GST M1 polymorphism lacks association with Handigodu syndrome

bioscipub.com

GST M1 polymorphism lacks association with Handigodu syndrome

Biotechnol. Bioinf. Bioeng. 2012, 2(1):628-631

GST M1 polymorphism lacks association with Handigodu syndrome

Suresh Basavaraj, Madhuri Digambareppa Biradar,

Suyamindra Subhash Kulkarni, Pramod Bhimrao Gai

Research Center for DNA Diagnostics, Department of Applied Genetics, Karnatak University,

Dharwad, Karnataka, 580003, India, Email: pramodbgai@gmail.com

ABSTRACT

Handigodu syndrome is a rare, early onset spondyloepimetaphyseal dysplasia endemic to malnad region of

Western Ghats of Karnataka, India. The disease follows predominantly autosomal dominant pattern of

inheritance, severely affecting the people belonging to socially deprived communities Channangi and

Chaluvadi. The study was designed to assess the relation between GSTM1 null polymorphism and Handigodu

syndrome risk. The analysis showed lack of statistical significance with null genotype of GSTM1 (OR=1.43,

95% CI= 0.67-3.08, X2=0.86, p=0.35). Present study suggested that there is no association between GSTM1

null polymorphism and Handigodu syndrome risk.

Keywords: Handigodu syndrome, ROS, Oxidative stress, GSTM1

INTRODUCTION

Handigodu syndrome is a rare, painful, endemic osteoarthritis affecting predominantly two

endogamous populations Channangi and Chaluvadi residing in malnad region of Western Ghats of

Karnataka, India. The syndrome is named after the village Handigodu from where, the first

incidence of the syndrome was reported. The syndrome is distributed in Channangi, Chaluvadi and

some other ethnic groups of Shimoga and Chikkamaglur districts. The syndrome was identified as

spondyloepimetaphyseal dysplasia (SEMD) which follows a predominantly autosomal dominant

pattern of inheritance [1] and further named as spondyloepimetaphyseal dysplasia, Handigodu type

(SEMD HG ) [2]. Radiographic investigations of affected individuals shows narrowing of the joint

space, irregularity and sclerosis of articular margins, presence of osteophytes, protrusio acetabuli,

flattening of femoral head, flattening and fragmentation of epiphyses, coxa vara, subchondral

sclerosis, small pelvis, wedge-shaped vertebrae, irregularity of end plates, and platyspondyly [1,3].

Earlier efforts by National Institute of Nutrition and Indian Council for Medical Research could not

attribute the cause to pesticide bioaccumulation or trace metals causing genotoxicity. Hence the

present study is an effort to test the association of polymorphism of GSTM1 gene, one of the key

role players in oxidative stress homeostasis.

The imbalance between the pro-oxidants and antioxidants gives rise to oxidative stress which

plays vital role in evolution of complex life, physiology and certain disease processes. Oxidative

stress is characterized by an elevated level of reactive oxygen species (ROS) which results in to

intracellular reduction - oxidation (redox) imbalance. This intracellular i mbalance has been

implicated in various physiological processes including bone development and pathogenesis.

Oxidative stress activates the expression of a wide range of genes that mediate the pathogenic effect

of ROS or are required for detection and detoxification of the oxidants. The process is mediated by

specific transcription factors whose expression, structure, stability, nuclear targeting or DNAbinding

affinity is regulated by the level of oxidative stress [4]. In bone tissues, ROS generation is a

key modulator of bone cell function/pathophysiology of mineralized tissues and is influenced by

Research Article, Biotechnol. Bioinf.

628

Bioeng. 2012, 2(1):628-631

© 2012 Society for Applied Biotechnology; pISSN 2249-9075, eISSN 2249-9938


Biotechnol. Bioinf. Bioeng. 2012, 2(1):628-631

oxidative stress. ROS promote bone loss by inhibiting osteoblast differentiation and enhancing

osteoclastogenesis. ROS-induced bone resorption occurs directly or indirectly through the

modulation of kinases and transcription factor activities in both osteoclasts and osteoblasts [5].

Increased ROS formation and decreased efficiency of the antioxidant defence not only causes the

permanent alteration of biological macromolecular structures but also their functions [6].

Glutathione S-transferases (GST) belongs to a superfamily of enzymes which plays key role in

the detoxification step of Phase II metabolism, usually by catalyzing the conjugation of reduced

glutathione into hydrophobic and electrophilic compounds along with other Phase II enzymes. The

action of GST against ROS inducing toxic compounds results in detoxification and protection of

cellular DNA against ROS-induced damage [7]. A common deletion of GSTM1 gene results in a

non-functional genotype, loss of enzyme activity and altered activity of the GST isoforms.

Polymorphisms in GST genes have been associated with susceptibility to a range of diseases,

including rheumatic diseases. GST polymorphisms alone and in concert with environmental

exposures are associated with disease outcome and behaviour of several enzymes [8-10]. The GST

M1 gene is located on chromosome 1p13, a region showing frequent loss of heterozygosity in

human bone diseases including arthritis. Approximately half of all individuals from different ethnic

population lack GST enzyme activity which is the result of a polymorphic expression of gene and

deficiency are due to the homozygous deletion of GST M1 gene. The GST M1 null allele [GST M1

(−)] has gathered much attention in the epidemiologic studies due to its linkage with an array of

human diseases [11].

MATERIALS AND METHODS

Collection of Blood Sample

About 5ml venous blood was collected in a K 2 EDTA coated vaccutainer using multiple blood

drawing syringe with help of trained medical practitioner. Before drawing the blood,

signature/thumbprint (in case of illiterate participants) was taken on informed consent form after

explaining the purpose of the study to the participants. All samples were transported to laboratory

according to standard protocol and stored at -80°C till further processing. The study has clearance

from a local human ethical committee.

Isolation of DNA

Genomic DNA from the all blood samples was isolated using DNeasy blood midi kit according to

manufacturer’s instruction. DNA amount present in the isolates was quantified using nanodrop. All

samples showed A 260 /A 280 between 1.7-1.9 assuring the high quality of isolated DNA. The DNA

samples were diluted in to 100 ng/μl aliquots, stored at -80°C until further use.

Genotyping of GST M1

Homozygous null deletion polymorphism in GSTM1 gene was determined by multiplex PCR using

specific primers using β-globin gene as an internal control. The reaction mixture was of 20 μl final

volume with following constituents: 100ng DNA, 5 pm of each primer, 200μM dNTP mix, 1× Taq

buffer and 1 unit Taq DNA polymerase (NEB). All PCR conditions were followed as prescribed by

manufacturer’s of Taq DNA polymerase. The annealing temperature was standardized as 58°C for

multiplexing; PCR was carried out for 35 cycles. The PCR products were separated on 1.5% agarose

gel. To improve the genotyping quality and substantiation, 30% of samples were tested in triplicates

and results were found to be reproducible with no discrepancy recorded in genotyping.

629


Biotechnol. Bioinf. Bioeng. 2012, 2(1):628-631

Statistical analysis

Statistical analysis was performed by using GraphPad Prism 5 for calculating Odds ratio, 95%

confidence interval and standard deviation.

RESULTS AND DISCUSSION

Statistical analysis showed frequency of GSTM1 null genotype in the affected and control

individuals 23 and 30% respectively. We observed lack of statistical significance with null genotype

of GSTM1 (OR=1.43, 95% CI=0.67-3.08, X2=0.86, p=0.35). Oxidative stress is characterized by an

increased level of ROS that induces the intracellular redox imbalance. Apart from involvement in

aging, physiological roles for ROS in regulation of cell functions and mediating intracellular signals

have emerged as major pathophysiological key player. Recent studies have demonstrated that ROS

generation is a key modulator of bone cell function and that oxidative status influences the

pathophysiology of mineralized tissues of bone [5]. The vital role of oxidative stress in bone

pathophysiology indicates the possibility that ROS production could be a major therapeutic target

under certain conditions. Further redox imbalance in bone cells represents a useful approach in the

design of future therapies for skeletal diseases [12].

Table 1. Primer sequences used for amplification.

Primer

GSTM1-Forward

GSTM1-Reverse

β - globin-Forward

β - globin-Reverse

Sequence

TCTGGGGAGGTTTGTTTTCA

TGGACACAGAACATCATGGAA

TGTCTACCTGGTCTGGTTGG

CCTCCAGGACAGCAATAAGG

The regulation of human cytosolic Glutathione S transferases has been well characterized in

many inflammatory diseases. These are polymorphic in nature and have population/ethnicdependent

polymorphism frequencies. The GSTM1 gene is located on chromosome 1p13.3. About

20 to 50% of individuals do not express the enzyme due to a homozygous gene deletion, known as

the GSTM1*0, or null allele [13]. The percentage of individuals who do not express the enzyme is

higher in Caucasians and Asians compared to Africans [14,15]. GSTM1 is involved in the

detoxification of polycyclic aromatic hydrocarbons and other mutagens, and cells from GSTM1 null

individuals are more susceptible to DNA damage caused by these agents [16,17].

Table 2. Statistical analysis of GSTM1 polymorphism in Handigodu syndrome.

Genotype Affected (%) Control (%) OR

(n=100) (n=100) (95% CI)

X 2 P

GSTM1 77 (77) 70 (70) 1.43

(0.67-3.08)

0.86 0.35

(1 DF)

Null 23(23) 30 (30) - -

Amongst the GST super family genes GST MI is highly polymorphic with homozygous deletion

occurring at varying but significant frequencies in different ethnic groups. In the present study, no

significant association was found between GSTM1 null polymorphism and Handigodu syndrome

risk. The frequencies of GSTM1 null genotype was similar that reported for Asian population [18].

630


Biotechnol. Bioinf. Bioeng. 2012, 2(1):628-631

Acknowledgements: Authors are thankful to the Department of Medical and Higher Education,

Government of Karnataka for providing financial assistance to undertake this work.

REFERENCES

[1] Agarwal SS, Phadke SR, Phadke RV, et al. Skeletal Radiology 1994, 23:611-619.

[2] Venugopal PN, Arja C, Chandrasekar A, et al. Biotechnol Bioinf Bioeng. 2011, 1:269-273.

[3] Siddesh ND, Shah H, Joseph B, Skeletal Radiology 2012, 41(8):939-945.

[4] Ma Q, Pharmacology and Therapeutics 2010, 125(3):376-393.

[5] Wauquier F, Leotoing L, Coxam V, et al. Trends Mol Med. 2009, 15:468-477.

[6] Battisti V, Maders LDK, Bagatini MD, et al. J Clin Biochem. 2008, 41:511-518.

[7] Ryberg D, Skaug V, Hewer A, et al. Carcinogenesis 1997, 18:1285-1289.

[8] Karlson EW, Watts J, Signorovitch J, et al. Arthritis Rheum. 2007, 56:244-254.

[9] Mattey DL, Hutchinson D, Dawes PT, et al. Arthritis Rheum. 2002, 46(3):640-646.

[10] Strange RC, Jones PW, Fryer AA. Toxicology Letters 2000, 112-113:357-363.

[11] Perez-Matute P, Zulet MA, Martinez JA. Curr Opin Pharmacol. 2009, 9:771-779.

[12] Nathan FM, Singh VA, Dhanoa A, et al. BMC Cancer 2011, 11:382.

[13] Seidgard J, Vorachek WR, Pero RW, et al. Proc. Natl. Acad. Sci. USA 1988, 85:7293-7297.

[14] Bailey LR, Roodi N, Verrier CS, et al. Cancer Res. 1998, 58:65-70.

[15] Roth MJ, Dawsey SM, Wang GQ, et al. Cancer Lett. 156:73-81.

[16] Stanulla M, Schrappe M, Brechlin AM, et al. Blood 2000, 95(4):1222-1228.

[17] Strange RC, Fryer AA. In: Metabolic Polymorphisms and Susceptibility to Cancer,Vineis P, Malats N,

Lang M, et al. (eds), IARC Scientific Publications, Lyon, France, 1999, 148:231-249.

[18] Nelson HH, Wiencke JK, Chriatiani DC, et al. Carcinogenesis 1995, 16:1243-1245.

631

More magazines by this user
Similar magazines