30-Lies Vanhee - ISHAM

Rapid quantification of humanpathogenicfungi in various samplesusing solid-phase cytometryLies VanheeLaboratory of Pharmaceutical MicrobiologyGhent University, Belgium

Solid-phase cytometry: 5 stepsFree fluorochromeMicro-organism1 filtrationViability substrate2 fluorescent labelling3 scanning 4 data analysis by5 validationcomputer

Prevalence of A. fumigatus inair and susceptibility testing

Aim of the studyDevelopment of a specific, rapid method forquantification and susceptibility testing of A.fumigatus in air

Solid-phase cytometry for theanalysis of air samples• Air sampling• Removal of the polymer• Transfer & dissolution• Filtration• Fluorescent labelling• Scanning & Validation

Evaluation of the sensitivity andspecificity for A.fumigatusMicrocolonies Spores No labellingA. fumigatus (40)R. stolonifer (2)P. variotii (2)Aspergillus spp. (12)Penicillium spp. (14)A. tenuissima (2)A. corymbifera (1)A. alternata (1)M. racemosus (1)R. oryzae (1)R. microsporus (1)Fusarium spp. (3)

Comparison with a traditionalculture-based method:Analysis of 1000 l air samples(locations with a low fungal load, in triplicate)→ Similar results between SPC & CultureAnalysis of 1000 l air samples(locations with a high fungal load, in triplicate)→ SPC* 570 A. fumigatus (24 locations)* 10 resistant A. fumigatus→ Culture* 15 A. fumigatus (several plates overgrown)* 5 resistant A. fumigatus (MIC > 16 µg/ml)

CONCLUSIONSolid-phase cytometryCultureTime to result 24 h 96 hDetection limit 1 cell / 250 l air ?Upper limit ofquantification∞400 cells / plateEase of use Rather complicated Very easyDynamic range High LowSpecificity High LowIdentification Easy ComplicatedSusceptibility testing Easy Complicated

Rapid detection ofCandida cells in blood

Aim of the study• High-grade candidemia: > 25 CFU / 10 ml bloodLow-grade candidemia: < 10 CFU /10 ml blood• Current methods are based on culture: at least 24h tilldiagnosis+ -Diagnosis requires a rapid method with a lowdetection limit which specifically detectsCandida cells in blood

IMS & SPC to capture & detectCandida cells in bloodIMSMAGNETICLABELLINGSEPARATION WASH ELUTIONRabbit anti-Candida albicans polyclonal AB (FITC conj.)Mouse anti-FITC monoclonal AB (MicroBeads ® conj.)

IMS & SPC to capture & detectCandida cells in bloodSPC•Filtration•FISH labelling (PNA probe) for C. albicans→ red fluorescence of C. albicans•ChemChrome V6 labelling→ green fluorescence of all Candida spp.•Scanning•ValidationCryptococcus, Sacharomyces, Penicillium, Aspergillus, Scedosporium, Fusarium: no fluorescence

IMS & SPC to capture & detectCandida cells in blood: recoverynumber of C. albicans cells3027242118151296C. albicans SC5314504540353025201510time to blood culture positive (h)3501 2 3 4 5 6 7 8 9 10healthy volunteerC. glabrata, C. krusei, C. parapsilosis, C. tropicalis,C. dubliniensis: similar resultsspiking suspensionIMS & SPC of 10 ml spiked bloodblood culture of 10 ml spiked blood0

CONCLUSIONResultIMS & SPC→Direct quantification ofCandida spp.→Identification of C.albicansBlood culture→Presence/absence ofmicro-organismsTime to result 4 h ± 24 hDetection limit 1 Candida/10 ml blood ?Ease of use Rather complicated Very easySpecificity High LowIdentification Yes No

Quantification of P. boydiicomplex spp.

Aim of the studyDevelopment of a specific, rapid method for quantificationof Pseudallescheria boydii complex spp.- In river water: indicator of long-term water quality- In respiratory samples from patients with cystic fibrosis- …

Quantification of P. boydii complexspp. by SPC-FISHPROBE PROBE SEQUENCE NUMBER OF BP TARGET1 TTACTACGCAGAAGGC 16 18S rRNAP. boydii complex spp.2 CTCGCCGTAGCGCCCCAACACCGA 24 28S rRNAP. boydii complex spp.EUK18 ACCAGACTTGCCCTCC 16 18S rRNAAll eukaryotesThe development and optimisation of a FISH-SPCprocedure is ongoing

- Prof. T. Coenye & Prof. H. Nelis- Prof. S. de Hoog (CBS)- Katrien Lagrou & Wouter Meerseman (University hospitalLeuven)- Margherita Battista, Elise De Rocker, Iris Clarysse, DanaPerman, Irene Arcones- Staff of the Laboratory of Pharmaceutical Microbiology- …ACKNOWLEDGEMENTS

Thank you for your attention!Questions?