let's make biology easy to engineer - The Circuits and Biology Lab at ...

cctbio.ece.umn.edu

let's make biology easy to engineer - The Circuits and Biology Lab at ...

TAATACGACTCACTATAGGGAGA


Genomes (> 500,000 bp)Increase process speed and reliabilityathways (10,000 < 500,000 bp)Increase process speed and reliabilityGenes (200 < 100,000 bp)Increase process speed and reliabilityOligos (


Carlson, Pace & Proliferation of Biological Technologies, Biosec. & Bioterror. 1(3):1 (2003)10


Ability to build DNA from scratchimproving faster than computersCarlson, Pace & Proliferation of Biological Technologies, Biosec. & Bioterror. 1(3):1 (2003)10


How much DNA on Earth?Image c/o http://www.rps.psu.edu/probing/graphics/earth2.jpgThe pangenome concept: a unifying view of genetic information.1: Med Sci Monit. 2005 Jul;11(7):HY24-9. Epub 2005 Jun 29.


How much DNA on Earth?4E35 bp bacterial DNAImage c/o http://www.rps.psu.edu/probing/graphics/earth2.jpg4E34 bp plant DNA1E34 bp animal DNA5E30 bp virus DNA5E35 bp DNA on the planetThe pangenome concept: a unifying view of genetic information.1: Med Sci Monit. 2005 Jul;11(7):HY24-9. Epub 2005 Jun 29.


Typical R01 c.2090


Typical R01 c.2090Specific Aim #1:Sequence all DNA on earth in first month of project


Typical R01 c.2090Specific Aim #1:Sequence all DNA on earth in first month of projectReviewer Comments:Data storage & sharing plans not adequateFunctional annotation tools insufficient


1. Genomes have finite lengths.2. Fixation rates of mutants in populations arefinite.3. Atrophy rates of functional genetic elementsare greater than zero.


Where are we today?


1) Malaria is a global problem,artemisinin offers a cure.16


2) Jay Keasling’steam spent $25Mto make artemisininvia biotechnology.1) Malaria is a global problem,artemisinin offers a cure.16


Today, each project is Herculean2) Jay Keasling’steam spent $25Mto make artemisininvia biotechnology.1) Malaria is a global problem,artemisinin offers a cure.16


Today, each project is Herculean2) Jay Keasling’steam spent $25Mto make artemisininvia biotechnology.1) Malaria is a global problem,artemisinin offers a cure.3) Butartemisininresistance isalreadyoccurring.16


Today, each project is Herculean2) Jay Keasling’steam spent $25Mto make artemisininvia biotechnology.1) Malaria is a global problem,artemisinin offers a cure.3) Butartemisininresistance isalreadyoccurring.Must we alwaysspend many years and$25M for each pressingbiotech project?16


Food Energy Environment Agriculture Health Chemicals Security


Food Energy Environment Agriculture Health Chemicals Security2004 DOE report lists 120 highvalue chemicals for biomanufacturingI6'.3;;5%%,;/'$Z;4/3&$0+%.6$%""2"';%7%""2"';%A69>6>=6"B&'/%6>E>/%&.%,63/%:B"3/1'&.;I6'D3;%,4#> !3;4293&;F53./'%*#3.&/'%G65/'%H#",+0/'%I".&/'%J3.#/'%J&"#.44!73/%B&'?6'>6$ 3$6,C3"'>6$ 3$6,4%&6>%42$$6>6$ 3$6,52.3&6$ 3$6,C3"6$ 3$6,@*+#,&'-#*D2/#&'"3$/'>%($%/'6>E/3$'>6$:3$6,52&12&3"J6&%$/B'"#.%&;:K:92.;E;'*;#>/0%;6;:?&',2$/;56;$0%&*L&'?;$0A6N26,;(;?3&/6$:3$6,L0&%'>6>%A%F2"6>6$ 3$6,!"2/3.6$:3$6,G#"'>6$ 3$6,G#"6/'"H(&3D6/'"76/&6$H($'>6/6$ 3$6,)*+#,&'-#.%/0#"*12&12&3"A#;6>%!"2$'>6$ 3$6,!"2$3&6$ 3$6,4'&D6/'"!3""6$ 3$6,5%&2"6$ 3$6,4%$'>,3F%.6$3";(..'>63:;#>/0%;6;P:0#,&'9%>3/6'>:?&',2$/;C%/0#":%;/%&;P:5'&.3",%0#,%P:($%/6$:3$6,P:J6.%/0#"%/0%&P:J6.%/0#"$3&D'>3/%P::C%/0#":3.6>%;P:CLISP:'"%16>;P:93;'"6>%A6>%3&:3>,:D&3>$0%,:QR:3"$'0'";P:3>,:.6-%,:0690%&:3"$'0'";="%16>:0#,&'1'&.#"3/6'> ?&',2$/;T:3",%0#,%;P:3"$'0'";P:3$6,;E;'*7O:.'"%$2"%;P:6;'D2/%>%:3>,:6/;:,%&6F3/6F%;!*'"%16>;P:93;'"6>%P:U3-%;P:,6%;%"5%&.%>/3/6'>:?&',2$/;P:B&'?#"%>%:9"#$'"P:.3"'>6$P:QP@*BJ=P:,63$6,;P:?&'?#" 3"$'0'"P:,63",%0#,%P:%?'-6,%;:($&#"3/%;P:A*B&'?#"%>%:9"#$'"P:J6'-3>%;P:B'"#%;/%&;P:A3$/6,%($&#"3/%;P:($&#"3.6,%;P:S;/%&;P:QP@*B&'?3>%,6'"P:C3"'>6$ 3$6,:3>,:'/0%&;:M%39%>/P:?&'?6'>'"P:3$&#"3/%B03&.3\:E>/%&.%,63/%;'*QP@*BJ=P:'.3"'>6$P:W3.6>'*@+BXL+5P:QPO*I2/3>%,6'"P:"*D2/#&'"3$/'>%P:?#&&'"6,'>%;P:%;/%&;P:,63.6>%;P:OPO*I6'>%""%P:0#,&'-#D2/#&6$ 3$6,V>;3/2&3/%,:;2$$6>3/% ,%&6F3/6F%;:W;%%:3D'F%X+#,&'-# ;2$$6>3/% ,%&6F3/6F%;:W3D'F%XP:0#,&'-#D2/#&'"3$/'>%(.6>':;2$$6>3/% ,%&6F3/6F%;:W;%%:3D'F%X+#,&'-#D2/#&3/%;P:%?'-#*"*D2/#&'"3$/'>%P:D2/%>'6$ 3$6,I2/3>%,6'";P:D2/%>'";J6'";P:Z%/'>% ,%&6F3/6F%;P:6>,%/%&.6>3>/C%/0#":;2$$6>3/% ,%&6F3/6F%;:W;%%:3D'F%XP:2>;3/2&3/%,:%;/%&;C3>#:12&3>:,%&6F3/6F%;#*3.6>'"%F2"6>3/%P:3/%(.6>':,6'";P:9"2/3&6$ 3$6,P;2D;/6/2/%,:?#&&'"6,'>%;:A3$/'>%;P:%;/%&;S!P:B!P:9"#$%&'"P:"3$/3/%P:0#,&'-# 12&3>;P:;293&:3$6,;QP)*?%>/3>%,6'"P:6/3$'>6$ ,%&6F3/6F%;P:?#&&'"6,'>%;P:%;/%&;Y2.%&'2;:12&3>:,%&6F3/6F%;P:;2$$6>3/%P:%;/%&;P:"%F2"6>6$ 3$6,73?&'"3$/3.P:,63.6>' 3"$'0'";P:QP)*,63.6>'?%>/3>%!"2$'>'"3$/'>%;P:%;/%&;J6"3$/'>%;P:.'>'"3$/'>%;P:'/0%&:?&',2$/;!"#$'";:WS!P:B!XP:9"#$%&'"P:"3$/3/%P:6;';'&D6,%B0%>'"6$;P:1'',:3,,6/6F%;E>/%&.%,63/%;52%":'-#9%>3/%;M%39%>/;*D26",6>9:2>6/(>/61&%%[%:3>,:,%6$%&;4'"F%>/;!&%%>:;'"F%>/;4?%$63"/#:$0%.6$3":6>/%&.%,63/%S.2";616%&;70%"3/6>9:39%>/;(.6>%;B"3;/6$6[%&;B'"#F6>#":3$%/3/%?+:$'>/&'":39%>/;M%;6>;P:$&';;"6>Z%&;B'"#F6>#":3"$'0'"B'"#3$&#"3/%;B'"#3$&#"3.6,%;B'"#%/0%&;B'"#?#&&'"6,'>%;B0/03"3/%:?'"#%;/%&;BSEL:?'"#.%&B'"#0#,&'-#?'"#%;/%&;Y#"'>;:W?'"#3.6,%;XB'"#0#,&'-#?'"#3.6,%;:I6;?0%>'" (:&%?"3$%.%>/:B'"#$3&D'>3/%;:B'"#2&%/03>%;B0%>'"*1'&.3",%0#,%:&%;6>;?'"#0#,&'-#3"Z'>'3/%;?'"#;3$$03&6,%;?'#3.6>'3$6,;B&',2$/;HV;%;E>,2;/&63"!/##/'+/0)+04+,+&/#'()73'&)./0&#/5(),/+5%#)="&%#)&#%"&2%0&()1"')$3#+-+."&+/0()%2+''+/0)","&%2%0&()'$%.+"5&6)53,#+."0&'()4/'%'()'%"5'L&3>;?'&/3/6'>*3%5'()/861%0"&%'()"0&+6$3/6'>E/57%7)$5"'&+.'()./2$3&%#)."'+01'()/$&+."5)-+,%#)./"&+01'()5+?3+7).#6'&"5)7+'$5"6'()$%0'()$%0.+5'()+09'()76%'()$"$%#)$#/73.&'+'2;6>9>"+0&'()#%'+0'()'+7+01()+0'35"&+/0().%2%0&'()./"&+01'():"#0+'4%'()-5"2%)#%&"#7%0&'()"74%'+:%'()."#$%&+01M%$&%3/6'>*//&1%"#()$#/&%.&+:%)%?3+$2%0&()."2%#")"07)-+52(),+.6.5%)$"#&')@)&+#%'()=%&)'3+&'()&"$%',:+#96%>%>5"'&+.)%6%15"''%'()./'2%&+.'()7%&%#1%0&'()$4"#2".%3&+."5'()'30&"0)5/&+/0()2%7+."53"'9'2;:C',%":'1:3 I6'D3;%, B&',2$/:5"'U*$03&/:1'&:I6'.3;; 5%%,;/'$Z;


Food Energy Environment Agriculture Health Chemicals Security


Food Energy Environment Agriculture Health Chemicals SecurityDoebley LabDepartment of GeneticsUniversity of Wisconsin-Madison


Food Energy Environment Agriculture Health Chemicals Security3 crop species (rice, wheat and maize) provide 60%of all calories and 54% of all protein in human foodDoebley LabDepartment of GeneticsUniversity of Wisconsin-Madison


Food Energy Environment Agriculture Health Chemicals Security3 crop species (rice, wheat and maize) provide 60%of all calories and 54% of all protein in human foodDoebley LabDepartment of GeneticsUniversity of Wisconsin-MadisonJim HaseloffDepartment of Plant SciencesUniversity of Cambridge


ChallengeMake biology easyto engineer.OpportunitiesEnable all constructivebiotechnologies.Better understandnature.http://i.pbase.com/u47/hodero/large/30691408.jungle.jpg


FAB.TREE.HABJoachim et al.MIT Arch.


Engineer as felon!


UnknownOur Lord's Candle (Yucca whipplei), Lakeview Mountains, 22 Apr 2006Smugmug.com


Unknownhttp://www.rootsweb.com/~usgenweb/mn/stearns/postcards/quarry.jpg


Washington National Cathedralhttp://www.cathedral.org/cathedral/discover/1930photos/5.shtml


http://www.nicmyers.com/media/hongkong_large_pano_nicmyers.jpg


http://en.wikipedia.org/wiki/Image:Eniac.jpg


http://en.wikipedia.org/wiki/Image:Apple_I.jpg


http://en.wikipedia.org/wiki/Internet


Apps


Tools


1. Info. theory & signal proc.32


7. Control & dyn. systems6. Reverse engineering5. Fab, CAD & EDA4. Standards & abstraction3. Languages & grammars2. Device design1. Info. theory & signal proc.32


Nagpal, Kondacs, Chang, Programming Methodology for Biologically-Inspired Self-Assembling Systems, in the AAAI SpringSymposium on Computational Synthesis: From Basic Building Blocks to High Level Functionality, March 2003.Movie online via http://www.swiss.csail.mit.edu/projects/amorphous/Robust/cross.mpeg34


1973Construction ofbiologically functionalbacterial plasmids in vitroCohen et al., PNAS, 197335


19731985Construction of Cloning and expressionbiologically functional of the humanbacterial plasmids in vitro erthropoietin geneCohen et al., PNAS, 1973Lin et al., PNAS,198535


197319852006Construction of Cloning and expressionbiologically functional of the humanbacterial plasmids in vitro erthropoietin geneProduction of theantimalarial drugprecursor artemisinicacid in engineered yeastCohen et al., PNAS, 1973Lin et al., PNAS,1985Ro et al., Nature, 200635


197319852006Construction of Cloning and expressionbiologically functional of the humanbacterial plasmids in vitro erthropoietin geneProduction of theantimalarial drugprecursor artemisinicacid in engineered yeastCohen et al., PNAS, 1973Lin et al., PNAS,1985Ro et al., Nature, 2006Genetic engineering basics unchanged past 30+ years35


We need new tools197319852006Construction of Cloning and expressionbiologically functional of the humanbacterial plasmids in vitro erthropoietin geneProduction of theantimalarial drugprecursor artemisinicacid in engineered yeastCohen et al., PNAS, 1973Lin et al., PNAS,1985Ro et al., Nature, 2006Genetic engineering basics unchanged past 30+ years35


FoodEnergyEnvironmentAgricultureHealthChemicalsSecurity$2.5B$2B$2.1B$3B$91B$20B $14BTotal U.S. R&D spending by sectorAAAS 2008 Federal R&D Budget Analysis; R&D Magazine 2008; John Mulligan, Blue Heron36


FoodEnergyEnvironmentAgricultureHealthChemicalsSecurity$2.5B$2B$2.1B$3B$91B$20B $14BTotal U.S. R&D spending by sectorNIH spends ~$1.5B annually on manipulating DNA(but relatively little getting better at doing so)AAAS 2008 Federal R&D Budget Analysis; R&D Magazine 2008; John Mulligan, Blue Heron36


Tool investments lackingFoodEnergyEnvironmentAgricultureHealthChemicalsSecurity$2.5B$2B$2.1B$3B$91B$20B $14BTotal U.S. R&D spending by sectorNIH spends ~$1.5B annually on manipulating DNA(but relatively little getting better at doing so)AAAS 2008 Federal R&D Budget Analysis; R&D Magazine 2008; John Mulligan, Blue Heron36


Synthetic Biology as Tools Revolution37


Synthetic Biology as Tools RevolutionFirstGen.Biotech =37


Synthetic Biology as Tools RevolutionRecombinant DNAFirstGen.Biotech =Basic “Cut” & “Paste”37


Synthetic Biology as Tools RevolutionRecombinant DNAPolymerase Chain ReactionFirstGen.Biotech =Basic “Cut” & “Paste”Amplify & Make Simple Changes37


Synthetic Biology as Tools RevolutionRecombinant DNAPolymerase Chain ReactionDNA SequencingFirstGen.Biotech =Basic “Cut” & “Paste”Amplify & Make Simple ChangesRead Out the Genetic Code37


Synthetic Biology as Tools RevolutionRecombinant DNAPolymerase Chain ReactionDNA SequencingFirstGen.Biotech =Basic “Cut” & “Paste”Amplify & Make Simple ChangesRead Out the Genetic CodeNextGen.BiotechAddsNewTools=37


Synthetic Biology as Tools RevolutionRecombinant DNAPolymerase Chain ReactionDNA SequencingFirstGen.Biotech =Basic “Cut” & “Paste”Amplify & Make Simple ChangesRead Out the Genetic CodeNextGen.BiotechAddsNewTools=37


Synthetic Biology as Tools RevolutionRecombinant DNAPolymerase Chain ReactionDNA SequencingFirstGen.Biotech =Basic “Cut” & “Paste”Amplify & Make Simple ChangesRead Out the Genetic CodeNextGen.BiotechAddsNewTools=37


Synthetic Biology as Tools RevolutionRecombinant DNAPolymerase Chain ReactionDNA SequencingFirstGen.Biotech =Basic “Cut” & “Paste”Amplify & Make Simple ChangesRead Out the Genetic CodeNextGen.BiotechAddsNewTools=37


Synthetic Biology as Tools RevolutionRecombinant DNAPolymerase Chain ReactionDNA SequencingFirstGen.Biotech = ...Basic “Cut” & “Paste”Amplify & Make Simple ChangesRead Out the Genetic CodeNextGen.BiotechAddsNewTools=37


Encoded information on DNAis complicatedTAATACGACTCACTATAGGGAGA38


Encoded information on DNAis complicatedTAATACGACTCACTATAGGGAGA01110100 00110111 0010000038


SystemsDevicesPartsDNA39


SystemsDevicesPartsDNA39


SystemsDevicesPartsDNA39


if {growing}call wintergreen()elsecall bananas()


smell test: iGEM jamboree


BBa_F26203OC 6 HSL PoPS ReceiverMechanism & FunctionA transcription factor (LuxR) that is active in the presenceof a cell-cell signaling molecule (3OC6HSL) is controlled bya regulated operator (PLtetO-1). Device input is 3OC6HSL.Device output is PoPS from a LuxR-regulated operator. Ifused in a cell containing TetR then a second input such asaTc can be used to produce a Boolean AND function.BBa_F2620Component PartsR0040 B0034 C0062 B0015 R0062PLtetO-1 RBS luxR Term. Plux,RCanton, Labno & EndyNature Biotechnology v26:7, 787-93 July 2008Static Performance*GFP synthesis rate (molecules cell !1 s !1 )6005004003002001000Chassis:Plasmids:Devices:Population MeanColony RangeHill Equation0E+00 1E!10 1E!09 1E!08 1E!07 1E!06 1E!05 1E!04[3OC 6HSL] (M)P out= P max[3OC 6HSL] nK n + [3OC 6HSL] nInput Compatibility*GFP synthesis rate (molecules cell !1 s !1 )600500400300200100Part Compatibility (qualitative)P max : 6.6 PoPS cell -1K: 1.5E-09 M 3OC 6 HSLn: 1.6MC4100, MG1655, and DH5pSB3K3 and pSB1A2E0240, E0430 and E0434Transcriptional Output Demand (low/high input)Nucleotides: 0 / 6xNt nucleotides cell -1 s -1Polymerases: 0 / 1.5E-1xNt RNAP cell -1Authors: Barry CantonAnia LabnoUpdated: March 20080C 4HSLC 6HSL3OC 6HSLC 7HSLC 8HSL3OC 8HSLC 10HSLC 12HSL0E+00 1E!10 1E!09 1E!08 1E!07 1E!06 1E!05 1E!04[AHL] (M)(Nt = downstream transcript length)876543210876543210PoPS cell !1PoPS cell !1Dynamic Performance*!10 0 10 20 30 40 50Time (min)BBa_F2620 Response Time: 92/>56 culture doublingsPerformance: >92/>56 culture doublings(low/high input during propagation)Signaling Devices http://parts.mit.edu/registry/index.php/Part:BBa_F2620License: Public876543210PoPS cell !147


Over 3500 BioBrick DNA partsFreely available*Today


3. Automated sequencing2. Polymerase chain reaction1. Recombinant DNA49


7. Reliable behavior6. Standardization5. Abstraction4. Automated construction3. Automated sequencing2. Polymerase chain reaction1. Recombinant DNA49


UCSF 2007 iGEM team51


UCSF 2007 iGEM team51


UCSF 2007 iGEM team52


2009 Stanford iGEM Team


Should teenagers practice genetic engineering?Yes54


Should teenagers practice genetic engineering?YesShould military force include biotechnology?No54


Should teenagers practice genetic engineering?YesShould military force include biotechnology?NoWill biohackers be good or bad?Good54


Should teenagers practice genetic engineering?YesShould military force include biotechnology?NoWill biohackers be good or bad?GoodShould BioBrick parts be patented or freely shared?Free54


Should teenagers practice genetic engineering?YesShould military force include biotechnology?NoWill biohackers be good or bad?GoodShould BioBrick parts be patented or freely shared?FreeShould genetic engineers sign their work?Yes54


Should teenagers practice genetic engineering?YesShould military force include biotechnology?NoWill biohackers be good or bad?GoodShould BioBrick parts be patented or freely shared?FreeShould genetic engineers sign their work?YesHow much can we construct with biology? ???54


Engineer many high quality standard biological parts1st order55


Engineer many high quality standard biological parts1st orderGet really good at building DNA1st order55


Engineer many high quality standard biological parts1st orderGet really good at building DNA1st orderDevelop IDE, CAD, EDA for biotechnology1st order55


Engineer many high quality standard biological parts1st orderGet really good at building DNA1st orderDevelop IDE, CAD, EDA for biotechnology1st orderObtain operational understanding forhow biology works2ndorder55


Engineer many high quality standard biological parts1st orderGet really good at building DNA1st orderDevelop IDE, CAD, EDA for biotechnology1st orderObtain operational understanding forhow biology works2ndorderDevelop engineering framework for the design ofunderstandable & sustainable integrated systems2ndorder55


Engineer many high quality standard biological parts1st orderGet really good at building DNA1st orderDevelop IDE, CAD, EDA for biotechnology1st orderObtain operational understanding forhow biology works2ndorderDevelop engineering framework for the design ofunderstandable & sustainable integrated systems2ndorderEnable humanity via the future of biotechnologyNthorder55

More magazines by this user
Similar magazines