S. Sabet - LinkSCEEM

linksceem.eu

S. Sabet - LinkSCEEM

Molecular Biology and Computer

Based Data analysis

(Bioinformatics)

Salwa Sabet

Faculty of Science

Cairo University

Molecular Biology

• A molecular biologist

works on DNA, RNA

and Protein molecular

levels


Manual DNA Sequencing

Molecular Biology And PC-Based Data

Analysis Software

• Computer-based sequence analysis, notation,

and manipulation is a necessity for all molecular

biologists working with any but the most simple

DNA sequences.


Some analysis applications

• Compare nucleotide or protein sequences to sequence databse

• Predict open reading frames of the given DNA or RNA sequence

• Restriction mapping.

• Comparing betwwen different given sequences

• Predict Primary, secondary and tertiary protein structures from a

given DNA sequence

• Analyse protein structure such as:

• Sites annotated analysis

• Hydrophilicity

• Isoelectric point

• DNA sequencing analyze DNA molecules labeled with multiple

fluorescent dyes

• Primer Design for PCR

Molecular Biology And Computer

Based Data Analysis Software

• NCBI/BLAST (1988): The Basic Local Alignment

Search Tool (BLAST) that finds regions of local

similarity between sequences

• PC-GENE (1995)

• Omiga (2001)

• ABI PRISM (Apple computers)

• BioEdit (2007)


DNA Sequencing manually

DNA sequence using the sequencer

software


Core_4a DNA sequence Homology with

C_ED43

Query 37 AGCACGAATCCTAAACCTCAAAGAAAAACCAAACGTAACACCAACCGCCGCCCAATGGAC 96

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 283 AGCACGAATCCTAAACCTCAAAGAAAAACCAAACGTAACACCAACCGCCGCCCAATGGAC 342

Query 97 GTTAAGTTCCCGGGTGGTGGCCANATCGTTGGCGGAGTTTACTTGTTGCCGCGCAGGGGC 156

||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||

Sbjct 343 GTTAAGTTCCCGGGTGGTGGCCAGATCGTTGGCGGAGTTTACTTGTTGCCGCGCAGGGGC 402

Query 157 CCCAGATTGGGTGTGCGCGCGACTCGGAAGACTTCGGAGCGGTCGCAACCTCGTGGAAGA 216

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 403 CCCAGATTGGGTGTGCGCGCGACTCGGAAGACTTCGGAGCGGTCGCAACCTCGTGGAAGA 462

Query 217 CGCCAACCTATCCCCAAGGCGCGTCGACCCGAGGGAAGGTCCTGGGCACAACCAGGATAT 276

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 463 CGCCAACCTATCCCCAAGGCGCGTCGACCCGAGGGAAGGTCCTGGGCACAACCAGGATAT 522

Query 277 CCATGGCCTCTTTACGGTAATGAGGGTTGTGGGTGGGCAGGATGGCTCTTGTCCCCCCGT 336

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 523 CCATGGCCTCTTTACGGTAATGAGGGTTGTGGGTGGGCAGGATGGCTCTTGTCCCCCCGT 582

Query 337 GGCCCTCGACCGTCTTGGGGCCCAAATGATCCCCGGCGGAGGTCCCGCGATTTGGGTAAG 396

||| ||||||||||||||||||||||||||||||| ||||||||||| |||||||||||

Sbjct 583 GGCTCTCGACCGTCTTGGGGCCCAAATGATCCCCGCGGGAGGTCCCGCAATTTGGGTAAG 642

Query 397 GTCATCGATACCCTAACCTGCGGCTTCGCCGACCTCATGGGATACATCCCGCTCGTAGGC 456

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct 643 GTCATCGATACCCTAACCTGCGGCTTCGCCGACCTCATGGGATACATCCCGCTCGTAGGC 702

• Sequence Homology: 97%

Cairo University (Faculty of Science)

• The faculty of science has an

advanced computer lab. with

about 25 networked machines

running both windows and

linux.

• Computation and data

analysis for

synchrotron/biotech and

astrophysics research.

• The synchrotron/biotech

software is hkl2000.

• The astrophysics software is

HEAsoft. IDL is a common

software.


Faculty of Science approaches

• Molecular biology labs and research noticeably

increased in the past few years

• Building an infrastructure by which a molecular

biologist can have an easy access HPC based on

DNA, RNA and protein visualization and data

analysis

• Collaboration with other countries to build HPC

infrastructure

More magazines by this user
Similar magazines