January 2011 - Wadsworth Center

More documents

Recommendations

Info

Schedule of 2011 Mycology PT Mailouts*Mycology IdentificationMycology Identification POSTMARKDEADLINESJanuary 26, 2011 March 11, 2011May 25, 2011 June 17, 2011September 27, 2011 November 14, 2011Mycology Identification - Yeast OnlyMycology Identification - Yeast OnlyPOSTMARK DEADLINESJanuary 26, 2011 February 18, 2011May 25, 2011 June 17, 2011September 27, 2011 October 24, 2011Mycology SusceptibilityMycology Susceptibility POSTMARKDEADLINESJanuary 26, 2011 February 18, 2011May 25, 2011 June 17, 2011September 27, 2011 October 24, 2011Mycology Direct DetectionMycology Direct Detection POSTMARKDEALINESJanuary 26, 2011 February 11, 2011September 27, 2011 October 17, 2011___________________________*Mycology PT Program has a set of standard test strains, which typically represent characteristic features of the respectivespecies. These strains will be made available to the participating laboratories for educational purposes. For practical reasons, nomore than two strains will be shipped at any given time subject to a maximum of five strains per year. Preference will be givento laboratories that request test strains for remedial purposes following unsatisfactory performance.4
TEST SPECIMENS AND GRADING POLICYTest Specimens*At least two strains of each mold specimen were examined for inclusion in the proficiency test event ofSeptember 2010 The colony morphology of these strains was studied on Sabouraud dextrose agar. The microscopicmorphologic features were examined by potato dextrose agar slide cultures. The physiological characteristics suchas cycloheximide sensitivity and growth at higher temperatures were investigated with appropriate test media. Thesingle strain that best demonstrated the morphologic and physiologic characteristics typical of the species was usedas a test analyte. Similarly, two or more strains of yeast species were examined for inclusion in the proficiency test.The colony morphology of all yeast strains was studied on corn meal agar with Tween 80 plates inoculated byDalmau or streak-cut method. Carbohydrate assimilation was studied with the API 20C AUX identification kit. Thefermentations of carbohydrates, i.e., glucose, maltose, sucrose, lactose, trehalose, and cellobiose, were alsoinvestigated using classical approaches. Additional physiologic characteristics such as nitrate assimilation, ureaseactivity, and cycloheximide sensitivity were investigated with the appropriate test media. The single strain that bestdemonstrated the morphologic and physiologic characteristics of the proposed test analyte was selected. Finally,ITS1 – ITS2 region of ribosomal genes was amplified, sequenced, and BLAST searched in two databases.Grading PolicyA laboratory’s response for each sample is compared with the response that reflects 80 percent agreementof 10 referee laboratories and/or 80 percent of all participating laboratories. The referee laboratories are selected atrandom from among hospital laboratories participating in the program. They represent all geographical areas ofNew York State and must have a record of excellent performance during the preceding three years. The maximumscore for each specimen is 20 based on the formula:# of correct responses × 100# of fungi present + # incorrect responsesAcceptable results for antifungal susceptibility testing are based on consensus MIC values +/- 2 dilutions orinterpretation per CLSI (NCCLS) guidelines or related, peer-reviewed publications. One yeast is to be testedagainst following drugs: amphotericin B, anidulafungin, caspofungin, flucytosine (5-FC), fluconazole, itraconazole,ketoconazole, micafungin, posaconazole, and voriconazole. The participating laboratories are allowed to select anynumber of antifungal drugs from the test panel based upon test practices in their facilities. A maximum score of 100will be equally distributed to account for the drugs selected by an individual laboratory. If the result for any drug isincorrect then laboratory gets a score of zero for that particular test component or set.For Cryptococcus neoformans antigen test, laboratories are evaluated on the basis of their responses and onoverall performance for all the analytes tested in the Direct Detection category. The maximum score for this eventis 100. Appropriate responses are determined by 80% agreement in participant responses. Target values andacceptable ranges are mean value +/- 2 dilutions; positive or negative answers will be acceptable from laboratoriesthat do not report titers. When both qualitative and quantitative results are reported for an analyte, ten points will bededucted for each incorrect result. When only qualitative OR quantitative results are reported, twenty points will bededucted from each incorrect result.A failure to attain an overall score of 80% is considered unsatisfactory performance. Laboratories receivingunsatisfactory scores in two out of three consecutive proficiency test events may be subject to ‘cease testing’.__________________________________*The use of brand and/or trade names in this report does not constitute an endorsement of the products on the part of theWadsworth Center or the New York State Department of Health.5
Page 2 and 3: Dr. Vishnu Chaturvedi, DirectorDr.
Page 6: Mycology - GeneralANSWER KEY AND LA
Page 9 and 10: MOLD DESCRIPTIONSM-1 Exophiala spp.
Page 11 and 12: D1/D2 domain sequence analysis. FEM
Page 13 and 14: M-2 Aspergillus versicolorSource: S
Page 15: prospective multicenter surveillanc
Page 18 and 19: M-3 Chaetomium spp.Source: FootLabo
Page 20 and 21: 5. Valinsky, L., Della Vedova, G.,
Page 22 and 23: M-4 Trichophton rubrumSource: Nail
Page 24 and 25: 3. Cetinkaya, Z., Kiraz, N., Karaca
Page 26 and 27: M-5 Paecilomyces spp.Source: Scalp
Page 28 and 29: A. B.Figure 9. (A) Seven-day-old, y
Page 30 and 31: Query 61 CCACTTACACCTGTGAACTGTTCTAC
Page 32 and 33: Figure 11. Seven-day-old, white to
Page 34 and 35: 201 250ATCTCTTGGC TCTCGCATCG ATGAAG
Page 36 and 37: Figure 13. Seven-day-old, mucoid, s
Page 38 and 39: Query 121 GAGCGAACTCCTATTCACTTATAAA
Page 40 and 41: Y-4 Rhodotorula minutaSource: Sputu
Page 42 and 43: Figure 17. Seven-day-old, soft, smo
Page 44 and 45: Query 61 CCCTCACCTCTGTGAACTGTGGACCT
Page 46 and 47: Figure 19. Five-day-old, white crea
Page 48 and 49: Summary:Table 3. Laboratory Perform
Page 50 and 51: Table 5. Antifungal Susceptibility
Page 52 and 53: determination of broth dilution min
Page 54 and 55:
Table 6. Summary of quantitative as
Page 56 and 57:
Summary of Molecular Tests SurveyDu
Page 58 and 59:
BIBLIOGRAPHY1. American Type Cultur
Page 60:
Copyright © 2011 Wadsworth CenterN
show all

January 2011 - Wadsworth Center

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?