (wild rice)
Hapcheon 3 (weedy)
T65 (japonica)
Kyongsan 2 (weedy)
IR36 (indica)
Fig. 3. A dendrogram showing genetic relationships among ancient
carbonized and current rice based on RAPD variation.
The hull shape of the carbonized rice was almost identical
to that of the current rice. The hull of the carbonized quasirice
was slightly different from that of carbonized rice and/or
the current rice, but the two ancient rice samples showed relatively
high genetic similarity. Further studies on the ancient
carbonized rice excavated from the peat-soil layers aged 13,010
and 17,310 years would provide useful information on the evolution
of rice species.
References
Nei M. 1987. Molecular evolutionary genetics. New York (USA):
Columbia University Press. 512 p.
Classification of carbonized rice
When genetic similarity was analyzed by Nei’s method based
on RAPD variation, the carbonized rice and the carbonized
quasi-rice were classified into one group and the current, indica,
japonica, weedy, and wild rice into another group (Fig.
2). Genetic similarity between the two groups was around 57%
(Fig. 3).
Notes
Diphyletic origin of cultivated rice based
on genetic analysis and archaeology
Y.I. Sato, S. Yamanaka, and Y. Fukuta
Authors’ addresses: H.S. Suh and J.H. Cho, College of Natural Resources,
Yeungnam University, Kyongsan, Korea; Y.J. Lee,
Chungbuk National University, Cheongju, Korea; M.H. Heu,
Seoul National University, Suwon, Korea.
We formulated a hypothesis on the origin of cultivated rice based on the results of DNA analysis of excavated rice grains and
recent available archaeological and biological data. We concluded that a major varietal group—japonica—had differentiated
from its ancestral species of wild rice in the middle and lower basins of the Yangtze River about 11,000 to 14,000 years ago.
Some japonica strains were brought into the southwestern provinces of China several thousand years ago and then transmitted
to the tropics. Another varietal group—indica—could have originated in the flooded plains of the tropics by incidental natural
hybridization(s) between indigenous wild relatives and japonica cultivars.
The origin of Asian cultivated rice (Oryza sativa L.) has been
controversial regarding its ancestors and phylogenetic relationship
among varietal groups as well as its geographic origin.
Molecular genetic analysis suggests multiple parentage of the
two major varietal groups of cultivars, indica and japonica. A
recent archaeological study in China suggested incipient
japonica cultivation in the middle and lower basins of the
Yangtze River. Here, a new hypothesis on the geographic origin
and phylogeny of cultivated rice is described.
Phylogenetic relationship of wild cultivated rice
Varietal differentiation of indica and japonica
The two major varietal groups, indica and japonica, are reported
to be shaped by a nonrandom association of alleles at
many independent loci for various traits (Oka 1958, Sato et al
1990). The nonrandom association was observed in isozyme
loci, restriction fragment length polymorphism (RFLP), rDNA,
and so on. Polymorphism in cpDNA (Chen et al 1993) and
differential sequence in the plastid subtype ID region (PS-ID)
have been observed in both indica and japonica (Fig. 1). Such
a state of disequilibrium between nuclear and cytoplasmic DNA
types suggests a diphyletic origin of indica and japonica rice.
Evidence for indica-japonica differentiation
in wild rice
The deletion in cpDNA was seen not only in cultivars but also
in wild rice strains. This deletion was frequently found in annual
strains of O. rufipogon (or O. nivara), but seldom in other
species. The deletion originated in the O. rufipogon complex
(Chen et al 1993) and was transferred to indica cultivars. RFLPs
in genomic DNA of wild rice suggest that the indica-japonica
differentiation occurred before domestication had begun. The
p-SINE-r2 polymorphism found at the Waxy locus in wild relatives
distinguishes indica-type (annual) strains from japonicatype
(perennial) strains.
Genetic diversity, evolution, and alien introgression 91

Time and
climate
Tropical
zone
Temperate
zone
Adapt to
upland or
extensive
conditions
Adapt to
paddy or
intensive
conditions
Indica
Tropical
japonica
Temperate
japonica
8C8A-D
6C9A-D
7C7A-D
6C8A-D
7C6A-ND
6C7A-ND
6C7A-ND
Appearance of
ancient
civilization
Natural hybridization
Incipient
japonica
Beginning of rice
cultivation
Cenozoic
appearance of
disturbed habitat
8C8A-D
6C9A-D
7C7A-D
6C8A-D
O. nivara
Annual,
seed
propagation
O. rufipogon
Perennial,
vegetative
propagation
Acquisition of
high seed
productivity
Fig. 1. A diagram showing the phylogeny of rice.
Description in circles indicates cpDNA types defined
by PS-ID sequence (Nakamura et al 1997)
and the presence or absence of 69 base-pair deletions
in the ORF100 region (Chen et al 1993). In
the PS-ID region, the first 13 to 16 base sequences
consist of 6 to 8 C-molecules followed
by 6 to 9 A-molecules. For instance, 6C7A means
that the first 13-base sequence is
CCCCCCAAAAAAA. A 69 base-pair deletion exists
at the ORF100 region of cpDNA in certain strains
of rice (N = with deletion, ND = without deletion).
The first domestication occurred in O. rufipogon,
which acquired high productivity of seed, from
which japonica cultivars arose. After the diversification
of japonica in the tropics, natural hybridization
occurred with O. nivara, from which indica
cultivars arose.
Genetic diversity in indica cultivars
Domestication usually reduces genetic diversity within a population.
However, indica cultivars are more diverse than japonica
cultivars in molecular markers (Zhang et al 1992). Such genetic
diversification in indica cultivars may suggest their defuse
origins. The fact that almost all indica cultivars have the
deleted cpDNA regardless of nuclear genomes suggests their
limited derivation; they could have been derived from natural
hybridization.
Geographic origin and distribution of wild and cultivated rice
Chang-Watabe hypothesis
It has been commonly accepted that the Asian cultivated rice
(Oryza sativa L.) was born in the Himalayan foothills. Based
on the shape of spikelets found in old bricks in South and Southeast
Asia, it was concluded that the cultivated rice domesticated
in the “Assam-Yunnan area” largely overlapped with the
region mentioned above. A similar hypothesis was proposed
by Chang (1976). Against the Chang-Watabe hypothesis, assumptions
of defuse origin (Harlan 1975) were also proposed.
In many reports, China and India were regarded as the centers
of origin. However, these works were formulated on the basis
of limited evidence only.
Ancient rice remains
Recent archaeological records strongly suggest that rice cultivation
began in the middle and lower basins of the Yangtze
River. In Hunan and Jainxi provinces, old relics (11,000 to
16,000 years BP, see Fig. 2) were found in caves from which
phytolith of rice spikelets was detected. However, the age may
be slightly overestimated. Five spikelets of wild rice were ob-
92 Advances in rice genetics

Yellow River
Yangtze River
1
3
North limit
of wild rice
distribution
2
Archaeological sites of rice cultivation
(older than 6,000 years BP)
Fig. 2. A map showing the proposed homeland of cultivated rice. Areas 1, 2, and 3 are proposed by this paper, Chang (1976), and Watabe
et al (1977), respectively. Note that archaeological sites of rice cultivation that are older than 6,000 years are distributed in area 1, but
not in areas 2 and 3.
served among 81 excavated samples among the Homedu relics
(7,000 years BP, Zhejiang Province). Some spikelets had
intermediate features between wild and cultivated species.
These facts may indicate the existence of primitive cultivars
during the Homedu period. Such old rice remains are not recorded
in the southwestern provinces of China. These archaeological
data definitely disagree with the Chang-Watabe hypothesis.
In India, many relics have been excavated all over the
country, particularly in the Ganga basin, but these are not older
than 2200 BC. In Thailand and Vietnam, some relics have been
found that were not older than 3000 BC. Rice cultivation began
not earlier than 3000 BC in the plains area of the tropics,
as far as current excavations point out.
DNA analysis for ancient rice grains
Many rice grains have been excavated from archaeological
sites. Some of them dried out, but others remain fresh. Yu
(1979) postulated that a rice variety in ancient China (Homedu
period, approximately 7,000 years BP) was a mixture of indica
and japonica, judging from the shape of excavated grains.
Grain shape, however, is not a good indicator for classifying a
rice variety (Sato 1991).
We attempted to extract DNA from “fresh” and unfired
excavated rice grains. Up to this date, 28 grains excavated in
China, Korea, Japan, and Thailand have been assigned their
PS-ID type. Of the 28 grains examined, 27 from China, Korea,
and Japan (1,900 to 6,000 years BP) were either 6C7A or
7C6A types, which are both japonica-specific sequences. Only
one from Thailand (Lopburi prefecture, approximately 2,500
years BP) was identified as being a 7C7A type, a type of indica.
The data strongly suggested that incipient cultivars in
eastern Asia were predominantly japonica.
Conclusions
Asian cultivated rice is concluded to have a defuse origin, based
on new data introduced. Japonica probably originated in the
middle and lower basins of the Yangtze River 11,000 to 14,000
Genetic diversity, evolution, and alien introgression 93

years ago, a type of O. rufipogon with nondeleted cpDNA.
Perhaps domestication began when strains of O. rufipogon with
a relatively high seed productivity because of stress conditions
appeared because of the cooler and drier conditions in
that period. Japonica cultivars were diversifying all over China
about 3,000 years ago. Some strains reached the tropics across
the Yunnan mountains. Perhaps those japonica strains were
hybridized by indigenous annual types of wild rice to produce
indica cultivars.
High genetic diversity in the Oriental Fertile Crescent is
explained by the introduction of indica and japonica cultivars
from the tropics and eastern China, respectively, and by the
consequent natural hybridization between them (Second 1981).
The genetic variation created has been preserved there without
erosion because of the complex conditions of climate, geography,
and human races. A sustainable way of agriculture
may have played an important role in this preservation. The
Oriental Fertile Crescent area would be a case of a secondary
center of genetic diversity (Vavilov 1926).
For future work, biological analysis of plant and animal
remains (bioarchaeology) would play an important role.
Harlan JR. 1975. Crops and man. Madison, Wis. (USA): American
Society of Agronomy/Crop Science Society of America.
Oka HI. 1958. Interval variation and classification of cultivated rice.
Indian J. Genet. Plant Breed. 18:79-89.
Sato YI. 1991. Variation in spikelet of the indica and japonica rice
cultivars of Asian origin. Jpn. J. Breed. 41:121-134. (In Japanese
with English summary.)
Sato YI, Ishikawa R, Morishima H. 1990. Nonrandom association
of genes and characters in indica and japonica rice. Heredity
65:75-79.
Second G. 1981. Origin of the genetic diversity of cultivated rice
(Oryza spp.): study of the polymorphism scored at 40 isozyme
loci. Jpn. J. Genet. 57:25-57.
Vavilov NI. 1926. Studies on the origin of cultivated plants. Bull.
Appl. Bot. 16:139-248.
Watabe T et al. 1977. Rice road. Tokyo (Japan): Nippon Housou
Kyoukai. (In Japanese.)
Yu XL. 1979. Origin, differentiation and dissemination of cultivated
rice in China, as suggested by rice grains excavated at Homedu.
Acta Agron. Sin. 5(3):1-12. (In Chinese.)
Zhang Q, Maroof MAS, Lu TY, Shen BZ. 1992. Genetic diversity
and differentiation of indica and japonica rice detected by
RFLP analysis. Theor. Appl. Genet. 83:495-499.
References
Chang TT. 1976. The origin, evolution, cultivation, dissemination,
and diversification of Asian and African rices. Euphytica
25:431-441.
Chen WB, Nakamura I, Sato YI, Nakai H. 1993. Distribution of
deletion type in cpDNA of cultivated and wild rice. Jpn. J.
Genet. 68:597-603.
Notes
Authors’ addresses: Y.I. Sato and S. Yamanaka, Faculty of Agriculture,
Shizuoka University, Shizuoka City 422-8529, Japan;
Y. Fukuta, IRRI, DAPO Box 7777, Metro Manila, Philippines.
Evolutionary and molecular genetic studies
at the waxy locus in cultivated rice and wild relatives
S. Yamanaka, I. Nakamura, H. Nakai, and Y.I. Sato
We investigated polymorphism in the waxy Wx locus among wild and cultivated rice. p-SINE1-r2, a retrotransposon inserted at
the Wx locus in Oryza sativa, showed polymorphism between wild rice O. nivara and O. rufipogon. This p-SINE1 polymorphism
could explain 70% of the annual-perennial differentiation, and it also corresponds to indica-japonica differentiation in wild
relatives. We also analyzed the first intron-exon splice site (AG/GT or AG/TT; G-T polymorphism). It was suggested that G-T
polymorphism corresponds to Wx a -Wx b and indica-japonica, respectively. Wild relatives possessed an AG/GT type without exception.
In 300 waxy strains, they have a mostly AG/TT (japonica-type) sequence, except for 10 strains, independently of
indica-japonica differentiation. It was concluded that waxy mutation and waxy rice cultivation had originated from japonica.
The waxy locus, which is responsible for amylose synthesis in
the endosperm, has been well studied in many cereals. The
wild relatives of Oryza sativa seem to be differentiated into
two groups at the Wx locus, and these results supported our
“diphyletic hypothesis.”
Materials
A total of 300 waxy strains of O. sativa collected from various
Asian countries and 23 strains each of two wild relatives, O.
rufipogon and O. nivara, were used for DNA analysis. Oryza
rufipogon and O. nivara were classified as perennial and annual
types, respectively, based on propagation systems observed
in their natural habitats (Sato 1994).
Analyses for p-SINE1-r2 polymorphism and indica-japonica
differentiation in wild relatives
We analyzed the size of the polymerase chain reaction (PCR)
fragment of the waxy structural gene. In O. sativa, there was
94 Advances in rice genetics

Table 1. Species characteristics in terms of annual-perennial habit, presence or absence of p-SINE1-r2 at Wx locus, and indica-japonica
differentiation in two wild relatives of rice.
Species Strain A-P a p-SINE1-r2 b ORF 100 c CMN-A32 d Species Strain A-P a p-SINE1-r2 b ORF 100 c CMN-A32 d
O. nivara HT12c A – + D I
O. rufipogon HT3 P – ND J
HT6 P – D J
HT12a P – ND I
CT1 P – ND J
CT6 P – ND I
CT7 P – ND J
CT10 P – ND J
CT11 P – + ND J
CT13 P – ND J
CT14 P – ND J
CT15a P – ND J
CB2a P – + ND J
CB2b P – ND J
CP5a P + D I
CP45b P – D J
CP46a P – ND J
NN61 P – ND J
NE103 P + D J
NE114 P – + ND J
NE115A P – ND J
LV10A-1 P – ND I
LV27 P – D I
W1944 P – ND J
CB7c A – + D I
CB8 A + ND I
CP4a A + D I
CP38 A – + D J
CP43a A – D J
NN59a A – D J
NE41 A + D I
NE53 A – D I
NE55 A + D I
NE58 A + D I
NE59 A + D I
NE60 A – D I
NE62 A – + D I
NE84 A + D J
NE101 A + D I
NE102 A + D I
NE104 A + D I
NE105 A + D I
NE106 A + D I
NE108 A + ND I
LV9 A – + D I
LV36B A + D I
a P = present, A = absent. b + = present, – = absent. c D = chloroplast DNA detected, ND = chloroplast DNA not detected. d J = japonica, I = indica.
no polymorphism. However, p-SINE1-r2, a retrotransposon
that was inserted in the 10th intron of the Wx gene of O. sativa
(Umeda et al 1991), showed polymorphism between O. nivara
and O. rufipogon. Most of O. nivara (annual), as well as O.
sativa, possessed this element but most of the O. rufipogon
(perennial) lacked it. To evaluate indica-japonica differentiation
in these wild relatives, both nuclear (CMN-A32) and chloroplast
(ORF100) DNA were analyzed by PCR. The results
indicated that 74% of O. nivara had indica features, whereas
65% of O. rufipogon showed japonica traits (Table 1). From
test results using the 46 strains, the annual-perennial habit (A,
P), p-SINE1-r2 polymorphism (+, –), chloroplast DNA (D,
ND), and nuclear DNA (I, J) were nonrandomly associated
with each other, indicating that a typical O. nivara (A, +, D, I)
and a typical O. rufipogon (P, –, ND, J) are dominant in natural
populations. This suggests that the wild relatives of O. sativa
had clearly differentiated into annual and perennial groups
at the Wx locus, and these two groups correspond to an indica
type of O. nivara and a japonica type of O. rufipogon. This is
strong evidence that O. nivara and O. rufipogon are wild ancestors
of indica and japonica, respectively, and that the origin
of O. sativa seems to be diphyletic.
G-T polymorphism in waxy strains
It was suggested that the first intron-exon splice site shows
nucleotide polymorphism (AG/GT or AG/TT; G-T polymorphism),
and that this G-T polymorphism corresponds to different
alleles, Wx a and Wx b , or indica-japonica, respectively
(Hirano et al 1998, Issiki et al 1998). We made cleaved amplified
polymorphic sequences (CAPS) markers to detect one base
substitution without sequencing analyses. This G-T mutation
site is not a restriction site, so we applied the derived CAPS
(dCAPS) method (Michaels and Amasino 1998, Neff et al
1998). This dCAPS marker correctly detected G-T polymorphism
(Fig. 1). The results of studying the 46 strains of wild
relatives indicated that they possess the AG/GT type without
exception. In 300 waxy strains from various countries and areas,
AG/TT (japonica type) was the major sequence observed
and only 10 strains had the AG/GT sequence, independently
of indica-japonica differentiation. This result suggests the
mainly japonica feature of waxy rice cultivar at this site. It
was concluded that waxy mutation had differentiated among
japonica types during their domestication.
References
Hirano HY, Eiguchi M, Sano Y. 1998. A single base change altered
the regulation of Waxy gene at the post-transcriptional level
during the domestication of rice. Mol. Biol. Evol. 15:978-
987.
Isshiki M, Morino K, Nakajima M, Okagaki RJ, Wessler SR, Izawa
T, Shimamoto K. 1998. A naturally occurring functional allele
of the rice waxy locus has a GT to TT mutation at the 5′
splice site of the first intron. Plant J. 15:133-138.
Michaels SD, Amasino RM. 1998. A robust method for detecting
single-nucleotide changes as polymorphic markers by PCR.
Plant J. 14:381-385.
Neff MM, Neff JD, Chory J, Pepper AE. 1998. dCAPS, a simple
technique for the genetic analysis of single nucleotide poly-
Genetic diversity, evolution, and alien introgression 95

M 1 2 3 4 5 6 7 8 9 10 11 12 M
dCAPS
Sequence
T G G T G G/T G G G T G T
T G G T G G G G G T G T
Fig.1. Comparison between dCAPS and
sequencing analyses for the detection
of G-T polymorphism. M = 100-bp ladder,
1 = T65, 2 = Acc. 130, 3 = Acc.
419, 4 = T65wx, 5 = Acc. 221, 6 =
Th8, 7 = LN27Ag, 8 = LH5-7, 9 = P76,
10 = Ch7, 11 = Is107, 12 = J177.
morphisms: experimental applications in Arabidopsis thaliana
genetics. Plant J. 14:387-392.
Sato YI, editor. 1994. Ecological-genetic studies on wild and cultivated
rice in tropical Asia (4th survey). Tropics 3:189-246.
Umeda M, Ohtsubo H, Ohtsubo E. 1991. Diversification of the rice
Waxy gene by insertion of mobile DNA elements into introns.
Jpn. J. Genet. 66:569-586.
Notes
Authors’ addresses: S. Yamanaka, The United Graduate School of
Agricultural Sciences, Gifu University, Gifu 1193; S.
Yamanaka, H. Nakai, and Y.I. Sato, Faculty of Agriculture,
Shizuoka University, Shizuoka 422-8529; I. Nakamura, Graduate
School of Science and Technology, Chiba University,
Matsudo 271-0092, Japan.
PCR-RFLP analysis of cpDNA and mtDNA in Oryza
L.J. Chen, D.S. Lee, and H.S. Suh
The conservation of gene order and the characterization of uniparental inheritance in chloroplast and mitochondrial genomes
have led to the design of chloroplast and mitochondrial primers, which facilitate phylogenetic or population genetic studies in
plants. The polymerase chain reaction–restriction fragment length polymorphism approach was used to detect genetic variations
in cpDNA and mtDNA in the genus Oryza and to clarify the phylogenetic relationships among 10 different species. Five
regions of the chloroplast genome and four regions of the mitochondrial genome were amplified with the plant cpDNA and
mtDNA universal primers and digested with several restriction enzymes. Genetic variation was evident in some regions of the
chloroplast and mitochondrial genomes among most investigated species. Species-diagnostic markers of cpDNA and mtDNA
were found, showing that differentiation of cpDNA and mtDNA varied from species to species. Intraspecific variations in cpDNA
and mtDNA were also detected in four species of the Oryza sativa complex, indicating that indica-japonica subspecific differentiation
of cpDNA and mtDNA followed the trend noted in the O. sativa complex.
The genus Oryza consists of 2 cultivated and 22 wild species
(Khush 1997). These species are adapted to a broad range of
habitats worldwide, which represent an enormous gene pool
for the genetic improvement of rice. Phylogenetic analysis of
chloroplast and mitochondrial genomes offers an effective way
to study the evolution of plant species. Restriction fragment
length polymorphism (RFLP) analysis of plant chloroplast
DNA (cpDNA) and mitochondrial DNA (mtDNA) has proved
to be a powerful tool for phylogenetic studies in many crops,
as well as in rice (Ishii et al 1993, Dally and Second 1990,
Chen et al 1993, Sun et al 1996, Ge et al 1999). However,
most of these studies focused on only a single region of cpDNA
by the polymerase chain reaction (PCR) method or on only a
few regions of mtDNA using the Southern blot RFLP approach.
The conservation of gene order of the chloroplast and
mitochondrial genomes and the knowledge of a complete chloroplast
and mitochondrial sequence have led to the design of
numerous “consensus” or “universal” chloroplast and mitochondria
primers, which facilitate phylogenetic or population
genetic studies (Demesure et al 1995, Dumolin-Lapegue et al
1997). Such PCR-based RFLP approaches seem extremely
attractive by comparison with traditional RFLP methods. Recently,
PCR-RFLP analysis of cpDNA was undertaken in the
genus Abies (Parducci and Szmidt 1999) and in mangrove species
(Parani et al 2000). Our study aimed to identify the utility
of the PCR-RFLP method in detecting genetic variation of
cpDNA and mtDNA in Oryza and to determine the phylogenetic
relationships of the chloroplast and mitochondrial genomes
among Oryza species.
96 Advances in rice genetics

Table 1. cpDNA genetic differentiation in the region of ORF100 within the genus Oryza.
No. of ORF100 cpDNA type Deletion
Species Genome entries type (%)
Deletion Nondeletion Others
Oryza sativa complex AA 85 19 65 0 22.4
O. sativa AA 61 10 51 0 16.4
Modern cultivars 7 2 5 0 28.6
Landraces 37 4 33 0 10.8
Weedy rice 17 4 13 0 23.5
O. rufipogon AA 20 8 12 0 40.0
O. barthii AA 2 1 1 0 50.0
O. meridionalis AA 2 0 2 0 0
Rhizome rice AA 1 0 1 0 0
Oryza officinalis complex CC 8 0 8 0 0
O. officinalis CC 2 0 2 0 0
O. punctata BB, BBCC 2 0 2 0 0
O. minuta BBCC 1 0 1 0 0
O. latifolia CCDD 1 0 1 0 0
O. grandiglumis CCDD 2 0 2 0 0
Genera related to Oryza 2 0 0 2 0
Zizania latifolia – 1 0 0 1 0
Leersia hexandra – 1 0 0 1 0
Table 2. DNA sequences of primer pairs used in the study.
Primer pair Sequence Size (bp) Amplification
cp-trnH-trnK F 5′-ACGGGAATTGAACCCGCGCA-3′ 1,831 Successful
R 5′-CCGACTAGTTCCGGGTTCGA-3′
cp-psbC-trnS F 5′-GGTGGTGACCAAGAAACCAC-3′ 1,611 Successful
R 5′-GGTTCGAATCCCTCTCTCTC-3′
cp-rbcL-rbcL F 5′-ATGTCACCACAAACAGAAACTAAAGCAAGT-3′ 1,381 Successful
R 5′-CTTCACAAGCAGCAGCTAGTTCAGGACTCC-3′
cp-rbcL-ORF106 F 5′-ACTACAGATCTCATACTACCCC-3′ 3,274 Successful
R 5′-ATGTCACCACAAACAGAAACTAAAGCAAGT-3′
cp-ORF100 F 5′-GGCCATTTTCTTTAG-3′ 1,100 Successful
R 5′-AGTCCACTCAGCCATCTCTC-3′
mt-nad1B-nad1C F 5′-GCATTACGATCTGCAGCTCA-3′ 1,184 Successful
R 5′-GGAGCTCGATTAGTTTCTGC-3′
mt-nad4(1)-nad4(2) F 5′-CAGTGGGTTGGTCTGGTATG-3′ 2,100 Successful
R 5′-TCATATGGGCTACTGAGGAG-3′
mt-nad4(2)-nad4(3) F 5′-TGTTTCCCGAAGCGACACTT-3′ 2,840 Successful
R 5′-AACCAGTCCATGACTTAACA-3′
mt-coxII-coxII F 5′-AATCCAATCCCGCAAAGGATT-3′ 1,531 Failed
R 5′-AGAAGATGATCCAGAATTGGG-3′
mt-18S rRNA-15S rRNA F 5′-GTGTTGCTGAGACATGCGCC-3′ 1,177 Successful
R 5′-ATATGGCGCAAGACGATTCC-3′
Materials and methods
Primer selection and DNA digestion
Table 1 lists the materials used. Total DNA was extracted from
fresh leaves of young seedlings using the CTAB protocol (Sun
et al 1996).
Ten pairs of universal primers for amplification of plant
cpDNA and mtDNA (Demesure et al 1995, Dumolin-Lapegue
et al 1997) were employed to amplify the corresponding region
in the chloroplast and mitochondrial genomes of rice
(Hiratsuka et al 1989). The sequences of the primer pairs used
and their designations are given in Table 2.
Amplified PCR products were digested with several restriction
enzyme combinations among the following: HindIII,
EcoRI, PstI, ScaI, XbaI, DraI, AluI, DdeI, HaeIII, Sau3AI,
TaqI, CfoI, and MspI. The digested cpDNA or mtDNA fragments
were then separated on 1.8–4.0% agarose gels (or on
6% nondenaturing polyacrylamide gels) in 1X TBE buffer.
Results and discussion
The nine primer pairs used successfully amplified the corresponding
regions of cpDNA and mtDNA in all the materials
investigated (Table 1), thereby supporting the usefulness of
Genetic diversity, evolution, and alien introgression 97

A
bp
6,557
2,322
1,611
M1 5 10 15 20 25 30 M
B M1 5 10 15 20 25 30
6,557
2,322
564
Fig 1. (A) Amplified fragment patterns of
cpDNA in the region of psbC-trnS. M = size
marker (λ/HindIII). Lane 1, low-copy type;
lane 2, medium-copy type; lane 5, high-copy
type. (B) The restriction fragment patterns
of four variants detected in psbC-trnS/CfoI
from 10 species in the genus Oryza. M =
size marker (λ/HindIII). Lanes 1–32: O.
rufipogon, O. latifolia, O. grandiglumis, O.
rufipogon, O. officinalis, O. punctata, O.
grandiglumis, rhizome rice, O. latifolia,
Zizania latifolia, O. minuta, O. officinalis,
Leersia hexandra, O. rufipogon (W1944), O.
sativa (Dawn), O. sativa (Tetep), O.
rufipogon, O. rufipogon, O. rufipogon, O. sativa
(Moroberekan), O. sativa (IRAT104), O.
sativa (Mamoriaka), O. sativa (5167), O.
sativa (68-83), O. rufipogon (Donxiang), O.
rufipogon (Dongxiang), O. meridionalis, O.
meridionalis, O. barthiii, O. sativa (Dianyu
1A), O. sativa (Dianyu 1B), and O. sativa
(Yuza 29F1).
bp
2,322
1,000
564
M 1 5 10 15 20 M
Fig 2. The restriction fragment patterns of
10 variants detected in nad4(2)-nad4(3)/
MspI from nine species in the genus Oryza.
M = size marker (λ/HindIII + DraI). Lanes
1–20: O. sativa (IR36), O. sativa (T65), O.
grandiglumis (CCDD), O. rufipogon
(W1945), O. officinalis (CC), O. punctata
(BB), O. grandiglumis (CCDD), rhizome rice,
O. latifolia (CCDD), Zizania latifolia, O.
minuta (BBCC), O. officinalis (Yunnan, CN),
Leersia hexandra, O. rufipogon (W1944),
O. punctata (BBCC), O. rufipogon
(Dongxiang, CN), O. meridionalis, O.
meridionalis, O. sativa (Dianyu 1A), and O.
barthii.
this method in detecting variation of cpDNA and mtDNA in
the genus Oryza.
Genetic differentiation of cpDNA
Previous reports (Dally and Second 1990, Chen et al 1993)
and our study results (Table 2) show no specific genetic marker
in the region of ORF100 to distinguish the Oryza officinalis
complex from the O. sativa complex. Expectedly, this study
first detected PCR-RFLP markers in regions of psbC-trnS (Fig.
1), rbcL-rbcL, and rbcL-ORF106, which permits identification
of the O. officinalis and O. sativa complexes.
Genetic differentiation of mtDNA in Oryza
No polymorphism was detected in most of the regions of
mtDNA within the genus Oryza. In contrast, striking interspecific
and intraspecific variations were detected in the region
of nad4(2)-nad4(3) (Fig. 2), suggesting that differentiation of
mtDNA varied from species to species and that indica-japonica
differentiation was dominant in the O. sativa complex (Sun et
al 1996).
The dendrogram of mtDNA among the species produced
by cluster analysis indicates that all cultivated, weedy, and wild
species of the O. sativa complex in Asia, Africa, America, and
Oceania fall into the same group and are further differentiated
into indica and japonica types, except for rhizome rice (accession
6209-3, of IRRI, may be O. longistaminata), which was
highly divergent from the genus Oryza. Meanwhile, a few
strains of the Asian O. rufipogon and the African O. barthii
were similar to some species of the O. officinalis complex.
This finding sheds new light on the origin and differentiation
of cultivated rice (Oka 1988, Second 1986).
Evolutionary significance of cpDNA and mtDNA
Differentiation of cpDNA and mtDNA probably resulted in
species and/or subspecies diverging in Oryza. Species-diagnostic
markers of cpDNA and mtDNA were found, revealing
that differentiation of cpDNA and mtDNA varied from species
to species in Oryza. The intraspecific variations in cpDNA
and mtDNA were detected in four species of the O. sativa
complex, indicating that indica-japonica subspecific differentiation
of cpDNA and mtDNA was the dominant trend in the
O. sativa complex. In some regions of the chloroplast and
mitochondrial genomes, the PCR-amplified DNA fragments
seemed to be the same in size, but there were differences in
copy number (Fig. 1A), implying that the number and size of
the chloroplasts and mitochondria in different lines of various
species may be associated with ecological adaptation during
the evolutionary process.
98 Advances in rice genetics

References
Chen WB, Nakamura I, Sato YI, Nakai H. 1993. Distribution of
deletion type in cpDNA of cultivated and wild rice. Jpn. J.
Genet. 68:579-603.
Dally A, Second G. 1990. Chloroplast DNA diversity in the wild
and cultivated species of rice (Genus Oryza, Section Oryza):
cladistic-mutation and genetic-distance analysis. Theor. Appl.
Genet. 80:209-222.
Demesure B, Sodzi N, Petit RJ. 1995. A set of universal primers for
amplification of polymorphic non-coding regions of mitochondrial
and chloroplast DNA in plants. Mol. Ecol. 4:129-131.
Dumolin-Lapegue S, Pemonge MH, Petit RJ. 1997. An enlarged set
of consensus primers for the study of organelle DNA in plants.
Mol. Ecol. 6:393-397.
Ge S, Sang T, Lu BR, Hong DY. 1999. Phylogeny of rice genomes
with emphasis on origins of allotetraploid species. Proc. Natl.
Acad. Sci. USA 96(25):14400-14405.
Hiratsuka J et al. 1989. The complete sequence of the rice (Oryza
sativa) chloroplast genome: intermolecular recombination
between distinct tRNA genes accounts for a major plastid DNA
inversion during the evolution of cereals. Mol. Gen. Genet.
217:185-194.
Ishii T, Terachi T, Mori N, Tsunewaki K. 1993. Comparative study
on the chloroplast, mitochondrial and nuclear genome differentiation
in two cultivated rice species, Oryza sativa and Oryza
glaberrima, by RFLP analysis. Theor. Appl. Genet. 86:88-
96.
Iwahashi M, Nakazono M, Kanno A, Sugino K, Ishibashi T, Hirai
A. 1992. Genetic and physical maps and a clone bank of mitochondria
DNA from rice. Theor. Appl. Genet. 84:275-279.
Khush GS. 1997. Origin, dispersal, cultivation and variation of rice.
Plant Mol. Biol. 35:25-34.
Oka HI, editor. 1988. Origin of cultivated rice. Jpn Sci. Soc. Press,
Tokyo/Elsevier, Amsterdam. 254 p.
Parani M, Lakshmi M, Ziegenhagen B, Fladung M, Senthilkumar P,
Parida A. 2000. Molecular phylogeny of mangroves. VII. PCR-
RFLP of trnS-psbC and rbcL gene regions in 24 mangrove
and mangrove-associate species. Theor. Appl. Genet. 100:454-
460.
Parducci L, Szmidt AE. 1999. PCR-RFLP analysis of cpDNA in the
genus Abies. Theor. Appl. Genet. 98:802-808.
Second G. 1986. Isozymes and phylogenetic relationship in Oryza.
In: Rice genetics. Manila (Philippines): International Rice
Research Institute. p 27-39.
Sun CQ, Wang XK, Yoshimura A, Iwata N. 1996. Genetic differentiation
of mitochondrial DNA in common wild rice (Oryza
rufipogon Griff) and cultivated rice (Oryza sativa L.). In: A
collection of papers on origin and dissemination of cultivated
rice in China. Beijing Agricultural University of China Press.
p 134-139.
Notes
Authors’ address: Laboratory of Plant Genetics and Breeding, Department
of Bio-Resources, College of Natural Resources,
Yeungnam University, Kyongsan 712-749, Republic of Korea.
Fax: (053)816-2814, e-mail: chenlijuan@hotmail.com.
Evolutionary significance of varietal groups resistant
to bacterial leaf blight in rice
T. Ogawa, N. Endo, G.A. Busto Jr., R.E. Tabien, S. Taura, and G.S. Khush
Intraspecific variation in rice has been of great importance in breeding. No single character is believed to be a criterion of
varietal differentiation; however, a reaction pattern to bacterial leaf blight (BB) races led to the natural formation of varietal
groups. The diversity of each varietal group was supported by isozyme classification as well as DNA analysis. The genes for BB
resistance and isozyme loci are located on different chromosomes. This dispersed nature of gene location is not simply
interpreted as due to genetic linkage. Hence, it could be proposed that varietal differentiation as a result of evolutionary
dynamics during domestication is closely linked to varietal groups resistant to BB.
Bacterial leaf blight (BB) caused by Xanthomonas oryzae pv.
oryzae is one of the major diseases of rice in Asian countries.
Because of the ineffectiveness of bactericidal agents, reliance
on the use of plant resistance is considerably high. Since the
first report of this disease in 1962, a systematic study has been
conducted at the International Rice Research Institute (IRRI)
and in Japan. After a series of inoculation tests, Ogawa et al
(1991) found that different resistance genes seem to link to
different ecotypes of rice. This report presents results on resistance
to BB and the significance of varietal groups.
BB resistance and varietal groups
Since 1983, a series of inoculation tests has been conducted at
IRRI. Varieties coming from one country were inoculated as a
group: 1,000 varieties per country at random. Native varieties
were classified into nine groups (Table 1, Ogawa et al 1998).
The Java14, TKM6, DZ192, CAS209, and TN1 groups contained
several varieties (major group), while the Mond Ba,
DV85, Makhmal Mehi, and BJ 1 groups included a few varieties
only (minor group). Because of the presence of natural
genes, five major varietal groups were formed.
Genetic diversity, evolution, and alien introgression 99

Table 1. Patterns of reaction to Philippine races of bacterial blight (BB) and associated ecotypes and main distribution (summarized from
Ogawa et al 1998).
Varietal Reaction pattern to BB races a Estimated Associated
group gene ecotype Main geographical distribution
1 2 3 4 5 6
Java14 RB RB RB RB RB S Xa3 Japonica Korea, China, Laos, Philippines, and Indonesia
TKM6 R S S MR RB S Xa4 Aman, Tjereh Bangladesh, India (central and southern parts),
Sri Lanka, Indonesia, Cambodia, and Myanmar
DZ192 R R R MS R S xa5 Aus, boro Bangladesh, Nepal, India (northern area), and
Pakistan
CAS209 S HR S S R S Xa10 Aman Vietnam, Myanmar, and India
Mond Ba R HR S MR R MS Xa4 + xa10 Aman Vietnam, Myanmar, and India
DV85 HR HR HR R HR MS xa5 + Xa7 Boro, Aus Vietnam, Myanmar, and India
Makhmal Mehi R R R R R MS Xa4 + xa5 Aman, boro, aus Vietnam, Myanmar, and India
BJ1 R R R R R R xa5 + xa13 Boro, aus Vietnam, Myanmar, and India
TN1 S S S S R S Xa14 Indica, japonica Malaysia, Vietnam, and China
a RB = resistant with browning margin around the lesion, S = susceptible, R = resistant, MR = moderately resistant, HR = highly resistant, MS = moderately susceptible.
Java14 group (Xa3)
Varieties in the Java14 group were resistant to four Philippine
races and developed brownish areas around the lesion (Table
1). They showed similar morphology: round grain, long awn,
long panicle, and limited tillering. This morphology indicates
that they belong to the bulu type (tropical japonica, upland
rice, or javanica). Varieties in this group come from wider areas
than varieties in other groups, but mainly from Korea,
China, Laos, the Philippines, and Indonesia.
TKM6 group (Xa4)
Varieties of the TKM6 group were resistant to race 1 and moderately
resistant to race 4 but were susceptible to races 2 and 3
(Table 1). This reaction pattern was similar to that of IR20 and
the resistance of IR20 was introduced from TKM6. This group
was therefore designated as the TKM6 group. Varieties in this
group showed the morphology of a typical indica; they come
mainly from Bangladesh, India (central and southern areas),
Sri Lanka, Indonesia, Cambodia, and Myanmar.
DZ192 group (xa5) and related varietal groups
Varieties of the DZ192 group were mostly resistant to races 1,
2, and 3 but moderately resistant to race 4 (Table 1). Genetic
analysis showed three minor groups: DV85 group (Xa7 and
xa5), Makhmal Mehi group (Xa4 and xa5), and BJ 1 group
(xa5 and xa13). Varieties of this group mostly showed the
morphology of aus or boro and were mainly from Bangladesh,
Nepal, India (northern area), and Pakistan.
CAS209 group (Xa10) and Mond Ba group
(Xa4 + Xa10)
The reaction of the CAS209 group was distinct: resistant to
only race 2 when races 1 to 4 were inoculated (Table 1). Some
varieties showed high resistance to race 2, resistance to race 1,
moderate resistance to race 4, and susceptibility to race 3. These
varieties had Xa4 and Xa10. This reaction pattern was first
noted in variety Mond Ba, so the group was denoted as the
Mond Ba group. Varieties belonging to the CAS209 and Mond
Ba groups mainly come from Vietnam, Myanmar, and India.
TN1 group (Xa14)
After finding races 5 and 6, we carried out the test using these
two races. We found that TN1 showed a specific reaction: resistant
only to race 5 and susceptible to other races (Table 1).
Genetic analysis confirmed a new gene (Xa14) (Taura et al
1992), and we denoted this group as the TN1 group. Varieties
of this group are mainly distributed in Malaysia, Vietnam, and
China.
Isozyme types and related characteristics
of each varietal group
These varietal groups underwent isozyme classification as established
by Glaszmann (1987). The Java14 group involved
almost all the isozyme types and type VI was predominant
(Table 2). In contrast, the majority of the DZ192 group was
type II. All varieties of the TKM6 group consisted of type I
and intermediate types (IM) only. Most varieties of the CAS209
and Mond Ba groups were type I. The TN1 group was found
to have either type I or VI. Further analysis revealed that some
allele combinations were specific to a particular group (Table
2). With isozyme type II, the co-presence of Amp1-2 and Amp2-
2 was predominant in the DZ192 group, whereas the combination
of Amp1-1 and Amp2-1 was peculiar to the Java14 group.
This kind of difference prompted further exciting possibilities
that a different allele combination could link to different phenotypes:
for instance, a colored brown rice was very frequent
in type II of the DZ192 group, while noncolored grain was
popular in type II of the Java14 group. For photoperiod sensitivity,
the majority of the Java14 (type VI) and DZ192 (type
II) groups were classified as photoperiod-insensitive, whereas
almost all varieties of the CAS209 (type I) group were highly
photoperiod-sensitive (Table 2). Half of the TKM6 (type I)
group was photoperiod-insensitive. When brown rice color was
100 Advances in rice genetics

Table 2. Morphological and physiological characteristics associated with bacterial blight-resistant groups.
Characteristics Java14(Xa3) TKM6(Xa4) DZ192(xa5) CAS209(Xa10) TN1(Xa14)
%
Isozyme type I a
Type I with Amp1 1 (typical indica) 4 79 4 77 83
Type I with Amp1 4 (typical indica) – 4 * b 17 3
Type II with Amp1 2 and Amp2 2 (aus, boro) * – 66 – –
Type II with Amp1 1 and Amp1 2 (aus, boro) 8 – * – –
Othe type II (aus, boro) – – 19 * 70
Type III (deepwater varieties) – – 4 * –
Type IV (floating rice) * – – – –
Type V (basmati from Myanmar to Iran) 6 – – 2 *
Type VI (japonica rice: ken, bulu, upland) 71 – * – 13
Intermediate (IM) type 9 17 5 3 *
Photosensitivity
Sensitive * * 48 99 –
Insensitive 99 99 52 * –
Brown rice
Colored 8 88 59 14 –
Noncolored 92 12 41 86 –
Indica-japonica classification c
Indica type 50 100 100 100 88
Japonica type 50 – – – 12
Phenol color reaction c
Ph (+) 18 98 79 92 44
Ph (–) 82 2 21 8 56
KClO 3 resistance c
K-resistant 61 15 5 13 23
K-susceptible 39 85 95 87 77
a Isozyme types were summarized from Endo and Ogawa (1997). b *=less than 1%. c Indica-japonica types were summarized from Endo et
al (1998). Ph and K values were the determinants of the indica-japonica classification.
contrasted, noncolored rice was predominant in the CAS209
group, while the colored and noncolored grains were mixed
half and half in the TKM6 group. These observations suggest
that phenotypic diversity was linked with the diversity of
isozyme genotypes.
Morphological and physiological characters for varietal
differentiation
In the past, many different morphological and physiological
criteria have been used to classify rice ecotypes. Morinaga
(1968) considered several rice ecotypes as a unit to study diversity,
whereas a phylogenetic lineage grouping of indica and
japonica types has been widely used (Matsuo 1952, Oka 1958,
Sato 1991). These lineage classifications are essentially based
on the idea that some discrete groups are defined a priori. Yet,
naturally formed BB varietal groups are studied.
Indica-japonica classification
Following the method described in Sato (1991), indica and
japonica types were classified (Endo et al 1998). The japonica
type was involved in only half of the Java14 group, followed
by 10% of the TN1 group, that is, a great majority was indica
type (Table 2). For isozyme type VI, almost half was japonica
type in the Java14 group, whereas all isozyme type VI was
japonica type in the TN1 group. Isozyme type VI of the TN1
group mainly comes from China, while isozyme type VI of the
Java14 group is distributed widely in Asia (Table 1). It seems
that japonica corresponds to type VI in an East Asian cline.
Alkali degradation is another criterion to separate tropical and
temperate japonicas (Oka 1958), but no clear dividing point
has been detected (Ogawa et al 1998). When isozyme type VI
of the TN1 group was compared with that of the Java14 group,
varieties of the TN1 group tended to have KOH susceptibility,
whereas Indonesian varieties (bulu) of the Java14 group showed
tendencies ranging from resistance to susceptibility. This supports
the conclusion that the determinant of the indica-japonica
classification can be ascribed to the East Asian cline.
Grain-shape variation
With grain shape as a criterion, as proposed by Matsuo (1952),
the following classification can be made: japonica is A type,
javanica is B type, and indica is C type. Grain-shape variation,
however, was not distinct among the BB varietal groups, except
for the TN1 group (see details in Ogawa et al 1998), nor
among isozyme types I, II, and VI. In the TN1 group, isozyme
type VI tended toward the A zone, while type I was scattered
in the C zone (Fig. 1). When the East Asian isozymes (type
VI) were plotted, those varieties tended toward the A zone, as
well as type VI originating from Bangladesh and northern In-
Genetic diversity, evolution, and alien introgression 101

Frequency (%)
70 A
Non-Asia
Spikelet length (mm)
11
B
10
Type 1
Type VI
50
Indonesia
9
60
Philippines
8
80
Southeast Asia
7
50
Bangladesh
6
2.0 2.5 3.0 3.5
Spikelet width (mm)
80
Korea, China, Taiwan (China)
80
Japan
1.0 2.0 3.0 4.0
Length/width ratio
Fig. 1. Grain-shape variation of
the Java14 group (A) and the
TN1 group (B).
Table 3. F 1 seed fertility a (upper orthogonal) and coefficients between genetic distance b and F 1 seed fertility (lower
orthogonal).
Varietal Java 14 group DZ192 group TKM6 group CAS209 group
group Gene
Min. Av Max. Min. Av Max. Min. Av Max. Min. Av Max.
Java14 Xa3 2.8 78.7 97.4 0.9 49.3 97.8 4.7 34.8 79.1 0.8 53.7 95.7
(0.80)
DZ192 xa5 26.2 68.1 94.3 37.3 67.3 96.0 24.0 76.1 96.9
(0.83) (0.88)
TKM6 Xa4 24.7 79.2 96.1 20.2 80.5 97.6
(0.75) (0.91) (0.91)
CAS209 Xa10 5.4 67.6 92.3
(0.56) (0.91) (0.93) (0.88)
TN1 Xa14
(–) (–) (–) (–)
a F 1 seed fertility was adjusted from Ogawa et al (1998), showing minimum (min.), average (av), and maximum (max.). b Genetic distance (Nei
1987) was calculated based on polymerase chain reaction analysis with random primers.
dia (data shown as length-width ratio in Fig. 1). Thus, a geographic
cline toward East Asia as well as northern India was
shown for grain-shape variation.
F 1
seed fertility and genetic diversity
Seed fertility was initially used as a criterion, leading to two
groups as subspecies indica and japonica (Kato 1930). At this
point, we crossed representative varieties (see details in Ogawa
et al 1998) and random amplified polymorphic DNA analysis
was applied to study genetic diversity. It was found that F 1
seed fertility varied not only between groups but also within
groups, depending on the individual combination (Table 3).
The results suggest that variation in F 1 seed fertility is essentially
on an individual basis with less association with varietal
group, presumably reflecting specific genes for sterility. This
idea is supported by the correlation analysis between F 1 seed
fertility and the genetic distance defined by Nei (1987): the
correlation coefficient was very high both between and within
groups.
102 Advances in rice genetics

References
Endo N, Ogawa T. 1997. Breed. Sci. 47:237-243.
Endo N, Taura S, Akiyoshi M, Ogawa T. 1998. Relationship between
the cultivar groups resistant to rice bacterial blight and
indica-japonica classification. Breed. Sci. 48:349-353.
Glaszmann JC. 1987. Isozymes and classification of Asian rice varieties.
Theor. Appl. Genet. 74:21-30.
Matsuo T. 1952. Geneaological studies on cultivated rice. Bull. Nat.
Inst. Agric. Sci. D 3:1-11.
Morinaga T. 1968. Trop. Agric. Res. Ser. 3:1-15.
Nei M. 1987. Phylogenetic trees. In: Molecular evolutionary genetics.
New York (USA): Columbia University Press. p 287-326.
Ogawa T, Busto GA, Tabien RE, Romero GO, Endo N, Khush GS.
1991. Grouping of rice cultivars based on reaction pattern to
Philippine races of bacterial blight pathogens (Xanthomonas
campestris pv. oryzae). Jpn. J. Breed. 41:109-119.
Ogawa T, Endo N, Busto Jr. GA, Tabien RE, Taura S, Khush GS.
1998. Res. Rep. Agric. Dev. Hokuriku Area No. 40:1-180.
Oka HI. 1958. Intervarietal variation and classification of cultivated
rice. Indian J. Genet. Plant Breed. 18:79-89.
Sato YI. 1991. Variation in spikelet shape of the indica and japonica
rice cultivars of Asian origin. Jpn. J. Breed. 41:121-134.
Taura S, Ogawa T, Tabien RE, Khush GS, Yoshimura A, Omura T.
1992. Resistance gene of rice cultivar, Taichung Native, to
Philippine races of bacterial blight pathogens. Jpn. J. Breed.
42:195-201.
Notes
Authors’ addresses: T. Ogawa, Chugoku National Agricultural Experiment
Station, Fukuyama, Hiroshima, Japan; N. Endo, Biotechnology
Research Center, Taisei Corporation, Narashino,
Chiba, Japan; G.A. Busto Jr. and G.S. Khush, Plant Breeding,
Genetics, and Biochemistry Division, IRRI, Philippines; R.E.
Tabien, PhilRice, Maligaya, 3119 Muñoz, Nueva Ecija, Philippines;
S. Taura, Gene Research Center, Kagoshima University,
Kagoshima, Japan.
Advances in rice chromosome research, 1995-2000
K. Fukui
The most significant accomplishment in rice chromosome research during the last 5 years has been the development of
fluorescence in situ hybridization (FISH) methods. Now, these methods are routinely used to localize genes of practical importance
on rice chromosomes. Three new rice genomes of G, H, and J were designated 36 years after the assignment of the F
genome in 1961. The orientation of the molecular linkage map of rice has been attained for the first time using secondary
trisomics and telotrisomics. Advances in rice chromosome research are summarized by (1) molecular cytology, (2) genomeand
chromosome-related research, and (3) new technologies.
Advances in rice chromosome research during the last few years
have been characterized by three features. First, dramatic improvement
was attained in molecular cytology, expanding the
target material from chromosomes to DNA fibers. Single-copy
genes can be localized on rice chromosomes. Moreover, genomic
in situ hybridization (GISH) became useful in breeding
programs. Second, three new rice genomes were assigned by
Southern hybridization methods instead of conventional cytological
observation of the meiotic configuration of homologous
chromosomes. The rice centromeres have been mapped
on linkage maps and the orientation of the molecular linkage
map was presented. Third, new technologies have continuously
been developed in the field of rice chromosome research. The
cloning of a functional domain of rice chromosomes, the development
of new software to analyze rice pachytene chromosomes,
and the identification of rice chromosome organization
within a nucleus will be reviewed. The effectiveness of
the molecular cytological approaches to rice genome research
has been reviewed earlier (Fukui and Ohmido 2000a).
Advances in molecular cytology
Fluorescence in situ hybridization (FISH)
The first reproducible rice FISH results were reported in 1994
using 45S rDNA as the probe (Fukui et al 1994). Then, the
development of FISH methods in rice chromosome research
went far beyond what we had expected (Fukui 1996). Major
advances in FISH on rice chromosomes include (1) the target
nucleotide sequences were broadened from repeated genes,
such as ribosomal RNA genes, to single-copy DNA sequences;
(2) the target materials were broadened from somatic chromosomes
to DNA fibers; and (3) a single color was used to detect
fluorescent signals before; now, many colors can be used simultaneously.
As a result, several useful genes, which are sometimes
single-copy genes, were physically mapped on the rice chromosomes.
Useful genes, Gm2, Pib, Xa21, and an RFLP marker
(Xnp247), etc., have successfully been visualized on rice chromosomes.
The genes detected were often located at the termi-
Genetic diversity, evolution, and alien introgression 103

A B C
D
E
nal regions, suggesting the concentrated localization of transcriptionally
active genes at the terminal regions of rice chromosomes.
Shishido et al (1996) detected the third 45S rDNA
locus in Oryza eichingeri (CC) by FISH. A peculiar distribution
of rDNA loci has been found in rice genomes different
from collinearity among rice and other cereal species.
FISH on extended DNA fibers (EDF-FISH)
Recent visualization methods allow us to directly see even
single DNA molecules under a fluorescence microscope. Extension
of repetitive sequences was visualized on DNA fibers
by the FISH method targeting DNA fibers. After FISH on extended
DNA fibers (EDF-FISH) using tandem repeat sequence
A (TrsA) and telomere sequences as probes, dot-like fluorescent
signal tracks of TrsA and telomere sequences were visualized
(Ohmido et al 2001). By using EDF-FISH, the amounts
of four different repetitive sequences of 45S rDNA, 5S rDNA,
telomere sequences, and TrsA between indica and japonica
rice were compared. As a result, indica showed higher contents
of all four repetitive sequences. It is thus concluded that
the FISH method, especially on DNA fibers, contributes much
to quantitative analyses of the copy number of the genes and
repetitive sequences.
Genomic in situ hybridization (GISH)
GISH is the method of painting chromosomes belonging to
different genomes with different colors. Although GISH in rice
was developed earlier by Fukui et al (1997), it has made much
progress more recently. These authors detected the fluorescent
signal from the genomic DNA of O. officinalis (CC) on
the C-genome chromosomes in O. minuta (BBCC) and O.
latifolia (CCDD). They have shown that the phylogenetic distance
between the C and D genomes is closer than that between
B and C by comparing fluorescence intensity among
the chromosomes in different genomes. Multicolored GISH in
rice was used to detect the specific elimination of chromosomes
in the B and C genomes in somatic hybrids with A (O.
sativa), B, and C (O. punctata) genomes. The three different
genomes were painted differently and chromosome reduction
in the specific genomes was unequivocally revealed. GISH is
also used to monitor chromosomal behavior in wide crosses
(Abbasi et al 1999).
Advances in genome- and chromosome-related research
New rice genomes and genome organization
Three new genomes were assigned by molecular means. Six
genomes from A to F had been reported and accepted to date.
After the assignment of the F genome in 1961, no report appeared
until the G (O. meyeriana), H, and J (O. ridleyi) genomes
were reported (Aggarwal et al 1997). These three new
genomes were assigned not by conventional hybridization experiments
followed by observation of meiotic configuration
but by genomic DNA hybridization.
Dong and Jiang (1998) reported a three-dimensional organization
of rice chromosomes within a rice nucleus. Using
the FISH method with telomere- and centromere-specific sequences,
they found no fixed allocation of rice chromosomes
within a nucleus (Rabl pattern) but a more or less random distribution
of telomeres and centromeres within a nucleus. This
104 Advances in rice genetics

tendency is common among plant species with a smaller genome
size. Telomere sequences within a nucleus have shown
random distribution.
Centromere mapping, introgression lines,
and the rice B chromosome
Using secondary trisomics, telotrisomics, and RFLP markers,
the positions of the centromeres on rice chromosomes were
located and the correct orientation of linkage maps obtained
(Singh et al 1996). Wang et al (2000) also mapped centromeric
regions on the molecular linkage map using centromereassociated
sequences.
Efforts in developing alien introgression lines continue
by using all the wild species that represent the A, B, C, BC,
CD, E, F, G, and HJ genomes at IRRI. A series of hybrids and
monosomic alien addition lines have successfully been produced
through an embryo rescue method, especially after remote
hybridization. Several useful traits—such as cytoplasmic
male sterility and resistance genes for grassy stunt virus,
bacterial blight, blast, brown planthopper, etc.—have been
introduced (Brar and Khush 1997). These efforts are urgently
needed to broaden the rice gene pool by introgressing genes
from diverse sources.
Rice B chromosomes were found in a rice aneuploid
variation among the progenies of triploid Zhongxian 3037
(Cheng et al 2000). Molecular markers on all 24 arms of the
rice chromosomes did not show any dosage effects; therefore,
B chromosomes might not have originated from any A-chromosome
fragments.
Advances in new technologies in rice chromosome research
The use of imaging technologies in the construction of the rice
somatic chromosome map and pachytene chromosome map,
cloning of functional domains of rice chromosomes or centromeres,
precise measurement of genome sizes of several rice
species by flow cytometry, and other technologies have been
reported in the last few years. Uozu et al (1997) reported genome
sizes of several rice species and revealed a strict relationship
between genome size and chromosome morphology.
A quantitative chromosome map of indica rice (IR36) has been
constructed by means of image analysis methods. Imaging
methods have been shown to be effective to quantitatively develop
the rice somatic chromosome map (Fukui and Iijima
1991). The third-generation image-analyzing system, CHIAS
3, has been developed. Furthermore, software for the analysis
of pachytene chromosomes is being developed. Based on the
preliminary analysis of rice chromosome 9 with a nucleolar
organizing region (NOR), large differences have been found
among three maps prepared from somatic chromosomes,
pachytene chromosomes, and a molecular map, especially at
the satellite regions. The result indicates that different maps
contain different biological information and that integration
of these maps is important.
Rice centromeric sequences are being analyzed to produce
a rice artificial chromosome. All the rice chromosomes
have an Arabidopsis-type telomere at the ends of the chromosomes.
Cloning of a functional centromere is an important step
toward constructing rice artificial chromosomes. Nonomura
and Kurata (1999) cloned a 264-bp sequence (RCS1516) by
PCR using CENP-B box-like sequences (CBLS). They characterized
the structure of a 14-kb centromere sequence in the
rice genome that includes 1.9-kb direct repeats.
In conclusion, rice chromosome research has developed
rapidly, introducing new technologies and giving new results.
We anticipate that rice chromosome research will become more
advanced and will provide indispensable information for rice
breeding, genetics, and genome research.
References
Abbasi FM, Brar DS, Carpena AL, Fukui K, Khush GS. 1999. Detection
of autosyndetic and allosyndetic pairing among A and
E genomes of Oryza through genomic in situ hybridization.
Rice Genet. Newsl. 16:24-25.
Aggarwal RK, Brar DS, Khush GS. 1997. Two new genomes in the
Oryza complex identified on the basis of molecular divergence
analysis using total genomic DNA hybridization. Mol. Gen.
Genet. 254:1-12.
Brar DS, Khush GS. 1997. Alien introgression in rice. Plant Mol.
Biol. 35:35-47.
Cheng ZK, Yu HX, Yan HH, Gu MH, Zhu LH. 2000. B chromosome
in a rice aneuploid variation. Theor. Appl. Genet.
101:564-568.
Dong F, Jiang J. 1998. Non-Rabl patterns of centromere and telomere
distribution in the interphase nuclei of plant cells. Chromosome
Res. 6:551-558.
Fukui K. 1996. Advances in rice chromosome research, 1990-1995.
In: Khush GS, editor. Rice genetics III. Proceedings of the
3rd International Rice Genetics Symposium, 16-20 Oct 1995.
Manila (Philippines): International Rice Research Institute.
p 117-130.
Fukui K, Iijima K. 1991. Somatic chromosome map of rice by imaging
methods. Theor. Appl. Genet. 81:589-596.
Fukui K, Ohmido N. 2000a. Rice genome research: an alternative
approach based on molecular cytology. In: Gustafson JP, editor.
Genomes. New York (USA): Kluwer Academic/Plenum
Publishers. p 109-121.
Fukui K, Shishido R, Kinoshita T. 1997. Identification of the rice D-
genome chromosomes by genomic in situ hybridization. Theor.
Appl. Genet. 95:1239-1245.
Fukui K, Ohmido N, Khush GS. 1994. Variability in rDNA loci in
genus Oryza detected through fluorescence in situ hybridization.
Theor. Appl. Genet. 87:893-899.
Nonomura KI, Kurata N. 1999. Organization of the 1.9-kb repeat
unit RCE1 in the centromeric region of rice chromosomes.
Mol. Gen. Genet. 26:1-10.
Ohmido N, Kijima K, Ashikawa I, Hans de Jong J, Fukui K. 2001.
Visualization of the terminal structure of rice chromosomes 6
and 12 with multicolor FISH to chromosomes and extended
DNA fibers. Plant Mol. Biol. 47:413-421.
Shishido R, Sano Y, Fukui K. 1996. The third 45S rDNA locus in O.
eichingeri CC newly detected by an improved FISH method.
Rice Genet. Newsl. 13:84-85.
Genetic diversity, evolution, and alien introgression 105

Singh K, Ishii T, Parco A, Huang N, Brar DS, Khush GS. 1996.
Centromere mapping and orientation of the molecular linkage
map of rice (Oryza sativa L.). Proc. Natl. Acad. Sci. USA
93:6163-6168.
Uozu S, Ikehashi H, Ohmido N, Ohtsubo H, Ohtsubo E, Fukui K.
1997. Repetitive sequences: cause for variation in genome
size and chromosome morphology in the genus Oryza. Plant
Mol. Biol. 35:791-799.
Wang S, Wang J, Jiang J, Zhang Q. 2000. Mapping of centromeric
regions on the molecular linkage map of rice (Oryza sativa
L.) using centromere-associated sequences. Mol. Gen. Genet.
263:165-172.
Notes
Achievements in rice cytogenetics
Hsin-Kan Wu and Ming-Hong Gu
Author’s address: Department of Biotechnology, Graduate School
of Engineering, Osaka University, Suita 565-0871, Osaka,
Japan.
Rice chromosomes are so small that it was difficult to peruse any cytogenetic data before 1960. In 1978, Dr. Kurata of Kyushu
University invented a technique that revealed rice somatic prometaphase chromosomes with clear-cut centromere position and
a total length varying from a few to more than 10 microns. This technique, in combination with that for pachytene chromosomes
explored in 1987, yielded many basic results: (1) the karyotypes of several cultivated and wild rice species showed
specific differences, (2) several sets of rice translocations were identified and used to correspond the genetic linkage groups
to chromosomes identified in the karyotype and to map morphological marker genes, and (3) two series of rice primary
trisomics have been examined. The invention of rice chromosome techniques can be regarded as the first milestone in rice
cytogenetics and the second was the construction of a molecular linkage map in 1988. The designation of the map was based
on an approved agreement in 1990 at IRRI. The molecular maps have been expanded and a new saturated map, consisting of
2,300 DNA markers, has been released in Japan. These maps are the basis for mapping of genes, marker-assisted selection,
comparative genomics, map-based gene isolation, and the like. Mapping of rice single-copy markers or genes has lagged
behind that of repetitive sequences. Fluorescent in situ hybridization (FISH) with nonisotope probes was found superior to that
with isotope probes. Achieving reliable signals of a single-copy gene below 10 kb has remained difficult. However, bacterial
artificial chromosome (BAC) clones containing a target single-copy gene produce good-quality signals on rice chromosomes.
Thus, FISH with BACs can be used to locate single-copy genes. Its future use in rice is promising, especially when detection
schemes with high resolution are adopted. As the complete rice genome sequence becomes available, the use of functional
genes would be substantially facilitated on the basis of cytogenetic knowledge accumulated in the past few decades—from the
chromosome to the DNA level.
Rice chromosomes are so small that it was difficult to peruse
any conventional cytogenetic studies, except for counting the
number of chromosomes specific to a species. Shastry et al
(1960) first suggested the use of rice chromosomes at the
pachytene stage to number chromosomes in descending order.
However, the order was found to be substantially different from
that found in three other laboratories (Oka and Wu 1988). Seven
years later, Wu (1967) explored the double mordant technique
for rice pachytene chromosome preparations. When this technique
was used in combination with that invented by Kurata
and Omura (1978) for mitotic prometaphase chromosomes,
many useful results were obtained.
l The karyotypes of several cultivated and wild rice
species were analyzed (Wu and Li l964, Kurata and
Omura l978, Chen and Wu l982, Chung and Wu l987,
Chung et al l993a). Variation was specific to the species.
In general, the l2 pairs of cultivated rice can be
well recognized. Chromosome 4 is unique in morphology,
with a heterochromatic short arm and the
biggest long arm to short arm ratio (L/S). Chromosomes
8 and l0 are the nucleolar chromosomes (in
l
l
the case of indica; there is only one in japonica, chromosome
8) attached to the nucleolus with their short
arm ends. Chromosome 10 is more metacentric. Undoubtedly,
the defined karyotypes are the basis for
identifying rice translocations and trisomics and for
physical mapping of rice genes.
Several previously reported rice translocations
(Nishimura l96l) were identified. These lines have
been used to relate rice genetic linkage groups to chromosomes
and to map rice genes (Iwata and Omura
197la,b, Chung and Wu 1994, Sato et al 1973, 1975,
Chen et al 1982).
At least two series of rice primary trisomics, one in
indica and one in japonica, were produced. The identification
of the extra chromosomes involved in the
two trisomic series was respectively reported by
Khush et al (1984) and Iwata and Omura (1984).
However, because of differences in chromosome
preparation technique, discrepancies occurred among
the identification groups (Khush at al 1984, Kurata
1988, Chung and Wu 1987, Wu and Chung 1988) of
106 Advances in rice genetics

the indica trisomic series isolated at IRRI. Later studies
showed that such discrepancies could also be
caused by the instability found in some of the triplos
(Chung and Wu 1997). After several meetings, an
agreement on chromosome numbering was approved
during the 2nd International Rice Genetics Symposium
in 1990. The third trisomic series was isolated
by Cheng (1999), following the 1990 numbering system.
In addition, a previously unknown set of 24
telotrisomics was also reported in his dissertation. The
first rice molecular map was constructed (McCouch
et al 1988) on the basis of the well-identified indica
trisomic series.
Nagao and Takahashi (1963) attempted the first rice genetic
map. However, a fine correspondence between rice linkage
groups and their chromosomes was not figured out until
chromosomes involved in the translocation and the trisomics
were appropriately defined in 1990. Kinoshita completed the
compilation of rice genes in the same year. This accumulated
knowledge about 300 rice genes in a period of 50 years (1940-
90) as reported in 224 papers. The rice linkage map was reported
to have about 160 genes located in 12 linkage groups
(Kinoshita 1990).
Mapping of genes at the rate of three genes per year could
not meet rice breeders’ needs. A genetic map of 144 DNA
molecular markers was constructed (McCouch et al 1988).
Amazingly, mapping of molecular markers was 12-fold faster
than conventional mapping using morphological markers. In
1994, a map with 726 DNA molecular markers (with an average
distance of 2 cM between two neighboring markers) was
reported (Causse et al 1994). Kurata et al (1994) constructed a
highly dense rice genetic map of 1,383 DNA. The distance
between the markers was as little as 1.14 cM on average. The
markers on the linkage maps were used in marker-based cloning
and breeding.
A gene that confers resistance to bacterial blight (xa21)
was found tightly linked to RG103 on chromosome 11 (Ronald
et al 1992). Another gene, Pi5(t), resistant to rice blast race
P06-6, was located on chromosome 4, flanked by markers
RG498 and RG864 (Wang et al 1994). A new locus, S18, which
affects high F 1 pollen sterility, was mapped between two DNA
markers, G1084 and R1629. These markers are 5.3 cM apart
on rice chromosome 10 (Doi et al 1998).
Gustafson and Dille (1992) mapped several cDNA markers
from the rice linkage group and found that the mapped
sites on the chromosome did not coincide with those on the
linkage groups. This suggests that a linkage (genetic) map
should not be regarded as a chromosome (physical) map.
Mapping of single-copy genes on rice chromosomes beyond
that of repetitive sequences is infrequent. Using radioisotopes,
telomeric sequences have been mapped at either one
or both ends of most rice prometaphase chromosomes (Chung
et al l993b). Mapping of 45s rRNA genes with a
nonradioisotope-labeled probe by FISH has been successful
(Fukui et al 1994). In our laboratory at Yangzhou University,
chromosome morphology can be so well retained after a modified
FISH with digoxigenin (DIG) labeling that the chromosome
image can be directly read. The 45s rRNA gene signals
are located at the ends of chromosomes 9 and l0. A successful
mapping of bacterial artificial chromosome (BAC) clones on
rice chromosomes (Jiang et al 1995) opens a channel where
rice single-copy genes or sequences can be indirectly mapped
with confidence. First, a BAC library is screened by the ECL
system using a single-copy target gene probe and hybridized
to the membrane. The positive BAC clone is used, in turn, as a
probe hybridized to rice chromosomes by FISH. Finally, the
localized BAC clones are digitally mapped (Jackson et al
1999).
Recently, a new FISH method called fiber-FISH has become
available. Jackson et al (1998) applied the extended DNA
fiber technique to the physical mapping of Arabidopsis
thaliana.
Other than the strategies mentioned above, synaptonemal
complex (SC) spreads (hypotonically spread pachytene
chromosomes) can be used in the mapping of single- and lowcopy
sequences as Peterson et al (1999) demonstrated. A minor
modification of the double-mordant technique for rice
pachytene chromosome preparation (Wu l967) would make it
possible to map rice single-copy genes on the SC with SC-
FISH.
Rice cytogenetics would contribute more to phase III of
the rice genome project. In phase III, the function of rice genes
will be identified (Wu 1999). Transgene expression may be
stable or unstable. Cytogenetic analysis in tobacco by FISH
showed that stably expressed transgenes were present in the
vicinity of telomeres. The unstably expressed transgenes occupied
intercalary and paracentromeric locations (Iglesias et
al 1997). It seems that transgene expression may be affected
by the site of integration on the chromosome (position effect)
beyond the number of transgene constructions integrated and
the structure of the plant DNA flanking the integrated construction.
References
Causse MA, Fulton TM, Cho YG, Ahn SN, Chunwongse J, Wu K,
Xiao J, Yu Z, Ronald PC, Harrington SE, Second G, McCouch
SR, Tanksley SD. 1994. Saturated molecular map of the rice
genome based on an interspecific backcross population. Genetics
138:1251-1274.
Chen JT, Lai HC, Huang IH, Chung MC, Wu HK. 1982. Identification
of rice translocation and the location of lazy (la) gene.
Bot. Bull. Acad. Sin. 23:71-87. (Chinese/English.)
Chen YJ, Wu HK. l982. A comparison of karyotypes among six Oryza
species. Bot. Bull. Acad. Sin. 23:l63-l83.
Cheng ZK. 1999. Rice aneuploids: origin, identification and application
in rice genomic research. Dissertation. Agric Yangzhou
University, Yangzhou, Jiangsu, China.
Chung MC, Wu HK. 1987. Karyotype analysis of IR36 and two trisomic
lines of rice. Bot. Bull. Acad. Sin. 28:289-304.
Chung MC, Wu HK. 1997. Chromosome instability induced by fragments
in trisomic rice (Oryza sativa L.). Cytologia 62:67-79.
Genetic diversity, evolution, and alien introgression 107

Chung MC, Wu HK. 1994. Cytological identification of the chromosomes
involved in Nishimura’s reciprocal translocation
lines. Theor. Appl. Genet. 88:956-964.
Chung MC, Ning CN, Wu HK. l993. Localization of ribosomal RNA
genes on rice chromosomes. Bot. Bull. Acad. Sin. 34:43-55.
Chung MC, Ning CN, Wu T, Wu R, Wu HK. 1993. Localization of
a repetitive sequence, (CCCTAAA) 11 , at the ends of rice chromosomes.
Rice Genet. Newsl. 10:123-125.
Doi K, Taguchi K, Yoshimura A. 1998. A new locus affecting high
F 1 pollen sterility found in backcrosss progenies of japonica
rice and African rice. Rice Genet. Newsl. 15:146-148.
Fukui K, Ohmido N, Khush GS. 1994. Variability in rDNA loci in
the genus Oryza detected through fluorescence in situ hybridization.
Theor. Appl. Genet. 87:893-899.
Gustafson P, Dille JE. 1992. Chromosome location of Oryza sativa
recombination linkage groups. Proc. Natl. Acad. Sci. USA
89:8646-8650.
Iglesias VA, Moscone EA, Papp I, Michalowski S, Phelan T, Spiker
S, Neuhuber F, Matzke M, Matzke AJM. 1997. Molecular
and cytogenetic analysis of stably and unstably expressed
transgene loci in tobacco. Plant Cell 9:1251-1264.
Iwata N, Omura T. 1971a. Linkage analysis by reciprocal translocation
method in rice plants (Oryza sativa L.). I. Linkage groups
corresponding to the chromosome 1, 2, 3, 4. Jpn. J. Breed.
21:19-28. (In Japanese/English.)
Iwata N, Omura T. 1971b. Linkage analysis by reciprocal translocation
method in rice plants (Oryza sativa L.). II. Linkage groups
corresponding to the chromosome 5, 6, 7, 8, 9, 10, and 11.
Sci. Bull. Fac. Agric. Kyushu Univ. 25:137-153. (In Japanese/English.)
Iwata N, Omura T. 1984. Studies on the trisomics in rice plants. V.
Relationship between the twelve chromosomes and the linkage
groups. Jpn. J. Breed. 34:314-321.
Jackson SA, Dong F, Jiang J. l999. Digital mapping of bacterial artificial
chromosome by fluorescence in situ hybridization. Plant
J. l7:58l-587.
Jackson SA, Wang MI, Goodman HM, Jiang J. l998. Application of
fiber FISH in physical mapping of Arabidopsis thaliana. Genome
4l:566-572.
Jiang J, Gill BS, Wang GL, Ronald PC, Ward DC. l995. Metaphase
and interphase fluorescence in situ hybridization mapping of
the rice genome with bacterial artificial chromosomes. Proc.
Natl. Acad. Sci. USA 92:4487-449l.
Khush GS, Singh RJ, Sur SC, Librojo AL. 1984. Primary trisomics
of rice: origin, morphology, cytology and use in linkage mapping.
Genetics 107:141-163.
Kinoshita T. 1990. Report of the committee on gene symbolization,
nomenclature and linkage groups. Rice Genet. Newsl. 7:16-
50.
Kurata N. 1988. Identification of trivalent chromosomes of IR36
Triplo plants. Rice Genet. Newsl. 5:54-59.
Kurata N, Omura T. 1978. Karyotype analysis in rice. I. A new method
for identifying all chromosome pairs. Jpn. J. Genet. 53:251-
255.
Kurata N, Nagamura Y, Yamamoto K, Harushima Y, Sue N, Wu J,
Antonio BA, Shomura A, Shimizu T, Lin SY, Inoue T, Fukuda
A, Shimano T, Kuboki Y, Toyama T, Miyamoto Y, Kirihara T,
Hayasaka K, Miyao A, Monna L, Zhong HS, Tamura Y, Wang
ZX, Momma T, Umehara Y, Yano M, Sasaki T, Minobe Y.
1994. A 300 kilobase interval genetic map of rice including
883 expressed sequences. Nat. Genet. 8:365-372.
McCouch SR, Kochert G, Yu ZH, Wang ZY, Khush GS, Coffman
WR, Tanksley SD. 1988. Molecular mapping of rice chromosomes.
Theor. Appl. Genet. 76:815-829.
Nagao S, Takahashi M. 1963. Genetical studies on rice plant. XXVII.
Trial construction of twelve linkage groups in Japanese rice.
Fac. Agric. Hokkaido Univ. 53:72-130.
Nishimura Y. 1961. Studies on the reciprocal translocations in rice
and barley. Bull. Natl. Inst. Agric. Sci. Jpn. Ser. D 9:171-235.
(In Japanese/English.)
Oka HI, Wu HK. 1988. Comparison of data on rice chromosomes
presented by different authors. Rice Genet. Newsl. 5:34-4l.
Peterson DG, Lapitan NLV, Stack SM. l999. Localization of singleand
low-copy sequences on tomato synatonemal complex
spreads using fluorescence in situ hybridization. Genetics
l52:427-439.
Ronald PC, Albano B, Tabien R, Abenes L, Wu KS, McCouch SR,
Tanksley SD. 1992. Genetic and physical analysis of the rice
bacterial blight disease resistance locus, Xa21. Mol. Gen.
Genet. 236:113-120.
Sato S, Kinoshita T, Takahashi M. 1973. Genetical studies on rice
plant. LIV. Linkage analysis of rice plant by the use of
Nishimura’s reciprocal translocation lines. Mem. Fac. Agric.
Hokkaido Univ. 8:367-376. (In Japanese/English.)
Sato S, Kinoshita T, Takahashi M. 1975. Genetical studies on rice
plant. LXII. Linkage analysis of rice plant by the use of
Nishimura’s reciprocal translocation lines induced from linkage
testers. Mem. Fac. Agric. Hokkaido Univ. 9:193-199.
Shastry SVS, Rangarao DR, Misra RM. 1960. Pachytene analysis in
Oryza. I. Chromosome morphology in Oryza sativa. Indian J.
Genet. Plant Breed. 20:l5-21.
Wang GL, Mackill DJ, Bonman JM, McCouch SR, Champoux MC,
Nelson RJ. 1994. RFLP mapping of genes conferring complete
and partial resistance to blast in a durably resistant rice
cultivar. Genetics 136:1421-1434.
Wu HK, Li SY. 1964. Chromosome morphology of Oryza sativa
and Oryza australiensis and their pairing in the F 1 hybrid at
earlier meiosis. Bot. Bull. Acad. Sin. 5:162-169.
Wu HK. 1967. Note on preparation of pachytene chromosomes by
double mordant. Sci. Agric. l5:40-44. (Chinese/English summary.)
Wu R. 1999. Report of the committee on genetic engineering
(Funtional genomics of plants). Rice Genet. Newsl. 16:10-
14.
Notes
Authors’ address: Laboratory of Rice Genetics and Breeding, Agricultural
College, Yangzhou University, Yangzhou, Jiangsu
225009, China.
108 Advances in rice genetics

Advanced cytogenetics in Oryzeae
S.A. Jackson, Z. Cheng, J. Jiang, and R.L. Phillips
Cytogenetic research in rice has lagged considerably behind that in other cereal species, including maize and wheat. However,
the advent of new molecular techniques has facilitated work in rice cytology. Rice pachytene chromosomes are ideal for
fluorescence in situ hybridization (FISH) mapping. The rice genome contains less repetitive DNA than that of many other cereal
species. Even though there are repetitive DNA sequences in most rice bacterial artificial chromosomes (BACs), it is possible to
map these BAC clones on rice chromosomes and DNA fibers by preannealing the probes to rice Cot-1 DNA. Thus, rice genomic
DNA clones are suitable for fiber-FISH mapping and FISH on extended DNA fibers. We found that DNA clones separated by
about 100 kb of DNA can be resolved on rice pachytene chromosomes. This is a much higher resolution than metaphase
chromosomes, where adjacent BACs would have to be separated by several megabases to resolve their order. We recently
developed a set of BACs that can be used to mark all 24 rice chromosome arms. This is a valuable tool for future cytogenetic
mapping in rice. Using fiber-FISH, several rice BACs have been mapped to determine the size of the gaps in BAC contigs that
are set to be sequenced. Several rice BACs have also been mapped in related species within the Oryzeae to determine the
physical conservation of genomic architecture. Based on the fiber-FISH mapping of rice BACs in American wild rice (Zizania
palustris), it appeared that over this evolutionary distance there has been an accumulation of intergenic DNA that is not
conserved between these two species. Although the comparative genetic map of wild rice and rice is more than 80% colinear,
the physical conservation of rice BACs in wild rice appears to be interrupted by DNA sequences that are not shared between
these two species.
Much has been accomplished in rice cytogenetics despite the
diminutive chromosomes of rice. Classical studies describe the
various genomes of the Oryza species by analyzing pairing in
hybrids. Singh et al (1996) used secondary trisomics and
telotrisomics to physically map genes and define the position
of rice centromeres. Because of the size of rice chromosomes,
other classical cytogenetic techniques, such as banding, were
unsuitable for chromosome analysis. However, the advent of
molecular cytogenetic techniques has paved the way for a new
era in rice chromosome research.
New molecular techniques have been applied to describe
the repetitive portion of the rice genome by mapping rDNA
loci on chromosomes and rDNA and other repetitive sequences
on extended DNA fibers (Dong et al 1998, Ohmido et al 2000).
Classical cytogenetic stocks have been combined with molecular
genetics to map sequences to particular chromosomal regions
(Singh et al 1996). Additionally, rice centromeres are
being dissected by molecular biological and molecular cytogenetic
techniques (Dong et al 1998, Wang et al 2000). This is
an exciting time for rice chromosome research since many
genomic resources are available (i.e., YAC—yeast artificial
chromosome—and BAC—bacterial artificial chromosome—
libraries, mutant stocks, rice genome sequencing) and tools
for chromosome research continue to be developed.
Advances in molecular cytogenetics
Molecular cytogenetics began with the development of radioactive
in situ hybridization technology followed by enzymatic
detection and finally by fluorescence technology (FISH). FISH
has become a powerful technique since it can be used on various
cytological targets and multiple sequences can be mapped
simultaneously using different fluors. Different cytological
targets offer differing advantages or disadvantages (Table 1).
Premetaphase I chromosomes at the pachytene stage are
excellent FISH targets. These chromosomes are more extended
than mitotic metaphase chromosomes and offer more resolution
to spatially separate adjacent DNA sequences. We have
been able to resolve adjacent BAC clones separated by as little
as 100 kb. Fiber-FISH is an extension of the basic FISH technique
using extended DNA fibers, prepared from interphase
nuclei, as the target for probe hybridization.
Table 1. Comparison of fluorescence in situ hybridization on various cytological targets.
Cytological target Resolution Minimum Advantages Disadvantages
probe size
Metaphase chromosome 1–2 Mb >20 kb Map to chromosome/arms Low resolution
Interphase nuclei 50 kb–1 Mb >20 kb Good resolution Less chromosomal
information
Pachytene chromosome 100 kb >10 kb Moderate resolution and map Chromosome morphology
to chromosome/arms
is distorted
DNA fibers Approx. 10–500 kb >1 kb High resolution Less chromosomal information
Genetic diversity, evolution, and alien introgression 109

A
C
D
B
E
Fig. 1. (A) BAC 96I15, identified
by screening rice BAC library
with RFLP probe R3166,
hybridizes to the short arm of
chromosome 5 on pachytene
chromosomes (arrow). (B) 5S
ribosomal DNA hybridized to
DNA fibers. The entire locus
is 299.8 kb in size. (C and D)
Rice BACs 32A12 (red) and
06F05 (green) (identified with
RFLP probes S10620 and
S14152, respectively) hybridized
to an interphase nucleus
(C, arrows) where the signals
overlap and to extended DNA
fibers (D) where the two BACs
are separated by a distance
of approximately 195 kb. (E)
RCS2, a high-copy tandemly
repeated centromeric sequence
hybridized to all 12
centromeres on pachytene
chromosomes. In B and D, the
bars are equivalent to 20 µm.
Advances in rice chromosome research
FISH has been a useful tool in rice research for many years
using metaphase chromosomes. Ribosomal DNA loci and other
repetitive sequences have been mapped to specific chromosomes
using FISH. However, only recently have interphase
nuclei, DNA fibers, and pachytene chromosomes become cytological
targets for FISH analyses.
Interphase nuclei and pachytene chromosomes
Interphase nuclei offer a much higher resolving power than
metaphase chromosomes but they must be combined with
analyses on metaphase/pachytene chromosomes to locate a
sequence to a specific chromosome. The distance in micrometers
between two DNA probes in an interphase nucleus is linearly
related to the physical distance in kilobases, over a range
of 100 kb to 1 Mb. FISH using rice interphase nuclei was combined
with FISH using prometaphase chromosomes in rice to
physically define the Xa21 regions using linked BACs (Jiang
et al 1995).
Pachytene chromosomes have long been used to identify
chromosomes in rice because of the ability to more easily
distinguish size, determine arm ratios, locate a nucleolar-organizing
region, and evaluate heterochromatin. However, only
recently have pachytene chromosomes become routine targets
for FISH. Z. Cheng and J. Jiang are currently using pachytene
chromosomes to evaluate/confirm genetic maps and help the
genome community assemble BAC contigs. Using Cot-1 DNA,
they are able to routinely map RFLP-selected BACs to specific
chromosome arms (Fig. 1A). They are also able to distinguish
the order of BACs separated by only 100 kb.
Recently, a set of BACs was developed to cytologically
mark all 24 chromosome arms. This is a valuable tool to be
able to follow individual chromosome arms in breeding applications,
aid in developing aneuploid stocks, and use in basic
research.
Fish on extended DNA fibers (fiber-FISH)
DNA fibers have been used to determine the size/copy number
of the 5S rDNA loci in rice (Ohmido et al 2000, Fig. 1B).
We have also used fiber-FISH to determine the physical distance
between two BACs selected with RFLP markers from
the genetic map of rice (Fig. 1C, D). BACs T06F05 and
T32A12 were selected with RFLP markers S10620 and
S14152, respectively, from chromosome 10. These two RFLP
probes map to the same locus (www.dna.affrc.go.jp/cgi-bin/
accsearch.plD48104), but the physical distance, determined
by measuring the distance in mm between the two BACs on
DNA fibers and converting to kb, was approximately 195 kb.
This has been confirmed in assembling the physical map for
sequencing at the Clemson University Genomics Institute
(CUGI).
110 Advances in rice genetics

Chromosome structure
The DNA structure of rice centromeres has recently begun to
be dissected. A rice centromeric BAC was isolated by screening
a rice BAC library with a cereal centromere-specific probe
(Dong et al 1998). The DNA structure of rice centromeres
appears to consist of a highly repetitive tandem 168-bp sequence
(RCS2, Fig. 1E). Structurally similar sequences (tandem
repeats of 160–180 bp) have been found in other cereal
centromeres but these do not share any sequence identity. Lower
copy repetitive centromeric sequences have been found in rice
and other cereals that can be species-/genera-specific or shared
across genera (Jiang et al 1996 Dong et al 1998).
Comparative physical mapping
Recently, we have focused on comparative physical mapping
using rice BACs as the basic resource. Arabidopsis BACs have
successfully been mapped on chromosomes and DNA fibers
from Brassica rapa (Jackson et al 2000). We have begun to
use this approach in the tribe Oryzeae using rice BACs to physically
define homologous/paralogous regions in related species.
Based on comparative genetic mapping, Zizania palustris
(American wild rice) has a genetic map that is >80% colinear
to the rice genetic map; however, it appears that there has been
an accumulation of intergenic sequences such that it is difficult
to physically define homologous regions by hybridizing
rice BACs to DNA fibers of Z. palustris. However, we are
beginning to use this approach in more closely related wild
Oryza species with better success. By using BACs from several
chromosomal regions of rice, we hope to know precisely
how Oryzeae chromosomes/genomes evolved.
References
Dong F, Miller JT, Jackson SA, Wang G-L, Ronald PC, Jiang J.
1998. Rice (Oryza sativa) centromeric regions consist of complex
DNA. Proc. Natl. Acad. Sci. USA 95:8135-8140.
Jackson SA, Cheng Z, Wang ML, Goodman HM, Jiang J. 2000.
Comparative FISH mapping of a 431-kb Arabidopsis thaliana
BAC contig reveals the role of chromosomal duplications in
the expansion of the Brassica rapa genome. Genetics 156:833-
838.
Jiang J, Gill BS, Wang GL, Ronald PC, Ward DC. 1995. Metaphase
and interphase fluorescence in situ hybridization mapping of
the rice genome with bacterial artificial chromosomes. Proc.
Natl. Acad. Sci. USA 92:4487-4491.
Jiang J, Nasuda S, Dong F, Scherrer CW, Woo S-S, Wing RA, Gill
BS, Ward DC. 1996. A conserved repetitive DNA element
located in the centromeres of cereal chromosomes. Proc. Natl.
Acad. Sci. USA 93:14210-14213.
Ohmido N, Kijima K, Akiyama Y, de Jong JH, Fukui K. 2000. Quantification
of total genomic DNA and selected repetitive sequences
reveals concurrent changes in different DNA families
in indica and japonica rice. Mol. Gen. Genet. 263:388-
394.
Singh K, Ishii T, Parco A, Huang N, Brar DS, Khush G. 1996. Centromere
mapping and orientation of the molecular linkage map
of rice (Oryza sativa L.). Proc. Natl. Acad. Sci. USA 93:6163-
6168.
Wang S, Wang J, Jiang J, Zhang Q. 2000. Mapping of centromeric
regions on the molecular linkage map of rice (Oryza sativa
L.) using centromere-associated sequences. Mol. Gen. Genet.
263:165-172.
Notes
Authors’ addresses: S.A. Jackson, R.L. Phillips, Department of
Agronomy and Plant Genetics, University of Minnesota, 411
Borlaug Hall, 1991 Upper Buford Circle, St. Paul, MN 55108;
Z. Cheng and J. Jiang, Department of Horticulture, University
of Wisconsin-Madison, 1575 Linden Drive, Madison, WI
53706, USA.
Cell-cycle synchronization and flow karyotyping in rice
J.H. Lee, Y.S. Chung, D.H. Kim, K.Y. Kim, J.W. Kim, O.C. Kwon, and J.S. Shin
Highly efficient cell synchronization and metaphase chromosome accumulation in rice root-tip cells were achieved. Flow
cytometric analysis was performed for obtaining optimal parameters to synchronize the cell cycles. High mitotic indices (57.6%
in root meristematic region) were obtained by treating 0.5-cm seedlings with 0.5 mM hydroxyurea at 30 o C for 4 h, incubating
in a hydroxyurea-free solution for 30 min, and then treating with 0.3 µM trifluralin for 3 h. After trifluralin treatment, incubation
in distilled water for 15 min reduced chromosome clumping on metaphase spread. Uniformity in seed germination at the time
of treatment is a critical parameter for obtaining a high metaphase index. Isolated rice chromosomes were suitable for flow
cytometric analysis and chromosome sorting. The morphology of flow-sorted metaphase chromosomes was not affected.
Rice has become a model plant for molecular genetic research.
It has 12 chromosomes, a small genome size (2C = 0.90 pg)
(Arumuganathan and Earle 1991), and a large proportion of
low-copy-number or unique DNA sequences compared with
other cereals. Cytogenetic research in rice, however, has been
limited because of the small size and similarity of metaphase
chromosomes, no reproducible chromosome banding pattern,
and the difficulty in qualifying and quantifying cytological
preparations (Fukui and Iijima 1991). Accumulation of many
metaphase chromosomes from root tips is an important step in
Genetic diversity, evolution, and alien introgression 111

somatic chromosome studies. Limited information is available
on cell-cycle synchronization from root tips in rice. Studies on
cell-cycle synchronization and chromosome preparation from
cereal root tips have been carried out (Pan et al 1993, Lee et al
1996, 1997a). The optimal parameters used to obtain many
metaphase cells are different for each species.
In this study, we present the conditions and parameters
for effective cell synchronization and accumulation of
metaphase chromosomes in rice root tips. We also describe
the flow of cytometric analysis and sorting of rice metaphase
chromosomes.
Materials and methods
Cell-cycle synchronization and metaphase accumulation
Rice seeds were obtained from Dr. Carl Johnson, University
of California-Davis (japonica, M202), and from Dr. Anna
McClung, Beaumont Breeding Station, Texas, USA (indica,
IR36). The cell cycle was systematically tested using flow
cytometry as described by Lee et al (1996). Seeds were sterilized
with 5% bleach solution for 30 min, and then incubated
on wet paper towels at room temperature for 2 d. Seedlings
with about 0.5-cm-long roots were treated with four different
concentrations (0.1, 0.5, 1.0, and 1.5 mM) of hydroxyurea
(DNA synthesis inhibitor) in 10 mL Hoagland solution at 30
o
C. The terminal 1.0-mm tips of five roots were excised and
analyzed at 1-h intervals from 0 to 24 h for each hydroxyurea
treatment. The percentage of nuclei in G1, S, and G2/M phases
in the root-tip cells was determined using flow cytometry.
Treatment parameters of trifluralin (metaphase blocking
reagent) were investigated for accumulating large numbers
of root-tip cells in metaphase. Seedlings of 0.5-cm length
were treated with 0.5 mM hydroxyurea in 10 mL Hoagland
solution at 30 o C for 4 h, rinsed in sterile distilled water, and
incubated at 30 o C for 30 min (until root-tip cells reached late
S or early G2 phase). They were then transferred to petri dishes
containing Whatman filter papers soaked in trifluralin with 0.2,
0.3, 0.4, and 0.5 µM in 10 mL Hoagland solution. The terminal
1.0-mm root tips were analyzed at 1-h intervals, and optimal
concentration and time of trifluralin treatment were determined
based on metaphase index and flow karyotyping. The
mitotic index was determined by scoring at least 100 cells per
root tip (0.5 mm from root cap). The mean mitotic index was
calculated from 20 observations.
Preparation of metaphase spreads
Metaphase spreads were prepared by enzymatic maceration.
Root tips were treated with an enzyme mixture (5% cellulase
Onozuka R-10 and 1% pectolyase Y-23 in 0.01 M citric acid/
sodium citrate buffer, pH 4.5) in a 1.5-mL microfuge tube at
room temperature for 30 min, washed with distilled water, and
tapped with fine forceps until well spread on a slide. The
squashed root tips were stained with drops of 5% modified
carbolfuchsin solution (Kao 1982) for 10 min. The slide was
heated slightly, after which one drop of distilled water was
added, and then covered with a coverslip. The preparations
were observed under a microscope for counting the mitotic
index. Metaphase cells were photographed under three different
conditions—normal exposure, overexposure, and underexposure—using
Kodak Tri-X pan 400 black-and-white film.
Flow cytometric analysis
Chromosomes were isolated from the terminal 1.0-mm root
tip by chopping with a sharp sterile scalpel blade in 0.5 mL
slightly modified LB01 buffer (15 mM Tris, 2 mM Na 2 EDTA,
80 mM KCl, 20 mM NaCl, 0.5 mM spermine, 3 mM
dithiothreitol, 20 µg mL –1 propidium iodide [PI], 0.25% Triton
X-100, pH 7.5). The chromosome suspension was filtered
through a 30-µm nylon mesh, incubated on ice for 30 min, and
analyzed on a FACScan flow cytometer (Becton Dickinson,
San Jose, CA, USA). The excitation source was an argon ion
laser emitting a 488-nm beam at 15 mW for excitation of PI.
Red PI fluorescence was collected with a standard 585/42-nm
band pass filter in the FL2 channel and with a 650-nm-long
pass filter in the FL3 channel. Forward light scatter values on
a linear scale of 1,024 channels and PI-fluorescence intensities
(FL3-peak height) on a logarithmic scale of fluorescence
of four decades of log were measured for all particles in the
chromosome suspensions. PI-fluorescence pulse area (FL2-A)
was measured on a linear scale of 1,024 channels for wheat
chromosomes in the preparations. Data were collected and
analyzed with the CellQuest software (Becton Dickinson, San
Jose, CA, USA).
Chromosome sorting was conducted on a FACS Vantage
cell sorter system (Becton Dickinson, San Jose, CA, USA).
An autoclaved chromosome isolation buffer without
dithiothreitol was used as sheath fluid. Sorting gates were set
on each of the prominent peaks of univariate flow karyotype,
in turn, to identify the objects corresponding to them. Objects
from the selected peak area were collected directly onto a piece
of black nitrocellulose membrane (Millipore Type AA, pore
size 0.8 µm) placed on a microscope slide. Chromosomes from
each peak were also collected into microfuge tubes by flow
sorting.
To confirm the content of sorted fractions, 20 µL of chromosome
isolation buffer was added to the sorted fraction on
the black membrane, covered with a coverslip, and observed
under an Olympus BM60 fluorescence research microscope.
Photographs were taken with an Olympus PM30 camera system
using Kodak Ektachrome 400 ASA color film and Kodak
Tri-X pan 400 black-and-white film.
A theoretical monoparametric flow karyotype was constructed
according to Conia et al (1989). The published relative
chromosome size (Fukui and Iijima 1991) was used for
this purpose. Channel numbers and the frequency values corresponding
to the channel numbers were used to draw the theoretical
flow karyotype.
112 Advances in rice genetics

A
B
A
Fig. 1. Synchronized rice root-tip cells showing high
metaphase index. Rice seedlings about 0.5 cm long
were treated with 0.5 mM hydroxyurea at 30 °C for 4
h, washed three times with sterile water, incubated in
Hoagland solution for 30 min, and then treated with
0.3 µM trifluralin for 3 h, followed by incubation in
sterile water for 15 min. A shows many metaphase
chromosomes of rice in a large area. B shows a higher
magnification of rice metaphase chromosomes. Scale
bar = 10 µm.
Results and discussion
Cell-cycle synchronization and metaphase
accumulation
Rice root-tip cells were efficiently synchronized using hydroxyurea
and trifluralin. Although hydroxyurea inhibits S-phase
progress, DNA synthesis occurs slowly after certain hours of
hydroxyurea treatment (Lee et al 1996). The optimal concentration
and duration of hydroxyurea are critical for effective
cell synchronization. Lee et al (1996, 1997a) obtained a
metaphase index higher than 70% in maize and wheat root-tip
cells by treating hydroxyurea and trifluralin. Our results showed
that 0.5-mM hydroxyurea treatment for 4 h followed by a 30-
min incubation in hydroxyurea-free solution was effective in
synchronizing cell cycles of rice root tips. A high concentration
(more than 1 mM) of hydroxyurea synchronized G1-phase
cells while the mitotic index was relatively low.
Trifluralin is a better metaphase blocking reagent for
accumulating cereal metaphase cells than colchicine or
amiprophos-methyl (see Lee et al 1996, 1997a). A 3-h treatment
of 0.3 µM trifluralin accumulated metaphase cells up to
57.6%, ranging from 51.1% to 63.3% in root-tip meristematic
area (Fig. 1). A longer treatment (more than 4 h) increased the
number of chromosome clumps and chromatids in the chromosome
preparation. A shorter treatment (1–2 h) resulted in
better chromosome spreads but reduced mitotic index. The
duration of the trifluralin treatment may need to be adjusted
based on the uses of chromosomes. A 1-h trifluralin treatment
was enough to obtain prometaphase chromosomes.
As Lee et al (1996, 1997a) pointed out in previous reports,
a high metaphase index in rice depended upon the uniformity
of germinated seedlings. Selection of 0.5-cm-long seedlings
at treatment time produced repeatedly high metaphase
indices. Optimal parameters for accumulating metaphase chromosomes
in rice root tips were obtained by treating 0.5-cmlong
seedlings with 0.5 mM hydroxyurea for 4 h, incubating
for 30 min after removing the hydroxyurea, followed by treatment
with 0.3 µM trifluralin for 3 h.
In addition to the accumulation of metaphase cells, enzymatic
maceration of fixed roots resulted in good chromosome
spreading. After trifluralin treatment, incubating in dis-
Counts
40
30
20
10
B
Cell debris
Chromosomes
Clumps
Nuclei
G1 G2
0
10 2 10 3 10 4 10 5 10 6
FL3-H
Long PI flourescence intensity
Fig. 2. Flow-sorted rice chromosomes. (A) The figure
on the left shows a low magnification of flow-sorted
rice chromosomes; the figure on the right shows a high
magnification and observed flow karyotypes. (B) Rice
chromosomes were sorted from all of the chromosome
peaks. Relative propidium iodide fluorescence intensity
on a log scale showed G1 and G2 nuclei, chromosome
clumps, chromosomes, and cell debris. Scale bar
= 5 µm.
tilled water for 15 min reduced chromosome clumps in chromosome
preparations. The modified carbolfuchsin dye (5%)
showed better staining of rice chromosomes compared with
ordinary acetocarmine or aceto-orcein staining.
Flow cytometric analysis
Flow cytometric analysis was performed using isolated
metaphase chromosomes stained with propidium iodide. Figure
2 shows rice sorted chromosomes and flow karyotypes
based on relative PI fluorescence intensity of chromosomes
on a log scale. Peaks corresponding to nuclei, chromosome
clumps, chromosomes, chromatids, and cellular debris were
identified. The morphology of sorted chromosomes was fairly
well preserved. Sorted chromosomes can be used for cytological
analysis such as in situ hybridization or chromosome mapping
using imaging methods. Similar flow karyotypes were
observed in indica (IR36) and japonica rice (M202) (data not
shown).
Figure 3 shows the rice theoretical flow karyotypes and
experimental flow karyotypes. The experimental flow karyotypes
(Fig. 3B) were similar to the theoretical flow karyotypes
(Fig. 3A). Usually, the theoretical flow karyotypes are constructed
based on relative chromosome sizes (Arumuganathan
et al 1991, Lee et al 1996, 1997a), assuming that DNA content
is correlated with chromosome size. However, the DNA content
of chromosomes was not always correlated with chromosome
size (Lee et al 1997b) because flow cytometry measures
the amount of fluorescence intensity. The stainability or affinity
of the DNA-specific fluorochrome dye, or the condensation
of chromatin fibers, is not uniform along the whole length
of a chromosome. A flow karyotype constructed based on DNA
content of individual chromosomes would be more reliable
Genetic diversity, evolution, and alien introgression 113

Frequency
9
A
8
10, 11, 12
CV = 4%
7
8, 9
6
5
5, 6, 7
4
3
4 2, 3
2
1
1
0
0 200 400 600 800 1,000
Channel number
Counts
20
15
10
5
Chromosomes
0
0 200 400 600 800 1,000
FL2-A
Linear PI flourescence intensity
Fig. 3. Theoretical (A) and observed (B) flow karyotypes of rice
on a linear scale. Theoretical flow karyotypes were constructed
based on relative chromosome size data (Fukui and Iijima 1991)
using 4% CV. Observed flow karyotypes had patterns similar to
those of theoretical flow karyotypes.
than one made based on relative chromosome size. Chromosome
peaks on the flow karyotype can be used to identify specific
chromosome types using imaging methods (Iijima et al
1991).
Results showed that it is possible to accumulate large
numbers of metaphase chromosomes from rice root-tip meristematic
cells. The procedures described can be used to sort
high-quality metaphase chromosomes. These sorted chromosomes
allow the construction of rice chromosome-specific libraries.
References
Arumuganathan K, Earle ED. 1991. Nuclear DNA content of some
important plant species. Plant Mol. Biol. Rep. 9:208-218.
Arumuganathan K, Slattery JP, Tanksley SD, Earle ED. 1991. Preparation
and flow cytometric analysis of metaphase chromosomes
of tomato. Theor. Appl. Genet. 82:101-111.
Fukui K, Iijima K. 1991. Somatic chromosome map of rice by imaging
methods. Theor. Appl. Genet. 81:589-596.
Iijima K, Kakeda K, Fukui K. 1991. Identification and characterization
of somatic rice chromosomes by imaging methods. Theor.
Appl. Genet. 81:597-605.
Kao KN. 1982. Staining methods for protoplasts and cells. In: Wetter
LR, Constabel F, editors. Plant tissue culture methods.
Saskatoon, Sask. (Canada): National Research Council of
Canada. p 67-71.
Lee JH, Arumuganathan K, Kaeppler SM, Kaeppler HF, Papa CM.
1996. Cell synchronization and isolation of metaphase chromosomes
from maize (Zea mays L.) root tips for flow
cytometric analysis and sorting. Genome 39:697-703.
Lee JH, Arumuganathan K, Yen Y, Kaeppler S, Kaeppler H,
Baenziger PS. 1997a. Root tip cell cycle synchronization and
metaphase chromosome isolation suitable for flow sorting in
common wheat (Triticum aestivum L.). Genome 40:633-638.
Lee JH, Yen Y, Arumuganathan K, Baenziger PS. 1997b. DNA content
of wheat monosomics at interphase estimated by flow
cytometry. Theor. Appl. Genet. 95:1300-1304.
Pan WH, Houben A, Schlegel R. 1993. Highly effective cell synchronization
in plant roots by hydroxyurea and
amiprophos-methyl or colchicine. Genome 36:387-390.
Notes
Authors’ addresses: J.H. Lee, Y.S. Chung, D.H. Kim, K.Y. Kim,
J.W. Kim, O.C. Kwon, Faculty of Life Science and Natural
Resources, Dong-A University, Pusan 604-714, Korea; J.S.
Shin, Graduate School of Biotechnology, Korea University,
Seoul 136-701, South Korea.
Acknowledgment: This research was financially supported by Dong-
A University.
114 Advances in rice genetics

High-resolution fluorescence in situ hybridization (FISH)
for gene mapping and molecular analysis of rice
chromosomes
N. Ohmido and K. Fukui
Fluorescence in situ hybridization (FISH) has been an effective technique for physical mapping of genes and repetitive DNA
sequences on plant chromosomes. Unique rice genomic DNA sequences ranging from 399 kb (YAC) to 1.29 kb (plasmid) were
localized on rice chromosomes using FISH. The detection sensitivity of FISH using rice chromosomes has improved considerably.
Extended DNA fibers (EDFs) achieve high spatial resolution and allow quantitative analysis to estimate copy numbers of
tandemly repeated sequences in the rice genome. Applications of EDF-FISH and combing techniques have allowed spatial
resolutions to increase up to 1 kb between adjacent targets and sensitivity up to 300 bp. The significance of advanced
molecular cytogenetic techniques and studies on the rice genome using high-resolution FISH, including EDF-FISH, are discussed.
In this study, we detected genes with several sizes of DNA,
including agriculturally important genes. A YAC (yeast artificial
chromosome) clone with an insert size of 399 kb was detected
at the end of rice chromosome 1 using fluorescence in
situ hybridization (FISH). A bacterial artificial chromosome
(BAC) clone with an insert size of 180 kb was detected at the
end of chromosome 2 (Fig. 1A). The BAC clone containing
the rice leaf blast resistance gene (Pi-b) was revealed at the
distal end of the long arm of chromosome 2 (2q2.1) (Figs. 1B,
1C, and 1D). A cosmid (35 kb) with the resistance gene (Xa21)
against bacterial blight was mapped on the interstitial region
of the long arm on chromosome 11 (11q1.3). Detection sensitivity
has been increased to detect even a restriction fragment
length polymorphism (RFLP) marker of only 1.29 kb. The
clone was mapped successfully to the distal region of the long
arm of rice chromosome 4 (4q2.1) (Ohmido et al 1998).
These results clearly demonstrated that the physical position
of functional rice genes with various sizes can be detected
on rice chromosomes. The sensitivity for detecting rice
A B C D
Fig. 1. (A-D) Physical mapping of a BAC clone on rice chromosome
2. (A) The location of BAC clone (180 kb) using FISH. Green
fluorescence signals appear at the end of chromosome 2. (B)
Enlarged images of the signal-tagged chromosome 2. Centromere
position is indicated by arrow. (C) The signal locations are mapped
on the rice chromosome as green dots. (D) Position of the clones
on the rice genetic map developed by Causse et al (1994). Red
box indicates the centromeric regions. A red bar indicates genetic
position of the BAC clone. Bar indicates 5 µm.
21
11
11
21
DNAs has been improved 400-fold based on the probe size.
DNA sequences that have been physically mapped can be used
effectively to fill in gaps in molecular contiguous maps and to
determine the actual physical distance between the DNA markers.
The structural characteristics of a chromosome where the
markers are densely or sparsely distributed can be analyzed
by using FISH. The relationship between the gene position
and the recombination value can be analyzed.
Highly sensitive physical mapping using extended DNA fibers
In general, the space-resolving power of FISH between highly
condensed metaphase chromosomes and interphase nuclei is
different. It has been reported that the spatial resolution of two
closely located nucleotide sequences by FISH on mitotic chromosomes
is 2–5 Mbp and 100 kb on a nucleus. The spatial
resolution in pachytene chromosomes ranges from 1.2 Mbp to
120 kb at heterochromatic and euchromatic regions, respectively
(de Jong et al 1999).
To analyze the terminal structure of rice chromosomes
at the molecular level, FISH was performed using telomere
and subtelomeric sequences of rice. In our studies, four different
FISH targets such as mitotic chromosomes, somatic nuclei,
meiotic chromosomes, and extended DNA fibers were
examined. Chromosome FISH revealed the presence of telomere
sequences at all the ends of rice chromosomes. Two TrsA
loci were also detected in haploid rice plants (Fig. 2A). Identifying
rice chromosomes based on the condensation pattern
(Fukui and Iijima 1991) before and/or after FISH revealed that
the two chromosomes with TrsA were the long arms of chromosomes
6 and 12, respectively. The interphase mapping of
TrsA and telomere sequences using diploid plants showed that
there were four TrsA sites within a japonica rice nucleus (Fig.
2B). TrsA signals were close to the telomere signals in the
interphase nucleus but did not completely overlap.
Genetic diversity, evolution, and alien introgression 115

A
B
A
B
C
Fig. 2. Multicolor fluorescence in situ hybridization (McFISH) on
haploid rice chromosomes and nuclei. (A) McFISH for rice
prometaphase chromosomes simultaneously using TrsA and telomere
sequences as probes. Chromosomes 6 and 12 are indicated
by solid and open arrowheads, respectively. (B) McFISH on
a rice nucleus. Bar indicates 10 µm.
Molecular analysis using extended DNA fibers
Fig. 3. Visualization of the terminal structure of rice chromosome
on extended DNA fibers (EDFs). (A) EDFs stained with YOYO-1. (B)
EDFs stained with DAPI. (C) Multicolor FISH on EDFs with TrsA
(red) and telomeric sequences [TTTAGGG] n (green). Bars indicate
5 µm.
Partial overlapping showed that TrsA and telomere sequences
did not mingle with each other but occupied individual positions.
However, when the two DNA sequences were located
close together, they could not be resolved using ordinary FISH
on chromosomes and nuclei. Thus, the space-resolving power
by FISH was improved on DNA fibers released from rice nuclei.
Recently, dramatic progress has been made in physical
mapping with adjacent DNA clones using FISH on extended
DNA fibers (EDFs) in both mammals and plants (Jackson et al
1998, Ohmido et al 2000).
To prepare rice EDFs, rice nuclei were isolated from
fresh rice seedlings. The isolated nuclei were then pipetted
onto one end of a glass slide and disrupted in a lysis buffer for
a few minutes. DNA fibers were stretched by tilting the glass
slides to an angle of 45 degrees. When the buffer floated downward
to the other end of the slide, DNA fibers were thus released
and extended. Each single nucleotide strand was visualized
after staining with YOYO-1 (Fig. 3A), a DNA-binding
green fluorescent dye that is more intense than DAPI (Fig.
3B).
FISH on the extended DNA fibers using TrsA as the
probe depicts clear “beads-on-a-string”-like green fluorescent
signal tracks. The shorter stretches of TrsA signals were determined
to correspond to the TrsA site from chromosome 6,
based on the weaker intensity of the fluorescent signal in the
chromosome FISH. Chromosome 12, which had a larger copy
number of TrsA than chromosome 6, showed longer stretches
of fluorescent signal. Fluorescent patterns of parallel-running
linear tracks of red (TrsA) and green spots (telomere) were
observed after multicolor EDF-FISH, simultaneously using
both TrsA and the telomere sequences as probes (Fig. 3C).
Signals from the telomeric sequences appeared as one or a
few dots at one end of the TrsA signal tracks, indicating that
the telomere sequences were much shorter than TrsA. Results
also indicated that the TrsA and the telomere sequences were
located in tandem with a few intervening sequences less than a
few kilobases long. TrsA and telomere signal tracks were measured
using CHIAS III (Kato and Fukui 1998) for the quantitative
analysis of EDF-FISH. The copy numbers of TrsA (unit
length: 355bp, Ohtsubo et al 1991) on chromosomes 6 and 12
were estimated to be 682 and 231 copies, respectively. For
this estimation, the conversion factor, one microscopic length
µm equals 3,270 bp nucleotide length, was applied. Both the
telomeric repeats on chromosomes 6 and 12 were observed as
a few dots of green fluorescence signals and were calculated
as 3.2 kb on average. Comparison of the lengths of telomere
sequences between indica and japonica rice using EDF-FISH
revealed that telomere sequences in indica rice are three times
longer than those in japonica rice.
The molecular combing technique is a derivative of the
EDF-FISH. DNA combing in conjunction with FISH enables
high-resolution visual mapping of the multiple gene clusters
on the large DNA fragment (Jackson et al 1999). EDF-FISH
with high space-resolving power is now available to quantitatively
analyze the length of repetitive sequences. Furthermore,
ordering of genes, which is important for chromosome walking
and contiguous mapping in genome research, is visually
attained by the FISH method.
References
Causse MA, Fulton TM, Cho YG, Ahn SN, Chunwongse J, Wu K,
Xiao J, Yu Z, Ronald PC, Harrington SE, Second G, McCouch
SR, Tanksley SD. 1994. Saturated molecular map of the rice
genome based on an interspecific backcross population. Genetics
138:1251-1274.
de Jong JH, Fransz P, Zabel P. 1999. High resolution FISH in plants—
techniques and applications. Trends Plant Sci. 4:258-263.
Fukui K, Iijima K. 1991. Somatic chromosome map of rice by imaging
methods. Theor. Appl. Genet. 81:589-596.
Jackson SA, Wang ML, Goodman HM, Jiang J. 1998. Application
of fiber-FISH in physical mapping of Arabidopsis thaliana.
Genome 41:566-572.
Jackson SA, Dong F, Jiang J. 1999. Digital mapping of bacterial
artificial chromosomes by fluorescence in situ hybridization.
Plant J. 17:581-587.
116 Advances in rice genetics

Kato S, Fukui K. 1998. Condensation pattern (CP) analysis using a
newly developed chromosome image analyzing system
(CHIAS III). Chromosome Res. 6:473-479.
Ohmido N, Akiyama Y, Fukui K. 1998. Physical mapping of unique
nucleotide sequences on identified rice chromosomes. Plant
Mol. Biol. 38:1043-1052.
Ohmido N, Kijima K, Akiyama Y, de Jong JH, Fukui K. 2000. Quantification
of total genomic DNA and selected repetitive sequences
reveals concurrent changes in different DNA families
in indica and japonica rice. Mol. Gen. Genet. 263:388-
394.
Ohtsubo H, Umeda M, Ohtsubo E. 1991. Organization of DNA sequences
highly repeated in tandem in rice genome. Jpn. J.
Genet. 66:241-254.
Notes
Authors’ addresses: N. Ohmido, Hokuriku National Agricultural
Experiment Station, Joetsu 943-0193, Japan; K. Fukui, Department
of Biotechnology, Graduate School of Engineering,
Osaka University, Suita 565-0871, Osaka, Japan.
Analysis of meiosis in rice after mutagenic treatment
N.A. Khailenko, A.I. Sedlovskiy, and L.N. Tyupina
We studied meiosis in mutagen-treated populations of rice. The treatment consisted of gamma rays (10, 15, and 20 KR),
ethylmethane sulfonate (EMS) in 0.2%, 0.4%, and 0.6% concentration for 12 h, and combinations of gamma rays (10, 15, 20
KR) and EMS (0.2%). Cultivar Dubovskiy-129 had normal meiosis with the regular formation of 12 bivalents with the second
division of meiosis showing normal anaphases and tetrads. All pollen grains were fertile. The mutagen-treated population
showed chlorophyll mutations and various other changes in morphological traits. Meiotic abnormalities were observed in EMS
treatments; 26% of the cells showed chromosome fragments. Chromosome stickiness was common in some treatments,
including the occurrence of polyploid cells. Variants (20 KR + 0.2% EMS) with univalents were recorded.
In the study of meiosis of cultivars, mutants are an important
spectrum of chromosomal variations and changes, and are used
to determine morphological traits. Research on meiosis is hampered
because chromosomes of rice are extremely small. Also,
chromosomes of rice are poorly stained with acetocarmine and
aceto-orcein.
In the literature, there is practically no research on meiotic
processes in rice. Several authors studied the meiotic behavior
of chromosomes in interspecific hybrids of rice and in
amphidiploids. However, limited literature is available in Russian
on rice cytology.
After mutagenic treatment, a high frequency of chromosomal
aberrations, translocations, bridges, fragments, and laggards
has been reported.
We studied the meiosis of cultivars and plants of the first
generation after treatment by various mutagens to explore the
possibility of accelerating breeding work and defining the productivity
of rice under conditions of the Almaty region.
Materials and methods
The materials were two cultivars, Dubovskiy-129 and
Alakulskiy, one dwarf rice from the world collection VIR (C-
5467), three samples of breeding lines (N 348, N 14/282, and
N 119/27), and M 1 plants of Dubovskiy-129 after treatment
by mutagens. Gamma rays (10, 15, 20 KR), ethylmethane sulfonate
(EMS) in 0.2%, 0.4%, and 0.6% concentration for 12
h, and combinations of gamma rays (10, 15, 20 KR) and EMS
(0.2%) were used as treatments. Plants were grown in the Main
Botanical Garden of the Academy of Sciences RK and in the
experimental field (Southern Pribalchashie).
The technique of fixing flowers and staining meiotic
chromosomes with some modifications (Khailenko and
Sedlovskiy 1998) was followed. Young panicles of rice were
fixed at 0600–0800 under 14–15 h of daylight in Almaty and
10–11 h in Southern Pribalchashie. The shoots were fixed with
a length of latter internode from 0 to 12 cm and a length of
panicle from 2 to 12 cm. The flowers of young rice panicles
were fixed on Newcomer. The material was stored in a refrigerator.
Results and discussion
Meiosis was normal for all rice accessions studied. In all meiotic
phases, the chromosomes paired completely. The number
of bivalents in diakinesis and metaphase I was equal to 12.
The meiosis showed normal anaphase and tetrads. The pollen
grains were fertile (90–100%).
After mutagen treatment, cv. Dubovskiy-129 in the first
generation showed various chlorophyll mutations and numerous
deviations in morphological traits. An analysis of meiosis
revealed a wide spectrum of chromosome abnormalities in all
mutagenic treatments.
The number of cells with fragmentation of chromosomes
ranged from 26% (0.2 EMS + 10 KR) to 80% (0.6% EMS).
More often, especially after treatment by EMS, besides fragmentation
of chromosomes, we observed formation of polyploid
(32) cells. Rao (1977) and Sen and Misra (1975) ob-
Genetic diversity, evolution, and alien introgression 117

served the same pasting together of meiotic chromosomes and
the formation of multivalents in microsporocytes of rice. The
treatments combining gamma rays and EMS increased meiotic
abnormalities, particularly with an increased dose or exposure
from 26% in variant 10 KR + 0.2% EMS to 68% in
variant 20 KR + 0.2% EMS. In the treatment 20 KR + 0.2%
EMS, univalents were observed together with normal bivalents,
and also lumps of chromatin.
At anaphase I, cells with bridges and lagging chromosomes
(3–7%) were observed occasionally. No micronucleus
was seen in dyads. In some mutagenic treatments, an insignificant
number of cells with lagging chromosomes (4%) and micronuclei
(5%) was observed.
Rao (1977) observed a high frequency of chromosomal
aberrations in gamma ray-treated populations, but no such abnormalities
were seen in EMS treatments. In our experiments,
treatment by EMS (0.6%) led to even more chromosome aberrations
at the early stages of prophase I, particularly at diakinesis.
Apparently, EMS causes not only asynapsis, but it also
somehow promotes partial polyploidization of chromosomes.
The same trend was observed under the combination treatment
of gamma rays and EMS: in cells of diplotene and diakinesis.
In some sterile anthers, pollen grains did not come out and
were covered with a common envelope. As a result, giant pollen
grains were formed. Such “cytological rejection” will be
useful for breeders. With this, it is possible to determine mutant
plants before the heading stage easily and quickly.
Various kinds of abnormalities in shape, size, and staining
ability of pollen grains were observed in mutagen-treated
populations of rice.
Mature pollen grains more often had one pore, but rarely
two to three pores. The proportion of such pollen grains was
insignificant (0.25–3.7%), but it was higher than in control
plants. It was possible that the gamma rays and EMS influenced
a gene or group of genes that determine the formation
of the pollen envelope.
Meiosis showing active division of cells in rice cultivars
and other cereal plants under Almaty conditions occurs mainly
during the morning hours. Treatment by gamma rays and EMS
causes several meiotic abnormalities, partial conjugation of
chromosomes in prophase and metaphase I, lagging chromosomes
and the formation of chromosomal and chromatid
bridges in anaphase I, the formation of dyads and tetrads with
micronuclei, increased pollen sterility, and an abnormal pollen
envelope. “Cytological rejection” of mutant rice plants after
treatment by gamma rays and EMS would be helpful to
breeders.
References
Khailenko NA, Sedlovskiy AI. 1998. Cytogenetic and
cytoembryological studies of interspecific and intergeneric
hybrid formation in soft spring wheat. Proceedings of the 9th
International Wheat Genetics Symposium, Saskatoon,
Saskatchewan, Canada. 2(1):56-58.
Rao GM. 1977. Efficiency and effectivenes of gamma rays and EMS
in rice. Cytologia 42(3-4):443-450.
Sen P, Misra RN. 1975. Chromosome pairing in an autotriploid rice.
Curr. Sci. 44(24):905-906.
Notes
Authors’ address: Institute of Plant Physiology, Genetics, and
Bioengineering of National Centre on Biotechnology of Republic
of Kazakhstan, 45 Timiryazev Str., 480090 Almaty,
Kazakhstan.
Genomic relationships of the AA genome Oryza species
B.R. Lu, M.E.B. Naredo, A.B. Juliano, and M.T. Jackson
The genomic relationships of the AA genome species were assessed by intraspecific and interspecific hybridization. Crossability
measured in terms of seed set varied greatly among the combinations, although hybrids were easily obtained. Intraspecific
hybrids showed >40% panicle fertility. In general, panicle fertility was greatly reduced in the interspecific hybrids, except for
those obtained from the reciprocal crosses between Oryza nivara and O. rufipogon, O. rufipogon and O. sativa, and O. barthii
and O. glaberrima that showed highly fertile hybrids. Meiosis was normal in both intra- and interspecific hybrids with normal
chromosome pairing at metaphase-I, except for a few hybrids involving O. longistaminata and O. meridionalis that showed
slightly lower pairing. We conclude that (1) the AA genome rice species are closely related in terms of their specific reproductive
isolation and chromosome homology, (2) maximum exchange of genetic material can be achieved in the AA genome rice
species through recombination, and (3) gene transfer through conventional breeding is highly applicable from the AA genome
wild Oryza species.
Eight Oryza species are classified in the O. sativa complex by
Vaughan (1989) or in Ser. Sativae by Lu (1999), including
two cultivated and six wild species. These species are morphologically
similar in terms of their relatively large grains
and long awns and inhabit similar environments such as lakes
and ponds, swamps, rivers, and canals under full sunshine. O.
sativa is grown worldwide, whereas O. glaberrima is cultivated
only in certain farming systems in West Africa. Among
the wild species, O. nivara and O. rufipogon are found in South
and Southeast Asia, O. barthii and O. longistaminata are widely
118 Advances in rice genetics

distributed in sub-Saharan Africa, O. meridionalis is found in
tropical Australia and Irian Jaya (Lu and Silitonga 1999), and
O. glumaepatula is native to South and Central America. Species
in the Ser. Sativae share the genome, AA, which makes
them the most accessible genetic resource in the Oryza gene
pool for rice improvement.
The assessment of species relationships can be achieved
through intra- and interspecific hybridization, with crossability
and fertility of F 1 hybrids as useful measures of species
relatedness in plants (Naredo et al 1997, 1998). Analysis of
chromosome pairing at metaphase-I is also a useful tool in
assessing genome homology among parental species, provided
that no genetically controlled pairing regulation is involved.
In this study, we conducted intra- and interspecific hybridization
to determine the genomic relationships among the AA
genome Oryza species assessed by chromosome homology in
addition to the estimation of reproductive barriers among the
species.
Intra- and interspecific hybridization
Crossability
Crosses were made among all the AA genome Oryza species,
and populations of the same species under screenhouse conditions
at the Genetic Resources Center at IRRI. Percentage (%)
seed set (number of seeds obtained divided by number of spikelets
pollinated) and panicle fertility were used to assess reproductive
barriers between species. Table 1 summarizes the results
from all possible combinations of inter- and intraspecific
crosses involving more than 90,000 spikelets.
Crossing data from the various combinations revealed
two general tendencies. First, hybridization among the AA genome
Oryza species is achievable although crossability varied
greatly among combinations. Seeds were obtained from all intraspecific
combinations, with mean seed set varying from 7.2%
to 30.7%. No seeds were obtained from the cross O.
glumaepatula/O. glaberrima. Less than 3% seed set was observed
in the crosses O. nivara/O. meridionalis (0.7%), O.
longistaminata/O. barthii (1.5%), O. rufipogon/O.
meridionalis (2.4%), and O. sativa/O. meridionalis (2.4%). In
contrast, high seed set was observed in the crosses O.
meridionalis/O. glaberrima (52.0%), O. barthii/O. sativa
(39.8%), O. nivara/O. glumaepatula (39.0%), and O. sativa/
O. glumaepatula (36.5%).
Second, considerable differences in seed set were observed
between some reciprocal crosses. For instance, in
crosses with O. longistaminata as the female parent, seed set
ranged from only 1.5% to 16.1% (mean = 6.9%) compared
with a seed set of 10.4% to 25.7% (mean = 19.4%) when it
was used as a pollen donor. In contrast, in crosses with O.
meridionalis as the female parent, seed set ranged from 5.8%
to 52.0% (mean = 20.2%); when it was used as a pollen donor,
seed set ranged from only 0.7% to 16.9% (mean = 6.3%). Although
no considerable difference in seed set was observed in
crosses with O. barthii as one parent, a relatively high seed set
was observed in crosses in which it was used as the female
parent (mean = 24.9%).
In addition, we observed that, although seed set was generally
high in crosses with O. longistaminata as the male parent,
the seeds were abnormal, with incomplete development
of endosperm or embryos. When used as the female parent,
only the cross with O. glumaepatula produced hybrids. No
hybrid plants were obtained from the crosses O. nivara/O.
sativa, O. meridionalis/O. longistaminata, O. meridionalis/
O. sativa, O. sativa/O. meridionalis, and O. glaberrima/O.
longistaminata. In contrast, some combinations involving O.
meridionalis or O. rufipogon as one parent produced few but
normal seeds that developed into vigorous hybrid plants as
with seeds from the other crosses. This suggested that reproductive
isolating mechanisms operate both before and after
fertilization among the AA genome Oryza species.
Hybrid fertility
Panicle fertility was based on the ratio of filled grains to the
total number of grains from five individually bagged panicles.
Table 1 shows that, in general, intraspecific crosses produced
partially to highly fertile hybrids. Mean panicle fertility in intraspecific
hybrids ranged from 41.5% to 91.6%.
In contrast, panicle fertility of interspecific hybrids varied
significantly, with either high or low fertility, indicating
different categories of relationships among the AA genome
species. Highly or partially fertile hybrids were obtained from
the reciprocal crosses involving O. glaberrima and O. barthii
(82.4%, 77.2%), O. nivara and O. rufipogon (44.8%, 28%),
and O. rufipogon and O. sativa (57.4%, 26.2%). The other
interspecific hybrids generally showed

Table 1. Crossability in AA genome Oryza species and meiotic analysis of intraspecific and interspecific hybrids.
Spikelets Mean Mean Pollen mother Meiotic configuration Chiasmata/
Combination pollinated seed panicle cells observed PMC
(no.) set (%) fertility (%) (no.) I II III IV
Intraspecific crosses
O. nivara/O. nivara 1,039 7.6 62.9 471 0.07 11.76 0 0.104 23.71
O. rufipogon/O. rufipogon 5,220 7.2 49.6 900 0.12 11.92 0 0.008 23.37
O. meridionalis/O. meridionalis 14,704 23.2 41.5 83 0.02 11.99 0 0 22.22
O. glumaepatula/O. glumaepatula 2,353 27.3 85.6 200 0.12 11.90 0 0.020 23.68
O. barthii/O. barthii 10,057 30.7 79.3 151 0.08 11.96 0 0 23.54
O. longistaminata/O. longistaminata 4,894 17.6 91.6 a 201 2.91 10.17 0 0.189 20.48
Interspecific crosses
O. nivara ×
O. rufipogon 3,674 12.7 44.8 1,177 0.10 11.94 0 0.008 23.34
O. meridionalis 322 0.7 0.9 – – – – – –
O. glumaepatula 804 39.0 1.6 100 0.12 11.94 0 0 23.52
O. barthii 1,222 19.5 1.3 144 0.22 11.82 0 0.035 23.37
O. longistaminata 4,474 10.4 0.6 – – – – – –
O. sativa 54 5.6 – – – – – – –
O. glaberrima 170 24.9 0.1 146 0.04 11.98 0 0 23.82
O. rufipogon ×
O. nivara 3,236 6.1 28.4 300 0.20 11.85 0 0.024 23.22
O. meridionalis 1,057 2.4 6.6 50 0 12.00 0 0 20.92
O. glumaepatula 1,161 11.0 2.3 200 0.25 11.86 0 0.005 23.54
O. barthii 2,198 15.4 0.7 150 0.79 11.61 0 0 22.70
O. longistaminata 7,408 13.6 6.2 50 0.24 10.40 0 0.740 23.04
O. sativa 592 6.0 57.4 50 0 11.86 0 0.020 23.04
O. glaberrima 155 17.7 5.6 – – – – – –
O. meridionalis ×
O. nivara 594 11.6 1.0 139 0.04 11.74 0.007 0.116 19.97
O. rufipogon 1,126 12.9 8.7 250 0.08 11.86 0.004 0.048 21.84
O. glumaepatula 890 14.0 0.4 100 0.04 11.98 0 0 23.66
O. barthii 1,137 23.6 0.1 23 0 12.00 0 0 23.65
O. longistaminata 2,113 21.5 – – – – – – –
O. sativa 262 5.8 – – – – – – –
O. glaberrima 130 52.0 0.03 – – – – – –
O. glumaepatula ×
O. nivara 941 26.1 5.4 40 0.42 11.70 0.025 0.025 22.62
continued on next page
meridionalis/O. nivara) to 23.83/PMC (O. barthii/O.
meridionalis) was not significantly reduced compared with that
of the parental materials (23.47 to 23.93/PMC, data not shown).
This indicated an extremely high homology among the AA
genome in the different species studied.
Multivalents were observed in some of the hybrids, suggesting
possible chromosomal translocation of the AA genome
in different species or populations. Chromosome bridges were
also found in some of the hybrids, caused more likely by the
heterozygote of chromosomal inversion in the hybrid.
Conclusions
Results indicated that all the AA genome Oryza species have
a relatively close relationship. The different AA genome species
showed different patterns of species relationships as re-
vealed by reproductive isolation data. O. meridionalis, O.
glumaepatula, O. longistaminata, O. rufipogon, and O. barthii
showed significant isolation mechanisms and warrant independent
species status. However, relationships among species from
the same geographic locations, such as O. rufipogon, O. nivara,
and O. sativa, or between O. barthii and O. glaberrima, are
considerably close and it is possible to produce fertile interspecific
hybrids without much difficulty. Whether these taxa
warrant independent taxonomic species status is questionable,
although traditionally, it is practical to treat them as distinct
species. Meiotic data revealed very limited differentiation
among the AA genome species, indicating that they contain
essentially identical genomes with high homology. Maximum
exchange of genetic materials can be achieved in the AA genome
Oryza species through conventional hybridization.
120 Advances in rice genetics

Continued from page 34.
Spikelets Mean Mean Pollen mother Meiotic configuration Chiasmata/
Combination pollinated seed panicle cells observed PMC
(no.) set (%) fertility (%) (no.) I II III IV
O. rufipogon 1,309 22.1 2.9 223 0.38 11.76 0 0.027 23.34
O. meridionalis 546 10.2 0.7 100 0 12.00 0 0 23.70
O. barthii 2,029 11.2 0.6 73 0.33 11.84 0 0 23.27
O. longistaminata 3,682 23.7 1.2 140 0.31 11.78 0 0.290 23.38
O. sativa 153 24.6 1.4 – – – – – –
O. glaberrima 40 0 – – – – – – –
O. barthii ×
O. nivara 2,405 23.0 1.1 167 0.27 11.75 0.006 0.054 23.62
O. rufipogon 1,368 33.2 2.0 50 0.08 11.96 0 0 23.56
O. meridionalis 574 8.5 0.4 24 0.08 11.96 0 0 23.83
O. glumaepatula 1,641 20.2 0.4 100 0.30 11.69 0 0.080 23.19
O. longistaminata 5,279 24.8 6.7 – – – – – –
O. sativa 534 39.8 1.6 50 0.48 11.76 0 0 23.52
O. glaberrima 740 24.7 77.2 – – – – – –
O. longistaminata ×
O. nivara 1,541 7.5 – – – – – – –
O. rufipogon 1,902 3.1 – – – – – – –
O. meridionalis 262 3.0 – – – – – – –
O. glumaepatula 932 13.3 1.4 50 0.52 11.74 0 0 23.32
O. barthii 1,898 1.5 – – – – – – –
O. sativa 1,073 3.8 – – – – – – –
O. glaberrima 78 16.1 – – – – – – –
O. sativa ×
O. nivara 300 20.9 11.9 – – – – – –
O. rufipogon 647 10.5 26.2 200 0.11 11.94 0 0.005 23.70
O. meridionalis 1,061 2.4 – – – – – – –
O. glumaepatula 192 36.5 1.1 150 0.11 11.95 0 0 23.61
O. barthii 602 12.3 0.3 – – – – – –
O. longistaminata 3,595 16.2 9.6 329 0.38 11.58 0 0.116 23.20
O. glaberrima ×
O. nivara 92 9.0 0.6 – – – – – –
O. rufipogon 210 11.6 4.7 – – – – – –
O. meridionalis 107 16.9 0.1 – – – – – –
O. glumaepatula 490 24.1 0.8 – – – – – –
O. barthii 1,022 31.4 82.4 30 0.10 11.90 0.033 0 23.47
O. longistaminata 997 25.7 – – – – – – –
a Based on panicle stainability.
References
Li HW, Wang TS, Chen CC, Wang WH. 1962. Cytogenetic studies
of Oryza sativa L. and its related species. 2. A preliminary
note on the interspecific hybrids within the section Sativa
Roschev. Bot. Bull. Acad. Sin. 3:209-219.
Lu BR. 1999. Taxonomy of the genus Oryza (Poaceae): historical
perspective and current status. Int. Rice Res. Notes 24:4-8.
Lu BR, Naredo MEB, Juliano A, Jackson MT. 1997. Hybridization
of AA genome rice species from Asia and Australia. II. Meiotic
analysis of Oryza meridionalis and its hybrids. Genet.
Res. Crop. Evol. 44:25-31.
Lu BR, Naredo MEB, Juliano A, Jackson MT. 1998. Taxonomic
status of Oryza glumaepatula Steud., a diploid wild rice species
from the New World. III. Assessment of genomic affinity
among rice taxa from South America, Asia and Australia.
Genet. Res. Crop. Evol. 45:215-223.
Lu BR, Silitonga TS. 1999. Wild rice Oryza meridionalis was first
found in Indonesia. Int. Rice Res. Notes 24(3):28.
Naredo MEB, Juliano A, Lu BR, Jackson MT. 1997. Hybridization
of AA genome rice species from Asia and Australia. I. Crosses
and development of hybrids. Genet. Res. Crop. Evol. 44:17-
24.
Naredo MEB, Juliano A, Lu BR, Jackson MT. 1998. Taxonomic
status of Oryza glumaepatula Steud., a diploid wild rice species
from the New World. II. Hybridization among South
American, Asian, and Australian AA genome species. Genet.
Res. Crop. Evol. 45:205-214.
Vaughan DA. 1989. The genus Oryza L.: current status of taxonomy.
IRRI Res. Paper Ser. 138. Los Baños (Philippines): International
Rice Research Institute.
Notes
Authors’ address: B.R. Lu, M.E.B. Naredo, A.B. Juliano, and M.T.
Jackson, Genetic Resources Center, IRRI, DAPO Box 7777,
Metro Manila, Philippines.
Genetic diversity, evolution, and alien introgression 121

Characterizing hybrid and backcross derivatives
of O. sativa × O. minuta using species probes
S.C. Tong, M.M. Clyde, Z. Zamrod, K. Narimah, and A.L. Mariam
Introgression from Oryza minuta in hybrid and backcross progenies from the cross O. sativa × O. minuta was investigated using
dot-blot hybridization with the genome-specific repetitive DNA probes pOm1, pOm4, and pOmPB10. Polymerase chain reaction
(PCR) was used to amplify the probes; the optimization was successful for pOm4 and pOmPB10. The amplified DNA
fragments were labeled with digoxigenin-11-dUTP (DIG) using the random primed labeling technique. From this procedure, 66
ng of pOm4 DNA and 76 ng of pOmPB10 DNA were labeled and used to test dot blots containing genomic DNA from hybrid and
backcross progenies of O. sativa × O. minuta. Results of hybridization using the two probes were positive for all plants tested (2
F 1
hybrid plants, 5 BC 1
plants, and 4 BC 2
plants) except for one BC 2
S12 plant, showing that these plants are introgressed with
the O. minuta genome. The BC 2
S12 plant (2n = 24) did not show any introgression.
Transfer of resistance traits via wide hybridization between
wild species of rice and the cultivated Oryza sativa has become
an important part of rice breeding programs (Jena and
Khush 1989). The tetraploid species O. minuta (BBCC genome)
has been successfully used to transfer resistance to blast
and bacterial blight (Amante-Bordeos et al 1992). O. minuta
is also known to be resistant to brown planthopper, whitebacked
planthopper, and green leafhopper (Sitch 1990). To test for
genome introgression in backcross derivatives from such wide
crosses, genome-specific DNA sequences have been developed
for several species such as O. minuta and O. australiensis,
and their potential as markers in analyzing genome introgression
was evaluated (Aswidinnoor et al 1995). This study was
conducted to detect introgression from O. minuta in backcross
plants derived from crosses of O. sativa cultivars Setanjung
and Mahsuri with O. minuta.
Materials and methods
A total of 16 genotypes were used: F 1 hybrids, BC 1 and BC 2 ,
and O. minuta and O. sativa varieties Setanjung and Mahsuri.
The backcross plants were produced in 1995 and are maintained
in the greenhouse at Universiti Kebangsaan, Malaysia.
The plasmids containing genome-specific DNA pOm1,
pOm4, and pOmPB10 (Aswidinnoor et al 1991) were obtained
courtesy of Prof. J.P. Gustafson from the University of Missouri,
Columbia. Total genomic DNA was isolated from the
plants using the protocol of Doyle and Doyle (1990). Approximately
20–50 ng µL –1 of DNA in 100 mL of final suspension
was obtained from each sample. Fragments from the plasmid
were amplified by polymerase chain reaction (PCR) using
primer pairs designed based on sequences published in
Aswidinnoor et al (1991). Table 1 gives the nucleotide sequences
of the primer pairs.
Each PCR reaction mixture consisted of 1 µL plasmid,
1 µL F primer 10 pmol, 1 µL R primer 10 pmol, 5 µL 10X
PCR buffer + MgCl 2 , 5 µL dNTP 2 mM, 0.05 µL Taq polymerase,
and 36.5 µL ddH 2 O. The PCR was performed under
the following conditions: 94 ºC for 4 min initially, denaturation
at 94 ºC for 1 min, annealing at 55 ºC for 1 min, and
extension at 72 ºC for 30 sec. After 30 cycles, final extension
was at 72 ºC for 7 min. The PCR product was purified using
the High Pure PCR Template Preparation Kit (Boehringer
Mannheim) according to the manufacturer’s instructions.
The DNA was labeled with DIG-High Prime labeling
and detection starter kit II Cat. No. 1585614 (Boehringer
Mannheim) and labeled DNA was quantified using the DIG
quantification test strip. Dot-blot hybridization and detection
were performed using anti-DIG-AP conjugate and antibody
supplied in the detection kit. For hybridization, approximately
equal amounts of DNA (3 µL) from each sample were spotted
onto the membrane.
Results and discussion
The DNA fragments containing genome-specific sequences
pOm4 (270 bp) and pOmPB10 (245 bp) were successfully
amplified and purified. However, results of PCR for pOm1
(157 bp) yielded primer-dimers and nonspecific bands of longer
molecular size than expected. Therefore, pOm1 was not used
in the detection. However, pOm4 and pOmPB10 resulted in
PCR products with the expected sizes (Table 1). The amount
of labeled DNA obtained was 66 ng for pOm4 and 76 ng for
pOmPB10.
The dot-blot experiment showed that the pOm4 probe
hybridized with samples except for O. sativa varieties
Setanjung and Mahsuri and the sample from plant B 2 S12 (Fig.
1). This indicated that the positive samples contained DNA
sequences homologous with the probes. Similar results were
obtained when pOmPB10 was used as a probe, indicating introgression
of the O. minuta genome in the positive plants.
The B 2 S12 plant did not show any hybridization to the
pOmPB10 probe. In contrast to other samples, plant B 2 M7
showed reduced hybridization signals to both pOm4 and
pOmPB10 probes. These results suggested that the amount of
introgressed O. minuta genome in B 2 M7 was less than in the
other positive plants.
122 Advances in rice genetics

Table 1. Nucleotide sequence of primer pairs for pOm1, pOm4, and
pOmPB10.
Primer pair Nucleotide sequence Size a
(bp)
pOm1 F 5′ AAG GGA ATA TGT TTG GCC CCA TTG G 3′ 157
pOm1 R 3′ GTA ACC AAC ACT TTT ACT TAA A 5′
pOm4 F 5′ TGA TTC TAA GAT CGG CAT GTC TAT T 3′ 270
pOm4 R 3′ CGA TAA GGC ATT GAC CCA TCA ATA T 5′
pOmPB10 F 5′ GAA GCA AGC ATC TCG GAG TTG GAA T 3′ 245
pOmPB10 R 3′ AAT CCC CTC CGT CGT ATG TAT AAC C 5′
a Expected size of PCR product.
O. minuta
O. sativa var. Setanjung
F 1
S4
B 1
M6
B 1
S1
B 1
S3
B 2
S12
O. sativa var. Mahsuri
F 1
S
B 1
M5
B 1
M7
B 1
S2
B 2
M7
B 2
M13
Cytological analysis showed that the BC 1 plants have
44 to 48 chromosomes, whereas the BC 2 plants, except for
B 2 S12, have 30 to 37 chromosomes (Mariam et al 1996). Thus,
positive hybridization concurs with the presence of O. minuta
chromosomes in the plants. Since the probes were highly specific
and dispersed in the O. minuta genome (Aswidinnoor et
al 1995), it can be inferred that the B 2 S12 plant (2n = 24) has
only O. sativa chromosomes. Any recombination that may have
occurred would involve DNA not containing sequences homologous
to pOm4 or pOmPB10.
References
Amante-Bordeos AD, Sitch LA, Nelson RJ, Dalmacia R, Oliva NV,
Aswidinnoor H, Leung H. 1992. Transfer of resistance to bacterial
blight and blast from the tetraploid wild rice Oryza
minuta to cultivated rice, Oryza sativa. Theor. Appl. Genet.
84:345-354.
Aswidinnoor H, Nelson RJ, Dallas JF, Mcintyre CL, Leung H,
Gustafson JP. 1991. Cloning and characterization of repetitive
DNA sequences from genomes of Oryza minuta and Oryza
australiensis. Genome 34:790-798.
Aswidinnoor H, Nelson RJ, Gustafson JP. 1995. Genome-specific
repetitive DNA probes detect introgression of Oryza minuta
genome into cultivated rice, Oryza sativa. Asia Pacific J. Mol.
Biol. Biotechnol. 3:215-223.
Doyle JJ, Doyle JL. 1990. Isolation of plant DNA from fresh tissue.
Focus 12:1315.
B 2
S14
pOm4 PCR products
B 2
S45
pOmPB10 PCR
Fig. 1. Dot blots of DNA samples hybridized to probe pOmPB10—
parent, hybrid, and backcross progenies are indicated. Note: No
hybridization with O. sativa and B 2 S12 plant.
Jena KK, Khush GS. 1989. Monosomic alien addition lines of rice:
production, morphology, cytology, and breeding behavior.
Genome 32:449-455.
Mariam AL, Zakri AH, Mahani MC, Normah MN. 1996. Interspecific
hybridization of cultivated rice Oryza sativa with the
wild rice O. minuta Presl. Theor. Appl. Genet. 93:664-671.
Sitch LA. 1990. Incompatibility barriers operating in crosses of Oryza
sativa with related species and genera. In: Gustafson JP, editor.
Genetic manipulation and plant improvement. II. New York
(USA): Plenum Press. p 77-93.
Notes
Genetic variation for perenniality in O. sativa/
O. rufipogon derivatives
E.J. Sacks, K.M. McNally, L. Liu, R. Lafitte, and T. Sta. Cruz
Authors’ addresses: S.C. Tong, M.M. Clyde, K. Narimah, School of
Environmental and Natural Resource Sciences; Z. Zamrod,
School of Biosciences and Biotechnology, Faculty of Science
and Technology, 43600 Bangi, Selangor; A.L. Mariam, School
of Science and Technology, Universiti Malaysia Sabah, Locked
Bag 2073, 88999 Kota Kinabalu, Sabah, Malaysia.
Introgression of perenniality genes from Oryza rufipogon to O. sativa would help upland rice farmers reduce soil erosion from
their fields. Parental upland cultivars and 51 O. sativa/O. rufipogon F 1
combinations were evaluated for 12 mo in an upland
field. None of the 14 parental upland cultivars survived the experiments, indicating that they were not highly perennial. In
contrast, 95 interspecific progenies (19%) survived, indicating that perenniality genes from O. rufipogon were expressed in
some of the hybrids. The choice of O. rufipogon as parental material had a large and highly significant effect on the survival rate
of the interspecific progenies. Phenotypic selection for perenniality should be done more than a year after planting. The
percentage of surviving individuals in F 1
families at 12 mo was moderately and significantly correlated with the vigor of the O.
rufipogon parent at 20 mo posttransplanting but not with parental vigor at 9 mo. These observations were consistent with a
Genetic diversity, evolution, and alien introgression 123

strong and significant correlation between the percentages of surviving individuals within O. rufipogon accessions at 15 mo with
data taken at 21 mo. Moreover, the percentage of surviving individuals within O. rufipogon accessions at 9 mo was not
significantly correlated with percent survival at 15 mo or 21 mo, indicating that early selection for perenniality is not efficient.
Selectable genetic variation for perenniality has been found in O. rufipogon and its progenies with O. sativa. Combining
agronomically desirable traits with perenniality should be feasible but will be time-intensive.
To foster sustainable land use, mitigate soil erosion, and protect
watersheds, we are developing perennial rice for the upland
ecosystem. In Southeast Asia, upland rice is often grown
on hilly fields, providing food security via low but stable yields
(about 1 t ha –1 ) with few or no purchased inputs. The traditional
shifting cultivation system for upland rice has long rotations
and is relatively sustainable. Recently, there has been a
trend toward less sustainable shorter rotations and more intensive
use of marginal lands. Perennial rice could be a useful
tool for enabling farmers to produce food sustainably while
using their land more intensively.
Oryza rufipogon is the undomesticated progenitor species
of cultivated Asian rice, O. sativa (Khush 1997). Upland
rice cultivars are annual or weakly perennial at best. We have
previously identified accessions of O. rufipogon that segregate
for perenniality and drought tolerance (IRRI 1998). Thus,
O. rufipogon may be a useful source of genes for developing
perennial cultivated rice.
Materials and methods
From six accessions of O. rufipogon observed in the earlier
study (IRRI 1998), 12 individuals were selected and crossed
with upland rice cultivars to produce F 1 seed (Table 1). Crossed
to each O. rufipogon genotype were one or more of 14 upland
rice cultivars (Table 1).
In 1998-99, an experiment was conducted to evaluate
the perenniality and drought tolerance of 51 O. sativa/O.
rufipogon F 1 combinations. In an upland field at IRRI, 501 F 1
individuals were evaluated. Two rows of seedlings spaced on
0.5-m centers were planted in each of 10 concrete-lined beds.
Beds were 1.2 m wide by 15.9 m long, with 0.8 m between
beds. All plants from a cross were placed in a single observational
plot.
From planting through mid-March 1999, supplemental
sprinkler irrigation was provided as needed. To evaluate
drought tolerance, no supplemental irrigation was provided
from 15 March 1999 (during the dry season) until the end of
the experiment. Because of above-average rainfall for March,
April, and May, entries were exposed to only a modest drought
stress. On 30 June 1999, entries were scored for survival and
survivors were rated for vigor (on a 1 to 9 scale, where 1 is
highest). The effects on F 1 survival of the O. sativa parent, O.
rufipogon parent, and their interaction were assessed using SAS
procedures CATMOD and FREQ (SAS 1990).
Results and discussion
By the end of the experiment, none of the cultivar controls had
survived, indicating that the O. sativa parents were not highly
perennial. For the F 1 s, 95 plants (19%) survived, indicating
that genes for perenniality from O. rufipogon were expressed
in some F 1 s.
Linear model analysis by SAS procedure CATMOD did
not detect significant interactions between the O. sativa and
O. rufipogon parents, or a significant main effect of the O.
sativa parent. Alhough the O. sativa parent and parental combination
did not have a detectable effect on survival, these data
should be interpreted cautiously in the light of the incomplete
crossing design. The effect of the O. rufipogon parent was
highly significant (P

Table 1. Number of O. sativa/O. rufipogon F 1 plants observed and percentage that survived after 1 year of cultivation and 2.5 months of
moderate drought stress.
O. rufipogon parents
O. sativa parents Probability a
106138-18 106138-4 106138-7 106340-2 106144-18 106340-1 105832-1 106144-2 106133-9
Azucena – – 4 – – 12 5 – 2 0.233
25% 8% 0% 0%
Basmati 370 5 9 – – 14 10 8 – – 0.000
40% 78% 21% 0% 0%
Cuiabana – – 12 – – 10 12 10 10 0.085
33% 10% 25% 0% 0%
IR55423-01 1 10 – 13 12 – – – – 0.018
100% 30% 8% 0%
IR60080-46A – – 14 – – 12 12 3 10 0.568
7% 0% 17% 0% 0%
IR63371-38 – – – – – 3 – – – na
0%
IR63380-08 – – – – – 10 – – – na
10%
IR65907-216-1-B 4 – – 14 – – – – – 0.011
100% 21%
IR68704-145-1-1-B – 10 – 14 – – – – – 0.000
90% 7%
IRAT104 – – 12 – – 2 – – – 0.091
58% 0%
IRAT212 – – 12 – – 10 12 13 10 0.011
58% 10% 17% 15% 0%
IRAT216 – – 12 – – – – – – na
0%
Vandana – – 12 – – 12 12 13 10 0.000
17% 0% 8% 0%
WAB56-50 – – 14 – – 12 12 3 12 0.055
21% 33% 0% 0% 0%
Prob. b 0.250 0.017 0.000 0.591 0.140 0.449 0.229 0.853 na
Summary by O. rufipogon
Total 10 29 92 41 26 93 73 42 54
Percent survived 70 66 35 12 12 11 10 7 0
Mean vigor of progenies 3.4 3.8 6.0 5.4 6.3 4.2 5.6 4.7 na
Standard deviation
for vigor 2.5 2.1 2.3 4.5 2.1 1.5 2.6 2.3 na
9-mo vigor of parent c 3 3 1 – 7 1 5 3 5
20-mo vigor of parent c 1 3 5 – 5 7 10 5 10
a Probability based on Fisher’s Exact Test for H 0 : no differences among O. rufipogon parents within each O. sativa parent. b Probability based on Fisher’s Exact Test for H 0 : no
differences among O. sativa parents within each O. rufipogon parent. c Vigor in a previous greenhouse experiment at 9 and 20 mo after transplanting; 10 = dead; na = not
applicable.
the earlier study on O. rufipogon accessions (IRRI 1998).
Within O. rufipogon accessions, a strong and significant correlation
was observed between the percentage of surviving
individuals at 15 mo with survival at 21 mo (r = 0.81). However,
the percentage of surviving individuals within O.
rufipogon accessions at 9 mo was not significantly correlated
with percent survival at 15 or 21 mo. Thus, both studies indicate
that early selection for perenniality is not efficient. Phenotypic
selection for perenniality should not be done earlier
than 1 y after planting.
Recombination and selection should allow the identification
of progenies that are perennial and agronomically desirable.
While the prospects for developing perennial cultivated
rice are good, much time will need to be invested in this
endeavor.
References
IRRI (International Rice Research Institute). 1998. Program report
for 1997. Manila (Philippines): IRRI. 175 p.
Khush GS. 1997. Origin, dispersal, cultivation and variation of rice.
Plant Mol. Biol. 35:25-34.
SAS Institute Inc. 1990. SAS/STAT user’s guide, version 6. 4th ed.
Cary, N.C. (USA): SAS Institute.
Notes
Authors’ address: Plant Breeding, Genetics, and Biochemistry Division,
International Rice Research Institute, DAPO Box 7777,
Manila, Philippines.
Genetic diversity, evolution, and alien introgression 125

Genetic population structures of Oryza glumaepatula
and O. grandiglumis distributed in the Amazon flood area
M. Akimoto and H. Morishima
Two wild rice species, Oryza glumaepatula (AA, 2n = 24) and O. grandiglumis (CCDD, 2n = 48), often grow sympatrically in the
Amazon Basin. The two species have different traits for adapting to heavy flood stress. O. glumaepatula can form floating
meadows and move down the river, while O. grandiglumis is immovable but has prominent internode elongation ability. Population
genetic structures of O. glumaepatula and O. grandiglumis were analyzed based on variation at 22 loci involving 13
enzymes in natural populations. The fixation index over polymorphic loci was 0.956 for O. glumaepatula and 0.344 for O.
grandiglumis, indicating that the former is predominantly selfing and the latter is partially outcrossing. Gene diversity calculated
for each population of O. glumaepatula tended to increase when going from the upper to the lower basin. The migration ability
of this species produces a gene flow that most probably proceeds in a one-way direction from the upper to the lower basin. In
O. grandiglumis, gene flow might have occurred mostly by means of pollen dispersion. Since pollen flow is nondirectional, no
gradient variation of gene diversity observed in O. glumaepatula was found in O. grandiglumis. Different life-history traits might
have led to the differentiation of the population structures of the two Amazonian wild rice species.
Life-history traits of plants strongly affect the genetic structure
of their natural populations. Population structures may
differ even among closely related species if they developed
different life-history traits.
Two wild rice species, Oryza glumaepatula (2n = 24)
and O. grandiglumis (2n = 48), often exist sympatrically in
the Amazon Basin. However, they seem to have different lifehistory
traits and differ in adaptation to the flood-area environments:
O. glumaepatula can quickly elongate its internodes
in response to the rapid increase in river water. At a
certain growth stage, its culms break and float on the water
surface. With secondary tillers and adventitious roots, it constructs
floating meadows and drifts about the river, mostly from
the upper to the lower basin. O. grandiglumis can also elongate
its internodes to cope with the rapid increase in river water,
but it never forms floating meadows as does O.
glumaepatula. Instead, it has the ability to lift its panicles above
water as deep as 10 m.
We examined the allozyme variability for the natural
populations of O. glumaepatula and O. grandiglumis and
looked at the factors affecting the genetic structures of Amazonian
wild rice populations.
Materials and methods
Allozyme variability was analyzed for 22 loci involving 13
enzymes using 15 populations each for O. glumaepatula and
O. grandiglumis. These populations were located in the upper
region from Manaus, a city in the middle reaches of the Amazon
(Fig. 1). We grew 15 plants per population and young leaves
were used for the allozyme assay. Statistical parameters such
as fixation index and Nei’s gene diversity were calculated based
on polymorphic loci.
Results and discussion
Among the loci analyzed, 12 loci of 9 enzymes and 5 loci of 4
enzymes were polymorphic as well as detectable for heterozygotes
of O. glumaepatula and O. grandiglumis, respectively.
For O. glumaepatula, observed heterozygosity (Ho) and expected
heterozygosity (He) were 0.010 and 0.223, respectively,
and its fixation index (Fis) was 0.956, indicating that Amazonian
O. glumaepatula is predominantly self-pollinating. Ho
and He for O. grandiglumis were 0.214 and 0.326, respectively,
and its Fis was significantly different from zero (Fis =
0.344, P>0.10). Amazonian O. grandiglumis is considered to
be partially outcrossing because we found many heterozygotes
in the populations.
The coefficients of gene differentiation (Gst) were 0.618
for O. glumaepatula and 0.280 for O. grandiglumis (Table 1).
These indicated that allele frequency at a locus tended to be
differentiated among geographically isolated populations in
both species, while the degree was larger in O. glumaepatula.
To examine the association between population location and
variability of genes, gene diversity was regressed against the
distance from Manaus for each population (Fig. 2). In O.
glumaepatula, gene diversity was found to increase as the populations
got farther from Manaus. The ability of O. glumaepatula
to float down the river resulted in a one-directional gene flow
proceeding from the upper to the lower basin, with the genes
accumulating in the lower basin. In O. grandiglumis, we could
not explain the variation pattern in gene diversity in relation to
the location of populations. The regression slope was not significantly
different from zero (P>0.10). Most probably, gene
flow by means of pollen dispersion has occurred among partially
outcrossing populations of O. grandiglumis. Because
pollen flow is nondirectional, gradient variation of gene diversity
as observed in O. glumaepatula was not found in O.
grandiglumis.
126 Advances in rice genetics

O. glumaepatula
O. grandiglumis
Manaus
100 km
Fig. 1.Geographic distribution
of the natural populations
of O. glumaepatula and
O. grandiglumis.
Gene diversity
0.3
0.2
O. glumaepatula
O. grandiglumis
Table 1. Allozyme diversity found in O. glumaepatula and O.
grandiglumis: observed heterozygosity (Ho), expected heterozygosity
(He), fixation index (Fis), and coefficient of gene differentiation
(Gst). Parameters were calculated using data from 12 and 5 polymorphic
loci for O. glumaepatula and O. grandiglumis, respectively.
Species Populations Ho He Fis Gst
O. glumaepatula 15 0.010 0.223 0.956 0.618
O. grandiglumis 15 0.214 0.326 0.344 0.280
0.1
O. glumaepatula and O. grandiglumis have different lifehistory
traits and different modes of gene flow among populations.
This might have led to the differentiation of the population
structures of the two species in the Amazon Basin.
0.0
0 2 4 6 8
Distance from Manaus (´100 km)
Fig. 2.Gene diversity as a function of geographic distance of populations
from Manaus. Solid and dashed lines denote regression
lines for O. glumaepatula and O. grandiglumis, respectively.
Notes
Authors’ addresses: M. Akimoto, Obihiro University of Agriculture
and Veterinary Medicine, Obihiro 080-8555; H. Morishima,
National Institute of Genetics, Mishima 411-8580, Japan.
Genetic diversity, evolution, and alien introgression 127

Oryza glumaepatula Steud. introgression lines in rice:
identification of genes for reproductive barriers
Sobrizal, Y. Matsuzaki, K. Ikeda, P.L. Sanchez, K. Doi, H. Yasui, E.R. Angeles, G.S. Khush, and A. Yoshimura
To broaden rice genetic resources, we developed introgression lines carrying Oryza glumaepatula (IRGC Acc. 105668) and O.
sativa cv. Taichung 65 cytoplasm. These lines contain overlapped O. glumaepatula chromosomal segments that covered most
parts of the O. glumaepatula genome in the Taichung 65 genetic background. Introgression lines were developed through
repeated backcrossing with Taichung 65 as a recurrent parent. Candidate lines were selected using 106 restriction fragment
length polymorphism (RFLP) markers well distributed on 12 rice chromosomes. During the process of development, two
reproductive barriers, hybrid weakness and pollen semisterility, were observed in the backcross populations. Hybrid weakness
was attributed to the interaction between O. glumaepatula cytoplasm and the nuclear genome of Taichung 65. The dominant
allele of O. glumaepatula restored the hybrid weakness of the plants having O. glumaepatula cytoplasm. The gene responsible
for hybrid weakness restoration was designated Rhw (hybrid weakness restoration for O. glumaepatula cytoplasm) and was
closely linked to RFLP marker C1115 on chromosome 8. Two F 1
pollen semisterility genes, S22(t) and S23(t), were closely
linked to RFLP markers S910 on chromosome 2 and C1340 on chromosome 7, respectively. Since the O. glumaepatula
homozygous alleles were not observed at the S910 locus in the BC 4
F 2
population, it seemed that the pollen having the O.
glumaepatula allele at the S22(t) locus aborted.
Oryza glumaepatula, a diploid (AA genome) wild species, is
distributed in Central and South America and the Caribbean
(Vaughan 1989). This species is adapted to flooded conditions
and grows widely in the Amazon Basin, Brazil (Akimoto et al
1998). The F 1 hybrids between O. sativa and O. glumaepatula
generally showed high pollen sterility (Hinata and Oka 1962,
Chu et al 1969). Molecular markers have enabled us to locate
useful genes or quantitative trait loci (QTLs). Using markeraided
selection, we developed a series of O. glumaepatula introgression
lines with O. sativa L. cv. Taichung 65 and O.
glumaepatula cytoplasm in the genetic background of Taichung
65. Such introgression lines would be important to broaden
rice genetic resources as well as to analyze the genetics of
traits specific to O. glumaepatula and to exploit this species in
rice breeding. We also analyzed the two reproductive barriers
(hybrid weakness and pollen sterility) encountered during the
development of introgression lines.
Materials and methods
In developing introgression lines, F 1 plants obtained through
reciprocal crosses between O. glumaepatula (IRGC Acc.
105668) and Taichung 65 served as female parents and were
continuously backcrossed with Taichung 65 to produce the
BC 4 F 1 populations. To select plants having the desired genotypes,
a whole-genome survey was conducted in the BC 3 F 1
generation by using 106 restriction fragment length polymorphism
markers scattered on 12 chromosomes. Selections in
the BC 4 F 1 generation were made on the basis of the observation
of genotypes of the target regions only. Then, the selected
BC 4 F 1 plants were self-pollinated to obtain BC 4 F 2 plants as
candidates for fixed lines.
To analyze hybrid weakness, a heterozygous plant having
O. glumaepatula cytoplasm (BC 4 F 1 17-27) was crossed
with Taichung 65. The BC 5 F 1 population was used as a mapping
population. Two genes for hybrid sterility were analyzed
using BC 5 F 1 and BC 4 F 2 populations.
Results and discussion
Development of introgression lines
In BC 3 F 1 , 103 plants having O. glumaepatula cytoplasm and
83 plants having Taichung 65 cytoplasm were genotyped by
106 RFLP markers to select plants containing the desired genotypes.
Each set of 27 selected plants with O. glumaepatula
cytoplasm and 36 plants with Taichung 65 cytoplasm, providing
almost complete coverage of the O. glumaepatula genome,
was further backcrossed to Taichung 65. In the BC 4 F 1 , 63 plants
having O. glumaepatula cytoplasm and 84 plants having
Taichung 65 cytoplasm were selected from 167 and 184 plants,
respectively, based on the genotype of the target region. Most
parts of the O. glumaepatula genome were covered, except
for some regions of chromosomes 1, 6, 10, and 12.
Hybrid weakness
The BC 4 F 1 with O. glumaepatula cytoplasm showed segregation
for hybrid weakness. Hybrid weakness was characterized
by poor growth stature and completely sterile panicles. But no
weak plant was observed in the BC 4 F 1 generation with Taichung
65 cytoplasm. In addition, the whole-genome genotyping using
106 RFLP markers revealed that all of the normal plants
segregated in the BC 3 F 1 with O. glumaepatula cytoplasm carried
alleles of O. glumaepatula at the locus of C1115 on chromosome
8. This tendency was not observed in the BC 3 F 1 with
Taichung 65 cytoplasm.
When a BC 4 F 1 plant with O. glumaepatula cytoplasm—
which contained the chromosome segment of O. glumaepatula
around the region of C1115 and which showed normal growth
128 Advances in rice genetics

stature—was crossed with Taichung 65, 28 normal and 29 weak
plants segregated in the BC 5 F 1 . Monogenic segregation (1:1)
suggests that hybrid weakness was governed by one gene. Tight
linkage was found between the weakness and C1115 on chromosome
8 (Fig. 1). Breeding behavior in the development of
two sets of O. glumaepatula introgression lines as well as linkage
analysis demonstrated that the weakness was due to the
interaction of O. glumaepatula cytoplasm and the Taichung
8S
8L
2.5 cM
Rhw
C1115
C347
Fig. 1. Linkage map of chromosome 8 showing the location
of Rhw. Framework map on the left is taken from
Harushima et al (1998).
65 nuclear genome, which resides around the locus of C1115.
The allele of O. glumaepatula is dominant and can restore
hybrid weakness of the plants having O. glumaepatula cytoplasm.
This gene was designated Rhw (hybrid weakness restoration
for O. glumaepatula cytoplasm).
Hybrid sterility
Two loci for hybrid sterility were identified in these backcross
populations. In the BC 4 F 2 population derived from BC 4 F 1 265
with Taichung 65 cytoplasm, the plants having normal and
semisterile pollens segregated in a 1:1 ratio (Fig. 2A). The
gene controlling pollen semisterility was tightly linked with
RFLP markers S910, R2510, and R2460 on the short arm of
chromosome 2 (Fig. 2B). Since no report is available on a
hybrid sterility gene on chromosome 2, this gene was designated
S22(t). The plant carrying heterozygous alleles at the
S22(t) locus showed 50% pollen sterility. Furthermore, no plant
with O. glumaepatula homozygous alleles at S910 was observed
in this BC 4 F 2 population (Table 1), suggesting that the
pollens carrying the O. glumaepatula allele were aborted.
The monogenic segregation (1:1) showing normal and
semisterile pollens was also observed in the BC 5 F 1 population
derived from backcrossing of BC 4 F 1 112 with Taichung 65
(Fig. 3A). Using this BC 5 F 1 population, the gene controlling
this pollen semisterility was mapped on the long arm of chromosome
7 and tightly linked with C1340 (Fig. 3B). Doi et al
(1999) reported that the F 1 pollen semisterility gene S21, found
in the backcross progenies of O. sativa and O. glaberrima,
was also tightly linked with RFLP marker C1340 on chromosome
7. There is a high possibility that S21 is allelic to the
hybrid sterility gene of O. glumaepatula. The gene is tentatively
designated S23(t).
No. of plants
40
30
A
N = 68
32
2S
B
C1357
36
20
1.5 cM
10
0
0 20 40 60 80 100
Pollen fertility (%)
2L
S22(t)
R2510
S910
R2460
Fig. 2. Frequency distribution
of pollen fertility in
the BC 4 F 2 population derived
from BC 4 F 1 265 (A)
and linkage map of chromosome
2 showing the
location of S22(t) (B).
No. of plants
50 A
50
40
N = 104
30
54
7S
B
cM
1.0
R1789
S23(t)
C1340
20
10
0
0 20 40 60 80 100
Pollen fertility (%)
7L
1.9
C213
Fig. 3. Frequency distribution
of pollen fertility in the BC 5 F 1
population derived from BC 4 F 1
112 (A) and linkage map of
chromosome 7 showing the
location of S23(t) (B).
Genetic diversity, evolution, and alien introgression 129

Table 1. Inheritance of Taichung 65 and O. glumaepatula
alleles at marker S910 in BC 4 F 2 population.
Pollen fertility
Allele a
TT TG GG
Normal 32 0 0
Semisterile 0 36 0
a TT, TG, and GG are Taichung 65 homozygous and heterozygous alleles
and O. glumaepatula homozygous alleles, respectively.
This study revealed the characteristics and chromosomal
location of three genes controlling reproductive barriers in
hybrids of O. glumaepatula and O. sativa. Information about
the nature of reproductive barriers would enable precise use
of the O. glumaepatula trait in improving rice varieties.
Chu YE, Morishima H, Oka HI. 1969. Reproductive barriers distributed
in cultivated rice species and their wild relatives. Jpn.
J. Genet. 44:207-223.
Doi K, Taguchi K, Yoshimura A. 1999. RFLP mapping of S20 and
S21 for F 1 pollen semi-sterility found in backcross progeny
of Oryza sativa and O. glaberrima. Rice Genet. Newsl. 16:65-
67.
Harushima H, Yano M, Shomura A, Sato M, Shimano T, Kuboki Y,
Yamamoto T, Lin SY, Antonio BA, Parco A, Kajiya H, Huang
N, Yamamoto K, Nagamura Y, Kurata N, Khush GS, Sasaki
T. 1998. A high-density rice genetic linkage map with 2275
markers using a single F 2 population. Genetics 148: 479-494.
Hinata K, Oka HI. 1962. A survey of hybrid sterility relationships in
the Asian forms of Oryza perennis and Oryza sativa. Jpn. J.
Genet. 37:314-328.
Vaughan D. 1989. The genus Oryza L.: current status of taxonomy.
IRRI Research Paper Series No. 138. Los Baños (Philippines):
International Rice Research Institute
References
Akimoto M, Shimamoto Y, Morishima H. 1998. Population genetic
structure of wild rice Oryza glumaepatula distributed in the
Amazon flood area influenced by its life-history traits. Mol.
Ecol. 7:1371-1381.
Notes
Authors’ addresses: Sobrizal, Y. Matsuzaki, K. Ikeda, P.L. Sanchez,
K. Doi, H. Yasui, and A. Yoshimura, Plant Breeding Laboratory,
Faculty of Agriculture, Kyushu University, Fukuoka 812-
8581 Japan; E.R. Angeles and G.S. Khush, International Rice
Research Institute, Los Baños, Philippines.
Advanced backcross analysis for transferring QTLs
from O. rufipogon
S.N. Ahn, K.H. Kang, J.P. Suh, S.J. Kwon, H.P. Moon, H.C. Choi, and S.R. McCouch
Two improved rice cultivars (Milyang23 and Hwaseongbyeo) were crossed to Oryza rufipogon, and their F 1
hybrids were backcrossed
to two elite cultivars. The promising BC 1
plants, selected for desirable phenotypic traits, were backcrossed to elite
cultivars to produce BC 2
plants. A total of 275 and 173 BC 2
F 2
families derived from the crosses of Milyang23 and Hwaseongbyeo,
respectively, were evaluated in replicated yield trials in Suwon, Korea. Eight agronomic traits, including yield and days to
heading, were evaluated. Transgressive segregants were observed for yield and other yield components. The BC 2
F 2
families
were screened using RFLP and microsatellite markers. Linkage analysis was conducted using QGENE with a threshold value of
0.01. Two QTLs associated with yield were identified on chromosomes 1 and 2 for the cross Milyang23/O. rufipogon. In
addition, 26 QTLs associated with yield components were also identified. For the Hwaseongbyeo/O. rufipogon cross, 20 QTLs
related to yield and yield components were identified. Our data suggested that introgression from O. rufipogon could contribute
positively to yield in elite cultivars.
Genetic diversity is a prerequisite for increasing yield and for
stabilizing production in the event of disease epidemics and
fluctuating environmental conditions. Wild relatives of crop
species have been given considerable attention in germplasm
collection because much of the genetic variation to be used is
contained in the wild relatives. The wild relatives of crop species
are phenotypically less desirable than modern varieties in
their overall appearance. These genetic resources have not been
used extensively for enhancing the performance of modern
cultivars, other than as a source of single genes for disease and
insect resistance. Recent research has shown the potential of
using wild species to improve cultivated crops for both yield
and quality traits (Xiao et al 1998). Two well-saturated restriction
fragment length polymorphism (RFLP) maps of rice
are available and a microsatellite map providing genome-wide
coverage of rice has been developed recently (Temnykh et al
2001). These maps contain closely linked, codominant loci
that can be monitored for linkage to genes controlling virtually
any trait important to crop plants. These maps, if used in
conjunction with traditional breeding techniques, allow researchers
to locate and selectively transfer genes conditioning
biotic and abiotic stress tolerance and various agronomic traits.
By targeting previously unused sources of genetic variation,
molecular marker analysis offers an effective way to bring
130 Advances in rice genetics

valuable new genes into the gene pool and simultaneously
improve crop performance. This study began to determine the
potential for using the wild relative, O. rufipogon, to improve
quantitative traits of agronomic importance in elite Korean
varieties Milyang23 and Hwaseongbyeo.
Materials and methods
O. rufipogon (IRGC 105491) was hybridized as the pollen
parent to Milyang23 and Hwaseongbyeo. The F 1 plants were
backcrossed twice to Milyang23 using Milyang23 as the pollen
parent. The 21 best-looking BC 1 plants out of 40 were
selected and backcrossed a second time to Milyang23 to produce
2,000 BC 2 plants. A subset of 275 BC 2 plants was selected
and selfed to produce the BC 2 F 2 families. The 275 BC 2 F 2
families along with the two parents were grown in a bird-netequipped
field at the National Crop Experiment Station,
Suweon, Korea. The field planting followed a completely randomized
block design with three replications. For each family
within a replication, 30-d-old seedlings were transplanted to a
two-row plot with 20 plants per row. Grain yield per plant was
obtained by averaging the grain harvest of the middle 20 plants
in each plot. Evaluation of seven additional traits (days to heading,
culm length, panicle length, panicles per plant, spikelets
per panicle, 1,000-grain weight, and ripening ratio) followed
the Standard evaluation system (RDA 1995). Two classes of
markers were employed to assay DNA polymorphisms between
the parents (Milyang23, O. rufipogon): RFLPs and
microsatellites. Leaf tissues were harvested from bulks of at
least 20 plants from each of the BC 2 F 2 families. Microsatellite
markers showing simple sequence repeat polymorphisms between
the parents were used to assay the BC 2 F 2 families. The
procedures for the analysis were as described in Panaud et al
(1996). Statistical analyses were performed using QGENE
(Nelson 1997) and Data Desk 4.0.
Results and discussion
Eighty out of 101 microsatellite markers (79%) detected polymorphism
between the parents, Hwaseongbyeo and O.
rufipogon. The higher polymorphism frequency by
microsatellite markers seemed to demonstrate the greater resolution
of this marker system.
Figure 1 shows the frequency distribution of eight traits
in the BC 2 F 2 families in the Hwaseongbyeo cross. O. rufipogon
(characterized as tall, awned, late-maturing, dormant, susceptible
to shattering, and with a black hull) was among the lowest
performers, being phenotypically inferior to Hwaseongbyeo.
Most of the BC 2 F 2 families yielded less than Hwaseongbyeo.
The transgressive segregants were observed for all traits: 11%
and 24% of the 173 BC 2 F 2 families outperformed Milyang23
in grain yield and spikelets per panicle, respectively. For the
BC 2 F 2 families in the Milyang23 cross, 9% and 36% outperformed
Milyang23 in grain yield and spikelets per panicle,
respectively (data not shown). In addition, 26 QTLs associated
with yield components were also identified for the
Milyang23/O. rufipogon cross. For the Hwaseongbyeo/O.
rufipogon cross, 20 QTLs related to yield and yield components
were identified. These results suggested that genes from
O. rufipogon can improve an elite cultivar in yield and yield
components.
To detect the O. rufipogon chromosome segments in the
Milyang23 genetic background of elite cultivars and demonstrate
a significant correlation between their presence and enhanced
grain yield, QTL mapping was conducted on the BC 2 F 2
data by regression of field performance on marker genotype
using standard ANOVA procedures. One QTL affecting grain
yield in the Milyang23 cross was identified on chromosome 1
(P

Hwaseongbyeo O. rufipogon Hwaseongbyeo O. rufipogon
Frequency
50
40
30
20
10
0
103 108 113 118 123 128 133
Days to heading
50
40
30
20
10
0
75 85 95 105 115 125
80 90 100 110 120
Culm length (cm)
Hwaseongbyeo O. rufipogon Hwaseongbyeo
O. rufipogon
60
50
20
20
10
0 0
20 21 22 23 24 25 26 11 12 13 14 15 16 17 18 19 20
40
40
30
Panicle length (cm)
Panicle number
60
40
20
0
60
70
Fertility (%)
Hwaseongbyeo
O. rufipogon
Hwaseongbyeo
O. rufipogon
40
80 100 120 140
30
20
10
0
60 65 70 75 80 85 90 95
90 110 130
Spikelets panicle –1
Hwaseongbyeo
O. rufipogon
40
30
20
10
0
16 17 18 19 20 21 22 23 25
1,000-grain weight (g)
O. rufipogon
50
40
30
20
10
0
24
Hwaseongbyeo
4.0 5.0 6.0 7.0 8.0 9.0
4.5 5.5 6.5 7.5 8.5
Yield (t ha –1 )
Fig. 1. Frequency distribution of
eight traits in the BC 2 F 2 families
from the O. sativa cv.
Hwaseongbyeo/O. rufipogon cross.
1
RZ288
RG458
RG532
RG811
Notes
Authors’ addresses: S.N. Ahn, Department of Agronomy, Chungnam
National University, Daejeon 305-764; K.H. Kang, J.P. Suh,
S.J. Kwon, H.P. Moon, H.C. Choi, National Crop Experiment
Station, RDA, Suwon 441-100, Korea; S.R. McCouch, Department
of Plant Breeding, 252 Emerson Hall, Cornell University,
Ithaca, N.Y. 14853, USA.
RM5
Milyang23/O. rufipogon
RZ776
RM34
Hwaseongbyeo/O. rufipogon
RZ730
RG331
Fig. 2. A comparison of
yield QTLs in RM5 region
on chromosome 1 of
rice.
132 Advances in rice genetics

Wild-QTL-allele effect in the background
of japonica Nipponbare and indica (IR36) cultivars
T. Ishii, N.S. Bautista, K. Shimadzutsu, N. Kobayashi, N. Uchida, and O. Kamijima
To identify useful quantitative trait loci (QTL) alleles from wild rice relatives, an accession of wild rice Oryza rufipogon from
Myanmar was crossed with one japonica (Nipponbare) and one indica (IR36) cultivar. In the BC 2
generation using O. sativa as
the recurrent parent, 11 morphological characters (days to heading, photosynthesis activity, culm and panicle length, number
of tillers, yield, 100-seed weight, seed length and width, grain length and width) were evaluated with the two populations,
consisting of approximately 200 plants each. Single-point QTL analysis was carried out with about 75 microsatellite markers
almost covering the rice genome. A total of 55 and 51 QTLs were identified at a significance of P

polymerase (Toyobo, Japan). Amplification was carried out in
a thermal cycler MP (TaKaRa, Japan) or PTC100 thermal controller
(MJ Research Inc., USA) as follows: 94 ºC for 5 min,
followed by 35 cycles of 94 ºC for 1 min, 55 ºC for 1 min, 72
ºC for 2 min, and ending with 5 min at 72 ºC for the final
extension. Amplified products were electrophoresed in 4%
polyacrylamide denaturing gel and the banding patterns were
visualized by the nonradioactive silver-staining method as described
by Panaud et al (1996).
Statistical analyses were performed using QGENE software
(Nelson 1997). QTL mapping was conducted on BC 2
data by regression of trait performance on marker genotype
using standard analysis of variance (ANOVA) procedures. The
map information on the microsatellite markers used was after
Temnykh et al (2000). A QTL was assumed to be associated
with a marker locus at a significance of P

Panaud O, Chen X, McCouch SR. 1996. Development of
microsatellite markers and characterization of simple sequence
length polymorphism (SSLP) in rice (Oryza sativa L.). Mol.
Gen. Genet. 252:597-607.
Tanksley SD, McCouch SR. 1997. Seed banks and molecular maps:
unlocking genetic potential from the wild. Science 277:1063-
1066.
Temnykh S, Park WD, Ayres N, Cartinhour S, Hauck N, Lipovich L,
Cho YG, Ishii T, McCouch SR. 2000. Mapping and genome
organization of microsatellite sequences in rice (Oryza sativa
L.). Theor. Appl. Genet. 100:697-712.
Wu KS, Tanksley SD. 1993. Abundance, polymorphism and genetic
mapping of microsatellites in rice. Mol. Gen. Genet. 241:225-
235.
Xiao J, Grandillo S, Ahn SN, McCouch SR, Tanksley SD, Li J, Yuan
L. 1996. Genes from wild rice improve yield. Nature 384:223-
224.
Notes
Authors’ addresses: T. Ishii, N. Uchida, O. Kamijima, Faculty of
Agriculture, Kobe University, Kobe 657-8501; N.S. Bautista
and K. Shimadzutsu, Graduate School of Science and Technology,
Kobe University, Kobe 657-8501; N. Kobayashi, Experimental
Farm, Kobe University, Kasai, Hyogo 675-2103,
Japan.
Trait-improving wild QTL alleles identified using advanced
backcross QTL analysis from a cross between cultivated
rice, Oryza sativa, and wild rice, O. rufipogon
N.S. Bautista, K. Shimadzutsu, T. Teranishi, S. Takamatsu, N. Kobayashi, N. Uchida, O. Kamijima, and T. Ishii
Advanced backcross quantitative trait loci (AB-QTL) analysis was carried out to identify the valuable QTLs from wild species
Oryza rufipogon W630, which is close to the cultivated species but inferior in its overall phenotype. The BC 2
testcross population
(O. sativa cv. IR36/O. rufipogon//IR36) consisting of 204 plants was used to evaluate 11 agronomically important quantitative
traits. Segregation of some traits approximately fitted the normal distribution, but transgressive segregants were also
observed for some of the traits studied. Using 74 microsatellite markers, a total of 51 significant QTLs were identified by singlepoint
analysis, of which 28 (54.9%) had wild QTL alleles that could enhance traits. For yield, four wild QTL alleles for increased
yield were detected. Results suggested that the wild QTL alleles would be useful for improving traits of agronomic importance
in rice.
Many important agronomic traits such as yield, days to heading,
number of panicles, and number of seeds per panicle show
a continuous range of phenotypes and are controlled by many
genes. These traits with complex inheritance are referred to as
quantitative traits. The availability of many new techniques
and saturated molecular maps in various crops made it possible
to study the effects of the individual quantitative trait
loci (QTLs). Recently, a new approach known as advanced
backcross quantitative trait loci (AB-QTL) analysis was developed
to identify and transfer valuable QTLs from unadapted
donor lines such as wild rice into elite breeding lines. Hence,
wild species of rice are now being used as a source of new
genes believed to be of intrinsic value in crop improvement.
In this study, trait-improving QTL alleles from wild species
were identified using an advanced backcross population
between the cultivated indica rice variety IR36 and the wild
Oryza rufipogon acc. W630 from Myanmar.
Materials and methods
The cultivated O. sativa indica cv. IR36 and wild O. rufipogon
acc. W630 were used in the QTL analysis as recurrent and
donor parents, respectively. Each single F 1 plant produced from
their cross was used to produce BC 1 plants. Seventeen BC 1
plants were selected to produce the BC 2 population.
Eleven morphological traits—(1) days to heading, (2)
photosynthesis activity, (3) culm length, (4) panicle length, (5)
number of tillers, (6) yield, (7) 100-seed weight, (8) seed length,
(9) seed width, (10) grain length, and (11) grain width—were
evaluated in 204 BC 2 plants. Selfed seeds of BC 2 plants
(BC 2 F 2 ) were used in the yield-testing trials in two locations,
Rokko and Kasai, in Japan.
Bulked DNA from more than 10 BC 2 F 2 seedlings was
used as total DNA of each BC 2 plant. These DNA samples
were used as templates to amplify the rice microsatellite regions.
In total, 113 microsatellite markers covering the 12 chromosomes
of rice were used in this study (Chen et al 1997,
Temnykh et al 2000). The procedure used for the microsatellite
assay was as described by Panaud et al (1996).
Statistical analyses were performed using QGENE
(Nelson 1997). QTL mapping was conducted on BC 2 data by
regression of trait performance on marker genotype using standard
analysis of variance procedures. The QTL was assumed
to be associated with a locus at a significance of P

Table 1. Correlations among 11 morphological traits in BC 2 population between O. rufipogon W630 and O. sativa IR36. a
Trait DH PS CL PL NT Y YR YK 100W SL SW GL
Days to heading (DH)
Photosynthesis 0.052
activity (PS)
Culm length (CL) 0.006 –0.135
Panicle length (PL) 0.275** –0.031 0.524**
No. of tillers (NT) 0.301** –0.027 0.196** 0.058
Yield (Y) 0.233** –0.136 0.783** 0.514** 0.549**
Yield in Rokko (YR) –0.096 0.033 0.702** 0.338** 0.051 0.587**
Yield in Kasai (YK) –0.179* –0.154 0.299** 0.209 –0.183* 0.280** 0.400**
100-grain weight 0.197** 0.014 0.283** 0.231** 0.012 0.351** 0.291** 0.134
(100W)
Seed length (SL) –0.271** –0.122 0.127 0.048 0.016 0.171* 0.213* 0.321** 0.213**
Seed width (SW) 0.056 0.028 0.164* 0.237** 0.033 0.149 0.058 0.160 0.226** 0.000
Grain length (GL) 0.151* 0.073 0.269** 0.136 –0.022 0.260** 0.313** 0.388** 0.434** 0.797** 0.044
Grain width (GW) 0.114 0.100 0.255* 0.316** –0.075 0.264** 0.175* 0.257** 0.468** –0.081 0.559** 0.177*
a * and ** = P

Table 2. Putative QTL locations and the most closely associated markers for 11 morphological characters detected in a BC 2 population
between Oryza rufipogon W630 and O. sativa cv. IR36.
Trait Chr. QTL location Marker Source PV (%) a P b AA AW Allele Additive
class c class c effect d % e
Days to heading 6 RM204 RM204 IR36 12.01 0.0007 105.27 99.25 –6.02 –11.44
9 RM242–RM201 RM242 IR36 10.42 0.0015 105.28 99.81 –5.47 –10.39
11 RM4B RM4B W630 11.13 0.0010 102.29 109.06 6.76 13.22
Photosynthesis 6 RM204–RM253 RM253 W630 13.68 0.0003 49.18 54.63 5.44 22.12
activity 11 RM4B RM4B W630 7.39 0.0073 49.78 54.35 4.57 18.36
12 RM20A RM20A IR36 9.03 0.0031 51.48 45.82 –5.66 –21.99
Culm length 1 RM9–RM246 RM5 W630 26.50

Tanksley SD, Grandillo S, Fulton TM, Zamir D, Eshed Y, Petiard V,
Lopez J, Beck-Bunn T. 1996. Advanced backcross QTL analysis
in a cross between an elite processing line of tomato and
its wild relative L. pimpinellifolium. Theor. Appl. Genet.
92:213-224.
Temnykh S, Park WD, Ayres N, Cartinhour S, Hauck N, Lipovich L,
Cho YG, Ishii T, McCouch SR. 2000. Mapping and genome
organization of microsatellite sequences in rice (O. sativa L.).
Theor. Appl. Genet. 100:697-712.
Notes
Authors’ addresses: N.S. Bautista, K. Shimadzutsu, Graduate School
of Science and Technology; T. Teranishi, S. Takamatsu, N.
Uchida, O. Kamijima, T. Ishii, Faculty of Agriculture, Kobe
University, Kobe 657-8501; and N. Kobayashi, Experimental
Farm, Kobe University, Kasai, Hyogo 675-2103, Japan.
Using new alleles from wild rice Oryza rufipogon to improve
cultivated rice (O. sativa ) in Latin America
C.P. Martínez, P. Moncada, J. López, A. Almeida, G. Gallego, J. Borrero, M.C. Duque, W. Roca, S.R. McCouch, C. Bruzzone, and J. Tohme
We report on progress made in identifying quantitative trait loci (QTLs) associated with yield increase in Oryza rufipogon. Two
improved rice cultivars (Bg90-2 and Oryzica 3) were crossed to O. rufipogon. The resulting BC 2
F 1
was evaluated on the basis
of negative phenotypic selection for undesirable agronomic traits. More than 300 BC 2
F 2
families were grown in replicated yield
trials at CIAT (Palmira). Data on 12 agronomic traits, including grain yield, were recorded. Transgressive segregation was
observed for grain yield and yield components. In the cross Bg90-2/O. rufipogon, and compared with Bg90-2, 16% of the
BC 2
F 2
families showed higher grain yield, while 22% of them had higher 1,000-grain weight; 48% showed higher total grain
yield per plant, 43% had longer panicles, and 26% had increased grain length. Similar results were obtained in the cross
Oryzica 3/O. rufipogon. The BC 2
F 2
families were screened using 140 restriction fragment length polymorphism (RFLP) markers
and 78 microsatellite markers. Linkage analysis was conducted using QGENE with a threshold value of 0.01. Molecular
markers RM13 and RM242 located on chromosomes 5 and 9, respectively, were associated with alleles derived from O.
rufipogon affecting grain yield positively. Out of 69 QTLs identified in the cross Bg90-2/O. rufipogon, 18 (26%) were traitimproving
alleles derived from O. rufipogon and these showed no detectable negative effect on any measured trait. From a
breeding perspective, these QTLs can be used immediately.
Latin America and the Caribbean (LAC) produces some 22
million t of rice, which represents about 3.6% of the world
rice output in an area of 6.7 million ha, representing 4.5% of
the world rice area. Nearly 300 varieties have been released,
90% of them targeted to irrigated conditions; modern semidwarf
varieties with higher yields and resistance to the main
diseases and pests account for 93% of all irrigated rice production,
in which average yield went from 3.3 t ha –1 in 1966 to
5.0 t ha –1 in 1995. However, little progress has been made in
upland rice and average yield remains around 1.3 t ha –1 . The
yield of improved upland varieties such as Caiapo typically
averages 2.5 t ha –1 (Moncada et al 2000).
Studies have indicated that yield per se of irrigated rice
in LAC has reached a plateau (Martínez et al 1995) probably
because of the narrow genetic base of both irrigated and upland
rice. New alleles can provide genetic variability for crop
enhancement. The wild Oryza species represent a potential
source of new alleles for improving the yield, quality, and stress
resistance of cultivated rice, but they have rarely been used
for the genetic improvement of quantitative traits (Xiao et al
1998). Xiao et al (1996, 1998) showed that quantitative trait
loci (QTLs) derived from O. rufipogon (IRGC Accession no.
105491) were associated with yield enhancement and other
important agronomic traits. The objective of this paper is to
provide increasing evidence that certain regions in O. rufipogon
harbor genes of interest for the genetic improvement of cultivated
rice in LAC.
Materials and methods
Population development
Two or three plants of the wild species O. rufipogon were hybridized
to several plants of each of the improved rice cultivars
Bg90-2, Oryzica 3, and Caiapo. Three F 1 hybrid plants
were backcrossed to the improved cultivar, using the latter as
the female parent; approximately 100–180 BC 1 F 1 seeds were
obtained per cross combination. The resulting BC 1 F 1 plants
were transplanted and evaluated on the basis of phenotype:
negative phenotypic selection for undesirable agronomic traits
(spreading plant type, excessive shattering, long awns, darkcolored
grains, high sterility, etc.) was used to narrow the selection
down to the best (40–50) individuals. Each selected
BC 1 individual was backcrossed again to the recurrent parent
and approximately 30 BC 2 F 1 seeds were produced: 20 BC 2
seeds from each of the selected BC 1 plants were sown under
irrigated conditions.
Negative phenotypic selection was applied again and the
best individuals per cross were selected and harvested indi-
138 Advances in rice genetics

vidually to produce the BC 2 F 2 seed: approximately 220–300
BC 2 F 1 plants were selected per cross combination for field
testing. Each selected BC 2 F 2 family was evaluated for 12 agronomic
traits.
Number of families
80
60
BG90-2
Field trials (F 2
, F 3
, F 4
, and F 5
generations)
The BC 2 F 2 families derived from the crosses of Bg90-2,
Oryzica 3, and Caiapo with O. rufipogon were planted in replicated
yield trials at CIAT (Palmira) and La Libertad Experiment
Station, Villavicencio. The Caiapo/O. rufipogon cross
was planted under upland-savanna conditions and two different
experiments were run. In the first experiment, BC 2 families
were established as an upland monoculture, while, in the
other experiment, the same 300 BC 2 families were planted in
an adjacent plot in association with a pasture crop, Brachiaria
brizantha. Transplanting (20 × 30 cm) was used at CIAT
(Palmira), whereas direct seeding was used elsewhere. A completely
randomized design with two replicates in a 2-row plot,
5 m long, was used. Data on 12 agronomic traits were recorded
on 10 randomly selected plants per plot, including plot grain
yield per family.
Based on yield potential and good agronomic traits, 38
BC 2 F 2 families from the cross Bg90-2/O. rufipogon were selected
and advanced by the bulk/pedigree methods and selected
on phenotype only. Evaluations for grain yield were done in
the F 3 and F 5 generations; a completely randomized design
with four replicates in a 4-row plot, 5 m long, was used. Additionally,
288 BC 2 F 2 families were planted under rainfed conditions
in Santa Rosa, Villavicencio, to be evaluated and selected
for tolerance for the main disease (rice blast) and
Helminthosporium, leaf scald, and grain discoloration. Based
on disease reaction and plant type, the best families were selected
and advanced by the bulk method up to the F 5 generation.
The most promising BC 2 F 2 families were identified in
the Oryzica 3/O. rufipogon cross and advanced by the pedigree
method to be yield-tested as F 4 families.
Molecular characterization of selected populations
The population of 274 BC 2 F 2 families from the cross Caiapo/
O. rufipogon was analyzed using 125 markers distributed at
aproximately 10-cM intervals throughout the genome. A total
of 200 restriction fragment length polymorphisms (RFLPs)
using four restriction enzymes (EcoRI, EcoRV, HindIII, and
DraI) and 50 simple sequence length polymorphisms (SSLPs)
were used to survey the parents for polymorphism. A total of
84 RFLPs and 43 simple sequence repeats (SSRs) were used
in the analysis of Bg90-2/O. rufipogon. SSLP analysis was
done as described in Chen et al (1997), with some modifications
in the polymerase chain reaction (PCR) profile.
Linkage map
The order of the RFLP markers was based on the interspecific
map of rice described by Causse et al (1994) and the order of
SSLP markers was based on Chen et al (1997) and Temnykh
et al (1999). Marker integration was done by aligning markers
common to both populations and establishing the most likely
40
20
O. rufipogon
0
1.0 3.5 6.0 8.5 11.0
Yield (t ha –1 )
Fig. 1. Frequency distribution of grain yield of 300 BC 2 F 2 families
from Bg90-2/O. rufipogon.
order and cM distances using Mapmaker on the BC 2 F 2 population.
Segregation ratios of individual markers were statistically
determined for each marker locus and deviation from the
expected Mendelian ratios was determined by chi-square tests
(P

the BC lines kept their yield advantage over the recurrent parent
through several generations of phenotypic selection; some
of these lines have been sent to national rice programs in LAC
for testing under local conditions.
Figure 2 summarizes putative QTLs affecting grain yield
and other agronomic traits that were derived from O. rufipogon.
Based on analyses of 125 SSLP and RFLP markers scored on
274 BC 2 F 2 families from Caiapo/O. rufipogon and using SPA,
IM, and CIM, Moncada et al (2000) detected two putative O.
rufipogon-derived QTLs for grain yield, 13 for yield components,
four for maturity duration, and six for plant height. In
contrast, based on 43 SSRs and 84 RFLP markers used to score
300 BC 2 F 2 families from the cross Bg90-2/O. rufipogon, at
CIAT we detected two putative QTLs for grain yield derived
from O. rufipogon, 16 for yield components, and one for maturity.
Although the phenotypic performance of the wild parent
would not suggest its value as a useful parent in a breeding
program, it is noteworthy that around 51% of the trait-enhancing
QTLs identified in both populations were derived from O.
rufipogon. Similar findings were reported by Xiao et al (1996,
1998) in a BC 2 F 2 population from a cross between O. rufipogon
and a popular Chinese hybrid.
It is also important to highlight that the picture emerging
when we consider data from Xiao et al (1998), Moncada et al
(2000), and our work at CIAT is that O. rufipogon possesses
alleles that affect grain yield and its components in a positive
manner and these alleles are likely to be expressed regardless
of environment, location, and genetic background.
In conclusion, parallel studies using advanced backcross
(AB)-QTL analysis provide strong evidence that certain regions
of the rice genome are likely to harbor genes of interest
for the improvement of cultivated rice in multiple environments.
This approach seems to have good potential for simultaneously
improving yield, adaptation, and grain quality for
cultivars in LAC and for broadening the genetic base of both
irrigated and upland rice.
References
Causse MA, Fulton TM, Cho YG, Ahn SN, Chunwongse J, Wu K,
Xiao JL, Yu Z, Ronald PC, Harrington SE, Second G,
McCouch SR, Tanksley SD. 1994. Saturated molecular map
of the rice genome based on an interspecific backcross population.
Genetics 138:1251-1274.
Chen X, Temnykh S, Xu Y, Cho YG, McCouch SR. 1997. Development
of a microsatellite framework map providing genomewide
coverage in rice (Oryza sativa L.). Theor. Appl. Genet.
95:553-567.
Table 1. Agronomic and grain quality traits of the top 10 BC 2 F 5 lines from the cross Bg90-2/O.
rufipogon under transplanting conditions, CIAT, 1999.
Pedigree Grain yield Flowering 1,000-grain White center Grain Amylose
(t ha –1 ) (d) weight (g) (0–5) length (%)
CT13956-29-M-3-M 7.4 96 33.3 3.0 L 31.3
CT 13976-7-M-6-M 7.2 98 30.2 2.2 M 32.0
CT13956-29-M-2-M 7.0 99 30.4 2.0 M 32.1
CT13956-29-M-29-M 7.0 98 33.5 3.4 L 28.9
CT13959-3-M-30-M 6.9 98 31.5 2.0 L 31.6
CT13956-29-M-14-M 6.9 95 29.8 2.2 L 29.3
CT3943-2-M-2-M 6.7 101 30.2 3.0 L 32.0
CT13958-13-M-26-M 6.7 102 28.1 0.6 L 30.9
CT13976-7-M-21-M 6.7 103 32.2 2.8 L 30.8
CT13959-3-M-10-M 6.7 99 31.1 1.8 L 32.0
CT13941-27-M-14-M 6.5 104 28.5 0.8 L 32.0
Bg90-2 (recurrent parent) 5.9 105 29.5 2.6 L 29.8
O. rufipogon 3.8 90 26.7 1.4 M 28.5
Table 2. Grain yield (t ha –1 ) stability of BC 2 lines from the
cross Bg90-2/O. rufipogon through different generations.
Pedigree BC 2 F 2 BC 2 F 3 BC 2 F 5
(1996) a (1997) b (1999) b
CT13941-27-M-14-M 7.0 7.3 6.5
CT13959-3-M-10-M 6.8 6.7 6.7
CT13958-13-M-5-M 6.8 7.0 6.5
CT13943-2-M-2-M 6.7 6.7 6.7
CT13976-7-M-6-M 5.9 7.5 7.2
CT13956-29-M-3-M 6.0 7.2 7.4
Bg90-2 6.0 6.5 5.9
O. rufipogon 2.2 5.0 3.8
a Av. of 2 replications. b Av. of 4 replications.
Martínez CP, Fisher A, González D, Ramírez H, Mojica D. 1995.
Potencial y limitaciones del nuevo tipo de planta de arroz del
IRRI. Arroz 15-20.
Moncada P, Martínez CP, Borrero J, Chatel M, Gauch Jr H, Guimarães
EP, Tohme J, McCouch SR. 2000. Quantitative trait loci (QTL)
for yield and yield components in an Oryza sativa × Oryza
rufipogon BC 2 F 2 population evaluated in an upland environment.
Theor. Appl. Genet. 102(1):41-52.
Temnykh S, Park WD, Ayres N, Cartinhour S, Hauck N, Lipovich L,
Cho YG, Ishii T, McCouch SR. 1999. Mapping and genome
organization of microsatellite sequences in rice (Oryza sativa
L.). Theor. Appl. Genet. 100(5):698-712.
Xiao J, Li J, Yuan L, Tanksley SD. 1996. Identification of QTLs
affecting traits of agronomic importance in a recombinant in-
140 Advances in rice genetics

RZ54
RZ54
CDO52
RM
RM22
RG36
RM233
h2.1
RG140
RM243
RZ449
disp1.1
RZ276
RM
spl1.1, spp1.1, gpp1.1
RZ513
ph1.1, gpl1.1, gw1.1, yld1.1
gw1.2
RZ613
RZ462
ph1.2
RM226
RM104
RZ801
dth3.1, dtm3.1
RZ783
RG10
RZ32
Chr 1
RM gpp1.1, ps1.1
RZ99
RM
RG95
RZ73
RZ53
RZ44
RM21
RM6
RM2
RZ54
gpp1.2, pl1.1, gpl1.1,
ps1.2, dth1.3, h1.1
dth3.1
ps3.1
spp2.1
gpp2.1
gpp2.2, spl2.1
spp2.2, spl2.2,
ph2.1, gpl2.1
dth2.1, dtm2.1, ph2.2
spp2.3, gpp2.3
RG14
CDO71
RZ16
RZ10
RM22
RZ56
RG256
RM20
RM26
RM30
Chr 2
RG50
RZ59
RZ47
RG2
RM22
RM
CDO68
RZ66
RM20
RM4
RG37
RM26
RZ6
gpp2.1, gpl2.1
pl2.1
ppl2.1
gpl4.1
gl4.1
RG10
RG10
spp4.1, gpp4.1
RG90
RG44
RG90
RZ65
wid3.1
dth3.2
RM
RZ74
RZ1
RZ58
RZ39
RZ57
RZ2
RZ59
RZ63
RM
RM25
RG91
RG36
RM1
RM5
wc3.2
gl3.1
gl3.2, ps3.2
ph4.1
RM11
RZ74
CDO24
RG16
RM31
RM12
CDO3
RM28
Chr 4
RG17
RZ71
RG32
RG47
RG21
RZ59
BCD13
RG16
gpp4.1
RZ63
gw3.1
RZ99
RM22
RM14
spp5.1, gpp5.1
RG135
RG55
RZ39
RZ55
CDO8
CDO50
RZ29
RZ18
Chr 3
RM12
RM1
RM24
RM16
RZ6
gl5.1, wc5.1
gw5.1, gpp5.1, wc5.3
spl6.1
RZ100
wax
RZ39
RZ14
RM21
RM5
RM20
RZ66
RG44
RM21
RZ61
yld6.1
ph5.2
RG48
RZ92
CDO20
Chr 5
CDO116
RG47
RZ22
RM2
RM3
pl5.1, gpl5.1
gl5.2
ppl6.1
CDO7
RM3
Chr 6
RG102
RM
RZ68
RZ88
pl6.1, h6.1
Fig. 2. Map locations of putative QTLs detected. Threshold value at 1%. Left markers indicate Caiapo/O. rufipogon cross. Right
markers indicate Bg90-2/O. rufipogon cross. QTLs are represented in italics and QTLs with increased effect due to O. rufipogon
are represented in boldface.
Genetic diversity, evolution, and alien introgression 141

RG35
RG11
RG39
RM24
RM1
RM23
RM15
RG2
RM23
RM3
RM4
ppl8.1, dth8.1
dtm7.1
dth
RG62
RM1
RM12
Chr 7
RG14
CDO40
RG3
RM21
RZ27
RM4
RG
RM14
RM26
RZ32
RZ61
RG103
RM21
RM23
RG59
pl1.1
Chr 8
CDO59
RM22
RZ206
RM25
RZ89
RM21
ps10.1
RZ1
RM24
pl9.1
RM31
BCD38
RM215
yld
disp1 1.1
ste 10.1
RZ40
CDO9
RG35
Chr 9
RG45
RZ40
RM20
ste 10.2
RM30
RZ50
RM14
Chr 10
RZ81
RZ42
wc11.1
ppl11.1
spl11.1
gw11.1
gpl11.1
ydl11.1
gw11.1
RG9
RM28
RZ63
RG11
RG109
RM20
RZ90
RZ53
RM22
RM4, RM20B, RM
C79
RM16
G32
G4
RM2
BCD80 gl11.1
RM25
G146
RM4
RM1
RZ39
RM10
RG86
RG
RM20
RG57
G111
RM1
RZ81
G139
RZ39
RG34
RG8
RG86
RG
RG45
gw12.1
C8
RG30
RZ7
CDO33
RZ26
RZ7
RG54
Chr 11
RZ53
gpl11.1
RM30
RM23
Chr 12
RG19
RG90
RM1
yld12.2
142 Advances in rice genetics

ed population derived from a subspecific rice cross. Theor.
Appl. Genet. 92:230-244.
Xiao J, Li J, Grandillo S, Sang-Nag A, Tanksley SD, McCouch SR.
1998. Identification of trait-improving quantitative trait loci
alleles from a wild rice relative, Oryza rufipogon. Genetics
150:899-909.
Notes
A new gene for resistance to bacterial blight
from Oryza rufipogon
Qi Zhang, S.C. Ling, B.Y. Zhao, C.L. Wang, W.C. Yang, K.J. Zhao, L.H. Zhu, D.Y. Li, and C.B. Chen
Authors’ addresses: C.P. Martínez, J. López, A. Almeida, G. Gallego,
J. Borrero, M.C. Duque, W. Roca, C. Bruzzone, J. Tohme,
CIAT, Apartado Aéreo 6713, Cali, Valle, Colombia; P.
Moncada, S.R. McCouch, Department of Plant Breeding, 252
Emerson Hall, Cornell University, Ithaca, NY 15863-1901,
USA.
One accession of wild rice Oryza rufipogon, RBB16, was found to be highly resistant to all 16 strains of Xanthomonas oryzae
pv. oryzae, including seven Chinese pathotypes and nine Philippine races. RBB16 was crossed with JG30, a susceptible indica
variety, and the F 1
was highly resistant to strain PXO99. The F 1
was used to produce doubled haploids through anther culture.
Resistant H 2
plants were advanced to H 4
, which was then backcrossed with the recurrent parent JG30. The BC plants similar
5
to JG30 and resistant to all 16 strains were selfed four times and a near-isogenic line with resistance was developed and
designated as WBB1. Inoculation tests showed that WBB1 was highly resistant to the nine Philippine races at both the seedling
and adult stages, while IRBB21 had the same broad spectrum of resistance at the tillering stage but not at the seedling stage.
Inheritance analysis showed that the resistance of WBB1 to PXO99 is controlled by a single dominant gene. After screening
160 simple sequence repeat primers, two markers (OSR6 and RM224) were found to be linked with the resistance gene. The
gene was mapped on rice chromosome 11, which is 5.3 cM from OSR6 and 27.7 cM from RM224. We have designated the
new gene from O. rufipogon as Xa23(t).
Bacterial blight (BB) caused by Xanthomonas oryzae pv.
oryzae (Xoo) is a serious rice disease in China. The resistance
gene Xa4 has been widely used in indica hybrids and inbred
cultivars. A strong selection among the pathogen population
has increased the frequency of Chinese pathotype V, which is
virulent to Xa4. Varieties with Xa4 became susceptible (Zhang
et al 1994). Khush et al (1990) identified a new resistance
gene, Xa21, from Oryza longistaminata. It was mapped on
chromosome 11.
Twenty-one resistant accessions from wild rice were reevaluated
with seven Chinese pathotypes, six Philippine races,
and three Japanese races at both the seedling and adult stages.
One accession, RBB16, from O. rufipogon, showed resistance
to all the strains used (Zhang et al 1994). An interspecific cross
was made between RBB16 and JG30, a susceptible indica cultivar.
We report on the identification of and molecular mapping
of the gene transferred from O. rufipogon into rice.
Materials and methods
Since the resistance of WBB1 was controlled by a dominant
gene (as analyzed in a previous study), six near-isogenic lines
(NILs) with BB dominant resistance genes—Xa21, Xa3, Xa4,
Xa7, Xa10, and Xa14 (Ogawa et al 1991)—were used as testers.
WBB1 was crossed with susceptible cultivar JG30 and
populations of F 2 and BC 1 F 1 were developed. In a previous
study, we found that none of the known genes, including Xa1,
Xa2, Xa3, Xa4, and Xa7, were allelic to the resistance gene in
WBB1 (Lin et al 1992).
Sixteen strains including seven Chinese pathotypes and
nine Philippine races were used. To examine the segregation
of the resistance gene, the F 2 populations were tested with strain
PXO99. Inoculum was prepared with a concentration of about
10 9 cells mL –1 . Fully expanded leaves of the plants were inoculated
at the seedling stage. Lesions were scored 14 d after
inoculation by visual assessment of percentage of lesion area.
Genomic DNA was isolated according to Dellaporta et
al (1983). Total DNA was digested with restriction enzymes
BamHI, BglII, DraI, EcoRI, EcoRV, HindIII, SacI, and XbaI,
separated by electrophoresis on 0.8% agarose gel and transferred
onto nylon membranes. Fifteen restriction fragment
length polymorphism (RFLP) markers located near the region
of simple sequence repeat (SSR) marker OSR6 were used as
probes to survey WBB1, JG30, F 1 , and resistant/susceptible
bulks of F 2 . The RFLP markers were further analyzed in the
F 2 population of 148 plants.
One hundred and sixty SSR primers were surveyed for
their ability to amplify the polymorphic bands between the
parents and the resistant and susceptible bulks. Polymerase
chain reaction was performed according to Panaud et al (1996).
A 148-plant F 2 population was used for linkage analysis
of the resistance gene and the SSR and RFLP markers. Markers
were placed on the linkage map by using the program
Mapmaker 3.0. Distances between markers are presented in
Genetic diversity, evolution, and alien introgression 143

Susceptible progenies
Resistant progenies
S Pool
R Pool
JG30
F 1
WBB1
Fig. 1. Cosegregation between
Xa23(t) and OSR6 in F 2
progenies derived from JG30/
WBB1.
centiMorgans, derived by using the Kosambi function
(Kosambi 1994). All markers were ordered at LOD>3.0.
Results and discussion
WBB1 showed resistance to the nine races at all growth stages.
IRBB21 also showed resistance to the nine races at the tillering
stage but not at the seedling stage. Xa3, Xa4, Xa7, Xa10, and
Xa14 showed no resistance to race 6, but showed resistance to
other races. The resistant reactions of WBB1 to the nine Philippine
races are different from that of gene Xa21 and other
testers.
All the F 1 plants from the cross WBB1/JG30 were highly
resistant to PXO99. The F 2 populations segregated in a ratio
of 3R:1S (x 2 = 0.88, P>0.25), and the BC 1 F 1 segregated in a
ratio of 1R:1S (x 2 = 0.06, P>0.25). The results indicate that
WBB1’s resistance to PXO99 is controlled by a single dominant
gene.
SSR analysis was performed using WBB1, JG30, and
the resistant/susceptible DNA bulks. Among the 160 SSR
primer pairs screened, OSR6 and RM224 detected polymorphism
between WBB1 and JG30 or the R pool and S pool
(Fig. 1). All 148 F 2 plants were surveyed with SSR primers
OSR6 and RM224 and linkage analysis was performed. The
new gene of WBB1 was mapped between two loci, 5.3 cM
from OSR6 and 27.7 cM from RM224, on rice chromosome
11 (Fig. 2).
RFLP markers in the region near OSR6 were selected to
probe the Southern blots of WBB1, F 1 , and JG30 DNA digested
with enzymes BamHI, BglII, DraI, EcoRI, EcoRV,
HindIII, SacI, and XbaI. Of 15 probes tested, only G1465 detected
polymorphism between the parents, and this was then
used to survey the filters of 148 F 2 plants. The distance between
RFLP marker G1465 and the new gene was 16.7 cM
(Fig. 2). Thus, the gene for resistance to BB from O. rufipogon
appears to be distinct from all the known resistance genes. We
have designated the new gene as Xa23(t).
References
Dellaporta SL, Wood J, Hicks JB. 1983. A plant DNA mini-preparation:
version II. Plant Mol. Biol. Rep. 1:19-21.
Khush GS, Bacalangco E, Ogawa T. 1990. A new gene for resistance
to bacterial blight from O. longistaminata. Rice Genet.
Newsl. 7:121-122.
Kosambi DD. 1994. The estimation of map distances from recombination
values. Ann. Eugenet. 12:172-175.
cM
18.4
15.5
16.3
19.7
4.2
RG103
RG1109
CDO520
OSR6
G1465
RM224
L190
RZ536
Xa21
Xa23(t)
Xa7
Xa3
Xa4
Fig. 2. Location of Xa23(t) on
the molecular map. The positions
of other markers and
bacterial blight resistance
genes are according to
Causse et al (1994).
Lin SC, Zhang Q, Que GS, Xing ZY, Wang CL. 1992. Evaluation
and genetic analysis for resistance to bacterial blight in wild
rice. Chin. J. Rice Sci. 6(4):155-158.
Ogawa T, Yamamoto T, Khush GS, Mew TW. 1991. Breeding of
near-isogenic lines of rice with single genes for resistance to
bacterial blight pathogen (Xanthomonas oryzae pv. oryzae)
in wild rice. Jpn. J. Breed. 41:523-529.
Panaud O, Chen X, McCouch SR. 1996. Development of
microsatellite markers and characterization of simple sequence
length polymorphisms (SSLPs) in rice (Oryza sativa L.). Mol.
Gen. Genet. 252:597-607.
Zhang Q, Wang CL, Shi AN, Bai JF, Lin SC. 1994. Evaluation of
resistance to bacterial blight (Xanthomonas oryzae pv. oryzae)
in wild species. Sci. Agric. Sin. 27(5):1-9.
144 Advances in rice genetics

Notes
Authors’ addresses: Qi Zhang, S.C. Ling, B.Y. Zhao, C.L. Wang,
and K.J. Zhao, Key Laboratory of Crop Genetics and Breeding,
Ministry of Agriculture, Institute of Crop Breeding and
Cultivation, CAAS, Beijing, 100081, China; L.H. Zhu, Institute
of Genetics, Academia Sinica, Beijing, 100101, China;
Identifying blast resistance in Oryza species
and its introgression into U.S. rice cultivars
G.C. Eizenga, T.H. Tai, F.N. Lee, and J.N. Rutger
D.Y. Li and C.B. Chen, Institute of Germplasm Resources,
GAAS, Naining, 530007, China.
Acknowledgments: This work was supported in part by the
Rockefeller Foundation (No. 1994-001#253, 97001#586) and
the National Natural Science Foundation of China (No.
39670508).
Blast (caused by Pyricularia grisea Cav.) is the major fungal disease affecting rice in the United States. Wild species have often
served as sources of disease resistance genes for crop plants. Research objectives were to (1) develop a method for screening
Oryza spp. and their progenies for resistance to rice blast races and (2) use closely linked microsatellite markers to follow the
introgression of blast resistance from Oryza spp. into cultivated rice. Twenty-one accessions, representing O. barthii, O.
glumaepatula, O. meridionalis, O. nivara, and O. rufipogon, were inoculated with U.S. blast races IB-1, IB-33, IB-49, IC-17, IE-
1K, IG-1, and IH-1 and rated for susceptibility. Some O. nivara accessions and an O. rufipogon accession appeared to have
resistance to certain U.S. blast races. The Oryza spp. were crossed with the long-grain experimental line RU9401188 and the
medium-grain cultivar Bengal. The F 2
progenies from these crosses and self seed from BC 1
progenies were evaluated for blast
resistance. Microsatellite markers, which map to previously identified blast resistance regions, are being used to follow the
introgression of Oryza sp. DNA into cultivated rice. Additional markers will be screened to identify novel Pi loci.
Blast (caused by Pyricularia grisea Cav.) is one of the major
fungal diseases affecting rice (Oryza sativa L.) in the United
States (Bonman 1992). Six different blast lineages are commonly
found in the U.S. P. grisea population (Correll and Lee
1996).
Wild relatives of Oryza are an important source of useful
genes for improvement of cultivated rice as summarized
by Khush (1989) and Sitch (1990). In U.S. germplasm, however,
only stem rot (caused by Sclerotium oryzae Cattaneo)
resistance has been reported to be introgressed from O.
rufipogon (Rutger et al 1987). Restriction fragment length
polymorphism (RFLP) and random amplified polymorphic
DNA markers closely linked to blast resistance genes (Pi genes)
have been previously identified (McCouch et al 1994). Chen
et al (1997) described 121 rice microsatellite markers and suggested
that these markers could be used for genotype identification
and marker-assisted selection. In the U.S., researchers
are surveying microsatellite markers to determine those very
closely linked to certain Pi genes.
The objectives of this study were to (1) develop a method
for screening Oryza spp. and their progenies for resistance to
the U.S. rice blast races and (2) identify microsatellite markers
closely linked to regions conferring blast resistance, which
could be used to follow the introgression of the Oryza sp. segments
into cultivated rice.
Materials and methods
Twenty-one species (AA genome) representing O. barthii, O.
glumaepatula, O. meridionalis, O. nivara, and O. rufipogon
were inoculated with a spore suspension of U.S. blast races
IB-1, IB-33, IB-49, IC-17, IE-1K, IG-1, and IH-1 at the fourto
five-leaf growth stage. One week after inoculation, plants
were rated for blast susceptibility using a scale of 0 = no lesions
to 9 = large susceptible lesions and/or leaves dying. Two
or three repeat inoculations and ratings were made on the same
plants using this procedure. To incorporate blast resistance into
cultivated rice, the Oryza spp. were backcrossed with the longgrain
experimental line RU9401188 and the medium-grain
cultivar Bengal (Linscombe et al 1993), both of which are
adapted to the southern U.S. Progenies were evaluated for blast
resistance using the aforementioned procedure.
Using RiceGenes (http://ars-genome.cornell.edu/rice/),
25 microsatellite markers were selected (RM17, RM21, RM39,
RM50, RM51, RM82, RM83, RM101, RM119, RM120,
RM136, RM208, RM210, RM213, RM221, RM223, RM229,
RM235, RM238b, RM241, RM249, RM254, RM255, RM256,
and RM263), which were closely linked to RFLP fragments
associated with blast resistance or mapped to the same chromosomal
regions as Pi genes. The markers were obtained from
Research Genetics (Huntsville, Alabama) and amplified according
to the manufacturer’s specifications. Markers were run
on a 4% polyacrylamide gel and visualized by silver staining
(Chen et al 1997).
Genetic diversity, evolution, and alien introgression 145

Table 1. Oryza species rated for blast tolerance in the seedling stage using blast races found in the U.S.
Species No. of Blast races a
accessions
IB-1 IB-33 IB-49 IC-17 IE-1K IG-1 IH-1
O. barthii 6 MS-S S S MR-MS S MS-S MR-S
O. glumaepatula 3 S S S MS MS-S S MR-MS
O. meridionalis 3 MS-S S S MS MS-S S MR-MS
O. nivara 5 MR-S MR-S MR-S R-MS R-MS-S R-S R-MR-MS
O. nivara/O. sativa 2 MR-MS S S MR-MS S R-MR MS
O. rufipogon 1 MR S MR MR MS MR MR
O. sativa/O. nivara 1 MS S MS MS S MS MS
a S = susceptible, MS = moderately susceptible, MR = moderately resistant, and R = resistant.
Results and discussion
Blast screenings indicated individual O. nivara accessions and
an O. rufipogon accession having resistance to specific U.S.
blast races (Table 1). Results from blast inoculations of the F 2
progenies produced by fertile F 1 plants suggest that resistance
to some blast races may be transferred into the U.S. cultivars
from some of the wild Oryza spp. but the cultivated parents,
RU9401188 and Bengal, are masking the Oryza sp. resistance.
As a result, crosses are also being made with M201, which is
susceptible to the blast races tested in this study.
Surveys of microsatellite markers against families that
had progenies showed that 23 of the 25 markers were polymorphic
with at least one AA-genome parent showing blast
resistance. These markers are being used to follow the introgression
of Oryza sp. DNA into cultivated rice (Fig. 1). Once
additional markers from Fjellstrom et al (this volume) and novel
Pi loci become available, the blast resistance identified in this
study may be characterized to a higher degree.
References
Bonman JM. 1992. Blast. In: Webster RK, Gunnell PS, editors. Compendium
of rice diseases. St. Paul, MN (USA): APS Press.
p 14-17.
Chen X, Temnykh S, Xu Y, Cho YG, McCouch SR. 1997. Development
of a microsatellite framework map providing genomewide
coverage in rice (Oryza sativa L.). Theor. Appl. Genet.
95:553-567.
Correll JC, Lee FN. 1996. The relationship between race and DNA
fingerprint groups in the rice blast pathogen. Arkansas Rice
Res. Stud. Res. Ser. 453:119-125.
Khush GS. 1989. Multiple disease and insect resistance for increased
yield stability in rice. In: Progress in irrigated rice research.
Manila (Philippines): International Rice Research Institute.
p 79-92.
Linscombe SD, Jodari F, McKenzie KS, Bollich PK, Groth DE, White
LM, Dunand RT, Sanders DE. 1993. Registration of ‘Bengal’
rice. Crop Sci. 33:645-646.
McCouch SR, Nelson RJ, Tohme J, Zeigler RS. 1994. Mapping of
blast resistance genes in rice. In: Zeigler RS, Leong SA, Teng
PS, editors. Rice blast disease. Wallingford (UK): CAB International.
p 167-186.
1 2 3 4 5 6 7 8 9 10 11
Fig. 1. RM213 differentiating
RU9401188 (lane
1), O. nivara (IRRI
100898) (lane 2),
F 1 (lane 3), BC 1
progenies (lanes
4–6) and BC 2 progenies
(lanes 7–11)
from this cross.
RM213 is located
near the region of
Pib on rice chromosome
2
(RiceGenes; http:/
ars-genome.cornell.
edu/rice/).
Rutger JN, Figoni RA, Webster RK, Oster JJ, McKenzie KS. 1987.
Registration of early maturing, marker gene, and stem rotresistant
germplasm lines of rice. Crop Sci. 27:1319-1320.
Sitch LA. 1990. Incompatibility barriers operating in crosses of Oryza
sativa with related species and genera. In: Gustafson JP, editor.
Gene manipulation and plant improvement II. Proceedings
of the 19th Stadler Genetics Symposium, Columbia, MO,
13-15 March 1989. New York (USA): Plenum Press. p 77-
93.
Notes
Authors’ address: G.C. Eizenga and T.H. Tai, Dale Bumpers National
Rice Research Center, USDA-ARS, Stuttgart, Arkansas
72160-0287; F.N. Lee and J.N. Rutger, Rice Research and
Extension Center, University of Arkansas, Stuttgart, Arkansas
72160-0351, USA.
146 Advances in rice genetics

Evaluation of O. sativa × O. glaberrima–derived
lines using microsatellite markers
M.-N. Ndjiondjop, J. Coburn, M.P. Jones, and S. McCouch
West African rice breeders have been trying for several decades to develop Oryza sativa varieties that combine high yield
potential and stress-adaptation traits (soil-toxicity and drought tolerance, pest and disease resistance). The indigenous African
cultivated species, O. glaberrima Steud., is an important reservoir of useful genes for resistance to major stresses, but it has
not been much exploited by breeders, mainly because of the lack of fertility of interspecific hybrids. The West Africa Rice
Development Association (WARDA) produced several hundred fixed genotypes derived from interspecific crosses between
CG14 (O. glaberrima) and japonica rice WAB 56-104 (O. sativa). We selected 50 fixed lines obtained after tissue culture and
50 interbreeding lines. A set of 100 microsatellites dispersed over the 12 chromosomes of rice was used. The polymorphism
between the two parents was up to 90%. The regions of the genome carrying O. glaberrima segments will be targeted for the
development of near-isogenic lines.
The genus Oryza has two cultivated species: O. sativa, which
is grown worldwide, and O. glaberrima, which is cultivated in
tropical West Africa. The African cultivated rice has been increasingly
replaced by the Asian cultivated species, O. sativa,
because of its low yield potential (caused by grain shattering
and lodging susceptibility), but African farmers still favor O.
glaberrima. In Asian rice, variability in resistance to rice yellow
mottle virus (RYMV) and African rice gall midge
(AfRGM) is limited. This resistance is found in the African
rice species, which also has several other useful traits such as
high weed competitiveness (because of early vigor and excellent
ground cover) and tolerance for drought, soil acidity, and
other stresses. The reproductive barriers between the two species
make the use of O. glaberrima in rice improvement difficult.
To overcome the sterility and recombination restriction,
we use anther culture to obtain interspecific hybrids and backcross
progenies. Several hundred interspecific lines derived
from crosses between varieties WAB56-104 (O. sativa subsp.
japonica) and CG14 (O. glaberrima) were developed at
WARDA. The best of these lines are dubbed “new rice for
Africa” (NERICA). We propose here the use of microsatellite
markers for the molecular evaluation of the interspecific progenies
with desired phenotypic traits.
Results
Polymorphism survey using microsatellite markers
In late 1998, the WARDA Molecular Biology Laboratory began
research on polymorphism on eight varieties using
microsatellites. All the combinations between O. sativa and
O. glaberrima parent material revealed a high level of interspecific
polymorphism (at least 78%). Polymorphism was also
detected among the three O. glaberrima varieties (CG14,
CG20, and IG10) in 12 of 17 marker comparisons.
The microsatellite survey detected a high level of polymorphism.
Each locus had at least two alleles of widely different
sizes. This confirms the strong variability characteristic of
microsatellites in comparison with isozyme and restriction fragment
length polymorphism markers.
Allelic frequency in the derived interspecific lines
The frequency of O. glaberrima alleles in the interspecific lines
was up to 20% (Table 1). The percentage of heterozygotes
was very low across the interspecific lines. Some lines had
more introgressed alleles from O. glaberrima than others, but
in general the O. glaberrima genome was found across the
interspecific lines. Among the individuals tested, most had 12%
of their alleles from CG14. This result meets the theoretical
expectation since the genotypes tested were in the BC 2 F 8 generation.
The microsatellite markers RM284, RM435, RM164,
and RM462 showed preferential selection for the O. glaberrima
genome across the lines. Marker RM435 was located on chromosome
6, where a gamete killer gene is in the O. glaberrima
genome responsible for sterility in the F 1 hybrid between O.
sativa and O. glaberrima; the other markers occurred on chromosomes
1, 5, and 8.
The graphical genotyping of these two lines showed that
they have inherited CG14 alleles in the O. sativa background
in almost all parts of the genome. The new recombination had
occurred during an earlier generation. Genotypes selected for
anther culture have been shown to be pure lines in our experiments.
No heterozygote was found in the lines produced
through anther culture. Individuals derived through classical
breeding showed a low level of heterozygosity.
Discussion
Among the 80 microsatellites used, 67 showed good amplification
patterns and the range of the alleles for each marker
was high. Several microsatellite markers showed complete
cosegregation across the interspecific lines. The coverage of
the genome was not complete; some parts of the genome needed
to be saturated using new markers. Introgression of the O.
Genetic diversity, evolution, and alien introgression 147

Table 1. Allelic frequencies in interspecific lines of rice.
Allele frequencies (%)
Interspecific line O. glaberrima Japonica Extra Heterozygote Missing
allele allele allele data
WAB450-I-B-P-138-HB 9 73 6 0 12
WAB450-I-B-P-160-HB 12 52 13 1.5 20
WAB450-I-B-P-33-HB 5 71 10 1.5 12.5
WAB450-11-1-1-P31-H 12 70 10 1.5 6.5
WAB450-24-3-2-P18-H 12 67 12 3 6
WAB450-I-B-P-153-HB 18 58 9 1.5 13
WAB450-5-1-BL1-DV6 10 49 16 0 24
WAB450-B-16A1.4 15 52 24 0 9
WAB450-4A2 14 46 7.5 3 29.5
WAB450-4-1-A16 20 38 7.5 6 28
WAB450-B-16A2.7 12 37 18 1.5 31.5
WAB450-B-16A1.8 14 43 22.4 3.6 17
glaberrima alleles into the O. sativa background was visualized
on the gel after silver staining. The ABI GeneScan TM was
also used to detect some segments similar to the ones found in
the O. glaberrima parent. The latter method was preferentially
used for this study because it is more sensitive and more precise
for the genotyping process.
Allelic frequency
The distribution of allele frequency from O. glaberrima showed
the maximum frequency at 12% and almost 87% for O. sativa.
This fits well with the normal segregation of the alleles of each
parent when the progenies are in the BC 2 F 8 generation. The
level of heterozygosity also fits the expected ratio. Moreover,
the level of extra alleles seemed high, since the crosses have
been grown in the field, where it would be difficult to avoid
outcrossing. Other factors could explain the level of extra alleles
that we observed: (1) the residual heterozygosity remaining
in the parent when crosses were made and (2) the parent
stock changing genetically after it was used to make the crosses,
by mutation, by contamination by outcrossing, or by physical
mixing of the seed from another genotype.
Segregation distortion
Segregation distortion is frequently observed in the interspecific
progenies. In our study, we found a strong segregation
distortion on chromosome 5 (RM164), chromosome 1
(RM284), and chromosome 8 (RM462). RM435 was located
on chromosome 6 and 50% of the lines showed the O.
glaberrima allele. Some previous studies on interspecific progenies
between O. glaberrima and O. sativa showed a strong
segregation distortion on chromosome 6, close to the
microsatellite markers OSR19 and OSR25, both containing
the waxy gene. This could be due to the presence of a sporogametophytic
sterility factor, s10, which was already found to
be tightly linked to the waxy gene (Sano et al 1984). The main
effect of this factor is that, in the heterozygous genotypes, male
gametes are systematically eliminated and female gametes carry
the O. sativa alleles. In our study, some of the markers that
showed the preferential selection of the CG14 alleles (O.
glaberrima parent) were not on chromosome 6, so the mechanism
involved in our study is probably different from that described
by Sano et al (1984). Our results revealed the introgression
of small fragments from the O. glaberrima parent.
Thus, the interspecific lines can be used to develop nearisogenic
lines necessary for determining the function of the
regions involved in the phenotyping observation of some interesting
agronomic traits, by multiple introgression of this
region in the O. sativa background.
The phenotyping of these lines is continuing at WARDA
for the identification of traits of interest, such as number of
secondary branches, number of tillers, etc.
Reference
Sano Y, Sano R, Morishima H. 1984. Neighbour effects between
two naturally occurring rice species, Oryza sativa and O.
glaberrima. J. Appl. Ecol. 21:245-254.
Notes
Authors’ addresses: M.-N. Ndjiondjop and M.P. Jones, WARDA/
ADRAO, 01 BP2551 Bouaké, Côte d’Ivoire; J. Coburn and
S. McCouch, Department of Plant Breeding, 252 Emerson
Hall, Cornell University, Ithaca, New York 14853-1902, USA.
148 Advances in rice genetics

Genetic analysis of pollen sterility loci found in hybrid
progeny between Oryza sativa and O. glabberima
K. Doi, K. Taguchi, and A. Yoshimura
Genes causing hybrid pollen sterility were identified in a cross between japonica rice (Oryza sativa L. cv. Taichung 65) and
African rice (O. glaberrima Steud. [Acc. 104038] from Senegal). Completely sterile F 1
hybrids were observed between the two
species. The hybrid pollen sterility genes were identified by quantitative trait loci (QTL) analysis and linkage mapping of
advanced backcross progeny. QTL analysis using a BC 2
F 1
population revealed QTLs on chromosomes 3, 7, and 10. These loci
were isolated based on the genetic background of Taichung 65 through repeated backcrossing. The location of each locus on
the restriction fragment length polymorphism map was determined using BC 5
F 1
. Four new loci—S18, S19, S20, and S21—
were mapped on chromosomes 10, 3, 7S, and 7L. Sterile pollens caused by different genes showed different morphology. This
indicates the existence of various mechanisms involved in pollen sterility. The expressed F 1
sterility between Taichung 65 and
O. glaberrima can be attributed to these newly identified loci.
African rice, Oryza glaberrima Steud., is an endemically cultivated
species in West Africa. It has characteristics different
from those of O. sativa—e.g., morphology, reaction to drought,
insect resistance, and annual growth habit. However, O.
glaberrima has not been exploited in rice breeding programs.
One of the reasons is the reproductive barrier between the two
species. We developed a series of O. glaberrima introgression
lines in the background of japonica rice for genetic analysis of
traits specific to the species (Doi et al 1997). Large variation
in pollen sterility was observed during development. Quantitative
trait loci (QTL) analysis using the BC 2 F 1 population
revealed some QTLs causing pollen sterility (Doi et al 1998).
In our study, putative QTLs were located on the restriction
fragment length polymorphism (RFLP) map using advanced
backcross progeny. Near-isogenic lines (NILs) were used to
characterize pollen sterility loci.
Materials and methods
An O. glaberrima accession, IRGC 104038, from Senegal,
kindly supplied by the International Rice Germplasm Center
of the International Rice Research Institute, Los Baños, Philippines,
was used as a donor parent. A japonica rice variety,
O. sativa cv. Taichung 65, was used as a recurrent parent. Since
Taichung 65 was used as a female parent in the initial cross,
all the progeny carried cytoplasm from Taichung 65. Further
backcrossing with Taichung 65 as a male parent was continued
after QTL analysis in the BC 2 F 1 population (Doi et al
1998). BC 4 F 1 plants heterozygous for a putative QTL region
and homozygous for the Taichung 65 allele in the other QTL
regions (i.e., those carrying only one QTL among the detected
QTLs) were selected using RFLP markers. The selected plants
were backcrossed with Taichung 65 pollen. Resulting backcross
populations (BC 5 F 1 ) were used for linkage mapping.
From these populations, heterozygotes for sterility loci were
selected (hereafter referred to as heterozygous NILs). These
NILs were used as male parents and crossed to Taichung 65
NILs carrying recessive genetic markers, chl10 (T65chl10) or
dl (T65dl). Pollen fertility of the derived F 1 plants was examined.
One to 2 days before anthesis, spikelets were collected
and stored in 70% ethanol. Pollen fertility was estimated as
the percentage of pollen grains that could be stained by the I 2 -
KI solution.
Results and discussion
All of the mapping populations, except 98DS-13, clearly segregated
into a monogenic 1:1 ratio for pollen sterile/semisterile
and normal plants (Table 1). 98DS-13 showed three types of
segregants: 28 sterile (

Table 1. Segregation of pollen sterility in BC 5 F 1 mapping populations.
Number of plants
Population Genes RFLP markers Total
(chromosome) (chromosome) Sterile Semisterile Fertile
(

these new loci since the location of S2 and Rfj was unknown
and the previous experiments used different cross combinations.
The QTL analysis in the BC 2 F 1 (Doi et al 1998) accurately
detected these loci. The NILs make it possible to characterize
the detected loci. A major portion of F 1 pollen sterility
between japonica rice and O. glaberrima could be attributed
to the loci identified in our study. The NILs produced
will be used for further characterization of sterility loci and in
positional cloning of involved genes.
References
Doi K, Iwata N, Yoshimura A. 1997. The construction of chromosome
substitution lines of African rice (Oryza glaberrima
Steud.) in the background of Japonica rice (O. sativa L.). Rice
Genet. Newsl. 14:39-41.
Doi K, Yoshimura A, Iwata N. 1998. RFLP mapping and QTL analysis
of heading date and pollen sterility using backcross populations
between Oryza sativa L. and Oryza glaberrima Steud.
Breed. Sci. 48:395-399.
Sano Y. 1986. Sterility barriers between Oryza sativa and O.
glaberrima. In: Rice genetics. Proceedings of the International
Rice Genetics Symposium, 27-31 May 1985, Los Baños, Philippines.
Manila (Philippines): International Rice Research Institute.
p 109-118.
Yabuno T. 1977. Genetic studies on the interspecific cytoplasm substitution
lines of japonica varieties of Oryza sativa L. and O.
glaberrima Steud. Euphytica 26:451-463.
Notes
Authors’ address: Plant Breeding Laboratory, Faculty of Agriculture,
Kyushu University, Fukouka 812-8581, Japan.
Acknowledgments: This study was supported in part by the Program
for Promotion of Basic Research Activities for Innovative
Biosciences. The authors are grateful to Drs. G.S. Khush and
E.A. Angeles, IRRI, Philippines, who kindly planted the mapping
population.
A rhizomatous individual obtained from interspecific BC 1
F 1
progenies between Oryza sativa and O. longistaminata
D. Tao, F. Hu, Y. Yang, P. Xu, J. Li, E. Sacks, K.L. McNally, and P. Sripichitt
Rhizome propagation would be a most useful method for breeding perennial rice genotypes. Some of the wild species—Oryza
longistaminata, O. officinalis, O. rhizomatis, and O. australiensis—are logical sources of perenniality. Among them, only O.
longistaminata has an AA genome like O. sativa. When RD23, an indica cultivar from Thailand, was pollinated by O. longistaminata,
one hybrid plant was obtained through embryo rescue. The interspecific hybrid had strong rhizome expression and showed
32.53% pollen fertility. When the hybrid was pollinated by RD23, 162 BC 1
F 1
plants were obtained, among which only one
individual had rhizomes like the F 1
hybrid.
Some rice species are entirely or predominantly perennial,
whereas others are annual. Perennial species include Oryza
rufipogon, O. glumaepatula, O. eichingeri, O. latifolia, O. alta,
O. grandiglumis, O. longiglumis, O. meyeriana, and O.
granulata. In contrast, O. sativa, O. nivara, O. meridionalis,
O. glaberrima, O. barthii, and O. punctata are annuals.
Tillering is a vegetative propagation trait common to all species,
perennial and annual, within the genus Oryza. Several
patterns of vegetative propagation that occur in the genus Oryza
could be useful in developing perennial rice. Tiller separation
in the perennial species O. glumaepatula is expressed under
certain environmental conditions (Oka and Morishima 1967)
and could be used as a pattern of vegetative propagation. Stem
regeneration, indicated by ratooning, stubble planting, or
stoloniferous growth, is also common among Oryza spp., especially
perennial species of the AA genome (Oka and
Morishima 1967). Rhizome production, which contributes to
perenniality and adaptation to temporal drought (Vaughan
1990, 1994), is commonly found in O. australiensis, O.
longistaminata, O. officinalis, and O. rhizomatis.
Rhizome production is the most logical pattern of propagation
to breed for perennial rice, especially upland rice. The
development of perennial rice, especially perennial hybrid rice,
has the potential to provide environment-friendly and economically
viable alternatives for use on land where annual production
is not sustainable (Wagoner 1990). To breed for rice ratooning
and stubble cropping, O. rufipogon would be the most
logical candidate; but to breed for perennial rice, O.
longistaminata, O. rhizomatis, O. officinalis, and O.
australiensis may be better donors of perenniality. O.
longistaminata has the same genome, AA, as O. sativa, and
therefore would be the better donor of genes for rhizome expression.
This paper reports preliminary results on the transfer
of rhizomes from O. longistaminata to cultivated rice in
order to breed for perennial rice.
Genetic diversity, evolution, and alien introgression 151

Materials and methods
Oryza longistaminata was collected from Niger and supplied
by Dr. Hiroshi Hyakutake, of the Ministry of Agriculture and
Forestry, Japan. The F 1 hybrid of RD23/O. longistaminata was
produced at Kasetsart University, Bangkok, Thailand, in 1996
by direct hybridization and embryo rescue (Tao and Sripichitt
2000). RD23 is an indica cultivar from Thailand. The F 1 hybrid
had 32.53% pollen fertility, indehiscent anthers, and rhizomes
that were intermediate between the two parents.
During 1999, in Sanya, Hainan, China, the F 1 hybrid of
RD23/O. longistaminata was pollinated by RD23, and normally
developed seeds were germinated on 1/4 MS medium
(3% sucrose + 0.7% agar, pH 5.8). Plantlets were transplanted
in the field in Sanya.
Results and discussion
After pollination by RD23, 168 normally developed BC 1 seeds
were obtained. Using aseptic culture conditions, 162 plants
were obtained and transplanted to an irrigated field. Among
the backcross progenies, only one individual had rhizomes like
the F 1 . This is the first report of a rhizomatous BC 1 F 1 when O.
sativa was used as a recurrent parent. Ghesquiere (1991) and
Ghesquiere and Causse (1992) reported unilateral inheritance
of the rhizomatous trait in crosses of O. longistaminata/O.
sativa, and thought that (1) one of two complementary lethal
genes, D1 located on chromosome 2, was closely linked to a
rhizomatous gene, or that both traits were controlled by the
same gene. Through linkage to molecular markers, Ghesquiere
(1991) and Ghesquiere and Causse (1992) found that the other
complementary lethal gene, D2 from O. sativa, was located
on chromosome 11.
However, data from an F 2 population of C105204/
Taichung 65 allowed Maekawa et al (1998) to find that a dominant
gene (Rhz) for the presence or absence of rhizomes was
located on chromosome 4. The low spikelet fertility (16.6%)
of the F 1 did not disturb segregation of the linked traits,
liguleless and rhizomatous. The degree of rhizome expression
among F 2 was variable, indicating that other genes in addition
to Rhz affected the trait.
Like the C105204/Taichung 65 F 1 observed by Maekawa
et al (1998), the RD23/O. longistaminata F 1 produced rhizomes,
indicating dominant gene control for the presence of
rhizomes. However, the intermediate rhizome size of the F 1 s
indicated that other genes affected rhizome expression. In contrast
to the simple segregation of the C105204/Taichung 65
F 2 , the RD23/O. longistaminata//RD23 population produced
only one rhizomatous individual out of 162 BC 1 F 1 progenies.
The limited occurrence of rhizome expression in RD23/O.
longistaminata//RD23 suggests that genes epistatic to Rhz affected
rhizome expression in this population. Thus, in the
RD23/O. longistaminata//RD23 population, rhizome expression
was likely controlled by several quantitative loci with
dosage effects. These observations on rhizome expression for
interspecific progenies of O. sativa and O. longistaminata are
consistent with observations of interspecific crosses in sorghum
(Piper and Kulakow 1994, Yim and Bayer 1997).
References
Ghesquiere A. 1991. Reexamination of genetic control of the reproductive
barrier between Oryza longistaminata and O. sativa
and relationship to rhizome expression. In: Rice genetics II.
Manila (Philippines): International Rice Research Institute.
p 729-730.
Ghesquiere A, Causse M. 1992. Linkage study between molecular
markers and genes controlling the reproductive barrier in interspecific
backcross between O. sativa and O. longistaminata.
Rice Genet. Newsl. 9:28-31.
Maekawa M, Inukai T, Rikiishi K, Matsuura T, Noda K. 1998. Inheritance
of the rhizomatous trait in hybrids of Oryza
longistaminata Chev. et Roehr. and O. sativa L. SABRAO J.
30(2):69-72.
Oka HI, Morishima H. 1967. Variations in the breeding systems of a
wild rice, Oryza perennis. Evolution 21:249-258.
Piper JK, Kulakow PA. 1994. Seed yield and biomass allocation in
Sorghum bicolor and F 1 and backcross generations of S. bicolor
× S. haplense hybrids. Can. J. Bot. 72:468-474.
Tao D, Sripichitt P. 2000. Preliminary report on transfer traits of
vegetative propagation from wild rices to O. sativa via distant
hybridization and embryo rescue. Kasetsart J. (Nat. Sci.) 34:1-
11.
Vaughan DA. 1990. A new rhizomatous Oryza species (Poaceae)
from Sri Lanka. Bot. J. Linn. Soc. 103:159-163.
Vaughan DA. 1994. The wild relatives of rice. Manila (Philippines):
International Rice Research Institute. 137 p.
Wagoner P. 1990. Perennial grain development: past efforts and potential
for the future. Crit. Rev. Plant Sci. 9:381-408.
Yim K, Bayer DE. 1997. Rhizome expression in a selected cross in
the Sorghum genus. Euphytica 94:253-256.
Notes
Authors’ addresses: D. Tao, F. Hu, Y. Yang, P. Xu, J. Li, Food Crops
Research Institute, Yunnan Academy of Agricultural Sciences,
Kunming 650205, China; E. Sacks, K.L. McNally, International
Rice Research Institute, Philippines; P. Sripichitt, Department
of Agronomy, Kasetsart University, Bangkok 10900,
Thailand.
Acknowledgment: Financial support from the Yunnan Agricultural
Department and Bundesministerium für Wirtschaftliche
Zusammenarbeit und Entwicklung (BMZ) is gratefully acknowledged.
152 Advances in rice genetics

Identifying late heading genes in rice using
Oryza glumaepatula introgression lines
P.L. Sanchez, Sobrizal, K. Ikeda, H. Yasui, and A. Yoshimura
A backcross population (BC 4
F 2
) was developed from a cross between japonica rice variety Taichung 65, used as a recurrent
parent, and the wild species Oryza glumaepatula, used as a donor parent. BC 4
F 2
254 (n = 72) and BC 4
F 2
222 (n = 78)
populations varied widely in days to heading. The number of days to heading of Taichung 65 ranged from 95 to 100, whereas
BC 4
F 2
254 and BC 4
F 2
222 ranged from 95 to 114 d and 95 to 111 d, respectively. Using linkage analysis, we found two late
heading genes, Lhd1(t) in BC 4
F 2
254 and Lhd2(t) in BC 4
F 2
222. The Lhd1(t) gene was located between RFLP markers C474
and R1962 on chromosome 6; it was linked to C474 and R1962, with a map distance of 1.4 and 1.5 cM, respectively. Lhd2(t)
was located between RFLP markers G338 and R1440 on chromosome 7; it was linked to G338 and R1440, with a map
distance of 1.3 and 1.3 cM, respectively. Lhd1(t) showed a good correspondence with that of EnSe1(t) and Hd3b, whereas the
position of Lhd2(t) on chromosome 7 might be identical to the region of the previously reported gene E1 and QTL Hd4. Both
the Lhd1(t) and Lhd2(t) genes resulted in late flowering under natural daylength conditions during May to September in
Fukuoka, Japan. The dominant allele of O. glumaepatula at Lhd1(t) and the partially dominant allele of O. glumaepatula at
Lhd2(t) were responsible for the delayed heading. The linked markers could be used for the isolation of late heading genes
through map-based cloning.
Days to heading is an important agronomic trait of rice because
it is highly associated with the regional and seasonal
adaptability of rice cultivars. The development of molecular
markers made possible the detection and identification of individual
genetic factors controlling days to heading. Chromosomal
locations of major genes affecting this trait have been
identified using molecular markers (Yano et al 1997, Yamamoto
et al 1998, Doi et al 1998).
The wild rice, Oryza glumaepatula, is a potential source
of new and valuable genes for days to heading. O. glumaepatula
can be easily crossed with Oryza sativa and genes from this
species can be introduced to cultivated rice by conventional
crossing and backcrossing procedures. Hence, this study aimed
at identifying genes controlling days to heading using the O.
glumaepatula introgression lines (glumILs) developed in a
previous study (Sobrizal et al 1999). The identification of new
genes could provide a new means for manipulating flowering
time in rice.
Materials and methods
Oryza glumaepatula (IRGC Acc. No. 105668) collected in
Brazil was crossed as the nuclear donor parent with Taichung
65 (TC65), a cultivated japonica rice variety as the cytoplasm
donor and recurrent parent (Sobrizal et al 1999). Crossing was
performed until BC 4 F 2 populations were obtained. Two BC 4 F 2
populations—BC 4 F 2 254 and BC 4 F 2 222—exhibiting wide
variation in days to heading were selected and planted in 1999
under natural daylength condition in a paddy field at the Kyushu
University Experiment Station, Japan.
Each line was monitored for the appearance of the first
panicle, which constitutes days to heading. The number of days
to heading was expressed as the number of days from sowing
to heading. Eight leaves (about 10 g) were collected from each
line after monitoring the heading date for DNA extraction.
DNA was extracted from fresh leaves of BC 4 F 2 plants
using the cetyltrimethylammonium bromide (CTAB) method.
DNA digestion, electrophoresis, and Southern blotting were
performed according to the methods described by Tsunematsu
et al (1996b). One hundred six restriction fragment length polymorphism
(RFLP) markers were surveyed and used for linkage
map construction.
DNA clones for hybridization were selected on the basis
of the existing RFLP linkage map. DNA hybridization and
detection of chemiluminescence on X-ray film were carried
out using the enhanced chemiluminescence (ECL) direct labeling
and detection system (Amersham). A polymorphism
survey was conducted in the BC 3 F 1 and retained heterozygous
regions were further evaluated in the BC 4 F 1 generation.
Recombination values were estimated following the
maximum likelihood equation and converted into genetic distances
(cM) using Kosambi function.
Results
BC 4
F 2
254
The frequency distribution for days to heading of selected
BC 4 F 2 254 populations (n = 72) is bimodal. Days to heading
in TC65 ranged from 95 to 100, while that of BC 4 F 2 254 ranged
from 95 to 114. Individuals were classified into two groups:
20 individuals for early heading and 52 individuals for late
heading. O. glumaepatula did not flower during the entire
growing season under natural daylength conditions; hence, no
data were obtained. The population segregated into a 1 early:3
late ratio, indicating a single dominant gene controlling heading
date (χ 2 = 0.30).
Genetic diversity, evolution, and alien introgression 153

Results of linkage analysis (n = 70) suggested that the
gene controlling days to heading was located between C474
and R1962 on chromosome 6. The gene was linked to C474
and R1962, with a map distance of 1.4 and 1.5 cM, respectively.
We designated this late heading gene as Lhd1(t).
BC 4
F 2
222
A bimodal frequency distribution of days to heading was also
observed from BC 4 F 2 222 (n = 78). Days to heading in BC 4 F 2
222 ranged from 94 to 111. Individuals were classified according
to two heading dates: 23 individuals for early heading
and 55 individuals for late heading. The chi-square test revealed
that this population also segregated into a 1 early:3 late
ratio, fitting the Mendelian ratio for a single dominant gene
(χ 2 = 0.84). The gene controlling days to heading was located
between G338 and R1440 on chromosome 7. The gene was
linked to G338 and R1440, with a map distance of 1.3 and 1.3
cM, respectively. We designated this late heading gene as
Lhd2(t).
Discussion
We identified two genes responsible for late heading, Lhd1(t)
and Lhd2(t). The gene Lhd1(t) was located on chromosome 6
and showed a good correspondence to the photoperiod sensitivity
genes EnSe1(t) (Sano 1992) and Hd3b (Yano et al 1997),
whereas the position of Lhd2(t) on chromosome 7 might be
identical to the region of the previously reported gene E1
(Okumoto et al 1992) and QTL Hd4 (Yano et al 1997). Lhd1(t)
and Lhd2(t) genes were responsible for the delayed heading in
glumILs under natural daylength conditions during May to
September in Fukuoka, Japan.
The O. glumaepatula we planted in the field did not
flower but the glumILs did. The flowering date of glumILs
exhibited transgressive segregation. Some plants flowered earlier
than Taichung 65 while other plants flowered very late.
The failure of O. glumaepatula to flower under natural
daylength conditions could indicate that it is a photoperiodsensitive
plant. Hence, we are currently conducting short- and
long-day treatments to test our hypothesis.
The dominant and partially dominant alleles of O.
glumaepatula at the Lhd1(t) and Lhd2(t) genes explained the
wide variation in days to heading in BC 4 F 2 populations. The
identification of genes responsible for late heading should lead
to a better understanding of this phenomenon. Using these
genes, days to heading may be altered; hence, rice maturity
could be manipulated to meet the specific rice maturity requirements
of local conditions. The RFLP markers linked to
Lhd1(t) and Lhd2(t) genes could be used for the isolation of
late heading genes through map-based cloning.
References
Doi K, Yoshimura A, Iwata N. 1998. RFLP mapping and QTL analysis
of heading date and pollen sterility using backcross populations
between Oryza sativa L. and Oryza glaberrima Steud.
Breed. Sci. 48:395-399.
Okumoto Y, Yoshimura A, Tanisaka T, Yamagata H. 1992. Analysis
of a rice variety Taichung 65 and its isogenic early heading
lines and late-heading genes E1, E2 and E3. Jpn. J. Breed.
42:415-429. (In Japanese.)
Sano Y. 1992. Genetic comparisons of chromosome 6 between wild
and cultivated rice. Jpn. J. Breed. 42:561-572.
Sobrizal, Ikeda K, Sanchez PL, Doi K, Angeles ER, Khush GS,
Yoshimura A. 1999. Development of Oryza glumaepatula
introgression lines in rice, O. sativa L. Rice Genet. Newsl.
16:107-108.
Yamamoto T, Kuboki Y, Lin SY, Sasaki T, Yano M. 1998. Fine mapping
of quantitative trait loci Hd1, Hd2, and Hd3 controlling
heading date of rice, as single Mendelian factors. Theor. Appl.
Genet. 97:37-44.
Yano M, Harushima Y, Nagamura Y, Kurata N, Minobe Y, Sasaki T.
1997. Identification of quantitative trait loci controlling heading
date in rice using a high-density linkage map. Theor. Appl.
Genet. 95:1025-1032.
Notes
Authors’ address: Plant Breeding Laboratory, Faculty of Agriculture,
Kyushu University, Fukuoka 812-8581, Japan.
Genetic variability of tolerance for iron toxicity
in different species of Oryza and their derivatives
R.D. Mendoza, J.A. Moliñawe, G.B. Gregorio, C.Q. Guerta, and D.S. Brar
Iron toxicity is a major constraint in rice production in acid lowland soils with moderate to high amounts of organic matter and
reactive iron. Breeding rice with tolerance for iron toxicity requires a good source of tolerance and a rapid and reliable screening
technique. Wild species of Oryza are an important source of useful genes for broadening the gene pool of rice with tolerance
for abiotic and biotic stresses. Using seedling-stage screening procedures, 161 genotypes representing 24 improved and
traditional varieties of O. sativa, 18 O. glaberrima, 10 O. rufipogon, 13 O. sativa × O. rufipogon derivatives, and 96 O. sativa ×
O. glaberrima derivatives were screened. Advanced progenies were screened in 300-ppm and 400-ppm iron concentrations
under controlled conditions in the phytotron. A wide range of variability in iron toxicity tolerance was observed in wild species
154 Advances in rice genetics

as well as in their derivatives. Seven genotypes of O. sativa and three accessions from O. rufipogon showed tolerance in 400-
ppm concentration, whereas none of the accessions from O. glaberrima species was tolerant. Varieties BW267-3, Suakoko 8,
IR9884, IR68544-29-2-1-3-1-2, and Azucena showed good levels of tolerance at 400-ppm iron concentration. Three O.
rufipogon accessions, 105909, 106412, and 106423, were found to be highly tolerant, and these could be good donors for
tolerance for iron toxicity. Some of the derivatives of O. sativa × O. glaberrima were found to have better tolerance for iron
toxicity than both parents. Most of the advanced progenies derived from O. sativa × O. rufipogon screened at 400-ppm iron
concentration showed tolerance to moderate tolerance.
Iron toxicity in acid lowland soil is the second major stress
that limits rice yields (Ponnamperuma et al 1973). It is a nutritional
disorder associated with excess water-soluble iron. Low
yields in iron-toxic fields are due to premature death of plants
or to a high percentage of unfilled grains. Rice affected with
iron toxicity shows yellowing or “bronzing” of leaves, stunted
growth, and scanty and coarse dark brown roots, ultimately
resulting in plant death or high sterility.
Information on genetic variability related to iron toxicity
tolerance in rice is limited (Taengsuwan 1998). Wild rice
varieties are the major potential sources of genetic variability
for biotic and abiotic stress tolerance. The evaluation and use
of different species of Oryza are important in broadening the
genetic base of modern rice varieties. The field screening procedure
currently used often gives variable results in terms of
tolerance because of stress heterogeneity in soil, variable
weather, and other associated soil stress. Hence, to identify
reliable donors, screening under controlled conditions was undertaken.
Diverse germplasm, including wild species and their
derivatives, was evaluated to identify promising donors for
tolerance of iron toxicity and to identify alien genes
introgressed into rice.
Materials and methods
The experimental materials comprised 24 O. sativa (indica)
varieties, 18 accessions of O. glaberrima, 10 accessions of O.
rufipogon, and advanced progenies of IR64 × O. rufipogon
acc. 106424 (12), IR74 × O. rufipogon acc. 106424, IR64 ×
O. glaberrima (30), and BG90-2 × O. glaberrima (66). These
materials were screened for iron toxicity tolerance at two levels
(300 ppm and 400 pmm) in nutrient solution using IRRI’s
protocol. O. rufipogon accessions and the O. sativa × O.
glaberrima progenies were screened only in a solution with
400-ppm iron concentration. Pregerminated seeds of all the
entries were sown on nylon nets floating on distilled water for
the first 3 d. On the fourth day, stress was imposed by replacing
water with iron-rich Yoshida culture solution using ferrous
sulfate. The pH of the solution was adjusted to 4.0 twice a day
to maintain its acid condition. This iron-rich solution was refreshed
every week. After 4 wk, plants were evaluated based
on the IRRI Standard evaluation system (IRRI 1996) of plant
scoring.
The experiment was conducted in two replications and
was done three times to minimize experimental error. In the
second experiment, 11 varieties, which were known for their
tolerance and susceptibility under iron-toxic conditions, were
screened under field and hydroponic conditions (400-ppm iron
concentration). Iron uptake in these 11 genotypes was also
analyzed to understand the mechanism of tolerance.
Results and discussion
In the initial study, accuracy and reproducibility of the results
of the hydroponic screening for test varieties under 400-ppm
iron concentration were consistent in their tolerance with field
conditions reported earlier. The results of iron uptake and tolerance
reaction testing in culture solution agreed with field
reactions for all entries except for variety Khao Dawk Mali
105, which gave a highly tolerant score in solution and leaf
tissue iron content but was reported to be moderately tolerant
under field conditions (Table 1). The iron uptake and visual
tolerance scores of all test genotypes indicated that the tolerant
varieties had less iron content in their leaf tissue, which
may be due to the nature of avoidance. The results of screening
at two levels of iron concentrations showed that many of
the entries that were tolerant at 300 ppm were susceptible at
the 400-ppm toxicity level (Table 2). Therefore, in screening
for potential and stable donors, 400-ppm iron concentration in
nutrient solution would be the most reliable.
Of 28 indica varieties screened, 7 were tolerant in 400-
ppm concentration, with an average score of

Table 1. Mean iron uptake and visual score of some cultivated rice
varieties tested in nutrient solution with 400-ppm iron level. a
Tolerance Iron uptake Visual
Variety level (mg/kg) score b
(IRRI SES)
Khao Daeng Tolerant 509 4.2
Khao Tah Petch Tolerant 422 3.5
Khao Bannah Tolerant 394 3.3
Khao Dawk Mali 105 Moderately tolerant 226 2.2
Leuang Pratew 123 Moderately tolerant 710 6.3
Plai Ngahm Prachinburi Moderately tolerant 736 6.3
Huntra 60 Susceptible 852 7.0
IR11141-6-1-4 Susceptible 1,144 8.0
IR45 Susceptible 832 7.1
IR74 (tolerant check) 401 3.0
IR63262 (susceptible
check) 1,188 8.0
Thirty advanced progenies of IR64 × O. glaberrima (different
accessions) were screened; seven entries (IR75871-4-
B-4-1, IR75079-1-5-4-7-1, IR75079-1-5-4-7-2, IR75079-1-5-
4-7-3, IR75871-4-29-4-3, IR75871-4-29-4-4, and IR75865-
7-7-16-2) showed a good level of tolerance though their parents
were susceptible, which indicated that gene interaction
could be important for iron toxicity tolerance. In the progenies
derived from crossing tolerant and susceptible parents, BG90-
2 × O. glaberrima, the frequency of tolerant genotypes was
less (14 out of 66 entries). The progenies that were observed
to have a good level of tolerance were IR75100-1-25-5-1-2,
IR75100-1-25-5-1-3, IR75100-1-25-5-1-4, IR75100-1-25-5-
1-6, IR75912-6-5-8-1, IR75912-6-5-8-2, and OG4831-4. The
distribution pattern of tolerant, moderately tolerant, and susceptible
progenies of susceptible × susceptible and tolerant ×
susceptible crosses involving O. sativa × O. glaberrima species
suggests interallelic interaction for iron toxicity tolerance.
A wide range of variability to iron toxicity tolerance was
observed among rice germplasm of different species. Different
degrees of leaf “bronzing” were expressed using a nutrient
culture solution technique under controlled conditions. O.
rufipogon would be a good potential genetic donor for tolerance
for iron toxicity.
a Adapted from PhD dissertation of Dr. S. Taengsuwan. b 1 = nearly normal growth, 9
= almost all plants dead or dying.
Table 2. Visual score of “bronzing” in some cultivated rice, wild rice, and their derivatives grown
under controlled conditions. a
Species/variety 400 300 Species/variety 400 300
ppm ppm ppm ppm
O. sativa
Azucena 3.06 2.00 TOG6508 7.38 5.50
Bg 90-2 3.25 2.00 TOG6589 7.25 5.50
PSBRc 18 8.39 5.30 TOG6597 6.63 5.75
PSBRc 68 5.75 5.00 TOG6631 7.63 5.50
PSBRc 70 4.00 2.50 TOG7235 5.88 4.25
IR56 6.25 4.50 TOG7242 5.38 4.50
IR64 6.29 3.13 TOG7291 6.25 4.00
IR68544-29-2-1-3-1-2 2.50 2.00 O. rufipogon
IR68552-55-3-2 7.50 4.00 105908 4.00
IR65600-81-5-3-2 5.25 3.00 105909 3.00
IR69502-6-SRN-3-UBN-1-B 6.00 3.25 105910 7.00
IR55423-01 7.50 5.50 106412 3.00
IR31917 6.50 3.00 106423 3.00
IR68821-101-4-B1-1-B 5.75 3.00 106424 4.00
IR60080-6A 3.25 2.25 IR64/O. rufipogon derivatives
IR68703-AC24-1 4.25 2.00 IR73382-80-9-3-13-2-2-1-2 5.25 3.25
O. glaberrima IR73382-89-9-3-13-2-2-1-3 4.00 3.00
IG10 7.25 5.25 IR73382-89-9-14-14-1-3-2-3 6.00 3.75
CG14 7.25 5.25 IR73382-111-9-19-19-2-3-1-2 5.75 3.75
CG17 7.00 4.50 IR73382-111-9-19-19-2-3-2-2 5.25 3.00
CG20 7.00 5.50 IR73384-11-7-8-3-2-3-1-1 5.00 3.00
TOG5674 7.00 5.50 IR73384-11-7-8-2-3-3-3 5.75 3.00
TOG5675 6.75 5.25 IR73384-8-11-16-1-2-3-3 4.00 2.00
TOG5681 6.88 4.75 IR73685-18-14-22-2-3-3-2 4.75 2.25
TOG5860 6.38 5.50 IR73678-8-1-3-3-2 4.75 2.00
TOG6216 5.50 4.75 IR73678-13-2-1-1-2 5.75 4.00
TOG6229 7.13 5.75 IR63768-13-2-1-3-2 5.00 3.75
TOG6472 6.88 5.50
a 1 = nearly normal growth, 9 = almost all plants dead or dying.
156 Advances in rice genetics

References
IRRI (International Rice Research Institute). 1996. Standard evaluation
system for rice. Manila (Philippines): IRRI. 52 p.
Ponnamperuma FN, Attanandana T, Beye G. 1973. Amelioration of
three acid sulphate soils for lowland rice. In: Symposium on
acid sulphate soils. Wageningen (Netherlands): International
Livestock Research Institute. p 391-393.
Taengsuwan S. 1998. Variability and genetics of tolerance for acid
sulfate soil conditions in rice. Ph.D. dissertation. University
of the Philippines Los Baños and IRRI, Los Baños, Philippines.
p 61-62.
Notes
Authors’ address: International Rice Research Institute, DAPO Box
7777, Metro Manila, Philippines.
Identifying subspecies-specific DNA markers in rice
J.H. Chin and H.J. Koh
Subspecies-specific random amplified polymorphic DNA (RAPD) markers using 30 varieties (15 japonica, 15 indica) of various
origin were identified. Of 266 random primers tested, 25 primers produced 31 subspecies-specific bands; 11 bands were
present only in japonica, 19 bands only in indica, and 1 band only in Tongil-type varieties. Rice varieties were classified into two
discrete subspecies groups by subspecies-specific markers. The SPV (subspecies-prototype variety) concept was introduced.
Varieties could be classified by SPV index based on the genetic similarity to SPV using subspecies-specific markers. Breeding
lines from crosses between Dasanbyeo (indica) and TR22183 (japonica), and Dasanbyeo (indica) and Seosan2 (japonica),
were analyzed by selected subspecies-specific markers. All the lines turned out to be genetically closer to the indica parent,
Dasanbyeo.
Since DNA markers provide greater and more reliable information
than morphological and biochemical markers, they have
been used extensively for identifying genotypes, estimating
genetic variability, constructing maps, and doing map-based
gene cloning (Paterson et al 1991). Among different DNA
markers, random amplified polymorphic DNA (RAPD) markers
have been frequently used for fingerprinting rice varieties
in Korea (Ahn et al 1996, 1998, Cho et al 1998). RAPDs seem
useful for differentiating genotypes because polymerase chain
reaction (PCR) amplification of genomic DNA using random
primers produces highly polymorphic bands from randomly
distributed primer-binding regions of genomic DNA. In addition,
RAPD analysis is simple and relatively cheap.
Breeding promising lines by accumulating desirable traits
dispersed in subspecies has been a major breeding strategy in
rice. However, the restricted recombination in hybrids between
subspecies has been a constraint and, also, there were no critical
markers to evaluate the genetic constitution of the progenies
from intersubspecific hybrids. This study was conducted
to identify subspecies-specific DNA markers that could be used
for differentiating indica and japonica varieties using RAPDs
in rice.
Materials and methods
The materials used constituted 30 rice varieties, which belong
to indica, temperate japonica, tropical japonica, or Tongil-type
(high-yielding varieties derived from indica/japonica crosses
but more similar to indica) from various geographical origins
(Table 1). At first, the bulked segregant analysis (BSA) method
(Michelmore et al 1991) was adopted for preliminary screening
of specific markers. Four DNA bulks, including five varieties
each from four varietal groups, were made and screened.
Next, 30 varieties were further tested using the markers selected
through the BSA method. Genomic DNA was extracted
from the leaves of each variety. Table 2 lists the primers tested
in this study.
The PI (prototype index) of each variety was calculated
as follows: PI = (number of subspecies-specific bands of a
variety)/(total number of all subspecies-specific bands). If a
variety has a PI close to 1 or 0, it has a genetic constitution
close to an indica or japonica prototype, respectively. As a
consequence, the SPV (subspecies-prototype variety) concept
was introduced. The SPV is a variety that possesses all the
subspecies-specific markers, and that is regarded as a typical
variety belonging to either indica or japonica. The genetic similarity
among varieties was obtained by using the computer
software NTSYS-PC.
Some of the breeding lines from crosses between
Dasanbyeo (indica) and TR22183 (japonica), and Dasanbyeo
and Seosan2 (japonica), were tested for genetic constitution
by selected subspecies-specific markers.
Results and discussion
Figure 1 shows a sample profile resulting from screening primers,
which produced subspecies-specific bands via the BSA
method. The uppermost band of the first two lanes was produced
using the primer OPF09 only in japonica, whereas the
third band from the top of the other two lanes was produced
only in indica. When the genomic DNA of 30 varieties was
amplified by the primer OPF09, it was confirmed that the up-
Genetic diversity, evolution, and alien introgression 157

Table 1. Rice varieties used in analysis.
Temperate japonica Tropical japonica Tongil-type Indica
1 a Tong88-7 C b 11 Gogowiere 16 Dasanbyeo K 21 China1039 C
2 Ilpumbyeo K 12 Malagit Sinaguing P 17 Milyang 23 K 22 IR36 IR
3 Dongjinbyeo K 13 B581A6 P 18 Chungcheongbyeo K 23 IR72 IR
4 TR22183 C 14 CP-SLO U 19 Hankangchalbyeo K 24 Tadukan P
5 Hapcheon 1 K 15 Azucena P 20 Nampungbyeo K 25 Tetep V
6 Norin mochi 1 J 26 Arc10239 I
7 Nagdongbyeo K 27 Basmati370 S
8 Shingeumobyeo K 28 IR21015 IR
9 Nipponbare J 29 New Sabramati I
10 Hwacheongbyeo K 30 Chinsurah Boro II I
a Varietal code. b Geographical origin: C = China, K = Korea, J = Japan, I = India, S = Sri Lanka, U = USA, P = Philippines, V = Vietnam, IR = IRRI.
Table 2. Primers used in analyzing rice varieties.
Type Primer Total Source
Decamer random OPA01–OPL20, OPN05, OPN16, OPO15, 253 Operon Corp.
primer a
OPP01, OPP16, OPQ05, OPR13, OPR15,
OPT07, OPU06, OPU09, OPU13, OPW02
CMNA32 b 1 Suh et al (1997)
Eicosamer random URP01–URP12 12 NIAST c
primer
a Random primers of OPERON Corp., OPA01–OPL20, were primarily tested, and several additional primers that
have been reported (Kwon et al 1998, Suh et al 1997) to produce subspecies-specific bands were also tested
in this study. b A primer that has been reported by Dr. Suh to produce subspecies-specific bands. c URPs (universal
random primers) are designed by Dr. Kang at the National Institute of Agricultural Science and Technology
(NIAST), Korea.
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30
Fig. 1. A sample profile showing
results of bulk screening of
varietal groups by OPF09 (left
to right lane: japonica, tropical
japonica, Tongil, and indica, respectively).
Fig. 2. RAPD profiles of 30 rice varieties amplified by OPF09. (Number codes refer to varieties listed
in Table 1. The first 15 varieties on the left, except Tong 88-7 (1), had the japonica-specific band in
common. The 15 varieties on the right, except Milyang23 (17) and China1039 (21), had two indicaspecific
bands in common.)
permost band appeared only in japonica and the third band
only in indica. One additional band, the fourth from the top,
which was specific to indica, was also found (Fig. 2).
Of 266 random primers tested, 103 primers were preliminarily
selected by BSA to produce subspecies-specific
bands. Of these, 53 primers that showed discrete and strong
bands were further tested using 30 varieties. Finally, 25 primers
were selected to produce subspecies-specific bands (Table
3). The 31 subspecies-specific bands amplified by the 25 primers
consisted of 11 bands, which are present only in japonica,
19 bands present only in indica, and 1 band found only in
Tongil-type varieties (Table 4).
Figure 3 shows a cluster diagram of 30 varieties for genetic
similarity based on 31 subspecies-specific bands, which
were classified into two discrete subspecies groups as expected.
The SPV concept was tentatively introduced. The varieties were
Ilpumbyeo, Dongjinbyeo, Hapcheon 1, Norin mochi 1,
Nagdongbyeo, Shingeumobyeo, Nipponbare, Malagit
Sinaguing, B581A6, and CP-SLO for japonica and IR36,
Tadukan, Tetep, and New Sabramati for indica. The prototype
index was calculated for each variety. All the SPVs had a PI =
1 (Fig. 4); the PIs of the others were below 1 and were proportional
to their genetic similarity to each SPV.
The breeding lines from crosses between Dasanbyeo (indica)
and TR22183 (japonica), and between Dasanbyeo and
Seosan2 (japonica), were analyzed by selected subspecies-specific
markers. All the lines turned out to be genetically closer
to the indica parent, Dasanbyeo. This implied that breeding
158 Advances in rice genetics

Table 3. Results of the RAPD analysis.
Subspecies-
Total Primers Polymorphic markers specific markers (no.)
Primers tested selected by
primers (no.) BSA (no.) Primers tested Bands Primers Bands
(no.) produced (no.)
RAPD 254 96 46 335 21 27
URP 12 7 7 108 4 4
Total 266 103 53 443 25 31
Table 4. Subspecies-specific markers (bands) identified
in rice.
Coefficient
0.0 0.5 0.6 0.8 1.0
Marker name a Type b Marker name Type
A07-1000 T N16-500 J
B11-720 I O15-320 I
C05-1300 I Q05-1100 J
C15-750 I Q05-1050 J
D08-1300 I R13-600 I
E08-450 J R13-420 I
E14-450 I R15-1200 J
E20-850 I U06-550 J
F09-1500 J U13-350 I
F09-650 I W02-550 J
F09-550 I URP01-1100 I
G03-350 I URP04-1020 I
G10-650 I URP10-2000 J
G10-450 I URP11-800 I
I01-2000 J
I08-520 I
J10-1000 J
a Marker nomenclature was done as follows: A07-1000, the band
was produced by the OPA07 primer and its size was 1,000 bp.
b Types I, J, and T indicate that each subspecies-specific marker
(band) is produced only in indica, japonica, and Tongil-type, respectively.
lines of certain varietal types could be preferred by selection
in the progenies from intersubspecific hybridization. In addition,
this might be related to segregation distortion in
intersubspecific crosses. The subspecies-specific markers could
be a criterion for selecting lines with desirable traits through
maximized recombination between subspecies. Screening for
more subspecies-specific DNA markers, isolation of each
marker band, and mapping of the markers are in progress.
References
Ahn SN, Park HW, Choi HC, Moon HP. 1996. Fingerprinting of
japonica rice cultivars using RAPD markers. Kor. J. Breed.
28(2):178-183.
Ahn SN, Kwak TS, Kang KH, Jeon YH, Choi HC, Moon HP. 1998.
Relationship between heterosis and genetic distance as measured
by RAPDs analysis in rice. Kor. J. Breed. 30(1):16-23.
Cho YS, Hong SK, Song MT, Moon HP, Lee JH, Kim NS. 1998.
Comparison of genetic variation among rice varieties detected
by RAPD, AFLP, and SSRP. Kor. J. Genet. 20(2):117-127.
27
Fig. 3. A cluster diagram for 30 varieties. (The numbers
are varietal codes as shown in Table 1.)
1
2
3
5
6
7
8
9
12
13
14
11
10
4
15
16
17
18
20
19
22
24
25
29
26
28
30
23
21
Genetic diversity, evolution, and alien introgression 159

PI
1.0
0.9
0.8
0.7
0.6
0.5
0.4
0.3
0.2
0.1
0
1 3 5 7 9 11 13 15 17 19 21 23 25 27 29
Japonica
Indica
Fig. 4. The prototype index (PI) of each
variety using only subspecies-specific
markers belonging to japonica or indica.
(The numbers are varietal codes
as shown in Table 1.)
Kwon SJ, Ahn SN, Hong HC, Moon HP, Choi HC. 1998. PCR markers
for indica and japonica differentiation in rice (Oryza sativa
L.). Kor. J. Crop Sci. (supp1.):112-113.
Michelmore RW, Paran I, Kesseki KV. 1991. Identification of markers
linked to disease resistance genes by bulked-segregant
analysis: a rapid method to detect markers in specific agronomic
regions by using segregation populations. Proc. Natl.
Acad. Sci. USA 88:9828-9332.
Paterson AH, Tanksley SD, Sorrells ME. 1991. DNA markers in
plant improvement. Adv. Agron. 46:39-90.
Suh HS, Sato YI, Morishima H. 1997. Genetic characterization of
weedy rice (Oryza sativa L.) based on morpho-physiology,
isozymes and RAPD markers. Theor. Appl. Genet. 94:316-
321.
Notes
Authors’ address: School of Plant Science, College of Agriculture
and Life Sciences, Seoul National University, Suwon 441-
744, Korea.
Acknowledgments: This work was supported by a grant from the
Center for Plant Molecular Genetics and Breeding Research,
Korea Science and Engineering Foundation.
Identifying RAPD markers to classify rice germplasm
as indica or japonica
R.P. da Cruz, M.C.B. Lopes, S.C.K. Milach, and S.I.G. Lopes
Cultivated rice is divided into two subspecies, indica and japonica, with distinct origins, that differ in many morphological and
physiological characters, which make them adapted to different kinds of environments. Knowing the subspecies of a genotype
is important in a breeding program to better organize germplasm resources and develop appropriate breeding strategies. In Rio
Grande do Sul, southern Brazil, most of the rice genotypes cultivated nowadays are of the indica type. In the past, however,
some japonica genotypes have been widely planted, such as Bluebelle. Today, breeding programs have an interest in japonica
types for introgressing cold-tolerance genes into indica genotypes, which are better adapted but lack this tolerance. Since it is
difficult to determine the subspecies of some genotypes based only on morphological characters, this work aimed at identifying
RAPD markers for determining genotype subspecies. Bulked segregant analysis was used to identify polymorphic fragments
between indica and japonica subspecies. Ten indica and 10 japonica genotypes had their DNA mixed. The two DNA bulks were
analyzed with 48 Operon primers, and only 17 produced polymorphic fragments. Among the primers tested in the open bulks,
only one produced a fragment that allowed genotype subspecies identification.
160 Advances in rice genetics

Table 1. Genotypes studied and their subspecies
and country of origin.
Genotype
Indica
BR-IRGA 409
Cica 8
El Paso 144
EMBRAPA 7—Taim
Epagri 108
IRGA 416
Oryzica 1
Supremo 1—sel. Colombia
IRGA 284-18-2-2-2
IRGA 369-31-2-3F-A1-1
Japonica
Bluebelle
Cypress
EEA 406
IAS 12-9 Formosa
INIA Tacuarí
L 202
Diamante
Quilla 66304
Quilla 64117
Koshihikari
Cultivated rice has two widely known subspecies, indica and
japonica. Differentiation between them has primarily been done
through morphological and physiological characters (Oka
1991). Later, isozyme polymorphism proved to be an efficient
tool for rice subspecies determination (Glaszmann 1987). More
recent developments in DNA markers provide a powerful tool
for genotype assessment and classification of rice germplasm
(Yu and Nguyen 1994, Mackill 1995). The use of japonica
genotypes in breeding programs of the southern region of Brazil
has increased because of their cold tolerance. Accurate
determination of a genotype’s subspecies is important for
germplasm organization and use in rice breeding. This study
aimed at identifying RAPD markers for rice subspecies characterization.
Materials and methods
Origin
Brazil
Colombia
Uruguay
Brazil
Brazil
Brazil
Colombia
Brazil
Brazil
Brazil
USA
USA
Brazil
Taiwan (China)
Uruguay
USA
Chile
Chile
Chile
Japan
Twenty rice genotypes were used in this study, with 10 each
representing indica and japonica subspecies. They were chosen
based on diversity of origin (Table 1). DNA was extracted
from the coleoptile since this tissue provides enough goodquality
DNA. The extraction was done using a sodium dodecyl
sulfate (SDS)-based protocol (Nelson 1993).
Random amplified polymorphic DNA (RAPD) markers
were used with the bulked segregant analysis (BSA) method
to detect specific primers for each subspecies group. Two DNA
bulks were prepared by taking 10 µL of each genotype’s working
sample and mixing them. Forty-eight random primers from
Operon (Table 2) were tested in the bulks to determine subspecies
specificity. RAPD reactions were run on an MJ Research
thermocycler. The 13-µL reaction consisted of 1X Taq
polymerase buffer, 2.5 mM MgCl 2 , 0.2 mM dNTPmix, 25 ng
Table 2. Operon primers tested and parameters evaluated to determine
primer efficiency in differentiating indica and japonica bulks.
Primers Primers that Polymorphic
Primer series tested amplified the bulks primers
(no.) (%) (no.) (%)
Operon A 3 3 (100.0) 2 (66.7)
Operon D 10 9 (90.0) 4 (44.4)
Operon E 12 8 (66.7) 5 (62.5)
Operon I 9 1 (11.1) 0 (0.0)
Operon J 10 10 (100.0) 6 (60.0)
Operon M 4 0 (0.0) 0 (0.0)
Total 48 31 17
of primer, 20 ng of genomic DNA, and 1 unit of Taq polymerase.
Amplification started with 4 min at 94 °C, followed
by 45 cycles of 30 sec at 94 °C (DNA denaturation), 30 sec at
37 °C (primer annealing), and 66 sec at 72 °C (primer extension).
The reaction was terminated after 7 min at 72 °C. RAPD
products were separated in a 2% agarose gel containing
ethidium bromide. A 100-bp DNA ladder was used to determine
the size of the fragments. Amplification products were
visualized under UV light and photographed to investigate the
existence of polymorphism between the two DNA bulks for
the primers tested.
Primers that showed polymorphism between the indica
and japonica bulks were tested in the “open” bulks by performing
a RAPD reaction for each genotype.
Results and discussion
Of 48 primers tested, 31 amplified the two DNA bulks, but
only 17 produced polymorphic fragments between them. Primers
from Operon series A, D, E, and J presented the highest
level of amplification and also produced polymorphic fragments
between indica and japonica bulks. Primers from series
I and M did not amplify, with the exception of a primer from
series I (Table 2). Figure 1 shows polymorphism obtained between
indica and japonica bulks with 10 primers from Operon
series J. It would be ideal to get amplification of only one of
the bulks, but this was observed for only two primers (Fig. 1).
Ten polymorphic primers were further tested in the open bulks
to confirm their efficacy. Among these, only one produced a
polymorphic fragment that allowed distinction between indica
and japonica genotypes (Fig. 2). Other primers still have to be
tested in the open bulks to confirm their discrimination power.
As more markers are identified, the precision of rice subspecies
determination will increase. More rice genotypes need to
be screened to test the reliability of the results.
References
Glaszmann JC. 1987. Isozymes and classification of Asian rice varieties.
Theor. Appl. Genet. 74:21-30.
Mackill DJ. 1995. Classifying japonica rice cultivars with RAPD
markers. Crop Sci. 35:889-894.
Genetic diversity, evolution, and alien introgression 161

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
Fig. 1. RAPD fragments of
10 primers from Operon
series J in indica and
japonica DNA bulks. (The
first lane is a 100-bp ladder;
even lane numbers
identify the indica bulk and
odd lane numbers identify
the japonica.)
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
900 bp
Fig. 2. RAPD fragments of
primer OPD 5 in 10 indica
genotypes and eight
japonica genotypes. (The
first lane is a 100-bp ladder,
the following 10 lanes
are indica genotypes, and
the last eight are japonica
genotypes.)
Nelson JC. 1993. ITMI wheat mapping workshop: laboratory manual.
Cornell University.
Oka HI. 1991. Genetic diversity of wild and cultivated rice. In: Khush
GS, Toenniessen GH, editors. Rice biotechnology. Wallingford
(UK): CAB International. p 55-81.
Yu LX, Nguyen HT. 1994. Genetic variation detected with RAPD
markers among upland and lowland rice cultivars (Oryza sativa
L.). Theor. Appl. Genet. 87:668-672.
Notes
Authors’ address: Department of Crop Plants, Rio Grande do Sul
Federal University, P.O. Box 776, 91501-970, Porto Alegre,
Brazil.
DNA fingerprinting and phylogenetic analysis of Indian
aromatic high-quality rice germplasm using panels
of fluorescent-labeled microsatellite markers
S. Jain, S.E. Mitchell, R.K. Jain, S. Kresovich, and S.R. McCouch
Four multiplex panels composed of 30 fluorescent-labeled simple sequence repeat (SSR) markers were used to study the
genetic diversity and phylogenetic relationships among the aromatic high-quality rice germplasm collections from different
parts of India. A total of 248 alleles were detected at 30 SSR loci; the number of alleles per locus ranged from 3 to 22, with
an average of 8.2. Genetic diversity was evaluated by estimating the polymorphism information content (PIC), distribution,
frequency, and range of allele sizes for each microsatellite locus. The similarity coefficients were analyzed to study phylogenetic
162 Advances in rice genetics

elationships by clustering algorithms. The PIC values, which are a reflection of allelic diversity among the varieties, were quite
high for all the microsatellites, averaging 0.565, and ranging from 0.203 to 0.904. The size range between the smallest and
largest allele for a given microsatellite varied from 3 to 68 bp. Microsatellite marker-based polymorphism was useful for
dissecting fine levels of genetic diversity among basmati rice varieties, and between basmati and nonbasmati varieties. Clustering
analyses indicate high levels of genetic diversity among the scented/high-quality rice germplasm of India. Several SSR
markers were identified that can be used to differentiate the commercially important basmati rice varieties.
Basmati rice is one of the most valued aromatic and superfinequality
rice varieties in the world (Khush and dela Cruz 1998).
Adulteration of superior basmati rice supplies with less expensive
and lower-quality indica or basmati rice is quite common.
DNA fingerprinting of basmati rice varieties can be used
to differentiate Indian basmati rice from other cheaper longgrain
rice cultivars and to identify seed mixtures. Hundreds of
other related scented and high-quality rice varieties are being
grown in different parts of the Indian subcontinent.
Microsatellite DNA markers (also known as simple sequence
repeats, SSRs) have been efficiently employed for cultivar identification
and genotyping in rice (McCouch et al 1997). More
than 500 mapped SSRs have been developed for rice (Temnykh
et al 2000).
Genetic profiles produced using SSRs can be used in
conjunction with pedigree and agronomic data to document
ownership and protect intellectual property rights. We used
four multiplex panels composed of 30 microsatellites for DNA
fingerprinting of 85 rice varieties representing the scented/highquality
rice germplasm collected from different parts of the
Indian subcontinent. The SSR-fingerprint database has been
used to study phylogenetic relationships.
Materials and methods
Indian aromatic/high-quality rice varieties/accessions (Fig. 1)
were obtained from the CCS Haryana Agricultural University
(HAU) Rice Research Station, Kaul, Haryana, India. Varieties
IR36, IR64, Azucena, Kasalath, BS125, and Nipponbare were
used as reference controls. Total genomic DNA was isolated
from the pooled leaf material of five plants. Thirty
microsatellites, organized into four panels (A, B, C, and D)
each consisting of 7–8 fluorescent-labeled markers, were used
as described in Blair et al (2002). The forward primers of the
markers were labeled with hexachloro-6-carboxyfluorescein
(HEX), tetrachloro-6-carboxyfluorescein (TET), or 6-
carboxyfluorescein (6-FAM) dye phosphoramidites, synthesized
on an Applied Biosystem 392 by the Cornell Bioresource
Facility. Individual PCR amplification of each microsatellite
was carried out in a total volume of 15 µL as described by
Panaud et al (1996) and Temnykh et al (2000). The PCR products
for each set of microsatellites were mixed together in a
ratio of 1:2:4 : FAM:TET:HEX. About 0.5 µL of the mixed
microsatellite samples was combined with 1 µL of a loading
buffer (98% formamide, 10 mm EDTA, blue dextran) and 0.1
µL of an internal-lane size standard, TAMRA-labeled
Genescan-350 (Applied Biosystem, Foster City, CA) as recommended
by Blair et al (2002). Samples were denatured at
95 ºC for 2 min and run for 6 h on 96-well, 5% denaturing
Long-ranger polyacrylamide gels (8.0 M urea) in 1X TBE
buffer with the recommended run module (constant 30 Watts)
and with filter set B using the ABI 377A Perkin Elmer
auotomated DNA sequencer. Molecular weights for
microsatellite bands, in base pairs, were estimated with
Genescan 672 software by the local Southern method. Individual
bands were designated as alleles of the appropriate
microsatellite loci using the Genotyper software package. Allele
binning was conducted using the procedure described by
Ghosh et al (1997). The polymorphism information content
(PIC) for each microsatellite marker was calculated according
to Anderson et al (1993). Similarity matrices were produced
using the “simqual” subprogram of software NTSYS-PC (Rholf
1993). The similarity coefficients were used for cluster analysis
of the varieties, performed using the “Sahn” subprogram of
NTSYS-PC, and to build dendrograms by UPGMA.
Results and discussion
Four multiplex panels with a total of 30 fluorescent-labeled
SSRs (Table 1) designed by Blair et al (2002) were used for
assessing genetic diversity among the 85 rice varieties. These
SSRs were selected from the collection of markers already
mapped in rice (Temnykh et al 2000, Blair et al 2002).
Table 1 describes the 30 SSRs used in the four multiplex
panels and data on the number of alleles scored, their size range,
and PIC values in this data set. Each individual SSR had a
unique banding pattern with a specific number of stutter-bands,
signal peak width, slope, and spread that could easily be recognized
and used to confirm allele scoring. In all the panels,
microsatellite markers tagged with the same dye color did not
overlap each other, and thus allele calling was straightforward
and unequivocal in all the panels. As only the most intense
band was evaluated for molecular weight, the stuttering did
not interfere with allele calling. The four multiplex panels produced
a total of 248 alleles from 85 genotypes; the number of
alleles for A, B, C, and D panels were 54, 44, 66, and 84,
respectively. The average number of alleles per SSR was 8.2
and the number of alleles for each SSR ranged from 3 (RM133,
RM323) to as many as 22 (RM252). The size range between
the smallest and largest allele for a given microsatellite varied
from 3 to 68 bp (Table 1). The PIC values, which reflect allelic
diversity among the varieties, were quite high for all the
microsatellites, averaging 0.565, and ranging from a low of
0.203 (RM337) to a high of 0.904 (RM252).
All the rice genotypes except two (Basmati 370 BD and
Belugyun) could be differentiated by the allelic polymorphism
Genetic diversity, evolution, and alien introgression 163

Kasalath
Bogajoha
Acc277805
Ambemohar157
Bas370BngDes
Balugyun
D66
BasMehtrah
BasSathi
Bas370
HBC-19
Akp-1
BasNorat439
BarhaiL
Bas370Pakistan
ChiniSakkar
Bas397
Bas6113
Bas5836
Bas334
BasSufaid100
Bas150
Bas370B
Bas405
BPT1235
Bas372A
Bas213
ChiniGuri
CBasmati
Taraori
Bas6313
Cemposelak
Dulhamiya
Bas375
BasIndia
Dubraj
Chokjyebichal5
Bas93B
PusaBasmati1
DM24
Blomberg
HKR(93)401
ARC14865
BegamiT-1
HKR-228
Bas134
Bogajoha
Bas502
Begami2-8
Begami40
MI-48
Ayepyung
Bas217
BasKamon
BS125cornell
Bas6131
CSR18
CSR10
CSR11
BokulJoha
Chokjyebichal4
Calrose76
HKR-120
BasTall
IR36cornell
CSR13
IR64cornell
Chokjyebichal3
Gobind
HKR-126
ChuXiangXian
BasT3Haiti
BasA3-3
Bas242
CSR21
BasC622
Della
Pokkali
Ambemohar1
Azucena
BasBahar
Nipponbare
NPT-1
NPT-3
NPT-2
0.80 0.85 0.90 0.95 1.00
Coefficient
Fig. 1. Dendrogram of 85 rice genotypes based on genetic diversity data for 248 alleles. Bas = basmati; BngDes =
Bangladesh; NPT = new plant type obtained from IRRI.
164 Advances in rice genetics

Table 1. Data on allele size range, number of alleles, and polymorphism information content (PIC) among
85 rice genotypes for 30 fluorescently labeled microsatellites from four multiplex panels (A, B, C, and D).
Panel/ Genebank or Chromosome Repeat Size Alleles PIC
fluorescent Marker clone number type (bp) (no.) value
label a
number
Panel A
FAM RM135 Osm35 3 (CGG) 10 119–131 4 0.530
RM280 CT780 4 (GA) 16 151–181 9 0.579
TET RM170 Osm68 6 (CCT) 7 99–119 7 0.578
RM153 Osm53 5 (GAA) 9 190–205 4 0.521
RM182 M1 7 (AT) 16 328–349 4 0.373
HEX RM286 CT806 11 (GA) 16 99–126 11 0.476
RM110 Osm10 2 (GA) 15 138–159 8 0.613
RM174 Osm74 2 (ACG) 7 (GA) 10 207–223 7 0.567
Mean 6.8 0.530
Panel B
FAM RM312 GT165 1 (ATTT) 4 (GT) 9 97–106 6 0.558
RM105 Osm5 9 (CCT) 6 126–138 5 0.493
RM171 Osm71 10 (GATG) 5 320–350 12 0.732
TET RM133 Osm33 6 (CT) 8 230–233 3 0.227
RM103 Osm3 6 (GAA) 5 327–338 5 0.599
HEX RM282 CT787 3 (GA) 15 125–137 5 0.489
RM337 CTT64 8 (CTT) 4 -19-(CTT) 8 157–192 8 0.203
Mean 6.3 0.560
Panel C
FAM RM1 GA12 1 (GA) 26 75–116 11 0.621
RM122 – 5 (GA) 11 226–247 8 0.290
TET RM5 GA273 1 (GA) 15 106–129 9 0.624
RM55 GA587 3 (GA) 17 215–240 8 0.568
HEX RM248 CT469 7 (GA) 25 72–104 10 0.582
RM231 CT234 3 (GA) 16 168–194 10 0.509
RM38 GA344 8 (GA) 16 231–263 10 0.774
Mean
Panel D
FAM RM253 CT452 6 (GA) 25 88–115 12 0.776
RM224 CT199 11 (GA) 13 121–159 9 0.628
RM252 CT206 4 (GA) 19 194–262 22 0.904
TET RM229 CT224 11 (GA) 11 104–136 8 0.575
RM17a GA56 12 (GA) 21 158–187 8 0.656
RM222 CT193 10 (GA) 18 193–225 13 0.761
HEX RM44 GA408 8 (GA) 16 100–131 9 0.685
RM323 CAT69 1 (CAT) 5 242–245 3 0.469
Mean 10.5 0.682
a FAM = 6-carboxyfluorescein, TET = tetrachloro-6-carboxyfluorescein, HEX = hexachloro-6-carboxyfluorescein.
at one or more of the 30 SSR loci screened. Identification of
markers that distinguish closely related basmati rice cultivars
such as Taraori Basmati, Basmati 370, and Pusa Basmati 1 is
of interest to exporters, commercial suppliers, and consumers
because of vast differences in their market prices. Results
showed that a single SSR marker, RM252, was sufficient to
discriminate these basmati rice varieties. As many as 15 other
SSRs could differentiate between two or more of the basmati
rice varieties.
Figure 1 shows the dendrogram depicting the phylogenetic
analysis of 85 rice genotypes obtained by UPGMA cluster
analysis based on diversity at 248 alleles. The clustering
analysis placed the 85 rice genotypes in seven groups, with a
similarity coefficient of 80%. The analyses indicate high levels
of genetic diversity among the scented/high-quality rice
genotypes available in India. A total of 48 Indian scented/highquality
rice varieties, including the traditional basmati rice
accessions (e.g., Taraori Basmati, Basmati 370, etc.) and the
cross-bred Pusa Basmati 1, were grouped together. Another
major group was composed of several indica rice varieties such
as the salt-tolerant CSR varieties, high-yielding indica varieties
developed in India (HKR126, Gobind, etc.), at IRRI, Philippines
(IR36), in Australia (Della), and in the United States
(Calrose76), along with a few basmati/scented rice collections
from India. New plant type accessions (IRRI, Philippines) along
with japonica rice varieties Azucena and Nipponbare and a
Genetic diversity, evolution, and alien introgression 165

asmati rice accession, Basmati Bahar, were placed together.
The salt-tolerant variety Pokkali, salt-sensitive MI-48, and the
Indian scented accession Ambemohar 1 formed individual
groups. The scented rice accessions Kasalath and Bogajoha
formed a separate group.
The high frequency of rare alleles, high PIC values, a
large number of alleles and allele size ranges, low similarity
values, and the overall results of the phylogenetic analysis indicate
the presence of substantial genetic diversity in available
Indian aromatic/high-quality rice germplasm. These results
indicate a complex pattern of evolution for these Indian
basmati/scented/high-quality rice genotypes and suggest that
they have probably evolved over a long time like the other
genotypes belonging to the Oryza sativa complex.
References
Anderson JA, Churchill GA, Autrique JE, Tanksley SD, Sorrells ME.
1993. Optimizing parental selection for genetic linkage maps.
Genome 36:181-186.
Blair MW, Hedetale V, McCouch SR. 2000. Fluorescent-labeled
microsatellite panels useful for detecting allelic diversity in
cultivated rice (Oryza sativa L.). Theor. Appl. Genet. 105:449-
457.
Ghosh S, Karanjawala ZE, Hauser ER, Ally D, Knapp JI, Rayman
JB, Musick A, Tannenbaum J, Te C, Shapiro S, Elrridge W,
Musick T, Martin C, Smith JR, Carpten, Brownstein MJ,
Powell JI, Whiten R, Chines P, Nylund SJ, Magnuson VL,
Boehnke M, Collins FS. 1997. Methods for precise sizing,
automated binning of alleles, and reduction of error rates in
large-scale genotyping using fluorescently labeled dinucleotide
markers. Genome Res. 7:165-178.
Khush GS, dela Cruz N. 1998. Developing Basmati rices with high
yield potential. Cahiers Options Mediterraneennes 24: Rice
quality. A pluridisciplinary approach. CD-ROM computer file.
CIHEAM, Paris.
McCouch SR, Chen X, Panaud O, Temnykh S, Xu Y, Cho YG, Huang
N, Ishii T, Blair M. 1997. Microsatellite marker development,
mapping and applications in rice genetics and breeding. Plant
Mol. Biol. 35:89-99.
Panaud O, Chen X, McCouch SR. 1996. Development of
microsatellite markers and characterization of simple sequence
length polymorphism (SSLP) in rice (Oryza sativa L.). Mol.
Gen. Genet. 252:597-607.
Rholf FJ. 1993. NTSYS-PC: numerical taxonomy and multivariate
analysis system. Version 1.8, Exeter Software, Setauket, New
York.
Temnykh S, Park WD, Ayres N, Cartinhour S, Hauck N, Lipovich L,
Cho YG, Ishii T, McCouch SR. 2000. Mapping and genome
organization of microsatellite sequences in rice (Oryza sativa
L.). Theor. Appl. Genet. 100:697-712.
Notes
Authors’ addresses: S. Jain, S.E. Mitchell, S. Kresovich, and S.R.
McCouch, Department of Plant Breeding, Cornell University,
Ithaca, NY; S. Jain and R.K. Jain, Department of Biotechnology
and Molecular Biology, CCS Haryana Agricultural University,
Hisar 125 004, India; Fax: 607-255-0420; e-mail:
srm4@cornell.edu.
Fingerprinting of Indian scented rice by RAPD markers
T. Stobdan, V.K. Khanna, U.S. Singh, and R.K. Singh
The random amplified polymorphic DNA (RAPD) technique was used to characterize and assess the genetic relationships in 32
accessions of aromatic rice and three accessions of nonaromatic rice. All ten decamer primers used yielded scorable amplification
patterns based on discernible bands. A dendrogram constructed using the Jacquard similarity coefficient and the
UPGMA algorithm based on 176 reproducible polymorphic products ranging in size from 0.32 to 3.0 kb revealed a high level of
variation among the accessions. Cluster analysis separated the 35 rice accessions into two main groups. All the aromatic rice
clustered together with one exception. The similarity coefficient ranged from 0.370 to 0.811, showing a diverse gene pool.
Accessions showing little morphological variation but having the same varietal name clustered together with one exception.
Thus, RAPD markers can detect enough polymorphism, even among closely related aromatic genotypes.
Aromatic rice is higly valued for its high grain quality. India
possesses an immense wealth of aromatic rice with wide variability
for morpho-physiological and cooking qualities. However,
it has been realized that, in the wake of the Green Revolution,
in which yield was emphasized, a lot of the precious
germplasm was replaced (Singh et al 1997). Plant breeders
have used the genetic diversity of the elite germplasm to determine
genetic relationships, select parents, manage
germplasm, and sample and protect germplasm. Molecular
markers such as restriction fragment length polymorphism
(RFLP), amplified fragment length polymorphism (AFLP),
microsatellites, and random amplified polymorphic DNA
(RAPD) have proved to be very useful for analyzing a large
number of genotypes. Of the available molecular markers,
RAPD is one of the simplest to use because hybridization steps
are not required and only a few nanograms of DNA are required
to detect a large number of polymorphisms in a short
time (Williams et al 1990). The technique is based on the amplification
by polymerase chain reaction (PCR) of discrete
DNA segments using small-size oligonucleotide primers of
166 Advances in rice genetics

Table 1. Accessions used to evaluate genetic variation of aromatic rice.
Code Accession Strain/variety Code Accession Strain/variety
number
number
1 4438 Pusa Basmati 20 4437 Basmati-370
2 5407 Basmati-370 21 5401 Basmati-370
3 4036 Dehraduni Basmati 22 4034 Dehraduni Basmati
4 4042 KH-7 23 4035 Dehraduni Basmati
5 4011 Kasturi 24 4087 Sugandha
6 4435 T-3 25 4088 Khushboo
7 4434 Kalanamak 26 5017 Tapovan-17
8 4085 Chhota Hansraj 27 5013 Tapovan-13
9 4071 Deshi Hansraj 28 5016 Tapovan-16
10 4029 Pakistani Basmati 29 5006 Tapovan-6
11 4095 N-12 30 5005 Tapovan-5
12 4041 T-23 31 5021 Tapovan-21
13 4122 Taraori Basmati 32 – Azucena
14 – Gaurav 33 a – Pant Dhan-4
15 4145 Tapovan-45 34 a – Pant Dhan-12
16 5022 Brown Basmati 35 a – Jaya
17 4444 Bindli
18 4048 Tilak Chandan
19 4430 Sonachur
a Nonaromatic.
Table 2. Nucleotide sequence of 10 oligonucleotide primers and
the number of RAPD markers produced in the 35 genotypes.
Sequence Total no. of Polymorphic loci
Primer 5′ to 3′ RAPD loci
Number %
T-21 GGACTGGAGT 20 20 100.0
C-19 GGGTAACGCC 16 15 93.8
OPK-11 AATGCCCCAG 19 19 100.0
OPF-14 TGCTGCAGGT 17 16 94.1
OPF-13 GGCTGCAGAA 18 18 100.0
OPF-06 GGGAATTCGG 14 11 78.6
OPC-07 GTCCCGACGA 24 24 100.0
OPD-08 GTGTGCCCCA 21 21 100.0
OPC-15 GACGGATCAG 15 14 93.3
OPJ-13 CCACACTACC 19 17 89.5
random design. Several groups have already used RAPD to
analyze rice genotypes (Virk et al 1995). However, different
groups of Indian scented rice varieties largely remain uncollected.
Therefore, our investigation was carried out to assess
genetic diversity among Indian aromatic rice.
Materials and methods
The 32 accessions of aromatic rice and three accessions of
nonaromatic rice used in this study (Table 1) were originally
collected from farmers’ fields of northern India and maintained
at G.B. Pant University of Agriculture and Technology,
Pantnagar, India. Their selection was based on morphological
characters and grain quality. This selection included accessions
collected from different places showing variation in their
morphological characters but having the same varietal name.
DNA was extracted following the method of Dellaporta
et al (1983). RNA was removed by treating with RNAse A
and finally purified by phenol:chloroform extraction and ethanol
precipitation. Quantification was done using a DyNA
Quant TM 2000 fluorometer.
For DNA amplification, 25 µL of reaction mixture was
prepared, containing 1 ng of DNA, 2.5 µL of PCR 10X buffer,
2 µL of dNTPs (25 mM each), 0.5 unit of Taq polymerase,
0.2 µM of 10-nt primer (Bangalore Genei, India), and sterile
distilled water to a final volume. Amplification was performed
in a Perkin Elmer thermocycler as follows: initial stand separation
at 92 °C for 5 min; followed by 45 cycles at 92 °C for
30 sec, 35 °C for 1 min, and 72 °C for 2 min; and a final hold
at 72 °C for 5 min as described by Virk et al (1995). Table 2
lists the ten decamer primers used. Eight of the ten primers
were selected based on their performance with rice DNA in an
earlier report (Virk et al 1995). The amplification products
were electrophoresed in 7.5% polyacrylamide gels, visualized
by ethidium bromide staining, and photographed under UV
light.
Data were scored on the presence or absence of amplification
products. If a band was present in a genotype, it was
designated as 1; if no shared band was present in another genotype,
it was designated as 0. Resulting matrices of molecular
data for all primers were submitted for analysis. Pairwise similarity
was computed using the Jacquard similarity coefficient.
A dendrogram was constructed using the unweighted pairgroup
method with arithmetic average (UPGMA) (Sneath and
Sokal 1973).
Genetic diversity, evolution, and alien introgression 167

Results
Ten decamer primers were used for PCR amplification of the
total DNA of the 35 genotypes. The amplification product of
all the primers showed polymorphism. Figure 1 shows the
RAPD profile amplified by primer OPC-15. A total of 184
products were amplified against the 35 genotypes, among which
176 products (95.6%) were polymorphic among these genotypes
and 14–24 polymorphic products were amplified by each
primer (Table 2), yielding 17.6 polymorphic products per
primer on average. This average is larger than what was reported
by Virk et al (1995) and Ko et al (1994).
The 176 polymorphic products with ten primers were
used to generate a similarity coefficient among the 35 genotypes.
The similarity coefficient ranged from 0.370 between
Tapovan-6 and Kalanamak to 0.811 between two different accessions
of Basmati 370 (Fig. 2).
To study the genetic relationships among different accessions,
the matrix of genetic distance was used for cluster
analysis with the UPGMA method and a dendrogram was constructed
(Fig. 2). The dendrogram readily separated the 35
genotypes into two major clusters, with one major cluster being
further divided into two major ones. Aromatic and
nonaromatic genotypes were clearly classified into two main
clusters at a similarity coefficient of 0.48; a Philippine aromatic
rice, Azucena, also went into the nonaromatic group.
Discussion
Indian rice has been classified as basmati and nonbasmati according
to aroma, kernel length, length/breadth (LB) ratio, and
kernel elongation after cooking. The distinction between the
two groups is also found in terms of the specific area of adaptation
for cultivation. Our results based on RAPD analysis
clearly separated the nonaromatic rice from the aromatic rice.
The aromatic rice was further grouped into two different clusters,
mainly on the basis of grain shape and size. These results
support the earlier classification of rice into two main groups,
short-grain and long-grain rice. Significant genetic variation
among the different accessions existed as revealed by RAPD
analysis. Pair-wise comparison indicated that Tapovan-6 and
Kalanamak showed the least similarity. The red rice collected
from the hilly region clustered together in the dendrogram and
showed high similarity. The accessions collected from different
places showing little variation in their morphological characters
but known by the same varietal name were grouped together
in the dendrogram, whereas one accession of Dehraduni
Basmati differed from the other two accessions.
Results show that RAPD can detect enough polymorphism
to differentiate among the Indian scented rice accessions,
even among accessions having the same varietal name
but showing similarity in a few morphological characters. Also,
a general pattern of separation between aromatic and
nonaromatic rice was obtained. RAPD is a relatively simple
technique for studying the genetic relationship among different
genotypes.
References
Dellaporta SL, Woods J, Hicks JB. 1983. A plant DNA mini preparation:
version II. Plant Mol. Biol. Rep. 1:19-21.
Ko HL, Cowan DC, Henry RJ, Graham GC, Blakeney AB, Lewin
LG. 1994. Random amplified polymorphic DNA analysis of
Australian rice (Oryza sativa L.) varieties. Euphytica 80:179-
189.
Singh RK, Singh US, Khush GS. 1997. Indigenous aromatic rice of
India: present scenario and needs. Agric. Situation India
Nov.:491-496.
Sneath PHA, Sokal RR. 1973. The principles and practice of numerical
classification. San Francisco, Calif. (USA): Numerical
Taxonomy Freeman.
Virk PS, Newbury HJ, Jackson MT, Ford-Lloyd BV. 1995. The identification
of duplicate accessions within a rice germplasm collection
using RAPD analysis. Theor. Appl. Genet. 90:1049-
1055.
Williams JGK, Kubelik AR, Livak KJ, Rafalski JA, Tingey SV. 1990.
DNA polymorphisms amplified by arbitrary primers are useful
as genetic markers. Nucl. Acids Res. 18:6531-6535.
Notes
Authors’ addresses: T. Stobdan, Department of Molecular Biology
and Genetic Engineering; V.K. Khanna, Department of Genetics
and Plant Breeding; U.S. Singh, Department of Plant
Pathology, G.B. Pant University of Agriculture and Technology,
Pantnagar 263145, Uttar Pradesh; R.K. Singh, IRRI
Liaison Office, New Delhi, India.
Acknowledgments: The senior author is grateful to the Department
of Biotechnology, Government of India, for providing a fellowship.
We are also thankful to Dr. U.S. Singh for providing
seed materials.
168 Advances in rice genetics

1 2 3 4 5 6 7 8 9 10 M 11 12 13 14 15 16 17 18 19 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 M
Fig. 1. Amplification products
from genomic DNA of 35 accessions
of rice using primer
OPC-15.
Similarity coefficient
0.45 0.60 0.75 0.90
Pusa Basmati
Pakistani Basmati
Chhota Hansraj
Deshi Hansraj
Nagisa-12
Taraori Basmati
Dehraduni Basmati
Type-3
Type-23
Bindli
Khakha-7
Kasturi
Gaurav
Tapovan-45
Brown Basmati
Kalanamak
Tilak Chandan
Sonachur
Basmati-370 (5107)
Basmati-370 (5401)
Basmati-370 (4437)
Dehraduni Basmati (4034)
Dehraduni Basmati (4035)
Tapovan-17
Tapovan-13
Tapovan-16
Tapovan-21
Tapovan-5
Tapovan-6
Khushboo
Sugandha
Azucena
Pant Dhan-4
Pant Dhan-12
Jaya
Fig. 2. Genetic variation in 35 genotypes of aromatic rice.
Genetic diversity, evolution, and alien introgression 169

Relationship between heterosis in F 1
hybrids and genetic
similarity among parents as measured by RAPD, SSR,
and co-ancestry analysis in japonica rice
H.J. Koh, C.W. Park, and J.H. Lee
The relationship between genetic similarity (GS) and performance/heterosis in F 1
hybrids among 10 japonica varieties was
investigated. A diallel set of 45 crosses among 10 varieties was made. The 45 F 1
s and their 10 parents were evaluated in
replicated trials in the field. GS among parents was estimated using 85 simple sequence repeat (SSR) markers, 129 random
amplified polymorphic DNA (RAPD) primers, and co-ancestry analysis. There were significant positive correlations among
genetic similarities based on three measures. Correlations between GS and yield heterosis were not consistent among three
GS measures. SSR-based GS was found to be the most applicable to predict yield heterosis or performance in the F 1
. However,
GSs by 13 selected RAPD primers showed much higher correlation coefficients than GSs by a total of 129 primers and by SSR
markers. This suggested that bands amplified with 13 selected RAPD primers should be associated with loci conferring heterosis
or performance in the F 1
. The relative efficiency of three GS measures for prediction of yield heterosis in the F 1
is also
discussed in this paper.
Prediction of heterosis is important for hybrid breeding programs
in crops. Screening F 1 hybrid combinations for superior
performance and strong heterosis is the most costly and timeconsuming
process in a hybrid rice breeding program. If a
simple, efficient, inexpensive, and reliable method could be
used to predict heterosis prior to extensive field testing, much
of the field work associated with making crosses and field
evaluation could be eliminated. The level of genetic similarity
between two parents has been proposed as a possible predictor
of F 1 performance and heterosis. Usually, a hybrid between
parents with a low level of genetic similarity shows a high
level of performance and heterosis (Ahn et al 1998, Saghai
Maroof et al 1997, Xiao et al 1996, Zhang et al 1996, Virmani
1994).
In this study, random amplified polymorphic DNAs
(RAPDs), simple sequence repeats (SSRs), and co-ancestry
coefficient analysis were employed to evaluate the genetic similarity
among 10 japonica varieties or lines. The relationship of
genetic similarity with yield of hybrids and heterosis was examined
to assess whether such an analysis is useful to predict
F 1 yield and heterosis in japonica rice.
Materials and methods
Ten japonica varieties, Chucheongbyeo, Nagdongbyeo,
Dongjinbyeo, Jinmibyeo, Ilpumbyeo, Yeongnambyeo,
Singeumobyeo, Ilmibyeo, Hwacheong waxy, and Nipponbare,
were used as parents. A diallel set of 45 crosses among 10
parents (excluding reciprocals) was made. The 45 F 1 hybrids
with the 10 parents were grown for yield evaluation in a field
in a randomized complete block design with two replications
in summer 1998 at the College of Agriculture and Life Sciences.
The plot size was 1.5 m 2 .
A set of 129 random decamer primers (Operon Tech.)
was used. Amplification reactions were in a final volume of
25 µL containing 20 ng of genomic DNA, 10 pmol of primer,
2.5 mM dNTP 2 µL, 1U of Taq DNA polymerase, 2.5 µL of
10X buffer, and 15 mM MgCl 2 2 µL. Samples were amplified
through 45 cycles of 1 min at 94 °C, 2 min at 37 °C, and 2 min
at 72 °C, followed by a final extension at 72 °C for 10 min in
a PTC-100 TM Programmable Thermal Controller (MJ Research).
Amplified products were resolved by electrophoresis
in 1.4% agarose gels.
The 85 rice SSR markers provided by Dr. McCouch of
Cornell University were used. Polymerase chain reaction (PCR)
was performed with a mixture of 100 ng of genomic DNA,
primer in 0.2 µmol buffer, 200 µmol each of dATP, dTTP,
dGTP, and dCTP, 50 mM KCl, 10 mM Tris-HCl (pH 8.3),
0.01% gelatin, 1.5 mM MgCl 2 , and 1U of Taq DNA polymerase.
PCR was done through 35 cycles of 1 min at 94 °C, 1
min at 55 °C, and 2 min at 72 °C, with a final extension at 72
°C for 5 min. Each reaction was run on a 4% polyacrylamide
sequencing gel and silver-stained as described in Panaud et al
(1996).
Band patterns for RAPD and SSR markers were recorded
for each parent by assigning a letter to each band. Band profiles
for each parent were assigned 1 to indicate the presence
and 0 to indicate the absence of a band. The genetic similarity
among 10 parents was estimated using the NTSYS-PC program.
Co-ancestry coefficients among 10 parents were calculated
by lineage analysis. Genetic relatedness between parents
and offspring was scored 1/2. The co-ancestry coefficient between
two varieties sums up the genetic relatedness along lineage
paths lying between two varieties. If two varieties had no
common ancestor at all, the coefficient was 0.
Heterosis was evaluated with two commonly used measurements:
mid-parent heterosis (MP) and better-parent (BP)
heterosis; mid-parent heterosis = [(F 1 – MP) / MP] × 100 (%),
170 Advances in rice genetics

Table 1. Genetic similarity among 10 parents based on RAPD (lower diagonal) and SSR analysis (upper
diagonal).
Parent 1 2 3 4 5 6 7 8 9 10
1 0.762 0.726 0.690 0.735 0.711 0.607 0.631 0.630 0.771
2 0.929 0.776 0.671 0.762 0.798 0.682 0.729 0.768 0.810
3 0.889 0.907 0.682 0.702 0.893 0.647 0.824 0.756 0.762
4 0.911 0.900 0.874 0.738 0.702 0.659 0.659 0.695 0.750
5 0.918 0.916 0.881 0.915 0.735 0.583 0.738 0.642 0.723
6 0.880 0.899 0.907 0.878 0.872 0.631 0.845 0.778 0.771
7 0.885 0.904 0.886 0.891 0.890 0.874 0.635 0.695 0.655
8 0.850 0.860 0.885 0.844 0.830 0.929 0.848 0.744 0.714
9 0.867 0.878 0.844 0.853 0.864 0.835 0.865 0.818 0.716
10 0.912 0.922 0.908 0.896 0.899 0.875 0.892 0.865 0.870
1 = Chucheongbyeo, 2 = Nakdongbyeo, 3 = Dongjinbyeo, 4 = Jinmibyeo, 5 = Ilpumbyeo, 6 = Yeongnambyeo, 7 = Singeumobyeo,
8 = Ilmibyeo, 9 = Hwacheong waxy, 10 = Nipponbare.
Table 2. Co-ancestry coefficients based on pedigree records among parents.
Parent 1 a 2 3 4 5 6 7 8 9
2 0
3 0.0625 0.25
4 0 0.0938 0.0234
5 0 0.0625 0.0156 0.3047
6 0.0313 0.1484 0.5059 0.0938 0.0840
7 0 0.2520 0.0630 0.0381 0.0923 0.0447
8 0.0156 0.0977 0.2588 0.0476 0.0430 0.5031 0.0233
9 0 0.2734 0.0684 0.0420 0.0303 0.0452 0.0682 0.0226
10 0 0.0625 0.0156 0.0938 0.0781 0.1484 0.0547 0.0745 0.0293
a Parental codes are as shown in Table 1.
better-parent heterosis = [(F 1 – BP) / BP] × 100 (%). The correlations
between genetic similarities and F 1 yield/its heterosis
were evaluated.
Results and discussion
Of 129 primers used to amplify genomic DNA from 10 parents,
98 (76%) primers revealed polymorphism among the
parents. The 129 primers produced a total of 542 bands, with
an average of 4.2; 230 (42%) bands showed polymorphism.
Genetic similarities among 10 parents based on RAPDs are
presented in Table 1. The 85 SSR markers used in this study
produced 1–21 alleles per marker among 10 parents, with an
average of 5.7. Genetic similarities based on SSR markers are
also shown (Table 1). Pedigree records of 10 parents were
tracked and thus co-ancestry coefficients were obtained (Table
2). Genetic similarities among parents were 0.818–0.929 by
RAPD, 0.583–0.893 by SSR, and 0–0.5059 by co-ancestry
analysis. In co-ancestry analysis, there was a limitation in
searching for full lineages among parents because of missing
records in the past, and thus the coefficients were generally
low; otherwise, they were similar to GS by two other methods.
The GS range by RAPD was much narrower than by SSR analysis.
Table 3 shows the relationship among GSs estimated by
the three methods. The GSs exhibited significantly positive
Table 3. Correlation coefficients among parents based on analysis
by 129 RAPD primers, 85 SSR primers, and pedigree record of parents.
Genetic similarities among parents based on
129 RAPD SSR a (B) Pedigree
primers (A) record (C)
A 0.343* 0.360*
B 0.587**
a * = significant at the 5% level, ** = significant at the 1% level.
correlations, indicating that any of them could be used for GS
estimation. However, since the correlation coefficients were
not so high, exceptions in GS estimates by the three methods
may have arisen.
Table 4 shows the means and ranges of grain yield per
10 plants and the heterosis of 45 F 1 hybrids. MP heterosis
ranged from –3.8% (Nagdongbyeo/Ilmibyeo) to 18.7%
(Chucheongbyeo/Singeumobyeo), whereas BP heterosis ranged
from –10.5% (Jinmibyeo/Ilpumbyeo) to 14.2%
(Yeongnambyeo/Nipponbare). The extent of heterosis in this
study was relatively lower as expected in intervarietal japonica
hybrids (Virmani 1994).
The correlation of GS based on RAPDs, SSRs, and coancestry
coefficients with grain yield and its heterosis in 45
Genetic diversity, evolution, and alien introgression 171

Table 4. Means and ranges of yield and its heterosis in 45 F 1 hybrids.
Grain yield (kg 10 plots –1 ) MPH a (%) BPH (%)
Mean Range Mean Range Mean Range
299.5 258.2–353.8 6.1 –3.8–18.7 –0.4 –10.5–14.2
a MPH = mid-parent heterosis, BPH = better-parent heterosis.
Table 5. Correlation coefficients between hybrid performance in grain yield and GS estimated by RAPDs,
SSRs, and co-ancestry coefficients in 45 F 1 hybrids.
RAPD analysis SSR analysis a Co-ancestry coefficient
Yield MPH BPH Yield MPH BPH Yield MPH BPH
–0.177 –0.016 –0.071 –0.690** –0.397** –0.373* –0.304* –0.301* –0.263
a ** = significant at the 1% level, * = significant at the 5% level.
hybrids was estimated (Table 5). GS by SSRs was correlated
with hybrid yield and both MP and BP heterosis, suggesting
that GS among parents based on SSR analysis could be a valuable
criterion to predict hybrid performance. However, GS by
RAPDs was not correlated with hybrid performance. In the
co-ancestry coefficient, there was a significant correlation between
GS and hybrid yield/MP heterosis, but not between GS
and BP heterosis. This indicated that GS by RAPD and coancestry
analysis was not an effective predictor of hybrid performance.
However, GS by co-ancestry analysis may be significantly
correlated with hybrid performance if the records of
lineage relationships among all the parents could be provided.
For further analysis with RAPDs, we estimated the GSs
among parents based on individual primers and correlated them
with hybrid performances. Consequently, among 98 RAPD
primers, which revealed polymorphism among parents, 13 were
selected to produce the bands that showed significant correlation
between GS and yield and its heterosis. Using these 13
primers, the GS among parents was reestimated and correlations
were analyzed between GS and hybrid performance.
Unlike previous results with all RAPD primers, the GS measured
by 13 selected RAPD primers exhibited a significant
correlation with hybrid yield (r = –0.743**) and its heterosis
(MP, r = –0.455**, and BP, r = –0.398**). This correlation
coefficient was higher than by SSR. This result contrasted with
the previous one shown in Table 5, in which GS by all the
RAPD primers was not correlated with hybrid performance.
Therefore, it was inferred that there should be loci associated
with hybrid performance, yield, and heterosis, and that the 13
selected RAPD primers produced the polymorphic bands
among parents related to the heterotic loci. If this is true, then
more loci affecting hybrid performance should be identified
so that prediction of hybrid performance using DNA markers
could be practically applied to hybrid rice breeding.
References
Ahn SN, Kwak TS, Kang KH, Jeon YH, Choi HC, Moon HP. 1998.
Relationship between heterosis and genetic distance as measured
by RAPDs analysis in rice. Kor. J. Breed. 30(1):16-23.
Panaud O, Chen X, McCouch SR. 1996. Development of
microsatellite markers and characterization of simple sequence
length polymorphism (SSLP) in rice (Oryza sativa L.). Mol.
Gen. Genet. 252:597-607.
Saghai Maroof MA, Yang GP, Zhang Q, Gravois KA. 1997. Correlation
between molecular marker distance and hybrid performance
in U.S. southern long grain rice. Crop Sci. 37:145-
150.
Virmani SS. 1994. Heterosis and hybrid rice breeding. Berlin (Germany):
Springer-Verlag. 189 p.
Xiao J, Li J, Yuan L, McCouch SR, Tanksley SD. 1996. Genetic
diversity and its relationship to hybrid performance and heterosis
in rice as revealed by PCR-based markers. Theor. Appl.
Genet. 92:637-643.
Zhang Q, Saghai Maroof MA, Yang GP, Liu KD, Zhou ZQ, Gravois
KA, Xu CG, Gao YJ. 1996. Relationships between molecular
marker polymorphism and hybrid performance in rice. Rice
genetics III. Los Baños (Philippines): International Rice Research
Institute. p 317-326.
Notes
Authors’ address: School of Plant Science, College of Agriculture
and Life Science, Seoul National University, Suwon 441-744,
Korea.
172 Advances in rice genetics

Reproductive barriers between japonica and indica crosses
Y. Harushima, M. Nakagahra, M. Yano, T. Sasaki, and N. Kurata
In a cross between japonica and indica rice cultivars, several segregation distortions caused by many kinds of reproductive
barriers were observed in the progenies. We developed a new method for mapping all kinds of reproductive barriers. This is the
first report of a genome-wide survey of all reproductive barriers. Reproductive barriers were analyzed in three crosses: Nipponbare/
Kasalath (NK), FL087/Dao Ren Qiao (FD), and FL1007/Kinandang Puti (FK). The frequency of each allele in the whole genome
was well explained by the number of reproductive barriers: 33 in NK, 32 in FD, and 37 in FK. Considering the position and
whether they were gametophytic or zygotic, at least 84 out of 102 barriers detected in the three crosses were at different loci.
There is no common barrier in the three crosses. The reproductive barriers between japonica and indica rice detected in this
study have probably developed after differentiation of cultivars into japonica and indica.
Differences in F 1 seed fertility between japonica and indica
crosses and many reproductive barriers have been reported
(Oka 1988, Kinoshita 1995). However, the nature of the reproductive
barriers between the two types of cultivars is not
clearly understood. Questions such as how many barriers are
between them and whether there is a common barrier between
them are not answered satisfactorily. Historically, the number
and location of reproductive barriers are estimated by observing
the association between sterility or segregation distortion
and mapped morphological or biochemical trait loci. However,
the recent identification of DNA markers covering the
whole genome has enabled genome-wide surveys of reproductive
barriers in a cross. A simple analysis of the F 2 seed fertility
as quantitative trait loci (OTLs) cannot explain the differences
in F 1 seed fertility in each cross or the segregation distortions
in the F 2 population. Segregation distortion is a feature
of all genetic reproductive barriers. To date, no quantitative
methods are available to estimate the number, location,
and strength of reproductive barriers using segregation characteristics
of marker genotypes.
A new method for characterizing reproductive barriers
using segregating allele frequencies in an F 2 population was
presented and applied to the intraspecific cross between
japonica and indica rice varieties. A multiresponse nonlinear
regression analysis was performed to estimate the number,
position, and strength of the reproductive barriers on each chromosome.
The best-fit mathematical model was selected to describe
the experimental observations of the allele frequencies
of the DNA markers.
Materials and methods
Plant material and map construction
Nipponbare is a japonica cultivar. Kasalath, Dao Ren Qiao,
and Kinandang Puti are indica cultivars from India, China, and
the Philippines, respectively. FL1087 and FL1007 are japonica
marker lines developed by Kyushu University (Fukuoka, Japan),
which correspond to FL102 and FL7, respectively. All
three F 2 populations from crosses between Nipponbare and
Kasalath (NK), between FL1087 and Dao Ren Qiao (FD), and
between FL1007 and Kinandang Puti (FK) were produced by
self-pollination of F 1 plants produced by crossing indica varieties
with japonica varieties. The seed fertility of NK F 1 plants
was full and that of FD and FK plants was about half. Two
linkage maps were constructed previously using 186, 94, and
93 F 2 plants from NK, FD, and FK, respectively (Antonio et al
1996, Harushima et al 1998). The allele frequencies of 1,055,
236, and 222 DNA markers at different positions were used
for the regression analysis of NK, FD, and FK maps, respectively.
Common markers between NK and FD were 206 and
those between NK and FK were 190.
Mathematical models for regression
The influence of a reproductive barrier on the genotype frequency
of linked markers depends on whether the reproductive
barrier acts in a gametophyte or a zygote. The simplest
model is a reproductive barrier affecting the gametophyte. A
single reproductive barrier alters the allele transmission rate
(t1) of parent A at the barrier location (x1) on a chromosome in
the male (or female) gametophyte. The t1 can vary from 0 to 1
and Mendelian segregation is 0.5. The probability of transmitting
an A genotype at x locus in the gametophyte can be expressed
as
(1 – θ1)t1 + θ1(1 – t1)
where θ1 is the recombination frequency between x and x1 and
θ1 can be expressed by the Kosambi map function, θ1 = ½
Tanh (2|x – x1) (Kosambi 1944). The probability of transmitting
another genotype, B, at x in the gametophyte can be expressed
as
θ1t1 + (1 – θ1)(1 – t1)
The expected frequencies of the homozygous genotype,
A, the homozygous genotype, B, and the heterozygote, H, are
computed as follows:
1
1
1
A = (t1 + θ1 – 2t1θ1), B = (1 – t1 – θ1 + 2t1θ1), H =
2
2
2 (1)
Genetic diversity, evolution, and alien introgression 173

In the case of a single zygotic viability barrier, the barrier
alters the zygotic viabilities. The relative viabilities of B
and the heterozygote to the other genotype, A, are Vb and Vh,
respectively. The viabilities of A, B, and H at x can be expressed
as
Vax = (1 – θv) 2 + 2θv)(1 – θv)Vh + θv 2 Vb, Vbx =
θv 2 + 2θv(1 – θv)Vh + (1 – θv) 2 Vb, Vhx = θv(1 – θv) +
{(1 – θv) 2 + θv 2 }Vh + θv(1 –θv) Vb
where θv is the probability of recombination between x and x v .
The expected frequencies of the homozygous genotype A, the
homozygous genotype B, and the heterozygote H are calculated
as follows:
where Agx, Bgx, and Hgx are the expected frequency of each
genotype by gametophytic barriers, and 0.25, 0.25, and 0.5
are expected without gametophytic barriers, respectively. We
have extended the mathematical models of more complicated
cases to explain the observed segregation distortions on a chromosome.
The regression analyses were performed on a
Macintosh computer using original programs developed from
Mathematica packages.
Results and discussion
Agx
A = ,
Agx + Vbx Bgx + Vhx Hgx
Vbx Bgx
B = ,
Agx + Vbx Bgx + Vhx Hgx
Vhx Hgx
H = ,
Agx + Vbx Bgx + Vhx Hgx
Regression analysis
The genotype segregation of adjacently linked markers tends
to be similar. Hence, when the frequency of each allele in the
F 2 plants is plotted along a high-density linkage map, three
continuous series of allele frequencies are obtained for each
chromosome, corresponding to the genotypes of the heterozygote
and each of the two possible homozygotes. A
multiresponse nonlinear regression method was used to analyze
segregation distortions in allele frequency. In the regression
analysis, mathematical models were fitted to the observed
frequencies of alleles on an entire chromosome. Thus, the regression
analysis was able to identify the positions of the reproductive
barriers and distinguish between gametophytic and
zygotic barriers and hence characterize the segregation distortions
of allele frequencies in the F 2 population.
The allele frequencies of DNA markers were measured
in F 2 populations from the three crosses (NK, FD, and FK),
and plotted along their genetic linkage maps. Deviations from
the expected Mendelian segregation ratios (25% for each homozygote
and 50% for the heterozygote) were observed for
(2)
all chromosomes in the three crosses for chromosome 7 in FD.
Regression analysis was performed for each chromosome. The
observed allele frequencies, the best regression curves of each
allele frequency, and the estimated barrier locations on chromosomes
1, 2, and 3 in each cross are presented in Figure 1.
The distortions in allele segregation frequencies on each chromosome
were well explained by one to four reproductive barriers.
The frequencies of each allele in a whole genome were
well explained by 33 barriers, including 15 gametophytic barriers
and 18 zygotic barriers in NK. Thirty-two barriers (15
gametophytic and 17 zygotic) and 37 barriers (19 gametophytic
and 18 zygotic) could explain the segregation frequencies in
FD and FK, respectively.
Comparisons among three crosses
To examine the possibility of common barriers lying between
japonica and indica rice cultivars, the positions of the reproductive
barriers detected in FD and FK were estimated on the
NK map using markers common with those of the NK map
and superimposed on it (Fig. 2). We examined the possibility
of reproductive barriers common in any two of these crosses,
considering not only the position of the barrier but also whether
it was gametophytic or zygotic. Seven pairs of gametophytic
barriers and 11 pairs of zygotic barriers in 14 regions may be
reproductive barriers common to two crosses (indicated by the
boxes in Fig. 2). At least 84 out of 102 barriers detected in this
study were at different loci among three crosses. Because there
are few common barriers in this study, most of the reproductive
barriers between japonica and indica rice detected here
would be formed after differentiation of the cultivars into
japonica and indica. Artificial selection and the change from
outbreeding to inbreeding during the cultivation process may
promote the formation of reproductive barriers between cultivars.
Isolation and characterization of the reproductive barriers
detected here would help elucidate the molecular mechanisms
behind the rapid formation of reproductive barriers.
References
Antonio BA, Inoue T, Kajiya H, Nagamura Y, Kurata N, Minobe Y,
Yano M, Nakagahra M, Sasaki T. 1996. Comparison of genetic
distance and order of DNA markers in five populations
of rice. Genome 39:946-956.
Harushima Y, Yano M, Shomura A, Sato M, Shimano T, Kuboki Y,
Yamamoto T, Lin SY, Antonio BA, Paroco A, Kajiya H, Huang
N, Yamamoto K, Nagamura Y, Kurata N, Khush GS, Sasaki
T. 1998. A high-density rice genetic linkage map with 2275
markers using a single F 2 population. Genetics 148:479-494.
Kinoshita T. 1995. Report of committee on gene symbolization, nomenclature
and linkage groups. Rice Genet. Newsl. 12:9-153.
Kosambi DD. 1944. The estimation of map distances from recombination
values. Ann. Eugen., Lond. 12:172-175.
Oka HI. 1988. Origin of cultivated rice. Japan Scientific Societies
Press, Tokyo/Elsevier Science Pub., Amsterdam (Netherlands).
p 156-159.
174 Advances in rice genetics

Frequency of genotype
50
Chromosome 1
Japonica homozygous
Indica homozygous
Heterozygous
50
Chromosome 2
50
Chromosome 3
25
25
25
0 0 50 100 150
0
0
50 100 150
0
0
50 100 150
50
50
50
25
25
25
0
0
50 100 150
0
0
50 100 150
0
0
50 100 150
75
50
50
50
25
25
25
0
0
50 100 150
0
0
50 100 150
0
0
50 100 150
Distance (cM)
Fig. 1. Frequencies of each allele on chromosomes 1, 2, and 3 in NK, FD, and FK are plotted along their genetic linkage maps.
For each chromosome, the left and right ends correspond to the short and long arms of the genetic linkage maps. The frequencies
of japonica homozygous genotypes, indica homozygous genotypes, and heterozygous genotypes of the individual markers
that were mapped at different locations are plotted at the marker positions. The best regression curves of each allele frequency
on the chromosome are also presented. The arrows show the locations of reproductive barriers. The upward and downward
arrows indicate the position of gametophytic barriers that increase the japonica and indica genotype, respectively. The
gametophytic barriers affecting male and female tissues on the same chromosome are noted by different vertical arrows
positioned above the chromosome axis. For example, at 150 cM on chromosome 1, two gametophytic barriers affect male and
female gametes. Arrows pointing both ways indicate the position of barriers that affect zygotic viability.
Notes
Authors’ addresses: Y. Harushima and N. Kurata, Plant Genetics
Laboratory, National Institute of Genetics, Yata, Mishima,
Japan; M. Nakagahra, National Agriculture Research Center,
Kannondai, Tsukuba, Ibaraki, Japan; M. Yano and T. Sasaki,
Rice Genome Research Program, National Institute of
Agrobiological Resources, Forestry, and Fisheries, Kannondai,
Tsukuba, Ibaraki 305-8602, Japan.
Genetic diversity, evolution, and alien introgression 175

cM
0
1S 2S 3S 4S 5S 6S 7S 8S 9S 10S 11S 12S
cM
0
25
25
50
50
75
75
10L
100
9L
100
125
4L
5L
6L
7L
8L
11L
12L
125
150
2L
175
3L
1L
200
Fig. 2. The locations of reproductive barriers in three japonica-indica crosses were coordinated on the rice genetic linkage map constructed
using NK. The red, green, and blue arrows represent reproductive barriers detected in NK, FD, and FK, respectively. The respective
locations of reproductive barriers detected in crosses other than NK were estimated by markers common to the NK map. The
locations of common markers were indicated as black lines on the map. The arrows pointing right and left indicate the location of barriers
that enable the gametophyte to increase the japonica and indica genotype, respectively. The gametophytic barriers affecting male and
female tissues on the same chromosome are indicated by different arrow positions on the chromosome map. The arrows pointing both
ways are locations of zygotic barriers. Boxed arrows indicate the possibility of finding allelic barriers for various crosses. S = short arm,
L = long arm.
Genetic basis of F 1
hybrid sterility and gamete
formation in rice
R. Suzuki, N. Sawamura, T. Okazawa, Khin-Thidar, and Y. Sano
The genetic basis of F 1
hybrid sterility was compared in inter- and intraspecific crosses using near-isogenic lines (NILs).
Although F 1
hybrid semisterility is frequently caused by allelic interaction in interspecific crosses, the genic actions were
divergent. The gamete eliminator, S6, was detected in three strains of Oryza rufipogon. S6 caused abortion of both female and
male gametes carrying S6-a from japonica rice only in the heterozygote. S6-n, which induces no infertility in combination with
S6 and S6-a, was widely distributed in wild strains as well as in indica type. Another gamete eliminator, S1, was detected in O.
glaberrima; S1 behaved like S6. To compare the genic effects by gamete eliminator (S1 and S6), histological investigations
were carried out. Results showed that S1 caused abnormal divisions in both mega- and microgametogenesis; however, S6
caused abnormalities only in megasporogenesis. Duplicate gametic lethal genes proposed for varietal crosses within O. sativa
were also reexamined. Three NILs showed only pollen infertility when crossed with the recurrent parent; however, an F 1
between
the NILs gave reduced spikelet fertility, suggesting that the accumulation of F 1
-pollen-semisterility genes affected female
fertility.
176 Advances in rice genetics

Table 1. Distribution of three alleles at the S6 locus in wild and
cultivated rice strains. a Strains (no.) with Lines
Species Type examined
S6 S6-a S6-n (no.)
O. sativa Japonica – 3 – 3
Indica – – 8 8
O. rufipogon Perennial 3 1 7 11
Annual – – 3 3
a An allelic state of a strain was examined by crossing with two NILs carrying st1
S6-a or st1 S6. S6-n was assumed when a strain gave fertile F 1 plants as well as
normal segregation for st1 in the F 2 of both crosses with the two NILs.
A
C
B
D
AN
PN
EN
SY
Rice offers an opportunity to study the development of hybrid
sterility barriers within and between species since hybrid sterility
frequently appears in crosses among closely related rice
taxa. Accumulated evidence shows that a complex gene system
might cause this phenomenon in plants (Oka 1988, Sano
1993), suggesting that any simple model for hybrid sterility is
insufficient to understand the real situation. Two of the difficulties
in its genetic analysis are that hybrid sterility behaves
like a quantitative trait and F 1 hybrid sterility is not easily discriminated
from hybrid breakdown. We compared hybrid sterility
genes between and within species by using near-isogenic
lines (NILs) that had been established.
E
F
The gamete eliminator and its distribution
The gamete eliminator causes abortion of both female and male
gametes carrying the opposite allele only in the heterozygote.
This type of sterility gene was detected in backcrossed populations
between Taichung 65 (T65, japonica type) and Oryza
rufipogon (W593 from Malaysia, perennial type). After introducing
a segment of chromosome 6 from W593 into T65, the
alien segment was found to carry a gamete eliminator, S6, which
was linked with st1 (stipple1) and was located near the centromere
on the short arm of chromosome 6 (Sano 1992).
To examine the distribution of the alleles, two NILs of
T65—A with st1 S6-a and B with st1 S6—were made in this
study. Strains with S6 are expected to give semisterile hybrids
and a distortion of st1 in the F 2 when crossed with NIL-A,
whereas strains with S6-a are fertile when crossed with NIL-
B. The different responses to the two NILs were used to examine
the distribution in wild and cultivated rice strains. Crossing
experiments suggested that S6-a is predominant in the
japonica type and S6 is distributed in perennial types of O.
rufipogon. However, most strains (18/25), except for the
japonica type, showed no difference between crosses with NIL-
A and NIL-B, which might be explained by an additional neutral
allele, S6-n, at S6 (Table 1). A gene that induces no infertility
in response to S6 was successfully introduced into T65
from Patpaku (indica type) by successive backcrosses. Since
the gene was located near the centromere, it was assumed to
be S6-n.
Fig. 1. Female gametophyte development affected by two gamete
eliminators, S1 and S6. A, B, the recurrent parent; C, D, S1/S1-a,
E, F, S6/S6-a. EN = egg nucleus, SY = synergid cell, PN = polar
nuclei, AN = antipodal cells. A bar shows 20 µm.
Histological comparisons of abnormalities caused
by gamete eliminators
To look into the genetic effects caused by gamete eliminators,
gametogenesis was investigated in semisterile plants caused
by two different gamete eliminators, S1 and S6, using NILs of
T65. S1 was detected in hybrids between the two cultivated
rice species, O. sativa and O. glaberrima, and it was tightly
linked with wx (waxy) on the short arm of chromosome 6 (Sano
1990). In pollen development, the heterozygotes of S1/S1-a
and S6/S6-a showed a distinct difference, namely, in S1/S1-a,
with half of the microspores deteriorating at the two-nucleate
stage after meiosis. In S6/S6-a, no abnormality was detected
in mature microspores, showing that the two genes caused
dysfunction of microspores in different stages of pollen development.
Megagametogenesis was also compared between the two
semisterile heterozygotes of S1/S1-a and S6/S6-a (Fig. 1). In
fertile plants, the functional megaspore is divided after meiosis
to form the immature eight-nucleate embryo sac. This period
corresponded to the stages of 1.5–1.8 mm in anther length.
At the flowering stage, about half of the embryo sacs were
aborted in the two semisterile heterozygotes of S1/S1-a and
S6/S6-a, indicating that embryo sacs carrying S1-a or S6-a
were aborted. Any antipodals, polar nuclei, and synergids were
not detected in aborted embryo sacs, suggesting that abortion
Genetic diversity, evolution, and alien introgression 177

P101
39.6
(38.0)
P98
49.3
(97.7)
18.9
(34.0)
Fig. 2. Pollen and spikelet (in parentheses) fertility in F 1 hybrids
between three NILs carrying different sets of duplicate lethals.
P98, P99, and P101 carry a set of duplicate lethals from Pachchaiperumal,
Peh-ku, and Henan-tsao, respectively.
P99
crossed with each other, including the recurrent parent (T65).
P98, P99, and P101 carried a set of duplicate lethals that was
introduced from indica types Pachchai-perumal, Peh-ku, and
Henan-tsao, respectively. All the NILs gave male semisterile
but female fertile plants when crossed with T65, showing that
the duplicate lethals affected only pollen development as reported.
All the F 1 hybrids between the three NILs showed more
severe male sterility since two different sets segregated. Spikelet
fertility was also high in the F 1 of P99 × P101, as expected.
However, the F 1 s of P98 × P101 and P98 × P99 showed a
reduced spikelet fertility (Fig. 2). Histological observations in
the F 1 of P98 × P101 detected no abnormality during
megagametogenesis. Results indicated that duplicate lethals
could induce spikelet sterility depending on the genetic background,
suggesting that the discrepancies could appear in early
generations of hybridization or backcrossed populations in
relation to their genic effects on hybrid sterility genes.
might have occurred at the early stage of megagametogenesis
(Fig. 1D, F). Histological observations revealed that abnormality
occurred in immature one- or two-nucleate embryo sacs
(Fig. 1C, E). Results indicated that the manner of cell division
affected by S6 differed markedly between the formation of
female and male gametes.
Duplicate lethals in indica-japonica crosses
Duplicate lethals were proposed as a major cause of F 1 pollen
sterility in varietal crosses of rice (Oka 1974). The genic model
assumes that the genotypes of parents are +1+1s2s2 and
s1s1+2+2 and that the hybrid produces aborted microspores,
which carry lethals of both s1 and s2. Different sets of duplicate
lethals seemed to cause different degrees of hybrid
semisterility and the assumption was partly supported by the
results making NILs with different sets of duplicate lethals from
different cultivars. The three NILs (P98, P99, and P101) established
by Oka (1974) were used in this study and inter-
References
Oka HI. 1974. Analysis of genes controlling F 1 sterility in rice by
use of isogenic lines. Genetics 77:521-534.
Oka HI. 1988. Functions and genetic bases of reproductive barriers.
In: Oka HI, editor. Origin of cultivated rice. Tokyo (Japan):
Elsevier. p 181-209.
Sano Y. 1990. Genic nature of gamete eliminator in rice. Genetics
125:183-191.
Sano Y. 1992. Genetic comparisons of chromosome 6 between wild
and cultivated rice. Jpn. J. Breed. 42:561-572.
Sano Y. 1993. Constraints in using wild relatives in breeding: lacking
of basic knowledge on crop gene pools. In: Buxton DR,
editor. International Crop Science I. Madison, Wis. (USA):
Crop Science Society of America. p 437-443.
Notes
Authors’ address: Faculty of Agriculture, Hokkaido University,
Sapporo 060-8589, Japan.
Developmental cytology on gametic abortion caused by
induced complementary genes gal and d60 in japonica rice
M. Tomita, H. Yamagata, and T. Tanisaka
Genes for hybrid sterility have been found in crosses between distantly related rice species showing a reproductive barrier. The
gametic lethal gene gal causes gametic abortion together with the semidwarfing gene d60 in crosses among closely related
japonica varieties. The F 1
between mutant line Hokuriku 100 (genotype d60d60GalGal, Gal: nonlethal allele) and its original
variety Koshihikari (D60D60galgal, D60: tall allele) showed 25% sterility because of the deterioration of both sex gametes
having the genotype d60gal. Development processes of male gametes were cytologically observed using the F 4
progenies.
Meioses, tetrads, stranded microspores, single-nucleate pollens, and first-pollen mitoses were normally observed in all plants.
However, at the middle binucleate stage, when generative nuclei became enclosed in newly formed generative cells and were
located opposite the pore side (apart from vegetative nuclei), some pollens discontinued development in the F 4
plants with
71.6% seed set. Before anthesis, two distinct types of pollen were observed: vacant pollens (median value 37 microns) with
only a remnant of the generative cell wall and normal trinucleate pollens (51 microns) with well-developed cytoplasm. The
frequency of the empty pollens averaged 24.5%, which was expected for the haploid genotype d60gal.
178 Advances in rice genetics

Genes for hybrid sterility of rice have been found mostly in
crosses between distantly related species, which belong to different
gene pools showing a reproductive barrier. This was the
first discovery of a hybrid sterility gene among japonica varieties
free from a reproductive barrier. The gametic lethal gene
gal was identified, together with its activator d60 (semidwarfing
gene), in a cross between semidwarf mutant Hokuriku 100 and
its original tall variety Koshihikari (Tomita et al 1989). Because
of the deterioration of the gametes having both gal and
d60, the F 1 between Hokuriku 100 (genotype d60d60GalGal,
Gal: mutant allele) and Koshihikari (D60D60galgal, D60: tall
allele) showed 25% sterility and the F 2 progenies then segregated
into a ratio of 1 semidwarf (1 d60d60GalGal):2 tall and
25% sterile (2 D60d60Galgal):6 tall (2 D60d60GalGal:1
D60D60GalGal:2 D60D60Galgal:1 D60D60galgal) (Tomita
1996), which was skewed from a ratio of 1 semidwarf:3 tall
based on a single recessive gene segregation.
Several genetic systems have been reported for hybrid
sterility between indica and japonica varietal groups, pollen
sterility by duplicate recessive gametophytic alleles (Oka 1953,
1974), female sterility caused by one-locus sporo-gametophytic
interactions (Kitamura 1962, Oka 1964, Ikehashi and Wan
1996, Wan and Ikehashi 1996), and both-sex breakdown according
to the one-locus gene model (Sano et al 1994). Onelocus
allelic interactions for male sterility were also found in
the species of hybrids between Oryza sativa and O. glaberrima
(Sano et al 1979), O. sativa and O. rufipogon (Sano 1992),
and O. sativa and O. glumaepatula. However, little information
on gametic developmental processes is available.
The semidwarfing gene d60 confers a good erect stature,
about 15 cm shorter than that of the original variety; d60
has potential to be a promising alternative to the preferentially
used gene sd1. For the practical use of d60 in semidwarfing
breeding programs, the pleiotropic effect in the gametic developmental
process must be overcome. The objective of this
paper is to demonstrate the male breakdown caused by gal
and d60.
Materials and methods
Developmental processes of male gametes were examined by
using 30 F 4 plants derived from the 25% sterile F 3 plants (genotype
D60d60Galgal), following the cross between Koshihikari
and Hokuriku 100. Both parents were also used. Hokuriku 100
is one of the most promising semidwarf mutants selected from
gamma-irradiated Koshihikari to enhance lodging resistance
of the leading Japanese variety Koshihikari. The growth stages
of male gametes were estimated from the auricle length between
the flag leaf and the next leaf. Ten panicles were sampled
from each plant several times before the meiotic stage to the
trinucleate pollen stage. Sampled panicles were fixed in formalin-acetic
alcohol (FAA) for 48 h and subsequently stored
in 70% ethanol. Specimens of microspores were prepared by
the acetocarmine squash method and then observed under a
compound microscope. The diameters of 250 pollens per glume
were measured at the trinucleate stage with an eyepiece micrometer
at 1,000X magnification. Percentage spikelet fertility
was calculated on the basis of the number of filled and
unfilled spikelets for each harvested panicle.
Results
The F 1 plants of Koshihikari (tall)/Hokuriku 100 (semidwarf)
grew into tall phenotypes like Koshihikari and averaged 28.4%
unfilled spikelets. F 2 progenies segregated into the ratio of 11
semidwarf plants (Hokuriku 100 type):24 25% sterile tall plants
(F 1 type):65 fertile tall plants (Koshihikari type) and the genotypic
classification of 11 semidwarf:24 tall and 25% sterile:19
tall heterozygous:46 tall homozygous determined by the F 3
test showed a good fit to the theoretical ratio of 1
d60d60GalGal:2 D60d60Galgal:2 D60d60GalGal:4 (1
D60D60GalGal:2 D60D60Galgal:1 D60D60galgal) (χ 2 = 0.49,
0.75

A B C D
E F G H
Fig. 1. Developmental process of male gametes in 25% sterile plants (genotype D60d60Galgal). (A) meiosis, (B) tetrads, (C) first mitotic
division, (D) early single-nucleate pollen, (E) late single-nucleate pollen, (F) metaphase of first-pollen mitosis, (G) anaphase of first-pollen
mitosis, (H) early binucleate pollen, (I) middle binucleate pollen, (J) abortive binucleate pollen (genotype d60gal), (K) degraded pollen
before flowering (genotype d60gal), (L) late binucleate pollen, (M) trinucleate pollen, (N) mature pollen before flowering.
types were D60d60Galgal, following the cross between
Koshihikari and Hokuriku 100.
Discussion
Two types of genetic systems were found to be responsible for
semisterility in intersubspecific hybrids between indica and
japonica varietal groups: the duplicate gametophytic lethal
system by the recessive s alleles on the two S loci (Oka 1953,
1974) and the one-locus sporo-gametophytic allelic interaction
by the single S locus (Kitamura 1962, Oka 1964, Ikehashi
and Wan 1996, Wan and Ikehashi 1996, Sano et al 1994). Oka
(1953) proposed that duplicate S gene loci, which work as
developmental factors in gametes, caused hybrid sterility when
the F 1 gametes received both the recessive s genes on each
duplicate locus. Hybrid sterility caused by gal and d60 and by
the duplicate s genes has similar effects and these gametophytic
genes are responsible for both systems. However, a critical
difference is found between the systems—gal and d60 caused
both-sex sterilities, whereas the duplicate s genes caused only
male sterility (Oka 1974). Moreover, both-sex breakdowns by
gal and d60 were quite rare cases except for S10, which caused
a one-locus allelic interaction (Sano et al 1994). Furthermore,
Oka (1953) observed that pollens deteriorated randomly from
the single-nucleate stage to the binucleate stage because of the
presence of duplicate s genes. In our study, it was observed
that gal and d60 caused simultaneous pollen abortion at the
middle binucleate stage. Moreover, Tomita (1996) reported
that the 25% sterility caused by gal and d60 occurred in addition
to the intersubspecific infertility in the F 1 between Milyang
23 and Hokuriku 100. From the four differences found in gene
effects, gal and d60 are clearly distinguished from the duplicate
s genes and the single S locus.
If the nonlethal gene Gal had not mutated from gal together
with the induction of d60, d60 should be eliminated in
an M 1 plant. The gal, which interacts with d60, has never been
found as a gametic lethal gene. Thus, Gal, being essential to
the transmission of d60, is a valuable gene, which can bring
about new semidwarf breeding through the use of d60.
References
Ikehashi H, Wan J. 1996. Differentiation of alleles at seven loci for
hybrid sterility in cultivated rice (Oryza sativa L.). In: Khush
GS, editor. Rice genetics III. Proceedings of the Third International
Rice Genetics Symposium, 16-20 Oct 1995. Manila
(Philippines): International Rice Research Institute. p 404-
408.
Kitamura E. 1962. Genetic studies on sterility observed in hybrids
between distantly related varieties of rice, Oryza sativa L. Bull.
Chugoku Agric. Exp. Stn. S. A8:141-205.
180 Advances in rice genetics

J
K
I
L M N
Fig. 1 continued.
Oka HI. 1953. The mechanism of sterility in the intervarietal hybrid.
(Phylogenetic differentiation of the cultivated rice. VI.) Jpn.
J. Breed. 2:217-224. (Japanese/English.)
Oka HI. 1964. Considerations on the genetic basis of intervarietal
sterility in Oryza sativa. In: Rice genetics and cytogenetics.
Amsterdam (Netherlands): Elsevier and International Rice
Research Institute. p 158-174.
Oka HI. 1974. Analysis of genes controlling F 1 sterility in rice by
the use of isogenic lines. Genetics 77:521-534.
Sano Y. 1992. Genetic comparisons of chromosome 6 between wild
and cultivated rice. Jpn. J. Breed. 42:561-572.
Sano Y, Sano R, Eiguchi M, Hirano HY. 1994. Gamete eliminator
adjacent to the wx locus as revealed by pollen analysis in rice.
J. Hered. 85:310-312.
Sano Y, Chu YE, Oka HI. 1979. Genetic studies of speciation in
cultivated rice. 1. Genic analysis for the F 1 sterility between
O. sativa L. and O. glaberrima Steud. Jpn. J. Genet. 54:121-
132.
Tomita M. 1996. The gametic lethal gene gal: activated only in the
presence of the semidwarfing gene d60 in rice. In: Khush GS,
editor. Rice genetics III. Proceedings of the Third International
Rice Genetics Symposium, 16-20 Oct 1995. Manila
(Philippines): International Rice Research Institute. p 396-
403.
Tomita M, Tanisaka T, Okumoto Y, Yamagata H. 1989. Linkage analysis
for the gametic lethal gene of rice variety Koshihikari and
the semidwarf gene induced in Koshihikari. In: Iyama S,
Takeda G, editors. The key to the survival of the Earth. Proceedings
of the 6th International Congress of the Society for
the Advancement of Breeding Researches in Asia and Oceania,
21-25 Aug 1989, Tsukuba, Japan. p 345-348.
Wan J, Ikehashi H. 1996. List of hybrid sterility gene loci (HSGLi)
in cultivated rice (Oryza sativa L.). Rice Genet. Newsl. 13:110-
114.
Notes
Authors’ addresses: M. Tomita, Faculty of Agriculture, Tottori University,
Koyama-cho, Tottori 680-8553, Japan; H. Yamagata,
Faculty of Biology-Oriented Science and Technology, Kinki
University, Uchita, Wakayama 649-6493, Japan; T. Tanisaka,
Graduate School of Agriculture, Kyoto University, Sakyo-ku,
Kyoto 606-8502, Japan. Email: tomita@muses.tottori-u.ac.jp.
Genetic diversity, evolution, and alien introgression 181

Molecular diversity and its geographical distribution
in core rice germplasm
W.J. Xu, S.B. Yu, S. Singh, J. Domingo, H. Bhandari, Y.F. Lu, C.H.M. Vijayakumar, P. Bagali, S. Sarkarung, S.S. Virmani, G.S. Khush, and Z.K. Li
In an effort to develop an international rice molecular breeding program, a large set of 193 rice genotypes from 19 different
countries/regions was collected to form a core rice gene pool. To evaluate the genetic diversity of the gene pool and provide
DNA polymorphism information for future gene/QTL mapping and marker-assisted breeding, a well-distributed anchor set of
101 simple sequence repeat (SSR) markers was used to genotype these lines. Considerable variation was found in all SSR
marker loci, with an overall genetic diversity of 0.687 and an average of 6.2 alleles per SSR locus. SSR loci with prevalent
alleles were scattered across the rice genome, except chromosomes 5 and 6. Cluster analysis of the 193 accessions based on
the SSR data revealed four cultivar groups. Group I corresponded to the classical indica group, while group IV corresponded to
the classical japonica group. Groups II and III represented a portion of the sample that consisted of some modern cultivars,
diverse landraces, and traditional japonica varieties. Cultivars in group I (indica) showed the highest level of diversity at all
levels. In particular, indica lines from China and India were apparently differentiated from each other, forming two separate
subgroups.
Rice is the staple food of more than three billion people in
Asia. Successes in rice genetic improvement are largely attributed
to the appropriate evaluation and use of genetic diversity.
In an effort to develop an international rice molecular
breeding program, a large set of 193 rice genotypes from 19
different countries or regions was collected as a core gene pool.
In our study, we try to quantify the genetic diversity of these
collections within and among cultivar groups as well as geographical
origins using mapped simple sequence repeat (SSR)
markers and to evaluate their relative contributions to total
gene diversity in the core gene pool. Information from this
study could be valuable for designing optimal procedures in
future molecular breeding practices.
Materials and methods
A total of 193 accessions were obtained from 19 countries or
regions. These accessions were chosen to represent the main
genetic diversity within and among geographical origins. DNA
extraction was done after 3 wk, following a modified CTAB
procedure. Polymerase chain reactions (PCR) and silver staining
procedures were as described in the technical manual of
Promega (1996). A total of 101 anchor SSR primer pairs developed
by Cornell University (Temnykh et al 2000) were used
in the assay. The resulting electrophoregrams were analyzed
with the software Quantity One from Bio-rad. The methods
for discriminating phenotypes of indica and japonica included
(1) phenol reaction, (2) degree of grain shedding, (3) ratio of
grain length to width, and (4) glume hairiness.
Each of the informative bands was scored independently:
1 for present and 0 for absent. A two-way data matrix was
constructed, consisting of the marker loci/alleles present in each
variety. The raw data were submitted to NTSYS-PC to transform
polymorphic bands into Dice distance. Cluster analyses
were performed based on the unweighted pair group method
using arithmetic averages (UPGMA) to reveal similarities
among these 193 genotypes. Analyses of molecular variance
(AMOVA) and allele frequencies were obtained using the software
package ARLEQUIN (Schneider et al 1996). Average
gene diversity over loci was calculated. Two-level hierarchical
gene diversity analyses were performed following the
method of Finkeldey and Murillo (1999) to partition total gene
diversity into within- and among-cultivar groups.
Results
Polymorphism
All 101 microsatellite loci were polymorphic over 193 core
genotypes. The total number of putative alleles was observed
to be 632, averaged as 6.3 alleles per locus. About 5% of the
alleles appeared in more than 50% of the cultivars (referred to
as prevalent alleles), in contrast to 48% of the alleles present
in fewer than 10% of the cultivars. The 34 microsatellite loci
with prevalent alleles were scattered over most of the rice genome,
except chromosomes 5 and 6. These two chromosomes
contributed the most to total genetic diversity (0.687) in the
core collection.
Cluster analysis
The UPGMA cluster dendrogram showed four major groups
and two groups with single varieties (Fig. 1). AMOVA showed
that among-group variation accounted for 8.56% of total molecular
variation, while within subgroups and among subgroups,
variation was 15.26% and 76.17%, respectively. Group I contributed
the most to gene diversity among and within varietal
groups as well as to total gene diversity (Fig. 2). Groups II,
III, and IV exhibited greater contributions to genetic differentiation
among groups than within groups and to total gene diversity.
Group I was recognized as the classical indica group,
consisting of four subgroups. The single group 1 consisted of
only variety Babaomi, which is from a high-elevation area of
182 Advances in rice genetics

Sub-G1 (52, 100%)
%
80
Sub-G2 (5, 100%)
Sub-G3 (31, 77.4%)
Group I
70
60
Ct(j)
Cs(j)
Cst(j)
Sub-G4 (44, 69.8%)
50
40
Single group 1
Sub-G5 (14, 35.7%)
Sub-G6 (11, 0%)
Group II
30
Sub-G7 (25, 3.8%)
Group III
20
0.24 0.30
Sub-G8 (9, 0%)
Single group 2
Group IV
Fig. 1. Association among eight subgroups revealed by
UPGMA cluster of Dice similarity coefficients calculated
from 101 SSR marker loci. Total number of lines and percentage
of indica lines are indicated in parentheses.
10
0
Group I Group II Group III Group IV
Fig. 2. Contributions of individual groups to gene diversity
among groups (Cst(j)), populations within groups (CS(j)), and
total gene diversity (Ct(j)).
Table 1. Geographical distribution of four major groups of 191 core collections in eight subgroups
(SG).
Geographical Group I Group II Group III Group IV
origin
SG1 SG2 SG3 SG4 SG5 SG6 SG7 SG8
Total
Africa 1 1 2 4
America 1 3 1 5
Bangladesh 2 1 3
China 16 5 1 8 5 2 2 5 44
Europe 5 5
India 9 5 15 4 3 1 37
Indonesia 2 1 1 1 1 6
Iran 2 3 1 6
IRRI 6 2 6 14
Japan 2 1 3
Korea 2 1 2 5
Malaysia 2 4 1 1 8
Myanmar 3 3 1 1 8
Nepal 1 3 3 3 10
Pakistan 1 2 3
Philippines 2 1 1 3 7
Sri Lanka 3 1 1 5
Thailand 2 2 4
Vietnam 2 10 1 1 14
Total 52 5 31 44 14 11 25 9 191
Yunnan Province in Southwestern China. Group II consisted
of two subgroups: sub-G5 and sub-G6. Most of the cultivars
in sub-G5 were landraces and traditional types, while those in
sub-G6 were improved japonica cultivars with particular characteristics
such as tolerance for biotic or abiotic stress or spe-
cial grain qualities. Varietal group III consisted of a wide range
of japonica cultivars. Group IV consisted of nine japonica
cultivars. Single group 2 has only one deepwater variety,
Jalmagna from India. The geographical origins of cultivars in
each group are shown in Table 1. Notably, most of the indica
Genetic diversity, evolution, and alien introgression 183

cultivars from China belonged to sub-G1 and sub-G2, while
those from India were under sub-G4.
Discussion
This study has shown that less than 5% of a total of 632 alleles
are prevalent alleles, which are present in more than 50% of
the cultivars in the core collections. This is consistent with our
knowledge that more than 95% of the rice collections in the
primary gene pool have seldom been used in modern plant
breeding programs. The occurrence of prevalent alleles is probably
caused by massive selection on a limited number of cultivars,
which is revealed by an analysis of the ancestry of improved
cultivars of Asian rice. The findings suggest that all
cultivars released by late 1979 under the IR designation can
be traced to the same maternal parent Cina (Hargrove et al
1980), and that all cultivars developed in the Philippines from
1960 to 1994 showed the genetic core of 19 ancestral parents.
None of the SSR markers with prevalent alleles were located
on chromosomes 5 and 6, providing evidence that a traditional
breeding strategy based on multiple crossing and phenotypic
selection has limited power to overcome sterility problems and
indica-japonica genomic differentiation. A majority of the
genes for indica-japonica hybrid sterility and indica-japonica
differentiation are located on chromosomes 5 and 6 (Zhang et
al 1997, Kinoshita 1993). The emphasis on the use of japonicaindica
variation for future molecular breeding would be of great
help for increasing the genetic diversity of rice cultivars,
thereby breaking the yield ceiling and improving production
sustainability.
The results of this study clearly suggest the possible existence
of temperate and tropical indica differentiation, although
this may not be as intensive as that of temperate and
tropical japonica. The classical evidence for the two ecotypes
of indica cultivars came from general differentiations in some
morphological traits, such as grain shape and defense pattern
against insect or disease infestation as well as heterotic pattern
within indica cultivars. It has been reported that the initial
high-yielding hybrid rice cultivars developed in China largely
resulted from the high genetic diversity between Chinese indica
maintainer lines and the tropical restorer line developed
at IRRI, which were later recognized as two heterotic groups
within indica (Zhang et al 1995).
References
Finkeldey R, Murillo O. 1999. Contribution of subpopulations to
total gene diversity. Theor. Appl. Genet. 98:664-668.
Hargrove TR, Coffman WR, Cabanilla VL. 1980. Ancestry of cultivars
of Asian rice. Crop Sci. 20:721-727.
Kinoshita T. 1993. Report of the Committee on Gene Symbolization,
Nomenclature and Linkage Groups. Rice Genet. Newsl.
10:7-39.
Schneider S, Kneffer JM, Roessle D, Excoffier L. 1996. ARLEQUIN.
Switzerland: Genetics and Biometry Laboratory, Department
of Anthropology, University of Geneva.
Temnykh S, Park WD, Ayres N, Cartinhour S, Hauck N, Lipovich L,
Cho YG, Ishii T, McCouch SR. 2000. Mapping and genome
organization of microsatellite sequences in rice (Oryza sativa
L.). Theor. Appl. Genet. 100:697-712.
Zhang QF, Gao YJ, Saghai Maroof MA, Yang SH, Li JX. 1995.
Molecular divergence and hybrid performance in rice. Mol.
Breed. 1:133-142.
Zhang QF, Liu KD, Yang GP, Saghai Maroof MA, Xu CG, Zhou
ZQ. 1997. Molecular marker diversity and hybrid sterility in
indica-japonica rice crosses. Theor. Appl. Genet. 95:112-118.
Notes
Authors’ address: Plant Breeding, Genetics, and Biochemistry Division,
International Rice Research Institute (IRRI), DAPO
Box 7777, Metro Manila, Philippines.
Phenotypic diversity in embryo mutants induced by tissue
culture in rice
T. Iwamoto, S.K. Hong, H. Imai, M. Matsuoka, and H. Kitano
We identified 146 rice embryo mutants from 6,000 M 2
lines that had been regenerated from 3-mo-old Nipponbare calli.
Among them, 52 mutants were characterized into three groups based on their phenotypes: deletion of embryonic organ(s),
abnormal embryo size, and aberration in organ morphology. Mutants with deletion of embryonic organ(s) are composed of
small globular embryos, club-shaped embryos, large undifferentiated embryos, and shootless and radicleless embryos. Changes
in embryo-size mutants seemed to be in the size of their scutellum. Such variation in mutants detected in embryogenesis
suggested that many genes could be related in regulating embryogenesis. The copy number of retrotransposon Tos17 increased
in several mutants. Some mutations may be affected by Tos17 because it can transpose throughout the chromosome
during tissue culture. Thus, we consider tissue culture useful for studying genetic regulation of organ differentiation and for
isolating genes expressed during embryogenesis.
184 Advances in rice genetics

Embryogenesis has been investigated by creating mutations in
rice, maize, and Arabidopsis. These studies indicate that complicated
regulatory systems are operating during embryogenesis,
including pattern formation, organ differentiation, axial
determination, size regulation, and morphogenesis. Despite the
growing interest in this area, little is known about their regulatory
mechanism.
Tissue culture-induced mutations have been reported in
many plant species and studied extensively. Hirochika et al
(1996) reported that retrotransposons are involved in tissue
culture mutations in rice. Among several retrotransposon families
of rice, the most active one, Tos17, is a useful tool for
insertional mutagenesis and gene tagging.
Materials and methods
Callus cultures were induced through seed culture of japonica
rice variety Nipponbare on Murashige and Skoog medium containing
2,4-dichlorophenoxyacetic acid at 2 mg L –1 . After 1-
mo incubation, calli were transferred onto N6 medium to induce
suspension-cultured cells. A total of about 8,000 M 1 lines
were regenerated from 3-mo-old calli. About 6,000 M 2 lines
were screened for embryo mutants. Mature dry seeds were allowed
to imbibe in water for 24 h, after which the abnormalities
of mature embryos were analyzed under the dissecting
microscope.
Mutant phenotypes were observed using standard paraffin
sections. Mature dry seeds were imbibed in water for 24 h
prior to fixation in formalin-acetic acid-70% ethanol (1:1:18)
solution. Removed embryos were dehydrated in a graded ethanol
series, embedded in paraffin, and then cut into 10-µm sections.
Sections were stained with Delafield’s hematoxylin. Phenotypes
of mutants were observed under the microscope.
Results
Characterization and categorization of mutants
Fifty-two embryo mutants were identified. The frequency of
mutant embryos in heterozygous plants was about 25% in most
mutants (data not shown). Although the embryonic mutants
had well-developed endosperms, many kinds of abnormalities
in each embryo were observed. These embryo mutants were
categorized into three groups: deletion of embryonic organ(s),
abnormal embryo size, and aberration in organ morphology
(Table 1).
Nineteen mutants were categorized as having deleted
organ(s) and two subgroups, one showing no embryonic organs
and the other lacking either shoot or radicle, were found.
Thirteen mutants failed to develop any embryonic organ (Table
1). Among them, seven mutants had relatively small and globular
(200 to 700 µm) or club-shaped (600 to 900 µm) embryos.
Six mutant embryos were relatively large (750 to 1,700 µm)
but had no embryonic organ. The second subgroup was represented
as shootless or radicleless embryos.
Embryo-size mutants showed reduced and enlarged sizes
without serious effects on the differentiation of either the shoot
Table 1. Categorization of embryo mutants in rice.
Phenotype/characteristics
Strain
Deletion of organ(s)
Organless, globular 1342, 2504, 3613, 4753
Organless, club-shaped 551, 2832, 5049
Large but organless 615, 1837, 3219, 3761, 3801, 4107
Shootless, normal radicle 904, 1041, 2995, 3491
Radicleless, normal shoot 521, 1661
Modified embryo size
Reduced embryo and organs 1154, 1184, 5799
Large scutellum 3716, 4479, 4779
Large scutellum, multiple 2206
organs
Morphological aberration
Shoot organization 378, 462, 940
Green embryo, abnormal
organ morphology 1145, 1469
Green embryo, viviparous 1881
Multiple organs 1336
Undeveloped organs 2320, 3477
Abnormal organ morphology 173, 1447, 3275, 3474, 3836, 4114,
4546, 4738, 4770, 4821, 5324,
5340, 5576, 5587, 5677, 5764,
5998
or radicle. Both types of mutations were obtained with four
reduced embryos and three giant embryos. In these mutants,
reduction or enlargement was exclusively due to scutellum
development. In some mutants, both shoot and radicle primordia
were formed. However, the morphology or the extent of
differentiation was abnormal. A very wide phenotypic variation
was observed among the 26 mutants belonging to this
group.
Copy number of Tos17
The copy number of retrotransposon Tos17 was examined in
some of the mutants. An increase in copy number of Tos17
was observed in some mutants based on the original copy number
of two in Nipponbare. One to four transposed Tos17 were
detected in different strains (904, 1145, 1154, 1184, 1469, 2504,
and 2832). Different hybridization patterns expected as a result
of random transposition were observed. In other mutants,
no change in the copy number of Tos17 was observed.
Discussion
Phenotypic diversity of rice embryonic mutations was reported
and many embryonic mutants treated by chemical mutagen have
been characterized to date (Hong et al 1995). In this study, we
induced mutations using tissue culture. Many mutations isolated
here were largely similar to those induced by chemical
mutagen. The fact that diverse phenotypes were observed suggested
that tissue culture is a useful method for inducing embryonic
mutations.
Retrotransposon Tos17 is activated and transposed
throughout the chromosome during tissue culture, thus spoiling
functional genes (Hirochika et al 1996). Because of this,
Genetic diversity, evolution, and alien introgression 185

Tos17 could be a useful alternative for gene tagging. An increase
in the copy number of Tos17 was recognized in some of
the mutants. Some of these mutations might have been caused
by the insertion of Tos17. However, whether or not the insertion
of Tos17 was responsible for these mutations is still not
clear. There were mutations in which no increase in copy number
was observed. Other transposons or factors may be responsible
for these mutations.
References
Hirochika H, Sugimoto K, Otsuki Y, Tsugawa H, Kanda M. 1996.
Retrotransposons of rice involved in mutations induced by
tissue culture. Proc. Natl. Acad. Sci. USA 93:7783-7788.
Hong SK, Aoki T, Kitano H, Satoh H, Nagato Y. 1995. Phenotypic
diversity of 188 rice embryo mutants. Dev. Genet. 16:298-
310.
Notes
Authors’ addresses: T. Iwamoto, H. Imai, H. Kitano, Graduate School
of Bioagricultural Sciences; S.K. Hong and M. Matsuoka,
Bioscience Center, Nagoya University, Furo-cho, Chikusa,
Nagoya 464-8601, Japan.
Genetic diversity in Korean japonica rice cultivars
S.J. Kwon, S.N. Ahn, C.I. Yang, H.C. Hong, Y.K. Kim, J.P. Suh, H.G. Hwang, H.P. Moon, and H.C. Choi
The genetic diversity in 123 japonica rice cultivars developed at the National Crop Experiment Station (NCES), National Honam
Agricultural Experiment Station (NHAES), and National Yeongnam Agricultural Experiment Station (NYAES) in Korea from 1933
to 1998 was assessed using 65 simple sequence repeats (SSRs) representing 65 loci with a total of 324 alleles. The genetic
diversity of 123 japonica cultivars was compared by breeding institute and period. The genetic diversity of the cultivars increased
slightly over time, reflecting the different genetic backgrounds of the cultivars developed for different ecosystems.
Overall, the diversity of the current japonica cultivars seems relatively narrow probably because of high selection pressure for
good grain quality and repeated use of the same-origin parents with proven yielding ability in the breeding program.
Plant breeders are concerned about genetic diversity because
it is a prerequisite for recombined improvement of various agronomic
characters in a breeding program and it could help
reduce the risk of widespread epidemics of insect pests and
diseases. For the last decade, the rice breeding program in
Korea has focused on developing rice cultivars with high grain
quality. Many of these high-quality rice varieties shared a common
ancestry and probably lacked genetic diversity. The exclusive
growing of japonica cultivars in the late 1980s promoted
the narrow genetic diversity of cultivated rice varieties
(Kim et al 1994).
DNA markers such as microsatellite or simple sequence
repeats (SSRs) provide an efficient way of evaluating genetic
diversity in germplasm because of their highly polymorphic
nature. This study was carried out to (1) monitor the changes
in genetic diversity of rice cultivars developed during 1933-
98, (2) investigate the probable causes for any change in genetic
diversity, and (3) provide a basis for the large-scale evaluation
of molecular divergence in rice germplasm.
Materials and methods
A total of 123 rice cultivars were used in this study. DNA was
extracted as described in Causse et al (1994). A set of 65
microsatellite markers was used to assess genetic diversity
(Table 1). The procedures for polymerase chain reaction (PCR)
for simple sequence length polymorphism (SSLP) analysis and
silver-staining were those as described by Panaud et al (1996).
Band profiles for each cultivar were rated 1 or 0 to indicate
the presence or the absence, respectively, of specific bands.
Genetic distances (GD) among all 7,503 pairs of 123 cultivars
were estimated from molecular data by Nei’s distance equation
(Nei 1987). The unweighted pair group method with mean
(UPGMA) in the computer program NTSYS-PC was used to
carry out cluster analysis. The polymorphic information content
(PIC) value was used to refer the related value of each
marker to the amount of polymorphism exhibited (Anderson
et al 1993).
Results and discussion
Table 1 summarizes the number of alleles detected per marker.
All 65 microsatellite markers detected polymorphism among
the 123 japonica cultivars. A total of 324 alleles were revealed
with a mean of 4.99 per marker. Three hundred twenty-four
loci differentiated at least one cultivar from the others. The
PIC value was computed for each marker (Table 1). OSR13,
OSR31, and CT531 had the lowest PIC value (0.016), whereas
CT19 had the highest (0.876). CT19 can be useful for evaluating
genetic differentiation and relationship among cultivars.
Nei’s GDs among 7,503 combinations of 123 japonica
rice cultivars ranged from 0.0091 to 0.3262, with an average
of 0.162 (data not shown). The 123 cultivars were classified
into six groups by cluster analysis based on Nei’s genetic dis-
186 Advances in rice genetics

Table 1. Number of alleles detected by individual markers.
Marker Chr. Alleles PIC Marker Chr. Alleles PIC Marker Chr. Alleles PIC
no. (no.) value no. (no.) value no. (no.) value
CT158 1 4 0.476 CT481 5 11 0.689 CT522 9 11 0.790
CT441 1 5 0.443 GA257 5 4 0.471 OSR28 9 5 0.436
CT461 1 5 0.655 OSR34 5 3 0.064 OSR29 9 5 0.454
CT550 1 9 0.772 RM164 5 3 0.569 CT106 10 3 0.173
GA12 1 4 0.618 CT19 6 19 0.876 CT193 10 5 0.560
OSR23 1 2 0.032 CT201 6 3 0.425 CT531 10 2 0.016
OSR27 1 2 0.064 GA534 6 4 0.479 CT14 11 5 0.529
CT41 2 9 0.704 OSR19 6 3 0.466 CT25 11 13 0.847
CT43 2 4 0.650 ATT002 7 9 0.770 CT44 11 5 0.209
CT87 2 3 0.403 CT360 7 3 0.219 CT199 11 6 0.449
CT388 2 4 0.048 CT469 7 4 0.048 CT224 11 6 0.727
GA479 2 7 0.710 GA97 7 4 0.212 GA275 11 6 0.719
OSR08 2 4 0.171 GA337 7 3 0.186 OSR06 11 9 0.810
OSR9B 2 6 0.202 GA397 7 3 0.048 RM167 11 3 0.384
OSR11 2 4 0.110 OSR22 7 5 0.325 CT368 12 3 0.337
OSR26 2 4 0.281 CT56 8 6 0.413 CT462 12 7 0.581
GA580 3 3 0.221 GA408 8 5 0.563 OSR20 12 12 0.848
OSR31 3 2 0.016 OSR07 8 5 0.391 OSR04 nd a 5 0.506
CT206 4 2 0.078 OSR30 8 3 0.048 OSR13 nd 2 0.016
CT404 4 4 0.603 OSR35 8 3 0.315 OSR14 nd 2 0.064
CT500 4 5 0.596 CT6 9 2 0.499 OSR24 nd 4 0.463
OSR15 4 3 0.139 CT131 9 5 0.656
a nd = not detected.
tances. The varieties developed by the same breeding institute
and period showed a tendency to cluster together (data not
shown). These results seemed to imply that grouping of cultivars
coincided with the genealogical information.
Of the 123 cultivars, 60 were developed by NCES, 38
by NHAES, 25 by NYAES, and 3 are foreign introductions.
Table 2 shows the total number of alleles in, and the allelic
diversity among, the rice cultivars developed by each breeding
team. The average GD among the NCES-bred cultivars
(0.159) was slightly higher than that of NHAES (0.146), and
NYAES (0.157).
While the major goal of the rice breeding programs in
the 1960s and 1970s was high yield and stable production,
this later shifted to high grain quality, yield stability, suitability
for direct seeding, and specialty uses. The development of
Korean japonica cultivars can be divided into four periods
based on the priority breeding objectives: 1933 to 1960, 1961
to 1980, 1981 to 1990, and 1991 to 1998. Table 3 summarizes
the trend of changes in genetic diversity and number of cultivars
developed within the various periods. GDs and PIC values
among cultivars developed in each period ranged from
0.133 (1933-60) to 0.167 (1980s) and 0.323 to 0.408, respectively.
The low level of genetic diversity (0.133) of 24 rice
cultivars developed during 1933-60 by NCES and NHAES
resulted from the practice of using closely related germplasm
in breeding programs. “Eunbangju” or pure-line selections from
this cultivar were used as parents of 15 cultivars; 14 of these
were clustered in the same second group.
Table 2. Comparison of allele number and genetic diversity among
japonica rice cultivars developed by the different breeding institutes
in Korea.
Character NCES NHAES NYAES Total
Total no. of alleles 287 226 226 324
Range of alleles 1–16 1–11 1–10 1–19
Average of alleles 4.39 3.48 3.48 4.99
Average of PIC 0.410 0.380 0.401 0.411
Average of genetic distances 0.159 0.146 0.157 0.162
No. of cultivars 60 38 25 123
No. of pairwise combinations 1,770 703 300 7,503
Table 3. Comparison of allele number and genetic diversity among
japonica cultivars, by breeding period.
Character 1910-60 1961-80 1981-90 1991-98
Total no. of alleles 183 188 250 248
Range of alleles 1–11 1–8 1–11 1–12
Average of alleles 2.79 2.89 3.85 3.82
Average of PIC 0.323 0.371 0.408 0.396
Average of genetic 0.133 0.156 0.167 0.161
distances
No. of cultivars 24 16 38 45
No. of pairwise 276 66 703 990
combinations
Genetic diversity, evolution, and alien introgression 187

The second period, 1961-80, represents the early years
of modern rice breeding in Korea. In the late 1960s, rice breeders
began using a common pool of elite germplasm to improve
resistance to lodging and blast disease and obtain high yield in
japonica rice. The GDs among 16 rice cultivars showed a higher
level than those before 1960. During the third period, the breeding
objective was improved grain quality with yield stability.
The average GDs (0.167) among 38 rice cultivars in this period
increased, pointing out that the more diversified genetic
backgrounds might be induced since those contained an almost
equal number of rice varieties developed by the three
breeding institutes. In the last period, 45 rice cultivars were
developed with diverse goals such as specialty uses, adaptability
to direct seeding, and others. When these specialty rice
cultivars are not included, the genetic diversity decreased to
0.157.
Overall, the diversity of the current japonica cultivars
seems relatively narrow even though the three breeding institutes
maintain separate but complementary breeding programs
(Kim et al 1994). This is evident when the Tongil-type cultivars
grown in the 1980s disappeared in farmers’ fields in the
1990s because of their unfavorable grain quality. The high
selection pressure for good grain quality and repeated use of
the same-origin parents with proven yielding ability in breeding
programs might have contributed to increasing the genetic
similarity (Park et al 1990).
References
Anderson JA, Churchill GA, Autrique JE, Tanksley SD, Sorrells ME.
1993. Optimizing parental selection for genetic linkage maps.
Genome 36:181-186.
Causse MA, Fulton TM, Cho YG, Ahn SN, Chunwongse J, Wu KS,
Xiao JH, Yu ZH, Ronald PC, Harrington SE, Second G,
McCouch SR, Tanksley SD. 1994. Saturated molecular map
of the rice genome based on an intraspecific backcross population.
Genetics 138:1251-1274.
Kim KH, Cho SY, Moon HP, Choi HC. 1994. Breeding strategy for
improvement and diversification of grain quality in rice. Korean
J. Breed. (suppl. 2):3-19.
Nei M. 1987. Molecular evolutionary genetics. Columbia, New York
(USA): Columbia University Press.
Panaud O, Chen X, McCouch SR. 1996. Development of
microsatellite markers and chracterization of simple sequence
length polymorphism (SSLP) in rice (Oryza sativa L.). Mol.
Gen. Genet. 252:597-607.
Park RK, Cho SY, Moon HP, Choi HC, Park NK, Choi YK. 1990.
Rice varietal improvement in Korea. Suwon (Korea): Rural
Development Administration.
Notes
Authors’ addresses: S.J. Kwon, C.I. Yang, H.C. Hong, Y.K. Kim,
J.P. Suh, H.G. Hwang, and H.C. Choi, National Crop Experiment
Station, RDA, Suwon 441-100; S.N. Ahn, Department
of Agronomy, Chungnam National University, Taejon 305-
764; H.P. Moon, National Yeongnam Agricultural Experiment
Station, RDA, Milyang 627-130, Korea. E-mail:
sjkwon@nces.go.kr.
Genetic diversity based on isozyme pattern
of rice germplasm in China
S.X. Tang, Y.Z. Jiang, X.H. Wei, D.S. Brar, and G.S. Khush
Genetic diversity was studied in 4,408 cultivars of core germplasm selected from 56,220 Chinese rice accessions on the basis
of 12 isozyme loci, Pgi-1, Pgi-2, Amp-1, Amp-2, Amp-3, Amp-4, Sdh-1, Adh-1, Est-1, Est-2, Est-5, and Est-9, analyzed
through starch gel electrophoresis. Among the materials examined, 431 different genotypes were detected; genotypic diversity
was 3.845. The average gene diversity index in all tested loci was 0.248. Based on isozyme allele pattern, there was clear
concordance to identify materials as indica (Hsien), japonica (Keng), and intermediate groups, with the ratios of 68.7%,
30.3%, and 0.98%, respectively. These figures matched well with 67.0% indica and 32.1% japonica based on the classification
of morphological characters. The average genetic diversity of indica rice was 0.193, which was much higher than that of
japonica (0.092). Amp-2 had the highest coefficient of genetic differentiation (Gst = 0.847) between indica and japonica,
followed by Pgi-1, Pgi-2, and Est-2. It was found that in six rice ecoregions in China, the cultivars in the southwest ecoregion
had the highest average genetic diversity (Ht = 0.266), followed by the south and central ecoregions. A new allele was
identified in only four indica cultivars (Makezhan, Jibianzi, Changmaodao, and Jiefan 16) out of the 4,408 genotypes analyzed.
This was designated Pgi-1 5 .
Core germplasm (core collection) is an important aspect in
expanding crop genetic resources. To fully understand the characters
of core germplasm representatives, it is necessary to
determine genetic variation in terms of morphological and biochemical
traits.
Rice is the most important crop in China. More than
70,000 rice accessions are stored in the China National Gene
Bank. Two distinct subspecies—indica (Hsien) and japonica
(Keng)—are well documented. Isozyme analysis provided a
valuable estimation of genetic variation and a classification of
188 Advances in rice genetics

ice germplasm (Fu and Pai 1979, Second 1982, Glaszmann
1987). But geographic distribution and genetic diversity based
on isozyme pattern have not been fully analyzed among Chinese
rice genetic resources. China is setting up rice core
germplasm using many methods, including cluster analysis and
random selection. Our study aimed to understand the geographic
distribution of isozyme variation and genetic diversity
in rice germplasm in China. This will help us set up core
germplasm for effective use in rice breeding, aside from understanding
the origin of rice.
Materials and methods
From a total of 56,220 accessions of Chinese rice germplasm,
4,408 cultivars of the primary core collection, including traditional
landraces, modern varieties, and hybrid rice (A, B, and
R lines), were planted in the experimental fields of the China
National Rice Research Institute (CNRRI), Hangzhou, China.
The harvested seeds of all 4,408 cultivars were analyzed for
isozyme pattern at the IRRI isozyme laboratory.
The seeds were germinated in plastic dishes at ambient
temperature under natural light. Crude extracts of water-soluble
proteins were prepared from the plumule and coleoptile of the
seedlings 4–6 d after germination by homogenization in a small
amount of distilled water. Imbibed filter paper wicks were then
inserted into the starch gel and subjected to starch gel electrophoresis
at 2 °C. Each gel accommodated 30 samples, together
with IR36 (indica) and Azucena (japonica). In buffer system I
with pH 8, the five enzymes assayed were phosphoglucose
isomerase (Pgi-1, Pgi-2), aminopeptidase (Amp-1, Amp-2,
Amp-3, and Amp-4), shikimate dehydrogenase (Sdh-1), alcohol
dehydrogenase (Adh-1), and esterase (Est-1, Est-2, Est-5,
and Est-9), following procedures described by Glaszmann
(1988).
Nei’s (1975) gene diversity (H) and average gene diversity
indices (Ht) were used as a measurement of isozyme variation.
Results and discussion
Allelic variation
The five enzymes allowed the detection of 52 alleles at 12
polymorphic loci (Pgi-1, Pgi-2, Amp-1, Amp-2, Amp-3, Amp-
4, Sdh-1, Adh-1, Est-1, Est-2, Est-5, and Est-9) among the 4,408
assayed cultivars. The number of alleles per locus ranged from
2 to 7, with an average of 4.3 (Table 1). H varied from 0.012
for Amp-4 to 0.547 for Est-2. Ht was 0.248. Five loci—Est-2,
Pgi-1, Pgi-2, Amp-2, and Sdh-1—had higher values of H
(H>0.250). Two other loci, Amp-4 and Est-5, showed lower
indices (H30%), while
Amp-4 had the lowest (DP = 0.5%).
Table 1. Enzyme loci identified with polymorphism indices in 4,408
cultivars in China.
Enzyme Locus No. of H a % DP b
alleles
Phosphoglucose isomerase Pgi-1 5 c 0.484 40.3
Pgi-2 4 0.452 34.4
Aminopeptidase Amp-1 7 0.162 8.6
Amp-2 4 0.437 30.8
Amp-3 7 0.138 6.9
Amp-4 4 0.012 0.5
Shikimate dehydrogenase Sdh-1 5 0.266 15.5
Alcohol dehydrogenase Adh-1 4 0.149 7.9
Esterase Est-1 2 0.132 7.1
Est-2 4 0.547 49.6
Est-5 3 0.064 3.2
Est-9 3 0.132 7.1
Av 4.3 0.248 17.7
a H = genetic diversity for each isozyme locus. b DP = degree of polymorphism for
each enzyme. c Including null allele.
Among the 4,408 genotypes examined, 431 different
genotypes were detected on the basis of 54 isozyme alleles.
Genotypic diversity was 3.845.
Isozyme diversity in indica and japonica subspecies
Based on isozyme patterns as described by Glaszmann (1987,
1988), the cultivars were divided into two major groups: indica
(Hsien, 3,028 cultivars) and japonica (Keng, 1,337 cultivars)
as well as intermediate (43 cultivars). Indica, japonica,
and intermediate accounted for 68.69%, 30.33%, and 0.98%,
respectively. This matched well with 66.97% indica and
32.06% japonica based on the classification of morphological
characters. In terms of distribution of allele frequency, 0.861
of Pgi-1 1 was in indica, but 0.997 of Pgi-1 2 was in japonica.
Similar observations were obtained from Amp-2 and Est-2:
0.996 of Amp-2 2 and 0.689 of Est-2 2 were in indica, but 0.993
of Amp-2 1 and 0.890 of Est-2 null were in japonica (Table 2). In
contrast, the average gene diversity for indica was 0.193, which
was much higher than that of japonica (0.092). Higher genetic
diversity for an individual locus existed for Pgi-2 (0.501), Est-
2 (0.450), Sdh-1 (0.334), and Pgi-1 (0.239) in indica, while it
was 0.208 for Amp-1 and 0.202 for Est-2 in japonica.
The average coefficient of genetic differentiation (Gst)
between indica and japonica for 12 isozyme loci was 0.281.
The highest Gst was found for locus Amp-2 (0.847), followed
by Pgi-1 (0.745), Pgi-2 (0.437), and Est-2 (0.404). This revealed
a high level of genetic differentiation between indica
and japonica for these four isozyme loci. Very low genetic
differentiation (Gst

Table 2. Genetic diversity in isozyme patterns and genetic differentiation
in indica and japonica subspecies.
Isozyme Allele Indica Japonica Total Gst b
Pgi-1 1 0.861 0.003 0.598
2 0.139 0.997 0.402 0.745
H 0.239 0.006 0.481
Pgi-2 1 0.507 0.996 0.656
2 0.492 0.004 0.343 0.437
3 0.001 0 0.001
H 0.501 0.008 0.452
Amp-1 1 0.933 0.883 0.917
2 0.001 0 0.001
3 0 0.113 0.035
4 0.058 0.001 0.040 0.071
5 0.008 0 0.006
6 0 0.003 0.001
H 0.126 0.208 0.156
Amp-2 1 0.001 0.933 0.286
2 0.996 0.007 0.693
3 0.003 0.059 0.020 0.847
4 0 0.001 0.001
H 0.008 0.126 0.438
Amp-3 0 0.001 0.006 0.002
1 0.923 0.957 0.933
2 0.061 0.035 0.052
3 0.014 0 0.010 0.113
4 0 0.001 0.001
5 0.001 0 0.001
6 0 0.001 0.001
H 0.144 0.083 0.128
Amp-4 0 0 0.001 0.001
1 0.998 0.991 0.995
2 0.001 0.005 0.002 0.100
4 0.001 0.003 0.002
H 0.004 0.018 0.010
Sdh-1 0 0.001 0.001 0.001
1 0.193 0.017 0.139
2 0.793 0.964 0.845 0.243
3 0.012 0.017 0.014
4 0.001 0.001 0.001
H 0.334 0.070 0.267
Adh-1 0 0.048 0.029 0.042
1 0.925 0.915 0.922
2 0.006 0.055 0.021 0.017
3 0.021 0.001 0.015
H 0.142 0.159 0.148
Est-1 0 0.076 0.058 0.071
1 0.924 0.942 0.929 0.053
H 0.141 0.109 0.132
Est-2 0 0.244 0.890 0.442
1 0.057 0.041 0.052
2 0.698 0.069 0.505 0.404
3 0.001 0 0.001
H 0.450 0.202 0.547
Est-5 0 0.025 0.048 0.032
1 0.974 0.952 0.967 0.109
2 0.001 0 0.001
H 0.051 0.091 0.064
Est-9 0 0.002 0.001 0.002
1 0.094 0.010 0.068 0.252
2 0.904 0.989 0.930
H 0.174 0.022 0.131
Total Ht a 0.193 0.092 0.246 0.283
tral China double- and single-rice (indica and japonica) region,
Region III is the southwest plateau region of single and
double rice (indica and japonica), Region IV is the North China
single-rice (japonica) region, Region V is the northeast China
early maturing and single-rice (japonica) region, and Region
VI is the northwest China single-rice (japonica) dry region.
More than 80% of the rice area and the germplasm collection
is located in ecoregions I, II, and III.
Table 3 shows the geographic distribution of 54 alleles
and the H values of 12 isozyme loci in six rice ecoregions,
revealing similarities in genetic diversity based on isozyme
and morphological characters. Region III had the highest average
genetic diversity (Ht = 0.266), with 3.50 alleles per locus,
which matched well with the highest morphological diversity
reported by many researchers (Huang et al 1996). Regions
I and II, major rice areas in China, had a higher genetic
diversity (Ht = 0.226 for both), with average alleles numbering
3.42 and 3.75 per locus, respectively. Region V had the
lowest average genetic diversity (Ht = 0.057), with the smallest
allele number of 2.08 per locus. This rice region is in the
high latitude (40–52°N), with only early maturing japonica
rice varieties.
A new allele, Pgi-1 5
A new allele, for Pgi-1, located on chromosome 4 and which
had not been reported before, was identified from four Chinese
indica cultivars (Makezhan, Jibianzi, Changmaodao, and
Jiefan 16) (0.088%) among the 4,408 cultivars. This new allele
was tentatively designated as Pgi-1 5 .
In the 1970s-’80s, some researchers identified Yunnan
as the origin of Chinese cultivated rice. One of the reasons
was the existence of a rich morphological variation in Yunnan
landraces caused by the variable eco-environment in the Yunnan
Plateau. However, some reports (Huang et al 1996) argued
that the great morphological diversity of Yunnan rice was the
result of a migration of germplasm from some border countries
(Myanmar, Vietnam, and Lao PDR). These reports said
that central China (more exactly, the area from the middle basin
of the Yangtze River up to the basin of the Huai River)
could be the origin of cultivated rice in China. Although our
study revealed that cultivated rice in Region III (especially in
Yunnan) had the highest gene diversity index in terms of
isozyme level, the average number of alleles in 12 isozyme
loci in Region III was 3.5, less than that of Region II (3.75). In
contrast, cultivars in Region II had the alleles of Pgi-1 3 , Amp-
1 null , Amp-1 6 , Amp-3 null , Amp-3 4 , Sdh-1 null t, and Est-9 null . The
tested cultivars in Region III did not have these alleles. This
result supports the hypothesis that Chinese cultivated rice originated
independently from central China.
It is not clear what caused differentiation at the isozyme
level (Li and Rutger 2000). But the distinct multilocus phenotypes
may be evidence of Chinese Hsien (indica) and Keng
(japonica) subspecies being domesticated in parallel.
a Ht = average genetic diversity for all isozyme loci. b Gst = coefficient of genetic
differentiation between indica and japonica.
190 Advances in rice genetics

Table 3. Genetic diversity for 12 isozyme loci in six rice ecoregions a in China.
Isozyme
Alleles
Ecoregion a
I II III IV V VI
Pgi-1 No. 3 3 3 3 1 2
H 0.454 0.452 0.499 0.515 0 0.364
Pgi-2 No. 3 3 3 2 3 2
H 0.496 0.455 0.313 0.214 0.066 0.232
Amp-1 No. 5 7 5 4 3 3
H 0.125 0.115 0.278 0.189 0.038 0.072
Amp-2 No. 3 3 4 2 3 3
H 0.268 0.400 0.509 0.348 0.130 0.418
Amp-3 No. 5 7 5 3 3 3
H 0.118 0.122 0.171 0.129 0.066 0.030
Amp-4 No. 2 4 4 3 2 2
H 0.002 0.010 0.014 0.035 0.033 0.014
Sdh-1 No. 5 4 4 3 1 3
H 0.352 0.286 0.153 0.146 0 0.180
Adh-1 No. 4 4 4 4 3 4
H 0.064 0.138 0.249 0.167 0.130 0.074
Est-1 No. 2 2 2 2 2 2
H 0.099 0.095 0.232 0.139 0.033 0.099
Est-2 No. 3 3 4 3 2 3
H 0.448 0.521 0.504 0.512 0.185 0.342
Est-5 No. 3 2 2 2 1 2
H 0.039 0.043 0.135 0.028 0 0.030
Est-9 No. 3 3 2 2 1 2
H 0.249 0.077 0.132 0.014 0 0.043
Average No. 3.42 3.75 3.50 2.75 2.08 2.58
H 0.226 0.226 0.266 0.203 0.057 0.158
a Rice ecoregions: I = South China, II = central China, III = southwest China, IV = North China, V =
northeast China, VI = northwest China.
References
Fu PY, Pai C. 1979. Genetic studies on isozymes in rice plant. II.
Classification and geographical distribution of cultivated rice
through isozyme studies. J. Agric. Assoc. China 107:1-6. (In
Chinese.)
Glaszmann JC. 1987. Isozymes and classification of Asian rice varieties.
Theor. Appl. Genet. 74:21-30.
Glaszmann JC. 1988. Geographic pattern of variation among Asian
native rice cultivars (Oryza sativa L.) based on 15 isozyme
loci. Genome 30:782-792.
Huang YH, Sun XL, Wang XK. 1996. Study on the center of genetic
diversity of Chinese cultivated rice. In: Wang XK, Sun XL,
editors. Origin and differentiation of Chinese cultivated rices.
China Agric. Univ. Press, Beijing. p 85-91. (In Chinese.)
Li ZK, Rutger JN. 2000. Geographic distribution and multilocus
organization of isozyme variation of rice (Oryza sativa L.).
Theor. Appl. Genet. 101:379-387.
Nei M. 1975. Molecular population genetics and evolution. New
York: Elsevier Sciences Publishing Co.
Second G. 1982. Origin of the genetic diversity of cultivated rice
(Oryza spp.): study on the polymorphism scored at 40 isozyme
loci. Jpn. J. Genet. 57:25-57.
Notes
Authors’ addresses: S.X. Tang, D.S. Brar, and G.S. Khush, International
Rice Research Institute, DAPO Box 7777, Metro Manila,
Philippines; Y.C. Jiang and X.H. Wei, China National
Rice Research Institute, Hangzhou 310006, China.
Acknowledgment: We are grateful to Ms. Ruth E. McNally for her
valuable help in isozyme analysis. This research was supported
by IRRI and Project 973 in China.
Genetic diversity, evolution, and alien introgression 191

Differential patterns of isozyme loci of Adh and Ldh between
upland and lowland rice varieties
L.J. Chen, D.S. Lee, and H.S. Suh
Ninety-eight rice genotypes of diverse origins were assayed for alcohol dehydrogenase (Adh) and lactate dehydrogenase (Ldh)
isozyme loci using starch-gel electrophoresis. Four alleles including null were detected in Adh1 as well as in Ldh1. The genetic
polymorphism revealed by Adh1 and Ldh1 for all study materials exhibited the same patterns. Polymorphisms for alleles 1 and
2 of Adh1 and Ldh1 were observed within the upland rice group, but not in lowland rice, including Oryza rufipogon and O.
barthii. Only upland rice genotypes possessed allele 2 of Adh1 and Ldh1. Some desirable traits of upland rice may be
associated with allele 2 of Adh1 and Ldh1 loci. Moreover, Adh and Ldh are believed to be associated with drought and coldstress
tolerance, and their isozyme variability in upland rice may also reflect agronomic and evolutionary significance in upland
rice.
Rice varieties are usually classified into indica and japonica
types based on various morphological characters and isozyme
polymorphism. Furthermore, they are classified into lowland
and upland varieties based on their cultivation habits and some
contrasting morphological characteristics. Although upland rice
is normally considered to be an ecotype rather than a subspecies
(Morinaga 1968, Cheng 1987, Glaszmann 1988), it is
believed to play an important role in indica-japonica differentiation.
Cheng (1987) presumed that hsien (indica) rice or Oryza
rufipogon differentiated into upland rice, which differentiated
into keng (japonica) rice in Yunnan, China. Thus, the genetic
analysis of upland landraces compared with lowland rice is
important for understanding the domestication of cultivated
rice and for searching for beneficial genes in upland rice.
Isozyme polymorphism in rice is increasingly used in
varietal classification. However, differences between upland
and lowland rice at particular isozyme loci had not gained much
attention in previous reports (Sun et al 1994, Nagamine et al
1992). Alcohol dehydrogenase (Adh) is an essential enzyme
in anaerobic metabolism, associated with drought stress and
cold stress in both maize and Arabidopsis (Dolferus et al 1994).
Lactate dehydrogenase (Ldh) is also associated with anaerobic
stress (Li et al 1993). Because of their physiological and
evolutionary significance, Adh and Ldh genes have been
cloned, sequenced, and mapped in rice (Li et al 1994, Ge et al
1999).
This study was conducted to determine genetic variability
in Adh and Ldh isozymes in upland landraces and compare
them with lowland varieties, and to understand the significance
of upland rice in the domestication and differentiation of cultivated
rice.
Materials and methods
A total of 98 rice genotypes composed of cultivated, weedy,
and wild rice species from all over the world were studied. Of
these, O. sativa accounted for 25 upland landraces and 36 lowland
cultivated and weedy strains, including indica and japonica
types collected from Asia and America; O. rufipogon comprised
35 strains, including perennial and annual types collected
from China; and O. barthii contained 2 strains originating
from Africa.
Adh and Ldh loci were assayed by starch-gel (system H,
Tris-citric, pH 7.6) methods (Glaszmann et al 1988). The staining
bands of Adh were examined using the systems suggested
by Morishima and Glaszmann (1990). The gel staining of Ldh
was performed using the procedure described by Chen et al
(2000). The numeral nomenclature systems (Morishima and
Glaszmann 1986) were employed for designating the alleles
of Ldh.
The genetic diversity of each locus (Div.) was calculated
by the following formula: Div. = 1– Σx ij2 , where x ij indicates
the frequency of the ith allele at the locus j (Ishikawa et al
1992).
Results and discussion
Isozyme allele detection
Among the strains investigated, four alleles, including a null,
were detected in isozyme locus Adh1 (Fig. 1). Likewise, in
Ldh, four distinct patterns, including a null, were observed,
suggesting that the locus of Ldh has four alleles corresponding
to medium-, slow-, and fast-moving bands, and a null (Fig.
2). The four alleles of Ldh were named Ldh1-1, Ldh1-2, Ldh1-
3, and Ldh1-0 according to the suggestion of Morishima and
Glaszmann (1986).
Adh and Ldh variability and its significance
in upland rice
The polymorphism revealed by Adh and Ldh in all test materials
exhibited the same patterns shown in Table 1. Only one
cultivated strain, Basmati 385 from Pakistan, possessed the
allele Ldh1-3, and only the Chinese weedy strain Lu-tao possessed
the null allele, Ldh1-0.
Generally, polymorphisms for three alleles of Adh1
(Adh1-1, Adh1-2, and Adh1-3) and Ldh1 (Ldh1-1, Ldh1-2, and
Ldh1-3) were not detected within lowland rice, including O.
sativa, O. rufipogon, and O. barthii, suggesting that there might
192 Advances in rice genetics

e no indica-japonica differentiation at the Adh1 locus in lowland
rice as well as in O. rufipogon. In contrast, polymorphisms
for three alleles of Adh (Adh1-1, Adh1-2, and Adh1-3) and
Ldh (Ldh1-1, Ldh1-2, and Ldh1-3) were observed within the
upland rice group, implying that upland rice may have special
physiological pathways to adapt to diverse environments. Additionally,
only upland rice strains possessed the allele of Adh1-
2 and Ldh1-2; hence, some desirable traits of upland rice are
probably associated with isozyme markers of Adh1-2 and Ldh1-
2.
In previous reports, Adh1-2 was found to be very rare in
Asian rice, accounting for 4% of the total of 1,688 strains investigated
(Glaszmann 1988), and absent in Japanese lowland
– 1 5 10 15 20 25 30 –
Adh1
+ +
Fig. 1. Starch-gel zymogram of alcohol dehydrogenase (Adh1). Adh1
has four alleles: Adh1-1, medium-moving band (lane 25); Adh1-2,
slow-moving band (lane 20); Adh1-3, fast-moving band (lane 29);
Adh1-0, null (lane 3). Lanes 1–30: T65 (japonica), IR36 (indica),
Lu-tao (weedy), Heidiaogu (weedy), Salshare (weedy), TKM5
(weedy), Xilaoshuya (indica), Heizhaogu (japonica), Wuzuigu (upland),
ZK8 (upland), Baichangmaogu (upland), Zhaoheigu (upland),
Dalaoyalin (upland), Luzigu (upland), Erbaigu (indica),
Lengshuibaigu (japonica), Laoyalin (japonica), Baichangmao (upland),
Erlaiding (upland), Gangzhagu (upland), Hongmaoying
(japonica), Ch54-14 (weedy), Bhadui (weedy), Chiem Do (weedy),
W1714 (weedy), US2 (weedy), Bailiandogu (upland), Heigu (indica),
Basmati 385 (indica), and Mongengshare (weedy).
– 1 5 10 15 20 25 30 –
Ldh1
+ +
Fig. 2. Starch-gel zymogram and interpretation of lactate dehydrogenase
(Ldh1). Ldh1 has four alleles: Ldh1-1, medium-moving
band (lane 25); Ldh1-2, slow-moving band (lane 20); Ldh1-3, fastmoving
band (lane 29); Ldh1-0, null (lane 3). Lanes 1–30 (see
legend of Fig. 1).
and upland rice (Ishikawa et al 1992) as well as in Madagascar
rice (Ahmadi et al 1991). However, it is not surprising to
find a peculiar allele 2 at locus Adh and Ldh in a Yunnan indigenous
upland landrace, since Yunnan is recognized as one
of the centers of genetic diversity of Asian cultivated rice (Sun
et al 1994). This study will complement other early works on
Yunnan indigenous rice (Nagamine et al 1992, Sun et al 1994).
Moreover, Adh and Ldh are believed to be associated with
drought, cold, and anaerobic stress tolerance. Isozyme variability
in upland rice accordingly may also reflect the agronomic
and evolutionary significance of domestication and differentiation
of cultivated rice in upland rice. Further research
is needed to understand this.
References
Ahmadi N, Glaszmann JC, Rabary E. 1991. Traditional highland
rices originating from intersubspecific recombination in Madagascar.
In: Rice genetics II. Los Baños (Philippines): International
Rice Research Institute. p 67-79.
Chen LJ, Lee DS, Suh HS. 2000. Identification of Ldh isozyme locus
in rice (O. sativa complex). Kor. J. Breed. 32 (supp1.1):62-
63.
Cheng KS. 1987. Identification of hsien, keng, and upland rice. In:
Mimeogr. paper. Kunming (China): Yunnan Academy of Agricultural
Sciences.
Dolferus R, deBruxelles G, Dennis ES, Peacock WJ. 1994. Regulation
of the Arabidopsis Adh-gene by anaerobic and other environmental
stresses. Ann. Bot. (London) 74:301-308.
Ge S, Sang T, Lu BR, Hong DY. 1999. Phylogeny of rice genomes
with emphasis on origins of allotetraploid species. Proc. Natl.
Acad. Sci. USA 96(25):14400-14405.
Glaszmann JC. 1988. Geographical pattern of variation among Asian
native rice cultivars (O. sativa L.) based on fifteen isozyme
loci. Genome 30:782-792.
Glaszmann JC, De los Reyes BG, Khush GS. 1988. Electrophoretic
variation of isozymes in plumules of rice (Oryza sativa L.)—
a key to the identification of 76 alleles at 24 loci. IRRI Res.
Paper Series. No. 134. 14 p.
Ishikawa R, Maeda K, Harada T, Niizeki M, Saito K. 1992. Genotypic
variation for 17 isozyme genes among Japanese upland
varieties in rice. Jpn. J. Breed. 42:737-746.
Li T, Takano T, Matsumura H, Takeda G. 1993. Anaerobic expression
and structural analysis of rice lactate dehydrogenase gene.
Proceedings of 7th International Congress of SABRAO.
Table 1. Polymorphisms for four alleles of Adh1 and Ldh1 loci in the Oryza sativa complex.
Strains Origin Frequency of Adh1 and Ldh1 alleles Gene
Taxon (no.) diversity
Null Allele 1 Allele 2 Allele 3
Oryza sativa
Upland rice 25 Asia 0 0.64 0.36 0 0.461
16 Yunnan, China 0 0.44 0.56 0 0.493
9 Japan, Philippines 0 1.00 0 0 0
Lowland rice 36 Asia, America 0.03 0.94 0 0.03 0.115
O. rufipogon 35 China 0 1.00 0 0 0
O. barthii 2 Africa 0 1.00 0 0 0
Genetic diversity, evolution, and alien introgression 193

Changhua (Taiwan): Taichung District Agricultural Improvement
Station and SABRAO.
Li T, Takano T, Nagamura Y, Takeda G. 1994. Linkage analysis of
rice lactate dehydrogenase gene. Rice Genet. Newsl. 11:109-
111.
Morinaga T. 1968. Origin and geographical distribution of Japanese
rice. Jpn. Agric. Res. Q. 3(2):1-5.
Morishima H, Glaszmann JC. 1986. Gene symbols for isozymes.
Rice Genet. Newsl. 3:15-17.
Morishima H, Glaszmann JC. 1990. Current status of isozyme gene
symbols. Rice Genet. Newsl. 7:50-57.
Nagamine T, Xiong JH, Xiao Q. 1992. Genetic variation in several
isozymes of indigenous rice varieties in Yunnan Province in
China. Jpn. J. Breed. 42:507-513.
Sun YL, Cai HW, Wang XK. 1994. Is Yunnan a rice diversity center
in isozyme variation Rice Genet. Newsl. 11:65.
Notes
Authors’ address: Laboratory of Plant Genetics and Breeding, Department
of Bio-Resources, College of Natural Resources,
Yeungnam University, Kyongsan 712-749, Republic of Korea,
fax: (053)816-2814, e-mail:chenlijuan@hotmail.com.
Genetic diversity in seed storage proteins of Bangladeshi
rice cultivars
M.S. Jahan, T. Kumamaru, H. Satoh, and A. Hamid
A total of 467 Bangladeshi rice cultivars were analyzed for endosperm storage protein glutelin and prolamin compared with
japonica and indica varieties Kinmaze and IR36. Screening was done by observing the profiles of sodium dodecyl sulfatepolyacrylamide
gel electrophoresis (SDS-PAGE) on a single-seed basis. A wide variation, in both banding pattern and staining
intensity of polypeptide bands, was observed for glutelin and prolamin seed storage proteins. In the glutelin acidic subunit,
seven different types were found based on apparent molecular size and staining intensity of three major polypeptide bands (α-
1, α-2, and α-3), whereas two kinds of variation were identified at the a-4 level depending mainly on molecular size. A great
variation was also detected in the case of prolamin and the varieties were divided into nine arbitrary groups.
Rice constitutes 95% of the cereals consumed in Bangladesh
and supplies 68% of the calories and 54% of the protein in the
diet of the population. In Bangladesh, rice research mainly
focused on yield improvement and only limited information is
available on seed protein diversity. Bhowmik et al (1990) reported
that Bangladeshi rice cultivars had some diversity in
seed storage proteins and recommended some lines for improving
grain quality. Our study determined the diversity in
seed storage protein in Bangladeshi rice cultivars and established
a basis for genetic improvement.
Characterizing rice cultivars by SDS-PAGE
Four hundred and sixty-seven Bangladeshi rice cultivars preserved
in the Laboratory of Plant Genetic Resources, Kyushu
University, Japan, were used for analyzing storage proteins in
the seed grain. The extracted proteins were separated by sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-
PAGE) on a single-seed basis. Rice glutelin is composed of a
and b subunits, which were separated into α-1, α-2, α-3, and
α-4 and β-1, β-2, and β-3. The α-3 band of japonica rice cultivar
Kinmaze was smaller in molecular size than that of indica
rice cultivar IR36, whereas the α-4 band of Kinmaze was
larger than that of IR36 (Uemura et al 1996). Based on mobility
and staining intensity of α-1, α-2, and α-3 bands, the cultivars
were arbitrarily classified into seven types compared with
Kinmaze and IR36 (Fig. 1). They were characterized as follows:
type 1: α-3 fast-migration type (α-3F); type 2: α-3 highintensity
type (α-3H); type 3: α-3 two-band type, each with
slow and fast migration (α-3SF); type 4: α-2 low intensity with
α-3 two-band type (α-2L/α-3SF); type 5: α-2 and α-3 lowintensity
type (α-2L/α-3L); type 6: α-1 high intensity with α-
2 low-intensity type (α-1H/α-2L); and type 7: α-3 slow-migration
type (α-3S). The number of varieties in each type was
82, 28, 4, 1, 1, 3, and 348, respectively. In Bangladesh, rice is
grown in three seasons, aus (summer), aman (autumn), and
boro (winter), and each season has one or more ecotypes. For
all seasons, a majority of the varieties are placed in type 7.
Two types of variation were detected in α-4 level depending
on the migration (Fig. 2), indicated as α-4 slow-migration
type (α-4S) and α-4 fast-migration type (α-4F). Their
representation in the total germplasm was 15% and 85%, respectively;
the former was restricted to aman rice only.
The standard variety Kinmaze had two major prolamin
bands, 13a and 13b (Kumamaru et al 1988). Minakuchi et al
(1994) called the extra band between 13a and 13b “13c.” Compared
with the standard varieties, nine tentative types were
detected in Bangladeshi rice varieties (Fig. 3). The first type
was characterized by the same intensity of 13a and 13b, whereas
the high intensity of 13b (13b-H) was identified in type 2. Lowintensity
13b (13b-L) was found in type 3, but was absent in
type 4. The fifth type had 13c with the absence of 13b. Types
6 and 7 contained 13c; the intensity of 13c was the same as
13b in type 7, but was thinner than 13a and 13b in type 6. Type
194 Advances in rice genetics

K 1 2 3 4 5 6 7 I
a b c d
kDa
57
40
26
20
16
13
α-1
α-2
α-3
α-4
13a
13b
kDa
57
40
26
20
α-1
α-2
α-3
α-4
Fig. 1. Variations for glutelin α subunit in Bangladeshi rice cultivars.
K = Kinmaze, 1 = type 1, 2 = type 2, 3 = type 3, 4 = type
4, 5 = type 5, 6 = type 6, 7 = type 7, I = IR36.
16
13
13a
13b
8 had an extra band with a higher molecular size than 13a,
including 13b-H/13a-L. The ninth type showed 13b and 13c
and the extra band was the same as that of type 8. The number
of varieties in each type was 209, 39, 111, 7, 53, 20, 15, 8, and
5, respectively. In all seasons, type 1 showed the highest frequency,
followed by type 2.
Wide variation was observed in the polypeptide bands
of storage proteins of Bangladeshi rice cultivars. Bhowmik et
al (1990) showed six types of variation in Bangladeshi rice
varieties considering glutelin and prolamin together. Satoh et
al (1990a,b) also reported SDS-PAGE variation in seed storage
proteins of African cultivated rice. Kumamaru et al (1988)
reported four types of mutants for storage protein of rice endosperm,
and described the mutants as possible breeding material
for rice improvement and for genetic and biochemical
studies of rice protein. The variations recorded in SDS-PAGE
analysis may be useful for further genetic and biochemical
analysis and improvement of rice protein, although the details
are still under investigation.
References
Bhowmik A, Omura T, Kumamaru T. 1990. Screening of rice varieties
for endosperm storage proteins. Plant Breed. 105:101-105.
Kumamaru T, Satoh H, Iwata N, Omura T, Ogawa M, Tanaka K.
1988. Mutants of rice storage proteins. 1. Screening of mutants
for rice storage proteins of protein bodies in the starchy
endosperm. Theor. Appl. Genet. 76:11-16.
Minakuchi S, Satoh H, Konishi T. 1994. Polymorphism of prolamin
polypeptides in rice cultivars from Bangladesh, Nepal and
Bhutan, a preliminary study. Rice Genet. Newsl. 11:175-176.
Satoh H, Ronald RX, Katayama TC. 1990a. SDS-PAGE analysis of
storage proteins of cultivated rice collected in Madagascar,
1988. Kagoshima University Research Center for the South
Pacific, Occasional papers no. 18:101-113.
Satoh H, Ching‘ang‘a HM, Ilaila D, Katayama TC. 1990b. SDS-
PAGE analysis of storage proteins of cultivated rice collected
in Tanzania, 1988. Kagoshima University Research Center for
the South Pacific, Occasional papers no. 18:114-126.
kDa
57
40
26
20
16
13
Fig. 3. Variations for prolamin in Bangladeshi rice cultivars. K =
Kinmaze, 1 = type 1, 2 = type 2, 3 = type 3, 4 = type 4, 5 = type
5, 6 = type 6, 7 = type 7, 8 = type 8, 9 = type 9, I = IR36.
Uemura YJ, Satoh H, Ogawa M, Suehisa H, Katayama TC, Yoshimura
A. 1996. Chromosomal location of genes encoding glutelin
polypeptides in rice. In: Khush GS, editor. Rice genetics III.
Proceedings of the Third International Rice Genetics Symposium,
16-20 Oct. 1995, Los Baños, Philippines. Manila (Philippines):
International Rice Research Institute. p 471-476.
Notes
Fig. 2. Variations for glutelin α-4 band in
Bangladeshi rice varieties. a = Kinmaze, b
= α-4 slow-migration type, c = α-4 fast-migration
type, d = IR36.
K 1 2 3 4 5 6 7 8 9 I
13a
13b
Authors’ addresses: M.S. Jahan, T. Kumamaru, H. Satoh, Laboratory
of Plant Genetic Resources, Faculty of Agriculture,
Kyushu University, Hakozaki, Fukuoka 812, Japan; A. Hamid,
Department of Agronomy, Bangabandhu Sheikh Mujibur
Rahman Agricultural University, Salna, Gazipur 1703,
Bangladesh.
Genetic diversity, evolution, and alien introgression 195

Genetic variation in storage protein and storage endosperm
starch in local rice cultivars of Myanmar
P.P. Aung, T. Kumamaru, and H. Satoh
Electrophoretically detected variation in seed storage protein (glutelin, prolamin) and waxy protein was analyzed among 150
local rice cultivars collected from six distinct regions of Myanmar. The variation in storage endosperm starch was found by the
alkali digestibility test. Variation in seed storage protein and endosperm starch led to the characterization of two varietal types
for glutelin, five varietal types for prolamin, and three varietal types for waxy protein and alkali digestibility score. The protein
profiles and alkali spreading score were compared with those of standard varieties, using Kinmaze and IR36 as controls.
Seventy-nine percent of the local rice cultivars in Myanmar belonged to the IR36-type group and 0.7% of the cultivars were of
the Kinmaze type. Four other types were differentiated by isoelectric focusing analysis from both Kinmaze and IR36 types.
Genetic variation in seed storage protein and storage endosperm
starch is important in genetic and breeding research. Protein is
important for people whose main staple food is rice. Endosperm
starch is one of the characters that determine cooking quality.
Bhowmik et al (1990) reported genetic variation in seed storage
protein of rice collected from Bangladesh. Genetic variation
in seed storage protein and endosperm starch among local
rice cultivars of Myanmar has not been studied. We therefore
investigated the genetic variation in these traits to improve rice
quality through breeding.
Materials and methods
One hundred and fifty local rice cultivars were collected from
six distinct regions in Myanmar: 79 from the delta area, 27
from the central dry zone, 22 from the northern mountain region,
19 from the coastal strip of Yakhine State and Thaninthayi
Division, 2 from the eastern mountain region, and 1 from the
western mountain region. The total storage protein of rice endosperm
was analyzed by sodium dodecyl sulfate–polyacrylamide
gel electrophoresis (SDS-PAGE). The glutelin extracted
from developing seeds was analyzed by isoelectric focusing
(IEF). Rice cultivars Kinmaze (japonica) and IR36 (indica)
were used as controls.
The starch characteristic was estimated by alkali digestibility
score, which is also a good indicator of cooking quality
because of its close linkage with the gelatinization temperature
of starch. The rice kernels were immersed in 1.7% KOH
for 24 h, and alkali spreading score was evaluated with a descriptive
scale (Little et al 1958).
Results and discussion
Glutelin consists of α and β subunits, which were separated
into α-1, α-2, α-3, α-4, and β-1, β-2, and β-3 (Uemura et al
1996). Two types of variation in the glutelin subunit were detected
in the rice cultivars (Fig. 1). Type A was characterized
by faster migration of the α-3 band compared with Kinmaze
and a wider gap between α-2 and α-3. Type B showed a slow
migration of α-3, similar to that of IR36, with respective frequencies
being 43% and 57%.
The banding patterns by SDS-PAGE analysis cannot fully
explain the prospects of gene coding for the glutelin molecule
because each SDS-PAGE band consists of more than two IEF
bands. IEF analysis showed that Kinmaze had up to 12 and 8
bands for glutelin α and β subunits, respectively (Fig. 2). The
variation in IEF banding patterns was compared with standard
varieties. In Figure 2, glutelin α-subunit bands were numbered
from 1 to 12 and β-subunit bands were labeled from A to I.
In Kinmaze, bands 1, 5, A, and B were present, but bands
3 and 6 were absent in comparison with IR36. Type A was
classified into two types (lane 1, 2). Type 1 was the same as in
Kinmaze (lane 1), and type 2 had an extra band in the acidic
position; the other bands were the same as in Kinmaze (lane
2). Type B was classified into four types—3, 4, 5, and 6. Type
3 was the same as in IR36 (lane 3). Type 4 showed bands 1
and 6, but bands 2, A, and B were not found (lane 4). In type 5,
bands 5 and 6 were present (lane 5). Type B cultivars were the
same as IR36; however, some variation was found in the site
of the glutelin β subunit. Bands A and B of the glutelin β subunit
were found in Kinmaze but not in IR36. However, these
bands were also found in type 6, and the other bands of type 6
were the same as in IR36 (lane 6). The frequency of types 1 to
6 were 0.7%, 0.7%, 79.0%, 0.6%, 2.0%, and 17.0% of total
cultivars, respectively. The results indicated that types 4, 5,
and 6 found in Myanmar cultivars (but different from Kinmaze
and IR36) may be recombinant between indica and japonica
types.
For prolamin, in terms of intensity of 13a and 13b in
SDS-PAGE profiles, there were five types: type A had high
intensity of both 13a and 13b bands, type B had high intensity
of only 13b, type C possessed only high intensity of 13a, type
D showed low intensity at both these bands, and type E had no
13b band. Their frequencies were 18%, 9%, 29%, 24%, and
20% of total cultivars, respectively.
196 Advances in rice genetics

kDa
60
57
Kinmaze 1 2 IR36
–
Kinmaze IR36 1 2 3 4 5 6
B
A
B
A
B
A
B
A
I
H
G
F
E
D
C
B
A
Glutelin
β subunit
40
20
13
α-1
α-2
α-3
α-4
β-1
β-2
β-3
Glutelin
α subunit
Glutelin
β subunit
13a
13b Prolamin
Fig. 1. Variation in glutelin subunits in Myanmar rice
cultivars by SDS-PAGE analysis. Lane 1 = type A, lane
2 = type B.
+
IEF
6
5
3
1
6 6
5
1
Fig. 2. Variation in glutelin detected by IEF analysis in Myanmar rice cultivars.
Lane 1 = type 1, lane 2 = type 2 (arrow indicates extra band in acidic position),
lane 3 = type 3, lane 4 = type 4, lane 5 = type 5, lane 6 = type 6. (Arrowhead
indicates specific band of Kinmaze and IR36.)
6
12
11
10
9
8
7
6
5
4
3
2
1
Glutelin
α subunit
Table 1. Variation in alkali spreading score of 150 Myanmar rice cultivars.
Alkali
digestibility
Variation in alkali digestibility score among varieties
collected from different regions b
score a WMR NMR EMR DA CSR CDZ Total
Low
1 0 5 1 23 1 4 34
2 0 4 0 14 4 5 27
3 0 3 1 18 5 6 33
Intermediate
4 0 5 0 16 4 5 30
5 0 4 0 4 3 4 15
6 1 1 0 3 1 2 8
High
7 0 0 0 1 1 1 3
8 0 0 0 0 0 0 0
9 0 0 0 0 0 0 0
a Score 1 to 3 (frequency 62.7%), score 4 to 6 (frequency 35.3%), score 7 to 9 (frequency 2.0%). b WMR
= western mountain region, NMR = northern mountain region, EMR = eastern mountain region, DA =
delta area, CSR = coastal strip region, CDZ = central dry zone.
Genetic variation in storage endosperm starch
Granule-bound starch synthase is known as waxy protein with
60 kDa. The enzyme is involved in amylose synthesis and waxy
protein is directly related to amylose content (Villareal and
Juliano 1989). The Myanmar cultivars were classified into three
expression types of 60-kDa protein based on their intensity—
high, low, and absent. The relative frequencies were 79%, 16%,
and 5%, respectively. Myanmar rice cultivars showed a high
intensity of 60 kDa, just like IR36.
The 94 Myanmar cultivars possessed low alkali digestibility
with scores from 1 to 3, whereas 53 cultivars showed
intermediate alkali digestibility with scores from 4 to 6. Three
cultivars had high alkali digestibility with scores from 7 to 9.
The Myanmar cultivars are generally more resistant and not
affected much by alkali compared with Kinmaze (Table 1).
The results showed Myanmar’s diverse rice genetic resources
for seed storage protein and endosperm starch. This
information will be valuable in rice breeding.
Genetic diversity, evolution, and alien introgression 197

References
Bhowmik A, Omura T, Kumamaru T. 1990. Screening of rice varieties
for endosperm storage protein. Plant Breed. 105:101-105.
Little RR, Hider BG, Dawson EH. 1958. Differential effect on dilute
alkali on 25 varieties of milled white rice. Cereal Chem.
35:111-126.
Uemura YJ, Satoh H, Ogawa M, Suehisa H, Katayama TC, Yoshimura
A. 1996. Chromosomal location of genes encoding glutelin
polypeptides in rice. In: Khush GS, editor. Rice genetics III.
Manila (Philippines): International Rice Research Institute.
p 471-476.
Villareal CP, Juliano BO. 1989. Comparative levels of waxy gene
product of endosperm starch granules of different rice
ecotypes. Starch/Starke 41:369-371.
Notes
Authors’ address: Faculty of Agriculture, Kyushu University,
Hakozaki, Fukuoka 812, Japan.
Variation in seed storage proteins of Pakistani
rice germplasm
S.U. Siddiqui, H. Satoh, and T. Kumamaru
Rice, the second most important crop in Pakistan, was investigated for endosperm storage proteins. Four hundred seventy-five
accessions, obtained from the Ministry of Agriculture, Fisheries, and Forestry (MAFF) genebank of Japan, underwent SDS-
PAGE and IEF analyses. A wide variation was found in local rice cultivars of Pakistan for the two major storage proteins, glutelin
and prolamin. Prolamins showed four types of variation by SDS-PAGE, whereas glutelin revealed six types of variation. For
proglutelin (57-kDa polypeptide), two types of variation were recorded in comparison with IR36 and Taichung 65. Some 90.5%
of high 57-kDa polypeptide (57H) spontaneous mutants were distributed in low-altitude areas of the Punjab region. The IEF
analysis of extracted glutelin also showed variation based on the intensity and presence or absence of the respective bands.
The 57H mutation (controlled by a single recessive gene, i.e., glup3 gene) was found to be located between RFLP markers
C1238 and R2370 within a 5.3-cM distance on chromosome 4. The observed variation for low prolamin and the glutelin
variation may be useful in improving the nutritional value of rice.
Pakistani rice germplasm is quite diverse in terms of qualitative
and quantitative traits (PGRI 1995). Rice research in Pakistan
mainly focused on increasing rice yield, while lacking
studies on grain protein quality. In this report, we describe the
diversity observed in Pakistani local rice genetic resources for
storage proteins to focus on materials that can be used to enhance
grain quality in terms of storage proteins. Four hundred
and seventy-five accessions of Pakistani local rice genetic resources
obtained from the Ministry of Agriculture, Fisheries,
and Forestry (MAFF) genebank of Japan were used as materials.
The endosperm storage proteins of the accessions were
analyzed by SDS-PAGE and IEF. Rice storage proteins are
composed of glutelin and prolamin. A major component of
prolamin is a 13-kDa polypeptide, which consists of 13a and
13b (Ogawa et al 1987). Rice glutelin consists of α and β subunits
composed of four and three bands, respectively (Uemura
et al 1996).
Figure 1 shows the prolamin variation: 16% of the total
accessions showed low levels of 13b (lane 1), whereas the presence
of the intermediate band between 13a and 13b, that is,
13c (not found in IR36 or T65), was observed in 1% of the
accessions (lane 2). Most of the cultivars (80%) had both bands
(13a and 13b) of equally high intensity (lane 3) and 3% of the
accessions had a low level of both 13-kDa polypeptides (lane
4). Bhowmik et al (1990) also reported that native rice varieties
of Bangladesh had a low intensity of 13a and 13b.
Minakuchi et al (1994) also reported the occurrence of three
bands (13a, 13b, and 13c) on prolamin in rice germplasm from
Bangladesh, Bhutan, and Nepal.
Pakistani varieties revealed six types of variation for the
glutelin subunit. Figure 2A shows the variation for the α-3
band, that is, the fast-migration α-3 band type (lane 1), slowmigration
α-3 band type (lane 2), α-3 band having both fast
and slow migration band types (lane 3), and α-3 band deletion
type (lane 4). Their frequencies were 70%, 11%, 2%, and 0.4%,
respectively. Figure 2B shows the variation for the α-4 band,
for which fast (lane 1) and slow (lane 2) migration types were
recorded. Their respective frequencies were 2% and 80% for
the total germplasm.
For the variation in the 57-kDa glutelin precursor, enriched
glutelin precursor (57H) cultivars were observed (Fig.
2C). The frequency of 57H was 18% of the total germplasm.
Satoh et al (1995) reported that 1.4% of the accessions from
North Asian countries showed 57H variation. Of these, 98%
were distributed in low-altitude areas, whereas the highest frequency
of occurrence was in the Punjab region (90.5%). The
198 Advances in rice genetics

1 2 3 4 5
A B C
1 2 3 4 5 1 2 1 2
α-1
α-2
α-3
α-4
57
kDa
α-4
13a
13c
13b
Fig. 1. SDS-PAGE banding pattern for total endosperm
protein showing variation in prolamin
bands. Lane 1 = low-intensity band of 13b; lane
2 = extra band, i.e., 13c indicated by the arrowhead;
lane 3 = equally high intensity of 13a and
13b; lane 4 = low intensity of 13a and 13b; lane
5 = IR36.
Fig. 2. SDS-PAGE analyses of total endosperm protein showing variation of
glutelin fraction. (A) Variation of α-3 band. Lane 1 = fast-migration α-3 band,
lane 2 = slow migration, lane 3 = slow- and fast-migration type, lane 4 =
deletion of α-3 band, lane 5 = IR36. (B) Variation of α-4 band. Lane 1 = slowmigration
α-4 band, lane 2 = fast-migration α-4 bands. (C) Variation of 57-
kDa glutelin precursor. Lane 1 = 57H (57 kDa high), lane 2 = normal intensity
of 57 kDa.
Glutelin
basic
subunit
Glutelin
acidic
subunit
+
Fig. 3. IEF banding pattern of glutelin polypeptides showing variation
in Pakistani cultivars. Lane 1 = Pakistani cultivar with the
same band pattern as IR36, lane 2 = recombinant type with band
6, A and B. Glutelin acidic subunit = glutelin α subunit, glutelin
basic subunit = glutelin β subunit.
distribution pattern of 57H variation showed a high degree of
correlation in terms of altitudinal and geographic occurrence.
Similarly, Katsuta et al (1996) reported that Pakistani rice
germplasm has a distinctive correlation with geographic distribution
in terms of altitude for esterase 3 enzyme. To investigate
the genetic behavior of the Pakistani 57H variation and
its relationship with the registered 57H gene, genetic analysis
was performed. In a cross with normal types, the segregation
of the normal and 57H types in the F 2 showed that the 57H
variation was controlled by a single recessive gene. From the
results of the cross with the registered 57H gene, it was clear
that the Pakistani 57H variation was allelic with the glup3 gene.
The glup3 was located within 5.3 cM between RFLP markers
C1238 and R2370 on chromosome 4.
The classified variation by SDS-PAGE was analyzed by
IEF for extracted glutelin. Glutelin was separated into α and β
subunits consisting of 12 and 10 bands, respectively. Uemura
et al (1996) reported that glutelin in both japonica cultivar
Kinmaze and indica cultivar IR36 possesses four unique IEF
bands. Taichung 65 showed the same pattern as Kinmaze. When
the IEF pattern of T65 and IR36 was compared, T65 specifically
had bands A and B in the β subunit and bands 1 and 11 in
the α subunit, not found in IR36. Instead, IR36 specifically
had bands C and E in the β subunit and bands 3 and 6 in the α
subunit, which were not found in Kinmaze. Pakistani rice cultivars
showed both T65 and IR36 types, whereas, in the types
with band 6, A and B (Fig. 3, lane 2) showed possible recombination
between T65 and IR36.
Our findings confirmed the existence of great diversity
in seed storage protein that could be used to improve protein
quality and may serve as a model for inheritance. Also, the
correlation that exists between variation and geographic distribution
may be used to evaluate environmental interaction
on QTLs.
References
–
IR36 1 2 T65
Bhowmik A, Omura T, Kumamaru T. 1990. Screening of rice varieties
for endosperm storage proteins. Plant Breed. 105:101-105.
Katsuta M, Okuno K, Afzal M, Anwar R. 1996. Genetic differentiation
of rice germplasm collected in Northern Pakistan. JARQ
30(2):61-67.
B
A
6
Kinmaze
specific
IR36
specific
Genetic diversity, evolution, and alien introgression 199

Minakuchi S, Satoh H, Konishi T. 1994. Polymorphism of prolamin
polypeptides in rice cultivars from Bangladesh, Nepal and
Bhutan, a preliminary study. Rice Genet. Newsl. 11:175-176.
Ogawa M, Kumamaru T, Satoh H, Iwata N, Omura Y, Kasai Z, Tanaka
K. 1987. Purification of protein body I of rice seed and its
polypeptide composition. Plant Cell Physiol. 28:1517-1527.
PGRI (Plant Genetic Resources Institute). 1995. Annual report 1995.
Islamabad (Pakistan): National Agricultural Research Centre,
PGRI. 104 p.
Satoh H, Kumamaru T, Ogawa M, Siraishi M, Gi Im B, Son MY,
Takemoto Y. 1995. Spontaneous mutants in rice. Rice Genet.
Newsl. 12:194-196.
Uemura YJ, Satoh H, Ogawa M, Suehisa H, Katayama TC, Yoshimura
A. 1996. Chromosomal location of genes encoding glutelin
polypeptides in rice. In: Khush GS, editor. Rice genetics III.
Proceedings of the Third International Rice Genetics Symposium,
16-20 Oct. 1995, Los Baños, Philippines. Manila (Philippines):
International Rice Research Institute. p 471-476.
Notes
Authors’ address: Laboratory of Plant Genetic Resources, Faculty
of Agriculture, Kyushu University, Fukuoka, Japan.
Genetic diversity in rainfed lowland rice genotypes
as detected by RAPD primers
S. Singh, S. Sarkarung, R.K. Singh, O.N. Singh, A.K. Singh, V.P. Singh, H.S. Bhandari, W. Xu, and Z. Li
The objective was to determine the genetic diversity among 21 rainfed lowland rice genotypes. The genotypes included both
landraces and improved cultivars, and were evaluated for important morphological characters and 47 RAPD markers. The
difference between genotypic and phenotypic coefficients of variation was relatively low for all the characters except grain yield
for both normal and delayed planting. A RAPD assay for 47 random primers revealed a total of 275 alleles, 91% of which were
polymorphic. The number of alleles detected by primers ranged from 1 to 17, with an average of 5.8, whereas gene frequencies
ranged from 0.14 to 0.96, except for AA09, AC02, AB17, HI46, and F19. Gene diversity was high (0.53 to 0.85). The
dendrogram generated from the RAPD assay revealed five distinct clusters of genotypes representing different responses to
drought and delayed planting. Genotypes in group 1 included IR66363-8M-1-1-1, RAU 83-85, SBR 3025, TTB 308-51, and
CN 1035-60, which were less sensitive to delayed planting, but sensitive to drought. Group 2 comprised PSR119, IR67495-
M-2-1-1-1, and KMJ 19, which showed sensitivity to delayed planting only when exposed to drought. Genotypes identified in
group 3 (Sabita, Madhukar, IR67471-M-8-1-1-1, IR66876-11-M-1-1-1, IR66366-M-7-1-1-1, CR 333-10, and Jal-Lahari)
were less sensitive to both delayed planting and drought. Rajshree and Mashuree of group 4 were sensitive to both drought and
delayed planting, while group 5, which included TTB 308-87, IR67440-M-2-1-1-1, KMJ17, and RAU 79-22, was less sensitive
to drought as well as delayed planting.
Rainfed lowlands account for 17 million ha of rice area in India,
mainly concentrated in eastern India. Because of uncertain
rainfall, early drought and flood are common in rainfed
lowland areas, which forces farmers to transplant the rice crop
late using older seedlings. Delayed planting is thus a major
cause for low yield, less than 2 t ha –1 , in this ecosystem. Estimation
of gene diversity is an important step in breeding programs.
Genetic markers such as restriction fragment length
polymorphism (RFLP), random amplified polymorphic DNA
(RAPD), etc., represent genetic variation at the DNA level,
without being influenced by environmental variation. This
paper analyzes the data collected from 16 advanced breeding
lines and five checks, using RAPD markers. The main objective
of the study was to assess the genetic diversity among
improved breeding lines vis-à-vis local varieties for their responses
to delayed planting.
Materials and methods
Field experiments were conducted during the rainy season at
CRS, Masodha, with 16 genotypes and five checks. The experimental
design used was a randomized complete block (three
replications) with a split-plot arrangement of treatments: planting
date as the main plots and the genotypes as subplots. Observations
on 10 morphophysiological characters were taken
from five sample hills in each subplot. Data recorded were
days to 50% flowering, plant height (cm), ear-bearing tillers
m –2 (EBT), panicle length (cm), grain yield plot –1 (converted
to t ha –1 ), 1,000-seed weight, number of grains, sterility (%),
total biomass (g), and harvest index (%).
The DNA was extracted and purified following the modified
CTAB (cetyltrimethylammonium bromide) procedure.
DNA amplification was performed in a 25-µL reaction volume
containing 10 mM Tris-CL (pH 8.3), 50 mM KCl, 2 mM
MgCl 2 , 100 mM dNTP, 10 ng primer, 25 ng genomic DNA,
and 2 units of Taq DNA polymerase, topped with 50 µL of
mineral oil. The thermal cycler (PCR machine, PTC-100 MJ
Research) was programmed for 45 cycles of 1 min at 94 °C
and 2 min at 72 °C. The amplified samples were stored at 4 °C
until loaded on 1.5% agarose gels in 1X TBE buffer and visualized
by ethidium bromide staining.
200 Advances in rice genetics

Table 1. Total number of alleles, allele length in bp, gene frequency, and gene diversity of 47 RAPD
markers assayed in 21 rice genotypes for delayed planting under rainfed lowland conditions.
M a TNA AL in (bp) GF GD M TNA AL in (bp) GE GD
AA01 6 200–750 0.29 0.70 B02 5 420–1,300 0.24 0.74
AA02 4 320–750 0.46 0.53 B03 4 320–650 0.25 0.72
AA03 4 300–800 0.31 0.68 B04 5 220–900 0.27 0.67
AA15 3 300–600 0.44 0.55 B18 4 300–800 0.32 0.67
AA09 2 450–1,070 0.38 0.03 B19 4 420–850 0.37 0.62
AB02 3 400–750 0.33 0.66 B20 8 250–600 0.23 0.76
AB06 8 550–900 0.26 0.73 C-01 7 300–1,000 0.29 0.70
AB11 3 405–750 0.38 0.61 C-08 7 350–900 0.18 0.81
AB17 4 490–1,080 0.90 0.09 C-19 5 500–800 0.30 0.69
AB19 6 520–750 0.29 0.70 E01 5 500–1,000 0.31 0.68
AC02 3 300–1,000 0.96 0.03 E08 4 350–800 0.27 0.72
AC10 3 250–480 0.38 0.61 E15 13 350–1,400 0.14 0.85
AC14 4 320–420 0.15 0.85 F17 9 220–900 0.27 0.72
AC15 7 520–1,300 0.29 0.70 F18 4 350–1,000 0.35 0.64
AF15 2 300–1,000 0.71 0.28 F19 1 200–900 0.81 0.18
AG10 10 410–1,200 0.17 0.82 G05 5 280–950 0.25 0.74
AG13 9 240–410 0.24 0.75 G06 3 450–1,300 0.44 0.55
AG16 6 355–1,000 0.22 0.77 H03 6 550–980 0.37 0.62
AI-10 17 450–1,600 0.18 0.81 H146 1 380–1,050 0.90 0.09
AL11 10 355–950 0.22 0.77 J16 9 390–450 0.14 0.85
AL13 5 210–850 0.37 0.62 O-05 11 550–1,000 0.22 0.77
AN06 6 380–950 0.25 0.74 O-06 5 440–950 0.26 0.73
AN14 7 390–550 0.33 0.66 N08 8 400–900 0.20 0.79
AN16 10 510–1,320 0.23 0.76
a M = markers, AL = allele length in bp, GD = gene diversity, TNA = total number of alleles, GF = gene frequency.
RAPD data were scored for computer analysis on the
basis of presence and absence (scale 1 and 0 for each allele)
and genetic distance was calculated for all 275 pairs of genotypes.
Similarity coefficients were used to construct a dendrogram
by UPGMA methods and NTSYS software (Rohlf 1992).
The gene diversity (heterozygosity) was calculated according
to Weir (1990):
Gene diversity = 1 – ΣP 2 ij
where Pij is the frequency of the jth RAPD pattern for clone I
and is summed across n patterns.
The split-plot analysis was carried out and genotypic and
phenotypic coefficients of variation and heritability (broadsense)
were calculated by SAS PROC GLM (SAS Institute
1985).
Results and discussion
Forty-seven primers were used for amplifying DNA segments
from the genomic DNA of 21 genotypes. For each primer evaluated,
out of a total of 275 alleles, 91% showed polymorphism.
The number of alleles per primer varied from 1 to 17 (Table
1). On average, 5.8 alleles per locus were observed. Except
for AA09, AC02, AB17, HI46, and F19, gene diversity recorded
was high (0.53 to 0.85) and gene frequencies ranged
from 0.14 to 0.96 (Table 1). AI10 primer produced more polymorphism
(17 bands). The size of the amplified segment ranged
from 200–750 bp for AA01 to 450–1,600 bp for AI10. Figure
1 shows the amplification products with primer E15. A very
clear banding pattern of amplified segments ranged from 350
to 1,400 bp. Amplified polymorphic DNA fragments were
screened based on Jaccard’s similarity coefficient. Pair-wise
similarity ranged from 0.06 to 0.84. The number of alleles
detected by AG10, AI70, and E15 showed a high degree of
polymorphism, with 10 to 17 alleles, gene frequency of 0.14
to 0.18, and gene diversity of 0.81 to 0.85.
Association among the 21 genotypes revealed by
UPGMA cluster analysis is presented in Figure 2. The clusters
were classified into two main groups, cluster 1 of mediumduration
varieties and cluster 2 of long-duration varieties. Although
the grouping of varieties by Jaccard’s coefficient of
similarity and cluster analysis based on RAPD data showed a
high degree of similarity, only a few lines showed different
behavior. For example, part of the four lines that showed high
values of similarity coefficient, such as TTB 308, fall into a
completely different group showing proximity with the group
consisting of Rajshree and Mahsuri. Similarly, PSR 1119-1-
13-3 and IR67495 formed a separate group based on Jaccard’s
method, while they were together in group 1 of the cluster analysis.
Genetic diversity, evolution, and alien introgression 201

kb 1 2 3 4 5 6 7 8 9 1011 1213 141516 1718192021
kb 1 2 3 4 5 6 7 8 9 1011 1213 141516 1718192021
Fig. 1. Polymorphic pattern detected in
various rainfed lowland genotypes using
RAPD. The genotypes were IR66876-11-
M (lane 1), RAU83-82-1 (lane 2),
SBR3025-2-B (lane 3), TTB308-50 (lane
4), Sabita (lane 5), Jal-Lahari (lane 6),
Madhukar (lane 7), IR66363-M-8 (lane 8),
IR66366-M-7 (lane 9), IR67440-M-5 (lane
10), CR333-10 (lane 11), CN1035-60
(lane 12), RAU419-85 (lane 13),
PSR1119-13 (lane 14), IR67471-M-8
(lane 15), IR67495-M-2 (lane 16), KMJ-
1-17-1 (lane 17), KMJ-1-19-1 (lane 18),
RAU79-22 (lane 19), Rajshree (lane 20),
and Mahsuri (lane 21). Amplification products
obtained with primer AG10 (A) and
AN16 (B).
IR66876-11-M
RAU83-85
SBR3025-B
RAU419-85
CN1035-60
PSR119-13-1
IR67495-2-M
KMJ1-19-1
Sabita
Madhukar
IR67471-M-8
IR66363-M-8
IR66366-M-7
RAU79-22-1
Jal-Lahari
Rajshree
Mahsuri
TTB308-51
IR67440-M-5
KMJ-1-17-1
CR333-10
0.84 0.65 0.46 0.28 0.09
Coefficient of similarity
Fig. 2. Dendrogram of rainfed lowland
genotypes planted under normal and
delayed conditions, constructed using
UPGMA based on Jaccard’s similarity
coefficients.
The coefficient of variation for different characters under
normal and delayed conditions ranged from 4.5 to 40.4
and 4.4 to 31.2, respectively, indicating a high degree of variability.
The genetic coefficient of variability (GCV) ranged
from 5.2% to 8.5% for days to 50% flowering (DF) and 41.5%
to 44.1% for grain yield (GY) in normal and delayed planting,
respectively. Number of grains (TGN), sterility, and total biomass
(TB) also showed a comparatively high GCV in both
planting conditions. The differences between GCV and PCA
for all the characters except GY and harvest index (HI) under
both planting conditions and panicle length under delayed
planting conditions were low. Heritability estimates were high
202 Advances in rice genetics

for traits such as DF, EBT, TW, TGN, sterility, and TB under
both planting conditions. The estimates were higher for PH
and GY (0.93 and 0.87) in normal versus delayed planting.
Genetic advance was high for GY (79.5 for normal and 70.8
for delayed planting) and TGN (42.4 for normal and 60.9 for
delayed planting) compared with that for TW (34.2 for normal
and 28.4 for delayed planting), HI (32.2 for normal and
29.1 for delayed), PH (35.9 for normal and 26.5 for delayed),
and EBT (26.8 for normal and 25.5 for delayed planting).
References
Rohlf FJ. 1992. NTSYS-pc: numerical taxonomy and multivariate
analysis system. New York (USA): Exeter Software.
SAS Institute. 1985. SAS users’ guide: statistics. Version 5 ed. Cary,
N.C. (USA): SAS Institute.
Weir BS. 1990. Genetic data analysis: methods for discrete population
genetic data. Sunderland, Mass. (USA): Sinauer Associates,
Inc. Publishers.
Notes
Authors’ addresses: S. Singh, S. Sarkarung, R.K. Singh, V.P. Singh,
W. Xu, and Z. Li, International Rice Research Institute, Los
Baños, Philippines; O.N. Singh and A.K. Singh, N.D. University
of Agriculture and Technology, Kumarganj, Faizabad,
Uttar Pradesh, India; H.S. Bhandari, Lumle Agricultural Research
Centre, Phokhara, Kaski, Nepal.
Marker-based estimation of coefficient of coancestry in rice
D.A. Tabanao, L.S. Sebastian, A.L. Carpena, J.E. Hernandez, A.I.N. Gironella, and R.N. Bernardo
The coefficient of coancestry was calculated using two methods based on DNA marker data. Microsatellite marker analysis of
eight modern rice varieties and their 25 progenitors resulted in a total of 559 alleles from 119 loci. Marker estimates were
computed for all 528 pairwise genotype combinations using the nonrelatives ( N
f ij
) and the tabular ( T
f ij
) methods. The mean
values of N
f ij
, T
f ij
, and f ij
were 0.1502, 0.0452, and 0.0649, respectively. T
f ij
and N
f ij
deviated by ≥0.10 from f ij
in about the same
number of genotype pairs, but T
f ij
correlated better to f ij
than did N
f ij
. The two marker estimates themselves were highly correlated
and deviated by ≥0.10 in only 44/258 genotype pairs. Also, the T
f ij
dendrogram agreed more closely with the f ij
dendrogram
than did the N
f ij
dendrogram, but both T
f ij
and N
f ij
were about as equally suitable as f ij
to cluster analysis. The differences
between pedigree and marker estimates were due to human selection and to the assumption that initial progenitors were
unrelated. The highly significant correlation of the marker estimates to f ij
indicated their validity as measures of genetic
relatedness, while their immunity to assumptions of the pedigree method and their appropriateness to classification implied
their superiority. T
f ij
is more accurate to use when pedigree information and DNA profiles are complete; otherwise, N
f ij
is more
meaningful to use.
Measures of genetic relatedness are very important in plant
breeding-related activities and are needed in applications involving
varietal identification, intellectual property protection,
and utility patenting (Smith 1997). The development of molecular
markers has enabled plant breeders to determine the
genetic relationships among plant germplasm at the level of
the DNA itself. DNA-based markers have the advantage of
being virtually unlimited in number and independent of environmental
effects. The question then would be: Which similarity
index is more accurate and meaningful to use
The coefficient of coancestry (f) is the most widely used
and accepted measure of genetic relatedness in plant breeding.
However, its total dependence on the parentage information
of the germplasm under comparison limits its use and accuracy
because it doesn’t satisfy the assumptions. Bernardo
(1993) proposed estimating the coefficient of coancestry by
using DNA marker data based on the fact that DNA marker
data are a direct sampling of the genome itself, and since f is
the probability that two alleles at the same locus are identical
by descent (ibd). This marker-based approach would circumvent
the problems associated with the classical pedigree-based
approach. This study was conducted (1) to compute the coefficients
of coancestry of selected rice germplasm using
microsatellite DNA marker data and (2) to assess their validity
relative to the pedigree-based method.
The use of simple sequence repeats (SSRs), also known
as microsatellites, is gaining wide acceptance in analyzing genetic
relationships because of their ability to detect large numbers
of discrete alleles repeatedly, accurately, and efficiently.
The genetic profiles produced by SSRs can be used in conjunction
with pedigree and performance data to document
ownership and protect intellectual property rights (McCouch
et al 1997). In DNA profiles, the proportion of alleles that are
common between two genotypes is known as marker similarity
(S). Lynch (1988) proposed that the expected value of S is
actually a function of f and the conditional probability that
marker alleles are alike in state (ais) given that they are not ibd
(θ).
Genetic diversity, evolution, and alien introgression 203

Materials and methods
The experiment comprised eight Philippine-released rice varieties
and 25 of their initial, intermediate, and immediate parents
(Table 1). A set of five varieties that were not related to
any of the sample materials was also grown for DNA sampling
using the CTAB procedure.
A total of 118 SSR primer pairs were used to survey the
microsatellite polymorphism of the sample materials, following
the concentrations of polymerase chain reaction (PCR)
components and temperature profile recommended by Research
Genetics (Huntsville, AL). PCR products were partitioned
in 4% polyacrylamide gels. Silver staining followed the
protocol provided by the manufacturer (Promega Corp., Madison,
WI). Allelic bands were denoted, from the fastest to the
slowest migrating fragments, by letters a, b, c, and so on.
The coefficient of coancestry was computed for all 528
pairwise genotype combinations, according to the formula of
Wright (1922). The marker-based coefficients of coancestry
were computed using two methods. The nonrelatives method
is based on the relationship of f ij to S ij :
S ij = ƒ ij + (1 – ƒ ij )θ ij (1)
S ij was calculated using simple matching coefficients in
NTSYS-PC (Rohlf 1993). θ ij was obtained as θ ij = ½ (θ i + θ j ),
where θ i (or θ j ) is the average proportion of marker variants
shared between genotype i (or genotype j) in the first set and
the inbreds in the second set. N ƒ ij was then computed as
N ƒ ij = (S ij – θ ij ) / (1 – θ ij ) (2)
The second method is based on a tabular analysis procedure
developed by Emik and Terrill (1949). The inbreds were
first sorted from oldest to newest so that an inbred was listed
before any of its progenies. Starting from the oldest inbred,
the coefficient of coancestry between i and j was calculated as
Τ f ij = λ a f aj + λ b f bj (3)
where f aj was the coefficient of coancestry between a and j, f bj
was the coefficient of coancestry between b and j, and λ a and
λ b are the marker-based parental contributions of a and b, respectively,
to i. A Fortran-based computer algorithm (Bernardo
et al 2000) was employed for this procedure. The parental
contributions were calculated as λ a = (S ai – S bi S ab )/[(1 – S ab ) 2 ]
and λ b = (S bi – S ai S ab )/[(1 – S ab ) 2 ].
A dendrogram was constructed from each type of estimate
using the unweighted pair-group method with arithmetic
mean. Then, the three types of estimates were compared at the
individual value level, at the matrix level, and at the dendrogram
level. To compare two matrices, the matrix correlation
coefficient was computed using SPSS 10.0 for Windows. To
compare two classifications, a matrix of cophenetic values was
produced from each of the two dendrograms. The two
cophenetic matrices were then analyzed for correlation.
Table 1. Rice genotypes used in the study.
Designation Parentage Origin
Group 1 (Sample materials)
Landraces
Benong
Cina
Dee-geo-woo-gen (DGWG)
Eravapandy
Kitchili Samba
Latisail
Pa Chiam
Seraup Besar 15
Tadukan
Tangkai Rotan
Thekkan
Tsai-yuan-chan (TYC)
Vellai Kar
Indonesia
China
China
India
India
Pakistan
China
Malaysia
Philippines
Malaysia
India
China
India
Selections from landraces
CO18 Vellai Kar India
Fortuna Pa Chiam USA
GEB24 Kitchili Samba India
PTB18 Eravapandy India
PTB21 Thekkan India
Rexoro Marong Paroc USA
Breeding materials
Blue Bonnet Rexoro/Fortuna USA
Intan Cina/Latisail Indonesia
Peta Cina/Latisail Indonesia
Sigadis Blue Bonnet/Benong Indonesia
TKM6 CO18/GEB24 India
TN 1 DGWG/TYC Taiwan
Released varieties
BPI76-1 Fortuna/Seraup Besar 15 Philippines
C-168 Intan/BPI76-1 Philippines
C4-137 Peta/BPI76-1 Philippines
C4-63G Peta/BPI76-1 Philippines
IR5 Peta/Tangkai Rotan IRRI
IR8 Peta/DGWG IRRI
IR22 IR8/Tadukan IRRI
UPL Ri5 Sigadis/BPI76-1 Philippines
Group 2 (Nonrelatives)
Babawee
Chou Sung
Hatsuboshi
Nahng Mon S4
Tetep
Sri Lanka
Korea
Japan
Thailand
Vietnam
To test for the goodness of fit of a tree matrix to the
original similarity matrix, a cophenetic matrix was produced
from the dendrogram. Then the cophenetic correlation coefficient
(r*) was computed by comparing the similarity coefficients
and the cophenetic coefficients. Since the cophenetic
and similarity matrices were not independent, the critical values
of r* given by Lapointe and Legendre (1992) were used
for tests of significance. As an additional measure of a
dendrogram’s goodness of fit to its similarity matrix, the Colless
consensus index (CI C ) for strict consensus trees (Rohlf 1982)
was also used with the CONSEN algorithm of NTSYS-PC.
204 Advances in rice genetics

Results and discussion
One of the markers produced two amplifications, resulting in
119 SSR loci in all. The number of alleles detected per locus
ranged from 2 to 11, with an average of 4.7 and a total of 559.
The number of SSR loci per chromosome ranged from 5 to 21,
with an average of 10 per chromosome.
The mean values of N f ij , T f ij , and f ij , computed in all 528
pairwise genotype combinations, were 0.1502, 0.0452, and
0.0649, respectively. N f ij deviated by ≥ 0.10 from T f ij in only
44 pairs (8.3%), but both N f ij and T f ij differed by ≥ 0.10 from f ij
in 269 (50.9%) and 259 (49.1%) pairs, respectively. The two
marker estimates were therefore comparable with each other
in agreement with f ij when mere deviations in values were considered.
The mean f ij was lower than the mean N f ij because the
former underestimated the true value of f because of the supposedly
unrelated progenitors, which may be related after all.
The mean T f ij was also lower than N f ij and about the same as
the mean f ij because the tabular analysis also depended to some
extent on parentage information. Some 128 genotype combinations
gave 0 N f ij values, in contrast with 425 combinations
in T f ij and in f ij . The nonrelatives method therefore demonstrated
the existence of genetic relation in many genotype combinations
by detecting 0 < f ij ≤ 1. These combinations were
otherwise deemed unrelated using the pedigree and tabular
methods. T f ij , however, has an advantage over f ij in that it takes
into account the effects of selection and genetic drift by including
the genomic contributions of the parents.
Other causes of the deviations of marker estimates from
pedigree estimates are selection and genetic drift, which occur
during inbred line development. These processes disrupt the
actual proportion of loci at which two homozygous cultivars
carry alleles that are ibd (Cox et al 1985). Selection is especially
intense in plant breeding programs, favoring those alleles
that are preferred by breeders.
For agreements at the matrix level, the two marker estimates
( N f ij and T f ij ) were highly correlated with each other (r =
0.61, P < 0.01). In the pedigree estimate, T f ij correlated better
(r = 0.74, P < 0.01) than did N f ij (r = 0.49, P < 0.01). This
implied that T f ij agrees better with f ij than does N f ij . The only
disadvantage of T f ij is that it requires complete pedigree information
and the DNA profile of all genotypes in the pedigree
tree.
Figure 1 shows the dendrograms based on N f ij and T f ij .
Results revealed that N f ij (r* = 0.90, CI C = 0.97) and T f ij (r* =
0.89, CI C = 1.00) were more suitable to cluster analysis than f ij
(r* = 0.78, CI C = 0.79). The T f ij dendrogram was also highly
compatible with the other marker estimate-based dendrogram
(r* = 0.63) and with the pedigree estimate-based (r* = 0.65)
dendrogram.
Thus, for accuracy, T f ij is superior to N f ij when the genotypes
under comparison have known and clear pedigrees, and
when all the genotypes in the pedigree tree have available DNA
profiles. Otherwise, N f ij estimates would be more meaningful
to use. For classification, T f ij and N f ij are about equally suitable,
and are both better than f ij , for cluster analysis, but the
T f ij dendrogram agreed more closely with the f ij dendrogram
than did the N f ij dendrogram.
The highly significant correlation of the marker estimates
to f ij indicated their validity as measures of genetic relatedness,
whereas their immunity to assumptions of the pedigree
method and their appropriateness to classification implied superiority
to the pedigree-based method.
References
Bernardo R. 1993. Estimation of coefficient of coancestry using
molecular markers in maize. Theor. Appl. Genet. 85:1055-
1062.
Bernardo R, Romero-Severson J, Ziegle J, Hauser J, Joe L, Hookstra
G, Doerge RW. 2000. Parental contribution and coefficient of
coancestry among maize inbreds: pedigree, RFLP, and SSR
data. Theor. Appl. Genet. 100:552-556.
Cox TS, Kiang YT, Gorman MB, Rodgers DM. 1985. Relationship
between coefficient of parentage and genetic similarity indices
in the soybean. Crop Sci. 25:529-532.
Emik LO, Terrill CE. 1949. Systematic procedures for calculating
inbreeding coefficients. J. Hered. 40:51-55.
Lapointe FJ, Legendre P. 1992. Statistical significance of the matrix
correlation coefficient for comparing independent phylogenetic
trees. Syst. Biol. 41:378-384.
Lynch M. 1988. Estimation of relatedness by DNA fingerprinting.
Mol. Biol. Evol. 5:584-599.
McCouch SR, Chen X, Panaud O, Temnykh S, Xu Y, Cho YG, Huang
N, Ishii T, Blair M. 1997. Microsatellite marker development,
mapping and applications in rice genetics and breeding. Plant
Mol. Biol. 35:89-99.
Rohlf FJ. 1982. Consensus indices for comparing classifications.
Math. Biosci. 59:131-144.
Rohlf FJ. 1993. Numerical taxonomy and multivariate analysis system
v 1.80. New York (USA): Exeter Software.
Smith S. 1997. Cultivar identification and varietal protection. In:
Caetano-Anolles G, Gresshoff PM, editors. DNA markers:
protocols, applications and overviews. New York: Wiley-Liss,
Inc. p 283-299.
Wright S. 1922. Coefficients of inbreeding and relationship. Am.
Nat. 56:330-338.
Notes
Authors’ addresses: D.A. Tabanao, L.S. Sebastian, Plant Breeding
and Biotechnology Division, Philippine Rice Research Institute,
Nueva Ecija; A.L. Carpena, J.E. Hernandez, Department
of Agronomy, University of the Philippines Los Baños
(UPLB); A.I.N. Gironella, Institute of Statistics, UPLB, Laguna,
Philippines; R.N. Bernardo, Department of Agronomy,
Purdue University, West Lafayette, Indiana, USA.
Genetic diversity, evolution, and alien introgression 205

A
Benong
Blue Bonnet
Fortuna
Rexoro
BP176-1
C-168
C4-137
C4-63G
UPLRi-5
IR5
Tangkai Rotan
Intan
Latisail
Sigadis
TKM6
Peta
Seraup Besar 15
Cina
DGWG
IR8
IR22
TN1
Tsai Yuan Chan
GEB24
Kitchili Samba
Tadukan
Thekkan
CO18
Vellai Kar
Eravapandy
PTB18
PTB21
Pa Chiam
0.00
0.25
0.50
0.75
1.00
B
Benong
Sigadis
Blue Bonnet
Fortuna
Rexoro
Pa Chiam
BP176-1
C-168
C4-137
C4-63G
UPLRi-5
Seraup Besar 15
Cina
Intan
Latisail
Peta
DGWG
IR8
IR22
IR5
Tangkai Rotan
TN1
Tsai Yuan Chan
Tadukan
CO18
Vellai Kar
GEB24
Kitchili Samba
TKM6
PTB21
Thekkan
Eravapandy
PTB18
0.00
0.25
0.50
0.75
1.00
Fig. 1. Dendrograms showing genetic relationships of 33 genotypes based on markerbased
coefficients of coancestry (A = nonrelatives method, N f ij ; B = tabular method,
T f ij ).
206 Advances in rice genetics

Molecular cytological studies on
a poly-egg rice mutant AP IV strain
Y. Lu and X. Liu
The AP strain is a mutant of poly-egg rice with one or more eggs in the AP embryo sac. In this poly-egg embryo sac, three eggs
are a majority. They could be further divided into three types—“5-2-1” type, “6-2-0” type, and “5-3-0” type—depending on
the whole structure of the embryo sac. Three types of embryo sac originated from a different new polygonum variant. In the new
polygonum variant, the early stage, from archesporial cell to megaspore, was not different. The difference appeared only in the
late stage, from the single nucleate embryo sac stage to the mature embryo sac stage. By using the immunological fluorescence
technique, nuclear behavior was confirmed to be abnormal. Abnormal microtubule behavior resulted in irregular positioning
of the nuclei as well as asynchronous microtubular patterns in different pairs of nuclei. Genetic polymorphism for the
structure of the embryo sac was found in a single panicle of AP. The gametophytic genotype, rather than the sporophytic
genotype, regulated microtubule behavior. It was suspected that some retrotransposons might control these abnormal cytoskeletal
activities.
Gametophyte mutants play an important role in the study of
molecular biology and plant breeding. Many male gametophyte
mutants have been reported in rice, but only a few female gametophyte
mutants have been found (Lu and Liu 1998). Among
them, only the poly-egg mutant (AP IV) has undergone cytological
analysis (Liu et al 1996a,b,c). One or more than one
embryo were found to result from fertilization and development
from the poly-egg apparatus in AP IV. In this embryo
sac, three eggs are the majority. They could be further divided
into three types, depending on the structure of the embryo sac,
that originated from different new polygonum variants. Liu
and Lu (1996b) concluded that four factors might have resulted
in these new polygonum variants: (1) the nucleus location
of the mononucleate embryo sac, (2) the direction of
nucleus division, (3) nonsynchronization of the sister nucleus,
and (4) the movement of a new division nucleus. Many studies
had indicated that these four factors correlated with the microtubule
organization. In this paper, the patterns of microtubule
organization in different types of embryo sacs, including the
normal polygonum type, were observed with the immunological
fluorescence technique.
Materials and methods
The rice polyembryonic line AP IV was planted at the South
China Agricultural University (SCAU). Spikelets were collected
at different stages of development. Ovules were dissected
and fixed in a mixture consisting of 4% paraformaldehyde,
10% DMSO, and 0.01% Triton X-100 in PEMG (2 mM
MgSO 4 , 5 mM EGTA, and 4% sucrose, pH 6.8) for 1 h at
room temperature. After rinsing with PEMG buffer three times,
samples were dehydrated in a graded series of ethanol. At 100%
ethanol, the temperature was raised to 56 °C; the ethanol was
then replaced by the PEG infiltration mixture. Mixtures were
subsequently replaced twice by pure PEG for 45 min, the ovules
were transferred into an eppendorf tube, and the tube was allowed
to cool slowly. Sections that were 30–50 mm thick were
prepared with a razor blade on an AO microtome. The sections
were put into a “microtube apparatus.” After rinsing with
distilled water three times, samples were treated with 0.1 NH 4 Cl
for 3 min and rinsed three times for 5 min each in PBS. Subsequently,
the sections were treated with 1% Tween-20 for 20
min and incubated with 1% BSA for 8 min.
The sections were then incubated in 100 µL of monoclonal
antibody anti-α-tubulin (Sigma T-9026) diluted l:25 in
PBS for 45 min. After rinsing in PBS three times, the sections
were incubated in antimouse IgG (whole molecule) FITC conjugate
(Sigma F-0257) diluted 1:80 with PBS for 45 min. The
sections were then transferred to a slide mounted in antifading
solutions and examined under a Leica TNT confocal laserscanning
microscope. The confocal images were recorded by
Kodak T-Max 100.
Results and discussion
Megasporogenesis
The PEG sections further proved that the megasporogenesis
of three polygonum-variant types of AP IV—“5-2-1”, “6-2-
0”, and “5-3-0”—was the same as that of the normal polygonum
type. The megasporogenesis included four developmental
stages. The pattern of microtubule configuration at different
developmental stages was studied.
Archesporial cell. The archesporial cell was located at
the uppermost end of the ovule just underneath the epidermis.
The cell was larger than other nucellar cells around. It had an
obvious nucleus and contained a complex network of microtubules
around the nuclear membrane.
Megasporocyte (interphase). The archesporial cell enlarged
and developed into a megasporocyte. The nucleus of
the megasporocyte moved near the micropyle end. There was
no difference in microtubules between the megasporocyte and
the archesporial cell, but the microtubules accumulated near
the micropyle end.
Genetic diversity, evolution, and alien introgression 207

Meiosis. Microtubules became strongly reoriented in the
megasporocyte during meiosis. They reoriented and organized
to spindle in metaphase I, becoming radiated in the dyad. In
the tetrad, the megaspore had radiated microtubules only near
the chalazal end. There were little microtubules in the other
cells.
Megaspore. The cell near the chalazal end developed
into a functional megaspore. Microtubules were arranged randomly
in the functional megaspore.
Megagametogenesis
In the normal polygonum type, megagametogenesis in rice went
through the mononucleate embryo sac, two-nucleate embryo
sac, four-nucleate embryo sac, eight-nucleate embryo sac, and
mature embryo sac phases. The megagametogenesis of the
polygonum-variant type involved the three-nucleate embryo
sac and five-nucleate embryo sac.
In the normal polygonum type, the functional megaspore
expanded somewhat with the formation of a large vacuole at
each pole of the cell with the nucleus localized at its center,
and developed into a mononucleate embryo sac. The microtubules
of the mononucleate embryo sac were mostly perinuclear,
and many longitudinal microtubular bundles extended from
the nucleus to the opposite cell poles. In the mononucleate
embryo sac of the 5-2-1 type, microtubules were the same as
those in the normal mononucleate embryo sac. In the
mononucleate embryo sac of the 6-2-0 type and 5-3-0 type
(polygonum-variant type, the same as below), the nucleus of
the embryo sac was located near the micropyle end, and only
some radiated microtubules were observed around the nuclear
membrane.
The first mitotic division of the mononucleate embryo
sac gave rise to the two-nucleate embryo sac, of which the two
nuclei migrated to the opposite poles. Microtubules were localized
at the perinuclear region, and some radiated microtubules
were found around the nuclei membrane. In the twonucleate
embryo sac of the 6-2-0 and 5-3-0 types, the two nuclei
were at the micropyle end. Subsequently, a nucleus at the
micropyle end divided and developed into a three-nucleate
embryo sac. Microtubules in the three-nucleate embryo sac
exhibited a network-like array and encircled the three nuclei.
In a normal four-nucleate embryo sac, in which two sister
nuclei were located at opposite poles, many condensed microtubules
were observed around the nuclei in the chalazal
end, and only a few around the nuclei in the micropyle end. In
the polygonum-variant types (5-3-0 and 6-2-0), there were four
nuclei, all located near the micropyle end. The microtubules
in the two kinds of four-nucleate embryo sac displayed a complex
network, with the four nuclei buried in the microtubules.
In the four-nucleate embryo sac of the 5-2-1 type, one nucleus
was located in the chalazal end and the other three nuclei in
the micropyle end. Before going into the eight-nucleate embryo
sac stage, the five-nucleate embryo sac may have developed
into the polygonum-variant type.
In the 5-2-1 type mature embryo sac, there were three
egg cells and two synergids in the micropyle end, two polar
nuclei on the egg cells, and one antipodal in the chalazal end.
In the 5-3-0-type mature embryo sac, there were three egg cells
and two synergids in the micropyle end, two polar nuclei on
the top of the egg cells, and one antipodal near the polar nuclei.
In the 6-2-0-type mature embryo sac, there were three
egg cells, two synergids, and one antipodal in the micropyle
end, and two nuclei on the top of the egg cell.
Many different patterns of microtubules were found at
different developmental stages of the AP IV embryo sac. In
the normal polygonum type, crucial features included microtubules
of the mononucleate embryo sac longitudinally extending
from the nucleus to the opposite pole of the cell. These
features appeared to be important in the precise positioning of
nuclei during the development of the embryo sac (Huang and
Sheridan 1996). However, these features were lacking during
the development of the polygonum-variant embryo sac. Abnormal
microtubule patterns accompanied the unsynchronized
and abnormal nuclear movements. In the mononucleate embryo
sac of the 5-3-0 and 6-2-0 types, the fused radiated microtubules
replaced the longitudinally extending microtubules.
This was the crucial factor, which caused the nucleus to move
to the micropyle end. In the two-nucleate and four-nucleate
embryo sacs of the 6-2-0 and 5-3-0 types, we found other radiated
perinuclear microtubules, which were different from those
in the normal polygonum type. These microtubules maintained
abnormal nuclear movement and resulted in the abnormal
mature embryo sac. Liu et al (1996c) had proved that genetic
polymorphism in the structure of the embryo sac existed in a
single panicle of the AP. The gametophytic genotype, rather
than the sporophytic structure, regulated the microtubule behavior
(Liu et al 1996a,b,c). It was suspected that some
retrotransposons might control the abnormal microtubule activities,
which affected the normal action of the nucleus.
References
Huang BQ, Sheridan WF. 1996. Embryo sac development in the
maize indeterminate gametophyte1 mutant: abnormal nuclear
behavior and defective microtubule organization. Plant Cell
8:1391-1407.
Liu XD, Lu YG, Chen QF. 1996a. Studies on the inheritance of polyeggs
in polyembryonic rice strain AP. Hereditas 18(5):7-10.
(In Chinese with English abstract.)
Liu XD, Lu YG, Xu XB, Zee SY. 1996b. Formation and development
of different types of embryo sacs in polyembryonic rice
strain AP. Acta Bot. Sin. 38(10):767-771. (In Chinese with
English abstract.)
Liu XD, Lu YG, Xu XB, Zee SY. 1996c. Study on the structure and
genetic polymorphism of embryo sac in polyembryonic rice
strain AP. Acta Bot. Sin. 38(8):594-598. (In Chinese with
English abstract.)
208 Advances in rice genetics

Lu YG, Liu XD. 1998. A mutant for variable egg number in rice.
Rice Genet. Newsl. 15:121-122.
Notes
Authors’ address: Plant Molecular Breeding Research Center, South
China Agricultural University, Guangzhou, Guangdong,
China.
Acknowledgments: The authors wish to thank Prof. S.Y. Zee of the
University of Hong Kong for providing facilities for research
and for helpful discussions. The authors also wish to thank
Mr. Honglong Zhu, a graduate student of the Department of
Agronomy, for helping in the PEG cutting section. This research
was supported by the National Natural Science Foundation
of China (39600008).
Genetic diversity, evolution, and alien introgression 209

Molecular markers, QTL mapping,
and marker-assisted selection
Molecular markers, QTL mapping, and marker-assisted selection 211

212 Advances in rice genetics

The application of molecular markers in rice
M. Christopher, S. Garland, R. Reinke, and R. Henry
Few rice improvement programs are taking full advantage of molecular marker technologies. Traits to be targeted for the
development of molecular markers in the short term should ideally be of importance to the industry, simply inherited, and highly
heritable, but difficult or unreliable to select using nonmolecular methods, and/or be desirable to select earlier in the program.
Information should be available on mode of inheritance and map location from populations similar to the population of interest
and existing polymerase chain reaction (PCR)-based markers. Traits to be targeted in the longer term should be of high
importance but may be more complex. They may be multigenic or quantitative and influenced by the environment. The mode
of inheritance for some traits may require clarification and gene location may be unknown. PCR-based markers may require
development from bulk segregation analysis, from known restriction fragment length polymorphism markers, from sequence
information, or from other methods. The availability of extensive map and sequence information offers an opportunity to design
sequence-tagged sites or microsatellite primers close to genes, within expressed sequences, or within genes. These candidate
markers should then be tested for level of polymorphism within the parental germplasm set, for degree of linkage to the target
trait, and for robustness in high-throughput screening systems. Three approaches can be considered for the incorporation of
molecular markers into a rice improvement program: (1) as an addendum to the existing program; (2) as one or more separate
subprograms, for example, as part of a backcrossing program or as a separate single-seed-descent subprogram; and (3) as
part of a radical redesign of the breeding and selection program, perhaps incorporating doubled-haploid technology. The choice
of approach will depend on the characters of interest, the resources available, and the time frame. Applications of molecular
markers to rice improvement other than for marker-assisted selection include identification of true hybrids, identification of
contested parentage, accelerated backcrossing, tracking of male sterility genes, identification of appropriate parents, and in
the study of wide hybrids. Strategies for the introduction of molecular marker technologies into the Australian rice improvement
program are discussed, using fragrance and semidwarfism as examples.
Molecular markers provide the ideal tool for improving the
effectiveness of selection for desirable traits in new rice varieties.
The characters most suited to molecular marker-assisted
selection must be identified and methods for the integration of
molecular technologies with current breeding strategies devised.
The application of molecular markers in the Australian
rice industry will include (1) an assessment of markers already
developed for use in Australian rice breeding populations, (2)
identification of new characters for future applications of molecular
markers, and (3) consideration of strategies for the introduction
of molecular marker technologies into the Australian
rice improvement program.
Existing markers
Garland and Henry (2000) developed molecular markers for
the identification of major genes governing semidwarf (sd1)
and grain fragrance (fgr) in rice.
Semidwarfism
The semidwarf gene (sd1) is responsible for producing sturdy,
moderately short plants with a high harvest index. This gene is
the source of semidwarfism in Australian rice varieties (Garland
and Henry 2000). Plant height is also influenced by environmental
and other genetic factors. A molecular marker for
this trait will allow sd1 to be detected accurately on a singleplant
basis, early in a selection program, regardless of confounding
effects.
Four useful polymerase chain reaction (PCR)-based
markers, closely linked to sd1, have been produced. They are
SCU-Rice-SSR-2 (source RG109) and SCU-Rice-STS-13312,
detected by size separation, and SCU-Rice-STS-S13471 and
SCU-Rice-STS-RG220, detected through restriction digest
(Garland and Henry 2000). A suitable polymorphic marker
was detected for most of the pairwise comparisons between
the semidwarf and tall varieties. It is envisioned that the markers
for sd1 will be applied to marker-assisted backcrossing.
Fragrance
The genetic control of fragrance in rice is more complicated
than that of semidwarfism. Fragrance is the essential character
involved in the production of basmati- or jasmine-type aroma.
Several chemicals are involved in producing this aroma (Buttery
et al 1983); however, a single constituent (2-acetyl-1-
pyrroline) is believed to be a major component and is controlled
by a single gene (Garland et al 2000). The current assessment
method of tasting individual grains for fragrance in
rice is labor-intensive and inaccurate (Garland and Henry
2000).
Three PCR-based markers—SCU-Rice-SSR-1, RM223,
and RM42—have been identified for fgr (Garland et al 2000).
A suitable polymorphic marker was detected for most pairwise
comparisons between fragrant and nonfragrant varieties. These
markers have already been used for the selection of fragrant
breeding lines from several populations in the Australian breeding
program.
A few important parent combinations, however, cannot
be distinguished for their fragrance status using these markers.
Development of further markers for fgr, to distinguish
between some important parental breeding combinations, is
therefore an important objective.
Molecular markers, QTL mapping, and marker-assisted selection 213

Identifying potential characters for the application of molecular
marker-assisted selection
Potential for the application of molecular markers to the Australian
rice breeding program has been assessed through the
following process:
1. The current rice improvement methods and strategy
were broadly defined.
2. A comprehensive list of breeding objectives was compiled.
3. Criteria were defined for the identification of traits
most suited to the application of molecular markers.
4. Literature was searched to assess the state of development
of markers and the application of marker-assisted
selection for each of these characters.
Current improvement strategies
Recurrent selection methodologies are primarily used in the
Australian rice improvement program. Typically, varieties will
undergo 8–12 years of assessment from the time of initial cross
through selection and release. Crosses are generally biparental.
Selection in early generations is based on agronomic performance
and visually assessed seed characters. More emphasis
is placed on quality characters in later generations of the
selection process. From around one million individual plants
tested in the F 2 generation, as few as one line may be selected
for release as a new variety.
Breeding objectives
The Australian rice improvement program breeds for eight
major grain types. These encompass short-, medium-, and longgrain
types, including fragrant, arborio, and sushi types. Waxy
or organically produced rice may be important in the future.
Breeding objectives currently applied by the Australian
rice improvement program can be broadly classified as agronomic
or quality-related (Table 1). As well as yield per se,
most specific characters relate to avoidance of or tolerance for
abiotic stresses and to harvestability. Characters listed as potential/future
agronomic target attributes relate to potential
threats of disease and possible changes in agronomic practices
associated with sustainability. Quality-related breeding
objectives relate to consumer preference and processing traits.
Potential/future quality traits include possible changes in enduse
or access to different market niches.
Criteria for identifying traits suited to the application
of molecular markers
Markers can be developed in the short, medium, and long term.
The criteria for selection of target traits include
l The character is of importance to industry.
l The trait is relatively simply inherited.
l The character is difficult to assess.
l
l
The existing assessment of the trait is unreliable.
The trait is influenced to a large extent by the environment
or by G × E interactions.
l It would be desirable to test for the trait earlier in the
breeding program.
l The trait cannot be assessed using a bioassay in Australia.
For example, quarantine considerations prevent
the introduction of new diseases into Australia. Having
resistance to these diseases in the local germplasm
would be a prudent safeguard against disease outbreaks.
Using these criteria, a set of characters potentially suited
to the application of selection using molecular markers is highlighted
in Table 1.
Strategies for introducing molecular marker technologies into
the improvement program
Options for incorporating molecular markers
Three general approaches can be considered for incorporating
molecular markers into the Australian rice improvement program:
1. Incorporation as an adjunct to the existing program.
2. Use in one or more subprograms: (a) as part of a backcrossing
(or enhanced backcrossing) program or (b)
as a separate single-seed-descent subprogram.
3. As part of a radical redesign of the breeding and selection
program.
This is likely to involve incorporating the use of both
molecular markers and doubled haploids. Involvement would
begin with parent selection, and molecular markers could be
involved in the improvement process right through pure seed
selection and variety registration.
Which of the above options is the most appropriate will
depend on the characters being selected. For example, the use
of molecular markers for fragrance may suit option 1. Option
2 would suit incorporation of disease resistances. Options 1
and 2 could probably be undertaken within the next year or
two, whereas option 3 could be implemented in the longer term
of perhaps 4–6 years.
References
Buttery RG, Ling LC, Bienvenido OJ, Turnbaugh JG. 1983. Cooked
rice aroma and 2-acetyl-1-pyrroline. J. Agric. Food Chem.
31:823-826.
Garland S, Henry R. 2000. Application of molecular markers to rice
breeding in Australia: molecular markers for the sd-1 and fgr
genes. A report for the Rural Industries Research and Development
Corporation. Kingston, ACT (Australia): RIRDC.
Garland S, Lewin L, Blakeney A, Reinke R, Henry R. 2000. PCRbased
molecular markers for the fragrance gene in rice (Oryza
sativa L.). Theor. Appl. Genet. 101(3):364-371.
Notes
Authors’ addresses: M. Christopher, S. Garland, and R. Henry, Centre
for Plant Conservation Genetics, Southern Cross University,
PO Box 157, Lismore, NSW 2480, Australia; R. Reinke, Yanco
Agricultural Institute, Yanco, NSW 2703, Australia.
214 Advances in rice genetics

Table 1. Traits currently selected as part of the Australian rice improvement program, and characters that may be
desirable to select, where a more suitable selection method is available. Some of the traits listed overlap. Characters
in bold indicate traits considered good candidates for the development of molecular markers for the Australian
rice improvement program. For height (semidwarf) and major fragrance components, markers have already
been developed for use in Australian breeding populations. In addition to those characters selected, cold tolerance,
starch content and starch characters, and the sun-cracking character are being examined by other projects.
Simply Environmental Current assessment
Breeding objectives inherited influence
Difficulty Accuracy Stage Importance
Agronomic
Current
Yield potential No High Medium High Late Very high
Height (semidwarf) Yes High Medium Medium Early High
Reduced lodging Yes High Low High Early High
Cold tolerance: at reproductive stage No High Medium-high High Medium Very high
at establishment No High Medium-high Medium Medium High
Short growing season, early maturity Medium Low High Early High
No pubescence Yes Low Low High Early Medium Hull color
Yes Low Low High Early Medium Awnless Yes M e -
dium Low High Early Medium Straight head High
Medium Medium Medium Medium Split gloom High Medium
Medium Medium Low
Ease of threshing Medium Low Medium Medium Medium
Future/possible
Disease resistance: blast Yes High High na a na Medium
sheath blight Yes High High na na Medium
bacterial blight Yes High High na na Medium
Herbicide resistance Yes Medium Low na na Low
Water-use efficiency No Medium High na na High
Nutrient efficiency (especially nitrogen) No High High na na Medium
Allelopathy na na Medium
Seedling vigor (water-use No High High na na High
efficiency/weeds/organic)
Flooding tolerance No High Medium na na Medium
Quality
Current
Amylose type and content Yes Medium Medium Medium Medium High
Amylopectin type and content Yes Medium Medium Medium Medium High
Grain length × width Yes Medium Low High Late High
Grain extension when cooked Yes Low Medium High Late High
Low chalk Yes High Low High Late High
Taste/fragrance as major component Yes Medium High Low Early
Gelatinization temperature Yes Low Medium Medium Medium High
Cooking time Yes Low Medium Medium Late Low
Sun cracking Yes High Low High Medium High
Pericarp color Yes Low Low High Early Medium
Milled grain color Yes Medium Medium High Late High
% whole-grain mill out No High Low High Medium High
1,000-grain weight No Medium Low High Medium High
Future/possible
Taste/fragrance as minor Yes Medium High na na Medium
component
Protein type and content Yes High Low na na Medium
Fiber/starch chain content na na Medium
Grain length × width consistency
within plant Medium Medium na na Medium
Standability No High na na Medium
Translucence High na na Medium
Waxy type Yes Low Low na na Low
Nutrition Medium Medium/high na na
a na = not applicable.
Molecular markers, QTL mapping, and marker-assisted selection 215

Application of molecular markers in rice breeding
in the Mekong Delta of Vietnam
Bui Chi Buu and Nguyen Thi Lang
The Mekong Delta is considered the largest granary of the country and it contributes more than 50% of rice production in
Vietnam. Both conventional and nonconventional breeding methods are being employed in rice. Marker-aided selection (MAS)
is applied to enhance selection efficiency. Genetic diversity was analyzed among wild species and landraces to select appropriate
breeding materials through isozyme markers and RAPD. Sequence-tagged site (STS) markers were used to detect
resistance genes for brown planthopper (BPH), bacterial blight, and blast. Most traditional cultivars in the delta were considered
as good sources for genes Pi2, xa5, and xa13. RG457 was found to be a useful marker for detecting BPH resistance to
biotypes 2 and 3. QTL analysis on salt tolerance was implemented with recombinant inbred line Tenasai 2/CB and F 3
populations
(IR28/Doc Phung). The 31 microsatellite markers and 74 RFLP markers were assigned to linkage groups. The linkage map
had a total map length of 2,340.50 cM. Markers associated with salt tolerance were located mostly on chromosomes 1, 2, 3,
9, 11, and 12. Four QTLs were identified for seedling survival, one for dry shoot weight, two for dry root weight, one for Na +
absorption, one for K + absorption, and four for Na + / K + ratio.
The Mekong Delta is considered the largest granary of the
country and plays the most important role in food security
policy. The delta contributes more than 50% of rice production
in the whole country. By 2010, the delta must produce
18–20 million t of rice. This a great challenge for rice breeders
at the Cuu Long Delta Rice Research Institute (CLRRI).
CLRRI has released 62 varieties since 1977. However, the delta
has 1.8 million ha of acid sulfate soil and 0.7 million ha of
salinity. Intensive rice cultivation in the delta has led to an
increased threat from continuously changing disease races and
insect biotypes. To overcome these constraints, there is an urgent
need to widen the gene pool of rice cultivars. Wild species
of rice are an important reservoir of useful genes. Molecular
breeding provides powerful new tools for rice improvement.
Molecular markers have several advantages over the traditional
phenotypic markers that were previously available to
plant breeders. They offer great scope for improving the efficiency
of conventional plant breeding by carrying out selection
not directly on the trait of interest but on molecular markers
linked to that trait. Molecular markers applied in rice breeding
at CLRRI have been used for some major biotic stresses
such as brown planthopper, blast, and bacterial blight and they
have also been used to analyze the genetic diversity of rice
germplasm, including 1,800 accessions of landraces and nearly
200 populations of three wild rice species (Oryza rufipogon,
O. nivara, and O. officinalis). Quantitative trait loci analyses
on salt tolerance and aluminum toxicity tolerance have been
main activities of rice genomics at CLRRI.
Genetic diversity
South Asia is a rich source of diversity for rice and its relatives.
The primary area of diversity for rice extends from the
foothills of the Himalayas from Nepal to northern Vietnam
(Chang 1976). Previous collecting efforts for wild Oryza species
in South Vietnam have concentrated on the Mekong Delta,
especially in Dong Thap Muoi.
Oryza officinalis (CC) can be found at the edge of fruit
orchards or in the shade of citrus plantations (Tien Giang and
Can Tho provinces), and in mangroves in Ca Mau peninsula.
O. officinalis has a wide range of resistance to pests. Oryza
nivara (AA) is an annual species that has been exploited for
its resistance to virus disease. Many years ago, it was found in
Dong Thap Muoi. However, it is now found only in Ho Lac
(High Plateau of Vietnam).
Many populations of Oryza rufipogon, a perennial species
(AA), have been found in Vietnam, from north to south,
with very diverse populations, especially in the Mekong Delta.
One hundred sixty populations were identified by four primers
designed through a centromere mapping program (Fig. 1).
Widespread and well-established populations of O. rufipogon
(perennial), O. nivara (annual), and “spontanea” (weedy) rice
can be found along borders of rivers and canals of the delta,
and sometimes in rice fields or marshes.
Among populations of O. rufipogon, 12% and 5% of the
populations were scored 1 and 3 (resistant), respectively, for
brown planthopper reaction. In the case of O. officinalis, 10%
were scored 1 and 13% were scored 3 (resistant). It is considered
a good donor for brown planthopper resistance and has
been successfully exploited in our breeding program (Buu et
al 1997). O. rufipogon is also considered a source that can
control acid sulfate tolerance and blast resistance. Of the populations,
39%, 40%, and 6% showed their blast resistance with
scores of 0, 1, and 3, respectively.
In the case of traditional cultivars, more than 1,800 accessions
are conserved at CLRRI. The average gene diversity
index (H) was highest among the landrace populations originating
from the High Plateau (0.276), followed by northern
areas (0.259), the Central Coast (0.254), and the Mekong Delta
(0.228), through isozyme analysis (Buu et al 1997). Four ge-
216 Advances in rice genetics

1 2 3 4 5 6 7 8 9 101112 13141516 1718 192021 22
23 24 25 26 27 2829 30 31 32 33 34 35 36 37 38 39 40 41 42
Fig. 1. Polymorphism in wild species detected with primer S3A9 (201/65).
Lanes 4–8: Oryza rufipogon population in Dong Thap Muoi; lanes 13–15: O.
nivara; lanes 24–30: O. officinalis population from Mekong Delta.
netic clusters were identified by Tocher and Mahalonobis methods
based on morphological traits. Floating rice cultivars in
the Mekong Delta (cluster I) are closer to Oryza rufipogon.
Cluster II included local rice accessions with salt tolerance
collected from coastal areas. Cluster III included deepwater
rice collected from the western region of the Bassac River with
improved plant type. Cluster IV was composed of early-monsoon
rice cultivars without photosensitivity.
The classification of rice germplasm through random
amplified polymorphic DNA (RAPD) showed two major clusters
and many subclusters that provide useful information for
selecting parents in the development of an intercluster crossing
program. Upland rice landraces such as Jo Ahn and Koi
Ame were classified in the same cluster. Glutinous rice varieties
such as Nep Som and Nep Oc have the same subcluster as
deepwater rice in the Mekong Delta such as Nam Vang and
Lua Lem Lun. Glutinous floating rice Nep Co Ba was classified
in the same cluster as normal glutinous rice Nep Cai Hai
Duong.
Some cultivars were successfully exploited in the CLRRI
breeding program because of their significant values of genetic
distance such as Bong Huong, Lua Thom, and Nep Thom
compared with exotic materials; however, germplasm use in
the gene bank is still very low (less than 0.3%). New varieties
released through this approach were OM2031 (Thai Lan/Bong
Huong) and AS996 (IR64/O. rufipogon).
DNA survey for bacterial blight resistance
A set of 67 accessions was used to evaluate lines with bacterial
leaf blight (BB) resistance by DNA markers. Genotypes
with stable BB resistance (e.g., Nep Hoa Vang, Bong Trang,
and Ba Le) have been developed in Vietnam from such
phenotyping, and others have often expressed no stability for
the resistance (Buu et al 1997). A survey to collect BB isolates
has been used since 1997 from North to South Vietnam.
The isolates were divided into seven groups based on their
pathogenicity. IRBB1, IRBB2, IRBB11, Kinmaze, and TN1
were susceptible to all isolates. Resistant plants had a 1,500-
bp band and susceptible plants a 1,000-bp band. Giau Dumont,
Ba Ren, and Trang Lun (deepwater rice); Nang Tri (floating
rice); Ba Tuc, Giong Doi, and Koi Bo Teng (upland rice) were
predicted to be resistant to BB (xa5). Marker-assisted selection
could simplify the process of combining the recessive xa5
resistance gene with other dominant BB resistance genes that
have overlapping effects or race specificities (Blair and
McCouch 1997). Useful molecular markers and near-isogenic
lines (NILs) carrying a single resistance gene are available.
IRBB3, IRBB4, IRBB5, IRBB6, and IRBB8 indicated resistance
to isolates collected in both North and South Vietnam.
Deepwater rice cultivars Trang Lun, Trang Phuoc, and Lua
Mua 16, which contain the genes xa5 and xa13 according to a
DNA survey, showed their stable resistance to BB in the monsoon
season of the delta. Promising high-yielding varieties from
crosses including donor genes with BB resistance were also
evaluated. Released varieties such as OM997, OM1490, and
OM1723 are resistant to most isolates from the north but not
to isolates from the south. Resistance based on major and minor
genes, or gene pyramiding, should be considered in further
rice breeding programs.
Molecular markers, QTL mapping, and marker-assisted selection 217

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 M
Fig. 2. Digested PCR products with HaeIII of traditional rice cultivars at locus RG64 to
detect Pi-2 gene (lane 1: CO39, susceptible: lane 2: C10151, resistant).
DNA survey on blast resistance
The selected RILs (C101A51) from a cross between 5173 (Pi2
gene) and CO39 linked to RG64 were added to the set for
blast resistance, with a genetic distance of 2.8 cM, located on
chromosome 6. A sequence-tagged site (STS) was generated
and PCR products were digested with HaeIII. The resistant
genotypes had a 750-bp band and the susceptible genotypes
had a 650-bp band (Fig. 2). Resistant landraces were predicted
by the marker as Nho Vang, Nho Thuoc Co, Ong Kho, Soc
Nau, Trang Chum, and Tau Huong (rainfed genotypes), along
with Nang Tri and Chet Cut (floating genotypes) (Buu et al
1997). Segregants of crosses including these donor materials
were also evaluated with the STS, simultaneously. For
phenotyping, rice blast isolates have been collected in the delta
since 1996. They were classified into four pathogenic races,
and the highest virulence was recognized in race 106.4. Among
1,150 landrace accessions screened for blast, 46 accessions
showed stable resistance, such as Te Tep, Sa Mo Ran, Tep Sai
Gon, Gie Noi, and Ba Le. Their resistance was detected by
STS markers. Genes for resistance in Te Tep controlling blast
were determined to be three dominant genes and one recessive
gene; in Gie Noi and Ba Le, two dominant inhibitory genes
controlled resistance (Buu et al 1992).
DNA survey for brown planthopper resistance
Population trends of brown planthopper (BPH) in the Mekong
Delta in five recent years were reviewed and its virulence to
rice varieties was examined by a seed-box screening test (Chau
1998). The BPH population in the delta is a mixture of biotypes
2 and 3, which are distinct from those in the north and
Central Coastal areas. Of the distinct O. officinalis populations
collected in the delta, 23% showed resistance to the new
BPH population. Of the thousands of landraces screened, 9%
are resistant to the old BPH population (1980-90) and none to
the new BPH population. A DNA survey was simultaneously
carried out to detect the BPH resistance gene among landraces
and wild rice species.
Two pairs of primer RG457 were used. An STS was generated
and PCR products digested with HinfI and AluI. Two
introgression lines (IR65482-4-136 and IR65842-17-511) resistant
to BPH biotypes 1 and 3 were selected for BC 2 F 4 of the
cross IR31917-45-3-2/O. australiensis (acc. 100882). DNA
of the F 2 population from IR54742/IR31917 was assessed
through PCR amplification using primer pair RG457RL/FL.
The banding pattern of the 37 F 2 individuals could be classified
into homozygote for the IR54742-type marker with the
size of 300-, 250-, and 200-bp fragments, homozygote for the
IR31917-type marker with the size of 500- and 200-bp fragments,
and heterozygotes displaying both fragments.
QTL analysis for salt tolerance
In the Mekong Delta, saline coastal soils cover approximately
703,000 ha (Buu et al 1995). Salt intrusion occurs from December
to May. Efforts have been made to identify a parameter
that could be used as the criterion for mass screening.
Parameters generally proposed are leaf injury rate at the seedling
stage, sterility after heading, and Na + /K + ratio in shoots
under saline conditions (Buu et al 1995). Selection efficiency
for salinity tolerance under field conditions remains very low
because of stress heterogeneity and the presence of other soilrelated
stresses. Two or more genes (quantitative) that significantly
interact with the environment govern salt tolerance.
Using F 6 RIL populations from the cross Tesanai 2/CB, one
QTL for survival days for salt tolerance was detected on chromosome
5 (Lin Hong Xuan 1995). Another QTL was also detected
on chromosome 10 for salt tolerance in the same cross
(Shahid Masood 1997).
Considerable genetic variation has been reported in salinity
tolerance among rice varieties. The salt tolerance of Nona
Bokra is greatest at the seedling and vegetative stages, Pokkali
is more tolerant at the reproductive stage and less sensitive to
photoperiod (Senadhira 1987), and Doc Do and Doc Phung
were considered as salt-tolerant donors in Vietnam (Buu et al
1995). Among 418 local rice accessions screened under salt
stress of 6–12 dS m –1 , 44 accessions were tolerant, including
Nang Co Do, Soc Nau (Buu et al 1995), Doc Do, Doc Phung,
Trai May, Ca Dung Trang, etc.
Progress in rice breeding for improved salt tolerance at
CLRRI has been based on the identification of a major gene
controlling salt tolerance in rice at the vegetative and reproductive
stage. An F 2 population was developed from IR28/
218 Advances in rice genetics

Tesanai
CB
Marker
Segregating RI individuals
Fig. 3. Segregation of RFLP marker C178 (chromosome 1) in a recombinant inbred (RI) population
of Tesanai 2/CB to detect the salt-tolerance gene.
Doc Phung. Another population of 108 RI lines was derived
from a cross between Tesanai 2 from China (tolerant variety)
and CB from the U.S. (susceptible). The RILs were evaluated
for seedling survival days (SD), dry root weight, dry shoot
weight, Na + and K + accumulation, and Na + /K + ratio in culture
solution (EC = 12 dS m –1 ). RFLP and microsatellite markers
of this population were used to detect the linkage to the target
traits (Fig. 3).
The 31 microsatellite markers and 74 RFLP markers were
assigned to a linkage group (Fig. 4). Although there are a few
gaps of more than 50 cM, the linkage map had a total map
length of 2,340.50 cM. The average interval size was 21.68
cM. RFLP analysis showed little polymorphism. Three
microsatellite markers were tightly linked with salinity tolerance:
RM209 and RM214 (chr. 11), and RM240 (chr. 2). Four
QTLs were identified for seedling survival days, one QTL for
dry shoot weight, two QTLs for dry root weight, one QTL for
Na + absorption, one QTL for K + absorption, and four QTLs
for Na + /K + ratio. The proportion of phenotypic variation explained
by each QTL ranged from 5.2% to 11.6% for SD and
from 4.8% to 14.4% for morphological characters and Na +
and K + accumulation.
References
Blair MW, McCouch SR. 1997. Microsatellite and sequence tagged
site markers diagnostic for rice bacterial leaf blight resistance
gene xa-5. Theor. Appl. Genet. 95:174-184.
Buu BC, Loan LC, Bay ND, Tao NV. 1992. Collection and evaluation
of rice germplasm in Mekong Delta. Vietnam Agric. Food
Stuff J. 357(3):90-92. (With English summary.)
Buu BC, Lang NT, Tao PB, Bay ND. 1995. Rice breeding research
strategy in the Mekong Delta. In: Fragile lives in fragile ecosystems.
Proceedings of the International Rice Research Conference.
Los Baños (Philippines): International Rice Research
Institute. p 739-755.
Buu BC, Tao NV, Lang NT. 1997. Rice germplasm conservation. In:
CLRRI Ann. Rep., Agric. Publ., Vietnam. p 9-16.
Chang TT. 1976. Exploitation and survey in rice. In: Frankel OH,
Hawkes JG, editors. Crop genetic resources for today and tomorrow.
Cambridge (UK): Cambridge University Press. p 159-
165.
Chau LM. 1998. Fluctuation and virulence of brown plant hopper
population in the Mekong Delta. OMonRice 6:63-75.
Lin Hong Xuan.1995. Mapping of QTL for salt tolerance in rice
(Oryza sativa L.) via molecular markers. Okinawa Subtropical
Station, JIRCAS 4:240-265.
Senadhira D. 1987. Salinity as a constraint to increasing rice production
in Asia. Paper presented at workshop on maintenance
of life support species in Asia Pacific Region, 4-7 April 1987.
Shahid Masood M. 1997. Identification and evaluation of salinity
tolerance in rice (Oryza sativa L.) using molecular markers.
Okinawa Subtropical Station, JIRCAS 6:121-135.
Notes
Authors’ address: Cuu Long Delta Rice Research Institute (CLRRI),
Omon, Cantho, Vietnam.
Acknowledgments: Thanks are due to the Rockefeller Foundation
for supporting the rice biotechnology project at CLRRI, Dr.
D.S. Brar for helping and supplying his breeding materials,
and Drs. G.S. Khush, Ning Huang, and Zhikang Li for their
advice and guidance.
Molecular markers, QTL mapping, and marker-assisted selection 219

cM
43.0
16.5
9.0
6.9
28.8
15.6
7.7
10.8
1.0
19.5
26.9
40.0
34.1
(1) RM212
(2) C86
(3) R2417
(4)
(5)
C1370
RM227
(6) C955
(7) C178
(8) R210
(9)
(10)
RM220
RM81A
(11) RM24
(12) C122
(13) C970
(14) C112
45.3
0.5
00.0
15.7
11.9
66.1
7.2
39.2
2.8
2.8
1.4
12.6
(15) RM240
(16) R1643
(17) R2510
(18) R26
(19) C560
(20) C747
(21) RM211
(22) RM233
(23) RM234
(24)
(25)
RM207
RM208
(26) RM213
43.0
4.0
40.4
9.4
14.0
38.7
10.3
13.6
5.3
33.1
Chr. 3
(28) C1488
(29) RM227
(30) RM231
(31) R250
(32) C746
(33) R19
(34) C516
(35) R2170
(36) C63
(37) C563
(38) R3156
50.2
34.8
33.1
26.7
Chr. 4
(39) C891
(40) R2373
(41) C734
(42) C445
(43) C1016
Chr. 1
(27) G227
Chr. 2
30.7
9.0
12.0
57.6
Chr. 5
(44) R521
(45)
(46)
R2558
R372
(47) R2289
(48) RM31
(49) R2147
12.6 (58) C39
7.7
(50) R2171
(51) R2123
32.0
32.8
(59) R3089
18.0
(52) R1952
(60) R1440
17.1
20.1
(61) RM214
(53) RM226
19.0
37.7
(54) RM217
17.8
(55) RM204
2.7
(62) R1789
(63) C596
37.7
Chr. 7
47.8
(56) C358
(57) R1167
12.6
27.6
30.3
10.2
27.0
11.2
2.1
50.9
(64) RM25
(65) RM223
(66) RM210
(67) C347
(68) G1073
(69) R2662
(70) R1963
(71) C1121
Chr. 6
Chr. 8
(72) R902
22.1
18.4
11.2
12.1
14.0
39.9
19.5
18.1
8.4
10.2
Chr. 9
(73) C506
(74) RM215
(75) RM201
(75) RM205
(77) RM219
(78) RM242
(79) C711
(80) C1454
(81) C397
(82) R1751
(83) R2538
47.8
51.0
44.1
18.7
Survival days (SD) Shoot wt. Root wt.
Na + K + Na + /K + ratio
(84) RM216
(85) R2174
(86) RM228
(87) R716
(88) C1286
Chr. 10
50.9
36.8
27.0
34.5
10.1
30.2
11.0
10.4
23.0
5.0
(99) R728
(100) RM224
(101) RM202
(102) RM206
(103) RM209
(104) G257
(105) G320
(106) C535
(107) C477
(108) C1506
(109) C950
50.9
3.3
6.0
12.3
87.6
11.0
28.1
Chr. 12
(101) RM235
(102) C901
(103) C443
(104) R1684
(105) G24
(106) R2375
(107) G2140
(108) R542
60.3
(110) C50
Chr. 11
Fig. 4. QTLs for salt tolerance mapped using recombinant inbred lines derived from a cross between Tesanai 2 (tolerant) and CB (susceptible).
220 Advances in rice genetics

Converting rice RFLP markers to PCR-based markers
by the dCAPS method
T. Komori, T. Yamamoto, and N. Nitta
We studied the use of the dCAPS method in rice, whose genome is about four times larger than that of Arabidopsis thaliana.
Results indicated that the dCAPS method would be of great help in developing PCR-based markers in rice. Results are
presented on how to develop dCAPS markers, especially for designing mismatched primers.
CAPS (cleaved amplified polymorphic sequence) markers are
advantageous in genetic analyses for several reasons: (1) only
nanogram quantities of DNA are required as a template, (2)
no tedious Southern hybridization is required, and (3) results
are highly reliable. The existence of a polymorphism-producing
restriction site difference between varieties is essential for
developing a CAPS marker. Although single nucleotide polymorphism
is one of the most common classes of DNA polymorphism,
the majority of single-base changes produce no
restriction site difference and thus do not serve the purpose of
developing CAPS markers. Recent research (Michaels and
Amasino 1998, Neff et al 1998) has revealed that single-base
changes producing no restriction site difference can be used in
developing new markers by means of the dCAPS (derived
CAPS) method in Arabidopsis thaliana.
As a model case, conversion of RFLP marker C81 to a
dCAPS marker was attempted.
Sequence comparison
The nucleotide sequence of RFLP marker probe C81 was determined,
and a set of polymerase chain reaction (PCR) primers
(F and R) was designed to amplify the corresponding genomic
region. When PCR was conducted with genomic DNA
of rice varieties, Asominori and IR24, 315-bp-long PCR products
were obtained. These products were purified by gel electrophoresis
and used for direct sequencing. One single-base
change was found.
Development of a dCAPS marker
To develop a dCAPS marker, five mismatched primers were
designed (Fig. 1). Each primer was combined with the R primer
and PCR was conducted using genomic DNA. Cycling conditions
were 94 °C for 2 min, followed by 35 cycles of 94 °C for
30 sec, 58 °C for 30 sec, and 72 °C for 30 sec. The extension
of the final cycle was prolonged to 2.5 min. TaKaRa ExTaq TM
was used as the DNA polymerase. The PCR product was treated
with EcoRI and separated by electrophoresis on 3%
MetaPhor TM agarose (FMC BioProducts) gel.
When F 3 , F 4 , or F 5 primer was used, the expected polymorphism
was observed; the IR24 product was digested with
EcoRI, and Asominori product was not. In contrast, when F 1
or F 2 primer was used, no polymorphism was observed. A sequence
analysis of each PCR product demonstrated that the
mismatch incorporated into F 1 and F 2 primers was repaired
during PCR amplification, probably because of the proofreading
activity of TaKaRa ExTaq TM . Our results contrast with those
of Michaels and Amasino (1998), who reported that mismatches
at the first or second base from the 3′ end of primers
would be preferable. The difference between their results and
ours might be due to the PCR conditions, especially the polymerase
used. In fact, we developed one dCAPS marker particular
for the polymerase. When TaKaRa Taq TM , which lacks
the proofreading activity, is used, polymorphism is shown as
expected. When TaKaRa ExTaq TM is used, the expected polymorphism
is not evident. The polymorphic pattern may change
depending on the polymerase used.
Applying the dCAPS method
It was shown that the dCAPS method could be applied to rice
genetic analysis. This method can potentially use any single
nucleotide polymorphism (SNP) for developing a PCR-based
marker, although some ingenious devices might be needed in
some cases. Figure 2 shows a typical example of such a case.
Two tactics are employed. One is disrupting redundant MboI
sites that exist in the region to be amplified and that would
make it difficult to detect the polymorphism clearly (Fig. 2, F
primer). The other is creating an MboI site that results in the
susceptibility of every PCR product to MboI and thus is useful
for avoiding misgenotyping caused by incorrect experimental
procedures (Fig. 2, R primer).
References
Michaels SD, Amasino RM. 1998. A robust method for detecting
single-nucleotide changes as polymorphic markers by PCR.
Plant J. 14:381-385.
Neff MM, Neff JD, Chory J, Pepper AE. 1998. dCAPS, a simple
technique for the genetic analysis of single nucleotide polymorphisms:
experimental applications in Arabidopsis thaliana
genetics. Plant J. 14:387-392.
Notes
Authors’ address: Orynova K.K., 700 Higashibara, Toyoda, Iwata,
Shizuoka 438-0802, Japan.
Molecular markers, QTL mapping, and marker-assisted selection 221

Genome (Asominori): ATTCAGAAGCCGATCGAGCAGGGTACCAGTAACTGCATGATGCTAATTTGA
TTAGGAGCGCTCTATATATATTAATTAATCTATTATGTGTTTTTATTATGCTGAGCTCGTGTTAATCTGTCATCCG
Genome (IR24): ATTCAGAAGCCGATCGAGCAGGGTACCAGTAACTGCATGATGCTAATTCGATTAG
GAGCGCTCTATATATATTAATTAATCTATTATGTGTTTTTATTATGCTGAGCTCGTGTTAATCTGTCATCCG
Primer (F1): GCAGGGTACCAGTAACTGCATGATGCG
Primer (F2): CAGGGTACCAGTAACTGCATGATGCGA
Primer (F3): AGGGTACCAGTAACTGCATGATGCGAA
Primer (F4): GGGTACCAGTAACTGCATGATGCGAAT
Primer (F5): GGTACCAGTAACTGCATGATGCGAATT
Primer (R): CTCGAGCACAATTAGACAGTAGGC
Expected PCR product
F1, Asominori: CAGGGTACCAGTAACTGCATGATGCGAATTTGATTAGGAGCGCTCTATATATATTAAT
TAATCTATTATGTGTTTTTATTATGCTGAGCTCGTGTTAATCTGTCATCCG
F1, IR24: GCAGGGTACCAGTAACTGCATGATGCGAATTCGATTAGGAGCGCTCTATATATATTAATTA
ATCTATTATGTGTTTTTATTATGCTGAGCTCGTGTTAATCTGTCATCCG
F2, Asominori: CAGGGTACCAGTAACTGCATGATGCGAATTTGATTAGGAGCGCTCTATATATATTAAT
TAATCTATTATGTGTTTTTATTATGCTGAGCTCGTGTTAATCTGTCATCCG
F2, IR24: CAGGGTACCAGTAACTGCATGATGCGAATTCGATTAGGAGCGCTCTATATATATTAATTAA
TCTATTATGTGTTTTTATTATGCTGAGCTCGTGTTAATCTGTCATCCG
F3, Asominori: AGGGTACCAGTAACTGCATGATGCGAATTTGATTAGGAGCGCTCTATATATATTAATT
AATCTATTATGTGTTTTTATTATGCTGAGCTCGTGTTAATCTGTCATCCG
F3, IR24: AGGGTACCAGTAACTGCATGATGCGAATTCGATTAGGAGCGCTCTATATATATTAATTAAT
CTATTATGTGTTTTTATTATGCTGAGCTCGTGTTAATCTGTCATCCG
F4, Asominori: GGGTACCAGTAACTGCATGATGCGAATTTGATTAGGAGCGCTCTATATATATTAATT
AATCTATTATGTGTTTTTATTATGCTGAGCTCGTGTTAATCTGTCATCCG
F4, IR24: GGGTACCAGTAACTGCATGATGCGAATTCGATTAGGAGCGCTCTATATATATTAATTAATC
TATTATGTGTTTTTATTATGCTGAGCTCGTGTTAATCTGTCATCCG
F5, Asominori: GGTACCAGTAACTGCATGATGCGAATTTGATTAGGAGCGCTCTATATATATTAATTA
ATCTATTATGTGTTTTTATTATGCTGAGCTCGTGTTAATCTGTCATCCG
F5, IR24: GGTACCAGTAACTGCATGATGCGAATTCGATTAGGAGCGCTCTATATATATTAATTAATC
TATTATGTGTTTTTATTATGCTGAGCTCGTGTTAATCTGTCATCCG
Actual PCR product
F1, Asominori: GCAGGGTACCAGTAACTGCATGATGCTAATTTGATTAGGAGCGCTCTATATATATTAA
TTAATCTATTATGTGTTTTTATTATGCTGAGCTCGTGTTAATCTGTCATCCG
F1, IR24: GCAGGGTACCAGTAACTGCATGATGCTAATTCGATTAGGAGCGCTCTATATATATTAATTA
ATCTATTATGTGTTTTTATTATGCTGAGCTCGTGTTAATCTGTCATCCG
F2, Asominori: CAGGGTACCAGTAACTGCATGATGCTAATTTGATTAGGAGCGCTCTATATATATTAAT
TAATCTATTATGTGTTTTTATTATGCTGAGCTCGTGTTAATCTGTCATCCG
F2, IR24: CAGGGTACCAGTAACTGCATGATGCTAATTCGATTAGGAGCGCTCTATATATATTAATTAAT
CTATTATGTGTTTTTATTATGCTGAGCTCGTGTTAATCTGTCATCCG
F3, Asominori: AGGGTACCAGTAACTGCATGATGCGAATTTGATTAGGAGCGCTCTATATATATTAATT
AATCTATTATGTGTTTTTATTATGCTGAGCTCGTGTTAATCTGTCATCCG
F3, IR24: AGGGTACCAGTAACTGCATGATGCGAATTCGATTAGGAGCGCTCTATATATATTAATTAAT
CTATTATGTGTTTTTATTATGCTGAGCTCGTGTTAATCTGTCATCCG
F4, Asominori: GGGTACCAGTAACTGCATGATGCGAATTTGATTAGGAGCGCTCTATATATATTAATTA
ATCTATTATGTGTTTTTATTATGCTGAGCTCGTGTTAATCTGTCATCCG
F4, IR24: GGGTACCAGTAACTGCATGATGCGAATTCGATTAGGAGCGCTCTATATATATTAATTAATCT
ATTATGTGTTTTTATTATGCTGAGCTCGTGTTAATCTGTCATCCG
F5, Asominori: GGTACCAGTAACTGCATGATGCGAATTTGATTAGGAGCGCTCTATATATATTAATTAA
TCTATTATGTGTTTTTATTATGCTGAGCTCGTGTTAATCTGTCATCCG
F5, IR24: GGTACCAGTAACTGCATGATGCGAATTCGATTAGGAGCGCTCTATATATATTAATTAATCTA
TTATGTGTTTTTATTATGCTGAGCTCGTGTTAATCTGTCATCCG
Fig. 1. Development of dCAPS marker C81 EcoRI. The nucleotide sequence of genomic
DNA, the primers designed to create the dCAPS marker, and the PCR products
are shown. The underlines indicate an EcoRI site.
222 Advances in rice genetics

Genome (Asominori):
GGATCCAGATCGAGACCGCCAAGATCATCCGCGACCGCCTCCGCTGGTGC
TACCGCATCGAGGGCGTCAACCACCACCAGAAGTGCCGCCACCTCGTCGACCAGTACCTCGAG
GCCACCCGCGGCGTCGGATGGGGCAAGGACGCCCGCCCGCCGGAGCTGCACGGTCCGATGAG
ATGATCC
Genome (IR24):
GGATCCAGATCGAGACCGCCAAGATCATCCGCGATCGCCTCCGCTGGTGCTAC
CGCATCGAGGGCGTCAACCACCACCAGAAGTGCCGCCACCTCGTCGACCAGTACCTCGAG
GCCACCCGCGGCGTCGGATGGGGCAAGGACGCCCGCCCTCCGGAGCTGCACGGTCCGATGAGATG
ATCC
Primer (F): TCCAGATGGAGACCGCCAATATCATCC
Primer (R): CTAGACGTGCCAGGCTACTCTACTAGG
PCR (Asominori): TCCAGATGGAGACCGCCAATATCATCCGCGACCGCCTCCGCTGGTGCTACCG
CATCGAGGGCGTCAACCACCACCAGAAGTGCCGCCACCTCGTCGACCAGTACCTCGAGGCCAC
CCGCGGCGTCGGATGGGGCAAGGACGCCCGCCCGCCGGATCTGCACGGTCCGATGAGATGAT
CC
PCR (IR24): TCCAGATGGAGACCGCCAATATCATCCGCGATCGCCTCCGCTGGTGCTACCGCATC
GAGGGCGTCAACCACCACCAGAAGTGCCGCCACCTCGTCGACCAGTACCTCGAGGCCACCCGC
GGCGTCGGATGGGGCAAGGACGCCCGCCCTCCGGATCTGCACGGTCCGATGAGATGATCC
Fig. 2. A typical example for developing an ideal marker. The forward primer (F) has
two mismatches to disrupt redundant MboI sites, and the reverse primer (R) has
one mismatch to create an MboI site. Underlines indicate MboI sites.
DNA markers to assess genetic purity of rice hybrids
R.V. Sonti, J. Yashitola, T. Thirumurugan, R.M. Sundaram, M.S. Ramesha, and N.P. Sarma
Ensuring hybrid purity is vital for hybrid rice technology. It is conventionally determined by a grow-out test, a time-consuming
and costly method. A variety of DNA markers such as microsatellites, sequence tagged sites (STSs), and random amplified
polymorphic DNAs (RAPDs) were used to distinguish parental lines and their hybrids. Parental lines (A and R) and their hybrids
in a set of four combinations were screened with 13 microsatellites, 10 STS markers, and 50 random primers. Several
polymorphisms were identified after polymerase chain reaction and electrophoresis on agarose gels. As both microsatellites
and STS markers are codominant, the polymorphism detected between the parental lines was used to establish hybridity. In
the case of RAPDs, the dominant polymorphic bands observed in each parental line amplified by the same primer were useful
to distinguish it from its hybrid.
One of the major constraints to the adoption of hybrid rice
technology is the need to produce and maintain an adequate
supply of homogeneous hybrid seed to farmers every season.
The maintenance of a high level of genetic purity of hybrid
seeds is imperative to exploit heterosis. Mao et al (1996) have
estimated that for every 1% impurity in hybrid seed, a yield
reduction of 100 kg ha –1 occurs. The purity of hybrid seed is
conventionally assayed by a grow-out test (GOT) on a representative
sample of seed to be marketed. The GOT is essentially
based on morphological (phenotype) uniformity. The
procedure is subjective as the expression of these traits can be
influenced by environmental factors. Because of their phenotypic
neutrality, DNA-based molecular markers can be used
for a precise assessment of plant genotype (Joshi et al 1999).
Examples of such markers are random amplified polymorphic
DNAs (RAPDs), sequence tagged sites (STSs), microsatellites,
and inter simple sequence repeats (ISSRs).
We examined the utility of RAPDs, STSs, and
microsatellites for assessing the genetic purity of rice hybrids.
Four rice hybrids and their parental lines were analyzed to
develop a marker system for assessing genetic purity. This study
describes the relative merits of these three types of markers
and their suitability for assessing the purity of hybrids as a
substitute for the GOT.
Materials and methods
The rice parental lines and their hybrids (in a set of four combinations)
analyzed are given in Table 1. Genomic DNA was
isolated from leaves of 18–20-day-old greenhouse-grown rice
plants.
A total of 50 random primers, 10 STSs, and 12
microsatellite primers were used in the assay (see details in
Table 2). For the polymorphism survey, DNA samples (50 ng)
were amplified in a reaction volume of 25 µL containing 1X
PCR buffer (10 mM Tris-HCl, pH 9.0, 1.5 mM MgCl 2 , 50
mM KCl, and 0.01% gelatin), 0.2 mM of each dNTP, and 1 U
of Taq DNA polymerase. Samples were overlaid with mineral
oil and polymerase chain reaction (PCR) was carried out in a
thermal cycler (Perkin-Elmer-480). PCR conditions in the
Molecular markers, QTL mapping, and marker-assisted selection 223

Table 1. Rice hybrids analyzed for purity.
Parental and hybrid line
CMS lines
IR58025 A
IR62829 A
Restorer lines
MTU9992
IR40750
BR827-35
Hybrids a
APRH 2 (IR62829A/MTU9992)
DRRH 1 (IR58025A/IR40750)
CNRH 3 (IR62829A/Ajaya)
Sahyadri (IR8025A/BR827-35)
Source
IRRI
Agricultural Research Station, Maruteru, India
IRRI
IRRI
Agricultural Research Station, Maruteru, India
Directorate of Rice Research, Hyderabad, India
Rice Research Station, Chinsurah, India
Regional Agricultural Research Station, Karjat, India
a CMS and restorer lines from which hybrids were obtained are indicated in parentheses.
Table 2. Frequency of heterozygosity at microsatellite and STS loci in rice hybrids.
Rice varieties
Frequency of heterozygosity
CMS line Restorer line Hybrid RAPD a STS Microsatellite
markers markers markers
IR62829A MTU9992 APRH 2 3/50 0/10 2/12
IR58025A IR40750 DRRH 1 1/50 1/10 3/12
IR62829A Ajaya CNRH 3 3/50 1/10 5/12
IR58025A BR827-35 Sahyadri 2/50 3/10 1/12
a For the RAPD, one polymorphic band unique for each parent, which was co-amplified in the hybrid, was
considered as a distinguishing polymorphic marker.
polymorphism survey were as described in the original references.
Results
Genomic DNA was isolated from two CMS lines, four restorer
lines, and four hybrids that are commercially cultivated in different
regions of India. Fifty random primers, 10 STSs, and 12
microsatellite markers were used to analyze these lines under
conditions described earlier. Polymorphisms were detected
after electrophoresis in 1.5% or 3.0% agarose gels, followed
by staining with ethidium bromide.
In RAPD analysis, multiple bands were observed in most
of the parental lines (Table 2). A primer amplifying the polymorphic
band(s) unique for each parent (CMS and restorer) of
a hybrid combination was selected and used to analyze the
corresponding hybrid. Even though many primers produced
such polymorphisms, only five (OPV 6, OPV 7, OPV 12, OPZ
5, and OPZ 17) produced reproducible co-amplification of the
unique parent-specific bands in the hybrids.
Ten STS markers were used for PCR analysis of parental
lines and hybrids (Fig. 1). As expected, only one allele was
detected in a hybrid when the parents were monomorphic for a
particular STS locus and two alleles (one allele per parent)
were present in a hybrid when polymorphism was detected in
the corresponding CMS and restorer lines. Of the 10 STS
markers analyzed, only three (pTA 248, F 8, and F 43) were
polymorphic and the other markers were monomorphic for the
lines screened.
In the case of microsatellites, five loci out of 12 (RM 1,
RM 19, RM 21, RM 164, and RM 206) amplified polymorphic
alleles in the parents (CMS and restorer) and these alleles
were amplified codominantly in the hybrids (Fig. 2). The rest
of the microsatellite markers did not exhibit polymorphism
between the parents.
Discussion
We used 50 random primers, 10 STS markers, and 12
microsatellite markers to detect genetic polymorphism among
two CMS lines, four restorers, and four hybrids. Except for
the parental combination for the hybrid APRH 2 (with respect
to STSs), at least one polymorphism was detected using these
sets of markers for each parental combination used to produce
hybrids.
Among the three marker systems studied, microsatellites
and STSs appear to be the best choice for testing the purity of
rice hybrids because they show codominance of parental alleles
in the hybrid. For RAPDs, even though many of the primers
showed polymorphism between parental lines, only a few
showed amplification of the polymorphic bands in the corresponding
hybrid, and many bands observed in the parental lines
224 Advances in rice genetics

p M 1 2 3 bp M 1 2 3
1,500
1,000
800
500
600
200
Fig. 1. Ethidium bromide-stained electrophoretic profile of PCRamplified
STS markers in CMS, hybrid, and restorer lines—polymorphism
between parental lines (lanes 1 and 3) and a rice hybrid
(lane 2). Molecular weight marker (lane M) used is a 100-bp
DNA ladder.
Fig. 2. Ethidium bromide-stained electrophoretic profile of PCRamplified
microsatellite markers in CMS, hybrid, and restorer
lines—polymorphism between parental lines (lanes 1 and 3) and
a rice hybrid (lane 2). Molecular weight marker (lane M) used is a
100-bp DNA ladder.
were not reproducibly amplified in the hybrids. This limits
their utility for applications such as hybrid purity testing. We
have found that microsatellites and STSs, because of their reproducibility
and robustness of amplification, are the ideal
marker systems for testing hybrid purity. Microsatellites are
likely to be the markers of choice because there are at least
351 well-distributed, polymorphic, and mapped microsatellite
markers in rice (Temnykh et al 2000). This constitutes a large
source of markers for detecting polymorphism between parental
lines of hybrids.
To assess purity through the GOT, a sample of 400 seeds
is used from each seed lot (Verma 1996). A seed sample of the
same size can be used in our DNA marker-based assay. We
have standardized a simple and rapid method for DNA extraction
from 5–7-day-old seedlings and the entire assay can be
completed within 14 days after harvest (data not shown). The
assays can be completed in a modestly equipped laboratory at
a cost of Rs 7,000 ($160; consumables only) for 400 seeds.
Though this cost appears to be high, it is actually insignificant
compared with the amount spent in storage and the costs of
the growth test. In addition, this assay provides much more
accurate results.
References
Joshi SP, Ranjekar PK, Gupta VS. 1999. Molecular markers in plant
genome analysis. Curr. Sci. 77:230-240.
Mao CX, Virmani SS, Ish Kumar. 1996. Technological innovations
to lower the costs of hybrid rice seed production. In: Virmani
SS, Siddiq EA, Muralidharan K, editors. Advances in hybrid
rice technology. Proceedings of the Third International Symposium
on Hybrid Rice, 14-16 Nov 1996, Hyderabad, India.
Manila (Philippines): International Rice Research Institute.
p 111-128.
Temnykh S, Park WD, Ayres N, Cartinhour S, Hauck N, Lipovich L,
Cho YG, Ishii T. 2000. Mapping and genome organization of
microsatellite sequences in rice (Oryza sativa L.). Theor. Appl.
Genet. 100:697-712.
Verma MM. 1996. Procedures for grow-out test (GOT). Seed Tech.
Newsl. 26:1-4.
Notes
Authors’s addresses: R.V. Sonti and J. Yashitola, Centre for Cellular
and Molecular Biology, Hyderabad 500 007, India; T.
Thirumurugan, R.M. Sundaram, M.S. Ramesha, and N.P.
Sarma, Directorate of Rice Research, Hyderabad 500 030,
India.
Molecular markers, QTL mapping, and marker-assisted selection 225

RAPD markers from mitochondrial DNA can distinguish
male sterile and fertile cytoplasm in indica rice
D.L. Hong, M. Ichii, Y. Ohara, C.M. Zhao, and S. Taketa
The total DNA of wild abortive (WA) cytoplasmic male sterile (CMS) line Zhenshan 97A and its maintainer Zhenshan 97B was
extracted by the CTAB method. One hundred primers were used to screen random amplified polymorphic DNA (RAPD) markers
to distinguish male sterile (A) and maintainer (B) plants at the seedling stage. Results showed that in Zhenshan 97A there was
a 1,600-bp DNA fragment in the product amplified by primer OPA12; in Zhenshan 97 B, it was absent. Further, the 1,600-bp
fragment was also found in WA-type CMS line Longtepu A and dwarf abortive (DA)-type CMS line Xieqingzao A, and not found
in their maintainer lines Longtepu B and Xieqingzao B. Also, the 1,600-bp fragment was not found in restorer line Minghui 63
(R). In the F 1
and F 2
of Zhenshan 97A/Minghui 63, all plants had the 1,600-bp fragment. When mitochondrial DNA (mtDNA)
was isolated from three pairs of A and B lines and amplified by OPA12, results showed that the 1,600-bp fragment was found
in the three male sterile lines, and not in the three maintainer lines. In DA-type CMS line Xieqingzao A, two other fragments
(1,000-bp and 700-bp) were found, except the 1,600-bp fragment. These results indicated that the 1,600-bp fragment
amplified by OPA12 was derived from male sterile cytoplasm, and can be used as a RAPD marker to distinguish A and B plants
at the seedling stage. The fragments amplified from mtDNA can be used to distinguish between the WA-type and DA-type
cytoplasm.
Hybrid rice occupies about 50% of the total rice area in China
(Lu and Hong 1999). To maximize the use of heterosis, hybrid
seeds supplied to farmers must be of high purity. Up to now,
the method used to determine hybrid rice seed purity in China
is to plant sample seeds and inspect them at the heading stage.
Discrimination of maintainer and CMS plants can only be conducted
at the heading stage by observing anthers and pollens.
Distinguishing maintainer and CMS lines at the seedling stage
is very useful in practice. Differences between CMS and their
maintainer lines exist in cytoplasm. CMS in rice is closely related
to mitochondria (Yamaguchi and Kakiuchi 1983,
Kadowaki et al 1986, Kadowaki and Harada 1989). In this
paper, we report the results on the use of random amplified
polymorphic DNA (RAPD) markers to distinguish maintainer
from CMS plants at the seedling stage, the segregation of the
RAPD marker in the F 2 generation, and the origin of the RAPD
marker.
Materials and methods
Zhenshan 97A and Zhenshan 97B, Longtepu A and Longtepu
B, Xieqingzao A and Xieqingzao B, restorer line Minghui 63,
and F 1 and F 2 of Zhenshan 97A /Minghui 63 were used in this
study.
Total DNA was extracted by the CTAB method using
0.5–0.8 g of green leaves for each sample. mtDNA was extracted
using the method of Kadowaki et al (1986) with 15–30
g of etiolated shoots.
The PCR amplification solution (40 L) consisted of 10
mM Tris-HCl (pH 8.3), 1.5 mM MgCl 2 , 50 mM KCl, gelatin
0.001%, 0.2 mM dNTP, 0.163 M primer, 0.5 unit Ampli Taq
Gold, and 20 ng template DNA. PCR amplification was conducted
using GeneAmp PCR System 2400 (Perkin Elmer,
USA) under the following conditions: 95 °C, 12 min; one time;
94 °C, 1 min; 37 °C, 1 min; 72 °C, 2 min; 45 cycles; 72 °C, 5
min.
Results
Screening RAPD markers to distinguish CMS
and maintainer lines
Among 100 primers (OPA01–OPE20, Operon 10 mer.) used,
13 did not amplify bands. Seventy primers amplified bands
but no polymorphism between Zhenshan 97A and Zhenshan
97B was observed. Seven primers amplified polymorphous
bands, but only primer OPA12 showed stable polymorphism
in different samples (replications). In Zhenshan 97A, OPA12
can amplify a 1,600-base pair (bp) band, whereas in Zhenshan
97B the 1,600-bp band was not found (Fig. 1). When total
DNA of Longtepu A, Longtepu B, Xieqingzao A, and
Xieqingzao B was used as a template and amplified by OPA12,
the 1,600-bp band was found in Longtepu A and Xieqingzao
A but not in Longtepu B and Xieqingzao B. It can be seen
from the results that the 1,600-bp band can be used as a RAPD
marker to distinguish between WA-type CMS and maintainer
plants, and to distinguish between DA-type CMS and maintainer
plants at the seedling stage.
Characterization of the 1,600-bp band
Total DNA of Zhenshan 97A, restorer line Minghui 63, and F 1
and F 2 plants of Zhenshan 97A/Minghui 63 was used as a template
and amplified by OPA12. Figure 2 shows that the 1,600-
bp band was not found in Minghui 63, but appeared in F 1 and
all F 2 plants investigated, indicating that the band was derived
from male sterile cytoplasm.
Using mtDNA of the three pairs of CMS lines and their
maintainer lines as a template and amplified by OPA12, it was
found that the 1,600-bp band appeared in Zhenshan 97A,
226 Advances in rice genetics

whereas in Zhenshan 97B no such band was found. In Longtepu
A, only the 1,600-bp band was found, whereas in Longtepu B
there was no 1,600-bp band but a 1,400-bp band was found. In
Xieqingzao A, except for the 1,600-bp band, two other bands
(1,000 bp and 700 bp) were found, whereas in Xieqingzao B
there was only one 1,000-bp band (Fig. 3). These results indicated
that the 1,600-bp band was derived from the mtDNA of
WA- and DA-type cytoplasm, and that bands other than the
1,600-bp can be used to distinguish between WA and DA cytoplasm.
Discussion
A
M 1 2 3 4 5 6 7 8 9 10 11 12 N M
bp
1,600
200
During the study, we tried six annealing temperatures (32, 35,
37, 39, 41, and 40 °C) and seven MgCl 2 concentrations (1.0,
1.5, 2.0, 2.5, 3.0, 3.5, and 4.0 mM) to study the specificity of
the 1,600-bp band. It was found that, from 37 to 40 °C, and at
1.0 and 1.5 mM, the 1,600-bp band appeared only in the male
sterile lines. With mtDNA as a template, we tried five kinds of
MgCl 2 concentrations (1.0, 1.5, 2.0, 3.0, and 4.0 mM) and
found that the 1,600-bp band was clearest under 2.0 mM.
The cost is about US$10 for one sample using the field
inspection method. It will cost $800 to inspect 800 plants by
using the RAPD marker. Apparently, the cost of the latter is
B
M 1 2 3 4 5 6 bp
1,600
200
1,600
1,400
1,000
700
C
1,600
200
Fig. 1. RAPD profile amplified by primer OPA12 using total DNA as
template (37 °C). A = Zhenshan 97, B = Longtepu, C = Xieqingzao,
M = DNA size marker, 1–6 = individual plants of maintainer line,
7–12 = individual plants of CMS line, N = negative control.
Fig. 3. RAPD profile amplified by primer OPA12 using mitochondrial
DNA as template. M = DNA size marker, 1 = Zhenshan 97A,
2 = Zhenshan 97B, 3 = Longtepu A, 4 = Longtepu B, 5 =
Xieqingzao A, 6 = Xieqingzao B.
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 M bp
1,600
Fig. 2. RAPD profile amplified by
primer OPA12 using total DNA as
template (37 °C). 1 = Zhenshan
97A, 2 = restorer line Minghui
63, 3 = F 1 plant of Zhenshan
97A/Minghui 63, 4–15 = F 2
plants of Zhenshan 97A/Minghui
63, M = DNA size marker.
Molecular markers, QTL mapping, and marker-assisted selection 227

too high. However, this marker is very useful in special cases
such as seed disputes or seed lawsuits. If the 1,600-bp marker
is related to the exon and the translation products (protein)
can be detected, it would be possible to make antibodies for
seed purity inspection and to decrease the cost.
References
Kadowaki K, Ishige T, Suzuki S, Harada K, Shinjyo C. 1986. Differences
in the characteristics of mitochondrial DNA between
normal and male sterile cytoplasm of japonica rice. Jpn. J.
Breed. 36:333-339.
Kadowaki K, Harada K. 1989. Differential organization of mitochondrial
gene in rice with normal and male-sterile cytoplasm.
Jpn. J. Breed. 39:179-186.
Lu ZM, Hong DL. 1999. Advances in hybrid rice seed production
techniques. In: Basra AS, editor. Heterosis and hybrid seed
production in agronomic crops. New York (USA): Food Products
Press, an imprint of The Haworth Press, Inc. p 65-79.
Yamaguchi H, Kakiuchi H. 1983. Electrophoretic analysis of mitochondrial
DNA from normal and male sterile cytoplasms in
rice. Jpn. J. Genet. 58:607-611.
Notes
Fine mapping of the F 1
pollen sterility loci S-a
and S-c in rice using PCR-based markers
Guiquan Zhang and Zemin Zhang
Authors’ addresses: D.L. Hong, M. Ichii, Y. Ohara, C.M. Zhao, and
S. Taketa, Faculty of Agriculture, Kagawa University, Miki,
Kagawa 761-0795, Japan; D.L. Jong, Department of
Agronomy, Nanjing Agricultural University, Nanjing 210095,
China.
F 1
hybrids from crosses between indica and japonica rice usually show pollen sterility in varying degrees. Two loci, S-a and S-
c, for F 1
pollen sterility were mapped previously using restriction fragment length polymorphism markers. To develop polymerase
chain reaction-based marker-assisted selection, the S-a and S-c loci were mapped using simple sequence length
polymorphism markers. Five markers—RM05, RM09, RM157B, RM24, and RM129—were found to be linked to S-a, which
was 2.0 cM away from RM09 and 8.1 cM away from RM157B. One SSLP marker and one sequence-tagged site marker were
detected to flank the S-c locus. It was 4.3 cM from RM218 and 0.3 cM from RG227STS. The mapping of S-a and S-c using
PCR-based markers will facilitate marker-assisted selection in rice breeding.
F 1 pollen sterility usually occurs in indica/japonica crosses.
Six loci of the F 1 pollen sterility genes were identified. In the
heterozygotes (S i /S j ) at the loci, allelic interaction causes the
male gametes carrying S j to be abortive. The abortive pollens
caused by S-a alleles are empty and unstained and those caused
by the alleles at the other five loci can be stained by 1% I 2 KI
solution (Zhang et al 1994, Zhang and Lu 1996). A set of nearisogenic
lines (NILs) with different genotypes at the S-a, S-b,
and S-c loci has been established (Zhang and Lu 1996). Using
restriction fragment length polymorphism (RFLP) markers, the
S-a locus was mapped on chromosome 1 (Zhuang et al 1999)
and the S-c locus on chromosome 3 (Zhuang et al 1996). In
this study, we mapped the S-a and S-c loci using polymerase
chain reaction (PCR)-based markers to facilitate marker-assisted
selection.
Materials and methods
The recurrent parent Taichung 65 and its NILs, TISL3 and
TISL5, were used to develop the mapping populations. TISL3
carried the genotype S-a i /S-a i and TISL5 had S-c j /S-c j , whereas
Taichung 65 had S-a j /S-a j and S-c j /S-c j (Zhang and Lu 1996).
The F 2 population from the cross Taichung 65/TISL3 consisted
of 174 individuals. Another F 2 population of 314 plants was
developed from the cross Taichung 65/TISL5. Pollen fertility
was examined under a microscope.
DNA extraction was done using the CTAB method. The
simple sequence length polymorphism (SSLP) markers were
selected from the SSLP map (Temnykh et al 2000). We designed
the primers of the RG227STS marker based on previous
sequencing data (Fu et al, South China Agricultural University,
personal communication). Linkage analysis was conducted
using MAPMAKER/EXP version 3.0.
Results and discussion
Pollen fertility in the F 1
and F 2
populations
In the cross Taichung 65/TISL3, F 1 pollen fertility was 65.4%.
In the F 2 population of 314 individuals, 155 plants were fertile
and 159 plants were sterile (Table 1). In Taichung 65/TISL5,
F 1 pollen fertility was 52.1%. The segregation of fertile and
sterile plants in the F 2 fit the ratio of 1:1 (Table 1).
Polymorphism in the S-a and S-c regions
Eight SSLP markers in the region of the S-a locus were selected
to survey polymorphism between Taichung 65 and
TISL3. Five of the markers—RM05, RM09, RM157B, RM24,
and RM129—showed polymorphism between the parents. Four
228 Advances in rice genetics

Table 1. Segregation of fertile and sterile plants in the F 2 populations.
cM A Markers cM B Markers
Cross Fertile Sterile Total Fertile:sterile
Taichung 65/TISL3 155 159 314 1:1 (P>0.5)
Taichung 65/TISL5 90 84 174 1:1 (P>0.5)
0.5
2.0
RM129
RM24
RM157B
SSLP markers near the S-c locus were used to survey polymorphism
between Taichung 65 and TISL5, and only the
marker RM218 produced polymorphism. To identify PCR
markers linked to the S-c locus, the RFLP marker RG227—
which was closely linked to S-c—was converted to an STS
marker. From the products amplified with RG227STS primers,
no amplicon length polymorphism (ALP) was found between
Taichung 65 and TISL5. The amplified products (about
700 bp in length) were then digested by three restriction enzymes.
Only HindIII produced polymorphism when the product
from Taichung 65 was digested into two fragments, whereas
the product from TISL5 was undigested.
Mapping of the S-a and S-c loci
The map, including five SSLP markers and the S-a locus, was
constructed by using the F 2 population from the cross Taichung
65/TISL3. The S-a locus was located in the region between
markers RM09 and RM157B. The distances between the S-a
locus and the markers RM09 and RM157B were 2.0 cM and
8.1 cM, respectively (Fig. 1A). The S-c locus was mapped by
using the F 2 population from the cross Taichung 65/TISL5.
Flanking the S-c locus were RM218, which was 4.3 cM away,
and RG227STS, which was 0.3 cM away (Fig. 1B).
We have identified six loci for F 1 pollen sterility genes
in rice. The F 1 hybrid sterility between indica and japonica
could be overcome by developing indica-compatible japonica
lines (ICJLs). The ICJLs carry the genotype S i /S i rather than
S j /S j at the F 1 pollen sterility loci so that they are compatible
with indica varieties (Zhang et al 1994, Zhang and Lu 1996).
A breeding program for ICJLs is being conducted. The PCRbased
markers closely linked to the S-a and S-c loci are useful
for marker-assisted selection in the ICJL breeding program.
8.1
2.0
2.7
References
S-a
RM09
RM05
Temnykh S, Park WD, Ayres N, Cartinhour S, Hauck N, Lipovich L,
Cho YG, Ishii T, McCouch SR. 2000. Mapping and genome
organization of microsatellite sequences in rice (Oryza sativa
L.). Theor. Appl. Genet. 100(5):697-712.
Zhang G, Lu Y, Zhang J, Liu G. 1994. Genetic studies on hybrid
sterility in cultivated rice (Oryza sativa). IV. Genotypes for
F 1 pollen sterility. Chin. J. Genet. 21:35-42.
Zhang G, Lu Y. 1996. Genetics of F 1 pollen sterility in Oryza sativa.
In: Rice genetics III. Manila (Philippines): International Rice
Research Institute. p 418-422.
Zhuang C, Zhang G, Mei M, Lu Y. 1996. Molecular mapping of
genes for F 1 pollen sterility in rice. Int. Rice Res. Notes 21(2-
3):20-21.
Zhuang C, Zhang G, Mei M, Lu Y. 1999. Molecular mapping of the
S-a locus for F 1 pollen sterility in cultivated rice (Oryza sativa
L.). Acta Genet. Sin. 26(3):213-218.
0.3
4.3
RG227STS
S-c
RM218
Fig. 1. Genetic maps of the S-a and S-c regions constructed
by PCR-based markers. (A) The map of the S-a region on rice
chromosome 1. (B) The map of the S-c region on rice chromosome
3.
Notes
Authors’ address: Plant Molecular Breeding Research Center, South
China Agricultural University, Guangzhou 510642, China.
Molecular markers, QTL mapping, and marker-assisted selection 229

Map-based cloning of the Hd1 gene controlling
photoperiod sensitivity in rice
M. Ashikari, Y. Katayose, U. Yamanouchi, L. Monna, T. Fuse, T. Sasaki, and M. Yano
A major quantitative trait locus, Hd1, that controls response to photoperiod was identified by the use of a map-based cloning
strategy. High-resolution mapping using 1,505 segregants permitted the definition of a genomic region of about 12 kb as a
candidate for Hd1. Further analysis revealed that Hd1 is a homologue of CONSTANS in Arabidopsis and encodes a protein with
the structure of a zinc finger domain and a nuclear localization signal. Sequencing analysis revealed a 43-bp deletion in the
first exon of photoperiod-sensitivity (se1) mutant HS66 and a 433-bp insertion in the intron in mutant HS110. Structural
analysis confirmed that the major gene controlling response to photoperiod, Se1, was allelic to Hd1. Genetic complementation
analysis confirmed the function of the candidate gene. The level of Hd1 mRNA was not greatly affected by a change in
daylength. The findings suggest that Hd1 promotes heading under short-day conditions and delays heading under long-day
conditions.
Heading date is one of the critical traits that enable rice to
adapt to different cultivation areas and cropping seasons. Many
genetic studies have been performed on heading date. Rice is
a short-day plant; its heading is promoted by short daylength.
Response to daylength (referred to as photoperiod sensitivity,
PS) and basic vegetative growth (BVG) determine the heading
date of rice. Several genes controlling PS in rice have been
identified (Yokoo et al 1980, Yamagata et al 1986, Sano 1992).
Quantitative trait loci (QTLs) for PS were also reported (Yano
et al 1997, Yamamoto et al 1998, Lin et al 2000). However, no
PS gene has been cloned and little is known about the structure
and function of PS genes in rice at the molecular level. In
this paper, we report the isolation of a major rice PS QTL,
Hd1, by map-based cloning.
Fine-scale and high-resolution mapping
From approximately 9,000 plants segregating for Hd1, 1,505
plants homozygous for the Kasalath Hd1 allele were selected
on the basis of days to heading (early heading). The selected
plants were used to detect recombination events in the genomic
region flanking Hd1 with the pooled-sampling method. Eleven
plants were selected and analyzed with restriction fragment
length polymorphism (RFLP) markers and a cleaved amplified
polymorphic sequence (CAPS) marker. The results suggest
that Hd1 lies in the interval between S20481 and P130
(Fig. 1).
Two yeast artificial chromosome (YAC) clones, Y4836
and Y3955, were found to contain three flanking markers,
C235, S20481, and S2539 (Fig. 1). Moreover, two P1-derived
artificial chromosome (PAC) clones, P0676F10 and P0038C5,
were selected with the flanking markers from the PAC genomic
library of Nipponbare. P0038C5 contained sequences for
S20481, S2539, and Y4836R. This suggests that P0038C5
encompassed the Hd1 locus (Fig. 1). Then, P0038C5 was sequenced
by the shotgun strategy. To more precisely determine
the location of Hd1, we developed nine CAPS markers (1a-i)
using sequence data (Fig. 1). These CAPS markers enabled us
to define 12 kb as the Hd1-containing region.
Identification and analysis of the Hd1 sequence
The candidate genomic sequence was analyzed by the Genscan
program. Two putative genes were predicted in this region (data
not shown). A BLAST search of nonredundant DNA databases
revealed that one putative gene showed significant similarity
to the Arabidopsis CONSTANS (CO) gene. The sequence showing
similarity to CO was further analyzed as a candidate because
of the known function of CO in the photoperiod response
in Arabidopsis (Putterill et al 1995). A comparison of the sequences
of Nipponbare and Kasalath revealed many sequence
variations, such as deletions and base substitutions. We also
analyzed sequences of the candidate genomic region of the
se1 mutants HS66 and HS110 and their progenitor variety,
Ginbouzu. The Se1 locus was thought to be allelic to the Hd1
locus based on the chromosomal location (Inoue et al 1992,
Yamamoto et al 1998, Tamura et al 1998). By sequence comparison
with the Ginbouzu Hd1, we found a 43-bp deletion in
the putative first exon of se1 mutant HS66 and a 433-bp insertion
in the putative intron of HS110. These results clearly suggest
that Hd1 was allelic to Se1. In addition, we determined
the cDNA sequence of Hd1 by sequencing a product amplified
by reverse transcriptase-polymerase chain reaction (RT-
PCR) and 3′ and 5′ primer extensions. The sequence obtained
indicates that rice Hd1 is composed of two exons that encode
a 395-amino-acid protein and is a member of the Arabidopsis
CO family with a zinc finger domain (Fig. 2). The deduced
amino acid sequence of the Hd1 protein was compared with
CO from Arabidopsis and BnCOA1 from Brassica napus. The
region containing the zinc finger motif showed 65% identity
and a consensus structure of CX 2 CX 16 CX 2 C in the CO family,
and the region near the C terminal end showed 83% identity
and is thought to be a nuclear localization signal (Putterill et al
1995, Robert et al 1998).
230 Advances in rice genetics

A
B
C
D
Y4836
Y3955
S20481
1a
kb
0
R1679
C235
P0676F10
P0038C5
Hd1 candidate region
Rec.
1b 1c 1d 1e Rec.
1f
5
S20481
Hd1
S2539
2 6 1 2
1g
Y4836R
P130
1h
Rec.
1i
Fig. 1. A fine-scale, high-resolution genetic and physical map of
the Hd1 region. (A) Genetic linkage map showing the relative position
of Hd1 with RFLP markers. Numbers under the horizontal
line are numbers of plants with a recombinant chromosome in the
adjacent marker intervals. (B) Yeast artificial chromosome (YAC)
and (C) P1-derived artificial chromosome (PAC) clones spanning
the Hd1 region. A circle indicates the presence of a sequence
corresponding to the RFLP markers. (D) Fine-scale genetic and
physical map showing relative position of the candidate region of
Hd1 and CAPS markers developed based on the sequence data.
Rec. indicates the approximate position of recombination events
that occurred near Hd1.
Y4836R
Complementation of function of the candidate gene
Fifty transgenic plants were obtained by Agrobacterium-mediated
transformation with a 7.1-kb ApaI fragment containing
the candidate gene region. The recipient line was a nearisogenic
line (NIL) (Hd1/Hd2), in which both functional alleles
at Hd1 and Hd2 were replaced by nonfunctional alleles
of Kasalath (Lin et al 2000). The self-pollinated progenies of
the selected plant that carried one copy of the integrated gene
showed wide variation in days to heading (53–93 d) under
short-day (SD) conditions (Fig. 3). We used the CAPS marker
1e to determine the presence or absence of the integrated gene
in each plant. Plants without the gene and NIL Hd1/Hd2 showed
more delayed heading than plants homozygous or heterozygous
for the gene. Thus, the 7.1-kb candidate genomic region
promotes heading under SD conditions. This is consistent with
results comparing NIL Hd2 and NIL Hd1/Hd2 (Lin et al 2000).
These results clearly suggest that the Hd1 sequence in the 7.1-
kb candidate genomic region retains the function of photoperiod
response.
Hd1
CO
BnCOA1
Consensus
Hd1
CO
BnCOA1
Consensus
Hd1
CO
BnCOA1
Consensus
Hd1
CO
BnCOA1
Consensus
Hd1
CO
BnCOA1
Consensus
Hd1
CO
BnCOA1
Consensus
Fig. 2. Deduced amino acid sequence of Hd1 protein and amino acid alignment with Arabidopsis CO and Brassica napus
BnCOA1. Boxes in N and C termini are conserved domains of the zinc finger motif (N) and nuclear localization signals (C).
Arrowheads indicate cysteine residues in the zinc finger domain. Letters in boldface represent identical amino acid residues
among the three proteins.
Molecular markers, QTL mapping, and marker-assisted selection 231

No. of plants
4
Nipponbare
3
NIL (Hd2)
NIL (Hd1/Hd2)
gDNA
Nipponbare
NIL (Hd1)
Ginbouzu
HS66
HS110
M L S0 S5 S10 L S10 L S10 L S10 L S10
2
1
0
52 55 58 61 6467 70 73 76 79 82 85 88 91 94
Days to heading
Fig. 3. Frequency distribution for days to heading in selfpollinated
progenies of one transformant. All plants were
cultivated under short-day conditions (10.0 h) in a controlled
growth chamber. Columns indicate plants with (black) and
without ( ) the candidate genomic fragment.
Fig. 4. Detection of mRNA in the varieties and lines used in this
study by RT-PCR assay. All plants were raised in long-day (16.0 h)
conditions and then subjected to the following treatments. L =
additional 10-d treatment in LD, S0 = no additional treatment, S5
= additional 5-d treatment under short daylength (10.0 h), and
S10 = additional 10-d treatment under short daylength.
Expression of Hd1
To determine whether the Hd1 candidate region was expressed
and whether the expression of Hd1 was induced by a change
in daylength, we performed RT-PCR analysis (Fig. 4). The
amplified fragment was designed to include a 33-bp deletion
in Kasalath, a 43-bp deletion in HS66, and a 433-bp insertion
in the intron in HS110. Hd1 mRNA was detected in Nipponbare
and NIL Hd1. However, the amplified product was slightly
smaller in Kasalath than in Nipponbare. Sequencing of the
amplified product showed this size difference to be consistent
with the 33-bp deletion in the genomic sequences. Ginbouzu
produced the same level of mRNA as Nipponbare. The se1
mutant HS66 also produced the same level of mRNA as
Ginbouzu, but its PCR product was slightly smaller than that
of Ginbouzu. In contrast, several kinds of amplified products
of the se1 mutant HS110 were seen in the RT-PCR assay (Fig.
4). Sequencing of these RT-PCR products revealed that the
size difference was consistent with that observed in genomic
sequences. These results clearly indicate that loss of functions
in Kasalath Hd1 and se1 in HS66 and HS110 might have occurred
because of the altered transcripts. The mRNA levels of
Nipponbare at Hd1 did not change with a transition from longday
(LD) to SD conditions (Fig. 4), which was associated with
the initiation of the transition to heading. These results suggest
that the expression of Hd1 is not greatly affected by a
change in daylength.
Conclusions
Hd1, a major photoperiod-sensitivity QTL in rice, encodes a
protein with the structure of the zinc finger transcription factor
that shows high similarity to CO protein in Arabidopsis. A
major photoperiod-sensitivity gene, Se1, is allelic to Hd. The
level of Hd1 mRNA was not affected by a change in daylength.
Hd1 promotes heading under SD conditions and inhibits it
under LD conditions. Hd1 played an important role in the genetic
control pathway of photoperiod response in both SD and
LD conditions.
References
Inoue H, Tanisaka T, Okumoto Y, Yamagata H. 1992. An early-heading
mutant gene of a mutant line HS66 of rice. Rep. Soc. Crop
Sci. Breed. Kinki 37:47-52. (In Japanese with English summary.)
Lin HX, Yamamoto T, Sasaki T, Yano M. 2000. Characterization
and detection of epistatic interactions of three QTLs, Hd1,
Hd2 and Hd3, controlling heading date in rice using nearisogenic
lines. Theor. Appl. Genet. 101:1021-1028.
Putterill J, Robson F, Lee K, Simon R, Coupland G. 1995. The
CONSTANS gene of Arabidopsis promotes flowering and encodes
a protein showing similarities to zinc finger transcription
factors. Cell 80:847-857.
Robert LS, Robson F, Sharpe A, Lydiate D, Coupland G. 1998. Conserved
structure and function of the Arabidopsis flowering
time gene CONSTANS in Brassica napus. Plant Mol. Biol.
37:763-773.
Sano Y. 1992. Genetic comparisons of chromosome 6 between wild
and cultivated rice. Jpn. J. Breed. 42:561-572.
Tamura K, Nomura K, Oshima I, Namai H, Yano M, Sasaki T, Kikuchi
F. 1998. Identification of restriction fragment length polymorphism
markers tightly linked to a major photoperiod sensitivity
gene, Se-1, and to a blast resistance gene, Piz-t, in rice.
SABRAO J. 30:61-67.
Yamagata H, Okumoto Y, Tanisaka T. 1986. Analysis of genes controlling
heading time in Japanese rice. In: Rice genetics I.
Manila (Philippines): International Rice Research Institute.
p 351-359.
Yamamoto T, Kuboki Y, Lin SY, Sasati T, Yano M. 1998. Fine mapping
of quantitative trait loci Hd-1, Hd-2 and Hd-3, controlling
heading date of rice, as single Mendelian factors. Theor.
Appl. Genet. 97:37-44.
232 Advances in rice genetics

Yano M, Harushima Y, Nagamura Y, Kurata N, Minobe Y, Sasaki T.
1997. Identification of quantitative trait loci controlling heading
date in rice using a high-density linkage map. Theor. Appl.
Genet. 95:1025-1032.
Yokoo M, Kikuchi F, Nakane A, Fujimaki H. 1980. Genetical analysis
of heading time by aid of close linkage with blast,
Pyricularia oryzae, resistance in rice. Bull. Natl. Inst. Agric.
Sci. Ser. D 31:95-126.
Notes
Authors’ addresses: M. Ashikari, T. Fuse, Bio-oriented Technology
Research Advancement Institution, Omiya, Saitama 331-853;
Y. Katayose, T. Sasaki, M. Yano, National Institute of
Agrobiological Resources, Kannondai 2-1-2, Tsukuba, Ibaraki
305-8602; U. Yamanouchi, L. Monna, Institute of the Society
for Techno-innovation of Agriculture, Forestry, and Fisheries,
Tsukuba, Ibaraki 305-0854; U. Yamanouchi, Department
of Biology, Faculty of Science, Toyama University, 3190
Gofuku, Toyama 930-8555, Japan.
Acknowledgments: We thank Prof. T. Tanisaka and Dr. Y. Okumoto,
Kyoto University, Japan, for their valuable comments and for
providing the se1 mutants. This work is supported mainly by
funds from the Program for Promotion of Basic Research
Activities for Innovative Biosciences.
Response of QTLs for heading date in rice at different sites
from tropical to temperate regions
Y. Fukuta, S. Kobayashi, H. Tsunematsu, L.A. Ebron, H. Kato, T. Umemoto, S. Morita, T. Sato, T. Yamaya, T. Nagamine, T. Fukuyama,
H. Sasahara, I. Ashikawa, K. Tamura, H. Nemoto, H. Maeda, K. Hamamura, T. Ogata, Y. Matsue, K. Ichitani, and A. Takagi
A total of 26 QTLs for heading date were obtained from 28 experiments carried out at 10 sites from tropical to temperate
regions using 191 recombinant inbred lines (RILs) derived from a cross involving indica (Milyang 23) and japonica (Akihikari)
cultivars. These RILs were evaluated in tropical and temperate regions; at IRRI in the 2000 dry season and at nine sites located
from Kyushu to Tohoku in Japan from 1995 to 1999, respectively. Because the QTL corresponding to a photoperiod-sensitive
gene, Se1, on chromosome 6 was not detected in these analyses, it was estimated that these two parents have the same
allele on the locus. In temperate regions, it was found that two QTLs located on chromosomes 7 and 11 had a strong effect on
heading date. Although the two QTLs were not detected in the tropical region, four specific QTLs were recognized on chromosomes
2, 3, 9, and 10. It was hypothesized that the genes relating to vegetative growth played an important role in segregation
in the tropical region and the photoperiod-sensitive and vegetative growth genes had a combined effect in temperate regions
because it was assumed that the QTL on chromosome 7 corresponded to a photoperiod-sensitive gene, E1.
Heading date in rice is an important trait for adaptation to different
cultivation regions and cropping seasons. Ichitani et al
(1998) and Kinoshita (1998) summarized 23 major genes controlling
heading date, 13 of which were mapped on chromosomes.
Many studies, such as those of Li et al (1995), Yano et
al (1997), Doi et al (1998), and Yamamoto et al (1998, 2000),
have been conducted on the genetic analysis of heading traits
using DNA markers. We used recombinant inbred lines (RILs)
to identify chromosomal regions associated with heading date
and to investigate the genotype × environment interaction at
individual QTLs in different conditions from temperate to tropical
regions.
Materials and methods
An RI population consisting of 191 RILs was used in this study.
The population was developed from a cross between Korean
indica rice variety Milyang 23 and Japanese japonica rice variety
Akihikari. Data on segregation of 183 RFLP markers had
been obtained from these RILs (Fig. 1, Fukuta et al 1999).
The heading date of the RI population was evaluated in
28 field experiments at nine sites in Japan (J) and one site in
the Philippines (P): Ohmagari (J), located at 39.28°N, 1999;
Sendai (J), 38.15°N, from 1996 to 1999; Niigata (J), 37.55°N,
in 1996 and 1999; Joetsu, 37.07°N, from 1995 to 1999;
Tsukuba (J), 36.12°N, from 1997 to 1999; Totori (J), 35.30°N,
1999; Fukuyama (J), 34.29°N, 1997 and 1999; Fukuoka (J),
33.35°N, 1997 to 1999; Kagoshima (J), 31.35°N, 1999; and
Los Baños (P), 2000 in the dry season, 14.11°N. The RILs
were grown from May to October in Japan and during the dry
season from December 1999 to April 2000 in the Philippines.
At Joetsu in 1997 and 1998, and at Sendai in 1997 and 1999,
RI populations were also cultivated under different fertilizer
conditions (N: 0 kg ha –1 or 7–100 kg ha –1 ) (Fig.1). The date
from transplanting to heading (heading date) was determined
for each line.
Interval mapping for QTLs was carried out using the
software QGENE (Nelson 1997). A LOD score threshold of
2.0 for declaring the presence of a QTL was used. The LOD
score’s peaks for each significant QTL were then used to position
the QTL on the linkage map. The gene effect (additive
effect) and percent phenotypic variation attributable to individual
QTLs were estimated at the peaks.
Molecular markers, QTL mapping, and marker-assisted selection 233

CEN
1S
1L
0.0 C970
10.4 XNpb107
13.6 20.3 NO79A
R210B
20.7 XNpb359
30.4 XNpb90
32.0 C955
51.3 R210
55.9 XNpb364
70.4 Y2746L*
82.1 XNpb302
84.9 C122
91.8 XNpb201
95.2 96.8 XNpb393
XNpb147
104.4 XNpb92
113.1 C86
122.5 XNpb113
3.0
2.3
2.1
2.3
138.0 XNpb393B
140.1 XNpb346
144.4 C112
2S 0.0 XNpb349
0.2 N366U
2L
25.1 XNpb227
40.3 XNpb353
41.9 C196
46.5 XNpb132
57.2 G2140B
58.6 G1314B
66.3 NI62A
72.2 XNpb199
86.2 XNpb39
104.2 XNpb298
127.3 G1234
129.0 XNpb317B
N164K
AC. –2.9
AB, –2.1
Y, –2.8
R, –2.0
O. –2.2
D, –2.3
9S 0.0 XNpb315
1.5 G1314D
2.4 XNpb36
3.5 R1164
15.4 XNpb40*
18.7 XNpb103
22.2 XNpb160
24.4 XNpb317C*
27.3 XNpb401
37.1 R1751
42.3 XNpb385
46.6 XNpb13
47.3 XNpb211
47.9 R2638
65.5 XNpb293
69.2 G1445
9L
AC, 2.0
AA, 2.4
Z, 2.7
Y, 3.0
3.3
U, 2.6
3.6
s, 3.8
R, 2.9
P, 2.5
O, 3.9
4.4
2.9
3.4
I, 3.3
D, 2.2
C, 2.4
B, 2.7
A, 2.6
CEN
AC, 2.1
2.4
N, 4.3
M, 3.3
L, 2.6
2.1
2.5
X, 2.7
2.4
T, 2.5
AA, 3.8
Z, 2.4
P, 3.4
O, 2.0
N, 2.2
2.5
H, 2.2
CEN
3S
AC, 2.9
AD, 2.1
2.9
K, 2.2
J, 2.0
CEN
6S
6L
0.0 XNpb209
15.8 C764
34.8 R2171
36.4 40.0 C235
C488*
41.6 XNpb172
48.6 G2028
57.9 G2140C
58.1 G1314A
69.4 XNpb12
81.2 XNpb135
85.4 XNpb342
P, 2.1
J, 2.1
H, 2.3
AD, 3.5
AB, 2.2
Z, 2.1
Y, 2.1
X, 3.1
T, 3.1
S, 2.1
N, 2.3
M, 3.3
L, 3.1
I, 3.1
H, 2.3
E, 2.7
D, 3.3
C, 2.0
A, 5.2
CEN
3L
0.0 C74
12.8 XNpb129
17.4 XNpb238
18.6 XNpb192
19.1 XNpb326
19.4 XNpb74
27.8 C198
28.8 N26AD
30.6 R2170
32.3 Y3870L
34.5 XNpb79
XNpb144
Y, 4.1
56.6 R250
65.3 C136
82.7 XNpb249
110.7 XNpb48
110.9 G1318
AD, 2.2
AC, 2.9
AB, 2.8
Z, 2.4
Y, 2.1
X, 2.7
U, 2.7
T, 3.5
P, 2.0
O, 2.7
N, 2.1
M, 3.0
I, 2.3
H, 3.4
G, 3.1
F, 3.2
E, 2.9
D, 2.1
C, 2.5
A, 4.1
0.0 XNpb50
3.6 N1165R
12.6 C1057
20.8 R2401
CEN
7L
32.3 XNpb338
37.8 R643B*
38.4 XNpb33
43.7 XNpb91
46.6 C451
XNpb152
53.1 XNpb117
64.6 NASL56
65.6 C507
67.3 XNpb379
78.4 N622U
78.7 C213
AD, 3.5
Q, –2.0
K, –2.0
E, –2.1
Z, –2.4
Y, –2.3
O, –2.4
M, –2.1
K, –2.0
AC, 12.8
AB, 4.9
AA, 2.0
Z, 9.3
Y, 12.1
X, 8.7
U, 6.5
T, 7.9
S, 9.5
R, 11.6
Q, 8.7
P, 3.5
O, 11.8
N, 3.1
M, 4.4
L, 5.5
K, 3.5
J, 3.0
I, 4.1
H, 3.7
G, 4.1
F, 4.1
E, 2.9
D, 4.2
C, 7.2
B, 8.0
A, 5.9
10S
10L
0.0 G1084
3.1 R1629
4.7 C1286
8.1 N9U
17.8 XNpb133
18.1 N33K
20.2 XNpb37
25.5 R1877
26.1 C1361
30.0 G2155
35.7 C16
44.6 XNpb127
11S
11L
0.0 XNpb42B
XNpb142B
1.8 XNpb335A
2.3 XNpb189A
18.2 NSSK190
20.0 C477
22.6 XNpb320
C734C
24.8 XNpb179
30.8 N099K
31.5 XNpb202
35.5 XNpb257
45.3 C1172
48.9 C1003A
65.7 XNpb181
67.8 G2132A
2.5
–2.5
–2.9
–2.0
AB, –2.2
–4.2
–3.0
–2.4
–2.6
–2.3
–2.7
–3.0
CEN
4S
0.0 XNpb203
R1854
CEN
31.6 C708
54.9 C734
77.7 XNpb237
4L
108.8 XNpb271
116.2 C513
117.8 XNpb161
129.2 XNpb331
141.8 XNpb235
142.3 XNpb264
144.3 XNpb197
148.1 C1016
156.3 C445
AB, –4.5
AA, –8.9
Z, –3.9
Y, –3.0
T, –3.8
S, –3.8
R, –4.7
O, –3.8
P, –7.0
o. –4.1
N, –2.4
M, –3.8
L, –5.9
K, –8.2
J, –9.2
I, –5.0
H, –4.6
G, –2.9
F, –2.1
E, –68
D, –5.1
C, –4.7
B, –4.0
AC, –2.1
H, 2.2
G, 2.4
E, 2.4
D, 2.5
8S
0.0 XNpb278
1.5 C825
11.2 XNpb321
12.6 XNpb38
41.3 XNpb104
CEN 43.0 XNpb369
44.6 G1314C
51.4 G2132B
53.4 G1073
59.1 XNpb187
8L
88.3 XNpb56
91.7 R662
93.1 XNpb321B
CEN
12S
XNpb193
0.0 XNpb77*
XNpb169*
6.3 XNpb142A
XNpb42A
6.9 XNpb189B
XNpb335B
8.1 XNpb338B
14.0 XNpb124B
38.9 XNpb304
39.0 G2140A
41.2 XNpb307
O, 2.1
5S
5L
0.0 XNpb139
9.5 Rpr1-1
0.0 N358L
1.9 XNpb387
10.7 R569
18.6 C734B
28.1 XNpb327
XNpb105
30.0 31.3 XNpb366
R1553
36.4 C128
39.6 XNpb255
53.5 C246
61.1 XNpb297
74.4 C1069
74.8 XNpb148
12L
87.8 G1106
92.3 C901
AD, 3.3
Fig. 1. Detected QTLs for heading date. The position of the QTLs is indicated on the left side of each chromosome. Triangles and vertical
bars indicate the position of the QTLs and the chromosome regions that showed a higher LOD score than 2.0 by interval mapping analysis.
The turned-up and inverted triangles of QTLs indicate the positive functions for late heading with Milyang 23 and Akihikari, respectively.
Letters and numbers indicate the investigation conditions and the peak values of LOD score detected by interval mapping at the QTL,
respectively. The RFLP linkage map (Fukuta et al 1999) was modified. (A) Sendai in 1996. (B) Sendai A (N: 100 kg ha –1 ) in 1997. (C) Sendai
B (N: 0 kg ha –1 ) in 1997. (D) Sendai A (N: 0 kg ha –1 ) in 1999. (E) Sendai B (N: 100 kg ha –1 ) in 1999. (F) Niigata A in 1996. (G) Niigata B in
1996. (H) Niigata in 1999. (I) Joetsu in 1995. (J) Joetsu A in 1996. (K) Joetsu B in 1996. (L) Joetsu A (N: 70 kg ha –1 ) in 1997. (M) Joetsu
B (N: 0 kg ha –1 ) in 1997. (N) Joetsu A (N: 70 kg ha –1 ) in 1998. (O) Joetsu B (N: 0 kg ha –1 ) in 1998. (P) Joetsu in 1999. (Q) Tsukuba in 1997.
(R) Tsukuba in 1999. (S) Tsukuba in 1999. (T) Fukuyama in 1997. (U) Fukuyama in 1999. (X) Fukuoka in 1997. (Y) Fukuoka in 1998. (Z)
Fukuoka in 1999. (AA) Ohmagari in 1999. (AB) Totori in 1999. (AC) Kagoshima in 1999. (AD) Los Baños in 2000 dry season.
234 Advances in rice genetics

Results and discussion
Segregation for heading date
Parental variety Akihikari had an earlier heading date than
Milyang 23 in every condition, and the range of the differences
varied from approximately 2 to 3 wk.
The segregation of the RI population showed wide variations
and transgressive segregation in early and late heading
date was also observed. The range of heading days in the RI
population varied from 24 to 55. Specially recognized was the
tendency to have earlier heading at southern sites than at northern
sites. Moreover, binomial distribution was observed (Fig.
2). The differences in segregation under various fertilizer conditions
were not as clear as the differences among years and
sites (data not shown).
Interval mapping for QTLs
A total of 26 QTLs for heading date were detected based on
analyses of results of 28 experiments (Fig. 1). But the QTL
corresponding to a photoperiod-sensitive gene, Se1, on chromosome
6 was not detected in these analyses. It was estimated
that these two parents have the same allele on the locus.
Two QTLs on chromosomes 7 and 11 indicated strong,
stable, and unique functions (Fig. 3). The QTLs on chromosomes
7 and 11 affected late heading with the Milyang 23 and
Akihikari homozygotes, respectively. Moreover, the strength
of QTL function varied among sites and years. In the 1999
investigations, the QTL on chromosome 7 (southern sites) indicated
a stronger function and the QTL on chromosome 11
(northern sites) showed the contrary. A reciprocal relationship
was also detected between the two QTLs when one QTL indicated
a high LOD score and the other showed a low value
(experimental results for some years in Joetsu, Sendai, and
Tsukuba). These results indicate that two QTLs with strong
functions on chromosomes 7 and 11 acted mainly in the RI
population in the temperate region. It was also assumed that
the QTL on chromosome 7 corresponded to a photoperiodsensitive
gene, E1, because the detected QTLs are located in
the same chromosomal region described by Ichitani et al (1998).
Although the total phenotypic variations of the RI population
were almost explained by the two QTLs in Japan (data
not shown), these were not detected at IRRI. Five other QTLs
were detected at Los Baños. Of these, four QTLs were detected
on chromosomes 2, 3, 9, and 10. This means that heading
date in a tropical region is controlled by a genetic mechanism
that is completely different from that in a temperate region.
Although different results with detected QTLs were recognized
among the fertilizer investigations, a definite tendency
was not shown.
It might be hypothesized that the genes relating to vegetative
growth played an important role in the segregation in
tropical regions, and the photosensitive and vegetative growth
genes acted together in temperate regions. It is necessary to
clarify the relationships among the detected QTLs and to evaluate
the reaction of QTLs in the wet season at Los Baños to
confirm the hypothesis and the genetic mechanism of heading
date.
References
Doi K, Yoshimura A, Iwata N. 1998. RFLP mapping and QTL analysis
of heading date and pollen sterility using backcross population
between Oryza sativa L. and Oryza glaberrima Steud.
Breed. Sci. 48:395-399.
Fukuta Y, Tamura T, Sasahara H, Fukuyama T. 1999. Genetic and
breeding analysis using molecular markers: variations of gene
frequency and the RFLP map of the hybrid population derived
from the cross between the rice variety Milyang 23 and
Akihikari. Breed. Res. 1(suppl. 2):176.
Ichitani K, Okumoto Y, Tanisaka T. 1998. Genetic analysis of the
rice cultivar Kasalath with special reference to two photoperiod
sensitivity loci, E1 and Se1. Breed. Sci. 48:51-57.
Kinoshita T. 1998. Report of the Committee on Gene Symbolization,
Nomenclature and Linkage Group. II. Linkage mapping
using mutant genes in rice. Rice Genet. Newsl. 15:13-74.
Li Z, Pinson SRM, Stansel JW, Park WD. 1995. Identification of
quantitative trait loci (QTLs) for heading date and plant height
in cultivated rice (Oryza sativa L.). Theor. Appl. Genet.
91:374-381.
Nelson JC. 1997. QGENE: software for marker-based genomic analysis
and breeding. Mol. Breed. 3:239-245.
Yamamoto T, Kuboki Y, Lin SY, Sasaki T, Yano M. 1998. Fine mapping
of quantitative trait loci Hd-1, Hd-2 and Hd-3, controlling
heading date of rice, as single Mendelian factors. Theor.
Appl. Genet. 97:37-44.
Yamamoto T, Lin H, Sasaki T, Yano M. 2000. Identification of heading
date quantitative trait locus Hd6 and characterization of
its epistatic interactions with Hd2 in rice using advanced backcross
progeny. Genetics 154:885-891.
Yano M, Harushima Y, Nagamura Y, Kurata N, Minobe Y, Sasaki T.
1997. Identification of quantitative trait loci controlling heading
date in rice using a high-density linkage map. Theor. Appl.
Genet. 95:1025-1032.
Notes
Authors’ addresses: Y. Fukuta, S. Kobayashi, H. Tsunematsu, A.
Ebron, and H. Kato, Plant Breeding, Genetics, and Biochemistry
Division, International Rice Research Institute, DAPO
Box 7777, Metro Manila, Philippines; T. Umemoto, Department
of Lowland Farming, Tohoku, NAES, Ohmagari, Akita;
S. Morita, Department of Upland Farming, Tohoku NAES,
Fukushima, Fukushima; T. Sato, Institute of Gene Eco.,
Tohoku University, Sendai, Miyagi; T. Yamaya, Faculty of
Agriculture, Tohoku University, Sendai, Miyagi; T. Nagamine,
Department of Genetic Resources I, NIAR, Tsukuba, Ibaraki;
T. Fukuyama, Faculty of Agriculture, Niigata University,
Niigata, Niigata; H. Sasahara, I. Ashikawa, and K. Tamura,
Department of Rice Research, Hokuriku NAES, Joetsu,
Niigata; H. Nemoto and H. Maeda, Department of Crop Breeding,
Chugoku, NAES, Fukuyama, Hiroshima; K. Hamamura,
Arid Land Research Center, Tottori University, Hamasaki,
Tottori; T. Ogata and Y. Matsue, Crop Protection Research
Institute, Fukuoka ARC, Fukuoka, Fukuoka; K. Itchitani and
A. Takagi, Faculty of Agriculture, Kagoshima University,
Kagoshima, Japan.
Molecular markers, QTL mapping, and marker-assisted selection 235

No. of lines
40
99 Ohmagari
A
M23
20
n = 190
A
M23
40
99 Sendai
20
n = 190
40
99 Niigata
A
M23
20
n = 187
50
99 Joetsu
A
M23
25
n = 188
40
99 Tsukuba
A
M23
20
n = 185
30
99 Tottori
A
M23
10
n = 190
30
99 Fukuyama
n = 188
A
M23
10
50
99 Fukuoka
A
M23
25
n = 190
20
10
A
99 Kagoshima
n = 190
M23
20
A
M23
99 Dry Los Baños
10
n = 188
40 55 70 85 100
Days to heading
Fig. 2. Segregation for heading date in Japan (1999) and the Philippines (2000 dry
season).
236 Advances in rice genetics

LOD
2.0
0.0
2.01
A
0.0
–2.0
A
2.0
0.0
2.0
2.89
3.70
B
C
0.0
–2.0
–8.91
–
B
0.0
2.0
0.0
3.49
9.52
D
E
0.0
–2.0
–6.83
–4.60
C
0.0
–2.0
D
2.0
–7.00
0.0
2.0
0.0
2.0
4.95
6.51
F
G
0.0
–2.0
0.0
–2.0
–3.84
–4.45
E
F
0.0
9.28
H
0.0
–1.36
G
2.0
0.0
–2.0
–3.92
H
0.0
12.83
I
0.0
–2.0
–2.20
I
0.0
–1.13
J
2.0
0.0
0.0
0.52
C213
N622U
XNpb379
C507
NASL56
XNpb117
XNpb152
C451
XNpb91
XNpb33
R643b
XNpb338c
R2401
C1057
N1165R
XNpb50
Chr. 7
J
XNpb42b
XNpb142b
XNpb335a
XNpb189a
NSSK190
C477
XNpb320
C734c
XNpb179
N099K
XNpb202
XNpb257
Chr. 11
C1172
C1003a
XNpb181
G2132a
Fig. 3. Interval mapping on chromosomes
7 and 11. Plus and minus
values of LOD score indicate positive
gene functions for late heading
in Milyang 23 and Akihikari homozygotes,
respectively. Data summary
from various sites in 1999: A =
Ohmagari, B = Sendai-1, C =
Niigata, D = Joetsu, E = Tsukuba, F
= Totori, G = Fukuyama, H =
Fukuoka, I = Kagoshima and Los
Baños during 2000 dry season.
Molecular markers, QTL mapping, and marker-assisted selection 237

Mapping quantitative trait loci controlling
heading date in rice
K. Fujino, T. Sato, H. Kiuchi, H. Kikuchi, Y. Nonoue, Y. Takeuchi, S.Y. Lin, and M. Yano
Quantitative trait loci (QTLs) for heading date were investigated using 122 BC 1
F 5
lines from the cross between Hayamasari and
Italica Livorno, both temperate japonicas. Analysis revealed the existence of only one QTL with a large effect, near marker
C596 on chromosome 7. The Italica Livorno allele at this QTL increased days to heading. This QTL explained about 30% of the
phenotypic variation in BC 1
F 5
lines. In multiple-QTL analysis with a major QTL near C596, an additional five QTLs with small
phenotypic effects were found. Four QTLs near C67a, C235, S954, and S1786 were mapped on chromosomes 1, 6, 7, and
12, respectively. The chromosomal location of one QTL near C249 was not identified. The Italica Livorno alleles increased days
to heading for all these QTLs except for the one near S954.
Rice is grown under various climatic conditions. When commercial
rice varieties are developed, it is important that their
maturity match the particular environment in which they are
grown. In Hokkaido, the northernmost rice cultivation region
(42–45°N latitude) in Japan, only extremely early maturing
varieties are adapted. The efficient manipulation of heading
date is a critical component of rice improvement efforts. By
using molecular techniques, many quantitative trait loci (QTLs)
for heading date have been identified. In these studies, where
a high level of DNA polymorphism is expected, genetically
diverse crosses were used as materials and QTLs with large
effects were found (Yano and Sasaki 1997). However, early
maturing varieties have not been used as parental lines in previous
QTL studies. We have conducted QTL analysis for heading
date using recombinant inbred lines derived from the cross
Hayamasari/Italica Livorno.
Materials and methods
Two rice varieties, Hayamasari (early maturing) from Hokkaido
and Italica Livorno (late-maturing) from Italy, were used as
parental lines of the mapping population. Both varieties are
classified as temperate japonica. The F 1 (Hayamasari/Italica
Livorno) was crossed with Hayamasari to produce BC 1 F 1 seeds.
One hundred and twenty-two BC 1 F 5 lines were developed from
the BC 1 F 1 plants by the single-seed descent method. The 122
BC 1 F 5 lines and their two parental lines were grown under
natural field conditions in Naganuma (43°N latitude),
Hokkaido, Japan. One representative plant was randomly selected
from each BC 1 F 5 line. Each plant was monitored for
date of appearance of the first panicle and the number of days
from sowing to heading was used for QTL analysis. A leaf
sample was also collected from selected plants for DNA extraction.
All experimental procedures for DNA extraction, Southern
blotting, and hybridization have been described previously
by Kurata et al (1994). Six hundred and eighty-five clones
were selected from the high-density linkage map (Harushima
et al 1998) as probes for the restriction fragment length polymorphism
(RFLP) analysis. Linkage groups and the order of
markers were determined using MAPMAKER/EXP (Lander
et al 1987). Since MAPMAKER/EXP did not include an option
for backcross inbred lines, the “F 2 intercross” mode was
employed in the analysis. The MAPMAKER/QTL software
(Lander and Botstein 1989, Lincoln et al 1993) was used to
estimate phenotypic effects of Italica Livorno alleles at detected
QTLs using the F 2 backcross mode. A log of odds (LOD)
score of 2.0 was used as the threshold to detect QTLs. A multiple-QTL
model examination was also carried out.
Results
The mean value of days to heading was 95 d (range 93–97) for
Hayamasari and 113 d (range 111–115) for Italica Livorno.
There was a large variation (range 85–123) in days to heading
in the BC 1 F 5 lines (Fig. 1). Transgressive segregants toward
late heading were also observed. This distribution suggested
that one major gene was involved in the segregation for heading
date in this population. However, there was still a large
variation in the early and late classes, suggesting that some
additional factors (genes) might be involved.
A parental RFLP survey was conducted using 685
probes, and 113 (16.5%) probes showed polymorphism between
Hayamasari and Italica Livorno. Of these 113 probes,
23 showed polymorphism of minor bands. To avoid unreliable
genotyping of BC 1 F 5 lines, 90 probes were used to construct a
linkage map (Fig. 2). The constructed linkage map covered
about 30% of the rice high-density linkage map (Fig. 2).
In the analysis of the single-QTL model, only one QTL
(LOD = 9.7) was found to be located near marker C596 on
chromosome 7 (Table 1). The additive effect of the Italica
Livorno allele at this QTL was 11.2 d and the percentage of
variance explained was 31.2%. An additional five QTLs, with
relatively small phenotypic effects, were detected based on
the multiple-QTL model with the QTL near C596 (Table 1).
Four QTLs were mapped near C67a (chromosome 1), C235
(chromosome 6), S954 (chromosome 7), and S1786 (chromosome
12), respectively. The chromosomal location of the QTL
near C249 was not identified because C249 showed no linkage
to other RFLP markers and the polymorphic DNA frag-
238 Advances in rice genetics

No. of lines
20
Hayamasari
Italica Livorno
15
10
5
0
83 87 91 95 99 103 107 111 115 119 123
Days to heading
Fig. 1. Frequency distribution of days to heading in the BC 1 F 5 lines. Horizontal and
vertical bars indicate the ranges and means, respectively.
cM 1 2 3 4 5 6 7 8 9 10 11 12
0
50
C235
S954
S1786
100
C596
150
C67a
Fig. 2. RFLP linkage map showing locations of the putative QTLs detected from analysis of BC 1 F 5 lines derived
from the cross between Hayamasari and Italica Livorno. Solid area indicates the linkage groups constructed
in the BC 1 F 5 lines, display based on the rice high-density linkage map (open area)(Harushima et al 1998).
Table 1. Putative QTLs that control heading date detected in
the BC 1 F 5 lines of rice. a
Marker loci
Effects on the phenotype
linked to Chromosome LOD
QTL AE PVE
C596 7 9.7 11.2 31.2
C67a 1 12.3 5.7 37.8
C235 6 11.9 4.9 37.0
S954 7 12.4 –6.1 38.4
S1786 12 11.9 5.5 36.5
C249 – 11.8 5.0 36.8
a C596 was detected in the scanning analysis using the single-QTL model. Others
were detected in the multiple-QTL model with C596. LOD = log likelihood
value calculated by MAPMAKER/QTL software in the “F 2 backcross” mode; AE
= additive effect of Italica Livorno allele on days to heading; PVE = percent of
total phenotypic variation explained by the QTL (all QTLs except for C596 are
cumulative values in the multiple-QTL model).
ments were different from those previously reported
(Harushima et al 1998). These five QTLs explained about 5.3–
7.2% of the phenotypic variance and had additive effects of
about 4.9–6.1 d. The Italica Livorno alleles increased days to
heading for all of these QTLs except for the one near S954.
Discussion
Among the current commercial rice cultivars in Hokkaido,
variation in heading date is only about 10 d from early to latematuring
types. The genes for heading date corresponding to
early, middle-, and late-maturing types are multiple alleles of
the photoperiod sensitivity–related gene (Fujino, unpublished
data). Five of the six QTLs identified in this study had an additive
effect of 4.9–6.1 d. If these QTLs for heading date were
used for rice breeding programs in Hokkaido, genetic variations
in heading date would be large. Molecular markers will
Molecular markers, QTL mapping, and marker-assisted selection 239

allow us to manipulate these QTLs for heading date more easily
than with phenotypic selection. However, it should be noted
that we estimated the effects of these QTLs using a single population.
The general utility of these QTLs will depend on their
expression in other genetic backgrounds.
The QTL near C596 on chromosome 7, with a relatively
large effect, was located at the distal end of the linkage group.
On the distal end of chromosome 7, Hd2 was already identified
(Yano et al 1997). Both Hd2 and the QTL near C596 detected
in this study were likely the same locus, based on their
chromosomal location. The QTL with a small effect on heading
date was found to be located near C235 on chromosome 6.
This QTL may correspond to Hd1 and Se-1, a major locus for
photoperiod sensitivity (Yano et al 1997, Yamamoto et al 1998).
The QTL near C67a on chromosome 1 was detected in almost
the same region as hd-1 found in the doubled-haploid population
of Zhai-Ye-Qing 8/Jing-Xi 17 (Lu et al 1996). Further
analysis will be necessary to clarify the allelic relationship
between known genes and the QTLs identified in this study.
Other QTLs near S954 on chromosome 7 and those near S1786
on chromosome 12 were not located in regions where QTLs
for heading date had been identified previously.
References
Harushima Y, Yano M, Shomura A, Sato M, Shimano T, Kuboki Y,
Yamamoto T, Lin SY, Antonio BA, Parco A, Kajiya H, Huang
N, Yamamoto K, Nagamura Y, Kurata N, Khush GS, Sasaki
T. 1998. A high-density rice genetic linkage map with 2275
markers using a single F 2 population. Genetics 148:479-494.
Kurata N, Nagamura Y, Yamamoto K, Harushima Y, Sue N, Wu J,
Antonio BA, Shomura A, Shimizu T, Lin S-Y, Inoue T, Fukuda
A, Shimano T, Kuboki Y, Toyama T, Miyamoto Y, Kirihara T,
Hayasaka K, Miyao A, Monna L, Zhong HS, Tamura Y, Wang
Z-X, Momma T, Umehara Y, Yano M, Sasaki T, Minobe Y.
1994. A 300-kilobase interval genetic map of rice including
883 expressed sequences. Nat. Genet. 8:365-372.
Lander ES, Green P, Abrahamson J, Barlow A, Daly MJ, Lincoln
SE, Newburg L. 1987. MAPMAKER: an interactive computer
package for constructing primary genetic linkage maps of experimental
and natural populations. Genomics 1:174-181.
Lander ES, Botstein D. 1989. Mapping Mendelian factors underlying
quantitative traits using RFLP linkage maps. Genetics
121:185-199.
Lincoln S, Daly M, Lander E. 1993. Mapping genes controlling quantitative
traits with MAPMAKER/QTL 1.1: a tutorial and reference
manual. 2nd ed. Whitehead Institute Technical Report.
Lu C, Shen L, Tan Z, Xu Y, He P, Chen Y, Zhu L. 1996. Comparative
mapping of QTLs for agronomic traits of rice across environments
using a doubled haploid population. Theor. Appl.
Genet. 93:1211-1217.
Yamamoto T, Kuboki Y, Lin SY, Sasaki T, Yano M. 1998. Fine mapping
of quantitative trait loci Hd-1, Hd-2 and Hd-3, controlling
heading date of rice, as single Mendelian factors. Theor.
Appl. Genet. 97:37-44.
Yano M, Harushima Y, Nagamura Y, Kurata N, Minobe Y, Sasaki T.
1997. Identification of quantitative trait loci controlling heading
date in rice using a high-density linkage map. Theor. Appl.
Genet. 95:1025-1032.
Yano M, Sasaki T. 1997. Genetic and molecular dissection of quantitative
traits in rice. Plant Mol. Biol. 35:145-153.
Notes
Authors’ addresses: K. Fujino and T. Sato, Hokkaido Green-Bio
Institute, Naganuma 069-1301; H. Kiuchi and H. Kikuchi,
Hokkaido Prefecture Kamikawa Agricultural Experiment Station,
Pippu 078-0397; Y. Nonoue, Y. Takeuchi, S.Y. Lin, and
M. Yano, Rice Genome Research Program, NIAR/STAFF,
Tsukuba 305-8602, Japan.
Acknowledgment: This work was supported by a grant from the Ministry
of Agriculture, Forestry, and Fisheries of Japan (Rice
Genome Project DM-1202).
QTL analysis for heading date using recombinant
inbred lines in rice
M. Oda, H. Yasui, and A. Yoshimura
We developed two sets of recombinant inbred lines (RILs). The first one, RIC, was derived from a cross between japonica
cultivar Taichung 65 and indica cultivar DV85. The second one, RID, was derived from a cross between japonica cultivar
Taichung 65 and indica cultivar ARC10313. To investigate quantitative trait loci (QTLs) for heading date, 123 lines of RIC (F 9
generation) and 136 lines of RID (F 10
generation) were genotyped using 116 and 89 restriction fragment length polymorphism
(RFLP) markers, respectively. In RIC, segregation distortions were found on 7 of the 12 rice chromosomes. In RID, distortions
were observed on 4 of 12 rice chromosomes. Three QTLs for heading date were detected on chromosomes 4, 5, and 10
(P

Number of plants
A
DV85 Taichung 65 35 B 25 C
16
30
N = 135
N = 128
N = 105
20
25
ARC10313 Taichung 65
12
Taichung 65
20 ARC10313
15
8
4
15
10
5
10
5
0 0
0
82 94 106 118 92 104 116 128 82 94 106 118
88 100 112
98 110 122 134
88 100 112
Days to heading
Fig. 1. Frequency distributions for days to heading in RIC at the second sowing (A), in RID at the first
sowing (B), and in RID at the second sowing (C).
Days to heading is an important agronomic trait of rice because
it is highly associated with regional and seasonal adaptability
of rice cultivars. To investigate the genetic basis of heading
behavior in rice, we developed two series of recombinant
inbred lines (RILs) derived from two crosses between japonica
and indica cultivars. In this study, we describe the construction
of a new series of RILs and QTL analysis for heading
date.
Materials and methods
Two indica cultivars, DV85 and ARC10313, were crossed to
japonica cultivar Taichung 65, using Taichung 65 as the female
parent. RILs were developed from these two crosses:
Taichung 65/DV85 (123 F 9 lines) and Taichung 65/ARC10313
(136 F 10 lines). In this paper, the former was named RIC and
the latter was called RID.
The two RIL seeds were sown on 1 May 1999 (first sowing,
about 13.5 h daylength) and on 26 May 1999 (second
sowing, about 14.5 h daylength) in Fukuoka, Japan. Seedlings
were transplanted on 7 June for the first sowing and on 26
June for the second sowing. RIC was tested at the second sowing
and RID was tested at the first and second sowing. Heading
date of 10 individual plants of each RIL was recorded when
the first spikelet of the panicle emerged at the base of each
flag leaf. Days to heading were expressed as the number of
days from seed sowing to heading.
The DNA of each line was extracted and used for restriction
fragment length polymorphism (RFLP) linkage map
construction. RFLP probes (Harushima et al 1998) were supplied
by the Rice Genome Program of Japan. RFLPs among
the parents were surveyed using six enzymes (BamHI, BglII,
DraI, EcoRI, EcoRV, and HindIII). A total of 116 RFLP markers
for RIC and 89 for RID were selected to construct the linkage
map. QTL analysis for heading date was conducted using
the QGENE v.2.29 (Nelson 1997), a software for DNA markerbased
genetic analysis on Macintosh.®
Results and discussion
Two RFLP linkage maps were constructed based on RFLP
marker segregation in the respective RILs. RIC and RID linkage
maps involved 116 and 89 RFLP markers, respectively. In
RIC, segregation distortions were observed in chromosomes
1, 4, 5, 6, 9, 10, and 11. In RID, distortions were noted on
chromosomes 3, 6, 10, and 11.
Frequency distributions for days to heading in two RIL
populations are shown in Figure 1. These data were combined
with the RFLP genotype of each RIL and loaded to QGENE
v.2.29 (Nelson 1997). Loci affecting days to heading were estimated
using the single-point command of the QGENE.
In RIC, three QTLs (P

Table 1. QTLs of heading date detected in RIC at the second sowing.
RFLP locus
Days to heading
near QTL F P c Additive d
(chromosome) AA a (N) aa b (N)
R288 (4) 98.9 (47) 96.0 (52) 8.59 0.004*** 1.5
C1402 (5) 95.3 (51) 99.0 (52) 12.82 0.001*** –1.8
R1877 (10) 99.5 (52) 94.7 (49) 23.00

Table 2. QTLs of heading date detected in RID at the first and second sowing.
RFLP locus
Days to heading
near QTL F P c Additive d
(chromosome) AA a (N) aa b (N)
First sowing
XNpb311 (4) 111.9 (70) 108.9 (63) 8.42 0.004*** 1.5
C213 (7) 112.1 (73) 108.5 (59) 12.16 0.001*** 1.8
R1629 (10) 112.8 (41) 109.3 (79) 8.88 0.004*** 1.7
C1166 (10) 113.5 (51) 108.7 (80) 21.69

found on the same position on the long arm of chromosome 4 and the two loci were localized between the two RFLP loci,
XNpb264 and XNpb197. The genetic distance between XNpb264 and Hwc-2 and that between Hwc-2 and XNpb197 was 0.7
cM and 2.0 cM, respectively. The Ph locus controls phenol color reaction of hulls, which is one criterion for classifying cultivars
into indica and japonica.
The F 1 weakness found in the crosses of Peruvian rice cultivar
Jamaica and Japanese lowland cultivars is controlled by a set
of complementary genes, Hwc-1 and Hwc-2. The prominent
feature of this hybrid weakness lies with the peculiar root
growth inhibition, which is expressed soon after germination.
Hwc-1 and Hwc-2 are carried by Jamaica and Japanese lowland
cultivars, respectively. The geographical distribution of
the Hwc-2 gene surveyed in Asian native cultivars showed that
this gene is common among temperate japonicas but not among
tropical japonicas or indicas. From these results, Sato and
Morishima (1988) assumed that the Hwc-2 gene originated in
an early stage of differentiation of temperate japonica types.
Isozyme and molecular marker analyses indicated that indicas
and japonicas are easily differentiated, but temperate and tropical
japonicas are not (Glaszmann 1987, Mackill 1995). Hwc-
2 may thus be a key gene for the differentiation of japonica
cultivars into temperate and tropical types. In this study, the
chromosomal location of the Hwc-2 locus was determined by
using recombinant inbred (RI) lines segregating for the locus.
Materials and methods
The RI lines have been developed by Fukuta et al (1999) from
the cross between Akihikari and Milyang 23. Akihikari is a
temperate japonica cultivar from Japan and carries the Hwc-2
gene. Milyang 23 is an indica cultivar from Korea and carries
neither the Hwc-1 nor Hwc-2 gene. Genotypes of 183 restriction
fragment length polymorphism (RFLP) loci almost covering
the whole rice genome have been identified for a set of
191 RI lines, and an RFLP linkage map was constructed based
on them (Fukuta et al 1999). A total of 127 randomly chosen
RI lines were crossed to the Hwc-1 carrier Jamaica as a pollen
donor, except for a few crosses. Then each RI line was estimated
to be an Hwc-2 carrier if the F 1 plants showed inhibition
of root elongation, and an Hwc-2 carrier if they showed
normal root elongation. Linkage analysis between Hwc-2 and
RFLP markers was performed using the computer program
MAPMAKER/EXP 3.0 (Lander et al 1987).
Phenol reaction, used to classify cultivars into indica and
japonica, is controlled by a gene at the Ph locus on chromosome
4. Milyang 23 carries the dominant allele Ph, while
Akihikari carries the recessive allele ph. To know the linkage
between the Ph and Hwc-2 loci, phenol reaction of the RI lines
was examined. The color of hulls after soaking in 3% phenol
solution for 3 d and drying overnight was scored. Lines whose
hulls turned black carried the Ph allele, whereas lines whose
hulls had the original color carried the ph allele.
Shiozawa et al (1993) reported that hybrid weakness was
recovered by high-temperature treatment in the cross between
Norin 8 and Jamaica. In this study, the effect of high temperature
on the expression of hybrid weakness was investigated in
reciprocal crosses between Akihikari and Jamaica. The seeds
of F 1 and parent cultivars were soaked in water at 28 °C for 3
d. Then, half of them were transferred under 34 °C conditions.
Four days later, root length of each plant was measured.
Results and discussion
Mapping the Hwc-2 locus
The linkage analysis with MAPMAKER/EXP 3.0 showed that
the Hwc-2 and Ph loci were on the same position on the long
arm of chromosome 4 and that the two loci were localized
between the two RFLP loci, XNpb264 and XNpb197. The genetic
distance between XNpb264 and Hwc-2 was 0.7 cM and
that between Hwc-2 and XNpb197 was 2.0 cM. From a phylogenetic
point of view, it is interesting that the Hwc-2 and Ph
loci, both of which have been associated with varietal differentiation,
are closely linked to each other. The Hwc-2 gene
does not express weakness by itself. To our knowledge, neither
a positive or negative effect of Ph gene expression on
adaptation has been reported. Therefore, these genes in themselves
are not considered to be causing or promoting varietal
differentiation. Proximal to the Ph locus exist many loci controlling
adaptability. These are Sh3 controlling the shattering
habit, Spr3(t) controlling panicle spread, Pikur1 controlling
blast resistance, and Xa1, Xa2, and Xa12 controlling bacterial
blight resistance. These facts suggest that the adaptability-genecomplex
rather than Hwc-2 or Ph might cause or promote varietal
differentiation in a way that some gene combinations are
suitable for areas where tropical japonica is predominant and
others for areas where temperate japonica is predominant. The
genes on Hwc-2 and Ph loci might be mutated and dragged by
surrounding gene combinations.
Physiology of hybrid weakness and future prospects
Hybrid weakness expressed in the reciprocal crosses between
Akihikari and Jamaica was recovered by 34 °C treatment (Table
1). The effect of high temperature is larger in the cross
Akihikari/Jamaica, suggesting the existence of a maternal or
cytoplasmic effect. The results of Shiozawa et al (1993) and
this study indicate that hybrid weakness offers a good experimental
system for the response to temperature. Cloning of the
Hwc-2 gene will contribute much to understanding this as well
as varietal differentiation. This gene has three advantages for
map-based cloning: (1) yeast artificial chromosome (YAC)
contigs composed of three YACs (Y2186, Y5056, and Y5212)
cover the chromosomal region where the Hwc-2 locus resides
(Kurata et al 1997); (2) RFLP markers, many of which are
cDNA clones, are condensed on the region; and (3) since the
symptoms of hybrid weakness appear soon after germination,
244 Advances in rice genetics

Table 1. Effect of high temperature on root elongation.
Root length (cm)
Hybrid
and Normal High
parenttemperature temperature
(28 °C) (34 °C)
Akihikari/Jamaica 1.70 ± 0.24 a 10.28 ± 0.33
Jamaica/Akihikari 1.24 ± 0.37 4.56 ± 0.86
Jamaica/Akihikari 9.38 ± 1.29 9.56 ± 0.59
6.70 ± 0.98 7.66 ± 0.99
a Data represent the mean ±SE root length of five plants that had been germinated
at 28 °C for 3 d and had been under each temperature treatment for 4
d.
a large segregating population can be examined. The results
of this study will be useful as a starting point for the cloning of
Hwc-2.
References
Fukuta Y, Tamura K, Sasahara H, Fukuyama T. 1999. Genetic and
breeding analysis using molecular marker. 18. Variations of
gene frequency and the RFLP map of the hybrid population
derived from the cross between the rice variety Milyang 23
and Akihikari. Breed. Res. 1(suppl. 2):176.
Glaszmann JC. 1987. Isozymes and classification of Asian rice varieties.
Theor. Appl. Genet. 74:21-30.
Kurata N, Umehara Y, Tanoue H, Sasaki T. 1997. Physical mapping
of the rice genome with YAC clones. Plant Mol. Biol. 35:101-
113.
Lander ES, Green P, Abrahamson J, Barlow A, Daly MJ, Lincoln
SE, Newburg L. 1987. MAPMAKER: an interactive computer
package for constructing primary genetic linkage maps
of experimental and natural populations. Genomics 1:174-181.
Mackill DJ. 1995. Classifying japonica rice cultivars with RAPD
markers. Crop Sci. 35:889-894.
Sato YI, Morishima H. 1988. Distribution of the genes causing F 2
chlorosis in rice cultivars of the Indica and Japonica types.
Theor. Appl. Genet. 75:723-727.
Shiozawa M, Fujiwara S, Marubashi W, Niwa M. 1993. Effects of
temperature on lethality of F 1 hybrid between Norin 8 × Jamaica
in rice (Oryza sativa L.). Jpn. J. Breed. 43(suppl. 2):264.
Notes
Authors’ addresses: K. Ichitani, K. Koba, and M. Sato, Faculty of
Agriculture, Kagoshima University, 1-21-24 Korimoto,
Kagoshima 890-0065, Japan; Y. Fukuta, International Rice
Research Institute, DAPO Box 7777, Metro Manila, Philippines;
S. Taura, Gene Research Center, Kagoshima University,
1-21-24 Korimoto, Kagoshima 890-0065, Japan.
Molecular markers for detecting bacterial blight resistance
genes in maintainer lines of rice hybrids
L. Borines, E. Redoña, B. Porter, F. White, C. Vera Cruz, and H. Leung
In the Philippines, hybrid rice breeding has emphasized the enhancement of resistance to bacterial blight (BB) caused by
Xanthomonas oryzae pv. oryzae (Xoo) in parental lines and hybrids. Early observations at the Philippine Rice Research Institute
(PhilRice) and initial phenotyping using nine races of Xoo showed that most of the maintainers, restorers, and hybrids are
susceptible to most races of Xoo. Molecular markers linked to resistance genes can facilitate the pyramiding of target genes,
particularly in cases where the presence of one gene may be masked by the expression of another gene. We have applied
marker-aided backcrossing to transfer and pyramid Xa4, Xa7, and Xa21 BB resistance genes from IRBB4/7 and IRBB21 to five
maintainer lines used for hybrid rice production in the Philippines. RFLP marker G1091 on chromosome 6 linked to Xa7 and the
STS marker of the Xa21 gene (kinase domain) were used to facilitate the detection of Xa7 and Xa21 in backcross progenies.
In addition, an AFLP marker (AFLP31-10) linked to Xa7 was identified by bulked segregant analysis. Using 154 BC 3
F 2
plants of
the IR58025B/IRBB4/7 cross, AFLP31-10 was found to be linked to G1091, hence confirming its location on chromosome 6.
AFLP31-10 is approximately 3 cM away from Xa7, whereas G1091 is about 7 cM away. Pyramids of Xa4 and Xa7 were
obtained in five B line/IRBB4/7 BC 3
F 2
populations (

λHindIII LianB Progenies
IR24 IRBB4/7
IR24 B D1 D2
Progenies
6.4 kb
4.0 kb
1.6 kb
1.0 kb
Fig. 1. G1091 marker used to detect Xa7 in the BC 3 F 1 progenies
of the LianB/IRBB4/7 cross showing the 4-kb band (resistant allele)
and 6.4-kb band (susceptible allele).
B—IR58025B
D2—IRBB21
D1—IRBB4/7
Fig. 2. Xa21 STS marker used to detect the Xa21 gene in the
BC 3 F 1 progenies of the cross of IR58025B with IRBB4/7 and
IRBB21.
Table 1. Mean lesion length (cm) of BC 3 F 2 plants of five maintainer/donor crosses containing Xa4, Xa7, Xa4/
7, and no genes in a pyramid together with controls inoculated with two diagnostic races of Xoo.
Lesion length (cm)
Cross Xa4 Xa7 Xa4/7 No gene
PXO61 PXO86 PXO61 PXO86 PXO61 PXO86 PXO61 PXO86
IR58025B/BB4/7 2.61 18.35 13.84 1.76 1.20 1.59 27.54 22.94
IR62829B/BB4/7 4.57 14.87 7.22 2.05 1.61 0.45 13.22 23.76
LianB/BB4/7 4.31 20.57 13.17 1.89 1.99 0.97 27.92 26.53
913B/BB4/7 4.42 16.37 11.92 1.85 1.49 1.57 23.44 20.19
BoB/BB4/7 – – 10.75 1.30 2.83 0.72 11.13 12.29
IRBB4 7.58 22.67
IRBB7 15.84 0.99
IRBB4/7 1.17 1.34
IR24 27.68 21.79
One of the most important constraints in hybrid seed production
is rice bacterial blight (BB) disease caused by
Xanthomonas oryzae pv. oryzae (Xoo). In hybrid seed production,
flag-leaf cutting to facilitate pollination is tantamount
to BB inoculation. Early observations at PhilRice and initial
phenotyping revealed that most parental lines and hybrids are
susceptible to bacterial blight. The use of resistant (R) cultivars
has been the most effective and economical way of controlling
BB. At least 23 resistance genes have been identified
from cultivated rice and wild species.
The identification of molecular markers closely linked
to disease resistance genes would facilitate the efficient transfer
of genes into elite breeding lines and pyramiding of BB
resistance genes. Our aim is to incorporate and pyramid Xa4,
Xa7, and Xa21 BB resistance genes in five maintainer (B) lines
of hybrid rice via marker-aided backcrossing.
Materials and methods
Two lines, IRBB4/7 and IRBB21, that contain the Xa4/7 and
Xa21 genes were used as donors, whereas five B lines from
PhilRice (IR58025B, IR62829B, LianB, 913B, and BoB)
served as the recurrent parents in backcrossing. Pairwise
crosses between each B line and donor were made until the
BC 3 F 2 to obtain gene pyramids . Phenotyping was undertaken
in each backcross generation and supplemented with markeraided
selection to select the resistant progenies.
Restriction fragment length polymorphism (RFLP)
marker G1091 linked to Xa7 on chromosome 6 (Kaji and
Ogawa 1995) and the sequence-tagged site (STS) marker of
the Xa21 gene (kinase domain) were used to facilitate the detection
of Xa7 and Xa21, respectively, in the backcross progenies
(Figs. 1 and 2). An amplified fragment length polymorphism
(AFLP) marker linked to Xa7 identified at Kansas State
University through bulked segregant analysis was also used.
This marker was optimized into a nonradioactive protocol and
the position relative to Xa7 and the G1091 marker was determined
using 154 BC 3 F 2 plants of the IR58025B/IRBB4/7 cross.
Results and discussion
Pyramids of Xa4 and Xa7 were successfully transferred to
BC 3 F 2 plants of five B line/IRBB4/7 crosses. Plants containing
both genes showed significantly shorter lesions (generally

IR24 B D
BC 3 F 2 progenies
2.6 4.5 cM
Xa7 AFLP31-10 G1091
Fig. 4. Partial map of chromosome 6 showing the arrangement
of Xa7, AFLP-31-10, and RFLP marker G1091 as determined
from linkage analysis using 154 BC 3 F 2 plants of
the IR58025B/IRBB4/7 cross.
S S R R R R S R S R R R S
B–IR58025B D–IRBB4/7
Fig. 3. AFLP31-10 marker DNA linked to the Xa7 gene showing the
314-bp resistant band and the slightly lower susceptible band
resulting from a 5-bp deletion. R = resistant, S = susceptible.
genes were comparable to those of the donor parent, IRBB4/
7.
Segregation of the Xa4 and Xa7 genes in four of the B
line/IRBB4/7 crosses (IR58025B, IR62829B, LianB, and 913B
with IRBB4/7) was independent and fitted the 9:3:3:1 ratio
for both Xa4 and Xa7, Xa4 alone, Xa7 alone, and no genes,
respectively. For the BoB/IRBB4/7 cross, plants did not show
the same phenotypic segregation pattern (χ 2 = 24.8). Pyramids
of Xa4, Xa7, and Xa21 genes were detected in the BC 3 F 1 plants
of three B lines crossed with IRBB4/7 and IRBB21 based on
their phenotypic reactions to PXO61 (

Identifying major genes and QTLs for field resistance
to neck blast in rice
S. Hittalmani, Srinivasachary, P. Bagali, and H.E. Shashidhar
Neck blast caused by Pyricularia grisea is a serious fungal disease of rice. The doubled-haploid (DH) population of the cross
IR64 (an indica variety)/Azucena (a japonica variety) was screened for neck blast resistance under severely infected field
conditions. IR64 was resistant, with less than 0.5% infection, whereas Azucena was susceptible, with up to 35% of the necks
infected. The 120 plants of the DH population had varying levels of infection, from complete resistance (0% infection) to
complete susceptibility. MAPMAKER EXP identified a major gene, NBL1(t), on chromosome 11 associated with the Nbp44
marker, with 11.4 cM distance, and RG167 and RG247 with 19.5 and 19.3 cM, respectively, at LOD 4.0. Three main
quantitative trait loci (QTLs) for neck blast were identified: chromosome 10 (qNBL-10), chromosome 9 (qNBL-9), and chromosome
5 (qNBL-5). Digenic epistatic QTLs that were significant were located on chromosomes 11, 9, and 7. Total epistasis was
44.9%. The main-effect QTL on chromosome 10 (qNBL-10) was highly significant (24.1% variation and LOD of 4.11). Both
major genes and QTLs control field resistance to neck blast in rice.
Neck blast (NB) in rice, caused by Pyricularia grisea Sacc., is
the most serious fungal disease of rice. Unlike leaf blast, which
normally infects plants at the early stage, NB infects plants at
the reproductive stage and causes serious damage to the economic
parts of plants. The disease infects the panicle and causes
losses in grain filling and quality. It further spreads to the grain
surface, causes discolorations, and affects the filling of the
spikelets. Host resistance is controlled by both major genes
and quantitative trait loci (QTLs) (Wang et al 1994, Mago et
al 1999). The resistance is attributed to minor genes or QTLs,
and two major genes and 10 QTLs for blast resistance were
identified in Moroberekan (Wang et al 1994). QTLs for blast
resistance have been reported by several workers, whereas reports
on NB resistance have been very few.
Our study aimed to conduct genetic analysis and identify
markers associated with major genes and QTLs for field
resistance to NB.
Materials and methods
One hundred and twenty-five doubled-haploid (DH) populations
developed from a cross between IR64 and Azucena
(Guiderdoni et al 1992) were used. Rice varieties CO 39, HR12,
and IR50 were used as susceptible checks. These were planted
in two replications with 20 plants in each replication in a randomized
complete block and observations were recorded on
all the plants.
The selected plants were evaluated during the 1997 wet
season. The plants were transplanted in late kharif at the Rice
Research Station, RRS Mandya. The plants were exposed to
natural disease incidence, which was quite satisfactory, as seen
in the susceptible checks (data not shown). The plants were
scored at 4 wk after heading following the standard evaluation
scale and converted into percentage.
Neck blast was scored as the percentage of the number
of infected panicles (necks) to the total number of tillers in the
main field. Neck blast infection was scored on 20 plants per
genotype before harvest and expressed in percentage.
Mapping of major genes was carried out using Mapmaker
EXP (LOD 4.0), whereas QTLs for NB were identified by interval
analysis using MAPMAKER QTL as well as a QTL
mapper with a threshold LOD ≥2.0. The progenies scored in
natural incidence were grouped as resistant and susceptible
for major gene mapping. Binary observations were made for
major gene mapping using Mapmaker EXP. The QTLs were
identified and mapped by eliminating the completely resistant
and susceptible lines. The nomenclature for QTLs was adopted
following the procedures of McCouch et al (1997).
Results and discussion
Mapping of a major gene and QTL for NB resistance
Linkage analysis using MAPMAKER revealed a major gene
for field resistance to NB, NBL-1(t) on chromosome 11 (Table
1). The position of the major gene is shown in Figure 1.
Among parents, there were significant differences in NB
infection and also in transgressive segregation among the progenies.
IR64 was found to be resistant to NB (

Table 1. Identification of major genes and QTLs for field resistance to neck blast (NB) in rice.
Major gene for NB resistance.
Chromosome Gene Markers Distance (cM)
11 NBL-1(t) Npb44 11.4
RG247 19.3
RG167 19.5
QTL main effect.
Chromosome QTL Marker interval LOD R 2 (%) Resistance
allele
10 qNB-10 C1195-R2174 4.11 24.1 IR64 QTL mapper
5 qNBL-5 RZ649-RZ225 2.42 11.1 MAPMAKER QTL
9 qNBL-9 Amy3ABC-RG667 2.03 8.5 MAPMAKER QTL
Epistatic effect.
Chromosome Interval I Chromosome Interval j LOD R 2 ij a
3 RG348-RZ329 7 Est9-RZ337B 3.89 13.8 0.5188**
3 RZ519-RZ448 9 G103-RZ206 5.31 13.8 0.5186**
4 RG143-RG620 11 RG103-RZ536 4.76 17.3 0.5815**
a ij = epistatic effect between i and j QTL. ** = significant at P = 0.01.
RG566
RZ390
RG313
RZ556
RG403
RG229
RG13
CDO105
RZ649
RZ67
RZ70
RZ225
Chromosome
5 9
RG757
CDO590
C711
G103
RZ206
RZ422
Amy3ABC
RZ228
RZ12
RG667
RG451
RZ792
RZ404
CDO127
RZ638
RZ400
RG118
Adh-1
RG1094
RG167
Npb44
RG247
RG103
RG1109
RZ536
Npb186
Fig.1. Location of major gene NBL-1(t) on chromosome 11 and
QTL for NB resistance on chromosomes 5 and 9 of rice.
11
11.4 cM
NBL-1(t)
19.5 cM
(chromosome 11), indicating that the loci for resistance major
and minor genes are independent. The QTL on chromosome 5
(qNBL-5) bracketing the RZ649-RZ225 marker interval had
an LOD of 2.4 and 11.1% phenotypic variation, while the QTL
on chromosome 9 (qNBL-9) at the Amy3ABC-RG667 marker
interval had an LOD of 2.03 and 8.5% phenotypic variation.
Although several loci have been reported to confer leaf blast
resistance, very few loci are identified for NB resistance. This
could also be attributed to the lower number of races that may
attack the adult plant, as it is a well-known fact that, as plants
grow older, they develop adult plant resistance and few races
may still be effective. The genetic nature of Pyricularia during
the reproductive stage shows that both major genes and
QTLs control the disease and they could be different.
Epistatic interaction of QTLs
Three digenic epistatic effects of the QTLs using QTL mapper
(V1.1) (Wang et al 1994) were identified. The main-effect
QTLs identified by both mappers did not interact. The interaction
for these loci was not significant. Although three digenic
epistatic QTLs with maximum variation of R 2 (24.08%) were
on different chromosomes, the epistatic QTL interaction was
for the regions on chromosomes 7, 9, and 11, with total epistasis
of 44.91%. The estimates of significant effects were positive
for two interactions (Table 1), indicating that these interactions
lead to higher resistance. As the main-effect QTLs were
significant and their interaction nonsignificant, it can be hypothesized
that resistance could be controlled by genetic main
effects without a significant environmental effect and QTL
interaction. The study indicates that NB resistance is controlled
by both major and minor genes, and the epistatic effect of the
main QTL is at a minimum.
Molecular markers, QTL mapping, and marker-assisted selection 249

References
Guiderdoni E, Gallinato E, Luistro J, Vergara G. 1992. Anther culture
of tropical japonica/indica hybrids of rice (Oryza sativa
L.). Euphytica 62:219-224.
Imbe T, Tsunematsu H, Kato H, Khush GS. 1998. Genetic analysis
of blast resistance in IR varieties. In: Paper presented at the
Second International Rice Blast Conference, 4-7 Aug 1998,
Montpellier, France. p 11.
Mago R, Nair S, Mohan M. 1999. Resistance gene analogues from
rice: cloning, sequencing and mapping. Theor. Appl. Genet.
99:50-57.
McCouch SR, Cho YG, Yano M, Paul E, Blinstrub M, Morishima
H, Kinoshita T. 1997. Report on QTL nomenclature. Rice
Genet. Newsl. 14:11-13.
Wang GL, Mackill DJ, Bonman M, McCouch SR, Champoux MC,
Nelson RJ. 1994. RFLP mapping of genes conferring complete
and partial resistance to blast in a durably resistant rice
cultivar. Genetics 136:1421-1434.
Notes
Authors’ address: Department of Genetics and Plant Breeding, University
of Agricultural Sciences, Bangalore 560 065, India.
Mapping QTLs for partial resistance to blast in rice
M.Z.I. Talukder, C. Leifert, and A.H. Price
A population of 100 F 6
recombinant inbred lines (RILs) produced by single-seed descent from a cross between Azucena
(japonica) and Bala (indica) was evaluated for partial resistance to blast in the greenhouse. A genetic map developed from this
population containing 135 markers on 17 linkage groups covering 1,680 cM was used to map the QTLs with composite interval
mapping. Five QTLs were identified for disease severity using the 3 LOD threshold—one each on chromosomes 1, 10, and 12
and two on chromosome 4. Altogether, these five QTLs accounted for 58% of the phenotypic variation in the population. Two
loci, one each on chromosomes 1 and 4, were detected for number of lesions per leaf and together they accounted for 17%
of the phenotypic variation. All of these QTLs reflected a positive effect from the Azucena allele. A total of five, two, and four
QTLs were detected for lesion length, lesion width, and lesion area, respectively, with a large-effect QTL on chromosome 12.
Rice blast is considered to be the most important disease of
rice. The insufficient durability of resistance to it is a major
problem in breeding blast-resistant varieties, especially in upland
rice (Bonman et al 1992). Dynamic changes in pathogen
composition have often resulted in the breakdown of resistance
in improved varieties and have been most striking when
resistance is conferred by major genes (Kiyosawa 1982). Durable
resistance is often associated with partial resistance conferred
by minor genes with cumulative effects. Recent advances
in DNA marker technology make it possible to identify quantitative
trait loci (QTLs) controlling important agronomic traits.
In this study, RFLP and AFLP markers were used to map QTLs
for partial resistance to blast.
Materials and methods
The isolate CD100 of Magnaporthe grisea from Côte d’Ivoire
has been identified as potentially valuable for mapping partial
resistance by Diddier Tharreau (CIRAD, Montpellier, France).
Four-week-old rice plants were inoculated with spores of this
isolate at a concentration of 1 × 10 5 spores mL –1 . The inoculum
was prepared following standard procedures. Inoculated
plants were incubated at above 90% relative humidity and 28
± 2 day/22 ± 2 °C night temperatures.
Six days after inoculation, each plant of the recombinant
inbred lines (RILs) was assessed individually for blast
infection. Disease severity (DS) was measured following the
Standard evaluation system for rice developed by IRRI (1996).
Number of lesions per leaf (LPL), lesion length (LL), lesion
width (LW), and lesion area (LA) were measured on the fourth
leaf of the inoculated plants.
A RIL population derived from a cross between japonica
variety Azucena and indica variety Bala (see Price et al 2000)
was used to map QTLs for partial blast resistance.
One hundred RILs were grown in the greenhouse on 10
trays. In each tray, seven replicate seeds of 10 RILs along with
both parents were sown. The RIL population was screened
with the blast fungus twice—on 13 and 31 March 2000. The
mean of each set of screening was used in the data analysis.
A genetic map developed from this population by Price
et al (2000) containing 101 RFLP and 34 AFLP markers on 17
linkage groups covering 1,680 cM was used in QTL analysis.
The computer program QTL Cartographer (Basten CJ, Weir
BS, and Zeng ZB, Department of Statistics, North Carolina
State University) was used to estimate QTLs. Positioning of
the QTLs was estimated following composite interval mapping
with the default settings for model 6. In the analysis, an
LOD score of 3.0 was used to determine the presence of a
QTL. The percentage of variation explained by a QTL was
calculated approximately by linear regression of the most significant
marker using the LRmapqtl program of QTL Cartographer.
Results and discussion
The phenotypic distribution of the traits was continuous, suggesting
quantitative inheritance of the characters studied (Fig.
1). In general, the traits followed a normal distribution, with
250 Advances in rice genetics

No. of RILs
20
15
10
5
25
20
15
10
5
0
20
15
10
5
0
0 1 2 3 4 5 6 7
Disease severity
0 10 20 30 40 50 60
Lesions leaf –1 (no.)
0
0.0 1.0 2.0 3.0 4.0 5.0
Lesion length (mm)
20
15
20
15
Mean of Azucena
Mean of Bala
10
10
5
5
0
0
0.0 0.4 0.8 1.2 1.6 2.0
0 2 4 6 8 10
Lesion width (mm)
Lesion area (mm 2 )
Fig. 1. Histograms showing the distribution of disease severity, number of lesions per leaf, lesion length (mm),
lesion width (mm), and lesion area measured in recombinant inbred lines (RILs) of rice.
the exception of LPL and LW. The skewed distribution of these
traits was due to the presence of a large number of small and
narrow lesions observed on a few RILs. The data of these traits
were transformed before QTL analysis. Transgressive segregation
was observed for all the traits studied.
Five QTLs for DS were identified, one each on chromosomes
1, 10, and 12, explaining 4.8%, 13.8%, and 18.9% of
the phenotypic variation, respectively, and two on chromosome
4 explaining 12.6% and 8.4% of the variation. The Azucena
alleles reduced DS in all these QTLs. Two QTLs for LPL, one
each on chromosomes 1 and 4 that coincided with the genomic
region, which controlled DS, accounted for 5.0% and 12.4%,
respectively, of the phenotypic variation. The Azucena alleles
reduced the number of lesions.
A total of five QTLs were detected for LL, one on chromosome
11 and two each on chromosomes 6 and 12, with positive
effects from both parents. Single-marker regression analysis
revealed either nonsignificant or small (

1 2
RG532
RG509
RG173
RG83
RZ995
e18m43.7
e18m43.6
e12m45.4
C178
e18m43.5
R2635
54 cM
C1370
G393
R2417
51 cM
RG171
G45
e18m43.8
G39/RG139
G57
C601
RG256
3
e12m37.4
C643
RG409
RG191
e12m45.1
RG745
e12m36.10
G144
e12m36.16
RZ474
C136
R1618
Chromosome
4
RG620
5
4.6 C734
RG449
RZ390
R3166
7.1
e18m43.17
RG190
R2232
R569
4.9 RG13
C513
RG163
C624
C43
RZ70
54 cM
RG119
RG346
4.3
4.1
6
C76
RZ516
e12m36.1
RG213
51 cM
e12m36.18
R2654
e12m37.7
e12m37.6
RG778
RZ682
3.5 4.6
4.0
5.9
C86
C949
RZ14
R117
Disease severity
Number of lesions per leaf
Lesion length
Lesion width
G164
Lesion area
100 cM
7
G338
C39
G89b
R1440
G20
C451
RG650
C507
e12m37.14
e12m36.1
RG351
8
R902
e12m36.7
G1010
C225
e12m37.10
e18m43.4
G2132
G1073
G187
R2676
R202
RG598
R662
9
R1164
e12m36x
R1687
R79
G385
e18m43.26
e12m36.13
G1085
e18m43.25
e12m36.4
C506
3.2
10
C701
G89d
RG257
e12m37.2
G1082
C16
C223
3.5
11
R642
RZ141
e18m43z
e12m36.2
G320
e15m35.14
G44
e12m45y
e12m36.15
RG2
C189
e12m36.6
G1465
e12m37.12
10.2
15.9
12.7
3.7
12
G24
CDO127
e12m37.13
G124
48 cM
R617
RG341
e12m36.14
R1933
C449
RG543
RG181/C901
3.0 3.7 3.8
Fig. 2. QTLs for characters related to partial blast resistance in rice. Boxes represent the one-LOD confidence interval and the values next to the boxes represent the
corresponding LOD score of the QTL. Boxes to the left of each chromosome identify QTLs where Azucena alleles have a positive effect, whereas boxes to the right
identify QTLs where Bala alleles have a positive effect.
252 Advances in rice genetics

Marker-assisted selection for transferring resistance
to blast in high-yielding but susceptible Jyothi
L. Babujee, B. Venkatesan, S. Kavitha, S.S. Gnanamanickam, S. Leenakumari, S. McCouch, and S. Leong
We have introgressed the blast resistance genes Pi1 and Pi2 from a CO39 pyramid through backcrossing into rice cv. Jyothi, a
high-yielding but blast- and bacterial blight (BB)-susceptible cultivar. The pyramided rice lines carrying Pi1 and Pi2 excluded
the entire rice blast population in Kerala State, southern India, when they were evaluated at Pattambi, Kerala, a hot spot for
blast. Phenotypic evaluation for selecting resistant progenies was supported by selection using molecular markers (microsatellite
markers RM224 and RM144 within 2.4 cM from Pi1 on chromosome 11). Progress has also been made to improve cv. Jyothi
and IR50 for resistance to BB. The pyramided line NH56 carrying Xa4, xa5, xa13, and Xa21 was used as the resistant donor
in backcross breeding. The RFLP marker G181 situated at 1.7 cM from Xa4 on chromosome 11 and PCR-based markers
(RG556 for xa5 within 0–1 cM on chromosome 5, RG136 for xa13 within 3.8 cM on chromosome 8, and pTA248 for Xa21 at
0–1 cM on chromosome 11) have been deployed to select lines carrying all four BB resistance genes.
Two important diseases that account for major yield losses in
most rice-growing areas worldwide are blast and bacterial blight
(BB). The use of host resistance is the most economical and
environment-friendly strategy to avert the spread of epidemics.
In the southern Indian state of Kerala, high-yielding cv.
Jyothi is cultivated in large areas, but it is highly susceptible to
both blast and bacterial blight. We also studied the genetic
structure and virulence characteristics of the rice blast fungus
in southern India and in Kerala (Sivaraj et al 2000). In lineage-exclusion
assays, none of the 25 pathogen lineages prevalent
in southern India, including Kerala, was able to overcome
the blast resistance afforded by Pi2(t) or Pi1 + Pi2(t) genes.
This study describes the transfer of these blast resistance genes
into rice cv. Jyothi through marker-assisted selection.
Materials and methods
A CO39 pyramid (carrying the dominant genes Pi1 and Pi2
for blast resistance) was crossed to elite commercial cultivar
Jyothi to obtain F 1 plants. The F 1 plants were further backcrossed
to obtain BC 1 plants or were selfed to obtain F 2 progeny.
Genomic DNA was extracted from F 2 plants, BC 1 plants,
and the parental lines following the modified method of Tai
and Tanksley (1990). The quality and quantity of the DNA
were determined electrophoretically. Primers for microsatellite
sequences RM144, RM224, RM139, and RM254 were obtained
from Dr. Susan McCouch’s laboratory at Cornell University.
Table 1 provides information on the nucleotide sequences
and length of these primer sources (http://ars-genome.
cornell. edu/rice/microsats.html).
Genomic DNA of the resistant donor parent and the
susceptible parent underwent PCR amplification in an MJ
thermocycler using the primer pairs. The PCR mixture consisted
of 10 ng of template DNA, 10 µM each of the primers,
0.1 mM dNTPs, 1X PCR buffer (10 mM Tris-HCl (pH 8.3),
50 mM KCl, 1.5 mM MgCl 2 , 0.01% gelatin), and 0.25 units of
Taq polymerase in a final volume of 25 µL. Template DNA
was initially denatured for 5 min at 94 °C, followed by 30
cycles of amplification under the following conditions: 15 sec
of denaturation at 94 °C, 15 sec of primer annealing at 55 °C,
and 15 sec of primer extension at 72 °C. A final 5-min incubation
was allowed at 72 °C for completion of primer extension.
The amplified DNA was mixed with 3X STR buffer (0.2% v/
v 5M NaOH, 95% v/v formamide, 0.05% w/v bromophenol
blue, 0.05% w/v xylene cyanol FF) to a final concentration of
1X and denatured by heating at 85 °C for 5 min and rapidly
chilling at –20 °C. The denatured samples were electrophoresed
on an aluminum-backed sequencing system (Model #
S3S from Owl Scientific Inc., MA, USA). Preparation of the
gel, assembly of the electrophoresis apparatus, and loading
and running of samples were according to procedures described
previously (Doyle 1996). Silver staining and photographing
procedures described in the Promega protocols and application
guide (Doyle 1996) were followed.
Magnaporthe grisea strain IN173.1.1 (MGR-RFLP lineage
“R”) that showed a differential reaction toward the two
parents (virulent on susceptible parent Jyothi and avirulent on
CO39, which carries Pi1) was used to differentiate resistant
(presumably because of the presence of Pi1) and susceptible
plants in F 2 and BC 1 populations. Phenotypic analyses were
carried out at the Regional Agricultural Research Station,
Pattambi, Kerala, in southern India. Methods for inoculum
preparation and inoculation were as described previously
(Mackill and Bonman 1992). For inoculation, a conidial suspension
of 100,000 conidia mL –1 in 0.5% gelatin was used.
Inoculated plants were kept in an enclosure devised with gunny
bags supported by PVC pipes. The bags were kept moist to
maintain high humidity (>90%) for the development of blast
symptoms. Disease reaction was scored 1 wk after inoculation
on a 0 to 9 scale described in the Standard evaluation system
for rice (IRTP 1988).
Molecular markers, QTL mapping, and marker-assisted selection 253

Table 1. Sequence of primers used for PCR amplification of microsatellite
loci.
Microsatellite locus/
primer
RM144 (OSM48)
RM224 (CT199)
Results
Electrophoretic analysis of PCR products derived from the
CO39 pyramid (Pi1 and Pi2) and Jyothi revealed no polymorphism
with RM254 and RM139. Allelic diversity was evident
at the microsatellite loci RM144 and RM224. A 210-bp band
corresponded to an allele from the susceptible parent, whereas
a 250-bp band corresponded to an allele from the resistant
parent for the microsatellite locus RM144. For the locus
RM224, a 140-bp band represented the allele from the susceptible
parent and a 90-bp band corresponded to the allele
from the resistant parent.
To examine the validity of the microsatellite loci as genetic
markers, genomic DNA from 150 F 2 individuals and 80
BC 1 individuals was PCR amplified using the primers CT199
(for microsatellite locus RM224) and OSM48 (for
microsatellite locus RM144). The resultant PCR products were
resolved on 4% acrylamide gel after denaturation. The banding
patterns were scored with reference to those of the parents.
The banding patterns of the F 2 individuals could be classified
as homozygous for the resistant-type marker (250-bp
band for RM144/90-bp band for RM224), homozygous for
the Jyothi-type marker (210-bp band for RM144/140-bp band
for RM224), or heterozygous (displaying both bands with either
marker). Resistant plants (heterozygotes) could similarly
be distinguished from the susceptible ones (homozygous for
the Jyothi-type marker) in the BC 1 population.
Chi-square analysis of goodness of fit was done for the
segregating populations (data not shown). Expected Mendelian
ratios of 1:1 and 1:2:1, respectively, were not obtained for
BC 1 and F 2 populations, suggesting a segregation distortion at
these loci.
Discussion
Primer sequence
F TGC CCT GGC GCA AAT TTG ATC C
R GCT AGA GGA GAT CAG ATG GTA GTG CAT G
F ATC GAT CGA TCT TCA CGA GG
R TGC TAT AAA AGG CAT TCG GG
Marker genotypes were used in this study to predict the presence
of the Pi1 gene in F 2 individuals. The F 2 individuals that
showed either band were predicted to be homozygous for the
corresponding allele, whereas plants that showed both bands
were predicted to be heterozygous at the Pi1 locus. This prediction
was compared with data derived from plant inoculation
assays of F 3 families. Table 2 shows the comparative results.
Lineage-exclusion tests have repeatedly identified the
Pi1 gene to be useful when deployed in combination with Pi2,
Table 2. Comparison of Pi1 genotype of F 2 plants based on SSLP
analysis of microsatellite loci (RM144 and RM224) and F 3 progeny
testing.
Number of plants
Match
Genotype (%)
SSLP analysis F 3 progeny test
RM144
RR 17 16 94.1
Rr 28 27 96.4
rr 105 105 100.0
RM224
RR 18 18 100.0
Rr 30 28 93.3
rr 102 102 100.0
another major blast resistance gene located on chromosome 6
to combat rice blast in southern India (Babujee and
Gnanamanickam 2000). To breed varieties with durable resistance
to blast, we are currently pyramiding the genes Pi1 and
Pi2 into high-yielding but blast-prone local cultivars by conventional
backcross breeding (Babujee and Gnanamanickam
2000). In this study, we have shown that microsatellite loci
can be used as genetic markers to identify plants carrying the
Pi1 gene for blast resistance in segregating populations. Because
linked RFLP and STS markers were not found, perhaps
because of the closely related genetic backgrounds of the parental
varieties, SSLP analysis was used to identify polymorphic
markers. Polymorphism associated with microsatellite loci
has been shown to be extremely useful in distinguishing closely
related rice varieties (Panaud et al 1995).
The microsatellite markers used in this study could distinguish
between homozygous/heterozygous resistant and susceptible
plants in F 2 and BC 1 populations. F 3 progeny-testing
results revealed a very high percentage of accuracy (Table 2),
indicating tight linkage of the markers to Pi1. Earlier, these
microsatellite DNA markers had been mapped within a distance
of 13.4 ± 1.4 cM from Pi1 on chromosome 11 (Susan
McCouch, personal communication). Chi-square analysis for
goodness of fit for F 2 and F 3 populations (data not shown)
indicated that segregation at the Pi1 locus did not conform to
typical Mendelian ratios. Distortion of segregation is not
uncommon in rice and the phenomenon has been recently reported
for other markers located very close to this region on
chromosome 11 (and at several regions on all 12 rice chromosomes)
(Xu et al 1997). The reasons for such a phenomenon,
however, remain unclear.
Polyacrylamide gel electrophoresis was used to resolve
PCR products in this study. However, a high-resolution matrix
such as metaphor:agarose (1:3) can serve as an efficient alternative
for use in laboratories with limited facilities. The low quantities
of DNA required for SSLP analysis and the rapidity with
which the analyses can be performed make it convenient for
use especially when the population to be screened is fairly large.
254 Advances in rice genetics

References
Babujee L, Gnanamanickam SS. 2000. Molecular tools for characterization
of rice blast pathogen (Magnaporthe grisea) population
and molecular marker-assisted breeding for disease resistance.
Curr. Sci. 78:248-257.
Doyle K, editor. 1996. Protocols and applications guide. 3rd ed. USA:
Promega Corp.
International Rice Testing Program (IRTP). 1988. Standard evaluation
system for rice, 3rd ed. Los Baños (Philippines): International
Rice Research Institute.
Mackill DJ, Bonman JM. 1992. Inheritance of blast resistance in
near isogenic lines of rice. Phytopathology 82:746-749.
Tai T, Tanksley SD. 1990. A rapid and inexpensive method for isolation
of total DNA from dehydrated plant tissue. Plant Mol.
Biol. Rep. 8:297-303.
Xu Y, Zhu L, Xiao J, Huang N, McCouch SR. 1997. Chromosomal
regions associated with segregation distortion of molecular
markers in F 2 , backcross, double haploid and recombinant
inbred populations in rice (Oryza sativa L.). Mol. Gen. Genet.
253:535-545.
Notes
Authors’ addresses: L. Babujee, B. Venkatesan, S. Kavitha, and S.S.
Gnanamanickam, Centre for Advanced Studies in Botany,
University of Madras, Guindy Campus, Chennai; S.
Leenakumari, Regional Agricultural Research Station,
Patambi, Kerala, India; S. McCouch, Department of Plant
Breeding, Cornell University, Ithaca, NY 14853; and S. Leong,
USDA-ARS, Department of Plant Pathology, University of
Wisconsin, Madison, WI 53706, USA.
Acknowledgments: This research was funded by generous grants from
the Rockefeller Foundation under their rice biotechnology
program. The authors wish to thank the director, Centre for
Advanced Studies in Botany, University of Madras, for laboratory
facilities. We also thank the associate director, RARS
(Kerala Agricultural University), Pattambi, Kerala, for providing
field space and assistance with the breeding.
Using microsatellite markers to select blast resistance
in U.S. rice breeding lines
R.G. Fjellstrom, C. Conaway, W.D. Park, M.A. Marchetti, and A.M. McClung
Blast disease, caused by Pyricularia grisea, is one of the most widespread and destructive diseases of rice in the world.
Combining blast-resistance genes can be difficult using traditional breeding methods since the presence of some resistance
genes can mask other resistance genes. We are developing PCR-based microsatellite markers associated with several major
blast-resistance genes. Microsatellite markers have been evaluated for their genetic linkage with the blast-resistance genes Pib,
Pi-k h , and Pi-ta 2 located on chromosomes 2, 11, and 12, respectively. We have identified three markers associated with the
Pi-b resistance gene derived from the Chinese variety Teqing and two markers associated with Pi-ta 2 resistance on chromosome
12 from the Vietnamese variety Tetep, and are evaluating three markers associated with the Pi-k h and Pi-k s resistance
alleles derived from the U.S. varieties Dawn and Caloro, respectively. These markers are being used to select new varieties that
will have blast-resistance gene combinations resulting in broad-spectrum resistance against blast races found in the U.S.
Rice blast, caused by Pyricularia grisea, is one of the most
widespread and destructive diseases of rice. The blast pathogen
is highly variable, with numerous races of blast present
under most field conditions. Blast-resistant varieties in the
United States have been developed from genetic sources that
have both complete and partial resistance factors. Unfortunately,
genes controlling complete resistance to blast confer
resistance to one or more, but not all, races of blast. Ten races
of blast, designated as IB-1, IB-45, IB-49, IB-54, IC-17, ID-
13, IE-1, IE-1K, IG-1, and IH-1, are commonly found in the
rice-growing regions of the U.S. Race-specific Pi-resistance
genes used in U.S. breeding programs include Pi-ta 2 , originating
from the Vietnamese variety Tetep, which confers resistance
to all races of blast in the U.S. except IE-1K; Pi-k h , originating
from Dawn, which confers resistance to IB-45, IB-54,
IG-1, and IH-1; Pi-k s (allelic to Pi-k h ), originating from Caloro,
which confers resistance to IB-54; and, more recently, Pi-b,
originating from the Chinese variety Teqing, which confers
resistance to IC-17, IE-1, IE-1K, and IG-1 (Marchetti et al
1987, Marchetti, unpublished data).
Multiple blast-resistance genes can be combined to obtain
broad-spectrum resistance. DNA markers provide a means
to efficiently pyramid several resistance factors together. DNA
markers associated with genes conferring both complete and
partial resistance to blast have been located on rice chromosome
maps, as reviewed in Hittalmani et al (2000). Comprehensive
microsatellite maps have been developed in rice that
have been combined with maps of disease-resistance genes
(RiceGenes, http://ars-genome.cornell.edu/rice/). In this study,
we report on the development of microsatellites for markerassisted
selection for blast resistance in the U.S. Department
of Agriculture-Texas A&M University (USDA/TAMU) varietal
improvement program.
Molecular markers, QTL mapping, and marker-assisted selection 255

Materials and methods
The crosses and blast races used to evaluate segregation of
individual Pi- genes included Gulfmont × Teqing using IE-1K
for Pi-b resistance; Jefferson-sibling × Katy using IB-54 for
Pi-k h resistance; Maybelle × M-201 and Maybelle × Bengal,
with both using IB-54 for Pi-k s resistance; and Kaybonnet ×
M-204 using IB-49 for Pi-ta 2 resistance.
Standard methods were used to prepare individual races
of the blast fungus for seedling inoculation and to evaluate
plants for their disease-resistance reaction 6–8 d after inoculation
(Marchetti et al 1987).
DNA was extracted from 20–40 mg lyophilized tissues
of greenhouse-evaluated material. Microsatellite markers were
polymerase chain reaction (PCR)-amplified using the protocol
of Ayers et al (1997) with primers RM138, RM166, and
RM208 for Pi-b; RM83 and RM101 for Pi-ta 2 ; and RM144
for Pi-k h . Amplification products were loaded on nondenaturing
8% polyacrylamide gels (1XTBE), run overnight at 220V,
stained (GelStar, FMC), placed on a blue light-emitting transilluminator
(DarkReader, Clare Chemical Research), and recorded
with a digital camera. Marker genotypes were determined
and compared with disease-resistance reactions to estimate
the linkage between resistance genes and microsatellites,
with genetic distance reported as a recombination fraction
(Morgan map units).
Results and discussion
Pi-b resistance factor on chromosome 2
The identification of microsatellite markers in the USDA/
TAMU program began before comprehensive microsatellite
maps were developed. Candidate microsatellite sequences
found near Pi-resistance gene regions were initially identified
from the sequence analysis of publicly accessed DNA databases
(e.g., GenBank). RM138 and RM166 were among the
first microsatellites identified to be closely linked to the Pi-b
gene of Teqing, flanking it at 5.3 and 5.1 cM, respectively
(Table 1). Other microsatellites later mapped between these
markers were subsequently tested and RM208 was found to
cosegregate (0.0 cM linkage, Table 1) with the Pi-b gene. Since
the Pi-b gene has been cloned (Wang et al 1999), we have
been able to confirm the cosegregation of IE-1K resistance
with a dominant marker indicating the presence of the Pi-b
gene sequences in this cross and in other crosses using Teqing
as a parent. We find the linked microsatellite markers to be
more useful than the dominant Pi-b gene sequence itself because
heterozygotes can be discriminated from homozygotes
and failed PCR amplification reactions can be more readily
identified.
Pi-k h /Pi-k s resistance factors on chromosome 11
RM144 was found to be 7.8 cM from the Pi-k h gene of the
Jefferson-sibling parent, which had been derived from the U.S.
variety Dawn (Table 1). We are currently evaluating RM144,
RM224, and RM254 to determine their usefulness for tagging
Table 1. Recombination rates between blast-resistance genes and
microsatellite markers tested in the USDA/TAMU varietal improvement
program.
Resistance gene Cross combination Microsatellite Recombination
Pi-b Gulfmont × Teqing a RM138 11/207
RM166 10/198
RM208 0/74
Pi-k h Jefferson-sib a × Katy RM144 17/217
Pi-ta 2 Kaybonnet a × M-204 RM83 6/57
RM101 29/557
a Blast-resistant parent.
the allelic Pi-k h and Pi-k s resistance genes in other crosses using
Bengal and M-201, respectively, as sources of resistance.
Pi-ta 2 resistance factors on chromosome 12
RM83 and RM101 were found to be located 10.5 cM and 5.2
cM, respectively, from the IB-49 resistance factor in Kaybonnet
(Table 1). Although the IC-17 and IB-49 resistance factors of
the Pi-ta 2 gene appear to be separate (Chao et al 1999,
Marchetti, unpublished data), we have not yet mapped the distance
between these factors. Because both markers lie on one
side of the Pi-ta 2 gene, we are trying to develop flanking markers
that are associated with the IB-49 and IC-17 resistance
factors and that could be used to detect recombination between
these factors.
In conclusion, we have identified microsatellite markers
associated with three blast-resistance genes used in U.S. rice
breeding programs. These markers are being actively used for
marker-assisted selection to introgress multiple blast-resistance
genes into advanced breeding lines.
References
Ayers NM, McClung AM, Larkin PD, Bligh HFJ, Jones CA, Park
WD. 1997. Microsatellites and a single-nucleotide polymorphism
differentiate apparent amylose classes in an extended
pedigree of U.S. rice germplasm. Theor. Appl. Genet. 94:773-
781.
Chao CT, Moldenhauer KAK, Ellingboe AH. 1999. Genetic analysis
of resistance/susceptibility in individual F 3 families of rice
against strains of Magnaporthe grisea containing different
genes for avirulence. Euphytica 109:183-190.
Hittalmani S, Parco A, Mew TV, Zeigler RS, Huang N. 2000. Fine
mapping and DNA marker-assisted pyramiding of the three
major genes for blast resistance in rice. Theor. Appl. Genet.
100:1121-1128.
Marchetti MA, Lai X, Bollich CN. 1987. Inheritance of resistance
to Pyricularia oryzae in rice cultivars grown in the United
States. Phytopathology 77:799-804.
Wang Z-X, Yano M, Yamanouchi U, Iwamoto M, Monna L, Hayasaka
H, Katayose Y, Sasaki T. 1999. The Pib gene for disease resistance
belongs to the nucleotide binding and leucine-rich
repeat class of plant disease resistance genes. Plant J. 19:55-
66.
256 Advances in rice genetics

Notes
Authors’ addresses: R.G. Fjellstrom, M.A. Marchetti, A.M.
McClung, United States Department of Agriculture (USDA),
Agricultural Research Service, Rice Research Unit, 1509
Aggie Drive, Beaumont, Texas 77713; C. Conaway, W.D. Park,
Department of Biochemistry and Biophysics, Texas A&M
University (TAMU), College Station, Texas 77843, USA.
Mapping a recessive gene conferring resistance
to rice yellow mottle virus
M.N. Ndjiondjop-Nzenkam, L. Albar, D. Fargette, C. Brugidou, M.P. Jones, and A. Ghesquiere
Rice yellow mottle virus (RYMV) is a serious disease of rice in Africa. Although partial resistance is found in upland rice
varieties, all the irrigated and lowland rice varieties commonly grown in Africa are highly susceptible to RYMV. A few accessions
of the African cultivated rice species (Oryza glaberrima) and a single variety of O. sativa (Gigante) display a very high resistance
level similar to immunity. The genetic basis of resistance to RYMV was determined through interspecific and intraspecific
crosses using Tog5681 (O. glaberrima) and Gigante as RYMV resistance donors and IR64 as the susceptible parent. The
resistance was due to the presence of a single recessive gene with probably different resistance alleles in Tog5681 and
Gigante. Bulked segregant analysis (BSA) was used to map the RYMV resistance gene. About 250 primer combinations were
used to compare banding patterns between parental lines and bulks of susceptible or resistant (IR64 × Gigante) F 3
lines. In
addition, more than 20 bands coming from one or the other parent were found to be candidates for the resistance coming from
Tog5681. Mapping on the (IR64 × Gigante) F 2
population revealed an interval of 17 cM spanning the RYMV resistance locus.
One of these markers was cloned and specific primers were designed. A cleaved amplified polymorphic sequence (CAPS) has
been determined to characterize the Gigante and IR64 alleles. This marker was mapped on the (IR64 × Azucena) genetic
linkage map and was localized on chromosome 4. PCR-based resistance markers allowed us to begin transferring the RYMV
resistance gene into Bouake 189, BG90-2, and Jaya (O. sativa) varieties, which are very well adapted to African lowland
conditions but are highly susceptible to RYMV. Fine mapping of the RYMV resistance locus and the construction of IR64 isolines
with the two resistance genes are in progress.
Rice yellow mottle sobemovirus (RYMV) is a major disease
affecting rice production in Africa and Madagascar. The intensification
of farming systems (irrigation and introduction
of high-yielding varieties) has led to RYMV epidemic outbreaks.
All varieties usually grown in irrigated conditions and
in lowland areas of Africa are susceptible to RYMV. In nature,
RYMV is transmitted by chrysomelid beetles. Symptoms consist
of yellow mottling on the leaves, reduced tillering, stunted
plants, and sterile flowers, and susceptible cultivars die. The
RYMV genome is a positive single-stranded RNA of 4,450
nucleotides. To replicate, RYMV uses a subgenomic RNA strategy
and its replication occurs in all parts of the rice plant, but
mainly in the mesophyll and xylem parenchyma. Different
degrees of resistance to RYMV have been detected in the cultivated
Asian (Oryza sativa) and African rice varieties (O.
glaberrima).
Partial resistance in rainfed rice O. sativa subsp. japonica
from Africa (Lac-23 and Moroberekan) and Asia (Azucena) is
under polygenic control. One major quantitative trait locus
(QTL) has been found on chromosome 12, which interacts with
other regions of the rice genome. A high level of resistance
needed for sustainable breeding has been found in some O.
glaberrima varieties and Gigante (O. sativa). We studied the
genetics of resistance to RYMV and mapping of genes linked
to RYMV.
Results suggested that there was no limitation to virus
spread in a susceptible cultivar such as IR64, which leads rapidly
to plant death. Conversely, the partial resistance of Azucena
was clearly expressed as a delay of virus spread in the inoculated
plant. Virus content was not significantly detected before
7 d postinoculation (dpi) and it was correlated with a lowered
RNA accumulation until 14 dpi. Nevertheless, kinetics of
the virus spread in Azucena showed that the resistance was
rapidly overcome.
Results
Expression of the resistance
The resistance found in Gigante and Tog5681 is expressed as
a lack of symptoms in infected plants and was not overcome
by any of the RYMV isolates tested.
The virus replicates in the protoplasts of both resistant
and susceptible varieties. We indirectly demonstrated vascular
movement of the virus throughout the resistant genotypes
with no accumulation of virus genome in the inoculated leaves
of different plant varieties.
Molecular markers, QTL mapping, and marker-assisted selection 257

Number of individuals per class
30
25
12%
Gigante
IR64
Resistant F 2 Susceptible F 2
20
15
7.5%
Fig. 2. Segregation for RYMV and CAPS marker in the F 2 population
(IR64 × Gigante).
10
4.5% 6%
3%
5
19%
1.5%
15%
0
Allelic frequency of O. glaberrima (%)
Fig. 1. Frequency of O. glaberrima alleles across interspecific lines.
Inheritance of RYMV resistance in Tog5681
and Gigante
Plant regeneration by tiller splitting of 1-mo-old plants was
performed to allow the evaluation of the virus titer of F 1 hybrids
and that of different backcross-derived sterile plants. Any
F 1 combinations between IR64 and the resistant parents,
Tog5681 and Gigante, and 19 interspecific backcross individuals
[(IR64 × Tog5681) × IR64] were tested and gave a high
ELISA response similar to IR64. These observations indicated
the recessive nature of the resistance. The reciprocal backcross
[(IR64 × Tog5681) × Tog5681] gave a clear 1:1 segregation
(χ 2 = 0.18), which was compatible with the presence of
a single recessive gene in Tog5681. Additionally, a backcross
individual, BC 1 F 1 , was found to be fertile and gave F 2 progenies.
The test involving these F 2 progenies as well as testcrosses
of the backcross sterile plants with the two parents
revealed a very high and homogeneous susceptibility of the
genetic material through both symptom scoring and ELISA
response. These results clearly confirmed that a single recessive
gene could explain the distribution of interspecific backcross
progenies in two resistance classes. The frequency of O.
glaberrima alleles in different interspecific lines is shown in
Figure 1.
The segregation of resistance was identified in 65 (IR64
× Gigante) F 2 plants inoculated with the BF 1 isolate. New
emerging leaves of each F 2 plant were tested by ELISA. The
ELISA responses clearly separated the F 2 plants into two groups
without intermediate values. In fact, the plants without symptoms
gave the very low ELISA response found in Gigante.
The other F 2 plants, whatever the symptom severity of the inoculated
leaves, gave a high ELISA response similar to that of
IR64. This clustering fits well a 3:1 segregation (χ 2 = 0.13)
corresponding to the presence of a single recessive resistance
gene in this F 2 population. Altogether, the two sources of resistance
(Tog5681 and Gigante) showed the same recessive
pattern of inheritance. The response to infection of F 1 hybrids
between Tog5681 and Gigante was very low and similar to
l Linkage between M1, M3, and the resistance gene
55 F 2 (IR64 ´ Gigante)
{ 80 resistant F 2 (IR64 ´ Gigante)
40 BC ((Tog5681 ´ IR64) ´ IR64)
M1 Rymv-1 M3
12.4 4.1
15% rec.
l Mapping of M1 on the IR64 ´ Azucena
linkage map
Chromosome 4
Rymv-1
Xa-2, Pi-
Xa-1, Gm2
Fig. 3. Location of Rymv-1 on chromosome 4 of rice.
CD0456
G1184B
RG190
SB734a
RG449
RG788
RZ565
RZ675
RZ740
RG163
RG214
RZ590
RG143
RG620
that of the parents. The resistance observed in (Tog5681 ×
Gigante) F 1 hybrids was in favor of an identical resistance locus.
F 3 progeny tests were carried out from the IR64 × Gigante
cross. Each F 3 family (10 to 20 plants per family) was inoculated
and symptom expression was assessed up to 2 mo after
inoculation. The frequency of resistant plants fits with the expected
segregation of 3:1 (χ 2 = 0.07). The classification of F 3
families fits the 1:2:1 expected distribution with the segregation
of a single resistance gene (χ 2 = 1.36).
Mapping of the CAPS marker linked to the RYMV
resistance gene in the interspecific reference map
(IR64 × Azucena)
Results showed segregation of the CAPS marker through the
F 2 population between IR64 × Gigante (Fig. 2). The resistance
to RYMV is recessive and controlled by a single gene, Rymv-
1, localized on chromosome 4 in the same region where other
resistance genes are also located (Fig. 3).
High resistance to RYMV was associated with very low
virus accumulation throughout plant growth. Resistant plants,
M1
10 cM
258 Advances in rice genetics

inoculated as early as 10 dpi, could complete a normal growth
cycle and produce an abundant seed set. A similar pattern of
resistance was found in O. breviligulata, which is the direct
progenitor of O. glaberrima (Thottapilly and Russel 1993).
Nevertheless, this high level of RYMV resistance is very rare
in O. glaberrima and is found only in five cultivars among
several hundred. The finding of an exceptional cultivar of O.
sativa with a resistance similar to that of an O. glaberrima
resistant cultivar is novel for the following reasons: (1) it is
the first time that such high resistance is reported in O. sativa
collections and nurseries despite intensive RYMV resistance
screening by national and international institutions, (2) Gigante
showed the typical morphological traits and lowland adaptation
of a traditional indica cultivar, whereas all the other indica
cultivars were found to be highly susceptible to RYMV,
and (3) only quantitative resistance has been observed in upland
rice cultivars in O. sativa.
The resistance to RYMV was controlled by the same
locus in Gigante and Tog5681 cultivars. The resistance mechanism
was completely different from the polygenic partial resistance
system found in upland cultivars of O. sativa. Identification
of morphological-dependent and morphological-independent
QTLs for RYMV resistance in the (IR64 × Azucena)
doubled-haploid populations supported this hypothesis. RYMV
resistance in Tog5681 and Gigante was caused by a mutation
of a plant factor (only one protein) necessary to the transport
of the virus within the mesophyll cells, since the inheritance of
RYMV resistance in these cultivars is monogenic and recessive.
The very rare occurrence of high resistance to RYMV in
O. sativa as well as in O. glaberrima also strongly confirmed
that it may have evolved from the mutation of the same host
factor.
The bulked segregant analysis method described by
Michelmore et al (1991) was applied on the interspecific and
intraspecific progenies using amplified fragment length polymorphism
markers. Of the six markers identified, one was transformed
in codominant CAPS (cleaved amplified polymorphic
sequence) and mapped on chromosome 4 close to other resistance
genes on the reference (IR64 × Azucena) genetic linkage
map. The cloning of the major recessive gene involved in
the short-distance movement of RYMV would greatly help to
identify the corresponding genes in more complex plant genomes
and to elucidate the unknown interactions of their products
with the movement protein of potyviruses.
References
Michelmore RW, Paran I, Kesseli RV. 1991. Identification of markers
linked to disease-resistance genes by bulked segregant
analysis: a rapid method to detect markers in specific genomic
regions by using segregating populations. Proc. Natl. Acad.
Sci. 88:9828-9832.
Thottapilly G, Russel HW. 1993. Evaluation of resistance to rice
yellow mottle virus in Oryza species. Indian J. Virol. 9(1):65-
73.
Notes
Authors’ addresses: M.N. Ndjiondjop-Nzenkam, M.P. Jones, West
Africa Rice Development Association (WARDA), 01 B.P.
2551, Bouaké 01, Côte d’Ivoire; D. Fargette, Centre
Internationale pour la Recherche et le Developpement en
Afrique de L’Quest; L. Albar, C. Brugidou, and A. Ghesquiere,
Institut de Recherche pour le Developpement (IRD), Unité de
Genetique Laboratoire Genetrop, 911 Avenue d’Agropolis,
B.P. 5045, 34032 Montpellier Cedex 1, France.
Partial resistance to rice yellow mottle virus: QTL
identification, genetic model, and QTL efficiency
analysis after marker-assisted introgression
N. Ahmadi, L. Albar, G. Pressoir, M. Lorieux, D. Fargette , and A. Ghesquière
QTLs for rice yellow mottle virus resistance were mapped in a doubled-haploid population of rice, IR64/Azucena. Resistance
was under polygenic control and 15 QTLs were detected on seven chromosomal fragments. For all the resistance QTLs
detected, the favorable allele was provided by the resistant parent Azucena. Using different resistance parameters and two
environments, three genomic fragments involved in resistance were pointed out. These segments were also involved in plant
architecture and development. Significant correlations were observed between resistance and tillering ability. A resistance QTL
involved in leaf virus content mapped on chromosome 12 (QTL 12
) was found to be independent of plant morphology. A search
of interactions between this QTL and the rest of the genome and between this QTL and morphological traits segregating in the
population showed that a complementary epistasis between QTL 12
and a QTL located on chromosome 7 (QTL 7
) was the major
genetic factor controlling the virus content. Marker-assisted selection was performed to introgress the resistance allele of QTL 12
and QTL 7
from Azucena into IR64. After three cycles of marker-assisted backcrosses, the proportion of the recipient genome in
the selected plant was close to 95% for the 10 noncarrier chromosomes, and the length of the donor chromosome segment
surrounding the two QTLs was less than 20 cM. Evaluation of the level of resistance in BC 1
F 3
and BC 2
F 3
lines confirmed the
relevance of the complementary epistasis genetic model proposed.
Molecular markers, QTL mapping, and marker-assisted selection 259

Rice yellow mottle virus (RYMV), first described in 1974
(Bakker 1974), is now, with blast, the most damaging disease
of rice in Africa, where it is endemic. It occurs in all ricegrowing
ecosystems, but incidence is particularly high in the
irrigated ecosystem with high-yielding indica varieties. Susceptible
varieties show yellowing, mottling, stunting, and sterility.
Control of the vector is of limited use against RYMV
spread (Abo et al 1998). The most promising strategy is the
development of resistant varieties.
Three types of varietal resistance to RYMV are known:
a resistance obtained through genetic transformation (Pinto et
al 1999), a natural high resistance (Ndjiondjop et al 1999),
and a natural partial resistance (PR) (Ghesquière et al 1997).
The natural high resistance is rare and observed in a few varieties
of Oryza glaberrima and in only one variety of O. sativa.
The PR to RYMV—limited symptoms, limited effect on plant
development, and reduced virus content—is more widely distributed.
All varieties with a significant PR belong to tropical
japonica and are not adapted to lowland cultivation. We present
here results on (1) mapping of resistance quantitative trait loci
(QTLs), (2) the effect of plant morphology and genetic background
on RYMV resistance, (3) marker-assisted introgression
(MAI) of the major genetic factors controlling the virus
content (VC) from an upland japonica variety, Azucena, into a
lowland susceptible indica variety, IR64, and (4) efficiency of
the genetic model proposed.
Materials and methods
One hundred and seventeen doubled-haploid (DH) lines of the
IR64/Azucena cross were used. For each DH line, plant morphology
and field-level resistance were characterized in the
IER research station in Mali and VC was assessed in a growth
chamber in Montpellier, France (Albar et al 1998). Field resistance
was evaluated through disease effect after inoculation
on plant morphology and development: height and number of
tillers 8 wk after sowing (H8r and T8r), height and number of
fertile tillers at maturity (HMr and TMr), heading date (HDr),
grain weight (GWr), symptom expression, and plant VC. Plant
VC was evaluated through enzyme-linked immunosorbent assay.
The QTL analysis method was described by Albar et al
(1998). As a QTL strongly involved in VC has been identified
on chromosome 12, a wide search was performed to find interactions
between this QTL and the rest of the genome and
between this QTL and morphological traits segregating in the
population (Pressoir et al 1998). To introgress two resistance
QTLs from Azucena to IR64, three cycles of molecular markerassisted
backcross breeding were carried out using restriction
fragment length polymorphism (RFLP) and microsatellite
markers. Concurrently, phenotypic control was performed in
controlled conditions on F 2 plants of each backcross generation.
The relationship between the allelic status of QTL 12 and
QTL 7 markers and leaf VC was analyzed in 12 BC 1 F 3 and 12
BC 2 F 3 lines, homozygous for the two QTL markers, in controlled
conditions (Ahmadi et al 2001).
Results and discussion
Mapping of resistance QTLs
A total of 15 QTLs were detected on seven chromosome regions
(Albar et al 1998). For all these QTLs, the favorable
allele was provided by the resistant parent Azucena. Analysis
based on HMr, T8r, H8r, and HDr detected four QTLs on chromosome
1, in the region of sd1. These QTLs explained 17%,
22%, 12%, and 15% of phenotypic variance observed on HMr,
T8r, H8r, and HDr, respectively. For GWr, two QTLs were
detected on chromosome 4 and chromosome 1, in the region
of sd1. These QTLs explained 31% of the variation. The QTL
mapped on chromosome 4 was co-located with a QTL implicated
in HDr. For VC assessed on plants grown in the field,
one QTL was mapped on chromosome 1, in the region where
QTLs controlling field resistance had been detected. This QTL
explained 28% of the phenotypic variation observed on this
character. Finally, for VC in plants grown in the growth chamber,
four QTLs on chromosomes 1, 2, 8, and 12 were found.
Among all resistance QTLs detected, the one mapped on chromosome
12 (QTL 12 ) has an important effect on leaf VC as
well as on symptoms in the field, and did not co-localize with
any plant aerial-part morphology QTL.
Search for interactions between QTL 12
and the rest
of the genome
This search provided evidence that a complementary epistasis
between QTL 12 and an RFLP marker close to a tillering QTL
located on chromosome 7 (QTL 7 ) could be the major genetic
factor controlling VC. The percentage of variance explained
by this interaction (36.5%) was much higher than the one explained
by RG869 alone (21%). Resistance was also affected
by a morphology-dependent resistance since tillering was interfering
with the resistance mechanism conditioned by the
epistasis between the two QTLs (Pressoir et al 1998).
Marker-assisted introgression of QTL 12
and QTL 7
The introgression process (Fig. 1) started with one of the DH
lines of IR64/Azucena, which already had a predominant
(60%) IR64 genetic background and a high level of resistance
associated with the Azucena alleles at QTL 12 and QTL 7 . This
DH line also showed recombination on each side of QTL 12 . In
BC 1 , a noncarrier chromosome selection was performed. In
BC 2 , selection was carried out for the resistance allele on the
two QTLs. The backcross process was then pursued with a
BC 2 F 2 plant homozygous for the resistance allele of QTL 12
and QTL 7 . In BC 3 , a background selection was performed with
microsatellite markers chosen on the basis of genetic conformation
of the selected BC 1 plant (Fig. 2A). In the selected
BC 3 progeny, the proportion of the recipient genome was close
to 95% for the 10 noncarrier chromosomes, and the length of
the donor chromosome segment surrounding the two QTLs
was less than 20 cM (Fig. 2B). This successful MAI was not in
strict conformation with recommendations of analytical and
simulation studies. This result points to the efficiency and
methodological flexibility of MAI.
260 Advances in rice genetics

Complementary epistasis between QTL 12
and QTL 7
and QTL efficiency
Within the BC 1 F 3 and BC 2 F 3 lines, the allelic status of QTL 12
and QTL 7 had a significant effect on plant VC, at P

A
1 2 3 4 5 6 7 8 9 10 11 12
B
1 2 3 4 5 6 7 8 9 10 11 12
Fig. 2. Genetic constitution of the selected
(A) BC 1 F 1 and (B) BC 3 F 1 plants. In
white, chromosomal segments from the
recipient parent IR64; in black, chromosomal
segments from the donor parent
Azucena. Arrow indicates the position of
the microsatellite marker loci used for
background selection in BC 3 .
Table 1. Allelic status of QTL 12 and QTL 7 and leaf virus content in
BC 1 and BC 2 progenies.
Genotype
Leaf virus content a
QTL 12 marker QTL 7 marker BC 1 -F 3 lines b BC 2 -F 3 lines b
R 12 R 12 R 7 R 7 0.443 a 0.305 a
R 12 R 12 S 7 S 7 0.553 ab 0.450 b
S 12 S 12 R 7 R 7 0.597 ab 0.619 c
S 12 S 12 S 7 S 7 0.815 b 0.650 c
Azucena 0.184 0.238
IR64 0.968 0.661
a Leaf virus content (VC) is expressed in absorbance (405 nm) measured by ELISA
test. b VC data of parents were not submitted to statistical analysis; VCs followed by
the same letter in each column are not significantly different according to Newman-
Keuls test, P = 0.05 for BC 1 F 3 and P = 0.01 for BC 2 F 3 .
Pinto Y, Kok R, Baulcombe D. 1999. Resistance to rice yellow mottle
virus in cultivated African rice varieties containing RYMV
transgenes. Nat. Biotechnol. 17:702-707.
Pressoir G, Albar L, Ahmadi N, Rimbault I, Lorieux M, Fargette D,
Ghesquière A. 1998. Genetic basis and mapping of the resistance
to rice yellow mottle virus. II. Evidence of a complementary
epistasis between two QTLs. Theor. Appl. Genet.
97:1155-1161.
Notes
Authors’ addresses: N. Ahmadi, CIRAD-CA/CALIM, Avenue
Agropolis, 34398 Montpellier Cedex 5; L. Albar, G. Pressoir,
M. Lorieux, A. Ghesquière, LPRC, ORSTOM/CIRAD,
BP5035, 34032 Montpellier Cedex; D. Fargette, Unité
Génétique, GeneTrop, ORSTOM, BP5045, 34032 Montpellier
Cedex, France.
262 Advances in rice genetics

Constructing linkage maps of brown planthopper resistance
genes Bph1, bph2, and Bph9 on rice chromosome 12
H. Murai, P.N. Sharma, K. Murata, Z. Hashimoto, Y. Ketipearachi, T. Shimizu,
S. Takumi, N. Mori, S. Kawasaki, and C. Nakamura
Genetic analysis of three brown planthopper (BPH) resistance genes—Bph1, bph2, and Bph9—was conducted using the
segregating populations derived from crosses of Tsukushibare with Norin-PL3 (a Bph1 introgression line), Norin-PL4 (a bph2
introgression line), or Pokkali (donor of Bph9). BPH bioassays showed that Bph1 and Bph9 were single dominant genes, but
a recessive gene, bph2, reportedly also behaved as a dominant gene. Restriction fragment length polymorphism, amplified
fragment length polymorphism, and random amplified polymorphic DNA markers were selected by bulk segregant analysis.
Bph1 was mapped on the long arm of chromosome 12, with the closest marker being at 3.1 cM. bph2 and Bph9 were mapped
at the regions proximal to the Bph1 locus. Within 3.2 cM covering the bph2 locus, nine AFLP markers were identified, one of
which showed complete cosegregation. bph2 was located within the 1.0-cM distance between two other flanking markers.
Together with the known Bph10(t) locus from Oryza australiensis, our results revealed the clustering of four functional BPH
resistance genes on the long arm of rice chromosome 12. The construction of a fine linkage map of bph2 should help mapbased
cloning and marker-assisted pyramiding with other BPH resistance genes.
Brown planthopper (BPH) is one of the most serious insect
pests of rice in Asia. Little is known about the molecular nature
of BPH resistance genes and the mechanism of BPH resistance.
Eleven BPH resistance genes have so far been identified
in indica rice varieties and two wild relatives. Three of
them (Bph1, bph2, and Bph10(t)) have been mapped on rice
chromosome 12 (Ishii et al 1994, Hirabayashi and Ogawa 1995,
Murata et al 1997, 1998). We attempted to construct linkage
maps of three BPH resistance genes, Bph1, bph2, and Bph9.
Materials and methods
A BPH-susceptible cultivar, Tsukushibare, two introgression
lines with BPH resistance genes, Norin-PL3 (Bph1) and Norin-
PL4 (bph2), and Pokkali (Bph9) were used. F 2 and F 3 progenies
derived from Tsukushibare/Norin-PL3 were used for
Bph1. For bph2, one heterozygous F 2 plant derived from
Tsukushibare/Norin-PL4 was selected. This F 2 plant possessed
a 9.8-cM segment introgressed from the resistance donor after
marker recombination outside of the bph2 locus. This recombinant
F 2 plant was used to obtain F 3 plants. F 4 and F 5 progenies
were derived after self-fertilization of two heterozygous
F 3 plants that showed identical marker genotypes within the
introgressed region. For Bph9, F 2 , F 3 , and F 4 plants from
Tsukushibare/Pokkali were used. Tsukushibare, Norin-PL3,
Norin-PL4, and Pokkali served as susceptible and resistant
controls in the following BPH bioassay and bulk segregant
analysis.
Conditions for the BPH bioassay using bulk seedlings
were similar to those described by Murata et al (1998). Genotypes
for BPH resistance/susceptibility of F 2 s (for Bph1) and
F 4 s (for bph2) were determined by assaying F 3 s and F 5 s, respectively.
For Bph9, genotypes of F 2 s were determined using
F 4 s in the bioassay.
DNA was extracted from 15 RR (resistant) and 16 SS
(susceptible) F 3 lines after determining the BPH genotypes of
individual F 2 s. For bph2 and Bph9, DNA was extracted from
10 RR and 10 SS F 4 s and F 3 s, respectively, and combined to
prepare RR and SS bulk DNA. The bulk DNA was used together
with the parental DNA in the bulk segregant analysis to
detect polymorphic markers associated with BPH resistance/
susceptibility. Restriction fragment length polymorphism
(RFLP) markers were detected by Southern blot analysis according
to Murata et al (1998). Bulk segregant analysis using
amplified fragment length polymorphism (AFLP) markers was
performed according to the supplier’s instructions (GIBCO-
BRL). Amplified products were fractionated by electrophoresis
through 13% polyacrylamide gel and stained with silverstaining
reagents (BIORAD). A high-efficiency AFLP genomescanning
system developed by Kawasaki et al (1999) was applied
to analyze bph2. In this system, amplified products were
visualized by staining with Sil-Best Stain TM for protein/PAGE
(Nacalai Tesque, Japan). For Bph9, the random amplified polymorphic
DNA (RAPD) marker system was applied together
with the RFLP marker system. RAPD-polymerase chain reaction
analysis was performed using 240 random 10-mer primers
(Operon Technologies Inc.).
Linkage analysis of Bph1 was conducted using 262 F 2 s,
whereas 224 F 4 s were used for bph2. Because of high sterility
in the cross Tsukushibare/Pokkali, only 62 F 2 s could be studied
for Bph9. The recombination values were calculated by
MAPMAKER and linkage maps were constructed based on
LOD scores greater than 3.0.
Results and discussion
Segregation of BPH resistance conferred by Bph1 was studied
in 262 F 2 individuals derived from Tsukushibare/Norin-PL3.
Molecular markers, QTL mapping, and marker-assisted selection 263

Nipponbare/Kasalath
Chromosome 12, short arm side
cM
Marker
TEL2A
G24B
C732B
R642B
Tsukushibare/Norin-PL3
cM
Marker
C751
C1336
R2672A
Tsukushibare/Pokkali
4.3
1.8
2.2
5.0
3.1
2.2
2.6
0.8
1.1
3.3
S1786A
G402
RZ261
Bph1
em24
R2708
em32
C87
G148
C454
CEN
Bph10(t)
R3375
R617
C443
S826
G2140
Bph9
S11679
G402
S2545
bph2
GR457
Bph1
C2808
R2708
R1709
C87
G148
C1069
R1684
C901
S1786A
C751
R643B
C454
Marker
R617
C443
ORF15
G2140
OPR04
Bph9
S2545
cM
2.5
4.4
7.5
8.7
8.8
12.5
6.1
C2808, R3106
R1709 2.5
Tsukushibare/Norin-PL4
cM Marker
KAM1
0.5
KAM2
0.5
KAM3
0.2
bph2
KAM4
0.8
KAM5
0.3
KAM6
KAM7
0.9
KAM8
Fig. 1. Map positions of
Bph1, bph2, Bph9, and
Bph10(t). The second map
from the left is the standard
Nipponbare/Kasalath map
of rice chromosome 12
(Harushima et al 1998). The
map on the left is for Bph1
and the two maps at the
right are for Bph9 and bph2.
Map positions of Bph1,
bph2, Bph9, and Bph10(t)
(Ishii et al 1994) are indicated
on the standard map.
These map positions are
arbitrary because they were
determined in different
mapping populations. CEN
= centromere.
The F 2 segregation of RR, RS, and SS fit in the expected 1:2:1
ratio. These RFLP markers were selected from the region on
chromosome 12 based on a previous mapping study (Murata
et al 1997). Three S-associated dominant, one R-associated
dominant, and four R/S-associated codominant RFLP markers
were identified. In addition, one R-associated dominant
and one codominant AFLP marker were identified. Segregation
of all the detected markers did not deviate from the expected
3:1 or 1:2:1 ratio, depending on dominance and
codominance, respectively. Bph1 was mapped on the long arm
of chromosome 12 (Fig. 1). A codominant AFLP marker
(em24) was closest to the Bph1 locus, with a distance of 3.1
cM.
Segregation of BPH resistance conferred by the reportedly
recessive gene bph2 was studied using 224 F 4 s derived
from the cross Tsukushibare/Norin-PL4. BPH genotypes of
individual F 4 s were determined after a bioassay of the F 5 s.
The F 4 segregation of RR, RS, and SS did not deviate from the
1:2:1 ratio, but the segregation of F 5 s from RS F 4 s showed the
dominant nature of bph2. This conflicting result agreed with a
previous one obtained using 159 F 2 s from the same cross combination
(Murata et al 1998). PCR using 21 of 1,344 primer
combinations resulted in amplification of R- or S-associated
polymorphic bands. After a preliminary experiment using 64
F 4 s, two S-associated and six R-associated markers were selected
as closely linked to bph2 and used in a further mapping
264 Advances in rice genetics

study of 224 F 4 s. They all showed the expected 3:1 segregation
ratio. Three AFLP markers were located at the region
proximal to the bph2 locus, with distances of 0.2 to 1.2 cM
(Fig. 1). The other four AFLP markers were at the region distal
from the bph2 locus, with distances of 0.8 to 2.0 cM. One
AFLP marker (KAM4) showed complete cosegregation, and
bph2 was mapped within 1.0 cM between two other flanking
markers.
Segregation analysis of 62 F 2 s (determined by F 3 genotypes
after bioassay of F 4 progenies) derived from
Tsukushibare/Pokkali showed that Bph9 behaved as a single
dominant gene. Bph9 was mapped close to the locus of bph2
with seven RFLP and two RAPD markers (Fig. 1). The closest
RAPD marker (OPR04) was 8.8 cM from the Bph9 locus.
We constructed linkage maps of the three BPH resistance
genes on the long arm of rice chromosome 12. The linkage
map of bph2 has been refined. In comparison with Bph10(t)
from Oryza australiensis (Ishii et al 1994), our result showed
that loci of the four functional BPH resistance genes are clustered
on this chromosomal region. The fine linkage map of
bph2 would be important for cloning this important gene and
for pyramiding it with other BPH resistance genes.
References
Harushima Y, Yano M, Shomura A, Sato M, Shimano T, Kuboki Y,
Yamamoto T, Lin SY, Antonio BA, Parco A, Kajiya H, Huang
N, Yamamoto K, Nagamura Y, Kurata N, Khush GS, Sasaki
T. 1998. A high-density rice genetic map with 2275 markers
using a single F 2 population. Genetics 148:479-494.
Hirabayashi H, Ogawa T. 1995. RFLP mapping of Bph-1 (brown
planthopper resistance gene) in rice. Jpn. J. Breed. 45:369-
371.
Ishii T, Brar DS, Multani DS, Khush GS. 1994. Molecular tagging
of genes for brown planthopper resistance and earliness
introgressed from Oryza australiensis into cultivated rice, O.
sativa. Genome 37:217-221.
Kawasaki S, Motomura T, Kamihara K. 1999. Development of a
high-efficiency AFLP genome scanning system. Jpn. Soc. Mol.
Biol. 22:520. (An abstract, in Japanese.)
Murata K, Nakamura C, Fujiwara M, Mori N, Kaneda C. 1997. Tagging
and mapping of brown planthopper resistance genes in
rice. In: Su J-C, editor. Proceedings of the 5th International
Symposium on Rice Molecular Biology. Taipei (Taiwan): Yi-
Hsien Pub. p 217-231.
Murata K, Fujiwara M, Kaneda C, Takumi S, Mori N, Nakamura C.
1998. RFLP mapping of a brown planthopper (Nilaparvata
lugens Stål) resistance gene bph2 of indica rice introgressed
into a japonica breeding line ‘Norin-PL4’. Genes Genet. Syst.
73:359-364.
Notes
Authors’ addresses: H. Murai, P.N. Sharma, K. Murata, Z.
Hashimoto, Y. Ketipearachi, T. Shimizu, S. Takumi, N. Mori,
and C. Nakamura, Laboratory of Plant Genetics, Faculty of
Agriculture, Kobe University, Nada-ku, Kobe 657-8501, Japan;
S. Kawasaki, National Institute of Agrobiological Resources,
2-1-2 Kannondai, Tsukuba 305-8602, Japan.
Molecular mapping and marker-aided selection of a gene
conferring resistance to an Indian biotype of brown
planthopper in rice
K.K. Jena, I.C. Pasalu, Y. Varalaxmi, Y. Kondala Rao, K. Krishnaiah, G. Kochert, and G.S. Khush
Brown planthopper (BPH) is one of the most destructive insect pests of rice in the Indian subcontinent. The BPH biotype of
India is different from other known biotypes. The introgression line IR54741-3-21-22, developed from the cross of Oryza
sativa/O. officinalis, expressed a high level of resistance to BPH after testing at the Directorate of Rice Research, Hyderabad,
India. The resistance in this line was controlled by a single dominant gene. DNA isolated from parents and individual F 2
plants
was amplified with 270 random amplified polymorphic DNA (RAPD) primers and polymerase chain reaction (PCR)-based RAPD
polymorphism (dominant and codominant) was detected. Of the 19 primers producing a codominant type of polymorphism,
only one primer (OPA16) could produce resistance- (938 bp) and susceptibility- (802 bp) specific bands in bulk segregant
analysis, which indicated that the DNA marker OPA16 938
might be a putative marker linked to the resistance gene. The
resistance-specific 938-bp DNA fragment was cloned and long primers of 18–20 bp were developed, which produced specific
PCR fragments cosegregating with resistance genes. The resistance-specific marker (938 bp) was mapped onto chromosome
11 of rice. The resistance-specific marker band was absent in most of the rice cultivars, except in Swarnalata, which showed
the presence of a homologous 938-bp DNA fragment. The result indicated that the resistance gene in Swarnalata (Bph-6) may
be the same as that in IR54741-3-21-22. The DNA marker OPA16 938
would be useful in marker-aided selection.
Molecular markers, QTL mapping, and marker-assisted selection 265

Rice is the staple food of more than half of the world’s population.
Diseases and insects are the major constraints to increased
rice production and productivity. Brown planthopper
(BPH) is one of the most destructive insect pests of rice and
causes considerable damage by direct feeding and by transmitting
grassy stunt and ragged stunt viral diseases (Khush
and Brar 1991). The Indian biotype of BPH is highly virulent
and differs from all other Southeast Asian biotypes. Host-plant
resistance is an important approach to developing BPH-resistant
cultivars.
DNA markers provide a unique opportunity to map genes
of agronomic importance. A comprehensive molecular map
consisting of more than 2,200 DNA markers is available in
rice (Harushima et al 1998). Molecular markers, combined with
bulk segregant analysis, have been used to identify markers
closely linked to agronomically important traits (Michelmore
et al 1991). Additionally, these random amplified polymorphic
DNA (RAPD) markers may be converted into highly repeatable
and useful diagnostic markers such as sequence-characterized
amplified regions (SCARs), which facilitate their use
in mapping and marker-assisted selection (MAS). BPH resistance
genes in rice have been mapped with restriction fragment
length polymophism (RFLP) and RAPD markers (Ishii
et al 1994, Jeon et al 1999). This information is useful in facilitating
breeding efforts aimed at developing more durable
forms of resistance to BPH.
The objectives of our study were to identify a polymerase
chain reaction (PCR)-based marker linked to the alien BPH
resistance gene introgressed from the wild species Oryza
officinalis, its chromosomal localization, and its application
for MAS.
Materials and methods
The introgression line IR54741-3-21-22 was used as the resistant
parent and the elite breeding line IR31917-45-3-2 was
used as the susceptible parent. Ninety-five F 3 progenies were
screened against the Indian BPH biotype at the entomology
glasshouse of the Directorate of Rice Research (DRR),
Hyderabad. The wild species O. officinalis (IRRI Acc.
100896), a donor of BPH resistance, was also included.
Doubled-haploid (DH) lines (127) derived from IR64/Azucena
were used for mapping the RAPD marker onto the rice RFLP
map. Other varieties such as TN1, IR8, Jaya, IR24, IR28, IR36,
IR54, IR72, Ptb33, ARC6650, Pokkali, Swarnalata, and T-12
were used for studying the presence/absence of resistance-specific
RAPD markers.
Markers linked to BPH resistance were identified by bulk
segregant analysis (Michelmore et al 1991). Fourteen F 2 individuals
were used in the resistant and susceptible bulk on the
basis of their reaction to BPH. RAPD amplifications were performed
on DNA from both parents, the two bulks, and F 2 individuals
following the protocols of Williams et al (1990).
A resistance-specific RAPD fragment was excised from
the gel and purified using the Concert Rapid gel extraction
kit of Gibco-BRL, USA. The fragment was ligated directly
into the TOPO-TA Cloning® system developed by Invitrogen,
USA. The presence of the fragment in the clone was assessed
by PCR screening of the bacterial colonies using the M13 forward
and reverse primers and verified by performing an alkaline
lysis preparation of plasmid DNA and subsequent EcoRI
digestion of the insert fragment from the plasmid. Doublestranded
sequencing of the cloned fragment was performed.
Two specific oligonucleotides were designed from the
sequence obtained for the marker band. Amplification of genomic
DNA with SCAR primers was done under the same
conditions as the RAPD reaction, except for the annealing temperature
(60 o C). The SCAR-amplified products were digested
with CfoI enzyme and resolved on 2.0% agarose gels.
The cloned RAPD product was used as a hybridization
probe to blots of genomic DNA digested with 11 restriction
enzymes. Polymorphic DNA fragments were detected among
the mapping population, IR64, and Azucena parents at the ClaI
site. The genotypes for the restriction fragment from the 127
DH plants were scored. Scores were incorporated into the data
pool on the RFLP map (Huang et al 1994). Genetic linkage
analysis was performed using MAPMAKER Software 3.0
(Lander et al 1987) and DH framework data as described by
Huang et al (1997). Marker order was determined with an LOD
score > 2.0. Distance of markers (cM) on the map was estimated
using the Kosambi (1944) function.
Results
The F 1 of the cross between IR54741-3-21-22 and IR31917-
45-3-2 was resistant to the Indian biotype of BPH, indicating
that BPH resistance is controlled by a dominant gene. Segregation
analysis using 95 F 3 progeny rows in three replications
showed a good fit to the 1:2:1 ratio (χ 2 = 3.230, P

Table 1. Reaction to the Indian biotype of brown planthopper of F 2
progenies derived from IR54741-3-21-22/IR31917-45-3-2.
1 2 3 4 5 6 7 M
Genotype a Phenotype Plants (no.) χ 2 P b
(1:2:1)
RR Resistant 21 0.318 0.50–0.25
RS Segregating for 56 1.520 0.50–0.25
resistance
SS Susceptible 18 1.392 0.50–0.25
5.9 kb
5.3 kb
a R = resistant, S = susceptible. b Nonsignificant at 1% level and 2 df.
M P 2 RB SB P 1
Fig. 2. Southern hybridization band patterns of doubled-haploid
lines and parents. Genomic DNA was digested with ClaI enzyme
and probed with the cloned 938-bp dig-labeled DNA probe. A 5.3-
kb band in Azucena parent (lane 7) and a 5.9-kb band in IR64
parent (lane 6). Lanes 3–5 and 1 are plants with IR64 allele and
lane 2 is doubled-haploid plant with Azucena allele. M = molecular
weight marker.
938 bp
to allow the amplification of the marker locus. Under the PCR
conditions described for the SCAR analysis, oligonucleotide
primer pair PR1F/PR1R (F: 5′ ACATCAGCGTCGTTCAAG
3′, R: 5′ CCGAAGGATAAAGCA CAC 3 ) amplified a single
band in the resistant parent and resistant bulk, indicating the
dominant nature of the resistance gene.
The RAPD marker OPA16 938 was located on the RFLP
map using the DH mapping population and the MAPMAKER
program (Lander et al 1987). The 938-bp DNA probe had a
segregation of 5.9-kb and 5.3-kb bands at the ClaI site (Fig. 2)
and the results indicated that the RAPD marker was located
on chromosome 11 of rice, along with 22 other DNA markers
assigned to the same chromosome. The marker OPA16 938 was
10.6 cM proximal to RG167 and 14 cM distal from the
microsatellite marker RM209.
The presence or absence of resistance-linked RAPD
marker OPA16 938 was surveyed with nine semidwarf rice varieties
and four traditional indica rice cultivars. The RAPD
profiles of all these genotypes amplified a 900-bp band, while
Swarnalata amplified the 938-bp band similar to the resistant
parent. The RAPD profiles of nine rice varieties—except
Ptb33, ARC6650, Swarnalata, and T-12—had a susceptibleparent-specific
802-bp band and were susceptible to the Indian
BPH biotype. However, Ptb33, ARC6650, and T-12 had
amplified a 764-bp band, which was not present in the susceptible
parent and susceptible varieties. The resistance gene
present in these varieties might be nonallelic to the gene present
in the resistant breeding line IR54741-3-21-22 and Swarnalata.
Hence, the DNA marker OPA16 938 could be used in MAS for
breeding rice varieties resistant to the Indian biotype of BPH.
Fig. 1. DNA amplification pattern obtained with random
primer OPA16 in bulk segregant analysis. The polymorphic
fragment of 938 bp is indicated by an arrow. M =
marker (X174), P 2 = resistant parent, RB = resistant bulk,
SB = susceptible bulk, P 1 = susceptible parent.
Discussion
RFLP, RAPD, microsatellites, and amplified fragment length
polymorphism have been used to tag genes of agronomic value
in several crop species. In our study, we have identified the
marker OPA16 938 using RAPD and bulk segregant analysis
(Jena et al 1998). The RAPD marker is tightly linked to the
resistance gene at a distance of 0.52 cM and can be used for
MAS for BPH resistance.
Robust genetic markers were developed through conversion
of polymorphisms identified by PCR-based RAPD and
bulk segregant analysis into SCARs. A specific SCAR marker
has been used to identify rice genotypes carrying a BPH resistance
gene that confers resistance to the Indian biotype of BPH
through MAS. Our results suggest that the resistance gene was
absent in most of the rice varieties, which are in fact susceptible
to the Indian BPH biotype, except Swarnalata, Ptb33,
and ARC6650. The homology of the 938-bp DNA fragment
between Swarnalata and IR54741-3-21-22 indicated that the
gene Bph-6 in Swarnalata (Kabir and Khush 1988) may be the
same as that in IR54741-3-21-22 and is designated as Bph-
6(t). The SCAR marker identified in this study would be useful
in cloning the gene for BPH resistance.
Molecular markers, QTL mapping, and marker-assisted selection 267

References
Harushima Y, Yano M, Shomura A, Sato M, Shimano T, Kuboki Y,
Yamamoto T, Lin SY, Antonio BA, Parco A, Kajiya H, Huang
N, Yamamoto K, Nagamura Y, Kurata N, Khush GS, Sasaki
T. 1998. A high-density rice genetic map with 2275 markers
using a single F 2 population. Genetics 148:479-494.
Huang N, McCouch S, Mew T, Parco A, Guiderdoni E. 1994. Development
of an RFLP map from a doubled haploid population
in rice. Rice Genet. Newsl. 11:34-137.
Ishii T, Brar DS, Multani DS, Khush GS. 1994. Molecular tagging
of genes for brown planthopper resistance and earliness
introgressed from O. australiensis into cultivated rice, O. sativa.
Genome 37:217-221.
Jena KK, Pasalu IC, Krishnaiah K, Khush GS. 1998. A RAPD marker
for the gene conferring resistance to Indian biotype of BPH.
Rice Genet. Newsl. 15:133-134.
Jeon YH, Ahn SN, Choi HC, Hahn TR, Moon HP. 1999. Identification
of a RAPD marker linked to a brown planthopper resistance
gene in rice. Euphytica 107:23-28.
Kabir MA, Khush GS. 1988. Genetic analysis of resistance of brown
planthopper in rice, Oryza sativa L. Plant Breed. 100:54-58.
Khush GS, Brar DS. 1991. Genetics of resistance to insects in crop
plants. Adv. Agron. 45:223-274.
Kosambi DD. 1944. The estimation of map distances from recombination
values. Ann. Eugen. 12:172-175.
Lander ES, Green P, Abrahamson J, Barlow A, Daly MJ, Lincoln
SE, Newburg AL. 1987. MAPMAKER: an interactive computer
package for constructing primary genetic linkage maps
of experimental and natural populations. Genomics 1:174-181.
Michelmore RW, Paran I, Kesseli RV. 1991. Identification of markers
linked to disease resistance gene by bulked segregant analysis:
a rapid method to detect markers in specific genomic regions
by using segregating populations. Proc. Natl. Acad. Sci.
USA 88:9828-9832.
Williams JGK, Kubelik AR, Livak KJ, Rafalski JA, Tingey SV. 1990.
DNA polymorphisms amplified by arbitrary primers are useful
as genetic markers. Nucleic Acids Res. 18:6531-6535.
Notes
Authors’ addresses: K.K Jena and Y. Varalaxmi, Biotechnology Centre,
Mahyco Research Foundation, Hyderabad 00073, India;
I.C. Pasalu, Y. Kondala Rao, K. Krishnaiah, Directorate of
Rice Research, Hyderabad 500030, India; G. Kochert, Department
of Botany, University of Georgia, Athens, GA 30602,
USA; G.S. Khush, International Rice Research Institute,
DAPO Box 7777, Metro Manila, Philippines.
Acknowledgment: The financial support received from the Mahyco
Research Foundation and the Rockefeller Foundation is gratefully
acknowledged.
Mapping QTLs for brown planthopper (BPH) resistance
introgressed from Oryza officinalis in rice
H. Hirabayashi, R. Kaji, M. Okamoto, T. Ogawa, D.S. Brar, E.R. Angeles, and G.S. Khush
We mapped new genes for resistance to BPH: bph11(t) and bph12(t), derived from O. officinalis on chromosomes 3 and 4,
respectively. QTL analysis was carried out using RFLP markers to identify the other new genes for resistance to BPH from O.
officinalis. Ninety-four recombinant inbred lines (RILs) from the cross between Hinohikari (susceptible japonica variety) and
IR54742-1-11-17 (resistant indica line introgressed from O. officinalis) were used for QTL analysis. QTLs for resistance to BPH
were detected on chromosomes 3, 4, and 12. The QTL located at RFLP marker G1318 on chromosome 3 showed the highest
value of LOD scores, while the other QTLs appeared to represent minor genes for BPH resistance.
Brown planthopper (BPH) is a serious pest in many rice-growing
countries. In Japan, BPH resistance conveyed by the resistance
genes Bph1 and bph2 has broken down. One of our breeding
objectives is to develop BPH-resistant varieties of japonica
rice carrying other effective BPH genes such as bph8 and Bph9
and identify new genes introgressed from wild rice species.
We identified two new resistance genes, bph11(t) and bph12(t)
(Hirabayashi et al 1997, 1998), derived from O. officinalis
and mapped these genes on chromosomes 3 and 4, respectively.
In this study, QTL analysis was carried out to identify
other new genes for resistance to BPH introgressed from O.
officinalis into rice.
Materials and methods
Indica introgression line IR54742-1-11-17 (IR31917-45-3-2/
O. officinalis//IR31917-45-3-2) with BPH resistance genes
introgressed from O. officinalis was crossed with Hinohikari,
a susceptible japonica variety. We tested F 3 lines from the cross
using a mass screening procedure with BPH biotype 1. The
segregation for BPH resistance showed that IR54742-1-11-17
carried one or two genes (Table 1). We then developed 94 F 6
recombinant inbred lines (RILs) derived from the F 2 population
of the cross.
Seedlings were infested at the 1.5-leaf stage with second-
to third-instar nymphs of BPH biotype 1 (10 nymphs per
seedling). We recorded the degree of BPH resistance at about
14 d after infestation compared with susceptible and resistant
checks. The RILs were classified and scored from susceptible
268 Advances in rice genetics

Table 1. Segregation in F 3 for BPH resistance from the cross of
japonica cv. Hinohikari (susceptible) with alien introgression line
IR54742-1-11-17 (resistant) derived from O. officinalis.
Lines (no.)
RILs (no.)
30
20
10
0
0
α2 test
RR/RS a SS Total Ratio α2 value
1 2 3 4 5
Level of resistance
Probability
121 19 140 3:1 9.7 0.0013) for
BPH resistance were detected on chromosomes 3, 4, and 12.
The located QTL at RFLP marker G1318 on chromosome 3
showed the highest LOD value (5.39). LOD scores of the other
two QTLs near the RFLP marker R288 on chromosome 4 and
near R1709 on chromosome 12 were 4.04 and 3.53, respectively
(Fig. 2).
Hirabayashi et al (1997) identified bph11(t) near G1318.
We will carry out an allele test for BPH resistance between
this QTL and bph11(t) on chromosome 3. The other two QTLs
on chromosomes 4 and 12 appeared to have minor effects for
BPH resistance. Bph3 (G.S. Khush, personal communication)
and bph12(t) (Hirabayashi et al 1998) were located around the
same region as one QTL on chromosome 4, whereas Bph1
(Hirabayashi and Ogawa 1999), bph2 (Murata et al1997), Bph9
(Murata et al 1997), and Bph10(t) (Ishii et al 1994) were located
around the same region as another QTL on chromosome
12. The relationships among these loci need to be studied.
Chr 3
5.39 3.0 LOD 0.0
G1318
R1925
R1927
R1618
4.04
3.0
Chr 4
LOD
0.0
C445
C107
R1427
R514
R1783
R335
R513
R271
R288
G124b
R1854
3.53
3.0
Chr 12
LOD
0.0
C1069
R1709
G2140
C443
R617
R3375
R2672
124a
r642b
g24b
Fig. 2. QTL analysis of brown planthopper resistance in Hinohikari/IR54742-1-11-17
recombinant inbred lines.
Molecular markers, QTL mapping, and marker-assisted selection 269

In this study, we estimated that IR54742-1-11-17 has
bph11(t), the BPH resistance gene closely linked with bph11(t)
and two minor QTLs.
References
Hirabayashi H, Kaji R, Ogawa T, Brar DS, Angeles ER, Khush GS.
1997. Mapping of new introgression gene for brown
planthopper (BPH) resistance from O. officinalis using RFLP
markers in rice. Proceeding of the 8th SABRAO General Congress
and the Annual Meeting of the Korean Breeding Society.
p 401-402.
Hirabayashi H, Angeles ER, Kaji R, Ogawa T, Brar DS, Khush GS.
1998. Identification of brown planthopper resistance gene
derived from O. officinalis using molecular markers in rice.
Breed. Sci. 48(suppl.):82. (In Japanese.)
Hirabayashi H, Ogawa T. 1999. Identification and utilization of DNA
markers linked to genes for resistance to brown planthopper
(BPH) in rice. Recent Adv. Breed. Sci. 41:71-74. (In Japanese.)
Ishii T, Brar DS, Multani DS, Khush GS. 1994. Molecular tagging
of genes for brown planthopper resistance and earliness
introgressed from Oryza australiensis into cultivated rice, O.
sativa. Genome 37:217-221.
Murata K, Nakamura C, Fujiwara M, Kawaguchi M, Mori N, Kaneda
C. 1997. RFLP mapping of brown planthopper resistance
genes in rice. Proceedings of the 8th SABRAO General Congress
and the Annual Meeting of the Korean Breeding Society.
p 193-194.
Notes
Authors’ addresses: H. Hirabayashi, R. Kaji, M. Okamoto, Kyushu
National Agricultural Experiment Station, Chikugo, Fukuoka,
833-0041; T. Ogawa, Chugoku National Agricultural Experiment
Station, Fukuyama, Hiroshima, 721-8514 Japan; D.S.
Brar, E.R. Angeles, and G.S. Khush, International Rice Research
Institute, Los Baños, Laguna, Philippines.
RFLP mapping of antibiosis to rice green leafhopper
M. Kadowaki, A. Yoshimura, and H. Yasui
Nephotettix cincticeps Uhler (green rice leafhopper: GRH) is an insect pest in temperate Asian rice fields. Three genes for the
antibiosis type of resistance to GRH were identified by restriction fragment length polymorphism mapping using near-isogenic
lines (NILs) derived from crosses between susceptible japonica and resistant indica varieties. In the first cross combination
between Asominori and IR24, IR24 and F 1
were found to be highly resistant (more than 80% nymph mortality), but Asominori
was susceptible (0% mortality). The self-pollinated progeny of the NIL heterozygous for the resistance gene showed 3 resistant:
1 susceptible segregation. A single dominant gene for resistance, which corresponds to Grh1, was mapped on chromosome 5.
In the second cross combination between Kinmaze and DV85, DV85 and F 1
were observed to be highly resistant, but Kinmaze
was susceptible. Using NILs, two dominant genes for resistance that would correspond to Grh4 and Grh2 were mapped on
chromosomes 3 and 11, respectively.
Nephotettix cincticeps Uhler (green rice leafhopper, GRH) is
one of the most serious insect pests of rice in temperate Asia.
GRH is a vector for the transmission of rice stripe and rice
dwarf viruses. The use of genes conferring resistance to GRH
is an effective way to protect rice plants against viral diseases.
To understand the genetics of resistance to GRH of two indica
varieties, IR24 and DV85, quantitative trait loci (QTL) analyses
have been conducted using two sets of recombinant inbred
lines (RILs). Major QTLs were detected (Yasui and Yoshimura
1999). A QTL on chromosome 5 (qGRH-5) was detected in
the cross Asominori/IR24, while two QTLs on chromosomes
3 and 11 (qGRH-3 and qGRH-11) were detected in Kinmaze/
DV85. In this study, three QTLs for antibiosis to GRH were
analyzed using near-isogenic lines (NILs).
Materials and methods
Three sets of NILs, derived from japonica and indica crosses
of Asominori/IR24 and Kinmaze/DV85, were evaluated for
antibiosis to GRH. As for the NILs developed by crossing
Asominori with IR24 and backcrossing with Asominori, BC 3 F 3
populations from the BC 3 F 2 plants heterozygous for qGRH-5
were used. For the NILs developed by crossing Kinmaze with
DV85 and backcrossing with Kinmaze, two BC 4 F 3 populations
from the BC 4 F 2 plants heterozygous only for qGRH-11
and homozygous for the DV85 allele on qGRH-3 (BC 4 F 3 population
no. 2) and vice versa (BC 4 F 3 population no. 4) were
used.
The GRH population originated from adults collected
in Kasuya, Fukuoka, Japan, in 1991. They were maintained at
25 °C and under 16-h light and 8-h dark conditions. Seedlings
were infested with 7–10 first- or second-instar nymphs. Antibiosis
was scored as nymph mortality 3 d after infestation. A
total of 17 restriction fragment length polymorphism (RFLP)
markers near the three QTLs were used to map genes for resistance
to GRH. QTL analysis for resistance to GRH was conducted
using MAPMAKER/QTL v1.1.
270 Advances in rice genetics

N = 144
5S
R569 Grh1 C309 R3313
7.4 0.7 17.8
5L
9.7
21.6
27.6
cM
Fig. 1. Linkage map of a gene for resistance
to GRH (Grh1) on chromosome 5.
C189
S723
Grh2
G4001
C50
R2458
N = 45
CEN
1.2 11.6
13.1
cM
11L
G1465
(fixed with Kinmaze)
Fig. 2. Linkage map of a gene for resistance
to GRH (Grh2) on chromosome 11.
Number of plants
Kinmaze
60
40
20
0
0 20 40 60 80 100
Nymph mortality (%)
Fig. 3. Frequency distribution for nymph mortality against
GRH in BC 4 F 3 population no. 4 derived from the cross
between Kinmaze and DV85. Open circles and bars indicate
the mean value and SD of nymph mortality in
Kinmaze (1.7%) and DV85 (96.0%).
Results and discussion
N = 106
DV85
IR24 and Asominori showed high and low nymph mortality,
respectively. The BC 3 F 3 population showed 3 (resistant):1 (susceptible)
segregation, indicating that a single dominant gene
controlled resistance. The gene corresponding to Grh1 (Tamura
et al 1999) was mapped on chromosome 5 and located between
RFLP markers R569 and C309 (Fig. 1).
DV85 and Kinmaze showed high and low nymph mortality,
respectively. Between the two BC 4 F 3 populations, 3 (resistant):1
(susceptible) segregation was observed in BC 4 F 3 2,
indicating that a single dominant gene controlled resistance.
The gene corresponding to Grh2 was mapped on chromosome
11 and located between RFLP markers S723 and G1465 (Fig.
2). In the other BC 4 F 3 population (BC 4 F 3 4), continuous distribution
for nymph mortality from moderate resistance to
strong resistance was observed (Fig. 3). QTL analysis revealed
that qGRH-3 controlled the resistance to GRH in BC 4 F 3 4 and
C603
R2170
3S
3L
1.5 3.1 3.0 9.4
cM
Fig. 4. QTL mapping of a gene for resistance to GRH (qGRH-3) on
chromosome 3.
was located near RFLP marker G144 (Fig. 4). It has been reported
that a pair of dominant genes with resistance to GRH
with complementary expression were located on chromosomes
3 and 11 (Fukuta et al 1998, Yazawa et al 1998) and designated
as Grh4 and Grh2, respectively. In this study, qGRH-11
was successfully converted to a single gene using a NIL (Fig.
2), but qGRH-3 was not due to moderate resistance influenced
by Grh2. This revealed that strong resistance was expressed
by Grh4 and Grh2 with complementary action, but plants carrying
only Grh2 showed unstable resistance (Fig. 3).
References
R44
qGRH-3
N = 108
Y3870R
G144
R2982 C2942 C80
Fukuta Y, Tamura K, Hirae M, Oya S. 1998. Genetic analysis of
resistance to green rice leafhopper (Nephotettix cincticeps
Uhler) in rice parental line, Norin-PL6, using RFLP markers.
Breed. Sci. 48:243-249.
Tamura K, Fukuta Y, Hirae M, Oya S, Ashikawa I, Yagi T. 1999.
Mapping of Grh1 locus for green rice leafhopper resistance
in rice using RFLP markers. Breed. Sci. 49:11-14.
Yasui H, Yoshimura A. 1999. QTL mapping of antibiosis to green
leafhopper, Nephotettix virescens Distant, and green rice leafhopper,
Nephotettix cincticeps Uhler, in rice, Oryza sativa L.
Rice Genet. Newsl. 16:96-98.
Molecular markers, QTL mapping, and marker-assisted selection 271

Yazawa S, Yasui H, Yoshimura A, Iwata N. 1998. RFLP mapping of
genes for resistance to green rice leafhopper (Nephotettix
cincticeps Uhler) in rice cultivar DV85 using near-isogenic
lines [in Japanese, with English summary]. Sci. Bull. Fac.
Agric. Kyushu Univ. 52:169-175.
Notes
Authors’ address: Plant Breeding Laboratory, Faculty of Agriculture,
Kyushu University, Fukuoka 812-8581, Japan.
Mapping of a gene ovicidal to whitebacked planthopper
Sogatella furcifera Horváth in rice
M. Yamasaki, A. Yoshimura, and H. Yasui
Whitebacked planthopper (WBPH), Sogatella furcifera Horváth, is a serious insect pest of rice in Asia. Rice ovicidal response to
WBPH is characterized by formation of watery lesions that result in death of the eggs. A gene ovicidal to WBPH was identified
and designated as Ovc. Recombinant inbred lines (RILs) derived from a cross between an ovicidal japonica variety, Asominori,
and a nonovicidal indica variety, IR24, were used in molecular analysis. A total of 15 quantitative trait loci (QTLs) for ovicidal
response were detected on nine different chromosomes. Using the F 2
population from a near-isogenic line, which was heterozygous
only for chromosome 6 QTLs, a single dominant gene was identified where the Asominori allele increased egg mortality.
Ovc was tightly linked to RFLP marker R1954 on chromosome 6. Ovc was responsible for the formation of watery lesions and
the production of an ovicidal substance, benzyl benzoate. Further genetic analysis revealed three QTLs on chromosomes 1
(qOVA-1) and 5 (qOVA-5-1 and qOVA-5-2). The Asominori alleles at three QTLs increased egg mortality in the presence of Ovc.
Whitebacked planthopper (WBPH), Sogatella furcifera
Horváth, is a serious insect pest of rice in Asia. The rice ovicidal
response to WBPH was characterized by formation of
watery lesions (WL) resulting in the death of eggs at ovipositional
sites (Suzuki et al 1996). It is considered to be a factor
that affects the suppression of WBPH multiplication. In this
study, we detected quantitative trait loci (QTLs) for ovicidal
response and located a major gene.
Materials and methods
Seventy-one recombinant inbred lines (RILs, F 8 , F 9 , and F 10 )
derived from a cross between an ovicidal japonica variety,
Asominori, and a nonovicidal indica variety, IR24 (Tsunematsu
et al 1996), were used for QTL analysis. Based on a set of
chromosomal segment substitution lines with IR24 genetic
background (Aida et al 1997), near-isogenic lines (NILs) for
the putative QTLs were developed through marker-assisted
selection.
The cultured WBPH population was maintained as described
by Yamasaki et al (1999). Rice plants were transplanted
in plastic cups and grown in a greenhouse. At the maximum
tillering stage, WBPH females were caged with a single plant
for 2 d. The plants were phenotyped for the formation of WL
and egg mortality (EM) 3 d after removing the insects. The
rice plants with WBPH eggs laid by migrant populations in
the experimental rice field of Kyushu University were investigated
to map the QTLs increasing EM. The formation of WL
and EM of WBPH was scored individually as described by
Yamasaki et al (1999). A bioassay of benzyl benzoate (BB),
an ovicidal substance, was conducted using a procedure described
by Seino et al (1996).
DNA extraction and restriction fragment length polymorphism
(RFLP) analysis were performed as described by
Tsunematsu et al (1996). QTL and epistasis analyses were
conducted following Yamasaki et al (1999) and by using
MAPMAKER/QTL v1.1 (Lincoln et al 1993). An LOD score
of 1.5 was used as the threshold for declaring a QTL. The
QTL for EM, which was mapped from the NIL, was designated
using a combination of letters and numbers (i.e., qOVA-
1). The letters “qOV” refer to ovicidal QTL and “A” was derived
from RIA (RILs in this study). Linkage analysis was performed
with MAPMAKER/EXP 3.0 (Lander et al 1987).
Results
A total of 15 QTLs for ovicidal response to WBPH were detected
(Yamasaki et al 1999). The QTL on the short arm of
chromosome 6 (6S) had the greatest effect for WL and EM.
The remaining 14 QTLs were detected in two regions each on
1S, 3S, and 5L (long arm of chromosome 5), and in one region
each on 1L, 2S, 2L, 4S, 6L, 8S, 10S, and the centromeric region
of chromosome 12 (12CEN). Alleles from both the parents
contributed to a high value of WL and/or EM. No significant
epistatic interaction was detected (P

No. of individuals
IR24
30
A
Asominori
B
6S
N = 86
cM
3.3
XNpb27
S1520
20
10
N = 86
0
0 20 40 60 80 100
WBPH egg mortality (%)
CEN
6L
3.6
6.3
R1954
Ovc
WI
Bb
L688
Fig. 1. Identification of a gene ovicidal
to whitebacked planthopper (WBPH).
(A) Frequency distribution of WBPH
egg mortality in the F 2 population. (B)
Location of the gene (Ovc) ovicidal to
WBPH, watery lesion gene (Wl), and
the gene for production of benzyl benzoate
(Bb) on the RFLP linkage map
of chromosome 6. CEN = centromere.
CEN
1S
1L
N = 96
cM
C86
11.4
XNpb113
4.3
XNpb54
4.3
XNpb346
5.9
C112
qOVA-1
CEN
5S
5L
cM
N = 45
4.6
5.8
N = 44
5.2
8.1
XNpb251
R3313
G1458
R2289
C1268
R1553
C128
qOVA-5-1
qOVA-5-2
Fig. 2. Mapping of ovicidal QTLs
qOVA-1, qOVA-5-1, and qOVA-5-
2. (A) Location of qOVA-1 (LOD =
17.4, R 2 = 60.1%, additive effect
= 5.0, dominance effect = 4.9)
on RFLP linkage map of chromosome
1. (B) Locations of qOVA-
5-1 (LOD = 7.2, R 2 = 57.7%, additive
effect = 10.1, dominance
effect = 11.4) and qOVA-5-2 (LOD
= 6.1, R 2 = 46.9%, additive effect
= 7.9, dominance effect =
7.4) on RFLP linkage map of chromosome
5. CEN = centromere.
was tightly linked to RFLP marker R1954 on 6S (Fig. 1B).
Ovc also cosegregated with the formation of WL and production
of BB from the results of genetic analysis using the same
F 2 individuals for Ovc mapping. These genes were designated
as Wl (watery lesion gene) and Bb (gene for production of
benzyl benzoate).
EM was investigated in the NILs for putative QTLs.
Asominori alleles at three QTLs (1L [qOVA-1], 5L-1 [qOVA-
5-1], and 5L-2 [qOVA-5-2]) increased EM with the existence
of Ovc. Three NILs—which were homozygous for Ovc and
heterozygous each for qOVA-1, qOVA-5-1, and qOVA-5-2—
were selected for QTL mapping. Genetic analysis for EM was
conducted using three kinds of progenies derived from the selected
plants. All the populations showed continuous distributions
within the high-EM category. qOVA-1 was located between
XNpb346 and C112 (Fig. 2A). Among two QTLs of
5L, one QTL, qOVA-5-1, was located between XNpb251 and
R3313, and another QTL, qOVA-5-2, was tightly linked to
C1268 (Fig. 2B).
Our study identified a gene (Ovc) ovicidal to WBPH
and three QTLs increasing the EM of WBPH. The Ovc was
essential for ovicidal response to WBPH and was considered
to be responsible for the formation of WLs and production of
BB. At least three Asominori alleles at qOVA-1, qOVA-5-1,
and qOVA-5-2 increased EM in the presence of Ovc. The three
QTLs with small genetic effect would enhance the function of
Ovc. It was concluded that Asominori alleles at Ovc and three
QTLs played an important role in ovicidal response of rice to
WBPH.
References
Aida Y, Tsunematsu H, Doi K, Yoshimura A. 1997. Development of
a series of introgression lines of japonica in the background
of indica rice. Rice Genet. Newsl. 14:41-43.
Lander ES, Green P, Abrahamson J, Barlow A, Daly MJ, Lincoln
SE, Newburg L. 1987. MAPMAKER: an interactive computer
package for construction of primary genetic linkage maps of
experimental and natural populations. Genomics 1:174-181.
Lincoln SE, Daly MJ, Lander ES. 1993. Mapping genes controlling
quantitative traits using MAPMAKER/QTL version 1.1. 2nd
ed. Whitehead Institute Technical Report.
Seino Y, Suzuki Y, Sogawa K. 1996. An ovicidal substance produced
by rice plants in response to oviposition by the
whitebacked planthopper, Sogatella furcifera (Horváth)
(Homoptera: Delphacidae). Appl. Entomol. Zool. 31:467-473.
Molecular markers, QTL mapping, and marker-assisted selection 273

Suzuki Y, Sogawa K, Seino Y. 1996. Ovicidal reaction of rice plants
against the whitebacked planthopper, Sogatella furcifera
Horváth (Homoptera: Delphacidae). Appl. Entomol. Zool.
31:111-118.
Tsunematsu H, Yoshimura A, Harushima Y, Nagamura Y, Kurata N,
Yano M, Sasaki T, Iwata N. 1996. RFLP framework map using
recombinant inbred lines in rice. Breed. Sci. 46:279-284.
Yamasaki M, Tsunematsu H, Yoshimura A, Iwata N, Yasui H. 1999.
Quantitative trait locus mapping of ovicidal response in rice
(Oryza sativa L.) against whitebacked planthopper (Sogatella
furcifera Horváth). Crop Sci. 39:1178-1183.
Notes
Authors’ address: Plant Breeding Laboratory, Faculty of Agriculture,
Kyushu University, 6-10-1, Hakozaki, Higashi-ku,
Fukuoka 812-8581, Japan.
Acknowledgments: We are grateful to Drs. K. Sogawa and Y. Suzuki
for providing insects and helpful comments and Mr. Y. Seino
for his guidance in the techniques for extraction of benzyl
benzoate and gas chromatography.
Molecular marker association
for yellow stem borer resistance in rice
A. Selvi, P.S. Shanmugasundaram, J.A.J. Raja, and S. Mohankumar
Yellow stem borer (YSB) resistance is governed by polygenes. We focused on identifying molecular markers associated with
YSB resistance. RAPD analysis in conjunction with bulked segregant analysis identified OPK6 695
as a marker specifically
amplified from the DNA of the resistant parent, progenies, and other resistant cultivars and OPHA5 660
that specifically amplified
in the susceptible parent, progenies, and susceptible cultivars. The identified markers showed linkage with YSB resistance.
RM241, located on chromosome 4, was also found to be associated with the trait. Further marker analysis is required to place
more markers closer to the gene(s) for YSB resistance.
Among the insect pests of rice, stem borers are considered to
be most serious, damaging the crop from the seedling stage to
maturity. Among the five borer species that are of economic
significance in Asia, the yellow stem borer (YSB) Scirpophaga
incertulas Walker is the most predominant one, causing a steady
annual yield loss of 10 million tons. Attempts to study the genetics
of YSB resistance revealed the polygenic nature of the
trait (Kalode et al 1987). The complex nature of the trait and
the inherent difficulties in screening have consequently made
breeding for YSB resistance a difficult task and no adequate
results have been obtained so far. Marker-assisted selection is
especially helpful when the characters studied are polygenic,
a situation particularly common for resistance traits. For YSB
resistance, the detection of major quantitative trait loci could
be of considerable value for breeding programs since their incorporation
in susceptible genotypes would permit a direct
increase in the resistance level in the improved genotypes.
In this study, we attempted to identify molecular markers
linked to major loci conferring YSB resistance in rice using
RAPDs and microsatellites.
Materials and methods
Marker analysis was performed on an F 2 population obtained
from a cross between two rice varieties, W1263 (resistant) and
CO 43 (susceptible). This F 2 population consisted of 90 individuals
that segregated for YSB resistance. Phenotyping was
carried out and damage by stem borer was scored at the vegetative
stage as deadhearts and at the reproductive stage as
white ears.
DNA was extracted from young leaves. Marker analysis
was done in conjunction with bulked segregant analysis
(Michelmore et al 1991). Ten F 2 individuals showing extreme
reactions for stem borer resistance and susceptibility were used
to constitute the bulks. The analysis was performed with DNA
of the parents, resistant and susceptible bulks, individuals comprising
the bulks, and the F 2 mapping population.
RAPD analysis was performed in a 25 µL reaction mixture
containing 10 mM tris-HCl (pH 8.3), 50 mM potassium
chloride, 1.62 mM magnesium chloride, 0.01% gelatin, 5 pmol
of arbitrary primer (Operon Technologies, Alameda, CA), 250
µM each of dNTPs, and 0.75 unit of Taq DNA polymerase
(Bangalore Genei Pvt. Ltd., India). Amplification was performed
using a Perkin Elmer (GENEAMP2400) Thermocycler.
The amplification profile consisted of an initial denaturation
at 95 °C for 5 min, followed by 35 cycles of denaturation at 94
°C for 1 min, annealing at 37 °C for 1 min, and primer extension
at 72 °C for 1 min, followed by a final extension at 72 °C
for 5 min. The products were analyzed either on 6% polyacrylamide-urea
gel or on 1.5% agarose gel.
Microsatellite analysis was done with 48 microsatellite
primers that were distributed on all 12 chromosomes. Twenty
nanograms of DNA were amplified in a 20 µL reaction mixture
containing 10 mM tris HCl (pH 8.3), 50 mM potassium
chloride, 1.5 mM magnesium chloride, 0.01% gelatin, forward
and reverse primers as recommended by the manufacturer (6
µL), 50 µM each of the dNTPs, and 0.3 unit of Taq polymerase.
The products were analyzed on a 6% denaturing polyacrylamide
gel.
274 Advances in rice genetics

The association of the marker with the trait was assessed
by two-way ANOVA and goodness of fit for marker segregation
using chi-square analysis of the F 2 population. Map distances
were calculated using MAPMAKER/Ver 3B (Lander
et al 1987). The markers were ordered into linkage groups
with an LOD score of 3.0 and a maximum distance of 50.0.
Recombination factors were converted into centiMorgans (cM)
by applying the Haldane function.
Frequency distribution (%)
100
90
80
70
60
50
40
30
20
10
White ear frequency
Deadheart frequency
F 1
(deadheart)
0
0 1 3 5 7 9
Damage (grade)
Fig. 1. Reaction to yellow stem borer in F 1 and F 2 .
Results and discussion
Phenotypic studies at both the deadheart and white ear stage
revealed that the F 1 s were intermediate for resistance to YSB
and in the F 2 there was a unimodal distribution for the YSB
reaction (Table 1, Fig. 1), which did not fit to any Mendelian
ratio and continuous variation indicated polygenic inheritance
involving a few genes with major effects. The polygenic nature
of the trait was also reported by Kalode et al (1987).
A parental survey with RAPD and microsatellite markers
revealed 36% and 25% polymorphism, respectively, among
the parents. Bulked segregant analysis was performed with the
polymorphic primers on the resistant and susceptible bulks and
primers that produced reproducible polymorphisms between
the bulks were selected (Fig. 2). Seven random primers—
OPG5, OPAH8, OPN11, OPG8, OPN18, OPK6, and OPC1—
were found co-segregating with the resistant bulk and the parent,
whereas OPAH5, OPC4, OPF7, and OPG8 were amplified
in the susceptible bulk and parent. Among the
microsatellite primers, RM241 and RM219 were found to be
segregating with resistant and susceptible bulks in a co-dominant
fashion. Further analysis of the bulk individuals with the
above primers identified four RAPD markers—OPK6 695 ,
OPC1 320 , OPAH5 660 , and OPC4 1300 —that segregated with resistance
and susceptibility, respectively (the subscripts indicated
the size of the amplified product). Similarly, among the
two microsatellite markers, RM241 located on chromosome 4
showed complete association with resistant and susceptible
bulk individuals amplifying a 148-bp fragment in resistant in-
Primer OPK 6 Primer OPAH 5
Marker
W 1263
Resistant bulk
Susceptible bulk
CO 43
CO 43
Susceptible bulk
Resistant bulk
W 1263
Marker
695 bp
680 bp
Fig. 2. RAPD profile of parents
and bulks.
Molecular markers, QTL mapping, and marker-assisted selection 275

Table 1. Reaction to yellow stem borer in F 1 and
F 2 of rice.
Score F 1 F 2
Deadhearts
White ears
0 – 19 3
1 1 8 4
3 15 29 23
5 21 19 15
7 – 21 19
9 – 93 28
Total 37 189 92
dividuals and a 162-bp fragment in the susceptible individuals.
The pooling of DNA from extreme phenotypic classes allowed
us to rapidly detect markers associated with respective
phenotypes without contamination of either class.
Linkage analysis with the F 2 phenotypic scores and
RAPD and microsatellite data with the MAPMAKER program
revealed that the RAPD markers K6 695 , C1 320 , and AH5 660 were
at a distance of 12.8, 15.2, and 14.9 cM, respectively, from the
gene(s) and the microsatellite marker was 25.3 cM away. The
markers OPK6 695 and OPAH5 660 were used to screen a set of
germplasm and it was seen that OPK6 695 was amplified in all
the resistant cultivars, whereas the marker OPAH5 660 was amplified
in all the susceptible cultivars, thus confirming linkage
with the trait.
A survey of microsatellite markers on chromosome 4 is
suggested to establish close linkages with YSB resistance.
References
Kalode MB, Bentur JS, Srinivasan TE. 1987. Screening and breeding
rice for stem borer resistance. Proceedings of the International
Workshop on Sorghum Stem Borers, 17-20 Nov 1987,
ICRISAT, Patancheru, India. p 153-158.
Lander ES, Green P, Abrahamson J, Barlow A, Daly MJ, Lincoln
SE, Newburg L. 1987. MAPMAKER: an interactive computer
package for construction of primary genetic linkage maps of
experimental and natural populations. Genomics 1:174-181.
Michelmore RW, Paran I, Kesseli V. 1991. Identification of markers
linked to disease resistance genes by bulked segregant analysis:
a rapid method to detect markers in specific genomic regions
by using segregating populations. Proc. Natl. Acad. Sci.
USA 88:9828-9832.
Notes
Authors’ addresses: A. Selvi, Sugarcane Breeding Institute,
Coimbatore 641007, Tamil Nadu, India; P.S.
Shanmugasundaram and J.A.J. Raja, Centre for Plant Molecular
Biology, Tamil Nadu Agricultural University, Coimbatore
641003, Tamil Nadu, India; S. Mohankumar, Department of
CSES, Virginia Tech University, Blacksburg, VA, USA.
Chromosome blocks are involved in adaptive
gene complexes in rice landraces
B.V. Ford-Lloyd, P.S. Virk, M.T. Jackson, and H.J. Newbury
The distribution of 122 mapped markers was monitored across 48 diverse landraces of rice. Strong statistical associations
were observed between some pairs of markers across the diverse material. These strongly associated pairs of markers mapped
to the same chromosomes only in some cases. The remainder were due to association between markers found on different
chromosomes. Many of these genetically unlinked but strongly associated markers are not randomly distributed across the
genome but occupy two sets of DNA blocks within the rice chromosomes. Analyses have revealed that sets of the same
markers are found in association with performance for each of four traits in the diverse landrace material and doubled haploid
mapping population. Hence, associations between markers and traits in the diverse material are, as expected, based on
associations between alleles at marker loci and alleles at quantitative trait loci. We propose that our data provide strong
evidence for the coadaptation of geographically distinct landraces and that this has resulted over time in the maintenance of
“adaptive gene complexes” involving agronomically important quantitative traits.
We have previously predicted the performance for various
quantitative traits in diverse germplasm of rice using molecular
markers (Virk et al 1996a,b). This is possible because of
the presence of statistical associations between the presence/
absence of individual markers and trait performance, identifiable
through regression analysis. In our most recent work, we
have investigated the genetic basis of the observed associations
between markers and QTL loci, and we have identified
features of the rice genome that underlie these associations.
The results shed light upon the evolution of cultivated rice and
raise questions about conventional genetic improvement of rice.
276 Advances in rice genetics

Materials and methods
A diverse set of 48 landraces of Oryza sativa (from South and
Southeast Asia) along with a mapping population of 60
doubled-haploid (DH) lines obtained from a cross between
IR64 and Azucena (Huang et al 1994, Maheswaran et al 1997)
constituted the material for this study (see Virk et al 1996a).
Morphological data for four quantitative traits (culm number,
culm length, panicle length, and days to 50% flowering) were
scored on 10 representative plants of each of the 48 landraces
and 60 DH lines.
The AFLP (amplified fragment length polymorphism)
protocol developed by Vos et al (1995) was essentially followed,
with minor modifications (Virk et al 1998). Fourteen
primer combinations yielding 122 mapped AFLP markers were
scored on the landraces and DH lines.
To detect associations between the 122 mapped AFLP
markers scored on the landraces, a contingency chi-square
analysis for all possible pairs (7,381) of markers was conducted.
To minimize the occurrence of false positives, a conservative
test was used in which the probability (P) obtained from the
normal test of significance was multiplied by n – 1 (where n is
the number of markers). The association was declared significant
wherever the adjusted P was less than 0.05.
Linear regression analysis was employed to detect the
association between an AFLP marker and a quantitative trait
for the landraces, where the latter was treated as a dependent
variable and the various AFLP marker genotypes as independent
variables (Virk et al 1996a,b). The method provides the
maximum likelihood estimates of the relationships between
performance for the quantitative trait and the presence/absence
of particular molecular markers. The maximum r 2 improvement
(MAXR) option of the PROC REG of the SAS statistical
package (SAS 1990) was used to determine the most appropriate
model.
In the DH mapping population, the significance of regression
was interpreted to be a result of genetic linkage, as
opposed to statistical or genetic association in the landraces.
Results
Initially, we carried out analyses in which associations between
different AFLP marker loci were examined. All 122 AFLP
markers, which had been mapped using a DH population (Virk
et al 1998), were scored as present/absent across the 48
landraces. In this diverse material, strong associations were
found between the allelic pattern of some pairs of markers using
chi-square analysis. Of a total of 7,381 pairs of markers,
960 were found to be strongly associated (P

this may be misleading; particular markers may have fallen
just outside the threshold significance used in the analyses and
therefore are not included. It may also be because polymorphism
at a QTL in the two parents used in the cross has assumed
a much greater significance in the mapping population
than it does across the diverse set of landraces. This could
occur if the effects of other QTLs cannot be detected because,
in this cross, these loci are monomorphic.
Conversely, some markers are associated with a trait in
the diverse material but not associated with that trait in the DH
population. This is partly explained because some of the QTLs
controlling the traits studied here may not be polymorphic in
the particular cross used to produce this mapping population.
Hence, those QTLs, and the markers associated with them,
would not be detected in the DH population. However, in addition,
because marker alleles on different chromosomes can
remain in association across diverse germplasm, a marker on
one chromosome may also be associated with a QTL allele
within an associated block on another chromosome.
How have alleles at loci in blocks on different chromosomes
remained in association during the adaptive evolution
of landraces These blocks may have been maintained in association
over the hundreds or thousands of years of rice
landrace cultivation over a geographically wide area. Alternatively,
the associations have been selected several or many times
during evolution, perhaps as an adaptive response to similar
environmental conditions. The combination of migration and
inbreeding giving rise to linkage disequilibrium may have been
significant in the initial establishment of associations, but cannot
alone account for their occurrence and maintenance over
time in geographically diverse regions of Asia. As with wild
oats and wild barley (Clegg and Allard 1972, Clegg et al 1972),
it would appear that, in these rice landraces, epistatic interactions
between alleles at different loci may have contributed to
the associations that we have found in this study.
We suggest that association, particularly of genes among
different chromosomal blocks, is the “coadaptation” of
Dobzhansky (1970), who suggested that the binding together
of favorable allele combinations could be favored by selection.
Selection, accompanied by recombination reduced by one
or all of linkage, inbreeding, and reduced population size, can
result in nonrandom associations among alleles at different loci,
giving rise to genes selected as coadapted units (Franklin and
Lewontin 1970, Allard et al 1972). The major hypothesis derived
from these studies is that, within inbreeding populations,
it is the interaction between favorable alleles within so-called
gene complexes that gives rise to the similar increased adaptation
of different populations to their local environments.
We have previously argued that the existence of associations
between markers and QTLs that can be identified
among diverse germplasm may have practical significance for
marker-assisted selection and germplasm evaluation (Virk et
al 1996a). However, if these associations have adaptive significance
in the history of rice landrace evolution, then perhaps
they also require consideration during the process of rice
improvement. Would a deliberate attempt to maintain adaptive
gene complexes intact during the recombination that takes
place in plant breeding point the way to further means of crop
improvement As we further dissect the rice genome, we will
have a better understanding of how these complexes function.
In any case, their existence demonstrates that breeding for
performance of rice varieties, especially for heterogeneous
environments where adaptation is paramount, must take account
of this important genetic mechanism.
References
Allard RW, Babbel GR, Clegg MT, Kahler AL. 1972. Evidence for
coadaptation in Avena barbata. Proc. Natl. Acad. Sci. USA
69:3043-3048.
Clegg MT, Allard RW. 1972. Patterns of genetic differentiation in
the slender wild oat species Avena barbata. Proc. Natl. Acad.
Sci. USA 69:1820-1824.
Clegg MT, Allard RW, Kahler AL. 1972. Is the gene the unit of
selection Evidence from two experimental plant populations.
Proc. Natl. Acad. Sci. USA 69:2472-2478.
Dobzhansky T. 1970. Genetics of the evolutionary process. Columbia,
N.Y. (USA): Columbia University Press. 505 p.
Franklin I, Lewontin RC. 1970. Is the gene the unit of selection
Genetics 65:707-734.
Huang N, McCouch SR, Mew T, Parco A, Guiderdoni E. 1994. Development
of a RFLP map from a DH population of rice. Rice
Genet. Newsl. 11:134-137.
Maheswaran M, Subudhi PK, Nandi S, Xu JC, Parco A, Yang DC,
Huang N. 1997. Polymorphism, distribution, and segregation
of AFLP markers in a DH rice population. Theor. Appl. Genet.
94:39-45.
SAS. 1990. SAS/STAT user’s guide. Version 6, 4th ed. Vol. 1. Cary,
N.C. (USA): SAS Institute Inc.
Virk P, Ford-Lloyd BV, Jackson MT, Newbury HJ. 1996a. Predicting
quantitative variation within rice germplasm using molecular
markers. Heredity 76:296-304.
Virk PS, Ford-Lloyd BV, Jackson MT, Pooni HS, Clemeno TP,
Newbury HJ. 1996b. Marker-assisted prediction of agronomic
traits using diverse rice germplasm. In: Khush GS, editor. Rice
genetics III. Proceedings of the Third International Rice Genetics
Symposium. Manila (Philippines): International Rice
Research Institute p 307-316.
Virk PS, Ford-Lloyd BV, Newbury HJ. 1998. Mapping AFLP markers
associated with subspecific differentiation of Oryza sativa
and an investigation of segregation distortion. Heredity
81:613-620.
Vos P, Hogers R, Sleeker M, Reijans M, Lee T, Homes M, Freiters
A, Pot J, Peleman J, Kuiper M, Zabeau M. 1995. AFLP: a
new concept for DNA fingerprinting. Nucl. Acids Res.
23:4407-4414.
Notes
Authors’ addresses: B.V. Ford-Lloyd and H.J. Newbury, School of
Biosciences, University of Birmingham, Edgbaston, Birmingham
B15 2TT, UK; P.S. Virk and M.T. Jackson, International
Rice Research Institute, Los Baños, Laguna, Philippines.
278 Advances in rice genetics

Drought tolerance in rice: QTLs, marker-assisted selection,
and environmental interactions
A. Price
A mapping population of 205 recombinant inbred lines based on a cross between two drought-tolerant upland rice varieties,
Bala and Azucena, was used to identify quantitative trait loci (QTLs) for drought-related traits (root morphology) and field
performance under drought. A root growth study included two types of soil-filled containers and hydroponics in addition to root
penetration assessment using the wax layer method. Drought screening was conducted over two seasons in the field at both
IRRI and WARDA. By using multiple environments and by comparing with other experiments conducted on other populations,
some potentially valuable QTLs have been identified. Four of these regions are now being used to improve the Indian upland
variety Kalinga III. A total of nine QTLs are being developed into near-isogenic lines to further investigate the nature of the QTLs.
Identifying rice varieties with genes that contribute to drought
tolerance and locating such genes on molecular linkage maps
offer a new and more precise way to produce drought-tolerant
rice varieties via marker-assisted selection. Locating such genes
is difficult because drought is a complex phenomenon, rice
germplasm has many mechanisms of tolerance for drought,
and each mechanism is generally multigenic. Much progress
has been made using several mapping populations that have
been screened for performance under drought in the field or
for individual traits related to drought tolerance (particularly
root morphology) in controlled-environment experiments.
While this research highlights the degree of interaction between
genotype and environment and the complex nature of
the genetics of drought tolerance, a pattern is beginning to
emerge that should be very useful for breeders. We describe
progress in identifying quantitative trait loci (QTLs) for
drought-tolerance mechanisms in a population of recombinant
inbred lines based on a cross of Bala and Azucena. We also
describe progress in marker-assisted selection (MAS) and the
development of near-isogenic lines (NILs) at particularly interesting
QTLs.
Screening of Bala × Azucena population
A cross between drought-tolerant varieties Bala and Azucena
produced an F 2 mapping population, which was used to identify
QTLs for root morphology of plants grown in a hydroponic
system (Price et al 1997, Price and Tomos 1997). This
was subsequently developed into an F 6 recombinant inbred
population of 205 lines by single-seed descent and used to
identify QTLs for root-penetration ability with the wax layer
approach (Price et al 2000). The population has also been
screened for root growth using three different methods. A large
root box (2 m long × 1 m wide × 1 m deep) containing 170
plants with each root system restricted to 7-cm-diam nylon
tubes was used to assess root growth in well-watered and
droughted conditions (Price et al 1999). The population has
been screened in thin sections of soil between glass (1.5 cm
thick × 30 cm wide × 120 cm deep) again under well-watered
and droughted conditions (Price et al 1999, Price et al, unpublished).
The population has also been screened in hydroponics
using the same methodology previously described by Price et
al (1997), only with a lower light intensity (300 mol m –2 s –1 )
(Price et al, unpublished). Figure 1 summarizes some of the
results of mapping the QTLs associated with root morphology
from these screens. The figure shows that many genomic regions
contribute to root growth under different conditions, but
some regions, such as C601 on chromosome 2 and G1085 on
chromosome 9, consistently affect rooting.
Marker-assisted selection and near-isogenic line development
As a result of these analyses, nine genomic regions were selected
for detailed investigation (Table 1). For each region,
evidence for an effect on either root growth or performance
under drought is presented, and this includes corroboration
from other populations. Four of the regions represent Azucena
alleles, which increase the length or thickness of the rooting
system. These regions are being transferred into a popular Indian
upland variety, Kalinga III, which is drought-susceptible
and has poor roots. All nine regions are being used to produce
NILs—lines that are genetically identical except at the QTL
of interest, where one line will have the Bala QTL allele and
the other the Azucena QTL allele. This is being achieved by
exploiting the residual heterozygosity in the F 6 population.
These NILs will be used to explore the physiological basis of
the QTLs and may be useful in fine mapping or isolating the
responsible genes.
References
Champoux MC, Wang G, Sarkarung S, Mackill DJ, O’Toole JC,
Huang N, McCouch SR. 1995. Locating genes associated with
root morphology and drought avoidance in rice via linkage to
molecular markers. Theor. Appl. Genet. 90:969-981.
Courtois B, McLaren G, Sinha PK, Prasad K, Yadav R, Shen L.
2000. Mapping QTLs associated with drought avoidance in
upland rice. Mol. Breed. 6:55-66.
Molecular markers, QTL mapping, and marker-assisted selection 279

1
RG532
RG173
RZ995
C178
R2635
54 cM
C1370
G393
R2417
51 cM
C86
C949
RZ14
R117
7
G338
C39
R1440
G20
C451
R1357
RG850
C507
RG351
2 RG509
RG83
RG171
G45
G39/RG139
G57
C601
RG256
100 cM
8
R902
G1010
C225
G2132
G1073
G187
R2676
R202
RG598
R662
3
C643
RG409
RG191
RG745
G144
RZ474
C136
9
R1164
R1687
R79
G385
G1085
C506
4
RG620
RG190
C734
RG449
C513
RG163
10
C701
G89d
RG257
G1082
C16
C223
5 RZ390
R3166
6
C76
RZ516
R2232
R569
RG213
RG13
51 cM
C624
C43
RZ70
R2654
54 cM
RG119
RG346
RG778
RZ682
Root Max. root Root-penetration
thickness length ability
TCC RBC TCC RBC
TCD RBD TCD RBD
Hydro. Hydro.
11 R642
RZ141
12
G24
CD0127
G124
G320
G44
RG2
C189
G1465
48 cM
R617
RG341
R1933
C449
RG543
RG181/C901
Fig. 1. RFLP and AFLP map of Bala × Azucena population (RFLPs indicated to the right of each
chromosome) showing QTLs for two morphological traits (root thickness and root length). These
traits were assessed in thin chambers under control (TCC) and drought (TCD) conditions and in
root boxes under control (RBC) and drought (RBD) conditions or hydroponics (Hydro.). In each
case, the LOD score was greater than 3.0; the box represents the 1 LOD confidence interval.
Also presented are QTLs for root-penetration ability (Price et al 2000). QTLs on the right side of
the chromosome represent the positive effect of Azucena alleles. Chromosome segments shaded
black represent targets for marker-assisted selection; those hatched are targets for near-isogenic
line production.
280 Advances in rice genetics

Table 1. QTLs associated with root growth or performance under drought in Bala × Azucena population.
Between Donor of Target
Chromosome markers positive for MAS QTL effect (and evidence) a
alleles or NIL
1 C86-RZ14- Bala NIL Performance under drought (f)
R117
2 RG171- Bala NIL Root thickness (a), root penetration (b), root-
G45-G39
pulling force (n)
2 G57-C601- Azucena MAS + Root length (a, d), root thickness (c, n), root
RG256 NIL penetration (b, l), performance under drought
(f, i)
3 RZ474-C136- Bala NIL Performance under drought (f), leaf ABA
R1618
accumulation (m)
5 RG13-C624- Bala NIL Root thickness (a, c, g), root length (a, c), root
C43
volume (h), root penetration (b), performance
under drought (f, i)
6 R2654-RG778- Azucena NIL Root thickness (c, d), root length (a), root penetra-
RZ682
tion (l), rooting depth (n)
7 R1357-RG650 Azucena MAS + NIL Root length (d), root thickness (d, g), root penetra-
-C507 tion (j), rooting depth (g, n)
9 G385-G1085 Azucena MAS + NIL Root length (d, g, k), root thickness (d, k),
performance under drought (f, i, k)
11 RG2-C189- Azucena MAS + NIL Root length (a, k), root penetration (b, k), root
G1465
pulling force (n)
a a = Bala × Azucena F 2 hydroponics (Price and Tomos 1997), b = Bala × Azucena F 6 root-penetration screen (Price et al 2000),
c = Bala × Azucena F 6 hydroponics (unpubl.), d = Bala × Azucena F 6 thin chamber screen (Price et al 1999 and unpubl.), e = Bala
× Azucena F 6 root box screen (Price et al 1999), f = Bala × Azucena F 6 field drought screen (Price et al 1999 and unpubl.), g =
Azucena × IR64 DH root tube screen (Yadav et al 1997), h = Azucena × IR64 DH field root growth screen (Hemamalini et al 2000),
i = Azucena × IR64 DH field drought screen (Courtois et al 2000), j = Azucena × IR64 DH root penetration screen (Zheng et al
2000), k = Co39 × Moroberekan F 8 root tube and field drought screen (Champoux et al 1995), l = Co39 × Moroberekan F 8 rootpenetration
screen (Ray et al 1996), m = IR20 × 63-83 F 2 drought screen (Quarrie et al 1997), n = CT9993-5-10-1-M ×
IR62266-42-6-2 DH field drought screen (Zhang et al 1999).
Hemamalini GS, Shashidar HE, Hittalmani S. 2000. Molecular
marker-assisted tagging of morphological and physiological
traits under two contrasting moisture regimes at peak vegetative
stage in rice (Oryza sativa L.). Euphytica 112:69-78.
Price A, Steele K, Townend J, Gorham G, Audebert A, Jones M,
Courtois B. 1999. Mapping root and shoot traits in rice: experience
in UK, IRRI, and WARDA. In: Ito O, O’Toole J,
Hardy B, editors. Genetic improvement of rice for water-limited
environments. Manila (Philippines): International Rice
Research Institute. p 257-273.
Price AH, Steele KA, Moore BJ, Barraclough PB, Clark LJ. 2000. A
combined RFLP and AFLP linkage map of upland rice (Oryza
sativa L.) used to identify QTLs for root-penetration ability.
Theor. Appl. Genet. 100:49-56.
Price AH, Tomos AD. 1997. Genetic dissection of root growth in
rice (Oryza sativa L.). II. Mapping quantitative trait loci using
molecular markers. Theor. Appl. Genet. 95:143-152.
Price AH, Virk DS, Tomos AD. 1997. Genetic dissection of root
growth in rice (Oryza sativa L.). I. A hydroponic screen. Theor.
Appl. Genet. 95:132-142.
Quarrie SA, Laurie DA, Zhu J, Lebreton C, Semikhodskii A, Steed
A, Witsenboer H, Calestani C. 1997. QTL analysis to study
the association between leaf size and abscisic acid accumulation
in droughted rice leaves and comparisons across cereals.
Plant Mol. Biol. 35:155-165.
Ray JD, Yu L, McCouch SR, Champoux MC, Wang G, Nguyen H.
1996. Mapping quantitative trait loci associated with root
penetration ability in rice (Oryza sativa L.). Theor. Appl.
Genet. 92:627-636.
Yadav R, Courtois B, Huang N, McLaren G. 1997. Mapping genes
controlling root morphology and root distribution on a doublehaploid
population of rice. Theor. Appl. Genet. 94:619-632.
Zhang J, Babu RC, Pantuwan G, Kamoshita A, Blum A, Sarkarung
S, O’Toole JC, Nguyen HT. 1999. Molecular dissection of
drought tolerance in rice: from physio-morphological traits to
field performance. In: Ito O, O’Toole J, Hardy B, editors.
Genetic improvement of rice for water-limited environments.
Manila (Philippines): International Rice Research Institute.
p 331-343.
Zheng H, Babu R, Pathan M, Ali L, Huang N, Courtois B, Nguyen
HT. 2000. Quantitative trait loci for root-penetration ability
and root thickness in rice: comparison of genetic backgrounds.
Genome 43:53-61.
Notes
Author’s address: Department of Plant and Soil Science, University
of Aberdeen, AB24 3UU, U.K.
Acknowledgments: The author acknowledges the great contribution
to this rice mapping project of many individuals who are or
who will be co-authors in other more detailed publications.
The research described has largely been funded by the Department
for International Development, U.K.
Molecular markers, QTL mapping, and marker-assisted selection 281

Identifying traits and molecular markers associated
with components of drought tolerance in rice
H.E. Shashidhar, N. Sharma, M. Ashoka, V. Rao, M. Toorchi, and S. Hittalmani
Bulk segregant analysis (BSA) for maximum root length (8–10 genotypes from each, deep-rooted and shallow-rooted phenotypes)
was carried out using RAPD primers on transgressant doubled-haploid lines of an IR64/Azucena mapping population.
One random primer-derived band out of 150 tested was found to cosegregate with maximum root length. This primer was found
to be codominant and mapped onto chromosome 10. The primer mapped with an LOD of 4.2 and accounted for 24% of the
variability for the trait. This was the first report of a primer for maximum root length across crops.
The efficiency of marker-assisted selection (MAS) depends
on the speed and accuracy with which the desirable gene/genotype/allele
can be identified from germplasm accessions or
among recombinants in breeding programs. The availability
of innumerable DNA markers and faster and cheaper polymerase
chain reaction (PCR) techniques coupled with the availability
of computer software for visualizing genomes allow us
to genotype successive generations of breeding material.
The simplicity of the MAS strategy depends on the inheritance
pattern of the trait of interest, with the complexity
increasing proportionately with the number of gene pairs “controlling/influencing”
the trait(s). Low heritability of the trait
complicates the task further. An array of markers, each identifying
one locus, may have to be assembled to account for a
large percentage of the variation for such a trait. PCR-based
markers are ideal for such tasks since they are easy to use, fast,
and reliable, and use a comparatively small amount of DNA.
Drought tolerance is a cumulative effect of several morphological,
phenological, biochemical, and physiological traits
each individually and collectively interacting with the environment.
It is desirable to select for the individual component
trait (primary trait) and also evaluate the effect(s) on the whole
plant and crop community levels. O’Toole (1989) said that
“marker-assisted selection holds immediate and near-term use”
in breeding for drought tolerance.
As a run-up to our effort to study and quantify drought
tolerance, we tagged root morphological traits under contrasting
moisture regimes (Hemamalini et al 2000). In a subsequent
study, we tried to ascertain the association of root morphology
with grain yield under contrasting moisture regimes. In this
study, transgressants for maximum root length (MRL) were
used to identify PCR-based markers associated with MRL. This
is the first report of markers associated with MRL across crops.
Materials and methods
Transgressants for MRL were identified based on evaluation
of doubled-haploid (DH) lines of an IR64/Azucena mapping
population under well-watered and low-moisture-stress conditions.
Phenotyping for root morphology was done following
Hemamalini et al (2000). Ten DH lines from shallow and deeprooted
extremes were chosen to constitute the individual bulks.
Table 1 presents the MRL values of the selected accessions
and parents chosen for the study.
Genomic DNA was extracted from 20–30-d-old leaves
of the selected transgressants—Azucena, IR64, and standard
checks—by the CTAB method. An equal quantity of DNA from
each genotype was used to construct DR (deep-rooted) and
SR (short-rooted) bulks. These two bulks were used to identify
markers associated with MRL adopting BSA (Williams et
al 1990, Michelmore et al 1991).
The PCR reaction mixture contained approximately 100
ng of genomic DNA, 200 mM of dNTPs, 0.2 mM of primer,
10X polymerase buffer, and 1 unit of Taq (MJ Research, USA)
with mineral oil overlay. Random primers were procured from
Operon (Operon Technologies, USA) and run on a PTC100
Thermal Cycler (MJ Research, USA). The PCR profile was
94 °C for 5 min, followed by 35 cycles of 94 °C for 1 min,
44 °C for 1 min, 72 °C for 1 min, and, finally, 5 min at 72 °C as
an extension. Bands were visualized by running on 1.4% agarose
gel stained with ethidium bromide.
Random primers were screened for polymorphism. Putative
polymorphic primers were reconfirmed for polymorphism.
RAPD primers showing polymorphism in the bulks were
screened across the 135 DH lines for mapping.
The data generated by using the BH14 primer on all 135
genotypes of the DH mapping population were subjected to
Table 1. The MRL values (in cm) of the selected accessions and
parents chosen for study.
Deep root
Shallow root
SI No. Genotype Root length SI No. Genotype Root length
1 Azucena 87.37 1 IR64 32.80
2 P7 54.65 2 P467 28.45
3 P107 68.98 3 P78 31.53
4 P333 72.63 4 P463 21.43
5 P192 65.50 5 P35 27.03
6 P210 64.47 6 P284 29.87
7 P12 56.35 7 P488 32.10
8 P391 56.35 8 P442 22.67
9 P1564 54.55 9 P124 28.20
282 Advances in rice genetics

M
IR64
AZU
–
+
7
107
333
192
210
12
391
1564
467
78
463
35
284
488
442
124
–
+
M
OPBH14
G1084
OSDIM
RG241
RZ625
Fig.1. OPBH14-derived banding pattern in parents of mapping population, deeprooted
bulk, shallow-rooted bulk, and constituents of the bulks.
Fig. 2. Linkage map of
chromosome 10
showing the region
near the OPBH14 locus.
MAPMAKER to identify the location of loci on the map in
relation to the 175 markers already mapped on the genome.
Results and discussion
A standard approach followed to identify markers associated
with traits under monogenic control has been to compare the
banding pattern between phenotypically contrasting plants/
genotypes. This strategy is also very useful in tagging QTLs.
One hundred fifty random primers were used to find the polymorphism
between the two bulks. Polymorphism between SR
and DR was consistent with OPBH14 (5′ACCGTGGGTG 3′):
a 1.5-kb band was associated with the DR bulk and its ingredient
genotypes, and a 1.3-kb band with the SR bulk and its ingredient
genotypes (Fig. 1). The primer polymorphism was
codominant.
The primer mapped to chromosome 10 in the vicinity of
the G1084 region, with an LOD threshold of 4. This accounted
for 24.0% of the variation for MRL.
The region flanked by G1084 and RG214 on the distal
portion of chromosome 10 was assessed with polymorphism
of OPBH14 (Fig. 2). Earlier studies have indicated the map
location (Tao et al 1997) of OSDIM, a cell-length mutant called
Dimunito, at this locus. Since cell-length increase could be an
important factor contributing to an increase in root length, the
mode of action of this locus could be hypothesized.
The band is being cloned for sequencing and development
of a SCAR marker.
References
Hemamalini GS, Shashidhar HE, Hittalmani S. 2000. Molecular
marker assisted tagging of root morphological traits under two
contrasting moisture regimes at peak vegetative stage in rice
(Oryza sativa L.). Euphytica 112:69-78.
Michelmore R, Paran I, Kesseli R. 1991. Identification of markers
linked to disease-resistance genes by bulk segregant analysis:
a rapid method to detect markers in specific genomic regions
by using segregating populations. Proc. Natl. Acad. Sci. USA
88:9828-9832.
O’Toole JC. 1989. Breeding for drought resistance in cereals. In:
Baker FWG, editor. Drought resistance in cereals. Wallingford
(UK): CAB International. p 107-116.
Tao L, Kameya N, Fukuta Y, Nakamura I. 1997. Molecular cloning
of OSDIM cDNA and its linkage analysis in rice. Rice Genet.
Newsl. 14:130-133.
Williams JGK, Kabelik AR, Livak KJ, Rafalski JA, Tingey SV. 1990.
DNA polymorphisms amplified by arbitrary primers are useful
as genetic markers. Nucl. Acids Res. 18:6531-6535.
Notes
Authors’ address: Department of Genetics and Plant Breeding, College
of Agriculture, University of Agricultural Sciences,
GKVK, Bangalore 560 065, India.
Acknowledgment: Financial assistance and training from the
Rockefeller Foundation Projects 95001#321 and 98001#671
are gratefully acknowledged.
Molecular markers, QTL mapping, and marker-assisted selection 283

Genes/QTLs affecting flood tolerance in rice
K. Sripongpankul, G.B.L. Posa, D. Senadhira, N. Huang, D.S. Brar, G.S. Khush, and Z. Li
A linkage map was constructed from 165 recombinant inbred lines (RILs) derived from IR74/Jalmagna using 113 amplified
fragment length polymorphisms, 29 restriction fragment length polymorphisms, and two genes (sd1 and adh1). The linkage
map covering the whole rice genome has a total length of 2,339.9 cM, with an average size between markers of 17.9 ± 10.3
cM. Elongation ability was evaluated on the basis of total plant height increment, internode elongation, and leaf elongation.
The first test was conducted under greenhouse conditions; the second one was done in the field. Six main-effect QTLs were
detected for plant elongation with an additional nine pairwise epistatic effects. Qlne1 contributed the largest effect (33.8% and
20.1%) for plant and internode elongation, which was observed in test 1. Variations of 29.6% and 33.1% were obtained in test
2 for the same QTL and traits. Qlne4 explained 36.7% of the variation in internode elongation, which was observed to be
significant only in test 2. The Jalmagna allele contributed for Qlne1, while IR74 contributed for Qlne4. The QTLs for leaf
elongation were detected on chromosomes 6 and 7 (QLe6 and Qle7). A total of 13 QTLs for submergence tolerance were
identified, of which 11 were contributed by Jalmagna and the rest by IR74. The QTL located on chromosome 9 has the highest
variation explained, which was contributed by the IR74 allele. Associations between elongation traits and submergence tolerance
were found in seven regions (of chromosomes 1, 3, 4, 5, and 7). Adaptation to flooding was mainly attributed to the
effect of Qlne1 and Qlne4 (plant elongation ability) and sub1(t) (submergence tolerance).
Submergence tolerance and plant elongation are two basic
adaptive mechanisms for rice grown under flood conditions.
Submergence tolerance is the ability of the rice plant to survive
in water under completely submerged conditions for 10 d
or more. The ability of the plant to elongate to keep the leaf
canopy above the water surface is referred to as elongation
ability. Flood-prone rice varieties possess one of these characteristics.
Submergence-tolerant varieties can survive flash
floods but will die if water does not recede in about 14 d. Varieties
with elongation ability elongate during flash floods and
may lodge when water recedes. These two mechanisms are
presumed to be opposite to each other. Thach (1994) showed
that the submergence tolerance gene in FR13A is allelic to one
of two complementary genes governing the elongation ability
of Jalmagna. Therefore, combining the submergence tolerance
of FR13A and the elongation ability of Jalmagna is not possible.
However, Saha Ray et al (1994) reported that submergence
tolerance and elongation ability could be combined in
the genotype using strongly submergence-tolerant parents. The
QTL analysis for flood tolerance of Sripongpankul (1998)
showed that some minor genes/QTLs for elongation ability in
rice have been located near the region of the major gene/QTL
for submergence tolerance on chromosome 9. The study was
undertaken to map the genes/QTLs controlling submergence
tolerance and elongation ability using amplified fragment length
polymorphism (AFLP) and restriction fragment length polymorphism
(RFLP) markers in recombinant inbred lines (RILs).
Materials and methods
The mapping population consisted of 165 F 8 RILs derived from
the cross between IR74 (a high-yielding, semidwarf, photoperiod-sensitive,
and nonelongating variety) and Jalmagna (a traditional
tall, low-yielding, photoperiod-sensitive, and rapidly
elongating variety). The parent and the RILs were evaluated
for elongation ability and submergence tolerance in two experiments.
In test 1, rice plants were submerged under slowly
increasing water levels in the greenhouse. In test 2, phenotyping
for elongation and submergence tolerance was conducted under
slowly increasing water levels in the field. In both tests,
elongation ability of each RIL was measured based on increments
in plant height, internode length, and leaf length
(Sripongpankul 1998). For submergence tolerance, lines surviving
the flooding treatment were given a score of 1 and the
dead ones had 0. AFLP, RFLP, and MAPMAKER/EXP version
3.0 were employed to produce the genotypic data and to
construct the genetic linkage map. The new computer program
QTLMAPPER v1.0 (Wang 1998) was used for genes/QTLs
and epistatic loci, including that for genetic effect analysis.
The likelihood chi-square statistic G 2 was used to detect the
association between markers and submergence tolerance.
Results and discussion
Jalmagna elongated very fast and survived in both tests,
whereas IR74 did not survive in test 2. It showed no internodal
elongation, but significantly elongated leaves of 40.4
cm in test 1 (clear water) were observed. Considerable variation
in both submergence tolerance and elongation ability existed
in the RILs (Fig. 1).
The new genetic linkage map contained 144 markers,
including 113 AFLPs, 29 RFLPs, and two genes (sd1 and
adh1). The constructed map covered all 12 rice chromosomes
and had a total length of 2,339.9 cM, with an average interval
of 17.9 ± 10.3 cM between markers. Six main-effect QTLs
and nine pairs of epistatic loci affecting plant elongation ability
were detected (Tables 1 and 2). Thirteen genomic regions
were found significantly associated with submergence tolerance
(Table 3). These included three main-effect QTLs—
Qlne1, Qlne2, and Qlne4—affecting internodal and plant height
284 Advances in rice genetics

1 2 3 4 5 6 78 9 10 11
RG229 RZ527
P3M6-4 P2M9-8
P1M3-5 P1M9-3 P1M5-15 P1M10-7 P2M7-7 P1M2-8 RG757 P3M6-7
P3M3-6
P2M6-5
P1M3-10
RZ613
RZ495
P1M3-16
P2M9-3
P2M10-14
P3M2-5
P2M5-18
P3M7-6
P1M9-4
P2M5-17
P2M2-7
P2M10-4
P1M5-11
P2M6-12
P1M6-7
P3M3-9
P2M6-8
P2M2-5
P2M1-12
P2M6-3
RZ154
P1M9-11 RG313 P1M3-6
P1M10-4 P2M3-5
P3M7-9 P2M10-2 P3M3-8
P2M6-6
P1M6-6
P1M3-7
P1M10-14
P1M9-12
P2M10-11
P3M6-5
P3M1-5
P3M7-11 P1M10-16
RG541
P3M1-10 P1M6-5 P3M1-11 P3M5-4
P3M1-3
RZ730
RZ444
P1M10-17
P3M5-1
P1M3-9
P1M7-8
P2M7-2 P1M10-12
P3M2-1
RG220
P3M1-9 RZ675
P1M10-5
P2M6-9
P1M2-2
P1M1-5
P1M3-13
P2M5-11
P1M9-10 P2M5-8
P2M7-3
RG109
P1M5-13
P1M10-3
P3M3-3
P1M6-9
RG650
P1M3-12
sd-1
P2M10-7
P2M5-13 RG403 P2M3-6
P3M7-3
P1M1-2
P1M7-3
P1M6-2 P2M10-6 P2M10-5 RG788
Sub1 P2M7-4
RG173
RG449 P2M1-7
P2M2-6
P2M9-4
P2M3-3
P2M7-1
P2M2-8
P1M5-10 P1M6-1
RZ123
RG190
P1M1-1
RZ892
P3M6-2
P3M2-6 RG553
RG98
P3M1-12
RG303
P1M3-14
P2M1-11
P2M9-6
P3M1-1
P3M2-2
RG118
Adh1
P1M3-2
P1M5-19
RZ14
P1M3-15
P2M1-15
Main-effect QTLs affecting internode elongation
Main-effect QTLs affecting leaf elongation
Epistatic and main-effect QTLs affecting initial plant height
Markers associated with submergence tolerance
Pairwise epistatic loci affecting plant elongation
Fig. 1. Genomic location for main-effect QTLs and epistatic loci affecting plant elongation of the IR74/Jalmagna recombinant inbred population.
12
P1M9-9
P3M7-4
RG81
P3M5-9
P1M7-4
P1M6-3
P1M7-6
CDO344
RG543
P1M1-4
RZ76
Molecular markers, QTL mapping, and marker-assisted selection 285

Table 1. Main-effect QTLs affecting plant elongation ability detected in the IR74/Jalmagna recombinant
inbred population.
Trait a QTL Chromosome Marker interval
Test 1 Test 2
LOD a (cm) R 2 (%) LOD a (cm) R 2 (%)
PHI QLne1 1 RG109–sd-1 10.5 –13.6 33.8 21.5 –23.2 29.6
PHI QLne2 2 P2M9-8–P2M6-8 – – – 7.4 –14.2 11.2
PHI QLne4 4 P3M1-5–P3M5-1 – – – 12.6 21.8 25.6
INI QLne1 1 RG109–sd-1 7.0 –8.7 20.1 18.9 –18.2 33.1
INI QLne2 2 P2M9-8–P2M6-8 – – – 5.1 –9.6 8.6
INI QLne4 4 P3M1-5–P3M5-1 – – – 10.7 21.8 36.7
LLI QLe4 4 P3M5-1–P2M5-8 6.2 –6.2 14.2 – – –
LLI QLe6 6 P1M10-7–P2M5-17 2.5 4.9 9.4 – – –
LLI QLe7 7 P1M3-9–P1M10-5 – – – 3.7 –3.5 12.0
a PHI, INI, and LLI are increments in plant height, internode, and leaf length. The gene effect, a, is the phenotypic effect due to substitution
of the Jalmagna allele by the IR74 allele.
Table 2. Digenic epistatic QTLs affecting plant elongation ability identified in the IR74/Jalmagna recombinant inbred population.
Trait a Chromosome Interval i Chromosome Interval j LOD a i (cm) a j (cm) aa ij (cm) R 2
PHI (1) 4 RG109–sd-1 5 RG403–P1M1-2 13.0 –6.1 8.2 –10.5 13.7
2 P3M1-9–P2M5-11 7 P1M6-6–P3M7-11 6.0 4.0 –9.2 10.2
2 P2M10-7–P2M10-6 12 P1M6-3–P1M7-6 5.2 4.3 –9.0 9.8
4 P2M5-8–P2M5-13 6 P1M5-13–P2M3-6 5.6 –9.1 10.0
PHI (2) 1 P2M10-11–RG541 9 RG553–P2M1-15 4.1 –9.1 6.2
2 P1M10-17–P3M1-9 5 P1M2-2–P2M7-3 3.6 5.9 5.1
3 P2M10-2–P3M6-5 6 P1M5-13–P2M3-6 3.6 8.4 5.9
7 P1M10-5–RG650 10 P1M7-3–RZ892 6.3 5.1 5.8 4.8
INI (1) 2 P3M1-9–P2M5-11 7 P3M7-11–P3M1-11 5.6 –7.9 19.4
4 P3M1-5–P3M5-1 5 RG403–P1M1-2 10.8 –21.2 23.7 35.5
INI (2) 2 P1M10-17–P3M1-9 5 P1M2-2–P2M7-3 4.0 8.0 6.4
3 P2M10-2–P3M6-5 6 P1M5-13–P2M3-6 4.7 8.6 7.4
7 P1M10-5–RG650 10 P1M7-3–RZ892 7.3 5.1 8.8 7.8
LLI (1) 1 RG109–sd-1 5 RG403–P1M1-2 10.8 –17.9 12.7 25.0
a (1) and (2) represent QTLs detected in tests 1 and 2, respectively. a i and a j are the main QTL effects associated with ith and jth loci, and aa ij is the epistatic effect
of QTLs.
Table 3. Genomic regions showing significant association with submergence tolerance
in the IR74/Jalmagna recombinant inbred population.
Chromosome Marker a G 2 Tolerance allele G 2 Tolerance allele
1 P1M6-2 23.2 Jalmagna
1 RG541 6.4 Jalmagna 5.1 Jalmagna
3 P1M3-5 15.7 IR74
4 P2M5-8 19.7 Jalmagna
4 P3M1-5 5.9 Jalmagna
5 P1M6-9 7.2 Jalmagna 9.4 Jalmagna
7 P1M3-9 5.2 Jalmagna
8 P3M7-3 6.9 Jalmagna 11.9 Jalmagna
9 P2M7-4, Sub1(t) 5.1 IR74 58.3 IR74
9 P2M5-18 6.6 Jalmagna
10 P3M1-3 13.0 Jalmagna
11 P3M1-12 8.0 Jalmagna
12 P3M7-4 6.0 Jalmagna
a Underlined markers are associated with detected QTLs affecting internodal or plant elongation. G 2 is the
likelihood ratio chi-square statistic. The significant values of G 2 at P = 0.05, 0.01, and 0.001 are 3.79,
6.63, and 11.60, respectively.
286 Advances in rice genetics

elongation. The Jalmagna allele at Qlne1 had a large effect on
plant and internodal elongation in test 1 (13.6 cm, R 2 = 33.8%,
and 8.7 cm, R 2 = 20.1%). In contrast, 23.2 cm (R 2 = 29.6%)
and 18.2 cm (R 2 = 33.1%) elongation were observed in test 2.
Qlne4 was detected only in test 2 and the IR74 allele at this
locus had a very large effect (21.8 cm, R 2 = 36.7%) on elongated
internodes. Qlne2 detected from test 2 and the Jalmagna
allele caused elongation in the internodes. Two main-effect
QTLs affecting leaf elongation, Qlne6 (R 2 = 9.4%) found in
test 1 and Qlne7 (R 2 = 12.0%) detected in test 2, were also
identified. Together, the main-effect and epistatic QTLs explained
most of the total variation observed in internodal and
plant elongation in both tests.
Eleven of Jalmagna’s alleles are present in the 13 genomic
regions that were associated with submergence tolerance;
the other two come from IR74. Seven (on chromosomes
1, 3, 4, 5, and 7) of the 13 submergence tolerance loci were
also found in the QTL regions for plant elongation. The other
six genomic regions on chromosomes 8, 9, 10, 11, and 12 were
associated with submergence tolerance only. Of these, the
marker showing the strongest association with submergence
tolerance was P2M7-4 on chromosome 9, where a major gene
for submergence tolerance, Sub1(t), was previously reported
(Xu and Mackill 1995, Nandi et al 1997). Surprisingly, the
IR74 allele at this locus contributed strongly to submergence
tolerance.
This study pointed to the fact that while adaptation of
Jalmagna to flooding conditions could be attributed to a large
number of loci associated with plant elongation and submergence
tolerance, the differential expression of alleles at three
loci played a key role. These included Qlne1 and Qlne4 that
affect plant height and internodal elongation and Sub(t) on
chromosome 9 that affects submergence tolerance. A third locus
appeared on chromosome 5 that interacted with both Qlne1
and Qlne4. The epistatic relationships among the three loci
need to be understood before they can be effectively transferred
into elite rice lines by marker-assisted breeding.
References
Nandi S, Subudhi PK, Senadhira D, Manigbas NL, Sen-Mandi S,
Huang N. 1997. Mapping QTLs for submergence tolerance in
rice by AFLP analysis and selective genotyping. Mol. Gen.
Genet. 225:1-8.
Saha Ray PK, HilleRisLambers D, Tepora NM. 1994. Genetics of
stem elongation ability in rice (Oryza sativa). Euphytica
74:137-141.
Sripongpankul K. 1998. Gene mapping and quantitative trait loci
analysis of flood tolerance in rice (Oryza sativa). Ph.D. dissertation,
University of the Philippines Los Baños, Laguna,
Philippines. 137 p.
Thach TD. 1994. The genetic association between elongation ability
and submergence tolerance in rice (Oryza sativa). M.S. thesis,
Central Luzon State University, Nueva Ecija, Philippines.
65 p.
Wang DL. 1998. A mixed model approach for mapping QTLs with
epistatic effects. Ph.D. dissertation, Zheijiang Agricultural
University, China.
Xu K, Mackill DJ. 1995. RAPD and RFLP mapping of a submergence
tolerance locus in rice. Rice Genet. Newsl. 12:244-245.
Notes
Authors’ addresses: K. Sripongpankul, Biotechnology Research and
Development Center, Department of Agriculture, Chatuchak,
Bangkok 10900, Thailand; G.B.L. Posa, D. Senadhira, N.
Huang, D.S. Brar, G.S. Khush, and Z. Li, International Rice
Research Institute, DAPO Box 7777, Metro Manila, Philippines.
Acknowledgment: The authors are grateful to the Rockefeller Foundation
for its financial support.
Mapping genes that control traits related to submergence
tolerance in rice
M. Seanglew, A. Vanavichit, S. Tragoonrung, and S. Sarkarung
A linkage map covering the whole rice genome was constructed from 172 recombinant inbred lines (RILs) derived from the
cross between FR13A (submergence-tolerant) and CT6241 (susceptible), using 41 restriction fragment length polymorphisms,
102 simple single length polymorphisms, and one simple sequence cleaved polymorphism (SSCP). Field evaluations of traits
responsive to submergence stresses were performed at Ayuttaya, Thailand, in 1998 and 1999. Twenty-eight-day-old seedlings
of 405 RILs with their parents were submerged in water 100–120 cm deep. Water was drained when the susceptible parent
died. Plants showed slow elongation under water with green leaves after submergence and this was significantly correlated with
plant recovery. QTL analysis showed that major QTLs for plant elongation, leaf-stay-green index, recovery rate, and plant
recovery after submergence were located on chromosome 9, accounting for 9%, 45%, 51%, and 63% of phenotypic variation,
respectively. Secondary QTLs were detected on chromosomes 2 and 7 and can additively enhance the effect of QTL ch9
. The
allele effect showed that faster plant recovery and more vigorous plants were contributed by FR13A. The results showed that
the chromosomal segment close to the marker with the FR13A genotype represented faster plant recovery after submergence,
while the CT6241 genotype showed the opposite.
Molecular markers, QTL mapping, and marker-assisted selection 287

Rice is grown worldwide under a wide range of agroclimatic
conditions. Rice productivity is affected by several biotic (diseases
and insects) and abiotic (unfavorable soil, temperature,
and water conditions) stresses. One of the most important
stresses that affect growth and yield of rice is submergence
under water. More than 30 × 10 6 ha of rainfed lowland rice
areas are affected by flash flooding (Piggin et al 1988). In the
rainfed lowland areas of eastern India, submergence is the third
most serious factor that limits rice production. One such type
of submergence is flash flooding, which affects areas of the
rainfed lowland rice ecosystem (Maurya et al 1988). In this
area, rate of elongation under water of rainfed lowland rice
results in lodging and death of plants after the water recedes.
Hence, plants adapted to these areas must have submergence
tolerance. Wild rice species are an important reservoir of useful
genes in breeding for tolerance for submergence stress. In
this study, recombinant inbred lines (RILs) from the cross between
submergence-tolerant FR13A and submergence-susceptible
CT6241 were used in the construction and mapping of
genes that control submergence tolerance in rice using simple
single length polymorphisms (SSLPs), simple sequence cleaved
polymorphism (SSCP), and restriction fragment length polymorphisms
(RFLPs). Traits related to submergence tolerance
in rice such as leaf-stay-green index, plant recovery, and plant
elongation were used in quantitative trait loci (QTL) mapping.
Materials and methods
RILs consisting of 172 individuals were developed by IRRI
from a cross between indica rice FR13A and japonica rice
CT6241-17-1-5-1. Total genomic DNA of each of the 172 RILs
and their parents was extracted from leaf tissues using the
CTAB-NaCl method.
For RFLP analysis, parental DNA as well as RILs were
digested with seven restriction enzymes (BamHI, BglII, DraI,
EcoRI, EcoRV, HindIII, and XbaI) according to the
manufacturer’s instructions (Boehringer Mannheim). The SSLP
procedure was performed according to Chen et al (1997) and
SSCP was performed.
The RIL population and four check cultivars (FR13A,
IR49830, CT6241, and IR42) were tested for submergence
stress under field conditions at Huntra, Thailand, in 1998. The
172 RILs and checks were also tested at the same place in
1999. A single replication was used in 1998 and two replications
were used in 1999. Individual lines were direct-seeded
in a two-row plot, 75 cm in length and with 25 cm distance
between rows. Checks were systematically seeded every 10
plots. Four weeks after seeding, the experimental crop was
completely submerged. The water level was kept 30 and 60
cm above the tallest entries to prevent their leaf tips from emerging
into the atmosphere in 1998 and 1999, respectively. Dissolved
oxygen concentrations measured at the same period after
3 d of submergence were 5.0–6.3 ppm and 4.8–5.5 ppm at the
crop canopy and soil surface, respectively. Water temperature
was 23–24 °C throughout the experiment. Light transmissions,
dissolved oxygen concentrations, and water temperature were
not measured in 1999.
Traits responsive to submergence stress
Plant elongation. Plant elongation was calculated as the average
of plant height difference before submergence and after
desubmergence. Plant height of 10 randomly selected plants
per genotype was recorded as the distance from the soil surface
to the tip of the longest leaf. Plant elongation was recorded
only in the 1998 RIL experiment.
Leaf-stay-green index. This index is described as the
ability of the leaves to stay green without senescence under
water. It was scored immediately after desubmergence using a
1–5 score on a plot basis. The score was based on the number
of yellow leaves, where 1 = all leaves not senescing and 5 = all
leaves with complete senescence.
Recovery score. Plant recovery is described as the ability
of the plant to overcome submergence stress by regrowing
the plant that was subjected to stress. Recovery was visually
scored after desubmergence at 0, 5, 10, and 15 d for the RIL
population and comparing recovery with that of check cultivars
using a 1–9 scale modified from Suprihatno and Coffman
(1981). The best recovery check, FR13A, had a score of 1.
IR49830 had a score of 2. CT6241 and IR42, the most susceptible
checks, were scored as 9 (completely dead).
Recovery rate. Recovery rate is described as how fast
plants can recover from submergence stress after
desubmergence. Recovery rate was calculated by simple regression
as follows:
Y = a + bX
where Y = recovery score, X = days after desubmergence (5,
10, and 15 d for our scoring and 5, 10, and 14 d for IRRI in
1998, and 3, 5, and 10 d for our scoring in 1999), a = intercept,
and b = recovery rate (slope).
Linkage and QTL analyses
JoinMap software version 2.0 (Stam and Van Ooijen 1995)
was used for linkage map construction. The linkage map was
constructed using 152 markers (41 RFLPs, 102 SSLPs, 1 SSCP,
and 9 bacterial artificial chromosome, BAC, end probes). The
BAC end probes were developed by Kamonsukyunyong
(1999). The final linkage map was calculated using a maximum
recombination frequency (rmax) of 0.50 and an LOD
score of 6.0. The genetic distances (cM) were calculated from
recombination values using the Kosambi function. QTL analysis
was performed with the software package MQTL (Tinker
and Mather 1995). Both simple interval mapping (SIM) and
simplified composite interval mapping (sCIM) techniques were
used for QTL detection. A significant threshold (an LOD score
of 2.4 or above) was used to declare the presence of a QTL. A
single-marker analysis using regression-based software,
Statgraphics 2.1 and ANOVA, was then used to detect the twolocus
interaction of QTLs for the traits responsive to submergence
stress.
288 Advances in rice genetics

RILs
RILs
60
50 FR13A
50 A CT6241
FR13A 40
CT6241 B
40
30
30
20
20
10 10
0 0
1767
27 37 47 57
–6 4 14 24 34 44 54
Plant height before submergence (cm)
Plant elongation (cm)
120
CT6241
100 C
80
60 FR13A
40
20
0
80
60
40
20
0
E
3 4 5
Leaf-stay-green index (1998)
FR13A
CT6241
2 4 6 8
Recovery score (1998)
50
CT6241
40
G
30
20 FR13A
10
0
–0.48 –0.28 –0.08 0.12 0.32
Recovery rate (1998)
120
100
80
60
40
D
FR13A
20
0
3
CT6241
1 2 4 5
Leaf-stay-green index (1999)
CT6241
120
100 F
80
60
40 FR13A
20
0
5 6 7 8 9
Recovery score (1999)
CT6241
100
80
H
60
40 FR13A
20
0
–0.52 –0.32 –0.12 0.08 0.28 0.48
Recovery rate (1999)
Fig. 1. A = frequency distribution
of plant height before submergence
(cm), B = plant elongation
(cm), C = leaf-stay-green index
in 1998, D = leaf-stay-green index
in 1999, E = recovery score
in 1998, F = recovery score in
1999, G = recovery rate in 1998,
and H = recovery rate in 1999
of 172 recombinant inbred lines
(RILs) derived from FR13A/
CT6241.
Results and discussion
Phenotypic distribution in submergence tolerance
Phenotypic distribution of all traits measured in both years
supported a major gene with other modifying effects or quantitative
modes of inheritance. The phenotypic distribution of
all the traits studied did not show discrete classes for Mendelian
analysis (Fig. 1). There were transgressive segregants that
elongate faster than CT6241. Segregation for leaf-stay-green
index favored more senescent and less vigorous plants. Plant
recovery showed quantitative distribution. The recovery rates
of tolerant and intolerant parents in 1998 were 0.45 and 0.06
score unit per day, respectively; the respective rates were 0.48
and 0.05 in 1999. Recovery rate was positively correlated with
leaf-stay-green index, recovery score, and plant elongation.
Linkage map construction and QTL analysis
Sixty percent of the 243 markers showing polymorphism between
the parents were used to screen for segregation in the
172 individuals in the RIL population. The 153-marker framework
map encompasses a total genetic distance of 1,217.7 cM
(Fig. 2). Fifty-two percent of the markers were significantly
distorted randomly from the expected 1:1 ratio (P

Chr 1 Chr 2
Chr 3 Chr 4
cM
C161
6.6
4.0
RM84 5.7 OSR1 0.9 RM251
OSR15
1.0
RM1 9.8 RM233F
1.1 RM7
R1944 9.9 RM233
5.5 RM232 19.4
2.9
10.9 RM233
OSR13
OSR16 1.2 RM241
20.6
RM53
RM252
3.5
10.0
2.5
7.1
4.3
6.3
1.6
5.8
0.5
2.5
4.6
2.2
5.3
7.9
RM243
RM35
R210
RM23
RM24
R1928
RM5
RM9
RM237
C122
RM246A
OSR27
RM212
C86
R2414
40.5
25.6
11.6
13.9
9.0
2.7
2.0
2.3
11.5
3.3
RM29
RM262
C49
RM221
RM240
RM6
RM250A
C56
RM208
RM48
58.2
11.3
14.5
RM16
R250
RM55
15.1
32.1
3.5
11.5
RM246B
RM261
R288
R2373
Chr 5
8.3
8.5
5.9
9.0
5.5
1.9
5.6
17.6
35.3
55.3
RM31
RM26
C1018
RM233B
R1553
RM164
R2289
R372
RM249
RM13
OSR34
12.8
0.0
2.9
7.1
9.3
12.2
17.6
50.8
Chr 6
R2869
RM204
RM225
RM217
RM253
R2147
R2171
RM3
C358
1.3
32.3
12.2
2.9
4.4
1.2
2.9
8.0
2.4
23.8
Chr 7Chr 8 Chr 9
Chr 10 Chr 11 Chr 12
C213
RM248
RM234
RM10
OSR4
C451
RM11
OSR22
RM214
RM2
C1057
17.3
4.5
1.7
4.9
2.9
9.9
9.0
1.8
10.0
19.5
13.1
5.6
R1963
RM230
OSR7
RM80
RM256
RM210
RM42
RM44
RM223
RM25
OSR30
RM250B
OSR35
2.2
0.7
5.8
3.5
3.5
1.1
10.7
4.5
36.8
0.0
1.2
5.9
7.4
0.6
0.0
0.0
0.0
0.0
1.9
0.0
0.0
0.0
0.0
0.0
0.0
0.0
1.0
0.7
RM205
OSR12
RM245
RM215
RM201
OSR28
OSR29
RM242
RM257
R79
RZ206
G103
C1454
RM219
u
RZ698
ag
ad
v
YAC30L
x
aa
SSC1
R1164
g
b
S10709
RG757
G36
13.4
2.8
6.0
30.1
7.9
6.9
RM228
R1877
OSR33
RM258
R1629
RM216
RM222
= QTL
6.8
9.0
13.8
12.7
8.1
2.2
9.3
6.8
25.4
1.4
1.3
10.6
C950
RM224
RM254
RM206
RM21 15.9
RM229
RM209
18.2
C3
RM202 0.5
12.5
1.6
RM4A
RM4B
RM20B
OSR1
1.9
1.1
1.7
27.7
RM12
RM17
C901
RM235
C449
OSR32
RM247
G24B
R642
RM20A
Fig. 2. Linkage maps based on 172 recombinant inbred (RI) progenies from the cross FR13A/T6241. Marker
loci are indicated on the right side of each linkage group, distance expressed in Kosambi cM units. Designations
RG and RZ are for restriction fragment length polymorphism (RFLP) markers by Cornell University, USA.
R, G, C, and s were for RFLP markers provided by the Rice Genome Project, Japan. OSR and RM were for
simple single length polymorphism (SSLP) markers from the Rice Genome Project, Japan, and Cornell University,
USA. The double line indicates large gaps.
290 Advances in rice genetics

covery rate, and plant elongation were all scored. The results
supported the finding that QTL ch9 had the highest PVE. Furthermore,
QTL ch9 was the only QTL detected for the second
round of phenotyping test as the major gene. It was the only
QTL detected since the plants became too stressed after submerging
them for a long time. Minor QTLs were detected on
chromosomes 2 (QTL ch2 ) and 7 (QTL ch7 ). Both loci combined
had less than 15% PVE compared with 60–70% observed with
QTL ch9 . The multiloci model revealed that both minor QTLs
had little effect on the major QTL ch9 . These minor QTLs could
be partial duplicates of QTL ch9 . This hypothesis was supported
in the two-locus interaction analysis. By comparing four group
means of all responsive traits, replacing FR13A alleles with
CT alleles at the minor QTLs will not be better than having
three FR13A alleles. A specific interaction was observed after
desubmergence. The FR allele of QTL ch2 played a role in the
first few days after desubmergence, but this was slowly minimized
a few days later when QTL ch7 gained more importance.
Breeding for greater tolerance for submergence stresses must
consider not only QTL ch9 but also the two minor QTLs.
QTL × QTL interaction
The ANOVA and multiple regression of QTL ch2 × QTL ch9 and
QTL ch7 × QTL ch9 interactions were significant for all responsive
traits. FR13A, the tolerant parent, contributed tolerance
alleles for all QTLs. The means of responsive traits for C QTLch2
× F QTLch9 and C QTLch7 × F QTLch9 phenotypes showed intermediate
tolerance, while F QTLch2 × F QTLch9 and F QTLch7 × F QTLch9
showed the highest tolerance for submergence. F QTLch2 ×
C QTLch9 and F QTLch7 × C QTLch9 showed the highest susceptibility
to submergence stress. The mean values of four allelic compositions
at these QTLs illustrated that QTL ch9 was the major
QTL for response to submergence stress. In nearly every case,
progenies carrying QTL ch7 and QTL ch2 could additively enhance
the effect of QTL ch9 . Graphical genotyping analysis also
proved that the region of chromosome 9 containing the QTL
for submergence tolerance is the most important segment of
the genome for the expression of this trait (data not shown).
References
Chen X, Temnykh S, Xu Y, Cho YG, McCouch SR. 1997. Development
of a microsatellite framework map providing genomewide
coverage in rice (Oryza sativa L.). Theor. Appl. Genet.
95:553-567.
Kamonsukyunyong W. 1999. Construction of physical map using
BAC: submergence tolerance QTL as a model. MS thesis,
Kasetsart University, Bangkok, Thailand.
Maurya DM, Bottrall A, Farrington J. 1988. Improved livelihoods,
genetic diversity and farmer participation: a strategy for rice
breeding in rainfed areas of India. Exp. Agric. 24:311-320.
Nandi S, Subudhi PK, Senadhira D, Manigbas NL, Sen-Mandi S,
Huang N. 1997. Mapping QTLs for submergence tolerance in
rice by AFLP and selective genotyping. Mol. Gen. Genet.
255:1-8.
Piggin C, Bhuiyan S, Ito O, Kam S, Kirk G, Ladha JK, McLaren G,
Moody K, Mortimer M, Nelson R, Pandey S, Paris T, Reichardt
W, Sarkarung S, Setter T, Singh RK, Singh VP, Trebuil G,
Tuong T, Wade L, Zeigler R. 1988. The IRRI Rainfed Lowland
Rice Research Program: directions and achievements.
Manila (Philippines): IRRI. 98 p.
Stam P, Van Ooijen JW. 1995. JoinMap Version 2.0: software for
the calculation of genetic linkage maps. CPRO-DLO,
Wageningen, The Netherlands. 58 p.
Suprihatno B, Coffman WR. 1981. Inheritance of submergence tolerance
in rice (Oryza sativa L.). SABRAO J. 13:98-108.
Tinker NA, Mather DE. 1995. MQTL: software for simplified composite
interval mapping of QTL in multiple environments. J
QTL. Available at http://probe.nalusda.gov:8000/otherdocs/
jqtl/1995-02. 25 November 1998.
Xu K, Mackill DJ. 1996. A major locus for submergence tolerance
mapped on rice chromosome 9. Mol. Breed. 2:219-224.
Notes
Authors’ addresses: M. Seanglew, A. Vanavichit, S. Tragoonrung,
DNA Technology Laboratory, Kasetsart University,
Kamphangsaen Campus, Nakorn Pathom 73140, Thailand; S.
Sarkarung, International Rice Research Institute, DAPO Box
7777, Metro Manila, Philippines.
Identifying QTLs for cold tolerance–related traits
in a Korean weedy rice
J.P. Suh, S.N. Ahn, H.S. Suh, H.P. Moon, and H.C. Choi
Molecular markers were used to locate quantitative trait loci (QTLs) for traits related to cold tolerance in an intrasubspecific
backcross of rice. A cross was made between cold-susceptible Tongil-type cultivar Milyang23 and cold-tolerant Korean japonica
weedy accession Hapcheonaengmi 3. A total of 98 BC 1
plants derived from a Milyang23/Hapcheonaengmi 3//Milyang23 cross
were evaluated for four traits: germination at 15 °C, seedling height, and cold injury at the plumule and seedling stages. A
linkage map was constructed using 2 morphological, 2 isozyme, 11 RFLP, 57 RAPD, 18 OSR, and 72 microsatellite markers
that spanned 1,733 cM of the rice genome, with an average interval length of 10.7 cM. Interval analysis identified a minimum
of 13 QTLs for 4 traits, with a range of 3–4 QTLs detected per trait. The direction of the additive gene effect coincided with that
predicted by phenotypes of the parents except for one on chromosome 6 related to germination at low temperature. The
percentage of phenotypic variation associated with single QTLs ranged from 9.3% to 18.6%. Multilocus analysis showed that
Molecular markers, QTL mapping, and marker-assisted selection 291

the cumulative action of all QTLs detected for each trait accounted for 31.8–38.1% of the phenotypic variation. Digenic
epistasis was not detected. Several regions of the genome showed effects on more than one trait. The identification of QTLs for
low-temperature germinability and cold tolerance at the early growth stage would be useful in making effective selection for
breeding cold-tolerant rice varieties.
Weedy rice possesses useful genes for tolerance for a wide
range of adverse conditions because it is successfully adapted
to grow under such natural conditions (Suh and Ha 1993).
Furthermore, no sterility problem is encountered when it is
crossed with elite cultivars because it is genetically more similar
to the elite cultivar than to wild rice (Suh et al 1997). Tolerance
for low temperature during different stages of rice growth
from germination to the seedling stage, early growth, and booting
and heading stages is an important feature required for
yield in cold rice-growing regions. Particularly in direct seeding
in the cool part of Korea, germination and early growth of
seedlings take place under relatively low-temperature conditions.
It is thus necessary to improve tolerance for low-temperature
stress of varieties during those stages. Molecular
marker technology has facilitated investigation of the inheritance
and identification of QTLs underlying cold tolerance. This
study was conducted to identify and characterize QTLs associated
with cold tolerance using a backcross population
(Milyang23/ Hapcheonaengmi 3//Milyang23).
Materials and methods
Cold-tolerant japonica weedy accession Hapcheonaengmi 3
was crossed as the male to cold-susceptible Tongil-type variety
Milyang23. F 1 plants were backcrossed to Milyang23.
Ninety-eight BC 1 plants were produced and field-grown individually
to produce BC 1 F 2 seeds for the cold tolerance test:
germinability at low temperature (15 °C for 30 d), seedling
height at low temperature (15 °C for 35 d), cold tolerance at
the plumule stage (4 °C for 5 d followed by 30 °C for 5 d), and
cold tolerance at the seedling stage (5 °C for 3 d followed by
30 °C treatment for 7 d). DNA was extracted from the fresh
leaves of BC 1 plants. The procedures used for the random
amplified polymorphic DNA (RAPD) and simple sequence
length polymorphism (SSLP) assay were as described in Suh
et al (1999) and Panaud et al (1996), respectively. Restriction
fragment length polymorphism (RFLP) genotypes were determined
as described in Suh et al (1999). The Mapmaker program
was used to establish a molecular map at a minimum
LOD value of 3.0 and map distance was expressed in Kosambi
centiMorgans. Statistical analyses were performed using qGene
and Data Desk 4.0. An LOD score of 2.0 was used as the threshold
for detecting QTL locations in the qGene program. The
total phenotypic variance explained was estimated by fitting a
model including all putative QTLs for the respective trait simultaneously.
Results and discussion
A total of 162 markers, including morphological, isozyme,
RFLP, RAPD, and microsatellite markers, were used to construct
a linkage map spanning 1,733 cM, with an average interval
size of 10.7 cM (Fig. 1). The order of SSR markers was
in good agreement with that of the map reported by Chen et al
(1997) except that RM208 and RM207, RM7 and RM251,
and OSR28 and OSR29 on chromosomes 2, 3, and 9 showed
cosegregation in this population (Fig. 1). Deviation from the
expected 1:1 segregation ratio was significant for the 19 mark-
cM
0
25
50
75
100
125
150
175
200
225
250
275
qLTS-1
1 2 3 4 5 56
OPWO2a
OPU06
RM22* qCTP-4 RM252 OPR06
OSR11
RM231
qLTG-5 RM249
OPNO9
OSR14
RM241
RG13
RM1
qLTS-2
RM233A RG226a*
RM255
OPG07
OPG18
RM211
RG391
OSR15
qLTG-6
OSR08
RM36*
qCTS-6
RM243
OPC06a
RM31
RM7*, RM251*
OPE19c
RM23
RM29*
OPJ18*
RZ744
OPA19
RM16*
RM5
OPQ05*
RM237
OPH07c
OPC06b
OSR31
OPK17
RM221
RG957
OPB07b
OPWO2b
RM250
Pgl 1
OPBO7b
RM208
OPE19e
OPL03
OPBO4
RM207
OSR23
RM50
RM204*
RM217
C
RG226b
OPU09
OPB05
RM3
OPE14
qCTP-7
78 9 10 11 12
RM51
OSR30
RM219
URP4Rb
OSR01
OPE19b
RM25
qLTS-10
RM222
RM20B
RG418
qLTS-9 OPN04a
OPN12b
RG128
OPV07
OPB06
OPC13 qLTG-11 RM167
RM82*
OPG13a
OPC07b
OPC07a
Rc
OPE02c
RM216
OPH07b
OPN12a
OPA08
OPU13
URP4Rc
qCTS-9
OPF01
OPW02c
OPN14
OSR04
RM42
RM257
OPN10a qCTS-11
OPW02e
RM258
OPD08
RM10
RM223
OSR29 qCTP-10
RM202
RM70
OSR07
OSR28
RM228
OPH02a
RM248
OPWO2d
RM215
OPT03
RM206
RZ66
RM245
RM224
RZ404
RM205
OPE07
RM247
OPF16
RG4
RM235
OPE02a
Acp 1
Fig. 1. An integrated map
based on isozyme, RFLP,
RAPD, and SSLP markers.
Marker identification is indicated
to the right of the columns;
map distance (to the
left of the map) is given in cM
(Kosambi function). QTLs are
given at the left side of the
columns. Skewed markers
(P

Frequency
(Mean ± SD)
Milyang23: (15 ± 1.3)
Hapcheonaengmi 3: (49 ± 8.2)
BC
20 1 F 1 population: (53.3 ± 24.4)
15
10
5
0 5 25 45 65 85
15 35 55 75
Germinability (%)
20
15
10
5
0
(Mean ± SD)
Milyang23: (2.3 ± 0.1)
Hapcheonaengmi 3: (7.2 ± 0.6)
BC 1 F 1 population: (4.5 ± 1.2)
95
2.5 3.5 4.5 5.5 6.5
3.0 4.0 5.0 6.0 7.0
Seedling elongation (cm)
50
40
30
20
10
0
(Mean ± SD)
Milyang23: (4.5 ± 0.3)
Hapcheonaengmi 3: (1.1 ± 0.1)
BC 1 F 1 population: (3.6 ± 0.8)
0.5 1.5 2.5 3.5 4.5
Plumule cold tolerance (ºC)
25
20
15
10
5
0
(Mean ± SD)
Milyang23: (8.6 ± 0.5)
Hapcheonaengmi 3: (1.6 ± 0.7)
BC 1 F 1 population: (5.7 ± 2.0)
0.5 2.5 4.5 6.5 8.5
1.5 3.5 5.5 7.5 7.0
Seedling cold tolerance (ºC)
Fig. 2. Frequency distributions of cold
tolerance–related traits in the BC 1
population. The value on the x-axis is
the mid-value of each group.
ers, and 15 and 4 were skewed in favor of Milyang23 and
Hapcheonaengmi 3 alleles, respectively (Fig. 1).
Figure 2 shows the frequency distribution of phenotypes
for four traits in the BC 1 F 2 families. Distribution of four traits
of the BC 1 F 2 lines was intermediate between that of parental
varieties except for low-temperature germinability. Transgressive
segregants were observed for germinability at low temperature.
Sixty percent of the BC 1 F 2 families outperformed
Hapcheonaengmi 3 in germinability at low temperature.
Three putative QTLs affecting germinability at low temperature
were detected on chromosomes 5, 6, and 11. Phenotypic
variation explained by the individual QTLs ranged from
11.4% to 18.6%, or 37.9% of the total phenotypic variation in
the backcross population. The Hapcheonaengmi 3 allele decreased
the germination rate at the QTL on chromosome 6.
No significant interactions among three QTLs were observed.
Four putative QTLs affecting seedling height at low temperature
were detected on chromosomes 1, 2, 9, and 10. Phenotypic
variation explained by the individual QTLs ranged from
9.3% to 14.6%, or 38.1% of the total phenotypic variation.
Three putative QTLs affecting plumule cold tolerance were
detected on chromosomes 4, 7, and 10. Phenotypic variation
explained by the individual QTLs ranged from 9.5% to 17.0%,
or 31.8% of the total phenotypic variation. Three QTLs affecting
seedling cold tolerance were detected on chromosomes
6, 9, and 11, accounting for 33.6% of the total phenotypic variation,
with each QTL explaining from 10.2% to 18.2%.
This study identified a minimum of 13 significant QTLs
for four traits, with three to four QTLs per trait. The direction
of the additive gene effect coincided with that predicted by the
phenotypes of the parents, except for one on chromosome 6
related to germinability at low temperature. This finding demonstrates
the ability of marker analysis to uncover cryptic genetic
variation that otherwise would have been masked by the
large differences between parents. A similar trend has been
reported for many other traits in various species (de Vicente
and Tanksley 1993, Xiao et al 1998). The presence of favorable
QTL alleles in both parents offers a good opportunity for
recovering transgressive segregants and provides a new combination
of novel alleles for breeding.
The QTLs underlying low-temperature germinability and
cold tolerance at the early growth stage identified in this study
would be useful for selecting lines with enhanced germinability
and cold tolerance at low temperatures.
References
Chen X, Temnykh S, Xu Y, Cho YG, McCouch SR. 1997. Development
of a microsatellite framework map providing genomewide
coverage in rice (Oryza sativa L.). Theor. Appl. Genet.
95:553-567.
de Vicente MC, Tanksley SD. 1993. QTL analysis of transgressive
segregation in an interspecific tomato cross. Genetics 143:585-
596.
Panaud O, Chen X, McCouch SR. 1996. Development of
microsatellite markers and characterization of simple sequence
length polymorphism (SSLP) in rice (Oryza sativa L.). Mol.
Gen. Genet. 252:597-607.
Suh HS, Ha WG. 1993. Collection and evaluation of Korean red
rices. V. Germination characteristics on different water and
soil depth. Korean J. Crop Sci. 38(2):128-133.
Suh HS, Sato YI, Morishima H. 1997. Genetic characterization of
weedy rice (Oryza sativa L.) based on morphophysiology,
isozymes and RAPD markers. Theor. Appl. Genet. 94:316-
321.
Molecular markers, QTL mapping, and marker-assisted selection 293

Suh JP, Ahn SN, Moon HP, Suh HS. 1999. QTL analysis of low
temperature germinability in a weedy rice. Korean J. Breed.
31(3):261-267.
Xiao J, Li J, Grandillo SG, Ahn SN, Yuan L, Tanksley SD, McCouch
SR. 1998. Identification of trait-improving quantitative trait
loci alleles from a wild rice relative, Oryza rufipogon. Genetics
150:899-909.
Notes
Authors’ addresses: J.P Suh, H.S. Suh Department of Agronomy,
Yeungnam University, Kyongsan 712-749; S.N. Ahn, Department
of Agronomy, Chungnam National University, Taejon
305-333; H.P. Moon, National Yeongnam Agricultural Experiment
Station, RDA, Milyang 627-130; H.C. Choi, National
Crop Experiment Station, RDA, Suwon 441-100, Korea.
Mapping QTLs for salt tolerance in rice
Nguyen Thi Lang, S. Masood, S. Yanagihara, and Bui Chi Buu
One hundred eight F 8
recombinant inbred lines (RILs) derived from the cross Tesanai 2/CB were evaluated. These RILs were
evaluated for seedling survival day (SD), dry root weight (Rt.wt), dry shoot weight (St.wt), Na + and K + content, and Na + /K + ratio
in culture solution (EC = 12 dS m –1 ). A linkage map was constructed using 108 RFLP markers and SSR markers covering
2,340.50 cM, with an average interval of 21.68 cM between marker loci. Markers associated with salt tolerance were located
on chromosomes 1, 2, 3, 9, 11, and 12. Several QTLs were identified: four for SD, one for dry shoot weight, two for dry root
weight, one for Na + absorption, one for K + absorption, and four for Na + /K + ratio. The proportion of phenotypic variation
explained by each QTL ranged from 5.2% to 11.6% for SD, and from 4.8% to 14.4% for morphological characters and Na + and
K + accumulation. Common QTLs were observed on chromosomes 3 and 9 for quantitative traits (SD and Rt.wt, and SD and
Na + /K + ). Common QTLs were also detected on chromosome 12 for Na + /K + and K + content.
Salt-tolerant varieties have generally been considered as the
most economical and effective way of increasing crop production
in saline soils. Efforts have been made to identify a parameter
that could be used as the criterion for mass screening.
Parameters generally proposed are leaf injury rate at the seedling
stage, sterility after heading, and Na + /K + ratio in the shoots
under saline conditions (Buu et al 1995). Selection efficiency
for salinity tolerance under field conditions remains very low
because of stress of heterogeneity and the presence of other
soil-related stresses. Two or more genes (quantitative) govern
salt tolerance that significantly interact with the environment.
Recent technical DNA marker technology has led to the molecular
dissection of complex traits. Using an F 6 recombinant
inbred line (RIL) population from the cross Tesanai 2/CB, one
QTL from the trait survival day for salt tolerance was detected
on chromosome 5 (Lin 1995). Another QTL was also detected
on chromosome 10 for salt tolerance in the same cross (Shahid
1997).
We investigated the genetic basis of salinity tolerance
and mapped QTLs for salt tolerance using microsatellite and
restriction fragment length polymorphism (RFLP) markers in
RILs produced from a cross between Tesanai 2 from China
and CB from the United States.
Materials and methods
F 8 RILs developed through single-seed descent (SSD) using
the rapid generation advance (RGA) method were used to map
salt tolerance in rice. The population of 108 RILs was derived
from a cross between Tesanai 2 from China and CB from the
U.S.
Sterilized seeds were placed in petri dishes with moistened
filter papers and incubated at 30 °C for 48 h to germinate.
Two pregerminated seeds per hole on the styrofoam seedling
float were selected. Three days after seedlings were well
established, distilled water was replaced by salinization nutrient
solution (Yoshida et al 1976). Initial salinity was at EC = 6
dS m –1 . Three days later, salinity was increased to 12 dS m –1
by adding NaCl to the nutrient solution. The solution was renewed
every 8 d and pH was maintained at 5.0 daily. A seedling
that was completely yellow with no green tissue evident
was considered dead. Plant survival day was recorded in days
from seeding to death.
Shoot and root samples were collected after 2 wk of salinization,
dried at 70 °C for 2 d, and weighed. Each plant sample
was ground in a mortar with 25 mL of 1N HCl and left to stand
at room temperature for 24 h, then briefly shaken and filtered.
K + and Na + standards were prepared by dilution from the 1,000-
ppm stock solution according to standard procedures (Yoshida
et al 1976). Na + and K + were determined by atomic absorption
spectrophotometer.
Five grams of leaf tissue were ground in liquid nitrogen,
then a 20-mL extraction buffer was added and vigorously
mixed. DNA checking for quality and concentration was undertaken
by restriction digestion with EcoRI. The mixture was
then electrophoresed in agarose gel with standard DNA.
Genomic DNA was digested with EcoRI, EcoRIV, and
HindIII overnight, and then electrophoresed on 0.8% agarose
294 Advances in rice genetics

gel. Southern blotting was carried out to transfer digested DNA
onto a Hybond N + membrane. The probes were amplified by
PCR and labeled with HRP (horseradish peroxidase) by using
the ECL direct nucleic acid-labeling and detection systems kit
(Amersham Life Science). The membranes were hybridized
with HRP-labeled probes, detected by chemiluminescence, and
autoradiographed on X-ray film for 2 h.
PCR amplification was performed in 10 mM Tris-HCl
(pH 8.3), 50 mM KCl, 1.5 mM MgCl 2 , 1 unit of TAKARA
Taq, 4 nmol dNTP, 10 pmol primer, with 30 ng genomic DNA
per 25 µL using a thermal cycler 9600 (Perkin-Elmer). The
PCRs were denatured at 95 °C for 4 min, followed by 35 cycles
of 94 °C for 45 sec, 55 °C for 30 sec, and 72 °C for 60 sec. The
final extension was at 72 °C for 5 min. After PCR, 13 µL of
loading buffer (98% formamide, 10 mm EDTA, 0.025% bromophenol
blue, and 0.025% xylene cyanol) were added. Polymorphisms
in the PCR products were detected by ethidium
bromide staining after electrophoresis on 5% agarose gel.
The program MapMaker was used to establish the
microsatellite and RFLP map. Marker order and map distances
were derived using the RI algorithm of MapMaker version 3.0.
Map distances were estimated using the Kosambi function
(Kosambi 1944). Linkage group was reconfirmed using the
group command with an LOD score of 3.0 and recombination
fraction = 0.4. Ripple command was used to verify the order
of the marker on each chromosome.
QTL analysis was performed with the software package
Q-gene 1994 from Cornell University and MapL from Japan.
Q-gene was used to find the location of major and minor genes.
QTL detection was performed by single-marker analysis (SMA)
and interval mapping (IM). One-way analysis of variance
(ANOVA) was performed for each single marker and each
combination of two markers to be identified as putatively associated
with salt tolerance (this was done to confirm the association
between the marker and salt tolerance loci). The
threshold for declaring a QTL for salinity tolerance was
LOD>3. All markers were tested for the expected 1:1 ratio. To
identify the mode of inheritance, reexamination of putative
QTL regions was carried out by three genetic components—
dominant, recessive, and additive—with Q-gene software.
Likelihood ratios (LRs) were calculated at 1-cM intervals along
the mapped genome. The proportion of phenotypic variation
explained by the significant marker was estimated as a coefficient
of determination (R 2 ) for the single-locus model.
Results and discussion
Figure 1 shows that the distribution of phenotypic salinity reaction
among the RILs was continuous, indicating a good recombination
for salinity reaction in the population. For dry
shoot weight (St.wt) and dry root weight (Rt.wt), large differences
were noted in the population. St.wt ranged from 45 to
110 mg and from 200 to 350 mg for Rt.wt.
Tolerant rice cultivars decreased Na + toxicity by maintaining
a high level of K + . Salinity tolerance (low Na + /K + ratio
in the shoot) is governed by both additive and dominant gene
effects (Gregorio and Senadhira 1993). The trait exhibited overdominance
and is controlled by at least two groups of genes
that exhibit dominance. The first group may control Na + exclusion
and the other K + absorption. The Na + /K + ratio in the
shoot of the tolerant genotypes was greater than in the sensitive
genotypes under salinization. Tesanai 2 (tolerant parent)
maintained a higher level of K + than CB (susceptible) and the
Na + /K + ratio in the shoot of Tesanai 2 was greater than in CB.
Seventy-four RFLP markers showed polymorphism between
the two parents. Fourteen simple sequence repeat (SSR)
primers showed no amplification, whereas 26 were monomorphic.
Among 31 polymorphic SSR markers, 35% were from
CB and the other 65% were from Tesanai 2. Amplified fragments
ranged in size from 95 to 220 bp for all primers used in
the analysis.
Of the 74 markers surveyed, 42 marker loci (56.75%)
significantly deviated from the 1:1 segregation ratio. All these
markers showed deviation toward Tesanai 2 alleles, with the
exception of one marker on chromosome 12 that deviated toward
CB alleles. Among 32 other markers that were not significantly
deviated, 26 loci (81.25%) were skewed in favor of
the Tesanai 2 allele, whereas 18.8% were skewed in favor of
CB alleles.
Genomic DNA from the 108 F 8 RILs of the cross between
the salt-tolerant (Tesanai 2) and susceptible (CB) varieties
was amplified with 31 primers, and banding patterns were
scored with reference to those of the parents. Banding patterns
of F 8 individuals could be classified either as homozygous
for the Tesanai 2-type marker or homozygote for the CBtype
marker. Among the SSR bands scored, 65% originated
from Tesanai 2, whereas 35% were from CB. Most of the markers
followed Mendelian segregation. From these markers, 13
were biased toward CB and 14 toward Tesanai 2.
Linkage analysis was performed with microsatellite and
RFLP mapping data using MapMaker version 3.0.
A molecular map was constructed according to published
microsatellites from Cornell University and RFLPs from Japan.
Figure 1 shows the linkage map for 74 RFLP and 31 SSR
markers.
Table 1 shows the results of one-way ANOVA. The association
among the indices of survival days of C711, C1454,
R3156, R1751, C560, C747, R26, and C178 was significant
(P

33.0
16.5
9.0
6.9
28.8
13.6
7.7
19.8
1.6
19.5
25.9
48.8
64.1
(1) RM212
(2) C86
(3) R2417
(4) C1370
(5) RM237
(6) C955
(7) C178
(8) R210
(9) RM220
(10) RM81A
(11) RM24
(12) C122
(13) C970
(14) C112
45.3
0.5
60.8
15.7
11.9
68.1
7.2
39.2
2.8
2.8
9.4
49.8
(15) RM240
(16) R1843
(17) R2510
(18) R26
(19) C560
(20) C747
(21) RM211
(22) RM233
(23) RM234
(24) RM207
(25) RM208
(26) RM213
43.0
4.0
48.4
9.4
14.5
38.2
16.3
13.6
5.3
33.1
Chr 3
(28) C1488
(29) RM227
(30) RM231
(31) R250
(32) C746
(33) R19
(34) C515
(35) R2170
(36) C63
(37) C563
(38) R3156
58.2
36.8
33.1
25.7
Chr 4
(39) C891
(40) R2373
(41) C734
(42) C445
(43) C1016
Chr 1
(27) G227
Chr 2
36.7
9.0
12.0
51.6
Chr 5
(44) R521
(45) R2558
(46) R372
(47) R2289
(48) RM31
12.6
7.7
32.6
20.1
19.0
17.8
37.7
18.3
Chr 6
(49) R2147
(50) R2171
(51) R2123
(52) R1962
(53) RM225
(54) RM217
(55) RM204
(56) C358
(57) R1167
32.6
13.9
17.1
37.7
2.7
Chr 7
(58) C39
(59) R3089
(60) R1440
(61) RM214
(62) R1789
(63) C596
12.6
27.5
36.3
10.2
27.0
11.3
2.1
54.0
Chr 8
(64) RM25
(65) RM223
(66) RM210
(67) C347
(68) G1073
(69) R2662
(70) R1963
(71) C1121
(72) R902
22.1
18.4
11.2
12.1
14.5
39.9
19.5
16.1
8.4
16.2
Chr 9
Surviving days)
Na +
(73) C506
(74) RM215
(75) RM201
(76) RM205
(77) RM219
(78) RM242
(79) C711
(80) C1454
(81) C397
(82) R1751
(83) R2638
Shoot wt.
K +
42.9
51.3
44.1
18.2
Root wt.
Na + /K + ratio
Chr 10
(84) RM216
(85) R2174
(86) RM228
(87) R716
(88) C1286
58.9
36.8
27.5
34.5
19.1
30.2
11.6
16.4
23.6
5.0
(89) R728
(90) RM224
(91) RM202
(92) RM206
(93) RM209
(94) G257
(95) G320
(96) C535
(97) C477
(98)
(99)
C1506
C950
14.9
3.3
5.0
12.3
87.5
11.3
28.1
Chr 12
(101) RM235
(102) C901
(103) C443
(104) R1684
(105) G24
(106) R3375
(107) G2140
(108) R642
50.3
(100) C50
Fig. 1. QTLs mapped for salinity tolerance of related traits from F 8 RILs from a cross between Tesanai 2 (salt-tolerant) and CB (saltsensitive).
Chr 11
296 Advances in rice genetics

Table 1. QTLs identified by single-marker analysis for seedling survival after salt stress.
Marker Chromosome Group Allelic F- P- R 2 DPE a
mean ± SE value value (%)
C711 9 P1 28.79 ± 0.26 7.54 0.0080 11.5 T
P2 25.64 ± 0.77
C1454 9 P1 28.79 ± 0.36 5.53 0.0235 11.6 T
P2 23.22 ± 0.00
R3156 3 P1 28.30 ± 0.28 5.30 0.0250 8.5 C
P2 30.90 ± 1.21
R1751 9 P1 28.92 ± 0.28 5.60 0.0277 6.9 T
P2 27.63 ± 0.60
C560 2 P1 28.38 ± 0.25 4.92 0.0298 6.6 C
P2 31.60 ± 1.56
C747 2 P1 28.22 ± 0.30 4.38 0.0402 6.1 C
P2 29.60 ± 0.60
R26 2 P1 28.46 ± 0.25 4.12 0.0450 5.2 C
P2 31.06 ± 1.60
C178 1 P1 28.84 ± 0.26 3.98 0.0500 5.8 T
P2 26.66 ± 1.61
a DPE = direction of phenotypic effect; indicates whether the parent alleles appear to increase the trait. T = Tesanai 2, C =
CB. R 2 in ANOVA.
Table 2. QTLs identified by single-marker analysis for salinity-tolerance-related traits (St.wt, Rt.wt, Na + , K + ,
Na + /K + ratio) in rice.
Trait Marker Chromosome Group Allelic F- P- R 2 DPE a
mean ± SE value value (%)
St.wt RM209 11 P1 284.5 ± 6.53 9.24 0.0036 14.38 T
P2 220.0 ± 8.54
R3156 3 P1 72.4 ± 2.04 5.87 0.018 9.34 C
P2 92.0 ± 4.98
Rt.wt C563 3 P1 73.0 ± 1.86 5.23 0.025 6.95 C
P2 87.5 ± 5.34
C397 9 P1 77.3 ± 2.04 4.00 0.050 6.35 T
P2 61.8 ± 2.60
RM240 2 P1 0.43 ± 0.01 5.21 0.025 7.22 C
Na + P2 0.48 ± 0.01
R1167 6 P1 0.44 ± 0.01 3.68 0.050 4.35 C
P2 0.55 ± 0.01
K + G24 12 P1 0.73 ± 0.02 10.57 0.002 17.45 C
P2 0.97 ± 0.11
C86 1 P1 0.57 ± 0.02 5.03 0.029 9.14 C
P2 0.73 ± 0.04
G24 12 P1 0.61 ± 0.02 4.83 0.032 8.81 T
Na + /K + P2 0.45 ± 0.07
RM214 7 P1 0.59 ± 0.02 3.86 0.050 5.86 C
P2 0.81 ± 0.06
C747 2 P1 0.62 ± 0.02 3.71 0.050 5.25 T
P2 0.54 ± 0.04
a DPE = direction of phenotypic effect; indicates whether the parent alleles appear to increase the trait. T = Tesanai 2, C = CB. R 2 in
ANOVA.
dry shoot weight. The observed phenotypic variation explained
14.37% on chromosome 11. Compared with interval analysis,
only one significant interaction was detected between RM209
and RM206. The alleles from Tesanai 2 showed an increase in
dry shoot weight.
Three markers—R3156, C563, and C397—were detected
to be linked to root weight on chromosomes 3 and 9.
They explained 9.34%, 6.95%, and 6.35% of the phenotypic
variation, respectively. Interval analysis was simultaneously
analyzed for effect on quantitative traits. Overlapping significant
markers for Rt.wt were found on chromosome 3 (Table
2).
One-way ANOVA demonstrated that RM240 (chr. 2) and
R1167 (chr. 6) were linked to the quantitative loci associated
with Na + absorption (Table 2). For Na + absorption, the markers
explained 7.22%, and 4.35% of the phenotypic variation,
Molecular markers, QTL mapping, and marker-assisted selection 297

espectively. However, only one significant interaction was
detected between RM240 and R1843 in interval analysis. The
alleles from CB showed an increase in Na + .
For K + absorption, one QTL was detected on chromosome
12, which explains 17.45% of the phenotypic variation.
The alleles from CB showed an increase in K + .
Four QTLs were located on chromosomes 1, 2, 7, and
12, which explained 9.1%, 5.2%, 5.9%, and 8.8% of the phenotypic
variation, respectively. The allele from CB showed an
increase in Na + /K + on chromosomes 1 and 7, whereas alleles
from Tesanai 2 were located on chromosomes 2 and 12. Common
QTLs were observed on chromosomes 3 and 9 for three
quantitative traits (SD, Rt.wt, and Na + /K + ). Common QTLs
were also detected on chromosome 12 for Na + /K + and K + .
On the basis of the QTLs for salinity tolerance excluding
the major gene on chromosomes 1, 2, 3, and 9, there was
independent inheritance of St.wt, Rt.wt, Na + , K + , and Na + /K +
ratio in the shoot. The interval analysis and single-marker analysis
used in detecting the QTLs showed the same results. Four
QTLs were identified for SD, one QTL for dry shoot weight,
two QTLs for dry root weight, one QTL for Na + absorption,
one QTL for K + absorption, and four QTLs for Na + /K + ratio.
These QTLs were located on chromosomes 1, 2, 3, 6, 7, 9, 11,
and 12. Common QTLs were observed on chromosomes 3 and
9 for quantitative traits (SD, Rt.wt, and Na + /K + ). Common
QTLs were also detected on chromosome 12 for Na + /K + and
K + . On this map, QTLs were detected at an interval of >30 cM
such as for Na + /K + ratio on chromosomes 1 and 7 and Na + on
chromosome 2. The genes tagged for salt tolerance in this study
can be used as anchor points to investigate the mechanisms of
salt tolerance in Tesanai 2.
Three microsatellite loci were tightly detected minor
genes for salinity tolerance: RM209 (chr. 11), RM240 (chr.
2), and RM214 (chr. 1). The ability to detect the tight linkage
between markers and salt-tolerance genes depends on the number
of mapped markers that are available for rice. Salt-tolerance
genes associated with seedling survival under saline conditions
provide a starting point for examining the effects of
these genes in rice.
References
Buu BC, Lang NT, Tao PB, Bay ND. 1995. Rice breeding research
strategy in the Mekong Delta. In: Fragile lives in fragile ecosystems.
Manila (Philippines): International Rice Research
Institute. p 739-755.
Gregorio GB, Senadhira D. 1993. Genetic analysis of salinity tolerance
in rice. Theor. Appl. Genet. 86:333-338.
Kosambi DD. 1944. The estimation of map distances from recombination
values. Ann. Engen. 12:172-175.
Lin Hong Xuan. 1995. Mapping of QTL for salt tolerance in rice
(Oryza sativa L.) via molecular markers. Okinawa Subtropical
Station, JIRCAS 4:240-265.
Shahid Masood M. 1997. Identification and evaluation of salinity
tolerance in rice (Oryza sativa L.) using molecular markers.
Okinawa Subtropical Station, JIRCAS 6:121-135.
Yoshida S, Forno DA, Cook JH, Gomez KA. 1976. Laboratory
manual for physiological studies of rice. 3 rd ed. Los Baños
(Philippines): International Rice Research Institute.
Notes
Authors’ addresses: Nguyen Thi Lang, Bui Chi Buu, Cuu Long Delta
Rice Research Institute, Vietnam; S. Masood and S.
Yanagihara, Okinawa Subtropical Station, JIRCAS, Japan.
Quantitative trait loci analysis of aluminum tolerance in rice
V.T. Nguyen, H.T. Nguyen, B.T. Le, T.D. Le, and A.H. Paterson
Rice cultivars grown on acid soil commonly suffer a serious yield reduction because of aluminum (Al) toxicity. A rapid nutrient
solution screening method was used to test 11 rice genotypes for Al tolerance. Rice seedlings were grown in a laboratory under
0 ppm Al and eight differential levels of stress treatment. Relative root length (RR) of 10-d-old plants was used as an index of
Al tolerance. Aluminum tolerance among 11 rice genotypes was determined and three major groups were identified: (1) the
highest aluminum tolerance group includes CT9993 and Nipponbare; (2) the intermediate aluminum tolerance group consists
of Moroberekan, Azucena, Chiembau, and Ca Dung Do; and (3) the susceptible group includes IR20, IR64, Omon 269-65,
Pokkali, and IR62266. A population derived from the cross between Chiembau and Omon 269-65 varieties is indica, but it
shows a relatively high level of DNA polymorphism. A total of 164 markers were used for linkage map construction. The 1,715-
cM linkage map covering the whole rice genome was used for QTL analysis. A total of nine different genomic regions on eight
chromosomes has been implicated in the genetic control of root and shoot growth under aluminum stress. The greatest effects
on aluminum tolerance were associated with the genomic region near WG110 (RG109–WG110 interval) on chromosome 1.
This major QTL for Al tolerance was found to be consistent among rice mapping populations.
298 Advances in rice genetics

Aluminum (Al) toxicity is the most important factor that limits
crop productivity in many areas of the world, particularly in
acid upland and lowland acid-sulfate soils. Toxic concentrations
of Al are usually found in acid soils at pH 5 and below.
Aluminum affects many physiological, biochemical, and metabolic
processes in plants. The initial and most dramatic symptom
of Al toxicity is inhibition of root elongation as a consequence
of root apex disruption. Al toxicity can inhibit shoot
growth by limiting the supply of nutrients and water because
of poor subsoil penetration or lower root hydraulic conductivity.
Shoot growth is also affected by Al toxicity and, in longer
duration experiments, has been used as an index of tolerance.
A diallel analysis using tolerant varieties Azucena and IRAT104
and sensitive varieties IR45 and IR1552 was conducted to investigate
the genetics of Al tolerance in rice (Khatiwada et al
1996). The results showed that Al tolerance is governed by
both additive and dominance effects, with a preponderance of
additive effects, suggesting the effects of several genes on Al
tolerance. The detection of putative QTLs could lead to the
identification of genes controlling Al tolerance or to the identification
of tightly linked markers to be used in marker-assisted
selection in rice. This study was conducted to determine
the variability of Al tolerance among 11 rice varieties and to
map genes or quantitative trait loci (QTLs) controlling Al tolerance
in rice using a cross between two indica varieties, Altolerant
local variety Chiembau and susceptible improved variety
Omon 269-65.
Materials and methods
Evaluation of rice lines for Al tolerance
Eleven rice genotypes (Table 1) were tested to determine the
genetic variability of Al tolerance in the laboratory using a
nutrient solution culture modified after Khatiwada et al (1996).
Azucena was used as the Al-tolerant check variety. The experiment
was conducted using a randomized complete block
design (RCBD) with six replications in 1997 at the Plant Molecular
Genetics Laboratory, Texas Tech University.
Seeds with uniform size were sterilized with 15% H 2 O 2 ,
rinsed with distilled water, and incubated on filter papers soaked
with distilled water in the dark at 30 °C for 2 d. Germinated
seeds were grown in distilled water for another 2 d in a culture
room maintained at 27 ± 2 °C with 12 h of light at 300 photosynthetic
photon flux density (PPFD). Seedlings were then
sown on a styrofoam sheet with a nylon net bottom with one
seedling per hole and 10 seedlings in one row per variety in
each replication. The styrofoam sheets were floated on a nutrient
solution in a plastic tray containing either 0 (control) or
10-, 20-, 30-, 40-, 50-, 60-, 80-, and 100-ppm Al (stress treatment).
The nutrient solution was replaced every 5 d. The pH
of the solutions was adjusted daily to 4.0 with 1 N NaOH or 1
N HCl. The hydroponic trays and seedlings were maintained
in the culture room at 27 ± 2 °C with 12 h of light at 300 PPFD
as above. The longest root of each seedling was measured after
10 d of growth in the control or stress solution. The ratio of
root length under stress to that under nonstress conditions was
used as the root tolerance index.
Mapping genes controlling Al tolerance in rice
Al tolerance screening. The leading local Al-tolerant indica
rice variety Chiembau grown in northern Vietnam was crossed
with an improved variety, Omon 269-65 (indica), from southern
Vietnam. From this cross, 188 F 2 plants were randomly
selected and selfed to produce 182 F 3 lines. These materials
were screened for Al tolerance under control (0 ppm Al) and
Al-stress conditions (30 ppm Al). Entries were arranged in a
RCBD with three replications. For each line in each replication,
the ratio of average root length under stress to that under
nonstress conditions was computed. In addition, the ratio of
shoot length under stress to that under nonstress conditions
for each line was computed.
Restriction fragment length polymorphism (RFLP)
genotyping. Genomic DNA of parents and 188 F 2 progenies
was extracted from 2 g of lyophilized leaf tissue. DNA was
digested with XbaI, HindIII, EcoRI, and EcoRV. Electrophoresis,
Southern blotting, and autoradiography followed standard
procedures.
Data analysis. An RFLP linkage map was constructed
using MAPMAKER. Trait means, correlation, and heritability
were determined using SAS (SAS Institute 1987). The mapping
of QTLs was performed following the interval mapping
method using MAPMAKER/QTL 1.1 (Lincoln et al 1992).
Results and discussion
Screening for tolerance for Al toxicity
Root length ratios of 11 rice genotypes under nine different
levels of Al toxicity are shown in Table 1. The results suggested
that 30 ppm is an optimal Al level for screening of rice.
Aluminum tolerance of 11 rice genotypes in this study could
be divided into three major groups: (1) the highest Al tolerance
group, which includes CT9993 and Nipponbare; (2) the
intermediate Al tolerance group, which consists of
Moroberekan, Azucena, Chiembau, and Cadungdo; and (3)
the susceptible group, which includes IR20, IR64, Omon 269-
65, Pokkali, and IR62266.
Mapping genes controlling Al tolerance in rice
The RFLP results and genetic map construction were discussed
by Nguyen et al (2001). The resulting linkage map spanned
1,715.8 cM, with an average distance of 10.46 cM (Kosambi
1944) between markers (Figure 1 as shown in Nguyen et al
2001). There are gaps on chromosomes 1, 2, 3, 4, 8, and 10,
but genome coverage was estimated to be approximately 90%
based on alignment to the map of Causse et al (1994). Interval
mapping analysis revealed a total of 20 QTLs for six root- and
shoot-related traits.
Control root length. Three QTLs—QAlCr2a, QAlCr3a,
and QAlC6a—were mapped on chromosomes 2, 3, and 6. Multiple
QTL model analysis indicated that these QTLs explained
18.3% of the phenotypic variance.
Molecular markers, QTL mapping, and marker-assisted selection 299

Table 1. Mean relative root length (RR) of 11 genotypes under nine different Al toxicity levels. a
Genotype
Al (ppm)
0 10 20 30 40 50 60 80 100
CT9993 100 102.92 81.14 56.37 37.48 34.17 31.69 29.9 24.18
Nipponbare 100 80.50 79.55 59.14 42.98 35.94 28.33 27.68 20.19
Moroberekan 100 69.01 51.68 41.32 30.31 26.28 21.34 19.61 13.58
Azucena 100 67.49 54.36 46.43 34.59 30.26 29.15 26.20 22.68
Chiembau 100 65.42 46.41 35.19 33.51 28.49 30.30 26.11 24.77
Cadungdo 100 53.42 47.42 32.54 29.29 24.19 28.98 21.38 18.32
Omon 269-65 100 51.57 34.92 22.50 13.35 16.31 15.44 14.53 12.85
IR20 100 48.27 31.49 26.01 19.17 29.48 24.14 21.06 16.17
IR64 100 45.28 29.54 23.60 20.94 21.61 20.02 19.92 16.70
IR62266 100 42.40 31.75 17.71 16.32 15.71 14.63 11.22 8.27
Pokkali 100 37.05 26.61 18.51 16.69 19.81 18.99 18.79 17.19
Mean value (%) – 60.34 46.80 34.48 26.81 25.68 23.90 21.49 17.68
LSD (0.05) – 18.19 12.74 8.10 6.17 4.29 6.55 3.04 2.54
CV (%) – 25.99 23.47 20.27 19.86 14.42 23.63 12.19 12.39
Root length under stress
a RR = × 100.
Root length under no stress
Stress root length. Three QTLs—QAlSr1a, QAlSr1b, and
QAlSr12a—were detected on chromosomes 1 and 12. Collectively,
three QTLs explained 38.9% of the phenotypic variance.
An additional QTL, QAlR1a, was found on chromosome
1 near QAlSr1b based on root measurement of the F 2 plants.
Root length ratio. Two major QTLs—QAlRr1a and
QAlRr2a—and two possible QTLs—QAlRr5a and
QAlRr11a—were detected on chromosomes 1, 2, 3, 5, and 11.
A full model containing the four QTLs explained 39.8% of the
phenotypic variance.
Control shoot length. Two QTLs—QAlCs1a and
QAlCs10a—were identified on chromosomes 1 and 10. A full
model containing the two QTLs explained 44.9% of the phenotypic
variance.
Stress shoot length. Three QTLs—QAlSs1a, QAlSs1b,
and QAlSs1a—were identified on chromosomes 1 and 10. A
possible QTL, QAlSs3a, was found on chromosome 3. A full
model containing the four QTLs explained 59.7% of the phenotypic
variance.
Shoot length ratio. QTL QAlS3a was identified on chromosome
3 and a possible QTL, QAlS6a, was found on chromosome
6. A full model containing the two QTLs explained
15.5% of the phenotypic variance.
A total of nine different genomic regions on eight chromosomes
have been implicated in the genetic control of root
and shoot growth under Al stress. By far, the greatest effects
on Al tolerance were associated with the region near WG110
on chromosome 1. This region contains a major QTL for Al
tolerance in rice. Our analysis indicated that this QTL is consistent
with other rice mapping populations when compared
with results obtained by Wu et al (2000) and our unpublished
data from a doubled-haploid population of CT9993/IR62266.
The major gene in this region does not seem to correspond to
most of the genes that have been mapped for Al tolerance in
other cereals. The results of this and other studies suggest that
Al tolerance in rice is a polygenic trait with major and minor
genes involved.
References
Causse MA, Fulton TM, Cho YG, Ahn SN, Chunwongse J, Wu K,
Xiao J, Yu Z, Ronald PC, Harrington SE, Second G, McCouch
SR, Tanksley SD. 1994. Saturated molecular map of the rice
genome based on an interspecific backcross population. Genetics
138:1251-1274.
Khatiwada SP, Senadhira D, Carpena AL, Zeigler RS, Fernandez
PG. 1996. Variability and genetics of tolerance for aluminum
toxicity in rice (Oryza sativa L.). Theor. Appl. Genet. 93:738-
744.
Kosambi DD. 1944. The estimation of map distances from recombination
values. Ann. Eugen. 12:172-175.
Lincoln SE, Daly MJ, Lander ES. 1992. Mapping genes controlling
quantitative traits with MAPMAKER/QTL 1.1. 2nd ed. Whitehead
Institute Technical Report. Cambridge, MA.
Nguyen VT, Burow MD, Nguyen HT, Le BT, Le TD, Paterson AH.
2001. Molecular mapping of genes conferring aluminum tolerance
in rice (Oryza sativa L.). Theor. Appl. Genet. 102:1002-
1010.
SAS Institute. 1987. SAS/STAT guide for personal computer version
6. Cary, N.C. (USA): SAS Institute.
Wu P, Liao CY, Hu B, Yi KK, Jin WZ, Ni JJ, He C. 2000. QTLs and
epistasis for aluminum tolerance in rice (Oryza sativa L.) at
different seeding stages. Theor. Appl. Genet. 100:1295-1303.
Notes
Authors’ addresses: B.T. Le, Institute of Biotechnology, Hanoi,
Vietnam; V.T. Nguyen and A.H. Paterson, Plant Genome Mapping
Laboratory, Texas A&M University, College Station,
Texas (current address: Plant Genome Mapping Laboratory,
University of Georgia, Athens); H.T. Nguyen, Plant Molecular
Genetics Laboratory, Texas Tech University, Lubbock,
Texas; V.T. Nguyen and T.D. Le, Department of Genetics,
National University of Hanoi, Hanoi, Vietnam.
300 Advances in rice genetics

11.3
9.3
16.7
6.7
9.2
24.6
19.9
12.9
7.7
5.1
24.3
1.0
7.8
9.5
9.0
5.6
26.2
2.3
18.9
4.4
22.1
12.6
7.2
Chr 1
RG459
RZ390b
RG236
RG323
WG110
RG109
RG780
PSB414***
RG394
RZ730a
RZ730b**
CDO920*** 25.7
RZ413b***
RZ413a***
RZ244***
RG118***
RZ489***
RG811
RG532b
RG532a
RG246b*
RG246a***
RG447*
RG313a
RG472
7.4
5.4
13.5
19.0
9.1
12.9
3.1
0.8
7.4
3.7
3.4
8.5
1.8
1.6
16.6
22.3
27.4
9.4
Chr 2
CUS382b***
CDO109b***
RZ681**
RZ446***
RG256
CDO204*
CDO941
RZ273
CDO1417
RZ567
RG139
CDO395
RG171b
RG171a*
RZ342
RG544
CUS39
RG83
RG152*
RG634b**
RG555
RG634a
25.5
25.4
5.4
1.3
25.2
12.8
13.8
22.5
7.6
0.4
25.0
18.0
6.0
1.2
12.9
10.6
Chr 9
RG996
RZ142
RZ448
CD0122
17.1
20.6
6.1
13.6
2.8
8.1
RZ474*** 3.0
9.5
RG179
CUS382a
CDO109a***
RG445a***
17.3
2.2
RG227 1.8
11.7
CDO1387
Chr 3 Chr 4
CDO192a*
RZ455*
RZ698
RG553b
RG553a
RZ422
CDO412***
BCD926***
RG570
18.5
5.3
25.2
10.2
4.3
27.4
5.9
19.8
RZ879
RG182 9.9
3.4
RG620 28.6
0.4
4.5
14.1
RG214 6.6 RG13
RZ909* 0.3
RZ993 10.4
3.9
RZ649* 10.8
RZ939 9.9
RG163
BCD454*
RZ740, RZ676
20.7
RZ668 16.8
RZ675
RG470* 4.7
19.4
28.3
RZ225
14.8
RG247a***
RG119*
17.6
RZ656
RG396
RZ69
Chr 5
CDO456
Chr 10
RG313b***
RG257
RZ892
RG313c
RZ960*
RZ583
BCD886
RZ421
RG561b
RG561a***
5.3 RG1109
RG353
16.1
0.7 RZ424a
RZ424c
1.6 RZ424b
38.3
4.8
3.2
2.1
10.4
6.6
19.0
10.5
11.6
22.0
5.9
16.8
CDO226a
CDO226b
RZ5357a
RZ5357b
CDO365
CDO534*
RG1094*
RG2
RZ53
RG1022
RZ638
RG525*
27.4
6.1
3.8
37.1
20.2
5.8
2.9
5.7
20.5
14.3
Chr 6
24.1
RZ144a***
CDO1380a*
RZ144b
CDO1380b
RZ213
CDO1395a
RG123 CDO1395
RZ953
RG716a
RZ682
CDO544
RG716b***
RG716c***
RG445b***
RZ76*
RG413
CDO459
RG247b**
RG9*
RG445c
RG341
RZ397
RZ816b
RG98***
RZ251***
5.5 RG351
6.2
3.1
15.3
13.6
5.5
22.0
12.6
9.0
3.2
12.4
RG598***
RG703
RG433
RZ989***
BCD855***
RG146***
CDO59*
RG678*
RG29
CDO407
RZ488
20.2
9.7
4.7
20.0
9.8
15.2
RG20
RG333b
RZ562*
RZ291
RG333a
PSB108
RZ926
RG136***
Control root length
Stress root length
Root length ratio
Control shoot length
Chr 11
Stress shoot length
Shoot length ratio
42.6
RZ816b
Chr 12
F 2 stress root length
Chr 7
Chr 8
Fig. 1. A rice linkage map with 164 RFLP marker loci constructed from 188 F 2 plants of the cross Chiembau/Omon 269-65. The numbers
between marker loci are Kosambi cM. Chromosomal locations of putative QTLs contributing to Al tolerance of root length and shoot length
of F 2 and F 3 populations in the cross Chiembau/Omon 269-65. The boxes cover the chromosomal regions where likelihood of the presence
of a QTL was within tenfold (1 LOD) of its maximal value and whiskers cover 2-LOD likelihood intervals. *, **, and *** indicate segregation
significant at 0.05, 0.01, and 0.005 probabilities (from Nguyen et al 2000).
Molecular markers, QTL mapping, and marker-assisted selection 301

Mapping QTLs for ozone resistance in rice
J.K. Sohn, J.J. Lee, K.M. Kim, Y.S. Kwon, and M.Y. Eun
Genotypic differences and inheritance of ozone (O 3
) resistance in rice were tested in a chamber with an O 3
-producing and
monitoring system. Most of the indica cultivars were more resistant than the japonica cultivars based on leaf injury to O 3
. The
segregation for O 3
resistance in the F 2
of a cross between resistant and susceptible cultivars revealed a nearly normal distribution.
Three significant QTLs associated with O 3
resistance in rice were mapped using the National Institute of Agricultural
Science and Technology (NIAST) map and the 164 recombinant inbred lines (MG RILs, F 13
) derived from Milyang23 (indica/
japonica)/Gihobyeo (japonica). These QTLs conferring O 3
resistance were linked to RZ569A–RG109 on chromosome 1, C507–
KCD405 on chromosome 7, and RG119–E13M60.348 on chromosome 11, explaining 20.5% of the total phenotypic variation.
The relationship between O 3
resistance and RFLP markers was analyzed in the F 2
populations derived from Milyang 23/
Chucheongbyeo and Milyang 23/Daeribbyeo 1. The RFLP marker RG109 turned out to be polymorphic and significantly distinguished
resistance and susceptibility to O 3
of the F 2
populations.
Ozone (O 3 ), a primary component of photochemical air pollution,
causes foliar injury to many plant species. The severity
of O 3 damage can vary significantly, depending on the plant
species or cultivar, O 3 concentration, and duration of O 3 exposure.
Genotypic differences in response to O 3 stress have
been noted in tobacco, potato, and soybean (Heagle et al 1998).
The objectives of this study were to detect the quantitative
trait loci (QTLs) for O 3 resistance and to analyze the effectiveness
of molecular marker-assisted selection (MAS) for resistance
to O 3 stress in rice. Injury was distinctly visible when
rice plants were fumigated for 3 to 4 h at 0.3 ppm O 3 concentration
in a chamber with the O 3 generator and monitoring system.
Most of the indica cultivars were relatively more resistant
than japonica varieties based on leaf injury to O 3 . F 1 plants
from crosses between resistant cultivar Milyang23 and susceptible
cultivar Chucheongbyeo or Daeribbyeo 1 showed an
intermediate reaction to O 3 . The segregation for O 3 resistance
in the F 2 populations of the crosses revealed a nearly normal
distribution. Continuous variation in the response of F 2 plants
to O 3 suggests that O 3 resistance of rice may be quantitatively
inherited (Sohn et al 1998). The advent of molecular marker
technology has led to the development of genetic maps that
make it possible to identify and locate genes or QTLs controlling
quantitative characters.
The QTLs associated with O 3 resistance in rice were
detected by using the NIAST map and the 164 recombinant
inbred lines derived from a cross between Milyang23 and
Gihobyeo (Cho et al 1998). Three significant QTLs related to
O 3 resistance were detected by interval mapping analysis (Table
1). The putative QTLs tentatively named qOZ-1, qOZ-7, and
qOZ-11 were located on chromosomes 1, 7, and 11, respectively
(Fig. 1). QTL qOZ-1 was found within RZ569A–RG109,
qOZ-7 was within C507–KCD405, and qOZ-11 within RG119–
E13M60.348 (Fig. 1). The phenotypic variation explained by
each QTL for O 3 resistance ranged from 4.8% to 8.4%.
Milyang23 alleles, represented by QTLs qOZ-1 and qOZ-11,
increased O 3 resistance, with an additive effect from 0.27 to
0.29, whereas qOZ-7 in Gihobyeo reduced O 3 resistance, with
an additive effect of 0.28 (Table 1). To assess the effectiveness
of MAS for O 3 resistance, we chose 24 F 2 plants with
resistance and 24 F 2 plants with susceptibility to O 3 stress
through phenotypic selection in the crosses Milyang 23/
Chucheongbyeo and Milyang23/Daeribbyeo 1. The relationship
between O 3 resistance and restriction fragment length
polymorphism markers tightly linked to QTL regions was analyzed.
RG109 was significantly distinguished between O 3 -resistant
and -susceptible lines (Fig. 2).
Results indicated that molecular markers can be used to
screen rice germplasm and to detect introgression for O 3 resistance
in segregating populations.
References
Cho YG, McCouch SR, Kuiper M, Kang MR, Pot J, Groenen JTM,
Eun MY. 1998. Integrated map of AFLP, SSLP and RFLP
markers using a recombinant inbred population of rice (Oryza
sativa L.). Theor. Appl. Genet. 97:370-380.
Table 1. Characteristics of QTLs associated with O 3 resistance in 164 MG RILs. a
QTLs Chromosome Markers F value P value LOD Variation Additive
(%) effect
qOZ-1 1 RZ569A–RG109 11.71 0.0008 2.48 8.43 –0.29
qOZ-7 7 C507–KCD 405 12.39 0.0006 2.62 4.76 0.28
qOZ-11 11 RG119–E13M60.348 15.38 0.0001 3.22 7.27 –0.27
a MG RILs = recombinant inbred lines derived from Milyang 23/Gihobyeo.
302 Advances in rice genetics

C161
RG140
EStI-1
RG165
RG128
RG678
RG304A
RM40
RZ638
Fig. 1. Genetic linkage map showing
locations of putative QTLs associated
with O 3 resistance (each bar) of 164
MG recombinant inbred lines.
RM35
RG811
RM11
RG711
qOZ-11
E13M60.348
13.0 cM
RG119, RG1094
RZ797
RG375
qOZ-7
KCD405
7.7 cM
C507
RG353
RZ536
RG519
E13M59.380
Chr. 11
qOZ-1
Chr. 1
RZ513
RG109
4.3 cM
RZ569A
RZ14
E26M47.M002
Chr. 7
E23M50.113
C213
Fig. 2. Autoradiography of
Southern hybridization of BglII
digest of rice DNA with radiolabeled
probe RG109 in F 2
populations derived from the
crosses Milyang23 (P1)/
Chucheongbyeo (P2) (A) and
Milyang23 (P1)/Daeribbyeo 1
(P2) (B). Phenotype: R = resistant,
S = susceptible to O 3 .
Genotype: 1–48 = F 2 plants.
A
Phenotype R S R R
Genotype P1 P2 F 1 1
R
24
S
25
5
48
Phenotype R S R R
Genotype P1 P2 F 1 1
R
24
B
S
25
S
48
Molecular markers, QTL mapping, and marker-assisted selection 303

Heagle AS, Miller JE, Booker FL. 1998. Influence of ozone stress
on soybean response to carbon dioxide enrichment. I. Foliar
properties. Crop Sci. 38:113-121.
Sohn JK, Kwon YS, Kim KM. 1998. Inheritance of resistance to
ozone in rice. Kor. J. Breed. 30(2):168-171.
Notes
Authors’ addresses: J.K. Sohn, J.J. Lee, K.M. Kim, Y.S. Kwon,
Department of Agronomy, College of Agriculture, Kyungpook
National University, Taegu 702-701; M.Y. Eun, Bioresources,
National Institute of Agricultural Science and Technology,
Rural Development Administration, Suwon 441-707, Korea.
Fine mapping of genes controlling intermediate amylose
content in rice using bulked segregant analysis
J. Lanceras, S. Tragoonrung, A. Vanavichit, and O. Naivikul
Amylose content (AC) is an important trait determining cooking and eating quality of rice. Bulked segregant analysis was used
to identify markers in the region of chromosome 6 containing the quantitative trait locus (QTL) for AC. Two DNA pools based on
the parental genotype for both markers defining the target interval and two pools produced from the phenotypic data were
constructed. The genotype pools composed of 10 individuals per pool were homozygous for the opposing alleles for the region
of the QTL defined by R1962 and RZ588. The phenotype-based pools were also composed of 10 individuals. The low-AC pool
contained individuals with ACs ranging from 11% to 16%, whereas the high-AC pool had 23–24% AC. The pools were screened
using 85 AFLP PCR II combinations. Two polymorphic markers were identified to be linked to chromosome 6: AC11 and AC12.
A waxy microsatellite marker flanking (CT) n
repeats at the 5′ regulatory region of the waxy gene was also used and mapped 7.2
cM from R1962. AC QTLs were reanalyzed and four QTLs were detected on chromosomes 3, 4, 6, and 7. The QTL detected on
chromosome 6 near the waxy microsatellite marker explained 58.7% of the phenotypic variation as part of the 80% variation
explained by the four QTLs. Marker AC12 on chromosome 6 was found 0.1 cM from the waxy marker. KDML105 contributed
low-AC QTLs on chromosomes 6 and 7, and CT9993 contributed QTLs on chromosomes 3 and 4. AC is positively correlated
with gelatinization temperature (GT) (0.3194) and negatively correlated with gel consistency (GC) (0.8011). The KDML105 ×
CT9993 population favored low to intermediate AC with high GT and hard GC. AC12 and the waxy microsatellite marker will be
useful for marker-assisted breeding.
Establishing a tight linkage between the gene and the marker
is the basic requirement in marker-assisted selection (MAS).
Bulked segregant analysis (BSA) is a fast method for identifying
markers in the specific region of interest. DNA pools can
be constructed based on the genotype and phenotype of the
existing mapping population from which the map can be produced
(Michelmore et al 1991). Rice eating and cooking qualities
are important agronomic traits and they should be emphasized
in breeding programs. Amylose content (AC) determines
the appearance and texture of rice. Likewise, rice used for industrial
purposes has specific properties dictated by AC. In
this study, information about the markers in the region of chromosome
6 containing the QTL for AC was identified and used
in the BSA to produce new markers in the region of the QTL
(Table 1). The waxy microsatellite marker was also genotyped
in the 141 recombinant inbred lines (RILs) from the Khao Dawk
Mali 105 (KDML105) × CT9993 cross. Gel consistency (GC)
and gelatinization temperature (GT) also play a role in the
cooking and processing quality of rice. The correlation among
AC, GC, and GT was also investigated.
Materials and methods
A population of 141 RILs of rice was used for mapping. The
population was derived from a cross between KDML105 with
intermediate AC (16.78%), medium GC, and low GT (Table
2). In contrast, CT9993-5-10-1-M has a high AC (24.04%),
hard GC, and high GT. AC was determined following the procedure
of Juliano and Villareal (1993). Procedures for GC and
GT were followed from Cagampang et al (1973) and Little et
al (1958), respectively.
DNA from selected plants was quantified on agarose gels
and approximately 2 µg of each sample was combined to make
the DNA pools. The combined mixture was diluted to a final
concentration of 100 ng µL –1 (Michelmore et al 1991). DNA
pool A contained DNA from plants that were homozygous for
the KDML105 segment for the genomic interval between markers
R1962 and RZ588. DNA pool B contained DNA from
plants that were homozygous for the CT9993 segment for the
same interval. Likewise, phenotype bulks were created based
on the amylose content of the plants. Phenotype bulk C contained
DNA from plants with low AC, whereas phenotype bulk
D contained DNA of individuals with high AC. The bulks were
screened using amplified fragment length polymorphism
(AFLP) following the procedure of Vos et al (1995). The first
round of AFLP analysis was done using the four DNA pools
together with the KDML105 and CT9993 DNA. Primer combinations
showing polymorphic bands between the genotype
and phenotype bulks were used to screen the RIL populations
to confirm and quantify the linkage between the polymorphic
304 Advances in rice genetics

Table 1. Numerical scoring data of RILs making up the DNA pools defined by markers
flanking the QTL and markers produced through bulked segregant analysis (BSA).
DNA Marker interval AFLP markers DNA Marker interval AFLP markers
pool from BSA pool from BSA
Pool A R1962 RZ588 AC12 AC11 Pool B R1962 RZ588 AC12 AC11
RI lines
RI lines
1 1 1 0 3 22 3 3 3 0
46 1 1 1 1 29 3 3 3 3
62 1 1 1 3 31 3 3 3 0
69 1 1 1 3 32 3 3 3 0
94 1 1 0 0 42 3 3 3 3
101 1 1 1 3 57 3 3 3 3
119 1 1 1 3 71 3 3 3 1
135 1 1 3 1 88 3 3 3 3
146 1 1 0 3 109 3 3 3 1
154 1 1 1 3 122 3 3 3 3
marker and the target region/locus of interest. All AFLP-produced
markers were designated with the code AC.
Segregation data for all polymorphic markers that were
produced as well as the waxy microsatellite marker were analyzed
by MAPMAKER (Lander et al 1987). QTL analysis was
performed with the software package MQTL. Both simple interval
mapping (SIM) and simplified composite interval mapping
(sCIM) procedures were used for QTL detection. The
data set was analyzed with 1,000 permutations, a 5-cM walking
speed, and a type I error rate of 5%. The significant threshold
(an LOD score of 2.4 or above) was used to declare the
presence of a QTL. Twenty-seven background markers were
specified as cofactors in the sCIM (Tinker and Mather 1995).
Association of markers with AC was analyzed using simple
regression, multiple regression, and ANOVA procedure in
Statgraphics3. Correlation of the three traits was also analyzed
using the same methods.
Results and discussion
The region of chromosome 6 containing the QTL for AC
flanked by R1962 and RZ588 with an interval size of 11.6 cM
was identified for fine-mapping procedures. This QTL explained
17.2% of the phenotypic variation in AC. A total of 85
AFLP PCR II combinations were used to screen the bulks. A
total of 92 and 73 polymorphic bands for the genotype pools
(bulks A and B) and phenotype pools (bulks C and D), respectively,
were identified following the polymorphism pattern
observed between KDML105 and CT9993. Polymorphic loci
identified by the phenotype bulks could possibly be mapped
at a location other than the chromosome 6 region of the QTL.
With this pattern of selecting polymorphic bands, nine loci
were detected. The same combinations were used to screen
the recombinant inbred lines for segregation analysis (Table
1). The segregation data for AC11 indicate that pools A and B
were skewed and may cause contamination in the pools by the
opposite alleles. This was also observed in the study of
Giovannoni et al (1991). The polymorphism observed using
Table 2. Classes of amylose content (AC) with varying types of gelatinization
temperature (GT) and gel consistency (GC) examined in
the 141 recombinant inbred lines (RILs) of KDML105 × CT9993.
Class AC (%) GT value GC value AC-GT-GC RILs
combinations a (no.)
1 11 1.00 42.00 L-H-M 1
2 12 1.28 58.75 L-H-M 4
3 13 1.54 56.20 L-H-M 5
4 14 2.80 43.00 L-H-M 1
5 15 1.89 63.67 L-H-S 3
6 16 1.76 41.57 L-H-M 7
7 17 4.10 32.50 L-I-Ha 2
8 18 2.28 30.50 L-HI-Ha 4
9 19 1.33 22.00 L-HI-Ha 3
10 20 1.94 23.53 I-H-Ha 15
11 21 2.24 22.24 I-H-Ha 21
12 22 2.64 22.08 I-HI-Ha 26
13 23 4.00 21.40 I-I-Ha 15
14 24 3.62 20.50 I-I-Ha 6
Total
113 a
a L = low, I = intermediate, S = soft, M = medium, HI = high intermediate, H =
high, Ha = hard. b Number of lines with complete data for AC, GT, and GC.
the AC11 combination could reflect competition between priming
sites in the skewed region. This explains the location of
AC11 out of the target region.
Linkage of the AFLP markers and the waxy microsatellite
marker was determined using MAPMAKER. The waxy marker
was located 7.1 cM away from R1962. Two of the nine polymorphic
loci were linked to chromosome 6. Marker AC12 (E/
CT-M/CTC) was mapped 0.1 cM from the waxy locus. In contrast,
AC11 (E/CT-M/CTA) was mapped far from the selected
interval (108.9 cM from RZ588) (Fig. 1). The map from which
the QTL for AC was analyzed is composed of 192 markers
comprising a total linkage distance of 1,626.2 cM. The average
two-locus interval is 8.5 cM. Of the 192 marker loci, 120
showed significant segregation distortion (P ≤ 0.05). KDML
alleles were overrepresented at 97 loci mainly on seven different
chromosomes. After adding the two AFLP markers and
Molecular markers, QTL mapping, and marker-assisted selection 305

cM
1.6
20.5
4.4
7.2
11.6
5.9
28.6
3.4
1.1
8.0
24.5
4.9
15.0
3.0
3.7
10.4
6.3
L203_7
L203_3
RM204 0.0 RM225
AC12 0.1 waxy
R1962
RM217
RZ588
G200
RZ667
C1478
R2171
L212_2
RG64
L203_11
L212_5 0.0 GA1_13
RM3
RM238
AC11
Fig. 1. Chromosome 6 map showing the
location of the QTL for amylose content.
Markers in italics flanked the QTL
(shaded box). Underlined markers represent
markers produced by bulked
segregant analysis.
the waxy marker, the position of the QTL was found between
the waxy marker and R1962. There were 22 low-AC transgressive
segregants with AC values lower than those of
KDML105. These data suggested that both parents possessed
some alleles for low-AC phenotypes and a unique profile of
alleles from the QTLs responsible for the expression of AC
resulting in low AC as exemplified by the transgressants.
Four QTLs were detected on chromosomes 3, 4, 6, and
7 using SIM and sCIM procedures of MQTL. The CT9993
allele at both loci contributed to low AC in the progenies. These
QTLs accounted for 11.3% and 16.0% of phenotypic variance
explained (PVE). The chromosome 6 QTL accounted for
58.7% of the PVE. KDML105 contributed the low-AC allele
at this locus. All QTLs explained 80.2% of the AC variation
observed in the RIL populations. A single gene of major effect
is responsible for differentiating low- and intermediate-AC
parents, differing by only 6–12% in AC. The occurrence of
transgressive segregants was due to modifier genes. The QTL
data confirm the multilocus control of AC in KDML105 and
provide some evidence for a low-AC allele in CT9993. These
results supported the presence of transgressive segregation in
the KDML105 × CT9993 population.
References
Cagampang GB, Perez CM, Juliano BO. 1973. A gel consistency
test for the eating quality of rice. J. Sci. Food Agric. 24:1589-
1594.
Giovannoni JJ, Wing RA, Ganal MW, Tanskley SD. 1991. Isolation
of molecular markers from specific chromosomal intervals
using DNA pools from existing mapping populations. Nucl.
Acids Res. 19(23):6553-6558.
Juliano BO, Villareal CP. 1993. Grain quality evaluation of world
rices. Manila (Philippines): IRRI. 205 p.
Lander ES, Green P, Abrahamson J, Barlow A, Daly MJ, Lincoln
SE, Newburg L. 1987. MAPMAKER: an interactive computer
package for constructing primary genetic linkage maps of experimental
and natural populations. Genomics 1:174-181.
Little RR, Hilder GB, Dawson EH. 1958. Differential effect of dilute
alkali on 25 varieties of milled white rice. Cereal Chem.
35:111-126.
Michelmore RW, Paran I, Kesseli RV. 1991. Identification of markers
linked to disease resistance genes by bulked segregant
analysis: a rapid method to detect markers in specific regions
by using segregating populations. Proc. Natl. Acad. Sci. USA
88:9828-9832.
Tinker NA, Mather DE. 1995. MQTL: software for simplified composite
interval mapping of QTL in multiple environments.
Available at http://probe.nalusda.gov: 8000/otherdocs/jqtl/
jqtl1995-01, 16 October 1999.
Vos P, Hogers R, Bleeker M, Reijans M, van de Lee T, Hornes M,
Frijters A, Pot J, Peleman J, Kuiper M, Zabean M. 1995.
AFLP: a new technique for DNA fingerprinting. Nucl. Acids
Res. 23(21):4407-4414.
Notes
Authors’ addresses: J. Lanceras, S. Tragoonrung, A. Vanavichit, DNA
Technology Laboratory, Kasetsart University, Kamphangsaen,
Nakorn Pathom 73140, Thailand; O. Naivikul, Faculty of
Agro-Industry, Kasetsart University, Bangkok 10900, Thailand;
J. Lanceras, Biotechnology Research and Development
Center, Department of Agriculture, Chatuchak, Bangkok
10900, Thailand.
306 Advances in rice genetics

Association between amylose content and a microsatellite
marker across exotic rice germplasm
C.J. Bergman, R.G. Fjellstrom, and A.M. McClung
A microsatellite sequence at the waxy gene of rice explains much of the variation in apparent amylose (AA) content of nonwaxy
U.S. germplasm. Since the amylose content of breeding lines is typically evaluated across multiple years and locations, this
microsatellite shows good promise for marker-aided selection of amylose content. Our study examined the association between
the microsatellite and AA using approximately 200 accessions from 53 countries. A previously unreported allele, (CT) 10
,
was found in accessions that had AA in low, intermediate, and high classes. A broader range in AA contents was identified for
(CT) 20
, (CT) 18
, (CT) , and (CT) alleles than was previously reported. The variance of AA explained by the microsatellite for
16 8
nonwaxy accessions and known mutants was 68%. The results indicate that this microsatellite marker can be a useful method
for predicting the AA content class of a diversity of rice germplasm. However, the relationship of AA content with this microsatellite
can be confounded by production environment and analytical methods for determining AA, as well as by other genes and
mutations that may occur in the genome.
Rice end-use quality is largely influenced by its amylose content.
Rapid analytical methods for determining apparent amylose
(AA) content have been used effectively for many years
to screen breeding progenies. However, in general, there is an
inverse relationship between field temperatures during grain
ripening and AA. Thus, the environmental influence on AA
can present problems when trying to categorize breeding lines
according to their end-use quality classes. Consequently, breeders
need to evaluate progenies across multiple years and locations
to produce more accurate estimates of AA.
A microsatellite at the waxy gene (Wx marker) of rice
has been identified (Bligh et al 1995). Ayres et al (1997) found
eight classes of (CT) n repeats at this microsatellite, which explained
a large portion of the variation in AA in nonwaxy U.S.
rice. This marker has proven its usefulness in decreasing the
time for cultivar development with the release of the U.S. cultivars
Cadet and Jacinto (McClung 1999).
Our objective was to examine the association between
the Wx marker and AA using rice germplasm of diverse origin
and to determine its potential for use in varietal development
programs that use international accessions.
Materials and methods
Rough rice samples were obtained from the National Small
Grains Collection of the U.S. Department of Agriculture-Agricultural
Research Service (USDA-ARS), the International
Rice Germplasm Collection at IRRI, and the Rice Research
Unit of the USDA-ARS. AA was determined in duplicate using
a single kernel of milled rice and is reported on an as-is
basis (Kuo et al 1996). An assay for the Wx marker reported
by Bergman et al (2000) was used to determine each accession’s
microsatellite allele. Electrophoretic bands were scored using
standards consisting of three microsatellite classes in a single
lane, loaded several times across the gel.
Results and discussion
Accessions having a broad diversity of origins were chosen to
capture a wide degree of genetic variation. Also, accessions
were included with the widest possible variation in the following
end-use quality-related traits: AA, parboiling loss, alkali
spreading value, and grain shape. All microsatellite classes
reported by Ayres et al (1997) were found, plus a previously
unreported class, (CT) 10 (Fig. 1). Similar to the finding by Ayres
et al (1997), the relationship between AA and the microsatellite
was strengthened by excluding waxy (glutinous) accessions.
Ayres et al (1997) reported 82.9% of the variance explained
for the AA content of 89 cultivars, primarily of U.S. origin.
Bergman et al (2000) reported that 88% of the variation in AA
was explained by the Wx marker in 199 nonwaxy breeding
lines and cultivars in the 1999 U.S. uniform rice regional nursery.
In our present study, the microsatellite explained 60% of
the variation in AA for 173 nonwaxy accessions.
Several reasons could explain why a reduced amount of
variation in AA content was accounted for by the microsatellite
in this study as compared with previous reports. This study
included greater genetic diversity as evidenced by the previously
unreported (CT) 10 class, which includes accessions having
low, intermediate, and high levels of AA (Fig. 2). Several
of the accessions in the (CT) 10 class are opaque mutants that
have approximately 10% AA (Mikami et al 1999). As shown
in Figure 2, the (CT) 16 allele was found in accessions having
intermediate AA, whereas it was previously associated with
only one waxy accession (Ayres et al 1997). Also, this broader
set of germplasm was observed to be more divergent for AA
in the (CT) 20 , (CT) 18 , and (CT) 8 classes than previously reported.
The association of AA content with the Wx marker in
this study may have been reduced because of the very diverse
environments in which the rice samples had been produced.
Within a cultivar, AA is known to vary up to 6 percentage
Molecular markers, QTL mapping, and marker-assisted selection 307

20 19 18 17 16 14 11 10 8
Apparent amylose (%)
35
30
25
20
15
10
5
Fig. 1. Electrophoretic gel showing nine alleles
for the waxy microsatellite associated with apparent
amylose content. Bands are identified according
to the number of CT repeats.
0
8 10 11 14 16 17 18 19 20
(CT)n
Fig. 2. Apparent amylose content and (CT) n class of 197 accessions
from 53 countries.
points because of production environment and analytical
method (Juliano and Pascual 1980). Individual kernels on a
panicle reportedly can vary up to 3.3 percentage points in AA
(Matsue et al 1994). Thus, a portion of the variance in AA
may have also resulted from sampling error introduced by analyzing
single kernels versus bulked samples.
The relationship of AA content with the Wx marker can
be confounded by production environment and analytical methods
for determining AA, as well as by other genes and mutations
that may occur in the genome. Consequently, before using
the Wx marker to make selections, breeders should have
good estimates of AA contents and knowledge of the (CT) n
classes of their parental breeding lines. This study has also
identified germplasm suitable for studying the role the waxy
gene plays in the control of AA and instances in which AA
may not be fully explained by the waxy gene.
References
Ayres NM, McClung AM, Larkin PD, Bligh HFJ, Jones CA, Park
WD. 1997. Microsatellites and a single-nucleotide polymorphism
differentiate apparent amylose classes in an extended
pedigree of U.S. rice germplasm. Theor. Appl. Genet. 94:773-
781.
Bergman CJ, Delgado JT, Fjellstrom RG, McClung AM. 2000. Evaluation
of breeding lines using a rapid method for a microsatellite
associated with the waxy gene. Texas Rice Research and Education
Program: Bottom Line Report. Texas A&M University.
Bligh HFJ, Till RI, Jones CA. 1995. A microsatellite sequence closely
linked to the waxy gene of Oryza sativa. Euphytica 86:83-85.
Juliano BO, Pascual CG. 1980. Quality characteristics of milled rice
grown in different countries. IRRI Res. Paper Ser. 48. Los
Baños (Philippines): International Rice Research Institute.
25 p.
Kuo YC, Webb BD, Stansel JW. 1996. Genetic study of milled rice
amylose content by means of single-grain amylose analysis.
J. Agric. Res. China 45:1-14.
Matsue Y, Odahara K, Hiramatsu M. 1994. Differences in protein
content, amylose content and palatability in relation to location
of grains within a rice panicle. Jpn. J. Crop Sci. 63:271-
277.
McClung AM. 1999. Development of rice varieties for conventional
and niche markets: a historical perspective of breeding for
rice quality in the U.S. Rice Utilization Workshop, Rice Quality:
Foundation for Value. USDA ARS and USA Rice Federation,
11-12 March, Little Rock, Arkansas, USA.
Mikami I, Munetoshi A, Hiro-Yuki H, Sano Y. 1999. Altered tissuespecific
expression at the Wx gene of the opaque mutants in
rice. Euphytica 105:91-97.
Notes
Authors’ address: USDA-ARS Rice Research Unit, 1509 Aggie
Drive, Beaumont, Texas 77713, USA.
308 Advances in rice genetics

Molecular genetic analysis of quantitative trait loci related
to rice grain quality
J.H. Lee, Y.S. Cho, K.H. Jung, M.T. Song, S.J. Yang, H.Y. Kim, and H.C. Choi
This study was conducted to analyze quantitative trait loci (QTLs) for grain quality. Recombinant inbred lines (RILs) were
developed by the single-seed descent method of progenies derived from a cross between a japonica tongil hybrid cultivar,
Nonganbyeo, and an indica line, BG276. The 272 F 7
individuals were used for DNA analysis using simple sequence repeat
(SSR) and amplified fragment length polymorphism (AFLP) markers. The molecular linkage map of the QTLs related to grain
quality was determined. A total of 15 significant QTLs governing six characters were detected with a variation of one to four
QTLs for the respective characters. However, no significant QTL was detected for grain length. Two QTLs for grain width were
identified on chromosomes 1 and 8, four QTLs for grain thickness on chromosomes 3, 7, 8, and 11, and two QTLs for grain
length/width ratio on chromosomes 5 and 10, respectively. A total of four QTLs for alkali digestion value were detected on
chromosomes 3, 7, 8, and 11 and three QTLs for amylose content on chromosomes 1, 6, and 11.
Most linkage maps developed with molecular markers such as
restriction fragment length polymorphism (RFLP), random amplified
polymorphic DNA (RAPD), simple sequence repeat
(SSR), and amplified fragment length polymorphism (AFLP)
are constructed using an F 2 population, backcross population,
doubled-haploid line (DHL), or recombinant inbred line (RIL)
derived from crosses between parents with a wide genetic distance.
RILs have become more and more important for practical
breeding and their usefulness in basic genetic analysis. This
study was carried out to construct a molecular genetic map of
rice by DNA markers and QTL analysis of grain quality traits
using 272 F 7 RILs derived from crosses between tongil and
indica rice.
Materials and methods
A set of rice RILs was developed from a cross between tongil
variety Nonganbyeo and indica line BG276 by the single-seed
descent method. With 272 F 7 RILs, AFLP and SSR markers
were generated for map construction. Grain shape and grain
quality traits, including grain length, width, thickness, and
length/width ratio; alkali digestion value; and amylose content
were measured following the standard method of the Rural
Development Administration of Korea. DNA was extracted
from the fresh young leaves of 272 RIL plants following the
procedures described in Causse et al (1994). The Mapmaker
program was used to establish a molecular map at an LOD
value of 3.0 and map distance expressed in Kosambi
centiMorgans. The analyses of QTLs associated with markers
for each trait were performed using one-way analysis of variance
(ANOVA) from Data Desk 4.0 and interval mapping in
the MAPMAKER/qGene 3.0 program. An LOD score of 2.0
was used as the threshold for detecting QTL location in
MAPMAKER/qGene.
Results and discussion
Figure 1 shows the frequency distribution of phenotypes for
each trait in the RILs. Symmetrical normal distribution was
observed for grain length and grain width, but a skewed frequency
distribution was observed for grain thickness, grain
length/width ratio, and amylose content among the RILs. The
alkali digestion value followed a bimodal distribution. This
trait was controlled by one major QTL.
The phenotypic values of some RILs were beyond the
ranges of parental means for all traits. The occurrence of such
transgressive segregants could be associated with the interaction
of complementary QTL alleles from two parents or overdominance
of a gene. These phenotypic variations in our study
were also reported by other QTL studies. Chang (1974) and
Lin and Chang (1981) reported that genes had different effects
on phenotypic expression depending on different cross combinations.
Somrith et al (1979) reported that grain length was
controlled by additive genetic effects and dominant effects,
but grain width was not related to any genetic effects. However,
Ramiah and Parthasarthy (1982) reported that the inheritance
of grain length was controlled by multiple genes and
there was a relationship between the genes for grain length
and grain width.
All 132 SSR and AFLP markers have been mapped on
the RIL population. A set of 22 SSR loci was used to construct
the framework assigned to the 12 chromosomes. The integration
of AFLP onto the SSR map generated a map. The total
length of the 12 linkage groups spanned 1,234 cM, and the
average length between markers was 9.4 cM.
A total of 15 significant QTLs (LOD ≥2.0) governing
five characters were detected, varying from 1 to 4 QTLs for
the respective characters. However, no significant QTL was
detected for grain length (Fig. 2, Table 1).
For grain width, two putative QTLs, qGW1 and Qgw8,
were associated with RM212 on chromosome 1 and A20-4 on
chromosome 8, respectively. These two QTLs explained 31.5%
Molecular markers, QTL mapping, and marker-assisted selection 309

Frequency (%)
80
60
P1 = 5.5 P2 = 6.5
40
20
0
4.2 4.8 5.4 6.0 6.6 7.2
Grain length (mm)
50
40
P1 = 2.2 P2 = 2.6
30
20
10
0
1.7 1.9 2.1 2.3 2.5 2.7 2.9
Length/width ratio (%)
80
P2 = 2.5
P1 = 2.4
60
40
20
0
2.0 2.2 2.4 2.6 2.8 3.0
Grain width (mm)
80
60
40
20
P1 = 2.0 P2 = 6.1
0
2.0 2.8 3.6 4.4 5.2 6.0 6.8
Alkali digestion value
60
50
40
30
20
10
0
80
60
40
20
1.4
P1 = 1.70
P2 = 1.85
1.5 1.6 1.7 1.8 1.9 2.0
Grain thickness (mm)
P1 = 15.8
P2 = 24.5
0
12 14 16 18 20 22 24
Amylose content (%)
Fig. 1.Frequency distribution of grain quality-related characters of 272 RILs and their parents, Nonganbyeo (P1)
and BG276 (P2).
of the total variation. Variation in grain length was promoted
by the BG276 alleles in the homologous state of qGW1 and
by the Nonganbyeo alleles of qGW8.
Four putative QTLs were mapped for grain thickness on
chromosomes 3, 7, 8, and 11, respectively. The simultaneous
fit of the four QTLs explained 62.1% of the total phenotypic
variation.
For grain length/width ratio, two putative QTLs, with
qLWR5 and qLWR10, accounted for 45.6% of the total phenotypic
variation. They were located near RM249 and A8-4
on chromosome 5 and near A14-6 and RM258 on chromosome
10, respectively. BG276 alleles increased grain length/
width ratio.
Four putative QTLs were mapped for alkali digestion
value on chromosomes 3, 7, 8, and 11, respectively. The percentage
of phenotypic variance explained by each QTL ranged
from 8.1% to 42.0%. The simultaneous fit of the four QTLs
explained 70.0% of the total phenotypic variation.
For amylose content, three putative QTLs, qAM1,
qAM6, and qAM11, were associated with A19-4 on chromosome
1, RM217 on chromosome 6, and A20-16 on chromosome
11, respectively. These three QTLs explained 79.5% of
the total variation. Amylose content was promoted by the
BG276 alleles in the homozygous state.
A total of 15 putative QTLs for grain length, width, thickness,
and length/width ratio; alkali digestion value; and amylose
content were detected on eight chromosomes. Nine out of
15 putative QTLs detected in this study were contributed by
BG276.
References
Causse P, Fulton TM, Cho YG, Ahn SN, Chunwongse J, Wu K,
Xiao J, Yu PC, Ronald SE, Harrington SE, Second G,
McCouch SR, Tanksley SD. 1994. Saturated molecular map
of the rice genome based on interspecific backcross populations.
Genetics 138:1251-1274.
Chang TT. 1974. Studies on the inheritance of grain shape of rice.
Taiwan Agric. Res. 23:9-15.
Lin MH, Chang TT. 1981. Inheritance of agronomic traits and character
association in crosses between dryland and wetland cultivars
of rice. SABRAO J. 13(1):11-13.
Ramiah K, Parthasarthy N. 1982. Inheritance of grain length in rice.
Ind. J. Agric. Sci. 3(5):808-819.
Somrith B, Chang TT, Jackson BR. 1979. Genetic analysis of traits
related to grain characteristics and quality in two crosses of
rice. Research Paper Series No. 35. Los Baños (Philippines):
International Rice Research Institute.
Tsunematsu H, Yoshimura AM, Iwata N. 1996. QTL analysis using
RI lines in rice. Rice genetics III. Manila (Philippines): International
Rice Research Institute. p 619-623.
Notes
Authors’ address: National Crop Experiment Station, Rural Development
Administration, 441-100 Suwon, Korea.
ljh@nces.go.kr.
310 Advances in rice genetics

cM
0
A6-2
A1-3
A1-4
A17-11
A9-10
RM249
A9-3
50
100
150
A18-1
A16-5
A21-2
A14-16
RM238A
A19-9
RM212
A19-4
A21-7
A11-6
A20-8
A14-9
Chr 2
A18-10
RM263
A20-15
A15-1
A18-4
RM240
A14-7
A14-8
A17-4
A20-7
A17-8
A17-7
A18-7
RM218
A20-3
A20-2
A9-2
A11-5
A21-5
RM22
A14-14
A9-9
A18-5
RM241
A17-7
A17-14
A11-1
A12-14
A12-12
A8-4
A8-2
A5-6
RM164
A15-4
A7-2
A19-6
A21-12
A16-14
Chr 5
Chr 6
A6-9
A5-10
A5-8
A11-2
RM217
A3-5
A10-4
A13-3
200
A14-17-6
A20-6
A17-13
RM23
A5-1
Chr 1
Chr 3
A20-14
A15-5
A3-4
A18-3
A7-1
RM261
A15-7
A10-7
A16-3
Chr 4
cM
0
A5-9
A14-4
A4-1
A14-6
A12-9
RM247
A20-5
RM258
50
100
A3-2
A16-7
A17-10
RM234
RM18
A6-3
A14-13
A20-4
A5-3
A3-1
A2-2
A20-3
A11-4
A21-11
A17-9
Chr 8
Chr 9
A18-11
RM242
RM257
RM215
Chr 10
A16-9
A16-10
A18-6
A14-5
A12-13
A10-6
A19-5
A21-9
A10-2
RM21
A6-5
RM206
A16-13
RM211
A14-10
A20-9
A4-3
A5-2
Chr 12
A20-16
150
A17-5
Chr 7
Grain width
Grain thickness
Grain length/width ratio
Alkali digestion value
Amylose
Chr 11
A15-2
Fig. 2.QTLs for grain quality mapped on RILs derived from Nonganbyeo/BG276.
Molecular markers, QTL mapping, and marker-assisted selection 311

Table 1. QTLs detected for grain quality traits in RILs derived from Nonganbyeo/BG276.
Trait QTLs Interval Peak Variation Phenotypic
LOD explained (%) effect
Grain length nd a – – – –
Grain width qGW1 RM212–A19-4 2.83 17.0 –0.2
qGW8 A20-4–A5-3 2.19 14.5 0.1
Grain thickness qGT3 A9-2–A-11-5 4.21 16.6 –0.1
qGT7 RM234–RM18 2.58 7.1 –0.0
qGT8 A11-4–A21-11 3.61 8.4 0.0
qGT11 A10-2–RM21 4.24 30.0 0.3
Length/width ratio qLWR5 RM249–A8-4 4.16 25.9 0.5
qLWR10 A14-6–RM258 3.15 19.7 0.2
Alkali digestion value qADV3 A9-2–A11-5 6.37 9.1 –1.3
qADV7 A3-2–A16-7 5.71 10.8 1.1
qADV8 A14-13–A20-4 8.11 42.0 –3.5
qADV11 A16-13–RM211 4.76 8.1 –3.1
Amylose content qAM1 A19-4–A21-7 2.86 17.5 1.5
qAM6 RM217–A3-5 4.62 45.4 2.9
qAM11 A20-16–A15-2 2.32 16.6 1.0
a nd = not detected.
Leaf senescence of a newly induced stay-green mutant
and mapping of the gene in rice
K.W. Cha, Y.J. Won, and H.J. Koh
A “stay-green” mutant was induced through a chemical mutagen, N-methyl-N-nitrosourea (MNU), in a japonica rice line,
Hwacheong-wx. Leaves of the mutant remained deep green until harvesting stage, when leaves of the normal type turned
yellow because of senescence. The stay-green trait was stably expressed under different environments. Agronomic characteristics
of the mutant were the same as those of the original line except for the greenness of the plants. The mutant differed from
the original line in chlorophyll a/b ratio along with leaf position and growth stages. The stay-green trait was controlled by a single
recessive gene, which was tentatively symbolized as sgr(t). The sgr(t) gene was located on chromosome 9. Two SSR markers,
RM242 and RM257, were linked with sgr(t) by 18 cM and 28 cM, respectively. A RAPD band of 1.2 kb amplified with OPI-9 was
also linked to the sgr(t) gene by 17.5 cM. The linkage order was OPI-9–sgr(t)–RM242–RM257.
Senescence that occurs at the end of the plant’s life cycle is
considered a process of apoptosis for optimized material mobilization
and/or for the growth of reproductive organs
(Kawasaki 1992). The most conspicuous change that occurs
during this process is chlorophyll degradation, which is frequently
used as an index of leaf senescence. Variation in leaf
senescence is affected by environmental factors. Several naturally
occurring variants that exhibit delayed senescence have
been reported (Thomas and Smart 1993). We developed a staygreen
mutant by using a chemical mutagen, N-methyl-Nnitrosourea
(MNU), to fertilize egg cells of Hwacheong-wx
line, an induced mutant line from Korean japonica rice variety
Hwacheongbyeo. This study was conducted to investigate the
mutant phenotype and to locate the gene governing stay-greenness
in the mutant.
Materials and methods
The stay-green mutant was selected in the M 2 population and
was advanced to a homozygous line. The mutant line used was
Hwacheong-wx-B-24-8-2-1-1 from the M 7 generation.
Hwacheongbyeo, Hwacheong-wx line, the stay-green mutant
line, and some other varieties were grown under normal field
management conditions and were evaluated for agronomic
characters, including chlorophyll content of leaves.
DNA was extracted from the leaves of the mutant, the
original line, and eight other varieties. The mutant was crossed
with Milyang23 and DNA was extracted from the leaves of
each F 2 plant and the parent. To preliminarily screen the linkage
of the gene, the bulked segregant analysis method was
adopted (Michelmore et al 1991, Koh et al 1996). An analysis
of microsatellite and random amplified polymorphic DNA
(RAPD) markers for mapping was carried out according to
the protocol described in Panaud et al (1996) and Ahn et al
312 Advances in rice genetics

Table 1. Comparison of agronomic characteristics between the stay-green mutant and the original line.
Line Heading Culm Panicle Panicles Spikelets Grain 1,000- Yield Grain dimension (mm)
date length length hill –1 panicle –1 fertility grain wt. hill –1
(cm) (cm) (no.) (no.) (%) (mg) (g) Length Width Thickness
Hwacheongbyeo 17 Aug 89.0 18.7 17.3 129.0 92.9 21.7 45.0 – – –
Hwacheong-wx 18 Aug 93.7 21.4 17.0 120.7 91.2 20.3 38.0 4.7 2.7 1.93
Mutant 18 Aug 93.3 20.8 17.5 129.5 92.7 20.5 43.0 4.7 2.7 1.93
Flag leaf
Chlorophyll (mg g –1 DW)
22
20
18
16
14
12
10
86420
Hwacheong
Hwa-wx
Mutant
Ilpum
M23
IR36
Second leaf
22
20
18
16
14
12
10
86420
Chlorophyll a/b
4.0
3.5
3.0
2.5
2.0
1.5
1.0
0.5
0
0 10 20 30 40 50 60 70
Hwa-wx
Mutant
0 10 20 30 40 50 60 70
Days after heading
0 10 20 30 40 50 60 70
4.0
3.5
3.0
2.5
2.0
1.5
1.0
0.5
0 0 10 20 30 40 50 60 70
Days after heading
Fig. 1. Changes in chlorophyll
content and chlorophyll
a/b ratio of leaves
after heading.
(1998). Linkage analysis was conducted using Mapmaker computer
software. Map distances were estimated using the
Kosambi function (Kosambi 1944).
Results and discussion
The leaves of the original line turned yellow, but those of the
mutant remained deep green (60 d after heading), which dried
to a greenish white color without yellowing. No significant
difference in agronomic characters was observed between the
mutant and original line (Table 1). When the mutant and original
line were fingerprinted with 85 microsatellite markers, they
showed 100% genetic similarity, indicating that the mutant
could have been induced through point mutation from the original
line.
The chlorophyll content of the leaves was measured at
5-d intervals after heading (Fig. 1). The chlorophyll content of
the mutant was the same as that of the original line and similar
to that of other varieties at the tillering and flowering stages.
As grain filling proceeded, the chlorophyll content of the checks
and the original line was greatly reduced in both flag and second
leaves as expected. The reduction rate was accelerated 25
to 35 d after heading depending on variety. The chlorophyll
content was nearly negligible 50 to 60 d after heading. The
reduction rate of chlorophyll content in the mutant was much
slower even after 30 d from heading. Some amount of chlorophyll
remained till senescence, keeping the leaves green until
damaged by low temperature. The chlorophyll a/b ratio of
leaves of the mutant was similar to that of a normal line during
the ripening stage (Fig. 1). However, the chlorophyll a/b ratio
of a normal line at 20 and 50–55 d after heading fluctuated
steeply.
The inheritance mode of the stay-green trait was studied
in F 1 and F 2 populations from crosses between the stay-green
mutant and some cultivars (Table 2). In the F 1 , all the plants
from every cross showed normal senescence. In F 2 populations,
the segregation ratio of normal:stay-green fitted the 3:1
ratio, indicating that a single recessive gene controlled the staygreen
trait of the mutant. It was tentatively labeled as sgr(t).
Molecular markers, QTL mapping, and marker-assisted selection 313

Table 2. Segregation of stay-green characteristics in F 1 and F 2 populations from crosses between
the stay-green mutant and rice cultivars.
F 1 F 2
Cross combination Total X 2 P
Normal Stay-green Normal Stay-green (3:1)
Mutant/Hwacheongbyeo 9 0 250 94 344 0.99 0.1–0.5
Mutant/Ilpumbyeo 9 0 192 57 249 0.59 0.5–0.9
Mutant/Milyang 23 9 0 129 35 164 1.17 0.1–0.5
Mutant/Dasanbyeo 9 0 179 59 238 0.01 >0.9
Mutant/IR8 9 0 211 51 262 4.28 0.1–0.5
Mutant/IR24 9 0 146 54 200 0.43 0.5–0.9
Mutant/CP-SLO 9 0 153 42 195 1.25 0.5–0.9
RM257
RM242
sgr(t)
OPI-9
As a result of bulked segregant analysis, two
microsatellite markers, RM242 and RM257, and one RAPD
marker, OPI-9, were found to be linked to the sgr(t) locus.
Using an F 2 population of mutant/Milyang23, the stay-green
gene sgr(t) was mapped on chromosome 9 (Fig. 2). The sgr(t)
gene was linked to OPI-9, by 17.5 cM, and to RM242 and
RM257, by 18 cM and 28 cM, respectively. The linkage order
was OPI-9–sgr(t)–RM242–RM257. In addition, the mutant was
crossed with a linkage tester with a marker gene, Dn-1 (Dense
panicle-1), of chromosome 9. The crossover value between
sgr(t) and Dn-1 was 26%.
cM
10.0
18.0
17.5
Chromosome 9
Fig. 2. Mapping of the stay-green
gene sgr(t) on chromosome 9.
References
Ahn SN, Kwak TS, Kang KH, Jeon YH, Choi HC, Moon HP. 1998.
Relationship between heterosis and measured by RAPDs
analysis in rice. Kor. J. Breed 30(1):16-23.
Kawasaki S. 1992. Analysis of leaf senescence through mutation
and affinity-labeling. Gamma Field Symposium. No. 31.
Koh HJ, Heu MH, McCouch SR. 1996. Molecular mapping of the
ge s gene controlling the super-giant embryo character in rice
(Oryza sativa L.). Theor. Appl. Genet. 92:257-261.
Kosambi DD. 1944. The estimation of map distances from recombination
values. Ann. Eugenet. 12:172-175.
Michelmore RW, Paran I, Kesseli KV. 1991. Identification of markers
linked to disease resistance genes by bulked segregant
analysis: a rapid method to detect markers in specific genomic
regions by using segregating populations. Proc. Natl. Acad.
Sci. USA 88:9828-9832.
Panaud O, Chen X, McCouch SR. 1996. Development of
microsatellite markers and characterization of simple sequence
length polymorphism (SSLP) in rice (Oryza sativa L.). Mol.
Gen. Genet. 252:597-607.
Thomas H, Smart CM. 1993. Crops that stay green. Ann. Appl. Biol.
123:193-219.
Notes
Authors’ address: School of Plant Science, College of Agricultural
and Life Sciences, Seoul National University, Suwon 441-
744, Korea.
Mapping the rt (root growth-inhibiting) gene
of rice by RFLP markers
M. Miwa, Y. Inukai, K. Satoh, M. Itoh, Y. Katayama, M. Ashikari, M. Matsuoka, and H. Kitano
Despite the many important roles of the plant root, the study of root growth and development has not received as much
attention as that of aerial organs, particularly at the molecular and genetic levels. To understand the genetic mechanism of root
growth, we studied the rice root growth-inhibiting mutant (rt mutant). A previous study revealed that a recessive rt gene
controlling the mutant phenotype primarily disturbs the normal formation of root epidermal systems. Thus, we tried to isolate
the rt gene using molecular markers. Preliminary results showed that the rt gene is located between RFLP markers C335 and
R3351 on the long arm of chromosome 4.
314 Advances in rice genetics

A B C D
E F G
*
*
Fig. 1. Phenotype of rt mutant
plants. (A and B) Seedling at 7thleaf
stage of Fukei 71 (A) and rt
mutant (B). (C and D) Primary root
of Fukei 71 (C) and rt mutant (D).
Arrow shows root hair. Arrowhead
shows lateral root. Longitudinal
sections of Fukei 71 (E) and rt
mutant (F and G). Asterisks show
stripped epidermal cells. Bar in
A, B = 5 cm, in E, F, and G = 100
mm. Kitano and Futsuhara
(1989).
The plant root is involved in acquiring water and nutrients,
anchoring the plant body, synthesizing plant hormones, storage
functions, and interacting with some soil microbes. Despite
the importance of such unique aspects of the root, the
molecular and genetic study of this organ has not been pursued
as vigorously as the development of aerial plant organs.
Genetic variations in root morphology have been described in
more than 30 plant species (O’Toole and Bland 1987). However,
most of these examples involved polygenic variation. The
isolation of single-gene mutants has been hampered by various
environmental factors through root growth and development
under the ground. Therefore, root mutants are particularly
rare in rice. We studied the rice root mutant rt detected
by Futsuhara and Kitano (1985) and isolated it using molecular
markers.
Materials and methods
The rt mutant was found in the M 2 progenies of a dwarf mutant
line, Fukei 71, treated with 0.3% solution of ethylenimine
for 2 h at 30 ºC (Futsuhara and Kitano 1985). To characterize
the mutant’s root morphology, histological observations were
carried out using longitudinal thin 5-mm sections of seminal
root tips of both the rt mutant and Fukei 71.
The trisomic testers derived from a japonica rice cultivar,
Kinmaze, were crossed with the rt mutant to detect the
chromosome number on which the mutant gene is located.
Further, the rt mutant was crossed with an indica rice cultivar,
Kasalath, for fine mapping based on molecular markers. About
2,000 F 2 seedlings expressing the rt phenotype were selected
and transplanted into the paddy field for DNA extraction and
linkage analysis.
The benzyl chloride method (Heng Zhu et al 1993) was
used for extracting total DNA from rice leaves. The extracted
DNA was digested with a restriction enzyme. Five grams of
each digested DNA were loaded on 0.7% agarose gel and run
for 16 h at 220 V and then blotted onto a nylon membrane.
Southern hybridization was done with horseradish peroxidaselabeled
restriction fragment length polymorphism (RFLP)
markers according to the protocol for the enhanced chemiluminescent
(ECL)-directed nucleic acid labeling and detection
system (Amersham Pharmacia). RFLP markers were provided
by the Rice Genome Research Program (RGP).
Results and discussion
In the model plant Arabidopsis, research on root growth and
development using molecular genetic approaches has been well
advanced. Studies on patterning of tissue and cell types of the
root, and on controlling root morphogenesis, are done largely
using various root mutants such as rhd3 and scr (Wysocka-
Diller et al 2000). However, there are only a few reports on
root mutants in rice. The study of root growth and development
in rice, particularly at the molecular level, has lagged
behind. We studied a root mutant (rt mutant) with a remarkably
reduced root growth (Fig. 1B) to obtain genetic information
on rice root growth and development (Futsuhara and
Kitano 1985).
Molecular markers, QTL mapping, and marker-assisted selection 315

71.2
72.6
76.7
81.9
83.2
Position
(cM)
4S
rt
Marker
L353
SS13322
C335
R3351
EH1171
ing minimum growth and physiological functions of the root
system even though its epidermis was lacking. In contrast, the
radicle in the mature embryo of the mutant showed a normal
morphology (data not shown), suggesting that the rt gene could
act only in the growing root after germination.
Although it became clear that the rt gene affects root
morphogenesis, other specific functions of this gene are still
obscure. Thus, we tried to isolate the rt gene using molecular
markers. Trisomic analysis to detect the chromosome number
of the mutant gene location showed an abnormal segregation
ratio that suggested that the rt gene is located on chromosome
4 (data not shown). We devised a strategy to isolate the rt gene
by an RFLP-based chromosome-walking technique using about
260 F 2 homozygous plants expressing the mutant phenotype.
Results of linkage analysis between rt and some molecular
markers on chromosome 4 showed that the rt gene was located
between markers C335 and R3351 on the long arm of
chromosome 4 (Fig. 2). We also selected to get recombinants
within these RFLP markers using cleaved amplified polymorphic
sequence (CAPS) analysis. By using CAPS primers
(EH1171 and SS13322, see Fig. 2), we selected many recombinants
between CAPS markers from about 2,000 rt homozygous
F 2 plants. We will select recombinant plants within RFLP
markers (C335 and R3351) using other molecular markers and
establish the physical map to finally isolate this gene.
97.9
4L
C1100
Fig. 2. RFLP and CAPS map of the genomic
region around rt on rice chromosome 4. The
rt gene is located between C335 and
R3351. EH1171 and SS13322 are CAPS
markers. Other markers are RFLP. S and L
= short and long arm, respectively.
The root system of the rt mutant was very compact because
of excessive inhibition of both seminal and crown root
growth. Histological observations on the root tip of the mutant
showed that the mutant epidermis was obviously abnormal and
stripped off from the cortex in the meristematic region. Its
epidermis was almost lacking on the surface of the upper side
of the root (Fig. 1G), resulting in only a few root hairs occurring
in the upper part of the growing root (Fig. 1C, D). However,
cell divisions and cell differentiations in the root apical
meristems of the mutant were nearly normal (Fig. 1E, F). These
suggested that the root of the mutant was capable of maintain-
References
Futsuhara Y, Kitano H. 1985. Inheritance of a root growth-inhibiting
mutant in rice. Rice Genet. Newsl. 2:70-71.
Heng Zhu, Qu F, Zhu L. 1993. Isolation of genomic DNAs from
plants, fungi, and bacteria using benzyl chloride. Nucleic Acids
Res. 21:5279-5280.
O’Toole J, Bland W. 1987. Genotypic variation in crop plant root
systems. Adv. Agron. 41:91-145.
Wysocka-Diller J, Helariutta Y, Fukaki H, Malamy J, Benfey P. 2000.
Molecular analysis of SCARECROW function reveals a radial
patterning mechanism common to root and shoot. Development
127:595-603.
Notes
Authors’ addresses: M. Miwa, Y. Inukai, H. Kitano, Graduate School
of Bioagricultural Sciences; M. Itoh, M. Ashikari, M.
Matsuoka, Bioscience Center, Nagoya University; K. Satoh,
Y. Katayama, Graduate School of Bio-Applications and Systems
Engineering, University of Agriculture and Technology.
316 Advances in rice genetics

Tagging and mapping of a new elongated-uppermostinternode
gene—eui2(t)—using AFLP, RFLP, and SSR
techniques
S.L. Yang, R.C. Yang, X.P. Qu, H.L. Ma, Q.Q. Zhang, S.B. Zhang, and R.H. Huang
A new elongated-uppermost-internode gene, eui2(t), was identified from a mutant, XQZeB-2. Using AFLP and bulked segregant
pools from F 3
progenies of the cross XQZeB-2/Aijiaonante, approximately 8,960 AFLP loci were screened with 128
primer combinations. Four polymorphic AFLP products were identified and designated as EM436, EM444, EM521, and EM527,
respectively. Among them, EM521 was tightly linked to the eui2(t) gene by segregation analysis. EM521 was mapped on
chromosome 10. Meanwhile, four SSR markers, RM258, RM269, RM271, and RM304, with a genetic distance to eui2 of
12.0, 12.9, 33.1, and 1.4 cM, respectively, were screened by microsatellite analysis. The results of microsatellite analysis and
the mapping of AFLP marker EM521 confirmed that eui2(t) was located in the middle of the long arm of chromosome 10. The
identification of the eui2(t) gene makes it possible to develop hybrid rice with sterile (A) and restorer lines (R) possessing
different eui genes simultaneously, which would result in a reduced application of GA 3
for both parental lines.
Rutger and Carnahan (1981) reported that the elongation of
the uppermost internode was controlled by a recessive gene,
eui. They predicted that, as far as A, B, and restorer lines are
concerned, the eui gene would be the fourth element for seed
production of hybrid rice. Many studies used the eui gene in
hybrid rice breeding in the past 20 years. Virmani et al (1988)
transferred the eui gene to IR50 (indica) by backcrossing and
designated the progeny as restorer line IR50eui. Shen et al
(1987) developed a new CMS line—Zhenchang A—without
panicle enclosure by introducing the eui gene into Zhenshan
97A. Librojo and Khush (1986) located the eui gene on chromosome
5 through the use of primary trisomics. Wu et al (1998)
screened a restriction fragment length polymorphism (RFLP)
marker, RG435, linked to the eui gene with a genetic distance
of 33.6 cM. In 1998, we identified two types of mutants possessing
an elongated uppermost internode and designated the
two mutants as XieqingzaoeB-1 (XQZeB-1) and
XieqingzaoeB-2 (XQZeB-2). Genetic analysis revealed that
the elongated uppermost internode in the two mutants was
governed by one pair of recessive genes. The recessive gene
of XQZeB-1 is allelic to the reported eui, but that of XQZeB-
2 is nonallelic. Therefore, the elongated-uppermost-internode
gene of XQZeB-2 is a new one, designated as eui2(t) (Yang et
al 1999). In this paper, the results of tagging and mapping of
the eui2(t) gene are reported.
Materials and methods
XQZeB-2, a mutant possessing elongated uppermost internode,
and Aijiaonante (AJNT), a semidwarf cultivar, were used.
An F 3 population was developed by planting 400 F 2 individuals
from the cross XQZeB-2 (with eui gene) × AJNT (without
eui gene) to identify molecular markers linked with the eui2
gene. One individual was randomly selected from each F 3 line,
which showed no segregation for culm length trait. One hundred
eighty homozygote (Eui/Eui or eui/eui) individuals were
obtained. Among them, 10 homozygous individuals with eui/
eui were selected at random and pooled as a long-culm-length
bulk (B L ), while another 10 homozygous individuals with Eui/
Eui were selected at random and pooled as a semidwarf bulk
(B S ).
AFLP analysis was performed using the amplified fragment
length polymorphism (AFLP) Analysis System I kit
(GibcoBRL, Life Technologies) with 33 P-labeled nucleotides
according to the supplier’s instructions and as described by
Vos et al (1995). One hundred twenty-eight primer combinations
in the AFLP Analysis System I were used to investigate
four DNA samples obtained from the parental lines XQZeB-
2(P T ) and AJNT (P S ), long-culm-length bulk (B L ), and semidwarf
bulk (B S ). AFLP bands present or absent in P T and B T ,
but correspondingly absent or present in P S and in B S , were
putatively linked to the eui2(t) gene.
The AFLP fragments were recovered and amplified. The
polymorphic amplification products were then resolved by agarose
gel electrophoresis and purified with a GeneClean kit.
The purified products were then cloned with pGEM R -T Easy
Vector Systems (Promega).
Microsatellite primers were synthesized according to the
reported data (http://genome.cornell.edu/rice/microsatmaps/
chr10.tx). PCR amplification was performed in 10 mM Tris-
HCl (pH 8.3), 50 mM KCl, 2.5 mM MgCl 2 , 10 or 15 ng primer,
0.8 µCi [α- 32 P]dCTP, 100 mM dNTP, and 1.5 U Taq DNA
polymerase, with 30 ng of genomic DNA per 20 µL. Thirtyfive
PCR cycles were performed, with 1 min of denaturation
at 94 o C, 1.5 min of annealing at 58 o C, and 2 min of polymerization
at 72 o C. Polymorphisms in the PCR products were
detected by X-film after electrophoresis on 6% denaturing
polyacrylamide gel (PAGE).
The AFLP marker EM521 was mapped using the
doubled-haploid mapping population from ZYQ/JX and the
corresponding molecular linkage maps using the Mapmaker
software.
Molecular markers, QTL mapping, and marker-assisted selection 317

Distance
from RM222
(cM)
Chr. 10
Locus
Distance (cM)
Chr. 10
Marker
0
4.3
7.1
15.5
16.7
23.1
50.0
51.2
52.1
58.3
61.1
62.3
65.6
68.0
78.4
83.9
89.7
93.0
96.8
107.6
RM222
RM244
RM216
RM239
RM311
G1084
RG257
RM184
RZ625
RG241
RM271
CDO93
RM269
RM258
RM304
RM171
G2155
RM294A
RG134
RZ500
RM147
RM333
RM271
RM269
RM258
RM304
eui(t)
22.20
0.90
10.60
1.40
0.00
EM521
2.1
1.9
14.2
15.6
8.3
4.7
13.1
11.5
16.6
7.8
G333
G1125
G1084
G1082
GA223
G291
EM521
G2155
C16
CT221
C223
Fig. 1. Linkage map of rice
chromosome 10 showing the
location of eui2(t).
Results
Using AFLP analysis and bulked segregant pools from the F 3
progenies of the cross of XQZeB-2 and AJNT, approximately
8,960 AFLP loci were screened with 128 primer combinations.
Four AFLP products generated by two pairs of primer combinations
(E-TC/M-CTT and E-ACA/M-CAG) were identified
as EM436, EM444, EM521, and EM527. Among them,
EM521 and EM436 were found to be a single-copy sequence,
but only the marker EM521 showed polymorphism in RFLP
analysis. EM521 was subsequently mapped on chromosome
10 using a doubled-haploid mapping population. Cosegregation
analysis showed that marker EM521was tightly linked to the
eui2(t) gene. There is only one recombinant in 100 homozygous
individuals with eui/eui or Eui/Eui.
One hundred eighty-six simple sequence repeat (SSR)
markers were screened. Four SSR markers—RM258, RM269,
RM271, and RM304, which were linked to eui2(t) and located
on chromosome 10—were identified. The genetic distances
analyzed with Mapmaker software from the four markers to
eui2(t) were 12.0, 12.9, 35.1, and 1.4 cM, respectively.
The linkage of eui2(t) with SSR markers and the AFLP
marker was analyzed with Mapmaker. Figure 1 shows the results.
It can be concluded that the eui2(t) gene is located in the
middle of the long arm of chromosome 10.
Discussion
AFLP and SSR are powerful markers for tagging and mapping
a new gene. Using these techniques, one AFLP marker and
four SSR markers were identified. These markers solidly
showed that the eui2(t) gene is located in the middle of the
long arm of chromosome 10. Among them, the AFLP marker
EM521 will be very useful in physical mapping because it is
closely linked with eui2(t).
So far, only one eui gene controlling the trait elongated
uppermost internode has been reported; the eui2(t) gene is a
new one. Compared with the lines possessing the eui1 gene,
lines possessing the eui2(t) gene were shorter but had an uppermost
internode with almost the same length. For example,
the proportion of the uppermost internode length to the entire
culm length of XQZeB-2 and XQZeB-1 was 65.3% and 54.8%,
respectively. Compared to the original XQZB, the increased
length of the uppermost internode of XQZeB-2 contributed
90.2% to the total increase in culm length and 53.3% in
XQZeB-1 (Yang et al 1999). This suggested that the identification
of the eui2(t) gene makes it possible to develop hybrid
rice with sterile (A) and restorer lines (R) possessing different
eui genes simultaneously, which would result in no or less application
of GA 3 for both parental lines.
References
Librojo AL, Khush GS. 1986. Chromosomal location of some mutant
genes through the use of primary trisomics in rice. In:
Rice genetics. Manila (Philippines): International Rice Research
Instititue. p 249-255.
Rutger JN, Carnahan HL. 1981. A fourth genetic element to facilitate
hybrid cereal production—a recessive tall in rice. Crop
Sci. 21:373-376.
Shen Zongtan, Yang Changdeng, He Zuhua. 1987. Studies on eliminating
panicle enclosure in a WA-type MS line of rice (Oryza
sativa subsp. indica). Chin. J. Rice Sci. 1(2):95-99. (In Chinese.)
Virmani SS, Dalmacio RD, Lopez MT. 1988. eui gene for elongated
uppermost internode transferred to indica rice. Int. Rice Res.
Notes 13(6):6.
318 Advances in rice genetics

Vos P, Hogers R, Bleeker M, Reijans M, van de Lee T, Hornes M,
Fritjers A, Pot J, Peleman J, Kulper M, Zabeau M. 1995.
AFLP: a new technique for DNA fingerprinting. Nucl. Acids
Res. 3:4407-4414.
Wu Yuliang, He Zuhua, Dong Jixin, Li Debao, Lin Hongxuan,
Zhuang Jieyun, Lu Jun, Zheng Kangle. 1998. The RFLP of
tagging of eui gene in rice. Chin. J. Rice Sci. 12(2):119-120.
(In Chinese.)
Yang RC, Yang SL, Huang RH, Zang QP. 1999. A new gene for
elongated uppermost internode. Rice Genet. Newsl. 16:41-
43.
Notes
Authors’ addresses: S.L. Yang, R.C. Yang, H.L. Ma, Q.Q. Zhang,
S.B. Zhang, Institute of Genetics and Crop Breeding, Fujian
Agricultural University, Fuzhou 350002; X.P. Qu, Institute
of Genetics, Chinese Academy of Science, Beijing 100101,
China.
Acknowledgments: The authors gratefully thank Prof. Bin Wang of
the Institute of Genetics, Chinese Academy of Science, Beijing,
for technical advice and for providing the facilities for this
study, and Prof. Lihuang Zhu, also of the Institute of Genetics,
for kindly providing the doubled-haploid mapping population
and its corresponding molecular linkage maps. This
program is supported by the Fujian Provincial Natural Foundation.
Map-based cloning of Ps1, a gene for pollen abortion in rice
S.Y. Lin, T. Takashi, T. Sasaki, and M. Yano
Abortions of male and female gametes are frequently observed in F 2
and advanced progenies from distant crosses of rice. We
detected a gene, Ps1, for pollen abortion in BC 4
F 4
backcross progenies derived from a cross between japonica variety Nipponbare
and indica variety Kasalath. The Ps1 gene was mapped onto chromosome 1 by a linkage analysis with RFLP markers. Further
progeny analysis using RFLP markers revealed that male gametes carrying the Nipponbare allele at the Ps1 locus were aborted
in plants heterozygous at the Ps1 locus. To isolate the Ps1 gene, we constructed a high-resolution genetic linkage map of the
Ps1 region; the Ps1 gene was mapped into the interval between RFLP markers G270 and E60083. Four P1-derived artificial
chromosome (PAC) clones were selected from the genomic library of Nipponbare by two sequence-tagged sites of G270 and
E60083. By genetic mapping of subclones derived from a PAC clone containing the Ps1 locus, a 20-kb region was defined as
a candidate genomic region for Ps1.
Abortions of male and female gametes are frequently observed
in F 2 and advanced progenies from distant crosses of rice. Such
gamete abortion causes seed sterility and has been the subject
of extensive genetic analysis; many genes involved in sterility
have been reported (reviewed by Ikehashi and Wan 1996,
Kinoshita 1998). However, the molecular basis of this sterility
is still uncertain because no gene has been identified at the
molecular level. While developing chromosomal segmental
substitution lines, we found a remarkable segregation distortion
in advanced backcross progenies derived from a cross
between japonica variety Nipponbare and indica variety
Kasalath. In this study, we proved that the segregation distortion
was caused by pollen abortion and that the gene involved
was located on chromosome 1. Moreover, to identify the gene
for pollen abortion at the molecular level, we performed a highresolution,
fine-scale linkage mapping of the gene. We also
developed a P1-derived artificial chromosome (PAC) clone
contig for the target region.
Small-scale mapping and characterization of Ps1
We used 192 BC 4 F 4 plants of Nipponbare (as the recurrent
parent) and Kasalath for a small-scale mapping of the gene for
pollen abortion. Plants with partially sterile (Fig. 1A) and completely
fertile pollen (Fig. 1B) were segregated in this population.
The segregation of the two classes was 102:90
(sterile:fertile). On the assumption that plants heterozygous at
the causal locus exhibited partial pollen sterility and those
homozygous at the causal locus exhibited complete fertility,
we successfully mapped the target locus between RFLP markers
R1928 and S13994 on chromosome 1 (Fig. 2A) and tentatively
designated it as Ps1. A remarkable segregation distortion
with only a few plants of the Nipponbare type was observed
in this population. These results suggested that the segregation
distortion occurred by pollen abortion and that pollen
with the Nipponbare allele at Ps1 might be selectively
aborted. To confirm the selective abortion of pollen with the
Nipponbare allele at Ps1, we surveyed the segregation distortion
in two BC 1 populations (Table 1). Remarkable segregation
distortion occurred in the BC 1 population derived from a
cross between Nipponbare and a plant heterozygous at Ps1 (as
a male parent), as well as in self-pollinated progenies of a plant
heterozygous at Ps1 (Table 1). On the other hand, no distortion
occurred in the BC 1 population from a cross between a
plant heterozygous at Ps1 and Kasalath (as a male parent)
(Table 1). These results indicated that the segregation distortion
occurred by selective abortion of pollen with the
Nipponbare allele at the Ps1 locus on plants heterozygous at
Molecular markers, QTL mapping, and marker-assisted selection 319

A
B
Fig. 1. Pollen abortion observed
in BC 4 F 4 plants derived from a
cross between Nipponbare and
Kasalath. (A) About half the pollen
was aborted, (B) all pollen
normal.
A
No. of
B C
cM
recombinants
No. of
recombinants
0.3
0.5
0.5
0.3
0.3
1.3
0.3
0.3
2.1
S13849
S765
V139
R1928
Ps1
S13994
S1945
R1467
R3072
9
6
4
R1928
G270
Ps1
E60083
S13994
S1945
P0417G11
P0672C09
P0693H09
P0013G02
G270
E60083
5
1
3
1
G270
Sub-24
Ps1
Sub-4
Sub-9
E60083
R2635
Fig. 2. Fine-scale, high-resolution linkage maps of the Ps1 region on chromosome
1. (A) Linkage map developed by analyzing 192 plants, (B) linkage map developed
by analyzing 2,500 plants, (C) PAC clone containing the Ps1 locus and a fine-scale,
high-resolution linkage map using newly developed RFLP markers derived from the
selected PAC clone.
Table 1. Segregation distortion of marker S13994 tightly linked to
Ps1 in different populations.
Population
Plants (no.) a
NN NK KK
P value
Selfed population 12 102 78

with RFLP markers revealed that Ps1 was mapped between
RFLP markers G270 and E60083, which were developed by
EST mapping (Wu et al 1999) (Fig. 2B). We then used the
sequence-tagged sites of G270 and E60083 to select PAC
clones from the genomic library of Nipponbare developed in
the Rice Genome Research Program (RGP) in Japan (Baba et
al 2000). As a result, four PAC clones were selected and one
PAC clone (P0013G02) was found to contain the Ps1 locus.
An insert of P0013G02 was subcloned and some resultant
subclones were mapped as RFLP markers. Finally, the Ps1
gene was mapped between Sub-9 and Sub-24, and cosegregated
with Sub-4 (Fig. 2C). Using Southern hybridization analysis,
we defined a genomic region of

A B
M 1 2 3 4 M 5 6 7 8 9 M
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 2021 22 M
Fig. 2. Segregation of the RG140L-L locus determined by S-SAP analysis.
PCR products of the segregating population were produced by DNA amplification
with primer RG140L-L. IR46/IR62829 and the genotypes of each F 2
individual were given the designation Rf3, rf3, and Rf3rf3 based on the
banding pattern of the RG140L-L locus. Lane 1: IR62829A, lane 2: IR46,
lanes 3–22: F 2 .
Taq polymerase in a volume of 25 µL). Template DNA was
initially denatured at 94 o C for 5 min, followed by 30 cycles of
PCR amplification under the following parameters: 1-min denaturation
at 94 o C, 1-min primer annealing at 55 o C, and 2-
min primer extension at 72 o C. A final 5-min incubation at 72
o C was allowed for completion of primer extension on a 480-
thermal cycler. The amplified products were electrophoretically
resolved on 1.2% agarose and using 1X TAE buffer.
When combinations of primers RG140FL/RL and
RG140FL/RB were used to amplify the DNA of the parents
IR58025A and IR46, the resulting PCR products were monomorphic.
Therefore, restriction enzymes were used to produce
SAP fragments using a method described by Williams et al
(1991). The amount and quality of PCR amplification were
first monitored by running 10-µL aliquots of the reaction mixture
on agarose gel. The enzyme mix was composed of 3.2 µL
sterile distilled water, 1.5 µL restriction buffer (10X), and 0.3
µL restriction enzyme (10U µL –1 ). After a brief spin in a
microfuge and standing overnight or after 4 h of incubation at
37 o C, the digested products were run on 1.5% agarose to resolve
digested PCR fragments.
Results
Fig. 1. Agarose gel electrophoresis of PCR products
amplified with DNA from varieties with primer
RG140L-L. (A): RG140L-L digested with EcoRI: lane
1: IR46, lane 2: IR62829A, lane 3: IR58025A, lane
4: IR68897A. (B): RG140L-L digested with PvuII: lane
5: IR46, lane 6: IR62829A, lane 7: IR24, Lane 8:
IR58025A, lane 9: ZSA.
The nucleotide sequence of RG140 was determined on the basis
of orientation to ensure accuracy. The G + C content of the
clone was determined to be 50–60%.
We are performing sequence-tagged site (STS) analysis
on the cross IR628295A/IR46R. It is clear from Figure 1 that
PCR can detect polymorphism at certain loci. This polymorphism
can be used as markers to distinguish between Rf3 and
CMS because all loci were scored as codominant.
In the case of RG532L-L, when combined with primer
RG532FL/RL, no polymorphism between IR46 and
IR628295A was observed. The PCR products were digested
with AluI and RsaI. RsaI fragments, which are identical in
IR628295A and IR46R, have to be scored as dominant or recessive
because of the absence of a band in one of the parents.
For example, three restriction sites for RsaI are present in the
PCR products of IR46R (350 and 250 bp) and IR628295A
(800, 350, and 250 bp).
Germplasm survey of polymorphism
When genomic DNA of various genotypes (IR24R, IR40750-
82-2-2-3R, ZSA, IR58025A, and IR68897A) was PCR-amplified
using the above primer combinations, no polymorphism
was noted. However, when the PCR products were digested
by EcoR1 and PvuII enzymes with the primer RG140FL/RL,
we noticed that IR24R and IR40750-82-2-2-3R had the same
band as IR46R and IR58025A, and IR68897A and ZSA had
the same band as IR628295A. Therefore, a PCR-based RFLP
linked to Rf-3 is produced between restorer and sterile lines.
In the case of RG532, when the genomic DNA of IR46R,
IR40750-82-2-2-3R, IR58025A, ZSA, and IR68897A was used
as a template, polymorphic bands among varieties were noted,
making it possible to compare the segregation pattern of the
S-SAP sequence-specific amplification polymorphism marker
with that of the RFLP marker.
Analysis of the F 2
population
DNA from the F 2 population, one of the crosses between
IR628295A and IR46, was assessed through PCR amplification
using the primer RG140FL/RL. The resultant PCR products
were spliced out by enzyme digestion with EcoRI. Fragments
were resolved on agarose gels and the banding patterns
were scored with reference to those of the parents. The banding
pattern of the F 2 individuals could be classified into homozygote
for the IR46R-type marker 900-bp and 500-bp fragments,
homozygote for IR628295A-type marker 1,400-bp fragment,
and heterozygotes (displaying both fragments IR46R and
IR628295A) (Fig. 2). Southern blots of the F 2 population were
322 Advances in rice genetics

Table 1. Rf3 analysis of F 2 through progeny testing and PCR from
IR2829A/IR46.
Progeny test
PCR analysis
Genotypes Plants rf3 rf3 Rf3rf3 Rf3 Rf3
(no.)
Accuracy (%)
rf3 rf3 20 20 0 0 100.0
Rf3 rf3 79 3 74 2 93.6
Rf3 Rf3 21 0 2 19 90.4
Table 2. Prediction of genotypes of F 2 plants based on flanking
RFLP markers (RG140FL/RL and RG532 FL/RL) for the Rf3 locus.
Prediction a Progeny testing Accuracy
(%)
RG532 RG140 rf3 Rf3
rf3 (20) rf3 (20) 20 0 100
Rf3 (21) Rf3 (21) 0 19 100
a No. of plants in parentheses.
probed with RG140. The segregation pattern of the RFLP
markers was the same as that of the S-SAP marker, indicating
that the same locus was detected by both procedures (Fig. 2).
The chi-square test for goodness-of-fit suggested a close
agreement of the SAP and RFLP marker segregation with that
of the expected Mendelian 1:2:1 ratio.
Selection based on a single marker
Closely linked DNA markers have been identified for Rf-3. A
single marker to identify Rf-3 in a segregating population in
120 F 2 individuals was based on a closely linked marker,
RG140 FL/RL from IR628295A/IR46R. The results of two
approaches are compared in Table 1. Twenty individual plants
were homozygous for rf3 rf3 based on the S-SAP and RFLP
markers, and were also found to be homozygous upon progeny
testing. This gives an accuracy of 100%. Of 79 plants that
were scored as heterozygous Rf3 rf3 based on progeny testing,
74 were found to be heterozygous based on SAP and RFLP
markers. Three plants were found to be homozygous rf3 and
two plants were found to be homozygous Rf3 Rf3. This gives
an accuracy of 93.6%. Twenty-one plants were found to be
homozygous Rf3 Rf3. When identifying homozygous restorer
genotypes, 100% was obtained. This gives an accuracy of
90.4%.
Selection based on flanking markers
Single-marker-based selection can be corrected if flanking
markers are used for marker-aided selection. We used both
flanking markers, RG140FI/RL and RG532FI/RL. Selection
accuracy was 100% in identifying plants with homozygous sterility
from a segregation of the F 2 population from IR628295A/
IR46R (Table 2).
Discussion
Two RFLP markers, RG532 and RG140, were mapped on chromosome
1 and found to be closely linked to Rf3. PCR-based
markers can detect polymorphism at certain loci, especially
when DNA from distantly related plants is amplified. In some
lines (ZSA, IR24, and IR46), none of the amplified loci directly
showed size polymorphism. We have consequently digested
the amplification products with four nucleotides recognizing
restriction endonuclease (six cutters). PCR products
were then digested with six-base recognizing restriction endonucleases
to detect DNA variation not detectable as amplified
fragment length polymorphism.
We tested this with the restorer gene Rf3, which has been
previously mapped with RFLP marker RG532 (Zhang et al
1996). We found a flanking marker, RG140, and used both
flanking markers, RG140 and RG532, to perform marker-aided
selection. Selection accuracy was 100% in identifying homozygous
sterile and fertile plants from a segregating F 2 population.
These results demonstrate the usefulness of marker-aided
selection to precisely identify the genotype of a linked target
gene in a segregating population.
References
Nguyen Thi Lang, Subudhi PK, Virmani SS, Huang N, Brar DS.
1997. Development of PCR-based markers for thermosensitive
genetic male sterility gene, tms3(t), in rice. Rice Genet. Newsl.
14:102-103.
Subudhi PK, Borkakati RP, Virmani SS, Huang N. 1997. Molecular
mapping of a thermosensitive genetic male sterility gene in
rice using bulked segregant analysis. Genome 40:188-194.
Williams MNV, Pande N, Nair S, Mohan M, Bennett J. 1991. Restriction
fragment length polymorphism analysis of polymerase
chain reaction products amplified from mapped loci of rice
(Oryza sativa L.) genomic DNA. Theor. Appl. Genet. 82:489-
498.
Zhang G, Angeles ER, Abenes ML, Khush GS, Huang N. 1996.
RAPD and RFLP mapping for the bacterial blight resistance
gene xa-13 in rice. Theor. Appl. Genet. 93:65-70.
Zheng KL, Huang N, Bennett J, Khush GS. 1995. PCR-based markerassisted
selection in rice breeding. IRRI Discussion Paper
Series 12. Manila (Philippines): International Rice Research
Institute.
Notes
Authors’ addresses: Nguyen Thi Lang and B.C. Buu, Cuu Long Delta
Rice Research Institute, Vietnam; S.S. Virmani, N. Huang,
D.S. Brar, and Z. Li, International Rice Research Institute,
DAPO Box 7777, Metro Manila, Philippines.
Acknowledgments: Thanks are due the Rockefeller Foundation for
giving the first author a postdoctoral fellowship, Drs. Gurdev
S. Khush and John C. O’Toole for their kind encouragement
and advice, and staff of the genetic marker laboratory of IRRI
for their assistance.
Molecular markers, QTL mapping, and marker-assisted selection 323

Genetics and mapping of the nuclear fertility restorer gene
for Honglian-type cytoplasmic male sterility in rice
Yinguo Zhu, Qingyang Huang, Yuqing He, and Runchun Jing
Honglian-type CMS (HL-CMS) is a new type of CMS that is different from the BT and WA type. The inheritance and mapping of
fertility restoration of HL-CMS were studied using an HL-CMS line, Congguang 41A. It was gametophytic in nature and controlled
by the interaction of a sterile cytoplasm with one pair of recessive nuclear genes. Comparison of the fertility restoration
relationship and allelism test between Congguang 41A and Zhenshan 97A (WA) showed that their sterile nuclear genes were
nonallelic. The fertility of HL-CMS was restored by a single dominant nuclear gene. Milyang 23 possessed a strong restoring
gene while Zhenshan 97 had a gene for partial fertility restoration. Microsatellite markers were used and a restorer gene was
mapped on chromosome 10, 7.8 and 3.6 cM apart from microsatellite markers RM258 and OSR33, respectively. Evidence
showed that restorer genes clustered on chromosome 10 in the rice genome.
Honglian-type CMS (HL-CMS) was bred by the research group
of Wuhan University. It has been widely used for the hybrid
rice breeding program in China. A series of interspecies and
intersubspecies hybrid rice combinations with high quality and
multiresistance has been bred using HL-CMS rice. HL-type
hybrid rice has been planted on more than 1 million ha every
year in China. In this research, HL-type CMS line Congguang
41A and its restorer lines were used to study the inheritance of
fertility of HL-CMS and map the HL-CMS fertility restorer
gene.
Materials and methods
CMS lines used were HL-type CMS line Congguang 41A and
WA-type CMS line Zhenshan 97A. Restorer lines and varieties
were Congguang 41B, Zhenshan 97B, Maxie B, Yuetai,
Milyang 23, IR661, 6078, Teqing, Shengyou 2, Minghui 63,
3037, and IR72.
Congguang 41A and Zhenshan 97A (control) were used
as female parents and three restorer lines and 10 varieties were
used as male parents. According to testcross results, the F 1 (A
× R), BC 1 (F 1 × B), and F 2 of three combinations from
Congguang 41A and the restorer lines Teqing, Shenyou 2, and
Milyang 2 were selected.
A BC 1 population developed from the cross Congguang
41A//Milyang 23/Congguang 41B was used as the mapping
population. Congguang 41A is a male sterile line of HL type
and Milyang 23 is the corresponding restorer line. Equal
amounts of DNA from 15 fertile and 15 sterile individuals were
pooled to construct the fertile and sterile bulk, respectively.
One hundred and fifty-nine microsatellite primer pairs
used in this study were kindly provided by Dr. Zhu Lihuang.
Polymerase chain reaction (PCR) was performed. The PCR
reaction was performed on a PE DNA Thermal Cycle 480.
Amplification products were sized on a 3.5% agarose gel.
Results
Congguang 41A and Zhenshan 97A were crossed with 12 different
cultivars of rice. Results indicated that the 12 rice cultivars
could be divided into three groups (Table 1). The first
group could restore the fertility of Zhenshan 97A completely
or partially; however, the fertility of Congguang 41A could
not be restored by them, and this group included Congguang
41 and Yuetai. The second group could restore the fertility of
Congguang 41A completely or partially, but it could not restore
that of Zhenshan 97A. This group consisted of Zhenshan
97B and Maxie B. The third group could restore both
Congguang 41A and Zhenshan 97A, and included Teqing,
Milyang 23, Shenyou 2, Minghui 63, 6078, IR661, 3037, and
IR72. Comparison of the fertility restoration relationship between
these two kinds of CMS lines showed that their nuclear
sterile genes were nonallelic. Their fertility restoration relationships
were significantly different. The pollen fertility of
F 1 hybrids between Congguang 41A and its restorer lines was
about 50%, but the natural seed setting rate was normal. This
result indicated that the male sterility of Congguang 41A was
gametophytic.
The natural seed setting rate of BC 2 and F 2 from
Congguang 41A/Teqing and Congguang 41A/Milyang 23 was
significantly different from the distribution of pollen fertility
from the F 2 . The mean natural seed setting rate of F 2 populations
from these two combinations was 79.2% and 77.4%, respectively,
which was higher than that of the F 1 generation by
1.7% and 11.5%, respectively.
DNA from Congguang 41A, Milyang 23, the fertile bulk,
and the sterile bulk was used as a PCR template to perform
microsatellite analysis using 159 microsatellite primer pairs.
Thirty-six primer pairs generated polymorphic bands between
parents. The primers RM258 and OSR33 located on chromosome
10 previously demonstrated polymorphic amplifications
between the sterile and fertile bulks. This result indicated that
the nuclear fertility restorer gene for HL-type CMS was on
chromosome 10. Linkage analysis with Mapmaker 3.0 revealed
324 Advances in rice genetics

Table 1. Comparison of fertility restoration (%) between Congguang 41A and
Zhenshan 97A.
Male parent
Self-cross Congguang 41A Zhenshan 97A
PFR a NSSR b PFR NSSR PFR NSSR
Congguang 41B 80.4 79.3 0 1.5 63.2 67.1
Yuetai 68.0 88.2 0.5 5.9 81.6 59.0
Zhenshan 97B 69.6 83.2 27.2 36.3 0 2.5
Maxie B 83.0 86.6 49.5 59.1 0 6.5
Milyang 23 83.0 89.0 49.3 65.9 84.8 –
Teqing 81.1 85.2 49.3 77.7 88.5 61.6
Shenyou 2 75.2 89.7 51.1 92.2 83.9 80.7
IR661 78.5 84.5 51.1 76.3 89.2 76.1
6078 80.7 61.8 50.0 81.6 82.5 60.0
Minghui 63 85.1 86.1 26.2 80.7 82.0 86.2
3037 83.4 73.4 52.2 69.7 89.8 83.9
IR72 81.0 85.9 54.7 82.8 79.9 52.8
a PFR = pollen fertility rate. b NSSR = natural seed setting rate.
cM
3.6
7.8
Rf-5
OSR33
RM258
Fig. 1. Location of the fertility
restorer gene (Rf-5) for
Honglian-type CMS rice.
that the fertility restorer gene was linked to these two markers
with a distance of 7.8 and 3.6 cM, respectively (Fig. 1).
Comparison of the fertility restoration relationship and
allelism test between HL-CMS and WA-CMS showed that their
nuclear sterility genes were nonallelic. The fertility of HL-CMS
was restored by a single dominant gene. Milyang 23 possessed
a strong restorer gene while Zhenshan 97 had a gene for partial
fertility restoration. The fertility restorer gene for HL-CMS
was mapped on chromosome 10. Akagi et al (1996) located
the fertility restorer gene for BT-CMS on chromosome 10,
with a distance of 3.7 cM from OSR33. Yao et al (1997) also
mapped Rf-4 for WA-CMS to chromosome 10, with a distance
of 3.3 cM from G4003. Comparison of the different molecular
linkage maps suggested that three restorer genes were located
on an adjacent region on chromosome 10. These results suggest
that, just like disease resistance genes, restorer genes may
also be clustered on the chromosome.
References
Akagi H, Yokozeki Y, Inagaki A, Fujimura. 1996. A codominant
DNA marker closely linked to the rice nuclear restorer gene,
Rf-1, identified with inter-SSR fingerprinting. Genome
39:1205.
Yao FY, Xu CG, Yu SB, Li JX, Gao YJ, Li XH, Zhang Q. 1997.
Mapping and genetic analysis of two fertility restorer loci in
the wild-abortive cytoplasmic male sterility system of rice
(Oryza sativa L.). Euphytica 98:183.
Notes
Authors’ addresses: Yinguo Zhu and Runchun Jing, College of Life
Sciences, Wuhan University, Wuhan 430072, China; Qingyang
Huang, College of Life Sciences, Central China Normal University,
Wuhan 430079, China; Yuqing He, National Key
Laboratory of Crop Improvement, Huazhong Agricultural
University, Wuhan 430070, China.
Molecular markers, QTL mapping, and marker-assisted selection 325

Molecular mapping and identification of QTLs
for some agronomic traits in rice
S.J. Kwon, S.N. Ahn, J.P. Suh, Y.C. Cho, H.C. Hong, Y.G. Kim, H.G. Hwang, H.P. Moon, and H.C. Choi
A molecular map of rice consisting of 114 amplified fragment length polymorphism (AFLP) and 38 simple sequence length
polymorphism (SSLP) markers was constructed using an F 8
recombinant inbred (RI) population derived from the cross between
two temperate japonica parents, Suweon365 and Chucheongbyeo. A set of SSLP markers was used to construct the framework
map. The AFLP markers were derived from 11 EcoRI(+2) and MseI(+3) primer combinations. Proportions of polymorphic
bands between the parents averaged 21.8% and 13.0% for SSLP and AFLP, respectively. The map covered 756.8 cM of the 12
rice chromosomes, with an average interval size of 5.6 cM. A total of seven significant quantitative trait loci for days to heading,
panicle length, panicles plant –1 , and spikelets panicle –1 were detected on four different chromosomes.
Molecular maps have been developed in rice using
intersubspecific (McCouch et al 1988, Cho et al 1998) and
interspecific crosses (Causse et al 1994). In Korea, the national
rice breeding program aims to develop high-quality varieties
with resistance to diseases using only japonica as parents.
To facilitate breeding work, molecular linkage maps based
on japonica × japonica crosses must be developed so that
marker-assisted selection can be used to exploit favorable traits
in japonica rice varieties. This study was carried out to develop
a molecular map from crosses of two japonica cultivars.
Materials and methods
The 231 recombinant inbred lines (RIL) (F 8 ) were developed
from the cross between two japonica (Suweon365,
Chucheongbyeo) cultivars at the National Crop Experiment
Station in Korea. These 231 lines were grown in the field with
the parents and evaluated for traits such as days to heading,
culm length, panicle length, panicles plant –1 , spikelets
panicle –1 , and grain yield. DNA was extracted from the fresh
young leaves of each RIL following procedures described in
Causse et al (1994). Procedures for simple sequence length
polymorphism (SSLP), amplified fragment length polymorphism
(AFLP) analysis, and silver staining are as described in
Panaud et al (1996) and Cho et al (1998). The Mapmaker program
was used to establish a molecular map at an LOD value
of 3.0. Quantitative trait loci (QTL) analysis was performed
using one-way analysis of variance (ANOVA) and the QGENE
program. An LOD score of 2.0 was used as the threshold for
detecting QTL location.
Results and discussion
Figure 1 shows the frequency distribution of phenotypes for
each trait; all traits displayed approximately normal distribution.
A total of 187 microsatellite markers were evaluated for
polymorphism between the parents; 38 (21.8%) of them detected
polymorphism. A single restriction enzyme combination
(EcoRI and MseI) was used to produce the AFLP data.
The AFLP markers were derived from 11 different EcoRI(+2)/
MseI(+3) primer combinations with different overhangs (data
not shown). The number of bands produced by each primer
combination ranged from 47 to 113, with a mean of 82.5. Of
the 909 AFLP bands, 118 (13.0%) were polymorphic (Table
1). The level of polymorphism was lower than that between
temperate and tropical japonica (Mackill et al 1996). The six
primer combinations having MseI(+CAT) in common showed
higher polymorphism; a total of 97 out of the 118 AFLP markers
scored were integrated into the map.
All 135 SSLP and AFLP markers have been mapped
and a set of 38 SSLP loci was used to construct the framework
(Chen et al 1997). The integration of AFLPs onto the SSLP
map produced an SC map with a total of 756.8 cM, and an
average interval size of 5.6 cM (data not shown). The genomic
coverage of the SC map is incomplete, as indicated by the
shorter total map length relative to the other maps. This map
has relatively fewer markers for chromosomes 1, 2, 3, and 6
and more markers for chromosomes 11 and 12. Redoña and
Mackill (1996) reported similar results for chromosomes 10
and 11, suggesting that these chromosomes may be highly polymorphic
within the subgroup and may be involved in the genetic
differentiation of japonica cultivars.
A total of seven significant QTLs were identified: two
for days to heading, three for panicle length, and one each for
panicles plant –1 and spikelets panicle –1 (Table 2). Two putative
QTLs were detected for days to heading on chromosomes
6 and 7. The two QTLs explained 15.9% of the total phenotypic
variation. Chromosomal locations of the two QTLs agree
with those reported previously (Yano et al 1997). For panicle
length, three QTLs were detected, accounting for 17.8% of
the total phenotypic variation. They were located near RM214
and RM215 on chromosomes 7 and 9, and on chromosome 11
between OSR01 and ATT59B. One significant QTL, qPPL-
11, was detected for panicles plant –1 . The Suweon365 allele
decreased the number of panicles plant –1 by 0.9 and accounted
for 4.1% of the total phenotypic variation. One significant QTL,
qSPP-11, was associated with spikelets panicle –1 on chromosome
11.
The QTLs detected in this study are minimal considering
that the map coverage is not complete. More markers are
326 Advances in rice genetics

Frequency
Frequency
Frequency
(Mean ± SD)
Suweon365: 104
Chuchengbyeo: 114
RILs: 108 + 5
60
50
40
30
20
10
0
99 105 111 117
102 108 114 120
Days to heading
70
60
50
40
30
20
10
0
(Mean ± SD)
Suweon365: 79.8 ± 2.1
Chuchengbyeo: 89.6 ± 1.5
RILs: 84 ± 8.2
63 73 83 93 103
68 78 88 98
Culm length
100
80
60
40
20
0
16
(Mean ± SD)
Suweon365: 19.9 ± 0.5
Chuchengbyeo: 18.0 ± 0.7
RILs: 19.6 ± 1.2
18 20 22
17 19 21
Panicle length
23
70
60
50
40
30
20
10
0
9
(Mean ± SD)
Suweon365: 15 ± 1.4
Chuchengbyeo: 17.4 ± 0.9
RILs: 15 ± 2.0
13
11
17 21
15 19
25
23
100
80
60
40
20
0
(Mean ± SD)
Suweon365: 92.0 ± 4.8
Chuchengbyeo: 88.3 ± 5.9
RILs: 91.0 ± 14.5
60 82 104 126
71 93 115 137
(Mean ± SD)
Suweon365: 627 ± 18.3
Chuchengbyeo: 580 ± 33.1
RILs: 649 ± 98.1
80
70
60
50
40
30
20
10
0
400 540 680 810 950
470 610 740 880
Panicles plant –1 (no.)
Spikelets plant –1 (no.)
Grain yield (kg 0.1 ha –1 )
Fig. 1. Frequency distribution of six traits in Suweon365/Chucheongbyeo recombinant inbred lines. The
value on the x-axis is the mid-value of each group.
Table 1. Analysis of polymorphism produced by SSLP and AFLP between
the parents.
Marker No. Polymorphic Level of Integrated
of bands bands (no.) polymorphism (%) markers (no.)
SSLP 187 38 21.8 38
AFLP 909 118 13.0 97
47 2 4.3 2
113 17 15.0 15
102 16 15.7 13
92 15 16.3 14
107 17 15.0 12
104 15 15.9 12
105 16 15.2 13
61 5 8.2 4
53 5 9.4 5
60 5 8.3 5
65 5 7.7 2
being added to this map; evaluation of other traits of agronomic
importance such as grain quality and others is also under
way. Mapping information from this study would be useful
for exploiting favorable traits in japonica rice varieties via
marker-assisted selection.
References
Causse MA, Fulton TM, Cho YG, Ahn SN, Chunwongse J, Wu KS,
Xiao JH, Yu ZH, Ronald PC, Harrington SE, Second G,
McCouch SR, Tanksley SD. 1994. Saturated molecular map
of the rice genome based on an interspecific backcross population.
Genetics 138:1251-1274.
Chen X, Temnynkh S, Xu Y, Cho YG, McCouch SR. 1997. Development
of a microsatellite map providing genome-wide coverage
in rice (Oryza sativa L.). Theor. Appl. Genet. 95:553-
567.
Cho YG, McCouch SR, Kuiper M, Kang MR Pot J, Groenen JTM,
Eun MY. 1998. Integrated map of AFLP, SSLP, and RFLP
markers using a recombinant inbred population of rice (Oryza
sativa L.). Theor. Appl. Genet. 97:370-380.
Mackill DJ, Zhang Z, Redoña ED, Colowit PM. 1996. Level of polymorphism
and genetic mapping of AFLP markers in rice.
Genome 39:969-977.
McCouch SR, Kochert G, Yu ZH, Wang ZY, Khush GS, Coffman
WR, Tanksley SD. 1988. Molecular mapping of rice chromosomes.
Theor. Appl. Genet. 76:815-829.
Panaud O, Chen X, McCouch SR. 1996. Development of
microsatellite markers and characterization of simple sequence
length polymorphism (SSLP) in rice (Oryza sativa L.). Mol.
Gen. Genet. 252:597-607.
Redoña ED, Mackill DJ. 1996. Molecular mapping of quantitative
trait loci in japonica rice. Genome 39:395-403.
Molecular markers, QTL mapping, and marker-assisted selection 327

Table 2. Quantitative trait loci related to agronomic traits in Suweon365/Chucheongbyeo recombinant inbred
lines (RILs).
Associated Peak % of Phenotypic effect Allele
Trait QTL Chromosome marker LOD PV a effect
SS CC
Days to heading qDTH-6 6 OSR19 4.78 9.6 110.3 107.3 3.0
qDTH-7 7 RM476 3.65 6.3 107.3 109.7 –2.4
Panicle length qPL-7 7 RM214 3.19 6.6 19.9 19.3 0.6
qPL-9 9 RM215 2.75 5.3 19.4 20.0 –0.6
qPL-11 11 OSR01– 2.20 5.9 19.9 19.3 0.6
ATT59B
Panicles plant –1 (no.) qPPP-11 11 em2215 2.04 4.1 14.6 15.5 –0.9
Spikelets panicle –1 (no.) qSPP-11 11 em626 5.32 8.5 95.2 86.7 8.5
a PV = phenotypic variation.
Yano M, Harushima Y, Nagamura Y, Kurata Y, Minode Y, Sasaki T.
1997. Identification of quantitative trait loci heading date in
rice using a high-density linkage map. Theor. Appl. Genet.
95:1025-1032.
Notes
Authors’ addresses: S.J. Kwon, J.P. Suh, Y.C. Cho, H.C. Hong, Y.G.
Kim, H.G. Hwang, H.C. Choi, National Crop Experiment Station,
RDA, Suwon 441-100; H.P. Moon, National Yeongnam
Agricultural Experiment Station, RDA, Milyang 627-130; S.N.
Ahn, Department of Agronomy, Chungnam National University,
Taejon 305-764, Korea. E-mail: sjkwon@nces.go.kr.
Mapping QTLs associated with tolerance for enhanced
ultraviolet-B radiation in rice
T. Sato, Y. Fukuta, M. Yano, and T. Kumagai
An understanding of the genetics of tolerance for enhanced ultraviolet-B (UV-B) radiation could aid in developing rice adaptable
to areas with high UV-B radiation. Putative quantitative trait loci (QTLs) associated with tolerance for enhanced UV-B radiation
in rice were identified using 98 backcross inbred lines (BIL) derived from the cross of japonica cv. Nipponbare (tolerant) ×
indica cv. Kasalath (susceptible). We used 245 RFLP markers to construct a framework linkage map. Lines were grown under
visible radiation with or without supplemental UV-B radiation in a growth chamber. We measured the dry weight of biomass,
plant height, and the accumulation of UV-absorbing compounds in leaf blades. As a measure of UV-B tolerance, we compared
the ratios of dry weight to those of the control under UV-B radiation. The ratio of dry weight in BILs demonstrated transgressive
variation. QTL analysis was conducted using interval analysis (QGENE). Three putative QTLs associated with tolerance for
increased UV-B radiation were mapped on chromosomes 1, 7, and 10. A major QTL on chromosome 10 accounted for 36% of
the total phenotypic variation. One QTL on chromosome 1 coincided with the chromosomal region associated with the accumulation
of UV-absorbing compounds on the leaf blade. The Nipponbare alleles showed tolerance for enhanced UV-B radiation,
except for those of one QTL on chromosome 7.
The depletion of the stratospheric ozone because of man-made
pollution has resulted in increased solar ultraviolet-B (UV-B)
radiation on Earth’s surface. In particular, information about
the effect of increased UV radiation on growth and development
of cereal crops is lacking. In a 5-y field study, we found
that enhanced UV-B radiation might have a negative effect on
grain development in the field in cool rice-cultivation regions
(Kumagai et al 2001). In previous experiments, we found that
various cultivars belonging to the same ecotype showed differences
in sensitivity to increased UV-B radiation (Kumagai
and Sato 1992). The sensitivity to increased UV-B radiation
in Japanese lowland rice cultivars was controlled by more than
two genes (Sato et al 1994). Furthermore, the tolerance for
increased UV-B radiation partly depended on the accumulation
of UV-absorbing compounds in leaf blades (Sato and
Kumagai 1997). The reasons for cultural variability in tolerance
for UV-B radiation are not yet well understood. We need
to understand first the genetic bases of UV tolerance and sensitivity.
The objective of this study was to identify putative
QTLs associated with tolerance for increased UV-B radiation
in rice.
328 Advances in rice genetics

C112
R117
C742
R2414
C86
C813
R2417
C1370
C122
R886
C808
R1485
R2635
R1928
C178
R2329
R210
C1211
C955
C885
R1944
R1613
C970
C161
UV-B sensitivity index
UV-absorbing substance
Length of 3rd leaves
C261
C1057
R565
S10012
R2401
R1488
C39
C1226
R1440
R3089
C451
R1357
R1245
C847
C1412
R1789
C596
C213
C728
LOD 0.0 LOD 0.0
LOD 0.0
C701
R1933
R2174
R2194
R1629
R2447
C1286
C1369
R1877
C488
R716
C809
G127
C223
Chr 1
Chr 7
Chr 10
Fig. 1. Interval analysis for UV-B sensitivity, the content of UV-absorbing compounds, and the length of the 3rd leaf. The arrowhead
indicates the position of putative QTLs, and open and darkened arrowheads show that Nipponbare (japonica) and Kasalath
(indica) alleles increase each parameter, respectively. Fine vertical lines represent the threshold for detection of a QTL (LOD =
1.50).
Materials and methods
Ninety-eight BC 1 F 5 lines developed from a backcross (BC 1 F 1 )
of Nipponbare (japonica, UV-B tolerant)/Kasalath (indica, UV-
B sensitive)//Nipponbare at the National Institute of Agricultural
Science and Technology were used (Lin et al 1998). A
linkage map of the 245 restriction fragment length polymorphism
(RFLP) markers used for QTL analysis was obtained
from the Rice Genome Project, Japan, previously described
by Lin et al (1998). Germinated seeds of backcross inbred lines
(BILs) were planted in synthetic culture soil in seedling trays
and transferred to a large growth chamber. These BIL plants
were grown for 4 wk under visible light with or without supplemental
UV-B radiation. Plants received 12 h of 130 µmol
m –2 s –1 photosynthetic photon flux density (PPFD). Ultraviolet-B
fluorescent tubes were suspended above the rice plants
and wrapped with cellulose diacetate (0.13 mm thick) films to
eliminate UV radiation with wavelengths below 290 nm. The
cellulose diacetate films were replaced every 10 d to maintain
uniform optical properties. The plant materials of aerial parts
in each BIL were oven-dried at 80 °C for 72 h and weighed.
Leaf tissues were cut into small pieces and immersed in 10 mL
of 70% methanol/1% HCl (v/v) in the dark at room temperature
for 4 d. The relative level of accumulation of UV-absorbing
compounds was determined by measuring the absorbance
at 330 nm using a spectrophotometer. The QTLs associated
with the percent change in dry weight and the accumulation of
UV-absorbing compounds were analyzed using interval analysis
of computer program QGENE (Nelson 1997).
Results and discussion
The percent change in dry weight (DW%) of aerial parts under
increased UV-B radiation in two parents, Nipponbare and
Kasalath, was 65% and 18%, respectively. The DW% of BILs
ranged from 12% to 87% with continuous variation and demonstrated
transgressive segregation. The transgressive segregation
resulted from the recombination of two or more genes
contributing to UV-B tolerance in rice. Three putative QTLs
on chromosomes 1, 7, and 10 were detected for DW%, together
explaining 53.7% of the phenotypic variation (Fig. 1).
The percentage of phenotypic variation that was explained by
QTLs on chromosomes 1 and 10 was 14% and 37%, respectively.
Nipponbare alleles increased the DW% of putative QTLs
on chromosomes 1 and 10, whereas the Kasalath allele increased
the DW% of the putative QTL on chromosome 7. The
putative QTL for accumulating UV-absorbing compounds in
the leaf blade was close to the chromosome region associated
with the putative DW% QTL on chromosome 1. Therefore,
tolerance for increased UV-B radiation was partially caused
by the accumulation of UV-absorbing compounds. Once this
was known, we could explore the possibility of using conventional
breeding to minimize the potential impact of increased
UV-B damage.
Molecular markers, QTL mapping, and marker-assisted selection 329

References
Kumagai T, Hidema J, Kang HS, Sato T. 2001. Effects of supplemental
UV-B radiation on the growth and yield of two cultivars
of Japanese lowland rice (Oryza sativa L.) under the field
in a cool rice-growing region of Japan. Agric. Ecosyst.
Environ. 83(1/2):201-208.
Kumagai T, Sato T. 1992. Inhibitory effects of increase in near-UV
radiation on the growth of Japanese rice cultivars (Oryza sativa
L.) in phytotron and recovery by exposure to visible radiation.
Jpn. J. Breed. 42:545-552.
Lin SY, Sasaki T, Yano M. 1998. Mapping quantitative trait loci
controlling seed dormancy and heading date in rice, Oryza
sativa L., using backcross inbred lines. Theor. Appl. Genet.
96:997-1003.
Nelson C. 1997. QGENE: software for marker-based genomic analysis
and breeding. Mol. Breed. 3:239-245.
Sato T, Kang HS, Kumagai T. 1994. Genetic study of resistance to
inhibitory effects of UV radiation in rice (Oryza sativa L.).
Physiol. Plant. 91:234-238.
Sato T, Kumagai T. 1997. Role of UV-absorbing compounds in genetic
differences in the resistance to UV-B radiation in rice
plants. Breed. Sci. 47:21-26.
Notes
Authors’ addresses: T. Sato and T. Kumagai, Institute of Genetic
Ecology, Tohoku University, Aoba-ku, Sendai 980-8577, Japan;
Y. Fukuta, Plant Breeding, Genetics, and Biochemistry
Division, International Rice Research Institute, DAPO Box
7777, Metro Manila, Philippines; M. Yano, Rice Genome Research
Program, National Institute of Agrobiological Resources,
2-1-2 Kannondai, Tsukuba 305-8602, Japan.
Genetic systems of cross-incompatibility
as pre- and postfertilization barriers in rice
K. Matsubara, R. Suzuki, Khin-Tidar, K. Okuno, and Y. Sano
Both pre- and postfertilization barriers have been detected after introducing alien genes from wild rice into cultivated rice,
which showed unidirectional cross-incompatibility. Aborted seeds were frequently produced when the near-isogenic line (NIL,
japonica type) carrying the segment of chromosome 6 from Oryza rufipogon was pollinated with the recurrent parent, whereas
the reciprocal showed normal seed setting. The cross-incompatibility was explained by three genes (Cinf, Su-Cinf, and cinm),
all of which were located on the short arm. Cinf and cinm controlled the cross-incompatibility in the female and male,
respectively, and Su-Cinf acted as a suppressor of Cinf. All three genes were expressed sporophytically. Meanwhile, retardation
of pollen tube elongation was observed when Akihikari (japonica type) was pollinated with IR58. The genetic analysis suggested
that both female and male reactions in Akihikari were controlled by dominant genes, confirming that the genes for crossincompatibility
are present in closely related relatives of rice.
Crossing barriers are frequently recognized in rice when distantly
related taxa are intercrossed. A range of variation in the
rate of success is also found in crosses between taxa sharing
the primary gene pool (Chu et al 1969, Sitch and Romero 1990).
Attention has been given to rice only in crosses with distantly
related taxa since hybrid seeds are obtained even in crosses
showing a reduced seed set. Recently, both pre- and
postfertilization barriers have been detected after introducing
alien genes from wild rice into cultivated rice, and both cases
showed unidirectional cross-incompatibility (Okuno 1996,
Sano 1992). Here we compared the genetic basis in the two
cross-incompatibility systems in rice.
Postfertilization barrier in a cross with wild rice
Reduced seed set was found during backcrossing between
T65wx (near-isogenic line, NIL, with wx) and W593 (Oryza
rufipogon from Malaysia). A segment of chromosome 6 was
introduced from W593 into T65wx and the resultant NIL produced
many shrunken seeds when it was again backcrossed
with T65wx, although the reciprocal cross showed a high seed
set (Sano 1992). A histological observation revealed that the
cell division in the young embryo seemed to proceed normally
but showed an overgrowth with deformed tissue differentiation
10 d after pollination. In contrast, the triploid endosperm
deteriorated within a few days after pollination, suggesting that
the aborted seeds resulted from irregularities in the formation
of endosperm as often found in wide crosses. Unidirectional
cross-incompatibility was controlled by a dominant gene located
near C (Chromogen). The alien segment was dissected
in the backcrossed population with restriction fragment length
polymorphism (RFLP) markers. Unexpectedly, no cross-incompatibility
was found when the plant with an alien segment
around the centromere was used as the pollen parent instead
of T65wx.
These observations led us to believe that the unidirectional
cross-incompatibility was regulated by the female and
male reactions. Accordingly, the causal gene near C was designated
Cinf (Cross-incompatibility in the female reaction) and
that near the centromere was cinm (cross-incompatibility in
330 Advances in rice genetics

Table 1. Percent crossability among crosses involving genotypes Cinf, cinm,
or Su-Cinf between W593 and T65wx. a
Combination cross Spikelets Seeds obtained (no.) Crossability
pollinated (%)
Female Male (no.) Normal Aborted
Cinf/Cinf cinm/cinm 331 40 157 12.1
Cinf/Cinf Cinm/Cinm 59 36 1 61.0
Cinf/Cinf Cinm/cinm 68 38 4 55.8
Su-Cinf/su-Cinf cinm/cinm 105 65 7 61.9
su-Cinf/su-Cinf cinm/cinm 186 15 98 8.1
a The NILs of T65wx were used for the cross experiments. The genotype of T65wx was cinfcinf
cinmcinm su-Cinfsu-Cinf. Cinf and Su-Cinf were introduced into T65wx from W593 and Patpaku,
respectively, while Cinm was from both donors. Cinm and Su-Cinf were located near the centromere
of chromosome 6 based on RFLP analysis.
Table 2. Percent crossability and rate a of pollen tubes that reached
the micropyle in crosses among IR58, Akihikai, and the F 1 .
Cross-combination Spikelets Crossability Rate of pollen
pollinated (%) tubes that
Female Male (no.) reached the
micropyle (%)
IR58 IR58 100 82.0 75.0
Akihikari Akihikari 119 96.6 80.6
IR58 Akihikari 69 0.0 0.0
IR58 F 1 21 9.5 4.5
F 1 Akihikari 36 55.6 60.0
Fig. 1. Growth of pollen tubes observed 4 h after
pollination when Akihikari (A) and IR58 (B) were
pollinated with Akihikari.
No. of pollen tubes that reached micropyle
Rate = × 100
No. of germinated pollen grains
the male reaction). Crossing experiments showed that both
genes acted sporophytically (Table 1). The gene cinm seemed
to be widely distributed in japonica-type rice since a reduced
seed set was frequently found when it was pollinated to Cinf
plants. However, it was noted that a reduced seed set was seldom
detected in crosses with indica type. To look into the genetic
constitutions of indica rice, the short arm of chromosome
6 was introduced from Patpaku into T65wx by backcrosses.
The NIL gave a high seed set when pollinated to the
pistils of the Cinf genotype, suggesting that the segment from
Patpaku might carry Cinm-like W593.
When T65wx was pollinated to the hybrid between the
two NILs carrying Cinf from W593 or Cinm from Patpaku,
the cross was expected to give a reduced seed set since Cinf
was dominant. However, the result indicated that the segment
introduced from Patpaku carried not only Cinm but also another
gene suppressing Cinf in the female reaction. The suppressor
seemed to be dominant since the heterozygote gave a
normal seed set when pollinated with T65wx, suggesting that
the gene was also expressed sporophytically (Table 1). The
suppressor was tentatively designated Su-Cinf. Thus, the crossincompatibility
was controlled by at least three genes, all of
which acted sporophytically and were located on the short arm
of chromosome 6.
Prefertilization barrier in a varietal cross
Recently, it was reported that IR58 showed a reduced seed set
when pollinated with Akihikari (japonica type), whereas the
reciprocal cross showed a normal seed set (Okuno 1996). Fluorescence
microscopic observation revealed that retardation in
pollen tube growth was the cause of the cross-incompatibility,
suggesting the presence of a prefertilization barrier (Fig. 1).
Although this is the first example of cross-incompatibility
within O. sativa, it was speculated that this might have resulted
from wide hybridization when a resistance gene for
grassy stunt virus from wild rice was introduced (Okuno 1996),
suggesting that caution must be exercised when using alien
germplasm in the future.
The cross-incompatibility was reconfirmed at Sapporo
based on seed set in the reciprocal crosses. A high seed set
was observed when the F 1 was pollinated with pollen grains of
Akihikari, but not when pollen grains of the F 1 were applied to
the pistils of IR58. In addition, the growth of pollen tubes after
germination was related to the degree of seed set in the
crosses (Table 2). This indicated that the arrest of the growth
of pollen tubes was the causal factor. Results suggested that
the cross-incompatibility was controlled by a recessive gene(s)
Molecular markers, QTL mapping, and marker-assisted selection 331

in the female reaction, but by a dominant gene(s) in the male
reaction.
The growth of pollen tubes was investigated to examine
F 2 segregation. The female and male reactions in each plant
were estimated by crossing to IR58 and with Akihikari, respectively
(Fig. 1). The result showed that the female and male
reactions seemed to be independently inherited, suggesting that
the gene(s) controlling the female and male reactions could be
recombined.
References
Chu YE, Morishima H, Oka HI. 1969. Reproductive barriers distributed
in cultivated rice species and their wild relatives. Jpn.
J. Genet. 44:207-223.
Okuno K. 1996. Partial cross-incompatibility in cultivated rice. Rice
Genet. Newsl. 13:117-118.
Sano Y. 1992. Genetic comparisons of chromosome 6 between wild
and cultivated rice. Jpn. J. Breed. 42:561-572.
Sitch LA, Romero GO. 1990. Attempts to overcome prefertilization
incompatibility in interspecific and intergeneric crosses involving
Oryza sativa L. Genome 33:321-327.
Notes
Authors’ addresses: K. Matsubara, R. Suzuki, Khin-Tidar, and Y.
Sano, Faculty of Agriculture, Hokkaido University, Sapporo
060-8589; K. Okuno, Hokkaido National Agricultural Experiment
Station, Hitsujigaoka, Sapporo 062-0045, Japan.
Female reaction (%)
80
60
40
20
0
Akihikari
F 1
IR58
20 40 60 80
Male reaction (%)
Fig. 2. Segregation pattern of the cross-incompatibility
in female and male reactions in F 2 plants of IR58 ×
Akihikari. The cross-incompatibility of each plant was
estimated from the rates of pollen tubes reaching the
micropyle when crossed to IR58 ( ) for the male reaction
and when crossed with Akihikari ( ) for the female
reaction.
Relationship between genetic distance and heterosis
under different fertilizer applications in rice
Z.Z. Piao, Y.I. Cho, and H.J. Koh
The 36 F 1
s from a half-diallel cross among nine parents, including five indicas (Dasanbyeo, Nonanbyeo, Milyang23, Guichow,
and CP-SLO), two japonicas (Hapcheon 1 and TR22183), and two new plant type (NPT) lines (IR66167-27-5-1-6, IR66746-
76-3-2), were grown under different fertilizer conditions. Heterosis was highest for grain yield in both fertilized and unfertilized
conditions, 60.4% and 11.6%, respectively. The extent of heterosis for all characters except grain fertility was significantly
higher in N-fertilized plots than in N-unfertilized plots. The 55 random decamers amplified 228 bands from the genomic DNAs
of nine parents, with an average of 4.16 bands per primer. Of these, 128 bands (56%) were polymorphic. Genetic distance
among parents ranged from 0.128 to 0.411; the closest was between IR66167-27-5-1-6 and IR66746-76-3-2 and the
farthest was between Dasanbyeo and TR22183. The nine parents were clustered into three groups. Significant positive correlations
were found between genetic distance and dry matter and grain yield in N-fertilized conditions, but not in N-unfertilized
conditions. This indicated that prediction of heterosis through genetic distance among parents based on random amplified
polymorphic DNA analysis is possible under normal N application.
Hybrid rice breeding has been successful via the development
of superior hybrids and the increase in outcrossing rates for
hybrid seed production (Virmani 1994). In intervarietal F 1 hybrids,
a standard maximum 40% heterosis in grain yield was
recorded (Koh et al 1990). In intersubspecific hybrids, a yield
increase of 30% over the existing best intervarietal hybrid varieties
is expected (Yuan 1994). Kato et al (1994) reported
that heterosis in hybrids from crosses between indica and
japonica varieties was generally larger than that in intervarietal
hybrids. Significant relationships were observed between the
heterosis of biomass and the polymorphism of isozymes and
restriction fragment length polymorphism (RFLP) markers.
332 Advances in rice genetics

Prediction of heterosis prior to field evaluation of F 1 hybrids
may promote the rapid and economical development of heterotic
hybrid combinations. Many researchers have reported
on the possibility of predicting F 1 yield via the estimation of
genetic distances by DNA markers. Recently, because of growing
concern about the environment, environment-favorable crop
cultivation has been stressed through the use of fewer agrochemical
inputs. Thus, studies on exploiting heterosis under
low fertilizer conditions are required.
This study was carried out to examine heterosis for characters
related to grain yield in F 1 hybrids among japonica, indica,
and new plant type (NPT) rice varieties, and to investigate
the relationship between heterosis and genetic distances
among parents based on random amplified polymorphic DNA
(RAPD) markers under N-fertilized and -unfertilized conditions.
Materials and methods
Nine parents, which included four indicas, two temperate
japonicas, two NPT lines, and one tropical japonica, and 36
F 1 hybrids from half-diallel crosses were grown on the experimental
rice field of Seoul National University in Suwon, Korea.
The 36 F 1 hybrids and parents were seeded on 26 April
and transplanted at one plant per hill on 29 May, with a planting
density of 25 × 15 cm. Fertilizer was applied at two levels—ordinary
N fertilizer (N-P 2 O 5 -K 2 O = 100-80-80 kg ha –1 )
and non-N fertilizer (N-P 2 O 5 -K 2 O = 0-80-80 kg ha –1 ). The
field layout was a randomized block design with two replications.
Each plot had 25 plants. Conventional cultural practices
were adopted for weed, disease, and pest control.
Heterosis for yield and yield components
Dry weight per plant was measured at 43 d (maximum tiller
stage) and 58 d (booting stage) after transplanting. Nitrogen
concentration (NC) in the shoot at the booting stage was analyzed
by the Kjeldahl Nitrogen Analyzer. Total shoot nitrogen
content (SNCB) and crop growth rate (CGR) were obtained
by using the following formula: total shoot nitrogen content at
the booting stage per unit area (SNCB) = (NC × W2) × P
[g m –2 ], and crop growth rate per unit area (CGR) = P × (W2 –
W1) / (t2 – t1) [g m –2 d –1 ], where W1 and W2 are the shoot dry
weights per plant measured at the maximum tillering and booting
stage, respectively, and t1– t2 corresponds to 15 d from
the maximum tillering to booting stage. Six agronomically
important traits were examined—culm length, panicle length,
panicle number plant –1 , spikelets panicle –1 , grain fertility, and
grain yield. The average data for two replications were used
for evaluating heterosis and for correlation analysis.
RAPD analysis and genetic diversity
Genomic DNA was extracted from the leaves of nine parents.
Fifty-five random decamer primers (Operon Tech.) selected
after a preliminary test were used to amplify the DNA of nine
parents. The polymerase chain reaction (PCR) protocol used
was as described by Ahn et al (1998).
Genetic distances in 36 pairs of the nine parents were
estimated from RAPD data by Nei’s genetic distance equation
(Nei 1987). Cluster analysis was done using the computer program
NTSYS-PC with an unweighted pair group method
(UPGMA). Heterosis in each character was denoted as midparental
heterosis, which was a measure of the superiority of
the F 1 over the mid-parental value. The relationship between
the genetic distance of parents and heterosis/hybrid performance
in the F 1 was evaluated by simple correlation analysis.
Results and discussion
Heterosis for agronomic traits
Table 1 shows the means and ranges of performance and midparental
heterosis (MPH) of 36 F 1 hybrids. Most of the characters
exhibited much better performance in N-fertilized conditions
than in N-unfertilized conditions as expected. However,
grain fertility, number of spikelets per panicle –1 , and
panicle length did not decrease even in plants grown under N-
unfertilized conditions, probably because plants grown under
N-unfertilized conditions were able to sustain fewer but bigger
panicles.
The degree of heterosis varied considerably. Heterosis
for yield ranged from –22.7% (Dasanbyeo/IR66746-76-3-2)
to 73.4% (Dasanbyeo/TR22183) under N-unfertilized conditions,
and 3.4% (Guichow/IR66746-76-3-2) to 262.1%
(IR66746-76-3-2/TR22183) under N-fertilized conditions. The
average heterosis for grain yield under N-fertilized conditions
(MPH: 60.4%) was much higher than in N-unfertilized conditions.
Heterosis in N-unfertilized conditions was highest for
grain yield (MPH: 11.6%) among the traits examined, followed
by culm length, panicle length, spikelets per panicle, and dry
weight plant –1 at the maximum tiller stage, and was generally
much lower than in N-fertilized conditions. Heterosis for the
other traits in N-unfertilized conditions was negligible or negative
for grain fertility. The reason that heterosis for grain yield
in N-unfertilized conditions was quite high even though there
was negligible heterosis in dry matter production might be attributable
to the heterosis for number of spikelets panicle –1 .
Heterosis for shoot N content in N-unfertilized conditions was
not detected, implying that N absorption ability of F 1 hybrids
was not higher than that of their parents under N-deficient conditions.
Murayama et al (1974) reported that heterosis in
intervarietal hybrids of japonica rice was not affected by planting
density and fertilizer level. Park (1999) also reported that
heterosis for all traits including grain yield was higher under
N-unfertilized conditions than under N-fertilized conditions
among intervarietal hybrids of japonica rice. Our results were
not consistent with these two reports, presumably because of
differences in plant materials, which had different responses
to N. However, further data are needed to confirm our results.
Molecular markers, QTL mapping, and marker-assisted selection 333

Table 1. Mean and range of hybrid performance and heterosis for growth characters and
grain yield in 36 F 1 hybrids under N-unfertilized and -fertilized conditions.
Performance
Mid-parent heterosis
Character N level c Mean Range Mean Range
Dry weight plant –1 (g) a 10 17.7 13.1–23.2 26.5 –20.1–68.4
0 5.7 3.5–9.0 5.2 –33.3–62.5
Dry weight plant – 1 (g) b 10 34.3 23.8–45.7 32.9 –3.0–98.2
0 14.6 9.7–21.9 0.8 –44.5–55.3
Shoot nitrogen content
at booting stage 10 6.4 4.4–8.4 24.2 –28.1–111.3
0 4.1 3.1–5.5 –1.3 –35.7–61.4
Crop growth rate 10 28.1 5.6–38.1 46.5 –69.2–230.3
0 15.1 7.4–23.1 –0.02 –59.3–94.7
Culm length (cm) 10 93.9 73.9–114.8 19.1 –4.2–130.4
0 83.1 69.9–96.4 11.5 –1.9–27.9
Panicle length (cm) 10 28.9 25.4–31.3 11.2 0.8–30.5
0 26.8 23.1–30.7 7.7 –3.3–21.7
Panicles plant –1 (no.) 10 10.4 6.2–14.5 20.5 –23.2–100.0
0 6.0 3.0–7.8 –0.7 –33.3–72.0
Spikelets panicle –1 (no.) 10 287.7 228.2–386.3 –0.6 –22.6–29.0
0 286.0 208.8–432.8 6.0 –12.7–38.3
Grain fertility (%) 10 80.3 29.9–95.4 –7.3 –64.7–16.7
0 84.6 39.8–96.7 –6.3 –56.6–19.7
Grain yield (kg ha –1 ) 10 1,068 1,029–1,531 60.4 –3.4–262.1
0 641 425–864 11.6 –22.7–73.4
a Maximum tillering stage. b Booting stage. c 10 = N-fertilized condition (N-P 2 O 5 -K 2 O = 100-80-80 kg ha –1 ). 0 = N-
unfertilized condition (N- P 2 O 5 -K 2 O = 0-80-80 kg ha –1 ).
Table 2. Genetic distances a among the nine parents based on RAPD analysis with 55 random decamers.
Parent b IR6 IR2 DS NA M23 GC TR HC
IR66167-27-5-1-6 (IR6) –
IR66746-76-3-2 (IR2) 0.128 a –
Dasanbyeo (DS) 0.342 0.279 –
Nonganbyeo (NA) 0.298 0.298 0.235 –
Milyang23 (M23) 0.294 0.268 0.131 0.169 –
Guichow (GC) 0.288 0.327 0.272 0.248 0.213 –
TR22183 (TR) 0.198 0.199 0.411 0.236 0.280 0.392 –
Hapcheon1 (HC) 0.260 0.189 0.284 0.248 0.307 0.365 0.155 –
CP-SLO (CP) 0.189 0.185 0.295 0.224 0.283 0.315 0.279 0.197
a Genetic distance = (1 – SM), SM = simple matching coefficient. b Indica: Dasanbyeo, Nonganbyeo, Milyang23, Guichow; temperate
japonica: TR22183, Hapcheon 1; tropical japonica: CP-SLO; NPT lines: IR66167-27-5-1-6, IR66746-76-3-2.
RAPD analysis, genetic diversity, and heterosis
The number of distinct bands amplified by each primer ranged
from 1 to 8. The 55 RAPD primers amplified a total of 228
bands from the genomic DNA of nine parents, with an average
of 4.16 bands per primer. Of the 228 bands, 128 (56%) produced
at least one polymorphic band differentiating at least
one from the other parent. Genetic distances among nine parents
(Table 2) ranged from 0.131 to 0.411; the closest was
between Dasanbyeo and Milyang23 and the farthest was between
Dasanbyeo and TR22183. Cluster analysis based on
genetic distances differentiated the nine parents into two major
groups that can be considered as indica and japonica (Fig.
1). Within the japonica cluster, two subgroups were apparent:
one was for NPT lines (IR66167-27-5-1-6, IR66746-76-3-2)
and the tropical japonica variety (CP-SLO) and the other was
for temperate japonica varieties (TR22183, Hapcheon1). The
two NPT lines were important for the tropical japonica group.
These results are consistent with the reports of Glaszmann
(1987).
Table 3 shows the correlation coefficients between genetic
distance based on RAPD analysis and the performance/
heterosis of 36 F 1 hybrids. A significantly positive correlation
was found between genetic distance and heterosis for dry weight
at the booting stage (r = 0.360*), crop growth rate (r = 0.402**),
panicle length (r = 0.473**), and grain yield (r = 0.329*) in N-
fertilized conditions. This indicated that the farther the genetic
distance between the parents, the better the performance of
the F 1 hybrids. No significant correlation was found under N-
334 Advances in rice genetics

Dasanbyeo
Milyang23
Nonganbyeo
Guichow
IR66167-27-5-1-6
IR66746-76-3-2
CP-SLO
Hapocheon1
TR22183
0.06 0.10 0.14 0.18 0.22 0.26 0.30
Genetic distance
Fig. 1. Dendrogram of the nine
rice parents based on genetic distance
by RAPD analysis.
Table 3. Correlation coefficients between genetic distance and heterosis for
growth characters and grain yield in 36 F 1 hybrids grown under N-fertilized and
-unfertilized conditions.
Characters
N-fertilized
N-unfertilized
Performance Mid-parent Performance Mid-parent
heterosis heterosis
GD-dry weight a 0.012 –0.126 0.312 0.189
GD-dry weight b 0.354 d 0.360 * 0.304 0.202
GD-SNCB c 0.137 0.102 0.164 0.111
GD-CGR 0.356 * 0.402 ** 0.225 0.126
GD-culm length –0.005 0.164 –0.057 0.056
GD-panicle length 0.190 0.473 ** 0.138 0.319
GD-panicles plant –1 0.043 0.087 0.078 –0.040
GD-spikelets panicle –1 0.187 0.279 –0.050 0.178
GD-grain fertility –0.494 ** –0.398 * –0.488 ** –0.397 *
GD-grain yield 0.492 ** 0.329 * 0.150 0.014
a Maximum tillering stage. b Booting stage. c Shoot nitrogen content at booting stage. GD = genetic
distance. d *, ** = significant at the 0.05 and 0.01 probability levels, respectively.
unfertilized conditions except with grain fertility. This might
be due to the low level of heterosis in N-unfertilized conditions
as shown in Table 1. For grain fertility, there was a significantly
negative correlation in both N-fertilized and -unfertilized
conditions as expected, such that grain fertility of F 1
hybrids between parents of farther genetic distance would be
lower. Ahn et al (1998) reported that genetic distance measures
based on RAPDs were useful for predicting yield and its
heterosis of intervarietal hybrids in japonica. Based on the results
of this and previous studies, it seemed that genetic distances
could be useful for predicting hybrid yield. However,
the accuracy might vary along with the parental varieties and
growing conditions of hybrids. Based on the results of this and
previous studies, it seemed that genetic distances could be useful
in predicting hybrid yield. However, the accuracy might
vary depending on the parental varieties and growing conditions
of hybrids.
References
Ahn SN, Kwak TS, Kang KH, Jeon YH, Choi HC, Moon HP. 1998.
Relationship between heterosis and genetic distance as measured
by RAPD analysis in rice. Kor. J. Breed 30(1):16-23.
Glaszmann JC. 1987. Isozymes and classification of Asian rice varieties.
Theor. Appl. Genet. 74:21-30.
Kato H, Tanaka K, Nakazumi H, Araki H, Yoshida T, Ogi Y,
Yanagihara S, Kishimoto N, Maruyama K. 1994. Heterosis of
biomass among rice ecospecies and isozyme polymorphism
and RFLP. Breed. Sci. 44:271-277.
Koh HJ, Kim HY, Heu MH. 1990. Current status and future outlook
on hybrid rice. Seoul Natl. Univ. J. Agric. Sci. 16(1):11-23.
Murayama S, Omura T, Miyazato K. 1974. Basic studies on utiliza-
Molecular markers, QTL mapping, and marker-assisted selection 335

tion of hybrid vigor in rice. IV. Heterosis under different cultural
conditions. Jpn. J. Breed. 24:287-290.
Nei M. 1987. Molecular evolutionary genetics. New York (USA):
Columbia University Press.
Park CW. 1999. Relationship between heterosis in F 1 hybrids and
genetic similarity in parents as measured by RAPD and SSR
analysis in japonica rice (Oryza sativa L.). MSc thesis. Seoul
National University, Korea.
Yuan LP. 1994. Increasing yield potential in rice by exploitation of
heterosis. In: Virmani SS, editor. Hybrid rice technology: new
Notes
developments and future prospects. Los Baños (Philippines):
International Rice Research Institute. p 1-6.
Authors’ address: School of Plant Science, College of Agriculture
and Life Sciences, Seoul National University, Suwon 441-
744, Korea.
Acknowledgments: The authors thank the Research and Development
Promotion Center for Agriculture and Forestry for its
financial support.
Isolating and characterizing molecular markers associated
with seedling-stage cold tolerance in rice
K.M. Kim, I.K. Chung, T.S. Kwak, and J.K. Sohn
The DNA marker associated with cold tolerance was cloned from random amplified polymorphic DNA (RAPD) fragments
amplified with genomic DNA of a rice cultivar, Dular. The nucleotide sequence revealed that the putative open reading frame
was 511 base pairs and contained 169 amino acid residues. It is 79% and 57% identical to the rice cDNA (C26347) found in
the GeneBank Database at the nucleotide and amino acid sequence levels, respectively. Through RAPD analysis for the cold
tolerance of 94 F 2
plants from a cross between Dular (indica, cold-sensitive cultivar) and Toyohatamochi (japonica, coldtolerant
cultivar), OPT8 511
was confirmed to have strong association with cold tolerance of rice. The clone OPT8 511
was amplified
from polymerase chain reaction of genomic DNA in 21 rice cultivars by custom-made primer. This marker could be of use
in marker-assisted selection for cold tolerance in rice.
In this study, we described the identification of a molecular
marker associated with cold tolerance in rice using the F 2 population
from a cross between Dular (cold-sensitive cultivar) and
Toyohatamochi (cold-tolerant cultivar).
A random amplified polymorphic DNA (RAPD) analysis
was conducted to investigate the contribution of genomic
DNA to the polymerase chain reaction (PCR) patterns of 94
F 2 plants from the mentioned cross. A polymorphic band of
approximately 600 bp between Dular and Toyohatamochi was
detected by the PCR analysis with OPT8 primers. Through
quantitative trait locus (QTL) analysis, we selected a fragment
of 600 bp (OPT8 600 ) related to cold tolerance in rice (Kim et
al 1997, 1999). To characterize the polymorphic DNA fragment
from Dular, we cloned and sequenced the selected fragment.
The DNA fragment was 511 bp in length and encoded
169 amino acids. The nucleotide and deduced amino acid sequences
of OPT8 511 showed high homology to those of rice
cDNA (SWISSPROT accession number C26347). The alignment
of OPT8 511 sequence with C26347 sequence is shown in
Figure 1. OPT8 511 showed 79% identity at the nucleotide sequence
level and 57% similarity to C26347 at the amino acid
level. The alignment of OPT8 511 sequence with the 22-kDa
alpha zein gene cluster of maize, two defense genes of tobacco
(structural organization of str246C and str246N), and bacterial
artificial chromosome (BAC) T24H24 of Arabidopsis
thaliana showed 41%, 31%, and 24% identity, respectively.
We found a highly significant correlation between the
band pattern of OPT8 511 and cold tolerance of 21 rice cultivars
(Fig. 2). The clone OPT8 511 was amplified, especially the
511-bp band from the DNA of cold-sensitive cultivars (Dular,
Hwaseongbyeo, Hwayeongbyeo, Junghwabyeo,
Cheongcheongbyeo, Gihobyeo, Gayabyeo, IR36,
Nonganbyeo). The RAPD marker OPT8 511 could be of use in
marker-assisted selection for cold tolerance in rice.
References
Kim KM, Park GH, Kim JH, Kwon YS, Sohn JK. 1999. Selection of
RAPD marker for growth of seedlings at low temperature in
rice. Mol. Cells 9:265-269.
Kim KM, Sohn JK, Kato A, Oono K. 1997. Analysis of a QTL associated
with cold tolerance at seedling stage of rice by RAPD
markers. Korean J. Breed. 29:342-348.
Notes
Author’s addresses: K.M. Kim and J.K Sohn, Department of
Agronomy, College of Agriculture, Kyungpook National University,
Taegu 702-701, Korea; I.K. Chung, Faculty of Life
Resource, Catholic University of Taegu-Hyosung, Kyungsan,
Kyungbuk 712-702, Korea; T.S. Kwak, College of Life Science
and Resources, Sangji University, Weonju 220-702, Korea.
336 Advances in rice genetics

A
B
Fig. 1. Alignment of clone OPT8 511 (1)
with rice cDNA from callus (2)
(SWISSPROT accession number
C26347). Both nucleotide (A) and
amino acid alignments (B) are shown.
Asterisks and the same letters represent
identical nucleotide and
amino acid residues, respectively.
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 M
Fig. 2. DNA polymorphism detected by amplification of genomic DNA via PCR, using two specific
20-mer primers, 5′-CGACAGTACCTCACAAAGAT-3′ and 5′-CGGCTGACGGAAAAACTTGC-3′. Arrow ()
indicates marker related to cold tolerance. M = DNA size marker lamda/HindIII. Rice cultivars: 1
= Dongjinbyeo, 2 = Donghaebyeo, 3 = Naepungbyeo, 4 = Dular, 5 = Toyohatamochi, 6 =
Sinseonchalbyeo, 7 = Ilmibyeo, 8 = Ilpumbyeo, 9 = Chucheongbyeo, 10 = Hwanambyeo, 11 =
Hwaseongbyeo, 12 = Hwayeongbyeo, 13 = Milyang 23, 14 = Junghwabyeo, 15 =
Cheongcheongbyeo, 16 = Milyang 126, 17 = Milyang 146, 18 = Gihobyeo, 19 = Gayabyeo, 20
= IR36, 21 = Nonganbyeo.
Molecular markers, QTL mapping, and marker-assisted selection 337

QTL analysis for discoloration of flag leaves during
the ripening period in rice
M. Obara, Y. Fukuta, M. Yano, T. Yamaya, and T. Sato
Our study aimed to identify the putative quantitative trait loci (QTLs) associated with the discoloration of flag leaves during the
ripening period, using 98 BC 1
F 6
lines derived from Nipponbare (japonica)/Kasalath (indica). We used 245 restriction fragment
length polymorphism markers to construct a framework linkage map. We measured the chlorophyll content of flag leaves by the
SPAD chlorophyll meter (Minolta Co. Ltd., Tokyo, Japan) every 7 d within 5 wk from flowering. These SPAD values were used for
the maximum content of chlorophyll and the half-life period of chlorophyll content. QTL analysis was conducted using interval
analysis (QGENE). The half-life period of chlorophyll content of Kasalath was shorter than that of Nipponbare. Two putative QTLs
associated with maximum chlorophyll content were mapped on chromosomes 6 and 9. A QTL associated with maximum
chlorophyll content on chromosome 6 was close to the region associated with flowering date. Three putative QTLs associated
with the half-life period of chlorophyll content were mapped on chromosomes 3, 6, and 10. A QTL associated with the half-life
period of chlorophyll content on chromosome 6 coincided with the region associated with grain weight.
The photosynthetic products from the upper leaves are the
major source of organic matter for developing grains in rice
plants. Therefore, the duration from expansion to discoloration
of the leaf is critical in determining the productivity of the
rice plant. Two remarkable events accompany leaf senescence:
one is a decline in photosynthesis activity and the other is
remobilization of nutrients. In Sasanishiki, a popular lowland
rice in northern Japan, senescing leaf blades contribute about
50% of total nitrogen in panicles (Mae and Ohira 1981). Two
upper leaf blades (flag leaf and second leaf) contribute 70–
80% of the carbohydrates in the grain. Nitrogen is one of the
most remobilizable elements during the reproductive stage of
the rice plant (Tanaka 1956). N content in the leaves is closely
related to photosynthetic activity. Therefore, the senescence
of upper leaves during the reproductive stage is directly related
to grain productivity. Leaf senescence is faster in indica
than in japonica rice cultivars and in warm regions than in
cool regions (Yoshida 1981).
In this investigation, we determined the putative quantitative
trait loci (QTLs) associated with the discoloration of
flag leaves during the ripening period.
Materials and methods
Ninety-eight BC 1 F 6 lines developed from a backcross (BC 1 F 1 )
of Nipponbare (japonica)/Kasalath (indica)//Nipponbare at the
National Institute of Agrobiological Resources were used. A
linkage map of 245 restriction fragment length polymorphism
(RFLP) markers used for QTL analysis was obtained from the
Rice Genome Project in Japan (Lin et al 1998). We used 245
RFLP markers to construct a framework linkage map.
Germinated seeds of the 98 backcross inbred lines (BILs)
and the two parents were sown on the nursery bed. Three nursery
plants were grown in 4-liter pots with 3 kg of soil supplemented
with 4.0 g of slow-release fertilizer (N, 16%; P 2 O 5 ,
16%; K 2 O, 16%) in a greenhouse (Yamaya et al 1997). The
chlorophyll content of flag leaves was measured using a SPAD
chlorophyll meter (Minolta) every 7 d within 5 wk from flowering.
The SPAD values were used to calculate the maximum
content of chlorophyll and the half-life period of chlorophyll
content. The aerial parts of the plants were harvested 1 wk
after heading and were dried in a well-ventilated room. After
drying, grain weight and grain size were measured.
QTL analysis was conducted using interval analysis
(QGENE version 2.29) (Nelson 1997).
Results and discussion
The half-life of chlorophyll content of flag leaves in Kasalath
was shorter than that of flag leaves in Nipponbare. Three putative
QTLs associated with the half-life of chlorophyll content
were identified on chromosomes 3, 6, and 10 (Fig. 1).
One of these QTLs, linked to marker R2547 on chromosome
6, coincided with the chromosomal region associated with grain
weight. In QTL analysis using 191 BILs derived from Akihikari
(japonica) and Milyang 23 (indica), we detected putative QTLs
associated with discoloration and grain weight on the same
region of chromosome 6 (unpublished data). Kasalath alleles
shortened the half-life of chlorophyll of putative QTLs on chromosomes
3 and 6, whereas Nipponbare alleles shortened the
half-life of chlorophyll of putative QTLs on chromosome 10.
The maximum chlorophyll content of flag leaves in
Kasalath was lower than that in Nipponbare. Two putative
QTLs associated with maximum chlorophyll content were identified
on chromosomes 6 and 9. One of these QTLs was close
to the chromosomal region associated with flowering date. The
maximum chlorophyll contents of early flowering lines were
higher than those of late-flowering lines.
Leaf senescence of the upper leaves during ripening is
very important for determining grain yield. Previous results
showed that a few indica cultivars, including Kasalath, contain
more GS1 protein in senescing leaf blades than japonica
cultivars (including Nipponbare) (Yamaya et al 1997, Obara
et al 2000). Further studies are needed to understand the mecha-
338 Advances in rice genetics

cM
0
50
100
R1925
R1927
R3226
R1618
C595
C944
C746
C136
R250
R19
G332
C80
C1677
C361
R2170
C1135
R3156
C1488
C63
C563
C25
C515
R2869
R1962
C191B
C498
R1954
L688
G200
R2147
C1478
R2171
R2123
R2654
R437
C214
G122
R674
R2549
C358
C556
R2071
R11
R1888
R1608
C607
R1167
Half-life period of chlorophyll content
Flowering date
Maximum chlorophyll content
Grain weight
C711
R1164
C701
R1587
C1454
G103
R79
R1751
G385
R2272
R2638
C609
C1263
C570
C506
G293
R1933
R2174
R2194
R1629
R2447
C1286
C1369
R1877
C488
R716
C809
G127
C223
Chr 3 Chr 6 Chr 9 Chr 10
Fig. 1. Linkage map and positions of QTLs for maximum chlorophyll content and the half-life period of chlorophyll content,
grain weight, and flowering date. An LOD fall-off of 2.0 was used to define the borders of the confidence intervals for
QTLs. Arrowhead indicates the position of putative QTLs.
nism of senescence of leaves and its interactions with other
traits such as nutrient mobilization.
References
Lin SY, Sasaki T, Yano M. 1998. Mapping quantitative trait loci
controlling seed dormancy and heading date in rice, Oryza
sativa L., using backcross inbred lines. Theor. Appl. Genet.
96:997-1003.
Mae T, Ohira K. 1981. The remobilization of nitrogen related to leaf
growth and senescence in rice plants (Oryza sativa L.). Plant
Cell Physiol. 22:1067-1074.
Nelson C. 1997. QGENE: software for marker-based genomic analysis
and breeding. Mol. Breed. 3:239-245.
Obara M, Sato T, Yamaya T. 2000. High content of cytosolic
glutamine synthetase does not accompany a high activity of
the enzyme in rice (Oryza sativa) leaves of indica cultivars.
Physiol. Plant. 108:11-18.
Tanaka A. 1956. Studies on characteristics of physiological function
of leaf at definite position on stem of rice plant. 3. Relation
between nitrogen metabolism and physiological function of
leaf at definite position. J. Sci. Soil. Manure Jpn. 26:413-418.
Yamaya T, Obara M, Hayakawa T, Sato T. 1997. Comparison of
contents for cytosolic-glutamine synthetase and NADH-dependent
glutamate synthase protein in leaves of japonica, indica
and javanica rice plants. Soil Sci. Plant Nutr. 43:1107-
1112.
Yoshida S. 1981. Fundamentals of rice crop science. Manila (Philippines):
International Rice Research Institute. 269 p.
Notes
Authors’ addresses: M. Obara, T. Yamaya, Department of Applied
Plant Science, Graduate School of Agricultural Sciences,
Tohoku University, 1-1 Tsutsumidori-Amemiyamachi, Aobaku,
Sendai 981-8555, Japan; Y. Fukuta, Plant Breeding, Genetics,
and Biochemistry Division, International Rice Research
Institute, DAPO Box 7777, Metro Manila, Philippines; M.
Yano, Rice Genome Research Program, National Institute of
Agrobiological Resources, 2-1-2 Kannonndai, Tsukuba 305-
8602, Japan; T. Sato, Institute of Genetic Ecology, Tohoku
University, 2-1-1 Katahira, Aoba-ku, Sendai 980-8577, Japan.
Molecular markers, QTL mapping, and marker-assisted selection 339

QTL analysis of root vitality in a doubled-haploid population
derived from anther culture of indica/japonica rice
Teng Sheng, Zeng Dali, Zheng Xianwu, K. Yasufumi, Qian Qian, and Zhu Lihuang
Root vitality in rice is important to the growth and development of every aboveground part. A doubled-haploid (DH) population
derived from anther culture of ZYQ8/JX17 F 1
, a typical indica and japonica hybrid, was used in this study. Root vitality of 134
DH lines was detected by determining the reduction ability of TTC in the heading period. Root vitality isn’t correlated to root
morphological characters. A QTL was detected between RG449 and RRF09_1 on chromosome 4. Its LOD score and variation
were 2.59 and 10.4%, respectively. Its additive effect was –1.6245. This QTL was from ZYQ8.
Root vitality is the basis of vigorous growth in the vegetative
stage and grain filling in the reproductive stage. There is a
close relation between the physiological activity of the root
and leaf senescence (Qiu et al 1981). Some QTLs for rice root
growth characteristics such as root length, root thickness, and
root penetration have been identified (Price et al 1997, Yadav
et al 1997). In this study, a pair of typical japonica/indica rice
varieties (ZYQ8/JX17) and their doubled-haploid (DH) populations
were used for QTL analysis of rice root vitality.
Materials and methods
A typical indica variety (ZYQ8) and a typical japonica variety
(JX17) were used as parents for crossing. More than 150 pure
DH lines were obtained after anther culture of F 1 hybrids. Of
these, 121 were selected for studying.
One hundred and twenty-four DH lines were used. During
the period of heading, three plants of each DH line were
selected to investigate their root vitality by using the TTC
method. About 1 g of surface-layer root was immersed in a
solution of 0.2% TTC, which was dissolved in 0.0335 mol
L –1 PBS, then incubated at 37 °C for 4 hours in the dark. One
mol L –1 of sulfate acid was added to stop the reaction. The
concentration of TTCH in extraction was measured according
to the absorbance at 485 nm measured by using a Backman
DU-640 spectrophotometer. Root vitality was represented by
the TTC quantity (mmol) reduced by 1 g of fresh root per hour
(Zhang 1992). The maximum root length, total root length,
root number, and root dry weight at the seedling stage were
also investigated.
Based on the constructed linkage map of the DH population,
interval QTL mapping was used to analyze the QTLs
for root vitality by using Mapmaker/QTL software. The presence
of a QTL was determined with a threshold LOD score of
2.0. The variation and additive effect of each QTL for relative
characters were also calculated.
Results
Analysis between root vitality and root growth traits such as
maximum root length, total root length, root number, and root
dry weight in the DH population was performed. There was
no relationship between root vitality and every root growth
trait. It was suggested that root vitality and root growth were
controlled by different genes.
Root vitality of indica (ZYQ8) was 148.39 mmol TTC/
(g FW h –1 ) and that of japonica (JX17) was 135.04 mmol TTC/
(g FW h –1 ). The distribution of root vitality in 134 DH lines
was continuous, showing that this characteristic was a quantitative
genetic trait suitable for QTL mapping (Fig. 1).
A rice RFLP linkage map was constructed by using the
DH population and 243 markers. Results of QTL detection of
root vitality from 134 DH lines appear in Table 1. One QTL,
qRV-4, was detected between marker RG449 and RRF09_1
on chromosome 4. Its LOD score and variation were 2.59 and
10.4%, respectively. Its additive effect was from ZYQ8.
Discussion
Some QTLs for length, thickness, weight, and penetration ability
of rice root have been identified (Price et al 1997, Yadav et
al 1997). The activities of growth and physiology of rice root
were at a maximum level in the heading stage. From young
inflorescence to heading, many surface-layer roots were produced.
The QTL for root vitality identified in this study was
between RG449 and RRF09_1 on chromosome 4. It was different
from QTLs for root growth traits such as maximum
length, total length, number, and dry weight of root (unpublished
data). Several dozen QTLs for root growth characteristics
had been identified. Among these QTLs, one QTL for
penetration index and two QTLs for root number were located
on chromosome 4 and linked with RG467C, RG214, and
RG163, respectively (Ray et al 1996). These markers didn’t
link tightly with qRV-4. It is suggested that the genes controlling
root vitality are different from the genes controlling root
growth.
The genes for root vitality also affect ratooning ability
by affecting the level of cytokinin. In this study, the QTL (qRV-
4) for root vitality was identified on almost the same region of
one of the QTLs for ratooning ability (Ra-4) identified by Tan
et al (1997) using the same DH population. The QTL qRV-4
340 Advances in rice genetics

No. of DH lines
30
25
20
15
10
5
0
20 40 60 80 100 120 140 160 180 200 220
Root vitality mg (TTC/(g FW h –1 )
Fig. 1. Distribution of root vitality in the doubled-haploid (DH) population.
Table 1. QTLs for root vitality.
Locus Chromosome Marker interval LOD score Variation(%) Additive effect
qRV-4 4 RG449-RRF09_1 2.59 10.4 –1.6245
also linked with the marker of one QTL for tiller number (Ray
et al 1996). The linkage of QTLs for root vitality and tiller
number may be related to cytokinin.
References
Price AH, Tomes AD, Virk DS. 1997. Genetic dissection of root
growth in rice (Oryza sativa). II. Mapping quantitative trait
loci using molecular markers. Theor. Appl. Genet 95:143-152.
Qiu HB, Pan YC, Wang BB, Lu DZ. 1981. Study on leaf senescence
and quantity of root exudate and the relation to grain yield.
Zhejiang Agric. Sci. 4:175-176.
Ray JD, Yu L, McCouch SR, Hampoux MC, Wang G, Nguyen HT.
1996. Mapping quantitative trait loci associated with root
penetration ability in rice (Oryza sativa L.). Theor Appl Genet.,
92:627-636.
Tan ZB, Shen LS, Yuan ZL, Lu CF, Chen Y, Zhou KD, Zhu LH.
1997. Identification of QTLs for ratooning ability and grain
yield traits of rice and analysis of their genetic effects. Acta
Agron. Sin. 23(3):289-295.
Yadav R, Courtois B, Huang N, McLaren G. 1997. Mapping genes
controlling root morphology and root distribution in a doubledhaploid
population of rice. Theor. Appl. Genet. 94:619-632.
Zhang XZ. 1992. Method for crop physiology. Beijing (China):
Agricultural Publishing Company. p 136-143.
Notes
Authors’ addresses: Teng Sheng, Zheng Xianwu, and Zhu Lihuang,
Institute of Genetics, Chinese Academy of Sciences, Beijing
100101; Teng Sheng, Zeng Dali, and Qian Qian, China National
Rice Research Institute, Hangzhou 310006; K.
Yasufumi, Japan International Research Center of Agricultural
Science, Tsukuba 305-8686, Japan.
Molecular markers, QTL mapping, and marker-assisted selection 341

Genomics
Genomics 343

344 Advances in rice genetics

Rice functional genomics via cDNA microarray analysis
J. Yazaki, N. Kishimoto, F. Fujii, K. Nakamura, J. Wu, K. Yamamoto, K. Sakata, T. Sasaki, and S. Kikuchi
One of the major goals of the Rice Genome Research Program (RGP) is to understand the function and interrelationships of
different genes that compose the rice genome. We have embarked on a large-scale rice functional genomics program using the
microarray system to obtain an expression profile of rice genes. About 9,000 partial cDNA sequences corresponding to unique
genes have been identified in the RGP. Rice microarrays have been constructed using 1,265 cDNA clones, including 459
sequences that correspond to genes of unknown function. Both the full-insert and gene-specific portions of the cDNA clones
were spotted on glass slides using a high-speed robotic arrayer. These were then used as probes to hybridize target RNAs
prepared from different rice tissues such as the leaf, root, panicle, and callus. The results indicate that gene-specific microarray
could detect weaker but much more specific signals than full-insert microarray. Some cDNA clones, including several genes
with unknown function, reproducibly showed differences in gene expression. These suggest the efficiency of using the microarray
system to evaluate the expression profiles of known rice genes as well as to assign unknown genes to various metabolic
pathways.
The Rice Genome Research Program (RGP) has undertaken
an extensive rice genome analysis since its launching in 1991,
which has resulted in the establishment of a catalog of rice
genes, a high-density linkage map, and YAC (yeast artificial
chromosome)-based physical maps of the 12 rice chromosomes.
A large collection of expressed sequence tags (ESTs)
was produced from cDNA sequencing using cDNA libraries
derived from rice calli cultured in different media and tissues
such as the root, shoot, leaf, and panicle (Yamamoto and Sasaki
1997). Approximately 9,000 partial cDNA sequences corresponding
to unique genes have been identified. Using these
resources, we established the first rice cDNA microarray to
facilitate gene expression profiling in rice.
Microarray is now widely recognized as an important
technology for functional genomics. The use of microarray for
gene expression monitoring is more effective than other methods
such as Northern hybridization and reverse transcriptase
and polymerase chain reaction (PCR). This technology facilitates
high-throughput expression analysis of the large number
of genes that compose the genome. We report on the rice cDNA
microarray system for gene expression monitoring and some
studies on reproducibility and detection linearity, the comparison
of full-length and 3′-UTR probes, and expression profiles
between different tissues.
Construction of a rice microarray
Figure 1 shows the schema for gene expression profiling using
cDNA microarray. All cDNA clones were produced by largescale
cDNA analysis in the RGP. A homology search was performed
by BLASTN and clones with high similarity were clustered.
The clustered clones were analyzed for sequence similarity
against protein and nucleic acid public databases. A homology
search was then performed by BLASTN and BLASTX,
and about 9,000 unique clones with high similarity were identified
putatively. A total of 1,265 independent clones were selected
randomly. Approximately two-thirds of the clones (806)
have annotations, whereas the remaining 459 clones have no
homology to any coding sequences available in public databases.
The full-insert cDNA clones were amplified by PCR
using M13 as a primer; M4 and RV were complementary to
the vector sequences flanking both sides of the cDNA insert.
The 3′-UTR cDNA clones were amplified by PCR using specific
primers complementary to specific regions of each cDNA
clone. The PCR products were purified to remove unwanted
salts, detergent, primers, and other impurities present in the
reaction mixture. The purified PCR products were mixed with
DMSO for microarray construction. In general, the total quantity
of each PCR product was greater than 1 µg. The average
size of full-insert and 3′-UTR cDNA clones was about 1,000
and 200 bp, respectively. A total of 1,265 cDNA probes were
spotted in duplicate on an aluminum-coated and DMSO-optimized
glass slide (1″ × 3″) using an Array Spotter Generation
III (Amersham Pharmacia, Tokyo, Japan). After spotting, the
slides were dried for about 1 h and exposed to UV for crosslinking.
Target preparation, hybridization, and image analysis
Japonica rice cultivar Nipponbare was used for RNA extraction
and target preparation. Leaf and root tissues were collected
from laboratory-cultured plants at 30 days after germination.
Flower buds were gathered at the onset of flowering.
Growth-phase calli were induced in medium with 2,4-
dichlorophenoxy acetic acid at 25 °C and collected after 20 d
of culture. Each poly (A)+RNA derived from these tissues was
labeled by a reverse transcriptase reaction with fluorescent dye.
Two fluorescent dyes, Cy3 and Cy5, are usually used in
microarray experiments because the use of two targets in one
hybridization is thought to reduce probable errors encountered
during hybridization, and this presumably makes the hybridization
experiment and comparison of expression profiles between
different target samples easier. However, the fluorescent
levels of Cy3 and Cy5 dyes after scanning are actually
different. For the aluminum-coated glass slide, the Cy5 signal
Genomics 345

Microarray preparation
RGP cDNA catalogue
Classification using 3′-UTR
Target sample preparation
DNA preparation
Automated system for DNA handling
Oryza sativa subsp. japonica cv.
Nipponbare
Spotting
Root, leaf, flower, and callus
Total RNA extraction
mRNA purification
Labeling
Mirror-type glass
Array spotter
Hybridization
Image analysis
Array scanner
Image Quant
Array Vision
Fig. 1. Schema of the microarray experiment. A total of 1,265 independent clones were selected randomly from the RGP expressed
sequence tag catalogue. cDNA preparation was carried out using an automated system, Genesis workstation (TECAN Co. Ltd.) with a robot
arm, clone selection, plasmid extraction, polymerase chain reaction (PCR) amplification, and adjusting DNA concentration. The purified
PCR products were mixed with DMSO for microarray construction. The cDNA probes were spotted in duplicate on mirror-type glass slides
(aluminum-coated and DMSO-optimized) using an Array Spotter. After spotting, the glass slides were dried and cross-linked under UV
conditions. Japonica rice cultivar Nipponbare was used for total RNA extraction. Poly (A)+RNA was purified using Oligotex-dT super
(Takara, Shiga, Japan). Each target sample was reverse-transcribed using Super Script II reverse transcriptase for fluorescent labeling.
The hybridized and washed microarrays were scanned using an Array Scanner. Computer software Image Quant and Array Vision was used
to locate and delineate every spot in the array and to integrate spot intensities and volumes for each individual spot.
346 Advances in rice genetics

Fluorescent signal intensity of expeiment 2
1.0E+07
1.0E+06
1.0E+05
1.0E+04
1.0E+03
1.0E+03 1.0E+04 1.0E+05 1.0E+06 1.0E+07
Fluorescent signal intensity of expeiment 2
○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○ ○
Fig. 2. Reproducibility of the hybridization
signal was analyzed and compared
by scatter plotting using 1,265
cDNA clones in duplicate. Target
poly(A)+RNA was prepared from rice
root tissue as described in the experimental
procedure. The sample
poly(A)+RNA mixture was reversetranscribed
in the presense of Cy5
dCTP. Twofold changes are indicated
by the broken line. Threefold changes
are indicated by the dotted line. The
line with Y (exp. 2) = X (exp. 1) shows
an equally expressed transcript.
is enhanced so that the level of the Cy3 signal is significantly
lower than that of Cy5. Adjusting both signals seems difficult
and, for this reason, comparing more than three target pieces
of data is also difficult. We thus prefer to use the single-target
system. Normally, we label the target RNA with Cy5-dCTP.
The control cRNAs were synthesized by in vitro transcription
from the mouse platelet-derived growth factor receptor gene.
Fluorescence-labeled targets were hybridized to cDNA
microarray glass slides for 16 h. After hybridization, the glass
slides were washed and air-dried using an air duster in a dustfree
environment. Then, the microarrays were scanned using
an Array Scanner Generation III (Molecular Dynamics). The
software Array Vision from Imaging Research was used to locate
and delineate every spot in the array and to integrate spot
intensities and volumes for each individual spot.
Reproducibility
The duplicated spots in the cDNA microarray were compared
to determine the extent of reproducibility. More than 90% of
the clones were dispersed within a two- to threefold expression
value when the duplicated spots (experiments 1 and 2)
were hybridized with one target at one-time hybridization (Figure
2). Abundantly expressed genes (more than 1 × 10 6 , fluorescent
signal intensity) could easily fit within this range. However,
less-abundant genes showed wide variation. Thus, it is
important to enlarge the reliability zone of gene expression.
One solution is to determine which gene is abundantly expressed
and which one is less abundant after repeated experiments.
Less-abundant gene probes must be gathered in one
array and hybridized with a much higher amount of the target
RNA. Some factors that may affect the reproducibility of
microarray data are spotting variability, DNA retention failure,
target RNA quality, over- or underestimation of target RNA
volumes, uneven labeling, hybridization, washing procedures,
and quantification of hybridization data. To obtain good and
reliable data, these experimental errors should be avoided and
repeated experiments may be necessary.
Detection sensitivity of transcript concentration
The in vitro transcript of detection sensitivity was measured
by using an internal control clone (mouse platelet-derived
growth factor receptor, 900 bp) that showed no cross-hybridization
with the rice genes. The control cRNA (1 ng, 0.5 ng,
0.1 ng, and 50 pg) was added to 1 µg of sample mRNA, resulting
in control cRNA to sample mRNA ratios of 100:100,000,
50:100,000, 10:100,000, and 5:100,000. The control cRNA
and sample mRNA mixtures were reverse-transcribed in the
presence of Cy5 dCTP into the first cDNA strand and hybridized
to complementary DNA elements on the microarray. Using
the control clone, we could detect from 1 ng (1/1,000 of
rice target RNA) to 50 pg of expression volume (data not
shown). However, at a concentration below 0.05 ng, the control
cRNA showed a lower signal than the background control
(element without spotted DNA) signal. The average background
fluorescent signal intensity was 1.3 × 10 5 .
Full-insert and 3′-UTR probes
EST mapping analysis in the RGP revealed that, when the 5′
portion of the ESTs was used as a probe, many ESTs were
assigned to multiple YAC clones. Alternatively, when the 3′
portion (3′-UTR region) was used as a probe, most ESTs were
detected in the specific regions of the YAC clones (Wu et al
2000). As we have already made PCR primers for the 3′-UTR
region of the EST clones, two probe systems from the fulllength
inserts and the 3′-UTR were constructed. Using both
probes, microarrays were compared using mRNAs from root
tissues at 30 d following germination (Table 1). In the fullinsert
microarray, the 10 most abundant clones consist of five
Genomics 347

Table 1. Comparison of gene expression profiles in rice root using full-insert and 3′-UTR microarray.
Clone ID Accession Putative gene identification Signal intensity
Full-insert
C52727 C97167 Ubiquitin (Avena fatua) 1.84E+07
S16157 AU065955 S. adenosyl methionine synthetase (Lycopersicon esculentum) 1.47E+07
C01912 D15997 NADH dehydrogenase (Paramecium tetraurelia) 1.33E+07
S16102 C24892 Ubiquitin extension protein (Lupinus albus) 1.30E+07
E02210 C72769 Actin (Nicotiana tabacum) 1.16E+07
C03001 C98384 Polyubiquitin (Arabidopsis thaliana) 1.08E+07
C00176 C97944 Ubiquitin (Oryza sativa) 1.05E+07
C52245 C27568 Ubiqiutin (Gallus gallus) 9.40E+06
S16144 AU032905 9.37E+06
C40015 AU077483 9.32E+06
3′UTR
C00176 C97944 Ubiquitin (O. sativa) 2.08E+07
C52727 C97167 Ubiquitin (A. fatua) 1.01E+07
S16102 C24892 Ubiquitin extension protein (L. albus) 8.38E+06
S16144 AU032905 3.23E+06
C40015 AU077483 3.10E+06
E03596 AU064058 Thioredoxin M (Zea mays) 2.87E+06
C12875 AU068273 2.83E+06
S04953 D41931 ZB8, phenylalamine ammonia-lyase (O. sativa) 2.57E+06
E02880 C73083 α-methyltransferase (Z. mays) 2.09E+06
S10563 AU032465 1.90E+06
Clone ID: the original clone identification number of the sequence submitted to DDBJ. Putative gene identification: gene annotation
obtained for sequences that resulted from a homology search in the public database. The gene with the highest score was used as the
putative gene identification for the sequence. The organism in which the gene was identified is indicated in parentheses. Signal intensity:
the abundance of transcripts from the target sample was reflected by signal intensity.
ubiquitin homologs (clone ID C52727, S16102, C03001,
C00176, and C52245), two unknown genes (S16144 and
C40015), and one homolog each of S-adenosyl methionine
synthase (S16157), NADH dehydrogenase (C01912), and actin
(E02210). In the 3′-UTR microarray, three ubiquitin homologs
(C00176, C52727, and S16102), four unknown genes
(S16144, C40015, C12875, and S10563), and one homolog
each of thioredoxin (E03596), phenylalanine ammonia-lyase
(S04593), and methyltransferase (E02880) were highly expressed.
Only three ubiquitin homologs (C00176, C52727, and
S16102) and two unknown genes (S16144, C40015), however,
were highly expressed in both full-insert and 3′-UTR
microarrays. These highly abundant genes can be classified as
root-specific genes. The rest, including two ubiquitin homologs
(C03001 and C52245), were selected by the 5′-portion of the
full-insert probes and are probably nonspecific genes in the
root. Furthermore, the total fluorescent intensity of the fullinsert
and 3′-UTR microarrays was about 180 × 10 7 and 4.5 ×
10 7 , respectively. A high fluorescent signal in the full-insert
microarray can be attributed to hybridization, not only of the
labeled target but also of other regions of the full insert. Furthermore,
the results suggest that the full-length cDNA
microarray is effective for the comprehensive analysis of the
family gene expression, whereas the 3′-UTR microarray is
useful for detecting gene-specific expression.
Expression profiles between different tissues
The full-insert cDNA microarray was evaluated for sensitivity
of gene expression in different tissues such as the leaf, root,
panicle, and callus. Poly (A)+RNA samples were labeled with
Cy5-dCTP and hybridized to the 1,265 full-insert cDNA
microarray. We compared the signal intensity of hybridization
with the scatter plot of expression profiles. Data were normalized
by getting the total fluorescent signal of each target DNA
and adjusting the value to obtain equal signals. Figure 3 shows
the scatter plot and the 10 most differentially expressed genes
in the panicle and callus.
Since the scatter-plot data showed that gene expression
profiling in panicle and callus tissues differs, there was a low
correlation between the panicle and callus. Many genes did
not fit within the two- to threefold expression level. Several
genes that showed absolute tissue specificity were identified.
A comparison of expressed genes in the panicle and callus
showed that the major allergen homolog Cynod1 and the pollen
allergen PhlpII homolog were highly abundant and expressed
more than 2,000-fold in the panicle. The calcium-binding
pollen allergen gene was also expressed more than 200-
fold in the panicle. These genes were detected as panicle-absolute
and panicle-specific genes. The other three genes corresponded
to the cDNA library derived from the floweringstage
panicle and the rest (C52093, S04987, S11020, and
S16157) corresponded to callus and shoot cDNA libraries. For
the callus, these results may be attributed to their totipotent
348 Advances in rice genetics

Flourescent signal intensity of panicles
1E+11
1E+10
1E+09
1E+08
1E+07
1E+06
1E+05
1E+04
1E+05 1E+06 1E+07 1E+08 1E+09
Flourescent signal intensity of calli
Fig. 3. Differential expression profile was analyzed and compared
by scatter plotting using 1,265 cDNA clones. Target poly(A)+RNA
was prepared from rice panicles and calli. The sample poly(A)+RNA
mixture was reverse-transcribed in the presence of Cy5 dCTP. Twofold
changes are indicated by the wide dotted line. Threefold
changes are indicated by the narrow dotted line. The line with Y
(exp. 2) = X (exp. 1) shows an equally expressed transcript.
nature so that various tissue-specific genes were possibly expressed.
A similar scatter plot was obtained for the leaf and
root (data not shown) and several genes that showed absolute
tissue specificity were also identified in the leaf. Homologs of
leaf-specific genes such as chlorophyll a/b binding protein,
photosystem I antenna protein, Xa21 protein kinase, and photosystem
II oxygen-involving complex protein showed differential
expression in the leaf. Except for cytochrome P-450,
the other highly expressed genes in the leaf corresponded to
shoot cDNAs.
The results demonstrate that microarray technology is
effective for analyzing massive gene expression and elucidation
of gene function. Although microarrays can only provide
information on the probed (arrayed) clones, this technique will
play an important role in the initial screening of genes with
specific expression patterns and can be applied to other biological
research to which molecular biological technology is
difficult to apply.
Future prospects
We are now preparing a rice EST microarray with about 10,000
independent clones from the RGP EST collection. However,
further cDNA cloning and structural analysis are needed to
cover all the expressing genes. For this purpose, the rice fulllength
cDNA project was launched in early 2000. This project
will be useful in establishing a more comprehensive rice cDNA
microarray covering the entire rice genome. It can thus be an
effective method for monitoring gene expression profiles at
various stages of growth and differentiation and as a response
to various stress conditions. The microarray will be used to
establish a system for functional analysis in rice, such as the
efficient selection of target genes and construction of gene
networks. The accumulation of cDNA microarray data will
also require an efficient database system to integrate all information
as individual entities and as part of the whole genome.
These advances in functional genomics will greatly accelerate
the many processes associated with rice improvement.
References
Wu J, Yamamoto S, Maehara T, Harada C, Shimokawa T, Ono N,
Mukai Y, Takazaki Y, Yazaki J, Koike K, Shomura A, Fujii F,
Yano M, Ando T, Kono I, Sasaki T, Matsumoto T. 2000. A
comprehensive map of rice expressed sequence tags (ESTs):
its characteristics and application to genome analysis. Proceedings
of the 6th International Congress of Plant Molecular
Biology.
Yamamoto K, Sasaki T. 1997. Large-scale EST sequencing in rice.
Plant Mol. Biol. 35:135-144.
Notes
Authors’ address: Rice Genome Research Program, National Institute
of Agrobiological Resources/Institute of the Society for
Techno-innovation of Agriculture, Forestry, and Fisheries,
Tsukuba 305-0854, Japan.
Acknowledgments: We thank Kohei Suzuki, Hideaki Suzuki (STAFF-
Institute), and Takumi Koyama (National Institute of Animal
Health) for providing the animal cDNA clones; Hideki
Nagasaki, Yoshiyuki Mukai, and Kazunori Waki (STAFF-Institute)
for technical assistance and many useful suggestions;
and Bal Antonio (STAFF-Institute) for helpful discussions and
critical reading of the manuscript. This work was supported
by a grant from the Ministry of Agriculture, Forestry, and Fisheries
of Japan (Rice Genome Project MA-1001).
Genomics 349

Developing genomics approaches
for crop trait improvement
H. Sakai, G. Taramino, N. Nagasawa, Guo-Hua Miao, J. Vogel, and S. Tingey
The advent of high-throughput sequencing capability has changed the paradigm of agricultural sciences in recent years. Genes
encoded by genomes are easily discovered in the form of expressed sequence tags (ESTs), and bioinformatic tools help predict
their functions. The development of mRNA profiling tools enables us to visualize the regulation of gene expression at the
genome level. We used these genomics approaches to identify genes that help improve traits of crops, including rice. In
conjunction with such genome-wide reverse genetics approaches, systematic forward genetics approaches will further help
elucidate biological pathways that involve complex gene interactions.
During the last several years, technologies in the genomics
area have developed rapidly, now enabling us to obtain data
encompassing entire gene activities. New technologies have
changed our way of approaching problems to understand biological
systems. The complexity of cellular activities at various
life stages can now be viewed more precisely on gene expression
patterns (Schena et al 1995). A genetic variation or
trait, which was recognized by its visible effect in classical
genetic analyses, can be characterized by its effect on spatial
and temporal cascades of genetic interactions. The genomics
technologies, which were assigned first to a small number of
species, are increasingly applied to various organisms, many
of which have economic importance.
The importance of genomics technologies is being realized
through various ways (see Fig. 1). One manifest advantage
of genomics approaches is in rapid gene discovery and
integral reverse genetics. Starting from the complete inventory
of genes encoded by the genome, genes involved in pathways
of interest are selected by their expression patterns without
knowing their functions. The complete inventory of genes
is achieved by whole-genome sequencing and/or extensive
cDNA (expressed sequence tag, EST) sequencing. The latter
method especially allows the relatively rapid identification of
genes expressed in certain tissues or in certain biological responses.
A disadvantage of the EST sequencing approach is
the redundancy of mRNA molecules, which often give large
differences in expression levels. However, improved normalization
methods of cDNA libraries, including the new Lynx
bead-cloning technology (Brenner et al 2000a,b), have enabled
us to sample a nearly complete set of expressed genes from
crop species, including rice. Gene expression patterns are further
analyzed in a highly parallel way by using technologies
such as microarrays (Schena et al 1995). These tools are helpful
in identifying a small group of candidate genes out of thousands
of genes. The function of candidate genes is validated
by analyzing antisense or overexpression transgenic plants or
plants carrying insertional mutations, which are identified from
mutant pools by a “gene machine” approach (Azpiroz-Leehan
and Feldmann 1997).
The second patent advantage of genomics technologies
is their efficacy in improving forward genetics approaches.
Forward genetics, often called classical genetics, starts from
the isolation of mutants or variants with defined lesions or traits.
The ability to characterize their genetic differences is crucial
to distinguishing unique pathways affected by mutations. To
this extent, genomics tools such as mRNA profiling give a new
dimension to mutant phenotyping, looking at the global effect
of loss- or gain-of-function of genes. Seemingly similar phenotypes
could be differentiated from each other by looking at
the expression patterns of downstream genes. One example is
disease resistance. Several rice cultivars show resistance to
fungal as well as bacterial infections by inducing common
hypersensitive-response reactions leading to local programmed
cell death. The difference in resistance phenotypes, however,
can be comprehended by a global change in the expression of
disease-response-related genes (see Fig. 2).
The third advantageous area of application of genomics
approaches is molecular breeding. When the detailed physical
structure of a given genome is available as contiguous DNA
Physical
maps
Reverse
genetics
Genes
Genome
sequence
ESTs
mRNA profiling
Proteomics
Mutants/variants
Functions
Markers
Molecular
breeding
Fig. 1. Framework of genomics technologies.
350 Advances in rice genetics

all ORFs (no classification chosen)
7.5
4.0
E
x
p
r
e
s
s
i
o
n
2.5
2.0
1.5
1.2
1.0
0.8
0.7
0.6
0.5
0.4
0.3
0.2
Trust
00
Relative
intensity
rice 184-429 0-72hr finale1
Selected: rlr12.pk0001.h9
7.5
4.0
4.0
3.0
2.0
1.0
E
x
p
r
e
s
s
i
o
n
2.5
2.0
1.5
1.2
1.0
0.8
0.7
0.6
0.5
0.4
0.0
0.0 24.0 48.0 72.0 8.0 24.0 48.0
184 429
Time (h)
Fig. 2. An example of gene expression analysis. More than 1,500 rice genes identified from EST sequencing
were prepared for making a microarray. The array was hybridized with probes obtained from rice leaves sampled
after 0, 4, 8, 24, 48, and 72 h of infection with compatible (184) and incompatible (429) strains of Magnaporthe
grisea. (A) A view of gene expression patterns. Each small square represents the expression pattern of one
gene at six different time points. Expression levels are coded by colors. Data were processed using GeneSpring.
(B) Subset of genes showing a significant induction of gene expression in the incompatible line after 8 h. Each
line shows the expression pattern of one gene; 37 genes are blotted on these graphs. Data collected from
microarray intensities were analyzed using GeneSpring.
72.0
Trust
0.3
0.2
0.0
Genomics 351

sequences or clones, mapping of genetically defined loci, including
QTLs, is achievable at the nucleotide level, which
eventually leads to the direct identification of corresponding
genes. This fine-mapping capability also eases the breeding
process tremendously through the availability of the best molecular
markers.
Although genomics technologies facilitate in-depth studies
of each crop species and aid accelerated breeding processes,
they also help us elucidate the molecular nature of natural variations
between species. Before the genomics era, such
interspecies studies were often depicted as not feasible, or not
possible. However, we now possess tools that allow global
gene mining and expression studies, and which enable us to
understand natural variations in the form of genes and gene
regulation. By acquiring this knowledge, traits from one species
can be reproduced in a distant species. One such example
is the production of epoxy fatty acid in seed (U.S. Patent 1999).
This exotic fatty acid is synthesized in only a few plants but
not in any crop species. The gene responsible for producing
the fatty acid was identified by deep EST sampling of cDNA
libraries made from the tissue of ironweed and bioinformaticbased
gene-mining methods. By transforming the gene, we can
now alter crops to produce the industrially valuable fatty acid.
Genomics technologies thus make it possible to exploit natural
resources for breeding purposes and to attain new traits,
which cannot be produced by conventional breeding, but only
by a long evolutionary process.
References
Azpiroz-Leehan R, Feldmann KA. 1997. T-DNA insertion mutagenesis
in Arabidopsis: going back and forth. Trends Genet.
13:152-156.
Brenner S, Johnson M, Bridgham J, Golda G, Lloyd DH, Johnson
D, Luo S, McCurdy S, Foy M, Ewan M, Roth R, George D,
Eletr S, Albrecht G, Vermaas E, Williams SR, Moon K,
Burcham T, Pallas M, DuBridge RB, Kirchner J, Fearon K,
Mao Ji, Corcoran K. 2000a. Gene expression analysis by massively
parallel signature sequencing (MPSS) on microbead
arrays. Nat. Biotechnol. 18:630-634.
Brenner S, Williams SR, Vermaas EH, Storck T, Moon K, McCollum
C, Mao JI, Luo S, Kirchner JJ, Eletr S, DuBridge RB, Burcham
T, Albrecht G. 2000b. In vitro cloning of complex mixtures of
DNA on microbeads: physical separation of differentially expressed
cDNAs. Proc. Natl. Acad. Sci. USA 97:1665-1670.
Schena M, Shalon D, Davis RW, Brown PO. 1995. Quantitative
monitoring of gene expression patterns with a complementary
DNA microarray. Science 270:467-470.
United States Patent 5,846,784, Hitz WD, 18 Feb. 1999. Fatty acid
modifying enzymes from developing seeds of Vernonia
galamenenisis.
Notes
Authors’ address: DuPont Agricultural Biotechnology, Genomics,
Delaware Technology Park 200, 1 Innovation Way, Newark,
DE 19714-6104, USA.
A gene machine for rice
N.M. Upadhyaya, X.-R. Zhou, Q.-H. Zhu, A. Eamens, K. Ramm, L. Wu, R. Sivakumar, S. Kumar, K.K. Narayanan, G. Thomas, T. Kato, D.-W. Yun,
W.J. Peacock, and E.S. Dennis
Insertional mutants will have a crucial role in identifying the function of each of the expected 25,000–40,000 plant genes. We
are using the two-component Ac/Ds transposon gene or enhancer trap system, initially delivered through T-DNA, to produce
libraries of insertional mutants in rice. Large numbers of Ac or Ds (enhancer or gene trap) transgenic lines have been produced.
Mutagenic populations containing Ac and Ds were produced by crossing, cotransformation, or super transformation. In the first
screening population, 4.6% of the plants were putative stable Ds trap lines (unlinked to Ac), with 40% containing Ds elements
unlinked to Ds donor sites. The regions flanking the original Ds launching pad (T-DNA tag) and Ds transpositions are being
sequenced. Among 12 T-DNA tags rescued, 5 were inserted into known sequences. Among 84 Ds tags, 13 were transposed
into known sequences, 52 into unknown sequences, and the other 19 in and around the original Ds launching pad. New
constructs with bar as a strong selectable marker for Ds itself and for Ds excision as well as a negative selector (tms2) for Ac
have been developed for high-throughput screening. Our aim is to build a substantial “gene machine.” A labnote-cum-relational
database, a tagged sequence database, and a Web site have been set up for efficient handling, processing, and
exchange and/or release of tagged sequence data.
A major challenge in the postgenomic era will be the identification
of the functions of the predicted 25,000–40,000 plant
genes. A multipronged approach combining analysis of structural
similarities, expression profiles, and mutant phenotypes
is required for assigning gene function. Mutants offer one avenue
of relating a gene to its function. Populations with T-
DNA or transposable element-induced knockout mutations are
becoming increasingly useful for identifying gene function in
plants. Using insertion mutants of rice, it is possible to uncover
regions of the genome that control the expression of genes
determining developmental processes as well as productivity
and quality characteristics.
The transposition of the maize transposable element Ac
in rice introduced through protoplast transformation has been
well demonstrated. A more detailed study of Ac as a tool for
rice functional genomics has been carried out by Enoki et al
352 Advances in rice genetics

A
Ds enhancer trap (pSK100)
CaMV 35S P- TA DsE
Ubi1(I) P-
LB hph 3¢ uidA ori bla nptll-2¢ P 5¢ sgfpS65T RB
CaMV 35S P-
Ds gene trap (pSK200)
DsG
SA Ubi1(I) P-
LB hph 5¢ 2¢P-nptll bla ori uidA
3¢ sgfpS65T RB
B
Sequence
phenotyping
GUS assay
Ac transposase (pSK300)
CaMV 35S P-
LB hph Ac W Ubi1(l) RB
Supertransformation
(Ac ® Ds)
Ds PCR
Ds lines ´ Ac lines
Ds/Ac
Mutagenic population
(Ac + Ds + GFP + )
Co-transformation
(Ac + Ds)
Screening population
GFP – GFP +
Hyg s Hyg r Hyg s Hyg r
Ac PCR
+ – – +
Discard
Screen
next
generation
+ –
Discard
Discard
Sequence
phenotyping
GUS assay
Ac PCR
– +
Ds PCR
Ds PCR
+ – – +
Excision PCR
+ –
Discard
Discard
Screen
next
generation
Fig. 1. Transposon gene and enhancer
trapping constructs and
trapping protocol. (A) Ds enhancer
trap (DsE), Ds gene trap (DsG),
and Ac transposase constructs
used in this study. The DsE contains
a promoterless uidA (gus)
gene with a transcriptional activator
(TA) as a trap reporter, a
manopine synthase 2′ gene promoter-driven
nptII as a trap tracer,
and ampicillin resistance gene bla
as a part of the plasmid rescue
system with Escherichia coli origin
of replication (ori). The binary
vector (pCAMBIA 1300 backbone)
with DsE also contains the Ubi1(I)
promoter-driven sgfpS65T gene
as a donor site reporter and the
CaMV 35S promoter-driven hph
gene as a selectable marker following
transformation. The binary
vector for DsG is the same as for
DsE except that it contains the
GPA1 intron with splice acceptors
(in all three reading frames) in
front of gus instead of TA and for
the orientation of DsGs. The Ac
construct is also in the binary vector
pCAMBIA 1300 and contains
a promoter-driven 5′ deleted Ac
transposase and CaMV 35S promoter-driven
hph. (B) Flow chart
of transposon trapping protocol.
LB = left border, RB = right border.
(1999). The use of a reporter gene containing a minimal promoter
(enhancer trap) or intron splice acceptors (gene trap)
with tagging (T-DNA or Ds transposon) sequences facilitates
“trapping” of genetic regions that do not have a visible phenotype.
This trapping system has been used effectively in
Arabidopsis with the two-element Ac/Ds system and in rice
via the T-DNA system (Jeon et al 2000). The success of the
two-element Ac/Ds system in producing insertion mutants in
rice has been demonstrated. We have been evaluating the Ac/
Ds-based gene and enhancer-trapping constructs developed (for
use in rice) by Kumar and Narayanan (1997), which were primarily
based on the constructs used in Arabidopsis. Here, we
report on our efforts to build a substantial “gene machine” (with
a large number of insertional mutants) using both the T-DNA
and Ac/Ds gene and enhancer trapping systems.
Rice cv. Nipponbare was transformed separately with
Ac transposase, Ds enhancer trap (DsE), and Ds gene trap
(DsG) constructs (Fig. 1A) using Agrobacterium. Selected Ac
and Ds lines were crossed to produce the mutagenic population
(F 1 plants). A mutagenic population was also produced
by supertransformation or cotransformation. Hygromycin-resistant
(hyg r ) Ac-containing callus lines (confirmed by polymerase
chain reaction, PCR, and/or Southern blot hybridization)
were supertransformed with DsE or DsG constructs. Plants
regenerated from hyg r and GFP-positive (Ds launching pad
reporter) callus lines were tested for Ds transposition (trap
Genomics 353

Table 1. The production of stable Ds trap lines using the two-element Ac/Ds gene/enhancer
trapping system.
Item Crossing Co- or
supertransformation
No. of starter lines (Ac + Ds + lines) 212 68
Ds active lines (showing GUS spots) 29 out of 104 42
No. of lines screened (first screening population) 22 (3,251 plants) 17 (944 plants)
No. of plants analyzed 1,197 944
Ds + plants 437 643
Ac – Ds – plants (putative stable traps) 90 49
Ac – Ds + GFP + Ds excision + plants (linked to Ds) 46 14
Flanking genomic sequences rescued from above 12 12
Independent stable traps (by sequence) 5 12
Ac – Ds + GFP – plants (unlinked to Ds donor site) 26 13
Flanking genomic sequences rescued from above 10 1
Independent stable traps (by sequence) 5 1
reporter GUS activity) and the presence of Ac and Ds by PCR
and/or Southern blot hybridization. Similar analyses were performed
for plants produced by cotransformation. Progenies of
selected mutagenic lines (F 2 of crosses or T 1 of double
transformants) were screened for stable traps as outlined in
Figure 1B.
Results
We produced 56, 53, and 54 transgenic lines containing Ac,
Ds enhancer trap (DsE), and Ds gene trap (DsG) constructs,
respectively. Twenty Ac lines, 12 DsE lines, and 14 DsG lines,
each with a single transgene locus, were used in crossing experiments
to produce the 212 starter mutagenic lines (F 1 progenies).
Sixty-eight starter mutagenic lines (T 0 lines) were also
produced by co- or supertransformation. Continual transposition
of Ds in callus material, which also contained Ac, was
evident from the different numbers and sizes of GUS-stained
tissues. GUS staining of leaves from the mutagenic population
(F 1 of crosses or T 0 of double transformants) revealed
lineages of early transposition events. More than half of the
putative mutagenic population showed varied numbers and
sizes of GUS spots or patterns, again suggesting continual transposition.
In the first screening population (F 2 of crosses or T 1
of double transformants), a small number of plants showed
distinct patterns of GUS expression, indicating germinal transposition.
Some stable Ds trap lines or original T-DNA tagged
lines showed mutant phenotypes. Table 1 summarizes the production
of stable Ds trap lines from these starter mutagenic
lines. The first screening population derived from crosses and
from double (co- or super-) transformation had 2.8% and 1.4%
putative stable traps (Ac – ) unlinked to the original Ds launching
pad, respectively. Possible stable traps still linked to the
Ds donor sites were 3.8% and 1.5% in screening populations
derived from crosses and double transformation, respectively.
DNA flanking the Ds launching pad (T-DNA insertion site)
and transposed Ds in these stable trap lines are being cloned
(using the built-in plasmid rescue system) and sequenced, with
sequences compared with those in the public databases. Among
12 T-DNA tags rescued, 5 were in known sequences. Among
84 Ds tags rescued, 13 were in known sequences, 52 in unknown
sequences, and the other 19 in and around the Ds launching
pad. Progenies of the trap lines are being screened for
mutations affecting various aspects of plant growth and development,
and for different spatial, temporal, and developmental
patterns of expression of the trap reporter gene (gus).
Discussion
The most direct method for producing insertion mutants is by
T-DNA tagging. Jeon et al (2000) reported on the first largescale
T-DNA insertional mutagenesis for functional genomics
in rice and produced approximately 18,000 fertile T-DNA gene
trap lines with an average loci number of 1.4. Without a robust
transformation system, it is difficult to produce the large number
of T-DNA tags required to saturate a genome. It has been
estimated that nearly half a million different tagged lines are
required to saturate the rice genome (Jeon et al 2000). We
have yet to fully assess the feasibility of using the Ac/Ds system
for high-throughput mutagenesis, but it was already evident
that the system could be improved with the incorporation
of a negative selector for the Ac construct and a strong tracer
selectable marker for Ds itself or for its subsequent excision.
Cytochrome P450 has been used as a negative selection marker
and bar as a tracer selectable marker in their constructs. Earlier,
we demonstrated that tms2 can be used as a negative selection
marker in rice (Upadhyaya et al 2000) and that bar can
be used as a strong Ds tracer or excision marker. We have
incorporated these features in our new constructs (Zhou et al,
this volume), which will greatly simplify the screening for stably
tagged lines, thus enabling us to build a substantial “gene
machine” within the next 3 years.
Because of the need to produce nearly half a million
tagged lines for saturating the genome, that is, to have stable
tags/traps in each of the predicted 40,000 plant genes (referred
to as the “Rice Gene Machine”), it is imperative that an international
collaboration be developed. To our knowledge, at least
five groups are actively involved in producing insertion mu-
354 Advances in rice genetics

tants in rice using T-DNA, Ac/Ds, En/I, and Arabidopsis Tag1,
with several other groups interested in joining the “tagging”
effort. It is absolutely vital to set up a common platform (an
international consortium) for exchanging information on tagged
lines so that the whole scientific community can have access
to the Rice Gene Machine. As part of this effort, a labnotecum-relational
database has been created, which catalogues
all the data produced on Ac and Ds lines, Ds trap lines, and
flanking rice genomic sequences, along with information on
mutant phenotypes and trap reporter expression patterns as well
as sequence information and sequence homology. A tagged
sequence database has also been set up, which will be made
available to registered users. A parallel search for sequences
homologous to our tagged sequences is being actively carried
out in publicly available databases. A Web site is also being
designed for the exchange or instant release of information on
lines with tags in known gene sequences.
References
Enoki H, Izawa T, Kawahara M, Komatsu M, Koh S, Kyozuka J,
Shimamoto K. 1999. Ac as a tool for the functional genomics
of rice. Plant J. 19:605-613.
Jeon J-S, Lee S, Jung K-H, Jun S-H, Jeong D-H, Lee J, Kim C, Jang
S, Lee S, Yang K, Nam J, An K, Han M-J, Sung R-J, Choi H-
S, Yu JH, Choi J-H, Cho S-Y, Cha S-S, Kim S-I, An G. 2000.
T-DNA insertional mutagenesis for functional genomics in
rice. Plant J. 22:561-570.
Kumar SC, Narayanan KK. 1997. Gene and enhancer trap constructs
for isolating genetic regions from rice. Rice Biotechnol. Q.
31:17-18.
Upadhyaya NM, Zhou X-R, Wu L, Ramm K, Dennis ES. 2000. The
tms2 gene as a negative selection marker in rice. Plant Mol.
Biol. Rep. 18(3):227-233.
Notes
Comparative genomics in the Oryzeae
S.A. Jackson, J.W. Lilly, R.L. Phillips, W.C. Kennard, and R.A. Porter
Authors’ addresses: N.M. Upadhyaya, X.-R. Zhou, Q.-H. Zhu, A.
Eamens, K. Ramm, L. Wu, R. Sivakumar, T. Kato, D.-W. Yun,
W.J. Peacock, E.S. Dennis, CSIRO Plant Industry, Canberra,
ACT 2601, Australia; S. Kumar, K.K. Narayanan, and G.
Thomas, Centre for Biotechnology, SPIC Science Foundation,
111 Mount Road, Guindy, Chennai 600 032, India.
Acknowledgments: The authors wish to thank GrainGene and the
GRDC for their financial support. Also, thanks are due to Drs.
A. Chaudhury and P.M. Waterhouse for their inputs as thinktank
members.
American wild rice (Zizania palustris) is a close relative of rice (Oryza sativa), with both belonging to the tribe
Oryzeae. To delineate the position of wild rice within the Oryzeae, genes Adh1, Adh2, and matK were sequenced
and compared with DNA sequences from other members of the Oryzeae. Both Adh1 and Adh2 appear to be
duplicated in the Zizania species, although not because of polyploidy as in the case of many wild rice species.
Unlike the rest of the Oryzeae, the Zizania species have chromosome numbers that differ from the basic number
of 12. Three chromosomes in Zizania sp. appear to be duplicates of rice chromosomes based on comparative
genetic mapping. There is, however, extensive genetic colinearity between wild rice and rice. More than 80% of
the RFLP loci are colinear between these two species. We have undertaken a physical mapping approach to
complement comparative genetic mapping. Although ribosomal DNA loci do not appear to be conserved in
number or location within the Oryza species, wild rice has two 5S rDNA loci and one NOR locus. As in other Oryza
species, the two 5S rDNA loci are intimately associated with the centromeres and the NOR is telomerically
located. Several rice centromeric sequences have been used for FISH and Southern analysis. Only RCS1, a
conserved cereal centromeric sequence, appears to be conserved. Bacterial artificial chromosomes, which are
part of the rice physical map being sequenced, are being mapped first in rice and subsequently in wild rice to
physically compare large genomic regions between these two species, examine chromosome evolution, and
evaluate the conservation of gene order and spacing in the Oryzeae. Thus far, there appears to be an accumulation
of intergenic sequences that are not conserved between wild rice and rice. Therefore, the accumulation of
intergenic DNA in the evolution of cereal plant species appears to occur at a high rate even within closely related
species in which genic sequences are closely conserved.
Zizania palustris (American wild rice) is the only grain native
to the North American continent. It has a long history of cultivation,
having been lake-harvested by Native Americans. Wild
rice has imperfect flowers, with the female flowers anatomically
superior to the male flowers, which presumably promotes
outcrossing. The Zizania species are unusual in the tribe
Oryzeae because they have members with chromosome
complements that are not multiples of n = 12. Z. aquatica and
Z. palustris are both n = 15 and Z. latifolia is n = 17. Based on
a comparative genetic map of Z. palustris and Oryza sativa,
three of the rice chromosomes (1, 4, and 9) appear to be present
as duplicates in Z. palustris (Kennard et al 1999). The Z.
palustris genome is roughly twice the size of the rice genome,
Genomics 355

Leersia perrieri
Zizaniopsis villanensis
Zizania aquatica
Zizania palustris
Zizania latifolia
Duplicated
Zizania latifolia
Zizania aquatica
Rhynchoryza subulata
Oryza sativa
Porteresia coarctata
Zea mays
Fig. 1. Phylogram of Adh1 sequences
from several previously
sequenced Oryzeae species (Ge
et al 1999) and three Zizania species.
The Adh1 gene is duplicated
in Z. aquatica and Z. latifolia. The
Zizania species are more closely
related to Rhynchoryza subulata
than Oryza sativa.
perhaps because of the increased amount of pericentromeric
heterochromatin.
Phylogenetic position in Oryzeae
Recent DNA sequencing of the phytochrome B gene (Matthews
et al 2000) showed that Z. palustris is a member of the tribe
Oryzeae. The nuclear Adh genes, Adh1 and Adh2, and the chloroplast
gene (matK) were sequenced from Z. palustris, Z.
aquatica, and Z. latifolia and compared with other Oryzeae
sequences from Genbank (Ge et al 1999). Using standard sequence
software, Zizania species were determined to be more
closely related to Rhynchoryza subulata, a South American
member of the Oryzeae, than to the Oryza species (Fig. 1).
This conclusion was supported by the Adh1, Adh2, and matK
phylogenies. Interestingly, the Adh genes appear to be duplicated
within all three Zizania species. Thus, the duplication of
these genes may have occurred after the specification of the
Zizanias from R. subulata. Ge et al (1999) sequenced these
genes from other members of Oryzeae and did not find duplicated
Adh genes except in polyploid Oryza species. In O. sativa,
Adh1 and Adh2 are separated by 35 kb on chromosome
11 (Tarchini et al 2000). Thus, this entire region may have
been duplicated in the Zizania species. We are studying this
using a physical mapping approach.
Comparative genetic and physical mapping
RFLP mapping of Z. palustris using rice probes
A restriction fragment length polymorphism (RFLP) map was
constructed for Z. palustris using rice, oat, and maize mapping
clones. Based on a shared set of mapping probes, a comparative
map of rice and Z. palustris was constructed (Kennard
et al 1999). More than 80% of the genetic loci in this comparative
map are colinear between these two species, making
it the most colinear comparison to date. Three of the rice chromosomes
(1, 4, and 9) appear to be duplicated and, at this
point, rice chromosome 12 does not appear to be colinearly
conserved in Z. palustris, which has been observed in other
comparative mapping studies involving rice. Several QTLs for
agronomic traits were mapped using the RFLP map in Z.
palustris, including those for seed nondormancy, nonshattering,
disease resistance, maturity, and yield. Several of the mapped
QTLs for these traits appear to be colinear with QTLs for similar
traits in rice (Kennard et al, personal communication).
356 Advances in rice genetics

3 kb
1 kb
1 2 3 4 5 1 2 3 4 5
A
B
related Brassica rapa (Jackson et al 2000). The B. rapa genome
is three times larger than the Arabidopsis genome, although
this may be due to genome duplication. However,
Arabidopsis BACs were successfully hybridized to both chromosomes
and extended DNA fibers of B. rapa. The fiber-FISH
signals derived from Arabidopsis BACs used on DNA fibers
from B. rapa were similar in size to those observed in
Arabidopsis, suggesting that there had not been an accumulation
of intergenic sequences in the evolution of these species.
When BACs containing rice DNA were hybridized to extended
DNA fibers of Z. palustris, there appeared to be an accumulation
of intergenic sequences such that it was difficult to delimit
the BAC ends for measurement. Thus, in these closely
related species, it appeared that there was an accumulation of
nonconserved intergenic sequences, suggesting that, in cereals,
the mode of genome evolution differs from that observed
in the B. rapa/Arabidopsis complex.
Fig. 2. Southern blot of BamHi-digested genomic DNA of (1) Zizania
palustris, (2) Z. aquatica, (3) Z. latifolia, (4) Oryza sativa, and (5)
Zea mays. (A) RCS2, a tandemly repeated O. sativa centromeric
clone, was present only in O. sativa. (B) RCS1, an interspersed
centromeric sequence from O. sativa, is present in all of the Zizania
species and Zea mays. Lane 3, Z. latifolia, was underloaded.
Physical mapping in Z. palustris
Ribosomal DNA sequences do not appear to be conserved in
location or number in the Oryza species (Shishido et al 2000).
Ribosomal sequences were mapped in Z. palustris. Two 5S
ribosomal arrays and one NOR (18S-5.8S-25S) were mapped
in Z. palustris. As in other Oryzeae species, the 5S rDNA arrays
were intimately associated with the centromere and the
NOR was telomerically located. In O. sativa, at least one of
the 5S rDNA sequences is located within RCS2, the rice centromeric
tandem repeat (F. Dong and J. Jiang, unpublished
data).
Dong et al (1998) isolated several rice sequences from
O. sativa. RCS1, a conserved cereal centromeric sequence, is
present in Z. palustris centromeres as shown by fluorescence
in situ hybridization (FISH), and is present in the genomes Z.
aquatica and Z. latifolia as shown by Southern analysis (Fig.
2B). Using RCS1, polymorphisms have been found in the Z.
palustris mapping population. Similar to what has been done
in O. sativa (Wang et al 2000), we are defining the genetic
location of the centromeres using this conserved sequence.
Based on Southern analysis, RCS2, a tandemly repeated centromeric
sequence, is not conserved in the Zizania species (Fig.
2A). We are now attempting to clone centromeric sequences
from Z. palustris to understand the evolution of centromeres
between closely related species.
Several rice bacterial artificial chromosomes (BACs) that
are part of the rice BAC physical map being sequenced have
been used to probe the genome of Z. palustris to understand
comparative genome structure and evolution. This technique
was successfully used to map Arabidopsis BACs in the closely
References
Dong F, Miller J, Jackson SA, Wang G-L, Ronald PC, Jiang J. 1998.
Rice (Oryza sativa) centromeric regions consist of complex
DNA. Proc. Natl. Acad. Sci. USA 95:8135-8140.
Ge S, Sang T, Lu B-R, Hong D-Y. 1999. Phylogeny of rice genomes
with emphasis on origin of allotetraploid species. Proc. Natl.
Acad. Sci. USA 96:14400-14405.
Jackson SA, Cheng Z, Wang M-L, Goodman HM, Jiang J. 2000.
Comparative FISH mapping of a 431-kb Arabidopsis thaliana
BAC contig reveals the role of chromosomal duplications in
the expansion of the Brassica rapa genome. Genetics 156:833-
838.
Kennard W, Phillips RL, Porter R, Grombacher A. 1999. A comparative
map of wild rice (Zizania palustris L. 2n=2x=30).
Theor. Appl. Genet. 99:793-799.
Matthews S, Tsai RC, Kellog EA. 2000. Phylogenetic structure in
the grass family (Poaceae): evidence from the nuclear gene
phytochrome B. Am. J. Bot. 87:96-107.
Shishido R, Sano Y, Fukui K. 2000. Ribosomal DNAs: an exception
to the conservation of gene order in rice genomes. Mol. Gen.
Genet. 263:586-591.
Tarchini R, Biddle P, Wineland R, Tingey S, Rafalski A. 2000. The
complete sequence of 340 kb of DNA around the rice Adh1-
Adh2 region reveals interrupted colinearity with maize chromosome
4. Plant Cell 12:381-391.
Wang J, Jiang J, Zhang Q. 2000. Mapping of centromeric regions on
the molecular linkage map of rice (Oryza sativa L.) using centromere-associated
sequences. Mol. Gen. Genet. 263:165-172.
Notes
Authors’ addresses: S.A. Jackson, R.L. Phillips, and R.A. Porter,
Department of Agronomy and Plant Genetics, University of
Minnesota, St. Paul, MN 55108; J.W. Lilly, Program in Plant
Breeding and Plant Genetics, University of Wisconsin-Madison,
Madison, WI 53076; and W.C. Kennard, Monsanto Company,
3302 SE Convenience Blvd., Ankeny, IA 50021, USA.
Genomics 357

T-DNA as a potential insertional mutagen in rice
C. Sallaud, D. Meynard, J.P. Brizard, M. Bès, C. Gay, M. Raynal, E. Bourgeois, H. Hoge, M. Delseny, and E. Guiderdoni
We investigated the potential of Agrobacterium tumefaciens-mediated transformation for producing a genome-wide library of T-
DNA rice plants individually characterized by their flanking sequence tag (FST). A japonica rice callus transformation procedure—which
relies both on high frequency (75% and 96% in Taipei 309 and Nipponbare, respectively) of cocultured calliyielding
resistant cell lines and independent generation of multiple (2 to 30) resistant cell lines per cocultured callus—was
optimized. Potential efficiencies were as high as 5 and 7 independent transformants per cocultured callus in cultivars Taipei
309 and Nipponbare. We further studied the integration of the T-DNA in more than 200 transgenic plants. Around 35% of the
T 0
plants were found to harbor one copy of the T-DNA in both populations. In Taipei 309, 90% of these plants did not have
integrated plasmid backbone sequences and 95% segregated the hygromycin resistance trait according to a 3:1 ratio in their
T 1
progenies. In multiple-copy plants, 31% of the plants had integrated plasmid backbone sequences and 52% and 10%
segregated according to a 3:1 and 15:1 ratio, respectively. Using an efficient polymerase chain reaction walking method, 82
(58%) DNA regions adjacent to the left border of T-DNA inserts (FSTs) have been isolated and sequenced. Results of a
homology search indicated that eight known genes had been tagged with the T-DNA.
Insertional mutagenesis is a means of disrupting gene function
based on the insertion of foreign DNA into a sequence of interest.
In higher plants, this encompasses the use of transposable
elements such as a transposon or retrotransposon, or T-
DNA. In rice, the autonomous maize Ac element has been transferred
into the rice genome since the early 1990s and has proved
to actively transpose and to insert in genes with a 3–4-fold
specificity, allowing the establishment of gene machines in cv.
Toride 1 and Nipponbare (Enoki et al 1999, Greco et al, unpublished).
More sophisticated double-component AcTpase/
Ds systems have recently been engineered in japonica rice cv.
Dong-Jin and have proved to be functional. The native rice
Ty1-copia Tos-17 retrotransposon, the copy number of which
is specifically amplified during tissue culture, has also proved
to be a valuable tool for forward and reverse genetics in rice
cv. Nipponbare (Hirochika 1999).
Although rice is amenable to Agrobacterium-mediated
transformation with efficiencies compatible with the engineering
of a large range of genes of interest, T-DNA insertional
mutagenesis has so far not been undertaken. This is because a
high-throughput transformation procedure permitting the generation
of thousands of transformants in a single experiment
has not yet been reported. In a large sample of transgenic plants,
it is also important to determine whether the most frequent
organization of the integrated T-DNA is compatible with further
PCR-based screenings in DNA pools and recovery of
flanking regions containing sufficiently informative sequences
for homology searches.
We investigated the potential of T-DNA transfer for producing
a genome-wide library of insertional mutants in rice to
be primarily used in reverse genetics. We report on the development
of a highly efficient transformation procedure relying
on both a careful choice of the target callus source and a modified
coculture and selection procedure in two model japonica
rice cultivars. We further determined the organization of the
T-DNA in more than 200 transformation events and isolated
the genomic region adjacent to the left border from 80 T-DNA
inserts.
Materials and methods
The 13.8-kb binary plasmid pC30063 was constructed by P.
Ouwerkerk (Leiden University, The Netherlands) by inserting
the 1,915-bp BamHI/PstI fragment of pMON30063 (kindly
provided by K.L. Fincher, Monsanto Company, St Louis, USA)
containing the S65Tgfp coding sequence-controlled CaMV 35S
promoter with a duplicated enhancer sequence and the nos3′
terminator, in the multiple cloning site of the pCAMBIA1301
binary vector (R. Jefferson, CAMBIA, Canberra, Australia)
(Fig. 1). Embryogenic nodular units released from the primary
embryo scutellum-derived callus of the japonica cultivars
Taipei 309 and Nipponbare were immersed in 25 mL of liquid
coculture medium containing Agrobacterium EHA 105
(pC30063) cells for 10–15 min, then transferred to petri dishes
containing solid coculture medium for a 3-d incubation at 25
°C in the dark. The procedure for coculture, selecting resistant
cell lines—using two 2–3-wk subcultures on different selection
media, and evolving transgenic rice plants—will be detailed
elsewhere.
Genomic DNA (2.5 µg) was digested with HindIII, which
cuts once in the T-DNA (Fig. 1), and transferred to nylon membranes
(Hybond N+, Amersham) after electrophoresis according
to the Southern blot procedure. Hybridizations were realized
with gusA and hph coding sequence and the 300-bp sequences
adjacent to the left (LB out) and right (RB out) borders
outside the T-DNA (Fig. 1). Flanking sequence tags (FSTs)
were amplified following a PCR walking method (Siebert et al
1995) adapted to plant materials by Devic et al (1997) and
later modified by Balzergue and coworkers (unpublished).
358 Advances in rice genetics

HindIII (4,336)
4.3 kb 3.1 kb
LB out hph e35S gfp e35S 35S gus RB out
T-border (left)
T-border (right)
CaMV 35S poly-A Nos poly-A Nos poly-A
Fig. 1. T-DNA of the binary plasmid pC30063 was used in transformation, indicated by restriction sites and
probes (black bar) used for molecular analysis of transgenic rice plants.
Table 1. Transformation of two rice cultivars by Agrobacterium strain EHA105 bearing the pC30063 binary
plasmid.
Cocultured GFP+ cell lines Number of Potential
Cultivar Cultured resistant cell per cocultured resistant cell minimum
calli (A) lines (B) callus (C)(mean ± lines a regenerating transformation
(no.) (%) SD) (no.) plants [no. and efficiency
% regeneration (D)] (A × B × C × D)/A
Taipei 309 110 75.4 4.9 ± 3.0 264 (52.8) 195.1
Nipponbare 100 96.0 7.3 ± 4.2 116 (49.8) 349.0
a A subset of randomly chosen Hyg R calli was placed under regeneration conditions irrespective of whether they exhibit GFP activity or
not.
Results and discussion
High-efficiency transformation
Table 1 presents the results of the coculture experiments of
embryogenic callus pieces with Agrobacterium strain EHA105
bearing the binary plasmid pC30063: 75.4 and 96.0 of
cocultured calli yielded an average of five and seven unambiguously
green fluorescent protein (GFP)-positive,
hygromycin-resistant cell lines in cv. Taipei 309 and
Nipponbare, respectively (Fig. 2). The formation of multiple
GFP-positive resistant cell lines arising from structurally independent
regions of the callus was observed as early as 12 d
after transfer to the first selection medium, when whitish translucent
globular proliferations developed from the dark brownturning
cocultured callus. The regeneration frequency (about
50% in both cultivars) was based on the regeneration of randomly
chosen hygromycin-resistant calli irrespective of their
GFP activity. Upon monitoring the GFP activity of calli on
RN medium, we found no significant difference between GFPpositive
and GFP-negative calli in terms of regeneration frequency
(data not shown). The potential minimum transformation
efficiency (PMTE) is 2 to 3.5 independent plants per
cocultured callus in cv. Taipei 309 and Nipponbare. In this
calculation, we assumed that all the hygromycin-resistant cell
lines were independent transformation events, but we did not
take into account the compact hygromycin-resistant calli displaying
faint or no GFP activity, which represent 60% and 51%
of the total calli produced in the two cultivars, respectively. If
all the hygromycin-resistant cell lines formed on the second
A
Fig. 2. (A) Multiple globular GFP-positive formations arising from
a cocultured callus 14 d after transfer to selective medium. (B)
Multiple hygromycin-resistant cell lines develop from cocultured
calli 5 wk following the coculture experiment with Agrobacterium
strain EHA105 bearing the pC30063; observed using a Leica
MZFLIII fluorescence stereomicroscope.
selection medium are transferred upon regeneration, the actual
potential transformation efficiency would reach 5 and 7 in
Taipei 309 and Nipponbare. Previous reported efficiencies of
Agrobacterium-mediated transformation of rice callus tissues
typically ranged from 0.1 to 0.5. Careful selection of starting
materials and modification of coculture and selection procedures
can enhance transformation.
B
Genomics 359

Organization of T-DNA in transgenic rice plants
To verify that hygromycin-resistant cell lines generated by a
single cocultured callus do represent independent transformation
events, we characterized 120 Taipei 309 plants obtained
from 17 cocultured calli, each regenerating a range of 4 to 23
hygromycin-resistant plants (Table 2). As illustrated in Figure
3 for callus 86, 22 out of 23 plants exhibited distinct hybridization
patterns, whereas plants 86.8 and 86.10 were clonal
and were likely derived from the fragmentation of a single transformed
cell line. Overall, 118 (97%) out of 120 plants analyzed
were found to exhibit independent patterns. A comparable
conclusion was drawn from the analysis of T-DNA plants
Table 2. Molecular characterization of 120 transgenic plants
regenerated from 17 cocultured calli of cv. Taipei 309.
Cocultured Regenerated Independent Single-copy
callus number plants analyzed events (no.) plants
(no.)
11 8 8 2
14 5 5 1
16 11 11 0
21 5 5 2
26 4 4 1
27 4 4 0
33 5 5 1
45 8 6 4
48 6 6 2
60 9 9 2
63 5 5 2
68 5 5 3
70 5 5 2
79 7 7 4
81 4 4 1
83 6 6 1
86 23 23 6
Total 120 118 34
of cultivars Nipponbare, Zhongzuo 321, and Azucena (data
not shown), indicating that the generation of multiple transformation
events from a single cocultured callus is a general
phenomenon.
The average number of T-DNA inserts in Taipei 309
and Nipponbare populations has been estimated to be 1.5 to 2.
A single T-DNA copy represented 37% and 41% of the T-
DNA plants in cv. Taipei 309 and Nipponbare, respectively,
and their progenies segregated according to a 3:1 ratio for
hygromycin resistance (Table 3). Ninety percent of the T 1 lines
exhibited gusA and gfp reporter gene activities, suggesting that
transgene silencing occurred at low frequency in this group of
plants (data not shown). The 3:1 segregation ratio was also
observed in 52% and 20.6% of the T 1 progenies of multiplecopy
plants of cv. Taipei 309 and Nipponbare, suggesting that
the copies had inserted at several sites but in a single genetic
locus. However, the possibility that the different T-DNA copies
had integrated several genetic loci with only one locus being
actively expressed cannot be ruled out. We used two probes
(LB out and RB out) hybridizing just outside of the right and
left T-DNA border end, respectively (Fig. 1), to detect integration
of non-T-DNA sequences. Upon analyses, we observed
a significant proportion of plants (20%) that have integrated
the binary vector backbone. Single-copy plants that have integrated
the binary vector backbone had a lower frequency (9%)
than multiple-copy (31%) plants in Taipei 309. This latter result
appears consistent with those obtained in PCR-based characterization
of 226 T 0 plants of different cultivars using strains
EHA101 and LBA4404. These harbor a comparable
pCAMBIA1301-derived vector (Yin and Wang 2000) where
33.2% of the T 0 plants were proven to contain non-T-DNA
sequences.
Line no.
kb
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23
10
7
5
4
hph
HindIII
10
7
5
4
3
gusA
HindIII
Fig. 3. Southern blot analysis of HindIII digests of genomic DNA of 23 plants regenerated from
cocultured callus 86, hybridized to the hph and gusA probes. Arrows indicate the two lines that
have the same T-DNA integration pattern.
360 Advances in rice genetics

Table 3. Molecular characterization and progeny analyses of transgenic plants of two rice cultivars.
T 0 Frequency of T-DNA inserts Segregation analysis in T 1 progeny
Cultivar plants independent (no.)
(no.) events
Single Multiple Single-copy lines Multiple-copy lines
3:1 ≠ 3:1 15:1 ≠
Taipei 309 120 97.0 37.0 54.0 95.0 5.0 52.0 10.0 38.0
Nipponbare 92 99.0 41.0 59.0 83.0 17.0 20.6 0.0 79.4
Table 4. Flanking sequence tags (FSTs) from T-DNA mutant lines found similar to sequences deposited in public databases.
FST size Blast N homology Acc. no. Insertion Identity Amino acid homology
(bp) site a (%)
327 O. sativa genomic clone, chr 1 AP001633 Intron 79 Lipase
269 A. thaliana MAP3K alpha protein kinase ATU58918 ORF 94 MAP3K alpha protein kinase
221 A. thaliana EF-1 β2, cds D83726 ORF 95 EF-1 β2
472 O. sativa genomic DNA, chr 4 OSB6015 Intron 85 Putative protein
461 Gypsy-type retrotransposon RIRE 8B AB014741.1 – 95 –
>600 O. sativa genomic clone, chr 1 AP001800 5′-UTR 86 Putative lipase
514 O. sativa genomic clone, chr 6 AP000399 ORF 83 Acyl-ACP-thioesterase
>600 O. sativa p34 cdc2 X60374 ORF 97 p34 cdc2
a OPR = open reading frame, UTR = untranslated region.
Isolation and sequencing of regions adjacent
to T-DNA insertion points (FSTs)
To learn more about T-DNA integration into the genome, isolation
of a large number of FSTs has been done by the PCR
walking method (Devic et al 1997). This method was selected
for its high reliability and procedural simplicity. A single PCR
product had been obtained from 82 transgenic Taipei 309
samples tested (58%, n = 141) in the second PCR runs when
the enzymes EcoRI/DraI or NaeI/SspI had been used. After
eliminating the T-DNA sequence, an average of 350 bp of the
host genomic DNA was obtained. In some lines, a large deletion
of the T-DNA right border (up to 120 bp) had been detected.
Using the blast tool to search in the Genbank, 10% of
the FST sequences proved to be identical to the binary vector,
indicating that in these mutant lines the binary vector has been
integrated into the genome with the T-DNA. These data confirmed
results obtained by hybridization with a probe specific
to the binary vector backbone (LB out). Isolating the FSTs for
these lines will be difficult in a large-scale procedure. Moreover,
the presence of these lines in a reverse genetics screen
would not be useful. A large number of the FSTs did not match
any known sequences in the database. We have identified FSTs
that are highly homologous to known genes (Table 4). Four
insertions are located within the exon of the gene, two within
the intron, and one in the 5′-UTR. These data indicated that
from 80 T-DNA lines at least 8 (10%) contained an insertion
within a known gene. Moreover, the expression of half of the
tagged genes was affected by the T-DNA insertion.
Conclusions
The transformation efficiency reported here allows the production
of several thousands of events in a single coculture
experiment of a few hundred callus pieces. The availability of
a high-throughput transformation procedure permits the creation
of a genome-wide T-DNA insert library in rice. Results
also proved that organization of integrated T-DNA is generally
compatible with recovery and further sequencing of genomic
regions flanking insertion points. Large-scale production
of FSTs should be attainable through optimization and
automation of the processes. A major question that remains is
the number of lines that need to be generated to ensure a genome-wide
coverage of T-DNA inserts in rice. This has been
estimated to be 100,000–180,000 in the Arabidopsis genome
(Krysan et al 1999), which represents one-fourth of that of
rice. A recent study has demonstrated that transgenic rice plants
exhibit integration of the T-DNA into a compositionally distinct
DNA fraction representing transcriptionally active regions
of the genome called the “gene space” (Barakat et al 2000).
As the gene space accounts for only 25% of the rice genome—
compared with 85% in Arabidopsis—the number of T-DNA
lines to be generated could be the same in the two model species.
References
Barakat A, Gallois P, Raynal M, Mestre-Ortega D, Sallaud C,
Guiderdoni E, Delseny M, Bernardi G. 2000. The distribution
of T-DNA in the genomes of transgenic Arabidopsis and
rice. FEBS Lett. 471:161-164.
Genomics 361

Devic M, Albert S, Delseny M, Roscoe TJ. 1997. Efficient PCR
walking on plant genomic DNA. Plant Physiol. Biochem.
35:331-339.
Enoki H, Izawa T, Kawahara M, Komatsu M, Koh S, Kyozuka J,
Shimamoto K. 1999. Ac as a tool for the functional genomics
of rice. Plant J. 19:605-613.
Hirochika H. 1999. Retrotransposons of rice as a tool for forward
and reverse genetics. In: Shimamoto K, editor. Molecular biology
of rice. Tokyo (Japan): Springer-Verlag. p 43-58.
Krysan PJ, Young JC, Sussman MR. 1999. T-DNA as an insertional
mutagen in Arabidopsis. Plant Cell 11:2283-2290.
Siebert PD, Chenchick A, Kellogg DE, Lukyanov KA, Lukyanov
SA. 1995. An improved PCR method for walking in uncloned
genomic DNA. Nucl. Acids Res. 23:1087-1088.
Yin Z, Wang GL. 2000. Evidence of multiple complex patterns of T-
DNA integration into the rice genome. Theor. Appl. Genet.
100:461-470.
Notes
Authors’ addresses: C. Sallaud, D. Meynard, M. Bès, C. Gay, E.
Bourgeois, E. Guiderdoni, Génoplante, Biotrop Programme,
Cirad-Amis, Avenue Agropolis, F-34398 Montpellier Cedex
5; J.P. Brizad, Genetrop, Ird, BP5045, 34032 Montpellier
Cedex 01; C. Gay, INRA-ENSAM, 2 Place Viala, F-34060
Montpellier Cedex 01; M. Raynal, M. Delseny, Laboratoire
Génome et Développement des Plantes, UMR5096, CNRS/
UP, 52, Avenue de Villeneuve, F-66860 Perpignan Cedex
France; H. Hoge, Rice Research Group, Institute of Molecular
Plant Science, Leiden University, PO Box 9505, 2300 RA
Leiden, The Netherlands.
New Ac/Ds-based constructs for efficient gene and enhancer
trapping in rice
X.-R. Zhou, K. Ramm, L. Wu, R. Sivakumar, E.S. Dennis, and N.M. Upahdyaya
We have evaluated Ac/Ds gene and enhancer trapping constructs and shown that all components except the negative selector
nptII gene work in rice. Hygromycin counter selection could identify the possible stable trap lines that did not contain Ac and in
which Ds had jumped to locations unlinked to their original positions. However, high-throughput screening requires quick and
efficient selection of stable Ds trap lines, linked or unlinked to their original positions, from among the large screening population.
We have evaluated two negative selectors, tms 2
(iaaH) under the control of the manopine synthase gene 2 promoter from
Agrobacterium tumefaciens and codA driven by the CaMV 35S promoter, for use in rice. The former was found to be suitable
for rice and an Ac construct with tms 2
as a negative selector has been employed. In the Ds enhancer and gene trap constructs,
the nptII gene has been replaced with bar as a strong negative selector for Ds. Ds gene and enhancer trap constructs with bar
as a Ds excision marker have also been made. Use of these new constructs will simplify the screening for stable trap lines.
Since transposition of the maize transposable element Ac in
rice, efforts have been made to use either Ac or the two-element
Ac/Ds system for large-scale insertional mutagenesis as
a tool for rice functional genomics. Based on gene density and
genome size, nearly half a million insertion mutants need to be
produced to saturate the rice genome of approximately 430
Mb (Jeon et al 2000). Use of a reporter gene with a minimal
promoter (enhancer trap) or with intron splice acceptors (gene
trap) with tagging (T-DNA or Ds transposon) sequences facilitates
the “trapping” of genetic regions that do not have a
visible phenotype. This “trapping” system has been used effectively
in Arabidopsis with the two-element Ac/Ds system
(Sundaresan et al 1995) and is now being used in rice.
We have been evaluating the Ac/Ds-based gene and enhancer
trapping constructs originally developed for use in
Arabidopsis (Sundaresan et al 1995) and redesigned for use in
rice (Kumar and Narayanan 1997). Here, we give an account
of our evaluation of the various components of these constructs
and of the additional features incorporated in our new constructs
designed for high-throughput mutagenesis and screening.
Features of currently used constructs
The binary vector (pCAMBIA1300) carrying Ac contains the
CaMV 35S promoter-driven hph as a selectable marker and
the Ubi1-TMV omega translational enhancer-driven, 5′ deleted
Ac (immobile Ac). The binary vector carrying the Ds enhancer
trap, DsE, contains the same hph and the Ubi1 promoter-driven
sgfpS65T gene as a Ds launching pad reporter. DsE also contains
the uidA gene with a minimal promoter (transcriptional
activator) as a trap reporter, manopine synthase 2′ gene promoter-driven
nptII gene as a trap tracer, and the ampicillin
resistance gene bla with an E. coli origin of replication as a
plasmid rescue system. The DsG construct is the same as DsE,
except that DsG contains the GPA1 (G-protein α-subunit from
Arabidopsis) intron with triple splice acceptors instead of the
minimal promoter. These constructs (Kumar and Narayanan
1997) were kindly supplied by our collaborators from the SPIC
Science Foundation, Chennai, India. We have used three delivery
methods to produce a large number of Ac/Ds starter
transgenic lines: parallel delivery of Ac and Ds into rice and
subsequent crossing, sequential delivery of Ac and Ds into rice,
362 Advances in rice genetics

and co-delivery of Ac and Ds into rice. The evaluations of
these constructs are based on results obtained from the first
screening population (F 2 of crosses or T 1 of double
transformants).
We have shown that the Ubi1 promoter-driven immobilized
Ac transposase, plant selectable marker hph, plasmid rescue
system, transcriptional activator, GPA1 intron with splice
acceptors, trap reporter gene uidA, and Ds donor site reporter
(Ubi1 P-sgfpS65T) all work efficiently in rice. Since both Ac
and Ds donor loci would have hph, we have explored the possibility
of using hygromycin spray as a counter selector to identify
Ds stable traps (unlinked to Ac) also unlinked to the Ds
donor site. Transgenic rice plants with the CaMV 35S promoter-driven
hph gene and nontransgenic plants were sprayed
with hygromycin B solution at concentrations of 50, 100, and
150 mg L –1 in water containing 0.05% AGRAL60 (ICI, Australia)
as a wetting agent. Nontransgenic or segregating null
plants developed necrosis or yellow spots on leaves within 4–
5 d of the treatment, especially at the higher dosages, whereas
hph transgenic plants did not show any obvious symptoms (Fig.
1A). The hygromycin B spray did not permanently affect the
growth and fertility of sensitive plants. Thus, we are able to
use hygromycin spray to identify sensitive progenies as devoid
of Ac and Ds donor sites (stable Ds traps unlinked to the
Ds donor site or null) with reasonable accuracy. However, we
have observed some progeny plants scored as sensitive by
hygromycin spray that contained the gene, which could have
become silent.
Modified green fluorescent protein (GFP) genes, such
as mgfp4 and sgfpS65T, have been used in rice as a vital reporter
(Upadhyaya et al 2000). The Ds constructs we used
have the Ubi1(I) promoter-driven sgfpS65T and this vital
marker is being used effectively, not only for monitoring transformation
but also for separating possible stable traps linked
to and unlinked from the original launching pad. Although with
the T 1 progeny for most Ds lines GFP expression segregated
normally, we did find several lines showing abnormal segregation
or complete silencing of GFP expression. For all crossing
experiments, only Ds lines with a history of normal segregation
were used (Fig. 1B).
Components added to new constructs
We have used transgenic lines with the CaMV 35S promoterdriven
bar gene to work out a spray system. Seedlings (15–20
d old) were sprayed with 1, 3, 5 and 10 mL L –1 commercial
Basta. Results showed that Basta spray at 5 mL L –1 is lethal to
wild-type control seedlings, whereas the transgenic plants remained
green and grew normally after Basta spray at this rate
(Fig. 1C).
A conditional negative selection marker is also essential
for high-throughput screening with the two-element transposon
tagging system. We have demonstrated that tms 2 can be used
as a negative selector in rice. T 1 transgenic seedlings expressing
this tms 2 gene under the control of the mas2 promoter
showed a significant reduction in shoot and root growth in the
A
hph + WT
150 µg hygromycin
mL –1
B
C
bar +
WT
5 mL L –1 Basta
B
GFP segregation
tms
+
2 WT
10 µM NAM
Fig. 1. Evaluation of the components for new Ac and Ds constructs.
(A) Detection of hyg s rice seedlings by hygromycin B spray now
being used as a counter selector for identifying hyg s plants in the
screening population that can contain only Ds unlinked to Ac and
Ds donor sites (launching pad) or nulls. (B) Germinating T 1 seeds
of a DsG transgenic line containing sgfpS65T driven by the Ubi1(I)
promoter at the Ds donor site (original T-DNA insertion site) showing
segregation of GFP expression. GFP expression visualized using
an MZ6 stereomicroscope (Leica Microscopy and Scientific
Instruments) illuminated by a 50-W HP mercury vapor lamp with a
fluorescence GFP-Plus filter set (480/40-nm excitation filter, 505-
nm LP dichromatic mirror, and 510-nm LP barrier filter). Arrows
indicate GFP – null seeds. (C) Transgenic seedlings containing a
CaMV 35S promoter-driven bar gene showing resistance to herbicide
Basta spray. (D) tms2 transgenic seeds showing germination
inhibition in the presence of naphthaleneacetamide in the germination
medium.
presence of 5–10 µM NAM under specified growth conditions
compared with control plants (Fig. 1D). The CaMV 35S promoter-driven
codA did not work efficiently as a negative selector
in rice (data not shown) and we are now testing a rice
Actin1 (Act1) promoter-driven codA for its suitability as a negative
selector.
Based on the above results, a set of new constructs with
a strong positive selector (bar) for Ds and a negative selector
(tms 2 ) for Ac has been made. Within the Ds constructs, the hph
gene is used as a selectable marker for transformation, and,
together with the sgfpS65T gene, for selection as a Ds donor
site (Fig. 2). The procedures for high-throughput screening of
Ac/Ds starter line progenies with these new constructs are to
(1) germinate seeds in the presence of 10 mM NAM to remove
the Ac-containing plants, (2) spray with Basta to kill
D
Genomics 363

Ds with bar as tracer
DsE
i
ii
LB 35S P hph T 3¢ uidA T bar 35SP ori bla 5¢ Ubi P gfp T RB
TA
DsG
LB 35S P hph T 3¢ uidA T bar 35SP ori bla 5¢ Ubi P gfp T RB
SA
Ds with bar excision marker
DsE
iii
iv
LB 35S P 3¢ uidA T ori bla 2¢P nptll T 5¢ bar T 35S P hph(l) T RB
TA
DsG
LB 35S P 3¢ uidA T ori bla 2¢P nptll T 5¢ bar T 35S P hph(l) T RB
SA
Ac transposase constructs
v
LB 2¢P tms 2
T 35S P Ac T 35S P hph T RB
vi
LB Act1 P codA T 35S P Ac T 35S P hph T RB
Fig. 2. New Ac/Ds-based gene constructs. Binary vector (pCAMBIA1300 backbone) constructs with
DsE (i) or DsG (ii) containing a CaMV 35S promoter-driven bar as a strong positive selector (Ds
tracer); a Ubi1(I) promoter-driven sgfpS65T as a donor site reporter; a CaMV 35S promoter-driven
hph as a selectable marker in transformation and as a counter selector in screening for unlinked Ds
trap lines; uidA as the trap reporter; and the ampicillin resistance gene bla and an E. coli origin of
replication (ori) for one-step cloning by plasmid rescue. Binary vector (pWBVec8 backbone) constructs
with DsE (iii) or DsG (iv) with bar as an excision marker and a CaMV 35S promoter-driven
intron-interrupted hph. The DsE and DsG shown here are the same as in pSK100 and pSK200 constructs
used previously. Binary vectors (pCAMBIA1300 backbone) with a CaMV 35S promoter-driven
5′-deleted Ac transposase, a CaMV 35S promoter-driven hph, and the Act1 promoter-driven codA (v)
or 2′ promoter-driven tms 2 (vi) as negative selectors.
plants devoid of Ds, and (3) spray with hygromycin combined
with the GFP score to separate Ds insertions linked (hph + and/
or GFP + ) and unlinked (hph – and/or GFP – ) to the Ds donor
site (T-DNA tag). This protocol will greatly reduce elaborate
time-consuming DNA extraction and PCR procedures. Ds gene
and enhancer trap constructs with bar as an excision marker
have also been made with a view to trapping genes linked to
the Ds donor site. These constructs have already been tested
in Arabidopsis (data not shown). We are also using the super
transformation system (first with the Ac construct, then with
the Ds construct) to produce Ac/Ds starter lines.
References
Jeon J-S, Lee S, Jung K-H, Jun S-H, Jeong D-H, Lee J, Kim C, Jang
S, Lee S, Yang K, Nam J, An K, Han M-J, Sung R-J, Choi H-
S, Yu J-H, Choi J-H, Cho S-Y, Cha S-S, Kim S-I, An G. 2000.
T-DNA insertional mutagenesis for functional genomics in
rice. Plant J. 22:561-570.
Kumar SC, Narayanan KK. 1997. Gene and enhancer trap constructs
for isolating genetic regions from rice. Rice Biotechnol. Q.
31:17-18.
Sundaresan V, Springer P, Volpe T, Haward S, Jones JD, Dean C,
Ma H, Martienssen R. 1995. Patterns of gene action in plant
development revealed by enhancer trap and gene trap transposable
elements. Genes Dev. 9:1797-1810.
Upadhyaya NM, Surin B, Ramm K, Gaudron J, Schunmann PHD,
Taylor W, Waterhouse PM, Wang M-B. 2000. Agrobacteriummediated
transformation of Australian rice cultivars Jarrah and
Amaroo using modified promoters and selectable markers.
Austr. J. Plant Physiol. 27:201-210.
Notes
Authors’ address: CSIRO Plant Industry, GPO Box 1600 Canberra,
ACT 2601, Australia.
Acknowledgments: We wish to thank S. Kumar, K. Narayanan, and
G. Thomas (SPIC Science Foundation, Chennai, India) for
providing their Ac and Ds constructs. We are also grateful to
GrainGene for financial support.
364 Advances in rice genetics

Ac/Ds-mediated gene trap systems for functional
genomics in rice
B.I. Je, C.M. Kim, Su Hyun Park, Sung Han Park, Y.J. Na, J.J. Lee, B.G. Oh, N.M. Hee, G.H. Yi, H.Y. Kim, and C.D. Han
We have established Ac/Ds-mediated gene trap systems in rice. The efficiency of these gene-tagging systems has been tested
by producing transgenic rice plants carrying a simple and single T-DNA insert. High Ds mobility and effective gene detection
implied that an Ac/Ds family would be an excellent genetic tool for use in functional genomics in rice. To produce a large
population of Ds transposants, single-copy Ds and Ac “starter” lines were produced. Each Ds starter line was examined for
transposition efficiency by crossing it with an Ac line. A couple of Ds lines (called Super J) showed that more than 50% of the
F 2
progenies demonstrated germinal transmission of transposed Ds elements.
Even though transposon tagging/trapping has proven to be
excellent for diagnosing the function of plant genes (Sundaresan
1996, Martienssen 1998), limited efforts have been made to
identify genes using insertional mutagens, especially heterologous
transposons such as the maize Ac/Ds (Izawa et al 1997).
We constructed Ac and enhancer/gene trap Ds vectors and introduced
them into the rice genome by Agrobacterium-mediated
transformation (Hiei et al 1994). The CaMV 35S promoter
was used to express Ac cDNA as a transposase source.
For gene trap Ds, two different introns with three alternative
splicing acceptors were fused to the GUS (Chin et al 1999). A
genetic marker for Ds (BAR) was inserted into each trap Ds.
Rice plants that contained single and simple insertions
of T-DNA were analyzed to evaluate gene-tagging efficiency.
When transgenic plants were produced by introducing Ac and
Ds in a single T-DNA vector, nearly 80% of the Ds elements
were excised from the original T-DNA insertion sites. Eight
percent of the transposed Ds elements expressed GUS in various
tissues of rice panicles. By sequencing DNA adjacent to
Ds and T-DNA, the efficiency of gene tagging was evaluated.
The data demonstrated that the Ac/Ds-mediated gene trap system
could be an excellent tool for analyzing gene functions in
rice (Chin et al 1999).
To perform a large-scale mutagenesis, several homozygous
“starter” lines that carry either a single copy of enhancer/
gene trap Ds or a single copy of Ac lines were produced. Thirteen
Ds and two Ac starter lines were developed. Western analysis
with Ac antiserum showed the consistent expression of Ac
that has been maintained for several generations (BC 1 F 4 ). The
Ds mobility of each line was examined by crossing the lines to
Ac. The data suggested that Ds mobilities were highly variable
among starter lines that carry a single copy of Ds. Based
on studies on Ds locations in F 1 and F 2 populations, the following
observations can be made:
1. Ds mobility depended on insertion sites.
2. In the presence of Ac expressed by the 35S promoter,
the Ds was more active in the main stalk than in tillers
of the same plant.
3. The excision timing of many Ds was quite late during
rice development even though Ac was expressed by a
CaMV 35S promoter.
4. Rice plants expressing Ac showed slight growth retardation.
Among 15 lines, two showed highly active Ds movement
in the F 1 of Ac × Ds. Figures 1 and 2 show the Ds location
in F 2 populations. Many Ds were independently translocated
even in the same F 2 progeny. Table 1 lists detailed information
on Ds movements in F 1 and F 2 progenies from two Ds
lines. Our data fully supported the idea that Ac/Ds transposon
tagging systems are powerful tools for functional genomics
once proper genetic schemes are applied to rice.
References
Chin HG, Choe MS, Lee SH, Park SH, Park SH, Koo JC, Kim NY,
Lee JJ, Oh BG, Yi GH, Kim SC, Choi HC, Cho MJ, Han CD.
1999. Molecular analysis of rice plants harboring an Ac/Ds
transposable element-mediated gene trapping system. Plant J.
19:615-624.
Hiei Y, Ohta S, Komari T, Kumashiro T. 1994. Efficient transformation
of rice (Oryza sativa L.) mediated by Agrobacterium and
sequence analysis of the boundaries of the T-DNA. Plant J.
6:271-282.
Izawa T, Ohnishi T, Nakano T, Ishida N, Enoki H, Hashimoto H,
Itoh K, Terada R, Wu C, Miyazaki C, Endo T, Iida S,
Shimamoto K. 1997. Transposon tagging in rice. Plant Mol.
Biol. 35:219-229.
Martienssen RA. 1998. Functional genomics: probing plant gene
function and expression with transposons. Proc. Natl. Acad.
Sci. USA 95:2021-2026.
Sundaresan V. 1996. Horizontal spread of transposon mutagenesis:
new uses for old elements. Trends Plant Sci. 1:184-190.
Notes
Authors’ addresses: B.I. Je, C.M. Kim, Su Hyun Park, Y.J. Na, and
C.D. Han, Plant Molecular Biology and Biotechnology Research
Center (PMBBRC) and Department of Molecular Biology
(DMB), Gyeongsang National University (GNU),
Chinju, 660-701; Sung Han Park, PMBBRC, GNU; J.J. Lee,
B.G. Oh, N.M. Hee, G.H. Yi, and H.Y. Kim, YeongNam National
Agricultural Experiment Station, Milyang, 627-130,
Korea.
Genomics 365

GS3
GS7
Fig. 1. Southern analysis of F 2 progenies from individual F 1 plants
of Ds line GS3. Ds line GS3 was crossed with Ac. Subsequent F 1
and F 2 progenies were analyzed by Southern hybridization to examine
the mobility and transmission of Ds GS3. Each panel represents
the F 2 progenies of a single F 1 plant. Each lane shows a
single F 2 plant and is shown as a bar on the top of the panels.
Arrows indicate the original Ds that resides at T-DNA loci. The transposed
Ds was detected as a bigger DNA fragment than the original
Ds on Southern blots, as indicated by brackets. Table 1 summarizes
the analysis of the Ds line GS3.
Fig. 2. Southern analysis of F 2 progenies from individual F 1 plants
of Ds line GS7. F 1 plants of the cross of Ds line GS7 with Ac and
subsequent F 2 progenies were analyzed by Southern hybridization
to examine the mobility and transmission of Ds GS7. Each
panel represents F 2 progenies of a single F 1 plant. Each lane shows
a single F 2 plant and is shown as a bar on the top of the panels.
An arrow indicates the original Ds that resides at T-DNA loci. Transposed
Ds are shown in brackets. Table 1 summarizes the behavior
of Ds GS7.
Table 1. Ds transposition in F 2 derived from the cross of two Ds lines in
rice.
Population GS3 GS7
F 2 plants/F 1 lines a 105/10 55/5
F 2 plants carrying only original Ds 27 (25.7%) 27 (49.1%)
F 2 plants carrying transposed Ds (tDs) 29 (27.6%) 10 (18.2%)
Independent tDs/total tDs in F
b 2 31/48 8/12
F 2 plants carrying no Ds (25% is expected) 49 (46.7%) 18 (32.7%)
a
The numbers indicate F 1 plants and their F 2 progenies. b An average of 12 F 2 plants were
examined from each F 1 plant. Independent insertions were counted based on polymorphic
fragments hybridized with a Ds-specific probe.
366 Advances in rice genetics

A rice retrotransposon, Tos17, as a tool for gene tagging
K. Murata, A. Miyao, K. Tanaka, M. Yamazaki, S. Takeda, K. Abe, K. Onosato, A. Miyazaki, Y. Yamashita, T. Sasaki, and H. Hirochika
A rice retrotransposon, Tos17, possesses unique features: transposition induced by tissue culture, a low copy number (1–4),
high frequency of transposition, resulting in 5–30 transposed copies, and random transposition throughout the genome. In
regenerated plants, transposed Tos17 copies are inactivated. Thus, Tos17 could be used for insertional mutagenesis as a tool
for functional analysis of rice genes. We have constructed a rice mutant panel consisting of more than 30,000 regenerated
knockout lines. Phenotypes of 2,300 lines were investigated in the field using R 2
segregating populations. Many kinds of
mutant phenotypes were observed at various stages; about 30% of the lines showed mutant phenotypes on plant morphology
and degree of fertility. Southern blot analysis was performed to identify the specific Tos17 copy cosegregating with the mutant
phenotype. The results strongly suggested that some mutations, including narrow leaf, brittle culm, viviparous, stripe, dwarf,
albino, low fertility, and sterility, were caused by a Tos17 insertion. Genomic sequences corresponding to their mutant loci were
amplified by TAIL-polymerase chain reaction (PCR) or suppression-PCR, cloned, and partially determined. A similarity search of
determined sequence data suggested that some of them have high similarity to known genes such as genes for cellulose
synthases and transcription factor. The others were new genes such as the gene regulating leaf width in the narrow-leaf mutant.
In Arabidopsis thaliana, the genomic DNA sequence included
in chromosomes 2 and 4 was completely determined, and many
genes were annotated in both chromosomes (EU AGP 1998,
Lin et al 1999). Although a large amount of sequence data in
various species has been determined and published, the practically
expressed functions of genes coded by these sequences
remain mostly ambiguous. Genome research would progress
tremendously if large-scale DNA sequencing were accompanied
by a gene functional analysis system. In rice, we focused
on an endogenous retrotransposon, Tos17, as one of the strategies
for systematic functional analysis of genes. This element
is activated by tissue culture and becomes inactive in regenerated
plants (Hirochika et al 1996). Tos17-induced mutations
are stably inherited in subsequent generations. About 5–30
transposed Tos17 copies are normally found, mainly in generich
regions in any regenerant line (Hirochika 1997). This high
frequency of mutation enables us to reduce the number of lines
for screening for analysis of rice genes.
Materials and methods
A large number of R 1 plants were regenerated following tissue
culture of rice cv. Nipponbare. The regenerated plants were
self-pollinated and the mutant phenotype of each line in the R 2
generation was investigated for plant morphology and seed
fertility in the field. Southern blot analysis showed that each
of several mutations cosegregates with one Tos17 copy, suggesting
that these mutations were caused by the insertion of
Tos17. To identify causative genes for these mutations, the
specific Tos17-flanking region corresponding to the mutant loci
was amplified by TAIL-PCR (Liu and Whittier 1995) or suppression-PCR
(Siebert et al 1995) and the genomic sequence
of the region was determined.
Narrow-leaf gene
Narrow-leaf mutation was identified in a regenerant line,
NC0608. The leaf width of the mutants decreased to 70% of
that of normal plants. Genetic analysis in the R 2 showed that
the narrow-leaf mutation was recessive. Genomic Southern blot
analysis showed that this mutation perfectly cosegregated with
one Tos17 copy (Fig. 1). These results strongly suggested that
this mutation was caused by a Tos17 insertion. The genomic
sequence corresponding to the mutant locus was amplified by
TAIL-PCR and the partial sequence was determined. This gene
was mapped on chromosome 1, where no narrow-leaf gene
has ever been mapped. The full length of cDNA from the narrow-leaf
gene was partially amplified by PCR screening of the
library, and 2,468 bp of full sequence was completely determined
(Fig. 2). This gene encoded a protein with 690 amino
acids. Homology search against a nonredundant DNA database
showed that this deduced amino acid sequence had high
similarity to those of a few hypothetical proteins in Arabidopsis
thaliana. This suggested common distribution of this gene
between monocot and dicot plants.
Cellulose synthase
In the segregating population of the insertion line NC0259,
the mutant exhibited phenotype as follows: extremely dwarf
growth habit, withering of the leaf apex during growth, and
easy fracturing of the leaf and stem by handling. This is the socalled
brittle culm phenotype. Also, in this line, the specific
flanking region of the Tos17 copy cosegregating with the brittle
culm phenotype was identified. The full length of the putative
causative gene of the brittle culm phenotype, including the
flanking region, was cloned. The amino acid sequence deduced
from the nucleotide sequence of the cloned gene showed high
similarity to a cellulose synthase of Populus.
Genomics 367

M C mt mt mt mt M C mt mt mt mt
M =λHindll marker
C = Nipponbare
mt = narrow-leaf mutant
Probe: Tos17
Probe: partial region of a flanking
sequence, NC0608_0_102
Fig. 1. Genomic Southern hybridization
analysis on a regenerant
line, NC0608. Both genomic
Southern blot analyses using the
partial region of Tos17 and one
of Tos17 flanking sequences as
a probe showed four Tos17 copies
independently inserted in the
genome of NC0608 narrow-leaf
mutant lines and suggested that
the mutant phenotype
cosegregated perfectly with one
Tos17 insertion.
Tos17
5¢
3¢
Exon region Intron region Poly(A) site
Tos17 insertion site in other regenerants
Fig. 2. The structure of the narrow-leaf gene tagged by Tos17. The full sequence of the tagged narrowleaf
gene was completely determined. One Tos17 copy was inserted between the 9th and 10th bp
from the 5′ end of the last exon.
Other mutants
One of the albino mutants observed with high frequency in the
mutant panel was suggested to be caused by loss-of-function
of a gene encoding magnesium chelatase (Falbel and Staehelin
1994). A mutant whose shoot development stopped at the thirdleaf
stage was found. The partial genomic sequence of the
putative causative gene showed that the gene encodes an NAC
domain found in no apical meristem (NAM) in petunia, cupshaped
cotyledon 2 (CUC2), and NAP in A. thaliana. Partial
genomic sequences of putative causative genes for mutations
causing low fertility or complete sterility showed no similarity
to those of known genes.
To obtain final proof that the cloned genes are really
causative genes for the mutations, molecular complementation
tests should be performed; some are being carried out for
some mutants. These results suggest that transposon tagging
using Tos17 is quite feasible, although further investigation is
suggested.
References
EU AGP (EU Arabidopsis Genome Project). 1998. Analysis of 1.9
Mb of contiguous sequence from chromosome 4 of
Arabidopsis thaliana. Nature 391:485-488.
Falbel TG, Staehelin LA. 1994. Characterization of a family of chlorophyll-deficient
wheat (Triticum) and barley (Hordeum
vulgare) mutants with defects in the magnesium-insertion step
of chlorophyll biosynthesis. Plant Physiol. 104:639-648.
Hirochika H. 1997. Retrotransposons of rice: their regulation and
use for genome analysis. Plant Mol. Biol. 35:231-240.
Hirochika H, Sugimoto K, Otsuki Y, Tsugawa H, Kanda M. 1996.
Retrotransposons of rice involved in mutations induced by
tissue culture. Proc. Natl. Acad. Sci. USA 93:7783-7788.
Lin X et al. 1999. Sequence and analysis of chromosome 2 of the
plant Arabidopsis thaliana. Nature 402:761-768.
Liu Y-G, Whittier RF. 1995. Thermal asymmetric interlaced PCR:
automatable amplification and sequencing of insert end fragment
from P1 and YAC clones for chromosomal walking.
Genomics 25:674-681.
Siebert PD, Chenchik A, Kellogg DE, Lukyanov KA, Lukyanov SA.
1995. An improved PCR method for walking in uncloned
genomic DNA. Nucl. Acids Res. 23:1087-1088.
Notes
Authors’ addresses: K. Murata, K. Tanaka, K. Onosato, and Y.
Yamashita, Institute of the Society for Techno-innovation of
Agriculture, Forestry, and Fisheries, Tsukuba, Ibaraki 305-
0854, Japan; A. Miyao, M. Yamazaki, S. Takeda, K. Abe, A.
Miyazaki, T. Sasaki, and H. Hirochika, National Institute of
Agrobiological Resources, Tsukuba, Ibaraki 305-8602, Japan.
368 Advances in rice genetics

Structural polymorphism found in RMU1
(rice mutator class 1) transposable elements in rice
K. Miura, R. Ishikawa, Y. Miyashita, M. Senda, S. Akada, T. Harada, and M. Niizeki
Rice Mutator is an element homologous to a maize Mutator transposable element. An RMu family consists of two classes,
RMu1 and RMu2. The RMu1 elements carry a predicted transposase gene designated as rmuA. rmuA shares high homology to
the transposase gene of the regulatory element MuDR of the Mutator family. The homologous part found in the genes corresponded
to the part of a putative transposase region that was conserved from bacteria to higher plants. We have already cloned
several members of the RMu1 class. RMu1-IR36, RMu1-435, RMu1-A1a, RMu1-A1b, and RMu1-A23 carried homologous
terminal inverted repeats, 193 bp in size. A possible regulatory element in RMu1 is RMu1-136. We are also cloning a
counterpart of the possible autonomous element from japonica strains. Japonica strains revealed transcription of the transposase
gene, but indica strains showed transcription under a particular condition. We are also specifying the specific regulation of the
transcription found in indica strains.
Rice Mutator is an element homologous to a maize Mutator
transposable element. The RMu family consists of two classes,
RMu1 and RMu2. The Rmu element carries a predicted gene,
rmuA. rmuA shares high homology to the transposase gene of
the maize Mutator transposable element. Several RMu elements
were cloned with the transposase gene as a probe. The longest
element is RMu1-IR36. Four partial-deletion derivatives were
RMu1-435, RMu1-A1a, RMu1-A1b, and RMu1-A23. All of
them carried homologous terminal inverted repeats (TIRs) and
the common internal sequence. Japonica strains revealed continuous
transcription of the transposase gene, but indica strains
were tightly regulated for the transcription. Their structural
differences are affected by different expression patterns.
Sequence variation in the RMu1 class
The RMu transposable elements have several subfamilies such
as the maize Mutator family. One of the families, RMu1, was
defined as an autonomous class. Each member of the class
carries a single rmuA gene, with a putative transposase domain
inside. The RMu2 class largely includes two kinds of
subfamilies. The first subfamily consists of deletion derivatives
from RMu1 elements. The second consists of elements
carrying unrelated internal sequences with long TIRs revealing
lower homology than other TIRs.
RMu1-IR36 was the first clone obtained from an indica
strain, IR36. Another indica strain, ACC435, carries a deletion
derivative, RMu1-435. The deletion derivative was cloned
from genomic libraries of ACC435. The deletion derivative
lost the 5′ upstream region of the internal sequence where a
promoter sequence of the rmuA gene existed.
Other RMu1 elements were cloned from japonica strains.
The A1 (Akage) strain of japonica rice is exceptional in producing
mutants; dwarf 1, dwarf 2, undulated rachis 1, awn 1,
and awn 2 are among such mutants (unpublished breeding histories,
Plant Breeding Institute, Faculty of Agriculture,
Hokkaido University). We have cloned two RMu1 elements,
RMu1-A1a and RMu1-A1b, from genomic libraries of the A1
strain, which revealed continuous expression of the rmuA gene.
Long polymerase chain reaction (PCR) by using LA-Taq supplied
by Takara Co. was also tried to clone entire elements
from japonica genomic DNA. The genomic DNA of A23,
which is a derivative strain from A1, was used as the PCR
template. Then, RMu1-A23 was cloned as a 4.1-kb product.
The product was cloned into pBluescript KS + at the T-added
blunt end. These elements were sequenced and compared with
RMu1-IR36 (Fig. 1). In contrast to RMu1-435, the RMu1 members
in the japonica genomic background have a smaller deletion
at the 5′ upstream region of the rmuA gene.
Intron
rmuA
Intron
RMu1-IR36
RMu1-435
RMu1-A1a
RMu1-A1b
RMu1-A23
TIR
–267 bp
–135 bp
+15 bp +18 bp
TIR
–154 bp
–6 bp –7 bp
+27 bp +25 bp
–154 bp
–6 bp –7 bp
–18 bp
Fig. 1. Structural differences
found in RMu elements. TIR
= terminal inverted repeats;
deletions and additions are
designated by vertical bars
and triangles.
Genomics 369

Expression of the rmuA gene
Constitutive expression of the rmuA gene was confirmed in
japonica strains. However, indica strains have not shown the
expression. When IR36 was exposed to stress conditions (chilling)
at regular intervals, the expression was activated. The difference
in expression patterns observed between two varietal
groups is attributed to sequence differences. The excess expression
of transposase genes could severely damage the host.
Tight regulation found in the indica strain or point mutations
found inside genes in japonica-originated RMu1 elements
would be critical for RMu elements to survive in the rice genome.
Notes
Authors’ addresses: K. Miura, R. Ishikawa, Y. Miyashita, T. Harada,
and M. Niizeki, Faculty of Agriculture Life Science, Hirosaki
University; M. Senda and S. Akada, Gene Research Center,
Hirosaki University, Hirosaki 036-8561, Japan.
Isolating and characterizing cold-responsive
gene-trapped lines from rice
S.C. Lee, S.H. Kim, S.J. Kim, H.S. Choi, M.Y. Lee, J.Y. Kim, K. Lee, S.H. Jeon, J.S. Jeon, G. An, and S.R. Kim
To understand the low-temperature response mechanism in plants, β-glucuronidase (GUS) gene-trapped rice plants were
screened for cold inducibility. Among 6,286 lines, 58 (0.9%) showed differential GUS activity by 5 °C treatment compared with
control plants or those exposed to wounding treatment. Of the 58 lines, 15 were also responsive to abscisic acid (ABA),
suggesting that the cold induction of those lines may be through the ABA-dependent pathway. It is expected that the coldinduced
lines contain the gus gene within the cold-responsive genes. Characterization of the tagged genes would give insights
into the cold-response mechanism in rice.
When exposed to low temperatures, plants respond with a series
of changes in the patterns of gene transcripts and protein
products. These changes have an effect on the distribution and
survival of plants, as well as on crop yield, worldwide. Many
plants of tropical or subtropical origin are injured or killed by
nonfreezing low temperature, showing various chilling-injury
symptoms such as chlorosis, necrosis, and growth retardation.
In contrast, cold-tolerant plants are able to grow at nonfreezing
low temperatures. Several genes inducible by low temperature
have been isolated from many plant species (Cattivelli
and Bartels 1990, Weretilnyk et al 1993). Most of the research
has focused on characterizing the regulatory mechanism of
the genes (Yamaguchi-Shinozaki and Shinozaki 1994, Wang
et al 1995). Furthermore, several results also suggest that there
are at least two regulatory pathways, which are ABA-dependent
and ABA-independent (Yamaguchi-Shinozaki and
Shinozaki 1994). Analysis of the promoters of some cold-induced
genes has provided valuable information on the transcriptional
regulation of the genes.
Mutant analysis has been a powerful method for understanding
stress-responsive mechanisms and can thus be used
for characterizing chilling tolerance. Populations of
mutagenized plants have been used for screening the chillingrelated
mutants, and diverse processes such as organelle biogenesis
and cell metabolism have been found to be related to
some chilling-tolerance responses (Hugly et al 1990, Tokuhisa
et al 1997).
All modern cultivars of rice are known to originate from
a tropical or subtropical progenitor and no known cold-resistant
wild rice has been reported. Rice is adversely affected by
cold. Poor seedling vigor, poor fertility, and, consequently,
reduced yields have been related to cold stress, which is dependent
on the developmental stage. To understand the coldresponse
mechanism, we have screened 6,286 GUS genetrapped
transgenic lines of rice plants. About 1% of the
transgenic lines were shown to be differentially regulated by 5
°C and some related results are presented.
Methods
Shoot fragments of young tillers from GUS gene-trapped T 0
plants (Jeon et al 2000) were incubated in MS medium at 5 °C
overnight and stained in X-glucsolution. GUS staining was
examined under a dissecting microscope and the GUS-positive
lines were selected. The selected lines were further
screened with 5 °C treatment, wounding (26 °C), and ABA
(100 µM) treatments for 12 h. The GUS assay and isolation of
the sequence flanking the GUS gene were performed according
to Jeon et al (2000).
Results and discussion
To screen for cold inducibility, 6,286 transgenic lines were
treated exposed to 5 °C treatment overnight. Several hundred
lines were shown to be GUS-positive and were subjected to a
370 Advances in rice genetics

Treatment
conditions
Line no.
Control 26 ºC
5 ºC
treatment
treatment
ABA
treatment
14822
16466
15167
23051
14801
14818
Fig. 1. Analysis of GUS activity in shoots of GUS
gene-trapped transgenic rice plants. GUS genetrapped
transgenic rice was examined for inducibility
by cold or ABA stresses. Young shoots of T 0
plants were cut into small pieces and exposed to
26 °C, 5 °C, and ABA (100 µM) treatments for 12 h.
After the treatments, the shoot segments were
stained in X-glucsolution. GUS activity was measured
and photographed under a dissecting microscope.
The GUS staining of lines #14822, #16466,
and #15167 was induced only by 5 °C treatment,
whereas that of line #23051 was induced by both
5 °C and ABA treatments. Also, lines #14801 and
#14818 showed constitutive GUS staining and were
up-regulated by the 5 °C treatment. The GUS staining
of line #14822 was localized in the pith; lines
#16466, #23051, and #14818 in the stems but
not in the leaf sheath; lines #15167 and #14801
in all regions of the shoot fragments.
second screening, along with a control and the same wounding
and ABA treatments. Finally, 58 lines (0.9%) showed differential
GUS activity by cold treatment compared with either
the control or wounded plants. Although 51 of the 58 lines
showed increased GUS staining, the other seven lines showed
decreased staining. Representative results from the increased
GUS staining by cold temperature are shown in Figure 1. The
cold-induction pattern of the gus gene was categorized into
three classes. The first class consisted of lines that showed
induced GUS staining only by 5 °C treatment (Fig. 1; #14822,
#16466, and #15167), and this class was most frequently observed.
The second class consisted of lines that showed induced
GUS staining by both 5 °C and ABA treatments (Fig. 1;
#23051), and 15 of the 58 lines belonged to this class. The
cold-induction pattern of this class suggests that the cold-induction
pathway may be through ABA. The third class consisted
of lines that showed up-regulated GUS staining by 5 °C
treatment (Fig. 1; #14801 and #14818). The lines in this class
showed constitutive GUS activity and the GUS activity was
further increased by 5 °C treatment.
The GUS staining pattern in various regions of the shoot
fragment was examined as well. Staining was localized in the
piths (Fig. 1; #14822), in the stems (Fig. 1; #16466, #23051,
and #14818), or in all regions of shoot fragments, including
the leaf sheaths (Fig. 1; #15167 and #14801). These results
suggest that a change in GUS staining of these 58 lines is affected
not only by cold treatment but also by tissue type.
It is expected that these lines contain the gus gene within
the cold-responsive genes of the rice genome. Currently, the
tagged genes of these significant lines are being cloned by thermal
asymmetric interlaced (TAIL)-polymerase chain reaction
(PCR) or the inverse PCR method. Characterization of the
tagged genes will give insights into the cold-response mechanism
in rice.
Reference
Cattivelli L, Bartels D. 1990. Molecular cloning and characterization
of cold-regulated genes in barley. Plant Physiol. 93:1504-
1510.
Hugly S, McCourt P, Browse J, Patterson GW, Somerville C. 1990.
A chilling sensitive mutant of Arabidopsis with altered sterylester
metabolism. Plant Physiol. 93:1053-1062.
Jeon JS, Lee S, Jung KH, Jun SH, Jeong DH, Lee J, Kim C, Jang S,
Lee S, Yang K, Nam J, An K, Han MJ, Sung RJ, Choi HS, Yu
JH, Choi JH, Cho SY, Cha SS, Kim SI, An G. 2000. T-DNA
insertional mutagenesis for functional genomics in rice. Plant
J. 22:561-570.
Tokuhisa JG, Feldmann KA, Labrie ST, Browse J. 1997. Mutational
analysis of chilling tolerance in plants. Plant Cell Environ.
20:1391-1400.
Wang H, Datla R, Georges F, Loewen M, Cutler AJ. 1995. Promoters
from kin1 and cor6.6, two homologous Arabidopsis
thaliana genes: transcriptional regulation and gene expression
induced by low temperature, ABA, osmoticum and dehydration.
Plant Mol. Biol. 28:605-617.
Genomics 371

Weretilnyk E, Orr W, White TC, Iu B, Singh J. 1993. Characterization
of three related low-temperature-regulated cDNAs from
winter Brassica napus. Plant Physiol. 101:171-177.
Yamaguchi-Shinozaki K, Shinozaki K. 1994. A novel cis-acting element
in an Arabidopsis gene is involved in responsiveness
to drought, low-temperature, or high salt stress. Plant Cell
6:251-264.
Notes
Authors’ addresses: S.C. Lee, S.H. Kim, S.J. Kim, H.S. Choi, M.Y.
Lee, J.Y. Kim, K. Lee, S.R. Kim, Department of Life Science,
Sogang University, Seoul 121-742, Republic of Korea;
S.H. Jeon, J.S. Jeon, G. An, Division of Molecular and Life
Science, Pohang University of Science and Technology,
Pohang 790-784, Republic of Korea.
Constructing a physical map of the rice genome
A.C. Sanchez, B. Fu, R. Maghirang, C. Aquino, J. Mendoza, J. Talag, S. Yu, J.R. Domingo, K.L. McNally, P. Bagali, G.S. Khush, and Z.K. Li
An effort was made to construct physical maps for individual rice chromosomes using the IR64 bacterial artificial chromosome
(BAC) library. The strategy for physical map construction involved three steps. First, the IR64 BAC library was screened with
anchor restriction fragment length polymorphism (RFLP) and sequence-tagged site (STS) markers to establish anchor BAC
islands across the genome. More than 400 RFLP and STS markers were used to screen the library. These markers identified
more than 1,000 anchor BAC clones. Second, the expected gaps between the anchor BAC contigs were filled by random
chromosome landing. In doing so, three-dimensional DNA pools prepared from the whole library were amplified with large
numbers of random primers to generate random BAC islands for gap filling. More than 200 random primers were used to
screen the BAC DNA pools, resulting in more than 500 random BAC islands. Assignment of these random BAC islands to
individual chromosomes was simultaneously conducted by genetic mapping and/or by hitting anchor BAC islands. Third, the
whole BAC library was fingerprinted and BAC contigs were assembled based on fingerprints of individual BAC clones using the
computer software, IMAGE and FPC from the Sanger Centre (www.sanger.ac.uk/Software). BAC contigs have been assembled
covering a significant portion of the rice genome. Physical maps for chromosomes 11 and 12 have been constructed. The
overlapping BAC contigs and PCR-based markers provide useful materials for genome mapping and molecular cloning of
important rice genes and QTLs.
A physical map of a chromosome or genome is defined as a
series of ordered, contiguous DNA clones spanning the entire
chromosome or genome and measured in the number of base
pairs of DNA. To date, most structural genomic efforts have
focused on the genome of a single japonica variety, Nipponbare.
However, the presence of two well-differentiated genomes, the
indica and japonica within rice, has been well documented. In
contrast to its much wider adaptation and growing areas, indica
has received minimal attention in structural genomics. To
capture information from genomic research on the japonica
genome and to achieve more efficient gene discovery, rice functional
genomics for large-scale gene discovery and function
assignment has emerged as an important research area in rice.
At IRRI, efforts are being made to identify and map a large
number of important rice genes/quantitative trait loci using the
near-isogenic IR64 introgression lines. To facilitate this effort
for gene discovery and allelic mining, we are also constructing
a physical map of the indica genome using the IR64 bacterial
artificial chromosome (BAC) library developed at IRRI.
We are constructing a physical map of the rice genome.
The physical map of IR64 obtained can be compared with the
available, developed physical map of japonica rice cultivar
Nipponbare to elucidate aspects of rice genome evolution and
rice chromosomal structure.
Materials and methods
Our strategy for physical map construction involved three generalized
steps: (1) establishing anchor BAC islands across the
genome, (2) gap filling by chromosome landing, and (3) assembling
the BAC islands into BAC contigs by HindIII fingerprinting.
The IR64 BAC library (Yang et al 1997) was screened
with genetically mapped DNA markers (Causse et al 1994,
Harushima et al 1998) to establish the anchor BAC islands
across the genome. Mapped restriction fragment length polymorphism
(RFLP) markers were used to screen the BAC library
by colony hybridization of high-density colony filters
with RFLP markers, as described by Yang et al (1997), with
minor modifications. For polymerase chain reaction (PCR)-
based anchor markers, plate, row, and column pools were amplified
using PCR primers according to protocols described
by Xu et al (1998).
The three-dimensional DNA pools prepared from the
whole library were amplified with large numbers of random
amplified polymorphic DNA (RAPD) primers to produce random
BAC islands. Assignment of these random BAC islands
to individual chromosomes was simultaneously conducted by
genetic mapping and by hitting anchor BAC islands.
372 Advances in rice genetics

Table 1. Chromosomal distribution of anchor BAC islands in rice.
Chromosome RFLP STS RAPD Total Total Av no. of
number markers markers markers no. of no. of clones/markers
(no.) (no.) (no.) markers clones
1 20 16 7 43 122 2.8
2 12 12 8 32 78 2.8
3 46 7 7 60 162 2.7
4 51 11 2 64 133 2.1
5 41 14 6 61 175 2.9
6 15 12 9 36 101 2.8
7 4 9 2 15 56 3.7
8 13 8 – 21 40 1.9
9 12 8 5 25 76 3.0
10 6 5 4 15 43 2.9
11 64 13 34 111 438 3.9
12 84 4 5 93 419 4.4
Total 368 119 89 576 1,843 3.2
BAC clones forming a BAC island identified through
colony hybridization and random chromosome landing underwent
Southern hybridization analysis to confirm their overlaps.
Insert sizes of the BAC clones were determined by pulsefield
gel electrophoresis. To extend the contigs, entire BAC
clones at both ends of the contigs were used as probes to screen
the BAC library for a step of chromosome walking.
For the rest of the rice chromosomes, computer software
programs analyzing the HindIII fingerprints were used. The
IMAGE and FPC programs (Sanger Centre, www.sanger.ac.uk)
automatically assemble contigs based on scanned images of
gel restriction patterns.
Results and discussion
A total of 488 RFLP and STS markers have been used to screen
the BAC library. We have also tested 498 RAPD primers for
screening the BAC library. To date, we have used 262 RAPD
primers to screen the library and a total of 614 BAC islands
consisting of 1,600 clones were identified by RAPD analysis.
Eighty-nine of the 614 BAC islands identified by RAPD primers
were localized to respective chromosomes by hitting clones
belonging to the anchor BAC islands. Hence, a total of 576
islands consisting of more than 1,800 clones have been assigned
to the different chromosomes, with an average of 3.3
BAC clones identified by each marker (Table 1). This average
agrees with the size of the BAC library—3.28 genome equivalents.
Figure 1 shows the distribution of the identified BAC
clones along the length of chromosome 11. The framework
physical map for chromosome 11 was developed using 64
RFLP, 13 STS, and 12 microsatellite markers. Anchor BAC
islands were further augmented by the 34 random BAC islands
from RAPD analysis. All these markers identified a total
of 438 clones, covering approximately 60% of chromosome
11.
The coverage of the whole physical map of chromosome
12 is 16 Mb or about 52% of chromosome 12. A total of 84
RFLP, 4 STS, and 6 microsatellite markers were used, producing
59 contigs with a total of 419 BAC clones. We are
undertaking a large-scale automated fingerprinting of BAC
clones belonging to the rest of the rice chromosomes.
References
Causse MA, Fulton TM, Cho YG, Ahn SN, Chunwongse J, Wu K,
Xiao J, Yu Z, Ronald PC, Harrington SE, Second G, McCouch
SR, Tanksley SD. 1994. Saturated molecular map of the genome
based on an interspecific backcross population. Genetics
138:1251-1274.
Harushima Y, Yano M, Shomura A, Sato M, Shimano T, Kuboki Y,
Yamamoto T, Lin AY, Antonio B, Parco A, Kajiya H, Huang
N, Yamamoto K, Nagamura Y, Kurata N, Khush GS, Sasaki
T. 1998. A high-density rice genetic linkage map with 2275
markers using a single F 2 population. Genetics 148:479-494.
Xu J, Yang D, Domingo J, Ni J, Huang N. 1998. Screening for overlapping
bacterial artificial chromosome clones by PCR analysis
with an arbitrary primer. Proc. Natl. Acad. Sci. USA
95:5661-5666.
Yang D, Parco A, Nandi S, Subudhi P, Zhu Y, Wang G, Huang N.
1997. Construction of a bacterial artificial chromosome (BAC)
library and identification of overlapping BAC clones with
chromosome 4-specific RFLP markers in rice. Theor. Appl.
Genet. 95:1147-1154.
Notes
Authors’ addresses: A.C. Sanchez, R. Maghirang, C. Aquino, J.
Mendoza, J. Talag, S. Yu, J.R. Domingo, K.L. McNally, P.
Bagali, G.S. Khush, and Z.K. Li, Plant Breeding, Genetics,
and Biochemistry Division, International Rice Research Institute,
Los Baños, Philippines; B. Fu, College of Life Sciences,
Wuhan University, Wuhan, China.
Genomics 373

374 Advances in rice genetics
Fig. 1. Chromosomal distribution of BAC clones along the length of chromosome 11.
25C06
17D13 AB191400
Cornell map
107
104
99.5
95.1
90.2
85.1
81.1
78.3
Tolrm-3
RG304
RG91
RZ525
CD0127B
RZ638
RG1022
RZ557
RZ722
RGP map
0.0
0.3
7.2
8.5
25.1
OSR1
06H18
42D09
02B21
RM4
RM20
15F19
16E24
26C08
01D19
10A19
17D13
15K24
16H24
16H09
Tol28
R77
C562
S1409
G24A
RG364
RG18
33O06
36P19
12F05
21G10
21F10
16O08
24G20
05A15
07F17
06A16
42H23
12C10
RG574
G189A
05G02
41L03
21G10
45M10
43O08
21F10
14O08
34C11
34C16
34C17
31D16
45B17
45C17
14F02
32F04
10F05
10HJ05
22C22
25H11
34D11
34H09
40I06
42J23
46B20
R2525
CD01216
48J06
15M11
15O07
14J07
37I07
37L08
37L09
42G11
RZ638
C410
RG118
RG1022
RZ557
RZ722
21F10
16O08
24K15
24K21
15L05
34C22
48L03 04L21
21G04 11G02
06K02 06K02
11K21
24K02
11D14
06O02
11K14
24K02
24K21
J090650
F053800
F050700
F050600
30J10
23B07
30B03
11K13
30O06
22F07
40A19
23N07
22N14
23B07
34B08
11K13
F15I300
K040700
34B08
48.4
39.1
37.4
33.4
29.9
26.1
22.4
21
RG1094
RG147
RZ100
RG2
RG14
RZ747
CDO365
CDO574X
Nc24
RG123
RG112
C292
RG1094
RM269
RM202
RG211
C944
G44
R341
51915
RG167
RM209
RM224
RM21
RM167
5790A
R2464
C3
RG2
RG12
RG14
RZ747
CDO365
CDO534
No21
RG103
C1172
C1172
R2537
G189
34O14
46H14
46L19
34H15
34O15
A195900
02H24
09I13
04H14
03H24
A191000
25H12
25H13
25H14
34L14
46H15
20I15
02H21
21I16
12H22
07C11
20C69
47K16
45802
44N06
12I01
02H21
34H14
15N26
07L14
17H24
00123
37I20
0091
12O10
42H23
06A16
32018
07507
10I18
15N04
41O95
44G08
34F01
13F02
35C14
35O24
13C24
24J01
19H22
04H13
04H10
21F10
36A94
47O14
32B11
39J02
44I06
13H09
40T13
30J11
40K23
47J14
38O92
03L07
04P10
31T04
46K16
46L15
12H22 K100T00
14P13
21F03
11K14
11K12
00494
33I67
14Z100
04O44
00J22
AL091204
05K04
04117
00L11
01N14
11A11
14I12
18M16
10I16
04F11
04M16
11A11
18I18
20F08
14N14
34F01
04A12
14N14
20F10
ADI60344
34L04
31O04
44H13
46H10
46N10
32H01
32F04
24O41
41H16
10L20
24C22
32O18
39J04
44I06
04H13
24L01
34J00
24I07
11F20
10C16
04T65
06M13
17O12
40J12
40F13
30J11
30J14
AL180600
OZ2420F4
0121350
20.0
17.7
12.7
7.1
9.0
–2.0
–4.0
–4.0
–4.0
RG103X
pTA248
RZ537
CDO520
RG1104
RG303
RZ934
Pi-1(t)
Xo-3
R04
C50
89.8
90.3
91.1
98.4
101.1
104.1
106.0
109.3
111.2
112.0
113.2
115.2
115.2
116.4
116.7
117.0
118.4
C6
G4001
CDO520
RG1104
G1465
RM204
RM254
RM224
G276
RG303
L833
C82
G389
C954
G131
R251
RM20
RG353
RG184
R1504
512886
L3628
C101505
T6055R4
S1872
L140
C102455
R543
R2424
R2536
S10559
To13
40A05
01O16
01P14
34A04
45A07
41G02
45B20
24O01
16B04
06H10
16K22
24K04
08O09
24O01
24C22
32H01
42L21
42F11
03L04
32B10
11A11
24O01
24O91
11B06
34K10
12M04
16L03
16L17
16F09
16I03
14N17
37I03
14N18
23K24
14C05
32A16
14A02
32M07
27N15
27N03
14N17
14A02
14H12
11N17
11N02
32P17
02N02
K160300
NO30800
NO31400
NO31000
42K21
40F13
16J17
14F15
40K23
##L04
04G01
31K01 34G01
34I01
44B12
15I01
16J17
24F13
34J11
42F11
30J11
30M22
40F12
40K23
39G01
47J14
42L21
02O02
45G02
31K01
40K04
21K01
17O19
16E09
20K11
10C19
30A04
28N04
29M02
37I15
14M13
G031010
K023540
16F02
16J02
20N02 NO81500
08J01
15I23
18I04
18J04
30H17
AH091418
30L21
30L17
18J04
30H17 C150800
06M10
24K01
30A04
08H21
12N09
30I05
48F12
48G12
08I21
08G21
LP007520076
36P19
33O46
24F13
01O16
01P18
38K17
44G02
45P20
42C10
02G03
23G08 LPC055
VO91800
Q161200
O111200
N061000
24K06
21M5
42C18
42I07
04G07
30L21
48K20
02018

Centromere structure of rice chromosome 5
K.I. Nonomura and N. Kurata
The centromere region of rice chromosomes consists of complex organizations with multiple repetitive elements. We aligned
and analyzed contiguous YAC (yeast artificial chromosome) and BAC (bacterial artificial chromosome) clones (contigs) derived
from the centromere region of rice chromosome 5. Tandem repeats of RCS2, which is a 160-bp repeat unit, were separated
into two clusters by about a 40-bp intervening sequence. Both clusters of RCS2 units seemed to be arranged in inverted
symmetry. At least 17 copies of 1.9-bp RCE1 centromeric repeats were also distributed along several hundred bp around both
RCS2 clusters. A reduction in genetic recombination was observed along the region where the contigs were derived. Furthermore,
fluorescent in situ hybridization (FISH) analysis of a BAC clone in one contig showed a complete match of the position
to the primary constriction of chromosome 5. These findings indicated that the contig presented here was derived from a
functional core for centromere formation in rice chromosome 5.
The centromere is an important domain for kinetochore formation,
sister chromatid cohesion, and transmission of chromosomes.
In multicellular organisms, the centromere is embedded
in large blocks of heterochromatin composed of highly
reiterated sequences. The pericentromeric repetitive sequences
are important for kinetochore formation and the stable transmission
of chromosomes. The centromere regions of
Arabidopsis thaliana were defined on a contiguous map of
full-sequenced BAC clones, whereas highly repeated regions
such as 180-bp tandem repeat clusters remained as gaps. Those
regions showed a dramatic reduction in genetic recombination
and contained abundant mobile elements. However, the
core sequences for kinetochore formation are still ambiguous
in plant chromosomes because centromere-specific binding
proteins have not been isolated. The finding of a maize homologue
of human CENP-C associated with a centromeric
retroelement, pSau3A9 (Dawe et al 1999), is the only case
indicating the interaction of centromere protein with chromatin
components in the plant kingdom.
In a previous study, we isolated a 1.9-kb centromerespecific
repetitive element, RCE1, which is the rice homologue
of maize pSau3A9 (Nonomura and Kurata 1999). Screening
and contiguous alignment of YAC and BAC clones (contigs)
revealed that RCE1 and RCS2, and other centromeric repeats
reported by Dong et al (1998), exhibited specific localization
on a contig map of the centromere region and that the rice
centromere is composed of various repetitive elements, including
retrotransposon-like sequences. We describe here the composition
of the centromeric repetitive elements in rice chromosome
5.
Screening of YAC clones with centromeric repeats
RCS2 and RCE1 are about 160-bp and 1.9-kb repetitive units,
respectively, which show centromere-specific localization in
the rice genome (Dong et al 1998, Nonomura and Kurata 1999).
To isolate YAC clones derived from the centromere region, an
RCS2 repeat unit was used as a probe for screening a YAC
filter set (Umehara et al 1995). Nineteen positive clones were
isolated from a total of 7,104 YAC clones, in which only Y6514
was anchored to chromosome 5 by RFLP marker G260 (Saji
et al 1996). Y6514 also contained RCE1 repeats from the result
of Southern blot hybridization. A G260 locus was mapped
at 53.7 cM and was included in a candidate centromere region
determined cytogenetically on an RFLP linkage map (Singh et
al 1996, Harushima et al 1998). In this position, no recombinant
segregated among 10 RFLP markers in 186 F 2 populations
(Harushima et al 1998), meaning a suppression of genetic
recombination in this region (Saji et al 1996). These facts
strongly suggested that the Y6514 clone was derived from the
centromere region of rice chromosome 5.
Distribution pattern of RCS2 and RCE1 in the centromere
region of chromosome 5
Four YACs, including Y6514, and 11 BACs were screened
with three RFLP markers at the 53.7-cM position, and aligned
by means of Southern blot hybridization and polymerase chain
reaction with the end sequences of those clones. Information
of end sequences and fingerprint patterns of BAC clones was
obtained from the Web site of the Clemson University
Genomics Institute (CUGI, www.genome.clemson.edu/).
RCS2 repeats were separated into two clusters, in which
they were arranged tandemly as observed in Southern blot
analysis of Y6514 and Y1263 with a 160-bp ladder pattern
(data not shown). From the result of subcloning and sequencing
DNA fragments around RCS2 clusters, both clusters of the
RCS2 tandem seemed to be arranged with inverted symmetry
in the centromere region of chromosome 5. The intervening
region between both clusters was about 40 bp long in maximum
and included cDNA clone RZ296, 520 bp adjacent to
c1, and a copy of the RCE1 repeat (#8-1). Sixteen copies of
RCE1, except #8-1, were distributed on both sides of RCS2
clusters. On the other hand, no copies of RCE1 were observed
in Y3173, about 200 bp distal from the RCS2 clusters. This
indicated characteristic localization of RCE1 repeats in the
centromere region of chromosome 5. B08E07, B95H15, and
B09I21 exhibited additional 4.2- and 20-bp bands compared
Genomics 375

Table 1. Database search of YAC/BAC end sequences for DDBJ database with BLASTN2.0.11 search.
Hit sequence
Clone # Size Acc. no.
searched (bp) Score E value Comments
(bits)
B22G11r 687 AB013613 339 2.00E-90 O. sativa DNA, centromere sequence RCB11
AB014740 48 1.10E-02 O. sativa gypsy-type retrotransposon RIRE8A
B01P11r 546 AB008772 80 3.00E-12 Triticum aestivum retrotransposon Tar1
D85597 38 8.60E+00 O. australiensis retrotransposon RIRE1
Y1263L 607 AB030283 96 5.00E-17 O. sativa gypsy-type retrotransposon RIRE2 DNA
Y3173L 119 AB014738 157 3.00E-36 O. sativa gypsy-type retrotransposon RIRE3 DNA
AB014740 70 5.00E-10 O. sativa gypsy-type retrotransposon RIRE8A
AB014741 58 2.00E-06 O. sativa gypsy-type retrotransposon RIRE8B DNA
Y4960R 103 AA231744 168 6.00E-40 RZ296 cDNA from rice O. sativa
Y6514L 61 AF058904 113 1.00E-23 O. sativa subsp. indica centromeric repeat family RCH2
Y3559L 71 AF058904 113 2.00E-23 O. sativa subsp. indica centromeric repeat family RCH2
AF090446 64 1.00E-08 Zea mays retrotransposon Opie-2
AF078903 52 6.00E-05 O. sativa subsp. indica centromeric repeat family RCS1
with Y1263 RCS2. Although it was not known which clone
reflected the nature of the centromere structure, it was possible
that BAC clones were rearranged or amplified in RCS2
tandem clusters.
Exact location of centromeric BAC clone on the primary
constriction of chromosome 5
A BAC clone B09I21 containing RCS2 and RCE1 repeats was
labeled by the nicktranslation method and provided for fluorescent
in situ hybridization (FISH) to locate it on somatic
chromosomes. This probe gave multiple signals that appeared
in many centromere regions because of the ubiquitous centromeric
repeats included in B09I21. To suppress common signals
for centromere regions, nonlabeled RCE1 and RCS2 fragments
were added in a hybridization mixture. Doublet signals
were observed only on a homologous pair, which was a submetacentric
karyotype of chromosome 5 (Kurata and Omura
1978). A doublet of rhodamine signal exactly localized to the
primary constriction provided the evidence that B09I21 and
adjacent clones were derived from the centromere region of
chromosome 5.
Multiple repetitive elements lie in centromeric YAC and BAC
contigs of chromosome 5
The end sequences of centromeric YAC and BAC clones of
chromosome 5 were obtained from a database search (Table
1). Most of the BAC end clones showed homology with a large
number of other BAC end sequences registered by CUGI,
meaning that the centromere region was composed of multiple
repetitive elements. Several end sequences exhibited homology
to some kinds of retrotransposons and centromeric repeats
(Table 1). In fact, Southern blot analysis revealed that centromeric
YAC and BAC contigs were rich in sequences similar to
long terminal repeats of RIRE3, a Ty3/gypsy-type retrotransposon
found in cultivated rice.
RCS2 and RCE1 repeat clusters are strong candidates
for the conformation center of kinetochore in rice chromosomes
for the following reasons: (1) the maize homologue of
human CENP-C closely associated with pSau3A9 is homologous
to RCE1 in maize cells (Dawe et al. 1999); (2) RCE1 and
its family repeats were found in most cereal centromeres (Jiang
et al 1996); (3) FISH signals of RCS2 and RCE1 were observed
on the centromere regions of all chromosomes (Dong
et al 1998, Nonomura and Kurata 1999); (4) genetic recombination
rates were suppressed along the contig region, including
RCS2 and RCE1 repeats; and (5) a BAC clone including
both repeat clusters was exactly positioned on the primary
constriction of rice chromosome 5. One of the ways to determine
functional allocation of centromeres on the rice chromosomes
is to construct rice artificial chromosomes (RAC) based
on YAC and BAC clones, including centromeric repetitive elements.
The RAC construct will be useful not only for basic
science but also for practical breeding programs.
References
Dawe RK, Reed LM, Yu HG, Muszynski MG, Hiat EN. 1999. A
maize homolog of mammalian CENPC is a constitutive component
of the inner kinetochore. Plant Cell 11:1227-1238.
Dong F, Miller JT, Jackson SA, Wang GL, Ronald PC, Jiang J. 1998.
Rice (Oryza sativa) centromeric regions consist of complex
DNA. Proc. Natl. Acad. Sci. USA 95:8135-8140.
Harushima Y, Yano M, Shomura A, Sato M, Shimano T, Kuboki Y,
Yamamoto T, Lin SY, Antonio BA, Parco A, Kajiya H, Huang
H, Yamamoto K, Nagamura Y, Kurata N, Khush GS, Sasaki
T. 1998. A high-density rice genetic linkage map with 2275
markers using a single F 2 population. Genetics 148:479-494.
Jiang J, Nasuda S, Dong F, Scherrer CW, Woo SS, Wing RA, Gill
BS, Ward DC. 1996. A conserved repetitive DNA element
located in the centromeres of cereal chromosomes. Proc. Natl.
Acad. Sci. USA 93:14210-14213.
376 Advances in rice genetics

Kurata N, Omura T. 1978. Karyotype analysis in rice. I. A new method
for identifying all chromosome pairs. Jpn. J. Genet. 53:251-
255.
Nonomura KI, Kurata N. 1999. Organization of the 1.9-kb repeat
unit RCE1 in the centromeric region of rice chromosomes.
Mol. Gen. Genet. 261:1-10.
Saji S, Umehara Y, Kurata N, Ashikawa I. Sasaki T. 1996. Construction
of YAC contigs on rice chromosome 5. DNA Res. 3:297-
302.
Singh K, Ishii T, Parco A, Huang N, Brar DS, Khush GS. 1996.
Centromere mapping and orientation of the molecular linkage
map of rice (Oryza sativa L.). Proc. Natl. Acad. Sci. USA
93:6163-6168.
Umehara Y, Inagaki A, Tanoue H, Yasukochi Y, Nagamura Y, Saji S,
Otsuki Y, Fujimura T, Kurata N, Minobe Y. 1995. Construction
and characterization of a rice YAC library for physical
mapping. Mol. Breed. 1:79-89.
Notes
Authors’ address: National Institute of Genetics, Yata 1111, Mishima,
Shizuoka 411-8540, Japan.
Acknowledgments: We thank R. Wing for sharing the BAC library
and filters of O. sativa cv. Nipponbare, and H. Ohtsubo for
providing LTR clones of the RIRE series. We are also grateful
to the Rice Genome Project (RGP) STAFF /MAFF DNA bank
of Japan and S. McCouch for providing RFLP marker clones.
This research was supported by Grant-in-Aid for Scientific
Research (B) 09460006 and for Encouragement of Young
Scientists (A) 11760227 of the Ministry of Education, Science,
Sports, and Culture, Japan.
Genic interaction between mutant genes related
to morphogenesis of panicle and spikelet in rice
I. Takamure, T. Aida, and S. Niikura
The leafy hull sterile (lhs) mutant is characterized by a deformed lemma and palea showing a leafy sheath structure and
accompanied by various malformed floral organs. In the retarded panicle rp(t) mutant, panicle development is inhibited under
low-temperature conditions. The neckleaf nl1 mutant has a bract leaf at the neck node of the panicle. We examined genic
interactions among lhs, rp(t), and nl1. Double mutants were produced in F 2
populations of crosses among three lines—H-726
(lhs), N-180 (rp(t)), and H-69 (nl1). A segregation ratio of 9:3:3:1 was observed in the respective populations. The double
mutant lhs rp(t) showed shoot-like spikelets, whereas the double mutant rp(t) nl1 showed shoot-like panicles. In contrast, the
double mutant lhs nl1 showed lhs-type spikelets and nl1-type bract leaves. Therefore, there is no genic interaction between lhs
and nl1. Two double mutants (lhs rp(t) and rp(t) nl1), their parental lines, and cultivar Shiokari as the control were tested for
rooting and vegetative growth ability from sterile spikelets and panicles. Only the double mutants lhs rp(t) and rp(t) nl1 grew to
independent plants from their shoot-like spikelets and panicles, respectively. These results indicated that the double mutants
lhs rp(t) and rp(t) nl1 inhibit the differentiation of floral organs, thus maintaining vegetative growth during spikelet and panicle
development, respectively.
Many morphological mutants with variation in panicles and
spikelets have been reported. The malformed mutants are important
for understanding the morphogenesis of the panicle
and spikelet. In this study, we focused on three mutants, lhs,
rp(t), and nl1, and examined interactions among these genes.
The leafy hull sterile mutant is controlled by a single recessive
gene, lhs, located on chromosome 3 (Kinoshita et al 1977).
Based on comparative observations of three organs (hull, leaf
blade, and leaf sheath) and peroxidase isozyme reaction, it
appears that lhs may be related to the developmental modification
from hull to leaf sheath (Niikura et al 1992, Takamure
and Kinoshita 1996). Further, the lhs mutant lacks a palea and
develops two lemmas in a spikelet. This mutant seems to have
the capability to develop more than two florets in a spikelet
with two leafy lemmas (Aida et al 1997). The retarded panicle
mutant is controlled by a single recessive gene, rp(t) (Aida et
al 1995). Under low-temperature conditions, panicles of the
rp(t) mutant remain in a juvenile stage without spikelet formation
and are covered with bract hairs. In contrast, the rp(t)
mutant develops nearly normal panicles and spikelets with low
seed setting under high-temperature conditions. The neck-leaf
mutant is controlled by a single recessive gene, nl1, located on
chromosome 5 (Nagao and Takahashi 1963). Usually, the large
part of the nl1 panicle is enclosed by the bract leaf.
Materials and methods
Three lines, H-726, N-180, and H-69, carrying lhs, rp(t), and
nl1 genes, respectively, were used as parents. To produce
double mutants, these three lines were intercrossed. The F 2
populations were grown in the rice field of the Experiment
Farm, Faculty of Agriculture, Hokkaido University.
Two double mutants (lhs/rp(t) and rp(t)/nl1), their parental
lines, and cv. Shiokari as a control were used for comparing
character expression. To investigate the effect of temperature
on character expression, these lines were grown in
Genomics 377

Fig. 1. F 2 segregation for panicle
types (A) and spikelet types (B)
in the cross H-726 (lhs) × N-180
(rp(t)) (from left to right, + +, +
rp(t), lhs +, and lhs rp(t)).
Table 1. Combined segregations of mutant genes in F 2 populations.
Cross
F 2 segregation
combination A:B Ratio χ 2 P
AB Ab aB ab Total
H-726 × N-180 lhs:rp(t) 613 188 196 67 1,064 9:3:3:1 1.08 0.7–0.8
N-180 × H-69 rp(t):nl1 164 50 55 23 292 9:3:3:1 1.65 0.6–0.7
H-726 × H-69 lhs:nl1 138 53 41 15 247 9:3:3:1 1.59 0.6–0.7
growth chambers kept at low (20 °C) and high (28 °C) temperatures.
To study vegetative growth ability, sterile spikelets
and panicles from those lines, which were still green, were
germinated in trays with 5-mm-deep water.
Fig. 2. F 2 segregation for panicle types in the cross N-180 (rp(t)) ×
H-69 (nl1) (from left to right, + +, + nl1, rp(t) +, and rp(t) nl1).
Results and discussion
The F 2 population of the cross H-726 × N-180 segregated into
the ratio of 9 normal:3 lhs:3 rp(t):1 shoot-like spikelet type
(Fig. 1 and Table 1). The F 3 progeny test confirmed that the
shoot-like spikelet type was caused by the double mutant (lhs
rp(t)). The double mutant had long rudimentary glumes, long
empty glumes, vegetative shoots, and no floral structures in
the spikelets. The lhs plant had two lemmas showing leaf sheath
structure in a spikelet, whereas the double mutant had some
leaves that differentiated into a leaf blade and tillers within a
spikelet.
The F 2 population of the cross N-180 × H-69 segregated
into the ratio 9 normal:3 rp(t):3 nl1:1 shoot-like panicle type
(Fig. 2 and Table 1). This was confirmed by the F 3 progeny
test, which showed that the shoot-like panicle type was caused
by the double mutant (rp(t) nl1). The double mutant had about
10 leaves in the nodes of a panicle, a few reduced spikelets
without floral organs, and complete sterility.
The F 2 population of the cross H-726 × H-69 segregated
into the ratio 9 normal:3 lhs:3 nl1:1 lhs/nl1 (Table 1). The
378 Advances in rice genetics

Table 2. Character expression of double mutants, parental lines, and Shiokari in the growth chamber (28 and
20 °C).
Line and cross Temperature Character a
combination (°C)
BLN BLL SN SF SL IE OE IR OR
Shiokari 28 – – 72.3 87.7 5.52 2.10 2.18 – –
20 – – 64.3 16.6** 5.68 2.43** 2.43** – –
H-69 (nl1) 28 1.0 18.1 49.3 92.7 5.77 2.71 2.63 – –
20 1.3 21.4 47.5 27.0** 5.93 3.16** 2.87 – –
N-180 (rp(t)) 28 – – 46.8 23.1 6.21 4.23 4.26 1.33 0.81
20 1.8 0.8 17.5** 0.0 7.15** 7.03** 6.27** 2.84 1.29
H-726 (lhs) 28 – – 78.0 11.1 11.80 2.06 2.16 – –
20 – – 73.5 0.0* 12.92 2.22 2.25 – –
N-180 × H-69 28 2.0 11.4 4.8 0.0 6.48 6.53 6.37 2.39 0.94
(F rp(t) nl1) 20 8.5 22.1 – – – – – – –
H-726 × N-180 28 – – 33.3 0.0 21.43 2.89 2.91 1.57 0.81
(F lhs rp(t)) 20 1.0 1.4 14.0* 0.0 21.44 8.24** 6.52** 1.99 1.09
a BLN = bract leaf no., BLL = bract leaf length (cm), SN = spikelet no., SF = seed fertility (%), SL = spikelet length (mm), IE and OE =
inside and outside empty glume length (mm), IR and OR = inside and outside rudimentary glume length (mm). *,** = significantly different
from the high temperature (28 °C) at the 5% and 1% levels, respectively.
double mutants showed lhs-type spikelets and nl1-type bract
leaves. This means that there is no genic interaction between
lhs and nl1.
Table 2 shows the effect of temperature on the character
expression of panicles and spikelets in two double mutants
(lhs rp(t) and rp(t) nl1), their parental lines, and Shiokari. N-
180 had elongated bract leaves and spikelets, empty and rudimentary
glumes, reduced spikelet number, and complete sterility
under low-temperature conditions. The double mutant
rp(t) nl1 differentiated leaves instead of branches from nodes
on panicles and showed no spikelets under low-temperature
conditions. The double mutant lhs rp(t) showed leaves instead
of florets in spikelets under both conditions. Under low-temperature
conditions, this double mutant had elongated bract
leaves and spikelets, empty and rudimentary glumes, and reduced
spikelet number. These results showed that the character
expression of lhs rp(t) and rp(t) nl1 was affected by temperature
conditions.
Table 3 shows rooting rates from sterile spikelets or
panicles of two double mutants and four lines. H-726 showed
low rooting rate from basal nodes of leafy sterile spikelets.
Double mutants lhs rp(t) and rp(t) nl1 showed high rooting
rates from nodes of shoot-like spikelets and shoot-like panicles,
respectively. These rooting spikelets and panicle nodes were
transplanted in flooded soil in pots. Some spikelets and panicle
nodes of two double mutants, lhs rp(t) and rp(t) nl1, grew to
independent plants and showed the same phenotypes as the
original plants. The shoot-like spikelet of lhs rp(t) and the
shoot-like panicle of rp(t) nl1 had vegetative growth abilities.
These results indicated that the double mutants lhs rp(t)
and rp(t) nl1 inhibited the differentiation of floral organs, thus
maintaining vegetative growth during spikelet and panicle development,
respectively. Thus, the dominant alleles Lhs, Rp(t),
Table 3. Rooting and establishment rates of sterile spikelets and
panicles.
Line and cross Genotype Rooting establishment (%)
combination
Shiokari – 0 0
H-69 nl1 0 0
N-180 rp(t) 0 0
H-726 lhs 9.7 0
N-180 × H-69 F rp(t) nl1 50.0 16.7
H-726 × N-180 F lhs rp(t) 55.6 37.0
and Nl1 are considered to have an important role in reproductive
growth.
References
Aida T, Niikura S, Takamure I. 1997. Genic interaction between lhs
(leafy hull sterile) and some mutant genes related to spikelet
formation. Rice Genet. Newsl. 14:50-52.
Aida T, Takamure I, Kinoshita T. 1995. Inheritance of a physiological
mutant showing retarded panicle development. Rice Genet.
Newsl. 12:202-203.
Kinoshita T, Hidano Y, Takahashi M. 1977. A mutant long hull sterile
found in the rice variety Sorachi. In: Genetical studies on
rice plant, LXVII. Mem. Fac. Agric. Hokkaido Univ.
10(3):247-268. (In Japanese with English summary.)
Nagao S, Takahashi M. 1963. Trial construction of twelve linkage
groups in Japanese rice. In: Genetical studies on rice plant,
XXVII . J. Fac. Agric. Hokkaido Univ. 53:72-130.
Niikura S, Takamure I, Kinoshita T. 1992. Character expression of
leafy hull sterile (lhs-1) in rice. Jpn. J. Plant Breed. 42 (Suppl.
2):288-289. (In Japanese.)
Genomics 379

Takamure I, Kinoshita T. 1996. Genetic analysis of morphological
mutations in rice spikelets. In: Rice genetics III. Proceedings
of the Third International Rice Genetics Symposium, 16-20
Oct 1995. Manila (Philippines): International Rice Research
Institute. p 387-390.
Notes
Authors’ addresses: I. Takamure, Graduate School of Agriculture,
Hokkaido University, Sapporo 060-8589; T. Aida, 5-24, Okojicho,
Sendai, Kagoshima 895-8650; S. Niikura, Tohoku Seed
Co., Utsunomiya 321-3232, Japan.
Oryzabase: an integrated rice science database
Y. Yamazaki, A. Yoshimura, Y. Nagato, and N. Kurata
Oryzabase is a comprehensive rice science database established in 2000 by a rice researchers’ committee in Japan. The
database originally aimed at collecting information ranging from classical rice genetics to structural and functional genomics.
The current Oryzabase consists of five parts: (1) genetic resources, (2) gene dictionary, (3) chromosome maps, (4) mutant
images, and (5) fundamental knowledge on rice science. The database includes more than 10,000 accessions of germplasm
collected or developed by classical breeding and/or new molecular biological methods as a result of the long history of rice
breeding in Japan. The Oryzabase map represents the integration of seven different maps from a classical linkage map to the
latest yeast artificial chromosome physical map provided by the Rice Genome Project. We have completed the internal crosslinking
of related information such as common markers on different maps, genes and the respective mutant images, strains
and their marker genes, and so on. Using a good Web-based interface, the rice gene dictionary has been constantly updated
by appropriate researchers and the Rice Genetics Cooperative. We are planning to do a more extensive cross-referencing of
Oryzabase to the major DNA sequence database, literature database, and other rice databases such as Ricegenes to provide
a wealth of information to rice researchers. Oryzabase is available at www.shigen.nig.ac.jp/rice/oryzabase/.
The rice genetic resource database was created in 1997 and
made available to the public through the Internet in collaboration
with rice researchers. In 1998, the Rice Genetic Resource
Committee was established to coordinate different projects on
genetic resource repository carried out at universities and research
institutes in Japan and to construct the database. The
committee handed over the rice genetic resource database and
constructed a trial version of a more integrated database called
Oryzabase. Oryzabase is a breeding-science-oriented database
and genome-science-oriented database. The goal of the database
is to compile as much knowledge as possible and to supply
virtual tools useful for experimental research.
Contents
Genetic resource stock information
The current database compiles more than 10,000 strains, including
marker gene testers (1,258 accessions), mutant lines
(547), isogenic lines (284), autotetraploid lines (52), primary
trisomics (71), reciprocal translocation homozygote lines
(224), cytoplasm substitution lines (43), cell culture lines (137),
landraces and improved varieties (6,293), and wild species
(1,609). The stock list still needs some revision. The latest
information will appear in release 1.0.
Gene dictionary
The dictionary contains more than 900 marker genes and 185
of them have been located on the maps, with more than 570
assigned to the chromosomes. We have a working group revising
the gene dictionary in cooperation with the Rice Genetics
Cooperative. Oryzabase has an online gene management
system, through which members can update information in the
dictionary. About 1,100 references for genes have been collected.
Integrated linkage maps
Since the integration of the different linkage maps, full crosslinking
of seven different maps has been done in Oryzabase. A
line is drawn between the common marker’s loci on different
maps, so that, if researchers find a certain marker on a map,
they can see its location relative to a common marker(s) between
neighboring maps (Fig.1) as well as retrieve relevant
information through the map (Fig. 2).
The linkage maps used in the database are as follows:
CL map: Classical linkage map with more than 209 phenotypic
markers (Kinoshita 1998).
IT map: Integrated map locating 83 restriction fragment
length polymorphism (RFLP) markers and 40 phenotypic
marker genes using 17 F 2 populations and 1 F 3 population
(Yoshimura et al 1997).
RI map: RFLP framework map with 375 markers using
recombinant inbred lines from a cross of japonica (Asominori)
and indica rice (IR24) (Tsunematsu et al 1996).
NK map: Molecular genetic map with 2,275 markers,
which was constructed with an F 2 population from a cross of
indica × japonica rice (Harushima et al 1998).
RGN map: RFLP map with 423 markers from the F 2
population of O. sativa × O. rufipogon.
Cornell map: Molecular map with 716 markers, including
mainly RFLP and cDNA markers using backcross popula-
380 Advances in rice genetics

Fig. 1. Cross-linking map display of CL, IT, RI, and NK maps. A line is drawn between the common marker’s (spl1) loci on
the two different maps (e.g., CL and IT). The gene name in the map is linked to the relevant information shown in Figure
2.
tions of O. sativa and O. longistaminata populations (Causse
et al 1994).
YAC contigs: Physical map with YAC clones (Kurata et
al 1997).
Mutant images
There are about 80 mutant image collections in the database.
The mutant phenotype was classified into six categories: (1)
seed, (2) endosperm, (3) panicle, (4) leaf (chlorophyll aberration),
(5) leaf (disease spots), and (6) embryogenesis (Fig. 3).
Strains, gene information, references, linkage maps, and mutant
images are connected to each other by a common gene ID
in the database to help users easily access all the relevant information.
Oryzabase also supports users by allowing them to
deposit mutant images using the online submission system.
Fundamental knowledge on rice science
This feature introduces basic rice science knowledge to students.
The current contents include (1) species and distribution
of wild and cultivated rice in the world, (2) rice morphology,
(3) rice mutants, (4) genetic map of rice, (5) rice chromosomes,
and (6) rice cultivation.
Genomics 381

Fig. 2. Spotted leaf 1 gene information with mutant images retrieved from the gene dictionary.
References
Causse MA, Fulton TM, Cho YG, Ahn SN, Chunwongse J, Wu K,
Xiao J, Yu Z, Ronald PC, Harrington SE, Second G, McCouch
SR, Tanksley SD. 1994. Saturated molecular map of the rice
genome based on an interspecific backcross population. Genetics
138:1251-1274.
Harushima Y, Yano M, Shomura A, Sato M, Shimano T, Kuboki Y,
Yamamoto T, Liu S-Y, Antonio BA, Parco A, Kajiya H, Huang
N, Yamamoto K, Nagamura Y, Kurata N, Khush GS, Sasaki
T. 1998. A high-density rice genetic linkage map with 2275
markers using a single F 2 population. Genetics 148:479-494.
Kinoshita T. 1995. Report of committee on gene symbolization:
nomenclature and linkage groups. Rice Genet. Newsl. 12:9-
153.
Kurata N, Umehara Y, Tanoue H, Sasaki T. 1997. Physical mapping
of the rice genome with YAC clones. Plant Mol. Biol. 35:101-
113.
Tsunematsu H, Yoshimura A, Harushima Y, Nagamura Y, Kurata N,
Yano M, Sasaki T, Iwata N. 1996. RFLP framework using
recombinant inbred lines in rice. Breed. Sci. 46:279-284.
Yoshimura A, Ideta O, Iwata N. 1997. Linkage map of phenotype
and RFLP markers in rice. Plant Mol. Biol. 35:49-60.
382 Advances in rice genetics

Fig. 3. Mutant phenotype collection of Oryzabase.
Notes
Authors’ addresses: Y. Yamazaki and N. Kurata, National Institute
of Genetics, Mishima, Shizouka, 411-8540, Japan; A.
Yoshimura, Kyushu University, Hakozaki, Higashi-ku,
Fukuoka, 812-8581, Japan; Y. Nagato, University of Tokyo,
Bunkyo-ku, Tokyo 113-8657, Japan.
Acknowledgments: We thank T. Yamakawa, K. Mitsui, K. Watanabe,
and M. Saito (National Institute of Genetics) for technical
assistance.
Genomics 383

RiceGenes 5.0: an online genomic resource
for the rice community
A.M. Baldo, G.A. DeClerck, T.G. Cargioli, I.V. Yap, C.M. Larota, S. Cartinhour, and S.R. McCouch
RiceGenes (http://ars-genome.cornell.edu/rice) is a publicly accessible genome database developed and curated by the USDA-
ARS. It serves as a resource for the international rice research community by providing a collection of 11 rice genetic maps
from a variety of sources, including Cornell University, the Japanese Rice Genome Research Program (JRGP), the Korea Rice
Genome Research Program (KRGP), and Chinese researchers. RiceGenes also documents comparisons with maps from other
grasses (maize, oat, wheat, and soon sorghum and wild rice). We have begun adding connections between genetic markers
and available rice BAC and PAC sequences identified by TIGR. In addition to information on molecular and morphological
markers, RiceGenes contains QTLs, photographs of mutant phenotypes, and hot links to GenBank, Oryzabase, and other online
resources. Molecular markers developed at Cornell University can be referenced and requested via the associated Web site at
Cornell. The RiceGenes team is also involved in developing new tools for rice genomic research to aid in SSR identification
(SSRIT, http://ars-genome.cornell.edu/rice/tools.html). RiceGenes is accessible on the Web at http://ars-genome.cornell.edu/
rice. The KRGP also provides RiceGenes in the form of a CD-ROM for Macintosh and Windows.
Genetic maps are the central focus of RiceGenes 5.0. While
sequences, genomic clones, QTLs, phenotypic traits, and references
are included, each of these items contains information
that is directly or indirectly related to the maps and markers in
the database. The references and sequences included are not
exhaustive collections of all such resources available for rice,
but are a selection relevant to mapping.
RiceGenes 5.0 contains 11 rice genetic maps: BS125/
WL02 (Causse et al 1994), Nipponbare/Kasalath (Kurata et al
1994), AijiaoNante/P16 (Xiong et al 1997), Milyang23/
Gihobyeo (Cho et al 1998), Morphological (Kinoshita 1998),
Nipponbare/Kasalath (Harushima et al 1998), ZhaiYeQing8/
JinXi (Shen et al 1998), Rice-Wilson (Wilson et al 1999),
BS125/WL02 (Susan R. McCouch and Sandra Harrington,
pers. commun. 2000), IR64/Azucena (Temnykh et al 2000),
and a rice consensus map (Susan R. McCouch, personal communication,
1997). A comparative map of maize is also available
(Wilson et al 1999).
Data classes
The variety of biological data types and technologies available
for genetic mapping necessitates an integrated approach
to database structure. In the current version of RiceGenes, we
have adopted a new approach to defining and organizing some
of our data classes.
Marker
Rather than treating probes, protein-coding genes, and singlegene
morphological phenotypes as separate kinds of entities,
we have defined a “marker” as any technology or technique
that allows one to observe morphological or molecular phenotypes
for genetic mapping. A marker may be of any one of
seven designated types: morphological or molecular (AFLP,
RFLP, RAPD, isozyme, microsatellite, STS). The fields present
in a marker record depend on which type of marker a record
represents, and the technologies involved in its use. In this
way, we have enabled queries across all of the types of data
that have been used to generate the maps in the database.
Locus
In RiceGenes 5.0, a “locus” is defined as a specific position
on a specific map associated with a marker. Many markers
have been identified as mapping to more than one position in
the rice genome. For example, RG634 has been mapped to
linkage groups 2, 7, 5, and 12 in various studies. The conventional
way to handle this is to append “A” to the marker name
for one position and “B” for the second position, and so on; in
some cases, this has been carried out to a sixth locus with “F,”
such as in G1184F and L363F. In other cases, the authors have
simply designated all of the loci with an “X.”
In approximately 50 cases, loci from different mapping
studies have the same name but are reported in different linkage
groups. The potential locus naming confusion is compounded
by the fact that approximately 80 markers have been
used to identify loci that have been assigned different names
in various studies. In addition, 58 markers map to different
positions on the same linkage group in eight studies. Differences
in locus names on the same linkage group are much
harder to identify by a simple query. Rather than risk inappropriately
merging data representing different biological entities,
we have chosen to append the linkage group and a fourcharacter
map study code to each locus. In this way, for example,
we can differentiate loci: G24-11RJ94, G24A-11RJ98,
G24B-11RJ98, G24A-11RS98, and G24B-11RS98. The
Map_Help record in the database provides a table of the map
studies and their codes.
Trait
In rebuilding RiceGenes, we have paid particular attention to
organizing phenotypic traits, which are shared by morphological
markers and QTLs. To enable browsing according to trait,
384 Advances in rice genetics

we have defined 10 overlapping trait categories called
“trait_types” in the database. The trait “heading date,” for example,
is cross-listed under trait types “maturity,” “plant architecture,”
and “yield and yield components.” QTL colors on
the consensus maps are assigned from a trait type in which the
QTL trait falls. A heading date QTL, for example, is colored
orange, which is the color designated for the maturity trait type.
Map views are provided to allow the user to view all QTLs in
a particular trait category regardless of the designated color.
We have also developed a set of codes for QTL traits, extending
the current naming convention for greater uniformity. A
table of these codes is available in the QTL_Help record in the
database.
QTLs
Quantitative trait loci (QTLs) are a deceptively complex class
of data to represent accurately in a database. Multiple methods
are available for statistically identifying their presence and location,
with different standards for the significance threshold.
A study population may be derived from a complex breeding
strategy and may be grown in several different locations. The
set of markers used may be from one or two standard sources
and often includes unique markers developed for the study,
which are not present in any other mapping study.
In RiceGenes 5.0, we have attempted as much as possible
to faithfully represent the information reported in a QTL
study while maintaining uniformity for querying purposes.
Several conventions were adopted to accomplish this. A phenotype
is strictly defined as an interaction between genetics
and environment, whereas a “QTL study” in the database is
defined as a breeding experiment using a single population in
a single location. Studies across environments or populations
published in a single reference are treated individually in the
database and are linked to each other through a common published
reference.
The various statistics that are reported as evidence of a
QTL are each stored in a separate field. This strategy enables
storage and querying of ANOVA statistics alongside interval
and composite interval analysis values, regardless of the combination
of these methods reported in an individual study. To
facilitate the appropriate display of a QTL, we wrote a simple
in-house tool that can determine the ends given a pair of loci
for each QTL and a genetic map. In RiceGenes 5.0, for instance,
we have displayed a QTL on a 1997 consensus map,
which, among the 11 maps in the database, has the most comprehensive
collection of markers used for QTL analysis. In
principle, an ideal map for this purpose would include all of
the current morphological, Cornell, and JRGP markers.
Features
To aid the user in navigating and querying the database, we
have added two new features. A context-specific help system
has been implemented for major data classes in which can be
found a strict definition of the class, an explanation of the fields
available in the class, and a sample query for accessing data in
the class. At the bottom of each data record in a documented
class, there is a clickable link that will take the user to the
appropriate explanation. Also, the online version of RiceGenes
5.0 has a fairly extensive collection of “QuickQueries” for
comon types of data searches (http://ars-genome.cornell.edu/
rice/quickqueries.html). There are instructions for modifying
the query parameters if the user desires a slightly different
combination of data.
References
Causse MA, Fulton TM, Cho YG, Ahn SN, Chunwongse J, Wu K,
Xiao J, Yu Z, Ronald PC, Harrington SE, Second G, McCouch
SR, Tanksley SD. 1994. Saturated molecular map of the rice
genome based on an interspecific backcross population. Genetics
138:1251-1274.
Cho YG, McCouch SR, Kuiper M, Kang MR, Pot J, Groenen JTM,
Eun MY. 1998. Integrated map of AFLP, SSLP, and RFLP
markers using a recombinant inbred population of rice (Oryza
sativa L.). Theor. Appl. Genet. 97:370-380.
Harushima Y, Yano M, Shomura A, Sato M, Shimano T, Kuboki Y,
Yamamoto T, Lin SY, Antonio BA, Parco A, Kajiya H, Huang
N, Yamamoto K, Nagamura Y, Kurata N, Khush GS, Sasaki
T. 1998. A high-density rice genetic linkage map with 2275
markers using a single F 2 population. Genetics 148:479-494.
Kinoshita T. 1998. Linkage mapping using mutant genes in rice.
Rice Genet. Newsl. 15:13-74.
Kurata N, Nagamura Y, Yamamoto K, Harushima Y, Sue N, Wu J,
Antonio BA, Shomura A, Shimizu T, Lin SY, Inoue T, Fukuda
A, Shimano T, Kuboki Y, Toyama T, Miyamoto Y, Kirihara T,
Hayasaka K, Miyao A, Monna L, Zhong HS, Tamura Y, Wang
ZX, Momma T, Umehara Y, Yano M, Sasaki T, Minobe Y.
1994. A 300-kilobase interval genetic map of rice including
883 expressed sequences. Nat. Genet. 8:365-372.
Shen LS, He P, Xu YB, Tan ZB, Lu CF, Zhu LH. 1998. Genetic
molecular linkage map construction and genome analysis of
rice doubled haploid population. Acta Bot. Sin. 40:1115-1122.
Temnykh S, Park WD, Ayres NM, Cartinhour S, Hauck N, Lipovich
L, Cho YG, Ishii T, McCouch SR. 2000. Mapping and genome
organization of microsatellite sequences in rice (Oryza
sativa L.). Theor. Appl. Genet. 100:697-712.
Wilson WA, Harrington SE, Woodman WL, Lee M, Sorrells ME,
McCouch SR. 1999. Inferences on the genome structure of
progenitor maize through comparative analysis of rice, maize,
and the domesticated Panicoids. Genetics 153:453-473.
Xiong L, Liu KD, Dai XK, Wang SW, Xu CG, Zhang DP, Maroof
MAS, Sasaki T, Zhang Q. 1997. A high-density RFLP map
based on the F 2 population of a cross between Oryza sativa
and O. rufipogon using Cornell and RGP markers. Rice Genet.
Newsl. 14:110-116.
Notes
Authors’ addresses: A.M. Baldo, S. Cartinhour, United States Department
of Agriculture, Agricultural Research Service, Center
for Agricultural Bioinformatics; G.A. DeClerk, I.V. Yap,
C.M. Larota, S.R. McCouch, Department of Plant Breeding;
T.G. Cargioli, Department of Agricultural and Biological Engineering,
Cornell University, Ithaca, New York 14853, USA.
Genomics 385

Acknowledgments: The authors acknowledge the USDA-ARS for
funding the work, the members of the McCouch laboratory
for their intellectual contribution and expertise, Dr. David
Matthews and Maria Nemchuk for their generous assistance
and support in the software development, and Jiming Li and
Jordan Hay for their assistance with translation and data entry.
CD-ROM for PC version of RiceGenes, a rice-specific ACEDB
Y.C. Shin, T.H. Lee, M.Y. Eun, and B.H. Nahm
For personal use in the stand-alone mode of database RiceGenes, a rice-specific ACEDB database operating under a Unix
system has been ported to RiceWin, a Windows version of RiceGenes. The CD-ROM that can be run on an IBM-compatible PC
is released. RiceWin is developed based on the WinAce program for Windows 95/98 and requires at least 16 MB of RAM with
the data of RiceGenes. The database includes information about 2,668 authors, 71,695 DNAs, 113 gene products, 1,254
genotypes, 252 journals, 4,783 loci, 853 images, 129 maps, 39 multimaps, 1,464 papers, 21,841 probes, 457 quantitative
trait loci, and 94,150 sequences. The RiceWin program is available in two formats—compressed and CD-ROM. The compressed
format is stuffed as a self-extracted file and will be automatically extracted with execution. The compressed format can
be downloaded at the ftp site of Myongji Bioserver (http://bio.myongji.ac.kr) and NAL, USDA (ftp://probe.nalusda.gov/pub/
ricegenes). The 2X CD-ROM containing RiceWin is available free of charge upon written request. The current version of the
program is 4.5.3.
Progress in genome research on various organisms around the
world has resulted in the rapid and massive accumulation of
bioinformation. Therefore, the use of a bioinformation database
via a computer network has become very important to
retrieve data of interest and biologically related information.
Huge sizes of data are collected in databases such as GenBank
(GenBank 2000) and EBI (EBI 2000). The information on and
analysis of sequences are available from the database and analysis
network. However, this sequence information is collected
regardless of the organism and it is not easy for users to combine
the biologically related data in any specific organism because
of the lack of an integrated database system. To overcome
these difficulties, a sophisticated networking of databases
is developed with the help of hypertext, which links various
types of data such as DNA, protein, and references to retrieve
related data such as that provided in Entrez (Entrez
2000).
The schematic diagram for the current flow of
bioinformation is described in Figure 1. Bioinformation such
as DNA, protein, and references is cross-linked and retrieved
according to users’ requests through the search system, Entrez
Browser, provided by GenBank in collaboration with
ProteinDB and Medline databases. With the recent increased
capacity of the network, sequences can be analyzed for homology
with BLAST and FASTA, with cross links to the analysis
program. Also, with the development of graphic interface
technology, graphic presentations of the sequence information
have been made possible.
As one of the powerful worldwide bioinformation networks,
ACEDB (A Caenorhabditis elegans Database) WWW
Server (ACEDB server) has been developed. Whatever type
of distribution media is used, the main database software is
called “ACEDB” database for the organization of
bioinformation such as DNA, protein sequences, QTL maps,
loci, probes, polymorphisms, metabolic pathways, and related
images.
ACEDB, the database software
ACEDB was developed by Richard Durbin and Jean Thierry-
Mieg (Durbin and Thierry-Mieg 1991). However, with the
application of the database software to organize molecular biology
data about genomes of diverse species, it refers to the
database software alone. The database software was originally
written in C language for the Unix system and the current Unix
version is 4.5. The software is available as source code and
binary format for a variety of workstation levels and other personal
computers (Table 1).
Structure of ACEDB
A major current trend in computer languages and database
design is “object-oriented” systems. The ACEDB developers
are trying to build system-organizing biological data into objects
and classes. In particular, there is neither class hierarchy
nor inheritance. Data are written in a modular but
nonideological way in straight C. However, display and disk
storage methods are class-dependent.
ACEDB does not use an underlying relational database
schema but a system in which data are stored in objects that
belong in classes. This is nevertheless a general database man-
386 Advances in rice genetics

AGIS
(NAL, USDA)
Plant Genome
Animal Genome
Microorg. Genome
A
C
E
D
B
E
ntrez
DNA DB
GenBank, EMBL, DDBJ
Protein DB
Swiss PR, PIR, PDB
Reference DB
Medline, Patent
ACeDB
MycDB
21DB
XDB
User
AAtDB
Treegenes
PigBase
BovGBase
Korea Rice
Genome Server
GrainGenes
MaizeDB
RiceGenes
RiceGenes
RiceWin
Fig. 1. A schematic diagram
for the current flow of
bioinformation.
Table 1. Current version and supporting system for the ACEDB program.
Version Supporting system Available FTP site
Unix (ACEDB 4.5) Sun/Solaris ftp://lirmm.lirmm.fr in pub/acedb
IBM RS-6000
ftp://cele.mrc-lmb.cam.ac.uk in pub/acedb
Linux PC 386/486/Pentium with Linux ftp://bioinformatics.weizmann.ac.il in pub/databases/acedb.
PC Windows 95/98 ftp://ncbi.nlm.nih.gov in repository/acedb
agement system using caches, session control, and a powerful
query language. Typical objects are clones, genes, alleles, papers,
sequences, etc. Each object is stored as a tree, following
a hierarchical structure for the class—called the “model.” Maps
are derived from data stored in tree objects but precomputed
and stored as tables for efficiency. The system of models allows
flexibility and efficiency of storage. Missing data are not
stored.
A major advantage is that the models can be extended
and refined without invalidating an existing database. Comments
can be added to any node of an object. In some ways,
class hierarchy is replaced by a system of models and trees,
which seems to be rather unusual. This system is very natural
for the representation of biological information, where, for
some members of a class, a lot might be known about some
aspects, but, for most, only a little is known.
Application of the ACEDB program
The main characteristics of the ACEDB program are that it is
organism-specific and object-oriented. The program provides
not only the retrieval DNA and protein sequences and references
but also probe information linked to loci on the map and
related polymorphism, including blot and mutant phenotype
images and various mapping information as raw data. The
ACEDB system is focused on linking the bioinformation related
to any specific organism.
Many organism-specific, diverse versions of the ACEDB
have been developed. All the organism-specific databases are
using the same software. However, the developers modified
the model, defining a hierarchical structure for the class in the
construction of the database according to organism characteristics
and type of data available. The list of current organismspecific
ACEDB servers, species, and sites for them is given
in Table 2. The information and management of the ACEDB
database are described at the home page of the ACEDB server.
Support for ACEDB servers
To support the management of the ACEDB, the AGIS server
at the NAL, USDA, provides tools for integrating version
ACEDB with Perl and the World Wide Web. A WWW interface
to 4.5 and instructions for this interface are available at a
WWW server (Matthews 2000). As supporting groups, there
are newsgroups, such as bionet.software.acedb and a USENET/
Biosci conference titled “bionet.software.acedb” for discussion
about the ACEDB. To participate in the conference by e-
mail, subscribe to biosci-server@net.bio.net with no subject
line and only the message “subscribe ACEDB-SOFT” in the
body. To unsubscribe, send the message “unsubscribe ACEDB-
SOFT” to the same address. After subscribing, any messages
(including your e-mail sent to acedb@net.bio.nef) will be distributed
automatically to all subscribers and to the electronic
conference. All of the articles in biosci.software.acedb are
archived by Biosci (www.bio.net/archives.html).
Genomics 387

Table 2. Diverse organism-specific ACEDB servers.
Database
AaeDB
AAtDB
AceDB
BarleyDB
BeneGenes
BrassicaDB
CassavaDB
ChlamyDB
DictyDB
Ecosys
FoodplantDB
MaizeDB
MPNADB
PathoGenes
RiceBlast
RiceGenes
SolGenes
SorghumDB
SoyBase
TreeGenes
Species
Aedes aegypti (mosquito)
Arabidopsis thaliana
Caenorhabditis elegans
Hordeum
Phaseolus, Vigna
Brassica napus
Manihot esculenta Crantz
Chlamydomonas
Dictyostelium
Plant ecological ranges
Native American food plants
Zea
Medicinal plants of native America
Cereal pathogens
Magnaporthe grisea
Oryza
Lycopersicon, Solanum, etc.
Sorghum
Glycine max
Forest trees
URL or contact
http://klab.agsci.colostate.edu/
http://genome-www.stanford.edu/
http://www.sanger.ac.uk/Projects/C_elegans/index.shtml
http://synteny.nott.ac.uk/barley.html
http://beangenes.cws.ndsu.nodak.edu/
http://synteny.nott.ac.uk/brassica.html
http://www.ciat.cgiar.org/projects/ip-3.htm
http://www.botany.duke.edu/chlamy/
http://www-biology.ucsd.edu/others/dsmith/dictydb.html
http://ars-genome.cornell.edu/Botany/aboutecosys.html
http://ars-genome.cornell.edu/Botany/aboutfoodplantdb.html
http://www.agron.missouri.edu/
http://ars-genome.cornell.edu/Botany/aboutmpnadb.html
http://ars-genome.cornell.edu/aboutpathogenes.html
http://ascus.cit.cornell.edu/blastdb/
http://ars-genome.cornell.edu/rice/
http://ars-genome.cornell.edu/solgenes/
http://algodon.tamu.edu/sorghumdb.html
http://129.186.26.94/
http://dendrome.ucdavis.edu/
RiceGenes
RiceGenes is one of the diverse, organism-specific DB versions
of the ACEDB program. The ACEDB is installed in a
Unix machine. Because biologists have difficulty maintaining
the Unix machine, data from RiceGenes are usually extracted
from the ACEDB server. The RiceGenes WWW server is supported
at the ACEDB server of NAL, USDA, while ftp and
Gopher servers are directed by Susan McCouch and curated
by Angela Baldo at USDA-ARS CBCG (RiceGenes 2000).
Also, the Korean rice genome server at the National Institute
of Agricultural Science and Technology, Rural Development
Administration, Suwon, Korea, serves as the mirror site of
RiceGenes (Mirror 2000). The current version is 4.5.
RiceGenes provides 32 classes such as author, DNA, gene product,
image, journal, locus, map, probe, sequence, etc.
At the beginning of the program provided by the WWW
server for RiceGenes in browse mode, the selection menu for
the category will be given in the table menu screen of the class.
When the requested class is selected, the object of interest can
be selected in the sublist or full-list menu, as an example of
sequence. In text format requested sequence information, various
objects underlined are linked and related information can
be retrieved from internal and external databases such as in
EMBL, GenBank and Sequence Analysis Tools, or Enzyme
Database by clicking the given letter. By selecting the probe
or polymorphism, the probe information and related polymorphic
Southern blot image can be obtained.
RiceWin
RiceWin, developed as part of the Korean Rice Genome Research
Program, is the Windows 95/98 version of RiceGenes.
RiceWin is developed for Windows 95/98 based on
WinAce4.5.6-beta (Bruskiewich 1998). It has 16 Mbytes of
RAM and 256 colors. RiceWin is available in two formats—
one is the CD-ROM version, which is available free of charge
upon written request; the other form is for downloading from
the ftp site. The files are available in zip formats. The compressed
formats are available at the ftp sites of the Korean rice
genome server and RiceGenes server at NAL, USDA.
RiceWin is developed for those who do not have network
access and is dedicated for personal use. It contains the
same data as those in RiceGenes with the same version. The
program can be started by clicking “RiceGenes 4.5.3” in the
ACEDB chooser program and clicking the class and objects
and linked following objects. The objects linked to classes such
as locus on the map, its sequences, authors, related papers,
and others are retrieved in the same way as in RiceGenes.
However, in RiceWin, all the objects linked are shown on the
monitor as multiple windows.
The first version, RiceMac 4.1.1, was released in May
1996 and updated to 4.1.2 in November 1996. The CD-ROM
version was released from RiceMac 4.1.2. The CD-ROM title
of the current version of RiceGenes 4.5.3, released in January
2000, contained the Windows 95/98 version of the three databases:
RiceWin 4.5.3, WinGrainGenes (GrainGenes 1998), and
RiceBlast 2.0 (RiceBlastDB 1998) titled “RiceGenes,
GrainGenes, RiceBlast” in collaboration with DB groups of
RiceGenes, GrainGenes, and RiceBlast. RiceWin will be updated
with the release of RiceGenes.
References
ACEDB and ACEDB WWW servers. http://ars-genome.cornell.
edu/, http://www.acedb.org/.
Bruskiewich R. 1998. www.acedb.org/WinAce.shtml, ftp://
ftp.sanger.ac.uk /pub/acedb/winace.
388 Advances in rice genetics

Durbin R, Thierry-Mieg J. 1991. A C. elegans database: ftp://
lirmm.lirmm.fr, ftp://cele.mrc-lmb.cam.ac.uk, ftp://
ncbi.nlm.nih.gov.
EBI (European Bioinformatics Institute). EMBL 2000.
www.ebi.ac.uk/.
Entrez. 2000. The NCBI WWW Entrez browser.
www.ncbi.nlm.nih.gov/Entrez/.
GenBank. 2000. www.ncbi.nlm.nih.gov/Genbank/index.html.
GrainGenes. 1998. Wheat, barley, oat, sugarcane and relatives, data
version 1.8. http://wheat.pw.usda.gov/, ftp://arsgenome.cornell.edu/pub/GrainGenes/.
Matthews DE. 2000. Frequently asked questions about ACEDB:
http://ars-genome.cornell.edu/acedocs/acedbfaq.html.
Mirror (Korean rice genome server at NIAST, RDA, and at Myongji
University). 2000. www.niast.go.kr/NIAST/Services/
RiceGenome.html, http://bio.myongji.ac.kr/ricemac4.html.
RiceBlastDB. 1998. A database for the rice blast fungus,
Magnaporthe grisea, data version 2.0:http://
ascus.cit.cornell.edu/blastdb/, ftp://ascus.cit.cornell.edu/pub/
blastdb/.
RiceGenes. 2000. http://ars-genome.cornell.edu/rice/, ftp://arsgenome.cornell.edu/pub/RiceGenes.
Notes
Authors’ addresses: Y.C. Shin, T.H. Lee, and B.H. Nahm, Department
of Biological Science, Myongji University, Yongin 449-
728, Korea; M.Y. Eun, Department of Cytogenetics, National
Institute of Agricultural Science and Technology, Suwon 441-
707, Korea.
Performing line × tester analysis with the SAS® system
V.I. Bartolome and G.B. Gregorio
Plant breeders use line × tester analysis to evaluate the general and specific combining ability of various lines and to estimate
gene effects. This analysis requires a lengthy series of complicated computational steps, which, when done in SAS ® , would
require in-depth knowledge of the software. However, few breeders have this capability; thus, a program was developed for
users with limited knowledge of SAS. This program requests information from users interactively and prints out the needed
analyses. Users of the program need to know only how to open the program file, respond to queries, and print the output. The
line × tester program is available from the Biometrics Unit at IRRI.
Line × tester analysis involves a lengthy series of complicated
computational steps, which, when done in SAS ® , would require
in-depth knowledge of the software. Thus, to help breeders
analyze their own data, we developed interactive programs
such as that for line × tester analysis using the SAS system.
In formulating programs for the genetic improvement of
yield, breeders face the difficult task of choosing parents for
hybridization. This is because yield is a quantitative character,
with several components, each of which is polygenically controlled
and therefore highly affected by environmental fluctuations.
The task becomes even more complex when breeders
have to choose from a wide collection of diverse germplasm.
Breeders use line × tester analysis to evaluate the general and
specific combining ability of parents. At the same time, this
analytical tool is useful in estimating various types of gene
effects. The analysis provides an opportunity for discriminating
large numbers of parents for their combining ability without
making so many crosses. Prasad and Sastry (1987) and
Manuel and Palanisamy (1989) used this technique to identify
parents and crosses that could be exploited for future breeding
programs. The tables presented in these papers are uniform
and can thus be standardized in a macro program.
The SAS program for line × tester analysis
The step-by-step procedure presented by Singh and Chaudhary
(1979) was used in developing the program for line × tester
analysis, with some modifications in the partitioning of variety
effect. The program was developed using the macro facility,
a powerful tool in SAS programming. To illustrate the program,
we used a sample data set with seven lines, four testers,
and four checks. Sample outputs are presented in the appendix.
The program was developed under the Windows ® environment.
It is interactive and does not require proficiency in
the use of SAS. One needs to know only how to open the program
file, respond to queries, and print the output. However,
if you intend to write a similar program, you will need an indepth
knowledge of the macro facility.
The program, through messages flashed in the log window,
asks you to input information in the program editor and
then submit responses by clicking on the running-man icon.
The information required is number of testers, lines, checks,
and replicates and the start and end column of their location in
the input file. The program also asks for the name of the data
set to be analyzed; entry number of lines, testers, and checks;
and the number and names of characters to be analyzed. In
response to queries on entry numbers, the numbers can be en-
Genomics 389

tered as a string separated by a period (e.g., 5.6.7.8.9.10.11).
This information is needed to create subset data sets for lines,
testers, and checks that will be needed in the computation of
various estimates.
Line × tester analysis outputs
After the program has received the needed information, it outputs
the tables needed in a line × tester analysis. The outputs
of the program include the following:
l Analysis of variance with partitioned variety group
effects. This helps in sorting out the variance from
different sources. Variations were partitioned between
varieties and within variety groups. This provides a
basis for the test of significance. The general linear
models (GLM) procedure of SAS/STAT was used to
output the sums of squares needed, including those
for the partitioned effects. The program was developed
to handle any number of testers, lines, and
checks. The contrast statement of the PROC GLM
was not used to partition variety effect as the number
of contrast coefficients will depend on the number of
testers, lines, and checks. All sums of squares were
combined in one data set. F values and their corresponding
levels of significance were recomputed and
then printed in a table using the data step report-writing
facility.
l Table of parent means and their respective general
combining ability (GCA), and hybrid means and their
respective specific combining ability (SCA). GCA is
the average performance of a line in a series of hybrids
and represents additive gene action (fixable
l
l
References
genes). SCA measures the deviation of hybrids from
the value expected on the basis of parental performance.
It represents nonadditive gene action
(nonfixable genes). Combining ability studies help in
identifying parents with a high GCA and in identifying
cross combinations showing a high SCA. GCA is
the difference of the parent mean from the grand mean,
whereas the SCA is the hybrid mean minus the line
and tester effects.
Table of standard errors for combining ability effect.
These standard errors can be used to test the significance
of the different combining ability effects.
Heterosis analysis. This table presents the performance
of the hybrids compared with that of their parents.
It can be used to identify hybrid performance
that exceeds the average parental performance.
Manuel WW, Palanisamy S. 1989. Line × tester analysis of combining
ability of rice. Oryza 26:27-32.
Prasad GSV, Sastry MVS. 1987. Line × tester analysis for combining
ability and heterosis in brown planthopper-resistant varieties.
Indian Agric. 31:257-265.
Singh RK, Chaudhary BD. 1979. Biometrical methods in quantitative
genetic analysis. New Delhi (India): Kalyani Publishers.
Notes
Authors’ address: V.I. Bartolome, Biometrics Unit, and G.B.
Gregorio, Plant Breeding, Genetics, and Biochemistry Division,
International Rice Research Institute (IRRI), Los Baños,
Philippines.
Appendix. Program outputs
A. Analysis of variance table for grain yield (kg ha –1 ).
Source of variation a df Sum of squares Mean square F Prob.
Rep 2 1,455,214.7442 727,607.3721 5.10 0.0083
Var 42 81,725,258.3566 1,945,839.4847 13.63 0.0000
C vs (P,H) 1 3,971,791.7241 3,971,791.7241 27.82 0.0000
P vs H 1 21,968,449.9528 21,968,449.9528 153.85 0.0000
Checks (C) 3 2,807,278.0000 935,759.3333 6.55 0.0008
Parent (P) 10 9,083,068.0606 908,306.8061 6.36 0.0000
Hybrid (H) 27 43,894,670.6190 1,625,728.5414 11.39 0.0000
Line 6 20,995,238.2857 3,499,206.3810 3.07 0.0299
Tester 3 2,359,246.2381 786,415.4127

B. Parental means and their respective general combining ability
(partial) for grain yield (kg ha –1 ) (av of 3 reps).
D. Standard errors of combining ability effects for
grain yield (kg ha –1 ).
Variety Parental mean GCA
Parameter
Estimate
Tester 1 796.333 228.2143
2 370.000 52.8810
3 767.667 –235.3095
4 1,168.667 –45.7857
Line 5 1,984.333 –635.3571
6 1,019.667 369.2262
7 1,799.000 760.8929
C. Hybrid means and their respective specific
combining ability (partial) for grain yield
(kg ha –1 ) (av of 3 reps).
Variety Hybrid mean SCA
12 1,762.667 1.7857
13 2,516.000 –249.4643
14 3,275.000 117.8690
15 2,649.667 –174.7143
16 2,620.000 497.0357
17 1,562.667 –224.4643
18 2,387.667 31.9524
19 1,656.000 70.4524
S.E. (GCA for line) 109.0833
S.E. (GCA for tester) 82.4592
S.E. (SCA for effects) 218.1666
S.E. (gi – gi) line 154.2671
S.E. (gi – gi) tester 116.6149
S.E. (sij – skl) 308.5341
Cov. H.S. (line) 196,507.0776
Cov. H.S. (tester) –16,890.7637
Cov. H.S. (av) 10,769.0465
Cov. F.S. 537,426.4023
s2A with F = 0 172,304.7437
s2A with F = 1 43,076.1859
s2D with F= 0 5,324,434.5305
s2D with F= 1 1,331,108.6329
Contribution of lines 47.83%
Contribution of testers 5.37%
Contribution of (1 × t) 46.79%
E. Heterosis analysis (partial) for grain yield (kg ha –1 ).
Hybrid Parental Better Diff. Heterosis Diff. Heteroris
Line Tester mean Female Male mean parent from over MP from over BP
(F 1 ) (MP) (BP) MP (%) BP (%)
5 1 1,762.67 1,984.33 796.33 1,390.33 1,984.33 372.33 26.78 –221.67 –11.17
2 1,656.00 1,984.33 370.00 1,177.17 1,984.33 478.83 40.68 –328.33 –16.55
3 1,081.67 1,984.33 767.67 1,376.00 1,984.33 –249.33 –21.39 –902.67 –45.49
4 1,630.33 1,984.33 1,168.67 1,576.50 1,984.33 53.83 3.41 –354.00 –17.84
6 1 2,516.00 1,019.67 796.33 908.00 1,019.67 1,608.00 177.09 1,496.33 146.75
2 2,802.67 1,019.67 370.00 694.83 1,019.67 2,107.83 303.36 1,783.00 174.86
3 2,181.00 1,019.67 767.67 893.67 1,019.67 1,287.33 144.05 1,161.33 113.89
4 2,649.33 1,019.67 1,168.67 1,094.17 1,168.67 1,555.17 142.13 1,480.67 126.70
Genomics 391

Gene isolation and function
Gene isolation and function 393

394 Advances in rice genetics

One super-mutator transposon family found in rice
R. Ishikawa, K. Miura, M. Ashida, M. Senda, S. Akada, T. Harada, and M. Niizeki
Rice Mutator (RMu) elements were cloned and characterized as Mutator homologs. The first clone was RMu1-IR36 carrying
long terminal inverted repeats (TIRs) flanked by a 9-bp target site duplication. As an internal sequence, a long open reading
frame shares high homology to a MURA protein coding gene, mudrA, in a maize Mutator element. The RMu family has several
members sharing homologous long TIRs. The TIRs also share about 50% similarity with that of a maize Mutator regulatory
element, MuDR. The most conserved domains were known as MURA protein-binding sequences and internal inverted repeatlike
sequences. Japonica strains showed continuous expression of the gene, whereas indica strains showed a highly regulated
expression. Current transposition activity was presumed by the ability to produce new bands in the selfed progeny. Active
transposable elements in the rice genome will provide useful information in functional genomics.
RMu1-IR36 was cloned as a homolog to maize Mutator transposable
elements (Ishikawa and Freeling 1996). Its size is 4,368
bp and it is flanked by a 9-bp genomic repeat. RMu transposable
elements have several subfamilies carrying terminal inverted
repeats (TIRs) revealing sequence similarities to TIRs
of RMu1-IR36 (Fig. 1). The TIRs carry highly conserved domains
sharing homology to TIRs of MuDR known as a regulatory
element of the Mutator family (Fig. 2). The RMu1 class is
an autonomous class in the RMu family. Each member in the
class carries a single rmuA gene having the putative transposase
domain inside (Eisen et al 1994). The open reading frame shares
a high similarity to the mudrA gene, which is a transposase
gene in MuDR (Chomet et al 1991, Eisen et al 1994). The
highest part revealed 80% similarity between two domains
found in rice RMu and maize Mutator elements (Fig. 3). Expression
of the gene was confirmed in japonica strains and a
particular indica strain when exposed to chilling stress at regular
intervals. The function has not yet been confirmed in rice.
However, we detected new bands in the self-pollinated progeny
in the A1 (Akage) strain (Fig. 4). We have not obtained
progeny from these strains because they did not set seeds. Thus,
we could not confirm whether this kind of new band can be
transmitted through pollen or egg. However, this condition to
activate the transcription of the rmuA gene would produce more
individuals carrying this kind of new band.
The RMu family as one of the super-Mu families
The rice genome has several transposons sharing structural
similarities to the maize Mu family. Among them, RMu1-IR36
exceptionally showed the highest similarity to MuDR. We think
that there are multi-Mu lineages in single genomes and that
any plant species might carry an Mu lineage. RMu1-IR36 is
one of the lineages and it seems to be the most promising element
for transposition. In addition, since maize Mutator is
known as a powerful tool for understanding gene function, rice
Mutator homologs will give us valuable tools for knowing the
function of numerous genomic sequences isolated by the rice
genome project.
References
Benito M, Walbot V. 1997. Characterization of the maize Mutator
transposable element MURA transposase as DNA-binding
protein. Mol. Cell Biol. 17:5165-5175.
RMu1-IR36
rmuA
RMu2-IR36
RMu2-A1a
RMu2-A1b
RMu2-A1c
Fig. 1. Members of the RMu family. RMu1-IR36 has an open reading frame (open boxes)
and long TIRs (arrows). Other members carry homologous TIRs but some members carry
unrelated internal sequences as shown in differently hatched boxes.
Gene isolation and function 395

RMu1, L
RMu1, L
Consensus
MuDR, L
MuDR, R
IR-like
MBS (25–56 nt)
RMu1, L
RMu1, L
Consensus
MuDR, L
MuDR, R
RMu1, L
RMu1, L
Consensus
MuDR, L
MuDR, R
IR-like
RMu1, L
RMu1, L
Consensus
MuDR, L
MuDR, R
RMu1, L
RMu1, L
Consensus
MuDR, L
MuDR, R
Fig. 2. Sequence comparison among TIRs of RMu1-IR36 and MuDR. Consensus sequences are common
nucleotides found in at least three sequences. Inverted repeat (IR)-like sequences are predicted inverted
repeats inside of these TIRs. MBS = MURA binding site (Benito and Walbot 1997).
MuDR
10 20 30 40
Rice
MuDR
50 60 70 80
Rice
MuDR
90 100 110 120
Rice
MuDR
130 140 142
Rice
Fig. 3. Conserved amino acid sequences between putative transposase domains found in
MuDR and RMu1-IR36. Asterisks show substitutional amino acids.
396 Advances in rice genetics

4.0 kb
Chomet P, Lisch D, Hardeman KJ, Chandler VL, Freeling M. 1991.
Identification of a regulatory transposon that controls the
Mutator transposable element system in maize. Genetics
129:261-270.
Eisen JA, Benito MI, Walbot V. 1994. Sequence similarity of putative
transposase links the maize Mutator autonomous element
and a group of bacterial insertion sequences. Nucleic Acids
Res. 19:2634-2636.
Ishikawa R, Freeling M. 1996. Putative transposase-like domain
found in rice genome. Rice Genet. Newsl. 13:146-147.
Fig. 4. Rmu-related restriction fragment length polymorphisms
found in the selfed progeny. Eight plants of strain A1 were grown
and mature leaves were used to extract genomic DNA. DNA was
digested with XhoI and probed with TIR.
Notes
Authors’ addresses: R. Ishikawa, K. Miura, M. Ashida, T. Harada,
and M. Niizeki, Faculty of Agriculture and Life Sciences; M.
Senda and S. Akada, Gene Research Center, Hirosaki University,
Hirosaki 036-8561, Japan.
A maize MuDR-like tranposable element transcribed
in the rice genome
S. Yoshida, N. Asakura, R. Ootani, and C. Nakamura
We previously showed that proline added to the subculture medium dramatically increased the frequency of albino plants in
rice tissue culture under high osmotic conditions. Using the differential display method, a proline-induced transcript was
identified that showed considerable homology to the maize mudrA transcript of the MuDR transposon. We obtained 12 genomic
clones, of which two clones, OsMu4-2 (4.7 kb) having terminal inverted repeats (TIRs) and OsMu10-1 (1.1 kb) with
highly homologous TIRs, were analyzed. Both had 9-bp putative target-site duplications outside of the TIRs. RT-PCR products
from the coding region of OsMu4-2 were obtained using primers designed by the genomic sequence. The structural analysis
suggested that OsMuDR is a rice orthologue of the maize MuDR. An amino acid sequence of the MURA-like protein deduced
from OsMu4-2, however, included several stop codons in the reading frame. Results suggested that OsMu4-2 was a pseudogene.
OsMu10-1 possessed only a 330-bp sequence of the 3′-end of the coding region. This deleted version possessed 5-nucleotide
direct repeats at the deletion point, suggesting that the deletion was caused by the interrupted gap repair mechanism. The
presence of such a deletion provided an indication that the rice MuDR element had transposed in the past.
Eukaryotic genomes possess numerous transposons and
retrotransposons. These transposable elements are considered
to be genomic modelers, playing a significant role in the evolution
of genome structure and function. Because of their transposable
nature, endogenous transposons and retrotransposons
have potential as genetic tools for investigating gene function.
In rice, the presence of retrotransposons (a Tos family) has
been demonstrated, which are activated by in vitro culture,
thus providing a powerful means for gene tagging (Hirochika
et al 1996). However, activation of even a most active member
(Tos17) is restricted in certain japonica rice varieties. It is
therefore predicted that unknown transposable elements are
present and contribute to the somaclonal variation in rice.
During a study of the effects of osmotic stress and exogenous
proline on plant regeneration from anther- and seedderived
callus cultures in rice, it was found that proline added
in subculture medium strongly stimulated regeneration of albino
plants. Through differential display screening, a maize
mudrA-like rice transcript was identified that showed accumulation
in callus subcultured under the condition stimulating
albino regeneration (Yoshida et al 1998). We report results on
the structural study of genomic clones and RT-PCR products
of the maize MuDR-like transposable element in rice.
Isolation and structural analysis of genomic clones
of the rice OsMuDR
A rice genomic library was screened using a previously obtained
partial cDNA clone, OsmudrA (Yoshida et al 1998), as
a probe. Sequences of two out of 12 clones were analyzed.
One clone, OsMu4-2, was 4.7 kb in length and had terminal
inverted repeats (TIRs), whereas the other clone, OsMu10-1,
was 1.1 kb with highly homologous TIRs (Fig. 1). They had 9-
bp putative target-site duplications outside of the TIRs. A cod-
Gene isolation and function 397

Sequence flanking the OsMu10-1 deletion end point
TTGGCAACAAttgtctcag
agtcaaacaaGGACAACT
mudrA-like transcript
5¢ 3¢
Sal H B H K E Sac X
ACCCACCTC
TGGGTGGAG
TIR
OsMu4-2
1 kb
ACACACCTC
TGTGTGGAG
TIR
TCTCTCGTC
TCCCTCGTC
AGAGAGCAG
AGGGAGCAG
TIR
TIR
OsMu10-1
Fig. 1. A schematic representation of two
rice genomic clones (OsMu4-2 and
OsMu10-1). Hatched areas are homologous
regions between the two clones and
black triangles represent terminal inverted
repeats (TIRs). Restriction sites are abbreviated;
B = BamHI, E = EcoRI, H = HindIII,
K = KpnI, Sac = SacI, Sal = SalI, X = XbaI.
In a mudrA-like transcript, the gray bar indicates
the region amplified by RT-PCR. In
the sequence flanking the OsMu10-1 deletion
end points, boxed sequences of
AACAA and a hatched region indicate direct
repeats and a deletion, respectively.
ing region of OsMu4-2 showed high homology with the maize
mudrA transcript. RT-PCR products were obtained using primers
designed by the genomic sequence of OsMu4-2 and RNAs
extracted from seed-derived callus subcultured with 10 mM
proline. A sequence revealed by overlapped products was compared
with those of the partial cDNA clone (OsmudrA) and
the genomic clone (OsMu4-2). The result suggested that the
genomic sequence had at least two splice sites for introns of
355-bp and 82-bp length. The other clone, OsMu10-1, showed
a large deletion and possessed only a 330-bp sequence of the
3′-end of the coding region. Two direct repeats of 5 bp
(AACAA) were found in the OsMu4-2 sequence, whereas, in
OsMu10-1, one repeat was missing (Fig. 1). This loss of the
repeat occurred at the region flanking the deletion end point.
This suggested that the deletion within OsMu10-1 was caused
by the interrupted gap repair mechanism involving the direct
repeats in the element, as already suggested in the Mu-element
of maize and P element of Drosophila (Hsia and Schnable
1995).
Homology of the rice OsMuDR with the maize MuDR
The amino acid sequence of the MURA (transposase)-like protein
(OsMURA) deduced from the nucleotide sequence of
OsMu4-2 included several stop codons in midpoints of the
reading frame, suggesting that it was a pseudogene. The longest
deduced amino acid sequence of OsMURA, however,
showed considerable homology (43.4% amino acid identity)
with the maize MURA. Within the sequence motif that is conserved
in MURA and putative transposases of a group of bacterial
insertion sequences (Eisen et al 1994), OsMURA showed
more than 50% amino acid identity with the maize MURA.
TIR sequences of OsMu showed an average of about
50% nucleotide identity with that of Mu1 of the maize Mu
family. A UPGMA analysis of the most-terminal region (93–
99 bp), including the transposase-binding site (Benito and
Walbot 1997), showed that the rice OsMu formed a distinct
cluster compared with that which contained all members of
the maize Mu family (Fig. 2).
Discussion
Mu transposable elements have been identified in maize. The
first insertion event was observed in lines with high copy numbers
(10 to 100 copies) of the Mu element, whereas less than
two copies were detected in the other lines (reviewed in
Bennetzen et al 1993). An autonomous regulator of the Mu
family has been cloned in several laboratories, designated as
MuDR. Multicopy MuDR was reported to cause 20- to 50-fold
higher frequency of forward mutation than the maize Ac and
Spm transposable elements. Furthermore, Cresse et al (1995)
reported that the Mu transposable element preferentially inserts
into low-copy-number DNA in gene-enriched regions of
the maize genome. Therefore, Mu elements are considered to
be an efficient tool for transposon tagging.
We showed that the rice genome possessed sequences
with considerable homology with the maize regulatory transposable
element MuDR. Many expressed sequences of rice
that show homology with the maize mudrA transcript have been
deposited in the database. However, their homology was much
less than that observed in the OsMu. Structural analysis of
genomic sequences and RT-PCR products suggested that the
rice element OsMuDR is an orthologue of the maize MuDR.
The rice OsMuDR is transcriptionally active, although the sequences
analyzed apparently represented a pseudogene. Importantly,
the presence of the deleted version (OsMu10-1) suggests
that this structure might have been caused by the interrupted
gap repair mechanism after transposition of the element
(Hsia and Schnable 1995). This provides an indication
that the rice element transposed at least in the past.
Activation/inactivation of MuDR is regulated by
demethylation/methylation. Joanin et al (1997) observed tissue-
and developmental stage-specific accumulation of Mu
transcripts. The study suggested the involvement of tissue-specific
promoters or enhancers that drive transcription of nearby
MuDR elements. These observations and the activation of
OsMuDR by proline might suggest the presence of a prolinemediated
regulatory mechanism of the rice element. Although
the functionally active Mu-like transposable element system
in rice has yet to be demonstrated, our results suggested that
398 Advances in rice genetics

Mu1.4-L
Mu1.7-R
Mu1-L
Mu5-R
Mu1.7-L
Mu7-L
Mu7-R
Mu8-L
Mu8-R
Mu1-R
Mu1.4-R
Mu4-L
Mu4-R
Mu3-L
Mu3-R
Mu5-L
Mu9-L
Mu9-R
OsMu10-1-L
OsMu4-2-L
OsMu10-1-R
0.20 0.15 0.10 0.05 0
Genetic distance
OsMu4-2-R
Fig. 2. A cluster analysis based on the
nucleotide sequences of TIRs in the
maize Mu transposons and the OsMu. A
dendrogram was constructed by UPGMA
method of DNA sequences in the mostterminal
93–99-bp region of TIRs.
OsMuDR might play an important role in somaclonal and
gametoclonal variations, including proline-stimulated albinism.
A further study of structural diversity and the regulatory mechanism
of this novel rice element is required to test this interesting
hypothesis.
References
Bennetzen J, Springer PS, Cresse AD, Hendrickx M. 1993. Specificity
and regulation of the mutator transposable element system
in maize. Crit. Rev. Plant Sci. 12:57-95.
Benito M-I, Walbot V. 1997. Characterization of the maize mutator
transposable element MURA transposase as a DNA-binding
protein. Mol. Cell. Biol. 17:5165-5175.
Cresse AD, Hulbert SH, Brown WE, Lucas LR, Bennetzen J. 1995.
Mu1-related transposable elements of maize preferentially
insert into low copy number DNA. Genetics 140:315-324.
Eisen JA, Benito M-I, Walbot V. 1994. Sequence similarity of putative
transposases links the maize Mutator autonomous element
and a group of bacterial insertion sequences. Nucleic
Acids Res. 22:2634-2636.
Hirochika H, Sugimoto K, Otsuki Y, Tsugawa H, Kanda M. 1996.
Retrotransposons of rice involved in mutations induced by
tissue culture. Proc. Natl. Acad. Sci. USA 93:7783-7788.
Hsia A-P, Schnable S. 1995. DNA sequence analyses support the
role of interrupted gap repair in the origin of internal deletions
of the maize transposon MuDR. Genetics 142:603-618.
Joanin P, Hershberger RJ, Benito M-I, Walbot V. 1997. Sense and
antisense transcripts of the maize MuDR regulatory transposon
localized by in situ hybridization. Plant Mol. Biol. 33:23-36.
Yoshida S, Tamaki K, Watanabe K, Fujino M, Nakamura C. 1998. A
maize MuDR-like element expressed in rice callus subcultured
with proline. Hereditas 129:95-99.
Notes
Authors’ addresses: S. Yoshida and R. Ootani, Hyogo Prefectural
Institute of Agricultural Research, Kasai, Hyogo, 679-0198;
N. Asakura, Faculty of Engineering, Kanagawa University,
Kanagawa-ku, Yokohama 221-8686; C. Nakamura, Faculty
of Agriculture, Kobe University, Nada-ku, Kobe 657-8501,
Japan.
Gene isolation and function 399

Transcriptional analysis of the Mu-like element Tnr2 in rice
F. Myouga, S. Tsuchimoto, H. Ohtsubo, and E. Ohtsubo
Tnr2 is a nonautonomous transposable element of rice with terminal inverted repeats (TIRs), and it produces a duplication of
a 9-bp sequence at the target site. Among the Tnr2 members, we found an exceptionally large member with homology to the
sequence of mudrA that is the transposase gene encoded by the maize transposable element MuDR. We identified transcripts
from mudrA of Tnr2 by Northern hybridization in both Nipponbare plants and Oc-cultured cells of rice, indicating that the Tnr2
member is able to transpose autonomously in the rice genome. RT-PCR and 5′- and 3′-RACE analyses of the transcripts
revealed that the positions of several introns present in mudrA of Tnr2 differed from those in MuDR, and that multiple
polyadenylation sites existed. During these studies, a transcript with about 60% homology to that of Tnr2 was found. These
results indicated that Tnr2, as well as the Tnr2 homolog, was transcribed and thus can transpose autonomously in the rice
genome.
Transposable DNA elements are classified into three major
families, Ac/Ds, En/Spm, and Mu. Elements of the Mu family
share 210-bp terminal inverted repeats (TIRs) and are flanked
by direct repeats of a 9-bp sequence of the target site. These
elements have the highest transposition activity and exhibit a
low specificity of the target sequence (Bennetzen 1996). MuDR
(4,942 bp long) is an autonomous element with two coding
regions, mudrA and mudrB, that encode proteins MURA and
MURB of 823 and 207 amino acid residues, respectively
(Hershberger et al 1995). MURA is a transposase and specifically
binds to the sequences within TIRs.
Tnr2 is a 147-bp insertion sequence found within a member
of the rice retroposon p-SINE1 (Mochizuki et al 1992). It
appears to be a transposable element because it has TIR sequences
about 56 bp long, and a target site duplication (TSD)
of a 9-bp sequence is seen in the regions flanking Tnr2. Tnr2
is thought to be a nonautonomous element because of its small
size. Several hundred copies of Tnr2 members have been identified
in the Oryza sativa genome. Among these Tnr2 members,
we found an exceptionally large one with homology to
the sequence of mudrA of MuDR. In this study, we report that
the mudrA-like region of Tnr2 was transcribed, which suggested
that the large Tnr2 member is a Mu-like autonomous
element of rice.
Materials and methods
Total genomic DNA was extracted from shoots of Oryza sativa
cv. Nipponbare and Oc-cultured cells treated with or without
0.3 mM 5-azacytidine, as described previously (Ohtsubo
et al 1997). Total RNA was extracted by acidic phenol and
RNaid Matrix (BIO 101).
Reverse transcription-polymerase chain reaction (RT-
PCR) was performed using primers, which hybridize to exons
3 and 4, and using total RNA (about 1 µg) as the template, as
described previously (Kumekawa et al 1999). The RACE-PCR
was done by a standard RACE protocol starting with 2 µg of
total RNA (Frohman et al 1988). The PCR-amplified cDNA
fragments were cloned into a vector plasmid (pGEM-T easy;
Promega). Nucleotide sequencing was carried out using an ABI
PRISM Dye Terminator Cycle Sequencing FS Core kit (PE
Applied Biosystems) and analyzed in an ABI 377 DNA sequencer.
Results and discussion
Expression of Tnr2 in the rice plant
and cultured cells
Tnr2 is a 147-bp nonautonomous transposable element present
in the O. sativa genome. Among the Tnr2 members, we found
an exceptionally large member with homology to mudrA, the
transposase gene encoded by the maize transposable element
MuDR. We examined the expression of the mudrA-like region
in Tnr2 in shoots of rice cv. Nipponbare and Oc-cultured cells
by RT-PCR and by 5′- and 3′-RACE, and found that Tnr2 was
expressed (Figs. 1 and 2). The expression of Tnr2 was also
examined in Oc cells treated with 5-azacytidine (azaC), which
eventually resulted in hypomethylation of genomic DNA
methyltransferase (Santi et al 1983, Jones 1984, 1985). The
amount of Tnr2 transcripts, however, was not increased by the
azaC treatment (data not shown). This suggested that the expression
of Tnr2 transposase is not epigenetically regulated
by DNA methylation, unlike the case of the Mu element (Brown
et al 1994).
Structural analysis of transcripts from Tnr2
Cloning and sequencing cDNAs obtained by RT-PCR and 5′-
RACE revealed that the number of introns in Tnr2 mudrA and
their positions differed from those in MuDR (Fig. 1). Exons 2
and 3 of Tnr2 mudrA were highly homologous to MuDR
mudrA, but not other exons. Interestingly, a few transcripts
existed that appeared to be produced by alternative splicing
(Fig. 3).
Cloning and sequencing cDNAs obtained by 3′-RACE
revealed the existence of multiple polyadenylation sites for
transcriptional termination within a 200-bp region. This region
included polyadenylation signals and direct repeats of a
sequence with a length ranging from 12 to 42 bp (Fig. 4A).
400 Advances in rice genetics

MuDR
mudrA
5′->3′ : Initiation codon : Termination codon
Frame 3
Frame 2
Frame 1
1001 2001 3001 4001
Exon 1 Exon 2 Exon 3 Exon 4
Tnr2
Exon 1 Exon 2 Exon 3 Exon 4 Exon 5
5′->3′ : Initiation codon : Termination codon
Frame 3
1001 2001 3001 4001 5001
Frame 2
Frame 1
Fig. 1. Structures of MuDR and
Tnr2. The shaded boxes in open
reading frames represent the coding
regions of mudrA. Exons of
mudrA are indicated by open and
closed boxes.
kb
23.1
9.4
6.5
4.3
M
Genomic
DNA
Nipponbare
plant RNA
Oc cells
RNA
+ – + –
RT
2.3
2.0
0.56
Fig. 2. An agarose gel (1.2%) showing
the amplified fragments by RT-
PCR. M = HindIII digests of phage
lambda; RT = treated with (+) or without
(–) reverse transcriptase.
Gene isolation and function 401

I
II
III
1 1001 2001 3001 4001 5001
1 2 3 4
A1
A2
Tnr2
IV
A3
mRNA Intron Splice junction sequences Features
I 1 TG GTAAGTTC GTCAG GAT –
2 GG GTATTATA TGCAG GTC –
3 AG GTTAGTTC TGCAG GAA –
4 AG GTAAGGCA GACAG GAG –
II A1 – No splicing of intron 1
III A2 TG GTAAGTTC TGCAG ATC Alternative splicing
IV A3 TG GTAAGTGG TGCAG TTC Alternative splicing
Fig. 3. Schematic representations of
transcripts and sequences at splicing
junctions. Transcripts include those produced
by alternative splicing.
A
Tnr2 mudrA
1 1001 2001 3001 4001 5001
Poly(A) signal
B
2800 3200 3600 2800 3200 3600
400
800
400
1st (horizontal): Tnr2
2nd (vertical): 3′-RACE product (Tnr2)
1st: Tnr2
2nd: 3′-RACE product (Tnr2 homolog)
Fig. 4. (A) The 3′-untranslated region
of Tnr2. An expanded view of
the 3′-untranslated region shows
several kinds of direct repeats
around transcription termination
sites. Positions of
polyadenylation (polyA) signals
are shown. (B) Dot matrices between
Tnr2 nucleotide sequence
and each of the two 3′-RACE products
from Tnr2 (left) and a Tnr2
homolog (right). Dots are placed
at locations with identical nucleotides
when more than 14 of 20
nucleotides are identical.
402 Advances in rice genetics

Presence of a transcript with homology to Tnr2
Cloning and sequencing cDNAs obtained by 3′-RACE also
revealed a transcript showing about 60% homology to Tnr2
(Fig. 4B). This suggested the existence of a Tnr2 homolog, an
autonomous element that is transcribed as is Tnr2. A computer-assisted
homology search of databases revealed many
other sequences with high homology to mudrA of Tnr2 in the
rice genome. Some of these Tnr2 homologs may also be autonomous
elements in the rice genome.
References
Bennetzen JL. 1996. The Mutator transposable element system of
maize. In: Saedler H, Gierl A, editors. Transposable elements.
New York: Springer-Verlag. p 195-229.
Brown WE, Springer PS, Bennetzen JL. 1994. Progressive modification
of Mu transposable elements during development.
Maydica 39:119-126.
Frohman MA, Dush MK, Martin GR. 1988. Rapid production of
full-length cDNAs from rare transcripts: amplification using
a single gene-specific oligonucleotide primer. Proc. Natl. Acad.
Sci. USA 85:8998-9002.
Hershberger RJ, Benito MI, Hardeman KJ, Warren C, Chandler VL,
Walbot V. 1995. Characterization of the major transcripts encoded
by the regulatory MuDR transposable element of maize.
Genetics 140:1087-1098.
Kumekawa N, Ohtsubo H, Horiuchi T, Ohtsubo E. 1999. Identification
and characterization of novel retrotransposons of the
gypsy type in rice. Mol. Gen. Genet. 260:593-602.
Ohtsubo H, Umeda M, Ohtsubo E. 1997. Organization of DNA sequences
highly repeated in tandem in rice genomes. Jpn. J.
Genet. 66:241-254.
Notes
Authors’ address: Institute of Molecular and Cellular Biosciences,
University of Tokyo, Bunkyo-ku, Tokyo 113-0032, Japan.
Phone: 81-3-5841-7852, fax: 81-3-5841-8484, e-mail:
eohtsubo@ims.u-tokyo.ac.jp.
Acknowledgments: We thank our colleague Dr. Y. Sekine for critically
reading the manuscript. This work was supported by a
Grant-in-Aid for Scientific Research from the Ministry of
Education, Science, Sports, and Culture of Japan, and by a
grant from the Ministry of Agriculture, Forestry, and Fisheries
of Japan.
Chloroplast targeting signal regulates transgene
expression in rice
I.C. Jang, K.H. Lee, B.H. Nahm, and J.K. Kim
Previously, we reported that the presence of the rbcS transit peptide (Tp) sequence as a plastid-targeting signal led to a greatly
enhanced accumulation of transgene products in transgenic rice plants. To study the mechanisms underlying the regulation of
transgene expression by the Tp sequence, we mutated the sequence (mTp) in such a way that it can no longer localize fused
heterologous proteins into plastids but it can retain the nucleotide sequence identical to that of its wild type. The mTp was
fused to the synthetic gene (sgfp) encoding a modified form of the green fluorescent protein (sGFP) and linked to the rice rbcS
promoter, resulting in an expression vector, rbcS-mTp-sgfp. To compare the expression levels in transgenic plants, two expression
vectors, rbcS-sgfp for an untargeted expression and rbcS-Tp-sgfp for a chloroplast-targeted expression, were constructed.
Several transgenic plants were produced for each construct by the Agrobacterium-mediated method. Nineteen transgenic lines
that are resistant to the Basta herbicide were analyzed by genomic Southern and Northern blot analyses, indicating that
transgene copy numbers ranged from one to four and the mRNA levels are very different, depending on the type of Tp sequence
employed. Transcript levels of rbcS-Tp-sgfp-transformed lines were significantly higher than those of either rbcS-mTp-sgfp- or
rbcS-sgfp-transformed lines, whereas levels of the last two were comparable. These results suggest that the rbcS transit
peptide sequence increases the accumulation of transgene products by sequestering gene products in chloroplasts, which also
increases mRNA levels significantly.
The majority of chloroplast proteins are nuclear-encoded and
synthesized as precursors on cytosolic ribosomes. Proteins
destined to the chloroplasts generally have an amino-terminal
extension known as a transit peptide (Tp) that makes them
localized into the organelles. A large number of Tp sequences
have been reported, and their amino acid sequences show little
homology at the levels of primary and secondary structure.
Ribulose bisphosphate carboxylase/oxygenase (Rubisco) is the
most abundant protein in the leaves of light-grown plants. The
rice rbcS gene was previously cloned and characterized
(Kyozuka et al 1993). It was predicted that removal of an N-
terminal Tp by putative cleavage between the Cys (residue
47) and Met (residue 48) of the rbcS precusor would yield a
mature rbcS protein. Recently, we reported that the Tp is correctly
cleaved between the Cys and Met from the Tp-sgfp fusion
protein during transport to chloroplasts of transgenic rice
plants (Jang et al 1999).
Some reports indicate that sequestering of the heterologous
proteins to chloroplasts by Tp sequences enhanced expression
levels (Jang et al 1999). Several studies of Tps dem-
Gene isolation and function 403

onstrated that processing of mutants in either the amino terminal
or central portion of the Tp appeared normal, but a deletion
mutation at the carboxyl-terminal interfered with both
transport and processing (Kindle and Lawrence 1998, Reiss et
al 1987). We mutated the sequence, altering nearly all the amino
acids of the Tp. The wild-type and the mutant Tp sequence,
together with the rice rbcS promoter, were linked to the sgfp
gene and transformed into rice. Several transgenic lines for
each construct were produced and the expression levels of sgfp
were analyzed and compared at transcript and protein levels.
Materials and methods
Construction of the plasmid pSB-RTG and its features are described
elsewhere (Jang et al 1999). The modified Tp sequence
(mTp) was PCR-amplified, inducing a frame-shift mutation
using upstream primer 5′-AGCTGCAGAGATGGGCCCCCT
CCGT-3′ that inserts the underlined G, downstream primer 5′-
CACCATGGCCTGC-TGCACCTGATCCTG-3′ that deletes
A, and the plasmid pSK-RTG (Jang et al 1999) as a template.
PCR-amplified DNA was digested with PstI and NcoI, ligated
with PstI/NcoI-linearized pSK-RG containing the rbcS promoter
linked to the sgfp gene, producing the plasmid pSK-
RmTG. The 2.2-kb DNA fragment containing the rbcS-Tpsgfp
was obtained by digestion with BamHI and NotI, and ligated
into BamHI/NotI-linearized pSB105, which contains the
potato protease inhibitor II terminator/35S promoter/bar/
nopaline synthase terminator in between the right- and leftborder
sequence of pSB11.
Transformation was carried out according to the procedure
of Hiei et al (1994), except for adding 7 mg L –1 and 4 mg
L –1 of phosphinotricin to the selection and the regeneration
medium, respectively. Genomic DNA was isolated from greenhouse-grown
leaves of transgenic rice plants. Southern hybridization
was carried out following standard procedures.
Total RNA was isolated from leaf tissues of transgenic
rice plants by the guanidium/LiCl method. Ten µg of total RNA
was denatured in the presence of 50% formamide, 2.2 M formaldehyde,
20 mM 3-(N-morpholino) propanesulfonic acid
(MOPS), and 0.5 mM EDTA for 5 min at 70 °C. The RNA
was electrophoresed on 1% formaldehyde-agarose gel and blotted
onto a Hybond N + nylon membrane. Hybridization, probe
DNA, and washing conditions were identical to those for Southern
hybridization. The band intensity that is exposed onto the
intensifying plate was quantified using the phospho-image
analyzer.
Results
Construction of plant expression vectors
To study the mechanisms underlying the regulation of transgene
expression by the Tp sequence, we mutated the sequence (mTp)
in such a way that it no longer localizes fused heterologous
proteins into plastids but retains the nucleotide sequence that
is nearly identical to that of its wild type. This was done by
inserting a nucleotide G right after the ATG translational initiation
codon sequence and by deleting a nucleotide T that
was a part of the Met codon sequence at position 48 (Jang et al
1999). This resulted in a frame shift between the initiation
codon and the Tp cleavage site. The amino acid sequence of
mTp is not very different from that of its wild type in terms of
hydrophobicity. The mTp was fused to the synthetic gene (sgfp)
encoding a modified form of the green fluorescent protein
(sGFP) and linked to the rice rbcS promoter, resulting in an
expression vector, pSB-RmTG (rbcS-mTp-sgfp). The regions
spanning the junction between mTp and sgfp were sequenced.
To compare the expression levels in transgenic plants, two other
expression vectors, pSB-RG (rbcS-sgfp) for an untargeted
expression and pSB-RTG (rbcS-Tp-sgfp) for a chloroplast-targeted
expression, were constructed. The three plasmids contain
the bar gene as a selectable marker for transformation
under the control of the CaMV 35S promoter.
Production and genomic DNA analysis
of transgenic rice plants
Fifty-eight independent lines (35 for rbcS-sgfp, 11 for rbcS-
Tp-sgfp, and 12 for rbcS-mTp-sgfp) of transgenic rice plants
were obtained. All transformants were first tested for herbicide
resistance by treating with 0.5% commercial herbicide
Basta. To examine the copy number and integration event of
the transgenes in their genomes, 12 herbicide-resistant plants
were randomly chosen and their genomic DNA extracted. The
genomic DNA from rbcS-sgfp-transformed plants was digested
either with XbaI, which excised the intact size of sgfp, or with
SpeI, which cut only one site of the plasmid. The 0.7-kb fragment
corresponding to “XbaI digest” appeared in all the
transformants, indicating that they contained the functional sgfp
gene. The rbcS-sgfp-transformed lines (Fig. 1A) showed distinct
band patterns, suggesting that each line was produced by
an independent integration event. Similarly, the genomic DNA
from rbcS-Tp-sgfp- or rbcS-mTp-sgfp-transformed plants was
digested either with PstI, which excised the full-length sgfp-
Tp plus PinII terminator, or with KpnI having a unique site on
its T-DNA. The 1.8-kb fragment corresponding to “PstI digest”
appeared in all the transformants and each line was produced
by an independent integration event (Fig. 1B, 1C).
Comparison of expression levels in transgenic plants
To examine the expression levels of the transgene, Northern
blot analysis was performed using total RNA from leaf tissues
and the sgfp gene as a probe. As shown in Figure 2A, the sgfp
transcripts were expressed in all the rbcS-, rbcS-Tp-, and rbcSmTp-transformed
lines. The sgfp expression levels in mature
leaves of rbcS-Tp-transformed lines were much higher than
those of rbcS-mTp-transformed lines, whereas the levels of
rbcS-mTp-sgfp- and rbcS-sgfp-transformed lines were comparable
(Fig. 2B). Levels of sGFP protein accumulation were
also compared among the transgenic lines by western blot
analysis (data not shown), indicating a pattern of variation similar
to that of the transcript levels. The wild-type Tp sequence
increased expression levels eight- to tenfold when compared
with the rbcS promoter itself or mTp (Fig. 2B). These results
404 Advances in rice genetics

A
rbcS
rbcS-Tp
rbcS-mTp
B C
PC NC 1 2 3 4 5 6
PC NC 1 2
PC NC 1 2 3 4
kb M 5X 3X 1X X X Sp X Sp X Sp X Sp X Sp XSp M 5X3X1X P P K P K M 5X 3X 1X P P K P K P K P K
23.1
9.4
6.5
4.3
2.3
2.0
0.5
Fig. 1. (A) Genomic DNA from the leaf tissues of rbcS-sgfp-transformed plants (1–6) was digested with
XbaI (X) and SpeI (Sp) and hybridized with an α- 32 P-labeled 0.7-kb DNA fragment containing the sgfp
coding region. PC contains XbaI-digested rbcS-sgfp. (B) Genomic DNA from the leaf tissues of rbcS-Tpsgfp-transformed
plants (1–2) was digested with PstI (P) and KpnI (K) and hybridized. PC contains PstIdigested
rbcS-Tp-sgfp. (C) Genomic DNA from the leaf tissues of rbcS-mTp-sgfp-transformed plants
(1–4) was digested with PstI (P) and KpnI (K) and hybridized. PC contains PstI-digested pSB-Rm-RmTG.
NC = genomic DNA from an untransformed control plant; 1X, 3X, and 5X in PC represent 1, 3, and 5
genome equivalents of rbcS-sgfp (A), rbcS-Tp-sgfp (B), or rbcS-mTp-sgfp (C) relative to 5 µg of rice
genomic DNA, respectively. The DNA molecular size markers (M) are indicated on the left-hand side.
A
rbcS rbcS-Tp rbcS-mTp
NC 1 2 3 4 5 6 1 2 1 2 3 4
sgfp
Control
B
Relative band intensity
1,400
1,200
1,000
800
600
400
200
0
C
rbcS1
rbcS2
rbcS3
rbcS4
rbcS5
rbcS6
rbcS-Tp1
rbcS-Tp2
rbcSmTp1
rbcSmTp2
rbcSmTp3
rbcSmTp4
Fig. 2. RNA gel-blot analysis and relative levels of sgfp transcripts in rbcS-sgfp-, rbcS-Tp-sgfp-, and rbcSmTp-sgfp-transformed
rice plants, respectively. Ethidium bromide (EtBr)-staining of total RNA was used as
a control for equal RNA loading. (A) Total RNA from leaf tissues of rbcS-sgfp (rbcS1-6), rbcS-Tp-sgfp (rbcS-
Tp1-2), and rbcS-mTp-sgfp (rbcS-mTp1-4) and from an untransformed control plant (C) was hybridized with
an α- 32 P-labeled 0.7-kb DNA fragment containing the sgfp coding region. (B) Relative transcript levels of
sgfp. The probed membrane in A was exposed onto the intensifying plate and detected by a phospho-image
analyzer (FLA 3000, Fuji) and relative band intensity was calculated using rbcS6 as a reference.
Gene isolation and function 405

suggest that sequestering of gene products in chloroplasts by
the Tp sequence increases transcript and protein accumulation
levels significantly.
Discussion
We observed previously the fusion of the rbcS promoter and
its Tp sequence to sgfp-produced plants, which expressed sgfp
of about 10% of the total soluble protein in mature leaf tissues
(Jang et al 1999). In this study, we mutated the rbcS Tp sequence
(mTp) such that it no longer transports sGFP into chloroplasts.
Transit peptide sequences are generally rich in basic
and hydroxylated amino acids and lack polar amino acids. Our
mTp is more basic than the wild-type Tp, but it has similar
hydrophobicity. The cleavage site region between the Cys47
and Met48 of the rbcS precursor (Kyozuka et al 1993) was
substituted for the Val47 and Gln48 in the mTp. Three expression
vectors, rbcS-sgfp and rbcS-mTp-sgfp for an untargeted
expression and rbcS-Tp-sgfp for a chloroplast-targeted expression,
were constructed and introduced into rice and the mTp
compared with its wild type for influence on a fused transgene
expression at transcript levels. The wild-type Tp sequence
(rbcS-Tp-sgfp) increased expression levels much more than
did the rbcS promoter itself (rbcS-sgfp) or mTp (rbcS-mTpsgfp).
These results prompt us to conclude that sequestering
of gene products in chloroplasts by the Tp sequence increases
transcript levels. We barely detected sGFP protein in leaves of
rbcS-mTp-sgfp-transformed lines using immunoblot analysis
(data not shown). We believe that mTp-sGFP protein became
unstable because of the presence of mTp and was degraded
rapidly by cytosolic protease. The context of the translation
initiation codon can also affect the rate of translation of mRNA
in plants (Helliwell and Gray 1995). The authors found that
the G at +4 is important for determining rates of translation
initiation. Although the mTp contains one additional G in the
sequence-flanking translation initiation, the G at the +4 position
remains the same as in its wild type.
References
Helliwell CA, Gray JC. 1995. The sequence surrounding the translation
initiation codon of the pea plastocyanin gene increases
translational efficiency of a reporter gene. Plant Mol. Biol.
29:621-626.
Hiei Y, Ohta S, Komari T, Kumashiro T. 1994. Efficient transformation
of rice (Oryza sativa L.) mediated by Agrobacterium and
sequence analysis of the boundaries of the T-DNA. Plant J.
6:271-282.
Jang I-C, Nahm BH, Kim J-K. 1999. Subcellular targeting of green
fluorescent protein to plastids in transgenic rice plants provides
a high-level expression system. Mol. Breed. 5:453-461.
Kindle KL, Lawrence SD. 1998. Transit peptide mutations that impair
in vitro and in vivo chloroplast protein import do not
affect accumulation of the α-subunit of chloroplast ATPase.
Plant Physiol. 116:1179-1190.
Kyozuka J, McElroy D, Hayakawa T, Xie Y, Wu R, Shimamoto K.
1993. Light-regulated and cell-specific expression of tomato
rbcS-gusA and rice rbcS-gusA fusion gene in transgenic rice.
Plant Physiol. 102:991-1000.
Reiss B, Wasmann CC, Bohnert HJ. 1987. Regions in the transit
peptide of SSU essential for transport into chloroplasts. Mol.
Gen. Genet. 209:116-121.
Notes
Authors’ address: Department of Biological Science, Myongji University,
Yongin 449-728, Korea.
Isolation and functional characterization
of the DREB family of genes in rice
J.G. Dubouzet, Y. Sakuma, E.G. Dubouzet, S. Miura, K. Yamaguchi-Shinozaki, and K. Shinozaki
The DREB gene family of transcription factors in Arabidopsis thaliana has been shown to play a key role in orchestrating the
plant’s response to stress factors such as cold, drought, and salinity. Cloning of similar genes in rice may be a prerequisite for
developing superior transgenic cultivars that can withstand or thrive in adverse environments. Here we report the characteristics
of the corresponding DREB homologues in rice, Os (Oryza sativa) DREB1A, 1B, 1G1, and OsDREB2. OsDREB1A, like
DREB1A, is up-regulated in plants exposed to cold. Unlike DREB1A, OsDREB1A is sensitive to salt and wound stress. Similar
to DREB2A, OsDREB2 is induced by drought and salinity but not by cold exposure. Both OsDREBs specifically bind the DRE/CRT
motif in the rd29 promoter. Based on GUS/LUC data produced in a rice protoplast assay, OsDREB1A is better than OsDREB2
in transactivating genes containing the DRE motif in their promoter regions. The OsDREB genes in this report may play an
important role in the production of superior transgenic rice plants that are resistant to multiple-stress environments.
406 Advances in rice genetics

Rice production is limited by abiotic stress factors such as cold,
drought, and salinity. Areas now under rice cultivation are often
beset by weather fluctuations such as cold or dry spells.
Hence, rice varieties that can withstand the vagaries of weather
can help stabilize production. Rice varieties that can be cultivated
in adverse environments will reduce the pressure to deforest
new areas for cultivation.
In Arabidopsis, Liu et al (1998) demonstrated the feasibility
of improving the plant’s ability to withstand extreme
abiotic stress by constitutive expression of a gene for a stressresponsive
transcription factor known as DREB1A. DREB1A,
B, and C and DREB2A and B belong to a large gene family of
DNA-binding proteins that contain a conserved region known
as the ethylene responsive factor/Apetala 2 (ERF/AP2) protein
domain in Arabidopsis. These DREBs produce proteins
that specifically bind to and activate genes containing a cisacting
element known as the dehydration responsive element/
C-repeat (DRE/CRT) motif with the core sequence PuCCGAC
(Liu et al 1998). This motif is involved in the rapid response
of Arabidopsis to drought, low-temperature, or high-salt stress
(Yamaguchi-Shinozaki and Shinozaki 1994). Combining
DREB1A with a DRE-containing, stress-responsive promoter
in transgenic Arabidopsis plants resulted in improved tolerance
for drought, salinity, and freezing (Kasuga et al 1999).
We report the isolation and characterization of stressinducible,
full-length cDNAs from rice that are homologous
to the DREBs.
Materials and methods
cDNA libraries were constructed from 17-d-old rice seedlings
that had been exposed to salt, cold, or drought stress. Homologues
to the DREBs were identified by using the BLAST program
to scan the rice sequence database. Probes were obtained
from the conserved N terminal and ERF/AP2 regions of these
homologues. Probing the cDNA libraries led to the isolation
of two DREB-type genes, OsDREB1A and OsDREB2. A third
cDNA clone, OsDREB1B, was recently obtained from the Rice
Genome Project (RGP, Japan).
Specific probes for each gene were produced from their
C terminals. RNA was prepared using the protocols described
by Yamaguchi-Shinozaki et al (1989). RNA gel blots were prepared
from rice seedlings that were exposed to cold (4 o C),
drought (air drying), or salinity (250 mM NaCl) stress for 20
min or 24 h. GST-fusion proteins were produced using the
protocol of Urao et al (1993) to evaluate binding specificity of
the OsDREB proteins to the DRE element in the promoter region
of the rd29A gene from Arabidopsis. Trans activity in
rice protoplasts was assayed by cotransforming a GUS reporter
gene fused to two copies of the minimal promoter region of
rd29A (containing the DRE motif) and effector plasmid constructs
of DREB1A, DREB2A, OsDREB1A, or OsDREB2. A
luciferase gene fused to a ubiquitin promoter was
cotransformed to serve as an internal control and to normalize
GUS values. This transcription assay basically followed the
procedures described by Hobo et al (1999).
Results and discussion
OsDREB1G1 encompasses a region in rice chromosome 6
whose putative protein translation is homologous to DREB1A
of A. thaliana. A truncated fragment of OsDREB1G1 was
amplified by polymerase chain reaction (PCR) and used to
screen cDNA libraries constructed from cold- and salt-stressed
3-wk-old rice plants as a probe, but only OsDREB1A was isolated.
A truncated expressed sequence tag (EST) (d38911) was
identified by BLAST as homologous to DREB2 and the fulllength
sequence (labeled as OsDREB2) was obtained by
screening a drought-stressed cDNA library and by PCR amplification
of the missing N terminus. The GC-rich OsDREB1B
was obtained by the RGP from a cDNA library constructed
from immature rice panicles.
OsDREB1A, OsDREB1B, and OsDREB1G1 showed
extensive similarity to DREB1A, especially in a portion of
their N terminal regions and in their ERF/AP2 domains (Fig.
1). The putative amino acid sequences of DREB2A and
OsDREB2 also showed extensive similarity in their N terminal
regions and ERF/AP2 domains. These extended conserved
regions imply that these genes have a fundamental role in plant
stress metabolism. The conserved N terminal sections of
DREB1A, OsDREB1A, and DREB2A may correspond to
nuclear-localizing signals in these genes.
The DREB1 family has three homologues in one contiguous
locus, whereas DREB2A and DREB2B are found in
separate chromosomes in Arabidopsis (Nakashima et al 2000).
Southern blot data suggest that OsDREB1A, 1B, and 1G1 and
OsDREB2 are probably unlinked single-copy genes (data not
shown). Northern hybridization of OsDREB1A revealed that
it is up-regulated by cold and salt stress (Fig. 2A). OsDREB1A
is also transiently activated by wounding (data not shown). Its
sensitivity to cold exposure, salt stress, or wounding makes it
more similar to DREB1C than to DREB1A. Like DREB1A,
OsDREB1B is up-regulated by cold. OsDREB1G1 failed to
hybridize with the RNA blots, indicating that it is not present
in 17-d-old rice seedlings. It may be epigenetically controlled
or it could be a pseudogene. Like DREB2A, OsDREB2 is upregulated
by drought or salinity stress.
In Arabidopsis, DREB proteins bind to DRE/CRT motifs
in the promoter regions of stress-responsive genes, thus
enhancing transcription. The gel-shift assay revealed that
OsDREB1A and OsDREB2 specifically bind to the DRE motif
found in the promoter region of the stress-responsive rd29A
gene of Arabidopsis (data not shown). Constitutive expression
of such stress-responsive genes by transgenic Arabidopsis
overexpressing DREB1A has been shown to improve stress
tolerance. Preliminary results from transient activation of an
rd29A promoter-GUS fusion reporter construct indicate that
OsDREB1A and, to a lesser extent, OsDREB2 up-regulate the
transcription of the GUS reporter gene, presumably by binding
to the DRE motif in the rd29A promoter. BLAST search
has revealed many putative genes with plausible DRE/CRT
motifs in their promoter regions.
Gene isolation and function 407

A
Protein domain
N terminal ERF/AP2 C terminal
38.8% 55.9% 19.9% similarity
OsDREB1G1
36.7% 68.3% 31.0% similarity
Positively charged
OsDREB1B
38.8%
Negatively charged
Positively charged
80
34.1% similarity
OsDREB1A
240
DREB1A
160
B
N terminal ERF/AP2 C terminal
51.8% 82.5% 24.5% similarity
Nuclear localizing
signal
OsDREB2
DREB2
100 200 300
Fig.1. (A) Structural comparison
of DREB1-type
proteins. (B) Structural
comparison of DREB2-
type proteins.
A
Water
20 min Water
24 h
ABA
20 min 24 ABA
h
Dry
20 min 24 Dry
h
Cold
20 min 24 Cold
h
NaCl
20 min 24 NaCl
h
We are now implementing research to identify OsDREB
target genes in rice. In addition, experiments for the constitutive
production of OsDREBs in transgenic rice have begun.
B
Fig. 2. Northern hybridization of OsDREB1A (A) and OsDREB (B).
References
Hobo T, Kowyama Y, Hattori T. 1999. A bZIP factor, TRAB1, interacts
with VP1 and mediates abscisic acid-induced transcription.
Proc. Natl. Acad. Sci. USA 96:15348-15353.
Kasuga M, Liu Q, Miura S, Yamaguchi-Shinozaki K, Shinozaki K.
1999. Improving plant drought, salt and freezing tolerance by
gene transfer of a single stress-inducible transcription factor.
Nat. Biotechnol. 17:287-291.
Liu Q, Kasuga M, Sakuma Y, Abe H, Miura S, Yamaguchi-Shinozaki
K, Shinozaki K. 1998. Two transcription factors DREB1 and
DREB2 with an EREBP/AP2 DNA binding domain separate
408 Advances in rice genetics

two cellular signal transduction pathways in drought- and lowtemperature-responsive
gene expression respectively in
Arabidopsis. Plant Cell 10:1391-1406.
Nakashima K, Shinwari ZK, Sakuma Y, Seki M, Miura S, Shinozaki
K, Yamaguchi-Shinozaki K. 2000. Organization and expression
of two Arabidopsis DREB2 genes encoding DRE-binding
proteins involved in dehydration- and high-salinity-responsive
gene expression. Plant Mol. Biol. 42:657-665.
Urao T, Yamaguchi-Shinozaki K, Urao S, Shinozaki K. 1993. An
Arabidopsis myb homologue is induced by dehydration stress
and its gene product binds to the conserved MYB recognition
sequence. Plant Cell 5:1529-1539.
Yamaguchi-Shinozaki K, Mundy J, Chua NH. 1989. Four tightly
linked rab genes are differentially expressed in rice. Plant Mol.
Biol. 14:29-39.
Yamaguchi-Shinozaki K, Shinozaki K. 1994. A novel cis-acting element
in an Arabidopsis gene is involved in responsiveness
to drought, low-temperature, or high-salt stress. Plant Cell
6:251-264.
Notes
Authors’ addresses: J.G. Dubouzet, Y. Sakuma, E.G. Dubouzet, S.
Miura, K. Yamaguchi-Shinozaki, Japan International Research
Center for Agricultural Science (JIRCAS), Tsukuba 305-8686;
K. Shinozaki, Institute of Physical and Chemical Research,
Tsukuba 305-0074, Japan.
Characterization and expression of rice
monosaccharide transporter genes, OsMST1–3
K. Toyofuku, T. Takeda, J. Yamaguchi, and M. Kasahara
This is the first report describing the cloning of full-length cDNA clones and the characterization of the monosaccharide
transporter gene from rice. OsMST1–3 (Oryza sativa monosaccharide transporters 1–3) have 12 putative transmembrane
domains separated by a central long hydrophilic region. Heterologous expression of OsMST3 in the yeast Saccharomyces
cerevisiae indicated that OsMST3 has transport activity for some monosaccharides in an energy-dependent H + co-transport
manner. Northern blot and in situ hybridization analyses showed that OsMST3 mRNA is detectable in leaf blades, leaf sheaths,
calli, and roots, especially in the xylem, as well as in sclerenchyma cells in the roots. These results suggested that OsMST3 is
involved in accumulating monosaccharides required for cell-wall synthesis at the stage of cell-thickening.
We report on the cloning of the first cDNA clones of a monosaccharide
transporter gene from rice and the characterization of
the corresponding gene products by heterologous expression
in Saccharomyces cerevisiae. Furthermore, we have examined
their cell-specific expression in the root by in situ hybridization.
The putative amino acid sequences of OsMST1–3 were
31.5% to 57.7% identical. OsMST1, OsMST2, and OsMST3
were 517, 522, and 518 amino acids long, respectively, with a
calculated molecular weight of 56.9, 57.4, and 57.0 kDa, respectively.
The hydrophobicity profile revealed that OsMST1–
3 have two sets of putative six-transmembrane domains separated
by a central long hydrophilic region. This topological
pattern was consistent with those of sugar transporters in microbes,
mammals, and plants, and the motifs of the monosaccharide
transporter reported by Henderson et al (1992) were
highly conserved among rice (OsMST1–3), castor bean (HXT6),
Arabidopsis (STP1), and humans (GLUT1). Several copies of
the genes encode for the monosaccharide transporter and related
transporters in the rice genome and those rice monosaccharide
transporters comprise a multigene family.
To verify whether OsMST1–3 function as monosaccharide
transporters, cDNAs were subcloned in a GAL expression
vector and introduced into LBY416, a strain of S. cerevisiae
in which high-affinity glucose transport activity is kept low,
since three monosaccharide transporter-related genes, HXT2,
GAL2, and SNF3, have been disrupted. Subcloned cDNAs were
expressed under the control of the GAL2 promoter in the presence
of galactose. The addition of HgCl 2 as an SH-group inhibitor
completely abolished the transport activity. While
OsMST1 did not show any activity, the glucose transport activity
of OsMST2 and 3 was nearly two and three times higher
than the control activity, respectively. The cell with an empty
vector (control) showed a low level of glucose transport in the
absence of HgCl 2 , which was caused by minor sugar
transporter(s) as a background. Since OsMST3 had the most
intense activity, we used it for further characterization.
To estimate the energy-dependent active transport system
or facilitating system of OsMST3, we used D-glucose, D-
xylose, and 3-O-methyl glucose (3-OMG), the classical
nonmetabolizable substrate analog for glucose, as transport
substrates. D-glucose showed a 7-fold and 5-fold higher transport
activity (Fig. 1A) than D-xylose (Fig. 1B) and 3-OMG
(Fig. 1C), respectively. Energization uptake by added ethanol
occurred in D-xylose and 3-OMG as transport substrates (Fig.
1). The transport of D-xylose increased up to about 8-fold
compared with that of a vector, and adding ethanol resulted in
a further increase in transport of D-xylose to about 10-fold.
Ethanol seemed to serve as an electron donor of the electrogenic
transmembrane transport of monosaccharides when the
Gene isolation and function 409

Transport (pmol 10 –7 )
800
A OsMST3 (D-glucose)
700
600
500
400
300
200
100
0
0 1 3 5
250
200
150
100
50
C
OsMST3 (3-OMG)
0
0 1 3 5
250
200
150
100
50
B
OsMST3 (D-xylose)
100
0
0
0 1 3 5
0 1 3 5
Uptake time (min)
50
D
Addition of EtOH
No addition
Addition of HgCl 2
pTV3e (D-xylose)
Fig. 1. Transport of D-glucose,
D-xylose, and 3-OMG in yeast
cells possessing OsMST3 (A, B,
C) and D-xylose transport in
cells possessing vector only (D).
Transport in yeast cells with or
without additional energization
by 100 mM ethanol in yeast
cells in the presence or absence
of 0.5 mM HgCl 2 is shown.
applied substrate could not be metabolized by yeast itself. The
uptake level of D-xylose in pTV3e remained at a considerably
low level during the tracing period (5 min) either with or without
ethanol (Fig. 1D). The energization on the plasma membrane
of yeast cells was reversible when uncoupler carbonylcyanide-m-chlorophenyl-hydrazone
(CCCP) was applied (Fig.
2). These results suggested that D-xylose accumulated in the
cells was rapidly metabolized and the apparent amount of D-
xylose transported rapidly decreased as a result of the plasma
membrane being deenergized by CCCP. Because of the acceleration
by energization and the inhibition after addition of the
uncoupler, OsMST3 serves as an energy-dependent monosaccharide
transport system, possibly an H + symporter. According
to the classification of transporters in living cells by Pao et
al (1998), OsMST3 can be classified into the SP (sugar porter)
family in MFS (major facilitator superfamily), also called
the uniporter-symporter-antiporter family.
Northern blot analysis using total RNA from various rice
tissues was conducted to detect OsMST mRNAs. A weak signal
for OsMST3 was detected in the expanded leaf blade and
leaf sheath, whereas a relatively strong signal was detected in
suspension calli and roots (Fig. 3). In situ hybridization using
the OsMST3 antisense probe showed that OsMST3 was exclusively
expressed in sclerenchyma and xylem cells. The cells in
which OsMST3 was expressed seemed to be distinctly charac-
D-xylose transport (pmol 10 –7 )
200
175
150
125
100
75
50
25
0
5
EtOH
CCCP
1 3 5 7 9 14 17 21 25
Uptake time (min)
Fig. 2. Effects of ethanol and uncoupler (CCCP) on D-xylose transport
in yeast cells possessing OsMST3. The starting concentration
of D-xylose in the medium was 0.1 mM and the final concentration
of CCCP in the medium was 50 µM. Arrows indicate the
time of energization with ethanol (100 mM) and the addition of
CCCP.
410 Advances in rice genetics

Callus
Leaf blade
(growing)
Leaf blade
(expanded)
Leaf sheath
Root
Dry embryo
OsMST3
rRNA
Fig. 3. Northern blot analysis
of OsMST3 mRNA. Total RNA
(15 µg) of each sample was
electrophoresed on formaldehyde
gel and blotted onto nylon
membrane and then hybridized
with the radio-labeled
cDNA probe. After the wash,
the membrane was exposed
using a Fujix BAS2000 Bio-Imaging
Analyzer (Fuji Photo Film
Co., Ltd., Tokyo, Japan). Staining
with ethidium bromide is
shown in the rRNA panel.
teristic of the cell wall; namely, they were thickened cells with
lignified, secondary walls. It is commonly accepted that cellulose,
a simple polymerization of glucose, is synthesized by
UDP-glucose. These results suggested that OsMST3 facilitated
the accumulation of monosaccharides, being a substrate for
the formation of cellulose when lignins are synthesized in the
cell wall at the cell-thickening stage.
In yeast, two unusual glucose transporters appear to function
as low- and high-glucose sensors, respectively, that produce
an intracellular glucose signal (Özcan et al 1996). Sensor
systems similar to those in yeast probably exist in multicellular
organisms such as higher plants, which consist of
mosaics of autotrophic green and heterotrophic nongreen cells.
Further characterization is required to clarify the monosaccharide
transport systems in plants.
References
Henderson PJ, Baldwin SA, Cairns MT, Charalambous BM, Dent
HC, Gunn F, Liang W-J, Lucas VA, Martin GE, McDonald
TP, McKeown BJ, Muiry JAR, Petro KR, Roberts PE, Shatwell
KP, Smith G, Tate CG. 1992. Sugar-cation symport systems
in bacteria. Int. Rev. Cytol. 137A:149-208.
Özcan S, Dover J, Rosenwald AG, Wolfl S, Johnston M. 1996. Two
glucose transporters in Saccharomyces cerevisiae are glucose
sensors that generate a signal for induction of gene expression.
Proc. Natl. Acad. Sci. USA 93:12428-12432.
Pao SP, Paulsen IT, Saier MH Jr. 1998. Major facilitator superfamily.
Microbiol. Mol. Biol. Rev. 62:1-34.
Notes
Authors’ addresses: K. Toyofuku, T. Takeda, and J. Yamaguchi, Bioscience
Center and Graduate School of Bioagricultural Sciences,
Nagoya University, Chikusa, Nagoya 464-8601, Japan;
M. Kasahara, Laboratory of Biophysics, School of Medicine,
Teikyo University, Hachioji, Tokyo 192-0395, Japan. Email:
jjyama@agr.nagoya-u.ac.jp. Present address: Division of Biological
Sciences, Graduate School of Science, Hokkaido University,
Kita-ku N10-W8, Sapporo 060-0810, Japan.
Functional analysis of R2R3-Myb genes in rice
J.W. Lee, S.K. Sung, S.K. Yi, and G. An
MYB proteins are transcription factors that contain a domain structurally and functionally related to the DNA binding domain of
the oncogene c-myb. MYB proteins in plants have two related helix-turn-helix motifs, the R2 and R3 repeats. To investigate the
roles of R2R3-Myb genes in rice, we have carried out polymerase chain reaction using R2R3 degenerate primers in cDNA
libraries made from young flowers, mature flowers, and seed coats. We isolated 35 partial cDNA clones of R2R3-Myb genes.
We chose 12 of these clones for further study. Antisense transgenic rice plants were produced to study the function of R2R3-
Myb genes.
Gene isolation and function 411

A
5¢ R2 R3 3¢
B
Forward primer
R2
..+G#WT.eED..L#.Y#..hG.G.W..##+.aGL.R cgKSCLRW#NyLrp.
Forward primer
R3
#+rG.#t..E–.#li.Lh..IG N+Ws.iA..IPgRTDNeiKNyWnt+#.++
Fig. 1. (A) Schematic diagram of plant R2R3-Myb
genes. (B) Consensus amino acid sequence of the
two repeats of plant R2R3-MYB proteins as described
previously (Romero et al 1998). Upper-case
letters indicate residues fully conserved in all proteins
used to derive the consensus. Lower-case
letters indicate residues identical in at least 80%
of the proteins. Other symbols are: + = basic
amino acid; – = acidic amino acid; # = hydrophobic
amino acid; R = A+G; Y = C+T; S = C+G; D =
A+G+T; N = A+G+T+G.
Plant transcription factors contain a variety of structural motifs
that allow for binding to specific DNA sequences. For example,
MYB proteins contain a specific type of the helix-turnhelix
motif of about 50 amino acids, which serves as the DNAbinding
domain. The DNA-binding domain of plant MYB proteins
is formed by imperfect repeats, R2 and R3, which are
similar to the animal c-MYB proteins (Rosinski and Atchley
1998).
In Arabidopsis, more than 100 genes in the R2R3-Myb
family have already been identified (Kranz et al 1998, Romero
et al 1998). Plant MYB proteins play important roles in controlling
the cell cycle, cell differentiation, hormone responses,
germination, and regulation of secondary metabolism. In rice,
however, only a few Myb genes have been characterized so far
(Suzuki et al 1997, Locatelli et al 2000). To understand the
roles of Myb genes in rice, we have isolated 35 Myb genes
from rice flowers and seed coats. We have constructed antisense
plants with 12 independent clones.
Results and discussion
Cloning of Myb genes from rice
To search for R2R3-Myb genes, partial clones of the Myb genes
were isolated from cDNA libraries made from young flowers,
mature flowers, and seed coats by PCR using the R2R3-Myb
degenerate oligonucleotides described previously (Fig. 1,
Romero et al 1998). Forward primers were 5′CGGAATTCD
(A,G)(G,A,T,C)AA(A,G)AG(C,T)TG(C,T)AG3′ ,
5′CGGAATTC(A,G,T)(A, G)(G,A,T,C)AA(A,G)AG(C,T)TG
(C,T)CG3′,5′CGGAATTC(A,G,T)(A,G)(G,A,T,C)AA(A,G)TC
(G,A,T,C)TG(C,T)AG3′, 5′CGGAATTC(A,G,T)(A,G)
(G,A,T,C)AA(A,G)TC(G,A,T,C)TG(C,T)CG3′ ,
5′CCCGGGTG(C,T)GG(G,A,T,C)AA(A,G)TC(G,A,T,C)TG3′,
and 5′GGAATTCTG (C,T)GG(G,A,T,C)AA(A,G)AG(C,T)
TG3′. The reverse primers were 3′TG(G,A,T,C)CT(A,G)
TT(A,G)CG(G,A,T,C)(C,T)A(G,A,T,C)TT
CTTAAGGC5′ ,3′ TG(G,A,T,C)CT(A,G)TT(A,G)
CT(C,T)TA(A,G,T)TTCTTAAGGC5′, and 3′TG(G,A,T,C)
CT(A,G)TT(A,G)(A,G)T(G,A,T,C)(C,T) A(G,A,T,C)
TTCTTAAGGC5′.
Sequencing of these clones resulted in the identification
of 35 clones that contained partial (average 223 bp) cDNAs of
R2R3-Myb genes. Some clones shared a significant homology
to each other (amino acid sequence identity >95%), and others
were significantly different when amino acid sequences
were compared. These clones can be classified into 16 independent
genes (Fig. 1). Comparison of the deduced amino acid
sequences of these clones revealed that a 50–80% homology
existed among these proteins.
Phylogenetic analysis of R2R3-MYB proteins
A computer search of DDBJ databases resulted in identification
of 56 rice Myb expressed sequence tag (EST) clones from
calli, roots, seedlings, and flowers. Twenty-six of these EST
clones were found to be redundant (nucleotide sequence identity
>95%). Therefore, there are 30 different Myb EST clones
in the databases. Eighteen of these clones contained the R2R3-
Myb domain. Of these clones, seven were identical to the Myb
clones isolated in this study. A phylogenetic tree of the R2R3-
MYB proteins was constructed with the UPGMA method using
the R2R3 conserved region sequences of the 27 R2R3-
MYB proteins (Fig. 2).
Among the16 independent Myb clones isolated from the
flowering stage, only seven were identical to preexisting ESTs.
Most of the EST clones in DDBJ databases were obtained from
vegetative tissues, whereas Myb clones have been isolated from
reproductive tissues.
Construction of binary vectors
and plant transformation
To study the roles of R2R3-Myb genes in rice, antisense binary
vectors were constructed using a binary vector, pGA1611,
that contains the maize ubiquitin promoter, including the first
intron of the gene. The R2R3-Myb clones were inserted into
the multiple cloning sites of the vector in an antisense orientation.
The genes were transferred into plant chromosomes by
the Agrobacterium-mediated transformation method. An average
of 10 plants were regenerated per independent clone. So
far, no phenotypic alterations have been observed in the
transgenic plants. A larger number of transgenic plants may
be needed to observe phenotypic changes brought about by
the antisense effects. Alternatively, the phenotype may be visible
only when the plants are exposed to a specific condition.
412 Advances in rice genetics

#17033 LRWI NYLRPG LKH G V FSP EEEETVMSLHAALGNK WSR IARHLPGR
#17032 LRXIIYLRPG LKXGV FSP EEXETVMSLHAALGXKWSX IARHLPGX
#17053 LRWI NYLRPG LKRGM FSQ EEEDIVI N L QAKLGNK WSQ IAMHLPGR
#17030 LRWA N H LRPN LKK G A F TAEEERLIIQ LHSKMGNK W ARMA AHLPGR
#17034 LRWM N H LRPN LKK G A FSK EEENKIIN LHRKMGNK WSRMA ADL QXR
#17057 LRWI NYLRPD LKRGA FSQ EEED LIIE LHAVLGNRWSQ IAAQLPGR
#17050 LRWI NYLRPD LKRGS FSQQEESLIIE LHRVLGNRWAQIAKHLPGR
#17028 LRWL NYLRPGIKRGNIS GDEEE LILRL RTLLGNRWSL IAGRLPGR
#17062 LRWL NYLRPGIKRGNIS GDEEE LILRLHTLLGNRWSL IAGRLPGR
#17039 LRWI NYLRPD LKRGN F TEEEDELIIK LHELLGNK WSL IAGRLPX R
#17037 LRWI NYLRPDIKRGN FSK EEEDTIIH LHELLGSGWSA IAARXPGR
#17029 LRWT NYLRPD LKRGLLTDAEEQLV I D LHAKLGNRWSK IAAKLPGR
#17055 LRWT NYLRPD LKRGLLTADEEQLVVDLHAKLGNRWSK IAAKLPGR
#17063 LRWL NYLRLDIK H G GYTDQE D R I ICS L YNSIG S RWSI IASKLPGR
#17059 LRWL NYLRPGVRRGSITPEED M V IRE LHSRWGNRWSK IAKHLPGR
#17052 LRWC N Q L S P QVEHRPF TPEEDDTILRAH ARFGNK W ATIARLL A GR
Consensus LRW. N y L rp.#++g.#...E ...##.lh..#Gn+W ..ia..lpgR
Fig. 2. Deduced amino acid
sequences of 16 partial cDNA
clones. The region shown is
that flanked by the sequences
used to derive the oligonucleotide
mixture described previously
(Romero et al 1998).
X denotes a sequencing error.
17064
17057
AU082324
17050
D47363
C73695
17039
17037
17053
AB010839
17033
17032
17034
17030
AU029559
17055
17029
AU081563
AB010835
17062
17059
D24590
D24724
17063
C72014
17052
AU062424
2
Coefficient of similarity
Fig. 3. Phylogenetic relationships
of rice R2R3-Myb proteins.
The R2R3-Myb clones isolated in
this study are underlined.
References
Kranz H, Denekamp M, Greco R, Jin H, Leyva A, Meissner RC,
Petroni K, Urzaubqui A, Bevan M, Martin C, Smeekens S,
Tonelli C, Paz-Ares J, Weisshaar B. 1998. Towards functional
characterization of the members of the R2R3-Myb gene family
from Arabidopsis thaliana. Plant J. 16(2):263-276.
Locatelli F, Bracale M, Magaraggia F, Faoro F, Manzocchi LA,
Coraggio I. 2000. The product of the rice myb7 unspliced
mRNA dimerizes with the maize leucine zipper Opaque2 and
stimulates its activity in a transient expression assay. J. Biol.
Chem. 275(23):17619-17625.
Romero I, Fuertes A, Benito M, Malpica JM, Leyva A, Paz-Ares J.
1998. More than 80 R2R3-MYB regulatory genes in the genome
of Arabidopsis thaliana. Plant J. 14(3):273-284.
Rosinski JA, Atchley WR. 1998. Molecular evolution of the Myb
family of transcription factors: evidence for polyphyletic origin.
J. Mol. Evol. 46:74-83.
Suzuki A, Suzuki T, Tanabe F, Washida H, Wu CY, Takaiwa F. 1997.
Cloning and expression of five myb-related genes from rice
seed. Gene 198(1-2):393-398.
Notes
Authors’ address: National Research Laboratory of Plant Functional
Genomics, Division of Molecular and Life Sciences, Pohang
University of Science and Technology, Pohang 790-784, Korea.
Gene isolation and function 413

Functional analysis of MADS-box genes expressed
preferentially in vegetative tissues
S.Y. Lee, S.H. Jang, S.H. Jun, and G.H. An
MADS-box genes encode transcription factors that are involved in regulating various developmental processes. Three MADSbox
genes (OsMADS50, OsMADS51, OsMADS52), which are expressed preferentially in vegetative organs, were selected for
functional analysis. The dendrogram analysis showed that these genes were evolutionally separated from the MADS-box genes
that are preferentially expressed in floral organs. Northern blot analyses displayed their characteristic expression pattern in
vegetative organs. The analysis using a yeast two-hybrid system revealed that there were almost no interactions between the
vegetative MADS-box proteins and the floral MADS-box proteins. Transgenic rice plants expressing OsMADS52 in a sense
orientation showed characteristic phenotypes such as dwarfism, twisted root/shoot growth, early senescence, and spotted
leaves. These phenotypes phenocopied wild-type seedlings treated with 1-aminocyclopropane-1-carboxylic acid. These phenotypes
were partially recovered by treatment of the ethylene inhibitor, AgNO 3
.
Rice has been an important cereal as a staple food of many
countries, and now it has become the model plant of monocots
such as wheat, maize, oat, and barley. Functional analysis of
rice genes is important. We have been studying rice MADSbox
genes, which belong to an important gene family that regulates
plant development at various stages. There has been a
significant advance in functional analysis of MADS-box genes
involved in reproductive organ development. However, little
is known about the function of the MADS-box genes expressed
in vegetative organs. Flower locus C (FLC) and short vegetative
phase (SVP) as repressors of flowering were discussed
(Sheldon et al 1999, Hartmann et al 2000). An NO 3 -inducible
Arabidopsis gene (ANR1), whose expression is induced by
nitrogen in roots, was thought to be involved in the developmental
plasticity in Arabidopsis roots (Zhang and Forde 1998).
Three rice MADS-box genes (OsMADS50, OsMADS51, and
OsMADS52), which are expressed preferentially in vegetative
organs, have been selected for functional analysis.
Results and discussion
Several MADS-box genes that are expressed in vegetative tissues
are present in expressed sequence tag databases. We isolated
three MADS-box genes (AB003328, AB003327, and
AB003326) from root and sheath libraries by polymerase chain
reaction (Shinozuka et al 1999). We renamed these genes
OsMADS50, OsMADS51, and OsMADS52. A comparison of
these genes with other MADS-box genes showed that these
genes are evolutionally divergent from the MADS-box genes
that are preferentially expressed in floral organs (Fig. 1). The
OsMADS52 protein was the most homologous to AGL12 and
showed 49% amino acid identity with the protein (Roundsley
et al 1995). The OsMADS50 protein was 50% identical to
AGL20.
To study the expression pattern of these genes, Northern
blot analyses were performed. OsMADS50 was strongly expressed
in seedling shoots and mature leaves, whereas
OsMADS51 was more strongly expressed in seedling shoots
and roots. The OsMADS52 gene was preferentially expressed
in seedling roots. An Arabidopsis MADS-box gene, AGL12,
which showed a high sequence homology to OsMADS52, was
also preferentially expressed in the roots, suggesting that
OsMADS52 may be a homologue of AGL12.
Intermolecular interactions between these MADS-box
proteins and MADS-box proteins that are expressed in floral
tissues (OsMADS1, 3, 4, 6, 14, 15, and 16) were investigated
by the yeast two-hybrid system. The results showed that
OsMADS52 weakly interacted with OsMADS1 and
OsMADS6, and the protein did not interact with the other
MADS-box proteins. OsMADS50 and OsMADS51 did not interact
with any MADS-box proteins. Furthermore,
OsMADS50, OsMADS51, and OsMADS52 did not form
homodimers in the yeast system.
Transgenic rice plants expressing either sense or
antisense constructs of these genes were produced. The
transgenic plants that ectopically expressed OsMADS52 in a
sense orientation showed several phenotypes (Fig. 2). Plants
1, 2, 3, and 4 showed early senescence and eventually died. In
plant 2, root development was severely retarded and shoots
were twisted. Plants 1 and 4 developed more roots than did
the wild type. In addition, their roots were partially twisted.
Plant 3 showed almost normal root development, but its roots
displayed early senescence. Plant 5 showed twisted roots. Plant
6 exhibited spotted leaves (Fig. 2, sample 7).
The phenotypes suggested that the alternations in
transgenic plants were probably due to ethylene overproduction.
To investigate the possibility, the effects of ethylene on
the wild-type rice seedlings were tested with various concentration
of 1-aminocyclopropane-1-carboxylic acid (ACC), a
precursor of ethylene (Fig. 3A). Seedling roots became twisted
at 1 µM ACC, and seedling shoots showed dwarfism, chlorosis,
and twisted phenotypes at 100 µM ACC. These phenotypes
were similar to those of transgenic plants expressing
OsMADS52, supporting the hypothesis that transgenic phenotypes
may be due to ethylene overproduction. To further confirm
the possibility, the transgenic rice plants were treated with
414 Advances in rice genetics

AGL12
AP1
OsMADS6
OsMADS52
OsMADS5
OsMADS51
PI
OsMADS2
OsMADS4
OsMADS16
AP3
ANR1
SVP
AGL17
OsMADS3
AG
AGL14
AGL20
OsMADS50
FLC
Fig. 1. Dendrogram of various
MADS-box proteins of rice and
Arabidopsis, constructed using
the PHYLIP software
(Felsenstein 1993).
1 2 3 4
References
1 2 3
Fig. 2. Phenotypes of transgenic plants expressing
OsMADS52. Regenerated plants were grown
on a rooting medium: 1 = plant 1; 2 = plant 2;
3 = plant 3; 4 = plant 4; 5 = plant 5; 6 = older
roots of plant 5; 7 = plant 6.
AgNO 3 at 10 nM or 1 µM (Fig. 3B, C). The roots of the
transgenic plants treated with AgNO 3 grew straight and faster
than did those of untreated transgenic plants. It can be concluded
that OsMADS52 appears to control ethylene production.
Felsenstein J. 1993. PHYLIP (Phylogeny Inference Package) version
3.5c. Department of Genetics, University of Washington,
Seattle.
Hartmann U, Hohmann S, Nettesheim K, Wisman E, Saedler H,
Huijser P. 2000. Molecular cloning of SVP: a negative regulator
of the floral transition in Arabidopsis. Plant J. 21:351-
360.
Rounsley SD, Ditta GS, Yanofsky MF. 1995. Diverse roles for MADS
box genes in Arabidopsis development. Plant Cell. 7:1259-
1269.
Sheldon CC, Burn JE, Perez PP, Metzger J, Edwards JA, Peacock
WJ, Dennis ES. 1999. The FLF MADS box gene: a repressor
of flowering in Arabidopsis regulated by vernalization and
methylation. Plant Cell. 11:445-458.
Shinozuka Y, Kojima S, Shomura A, Ichimura H, Yano M, Yamamoto
K, Sasaki T. 1999. Isolation and characterization of rice MADS
box gene homologues and their RFLP mapping. DNA Res.
6:123-129.
Zhang H, Forde BG. 1998. An Arabidopsis MADS box gene that
controls nutrient-induced changes in root architecture. Science
279:407-409.
Notes
Authors’ addresses: National Research Laboratory of Plant Functional
Genomics, Division of Molecular and Life Sciences,
Pohang University of Science and Technology, Pohang 790-
784, Republic of Korea.
Gene isolation and function 415

A
1 2 3 4 5 6
B
1 2 3 C 1 2
Fig. 3. Effects of ethylene on wild-type
seedlings and effects of AgNO 3 on
transgenic plants expressing
OsMADS52. (A) Various concentrations
of ACC were applied to rice seedlings
14 d after sowing. 1 = 1 nM; 2 = 10
nM; 3 = 100 nM; 4 = 1 µM; 5 = 10
µM; 6 = 100 µM. (B) Roots of
transgenic plants treated with AgNO 3 .
1 = 0 µM; 2 = 10 nM; 3 = 1 µM. (C)
Roots of transgenic plants treated with
various concentrations of AgNO 3 . 1 =
0 µM; 2 = 1 µM.
Functional analysis of protein phosphatase 2C in rice
K. Yang, D.H. Jeong, and G. An
Protein phosphorylation and dephosphorylation are major regulatory mechanisms that cells use to transmit signals from their
extracellular environment to the interior. Two structurally distinct groups of serine/threonine phosphatases are known: the PP1/
PP2A family and the PP2C family. Here, we focus on the functions related to development and stress response. We have
obtained six rice expressed sequence tag clones that contain the highly conserved KAPP catalytic domain. In addition, we have
isolated three clones from a young panicle cDNA library by polymerase chain reaction using degenerate primers. RNA gel blot
analysis showed that some of these genes are expressed constitutively, while others are preferentially expressed in certain
tissue. We also present data on inducibility of genes to stresses such as cold, salt, and abscisic acid. The yeast two-hybrid
system is being employed to find regulatory partners or substrates of the PP2C clones. Transgenic plants expressing the
antisense constructs of the genes are being analyzed to determine the functional roles of the PP2C clones.
Protein phosphorylation and dephosphorylation are major
mechanisms involved in conveying developmental signals and
environmental information to the cell. These functions are
carried out by protein kinases and phosphatases. On the basis
of substrate specificity, protein phosphatases are classified into
two major groups: tyrosine and serine/threonine phosphatase.
The serine/threonine phosphatases are in turn divided into the
PP1/PP2A family and the PP2C family. PP2Cs require Mg 2+
or Mn 2+ for their activity and are insensitive to ocadaic acid,
an inhibitor of PP1/PP2A enzymes (Cohen 1989).
Several functional roles of PP2Cs have been reported.
Genetic studies have shown that ABI1 has functions related
to the signal transduction cascade of abscisic acid (ABA).
Moreover, kinase-associated protein phosphatase is known to
be an important element in flower meristem development
(Stone et al 1994). In addition, an alfalfa PP2C that was named
MP2C has been found to act as a negative regulator of stressactivated
mitogen-activated protein kinase (Meskiene et al
1998).
Results and discussion
Molecular cloning of protein phosphatase
2C (PP2C) in rice
Protein phosphatases in the 2C family contain 11 conserved
motifs that are scattered along the catalytic sequence (Bork et
al 1996). We obtained six expressed sequence tag (EST) clones
(D39634, D41977, D47609, C73034, D46746, and D24960)
from the Ministry of Agriculture, Forestry, and Fisheries DNA
bank that contained some of these conserved motifs. These
416 Advances in rice genetics

Motif 1 Motif 11
OsKAPP catalytic
domain
Motif 2 Motif 8
kb
Ospp2c1 (D47609) 1.1
Ospp2c2 (D41977) 1.0
Ospp2c3 (D24960) 1.1
SacI
Ospp2c4 (D46746) 1.6
SacI
Ospp2c5 (C73034) 1.0
Ospp2c6 (D39634) 1.0
Ospp2c7 0.6
Ospp2c8 0.6
Ospp2c9 0.6
Fig. 1. The lengths and positions
of Ospp2c clones relative
to OsKAPP catalytic domain.
Full lengths of these
clones, except Ospp2c4 and
Ospp2c5, are used for Northern
blot probes and construction
of antisense vectors. The
broken lines indicate the DNA
probes made from Ospp2c4
and Ospp2c5.
EST clones averaged 1.1 kb in length. One of these clones
(D46746) had the complete catalytic sequence but the others
had none (Fig. 1).
In addition to these EST clones, we isolated three putative
PP2C clones from a young panicle cDNA library by polymerase
chain reaction using degenerate primers (Fig. 1). The
degenerate primers were based on the sequences of motif 2
(5′-TI[T/C]GA[T/C]GG[G/A/T/C]CA[T/C]GG[G/A/T/C]GG-
3′) and motif 8 (5′-[A/T][T/C][G/A]TCCCA[T/C]AA[G/A/T/
C]CCGTC-3′, 5′-[A/T][T/C][G/A]TCCCA[G/A/T/C]A[G/
C][G/A/T/C]CCATC-3′, 5′-[A/T][T/C][G/A]TCCCA[G/A/T/
C]A[G/C][G/A/T/C]CCGTC-3′), which were highly conserved
among the plant PP2C clones (Rodriquez 1998). We named
these nine clones Ospp2cs (Fig. 1).
Ospp2c1
Ospp2c2
Ospp2c3
Ospp2c4
Ospp2c5
Lane
1 2 3 4 5 6
kb
1.3
1.4
1.6
1.6
1.5
RNA expression level analysis of Ospp2cs
The transcripts of several Ospp2c clones were analyzed for
tissue specificity and for stress responsibility by Northern blot.
The results showed that Ospp2c4 was transcribed preferentially
in panicles and mature flowers. The transcripts of
Ospp2c5 were most abundant in mature leaves (Fig. 2). However,
the transcripts of the other clones (Ospp2c1, 2, and 3)
did not show any tissue or development specificity (Fig. 2).
To examine whether these clones are induced by cold
stress or ABA treatment, 10-d-old seedlings were kept at 17
°C for 3, 6, 12, and 24 h and were treated with ABA at 10, 25,
50, and 100 µM for 6 h. However, the transcripts of Ospp2cs
were not influenced by these treatments (data not shown).
rDNA
Fig. 2. Northern blot analysis of Ospp2cs. 1 = seedling
shoots (10 d); 2 = seedling roots (10 d); 3 = mature
leaves (8 wk); 4 = immature panicles smaller than
5 cm; 5 = panicles at 5–10-cm length stage; 6 =
panicles taller than 10 cm. rDNA indicates Arabidopsis
18S ribosomal DNA.
Gene isolation and function 417

RB P ubiquitin Insert T nos P 35S Hph T 7 LB
Fig. 3. Schematic map of the binary vector pGA1611 used for transformation. RB =
right border, P ubiquitin = maize ubiquitin promoter, T nos = nos terminator, P 35S = cauliflower
mosaic virus 35S promoter, Hph = hygromycin phosphotransferase, T 7 =
terminator of the 7 gene of pTiA6, LB = left border.
Ospp2c antisense transgenic rice plants
We have produced antisense transgenic rice plants by
Agrobacterium-mediated transformation using binary vectors
that we have constructed (Fig. 3). About 30 rice plants for each
clone (Ospp2c 1–9) have been produced and analyzed for development
abnormalities. However, we did not notice any abnormal
phenotypes at the preflowering stage. We will examine
whether the transgenic rice plants will show mutant phenotypes
at later developmental stages. If, however, the functions
of these clones are redundant, we will not be able to see any
abnormality. In that case, it may be better to produce transgenic
rice that overexpresses these clones to determine the function.
Analysis of the transcript levels and mutant phenotype
of transgenic rice was not enough to understand the functions
of Ospp2cs. A study of the regulatory elements or substrates
as well as enzyme activity would be important. Therefore, we
plan to do yeast two-hybrid screens with Ospp2cs as bait and
phosphatase enzyme activity assays.
References
Bork P, Brown NP, Hegyi H, Schultz J. 1996. The protein phosphatase
2C (PP2C) superfamily: detection of bacterial homologues.
Protein Sci. 5:1421-1425.
Cohen P. 1989. The structure and regulation of protein phosphatases.
Annu. Rev. Biochem. 58:453-508.
Meskiene I, Bogre L, Glaser W, Balog J, Brandstotter M, Zwerger
K, Ammerer G, Hirt H. 1998. MP2C, a plant protein phosphatase
2C, functions as a negative regulator of mitogen-activated
protein kinase pathways in yeast and plants. Proc. Natl.
Acad. Sci. USA 95:1938-1943.
Rodriguez PL. 1998. Protein phosphatase 2C (PP2C) function in
higher plants. Plant Mol. Biol. 38:919-927.
Stone JM, Collinge MA, Smith RD, Horn MA, Walker JC. 1994.
Interaction of a protein phosphatase with an Arabidopsis
serine-threonine receptor kinase. Science 266:793-795.
Notes
Authors’ address: National Research Laboratory of Plant Functional
Genomics, Department of Life Science, Pohang University of
Science and Technology, Pohang 790-784, Korea.
Functions of mitochondrial aldehyde dehydrogenase
in rice under anaerobic conditions
M. Nakazono, Y. Li, H. Tsuji, N. Tsutsumi, and A. Hirai
Alcoholic fermentation is important for the survival of plants under anaerobic conditions. Acetaldehyde, one of the intermediates
of alcoholic fermentation, is not only reduced by alcohol dehydrogenase (ADH) but can also be oxidized by aldehyde
dehydrogenase (ALDH). To determine whether ALDH plays a role in anaerobic metabolism in rice, we characterized a cDNA
clone encoding mitochondrial ALDH from rice (Aldh2a). Analysis of the subcellular localization of ALDH2a protein and an in
vitro ALDH assay indicated that ALDH2a oxidizes acetaldehyde in mitochondria. A Southern blot analysis indicated that mitochondrial
ALDH is encoded by at least two genes in rice. We found that the Aldh2a mRNA was present at high levels in leaves
of dark-grown seedlings, mature leaf sheaths, and panicles. Expression of the rice Aldh2a gene, unlike the expression of the
tobacco Aldh2a gene, was induced in rice seedlings by submergence. A possible involvement of ALDH2a in the submergence
tolerance of rice is discussed.
Glycolysis and alcoholic fermentation are important for energy
production during seed germination, especially in anaerobic
environments (Perata and Alpi 1993). Alcoholic fermentation
consists of two steps: the decarboxylation of pyruvate
to acetaldehyde catalyzed by pyruvate decarboxylase (PDC),
followed by reduction of acetaldehyde to ethanol with the concomitant
oxidation of NADH to NAD + catalyzed by alcohol
dehydrogenase (ADH) (Perata and Alpi 1993). This metabolic
pathway is recognized as the principal catalytic pathway for
recycling NAD + to maintain glycolysis and the ATP level in
the absence of oxygen. The expression of the genes involved
in glycolysis and alcoholic fermentation (e.g., ADH, PDC, glyceraldehyde-3-phosphate
dehydrogenase, enolase) is dramatically
induced by anaerobiosis (Sachs et al 1996).
418 Advances in rice genetics

11-day-old seedlings
3-month-old plants
Leaves (light)
Leaves (dark)
Roots (light)
Roots (dark)
Leaf blades
Leaf sheaths
Young panicles
Panicles after
heading
Aldh2a
(1.9 kb)
Fig. 1. Northern hybridization
analysis of transcripts of the
Aldh2a gene in various organs.
Each lane was loaded with 5 µg
total RNA extracted from young
leaves and young roots (of 11-
d-old seedlings under light or
dark conditions), mature leaf
blades, mature leaf sheaths,
young panicles, and panicles
after heading. The size of the
transcript of Aldh2a (1.9 kb) is
shown by the arrow at the right.
Aldehyde dehydrogenases [aldehyde:NAD(P) + oxidoreductases]
(ALDHs) are a group of enzymes catalyzing the
conversion of aldehydes to the corresponding acids. Mitochondrial
ALDH protein (ALDH2) exhibits a high activity for oxidizing
acetaldehyde, an intermediate of alcoholic fermentation,
and is thought to play an important role in detoxifying
acetaldehyde. In 1996, a gene for mitochondrial ALDH was
identified in maize (Cui et al 1996). The gene, rf2, was found
to be a nuclear restorer gene of Texas-type cytoplasmic male
sterility (cms-T). Subsequently, in tobacco, two Aldh genes
(Aldh2a and Aldh2b) were identified, and the Aldh2a transcript
and the ALDH2a protein were found to be present at
high levels in floral tissues, especially stamens, pistils, and
pollen (op Den Camp and Kuhlemeier 1997). Under anaerobic
conditions, the expression of Adh and Pdc is induced in
tobacco leaves, but the expression of Aldh2a is not. Therefore,
tobacco ALDH2a does not seem to function in anaerobic
environments (op Den Camp and Kuhlemeier 1997). In this
study, we characterized a cDNA clone encoding mitochondrial
ALDH from rice. We estimated the possible function of rice
ALDH2a under anaerobic conditions.
Materials and methods
Rice (Oryza sativa L. cv. Nipponbare) was grown under light
conditions at 28 o C for 10 d to extract total DNA. To extract
total RNA, leaves and roots of seedlings that were grown in
the light or in the dark at 28 o C for 11 d were used. Mature leaf
blades, mature leaf sheaths, and young panicles from 3-moold
plants and panicles taken after heading from 3.5-mo-old
plants were prepared. To study oxygen deprivation, 7-d-old
aerobically grown seedlings were submerged in the dark at 28
o
C for 12, 24, and 36 h. After 36 h, the submerged seedlings
were transferred to aerobic conditions in the dark at 28 o C for
12 and 24 h.
Southern hybridization, Northern hybridization, and an
analysis of subcellular localization of ALDH2a protein were
carried out by the method previously described (Li et al 2000).
Results and discussion
To determine whether ALDH plays a role in anaerobic metabolism
in rice, we characterized a cDNA clone encoding
mitochondrial ALDH2 (Aldh2a) from rice. Analysis of the
subcellular localization of ALDH2a protein using green fluorescent
protein (GFP) and an in vitro ALDH assay using protein
extracts from Escherichia coli cells that overexpressed
ALDH2a indicated that ALDH2a functions in oxidizing acetaldehyde
in mitochondria. Southern blot hybridization was
carried out using the coding region of Aldh2a as a probe. The
result indicated that mitochondrial ALDH2 is encoded by at
least two genes in rice.
The expression of the Aldh2a gene was examined by
Northern hybridization by determining the relative steady-state
mRNA amounts in different organs of rice. Using total RNAs
extracted from young leaves and young roots of 11-d-old seedlings
grown under light or dark conditions, mature leaf blades,
mature leaf sheaths, young panicles, and panicles after heading,
a single transcript of approximately 1.9 kb was observed
(Fig. 1). The steady-state levels of the Aldh2a transcript in
leaves of 11-d-old seedlings were higher than those in roots.
Furthermore, the amounts of mRNA in tissues grown under
darkness were higher than those in tissues grown in the light.
In mature rice plants, high relative amounts of the Aldh2a
mRNA were detected in young panicles, panicles after heading,
and leaf sheaths.
Rice has a higher tolerance for anaerobic conditions than
does tobacco. The expression of rice Adh1 (Xie and Wu 1989)
and rice Pdc1 (Hossin et al 1996) is induced in an anaerobic
environment. To determine whether the expression of the rice
mitochondrial ALDH gene (Aldh2a) is also induced under such
conditions, we submerged 7-d-old seedlings grown under aerobic
conditions for 12, 24, and 36 h in the dark and then subjected
them to a Northern hybridization analysis using probes
specific to Aldh2a. We also investigated the expression of Adh1
and Pdc1. The steady-state levels of the Aldh2a, Adh1, and
Pdc1 mRNAs were increased dramatically by the submergence
Gene isolation and function 419

Submerged
Aerobic
0 12 24 36 36/12 36/24
(h)
Aldh2a
(1.9 kb)
Adh1
(1.6 kb)
Pdc1
(2.4 kb)
Fig. 2. Expression of Aldh2a, Adh1, and Pdc1 is induced
under submerged conditions. Seven-day-old seedlings
grown in an aerobic environment in the light were submerged
in the dark for 12, 24, and 36 h. After 36 h,
seedlings were returned to aerobic conditions in the
dark for 12 and 24 h (36/12 and 36/24, respectively).
The sizes of the transcripts of Aldh2a (1.9 kb), Adh1
(1.6 kb), and Pdc1 (2.4 kb) are shown by the arrows at
the right.
treatment (Fig. 2). When the submerged seedlings were transferred
to an aerobic environment, the amounts of these transcripts
decreased. This indicated that ALDH2a, like ADH1
and PDC1, is involved in anaerobic metabolism.
op Den Camp and Kuhlemeier (1997) reported that tobacco
Aldh2a transcript levels did not increase during anaerobiosis
in leaf tissue, and proposed that a pathway involving
ALDH is not important for normal metabolism in tobacco
leaves, even in anaerobiosis. In preliminary studies, we found
that expression of the Arabidopsis ALDH2a gene was also not
enhanced under submerged conditions (data not shown). We
propose that rice may have a greater ability than tobacco and
Arabidopsis to detoxify acetaldehyde, which is produced during
alcoholic fermentation in anaerobiosis, by both ALDH and
ADH. Higher levels of ALDH may be one of the reasons why
rice is more tolerant of submergence than other plant species
such as tobacco and Arabidopsis. To date, it is unclear whether
expression of the Aldh2 gene is enhanced under anaerobic
conditions in maize and wheat. It will be of interest to examine
the expression of these Aldh2 genes during submergence.
Under anaerobic conditions, fermentation regenerates
NAD + from NADH, allowing plant cells to continue glycolysis
and maintain the ATP level (Perata and Alpi 1993). The
conversion of acetaldehyde to acetate by ALDH consumes
NAD + , and this consumption could potentially block glycolysis.
However, the hypoxia-inducible ALDH2a protein is localized
in mitochondria and is separated from the cytosolic
enzymes involved in glycolysis and alcoholic fermentation.
This suggests that reduction of NAD + to NADH by rice
ALDH2a does not influence the efficiency of glycolysis. Plants
have many ALDH isozymes. We assume that at least two of
these isozymes are involved in oxidizing acetaldehyde. One is
a mitochondrial enzyme (Cui et al 1996, op den Camp and
Kuhlemeier 1997) and another is a cytosolic enzyme (Li et al
2000). In contrast to the expression of the mitochondrial Aldh2a
gene, the expression of the rice cytosolic Aldh1a gene is probably
not influenced by oxygen status (Li, Nakazono, and Hirai,
unpublished data). Thus, it seems reasonable that the mitochondrial
ALDH2a protein is induced to ensure the continuation
of glycolysis, and that the cytosolic ALDH isozymes are
not induced for this purpose.
References
Cui X, Wise RP, Schnable PS. 1996. The rf2 nuclear restorer gene
of male-sterile T-cytoplasm maize. Science 272:1334-1336.
Hossin MA, Huq E, Grover A, Dennis ES, Peacock WJ, Hodges
TK. 1996. Characterization of pyruvate decarboxylase genes
from rice. Plant Mol. Biol. 31:761-770.
Li Y, Nakazono M, Tsutsumi N, Hirai A. 2000. Molecular and cellular
characterizations of a cDNA clone encoding a novel
isozyme of aldehyde dehydrogenase from rice. Gene 249:67-
74.
op Den Camp RGL, Kuhlemeier C. 1997. Aldehyde dehydrogenase
in tobacco pollen. Plant Mol. Biol. 35:355-365.
Perata P, Alpi A. 1993. Plant responses to anaerobiosis. Plant Sci.
93:1-17.
Sachs MM, Subbaiah CC, Saab IN. 1996. Anaerobic gene expression
and flooding tolerance in maize. J. Exp. Bot. 47:1-15.
Xie Y, Wu R. 1989. Rice alcohol dehydrogenase genes: anaerobic
induction, organ specific expression and characterization of
cDNA clones. Plant Mol. Biol. 13:53-68.
Notes
Authors’ address: Laboratory of Plant Molecular Genetics, Graduate
School of Agricultural and Life Sciences, The University
of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan.
420 Advances in rice genetics

Identification of differentially expressed genes during
disease resistance response from rice by cDNA arrays
Bin Zhou, Kaiman Peng, Zhaohui Chu, Shiping Wang, and Qifa Zhang
A normalized cDNA library was constructed with 14 different tissues from rice variety Minghui 63, including tissues after
inoculation with the pathogens Xanthomonas oryzae pv. oryzae (Xoo) and Pyricularia grisea. This library contains about 62,000
clones with an average insert length of 1.2 kb. Approximately 20,000 clones from the library were arrayed on nylon film. Total
RNA samples, isolated from different bacterial blight or blast resistance varieties and near-isogenic lines induced with different
strains or isolates of Xoo or P. grisea, respectively, were used as probes to screen the cDNA arrays for identification of defenserelated
genes. Some 110 differentially expressed sequences were identified. The expression of 56 of these sequences increased
and 54 decreased or was inhibited after inoculation with Xoo or P. grisea. Sequence analysis of the 56 sequences
showing increased expression after pathogen induction reveals that about two-thirds of these sequences match with known
functional proteins in the databases, which can be classified into several groups according to the putative functions. The cDNA
array technique can provide an efficient tool for identifying defense-related genes.
Resistance in plants to an incompatible pathogen is manifested
as two biochemical and physical responses, the hypersensitive
reaction (HR) and systemic acquired resistance (SAR). Many
gene products are involved in the processes of HR and SAR.
Great efforts have been made in the studies of disease resistance
(R) and SAR-responsive genes, especially those encoding
pathogenesis-related (PR) proteins. However, much still
remains to be learned concerning the regulation of HR and
SAR, as well as the signaling pathway between HR and SAR.
The cDNA array technique, by allowing for large-scale displaying
of gene expression, provides a powerful tool for studying
the genes involved in defense response at the whole-genome
level. Our study aimed to identify disease resistance–
related genes to characterize the pathways of the response to
important diseases in rice.
Materials and methods
A normalized rice cDNA library from rice variety Minghui 63
was used to prepare the cDNA arrays. This cDNA library was
constructed using 14 different tissues, including callus, seedlings
(etiolated, three-leaf stage, and five-leaf stage), culm
(tillering stage and flowering stage), root, flag leaf, panicle
(flowering stage and two different stages of grain-filling),
flower, leaves after inoculation with Xanthomonas oryzae pv.
oryzae (Xoo), and leaves after inoculation with Pyricularia
grisea. A total of about 62,000 clones with an average insert
length of 1.2 kb were collected and stored. Plasmids from
20,000 clones were extracted and arrayed onto Hybond-N +
nylon filters using a Biomek 2000 laboratory automation workstation
(Beckman, Fullerton, CA). The filter, 8 × 12 cm in size,
was arrayed into 384 grids each containing 8 dots of plasmid
DNA, with each clone spotted twice in symmetric positions
within the grid.
Rice varieties and near-isogenic lines (NILs)—
C101A51, Minghui 63, IRBB10, and IRBB13—containing
various disease resistance genes were inoculated with incompatible
pathogens. C101A51, containing blast resistance gene
Pi2, and Minghui 63, containing at least one unidentified blast
resistance gene (unpublished data), were inoculated with Philippine
isolate V86013 of P. grisea. The NILs IRBB10 and
IRBB13 containing bacterial blight resistance genes Xa10 and
xa13, respectively, were inoculated at the four-leaf stage with
PXO86 (Philippine race 2) and PXO99 (Philippine race 6) of
Xoo, respectively. The control plants were treated under the
same conditions except that the pathogen suspension was replaced
by water for both bacterial blight and blast inoculations.
Total RNA was isolated from rice leaves harvested five
days after pathogen inoculation. The first-strand cDNA was
synthesized as the hybridization probe. The reverse transcription
reaction was performed in a 50-µL volume containing 50–
100 µg total RNA, 1 µg oligo (dT) 15 primer, 400 U Superscripts
II reverse transcriptase (GIBCO-BRL), 1X first-strand
buffer, 100 µM each of dATP, dGTP, and dTTP, 50 µCi 32 P-
dCTP, and 0.5 µM DTT. After incubation at 37 °C for 1 h, the
reaction was stopped and the RNA was degraded with 5 µL of
0.5 N NaOH and 5 µL of 100 mM EDTA for 10 min at 70 °C.
The probe was purified using a Sephadex G-50 column.
Filters were prehybridized for 3 to 6 h at 65 °C in a
plastic bag containing 15 mL of hybridization buffer. The filters
were hybridized overnight in the same hybridization buffer
containing the probe. After hybridization, the filters were
washed 1 to 2 times in 0.5X SSC and 0.1% SDS for 15 min at
65 °C. Autoradiograph was subsequently carried out using
PhosphorImager SI (Molecular Dynamics, Sunnyvale, CA).
Results and discussion
Hybridization of the filters with the probes prepared from the
pathogen inoculated and mock-inoculated control tissues revealed
a large number of differentially expressed sequences.
Expression after pathogen inoculation increased for some of
the genes, and decreased or was totally inhibited for others.
Gene isolation and function 421

A
Table 1. The classification of genes whose expression increased
after pathogen inoculation.
Putative gene group
Number of genes
B
Fig. 1. The autoradiograph of cDNA arrays. The pair
of cDNA arrays containing the same cDNA clones
was hybridized with cDNA probes prepared from
Minghui 63 5 days after mock-inoculation (A) and
pathogen inoculation (B), respectively. The arrows
numbered 1 to 4 indicate the sequences showing
increased expression after pathogen inoculation
and arrow number 5 indicates the sequence exhibiting
decreased expression after pathogen inoculation.
The amount of differential expression varied from one sequence
to another (Fig. 1), indicating different levels of response to
pathogen induction.
The differential expression of a small portion of genes
was not pathogen-specific; their expression was enhanced or
reduced in tissues inoculated with both pathogens. In contrast,
the differential expression displayed by most of the sequences
was pathogen-specific, and was differentially expressed after
induction by only one pathogen or the other.
Sequence comparison and BLAST search (Altschul et
al 1997) were conducted to analyze the differentially expressed
genes. A total of 110 unique sequences were identified; 56 of
the sequences showed increased expression and the remaining
54 showed decreased or inhibited expression after pathogen
inoculation.
Of the sequences showing increased expression after
pathogen induction, 53 had various degrees of similarity with
genes in the databases and the other 3 showed no sequence
homology with any of the genes or sequences in the databases
(Table 1). The sequences can be grouped according to the putative
functions of their encoded proteins. The three sequences
in the transcription regulation group all encode putative DNAbinding
proteins, including WRKY-type DNA-binding protein.
The results suggest that the WRKY-like gene may also
Transcription regulation 3
Translation regulation 4
Transport proteins 2
Kinase 2
Metabolic enzyme 9
Other function 17
Unknown function 16
No significant similarity found in databases 3
regulate the expression of PR genes in rice during defense response.
Two candidate kinase sequences were identified to be
responsive to pathogen induction in our study. It is known that
kinases participate in many signal transduction pathways, including
the pathways in defense response. One sequence in
the “other function” group of Table 1 encodes a putative
proteasome component. Similar results were reported in tobacco,
in which the expression of a subunit of proteasome can
be induced by salicylic acid, known to be one of the signal
molecules for SAR (Etienne et al 2000).
Although 56 genes with increased expression by pathogen
induction were identified, none of them had homology
with the intensively studied PR genes in the literature, such as
those encoding beta-1,3-glucanase, chitinase, or peroxidase
(Loon et al 1994). This may be partly because only a portion
of the cDNA library was screened, and/or the expression of
those PR genes is elicitor-specific (Smith and Metraux 1991).
In summary, rice disease resistance response is a complex
process involving many components of various functions.
The cDNA array technique can provide an efficient tool for
identifying defense-related genes.
References
Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W,
Lipman DJ. 1997. Gapped BLAST and PSI-BLAST: a new
generation of protein database search programs. Nucl. Acids
Res. 25:3389-3402.
Etienne P, Petitot AS, Houot V, Blein JP, Suty L. 2000. Induction of
tcI 7, a gene encoding a beta-subunit of proteasome, in tobacco
plants treated with elicitins, salicylic acid or hydrogen
peroxide. FEBS Lett. 466:213-218.
Loon LC van, Pierpoint WS, Boller TH, Conejero V. 1994. Recommendations
for naming plant pathogenesis-related proteins.
Plant Mol. Biol. Rep. 12:245-264.
Smith JA, Metraux J-P. 1991. Pseudomonas syringae pv. syringae
induces systemic resistance to Pyricularia oryzae in rice.
Physiol. Mol. Plant Pathol. 39:451-461.
Notes
Authors’ address: National Key Laboratory of Crop Genetic Improvement,
Huazhong Agricultural University, Wuhan
430070, China.
422 Advances in rice genetics

Rice transcript RIM2 accumulates in response to
Magnaporthe grisea and its predicted protein shares
similarity with proteins encoded by CACTA transposons
J.X. Dong, H.T. Dong, Z.H. He, and D.B. Li
Rice gene RIM2 was identified by mRNA differential analysis. The mRNA is strongly induced in incompatible interactions
between rice and Magnaporthe grisea. RIM2 is also induced by a cell-wall elicitor derived from M. grisea, but not by wounding.
A 3.3-kb cDNA clone was identified and is predicted to encode a protein of 653 amino acids, which shares 32% to 53%
identities with proteins encoded by the CACTA transposons of other plants. An AT-rich region was found in the 5′ and 3′
noncoding termini of RIM2. RIM2 shares 82% sequence identity with sequences flanking Xa21 gene family members, such as
A1 and C of the disease-resistance genes. Four direct repeats were identified in the 3′ noncoding terminus. Southern hybridization
with genomic DNA from different rice species indicated that RIM2 is present in multiple copies. Results suggested that
RIM2 transcription accumulation might be an early rice response to pathogen attack.
Plants have developed genetic systems for responding to environmental
stresses. It is known that some plant transposable
elements (TEs) are activated in response to a changing environment
(Wessler 1996). Interestingly, some transposons are
induced by pathogen challenge (Vernhettes et al 1997).
We are interested in the rice defense response to pathogen
challenge. Rice blast caused by Magnaporthe grisea is
one of the most destructive diseases in rice. Several rice genes
with defense against M. grisea have been isolated, such as the
phenylalanine ammonia-lyase (PAL) gene, chitinase gene, and
3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR)
gene. Some cloned rice genes are strongly induced by M. grisea
(Dong et al 1997) or by the elicitor from the cell wall of M.
grisea (Xu et al 1996). However, no study shows that rice
transposons are involved in response to pathogen attack.
Here we describe a rice gene, RIM2, that is induced by
M. grisea and a cell-wall elicitor of M. grisea. The predicted
RIM2 protein is 42% identical to TNP2 encoded by the Antirrhinum
majus transposon Tam1 and 32% identical to TNPD
encoded by the maize transposon En/Spm. Both Tam1 and En/
Spm are called CACTA-elements because of the conserved
sequence CACTA present in the terminal inverted repeats
(TIRs). RIM2 shows an 82% sequence identity to the flanking
DNA sequences of Xa21 gene family members.
Results
Identification and cloning of the full-length
RIM2 cDNA
Through mRNA differential display PCR (DD-PCR) using
RNA from the near-isogenic lines (NILs) H7R and H7S with
or without the resistance gene Pi-r1(t) (He and Shen 1990)
inoculated with the blast isolate ZB15, a 0.8-kb DD-PCR fragment
(RIM19-8) was identified to be induced in both incompatible
and compatible interactions of rice and M. grisea. Using
the 0.8-kb RIM19-8 cDNA as a probe, a 3.3-kb cDNA
clone was isolated from 5 × 10 5 clones of the rice cDNA library.
The 3.3-kb cDNA consists of an open reading frame
(ORF) of 1,959 bp and a long AT-rich noncoding 3′ tail. One
104-bp sequence was found directly repeated four times (the
repeat 1–4) in the 3′ noncoding region within the residues from
2,765 to 3,152. Among the four repeats, repeats 1 and 2 were
almost identical. Repeats 3 and 4 had some nucleotide changes
compared with repeats 1 and 2. The short sequence
AATTTTTATTAATTTTAA of repeats 3 and 4 was derived
from the sequence AATTTTTAAAAGTA(GT)AA in repeats
1 and 2 by replacing AAAGTA(GT) with TTAATT. Repeat 4
was truncated by a 35-bp deletion in the 3′-terminus (GenBank
accession number for RIM2 is AF121139 and PGR99-042).
RIM2 transcript accumulates by M. grisea attack
Northern blotting showed that the RIM2 transcript accumulated
in both incompatible and compatible interactions from 8
h to at least 36 h after inoculation (Fig. 1A). Mock inoculation
slightly induced RIM2 transcript accumulation (Fig. 1B). No
difference in transcript accumulation was observed between
the incompatible and compatible interactions, indicating that
RIM2 induction is not a resistance gene–related response to
M. grisea attack. A polysaccharide fraction from the cell wall
of M. grisea is known to induce rice defense gene expression
(Xu et al 1996); it also induced RIM2 expression in cell suspensions
within 1–2 h after elicitor treatment. However, wounding
obviously did not induce RIM2 expression. Results indicated
that RIM2 is specifically inducible by M. grisea. All
Northern blots revealed two transcripts that are about 4 kb and
3.3 kb, respectively.
RIM2 shares 32–55% identity
with CACTA-transposons protein
An ORF of 1,959 bp was found in RIM2 cDNA, which encodes
a predicted protein with 653 amino acids. A database
search showed that this RIM2 protein shares 32–55% identity
with proteins encoded by CACTA-like elements. The sequence
similarity among these proteins indicates that the structural
Gene isolation and function 423

H7R/isolate ZB15
(incompatible)
H7S/isolate ZB15
(compatible)
0 4 8 12 24 36 0 4 8 12 24 36 (h)
kb
RIM2
A
4.0
3.3
rDNA
B
RIM2
rDNA
4.0
3.3
Fig. 1. Transcript accumulation of
RIM2 in incompatible and compatible
interactions between the rice
near-isogenic lines H7R and H7S
and the M. grisea isolate ZB15. (A)
Northern blot showing RIM2 transcript
accumulation during the
time course from 0 to 36 h after
inoculation with isolate ZB15. (B)
Northern blot for mock inoculation
controls.
organizations of CACTA elements are strikingly similar in
plants.
RIM2 shares 82% identity with flanking
regions of Xa21
A DNA database search revealed that a 1-kb RIM2 sequence
from –631 to +427 shares 82% identity with the 5′-flanking
region of member A1 and 5′-and 3′-flanking regions of member
C of the rice disease resistance gene Xa21 family (Song et
al 1997). The results support and add to the observation that
the Xa21 family is a transposon-rich locus (Song et al 1998).
We also found in the GenBank of NCBI that a rice partial cDNA
clone, SR4, with 321 bp is identical to the sequence from 1,925
to 2,224 of RIM2 except for its poly(A) tail (GenBank Accession
No. U16784). SR4 is a sucrose-regulated gene in rice cell
culture revealed also by DD-PCR. It is not clear whether RIM2
and SR4 are the same gene because SR4 has an earlier poly(A)
tail.
RIM2 copy number in the rice genome
Southern blotting revealed four hybridizing fragments of rice
genomic DNA digested by EcoRI, indicating that a family of
RIM2 elements exists in the rice genome of all test lines. No
DNA restriction fragment length polymorphism (RFLP) was
identified, suggesting that the RIM2 element might not be mobile.
Discussion
The CACTA elements are usually large, up to 15.2 kb, encode
two proteins thought to play a role in transposition, and carry
conserved TIRs with the consensus sequence CACTA. Another
CACTA element, Tnr3, is also found in rice that carries
some characteristics of the En/Spm family (Motohashi et al
1996). Cloning the RIM2 full-length DNA will reveal more
information on its structure and allow us to know whether the
CACTA motif exists in the 5′ and 3′ TIRs.
Transposons in flanking regions of normal plant genes
affect gene structure and expression. RIM2 sequences are found
in flanking regions of member A1 and C of the Xa21 gene
family. In addition, 17 other elements have been found at the
Xa21 locus (Song et al 1998). Furthermore, the Xa21-linked
marker pTA818 carrying a CACTA-like element may have transposed
from an unlinked chromosome to the Xa21 locus on
chromosome 11, resulting in the sequence duplication in the
wild species Oryza longistaminata. These results support the
idea that TEs play an important role in the evolution of resistance-gene
loci.
Transcription and transposition of TEs are commonly
activated by several environmental stresses (Wessler 1996).
The RIM2 transcript strongly accumulates in plants inoculated
with M. grisea and in cells treated with a fungal elicitor, but
not by wounding. As with the tobacco transposon Tnt1, transcript
accumulates in response to several microbial elicitors
from fungus and bacterium, which have a common ability to
424 Advances in rice genetics

initiate a hypersensitive response in tobacco and in abiotic factors
such as Na salicylate and CuCl 2 .
RIM2 transcript accumulation is triggered by M. grisea
inoculation and may reflect an early response to pathogen attack
like the tobacco Tnt1 (Vernhettes et al 1997). It will be
interesting to investigate whether RIM2 can be activated to
transpose during long-term tissue culture and during induction.
References
Dong HT, He ZH, Wu YL, Cheng SJ, Dong JX, Li DB. 1997.
GenBank Accession Number: U83834, U83835.
He ZH, Shen ZT. 1990. Near-isogenic pairs of indica rice with blast
(B1) resistance genes. Int. Rice Res. Newsl. 15:7.
Motohashi R, Ohtsubo E, Ohtsubo E. 1996. Identification of Tnr3,
a suppressor-mutator/enhancer-like transposable element from
rice. Mol. Gen. Genet. 250:148-152.
Song WY, Pi LY, Bureau TE, Ronald PC. 1998. Identification and
characterization of 14 transposon-like elements in the
noncoding regions of members of the Xa21 family of disease
resistance genes in rice. Mol. Gen. Genet. 258:449-456.
Song WY, Pi LY, Wang GL, Gardner J, Holsten T, Ronald PC. 1997.
Evolution of the rice Xa21 disease resistance gene family. Plant
Cell 9:1279-1287.
Vernhettes S, Grandbastien MA, Casacuberta JM. 1997. In vivo characterization
of transcriptional regulatory sequences involved
in the defense-associated expression of the tobacco
retrotransposon Tnt1. Plant Mol. Biol. 35:673-679.
Wessler SR.1996. Plant retrotransposons: turned on by stress. Curr.
Biol. 6:956-961.
Xu Y, Zhu Q, Panbangred W, Shirasu K, Lamb C. 1996. Regulation,
expression and function of a new basic chitinase gene in rice
(Oryza sativa L.). Plant Mol. Biol. 30:387-401.
Notes
Chimeric receptor kinases for plant disease
resistance engineering in rice
Zuhua He, Zhiyong Wang, Qun Zhu, Jianming Li, C. Lamb, J. Chory, and P. Ronald
Authors’ address: Biotechnology Institute, Zhejiang University,
Huajiachi, Hangzhou 310029, China. E-mail:
lidb@mail.hz.zj.cn.
Incompatible interactions between plants and pathogens are characterized by defense responses such as the oxidative burst,
hypersensitive cell death, and defense-gene activation. These interactions are often “gene-for-gene” specific. Developing a
nonspecific disease resistance strategy is important. We designed chimeric receptors that combined the intracellular domain
of the rice receptor kinase Xa21 conferring bacterial blight resistance with the extracellular ligand-binding domains from other
proteins. Cell death and an oxidative burst were observed in cell lines expressing the Xa21 gene when inoculated with an
avirulent strain of Xanthomonas oryzae pv. oryzae (Xoo) but not with a virulent strain or in the wild-type cell line. Transcription
of two defense-related genes, RCH10 and PAL, was induced, whereas OsCatB was down-regulated in the incompatible interaction.
One of the chimeric receptors, NRG1 (novel receptor gene), which consisted of the extracellular and transmembrane
domains of the Arabidopsis brassinosteroid receptor (BRI1) and the XA21 kinase domain, was constitutively expressed in rice
cell lines. These cell lines displayed cell death, RCH10 and PAL activation, and OsCatB suppression when treated with the
ligand brassinolide (BL), as compared with wild-type and mutant controls. Another chimeric receptor-like kinase, NRG6, which
combined the extracellular chitin-binding (Hevein) domain of rice chitinase with the XA21 transmembrane and kinase domains,
also showed cell death, an oxidative burst, and defense-related gene activation/suppression in constitutive-expression cell
lines after treatment with chitin. The NRG1 and NRG6 plants exhibited dwarfism and partial disease resistance to Xoo. Our work
provides a new approach for the design of novel signaling genes controlling plant disease resistance and development, and for
the discovery of ligands for leucine-rich-repeat receptor kinases.
Plant disease resistance occurs when a plant carrying a resistance
(R) gene is attacked by a pathogen carrying a corresponding
avirulence (Avr) gene. This incompatible interaction leads
to the hypersensitive response (HR) characterized by cell death
at infected sites. Other resistance responses include an oxidative
burst, activation of defense-related genes, cell wall reinforcement,
and the production of phytoalexins. It has been proposed
that R (defense-related) proteins interact with corresponding
Avr (avirulence) proteins in a ligand-receptor mechanism
that triggers cell death and disease responses. In support
of this hypothesis, direct physical interaction between the tomato
R protein PTO and the Avr protein AvrPTO has been
observed. Cell death and defense responses are triggered following
many R and Avr protein interactions. Most cloned R
genes confer race-specific resistance, limiting their application
for plant disease control. The development of a nonspecific
disease resistance strategy is therefore of scientific and
agronomic interest.
Gene isolation and function 425

LRR TM JM Kinase
XA21
LRR TM JM Kinase
BRI1
Hevein
Catalytic domain
RCH10
Constructs
35S
LRR TM JM Kinase
NOS-ter
NRG-1
35S
35S
35S
35S
LRR mutant
G611E
LRR TM JM
TM JM Kinase
Kinase mutant
K737E
Hevein TM JM Kinase
Hevein
TM
JM
Kinase mutant
K737E
NOS-ter
NOS-ter
NOS-ter
NOS-ter
NRG1mL
NRG1mK
NRG6
NRG6mK
Fig. 1. Schematic diagram of chimeric
receptor kinases NRG1 and
NRG6 and mutant controls. The
XA21 and BRI1 or RCH10 proteins
are indicated by gray and empty
boxes, respectively. Chimeras
NRG1, NRG1mL, and NRG1mK
carry the BRI1 LRR, TM, and JM
domains and the XA21 kinase domain.
NRG6 and NRG6mK carry the
RCH10 signal and Hevein domains
and the XA21 TM and cytoplasmic
kinase domains. All chimeras are
driven by the cauliflower mosaic
virus 35S promoter in rice cells.
We constructed chimeric receptor-like kinases: NRG1
(novel receptor gene 1), which consists of the leucine-rich repeat
(LRR) and transmembrane (TM) domains of the
Arabidopsis brassinosteroid receptor kinase BRI1 and the
XA21 kinase domain (He et al 2000); and NRG6, which consists
of the Hevein domain of rice chitinase RCH10 (Zhu and
Lamb 1994) and the XA21 domain (Song et al 1995). The
Hevein domain is a high-affinity chitin-binding domain present
in some chitinases and other chitin-binding proteins. Treatment
of the NRG1 cell lines with the ligand brassinolide (BL)
and the NRG6 cell lines with the ligand chitin results in cell
death and activation of defense-related genes.
Results
Construction and transgenic rice cell lines
of NRG1 and NRG6
The novel receptor gene constructs NRG1 and NRG6 and their
mutant controls are shown in Figure 1. NRG1 consists of the
BRI1 LRR, TM, and juxtamembrane (JM) domains and the
XA21 kinase domain, which encodes a protein with 1,197
amino acids. NRG1mL and NRG1mK are identical to NRG1,
except that NRG1mL carries a mutant in the BRIl LRR domain
(bin-113, G611E) 19 and NRG1mK carries the XA21 kinase
domain mutant (K737E) by in vitro mutagenesis. The
XA21 (K737E) mutant was previously shown to lack kinase
activity in vitro (Song and Ronald, unpublished data). NRG6
consists of the Hevein domain-coding region, including the
signal peptide of the rice chitinase RCH10 and the coding region
of the TM, JM, and kinase domains of XA21, which encodes
a protein of 463 amino acids. NRG6mK is identical to
NRG6, except for the fact that the kinase domain carries a
mutation in lysine 737 (K737E). The japonica rice cultivar
Taipei 309 was transformed with the chimeric constructs. Suspension
cell lines were established from transformants NRG1-
30, NRG1-34 expressing NRG1, NRG1mL, NRG1mK, NRG6-
39, NRG6-61 expressing NRG6, NRG6mK, and the
nontransgenic Taipei 309 as described below. Northern blotting
and western blotting indicated that the chimeric proteins
of NRG1, NRG1mL and NRG1mK, and NRG6 and NRG6mK
could be expressed probably as membrane-bond proteins (data
not shown).
Brassinolide and chitin induce cell death
and oxidative burst in NRG1 and NRG6 cell lines
The NRG1 and NRG6 cell lines undergo cell death in response
to BL (2 µm) and chitin (200 ng mL –1 pentamer and hexamer),
respectively. Evans blue staining showed that cell death was
induced in the two NRG1 independent cell lines, NRG1-30
and NRG1-34, after treatment for 24 h with BL (Fig. 2A), and
in the two NRG6 cell lines, NRG6-39 and NRG6-61, after
treatment with chitin (Fig. 3A), compared with the controls,
respectively. The observation that chitin is an inducer of plant
defense responses may account for the higher background cell
death induced by chitin in the control cell lines. Using a modified
ferrous oxidation method, a detectable oxidative burst was
observed in the NRG1 and NRG6 cell lines 30 min after BL
and chitin treatment compared with control cell lines (Figs.
426 Advances in rice genetics

Dye-binding increase (%) over control
35
A
30
25
20
H 2 O 2 levels (nM)
2,500
2,000
B
15
10
5
0
NRG1-30
NRG1-34
NRG1mL
NRG1mK
Taipei 309
1,500
1,000
NRG1-30
NRG1-34
NRG1mL
NRG1mK
Taipei 309
Fig. 2. Cell death and an oxidative burst
induced by brassinolide (BL) treatment
of the NRG1 cell lines. (A) Cells were
stained with Evans blue and washed with
water to remove excessive dye. Cell
death is observed as a dye-binding increase
in cell lines treated with 2 µm
BL for 24 h. (B) An oxidative burst is induced
in cell lines treated with BL for
30 min. Control is shown in white column,
treatment in solid column.
Dye-binding increase (%) over control
80
A
70
60
50
40
30
20
10
0
NRG6-39
NRG6-61
NRG6mK
Taipei 309
H 2 O 2 levels (nM)
2,000
1,900
1,800
1,700
1,600
1,500
1,400
1,300
1,200
1,100
1,000
NRG6-39
NRG6-61
NRG6mK
B
Taipei 309
Fig. 3. Cell death and an oxidative
burst induced by chitin treatment
of the NRG6 cell lines. (A) Cell
death is observed in cell lines
treated with chitin (200 ng mL –1 )
for 24 h. (B) An oxidative burst is
induced in cell lines treated with
chitin for 30 min. Control is shown
in white column, treatment in solid
column.
2B, 3B). Similarly, cell death and an oxidative burst were observed
in the Xa21 cell line inoculated with the incompatible
Xoo race P6 20 . These results indicate that BL and chitin can
trigger cell death in the NRG1 and NRG6 cell lines, respectively.
Brassinolide and chitin induce/repress defenserelated
genes in NRG1 and NRG6 cell lines
Activation of the XA21 signal leads to rapid and strong transcription
of the rice defense-related genes, RCH10 and PAL
(phenylalanine ammonia-lyase), and a decrease in OsCatB
(catalase B) transcription. In the NRG1 cells, BL could transcribe
accumulation of RCH10 and PAL, with the peak (fiveto
eightfold) occurring 4–8 h after BL treatment (Fig. 4). In
contrast, neither NRG1mL and NRG1mK nor Taipei 309 cells
showed an induction of RCH10 and PAL. Similarly, we found
that chitin induced a stronger transcription of RCH10 and PAL
in the NRG6 cell lines, with peak levels (12–16-fold) occurring
2–8 h for PAL and 24 h for RCH10 after chitin treatment
(Fig. 5). In contrast, the control cell lines NRG6mK and Taipei
309 showed reduced induction (three- to fourfold) of RCH10
and PAL by chitin. Similar to observations in XA21 cell lines
(He et al 2000), accumulation of OsCatB transcripts decreased
in the NRG1 and NRG6 cell lines after BL and chitin treatment,
respectively, whereas the control cell lines exhibited no
change (Figs. 4, 5). Transcript levels of OsCatB increased in
all cell lines 24 h after chitin treatment (Fig. 5), suggesting
that the chitin-induced defense response might involve multiple
pathways.
The transgenic plants NRG1 and NRG6 (T 0 ) were dwarf
and sterile, whereas the control plants showed no difference
compared with the wild-type Taipei 309 (data not shown). We
observed that the NRG1 plants treated with BL and NRG6
plants nontreated exhibited partial disease resistance to Xoo
in preliminary experiments (data not shown), although we could
not conduct a detailed disease resistance assay because of the
lack of T 1 plants. Brassinosteroids produced in plants could
activate the NPR1 kinase, leading to the constitutive activation
of a plant defense response. Similarly, the observation
that β-[1-4]-N-acetylglucosamine (GlcNAc) residues, compo-
Gene isolation and function 427

NRG1-30
NRG1-34
0 2 4 8 12 24 0 2 4 8 12 24 (h)
RCH10
PAL
CatB
rRNA
NRG1mL NRG1mK Taipei 309
0 2 4 8 12 24 0 2 4 8 12 24 0 2 4 8 12 24 (h)
RCH10
PAL
CatB
rRNA
Fig. 4. Increase or decrease in rice defense-related gene transcripts after brassinolide (BL) treatment. Northern
blotting shows transcript accumulation of RCH10, PAL, and OsCatB in cell lines treated with 2 µm BL over 0, 2, 4,
8, 12, and 24 h.
NRG6-39 NRG6-61 NRG6mK
Taipei 309
0 2 8 24 0 2 8 24 0 2 8 24 0 2 8 24 (h)
RCH10
PAL
OsCatB
rRNA
Fig. 5. Increase or decrease in rice defense-related gene transcripts after chitin treatment. Northern blotting
shows transcript accumulation of RCH10, PAL, and OsCatB in cell lines treated with chitin (200 ng mL –1 ) over 0,
2, 8, and 24 h.
nents of chitin, are abundant in plant cell walls may account
for the phenotypes of the NRG6 plants. GlcNAc may serve as
a ligand for the chimeric receptor and may activate constitutive
defense responses.
Discussion
We have shown that two chimeric receptor-like kinases can
initiate plant defense responses, including cell death, an oxidative
burst, and defense-related gene induction or repression,
in response to the chemical ligands BL and chitin treatment
(Figs. 2–5). Transmembrane signaling via ligand-induced activation
of receptor kinases, characterized by dimerization and
autophosphorylation of kinases, plays an important role in signal
transduction controlling cell growth and disease (Hunter
2000). Our results provide evidence that chimeric receptors
may be good tools for investigating signal transduction in both
plant cells and animal cells.
BRI1 is a membrane-bond protein (Friedrichsen et al
2000), demonstrating that the chimeric NRG1 protein is a receptor
kinase of membrane-localization as revealed by
immunodetection (data not shown). Similarly, the RCH10 protein
lacks a C-terminal vacuolar targeting signal and is thought
to be an extracellular protein (Nishizawa et al 1993). Our pre-
428 Advances in rice genetics

liminary results also indicate that the Hevein-XA21 protein
co-purifies with the membrane fraction (data not shown). These
results suggest that BL and chitin molecules can be perceived
at the cell surface by the LRR domain of BRI1 and the Hevein
domain of RCH10 to initiate intracellular XA21 kinase signaling
via dimerization and phosphorylation of the chimeric
kinase.
We observed that the NRG1 and NRG6 plants exhibited
partial disease resistance to Xoo (data not shown), suggesting
that chimeric receptors could be used to engineer broad-spectrum
disease resistance. However, the NRG1 and NRG6 plants
were dwarfed and sterile. It may be possible to manipulate
healthy transgenic plants expressing NRG1 and NRG6 driven
by a weaker or BL- and chitin-inducible promoter, respectively.
Our results indicate that the Xa21 gene can be used as a foundation
for designing novel genes conferring broad-spectrum
disease resistance in cereals. Several approaches may be possible:
(1) The catalytic domain of XA21 can be fused to known
ligand-binding domains such as NRG1 and NRG6 and the
defense response is triggered by ligand treatment; (2) It could
be possible to design disease resistance receptors with ligandbinding
domains recognizing virulence factors common to
many plant pathogens; (3) Broader-spectrum resistance could
be achieved by combining the Avr protein-binding domains of
multiple R gene products and fusing them to the XA21 catalytic
domain.
He Z, Wang Z-Y, Li Z, Zhu Q, Lamb C, Ronald P, Chory J. 2000.
Perception of brassinosteroids by the extracellular domain of
the receptor kinase, BRI1. Science 288:2360-2363.
Hunter T. 2000. Signaling: 2000 and beyond. Cell 100:113-127.
Nishizawa Y, Kishimoto N, Saito A, Hibi T. 1993. Sequence variation,
differential expression and chromosomal location of rice
chitinase genes. Mol. Gen. Genet. 241:1-10.
Song WY, Wang GL, Chen LL, Kim HS, Pi LY, Holsten T, Gardner
J, Wang B, Zhai WX, Zhu LH, Fuquest C, Ronald P. 1995. A
receptor kinase-like protein encoded by the rice disease resistance
gene, Xa21. Science 270:1804-1806.
Zhu Q, Lamb CJ. 1994. Isolation and characterization of a rice gene
encoding a basic chitinase. Mol. Gen. Genet. 226:289-296.
Notes
Authors’ addresses: Zuhua He, Biotechnology Institute, Zhejiang
University, Hangzhou 310029, China; Zuhua He and P.
Ronald, Department of Plant Pathology, UC Davis, Davis, CA
95616; Zuhua He, Zhiyong Wang, Qun Zhu, Jianming Li, C.
Lamb, and J. Chory, Plant Biology Laboratory, The Salk Institute
for Biological Studies, La Jolla, CA 92037; C. Lamb,
John Innes Centre, Norwich, NR47UH, UK; J, Chory, The
Howard Hughes Medical Institute, The Salk Institute for Biological
Studies, La Jolla, CA 92037. Current address: Qun
Zhu, Dupont Company, Wilmington, DE 19880-0402;
Jianming Le, Department of Biology, University of Michigan,
Ann Arbor, MI 48190-1048, USA.
References
Friedrichsen D, Joaziro C, Li J, Hunter T, Chory J. 2000.
Brassinosteroid-insensitive-1 is a ubiquitously expressed leucine-rich
repeat receptor serine/threonine kinase. Plant Physiol.
123:1247-1255.
Jasmonic acid- and salicylic acid-mediated defense signal
transduction in rice
Y. Yang, M. Qi, M.-W. Lee, and L. Xiong
A combination of molecular, biochemical, and genomic approaches is being used to study jasmonic acid (JA)- and salicylic acid
(SA)-mediated defense signal transduction in rice. By generating and analyzing SA-deficient transgenic rice, we have demonstrated
that SA acts as a preformed antioxidant to modulate redox balance and prevent rice plants from suffering from oxidative
damage caused by aging and biotic and abiotic stresses. In contrast, JA appears to function as an important signal molecule
in rice for inducing systemic acquired resistance against pathogen infection. To gain further insights into SA- and JA-mediated
defense signal transduction in rice, we isolated a large number of JA-, benzothiadiazole (BTH)-, and/or blast fungus-induced
immediate early (IE) genes, whose transcription is independent of de novo protein synthesis. Sequence analysis shows that
these IE genes encode putative protein kinases, transcription factors, and other potential signaling components. A JA-inducible
IE gene that encodes a Myb transcription factor was found to be associated with blast infection and lesion formation by
promoting host cell death. Further analysis of these IE genes will not only enhance our understanding of defense signal
transduction in rice, but also facilitate the development of novel strategies for disease control.
Gene isolation and function 429

Endogenous secondary signals such as jasmonic acid (JA) and
salicylic acid (SA) play an important role in induced resistance
against pathogen infection and insect herbivory. Salicylic
acid is a key endogenous secondary signal involved in
activating plant defense response. A synthetic analogue of SA
such as benzothiadiazole (BTH) has been commercially used
as an inducer of systemic acquired resistance (SAR) for disease
control in the field. Recently, jasmonic acid was also demonstrated
to play an important role in inducing disease resistance
responses through a distinct, SA-independent signaling
pathway. Therefore, multiple endogenous molecules (including
SA, JA, and ethylene) are involved in the complex network
of signaling pathways that leads to local and systemic
resistance. Furthermore, cross-talk between these defense signaling
pathways appears to be very common and important in
regulating plant defense responses.
To date, the majority of the research in defense signaling
mechanisms has focused on dicot species such as
Arabidopsis and tobacco, whereas in economically important
cereal crops our understanding of signal transduction leading
to disease resistance is limited (Piffanelli et al 1999). Only a
few signaling components (e.g., small-GTP binding protein,
MAP kinase; Kawasaki et al 1999, Kim et al 1999) and a dozen
defense genes (e.g., PR-1, PBZ1, β-glucanase, chitinase, phenylalanine
ammonia lyase, HMG-CoA reductase) have been
isolated from rice and implicated to be involved in host defense
response. Therefore, efforts are required to identify novel
signaling components and to elucidate signal transduction
mechanisms involved in rice defense responses.
Role of SA and JA in rice defense signaling
In contrast to tobacco and Arabidopsis, both of which contain
low basal levels of SA (0.01–0.1 µg g –1 fresh weight), rice has
high levels of SA (5–20 µg g –1 fresh weight, Silverman et al
1995). To elucidate the potential role of SA in rice disease
resistance, SA-deficient transgenic rice Nipponbare was generated
via Agrobacterium-mediated transformation by
overexpressing a bacterial salicylate hydroxylase gene (nahG)
that degrades SA. HPLC analysis indicates that these transgenic
rice plants contain

Kawasaki T, Henmi K, Ono E, Hatakeyama S, Iwano M, Satoh H,
Shimamoto K. 1999. The small GTP-binding protein Rac is a
regulator of cell death in plants. Proc. Natl. Acad. Sci. USA
96:10922-10926.
Kim WY, Kim CY, Cheong NE, Choi YO, Lee KO, Lee SH, Park
JB, Nakano A, Bahk JD, Cho MJ, Lee SY. 1999. Characterization
of two fungal-elicitor-induced rice cDNAs encoding
functional homologues of the rab-specific GDP-dissociation
inhibitor. Planta 210:143-149.
Piffanelli P, Devoto A, Schulze-Lefert P. 1999. Defense signaling
pathways in cereals. Curr. Opin. Plant Biol. 2:295-300.
Silverman P, Seskar M, Kanter D, Schweizer P, Metraux J-P, Raskin
I. 1995. Salicylic acid in rice: biosynthesis, conjugation and
possible role. Plant Physiol. 108:633-639.
Notes
Authors’ address: Department of Plant Pathology, University of
Arkansas, Fayetteville, Arkansas 72701, USA.
Alternative splicing bestows capacity for nuclear
expression and mitochondrial targeting in rice
K. Kadowaki and N. Kubo
The gene content of the plant mitochondrial genome is much larger than that of animals, insects, etc. A striking example exists
in liverwort and Arabidopsis, in which 16 and 9 kinds of ribosomal protein genes have been identified, respectively, whereas
none of these genes are encoded in mammals and yeast. The rice mitochondrial genome has a sequence homologous to that
of the gene for ribosomal protein S14 (rps14), but the coding sequence is interrupted by internal stop codons. A functional
rps14 gene was isolated from the rice nuclear genome, suggesting a gene-transfer event from the mitochondrion to the
nucleus. The nuclear rps14 gene encodes a long N-terminal extension showing significant similarity to a part of mitochondrial
succinate dehydrogenase subunit B (SDHB) protein from humans. Isolation of a functional rice sdhB cDNA and subsequent
sequence comparison to the nuclear rps14 indicates that the 5′ portions of the two cDNAs are identical. The sdhB genomic
sequence shows that the SDHB-coding region is divided into two exons. Surprisingly, the RPS14-coding region is located
between the two exons. DNA gel blot analysis indicates that both sdhB and rps14 are present at a single locus in the rice
nucleus. These findings strongly suggest that the two gene transcripts result from a single mRNA precursor by alternative
splicing. The migration of the mitochondrial rps14 sequence into the already existing sdhB gene could bestow capacity for
nuclear expression and mitochondrial targeting.
The endosymbiont hypothesis for mitochondrial origin has
generally been accepted (Gray 1992). The gene content of the
plant mitochondrial genome is much larger than that of animals,
insects, etc. (Brennicke et al 1993). A striking example
exists in liverwort and Arabidopsis, in which 16 and 9 kinds
of ribosomal protein genes have been identified, respectively,
whereas none of these genes are encoded in mammals and yeast
(Oda et al 1992, Unseld et al 1997). Several plant mitochondrial
genomes have been shown to contain pseudogenes, and
the total gene content of the mitochondrial genome is not always
the same among higher plant species, including even
evolutionarily related species. These observations suggest that
gene-transfer events from the mitochondrion to the nucleus
are carried out by an active process in plants (Brennicke et al
1993). However, knowledge of gene transfer followed by a
gene activation process is still very limited.
We report a gene-transfer event and a process of acquisition
for a targeting signal as well as a nuclear expression. An
alternative splicing event supplies the same targeting signal to
different proteins and activates a newly transferred mitochondrial
protein gene in the nucleus.
Materials and methods
Etiolated seedlings of rice cv. Nipponbare were used as plant
material. Handling of DNA, RNA, and proteins is described
(Sambrook et al 1989).
Results
rps14-related sequence in rice mitochondrial
genome is not functional
A mitochondrial DNA library of rice was screened by using
the liverwort rps14 gene as a probe to determine the organization
of the rps14 gene in rice. A clone was successfully obtained
and its DNA was sequenced. The nucleotide sequence
indicated that an rps14-homologous sequence was located one
nucleotide downstream of an rpsl5 gene. The nucleotide and
deduced amino acid sequence comparison with those from
other plant species showed that the rice rpsl5 gene retains an
intact open reading frame (ORF), whereas the original reading
frame of rps14 is interrupted by nucleotide deletions at
four positions.
Gene isolation and function 431

ps14 cDNA
Genomic
structure
sdhB cDNA
poly(A)
poly(A)
740 nt 1,142 nt
Fig. 1.Schematic representation of rice
nuclear rps14 and sdhB genes. Boxes
and thin lines represent protein coding
sequence and nontranslated regions,
respectively. The box with horizontal
lines represents the rps15 gene. rps14-
homologous regions are shown by black
boxes. sdhB-related regions are shown
by hatched boxes. Putative mitochondrial
targeting signals are indicated by
boxes with dots.
Functional mitochondrial rps14 is encoded
in the nuclear genome
Because the mitochondrial-encoded rps14 sequence in rice is
a pseudogene, a functional rps14 gene is likely to be encoded
in the nuclear genome. A rice cDNA library made from
poly(A)+RNA was screened by using the rice mitochondrial
rps14 pseudogene sequence as a probe, resulting in the identification
of nine positive cDNA clones. The largest cDNA clone
includes an ORF capable of encoding 350 amino acids.
A nuclear-encoded rps14 gene carries a long
N-terminal extension homologous to a part
of the sdhB gene
The deduced amino acid sequence of the nuclear rps14 gene
has an additional 250 amino acid residues at the N-terminal
region compared with the mitochondrial rps14 genes from other
plants. Interestingly, a protein database search indicated that
the extended portion (positions 49–225) showed a significant
amino acid sequence similarity to mitochondrial SDHB, which
is a component of complex II in the respiratory chain from
humans, yeast, and a malarial parasite (Plasmodium
falciparum).
Because the homologous part is just a part of the sdhB
gene from other species, the rice cDNA library was screened
by using the sdhB-homologous region of the nuclear rps14
cDNA clone as a probe. The rice sdhB gene isolated showed
58% and 57% amino acid identity to the human and P.
falciparum SDHB, respectively. It is surprising that the sdhB
and the nuclear rps14 genes of rice have identical nucleotide
sequences not only for their coding regions but also for the 5′
flanking sequences.
Alternative splicing event is involved for expression
Cloning of the sdhB genomic sequence was carried out by using
the sdhB cDNA as a probe and four clones were isolated.
Nucleotide sequence analysis and sequence comparison of the
isolated genomic clones indicated that the sequence order is
the 5′ end, the sdhB-rps14 common region, an intron, the
RPS14-coding region, an intron, the C-terminal region specific
for the sdhB gene, and the 3′ end (Fig. 1). According to
this scheme, three exons are separated by two introns. Each of
the four isolated clones has the same physical structure as the
clone sequenced, confirming that the sdhB-rps14 genomic sequence
represents a single locus. The expressions of the sdhB
and the nuclear rps14 genes were examined by RNA gel blot
analysis. A 1.2-kb band was detected with all three probes.
Considering the size of the sdhB (1,132 nt) and the nuclear
rps14 (1,233 nt) cDNAs, the size of the 1.2-kb band is in good
agreement with the sizes of the two cDNA clones. Splicing
events of the two gene transcripts were also confirmed by reverse
transcription-polymerase chain reaction (data not shown).
The deduced amino acid sequence of the nuclear
rps14 gene has an N-terminal extension that seems
to be a targeting signal to mitochondria
To clarify whether the targeting signal is cleaved off after protein
import into mitochondria, the antirice RPS14 antibody
was raised in a rabbit, and protein blot analysis was carried
out by using antibodies against rice RPS14 and P. falciparum
SDHB proteins. A 16.5-kDa peptide was detected when the
anti-RPS14 antibody was used. The size of this peptide is
smaller than that of the RPS14 peptide, as deduced from the
nuclear rps14 cDNA sequence (39.1 kDa). The size of the 16.5-
kDa peptide is larger than that of the predicted mitochondrialencoded
RPS14 peptide (approximately 12 kDa), but it is suspected
that most of the SDHB-homologous region has been
removed.
A signal of 27.2 kDa was detected with the anti-P.
falciparum SDHB antibody, implying translation and import
of the SDHB protein into mitochondria. The peptide size of
27.2 kDa is 3.9 kDa shorter than that of the SDHB peptide
deduced from the sdhB cDNA sequence (31.1 kDa) and similar
to that of eubacteria, suggesting processing of SDHB protein
after protein import.
Discussion
A mitochondrial sequence that has migrated into a nucleus
needs to acquire many sequence elements (e.g., promoter, mitochondrial
targeting signal for protein import, and
polyadenylation signal) for its functional expression because
of the difference in gene expression systems between the
nucleus and mitochondrion. The alternative splicing event
found in this study is an example of the acquisition of a targeting
signal. In short, a transferred mitochondrial sequence could
acquire both a nuclear expression system and a mitochondrial
targeting signal through its integration with an already existing
mitochondrial protein gene in the nucleus (Kubo et al 1999).
432 Advances in rice genetics

Mitochondrion
Nucleus
Transfer
sdhB
Intron
Targeting signal
Transfer
rps14
Alternative splicing
Protein import
sdhB
transcript
rps14
transcript
Fig. 2.Model for the gene transfer of sdhB
and rps14. Rice nucleus and mitochondrion
are shown by a rectangle and an
enclosure, respectively. Exons and introns
are represented by boxes and broken
lines, respectively. Black and hatched
circles represent the products of rps14
and sdhB genes, respectively. Other symbols
correspond to those in Figure 1.
References
Brennicke A, Grohmann L, Hiesel R, Knoop V, Schuster W. 1993.
The mitochondrial genome on its way to the nucleus: different
stages of gene transfer in higher plants. FEBS Lett.
325:140-145.
Gray MW. 1992. The endosymbiont hypothesis revisited. Int. Rev.
Cytol. 141:233-357.
Kubo N, Harada K, Hirai A, Kadowaki K. 1999. A single nuclear
transcript encoding mitochondrial RPS14 and SDHB of rice
is processed by alternative splicing: common use of the same
mitochondrial targeting signal for different proteins. Proc. Natl.
Acad. Sci. USA 96:9207-9211.
Oda K, Yamato K, Ohta E, Nakamura Y, Takemura M, Nozato N,
Akashi K, Kanegae T, Ogura Y, Kohchi T. 1992. Gene organization
deduced from the complete sequence of liverwort
Marchantia polymorpha mitochondrial DNA: a primitive form
of plant mitochondrial genome. J. Mol. Biol. 223:1-7.
Sambrook J, Fritsh EF, Maniatis T. 1989. Molecular cloning: a laboratory
manual. 2nd ed. Plainview, N.Y. (USA): Cold Spring
Harbor Laboratory Press.
Unseld M, Marienfeld JR, Brandt P, Brennicke A. 1997. The mitochondrial
genome of Arabidopsis thaliana contains 57 genes
in 366,924 nucleotides. Nat. Genet. 15:57-61.
Notes
Authors’ address: National Institute of Agrobiological Resources,
Department of Genetic Resources II, Kannondai 2-1-2,
Tsukuba, Ibaraki 305-8602, Japan.
Acknowledgments: We thank Professor K. Ohyama for providing
the liverwort rps14 gene, Professor K. Kita for providing the
anti-P. falciparum SDHB antibody, and Drs. A. Hirai and K.
Harada for helpful discussions. This work was partly supported
by a grant from the Ministry of Agriculture, Forestry,
and Fisheries to K. Kadowaki and by a Japan Society for the
Promotion of Science research fellowship for junior scientists
to N. Kubo.
Gene isolation and function 433

Transferring the ribosomal protein S10 gene
from the mitochondrion to the nucleus in rice
N. Kubo, X. Jordana, K. Harada, and K. Kadowaki
The mitochondrial genome contains only a few genes and most mitochondrial proteins seem to be encoded by the nuclear
genome, suggesting a gene transfer event from the mitochondrion to the nucleus during evolution. However, little is known
about the details of such gene transfer events. We report that a gene for mitochondrial ribosomal protein S10 (rps10) has been
transferred to the nucleus in rice. The rps10 is encoded by the mitochondrial genome in potato and pea, but is absent from the
rice mitochondrial genome and has been transferred to the nucleus. Interestingly, there are two rps10 genes in the rice nucleus
and their transcript abundance differs. Protein blot analysis detected the RPS10 protein in rice mitochondria, although the
RPS10 has no N-terminal presequence for protein targeting to mitochondria. This result suggests that targeting information is
encoded in their internal region. Genomic sequence analysis indicated that each rps10 gene has an intron in the 5′ untranslated
region and that their intron sequences are homologous to each other. This result strongly suggested that a duplication event
occurred after the transfer of the rps10 gene to the nucleus.
It is now generally accepted that mitochondria are descendants
of endosymbiont bacteria (Gray 1992). The mitochondrial genome
contains only a few genes and most mitochondrial proteins
seem to be encoded by the nuclear genome and imported
into the mitochondria. Different gene contents of current plant
mitochondrial genomes suggest an ongoing process of gene
transfer from the mitochondrion to the nucleus during evolution
(Brennicke et al 1993). However, little is still known about
the details of such gene transfer events.
In previous studies, we analyzed several mitochondrial
ribosomal protein genes from rice (Handa et al 1998, Kadowaki
et al 1996, Kubo et al 1996, 1999, Zanlungo et al 1995). In
these studies, we found that a sequence homologous to ribosomal
protein S10 genes (rps10) has been lost from the rice mitochondrial
genome and is present in the nuclear genome. The
rps10 genes have been identified in the mitochondrial genomes
of potato and pea, but are absent in Arabidopsis, Oenothera,
and wheat (Knoop et al 1995, Zanlungo et al 1995). In rice,
two copies of the rps10 genes are present and transcribed in
the nuclear genome. Their deduced protein sequences show
no additional apparent N-terminal presequences for mitochondrial
targeting, suggesting that targeting information is encoded
in the internal region. The process of rps10-gene transfer and
subsequent duplication of the rps10 gene are discussed.
Materials and methods
Nucleic acid preparation; DNA, RNA, and protein blot analyses;
construction and screening of recombinant libraries; and
nucleotide sequence analysis were performed as previously
described (Kadowaki et al 1996, Kubo et al 1999).
Results and discussion
The rps10 gene is located in the mitochondrial genome of potato
and pea (Knoop et al 1995, Zanlungo et al 1995). In contrast,
DNA gel blot indicates that an rps10-related sequence
has been completely lost from the mitochondrial genome and
has been transferred to the nuclear genome in rice. A rice cDNA
library was screened using the potato mitochondrial rps10 gene
as a probe to isolate the nuclear rps10 gene. Two kinds of
cDNA clones (s10-1, s10-2) were obtained, suggesting the
presence and transcription of two rps10-homologous sequences
in the rice nucleus. Their predicted amino acid sequences
showed 62–65% homology to the mitochondrial RPS10 from
potato and pea (Knoop et al 1995, Zanlungo et al 1995) and
showed 53–55% homology to the Arabidopsis nuclear RPS10
(Wischmann and Schuster 1995). Transcription of the rice
rps10 genes was analyzed by RNA gel blot analysis. A 0.8-kb
signal was detected using the coding region of the s10-1 cDNA
as a probe, in good agreement with the size of the s10-1 cDNA
(750 nucleotides). On the contrary, no signal was detected when
the 3′-flanking region of the s10-2 cDNA was used as an s10-
2 specific probe. This result strongly suggested that transcript
abundance of s10-2 is lower than that of s10-1.
In general, mitochondrial proteins encoded in the nuclear
genome have signals for mitochondrial targeting or the socalled
“presequences.” In Arabidopsis, the nuclear-encoded
RPS10 protein has an N-terminal extension as long as 100
amino acids (Wischmann and Schuster 1995). In contrast, the
rice RPS10 polypeptides have no apparent N-terminal extensions
for mitochondrial targeting. These results suggested that
mechanisms for mitochondrial targeting of RPS10 differ between
rice and Arabidopsis. To examine the presence of RPS10
in rice mitochondria, a protein blot analysis was carried out
using an antibody raised against potato RPS10. A band of expected
size (13.0 kDa) was detected in a soluble fraction of
rice mitochondrial proteins. Although the rice rps10 genes did
not appear to encode N-terminal extensions for presequence,
the rice RPS10 protein was detected in rice mitochondria. These
results suggested that targeting information of rice RPS10 proteins
is encoded in the internal region.
Isolation and nucleotide sequence analysis of the genomic
clones corresponding to the rps10 cDNAs revealed that each
434 Advances in rice genetics

s10-1 s10-2
Nucleus
Mitochondrion
Mitochondrial genome
Fig. 1. Model for the gene
transfer event of the rice
rps10 gene. Coding regions
and introns of rice nuclear
rps10 genes are shown by
open boxes and open triangles,
respectively.
rps10 gene has an intron at almost the same position in the 5′
untranslated region. Intron sequences are 1,283-bp and 1,683-
bp long, respectively, and share 51% identity. These results
strongly suggested the occurrence of duplication in the rps10
gene rather than two independent transfer events (Fig. 1).
References
Brennicke A, Grohmann L, Hiesel R, Knoop V, Schuster W. 1993.
The mitochondrial genome on its way to the nucleus: different
stages of gene transfer in higher plants. FEBS Lett.
325:140-145.
Gray MW. 1992. The endosymbiont hypothesis revisited. Int. Rev.
Cytol. 141:233-357.
Handa H, Kubo N, Kadowaki K. 1998. Genes for the ribosomal S4
protein encoded in higher plant mitochondria are transcribed,
edited, and translated. Mol. Gen. Genet. 258:199-207.
Kadowaki K, Kubo N, Ozawa K, Hirai A. 1996. Targeting
presequence acquisition after mitochondrial gene transfer to
the nucleus occurs by duplication of existing targeting signals.
EMBO J. 15:6652-6661.
Knoop V, Ehrhardt T, Lattig K, Brennicke A. 1995. The gene for
ribosomal protein S10 is present in mitochondria of pea and
potato but absent from those of Arabidopsis and Oenothera.
Curr. Genet. 27:559-564.
Kubo N, Harada K, Hirai A, Kadowaki K. 1999. A single nuclear
transcript encoding mitochondrial RPS14 and SDHB of rice
is processed by alternative splicing: common use of the same
mitochondrial targeting signal for different proteins. Proc. Natl.
Acad. Sci. USA 96:9207-9211.
Kubo N, Ozawa K, Hino T, Kadowaki K. 1996. A ribosomal protein
L2 gene is transcribed, spliced, and edited at one site in rice
mitochondria. Plant Mol. Biol. 31:853-862.
Wischmann C, Schuster W. 1995. Transfer of rps10 from the mitochondrion
to the nucleus in Arabidopsis thaliana: evidence
for RNA-mediated transfer and exon shuffling at the integration
site. FEBS Lett. 374:152-156.
Zanlungo S, Quioones V, Moenne A, Holuigue L, Jordana X. 1995.
Splicing and editing of rps10 transcripts in potato mitochondria.
Curr. Genet. 27:565-571.
Notes
Authors’ addresses: N. Kubo and K. Kadowaki, Department of Genetic
Resources II, National Institute of Agrobiological Resources,
Tsukuba, Ibaraki 305-8602; N. Kubo and K. Harada,
Faculty of Horticulture, Chiba University, Matsudo, Chiba
271-8510, Japan; and X. Jordana, Departamento de Genética
Molecular y Microbiología, Facultad de Ciencias Biológicas,
Pontificia Universidad Católica de Chile, Santiago, Chile.
Acknowledgments: This work was partly supported by a grant from
the Ministry of Agriculture, Forestry, and Fisheries to K.K.
and by a grant from the JSPS Research Fellowships for Young
Scientists to N.K.
Gene isolation and function 435

Hypothetical model of genetic regulation
of the glutelin biosynthesis pathway
Y. Takemoto, M. Ogawa, T. Kumamaru, T.W. Okita, and H. Satoh
To study the genetic regulation of the glutelin biosynthesis pathway, we induced the highly accumulated 57-kDa glutelin
precursor mutant (57H mutant) and characterized four 57H mutants, esp2, Glup1, glup2, and glup3. Electron-microscopic
observation showed that glutelin precursor in esp2, Glup1, and glup2 was deposited in the mutant-type protein body (PB)
derived from the endoplasmic reticulum (ER). Glutelin precursor and prolamin were mixed in the mutant-type PB; protein in
both Glup1 and glup2 was distributed separately in the PB. The glutelin precursors in glup3 were deposited in the PBII with
mature glutelin subunits. Glutelin extraction under several conditions indicates that the glutelin precursor and prolamin polypeptides
aggregate by an interchain S-S bond in esp2. Western blot analysis demonstrated that esp2 contained BiP and a calnexin, but
lacked protein disulfide isomerase (PDI). In esp2, the absence of PDI was considered to have caused glutelin precursor
retention in the ER by an irregular S-S bond with prolamin polypeptides. A partial cDNA clone of PDI was isolated and
sequenced. The PDI clone possessed a thioledoxin site and ER retention signal, KEDL, at the C-terminal. A comparison of
deduced amino acid sequences of PDIs from maize, wheat, and barley showed a shared identity of 84.2% to 84.9%. We
constructed a hypothetical model of genetic regulation of the glutelin biosynthesis pathway. The Esp2 gene regulated the
expression of PDI, which played an essential role in segregating the glutelin precursor and prolamin polypeptides in the ER. The
glup1 and Glup2 genes possibly controlled the transportation from the ER to the vacuole. The Glup3 gene regulated the
cleavage of the gluten precursor in the vacuole.
Rice seed storage proteins—glutelin and prolamin—are synthesized
on the endoplasmic reticulum (ER) and are deposited
into the distinct organelle. Glutelins are synthesized as the 57-
kDa glutelin precursor on the ER membrane (Yamagata et al
1982), transported into the vacuole, cleaved into mature glutelin
subunits, and accumulated in the vacuole component,
namely, as protein body (PB)II (Yamagata and Tanaka 1986).
Prolamin polypeptides are synthesized on the ER membrane
and stored as PBI within the ER lumen (Tanaka et al 1980,
Ogawa et al 1987). Relatively little work has been done on the
genetic regulation of the protein biosynthesis pathway.
We induced and characterized the highly accumulated
57-kDa polypeptide mutants (57H mutant) esp2, Glup1, glup2,
and glup3. The 57-kDa polypeptide accumulated in four mutants
reacted with both glutelin α (alpha) and β (beta) subunits,
showing that the 57-kDa polypeptide deposited in these
mutants is a glutelin precursor. Rice glutelin was extracted only
after the removal of globulin in wild types and mutants. Prior
removal of prolamin had no effect on the glutelin extraction
(Fig. 1). These results showed that glutelin and globulin coexisted
with some interaction in the PBII and prolamin had no
relation to glutelin deposition. In esp2, however, the prior removal
of prolamin in addition to globulin removal were essential
to the extraction of the glutelin precursor. This result
suggested that, in the esp2 mutant, the glutelin precursor and
prolamin polypeptides were deposited into the same PB and
formed the precursor-prolamin aggregates by an interchain
disulfide bond. In contrast, the extraction of the glutelin precursor
in the other three mutants required only the prior removal
of globulin.
To specify the deposition site of the glutelin precursor
in each mutant, developing endosperms of these mutants were
observed under an electron microscope (Fig. 2). Two types of
PBs—PBI and PBII—were observed in the developing endosperm
of wild-type Kinmaze as reported by Tanaka et al
(1980). In esp2, mutant-type PB and the normal-type PBII were
both observed. The immunolabeling analysis and PB isolation
demonstrated that the glutelin precursor accumulated in the
mutant-type PB with prolamin polypeptides. Other types of
mutant PB that are attached to the polysome were observed in
Glup1 and glup2 mutants. Although the glutelin antibody and
prolamin antibody reacted in each mutant-type PB, both antibodies
were distributed separately.
Rice glutelin is cleaved into mature glutelin in the vacuole
(Yamagata and Tanaka 1986). Glutelin precursor and prolamin
polypeptides were deposited together in the mutant-type
PBs, but both proteins were deposited separately. These results
suggested that the glutelin precursor of the three mutants
was deposited into the ER-derived PB with prolamin. In contrast,
in glup3, only normal types of PBI and PBII were observed.
The PB fractionation by sucrose density gradient centrifugation
showed that the glutelin precursors in glup3 were
fractionated with mature glutelin, indicating that these were
deposited in the PBII with mature glutelin subunits. These results
suggested that mutations in esp2, Glup1, and glup2 are
related to the sorting of glutelin precursors and prolamin
polypeptides in the ER or the transportation of glutelin precursor
from the ER to the vacuole, whereas those of glup3
were related to the cleavage of the glutelin precursor in the
vacuole.
The assembly of prolamin in the ER is mediated by binding
protein (BiP), a kind of chaperone (Li et al 1993, Muench
et al 1997). To clear the effect of the chaperones for 57H mutations,
esp2, Glup1, and glup2 were analyzed by western blot
436 Advances in rice genetics

0.5 M NaCl – + – + + – + – + + – + – + +
60% n-propanol – – – + – – – – + – – – – + –
5% 2-ME – – + – + – – + – + – – + – +
60% n-propanol
(kDa)
57
Wild type
40
20
esp2
Glup1
13
glup2
57
40
20
13
glup3
Fig. 1. SDS-PAGE
analysis of proteins
extracted by 1% lactic
acid from Kinmaze 57H
mutants after
preextraction with different
solvents. T =
total protein, + = pretreatment,
– = no pretreatment.
Wild type
esp2
Glup1
glup2
glup3
Fig. 2. Electron microscopic
observation of developing
endosperm of Kinmaze 57H
mutants.
using antibodies for three kinds of chaperone, BiP, protein disulfide
isomerase (PDI), and calnexin. Results showed that esp2
endosperm contained an amount of BiP and calnexin but lacked
PDI. The protein level of these chaperones in Glup1 and glup2
was almost the same as in the wild type (Fig. 3). Developmental
deposition analysis of glutelin, prolamin, PDI, and BiP in
the wild type showed that PDI expression synchronized with
the expression of glutelin (Fig. 4). This result suggested the
possibility that PDI affects the assembly and folding of the
glutelin precursor in the ER. In esp2, the absence of PDI was
considered to have caused the formation of the precursor-prolamin
aggregate by a disulfide bond, resulting in retention of
the glutelin precursor within the ER lumen. In Glup1 and glup2,
glutelin precursors and prolamin polypeptides may have been
deposited into the ER-derived PB; both proteins were not aggregated
because of PDI, supporting the hypothesis that PDI
plays a role in sorting glutelin precursors and prolamin polypeptides
in the ER.
A partial cDNA clone of PDI was isolated from the
cDNA library made from developing rice seed and sequenced.
The PDI clone possessed a thioledoxin site and ER retention
signal, and tetrapeptide KDEL at the C-terminal. Comparison
Gene isolation and function 437

Developing seed
Wild type
esp2
Glup1
glup2
Wild type
Mature seed
esp2
Glup1
glup2
(kDa)
3 4 5 6 7 8 9 10
57
40
BiP
20
13
BiP
PDI
57 kDa
α subunit
Calnexin
β subunit
Prolamin
Days after flowering
Fig. 4. Western blot analysis of developmental changes of seed storage
protein deposition and BiP and PDI activities in wild-type Kinmaze.
PDI
Fig. 3. Western blot analysis of the protein from
the mature and immature seed of 57H mutant
treated with anti-BiP, anti-calnexin, and anti-PDI
antibodies.
of the deduced amino acid sequence of PDIs from maize,
wheat, and barley showed that the PDIs shared 84.2% to 84.9%
identity. Northern blot analysis using the PDI clone as a pro