TURKISH JOURNAL OF HEMATOLOGY

Volume 37 Issue 2

June 2020

E-ISSN: 1308-5263

TURKISH JOURNAL OF HEMATOLOGY • VOL.: 37 ISSUE: 2 JUNE 2020

Research Articles

In Silico Study of Correlation between Missense Variations of F8 Gene and Inhibitor Formation in Severe Hemophilia A

Mostefa Fodil and Faouzia Zemani; Oran, Algeria

Splenic Marginal Zone Lymphoma in Turkey: Association with Hepatitis B Instead of Hepatitis C Virus as an Etiologic and

Possible Prognostic Factor - A Multicenter Cohort Study

Müfide Okay et al.; Ankara, Edirne, Trabzon, Samsun, Kayseri, İzmir, Denizli, Van, Erzurum, İstanbul, Malatya, Turkey

Bortezomib-based Regimens Improve the Outcome of Patients with Primary or Secondary Plasma Cell Leukemia: A

Retrospective Cohort Study

Huijuan Wang et al.; Beijing, China

PTEN and AKT1 Variations in Childhood T-Cell Acute Lymphoblastic Leukemia

Fulya Küçükcankurt et al.; İstanbul, Turkey

Expression Profile Screening and Bioinformatics Analysis of circRNA, LncRNA, and mRNA in Acute Myeloid Leukemia

Drug-Resistant Cells

Meiling Li et al.; Xiamen, Duyun, China

Cover Picture:

Chandan Kumar, Garima Jain, Anita

Chopra, New Delhi, India

Garland of Erythroblasts around a

Macrophage: Erythroblastic Island

2

Editor-in-Chief

Reyhan Küçükkaya

İstanbul, Turkey

rkucukkaya@hotmail.com

Associate Editors

A. Emre Eşkazan

İstanbul University-Cerrahpaşa,

İstanbul, Turkey

Ayşegül Ünüvar

İstanbul University, İstanbul, Turkey

aysegulu@hotmail.com

Cengiz Beyan

cengizbeyan@hotmail.com

Hale Ören

Dokuz Eylül University, İzmir, Turkey

hale.oren@deu.edu.tr

İbrahim C. Haznedaroğlu

Hacettepe University, Ankara, Turkey

haznedar@yahoo.com

Selami Koçak Toprak

Ankara University, Ankara, Turkey

sktoprak@yahoo.com

Semra Paydaş

Çukurova University, Adana, Turkey

sepay@cu.edu.tr

Şule Ünal


Assistant Editors

Ali İrfan Emre Tekgündüz

Dr. A. Yurtaslan Ankara Oncology Training

and Research Hospital, Ankara, Turkey

Claudio Cerchione

University of Naples Federico II Napoli,

Campania, Italy

Elif Ünal İnce

Ankara University, Ankara, Turkey

İnci Alacacıoğlu

Dokuz Eylül University, İzmir, Turkey

Müge Sayitoğlu

İstanbul University, İstanbul, Turkey

Nil Güler

Ondokuz Mayıs University, Samsun, Turkey

Olga Meltem Akay

Koç University, İstanbul, Turkey

Veysel Sabri Hançer

İstinye University, İstanbul, Turkey

Zühre Kaya

Gazi University, Ankara, Turkey

International Review Board

Nejat Akar

Görgün Akpek

Serhan Alkan

Çiğdem Altay

Koen van Besien

Ayhan Çavdar

M. Sıraç Dilber

Ahmet Doğan

Peter Dreger

Thierry Facon

Jawed Fareed

Gösta Gahrton

Dieter Hoelzer

Marilyn Manco-Johnson

Andreas Josting

Emin Kansu

Winfried Kern

Nigel Key

Korgün Koral

Abdullah Kutlar

Luca Malcovati

Robert Marcus

Jean Pierre Marie

Ghulam Mufti

Gerassimos A. Pangalis

Antonio Piga

Ananda Prasad

Jacob M. Rowe

Jens-Ulrich Rüffer

Norbert Schmitz

Orhan Sezer

Anna Sureda

Ayalew Tefferi

Nükhet Tüzüner

Catherine Verfaillie

Srdan Verstovsek

Claudio Viscoli

Past Editors

Erich Frank

Orhan Ulutin

Hamdi Akan

Aytemiz Gürgey

Senior Advisory Board

Yücel Tangün

Osman İlhan

Muhit Özcan

Teoman Soysal

Ahmet Muzaffer Demir

TOBB University of Economics and Technology Hospital, Ankara, Turkey

Maryland School of Medicine, Baltimore, USA

Cedars-Sinai Medical Center, USA

Ankara, Turkey

University of Chicago Medical Center, Chicago, USA

Ankara, Turkey

Karolinska University, Stockholm, Sweden

Mayo Clinic Saint Marys Hospital, USA

Heidelberg University, Heidelberg, Germany

Lille University, Lille, France

Loyola University, Maywood, USA

Karolinska University Hospital, Stockholm, Sweden

Frankfurt University, Frankfurt, Germany

University of Colorado Anschutz Medical Campus, USA

University Hospital Cologne, Cologne, Germany


Albert Ludwigs University, Germany

University of North Carolina School of Medicine, NC, USA

Southwestern Medical Center, Texas, USA

Medical College of Georgia at Augusta University, Augusta, USA

Pavia Medical School University, Pavia, Italy

Kings College Hospital, London, UK

Pierre et Marie Curie University, Paris, France

King’s Hospital, London, UK

Athens University, Athens, Greece

Torino University, Torino, Italy

Wayne State University School of Medicine, Detroit, USA

Rambam Medical Center, Haifa, Israel

University of Köln, Germany

AK St Georg, Hamburg, Germany

University Medical Center Hamburg, Germany

Santa Creu i Sant Pau Hospital, Barcelona, Spain

Mayo Clinic, Rochester, Minnesota, USA

İstanbul Cerrahpaşa University, İstanbul, Turkey

University of Minnesota, Minnesota, USA

The University of Texas MD Anderson Cancer Center, Houston, USA

San Martino University, Genoa, Italy

Language Editor

Leslie Demir

Statistic Editor

Hülya Ellidokuz

Editorial Office

İpek Durusu

Bengü Timoçin Efe

A-I

Publishing

Services

GALENOS PUBLISHER

Molla Gürani Mah. Kaçamak Sk. No: 21/1, Fındıkzade, İstanbul, Turkey

Phone: +90 212 621 99 25 • Fax: +90 212 621 99 27 • www. galenos.com.tr

Contact Information

Editorial Correspondence should be addressed to Dr. Reyhan Küçükkaya

E-mail : rkucukkaya@hotmail.com

All Inquiries Should be Addressed to

TURKISH JOURNAL OF HEMATOLOGY

Address : Turan Güneş Bulv. İlkbahar Mah. Fahreddin Paşa Sokağı (eski 613. Sok.) No: 8 06550 Çankaya, Ankara / Turkey

Phone : +90 312 490 98 97

Fax : +90 312 490 98 68

E-mail : info@tjh.com.tr

E-ISSN: 1308-5263

Publishing Manager

Muhlis Cem Ar

Management Address

Türk Hematoloji Derneği

Turan Güneş Bulv. İlkbahar Mah. Fahreddin Paşa Sokağı (eski 613. Sok.)

No: 8 06550 Çankaya, Ankara / Turkey

Online Manuscript Submission

http://mc.manuscriptcentral.com/tjh

Web Page

www.tjh.com.tr

Owner on Behalf of the Turkish Society

of Hematology

Güner Hayri Özsan

Publishing House

Molla Gürani Mah. Kaçamak Sk. No: 21,

34093 Fındıkzade, İstanbul, Turkey

Tel: +90 212 621 99 25

Fax: +90 212 621 99 27

E-mail: info@galenos.com.tr

Publisher Certificate Number: 14521

Publication Date

06.05.2020

Cover Picture

Chandan Kumar, Garima Jain, Anita Chopra, New Delhi, India

Garland of Erythroblasts around a Macrophage: Erythroblastic

Island

Bone marrow aspiration smear showed immature cells with

disseminated intranuclear/intracytoplasmic vacuolization.

International scientific journal published quarterly.

The Turkish Journal of Hematology is published by the commercial enterprise

of the Turkish Society of Hematology with Decision Number 6 issued by the

Society on 7 October 2008.

A-II

AIMS AND SCOPE

The Turkish Journal of Hematology is published quarterly (March, June,

September, and December) by the Turkish Society of Hematology. It is an

independent, non-profit peer-reviewed international English-language

periodical encompassing subjects relevant to hematology.

The Editorial Board of The Turkish Journal of Hematology adheres to the

principles of the World Association of Medical Editors (WAME), International

Council of Medical Journal Editors (ICMJE), Committee on Publication

Ethics (COPE), Consolidated Standards of Reporting Trials (CONSORT) and

Strengthening the Reporting of Observational Studies in Epidemiology

(STROBE).

The aim of The Turkish Journal of Hematology is to publish original

hematological research of the highest scientific quality and clinical relevance.

Additionally, educational material, reviews on basic developments, editorial

short notes, images in hematology, and letters from hematology specialists

and clinicians covering their experience and comments on hematology and

related medical fields as well as social subjects are published. As of December

2015, The Turkish Journal of Hematology does not accept case reports.

Important new findings or data about interesting hematological cases may

be submitted as a brief report.

General practitioners interested in hematology and internal medicine

specialists are among our target audience, and The Turkish Journal of

Hematology aims to publish according to their needs. The Turkish Journal of

Hematology is indexed, as follows:

- PubMed Medline

- PubMed Central

- Science Citation Index Expanded

- EMBASE

- Scopus

- CINAHL

- Gale/Cengage Learning

- EBSCO

- DOAJ

- ProQuest

- Index Copernicus

- Tübitak/Ulakbim Turkish Medical Database

- Turk Medline

- Hinari

- GOALI

- ARDI

- OARE

Impact Factor: 0.779

Open Access Policy

Turkish Journal of Hematology is an Open Access journal. This journal

provides immediate open access to its content on the principle that making

research freely available to the public supports a greater global exchange of

knowledge.

Open Access Policy is based on the rules of the Budapest Open Access

Initiative (BOAI) http://www.budapestopenaccessinitiative.org/.

Subscription Information

The Turkish Journal of Hematology is published electronically only as of

2019. Therefore, subscriptions are not necessary. All published volumes are

available in full text free-of-charge online at www.tjh.com.tr.

Address: Turan Güneş Bulv. İlkbahar Mah. Fahreddin Paşa Sokağı (eski 613.

Sok.) No: 8 06550 Çankaya, Ankara / Turkey

Telephone: +90 312 490 98 97

Fax: +90 312 490 98 68

Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh

Web page: www.tjh.com.tr

E-mail: info@tjh.com.tr

Permissions

Requests for permission to reproduce published material should be sent to

the editorial office.

Editor: Professor Dr. Reyhan Küçükkaya

Adress: Turan Güneş Bulv. İlkbahar Mah. Fahreddin Paşa Sokağı (eski 613.

Sok.) No: 8 06550 Çankaya, Ankara / Turkey

Telephone: +90 312 490 98 97

Fax: +90 312 490 98 68

Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh

Web page: www.tjh.com.tr

E-mail: info@tjh.com.tr

Publisher

Galenos Yayınevi

Molla Gürani Mah. Kaçamak Sk. No:21 34093 Fındıkzade-İstanbul, Turkey

Telephone : +90 212 621 99 25

Fax : +90 212 621 99 27

info@galenos.com.tr

Instructions for Authors

Instructions for authors are published in the journal and at www.tjh.com.tr

Material Disclaimer

Authors are responsible for the manuscripts they publish in The Turkish

Journal of Hematology. The editor, editorial board, and publisher do not

accept any responsibility for published manuscripts.

If you use a table or figure (or some data in a table or figure) from another

source, cite the source directly in the figure or table legend.

Editorial Policy

Following receipt of each manuscript, a checklist is completed by the Editorial

Assistant. The Editorial Assistant checks that each manuscript contains all

required components and adheres to the author guidelines, after which time

it will be forwarded to the Editor in Chief. Following the Editor in Chief’s

evaluation, each manuscript is forwarded to the Associate Editor, who in

turn assigns reviewers. Generally, all manuscripts will be reviewed by at least

three reviewers selected by the Associate Editor, based on their relevant

expertise. Associate editor could be assigned as a reviewer along with the

reviewers. After the reviewing process, all manuscripts are evaluated in the

Editorial Board Meeting.

Turkish Journal of Hematology’s editor and Editorial Board members are active

researchers. It is possible that they would desire to submit their manuscript

to the Turkish Journal of Hematology. This may be creating a conflict of

interest. These manuscripts will not be evaluated by the submitting editor(s).

The review process will be managed and decisions made by editor-in-chief

who will act independently. In some situation, this process will be overseen

by an outside independent expert in reviewing submissions from editors.

A-III

TURKISH JOURNAL OF HEMATOLOGY

INSTRUCTIONS FOR AUTHORS

The Turkish Journal of Hematology accepts invited review articles,

research articles, brief reports, letters to the editor, and hematological

images that are relevant to the scope of hematology, on the condition

that they have not been previously published elsewhere. Basic science

manuscripts, such as randomized, cohort, cross-sectional, and casecontrol

studies, are given preference. All manuscripts are subject

to editorial revision to ensure they conform to the style adopted by

the journal. There is a double-blind reviewing system. Review articles

are solicited by the Editor-in-Chief. Authors wishing to submit an

unsolicited review article should contact the Editor-in-Chief prior to

submission in order to screen the proposed topic for relevance and

priority.

The Turkish Journal of Hematology does not charge any article

submission or processing charges.

Manuscripts should be prepared according to ICMJE guidelines (http://

www.icmje.org/). Original manuscripts require a structured abstract.

Label each section of the structured abstract with the appropriate

subheading (Objective, Materials and Methods, Results, and Conclusion).

Letters to the editor do not require an abstract. Research or project

support should be acknowledged as a footnote on the title page.

Technical and other assistance should be provided on the title page.

Original Manuscripts

Title Page

Title: The title should provide important information regarding the

manuscript’s content. The title must specify that the study is a cohort

study, cross-sectional study, case-control study, or randomized study (i.e.

Cao GY, Li KX, Jin PF, Yue XY, Yang C, Hu X. Comparative bioavailability

of ferrous succinate tablet formulations without correction for baseline

circadian changes in iron concentration in healthy Chinese male

subjects: A single-dose, randomized, 2-period crossover study. Clin Ther

2011;33:2054-2059).

The title page should include the authors’ names, degrees, and

institutional/professional affiliations and a short title, abbreviations,

keywords, financial disclosure statement, and conflict of interest

statement. If a manuscript includes authors from more than one

institution, each author’s name should be followed by a superscript

number that corresponds to their institution, which is listed separately.

Please provide contact information for the corresponding author,

including name, e-mail address, and telephone and fax numbers.

Important Notice: The title page should be submitted separately.

Running Head: The running head should not be more than 40

characters, including spaces, and should be located at the bottom of

the title page.

Word Count: A word count for the manuscript, excluding abstract,

acknowledgments, figure and table legends, and references, should be

provided and should not exceed 2500 words. The word count for the

abstract should not exceed 300 words.

Conflict of Interest Statement: To prevent potential conflicts of

interest from being overlooked, this statement must be included in each

manuscript. In case there are conflicts of interest, every author should

complete the ICMJE general declaration form, which can be obtained at

http://www.icmje.org/downloads/coi_disclosure.zip

Abstract and Keywords: The second page should include an abstract

that does not exceed 300 words. For manuscripts sent by authors in

Turkey, a title and abstract in Turkish are also required. As most readers

read the abstract first, it is critically important. Moreover, as various

electronic databases integrate only abstracts into their index, important

findings should be presented in the abstract.

Objective: The abstract should state the objective (the purpose of the

study and hypothesis) and summarize the rationale for the study.

Materials and Methods: Important methods should be written

respectively.

Results: Important findings and results should be provided here.

Conclusion: The study’s new and important findings should be

highlighted and interpreted.

Other types of manuscripts, such as reviews, brief reports, and

editorials, will be published according to uniform requirements.

Provide 3-10 keywords below the abstract to assist indexers. Use

terms from the Index Medicus Medical Subject Headings List

(for randomized studies a CONSORT abstract should be provided: http://

www.consort-statement.org).

Introduction: The introduction should include an overview of the

relevant literature presented in summary form (one page), and whatever

remains interesting, unique, problematic, relevant, or unknown about

the topic must be specified. The introduction should conclude with the

rationale for the study, its design, and its objective(s).

Materials and Methods: Clearly describe the selection of observational

or experimental participants, such as patients, laboratory animals, and

controls, including inclusion and exclusion criteria and a description of

the source population. Identify the methods and procedures in sufficient

detail to allow other researchers to reproduce your results. Provide

references to established methods (including statistical methods),

provide references to brief modified methods, and provide the rationale

for using them and an evaluation of their limitations. Identify all drugs

and chemicals used, including generic names, doses, and routes of

administration. The section should include only information that was

available at the time the plan or protocol for the study was devised

A-IV

(https://www.strobe-statement.org/fileadmin/Strobe/uploads/checklists/

STROBE_checklist_v4_combined.pdf).

Statistics: Describe the statistical methods used in enough detail to

enable a knowledgeable reader with access to the original data to verify

the reported results. Statistically important data should be given in the

text, tables, and figures. Provide details about randomization, describe

treatment complications, provide the number of observations, and specify

all computer programs used.

Results: Present your results in logical sequence in the text, tables, and

figures. Do not present all the data provided in the tables and/or figures

in the text; emphasize and/or summarize only important findings, results,

and observations in the text. For clinical studies provide the number of

samples, cases, and controls included in the study. Discrepancies between

the planned number and obtained number of participants should be

explained. Comparisons and statistically important values (i.e. p-value

and confidence interval) should be provided.

Discussion: This section should include a discussion of the data. New and

important findings/results and the conclusions they lead to should be

emphasized. Link the conclusions with the goals of the study, but avoid

unqualified statements and conclusions not completely supported by the

data. Do not repeat the findings/results in detail; important findings/results

should be compared with those of similar studies in the literature, along with

a summarization. In other words, similarities or differences in the obtained

findings/results with those previously reported should be discussed.

Study Limitations: Limitations of the study should be detailed. In

addition, an evaluation of the implications of the obtained findings/

results for future research should be outlined.

Conclusion: The conclusion of the study should be highlighted.

References

Cite references in the text, tables, and figures with numbers in square

brackets. Number references consecutively according to the order in

which they first appear in the text. Journal titles should be abbreviated

according to the style used in Index Medicus (consult List of Journals

Indexed in Index Medicus). Include among the references any paper

accepted, but not yet published, designating the journal followed by “in

press”.

Examples of References:

1. List all authors

Deeg HJ, O’Donnel M, Tolar J. Optimization of conditioning for marrow

transplantation from unrelated donors for patients with aplastic anemia

after failure of immunosuppressive therapy. Blood 2006;108:1485-1491.

2. Organization as author

Royal Marsden Hospital Bone Marrow Transplantation Team. Failure of

syngeneic bone marrow graft without preconditioning in post-hepatitis

marrow aplasia. Lancet 1977;2:742-744.

3. Book

Wintrobe MM. Clinical Hematology, 5th ed. Philadelphia, Lea & Febiger, 1961.

4. Book Chapter

Perutz MF. Molecular anatomy and physiology of hemoglobin. In:

Steinberg MH, Forget BG, Higs DR, Nagel RI, (eds). Disorders of Hemoglobin:

Genetics, Pathophysiology, Clinical Management. New York, Cambridge

University Press, 2000.

5. Abstract

Drachman JG, Griffin JH, Kaushansky K. The c-Mpl ligand (thrombopoietin)

stimulates tyrosine phosphorylation. Blood 1994;84:390a (abstract).

6. Letter to the Editor

Rao PN, Hayworth HR, Carroll AJ, Bowden DW, Pettenati MJ. Further

definition of 20q deletion in myeloid leukemia using fluorescence in situ

hybridization. Blood 1994;84:2821-2823.

7. Supplement

Alter BP. Fanconi’s anemia, transplantation, and cancer. Pediatr Transplant

2005;9(Suppl 7):81-86.

Brief Reports

Abstract length: Not to exceed 150 words.

Article length: Not to exceed 1200 words.

Introduction: State the purpose and summarize the rationale for the study.

Materials and Methods: Clearly describe the selection of the observational

or experimental participants. Identify the methods and procedures in

sufficient detail. Provide references to established methods (including

statistical methods), provide references to brief modified methods, and

provide the rationale for their use and an evaluation of their limitations.

Identify all drugs and chemicals used, including generic names, doses, and

routes of administration.

Statistics: Describe the statistical methods used in enough detail to

enable a knowledgeable reader with access to the original data to verify

the reported findings/results. Provide details about randomization,

describe treatment complications, provide the number of observations,

and specify all computer programs used.

Results: Present the findings/results in a logical sequence in the text, tables,

and figures. Do not repeat all the findings/results in the tables and figures in

the text; emphasize and/or summarize only those that are most important.

Discussion: Highlight the new and important findings/results of the

study and the conclusions they lead to. Link the conclusions with the

goals of the study, but avoid unqualified statements and conclusions not

completely supported by your data.

Invited Review Articles



Review articles should not include more than 100 references. Reviews

should include a conclusion, in which a new hypothesis or study about the

subject may be posited. Do not publish methods for literature search or level

of evidence. Authors who will prepare review articles should already have

published research articles on the relevant subject. The study’s new and

A-V

important findings should be highlighted and interpreted in the Conclusion

section. There should be a maximum of two authors for review articles.

Perspectives in Hematology

“Perspectives” are articles discussing significant topics relevant to

hematology. They are more personal than a Review Article. Authors

wishing to submit a Perspective in Hematology article should contact

the Editor in Chief prior to submission in order to screen the proposed

topic for relevance and priority. Articles submitted for “Perspectives

in Hematology” must advance the hot subjects of experimental and/

or clinical hematology beyond the articles previously published or in

press in TJH. Perspective papers should meet the restrictive criteria of

TJH regarding unique scientific and/or educational value, which will

impact and enhance clinical hematology practice or the diagnostic

understanding of blood diseases. Priority will be assigned to such

manuscripts based upon the prominence, significance, and timeliness of

the content. The submitting author must already be an expert with a

recognized significant published scientific experience in the specific field

related to the “Perspectives” article.



References: Should not include more than 50 references

Images in Hematology


Authors can submit for consideration illustrations or photos that are

interesting, instructive, and visually attractive, along with a few lines

of explanatory text and references. Images in Hematology can include

no more than 200 words of text, 5 references, and 3 figures or tables.

No abstract, discussion, or conclusion is required, but please include a

brief title.

Letters to the Editor


Letters can include no more than 500 words of text, 5-10 references,

and 1 figure or table. No abstract is required, but please include a brief

title. The total number is usually limited to a maximum of five authors

for a letter to the editor.

Tables

Supply each table in a separate file. Number tables according to the order

in which they appear in the text, and supply a brief caption for each.

Give each column a short or abbreviated heading. Write explanatory

statistical measures of variation, such as standard deviation or standard

error of mean. Be sure that each table is cited in the text.

Figures

Figures should be professionally drawn and/or photographed. Authors

should number figures according to the order in which they appear in

the text. Figures include graphs, charts, photographs, and illustrations.

Each figure should be accompanied by a legend that does not exceed

50 words. Use abbreviations only if they have been introduced in the

text. Authors are also required to provide the level of magnification for

histological slides. Explain the internal scale and identify the staining

method used. Figures should be submitted as separate files, not in

the text file. High-resolution image files are not preferred for initial

submission as the file sizes may be too large. The total file size of the

PDF for peer review should not exceed 5 MB.

Authorship

Each author should have participated sufficiently in the work to assume

public responsibility for the content. Any portion of a manuscript that is

critical to its main conclusions must be the responsibility of at least one

author.

Contributor’s Statement

All submissions should contain a contributor’s statement page. Each

statement should contain substantial contributions to idea and design,

acquisition of data, and analysis and interpretation of findings. All persons

designated as an author should qualify for authorship, and all those that

qualify should be listed. Each author should have participated sufficiently

in the work to take responsibility for appropriate portions of the text.

Acknowledgments

Acknowledge support received from individuals, organizations, grants,

corporations, and any other source. For work involving a biomedical

product or potential product partially or wholly supported by corporate

funding, a note stating, “This study was financially supported (in part)

with funds provided by (company name) to (authors’ initials)”, must

be included. Grant support, if received, needs to be stated and the

specific granting institutions’ names and grant numbers provided when

applicable.

Authors are expected to disclose on the title page any commercial or

other associations that might pose a conflict of interest in connection

with the submitted manuscript. All funding sources that supported the

work and the institutional and/or corporate affiliations of the authors

should be acknowledged on the title page.

Ethics

When reporting experiments conducted with humans indicate that

the procedures were in accordance with ethical standards set forth

by the committee that oversees human subject research. Approval of

research protocols by the relevant ethics committee, in accordance with

international agreements (Helsinki Declaration of 1975, revised 2013

available at https://www.wma.net/policies-post/wma-declaration-ofhelsinki-ethical-principles-for-medical-research-involving-humansubjects/),

is required for all experimental, clinical, and drug studies.

Patient names, initials, and hospital identification numbers should not be

used. Manuscripts reporting the results of experimental investigations

conducted with humans must state that the study protocol received

A-VI

institutional review board approval and that the participants provided

informed consent.

Non-compliance with scientific accuracy is not in accord with scientific

ethics. Plagiarism: To re-publish, in whole or in part, the contents of

another author’s publication as one’s own without providing a reference.

Fabrication: To publish data and findings/results that do not exist.

Duplication: Use of data from another publication, which includes republishing

a manuscript in different languages. Salami slicing: To create

more than one publication by dividing the results of a study unnecessarily.

We disapprove of such unethical practices as plagiarism, fabrication,

duplication, and salami slicing, as well as efforts to influence the

review process with such practices as gifting authorship, inappropriate

acknowledgments, and references. Additionally, authors must respect

participants‘ right to privacy.

On the other hand, short abstracts published in congress books that do

not exceed 400 words and present data of preliminary research, and those

that are presented in an electronic environment, are not considered as

previously published work. Authors in such a situation must declare this

status on the first page of the manuscript and in the cover letter.

(The COPE flowchart is available at http://publicationethics.org.)

We use iThenticate to screen all submissions for plagiarism before

publication.

Conditions of Publication

All authors are required to affirm the following statements before their

manuscript is considered: 1. The manuscript is being submitted only

to The Turkish Journal of Hematology; 2. The manuscript will not be

submitted elsewhere while under consideration by The Turkish Journal

of Hematology; 3. The manuscript has not been published elsewhere,

and should it be published in The Turkish Journal of Hematology it will

not be published elsewhere without the permission of the editors (these

restrictions do not apply to abstracts or to press reports for presentations

at scientific meetings); 4. All authors are responsible for the manuscript’s

content; 5. All authors participated in the study concept and design,

analysis and interpretation of the data, and drafting or revising of the

manuscript and have approved the manuscript as submitted. In addition,

all authors are required to disclose any professional affiliation, financial

agreement, or other involvement with any company whose product

figures prominently in the submitted manuscript.

Authors of accepted manuscripts will receive electronic page proofs and

are responsible for proofreading and checking the entire article within

two days. Failure to return the proof in two days will delay publication.

If the authors cannot be reached by email or telephone within two

weeks, the manuscript will be rejected and will not be published in the

journal.

Copyright

At the time of submission all authors will receive instructions for submitting

an online copyright form. No manuscript will be considered for review until

all authors have completed their copyright form. Please note, it is our practice

not to accept copyright forms via fax, e-mail, or postal service unless there

is a problem with the online author accounts that cannot be resolved. Every

effort should be made to use the online copyright system. Corresponding

authors can log in to the submission system at any time to check the status

of any co-author’s copyright form. All accepted manuscripts become the

permanent property of The Turkish Journal of Hematology and may not be

published elsewhere, in whole or in part, without written permission.

Note: We cannot accept any copyright form that has been altered,

revised, amended, or otherwise changed. Our original copyright form

must be used as is.

Units of Measurement

Measurements should be reported using the metric system, according

to the International System of Units (SI). Consult the SI Unit Conversion

Guide, New England Journal of Medicine Books, 1992.

An extensive list of conversion factors can be found at https://www.

nist.gov/sites/default/files/documents/pml/wmd/metric/SP1038.pdf. For

more details, see http://www.amamanualofstyle.com/oso/public/jama/

si_conversion_table.html.

Abbreviations and Symbols

Use only standard abbreviations. Avoid abbreviations in the title and

abstract. The full term for an abbreviation should precede its first use

in the text, unless it is a standard abbreviation. All acronyms used in the

text should be expanded at first mention, followed by the abbreviation

in parentheses; thereafter the acronym only should appear in the text.

Acronyms may be used in the abstract if they occur 3 or more times

therein, but must be reintroduced in the body of the text. Generally,

abbreviations should be limited to those defined in the AMA Manual of

Style, current edition. A list of each abbreviation (and the corresponding

full term) used in the manuscript must be provided on the title page.

Online Manuscript Submission Process

The Turkish Journal of Hematology uses submission software powered

by ScholarOne Manuscripts. The website for submissions to The Turkish

Journal of Hematology is http://mc.manuscriptcentral.com/tjh. This

system is quick and convenient, both for authors and reviewers.

Setting Up an Account

New users to the submission site will need to register and enter their

account details before they can submit a manuscript. Log in, or click

the “Create Account” button if you are a first-time user. To create a new

account: After clicking the “Create Account” button, enter your name and

e-mail address, and then click the “Next” button. Your e-mail address is very

important. Enter your institution and address information, as appropriate,

and then click the “Next” Button. Enter a user ID and password of your

choice, select your area of expertise, and then click the “Finish” button.

If you have an account, but have forgotten your log-in details, go to

“Password Help” on the journal’s online submission system and enter your

e-mail address. The system will send you an automatic user ID and a new

temporary password.

A-VII

Full instructions and support are available on the site, and a user ID

and password can be obtained during your first visit. Full support for

authors is provided. Each page has a “Get Help Now” icon that connects

directly to the online support system. Contact the journal administrator

with any questions about submitting your manuscript to the journal

(info@tjh.com.tr). For ScholarOne Manuscripts customer support, click

on the “Get Help Now” link on the top right-hand corner of every page

on the site.

The Electronic Submission Process

Log in to your author center. Once you have logged in, click the “Submit

a Manuscript” link in the menu bar. Enter the appropriate data and

answer the questions. You may copy and paste directly from your

manuscript. Click the “Next” button on each screen to save your work

and advance to the next screen.

Upload Files

Click on the “Browse” button and locate the file on your computer. Select

the appropriate designation for each file in the drop-down menu next to

the “Browse” button. When you have selected all the files you want to

upload, click the “Upload Files” button. Review your submission before

sending to the journal. Click the “Submit” button when you are finished

reviewing. You can use ScholarOne Manuscripts at any time to check

the status of your submission. The journal’s editorial office will inform

you by e-mail once a decision has been made. After your manuscript

has been submitted, a checklist will then be completed by the Editorial

Assistant. The Editorial Assistant will check that the manuscript contains

all required components and adheres to the author guidelines. Once the

Editorial Assistant is satisfied with the manuscript it will be forwarded to

the Senior Editor, who will assign an editor and reviewers.

The Review Processs

Each manuscript submitted to The Turkish Journal of Hematology is

subject to an initial review by the editorial office in order to determine

if it is aligned with the journal’s aims and scope and complies with

essential requirements. Manuscripts sent for peer review will be assigned

to one of the journal’s associate editors that has expertise relevant to the

manuscript’s content. All accepted manuscripts are sent to a statistical

and English language editor before publishing. Once papers have been

reviewed, the reviewers’ comments are sent to the Editor, who will then

make a preliminary decision on the paper. At this stage, based on the

feedback from reviewers, manuscripts can be accepted or rejected, or

revisions can be recommended. Following initial peer-review, articles

judged worthy of further consideration often require revision. Revised

manuscripts generally must be received within 3 months of the date of

the initial decision. Extensions must be requested from the Associate

Editor at least 2 weeks before the 3-month revision deadline expires;

The Turkish Journal of Hematology will reject manuscripts that are

not received within the 3-month revision deadline. Manuscripts with

extensive revision recommendations will be sent for further review

(usually by the same reviewers) upon their re-submission. When a

manuscript is finally accepted for publication, the Technical Editor

undertakes a final edit and a marked-up copy will be e-mailed to the

corresponding author for review and any final adjustments.

Submission of Revised Papers

When revising a manuscript based on the reviewers’ and Editor’s

feedback, please insert all changed text in red. Please do not use

track changes, as this feature can make reading difficult. To submit

revised manuscripts, please log in to your author center at ScholarOne

Manuscripts. Your manuscript will be stored under “Manuscripts with

Decisions”. Please click on the “Create a Revision” link located to the right

of the manuscript title. A revised manuscript number will be created for

you; you will then need to click on the “Continue Submission” button.

You will then be guided through a submission process very similar to

that for new manuscripts. You will be able to amend any details you

wish. At stage 6 (“File Upload”), please delete the file for your original

manuscript and upload the revised version. Additionally, please upload

an anonymous cover letter, preferably in table format, including a

point-by-point response to the reviews’ revision recommendations. You

will then need to review your paper as a PDF and click the “Submit”

button. Your revised manuscript will have the same ID number as the

original version, but with the addition of an R and a number at the

end, for example, TJH-2011-0001 for an original and TJH-2011-0001.

R1, indicating a first revision; subsequent revisions will end with R2,

R3, and so on. Please do not submit a revised manuscript as a new

paper, as revised manuscripts are processed differently. If you click on

the “Create a Revision” button and receive a message stating that the

revision option has expired, please contact the Editorial Assistant at

info@tjh.com.tr to reactivate the option.

English Language and Statistical Editing

All manuscripts are professionally edited by an English language editor

prior to publication. After papers have been accepted for publication,

manuscript files are forwarded to the statistical and English language

editors before publishing. Editors will make changes to the manuscript

to ensure it adheres to TJH requirements. Significant changes or

concerns are referred to corresponding authors for editing.

Online Early

The Turkish Journal of Hematology publishes abstracts of accepted

manuscripts online in advance of their publication. Once an accepted

manuscript has been edited, the authors have submitted any final

corrections, and all changes have been incorporated, the manuscript will

be published online. At that time the manuscript will receive a Digital

Object Identifier (DOI) number. Both forms can be found at www.tjh.

com.tr. Authors of accepted manuscripts will receive electronic page

proofs directly from the printer and are responsible for proofreading

and checking the entire manuscript, including tables, figures, and

references. Page proofs must be returned within 48 hours to avoid delays

in publication.

A-VIII

CONTENTS

Research Articles

77 In Silico Study of Correlation between Missense Variations of F8 Gene and Inhibitor Formation in Severe Hemophilia A

Mostefa Fodil, Faouzia Zemani; Oran, Algeria

84 Splenic Marginal Zone Lymphoma in Turkey: Association with Hepatitis B Instead of Hepatitis C Virus as an Etiologic and Possible Prognostic

Factor - A Multicenter Cohort Study

Müfide Okay, Tuncay Aslan, Evren Özdemir, Ayşegül Üner, Arzu Sağlam, Elif Güngör, Ayşe Uysal, Nevin Alayvaz Aslan, Esra Yıldızhan, Abdullah

Ağıt, Mehmet Sinan Dal, Serdal Korkmaz, Sinem Namdaroğlu, Serdar Sivgin, Gülsüm Akgün Çağlıyan, Sinan Demircioğlu, İbrahim Barışta,

Esra Özhamam, Filiz Vural, Bülent Eser, Gülsüm Özet, Rahşan Yıldırım, Mehmet Hilmi Doğu, İlhami Berber, Mehmet Ali Erkurt, Ümit Yavuz

Malkan, Fevzi Altuntaş, Yahya Büyükaşık; Ankara, Edirne, Trabzon, Samsun, Kayseri, İzmir, Denizli, Van, Erzurum, İstanbul, Malatya, Turkey

91 Bortezomib-based Regimens Improve the Outcome of Patients with Primary or Secondary Plasma Cell Leukemia: A Retrospective Cohort

Study

Huijuan Wang, Huixing Zhou, Zhiyao Zhang, Chuanying Geng, Wenming Chen; Beijing, China

98 PTEN and AKT1 Variations in Childhood T-Cell Acute Lymphoblastic Leukemia

Fulya Küçükcankurt, Yücel Erbilgin, Sinem Fırtına, Özden Hatırnaz Ng, Zeynep Karakaş, Tiraje Celkan, Ayşegül Ünüvar, Uğur Özbek, Müge

Sayitoğlu; İstanbul, Turkey

104 Expression Profile Screening and Bioinformatics Analysis of circRNA, LncRNA, and mRNA in Acute Myeloid Leukemia Drug-Resistant Cells

Meiling Li, Fuxue Meng, Quanyi Lu; Xiamen, Duyun, China

Perspectives in Hematology

111 Endocrine and Metabolic Disorders after Hematopoietic Cell Transplantation

Annalisa Paviglianiti; Paris, France

Brief Report

116 The Impact of Early Versus Late Platelet and Neutrophil Recovery after Induction Chemotherapy on Survival Outcomes of Patients with Acute

Myeloid Leukemia

Rafiye Çiftçiler, İbrahim C. Haznedaroğlu, Nilgün Sayınalp, Osman Özcebe, Salih Aksu, Haluk Demiroğlu, Hakan Göker, Ümit Yavuz Malkan,

Yahya Büyükaşık; Ankara, Turkey

Images in Hematology

121 A Rare Chromosomal Abnormality in Chronic Lymphocytic Leukemia: t(13;13)

Akbar Safaei, Ahmad Monabati, Moeinadin Safavi; Shiraz, Tehran, Iran

123 Garland of Erythroblasts around a Macrophage: Erythroblastic Island

Chandan Kumar, Garima Jain, Anita Chopra; New Delhi, India

A-IX

Letters to the Editor

125 Percentages and Absolute Numbers of CD4+CD8+ Double-positive T Lymphocytes in the Peripheral Blood of Normal Italian Subjects:

Relationship with Age and Sex

Alessandra Marini, Daniela Avino, Monica De Donno, Francesca Romano, Riccardo Morganti; Camaiore, Pagani, Pisa, Italy

127 Double-positive T Lymphocytes Do Not Vary in Different Age Groups in Colombian Blood Donors

Miguel S. Gonzalez-Mancera, John Mario Gonzalez; Bogota, Colombia

128 A Novel Mutation in a Patient with Wiskott-Aldrich Syndrome

Yurday Öncül, Arzu Akyay, İbrahim Tekedereli; Malatya, Turkey

130 Budd-Chiari Syndrome: An Unusual Complication of AL Amyloidosis

Tarık Onur Tiryaki, İpek Yönal Hindilerden, GülçinYegen, Meliha Nalçacı; İstanbul, Turkey

132 Rare Cytogenetic Anomalies in Two Pediatric Patients with Acute Leukemia

Süreyya Bozkurt, Şule Ünal, Turan Bayhan, Fatma Gümrük, Mualla Çetin; İstanbul, Ankara, Turkey

134 Importance of DNA Sequencing for Abnormal Hemoglobins Detected by HPLC Screening

Duran Canatan, Abdullah Çim, Serpil Delibaş, Emel Altunsoy, Serdar Ceylaner; Antalya, Ankara, Turkey

135 Two Rare Pathogenic HBB Variants in a Patient with β-Thalassemia Intermedia

Veysel Sabri Hançer, Tunç Fışgın, Murat Büyükdoğan; İstanbul, Turkey

137 A Case of Myelodysplastic Syndrome in an Adult with Down Syndrome: A Rare Observation of a Well-known Pediatric Disease

Harpreet Virk, Shano Naseem; Chandigarh, India

A-X

RESEARCH ARTICLE

DOI: 10.4274/tjh.galenos.2019.2019.0094

Turk J Hematol 2020;37:77-83

In Silico Study of Correlation between Missense Variations of F8

Gene and Inhibitor Formation in Severe Hemophilia A

Ağır Hemofili A’da Yanlış Anlamlı F8 Gen Varyasyonları ile İnhibitör Oluşumu İlişkisini

İnceleyen Bilgisayar Simülasyon Çalışması

Mostefa Fodil 1 , Faouzia Zemani 2

1Higher School of Biological Sciences of Oran (ESSBO), Oran, Algeria

2Molecular and Cellular Genetics Laboratory, Oran University of Science and Technology - Mohamed Boudiaf (USTOMB), Oran, Algeria

Abstract

Objective: Deleterious substitutions of the F8 gene are responsible

for causing hemophilia A, which is an inherited bleeding disorder

resulting from reduced or absent activity of the coagulant protein

factor VIII (FVIII). The most important complication in treatment is

inhibitor development toward therapeutic factor VIII. In this study,

we aimed to analyze the effects of deleterious substitutions in the F8

gene upon protein structure and function.

Materials and Methods: All tests were conducted by computational

methods from the CHAMP (CDC Hemophilia A Mutation Project)

database. We performed an in silico analysis of deleterious variations

using five software programs, Sift, PolyPhen-2, Align-GVGD, KD4v,

and MutationTaster, in order to analyze the correlation between

variation and the disease. We also studied the correlation between

these variations and inhibitor formation.

Results: Our analysis showed that these in silico tools are coherent

and that there are more variations in the A than the C domains.

Moreover, we noticed that there are more deleterious variations than

neutral variations in each of the A and C domains. We also found that

13.51% of the patients suffered from a severe form of hemophilia A

and that carriers of missense variations developed inhibitors. Also, for

the first time, we determined that variation nature is not associated

with inhibitor formation. Furthermore, this analysis showed that the

risk of developing inhibitors increases when the variation causes a

change of amino acid class.

Conclusion: This study will help to correctly associate variations

with inhibitor development and aid in early characterization of novel

variants.

Keywords: Hemophilia A, Missense variation, In silico analysis,

Inhibitor formation, FVIII, Coagulation

Öz

Amaç: F8 genindeki patolojik varyasyonlar, pıhtılaşma faktörü VIII’in

(FVIII) azalmış ya da kaybolmuş aktivitesinden kaynaklanan ve kalıtsal

bir kanama bozukluğu olan Hemofili A’ya neden olmaktadır. Tedavide

en önemli zorluk, tedavi edici faktör VIII’e karşı inhibitör gelişimidir.

Bu çalışmada F8 gen varyasyonlarının protein yapısı ve fonksiyonu

üzerine olan etkilerini incelemeyi amaçladık.

Gereç ve Yöntemler: Tüm testler CHAMP (CDC Hemofili A Mutasyon

Projesi) veri tabanından bilgisayar hesaplama yöntemleriyle yapıldı.

Varyasyon ve hastalık arasındaki ilişkiyi araştırmak için beş farklı yazılım

programı; Sift, PolyPhen-2, Align-GVGD, KD4v ve MutationTaster

kullanarak, patojenik varyasyonların analizi yapıldı. İlave olarak bu

varyasyonlar ve inhibitör oluşumu arasındaki ilişki de incelendi.

Bulgular: Analizlerimiz bilgisayar tahmin araçlarının tutarlı olarak

A bölgesinde, C bölgesine kıyasla daha fazla varyasyon olduğunu

gösterdi. Ayrıca A ve C bölgelerinde nötral varyasyonlardan ziyade

patojenik varyasyonlar bulunduğunu fark ettik. Ayrıca hastaların

%13,51’inin ağır hemofili A olduğunu ve yanlış anlamlı varyasyon

taşıyıcılarının inhibitör geliştirdiğini bulduk. Ayrıca ilk kez varyasyon

türünün inhibitör oluşumu ile ilişkili olmadığını gösterdik. İlave olarak

bu analiz, aminoasit değişimine yol açan varyasyonların inhibitör

geliştirme riskini arttırdığını bize gösterdi.

Sonuç: Bu çalışma inhibitör gelişimi ile varyasyonları doğru bir şekilde

ilişkilendirmeye ve yeni varyasyonların erken karakterizasyonuna

yardımcı olacaktır.

Anahtar Sözcükler: Hemofili A, Yanlış anlamlı varyasyon, Bilgisayar

analizi, İnhibitör oluşumu, FVIII, Pıhtılaşma

©Copyright 2020 by Turkish Society of Hematology

Turkish Journal of Hematology, Published by Galenos Publishing House

Address for Correspondence/Yazışma Adresi: Mostefa Fodil, M.D., Higher School of Biological Sciences of Oran

(ESSBO), Oran, Algeria

Phone : +213699436929

E-mail : mostefa.fodil@gmail.com ORCID: orcid.org/0000-0003-2856-1988

Received/Geliş tarihi: March 5, 2019

Accepted/Kabul tarihi: December 24, 2019

77

Fodil M and Zemani F: Inhibitor Development and F8 Variations


Introduction

The X-linked bleeding disorder hemophilia A (HA) (OMIM

#306700) is caused by a decrease or dysfunction in circulating

blood coagulation factor VIII. This coagulation defect is present

in 1/5000 of the male population [1,2]. According to the residual

plasma FVIII coagulant activity (FVIII: C), HA can be classified

into 3 forms: severe (FVIII: C<1%), moderate (1% <FVIII: C<5%),

and mild (5% <FVIII: C<40%) [2]. Treatment of hemorrhages in

hemophiliac patients consists of protein replacement therapy

using plasma-derived or recombinant FVIII [3,4]. A serious

complication of this therapy is the development of inhibitors

(i.e. neutralizing alloantibodies against FVIII), which negate

treatment benefits [2,5,6]. This process is observed in more than

30% of patients with severe HA. However, only 3% to 13% of

patients with moderate and mild HA develop these inhibitors

[7,8]. Several studies showed that determinants of inhibitor

formation include environmental factors [9,10,11,12] as well as

the patient’s genetic background. The type of variation in the

F8 gene is the strongest risk factor for inhibitor development

[7,13]. A recent meta-analysis confirmed that the risk of

patients with large deletions and nonsense variations was

higher when compared with the risk of inhibitor development

in patients with intron 22 inversion [13]. The same study showed

that the risk of patients with intron 1 inversions and splicesite

variations was equal, and the risk of patients with small

deletions and insertions and missense variations was lower [13].

In our study, the role of F8 missense variations in inhibitor

risk was evaluated in a cohort of 407 patients with severe

HA extracted from the CDC Hemophilia A Mutation Project

(CHAMP) database [14]. We have also assessed the impact of

these missense variations on the structure and/or function of

the FVIII protein using in silico programs.

Materials and Methods

Extraction of Variation Information

The variation information of F8 was retrieved from the CHAMP

database for our analysis [14]. Among the 2537 variations listed

in the CHAMP database until 2014, we selected 407 missense

exon variations from severe hemophilia A patients for this

study. Among these variants, 296 have known inhibitor status.

Evaluation of the Variations

Clustal W2

This software uses sequence homology to study the conservation

between species during evolution [15]. The protein sequences

of Mus musculus, Rattus norvegicus, and Macaca fascicularis

were collected from the UniProt database (http://www.uniprot.

org/) regarding their phylogenetic proximity. We then aligned

these sequences to locate the variations relative to the important

regions of the genome that are most conserved.

SIFT

Sorting Intolerant From Tolerant (SIFT) is a program based

on sequence homology to predict whether an amino acid

substitution will affect protein function [16]. The scores are

classified as intolerant (0.00-0.05), potentially intolerant

(0.051-0.10), borderline (0.101-0.20), or tolerant (0.201-1.00).

A tolerant substitution does not have deleterious effects on

protein function. On the other hand, intolerant substitution

appears to have a partial or complete impact on the loss of

protein function.

PolyPhen-2

Polymorphism Phenotyping v2 (PolyPhen-2), available as

software and via a Web server, predicts the possible impact

of amino acid substitutions on the stability and function of

human proteins using structural and comparative evolutionary

considerations [17]. It is based on three types of information:

the multiple alignment, structural information from the

database structure (PDB), and the physicochemical properties

of the amino acids. Predictions of a variation’s effect on protein

structure are assigned as “probably damaging”, with a score of

≥2.000, and “possibly damaging”, with a score of 1.500-1.999,

which means that these variations may affect protein function

and/or structure. Finally, “benign”, with a score of 0.000-0.999,

signifies no likely phenotypic effect.

Align-GVGD

Align-GVGD is a freely available web-based program that

combines multiple sequence alignment and biophysical

characteristics of amino acids that are based on Grantham

distance [18]. The Grantham distance calculates the

physicochemical difference between two amino acids. If this

distance is important, it means that the two amino acids are

different. The results are established as classes C0 to C65. Classes

C45 to C65 are more likely to affect the function, while classes

C0 to C25 are less likely to affect the function.

KD4v

KD4v is based on two complementary services: the first is similar

to other prediction software such as SIFT and PolyPhen-2,

while the second is based on the information and the threedimensional

(3D) structure to predict changes in size, charge,

polarity, hydrophobicity, accessibility, and physicochemical

properties of amino acids due to a missense variation [19]. KD4v

predicts whether the variation is “neutral” or “deleterious” for

the protein.

MutationTaster

MutationTaster is a free web-based application to evaluate

DNA sequence variants for their disease-causing potential.

78



The software performs a battery of in silico tests to estimate

the impact of the variant on the gene product/protein. This

program was designed for the rapid assessment of the potential

pathogenic alterations in DNA sequences [20]. It integrates

information from different databases and biomedical analyses

that include conservation during evolution, changes in splice

sites, and the loss of protein function. MutationTaster predicts

if the variation is “disease-causing” or just a “polymorphism”.

Statistical Analysis

In order to evaluate statistical differences between different

groups (presence or absence of inhibitors) we used the chisquare

test (χ 2 ). Classical chi-square evaluation is possible when

numbers are greater than 5. An estimated p-value of less than

or equal to 0.05 was considered to be statistically significant.

Results

Among the 407 exon variations studied by ClustalW2, 378

(92.87%) are located in highly conserved regions. We applied

five in silico tools, SIFT, PolyPhen-2, Align-GVGD, KD4v, and

MutationTaster, to predict the effects of each variation on the

protein function and/or structure (Table 1).

For the rest of the analysis, we chose to take into consideration

the results of KD4V, since it is a software program based on

structure homology and also considers the information on the

three-dimensional structure. The results obtained allowed us to

classify variations as deleterious or neutral. First, we studied the

distribution of variations according to domains A (A1+A2+A3)

and C (C1+C2) of the FVIII protein. The variations located on the

B domain were not included in this study. In fact, the B domain

does not play a major role in blood clotting. Our results showed

that the A domain contains four times more variations than the

C domain (Figure 1).

We then examined the distribution of deleterious and neutral

variations according to the A and C domains. Therefore, we

calculated the frequencies of deleterious and neutral variations

in each domain: A1, A2, A3, C1, and C2. We noticed that

deleterious variations were significantly more prevalent than

neutral variations in each domain (p<0.001) (Figure 2).

Among the 407 variations, 296 (72.73%) variants have known

inhibitor status. Accordingly, 13.51% of patients developed

inhibitors, while 86.49% did not (Table 2). In order to test the

correlation between the nature of the variation (deleterious/

Table 1. Prediction results of studied variations’ effects on the protein function and/or structure.

SIFT PolyPhen-2 Align-GVGD KD4v MutationTaster

Tolerant

[0.201-1.0]

20

(4.91%)

Benign

[0-0.99]

11

(2.70%)

Less likely

[C0-C25]

76 (18.67%) Neutral

96

(23.59%)

Polymorphism 52 (12.78%)

Deleterious

[0.00-0.05]

387

(95.09%)

Possibly

damaging

[1.5-1.99]

12

(2.95%)

Intermediate

[C35]

17 (4.18%) Deleterious

311

(76.41%)

Disease

causing

355 (87.22%)

Probably

damaging

[>2.0]

384

(94.35%)

More likely

[C45-C65]

314 (77.15%)

Figure 1. Variation distribution according to the A and C domains.

Figure 2. Deleterious and neutral variation distribution according

to the A and C domains. ***: p<0.001.

79



neutral) and inhibitor formation, frequencies of deleterious and

neutral variations in the two groups of patients were calculated

(developing or not developing inhibitors). The results showed

the absence of a correlation between inhibitor development

and variation nature (Figure 3). In fact, in the group of patients

developing inhibitors, there were no statistically differences

between deleterious and neutral variations frequencies (13.54%

vs. 13.43%; p=0.9). The same results were observed in the second

group of patients that did not develop inhibitors (86.46% vs.

86.57%; p=0.9).

We then studied the impact of the localization of a variation

on the A1, A2, A3, C1, and C2 domains on inhibitor formation.

Therefore, for each domain we calculated the variant frequencies

among the group of patients developing inhibitors. Frequencies

of patients with missense variations located in the A3 and C2

domains were higher than those with variations located in the

A1, A2, and C1 domains (Figure 3). However, this difference was

not statistically significant (p=0.19).

Table 2. Distribution of single-nucleotide polymorphisms in

patients with or without inhibitors.

Inhibitors Number of variations Percentage (%)

Presence 40 13.51

Absence 256 86.49

Finally, we assigned four different classes of amino acids

according to the properties of their side chains [class 1:

hydrophobic (A, V, F, P, M, I, L, W); class 2: polar uncharged (S, Y,

N, Q, C, T, H, G); class 3: acidic (D, E); class 4: basic (K, R)] Then

we examined whether substitution caused changes in the amino

acid class. The substitution of the wild-type amino acid by an

amino acid from the same class gives an intra-class substitution.

However, its replacement by an amino acid of another class

results in inter-class substitution.

Comparison of all intra- and inter-amino acid substitutions

showed that a significantly greater incidence of inhibitor

formation was observed in the case of inter-amino acid

substitutions than intra-amino acid substitutions: 28 (70%)

vs. 12 (30%) (p=0.003, according to a normal distribution)

(Table 3).

Discussion

Alterations of the F8 gene are extremely diverse. Many

bioinformatics tools were used to assess the impact of these

variations on protein function. These are based on the study of

sequence conservation, amino acid physicochemical properties,

and the information concerning the 3D structure of the

FVIII protein [21,22,23]. In this perspective, we analyzed 407

Figure 3. Correlation between variation character (deleterious/

neutral) and inhibitor formation.

Figure 4. Correlation of variation localization on each domain

with inhibitor formation.

Table 3. Variation distribution in the patients that developed inhibitors according to the change of amino acidic class. 1:

Hydrophobic (A, V, L, I, M, P, F). 2: Polar uncharged (S, Y, N, Q, C, T, H, G). 3: Acidic (D, E). 4: Basic (K, R).

Change in 1 Change in 2 Change in 3 Change in 4 Intra-class Inter-class

1 10 3 5 5 10 13

2 2 2 3 3 2 8

3 2 0 0 1 0 3

4 2 0 2 0 0 4

Total 12 (30%) 28 (70%)

80



variations extracted from the CHAMP database. We selected

exon missense variations that are responsible for the severe

form of HA.

The conservation analysis study focused on the most important

regions that can influence the stability, the function, and the

structure of the FVIII protein. The results obtained by ClustalW2

showed that 92.87% of the analyzed variations were located in

highly conserved regions. Therefore, these variations are likely

to have a very important deleterious effect on the function of

the FVIII protein [24].

We then studied the distribution of the variations according to

the A and C domains. The variations located in the B domain

were not included in this study. In fact, the B domain does not

play a major role in blood clotting, but it is involved in intracellular

interactions such as the regulation of quality control

and secretion. Therefore, it could be considered that missense

variations located in the B domain can only affect the efficiency

of secretion of FVIII [25,26]. Indeed, if a missense variation is

identified in the B domain in a patient with HA, it would be

necessary to look for other variations in the other domains of

the F8 gene.

Our results showed that there are four times more variations in

the A domains than the C domains (80.34% vs. 19.66%, p<0.001).

This is probably due to the fact that the peptide sequences of

the A domains (1112 amino acids) are approximately three times

longer than the peptide sequences of the C domains (312 amino

acids) [27,28].

On the other hand, we studied the impact of the 407 variations

using five in silico tools, SIFT, PolyPhen-2, Align-GVGD, KD4v,

and MutationTaster, in order to predict deleterious and/or

damaging effect of variations. The combination of the results

obtained by these software programs showed that there were

more deleterious than neutral variations. This observation was

in keeping with the patients’ phenotypes as they developed

the severe form of HA. According to KD4v results, we noticed

that there were three times more deleterious variations than

neutral variations. This difference was still valid for each of

the A domains (A1, A2, and A3) and C domains (C1 and C2)

(p<0.001). This observation was in correlation with the results

obtained by MutationTaster, which predicted that 87.22%

of the variations were disease-causing and 12.78% were

polymorphisms. Regarding the neutral variations, they probably

represent polymorphisms that are not responsible for the

disease. In fact, it has been reported that in 2% to 18% of

patients with HA, no genetic alterations were detected except

polymorphisms [29,30,31]. Moreover, the A and C domains have

important interaction sites. Indeed, the activation sites of the

FVIII protein by thrombin are located in the A domain (Arg372,

Arg740, and Arg1689) [32]. Consequently, if a variation affects

one of these sites, the FVIII will not be activated and the tenase

complex will not activate the FX. This induces the arrest of the

coagulation cascade [33]. Furthermore, the C domain interacts

with von Willebrand factor and the phospholipid membrane.

These interactions are responsible for maintaining the stability

and structure of the FVIII protein [7]. Besides, the A domain has

six disulfide bonds (Cys-Cys) and the C domain contains only

two. Those bridges are responsible for the protein stability and

risk being broken because of missense variations [34].

Furthermore, in order to study the correlation between the

impact of the variations and inhibitor formation, we examined

the 296 variations that have known inhibitor status. We

have shown that 13.51% of the patients with a severe form

of HA carrying missense variations developed inhibitors. This

frequency is higher than that found in Oldenburg and Pavlova’s

study, where HA patients with missense variations had a risk of

5% of developing inhibitors [7]. This difference can be explained

by the fact that our study concerns only the severe form of HA.

In a recent study, Spena et al. [36] evaluated the association

between F8 gene variants and inhibitor development by

analyzing 231 causative variants, grouped as low-risk and

high-risk variations according to Gouw et al. [35]. Only a small

difference was observed in the cumulative inhibitor incidence

[32.0% (95% CI=18.9 to 45.1) vs. 37.9% (95% CI=29.9 to 45.9)]

for low- and high-risk variations classified corresponding to a

hazard ratio of 1.35 (95% CI=0.78-2.35) [36].

Otherwise, according to the hypothesis of Schwaab et al. [37],

the low risk of developing inhibitors in patients with missense

variations is due to the fact that patients with missense

variations synthesize some endogenous protein that, although

functionally altered, are sufficient to induce immune tolerance.

We supposed that a deleterious variation that alters the protein

function and structure might increase the risk of developing

inhibitors. We noticed that there were no correlations between

deleterious missense variations and inhibitor formation (p=0.9).

We then studied the association between the location of a

variation in the A and C domains with inhibitor formation. We

observed that these variations are located in different domains.

There were more variations located in the A3 and C2 domains

(respectively 20.55% and 18.75%) than the other domains.

However, this difference was not significant (p=0.19). Indeed,

the FVIII inhibitors recognize epitopes on all the domains [38].

Finally, we analyzed the impact of a change of physicochemical

properties of amino acids due to missense variations according

to inhibitor formation. Our data showed that the risk of

developing inhibitors increases when the variation causes

a change of amino acid class (70% vs. 30%; p=0.003). These

results support those of Schwaab et al. [37] study (91.5%).

81



This percentage decreases (8.5%) in the case of patients with

missense variations that do not cause changes in amino acid

class [37].

Conclusion

Our study showed that there are more variations in the A than the

C domain. Moreover, we noticed that there are more deleterious

than neutral variations in each of the A and C domains. For

the first time, we have determined that variation nature is not

associated with inhibitor formation. This study showed that

variations in patients developing inhibitors are localized on

both A and C domains of FVIII. Finally, we showed that the risk

of developing inhibitors increases when the variation causes a

change of amino acid class.

This analysis showed that combining information from different

tools may facilitate a better understanding for predictive

accuracy in determining the functional impact of a given

variation.

Ethics

Ethics Committee Approval: Not applicable.

Informed Consent: Not applicable.

Authorship Contributions

Concept: M.F., F.Z.; Design: M.F., F.Z.; Analysis or

Interpretation: M.F., F.Z.; Writing: M.F., F.Z.

Conflict of Interest: No conflict of interest was declared by the

authors.

Financial Disclosure: The authors declared that this study

received no financial support.

Acknowledgments: The authors state that they have no interests

that might be perceived as posing a conflict or bias.

References

1. Lenting PJ, van Mourik JA, Mertens K. The life cycle of coagulation factor

VIII in view of its structure and function. Blood 1998;92:3983-3996.

2. White GC 2nd, Rosendaal F, Aledort LM, Lusher JM, Rothschild C, Ingerslev

J; Factor VIII and Factor IX Subcommittee. Definitions in hemophilia.

Recommendation of the scientific subcommittee on factor VIII and factor

IX of the scientific and standardization committee of the International

Society on Thrombosis and Haemostasis. Thromb Haemost 2001;85:560.

3. Viel KR, Ameri A, Abshire TC, Iyer RV, Watts RG, Lutcher C, Channell C, Cole

SA, Fernstrom KM, Nakaya S, Kasper CK, Thompson AR, Almasy L, Howard

TE. Inhibitors of factor VIII in black patients with hemophilia. N Engl J Med

16 2009;360:1618-1627.

4. Mannucci PM, Tuddenham EG. The hemophilias--from royal genes to gene

therapy. N Engl J Med 2001;344:1773-1779.

5. Fulcher CA, de Graaf Mahoney S, Zimmerman TS. FVIII inhibitor IgG subclass

and FVIII polypeptide specificity determined by immunoblotting. Blood

1987;69:1475-1480.

6. Hoyer LW. The factor VIII complex: structure and function. Blood 1981;58:1-

13.

7. Oldenburg J, Pavlova A. Genetic risk factors for inhibitors to factors VIII and

IX. Haemoph Off J World Fed Hemoph 2006;12(Suppl 6):15-22.

8. Witmer C, Young G. Factor VIII inhibitors in hemophilia A: rationale and

latest evidence. Ther Adv Hematol 2013;4:59-72.

9. Bardi E, Astermark J. Genetic risk factors for inhibitors in haemophilia A. Eur

J Haematol 2015;94(Suppl 77):710.

10. Carcao M, Re W, Ewenstein B. The role of previously untreated patient

studies in understanding the development of FVIII inhibitors. Haemoph Off

J World Fed Hemoph 2016;22:22-31.

11. Gorski MM, Blighe K, Lotta LA, Pappalardo E, Garagiola I, Mancini I, Mancuso

ME, Fasulo MR, Santagostino E, Peyvandi F. Whole-exome sequencing to

identify genetic risk variants underlying inhibitor development in severe

hemophilia A patients. Blood 2016;127:2924-2933.

12. Rosendaal FR, Palla R, Garagiola I, Mannucci PM, Peyvandi F; SIPPET Study

Group. Genetic risk stratification to reduce inhibitor development in the

early treatment of hemophilia A: a SIPPET analysis. Blood 2017;130:1757-

1759.

13. Gouw SC, van den Berg HM, Oldenburg J, Astermark J, de Groot PG,

Margaglione M, Thompson AR, van Heerde W, Boekhorst J, Miller CH, le

Cessie S, van der Bom JG. F8 gene mutation type and inhibitor development

in patients with severe hemophilia A: systematic review and meta-analysis.

Blood 2012;119:2922-2934.

14. Payne AB, Miller CH, Kelly FM, Michael Soucie J, Craig Hooper W. The

CDC Hemophilia A Mutation Project (CHAMP) mutation list: a new online

resource. Hum Mutat 2013;34:E2382-2391.

15. Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, Higgins DG, Thompson

JD. Multiple sequence alignment with the Clustal series of programs.

Nucleic Acids Res 2003;31:3497-3500.

16. Ng PC, Henikoff S. SIFT: Predicting amino acid changes that affect protein

function. Nucleic Acids Res 2003;31:3812-3814.

17. Sunyaev S, Ramensky V, Bork P. Towards a structural basis of human nonsynonymous

single nucleotide polymorphisms. Trends Genet 2000;16:198-

200.

18. Tavtigian SV, Byrnes GB, Goldgar DE, Thomas A. Classification of rare

missense substitutions, using risk surfaces, with genetic- and molecularepidemiology

applications. Hum Mutat 2008;29:1342-1354.

19. Luu TD, Rusu A, Walter V, Linard B, Poidevin L, Ripp R, Moulinier L, Muller J,

Raffelsberger W, Wicker N, Lecompte O, Thompson JD, Poch O, Nguyen H.

KD4v: Comprehensible Knowledge Discovery System for Missense Variant.

Nucleic Acids Res 2012;40:W71-75.

20. Schwarz JM, Rödelsperger C, Schuelke M, Seelow D. MutationTaster

evaluates disease-causing potential of sequence alterations. Nat Methods

2010;7:575-576.

21. Hamasaki-Katagiri N, Salari R, Wu A, Qi Y, Schiller T, Filiberto AC, Schisterman

EF, Komar AA, Przytycka TM, Kimchi-Sarfaty C. A gene-specific method for

predicting hemophilia-causing point mutations. J Mol Biol 2013;425:4023-

4033.

22. Doss CGP. In silico profiling of deleterious amino acid substitutions of

potential pathological importance in haemophlia A and haemophlia B. J

Biomed Sci 2012;19:30.

23. Liu ML, Shen BW, Nakaya S, Pratt KP, Fujikawa K, Davie EW, Stoddard

BL, Thompson AR. Hemophilic factor VIII C1- and C2-domain missense

mutations and their modeling to the 1.5-angstrom human C2-domain

crystal structure. Blood 2000;96:979-987.

24. Sengupta M, Sarkar D, Ganguly K, Sengupta D, Bhaskar S, Ray K. In silico

analyses of missense mutations in coagulation factor VIII: identification of

severity determinants of haemophilia A. Haemoph Off J World Fed Hemoph

2015;21:662-669.

82



25. Bogdanova N, Markoff A, Eisert R, Wermes C, Pollmann H, Todorova A,

Chlystun M, Nowak-Göttl U, Horst J. Spectrum of molecular defects and

mutation detection rate in patients with mild and moderate hemophilia A.

Hum Mutat 2007;28:54-60.

26. Jayandharan G, Shaji RV, Baidya S, Nair SC, Chandy M, Srivastava A.

Identification of factor VIII gene mutations in 101 patients with haemophilia

A: mutation analysis by inversion screening and multiplex PCR and CSGE

and molecular modelling of 10 novel missense substitutions. Haemoph Off

J World Fed Hemoph 2005;11:481-491.

27. Oldenburg J. Mutation profiling in haemophilia A. Thromb Haemost

2001;85:577-579.

28. Pipe SW. Functional roles of the factor VIII B domain. Haemoph Off J World

Fed Hemoph 2009;15:1187-1196.

29. Ogata K, Selvaraj SR, Miao HZ, Pipe SW. Most factor VIII B domain missense

mutations are unlikely to be causative mutations for severe hemophilia A:

implications for genotyping. J Thromb Haemost 2011;9:1183-1190.

30. Saenko EL, Ananyeva NM, Tuddenham EGD, Kemball-Cook G. Factor VIII -

novel insights into form and function. Br J Haematol 2002;119:323-331.

31. Thompson AR. Structure and function of the factor VIII gene and protein.

Semin Thromb Hemost 2003;29:11-22.

32. Pittman DD, Kaufman RJ. Proteolytic requirements for thrombin

activation of anti-hemophilic factor (factor VIII). Proc Natl Acad Sci U S A

1988;85:2429-2433.

33. Butenas S, van’t Veer C, Mann KG. “Normal” thrombin generation. Blood

1999;94:21692178.

34. McMullen BA, Fujikawa K, Davie EW, Hedner U, Ezban M. Locations

of disulfide bonds and free cysteines in the heavy and light chains of

recombinant human factor VIII (antihemophilic factor A). Protein Sci Publ

Protein Soc 1995;4:740-746.

35. Gouw SC, van der Bom JG, Ljung R, Escuriola C, Cid AR, Claeyssens-Donadel

S, van Geet C, Kenet G, Mäkipernaa A, Molinari AC, Muntean W, Kobelt R,

Rivard G, Santagostino E, Thomas A, van den Berg HM; PedNet and RODIN

Study Group. Factor VIII products and inhibitor development in severe

hemophilia A. N Engl J Med 2013;368:231-239.

36. Spena S, Garagiola I, Cannavò A, Mortarino M, Mannucci PM, Rosendaal

FR, Peyvandi F; SIPPET Study Group. Prediction of factor VIII inhibitor

development in the SIPPET cohort by mutational analysis and factor VIII

antigen measurement. J Thromb Haemost 2018;16:778-790.

37. Schwaab R, Pavlova A, Albert T, Caspers M, Oldenburg J. Significance of F8

missense mutations with respect to inhibitor formation. Thromb Haemost

2013;109:464-470.

38. Chaves DG, Velloso-Rodrigues C, Moreau V, Nguyen C, Villard S, Belisário

AR, Granier C, Santoro MM. Reactivity profile of anti-factor VIII antibodies

with designed synthetic peptides mimicking epitopes of the C2 and a1

domains. Br J Haematol 2008;141:708-715.

83

RESEARCH ARTICLE

DOI: 10.4274/tjh.galenos.2019.2019.0177


Splenic Marginal Zone Lymphoma in Turkey: Association with

Hepatitis B Instead of Hepatitis C Virus as an Etiologic and

Possible Prognostic Factor - A Multicenter Cohort Study

Türkiye’de Splenik Marjinal Zon Lenfoma: Hepatit C Virüs Yerine Hepatit B Virüsünün

Etiyolojik ve Olası Prognostik Faktör Oluşu-Çok Merkezli Kohort Çalışması

Müfide Okay 1 , Tuncay Aslan 1 , Evren Özdemir 2 , Ayşegül Üner 3 , Arzu Sağlam 3 , Elif Güngör 4 , Ayşe Uysal 5 ,

Nevin Alayvaz Aslan 6 , Esra Yıldızhan 7 , Abdullah Ağıt 8 , Mehmet Sinan Dal 9 , Serdal Korkmaz 10 , Sinem Namdaroğlu 11 ,

Serdar Sivgin 12 , Gülsüm Akgün Çağlıyan 13 , Sinan Demircioğlu 14 , İbrahim Barışta 15 , Esra Özhamam 16 , Filiz Vural 17 ,

Bülent Eser 7 , Gülsüm Özet 8 , Rahşan Yıldırım 18 , Mehmet Hilmi Doğu 19 , İlhami Berber 20 , Mehmet Ali Erkurt 21 ,

Ümit Yavuz Malkan22, Fevzi Altuntaş9,23, Yahya Büyükaşık1

1Hacettepe University Faculty of Medicine, Department of Internal Medicine, Division of Hematology, Ankara, Turkey

2Medicana International Ankara Hospital, Clinic of Medical Oncology, Ankara, Turkey

3Hacettepe University Faculty of Medicine, Department of Pathology, Ankara, Turkey

4Trakya University Faculty of Medicine, Department of Internal Medicine, Edirne, Turkey

5University of Health Sciences, Trabzon Kanuni Training and Research Hospital, Division of Hematology, Trabzon, Turkey

6Ondokuz Mayıs University Faculty of Medicine, Department of Hematology, Samsun, Turkey

7Erciyes University Faculty of Medicine, Department of Hematology, Kayseri, Turkey

8Ankara Numune Training and Research Hospital, Division of Hematology, Ankara, Turkey

9University of Health Sciences, Ankara Oncology Training and Research Hospital, Clinic of Hematology and BMT Unit, Ankara, Turkey

10Kayseri Training and Research Hospital, Division of Hematology, Kayseri, Turkey

11University of Health Sciences, İzmir, Turkey

12Acıbadem Kayseri Hospital, Kayseri, Turkey

13Denizli State Hospital, Division of Hematology, Denizli, Turkey

14Yüzüncü Yıl University Faculty of Medicine, Department of Hematology, Van, Turkey

15Hacettepe University Faculty of Medicine, Department of Medical Oncology, Ankara, Turkey

16Ankara Numune Training and Research Hospital, Division of Pathology, Ankara, Turkey

17Ege University Faculty of Medicine, Department of Internal Medicine, Division of Hematology, İzmir, Turkey

18Atatürk University Faculty of Medicine, Department of Hematology, Erzurum, Turkey

19İstanbul Training and Research Hospital, Clinic Hematology, İstanbul, Turkey

20Malatya Training and Research Hospital, Division of Hematology, Malatya, Turkey

21İnönü University Faculty of Medicine, Department of Internal Medicine, Division of Hematology, Malatya, Turkey

22University of Health Sciences, Dışkapı Yıldırım Beyazıt Training and Research Hospital, Clinic of Hematology, Ankara, Turkey

23Yıldırım Beyazıt University Faculty of Medicine, Department of Internal Medicine, Division of Hematology, Ankara, Turkey



Address for Correspondence/Yazışma Adresi: Müfide Okay, M.D., Hacettepe University Faculty of Medicine,

Department of Internal Medicine, Division of Hematology, Ankara, Turkey

Phone : +903123051536

E-mail : mufide_okay@yahoo.com ORCID: orcid.org/0000-0001-5317-0597

Received/Geliş tarihi: May 5, 2019

Accepted/Kabul tarihi: October 18, 2019

84


Okay M, et al: Splenic Marginal Zone Lymphoma in Turkey

Abstract

Objective: Chronic antigenic stimulation is frequently blamed in

the pathogenesis of extranodal marginal zone lymphomas including

splenic marginal zone lymphoma (SMZL). Chronic hepatitis C is

frequently observed in SMZL patients in some geographical regions.

However, these reports are largely from North America and Europe,

and data from other countries are insufficient. In this multicenter

study we aimed to identify the clinical characteristics of SMZL patients

in Turkey, including viral hepatitis status and treatment details.

Materials and Methods: Data were gathered from participating

centers from different regions of Turkey using IBM SPSS Statistics

23 for Windows. Hepatitis B virus surface antigen (HBsAg), anti-HBs

antibody, anti-HB core antigen antibody (anti-HBcAg), HB viral load,

anti-hepatitis C virus (HCV) antibody, HCV viral load results were

analyzed.

Results: One hundred and four patients were reported. Hepatitis C

virus positivity was observed in only one patient. However, hepatitis

B virus surface antigen (HBsAg) positivity was observed in 11.2%

and HBsAg and/or anti-HB core antigen antibody (anti-HBcAg)

positivities were seen in 34.2% of the patients. The median age was

60 years (range=35-87). Median follow-up duration was 21.2 months

(range=00.2-212; 23.2 months for surviving patients). Median overall

survival was not reached. Estimated 3-year and 10-year survival

rates were 84.8% and 68.9%, respectively. Older age, no splenectomy

during follow-up, platelet count of <90x10 3 /µL, lower albumin, higher

lactate dehydrogenase, higher β 2

-microglobulin, and HBsAg positivity

were associated with increased risk of death. Only albumin remained

significant in multivariable analysis.

Conclusion: These results indicate that hepatitis B virus may be a

possible risk factor for SMZL in our population. It may also be an

indirect prognostic factor.

Keywords: Low-grade lymphoma, Hepatitis B virus, Hepatitis C virus,

Risk factors

Öz

Amaç: Splenik marjinal zon lenfoma’yı da (SMZL) içeren ekstranodal

marjinal zon lenfomaların patogenezinde, kronik antijenik stimülasyon

sorumlu olan mekanizmadır. Bazı coğrafik bölgelerde SMZL

hastalarında kronik hepatit C sıklıkla gözlenir. Fakat bu çalışmalar

sıklıkla kuzey Amerika ve Avrupa’dandır. Diğer ülkelerden veriler

sınırlıdır. Bu çalışma ile Türkiye’deki SMZL hastalarının hepatit serolojisi

durumları ve tedavi yöntemlerinin ortaya konulması amaçlanmıştır.

Gereç ve Yöntemler: Türkiye’de farklı merkezlerden IBM SPSS

Statistics for Windows v23 elektronik tablo kullanılarak veriler

toplanmıştır. Hepatit B virüs yüzey antijeni (HBsAg), Anti-HBs antikor,

Anti-HB kor antijen antikoru (anti-HBcAg), HB virüs yükü, anti-hepatit

C virüs (HCV) antikoru, HCV virüs yükü sonuçları analiz edilmiştir.

Bulgular: Yüz dört hastanın verilerine ulaşılmıştır. Hepatit C virüs

pozitifliği sadece 1 hastada tespit edilmiştir. Hepatit B virüs yüzey

antijeni (HBsAg) pozitifliği %11,2, HBsAg ve/veya hepatit B kor antijen

antikoru (anti-HBcAg) pozitifliği %34,2 oranında tespit edilmiştir.

Ortanca yaş 60 yıl (35-87) olarak saptanmıştır. Ortanca izlem süresi

21,2 (0,2-212) ay (yaşayan hastalar için 23,2 ay) olarak bulunmuştur.

Ortanca genel sağkalım (GS) süresine ulaşılamamıştır. Tahmini 3-yıl

ve 10-yıl GS oranları %84,8 ve %68,9 olarak bulunmuştur. İleri yaş,

splenektomi yapılmaması, <90x10 3 /µL platelet sayısı, hipoalbuminemi,

laktat dehidrogenaz yüksekliği, β 2

-mikroglobulin yüksekliği ve

HBsAg pozitifliği sağkalımla ilişkili faktörler olarak bulunmuştur. Çok

değişkenli analizde, sadece albumin düşüklüğü istatistiksel olarak

anlamlı saptanmıştır.

Sonuç: Bu çalışmanın sonuçlarına göre, toplumumuzda SMZL için

hepatit B virüsü olası bir risk faktörü olabilir. Aynı zamanda indirek bir

prognostik gösterge olabilir.

Anahtar Sözcükler: Düşük dereceli lenfoma, Hepatit B virüs, Hepatit

C virüs, Risk faktörleri

Introduction

Splenic marginal zone lymphoma (SMZL) is a rare B-cell

lymphoma. It constitutes less than 2% of lymphoid neoplasms

[1]. The majority of patients have an indolent course with

median overall survival of about 10 years [2,3].

Chronic hepatitis C is frequently observed in SMZL patients.

However, these reports are largely from North America and

Europe [4,5]. Data from various countries with different

hepatitis prevalence rates are lacking.

Many prognostic factors have been described for SMZL, such

as leukocytosis, thrombocytopenia, elevated β 2

-microglobulin,

anemia, elevated lactate dehydrogenase (LDH), decreased

albumin, impaired performance status, advanced age, bone

marrow involvement, and histologic transformation [6,7,8,9,10].

Various clinical prognostic scores have been described, but

no universally accepted risk stratification formula has been

identified.

No curative treatment has been described for this indolent

neoplastic disorder. Treatment is indicated in the case of

symptomatic disease and/or significant cytopenia. Splenectomy,

rituximab, rituximab plus single-agent or multiagent

chemotherapy regimens, and recently ibrutinib and idelalisib

have been reported to give high treatment success rates [11].

In this multicenter cohort study we aimed to identify the

clinical characteristics of SMZL patients in Turkey including viral

hepatitis status, treatment details, and survival.


Data were gathered from voluntarily participating centers

from different regions of Turkey using IBM SPSS Statistics

23 for Windows (IBM Corp., Armonk, NY, USA). The diagnosis

of SMZL, established by the local hematopathologist, was

accepted. Diagnoses were based on widening of the white

pulp without predominant red pulp involvement and a wide

immunohistochemical panel that helped rule out other lowgrade

B-cell lymphomas and clinicopathologic correlation.

85



The neoplastic B-cell population was immunophenotypically

required to lack cyclin D1, CD10, Bcl-6, CD123, annexin-1, and coexpression

of CD5 and CD23. A central review in our department

of pathology was not obligatory, but statistical evaluations were

repeated in the group of cases (n=40) diagnosed at the primary

research center, Hacettepe University’s Faculty of Medicine

(HUFM). In the case of atypical clinical presentation (e.g., presence

of prominent lymphadenopathies in addition to splenomegaly),

unexpected morphological, and/or immunophenotypic

findings, the submitting center was contacted to confirm the

diagnosis. As presented in Table 1, the following data were

recorded: age; sex; main reasons for admission to the hospital;

leukocyte, lymphocyte, and neutrophil counts and hemoglobin

level, platelet count, serum albumin, and β 2

-microglobulin at

diagnosis; CD5, CD10, CD20, CD23, CD7, CD103, surface Ig,

cyclin D1, and FMC7 results (immunohistochemical or flow

cytometry); spleen size; bone marrow involvement; extranodal

involvement site; ECOG performance status; and hepatitis

B virus surface antigen (HBsAg), anti-HBs antibody, anti-HB

core antigen antibody (anti-HBc), HB viral load, anti-hepatitis

C virus (HCV) antibody, and HCV viral load results. In addition,

the first treatment choice (watch-and-wait, splenectomy,

chemoimmunotherapy, etc.), treatment response, and survival

status were recorded. Treatment responses were defined as

previously reported [12]: 1) hematological improvement (after

splenectomy): at least 50% improvement in blood counts; 2)

partial response: ≥50% improvement in spleen size, cytopenias,

and lymphadenopathies if present, and decrease in the level of

marrow lymphoid infiltration; 3) complete response: resolution

of organomegaly, normalization of blood counts (hemoglobin

>12 g/dL, platelet count >100x10 3 /µL, neutrophils >1.5x10 3 /µL),

no evidence of circulating clonal B cells, and no or minor BM

infiltration detected by immunohistochemistry; 4) no response

or progressive disease: less than partial response or disease

progression.


Categorical and continuous data were expressed as ratio (%)

and median (range) and they were compared by chi-square

and independent samples t-tests, respectively. Survival analyses

were computed by the Kaplan-Meier method. Overall survival

(OS) was calculated from presentation to the date of mortality

due to any reason. Patients who had not died at the last followup

were censored at that time. Parameters related to survival

were investigated by Cox regression univariate and multivariate

analyses. All 7 parameters in Table 2 were included in the

multivariable model. All patients gave informed consent for

their treatment and information analyses. This study complied

with the Declaration of Helsinki. IBM SPSS Statistics 23 for

Windows was used for statistical analyses. Values of p<0.05

were considered statistically significant.

Results

A total of 104 patients, diagnosed between June 1999 and

November 2017, were reported from 23 hematology/oncology

centers. Forty-seven (45%) of these were diagnosed/confirmed

at our center. Data on baseline clinical characteristics are

presented in Table 1. The median age was 60 years (range=35-87),

Table 1. Baseline characteristics and main treatment details

of patients.

Clinical Parameters n=104

Median age, years (range) 60 (35-87)

Female/male 65 (62.5%)/39 (37.5%)

Median (range) interval between

admission and diagnosis (months)

Main reason for admission

Cytopenia symptoms

Abdominal complaints

B symptoms

Liver dysfunction

Frequency of symptoms at diagnosis

Cytopenia symptoms

Abdominal complaints

B symptoms

Coincidental

ECOG performance score at diagnosis

Asymptomatic

1

2

3

1.6 (0-85)

26 (26.8%)

44 (45.4%)

25 (25.8%)

2 (2.1%)

46 (44.2%)

63 (58.6%)

48 (46.1%)

9 (8.6%)

21/95 (20.2%)

45/95 (43.3%)

22/95 (21.2%)

7/95 (6.7%)

Bone marrow involvement 81/98 (82.6%)

Peripheral blood involvement 51/91 (56%)

Lymphadenopathy 51/100 (51%)

Extranodal involvement 26/102 (25.5%)

Spleen length on ultrasound/computed

tomography, median (range)

22 (13-32)

HbsAg 11/98 (11.2%)

Anti-HCV 1/93 (1.1%)

HbsAg or anti-HBc 26/76 (34.2%)

Upfront management

Watch-and-wait 19/103 (18.4%)

Splenectomy 51/103 (49.5%)

CH (O)P±R* 18/103 (17.5%)

Purine analog ± R 6/103 (5.8%)

Other 9/103 (8.7%)

Best responses (in treated patients)

during follow-up

No response 4/79 (5.1%)

Hematological improvement 40/79 (50.6%)

Partial response 11/79 (13.9%)

Complete response 24/79 (30.4%)

*CH(O)P±R: Cyclophosphamide, doxorubicin, vincristine, prednisone ± rituximab.

86



and 62.5% of the patients were female. Cytopenia(s) and/or

related symptoms (26.8%) and abdominal discomfort (45.4%)

were the most frequent reasons for hospital admission. At

presentation, 46.1% of patients had B symptoms (fever, night

sweats, weight loss), while 8.6% of the patients lacked diseaserelated

symptoms and were diagnosed incidentally. According to

ECOG performance scoring, 22.1%, 47.4%, 23.2%, and 7.4% of

patients were scored as 0, 1, 2, and 3, respectively. At diagnosis,

77.9% and 49% of patients had bone marrow and peripheral

blood involvement, respectively, while 17.3% of patients had

prominent lymphadenopathies in addition to splenomegaly.

Eleven of 98 (11.2%) evaluable patients had HBsAg positivity

and only 1 of 93 (1.1%) evaluable patients had HCV positivity.

Twenty-two of 74 (29.7%) evaluable patients had anti-HBc

positivity. The rate of HBsAg and/or anti-HBc positivity was

34.2%. The rate of HBsAg and/or anti-HBc positivity was 30.2%

in these cases. The rates of HBsAg and anti-HBc positivities were

13% and 27.9%, respectively, in the cases diagnosed at HUFM.

All positive HBV patients received antiviral prophylaxis.

[1.00 (1.00-1.00)], higher β 2

-microglobulin [1.00 (1.00-1.00)],

and HBsAg positivity [0.27 (0.08-0.88)] were associated with

increased risk of death in the univariate analyses. Only serum

albumin level remained marginally significant in multivariate

analysis [0.09 (0.00-1.04)]. Univariate and multivariate analyses

for survival are shown in Table 2.

Discussion

In this analysis we report increased prevalence of chronic HBV

infection in SMZL patients. HBV exposure is prevalent among

adults in Turkey. The reported rate of HBsAg positivity in blood

donors was approximately 2%-3% during the last decade

[13,14]. In recent epidemiological data, the prevalence was

reported as close to 4% [15]. Anti-HCV positivity was reported

to be close to 1% in our country [16]. HBsAg was 3.7% and anti-

HCV Ab positivity was 2.8% in lymphoma patients in another

study from Turkey [17]. We previously reported interim results

of this study in 2016 [18]. To the best of our knowledge, we

were the first group to suggest a possible association between

Wait-and-watch strategies, splenectomy, and chemo(immune)-

therapy were the frontline management methods for 18.4%,

49.5%, and 32.1% of patients, respectively. Only 79 patients

were evaluated for response. Hematological improvement

and complete response were obtained in the majority of

patients (Table 1). Median follow-up duration was 21.2 months

(range=0.2-212; 23.2 months for surviving patients). Fourteen

(13.4%) patients died during follow-up. Median OS was not

reached. Estimated 3-year and 10-year survival rates were

84.8% and 68.9%, respectively (Figure 1).

Older age [hazard ratio (HR), confidence interval (CI): 1.10

(1.03-1.17)], no splenectomy during follow-up [3.88 (1.26-

11.88)], platelet counts of <90x10 3 /µL at presentation [3.84

(1.31-11.20)], lower albumin [0.13 (0.03-0.47)], elevated LDH

Table 2. Univariate and multivariate analyses for survival.

Univariate analysis

Figure 1. Overall survival of all patients.

Multivariate analysis

Parameter P Odds ratio (OR) 95% confidence interval p OR 95% confidence interval

Age 0.00 1.10 1.03-1.17 0.23 1.07 0.95-1.22

Albumin 0.00 0.13 0.03-0.47 0.05 0.09 0.00-1.04

HBsAg positivity 0.03 0.27 0.08-0.88 0.18 0.16 0.01-2.44

Lactate dehydrogenase 0.02 1.00 1.00-1.00 0.96 1.00 0.99-1.00

Splenectomy 0.01 3.88 1.26-11.88 0.46 2.33 0.24-22.13

Platelets

<90x10 3 /µL

0.01 3.84 1.31-11.20 0.24 2.40 0.54-10.66

b 2

-microglobulin 0.00 1.00 1.00-1.00 0.94 1.00 1.00-1.00

87



HBV and SMZL in a considerably large SMZL cohort. Some other

studies reported on only a few patients with SMZL associated

with HBV [19,20,21,22,23]. Recently, Fetica et al. [24] from

Romania found HBV infection in 3 patients out of 34 SMZL

patients in the same time period as our early report. A more

recent study from China reported HBsAg positivity in 25/160

(16%) and resolved HBV infection (HBsAg negative, anti-HBc

positive) in 54/160 (34%) patients [25]. A summary of the data

in the literature on HBV and HCV seropositivity is shown in Table

3 [19,20,21,22,23,24,25,26,27,28,29].

Chronic antigenic stimulation is frequently blamed in the

pathogenesis of extranodal marginal zone lymphomas. The

association between gastric mucosa-associated lymphoid tissue

lymphoma and chronic Helicobacter pylori infection is the

classical example for this relationship. An association between

HCV and SMZL has been previously reported in some geographic

regions, mostly in South Europe [2,5,29]. Now we can suggest

that the association between SMZL and chronic viral hepatitis

is not specific for HCV. HBV may also be involved in SMZL

lymphomagenesis.

Splenectomy and rituximab-based chemoimmunotherapies

were the most frequently used treatments in our cohort. This

is in concordance with current treatment strategies for SMZL.

Responses (most commonly hematological improvement after

splenectomy as expected) were very frequent (94.9%) in our

cohort. The median follow-up duration (21.2 months) in our

patients was relatively short for this indolent lymphoma.

Estimated 10-year survival was 68.6%. We found many

parameters (lower albumin, splenectomy, thrombocytopenia,

elevated LDH, higher b 2

-microglobulin, and HBsAg positivity)

to be associated with overall survival, but albumin was the

only parameter to retain marginal significance in multivariate

analysis (Figure 2). HBsAg positivity was an adverse prognostic

factor in univariate analysis, but not in the multivariate test. It

is possible that HBV may indirectly affect survival by lowering

serum albumin levels due to liver impairment. This suggestion

should be investigated in further studies.

Arcaini et al. [2] reported 10-year OS as 65% in SMZL. In that

study, the authors proposed a prognostic model including

hemoglobin of <12 g/dL, elevated LDH, and albumin level of <3.5

Table 3. Summary of the data in the literature about hepatitis B and C.

Reference

Type

[19] Case report 1

[20] Letter to the editor 1

[22] Case report 1

[26] Case report 1

[23] Research article 129


Number of

patients

Important clinical features

56-year-old Lebanese male patient with B symptoms and elevated liver

enzymes was diagnosed with HBV infection; after 6 months, SMZL was

diagnosed due to persistent splenomegaly

38-year-old male Greek patient with a history of chronic HBV infection was

diagnosed with SMZL with developing B symptoms and splenomegaly

64-year-old Chinese man with cirrhosis (HBV-positive) was diagnosed with

hepatocellular cancer and SMZL (mass in liver and spleen)

42-year-old Caucasian male patient with a history of chronic HCV infection

was diagnosed with SMZL with increased lymphocyte count and mild

splenomegaly

129 adult patients were consecutively diagnosed with SMZL in Italian

hematological centers; HCV seropositivity was 16/129 (16%)

731 lymphoma cases from Romania with Hodgkin lymphoma (160 cases),

NHLs (571 cases), and SMZL (34 cases); results of tests for viral hepatitis

infection were available for 17 cases (17/34); 2/17 (11.7%) patients were

positive for HCV and 3/17 (17.7%) patients were positive for HBV


1052 MZL cases with EMZL (633 cases), NMZL (157 cases), and SMZL (140

cases) and 13766 controls from 12 case-control studies; HCV seropositivity

was 3.2%, OR was 3.04 (95% CI: 1.65-5.60)




Study was based on real-life data from Italy; HCV positivity was 3.1% in 100

SMZL patients

Study was conducted with 160 SMZL patients from China; 25 patients (16%)

were HBsAg-positive and 54 (34%) patients had resolved HBV infection; IGH

gene was analyzed in 39 patients; patients with HBV infection presented

biased IGHV-D-J rearrangements and mutational status

9 SMZL patients with HCV infection from France who received IFN alpha had

remission; in contrast, none of the six HCV-negative patients had a response

to IFN therapy

HBV: Hepatitis B infection, HCV: hepatitis C infection, MZL: marginal zone lymphoma, EMZL: extranodal marginal zone lymphoma, NMZL: nodal marginal zone lymphoma,

OR: odds ratio, CI: confidence interval, IFN alpha: interferon alpha.

88



S.K., S.N., S.S., G.A.C., S.D., I.B., E.O., F.V., M.T., B.E., G.O., R.Y.,

M.H.D., I.B., M.A.E., F.A., Y.B.; Analysis or Interpretation: M.O.,

U.Y.M., Y.B.; Literature Search: M.O., U.Y.M., Y.B.; Writing: M.O.,

U.Y.M., Y.B.


authors.

Financial Disclosure: This research did not receive any specific

grants from funding agencies in the public, commercial, or notfor-profit

sectors.

Figure 2. Overall survival according to serum albumin level at

diagnosis.

g/dL as adverse prognostic factors. In another study, Montalbán

et al. [5] developed a continuous model for estimating

lymphoma-specific survival including decreased hemoglobin

level, lower platelet count, elevated LDH, and extrahilar

lymphadenopathy as unfavorable prognostic indicators. In a

recent Chinese study [25], the authors also suggested a new

prognostic system. Decreased hemoglobin, HBsAg positivity, and

complex karyotype were related to decreased survival in that

study. We did not intend to develop a prognostic scoring system

or to test previously suggested scoring systems in our study,

but it is convincing to observe that many of the risk factors we

identified in univariate analyses have been previously reported

to have prognostic significance in SMZL.

The major limitations of this study are its retrospective design

and somewhat limited number of patients.

Conclusion

Our results in association with some recent literature data

indicate that HBV may be a possible risk factor for development

of SMZL in some geographical regions, similar to HCV in some

Western countries. It may also be an indirect prognostic factor.

Larger studies about this rare lymphoma would obviously

provide better data and firmer conclusions on this relationship

and the prognostic impact of HBV.

Ethics

Ethics Committee Approval: Retrospective study.

Informed Consent: Approval was obtained from the patients

during their first hospitalization as most of them were being

treated in the hospital.


Concept: M.O., H.G., Y.B.; Design: M.O., H.G., Y.B.; Data Collection

or Processing: M.O., T.O., E.O., E.G., A.U., N.A.A., E.Y., A.A., M.S.D.,

Acknowledgments: The interim results of this study were

presented at the American Society of Hematology 2016 Annual

Meeting.

Gülsüm Emel Pamuk, M.D., previously affiliated with Trakya

University’s Faculty of Medicine, could not be contacted during

the preparation and submission of this paper. We would like to

thank her for her contributions.

References

1. Swerdlow SH, Campo E, Pileri SA, Harris NL, Stein H, Siebert R, Advani R,

Ghielmini M, Salles GA, Zelenetz AD, Jaffe ES. The 2016 revision of the

World Health Organization classification of lymphoid neoplasms. Blood

2016;127:2375-2390.

2. Arcaini L, Lazzarino M, Colombo N, Burcheri S, Boveri E, Paulli M, Morra E,

Gambacorta M, Cortelazzo S, Tucci A, Ungari M, Ambrosetti A, Menestrina

F, Orsucci L, Novero D, Pulsoni A, Frezzato M, Gaidano G, Vallisa D, Minardi

V, Tripodo C, Callea V, Baldini L, Merli F, Federico M, Franco V, Iannitto E;

Integruppo Italiano Linfomi. Splenic marginal zone lymphoma: a prognostic

model for clinical use. Blood 2006;107:4643-4649.

3. Olszewski AJ, Castillo JJ. Survival of patients with marginal zone lymphoma:

analysis of the Surveillance, Epidemiology, and End Results database. Cancer

2013;119:629-638.

4. Peveling-Oberhag J, Crisman G, Schmidt A, Döring C, Lucioni M, Arcaini

L, Rattotti S, Hartmann S, Piiper A, Hofmann WP, Paulli M, Küppers R,

Zeuzem S, Hansmann ML. Dysregulation of global microRNA expression in

splenic marginal zone lymphoma and influence of chronic hepatitis C virus

infection. Leukemia 2012;26:1654-1662.

5. Montalbán C, Abraira V, Arcaini L, Domingo-Domenech E, Guisado-Vasco P,

Iannitto E, Mollejo M, Matutes E, Ferreri A, Salar A, Rattotti S, Carpaneto A,

Pérez Fernández R, Bello JL, Hernández M, Caballero D, Carbonell F, Piris MA;

Splenic Marginal Zone Lymphoma Study Group. Risk stratification for splenic

marginal zone lymphoma based on haemoglobin concentration, platelet

count, high lactate dehydrogenase level and extrahilar lymphadenopathy:

development and validation on 593 cases. Br J Haematol 2012;159:164-

171.

6. Thieblemont C, Felman P, Berger F, Dumontet C, Arnaud P, Hequet O, Arcache

J, Callet-Bauchu E, Salles G, Coiffier B. Treatment of splenic marginal zone

B-cell lymphoma: an analysis of 81 patients. Clin Lymphoma 2002;3:41-47.

7. Troussard X, Valensi F, Duchayne E, Garand R, Felman P, Tulliez M, Henry-

Amar M, Bryon PA, Flandrin G. Splenic lymphoma with villous lymphocytes:

clinical presentation, biology and prognostic factors in a series of 100

patients. Groupe Francais d’Hématologie Cellulaire (GFHC). Br J Haematol

1996;93:731-736.

8. Parry-Jones N, Matutes E, Gruszka-Westwood AM, Swansbury GJ,

Wotherspoon AC, Catovsky D. Prognostic features of splenic lymphoma with

villous lymphocytes: a report on 129 patients. Br J Haematol 2003;120:759-

764.

89



9. Chacón JI, Mollejo M, Muñoz E, Algara P, Mateo M, Lopez L, Andrade J,

Carbonero IG, Martínez B, Piris MA, Cruz MA. Splenic marginal zone

lymphoma: clinical characteristics and prognostic factors in a series of 60

patients. Blood 2002;100:1648-1654.

10. Lenglet J, Traullé C, Mounier N, Benet C, Munoz-Bongrand N, Amorin S,

Noguera ME, Traverse-Glehen A, Ffrench M, Baseggio L, Felman P, Callet-

Bauchu E, Brice P, Berger F, Salles G, Brière J, Coiffier B, Thieblemont C.

Long-term follow-up analysis of 100 patients with splenic marginal

zone lymphoma treated with splenectomy as first-line treatment. Leuk

Lymphoma 2014;55:1854-1860.

11. Dreyling M, Thieblemont C, Gallamini A, Arcaini L, Campo E, Hermine O,

Kluin-Nelemans JC, Ladetto M, Le Gouill S, Iannitto E, Pileri S, Rodriguez

J, Schmitz N, Wotherspoon A, Zinzani P, Zucca E. ESMO Consensus

conferences: guidelines on malignant lymphoma. part 2: marginal zone

lymphoma, mantle cell lymphoma, peripheral T-cell lymphoma. Ann Oncol

2013;24:857-877.

12. Matutes E, Oscier D, Montalban C, Berger F, Callet-Bauchu E, Dogan A,

Felman P, Franco V, Iannitto E, Mollejo M, Papadaki T, Remstein ED, Salar A,

Solé F, Stamatopoulos K, Thieblemont C, Traverse-Glehen A, Wotherspoon A,

Coiffier B, Piris MA. Splenic marginal zone lymphoma proposals for a revision

of diagnostic, staging and therapeutic criteria. Leukemia 2008;22:487-495.

13. Yakut U, Güney M, Doğanay ÜD, Koçak A, Avcı İ. Bir kan merkezinde

bağışçılara uygulanan mikrobiyolojik tarama testleri sonuçlarının on yıllık

değerlendirilmesi. Türk Mikrobiyol Cem Derg 2010;40:201-206.

14. Çelebi D, Çelebi Ö, Altoparlak Ü, Kök A. Kan donörlerinde HBsAg, anti-HCV,

anti-HIV, sifiliz seroprevalansı ve macro-ELISA sonuçlarının optik dansite

değerleri ile doğrulama testlerinin karşılaştırılması. Türk Mikrobiyol Cem

Derg 2012;42:137-141.

15. Özkan H. Epidemiology of chronic hepatitis B in Turkey. Euroasian J

Hepatogastroenterol 2018;8:73-74.

16. Tozun N, Ozdogan O, Cakaloglu Y, Idilman R, Karasu Z, Akarca U, Kaymakoglu

S, Ergonul O. Seroprevalence of hepatitis B and C virus infections and

risk factors in Turkey: a fieldwork TURHEP study. Clin Microbiol Infect

2015;21:1020-1026.

17. Sonmez M, Bektas O, Yilmaz M, Durmus A, Akdogan E, Topbas M, Erturk

M, Ovali E, Omay SB. The relation of lymphoma and hepatitis B virus/

hepatitis C virus infections in the region of East Black Sea, Turkey. Tumori

2007;93:536-539.

18. Aslan T, Ozdemir E, Uner A, Gungor E, Alayvaz Aslan N, Yildizhan E, Agit A,

Korkmaz S, Akgun Cagliyan G, Barista I, Ozhamam E, Pamuk GE, Turgut M,

Eser B, Ozet G, Yıldırım R, Buyukasik Y. Splenic marginal zone lymphoma

in an East Mediterranean/Middle Eastern population cohort: possible

association with hepatitis B instead of hepatitis C virus as an etiologic and

prognostic factor (ThREG-NHL01 Study). Blood 2016;128:5332.

19. Koot AW, Visscher AP, Huits RM. Remission of splenic marginal zone

lymphoma in a patient treated for hepatitis B: a case of HBV-associated

lymphoma. Acta Clin Belg 2015;70:301-303.

20. Christou L, Kalambokis G, Bai M, Kamina S, Tsianos E. Splenic marginal zone

lymphoma in a patient with chronic hepatitis B. J Gastrointestin Liver Dis

2009;18:511-512.

21. Mathew J, Aldean I. Splenic marginal zone lymphoma associated with

hepatitis B virus infection: a case report. Internet J Surg 2002;5:3.

22. Zhang SH, Xu AM, Zheng JM, He MX. Coexistence of splenic marginal zone

lymphoma with hepatocellular carcinoma: a case report. Diagn Pathol

2007;2:5.

23. Iannitto E, Minardi V, Callea V, Stelitano C, Calvaruso G, Tripodo C, Quintini

G, De Cantis S, Ambrosetti A, Pizzolo G, Franco V, Florena AM, Abbadessa V.

Assessment of the frequency of additional cancers in patients with splenic

marginal zone lymphoma. Eur J Haematol 2006;76:134-140.

24. Fetica B, Pop B, Blaga ML, Fulop A, Dima D, Zdrenghea MT, Vlad CI, Bojan AS,

Achimas-Cadariu P, Lisencu CI, Irimie A, Weisenburger DD. High prevalence

of viral hepatitis in a series of splenic marginal zone lymphomas from

Romania. Blood Cancer J 2016;6:498.

25. Yi S, Yan Y, Xiong W, Lv R, Yu Z, Liu W, Liu E, Li H, Liu H, Li Z, An G, Xu Y,

Ru K, Zou D, Qiu L. Distinct clinical characteristics draw a new prognostic

model for splenic marginal zone lymphoma in HBV high prevalent region.

Oncotarget 2017;8:98757-98770.

26. Rossotti R, Travi G, Pazzi A, Baiguera C, Morra E, Puoti M. Rapid clearance

of HCV-related splenic marginal zone lymphoma under an interferon-free,

NS3/NS4A inhibitor-based treatment. A case report. J Hepatol 2015;62:234-

237.

27. Bracci PM, Benavente Y, Turner JJ, Paltiel O, Slager SL, Vajdic CM, Norman

AD, Cerhan JR, Chiu BC, Becker N, Cocco P, Dogan A, Nieters A, Holly EA,

Kane EV, Smedby KE, Maynadié M, Spinelli JJ, Roman E, Glimelius B, Wang

SS, Sampson JN, Morton LM, de Sanjosé S. Medical history, lifestyle, family

history, and occupational risk factors for marginal zone lymphoma: the

InterLymph Non-Hodgkin Lymphoma Subtypes Project. J Natl Cancer Inst

Monogr 2014;2014:52-65.

28. Perrone S, D’Elia GM, Annechini G, Ferretti A, Tosti ME, Foà R, Pulsoni A.

Splenic marginal zone lymphoma: prognostic factors, role of watch and

wait policy, and other therapeutic approaches in the rituximab era. Leuk

Res 2016;44:53-60.

29. Hermine O, Lefrère F, Bronowicki JP, Mariette X, Jondeau K, Eclache-

Saudreau V, Delmas B, Valensi F, Cacoub P, Brechot C, Varet B, Troussard X.

Regression of splenic lymphoma with villous lymphocytes after treatment

of hepatitis C virus infection. N Engl J Med 2002;347:89-94.

90

RESEARCH ARTICLE

DOI: 10.4274/tjh.galenos.2019.2019.0254


Bortezomib-based Regimens Improve the Outcome of

Patients with Primary or Secondary Plasma Cell Leukemia: A

Retrospective Cohort Study

Bortezomib Temelli Tedavi Rejimleri Birincil veya İkincil Plazma Hücreli Lösemi Hastalarının

Sonuçlarını İyileştirir: Retrospektif Kohort Çalışması

Huijuan Wang 1 , Huixing Zhou 1 , Zhiyao Zhang 1 , Chuanying Geng 2 , Wenming Chen 3

1Beijing, China

2Workers Stadium South Road, Chaoyang District, Beijing, China

3Chaoyang District, Hematology, Beijing, China Beijing

Abstract

Objective: The management experience for plasma cell leukemia

(PCL) is still limited by PCL’s rare incidence and aggressive course. The

goal of this study was to further identify the efficacy of bortezomibcontaining

regimens for PCL in Chinese patients.

Materials and Methods: In this study, 56 consecutive PCL patients

[14 primary PCL (pPCL) and 42 secondary PCL (sPCL) cases] were

retrospectively enrolled and 42/56 patients received bortezomibbased

regimens (BBRs), including 10/14 pPCL and 32/42 sPCL patients.

The patients’ survival data, clinical information, and safety data were

collected and analyzed.

Results: In pPCL and sPCL patients, the overall response rate in the

bortezomib group was 90.0% and 25.0%, respectively. The median

progression-free survival from PCL diagnosis for pPCL and sPCL was

8.3 months vs. 2.9 months (p=0.043) and median overall survival

(OS) from PCL diagnosis was 23.3 months vs. 4.0 months. The OS for

patients receiving BBRs was significantly longer for both pPCL (8.3

vs. 1.2 months, p=0.002) and sPCL (4.3 vs. 1.1 months, p<0.001). In

multivariate COX analysis, BBR treatment [p=0.008, hazard ratio

(HR)=0.38, 95% confidence interval (CI)=0.19-0.77] and very good

partial response or better (≥VGPR) (p=0.035, HR=0.19, 95% CI=0.04-

0.74) were independent predictors of OS for sPCL patients. For pPCL

patients, BBR predicted OS (p=0.029, HR=0.056, 95% CI=0.004-0.745)

instead of ≥VGPR (p=0.272, HR=3.365, 95% CI=0.38-29.303).

Conclusion: It was found that BBRs could significantly improve OS for

both pPCL and sPCL patients.

Keywords: Primary plasma cell leukemia, Secondary plasma cell

leukemia, Bortezomib-based treatment, Overall survival

Öz

Amaç: Plazma hücreli lösemide (PHL) tedavi deneyimi PHL’nin nadir

görülmesi ve agresif seyri nedeni ile halen sınırlıdır. Bu çalışmanın

amacı Çin’deki PHL hastalarında bortezomib temelli tedavi rejimlerinin

etkinliğini belirlemektir.

Gereç ve Yöntemler: Bu çalışmaya geriye dönük olarak 56 PHL olgusu

[14 birincil PHL (pPHL) ve 42 ikincil PHL (sPHL)] dahil edilmiştir ve

pPHL 10/14 ve sPHL 32/42 olmak üzere 42/56 olgu bortezomib temelli

tedavi (BTT) almıştır. Hastaların sağ-kalım verileri, klinik bilgileri ve

güvenlik verileri toplandı ve analiz edildi.

Bulgular: PPHL ve sPHL hastalarında bortezomib grubunda genel

yanıt oranı sırasıyla %90 ve %25 idi. PHL tanısından itibaren ortanca

hastalıksız sağ kalım pPHL ve sPHL için sırasıyla 8,3 ay ve 2,9 ay

(p=0,043) ve genel ortanca sağkalım (GS) 23,3 ay ve 4 ay idi. BTT alan

hastalar için GS hem pPHL (8,3 aya 1,2 ay, p=0,002) hem de sPHL

(4,3 aya 1,1 ay, p<0,001) için anlamlı olarak daha uzun bulundu. Çok

değişkenli COX analizinde BTT [p=0,008, kalp atım oranı (KAO)=0,38,

%95 güven aralığı (CI)=0.19-0.77] ve daha iyi ya da çok iyi kısmi yanıt

(≥ÇİKY) (p=0,035, KAO=0,19, %95 CI=0,04-0,74), sPHL hastaları için

GS’ın bağımsız göstergesidir. PPHL hastalarında BTT için öngörülen GS

(p=0.029, KAO=0,056, %95 CI=0,004-0,745) iken, ≥ÇİKY için (p=0,272,

HR=3,365, %95 CI=0,38-29,303) idi.

Sonuç: BTT’nin hem pPHL hem de sPHL hastalarında genel sağkalımı

belirgin olarak iyileştirebileceği bulunmuştur.

Anahtar Sözcükler: Birincil plazma hücreli lösemi, İkincil plazma

hücreli lösemi, Bortezomib temelli tedavi, Sağkalım



Address for Correspondence/Yazışma Adresi: Wenming Chen, M.D., Hematology, 8 th Gongti South

Street, Chaoyang District, Beijing, China

Phone : +8613910107759

E-mail : xybxx@ccmu.eucn ORCID: orcid.org/0000-0001-7682-6907

Received/Geliş tarihi: July 7, 2019

Accepted/Kabul tarihi: November 26, 2019

91

Wang H, et al: Bortezomib-based Regimen Improve Survival of PCL


Introduction

Plasma cell leukemia (PCL) is the most aggressive disease among

plasma cell malignancies with malignant plasma cells present

in the peripheral blood, which accounts for 2%-4% of patients

with multiple myeloma [1]. The diagnostic criteria of PCL are

based on the presence of more than 20% plasma cells in the

peripheral blood or an absolute plasma cell count of greater

than 2x10 9 /L [2,3]. Primary PCL (pPCL) patients represent

cases of de novo leukemia, accounting for 60% of PCL cases.

Secondary PCL (sPCL) represents aggressive transformation of

relapsed or refractory multiple myeloma (MM), occurring in

40% of PCL cases.

The survival of PCL patients remains considerably poor, especially

for sPCL patients [1,4], and because of its low incidence and

extreme aggressiveness, the therapeutic management of PCL is

limited. Results from both retrospective [5,6] and prospective

research [7,8] are insufficient and no explicit conclusion has been

reached. The purpose of this study was to explore the survival

of pPCL and sPCL patients being treated with bortezomib-based

regimens (BBRs) in China.


Patients

We retrospectively and consecutively collected data of 56 PCL

patients (including 14 with pPCL and 42 with sPCL) diagnosed

and treated in Beijing Chao-Yang Hospital, Capital Medical

University, between 2000 and 2017. Diagnosis of PCL was based

on the criteria proposed by the International Myeloma Working

Group (IMWG) [9].

Methodology

We retrospectively collected clinical data of pPCL and sPCL

patients during the aforementioned period of time. These clinical

data included the date of pPCL or sPCL diagnosis, the date of last

follow-up, progression-free survival (PFS), overall survival (OS),

and information about the treatment. This study was conducted

in accordance with the World Medical Association Declaration

of Helsinki and approved by the Ethics Committee of Beijing

Chao-Yang Hospital, Capital Medical University. The patients or

relatives gave their written informed consent. Baseline data are

shown in Table 1.

Response to treatment was evaluated according to the IMWG

criteria [10]. BBRs were defined as triplet or quartet therapy

containing bortezomib according to the IMWG consensus,

administered subcutaneously at a dose of 1.0 to 1.3 mg/m 2 once

or twice a week.


One-way ANOVA, Pearson’s chi-square test, and the Mann-

Whitney U test were used for the calculation of significant

differences and correlations of clinical and laboratory features

and response rates between groups. The Kaplan-Meier method

was used to estimate survival curves. Cox regression univariate

and multivariate analyses were used to measure possible

independent predictive factors for survival. Values of p<0.05

were considered statistically significant. Statistical description

and analysis were carried out with the software package IBM

SPSS 24 (IBM Corp., Armonk, NY, USA).

Results

Patients

There were 56 PCL patients diagnosed and treated from 2000 to

2017 in Beijing Chao-Yang Hospital, Capital Medical University.

Fourteen patients had pPCL (0.87% of all MM patients) and

42 patients had sPCL (2.61% of all MM patients). Five patients

(35.7%) with pPCL and eight patients (19.0%) with sPCL were

≥65 years old. For sPCL patients, the median time from diagnosis

of MM to progression to sPCL was 26.5 months (range=14.9 to

48.8 months). The baseline characteristics of the sPCL and pPCL

groups are listed in Table 1. Platelet counts were significantly

higher in pPCL (p=0.002). Lactate dehydrogenase (LDH) was

significantly higher in sPCL (437.5 U/L vs. 166.3 U/L, p<0.05). Age

and serum Ca and β 2

-microglobulin did not differ between pPCL

and sPCL (p>0.05). Immunophenotyping data of the peripheral

blood plasma cells were available for 37 of 59 patients and

CD56 was negative in 15 of 37 (40.5%) patients. The frequency

of CD20 and CD27 expression was significantly higher in pPCL

patients than sPCL patients (21.4% vs. 7.1%, p=0.004; 35.7% vs.

7.1%, p<0.001).

Fluorescence in situ hybridization data were available for 24

patients; 16/24 patients (66.7%) presented with high-risk

features including del17p present in 8 patients, t(4;14) present

in 6 patients, and t(14;16) present in 5 patients (Table 1). In

particular, 9 sPCL and 2 pPCL patients presented with 2 or 3

cytogenetic aberrations concurrently. The occurrence of del17p

and t(14;16) was markedly higher in sPCL patients pPCL patients

(19% vs. 7.1%, p=0.019; 0% vs. 11.9%, p<0.001), while the

occurrence of t(4;14) was significantly higher in pPCL patients

than sPCL patients (21.4% vs. 7.1%, p=0.007).

Response to Treatment

Treatment regimens in patients with pPCL and sPCL are listed

in Table 2. Conventional regimens are regimens without

proteasome inhibitors and immunomodulatory drugs, including

DECP (cisplatin, etoposide, cyclophosphamide, dexamethasone)

and VMP (vincristine, melphalan, prednisone). The median

treatment cycle number was 11 cycles in pPCL and 3 cycles in

sPCL patients. Of the sPCL patients, 88.7% patients had novel

drug-based induction therapy before progression to sPCL, and

in total 42/56 (75.0%) patients (including 10 pPCL and 32 sPCL)

received bortezomib-based induction for the treatment of

92



Table 1. Patients’ characteristics of pPCL and sPCL.

Parameters pPCL (n=14) sPCL (n=42)

Age 61 (39-76) 58 (35-73)

≥65 years old 5 (35.7%) 8 (19.0%)

Sex

Male 5 (35.7%) 25 (59.5%)

Heavy light chain

IgG 8 (57.1%) 16 (38.1%)

IgA 1 (7.1%) 11 (26.2%)

IgD 0 2 (4.8%)

Nonsecretory 0 3 (7.2%)

Light chain

Kappa 4 (28.6%) 19 (45.2%)

Lambda 10 (71.4%) 20 (47.6%)

DS phase

I 0 1 (2.4%)

II 2 (14.3%) 8 (19.0%)

III 12 (85.7%) 33 (78.6%)

Renal dysfunction

A 9 (64.3%) 34 (81.0%)

B 5 (35.7) 8 (19.0%)

ISS stage

I 0 5 (11.9%%)

II 4 (28.6%) 15 (35.7%)

III 10 (71.4%) 22 (52.4%)

EMD 5 (35.7%) 8 (19%)

FISH

Del17p 1 (7.1%) 8 (19%)

1q21 amplification 2 (14.3%) 10 (23.8%)

t(4;14) 3 (21.4%) 3 (7.1%)

t(11;14) 1 (7.1%) 6 (14.3%)

t(14;16) 0 5 (11.9%)

CD20 positive 3 (21.4%) 3 (7.1%)

CD56 positive 6 (42.9%) 17 (40.5%)

CD28 positive 0 6 (14.3%)

CD27 positive 5 (35.7%) 3 (7.1%)

Hb, g/L 81.0 (65.5-104) 70 (60.5-89.5)

PLT, x10 9 /L 85.5 (68.5-134.6) 31 (19-72)

WBC, x10 9 /L 12.2 (6.04-22.2) 6.06 (3.7-13.23)

Cr, µmol/L 82.7 (66.8-280.4) 88.8 (57.9-174.1)

Ca, mmol/L 2.20 (2.17-2.54) 2.21 (1.99-2.21)

ALB, g/L 31.0 (28.8-35.6) 31.4 (24.4-36.3)

LDH, U/L 166.3 (159.5-463)

437.5 (182.8-

662.5)

BMPCs, % 73.2 (62.8-73.25) 74.0 (54.5-89.1)

Involved FLC, mg/L 464.8 (62.1-464.8)

545.0 (107.5-

1073.8)

FLC κ/λ ratio 4.02 (0.06-4.03)

14.78 (2.12-

139.23)

pPCL: Primary plasma cell leukemia, sPCL: secondary plasma cell leukemia, ISS:

international Scoring System, EMD: extramedullary disease, FISH: fluorescence in situ

hybridization, LDH: lactate dehydrogenase, BMPCs: bone marrow plasma cells, FLC:

free light chain, Ig: immunoglobulin, WBC: white blood cell, PLT: platelets, platelets,

ALB: albumin.

PCL. Nine patients (2 pPCL and 7 sPCL) underwent autologous

stem cell transplantation (ASCT). Overall response rate (ORR)

was 71.4% in pPCL [complete response (CR)=21.4%, very good

partial response (VGPR)=28.6%, partial response (PR)=21.4%,

stable disease (SD)=21.4%, partial disease (PD)=7.1%) and

19% in sPCL (CR=4.8%, VGPR=2.4%, PR=11.9%, SD=45.2%,

PD=35.7%).

ORR differed significantly between patients who received BBRs

versus those who received conventional regimens (40.5% vs.

7.1%, p=0.044) (Table 3). Response rates significantly differed

between patients who received BBRs and conventional regimens

in both pPCL (90.0% vs. 25.0%) and sPCL (25.0% vs. 0%); pPCL

patients who received a BBR had the highest response rate and

the median time to progression for pPCL was 8.4 months (95%

CI=2.4-10.9). The results demonstrated that bortezomib could

improve the quality of response in both pPCL and sPCL patients.

Survival Data

The median follow-up of the total 56 patients was 32.1 months

(range=1.3-104.7 months). At the end of the follow-up time, 3

of 14 pPCL and 4 of 42 sPCL patients were alive. The median PFS

Table 2. Therapeutic regimens.

Regimen pPCL sPCL Overall

PAD 5 8 13

PCD 1 1 2

MPV 1 6 7

PDT 4 7 11

V-DTPACE 5 5

V-DECP 5 5

Conventional

regimens

4 10 14

pPCL: Primary PCL; sPCL: secondary PCL; PAD; bortezomib, adriamycin, dexamethasone;

PCD: bortezomib, cyclophosphamide, dexamethasone; PDT: bortezomib,

dexamethasone, thalidomide; MPV: melphalan, prednisone, bortezomib; V-DCEP:

bortezomib, dexamethasone, cyclophosphamide, etoposide, cisplatin; V-DTPACE:

bortezomib, dexamethasone, thalidomide, cisplatin, doxorubicin, cyclophosphamide,

etoposide.

Table 3. Response rate in patients treated with bortezomibbased

regimens or conventional chemistry.

pPCL

n=14

sPCL

n=42

BBR CR BBR CR

ORR 9 (90.0%) 1 (25.0%) 8 (25.0%) 0

≥VGPR 7 (70.0%) 0 3 (9.4%) 0

PR 2 (20.0%) 1 (25.0%) 5 (15.6%) 0

SD 1 (10.0%) 2 (50.0%) 16 (50.0%) 3 (30.0%)

PD 0 1 (25.0%) 8 (25.0%) 7 (70.0%)

ORR: Overall response rate, VGPR: very good partial response, PR: partial response,

SD: stable disease, PD: progressive disease, BBR: bortezomib-based regimen, CR:

conventional regimen.

93



from PCL diagnosis for pPCL and sPCL was 8.3 months vs. 2.9

months (p=0.043) (Figure 1A). The median OS from PCL diagnosis

for pPCL and sPCL was 23.3 months (95% CI=4.1-21.6) vs. 4.0

months (95% CI=1.7-6.2) (p=0.012) (Figure 1B). sPCL patients

were much more likely to experience disease progression during

treatment.

The median PFS in pPCL patients undergoing a BBR was

significantly longer than that of those receiving conventional

therapy (8.3 vs. 1.2 months, p=0.002), as was also the case for

sPCL patients (4.3 vs. 1.1 months, p<0.001) (Figures 2A and 2B).

Furthermore, BBR treatment also significantly improved OS in

both pPCL patients (19.1 vs. 2.1 months, p=0.002) and sPCL

patients (6.2 vs. 1.4 months, p=0.001) (Figures 2C and 2D). The

median OS after relapse for pPCL and sPCL patients treated with

BBR was 4.5 months and 1.6 months, respectively. There were

2 pPCL patients and 7 sPCL patients who received autologous

hematopoietic stem cell transplantation (HSCT) therapy. The

median OS of HSCT recipients was 29.1 months in pPCL patients

and 17.5 months in sPCL patients. Furthermore, the OS for

patients who achieved CR and VGPR was remarkably better than

that of those who achieved PR or less in both pPCL (19.5 vs. 1.9

months, p=0.002) and sPCL (16.2 vs. 2.4 months, p=0.006).

Univariate Cox regression analysis showed that type of PCL,

LDH, type of treatment (BBR vs. conventional treatment), and

quality of response indicated significantly better OS from the

PCL diagnosis (p<0.05). For pPCL, OS significantly benefitted

from BBR and high-quality response (p=0.033, HR=6.877,

95% CI=1.173-40.322; p=0.040, HR=2.930, 95% CI=1.049-

8.183, respectively). For sPCL patients, BBR treatment (p=0.001,

HR=3.252, 95% CI=1.603-6.598) and high-quality response

(≥VGPR, p=0.021, HR=1.937, 95% CI=1.1-3.4) also effectively

contributed to OS. In multivariate COX analysis, BBR treatment

(p=0.008, HR=0.38, 95% CI=0.19-0.77) and response ≥VGPR

(p=0.035, HR=0.19, 95% CI=0.04-0.74) were independent

predictors of OS for sPCL patients, while for pPCL patients, BBR

predicted OS (p=0.029, HR=0.056, 95% CI=0.004-0.745) instead

of ≥VGPR (p=0.272).

Safety

Figure 1. PFS and OS from PCL diagnosis in patients with primary

PCL (pPCL) and secondary PCL (sPCL).

PFS: Progression-free survival, OS: overall survival, PCL: plasma cell

leukemia.

Figure 2. PFS and OS of patients treated with bortezomib-based

regimens (BBRs) and conventional therapy (CT). A, B) pPCL PFS

and sPCL PFS; C, D) pPCL OS and sPCL OS.

PFS: Progression-free survival, OS: overall survival, PCL: plasma cell

leukemia.

sPCL patients constituted the majority of our population and

most of them were exposed to bortezomib treatment. Therefore,

there was a higher incidence of grade 3 and 4 adverse events

for this mixed population. In bortezomib-treated patients,

grade 3 or 4 myelosuppression was present in 48.2% of patients.

Grade 3 or 4 neurotoxicity happened in 19.6% of patients.

Gastrointestinal toxicity of grade 3 or 4 was present in 16.1% of

patients. The incidence of grade 3-4 renal toxicity and hepatic

toxicity was 8.9% and 12.5%, respectively. Neutropenic infection

was present in 32.1% of patients, and seven patients died from

acute respiratory failure caused by neutropenic infection in the

bortezomib group.

Discussion

PCL is an extremely rare and aggressive form of plasma cell

malignancy [4], and the OS from diagnosis ranges from 7

to 14 months [11,12]. The survival of patients with pPCL is

short. In seven series, the historical median survival without

novel therapies ranged from 6.8 to 12.6 months in the era of

conventional therapy [3,11,13,14]. Novel agents followed by

stem cell transplant yielded prolonged survival of more than 3

years [15]. The best survival data, incorporating hematopoietic

stem cell transplantation, demonstrated median survival of

longer than 3 years [15]. However, in the era of novel agents,

the proteasome inhibitor bortezomib has shown clinical efficacy

in both pPCL and sPCL [16,17]. BBRs could improve both

therapeutic response and survival of PCL patients, especially

those with pPCL [5]. Furthermore, in the study by Katodritou

et al. [18], bortezomib-based treatment showed clinical activity

94



in pPCL patients with t(4;14) and CD27 expression. In another

study by Katodritou et al. [6], with BBRs and a median follow-up

of 51 months, the median OS of the patients with pPCL and sPCL

treated with BBRs was 18 and 7 months, respectively. Autologous

or allogenic HSCT has yielded encouraging outcomes and could

prolong survival to more than 30 months [1,15,19]. However,

only younger and highly eligible patients may benefit from

stem cell transplantation and there are limited data from novel

drug-based regimens in the treatment of PCL. The incidence of

PCL is rare and the aggressively poor physical status of patients

cannot tolerate the adverse effects of novel drugs. In recent

years, however, several case series of PCL indicated that both

pPCL and sPCL patients could benefit from bortezomib regimens

[5,6,20,21,22,23].

Our current data collected from a single center are from 14

pPCL patients and 42 sPCL patients, representing the largest

retrospective study with the longest follow-up time in China. To

date, the largest series of pPCL treated with BBR was reported by

Katodritou et al. [23], which included 50 pPCL patients, and that

of Mina et al. [24], which enrolled 38 pPCL patients. The study

of Jurczyszyn et al. [25] summarized the results of 101 sPCL

patients. We have reported an ORR of 71.5% in pPCL patients

receiving BBRs, which is similar to the result of 70% reported

by Katodritou et al. [23]. However, our ORR is much higher than

that of the previous study without novel agents. Meanwhile,

Katodritou et al. [23] reported 100% ORR for pPCL patients with

bortezomib-therapy and ASCT. As only 1 of our pPCL patients

received allogenic HSCT treatment, our study cannot evaluate

the role of bortezomib-therapy + allo-HSCT for pPCL patients,

which is one of the deficiencies of this study.

For sPCL patients, bortezomib treatment could also contribute

to higher ORR and prolong survival significantly. Our data are

in accordance with the aforementioned studies, with a slightly

lower overall response of 70.0% for ≥VGPR in pPCL patients.

In sPCL patients treated with BBRs the ORR was 25%, which

corresponds with the 36.4% ORR of Katodritou et al. [6] but is

lower than the ORR of 60% reported by Jurczyszyn et al. [25].

With respect to survival, at the time of data collection, 3/14

(21.4%) pPCL patients and 4/42 (9.5%) sPCL patients receiving

BBRs were still alive. Most sPCL patients die after the disease

progresses. The median OS of PCL patients diagnosed with pPCL

and sPCL was 23.3 months vs. 4.0 months, whereas the median

OS of PCL patients diagnosed with pPCL and sPCL who received

BBRs was 19.1 months vs. 6.8 months, respectively. Multivariate

Cox regression analysis also proved BBRs to be positive predictors

for both pPCL and sPCL patients, which highlights the impact

of bortezomib treatment of PCL patents. Our conclusion is in

accordance with previous studies. More remarkably, our data

demonstrate that BBRs contributed to much longer OS for both

pPCL and sPCL patients. However, because of the small number

of pPCL patients, the survival data of our pPCL patients should

be further validated by data from larger samples. In the study

by D’Arena et al. [5], 2-year median follow-up reached 55%

while median follow-up was not reached. In the multicenter

retrospective study of Pagano et al. [14], the median OS for 73

pPCL patients was 12.6 months and HSCT patients had a longer

OS (median=38.1 months). In our study, the median OS of HSCTtreated

PCL patients was 29.1 months in pPCL patients (2/14

patients) and 27.53 months in sPCL patients (7/42 patients).

Though the small number of patients limits the reliability, the

results still highlight the benefits of HSCT.

The study of Lebovic et al. [21] reported the data of 25 PCL

patients (13 with pPCL) treated with bortezomib-based agents

and 19 patients received HSCT. The median OS of pPCL patients

treated with a bortezomib-based agent was 28.4 months and

the 18 patients treated with bortezomib regimens had the

opportunity for optimum treatments, which could explain the

better survival of those patients. In the study by Katodritou et

al. [6], only six of the pPCL patients had undergone autologous

HSCT and HSCT was not a significant predictor for OS in the

univariate analysis. On the other hand, 45% of patients

were still alive at 2 years, and after 4 years and 3 months of

median follow-up 28% of all pPCL patients were still alive.

The administration of “triplet” bortezomib-based treatment in

15/18 pPCL patients could probably explain the high ORR and

the longer survival in their study.

In our study, according to multivariate COX analysis, treatment

with BBRs and high-quality response (≥VGPR) positively

predicted OS after PCL diagnosis. Likewise, in the studies of

Katodritou et al. [6], Jurczyszyn et al. [25], and Mina et al. [24],

it was reported that high-quality response was an important

positive indicator of OS in pPCL patients. To some extent, BBRs

and other novel agents may overcome the negative impact

of highly aggressive PCL. Nevertheless, further verification is

needed.

Bias on account of financial situation and comorbidities of

patients also exists in this study, which is an inevitable factor

in real-world clinical work. Our clinical features between the

2 groups were mostly matched. Because of the small sample

of pPCL patients, the results will be further verified in a future

study.

Safety is one of the important factors affecting the efficacy of

bortezomib, especially in elderly myeloma patients. Our results

showed that the adverse effects were acceptable even in sPCL

patients who received BBRs for induction therapy, similar to the

study of Katodritou et al. [6], in which grades 3/4 neurological,

hematological, and infectious adverse events happened in 7%,

41.4%, and 31% of cases, respectively. In the study of D’Arena

et al. [5], grades 3 and 4 hematological, neurological, and

95



infectious events occurred in 20%, 21%, and 16%. As our study

included more sPCL patients and older patients, our incidences

of infection and neurological adverse events were relatively

higher.

Conclusion

Our data from a relatively high number of PCL patients have

shown that treatment with BBRs is highly effective and safe in

cases of PCL. BBRs and patients’ high-quality responses could be

independent predictors for OS in PCL patients. BBRs are among

the best therapeutic options for PCL patients, which could

contribute to both therapeutic response and further overall

survival. However, the defects of this study lie in the lack of

data from ASCT PCL patients, which leads to weaker survival

data than in other works. The conclusion is still required to be

validated in studies with further large numbers of PCL patients.

With novel drugs arising, new management approaches for both

primary and secondary PCL will appear for deeper response and

longer survival.

Ethics

Ethics Committee Approval: This study was conducted in

accordance with the World Medical Association Declaration of

Helsinki and approved by the Ethics Committee of Beijing Chao-

Yang Hospital, Capital Medical University.

Informed Consent: Informed consent was obtained from all

participants included in the study.


Concept: H.W., H.Z., Z.Z., C.G., W.C.; Design: H.W., H.Z., Z.Z., C.G.,

W.C.; Data Collection or Processing: H.W., H.Z., Z.Z., C.G., W.C.;

Analysis or Interpretation: H.W., H.Z., Z.Z., C.G., W.C.; Literature

Search: H.W., H.Z., Z.Z., C.G., W.C.; Writing: H.W., H.Z., Z.Z., C.G.,

W.C.


authors.



Acknowledgments: This study was funded by the National

Natural Science Foundation of China (No. 81500164).

References

1. Tiedemann RE, Gonzalez-Paz N, Kyle RA, Santana-Davila R, Price-Troska T,

Van Wier SA, Chng WJ, Ketterling RP, Gertz MA, Henderson K, Greipp PR,

Dispenzieri A, Lacy MQ, Rajkumar SV, Bergsagel PL, Stewart AK, Fonseca

R. Genetic aberrations and survival in plasma cell leukemia. Leukemia

2008;22:1044-1052.

2. Kyle RA, Maldonado JE, Bayrd ED. Plasma cell leukemia. Report on 17 cases.

Arch Intern Med 1974;133:813-818.

3. Noel P, Kyle RA. Plasma cell leukemia: an evaluation of response to therapy.

Am J Med 1987;83:1062-1068.

4. Mina R, D’Agostino M, Cerrato C, Gay F, Palumbo A. Plasma cell leukemia:

update on biology and therapy. Leuk Lymphoma 2017;58:1538-1547.

5. D’Arena G, Valentini CG, Pietrantuono G, Guariglia R, Martorelli MC,

Mansueto G, Villani O, Onofrillo D, Falcone A, Specchia G, Semenzato G,

Di Renzo N, Mastrullo L, Venditti A, Ferrara F, Palumbo A, Pagano L, Musto

P. Frontline chemotherapy with bortezomib-containing combinations

improves response rate and survival in primary plasma cell leukemia: a

retrospective study from GIMEMA Multiple Myeloma Working Party. Ann

Oncol 2012;23:1499-1502.

6. Katodritou E, Terpos E, Kelaidi C, Kotsopoulou M, Delimpasi S, Kyrtsonis

MC, Symeonidis A, Giannakoulas N, Stefanoudaki A, Christoulas D,

Chatziaggelidou C, Gastari V, Spyridis N, Verrou E, Konstantinidou P, Zervas

K, Dimopoulos MA. Treatment with bortezomib-based regimens improves

overall response and predicts for survival in patients with primary or

secondary plasma cell leukemia: analysis of the Greek Myeloma Study

Group. Am J Hematol 2014;89:145-150.

7. Royer B, Minvielle S, Diouf M, Roussel M, Karlin L, Hulin C, Arnulf B, Macro

M, Cailleres S, Brion A, Brechignac S, Belhadj K, Chretien ML, Wetterwald

M, Chaleteix C, Tiab M, Leleu X, Frenzel L, Garderet L, Choquet S, Fuzibet JG,

Dauriac C, Forneker LM, Benboubker L, Facon T, Moreau P, Avet-Loiseau H,

Marolleau JP. Bortezomib, doxorubicin, cyclophosphamide, dexamethasone

induction followed by stem cell transplantation for primary plasma cell

leukemia: a prospective phase II study of the Intergroupe Francophone du

Myelome. J Clin Oncol 2016;34:2125-2132.

8. Musto P, Simeon V, Martorelli MC, Petrucci MT, Cascavilla N, Di Raimondo F,

Caravita T, Morabito F, Offidani M, Olivieri A, Benevolo G, Mina R, Guariglia

R, D’Arena G, Mansueto G, Filardi N, Nobile F, Levi A, Falcone A, Cavalli

M, Pietrantuono G, Villani O, Bringhen S, Omede P, Lerose R, Agnelli L,

Todoerti K, Neri A, Boccadoro M, Palumbo A. Lenalidomide and lowdose

dexamethasone for newly diagnosed primary plasma cell leukemia.

Leukemia 2014;28:222-225.

9. Kyle RA, Durie BG, Rajkumar SV, Landgren O, Blade J, Merlini G, Kröger N,

Einsele H, Vesole DH, Dimopoulos M, San Miguel J, Avet-Loiseau H, Hajek

R, Chen WM, Anderson KC, Ludwig H, Sonneveld P, Pavlovsky S, Palumbo A,

Richardson PG, Barlogie B, Greipp P, Vescio R, Turesson I, Westin J, Boccadoro

M; International Myeloma Working Group. Monoclonal gammopathy of

undetermined significance (MGUS) and smoldering (asymptomatic) multiple

myeloma: IMWG consensus perspectives risk factors for progression and

guidelines for monitoring and management. Leukemia 2010;24:1121-1127.

10. Fernández de Larrea C, Kyle RA, Durie BG, Ludwig H, Usmani S, Vesole

DH, Hajek R, San Miguel JF, Sezer O, Sonneveld P, Kumar SK, Mahindra A,

Comenzo R, Palumbo A, Mazumber A, Anderson KC, Richardson PG, Badros

AZ, Caers J, Cavo M, LeLeu X, Dimopoulos MA, Chim CS, Schots R, Noeul A,

Fantl D, Mellqvist UH, Landgren O, Chanan-Khan A, Moreau P, Fonseca R,

Merlini G, Lahuerta JJ, Bladé J, Orlowski RZ, Shah JJ; International Myeloma

Working Group. Plasma cell leukemia: consensus statement on diagnostic

requirements, response criteria and treatment recommendations by the

International Myeloma Working Group. Leukemia 2013;27:780-791.

11. Ramsingh G, Mehan P, Luo J, Vij R, Morgensztern D. Primary plasma cell

leukemia: a Surveillance, Epidemiology, and End Results database analysis

between 1973 and 2004. Cancer 2009;115:5734-5739.

12. Sher T, Miller KC, Deeb G, Lee K, Chanan-Khan A. Plasma cell leukaemia and

other aggressive plasma cell malignancies. Br J Haematol 2010;150:418-

427.

13. Colovic M, Jankovic G, Suvajdžic N, Milic N, Dorcevic V, Jankovic S. Thirty

patients with primary plasma cell leukemia: a single center experience.

Medical Oncology 2008;25:154-160.

14. Pagano L, Valentini CG, De Stefano V, Venditti A, Visani G, Petrucci MT,

Candoni A, Specchia G, Visco C, Pogliani EM, Ferrara F, Galieni P, Gozzetti A,

Fianchi L, De Muro M, Leone G, Musto P, Pulsoni A; GIMEMA-ALWP (Gruppo

96



Italiano Malattie EMatologiche dell’Adulto, Acute Leukemia Working Party:

coordinator Sergio Amadori). Primary plasma cell leukemia: a retrospective

multicenter study of 73 patients. Ann Oncol 2011;22:1628-1635.

15. Mahindra A, Kalaycio ME, Vela-Ojeda J, Vesole DH, Zhang MJ, Li P, Berenson

JR, Bird JM, Dispenzieri A, Gajewski JL, Gale RP, Holmberg L, Kumar S, Kyle

RA, Lazarus HM, Lonial S, Mikhael J, Milone GA, Munker R, Nath R, Saccaro

S, To LB, Vogl DT, Wirk B, Hari P. Hematopoietic cell transplantation for

primary plasma cell leukemia: results from the Center for International

Blood and Marrow Transplant Research. Leukemia 2012;26:1091-1097.

16. Esparís‐Ogando A, Alegre A, Aguado B, Mateo G, Gutiérrez N, Bladé J,

Schenkein D, Pandiella A, San Miguel JF. Bortezomib is an efficient agent in

plasma cell leukemias. Int J Cancer 2005;114:665-667.

17. van de Donk NW, Lokhorst HM, Anderson KC, Richardson PG. How I treat

plasma cell leukemia. Blood 2012;120:2376-2389.

18. Katodritou E, Verrou E, Gastari V, Hadjiaggelidou C, Terpos E, Zervas K.

Response of primary plasma cell leukemia to the combination of bortezomib

and dexamethasone: do specific cytogenetic and immunophenotypic

characteristics influence treatment outcome? Leuk Res 2008;32:1153-1156.

19. Saccaro S, Fonseca R, Veillon DM, Cotelingam J, Nordberg ML, Bredeson C,

Glass J, Munker R. Primary plasma cell leukemia: report of 17 new cases

treated with autologous or allogeneic stem-cell transplantation and review

of the literature. Am J Hematol 2005;78:288-294.

20. Libby E, Candelaria-Quintana D, Moualla H, Abdul-Jaleel M, Rabinowitz

I. Durable complete remission of primary plasma cell leukemia with the

bortezomib plus melphalan and prednisone (VMP) regimen. Am J Hematol

2010;85:733-734.

21. Lebovic D, Zhang L, Alsina M, Nishihori T, Shain KH, Sullivan D, Ochoa-

Bayona JL, Kharfan-Dabaja MA, Baz R. Clinical outcomes of patients with

plasma cell leukemia in the era of novel therapies and hematopoietic

stem cell transplantation strategies: a single-institution experience. Clin

Lymphoma Myeloma Leuk 2011;11:507-511.

22. Ali R, Beksac M, Ozkalemkas F, Ozkocaman V, Ozkan A, Ozcelik T, Tunali A.

Efficacy of bortezomib in combination chemotherapy on secondary plasma

cell leukemia. Leuk Lymphoma 2007;48:1426-1428.

23. Katodritou E, Terpos E, Delimpasi S, Kotsopoulou M, Michalis E, Vadikolia

C, Kyrtsonis MC, Symeonidis A, Giannakoulas N, Vadikolia C, Michael

M, Kalpadakis C, Gougopoulou T, Prokopiou C, Kaiafa G, Christoulas D,

Gavriatopoulou M, Giannopoulou E, Labropoulou V, Verrou E, Kastritis E,

Konstantinidou P, Anagnostopoulos A, Dimopoulos MA. Real-world data on

prognosis and outcome of primary plasma cell leukemia in the era of novel

agents: a multicenter national study by the Greek Myeloma Study Group.

Blood Cancer J 2018;8:31.

24. Mina R, Joseph NS, Kaufman JL, Gupta VA, Heffner LT, Hofmeister CC,

Boise LH, Dhodapkar MV, Gleason C, Nooka AK, Lonial S. Survival outcomes

of patients with primary plasma cell leukemia (pPCL) treated with novel

agents. Cancer 2019;125:416-423.

25. Jurczyszyn A, Castillo JJ, Avivi I, Czepiel J, Davila J, Vij R, Fiala MA, Gozzetti

A, Grzasko N, Milunovic V, Hus I, Madry K, Waszczuk-Gajda A, Usnarska-

Zubkiewicz L, Debski J, Atilla E, Beksac M, Mele G, Sawicki W, Jayabalan D,

Charlinski G, Gyula Szabo A, Hajek R, Delforge M, Kopacz A, Fantl D, Waage

A, Crusoe E, Hungria V, Richardson P, Laubach J, Guerrero-Garcia T, Liu J,

Vesole DH. Secondary plasma cell leukemia: a multicenter retrospective

study of 101 patients. Leuk Lymphoma 2019;60:118-123.

97

RESEARCH ARTICLE

DOI: 10.4274/tjh.galenos.2019.2019.0282


PTEN and AKT1 Variations in Childhood T-Cell Acute

Lymphoblastic Leukemia

Çocukluk Çağı T-hücreli Akut Lenfoblastik Lösemi Hastalarında PTEN ve AKT1 Varyasyonlar

Fulya Küçükcankurt 1,2,a , Yücel Erbilgin 1,a , Sinem Fırtına 1,3 , Özden Hatırnaz Ng 1,4 , Zeynep Karakaş 5 , Tiraje Celkan 6 ,

Ayşegül Ünüvar 5 , Uğur Özbek 1,7 , Müge Sayitoğlu 1

1İstanbul University, Aziz Sancar Institute of Experimental Medicine, Department of Genetics, İstanbul, Turkey

2Altınbaş University Faculty of Medicine, İstanbul, Turkey

3İstinye University Faculty of Art and Science, Department of Molecular Biology and Genetics, İstanbul, Turkey

4Acıbadem Mehmet Ali Aydınlar University Faculty of Medicine, Department of Medical Biology, İstanbul, Turkey

5İstanbul University Faculty of Medicine, Department of Pediatrics Hematology, İstanbul, Turkey

6İstanbul University-Cerrahpaşa Cerrahpaşa Faculty of Medicine, Department of Pediatric Hematology, İstanbul, Turkey

7Acıbadem Mehmet Ali Aydınlar University Faculty of Medicine, Department of Medical Genetics, İstanbul, Turkey

aF.K. and Y.E. contributed equally to this work.

Abstract

Objective: PTEN/AKT pathway deregulations have been reported to

be associated with treatment response in acute leukemia. This study

examined pediatric T-cell acute lymphoblastic leukemia (T-ALL)

samples for PTEN and AKT1 gene variations and evaluated the clinical

findings.

Materials and Methods: Fifty diagnostic bone marrow samples of

childhood T-ALL cases were investigated for the hotspot regions of

the PTEN and AKT1 genes by targeted next-generation sequencing.

Results: A total of five PTEN variations were found in three of the 50

T-ALL cases (6%). Three of the PTEN variations were first reported in

this study. Furthermore, one patient clearly had two different mutant

clones for PTEN. Two intronic single-nucleotide variations were found

in AKT1 and none of the patients carried pathogenic AKT1 variations.

Conclusion: Targeted deep sequencing allowed us to detect both lowlevel

variations and clonal diversity. Low-level PTEN/AKT1 variation

frequency makes it harder to investigate the clinical associations

of the variants. On the other hand, characterization of the PTEN/

AKT signaling members is important for improving case-specific

therapeutic strategies.

Keywords: T-ALL, PTEN, AKT1, Next-generation sequencing

Öz

Amaç: PTEN/AKT yolak düzensizliklerinin akut lösemide tedavi yanıtı

ile ilişkili olduğu bildirilmiştir. Çalışmanın kapsamı, pediatrik T-ALL

hastalarının PTEN ve AKT1 genlerinin sıcak bölge varyasyonları için

incelenmesi ve klinik bulgularla değerlendirilmesidir.

Gereç ve Yöntemler: Elli pediatrik T-ALL olgusunun tanı zamanı

kemik iliği örnekleri, PTEN ve AKT1 genlerinin sıcak bölgeleri için

hedefe yönelik yeni nesil dizileme ile dizilenmiştir.

Bulgular: Elli T-ALL olgusunun %6’sında PTEN varyasyonu

saptanmıştır. Tespit edilen varyasyonlardan üçü ilk defa bu çalışmada

gösterilmiştir. Ayrıca bir hastanın PTEN açısından iki farklı mutant

klon taşıdığı belirlenmiştir. AKT1 geninde iki intronik tek nükleotid

polimorfizmi tespit edilirken hiçbir olguda patojenik AKT1 varyasyonu

saptanmamıştır.

Sonuç: Derin dizileme, hem düşük düzeydeki varyasyonların hem

de klonal çeşitliliğin belirlenmesine olanak sağlamıştır. T-ALL

hastalarındaki düşük düzey PTEN/AKT1 varyasyon sıklığı, varyantların

klinikle ilişkisinin ortaya çıkarılmasını zorlaştırmaktadır. Diğer yandan,

PTEN/AKT sinyal yolağının karakterizasyonu hasta spesifik terapötik

stratejilerin uygulanabilirliği için önemlidir.

Anahtar Sözcükler: T-ALL, PTEN, AKT1, Yeni nesil dizileme

Introduction

One of the key signal transduction pathways involved in

malignant transformation is the PTEN/PI3K/AKT pathway,

which regulates cellular metabolism, cell growth, translation,

chromosome stability, and cell survival [1]. Phosphatase and

tensin homolog deleted on chromosome ten (PTEN) is a lipid

and dual function phosphatase that antagonizes the PI3K/

AKT pathway; by dephosphorylating phosphoinositide 3-kinase



Address for Correspondence/Yazışma Adresi: Müge Sayitoğlu, Ph.D., İstanbul University, Aziz Sancar Institute of

Experimental Medicine, Department of Genetics, İstanbul, Turkey

Phone : +90 212 414 20 00 -33314

E-mail : mugeay@istanbul.edu.tr ORCID: orcid.org/0000-0002-8648-213X


Accepted/Kabul tarihi: November 19, 2019

98


Küçükcankurt F, et al: PTEN and AKT1 Variations in T-ALL

(PI3K) it produces PIP2 (phosphatidylinositol 4,5-bisphosphate)

and PIP3 (phosphatidylinositol (3,4,5)-triphosphate) and so

terminates the transmission of the signal to AKT and other

PIP3-effector targets [2]. AKT1 is a serine threonine kinase

that modulates the cell cycle checkpoint [3]. AKT1 is activated

by platelet-derived growth factor and its activation is

deregulated by mutations in the pleckstrin homology domain of

AKT1. Survival factors can suppress apoptosis in a transcriptionindependent

manner by activating the serine/threonine kinase

AKT1, which then phosphorylates and inactivates components

of the apoptotic machinery [4].

PTEN as a tumor suppressor is frequently mutated in cancers

and its inactivation results in constitutive activation of the

PI3K/AKT pathway. PTEN is a regulatory key to prevent the

malignant transformation of T-cells [5]. The PTEN/AKT pathway

has an important role in the β-selection checkpoint in T-cell

development and lymphocyte homeostasis [6]. PTEN-deficient

T-cells are found to be highly proliferative as a cause of increased

phosphorylation of AKT [7]. AKT1 is highly expressed in thymus

tissue and knockout studies showed that terminal differentiation

in CD8+ T-cells failed, with increased proliferation, cytokine

secretion, and prolonged survival [8,9]. PTEN/AKT abnormalities

resulting in deletion, insertion, or missense mutations lead to

differential regulation in different hematologic malignancies

[10,11,12,13,14]. Genomic resequencing results showed that

PI3K/AKT pathway genes are commonly mutated in pediatric

and young adult T-cell acute lymphoblastic leukemia (T-ALL)

cases [11,15]. In this study, PTEN and AKT1 variations and their

clinical associations were analyzed in a group of childhood

T-ALL cases.


Childhood T-ALL cases (n=50) diagnosed at the İstanbul

University Faculty of Medicine and Cerrahpaşa University

Faculty of Medicine were included in this study. Patients were

treated according to the BFM-ALL protocol. Diagnostic bone

marrow samples with a blast count of >80% were included in

the study. The T-cell origin of ALL was defined by the expression

of immunophenotype markers that included CD1a, CD2,

cytoplasmic CD3, surface CD3, CD4, CD5, CD7, and CD8. T-ALL

cases were evaluated according to the European Group for the

Immunological Characterization of Leukemia classification scale

as immature (n=20), cortical (n=17), or mature (n=4); however,

nine cases were not able to be further classified due to limited

immunological marker information [11]. Median age was 8

(range=0.9-17) years and other clinical features of the T-ALL

cases are summarized in Table 1. Written and oral informed

consent was obtained from the legal representatives of the

pediatric patients.

Identification of PTEN and AKT1 variations

The mononuclear cells of the bone marrow samples were isolated

by the Ficoll density gradient procedure [16]. Genomic DNA was

isolated with the QIAamp DNA Mini Kit (QIAGEN GmbH, Hilden,

Germany) according to the manufacturer’s protocol. DNA

quality and quantity were checked with a spectrophotometer

(NanoDrop 100, Thermo Scientific, USA). The hotspot regions of

PTEN (exons 7 and 8) and AKT1 (exon 2) were covered by primer

pairs, which were designed and validated by the ALL package

of the IRON-II (Interlaboratory Robustness of Next-Generation

Sequencing) study (Table 2). Exons were amplified using the

FastStart High Fidelity PCR System and GC-RICH PCR System

kits (Roche Applied Science, Penzberg, Germany). Amplicons

were purified with Ampure XP beads (Beckman Coulter, Krefeld,

Germany) and libraries were quantified by Quant-iT PicoGreen

dsDNA Reagent (Invitrogen, Carlsbad, CA, USA). Deep sequencing

was performed on a Roche FLX GS Junior (454-Life Sciences,

Branford, CT, USA) according to the manufacturer’s instructions.

The minimum read depth threshold per amplicon per sample

was set to 500x. Sanger sequencing was used to confirm the

variations, and low-level variants (variant calling was <20%)

were re-sequenced by using a different MID. After the data

quality assessment, variant detection analyses were done by

AVA software (GS Amplicon Variant Analyzer software version

2.5.3, Roche Applied Science). The in silico prediction tools

MutationTaster [17] and SIFT [18] were used to evaluate the

functional effects of identified variants in PTEN (NM_000314.4)

and AKT1 (NM_005163.2).

Results

A total of 50 childhood T-ALL patients were screened for

hotspot regions of PTEN and AKT1 by targeted deep sequencing.

All detected variations are listed in Table 3. A total of five PTEN

variations were found in three of the 50 T-ALL cases (6%) and

all the variations occurred in exon 7, truncating PTEN in the

C2-domain.

A nonsense c.781C>T, p.Q261* (rs730882131) pathogenic variant

was found in one patient (P#7) with a low frequency (2.1%),

and this somatic variation was evaluated as a small background

clone without any clinical significance. P#7 is a 3.5-year-old boy

who was classified in the medium-risk group (MRG), a responder

to induction therapy who was followed for 27 months.

Three novel variants including insertions and deletions were

detected in two T-ALL cases. One patient (P#48) had two

different mutant clones for PTEN; the first clone carried

c.700_701insCTGGAGCCGAC p.R234Pfs*26 with 40% frequency

and the second clone harbored c.707_720delACAAGTTCATGTAC

and c.724_740delGAGTTCCCTCAGCCGTT deletions that cause

p.D236Vfs*6 with 16% frequency, which are classified as

“deleterious” by SIFT. The deletion area was able to be detected

by conventional sequencing; however, it was not possible to

99



distinguish the clones (Figure 1B). P#48 is a 12-year-old girl

who had high white blood cell count at diagnosis (170x10 9 /L)

with lymphadenopathy, splenomegaly, and hepatomegaly; she

was a responder to induction therapy and has been followed in

remission for 90 months.

One patient (P#27) also had two variations in the PTEN gene:

a likely pathogenic deletion c.703delG, p.G235Kfs*21 with 10%

frequency and a novel insertion c.737_738insAAG, p.P246_

L247insR with 4.6% frequency (Figure 1A). She is 7 years old

and classified in the MRG, a responder to induction therapy. She

Table 1. Clinical features of childhood T-ALL patients.

Clinical features

100

All cases

(n=50)

PTEN variation (+)

(n=3)

Sex

Male:Female 39:11 1:2 37:10

PTEN variation (-)

(n=47)

Platelets, 10 9 /L

Median (min-max) 43000 (5400-450000) 60000 (51000-72000) 44000 (5400-450000)

WBC, 10 9 /L

Median (min-max) 86000 (1300-603000) 90000 (10300-170000) 76400 (1300-603000)

Hemoglobin, g/dL

Median (min-max) 10 (1.2-13.5) 10 (9.3-12) 8.6 (1.2-13.5)

CNS involvement, n (%)

Yes

No

NA

Risk group, n (%)

MRG

HRG

SRG

Steroid response, n (%)

Yes

No

NA

Day 33 BM, n (%)

Remission

No remission

NA

Relapse, n (%)

Yes

No

NA

Last status, n (%)

Live

Dead

NA

NOTCH1/FBXW7 mutation, n (%)

Yes

No

NA

t(9;22), n (%)

Yes

No

t(4;11), n (%)

Yes

No

12 (24)

26 (52)

12 (24)

13 (26)

20 (40)

17 (34)

17 (34)

2 (4)

31 (62)

31 (62)

8 (16)

11 (22)

11 (22)

29 (58)

10 (20)

20 (40)

20 (40)

10 (20)

7 (14)

17 (34)

26 (52)

0 (0)

50 (100)

8 (16)

42 (84)

0 (0)

2 (67)

1 (33)

1 (33)

2 (67)

0 (0)

1 (33)

0 (0)

2 (67)

3 (100)

0 (0)

0 (0)

1 (33)

2 (67)

0 (0)

3 (100)

0 (0)

0 (0)

0 (0)

1 (33)

2 (67)

0 (0)

0 (0)

0 (0)

0 (0)

12 (25.5)

24 (51.1)

11 (23.4)

12 (25.6)

18 (38.2)

17 (36.2)

16 (34)

2 (4)

29 (62)

28 (59.6)

8 (17)

11 (23.4)

10 (21.3)

27 (57.4)

10 (21.3)

17 (36.2)

20 (42.5)

10 (21.3)

7 (14.9)

16 (34)

24 (51.1)

0 (0)

50 (100)

8 (17)

42 (83)

BM: Bone marrow, WBC: white blood cells, Hb: hemoglobin, CNS: eentral nervous system, SRG: standard risk group, MRG: medium risk group, HRG: high risk group, NA: not available,

t: translocation, min: minumum, max: maximum.



Table 2. Gene-specific primer sets for deep sequencing.

Gene Exon Forward primer 5’-3’ Reverse primer 5’ -3’

PTEN 7 GCATTTCCTGTGAAATAATACTGG CACCAATGCCAGAGTAAGCA

PTEN 8 TGTTTAACATAGGTGACAGATTTTCTT AAGTCAACAACCCCCACAAA

AKT1 2 GGTCAGAGAGCTTAGAGGGATG CACAGACCCTGGGGCTACTA

Table 3. Pathogenic PTEN variations in childhood T-ALL patients.

Patient ID HGVSc Protein Variation dbSNP MutationTaster SIFT

P#48 c.700_701insCTGGAGCCGAC p.R234Pfs*26 Insertion Novel DC DM

P#48

c.707_720delACAAGTTCATGTAC

c.724_740delGAGTTCCCTCAGCCGTT

p.D236Vfs*6 Deletion Novel DC DM

P#7 c.781C>T p.Q261* Nonsense rs730882131 DC DM

P#27 c.703delG p.G235Kfs*21 Deletion

ExAc-likely

pathogenic DC DM

P#27 c.737_738insAAG p.P246_L247insR Insertion Novel DC DM

HGVS: Human Genome Variation Society, SIFT: sorting Intolerant from Tolerant, where SIFT scores predict the effect of variants on protein function and ≤0.05 is predicted to have

damaging effects on protein function; dbSNP: database for Single Nucleotide Polymorphisms; MutationTaster indicates that the amino acid sequence changed and protein features

(might have) affected splice site changes, ExAc: Exome Aggregation Consortium, DC: Disease-causing, DM: damaging, DL: Deleterious (NM_000314.4 reference for PTEN).

presented with lymphadenopathy, splenomegaly, hepatomegaly,

and mediastinum involvements. She had early relapse and

has now been in remission for 80 months. Furthermore, two

common intronic single-nucleotide variations, rs2494749 (8%)

and rs2494748 (6%), were found in the AKT1 gene. However,

none of the patients carried the diseased-linked variation in

exon 2 of the AKT1 gene.

NOTCH1/FBXW7 mutation data were available for 24 of the

patients [19]. None of the patients who had NOTCH1/FBXW7

variations carried PTEN or AKT1 mutations for the respective

exons. Furthermore, patients who had PTEN or AKT1 variations

did not carry t(9;22), t(12;21), or t(4;11).

Discussion

Figure 1. Novel variants including insertions and deletions were

detected in two T-ALL cases.

PTEN has an important role in the proliferation and survival

of T-cell progenitors, and its loss may sustain leukemic T-cell

viability in T-ALL [20]. PTEN function is often inactivated by

different mechanisms such as mutations, epigenetic alterations,

gene silencing, and post-translational modifications in cancers

where it can be associated with reduced chemotherapy response

and poor prognosis [21,22].

101



The frequency of PTEN variation was previously reported

as 5%-27% in different studies of T-ALL patients. Different

methodologies, numbers of analyzed cases, and whole exome

or hot spot region examinations may explain this diversity. In

our study, exon 7 and exon 8, which are the hot spot regions

for PTEN gene variations, were screened with targeted amplicon

sequencing. Three patients had PTEN mutations in our cohort;

on the other hand, two of the patients harbored multiple

PTEN mutant clones that we were able to distinguish by deep

sequencing. Furthermore, two patients showed low-level PTEN

variations; we may consider that PTEN mutations were not the

first to be hit for the oncogenic behavior in these T-ALL patients.

In common with other studies, all the mutations were located

in exon 7 and two novel frameshift mutations were detected

in one patient, predicted to cause truncated protein. Truncating

mutations located within the first eight exons of the PTEN gene

lead to mono-allelic expression by nonsense mediated decay

[23]. Furthermore, a nonsense PTEN variation was found in a

T-ALL patient that resulted in the loss of PTEN protein levels [10].

All the patients with mutations for PTEN achieved remission

after induction therapy and one patient developed early relapse.

Furthermore, all patients were alive during the follow-up. PTEN

is implicated in regulating downstream effects of NOTCH1

signaling such as proliferation and survival of T-cell progenitors.

PTEN mutations were also suggested to be secondary mutations

following NOTCH1-activating mutations, rendering cells

insensitive to γ-secretase inhibitors. On the other hand, other

studies suggested that NOTCH1-activating mutations and PTEN

mutations were two different hits in different T-ALL subgroups

[21,24]. Patients with PTEN mutations were particularly

associated with the TAL-1-expressing group in T-ALL cases. In

our cohort, 30% of T-ALL patients harbored NOTCH1/FBXW7

mutations and none of the PTEN mutant samples carried

NOTCH1/FBXW7 aberrations [19].

Previous studies have reported controversial prognostic effects

of PTEN variations in childhood T-ALL [11,13,25]. In the BFM

(n=301) and GBTL1 ALL-99 (Brazilian) (n=62) pediatric ALL

cohort studies, it was shown that in the absence of NOTCH1

mutations PTEN gene variations were associated with poor

prognosis, while the DCOG/COALL (German) (n=146) cohort

study reported PTEN variations as independent high-risk factors

for relapse [10]. However, the UKALL2003 (n=145) pediatric

cohort could not find any association between PTEN variations

and clinical findings [11]. An Italian study group examined 257

children with T-ALL treated with AIEOP-BFM protocols. They

found an association between increased risk of relapse and PTEN

mutations in pediatric T-ALL [26]. In another study, Szarzynska-

Zawadzka et al. [27] screened 162 patients with T-ALL for

PTEN aberrations (mutations, copy number variations, and

deletions) and found that PTEN deletions were more common

than mutations (16% vs. 9%) in the patients. Additionally, biallelic

inactivation of PTEN (co-occurrence of deletions and

mutations) was detected in 8% of patients. PTEN deletions were

associated with worse survival and increased risk of relapse.

However, PTEN mutations were associated with poor survival

but not with relapse. These findings suggest the existence of

multiple leukemic sub-clones displaying various PTEN anomalies,

with each of these subsets possibly having different biological

and clinical features. Detailed analysis of the type of genetic

anomaly would be useful to refine risk stratification based on

PTEN status.

Study Limitations

This study has some limitations. The number of patients in the

study is limited and the patients had only been screened for the

hot spot regions of the genes, although variation frequencies

are similar to those of other studies.

Conclusion

PTEN tumor suppressor gene inactivation is a frequent

event in T-ALL, but its effect on patient therapy response is

debatable. Herein, only a small proportion of T-ALL patients

had PTEN and AKT1 variations. Therefore, it is not possible to

reach a meaningful conclusion about the prognostic value of

PTEN mutations in T-ALL. In our cohort, screening for PTEN

abnormalities at diagnosis did not add further information

about patients’ risk groups. However, the PTEN genotype may

serve as a potential biomarker for targeted therapy in later

perspective studies. Furthermore, PTEN mutations are not the

only aberrations that contribute to the loss of PTEN protein in

T-ALL patient samples. Other PTEN aberrations (copy number

variations, deletions), different molecular mechanisms like

effective PTEN-splicing, long noncoding RNAs, and epigenetic

modulations that also lead to PTEN inactivation should also be

evaluated in the future. The PTEN/AKT pathway has a critical role

in cell growth and survival and has become a target pathway

for pharmacological studies due to its frequent activation in

various types of tumors [28,29,30,31,32]. In order to identify

patients who may benefit from novel developed therapeutics,

it is important to characterize the molecular background of the

patients.

Ethics

Ethics Committee Approval: The ethical committee of

the İstanbul Medical Faculty (reference number and date:

1298/22.08.2014) approved this study.

Informed Consent: It was obtained from the parents or legal

guardians before patients’ enrollment in the study.


Concept: M.S, U.Ö., O.H.; Design: S.F., M.S., O.H., Y.E.; Data

Collection or Processing: F.K., Y.E., M.S., Z.K, T.C., A.Ü; Analysis

102



or Interpretation: F.K., Y.E., M.S, S.F; Literature Search: F.K., Y.E.,

M.S.; Writing: F.K., Y.E., M.S.

Acknowledgments: We highly appreciate the efforts of Monica

Ann Malt, MSN, RN, and CPAN (Bezmialem Vakıf University,

Turkey), for language editing of this paper.


authors.

Financial Disclosure: The present work was supported by the

Research Fund of İstanbul University (Project No. 48185) and

the İstanbul Development Agency, Investment in the Future:

Project of BIOBANK (Project No: TR10/15/YNK/0093).

References

1. Yin Y, Shen WH. PTEN: A new guardian of the genome. Oncogene

2008;27:5443-5453.

2. Hopkins BD, Hodakoski C, Barrows D, Mense SM, Parsons RE. PTEN function:

The long and the short of it. Trends Biochem Sci 2014;39:183-190.

3. Cai J, Xu L, Tang H, Yang Q, Yi X, Fang Y, Zhu Y, Wang Z. The role of the

PTEN/PI3K/Akt pathway on prognosis in epithelial ovarian cancer: a metaanalysis.

Oncologist 2014;19:528-535.

4. Mahajan K, Mahajan NP. PI3K-independent AKT activation in cancers: a

treasure trove for novel therapeutics. J Cell Physiol 2012;227:3178-3184.

5. Maehama T. PTEN: Its deregulation and tumorigenesis. Biol Pharm Bull

2007;30:1624-1627.

6. Suzuki A, Yamaguchi MT, Ohteki T, Sasaki T, Kaisho T, Kimura Y, Yoshida

R, Wakeham A, Higuchi T, Fukumoto M, Tsubata T, Ohashi PS, Koyasu S,

Penninger JM, Nakano T, Mak TW. T cell-specific loss of Pten leads to defects

in central and peripheral tolerance. Immunity 2001;14:523-534.

7. Carnero A, Paramio JM. The PTEN/PI3K/AKT pathway in vivo, cancer mouse

models. Front Oncol 2014;4:252.

8. Le Page C, Koumakpayi IH, Alam-Fahmy M, Mes-Masson AM, Saad F.

Expression and localisation of Akt-1, Akt-2 and Akt-3 correlate with clinical

outcome of prostate cancer patients. Br J Cancer 2006;94:1906-1912.

9. Sauer S, Bruno L, Hertweck A, Finlay D, Leleu M, Spivakov M, Knight ZA,

Cobb BS, Cantrell D, O’Connor E, Shokat KM, Fisher AG, Merkenschlager M.

T cell receptor signaling controls Foxp3 expression via PI3K, Akt, and mTOR.

Proc Natl Acad Sci U S A 2008;105:7797-7802.

10. Zuurbier L, Petricoin EF 3rd, Vuerhard MJ, Calvert V, Kooi C, Buijs-Gladdines

JG, Smits WK, Sonneveld E, Veerman AJ, Kamps WA, Horstmann M, Pieters

R, Meijerink JP. The significance of PTEN and AKT aberrations in pediatric

T-cell acute lymphoblastic leukemia. Haematologica 2012;97:1405-1413.

11. Jenkinson S, Kirkwood AA, Goulden N, Vora A, Linch DC, Gale RE. Impact

of PTEN abnormalities on outcome in pediatric patients with T-cell acute

lymphoblastic leukemia treated on the MRC UKALL2003 trial. Leukemia

2016;30:39-47.

12. Larson Gedman A, Chen Q, Kugel Desmoulin S, Ge Y, LaFiura K, Haska

CL, Cherian C, Devidas M, Linda SB, Taub JW, Matherly LH. The impact

of NOTCH1, FBW7 and PTEN mutations on prognosis and downstream

signaling in pediatric T-cell acute lymphoblastic leukemia: a report from

the Children’s Oncology Group. Leukemia 2009;23:1417-1425.

13. Gutierrez A, Sanda T, Grebliunaite R, Carracedo A, Salmena L, Ahn Y, Dahlberg

S, Neuberg D, Moreau LA, Winter SS, Larson R, Zhang J, Protopopov A, Chin

L, Pandolfi PP, Silverman LB, Hunger SP, Sallan SE, Look AT. High frequency

of PTEN, PI3K and AKT abnormalities in T cell acute lymphoblastic leukemia.

Blood 2009;114:647-650.

14. Morotti A. The role of the tumor suppressor PTEN in chronic myeloid

leukemia pathogenesis. Science Proceedings 2015;2:e638.

15. Liu Y, Easton J, Shao Y, Maciaszek J, Wang Z, Wilkinson MR, McCastlain K,

Edmonson M, Pounds SB, Shi L, Zhou X, Ma X, Sioson E, Li Y, Rusch M, Gupta

P, Pei D, Cheng C, Smith MA, Auvil JG, Gerhard DS, Relling MV, Winick

NJ, Carroll AJ, Heerema NA, Raetz E, Devidas M, Willman CL, Harvey RC,

Carroll WL, Dunsmore KP, Winter SS, Wood BL, Sorrentino BP, Downing

JR, Loh ML, Hunger SP, Zhang J, Mullighan CG. The genomic landscape of

pediatric and young adult T-lineage acute lymphoblastic leukemia. Nat

Genet 2017;49:1211-1218.

16. Panda SK, Ravindran B. Isolation of human PBMCs. Bio-Protocol 2013;3:4-6.

17. Schwarz JM, Cooper DN, Schuelke M, Seelow D. MutationTaster2: Mutation

prediction for the deep-sequencing age. Nat Methods 2014;11:361-362.

18. Choi Y, Sims GE, Murphy S, Miller JR, Chan AP. Predicting the functional

effect of amino acid substitutions and indels. PLoS One 2012;7:e46688.

19. Erbilgin Y, Sayitoglu M, Hatirnaz O, Dogru O, Akcay A, Tuysuz G, Celkan T,

Aydogan G, Salcioglu Z, Timur C, Yuksel-Soycan L, Ure U, Anak S, Agaoglu

L, Devecioglu O, Yildiz I, Ozbek U. Prognostic significance of NOTCH1 and

FBXW7 mutations in pediatric T-ALL. Dis Markers 2010;28:353-360.

20. Tesio M, Trinquand A, Macintyre E, Asnafi V. Oncogenic PTEN functions and

models in T-cell malignancies. Oncogene 2016;35:3887-3896.

21. Mendes RD, Canté-Barrett K, Pieters R, Meijerink JP. The relevance of PTEN-

AKT in relation to NOTCH1-directed treatment strategies in T-cell acute

lymphoblastic leukemia. Haematologica 2016;101:1010-1017.

22. Milella M, Falcone I, Conciatori F, Cesta Incani U, Del Curatolo A, Inzerilli

N, Nuzzo CM, Vaccaro V, Vari S, Cognetti F, Ciuffreda L. PTEN: Multiple

functions in human malignant tumors. Front Oncol 2015;16;5:24.

23. Tétreault MP. Esophageal cancer: insights from mouse models. Cancer

Growth Metastasis 2015;8(Suppl 1):37-46.

24. Palomero T, Sulis ML, Cortina M, Real PJ, Barnes K, Ciofani M, Caparros E,

Buteau J, Brown K, Perkins SL, Bhagat G, Agarwal AM, Basso G, Castillo

M, Nagase S, Cordon-Cardo C, Parsons R, Zúñiga-Pflücker JC, Dominguez

M, Ferrando AA. Mutational loss of PTEN induces resistance to NOTCH1

inhibition in T-cell leukemia. Nat Med 2007;13:1203-1210.

25. Jotta PY, Ganazza MA, Silva A, Viana MB, da Silva MJ, Zambaldi LJ, Barata

JT, Brandalise SR, Yunes JA. Negative prognostic impact of PTEN mutation in

pediatric T-cell acute lymphoblastic leukemia. Leukemia 2010;24:239-242.

26. Paganin M, Grillo MF, Silvestri D, Scapinello G, Buldini B, Cazzaniga G,

Biondi A, Valsecchi MG, Conter V, Te Kronnie G, Basso G. The presence of

mutated and deleted PTEN is associated with an increased risk of relapse in

childhood T cell acute lymphoblastic leukaemia treated with AIEOP-BFM

ALL protocols. Br J Haematol 2018;182:705-711.

27. Szarzynska-Zawadzka B, Kunz JB, Sedek Ł, Kosmalska M, Zdon K, Biecek

P, Bandapalli OR, Kraszewska-Hamilton M, Jaksik R, Drobna M, Kowalczyk

JR, Szczepanski T, Van Vlierberghe P, Kulozik AE, Witt M, Dawidowska M.

PTEN abnormalities predict poor outcome in children with T-cell acute

lymphoblastic leukemia treated according to ALL IC-BFM protocols. Am J

Hematol 2019;94:93-96.

28. Dillon L, Miller T. Therapeutic targeting of cancers with loss of PTEN

function. Curr Drug Targets 2014;15:65-79.

29. Hall CP, Reynolds CP, Kang MH. Modulation of glucocorticoid resistance in

pediatric T-cell acute lymphoblastic leukemia by increasing BIM expression

with the PI3K/mTOR inhibitor BEZ235. Clin Cancer Res 2016;22:621-632.

30. Azimi A, Azimi A. Hypothesis: ROBOPHERA, a phosphatase and tensin

homolog-targeted antineoplastic therapy. Anticancer Drugs 2017;28:369-375.

31. Zhang X, Park JS, Park KH, Kim KH, Jung M, Chung HC, Rha SY, Kim HS. PTEN

deficiency as a predictive biomarker of resistance to HER2-targeted therapy

in advanced gastric cancer. Oncology 2015;88:76-85.

32. Moses C, Nugent F, Waryah CB, Garcia-Bloj B, Harvey AR, Blancafort P.

Activating PTEN tumor suppressor expression with the CRISPR/dCas9

system. Mol Ther Nucleic Acids 2019;14:287-300.

103

RESEARCH ARTICLE

DOI: 10.4274/tjh.galenos.2019.2019.0312


Expression Profile Screening and Bioinformatics Analysis of

circRNA, LncRNA, and mRNA in Acute Myeloid Leukemia Drug-

Resistant Cells

Akut Myeloid Lösemi İlaç-Dirençli Hücrelerde circRNA, LncRNA, ve mRNA Ekspresyon

Profili Tarama ve Biyoinformatik Analizi

Meiling Li 1,2 , Fuxue Meng 2 , Quanyi Lu 1

1Zhongshan Hospital Affiliated to Xiamen University, Department of Hematology, Xiamen, China

2The Third Affiliated Hospital of Guizhou Medical University, Department of Hematology and Rheumatology, Duyun, China

Abstract

Objective: Acute myeloid leukemia (AML) is a highly heterogeneous

hematological malignancy, and drug resistance and relapse are

key factors in the failure of leukemia treatment. Studies have

increasingly shown that circRNA and LncRNA play important roles

in the development of tumors, but their roles remain unclear in the

mechanism of AML resistance.

Materials and Methods: Resistant AML cell line HL-60/ADM

(adriamycin, ADM) was constructed and circRNA, LncRNA, and mRNA

expression profiles were screened followed by high-throughput

sequencing. Bioinformatics analysis was then carried out, and the

circRNA-miRNA ceRNA network was constructed and confirmed using

qRT-PCR analysis.

Results: A total of 1824 circRNAs, 2414 LncRNAs, and 5346 mRNAs

were screened for differentially expressed genes. Enrichment analysis

was performed utilizing Gene Ontology and the Kyoto Encyclopedia of

Genes and Genomes, which mainly involved protein domain specific

binding, transforming growth factor-β (TGF-β) receptor, and cellular

metabolism. The mTOR signaling pathway, MAPK signaling pathway,

RAP1 signaling pathway, and Akt signaling pathway were closely

related to drug resistance.

Conclusion: Our study provides a systematic outlook on the potential

function of ncRNA in the molecular mechanisms of resistant AML cells.

Hsa-circ-0000978 and hsa-circ-0000483 might serve as potential

prognostic biomarkers and therapeutic targets of AML resistance.

Keywords: Acute myeloid leukemia, Drug resistance, CircRNA, LncRNA,

Bioinformatics analysis

Öz

Amaç: Akut myeloid lösemi (AML) oldukça heterojen bir hematolojik

malignitedir, ve tedavi başarısızlığında ilaç direnci ve nüks anahtar rol

oynamaktadır. Çalışmalar, circRNA ve lncRNA’nın tümör gelişiminde

önemli rol oynadığını artarak göstermektedir, ancak AML direnç

mekanizmasında rolleri belirsizliğini korumaktadır.

Gereç ve Yöntemler: Dirençli AML hücre hattı HL-60/ADM (adriamisin,

ADM) oluşturuldu ve circRNA, LncRNA, ve mRNA ekspresyon profilleri

yüksek-kapasitede dizileme sonrası tarandı. Sonra biyoinformatik

analiz gerçekleştirildi ve circRNA-miRNA ceRNA ağı oluşturuldu ve

qRT-PCR analizi kullanılarak doğrulandı.

Bulgular: Farklı ifade edilen genler için toplam 1824 circRNA, 2414

LncRNA, ve 5346 mRNA tarandı. Başlıca protein domain spesifik

bağlama, transforme edici büyüme faktörü-β (TGF-β) reseptörü, ve

hücresel metabolizma ile ilgili ‘Gene Ontology’ ve ‘Kyoto Encyclopedia

of Genes and Genome’ kullanılarak zenginleştirme analizi

gerçekleştirildi. mTOR sinyal yolağı, MAPK sinyal yolağı, RAP1 sinyal

yolağı ve Akt sinyal yolağı ilaç direnci ile yakından ilişkili idi.

Sonuç: Çalışmamız, dirençli AML hücrelerinin moleküler

mekanizmasında ncRNA’ın potansiyel fonksiyonuna sistematik bir

bakış açısı sağlamıştır. Hsa-circ-0000978 ve hsa-circ-0000483

potansiyel prognostik biyogöstergeler ve AML direncinin terapötik

hedefleri olarak işlev görebilirler.

Anahtar Sözcükler: Akut myeloid lösemi, İlaç direnci, CircRNA,

LncRNA, Biyoinformatik analiz



Address for Correspondence/Yazışma Adresi: Quanyi Lu, M.D., Zhongshan Hospital Affiliated to Xiamen

University, Department of Hematology, Xiamen, China

Phone : 86-18375129409

E-mail : wzst666@126.com ORCID: orcid.org/0000-0001-7173-6080

Received/Geliş tarihi: August 22, 2019


104


Li M, et al: Expression Profile of Resistant Leukemia Cells

Introduction

Acute myeloid leukemia (AML) is a highly heterogeneous

hematological malignancy. Although its treatment has made

significant progress, the prognosis is still unsatisfactory.

Recurrence and drug resistance are the main factors [1]. At

present, there are many studies on the molecular mechanisms

of AML resistance [2,3]. However, with the development of

bioinformatics, the epigenetic mechanism in the pathogenesis

of AML still remains unclear.

Among human transcripts, about 10%-20% are proteinencoding

RNA, and the remaining 80%-90% are noncoding

RNAs (ncRNAs) [4,5]. Long noncoding RNAs (LncRNAs) are a

class of noncoding RNAs that regulate gene expression at the

transcriptional or posttranscriptional level [6]. LncRNA plays

an important regulatory role in the drug resistance process. Li

et al. [7] reported that the LncRNA HOTTIP can promote the

development of pancreatic cancer and regulate gemcitabine

resistance by regulating HOXA13, while HOTTIP regulates

cisplatin resistance in osteosarcoma cells by activating the

Wnt/β-catenin pathway [8]. In addition, Qu et al. [9] found that

in sunitinib-resistant renal cell carcinoma, when FOX0 and AKT

expression decreased, LncRNA increased, knocking out LncRNA

and then reversing drug resistance. Endogenous competition

between mir-34 and mir-449 promotes the expression of AXL

and c-MET in sunitinib-resistant renal cell carcinoma to regulate

the drug resistance process, confirming that LncRNA can be used

as a target to repair drug resistance. Circular RNAs (circRNAs)

are novel noncoding RNAs characterized by a covalently closed

structure with nonrandom spiking and RNase degradation

resistance [10,11]. CircRNA is present in the cytoplasm and is

extremely abundant and highly conserved and stable in the

blood [12]. CircRNAs are increasingly found in various diseases

and show cell or tissue specificity [13,14,15].

At present, the molecular mechanism of LncRNA and circRNA

in resistant AML cells remains unclear. In this study, highthroughput

sequencing of HL-60 and HL-60/ADM (adriamycin,

ADM) was performed utilizing Gene Ontology (GO) and the

Kyoto Encyclopedia of Genes and Genomes (KEGG). A circRNAmiRNA

ceRNA network was constructed to provide new

therapeutic targets and the theoretical basis for treatment of

drug resistance in AML.


Materials

HL-60 cells were donated by Professor Lu Quanyi of the Key

Laboratory of Hematology, Xiamen University, Xiamen, China.

Basic RPMI 1640 Medium (GIBCO, Carlsbad, CA, USA), fetal

bovine serum (FBS; ScienCell, Carlsbad, CA, USA), adriamycin

(Haizhenghuirui Pharmaceutical Co. Ltd., Fuyang, Zhejiang,

China), the Cell Counting Kit-8 (Dojindo, Tokyo, Japan), RIPA

buffer (Beijing Solarbio Science & Technology Co. Ltd., Beijing,

China), the BCA Protein Assay Kit and One-Step Western Kit HRP

(Beijing Kangwei Century Biotechnology Co. Ltd., Beijing, China),

GAPDH monoclonal antibody (ImmunoWay Biotechnology Co,

Plano, TX, USA); P-gp monoclonal antibody (Abcam, Cambridge,

MA, USA), and Immobilon Western Chemiluminescent HRP

Substrate (Millipore Corp., Billerica, MA, USA) were also obtained.

Methods

Cell Culture and Drug Resistance Induction

HL-60 cells were incubated in basic RPMI 1640 Medium containing

10% FBS, 100 µg/mL streptomycin, and 100 U/mL penicillin at

37 °C and 5% CO 2

under saturated humidity conditions after

recovery. The liquid was changed once every 2 days, and 10 6

cells/mL were amplified at a 1:3 ratio. ADM induction was

performed in HL-60 cells by combining the concentration

gradient increasing method and the impact method (high-dose

intermittent induction) as referenced in the literature [16]. The

initial induction concentration was 0.1 µg/mL, shock induction

was performed for 1 h, and culturing was continued until HL-60

cells grew and proliferated normally at 1 µg/mL ADM. It took 8

months to successfully induce ADM resistance in HL-60 cells.

CCK-8 Assay and Cell IC 50

Values

HL-60 cells were collected and centrifuged at 1000 rpm/min for

5 min, and then they were resuspended in RPMI 1640 Medium

and counted. Furthermore, 10 4 cells of cell suspensions of 100

µL were placed in 96-well plates at 37 °C in a 5% CO 2

incubator

for culturing for 24 h. ADM was added with differences in

concentrations of 10 µL and cells were incubated for 24 h, and

then 10 µL of CCK-8 solution was added to each well. Culture

plates were further incubated in the incubator for 4 h. OD values

were measured and data were collected to calculate IC 50

values,

or ADM concentrations required for 50% inhibition in vitro.

Western Blot Detection of the Expression of Drug-Resistant

Protein

RIPA buffer was added with phenylmethanesulfonyl fluoride

to collect the cells showing logarithmic growth, and proteins

were extracted from the cells. Protein concentration was

determined using the BCA Protein Assay Kit. Protein samples

containing sample buffer were denatured for 5 min in boiling

water. SDS-PAGE electrophoresis was performed with 25 µg of

sample in each hole with the addition of 5 µL of prestained

protein marker. When the bromophenol blue dye ran off the

gel layer, the electrophoresis was terminated, and further

experiments were performed on a 35 mA transmembrane

overnight. The One-Step Western Kit HRP was used according to

the manufacturer’s instructions. Rabbit P-gp antibody, antibody

pretreatment solution, and dilution buffer solution were added,

105



mixed, and poured onto the membrane. Immobilon Western

Chemiluminescent HRP Substrate was used for color reaction.

RNA Library Construction and Sequencing

High-throughput sequencing service was provided by CloudSeq

Biotech (Shanghai, China). Transcriptome high-throughput

sequencing and subsequent bioinformatics analyses were also

performed by CloudSeq Biotech (Shanghai, China). Briefly, total

RNA was used to remove the rRNAs using the Ribo-Zero rRNA

Removal Kit (Illumina, USA) according to the manufacturer’s

instructions. RNA libraries were constructed using rRNAdepleted

RNAs with the TruSeq Stranded Total RNA Library Prep

Kit (Illumina, USA) according to the manufacturer’s instructions.

Libraries were checked for quality, and they were quantified

using the Bioanalyzer 2100 system (Agilent Technologies, USA).

Furthermore, 10 pM libraries were denatured as single-stranded

DNA molecules, captured on Illumina flow cells, amplified in situ

as clusters, and finally sequenced for 150 cycles on an Illumina

HiSeq Sequencer according to the manufacturer’s instructions.

Bioinformatics Analysis

For circRNA, high-quality reads were aligned to the reference

genome/transcriptome with STAR software (v2.5.1b) and

circRNAs were detected and identified with DCC software

(v0.4.4). edgeR software (v3.16.5) was used to normalize the

data and perform analysis of differentially expressed circRNAs.

GO and KEGG analyses were performed for the differentially

expressed circRNA-associated genes.

For LncRNA and mRNA, high-quality reads were aligned to the

human reference genome (UCSC hg19) with HISAT2 software

(v2.0.4). Then, guided by the Ensembl gtf gene annotation file,

the Cuffdiff program (v2.2.1, part of Cufflinks software) was

used to get the FPKM (fragments per kilobase of exon model per

million reads mapped) for the expression profiles of LncRNA and

mRNA. Accordingly, fold change and p-values were calculated

based on FPKM, and differentially expressed LncRNAs and

mRNAs were identified. LncRNA target genes were predicted

by locations in relation to nearby genes, and GO and pathway

analyses were performed on these target genes.

Time PCR System (Applied Biosystems) using the qPCR SYBR Green

Master Mix (CloudSeq). Primer design was as follows: chr13:

50054355-50057699+ (F 5’-CCTGAATCCAAGACAGCCA-3’, R

5’-AAGGGGGAAGTTTTGGCA-3’), chr18: 21644104-21649235+ (F

5’-GAAAATCCGCCCCCTCTA-3’, R 5’-TGACAAAGCTGGCTCCAA-3’),

chr7: 22330794-22357656- (F 5’-CATTCCTGCCAGAGGTGG-3’, R

5’-TGGGAAGGCGTATGTTCAA-3’), chr2: 15629018-15651474- (F

5’-CATCTGGGCGATTCCATC-3’, R 5’- AACCCCGTCTCCACCATT-3’),

and ACTB (F5’-GTGGCCGAGGACTTTGATTG-3’, R

5’-CCTGTAACAACGCATCTCATATT-3’). The target RNA and

internal parameters of each sample were subjected to real-time

PCR, which was repeated three times. The data were analyzed

by the 2 -ΔΔC T method.


All of the experimental data are presented as mean ± standard

deviation (SD), and the t-test was used for comparisons

between the two groups. Values of p<0.05 were considered to

be significantly different. GraphPad Prism 5 software was used

for statistical analysis.

Results

Construction of HL-60/ADM Drug-Resistant Cell Lines

Adriamycin resistance was induced in HL-60 cells via a

combination of the concentration gradient method and the

impact method (high-dose intermittent induction method)

according to the literature [16], and it took 8 months to obtain

HL-60/ADM resistant cell lines. IC 50

detection is shown in

Figure 1A. The expression of the drug resistance protein P-gp

in HL-60/ADM resistant cells was significantly higher than that

in HL-60 cells, with significance at p<0.01 (Figures 1B and 1C).

Expression of circRNA, LncRNA, and mRNA in Resistant Cells

To analyze the gene expression of resistant AML cells, we

performed high-throughput sequencing of circRNA, LncRNA,

and mRNA, and we screened differentially expressed genes.

Hierarchical cluster analysis showed that the expression patterns

Construction of circRNA-miRNA ceRNA Network

CircRNA-miRNA interactions were predicted using miRcode

(http://www.mircode.org/) and TargetScan (http://www.

targetscan.org/vert_72/) based on seed-match sequences. The

circRNA-miRNA network was then constructed using Cytoscape

software (http://www.cytoscape.org/).

Validation of Differentially Expressed circRNAs

Total RNA was extracted by TRIzol (Invitrogen Life Technologies,

Shanghai, China) to synthesize cDNA via reverse transcription.

Quantitative real-time PCR was performed on the ViiA 7 Real-

Figure 1. Detection of HL-60/ADM resistance: A) HL-60/ADM IC 50

test, where the ADM concentration gradient was set at 0, 0.1, 0.2,

0.4, 0.8, and 1.6 µg/mL. The horizontal axis is ADM concentration

and vertical axis is inhibition rate. B) Expression of drug-resistance

related protein P-gp. C) P-gp/GAPDH ratio (**p<0.01).

106



of drug-resistant and drug-sensitive cells were significantly

different (circRNA, Figure 2A; LncRNA, Figure 2D; mRNA, Figure

2G). Scatter plots were used to evaluate circRNA between

drug-resistant and drug-sensitive cells. LncRNA and mRNA

signal values were normalized to log2 values for visualization

of expression differences (Figures 2B, 2E, and 2H, respectively).

Volcanic maps were constructed based on fold change (FC≥1.2)

and p-value (<0.05), and volcano maps of the differentially

expressed genes between these two different conditions are

provided in Figures 2C, 2F, and 2I. The general characteristics of

RNA include RNA type, length, and localization distribution, as

shown in Figures 2J-2L. The results showed that resistant AML

cells differentially expressed 1824 circRNAs, 2414 LncRNAs, and

5346 mRNAs.

Functional Analysis of Differentially Expressed circRNA, LncRNA,

and mRNA

To explore the underlying genomics mechanisms involved in the

developmental disorders of AML tumorigenesis, GO and KEGG

pathway enrichment analyses of differentially expressed genes

were used to evaluate candidate RNA functions. The GO terms

with the highest enrichment scores for upregulated circRNA

targeting were ribonucleoside triphosphate catabolic process

and purine ribonucleoside triphosphate catabolic process (BP),

intracellular (CC), and adenyl ribonucleotide binding (MF); for

LncRNA, the GO terms involved macromolecule modification

(BP), cornified envelope (CC), and protein homodimerization

activity (MF); and anatomical structure morphogenesis (BP),

cytoplasm (CC), and protein binding (MF) belonged to the GO

analysis of mRNA. Furthermore, KEGG pathway analysis was

performed to predict potential module functions. The KEGG

analysis results were as follows: for circRNA, the B cell receptor

signaling pathway (hsa04662), T cell receptor signaling pathway

(hsa04660), MAPK signaling pathway (hsa04010), and mTOR

signaling pathway (hsa04150); for LncRNA, signaling pathways

regulating pluripotency of stem cells (hsa04550); and for mRNA,

the Wnt signaling pathway (hsa04310), Rap1 signaling pathway

(hsa04015), p53 signaling pathway (hsa04115), and VEGF

signaling pathway (hsa04370). These are closely related to cancer

progression and are significantly enriched in AML (Figure 3).

Construction of circRNA-miRNA ceRNA Network

To fully understand the underlying mechanisms of circRNA

and AML development, based on differentially expressed

circRNA data, we used a database to predict target miRNAs

interacting with circRNA, and Cytoscape was used to construct

a circRNA-targeted miRNA gene network map (Figure 4). For a

particular miRNA, circRNA has many targets, and the network

map illustrates the first five predicted miRNA targets that

differentially express circRNA.

Validation of circRNA Expression by RT-qPCR

Two upregulated genes (chr7: 2330794-22357656- and chr2:

15629018-15651474-) and two downregulated genes (chr13:

50054355-50057699+ and chr18: 21644104-21649235+)

Figure 2. Differential expression of circRNA, LncRNA, and mRNA

in HL-60/ADM. A-C) Hierarchical clustering, scatter plots, and

volcano plots of the differentially expressed circRNAs in HL-

60 and HL-60/ADM, respectively. D-F) Hierarchical clustering,

scatter plots, and volcano plots of the differentially expressed

LncRNAs in HL-60 and HL-60/ADM, respectively. G-I) Hierarchical

clustering, scatter plots, and volcano plots of the differentially

expressed mRNAs in HL-60 and HL-60/ADM, respectively. J) The

catalog of differentially expressed circRNAs. K) Distribution of

differentially expressed LncRNAs based on the length of nuclear

acids. L) Distribution of differentially expressed mRNAs based on

the location on human chromosomes.

Figure 3. GO and KEGG pathway analysis of circRNA, LncRNA,

and mRNA. A-B) Analysis of GO in terms of upregulation and

downregulation of circRNA. C) Pathway analysis of upregulation of

LncRNA. D) GO molecular function classification for upregulation

of mRNA.

107



were selected from the circRNAs with differential expression.

Differentially expressed circRNA levels were verified by RTqPCR.

As shown in Figure 5, the results of four circRNAs were

consistent with the trend observed in circRNA sequencing.

Discussion

At present, chemotherapy is still one of the main treatments

for leukemia. However, multidrug resistance and treatment

Figure 4. Network of twelve differentially expressed circRNA

and miRNA genes predicted in drug-resistant cells. CircRNA:

Red circles; MiRNA: green polygons. Twelve different genes were

selected from the upregulated circRNAs to construct the circRNAtargeted

miRNA gene network. Each circRNA is shown with five

miRNA predicted targets.

Figure 5. Expression levels of differentially expressed circRNA were

detected by RT-qPCR. The horizontal axis is genes and the vertical

axis is circRNA expression levels. A) Two genes, chr7:2330794-

22357656- and chr2:15629018-15651474, were selected from

circRNA with upregulated expression. B) chr13:50054355-

50057699+ and chr18:21644104-21649235+ were selected from

downregulated circRNAs. The target RNA and internal parameters

of each sample were subjected to real-time PCR, which was

repeated three times. The data were analyzed by 2- ΔΔC T method.

**p<0.01,*p<0.05.

are key factors in the failure of leukemia treatment. Several

factors are involved in the mechanism of leukemia resistance,

including ABC transporter-mediated multidrug resistance [17],

DNA repair abnormalities [18], variations in the bone marrow

microenvironment [19], and abnormal expression of noncoding

RNAs including circRNA, miRNA, and LncRNA [20]. Undeniably,

ncRNAs have opened up new prospects for AML diagnosis,

prognosis, and treatment. Indeed, the expression of specific

ncRNAs such as circRNAs and LncRNAs could assist clinicians

in classifying subtypes, evaluating prognosis, and predicting

the response to drug treatment in AML. Garzon et al. [21]

evaluated the associations of LncRNA expression with clinical

characteristics, gene mutations, and outcomes and constructed

an LncRNA score including 48 LncRNAs for independently

predicting outcome prognosis, confirming that LncRNAs can

assist in predicting clinical outcomes in older patients with

CN-AML. Moreover, Li and Sun [22] reported that SNHG5

overexpression was frequently observed in AML patients with

advanced FAB classification and unfavorable cytogenetics.

Furthermore, a higher SNHG5 expression level was also associated

with shorter overall survival. However, comprehensive analyses

of the profiles of differentially expressed circRNAs, LncRNAs,

and mRNAs in resistant AML cells have not been studied. Thus,

we explored the expression profiles and predicted the potential

functions of circRNAs, LncRNAs, and mRNAs in resistant

AML cells by utilizing RNA high-throughput sequencing and

bioinformatics analysis.

The numbers of differentially expressed genes of circRNAs,

LncRNAs, and mRNA in resistant AML cells are 1824, 2414,

and 5346, respectively. GO and KEGG pathway analyses of

differentially expressed LncRNAs mainly revealed protein

domain specific binding and protein dimerization activity. This

provides a basis for important contributions to the development

and resistance of leukemia. Although the understanding of the

nature and function of circRNAs is still limited, it is undeniable

that circRNA has always been a research hotspot in the field

of ncRNAs, which particularly regulate miRNA-targeted gene

expression as ceRNA molecules [23,24]. GO and KEGG pathway

analyses predicted that these differentially expressed circRNA

functions were related to tumor development, drug-resistant

regulation, and metabolism-related pathways.

GO analysis mainly revealed involvement with PI3K activity,

transforming growth factor-β (TGF-β) receptor, and cellular

metabolism. Sui et al. [25] reported that activation of the

PI3K/Akt/NF-κB pathway promotes P-gp expression, and the

inhibition of this pathway reverses P-gp-mediated multidrug

resistance. Zhou et al. explored the effect of the PI3K-specific

inhibitor ZSTK474 on K562/A02 cells and their results showed

that ZSTK474 reversed the resistance of K562/A02 cells to ADM

and imatinib by downregulating P-gp expression; accordingly,

the target of ZSTK474 for CML treatment is PI3K [26]. It can be

108



seen that PI3K activity plays an important role in the regulation

of drug resistance in leukemia. Results of KEGG analysis indicated

that the upregulated circRNA in drug-resistant cells was mainly

related to the mTOR signaling pathway, MAPK signaling pathway,

and Akt signaling pathway. The PI3K/Akt signaling pathway

maintains a close relationship between tumor cell multidrug

resistance and P-gp. Studies have shown that activation of the

PI3K/Akt signaling pathway increases drug efflux via the ATPbinding

cassette (ABC) transporter [27], while the blocking of

PI3K/Akt signaling pathways leads to downregulation of P-gp

and MRP1 expression, restoring sensitivity to chemotherapeutic

drugs [28].

According to the ceRNA theory, a circRNA-miRNA regulation

network is present in cases of resistant AML. Moreover,

differentially expressed circRNAs-miRNA interactions were

predicted and the potential molecular mechanisms were

further explored. Among these predicted potential target

miRNAs, hsa-miR-24-2-59 is reported to be upregulated during

hematopoietic cell terminal differentiation, suppressing MYC

expression [29]. Hsa-miR-181b-5p may play a prominent role

in pituitary adenoma as an effective biomarker and therapeutic

target [30]. However, there are some limitations to this study,

such as a small sample size and the in vitro research being

conducted only on HL-60 cells. The next step of this work will

be to verify the expression of LncRNAs and circRNAs in AML

patients and to study the mechanisms of LncRNAs and circRNAs

in the development of resistant AML.

Conclusion

Even though only resistance to adriamycin was assessed in

this study, the results suggest that the expression changes of

circRNA/LncRNA regulate the cell resistance of AML, providing a

new theoretical basis for the further understanding of multidrug

resistance mechanisms and targeted therapies in AML.

Ethics

Ethics Committee Approval: No human studies were involved

in this work.

Informed Consent: This study did not involve animal and

human ethics.


Concept: Q.L.; Data Collection or Processing: M.L., F.M.; Analysis

or Interpretation: F.M.

Conflict of Interest: The authors have no conflicts of interest

to declare.

Financial Disclosure: This work was supported by the Science and

Technology Project of the Science and Technology Department

of Guizhou Province (Qian Ke He Basics [2016]1129), the Science

and Technology Fund Project of the Health and Family Planning

Commission of Guizhou Province (gzwjkj2016-1-025), and the

Chinese Medicine Science and Technology Research Project of

the Guizhou Provincial Administration of Traditional Chinese

Medicine (QZZYY-2017-035).

References

1. Li XX, Zhou JD, Wen XM, Zhang TJ, Wu DH, Deng ZQ, Zhang ZH, Lian XY,

He PF, Yao XY, Lin J, Qian J. Increased MCL-1 expression predicts poor

prognosis and disease recurrence in acute myeloid leukemia. Onco Targets

Ther 2019;12:3295-3304.

2. Shang J, Chen WM, Liu S, Wang ZH, Wei TN, Chen ZZ, Wu WB. CircPAN3

contributes to drug resistance in acute myeloid leukemia through regulation

of autophagy. Leuk Res 2019;85:106198.

3. Lai QY, He YZ, Peng XW, Zhou X, Liang D, Wang L. Histone deacetylase 1

induced by neddylation inhibition contributes to drug resistance in acute

myelogenous leukemia. Cell Commun Signal 2019;17:86.

4. Bertone P, Stolc V, Royce TE, Rozowsky JS, Urban AE, Zhu X, Rinn JL,

Tongprasit W, Samanta M, Weissman S, Gerstein M, Snyder M. Global

identification of human transcribed sequences with genome tiling arrays.

Science 2004;306:2242-2246.

5. Kapranov P, Cheng J, Dike S, Nix DA, Duttagupta R, Willingham AT, Stadler

PF, Hertel J, Hackermüller J, Hofacker IL, Bell I, Cheung E, Drenkow J, Dumais

E, Patel S, Helt G, Ganesh M, Ghosh S, Piccolboni A, Sementchenko V,

Tammana H, Gingeras TR. RNA maps reveal new RNA classes and a possible

function for pervasive transcription. Science 2007;316:1484-1488.

6. Guttman M, Rinn JL. Modular regulatory principles of large noncoding.

Nature 2012;482:339-346.

7. Li Z, Zhao X, Zhou Y, Liu Y, Zhou Q, Ye H, Wang Y, Zeng J, Song Y, Gao W,

Zheng S, Zhuang B, Chen H, Li W, Li H, Li H, Fu Z, Chen R. The long noncoding

RNA HOTTIP promotes progression and gemcitabine resistance by

regulating HOXA13 in pancreatic cancer. J Transl Med 2015;13:84.

8. Li Z, Zhao L, Wang Q. Overexpression of long non-coding RNA HOTTIP

increases chemoresistance of osteosarcoma cell by activating the Wnt/βcatenin

pathway. Am J Transl Res 2016;8:2385-2393.

9. Qu L, Ding J, Chen C, Wu ZJ, Liu B, Gao Y, Chen W, Liu F, Sun W, Li XF, Wang

X, Wang Y, Xu ZY, Gao L, Yang Q, Xu B, Li YM, Fang ZY, Xu ZP, Bao Y, Wu DS,

Miao X, Sun HY, Sun YH, Wang HY, Wang LH. Exosome-transmitted lncARSR

promotes sunitinib resistance in renal cancer by acting as a competing

endogenous RNA. Cancer Cell 2016;29:653-668.

10. Wilusz JE, Sharp PA. Molecular biology. A circuitous route to noncoding

RNA. Science 2013;340:440-441.

11. Jeck WR, Sorrentino JA, Wang K, Slevin MK, Burd CE, Liu J, Marzluff WF,

Sharpless NE. Circular RNAs are abundant, conserved, and associated with

ALU repeats. RNA 2013;19:141-157.

12. Grisendi S, Mecucci C, Falini B, Pandolfi PP. Nucleophosmin and cancer. Nat

Rev Cancer 2006;6:493-505.

13. Salzman J, Chen RE, Olsen MN, Wang PL, Brown PO. Cell-type specific

features of circular RNA expression. PLoS Genet 2013;9:e1003777.

14. Memczak S, Jens M, Elefsinioti A, Torti F, Krueger J, Rybak A, Maier L,

Mackowiak SD, Gregersen LH, Munschauer M, Loewer A, Ziebold U,

Landthaler M, Kocks C, le Noble F, Rajewsky N. Circular RNAs are a large

class of animal RNAs with regulatory potency. Nature 2013;495:333-338.

15. Rybak-Wolf A, Stottmeister C, Glažar P, Jens M, Pino N, Giusti S, Hanan M,

Behm M, Bartok O, Ashwal-Fluss R, Herzog M, Schreyer L, Papavasileiou

P, Ivanov A, Öhman M, Refojo D, Kadener S, Rajewsky N. Circular RNAs

in the mammalian brain are highly abundant, conserved, and dynamically

expressed. Mol Cell 2015;58:870-885.

109



16. Chen J, Wei H, Cheng J, Xie B, Wang B, Yi J, Tian B, Liu Z, Wang F, Zhang

Z. Characteristics of doxorubicin-selected multidrug-resistant human

leukemia HL-60 cells with tolerance to arsenic trioxide and contribution of

leukemia stem cells. Oncol Lett 2018;15:1255-1262.

17. Liu B, Li LJ, Gong X, Zhang W, Zhang H, Zhao L. Co-expression of ATP

binding cassette transporters is associated with poor prognosis in acute

myeloid leukemia. Oncol Lett 2018;15:6671-6677.

18. Rushing AW, Hoang K, Polakowski N, Lemasson I. The human

T-cell leukemia virus type 1 basic leucine zipper factor attenuates repair of

double-stranded DNA breaks via nonhomologous end joining. J

Virol 2018;92:e00672-18.

19. Su M, Chang YT, Hernandez D, Jones RJ, Ghiaur G. Regulation of drug

metabolizing enzymes in the leukaemic bone marrow microenvironment. J

Cell Mol Med 2019;23:4111-4117.

20. Calin GA. The noncoding RNA revolution-three decades and still going

strong. Mol Oncol 2019;13:3.

21. Garzon R, Volinia S, Papaioannou D, Nicolet D, Kohlschmidt J, Yan PS,

Mrózek K, Bucci D, Carroll AJ, Baer MR, Wetzler M, Carter TH, Powell BL,

Kolitz JE, Moore JO, Eisfeld AK, Blachly JS, Blum W, Caligiuri MA, Stone RM,

Marcucci G, Croce CM, Byrd JC, Bloomfield CD. Expression and prognostic

impact of lncRNAs in acute myeloid leukemia. Proc Natl Acad Sci U S A

2014;111:18679-18684.

22. Li J, Sun CK. Long noncoding RNA SNHG5 is up-regulated and serves as a

potential prognostic biomarker in acute myeloid leukemia. Eur Rev Med

Pharmacol Sci 2018;22:3342-3347.

23. Hansen TB, Jensen TI, Clausen BH, Bramsen JB, Finsen B, Damgaard CK,

Kjems J. Natural RNA circles function as efficient microRNA sponges.

Nature 2013;495:384-388.

24. Liu J, Liu T, Wang X, He A. Circles reshaping the RNA world: from waste to

treasure. Mol Cancer 2017;16:58.

25. Sui H, Pan SF, Feng Y, Jin BH, Liu X, Zhou LH, Hou FG, Wang WH, Fu XL, Han

ZF, Ren JL, Shi XL, Zhu HR, Li Q. Zuo Jin Wan reverses P-gp-mediated drugresistance

by inhibiting activation of the PI3K/Akt/NF-kB pathway. BMC

Complement Altern Med 2014;14:279.

26. Zhou Q, Chen Y, Chen X, Zhao W, Zhong Y, Wang R, Jin M, Qiu Y, Kong D.

In vitro antileukemia activity of ZSTK474 on K562 and multidrug resistant

K562/A02 cells. Int J Biol Sci 2016;12:631-638.

27. Zhang X, Dong W, Zhou H, Li H, Wang N, Miao X, Jia L. α-2,8-Sialyltransferase

is involved in the development of multidrug resistance via PI3K/Akt

pathway in human chronic myeloid leukemia. IUBMB Life 2015;67:77-87.

28. Ma H, Cheng L, Hao K, Li Y, Song X, Zhou H, Jia L. Reversal effect of ST6GAL

1 on multidrug resistance in human leukemia by regulating the PI3K/Akt

pathway and the expression of P-gp and MRP1. PLoS One 2014;9:e85113.

29. Lal A, Navarro F, Maher CA, Maliszewski LE, Yan N, O’Day E, Chowdhury

D, Dykxhoorn DM, Tsai P, Hofmann O, Becker KG, Gorospe M, Hide W,

Lieberman J. miR-24 inhibits cell proliferation by targeting E2F2, MYC, and

other cell-cycle genes via binding to “seedless” 3‘UTR microRNA recognition

elements. Mol Cell 2009;35:610-625.

30. Wu S, Gu Y, Huang Y, Wong TC, Ding H, Liu T, Zhang Y, Zhang X. Novel

biomarkers for non-functioning invasive pituitary adenomas were

identified by using analysis of microRNAs expression profile. Biochem

Genet 2017;55:253-267.

110

PERSPECTIVES IN HEMATOLOGY

DOI: 10.4274/tjh.galenos.2019.2019.0248


Endocrine and Metabolic Disorders after Hematopoietic Cell

Transplantation

Hematopoietik Hücre Transplantasyonu sonrası Endokrin ve Metabolik Bozukluklar

Annalisa Paviglianiti

Saint Antoine Hospital, Department of Hematology and Cell Therapy, AP-HP, Paris, France

Abstract

Chemotherapy treatment and autologous and allogeneic cell

transplantations are often complicated by the onset of metabolic

and endocrine disorders. Autoimmune disorders, metabolic diseases,

and hormonal dysfunctions are some of the endocrine complications

observed during or after treatment with immunotherapy (mostly

novel agents) and/or chemotherapy conditioning for transplantation.

Although successful treatment of the underlying hematological

condition often improves the dysfunction, endocrinopathies can

have an impact on prognosis and are associated with poor survival;

therefore, it is important to detect and treat them as early as possible.

An increased incidence of cardiovascular diseases and metabolic

syndrome has been observed after transplantation mostly in longterm

survivors. In addition, chemotherapy and radiation along with

the prolonged use of corticosteroids can contribute to the onset

of thyroid and gonadal dysfunctions. The aim of this article is to

describe metabolic dysfunctions occurring in patients who underwent

allogeneic cell transplantation.

Keywords: Diabetes, Metabolic complications, Hematological disease,

Hematopoietic cell transplantation, Endocrine disorders

Öz

Kemoterapi tedavisi ve otolog ve allojeneik hücre transplantasyonları,

metabolik ve endokrin bozuklukların başlaması ile sıklıkla komplike

olmaktadır. Otoimmün bozukluklar, metabolik hastalıklar, ve

hormonal disfonksiyonlar immünoterapi (çoğunlukla yeni ajanlar)

ve/veya transplantasyon için uygulanan hazırlama rejimi sırasında

veya sonrasında gözlenen bazı endokrin komplikasyonlardır. Altta

yatan hematolojik durumun başarılı tedavisi endokrin disfonksiyonu

sıklıkla iyileştirmekle birlikte, endokrinopatilerin prognoz üzerine

etkisi olabilir ve kısa yaşam süresi ile ilişkilidir; bu nedenle mümkün

olduğu kadar erken saptanmaları ve tedavi edilmeleri önemlidir.

Çoğunlukla uzun dönem sağkalan hastalarda transplantasyon sonrası

kardiyovasküler hastalıklar ve metabolik sendromun insidansında

artma gözlenmektedir. Ek olarak, kortikosteroidlerin uzun süreli

kullanımı ile birlikte kemoterapi ve radyoterapi tiroid ve gonadal

bozuklukların başlamasına katkıda bulunabilir. Bu yazının amacı

allojeneik kök hücre transplantasyonu uygulanan hastalarda metabolik

bozuklukların anlatılmasıdır.

Anahtar Sözcükler: Diyabet, Metabolik bozukluklar, Hematolojik

hastalık, Hematopoietik hücre transplantasyonu, Endokrin bozukluklar

Introduction

Patients with hematological diseases undergoing chemotherapy

and/or hematopoietic cell transplantation (HCT) could

experience endocrine and metabolic complications affecting

their quality of life in a chronic way [1,2,3]. The occurrence

of metabolic complications can be related to different factors

including hematological disease, preexisting risk conditions,

cancer treatments, and HCT conditioning regimen modalities

(total body conditioning and type of chemotherapy).

Cancer treatment often consists of a combination of

corticosteroids with chemo-immunotherapy that can favor the

development of metabolic alterations. Furthermore, the use of

immunosuppressive agents in HCT settings is another iatrogenic

cause (Table 1). Nevertheless, the majority of available data

on the occurrence of endocrine complications refers to

pediatric populations. Reports on the endocrine consequences

of allogeneic transplantation at an adult age are poorer and

disparate.

Progress made in the cure of cancer has allowed for an increase

in the numbers of survivors of hematological diseases. Therefore,

prevention and prompt diagnosis of early and late endocrine

and metabolic complications, which impact a patient’s quality



Address for Correspondence/Yazışma Adresi: Annalisa Paviglianiti, M.D., Saint Antoine Hospital,

Department of Hematology and Cell Therapy, AP-HP, Paris, France

Phone : 0033(0) 1 42494823

E-mail : annalisa.paviglianiti@gmail.com ORCID: orcid.org/0000-0002-4243-9252



111

Paviglianiti A: Metabolic Diseases in Hematology


Table 1. Main risk factors for endocrine disorders after HCT.

Risk factors

Chemotherapy conditioning

Radiation therapy

Chronic GVHD

Female sex

Pituitary irradiation

High-dose and prolonged corticosteroid

treatment for GVHD

Young age at HCT

Pituitary irradiation

Low BMI

Chronic GVHD

Age >25 years at HCT

Alkylating agent use

Age <50 years

Prolonged corticosteroid use

Methotrexate use

Diagnosis of ALL

Prolonged immunosuppression

High-dose and prolonged corticosteroids

use for GVHD

Immunosuppressive therapy

Lipodystrophy due to GVHD

Elevated BMI

of life, are important. Herein, we discuss the main metabolic

and endocrine alterations in patients with hematological

malignancies undergoing HCT.

Diabetes

Endocrine alteration

Hypothyroidism

Adrenal insufficiency

Growth hormone

insufficiency

Spermatogenesis

alterations

Osteoporosis

Insulin resistance

HCT: Hematopoietic cell transplantation, GVHD: graft-versus-host disease, ALL: acute

lymphoblastic leukemia, BMI: body mass index.

Hyperglycemia is a frequent metabolic alteration in patients

with hematological diseases [4]. Glucocorticoids induce

hyperglycemia by increasing insulin resistance through

post-receptor insulin signaling defects [5]. Different factors

can trigger a preexisting condition of insulin resistance or

increase insulin requirements in a previously normoglycemic

patient. The main cause of hyperglycemia in patients with

hematological malignancies is glucocorticoid treatment, which

is frequently part of chemotherapy regimens and is also used

for the treatment of acute graft-versus-host disease (GVHD) in

patients who underwent HCT. Corticosteroids are able to induce

apoptosis of lymphocytes [6] and are an essential part of the

treatment for lymphoma [7], acute lymphoblastic leukemia [8],

and multiple myeloma [9]. Glucocorticoids are also used for the

prevention of acute and delayed chemotherapy-induced nausea

and vomiting in association with other antiemetic agents with

different doses according to grading [10,11,12].

In allogeneic settings, high-dose steroids are used for 1 to 2

weeks and eventually tapered over 8 weeks or more to treat

GVHD [13]. The use of calcineurin inhibitors, such as tacrolimus

and cyclosporine, is also associated with hyperglycemia due to

a direct effect on insulin biosynthesis and release [14], and with

islet cell apoptosis after toxic levels [5]. Another possible cause

of hyperglycemia in these patients is the administration of total

parenteral nutrition (TPN). Several studies have demonstrated

higher hyperglycemia rates in HCT recipients treated with TPN

compared to those who were not [15].

Hyperglycemia is associated with adverse outcomes in patients

undergoing intensive chemotherapy and HCT, such as increased

infections [16], incidence of GVHD [17], and mortality [18,19,20].

A survey of 1089 patients who underwent HCT reported higher

incidence of type 2 diabetes in allogeneic but not in autologous

HCT cases [21]. Moreover, a higher prevalence of metabolic

syndrome was reported in 86 patients who underwent allogeneic

HCT, highlighting the importance of glycemia monitoring in this

setting [22].

Treatment should be differentiated according to preexisting

diabetic status. For patients with type 2 diabetes before

chemotherapy, insulin substitution therapy is recommended.

In a study of patients with hematological malignancies and

type 2 diabetes, an increase of insulin therapy to 1.2 UI/kg a

day was necessary [23]. In patients with no previous history of

diabetes, treatment can be stratified according to mild (<200

mg/dL), moderate (200-300 mg/dL), or severe (>300 mg/dL)

hyperglycemia. Intravenous insulin should be reserved for critical

cases. For patients undergoing allogeneic HCT, glycosylated

hemoglobin (A1c) and lipid assay should be done once a year.

This timing should be shortened to 3 or 6 months for patients

who received corticosteroids or calcineurin inhibitors [24].

Metabolic Syndrome

The International Diabetes Foundation has defined metabolic

syndrome as the presence of at least three of the following

risk factors: abdominal obesity, triglycerides of more than 1.7

mmol/L, HDL cholesterol of less than 1 mmol/L for men and

less than 1.3 mmol/L for women, blood pressure of more than

130/85 mmHg, and blood glucose of more than 5.6 mmol/L

or treatments for the last three findings. A high incidence of

metabolic syndrome has been reported in HCT recipients [24].

One of the causes is the use of corticosteroids. Allogeneic

HCT recipients also have a higher incidence of dyslipidemia

compared to autologous recipients [25]. The lifestyle and family

history in association with treatments (total body irradiation,

112



acute and chronic GVHD, immunosuppressive treatment) have

all been associated with an augmented risk of dyslipidemia and,

consequently, metabolic syndrome [26]. Although there are no

studies showing the incidence of cardiovascular disease after

HCT, a few case reports described the onset of coronary artery

disease and early heart failure at a median of 7.5 years after

HCT in recipients aged 35 years old [27]. In adult long-term

survivors it is recommended to perform screening for glycemia

and dyslipidemia annually and a blood pressure assessment

at every outpatient consultation. Dietary restrictions and

treatment with statins for hypercholesterolemia and fibrate for

hypertryglicemia should also be considered.

Hypoglycemia

Hypoglycemia is a rare event but can occur as a consequence

of paraneoplastic production of insulin-like factors. The

main pathogenic mechanism for hypoglycemia is IGF-2

secretion. Hypoglycemia may also be due to increased glucose

consumption by the tumor [28]. Iatrogenic hypoglycemia has

also been reported in patients treated with rituximab [29],

tyrosine kinase inhibitors [30], and oral purine analogues [31], as

well as in those receiving trimethoprim/sulfamethoxazole [32];

all these drugs are commonly used in the allogeneic HCT setting.

A suggested mechanism for antibiotic-associated hypoglycemia

is the sulfonylurea-like effect [32].

The optimal therapeutic approach to hypoglycemia is to treat the

underlying malignancy. Parenteral dextrose has an immediate

effect, while oral glucose administration leads to glycemia in

15 to 30 minutes. For recurrent or chronic hypoglycemia, longterm

management includes intravenous corticosteroids and

glucagon (0.5 to 1 mg, intramuscularly).

Pituitary Dysfunctions

The prolonged use (more than 3 months) of steroids at a dose

of more than 7.5 mg/day can be associated with inhibition of

the production of the hypothalamic corticotrophin-releasing

hormone, leading to pituitary deficiency in HCT recipients

(secondary adrenal insufficiency). Corticotrophin deficiency

can also be caused by total body irradiation (TBI) [33]. Blood

cortisol levels and ACTH should be tested in all patients with

clinical symptoms and/or those who had long courses of steroids

treatment.

Replacement therapy with hydrocortisone is recommended

until the adrenal axis recovers [34]. Thyrotropin, gonadotropin,

and somatotropin deficiencies may also be associated.

Thyroid Disorders

Hypothyroidism is one of the most common endocrine

dysfunctions occurring after HCT [35]. The incidence varies

according to conditioning regimen, and it is increased in

the case of TBI. In a retrospective study, 248 patients who

underwent HCT (related donors, n=150; unrelated donors, n=70;

autologous, n=28) were compared to 317 siblings. Multivariate

analysis found that chronic GVHD was associated with a higher

risk of hypothyroidism together with other endocrine and

vascular diseases for related and unrelated survivors compared

to siblings [21]. A more recent retrospective study on acute

myeloid leukemia patients reported the presence of positive

thyroperoxidase antibodies and more than one allogeneic

HCT as being the main risk factors for developing clinical

hypothyroidism [36]. In addition, several retrospective studies

reported prolonged immunosuppressive therapy, HLA B35 of

the donor, and female donor to male recipient mismatch as risk

factors for hypothyroidism [37]. Patients should be screened

every 6 months in the first year after HCT and then once a

year for thyroid function (FT4 and TSH). A retrospective study

also reported that HCT recipients have a 3.26-fold higher risk

of thyroid cancer compared to the general population [38]. For

this reason, a thyroid ultrasound exam is recommended every 5

years after HCT after a normal clinical examination or every year

after an abnormal thyroid palpation [38].

Gonadal Dysfunction

Chemotherapy and radiation can cause infertility according to

type and dose [39].

For women, the degree of damage is dependent on the

chemotherapy agent and the patient’s age. Salooja et

al. retrospectively reported pregnancy outcomes after

HCT, indicating that patients who received busulfan and

cyclophosphamide are at higher risk of ovarian failure, while

cases of pregnancy were described for recipients of only

cyclophosphamide [40]. On the other hand, radiation leads to

sterility. Data derived from human oocyte models treated with

radiation have demonstrated that the lethal threshold is 2 Gy

[41].

For males, radiation is the main cause of azoospermia.

Chemotherapy with busulfan induces azoospermia at a

lower rate (approximately 50% of male patients). Rovo et

al. retrospectively reported that the presence of GVHD was

associated with adverse sperm recovery in 224 male patients

who underwent HCT [42].

Osteoporosis

The use of corticosteroids for hematological diseases and

for acute GVHD treatment is one of the main risk factors for

osteoporosis in HCT recipients. Age, lack of physical activity and

sun exposure, and gonadal failure are other causes. Moreover,

high-dose chemotherapy has been associated with a loss in

trabecular and cortical bone [43]. Vitamin D supplementation

113



(100,000 unit dose of oral cholecalciferol every month) is

essential to prevent osteoporosis in HCT recipients.

Conclusion

Survival after chemotherapy and HCT has improved with time;

therefore, it is important to include evaluation of metabolic and

endocrine disorders during follow-up. Moreover, the impact of

haploidentical HCT and novel immunotherapies on long-term

outcomes is still under assessment. Prospective research is

needed to better define individual risk factors for prevention

and strategies for treatment.

Ethics

Informed Consent: Institutional review board approval was

given and the participants provided informed consent.

Financial Disclosure: The author declared that this study


References

1. Flombaum CD. Metabolic emergencies in the cancer patient. Semin Oncol

2000;27:322-334.

2. Lee JH, Choi SJ, Lee JH, Kim SE, Seol M, Lee YS, Lee JS, Kim WK, Lee KH.

Severe metabolic abnormalities after allogeneic hematopoietic cell

transplantation. Bone Marrow Transplant 2005;35:63-69.

3. Ho AY, Mijovic A, Pagliuca A, Mufti GJ. Idiopathic hyperammonaemia

syndrome following allogeneic peripheral blood progenitor cell

transplantation (allo-PBPCT). Bone Marrow Transplant 1997;20:1007-1008.

4. Healy SJ, Dungan KM. Hyperglycemia in patients with hematologic

malignancies. Curr Diab Rep 2015;15:8.

5. Clore JN, Thurby-Hay L. Glucocorticoid-induced hyperglycemia. Endocr

Pract 2009;15:469-474.

6. Smith LK, Cidlowski JA. Glucocorticoid-induced apoptosis of healthy and

malignant lymphocytes. Prog Brain Res 2010;182:1-30.

7. Armitage JO. Treatment of non-Hodgkin’s lymphoma. N Engl J Med

1993;328:1023-1030.

8. Pui CH, Evans WE. Treatment of acute lymphoblastic leukemia. N Engl J Med

2006;354:166-178.

9. Burwick N, Sharma S. Glucocorticoids in multiple myeloma: past, present,

and future. Ann Hematol 2019;98:19-28.

10. Hesketh PJ. Chemotherapy-induced nausea and vomiting. N Engl J Med

2008;358:2482-2494.

11. American Society of Clinical Oncology; Kris MG, Hesketh PJ, Somerfield MR,

Feyer P, Clark-Snow R, Koeller JM, Morrow GR, Chinnery LW, Chesney MJ,

Gralla RJ, Grunberg SM. American Society of Clinical Oncology guideline

for antiemetics in oncology: update 2006. J Clin Oncol 2006;24:2932-2947.

12. Jordan K, Gralla R, Jahn F, Molassiotis A. International antiemetic guidelines

on chemotherapy induced nausea and vomiting (CINV): content and

implementation in daily routine practice. Eur J Pharmacol 2014;722:197-

202.

13. Griffith ML, Jagasia M, Jagasia SM. Diabetes mellitus after hematopoietic

stem cell transplantation. Endocr Pract 2010;16:699-706.

14. Vincenti F, Friman S, Scheuermann E, Rostaing L, Jenssen T, Campistol JM,

Uchida K, Pescovitz MD, Marchetti P, Tuncer M, Citterio F, Wiecek A, Chadban

S, El-Shahawy M, Budde K, Goto N; DIRECT (Diabetes Incidence after Renal

Transplantation: Neoral C Monitoring Versus Tacrolimus) Investigators.

Results of an international, randomized trial comparing glucose metabolism

disorders and outcome with cyclosporine versus tacrolimus. Am J Transplant

2007;7:1506-1514.

15. Sheean PM, Freels SA, Helton WS, Braunschweig CA. Adverse clinical

consequences of hyperglycemia from total parenteral nutrition exposure

during hematopoietic stem cell transplantation. Biol Blood Marrow

Transplant 2006;12:656-664.

16. Derr RL, Hsiao VC, Saudek CD. Antecedent hyperglycemia is associated

with an increased risk of neutropenic infections during bone marrow

transplantation. Diabetes Care 2008;31:1972-1977.

17. Gebremedhin E, Behrendt CE, Nakamura R, Parker P, Salehian B. Severe

hyperglycemia immediately after allogeneic hematopoietic stemcell

transplantation is predictive of acute graft-versus-host disease.

Inflammation 2013;36:177-185.

18. Hammer MJ, Casper C, Gooley TA, O’Donnell PV, Boeckh M, Hirsch IB. The

contribution of malglycemia to mortality among allogeneic hematopoietic

cell transplant recipients. Biol Blood Marrow Transplant 2009;15:344-351.

19. Garg R, Bhutani H, Alyea E, Pendergrass M. Hyperglycemia and length of

stay in patients hospitalized for bone marrow transplantation. Diabetes

Care 2007;30:993-994.

20. Brunello A, Kapoor R, Extermann M. Hyperglycemia during chemotherapy

for hematologic and solid tumors is correlated with increased toxicity. Am J

Clin Oncol 2011;34:292-296.

21. Baker KS, Ness KK, Steinberger J, Carter A, Francisco L, Burns LJ, Sklar C,

Forman S, Weisdorf D, Gurney JG, Bhatia S. Diabetes, hypertension, and

cardiovascular events in survivors of hematopoietic cell transplantation:

a report from the bone marrow transplantation survivor study. Blood

2007;109:1765-1772.

22. Majhail NS, Flowers ME, Ness KK, Jagasia M, Carpenter PA, Arora M, Arai

S, Johnston L, Martin PJ, Baker KS, Lee SJ, Burns LJ. High prevalence of

metabolic syndrome after allogeneic hematopoietic cell transplantation.

Bone Marrow Transplant 2009;43:49-54.

23. Gosmanov AR, Goorha S, Stelts S, Peng L, Umpierrez GE. Management of

hyperglycemia in diabetic patients with hematologic malignancies during

dexamethasone therapy. Endocr Pract 2013;19:231-235.

24. DeFilipp Z, Duarte RF, Snowden JA, Majhail NS, Greenfield DM, Miranda JL,

Arat M, Baker KS, Burns LJ, Duncan CN, Gilleece M, Hale GA, Hamadani M,

Hamilton BK, Hogan WJ, Hsu JW, Inamoto Y, Kamble RT, Lupo-Stanghellini

MT, Malone AK, McCarthy P, Mohty M, Norkin M, Paplham P, Ramanathan

M, Richart JM, Salooja N, Schouten HC, Schoemans H, Seber A, Steinberg

A, Wirk BM, Wood WA, Battiwalla M, Flowers ME, Savani BN, Shaw BE.

Metabolic syndrome and cardiovascular disease following hematopoietic

cell transplantation: screening and preventive practice recommendations

from CIBMTR and EBMT. Bone Marrow Transplant 2017;52:173-182.

25. Tichelli A, Bucher C, Rovó A, Stussi G, Stern M, Paulussen M, Halter J, Meyer-

Monard S, Heim D, Tsakiris DA, Biedermann B, Passweg JR, Gratwohl A.

Premature cardiovascular disease after allogeneic hematopoietic stem-cell

transplantation. Blood 2007;110:3463-3471.

26. Oudin C, Auquier P, Bertrand Y, Contet A, Kanold J, Sirvent N, Thouvenin S,

Tabone MD, Lutz P, Ducassou S, Plantaz D, Dalle JH, Gandemer V, Beliard S,

Berbis J, Vercasson C, Barlogis V, Baruchel A, Leverger G, Michel G. Metabolic

syndrome in adults who received hematopoietic stem cell transplantation

for acute childhood leukemia: an LEA study. Bone Marrow Transplant

2015;50:1438-1444.

27. Annaloro C, Airaghi L, Saporiti G, Onida F, Cortelezzi A, Deliliers GL.

Metabolic syndrome in patients with hematological diseases. Expert Rev

Hematol 2012;5:439-458.

28. Halsall DJ, Mangi M, Soos M, Fahie-Wilson MN, Wark G, Mainwaring-Burton

R, O’Rahilly S. Hypoglycemia due to an insulin binding antibody in a patient

with an IgA-kappa myeloma. J Clin Endocrinol Metab 2007;92:2013-2016.

29. Hussain BM, Geetha N, Lali V, Pandey M. Rituximab induced hypoglycemia

in non-Hodgkin’s lymphoma. World J Surg Oncol 2006;4:89.

114



30. Agostino NM, Chinchilli VM, Lynch CJ, Koszyk-Szewczyk A, Gingrich R, Sivik

J, Drabick JJ. Effect of the tyrosine kinase inhibitors (sunitinib, sorafenib,

dasatinib, and imatinib) on blood glucose levels in diabetic and nondiabetic

patients in general clinical practice. J Oncol Pharm Pract 2011;17:197-202.

31. Bay A, Oner AF, Cesur Y, Dogan M, Etlik O, Sanli F. Symptomatic hypoglycemia:

an unusual side effect of oral purine analogues for treatment of ALL. Pediatr

Blood Cancer 2006;47:330-331.

32. Nunnari G, Celesia BM, Bellissimo F, Tosto S, La Rocca M, Giarratana F, Benanti

F, Caltabiano E, Russo R, Cacopardo B. Trimethoprim-sulfamethoxazoleassociated

severe hypoglycaemia: a sulfonylurea-like effect. Eur Rev Med

Pharmacol Sci 2010;14:1015-1018.

33. Sathyapalan T, Dixit S. Radiotherapy-induced hypopituitarism: a review.

Expert Rev Anticancer Ther 2012;12:669-683.

34. Savani BN, Griffith ML, Jagasia S, Lee SJ. How I treat late effects in adults

after allogeneic stem cell transplantation. Blood 2011;117:3002-3009.

35. Isshiki Y, Ono K, Shono K, Onoda M, Yokota A. Autoimmune thyroid

dysfunction after allogeneic hematopoietic stem cell transplant. Leuk

Lymphoma 2016;57:1227-1229.

36. Medinger M, Zeiter D, Heim D, Halter J, Gerull S, Tichelli A, Passweg J,

Nigro N. Hypothyroidism following allogeneic hematopoietic stem cell

transplantation for acute myeloid leukemia. Leuk Res 2017;58:43-47.

37. Savani BN, Koklanaris EK, Le Q, Shenoy A, Goodman S, Barrett AJ. Prolonged

chronic graft-versus-host disease is a risk factor for thyroid failure in longterm

survivors after matched sibling donor stem cell transplantation for

hematologic malignancies. Biol Blood Marrow Transplant 2009;15:377-381.

38. Cohen A, Rovelli A, Merlo DF, van Lint MT, Lanino E, Bresters D, Ceppi M,

Bocchini V, Tichelli A, Socié G. Risk for secondary thyroid carcinoma after

hematopoietic stem-cell transplantation: an EBMT Late Effects Working

Party Study. J Clin Oncol 2007;25:2449-2454.

39. Tichelli A, Rovó A. Fertility issues following hematopoietic stem cell

transplantation. Expert Rev Hematol 2013;6:375-388.

40. Salooja N, Szydlo RM, Socie G, Rio B, Chatterjee R, Ljungman P, Van Lint

MT, Powles R, Jackson G, Hinterberger-Fischer M, Kolb HJ, Apperley JF;

Late Effects Working Party of the European Group for Blood and Marrow

Transplantation. Pregnancy outcomes after peripheral blood or bone

marrow transplantation: a retrospective survey. Lancet 2001;358:271-276.

41. Wallace WH, Thomson AB, Kelsey TW. The radiosensitivity of the human

oocyte. Hum Reprod 2003;18:117-121.

42. Rovó A, Aljurf M, Chiodi S, Spinelli S, Salooja N, Sucak G, Hunter A, Kim

TS, Socié G, van Lint MT, Passweg JR, Arat M, Badoglio M, Tichelli A; Late

Effects Working Party of the EBMT. Ongoing graft-versus-host disease

is a risk factor for azoospermia after allogeneic hematopoietic stem cell

transplantation: a survey of the Late Effects Working Party of the European

Group for Blood and Marrow Transplantation. Haematologica 2013;98:339-

345.

43. Banfi A, Podestà M, Fazzuoli L, Sertoli MR, Venturini M, Santini G, Cancedda

R, Quarto R. High-dose chemotherapy shows a dose-dependent toxicity

to bone marrow osteoprogenitors: a mechanism for post-bone marrow

transplantation osteopenia. Cancer 2001;92:2419-2428.

115

BRIEF REPORT

DOI: 10.4274/tjh.galenos.2019.2019.0154


The Impact of Early Versus Late Platelet and Neutrophil Recovery

after Induction Chemotherapy on Survival Outcomes of Patients

with Acute Myeloid Leukemia

Akut Myeloid Lösemili Hastalarda İndüksiyon Kemoterapisi Sonrası Erken ve Geç Trombosit

ve Nötrofil İyileşmesinin Etkileri

Rafiye Çiftçiler¹, İbrahim C. Haznedaroğlu¹, Nilgün Sayınalp 1 , Osman Özcebe 1 , Salih Aksu 1 , Haluk Demiroğlu 1 ,

Hakan Göker 1 , Ümit Yavuz Malkan 2 , Yahya Büyükaşık 1

1Hacettepe University Faculty of Medicine, Department of Hematology, Ankara, Turkey

2Dışkapı Training and Research Hospital, Department of Hematology, Ankara, Turkey

Abstract

Objective: The prognosis of patients with acute myeloid leukemia

(AML) is affected by factors that are both patient- and diseasespecific.

The aim of this study is to evaluate the impact of early versus

late platelet and neutrophil recovery after induction chemotherapy

on survival outcomes of AML patients.

Materials and Methods: A total of 181 patients with AML who were

treated in our tertiary center between 2001 and 2018 were evaluated.

Neutrophil and platelet recovery times were accepted as the periods

from the beginning of induction chemotherapy to a neutrophil

count of ≥0.5x10 9 /L and a platelet count of ≥20x10 9 /L 3 days in a

row, respectively. The median time to platelet recovery was 25 days

(range=12-52) for all patients. Therefore, platelet recovery in the

first 25 days was defined as early platelet recovery (EPR) and at ≥26

days it was defined as late platelet recovery (LPR). The median time

to neutrophil recovery was 28 days (range=13-51) for all patients.

Therefore, neutrophil recovery in the first 28 days was defined as early

neutrophil recovery, and at ≥29 days it was defined as late neutrophil

recovery.

Results: The 5-year overall survival (OS) rates for patients who had

EPR and LPR after induction chemotherapy were 62% and 23%,

respectively (p<0.001). The 5-year disease-free survival (DFS) rates for

patients who had EPR and LPR after induction chemotherapy were

57% and 15%, respectively (p<0.001).

Conclusion: Short bone marrow recovery time may indicate better

healthy hematopoiesis and marrow capacity associated with longer

OS and DFS.

Keywords: Acute myeloid leukemia, Platelet recovery, Neutrophil

recovery

Öz

Amaç: Akut myeloid lösemili (AML) hastaların prognozu, hem hastaya

hem de hastalığa özgü faktörlerden etkilenmektedir. Bu çalışmanın

amacı, indüksiyon kemoterapisi sonrası erken ve geç trombosit ve

nötrofil iyileşmesinin akut myeloid lösemi hastalarının sağkalım

sonuçları üzerindeki etkisini değerlendirmektir.

Gereç ve Yöntemler: 2001-2018 yılları arasında üçüncü basamak

sağlık merkezimizde tedavi edilen 181 AML hastası çalışmaya alındı.

Nötrofil ve trombosit iyileşme süreleri, indüksiyon kemoterapisinin

başlangıcından itibaren sırasıyla 3 gün süreyle nötrofil sayısının

0,5×10 9 /L’ye ve trombosit sayısının 20×10 9 /L’ye ulaşması olarak kabul

edildi. Trombosit iyileşmesinin ortalama süresi tüm hastalar için 25

gündü (12-52). Bu nedenle, ilk 25 günde trombosit iyileşmesi erken

trombosit iyileşmesi ve ≥26 gün geç trombosit iyileşmesi olarak

tanımlandı. Nötrofil iyileşmesine kadar geçen ortalama süre tüm

hastalar için 28 gündür (13-51). Bu nedenle, ilk 28 günde nötrofil

iyileşmesi erken nötrofil iyileşmesi ve ≥29 gün geç nötrofil iyileşmesi

olarak tanımlandı.

Bulgular: İndüksiyon kemoterapisi sonrası erken ve geç trombosit

iyileşmesi olan hastalar için 5 yıllık genel sağkalım sırasıyla %62 ve

%23 olarak saptandı (p<0,001). İndüksiyon kemoterapisi sonrası

erken ve geç trombosit iyileşmesi olan hastalar için 5 yıllık hastalıksız

sağkalım sırasıyla %57 ve %15 saptandı (p<0,001).

Sonuç: Sonuç olarak, kısa kemik iliği iyileşme süresi, daha uzun genel

ve hastalıksız sağkalım ile ilişkili daha sağlıklı bir hematopoez/kemik

iliği kapasitesini gösterebilir.

Anahtar Sözcükler: Akut myeloid lösemi, Nötrofil iyileşmesi,

Trombosit iyileşmesi



Address for Correspondence/Yazışma Adresi: Rafiye Çiftçiler, M.D., Hacettepe University Faculty of Medicine,

Department of Hematology, Ankara, Turkey

Phone : +90 505 583 17 98

E-mail : rafiyesarigul@gmail.com ORCID: orcid.org/0000-0001-5687-8531

Received/Geliş tarihi: April 9, 2019

Accepted/Kabul tarihi: September 2, 2019

116


Çiftçiler R, et al: The Impact of Early Versus Late Platelet and Neutrophil Recovery

Introduction

The clinical outcome of patients with acute myeloid leukemia

(AML) varies across a wide spectrum, ranging from survival of

a few days to remission. Therefore, the prediction of outcome

is vital for those patients [1]. Prognosis of patients with AML

is affected by factors that are both patient- and diseasespecific.

The most significant disease-specific prognostic

factors at the time of diagnosis of AML are cytogenetics and

molecular abnormalities [2]. On the other hand, the most

important patient-specific prognostic factor is age at diagnosis

[3]. Estimating resistance to treatment in patients with AML

is extremely important for critical therapeutic decisions and

follow-up of the patient [4]. Very limited data are available

regarding the association between AML prognosis and bone

marrow recovery kinetics following induction chemotherapy

[5,6,7]. The aim of this study was to evaluate the impact of early

versus late platelet and neutrophil recovery after induction

chemotherapy on the survival outcomes of AML patients.


Study Design and Data Collection

This study was performed in a retrospective manner. All clinical

data were collected from hospital medical records. As a result of

the application standards of the hospitals of Hacettepe Medical

School, it has been recognized from the patient records that all

of the studied patients had given informed consent at the time of

hospitalization and before the administration of chemotherapy

and other relevant diagnostic/therapeutic standards of care.

Patient and Disease Characteristics

Neutrophil recovery time (NRT) and platelet recovery time (PRT)

were accepted as the periods from the beginning of induction

chemotherapy to a neutrophil count of ≥0.5x10 9 /L 3 days

in a row and a platelet count of ≥20×10 9 /L 3 days in a row

(without transfusion support), respectively. The median time to

platelet recovery was 25 days (range=12-52) for all patients.

Therefore, platelet recovery in the first 25 days was defined as

early platelet recovery (EPR) and at ≥26 days it was defined

as late platelet recovery (LPR). The median time to neutrophil

recovery was 28 days (range=13-51) for all patients. Therefore,

neutrophil recovery in the first 28 days was defined as early

neutrophil recovery (ENR) and at ≥29 days it was defined as late

neutrophil recovery (LNR).

In this study, patient inclusion criteria were as follows: age

>18 years at the time of diagnosis, patients who received

first induction chemotherapy, and achievement of complete

remission after induction chemotherapy. Patients with refractory

AML and patients who were diagnosed with acute promyelocytic

leukemia were not included in this study. All patients included

in the study received idarubicin (12 mg/m 2 IV push on each of

the first 3 days of treatment) and Ara-C (100 mg/m 2 daily as a

continuous infusion for 7 days) as induction chemotherapy [8].

Statistical Analyses

Statistical analyses were performed using SPSS 25 (IBM Corp.,

Armonk, NY, USA). The variables were investigated using

visual (histograms, probability plots) and analytical methods

(Kolmogorov-Smirnov/Shapiro-Wilk tests) to determine

whether they were normally distributed or not. Statistical

comparisons were made using chi-square tests for categorical

data. The Student t-test for two independent samples was used

for comparison of continuous numerical data. Survival analyses

were made using Kaplan-Meier tests. Multivariate analysis of

predictors of survival was performed using the Cox regression

test. Parameters with p≤0.10 in univariate tests were included

in the multivariate analysis, while p<0.05 was considered to

indicate statistical significance.

Results

Patients’ Characteristics

A total of 450 AML patients admitted to our hospital between

2001 and 2018 were screened for this study. Patients with

refractory AML, patients who did not achieve complete

remission after the first induction chemotherapy, and patients

who died during induction chemotherapy were not included

in the study. Patient characteristics are summarized in Table 1.

There were 106 (57.9%) males and 77 (42.1%) females with a

median age of 44 (range=18-69) years at diagnosis. Karyotype

analyses were available for 159 patients: 6 patients (3.7%) were

in the favorable-risk group, 101 (63.5%) patients were in the

intermediate-risk group, and 54 (33.9%) patients were in the

adverse-risk group according to the European LeukemiaNet

classification [9]. The number of patients classified as having

Eastern Cooperative Oncology Group performance status (ECOG

PS) 0, 1, 2, and 3 were 4 (2.2%), 87 (48.1%), 78 (43.1%), and

12 (6.6%), respectively [10]. According to periods, LPR was seen

in fewer patients between 2011 and 2018 than in 2001-2010

(p=0.01). Preexisting myelodysplastic syndrome or secondary

AML was seen more in patients with LPR than in patients with

EPR (p=0.02).

There were no statistically significant differences between

the two groups in terms of median age (p=0.10), sex (p=0.18),

cytogenetic risk group (p=0.77), and ECOG PS (p=0.06). Mortality

(66.3% vs. 30.4%, p<0.001) and relapse rate (47.2% vs. 29.3%

p=0.01) were higher in patients who had LPR than EPR after

induction chemotherapy. Nonrelapse mortality rate (NMR) was

higher in patients who had LPR than EPR (28.1% vs. 9.8%,

p=0.001). Major causes of NRM were infections (20 vs. 8), heart

attack (3 vs. 0), acute renal failure (1 vs. 0), and graft-versushost

disease (1 vs. 0) in LPR and EPR patients, respectively.

117



Table 1. Baseline characteristics of AML patients.

Parameters Patients who had EPR Patients who had LPR p-value

N (%) 92 (50.8%) 89 (49.2%)

Median age (range), years 41 (19-69) 45 (18-68) 0.10

Male/female (%) 49/43 (53.3%/46.7%) 56/33 (62.9%/37.1%) 0.18

Platelet recovery time, ± SD 19.8±3.4 35.5±7.9 <0.001

ECOG performance status 0.06

0 3 (3.3%) 1 (1.1%)

1 52 (56.5%) 35 (39.3%)

2 32 (34.8%) 46 (51.7%)

3 5 (5.4%) 7 (7.9%)

Cytogenetic risk group 0.77

Favorable 2 (2.2%) 4 (4.5%)

Intermediate 50 (54.3%) 51 (57.3%)

Adverse 28 (30.4%) 24 (27.0%)

Unavailable 12 (13.0%) 10 (11.2%)

According to time period 0.01

2001-2010 27 (39.1%) 42 (60.9%)

2011-2018 65 (58 %) 47 (42%)

Preexisting MDS or secondary AML 0.02

Preexisting MDS 1 (1.1%) 9 (10.1%)

Secondary AML 3 (3.3%) 2 (2.2%)

Patients who had early/late neutrophil recovery 77/15 (83.7%/16.3%) 23/66 (25.8%/74.2%) <0.001

Neutrophil recovery time, ±SD 24.8±7.1 34.0±8.2 <0.001

Allo-HSCT 66 (71.7%) 46 (51.7%) 0.005

Relapse rate (%) 27 (29.3%) 42 (47.2%) 0.01

Mortality rate (%) 28 (30.4%) 59 (66.3%) <0.001

Nonrelapse mortality (%) 9 (9.8%) 25 (28.1%) 0.002

AML: Acute myeloid leukemia, EPR: early platelet recovery; LPR: late platelet recovery, ECOG: eastern Cooperative Oncology Group, MDS: myelodysplastic syndrome, allo-HSCT:

allogeneic hematopoietic stem cell transplantation.

Overall Outcomes

Median follow-up time was 21 months (range=1.5-220) for all

patients. The 3-year overall survival (OS) rates for patients who

had EPR and LPR were 68% and 40%, respectively. The 5-year

OS rates for patients who had EPR and LPR were 62% and 23%,

respectively (p<0.001). The 3-year disease-free survival (DFS)

rates for patients who had EPR and LPR were 64% and 28%,

respectively. The 5-year DFS rates for patients who had EPR and

LPR were 57% and 15%, respectively (p<0.001).

The 3-year OS rates for patients who had ENR and LNR were 63%

and 42%, respectively. The 5-year OS rates for patients who had

ENR and LNR were 53% and 28%, respectively (p<0.001). The

3-year DFS rates for patients who had ENR and LNR were 57%

and 32%, respectively. The 5-year DFS rates for patients who

had ENR and LNR were 46% and 22%, respectively (p<0.001)

(Figure 1).

Figure 1. Overall survival (OS) and disease-free survival (DFS)

of patients (A-B for EPR and LPR groups, C-D for ENR and LNR

groups).

118



Table 2. Univariate and multivariate analyses of overall survival (OS) and disease-free survival (DFS).

Parameters for OS

Univariate analyses

Hazard ratio

95% confidence

interval

p-value

Multivariate analyses

Hazard ratio

95% confidence

interval

Age 1.025 1.008-1.042 0.004 1.003 0.987-1.020 0.69

Sex (female) 0.730 0.470-1.132 0.159

p-value

Cytogenetic 2.350 1.770-3.120 <0.001 1.691 1.260-2.269 <0.001

ECOG PS 3.271 2.346-4.561 <0.001 2.393 1.633-3.506 <0.001

ENR 2.157 1.408-3.307 <0.001 1.337 0.781-2.289 0.28

EPR 2.744 1.744-4.315 <0.001 1.911 1.090-3.348 0.02

Parameters for DFS

Age 1.022 1.006-1.037 0.006 1.006 0.991-1.021 0.41

Sex (female) 0.678 0.452-1.018 0.06 0.500 0.324-0.772 0.002

Cytogenetic 2.094 1.625-2.698 <0.001 1.680 1.284-2.199 <0.001

ECOG PS 2.816 2.085-3.805 <0.001 2.392 1.656-3.454 <0.001

ENR 2.090 1.413-3.091 <0.001 1.281 0.766-2.141 0.34

EPR 2.650 1.758-3.996 <0.001 1.944 1.144-3.305 0.01

ECOG PS: Eastern Cooperative Oncology Group performance status, ENR: early neutrophil recovery, EPR: early platelet recovery, OS: overall survival, DFS: disease-free survival.

Cox Regression Analyses

In univariate analyses, factors affecting OS were age (p=0.004),

cytogenetics (p<0.001), ECOG PS (p<0.001), ENR (p<0.001),

and EPR (p<0.001) of the patients, as shown in Table 2. Cox

regression analysis revealed the parameters predicting OS as

cytogenetics (p<0.001), ECOG PS (p<0.001), and EPR (p=0.02)

of the patients.

In univariate analyses, factors affecting DFS were age (p=0.006),

sex (p=0.06), cytogenetics (p<0.001), ECOG PS (p<0.001), ENR

(p=0.009), and EPR (p=0.001) of the patients. Cox regression

analysis revealed the parameters predicting DFS as sex (p=0.002),

cytogenetics (p<0.001), ECOG PS (p<0.001), and EPR (p=0.01) of

the patients.

Discussion

After induction chemotherapy, the duration of neutropenia

and thrombocytopenia carries a risk of complications in

AML patients. Some patients die from infections during the

neutropenic period. Intracranial hemorrhage may be seen

because of thrombocytopenia as a serious life-threatening

complication. In this study, EPR was one of the significant

independent parameters in multivariate analysis that included

classical prognostic risk factors for OS and DFS. Since

hematopoietic growth factors were used for neutrophil recovery

in some patients, ENR may not have significantly resulted in

long OS and DFS in multivariate analysis. Bone marrow reserve

may be considered to be better in patients who had EPR and

ENR. Patients with LPR and LNR may be considered more atrisk

and donor screening may be initiated at an early stage for

allogeneic hematopoietic stem cell transplantation (allo-HSCT).

AML prognosis is related to bone marrow recovery, cellular

kinetics [5], and blast clearance after induction chemotherapy

[11,12]. Some studies reported that an early response to induction

chemotherapy was a strong and independent prognostic

factor for survival in patients with de novo and relapsed AML

[13,14,15]. Yamazaki et al. [16] showed that the regeneration

of hematopoiesis after induction chemotherapy, and especially

the recovery of platelets, is an important positive predictor for

DFS in patients with AML. On the other hand, a previous study

evaluated the survival outcomes of patients who underwent

allo-HSCT with incomplete remission (CRi, bone marrow CR

with absolute neutrophil count of <1,000/mm 3 and/or platelet

count of <100,000/mm 3 ) and complete remission (CR, bone

marrow CR with absolute neutrophil count of ≥1,000/mm 3 and

platelet count of ≥100,000/mm 3 ). The study showed equivalent

posttransplant outcomes between patients who were in CR and

in CRi before allo-HSCT. Therefore, allo-HSCT can eliminate the

negative effect of pretransplant blood count levels [17]. The

major cause of NRM was infection; therefore, allo-HSCT might

be considered in the nadir period for AML patients. However,

it will be difficult to find a donor in such a short period and

prepare the patient for allo-HSCT.

Conclusion

Early bone marrow recovery may indicate a better healthy

hematopoiesis and marrow capacity associated with longer OS

and DFS. As PRT and NRT are very easy to detect, they can be

119



used as prognostic indicators in countries with limited laboratory

facilities. Our results support the impression that an accelerated

platelet and neutrophil recovery following chemotherapy could

be accepted as a promising sign of good prognosis and thus

good future response to therapy in AML. The results of this

study are important for prediction of the prognosis of newly

diagnosed AML patients.

Ethics

Ethics Committee Approval: All ethical considerations

were strictly followed in accordance with the 1964 Helsinki

Declaration. As standard care/action of the hospitals of the

Hacettepe Medical School, it has been recognized from the

patient records that all of the studied patients had given

informed consent at the time of hospitalization and before the

administration of chemotherapy and other relevant diagnostic/

therapeutic standards of care.

Informed Consent: All of the studied patients gave informed

consent at the time of admission to the hospital.


Surgical and Medical Practices: R.Ç.; Concept: Y.B.; Design:

H.D.; Data Collection or Processing: R.Ç., Ü.Y.M.; Analysis or

Interpretation: Y.B., O.Ö., N.S.; Literature Search: İ.C.H., S.A.;

Writing: R.Ç.

Conflict of Interest: The authors of this paper have no conflict

of interests, including specific financial interests, relationships,

and/or affiliations relevant to the subject matter or materials

included.



References

1. Ferrara F, Palmieri S, Leoni F. Clinically useful prognostic factors in acute

myeloid leukemia. Crit Rev Oncol Hematol 2008;66:181-193.

2. Döhner H, Estey E, Grimwade D, Amadori S, Appelbaum FR, Büchner T,

Dombret H, Ebert BL, Fenaux P, Larson RA, Levine RL, Lo-Coco F, Naoe T,

Niederwieser D, Ossenkoppele GJ, Sanz M, Sierra J, Tallman MS, Tien HF,

Wei AH, Löwenberg B, Bloomfield CD. Diagnosis and management of AML

in adults: 2017 ELN recommendations from an international expert panel.

Blood 2017;129:424-447.

3. Liersch R, Müller-Tidow C, Berdel WE, Krug U. Prognostic factors for acute

myeloid leukaemia in adults-biological significance and clinical use. Br J

Haematol 2014;165:17-38.

4. Walter RB, Othus M, Burnett AK, Löwenberg B, Kantarjian HM, Ossenkoppele

GJ, Hills RK, Ravandi F, Pabst T, Evans A, Pierce SR, Vekemans MC, Appelbaum

FR, Estey EH. Resistance prediction in AML: analysis of 4601 patients

from MRC/NCRI, HOVON/SAKK, SWOG and MD Anderson Cancer Center.

Leukemia 2015;29:312-320.

5. Yanada M, Borthakur G, Garcia-Manero G, Ravandi F, Faderl S, Pierce S,

Kantarjian H, Estey E. Blood counts at time of complete remission provide

additional independent prognostic information in acute myeloid leukemia.

Leuk Res 2008;32:1505-1509.

6. Malkan UY, Gunes G, Isik A, Eliacik E, Etgul S, Aslan T, Balaban MS,

Haznedaroglu IC, Demiroglu H, Goker H, Ozcebe OI, Sayınalp N, Aksu S,

Buyukasik Y. Rebound thrombocytosis following induction chemotherapy

is an independent predictor of a good prognosis in acute myeloid leukemia

patients attaining first complete remission. Acta Haematol 2015;134:32-37.

7. Gonen C, Haznedaroglu IC, Aksu S, Koca E, Göker H, Büyükaşik Y, Sayinalp N,

Ozcebe O, Dündar S. Endogenous thrombopoietin levels during the clinical

management of acute myeloid leukaemia. Platelets 2005;16:31-37.

8. Ravandi F, Cortes JE, Jones D, Faderl S, Garcia-Manero G, Konopleva MY,

O’Brien S, Estrov Z, Borthakur G, Thomas D, Pierce SR, Brandt M, Byrd A,

Bekele BN, Pratz K, Luthra R, Levis M, Andreeff M, Kantarjian HM. Phase I/II

study of combination therapy with sorafenib, idarubicin, and cytarabine in

younger patients with acute myeloid leukemia. J Clin Oncol 2010;28:1856-

1862.

9. Döhner H, Estey EH, Amadori S, Appelbaum FR, Büchner T, Burnett

AK, Dombret H, Fenaux P, Grimwade D, Larson RA, Lo-Coco F, Naoe T,

Niederwieser D, Ossenkoppele GJ, Sanz MA, Sierra J, Tallman MS, Löwenberg

B, Bloomfield CD; European LeukemiaNet. Diagnosis and management of

acute myeloid leukemia in adults: recommendations from an international

expert panel, on behalf of the European LeukemiaNet. Blood 2010;115:453-

474.

10. Oken MM, Creech RH, Tormey DC, Horton J, Davis TE, McFadden ET, Carbone

PP. Toxicity and response criteria of the Eastern Cooperative Oncology

Group. Am J Clin Oncol 1982;5:649-656.

11. Elliott MA, Litzow MR, Letendre LL, Wolf RC, Hanson CA, Tefferi A, Tallman

MS. Early peripheral blood blast clearance during induction chemotherapy

for acute myeloid leukemia predicts superior relapse-free survival. Blood

2007;110:4172-4174.

12. Vainstein V, Buckley SA, Shukron O, Estey EH, Abkowitz JL, Wood BL, Walter

RB. Rapid rate of peripheral blood blast clearance accurately predicts

complete remission in acute myeloid leukemia. Leukemia 2014;28:713.

13. Kern W, Haferlach T, Schoch C, Loffler H, Gassmann W, Heinecke A,

Sauerland MC, Berdel W, Buchner T, Hiddemann W. Early blast clearance by

remission induction therapy is a major independent prognostic factor for

both achievement of complete remission and long-term outcome in acute

myeloid leukemia: data from the German AML Cooperative Group (AMLCG)

1992 Trial. Blood 2003;101:64-70.

14. Creutzig U, Zimmermann M, Ritter J, Henze G, Graf N, Löffler H, Schellong

G. Definition of a standard-risk group in children with AML. Br J Haematol

1999;104:630-639.

15. Creutzig U, Zimmermann M, Dworzak MN, Gibson B, Tamminga R,

Abrahamsson J, Ha SY, Hasle H, Maschan A, Bertrand Y, Leverger G, von

Neuhoff C, Razzouk B, Rizzari C, Smisek P, Smith OP, Stark B, Reinhardt

D, Kaspers GL. The prognostic significance of early treatment response in

pediatric relapsed acute myeloid leukemia: results of the international

study Relapsed AML 2001/01. Haematologica 2014;99:1472-1478.

16. Yamazaki E, Kanamori H, Itabashi M, Ogusa E, Numata A, Yamamoto W, Ito

S, Tachibana T, Hagihara M, Matsumoto K, Koharazawa H, Taguchi J, Tomita

N, Fujimaki K, Fujita H, Fujisawa S, Ogawa K, Ishigatsubo Y. Hyper-recovery

of platelets after induction therapy is a predictor of relapse-free survival in

acute myeloid leukemia. Leuk Lymphoma 2017;58:104-109.

17. Ciftciler R, Demiroglu H, Buyukasık Y, Aksu S, Goker H. Impact of blood

count recovery-based complete remission before allogeneic hematopoietic

stem cell transplantation on survival in patients with acute myeloid

leukemia. Clin Lymphoma Myeloma Leuk 2019;19:e205-e212.

120

IMAGES IN HEMATOLOGY

DOI: 10.4274/tjh.galenos.2019.2019.0134


A Rare Chromosomal Abnormality in Chronic Lymphocytic

Leukemia: t(13;13)

Kronik Lenfositik Lösemide Nadir Bir Kromozomal Anomali: t(13;13)

Akbar Safaei 1 , Ahmad Monabati 1,3 , Moeinadin Safavi 1,2

1Shiraz University of Medical Sciences Molecular Pathology and Cytogenetic Section, Medical Faculty, Department of Pathology, Shiraz, Iran

2Tehran University of Medical Sciences Medical Faculty, Department of Pathology, Tehran, Iran

3Shiraz University of Medical Sciences, Hematopathology Research Center, Shiraz, Iran

Figure 1. Peripheral blood culture with TPA revealed t(13;13) (q14;q32).

The patient was a 67-year-old man with peripheral blood

lymphocytosis. The patient’s complete blood count revealed

hemoglobin of 12.2 g/dL, white blood cell count of 22,000/µL,

and platelet count of 124,000/µL. The differential count for

white blood cells was as follows: neutrophils, 10%; lymphocytes,

86%; and monocytes, 4%. Absolute lymphocyte count was

18,920/µL. Flow cytometry of peripheral blood revealed 86%

lymphocytes, which were positive for CD19, CD79b, CD20 (dim),

CD5, CD23, and CD45, but they were negative for FMC7 and

CD38. Blood culture with phorbol 12-myristate 13-acetate (TPA)

and subsequent Giemsa banding revealed t(13;13)(q14;q32)

[8]/46,XY[12] (Figure 1).

Structural aberrations of the long arm of chromosome

13,t/del(13q) account for 20% of all chromosomal abnormalities

in chronic lymphocytic leukemia [1]. This rate is even higher when



Address for Correspondence/Yazışma Adresi: Moeinadin Safavi, M.D., Shiraz University of Medical Sciences

Molecular Pathology and Cytogenetic Section, Medical Faculty, Department of Pathology, Shiraz, Iran

E-mail : safavi_moeinadin@yahoo.com ORCID: orcid.org/0000-0002-4042-7506

Received/Geliş tarihi: March 29, 2019

Accepted/Kabul tarihi: June 11, 2019

121

Safaei A, et al: Rare Chromosomal Abnormality


more precise methods like fluorescence in situ hybridization are

used for deletion of band 13q14, reaching 50% of all cases.

Although translocations of chromosome 13 could have different

counterparts, t(13;13) has been reported very rarely. According

to the Mitelman database, only six cases have been registered

so far [2].

Keywords: Chronic lymphocytic leukemia, Cytogenetics,

Chromosome 13

Anahtar Sözcükler: Kronik lenfositik lösemi, Sitogenetik,

Kromozom 13

Informed Consent: Informed consent was obtained from the

individual participant included in the study.


Concept: A.S., A.M.; Design: M.S.; Data Collection or Processing:

M.S.; Interpretation: A.S., A.M., M.S.; Literature Search: M.S.;

Writing: M.S.

Conflict of Interest: The authors declare no conflict of interest.

References

1. Herholz H, Kern W, Schnittger S, Haferlach T, Dicker F, Haferlach C.

Translocations as a mechanism for homozygous deletion of 13q14 and loss

of the ATM gene in a patient with B-cell chronic lymphocytic leukemia.

Cancer Genet Cytogenet 2007;174:57-60.

2. Mitelman Database of Chromosome Aberrations and Gene Fusions in

Cancer. Bethesda, National Cancer Institute. Accessed 29 March 2019.

Available online at https://cgap.nci.nih.gov/Chromosomes/Mitelman.

122

IMAGES IN HEMATOLOGY

DOI: 10.4274/tjh.galenos.2019.2019.0398


Garland of Erythroblasts around a Macrophage: Erythroblastic

Island

Makrofajların Etrafndaki Eritroblast Halkası: Eritroblastik Ada

Chandan Kumar, Garima Jain, Anita Chopra

Laboratory Oncology Unit, Dr. B.R.A.I.R.C.H., All India Institute of Medical Sciences, New Delhi, India

Figure 1. Bone marrow aspirate showing erythroid precursors

surrounding a central macrophage: erythroblastic island (Jenner and

Giemsa, 1000 x ).

Erythroblastic islands (EBIs) were first described by Marcel Bessis

in 1958 [1] as functional units of erythropoiesis where a central

macrophage functions as a “nurse” cell [2].

We found a picturesque erythroblastic island with a central

macrophage encircled by a garland of erythroid cells (Figure

1) in the bone marrow aspirate (BMA) of a 43-year-old man

diagnosed with diffuse large B-cell lymphoma (DLBCL) on

lymph node biopsy. BMA was done as a part of the staging

workup, which was cellular and showed normoblastic erythroid

hyperplasia and no evidence of lymphoma infiltration. Many

macrophages surrounded by erythroid precursors (EBIs) were

also seen.

Early descriptions of EBIs did not receive much attention because

of their infrequent occurrence in BMA due to their distortion

during smear preparation [2]. Some recent studies [3,4] have

suggested that EBIs can boost the number of red blood cells



Address for Correspondence/Yazışma Adresi: Anita Chopra, M.D., Laboratory Oncology Unit, Dr. B.R.A.I.R.C.H., All

India Institute of Medical Sciences, New Delhi, India

Phone : 91-11-29575415

E-mail : chopraanita2005@gmail.com ORCID: orcid.org/0000-0002-0238-8702

Received/Geliş tarihi: November 9, 2019


123

Kumar C, et al: Erythroblastic Island


produced in vivo during stress and can also act as potential targets

in the treatment of inappropriately accelerated erythropoiesis

in disease conditions like β-thalassemia and polycythemia vera.

While progress is being made in understanding the role of the

central macrophage of an EBI in regulating erythropoiesis, many

questions remain unanswered, such as its precise physiology,

clinical relevance, and contribution to the pathology of

erythropoiesis in benign and malignant hematopoietic disorders.

Keywords: Erythroblastic island, Macrophage

Anahtar Sözcükler: Eritroblast adası, Makrofaj

Informed Consent: Bone marrow examination was done as part

of routine work-up of the patient after obtaining his consent.

We did not collect extra samples from the patient.


CK and AC saw the morphology slides. CK and GJ wrote the

manuscript.

Conflict of Interest: None declared.

References

1. Bessis M. Erythroblastic island, functional unity of bone marrow. Rev

Hematol 1958;13:8-11.

2. Chasis JA, Mohandas N. Erythroblastic islands: niches for erythropoiesis.

Blood 2008;112:470-478.

3. Chow A, Huggins M, Ahmed J, Hashimoto D, Lucas D, Kunisaki Y, Pinho

S, Leboeuf M, Noizat C, van Rooijen N, Tanaka M, Zhao ZJ, Bergman A,

Merad M, Frenette PS. CD169+ macrophages provide a niche promoting

erythropoiesis under homeostasis and stress. Nat Med 2013;19:429-436.

4. Ramos P, Casu C, Gardenghi S, Breda L, Crielaard BJ, Guy E, Marongiu MF,

Gupta R, Levine RL, Abdel-Wahab O, Ebert BL, Van Rooijen N, Ghaffari S, Grady

RW, Giardina PJ, Rivella S. Macrophages support pathological erythropoiesis

in polycythemia vera and β-thalassemia. Nat Med 2013;19:437-445.

124

LETTERS TO THE EDITOR


Percentages and Absolute Numbers of CD4+CD8+ Doublepositive

T Lymphocytes in the Peripheral Blood of Normal Italian

Subjects: Relationship with Age and Sex

Normal İtalyan Bireylerin Periferik Kanında CD4+CD8+ Çift-pozitif T Lenfositlerin Oran ve

Sayıları: Yaş ve Cinsiyet İlişkisi

Alessandra Marini 1 , Daniela Avino 2 , Monica De Donno 1 , Francesca Romano 1 , Riccardo Morganti 3

1Laboratory of Clinical Pathology, Versilia Hospital, Lido di Camaiore, Italy

2Unit of Hematological Diagnostics, A. Tortora Hospital, Pagani, Italy

3Section of Statistics, AOUP, Pisa, Italy

To the Editor,

We read with great interest the paper by Gonzalez-Mancera

et al. [1] concerning the percentages of CD4+CD8+ doublepositive

T-lymphocytes (DPTs) in normal subjects. DPTs are a

small subset of T cells normally found in the peripheral blood.

Their functions appear to be controversial, since both cytotoxic

and suppressive roles have been reported [2].

The paper by Gonzalez-Mancera et al. [1] assessed the frequency

of DPTs in a large cohort of normal subjects. This topic is very

interesting, since only a few papers with the aim of establishing

reference values of DPTs have been published. Previous studies

were carried out with Spanish and German subjects [3,4], while

that of Gonzalez-Mancera et al. [1] took Colombian individuals

into consideration.

With regards to Italy, to the best of our knowledge, no data

about the frequency of DPTs have been produced so far. It is

noteworthy that the largest multicenter Italian study, carried

out in 1999, did not evaluate DPTs [5].

Therefore, we revised our electronic files on normal Italian

subjects referring to our laboratories for routine controls. We

evaluated 238 subjects (males=84; females=154) with normal

complete blood counts and hematochemical values. Flow

cytometry was carried out with a FACSCanto II cytometer,

assisted by FACSCanto software. A single platform assay was

performed using the BD Multitest 6-color TBNK reagent and

Trucount tubes. All subjects showed normal percentages and

absolute counts of CD3+, CD4+, CD8+, CD19+, and CD16/CD56+

lymphocytes. The CD4:CD8 ratio was always >1. Percentages

and absolute counts of CD4+CD8+ DPTs were calculated by

automated lymphocyte gating.

Continuous data were described by mean, standard deviation

(SD), median, and interquartile range. Comparisons between

CD4+CD8+ DPTs and age categories or sex were performed

by two-way ANOVA followed by multiple comparisons (LSD

method). Significance was fixed at 0.05. All analyses were

carried out with SPSS 25.

Results are shown in Tables 1 and 2 and are expressed both as

percentages and absolute counts. We found that the comparisons

of DPTs with the factors of “sex” and “sex-age” were not

significant (p=0.533 and p=0.398, respectively). Interestingly,

we found a statistically significant increase of DPTs with age.

This phenomenon was more evident when younger subjects

(especially 20-30 years old) and older subjects (older than 50

years) were compared.

Previous studies showed discordant results, since DPT frequency

was found to increase with age in Spanish individuals [3] but

to decrease with age in German males [4]. These two studies

did not find a relationship between DPT frequency and sex,

in agreement with our results. On the contrary, Gonzalez-

Mancera et al. [1] reported that women showed a significantly

higher DPT percentage than males.

Our method did not allow us to make a distinction between

CD4 high CD8 low and CD4 low CD8 high , as done by Gonzalez-Mancera et

al. [1]. Nevertheless, we think that our study might provide some

novel information about reference values of DPTs and might

encourage further studies, since this subset of lymphocytes

might play a significant role in some human diseases.

Acknowledgment

The authors thank Giovanni Carulli, M.D., Division of Hematology,

University of Pisa, for helpful discussion.

Keywords: CD4+CD8+ double-positive T lymphocytes, Flow

cytometry

Anahtar Sözcükler: CD4+CD8+ çift-pozitif T lenfositler, Akım

sitometri

125



Table 1. Descriptive analysis of double-positive T lymphocytes (DPTs), stratified for sex and age. The comparisons of DPTs with the

factors “sex” and “sex-age” are not significant (p=0.533 and p=0.398, respectively).

20-30 30-40 40-50 50-60 60-70

T lymphocytes Statistics Population M F

years years years years years

CD4+CD8+ DPTs (%)

CD4+CD8+ DPTs/µL

SD: Standard deviation, M: males, F: females, per: percentile.

Mean 0.88 0.84 0.91 0.40 0.62 1.07 0.92 1.17

SD 0.98 0.89 1.03 0.26 0.39 1.01 0.77 1.51

Median 0.60 0.52 0.69 0.36 0.55 0.76 0.60 0.79

25 th per 0.40 0.37 0.40 0.20 0.38 0.50 0.50 0.40

75 th per 1.00 1.00 1.02 0.56 0.80 1.23 1.02 1.30

Mean 18.89 16.60 20.14 9.25 13.35 21.31 22.92 22.77

SD 21.96 19.70 23.07 6.57 10.39 21.72 26.75 27.09

Median 12.00 11.00 14.00 8.00 11.00 14.00 13.00 14.00

25 th per 7.11 6.35 9.00 5.54 6.00 9.00 9.00 8.50

75 th per 20.25 16.18 22.00 12.00 17.00 20.00 23.00 23.50

Table 2. Inferential analysis of DPTs: multiple comparisons related to age categories after two-way ANOVA (age and sex).

CD4+CD8+ DPTs (%) Category p-value CD4+CD8+ DP/µL Category p-value

20-30 years

30-40 years

40-50 years

30-40 years 0.328

30-40 years 0.412

40-50 years 0.001* 40-50 years 0.012*

20-30 years

50-60 years 0.012* 50-60 years 0.004*

60-70 years <0.0001* 60-70 years 0.005*

40-50 years 0.021*

40-50 years 0.076

50-60 years 0.114 30-40 years

50-60 years 0.030*

60-70 years 0.006* 60-70 years 0.037*

50-60 years 0.405

50-60 years 0.696

40-50 years

60-70 years 0.615 60-70 years 0.731

50-60 years 60-70 years 0.181 50-60 years 60-70 years 0.970

*: The p-value is statistically significant.

Informed Consent: Informed consent was not needed, as this

was a retrospective chart review.


Concept and writing: A.M.; Flow cytometry: A.M., D.A., M.D.D.,

F.R.; Statistics: R.M.


References

1. Gonzalez-Mancera MS, Bolaños NI, Salamanca M, Orjuela GA, Rodriguez

AN, Gonzalez JM. Percentages of CD4+CD8+ double-positive T lymphocytes

in the peripheral blood of adults from a blood bank in Bogotá, Colombia.

Turk J Hematol 2020;37:36-41.

2. Overgaard NH, Jung JW, Steptoe RJ, Wells JW. CD4+/CD8+ double-positive

T cells: more than just a developmental stage? J Leukoc Biol 2015;97:31-38.

3. García-Dabrio MC, Pujol-Moix N, Martinez-Perez A, Fontcuberta J, Souto

JC, Soria JM, Nomdedéu JF. Influence of age, gender and lifestyle in

lymphocyte subsets: report from the Spanish Gait-2 Study. Acta Haematol

2012;127:244-249.

4. Melzer S, Zachariae S, Bocsi J, Engel C, Löffler M, Tárnok A. Reference

intervals for leukocyte subsets in adults: results from a population-based

study using 10-color flow cytometry. Cytometry B Clin Cytom 2015;88:270-

281.

5. Santagostino A, Garbaccio G, Pistorio A, Bolis V, Camisasca G, Pagliaro

P, Girotto M. An Italian national multicenter study for the definition of

reference ranges for normal values of peripheral blood lymphocyte subsets

in healthy adults. Haematologica 1999;84:499-504.



Address for Correspondence/Yazışma Adresi: Alessandra Marini, M.D., Laboratory of Clinical Pathology,

Versilia Hospital, Lido di Camaiore, Italy

Phone : +39 0584 6055320

E-mail : alessandra.marini@hotmail.it ORCID: orcid.org/0000-0002-2605-7051

Received/Geliş tarihi: December 13, 2019

Accepted/Kabul tarihi: January 17, 2019

DOI: 10.4274/tjh.galenos.2019.2019.0452

126



Double-positive T Lymphocytes Do Not Vary in Different Age

Groups in Colombian Blood Donors

Kolombiyalı Kan Vericilerinde Çift-pozitif T Lenfositler Değişik Yaş Gruplarında Farklılık

Göstermemektedir

Miguel S. Gonzalez-Mancera,

John Mario Gonzalez

Universidad de los Andes, School of Medicine, Grupo de Ciencias Básicas Médicas, Bogotá, Colombia

To the Editor,

We read with interest the letter of Gonzalez-Mancera et al. [1]

regarding the percentages and absolute numbers of doublepositive

T cells (DPTs) in the peripheral blood of a normal

Italian population. In a previous article by our group, the DPT

population was evaluated in one hundred suitable donors from a

Colombian blood bank using flow cytometry. Our main findings

showed a median DPT value of 2.6% and a higher percentage

in women.

In the Italian cohort, they found an increase of DPTs with age

and no difference by sex. In our original study, we did not test

donors over 61 years old to corroborate if age is associated with

the marked increased level of DPTs above this age, as shown in

the Italian population. We reanalyzed our data and did not find

a difference in the percentages of DPTs when comparing age

groups (Figure 1).

In the Spanish and German cohorts, although there was no

significant difference in DPTs according to sex, women showed

a tendency to have more DPTs when compared to men [2,3].

The flow cytometry panel (monoclonal antibodies and

fluorochromes) used in our work detected and discriminated

the DPTs through manual gating as shown in the original

publication [1]. Previous studies showed that the antibody

cocktail and the gating strategy (manual versus automated) are

sources of variability in the results [4]. Also, according to our

original flow cytometry analysis [1], it was possible to determine

the subpopulations of CD4 high CD8 low and CD4 low CD8 high in healthy

donors as described by other authors [5,6].

In order to understand the differences found in these

publications, future studies must include a more diverse

population, larger samples, and increased age range.

Keywords: T lymphocytes, Flow cytometry

Anahtar Sözcükler: T lenfosit, Akım sitometrisi

Informed Consent: Not relevant.


Analysis or Interpretation: M.S.G., J.M.G.; Literature Search:

M.S.G., J.M.G.; Writing: M.S.G., J.M.G.




References

1. Gonzalez-Mancera MS, Bolaños NI, Salamanca M, Orjuela GA, Rodriguez

AN, Gonzalez JM. Percentages of CD4+CD8+ double-positive T lymphocytes

in the peripheral blood of adults from a blood bank in Bogotá, Colombia.

Turk J Hematol 2019;37:36-41.

2. García-Dabrio MC, Pujol-Moix N, Martinez-Perez A, Fontcuberta J, Souto

JC, Soria JM, Nomdedéu JF. Influence of age, gender and lifestyle in

lymphocyte subsets: report from the Spanish Gait-2 Study. Acta Haematol

2012;127:244-249.

3. Melzer S, Zachariae S, Bocsi J, Engel C, Löffler M, Tárnok A. Reference intervals

for leukocyte subsets in adults: results from a population-based study using

10-color flow cytometry. Cytometry B Clin Cytom 2015;88:270-281.

Figure 1. Median and interquartile rankings of donors according

to age group. Kruskal-Wallis, p=0.83.

4. Maecker HT, Rinfret A, D’Souza P, Darden J, Roig E, Landry C, Hayes P,

Birungi J, Anzala O, Garcia M, Harari A, Frank I, Baydo R, Baker M, Holbrook

127



J, Ottinger J, Lamoreaux L, Epling CL, Sinclair E, Suni MA, Punt K, Calarota

S, El-Bahi S, Alter G, Maila H, Kuta E, Cox J, Gray C, Altfeld M, Nougarede

N, Boyer J, Tussey L, Tobery T, Bredt B, Roederer M, Koup R, Maino VC,

Weinhold K, Pantaleo G, Gilmour J, Horton H, Sekaly RP . Standardization of

cytokine flow cytometry assays. BMC Immunol 2005;6:13.

5. Nascimbeni M, Shin EC, Chiriboga L, Kleiner DE, Rehermann B. Peripheral

CD4+ CD8+ T cells are differentiated effector memory cells with antiviral

functions. Blood 2004;104:478-486.

6. Sullivan YB, Landay AL, Zack JA, Kitchen SG, Al-Harthi L. Upregulation of

CD4 on CD8 + T cells: CD4 dim CD8 bright T cells constitute an activated phenotype

of CD8+ T cells. Immunology 2001;103:270-280.



Address for Correspondence/Yazışma Adresi: Miguel S. Gonzalez-Mancera, M.D., Universidad de los Andes,

School of Medicine, Grupo de Ciencias Básicas Médicas, Bogotá, Colombia

E-mail : ms.gonzalez137@uniandes.edu.com ORCID: orcid.org/0000-0001-7251-5984

Received/Geliş tarihi: January 13, 2020


DOI: 10.4274/tjh.galenos.2020.2020.0017

A Novel Mutation in a Patient with Wiskott-Aldrich Syndrome

Wiskott-Aldrich Sendrom’lu Bir Hastada Yeni Bir Mutasyon

Yurday Öncül 1 , Arzu Akyay 1 , İbrahim Tekedereli 2

1İnönü University Faculty of Medicine, Division of Pediatric Hematology, Malatya, Turkey

2İnönü University Faculty of Medicine, Division of Medical Genetics, Malatya, Turkey

To the Editor,

We read with great interest the recently published article in

your journal by Kaya et al. [1] regarding a novel mutation in the

Wiskott-Aldrich syndrome (WAS) gene. After that publication,

we also had a patient with another novel mutation in the WAS

gene from Turkey.

A 3-month-old boy was admitted to our hospital with the

complaints of cough, wheezing, and eczema. He also had a

history of pneumonia. On physical examination, diffuse eczema

was observed (Figure 1), along with widespread petechiae and

pulmonary crepitant rales and rhonchi. His family history was

unremarkable. Laboratory analysis revealed anemia (hemoglobin

of 8.9 g/dL), leukocytosis (white blood count of 13,330/mm 3 ),

and thrombocytopenia (platelet count of 63,000/mm 3 ). Mean

platelet volume was 4.8 fL. A peripheral blood smear revealed

thrombocytopenia and micro-thrombocytes. Immunoglobulin

levels were normal. Peripheral lymphocyte subset analysis

revealed reduced CD3 percentage and CD16/CD56 ratio. With

these results, patient was diagnosed with WAS, and molecular

genetic analysis revealed a novel mutation in the WAS gene, a

hemizygous c.11_12insGG p.G4Afs mutation on exon 1 (Figure

2). The patient is 18 months old now. Human intravenous

immunoglobulin therapy was administered monthly, and

thrombocyte replacement was done in case of need [2]. He did

not have a family donor, so he was scheduled for allogeneic

hematopoietic stem cell transplantation from an unrelated

donor.

Figure 1. Physical examination revealed diffuse eczema,

widespread petechiae, and pulmonary crepitant rales and rhonchi.

128



a mutational hotspot. To the best of our knowledge, this is the

first case of this mutation to be presented. We suspect that this

mutation might be important in contributing to the genotypephenotype

relation.

Keywords: Wiskott-Aldrich Syndrome, WAS gene, Novel

mutation

Anahtar Sözcükler: Wiskott-Aldrich sendromu, WAS geni, Yeni

mutation

Figure 2. Hemizygous c.11_12insGG p.G4Afs mutation on exon

1 (A, B).

The clinical presentation of WAS is very heterogeneous. Based

on the severity of symptoms, a 5-point severity score was

developed [2,3]. This score differentiates patients with milder

presentation (scores of up to 2) from the severe classic WAS

phenotype (scores of 3-5). While most patients suffer from

thrombocytopenia and susceptibility to infections, the other

clinical complications of the disease can be variably present

[4]. WAS cases with milder clinical manifestations are usually

referred to as X-linked thrombocytopenia (XLT) [4,5]. XLT

patients must also be carefully monitored, however, because

patients with initially mild phenotypes can transition to severe

phenotypes. Our patient presented a classical severe case of

WAS with severe eczema, immune deficiency with recurrent

infections, and thrombocytopenia.

There are many possible mutations in the WAS gene. However,

missense mutations are seen most often, especially on the first

four exons. The subsequently most frequent mutations are

splice mutations, deletions, insertions, nonsense mutations,

and complex mutations in descending order [3,4]. The missense

mutations on exons 2 and 3 are linked to mild phenotypes [5].

The nonsense mutations, insertions, and deletions are often

associated with severe phenotypes. In our case, a hemizygous

c.11_12insGG p.G4Afs mutation on exon 1 was detected. This

was a frameshift mutation. Frameshift mutations encode

incorrect amino acids and usually cause nonsense codons [6].

Another frameshift mutation at the c:11 position on the WAS

gene with deletion of a guanine nucleotide has been reported as

a disease-causing variant [7]. In our case, an insertion affected

the WAS protein and led to the emergence of the disease.

Therefore, the 11 th position on WAS cDNA could be referred to as

Informed Consent: Written informed consent was received

from the patient’s parents.


Concept: A.A., Y.Ö.; Data Collection or Processing: Y.Ö., A.A.;

Analysis or Interpretation: A.A., Y.Ö., İ.T.; Literature Search: Y.Ö.,

A.A., İ.T.; Writing: Y.Ö., A.A., İ.T.

Conflict of Interest: No author of this paper has a conflict of

interest, including specific financial interests, relationships,


included in this manuscript.

Disclosure of funding: The authors have no conflicts of interest

or funding to disclose.

References

1. Kaya Z, Muluk C, Haskoloğlu Ş, Lale Ş, Tufan LŞ. A novel mutation in a child

with atypical Wiskott-Aldrich syndrome complicated by cytomegalovirus

infection. Turk J Hematol 2019;36:70-71.

2. Ochs HD, Filipovich AH, Veys P, Cowan MJ, Kapoor N. Wiskott-Aldrich

syndrome: diagnosis, clinical and laboratory manifestations, and treatment.

Biol Blood Marrow Transplant 2009;15(1 Suppl):84-90.

3. Candotti F. Clinical manifestations and pathophysiological mechanisms of

the Wiskott-Aldrich syndrome. J Clin Immunol 2018:38:13-27.

4. Notarangelo LD, Miao CH, Ochs HD. Wiskott-Aldrich syndrome. Curr Opin

Hematol 2008;15:30-36.

5. Zhu Q, Zhang M, Blaese RM, Derry JM, Junker A, Francke U, Chen SH, Ochs HD.

The Wiskott-Aldrich syndrome and X-linked congenital thrombocytopenia

are caused by mutations of the same gene. Blood 1995;86:3797-3804.

6. Pelley JW. Elsevier’s Integrated Biochemistry, 2nd ed. Amsterdam, Elsevier,

2007.

7. Du W, Kumaki S, Uchiyama T, Yachie A, Yeng Looi C, Kawai S, Minegishi

M, Ramesh N, Geha RS, Sasahara Y, Tsuchiya S. A second-site mutation

in the initiation codon of WAS (WASP) results in expansion of

subsets of lymphocytes in a Wiskott-Aldrich syndrome patient. Hum

Mutat 2006;27:370-375.



Address for Correspondence/Yazışma Adresi: Arzu Akyay, M.D., İnönü University Faculty of Medicine,

Division of Pediatric Hematology, Malatya, Turkey

Phone : +90 422 341 06 60/5319

E-mail : arzuakyay@yahoo.com ORCID: orcid.org/0000-0002-4480-7784

Received/Geliş tarihi: August 26, 2019


DOI: 10.4274/tjh.galenos.2020.2019.0321

129



Budd-Chiari Syndrome: An Unusual Complication of AL Amyloidosis

Primer Amiloidozun Nadir Bir Karaciğer Tutulumu: Budd-Chiari Sendromu

Tarık Onur Tiryaki 1 , İpek Yönal Hindilerden 1 , Gülçin Yegen 2 , Meliha Nalçacı 1

¹İstanbul University İstanbul Medical Faculty, Department of Internal Medicine, Division of Hematology, İstanbul, Turkey

2İstanbul University İstanbul Medical Faculty, Department of Pathology, İstanbul, Turkey

To the Editor,

Budd-Chiari syndrome (BCS) is an uncommon congestive

hepatopathy caused by blockage of hepatic veins in the absence

of cardiac/pericardial disorders as well as hepatic veno-occlusive

disease [1]. In 75% of patients with BCS there is an underlying

condition that predisposes to blood clotting [2]. More than

one etiological factor may play a role in 25% of cases [2].

Coagulation problems mainly involving bleeding abnormalities

are well recognized in AL amyloidosis while thrombosis is

a less common feature [3]. Here, we report a rare case of AL

amyloidosis complicated by BCS.

A 66-year-old man presented with right upper abdominal pain.

On physical examination, there was hepatomegaly measuring

6 cm below the costal margin. His complete blood count

(CBC) was as follows: hemoglobin (Hb), 11 g/dL; white blood

cell count, 15,100/mm 3 ; neutrophils, 8400/mm 3 ; lymphocytes,

4700/mm 3 ; platelets, 677,000/mm 3 . The following biochemical

tests were abnormal: corrected calcium, 10.74 mg/dL (normal

range: 8.5-10.5); albumin, 3.12 g/dL (normal=3.2-5.5); alkaline

phosphatase, 266 IU/L (normal=35-105); gamma-glutamyl

transferase, 388 IU/L (normal=5-85); C-reactive protein, 26

(normal=0-5); erythrocyte sedimentation rate, 85 mm/h

(normal=0-20). JAK2V617F mutation was not detected and

bcr-abl was negative. Upon serum protein electrophoresis, a

monoclonal protein of 0.01 g/dL was present and serum and

urine immunofixation electrophoresis showed monoclonal λ

light chain. Serological tests for hepatitis B, hepatitis C, HIV,

and autoimmune liver disorders were negative. The result of the

24-h urine protein was 150 mg. Abdominal ultrasonography

showed hepatomegaly measuring 189 mm on the longitudinal

axis. Liver biopsy showed diffuse amyloid deposits in the

parenchyma stained by Congo red (Figure 1). Bone marrow

biopsy demonstrated increased plasma cells constituting 20% of

the marrow cellularity and eosinophilic, homogeneous deposits

of amyloid confirmed by Congo red staining. Echocardiography

showed thickened interventricular septum measuring 15 mm.

Histological examination of the duodenum revealed amorphous

pink deposits in the lamina propria staining positive for Congo

red. The patient did not meet the diagnostic criteria for

myeloma and was diagnosed with AL amyloidosis with kidney,

heart, liver, and gastrointestinal tract involvement. CyBorD was

initiated as induction treatment. After 1 course of CyBorD,

his CBC results were completely normal. After the 4 th course,

the patient presented with severe acute right upper quadrant

abdominal pain and severe orthostatic hypotension. Abdominal

CT angiography showed thrombosis of the left and middle

hepatic veins. Intrahepatic venous collaterals and a relative

increase in the caudate and left lobes of the liver were noted

(Figure 2). These findings were compatible with BCS. Screening

Figure 1. Diffuse infiltration of eosinophilic amorphous material

in the liver parenchyma (a, H&E, 400 x ), and deposition positive

for Congo red staining (b, 400 x ).

Figure 2. Abdominal CT angiography demonstrated occlusion of

the left hepatic vein and enlargement in the left lobe of the liver.

130



for hereditary and/or acquired thrombophilic conditions were

negative. Anticoagulation with low-molecular-weight heparin

was initiated.

To our knowledge, this is the first reported case of AL amyloidosis

complicated by BCS in the absence of nephrotic syndrome.

The underlying causes of bleeding in AL amyloidosis are well

established, including acquired factor X deficiency, increased

intravascular coagulation and fibrinolysis, and capillary

infiltration by amyloid and liver involvement, which results in

the reduced synthesis of procoagulant proteins [4,5]. Thrombosis

is a less-recognized association of AL amyloidosis. It was

demonstrated that impairment of the thrombin-antithrombin

pathway, in association with low antithrombin biological activity,

contributed to hypercoagulability in amyloidosis [5]. Cançado

et al. [6] described a BCS patient diagnosed with AL amyloidosis

in the concomitant presence of nephrotic-range proteinuria. The

loss of hemostatic proteins due to nephrotic syndrome certainly

contributed to the imbalance between clotting factors and

inhibitors [6]. Although arterial thrombosis after bortezomib

treatment has been reported rarely, a review of data from phase

3 trials demonstrated lower venous thromboembolism risk

with bortezomib [7,8]. Therefore, we believe that there is no

association between BCS and bortezomib. Our case shows that

AL amyloidosis patients can develop BCS even in the absence of

nephrotic syndrome.

Keywords: Primary amyloidosis, Budd-Chiari syndrome, Plasma

cell diseases

Anahtar Sözcükler: Primer amiloidoz, Budd-Chiari sendromu,

Plazma hücre hastalıkları

Compliance with Ethical Standards: The authors have no

potential conflicts of interests to declare. This research includes

human participants. Informed consent was obtained. All

procedures performed in this study were in accordance with the

ethical standards of the institutional and/or national research

committee and with the 1964 Helsinki Declaration and its later

amendments or comparable ethical standards. This study did not

receive any funding.

Informed Consent: It was received.


Data Collection or Processing: G.Y., M.N.; Writing: O.T.T., İ.Y.H.


authors.



References

1. Aydinli M, Bayraktar Y. Budd-Chiari syndrome: etiology, pathogenesis and

diagnosis. World J Gastroenterol 2007;13:2693-2696.

2. Denninger MH, Chaït Y, Casadevall N, Hillaire S, Guillin MC, Bezeaud A,

Erlinger S, Briere J, Valla D. Cause of portal or hepatic venous thrombosis

in adults: the role of multiple concurrent factors. Hepatology 2000;31:587-

591.

3. Kyle RA, Gertz MA. Primary systemic amyloidosis: clinical and laboratory

features in 474 cases. Semin Hematol 1995;32:45-59.

4. Kyle RA, Greipp PR. Amyloidosis (AL): clinical and laboratory features in 229

cases. Mayo Clin Proc 1983;58:665-683.

5. Gamba G, Montani N, Anesi E, Palladini G, Lorenzutti F, Perfetti V, Merlini

G. Abnormalities in thrombin-antithrombin pathway in AL amyloidosis.

Amyloid 1999;6:273-277.

6. Cançado GGL, Faria LC, Osório FMF, Vidigal PVT, Couto CA, Ferrari TCA. Budd

Chiari syndrome associated with AL amyloidosis: a coagulation paradox.

Amyloid 2018;25:70-71.

7. Guo HF, Su HL, Mao JJ, Sun C, Wang J, Zhou X. Stroke after treatment with

bortezomib and dexamethasone in a Chinese patient with extramedullary

relapse of multiple myeloma. Int J Clin Pharmacol Ther 2010;48:776-778.

8. Zangari M, Fink L, Zhan F, Tricot G. Low venous thromboembolic risk with

bortezomib in multiple myeloma and potential protective effect with

thalidomide/lenalidomide-based therapy: review of data from phase 3 trials

and studies of novel combination regimens. Clin Lymphoma Myeloma Leuk

2011;11:228-236.



Address for Correspondence/Yazışma Adresi: Onur Tarık Tiryaki, M.D., İstanbul University İstanbul Medical

Faculty, Department of Internal Medicine, Division of Hematology, İstanbul, Turkey

Phone : +90 506 216 86 95

E-mail : tonurtiryaki@gmail.com ORCID: orcid.org/0000-0002-0096-5684

Received/Geliş tarihi: May 12, 2019

Accepted/Kabul tarihi: February 28, 2020

DOI: 10.4274/tjh.galenos.2020.2019.0186

131



Rare Cytogenetic Anomalies in Two Pediatric Patients with Acute

Leukemia

Akut Lösemili İki Pediatrik Hastada Nadir Görülen Sitogenetik Anomaliler

Süreyya Bozkurt 1 , Şule Ünal 2 , Turan Bayhan 3 , Fatma Gümrük 2 , Mualla Çetin 2

1Istinye University Faculty of Medicine, Department of Medical Biology, İstanbul, Turkey

2Hacettepe University Faculty of Medicine, Department of Pediatric Hematology, Ankara, Turkey

3Dr. Abdurrahman Yurtaslan Oncology Hospital, Clinic of Pediatric Oncology and Hematology, Ankara, Turkey

To the Editor,

Structural chromosomal abnormalities are frequently seen

in both pediatric acute lymphoblastic leukemia (ALL) and

acute myeloid leukemia (AML) cases [1,2,3]. Although some

chromosomal abnormalities are common, other abnormalities

are rarely seen [4,5]. In this study two relatively rare cytogenetic

abnormalities are reported.

All procedures were performed in accordance with the Helsinki

Declaration and approved by the local ethics committee

(Approval No: GO 16/267-45).

Case One

CALLA+ pre-B-cell ALL was diagnosed in an 8-year-old-boy. The

complete blood count (CBC) at diagnosis revealed hemoglobin

of 5.5 g/dL, white blood cell (WBC) count of 2.8x10 9 /L, and

platelet count of 301x10 9 /L. He had t(1;4)(q42;q22) in all

twenty metaphases as a sole abnormality (Figure 1). The ALLIC-

BFM-2009 treatment protocol was started. Bone marrow

examination on day 15 revealed remission. The patient was

diagnosed in 2006. The last follow-up visit was in December

2019 and he is still alive.

case [7]. While we found t(1;4)(q42;q22) as a sole abnormality in

all metaphases, the anomaly was found in a complex karyotype

in the previously reported case. The hybrid gene formed as a

consequence of this t(1;4)(q42;q22) and its function are not

known. Our case is the second reported case with this anomaly

and thus contributes to the literature.

In our second case, t(1;11)(p32;q23) was found, which has been

seen in a total of seven pediatric AML cases to date [6]. The ages

of patients in whom this abnormality was previously detected

were between 0 and 12 years, two of them being infants; our

patient was 2.5 months old. When the FAB classification of the

patients was examined for the previously reported cases, M0,

M1, M4, and M5 were found. Hayashi et al. [8] reported this

anomaly for the first time in a 7-year-old patient with AML

M1 and they did not find this anomaly at diagnosis; instead, it

was detected during the remission of the patient. In our case,

t(1;11)(p32;q23) was present at the time of diagnosis of acute

Case Two

A girl of two and half months was diagnosed with the AML

FAB-M5 phenotype. She had no comorbid disease and the

diepoxybutane (DEB) test for Fanconi’s anemia was negative.

CBC results at diagnosis revealed hemoglobin of 10 g/dL,

WBC count of 9.2x10 9 /L, and platelet count of 365x10 9 /L. The

AML-BFM-2004 protocol was initiated. The karyotype of the

patient was 46,XX,t(1;11)(p32;q23)[19]/46,XX [1]. Bone marrow

aspiration of the patient showed that she had entered the

remission.

Herein, we report two rare translocations. t(1;4)(q42;q22) was

found in Case 1 with ALL and this anomaly has been reported in

one case to date according to the database in which we searched

[6]. The previous case was also a pediatric ALL patient, as in our

Figure 1. Case 1 revealed t(1;4)(q42;q22) in all twenty metaphases

as a sole abnormality.

132



leukemia. The result of t(1;11)(p32;q23) is the MLL-EPS15 fusion

gene. The role of this fusion gene in the pathogenesis of AML

is not known, but it has been suggested that the coiled-coil

domains of EPS15 mediate oligomerization and activate MLL

[9,10,11].

The prognostic values of rare cytogenetic anomalies are

unknown. The accumulation of knowledge about rare

cytogenetic anomalies detected in childhood leukemia is

expected to contribute to a better understanding of the

pathogenesis of these diseases.

Key words: Acute myeloid leukemia, Rare cytogenetic anomalies,

Karyotype

Anahtar Sözcükler: Akut myeloid lösemi, Nadir sitogenetik

anomaliler, Karyotip

Informed Consent: Informed consent was received from the

families of all patients.


Concept: Ş.Ü., F.G., M.Ç.; Design: Ş.Ü., F.G., M.Ç.; Data Collection

or Processing: S.B., T.B.; Analysis or Interpretation: Ş.Ü., S.B., T.B.;

Literature Search: S.B.; Writing: S.B.


References

1. Seth R, Singh A. Leukemias in children. Indian J Pediatr 2015;82:817-824.

2. Manola KN. Cytogenetics of pediatric acute myeloid leukemia. Eur J

Haematol 2009;83:391-405.

3. Hunger SP, Mullighan CG. Redefining ALL classification: toward detecting

high-risk ALL and implementing precision medicine. Blood 2015;125:3977-

3987.

4. Iacobucci I, Mullighan CG. Genetic basis of acute lymphoblastic leukemia. J

Clin Oncol 2017;35:975-983.

5. Harrison C. New genetics and diagnosis of childhood B-cell precursor acute

lymphoblastic leukemia. Pediatric Rep 2011;3(Suppl 2):2-4.

6. Mitelman F, Johansson B, Mertens F. Mitelman Database of Chromosome

Aberrations and Gene Fusions in Cancer. http://cgap.nci.nih.gov/

Chromosomes/Mitelman, 2017.

7. Behm FG, Raimondi SC, Schell MJ, Look AT, Rivera GK, Pui CH. Lack of

CD45 antigen on blast cells in childhood acute lymphoblastic leukemia is

associated with chromosomal hyperdiploidy and other favorable prognostic

features. Blood 1992;79:1011-1016.

8. Hayashi Y, Raimondi SC, Behm FG, Santana VM, Kalwinsky DK, Pui CH, Mirro

J Jr, William DL. Two karyotypically independent leukemic clones with the

t(8;21) and 11q23 translocation in acute myeloblastic leukemia at relapse.

Blood 1989;73:1650-1655.

9. Rogaia D, Grignani F, Carbone R, Riganelli D, LoCoco F, Nakamura T, Croce

CM, Di Fiore PP, Pelicci PG . The localization of the HRX/ALL1 protein to

specific nuclear subdomains is altered by fusion with its eps15 translocation

partner. Cancer Res 1997;57:799-802.

10. Huret JL. t(1;11)(p32;q23). Atlas Genet Cytogenet Oncol Haematol

2011;15:529-532.

11. Meyer C, Hofmann J, Burmeister T, Gröger D, Park TS, Emerenciano M,

Pombo de Oliveira M, Renneville A, Villarese P, Macintyre E, Cavé H, Clappier

E, Mass-Malo K, Zuna J, Trka J, De Braekeleer E, De Braekeleer M, Oh SH,

Tsaur G, Fechina L, van der Velden VH, van Dongen JJ, Delabesse E, Binato

R, Silva ML, Kustanovich A, Aleinikova O, Harris MH, Lund-Aho T, Juvonen

V, Heidenreich O, Vormoor J, Choi WW, Jarosova M, Kolenova A, Bueno C,

Menendez P, Wehner S, Eckert C, Talmant P, Tondeur S, Lippert E, Launay

E, Henry C, Ballerini P, Lapillone H, Callanan MB, Cayuela JM, Herbaux C,

Cazzaniga G, Kakadiya PM, Bohlander S, Ahlmann M, Choi JR, Gameiro P,

Lee DS, Krauter J, Cornillet-Lefebvre P, Te Kronnie G, Schäfer BW, Kubetzko

S, Alonso CN, zur Stadt U, Sutton R, Venn NC, Izraeli S, Trakhtenbrot L,

Madsen HO, Archer P, Hancock J, Cerveira N, Teixeira MR, Lo Nigro L, Möricke

A, Stanulla M, Schrappe M, Sedék L, Szczepanski T, Zwaan CM, Coenen EA,

van den Heuvel-Eibrink MM, Strehl S, Dworzak M, Panzer-Grümayer R,

Dingermann T, Klingebiel T, Marschalek R. The MLL recombinome of acute

leukemias in 2013. Leukemia 2013;27:2165-2176.



Address for Correspondence/Yazışma Adresi: Süreyya Bozkurt, M.D., İstinye University Faculty of Medicine,

Department of Medical Biology, İstanbul,Turkey

Phone : +90 850 283 60 00

E-mail : sureyyabozkurt8@gmail.com ORCID: orcid.org/0000-0002-1765-9894



DOI: 10.4274/tjh.galenos.2020.2019.0425

133



Importance of DNA Sequencing for Abnormal Hemoglobins

Detected by HPLC Screening

HPLC ile Tanımlanan Anormal Hemoglobinler için DNA Dizilemenin Önemi

Duran Canatan 1,2 , Abdullah Çim 1 , Serpil Delibaş 2 , Emel Altunsoy 1 , Serdar Ceylaner 3

1Antalya Genetic Diseases Diagnosis Center, Antalya, Turkey

2Mediterranean Blood Diseases Foundation - Hemoglobinopathy Diagnosis Center, Antalya, Turkey

3Intergen Genetic Diseases Diagnosis Center, Ankara, Turkey

To the Editor,

Hemoglobinopathies are the most common health problem

in Turkey. A hemoglobinopathy prevention program has been

implemented by the Ministry of Health in Turkey in 33 provinces

since 2003 and it spread to all 81 provinces in 2018 [1]. Our

hemoglobinopathy diagnostic center has been licensed for 16

years [2]. The aim of this study was to compare the molecular

genetic analysis and high-performance liquid chromatography

(HPLC) results for abnormal hemoglobins. Blood samples were

directed from local primary health care centers, hospitals, and

laboratories in the context of premarital screening processes.

Complete blood count (CBC) and HPLC methods were applied

for all blood samples. Abnormal hemoglobins or abnormal bands

were detected in 219 (0.67%) of 32,513 blood samples between

2013 and 2019. DNA sequencing was performed for 190 of 219

samples. Of those 190 samples, 38 were abnormal bands, 76

were HbS, 49 were HbD, 6 were HbC, and 21 were HbE. While

ten different mutations were detected in 24 cases (63.2%), they

were not found for 14 (36.8%) of 38 abnormal bands (Table

1). In addition, molecular analysis confirmed 69 cases of HbS

(90.8%) from among 76 HbS, 42 HbD Punjab (85.7%) in 49 HbD,

4 HbC (66.7%) in 6 HbC, and 4 HbE (19%) in 21 HbE samples

detected by HPLC.

Al-Madhani et al. [3] screened 3740 newborns and compared

the results of CBC and HPLC with the molecular genetic analysis

results for 290 newborns. They confirmed 26 cases of homozygous

sickle cell anemia and 5 of homozygous β-thalassemia major

by DNA sequencing among 31 newborns [3]. Warghade et al.

[4] screened 65,779 cases for hemoglobinopathy using cationexchange

(CE)-HPLC and abnormal hemoglobin fractions were

observed in 12,131 (18.44%) cases. They confirmed eight rare

hemoglobin variants by beta-globin gene analysis for those

samples that could not be distinguished by CE-HPLC [4].

Chen et al. screened couples of reproductive age using HPLC

and reported 1.14% hemoglobinopathy in the Chinese city of

Table 1. Molecular analysis of the cases with abnormal bands

(n=38).

Mutation N %

Unknown 14 36.84

Hb O-Arab (β121 Glu->Lys) 5 13.15

Hb S (β 6 Glu->Ala) 4 10.52

Hb G-Coushatta (β 22 Glu->Ala) 4 10.52

Beta IVS2.1(G->A) 3 7.89

Hb Hamadan (β56 Gly->Arg) 2 5.26

Hb G Norfolk (A2 85 Asp->Asn] 2 5.26

-30(T>A) 1 2.63

-56(G>C 1 2.63

Hb Fontainebleau (A21(B2) Ala>Pro) 1 2.63

Hb Ernz (β 123(H1) Thr-->Asn) 1 2.63

Guangzhou. They reported 8 different abnormal hemoglobins

by molecular techniques [5].

In the present study, the concordance of sequencing analysis

with the HPLC results was 90.8% for HbS, 85.7% for HbD, 66.7%

for HbC, and 19% for HbE. Interestingly, 10 different abnormal

hemoglobin variants have been detected using DNA sequencing

in 24 of 38 (63.2%) samples with abnormal bands. Therefore,

the type of abnormal hemoglobin can be determined more

precisely using molecular analysis.

In conclusion, whatever screening method is used in

hemoglobinopathy diagnosis centers, all reports should include

the following expression: “This is a screening test; molecular

analysis should be carried out for a definite result”. Taking into

account the different results obtained in screening and molecular

analysis, physicians working in these centers should be offered

access to molecular analysis for all abnormal hemoglobins and

abnormal bands.

134



Keywords: Hemoglobinopathy, HPLC, DNA, Sequencing

Anahtar Sözcükler: Hemoglobinopati, HPLC, DNA, Dizileme

Informed Consent: As a result of the explanations, the patients

voluntarily asked for the tests to be conducted.


Concept: D.C.; Design: D.C.; Data Collection or Processing: S.D.,

A.Ç., E.A.; Analysis or Interpretation: D.C., A.Ç., S.C.; Literature

Search: D.C., A.Ç.; Writing: D.C., A.Ç.

Conflict of Interest: The authors of this paper have no conflicts

of interest, including specific financial interests, relationships,


included.

References

1. Canatan D, Kose MR, Ustundağ M, Haznedaroglu D, Ozbaş S.

Hemoglobinopathy control program in Turkey. Community Genet

2006;9:124-126.

2. Canatan D, Delibas S. Report on ten years’ experience of premarital

hemoglobinopathy screening at a center in Antalya, Southern Turkey.

Hemoglobin 2016;40:273-276.

3. Al-Madhani A, Pathare A, Al Zadjali S, Al Rawahi M, Al-Nabhani I,

Alkindi S. The use of HPLC as a tool for neonatal cord blood screening

of haemoglobinopathy: a validation study. Mediterr J Hematol Infect Dis

2019;11:e2019005.

4. Warghade S, Britto J, Haryan R, Dalvi T, Bendre R, Chheda P, Matkar S,

Salunkhe Y, Chanekar M, Shah N. Prevalence of hemoglobin variants and

hemoglobinopathies using cation-exchange high-performance liquid

chromatography in central reference laboratory of India: a report of 65779

cases. J Lab Physicians 2018;10:73-79.

5. Chen GL, Qu YX, Jiang F, Tang Y, Tang F, Zuo LD. Screening abnormal

hemoglobin diseases for couples of childbearing age in Guangzhou City by

HPLC. Zhongguo Shi Yan Xue Ye Xue Za Zhi 2017;25:1768-1771.



Address for Correspondence/Yazışma Adresi: Duran Canatan, M.D., Antalya Genetic Diseases Diagnosis

Center, Antalya, Turkey

Phone : +90 242 248 88 40

E-mail : durancanatan@gmail.com ORCID: orcid.org/0000-0001-8128-8269

Received/Geliş tarihi: December 28, 2019


DOI: 10.4274/tjh.galenos.2020.2019.0470

Two Rare Pathogenic HBB Variants in a Patient with

β-Thalassemia Intermedia

Bir Beta Talasemi İntermedya Hastasında İki Nadir Patojenik HBB Varyantı

Veysel Sabri Hançer 1 , Tunç Fışgın 2 , Murat Büyükdoğan 3

1İstinye University Faculty of Medicine, Department of Medical Biology, İstanbul, Turkey

2Altınbaş University Faculty of Medicine, Department of Pediatrics, İstanbul, Turkey

3İstinye University Faculty of Medicine, Department of Medical Genetics, İstanbul, Turkey

To the Editor,

The β-thalassemias are a group of hereditary disorders

with autosomal recessive inheritance characterized by the

presence of defective synthesis of the β-globin chain, an

integral component of the hemoglobin molecule, resulting

in either partial synthesis (β + ) or complete absence (β 0 ) [1].

The disease reaches a high frequency in the Mediterranean

Basin, Africa, the Middle East, the Indian subcontinent,

and Southeast Asia [2]. According to the World Health

Organization, the frequency of abnormal hemoglobin is 7%

globally [3]. β-Thalassemia major is characterized by completely

inhibited synthesis of beta chains [4], and so it must be treated,

generally by transfusion therapy [4]. The β-thalassemia major

phenotype has homozygotes or compound heterozygotes

for β 0 or β + genes. Generally, mutations targeting the coding

regions of the gene and conservative regions on the exon-intron

boundary lead to β 0 -thalassemia, and mutations in regions that

do not encode β + -thalassemia. In contrast to the major type, the

presence of one normal gene in heterozygotes usually leads to

enough normal β-globin chain synthesis so that the affected

individuals are usually asymptomatic with only hypochromic

and microcytic red blood cells. This condition is referred to as

β-thalassemia minor [5]. β-Thalassemia intermedia clinically

differs from the major and minor ones with respect to the

necessity of transfusion. The degree of anemia for β-thalassemia

major is more aggravated than that for β-thalassemia

intermedia. The genotype of β-thalassemia intermedia is mostly

135



These findings may be useful for genetic counseling, premarital/

prenatal diagnosis, and prevention programs.

Keywords: Beta thalassemia, HBB, Variation

Anahtar Sözcükler: Beta talasemi, HBB, Varyasyon

Informed Consent: Written informed consent was obtained

from the patient’s parents.


Design: V.S.H.; Data Collection: V.SH., T.F., M.B.; Writing: V.S.H.

Figure 1. Electropherograms of the patient.

homozygous or compound heterozygous [5]. A 14-year-old

male Iraqi patient with Turkish origins presented with infection,

mild hepatomegaly, and loss of appetite. Laboratory findings

were as follows: white blood cell count, 13.53x10 9 /L; red blood

cell count, 3.84x10 12 /L; platelet count, 367x10 9 /L; hemoglobin,

7.7 g/dL; hematocrit, 26.3%; mean corpuscular hemoglobin,

22.7 pg; and mean corpuscular volume, 68.5 fL. The patient

had no transfusion history. Written informed consent was

obtained. A peripheral blood sample was collected in an EDTAcontaining

tube. Genomic DNA was extracted from the white

blood cells. The HBB gene was amplified as 2 polymerase chain

reaction (PCR) fragments (from the -101 position to the Poly-A

signal) using 40 ng of genomic DNA in reaction volumes of 25

µL. After PCR amplification, sequencing was performed using

the BigDye Terminator v3.1 Cycle Sequencing Kit. The patient

had heterozygous c.251delG (p.Gly84fs, rs193922555, β 0 )

and heterozygous c.316-3 C>A (IVSII-848 C>A, rs33913413,

β + ) pathologic variants, as shown in Figure 1. Sequencing

analysis showed that the father had heterozygous c.251delG

and the mother had heterozygous c.316-3 C>A variants. The

global frequency of c.251delG and c.316-3 C>A is unknown

and 0.00002%, respectively [6]. c.316-3 C>A is observed at a

frequency of 0.4% in Turkey [7] and 2.9% in Iraq [8]. c.251delG is

observed at 0.2% in Turkey [9] and 10.1% in northern Iraq [10].

Conflict of Interest: The authors of this paper have no conflicts

of interest, including specific financial interests, relationships,


included.



References

1. Rachmilewitz EA, Giardina PJ. How I treat thalassemia. Blood 2011;118:3479-

3488.

2. Weatherall DJ, Clegg JB. The Thalassaemia Syndromes, 3rd ed.

Oxford, Blackwell Scientific Publications, 1981.

3. World Health Organization. Management of Haemoglobin Disorders: Report

of Joint WHO-TIF Meeting. Geneva, WHO, 2012.

4. Atanasovska B, Bozhinovski G, Chakalova L, Kocheva S, Karanfilski O,

Plaseska-Karanfiska D. Molecular diagnostics of β-thalassemia. Balkan J

Med Genet 2012;15:61-65.

5. Galanello R, Origa R. Beta-thalassemia. Orphanet J Rare Dis 2010; 5:11.

6. NCBI. dbSNP. Available at www.ncbi.nlm.nih.gov/snp.

7. Altay C, Basak AN. Molecular basis and prenatal diagnosis of

hemoglobinopathies in Turkey. Int J Peadiatr Hematol Oncol 1995;2:283-

290.

8. Al-Allawi NA, Al-Mousawi BM, Badi AI, Jalal SD. The spectrum

of β-thalassemia mutations in Baghdad, Central Iraq. Hemoglobin

2013;37:444-453.

9. Çürük MA, Arpacı A, Atilla G, Tuli A, Kılınç Y, Aksoy K, Yüreğir GT. Genetic

heterogeneity of β thalassemia at Çukurova in Southern Turkey. Hemoglobin

2001;25:241-245.

10. Al-Allawi NA, Jalal SD, Mohammad AD, Omer SQ, Markous RS. β-Thalassemia

intermedia in northern Iraq: a single center experience. Biomed Res

Int 2014;2014:262853.



Address for Correspondence/Yazışma Adresi: Veysel Sabri Hançer, M.D., İstinye University Faculty of

Medicine, Department of Medical Biology, İstanbul, Turkey

E-mail : vhancer@istinye.edu.tr ORCID: orcid.org/0000-0003-2994-1077

Received/Geliş tarihi: January 13, 2020


DOI: 10.4274/tjh.galenos.2020.2020.0020

136



A Case of Myelodysplastic Syndrome in an Adult with Down

Syndrome: A Rare Observation of a Well-known Pediatric Disease

Down Sendromlu Erişkinde Myelodisplastik Sendrom: İyi Bilenen Bir Pediatrik Hastalığın

Nadiren Görülmesi

Harpreet Virk 1 , Shano Naseem 2

1Postgraduate Institute of Medical Education and Research, Senior Resident, Department of Pathology, Chandigarh, India

2Postgraduate Institute of Medical Education and Research, Department of Hematology, Chandigarh, India

To the Editor,

A 56-year-old man with Down syndrome (DS) presented with a

fever for the previous 7 weeks. On evaluation he was found to

have bicytopenia with hemoglobin (Hb) of 87 g/L and platelet

count of 100x10 9 /L. Total leukocyte count was 5.9x10 9 /L. Even

after an adequate trial of hematinics, the anemia persisted. Bone

marrow examination revealed significant dysgranulopoiesis in

43% of neutrophils in the form of hypolobation, hypogranulation,

ring forms, and pseudo-Pelger-Huet anomaly (Figures 1a-1c).

No significant dyserythropoiesis or dysmegakaryopoiesis was

noted. Bone marrow biopsy showed hypercellular marrow

spaces with granulocytic hyperplasia; however, megakaryocytes

and erythroid series were adequately represented. Fluorescence

in situ hybridization (FISH) testing was performed, which

revealed deletion of the 20q12 locus in 140/200 (70%) of nuclei

examined (Figure 1d). It was negative for -7/7q deletion, -5/5q

deletion, and trisomy 8. The patient currently remains under

observation with hematinic supplementation and close followup

of blood counts.

The age of onset for myeloid neoplasms in children with DS

is bimodal, peaking first in the newborn period and again at

3-6 years. However, this increased risk continues even into

adulthood [1]. Pertaining to this increased risk, even minor

but persistent cytopenias give rise to concerns regarding the

possibility of underlying myelodysplastic syndrome (MDS) or

marrow failure, or the potential for the development of myeloid

leukemia. This has become important given the increasing

life expectancy of adults with this disorder [2]. Although

conditions like hypothyroidism, obesity, epilepsy, dementia, and

Alzheimer’s disease are known to become increasingly prevalent

in individuals with DS in later life [3], myeloid leukemias in

general and MDS in particular are relatively less common.

Deletion of the long arm of chromosome 20 (del20q) has been

reported in 3%-7% of patients with MDS. Isolated del20q is

associated with a low risk of progression to AML, with good

prognosis and overall prolonged survival [4]. Although

this abnormality has been well documented in the MDS

subpopulation, its prevalence in MDS associated with DS has

not been described in the literature. McLean et al. studied 9

patients with DS with a median age of 41 years having clinical

suspicion of MDS. In their cohort, multilineage dysplasia was

observed in one case only. No acquired cytogenetic abnormality

was seen in any of the cases [5].

Our patient had bicytopenia to begin with, with improvement

in leukocyte and platelet counts after supportive care. However,

his Hb was persistently low even after an adequate trial of

hematinics. Morphological dysplasia was noted in a single

lineage in the form of dysgranulopoiesis and FISH studies

revealed deletion in 20q, which to our knowledge has never

been reported before in this clinical scenario.

DS can no longer be considered a “pediatric” disease; rather,

it is a condition that can affect an individual’s whole lifespan.

Figure 1. Bone marrow examination revealed significant

dysgranulopoiesis in 43% of neutrophils in the form of

hypolobation, hypogranulation, ring forms, and pseudo-Pelger-

Huet anomaly (a-c), while fluorescence in situ hybridization

testing revealed deletion of the 20q12 locus in 140/200 (70%) of

nuclei examined (d).

137



Comprehensive research has been done on myeloid neoplasms

related to pediatric DS; we now emphasize the importance of

reporting similar findings in adult patients, so as to be able to

better delineate the course and subsequent management of this

under-recognized condition in later life.

Keywords: Adult, Down syndrome, Myelodysplastic syndrome

Anahtar Sözcükler: Yetişkin, Down sendrom, Myelodisplastik

sendrom

Informed Consent: Informed consent was obtained from the

patient included in the study.


Data Collection or Processing: H.V.; Literature Search: H.V., S.N.;

Writing: H.V., S.N.

Conflict of Interest: We confirm that there are no conflicts of

interest to declare.

References

1. Fong CT, Bordeur GM. Down’s syndrome and leukemia: epidemiology,

genetics, cytogenetics and mechanisms of leukemogenesis. Cancer Genet

Cytogenet 1987;28:55-76.

2. Glasson EJ, Sullivan SG, Hussain R, Petterson BA, Montgomery PD, Bittles AH.

The changing survival profile of people with Down’s syndrome: implications

for genetic counselling. Clin Genet 2002;62:390-393.

3. Carfì A, Antocicco M, Brandi V, Cipriani C, Fiore F, Mascia D, Settanni S,

Vetrano DL, Bernabei R, Onder G. Characteristics of adults with Down

syndrome: prevalence of age-related conditions. Front Med (Lausanne)

2014;1:51.

4. De Benedittis D, Fianchi L, Niscola P, Piccioni A, Di Veroli A, Campagna A,

Mancini S, Villiva N, Mohamed S, Carmosino I, Criscuolo M, Fenu S, Aloe

Spiriti MA, Buccisano F, Breccia M, Mancini M, Latagliata R. Myelodysplastic

syndromes with isolated 20q deletion: a new clinical-biological entity?

Blood 2018;132(Suppl 1):5516.

5. McLean S, McHale C, Enright H. Hematological abnormalities in adult

patients with Down’s syndrome. Ir J Med Sci 2009;178:35-38.



Address for Correspondence/Yazışma Adresi: Shano Naseem, M.D., Postgraduate Institute of Medical

Education and Research, Department of Hematology, Chandigarh, India

Phone : 91-172-2755131

E-mail : shanonaseem@yahoo.co.in ORCID: orcid.org/0000-0003-0580-019X



DOI: 10.4274/tjh.galenos.2020.2019.0397

138

Advisory Board of This Issue (June 2020)

Atoosa Gharib, Iran

Aydan Akdeniz, Turkey

Ayşe Çırakoğlu, Turkey

Barbara J. Bain, United Kingdom

Bela Balint, Serbia

Brenda W. Cooper, USA

Can Boğa, Turkey

Davut Albayrak, Turkey

Deniz Karapınar, Turkey

Ebru Koca, Turkey

Elias Kouroumalis, Greece

Evren Özdemir, Turkey

Fatma Burcu Belen Apak, Turkey

Giuseppe Visani, Italy

Hakan Göker, Turkey

Ines Lohse, USA

İrfan Yavaşoğlu, Turkey

Juan Manuel Mejia-Arangure, Mexico

Maryam Abolhasani, Iran

Müge Sayitoğlu, Turkey

Mutlu Arat, Turkey

Muzaffer Keklik, Turkey

Nazan Sarper, Turkey

Nejat Akar, Turkey

Neşe Yaralı, Turkey

Nilgün Sayınalp, Turkey

Peter H. Wiernik, USA

Rajive Kumar, India

Seok-Goo Cho, Korea

Tahir Atik, Turkey

Tülin Tiraje Celkan, Turkey

Vanessa Innao, Italy

Vasilios Berdoukas, China

Veysel Sabri Hançer, Turkey

Vijay Kumar, India

Wellington F. da Silva, Brazil

Zahit Bolaman, Turkey

Zübeyde Nur Özkurt, Turkey

Zühre Kaya, Turkey

TURKISH JOURNAL OF HEMATOLOGY

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?