isolation, characterisation and molecular typing of feline ...

dtl.unimelb.edu.au

isolation, characterisation and molecular typing of feline ...

ISOLATION, CHARACTERISATION AND

MOLECULAR TYPING OF FELINE MYCOPLASMA

SPECIES

Sally Rae Robinson

BVSc (Hons)

Thesis submitted in fulfilment of the requirements of the Degree of

Master of Veterinary Science (by research)

Department of Veterinary Science, The University of Melbourne

March 2009


ABSTRACT

The exact role of mycoplasma in feline ocular and respiratory disease is not yet

understood. The results of previous studies are contradictory in this regard. There is

some evidence to suggest that M. felis has a pathogenic role in such diseases, but it is

inconclusive.

The aim of this study was to investigate the prevalence and anatomical distribution of

mycoplasmas in a population of shelter cats, to determine which species were present,

and establish the association of their presence with ocular or respiratory disease.

The prevalence of mycoplasma in the 110 cats examined was 71.8%, as determined

by in vitro culture. Mycoplasma was most commonly isolated from the pharynx,

followed by the bronchus and conjunctiva. In infected cats, mycoplasmas were likely

to be isolated from multiple anatomical sites.

The polymerase chain reaction (PCR) was used to amplify part of the 16S rRNA

gene, and the mutation scanning technique non-isotopic single-strand conformation

polymorphism (SSCP) was utilised to delineate mycoplasma isolates based on

nucleotide sequence variation. PCR-SSCP proved to be a useful method to screen

large numbers of samples for variation and to group them according to species.

The species of mycoplasma identified by nucleotide sequencing were M. felis and M.

gateae. It was not determined whether it was possible to differentiate between M.

gateae and M. arginini based on SSCP profile results with the target DNA region

used due to their almost identical nucleotide sequence. This group of M. gateae/M.

arginini served as a useful non-pathogenic comparison group to M. felis.

There was no statistically significant difference between M. felis and the M. gateae/M.

arginini group with respect to prevalence or anatomic distribution. There was no

evidence of any association of mycoplasma with disease linked to any of the anatomic

locations studied.

i


Mycoplasmas were isolated from the lower respiratory tract in 42.7% of cats. The

isolation of mycoplasmas from the lower respiratory tract of healthy cats has been

reported once, but this is the first report of M. felis being isolated from this location in

healthy cats. This finding indicates that the isolation of mycoplasmas from the lower

respiratory tract is not sufficient evidence to implicate a role in respiratory disease.

Mycoplasmas were not significantly involved in ocular or respiratory disease in the

population of cats studied. More likely, they are commensal organisms in the

conjunctiva, pharynx and bronchus. Whether they are capable of playing an

opportunistic role in disease, or what conditions may facilitate such a role remains to

be determined.

ii


DECLARATION

This is to certify that the thesis comprises only my original work except where

indicated in the preface; due acknowledgement has been made in the text to all other

material used; the thesis is < 30,000 words in length, exclusive of tables, figures,

appendices and bibliography.

There are pages throughout this thesis intentionally left blank.

Sally Robinson

March 2009

iii


ACKNOWLEDGEMENTS

I would like to acknowledge the assistance of my supervisors Steven Holloway,

Kevin Whithear and Robin Gasser for their interest and ideas during the experimental

phases, and especially Steven for his patience and understanding to the end of the

thesis writing. Thank you to Tony Belfiore and Nathan Jeffery for their expertise and

great company in the mycoplasma laboratory. Thanks also to Min Hu, Yousef El

Osta, and the postgraduate students in the parasitology laboratory for their technical

assistance and for accepting me as a non-parasitological impostor.

I would like to acknowledge the Cat Protection Society, Victoria, for kindly allowing

me access to the population of cats at the shelter for this study.

Thank you to Garry Anderson for his time and enthusiasm in assisting me with the

statistical analysis for this project.

Mostly I give thanks for the tremendous support from all of my family; firstly to my

husband Nick for his critical eye and unfailing belief in my abilities, and to my

amazing daughters Sophie and Catherine who have made the completion of this

project a little more challenging to achieve but ultimately more rewarding. I thank my

parents Helen and Michael for their encouragement and belief in me to achieve

anything, and for providing the educational opportunities for me to do so. I am also

very grateful for the love and support from my parents-in-law Jen and Wayne.

Especially, I am indebted to WFR for the guidance, wisdom and direction he provided

at a critical time in the thesis writing process.

iv


COMMUNICATIONS

Work presented in this thesis has been communicated in the papers or presented at the

meetings/conferences listed below:

Sally Robinson, Robin Gasser, Steven Holloway

‘Epidemiology and molecular typing of feline mycoplasmas from a population of

shelter cats.’ (Manuscript in preparation)

Sally Robinson, Robin Gasser, Steven Holloway (2004)

Master of Veterinary Science confirmation seminar presented at The University of

Melbourne Veterinary Clinical Centre, Melbourne, Australia.

Sally Robinson, Robin Gasser, Steven Holloway (2004)

‘Feline mycoplasmas.’ Oral presentation at the Australian College of Veterinary

Scientists annual conference, young speakers section of the small animal medicine

chapter. Gold Coast, Australia.

Sally Robinson, Robin Gasser, Steven Holloway (2004)

‘Feline mycoplasmas.’ Oral presentation at the University of Melbourne Academic

Associates Meeting. Melbourne, Australia.

v


TABLE OF CONTENTS

CHAPTER 1 INTRODUCTION AND LITERATURE REVIEW .......................... 1

1.1 INTRODUCTION....................................................................................................................... 1

1.2 RESEARCH OBJECTIVES .......................................................................................................... 3

1.3 LITERATURE REVIEW ............................................................................................................. 3

1.3.1 Mycoplasmas – general characteristics............................................................................ 3

1.3.2 Species of mycoplasma isolated from cats ........................................................................ 5

1.3.3 Methods for the isolation and identification of feline mycoplasmas ................................. 7

1.3.3.1 Collection techniques ............................................................................................................ 7

1.3.3.2 Culture media ........................................................................................................................ 9

1.3.3.3 Culture conditions ............................................................................................................... 10

1.3.3.4 Morphology ........................................................................................................................ 10

1.3.3.5 Biochemical profiles ........................................................................................................... 11

1.3.3.6 Serological methods for specific identification ................................................................... 11

1.3.3.7 Molecular methods for specific identification ..................................................................... 12

1.3.4 Epidemiology of feline mycoplasmas .............................................................................. 16

1.3.4.1 Prevalence of mycoplasma in cats ...................................................................................... 16

1.3.4.2 Prevalence – with reference to anatomical location ............................................................ 17

1.3.4.3 Prevalence - with reference to different mycoplasma species ............................................. 21

1.3.4.4 Possible roles of individual mycoplasma species in cats ..................................................... 22

1.3.4.5 Age of cats .......................................................................................................................... 26

1.3.4.6 Geographical and climatic factors ....................................................................................... 28

1.3.4.7 Prevalence of mycoplasmas compared with other ‘respiratory pathogens’ ......................... 29

1.3.4.8 Relationship of mycoplasmas to other respiratory pathogens ............................................. 30

1.3.4.9 Association of mycoplasma with feline bronchial disease (FBD) ....................................... 31

1.3.4.10 Presence of feline mycoplasmas in other species ................................................................ 32

1.3.4.11 Consideration of factors that may facilitate mycoplasmal involvement in disease ............. 34

1.4 CONCLUSION ........................................................................................................................ 37

1.5 AIMS .................................................................................................................................... 39

CHAPTER 2 EPIDEMIOLOGICAL SURVEY OF FELINE MYCOPLASMA. 41

2.1 INTRODUCTION..................................................................................................................... 41

2.2 MATERIALS AND METHODS .................................................................................................. 42

2.2.1 Animal Collection ........................................................................................................... 42

2.2.2 Culture ............................................................................................................................ 43

2.2.3 Statistical analysis .......................................................................................................... 44

2.3 RESULTS .............................................................................................................................. 45

2.4 DISCUSSION ......................................................................................................................... 47

CHAPTER 3 MOLECULAR CHARACTERISATION OF FELINE

MYCOPLASMA ..................................................................................... 53

3.1 INTRODUCTION..................................................................................................................... 53

3.2 MATERIALS AND METHOD .................................................................................................... 54

3.2.1 DNA extraction by heat lysis .......................................................................................... 54

3.2.2 Mycoplasma 16S rRNA gene amplification .................................................................... 54

3.2.3 Primer design for PCR-SSCP analysis ........................................................................... 55

3.2.4 PCR optimisation ............................................................................................................ 56

3.2.5 PCR of mycoplasma swab samples ................................................................................. 58

3.2.6 Non-isotopic Single-Strand Conformation Polymorphism (SSCP) ................................. 58

3.2.6.1 Assessment of variability within samples ........................................................................... 58

3.2.6.2 SSCP of mycoplasma-positive PCR samples ...................................................................... 59

3.2.7 DNA Sequencing ............................................................................................................. 59

3.2.8 Sequence analysis ........................................................................................................... 60

3.2.9 Statistical analysis .......................................................................................................... 61

3.3 RESULTS .............................................................................................................................. 63

3.3.1 PCR of controls and samples .......................................................................................... 63

3.3.2 Screening of isolates by SSCP for genetic variability..................................................... 63

3.3.3 SSCP-coupled analysis of all samples, and identification .............................................. 63

vi


3.3.4 Numbers and proportion of each mycoplasma species found ......................................... 65

3.3.5 Comparison of colour change observed in liquid culture and identification based on

PCR-SSCP and nucleotide sequencing ........................................................................... 65

3.3.6 Analysis of species distribution among anatomical sites ................................................ 66

3.3.7 Association between mycoplasma species and ocular/respiratory disease .................... 68

3.4 DISCUSSION ......................................................................................................................... 69

CHAPTER 4 GENERAL DISCUSSION AND CONCLUSIONS ......................... 81

CHAPTER 5 APPENDICES ..................................................................................... 89

5.1 APPENDIX 1: DATA COLLECTION SHEET .............................................................................. 89

5.2 APPENDIX 2: LIQUID MYCOPLASMA MEDIA .......................................................................... 90

5.3 APPENDIX 3: MYCOPLASMA AGAR FORMULATION ............................................................... 91

5.4 APPENDIX 4: CALCULATING THE BINOMIAL DISTRIBUTION .................................................. 92

5.5 APPENDIX 5: PROTOCOL FOR DNA EXTRACTION BY HEAT LYSIS METHOD ........................... 94

5.6 APPENDIX 6: ALIGNMENT OF FELINE MYCOPLASMA SPECIES IN THE REGION AMPLIFIED BY

PRIMERS FD1000 AND MYCOR ............................................................................................ 95

5.7 APPENDIX 7: COMPARISON OF DNA EXTRACTION METHOD AND INFLUENCE OF CULTURE

MEDIA IN SAMPLES BY RELATIVE INTENSITY OF PCR PRODUCTS VISUALISED ON AGAROSE

GEL ....................................................................................................................................... 96

5.8 APPENDIX 8: DNA PURIFICATION PROTOCOL ....................................................................... 97

CHAPTER 6 REFERENCES .................................................................................... 99

vii


LIST OF TABLES

Table 1.1: Comparative colony characteristics for feline mycoplasma species

Table 1.2: Comparative biochemical characteristics of feline mycoplasma species

Table 1.3: Comparative percentage of mycoplasma isolates from ‘sick’ and healthy

cats found to be infected with each of three species of mycoplasma

Table 2.1: Study population characteristics

Table 2.2: Comparison of prevalence of mycoplasma-positive samples and gender

of cats

Table 2.3: Comparison of prevalence of mycoplasma-positive samples in adult and

juvenile cats

Table 2.4: Comparison of prevalence of mycoplasma-positive samples in stray and

owned cats

Table 2.5: Comparison of prevalence of mycoplasma-positive samples and location

of cats within shelter

Table 2.6: Comparison of prevalence of mycoplasma-positive samples between cats

with and without signs of ocular/respiratory disease

Table 2.7 Comparison of paired proportions for mycoplasma status between the

conjunctiva and pharynx using McNemar’s test

Table 2.8: Comparison of paired proportions for mycoplasma status between the

conjunctiva and bronchus using McNemar’s test

Table 2.9: Comparison of paired proportions for mycoplasma status between the

pharynx and bronchus using McNemar’s test

Table 2.10: Comparison of prevalence of mycoplasma-positive conjunctival swabs

between cats with and without conjunctivitis

Table 2.11: Comparison of prevalence of mycoplasma-positive pharyngeal swabs

between cats with and without signs of upper respiratory tract disease

Table 2.12: Comparison of prevalence of mycoplasma-positive bronchial swabs

between cats with and without gross lung pathology

Table 2.13: χ 2 test of goodness of fit of the binomial distribution, applied to the

number of cats with a particular number of mycoplasma-positive

anatomic sites

Table 3.1: Mycoplasma 16S rRNA gene PCR primer sequences

viii


Table 3.2: Results of SSCP for the 129 mycoplasma-positive PCR samples

Table 3.3: Number of variant SSCP profiles identified and comparison to health

status of cats

Table 3.4: Numbers of cats that had the same mycoplasma species or different

mycoplasma species among sites when multiple sites within a cat

contained mycoplasma

Table 3.5: Comparison of the proportion of each mycoplasma species between

different combinations of positive sites using Fisher’s exact test (where

the same species was present at each site)

Table 3.6: Comparison of the proportion of each mycoplasma species between

different combinations of positive sites using Fisher’s exact test (where

those with different species at each site were also considered in the

overall proportion)

Table 3.7: Number and proportion of positive samples for each species of

mycoplasma at each anatomic site sampled

Table 3.8: Proportion of observations and odds at each site of a positive result for

M. felis (F) compared to M. gateae/M. arginini (R)

Table 3.9: Comparison of likelihood of M. felis versus M. gateae/M. arginini at

particular anatomic sites using the odds ratio

Table 3.10: Comparison of paired proportions for mycoplasma status overall

between the conjunctiva and pharynx using McNemar’s test

Table 3.11: Comparison of paired proportions for mycoplasma status overall

between the conjunctiva and bronchus using McNemar’s test

Table 3.12: Comparison of paired proportions for mycoplasma status overall

between the pharynx and bronchus using McNemar’s test

Table 3.13: Comparison of paired proportions for M. felis status between the

conjunctiva and pharynx using McNemar’s test

Table 3.14: Comparison of paired proportions for M. felis status between the

conjunctiva and bronchus using McNemar’s test

Table 3.15: Comparison of paired proportions for M. felis status between the pharynx

and bronchus using McNemar’s test

Table 3.16: Comparison of paired proportions for M. gateae/M. arginini status

between the conjunctiva and pharynx using McNemar’s test

ix


Table 3.17: Comparison of paired proportions for M. gateae/M. arginini status

between the conjunctiva and bronchus using McNemar’s test

Table 3.18: Comparison of paired proportions for M. gateae/M. arginini status

between the pharynx and bronchus using McNemar’s test

Table 3.19: Number of each mycoplasma species at any site for both healthy and

diseased cats.

Table 3.20: Comparison of proportion of each mycoplasma species present in

conjunctival swabs between cats with and without conjunctivitis

Table 3.21: Comparison of proportion of each mycoplasma species present in

pharyngeal swabs between cats with and without upper respiratory tract

signs

Table 3.22: Comparison of proportion of each mycoplasma species present in

bronchial swabs between cats with and without lower respiratory tract

signs

x


LIST OF FIGURES

Figure 2.1: Location of signs of disease observed in the study population of cats

Figure 2.2: Anatomic distribution of mycoplasma-positive swabs

Figure 2.3: Anatomic distribution and combination of mycoplasma-positive swabs

Figure 3.1: Mycoplasma 16S rRNA gene, primers, and amplified products

Figure 3.2: Gel showing PCR products amplified by primers MycoF and MycoR

Figure 3.3: Gel showing PCR products amplified by primers FD1000 and MycoR

Figure 3.4: SSCP gel of feline mycoplasma samples showing two distinct profiles; F

and R

Figure 3.5: SSCP gel of feline mycoplasma samples showing variant F profiles in

addition to the two profiles F and R

Figure 3.6: Nucleotide sequence alignment of sample 103C (profile F) with the

sequence representing M. felis

Figure 3.7: Nucleotide sequence alignment of F profile variant samples (110C and

111B) with M. felis and regular F profile (103C)

Figure 3.8: Nucleotide sequence alignment of sample 14A (profile R) with M. gateae

Figure 3.9: Comparison of mycoplasma species distribution across the different

anatomic locations studied

xi


ABBREVIATIONS

AFLP Amplified fragment length polymorphism

bp Base pairs

BAL Bronchoalveolar lavage

DGGE Denaturing gradient gel electrophoresis

DNA Deoxyribonucleic acid

EDTA Ethylene diamine tetraacetic acid

FBD Feline bronchial disease

FCV Feline calicivirus

FeLV Feline leukaemia virus

FHV Feline herpesvirus

FIV Feline immunodeficiency virus

Ig Immunoglobulin

LAMP Lipid associated membrane protein

LRT Lower respiratory tract

PAMP Pathogen associated molecular pattern

PBS Phosphate buffered saline

PCR Polymerase chain reaction

RNA Ribonucleic acid

SPF Specific pathogen free

SSCP Single-strand conformation polymorphism

TLR Toll-like receptor

URT Upper respiratory tract

UV Ultraviolet

16S rRNA gene The 16 small subunit ribosomal RNA gene

16-23S IGS Intergenic spacer region between the 16 and 23 small subunit

ribosomal RNA genes

xii


1.1 Introduction

Chapter 1 Introduction and Literature Review

Mycoplasmas are one of the smallest known free-living organisms. Their small size,

combined with plasticity due to the absence of a rigid cell wall leaves them well

suited to close associations with cellular membranes. These intimate cellular

environments not only provide osmotic protection, but the fastidious oxygen,

temperature and nutritional requirements of mycoplasmas can also be met.

Consequently, mycoplasmas are commonly found living on mucous membranes of

their mammalian hosts (Razin and Freundt, 1984). The normal host defence

mechanisms of the conjunctiva, upper respiratory and urogenital tracts tolerate a

resident microflora population. As a consequence, mycoplasmas commonly colonise

the upper respiratory tract (URT) compared with the relatively sterile environment of

the lower respiratory tract (LRT). Within this niche, mycoplasmas must develop

specific methods to avoid injuring the host cells and activating host defence

mechanisms. The conjunctiva and URT primarily use secretions containing IgA and

mucosal associated lymphoid tissue for their defence, while the lower respiratory tract

also has a combination of ciliated epithelial cells and mucous covering, making it

more difficult for organisms to attach. In addition, the lower respiratory tract has a

wider array of lymphoid tissue, with location specific immune cells (alveolar

macrophages and Clara cells) and antibodies (IgA, IgE, and IgG) (reviewed in (Cohn

and Reinero, 2007; Lopez, 2007)).

To survive, mycoplasmas need to attach to host epithelial cells so their physiologic

requirements can be met, which also provides protection from mechanical flushing

((Razin, 1978), cited in (Cassell et al., 1985)). Irrespective of any specific pathogenic

mechanisms, mycoplasmas must be able to evade the host defences to cause local

damage or to enter the body, and thus must have substantial capacity for attachment

as well as specific virulence factors (reviewed in (Cassell et al., 1985; Rottem, 2003)).

Moreover, mycoplasmas may act synergistically with other organisms, such as

bacteria or viruses, to cause disease.

1


Due to their attachment to mucous membranes, disease caused by mycoplasma is

typically confined the conjunctiva, respiratory tract and/or urogenital tract

(Rosenbusch, 1994). However, when mycoplasma infection becomes systemic,

synovial infection is common (Rosenbusch, 1994). Mycoplasmal respiratory diseases

of veterinary importance include Contagious Bovine Pleuropneumonia, Contagious

Caprine Pleuropneumonia, Enzootic Pneumonia of pigs and Chronic Respiratory

Disease of poultry (Cassell et al., 1985). Most mycoplasma diseases, although

chronic, are often not fatal. Where mycoplasmas are known to cause disease, they

may do so inconsistently and can be found in apparently healthy hosts. This proves

challenging in determining their exact role in many diseases and despite what is

known, the pathogenesis of mycoplasmal diseases are poorly understood. The

conditions under which mycoplasmas are pathogenic are multifactorial, based not

only on virulence but also host and environment factors.

Respiratory disease in animals usually has a complex and multifactorial aetiology.

The syndrome known as ‘cat flu’ or feline upper respiratory disease complex (broadly

including conjunctivitis) may involve a number of aetiologic agents, including feline

herpesvirus (FHV), feline calicivirus (FCV), Chlamydophila felis, Bordetella

bronchiseptica and Mycoplasma spp. In the past, it was thought that viral agents

played the major role in feline upper respiratory disease, being exacerbated or

complicated by superimposition of secondary bacterial infections. Although the

pathogenic role of viruses has been clearly demonstrated, there is evidence to suggest

that these bacteria may cause primary disease (Gaskell and Bennett, 1996; Dawson

and Willoughby, 1999).

The epidemiology of feline respiratory disease is likely to be complex. Host, pathogen

and environmental factors are variable, and when considering the prevalence of

mycoplasma in feline populations, it is important to differentiate between presence of

the organism, and an association with disease. Furthermore, the boundaries between a

commensal organism, opportunistic invader and pathogen can be difficult to

determine. Microbiological disease of the respiratory tract has an inherent complexity,

particularly when identifying multiple potentially causative organisms and

determining their role. Additionally, mycoplasmas tend to be fastidious, with stringent

growth conditions, making them either difficult to isolate or slow to grow. The

2


development of rapid and sensitive molecular techniques, such as PCR and nucleotide

sequencing, have improved the characterisation of mycoplasmas and other organisms

to the species level both for diagnostic purposes and research.

1.2 Research Objectives

Syndromes involving ocular and respiratory diseases are widespread and significant

problems in cats. Mycoplasmas have a demonstrated ability to act as primary

pathogens in respiratory disease of other host species, and have been reported to be a

primary pathogen in several feline case studies. The aim of this thesis is to investigate

the epidemiology of feline mycoplasmas and any association with disease by

surveying a population of shelter cats.

The objective of this chapter is to concisely and critically review the current literature

relating to feline mycoplasmas; in particular, the species of mycoplasma known to

infect cats, their distribution and prevalence, and review the evidence of their role in

disease. Current methods of isolation and characterisation of these organisms are also

reviewed. This research, and hence review will be limited to “surface” mycoplasmas,

not the “haemotropic” organisms recently reclassified as mycoplasmas.

1.3 Literature Review

1.3.1 Mycoplasmas – general characteristics

Mycoplasmas are amongst the smallest known free-living prokaryotic organisms.

They range in size from 0.3-0.8 µm (Razin and Freundt, 1984), with a genome size

ranging from 580 to 1300 kb (Morowitz and Wallace, 1973; Razin, 1992). They

belong to the Class Mollicutes (meaning soft skin), Order Mycoplasmatales, Family

Mycoplasmataceae and the Genus Mycoplasma (meaning fungus form). There are at

least 112 defined species of mycoplasma (Tully and Bradbury, 2003).

Mycoplasmas have evolved into their ecological niche by a process of genome

minimisation (reviewed by (Bradbury, 2005)). The simplicity of the mycoplasma

genome means they have the machinery for complex protein synthesis, but rely on

hosts for their survival, and this also accounts for their slow growth.

3


Mycoplasmas have been found in an extensive range of avian and mammalian hosts,

including humans, and are found as a common contaminant of cell cultures and

veterinary vaccines (Thornton, 1986; Kojima et al., 1996). Mycoplasmas are usually

host specific, particularly those species that are pathogenic (Whitford et al., 1994).

Some mycoplasma species, such as M. arginini are found in multiple host species

(Razin and Freundt, 1984).

Mycoplasmas cannot synthesise peptidoglycans and thus have no rigid cell wall, but a

flexible triple-layered outer plasma membrane, allowing pleomorphism. Owing to the

absence of a cell wall, mycoplasmas are usually not resilient in the environment, and

hence, are found living in association with their hosts, most commonly on mucous

membranes. Thus, the types of diseases they are associated with are those of the

respiratory tract, conjunctiva and urogenital tract.

Less than half of known mycoplasma species cause a specific disease or have a

defined pathogenicity (Razin and Freundt, 1984). Most species isolated in association

with disease have a poorly defined role in the disease pathogenesis, while other

mycoplasma species are considered to be part of the normal microbial flora of

mucosal surfaces. Radostits et al. (1994) highlight this point: “There is uncertainty

about the real importance of mycoplasmas in many diseases from which they are

consistently isolated” (Radostits et al., 1994). Some mycoplasmas do, however, cause

significant and widespread disease, particularly of the respiratory system. These have

important health and economic consequences in pig, poultry and ruminant production

industries; hence, there has been extensive research into these organisms, particularly

focussing on pathogenesis, virulence and vaccine antigen targets (Whithear, 1996;

Minion, 2002; Thiaucourt et al., 2003; Bradbury, 2005; Nicholas et al., 2009).

Much less is known about the role and characteristics of mycoplasmas in companion

animals, such as horses, dogs and cats (Whitford and Lingsweiler, 1994).

Mycoplasmas have been associated with, implicated in, or isolated from cases of

conjunctivitis (Cello, 1957; Cole et al., 1967; Tan and Markham, 1971b; Campbell et

al., 1973b; Shewen et al., 1980; Haesebrouck et al., 1991; Low et al., 2007; Hartmann

et al., 2008), upper respiratory disease (Schneck, 1972; Schneck, 1973; Bannasch and

4


Foley, 2005; Johnson et al., 2005; Huebner et al., 2007; Hartmann et al., 2008; Veir et

al., 2008; Johnson and Kass, 2009), pneumonia (Tan, 1974; Tan and Miles, 1974b;

Randolph et al., 1993; Foster et al., 1998; Bart et al., 2000; Chandler and Lappin,

2002; Foster et al., 2004b; Foster et al., 2004c; Trow et al., 2008), pyothorax (Malik

et al., 1991; Gulbahar and Gurturk, 2002), bronchial disease (Foster et al., 2004a;

Foster et al., 2004b; Foster et al., 2004c), abscesses (Keane, 1983; Crisp et al., 1987;

Walker et al., 1995; Adamson, 2004), aural polyps (Cross, 2004; Klose et al., 2007),

and arthritis (Moise et al., 1983; Hooper et al., 1985; Liehmann et al., 2006;

Zeugswetter et al., 2007) in cats. However, evidence for the role of mycoplasmas as

primary pathogens in these diseased cats is rarely conclusive. The limited

investigation of feline mycoplasmas may be a reflection of this species lacking the

same economic significance as production animals. Alternatively, feline mycoplasmas

may not cause enough economic loss or morbidity. This may be because cats are

seldom kept in conditions of close confinement similar to that of intensive piggeries

or poultry establishments. In addition, routine cultures from cats do not usually

include mycoplasma-specific media.

1.3.2 Species of mycoplasma isolated from cats

The earliest report of mycoplasma isolation in a cat was from the lung of a 6 week old

kitten with pneumonia in 1954 (Switzer, 1967). Mycoplasma was then found in cats

with conjunctivitis (Cello, 1957) and in the saliva of healthy cats (Cole et al., 1967).

Cole et al. (1967) characterised the isolates by their morphology, biochemical

requirements and antigenic composition, and identified two distinct species, M. felis

and M. gateae. Subsequently, two other species were discovered in domestic cats: M.

feliminutum (Heyward et al., 1969) and M. arginini (Tan and Miles, 1974b). It is

these four species of mycoplasma that are frequently isolated from cats, or are

recognised as having cats as their primary host.

Although M. felis is relatively host-specific, it has been isolated from other host

species including horses (Ogilvie et al., 1983; Rosendal et al., 1986; Carman et al.,

1997; Wood et al., 1997), and M. gateae has been frequently isolated from dogs

(Rosendal, 1979). Although M. arginini is found in cats, it has a wide host distribution

(Razin and Freundt, 1984). M. feliminutum differs from the other feline mycoplasmas,

5


with only one report of isolation in cats (Heyward et al., 1969), one in a horse and on

more than one occasion in dogs (Razin and Freundt, 1984). Despite these four

mycoplasma species having cats as a host, they are not phylogenetically close based

on 16S rRNA sequence data (Brown et al., 1995).

Other mycoplasma species isolated from cats include M. pulmonis, M. arthritidis and

M. gallisepticum (Tan et al., 1977a). These species were isolated from the

oropharynx of a small number (representing less than 4% of positive isolates) of

clinically normal cats (in addition to M. gateae, M. felis and M. arginini). In addition,

this study reported a number of oropharyngeal mycoplasma isolates (2% of positive

isolates) whose species status was unable to be determined by growth inhibition tests

using reference antisera against 14 different mycoplasma species. A previous study by

Tan and Miles (1974b) cultured 15 mycoplasma isolates from the oropharynx of

diseased cats, and 19 isolates from the oropharynx of moribund cats which were not

identified as either M. gateae, M. felis or M. arginini by growth inhibition. No attempt

was made to investigate these isolates further. It is therefore possible that there are

more mycoplasma species that inhabit the oropharynx of cats. Although it seems

unlikely that the other species have a pathogenic role, it is important to characterise

the normal flora of the oropharynx as there is potential for opportunistic secondary

mycoplasmal infections.

Other organisms related to mycoplasmas of the Genus Ureaplasma and Acholeplasma

have also been recovered from domestic cats (Tan and Markham, 1971a; Tan and

Miles, 1972; Tan and Miles, 1974a; Tan and Miles, 1974b; Tan et al., 1977a;

Randolph et al., 1993; Senior and Brown, 1996). These are readily differentiated from

mycoplasmas using biochemical characteristics; Ureaplasmas contain the enzyme

urease and can therefore hydrolyse urea, whereas Acholeplasmas do not require

sterols for growth (Razin and Freundt, 1984). Neither species have been significantly

associated with disease in cats, apart from some experimental evidence of

Ureaplasmas inducing abortions in pregnant queens (Tan and Miles, 1974a).

Following early descriptions of mycoplasmas in cats, further research investigated the

extent of the presence and role of mycoplasma in causing disease. Different research

groups contributed significantly to this over a 10-year period from 1969, largely by

6


investigating the presence of mycoplasma in greater numbers of both healthy and

diseased cats, by characterisation and identification of mycoplasma to the species

level (utilising biochemical and serological methods), and the use of experimental

transmission studies to determine their pathogenic potential (Heyward et al., 1969;

Blackmore et al., 1971; Tan and Markham, 1971a; Tan and Markham, 1971b; Tan

and Miles, 1972; Blackmore and Hill, 1973; Tan and Miles, 1973; Tan and Miles,

1974a; Tan, 1974; Tan and Miles, 1974b; Tan et al., 1977a; Tan et al., 1977b).

Despite more recent advances in molecular and genetic technologies, very little is

known about the genetic characteristics of feline mycoplasmas in relation to major

genes, attachment structures, antigenic regions and virulence factors. There has,

however, been characterisation of the 16S rRNA gene nucleotide sequence, which has

provided a molecular basis for species identification and phylogeny construction of

feline mycoplasmas (Brown et al., 1995).

1.3.3 Methods for the isolation and identification of feline mycoplasmas

1.3.3.1 Collection techniques

The conventional method for isolating mycoplasmas from mucosal surfaces is

recovery via swab samples, which can be either streaked directly on to plates or

placed into liquid culture media (Rosendal, 1979). Tissue mycoplasmacidal factors

have been described by various authors (Tully and Rask-Nielsen, 1967; Kaklamanis et

al., 1969; Rosendal, 1979) which may be liberated following the homogenisation of

tissue samples. To prevent this problem, tissue samples should be pushed onto plates

and then placed in broth (Rosendal, 1979). In contrast, Razin and Freundt (1984)

suggested that tissues should be dissected coarsely and then added to liquid

mycoplasma media followed by at least two ten-fold dilutions in broth to reduce

concentrations of inhibitory components.

Mycoplasmas have been detected directly by PCR from swabs of feline conjunctiva

(Bannasch and Foley, 2005; Huebner et al., 2007; Low et al., 2007; Hartmann et al.,

2008), oropharynx (Huebner et al., 2007; Hartmann et al., 2008; Veir et al., 2008),

and nasal flush and biopsy samples (Johnson et al., 2004; Veir et al., 2008). The use

7


of direct swabs for subsequent PCR amplification (of a suitable DNA target region)

might circumvent the effects of mycoplasmacidal components on culture, because

viable organisms are not required for DNA amplification by the PCR.

Other studies have utilised bronchoalveolar lavage (BAL) to isolate mycoplasmas

from the lower respiratory tract of cats (Randolph et al., 1993), and retrospective

studies of lower respiratory tract cytology, microbiology and disease are based on the

use of BAL to culture the organisms (Padrid et al., 1991; Chandler and Lappin, 2002;

Foster et al., 2004a; Foster et al., 2004b; Foster et al., 2004c). BAL is more applicable

to, and widely used in, the clinical setting and may also avoid the release of

mycoplasmacidal factors by avoiding tissue disruption.

The relative efficacy of retrieving different mycoplasma species using lavage

techniques may depend on their varying degrees of adherence or attachment. This

aspect has not been studied in the LRT of cats but was considered in a study

comparing the relative isolation of mycoplasmas using both nasal flush and biopsy for

comparison (Johnson et al., 2004). Part of the rationale for the study by Johnson et al.

(2004) was based on a study which investigated porcine mycoplasmas, and found

pathogenic mycoplasmas adhered to cilia on epithelial cells whereas non-pathogenic

species did not (Young et al., 2000). There was no significant difference between

nasal flush and biopsy samples for the isolation of mycoplasmas in this, or a more

recent analysis of cats with URT disease (Johnson et al., 2004; Johnson and Kass,

2009). As the respiratory health of the cats was not considered in the former study,

and there was little discrepancy between the sampling methods, no further analysis

was undertaken to determine any difference in mycoplasma species represented or to

relate it to their pathogenicity.

Handling of samples is important in the recovery of mycoplasma, both by culture and

PCR. Mycoplasma-specific media or other transport medium (such as Amies’ without

charcoal or Stuart’s) is required to maintain viable organisms in samples to be

cultured (Razin and Freundt, 1984; Whitford, 1994). There are three important rules

for the transport of samples, which are to keep the sample moist, cool and to “move

fast” (Whitford, 1994). Isolation is maximised if samples are placed in media within a

8


few hours of collection, but if delays of more than 24 hours are inevitable, freezing at

-70 ºC is recommended (Whitford, 1994).

Methods of collection and transport of feline swabs which have been utilised for

direct PCR analysis of mycoplasmas have differed among studies. Generally, studies

have been based on rolling dry or moistened swabs across the mucous membrane,

placing the sample in sterile saline or phosphate-buffered saline and either processed

within a few hours or frozen at -20 ºC, -70 ºC, or -80 ºC until processing (Johnson et

al., 2004; Bannasch and Foley, 2005; Low et al., 2007; Sjödahl-Essén et al., 2008;

Veir et al., 2008). Blackmore et al. (1971) demonstrated that the recovery of

mycoplasmas at post mortem closely corresponded to results obtained from taking

swabs from animals ante mortem.

1.3.3.2 Culture media

Mycoplasmas are facultative anaerobes, requiring cholesterol or related sterols for

growth, and use either sugars or arginine as their major energy source. Media

requirements are complex due to the limited ability of mycoplasmas to produce many

nutrients. Mycoplasma media and its components have previously been described

(Edward, 1947; Hayflick, 1965; Frey et al., 1973), and with minor modifications, are

widely used for the isolation of feline mycoplasmas (Cole et al., 1967; Heyward et al.,

1969; Spradbrow et al., 1970b; Blackmore et al., 1971; Hill, 1971; Tan and Markham,

1971b; Tan and Miles, 1972; Blackmore and Hill, 1973; Tan and Miles, 1973, 1974b;

Tan et al., 1977a; Tan et al., 1977b; Haesebrouck et al., 1991; Johnson et al., 2004;

Johnson and Kass, 2009).

An important consideration in the formulation of mycoplasma media is to provide

osmolarity needed due to the absence of a cell wall (Rosenbusch, 1994). Animal

serum is a source of sterols and fatty acids, while yeast extract, glucose or arginine

can be used as a source of metabolisable energy (Rosenbusch, 1994). Different

mycoplasma species preferentially utilise either one of these energy sources, and

phenol red is added as an indicator to differentiate pH changes associated with

different energy utilisation (Ruhnke and Rosendal, 1994). Antimicrobial agents

9


penicillin and thallium acetate are added to inhibit bacterial overgrowth or

contamination (Edward, 1947).

The comparative efficacy of recovering feline mycoplasmas using both solid and

liquid media has been described (Hill, 1971). This study found that there were 6

(16%) additional isolates obtained from inoculating liquid media that were not

apparent from solid media alone. Additionally, mycoplasmas could be isolated from

up to 20% of the liquid media that had not shown any obvious change in pH after a 2-

week culture period. This finding demonstrated the importance of inoculating liquid

media in addition to culture plates, and also that pH change in liquid media may be an

insensitive method for determining the presence of mycoplasmas.

1.3.3.3 Culture conditions

As none of the known feline mycoplasmas are strict anaerobes, normal atmospheric

conditions, or room air with 5% CO2 is satisfactory for growth (Rosendal, 1979;

Whitford and Lingsweiler, 1994). The optimal temperature for growth of

mycoplasmas from animal origin is 36-37 ºC (Razin and Freundt, 1984). Mycoplasma

species recovered from cats have been grown aerobically at 37 ºC (Heyward et al.,

1969) or in 5% CO2 (Tan and Miles, 1972, 1974b).

1.3.3.4 Morphology

Compared with most other bacteria, mycoplasma colonies are very small (< 1 mm

diameter) and are typified by a “fried-egg” appearance of a dense granular core

resulting from their tendency to grow down into the solid media, with a flat

translucent periphery of outward growth. Some species have distinct features of

colony morphology, but this is not a sensitive criterion for identification, as variation

can arise due to variations in media and growth conditions (Razin and Freundt, 1984).

The morphological characteristics of each of the four feline mycoplasma species are

listed in Table 1.1.

10


1.3.3.5 Biochemical profiles

A standard set of biochemical tests has been established for the characterisation of

mycoplasma isolates by the International Committee on Systematic Bacteriology,

Subcommittee on the Taxonomy of Mollicutes (Brown et al., 2007). These protocols

are reviewed in (Goll, 1994), and are beyond the scope of this review. The

biochemical profiles of most mycoplasma species of veterinary importance have been

summarised (Razin and Freundt, 1984; Ruhnke and Rosendal, 1994). The

distinguishing metabolic features of the four common feline mycoplasma species are

given in Table 1.2.

1.3.3.6 Serological methods for specific identification

Following an assessment of the morphological and biochemical characteristics of

Mycoplamas, serological tools have, until recently, been used as the standard

approach for the specific identification of mycoplasma (Brown et al., 2007). Specific

identification is made by comparing the serological characteristics of an isolate with

those of reference strains using various techniques such as growth inhibition,

metabolic inhibition, immunofluorescence and immunobinding. These techniques

have been reviewed elsewhere (Rosendal, 1979; Goll, 1994; Brown et al., 2007) and

are beyond the scope of this review. However, it is important to understand the

limitations of these techniques during critical review of the literature where

mycoplasmas have been identified by these means.

The use of serological methods for specific identification has certain disadvantages,

which relate predominantly to cross-reactivity among mycoplasma species as a result

of common antigens (Goll, 1994). Although each feline mycoplasma species can be

demonstrated as serologically distinct, a degree of cross-reactivity can occur between

them in particular tests (Cole et al., 1967; Heyward et al., 1969; Rosendal, 1979). Test

interpretation must therefore be made with caution and consideration of test accuracy

and limitations, which has been reviewed elsewhere (Goll, 1994) and are beyond the

scope of this review. A major disadvantage of serological methods compared with

more recent molecular methods is the requirement for maintenance of a wide array of

reference type cultures and antisera. As antisera are produced in experimental

11


Table 1.1: Comparative colony characteristics for feline mycoplasma species

(Heyward et al., 1969; Hill, 1971)

Species Colony morphology Average

M. felis Large circular colonies, rust-like

hue, prominent central core, dense

periphery that becomes brown

with age

M. gateae Clear, vacuolated colonies, small

central core

M. arginini As above with more prominent

central core

M. feliminutum Small colonies, irregular shape, no

central core

colony

size (µm)

550 24

185 24

185 24

140 72

Time for growth

(h)

(brown colour can

take 7-14 days to

develop)

Table 1.2: Comparative biochemical characteristics of feline mycoplasma species

Species Glucose

(Razin and Freundt, 1984; Whitford et al., 1994)

fermentation

Arginine

hydrolysis

Phosphatase

activity

Expected colour

change in liquid

media *

M. felis + - - yellow

M. gateae - + - red

M. arginini - + - red

M. feliminutum x - + x

(* based on the use of phenol red indicator, whereby acidification of the media

produces a yellow colour change, and alkalinisation a red colour change; x =

unresolved)


animals, the use of molecular methods reduces the need for animal use, an important

welfare consideration, and also averts the expense of maintaining animal colonies.

Not withstanding these limitations, the serological characteristics of feline

mycoplasma isolates have been described and are diagnostically useful (Cole et al.,

1967; Heyward et al., 1969; Rosendal, 1979). M. felis has been demonstrated to be

serologically distinct from M. gateae, M. arginini and M. feliminutum (Cole et al.,

1967; Heyward et al., 1969). The single M. feliminutum isolated was serologically

distinct from other feline species (Heyward et al., 1969).

In addition to the very similar morphological and identical biochemical

characteristics, the close relationship of M. gateae and M. arginini is also evident in

their serological cross-reactivity (Heyward et al., 1969; Rosendal, 1979). In contrast,

an immunobinding assay specifically designed to distinguish feline isolates of M. felis

and M. gateae was tested against cultures of M. arginini and M. feliminutum; no

cross-reactivity was evident using this method (Brown et al., 1990).

1.3.3.7 Molecular methods for specific identification

Molecular methods for the genetic characterisation of mycoplasmas have largely

superseded the use of serological methods. The International Committee on

Systematics of Prokaryotes Subcommittee on the Taxonomy of Mollicutes recognised

this recently (Brown et al., 2007). The 16S rRNA gene nucleotide sequence is now

the primary method for specific identification and determination of phylogenetic

relationships, provided that the serological and phenotypic data substantiates

identification (Brown et al., 2007). Specific amplification of target DNA regions such

as the 16S rRNA gene by the PCR can be used to identify isolates to the species

and/or subspecies level. This is usually performed by comparison of sequence data

with those in databases such as GenBank® (National Centre for Biotechnology

Information, Bethesda, MD, USA http://www.ncbi.nlm.nih.gov), which contain

reference sequences. Differences in nucleotide sequence can be used to develop PCR

based methods for the rapid identification of different species.

12


Some advantages of molecular techniques (compared with serological) are that they

generally are more rapid, accurate (specific), and avoid problems with culture of

nonviable, fastidious or contaminant organisms (as reagents are directed specifically

at mycoplasma) (Brown et al., 1995; Chalker et al., 2004; Johnson et al., 2004).

Using these techniques requires standardisation and validation, using appropriate

controls, to maximise their accuracy and efficiency. Particular attention must be paid

to meticulous “technique” due to the incredible sensitivity of PCR to contamination.

Primers universal to the 16S rRNA genes of mycoplasmas have been used for the

purpose of differentiating among feline mycoplasma species (Brown et al., 1995). The

PCR-amplified nucleotide sequences from feline mycoplasma isolates were

determined. An approach was developed with the use of particular restriction

endonucleases to cleave PCR products, yielding digestion patterns of characteristic

fragment sizes for each mycoplasma species (Brown et al., 1995). Variations of these

techniques have subsequently been applied to feline population studies to amplify

DNA from clinical isolates for mycoplasma identification (Bannasch and Foley, 2005;

Gray et al., 2005; Huebner et al., 2007; Klose et al., 2007; Low et al., 2007;

Hartmann et al., 2008; Sjödahl-Essén et al., 2008; Veir et al., 2008).

The genetic relationships of some mycoplasma species have been examined using the

16S-23S rRNA intergenic spacer region (IGS) (Harasawa, 1999). This region is less

conserved than the 16S rRNA gene, but as it contains both conserved and variable

regions in a 200-350 bp sequence, it was considered to be a useful region for the

genetic comparison of species within a genus (Harasawa, 1999). Results from the

study demonstrated phylogenetic relationships of mycoplasma which were similar to

those proposed previously using 16S rRNA gene data (Harasawa, 1999). Sequence

variability in the IGS within species must also be considered to determine its value for

species differentiation. Investigation of the use of PCR employing the 16S-23S IGS

region to identify M. felis in feline clinical samples demonstrated a high level of

sequence conservation in this region among M. felis isolates (Chalker et al., 2004).

The PCR was specific for M. felis when tested against three other feline mycoplasma

species (Chalker et al., 2004). A variation of this PCR technique (Chalker et al.,

2004) has recently been modified for use with real-time PCR for M felis, allowing

13


quantification of DNA and, by inference, organisms from swab samples (Nicholas et

al., 2008b; Sjödahl-Essén et al., 2008).

Other techniques such as restriction endonuclease analysis may be used in

combination with PCR to differentiate among species of mycoplasma, particularly to

reduce the requirement for sequencing every isolate (Brown et al., 1995). An

alternative method integrating the use of restriction endonucleases is whole genome

fingerprinting using the amplified-fragment polymorphism (AFLP) method (Vos et

al., 1995). AFLP is based on the selective amplification of restriction fragments by

PCR to create characteristic banding patterns for nucleotide sequences representing

different species. AFLP has been used for identifying and characterising both inter-

and intra-species variability in a range of mycoplasma species (Kokotovic et al.,

1999). Other molecular typing methods have been reviewed in (Nicholas et al.,

2008c), and are beyond the scope of this review.

PCR-coupled mutation detection techniques have proven to be useful across a range

of organisms for rapidly screening large numbers of samples for sequence variation,

and in particular for low level detection of variation (reviewed by (Gasser, 1997;

Gasser and Chilton, 2001; Gasser et al., 2006)). Denaturing gradient gel

electrophoresis (DGGE) and single-strand conformation polymorphism (SSCP) are

examples of such techniques. DGGE utilises the differential melting behaviour of

DNA fragments resulting from sequence variation. Fragments are separated in a gel

containing a gradient of chemical denaturants (such as urea and formamide) at a high

temperature (Gasser, 2001; McAuliffe et al., 2003). The concentration of denaturant

at which the DNA molecule separates is based on its nucleotide composition and

sequence, and the electrophoretic mobility decreases as the DNA becomes partially

denatured (Gasser, 2001). DGGE has been assessed as a means of rapid identification

for a range of mycoplasma species, including M. felis (McAuliffe et al., 2003;

Nicholas et al., 2008a). In this study (McAuliffe et al., 2003), intra- and inter-species

variation was demonstrated in the V3 region of the 16S rRNA gene by the use of

DGGE. Mycoplasma species were readily differentiated with this technique if

sufficient sequence variation existed in this region. Some closely related species

contained identical nucleotide sequences in this region and were thus unable to be

differentiated, which was a limitation of study design rather than of the technique.

14


The principle of SSCP is that single-stranded DNA assumes one or more

conformations based on its nucleotide sequence, as pairing between nucleotides

occurs to form structures. These conformations are highly dependent upon the

nucleotide sequence, and variation in the sequence alters the structure of the molecule

(Gasser et al., 2006). This variation (or polymorphism) can be detected based on

differing migration through a non-denaturing electrophoretic gel, and is evident from

unique banding profiles when visualised with a variety of staining methods or

autoradiography.

The sensitivity or mutation detection rate of the SSCP technique is dependent on a

number of factors, most importantly being size of the DNA fragment used and

electrophoresis conditions (Gasser, 2001). The DNA fragment sizes most suited to

SSCP were sequences of 100 to 500 base pairs (Gasser et al., 2006). Although the

mutation detection rate can decrease with sequences of > 200 bp (Gasser et al., 2006),

point mutations have been detected in sequences of up to 530 bp (Zhu and Gasser,

1998). A detailed protocol for the use of SSCP has been described including the use

of both radiolabelled and non-isotopic SSCP, and the different staining methods that

can be used for detection (Gasser et al., 2006).

In addition to detecting sequence variation or mutations between isolates or samples,

sequence variation has been demonstrated in samples by SSCP (Gasser et al., 2003;

Chalmers et al., 2005). This, and the ability of SSCP to detect point mutations over a

relatively large sequence (compared with variability within restriction endonuclease

cleavage sites) and to rapidly screen large sample numbers with relative technical ease

(Gasser et al., 2006), demonstrate advantages over techniques such as restriction

endonuclease analysis.

PCR-SSCP has been applied to the study of mycoplasmas, first to study the molecular

basis for resistance of M. hominis to fluoroquinolones (Gushchin et al., 1998), and

more recently, to classify isolates of M. synoviae to the subspecies level (Jeffery et al.,

2007). As both population and molecular epidemiological studies are important in

investigating infectious disease agents, PCR-SSCP should find increased applications

to mycoplasmas.

15


1.3.4 Epidemiology of feline mycoplasmas

Although the exact role that mycoplasma plays in ocular and respiratory disease of

cats, or specific host-organism relationships are not well known, current knowledge

can be reviewed in an attempt to determine a possible epidemiologic model for

disease and identify knowledge gaps. Epidemiological and ecological factors are

considered in terms of where mycoplasmas are found in cats and what species are

present. Additionally, geographical and climatic factors, the presence and interaction

of mycoplasmas with other respiratory pathogens, and host factors such as age and

immune response are reviewed.

1.3.4.1 Prevalence of mycoplasma in cats

There are numerous challenges in comparing studies of mycoplasma prevalence in

feline populations. Discrepancies across almost all studies hinder specific

comparisons, however broad generalisations are possible. There are differences such

as whether cats are owned or stray/shelter cats, gender, age, health status,

geographical location, climate and time of year. In addition, the presence of other

respiratory pathogens or systemic diseases, such as potentially immunosuppressive

diseases, may influence the presence and isolation of mycoplasmas. Furthermore,

variation in collection techniques, growth media and conditions, and anatomic sites

sampled may affect results. Findings are often presented as numbers of positive

samples out of total number of samples, which does not allow prevalence data to be

compared (in terms of numbers of cats and/or anatomic site). Where mycoplasma

species were defined, methods often differed from those (primarily serological)

employed in earlier studies to molecular methods in more recent investigations.

Differing sensitivity and specificity of different detection methods has consequences

in relation to the accuracy of specific identification. It is therefore useful to consider

prevalence data across groups or populations of cats, as they can then be compared

and contrasted, drawing the most meaningful conclusions from the data.

16


1.3.4.2 Prevalence – with reference to anatomical location

Mycoplasmas have been isolated from a range of anatomical sites in cats including

the conjunctiva, upper and lower respiratory tracts, urogenital tract, rectum, joint

spaces and ear canals (Heyward et al., 1969; Tan and Miles, 1974b; Tan et al., 1977a;

Tan et al., 1977b; Moise et al., 1983; Haesebrouck et al., 1991; Randolph et al., 1993;

Senior and Brown, 1996; Cross, 2004; Klose et al., 2007). The significance of

isolating mycoplasma and associations with disease can be inferred by establishing

the relative frequency of isolation from both diseased and healthy cats.

The upper respiratory tract of healthy cats is inhabited by a resident population of

microorganisms which include Pasteurella multocida, non-haemolytic Streptococcus,

and Escherichia coli (Lappin et al., 2007). Feline herpesvirus and feline calicivirus

have also been isolated from the URT of healthy cats (Ellis, 1981). In addition,

anaerobic bacteria from the oral cavity of healthy cats have been characterised, and

include isolates from the genera Actinomyces, Bacteroides and Fusobacterium (Love

et al., 1990). The association of microbial flora with the URT is dependent on both

the nature of host defence mechanisms and the attributes of the organisms that allow

them to remain there. Understanding the non-pathogenic association of organisms

with their hosts in this way may provide a basis for comparison when disease results

from these or other pathogenic organisms.

Mycoplasmas live on the mucous membranes in the URT if they can attach or adhere

firmly enough to withstand flushing by secretions, and if they can evade host

defences. Mycoplasmas may avoid non-specific host defences such as phagocytosis

by expressing antiphagocytic activity or resulting from close attachment of the

organism to the host cells (reviewed in (Cassell et al., 1985)). Another way that

mycoplasmas may be permitted to colonise the epithelium is a delay or prevention of

antigenic recognition which may result from organisms being somewhat protected by

their location on the epithelium. Biofilm formation has been demonstrated in some

species of mycoplasma such as M. bovis, and some authors have speculated that this

may have a role in resisting host defences (McAuliffe et al., 2006). Additionally, the

ability to adsorb serum proteins or host cellular antigens (as demonstrated for M.

hyorhinis) may mask mycoplasma-specific antigens or mimic host antigens (reviewed

in (Cassell et al., 1985)). Alternatively, exposure to small amounts of mycoplasmal

17


antigen may induce low-dose tolerance ((Nossal, 1983), cited in (Cassell et al.,

1985)). Mycoplasmas may evade effector mechanisms; for example mycoplasmas

may be firmly established on the surface of host cells before an IgA response is

activated (reviewed in (Cassell et al., 1985)). If mycoplasmas breach the epithelium

or cause cell damage, the immune system will alert their presence and the resultant

inflammatory response may destroy them. However even in the face of a specific

immune response, the mycoplasmas may be protected by localisation on the epithelial

surface where they are not readily accessible to phagocytic or lymphoid cells (Cassell

et al., 1985). Thus they may still reside on mucous membranes of the URT after an

immune response has cleared those organisms that gained systemic entry or invaded

more distally into the respiratory tract where there is a greater armoury of immune

mechanisms.

The highest frequency of mycoplasma recovery has been from the URT. The

prevalence of mycoplasma in the pharynx of healthy cats ranges from 35 to 100%

(Jones and Sabine, 1970; Blackmore et al., 1971; Tan and Miles, 1972; Tan et al.,

1977a; Haesebrouck et al., 1991; Randolph et al., 1993), which is comparable to

diseased cats (Spradbrow et al., 1970b; Schneck, 1973; Tan and Miles, 1973;

Randolph et al., 1993; Hartmann et al., 2008; Johnson and Kass, 2009), suggesting

that mycoplasmas live as commensal organisms in the URT.

Bannasch and Foley (2005) used an unmatched case control study, taking swabs from

the conjunctiva and oropharynx of cats both with and without upper respiratory

disease in animal shelters. Mycoplasma was found in 80 of 573 cats (14%); 65

isolates were from cats with upper respiratory disease and 15 without; the difference

was statistically significant with an odds ratio of 4.26. Cats with mycoplasma were

found to have more severe ocular discharge, conjunctivitis and nasal discharge

compared to cats without mycoplasma. This study provides evidence that

mycoplasma can have a significant association with upper respiratory disease in cats.

However, the study did not investigate mycoplasma-positive cats that had concurrent

infection with other organisms, and only conjunctival samples were tested for

mycoplasma. The presence of mycoplasma in the oropharynx was not included in the

analysis, leaving the involvement of mycoplasma in disease in the oropharynx

unclear.

18


The conjunctiva is a mucosal surface in contact with the external environment, and is

accessible to microorganisms as a possible route of entry to the host. The host

defences in this area consist of antibacterial factors and lysozymes in secretions of

lacrimal and associated glands, mucosal immune responses from submucosal

lymphocytic tissue and mechanical flushing by tears (Tizard, 1996). Organisms

demonstrated in the conjunctiva of healthy cats are Staphylococcus epidermidis,

Staphylococcus aureus, Streptococcus spp, Mycoplasma spp., Bacillus spp., and

Corynebacterium spp. (Campbell et al., 1973a; Shewen et al., 1980; Low et al.,

2007). Mycoplasmas have been isolated from the conjunctiva of up to 20% of healthy

cats (Blackmore et al., 1971; Tan and Miles, 1972; Tan et al., 1977a; Haesebrouck et

al., 1991; Low et al., 2007). The association of mycoplasma with conjunctivitis has

been demonstrated in various studies (Tan and Miles, 1972, 1973, 1974b; Tan et al.,

1977a; Haesebrouck et al., 1991; Low et al., 2007), with greater frequency of

isolation from cats with conjunctivitis than without, but evidence for the pathogenicity

or virulence of mycoplasmas in producing such disease has been conflicting.

Two studies have demonstrated the development of conjunctivitis following

experimental transmission of mycoplasmas (Tan, 1974; Haesebrouck et al., 1991),

whereas multiple other studies failed consistently to do so (Cello, 1957; Cole et al.,

1967; Blackmore and Hill, 1973; Tan et al., 1977b; Lappin et al., 2007). The

conflicting results may reflect differences in pathogenicity of mycoplasma species or

particular isolates, or in susceptibility to mycoplasma associated with age or other

characteristics of the cats. The involvement of other infectious agents is difficult to

determine, as not all of the above studies were performed in specific pathogen free

(SPF) cats. As with upper respiratory tract disease, the involvement of mycoplasma

with FHV or Chlamydophila felis in conjunctivitis or ocular disease must be

considered. Low et al. (2007) demonstrated that cats with active conjunctivitis were

significantly more likely to have mycoplasma than those without, and that multiple

agent infections were uncommon. Thus, the evidence supports an involvement of

mycoplasmas with conjunctivitis in cats, but the precise circumstances under which

disease occurs and the specific characteristics of the organisms involved have not

been determined.

19


The lower respiratory tract is substantially different from the URT as it is relatively

free of microbes (Tizard, 1996; Lopez, 2007). The host defences in this region reflect

this, being more sophisticated than in the upper respiratory tract. In addition to

mucous secretions, lysozymes and IgA, the epithelium is ciliated. The latter may

reduce attachment sites for microorganisms, provide a filter for particulate matter and

a means to remove such matter via the mucociliary elevator. The lower respiratory

tract also has a greater array of immunoglobulins (IgA, IgE and IgG), lymphoid

nodules (in the form of bronchus-associated lymphoid tissue [BALT]) and resident

immune cells such as the alveolar macrophages (Tizard, 1996; Cohn and Reinero,

2007; Lopez, 2007).

Despite the host defences of the LRT, microorganisms have been isolated from this

location in healthy cats. These microorganisms include Pasteurella, Pseudomonas,

Staphylococcus, Streptococcus, Escherichia coli, Bordetella bronchiseptica and

Micrococcus spp. (Padrid et al., 1991; Dye et al., 1996). Finding these organisms in

the LRT raises questions as to whether they reside here as non-pathogenic

commensals, or are simply an example of the transient introduction of oropharyngeal

and nasal flora with inspired air that are continually removed by intact host defences

(Lopez, 2007).

Mycoplasmas are not considered normal inhabitants of the lower respiratory tract

based on the comparative lack of isolation from this location in healthy cats (Tan et

al., 1977a). This is highlighted when compared with the presence of mycoplasmas in

cats with lower respiratory tract disease (Tan, 1974; Tan and Miles, 1974b; Randolph

et al., 1993). In contrast, the isolation of M. gateae from the trachea of 29% of healthy

cats is considered an important finding (Heyward et al., 1969). The lack of

verification of the presence of mycoplasmas in the lower respiratory tract may be due

to the infrequent sampling of this site in healthy cats or the sampling techniques (due

to false negative results from liberation of tissue mycoplasmacidal factors).

Alternatively, it may be that mycoplasmas are not normal inhabitants of this part of

the respiratory tract.

In individual studies where mycoplasmas have been isolated from clinical cases of

lower respiratory tract disease, underlying causes or predisposing factors were

20


consistent features (Crisp et al., 1987; Malik et al., 1991; Foster et al., 1998; Gulbahar

and Gurturk, 2002; Trow et al., 2008). Retrospective studies have demonstrated that

the prevalence of mycoplasma in the lower respiratory tract of cats with respiratory

disease is approximately 16 to 60% (Stein and Lappin, 2000; Foster et al., 2004b;

Foster et al., 2004c), and 3.7% when associated with pyothorax in cats (Barrs et al.,

2005). From these studies, it appears that mycoplasmas may be under-represented as

significant organisms. This may be from lack of routine culture for mycoplasmas

using specific media, and also from empirical antibiotic treatment putatively killing

these organisms or stopping their growth. Despite these factors, Foster et al. (2004b)

showed that mycoplasma were the most commonly isolated organisms in feline lower

respiratory tract infections.

These retrospective studies give some indication of the prevalence of mycoplasmas to

be expected in lower respiratory tract disease in cats. Moreover, they describe

findings which may support the involvement of mycoplasmas in this disease, such as

positive culture and the resolution of disease following antimicrobial treatment

(Chandler and Lappin, 2002; Foster et al., 2004b). However, there is still question

regarding the role of mycoplasma in inducing disease. Other potential infectious

pathogens, such as viruses were not excluded, and perhaps the frequent isolation of

mycoplasma from these diseased animals was simply a reflection of the organism

being present in this location as a commensal. They may, however, represent

opportunistic pathogens under particular predisposing conditions. Hence the

significance of the presence of mycoplasma species in the lower respiratory tract is far

from resolved, and as such, further investigations are indicated.

1.3.4.3 Prevalence - with reference to different mycoplasma species

Prevalence studies of different mycoplasma species in cats are limited. Many studies

have either not identified isolates to the species level, or have made assumptions

without definitively determining the species involved. Based on relatively

comprehensive studies (Tan and Miles, 1974b; Tan et al., 1977a), the trend of species

prevalence is: M. gateae > M. felis > M. arginini. This trend was reported for both

diseased and healthy cats in these studies, and was also similar in an earlier study of

healthy cats (Heyward et al., 1969). This pattern differed when considering

21


conjunctival samples of sick cats, whereby the prevalence of M. felis was greater than

either M. gateae or M. arginini (Tan and Miles, 1974b). M. felis was found to be

slightly more prevalent than M. gateae in both the conjunctiva and throat in another

large study (Blackmore et al., 1971). These differences are not substantial, and may

reflect differences in individual populations or geographical locations, and give an

indication as to the most common feline mycoplasma species.

Tan et al. (1977a) found that some swabs yielded more than one type of mycoplasma,

however the combinations of species and from which anatomic sites they were

recovered were not documented. An earlier study demonstrated that M. felis and M.

gateae were frequently found concurrently in the pharynx of cats (Blackmore et al.,

1971). In this study, 77 of 144 (53.5%) cats from one colony and 10 of 26 (38.5%) of

cats from another colony (for which mycoplasma was demonstrated in the

oropharynx) had both M. felis and M. gateae concurrently.

1.3.4.4 Possible roles of individual mycoplasma species in cats

The overall trend for prevalence of different mycoplasma species was similar in a

range of anatomic locations of healthy and diseased cats, while the relative prevalence

of different species between diseased and healthy cats has been shown to differ (Table

1.3)(Tan and Miles, 1974b). This indicates that the different species may have varying

roles or involvement in their hosts, particularly with respect to pathogenicity. Each

species of mycoplasma in cats will be reviewed, considering what is currently

understood about the host-mycoplasma relationship and pathogenesis.

Frequent isolation of M. gateae from the URT tract of cats (Heyward et al., 1969;

Blackmore et al., 1971; Tan et al., 1977a), combined with the lack of evidence of an

association with disease (Tan and Miles, 1974b) or immunologic response to the

organism (Blackmore and Hill, 1973; Tan and Miles, 1974b; Tan et al., 1977a),

suggests it is a non-pathogenic, commensal organism of the feline upper respiratory

tract. M. gateae has also been isolated from both the conjunctiva and lower

respiratory tract of healthy cats (Heyward et al., 1969; Blackmore et al., 1971; Tan et

al., 1977a). In the rare instances where M. gateae has been isolated from cases of

feline arthritis, there has been evidence of concurrent immunosuppression suggesting

22


predisposition to infection (Moise et al., 1983; Crissman, 1986; Zeugswetter et al.,

2007). The scant evidence available for M. gateae in cats suggests it does not

independently initiate disease (Blackmore and Hill, 1973), apart from an isolate which

displayed tropism to joints when inoculated intravenously (Moise et al., 1983). This

latter finding is not remarkable given mycoplasmas of other species frequently

localise in joints following dissemination via the blood-stream (Cole and Ward, 1979;

Cole et al., 1985).

Several studies suggest M. arginini is a non-pathogenic commensal organism of the

conjunctiva and upper respiratory tract due to the frequent isolation from this location

in healthy cats (Tan et al., 1977a; Tan et al., 1977b). In addition, the relative lack of a

host immune response (Blackmore and Hill, 1973; Tan and Miles, 1974b; Tan et al.,

1977a; Tan et al., 1977b) and an inability to induce disease following experimental

infection (Blackmore and Hill, 1973; Tan et al., 1977b) supports the role as a

commensal. M. arginini has a widespread distribution in a range of species (Razin and

Freundt, 1984) and is a common contaminant of cell cultures (McGarrity and Kotani,

1985; McGarrity et al., 1992). However, the pathogenicity of M. arginini is unknown

(Razin and Freundt, 1984). As is true for M. gateae, there have been rare isolations of

M. arginini from cats with disease, but no evidence of them causing or playing a role

in the disease (Tan and Miles, 1974b; Tan et al., 1977b), which is consistent with the

ecological and biological similarities of these two species.

In contrast to M. arginini and M. gateae, M. felis has been implicated to varying

degrees in both feline conjunctivitis and respiratory disease (Cole et al., 1967;

Campbell et al., 1973b; Tan, 1974; Haesebrouck et al., 1991; Randolph et al., 1993).

Despite inconsistent findings regarding the expression of disease in experimental

transmission studies (Cello, 1957; Cole et al., 1967; Blackmore and Hill, 1973; Tan,

1974; Tan et al., 1977b; Lappin et al., 2007), more frequent isolation of M. felis from

cats with conjunctivitis than from unaffected cats has led to acceptance of this species

as a causative agent (Tan and Miles, 1973; Tan et al., 1977a; Haesebrouck et al.,

1991; Low et al., 2007).

Serological studies have markedly differed for M. felis compared with M. gateae and

M. arginini, with M. felis antibodies demonstrated in a relatively high proportion of

23


Table 1.3: Comparative percentage of mycoplasma isolates from ‘sick’ and healthy

cats found to be infected with each of three species of mycoplasma (adapted from Tan

‘Sick’ cats

(total isolates 212)

Dead/sacrificed

cats

(total isolates 195)

Healthy cats

(total isolates 45)

and Miles, 1974)*

M. felis M. gateae M. arginini

29.7% 46.2% 16.5%

38.0% 43.1% 9.2%

4.4% 62.2% 6.7%

*The majority of ‘sick’ cats from this study were noted to have respiratory infections,

but also included “conjunctivitis, tonsillitis, glossitis, urolithiasis and other forms of

urogenital tract infections, inappetence, enteritis, dysentery and various forms of food

poisoning”.


healthy and diseased cats (Tan and Miles, 1974b; Tan et al., 1977a). The

demonstration of antibodies indicates exposure to and immunological recognition of

an organism (Goldsby et al., 2003). The presence of antibodies does not, however,

indicate the presence of disease as a result of this exposure. An example of this can be

demonstrated by the findings of an experimental transmission study (Tan, 1974). Tan

(1974) demonstrated the production of antibodies to M. felis in kittens that developed

conjunctivitis following experimental inoculation with this species, and also in control

kittens exposed to M. felis by close proximity to the inoculated kittens. Post exposure,

the control kittens developed M. felis antibodies, but had no clinical signs of disease.

The cats were not SPF and, in spite of the fact the kittens were negative for

unspecified viral and bacterial agents, the involvement of other organisms cannot be

excluded with certainty. This study provides evidence for the pathogenicity of M.

felis, however it was not determined that this species of mycoplasma is sufficiently

virulent under natural conditions of transmission to cause clinical disease (compared

with the experimental introduction of a concentrated isolate).

In this same study (Tan, 1974), M. felis was isolated from the lower respiratory tract

of two kittens with post mortem evidence of interstitial pneumonia following

experimental introduction of M. felis into the eyes and nostrils. However, the presence

of M. felis in the lower respiratory tract was not tested for at the beginning of the

study. It is possible that the pneumonia observed was induced by the introduction of

M. felis into these kittens, but these results are equivocal. The importance of this

finding is limited by the confounding factors of a concentrated inoculum and non-SPF

cats described previously.

M. felis has been isolated from the LRT of a small number of diseased cats. A large

study determined the incidence and significance of mycoplasmas in sick cats,

isolating M. felis from the tracheas of 3 cats and lungs of 4 cats post mortem (Tan and

Miles, 1974b). This study did not state from how many cats LRT samples were taken,

limiting the significance of these findings. In addition, respiratory infections were

noted to constitute the majority of disease observed in the population studied,

however no correlation was made with individual animals from which mycoplasmas

were isolated from the LRT. No direct evidence was presented for the proposed role

24


of mycoplasma causing pneumonia in cats, which raises questions about the validity

of their conclusions.

There have been no reports of respiratory disease being reproduced experimentally by

inoculating cats with mycoplasmas isolated from feline cases of respiratory disease

(reviewed in (Bemis, 1992)). Also, there has not been any description of

mycoplasmas being contagious in cases of suspected natural infection. Similarly,

there have been no reports of outbreaks of mycoplasma related respiratory disease in

animal shelters where its presence has been demonstrated (Heyward et al., 1969;

Blackmore et al., 1971; Bannasch and Foley, 2005; Veir et al., 2008). Extrapolating

from mycoplasmal respiratory diseases in other animal species, an occurrence of

Mycoplasmosis might be expected if M. felis were sufficiently virulent as a primary

pathogen. However, whether M. felis plays a synergistic, secondary or opportunistic

role in respiratory disease requires further investigation.

Rare occurrences of arthritis linked to M. felis have been demonstrated (Hooper et al.,

1985; Liehmann et al., 2006). These cases had underlying trauma or

immunosuppression, similar to cases involving M. gateae (Moise et al., 1983;

Crissman, 1986; Zeugswetter et al., 2007). This information reinforces the concept

that in an immunocompetent feline host, mycoplasma species do not usually gain

systemic entry. It has been suggested that this resistance is marked in cats compared

with other species such as pigs and poultry, which may be a reflection of the

consequences of intensive food animal production systems (Pedersen, 1998). It could

however be related to feline mycoplasma species being less virulent.

Despite the demonstrated pathogenic capacity of M. felis under certain conditions,

there is sufficient doubt as to its role as a primary pathogen. The frequent isolation of

M. felis from healthy cats and the inability to consistently initiate disease in many

experimental transmission studies or following natural transmission would indicate

that it is not sufficiently virulent to initiate disease alone. As the antigenic or virulent

features of M. felis have not been defined, mechanisms for pathogenicity have not

been determined. It is possible there are different variants of M. felis accounting for

the apparent associations observed, or particular conditions are required for it to

penetrate the mucosa. Factors influencing mucosal host defences, or presence of

25


inflammation or other microorganisms allowing mycoplasmas to gain host entry may

be important. Further investigation is required to improve the understanding of M.

felis characteristics to conclusively establish its role as a putative pathogen in cats.

It would appear the isolation of M. feliminutum is a rare occurrence, being recovered

in only one instance from a healthy cat (Heyward et al., 1969). One might question

whether this is a mycoplasma species of cats, or whether the lack of other evidence

relates to it having been overlooked or out-competed by other mycoplasmas in

culture, due to its slower growth or differing metabolic requirements which have been

previously suggested (Heyward et al., 1969).

Reports of pneumonia, pyothorax, pulmonary and subcutaneous abscesses in cats

from which mycoplasmas have been isolated have often not confirmed identification

to the species level (Crisp et al., 1987; Malik et al., 1991; Foster et al., 1998;

Gulbahar and Gurturk, 2002; Adamson, 2004; Cross, 2004; Trow et al., 2008). The

significance of these isolations is questionable, given that mycoplasmas are frequently

present in many healthy cats. Association with these diseases, even if via direct

culture from the lesion, is not sufficient evidence for the organism being responsible

for or involved in the disease.

1.3.4.5 Age of cats

A large study of respiratory pathogen epidemiology from Californian shelter cats

found age to be a significant risk factor for mycoplasma infection in the upper

respiratory tract (Bannasch and Foley, 2005). There was an increased risk in age

groups of 0 to 3 months and 7 to 11 months, and a decreased risk for cats over 12

months. These results were not divided into findings for the individual organisms

identified, such that it is unknown whether this risk relates to mycoplasma alone.

A different study showed upper respiratory disease was most common in young cats

from 6 weeks to 8 months of age (Schneck, 1972). Mycoplasmas were isolated from

63% of ocular and nasal swabs of kittens with respiratory disease. The comparative

prevalence of mycoplasma in healthy kittens was not included. The presence of virus

26


in the kittens was not described, even though the authors commented that viral

respiratory disease was common leaving the significance of this study equivocal.

The incidence of mycoplasma increased with age in another population of cats until

approximately 6 months of age, with the highest incidence occurring in cats above 6-

12 weeks of age (Blackmore et al., 1971). The prevalence of mycoplasma remained at

consistently high levels beyond this age. This was suggested to be due to the

microorganisms being transmitted primarily by contact with other cats at a young age.

Evidence of transmission by contact has been demonstrated (Tan, 1974; Lappin et al.,

2007). Another route of transmission may be vertically from the queen’s vagina

during birth; mycoplasmas have been isolated from this location (Heyward et al.,

1969; Blackmore et al., 1971; Tan and Miles, 1972, 1974b; Tan et al., 1977a; Tan et

al., 1977b).

Under normal circumstances, kittens are in a germ-free environment in utero, and are

subsequently exposed to a wide variety of organisms after parturition. Microbial flora

is established in the first few weeks of life on the mucous membranes and in the

gastrointestinal tract. Organisms that have colonised the mucosal surfaces then

compete for life against other microorganisms and developing mucosal immunity

(reviewed in (Baskerville, 1981; Kononen, 2000)). Commensal organisms that survive

on the surface, such as mycoplasmas, usually avoid the host’s immune response and

form part of the normal microbial flora ((reviewed in (Heyward et al., 1969;

Blackmore et al., 1971; Tan and Miles, 1972; Baskerville, 1981; Kononen, 2000)).

Upper respiratory tract disease is more prevalent in young cats (Binns et al., 2000;

Bannasch and Foley, 2005). This may be related to immaturity of the immune system

in the first few months of life (reviewed in (Day, 2007; Morein et al., 2007)). In the

period of waning maternal immunity, the development of the immune system is still

occurring, which renders kittens more vulnerable to a range of diseases during this

time compared with adult cats (reviewed in (Day, 2007; Morein et al., 2007)).

Additionally, the resident microfloral populations of adult cats provide some

protection by competing for attachment sites and nutrients with pathogenic organisms

(reviewed in (Baskerville, 1981; Kononen, 2000)). However, the resident microflora

may not be well established at this stage of the development of the immune system.

27


1.3.4.6 Geographical and climatic factors

Geographical location and climate have not been considered specifically in any

studies of mycoplasma in cats. Surveys and case reports in the literature cover areas in

North America (Cello, 1957; Cole et al., 1967; Heyward et al., 1969; Campbell et al.,

1973a; Campbell et al., 1973b; Shewen et al., 1980; Keane, 1983; Moise et al., 1983;

Crisp et al., 1987; Brown et al., 1990; Randolph et al., 1993; Walker et al., 1995;

Chandler and Lappin, 2002; Bannasch and Foley, 2005; Johnson et al., 2005; Klose et

al., 2007; Low et al., 2007; Trow et al., 2008; Veir et al., 2008), England (Blackmore

et al., 1971; Hill, 1971; Schneck, 1972; Schneck, 1973), Belgium (Haesebrouck et al.,

1991), Switzerland (Bart et al., 2000), Germany (Huebner et al., 2007; Hartmann et

al., 2008), Sweden (Sjödahl-Essén et al., 2008), Singapore (Tan et al., 1977a; Tan et

al., 1977b), New Zealand (Tan and Markham, 1971b; Tan and Miles, 1972, 1973,

1974b) and Australia (Brisbane; (Spradbrow et al., 1970b), Sydney; (Malik et al.,

1991; Foster et al., 1998; Foster et al., 2004a; Foster et al., 2004b; Foster et al.,

2004c; Barrs et al., 2005) and Melbourne; (Jones and Sabine, 1970; Hooper et al.,

1985)). Study comparisons are difficult because of different methods of investigation

and presentation of results (as discussed previously under section 1.3.4.1).

Assessment of prevalence among these studies found no pattern to the overall

geographical distribution, anatomical location or any differences in the organism

characteristics. It can be concluded that feline mycoplasmas have widespread

geographical distribution.

One study considered the effect of season as part of a retrospective study of LRT

infection in cats (Foster et al., 2004b). Of those considered to be mycoplasmal

infections, clinical signs commenced in autumn in 4 of the 8 cats for which the time

of onset was known. Additionally, in some cases there was recurrence of clinical

signs when the weather became cold. Although mycoplasmal LRTI may be influenced

by cold weather, greater numbers of cats need to be studied to determine whether this

is a significant and widespread trend.

28


1.3.4.7 Prevalence of mycoplasmas compared with other ‘respiratory pathogens’

In a survey of shelter cats, the prevalence of multiple respiratory pathogens was

considered (Bannasch and Foley, 2005). Mycoplasma was found to be the third most

prevalent group of organisms, after FCV and FHV (Bannasch and Foley, 2005). The

prevalence of mycoplasma may have been underestimated, as only the conjunctiva

was sampled for mycoplasma, whereas the viral samples were obtained from both the

conjunctiva and oropharynx.

From a group of 68 cats with clinical signs of ‘cat flu’, M. felis has been identified to

be the most prevalent organism from the mouth and conjunctiva (Huebner et al.,

2007). In this study, PCR assays were used to investigate the prevalence of both viral

and bacterial agents typically associated with cat flu.

A retrospective study examined records from 245 cats diagnosed with pneumonia or

conjunctivitis/rhinitis. Bacterial infections constituted 33.5% of cases, viral infections

constituted 18.4% of cases, and viral with secondary bacterial infections was

suspected in 8.2% of cases (Bart et al., 2000). This study was not able to verify the

specific aetiology of each of these cases. Differing diagnostic tests and results in some

cases meant the specific agent was neither confirmed nor clear whether multiple

microorganisms were isolated from individual cases. Cultures from lung samples

taken post mortem of 40 cats with bacterial infection revealed that mycoplasma was

the third most commonly isolated group of organisms (after Bordetella bronchiseptica

and Pasteurella spp.) (Bart et al., 2000).

A retrospective study of 21 cases of LRT infection in Australia indicated that

mycoplasma was the most common ‘cause’ of LRT infection (Foster et al., 2004b).

This finding was based primarily on culture of BAL samples, but infectious agents

cultured were only considered the aetiologic agents if historical, clinical, radiographic

and cytologic findings were in agreement, combined with an unambiguous positive

response to appropriate antimicrobial therapy. Cases included in the study were

considered to be not to be viral, based on these criteria, but the presence of viral

agents was not specifically excluded, and hence their involvement cannot be excluded

with certainty.

29


In conclusion, mycoplasmas are one of the most common groups of organisms

isolated from cats with upper and lower respiratory tract disease; however, their role

in such diseases is uncertain, particularly given they are also commonly isolated from

non-diseased cats. For many cases of respiratory disease in cats, no aetiological agent

or combination of agents has been identified unequivocally. This aspect is in part due

to the ‘invasiveness’ in sampling the lower respiratory tract, but also as viral detection

techniques are often not employed. The myriad of possible causes may require

extensive and hence expensive study to investigate viral, bacterial, fungal, parasitic,

inflammatory and neoplastic causes. These include imaging, sampling for cytology,

microbiology and PCR. These tests are not always clinically indicated (or affordable

to the client) in every case. Empirical antimicrobial therapy is therefore sometimes

employed in such cases where bacterial infection is likely, as a ‘tool’ to evaluate

response to treatment. This may be appropriate in individual cases, but it limits

accumulation of knowledge of individual organisms involved on a population basis.

1.3.4.8 Relationship of mycoplasmas to other respiratory pathogens

Low et al. (2007) demonstrated that it was uncommon to find multiple infections in a

population of 55 cats with conjunctivitis. Only 2 cats had M. felis and Chlamydophila

felis concurrently, and one cat harboured M. felis and FHV concurrently. Similarly,

another study demonstrated the concurrent presence of M. felis and FCV in 8 samples

from the oral cavity and 3 from the conjunctiva from 68 cats with ‘cat flu’ (Huebner

et al., 2007).

Earlier studies examined a population of cats with respiratory disease for the presence

of both viruses and mycoplasmas (Spradbrow et al., 1970a; Spradbrow et al., 1970b).

The findings for the viral and mycoplasmal isolations from this population were

published separately, and the results were not correlated within individual animals and

hence conclusions cannot be made as to the proportion that had concurrent infections.

The incidence of mycoplasma was found to be higher in a population of healthy adult

cats from a closed feline colony where viral respiratory infections were prevalent,

than in healthy adult domestic cats (Schneck, 1972; Schneck, 1973). These findings

30


support, to some extent, a relationship between mycoplasma and virus infections

known to be involved in the respiratory disease complex. However, they could also

reflect other differences (e.g. environmental factors) between colony and household

cats. These reports only considered 12 cats in each group, with 5 (42%) of the colony

cats, and 1 (8.3%) of the household cats testing positive for mycoplasma by culture

(Schneck, 1972; Schneck, 1973). It was not reported how many of the cats sampled

had recent viral infections or were potential viral carriers. The relative prevalence of

mycoplasma between diseased cats from the colony or from households was not

considered which leaves the findings inconclusive.

Although mycoplasma have not been proven to be associated with other respiratory

pathogens it is possible that they are. Several authors speculated that mycoplasmas

may act either as synergistic or opportunistic invaders following the damage of the

respiratory epithelium by viruses (Heyward et al., 1969; Schneck, 1972; Campbell et

al., 1973b; Pedersen, 1998; Dawson and Willoughby, 1999; Whitley, 2000). This

speculation is partly based on the demonstration of similar associations in other

animal species infected with mycoplasma. There are multiple examples where the

severity of respiratory or ocular disease is worsened when other bacteria or viruses are

involved, compared with the disease produced by the mycoplasma alone (Simecka et

al., 1992). Even with scant evidence for mycoplasmas causing a defined disease

condition as a result of exposure, the association of mycoplasmas with ocular and

respiratory diseases in cats may be suggestive of a more complex aetiology.

Relationships with other organisms may explain the discrepancies between

experimental transmission studies conducted in SPF compared with those in non-SPF

cats, and would be a logical conclusion, given the multifactorial aetiologic nature of

these diseases.

1.3.4.9 Association of mycoplasma with feline bronchial disease (FBD)

Association of mycoplasma with feline bronchial disease (FBD), an inflammatory

airway disease with no identifiable aetiology, has been suggested based on findings

from retrospective studies of feline LRT infection and FBD (Foster et al., 2004a;

Foster et al., 2004b; Foster et al., 2004c). In these studies, mycoplasmas were not

cultured from any cases with pulmonary lesions other than FBD. Additionally, LRT

31


infections identified in a subset of the 25 cats diagnosed with FBD (purebred shorthair

cats, excluding Siamese and Burmese) were all due to mycoplasmas. This subset of

cats was more likely than domestic cats to have both FBD and LRT infections. These

findings however, do not provide evidence for a definite link between FBD and

mycoplasma.

There is growing evidence from the human literature for links between mycoplasmal

infection and asthma in humans ((Sabato et al., 1984; Seggev et al., 1986; Teo et al.,

1986; Petrovsky, 1990; Gil et al., 1993; Kondo et al., 1994; Yano et al., 1994; Seggev

et al., 1996; Kraft et al., 1998; Micillo et al., 2000) cited in (Foster et al., 2004b;

Foster et al., 2004c)), which is outside the scope of this review. These authors

suggested that based on their findings and similarly to the human literature cited in the

article “FBD may predispose to mycoplasmal LRT infections, although it is equally

possible that mycoplasmal LRT infections may cause airway hyper-reactivity and

induce FBD” (Foster et al., 2004b; Foster et al., 2004c). Although this aspect

certainly warrants further investigation, there is currently no evidence for an

association in cats.

1.3.4.10 Presence of feline mycoplasmas in other species

There are two reports of human infections with mycoplasma which were thought to

have been transmitted from a cat (McCabe et al., 1987; Bonilla et al., 1997). The first

occurred in a veterinarian scratched by a cat on the finger and subsequently developed

a septic tenosynovitis from which mycoplasma was cultured (McCabe et al., 1987).

The second relates to M. felis associated arthritis in an immunocompromised

individual who had been bitten by a cat (Bonilla et al., 1997). The protracted nature of

the arthritic disease in this individual, and the difficulty of antimicrobial treatment by

bacteriostatic drugs in an immunocompromised state highlight the importance of the

immune system in clearing the organisms. The feline zoonoses guidelines from the

American Association of Feline Practitioners (Tuzio et al., 2005) include M. felis as a

rare zoonosis, and cite the above 2 cases (McCabe et al., 1987; Bonilla et al., 1997).

Methods to minimise the risks of cat bites or scratches are discussed, and in their

event, the authors advise that medical advice be sought. The role of

32


immunosuppression in zoonoses is also raised, as it poses an increased risk for a range

of zoonotic diseases.

M. felis has also been isolated from horses in association with lower respiratory tract

disease (Carman et al., 1997; Wood et al., 1997) and pleuritis (Ogilvie et al., 1983).

This is the only mycoplasma species in horses that has been implicated as having a

causal relationship with disease (Whitford and Lingsweiler, 1994). The significance

of M. felis in these cases comes from demonstration of sero-conversion in paired sera

(Ogilvie et al., 1983; Rosendal et al., 1986; Carman et al., 1997; Wood et al., 1997)

and from the experimental induction of pleuritis when M. felis was introduced into

healthy horses (Ogilvie et al., 1983; Rosendal et al., 1986). This was done by

inoculation into the thoracic cavity which is not the natural route of transmission.

These studies fail to conclusively determine a primary pathogenic role or virulence of

M. felis in horses by not definitively excluding the involvement of other organisms.

Mycoplasma infection in horses is unlikely to be a geographically widespread

problem. Infrequent localised occurrences may occur due to unrecognised

circumstances of horses coming in contact with the organism. Three of these four

equine studies were from Ontario, Canada (Ogilvie et al., 1983; Rosendal et al., 1986;

Carman et al., 1997), and the other from the United Kingdom (Wood et al., 1997).

Another possibility is that mycoplasma has not been considered during investigation

of pleural or lower respiratory tract disease in horses, with specific culture media not

being employed to culture the organisms. How these horses came into contact with M.

felis is unknown; whether this is an example of the organism acting in a more virulent

way in an atypical or accidental species, or whether the horse is a true host of M. felis

remains to be determined. The presence of M. felis in the healthy equine population

has not been reported; hence, it is possible that it is present as a commensal organism

in the wider population.

The discovery of M. felis in horses has prompted some researchers (Brown et al.,

1995) to question whether the organism isolated from these equine cases was the

feline variant of M. felis or not. The question of identity arose due to the observation

that pharyngeal swabs from cats identified as M. felis by an immunobinding assay

were not confirmed by 16S rRNA gene sequence data (Brown et al., 1990; Brown et

33


al., 1995). M. felis was identified by serological methods in each of the equine

studies. Nucleotide sequence analysis of these isolates would provide insights into the

genetic relationship of these organisms with the feline isolates.

There have been a number of reports of mycoplasma isolation from captive felids,

including lions (Pantherae leo), cheetahs (Acinonyx jubatus), pumas (Felis concolor)

a leopard (Panthera pardus), a tiger (Panthera tigris), a lynx (Felis lynx) and a serval

(Felis serval) (Hill, 1975; Hill, 1992; Brown et al., 1995; Johnsrude et al., 1996).

Although mycoplasmas have been isolated from the same anatomical locations as

domestic cats, some different mycoplasma species were present in these hosts in

addition to M. felis, M. gateae and M. arginini (Hill, 1975; Hill, 1992). It would

appear from these studies that mycoplasmas are present as “normal flora” in the upper

respiratory tract, as they are in domestic cats. Exceptions related to the isolation of M.

felis from a juvenile serval with severe pneumonia. This animal had been in contact

with domestic cats as it was being hand-reared, and could have been predisposed to

such an infection as a result of not receiving colostrum, and from a previous treatment

with amoxicillin (Johnsrude et al., 1996). In another study, M. arginini was recovered

at post mortem from the lungs and brain of a lion with encephalitis (Heyward et al.,

1969; Tully et al., 1972).

1.3.4.11 Consideration of factors that may facilitate mycoplasmal involvement in

disease

Even with extensive research into mycoplasmas, many specific factors of their

involvement in disease remain obscure. This is true even for widely studied

mycoplasma species such as M. hyopneumoniae (Pieters et al., 2009). The interaction

between host, organism and environment is an integral part of any infectious disease,

but the multifactorial nature of the role that mycoplasmas have in disease has proven

to be challenging for investigators.

Specific factors relating to the organisms which determine the relationship of

mycoplasmas to their hosts and pathogenicity have not been characterised for feline

mycoplasma species. Studies from other ycoplasmas have shown that attachment is

an integral part of pathogenicity (reviewed in (Cassell et al., 1985; Simecka et al.,

34


1992; Rottem, 2003)). Specialised attachment structures and specific binding to

receptor sites on host cells have been demonstrated for some species of mycoplasma,

such as M. gallisepticum and M. pneumoniae. These have been reviewed elsewhere

((Simecka et al., 1992; Rottem, 2003)) and are outside the scope of this thesis. In vitro

studies of mycoplasmas associated with respiratory disease, such as M.

hyopneumoniae have demonstrated their ability to adhere to ciliated epithelial cells,

affect ciliary motility, and occasionally result in loss of cilia and epithelial necrosis

(Simecka et al., 1992; DeBey and Ross, 1994). Mycoplasmas have also been shown

to directly induce cell injury via production of toxic substances, and indirectly by

inciting host inflammatory responses which may be responsible for the resultant tissue

damage (Simecka et al., 1992).

Mycoplasmas may modulate the host immune system in a variety of ways. Induction

of host cell cytokine production is thought to be a major virulence mechanism of

mycoplasmas, which can result in stimulation or down-regulation of different

inflammatory pathways (reviewed in (Rottem, 2003)). Lipid associated membrane

proteins (LAMPs) of mycoplasmas have been shown to induce signalling pathways

via pathogen associated molecular pattern (PAMP) recognition receptors of the host

innate immune system (reviewed in (Rottem, 2003; You et al., 2006)). Interaction of

LAMPs with toll-like receptors TLR2 and TLR6 result in signalling cascades leading

to stimulation of pro-inflammatory cytokine secretion and to apoptosis (reviewed in

(You et al., 2006)).

There has been great interest in determining and characterising surface components of

mycoplasmas which may act as both antigenic and virulence factors. This will aid

further characterisation of their pathogenic mechanisms and interaction with host

cells. Some species of mycoplasma such as M. pulmonis and M. hyorhinis have the

ability to change their phenotype, particularly with surface antigens (reviewed in

(Simecka et al., 1992; Rottem, 2003)). This may influence the interaction of

mycoplasmas with host cells, altering their ability to attach and to prevent

immunological recognition by the host. Additionally, some surface mycoplasmas such

as M. pneumoniae and M. gallisepticum have been shown to reside in non-phagocytic

host cells, where they are partially protected from the host immune system (reviewed

in (Rottem, 2003)). These factors may explain some variability of virulence observed

35


within particular species of mycoplasma (Simecka et al., 1992). The elucidation of

immunogenic components has been utilised to develop vaccines aimed at reduction of

production losses associated with mycoplasmas in some species, such as M.

hyopneumoniae in pigs, M. mycoides subsp. mycoides in cattle, and M. gallisepticum

and M. synoviae in poultry (reviewed in (Whithear, 1996; Thiaucourt et al., 2003;

Maes et al., 2008; Nicholas et al., 2009)).

Host factors are equally important in determining the result of exposure to

mycoplasmas. The mechanisms of the immune response to mycoplasmas are not fully

understood. Innate immunity is thought to provide the primary defence in the

respiratory system, with the production of an acquired antibody response being

particularly important for protection against systemic infections (Cartner et al., 1998).

Both cell mediated and humoral immunity are required for maximal efficiency in

eliminating mycoplasmas (Fernald, 1979; Cartner et al., 1998). The T lymphocyte

response is important in the outcome of mycoplasmal respiratory infections, as the

specific type of T cell response to mycoplasma infection influences the balance

between host resistance and immunopathogenesis, particularly in chronic

mycoplasmal disease (Jones and Simecka, 2003).

The feline immune response to mycoplasmas has not been studied beyond the

demonstration of antibody production in healthy and diseased cats (Tan, 1974; Tan

and Miles, 1974b; Tan et al., 1977a). It is not known whether such responses are

effective against current infections, capable of eliminating the organisms, or

protective against subsequent challenge. However it would appear that if virulent, the

continued presence of M. felis organisms in the host after resolution of disease could

be defined as remaining in an asymptomatic ‘carrier’ state. This has been

demonstrated for M. hyopneumoniae pneumonia in pigs, where convalescent carriers

were able to infect susceptible animals for up to 200 days post infection (Pieters et al.,

2009).

Irrespective of exact immune mechanisms involved, a functional immune system is

required to eliminate mycoplasma infection. A competent immune response is

important in both eliminating organisms and acting in the prevention of disease. This

principle is highlighted by frequent reports of cats with immune compromise or other

36


underlying diseases and concurrent infection with mycoplasmas of little primary

pathogenic significance (Cello, 1957; Moise et al., 1983; Hooper et al., 1985;

Crissman, 1986; Malik et al., 1991; Pedersen, 1998; Zeugswetter et al., 2007).

Environmental factors are known to be important in the outcome of exposure to

mycoplasma in intensive production situations. The evidence and mechanisms of

involvement in different animal species has been reviewed elsewhere ((Simecka et al.,

1992)) and is outside the scope of this review. Environmental factors, such as air

temperature and quality, essentially have their effect by altering host respiratory

defence mechanisms (Jones and Simecka, 2003). Whether these factors are important

in cats in shelter environments (which may be likened to intensive production

systems) has not been determined, although risk factors for disease in such systems

have been studied to some extent (Bannasch and Foley, 2005).

Finally, other pathogens may play a crucial part in diseases involving mycoplasmas in

cats. Although concurrent isolations have not often been demonstrated in diseased

cats, or specific links or associations with particular pathogens have not been made,

such interactions cannot be excluded. An additional factor that has not been

considered and is outside the scope of this review is the vaccination of cats for

respiratory pathogens. The prevention of viral respiratory disease may influence the

prevalence and role of mycoplasmas in different populations.

1.4 Conclusion

The current literature review has shown that mycoplasmas are common inhabitants of

the upper respiratory tract of healthy domestic cats from widespread geographical

locations. However, there is uncertainty regarding the prevalence of these organisms

in the lower respiratory tract of cats. The infrequent isolation of mycoplasmas from

this location may relate to previous sampling techniques, a relative lack of sampling

of this location, or because mycoplasmas are not normal inhabitants of this region.

Some non-pathogenic species of mycoplasma such as M. gateae and M. arginini

appear to be commensal microorganisms of the conjunctiva and upper respiratory

tract of cats. Their presence does not evoke a host immune response. These non-

37


pathogenic mycoplasmas may be involved with disease under certain conditions.

Although these conditions are not yet defined, a compromised host defence is a factor,

particularly if it allows mycoplasmas to penetrate the mucosa and become

disseminated systemically, in which case, it seems likely that the mycoplasmas may

preferentially localise to joints.

M. felis, on the other hand, may be involved in disease of the conjunctiva and

respiratory tract in cats. There is evidence to suggest that M. felis has some degree of

virulence and is recognised by the immune system, which may be indicative of it

being more invasive or antigenic in some way than the other mycoplasma species. M.

felis is also a normal inhabitant of healthy cats. Even with its association with disease,

M. felis does not consistently produce disease under experimental conditions, which

may indicate that it is more of an opportunistic invader than a primary pathogen. No

specific disease or syndrome has yet been associated with M. felis solely as the result

of exposure of the host to the organism. It would appear, as for many other

mycoplasmas, that any such involvement in disease is multifactorial.

Very little is understood about the factors involved in mycoplasma-related feline

diseases. The genetic characteristics of feline mycoplasmas are poorly defined, and

the structural components for attachment, antigenicity and virulence have not yet been

characterised. This limits the understanding of host-organism interactions. The

understanding of the specific mechanisms by which the host immune system interacts

with mycoplasma is limited, apart from a demonstration of seroconversion. Finally,

interactions of mycoplasma with other pathogens or environmental factors have not

been studied in detail.

A limitation of published reports at present is the unresolved significance of the

presence of mycoplasma in the lower respiratory tract of cats. This is due to the

relatively infrequent identification of mycoplasma to the species level and the past

usage of relatively unreliable methods for specific identification. There has been a

distinct lack of statistical analysis of the association of mycoplasma with disease.

With the development of rapid and sensitive molecular methods of identification,

further investigation is warranted in order to define the extent, nature and significance

of mycoplasmas in domestic cats.

38


1.5 Aims

The specific aims of this thesis are to:

• survey a population of shelter cats for the presence of mycoplasma;

• examine the population of shelter cats for clinical or post mortem evidence of

ocular or respiratory disease;

• culture mycoplasma from direct swabs obtained at necropsy from the

conjunctiva, pharynx and bronchi;

• determine the overall prevalence of mycoplasma in a population of cats;

• determine the prevalence of mycoplasma at different anatomical sites;

• evaluate the association of the presence of mycoplasma with ocular, upper and

lower respiratory tract disease;

• genetically characterise mycoplasma isolates to determine the species present

in the population; and

• assess the association of particular mycoplasma species identified with their

anatomical distribution and presence of disease.

39


Chapter 2 Epidemiological Survey of Feline Mycoplasma

2.1 Introduction

A major challenge facing researchers who study infectious diseases relates to

unequivocal demonstration that organisms isolated from tissue lesions are the

aetiological agent. This is most evident in cases of respiratory disease in almost all

domestic species, and is particularly the case with ubiquitous organisms such as

mycoplasmas. While cause and effect has been shown for some species of

mycoplasmas, it remains to be convincingly demonstrated for naturally occurring

mycoplasmas in the cat. This aspect is complicated by the fact that experimental

infection of susceptible cats with the most pathogenic feline mycoplasma, M. felis,

has not always induced disease.

Given that cause and effect can be difficult to prove, alternative approaches may rely

upon association, but only where an association has been subjected to the rigour of

statistical analysis. This chapter investigates the associations between mycoplasmas

isolated from the conjunctiva, upper and lower respiratory tract and a number of

characteristics of the host, particularly the presence or absence of clinically apparent

ocular or respiratory disease. In addition, this chapter focuses on the prevalence of

mycoplasma at these sites and any relationships of that prevalence among the sites.

41


2.2 Materials and methods

2.2.1 Animal Collection

Samples were collected over a three-week period in June 2003. Cats were obtained

from a Melbourne animal shelter and were stray cats delivered to the shelter by a

member of the public or picked up by a local council service, or domestic cats

surrendered to the shelter by their owner. The cats used in this study were euthanised

for being unhandlable, unsuitable to be re-homed due to temperament, age or health,

or there not being enough space at the facility. The cats were held for up to one day in

a holding room or for eight days in the shelter’s housing facility.

Prior to euthanasia, cats were clinically examined. Particularly, any signs of

conjunctivitis or respiratory disease were noted. Data collection sheets (Appendix 1)

were used to record age, breed, sex, weight and rectal temperature. As the actual age

of most cats was unknown, age was recorded as either juvenile or adult based on

dentition (Wiggs and Lobprise, 1997). Cats were then euthanised using Lethabarb®

(pentobarbitone 200 mg/ml, Virbac, NSW, Australia) diluted 1:2 in water and injected

into the peritoneal cavity. Cats were labelled and transported individually in plastic

bags to the Veterinary Clinical Centre of the University of Melbourne where

necropsies were conducted.

Full necropsies were performed and swabs taken from the conjunctiva, oropharynx

and main stem bronchus, were placed immediately into 5 ml of liquid mycoplasma

media (Appendix 2). Using sterile scissors the trachea was opened from the dorsal

surface. This was performed distal to the pharynx to avoid contamination. The

incision was extended as far distally as the carina to expose the mainstem bronchi.

While being held open with the scissors, a sterile swab was inserted through the

incision (without contacting the sides) into the left bronchus as deep as the diameter

of the swab would allow. A representative tissue sample of ~ 1.5 cm 3 was taken from

lungs in which macroscopic changes were evident and placed in 10% buffered

formalin to preserve the tissue for histopathologic examination if required.

42


Table 2.1: Study population characteristics

Cats Sex Age Origin Location / Time spent

� � Adult Juvenile Stray Owned Holding

room/1 day

Number 52 58 101 9 85 25 76 34

Pound/

8 days

% 47.3 52.7 91.8 8.2 77.3 22.7 69.1 30.9


One hundred and nineteen cats were examined. Samples from the initial 9 of them

were disregarded from the study, as collection method was altered, leaving a study

population of 110 cats (Table 2.1).

2.2.2 Culture

The inoculated broths were incubated in air at 37 °C for 4 weeks. They were

monitored daily for colour change. A change in colour from light pink-orange to red

indicated an alkaline shift, as a result of arginine utilisation, whereas a change to

yellow indicated an acid shift due to glucose utilisation by the mycoplasmas. Where

colour change was noted, broths were frozen and kept at -20 °C. Broths that became

turbid were assumed to have bacterial contamination and were discarded. Broths with

no change after 4 weeks were assumed to have no mycoplasma growth and were

discarded. Each of the positive broth samples (“primary broth samples”) were thawed,

agitated and plated on to mycoplasma agar plates (Appendix 3). Plates were divided

into 5 vertical areas and “streaked” by allowing 20 µl of broth to run from a pipette

down the plate in each section by gravity. The plates were incubated in air at 37 °C

and checked daily using a dissecting microscope for the presence of characteristic

mycoplasma colonies (typified by a “fried-egg” appearance) (Razin and Freundt,

1984).

Five individual colonies from each original sample were selected using a sterile glass

pipette tip to lift a single colony from the agar. Each colony was suspended into 2 ml

of mycoplasma liquid media. These broths were incubated at 37 °C and checked twice

daily for a colour change. In broths demonstrating growth (“secondary broth

samples”), aliquots of 0.5 ml and 1.5 ml were transferred to 1.5 ml microcentrifuge

tubes, and kept frozen at -70 °C.

The method described was repeated for plates with either bacterial or fungal

contamination or no growth of mycoplasma colonies. Samples with no colony

formation were considered to be ‘test negative’.

43


2.2.3 Statistical analysis

Fisher’s exact test was used to determine any statistically significant differences in the

prevalence of positive samples between groups of cats, considering various factors,

such as sex, age, origin of the cat, location of the cat, and presence of ocular or

respiratory disease. P-values were determined using the computer software Stata

(StataCorp., 2007), and a value of ≤ 0.05 was considered significant.

Data were considered with respect to differences in prevalence between the three

anatomic locations sampled. A Venn diagram was used to compare the pattern of

distribution of mycoplasma-positive sites. McNemar’s test was used to compare

paired proportions of the presence of mycoplasma between the three anatomical

locations. Stata software (StataCorp., 2007) was also used for McNemar’s test, and a

P-value of ≤ 0.05 was considered significant. Fisher’s exact test was used to

determine whether there was any significant difference in the prevalence of a positive

swab in a particular anatomical location for which there was evidence of disease or

absence of disease.

The number of mycoplasma test-positive sites per cat was also considered (range 0 to

3 sites per cat). To determine whether the presence of mycoplasma in a particular

anatomical location was independent of the presence of mycoplasma in other

anatomical locations within a cat, the data were compared to a binomial distribution,

as described by (Snedecor and Cochran, 1980) using a chi-squared test to determine

the P-value (see Appendix 4 for calculation of expected numbers using the binomial

distribution). Using a two-tailed test with 2 degrees of freedom (Snedecor and

Cochran, 1978), a P-value of ≤ 0.05 was considered significant. The null hypothesis

for this test was thus that the frequency of the number of positive sites per cat has a

binomial distribution. For this hypothesis to be true, the presence of mycoplasma at a

particular anatomical location must be independent of the presence of mycoplasma at

any other site in each cat.

44


2.3 Results

One hundred and ten cats were included in the study. Thirty-eight cats (34.5%)

showed any signs of disease. The prevalence of cats with evidence of some form of

ocular or respiratory disease (for the purpose of this study this includes conjunctival,

upper and lower respiratory tract disease) was 31.8%. There were 24 cats (21.8%)

with conjunctivitis or ocular discharge, 6 cats (5.5%) with upper respiratory tract

signs (nasal discharge, sneezing, oral ulceration), and 14 cats (12.7%) had

macroscopic lung changes which were considered to be post mortem artefact (Figure

2.1). The changes were limited to either reddish/pink mottling or small (< 2 mm)

white nodules on the pleural surface of the lung. These were mostly observed on the

caudal lung lobes, and were thought to be due to barbiturate precipitates resulting

from the systemic absorption of barbiturate via intraperitoneal injection (personal

communication, Prof. W. F. Robinson (BVSc MVSc, PhD, DipACVP, MACVSc),

2007).

From the primary broth samples, 92/110 (83.6%) cats had one or more positive

samples based on a colour change in mycoplasma liquid media. Of these 92 cats with

samples plated on to agar, 79/110 cats (71.8%) had a sample with growth of typical

mycoplasma colonies. Samples from which mycoplasma grew on solid medium were

designated “confirmed” positives and used for further analyses.

The prevalence of mycoplasma was compared for different groups of cats based on

sex, age, origin and location within (and hence time spent in) the shelter. There was

no significant difference observed between groups for any of these factors (Tables

2.2- 2.5).

The prevalence of mycoplasma was compared for cats with any signs of

ocular/respiratory disease and those with no evidence of ocular/respiratory disease

(Table 2.6). There was no statistically significant difference in the frequency of

mycoplasma isolation between these two groups (p = 1.0).

Of a total of 330 swab samples (110 cats x 3 samples each), 134/330 (40.6%) swab

samples were positive for mycoplasma. Of these 134 positive samples, considering

45


anatomical location, 15/110 (13.6%) of cats had a positive conjunctival sample,

72/110 (65.5%) a positive pharyngeal sample, and 47/110 (42.7%) a positive

bronchial sample (Figure 2.2).

The distribution and combination of mycoplasma-positive swabs in the cats, in terms

of anatomical location, was compared using a Venn diagram (Figure 2.3). The most

common occurrence was the presence of both a positive pharyngeal and bronchial

swab (31.8% of cats), followed by no positive swabs (28.2%), a positive pharyngeal

swab (21.2%), positive swabs in all three locations (6.4%), a positive result for both

pharyngeal and conjunctival swabs (5.5%), and a positive bronchial swab (4.5%).

There were no cats with the combination of a positive conjunctival and bronchial

swab.

mycoplasma was found at a significantly greater prevalence in both the pharynx and

bronchus when compared with the conjunctiva, and also the pharynx compared to the

bronchus. Each of these differences were significant with P-values of


Figure 2.1: Location of signs of disease observed in the study population of cats

Number of cats

30

25

20

15

10

5

0

(n = 110).

Conjunctiva Upper respiratory

tract

Location of disease

Lungs

a) Number of cats with disease observed in each of the three study sites

Number of cats

16

14

12

10

8

6

4

2

0

ocular URT lung ocular +

URT

ocular +

lung

Location of disease

URT +

lung

ocular +

URT +

lung

other

b) Number of cats with any signs of disease including those with combinations of

diseased sites


Table 2.2: Comparison of prevalence of mycoplasma-positive samples and gender of

cats

Factor

Swab

+ - Total

Male 38 14 52 73.1

Female 41 17 58 70.7

% positive P-value

79 31 110 0.83

Table 2.3: Comparison of prevalence of mycoplasma-positive samples in adult and

juvenile cats

Factor

Swab

+ - Total

Adult 75 26 101 74.3

Juvenile 4 5 9 44.4

% positive P-value

79 31 110 0.11

Table 2.4: Comparison of prevalence of mycoplasma-positive samples in stray and

owned cats

Factor

Swab

+ - Total

Stray 63 22 85 74.1

Owned 16 9 25 64.0

% positive P-value

79 31 110 0.32


Table 2.5: Comparison of prevalence of mycoplasma-positive samples and location

of cats within shelter

Factor

Swab

Holding room

(1 day)

Pound

(8 days)

+ - Total

55 21 76 72.4

24 10 34 70.6

% positive P-value

79 31 110 1.0

Table 2.6: Comparison of prevalence of mycoplasma-positive samples between cats

with and without signs of ocular/respiratory disease

Factor

Swab

Ocular/respiratory

disease present

Ocular/respiratory

disease not present

+ - Total

25 10 35 71.4

54 21 75 72.0

% positive P-value

79 31 110 1.0


Number of cats

Figure 2.2: Anatomic distribution of mycoplasma-positive swabs

80

70

60

50

40

30

20

10

0

conjunctiva pharynx bronchus

Anatomic site

Mycoplasma-positive

swabs


Figure 2.3: Anatomic distribution and combination of mycoplasma-positive swabs (n = 110 cats)

pharynx

24

6 35

7 7

2 0 5

bronchus

conjunctiva

negative = 31


Table 2.7: Comparison of paired proportions for mycoplasma status between the

conjunctiva and pharynx using McNemar’s test.

pharynx

conjunctiva

Myco + Myco - Total % positive

Myco + 13 2 15 15/110 (13.6%)

Myco - 59 36 95

Total 72 38 110

% positive 72/110 (65.5%) P-value


Table 2.10: Comparison of prevalence of mycoplasma-positive conjunctival swabs

between cats with and without conjunctivitis

Conjunctivitis

Ocular discharge

Conjunctival

Swab

+ -

Total

%

positive

Yes 1 23 24 4.2

No 13 73 86 15.1

P-value

14 96 110 0.30

Table 2.11: Comparison of prevalence of mycoplasma-positive pharyngeal swabs

between cats with and without signs of upper respiratory tract disease

URT signs

(nasal discharge,

sneezing.

oral ulceration)

Pharyngeal

Swab

+ -

Total

%

positive

Yes 5 1 6 83.3

No 67 37 104 64.4

P-value

72 38 110 0.66

Table 2.12: Comparison of prevalence of mycoplasma-positive bronchial swabs

between cats with and without gross lung pathology

Lung Pathology

Bronchial

Swab

+ -

Total

%

positive

Yes 8 7 15 53.3

No 39 56 95 41.1

P-value

47 63 110 0.41


Table 2.13: � 2 test of goodness of fit of the binomial distribution, applied to the

number of cats with a particular number of mycoplasma-positive anatomic sites. The

overall prevalence of mycoplasma-positive sites was 134/330 sites from 110 cats.

Number of

positive sites

Number of cats � 2 = (O-E) 2 /E

Observed

(O)

Expected

(E)

P-value

0 31 23.05 2.74 0.098

1 31 47.27 5.60 0.018*

2 41 32.32 2.33 0.127

3 7 7.36 0.02 0.89

Overall 110 110 10.69 (2df) 0.005*

*Statistically significant (p � 0.05)


2.4 Discussion

Of the population of cats presented to an animal shelter in Melbourne, Australia in

June of 2003, approximately one third had clinically apparent ocular and upper

respiratory tract disease. However, none of the cats were considered to have

characteristics of acute or chronic pneumonia. A high percentage of cats (71.8%) were

infected with mycoplasma and more often than not, mycoplasma infection was

present at more than one anatomical site. Mycoplasma was most prevalent in the

pharynx, followed by the bronchus then conjunctiva. While these findings are similar

to other studies for the conjunctiva and upper respiratory tract of cats (Heyward et al.,

1969; Blackmore et al., 1971; Tan and Miles, 1972, 1974b; Tan et al., 1977a; Tan et

al., 1977b; Randolph et al., 1993; Bannasch and Foley, 2005; Low et al., 2007), there

was a higher than expected number of cats (42.7%) with mycoplasma cultured from

the lower respiratory tract.

Isolation of mycoplasmas from the lower respiratory tract of healthy cats has been

considered an abnormal finding due to lack of isolation from this location in previous

studies (Tan et al., 1977a; Padrid et al., 1991; Randolph et al., 1993). Potentially, this

may have been due to the liberation of mycoplasmacidal factors during sampling, or

because the LRT is most often sampled when investigating the cause of disease and

only rarely examined for the presence of mycoplasma in healthy cats. The present

study shows that over 80% of the cats from which mycoplasma was isolated from the

bronchus had no evidence of pulmonary lesions. This is directly contrasted by a study

that found no evidence of mycoplasmas in tracheobronchial lavage samples from

healthy cats compared to isolation from 21% of cats with pulmonary disease

(Randolph et al., 1993). A difference between this and the current study is the

sampling method of tracheobronchial lavage versus bronchial swab sampling, and

may account for the different findings. However, the current findings are consistent

with a different study where 29% of tracheal specimens from healthy cats contained

M. gateae (Heyward et al., 1969). The current study suggests that mycoplasmas are a

normal inhabitant of the LRT which is supported by other studies showing the LRT is

not a sterile environment in cats (Padrid et al., 1991; Dye et al., 1996). This

contradicts the assumption made by some authors that isolation of mycoplasmas from

the LRT of cats with pulmonary disease is sufficient evidence to conclude it has a

47


pathogenic role in the disease (Malik et al., 1991; Foster et al., 1998; Chandler and

Lappin, 2002). The current study clearly shows that mycoplasma isolation from an

animal with pulmonary disease should be interpreted with caution before assuming an

aetiological role.

The absence of clinical observations of pneumonia in cats that either had clinically

apparent URT disease or mycoplasmas in the LRT suggests that feline mycoplasmas

are unlikely to cause primary pneumonia (nor was there any evidence that the URT

disease seen in this study was caused by mycoplasmas). Moreover, the current study

has shown that feline mycoplasmas may be considered commensal organisms. This is

in contrast to studies that have suggested mycoplasmas cause disease in cats (Tan and

Markham, 1971b; Campbell et al., 1973b; Tan, 1974; Tan and Miles, 1974b;

Haesebrouck et al., 1991; Malik et al., 1991; Randolph et al., 1993; Foster et al.,

1998; Chandler and Lappin, 2002; Foster et al., 2004b; Bannasch and Foley, 2005;

Low et al., 2007). Mycoplasmas may have the capacity to cause disease under

different conditions, such as in an immunocompromised host, or in the presence of

existing respiratory disease. Existing mucosal damage, with the attendant

inflammatory changes, might provide mycoplasmas with the opportunity to cross the

mucosa and cause additional damage. If this were the case, they could be classed as

commensal organisms with the capacity to act as opportunistic invaders.

No significant association between gender, age, whether cats were stray or owned, the

location in or time spent at the facility, and the presence of mycoplasma was

demonstrated in the current study. Most importantly, there was no association

between the presence or absence of mycoplasma and the presence or absence of

clinical signs of ocular and respiratory disease. Specifically, there was no association

between the presence of mycoplasma at a particular anatomical location with any

evidence of disease in that location. Few other studies have considered such

associations statistically. One study found no association between mycoplasma-

positive cats with respect to age or gender (Randolph et al., 1993). However, a

significant association was demonstrated between the presence of mycoplasma and

upper respiratory tract disease in a population of 573 shelter cats (Bannasch and

Foley, 2005). This is in contrast to the current study where the association with URT

disease demonstrated by Bannasch and Foley (2005) may be indicative of either a

48


different or more virulent mycoplasma species or a high prevalence of other

respiratory pathogens which influenced the mycoplasmal population. The absence of

any statistical associations of ocular or respiratory disease with mycoplasma isolation

suggests that these organisms are not pathogenic in the feline population in the current

study.

Although the precise pathogenic mechanisms and virulence factors of most

pathogenic mycoplasma species have not yet been defined precisely, particular

virulence characteristics have been determined for some. Mechanisms of adherence,

cell injury and antigenic variation have been demonstrated in some mycoplasmas

(reviewed in (Simecka et al., 1992)). It may be the inability of feline mycoplasmas to

express such virulence factors that differentiates them from pathogenic mycoplasma

species. A more thorough study of potential virulence factors in mycoplasmas isolated

from cats with pneumonia or clinical disease needs to be undertaken. In addition,

greater numbers of diseased cats, greater numbers of juvenile cats, or repeated studies

at different times of the year and/or in different years, may show different

associations. These aspects should be addressed in future investigations.

The current study showed a statistical significance in isolation of mycoplasma

between the anatomical sites sampled. In particular, there was a much higher

prevalence of mycoplasma isolated from both the pharynx and bronchus than the

conjunctiva. Other reports have not statistically analysed the difference in prevalence

among these anatomical sites, although many studies have demonstrated this trend for

the pharynx being the most frequent site for mycoplasma in the cat (Heyward et al.,

1969; Blackmore et al., 1971; Tan and Markham, 1971b; Tan and Miles, 1974b; Tan

et al., 1977a; Tan et al., 1977b; Randolph et al., 1993; Hartmann et al., 2008; Veir et

al., 2008)

To speculate on the results of this study, one could suggest that the pharynx is the

favoured environment for feline mycoplasmas compared with both the conjunctival

and bronchial environments. Although this site is generally more tolerant of a

microfloral population, the prevalence of these organisms in the other sites also

suggests that the organisms can evade the host defences sufficiently to reside there. It

is apparent that when a cat is infected with mycoplasma, (most commonly in the

49


pharynx) it is much more likely to also have mycoplasma in one or more of the other

sites (conjunctiva and bronchus). The presence of mycoplasma at a particular site is

not independent of mycoplasma presence at other sites as indicated by frequency

distribution data from the current study not fitting a binomial distribution. Previous

studies of the anatomical location of mycoplasmas in feline populations have sampled

multiple sites (such as (Heyward et al., 1969; Spradbrow et al., 1970b; Blackmore et

al., 1971; Tan and Miles, 1974b; Tan et al., 1977a; Tan et al., 1977b)), but have not

considered the number of positive sites or the relative frequency of the distribution

and combinations of positive sites in the cats. The current study provides a more

detailed description of the ecology of the mycoplasmal organisms within the

population studied, which may assist in further determining the mechanism of host

interactions.

The combination of mycoplasma in the pharynx and bronchus was greater than any

site alone. This appears to be a logical progression, rather than a post mortem

occurrence. Evidence for this suggestion comes both from studies demonstrating that

the LRT is not sterile in cats (Padrid et al., 1991; Dye et al., 1996), and also the

findings of the present study that some cats had mycoplasma isolated from the

bronchus only. Mycoplasmas in other species are able to access and attach to the

LRT (reviewed in (Cassell et al., 1985)) and can colonise both ciliated and non-

ciliated epithelial surfaces in the respiratory tract (Bemis, 1992). It would not be

surprising if feline mycoplasmas shared some of these characteristics. Therefore, once

a cat becomes infected with mycoplasma, it colonises other sites that are either

anatomically or functionally related (e.g., pharynx to bronchus), or into the

conjunctiva by saliva when self grooming or vice versa via the nasolacrimal duct. It

would be logical to assume that it is easier to transmit an organism between sites in an

individual than between individuals. The ability of the mycoplasma to colonise any

particular site is still reliant on avoiding the host defence mechanisms at that site.

Perhaps this occurs because mycoplasma do not disturb the host defence mechanisms

by remaining attached to epithelium, thus avoiding being presented as a foreign

antigen to the cat’s immune system.

Based on the findings in this study and also the rate of isolation of mycoplasmas from

other studies (Heyward et al., 1969; Blackmore et al., 1971; Tan and Miles, 1972,

50


1974b; Tan et al., 1977a; Tan et al., 1977b; Bannasch and Foley, 2005), one could

suggest that mycoplasma could be isolated from almost any anatomical site from the

conjunctiva, through the nasal, oral, pharyngeal, and tracheal regions to the bronchi.

How far down the respiratory tract one might isolate mycoplasma is unknown;

however, other evidence indicates that isolating mycoplasma from lung tissue might

be particularly difficult due to mycoplasmacidal factors released during attempted

isolation (Tully and Rask-Nielsen, 1967; Kaklamanis et al., 1969; Rosendal, 1979).

This problem might be overcome by using PCR directly from tissue swabs, as this

technique does not rely on the culture of viable mycoplasmas to detect their DNA.

PCR also bypasses any potential issues with mycoplasma being slow or difficult to

culture, or requiring specific growth conditions.

Bronchoalveolar lavage (BAL) is a technique for sampling the alveoli (Tully et al.,

1972; Padrid et al., 1991; Randolph et al., 1993; Foster et al., 2004c), and has the

advantage of being a useful diagnostic tool in live animals. However, using this

approach, it is not possible to specifically establish whether the organisms originate

from the bronchi themselves or from the bronchioles or alveoli. Bronchial swab

sampling was chosen as the method for mycoplasma recovery from the lower

respiratory tract in the current study. Although techniques such as BAL sample more

distal sites of the lower respiratory tract, bronchial swabs provided samples that were

more consistent for comparisons to the conjunctival and pharyngeal samples collected

concurrently in each cat.

The current study demonstrates the overall prevalence of mycoplasma in a population

of cats by culturing the organism from swabs and evaluates their relative prevalence

in different subsets of this population, in order to determine if there were any

associations between different groups of cats, and the presence or absence of disease.

The effect of multiple species of mycoplasma may have complicated this study,

particularly if pathogenic and non-pathogenic mycoplasma species were present, and

will be considered in Chapter 3.

51


Chapter 3 Molecular Characterisation of Feline Mycoplasma

3.1 Introduction

Identification of feline mycoplasma isolates to the species level is an important aspect

of any population or clinical study, particularly for investigating association with

disease. Previous reports have incompletely considered this aspect limiting the

significance of the conclusions (Crisp et al., 1987; Malik et al., 1991; Randolph et al.,

1993; Foster et al., 1998; Bannasch and Foley, 2005; Low et al., 2007; Trow et al.,

2008; Veir et al., 2008). Even though it was demonstrated in Chapter 2 there was no

significant association of mycoplasmas with ocular or respiratory disease, each

mycoplasma species should be considered separately to avoid species related

differences biasing results.

Identifying feline mycoplasmas to the species level by PCR amplification and

sequencing of the 16S rRNA gene has been reported (Brown et al., 1995). Molecular

methods have several advantages compared with traditional serological methods (see

section 1.3.3.7), and relate primarily to the wide accessibility of reagents and savings

in time. A recent study has established the molecular method of SSCP to examine

nucleotide variations of mycoplasma species (Jeffery et al., 2007). One of the

advantages of this approach is the ability to rapidly screen a large number of samples,

making it applicable to studies such as this one.

This chapter describes analysis of part of the 16S rRNA gene by PCR-based SSCP for

identification of feline mycoplasma. This technique was used to classify mycoplasma-

positive culture samples so different species could be identified by comparison to

published 16S rRNA sequences.

53


3.2 Materials and method

3.2.1 DNA extraction by heat lysis

Genomic DNA from mycoplasma-positive swab samples (“secondary broth samples”

described in section 2.2.2) was prepared for PCR. Mycoplasma media supernatant

was removed by aspiration following centrifugation of broth at 14,000 x g for 3 min.

The remaining pellet was twice washed and centrifuged, first in phosphate buffered

saline (PBS), then in sterile deionised water (Appendix 5). The resuspended

mycoplasmas were heated to 95 ºC for 5 min to release the DNA from the

mycoplasma cells. This mycoplasmal lysate was stored at -70 ºC then thawed and

used directly for all PCR studies without further purification.

3.2.2 Mycoplasma 16S rRNA gene amplification

The sequences of eight feline mycoplasma species for which the 16S rRNA genes had

been characterised (Brown et al., 1995) were obtained from GenBank® (National

Centre for Biotechnology Information, Bethesda, MD, USA

http://www.ncbi.nlm.nih.gov), and were aligned using the computer programs

GeneWorks (Oxford Molecular Group, now part of Accelrys, San Diego, CA, USA)

and ANGIS BioManager (Australian National Genomic Information Service,

CLUSTALW(Accurate) application (Thompson et al., 1994)

http://www.angis.org.au). Primers designed to amplify the 16S rRNA gene of feline

mycoplasmas (Brown et al., 1995), named MycoF and MycoR (Table 3.1 and Figure

3.1), were commercially synthesised (GeneWorks Pty. Ltd. South Australia,

Australia). This primer set binds to terminal 16S rRNA sequences that are conserved

in Mollicutes (Brown et al., 1990; Deng et al., 1991), and amplifies a 1.5 kb fragment.

Primers were reconstituted to a 25 µM solution in sterile deionised water.

PCR was performed in a 50 µl reaction containing 5 µl of 10 X magnesium free

buffer, 1.5 mM MgCl2, 0.2 mM nucleotide mix, 0.025 µg each primer, 1.5 units of

Taq DNA polymerase, and 10 µl of mycoplasma DNA. PCR was run in an Eppendorf

Mastercycler 5330 plus (Hamburg, Germany). The PCR conditions were 50 cycles of

the following: 94 °C for 45 s, 59 °C for 60 s and 72 °C for 2 min. Positive control

54


samples used for the reaction were DNA from M. felis, M. arginini, M. synoviae, and

M. gallisepticum (courtesy of The University of Melbourne Veterinary Science

Department Microbiological Research Laboratories). A negative control for the

reaction included 10 µl of RNAse free water.

PCR products were subjected to electrophoresis through 1.5% agarose gels containing

ethidium bromide in 1 X Tris-phosphate EDTA buffer; 10 µl of PCR product plus 3

µl loading buffer were loaded in each lane, and a molecular weight marker (Sigma

P9577 DNA ladder marker (Sigma-Aldrich Co. NSW, Australia) used to estimate

product size. Gels were electrophoresed at 100 V, and amplicons detected and

photographed upon transillumination with UV light.

3.2.3 Primer design for PCR-SSCP analysis

PCR primers were designed to produce a suitable sized DNA fragment for SSCP. The

aim was to have the amplified fragment in the range of 250 to 350 bp and from a

region of the 16S rRNA gene with variability among the eight feline mycoplasma

species previously described (Brown et al., 1995).

Two sets of potentially suitable primers were identified, FB50 and RA50 to amplify a

233 bp fragment, and FD1000 and RC1000 to amplify a 274 bp fragment (Table 3.1

and Figure 3.1). Primers were commercially synthesised (GeneWorks Pty. Ltd. South

Australia, Australia), and were reconstituted to a 100 mM solution with sterile

deionised water.

The PCR was run on a Perkin Elmer DNA Thermal Cycler 480 machine (Waltham,

Massachusetts, USA) and was performed with 5 µl of 10 X magnesium free buffer,

3.0 mM MgCl2, 0.2 mM nucleotide mix, 0.025 µg each primer, 2 units of Taq DNA

polymerase, and 1 µl of genomic DNA in a 50 µl reaction. PCR conditions were

denaturation at 94 ºC for 5 min, 35 cycles of the following: 94 ºC for 30 s, 60 ºC for

30 s and 72 ºC for 30 s. This was followed by an elongation step at 72 ºC for 5 min

before being cooled to 4 ºC. Positive controls used for the reactions were M. felis and

negative controls of sterile deionised water in place of genomic DNA.

55


Table 3.1: Mycoplasma 16S rRNA gene PCR primer sequences

Primer Nucleotide sequence (5’ to 3’) Position

MycoF AGA GTT TGA TCC TGG CTC AGG A 11-30

MycoR GGT AGG GAT ACC TTG TTA CGA CT 1512-1493

FB50 GCG AAC/T GGG TGA GTA ACA CG 79-98

RA50 TCT CAG TCC CAG/A TGT GGC 322-305

FD1000 CTC GTG TCG TGA GAT GT 1055-1071

RC1000 TG/AC GAT TAC TAG CGA TTC C 1343-1325


Figure 3.1 : Mycoplasma 16S rRNA gene, primers, and amplified products

← primers

16S rRNA gene

Myco F FB50 RA50 FD1000 RC1000 Myco R

← nt position

0 11 30 79 98 305 322 1055 1071 1325 1343 1493 1512

~1.5kb

fragment

233 bp

fragment

274 bp

fragment

263 bp fragment

476 bp fragment


These smaller PCR products were electrophoresed through 2% agarose gels in 0.5 X

Tris Boric EDTA at 100 V; 5 µl of PCR product plus 3 µl of 6 X loading dye

(Promega, Madison, WI, USA) was added to each well, and ΦX174 DNA/HaeIII

(Promega, Madison, WI, USA) was included as a molecular weight marker to

estimate product size. Gels were stained with ethidium bromide to detect amplicons

and were photographed upon transillumination with UV light.

Primer combinations MycoF and RA50 (to amplify a 263 bp fragment), and FD1000

and MycoR (to amplify a 476 bp fragment) were then tested by PCR of M. felis

controls to assess their suitability for PCR-SSCP. Primers FD1000 and MycoR were

chosen as the most suitable primer pair for the study based on both size and quality of

PCR product. These primers amplify a 457 bp fragment from position 1055 – 1512 of

the 16S rRNA gene (Figure 3.1). The sequence alignment of the 16S rRNA gene

fragment these primers amplify for the eight feline species described is shown in

Appendix 6.

3.2.4 PCR optimisation

In addition to selecting the most suitable primers for both amplification of

mycoplasma DNA from swab samples and to give an appropriate product (size and

variability) to use in PCR-SSCP, the following steps were taken to optimise the PCR.

M. felis was used as the positive sample. The PCR conditions and annealing

temperature were selected based on the length and expected nucleotide composition

of the primers and fragment to be amplified. These conditions provided suitable

products with a clear band on an agarose gel. A magnesium titration was performed to

determine the optimum MgCl2 concentration for the reaction. There was no difference

in intensity of bands observed across an MgCl2 concentration range of 0.5 – 4.0 mM.

A concentration of 3.0 mM was used for the reactions. The amount of sample DNA

used in the reactions was varied from 1-3 µl; 2 µl was chosen as giving bands of

maximal intensity.

56


The method of mycoplasma DNA extraction was considered. The heat lysis method

described in section 3.2.1 was compared with a modified protocol which eliminated

the heating step, and also to a column purification method with the DNeasy® Tissue

Kit (Qiagen Pty. Ltd. Victoria, Australia) according to manufacturer’s instructions.

There was no considerable difference in the intensity of PCR products using either

extraction method (Appendix 7). The modified protocol without the heating step

produced a product of reduced intensity using agarose gel separation. As there was no

apparent advantage using the column purification method, the heat lysis method was

selected for the study.

The possibility of mycoplasma media having an inhibitory effect on the PCR was

considered. The column purification method should have removed all components of

the media, whereas the heat lysis method relies on removal of the majority of such

components by heating and dilution. As described above (and shown in Appendix 7),

there was no difference in the intensity of PCR products for the two extraction

methods. Additionally, following DNA extraction by the heat lysis method, liquid

mycoplasma media was added in increasing concentrations to the M. felis samples.

Bands of lower intensity were evident in samples containing media, and this was more

apparent at higher concentrations (Appendix 7). The heat lysis method of DNA

extraction was considered suitable for the reactions.

The final optimised PCR with primers FD1000 and MycoR in a Perkin Elmer DNA

Thermal Cycler 480 machine (Waltham, Massachusetts, USA) was determined to be:

5 µl of 10 X magnesium free buffer, 3.0 mM MgCl2, 0.2 mM nucleotide mix, 0.025

µg each primer, 2 units of Taq DNA polymerase, and 2 µl of genomic DNA in a 50 µl

reaction. PCR conditions were denaturation at 94 ºC for 5 min, 35 cycles of the

following: 94 ºC for 30 s, 60 ºC for 30 s and 72 ºC for 30 s, then elongation at 72 ºC

for 5 min and finally cooled to 4 ºC. Positive control samples used for the reactions

were M. felis and negative control samples were sterile deionised water.

PCR products were subjected to electrophoresis through 2% agarose gels in 0.5 X Tris

Boric EDTA) at 100 V. 5 µl of PCR product with 3 µl of 6 X loading dye (Promega,

Madison, WI, USA) was added to each well, and ΦX174 DNA/HaeIII (Promega,

57


Madison, WI, USA) was included as a molecular weight marker to estimate product

size. Gels were stained with ethidium bromide to detect amplicons and were

photographed after transillumination with UV light.

3.2.5 PCR of mycoplasma swab samples

PCR was first performed on one of five colony isolates from each of the positive

secondary broth samples (from section 2.2.2). Primers FD1000 and MycoR were used

with PCR conditions and controls as per section 3.2.4. Additionally for each positive

sample, the five colony isolates were then pooled, and the PCR was performed on the

isolate pool.

3.2.6 Non-isotopic Single-Strand Conformation Polymorphism (SSCP)

3.2.6.1 Assessment of variability within samples

Three cats with mycoplasma-positive samples were randomly chosen for each

anatomical site studied (conjunctiva, pharynx and bronchus) to assess the likelihood

of variability within the five colonies that had been selected for each sample in section

2.2.2. DNA from all five colonies of each positive sample was amplified individually

by PCR as described in section 3.2.5. Feline DNA from an animal unrelated to this

study was used as an additional negative (host) control.

Precast SSCP gels (GMA for SSCP, Elchrom Scientific AG, Switzerland) were

placed into the SEA 2000® Electrophoresis apparatus, (Elchrom Scientific AG,

Switzerland) containing 1 X Tris-Acetic EDTA buffer, pre-cooled with a cooling

system (MultiTemp III, Amersham Pharmacia Biotech) to 7.4 °C and pre-run at 74 V

for 15 min prior to loading PCR products. PCR products were prepared by adding 10

µl of PCR product to 5 µl of DNA sequence stop solution (Promega, Madison, WI,

USA). The mix was briefly centrifuged, and denatured in a preheated PCR machine

(Perkin Elmer DNA Thermal Cycler 480, Waltham, Massachusetts, USA) at 94 °C for

15 min. The tubes were then snap-cooled in a freeze-block at -20 ºC and loaded into

wells of the SSCP gel, and run for 17 h at 74 V and a constant 7.4 °C. ΦX174

DNA/HaeIII (Promega, Madison, WI, USA) was used at as a reference marker. Gels

58


were stained in ethidium bromide for 15 min, de-stained in water for 10 min, and

photographed upon transillumination with UV light.

3.2.6.2 SSCP of mycoplasma-positive PCR samples

Each of the positive PCR products described in section 3.2.5 (for both the single

isolate and pooled isolate samples) had SSCP performed by steps described in section

3.2.6.1. SSCP gels were analysed to determine the number of unique SSCP profiles.

An SSCP profile is the pattern of bands visualised on a gel which correspond to the

two single strands of DNA. Their migration through the gel is a function of the

secondary and tertiary structure they form following denaturation which is based on

their nucleotide sequence. Each sample may have two bands (for each strand), or

greater than two if there are DNA fragments with nucleotide variations (which could

arise due to the presence of mutations, subspecies differences, or more than one

species being present). If more than one species were present, the SSCP profile would

reflect this in the form of a combined profile, with two bands from each species

present.

Each time a unique profile was identified, the profile was assigned the number of the

original cat the sample corresponded to, and all subsequent samples with the same

profile were given this number. Once the different profiles from each gel were

identified, representatives of these were run on “summary gels” in order to display

profiles side by side. Samples with the same profile were disregarded in order to

select only the unique SSCP profiles for sequencing.

3.2.7 DNA Sequencing

A representative PCR product of each different SSCP profile was sequenced to

determine which mycoplasma species the profile corresponded to. Prior to sequencing

PCR products were purified using Wizard® PCR Preps DNA Purification System

(Promega, Madison, WI, USA) (Appendix 8). Prior to sequencing, purified DNA was

then subjected to electrophoresis through 2% agarose gels using genomic DNA

standards of known concentration (pGEM® control DNA, 200 pg/µl, Promega,

Madison, WI, USA), to estimate sample concentration.

59


The sequencing reactions were performed according to the manufacturers directions

in microcentrifuge tubes using ABI Prism® BigDye Terminator Cycle Sequencing

Ready Reaction Kits (Versions 2.0 and 3.1) (Applied Biosystems, California, USA).

Reactions of 20 µl were prepared by combining 6 µl of Terminator Ready Reaction

mix (Applied Biosystems, California, USA), 3.5 µl of primer (diluted 1:100 from

previously described 100 µM solution to make 1 µM) and 3-10 ng of DNA. For each

sample, sequencing reactions were performed in both the forward and reverse

direction (with primers FD1000 and MycoR respectively). Sequencing reactions were

performed according to the manufacturer’s directions in a Perkin Elmer DNA

Thermal Cycler 480 (Waltham, Massachusetts, USA) with cycling conditions of 96 ºC

for 5 min, 25 cycles of the following: 96 ºC for 30 s, 50 ºC for 15 s and 60 ºC for 4

min, then cooled to 4 ºC.

Sequencing reactions were purified by isopropanol precipitation to remove excess

mineral oil and reagents, according to the ABI Prism® BigDye Terminator Cycle

Sequencing Ready Reaction Kit (Versions 2.0 and 3.1) directions (Applied

Biosystems, California, USA). This was achieved by addition of 75% isopropanol to

precipitate the extension products, followed by removal of the supernatant leaving the

purified products. Precipitated products were analysed by Griffith University DNA

Sequencing Facility (GUDSF) (School of Biomolecular and Biomedical Science,

Nathan, Queensland, Australia).

3.2.8 Sequence analysis

Sequences from GUDSF were analysed using the software program Chromas version

2.24 (Technelysium Pty. Ltd. Tewantin, QLD, Australia,

http://www.technelysium.com.au). In order to analyse multiple sequences or to

compare the forward and reverse sequences, the CAP (contig assembly program)

Sequence Assembly Machine software (Campus IFOM-IEO Milan, Italy,

http://www.bio.ifom-ieo-campus.it/cap ((Huang, 1992))) was used to perform contigs

of forward and reverse sequences, and sequence alignments. Once a contig sequence

was established, BLAST (Basic Local Alignment Search Tool) searches of the

sequences were conducted using the National Centre for Biotechnology Information

60


website (http://www.ncbi.nlm.nih.gov). BLAST searches the database GenBank®

(National Centre for Biotechnology Information, Bethesda, Maryland, USA) and

compares the sample sequence to determine whether it was identical or similar to

other mycoplasma sequences.

3.2.9 Statistical analysis

SSCP results from section 3.2.6.2 were used to determine the overall prevalence of

the different mycoplasma species identified (as represented by the different SSCP

profiles F and R). These data were then further analysed to determine if positive

samples within an individual cat were of the same species, and to determine if there

was any association between anatomical location and mycoplasma species, or

between mycoplasma species and presence of disease.

To determine if there were significant differences between species of mycoplasma

and combination of anatomical sites they were present in (where there were multiple

positive sites in an individual cat), Fisher’s exact test was used. This compared

proportions with respect to which combination of anatomic sites within each cat were

positive for each of the two species found. P-values were determined using the

computer software program Stata (StataCorp., 2007) with a value of ≤ 0.05

considered significant.

To determine whether a particular mycoplasma species was associated more

frequently with a particular anatomical location, comparisons were made for the three

anatomic locations. This was determined by a random effects logistic regression to

take account of the non-independence of observations, where multiple observations

within a cat were correlated, as some samples came from the same cat (Dohoo et al.,

2003). Stata software was used to calculate the random effects logistic regression

using the xtlogit command (StataCorp., 2007). Data were organised into binary form

with respect to ‘positivity to profile F’. For every cat, each site (conjunctiva (A),

pharynx (B) and bronchus (C)) was given either the number 1 if positive for F, 0 if not

positive for F (i.e. was profile R), or left blank if no sample, negative for mycoplasma

or unknown. This data only considers those samples where a result for species based

on SSCP was known, and therefore directly compares the proportion of the different

61


species found between each site. Samples that were negative for mycoplasma were

not included in this test. The odds were defined as p/(1-p) where p was the proportion

of observations that were positive to F. The odds ratio was the ratio of the odds when

comparing sites. An odds ratio of 1 indicates the odds of having a positive sample at

each site are the same. A P-value of ≤ 0.05 was considered significant.

McNemar’s test was used to compare paired proportions for inclusion of

mycoplasma-negative cats in the analysis. This compared both the presence and

absence of mycoplasma (both overall and then for each mycoplasma species found)

between different anatomic locations. Stata software (StataCorp., 2007) was used for

McNemar’s test and a P-value of ≤ 0.05 was considered significant.

Fisher’s exact test was used to investigate any association between the presence of

each mycoplasma species and the presence of disease. Although there was no

statistically significant relationship found in Chapter 2 for mycoplasma-positive

results, this test considered any association of each individual species with the

presence of disease. Results were considered overall, and specifically where disease

was present in the same anatomic location as the positive swabs. Fisher’s exact test

was performed with PEPI for Windows (Abramson, 2004) to determine a P-value. A

P-value of ≤ 0.05 was considered significant.

62


3.3 Results

3.3.1 PCR of controls and samples

PCR amplification of the 16S rRNA gene of reference for mycoplasma species M.

felis, M. arginini, M. synoviae and M. gallisepticum using the primer pair MycoF and

MycoR yielded the expected amplified product, of ~ 1.5 kb (Figure 3.2).

The primer pair FD1000 and MycoR yielded a fragment of the expected size of ~ 450

bp (Figure 3.3). This occurred with both the reference strain M. felis, and the feline

samples assumed to be mycoplasma-positive based on the colour change in broth and

subsequent growth of typical mycoplasma colonies on agar.

One hundred and twenty nine (96.3%) of the 134 feline samples that were

mycoplasma culture-positive were also PCR positive. This represents an overall

prevalence of 129/330 samples (39.1%), or 75/110 cats (68.2%).

3.3.2 Screening of isolates by SSCP for genetic variability

All five colony isolates were tested from three cats for each of the three anatomic sites

investigated (i.e. 5 isolates each from 9 samples overall). Four different SSCP profiles

were identified (data not shown). Seven of the nine samples had five identical isolate

profiles whereas the other two samples had more than one profile identified amongst

the five isolates. This demonstration of variability provided evidence for analysing

both the single colony isolate, and a pooled sample of the five colony isolates by

SSCP for all samples.

3.3.3 SSCP-coupled analysis of all samples, and identification

There were two frequently occurring SSCP profiles, which were identified as ‘F’, as it

was identical to the M. felis positive control, and ‘R’, as this profile was retarded (in

migration) by comparison (Figure 3.4). An SSCP result attributable to either of these

profiles was obtained for 111 samples, from 66 cats (Table 3.2). There were three

additional profiles, which were all variants of F, as they contained the F profile as

63


1,500 bp

Figure 3.2: Gel showing PCR products amplified by primers MycoF and

MycoR

1 2 3 4 5 6 7 8 9 10 11 12

Key: Lane on gel Sample

1 Sigma P9577 marker

2 M. felis

3 M. felis(diluted*)

4 blank

5 M. felis

6 M. felis (diluted*)

7 blank

8 M. gallisepticum

9 M. synoviae

10 blank

11 M. arginini

12 M. arginini (diluted*)

*(all dilutions 1 in 5 with water)


Figure 3.3: Gel showing PCR products amplified by primers

603bp

310bp

FD1000 and MycoR

1 2 3

Key: Lane on gel Sample + Primers

1 �X174 DNA/Hae III Marker

2 M. felis with MycoR and RA50

3 M. felis with FD1000 and MycoR


Figure 3.4: SSCP gel of feline mycoplasma samples showing

two distinct profiles; F and R

R F R F ΦX


Table 3.2: Results of SSCP for the 129 mycoplasma-positive PCR samples

M. felis M. gateae /

M. arginini

Both Negative

(no SSCP

result)

Number of

positive

# Samples 62 49 1* 17 111

% of

positive

55.9 44.1 0

# Cats 32 26 8* 11 65

% of

positive

48.5 39.4 12.1

*This sample (106C) was excluded from further analysis

Table 3.3: Number of variant SSCP profiles identified and comparison to health

status of cats

SSCP profile

variant

Number of

samples

Number of cats Diseased cats

F(a) 5 4 0

F(b) 2 1 1

F(c) 1 1 0

Total 8 6 1


well as an extra band (Figure 3.5). Variant F profiles were evident in 8 samples from

6 cats (Table 3.3).

The SSCP result for both the ‘single colony’ and the five ‘pooled’ colonies for each

sample was compared to determine whether they had the same or different profile. In

every case except one (sample 106C), the result for the single and pooled samples

were the same, or contained a variant of the same profile.

Representative samples of the two frequently occurring SSCP profiles (F and R) were

sequenced. Sequences were compared using the BLAST search tool of databases

containing known/published sequences of the 16S rRNA gene. Profile F showed 98%

sequence similarity to M. felis (accession number U09787.1 (Figure 3.6)). Using

SSCP, this profile was identical to the M. felis reference strain used throughout the

experiments. Representative samples from two of the three F profile variants were

also sequenced, both demonstrating 98% sequence similarity to the reference strain of

M. felis using BLAST (Figure 3.7). Overall, there was minimal variation between the

different isolates, with 1-3 nucleotide differences present.

Profile R was determined to be M. gateae using BLAST (accession number

U15796.1), with 99% sequence similarity to the reference strain (Figure 3.8).

However, it was not possible to extrapolate this finding to differentiate between M.

gateae and M. arginini for the SSCP profile R. There is only one nucleotide

difference between M. gateae and M. arginini in this region of the 16S rRNA gene,

and although the sample that was sequenced was similar to M. gateae, the other

samples in the study with the same SSCP profile could have been either of these

species. This was due to a single nucleotide difference that may not alter the

secondary structure of the DNA sufficiently to be detected by SSCP, particularly for

an amplicon size as used here (~ 450 bp). For results analysis, samples that were

considered to be profile F will be referred to as M. felis and those of profile R will be

referred to as M. gateae/M. arginini.

64


3.3.4 Numbers and proportion of each mycoplasma species found

M. felis was more prevalent than M. gateae/M. arginini for both the number of

samples and number of cats (Table 3.2). There were 17/129 samples and 11/75 cats

that were positive for mycoplasma by PCR, for which an SSCP result was not

obtained. This was either because there was an unreadable result, no result, or for the

purposes of data analysis, a variant profile. These will be considered further in the

discussion. There was one sample, 106C, for which the SSCP profile was different for

the single colony sample and the pooled sample of all five colonies, and although this

will also be considered in the discussion, it was excluded from data analysis. For the

remaining 7 cats with both mycoplasma species, the differing species were present in

different samples and hence anatomical locations.

3.3.5 Comparison of colour change observed in liquid culture and identification

based on PCR-SSCP and nucleotide sequencing

Analysis of the correlation between colour changes observed in liquid culture of

mycoplasmas and the species identified for each sample by PCR-SSCP and nucleotide

sequencing was performed. Of the 111 samples for which an SSCP result was

obtained, there were 32 where the colour change of some or all of the broths differed

from that expected from the taxa identified. This is based on knowledge of the

preferred energy utilisation of that species (Table 1.2). Where a primary broth

changes colour to yellow, it is indicative of an acid shift and represents glucose

fermentation, which would be expected of M. felis. Alternatively, a colour change to

red is indicative of an alkaline shift, and represents arginine utilisation, which would

be expected of M. gateae and M. arginini.

The colour change in both the primary broth (a single sample from the direct swab)

and then the secondary broths (five samples obtained from five mycoplasma colonies

from the primary plates) was considered. Each of the five secondary broth samples

displayed the same colour change as the primary broth in 80/111 samples. There were

13/111 samples where the colour change of the five secondary broth samples was

different from that of the primary broth. Finally, there were 18/111 samples where

both colour changes were represented in the five secondary broth samples.

65


Figure 3.5 SSCP gel of feline mycoplasma samples showing variant F profiles in addition to the two profiles

F and R

Key:

M. felis positive control

F profile

F profile variant

R profile

F profile


Figure 3.6: Nucleotide sequence alignment of sample 103C (profile F) with the sequence

representing M. felis

1061 1071 1081 1091 1101

consensus CGAGCGCAACCCTTG CCTTAGTTAAATATTCTAGGGAGACTGCCCGAGTAA

M.felis ...............GTC....................................

103C ...............T--....................................

1111 1121 1131 1141 1151 1161

consensus TTGGGAGGAAGGTGGGGACGACGTCAAATCATCATGCCTCTTACGAGTGGGGCAACACAC

M.felis ............................................................

103C ............................................................

1171 1181 1191 1201 1211 1221

consensus GTGCTACAATGGATGGTACAAAGAGAAGCAATACGGCGACGT GAGCAAATCTCAAAAAA

M.felis ..........................................N.................

103C ..........................................T.................

1231 1241 1251 1261 1271 1281

consensus CCATTCTCAGTTCGGATTGTAGTCTGCAACTCGACTACATGAAGTCGGAATCGCTAGTAA

M.felis ............................................................

103C ............................................................

1291 1301 1311 1321 1331 1341

consensus TCGTAGATCAGCTACGCTACGGTGAATACGTTCTCGGGTCTTGTACACACCGCCCGTCAC

M.felis ............................................................

103C ............................................................

1351 1361 1371 1381 1391 1401

consensus ACCATGGGAGCTGGTAATGCCCGAAGTCGGTTTTGTTAACTACGGAGACAACTGCCTAAG

M.felis ............................................................

103C ............................................................

1411 1421

consensus GCAGGGCCGGTGACTGGGG

M.felis ...................

103C ...................


Figure 3.7 Nucleotide sequence alignment of F profile variant samples (110C and 111B) with

M. felis and regular F profile (103C)

1021 1031 1041 1051 1061 1071

consensus TCGTGAGATGTTCGGTTAAGTCC GCA CGAGCGCAACCCTTGT--CCTTAG

M.felis .......................T...A...............GTC......

111B .......................T...A........................

110C .......................N...T........................

103C ----------------------------........................

1081 1091 1101 1111 1121 1131

consensus TTAAATATTCTAGGGAGACTGCCCGAGTAATTGGGAGGAAGGTGGGGACGACGTCAAATC

M.felis ............................................................

111B ............................................................

110C ............................................................

103C ............................................................

1141 1151 1161 1171 1181 1191

consensus ATCATGCCTCTTACGAGTGGGGCA-ACACACGTGCTACAATGGATGGTACAAAGAGAAGC

M.felis ............................................................

111B ............................................................

110C ........................T...................................

103C ............................................................

1201 1211 1221 1231 1241 1251

consensus AATACGGCGACGTTGAGCAAATCTCAAAAAACCATTCTCAGTTCGGATTGTAGTCTGCAA

M.felis .............N..............................................

111B ............................................................

110C ............................................................

103C ............................................................

1261 1271 1281 1291 1301 1311

consensus CTCGACTACATGAAGTCGGAATCGCTAGTAATCGTAGATCAGCTACGCTACGGTGAATAC

M.felis ............................................................

111B ............................................................

110C ............................................................

103C ............................................................

1321 1331 1341 1351 1361 1371

consensus GTTCTCGGGTCTTGTACACACCGCCCGTCACACCATGGGAGCTGGTAATGCCCGAAGTCG

M.felis ............................................................

111B ...............................N............................

110C ..........................................C.................

103C ............................................................

1381 1391 1401 1411 1421

consensus GTTTTGTTAACTACGGAGACAACTGCCTAAGGCAGGGCCGGTGACTGGGG

M.felis ..................................................

111B .....................N.........-......G-----------

110C ..................................................

103C ..................................................


Figure 3.8: Nucleotide sequence alignment of sample 14A (profile R) with M. gateae

1031 1041 1051 1061 1071 1081

consensus GAGATGTTTGGTCAAGTCCTGCAACGAGCGCAACCCCTATCTTTAGTTACTAACGAGTCA

M.gateae ............................................................

14A ............................................................

1091 1101 1111 1121 1131 1141

consensus TGTCGAGGACTCTAGAGATACT CCTGGGTAACCGGGAGGAAGGTGGGGATGACGTCAA

M.gateae ......................G-....................................

14A ......................CA....................................

1151 1161 1171 1181 1191 1201

consensus ATCATCATGCCTCTTACGAGTGGGGCAACACACGTGCTACAATGGTCGGTACAAAGAGAA

M.gateae ............................................................

14A ............................................................

1211 1221 1231 1241 1251 1261

consensus GCAATATGGCGACATGGAGCAAATCTCAAAAAGCCGATCTCAGTTCGGATTGGAGTCTGC

M.gateae ............................................................

14A ............................................................

1271 1281 1291 1301 1311 1321

consensus AATTCGACTCCATGAAGTCGGAATCGCTAGTAATCGCAGATCAGCTACGCTGCGGTGAAT

M.gateae ............................................................

14A ............................................................

1331 1341 1351 1361 1371 1381

consensus ACGTTCTCGGGTCTTGTACACACCGCCCGTCACACCATGGGAGCTGGTAATACCCAAAGT

M.gateae ............................................................

14A ............................................................

1391 1401 1411 1421 1431 1441

consensus CGGTTAGCTAACCTCGGAGGCGACCGCCTAAGGTAGGACTGGTGACTGGGGTGA

M.gateae ......................................................

14A ......................................................


There were 94/111 samples where the colour change in the primary broth was

consistent with that expected for the taxa identified by SSCP. For those samples

where each of the five secondary broth samples demonstrated the same colour change

(93/111), it was in agreement with the identification based on the SSCP result in all

but one sample.

3.3.6 Analysis of species distribution among anatomical sites

Where there were multiple mycoplasma-positive samples in an individual cat, the

distribution and proportion of the two groups of mycoplasma species were considered.

The majority of cats 32/39 (82.1%) had a single species/group of mycoplasma at

multiple anatomic sites (Table 3.4). There were, however, a small number of cats

where different species were present in different locations. There were no cats for

which multiple species were identified at a single site (except the case of 106C

described in sections 3.3.3 and 3.3.4, which is not included in this table).

Although the majority of cats had the same species at multiple anatomic sites, neither

species was associated more frequently with any particular combination of sites.

Fisher’s exact test was used to compare the proportions of species for different

combinations of sites where data were available (Tables 3.5 and 3.6). There was no

significant difference in the proportions of M. felis and M. gateae/M. arginini across

these combinations of anatomical locations (p = 0.29 and 0.34).

M. felis was found more often than M. gateae/M. arginini in the conjunctiva and

pharynx, whereas these species had a slightly higher prevalence than M. felis in the

bronchus (Table 3.7 and Figure 3.9). The presence of mycoplasma at a particular site

was not necessarily independent of other sites (because they were from the same cat).

The random effects logistic regression shows that M. felis and M. gateae/M. arginini

were found in similar proportions at each site. The proportion of observations that

were positive for M. felis (compared with M. gateae/M. arginini) were not statistically

different for the overall effect of site (Wald p = 0.62, Likelihood Ratio Test p = 0.61).

.

The proportion of observations that were M. felis (including the odds of this occurring

at a particular site) were compared with M. gateae/M. arginini (Table 3.8). The odds

66


of a mycoplasma-positive conjunctival sample being M. felis as opposed to M.

gateae/M. arginini, was 4.5 to 1. Similarly, a mycoplasma-positive pharyngeal sample

had odds of 1.26 to 1 of being M. felis. Bronchial samples, however, were slightly

more likely to be M. gateae/M. arginini than M. felis, with odds of 0.95 to 1.

While there was not a significant difference in the ratio of odds from the logistic

regression model, and therefore proportion of M. felis and M. gateae/M. arginini

between anatomic sites, there appeared to be a trend (Table 3.9). Although not

significant (p = 0.34), the biggest difference noted was the proportion of M. felis

(compared with M. gateae/M. arginini) was greater in the conjunctiva compared with

the bronchus. M. felis was also proportionately greater in the conjunctiva than the

pharynx (p = 0.47).

When also considering those cats that were negative for mycoplasma in the statistical

analysis, McNemar’s test was used to compare paired proportions of mycoplasma-

positive cats among sites. This enabled the comparison of the likelihood of either any

mycoplasma-positive sample, or a particular mycoplasma species between sites. The

proportion of mycoplasma-positive samples was significantly greater in both the

pharynx (p < 0.001, Table 3.10) and bronchus (p < 0.001, Table 3.11) compared to the

conjunctiva. Similarly, the proportion of mycoplasma-positive samples was

significantly greater in the pharynx compared with the bronchus (p = 0.002, Table

3.12). When species of mycoplasma was also considered, M. felis was found at a

significantly higher proportion in the pharynx (p < 0.001, Table 3.13) and bronchus (p

= 0.031, Table 3.14) compared with the conjunctiva and also in the pharynx when

compared with the bronchus (p = 0.007, Table 3.15). M. gateae/M. arginini was also

found at a significantly higher proportion in the pharynx (p < 0.001, Table 3.16) and

bronchus (p < 0.001, Table 3.17) compared with the conjunctiva, but in similar

proportions between the pharynx and bronchus (p = 0.17, Table 3.18).

Although there are significant differences in the prevalence and distribution of

mycoplasma between anatomic sites studied, the pattern of the anatomical distribution

is consistent between the different species of Mycoplasma found. Comparatively,

neither mycoplasma species had a significantly greater prevalence at a particular

anatomical site than the other species.

67


Table 3.4: Numbers of cats that had the same mycoplasma species or different

mycoplasma species among sites when multiple sites within a cat contained

mycoplasma, where A = conjunctiva, B = pharynx, C = bronchus

Combination of

anatomic sites

with positive

samples

Number of cats with

same mycoplasma

species at all sites

M. felis M.gateae /

M.arginini

Number of cats

with different

mycoplasma

species at different

sites

Total

2 sites AB 3 1 0 32

BC 9 14 5

CA 0 0 0

(total) (12) (15)

3 sites ABC 5 0 2 7

(total) (5) (0)

Total 17 15 7 39

32


Table 3.5: Comparison of the proportion of each species between different

combinations of positive sites using Fisher’s exact test (where the same mycoplasma

species was present at each site), where A = conjunctiva, B = pharynx, C = bronchus

Positive sites M. felis M. gateae /

M. arginini

A + B 3 (75.0%) 1 (25.0%) 4

B + C 9 (39.1%) 14 (60.9%) 23

Total P-value

0.29

Table 3.6: Comparison of the proportion of each species between different

combinations of positive sites using Fisher’s exact test (where those with different

mycoplasma species at each site were also considered in the overall proportion),

where A = conjunctiva, B = pharynx, C = bronchus

Positive

sites

Same species Different

M. felis M. gateae /

M. arginini

species

A + B 3 (75.0%) 1 (25.0%) 0 4

B + C 9 (32.1%) 14 (50.0%) 5 (17.9%) 28

Total P-value

0.34


Table 3.7: Number and proportion of positive samples for each species of

mycoplasma at each anatomic site sampled

Anatomic site Species Total number of

M. felis M. gateae/

M. arginini

mycoplasma-positive

samples (111)

Conjunctiva (A) 9 (81.8%) 2 (18.2%) 11

Pharynx (B) 34 (55.7%) 27 (44.3%) 61

Bronchus (C) 19 (48.7%) 20 (51.3%) 39

Figure 3.9: Comparison of mycoplasma species distribution across the different

anatomic locations studied

Number of cats

40

35

30

25

20

15

10

5

0

Conjunctiva (A)

Pharynx (B)

Bronchus (C)

Anatomic site

M.felis

M.gateae/arginini


Table 3.8: Proportion of observations and odds at each site of a positive result for M.

felis (F) compared to M. gateae/M. arginini (R).

Site F/(F + R) % Odds

Conjunctiva

A

Pharynx

B

Bronchus

C

9/11 81.8 4.5

34/61 55.7 1.26

19/39 48.7 0.95

Table 3.9: Comparison of likelihood of M. felis versus M. gateae/M. arginini at

particular anatomic sites using the odds ratio, where A = conjunctiva, B = pharynx, C

= bronchus

Sites Odds ratio* 95% CI P-value

B vs A 0.34 0.02 – 6.59 0.47

C vs A 0.23 0.01 – 4.67 0.34

C vs B 0.68 0.15 – 3.16 0.62

*Odds ratio of 1 means they are the same


Table 3.10: Comparison of paired proportions for mycoplasma status overall between

the conjunctiva and pharynx using McNemar’s test.

pharynx

conjunctiva

Myco + Myco - Total % positive

Myco + 10 1 11 11/110 (10%)

Myco - 51 48 99

Total 61 49 110

% positive 61/110 (55%) P-value

< 0.001

Table 3.11: Comparison of paired proportions for mycoplasma status overall between

the conjunctiva and bronchus using McNemar’s test.

bronchus

conjunctiva

Myco + Myco - Total % positive

Myco + 7 4 11 11/109

Myco - 32 66 98

Total 39 70 109

% positive 39/109

(35.8%)

(10.1%)

P-value

< 0.001


Table 3.12: Comparison of paired proportions for mycoplasma status overall between

the pharynx and bronchus using McNemar’s test.

pharynx

bronchus

Myco + Myco - Total % positive

Myco + 34 26 60 60/109 (55%)

Myco - 5 44 49

Total 39 70 109

% positive 39/109

(35.8%)

P-value

0.002

Table 3.13: Comparison of paired proportions for M. felis status between the

conjunctiva and pharynx using McNemar’s test.

pharynx

conjunctiva

Myco + Myco - Total % positive

Myco + 8 1 9 9/110 (8.2%)

Myco - 26 75 101

Total 34 76 110

% positive 34/110

(30.9%)

P-value

< 0.001


Table 3.14: Comparison of paired proportions for M. felis status between the

conjunctiva and bronchus using McNemar’s test.

bronchus

conjunctiva

Myco + Myco - Total % positive

Myco + 5 4 9 9/109 (8.3%)

Myco - 14 86 100

Total 19 90 109

% positive 19/109

(17.4%)

P-value

0.031

Table 3.15: Comparison of paired proportions for M. felis status between the pharynx

and bronchus using McNemar’s test.

pharynx

bronchus

Myco + Myco - Total % positive

Myco + 14 19 33 33/109

Myco - 5 71 76

Total 19 90 109

% positive 19/109

(17.4%)

(30.3%)

P-value

0.007


Table 3.16: Comparison of paired proportions for M. gateae/M. arginini status

between the conjunctiva and pharynx using McNemar’s test.

pharynx

conjunctiva

Myco + Myco - Total % positive

Myco + 1 1 2 2/110 (1.8%)

Myco - 26 82 108

Total 27 83 110

% positive 27/110

(24.5%)

P-value

< 0.001

Table 3.17: Comparison of paired proportions for M. gateae/M. arginini status

between the conjunctiva and bronchus using McNemar’s test.

bronchus

conjunctiva

Myco + Myco - Total % positive

Myco + 1 1 2 2/109 (1.8%)

Myco - 19 88 107

Total 20 89 109

% positive 20/109

(18.3%)

P-value

< 0.001


Table 3.18: Comparison of paired proportions for M. gateae/M. arginini status

between the pharynx and bronchus using McNemar’s test.

pharynx

bronchus

Myco + Myco - Total % positive

Myco + 14 13 27 27/109

Myco - 6 76 182

Total 20 89 109

% positive 20/109

(18.3%)

(24.8%)

P-value

0.17

Table 3.19: Number of each mycoplasma species at any site for both healthy and

diseased cats. P-value represents a comparison of proportions of each mycoplasma

species at any site between healthy and diseased cats using Fisher’s exact test.

M. felis M. gateae/

M. arginini

Both Total P-value

Healthy 22 17 5 44

Diseased* 9 9 2 20

Total 31 26 7 64 1.00

*all had disease that was associated with the conjunctiva, or upper/lower respiratory

tract as scored in data sheets described in section 2.2.1


Table 3.20: Comparison of proportion of each mycoplasma species present in

conjunctival swabs between cats with and without conjunctivitis

Ocular

Signs

Species Negative Total

M. felis M. gateae/

M. arginini

P-value

Yes 0 1 15 16 0.13

No 8 1 41 50

Table 3.21: Comparison of proportion of each mycoplasma species present in

pharyngeal swabs between cats with and without upper respiratory tract signs

URT

signs

Species Negative Total

M. felis M. gateae/

M. arginini

P-value

Yes 1 3 0 4 0.54

No 32 24 6 62

Table 3.22: Comparison of proportion of each mycoplasma species present in

bronchial swabs between cats with and without lower respiratory tract signs

LRT

signs

Species Negative Total

M. felis M. gateae/

M. arginini

P-value

Yes 3 3 1 7 0.35

No 16 17 25 58


3.3.7 Association between mycoplasma species and ocular/respiratory disease

Neither M. felis nor M. gateae/M. arginini were found to be associated more

frequently with disease at either all anatomic sites, or specifically in the anatomical

location in which signs of disease were observed. Fisher’s exact test was used to

compare proportions of each species in healthy and diseased cats (Table 3.19), and

specifically for each of the three anatomic locations (Tables 3.20 to 3.22). There was

no evidence of either M. felis or M. gateae/M. arginini being associated with disease

in the population of cats studied.

The samples with variant M. felis profiles were compared with the health status of the

six cats they were isolated from (Table 3.3). All were healthy cats with the exception

of one cat. The variant F(b) isolates from this cat were from the pharynx and

bronchus, and the cat had bilateral conjunctivitis with mucopurulent ocular discharge

and mottling of both caudal lung lobes.

68


3.4 Discussion

The results of the current study confirmed the high prevalence of mycoplasma in the

conjunctiva, pharynx and bronchi of cats. The combined use of PCR and SSCP

enabled a large number of samples to be rapidly screened for genetic variation and

identity. Two distinct profiles (F and R) were readily identified by SSCP. These were

representative isolates of M. felis, and M. gateae respectively. The aim of this study

was to determine the species these isolates belonged to, rather than to demonstrate any

genetic variability between mycoplasmas isolated from different populations or

geographical locations.

It was not possible to distinguish between M. gateae and M. arginini by analysing the

region of the 16S rRNA gene by PCR-SSCP in the current study. This was due to

there being only one nucleotide difference between the two species in the 450 bp

target region. Although this difference may be identified by sequencing, it may not

always provide sufficient variability to see a different SSCP profile. All samples

represented by profile R were therefore grouped into a single cohort, even though they

may contain both M. gateae and M. arginini. Currently, there is a lack of evidence

suggesting either M. gateae or M. arginini is associated with disease in cats (Heyward

et al., 1969; Blackmore et al., 1971; Blackmore and Hill, 1973; Tan and Miles,

1974b; Tan et al., 1977a; Tan et al., 1977b). M. felis however, has been implicated as

having a pathogenic role in both conjunctival and respiratory disease in cats (Cole et

al., 1967; Schneck, 1972; Campbell et al., 1973b; Tan and Miles, 1973; Tan, 1974;

Tan and Miles, 1974b; Haesebrouck et al., 1991; Randolph et al., 1993). The main

consideration was to separate M. felis from other non-pathogenic species to determine

whether there was any evidence of it being associated with disease. M. gateae/M.

arginini therefore provided a non-pathogenic group for comparison with M. felis.

The current study showed M. felis had a slightly higher prevalence within total

samples and number of cats than the non-pathogenic group M. gateae/M. arginini.

This supports similar findings in feline populations from studies in New Zealand (Tan

and Miles, 1974b; Tan et al., 1977a), England (Blackmore et al., 1971) and the USA

(Heyward et al., 1969).

69


The criteria for determining the presence of multiple mycoplasma species in a sample

(representing one anatomical site) is based on identification of multiple SSCP profiles

in that sample. One sample in this study (106C) had more than one species of

mycoplasma evident at a single anatomical site, with a different SSCP profile from

the single colony and the pooled colony sample. This suggests one anatomical site

contained two different mycoplasma species, which was atypical in this population of

cats. This is in contrast to similar feline population studies where multiple

mycoplasma species were commonly isolated from swabs (Heyward et al., 1969;

Blackmore et al., 1971; Hill, 1971; Tan and Miles, 1974b; Tan et al., 1977a).

Although this suggests there were multiple species isolated from that site, a mixed

SSCP profile should also have been evident in the pooled colony sample, as the single

colony isolate is represented in the pooled sample. However, neither this sample nor

any others had a combination of two distinct SSCP profiles, which would indicate

multiple species within the sample.

Where there were multiple anatomic sites in a cat with mycoplasma, the same

species/group of mycoplasma was isolated from each site in the vast majority of cases

in this study. This occurrence was likely due to the anatomical or functional

relationship between sites discussed in Chapter 2.

There was no significant site predilection for either M. felis or M. gateae/M. arginini

when compared at any one site (conjunctiva, pharynx or bronchi) or any combination

of sites. Although not statistically analysed in previous studies, M. gateae tended to be

slightly more prevalent than M. felis and M. arginini in the pharynx (Heyward et al.,

1969; Tan and Miles, 1974b; Tan et al., 1977a), whereas M. felis was more prevalent

in the conjunctiva (Blackmore et al., 1971; Tan and Miles, 1974b). However, in the

present study, M. felis was slightly more prevalent than M. gateae/M. arginini in the

overall number of samples and cats. This was also true for the conjunctiva and

pharynx, although the differences were not significant when proportions of each

species between sites were compared. This difference was most apparent in the

conjunctiva, where the odds of a mycoplasma-positive conjunctival sample being M.

felis, as opposed to M. gateae/M. arginini, was 4.5 to 1. This is supported by studies

70


where M. felis is the species of mycoplasma isolated from the conjunctiva most

commonly (Blackmore et al., 1971; Tan and Miles, 1974b).

Similar to the results reported in Chapter 2, there was a statistically significant

difference in the prevalence of mycoplasma between sites, as confirmed by PCR. In

these circumstances, the pharynx was by far the most common site from which

mycoplasma was isolated, followed by the bronchus and then the conjunctiva. When

the data were examined for each mycoplasma species separately, the same significant

relationships existed among sites. That is, both M. felis and M. gateae/M. arginini

were recovered significantly more frequently from the pharynx than the conjunctiva,

and also from the bronchus than the conjunctiva. The exception was that M. gateae/M.

arginini had no statistically significant difference in prevalence between the pharynx

and bronchus as M. felis did. Although this demonstrates that both species have a

predilection for particular anatomical sites, the two species were not significantly

different to each other. Neither species was comparatively more prevalent at any one

site. Therefore, there are no discernable differences in the ecology or relative

preference for site by either species.

The regular isolation of both M. felis, and M. gateae/M. arginini from the bronchus

was interesting. Given the careful method of sampling, it is unlikely this was the

result of contamination. As the samples were taken following euthanasia, it is possible

that pharyngeal mucous moved (post mortem) into the trachea, and subsequently the

bronchus from either agonal inhalation or during subsequent movement of the bodies.

Evaluation of post mortem microbiological examination and the significance of such

factors as bacterial invasion or translocation are inconclusive (reviewed in (du Moulin

and Love, 1988; Tsokos and Puschel, 2001; Morris et al., 2006)), but do discuss

important factors for obtaining representative samples such as time interval from

death to post mortem, storage temperature, technique and also interpretation of culture

results. In this study, routine bacterial culture may have provided some insight as to

whether the mycoplasmas isolated from the bronchi originated from the oropharynx,

based on the concurrent presence of a mixed flora of resident oropharyngeal

organisms.

71


Further evidence for these being meaningful isolates comes from the fact that in five

of the cats in the current study, mycoplasma was isolated from the bronchus but not

from the pharynx. From four others, a different species was isolated from the

bronchus compared with the pharynx, indicating they had not originated from this

location. These findings are supported by a study where 35% of healthy cats had

mycoplasma isolated from the trachea (Heyward et al., 1969). Each of these 10

tracheal isolates were found to be M. gateae (Heyward et al., 1969), whereas the

current study demonstrated an equivalent prevalence of M. felis and M. gateae/M.

arginini from the bronchial isolates. This is the first study to demonstrate the isolation

of M. felis from the lower respiratory tract of a population of healthy cats.

Differentiation of the mycoplasmas into species/groups did not demonstrate any

statistical association with ocular or respiratory disease. This was true both overall

(for any sign of disease and isolation of that species from any site), and specific to the

isolation of each species from the location of the signs of disease.

M. felis was isolated from eight cats with no sign of conjunctivitis compared with

none of the cats with conjunctivitis. This contrasts a number of studies where M. felis

had been isolated from the conjunctiva in greater numbers in cats with conjunctivitis

or upper respiratory tract disease than without (Tan and Miles, 1973, 1974b; Tan et

al., 1977a; Shewen et al., 1980; Haesebrouck et al., 1991; Bannasch and Foley, 2005;

Low et al., 2007), implying that it may cause the disease. However, it was consistent

with findings from other studies that have found M. felis in similar proportions in cats

with and without conjunctivitis (Blackmore et al., 1971). M. felis isolated from the

conjunctiva of cats in the current study was not associated with conjunctivitis. By

studying larger numbers of cats or more cats with conjunctivitis, associations may be

found to exist.

The M. felis variant F(b) was isolated from the pharynx and bronchus of one cat with

bilateral conjunctivitis and mucopurulent ocular discharge. Although no conclusions

can be drawn from this one instance, in future it may be informative to further analyse

isolates such as this one containing nucleotide variation. Further characterisation of

the genotypic and phenotypic features of the organism, and experimental transmission

72


studies may assist to determine if the nucleotide variation contributes to any

difference in virulence of these isolates.

Compared to each other, M. felis and M. gateae/M. arginini both followed the same

pattern of prevalence and distribution across anatomical sites. In addition, the lack of

association between either group and the presence of disease in each of these sites

(conjunctiva, pharynx and bronchus), suggests they are both commensal organisms in

these sites. The results of the current study are strongly suggestive of neither M. felis

nor M. gateae/M. arginini being significantly associated with ocular or respiratory

disease in cats. It also suggests that M. felis and M. gateae/M. arginini could be

considered as inhabitants of the ocular and respiratory mucous membrane

environments.

Technical considerations of PCR-SSCP

From the initial provisional identification of mycoplasma colonies on solid media

from 134/330 samples, 129 of these were PCR positive using the primers developed

for SSCP analysis (FD1000 and Myco R). Of these, 111 were positive by SSCP

analysis. Given what was considered to be optimal conditions for PCR, some

mycoplasma appeared to be unable to be amplified, and furthermore of those that

were amplified by PCR several were unable to be analysed by SSCP.

This discrepancy may be due to bacteria identified as mycoplasmas by colony

morphology which did not belong to the genus. It would be unusual, given the

characteristic appearance of mycoplasma colonies, and the use of selective

mycoplasma media, that these were mistaken for microorganisms other than

mycoplasma. The second possibility is that they were mycoplasmas, but not

mycoplasma species that were capable of being amplified by these primers. Given the

current knowledge of mycoplasmas in the cat, this is unlikely. However, much of this

knowledge was acquired prior to the advent of molecular technologies and may be

incomplete. Thirdly, and most likely is that the negatives were false negatives due to

technical error. There may be similar explanations for the loss of samples from PCR

to SSCP, and it seems that these samples that were negative were possibly due to

technical error.

73


It was noticed during the course of these experiments that the sample DNA appeared

to degrade over time during storage at -70 ºC. This could possibly have been due to

contamination with DNAses at the time of DNA isolation although no definitive study

was performed to prove this. Therefore it may be prudent to perform PCR soon after

sample preparation. The effect of temperature and specifically the degradation was

not tested in this study, and would need to be established to determine the most

appropriate method for sample handling.

Alternatively, there may have been the carry over of inhibitors of PCR following

genomic DNA isolation. Factors inhibitory to the PCR have been reported in previous

studies, an example being those found in saliva (Ochert et al., 1994). In this study,

inhibition of the PCR was demonstrated by addition of varying concentrations of

mycoplasma media (see section 3.2.4). The heat lysis method of DNA extraction used

for the experiments yielded equivalent results to a commercial kit column purification

method during PCR optimisation (Appendix 7). Based on this it was assumed the

heat lysis method was sufficient to overcome inhibitory factors from the sample itself

or the mycoplasma media. However, this finding was based on subjective visual

assessment of PCR product on an agarose gel. Quantification of levels of PCR

product from a constant amount of genomic DNA by quantitative (real-time) PCR

would be a more sensitive method to assess inhibition and would be beneficial in

future studies.

It is possible that the results of this study underestimate the true prevalence of

mycoplasmas in the feline populations studied. In addition to the “loss of samples”

(described above) from the original number of culture-positive samples, mycoplasmas

have been isolated from up to 20% of liquid media which had not shown any obvious

change in pH within 2 weeks (Hill, 1971). Colour change of liquid media was used as

a method of screening large numbers of samples in the current study, being simple

and cost effective, and only those eliciting such change were plated on to solid media

to confirm the presence of mycoplasma colonies. However, the findings of Hill (1971)

indicate that colour change may be a relatively insensitive method for determining the

presence of mycoplasma, and implies the possibility of false negative results in the

present study. This problem may be overcome by amplifying genomic DNA directly

74


from swab samples. This method has been demonstrated to be equivalent in

sensitivity to culture (Johnson et al., 2004; Veir et al., 2008).

Some samples in this study, whether single colony or pooled, contained one or two

additional bands in their SSCP profile in addition to a typical F profile. The presence

of multiple bands, representing unique conformers of the sense and antisense strands

due to sequence variation in SSCP profiles, is a common finding in other organisms

(Gasser et al., 2006; Jex et al., 2007) and has been demonstrated in the vlhA gene of

M. synoviae (Jeffery et al., 2007). The additional bands seen in the current study most

likely represent minor nucleotide variation within species, rather than two separate

species, either as a result of the presence of natural variation, strain differences, or

infidelity of PCR. This was confirmed by nucleotide sequencing of representatives of

these variant-type profiles, which were demonstrated to be M. felis. The M. felis

variants sequenced had 98% similarity to the reference strain of M. felis, and

contained 3 nucleotide differences in this region. Analysis of variation across the

entire 16S rRNA gene or genome was beyond the scope of this study. Although exact

reasons for this variability remain uncertain, it confirms the usefulness of the SSCP

technique to detect small nucleotide differences. To resolve the uncertainty of what

the extra bands represented in this study, it would be necessary to excise them from

the gels and sequence them (Gasser, 2001). Comparison with the sequencing reactions

on the original broth culture samples corresponding to the SSCP sample could then be

made to determine the origin of the sequence variability.

In the current study no sample showed an SSCP profile consistent with the presence

of more than one mycoplasma species. As SSCP has been demonstrated to detect

multiple species or strains in a single sample based on their differing nucleotide

sequence and hence different secondary structure (Gasser et al., 2003; Chalmers et al.,

2005), it would be expected that a mixture of species should have been evident.

It is possible that the five mycoplasma colonies selected for each sample (section

2.2.2) were all one mycoplasma species even though multiple species may have been

present. The probability of selecting five colonies of one species from a plate

containing two or more species cannot be estimated without already knowing the

prevalence of each species in the population (personal communication, G. A.

75


Anderson (BAgrSc(Hons) GradDipApplStats MVSc), 2007). This is considered

unlikely, as colonies with differing morphology were not evident, which would be

expected if different species were present. Other possibilities include only one

mycoplasma species present in the site sampled, more than one species but one

present in greater numbers, or that one particular mycoplasma species was

overgrowing the others in the primary broths due to preferential culture conditions.

Although liquid media for the current study was suitable for the growth of M. felis,

evidence does not suggest that other feline species have different requirements

(Rosendal, 1979; Whitford et al., 1994). If this were the case, these studies should

have shown a much greater prevalence of M. felis in comparison with the other

species, which did not occur. However, this information relies on characterisation of

mycoplasma isolates by culture, biochemical and serologic methods prior to the

availability of molecular diagnostic techniques. This may not account for species that

have been inadvertently selected against in due to a requirement for different culture

requirements or growth conditions. The potential for such organisms has not been

excluded in the population of cats in the current study. A comparison of mycoplasma

PCR from direct swab samples in addition to cultured swab samples might resolve

this issue.

It is possible that the five mycoplasma colonies selected for each sample (section

2.2.2) were all one mycoplasma species even though multiple species may have been

present. The probability of selecting five colonies of one species from a plate

containing two or more species cannot be estimated without already knowing the

prevalence of each species in the population (personal communication, G. A.

Anderson (BAgrSc(Hons) GradDipApplStats MVSc), 2007). This is considered

unlikely, as colonies with differing morphology were not evident, which would be

expected if different species were present. Other possibilities include only one

mycoplasma species present in the site sampled, more than one species but one

present in greater numbers, or that one particular mycoplasma species was

overgrowing the others in the primary broths due to preferential culture conditions.

Although liquid media for the current study was suitable for the growth of M. felis,

evidence does not suggest that other feline species have differing requirements

(Rosendal, 1979; Whitford et al., 1994). If this were the case, there should have been

76


a much greater prevalence of this organism in comparison with the others, which did

not occur.

There were 18 samples for which the five secondary broth samples (each grown from

a single mycoplasma colony taken from the primary plates) did not produce the same

colour change as the primary broth. This may have occurred because there were

multiple species present on the plates. It is possible that the differing colony

morphology was not always evident when colonies were selected, as it can sometimes

take 7-14 days for such morphological characteristics to become apparent (Hill,

1971). However, if this were the case, then multiple species should have been evident

as mixed SSCP profiles, as discussed previously. Other possible reasons for this may

be that colour change is an insensitive method for determining species, and a single

species may induce either colour change, despite their preferred energy utilisation.

This would need to be tested further to determine whether this does in fact occur.

Without further evidence, it would seem that direct PCR on swabs with universal

primers should circumvent any problems that may occur in relation to the

mycoplasma population changing as a result of culture conditions or competition.

The species of mycoplasma determined from SSCP profile results agreed with that

expected from the colour change of the single colony secondary broth samples (there

was only one sample that differed in this respect). However the colour change

recorded from the primary broths was not consistent with that seen in the secondary

broths in 13 samples. It appears that either colour change is insensitive as a means of

presumptive species identification, or there is a shift in the mycoplasma population

occurring in the transfer of primary liquid cultures to plates and then back to broths.

The colour change is less important when molecular techniques are used as the means

of mycoplasma identification. However, to avoid the possibility of population shifts

occurring prior to PCR and SSCP, thereby influencing the study results, it would be

prudent to use direct swabs for PCR, or to directly plate the swabs on solid media, in

addition to using liquid cultures, to obtain larger amounts of DNA from single,

representative colonies.

77


Differentiation of M. gateae and M. arginini

M. gateae and M. arginini have very similar colony morphology, biochemical

characteristics, some serological cross-reactivity, and 98% sequence similarity

between them in the entire 16S rRNA gene (Hill, 1971; Brown et al., 1995). Using

molecular methods based upon the 16S rRNA gene, it was not possible in this study to

distinguish between these two species of mycoplasma.

Although the mutation detection level for SSCP can be as sensitive as 100% for

sequences of 100-200 bp (Gasser, 2001), it has also been reported that the ability to

differentiate to this level of variability may be reduced for sequences of greater than

200 bp (Gasser et al., 2006). The relative change in migration of a larger strand of

DNA with only a small change in structure would presumably be less, and hence the

ability to detect such a difference, or the sensitivity would consequently be reduced

(reviewed in (Gasser et al., 2006)). Despite this, SSCP has been demonstrated to

detect differences of 1 nucleotide in sequences of 400 bp (Jeffery et al., 2007) and

530 bp (Zhu and Gasser, 1998). However, the sensitivity of SSCP to determine such

small nucleotide differences should be dependent on the exact location of the

mutation and its effect on the resultant structure of the single-stranded DNA, and

consequently its rate of migration through a non-denaturing gel (reviewed in (Gasser

et al., 2006)). Further analysis of SSCP using reference samples of all feline

mycoplasma species, and PCR amplification of different genes other than 16S rRNA,

may improve the specificity of SSCP to differentiate unknown mycoplasma species.

The current study demonstrated that for a rapid test that clearly differentiates between

mycoplasma species rather than study variation within one species, a set of primers

that amplifies a region of the 16S rRNA gene with greater variability than one

nucleotide between species is required.

The 16S-23S intergenic spacer (IGS) region of the rRNA gene may prove to be a

suitable region, due to it being less conserved that the adjacent 16S and 23S regions.

The length of the 16S-23S IGS varies between 200-350 bp in different mycoplasma

species (Harasawa, 1999); this size should be suitable for SSCP (reviewed in (Gasser

et al., 2006)). Intergenic spacer regions of ribosomal genes have been successfully

utilised in other organisms for SSCP analysis (Gasser et al., 2003). A PCR for the

detection of M. felis was developed using this region due to its species specificity, and

78


found it to be highly conserved between different isolates of M. felis (Chalker et al.,

2004). In this same study, an alignment between the IGS of M. gateae and M. arginini

contained only 3 nucleotide differences and a possible further 6 positions of

variability due to deletions/insertions (Chalker et al., 2004). It remains to be

determined whether universal primers in a conserved region of 16S-23S IGS region

can be designed to PCR-amplify a small, sufficiently variable region from any

mycoplasma species to readily differentiate between species by SSCP.

The present study demonstrated that a large number of samples can be rapidly and

easily screened by SSCP. This method allowed sequence variation of the samples to

be displayed both within and between species. The variant M. felis profiles in this

study showed that sequence variation within a species is represented by SSCP.

Although not demonstrated in this study, SSCP may detect multiple species of

mycoplasma in a single sample. This approach would also detect variants or

previously uncharacterised species, eliminating the need to culture the organisms.

Ultimately, using suitable target DNA regions, PCR-SSCP should provide a rapid and

accurate tool for the identification of mycoplasmas to the species level compared with

currently used methods.

79


Chapter 4 General Discussion and Conclusions

The current thesis provides the first in depth investigation of the molecular

identification and prevalence of mycoplasmas in the respiratory tract of a defined

population of shelter cats. The prevalence of mycoplasma in more than 70% of the

population of shelter cats investigated in this thesis was similar to studies from many

parts of the world where cats are kept as companion animals (Heyward et al., 1969;

Blackmore et al., 1971; Schneck, 1973; Tan and Miles, 1974b; Tan et al., 1977a; Tan

et al., 1977b). Although mycoplasma has been isolated from and studied in cats from

Australia previously (Jones and Sabine, 1970; Spradbrow et al., 1970b; Malik et al.,

1991; Foster et al., 1998; Foster et al., 2004a; Foster et al., 2004b; Foster et al.,

2004c), the prevalence of these organisms had not been determined, and only a single

isolate from these studies had been identified to the species level (M. felis, (Hooper et

al., 1985)). Isolates of Mycoplasma felis and Mycoplasma gateae were identified by

nucleotide sequencing in the feline population examined in the current study, and

these two species were the most frequently recovered from cats worldwide (Heyward

et al., 1969; Blackmore et al., 1971; Tan and Miles, 1974b; Tan et al., 1977a).

Differentiating M. gateae from M. arginini has, in the past, been problematic due to

their morphological, biochemical, serological and sequence similarities (Heyward et

al., 1969; Hill, 1971; Rosendal, 1979; Razin and Freundt, 1984; Whitford et al.,

1994). Such difficulties were also encountered in the current thesis, as both were 99%

similar in the 16S rRNA gene sequence. It was not possible to unequivocally

distinguish them using the current molecular approach. This may have been avoided

during selection of primers to distinguish between the common feline mycoplasma

species. However, with further characterisation of the mycoplasma genome, a shorter

or more suitable region (with more sequence variation among species) could be used

for PCR-SSCP analysis.

The current thesis confirmed, through rigorous statistical analysis, the role of M.

gateae/M. arginini in domestic cats as commensal organisms of the conjunctiva,

oropharynx and respiratory tract. M. gateae/M. arginini were found in equivalent

numbers from both healthy and diseased cats. There was no association between the

81


presence of these organisms and disease found in the current thesis. Previous studies

have demonstrated that these organisms rarely induce a detectable immune response

in cats (Blackmore and Hill, 1973; Tan and Miles, 1974b; Tan et al., 1977a; Tan et

al., 1977b). Thus, it would seem they are not pathogenic, remain on the mucosa,

rarely crossing it and thus do not stimulate an immune response.

M. felis did not significantly differ in its frequency of isolation or anatomical

distribution from the non-pathogenic group of M. gateae/M. arginini. This, combined

with no evidence of disease association with M. felis, suggested it also is a commensal

organism of the feline conjunctiva and respiratory tract. For the first time, the current

thesis has shown that M. felis is a common inhabitant of the lower respiratory tract in

healthy cats. Although M. felis mimicked the non-pathogenic group in this study with

respect to the lack of any significant association with clinical disease, there is

serological evidence from previous literature that M. felis is recognised by the

immune system (Tan, 1974; Tan and Miles, 1974b; Tan et al., 1977a). The findings of

the current thesis highlight the need to re-examine evidence that M. felis causes

conjunctivitis and possibly also pneumonia.

There are some studies that are indicative of the presence of M. felis being associated

with disease (Cole et al., 1967; Campbell et al., 1973b; Shewen et al., 1980;

Haesebrouck et al., 1991; Randolph et al., 1993), but these studies do not

unequivocally demonstrate cause and effect of a pathogenic nature of these

microorganisms. Furthermore, there are several supportive studies showing that M.

felis has no association with disease, either as a result of its frequent isolation from

healthy cats (Heyward et al., 1969; Blackmore et al., 1971) or failing to consistently

induce disease experimentally (Cello, 1957; Blackmore and Hill, 1973; Lappin et al.,

2007). M. felis has been associated with disease from cats that are immunosuppressed

or have underlying diseases (Cello, 1957; Hooper et al., 1985), implying an

opportunistic role of this microorganism in inducing disease.

There has been a single study with substantial evidence for pathogenicity by M. felis

(Tan, 1974). In this study, conjunctivitis was observed following the instillation of a

strain of M. felis from a kitten with conjunctivitis into the eyes and nose of healthy

kittens. Serum antibodies to M. felis were detected in these kittens following

82


inoculation. The absence in these kittens of other bacteria and viruses, the

development of disease post inoculation, the organism being re-isolated from the

kittens, and the serological response provided evidence for pathogenicity. However,

the control kittens in the study also produced a low-level antibody response to M. felis

(likely due to transmission from the inoculated cats in adjacent cages), but no clinical

disease was evident in the control kittens; thus, natural transfer of M. felis did not

produce clinical disease in healthy kittens. The results of the present thesis also

suggest that M. felis, in the natural state, is not sufficiently virulent to delineate

clinical disease caused by this organism from other causes of upper respiratory tract

and ocular diseases.

In contrast to the study by Tan (1974), Blackmore and Hill (1973) did not find a link

between M. felis and overt clinical disease or seroconversion. This may indicate that

there were other confounding factors in the study by Tan (1974) and may explain why

there was a lack of disease induced in SPF cats, since in this one study where severe

disease was produced, the cats were not SPF. Disease might be the result of co-

infection with other known pathogens which breach the mucosa or produce mucosal

damage permitting exposure of mycoplasma to the immune system, in spite of the

authors’ comment that the cats were tested for non-specified viruses and bacteria.

In conclusion, M. felis may be pathogenic in the broad sense, but is in all probability

of very low virulence. Although no evidence of variation in virulence between

different isolates or strains of M. felis has yet been demonstrated, the variation in

disease and the seroconversion of cats experimentally infected with M. felis suggest

that different “strains” may occur. It may be that there are different strains within each

of the currently described mycoplasma species with differing levels of virulence, such

as those of isolates of M. hyopneumoniae known to infect pigs (Meyns et al., 2007).

This proposal may account for some differences in findings among studies in which

no association of mycoplasma and disease was apparent. However, there are other

possible reasons for these discrepancies that have not yet been addressed, the most

important of which is the presence of other ocular or respiratory pathogens.

Ideally, to definitively determine a pathogenic role of feline mycoplasmas, disease

should be consistently produced by experimental transmission of suspected virulent

83


M. felis isolated from diseased cats into SPF cats. In addition, an unequivocal increase

in antibody titres in paired samples would also provide evidence for infection. The

multifactorial nature of mycoplasmal disease in species other than cats, and the multi-

agent nature of respiratory disease make such studies difficult. Even for species that

are considered primary pathogens, such as M. mycoides subsp. mycoides, as the

causative agent of Contagious Bovine Pleuropneumonia, Koch’s postulates have not

been fulfilled, and many species that are accepted as pathogens can also be found in

apparently healthy hosts (reviewed in (Cassell et al., 1985)). With such limited

knowledge of the factors involved, such as structural and functional components or

genetic makeup that determine pathogenicity of mycoplasmas, the specific ways these

organisms interact with the host immune system and other environmental influences,

it is incredibly difficult to conclusively determine a defined role in disease.

As the species of mycoplasma isolated in the current thesis were present in the

conjunctiva, upper and lower respiratory tract, it would reasonable to expect to

encounter disease associated with its presence in these locations if these organisms

were sufficiently virulent. As there was no clinical or post mortem evidence of ocular

or respiratory disease being significantly associated with the isolation of mycoplasmas

at the respective anatomical sites, it appears that the species present in this population

of cats were not pathogenic. However the possibility that some of these isolates may

be pathogenic to particular animals in other situations cannot be excluded. Serological

methods may have been useful to assist the determination of any past or present

evidence of an immune response to these organisms. The majority of cats in the

current thesis were adult, which may bias results given initial infection usually occurs

in young cats during first contact with mycoplasma and may result in clinical signs of

disease. These young individuals may recover and become carriers of the organism

which are then commensal organisms with the potential to become opportunistic

invaders under favourable conditions.

It is possible that both groups of mycoplasma species isolated in the current thesis

may be opportunistic pathogens, which under certain conditions, such as damage to

the respiratory epithelium by other respiratory pathogens, stress or other disease

leading to immune compromise, they may further contribute to disease or initiate

damage or disease themselves as opportunists. Currently, there is no direct evidence

84


for such occurrences. There is some evidence from both case reports (Campbell et al.,

1973b; Moise et al., 1983; Hooper et al., 1985; Malik et al., 1991; Walker et al.,

1995; Foster et al., 1998; Chandler and Lappin, 2002; Barrs et al., 2005; Liehmann et

al., 2006) and experimental transmission studies (Cello, 1957; Moise et al., 1983)

where the presence of immune compromise or underlying disease is frequently

associated with disease involving mycoplasma in cats. Therefore, it would appear to

be more a lack of host defences than virulent features of the organisms allowing this

opportunism. There is scant evidence showing mycoplasma is associated with disease

in conjunction with other ocular or respiratory pathogens, as they have not often been

concurrently recovered, and because as clearly demonstrated in the current thesis, the

presence of mycoplasma does not indicate involvement in disease.

The current thesis found no association of mycoplasma with ocular or respiratory

disease in the study population. Greater study population numbers may enhance subtle

differences; however this study of 110 cats showed no significant differences. The

group numbers are considered sufficient to show any major or obvious associations,

such as primary pathogenicity. However the small number of juvenile animals and

diseased cats in the present study may be a contributing factor to some of the

contrasting results of previous studies (e.g., (Cole et al., 1967; Tan and Markham,

1971b; Campbell et al., 1973b; Tan, 1974; Tan and Miles, 1974b; Haesebrouck et al.,

1991; Randolph et al., 1993; Foster et al., 2004b; Bannasch and Foley, 2005; Low et

al., 2007)). Different sampling methods and locations may account for some of the

discrepencies between studies. Differences may also be apparent at other times of the

year, between years, or where relationships with other respiratory pathogens or

viruses affecting immune function exist. Further work may be indicated to define

these variables.

The use of PCR-SSCP as a means for rapidly screening large numbers of mycoplasma

samples for genetic variation was demonstrated in the current thesis. With further

validation and standardisation SSCP could provide clear advantages over currently

used techniques of identification, being more rapid than culture to perform, and being

able to detect organisms that may be slow growing or difficult to recover via culture.

PCR and SSCP have the potential to overcome some of the limitations of serological

methods of identification such as serological cross reactivity and antigenic variation

85


among mycoplasma species (Heyward et al., 1969; Brown et al., 1995), and eliminate

the requirement for experimental animals to produce antisera. Additionally, they have

the potential for applications beyond the identification of mycoplasmas. The

technique could be used to detect multiple species present in samples which has been

demonstrated previously for Cryptosporidium (Chalmers et al., 2005). It has also been

utilised to genetically characterise regions associated with virulence, such as the vlhA

gene in M. synoviae (Jeffery et al., 2007). It may be more accurate and rapid than

approaches such as PCR-RFLP as one gel can determine species present in a range of

samples, compared with performing an algorithm of digests. In addition, sequence

variation can be detected across a region of 100 to 500 bp, compared with only a few

nucleotides of the endonuclease cleavage regions. Further sequencing and analysis of

mycoplasma genomes is required to identify DNA targets better suited for use in

PCR-SSCP analysis for species identification or identification of virulence factors in

isolates.

A major strength of the current thesis in clarifying the role of mycoplasmas in feline

ocular and respiratory disease is the use of rigorous statistical analysis. These analyses

comparing M. felis with the non-pathogenic species of mycoplasma demonstrated no

significant difference in prevalence, distribution, or association with disease between

groups, and provided evidence to support the proposal that they are not pathogenic

under normal circumstances. Additionally, this study demonstrated important

ecological characteristics of the organisms in the statistical comparison of

mycoplasma species and anatomical sites they were isolated from. It clearly

demonstrates that the isolation of mycoplasma from the conjunctiva or any part of the

respiratory tract of a cat is not sufficient evidence to implicate a causative role in

disease. In contrast, a number of studies have demonstrated a positive association

between the isolation of mycoplasmas with ocular and respiratory disease (Randolph

et al., 1993; Bannasch and Foley, 2005; Low et al., 2007), whereas previous reports

of the prevalence of mycoplasma in feline population studies have been limited in

their ability to make conclusions as to the significance of mycoplasma isolation by the

lack of statistical analysis in determining any association with disease (Blackmore et

al., 1971; Schneck, 1973; Tan and Miles, 1974b; Tan et al., 1977b; Haesebrouck et

al., 1991).

86


The findings of the current thesis make an important contribution to both the overall

epidemiological context of feline mycoplasmas, and also the means to identify them

to the species level using PCR-based techniques. With continuing research into

mycoplasmas of cats and other species, more detail will emerge as to the specific

mechanisms by which mycoplasmas interact with their hosts and the conditions under

which disease may occur. Future research should focus on establishing any direct

evidence for pathogenicity in mycoplasmas isolated from cats in which they are

thought to relate to disease. Isolates should then be investigated by performing

experimental transmission studies in SPF cats. For any species or strains for which

such pathogenic potential is evident, additional studies should be undertaken to

characterise, compare and contrast the genetic and functional makeup of these

organisms to better understand the genetic correlates of virulence.

It has been suggested that the role of mycoplasmas in disease may well be influenced

by a deficiency in the host’s defence mechanism more so than the attributes of the

organism (Whitford and Lingsweiler, 1994). Therefore, it may be equally important to

determine the place of mycoplasma in the complex aetiology of respiratory disease,

such that it can be determined when these organisms change from being commensals

to opportunistic pathogens. This is not simple due to the multitude of factors that may

influence such a process in any individual. The value of the current thesis is that it

shows mycoplasmas are often present in the lower respiratory tract, which should

initiate future case studies of feline respiratory disease to genetically characterise the

mycoplasma isolated beyond the species level. Furthermore, it may be possible, using

cats with resident mycoplasmal flora in the lower respiratory tract, to introduce

respiratory viruses, and measure mycoplasma numbers over the course of disease,

while monitoring serological responses. There may also be benefits in determining

whether viruses, such as feline immunodeficiency virus (FIV) and feline leukaemia

virus (FeLV), by reducing immune competence, influence mycoplasma numbers or

behaviour in their hosts. Such studies may not only provide new information

regarding the way mycoplasmas interact with their hosts, but aid the clinical

management of such diseases.

Perhaps a true symbiotic relationship exists between some species of mycoplasma

such as M. gateae and M. arginini and their hosts. The benefits of such an association

87


for the mycoplasmas are obvious; warmth, protection and nutrition for organisms that,

without cell walls are sensitive to changes in environmental conditions, and with a

relatively limited capacity for synthesis of nutrients. However, for the hosts,

mycoplasmas may provide a degree of protection to the host from other pathogenic

organisms, which must compete for attachment surfaces and nutrients with the

established resident population. In the least, it may be a commensal relationship,

advantageous for the organism, which in turn does not cause undue harm to the host,

and perhaps does not come into close contact with the immune system. Even for other

resident mycoplasma species, such as M. felis, which may breach the mucosa and

come into contact with the immune system, this low level pathogenicity may not be

sufficient to cause clinical disease to the host under normal circumstances. This would

reinforce the true opportunistic nature of these organisms as pathogens, as there must

be other factors involved for disease to occur.

Relatively few of the mycoplasma species characterised to date are primary

pathogens. It may only be those mycoplasma species that have not evolved in

association with that particular host to the same degree as commensal organisms that

are the pathogens, with selective pressures reducing or eliminating virulence factors

over time. It seems possible that periodically, more virulent mycoplasma that possess

pathogenic characteristics emerge, being associated with disease. However, the vast

majority of mycoplasmas appear to remain as minimally-virulent, commensal

organisms. Future studies are needed to investigate pathogenic isolates to elucidate

the true role of mycoplasma infection in cats.

88


Chapter 5 Appendices

5.1 Appendix 1: Data Collection Sheet

89


5.2 Appendix 2: Liquid mycoplasma media

90


5.3 Appendix 3: Mycoplasma agar formulation

91


5.4 Appendix 4: Calculating the binomial distribution

Calculation of the expected number of cats with differing numbers of mycoplasma-

positive sites using a binomial distribution (Snedecor and Cochran, 1978):

For the trial; S (success) = sample is positive

F (failure) = sample is negative

In a single drawing; p = probability of obtaining S

q = 1-p = probability of obtaining F

Formula for probability of r successes in n trials; ( n r)p r q n-r

p = probability of a site being mycoplasma-positive

p = total number of positive samples / total number of samples

p = 134 / 110 cats x 3 anatomic sites

p = 134/330

p = 0.406

q = probability of a site being mycoplasma-negative

q = 1-p

q = 1 – 134/330

q = 196/330

q = 0.594

92


Number of

positive sites

Probability Expected number

of cats (E)

0 q 3 (0.594) 3 x 110 23.05

1 3pq 2 3 x (0.406) x

(0.594) 2 x 110

2 3p 2 q 3 x (0.406) 2 x

(0.594) x 110

(E)

47.27

32.33

3 p 3 (0.406) 3 7.36

The chi-squared test is then used to determine if there is a statistically significant

difference between the observed number of cats with a certain number of positive

sites (O), and the expected number (E), calculated above.

χ 2 = (O-E) 2 /E

To determine the degrees of freedom (df) needed in order to calculate a P-value

(Snedecor and Cochran, 1980):

df = (number of classes) – (number of estimated parameters) – 1

df = 4 – 1 – 1

df = 2

(where p is estimated from the data)

93


5.5 Appendix 5: Protocol for DNA extraction by heat lysis method

1. Place microcentrifuge tubes in a rack for the number of samples and 2 controls

2. For each sample, using new tips each time: place 500 µl of broth in a

microcentrifuge tube

3. Centrifuge for 5 min at maximum speed in centrifuge

4. Discard the supernatant. Remove any residual supernatant with a pipette

5. Using new tips each time resuspend the cell pellet in 500 µl of PBS*

6. Centrifuge for 5 min at maximum speed in centrifuge

7. Discard the supernatant

8. Using new tips each time resuspend the cell pellet in 20 µl of deionised sterile

water

9. Heat the tubes at 95 ºC for 5 min

10. Place tubes on ice

*PBS – Phosphate Buffered Saline

Modified from: The University of Melbourne Veterinary Science Department Asia

Pacific Centre for Animal Health, Standard Operating Procedure number

MYCO/PCR/01: A PCR protocol for the detection of Mycoplasma gallisepticum and

M. synoviae. Written by Jill Jones on 6/7/00.

94


5.6 Appendix 6: Alignment of feline mycoplasma species in the region amplified

by primers FD1000 and MycoR

Position 1021 1031 1041 1051 1061 1071 1081 1091

Consensus TGACAGATGGTGCATGGTTGTCGTCAGCTCGTGTCGTGAGATGTTCGGTTAAGTCCTGCAACGAGCGCAACCCTTA--TC

M.arginini .............................................T...C.......................C......

M.gateae .............................................T...C.......................C......

M.felifaucium ................................................................................

M.leopharyngis .......................C........................................................

M.simbae .......................C...T................C.............A..............C.G....

M.felis ...........................................................................GGTC.

M.leocaptivus ............................................A..C......G.CAT................-.T..

M.feliminutum GT....G...................-..................G..........C..............T.......T

Position 1101 1111 1121 1131 1141 1151 1161 1171

Consensus TTAGTTACTA C-ATT A T -G ACTCTAG GAGACTGCC GAGT-AATCGGGAGGAAGGTGGGGACGACGTCAAA

M.arginini T..........A.G.G.C.TG.CGA.G.......A..T......T.G.....CT................T.........

M.gateae T..........A.G.G.C.TG.CGA.G.......A..T......T.G.....C.................T.........

M.felifaucium C..........C....NT.GT.GAT.G......AG......N..C...................................

M.leopharyngis C..........C.....A.GT.GA..G......AG.........G.........C.........................

M.simbae C..........A.....T.GNGGA..C......AG.........C..C................................

M.felis C.......AA---.-.AT------.----.....G.........C........T..........................

M.leocaptivus T.......A----.-..T------.----.T...A..TN.....CA.......T..........C....N..........

M.feliminutum GC..T..G.C.G.....C.GT.GG..A...A...T.........A.T.AC..A.T..........A..A.T.........

Position 1181 1191 1201 1211 1221 1231 1241 1251

Consensus T-CATCATGCCTCTTACGAGTGGGGCAACACACGTGCTACAATGG CGGTACAAAGAGAAGCAA ATGG GACATGG-AG

M.arginini .............................................T..................T....C..........

M.gateae .............................................T..................T....C..........

M.felifaucium ..........................T..................C..................ACA..C...TG.....

M.leopharyngis ..........................T..................A.A................A....T.....CA...

M.simbae .T.......................................G...C.......C..C..C.G.CAC...A....GA.C..

M.felis .............................................AT.................T.C..C...G.N....

M.leocaptivus .............................................A..................T..A.T..T.......

M.feliminutum ...........C....T..CCT....T...A.....A........TT.A.......G.....C.A.GC.T..GC......

Position 1261 1271 1281 1291 1301 1311 1321 1331

Consensus CAAATCTCAAAAAACCG TCTCAGTTCGGATTG AGTCTGCAACTCGACT CATGAAGTCGGAATCGCTAGTAATCGTAG

M.arginini .............G...A...............G.........T......C..........................C..

M.gateae .............G...A...............G.........T......C..........................C..

M.felifaucium ....C............G...............A................T.............................

M.leopharyngis ....C..........T.T...............A................T........T....................

M.simbae ....C.A......G...G...............GC.......N.......C.............................

M.felis ................AT...............T................A.............................

M.leocaptivus .................T...............T................A.............................

M.feliminutum ......C..G....A.AA..C............A................T.......C..................C.A

Position 1341 1351 1361 1371 1381 1391 1401 1411

Consensus ATCAGCTACGCT CGGTGAATACGTTCTCGGGTCTTGTACACACCGCCCGTCA ACCATGGGAGCTGGTAATGCCCGAAG

M.arginini ............G........................................C..................A...A...

M.gateae ............G........................................C..................A...A...

M.felifaucium ............N........................................A..........................

M.leopharyngis ............A........................................A..........................

M.simbae ............A..................T..............N......A..........................

M.felis ............A........................................C..........................

M.leocaptivus ............A........................................C..........................

M.feliminutum .....A-...T.G.................A.GT...C...............A....C.AA..T.TA....A...A..A

Position 1421 1431 1441 1451 1461 1471

Consensus TCGGTTT -TAAC --A GGAG AACTGCCTAAGGCAGGACTGGTGACTGGGGTT -

M.arginini ......AGC.....C..TC....GCG..C........T..................GA.

M.gateae ......AGC.....C..TC....GCG..C........T..................GA.

M.felifaucium .......A-....AG...-------................................A.

M.leopharyngis .......A-....AG...-------................................-.

M.simbae .......A-....AC...-------................................-.

M.felis .......TGT....T...C....AC................G.C...........G.GA

M.leocaptivus .......TGT....T...C....AC................G.C...........-.G.

M.feliminutum C....GGTC.....CGT.A....GG.G.C.T......T...GTAAA...T.......A.

95


5.7 Appendix 7: Comparison of DNA extraction method and influence of

culture media in samples by relative intensity of PCR products visualised

on agarose gel

Sample (M. felis) extraction

method

Presence of

mycoplasma media

(% volume)

Relative intensity

(visual)

Column purification - +++

Column purification + media

(100%)

+ +

Heat extraction method - +++

Heat extraction method (no

heating step)

- +

Heat extraction method + media + (25%) ++

Heat extraction method + media + (50%) +

Heat extraction method + media + (75%) +

Heat extraction method + media + (100%) +

Water + media negative control + (100%) -

Water-only negative control - -

PCR with primer pair FD1000 and MycoR as per protocol outlined in section 3.2.4

96


5.8 Appendix 8: DNA purification protocol

Modified as follows from Wizard® PCR Preps DNA Purification System Protocol

(Promega, Madison, Wisconsin, USA, http://www.promega.com):

1. Add 50 µl purificator in with PCR product

2. Attach column to 1.5 ml microcentrifuge tube

3. Attach 5 ml syringe barrel – set plunger aside

4. Add 500 µl resin into syringe, and add product

5. Use syringe plunger to push through column, discard

6. Remove plunger

7. Add 2 mL 80% isopropanol and plunge through column, discard

8. Spin briefly into microcentrifuge tube – discard tube

9. Place column into new tube

10. Add 35 µl deionised water, pre-warmed to 70 °C to elute

11. Spin briefly in centrifuge

12. Discard column – keep eluted DNA in tube

97


Chapter 6 References

Abramson, J.H. (2004). WINPEPI (PEPI-for-Windows): Computer programs for

epidemiologists. Epidemiolgic Perspectives & Innovations 1, 6.

Adamson, D. (2004). Retrobulbar Abscess, Kitten. In: Pediatrics and Geriatrics

Folder: Veterinary Information Network, Inc.,

http://www.vin.com/Members/SearchDB/Boards/BO325000/BO323431.htm.

Bannasch, M.J., and Foley, J.E. (2005). Epidemiologic evaluation of multiple

respiratory pathogens in cats in animal shelters. Journal of Feline Medicine and

Surgery 7, 109-119.

Barrs, V.R., Allan, G.S., Beatty, J.A., and Malik, R. (2005). Feline pyothorax: a

retrospective study of 27 cases in Australia. Journal of Feline Medicine and Surgery

7, 211-222.

Bart, M., Guscetti, A., Zurbriggen, A., Pospischil, A., and Schiller, I. (2000). Feline

infectious pneumonia: A short literature review and a retrospective

immunohistological study on the involvement of Chlamydia spp. and Distemper virus.

The Veterinary Journal 159, 220-230.

Baskerville, A. (1981). Mechanisms of infection in the respiratory tract. New Zealand

Veterinary Journal 29, 235-238.

Bemis, D.A. (1992). Bordetella and Mycoplasma respiratory infections in dogs and

cats. Veterinary Clinics of North America: Small Animal Practice 22, 1173-1186.

Binns, S.H., Dawson, S., Speakman, A.J., Cuevas, L.E., Hart, C.A., Gaskell, C.J.,

Morgan, K.L., and Gaskell, R.M. (2000). A study of feline upper respiratory tract

disease with reference to prevalence and risk factors for infection with feline

calicivirus and feline herpesvirus. Journal of Feline Medicine and Surgery 2, 123-133.

99


Blackmore, D.K., and Hill, A. (1973). The experimental transmission of various

mycoplasmas of feline origin to domestic cats (Felis catus). Journal of Small Animal

Practice. 14, 7-13.

Blackmore, D.K., Hill, A., and Jackson, O.F. (1971). The incidence of mycoplasma in

pet and colony maintained cats. Journal of Small Animal Practice 12, 207-216.

Bonilla, H.F., Chenoweth, C.E., Tully, J.G., Blythe, L.K., Robertson, J.A.,

Ognenovski, V.M., and Kauffman, C.A. (1997). Mycoplasma felis septic arthritis in a

patient with hypogammaglobulinemia. Clinical Infectious Diseases 24, 222-225.

Bradbury, J.M. (2005). Poultry mycoplasmas: sophisticated pathogens in simple

guise. British Poultry Science 46, 125-136.

Brown, D.R., McLaughlin, G.S., and Brown, M.B. (1995). Taxonomy of the feline

mycoplasmas Mycoplasma felifaucium, Mycoplasma feliminutum, Mycoplasma felis,

Mycoplasma gateae, Mycoplasma leocaptivus, Mycoplasma leopharyngis, and

Mycoplasma simbae by 16S rRNA gene sequence comparisons. International Journal

of Systematic Bacteriology. 45, 560-564.

Brown, D.R., Whitcomb, R.F., and Bradbury, J.M. (2007). Revised minimal standards

for description of new species of the class Mollicutes (division Tenericutes).

International Journal of Systematic and Evolutionary Micorbiology 57, 2703-2719.

Brown, M.B., Gionet, P., and Senior, D.F. (1990). Identification of Mycoplasma felis

and Mycoplasma gateae by an immunobinding assay. Journal of Clinical

Microbiology. 28, 1870-1873.

Campbell, L.H., Fox, J.G., and Snyder, S.B. (1973a). Ocular bacteria and

mycoplasma of the clinically normal cat. Feline Practice 3, 10-12.

Campbell, L.H., Snyder, S.B., Reed, C., and Fox, J.G. (1973b). Mycoplasma felis -

associated conjunctivitis in cats. Journal of the American Veterinary Medical

Association 163, 991-995.

100


Carman, S., Rosendal, S., Huber, L., Gyles, C., McKee, S., Willoughby, R.A.,

Dubovi, E., Thorsen, J., and Lein, D. (1997). Infectious agents in acute repiratory

disease in horses in Ontario. Journal of Veterinary Diagnostic Investigation 9, 17-23.

Cartner, S.C., Lindsey, J.R., Gibbs-Erwin, J., Cassell, G.H., and Simecka, J.W.

(1998). Roles of innate and adaptive immunity in respiratory mycoplasmosis.

Infection and Immunity 66, 3485-3491.

Cassell, G.H., Clyde, W.A.J., and Davis, J.K. (1985). Mycoplasmal respiratory

infections. In: The Mycoplasmas IV: Mycoplasma Pathogenicity, vol. 4, eds. S. Razin

and M.F. Barile, Orlando: Academic Press, Inc., 65-106.

Cello, R.M. (1957). Association of pleuropneumonialike organisms with

conjunctivitis of cats. American Journal of Ophthalmology 43, 296-297.

Chalker, V.J., Owen, W.M.A., Paterson, C.J.I., and Brownlie, J. (2004). Development

of a polymerase chain reaction for the detection of Mycoplasma felis in domestic cats.

Veterinary Microbiology 100, 77-82.

Chalmers, R.M., Ferguson, C., Caccio, S., Gasser, R.B., Abs EL-Osta, Y.G., Heijnen,

L., Xiao, L., Elwin, K., S., H., Sinclair, M., and Stevens, M. (2005). Direct

comparison of selected methods for genetic characterisation of Cryptosporidium

parvum and Cryptosporidium hominis species. International Journal for Parasitology

35, 397-410.

Chandler, J.C., and Lappin, M.R. (2002). Mycoplasmal respiratory infections in small

animals: 17 cases (1988-1999). Journal of the American Animal Hospital Association

38, 111-119.

Cohn, L.A., and Reinero, C.R. (2007). Respiratory defences in health and disease.

Veterinary Clinics of North America: Small Animal Practice 37, 845-860.

Cole, B.C., Golightly, L., and Ward, J.R. (1967). Characterization of Mycoplasma

strains from cats. Journal of Bacteriology 94, 1451-1458.

101


Cole, B.C., and Ward, J.R. (1979). Mycoplasmas as arthritogenic agents. In: The

Mycoplasmas II: Human and animal Mycoplasmas, vol. 2, eds. J.G. Tully and R.F.

Whitcomb, New York: Academic Press Inc., 367-398.

Cole, B.C., Washburn, L.R., and Taylor-Robinson, D. (1985). Mycoplasma-induced

arthritis. In: The Mycoplasmas IV: Mycoplasma pathogenicity, vol. 4, eds. S. Razin

and M.F. Barile, Orlando: Academic Press Inc., 107-160.

Crisp, M.S., Birchard, S.J., Lawrence, A.E., and Fingeroth, J. (1987). Pulmonary

abscess caused by a Mycoplasma sp in a cat. Journal of the American Veterinary

Medical Association 191, 340-342.

Crissman, J.W. (1986). Mycoplasma gateae arthritis in the cat. Dissertation Abstracts

International - B 47, 2382.

Cross, C. (2004). Mycoplasma cultured from a cat with chronic ear infections and ear

polyps. In: Internal Medicine - Feline Folder: Veterinary Information Network, Inc.,

http://www.vin.com/Members/SearchDB/Boards/BO315000/BO314478.htm.

Dawson, S., and Willoughby, K. (1999). Feline infectious upper respiratory tract

disease - an update. In Practice 21, 232-237.

Day, M.J. (2007). Immune system development in the dog and cat. Journal of

Comparative Pathology 137, S10-S15.

DeBey, M.C., and Ross, R.F. (1994). Ciliostasis and loss of cilia induced by

Mycoplasma hyopneumoniae in porcine tracheal organ cultures. Infection and

Immunity 62, 5312-5318.

Deng, S., Hiruki, C., Robertson, J.A., and Stemke, G.W. (1991). Detection by PCR

and differentiation by restriction fragment length polymorphism of Acholeplasma,

Spiroplasma, Mycoplasma, and Ureaplasma, based upon 16S rRNA genes. PCR

Methods and Applications 1, 202-204.

102


Dohoo, I., Martin, W., and Stryhn, H. (2003). Mixed models for discrete data. In:

Veterinary Epidemiologic Research, eds. I. Dohoo, W. Martin, and H. Stryhn,

Charlottetown: AVC Inc., 499-520.

du Moulin, G.G., and Love, W. (1988). The value of autopsy microbiology. Clinical

Microbiology Newsletter 10, 165-167.

Dye, J.A., McKiernan, B.C., Rozanski, E.A., Hoffman, W.E., Losonsky, J.M.,

Homco, L.D., Wesiger, R.M., and Kakoma, I. (1996). Bronchopulmonary disease in

the cat: historical, physical, radiographic, clinicopathologic, and pulmonary functional

evaluation of 24 affected and 15 healthy cats. Journal of Veterinary Internal Medicine

10, 385-400.

Edward, D.G. (1947). A selective medium for pleuropneumonia-like organisms.

Journal of General Microbiology 1, 238-243.

Ellis, T.M. (1981). Feline respiratory virus carriers in clinically healthy cats.

Australian Veterinary Journal 57, 115-118.

Fernald, G.W. (1979). Humoral and cellular immune responses to mycoplasmas. In:

The Mycoplasmas II: Human and animal mycoplasmas, vol. 2, eds. J.G. Tully and

R.F. Whitcomb, New York: Academic Press Inc., 399-423.

Foster, S.F., Allan, G.S., Martin, P., Robertson, I.D., and Malik, R. (2004a). Twenty-

five cases of feline bronchial disease (1995-2000). Journal of Feline Medicine and

Surgery 6, 181-188.

Foster, S.F., Barrs, V.R., Martin, P., and Malik, R. (1998). Pneumonia associated with

Mycoplasma spp in three cats. Australian Veterinary Journal. 76, 460-464.

Foster, S.F., Martin, P., Allan, G.S., Barrs, V.R., and Malik, R. (2004b). Lower

respiratory tract infection in cats: 21 cases (1995-2000). Journal of Feline Medicine

and Surgery 6, 167-180.

103


Foster, S.F., Martin, P., Braddock, J.A., and Malik, R. (2004c). A retrospective

analysis of feline bronchoalveolar lavage cytology and microbiology (1995-2000).

Journal of Feline Medicine and Surgery 6, 189-198.

Frey, M.L., Thomas, G.B., and Hale, P.A. (1973). Recovery and identification of

Mycoplasmas from animals. Annals of the New York Academy of Sciences 225, 334-

346.

Gaskell, R.M., and Bennett, M. (1996). Feline infectious respiratory disease. In:

Feline and canine infectious diseases, Oxford: Blackwell Science, 3-28.

Gasser, R.B. (1997). Mutation scanning methods for the analysis of parasite genes.

International journal for parasitology 27, 1449-1463.

Gasser, R.B. (2001). Identification of parasitic nematodes and study of genetic

variability using PCR approaches. In: Parasitic Nematodes: Molecular biology,

biochemistry and immunology, eds. M.W. Kennedy and W. Harnett, Wallingford:

CAB International, 53-82.

Gasser, R.B., Abs EL-Osta, Y.G., and Chalmers, R.M. (2003). Electrophoretic

analysis of genetic variability within Cryptosporidium parvum from imported and

autochthonous cases of human Cryptosporidiosis in the United Kingdom. Applied and

Environmental Microbiology 69, 2719-2730.

Gasser, R.B., and Chilton, N.B. (2001). Applications of single-strand conformation

polymorphism (SSCP) to taxonomy, diagnosis, population genetics and molecular

evolution of parasitic nematodes. Veterinary Parasitology 101, 201-213.

Gasser, R.B., Hu, M., Chilton, N.B., Campbell, B.E., Jex, A.J., Otranto, D., Cafarchia,

C., Beveridge, I., and Zhu, X. (2006). Single-strand conformation polymorphism

(SSCP) for the analysis of genetic variation. Nature Protocols 1, 3121-3128.

Gil, J.C., Cedillo, R.L., Mayagoitia, B.G., and Paz, M.D. (1993). Isolation of

Mycoplasma pneumoniae from asthmatic patients. Annals of Allergy 70, 23-25.

104


Goldsby, R.A., Kindt, T.J., Osborne, B.A., and Kuby, J. (2003). Immune response to

infectious diseases. In: Immunology, New York: W.H. Freeman and Company, 389-

412.

Goll, F., Jr. (1994). Identification of Mycoplasmas isolated from domestic animals.

In: Mycoplasmosis in animals: Laboratory diagnosis, eds. H.W. Whitford, R.F.

Rosenbusch, and L.H. Lauerman, Ames: Iowa State University Press, 15-30.

Gray, L.D., Ketring, K.L., and Tang, Y.W. (2005). Clinical use of 16S rRNA gene

sequencing to identify Mycoplasma felis and M. gateae associated with feline

ulcerative keratitis. Journal of Clinical Microbiology 43, 3431-3434.

Gulbahar, M.Y., and Gurturk, K. (2002). Pyothorax associated with a Mycoplasma sp

and Arcanobacterium pyogenes in a kitten. Australian Veterinary Journal 80, 344-

345.

Gushchin, A.E., Taganov, K.D., Topol', I., and Govorun, V.M. (1998). Use of a

method of single-stranded DNA fragment confomation polymorphism (SSCP) for

detecting resistance of Mycoplasma hominis to fluoroquinolones. Molikuliarnaia

genetika, mikrobiologiia i virusologiia 4, 37-40.

Haesebrouck, F., Devriese, L.A., van Rijssen, B., and Cox, E. (1991). Incidence and

significance of isolation of Mycoplasma felis from conjunctival swabs of cats.

Veterinary Microbiology. 26, 95-101.

Harasawa, R. (1999). Genetic relationships among Mycoplasmas based on the 16S-

23S rRNA spacer sequence. Microbiology and Immunology 43, 127-132.

Hartmann, A.D., Helps, C.R., Lappin, M.R., Werckenthin, C., and Hartmann, K.

(2008). Efficacy of pradofloxacin in cats with feline upper respiratory tract disease

due to Chlamydophila felis or Mycoplasma infections. Journal of Veterinary Internal

Medicine 22, 44-52.

Hayflick, L. (1965). Tissue cultures and Mycoplasmas. Texas Reports on Biology and

Medicine 23, 285-303.

105


Heyward, J.T., Sabry, M.Z., and Dowdle, W.R. (1969). Characterization of

Mycoplasma species of feline origin. American Journal of Veterinary Research. 30,

615-622.

Hill, A. (1971). Further studies on the morphology and isolation of feline

mycoplasmas. Journal of Small Animal Practice. 12, 219-223.

Hill, A. (1975). Comparison of mycoplasmas isolated from captive wild felines.

Research in Veterinary Science 18, 139-143.

Hill, A.C. (1992). Mycoplasma simbae sp. nov., Mycoplasma leopharyngis sp. nov.,

and Mycoplasma leocaptivus sp. nov., isolated from lions. International Journal of

Systematic Bacteriology 42, 518-523.

Hooper, P.T., Ireland, L.A., and Carter, A. (1985). Mycoplasma polyarthritis in a cat

with probable severe immune deficiency. Australian Veterinary Journal 62, 352.

Huang, X. (1992). A contig assembly program based on sensitive detection of

fragment overlaps. Genomics 14, 18-25.

Huebner, J., Muller, E., Buttner, K., and Langbein-Detsch, I. (2007). "Cat flu" -

Which organisms play a major role in feline respiratory disease? Research abstract

program of the 25th annual ACVIM Forum, Seattle, WA, published in Journal of

Veterinary Internal Medicine 21, 628.

Jeffery, N., Gasser, R.B., Steer, P.A., and Noormohammadi, A.H. (2007).

Classification of Mycoplasma synoviae strains using single-strand conformation

polymorphism and high-resolution melting-curve analysis of the vlhA gene single-

copy region. Microbiology 153, 2679-2688.

Jex, A.J., Whipp, M., Campbell, B.E., Caccio, S., Stevens, M., Hogg, G., and Gasser,

R.B. (2007). A practical and cost-effective mutation scanning-based approach for

investigating genetic variation in Cryptosporidium. Electrophoresis 28, 3875-3883.

106


Johnson, L.R., Drazenovich, N.L., and Foley, J.E. (2004). A comparison of routine

culture with polymerase chain reaction technology for the detection of Mycoplasma

species in feline nasal samples. Journal of Veterinary Diagnostic Investigation 16,

347-351.

Johnson, L.R., Foley, J.E., De Cock, H.E., Clarke, H.E., and Maggs, D.J. (2005).

Assessment of infectious organisms associated with chronic rhinosinusitis in cats.

Journal of the American Veterinary Medical Association 227, 579-585.

Johnson, L.R., and Kass, P.H. (2009). Effect of sample colletion methodology on

nasal culture results in cats. Journal of Feline Medicine and Surgery In press.

Johnsrude, J.D., Christopher, M.M., Lung, N.P., and Brown, M.B. (1996). Isolation of

Mycoplasma felis from a serval (Felis serval) with severe respiratory disease. Journal

of Wildlife Diseases 32, 691-694.

Jones, H.P., and Simecka, J.W. (2003). T lymphocyte responses are critical

determinants in the pathogenesis and resisitance to mycoplasma respiratory disease.

Frontiers in Bioscience 8, d930-945.

Jones, R.F., and Sabine, M. (1970). The isolation of Mycoplasmas from clinically

normal cats. Australian Veterinary Journal 46, 343.

Kaklamanis, E., Thomas, L., Stavropoulos, K., Borman, I., and Boshwitz, C. (1969).

Mycoplasmacidal action of normal tissue extracts. Nature 221, 860-862.

Keane, D.P. (1983). Chronic abscesses in cats associated with an organism

resembling Mycoplasma. Canadian Veterinary Journal 24, 289-291.

Klose, T.C., Rosychuk, R.A., MacPhail, C.M., Hawley, J.R., Veir, J., Schultheiss, P.,

and Lappin, M.R. (2007). Association between upper respiratory tract infection and

inflammatory aural and nasopharyngeal polyps in cats. Research abstract program of

the 25th annual ACVIM Forum published in Journal of Veterinary Internal Medicine

21, 628.

107


Kojima, A., Takahashi, T., Kijima, M., Ogikubo, Y., Tamura, Y., and Harasawa, R.

(1996). Detection of mycoplasma DNA in veterinary live virus vaccines by the

polymerase chain reaction. Journal of Veterinary Medical Science. 58, 1045-1048.

Kokotovic, B., Friis, N.F., Jesen, J.S., and Ahrens, P. (1999). Amplified-fragment

length polymorphism fingerprinting of Mycoplasma species. Journal of Clinical

Microbiology 37, 3300-3307.

Kondo, S., Ito, M., Saito, M., Sugimori, M., and Watanabe, H. (1994). Progressive

bronchial obstruction during the acute stage of respiratory tract infection in asthmatic

children. Chest 106, 100-104.

Kononen, E. (2000). Development of oral bacterial flora in young children. Annals of

Medicine 32, 107-112.

Kraft, M., Cassell, G.H., Henson, J.E., Watson, H., Williamson, J., Marmion, B.P.,

Gaydos, C.A., and Martin, R.J. (1998). Detection of Mycoplasma pneumoniae in the

airways of adults with chronic asthma. American journal of respiratory critical care

medicine 158, 998-1001.

Lappin, M.R., Veir, J.K., and Hawley, J.R. (2007). Transmission of Mycoplasma spp

in specific pathogen free kittens. Research abstract program of the 25th annual

ACVIM Forum published in Journal of Veterinary Internal Medicine 21, 639.

Liehmann, L., Degasperi, B., Spergser, J., and Niebauer, G.W. (2006). Mycoplasma

felis arthritis in two cats. Journal of Small Animal Practice 47, 476-479.

Lopez, A. (2007). Respiratory system. In: Pathologic basis of veterinary disease, eds.

M.D. McGavin and J.F. Zachary, St. Louis: Mosby Elsevier, 463-558.

Love, D.N., Vekselstein, R., and Collings, S. (1990). The obligate and facultatively

anaerobic bacterial flora of the normal feline gingival margin. Veterinary

Microbiology 22, 267-275.

108


Low, H.C., Powell, C.C., Veir, J.K., Hawley, J.R., and Lappin, M.R. (2007).

Prevalence of feline herpesvirus 1, Chlamydophila felis, and Mycoplasma spp DNA in

conjunctival cells collected from cats with and without conjunctivitis. American

Journal of Veterinary Research 68, 643-648.

Maes, D., Segales, J., Meyns, T., Sibila, M., Pieters, M., and Haesebrouck, F. (2008).

Control of Mycoplasma hyopneumoniae infections in pigs. Veterinary Microbiology

126, 297-309.

Malik, R., Love, D.N., Hunt, G.B., Canfield, P.J., and Taylor, V. (1991). Pyothorax

associated with a Mycoplasma species in a kitten. Journal of Small Animal Practice

32, 31-34.

McAuliffe, L., Ellis, R.J., Ayling, R.D., and Nicholas, R.A. (2003). Differentiation of

Mycoplasma species by 16S ribosomal DNA PCR and denaturing gradient gel

electrophoresis fingerprinting. Journal of Clinical Microbiology 41, 4844-4847.

McAuliffe, L., Ellis, R.J., Miles, K., Ayling, R.D., and Nicholas, R.A.J. (2006).

Biofilm formation by mycoplasma species and its role in environmental persistence

and survival. Microbiology 152, 913-922.

McCabe, S.J., Murray, J.F., Ruhnke, H.L., and Rachlis, A. (1987). Mycoplasma

infection of the hand aquired from a cat. Journal of Hand Surgery 12A, 1085.

McGarrity, G.J., and Kotani, H. (1985). Cell culture Mycoplasmas. In: The

Mycoplasmas IV: Mycoplasma pathogenicity, vol. 4, eds. S. Razin and M.F. Barile,

Orlando: Academic Press Inc., 353-390.

McGarrity, G.J., Kotani, H., and Butler, G.H. (1992). Mycoplasmas and tissue culture

cells. In: Mycoplasmas: Molecular biology and pathogenesis, ed. J. Maniloff,

Washington DC: American Society for Microbiology, 445-454.

Meyns, T., Maes, D., Calus, D., Ribbens, S., Dewulf, J., Chiers, K., de Kruif, A., Cox,

E., Decostere, A., and Haesebrouck, F. (2007). Interactions of highly and low virulent

109


Mycoplasma hyopneumoniae isolates with the respiratory tract of pigs. Veterinary

Microbiology 120, 87-95.

Micillo, E., Bianco, A., D'Auria, D., Mazzarella, G., and Abbate, G.F. (2000).

Respiratory infections and asthma. Allergy 55, 42-45.

Minion, F.C. (2002). Molecular pathogenesis of Mycoplasma animal respiratory

pathogens. Frontiers in Bioscience 7, d1410-1422.

Moise, N.S., Crissman, J.W., Fairbrother, J.F., and Baldwin, C. (1983). Mycoplasma

gateae arthritis and tenosynovitis in cats: case report and experimental reproduction

of the disease. American Journal of Veterinary Research 44, 16-21.

Morein, B., Blomqvist, G., and Hu, K. (2007). Immune responsiveness in the neonatal

period. Journal of Comparative Pathology 137, S27-S31.

Morowitz, H.J., and Wallace, D.C. (1973). Genome size and life cycle of the

Mycoplasma. Annals of the New York Academy of Sciences 225, 62-73.

Morris, J.A., Harrison, L.M., and Partridge, S.M. (2006). Postmortem bacteriology: a

re-evaluation. Journal of Clinical Pathology 59, 1-9.

Nicholas, R., Ayling, R., and McAuliffe, L. (2008a). Detection and differentiation of

Mycoplasma species usinmg PCR/Denaturing gradient gel electrophoresis. In:

Mycoplasma diseases of ruminants, Wallingford: CAB International, 15-27.

Nicholas, R., Ayling, R., and McAuliffe, L. (2008b). Detection of Mycoplasma

species using polymerase chain reaction (PCR). In: Mycoplasma diseases of

ruminants, Wallingford: CAB International, 28-34.

Nicholas, R., Ayling, R., and McAuliffe, L. (2008c). Molecular typing of

Mycoplasma species. In: Mycoplasma diseases of ruminants, Wallingford: CAB

International, 35-52.

110


Nicholas, R.A.J., Ayling, R.D., and McAuliffe, L. (2009). Vaccines for Mycoplasma

diseases in animals and man. Journal of Comparative Pathology 140, 85-96.

Nossal, G.J.V. (1983). Cellular mechanisms of immunologic tolerance. Annual

reviews in immunology 1, 33-62.

Ochert, A.S., Boulter, A.W., Bimbaum, W., Johnson, N.W., and Teo, C.G. (1994).

Inhibitory effect of salivary fluids on PCR: potency and removal. PCR Methods and

Applications 3, 365-368.

Ogilvie, T.H., Rosendal, S., Blackwell, T.E., Rostkowski, C.M., Julian, R.J., and

Ruhnke, L. (1983). Mycoplasma felis as a cause of pleuritis in horses. Journal of the

American Veterinary Medical Association 182, 1374-1376.

Padrid, P.A., Feldman, B.F., Funk, K., Samitz, E.M., Reil, D., and Cross, C.E. (1991).

Cytologic, microbiologic, and biochemical analysis of bronchoalveolar lavage fluid

obtained from 24 healthy cats. American Journal of Veterinary Research. 52, 1300-

1307.

Pedersen, N.C. (1998). Mycoplasmosis. In: Feline Infectious Diseases, Goleta:

American Veterinary Publications Inc., 215-220.

Petrovsky, T. (1990). Mycoplasma pneumoniae infection and post-infection asthma.

Medical Journal of Australia 152, 391.

Pieters, M., Pijoan, C., Fano, E., and Dee, S. (2009). An assessment of the duration of

Mycoplasma hyopneumoniae infection in an experimentally infected population of

pigs. Veterinary Microbiology 134, 261-266.

Radostits, O.M., Blood, D.C., and Gay, C.C. (1994). Diseases caused by Mycoplasma

spp. In: Veterinary Medicine, London: Bailliere Tindall, 908-925.

Randolph, J.F., Moise, N.S., Scarlett, J.M., Shin, S.J., Blue, J.T., and Corbett, J.R.

(1993). Prevalence of mycoplasmal and ureaplasmal recovery from tracheobronchial

111


lavages and of mycoplasmal recovery from pharyngeal swab specimens in cats with

or without pulmonary disease. American Journal of Veterinary Research. 54, 897-900.

Razin, S. (1978). The mycoplasmas. Microbiological Reviews 42, 414-470.

Razin, S. (1992). Mycoplasma taxonomy and ecology. In: Mycoplasmas: molecular

biology and pathogenesis, ed. J. Maniloff, Washington DC: American Society for

Microbiology, 3-22.

Razin, S., and Freundt, E.A. (1984). The Mycoplasmas. In: Bergey's Manual of

Systematic Bacteriology, vol. 1, ed. N.R. Krieg, Baltimore: Williams & Wilkins, 740-

770.

Rosenbusch, R.F. (1994). Biology and taxonomy of the Mycoplasmas. In:

Mycoplasmosis in animals: Laboratory diagnosis, eds. H.W. Whitford, R.F.

Rosenbusch, and L.H. Lauerman, Ames: Iowa State University Press, 3-11.

Rosendal, S. (1979). Canine and feline mycoplasmas. In: The Mycoplasmas II:

Human and animal mycoplasmas, vol. 2, eds. J.G. Tully and R.F. Whitcomb, New

York: Academic Press, 217-234.

Rosendal, S., Blackwell, T.E., Lumsden, J.H., Physick-Sheard, P.W., Viel, L.,

Watson, S., and Woods, P. (1986). Detection of antibodies to Mycoplasma felis in

horses. Journal of the American Veterinary Medical Association 188, 292-294.

Rottem, S. (2003). Interaction of Mycoplasmas with host cells. Physiological Reviews

83, 417-432.

Ruhnke, H.L., and Rosendal, S. (1994). Useful protocols for diagnosis of animal

Mycoplasmas Addendum I. Media formulations and techniques. In: Mycoplasmosis

in animals: Laboratory diagnosis, eds. H.W. Whitford, R.F. Rosenbusch, and L.H.

Lauerman, Ames: Iowa State University Press, 141-155.

112


Sabato, A.R., Martin, A.J., Marmion, B.P., Kok, T.W., and Cooper, D.M. (1984).

Mycoplasma pneumoniae: acute illness, antibiotics and subsequent pulmonary

function. Archives of disease in childhood 59, 1034-1037.

Schneck, G. (1973). Mycoplasma in a cat colony. Veterinary Medicine & Small

Animal Clinician 68, 381-383.

Schneck, G.W. (1972). Mycoplasma species in association with feline viruses.

Veterinary Record. 91, 594-595.

Seggev, J.S., Lis, I., Siman-Tov, R., Gutman, R., Abu-Samara, H., Schey, G., and

Naot, Y. (1986). Mycoplasma pneumoniae is a frequent cause of exacerbation of

bronchial asthma in adults. Annals of Allergy 57, 263-265.

Seggev, J.S., Sedmak, G.V., and Kurup, V.P. (1996). Isotype-specific antibody

responses to acute Mycoplasma pneumoniae infection. Annals of Allergy, Asthma &

Immunology 77, 67-73.

Senior, D.F., and Brown, M.B. (1996). The role of Mycoplasma species and

Ureaplasma species in feline lower urinary tract disease. Veterinary Clinics of North

America - Small Animal Practice. 26, 305-308.

Shewen, P.E., Povey, R.C., and Wilson, M.R. (1980). A survey of the conjunctival

flora of clinically normal cats and cats with conjunctivitis. Canadian Veterinary

Journal 21, 231-233.

Simecka, J.W., Davis, J.K., Davidson, M.K., Ross, S.E., Stadtlander, C.T.K.H., and

Cassell, G.H. (1992). Mycoplasma diseases of animals. In: Mycoplasmas: Molecular

biology and pathogenesis, ed. J. Maniloff, Washington DC: American Society for

Microbiology, 391-415.

Sjödahl-Essén, T., Tidholm, A., Thorén, P., Persson-Wadman, A., Bölske, G., Aspán,

A., and Treiberg Berndtsson, L. (2008). Evaluation of different sampling methods and

results of real-time PCR for detection of feline herpes virus-1, Chlamydophila felis

and Mycoplasma felis in cats. Veterinary Ophthalmology 11, 375-380.

113


Snedecor, G.W., and Cochran, W.G. (1978). Attribute data with more than one degree

of freedom. In: Statistical Methods, Ames: Iowa State University Press, 236-238.

Snedecor, G.W., and Cochran, W.G. (1980). Binomial distribution. In: Statistical

Methods, Ames: Iowa State University Press, 110-114.

Spradbrow, P.B., Bagust, T.J., Burgess, G., and Portas, B. (1970a). The isolation of

Picornaviruses from cats with respiratory disease. Australian Veterinary Journal 46,

105-108.

Spradbrow, P.B., Marley, J., Portas, B., and Burgess, G. (1970b). The isolation of

Mycoplasmas from cats with respiratory disease. Australian Veterinary Journal 46,

109-110.

StataCorp. (2007). Stata Statistical Software: Release 10.0., College Station, Texas.

Stein, J.E., and Lappin, M.R. (2000). Bacterial culture results in cats with upper and

lower airway disease: 225 cases (1995-1999). 19th Annual ACVIM Forum, Seattle,

Washington.

Switzer, W.P. (1967). The genus Mycoplasma. In: Veterinary bacteriology and

virology, eds. I.A. Merchant and R.A. Packer, Ames: Iowa University Press, 531-548.

Tan, R.J., Lim, E.W., and Ishak, B. (1977a). Ecology of mycoplasmas in clinically

healthy cats. Australian Veterinary Journal. 53, 515-518.

Tan, R.J., and Markham, J.G. (1971a). Feline T-strain mycoplasmas. Japanese Journal

of Experimental Medicine. 41, 247-248.

Tan, R.J., and Miles, J.A. (1974a). Possible role of feline T-strain mycoplasmas in cat

abortion. Australian Veterinary Journal. 50, 142-145.

Tan, R.J.S. (1974). Susceptibility of kittens to Mycoplasma felis infection. Japanese

Journal of Experimental Medicine 44, 235-240.

114


Tan, R.J.S., and Markham, J. (1971b). Isolation of Mycoplasma from cats with

conjunctivitis. New Zealand Veterinary Journal 19, 28.

Tan, R.J.S., and Miles, J.A.R. (1972). Mycoplasma isolations from clinically normal

cats. British Veterinary Journal 128, 87-90.

Tan, R.J.S., and Miles, J.A.R. (1973). Characterization of Mycoplasmas isolated from

cats with conjunctivitis. New Zealand Veterinary Journal 21, 27-32.

Tan, R.J.S., and Miles, J.A.R. (1974b). Incidence and significance of Mycoplasmas in

sick cats. Research in Veterinary Science 16, 27-34.

Tan, R.J.S., Wang Lim, E., and Ishak, B. (1977b). Significance and pathogenic role of

Mycoplasma arginini in cat diseases. Canadian journal of Comparative Medicine 41,

349-354.

Teo, J., Vellayappan, K., Yip, W.C.L., and Doraisingham, S. (1986). Mycoplasma

pneumoniae and viral infections in childhood asthma. Journal of Tropical Pediatrics

32, 87-89.

Thiaucourt, F., Dedieu, L., J.C., M., Bonnet, P., Lesnoff, M., Laval, G., and Provost,

A. (2003). Contagious bovine pleuropneumonia vaccines, historic highlights, present

situation and hopes. Developmental Biology 114, 147-160.

Thompson, J.D., Higgins, D.G., and Gibson, T.J. (1994). CLUSTALW: improving the

sensitivity of progressive multiple sequence alignment through sequence weighting,

position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22,

4673-4680.

Thornton, D.H. (1986). A survey of mycoplasma detection in veterinary vaccines.

Vaccine. 4, 237-240.

Tizard, I.R. (1996). Immunity at body surfaces. In: Veterinary Immunology: an

introduction, ed. I.R. Tizard, Philadelphia: W.B. Saunders Company, 251-264.

115


Trow, A.V., Rozanski, E.A., and Tidwell, A.S. (2008). Primary mycoplasma

pneumonia associated with reversible respiratory failure in a cat. Journal of Feline

Medicine and Surgery 10, 398-402.

Tsokos, M., and Puschel, K. (2001). Postmortem bacteriology in forensic pathology:

diagnostic value and interpretation. Legal Medicine 3, 15-22.

Tully, J.G., and Bradbury, J.M. (2003). Taxa covered by the ICSP Subcommittee on

the Taxonomy of Mollicutes - June 2003, vol. 2007: International Committee on

Systematics of Prokaryotes Subcommittee on the Taxonomy of Mollicutes.

Tully, J.G., Del Giudice, R.A., and Barile, M.F. (1972). Synonomy of Mycoplasma

arginini and Mycoplasma leonis. International Journal of Systematic Bacteriology 22,

47-49.

Tully, J.G., and Rask-Nielsen, R. (1967). Mycoplasma in leukemic and nonleukemic

mice. Annals of the New York Academy of Sciences 143, 345-352.

Tuzio, H., Edwards, D., Elston, T., Jarboe, L., Kudrak, S., Richards, J., and Rodan, I.

(2005). Feline zoonoses guidelines from the American Association of Feline

Practitioners. Journal of Feline Medicine and Surgery 7, 243-274.

Veir, J., Ruch-Gallie, R., Spindel, M.E., and Lappin, M.R. (2008). Prevalence of

selected infectious organisms and comparison of two anatomic sampling sites in

shelter cats with upper respiratory tract disease. Journal of Feline Medicine and

Surgery 10, 551-557.

Vos, P., Hogers, R., Bleeker, M., Reijans, M., van de Lee, T., Hornes, M., Friters, A.,

Pot, J., Paleman, J., Kuiper, M., and Zabeau, M. (1995). AFLP: a new technique for

DNA fingerprinting. Nucleic Acids Research 23, 4407-4414.

Walker, R.D., Walshaw, R., Riggs, C.M., and Mosser, T. (1995). Recovery of two

mycoplasma species from abscesses in a cat following bite wounds from a dog.

Journal of Veterinary Diagnostic Investigation 7, 154-156.

116


Whitford, H.W. (1994). Isolation of Mycoplasmas from clinical specimens. In:

Mycoplasmosis in animals: Laboratory diagnosis, eds. H.W. Whitford, R.F.

Rosenbusch, and L.H. Lauerman, Ames: Iowa State University Press, 12-14.

Whitford, H.W., and Lingsweiler, S.W. (1994). Canine, Feline, and Equine

Mycoplasmas. In: Mycoplasmosis in animals: Laboratory diagnosis, eds. H.W.

Whitford, R.F. Rosenbusch, and L.H. Lauerman, Ames: Iowa State University Press.

Whitford, H.W., Rosenbusch, R.F., and Lauerman, L.H. (eds.) (1994).

Mycoplasmosis in animals: Laboratory diagnosis. Iowa State University Press: Ames.

Whithear, K.G. (1996). Control of avian mycoplasmoses by vaccination. Revue

scientifique et techniques 15, 1527-1553.

Whitley, R.D. (2000). Canine and feline primary ocular bacterial infections.

Veterinary Clinics of North America: Small Animal Practice 30, 1151-1167.

Wiggs, R.B., and Lobprise, H.B. (1997). Domestic feline oral and dental disease. In:

Veterinary Dentistry: Principles & Practice, eds. R.B. Wiggs and H.B. Lobprise,

Philadelphia: Lippincott-Raven publishers, 483.

Wood, J.L.N., Chanter, N., Newton, J.R., Burrell, M.H., Dugdale, D., Windsor, H.M.,

Windsor, G.D., Rosendal, S., and Townsend, H.G.G. (1997). An outbreak of

respiratory disease in horses associated with Mycoplasma felis infection. Veterinary

Record 140, 388-391.

Yano, T., Ichikawa, Y., Komatu, S., Arai, S., and Oizumi, K. (1994). Association of

Mycoplasma pneumoniae antigen with initial onset of bronchial asthma. American

Journal of Respiratory Critical Care 149, 1348-1353.

You, X., Zeng, Y., and Wu, Y. (2006). Interactions between mycoplasma lipid-

associated membrane proteins and the host cells. Journal of Zhejiang University

SCIENCE B 7, 342-350.

117


Young, T.F., Thacker, E.L., Erickson, B.Z., and Ross, R.F. (2000). A tissue culture

system to study respiratory ciliary epithelial adherence of selected swine

Mycoplasmas. Veterinary Microbiology 71, 269-279.

Zeugswetter, F., Hittmair, K.M., de Arespacochaga, A.G., Shibley, S., and Spergser,

J. (2007). Erosive polyarthritis associated with Mycoplasma gateae in a cat. Journal of

Feline Medicine and Surgery 9, 226-231.

Zhu, X.Q., and Gasser, R.B. (1998). SSCP-based mutation scanning approaches to

fingerprint sequence variation in ribosomal DNA of ascaridoid nematodes.

Electrophoresis 19, 1366-1373.

118

More magazines by this user
Similar magazines