2016-4

Volume 33 Issue 4 December 2016 80 TL
ISSN 1300-7777
Research Articles
Prognostic Factors and a New Prognostic Index Model for Children and Adolescents with Hodgkin’s Lymphoma
Who Underwent Autologous Hematopoietic Stem Cell Transplantation: A Multicenter Study of the Turkish Pediatric
Bone Marrow Transplantation Study Group
Vural Kesik, et al.; Ankara, Kayseri, İzmir, İstanbul, Antalya, Samsun, Turkey
The Role of Azacitidine in the Treatment of Elderly Patients with Acute Myeloid Leukemia: Results of a Retrospective
Multicenter Study
Anıl Tombak, et al.; Mersin, Eskişehir, Ankara, Adana, İzmir, Erzurum, Malatya, İstanbul, Kocaeli, Aydın, Denizli,
Kayseri, Antalya, Düzce, Turkey
The Prognosis of Adult Burkitt’s Cell Leukemia in Real-Life Clinical Practice
Ümit Yavuz Malkan, et al.; Ankara, Turkey
Expression Profiles of the Individual Genes Corresponding to the Genes Generated by Cytotoxicity Experiments
with Bortezomib in Multiple Myeloma
Mehdi Ghasemi, et al.; Ankara, Turkey
The Effect of Hyperparathyroid State on Platelet Functions and Bone Loss
Göknur Yorulmaz, et al.; Eskişehir, Turkey
Warfarin Dosing and Time Required to Reach Therapeutic International Normalized Ratio in Patients with
Hypercoagulable Conditions
Pushpinderdeep Kahlon, et al.; Detroit, USA; Doha, Qatar; Multan, Pakistan
Early Changes of Mannose-Binding Lectin, H-Ficolin, and Procalcitonin in Patients with Febrile Neutropenia: A
Prospective Observational Study
Sibel Işlak Mutcalı, et al.; İstanbul, Turkey
Prospective Evaluation of Infection Episodes in Cancer Patients in a Tertiary Care Academic Center: Microbiological
Features and Risk Factors for Mortality
Nursel Çalık Başaran, et al.; Ankara, Turkey
Effect of Hereditary Hemochromatosis Gene H63D and C282Y Mutations on Iron Overload in Sickle Cell Disease
Patients
Yunus Kasım Terzi, et al.; Ankara, Turkey
Health-Related Quality of Life, Depression, Anxiety, and Self-Image in Acute Lymphocytic Leukemia Survivors
Birol Baytan, et al.; Bursa, Turkey
Cover Picture:
Sunset, Lake Bafa
Erden Atilla
4

Editor-in-Chief
Reyhan Küçükkaya
İstanbul, Turkey
Associate Editors
Ayşegül Ünüvar
İstanbul University, İstanbul, Turkey
Cengiz Beyan
TOBB University of Economics and
Technology, Ankara, Turkey
Hale Ören
Dokuz Eylül University, İzmir, Turkey
İbrahim C. Haznedaroğlu
Hacettepe University, Ankara, Turkey
M. Cem Ar
İstanbul University Cerrahpaşa Faculty of
Medicine, İstanbul, Turkey
Selami Koçak Toprak
Ankara University, Ankara, Turkey
Semra Paydaş
Çukurova University, Adana, Turkey
Assistant Editors
A. Emre Eşkazan
İstanbul University Cerrahpaşa Faculty of
Medicine, İstanbul, Turkey
Ali İrfan Emre Tekgündüz
Dr. A. Yurtaslan Ankara Oncology Training
and Research Hospital, Ankara, Turkey
Elif Ünal İnce
Ankara University, Ankara, Turkey
İnci Alacacıoğlu
Dokuz Eylül University, İzmir, Turkey
Müge Sayitoğlu
İstanbul University, İstanbul, Turkey
Nil Güler
Ondokuz Mayıs University, Samsun, Turkey
Olga Meltem Akay
Koç University, İstanbul, Turkey
Şule Ünal
Hacettepe University, Ankara, Turkey
Veysel Sabri Hançer
İstanbul Bilim University, İstanbul, Turkey
Zühre Kaya
Gazi University, Ankara, Turkey
International Review Board
Nejat Akar
Görgün Akpek
Serhan Alkan
Çiğdem Altay
Koen van Besien
Ayhan Çavdar
M. Sıraç Dilber
Ahmet Doğan
Peter Dreger
Thierry Facon
Jawed Fareed
Gösta Gahrton
Dieter Hoelzer
Marilyn Manco-Johnson
Andreas Josting
Emin Kansu
Winfried Kern
Nigel Key
Korgün Koral
Abdullah Kutlar
Luca Malcovati
Robert Marcus
Jean Pierre Marie
Ghulam Mufti
Gerassimos A. Pangalis
Antonio Piga
Ananda Prasad
Jacob M. Rowe
Jens-Ulrich Rüffer
Norbert Schmitz
Orhan Sezer
Anna Sureda
Ayalew Tefferi
Nükhet Tüzüner
Catherine Verfaillie
Srdan Verstovsek
Claudio Viscoli
Past Editors
Erich Frank
Orhan Ulutin
Hamdi Akan
Aytemiz Gürgey
Senior Advisory Board
Yücel Tangün
Osman İlhan
Muhit Özcan
Teoman Soysal
TOBB Economy Technical University Hospital, Ankara, Turkey
Maryland School of Medicine, Baltimore, USA
Cedars-Sinai Medical Center, USA
Ankara, Turkey
Chicago Medical Center University, Chicago, USA
Ankara, Turkey
Karolinska University, Stockholm, Sweden
Mayo Clinic Saint Marys Hospital, USA
Heidelberg University, Heidelberg, Germany
Lille University, Lille, France
Loyola University, Maywood, USA
Karolinska University Hospital, Stockholm, Sweden
Frankfurt University, Frankfurt, Germany
Colorado Health Sciences University, USA
University Hospital Cologne, Cologne, Germany
Hacettepe University, Ankara, Turkey
Albert Ludwigs University, Germany
University of North Carolina School of Medicine, NC, USA
Southwestern Medical Center, Texas, USA
Georgia Health Sciences University, Augusta, USA
Pavia Medical School University, Pavia, Italy
Kings College Hospital, London, UK
Pierre et Marie Curie University, Paris, France
King’s Hospital, London, UK
Athens University, Athens, Greece
Torino University, Torino, Italy
Wayne State University School of Medicine, Detroit, USA
Rambam Medical Center, Haifa, Israel
University of Köln, Germany
AK St Georg, Hamburg, Germany
Memorial Şişli Hospital, İstanbul, Turkey
Santa Creu i Sant Pau Hospital, Barcelona, Spain
Mayo Clinic, Rochester, Minnesota, USA
İstanbul Cerrahpaşa University, İstanbul, Turkey
University of Minnesota, Minnesota, USA
The University of Texas MD Anderson Cancer Center, Houston, USA
San Martino University, Genoa, Italy
Language Editor
Leslie Demir
Statistic Editor
Hülya Ellidokuz
Editorial Office
İpek Durusu
Bengü Timoçin
A-I
Publishing
Services
GALENOS PUBLISHER
Molla Gürani Mah. Kaçamak Sk. No: 21/1, Fındıkzade, İstanbul, Turkey
Phone: +90 212 621 99 25 • Fax: +90 212 621 99 27 • www. galenos.com.tr

Contact Information
Editorial Correspondence should be addressed to Dr. Reyhan Küçükkaya
E-mail : rkucukkaya@hotmail.com
All Inquiries Should be Addressed to
TURKISH JOURNAL OF HEMATOLOGY
Address : İlkbahar Mahallesi, Turan Güneş Bulvarı 613. Sk. No:8 06550 Çankaya, Ankara / Turkey
Phone : +90 312 490 98 97
Fax : +90 312 490 98 68
E-mail : info@tjh.com.tr
ISSN: 1300-7777
Publishing Manager
Sorumlu Yazı İşleri Müdürü
Güner Hayri Özsan
Management Address
Yayın İdare Adresi
Türk Hematoloji Derneği
İlkbahar Mahallesi, Turan Güneş Bulvarı 613. Sk.
No: 8 06550 Çankaya, Ankara / Turkey
Online Manuscript Submission
http://mc.manuscriptcentral.com/tjh
Web page
www.tjh.com.tr
Owner on behalf of the Turkish Society of Hematology
Türk Hematoloji Derneği adına yayın sahibi
Ahmet Muzaffer Demir
Üç ayda bir yayımlanan İngilizce süreli yayındır.
International scientific journal published quarterly.
Publishing House / Yayınevi
Molla Gürani Mah. Kaçamak Sk. No: 21, 34093
Fındıkzade, İstanbul, Turkey
Tel: +90 212 621 99 25 Faks: +90 212 621 99 27
E-posta: info@galenos.com.tr
Baskı: Özgün Ofset Ticaret Ltd. Şti.
Yeşilce Mah. Aytekin Sk. No: 21 34418 4. Levent / İstanbul
Printing Date / Basım Tarihi
30.11.2016
Cover Picture
Erden Atilla is currently working at the Ankara University Department of
Hematology, Ankara, Turkey.
Türk Hematoloji Derneği, 07.10.2008 tarihli ve 6 no’lu kararı ile Turkish
Journal of Hematology’nin Türk Hematoloji Derneği İktisadi İşletmesi
tarafından yayınlanmasına karar vermiştir.
A-II

AIMS AND SCOPE
The Turkish Journal of Hematology is published quarterly (March, June,
September, and December) by the Turkish Society of Hematology. It is an
independent, non-profit peer-reviewed international English-language
periodical encompassing subjects relevant to hematology.
The Editorial Board of The Turkish Journal of Hematology adheres to
the principles of the World Association of Medical Editors (WAME),
International Council of Medical Journal Editors (ICMJE), Committee on
Publication Ethics (COPE), Consolidated Standards of Reporting Trials
(CONSORT) and Strengthening the Reporting of Observational Studies in
Epidemiology (STROBE).
The aim of The Turkish Journal of Hematology is to publish original
hematological research of the highest scientific quality and clinical
relevance. Additionally, educational material, reviews on basic
developments, editorial short notes, images in hematology, and letters
from hematology specialists and clinicians covering their experience and
comments on hematology and related medical fields as well as social
subjects are published. As of December 2015, The Turkish Journal of
Hematology does not accept case reports. Important new findings or data
about interesting hematological cases may be submitted as a brief report.
General practitioners interested in hematology and internal medicine
specialists are among our target audience, and The Turkish Journal of
Hematology aims to publish according to their needs. The Turkish Journal
of Hematology is indexed, as follows:
- PubMed Medline
- PubMed Central
- Science Citation Index Expanded
- EMBASE
- Scopus
- CINAHL
- Gale/Cengage Learning
- EBSCO
- DOAJ
- ProQuest
- Index Copernicus
- Tübitak/Ulakbim Turkish Medical Database
- Turk Medline
Impact Factor: 0.827
Subscription Information
The Turkish Journal of Hematology is sent free-of-charge to members
of Turkish Society of Hematology and libraries in Turkey and abroad.
Hematologists, other medical specialists that are interested in hematology,
and academicians could subscribe for only 40 $ per printed issue. All
published volumes are available in full text free-of-charge online at www.
tjh.com.tr.
Address: İlkbahar Mah., Turan Güneş Bulvarı, 613 Sok., No: 8, Çankaya,
Ankara, Turkey
Telephone: +90 312 490 98 97
Fax: +90 312 490 98 68
Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh
Web page: www.tjh.com.tr
E-mail: info@tjh.com.tr
Permissions
Requests for permission to reproduce published material should be sent to
the editorial office.
Editor: Professor Dr. Reyhan Küçükkaya
Adress: İlkbahar Mah, Turan Günes Bulvarı, 613 Sok., No: 8, Çankaya,
Ankara, Turkey
Telephone: +90 312 490 98 97
Fax: +90 312 490 98 68
Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh
Web page: www.tjh.com.tr
E-mail: info@tjh.com.tr
Publisher
Galenos Yayınevi
Molla Gürani Mah. Kaçamak Sk. No:21 34093 Fındıkzade-İstanbul, Turkey
Telephone : +90 212 621 99 25
Fax : +90 212 621 99 27
info@galenos.com.tr
Instructions for Authors
Instructions for authors are published in the journal and at www.tjh.com.tr
Material Disclaimer
Authors are responsible for the manuscripts they publish in The Turkish
Journal of Hematology. The editor, editorial board, and publisher do not
accept any responsibility for published manuscripts.
If you use a table or figure (or some data in a table or figure) from another
source, cite the source directly in the figure or table legend.
The journal is printed on acid-free paper.
Editorial Policy
Following receipt of each manuscript, a checklist is completed by the
Editorial Assistant. The Editorial Assistant checks that each manuscript
contains all required components and adheres to the author guidelines,
after which time it will be forwarded to the Editor in Chief. Following the
Editor in Chief’s evaluation, each manuscript is forwarded to the Associate
Editor, who in turn assigns reviewers. Generally, all manuscripts will be
reviewed by at least three reviewers selected by the Associate Editor, based
on their relevant expertise. Associate editor could be assigned as a reviewer
along with the reviewers. After the reviewing process, all manuscripts are
evaluated in the Editorial Board Meeting.
Turkish Journal of Hematology’s editor and Editorial Board members are
active researchers. It is possible that they would desire to submit their
manuscript to the Turkish Journal of Hematology. This may be creating
a conflict of interest. These manuscripts will not be evaluated by the
submitting editor(s). The review process will be managed and decisions
made by editor-in-chief who will act independently. In some situation, this
process will be overseen by an outside independent expert in reviewing
submissions from editors.
A-III

TURKISH JOURNAL OF HEMATOLOGY
INSTRUCTIONS TO AUTHORS
The Turkish Journal of Hematology accepts invited review articles, research
articles, brief reports, letters to the editor, and hematological images that
are relevant to the scope of hematology, on the condition that they have
not been previously published elsewhere. Basic science manuscripts, such
as randomized, cohort, cross-sectional, and case control studies, are given
preference. All manuscripts are subject to editorial revision to ensure they
conform to the style adopted by the journal. There is a double blind kind
of reviewing system. Review articles are solicited by the Editor in Chief.
Authors wishing to submit an unsolicited. Review Article should contact
the Editor in Chief prior to submission in order to screen the proposed
topic for relevance and priority.
Manuscripts should be prepared according to ICMJE guidelines (http://
www.icmje.org/). Original manuscripts require a structured abstract. Label
each section of the structured abstract with the appropriate subheading
(Objective, Materials and Methods, Results, and Conclusion). Letters to
the editor do not require an abstract. Research or project support should
be acknowledged as a footnote on the title page. Technical and other
assistance should be provided on the title page.
Original Manuscripts
Title Page
Title: The title should provide important information regarding the
manuscript’s content. The title must specify that the study is a cohort
study, cross-sectional study, case control study, or randomized study (i.e.
Cao GY, Li KX, Jin PF, Yue XY, Yang C, Hu X. Comparative bioavailability
of ferrous succinate tablet formulations without correction for baseline
circadian changes in iron concentration in healthy Chinese male subjects:
A single-dose, randomized, 2-period crossover study. Clin Ther. 2011; 33:
2054-2059).
The title page should include the authors’ names, degrees, and institutional/
professional affiliations, a short title, abbreviations, keywords, financial
disclosure statement, and conflict of interest statement. If a manuscript
includes authors from more than one institution, each author’s name
should be followed by a superscript number that corresponds to their
institution, which is listed separately. Please provide contact information
for the corresponding author, including name, e-mail address, and
telephone and fax numbers.
Running Head: The running head should not be more than 40 characters,
including spaces, and should be located at the bottom of the title page.
Word Count: A word count for the manuscript, excluding abstract,
acknowledgments, figure and table legends, and references, should be
provided not exceed 2500 words. The word count for an abstract should
be not exceed 300 words.
Conflict-of-Interest Statement: To prevent potential conflicts of
interest from being overlooked, this statement must be included in each
manuscript. In case there are conflicts of interest, every author should
complete the ICMJE general declaration form, which can be obtained at:
http://www.icmje.org/coi_disclose.pdf.
Abstract and Keywords: The second page should include an abstract
that does not exceed 300 words. For manuscripts sent by authors in
Turkey, a title and abstract in Turkish are also required. As most readers
read the abstract first, it is critically important. Moreover, as various
electronic databases integrate only abstracts into their index, important
findings should be presented in the abstract.
Objective: The abstract should state the objective (the purpose of the
study and hypothesis) and summarize the rationale for the study.
Materials and Methods: Important methods should be written
respectively.
Results: Important findings and results should be provided here.
Conclusion: The study’s new and important findings should be
highlighted and interpreted.
Other types of manuscripts, such as reviews, perspectives, and
editorials, will be published according to uniform requirements.
Provide 3-10 keywords below the abstract to assist indexers. Use
terms from the Index Medicus Medical Subject Headings List
(for randomized studies a CONSORT abstract should be provided (http://
www.consort-statement.org).
Introduction: The introduction should include an overview of the
relevant literature presented in summary form (one page), and what ever
remains interesting, unique, problematic, relevant, or unknown about
the topic must be specified. The introduction should conclude with the
rationale for the study, its design, and its objective(s).
Materials and Methods: Clearly describe the selection of observational
or experimental participants, such as patients, laboratory animals, and
controls, including inclusion and exclusion criteria and a description of the
source population. Identify the methods and procedures in sufficient detail
to allow other researchers to reproduce your results. Provide references
to established methods (including statistical methods), provide references
to brief modified methods, and provide the rationale for using them and
an evaluation of their limitations. Identify all drugs and chemicals used,
including generic names, doses, and routes of administration. The section
should include only information that was available at the time the plan
or protocol for the study was devised (http://www.strobe-statement.org/
fileadmin/Strobe/uploads/checklists/STROBE_checklist_v4_combined.
pdf).
Statistics: Describe the statistical methods used in enough detail to
enable a knowledgeable reader with access to the original data to verify
the reported results. Statistically important data should be given in the
A-IV

text, tables and figures. Provide details about randomization, describe
treatment complications, provide the number of observations, and specify
all computer programs used.
Results: Present your results in logical sequence in the text, tables, and
figures. Do not present all the data provided in the tables and/or figures
in the text; emphasize and/or summarize only important findings, results,
and observations in the text. For clinical studies provide the number of
samples, cases, and controls included in the study. Discrepancies between
the planned number and obtained number of participants should be
explained. Comparisons, and statistically important values (i.e. P value
and confidence interval) should be provided.
Discussion: This section should include a discussion of the data. New and
important findings/results, and the conclusions they lead to should be
emphasized. Link the conclusions with the goals of the study, but avoid
unqualified statements and conclusions not completely supported by
the data. Do not repeat the findings/results in detail; important findings/
results should be compared with those of similar studies in the literature,
along with a summarization. In other words, similarities or differences in
the obtained findings/results with those previously reported should be
discussed.
Study Limitations: Limitations of the study should be detailed. In
addition, an evaluation of the implications of the obtained findings/
results for future research should be outlined.
Conclusion: The conclusion of the study should be highlighted.
References
Cite references in the text, tables, and figures with numbers in parentheses.
Number references consecutively according to the order in which they
first appear in the text. Journal titles should be abbreviated according to
the style used in Index Medicus (consult List of Journals Indexed in Index
Medicus). Include among the references any paper accepted, but not yet
published, designating the journal and followed by, in press.
Examples of References:
1. List all authors.
Deeg HJ, O’Donnel M, Tolar J. Optimization of conditioning for marrow
transplantation from unrelated donors for patients with aplastic anemia
after failure immunosuppressive therapy. Blood 2006;108:1485-1491.
2. Organization as author
Royal Marsden Hospital Bone Marrow Transplantation Team. Failure of
syngeneic bone marrow graft without preconditioning in post-hepatitis
marrow aplasia. Lancet 1977;2:742-744.
3. Book
Wintrobe MM. Clinical Hematology, 5th ed. Philadelphia, Lea & Febiger,
1961.
4. Book Chapter
Perutz MF. Molecular anatomy and physiology of hemoglobin. In:
Steinberg MH, Forget BG, Higs DR, Nagel RI, (eds). Disorders of Hemoglobin:
Genetics, Pathophysiology, Clinical Management. New York, Cambridge
University Press, 2000.
5. Abstract
Drachman JG, Griffin JH, Kaushansky K. The c-Mpl ligand (thrombopoietin)
stimulates tyrosine phosphorylation. Blood 1994;84:390a (abstract).
6. Letter to the Editor
Rao PN, Hayworth HR, Carroll AJ, Bowden DW, Pettenati MJ. Further
definition of 20q deletion in myeloid leukemia using fluorescence in situ
hybridization. Blood 1994;84:2821-2823.
7. Supplement
Alter BP. Fanconi’s anemia, transplantation, and cancer. Pediatr Transplant.
2005;9(Suppl 7):81-86
Brief Reports
Abstract length: Not to exceed 150 words.
Article length: Not to exceed 1200 words.
Introduction: State the purpose and summarize the rationale for the study.
Materials and Methods: Clearly describe the selection of the observational
or experimental participants. Identify the methods and procedures in
sufficient detail. Provide references to established methods (including
statistical methods), provide references to brief modified methods, and
provide the rationale for their use and an evaluation of their limitations.
Identify all drugs and chemicals used, including generic names, doses, and
routes of administration.
Statistics: Describe the statistical methods used in enough detail to
enable a knowledgeable reader with access to the original data to verify
the reported findings/results. Provide details about randomization,
describe treatment complications, provide the number of observations,
and specify all computer programs used.
Results: Present the findings/results in a logical sequence in the text,
tables, and figures. Do not repeat all the findings/results in the tables and
figures in the text; emphasize and/or summarize only those that are most
important.
Discussion: Highlight the new and important findings/results of the
study and the conclusions they lead to. Link the conclusions with the
goals of the study, but avoid unqualified statements and conclusions not
completely supported by your data.
Invited Review Articles
Abstract length: Not to exceed 300 words.
Article length: Not to exceed 4000 words.
Review articles should not include more than 100 references. Reviews
A-V

should include a conclusion, in which a new hypothesis or study about the
subject may be posited. Do not publish methods for literature search or
level of evidence. Authors who will prepare review articles should already
have published research articles on therel evant subject. The study’s new
and important findings should be highlighted and interpreted in the
Conclusion section. There should be a maximum of two authors for review
articles.
Images in Hematology
Article length: Not exceed 200 words.
Authors can submit for consideration an illustration and photos that is
interesting, instructive, and visually attractive, along with a few lines of
explanatory text and references. Images in Hematology can include no
more than 200 words of text, 5 references, and 3 figure or table. No
abstract, discussion or conclusion are required but please include a brief
title.
Letters to the Editor
Article length: Not to exceed 500 words.
Letters can include no more than 500 words of text, 5-10 references, and
1 figure or table. No abstract is required, but please include a brief title.
Tables
Supply each table on a separate file. Number tables according to the
order in which they appear in the text, and supply a brief caption for
each. Give each column a short or abbreviated heading. Write explanatory
statistical measures of variation, such as standard deviation or standard
error of mean. Be sure that each table is cited in the text.
Figures
Figures should be professionally drawn and/or photographed. Authors
should number figures according to the order in which they appear in the
text. Figures include graphs, charts, photographs, and illustrations. Each
figure should be accompanied by a legend that does not exceed 50 words.
Use abbreviations only if they have been introduced in the text. Authors
are also required to provide the level of magnification for histological
slides. Explain the internal scale and identify the staining method used.
Figures should be submitted as separate files, not in the text file. Highresolution
image files are not preferred for initial submission as the file
sizes may be too large. The total file size of the PDF for peer review should
not exceed 5 MB.
Authorship
Each author should have participated sufficiently in the work to assume
public responsibility for the content. Any portion of a manuscript that
is critical to its main conclusions must be the responsibility of at least
1 author.
Contributor’s Statement
All submissions should contain a contributor’s statement page. Each
manuscript should contain substantial contributions to idea and design,
acquisition of data, or analysis and interpretation of findings. All persons
designated as an author should qualify for authorship, and all those that
qualify should be listed. Each author should have participated sufficiently
in the work to take responsibility for appropriate portions of the text.
Acknowledgments
Acknowledge support received from individuals, organizations, grants,
corporations, and any other source. For work involving a biomedical
product or potential product partially or wholly supported by corporate
funding, a note stating, “This study was financially supported (in part)
with funds provided by (company name) to (authors’ initials)”, must
be included. Grant support, if received, needs to be stated and the
specific granting institutions’ names and grant numbers provided when
applicable.
Authors are expected to disclose on the title page any commercial or
other associations that might pose a conflict of interest in connection
with the submitted manuscript. All funding sources that supported the
work and the institutional and/or corporate affiliations of the authors
should be acknowledged on the title page.
Ethics
When reporting experiments conducted with humans indicate that
the procedures were in accordance with ethical standards set forth
by the committee that oversees human experimentation. Approval of
research protocols by the relevant ethics committee, in accordance with
international agreements (Helsinki Declaration of 1975, revised 2002
available at http://www.wma.net/e/policy/b3.htm, “Guide for the Care and
use of Laboratory Animals” www.nap.edu/catalog/5140.html/), is required
for all experimental, clinical, and drug studies. Patient names, initials,
and hospital identification numbers should not be used. Manuscripts
reporting the results of experimental investigations conducted with
humans must state that the study protocol received institutional review
board approval and that the participants provided informed consent.
Non-compliance with scientific accuracy is not in accord with scientific
ethics. Plagiarism: To re-publish-whole or in part-the contents of
another author’s publication as one’s own without providing a reference.
Fabrication: To publish data and findings/results that do not exist.
Duplication: Use of data from another publication, which includes
re-publishing a manuscript in different languages. Salamisation: To
create more than one publication by dividing the results of a study
preternaturally.
We disapprove of such unethical practices as plagiarism, fabrication,
duplication, and salamisation, as well as efforts to influence the
review process with such practices as gifting authorship, inappropriate
acknowledgements, and references. Additionally, authors must respect
participant right to privacy.
On the other hand, short abstracts published in congress books that do
not exceed 400 words and present data of preliminary research, and
A-VI

those that are presented in an electronic environment are not accepted
pre-published work. Authors in such situation must declare this status on
the first page of the manuscript and in the cover letter.
(The COPE flowchart is available at: http://publicationethics.org)
We use iThenticate to screen all submissions for plagiarism before
publication.
Turkish Journal of Hematology uses plagiarism screening service to verify
the originality of content submitted before publication.
Conditions of Publication
All authors are required to affirm the following statements before their
manuscript is considered: 1. The manuscript is being submitted only
to The Turkish Journal of Hematology; 2. The manuscript will not be
submitted elsewhere while under consideration by The Turkish Journal
of Hematology; 3. The manuscript has not been published elsewhere,
and should it be published in The Turkish Journal of Hematology it will
not be published elsewhere without the permission of the editors (these
restrictions do not apply to abstracts or to press reports for presentations
at scientific meetings); 4. All authors are responsible for the manuscript’s
content; 5. All authors participated in the study concept and design,
analysis and interpretation of the data, drafting or revising of the
manuscript, and have approved the manuscript as submitted. In addition,
all authors are required to disclose any professional affiliation, financial
agreement, or other involvement with any company whose product
figures prominently in the submitted manuscript.
Authors of accepted manuscripts will receive electronic page proofs and
are responsible for proofreading and checking the entire article within
two days. Failure to return the proof in two days will delay publication. If
the authors cannot be reached by email or telephone within two weeks,
the manuscript will be rejected and will not be published in the journal.
Copyright
At the time of submission all authors will receive instructions for
submitting an online copyright form. No manuscript will be considered
for review until all authors have completed their copyright form. Please
note, it is our practice not to accept copyright forms via fax, e-mail, or
postal service unless there is a problem with the online author accounts
that cannot be resolved. Every effort should be made to use the online
copyright system. Corresponding authors can log in to the submission
system at any time to check the status of any co-author’s copyright form.
All accepted manuscripts become the permanent property of The Turkish
Journal of Hematology and may not be published elsewhere-in whole or
in part-without written permission.
Note: We cannot accept any copyright that has been altered, revised,
amended, or otherwise changed. Our original copyright form must be
used as is.
Units of Measurement
Measurements should be reported using the metric system, according
to the International System of Units (SI). Consult the SI Unit Conversion
Guide, New England Journal of Medicine Books, 1992.
An extensive list of conversion factors can be found at http://www.unc.
edu/~rowlett/units/scales/clinical_data.html. For more details, see http://
www.amamanualofstyle.com/oso/public/jama/si_conversion_table.html.
Example for CBC.
Hematology component
SI units
RBC 6.7-11 x 10 12 /L
WBC 5.5-19.5 x10 9 /L
Hemoglobin
PCV
MCV
MCHC
MCH
116-168 g/L
0.31-0.46 L/L
39-53 fL
300-360 g/L
19.5-25 pg
Platelets 300-700 x 10 9 /L
Source: http://www.vetstream.com/felis/Corporate/993fhtm/ha-mat.htm
Abbreviations and Symbols
Use only standard abbreviations. Avoid abbreviations in the title and
abstract. The full term for an abbreviation should precede its first use
in the text, unless it is a standard abbreviation. All acronyms used in the
text should be expanded at first mention, followed by the abbreviation
in parentheses; thereafter the acronym only should appear in the text.
Acronyms may be used in the abstract if they occur 3 or more times
therein, but must be reintroduced in the body of the text. Generally,
abbreviations should be limited to those defined in the AMA Manual of
Style, current edition. A list of each abbreviation (and the corresponding
full term) used in the manuscript must be provided on the title page.
Online Manuscript Submission Process
The Turkish Journal of Hematology uses submission software powered
by ScholarOne Manuscripts. The website for submissions to The Turkish
Journal of Hematology is http://mc.manuscriptcentral.com/tjh. This
system is quick and convenient, both for authors and reviewers.
Setting up an account
New users to the submission site will need to register and enter their
account details before they can submit a manuscript. Log in, or click
the “Create Account” button if you are a first-time user. To create a
new account: After clicking the “Create Account” button, enter your
name and e-mail address, and then click the “Next” button. Your e-mail
address is very important. Enter your institution and address information,
A-VII

as appropriate, and then click the “Next” Button. Enter a user ID and
password of your choice, select your area of expertise, and then click the
“Finish” button.
If you have an account, but have forgotten your log-in details, go to
“Password Help” on the journal’s online submission system and enter
your e-mail address. The system will send you an automatic user ID and
a new temporary password.
Full instructions and support are available on the site, and a user ID and
password can be obtained during your first visit. Full support for authors
is provided. Each page has a “Get Help Now” icon that connects directly
to the online support system. Contact the journal administrator with any
questions about submitting your manuscript to the journal (info@tjh.
com.tr). For ScholarOne Manuscripts customer support, click on the “Get
Help Now” link on the top right hand corner of every page on the site.
The Electronic Submission Process
Log in to your author center. Once you have logged in, click the “Submit a
Manuscript” link in the menu bar. Enter the appropriate data and answer
the questions. You may copy and paste directly from your manuscript.
Click the “Next” button on each screen to save your work and advance
to the next screen.
Upload Files
Click on the “Browse” button and locate the file on your computer. Select
the appropriate designation for each file in the drop-down menu next to
the “Browse” button. When you have selected all the files you want to
upload, click the “Upload Files” button. Review your submission before
sending to the journal. Click the “Submit” button when you are finished
reviewing. You can use ScholarOne Manuscripts at any time to check
the status of your submission. The journal’s editorial office will inform
you by e-mail once a decision has been made. After your manuscript
has been submitted, a checklist will then be completed by the Editorial
Assistant. The Editorial Assistant will check that the manuscript contains
all required components and adheres to the author guidelines. Once the
Editorial Assistant is satisfied with the manuscript it will be forwarded to
the Senior Editor, who will assign an editor and reviewers.
The Review Process
Each manuscript submitted to The Turkish Journal of Hematology is
subject to an initial review by the editorial office in order to determine
if it is aligned with the journal’s aims and scope, and complies with
essential requirements. Manuscripts sent for peer review will be assigned
to one of the journal’s associate editors that has expertise relevant to the
manuscript’s content. All accepted manuscripts are sent to a statistical
and English language editor before publishing. Once papers have been
reviewed, the reviewers’ comments are sent to the Editor, who will then
make a preliminary decision on the paper. At this stage, based on the
feedback from reviewers, manuscripts can be accepted, rejected, or
revisions can be recommended. Following initial peer-review, articles
judged worthy of further consideration often require revision. Revised
manuscripts generally must be received within 3 months of the date of
the initial decision. Extensions must be requested from the Associate
Editor at least 2 weeks before the 3-month revision deadline expires;
The Turkish Journal of Hematology will reject manuscripts that are not
received within the 3-month revision deadline. Manuscripts with extensive
revision recommendations will be sent for further review (usually by the
same reviewers) upon their re-submission. When a manuscript is finally
accepted for publication, the Technical Editor undertakes a final edit
and a marked-up copy will be e-mailed to the corresponding author for
review and to make any final adjustments.
Submission of Revised Papers
When revising a manuscript based on the reviewers’ and Editor’s feedback,
please insert all changed text in red. Please do not use track changes, as
this feature can make reading difficult. To submit revised manuscripts,
please log into your author center at ScholarOne Manuscripts. Your
manuscript will be stored under “Manuscripts with Decisions”. Please click
on the “Create a Revision” link located to the right of the manuscript title.
A revised manuscript number will be created for you; you will then need
to click on the “Continue Submission” button. You will then be guided
through a submission process very similar to that for new manuscripts.
You will be able to amend any details you wish. At stage 6 (“File Upload”),
please delete the file for your original manuscript and upload the revised
version. Additionally, please upload an anonymous cover letter, preferably
in table format, including a point-by-point response to the reviews’
revision recommendations. You will then need to review your paper as
a PDF and click the “Submit” button. Your revised manuscript will have
the same ID number as the original version, but with the addition of an R
and a number at the end, for example, TJH-2011-0001 for an original and
TJH-2011-0001.R1, indicating a first revision; subsequent revisions will
end with R2, R3, and so on. Please do not submit a revised manuscript
as a new paper, as revised manuscripts are processed differently. If you
click on the “Create a Revision” button and receive a message stating that
the revision option has expired, please contact the Editorial Assistant at
info@tjh.com.tr to reactivate the option.
English Language Editing
All manuscripts are professionally edited by an English language editor
prior to publication.
Online Early
The Turkish Journal of Hematology publishes abstracts of accepted
manuscripts online in advance of their publication in print. Once an
accepted manuscript has been edited, the authors have submitted any
final corrections, and all changes have been incorporated, the manuscript
will be published online. At that time the manuscript will receive a Digital
Object Identifier (DOI) number. Both forms can be found at www.tjh.
A-VIII

CONTENTS
Research Articles
265 Prognostic Factors and a New Prognostic Index Model for Children and Adolescents with Hodgkin’s Lymphoma Who Underwent
Autologous Hematopoietic Stem Cell Transplantation: A Multicenter Study of the Turkish Pediatric Bone Marrow Transplantation Study Group
Vural Kesik, Erman Ataş, Musa Karakükcü, Serap Aksoylar, Fatih Erbey, Nurdan Taçyıldız, Alphan Küpesiz, Haldun Öniz,
Ekrem Ünal, Savaş Kansoy, Gülyüz Öztürk, Murat Elli, Zühre Kaya, Emel Ünal, Volkan Hazar, Şebnem Yılmaz Bengoa,
Gülsün Karasu, Didem Atay, Ayhan Dağdemir, Hale Ören, Ülker Koçak, M. Akif Yeşilipek
273 The Role of Azacitidine in the Treatment of Elderly Patients with Acute Myeloid Leukemia: Results of a Retrospective Multicenter Study
Anıl Tombak, Mehmet Ali Uçar, Aydan Akdeniz, Eyüp Naci Tiftik, Deniz Gören Şahin, Olga Meltem Akay, Murat Yıldırım,
Oral Nevruz, Cem Kis, Emel Gürkan, Şerife Medeni Solmaz, Mehmet Ali Özcan, Rahşan Yıldırım, İlhami Berber, Mehmet Ali Erkurt,
Tülin Fıratlı Tuğlular, Pınar Tarkun, İrfan Yavaşoğlu, Mehmet Hilmi Doğu, İsmail Sarı, Mustafa Merter, Muhit Özcan,
Esra Yıldızhan, Leylagül Kaynar, Özgür Mehtap, Ayşe Uysal, Fahri Şahin, Ozan Salim, Mehmet Ali Sungur
281 The Prognosis of Adult Burkitt’s Cell Leukemia in Real-Life Clinical Practice
Ümit Yavuz Malkan, Gürsel Güneş, Hakan Göker, İbrahim C. Haznedaroğlu, Kadir Acar, Eylem Eliaçık, Sezgin Etgül, Tuncay Aslan,
Seda Balaban, Haluk Demiroğlu, Osman I. Özcebe, Nilgün Sayınalp, Salih Aksu, Yahya Büyükaşık
286 Expression Profiles of the Individual Genes Corresponding to the Genes Generated by Cytotoxicity Experiments with Bortezomib in
Multiple Myeloma
Mehdi Ghasemi, Semih Alpsoy, Seyhan Türk, Ümit Y. Malkan, Şükrü Atakan, İbrahim C. Haznedaroğlu, Gürsel Güneş,
Mehmet Gündüz, Burak Yılmaz, Sezgin Etgül, Seda Aydın, Tuncay Aslan, Nilgün Sayınalp, Salih Aksu, Haluk Demiroğlu,
Osman İ. Özcebe, Yahya Büyükaşık, Hakan Göker
293 The Effect of Hyperparathyroid State on Platelet Functions and Bone Loss
Göknur Yorulmaz, Ayşen Akalın, Olga Meltem Akay, Garip Şahin, Cengiz Bal
299 Warfarin Dosing and Time Required to Reach Therapeutic International Normalized Ratio in Patients with Hypercoagulable Conditions
Pushpinderdeep Kahlon, Shahzaib Nabi, Adeel Arshad, Absia Jabbar, Ali Haythem
304 Early Changes of Mannose-Binding Lectin, H-Ficolin, and Procalcitonin in Patients with Febrile Neutropenia: A Prospective Observational Study
Sibel Işlak Mutcalı, Neşe Saltoğlu, İlker İnanç Balkan, Reşat Özaras, Mücahit Yemişen, Bilgül Mete, Fehmi Tabak, Ali Mert,
Recep Öztürk, Seniz Öngören, Zafer Başlar, Yıldız Aydın, Burhan Ferhanoğlu, Teoman Soysal
311 Prospective Evaluation of Infection Episodes in Cancer Patients in a Tertiary Care Academic Center: Microbiological Features and
Risk Factors for Mortality
Nursel Çalık Başaran, Ergun Karaağaoğlu, Gülşen Hasçelik, Mine Durusu Tanrıöver, Murat Akova
320 Effect of Hereditary Hemochromatosis Gene H63D and C282Y Mutations on Iron Overload in Sickle Cell Disease Patients
Yunus Kasım Terzi, Tuğçe Bulakbaşı Balcı, Can Boğa, Zafer Koç, Zerrin Yılmaz Çelik, Hakan Özdoğu, Sema Karakuş, Feride İffet Şahin
326 Health-Related Quality of Life, Depression, Anxiety, and Self-Image in Acute Lymphocytic Leukemia Survivors
Birol Baytan, Çiğdem Aşut, Arzu Çırpan Kantarcıoğlu, Melike Sezgin Evim, Adalet Meral Güneş
Brief Reports
331 Clinical Courses of Two Pediatric Patients with Acute Megakaryoblastic Leukemia Harboring the CBFA2T3-GLIS2 Fusion Gene
Mayu Ishibashi, Tomoko Yokosuka, Masakatsu D. Yanagimachi, Fuminori Iwasaki, Shin-ichi Tsujimoto, Koji Sasaki,
Masanobu Takeuchi, Reo Tanoshima, Hiromi Kato, Ryosuke Kajiwara, Fumiko Tanaka, Hiroaki Goto, Shumpei Yokota
A-IX

335 Evaluation of Insulin-like Growth Factor-1 and Insulin-like Growth Factor Binding Protein-3 Expression Levels in Patients with Chronic
Lymphocytic Leukemia
Mesut Ayer, Abdullah Sakin, Selim Ay, Aylin Ayer, Elif Gökçen Sazak, Melih Aktan
339 The Frequency of HLA-A, HLA-B, and HLA-DRB1 Alleles in Patients with Acute Lymphoblastic Leukemia in the Turkish Population:
A Case-Control Study
Türkan Patıroğlu, H. Haluk Akar
346 Varicella-Zoster Virus Infections in Pediatric Malignancy Patients: A Seven-Year Analysis
Mine Düzgöl, Gülcihan Özek, Nuri Bayram, Yeşim Oymak, Ahu Kara, Bengü Demirağ, Tuba Hilkay Karapınar, Yılmaz Ay,
Canan Vergin, İlker Devrim
Images in Hematology
349 Chediak-Higashi Syndrome in Accelerated Phase Masquerading as Acute Leukemia
Mili Jain, Ashutosh Kumar, Uma Shankar Singh, Rashmi Kushwaha
351 Auer Rod-Like Inclusions in Reactive Plasma Cells in a Case of Acute Myeloid Leukemia
Sarita Pradhan
353 Coexistence of Chronic Lymphocytic Leukemia and Acute Myeloid Leukemia
Ivana Milosevic
Letters to the Editor
355 Evaluation of Knowledge of Patients with Hemophilia Regarding Their Diseases and Treatment in Iran
Mehran Karimi, Tahereh Zarei, Sezaneh Haghpanah, Zohreh Zahedi
356 Therapeutic Plasma Exchange Ameliorates Incompatible Crossmatches
Mehmet Özen, Sinan Erkul, Gülen Sezer Alptekin Erkul, Özlem Genç, Engin Akgül, Ahmet Hakan Vural
358 Megaloblastic Anemia with Ring Sideroblasts Is Not Always Myelodysplastic Syndrome
Neha Chopra Narang, Mrinalini Kotru, Kavana Rao, Meera Sikka
360 Annular Erythematous Patches as the Presenting Sign of Extranodal Natural Killer/T-Cell Lymphoma
Can Baykal, Algün Polat Ekinci, Şule Öztürk Sarı, Zeynep Topkarcı, Özgür Demir, Nesimi Büyükbabani
362 Presentation of Diffuse Large B-Cell Lymphoma Relapse as a Penile Mass
Birgül Öneç, Kürşad Öneç, Ali Ümit Esbah, Onur Esbah
363 Successful Treatment of Disseminated Fusariosis with the Combination of Voriconazole and Liposomal Amphotericin B
Nur Efe İris, Serkan Güvenç, Tülay Özçelik, Aslıhan Demirel, Safiye Koçulu, Esin Çevik, Mutlu Arat
365 NOS3 27-bp and IL4 70-bp VNTR Polymorphisms Do Not Contribute to the Risk of Sickle Cell Crisis
Henu Verma, Hrishikesh Mishra, P. K. Khodiar, P. K. Patra, L. V. K. S. Bhaskar
367 Comment: In Response to “Auer Rod-Like Inclusions in Reactive Plasma Cells in a Case of Acute Myeloid Leukemia”
Smeeta Gajendra
368 Reply: “Auer Rod-Like Inclusions in Reactive Plasma Cells in a Case of Acute Myeloid Leukemia”
Sarita Pradhan
368 Auer Rods Are Not Seen in Non-Neoplastic Cells
İrfan Yavaşoğlu, Zahit Bolaman
370 Iron and Zinc Treatment in Iron Deficiency
Beuy Joob, Viroj Wiwanitkit
A-X

Advisory Board of This Issue (December 2016)
Aaron Reitman, USA
Abbas Abdulsalam, Iraq
Ahmet Emre Eşkazan, Turkey
Ana Boban, Croatia
Ateş Kara, Turkey
Athanasios D. Giannoukas, Greece
Aurore Keutgens, Belgium
Ban Hock Tan, Singapore
Betül Tavil, Turkey
Brenda Cooper, USA
Bülent Eser, Turkey
Burhan Ferhanoğlu, Turkey
David Yang, Canada
Deniz Arıca, Turkey
Deniz Karapınar, Turkey
Dongjin Wang, China
Elena Cassinerio, Italy
Elif Ünal İnce, Turkey
Fahri Şahin, Turkey
Gerwin Huls, Netherlands
Hamdi Akan, Turkey
Heidrun Karlic, Austria
Hyun-Jeong Cho, Korea
İlknur Kozanoğlu, Turkey
Javier Fernandez Torres, Mexico
John Bennett, USA
Jose Perdomo, Australia
Kaan Kavaklı, Turkey
Levent Ündar, Turkey
Marie Ambroise, India
Mehmet Ali Ergün, Turkey
Mehmet Turgut, Turkey
Meliha Nalçacı, Turkey
Meral Beksaç, Turkey
Müge Sayitoğlu, Turkey
Muhlis Cem Ar, Turkey
Murat Akova, Turkey
Nazan Sarper, Turkey
Nil Güler, Turkey
Ning Lou, China
Pasquale Niscola, Italy
Pervin Topçuoğlu, Turkey
Peter Bronnum Nielsen, Denmark
Prakas Mandal, India
Pranaw Kumar Jha, India
Rahajeng Tunjungputri, Netherlands
Sandeep Dhindsa, USA
Selami Koçak Toprak, Turkey
Sema Anak, Turkey
Sevgi Kalayoğlu Beşışık, Turkey
Shamsher Singh, Australia
Suar Çakı Kılıç, Turkey
Tahsin Özpolat, USA
Tülay Tecimer, Turkey
Türkan Patıroğlu, Turkey
Valerio Cecinatl, Italy
Veysel Sabri Hançer, Turkey
Yasemin Işık Balcı, Turkey

6 th International Congress
on
Leukemia Lymphoma Myeloma
May 11 - 13
2017
İSTANBUL
TURKEY
Radison Blu Hotel, Şişli
www.icllm2017.org

RESEARCH ARTICLE
DOI: 10.4274/tjh.2015.0280
Turk J Hematol 2016;33:265-272
Prognostic Factors and a New Prognostic Index Model for
Children and Adolescents with Hodgkin’s Lymphoma Who
Underwent Autologous Hematopoietic Stem Cell Transplantation:
A Multicenter Study of the Turkish Pediatric Bone Marrow
Transplantation Study Group
Otolog Hematopoetik Kök Hücre Nakli Uygulanmış Hodgkin Lenfomalı Çocuk ve
Adölesanlarda Prognostik Faktörler ve Yeni Bir Prognostik İndeks Modeli: Türk Pediatrik
Kemik İliği Nakli Çalışma Grubundan Çok Merkezli Çalışma
Vural Kesik 1 , Erman Ataş 1 , Musa Karakükcü 2 , Serap Aksoylar 3 , Fatih Erbey 4 , Nurdan Taçyıldız 5 , Alphan Küpesiz 6 , Haldun Öniz 7 ,
Ekrem Ünal 2 , Savaş Kansoy 3 , Gülyüz Öztürk 4 , Murat Elli 8 , Zühre Kaya 9 , Emel Ünal 5 , Volkan Hazar 6 , Şebnem Yılmaz Bengoa 10 ,
Gülsün Karasu 11 , Didem Atay 4 , Ayhan Dağdemir 8 , Hale Ören 10 , Ülker Koçak 9 , M. Akif Yeşilipek 11
1Gülhane Training and Research Hospital Clinic of Pediatric Oncology, Ankara, Turkey
2Erciyes University Faculty of Medicine, Department of Pediatric Hematology-Oncology and Bone Marrow Transplantation Unit, Kayseri, Turkey
Öz
3Ege University Faculty of Medicine, Department of Pediatric Oncology and Bone Marrow Transplantation Unit, İzmir, Turkey
4Medical Park Bahçelievler Hospital, Pediatric Bone Marrow Transplantation Unit, İstanbul, Turkey
5Ankara University Faculty of Medicine, Department of Pediatric Oncology and Bone Marrow Transplantation Unit, Ankara, Turkey
6Akdeniz University Faculty of Medicine, Department of Pediatric Hematology-Oncology and Bone Marrow Transplantation Unit, Antalya, Turkey
7Tepecik Training and Research Hospital, Clinic of Pediatric Oncology and Bone Marrow Transplantation Unit, İzmir, Turkey
8Ondokuz Mayıs University Faculty of Medicine, Department of Pediatric Oncology and Bone Marrow Transplantation Unit, Samsun, Turkey
9Gazi University Faculty of Medicine, Department of Pediatric Hematology and Bone Marrow Transplantation Unit, Ankara, Turkey
10Dokuz Eylül University Faculty of Medicine, Department of Pediatric Hematology and Bone Marrow Transplantation Unit, İzmir, Turkey
11Medical Park Göztepe Hospital, Pediatric Bone Marrow Transplantation Unit, İstanbul, Turkey
Abstract
Objective: The prognostic factors and a new childhood prognostic
index after autologous hematopoietic stem cell transplantation
(AHSCT) in patients with relapsed/refractory Hodgkin’s lymphoma (HL)
were evaluated.
Materials and Methods: The prognostic factors of 61 patients who
underwent AHSCT between January 1990 and December 2014 were
evaluated. In addition, the Age-Adjusted International Prognostic
Index and the Childhood International Prognostic Index (CIPI) were
evaluated for their impact on prognosis.
Results: The median age of the 61 patients was 14.8 years (minimummaximum:
5-20 years) at the time of AHSCT. There were single
relapses in 28 patients, ≥2 relapses in eight patients, and refractory
disease in 25 patients. The chemosensitivity/chemorefractory ratio
was 36/25. No pretransplant radiotherapy, no remission at the time of
Öz
Amaç: Relaps/refrakter Hodgkin lenfomanın (HL) otolog hematopoetik
kök hücre nakli (OHKHN) sonrasındaki prognozunu gösterecek
belirteçler ve çocukluk çağında yeni bir prognostik skorlama araştırıldı.
Gereç ve Yöntemler: Bu çalışmada, Ocak 1990-Aralık 2014 tarihleri
arasında OHKHN uygulanan 61 hastanın OHKHN sonrası prognozunu
etkileyen faktörlerin sağkalım üzerine etkisi araştırıldı. Aynı zamanda
Yaşa Göre Düzeltilmiş Uluslararası Prognostik İndeks ve Çocukluk
Dönemi Uluslararası Prognostik İndeks’lerinin (ÇDUPİ) prognoz
üzerindeki etkisi değerlendirildi.
Bulgular: Altmış bir hastanın ortanca yaşı OHKHN sırasında 14,8 yıl
(5-20 yıl) idi. Hastalardan, 28 olguda bir relaps, 8 olguda ≥2 relaps
ve 25 olguda refrakter hastalık vardı. Kemosensitivite/kemoterapiye
dirençlilik oranı 36/25 idi. Nakil öncesi radyoterapi almamak, nakil
öncesi remisyonda olmamak, nakil sonrası beyaz kan hücresi sayısının
Address for Correspondence/Yazışma Adresi: Vural KESİK, M.D.,
Gülhane Training and Research Hospital Clinic of Pediatric Oncology, Ankara, Turkey
Phone : +90 312 304 43 94
E-mail : vural73@yahoo.com
Received/Geliş tarihi: July 29, 2015
Accepted/Kabul tarihi: November 02, 2015
265

Kesik V, et al: Prognostic Markers of Hodgkin’s Lymphoma after Autologous Hematopoietic Stem Cell Transplantation Turk J Hematol 2016;33:265-272
transplantation, posttransplant white blood cell count over 10x10 3 /
µL, posttransplant positron emission tomography positivity at day 100,
and serum albumin of <2.5 g/dL at diagnosis were correlated with
progression-free survival. No remission at the time of transplantation,
bone marrow positivity at diagnosis, and relapse after AHSCT were
significant parameters for overall survival.
Conclusion: The major factors affecting the progression-free and
overall survival were clearly demonstrated. A CIPI that uses a lactate
dehydrogenase level of 500 IU/L worked well for estimating the
prognosis. We recommend AHSCT at first complete remission for
relapsed cases, and it should also be taken into consideration for
patients with high prognostic scores at diagnosis.
Keywords: Childhood Hodgkin’s lymphoma, Prognosis, Autologous
hematopoietic stem cell transplantation, Prognostic index
Introduction
Children with Hodgkin’s lymphoma (HL) have an excellent
prognosis, and their survival rates are satisfactory. The survival
rates for HL have increased from 81% to 95% for children
and adolescents, even those with advanced-stage disease [1].
Approximately 15% of patients cannot be cured and experience
relapse after first-line treatment [2]. The relapse rate is
increased up to 30% in advanced stages, and most relapses of
HL occur within the first 2 years after completing treatment
[3,4]. Autologous hematopoietic stem cell transplantation
(AHSCT) is recommended for patients with refractory disease
during therapy or disease relapse within 1 year after completing
therapy [5,6]. However, some patients who undergo AHSCT
develop recurrence within 1 year [7].
There has been much research on the prognostic parameters
of patients who get worse [8,9,10,11,12]. These prognostic
parameters and scores include the International Prognostic
Index (IPI) and the Age-Adjusted IPI (AAIPI), which have been
proven to show a close relationship between relapse and a poor
prognosis [13]. However, most of these parameters and scores are
for newly diagnosed and adult patients. Thus, in this multicenter
study, we evaluated the effect of various factors and prognostic
indexes, at diagnosis and pre- and posttransplant, on the relapse
rate and survival of children with HL who undergo AHSCT. In
addition, we aimed to create and develop a new international
prognostic index that is specific to children with newly
diagnosed advanced Hodgkin’s disease in order to evaluate the
prognosis even after AHSCT.
Materials and Methods
This was a multicenter and retrospective study. Eleven pediatric
stem cell transplant centers in different cities around Turkey
participated, and the data were recorded retrospectively for
61 patients between January 1990 and December 2014. Three
patients had undergone AHSCT before the year 2000, while 58
had undergone AHSCT after that point. Approval for the study
10x10 3 /µL üzerinde olması, nakil sonrası 100. gün pozitron emisyon
tomografisi pozitifliği, tanıda 2,5 g/dL’den düşük serum albümin
düzeyi progresyonsuz sağkalım üzerinde etkili belirteçler iken
transplantasyon zamanı remisyonda olmamak, tanıda kemik iliği
pozitifliği ve OHKHN sonrası relaps ise genel sağkalım üzerinde etkili
parametreler olarak bulundu.
Sonuç: Relaps/refrakter HL’li çocuklarda progresyonsuz ve genel
sağkalımı etkileyen faktörler açıkça gösterildi. Serum laktat dehidrogenaz
üst sınırını 500 IU/L olarak kullanan ÇDUPİ prognozu göstermede etkili
bulundu. Relaps hastalarda ilk tam remisyonda OHKHN yapılmasını ve
tanı anında yüksek prognostik skoru olan olguların da OHKHN açısından
değerlendirmeye alınmasını önermekteyiz.
Anahtar Sözcükler: Çocukluk çağı Hodgkin lenfoma, Prognoz, Otolog
hematopoetik kök hücre nakli, Prognostik indeks
was obtained from the local ethics committee. Exclusion criteria
for the subjects included lymphomas other than HL and missing
data. In four cases of an unknown pathologic subgroup of HL,
the histologic slides were re-reviewed.
Participants’ Characteristics
Sixty-one children from 11 centers, who underwent AHSCT for
refractory or recurrent HL, were included and retrospectively
analyzed. They showed some significant index values at
diagnosis, pretransplant, and posttransplant for survival and
event status after AHSCT.
Age, sex, concomitant diseases such as immune deficiency
syndromes, and risk factors were analyzed. At diagnosis, risk
factors were based on age, sex, primary tumor localization,
number of relapses, time to relapse from diagnosis until
completing the treatment, response to salvage chemotherapy,
stage of disease, Karnofsky/Lansky score, pathologic HL type,
bulky tumor, spleen involvement, extranodal involvement, bone
or bone marrow involvement, B symptoms, hemoglobin, white
blood cell (WBC) count, lymphocytes, monocytes, mean platelet
volume (MPV), ferritin, albumin, lactate dehydrogenase (LDH),
and sedimentation rate. Pretransplant risk factors were based
on positron emission tomography-computed tomography (PET-
CT) positivity, number of chemotherapy regimens, radiotherapy
(RT), conditioning regimen, and disease status at the time of
transplantation. After transplant, the risk factors were based
on lymphocyte counts on posttransplant days 15 and 100, WBC
counts, neutrophils, monocytes, platelets, MPV, neutrophil/
lymphocyte ratio (NLR), platelet/lymphocyte ratio (PLR), LDH,
and positivity of PET-CT on posttransplant day 100.
Description of Features
Chemosensitivity: Susceptibility to the action of the
chemotherapy protocol with a complete or very good response.
Staging: HL was graded using the Cotswold modification of
the Ann Arbor staging system. Bulky disease is defined as the
266

Turk J Hematol 2016;33:265-272
Kesik V, et al: Prognostic Markers of Hodgkin’s Lymphoma after Autologous Hematopoietic Stem Cell Transplantation
largest deposit being >10 cm or the mediastinum being wider
than one-third of the chest on chest X-ray [14].
Time to relapse: Refractory disease was defined as occurring
within 3 months after completion of therapy or during therapy.
Early relapse was defined as disease recurring within 3-12
months, and late relapse was defined as disease occurring more
than 12 months from the end of therapy [5].
Prognostic Indexes
Karnofsky/Lansky a Status
The Karnofsky/Lansky performance status is used to determine
the functional status of the patient and is essential for all
outcome-based analyses. The Karnofsky scale is designed
for patients aged 16 years and older, and the Lansky scale is
designed for those under 16 years. The Karnofsky/Lansky scores
range from 100 to 0, with 100 indicating ‘perfect’ health and 0
representing death [15].
Childhood International Prognostic Index
The original AAIPI incorporates serum LDH levels, Eastern
Cooperative Oncology Group (ECOG) performance status, and
Ann Arbor clinical stage at diagnosis. Based on these factors,
patients are divided into four risk groups: 0, low risk; 1, lowintermediate
risk; 2, high-intermediate risk; and 3, high risk [13].
We adapted the AAIPI for children according to an LDH level
of 500 IU/L instead of 250 IU/L because of its high prognostic
predictively in childhood HL, and we used the Cotswold
modification of the Ann Arbor clinical stage at diagnosis with
an ECOG modification score according to the pretransplant
Karnofsky/Lansky performance score [15] and the Childhood
International Prognostic Index (CIPI).
Types of Outcome Measures
The definitions used as survival terms were as follows: 1) overall
survival (OS) was calculated from the start of the treatment until
death from any cause; 2) progression-free survival (PFS) was
the achievement of stable disease without signs of progression,
calculated from the day of transplant to the date of the next
relapse or from the date of randomization for post-complete
remission (CR) questions; and 3) event-free survival (EFS) was
calculated from the date of the start of treatment to the date
of the first event (failure to achieve CR, relapse, or death from
any cause).
Statistical Analysis
Statistical analyses were performed using SPSS 15.0. Descriptive
analyses were presented using medians or mean ± standard
deviation for variables. The Kaplan-Meier method and logrank
tests were used in the analysis. The risk factors described
above were analyzed as prognostic factors for the survival rate
with Cox regression analysis. Variables with values of p<0.05
were shown in the univariate analysis and were included in the
multivariate analysis model. A p-value of less than 0.05 was
considered to show a statistically significant result.
Results
Clinical Features of Patients
Sixty-one patients with refractory/relapsed HL were analyzed.
The demographic features are presented in Table 1. The median
age was 14.8 years (minimum-maximum: 5-20), and the
male/female ratio was 40/21=1.9. The subtypes of HL were
lymphocyte-rich in three cases, nodular sclerosis in 32, mixed
cellularity in 23, and unclassified in three. The chemosensitivity/
chemorefractory ratio was 36/25. Additional conditions, such
as tuberculosis (n=3), hepatitis B, Castleman disease, chronic
persistent hepatitis, pericardial effusion, and thymoma, were
detected in eight (13.1%) cases. The primary tumor localizations
were cervical in 24 (39.3%) cases, mediastinal in 24 (39.3%),
abdominal in nine (14.8%), inguinal in three (4.9%), and bone
in one (1.6%). There was bulky tumor in 21 (34.4%) cases,
extranodal involvement in 27 (44.3%), spleen involvement in
33 (54.1%), bone involvement in 12 (19.7%), and bone marrow
involvement in one (1.6%). Stage I disease was detected in nine
(14.7%) cases, Stage II in 12 (19.7%), Stage III in 10 (16.4%),
and Stage IV in 30 (49.2%). Median (mean ± standard deviation,
minimum-maximum) hemoglobin, WBC count, lymphocytes,
monocytes, platelets, MPV, ferritin, albumin, LDH, erythrocyte
sedimentation rate, and Karnofsky/Lansky score at diagnosis
were 10.8 g/L (10.7±1.7 g/L, 5.9-13.1), 11.4x10 3 /µL (11.7±5.7x10 3 /
µL, 3.7-24.2), 1.8x10 3 /µL (2±1.1x10 3 /µL, 0.5-4.7), 0.7x10 3 /µL
(1.2±1.1x10 3 /µL, 0.2-6.4), 352x10 3 /µL (425-157x10 3 /µL, 193-
797), 7.6 fL (7.5±1.1 fL, 5.3-9.7), 165 ng/dL (349±320 ng/dL, 20-
1290), 3.7 mg/dL (3.8±0.8 mg/dL, 1.4-4.9), 419 IU/L (460±192
IU/L, 150-970), 63 mm/h (63±37 mm/h, 10-140), and 90 (88±16,
40-100), respectively.
Forty-two (68.8%) patients underwent RT before AHSCT. At
the time of the study, 44 of 61 patients were alive, 15 were
dead, and two were lost to follow-up. The causes of death were
progressive disease in nine patients, infection in two patients,
and other reasons except for relapse in four patients, including
posttransplant lymphoproliferative disease in one case, acute
myeloid leukemia progression in another, anaplastic large cell
lymphoma as a secondary cancer in another, and transplantrelated
pulmonary hemorrhage in the last. The nonrelapse
mortality rate was 40% (infection in two cases, other causes
except for relapse in four cases, and lost to follow-up in two
cases). The mortality rate 100 days after AHSCT was 6.5% (4
of 61 cases). The transplant-related mortality rate 100 days
after AHSCT was 3.2% (2 of 61 cases; infection in one case and
pulmonary hemorrhage in the other). The median relapse time
267

Kesik V, et al: Prognostic Markers of Hodgkin’s Lymphoma after Autologous Hematopoietic Stem Cell Transplantation
Turk J Hematol 2016;33:265-272
Table 1. Demographic, clinical, and histopathological
features of the patients with relapsed refractory Hodgkin’s
lymphoma.
Features Number %
Sex
Male 40 65.6
Female 21 34.4
Age (years)
5-10 5 8.2
11-15 26 42.6
>15 30 49.2
Subtype of Hodgkin’s lymphoma
Lymphocyte-rich 3 4.9
Nodular sclerosis 32 52.5
Mixed cellularity 23 37.7
Unclassified 3 4.9
Primary localization
Cervical 24 39.3
Mediastinal 24 39.3
Abdominal 9 14.8
Inguinal 3 4.9
Bone 1 1.6
Other features and involvements
Bulky tumor 21 34.4
Extranodal 27 44.3
Spleen 33 54.1
Bone 12 19.7
Bone marrow 1 1.6
Stage
I 9 14.7
II 12 19.7
III 10 16.4
IV 30 49.2
Response to chemotherapy
Chemosensitive 36 59.1
Chemorefractory 25 40.9
Type of relapse
Refractory 33 54.1
Early 12 19.7
Late 16 26.2
Radiotherapy before AHSCT
Yes 42 68.8
No 19 31.2
Table 1. Continuation
Disease status at AHSCT
CR2 28 45.9
≥CR3 8 13.2
Refractory 25 40.9
Conditioning regimens
BEAM 44 72.1
Others 17 27.9
PET-CT positivity before/after day 100 after AHSCT
Yes 22/14 37/23
No 49/47 63/77
AHSCT: Autologous hematopoietic stem cell transplantation, CR: complete remission,
PET-CT: positron emission tomography-computerized tomography.
was 11 months (minimum-maximum: 1-105). Types of relapse
were refractory disease in 33 (54.1%) patients, early relapse in
12 (19.7%), and late relapse in 16 (26.2%). The PFS and OS rates
for type of relapse were as follows: the 3-year PFS rates were
93.8% for late relapse, 91.7% for early relapse, and 38.7% for
refractory disease (p<0.001); the OS rates were 100% for late
relapse, 83.3% for early relapse (death due to other causes except
for relapse and infection), and 57.6% for refractory disease
(p=0.003). The 3-year survival rates were 57.6% for refractory
disease and 88.9% for patients who responded (p=0.001). Threeyear
PFS rates were 38.7% for refractory disease and 94.4% for
patients who responded (p<0.001).
Features of Treatment
All of the patients underwent AHSCT. The disease status at the
time of transplantation was as follows: 36 patients were in
CR (CR2=28 patients, ≥CR3=8 patients) and 25 patients with
refractory disease were not in remission. The 3-year PFS rates
were 77.3% for patients with remission and 49.3% for patients
without remission (p=0.007), while the OS rates were 91.4%
for patients with remission and 59.1% for patients without
remission (p=0.01).
The BEAM regimen was used in 44 (72.1%) patients, and
other regimens were used in 17 (27.9%). Cyclophosphamide,
etoposide, and BCNU in one case; busulphan and melphalan
in five cases; busulphan, cyclophosphamide, and etoposide in
four cases; fludarabine and busulphan in one case; total body
irradiation, cyclophosphamide, and etoposide in three cases;
CCNU, ifosfamide, and etoposide in two cases; and CCNU,
cyclophosphamide, and etoposide in one case were used as
other conditioning regimens. PET positivity and negativity were
37% and 63%, respectively, before AHSCT; however, these rates
were 23% and 77% after AHSCT on day 100. Forty-two children
(68.8%) received RT before AHSCT.
268

Turk J Hematol 2016;33:265-272
Kesik V, et al: Prognostic Markers of Hodgkin’s Lymphoma after Autologous Hematopoietic Stem Cell Transplantation
Treatment Results
The median (mean ± standard deviation, minimum-maximum)
level of lymphocyte counts at day 15 after AHSCT was 0.45x10 3 /
µL (0.51±0.38x10 3 /µL, 0.01-1.8). The median (mean ± standard
deviation, minimum-maximum) levels of WBCs, lymphocytes,
neutrophils, monocytes, platelets, and MPV at day 100 after
AHSCT were 3.9x10 3 /µL (4.6±2.7x10 3 /µL, 1.2-14.6), 1.3x10 3 /
µL (1.4±0.9x10 3 /µL, 0.02-5.1), 1.9x10 3 /µL (2.5±2.3x10 3 /µL, 0.3-
12.4), 0.36x10 3 /µL (0.41±0.27x10 3 /µL, 0.04-1.43), 127x10 3 /
µL (131±80x10 3 /µL, 14-308), and 7.5 fL (7.7±1.4 fL, 4.9-11.3),
respectively. Three-year OS/PFS rates were 77.3% and 68.5%
with a median follow-up of 27 months (minimum-maximum:
1-114 months) for all patients, respectively. The prognostic
factors affecting EFS and OS are presented in Tables 2 and 3.
of 2 (p=0.36), while the 3-year OS rates were 80.0% for a score
of 0 (death due to infection), 93.3% for a score of 1, and 75.0%
for a score of 2 (p=0.46) (Figure 1).
Patients were scored based on a WBC count of >10x10 3 /µL at
100 days after AHSCT (0: no, 1: yes), RT before AHSCT (0: yes,
1: no), remission status at AHSCT (0: yes, 1: no), PET-CT status
at 100 days after AHSCT (0: negative, 1: positive), and serum
albumin of <2.5 g/dL (0: no, 1: yes). This scoring correlated with
The 3-year PFS and OS rates were 65.2% and 78.4%, respectively,
in patients who underwent AHSCT after the year 2000, but of
the three cases recorded before the year 2000, two patients
relapsed and all died.
With regard to the CIPI scores, the 3-year PFS rates were 100%
for a score of 0, 61.3% for a score of 1, and 60.0% for a score
Figure 1. (A) Progression-free and (B) overall survival according
to Childhood International Prognostic Index scores [254x135 mm
(72x72 DPI)].
Table 2. Effective parameters on relapse of patients with Hodgkin’s lymphoma after autologous hematopoietic stem cell
transplantation in univariate and multivariate analysis.
Prognostic factors Category Univariate analysis Multivariate analysis
HR 95% CI p HR 95% CI p
Subtype of HL LR/MC/NS/UC 1.6 1.1-2.6 0.042 - - -
WBC at 100 days after AHSCT ≥10x10 3 /µL 5.4 1.5-19.2 0.009 32.8 1.9-544.3 0.015
RT before AHSCT No 3.1 1.2-7.6 0.019 13.2 1.3-129.5 0.027
Disease status at AHSCT NR 3.2 1.2-8.2 0.012 18.5 1.4-152.1 0.048
Primary refractory Yes 4.1 1.5-10.4 0.003 - - -
Type of relapse L/E/VE 0.17 0.06-0.53 0.002 - - -
PET-CT status at 100 days after
AHSCT
Positive 4.4 1.2-7.6 0.009 137.9 2.1-9093.1 0.021
Serum albumin at diagnosis <2.5 g/dL 13.1 1.2-14.4 0.035 59.5 1.6-2238.6 0.027
p<0.05 is significant. PET-CT: Positron emission tomography-computed tomography, CI: confidence interval, AHSCT: autologous stem cell transplantation, CR: complete remission,
NR: no remission, L: late relapse, E: early relapse, VE: very early relapse, HR: hazard ratio, WBC: white blood cell count, RT: radiotherapy, LR: lymphocyte-rich, MC: mixed cellularity,
NS: nodular sclerosing, UC: unclassified, HL: Hodgkin’s lymphoma.
Table 3. Effective parameters on survival of patients with Hodgkin’s lymphoma after AHSCT in univariate and multivariate
analysis.
Prognostic factors Category Univariate analysis Multivariate analysis
HR 95% CI p HR 95% CI p
Disease status at AHSCT NR 3.2 1.2-9.1 0.027 12.4 1.4-107.1 0.022
Type of relapse L/E/VE 0.11 0.02-0.72 0.002 - -
Relapse after AHSCT Yes 7.6 2.1-27.5 0.002 11.2 2.5-50.3 0.002
PET-CT status at 100 days after AHSCT Positive 4.2 1.1-17.5 0.04 - - -
Bone marrow (+) at diagnosis Yes 11.3 1.3-96.8 0.027 48.4 3.9-586.7 0.002
p<0.05 is significant. PET-CT: Positron emission tomography-computed tomography, CI: confidence interval, AHSCT: autologous hematopoietic stem cell transplantation, CR: complete
remission, NR: no remission, L: late relapse, E: early relapse, VE: very early relapse, HR: hazard ratio.
269

Kesik V, et al: Prognostic Markers of Hodgkin’s Lymphoma after Autologous Hematopoietic Stem Cell Transplantation
Turk J Hematol 2016;33:265-272
the following 3-year PFS rates: Group 0=100%, Group 1=66.7%,
Group 2=50%, and Group >3=0% (p=0.001) (0: low risk, 1: lowintermediate
risk, 2: high-intermediate risk, >3: high risk). For
3-year OS, remission status at AHSCT (0: yes, 1: no), relapse after
AHSCT (0: no, 1: yes), and bone marrow positivity at diagnosis
(0: no, 1: yes) were scored and showed that Group 0=92%,
Group 1=78.6%, and Group 2=40% (p<0.001).
Discussion
Several prognostic factors affect survival in HL, such as
extranodal disease at time of relapse, mediastinal mass at time
of transplant, advanced stage at relapse, primary refractory
disease, and a positive PET scan prior to AHSCT [2,16,17,18,19].
We found that no pretransplant RT, a posttransplant WBC
count of >10x10 3 /µL, posttransplant PET positivity at day 100,
serum albumin of <2.5 g/dL at diagnosis, no remission at the
time of transplantation, bone marrow positivity at diagnosis,
and relapse after AHSCT were significant parameters related to
events after AHSCT and OS. In addition, CIPI was significant in
estimating survival after AHSCT in HL.
RT is an important treatment method for HL. Although there
have been several studies on discarding RT in the treatment of
HL at earlier stages, its removal has been proven to increase the
risk of relapse at later stages [20]. Some centers also tend to
give RT after transplantation in order to not waste time before
the transplant and to avoid recurrence of the disease. Our
results clearly showed that there was a 13.2-fold increased risk
of relapse in patients who underwent RT after transplant, but
there was no impact on OS. Lowering the tumor volume with RT
before AHSCT may improve the prognosis.
The NLR and PLR were reported to indicate disease severity and
prognosis in patients with various diseases [21]. However, there
is no relationship between pretransplant and posttransplant
NLR, PLR, lymphocyte, monocyte, and MPV levels in patients
who survive. There is also no relationship between pre- and
posttransplant neutrophil, lymphocyte, NLR, PLR, and MPV
levels and survival. However, on posttransplant day 100, a WBC
count of over 10x10 3 /µL was found to increase the relapse risk
32.8-fold, but it had no impact on OS.
Several prognostic indexes have been used to evaluate the
survival of patients with lymphoma. The IPI and the AAIPI are
the two of the leading methods [13]. Low scores are correlated
with a high survival rate and high scores with a low survival
rate. Satwani et al. [22] reported that patients with relapsed/
refractory HL in the high-risk group according to prognostic
models for PFS have a high progression risk after AHSCT. We
used the CIPI and it worked well for estimating survival. The
survival rates of our patients were 100%, 59.3%, and 58.3% for
events after AHSCT and 80%, 91.7%, and 80% for OS for scores
of 0, 1, and 2, respectively. According to our study, the risk of
progression increased with the increase of the prognostic score,
and this result was compatible with previous studies.
Some pediatric oncology centers may prefer to treat their patients
with chemotherapy without AHSCT. However, the outcomes of
patients who underwent salvage chemotherapy alone were not
found to be satisfactory [23]. Studies about the proper timing
of AHSCT are limited in pediatric populations. Stoneham et
al. reported that AHSCT did not offer any significant survival
advantages over conventional salvage therapy in children with
relapsed HL compared to those with primary refractory disease
[24]. Ataş et al. did not demonstrate survival improvement after
AHSCT in early-relapse HL cases (n=6) when compared to laterelapse
cases (n=3). Therefore, AHSCT is advisable regardless of
the time of relapse in children with relapsed HL [25]. In our
study, relapse occurred in 61 subjects with HL; of these, 33 cases
(54.1%) were reported to be refractory to treatment, 12 (19.7%)
were early relapses, and 16 (26.2%) were late relapses. Early
relapse and refractory disease were three times more common
than late relapse, and the OS rates were 100% for late relapse,
83.3% for early relapse, and 57.6% for refractory disease at 3
years.
Metzger et al. reported treatment results after initial salvage
therapy according to early relapse (28%), late relapse (42%),
and refractory disease (30%). However, inadequate response
to initial salvage therapy was the only significant variable
with regard to prognosis, and the 5-year OS rate for these
patients was 17.9%, compared with 97.2% for the patients who
responded [2]. In our study, the 5-year OS rate for patients with
chemorefractory disease was 40.3%, compared to 88.9% for
patients who responded. Based on these studies, it seems that
chemorefractory patients have poor survival rates even after
undergoing AHSCT.
Disease status at transplantation (with or without CR) is one
of the most important risk factors for outcomes. Marcais et al.
reported a 39% OS rate and an 18% PFS rate for chemorefractory
disease compared to patients in CR, who had a 70%-74% OS
rate and a 40%-51% PFS rate at 3 years [26]. In our study, 36
patients were in CR and 25 patients were without remission. The
survival rates of patients in remission prior to transplant were
two times higher than those of patients without remission (OS:
91.4% vs. 59.1%). The relapse rate was lower in the remission
group (PFS: 77.3% vs. 49.3%). If the tumor burden can be
lowered sufficiently, the success of AHSCT treatment may
increase, with high survival and low relapse rates.
The benefit of stem cell transplantation was mainly seen in PFS
for patients with relapsed/refractory HL after first-line therapy
[27]. Some authors recommended AHSCT for children with
early relapsed and refractory HL [5,6,28]. The 3-year OS rate
270

Turk J Hematol 2016;33:265-272
Kesik V, et al: Prognostic Markers of Hodgkin’s Lymphoma after Autologous Hematopoietic Stem Cell Transplantation
for patients who underwent AHSCT was 77.3% in this study,
and their PFS rate was 68.5%. Other studies on AHSCT reported
the projected survival rate as 45% to 70% and PFS as 30% to
89% [16,17,18,29]. Despite our short median follow-up period
(27 months), our results are comparable to those found in other
reports of children with relapsed/refractory HL who received
AHSCT.
Pretreatment factors such as advanced stage of disease (Stage
IIB, IIIB, or IV), presence of B symptoms, histology, presence
of bulky disease, extranodal extension, elevated erythrocyte
sedimentation rate, leukocytosis (WBC count of ≥11.5x10 3 /
µL), anemia (hemoglobin of <10.5-11.0 g/L), male sex,
rapidity of response to initial treatment with chemotherapy,
fluorodeoxyglucose-PET avidity after two cycles, low serum
albumin (<4 g/dL), and low lymphocyte count (<0.6x10 3 /µL
or <8% of WBC count) were reported as prognostic factors in
previous studies [8,9,10,11,12,30]. Relapsed patients with HL who
had localized disease that was treated with chemotherapy alone
and/or low-dose involved-field radiation therapy consolidation,
and whose relapse occurred ≥12 months after completing
therapy, have better survival with intensive conventional
chemotherapy [8]. Extranodal disease at relapse, mediastinal
mass at time of transplant, advanced stage at relapse, primary
refractory disease, and a positive PET scan prior to AHSCT were
significant factors in post-AHSCT events [2,16,17,18,19]. Claviez
et al. reported that the most important predictors for disease
control following AHSCT were time to relapse and disease status
at transplantation [5]. We found by multivariate analysis that a
WBC count of >10x10 3 /µL at 100 days after AHSCT, no RT before
AHSCT, no remission after AHSCT, PET-CT positivity at 100 days
after AHSCT, and serum albumin of <2.5 g/dL were significant
factors for PFS, and that no remission after AHSCT, relapse after
AHSCT, and bone marrow positivity at diagnosis were significant
factors for OS.
In conclusion, the major factors affecting the prognosis of
children with relapsed/refractory HL seem to be tumor load
and chemosensitivity. Treatments that significantly decrease
the tumor volume before AHSCT may improve the survival rate,
as we saw a benefit with RT on EFS when performed before
AHSCT. In addition, the survival rates of patients in remission
before AHSCT were twice as high as those of patients without
remission. AHSCT had a significant benefit on OS, but the timing
must be investigated in larger studies. We also suggest different
treatment approaches for patients with high IPI and/or CIPI
scores to improve EFS and PFS. We suggest that a CIPI that uses
an LDH level of 500 IU/L is more useful in childhood. A serum
albumin status of <2.5 g/dL at diagnosis had a significant effect
on PFS, pointing to the study of the immunologic profile of
the patients, and the treatment schedule may be redesigned
with this immunologic profile. In addition, the characteristics
that showed significance in a univariate but not a multivariate
analysis appear to have an influence as well, and might show a
stronger correlation in larger trials. Patients with high prognostic
factors should be evaluated at diagnosis and may be directed to
AHSCT consolidation therapy at the time of the first CR.
Ethics
Ethics Committee Approval: Gülhane Military Medical
Academy Ethic Committee 03.02.2015/03, Informed Consent:
Retrospective study.
Authorship Contributions
Concept: Vural Kesik, Erman Ataş, Musa Karakükcü, Serap
Aksoylar, Fatih Erbey, Nurdan Taçyıldız, Alphan Küpesiz, Haldun
Öniz, Ekrem Ünal, Savaş Kansoy, Gülyüz Öztürk, Murat Elli,
Zühre Kaya, Emel Ünal, Volkan Hazar, Şebnem Yılmaz Bengoa,
Gülsün Karasu, Didem Atay, Ayhan Dağdemir, Hale Ören, Ülker
Koçak, M. Akif Yeşilipek; Design: Vural Kesik; Data Collection
or Processing: Vural Kesik, Erman Ataş, Musa Karakükcü, Serap
Aksoylar, Fatih Erbey, Nurdan Taçyıldız, Alphan Küpesiz, Haldun
Öniz, Ekrem Ünal, Savaş Kansoy, Gülyüz Öztürk, Murat Elli, Zühre
Kaya, Emel Ünal, Volkan Hazar, Şebnem Yılmaz Bengoa, Gülsün
Karasu, Didem Atay, Ayhan Dağdemir, Hale Ören, Ülker Koçak,
M. Akif Yeşilipek; Analysis or Interpretation: Vural Kesik, Erman
Ataş; Literature Search: Vural Kesik; Writing: Vural Kesik, Erman
Ataş.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Smith MA, Seibel NL, Altekruse SF, Ries LA, Melbert DL, O’Leary M, Smith FO,
Reaman GH. Outcomes for children and adolescents with cancer: challenges
for the twenty-first century. J Clin Oncol 2010;28:2625-2634.
2. Metzger ML, Hudson MM, Krasin MJ, Wu J, Kaste SC, Kun LE, Sandlund
JT, Howard SC. Initial response to salvage therapy determines prognosis
in relapsed pediatric Hodgkin lymphoma patients. Cancer 2010;116:4376-
4384.
3. Voss SD, Chen L, Constine LS, Chauvenet A, Fitzgerald TJ, Kaste SC, Slovis
T, Schwartz CL. Surveillance computed tomography imaging and detection
of relapse in intermediate- and advanced-stage pediatric Hodgkin’s
lymphoma: a report from the Children’s Oncology Group. J Clin Oncol
2012;30:2635-2640.
4. Kuruvilla J. Standard therapy of advanced Hodgkin lymphoma. Hematology
Am Soc Hematol Educ Program 2009;1:497-506.
5. Claviez A, Sureda A, Schmitz N. Haematopoietic SCT for children and
adolescents with relapsed and refractory Hodgkin’s lymphoma. Bone
Marrow Transplant 2008;42(Suppl 2):16-24.
6. Körholz D, Claviez A, Hasenclever D, Kluge R, Hirsch W, Kamprad F, Dörffel
W, Wickmann L, Papsdorf K, Dieckmann K, Kahn T, Mauz-Körholz C,
Dannenberg C, Pötter R, Brosteanu O, Schellong G, Sabri O. The concept of
the GPOH-HD 2003 therapy study for pediatric Hodgkin’s disease: evolution
in the tradition of the DAL/GPOH studies. Klin Padiatr 2004;216:150-156.
271

Kesik V, et al: Prognostic Markers of Hodgkin’s Lymphoma after Autologous Hematopoietic Stem Cell Transplantation
Turk J Hematol 2016;33:265-272
7. Dhakal S, Biswas T, Liesveld JL, Friedberg JW, Phillips GL, Constine LS.
Patterns and timing of initial relapse in patients subsequently undergoing
transplantation for Hodgkin’s lymphoma. Int J Radiat Oncol Biol Phys
2009;75:188-192.
8. Nachman JB, Sposto R, Herzog P, Gilchrist GS, Wolden SL, Thomson J, Kadin
ME, Pattengale P, Davis PC, Hutchinson RJ, White K, Children’s Cancer
Group. Randomized comparison of low-dose involved-field radiotherapy
and no radiotherapy for children with Hodgkin’s disease who achieve a
complete response to chemotherapy. J Clin Oncol 2002;20:3765-3771.
9. Rühl U, Albrecht M, Dieckmann K, Lüders H, Marciniak H, Schellenberg D,
Wickmann L, Dörffel W. Response-adapted radiotherapy in the treatment
of pediatric Hodgkin’s disease: an interim report at 5 years of the German
GPOH-HD 95 trial. Int J Radiat Oncol Biol Phys 2001;51:1209-1218.
10. Smith RS, Chen Q, Hudson MM, Link MP, Kun L, Weinstein H, Billett A,
Marcus KJ, Tarbell NJ, Donaldson SS. Prognostic factors for children with
Hodgkin’s disease treated with combined-modality therapy. J Clin Oncol
2003;21:2026-2033.
11. Carde P, Koscielny S, Franklin J, Axdorph U, Raemaekers J, Diehl V, Aleman
B, Brosteanu O, Hasenclever D, Oberlin O, Bonvin N, Björkholm M. Early
response to chemotherapy: a surrogate for final outcome of Hodgkin’s
disease patients that should influence initial treatment length and
intensity? Ann Oncol 2002;13(Suppl 1):86-91.
12. Metzger ML, Castellino SM, Hudson MM, Rai SN, Kaste SC, Krasin MJ, Kun
LE, Pui CH, Howard SC. Effect of race on the outcome of pediatric patients
with Hodgkin’s lymphoma. J Clin Oncology 2008;26:1282-1288.
13. No authors listed. A predictive model for aggressive non-Hodgkin’s
lymphoma. The International Non-Hodgkin’s Lymphoma Prognostic Factors
Project. N Engl J Med 1993;329:987-994.
14. Lister TA, Crowther D, Sutcliffe SB, Glatstein E, Canellos GP, Young RC,
Rosenberg SA, Coltman CA, Tubiana M. Report of a committee convened
to discuss the evaluation and staging of patients with Hodgkin’s disease:
Cotswolds meeting. J Clin Oncol 1989;7:1630-1636.
15. National Marrow Donor Program & The Medical College of Wisconsin.
Forms Manual: Appendix-L-Karnofsky/Lansky Performance Status
A00428 Revision 1. 31/01/2009. Available online at http://www.cibmtr.
org/DataManagement/TrainingReference/Manuals/DataManagement/
Documents/appendix-l.pdf.
16. Lieskovsky YE, Donaldson SS, Torres MA, Wong RM, Amylon MD, Link MP,
Agarwal R. High-dose therapy and autologous hematopoietic stem-cell
transplantation for recurrent or refractory pediatric Hodgkin’s disease:
results and prognostic indices. J Clin Oncol 2004;22:4532-4540.
17. Akhtar S, Abdelsalam M, El Weshi A, Al Husseini H, Janabi I, Rahal
M, Maghfoor I. High-dose chemotherapy and autologous stem cell
transplantation for Hodgkin’s lymphoma in the kingdom of Saudi Arabia:
King Faisal specialist hospital and research center experience. Bone Marrow
Transplant 2008;42(Suppl 1):37-40.
18. Harris RE, Termuhlen AM, Smith LM, Lynch J, Henry MM, Perkins SL, Gross
TG, Warkentin P, Vlachos A, Harrison L, Cairo MS. Autologous peripheral
blood stem cell transplantation in children with refractory or relapsed
lymphoma: results of Children’s Oncology Group study A5962. Biol Blood
Marrow Transplant 2011;17:249-258.
19. Jabbour E, Hosing C, Ayers G, Nunez R, Anderlini P, Pro B, Khouri I, Younes
A, Hagemeister F, Kwak L, Fayad L. Pretransplant positive positron emission
tomography/gallium scans predict poor outcome in patients with recurrent/
refractory Hodgkin lymphoma. Cancer 2007;109:2481-2489.
20. Wolden SL, Chen L, Kelly KM, Herzog P, Gilchrist GS, Thomson J, Sposto R,
Kadin ME, Hutchinson RJ, Nachman J. Long-term results of CCG 5942: a
randomized comparison of chemotherapy with and without radiotherapy
for children with Hodgkin’s lymphoma--a report from the Children’s
Oncology Group. J Clin Oncol 2012;30:3174-3180.
21. Azab B, Shah N, Radbel J, Tan P, Bhatt V, Vonfrolio S, Habeshy A, Picon A,
Bloom S. Pretreatment neutrophil/lymphocyte ratio is superior to platelet/
lymphocyte ratio as a predictor of long-term mortality in breast cancer
patients. Med Oncol 2013;30:432.
22. Satwani P, Ahn KW, Carreras J, Abdel-Azim H, Cairo MS, Cashen A, Chen
AI, Cohen JB, Costa LJ, Dandoy C, Fenske TS, Freytes CO, Ganguly S, Gale
RP, Ghosh N, Hertzberg MS, Hayashi RJ, Kamble RT, Kanate AS, Keating A,
Kharfan-Dabaja MA, Lazarus HM, Marks DI, Nishihori T, Olsson RF, Prestidge
TD, Rolon JM, Savani BN, Vose JM, Wood WA, Inwards DJ, Bachanova V,
Smith SM, Maloney DG, Sureda A, Hamadani M. A prognostic model
predicting autologous transplantation outcomes in children, adolescents
and young adults with Hodgkin lymphoma. Bone Marrow Transplant
2015;50:1416-1423.
23. Longo DL, Duffey PL, Young RC, Hubbard SM, Ihde DC, Glatstein E,
Phares JC, Jaffe ES, Urba WJ, DeVita VT Jr. Conventional-dose salvage
combination chemotherapy in patients relapsing with Hodgkin’s disease
after combination chemotherapy: the low probability for cure. J Clin Oncol
1992;10:210-218.
24. Stoneham S, Ashley S, Pinkerton CR, Wallace WH, Shankar AG; United
Kingdom Children’s Cancer Study Group. Outcome after autologous
hemopoietic stem cell transplantation in relapsed or refractory childhood
Hodgkin disease. J Pediatr Hematol Oncol 2004;26:740-745.
25. Ataş E, Kesik V, Babacan O, Korkmazer N, Akyüz C. The timing of autologous
stem cell transplantation and the prognostic factors affecting the
prognosis in children with relapsed Hodgkin lymphoma. Pediatr Transplant
2015;19:380-384.
26. Marcais A, Porcher R, Robin M, Mohty M, Michalet M, Blaise D, Tabrizi R,
Clement L, Ceballos P, Daguindau E, Bilger K, Dhedin N, Lapusan S, Bay JO,
Pautas C, Garban F, Ifrah N, Guillerm G, Contentin N, Bourhis JH, Yakoub
Agha I, Bernard M, Cornillon J, Milpied N. Impact of disease status and stem
cell source on the results of reduced intensity conditioning transplant for
Hodgkin’s lymphoma: a retrospective study from the French Society of Bone
Marrow Transplantation and Cellular Therapy (SFGM-TC). Haematologica
2013;98:1467-1475.
27. Rancea M, Monsef I, von Tresckow B, Engert A, Skoetz N. High-dose
chemotherapy followed by autologous stem cell transplantation for
patients with relapsed/refractory Hodgkin lymphoma. Cochrane Database
Syst Rev 2013;6:CD009411.
28. Schellong G, Dörffel W, Claviez A, Körholz D, Mann G, Scheel-Walter HG,
Bökkerink JP, Riepenhausen M, Lüders H, Pötter R, Rühl U; DAL/GPOH.
Salvage therapy of progressive and recurrent Hodgkin’s disease: results
from a multicenter study of the pediatric DAL/GPOH-HD study group. J Clin
Oncol 2005;23:6181-6189.
29. Shafer JA, Heslop HE, Brenner MK, Carrum G, Wu MF, Liu H, Ahmed N,
Gottschalk S, Kamble R, Leung KS, Myers GD, Bollard CM, Krance RA.
Outcome of hematopoietic stem cell transplant as salvage therapy for
Hodgkin’s lymphoma in adolescents and young adults at a single institution.
Leuk Lymphoma 2010;51:664-670.
30. Hasenclever D, Diehl V. A prognostic score for advanced Hodgkin’s disease.
International Prognostic Factors Project on Advanced Hodgkin’s Disease. N
Engl J Med 1998;339:1506-1514.
272

RESEARCH ARTICLE
DOI: 10.4274/tjh.2015.0203
Turk J Hematol 2016;33:273-280
The Role of Azacitidine in the Treatment of Elderly Patients with Acute
Myeloid Leukemia: Results of a Retrospective Multicenter Study
Akut Miyeloid Lösemili Yaşlı Hastaların Tedavisinde Azasitidinin Rolü: Retrospektif Çok
Merkezli Bir Çalışmanın Sonuçları
Anıl Tombak 1 , Mehmet Ali Uçar 1 , Aydan Akdeniz 1 , Eyüp Naci Tiftik 1 , Deniz Gören Şahin 2 , Olga Meltem Akay 2 , Murat Yıldırım 3 ,
Oral Nevruz 3 , Cem Kis 4 , Emel Gürkan 4 , Şerife Medeni Solmaz 5 , Mehmet Ali Özcan 5 , Rahşan Yıldırım 6 , İlhami Berber 7 , Mehmet Ali Erkurt 7 ,
Tülin Fıratlı Tuğlular 8 , Pınar Tarkun 9 , İrfan Yavaşoğlu 10 , Mehmet Hilmi Doğu 11 , İsmail Sarı 11 , Mustafa Merter 12 , Muhit Özcan 12 ,
Esra Yıldızhan 13 , Leylagül Kaynar 13 , Özgür Mehtap 9 , Ayşe Uysal 14 , Fahri Şahin 14 , Ozan Salim 15 , Mehmet Ali Sungur 16
1Mersin University Faculty of Medicine, Department of Hematology, Mersin, Turkey
2Osmangazi University Faculty of Medicine, Department of Hematology, Eskişehir, Turkey
3Gülhane Training and Research Hospital, Clinic of Hematology, Ankara, Turkey
4Çukurova University Faculty of Medicine, Department of Hematology, Adana, Turkey
5Dokuz Eylül University Faculty of Medicine, Department of Hematology, İzmir, Turkey
6Atatürk University Faculty of Medicine, Department of Hematology, Erzurum, Turkey
7İnönü University Faculty of Medicine, Department of Hematology, Malatya, Turkey
8Marmara University Faculty of Medicine, Department of Hematology, İstanbul, Turkey
9Kocaeli University Faculty of Medicine, Department of Hematology, Kocaeli, Turkey
10Adnan Menderes University Faculty of Medicine, Department of Hematology, Aydın, Turkey
11Pamukkale University Faculty of Medicine, Department of Hematology, Denizli, Turkey
12Ankara University Faculty of Medicine, Department of Hematology, Ankara, Turkey
13Erciyes University Faculty of Medicine, Department of Hematology, Kayseri, Turkey
14Ege University Faculty of Medicine, Department of Hematology, İzmir, Turkey
15Akdeniz University Faculty of Medicine, Department of Hematology, Antalya, Turkey
16Düzce University Faculty of Medicine, Department of Biostatistics, Düzce, Turkey
Abstract
Objective: In this study, we aimed to investigate the efficacy and
safety of azacitidine (AZA) in elderly patients with acute myeloid
leukemia (AML), including patients with >30% bone marrow (BM)
blasts.
Materials and Methods: In this retrospective multicenter study,
130 patients of ≥60 years old who were ineligible for intensive
chemotherapy or had progressed despite conventional treatment were
included.
Results: The median age was 73 years and 61.5% of patients had
>30% BM blasts. Patients received AZA for a median of four cycles
(range: 1-21). Initial overall response [including complete remission
(CR)/CR with incomplete recovery/partial remission] was 36.2%.
Hematologic improvement (HI) of any kind was documented in 37.7%
of all patients. HI was also documented in 27.1% of patients who
were unresponsive to treatment. Median overall survival (OS) was 18
Öz
Amaç: Bu çalışmada, kemik iliğindeki (Kİ) blast oranı >%30 olan olguları
da içeren akut miyeloid lösemili (AML) yaşlı hastalarda, azasitidinin
(AZA) etkinliğinin ve güvenliğinin araştırılmasını amaçladık.
Gereç ve Yöntemler: Bu geriye dönük, çok merkezli çalışmaya,
yoğun kemoterapi için uygun olmayan ya da konvansiyonel tedavilere
rağmen hastalığı ilerleyen ≥60 yaştaki 130 hasta dahil edildi.
Bulgular: Ortanca yaş 73 idi, hastaların %61,5’inde Kİ blast oranı
>%30 olarak bulundu. Hastalar, ortanca 4 döngü (1-21 aralığında)
AZA almıştı. Başlangıç genel yanıt oranı [tam yanıtı (TY)/eksik
düzelmenin olduğu TY/kısmi yanıtı içeren] %36,2 idi. Herhangi bir
hematolojik düzelme (HD), tüm hastaların %36,2’sinde tespit edildi.
HD tedaviye yanıtsız hastaların %27,1’inde de saptandı. Ortanca
genel sağkalım, yanıt verenlerde 18 ay, yanıt vermeyenlerde 12 ay idi
(p=0,005). Tedaviye yanıtsız hasta grubunda HD’nin, HD olmayanlara
kıyasla genel sağkalımı arttırdığı görüldü (ortanca sağkalım 14 aya
Address for Correspondence/Yazışma Adresi: Anıl TOMBAK, M.D.,
Mersin University Faculty of Medicine, Department of Hematology, Mersin, Turkey
Phone : +90 532 346 07 67
E-mail : aniltombak@mersin.edu.tr
Received/Geliş tarihi: May 17, 2015
Accepted/Kabul tarihi: November 19, 2015
273

Tombak A, et al: Azacitidine and Elderly Acute Myeloid Leukemia Patients
Turk J Hematol 2016;33:273-280
months for responders and 12 months for nonresponders (p=0.005).
In the unresponsive patient group, any HI improved OS compared to
patients without any HI (median OS was 14 months versus 10 months,
p=0.068). Eastern Cooperative Oncology Group performance status of
<2, increasing number of AZA cycles (≥5 courses), and any HI predicted
better OS. Age, AML type, and BM blast percentage had no impact.
Conclusion: We conclude that AZA is effective and well tolerated in
elderly comorbid AML patients, irrespective of BM blast count, and
HI should be considered a sufficient response to continue treatment
with AZA.
Keywords: Azacitidine, Acute myeloid leukemia, Elderly, Bone marrow
blasts, Prognostic factors, Overall survival
Introduction
Acute myeloid leukemia (AML) is predominantly a disease of
older patients with a median age at diagnosis of ~70 years
[1,2]. Older patients with AML have significant comorbidities,
a poorer performance status, more unfavorable cytogenetic
abnormalities, and a higher incidence of secondary AML than
their younger counterparts and only approximately 1/3 of
elderly AML patients are eligible for conventional anthracycline/
cytarabine-based intensive chemotherapeutic approaches
[3,4,5]. However, overall results of intensive chemotherapy
remain poor even for those who do meet inclusion criteria for
such treatment [1,3,4,5]. Patients not suitable for intensive
chemotherapy or who did not respond to these treatment
options are frequently offered best supportive care (BSC) only,
and the prognosis is dismal [6,7].
The hypomethylating agents decitabine and azacitidine (AZA)
have significant activity in patients with a myelodysplastic
syndrome (MDS) [8,9]. The use of AZA was associated with
improved survival when compared to BSC or low-dose cytarabine
in patients with high-risk MDS, including those with marrow
blast counts ranging from 20% to 30%, leading to AZA approval
in these disease categories [8,10]. In untreated or relapsed/
refractory AML, a few studies have also shown significant
response rates of AZA therapy [11,12,13,14,15]. However, there
are limited data showing the efficacy of AZA in AML patients
with >30% bone marrow (BM) blasts.
In this retrospective multicenter study, we aimed to investigate
the efficacy and safety of AZA in elderly patients with AML
(including patients with >30% BM blasts) defined according to
the World Health Organization (WHO).
Materials and Methods
Patients and Eligibility Criteria
Between June 2009 and June 2014, 130 patients of ≥60 years old
with AML from 16 specialized centers for hematology in Turkey,
defined according to WHO criteria, were included. Eligibility
criteria included all ≥60-year-old AML patients who were treated
kıyasla 10 ay, p=0,068). Doğu Kooperatif Onkoloji Grubu performans
durumunun <2 olması, AZA döngü sayısının artması (≥5 döngü) ve
herhangi bir HD olması, daha iyi genel sağkalımı öngörüyordu. Yaşın,
AML tipinin, Kİ blast yüzdesinin etkisi yoktu.
Sonuç: AZA, yaşlı, eşlik eden hastalıkları olan AML’li hastalarda, Kİ
blast sayısından bağımsız olarak etkindir ve iyi tolere edilmektedir ve
HD’nin, AZA ile tedaviye devam etmek için yeterli bir yanıt olduğu göz
önünde bulundurulmalıdır.
Anahtar Sözcükler: Azasitidin, Akut miyeloid lösemi, Yaşlı, Kemik iliği
blastları, Prognostik faktörler, Genel sağkalım
with at least one dose of AZA. Demographic data, comorbidities
(cardiovascular diseases, diabetes mellitus, prior/concomitant
malignancies, pulmonary disease, renal insufficiency), Eastern
Cooperative Oncology Group (ECOG) status, transfusion
dependency, cytogenetic risk status according to the refined
Medical Research Council (MRC) criteria [16], treatment prior
to AZA, and concomitant treatments were recorded. AZA was
administered at 75 mg/m 2 subcutaneously daily for 7 days and
100 mg/m 2 subcutaneously daily for 7 days. The local ethics
committee approved this retrospective analysis.
Efficacy and Safety Assessments
Assessment of response was performed after a median of 4
cycles of AZA. BM aspirations/punctures were performed and
reviewed by the principal investigator (hematologist) at each
center. Overall responses including complete remission (CR),
partial remission (PR), CR with incomplete recovery (CRi), and
failure were defined according to International Working Group
(IWG) criteria for AML [17]. Patients with persisting peripheral
blasts following AZA were also classified as nonresponders if BM
puncture was not performed. Hematologic improvement (HI)
was evaluated using IWG criteria for MDS from the collected
transfusion records of the patients [18]. Specific hematologic
and nonhematological adverse events were graded according to
Common Terminology Criteria for Adverse Events (CTCAE) v4.0,
published on 28 May 2009, by the National Cancer Institute.
All data including response, HI, and adverse events were
determined and recorded by principal hematologists at the
respective centers.
Statistical Analysis
Categorical data were analyzed by chi-square or Fisher’s exact
test according to expected count rule and summarized as
frequency and percentage. Both univariate and multivariate
logistic regression analyses were used to obtain the odds ratio
(OR) of variables that significantly affected response rate.
Survival times and curves were estimated by Kaplan-Meier
method and compared by log-rank test. Both univariate and
multivariate Cox regression models were constructed for
obtaining the hazard ratio (HR) of variables that significantly
274

Turk J Hematol 2016;33:273-280
Tombak A, et al: Azacitidine and Elderly Acute Myeloid Leukemia Patients
affected survival. Statistical analyses were performed with
PASW v.18 software (Predictive Analytics Software is a registered
trademark of SPSS Inc.), and p<0.05 was considered statistically
significant.
Results
Patient Characteristics
Patient baseline characteristics are summarized in Table 1. A total
of 130 patients with AML (58 women, 72 men) receiving AZA
were included in the study. Median age was 73, ranging from
60 to 88 years; 31.5% (n=41) of patients were 60-69 years old,
49.2% (n=64) were 70-79 years old, and 19.2% (n=25) were ≥80
years old. ECOG performance status (ECOG-PS) was ≥2 in 54.6%
(n=71) and there were comorbidities in 66.2% (n=86) of the
cases; of these, 89.5% (n=77) had <3 and 10.5% (n=9) had ≥3
comorbidities. Lactate dehydrogenase (LDH) level was <225 IU/L in
20.8% (n=27) and was ≥225 IU/L in 75.4% (n=98) of the cases, and
40.8% (n=53) of the patients had a leukocyte count of >10x10 9 /L.
Median absolute neutrophil count (ANC) was 1.1x10 9 /L, median
hemoglobin concentration was 8.7 g/L, and median platelet
count was 57x10 9 /L. Ninety-four (72.3%) patients had peripheral
blood blasts and 80 patients (61.5%) had >30% BM blasts. One
hundred and twelve patients (86.2%) required erythrocyte and/
or thrombocyte transfusion (transfusion-dependent), while 5.4%
had an unfavorable karyotype and 50.8% had an intermediate
karyotype according to MRC criteria [16].
Treatment Modalities
While 54.6% (n=71) of the patients did not receive any treatment
prior to AZA, intensive chemotherapy, hydroxyurea, low-dose
cytarabine, erythropoietin-stimulating agents, iron chelation
therapy, lenalidomide, and granulocyte-colony stimulating
factor (G-CSF) were used in 16.9% (n=22), 16.9% (n=22), 5.4%
(n=7), 3.1% (n=4), 1.5% (n=2), 0.8% (n=1), and 0.8% (n=1) of
the cases, respectively.
AZA was administered as first-line therapy in 79.2% of patients
(n=103). No CR or early relapse after conventional (intensive)
chemotherapy and after other disease-modifying treatments
was the reason for AZA treatment in 13.8% (n=18) and
6.9% (n=9) of patients, respectively. AZA was administered
at 75 mg/m 2 subcutaneously daily for 7 days and 100 mg/m 2
subcutaneously daily for 7 days in 81.5% and 18.5% of the
patients, respectively. A median number of 4 (range: 1-21)
AZA courses were given in 28-day intervals. In all AZA cycles,
hydroxyurea (11.5%) or G-CSF (7.7%) was given concomitantly
when deemed necessary by the treating physician.
Response to Azacitidine and Survival
Initial overall response (including CR/CRi/PR according to IWG)
was evaluated after a median of 4 cycles of AZA. While there
was no response in 53.8% (n=70) of patients, CR, CRi, and PR
Table 1. Baseline characteristics.
Total number of patients, n 130
Median age, years (range) 73 (60-88)
Age categories, n (%)
60-69 years 41 (31.5)
70-79 years 64 (49.2)
≥80 years 25 (19.2)
Males, n (%) 72 (55.4)
Type of AML, n (%)
t-AML 6 (4.6)
AML-RCA 9 (6.9)
AML-MRF 47 (36.2)
AML-NOS 68 (52.3)
Peripheral blood blasts, n (%)
0% 7 (5.4)
>0% 94 (72.3)
Unknown 29 (22.3)
Median (range), % 15 (0-90)
Bone marrow blasts, n (%)
20%-30% 36 (27.7)
>30% (off-label use) 80 (61.5)
Unknown 14 (10.8)
Median (range), % 49.5 (20-97)
WBC count (10 9 /L), n (%)
≤10x10 9 /L 77 (59.2)
>10x10 9 /L 53 (40.8)
Median (range), % 4.9 (0.7-146)
ANC (10 9 /L), median (range) 1.1 (0.05-142.7)
Hb (g/L), median (range) 8.7 (4.2-14)
Platelet count (10 9 /L), median (range) 57 (5-786)
LDH (IU/L)
<225
≥225 27 (20.8)
Unknown 98 (75.4)
Transfusion dependency (TD), n (%) 5 (3.8)
No
Any type of TD
RBC-TD 18 (13.8)
PLT-TD 112 (86.2)
RBC-TD + PLT-TD 40 (30.7)
275

Tombak A, et al: Azacitidine and Elderly Acute Myeloid Leukemia Patients
Turk J Hematol 2016;33:273-280
Table 1. Continuation
MRC cytogenetic risk, n (%)
Not evaluable 14 (10.7)
Good 58 (44.6)
Intermediate 56 (43.1)
High 1 (0.8)
Comorbidities, n (%) 66 (50.8)
Number of comorbidities, n (%) 7 (5.4)
<3 86 (66.2)
≥3 77 (89.5)
ECOG-PS score, n (%)
ECOG <2 9 (10.5)
ECOG ≥2 52 (40)
Unknown 71 (54.6)
Treatment prior to azacitidine, n (%) 7 (5.4)
None 71 (54.6)
Reason for treatment, n (%)
First-line treatment 103 (79.2)
No CR to/early relapse after intensive
chemotherapy
18 (13.8)
No CR to other prior treatments 9 (6.9)
t-AML: Treatment-related acute myeloid leukemia, AML-RCA: acute myeloid leukemia
with recurrent cytogenetic abnormalities, AML-MRF: acute myeloid leukemia with
MDS-related features, AML-NOS: acute myeloid leukemia not otherwise specified,
WBC: white blood cell, ANC: absolute neutrophil count, Hb: hemoglobin, LDH: lactate
dehydrogenase, RBC: red blood cell, PLT: platelet, MRC: myelodysplastic syndromerelated
cytogenetics, ECOG: Eastern Cooperative Oncology Group, G-CSF: granulocytecolony
stimulating factor, CR: complete remission.
were documented in 13.1% (n=17), 6.2% (n=8), and 16.9%
(n=22) of the cases, respectively (Table 2). Any HI according to
IWG criteria was documented in 37.7% (n=49) of the patients;
neutrophil, erythroid, and platelet responses were observed in
18.5% (n=24), 3.8% (n=5), and 15.4% (n=20) of the patients,
respectively (Table 2). HI was also documented in 27.1% (n=19)
of 70 patients who were unresponsive to treatment.
Median overall survival (OS) was 12.3 [95% confidence interval
(CI): 10.1-14.6] months as of the first diagnosis of AML. Diseasefree
survival (DFS) and event-free survival (EFS) were 16.2 (95%
CI: 6.7-25.7) and 8.3 (95% CI: 6.1-10.6) months, respectively.
Median OS was 18 (95% CI: 10.6-25.4) months for responders
(defined as CR/CRi/PR) and 12 (95% CI: 9.2-14.8) months for
nonresponders (p=0.005). In addition, median OS was 14 (95%
CI: 4.1-23.9) months in patients unresponsive to treatment
(without CR/CRi/PR) but with any HI (n=19), and was 10 (95%
CI: 4.1-15.9) months in patients unresponsive to treatment and
also without any HI (n=51) (p=0.068). Median OS of the patients
who received AZA as a rescue after intensive chemotherapy was
24 (95% CI: 13.3-34.7) months as of the first diagnosis of AML.
Table 2. Response to azacitidine according to International
Working Group criteria.
Response n (%)
No response 70 (53.8)
Overall response 1 47 (36.2)
CR 17 (13.1)
CRi 8 (6.2)
PR 22 (16.9)
Not evaluable 13 (10)
HI n (%)
No HI 81 (62.3)
Any HI 49 (37.7)
Neutrophil response 24 (18.5)
Erythroid response 5 (3.8)
Platelet response 20 (15.4)
1 Overall response includes CR, CRi, and PR.
CR: Complete response, CRi: complete response with incomplete recovery, PR: partial
response, HI: hematologic improvement.
In univariate analysis the following parameters had a significant
effect on both treatment response and OS: ECOG-PS score,
number of AZA cycles, and any HI. However, sex, age, absolute
number of comorbidities, presence of peripheral blasts, AML
type, leukocyte count at the time of diagnosis, treatment
prior to AZA, and BM blast count had no significant impact
on treatment response and OS (Table 3). Since the number of
patients with good (n=1) and poor-risk cytogenetics (n=7) was
low, the effect of cytogenetics on response to treatment and
OS was not evaluated. Similarly, since the number of patients
receiving AZA at 100 mg/m 2 was low (n=24), the impact of
altered dosing schedules of AZA was not evaluated.
In multivariate analysis, all variables with p<0.05 in univariate
analysis were included, and it was found that increasing number
of AZA cycles (≥5) was associated with a better response rate
and ECOG-PS score of ≥2 was a significant predictor of shorter
OS (Table 4).
Toxicity and Adverse Events
A total of 351 adverse events were documented. CTCAE grade 3-4
neutropenia, thrombocytopenia, and anemia were documented
in 34.6%, 40.8%, and 39.2% of patients, respectively. Febrile
neutropenia was documented in 60.8% of the patients. Other
nonhematological toxicities were usually mild, the most
common adverse events being mucositis, diarrhea, injection site
pain, and nausea.
Discussion
Incidence of AML increases with age and most patients are
deemed unsuitable for intensive treatment options. Outcomes
276

Turk J Hematol 2016;33:273-280
Tombak A, et al: Azacitidine and Elderly Acute Myeloid Leukemia Patients
following conventional chemotherapeutic approaches are poor.
AZA is a hypomethylating agent, and owing to its acceptable
tolerability profiles and emerging evidence of clinical efficacy,
it may provide an exciting approach to the treatment of elderly
patients with AML. It is licensed for patients with 20%-30%
blasts and it confers a survival benefit in these patients [14];
studies suggest 10%-20% CR rates with AZA [14,19,20,21] and
these patients have OS rates equivalent or superior to other
conventional treatments [14,19,21]. However, data on AZA
activity in AML patients with BM blast counts of >30% are
limited and the drug can be used off-label in these patients,
although several analyses have also suggested that AZA is active
and well tolerated in patients with >30% BM blasts as well
[11,12,15,20].
Table 3. Univariate analysis for response and overall survival.
Sex,
Female/Male
Age,
60-69/70-79/≥80 years
Absolute number of
comorbidities, <3/≥3
Peripheral blasts,
0%/>0%
BM blast count,
20%-30%/>30%
AML type,
t-AML/AML-RCA/AML-MRF/AML-NOS
Treatment prior to AZA,
No/Yes
Leukocyte count at diagnosis, ≤10x10 9 /
L/>10x10 9 /L
LDH,
≥225/<225 IU/L
ECOG,
≥2/<2
Number of AZA cycles,
≥5/<5
Transfusion dependency,
Yes/No
Any HI,
Yes/No
Overall response rate, %
p-value
44.4/36.5 0.383
44.7/37.9/38.1 0.783
33.8/55.6 0.273
42.9/36.4 0.706
41.7/39.1 0.801
50.0/43.2/57.1/35.0 0.592
47.6/30.2 0.056
40.3/40.0 0.976
41.9/38.5 0.758
29.7/53.2 0.012
61.9/28 0.001
36.3/66.7 0.025
59.6/27.1 0.001
Median overall survival,
months, and 95% CI
12.3/13.3
10.3-14.3/9.1-17.6
19/12.3/15
3.9-34.1/10.2-14.5/1.2-28.9
13/9
10.2-15.8/1.6-16.4
12.3/12.3
6.2-12.3/10.1-14.5
13/12.3
7.8-18.2/9.6-15.1
7/11.3/6/14.1
4.4-9.6/9.2-13.4/3.5-12.9/11.9-16.2
12.3/13.2
9.1-15.6/9.9-16.4
14/10.5
8.9-19.1/7.8-13.1
11/19
8.6-13.4/12.1-25.9
10/14.1
8.1-11.9/7.8-20.3
14.1/9
8.5-19.6/4.0-14.0
12.3/20
9.8-14.8/4.2-35.9
18/10
10.0-26.0/5.1-14.9
p-value
CI: Confidence interval, BM: bone marrow, t-AML: treatment-related acute myeloid leukemia, AML-RCA: acute myeloid leukemia with recurrent cytogenetic abnormalities, AML-MRF:
acute myeloid leukemia with MDS-related features, AML-NOS: acute myeloid leukemia not otherwise specified, LDH: lactate dehydrogenase, ECOG: Eastern Cooperative Oncology
Group, AZA: azacitidine, HI: hematologic improvement.
Table 4. Multivariate analysis for response and overall survival.
Response
Overall survival
OR (95% CI) p-value HR (95% CI) p-value
LDH, ≥225/<225 IU/L 0.715 (0.248-2.058) 0.533 1.862 (0.977-3.549) 0.059
ECOG, ≥2/<2 2.360 (0.969-5.748) 0.059 1.677 (1.020-2.758) 0.042
Number of AZA cycles, ≥5/<5 0.312 (0.123-0.793) 0.014 0.576 (0.332-1.001) 0.050
Transfusion dependency, yes/no 3.165 (0.790-12.683) 0.104 1.509 (0.650-3.505) 0.339
Any HI, yes/no 0.311 (0.125-0.776) 0.012 0.621 (0.359-1.077) 0.090
OR: Odds ratio, CI: confidence interval, HR: hazard ratio, LDH: lactate dehydrogenase, ECOG: Eastern Cooperative Oncology Group, AZA: azacitidine, HI: hematologic improvement.
0.303
0.057
0.662
0.379
0.929
0.091
0.158
0.225
0.018
0.034
0.011
0.077
0.002
277

Tombak A, et al: Azacitidine and Elderly Acute Myeloid Leukemia Patients
Turk J Hematol 2016;33:273-280
In the current study, we retrospectively analyzed the efficacy and
toxicity of AZA in 130 patients with AML who were ≥60 years
of age, and this cohort also included 80 patients (61.5% of the
cases) with >30% BM blasts. We found a CR rate similar to the
CR rates of recent studies [14,19,20,21], which was documented
in 13.1% of our patient cohort. Median OS was 12.3 months
and OS was longer in responders compared to nonresponders.
We also showed that AZA was effective in the group with >30%
BM blasts and that BM blast count of 20%-30% versus >30%
has no significant impact on response rate or OS. In addition,
although the response rate and OS were somewhat poor
with the presence of peripheral blasts, these results were not
statistically significant. In a study conducted by van der Helm
et al. it was shown that BM blast percentage had no impact
on OS as well [22]. In a recent phase 3 study of AZA versus
conventional care regimens in newly diagnosed AML patients
of ≥65 years with >30% BM blasts, Dombret et al. confirmed
the clinical observation that AZA can have meaningful clinical
activity (e.g., transfusion independency) and improve survival,
even though no CR is achieved [23]. Thus, we recommend that
AML patients with >30% BM blasts should not be precluded
from treatment with AZA and the presence of peripheral blasts
should not be a reason for therapy cessation.
HI was found to be a predictor of prolonged survival; significantly
longer OS was observed in patients achieving any kind of HI
compared to patients without any HI (p=0.002), and similar
results have been shown in recent AML patient cohorts [15,20].
However, interestingly, we also found that in the unresponsive
(without CR/CRi/PR) patient group, OS was significantly longer
for patients who achieved HI compared to those without any HI
(p=0.068). In other words, although this was not a statistically
significant result, HI without CR/CRi or PR was also associated
with a better OS. If commonly used AML response criteria were
to be applied [17], patients who experience HI without CR, CRi,
or PR would be called nonresponders and treatment with AZA
would be discontinued. With these results, we can conclude that,
since cytopenias are the cause of mortality in the majority of
patients with AML, the goal of therapy with AZA should not just
be CR or PR, and therapy should be continued in patients with
any HI although there is not any simultaneous BM response.
Another result of our study was that, as the number of AZA
courses increased, response rate and OS increased. This is not
a surprise, because the epigenetic therapeutic effects of AZA
are dependent on the S-phase of the cell cycle and each cycle
of therapy can only affect the fraction of the malignant clone
that enters the S-phase. Thus, the best responses can occur after
as many as 12 cycles of therapy, with a median of 3-3.5 cycles
[24]. Therefore, the treatment should not be interrupted in the
early stages of therapy and it should be continued as long as
the response is durable and/or until overt clinical progression
occurs.
We confirm the results of previous studies [15,20,25] that WHO-
AML type, treatment prior to AZA, sex, and age had no significant
effect on OS. Not the age but rather the absolute number of
comorbidities may adversely affect OS. In our study, a cut-off
of <3/≥3 comorbidities was analyzed and there was a trend
for reduced OS for patients with ≥3 comorbidities, which was,
however, not statistically significant (p=0.662). Similarly, LDH of
≥225 IU/L was associated with reduced OS (p=0.018), but it had
no impact on treatment response (p=0.758). Importantly, ECOG-
PS of ≥2 was found to be the only baseline factor affecting OS in
both univariate and multivariate analysis. Recently, an Austrian
group reported that the absolute number of comorbidities and
LDH of ≥225 IU/L were independent adverse predictors of OS in
their larger cohort (n=302) [15] and borderline significant in
their previously published smaller cohort (n=155) [20]. As we
found in our study, ECOG-PS of ≥2 was an independent adverse
predictor of OS in both of the Austrian studies [15,20], and in
a French study as well [25]. In our opinion, older age, WHO-
AML type, prior treatments, and LDH level should not lead to
a decision to withhold treatment of AZA in favor of BSC if the
patient has an ECOG-PS score of <2.
Elevated leukocyte count had no impact on OS in our study, but
conflicting results exist in the literature. Both aforementioned
Austrian publications showed that leukocyte count of neither
>10x10 9 /L nor >15x10 9 /L significantly affected OS [15,20], but
the French publication showed a significant effect of leukocyte
count of >15x10 9 /L on OS [25]. We think that AML patients with
high leukocyte counts should not be precluded from treatment
with AZA, and cytoreduction with hydroxyurea or low-dose
cytarabine may be an appropriate approach in such patients.
As expected, transfusion dependence prior to AZA was
associated with reduced OS in our study in univariate analysis,
which was, however, not statistically significant (p=0.077).
Transfusion dependence was not a predictor of reduced OS in
the multivariate analysis of the Austrian studies, as well [15,20].
The most commonly observed toxicity was febrile neutropenia,
at a rate higher than seen in the literature [12,13,15]. Other
nonhematological toxicities were mild. However, due to the
retrospective nature of this analysis, toxicities in general were
probably underestimated.
Certainly, our study has several shortcomings, since it was a
retrospective study, the patient population was heterogeneous,
and the effect of cytogenetics on response to treatment was
not evaluated.
In conclusion, AZA is effective and well tolerated in elderly
comorbid AML patients with fewer required erythrocyte and
platelet transfusions, irrespective of BM blast count. HI should
be considered a sufficient response to continue treatment with
AZA and treatment should not be interrupted since OS and
278

Turk J Hematol 2016;33:273-280
Tombak A, et al: Azacitidine and Elderly Acute Myeloid Leukemia Patients
response to treatment increase with increasing numbers of AZA
cycles.
Ethics
Ethics Committee Approval: This study was approved by
Mersin University Ethics Committee, Informed Consent: It is a
retrospective study.
Authorship Contributions
Concept: Anıl Tombak, Design: Anıl Tombak, Data Collection and
Processing: Anıl Tombak, Mehmet Ali Uçar, Aydan Akdeniz, Eyüp
Naci Tiftik, Deniz Gören Şahin, Olga Meltem Akay, Murat Yıldırım,
Oral Nevruz, Cem Kis, Emel Gürkan, Şerife Medeni Solmaz,
Mehmet Ali Özcan, Rahşan Yıldırım, İlhami Berber, Mehmet
Ali Erkurt, Tülin Fıratlı Tuğlular, Pınar Tarkun, İrfan Yavaşoğlu,
Mehmet Hilmi Doğu, İsmail Sarı, Mustafa Merter, Muhit Özcan,
Esra Yıldızhan, Leylagül Kaynar, Özgür Mehtap, Ayşe Uysal, Fahri
Şahin, Ozan Salim, Mehmet Ali Sungur; Analysis or Interpretation:
Anıl Tombak, Mehmet Ali Uçar, Aydan Akdeniz, Eyüp Naci Tiftik,
Deniz Gören Şahin, Olga Meltem Akay, Murat Yıldırım, Oral
Nevruz, Cem Kis, Emel Gürkan, Şerife Medeni Solmaz, Mehmet
Ali Özcan, Rahşan Yıldırım, İlhami Berber, Mehmet Ali Erkurt,
Tülin Fıratlı Tuğlular, Pınar Tarkun, İrfan Yavaşoğlu, Mehmet Hilmi
Doğu, İsmail Sarı, Mustafa Merter, Muhit Özcan, Esra Yıldızhan,
Leylagül Kaynar, Özgür Mehtap, Ayşe Uysal, Fahri Şahin, Ozan
Salim, Mehmet Ali Sungur; Literature Search: Anıl Tombak,
Mehmet Ali Uçar, Aydan Akdeniz, Eyüp Naci Tiftik, Deniz Gören
Şahin, Olga Meltem Akay, Murat Yıldırım, Oral Nevruz, Cem Kis,
Emel Gürkan, Şerife Medeni Solmaz, Mehmet Ali Özcan, Rahşan
Yıldırım, İlhami Berber, Mehmet Ali Erkurt, Tülin Fıratlı Tuğlular,
Pınar Tarkun, İrfan Yavaşoğlu, Mehmet Hilmi Doğu, İsmail Sarı,
Mustafa Merter, Muhit Özcan, Esra Yıldızhan, Leylagül Kaynar,
Özgür Mehtap, Ayşe Uysal, Fahri Şahin, Ozan Salim, Mehmet Ali
Sungur; Writing: Anıl Tombak.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Klepin HD, Balducci L. Acute myelogenous leukemia in older adults.
Oncologist 2009;14:222-232.
2. Appelbaum FR, Gundacker H, Head DR, Slovak ML, Willman CL, Godwin
JE, Anderson JE, Petersdorf SH. Age and acute myeloid leukemia. Blood
2006;107:3481-3485.
3. Anderson JE, Kopecky KJ, Willman CL, Head D, O’Donnell MR, Luthardt FW,
Norwood TH, Chen IM, Balcerzak SP, Johnson DB, Appelbaum FR. Outcome
after induction chemotherapy for older patients with acute myeloid
leukemia is not improved with mitoxantrone and etoposide compared to
cytarabine and daunorubicin: a Southwest Oncology Group study. Blood
2002;100:3869-3876.
4. Kantarjian H, O’Brien S, Cortes J, Giles F, Faderl S, Jabbour E, Garcia-Manero
G, Wierda W, Pierce S, Shan J, Estey E. Results of intensive chemotherapy
in 998 patients age 65 years or older with acute myeloid leukemia or highrisk
myelodysplastic syndrome: predictive prognostic models for outcome.
Cancer 2006;106:1090-1098.
5. Menzin J, Lang K, Earle CC, Kerney D, Mallick R. The outcomes and costs of
acute myeloid leukemia among the elderly. Arch Intern Med 2002;162:1597-
1603.
6. Deschler B, de Witte T, Mertelsmann R, Lübbert M. Treatment decision-making
for older patients with high-risk myelodysplastic syndrome or acute myeloid
leukemia: problems and approaches. Haematologica 2006;91:1513-1522.
7. Kantarjian H, Ravandi F, O’Brien S, Cortes J, Faderl S, Garcia-Manero G,
Jabbour E, Wierda W, Kadia T, Pierce S, Shan J, Keating M, Freireich EJ.
Intensive chemotherapy does not benefit most older patients (age 70 years
or older) with acute myeloid leukemia. Blood 2010;116:4422-4429.
8. Fenaux P, Mufti GJ, Hellstrom-Lindberg E, Santini V, Finelli C, Giagounidis
A, Schoch R, Gattermann N, Sanz G, List A, Gore SD, Seymour JF, Bennett
JM, Byrd J, Backstrom J, Zimmerman L, McKenzie D, Beach C, Silverman
LR; International Vidaza High-Risk MDS Survival Study Group. Efficacy
of azacitidine compared with that of conventional care regimens in the
treatment of higher-risk myelodysplastic syndromes: a randomised, openlabel,
phase III study. Lancet Oncol 2009;10:223-232.
9. Itzykson R, Thépot S, Quesnel B, Dreyfus F, Beyne-Rauzy O, Turlure P, Vey
N, Recher C, Dartigeas C, Legros L, Delaunay J, Salanoubat C, Visanica S,
Stamatoullas A, Isnard F, Marfaing-Koka A, de Botton S, Chelghoum
Y, Taksin AL, Plantier I, Ame S, Boehrer S, Gardin C, Beach CL, Adès L,
Fenaux P; Groupe Francophone des Myelodysplasies (GFM). Prognostic
factors for response and overall survival in 282 patients with higher-risk
myelodysplastic syndromes treated with azacitidine. Blood 2011;117:403-
411.
10. Silverman LR, McKenzie DR, Peterson BL, Holland JF, Backstrom JT, Beach
CL, Larson RA; Cancer and Leukemia Group B. Further analysis of trials with
azacitidine in patients with myelodysplastic syndrome: studies 8421, 8921,
and 9221 by the Cancer and Leukemia Group B. J Clin Oncol 2006;24:3895-
3903.
11. Al-Ali HK, Jaekel N, Junghanss C, Maschmeyer G, Krahl R, Cross M, Hoppe
G, Niederwieser D. Azacitidine in patients with acute myeloid leukemia
medically unfit for or resistant to chemotherapy: a multicenter phase I/II
study. Leuk Lymphoma 2012;53:110-117.
12. Maurillo L, Venditti A, Spagnoli A, Gaidano G, Ferrero D, Oliva E, Lunghi
M, D’Arco AM, Levis A, Pastore D, Di Renzo N, Santagostino A, Pavone V,
Buccisano F, Musto P. Azacitidine for the treatment of patients with acute
myeloid leukemia: report of 82 patients enrolled in an Italian Compassionate
Program. Cancer 2012;118:1014-1022.
13. Sudan N, Rossetti JM, Shadduck RK, Latsko J, Lech JA, Kaplan RB, Kennedy
M, Gryn JF, Faroun Y, Lister J. Treatment of acute myelogenous leukemia
with outpatient azacitidine. Cancer 2006;107:1839-1843.
14. Fenaux P, Mufti GJ, Hellström-Lindberg E, Santini V, Gattermann N,
Germing U, Sanz G, List AF, Gore S, Seymour JF, Dombret H, Backstrom J,
Zimmerman L, McKenzie D, Beach CL, Silverman LR. Azacitidine prolongs
overall survival compared with conventional care regimens in elderly
patients with low bone marrow blast count acute myeloid leukemia. J Clin
Oncol 2010;28:562-569.
15. Pleyer L, Burgstaller S, Girschikofsky M, Linkesch W, Stauder R, Pfeilstocker
M, Schreder M, Tinchon C, Sliwa T, Lang A, Sperr WR, Krippl P, Geissler D,
Voskova D, Schlick K, Thaler J, Machherndl-Spandl S, Theiler G, Eckmüllner
O, Greil R. Azacitidine in 302 patients with WHO-defined acute myeloid
leukemia: results from the Austrian Azacitidine Registry of the AGMT-Study
Group. Ann Hematol 2014;93:1825-1838.
16. Grimwade D, Hills RK, Moorman AV, Walker H, Chatters S, Goldstone AH,
Wheatley K, Harrison CJ, Burnett AK; National Cancer Research Institute
Adult Leukaemia Working Group. Refinement of cytogenetic classification
in acute myeloid leukemia: determination of prognostic significance of rare
recurring chromosomal abnormalities among 5876 younger adult patients
treated in the United Kingdom Medical Research Council trials. Blood
2010;116:354-365.
279

Tombak A, et al: Azacitidine and Elderly Acute Myeloid Leukemia Patients
Turk J Hematol 2016;33:273-280
17. Cheson BD, Bennett JM, Kopecky KJ, Büchner T, Willman CL, Estey EH,
Schiffer CA, Doehner H, Tallman MS, Lister TA, Lo-Coco F, Willemze R, Biondi
A, Hiddemann W, Larson RA, Löwenberg B, Sanz MA, Head DR, Ohno R,
Bloomfield CD; International Working Group for Diagnosis, Standardization
of Response Criteria, Treatment Outcomes, and Reporting Standards for
Therapeutic Trials in Acute Myeloid Leukemia. Revised recommendations
of the International Working Group for Diagnosis, Standardization of
Response Criteria, Treatment Outcomes, and Reporting Standards for
Therapeutic Trials in Acute Myeloid Leukemia. J Clin Oncol 2003;21:4642-
4649.
18. Cheson BD, Bennett JM, Kantarjian H, Pinto A, Schiffer CA, Nimer SD,
Löwenberg B, Beran M, de Witte TM, Stone RM, Mittelman M, Sanz GF,
Wijermans PW, Gore S, Greenberg PL; World Health Organization (WHO)
International Working Group. Report of an international working group
to standardize response criteria for myelodysplastic syndromes. Blood
2000;96:3671-3674.
19. Quintas-Cardama A, Ravandi F, Liu-Dumlao T, Brandt M, Faderl S, Pierce S,
Borthakur G, Garcia-Manero G, Cortes J, Kantarjian H. Epigenetic therapy
is associated with similar survival compared with intensive chemotherapy
in older patients with newly diagnosed acute myeloid leukemia. Blood
2012;120:4840-4845.
20. Pleyer L, Stauder R, Burgstaller S, Schreder M, Tinchon C, Pfeilstocker M,
Steinkirchner S, Melchardt T, Mitrovic M, Girschikofsky M, Lang A, Krippl P,
Sliwa T, Egle A, Linkesch W, Voskova D, Angermann H, Greil R. Azacitidine in
patients with WHO-defined AML - results of 155 patients from the Austrian
Azacitidine Registry of the AGMT-Study Group. J Hematol Oncol 2013;6:32.
21. Radujkovic A, Dietrich S, Bochtler T, Krämer A, Schöning T, Ho AD, Dreger P,
Luft T. Azacitidine and low-dose cytarabine in palliative patients with acute
myeloid leukemia and high bone marrow blast counts--a retrospective
single-center experience. Eur J Haematol 2014;93:112-117.
22. van der Helm LH, Veeger NJ, van Marwijk Kooy M, Beeker A, de Weerdt O,
de Groot M, Alhan C, Hoogendoorn M, Laterveer L, van de Loosdrecht AA,
Koedam J, Vellenga E, Huls G. Azacitidine results in comparable outcome in
newly diagnosed AML patients with more or less than 30% bone marrow
blasts. Leuk Res 2013;37:877-882.
23. Dombret H, Seymour JF, Butrym A, Wierzbowska A, Selleslag D, Jang JH,
Kumar R, Cavenagh J, Schuh AC, Candoni A, Récher C, Sandhu I, Bernal del
Castillo T, Al-Ali HK, Martinelli G, Falantes J, Noppeney R, Stone RM, Minden
MD, McIntyre H, Songer S, Lucy LM, Beach CL, Döhner H. International
phase 3 study of azacitidine vs conventional care regimens in older patients
with newly diagnosed AML with >30% blasts. Blood 2015;126:291-299.
24. Gore SD. New ways to use DNA methyltransferase inhibitors for the
treatment of myelodysplastic syndrome. Hematology Am Soc Hematol Educ
Program 2011;2011:550-555.
25. Thepot S, Itzykson R, Seegers V, Recher C, Raffoux E, Quesnel B, Delaunay J,
Cluzeau T, Marfaing Koka A, Stamatoullas A, Chaury MP, Dartigeas C, Cheze
S, Banos A, Morel P, Plantier I, Taksin AL, Marolleau JP, Pautas C, Thomas X,
Isnard F, Beve B, Chait Y, Guerci A, Vey N, Dreyfus F, Ades L, Ifrah N, Dombret
H, Fenaux P, Gardin C; Groupe Francophone des Myélodysplasies (GFM),
Acute Leukemia French Association (ALFA); Groupe Ouest-Est des Leucémies
Aiguës; Maladies du Sang (GOELAMS). Azacitidine in untreated acute myeloid
leukemia: a report on 149 patients. Am J Hematol 2014;89:410-416.
280

RESEARCH ARTICLE
DOI: 10.4274/tjh.2015.0088
Turk J Hematol 2016;33:281-285
The Prognosis of Adult Burkitt’s Cell Leukemia in Real-Life
Clinical Practice
Erişkin Burkitt Hücreli Löseminin Klinik Pratikteki Seyri
Ümit Yavuz Malkan 1 , Gürsel Güneş 1 , Hakan Göker 1 , İbrahim C. Haznedaroğlu 1 , Kadir Acar 2 , Eylem Eliaçık 1 , Sezgin Etgül 1 , Tuncay Aslan 1 ,
Seda Balaban 1 , Haluk Demiroğlu 1 , Osman İ. Özcebe 1 , Nilgün Sayınalp 1 , Salih Aksu 1 , Yahya Büyükaşık 1
1Hacettepe University Faculty of Medicine, Department of Hematology, Ankara, Turkey
2Gazi University Faculty of Medicine, Department of Hematology, Ankara, Turkey
Abstract
Objective: Many studies reported an improved prognosis in
patients with Burkitt’s lymphoma obviating the need of stem cell
transplantation. However, prognosis of the advanced disease [i.e.
Burkitt’s cell leukemia (BCL)] has not been reported with current
treatment modalities except for a few prospective trials. The aim of
this study is to compare the prognoses of BCL patients with similarly
treated and nontransplanted patients with other types of acute
lymphoblastic leukemia (ALL) and with ALL patients that underwent
allogeneic stem cell transplantation (ASCT) in their first remissions.
Materials and Methods: In this retrospective analysis, BCL patients
aged between 16 and 63 who were admitted between 2000 and 2014
to the hospitals of Hacettepe or Gazi University and were treated with
intensive therapies aimed at cure were included. All ALL patients who
were treated with a similar protocol not including transplantation
during the same period (NT-ALL group) and all ALL patients who
underwent ASCT in the first complete remission during the same
period (T-ALL group) served as control groups.
Results: The central nervous system or extramedullary involvement
rates, lactate dehydrogenase levels, and white blood cell counts at
diagnosis were higher in the BCL group than the NT-ALL group and
these differences were significant. BCL patients had disease-free
survival (DFS) durations comparable with the T-ALL cohort but NT-
ALL patients had significantly shorter DFS durations. Both cumulative
relapse incidence and cumulative nonrelapse mortality were higher in
NT-ALL patients compared to the T-ALL group and BCL patients.
Conclusion: DFS in BCL patients treated with a widely accepted
modern regimen, R-HyperCVAD, is comparable to results in other
ALL patients receiving allogeneic transplantation. Our results are in
agreement with a few prospective noncomparative studies suggesting
no further need for stem cell transplantation in BCL.
Keywords: Burkitt’s cell leukemia, Prognosis
Amaç: Yapılan birçok çalışmada Burkitt lenfomanın seyrinin düzeldiği,
hatta kemik iliği nakli ihtiyacının ortadan kalktığı ileri sürülmektedir.
Ancak birkaç ileriye dönük çalışma haricinde, güncel tedavi yöntemleri
altında hastalığın lösemik formunun seyri hakkında araştırma
yapılmamıştır. Bu çalışmanın amacı Burkitt hücreli lösemi (BHL)
hastalarının klinik seyrinin, benzer tedavi alan ve transplantasyon
uygulanmayan diğer akut lenfoblastik lösemi (ALL) hastaları ve ilk
remisyonlarında allojenik kök hücre nakli (AKHN) uygulanan ALL
hastalarıyla kıyaslanmasıdır.
Gereç ve Yöntemler: Geriye dönük olarak tasarlanan bu çalışmaya
yaşları 16 ile 63 arasında değişen, 2000 ile 2014 yılları arasında
Hacettepe ve Gazi Üniversitesi Hastaneleri’ne başvurup kür amacıyla
intensif tedavi verilen BHL hastaları alınmıştır. Transplantasyon
haricinde benzer tedavi protokolüyle tedavi edilen tüm ALL hastaları
(NT-ALL) ve aynı dönemde ilk tam remisyonlarında AKHN uygulanan
hastalar (T-ALL) kontrol grupları olarak çalışmaya alınmışlardır.
Bulgular: Santral sinir sistemi ya da ekstra medüller tutulum
hızları, tanı anındaki laktat dehidrogenaz düzeyleri ve beyaz küre
sayısı BHL hastalarında NT-ALL hastalarına göre istatistiksel olarak
anlamlı olacak şekilde daha yüksekti. BHL hastaları T-ALL hastalarıyla
benzer hastalıksız sağkalım (HS) süresine sahip olmakla beraber, NT-
ALL hastalarında HS süresi önemli oranda azalmıştı. Kümülatif nüks
insidansı ve kümülatif nüks dışı ölümler NT-ALL hastalarında T-ALL ve
BHL hastalarında kıyasla daha fazlaydı.
Sonuç: Sonuç olarak, geniş kabul gören modern bir rejim olan
R-HyperCVAD ile tedavi edilen BHL hastalarında HS süresi allojenik
transplantasyon uygulanmış diğer ALL hastaları ile benzer bulundu.
Bizim çalışmamızın sonuçları, literatürde ileri dönük dizayn edilmiş
ancak kontrol grupları ile karşılaştırma olmadan yapılmış ve BHL’de
transplantasyon gerekmediğini öne süren az sayıdaki çalışma ile
örtüşmektedir.
Öz
Anahtar Sözcükler: Burkitt hücreli lösemi, Prognoz
Address for Correspondence/Yazışma Adresi: Ümit Yavuz MALKAN, M.D.,
Hacettepe University Faculty of Medicine, Department of Hematology, Ankara, Turkey
Phone : +90 532 778 00 87
E-mail : umitmalkan@hotmail.com
Received/Geliş tarihi: February 23, 2015
Accepted/Kabul tarihi: December 14, 2015
281

Malkan ÜY, et al: The Prognosis of Adult Burkitt’s Cell Leukemia Turk J Hematol 2016;33:281-285
Introduction
In the last decade, many studies reported an improved prognosis
in patients with Burkitt’s lymphoma obviating the need for
stem cell transplantation. There is a general consensus that the
prognosis of Burkitt’s lymphoma is closely related to the disease
stage and degree regarding the involvement of bone marrow and
peripheral blood. However, prognosis of the advanced disease
(i.e. Burkitt’s cell leukemia) specifically has not been reported
with current treatment modalities except for a few prospective
trials, which may not reflect everyday real-life clinical practices
with their own limitations.
The aim of this study is to compare the prognoses of Burkitt’s cell
leukemia patients with similarly treated and nontransplanted
patients with other types of acute lymphoblastic leukemia and
with acute lymphoblastic leukemia patients that underwent
allogeneic stem cell transplantation in their first remissions.
Materials and Methods
Study Population
In this retrospective analysis, Burkitt’s cell leukemia patients
aged between 16 and 63 years who were admitted between
2000 and 2014 to the hospitals of Hacettepe or Gazi University
and treated with intensive therapies aimed at cure were
included in the study. Twenty-five patients who were treated
with HyperCVAD ± rituximab were included in the study; as
only one patient was treated with the R-EPOCH regimen,
that patient was excluded from the study. The diagnosis
of Burkitt’s cell leukemia was made based on the presence
of characteristic morphological (FAB L3 morphology and
>95% Ki-67 proliferation index) or cytogenetic/molecular
(specific translocations involving MYC at band 8q24 or MYC
rearrangement in fluorescence in situ hybridization analysis)
properties and mature B-cell immunophenotype (TdT negativity
plus sIg positivity of >20% or κ/λ light-chain clonality). The
minimal criterion for the diagnosis of a leukemic disease
condition was more than 25% bone marrow involvement. All
acute lymphoblastic leukemia patients who were treated with a
similar protocol not including transplantation during the same
period (NT-ALL group) and all acute lymphoblastic leukemia
patients who underwent allogeneic stem cell transplantation
in the first complete remission during the same period (T-ALL
group) served as control groups.
Treatment Protocols
Specifics of the HyperCVAD ± rituximab regimen, including
central nervous system (CNS) prophylaxis and treatment
strategies, were as described by Thomas et al. [1]. Chemotherapy
consisted of 8 alternating courses without maintenance therapy.
When given, rituximab was administered during courses 1 to 4.
Odd courses (1, 3, 5, 7) were HyperCVAD. When given, rituximab
was administered at 375 mg/m 2 i.v. over 2 to 6 h on days 1 and
11 of HyperCVAD and on days 2 and 8 of MTX and ara-C, during
the first 4 courses.
Study End-Points and Statistical Analysis
Numerical descriptive data were expressed as median (minimummaximum).
Continuous and categorical data were compared with
the t-test and chi-square test, respectively. Primary endpoints
of the study were complete remission (CR) rate, disease-free
survival (DFS), and overall survival (OS). OS was calculated
from diagnosis to the date of mortality of any reason. DFS was
analyzed in CR patients from date of CR attainment to relapse
or death in remission. The patients who did not die and those
who did not relapse or die in remission at last follow-up were
censored at this time for OS and DFS computations, respectively.
Cumulative relapse (CRI) and cumulative nonrelapse mortality
incidences (CNRMI) were computed for patients who attained
CR, from the date of CR until relapse or nonrelapse mortality
(NRM), respectively. The patients who did not relapse or die in
remission at last follow-up were censored at this time. Relapse
was considered a competing risk for NRM, and NRM was
considered a competing risk for relapse during CRI and CNRMI
computations. Categorical and continuous data were compared
by the chi-square and independent-samples t-test, respectively.
Survival analyses were computed by the Kaplan-Meier method.
Comparisons of survival rates were done by the log-rank test.
CRI and CNRMI were calculated according to Gray’s test [2]
as described by Scrucca et al. [3]. Cumulative incidences were
calculated by means of the statistical software environment
R, Version 2.15.2 (The R Foundation for Statistical Computing,
Vienna, Austria) [4]. SPSS 17.0 (SPSS Inc., Chicago, IL, USA) was
used for other statistical analyses.
Results
T-ALL patients were frequently referred after remission attainment
from other centers. Some of these patients’ baseline parameters
were missing. There were 25, 44, and 48 patients in the Burkitt’s
cell leukemia, NT-ALL, and T-ALL groups, respectively. Important
baseline characteristics of Burkitt’s cell leukemia and NT-ALL
patients are presented in Table 1. All 25 Burkitt’s cell leukemia
patients had been treated with the HyperCVAD ± rituximab
regimen and were not transplanted. Rituximab treatments were
given to most of the Burkitt’s cell leukemia patients; only 3
Burkitt’s cell leukemia patients had not received rituximab. Only
nontransplanted acute lymphoblastic leukemia (NT-ALL) patients
who were treated with HyperCVAD were selected as controls.
Median numbers of HyperCVAD ± rituximab regimens given to
Burkitt’s and NT-ALL patients were 8 and 7.5, respectively. The
CNS or extramedullary involvement rate, lactate dehydrogenase
levels, and white blood cell count at diagnosis were higher in
282

Turk J Hematol 2016;33:281-285
Malkan ÜY, et al: The Prognosis of Adult Burkitt’s Cell Leukemia
the Burkitt’s group than the NT-ALL group and these differences
were significant (p=0.008, p=0.016, and p=0.036, respectively).
We also analyzed the chemotherapy intervals between
treatment cycles. There was no significant difference between
the intervals of treatment cycles for the Burkitt’s cell leukemia
and NT-ALL groups. The median (95% confidence interval) OS
time for all 25 Burkitt’s cell leukemia patients was 31.1 (3.1-
59.1) months. The mean (95% confidence interval) DFS time
for Burkitt’s cell leukemia patients was 50.0 (30.9-69.2) months
(median not reached). After analyzing the prognosis, we further
analyzed the induction chemotherapy results and OS in the
patients with Burkitt’s cell leukemia receiving HyperCVAD and
similarly treated nontransplanted acute lymphoblastic leukemia
patients. Transplanted acute lymphoblastic leukemia patients
were preferentially not included in this analysis because the
majority of them had been referred after remission attainment
from other centers. After the induction therapy, 5 patients died,
19 patients achieved CR, and 1 patient had no response in the
Burkitt’s cell leukemia group. Four patients died, 33 patients
achieved CR, and 7 patients had no response in the NT-ALL
group. We achieved a 76% CR rate in the Burkitt’s group and a
75% CR rate in the NT-ALL group (p=0.182). The median (95%
confidence interval) OS time for the Burkitt’s and NT-ALL groups
were 31.1 (3.1-59.1) and 12.1 (7.0-17.3) months, respectively
(p=0.261). There was no significant difference between the two
groups (Figure 1). After obtaining these results, we analyzed the
DFS, CRI, and CNRMI in the 3 groups. The mean DFS time for the
Burkitt’s, NT-ALL, and T-ALL groups was 50.0±9.7, 31.4±6.7, and
83.3±9.1 months, respectively (p=0.002). There was a significant
statistical difference between these 3 groups (Figure 2). Burkitt’s
cell leukemia patients had DFS durations comparable with
the T-ALL cohort (50.0±9.7 vs. 83.3±9.1 months, respectively;
p=0.17), but NT-ALL patients had significantly inferior DFS
durations compared to the T-ALL group (31.4±6.7 vs. 83.3±9.1
months, respectively; p=0.001). Both CRI (45.4% [standard error,
SE: 9.8%], 38.2% [SE: 7.8%], and 35.7% [SE: 12.5%] at the 80 th
month; p=0.04) and CNRMI (28.5% [SE: 8.8%], 6.8% [SE: 3.9%],
and 11.5% [SE: 8%] at the 80 th month; p=0.03) were higher in
NT-ALL patients compared to the T-ALL group and Burkitt’s cell
leukemia patients (Figure 3).
Discussion
As stem cell transplantation for Burkitt’s cell leukemia has been
abandoned in the modern era, we preferred to evaluate success
of current treatment in these cases by comparing them with
similarly treated NT-ALL and T-ALL patients. Currently, allogeneic
stem cell transplantation is deemed necessary in adult acute
lymphoblastic leukemia during the first complete remission.
We thought that in the absence of possibilities of evaluating
the value of allogeneic stem cell transplantation in Burkitt’s
cell leukemia by a randomized study or by using a currently
transplanted Burkitt’s cohort, the necessity of treatment could
be weighed by comparison of Burkitt’s cell leukemia cases with
T-ALL and NT-ALL patients. Transplanted acute lymphoblastic
leukemia patients had the best DFS, significantly better than
that of nontransplanted patients. However, no DFS advantage
could be observed in transplanted patients compared to Burkitt’s
cell leukemia patients.
Figure 2. Disease-free survival time of Burkitt, NTxALL, and TxALL
groups.
Figure 1. Overall survival time for Burkitt and NTxALL groups.
Figure 3. Cumulative relapse and cumulative nonrelapse mortality
incidences of Burkitt, NTxALL, and TxALL groups.
283

Malkan ÜY, et al: The Prognosis of Adult Burkitt’s Cell Leukemia Turk J Hematol 2016;33:281-285
Table 1. Main baseline characteristics and follow-up durations of Burkitt’s cell leukemia and similarly treated non-transplant
acute lymphoblastic leukemia patients.
Parameters Burkitt’s Cell Leukemia Group Non-Transplant ALL Group p-value
Number of cases 25 44
Sex (Male/Female) 18/7 23/21 0.086
ECOG performance score (0/1/2/3/4) 3/16/3/3/0 12/21/4/5/2 0.438
Age (Median, range) 39 (16-63) 31 (16-63) 0.192
LDH at diagnosis (U/L) 2035 (499-12000) 919 (331-9820) 0.016
Hemoglobin at diagnosis (g/dL) 10.0 (4.9-14.0) 9.1 (4.0-15.5) 0.920
Leucocyte count at diagnosis (x10 9 /L) 9.6 (1.7-24.7) 8.8 (0.8-216.4) 0.036
Platelet count at diagnosis (x10 9 /L) 103.5 (11-631) 53.5 (8-560) 0.141
Chemotherapy Interval 1-2 nd , days 26.5 (18-33) 28.0 (17.0-45.0) 0.521
Chemotherapy Interval 2-3 rd , days 26.5 (20.0-33.0) 26.0 (19.0-34.0) 0.878
Chemotherapy Interval 3-4 th , days 24.0 (20.0-44.0) 26.0 (21.0-37.0) 0.613
Chemotherapy Interval 4-5 th , days 25.0 (19.0-49.0) 25.0 (20.0-46.0) 0.676
Chemotherapy Interval 5-6 th , days 30.0 (24.0-46.0) 29.0 (22.0-43.0) 0.395
Chemotherapy Interval 6-7 th , days 37.5 (27.0-42.0) 29.0 (23.0-40.0) 0.087
Chemotherapy Interval 7-8 th , days 31.0 (24.0-45.0) 29.0 (22.0-40.0) 0.148
Central Nervous System or Extramedullary involvement (Y/N) 12/14 7/37 0.008
Blasts in peripheral blood film (Y/N) 8/4 15/12 0.515
Blasts in marrow <25%, 25%-50%, >50% 1/0/11 0/1/24 0.275
Follow-up time for surviving patients, months 22.7 (1.4-88.5) 38.6 (0.5-90.7)
LDH: Lactate dehydrogenase, ECOG: The Eastern Cooperative Oncology Group, Y/N: Yes/No
In our study, we achieved a 76% CR rate after induction
therapy in Burkitt’s cell leukemia cases. In a study conducted
by a German group, an 86% CR rate was achieved in Burkitt’s
cell leukemia patients [5]. In another study conducted in Italy,
investigators obtained a 79% CR, 8% no-response rate, and
13% death rate in Burkitt’s lymphoma and leukemia patients
after induction chemotherapy [6]. In our study, we obtained
76% CR, 20% death, and 4% no-response rates in Burkitt’s
cell leukemia patients. The induction death rate in our study
was higher than that of the Italian study. The reason for this
difference may be that participants were in an advanced stage
of disease (Burkitt’s cell leukemia) in our study, whereas patients
in the Italian study had both Burkitt’s lymphoma and leukemia.
Furthermore, in the Italian study, investigators found a relapse
rate of only 7% in patients treated with an intercycle interval of
≤25 days. We found the CRI of Burkitt’s cell leukemia patients
as 35.7%, which was much higher. The intercycle interval could
be the reason for this difference, because in our study the mean
duration of all chemotherapy intercycles was longer than 25
days. It is known that men are more commonly affected by
Burkitt’s disease with a 3-4:1 ratio [7]. Similarly, in our cohort,
men were more common, with a ratio of 2.5:1.
In reported clinical trials, the prognosis for Burkitt’s lymphoma
is generally favorable, with median survivals of 75%-90% with
modern chemoimmunotherapy regimens [1,8]. An analysis of
the Surveillance Epidemiology and End Results (SEER) database
was less encouraging, however, with a 5-year OS rate of 56%
and better survival seen in younger patients with lowerrisk
disease (87% and 71% for patients aged 0-19 years and
for patients with low-risk disease, respectively) [9,10]. The
impact of age on outcomes is likely multifactorial and reflects
increased treatment toxicity or decreased treatment intensity
in older individuals, as well as the potential misclassification
of disease in this population. In our study the mean OS time
for all 25 Burkitt’s cell leukemia patients was 43.6±9.2 months.
Burkitt’s lymphoma principally involves the lymph nodes, bone
marrow, and CNS, but it may also present with peripheral blood
involvement [11]. In our study, peripheral blood involvement was
present in 66% of cases. A limitation of our study is that in the
T-ALL group DFS duration after first CR was found comparable
but OS duration was not calculable.
In conclusion, DFS in Burkitt’s cell leukemia patients treated
with a widely accepted modern regimen, R-HyperCVAD, is
comparable to that of allogeneic transplanted patients of
acute lymphoblastic leukemia. Although this study has some
disadvantages inherent to its retrospective design, use of non-
Burkitt’s control groups, and a limited patient numbers, we think
that a better comparative study design is practically impossible
due to the absence of a large transplanted Burkitt’s cohort
and ethical issues in planning a prospective study including
transplantation in these patients. Our results are in agreement
with the few prospective noncomparative studies [12,13],
284

Turk J Hematol 2016;33:281-285
Malkan ÜY, et al: The Prognosis of Adult Burkitt’s Cell Leukemia
suggesting no further need for stem cell transplantation in
Burkitt’s cell leukemia.
Ethics
Informed Consent was taken during the hospital admission of
the patients, additional Ethics Committee Approval was not
applicable based on the nature of this retrospective analysis.
Authorship Contributions
Medical Practices: Ümit Yavuz Malkan, Gürsel Güneş, Hakan
Göker, İbrahim C. Haznedaroğlu, Kadir Acar, Eylem Eliaçık,
Sezgin Etgül, Tuncay Aslan, Seda Balaban, Haluk Demiroğlu,
Osman İ. Özcebe, Nilgün Sayınalp, Salih Aksu, Yahya
Büyükaşık; Concept: Ümit Yavuz Malkan, Yahya Büyükaşık;
Design: Ümit Yavuz Malkan, Yahya Büyükaşık; Data Collection
or Processing: Ümit Yavuz Malkan, Gürsel Güneş, Hakan Göker,
İbrahim C. Haznedaroğlu, Kadir Acar, Eylem Eliaçık, Sezgin Etgül,
Tuncay Aslan, Seda Balaban, Haluk Demiroğlu, Osman İ. Özcebe,
Nilgün Sayınalp, Salih Aksu, Yahya Büyükaşık; Analysis or
Interpretation: Ümit Yavuz Malkan, Yahya Büyükaşık; Literature
Search: Ümit Yavuz Malkan; Writing: Ümit Yavuz Malkan.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Thomas DA, Faderl S, O’Brien S, Bueso-Ramos C, Cortes J, Garcia-Manero G,
Giles FJ, Verstovsek S, Wierda WG, Pierce SA, Shan J, Brandt M, Hagemeister
FB, Keating MJ, Cabanillas F, Kantarjian H. Chemoimmunotherapy with
hyper-CVAD plus rituximab for the treatment of adult Burkitt’s and
Burkitt’s-type lymphoma or acute lymphoblastic leukemia. Cancer
2006;106:1569-1580.
2. Gray RJ. A class of K-sample tests for comparing the cumulative incidence
of a competing risk. Ann Stat 1988;16:1141-1154.
3. Scrucca L, Santucci A, Aversa F. Competing risk analysis using R: an easy
guide for clinicians. Bone Marrow Transplant 2007;40:381-387.
4. Team RDC. R: A Language and Environment for Statistical Computing.
Vienna, Austria, R Foundation for Statistical Computing, 2012.
5. Hoelzer D, Walewski J, Döhner H, Schmid M, Hiddemann W, Baumann A,
Serve H, Dührsen U, Hüttmann A, Thiel E, Dengler J, Kneba M, Schuler M,
Schmidt-Wolf I, Beck J, Hertenstein B, Reichle A, Domanska-Czyz K, Fietkau
R, Horst HA, Rieder H, Schwartz S, Burmeister T, Goekbuget N. Substantially
improved outcome of adult Burkitt’s non-Hodgkin lymphoma and leukemia
patients with rituximab and a short-intensive chemotherapy; report of a
large prospective multicenter trial. Blood 2012;120:667a (abstract).
6. Intermesoli T, Rambaldi A, Rossi G, Delaini F, Romani C, Pogliani EM, Pagani
C, Angelucci E, Terruzzi E, Levis A, Cassibba V, Mattei D, Gianfaldoni G,
Scattolin AM, Di Bona E, Oldani E, Parolini M, Gökbuget N, Bassan R. High
cure rates in Burkitt’s lymphoma and leukemia: a Northern Italy Leukemia
Group study of the German short intensive rituximab-chemotherapy
program. Haematologica 2013;98:1718-1725.
7. Morton LM, Wang SS, Devesa SS, Hartge P, Weisenburger DD, Linet MS.
Lymphoma incidence patterns by WHO subtype in the United States, 1992-
2001. Blood 2006;107:265-276.
8. Magrath I, Adde M, Shad A, Venzon D, Seibel N, Gootenberg J, Neely J, Arndt
C, Nieder M, Jaffe E, Wittes RA, Horak ID. Adults and children with small
non-cleaved-cell lymphoma have a similar excellent outcome when treated
with the same chemotherapy regimen. J Clin Oncol 1996;14:925-934.
9. Castillo JJ, Winer ES, Olszewski AJ. Population-based prognostic factors
for survival in patients with Burkitt’s lymphoma: an analysis from
the Surveillance, Epidemiology, and End Results database. Cancer
2013;119:3672-3679.
10. Costa LJ, Xavier AC, Wahlquist AE, Hill EG. Trends in survival of patients with
Burkitt’s lymphoma/leukemia in the USA: an analysis of 3691 cases. Blood
2013;121:4861-4866.
11. Swerdlow SH, Campo E, Harris NL, Jaffe ES, Pileri SA, Stein H, Thiele J,
Vardiman JW. WHO Classification of Tumours of Haematopoietic and
Lymphoid Tissues. Lyon, France, IARC Press, 2008.
12. Maramattom LV, Hari PN, Burns LJ, Carreras J, Arcese W, Cairo MS, Costa
LJ, Fenske TS, Lill M, Freytes CO, Gale RP, Gross TG, Hale GA, Hamadani
M, Holmberg LA, Hsu JW, Inwards DJ, Lazarus HM, Marks DI, Maloney DG,
Maziarz RT, Montoto S, Rizzieri DA, Wirk B, Gajewski JL. Autologous and
allogeneic transplantation for Burkitt lymphoma outcomes and changes in
utilization: a report from the Center for International Blood and Marrow
Transplant Research. Biol Blood Marrow Transplant 2013;19:173-179.
13. Maruyama D, Watanabe T, Maeshima AM, Nomoto J, Taniguchi H, Azuma T,
Mori M, Munakata W, Kim SW, Kobayashi Y, Matsuno Y, Tobinai K. Modified
cyclophosphamide, vincristine, doxorubicin, and methotrexate (CODOX-M)/
ifosfamide, etoposide, and cytarabine (IVAC) therapy with or without
rituximab in Japanese adult patients with Burkitt lymphoma (BL) and B cell
lymphoma, unclassifiable, with features intermediate between diffuse large
B cell lymphoma and BL. Int J Hematol 2010;92:732-743.
285

RESEARCH ARTICLE
DOI: 10.4274/tjh.2015.0145
Turk J Hematol 2016;33:286-292
Expression Profiles of the Individual Genes Corresponding to the
Genes Generated by Cytotoxicity Experiments with Bortezomib in
Multiple Myeloma
Multipl Miyelomda Bortezomib ile Yapılan Sitotoksisite Çalışmalarında Ortaya Çıkan Genlere
Karşılık Gelen Özgün Genlerin Ekspresyon Profili
Mehdi Ghasemi 1,2 , Semih Alpsoy 1,3 , Seyhan Türk 4 , Ümit Y. Malkan 5 , Şükrü Atakan 1,2 , İbrahim C. Haznedaroğlu 5 , Gürsel Güneş 5 ,
Mehmet Gündüz 6 , Burak Yılmaz 1 , Sezgin Etgül 5 , Seda Aydın 5 , Tuncay Aslan 5 , Nilgün Sayınalp 5 , Salih Aksu 5 , Haluk Demiroğlu 5 ,
Osman İ. Özcebe 5 , Yahya Büyükaşık 5 , Hakan Göker 5
1Sentegen Biotechnology, Ankara, Turkey
2Bilkent University Faculty of Science, Department of Molecular Biology and Genetics, Ankara, Turkey
3METU Graduate School of Informatics Institute, Health Informatics Program, Clinic of Bioinformatics, Ankara, Turkey
4Hacettepe University Faculty of Pharmacy, Department of Biochemistry, Ankara, Turkey
5Hacettepe University Faculty of Medicine, Department of Internal Medicine, Division of Hematology, Ankara, Turkey
6Atatürk Training and Research Hospital, Clinic of Hematology, Ankara, Turkey
Abstract
Objective: Multiple myeloma (MM) is currently incurable due to
refractory disease relapse even under novel anti-myeloma treatment.
In silico studies are effective for key decision making during
clinicopathological battles against the chronic course of MM. The aim
of this present in silico study was to identify individual genes whose
expression profiles match that of the one generated by cytotoxicity
experiments for bortezomib.
Materials and Methods: We used an in silico literature mining
approach to identify potential biomarkers by creating a summarized
set of metadata derived from relevant information. The E-MTAB-783
dataset containing expression data from 789 cancer cell lines
including 8 myeloma cell lines with drug screening data from the
Wellcome Trust Sanger Institute database obtained from ArrayExpress
was “Robust Multi-array analysis” normalized using GeneSpring
v.12.5. Drug toxicity data were obtained from the Genomics of Drug
Sensitivity in Cancer project. In order to identify individual genes
whose expression profiles matched that of the one generated by
cytotoxicity experiments for bortezomib, we used a linear regressionbased
approach, where we searched for statistically significant
correlations between gene expression values and IC50 data. The
intersections of the genes were identified in 8 cell lines and used for
further analysis.
Results: Our linear regression model identified 73 genes and some
genes expression levels were found to very closely correlated with
bortezomib IC50 values. When all 73 genes were used in a hierarchical
Amaç: Multipl miyelom (MM) günümüzde uygulanan yeni MM
tedavilerine rağmen, refrakter hastalığın relapsı nedeniyle kür
edilemeyen bir hastalıktır. In silico çalışmalar, MM’nin kronik seyrine
karşı verilen klinikopatolojik savaşta alınan kararlar açısından oldukça
önemlidir. Buradaki in silico çalışmanın amacı, bortezomib için
yapılmış sitotoksisite çalışmalarında ortaya çıkan genlerle eşleşen
özgün genleri ortaya koymaktır.
Gereç ve Yöntemler: Biz bu çalışmada, potansiyel biyobelirteçleri
ortaya koymak için araştırma konusuna uygun bir şekilde türetilmiş
özetleyici veri seti üreterek in silico literatür taraması gerçekleştirdik.
“Wellcome Trust Sanger” enstitüsünün 8 miyelom hücre serisi de olmak
üzere toplam 789 kanser hücre serisini ilaç tarama verileriyle beraber
içeren E-MTAB-783 veri seti ArrayExpress’den elde edilip, GeneSpring
v.12.5 kullanılarak “Robust Multi-array analysis” normalize edildi. İlaç
toksisite verisi “Genomics of Drug Sensitivity in Cancer” projesinden
elde edildi. Biz bu çalışmada, eşleşen genleri saptamak amacıyla, gen
ekspresyon değerleri ve IC50 verileri arasındaki istatistiksel açıdan
anlamlı korelasyonları lineer regresyon temelli yaklaşım uygulayarak
araştırdık. Sekiz hücre serisinde gen kesişimi tespit edildi ve bu hücre
serileri ileri analiz için kullanıldı.
Bulgular: Kullandığımız lineer regresyon modeli sayesinde 73 genin
ve bazı gen ekspresyon düzeylerinin, bortezomibin IC50 değeri ile çok
yakın korelasyon gösterdiğini tespit ettik. Tüm 73 geni hiyerarşik küme
analizi ile incelediğimizde, iki ana kümede toplanan hücrelerin, görece
duyarlı ve dirençli hücreler olduğunu gördük. Bütün önemli genlerin
Öz
Address for Correspondence/Yazışma Adresi: İbrahim C. HAZNEDAROĞLU, M.D.,
Hacettepe University Faculty of Medicine, Department of Internal Medicine, Division of Hematology, Ankara, Turkey
Phone : +90 312 305 15 43
E-mail : ichaznedaroglu@gmail.com
Received/Geliş tarihi: April 02, 2015
Accepted/Kabul tarihi: February 08, 2016
286

Turk J Hematol 2016;33:286-292
Ghasemi M, et al: Identification of Individual Genes for Bortezomib
cluster analysis, two major clusters of cells representing relatively
sensitive and resistant cells could be identified. Pathway and molecular
function analysis of all the significant genes was also investigated, as
well as the genes involved in pathways.
Conclusion: The findings of our present in silico study could be
important not only for the understanding of the genomics of MM
but also for the better arrangement of the targeted anti-myeloma
therapies, such as bortezomib.
Keywords: Myeloma and other plasma cell dyscrasias, Neoplasia,
Cytogenetics, Gene therapy, Molecular hematology
moleküler yolak ve fonksiyon analizi, yolaklara dahil olan genlerle
beraber incelenmiştir.
Sonuç: Gerçekleştirdiğimiz bu in silico çalışmada ortaya konan veriler,
MM genomiğinin anlaşılması ve bortezomib gibi hedefe yönelik
miyelom tedavilerinin daha iyi yönetilebilmesi açısından önemlidir.
Anahtar Sözcükler: Miyelom ve diğer plazma hücre diskrazileri,
Neoplazi, Sitogenetik, Gen terapisi, Moleküler hematoloji
Introduction
Multiple myeloma (MM) is clinically, cytogenetically, and
molecularly a very heterogeneous complicated neoplastic
hematological disorder [1]. Numerous intra- and intercellular
interactions, soluble/membrane-bound factors, and cell cycle
machineries [2] represent potential targets of drug treatments in
patients with MM [3]. Therefore, virtual drug treatments aimed
at different targets can be explored using the computational
models. Bortezomib is a targeted therapeutic drug for MM with
high affinity, specificity, and selectivity for catalytic activity
of proteasome. Bortezomib induces apoptosis in MM, inhibits
the activation of nuclear factor-κB, suppresses survival of MM
cells, and inhibits interleukin-6 triggered MM-cell proliferation,
as well as inhibiting MM-cell adhesion in the bone marrow
microenvironment [3,4,5,6,7]. Accurate preclinical predictions
of the clinical efficacy of anti-MM drugs are needed.
MM is currently incurable due to refractory disease relapse even
under novel anti-myeloma treatment [8]. Current challenges for
the management of MM, including bortezomib drug treatment,
are resistance development to drugs, increased unsustainable
cost [9,10], lack of standardization in the therapeutic steps
including stem cell transplantation, and morbidity and
mortality due to drugs and/or ongoing resistant incurable
neoplastic myeloma disease [4,5,11,12,13]. In silico studies are
effective for key decision making during clinicopathological
battles against the chronic course of MM [3,7,14,15]. The aim
of this present in silico study is to identify individual genes
whose expression profiles match that of the one generated by
cytotoxicity experiments for bortezomib. Elucidation of the
gene expression profiles (GEP) of the proteasome inhibitors in
the pharmacobiological basis of MM is extremely important for
the clinical activity of anti-MM drugs with regards to effectivity,
safety, tolerability, toxicity, and pharmacoeconomy. The use of
predictive simulation technology seems to be vital in designing
therapeutics for targeting novel biological mechanisms using
existing or novel chemistry [16].
Materials and Methods
Public Expression and Drug Cytotoxicity Data
The myeloma cell line expression data were retrieved from
ArrayExpress (E-MTAB-783) and consisted of transcriptomic
profiles of 789 cancer cell lines from various types of cancer.
Seven myeloma cell lines (ARH-77, IM-9, LP-1, L-363, OPM-
2, RPMI-8226, and SK-MM-2) among the 789 cell lines were
selected to be used in analyses after quality control. The drug
cytotoxicity data of bortezomib, on the other hand, were
retrieved from the Genomics of Drug Sensitivity in Cancer
database of the Wellcome Trust Sanger Institute (http://www.
cancerrxgene.org).
Expression Data Preprocessing
GeneSpring software version 12.5 was used to extract raw data
and background corrected gene expression data were generated.
Further preprocessing was done using the Affy package for R
and “Robust Multi-array analysis” normalization was applied to
the data according to the Affy procedure.
In Silico Classification of Myeloma Cell Lines and Identification
of Candidate Gene Biomarkers
We used an in silico literature mining approach to identify
potential biomarkers by creating a summarized set of metadata
derived from relevant information [17,18,19]. To do that, a linear
regression model was used to discover genes whose expression
profiles correlated with bortezomib sensitivity as measured
for 7 myeloma cell lines by IC50 values from the Genomics of
Drug Sensitivity in Cancer database. All genes with a Pearson’s
correlation coefficient related p-value below 0.01 and Pearson
product-moment correlation coefficient value (r-value) higher
than 0.9 were considered as candidate biomarker genes.
Myeloma cell lines (SK-MM-2, OPM-2, U-266, RPMI-8226,
ARH-77, L-363, IM-9, and LP-1) were hierarchically clustered
based on determined biomarker genes, with Euclidian distance
measures for both genes and arrays and complete linkage,
using Cluster 3.0 software. In addition, we mapped these genes
in biological pathways by using the Protein ANalysis THrough
Evolutionary Relationships (PANTHER) classification system
tool. The gene expression levels of cell lines were correlated
with drug screening data (IC50 data) of bortezomib from the
Wellcome Trust Sanger Institute Database. Drug toxicity data
were obtained from the Genomics of Drug Sensitivity in Cancer
project (http://www.cancerrxgene.org).
287

Ghasemi M, et al: Identification of Individual Genes for Bortezomib
Turk J Hematol 2016;33:286-292
Results
In order to identify individual genes whose expression profiles
matched that of the one generated by cytotoxicity experiments
for bortezomib, we used a linear regression-based approach,
where we searched for statistically significant correlations
between gene expression values and IC50 data [17,18,19]. The
intersections of the genes were identified in 7 cell lines and
used for further analysis. IC50 values of 7 MM cell lines after 72
h of treatment with bortezomib are shown in Figure 1. In this
figure cells are sorted based on their sensitivity to bortezomib.
Our linear regression model identified 73 genes. Genes with very
good concordance between expression levels and bortezomib
IC50 values are shown in Figure 2. When all 73 genes were used
in a hierarchical cluster analysis, two major clusters of cells
representing relatively sensitive and resistant cells could be
identified, as seen in Figure 3. Pathway and molecular function
analysis of all the significant genes is shown in Figure 4. Table
1 shows the genes involved in pathways. Table 1 also presents
the families and subfamilies of these genes, suggesting that
other members of these families might have effects on and
responsibility for drug resistance. All of the proteins coded by
these genes have key roles in cancer progression and some in
metastasis.
Figure 3. Clustering of multiple myeloma cell lines based on
candidate gene biomarkers. Hierarchical clustering of myeloma
cell lines according to 73 genes whose expressions show significant
association with bortezomib chemosensitivity. Two major clusters
are demonstrable, one containing relatively resistant cells and
one containing less sensitive cells.
Figure 1. IC50 values for myeloma cell lines. As can be seen,
the most resistant cell line to bortezomib is IM-9, while OPM-2
presents the most sensitive profile.
Figure 2. The correlation between gene expression and bortezomib
IC50 values. Fifty-three genes are positively correlated with drug
resistance while the rest show negative correlations.
Figure 4. Biological pathway and molecular function analysis:
A) biological pathway analysis of the genes whose expressions
are correlated with bortezomib resistance in multiple myeloma
cell lines; B) molecular function analyses of 73 genes that show
a significant correlation with bortezomib resistance in multiple
myeloma cell lines.
288

Turk J Hematol 2016;33:286-292
Ghasemi M, et al: Identification of Individual Genes for Bortezomib
Table 1. List of genes involved in specific pathways. The genes presented in this table are outcomes of Pearson correlation analysis done by using bortezomib
chemosensitivity data and gene expression data for the multiple myeloma cell lines.
Pathway Mapped
ID
Angiogenesis
Cadherin signaling pathway
Gonadotropin releasing hormone receptor pathway
Gene Name/Gene Symbol PANTHER Family/Subfamily PANTHER Protein Class Species
FGF2 FGF2; ortholog Fibroblast growth factor 2
(PTHR11486:SF68)
Growth factor Homo sapiens
KRAS GTPase KRas; KRAS; ortholog GTPase KRAS (PTHR24070:SF186) Small GTPase Homo sapiens
CDHS Cadherin 5; CDH5; ortholog Cadherin-5 (PTHR24027:SF89) Cell junction protein; cadherin Homo sapiens
CSNK2A2 Casein kinase II subunit al pha’; CSNK2A2; ort Casein kinase II subunit alpha’
(PTHR24054:SF3)
SMAD4 Mothers against decapentaplegic homolog Mothers against decapentaplegic
homolog 4
Homo sapiens
Transcription factor Homo sapiens
GNAO1 Guanine nudeotide-binding protein G(o) subunit Guanine nucleotide-binding protein Heterotrimeric G- protein Homo sapiens
Iflammation mediated by chemokine and cytokine signaling pathway
Integrin signalling pathway
Ubiquitin
proteasome pathway
Wnt signaling pathway
FGF2: Fibroblast growth factor 2.
ARRB2 Beta-arrestin-2; ARRB2; ortholog Beta-arrestin-2 (PTHR11792:SF20) Enzyme modulator Homo sapiens
RGS4 Regulator of G protein signaling 4 Regulator of G protein signaling 4
(PTHR10845:SF40)
G protein modulator Homo sapiens
GNAO1 Guanine nucleotide binding protein G (0) subunit Guanine nucleotide binding protein Heterotrimeric G protein Homo sapiens
KRAS GTPase KRas; KRAS; ortholog GTPase KRAS (PTHR24070:SF186) Small GTPase Homo sapiens
COL1A2 Collagen alpha-2(I) chain; COL1A2; ortholog Collagen alpha- 2(I) chain
(PTHR24023:SF441)
Transporter; surfactant; receptor;
extracellular matrix
Homo sapiens
KRAS GTPase KRas; KRAS; ortholog GTPase KRAS (PTHR24070:SF186) Small GTPase Homo sapiens
PSMD8 26S proteasome non- ATPase regulatory subunit 26S Proteasome non-atpase regulatory Enzyme modulator Homo sapiens
ARRB2 Beta-arrestin-2; ARRB2; ortholog Beta-arrestin-2 (PTHR11792:SF20) Enzyme modulator Homo sapiens
CDHS Cadherin 5; CDH5; ortholog Cadherin-5 (PTHR24027:SF89) Cell junction
protein; cadherin
SMAD4 Mothers against decapentaplegic omolog Mothers against decapentaplegic
homolog 4
CSNK2A2 Casein kinase II subunit al pha’; CSNK2A2; ort Casein kinase II subunit alpha’
(PTHR24054:SF3)
Homo sapiens
Transcription factor Homo sapiens
Homo sapiens
289

Ghasemi M, et al: Identification of Individual Genes for Bortezomib
Turk J Hematol 2016;33:286-292
Discussion
In this in silico study, the hierarchical clustering of myeloma cell
lines according to bortezomib hemosensitivity biomarker genes
has been described. The heat map represented the clustering of 8
myeloma cell lines based on 73 genes disclosing either bortezomib
resistance or less sensitive myeloma cells. Likewise, the concordances
between gene expression and IC50 values of 8 myeloma cell lines
are shown for 73 genes. Furthermore, the relevant biological
pathway analyses of the genes whose expressions are concordant
with bortezomib cytotoxicity were explored via the molecular
functional analyses of the 73 genes (Figures 2, 3, and 4). The genes
involved in specific pathways regarding the proteasome inhibitors,
and particularly bortezomib, are related to the critical pathological
events of MM such as tumor angiogenesis and neoplastic signaling
pathways (cadherin, integrin, Wnt, GnRH, ubiquitin), as well as
chemokine-mediated inflammation (Table 1). Those pathways
are essentially important in the biology of myeloma, such as the
ubiquitin proteasome system, which plays a role in the regulation
of most cellular pathways, and its deregulation in MM represents a
target for proteasome inhibition via bortezomib [20]. Proliferation
and apoptosis pathways are pathologically regulated by the
ubiquitin-proteasome system, resulting in cellular neoplastic
transformation in MM [21]. Targeting pathological angiogenesis
in MM via bortezomib may delay tumor growth and reduce
cytokine paracrine loops mediated by angiogenic factors [22].
Meanwhile, the signal transducers and activators of transcription
proteins represent a family of cytoplasmic transcription factors
that regulate a pleiotropic range of biological processes in MM
[23]. Cell-cell interactions and cancer-initiating cells further
complicate the biology of MM [24]. A previous study, in accordance
with our present results, examined gene ontogeny related to
bortezomib and suggested involvement in cellular development
and carcinogenesis [25].
In the present study, by performing in silico correlation analysis,
we determined genes whose expressions are correlated with
bortezomib chemosensitivity in MM cell lines. Among 73
genes that are highly correlated with drug-resistant response
(absolute Pearson r-value of >0.80), 20 genes showed a reverse
correlation with chemosensitivity to bortezomib. This means that
overexpression of these genes makes cancer cells more sensitive
to bortezomib and the expressions of these genes are associated
with good prognosis. Conversely, 53 genes are positively correlated
to bortezomib response and make cells more resistant to drug
treatment, and overexpression of these genes is associated with
poor prognosis (supplementary data). We also tried to determine
the pathways in which these genes are involved and figure out
the relation between outcome and MM drug resistance profile by
using another classification system. The PANTHER classification
system was designed to classify proteins and their genes in order to
facilitate high-throughput analysis. Proteins have been classified
according to family and subfamily, molecular function, biological
process, and pathway. Further in vitro and clinical validation studies
are needed to determine and validate the exact role of each gene
or panel of genes that are suggested in the present study as gene
biomarkers for bortezomib-resistant response in MM cancer.
In 2007 Mulligan et al. assessed the feasibility of prospective
pharmacogenomics research in multicenter international clinical
trials of bortezomib in MM [26]. They tried to highlight those genes
whose expressions are related to drug response and survival using
bone marrow clinical samples by performing gene set enrichment
analysis, analysis of clinical response, and overall survival analysis.
The present study has two main differences from that study in
terms of genomic approach and databases used. Our database
came from established MM cell lines and the genomic approach
was analysis of correlations between gene expression and drug
response. Despite the two different approaches, we can see that
many genes in this study and in that of Mulligan et al. overlap. On
the other hand, our analysis shows some other genes that are able
to predict response to bortezomib.
Cancer cell lines have a notable role in cancer drug discovery.
Jaeger et al. found that drug sensitivity in cancer cell lines is not
tissue-specific and recommended that, to get the most trustable
results using cell lines, it will be necessary to include those cell
lines’ molecular characteristics [27]. Similarly, in this experiment we
did integrate those data into biological analysis, such as pathway
analysis and hierarchical clustering.
The overall results of the present data mining study reveal the
complicated nature of MM [28] and locate the drug bortezomib at
the critical crossroads of the pathobiology of the disease, driving
the clinical course of MM. For instance, the LP-1 cell line was
found to be resistant to bortezomib in our present study (Figure
3). A previous study suggested that the expression of Apaf-1 might
be predictive of the response to proteasome inhibition [29]. Based
on our present results, patients with MM mimicking the molecular
profile/behavior of LP-1 at any clinical evaluation point during the
long-term clinical course of MM will be candidates for therapeutic
regimens other than bortezomib. Ideally, those multiresistant
MM patients should be single- or multiple-transplanted based
on individual clinical responses [14]. We intend to test these
hypotheses in future experiments designed to examine genomic
profiles of the biological samples obtained from our MM patient
cohort.
The results of our present study represent the rational basis
for future molecular studies dealing with biological myeloma
samples (peripheral blood and/or bone marrow) obtained from
‘real-life’ patients with MM. This issue is not just academically
important since the proper selection of anti-myeloma drugs
in everyday clinical practice during the long-term incurable
advanced clinical forms of MM is challenging even to the
most skilled clinicians. Randomized clinical trials (RCTs) usually
compare drugs but do not decide on treatment strategies and
proper selection of drug combinations [30], particularly for
290

Turk J Hematol 2016;33:286-292
Ghasemi M, et al: Identification of Individual Genes for Bortezomib
the handicapped myeloma patients with already present organ
toxicities that are usually excluded from RCTs [12,13,31]. For reallife
myeloma clinics, the pharmacobiological profile of the antimyeloma
drug together with the resistance profile [32] should
be determined with the corresponding pathobiology of the MM
disease course. This molecular approach could be particularly
important for making decisions about hematopoietic stem cell
transplantation for MM [14].
MM is a very heterogeneous disease [1]. Genetic changes could play
a major role in prognosis in MM. However, in contrast to leukemias,
no “good-risk” abnormalities have been described. Molecular
analyses using GEP dissected the genetic basis of MM. Although
various GEP-based signatures have been reported to identify highrisk
myeloma disease and predict prognosis, the inability of GEP to
predict clinical response in MM is also evident [1].
Barlogie et al., Shaughnessy et al., and Shaughnessy et al. showed
the advantages of using GEP data to elucidate the molecular basis
of resistance to chemotherapy as well as classification of MM
patients in terms of poor prognosis and risk of relapse [33,34,35].
In this study, we determined those genes whose expressions are in
correlation with bortezomib using GEP data.
Khin et al. generated patient-individualized estimations of initial
response to chemotherapeutic agents in MM and time to relapse
[36]. They designated an experimental platform with the specific
intent of generating experimental parameters for a computational
clinical model of personalized therapy in MM, while taking into
consideration the limitations of working with patient primary
cells and the need to incorporate elements of the myeloma tumor
microenvironment. They suggested that myeloma patient-specific
computational models, parameterized by in vitro platforms,
could be combined with genomic datasets to better understand
drug resistance in MM. Wang et al. developed a computational
model of MM-bone marrow microenvironment interactions and
clarified that intercellular signaling mechanisms implemented in
this model appropriately drive MM disease progression [37]. Our
findings in the present study also indicated that an understanding
of the genomic myeloma dynamics might be useful for predictions
of disease prognosis, as well as for proposing better therapeutic
strategies for each patient with MM.
Bortezomib is able to induce tumor cell death by degradation of
key proteins. It is employed as a first-line treatment in relapsed or
resistant MM patients. However, bortezomib often induces a doselimiting
toxicity in the form of painful sensory neuropathy, which
can mainly be reduced by subcutaneous administration or dose
modification. Richardson et al. showed that some of the genes
that are shown to related to bortezomib resistancy in the present
study are also interestingly related to bortezomib-associated
neurotoxicity [38]. It is suggested that those genes are involved in
the pathways that control toxicity and resistancy [26,38].
The findings of our present in silico study could be important
not only for the understanding of the genomics of MM but also
for the better arrangement of targeted anti-myeloma therapies,
such as bortezomib. Improvement in the understanding of MM
pathogenesis will refine the molecular dissection of the disease,
especially in the context of novel anti-myeloma drugs affecting
the disease course. Genomics, proteomics, transcriptomics, and
metabolomics studies (in silico, in vitro, in vivo) should be integrated
to understand their significance in the management of MM, as
well as to offer better therapeutics and treatment strategies to
patients with MM.
Ethics
Ethics Committee Approval: The research was performed in an in
silico setting. Therefore, evaluation of the ethics committee was
not required; Informed Consent: N/A.
Authorship Contributions
Concept: Mehdi Ghasemi, Semih Alpsoy, Seyhan Türk, Ümit Y.
Malkan, Şükrü Atakan, İbrahim C. Haznedaroğlu, Gürsel Güneş,
Mehmet Gündüz, Burak Yılmaz, Sezgin Etgül, Seda Aydın, Tuncay
Aslan, Nilgün Sayınalp, Salih Aksu, Haluk Demiroğlu, Osman İ.
Özcebe, Yahya Büyükaşık, Hakan Göker; Design: Mehdi Ghasemi,
Semih Alpsoy, Seyhan Türk, Ümit Y. Malkan, Şükrü Atakan, İbrahim
C. Haznedaroğlu, Gürsel Güneş, Mehmet Gündüz, Burak Yılmaz,
Sezgin Etgül, Seda Aydın, Tuncay Aslan, Nilgün Sayınalp, Salih
Aksu, Haluk Demiroğlu, Osman İ. Özcebe, Yahya Büyükaşık, Hakan
Göker; Data Collection or Processing: Mehdi Ghasemi, Semih
Alpsoy, Seyhan Türk, Ümit Y. Malkan, Şükrü Atakan, İbrahim C.
Haznedaroğlu, Gürsel Güneş, Mehmet Gündüz, Burak Yılmaz,
Sezgin Etgül, Seda Aydın, Tuncay Aslan, Nilgün Sayınalp, Salih Aksu,
Haluk Demiroğlu, Osman İ. Özcebe, Yahya Büyükaşık, Hakan Göker;
Analysis or Interpretation: Mehdi Ghasemi, Semih Alpsoy, Seyhan
Türk, Ümit Y. Malkan, Şükrü Atakan, İbrahim C. Haznedaroğlu, Gürsel
Güneş, Mehmet Gündüz, Burak Yılmaz, Sezgin Etgül, Seda Aydın,
Tuncay Aslan, Nilgün Sayınalp, Salih Aksu, Haluk Demiroğlu, Osman
İ. Özcebe, Yahya Büyükaşık, Hakan Göker; Literature Search: Mehdi
Ghasemi, Semih Alpsoy, Seyhan Türk, Ümit Y. Malkan, Şükrü Atakan,
İbrahim C. Haznedaroğlu, Gürsel Güneş, Mehmet Gündüz, Burak
Yılmaz, Sezgin Etgül, Seda Aydın, Tuncay Aslan, Nilgün Sayınalp,
Salih Aksu, Haluk Demiroğlu, Osman İ. Özcebe, Yahya Büyükaşık,
Hakan Göker; Writing: Mehdi Ghasemi, Semih Alpsoy, Seyhan Türk,
Ümit Y. Malkan, Şükrü Atakan, İbrahim C. Haznedaroğlu, Gürsel
Güneş, Mehmet Gündüz, Burak Yılmaz, Sezgin Etgül, Seda Aydın,
Tuncay Aslan, Nilgün Sayınalp, Salih Aksu, Haluk Demiroğlu, Osman
İ. Özcebe, Yahya Büyükaşık, Hakan Göker.
Conflict of Interest: The authors of this paper have no conflicts of
interest, including specific financial interests, relationships, and/or
affiliations relevant to the subject matter or materials included.
References
1. Corre J, Munshi N, Avet-Loiseau H. Genetics of multiple myeloma: another
heterogeneity level? Blood 2015;125:1870-1876.
2. Liu YH, Bi JX, Zeng AP, Yuan JQ. A population balance model describing the cell
cycle dynamics of myeloma cell cultivation. Biotechnol Prog 2007;23:1198-1209.
291

Ghasemi M, et al: Identification of Individual Genes for Bortezomib
Turk J Hematol 2016;33:286-292
3. Wang Y, Lin B. In silico investigations of potential anabolic treatments in
multiple myeloma-induced bone disease. Bone 2013;55:132-149.
4. Merin NM, Kelly KR. Clinical use of proteasome inhibitors in the treatment of
multiple myeloma. Pharmaceuticals (Basel) 2014;8:1-20.
5. Möller J, Nicklasson L, Murthy A. Cost-effectiveness of novel relapsed-refractory
multiple myeloma therapies in Norway: lenalidomide plus dexamethasone vs
bortezomib. J Med Econ 2011;14:690-697.
6. Niewerth D, Jansen G, Assaraf YG, Zweegman S, Kaspers GJ, Cloos J. Molecular
basis of resistance to proteasome inhibitors in hematological malignancies.
Drug Resist Updat 2015;18:18-35.
7. Sung MH, Simon R. In silico simulation of inhibitor drug effects on nuclear
factor-κB pathway dynamics. Mol Pharmacol 2004;66:70-75.
8. Su J, Zhang L, Zhang W, Choi DS, Wen J, Jiang B, Chang CC, Zhou X. Targeting the
biophysical properties of the myeloma initiating cell niches: a pharmaceutical
synergism analysis using multi-scale agent-based modeling. PLoS One
2014;9:e85059.
9. Brown RE, Stern S, Dhanasiri S, Schey S. Lenalidomide for multiple myeloma:
cost-effectiveness in patients with one prior therapy in England and Wales. Eur
J Health Econ 2013;14:507-514.
10. Saret CJ, Winn AN, Shah G, Parsons SK, Lin PJ, Cohen JT, Neumann PJ. Value of
innovation in hematologic malignancies: a systematic review of published costeffectiveness
analyses. Blood 2015;125:1866-1869.
11. Arikian SR, Milentijevic D, Binder G, Gibson CJ, Hu XH, Nagarwala Y, Hussein
M, Corvino FA, Surinach A, Usmani SZ. Patterns of total cost and economic
consequences of progression for patients with newly diagnosed multiple
myeloma. Curr Med Res Opin 2015;31:1105-1115.
12. Serefhanoglu S, Haznedaroglu IC, Goker H, Buyukasik Y, Ozcebe OI. Multiple
bulky cutaneous plasmacytomas with CNS relapse without bone marrow
involvement during the course of a lambda light chain myeloma. Onkologie
2009;32:662-664.
13. Serefhanoglu S, Sayinalp N, Haznedaroglu IC, Goker H, Cetiner D, Aksu S,
Buyukasik Y, Ozcebe OI. Extramedullary plasmacytomas of the thyroid and
pericardium as initial presentation of multiple myeloma. Ann Hematol
2008;87:853-854.
14. Dingli D, Pacheco JM, Dispenzieri A, Hayman SR, Kumar SK, Lacy MQ, Gastineau
DA, Gertz MA. In vivo and in silico studies on single versus multiple transplants
for multiple myeloma. Cancer Sci 2007;98:734-739.
15. Wang Y, Lin B. In silico investigations of the anti-catabolic effects of
pamidronate and denosumab on multiple myeloma-induced bone disease. PLoS
One 2012;7:e44868.
16. Doudican NA, Mazumder A, Kapoor S, Sultana Z, Kumar A, Talawdekar A, Basu
K, Agrawal A, Aggarwal A, Shetty K, Singh NK, Kumar C, Tyagi A, Singh NK,
Darlybai JC, Abbasi T, Vali S. Predictive simulation approach for designing cancer
therapeutic regimens with novel biological mechanisms. J Cancer 2014;5:406-
416.
17. Garnett MJ, Edelman EJ, Heidorn SJ, Greenman CD, Dastur A, Lau KW, Greninger
P, Thompson IR, Luo X, Soares J, Liu Q, Iorio F, Surdez D, Chen L, Milano RJ,
Bignell GR, Tam AT, Davies H, Stevenson JA, Barthorpe S, Lutz SR, Kogera F,
Lawrence K, McLaren-Douglas A, Mitropoulos X, Mironenko T, Thi H, Richardson
L, Zhou W, Jewitt F, Zhang T, O’Brien P, Boisvert JL, Price S,Hur W, Yang W, Deng
X, Butler A, Choi HG, Chang JW, Baselga J, Stamenkovic I, Engelman JA, Sharma
SV, Delattre O, Saez-Rodriguez J, Gray NS, Settleman J, Futreal PA, Haber DA,
Stratton MR, Ramaswamy S, McDermott U, Benes CH. Systematic identification
of genomic markers of drug sensitivity in cancer cells. Nature 2012;483:570-
575.
18. Mi H, Muruganujan A, Thomas PD. PANTHER in 2013: modeling the evolution of
gene function, and other gene attributes, in the context of phylogenetic trees.
Nucleic Acids Res 2013;41:D377-386.
19. Thomas PD, Kejariwal A, Guo N, Mi H, Campbell MJ, Muruganujan A, Lazareva-
Ulitsky B. Applications for protein sequence-function evolution data: mRNA/
protein expression analysis and coding SNP scoring tools. Nucleic Acids Res
2006;34:W645-650.
20. Landre V, Rotblat B, Melino S, Bernassola F, Melino G. Screening for E3-ubiquitin
ligase inhibitors: challenges and opportunities. Oncotarget 2014;5:7988-8013.
21. Zuo J, Bi C, Fan Y, Buac D, Nardon C, Daniel KG, Dou QP. Cellular and
computational studies of proteasome inhibition and apoptosis induction
in human cancer cells by amino acid Schiff base-copper complexes. J Inorg
Biochem 2013;118:83-93.
22. Silva AS, Gatenby RA. Adaptation to survival in germinal center is the initial step
in onset of indolent stage of multiple myeloma. Mol Pharm 2011;8:2012-2020.
23. Page BD, Croucher DC, Li ZH, Haftchenary S, Jimenez-Zepeda VH, Atkinson J,
Spagnuolo PA, Wong YL, Colaguori R, Lewis AM, Schimmer AD, Trudel S, Gunning
PT. Inhibiting aberrant signal transducer and activator of transcription protein
activation with tetrapodal, small molecule Src homology 2 domain binders:
promising agents against multiple myeloma. J Med Chem 2013;56:7190-7200.
24. Peng T, Peng H, Choi DS, Su J, Chang CC, Zhou X. Modeling cell-cell interactions
in regulating multiple myeloma initiating cell fate. IEEE J Biomed Health Inform
2014;18:484-491.
25. Nagji AS, Cho SH, Liu Y, Lee JK, Jones DR. Multigene expression-based predictors
for sensitivity to Vorinostat and Velcade in non-small cell lung cancer. Mol
Cancer Ther 2010;9:2834-2843.
26. Mulligan G, Mitsiades C, Bryant B, Zhan F, Chng WJ, Roels S, Koenig E, Fergus A,
Huang Y, Richardson P, Trepicchio WL, Broyl A, Sonneveld P, Shaughnessy JD Jr,
Bergsagel PL, Schenkein D, Esseltine DL, Boral A, Anderson KC. Gene expression
profiling and correlation with outcome in clinical trials of the proteasome
inhibitor bortezomib. Blood 2007;109:3177-3188.
27. Jaeger S, Duran-Frigola M, Aloy P. Drug sensitivity in cancer cell lines is not
tissue-specific. Mol Cancer 2015;14:40.
28. Uz B, Tatonyan SÇ, Sayitoğlu M, Erbilgin Y, Hatırnaz O, Aksu S, Büyükaşık Y,
Sayınalp N, Göker H, Ozcebe Oİ, Ozbek U, Haznedaroğlu IC. Local reninangiotensin
system in normal hematopoietic and multiple myeloma-related
progenitor cells. Turk J Haematol 2014;31:136-142.
29. Ottosson-Wadlund A, Ceder R, Preta G, Pokrovskaja K, Grafström RC, Heyman
M, Söderhäll S, Grandér D, Hedenfalk I, Robertson JD, Fadeel B. Requirement
of apoptotic protease-activating factor-1 for bortezomib-induced apoptosis
but not for Fas-mediated apoptosis in human leukemic cells. Mol Pharmacol
2013;83:245-255.
30. Usmani SZ, Lonial S. Novel drug combinations for the management of
relapsed/refractory multiple myeloma. Clin Lymphoma Myeloma Leuk
2014;14(Suppl):S71-77.
31. Kocabeyoglu S, Mocan MC, Haznedaroglu IC, Uner A, Uzunosmanoglu E, Irkec
M. In vivo confocal microscopic characteristics of crystalline keratopathy
in patients with monoclonal gammopathy: report of two cases. Indian J
Ophthalmol 2014;62:938-940.
32. Peng H, Peng T, Wen J, Engler DA, Matsunami RK, Su J, Zhang L, Chang CC,
Zhou X. Characterization of p38 MAPK isoforms for drug resistance study using
systems biology approach. Bioinformatics 2014;30:1899-1907.
33. Barlogie B, Anaissie E, van Rhee F, Pineda-Roman M, Zangari M, Shaughnessy J,
Epstein J, Crowley J. The Arkansas approach to therapy of patients with multiple
myeloma. Best Pract Res Clin Haematol 2007;20:761-781.
34. Shaughnessy JD Jr, Qu P, Usmani S, Heuck CJ, Zhang Q, Zhou Y, Tian E, Hanamura
I, van Rhee F, Anaissie E, Epstein J, Nair B, Stephens O, Williams R, Waheed
S, Alsayed Y, Crowley J, Barlogie B. Pharmacogenomics of bortezomib testdosing
identifies hyperexpression of proteasome genes, especially PSMD4,
as novel high-risk feature in myeloma treated with Total Therapy 3. Blood
2011;118:3512-3524.
35. Shaughnessy JD, Zhan F, Huang Y, Barlogie B. In vivo changes in gene expression
profiles (GEP) after bortezomib (V) for multiple myeloma (MM): differential
effects on plasma cells (PC) and micro-environment (ME). J Clin Oncol
2006;24:7603 (abstract).
36. Khin ZP, Ribeiro ML, Jacobson T, Hazlehurst L, Perez L, Baz R, Shain K, Silva
AS. A preclinical assay for chemosensitivity in multiple myeloma. Cancer Res
2014;74:56-67.
37. Wang Y, Pivonka P, Buenzli PR, Smith DW, Dunstan CR. Computational modeling
of interactions between multiple myeloma and the bone microenvironment.
PLoS One 2011;6:e27494.
38. Richardson PG, Sonneveld P, Schuster MW, Irwin D, Stadtmauer EA, Facon T,
Harousseau JL, Ben-Yehuda D, Lonial S, Goldschmidt H, Reece D, San-Miguel JF,
Bladé J, Boccadoro M, Cavenagh J, Dalton WS, Boral AL, Esseltine DL, Porter JB,
Schenkein D, Anderson KC; Assessment of Proteasome Inhibition for Extending
Remissions (APEX) Investigators. Bortezomib or high-dose dexamethasone for
relapsed multiple myeloma. N Engl J Med 2005;352:2487-2498.
292

RESEARCH ARTICLE
DOI: 10.4274/tjh.2015.0087
Turk J Hematol 2016;33:293-298
The Effect of Hyperparathyroid State on Platelet Functions and
Bone Loss
Hiperparatiroidi Durumun Trombosit Fonksiyonları ve Kemik Kaybı Üzerine Olan Etkisi
Göknur Yorulmaz 1 , Aysen Akalın 2 , Olga Meltem Akay 3 , Garip Şahin 4 , Cengiz Bal 5
1Eskişehir State Hospital, Clinic of Endocrinology, Eskişehir, Turkey
2Eskişehir Osmangazi University Faculty of Medicine, Department of Endocrinology, Eskişehir, Turkey
3Eskişehir Osmangazi University Faculty of Medicine, Department of Hematology, Eskişehir, Turkey
4Eskişehir Osmangazi University Faculty of Medicine, Department of Nephrology, Eskişehir, Turkey
5Eskişehir Osmangazi University Faculty of Medicine, Department of Biostatistics and Medical Informatics, Eskişehir, Turkey
Abstract
Objective: Coagulation and fibrinolysis defects were reported in
primary hyperparathyroid patients. However, there are not enough
data regarding platelet functions in this group of patients. Our aim
was to evaluate the platelet functions in primary and secondary
hyperparathyroid patients and to compare them with healthy subjects.
Materials and Methods: In our study 25 subjects with primary
hyperparathyroidism (PHPT), 25 subjects with secondary
hyperparathyroidism (SHPT), and 25 healthy controls were included.
Platelet functions of the subjects were evaluated by using plateletrich
plasma and platelet aggregation tests induced with epinephrine,
adenosine diphosphate (ADP), collagen, and ristocetin. Serum P
selectin levels, which indicate platelet activation level, were measured
in all subjects. Bone mineral densitometry was performed for all
patients.
Results: There was no significant difference between the groups
with PHPT and SHPT and the control group regarding the platelet
aggregation tests and serum P selectin levels. There was also no
significant correlation between parathormone levels and aggregation
parameters (ristocetin, epinephrine, collagen, and ADP: respectively
p=0.446, 0.537, 0.346, and 0.302) and between P selectin (p=0.516)
levels. When we separated the patients according to serum calcium
levels, there was also no significant difference between aggregation
parameters and serum P selectin levels between the patients with
hypercalcemia and the patients with normocalcemia. We could not
find any significant correlation between aggregation parameters, P
selectin levels, and serum calcium levels in this group of patients.
Bone loss was greater in patients with PHPT.
Conclusion: There is no significant effect of PHPT or SHPT and serum
calcium levels on platelet functions when evaluated by aggregation
tests.
Keywords: Hyperparathyroidism, Platelet function, P selectin,
Calcium, Bone loss
Öz
Amaç: Koagülasyon ve fibrinoliz bozuklukları primer hiperparatiroidili
hastalarda rapor edilmekle beraber bu hasta grubunda trombosit
işlevlerine ilişkin yeterli veri yoktur. Bu nedenle primer ve sekonder
hiperparatiroidisi olan hastalarda ve sağlıklı kontrol grubunda
trombosit fonksiyonlarını değerlendirmeyi ve gruplar arasında farkı
karşılaştırmayı amaçladık.
Gereç ve Yöntemler: Çalışmamıza 25 primer hiperparatiroidisi
(PHPT) olan hasta, 25 sekonder hiperparatiroidisi (SHPT) olan hasta
ve 25 kontrol grubu dahil edildi. Trombosit fonksiyonları trombositten
zengin plazma ve epinefrin, adenozin difosfat (ADP), kollajen ve
ristosetinle trombosit agregasyon testleri yapılarak değerlendirildi.
Trombosit aktivasyon düzeyini gösteren serum P selektin düzeyleri
tüm hastalarda ölçüldü. Kemik mineral dansitometresi tüm hastalarda
değerlendirildi.
Bulgular: PHPT ve SHPT’li hastalar ve kontrol grubunun trombosit
fonksiyon testleri ve serum P selektin düzeyleri arasında istatistiksel
açıdan anlamlı bir fark saptanmadı. Parathormon düzeyi ile agregasyon
parametreleri (ristosetin, epinefrin, kollajen, ve ADP: sırasıyla p=0,446,
0,537, 0,346 ve 0,302) ve P selektin (p=0,516) düzeyi arasında da
anlamlı bir korelasyon saptanmadı. Hastalar kalsiyum düzeylerine
göre hiperkalsemik ve normokalsemik olarak ayrıldıklarında da
agregasyon parametreleri ve P selektin düzeyleri arasında anlamlı fark
saptanmadı. Hasta gruplarımızda trombosit fonksiyonları, P selektin
düzeyi, serum kalsiyum düzeyileri arasında istatistiksel açıdan anlamlı
fark bulunmadı. Kemik kaybı PHPT’li olan grupta daha belirgindi.
Sonuç: Agregasyon testleri ile değerlendirildiğinde PHPT veya SHPT ve
serum kalsiyum düzeylerinin trombosit fonksiyonları üzerine belirgin
etkisi yoktur.
Anahtar Sözcükler: Hiperparatiroidism, Trombosit fonksiyonları, P
selektin, Kalsiyum, Kemik kaybı
Address for Correspondence/Yazışma Adresi: Göknur YORULMAZ, M.D.,
Eskişehir State Hospital, Clinic of Endocrinology, Eskişehir, Turkey
Phone : +90 505 866 58 83
E-mail : goknuryorulmaz@hotmail.com
Received/Geliş tarihi: February 20, 2015
Accepted/Kabul tarihi: June 15, 2015
293

Yorulmaz G, et al: Hyperparathyroidism and Platelet Functions
Turk J Hematol 2016;33:293-298
Introduction
Hemostasis is regulated by a balance between stimulators and
inhibitors of platelet functions. The deterioration of the balance
between inhibitors and stimulators of platelet functions results
in thrombosis or bleeding. Platelets are involved in primary
hemostasis, which includes the formation of a plug by the
adhesion and activation of platelets in response to vascular
damage or the loss of integrity of the vascular wall. Many
physiological stimuli can activate platelets both in vivo and in
vitro, such as collagen, proteolytic enzymes, and low-molecularweight
compounds. Clinically platelet functions are evaluated
by platelet aggregation and activation tests [1,2]. The use of
platelet agonists such as collagen, adenosine diphosphate (ADP),
epinephrine, and ristocetin triggers classical platelet response
and a great deal of information can be obtained from platelet
aggregation. P selectin is a membrane glycoprotein within
platelets and endothelial cells that is mobilized to the plasma
membrane following cell activation and it is used to evaluate
platelet activation [3,4].
It is well known that primary hyperparathyroidism (PHPT) is
associated with a high risk of cardiovascular disease and increased
mortality and morbidity related to cardiovascular problems
[5,6,7]. There are also studies that relate hyperparathyroidism
with a potential tendency toward hypercoagulation [8,9].
There are some cases of thrombotic events seen in the course
of hyperparathyroidism [10]. However, knowledge about
the effects of hyperparathyroidism on platelet functions is
unsatisfactory and conflicting. Whereas elevated parathormone
(PTH) levels and hypercalcemia are significant features of PHPT,
PTH elevation does not accompany hypercalcemia in secondary
hyperparathyroidism (SHPT). There are studies investigating
the effect of serum calcium levels on platelet aggregation,
coagulation, and thromboelastography in healthy people [11].
However, it is not clear whether hyperparathyroidism disturbs
platelet function and if so whether it is related to the high PTH
levels per se or to the accompanying hypercalcemia.
In this study we aimed to evaluate platelet functions in patients
with both PHPT and SHPT.
Materials and Methods
Twenty-five subjects with PHPT, 25 subjects with SHPT, and
25 healthy age-matched control subjects were included in the
study. The diagnosis of PHPT was based on clinical assessment
and laboratory findings. Parathyroid adenomas were shown in
all of the PHPT patients on both parathyroid ultrasound and
99m
technetium scans of the parathyroids. Elevated PTH levels in the
case of normal or low serum calcium level, vitamin D deficiency,
and decreased urinary calcium excretion were regarded as signs
of SHPT. Twenty-five healthy age- and sex-matched subjects with
normal values of biochemical parameters were used as controls.
The purpose and the procedure of the tests were explained to
the subjects and written informed consent was obtained from
each participant. The experimental protocol was designed and
performed according to the principles of the Declaration of
Helsinki and it was approved by the Ethics Committee of the
Eskişehir Osmangazi University Medical Faculty.
Serum calcium, phosphorus, albumin, chloride, and creatinine
levels were measured for each of the subjects. Serum intact PTH
was measured from venous blood samples at a central laboratory
using a solid-phase two-site chemiluminescent enzyme-labeled
immunometric assay with a reference range of 15-65 pg/
mL. Serum calcium, phosphorus, and creatinine levels were
measured colorimetrically. Serum albumin levels were measured
by immunoturbidimetric assay and serum creatinine levels were
measured by using an ion-selective electrode. Twenty-four
hour urine collections were used in order to calculate urinary
calcium excretion rates. Creatinine clearance (Ccr) levels were
calculated according to the Cockroft-Gault formula. Patients
with serum creatinine level above 1.2 mg/dL or Ccr level below
70 mL/min were not included in the study in order to exclude
the confounding effects of renal failure on platelet functions.
Tubular reabsorption of phosphate was calculated as TRP=[1-
(up/pp)x(pcr/ucr)]x100.
Platelet functions of the subjects were evaluated by using
platelet-rich plasma and platelet aggregation tests with
epinephrine, ADP, collagen, and ristocetin. Serum P selectin
levels, which indicate platelet activation level, were also
measured in all subjects. Groups were matched with respect to
age. Exclusion criteria included patients with known bleeding
or other systemic disorders such as hepatic and endocrine
diseases, acute infections, autoimmune disorders, or cancer, and
a platelet count of less than 150x10 9 /L or more than 450x10 9 /L
and a hemoglobin level of less than 10 g/dL. The patients did
not receive agents that could affect platelet functions such as
acetylsalicylic acid, ticlopidine, dipyridamole, or nonsteroidal
antiinflammatory drugs in the 10 days prior to the platelet
aggregation studies.
Sample Collection and Laboratory Methods
Citrated blood was collected under light tourniquet through
19-gauge needles into 4.5-mL vacutainers (Becton Dickinson,
USA) containing 3.2% trisodium citrate in a 9:1 blood/
anticoagulant ratio. The collection was performed early in the
morning after overnight fasting. Samples for blood counts
were drawn into Becton Dickinson anticoagulated tubes and
complete counts were made with a Beckman Coulter Gen-S
SM (USA) automated blood counting device. Coagulation
tests were performed with an ACL TOP Coagulation Analyzer
(Instrumentation Laboratory, USA). Prothrombin time (PT) was
measured with a HemosIL RecombiPlasTin kit (Instrumentation
294

Turk J Hematol 2016;33:293-298
Yorulmaz G, et al: Hyperparathyroidism and Platelet Functions
Laboratory), activated partial thromboplastin time (aPTT) was
measured with a HemosIL SynthASil kit (Instrumentation
Laboratory), and fibrinogen was measured with a HemosIL
Fibrinogen-C XL kit (Instrumentation Laboratory). The normal
ranges for these tests in our laboratory are: aPTT, 24-36 s; PT,
8-13 s; and fibrinogen, 200-400 mg/dL.
Platelet aggregation studies were performed with a whole blood
lumi-aggregometer (Model 540-Ca, Chrono-log Corporation,
USA) using an optical method according to the manufacturer’s
instructions. Whole-blood specimens were centrifuged for
10 min at 200xg to obtain platelet-rich plasma. Plateletpoor
plasma was obtained from the remaining specimens by
recentrifugation at 200xg for 15 min. A platelet count was
performed on the platelet-rich plasma and was adjusted to
300x10 3 /µL with platelet-poor plasma. Next, 450 µL of this
platelet-rich plasma was transferred into cuvettes (Chronolog
No: P/N 312), each containing a disposable siliconized bar.
After agonist addition, platelet aggregation was measured over
6 min and expressed as a percentage of the maximal amplitude
in platelet-rich plasma. The agonists used and their final
concentrations were: ADP (Chrono Par 384), 5 µM; collagen
(Chrono Par 385), 2 µg/mL; ristocetin (Chrono Par 396), 1.25 mg/
mL; and epinephrine (Chrono Par 393), 5 µM. A commercially
available ELISA method was used to determine serum P selectin
levels (BBE6 catalog number, R&D Systems, USA). All analyses
were performed in duplicate, and the mean value was used
for statistical calculations. The levels of osteocalcin (2-22 ng/
mL) and deoxypyridinoline (2.3-5.4 nM DPD/mM creatine) were
measured. The bone mineral densitometry of the patients was
studied and T scores were evaluated.
All statistical analysis was performed using SPSS 15 and
SigmaStat 3.5. The distibution of variables was checked initially
by Shapiro-Wilk test. Parametric tests were applied to data having
normal distribution. Comparisons between 2 different groups
were assessed by independent t-test and changes of variables
within groups were assessed by paired samples t-test. Pearson
correlation analysis was used to evaluate the relationships
between variables. P<0.05 was accepted as indicating statistical
significance. Results are given as mean ± SD.
Results
Basic characteristics of the study population are shown in
Table 1. PTH levels of the patients with primary and SHPT were
significantly higher than those of the control group (p<0.01).
Serum calcium levels of the patients with PHPT were higher than
those of both the patients with SHPT and the control group, as
expected (p<0.001). There was no significant difference between
hematological parameters such as hemoglobin, leukocyte and
platelet counts, and PT levels among the groups. PTT and D-dimer
levels were higher in patients with SHPT (Tables 1 and 2).
Patients with primary and SHPT are compared in Tables 1 and
3. PTH, serum calcium, urinary calcium excretion, and chloride/
phosphorus ratios were higher in patients with PHPT when
compared with SHPT (p<0.001). Tubular phosphate levels
were low in patients with PHPT (p<0.001). When bone mineral
densitometries were evaluated, femur neck bone density was
lower in patients with PHPT (p<0.05). Osteocalcin levels were
higher in patients with PHPT (p<0.001).
Platelet functions of the patients with primary and SHPT and
the control group are shown in Table 2. Platelet functions
evaluated by platelet aggregation induced by epinephrine, ADP,
collagen, and ristocetin were not statistically different from
each other. There was also no significant difference of P selectin
levels among the groups. There was no significant correlation
between either PTH or P selectin levels and platelet aggregation
parameters.
Table 1. Baseline characteristics and serum laboratory parameters of the study population.
Baseline Characteristics and
Laboratory Parameters
PHPT, n=25 SHPT, n=25 Controls, n=25 p
Age 57.2±12.9 54.3±11.6 49.6±17.9 NS
Hemoglobin (g/dL) 13.11±1.4 13.02±1.55 13.2±1.68 NS
Leukocytes (x10 3 /mL) 6072±1706 6996±1430 7004±1510 NS
Platelets (x10 3 /µL) 237±36 239±60 243±60 NS
PTH (pg/mL) 178 (105-431) 131 (112-177) 31 (38-58) <0.01 (1-3, 2-3)
Calcium (mg/dL) 11.18±0.71 9.4±0.56 9.59±0.4 <0.01 (1-2, 1-3)
Phosphorus (mg/dL) 2.2±0.52 3.1±0.58 3.3±0.69 <0.001 (1-2, 1-3)
Chloride/phosphorus 46.7 (40.7-53.2) 31.4 (34.5-37.8) 29.9 (32.2-33.4) <0.001 (1-2, 1-3)
Urine calcium 360 (255-476) 62 (35-110) - <0.001 (1-2)
Tubular phosphate reabsorption (%) 70 (56-85) 85 (78-92) - <0.001 (1-2)
C cr (mL/min) 96±21.3 96.8±37.28 - NS (1-2)
PHPT: Primary hyperparathyroidism, SHPT: secondary hyperparathyroidism, C cr : creatinine clearance, NS: nonsignificant.
295

Yorulmaz G, et al: Hyperparathyroidism and Platelet Functions
Turk J Hematol 2016;33:293-298
Patients with primary and SHPT were divided into two groups
according to serum calcium levels (Table 4). The first group
included the patients with serum calcium levels equal to or
higher than 10.5 mg/dL and the second group included the
patients with serum calcium levels lower than 10.5 mg/dL.
There was no significant difference between the two groups in
respect to platelet aggregation studies induced by epinephrine,
ADP, collagen, and ristocetin. P selectin levels also did not
differ significantly between the groups. We could not find
any significant correlation between aggregation parameters,
P selectin levels, and serum calcium levels in this group of
patients. Statistical values did not differ when serum calcium
corrected for serum albumin level was used.
Discussion
Recent studies suggest that hyperparathyroidism has many
systemic effects other than those on bone and mineral
metabolism. PTH excess is strongly associated with prevalent
and incident cardiovascular risk factors such as hypertension,
diabetes, and cardiovascular diseases. There is also evidence
connecting adverse cardiovascular outcomes, including death
and incident coronary artery disease and myocardial infarction,
to PTH excess [6,12,13,14]. Two biochemical features of
hyperparathyroidism, namely elevated PTH levels and elevated
serum calcium levels, may be implicated with those adverse
outcomes. Although there are some studies suggesting that
severe PHPT could impair vascular compliance and PTH rather
than serum calcium levels being the casual factor, it is still
uncertain which of the parameters is the main offending
mediator in those circumstances [15].
Abnormalities in coagulation and fibrinolysis pathways have
also been detected in PHPT, mostly supported by small casecontrol
studies, and the evidence is still conflicting [8,9].
There are some case reports of thrombotic events associated
with PHPT in which high serum calcium is accused of being
a causative factor. In those cases, renal vein thrombosis and
dermal necrosis due to thrombosis were encountered during the
course of hyperparathyroidism [10,16,17]. Thrombotic events
were reported also in SHPT [17]. The high incidence of vascular
thrombosis seen in patients with hyperparathyroidism may
represent a potential for hypercoagulation and may explain the
increased cardiovascular morbidity in those patients.
In an early study on this topic, bovine PTH was shown in vitro to
inhibit platelet aggregation and activation strongly [18]. Later,
however, another study showed that platelet functions were
not affected by synthetically manufactured PTH. The irregular
platelet functions in the previous study were attributed by the
authors to the additives used during the preparation of the
bovine PTH [19].
In symptomatic primary hyperparathyroid patients, significantly
higher plasma levels of tissue plasminogen activator and lower
Table 2. Platelet aggregation studies and P selectin levels of the patients and the control group.
Platelet Aggregation Parameters and P
Selectin Levels
PHPT, n=25 SHPT, n=25 Controls, n=25 p
Ristocetin (ohm) 93.0 (84.2-101.25) 96.0 (84.25-101.25) 98 (92-103) NS
Epinephrine (ohm) 92.0 (83-106) 99 (92.8-105) 100 (90.5-103) NS
Collagen (ohm) 96 (89.5-100.3) 98 (98-100.3) 99 (97-104) NS
ADP (ohm) 95 (90.5-109) 99 (93.7-104.3) 104 (95-108) NS
Serum P selectin (ng/mL) 31.4 (23.6-38.3) 31.2 (24.4-38.6) 29.2 (20.9-36.6) NS
PT (s) 10.78 (11.2-11.5) 10.85 (11.3-11.9) 10.7 (11.0-11.2) NS
aPTT (s) 28.6±3.14 28.99±2.85 27.0±2.24 <0.05 (2-3)
Fibrinogen (mg/dL) 319±52 297±93 290±59 NS
D-dimer (µg/dL) 99.75 (129-180.7) 128 (170-262.2) 65.6 (109-210.5) <0.05 (2-3)
PT: Prothrombin time, PTT: partial thromboplastin time, PHPT: primary hyperparathyroidism, SHPT: secondary hyperparathyroidism, ADP: adenosine diphosphate, NS: nonsignificant.
Table 3. Comparison of bone mineral densitometry values, osteocalcin, and urine deoxypyridinoline levels of patients with
primary hyperparathyroidism and secondary hyperparathyroidism.
BMD Areas, Osteocalcin, and Urine Deoxypyridinoline Levels PHPT, n=25 SHPT, n=25 p
L 1-4 -3.19 (-3.6 to 1.92) -2.1 (-3.3 to 1.42) NS
Femur neck -2.2 (-3.23 to 1.49) -1.8 (-2.5 to 0.94) <0.05
Osteocalcin (2-22 ng/mL) 8.1 (5.4-10.3) 3.4 (1.57-5.09) <0.01
Urine deoxypyridinoline (2.3-5.4 nM DPD/mM creatine) 7.0 (6.0-10.7) 8.7 (5.5-25.5) NS
BMD: Bone mineral densitometry, NS: nonsignificant, PHPT: primary hyperparathyroidism, SHPT: secondary hyperparathyroidism, femur neck and L 1-4 (lumbar), T score.
296

Turk J Hematol 2016;33:293-298
Yorulmaz G, et al: Hyperparathyroidism and Platelet Functions
Table 4. Platelet functions of the patients classified according to serum calcium levels.
Platelet Aggregation Parameters and P Selectin
Levels
Serum Calcium ≥10.5 mg/dL, n=22 Serum Calcium <10.5 mg/dL, n=28 p
Platelet aggregation - - -
Ristocetin (%) 88.90±23.90 91.85±17.31 NS
Epinephrine (%) 92.95±16.57 95.64±17.55 NS
Collagen (%) 97.72±13.02 89.75±23.82 NS
ADP (%) 103.04±19.92 96.96±10.84 NS
Serum P selectin (ng/m) 35.10±20.80 32.40±10.02 NS
ADP: Adenosine diphosphate, NS: nonsignificant.
platelet activator inhibitor-1 (PAI-1) and tissue factor pathway
inhibitor F levels compared to controls matched for age, sex, and
body mass index were reported. Elevated PAI-1 levels found in
patients with PHPT were proposed to be the causative factor for
the tendency to thromboembolic events by lowering fibrinolytic
activity. Those findings were suggested to represent a potential
hypercoagulable and hypofibrinolytic state [9]. Increased
platelet count, higher activities of factor VII and IX, and increased
levels of D-dimer were also found in PHPT patients compared to
healthy controls [8]. In another study, a positive relationship
was found between PTH and PAI-1 levels in patients with
PHPT without manifest cardiovascular disease [20]. However,
hemostatic and fibrinolytic disorders of hyperparathyroidism
are very rarely studied fields of research in the literature and
there are not enough data on this subject. Platelet functions
induced by ristocetin, ADP, collagen, and epinephrine were not
studied in hyperparathyroid patients before and there is no
study to date evaluating P selectin levels in hyperparathyroid
patients. Moreover, all the studies evaluating the fibrinolysis
and coagulation cascades were performed in patients with PHPT
and do not indicate whether the elevated PTH levels or the high
calcium levels were responsible for the results.
In our study, we could not find any significant differences among
groups regarding platelet activation and aggregation studies.
There was no significant correlation between PTH levels and
aggregation parameters or serum P selectin levels. According
to these results we concluded that primary and SHPT did not
notably affect platelet functions. In this respect, this is the first
study to show platelet aggregation and activation levels in both
primary and SHPT. Contrary to the mentioned studies, D-dimer
levels were higher in patients with SHPT, which make us think
that high levels of PTH may cause a trend toward thrombosis
independent of calcium levels. Another result of our study
shows that lumbar and femoral bone loss was more pronounced
in patients with PHPT. According to other studies bone mineral
densitometry is decreased in hyperparathyroidism, and after
parathyroidectomy bone mineral densitometry improves [21].
However, platelet functions could be affected by the levels
of serum calcium of the patients independently of PTH levels.
Therefore, we also evaluated the patients by separating the
patients according to their serum calcium levels and compared
the platelet functions of the patients with high serum
calcium levels (≥10.5 mg/dL) with the patients with normal
serum calcium levels (<10.5 mg/dL). Hypercalcemia almost
always accompanies PHPT, but patients with SHPT are usually
normocalcemic. Calcium levels are known to play a key role
in the regulation of platelet functions. In a previous study,
the effects of extracellular calcium concentrations on platelet
aggregation, coagulation, and thromboelastography were
studied in vitro in blood samples collected from healthy subjects
[11]. In that study it was shown that high calcium levels could
inhibit platelet aggregation, coagulation factor activity, and
blood coagulation; the level of calcium found to affect platelet
functions was ≥15 mg/dL [11]. In our study, we could not show
any significant difference regarding platelet aggregation studies
and serum P selectin levels between the patients with high and
normal serum calcium levels. We concluded that serum calcium
levels did not significantly alter platelet functions. However, it
is possible that our findings might be related to the fact that
our patients’ average calcium levels were not as high as in the
previous study. In our patient group the highest serum calcium
level was 12.4 mg/dL, and when corrected according to serum
albumin level, this reached 13.9 mg/dL at most. Moreover, in
the previous study, in vitro calcium levels were used. In another
study mean platelet volume was used to evaluate thrombocyte
activation in patients with PHPT and platelet activation was
found to be increased [22]. However, mean platelet volume is
not a valuable measure for platelet activation.
In conclusion, in this study we showed that platelet aggregation
did not change in either primary or SHPT. However, since we did
not study platelet aggregation inhibition, we cannot say clearly
with the existing data whether there is a tendency toward
thrombosis or not in hyperparathyroidism.
Ethics
Ethics Committee Approval: Eskişehir Osmangazi University
Ethics Committee 29 May 2009 (approval number: 11); Informed
Consent: It was taken.
297

Yorulmaz G, et al: Hyperparathyroidism and Platelet Functions
Turk J Hematol 2016;33:293-298
Authorship Contributions
Medical Practices: Göknur Yorulmaz; Concept: Göknur Yorulmaz,
Aysen Akalın; Design: Göknur Yorulmaz, Aysen Akalın, Olga
Meltem Akay; Data Collection or Processing: Göknur Yorulmaz,
Aysen Akalın, Olga Meltem Akay, Garip Şahin, Cengiz Bal;
Analysis or Interpretation: Göknur Yorulmaz, Aysen Akalın, Olga
Meltem Akay, Garip Şahin; Literature Search: Göknur Yorulmaz,
Aysen Akalın, Olga Meltem Akay, Garip Şahin, Cengiz Bal;
Writing: Göknur Yorulmaz, Aysen Akalın, Olga Meltem Akay,
Garip Şahin, Cengiz Bal.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Shebuski RJ, Kilgore KS. Role of inflammatory mediators in thrombogenesis.
J Pharmacol Exp Ther 2002;300:729-735.
2. Hayward CP, Pai M, Liu Y, Moffat KA, Seecharan J, Webert KE, Cook RJ,
Heddle NM. Diagnostic utility of light transmission platelet aggregometry:
results from a prospective study of individuals referred for bleeding disorder
assessments. J Thromb Haemost 2009;7:676-684.
3. Rand ML, Leung R, Packham MA. Platelet function assays. Transfus Apher
Sci 2003;28:307-317.
4. Zucker MB, Nachmias VT. Platelet activation. Arteriosclerosis 1985;5:2-18.
5. Hedback G, Tisell LE, Bengtsson BA, Hedman I, Oden A. Premature death in
patients operated on for PHPT. World J Surg 1990;14:829-835.
6. Hedback G, Oden A. Increased risk of death from primary hyperparathyroidism:
an update. Eur J Clin Invest 1998;28:271-276.
7. Stefenelli T, Mayr H, Berger-Klein J, Globits S, Wolosczcuk W, Niederle B.
Primary hyperparathyroidism: incidence of cardiac abnormalities and partial
reversibility after successful parathyroidectomy. Am J Med 1993;95:197-202.
8. Erem C, Kocak M, Hacihasanoglu A, Yilmaz M, Saglam F, Ersoz HO.
Blood coagulation, fibrinolysis and lipid profile in patients with primary
hyperparathyroidism: increased plasma factor VII and X activities and
D-dimer levels. Exp Clin Endocrinol Diabetes 2008;116:619-624.
9. Erem C, Kocak M, Nuhoglu I, Yilmaz M, Ucuncu O. Increased plasma activator
inhibitor-1, decreased tissue factor pathway inhibitor, and unchanged
thrombin-activatable fibrinolysis inhibitor levels in patients with primary
hyperparathyroidism. Eur J Endocrinol 2009;160:863-868.
10. Franchello A, Camandona M, Gasparri G. Acute hyperparathyroidism and
vascular thrombosis: an unrecognized association. J Endocrinol Invest
2010;33:683.
11. Li ZL, Chen XM, Yang LC, Deng XL, Fu SH, Cai LL, Zhou Y, Chen J, Bai J, Cong
YL. Effects of extracellular calcium concentration on platelets aggregation,
coagulation indices and thromboelastography. Zhonghua Yi Xue Za Zhi
2010;90:1547-1550.
12. Anderson JL, Vanwoerkum R, Horne BD, Bair TL, May HT, Lappe DL,
Muhlestein JB. Parathyroid hormone, vitamin D, renal dysfunction, and
cardiovascular disease: dependent or independent risk factors? Am Heart J
2011;162:331-339.
13. Han D, Trooskin S, Wang X. Prevalence of cardiovascular risk factors in male
and female patients with primary hyperparathyroidism. J Endocrinol Invest
2012;35:548-552.
14. Kiernan TJ, O’Flynn AM, McDermott JH, Kearney P. Primary
hyperparathyroidism and the cardiovascular system. Int J Cardiol
2006;113:E89-92.
15. Walker MD, Fleischer J, Rundek T, McMahon DJ, Homma S, Sacco R, Silverberg
SJ. Carotid vascular abnormalities in primary hyperparathyroidism. J Clin
Endocrinol Metab 2009;94:3849-3856.
16. Smallman LA. Renal vein thrombosis complicating primary
hyperparathyroidism. Postgrad Med J 1982;58:441-442.
17. Huertas VE, Maletz RM, Weller JM. Dermal necrosis due to thrombosis in
severe secondary hyperparathyroidism. Arch Intern Med 1976;136:712-716.
18. Remuzzi G, Benigni A, Dodesini P, Schieppati A, Livio M, Poletti E, Mecca
G, de Gaetano G. Parathyroid hormone inhibits human platelet function.
Lancet 1981;12:1321-1323.
19. Leithner C, Kovarik J, Sinzinger H, Woloszcuk W. Parathyroid hormone does
not inhibit platelet aggregation. Lancet 1984;18:367-368.
20. Chertok-Shacham E, Ishay A, Lavi I, Luboshitzky R. Biomarkers of
hypercoagulability and inflammation in primary hyperparathyroidism. Med
Sci Monit 2008;14:628-632.
21. Sitges-Serra A, García L, Prieto R, Peña MJ, Nogués X, Sancho JJ. Effect
of parathyroidectomy for primary hyperparathyroidism on bone mineral
density in postmenopausal women. Br J Surg 2010;97:1013-1019.
22. Yilmaz H. Assessment of mean platelet volume (MPV) in primary
hyperparathyroidism: effects of successful parathyroidectomy on MPV
levels. Endocr Regul 2014;48:182-188.
298

RESEARCH ARTICLE
DOI: 10.4274/tjh.2015.0271
Turk J Hematol 2016;33:299-303
Warfarin Dosing and Time Required to Reach Therapeutic
International Normalized Ratio in Patients with Hypercoagulable
Conditions
Hiperkoagülabilite Durumları Olan Hastalarda Terapötik Uluslararası Düzeltme Oranına
Ulaşmak için Gerekli Warfarin Doz ve Süresi
Pushpinderdeep Kahlon 1 , Shahzaib Nabi 1 , Adeel Arshad 2 , Absia Jabbar 3 , Ali Haythem 4
1Wayne State University, Henry Ford Health System, Clinic of Internal Medicine, Detroit, USA
2Weill Cornell University, Hamad Medical Corporation, Clinic of Internal Medicine, Doha, Qatar
3Nishtar Hospital, University of Health Science, Multan, Pakistan
4Wayne State University, Henry Ford Health System, Clinic of Hematology-Oncology, Detroit, USA
Abstract
Objective: The purpose of this study was to analyze the difference in
duration of anticoagulation and dose of warfarin required to reach a
therapeutic international normalized ratio [(INR) of 2 to 3] in patients
with hypercoagulable conditions as compared to controls. To our
knowledge, this study is the first in the literature to delineate such
a difference.
Materials and Methods: A retrospective chart review was performed
in a tertiary care hospital. The total study population was 622.
Cases (n=125) were patients with a diagnosis of a hypercoagulable
syndrome who developed venous thromboembolism. Controls (n=497)
were patients with a diagnosis of venous thromboembolism in the
absence of a hypercoagulable syndrome and were matched for age,
sex, and race.
Results: The total dose of warfarin required to reach therapeutic INR
in cases was higher (50.7±17.6 mg) as compared to controls (41.2±17.7
mg). The total number of days required to reach therapeutic INR in
cases was 8.9±3.5 days as compared to controls (6.8±2.9 days). Both
of these differences were statistically significant (p<0.001).
Conclusion: Patients with hypercoagulable conditions require
approximately 10 mg of additional total warfarin dose and also
require, on average, 2 extra days to reach therapeutic INR as compared
to controls.
Keywords: International normalized ratio, Warfarin, Hypercoagulable
conditions, Venous thromboembolism
Öz
Amaç: Bu çalışmanın amacı kontrollerle karşılaştırıldığında
hiperkoagülabilite durumları olan hastalarda terapötik uluslararası
düzeltme oranında (INR) 2 ile 3 aralığına ulaşmak için gerekli warfarin
doz ve antikoagülan süresindeki farklılığı analiz etmektir. Bildiğimiz
kadarıyla; bu farklılığı tarifleyen literatürdeki ilk çalışmadır.
Gereç ve Yöntemler: Retrospektif dosya taraması 3. basamak
hastanede yapıldı. Toplam çalışmaya alınan hasta sayısı 622 idi. Venöz
tromboembolizmi olan bu hastalardan 125’inin hiperkoagülabilite
sendromu olup yaş, cins ve etnik kökeni aynı 497 kontrol hastasında
hiperkoagülabilite sendromu yoktu.
Bulgular: Hastalarda terapötik INR’ye ulaşmak için gerekli total
warfarin dozu (50,7±17,6 mg) kontrollerin dozu (41,2±17,7 mg) ile
karşılaştırıldığında yüksekti. Terapötik INR’ye ulaşmak için gerekli
total gün sayısı hastalarda 8,9±3,5 gün olup kontrollerde 6,8±2,9 gün
idi. Her iki karşılaştırmada da istatistiksel farklılık anlamlı bulundu
(p<0,001).
Sonuç: Hiperkoagülabilite durumları olan hastalarda terapötik INR’ye
ulaşmak için kontrollere göre yaklaşık 10 mg ek total warfarin dozu ve
ortalama 2 ek gün gereklidir.
Anahtar Sözcükler: Uluslararası düzeltme oranı, Warfarin,
Hiperkoagülabilite durumları, Venöz tromboembolizm
Address for Correspondence/Yazışma Adresi: Shahzaib NABİ, M.D.,
Wayne State University, Henry Ford Health System, Clinic of Internal Medicine, Detroit, USA
Phone : +1-313-482-8768
E-mail : shahzaib.nabi@ucdenver.edu
Received/Geliş tarihi: July 14, 2015
Accepted/Kabul tarihi: October 06, 2015
299

Kahlon P, et al: Therapeutic International Normalized Ratio in Hypercoagulable Conditions
Turk J Hematol 2016;33:299-303
Introduction
It has been well documented that both acquired and
hypercoagulable conditions play an important role in
thrombophilia development. Studies suggest that important
genetic factors that have notable significance include factor
V Leiden mutation, prothrombin gene mutation, deficiency
of protein S or protein C, antithrombin III deficiency, and
hyperhomocysteinemia. Acquired hypercoagulability factors
include non-modifiable factors, such as age and antiphospholipid
antibodies, and modifiable factors, such as pregnancy, oral
contraceptive and hormone replacement therapy, recent travel,
and obesity, as well other factors such as malignancy, recent
surgery, trauma, and prolonged immobility [1].
Once a patient develops venous thromboembolism (VTE), the
main mode of treatment has been warfarin, with recent advent
of newer medications such as rivaroxaban [2]. Warfarin still
remains one of the most commonly used medications for VTE in
the United States. Previously there have been a few studies that
have investigated warfarin dosing in specific hypercoagulable
conditions, such as antiphospholipid antibodies and highversus
low-intensity warfarin efficacy in recurrent deep vein
thrombosis (DVT) prevention [3]. However, it is not known if a
difference exists in the total dose and time of warfarin therapy
necessary to reach a therapeutic international normalized ratio
(INR) in patients with hypercoagulable conditions. The goal of
this study was to determine the difference in the time and dose
of warfarin required to reach therapeutic INR (i.e. INR of 2 to
3) in patients with hypercoagulable conditions as compared to
controls.
Materials and Methods
The study was approved by our institutional review board. A
retrospective chart review was performed for patients seen in our
tertiary care facility from January 2002 to December 2012. The
inclusion criteria for cases were patients with hypercoagulable
conditions, which included patients with factor V Leiden
mutation, prothrombin gene mutation, protein S or protein
C deficiency, antithrombin III deficiency, dysfibrinogenemia,
and antiphospholipid antibodies who developed unprovoked
VTE (DVT, pulmonary embolism, or both). The diagnostic tests
used were venous duplex for DVT and computed tomography
angiogram or ventilation/perfusion lung scan for pulmonary
embolism. Controls were age-, sex-, and race-matched patients
who developed VTE but did not have a hypercoagulable
syndrome. Confounding factors were assessed in both cases and
controls and included end-stage renal disease, malignancies,
recent surgery (within 1 month of development of VTE), and
oral contraceptive use. Therapeutic INR was defined as an INR of
2-3 on 2 consecutive blood draws separated by a 24-h duration.
All subjects received an initial 5-mg loading dose of warfarin
and all of them received heparin at the time of diagnosis of VTE
(bridging therapy). The total dose of warfarin required to reach
a therapeutic INR and the number of days required to reach a
therapeutic INR were analyzed.
Statistical analysis with a primary aim of comparing cases to
controls was performed. Data were described using standard
descriptive statistics, i.e. counts, percentages, means, and
standard deviations. Crude (unadjusted) odds ratios were
obtained from univariate logistic regression models. All variables
with a univariate p-value of <0.2 were placed in a multivariable
logistic regression and stepwise selection with stay criteria
of p≤0.05 were used to arrive at a final model. Statistical
significance was set at p<0.05 and all analyses were performed
using SAS 9.4 (SAS Institute Inc., Cary, NC, USA).
Results
A total of 622 patients were analyzed in this study. Of these,
125 were cases and 497 were controls. The mean age at the time
of diagnosis of VTE in both cases and controls was 53 years. In
all, 58% of the patients were female. The male to female ratios
for both the cases and controls were roughly the same. The
most common race was Caucasian (59%), followed by African
American (32%); other races constituted 9% of the total study
population. Among the patient population, 39% developed a
DVT, 42% developed a pulmonary embolism, and 18% developed
both a DVT and a pulmonary embolism.
The total number of days required to reach therapeutic INR was
8.9±3.5 days in cases, whereas in controls it was 6.8±2.9 days.
The difference was found to be statistically significant (p<0.001).
The total dose of warfarin required to reach therapeutic INR
was 50.7±17.6 mg in cases as compared to 41.2±17.7 mg in
controls. The difference remained statistically significant after
multivariate regression analysis (p<0.001).
A multivariable model was built starting with all variables with
a univariate p-value of <0.2. Stepwise selection was then used
to arrive at the final model given in Table 1. We found that
every 1-day increase in the number of days to therapeutic INR
was associated with 19% increased odds of being a case, and
every 1-unit increase in warfarin dose to therapeutic INR was
associated with 1% increased odds of being a case.
Discussion
For the last 60 years, warfarin has been the mainstay of
management of thromboembolism in a variety of both
hereditary and acquired conditions [4]. Even with its narrow
therapeutic index, meticulous monitoring, dire adverse effects,
and interactions with an array of foods, drugs, and herbs,
warfarin is still the most widely used oral anticoagulant in
North America with over 25 million prescriptions in the United
States in 2010 [4,5].
300

Turk J Hematol 2016;33:299-303
Kahlon P, et al: Therapeutic International Normalized Ratio in Hypercoagulable Conditions
Warfarin acts by interfering with the enzyme vitamin K epoxide
reductase, which modulates the gamma carboxylation of
procoagulant factors II, VII, IX, and X and anticoagulant proteins
C, S, and Z [6]. Because of the latter action, warfarin has the
potential of exerting a transient procoagulant effect early in
therapy. To counter that, heparin ‘bridging’ is recommended for
a minimum of 5 days and until the INR is 2.0 or above for at least
24 h [7]. As the antithrombotic effect of warfarin necessitates
the inhibition of factor II, which has a very long half-life (60-72
h) as compared to other factors (6-24 h), it takes approximately
6 days for warfarin to exert its full efficacy even though the
earliest changes in INR can be seen after 24 to 36 h [8,9,10,11].
The average number of days to achieve therapeutic INR after
starting warfarin is reported to be 5-6 days [12].
Selection of an appropriate dose for warfarin initiation
is challenging and controversial because of interpersonal
variability in its pharmacokinetic and pharmacodynamic
parameters. Kovacs et al. found that patients who were initiated
with 10 mg of warfarin achieved therapeutic INR 1.4 days earlier
than those who received 5 mg [13]. One study concluded that
initiation with 5 mg of warfarin was associated with 5.6 days of
bridging with low-molecular-weight heparin [14]. The American
College of Chest Physicians recommends initiation with 10 mg
in patients healthy enough to be treated as outpatients, with
dose modifications done as per the INR after 2 days [7]. From a
practical point of view, adjusting the warfarin dose to achieve
and maintain therapeutic INR is a challenging task that we
face regularly during our day-to-day clinical encounters. A
myriad of factors lead to this commonly observed interpatient
variation in the warfarin dose requirement and number of days
required to achieve the therapeutic INR. Our study compared
these 2 variables in patients with and without hypercoagulable
conditions. We found that patients with hypercoagulable
conditions on average require higher doses and more days
to achieve the target INR as compared to those without any
hypercoagulable conditions. To our knowledge, this study is one
of the first in the literature to delineate such a difference.
Table 1. Patient characteristics along with univariate and multivariate analysis.
Variable Response Cases (n=125) Controls
(n=497)
Univariate
Analysis
OR (95% CI)
p-value
Age Mean ± SD 60.4±15.0 60.5±16.0 1.00 (0.98, 1.01) 0.939
Sex
Race
VTE
Age at time of
VTE
Cancer
End-stage renal
disease
Surgery
Antibiotics
Oral
contraceptive
pills
Total days to
therapeutic INR
Total dose to
therapeutic INR
Male
Female
55 (44%)
70 (56%)
72 (58%)
Caucasian
Other 1 15 (12%)
African American 38 (30%)
DVT
PE
Both
44 (35%)
53 (42%)
28 (22%)
207 (42%)
290 (58%)
293 (59%)
160 (32%)
44 (9%)
201 (40%)
211 (42%)
85 (17%)
1.10 (0.74, 1.64) 0.634
1.04 (0.67, 1.60)
1.44 (0.72, 2.85)
0.66 (0.39, 1.14)
0.76 (0.45, 1.29)
0.556
0.326
Mean ± SD 53.0±14.9 53.5±15.0 0.99 (0.98, 1.01) 0.747
No
Yes
No
Yes
No
Yes
No
Yes
No
Yes
122 (98%)
3 (2%)
122 (98%)
3 (2%)
118 (94%)
7 (6%)
102 (82%)
23 (18%)
122 (98%)
3 (2%)
450 (91%)
47 (9%)
489 (98%)
8 (2%)
371 (75%)
126 (25%)
407 (82%)
90 (18%)
478 (96%)
19 (4%)
Mean ± SD 8.9±3.5 (5.4 to 12.4) 6.8±2.9
(3.9 to 9.7)
Mean ± SD 50.7±17.6 (33.1 to 68.3) 41.2±17.7
(23.5 to 58.9)
Multivariate
Analysis
OR (95% CI)
p-value
0.24 (0.07, 0.77) 0.009 0.26 (0.08, 0.87) 0.029
1.50 (0.39, 5.75) 0.549
0.18 (0.08, 0.38) <0.001 0.13 (0.06, 0.31) <0.001
1.02 (0.61, 1.69) 0.940
0.62 (0.18, 2.12) 0.441
1.22 (1.15, 1.29) <0.001 1.19 (1.10, 1.28) <0.001
1.03 (1.02, 1.04) <0.001 1.01 (1.00, 1.03) 0.034
1 All other races except Caucasian and African American, SD: Standard deviation, VTE: venous thromboembolism, INR: international normalized ratio, CI: confidence interval, OR: odds
ratio, DVT: deep vein thrombosis.
301

Kahlon P, et al: Therapeutic International Normalized Ratio in Hypercoagulable Conditions
Turk J Hematol 2016;33:299-303
As described earlier, other factors might also affect the variables
under study, which could have been potential confounders in
our study. The elderly and females require a smaller weekly
dose of warfarin than their counterparts. Even though there
are no convincing data, it is generally preferred that the elderly
be started on a low-dose warfarin regimen because of the
exaggeration of anticoagulation response in this age group [15].
One of the strongest and statistically significant patient-specific
factors that can influence the warfarin dose requirement is the
concomitant use of drugs that affect cytochrome P450 (17.2 mg
additional dosage of warfarin per week) [16]. From antibiotics
to anticonvulsants, ginger to ginseng, and spinach to spices,
a tiring list of drugs, herbs, and foods is reported to interact
with warfarin by multiple mechanisms, which can involve its
absorption, bioavailability, metabolism, and excretion. Recent
surgery was also assessed as a variable in this study. It should be
noted that surgeries are generally considered to be transiently
hypercoagulable states. Surgeries involving lower extremities
(such as hip/knee replacement) carry the highest risk of VTE and
should be managed carefully in patients with hypercoagulable
states.
Even though not recommended for general testing, genetic
mutations can lead to variations in the dosage requirement of
warfarin among different patients, which ultimately affects
the number of days required to achieve the therapeutic INR.
Polymorphism in the VKORC1 gene, which codes for the target
enzyme for warfarin, results in 2 haplotypes: A, which makes
the patient sensitive to smaller doses, and B, which necessitates
administration of higher doses to achieve and maintain the same
range of INR. The Asp36Tyr missense mutation in VKORC1, found
in 15% of the Ethiopian population in one study, was strongly
associated with a warfarin requirement of >70 mg/week. On the
other hand, CYP2C9 (and less commonly CYP1A1, CYPCA1, and
CYP3A4), which metabolizes the more potent enantiomer of the
warfarin molecule, has been found to have 2 relatively common
variant forms with reduced activity (CYP2CP*2 and CYP2C9*3).
Patients with these variants have less rapid clearance of warfarin,
thus requiring lower dosage administrations [17]. In one study,
VKORC1 was significantly associated with the time required to
achieve the first therapeutic INR while CYP2C9 predicted the
time to reach an INR above 4, which predisposes the patient to
hemorrhagic complications [18,19].
Gene polymorphisms are found to be more common in
African Americans than Asians and Caucasians, which affects
the number of days and the dose needed to achieve the first
target INR. Other patient-specific factors that can affect the
variables under study include body mass index/body surface
area (especially height), poor compliance, comorbid conditions,
and true warfarin resistance, which is a quite rare occurrence
(0.01%) [19].
The major limitation of this study is that it was a single-center,
retrospective study and the results might not be applicable to the
general population. Moreover, our ‘cases’ group was relatively
small, likely secondary to the rarity of the above-mentioned
hypercoagulable conditions. However, to compensate for this
relatively small sample size, we used a large ‘control’ group to
increase the power of the study. Every effort was made during
data collection to avoid bias as much as possible.
Conclusion
In summary, this study lays the foundation of a novel idea
of comparing warfarin dosage and the time required to
achieve therapeutic INR in patients with and without known
hypercoagulability conditions. The likely mechanism of the
observed difference is inherent thrombogenic potential in
hypercoagulable states with more natural resistance towards
anticoagulation. With a few confounders playing a role, this
proposition needs further consolidation with large-scale trials
that might help us in predicting the initial dose to start with
in patients with and without a procoagulant condition. The
observed effect can, in another way, be studied retrospectively
to understand the difference in the pathophysiology of the
thromboembolism in these 2 populations, which may explain
the etiological aspects of the results noticed.
Acknowledgment
We would like to acknowledge the great efforts of our
exceptionally hard-working librarian, Stephanie Stebens, who
helped us in the final editing of this manuscript. Her suggestions
played a huge role in finalizing this manuscript.
Ethics
Ethics Committee Approval: The study was approved by the IRB/
Ethics Committee; Informed Consent: Was not needed as this
was a retrospective chart review.
Authorship Contributions
Concept: Pushpinderdeep Kahlon, Shahzaib Nabi, Adeel Arshad,
Absia Jabbar, Ali Haythem; Design: Pushpinderdeep Kahlon,
Shahzaib Nabi, Adeel Arshad, Absia Jabbar, Ali Haythem; Data
Collection or Processing: Shahzaib Nabi and Pushpinderdeep
Kahlon; Analysis or Interpretation: Pushpinderdeep Kahlon,
Shahzaib Nabi, Adeel Arshad, Absia Jabbar, Ali Haythem;
Literature Search: Pushpinderdeep Kahlon, Shahzaib Nabi, Adeel
Arshad, Absia Jabbar, Ali Haythem; Writing: Pushpinderdeep
Kahlon, Shahzaib Nabi, Adeel Arshad, Absia Jabbar, Ali Haythem.
Conflict of Interest: The authors of this paper have no conflicts of
interest, including specific financial interests, relationships, and/
or affiliations relevant to the subject matter or materials included.
302

Turk J Hematol 2016;33:299-303
Kahlon P, et al: Therapeutic International Normalized Ratio in Hypercoagulable Conditions
References
1. Varga EA, Kujovich JL. Management of inherited thrombophilia: guide for
genetics professionals. Clin Genet 2012;81:7-17.
2. EINSTEIN Investigators, Bauersachs R, Berkowitz SD, Brenner B, Buller
HR, Decousus H, Gallus AS, Lensing AW, Misselwitz F, Prins MH, Raskob
GE, Segers A, Verhamme P, Wells P, Agnelli G, Bounameaux H, Cohen A,
Davidson BL, Piovella F, Schellong S. Oral rivaroxaban for symptomatic
venous thromboembolism. N Engl J Med 2010;363:2499-2510.
3. Crowther MA, Ginsberg JS, Julian J, Denburg J, Hirsh J, Douketis J, Laskin
C, Fortin P, Anderson D, Kearon C, Clarke A, Geerts W, Forgie M, Green
D, Costantini L, Yacura W, Wilson S, Gent M, Kovacs MJ. A comparison of
two intensities of warfarin for the prevention of recurrent thrombosis
in patients with the antiphospholipid antibody syndrome. N Engl J Med
2003;349:1133-1138.
4. Johnson JA. Warfarin pharmacogenetics: a rising tide for its clinical value.
Circulation 2012;125:1964-1966.
5. Holbrook AM, Pereira JA, Labiris R, McDonald H, Douketis JD, Crowther
M, Wells PS. Systematic overview of warfarin and its drug and food
interactions. Arch Intern Med 2005;165:1095-1106.
6. Whitlon DS, Sadowski JA, Suttie JW. Mechanism of coumarin action:
significance of vitamin K epoxide reductase inhibition. Biochemistry
1978;17:1371-1377.
7. Guyatt GH, Akl EA, Crowther M, Gutterman DD, Schuünemann HJ; American
college of chest physicians antithrombotic therapy and prevention of
thrombosis panel. executive summary: antithrombotic therapy and
prevention of thrombosis, 9th ed: American College of Chest Physicians
Evidence-Based Clinical Practice Guidelines. Chest 2012;141(Suppl 2):7-47.
8. Zivelin A, Rao LV, Rapaport SI. Mechanism of the anticoagulant effect
of warfarin as evaluated in rabbits by selective depression of individual
procoagulant vitamin K-dependent clotting factors. J Clin Invest
1993;92:2131-2140.
9. Weitz JI, Hudoba M, Massel D, Maraganore J, Hirsh J. Clot-bound thrombin
is protected from inhibition by heparin-antithrombin III but is susceptible
to inactivation by antithrombin III-independent inhibitors. J Clin Invest
1990;86:385-391.
10. Wessler S, Gitel SN. Warfarin. From bedside to bench. N Engl J Med
1984;311:645-652.
11. Kuruvilla M, Gurk-Turner C. A review of warfarin dosing and monitoring.
Proc (Bayl Univ Med Cent) 2001;14:305-306.
12. Harrison L, Johnston M, Massicotte MP, Crowther M, Moffat K, Hirsh J.
Comparison of 5-mg and 10-mg loading doses in initiation of warfarin
therapy. Ann Intern Med 1997;126:133-136.
13. Kovacs MJ, Rodger M, Anderson DR, Morrow B, Kells G, Kovacs J, Boyle E,
Wells PS. Comparison of 10-mg and 5-mg warfarin initiation nomograms
together with low-molecular-weight heparin for outpatient treatment of
acute venous thromboembolism. A randomized, double-blind, controlled
trial. Ann Intern Med 2003;138:714-719.
14. Deerhake JP, Merz JC, Cooper JV, Eagle KA, Fay WP. The duration of
anticoagulation bridging therapy in clinical practice may significantly
exceed that observed in clinical trials. J Thromb Thrombolysis 2007;23:107-
113.
15. Gurwitz JH, Avorn J, Ross-Degnan D, Choodnovskiy I, Ansell J. Aging and the
anticoagulant response to warfarin therapy. Ann Intern Med 1992;116:901-
904.
16. Whitley HP, Fermo JD, Chumney EC, Brzezinski WA. Effect of patientspecific
factors on weekly warfarin dose. Ther Clin Risk Manag 2007;3:499-
504.
17. Higashi MK, Veenstra DL, Kondo LM, Wittkowsky AK, Srinouanprachanh
SL, Farin FM, Rettie AE. Association between CYP2C9 genetic variants
and anticoagulation-related outcomes during warfarin therapy. JAMA
2002;287:1690-1698.
18. Li T, Lange LA, Li X, Susswein L, Bryant B, Malone R, Lange EM, Huang TY,
Stafford DW, Evans JP. Polymorphisms in the VKORC1 gene are strongly
associated with warfarin dosage requirements in patients receiving
anticoagulation. J Med Genet 2006;43:740-744.
19. Sinxadi P, Blockman M. Warfarin resistance. Cardiovasc J Afr 2008;19:215-
217.
303

RESEARCH ARTICLE
DOI: 10.4274/tjh.2014.0385
Turk J Hematol 2016;33:304-310
Early Changes of Mannose-Binding Lectin, H-Ficolin, and
Procalcitonin in Patients with Febrile Neutropenia: A Prospective
Observational Study
Febril Nötropeni Olgularında Mannoz Bağlayan Lektin, H-Fikolin ve Prokalsitonin
Düzeylerinde Erken Dönem Değişimleri
Sibel Işlak Mutcalı 1 , Neşe Saltoğlu 1 , İlker İnanç Balkan 1 , Reşat Özaras 1 , Mücahit Yemişen 1 , Bilgül Mete 1 , Fehmi Tabak 1 , Ali Mert 2 ,
Recep Öztürk 1 , Şeniz Öngören 3 , Zafer Başlar 3 , Yıldız Aydın 3 , Burhan Ferhanoğlu 4 , Teoman Soysal 3
1İstanbul University Cerrahpaşa Faculty of Medicine, Department of Infectious Diseases and Clinical Microbiology, İstanbul, Turkey
2Medipol University Faculty of Medicine, Department of Internal Medicine, İstanbul, Turkey
3İstanbul University Cerrahpaşa Faculty of Medicine, Department of Hematology, İstanbul, Turkey
4Koç University Faculty of Medicine, Department of Internal Medicine, Division of Hematology, İstanbul, Turkey
Abstract
Objective: The significance of mannose-binding lectin (MBL) and
H-ficolin deficiency in febrile neutropenic (FN) patients and the
correlation of these markers along with consecutive C-reactive protein
(CRP) and procalcitonin (PCT) levels during the infectious process are
investigated.
Materials and Methods: Patients with any hematological
malignancies who were defined to have “microbiologically confirmed
infection”, “clinically documented infection”, or “fever of unknown
origin” were included in this single-center prospective observational
study. Serum levels of CRP, PCT, MBL, and H-ficolin were determined
on 3 separate occasions: at baseline (between hospital admission and
chemotherapy), at the onset of fever, and at the 72 nd hour of fever.
Results: Forty-six patients (54% male, mean age 41.7 years) with
61 separate episodes of FN were evaluated. Eleven patients (23.9%)
had “microbiologically confirmed infection”, 17 (37%) had “clinically
documented infection”, and 18 (39.1%) had “fever of unknown origin”.
Fourteen (30.4%) patients had low (<500 ng/mL) initial MBL levels and
7 (15.21%) had low (<12,000 ng/mL) H-ficolin levels. Baseline MBL
and H-ficolin levels did not significantly change on the first and third
days of fever (p=0.076). Gram-negative bacteremia more frequently
occurred in those with low initial MBL levels (p=0.006). PCT levels
were significantly higher in those with microbiologically documented
infections. Mean and median PCT levels were significantly higher in
cases with bacteremia. There was no significant difference between
hemoculture-positive and-negative patients in terms of CRP levels.
Conclusion: Monitoring serum H-ficolin levels was shown to be of
no benefit in terms of predicting severe infection. Low baseline MBL
levels were correlated with high risk of gram-negative bacteremia;
however, no significant correlation was shown in the follow-up. Close
monitoring of PCT levels is warranted to provide more accurate and
specific data while monitoring cases of bacteremia.
Keywords: Febrile neutropenia, Infection, Mannose-binding lectin,
H-ficolin, Procalcitonin, C-reactive protein
Öz
Amaç: Febril nötropenik (FEN) hastalarda mannoz-bağlayıcı lektin
(MBL) ve H-fikolin eksikliğinin önemi
Öz
ve bu belirteçlerin enfeksiyon
atağı sırasında ardışık C-reaktif protein (CRP) ve prokalsitonin (PCT)
ölçümleri ile korelasyonu araştırılmıştır.
Gereç ve Yöntemler: Bu tek merkezli prospektif gözlemsel çalışmaya,
hematolojik malignite nedeniyle izlenen ve “mikrobiyolojik olarak
doğrulanmış enfeksiyon”, “klinik olarak dökümante edilmiş enfeksiyon”
veya “nedeni bilinmeyen ateş” tanıları konulan hastalar dahil edilmiştir.
Serum CRP, PCT, MBL ve H-fikolin düzeyleri; başlangıçta (hastaneye
başvuru ile kemoterapi başlangıcı arasında), ateş atağının başında ve
72. saatinde olmak üzere üç ayrı zamanda ölçülmüştür.
Bulgular: Kırk altı (%54 erkek, ortalama yaş 41,7) hastada gelişen
61 ayrı FEN atağı değerlendirildi. Hastaların 11’inde (%23,9)
“mikrobiyolojik doğrulanmış enfeksiyon”, 17’sinde (%37) “klinik
dökümante enfeksiyon”, 18’inde (%39,1) ise nedeni bilinmeyen ateş
mevcut idi. Başlangıç MBL düzeyi (<500 ng/mL) yedi hastada, H-fikolin
düzeyi ise (<12,000 ng/mL) 14 hastada düşük bulundu. Bazal MBL
ve H-fikolin düzeylerinin ateşin birinci ve üçüncü gününde anlamlı
olarak değişmediği belirlendi (p=0,076). Başlangıç MBL düzeyi düşük
olan hastalarda gram-negatif bakteremilerin daha sık ortaya çıktığı
saptandı (p=0,006). PCT düzeyleri “mikrobiyolojik olarak doğrulanmış”
enfeksiyonu bulunanlarda anlamlı olarak daha yüksekti. Medyan PCT
düzeyleri tüm FEN epizodlarında anlamlı olarak yükselmiş bulundu.
Sonuç: Ciddi bakteremilerin ön görülmesi açısından serum H-fikolin
düzeylerinin izlenmesinin yararı olmadığı gösterildi. Düşük bazal
MBL düzeyleri ile yüksek gram-negatif bakteremi riski arasında
ilişkili olduğu belirlenmekle birlikte izlemde anlamlı korelasyon
gösterilemedi. Bakteremi olgularının izleminde daha hızlı ve özgül
veriler elde edebilmek için PCT düzeylerinin yakın izleminin gerekli
olduğu sonucuna varıldı.
Anahtar Sözcükler: Febril nötropeni, Enfeksiyon, Mannoz-bağlayıcı
lektin, H-fikolin, Prokalsitonin, C-reaktif protein
Address for Correspondence/Yazışma Adresi: İlker İnanç BALKAN, M.D.,
İstanbul University Cerrahpaşa Faculty of Medicine, Department of Infectious Diseases and Clinical Microbiology,
İstanbul, Turkey Phone : +90 212 414 30 00
E-mail : ilkerinancbalkan@hotmail.com
Received/Geliş tarihi: September 26, 2014
Accepted/Kabul tarihi: April 13, 2015
304

Turk J Hematol 2016;33:304-310
Işlak Mutcalı S, et al: Early Changes in MBL, H-Ficolin, Procalcitonin in Febrile Neutropenia
Introduction
Blood stream infections (BSIs) due to invasive bacterial and
fungal pathogens are major causes of infection related mortality.
Gram-negative and gram-positive bacteremia account for
50%-60% of BSIs during febrile neutropenia (FN) episodes
[1,2,3]. Nonspecific signs and symptoms and conventional
microbiologic methods pose some problems in the diagnosis of
severe infections in neutropenic patients. Hemoculture is still
the standard diagnostic method, but the positivity rate is only
about 20-50% in FN episodes [4] and microbial identification
takes 2-6 days [1]. Definition of early diagnostic markers that
will guide antimicrobial treatment is critical [5].
In current practice, antibacterial therapy is initiated
immediately after blood cultures are obtained and before any
other diagnostic procedures, in accordance with guidelines.
Leukocytes and differential blood count, hemoglobin, platelets,
serum glutamate oxaloacetate transaminase, serum glutamate
pyruvate transaminase, lactate dehydrogenase, alkaline
phosphatase, gamma glutamyltransferase, bilirubin, uric acid,
creatinine, sodium, potassium, partial thromboplastin time,
and C-reactive protein (CRP) are measured twice a week before
and during therapy in the routine practice of our hematology
section. Procalcitonin (PCT) is measured weekly throughout the
neutropenic episode.
Mannose-binding lectin (MBL) is a plasma collectin (C-type lectin
with a collagen-like domain) thought to have an important
role in innate immunity [6]. Its lectin domain recognizes sugar
patterns typical of microbial surfaces, while its collagen-like
region facilitates microbial uptake by phagocytic cells. MBL can
activate the complement by a mechanism similar to the classical
pathway, but using MBL-associated serine proteases instead
of C1r and C1s. The complement system provides immediate
defense against infection and has proinflammatory effects.
MBL deficiency is defined as a serum level of <500 ng/mL. It
is a laboratory finding that does not necessarily equate to a
clinical disorder. MBL deficiency is associated with a large and
heterogeneous group of disease processes. However, subnormal
levels are also found in healthy people. To date, there is no
consensus on the clinical relevance of MBL deficiency or its
treatment [7].
According to the results of the largest adult cohort, MBL deficiency
is not correlated with more frequent or more prolonged febrile
episodes during myelosuppressive chemotherapy in adults with
hematological cancer, but severe infections are more frequent
in MBL-deficient patients and first severe infection develops
earlier in this group compared with nondeficient patients [8].
In this prospective study we aimed to confirm or refute these
findings and to extend the investigation to one of the plasma
ficolins, the Hakata antigen (H-ficolin). Ficolins share with
collectins an overall quaternary structure resembling C1q and
bind to bacteria and activate the complement using the lectin
pathway of complement activation [9]. H-ficolin might therefore
be a potentially useful marker of innate immunity. In this
respect, the significance of MBL and H-ficolin deficiency in FN
patients and the role of consecutive CRP and PCT measurements
in the etiological differentiation of fever and in establishing a
follow-up protocol are investigated.
Materials and Methods
The study was planned and conducted with a prospective
methodology. All patients were consecutively evaluated and
included in the relevant predefined case groups. Patients
hospitalized in the hematology and hematopoietic stem
cell transplantation units of the Cerrahpaşa Medical School
Training Hospital with any hematological malignancies and who
developed at least one episode of FN between February 2011 and
July 2012 were included in the study. Patients were divided into
3 diagnostic groups as “microbiologically confirmed infection”,
“clinically documented infection”, and “fever of unknown
origin” according to German guidelines [10]. The patients were
reevaluated at the end of the neutropenic episode and assigned
to the relevant groups by the principle investigator, who was
blinded to the laboratory results at that time.
Study Protocol
Three separate blood samples were obtained from the patients
on 3 separate occasions: at baseline (between hospital admission
and chemotherapy), at the onset of fever, and 72 h after the
first febrile spike. Empirical antipseudomonal antimicrobial
treatment (piperacillin tazobactam or cefoperazone/sulbactam
for the first episode and carbapenem for recurrent episodes or
in case of increased risk of extended-spectrum beta-lactamaseproducing
gram-negative bacteria) was initiated in accordance
with the FN guidelines [10] following hemoculture. Some
patients with prolonged neutropenia developed more than one
febrile episode and data were recorded separately for each.
Data Collection
All required data were recorded on case follow-up forms from
the first day of hospitalization. Demographic and clinical
features including age, sex, comorbidities, vital signs, status
of clinical sepsis, radiological data, microbiological data,
antimicrobial treatment, and response data were recorded.
Clinical and laboratory improvement within 96 h of treatment
was defined as response to the antimicrobials.
Inclusion Criteria
Patients with hematologic malignancies who developed an
episode of FN were included. Neutropenia was defined as an
absolute neutrophil count of ≤500/mm 3 or 500-1000/mm 3 but
305

Işlak Mutcalı S, et al: Early Changes in MBL, H-Ficolin, Procalcitonin in Febrile Neutropenia
Turk J Hematol 2016;33:304-310
expected to fall below ≤500/mm 3 within 24-48 h. Fever was
defined as a single measurement of tympanic fever of ≥38 °C or
at least 2 consecutive measurements of tympanic fever of ≥37.8
°C measured with 4 h intervals within 24 h of monitoring.
Exclusion Criteria
Patients lacking any of the 3 blood samples during follow-up
were excluded, along with those under 18 years or pregnant.
Antimicrobial Treatment
There was no off-protocol intervention regarding antimicrobial
use in FN episodes during the study period.
Laboratory Analysis
Blood cultures were incubated for 7 days in an automated
hemoculture system (BacT ALERT 3D, bioMérieux, France).
Conventional biochemical methods and automated systems
(API automation pour identification, bioMérieux) were used for
identification.
Antimicrobial susceptibility tests were performed using the
disk diffusion method in accordance with the relevant Clinical
and Laboratory Standards Institute recommendations [11].
Blood samples were stored at -80 °C in accordance with the
manufacturer’s recommendations (B.R.A.H.M.S., Hycult) and
were tested after being thawed and centrifuged for 1 min.
MBL, H-ficolin, and PCT levels were measured using Hycult MBL,
enzyme-linked immunosorbent assay, and B.R.A.H.M.S. VIDAS
methods, respectively.
Statistical Analysis
SPSS 16.0 was used for statistical analyses. Categorical variables
were analyzed with chi-square tests and continuous variables
were analyzed with Student t or Mann-Whitney U tests. The
Spearman correlation test was used to evaluate correlation
between continuous variables. A p-value of <0.05 was accepted
as statistically significant.
Ethical Approval
This single-center, prospective, observational study was approved
by the Institutional Review Board of Cerrahpaşa Medical School.
All collected data were kept confidential.
Results
A total of 82 patients were registered. Sixty-one FN episodes
in 46 patients were included in the study after excluding 36
patients lacking any of the 3 serum samples or not fulfilling
the inclusion criteria. Twenty-five (54%) of the patients were
male and the mean age was 41.7, ranging between 19 and 81
years. Distribution of diagnoses and number of FN episodes per
diagnosis and patient are shown in Table 1.
The clinical manifestations of the cases with FN episodes are
defined below:
1. Microbiologically + clinically documented infection: 11 cases
(23.9%),
2. Only clinically documented infection: 17 cases (37%),
3. Fever of unknown origin: 18 cases (39.1%).
Eight (8/11) of the patients with microbiologically + clinically
documented infection had primary bacteremia, 2 had
bacteremia due to urinary tract infection, and 1 had urinary
infection. Six of the pathogens isolated from blood cultures
were gram-positive cocci and 4 were gram-negative bacilli. The
most common gram-positive bacteria were methicillin-resistant
coagulase negative staphylococci and the most common gramnegative
bacterium was Escherichia coli.
Among those 17 cases with clinically documented infections,
the source of infection was skin and soft tissue in 4, perianal
abscess in 3, catheter exit site in 3, tooth abscess in 2, pneumonia
in 1, myositis in 1, tracheostomy site in 1, surgical site in 1,
and tonsillitis in 1. The rate of gram-negative bacteremia
was significantly higher in cases with lower MBL levels when
compared to cases with normal MBL levels (p=0.006) (Table 2).
The average level of MBL was 3.060 ng/mL. Average levels of MBL
did not significantly vary between the 3 measurements (MBL-0,
MBL-1, and MBL-2) during the episodes of FN (p=0.076) (Figure
1a). Similarly, there was no significant difference between
baseline, first day of fever, and third day of fever levels of
H-ficolin (p>0.05) (Figure 1b). The average H-ficolin level of the
cases was measured as 18.470 ng/mL. Median baseline CRP level
(CRP-0) was measured as 24 mg/L (normal range: 0-5 mg/L). The
average CRP level was elevated to 84.8 mg/L on the first day of
FN episodes (CRP-1) and to 98 mg/L on the third day (CRP-2)
(Figure 1c). This increase in the serial CRP levels was statistically
significant (p<0.0001).
Table 1. Hematological diagnoses of patients and number of
febrile neutropenia episodes.
Diagnosis Patients FN Episodes FN Episodes
Per Patient
n % n % n
AML 16 34.78 25 40.98 1.56
ALL 15 32.61 21 34.43 1.4
NHL 7 15.22 7 11.48 1
HL 4 8.7 4 6.56 1
Others 4 8.7 4 6.56 1
Total 46 100 61 100
AML: Acute myeloid leukemia, ALL: acute lymphoblastic leukemia, NHL: non-Hodgkin
lymphoma, HL: Hodgkin lymphoma, FN: febrile neutropenic.
306

Turk J Hematol 2016;33:304-310
Işlak Mutcalı S, et al: Early Changes in MBL, H-Ficolin, Procalcitonin in Febrile Neutropenia
Median PCT levels (normal range: <0.5 ng/mL) were also
significantly elevated in FN episodes (baseline PCT-0: 2.13 ng/
mL, first day of fever PCT-1: 6.69 ng/mL, third day of fever PCT-
2: 6.20 ng/mL; p<0.0001) (Figure 1d).
As shown in Table 3, PCT-1 was increased with borderline
significance (p=0.055), while PCT-2 was significantly higher
(p=0.028) when compared to baseline levels in cases with
microbiologically documented infection. Kruskal-Wallis variance
analysis revealed no significant difference in terms of CRP levels
between predefined subgroups, while median PCT levels were
a
3.5
3
2.5
2
1.5
1
0.5
0
3.06
2.67
84.8
3.13
98.2
b
18.47 17.88 19.3
H-ficolin-0 H-ficolin-1 H-ficolin-2
6.59
6.2
significantly higher in those with microbiologically documented
infections. Median PCT levels according to FN subgroups
are shown in detail in Table 3 and Figure 2. The correlations
between CRP, PCT, MBL, and H-ficolin levels during FN episodes
were examined with Spearman correlation analysis. A strongly
positive correlation was found between PCT-2 and CRP-2 values
(p=0.008, r=0.39). CRP and PCT trajectories on the third day of
fever were found to be parallel to each other. Similarly, there
was a significant correlation between H-ficolin-2 and CRP-2
values (p=0.026, r=0.33).
While there was no significant difference between hemoculturepositive
and hemoculture-negative patients in terms of CRP
levels, mean and median PCT levels were significantly higher in
cases with bacteremia (Table 3).
Mortality occurred in 9 (19.6%) of the 46 cases during the study
period, 7 of which involved refractory hematologic malignancies
and 2 bacteremia due to multiple-drug resistant gram-negative
strains, one of which was carbapenemase-producing.
24
2.13
2
1.5
1
c
d
0,5
Figure 1. Serum mannose-binding lectin (a), H-ficolin (b),
C-reactive protein (c), and procalcitonin (d) levels in patients.
0=at initial (between hospital admission and before chemotherapy), 1=at the
onset of fever, and 2=at the 72 nd hour of fever.
MBL: Mannose-binding lectin, PCT: procalcitonin, CRP: C-reactive protein.
0
Figure 2. Median procalcitonin levels in febrile neutropenic
patient subgroups.
FUO: Fever of unknown origin, PCT: procalcitonin.
Table 2. Rates and distribution of bacteremia according to mannose-binding lectin levels.
MBL Level (ng/mL)
No. of
Patients
Gram (+) Growth in
Hemoculture
Gram (-) Growth in
Hemoculture
<500 14 1 4 5 38.5
≥500 32 5 0 5 15.1
Total 46 6 4 10 21.7
MBL: Mannose-binding lectin.
Positive Hemocultures
n %
p-value
0.006
Table 3. Median serum procalcitonin and C-reactive protein levels in three patient groups with febrile neutropenia.
Fever of Unknown Origin
(n=18)
Only Clinically Documented
(n=17)
Microbiologically and Clinically
Documented (n=11)
PCT-0 0.05 0.05 0.07 0.794
PCT-1 0.1 0.29 0.67 0.055
PCT-2 0.17 0.25 1.73 0.028
CRP-0 8.5 4 15 0.307
CRP-1 62.5 94 44 0.126
CRP-2 109.5 55 86 0.355
p-value
PCT: Procalcitonin, CRP: C-reactive protein.
PCT-0, CRP-0: baseline serum PCT and CRP levels, PCT-1, CRP-1: serum PCT and CRP levels on the first day of febrile episode, PCT-2, CRP-2: serum PCT and CRP levels 72 h after the
first peak of fever.
307

Işlak Mutcalı S, et al: Early Changes in MBL, H-Ficolin, Procalcitonin in Febrile Neutropenia
Turk J Hematol 2016;33:304-310
Discussion
Early diagnostic markers would ideally reflect the severity of the
infection, help classify FN episodes as low-risk and high-risk in
terms of likelihood of septic complications, and not be affected
by the number of leukocytes and the course of underlying
disease. CRP, as an acute phase marker and the most wellknown
biochemical marker of inflammation in patients with
FN, was not found to be useful in the differential diagnosis of
fever of unknown origin, bacteremia, and clinically documented
infections in neutropenic patients. Similar to our study, CRP was
found to be of no use in differential diagnosis in other studies
[12,13,14]. False negativity that can be recognized in certain
patient groups such as patients with leukemia, viral infections,
systemic lupus erythematosus, progressive systemic sclerosis,
dermatomyositis, ulcerative colitis, Sjögren’s syndrome, and
cerebral infarction is an additional drawback for CRP as an
acute phase marker [15].
Although the levels of serum PCT were determined to be lower
in neutropenic patients when compared to those with intact
immune systems, studies have shown that neutropenic patients
had significantly higher PCT levels on days 0 and 2 in the case
of sepsis [16]. The relationship between CRP and PCT levels
during FN episodes was investigated in our study, and it was
found that CRP is not a sensitive marker of early infection in
neutropenic patients, while PCT would be preferred in the early
diagnosis of sepsis. The rise of CRP or PCT from day 1 to day 3
in any patient group was evaluated as the expected peak serum
levels related to the severity of infection rather than an ongoing
uncontrolled sepsis. In our study, a slightly significant difference
(p=0.055) was found between the first-day PCT levels (PCT-
1) of FN episodes in bacteremic and nonbacteremic patients.
Patients who had a microbiologically documented infection had
significantly higher PCT levels on the third day (PCT-2) of the FN
episode (p<0.05). CRP levels had no correlation with the clinical
subcategories of FN episode, but higher PCT levels on the first day
of fever (>0.5 ng/mL) and 72 h after the first peak of fever (with
a cut point of >3-fold rise) were correlated with bacteremia,
and particularly with gram-negative bacteremia. Although
Svaldi et al. [17] reported that PCT levels did not significantly
differ whether gram-negative or gram-positive bacteria were
present when leukocyte count was <1.0x10 9 /L, PCT levels were
found to be higher in bacteremic patients than nonbacteremic
patients and were more rapidly decreased in nondocumented
infections in the studies of Akçay [13] and Secmeer et al. [18].
Nevertheless, de Bont et al. [19] reported similar levels of initial
PCT levels at the onset of fever in bacteremic and nonbacteremic
patients in a cohort of 66 patients. In the same study, cases
with coagulase-negative staphylococci bacteremia were found
not to have significant rises in PCT levels. Similar to our study,
Fleischhack et al. [20] reported that children with FN infected
with gram-negative bacteremia had higher PCT levels than did
gram-positive cases [21].
It was concluded in a review published by Sakr et al. [21] of
30 studies that PCT levels were useful to distinguish the febrile
episodes of systemic infection from noninfectious causes of
fever. However, the capability to differentiate gram-negative
and gram-positive bacteria in the etiology was limited.
MBL deficiency is defined as a serum level of <0.1 mg/L and
was found in 5-10% of healthy adults. In a prospective
study [21] evaluating 255 adult patients with hematologic
malignancies and neutropenia, MBL levels were measured prior
to the initiation of chemotherapy and on the first day of a
febrile episode. MBL deficiency (<500 ng/mL) was detected in
62 (24%) of the patients.
The incidence of severe infection was higher among MBLdeficient
patients than among non-MBL-deficient patients. In
our study, MBL levels did not show any significant change in
the first 3 days of FN. MBL levels were within normal ranges in
32 (69.5%) patients, 5 (15.1%) of whom had bacteremia due
to gram-positive cocci. MBL levels were low (<500 ng/mL) in
14 (30.5%) of patients. Patients with low levels of MBL had a
significantly higher rate of gram-negative bacteremia compared
to patients with normal MBL levels (p=0.006), suggesting a
correlation between MBL levels and risk of gram-negative
infection.
In the review by Frakking et al. [22] investigating the correlation
of infection in pediatric oncology patients with MBL deficiency
and/or severity of infection, no relationship was found between
low MBL levels and presence of sepsis, bacteremia, or fungal
infection in 3 of the 5 studies, while the results of the other
2 studies were to the contrary. Although there are a variety of
studies with different results in the literature [23,24,25,26,27],
Peterslund et al. [28] showed a significant correlation between
low levels of MBL and the development of bacteremia in adult
patients with hematological malignancies.
In the study of Neth et al. [29] comparing 24 children with MBL
levels of <1000 μg/L and 38 children with MBL levels of ≥1000
μg/mL, those with lower MBL levels developed FN episodes
significantly more frequently. Schlapbach et al. [23] detected
significantly more episodes of severe bacterial infections in
patients with low MBL levels (<100 μg/mL), while those with
higher MBL levels (>1000 μg/mL) had more frequent FN episodes
due to microbiologically nondefined etiology. Kilpatrick et al.
[24] demonstrated that patients with MBL of ≤0.1 mg/mL had
significantly more major infections than no infections within
the follow-up period (p<0.05). Deficiency of MBL (≤0.1 µg/
mL) was significantly more frequent in patients with serious
infections when compared to those with no infection within the
308

Turk J Hematol 2016;33:304-310
Işlak Mutcalı S, et al: Early Changes in MBL, H-Ficolin, Procalcitonin in Febrile Neutropenia
follow-up period (p<0.05) [6] in a cohort of 128 patients with
hematological malignancies treated by chemotherapy alone or
combined with bone marrow transplantation. In the study of
Bergmann et al. [25], no significant correlation between low
MBL levels and the development of infection was detected in
the FN episodes of patients with acute leukemia. Nevertheless,
Horiuchi et al. [26] showed that low levels of a particular
MBL genotype were related to severe bacterial infection. The
dramatic differences reported in the studies of Peterslund et
al. [28], Neth et al. [29], and Schlapbach et al. [23] in median
MBL concentrations were virtually identical to those of the
other patient categories. The studies of Klostergaard et al. [27],
Frakking et al. [22], and Schlapbach et al. [23] revealed that
infections due to gram-positive bacteria were more commonly
observed in cases with low MBL levels.
MBL is one of the factors that may influence susceptibility
to infection [6]. MBL variant alleles (implying low levels of
circulating MBL) were found to be associated with major
infections in recipients of allogeneic hemopoietic stem cell
transplants [30]. Measuring the baseline MBL levels might be
useful to define any predisposition to infections, particularly
due to gram-negative bacteria, as a conclusion of our study.
Baseline MBL levels might help categorize patients into highrisk
and low-risk groups. A further study investigating how
baseline MBL levels correlate with Multinational Association of
Supportive Care in Cancer (MASCC) scores would be of great
value. Given the easy treatment of its deficiency, baseline MBL
will probably be a surrogate marker for the MASCC score,
despite the current cost of the test.
H-ficolin was the other collectin investigated in our study.
Seven patients had low levels of H-ficolin, 2 of whom developed
gram-positive and 1 of whom developed gram-negative
bacteremia. Due to the small number of patients in this group,
no correlation was established between low H-ficolin levels and
development of infection. In 4 of the 7 patients who had lower
H-ficolin levels, MBL was also low. Two of these 4 patients had
bacteremia.
In our study, MBL and H-ficolin levels did not show any
significant variability in any subgroup of patients within the
first 3 days of FN episodes. Different studies revealed different
results owing to different patient groups, use of different
chemotherapy regimens, and varying features of nosocomial
causative agents within centers.
Conclusion
Obtaining baseline MBL levels seems to be useful to predict
severe infections, particularly due to gram-negative bacteria,
in FN patients. Consecutive PCT levels are much more correlated
with microbiologically documented infections, including
bacteremia, and are preferable to CRP as a follow-up marker. No
significant relation was found with baseline H-ficolin levels
and risk of infection, and no significant change in serum level
was detected during an emerging infection. Treatment of MBL
deficiency would be a useful research topic to decrease the risk
of severe infections, particularly due to gram-negative bacteria
in cases with neutropenia.
Acknowledgments
We would like to express our sincere thanks to Professor Bekir
Kocazeybek, MD, and Pelin Yüksel, MD, PhD, for laboratory and
technical support. We are grateful to Dana Clutter, MD, for
her contributions and revision of the manuscript in terms of
language. This study was financially supported by the İstanbul
University Research and Projects Unit (Project no: 3847).
Ethics
Ethics Committee Approval: İstanbul University Cerrahpaşa
Faculty of Medicine Ethics Committee (approval number:
2009/22079) (15.07.2009); Informed Consent: It was taken.
Authorship Contributions
Infection Consultation Practices: Sibel Işlak Mutcalı, Neşe
Saltoğlu, İlker İnanç Balkan, Reşat Özaras, Mücahit Yemişen,
Bilgül Mete, Fehmi Tabak, Ali Mert, Recep Öztürk; Hematological
follow-up: Şeniz Öngören, Zafer Başlar, Yıldız Aydın, Burhan
Ferhanoğlu, Teoman Soysal; Design: Sibel Işlak Mutcalı,
Neşe Saltoğlu, İlker İnanç Balkan; Laboratory and Technical
Support: Bekir Kocazeybek, Pelin Yüksel, Sibel Işlak Mutcalı;
Data Collection or Processing: Sibel Işlak Mutcalı; Analysis or
Interpretation: Sibel Işlak Mutcalı, Neşe Saltoğlu, İlker İnanç
Balkan, Reşat Özaras; Literature Search: Sibel Işlak Mutcalı, Neşe
Saltoğlu; Writing: Sibel Işlak Mutcalı, Neşe Saltoğlu, İlker İnanç
Balkan, Reşat Özaras, Mücahit Yemişen, Bilgül Mete, Fehmi
Tabak, Ali Mert, Recep Öztürk, Şeniz Öngören, Zafer Başlar, Yıldız
Aydın, Burhan Ferhanoğlu, Teoman Soysal.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships, and/
or affiliations relevant to the subject matter or materials included.
References
1. Chen SC, Kontoyiannis DP. New molecular and surrogate biomarker-based
tests in the diagnosis of bacterial and fungal infection in febrile neutropenic
patients. Curr Opin Infect Dis 2010;23:567-577.
2. Einsele H, Loeffler J. Contribution of new diagnostic approaches to
antifungal treatment plans in high-risk hematology patients. Clin Microbiol
Infect 2008;14(Suppl 4):37-45.
3. Pfaller MA, Diekema DJ. Epidemiology of invasive candidiasis: a persistent
public health problem. Clin Microbiol Rev 2007;20:133-163.
4. Hsu DI, Nguyen M, Nguyen L, Law A, Wong-Beringer A. A multicentre
study to evaluate the impact of timing of caspofungin administration
on outcomes of invasive candidiasis in non-immunocompromised adult
patients. J Antimicrob Chemother 2010;65:1765-1770.
309

Işlak Mutcalı S, et al: Early Changes in MBL, H-Ficolin, Procalcitonin in Febrile Neutropenia
Turk J Hematol 2016;33:304-310
5. Mancini N, Clerici D, Diotti R, Perotti M, Ghidoli N, De Marco D, Pizzorno
B, Emrich T, Burioni R, Ciceri F, Clementi M. Molecular diagnosis of sepsis
in neutropenic patients with hematological malignancies. J Med Microbiol
2008;57:601-604.
6. Kilpatrick DC. Mannan-binding lectin and its role in innate immunity.
Transfus Med 2002;12:335-352.
7. Bronkhorst MW, Bouwman LH. Mannose-binding lectin deficiency. 2014.
Available online at http://www.uptodate.com/contents/mannose-bindinglectin-deficiency.
Accessed on 27 January 2015.
8. Vekemans M, Robinson J, Georgala A, Heymans C, Muanza F, Paesmans
M, Klastersky J, Barette M, Meuleman N, Huet F, Calandra T, Costantini S,
Ferrant A, Mathissen F, Axelsen M, Marchetti O, Aoun M. Low mannosebinding
lectin concentration is associated with severe infection in patients
with hematological cancer who are undergoing chemotherapy. Clin Infect
Dis 2007;44:1593-1601.
9. Matsushita M, Fujita T. The role of ficolins in innate immunity.
Immunobiology 2002;205:490-497.
10. Link H, Böhme A, Cornely OA, Höffken K, Kellner O, Kern WV, Mahlberg R,
Maschmeyer G, Nowrousian MR, Ostermann H, Ruhnke M, Sezer O, Schiel
X, Wilhelm M, Auner HW; Diseases Working Party (AGIHO) of the German
Society of Hematology and Oncology (DGHO); Group Interventional Therapy
of Unexplained Fever, Arbeitsgemeinschaft Supportivmassnahmen in der
Onkologie (ASO) of the Deutsche Krebsgesellschaft (DKG-German Cancer
Society). Antimicrobial therapy of unexplained fever in neutropenic patients-
-guidelines of the Infectious Diseases Working Party (AGIHO) of the German
Society of Hematology and Oncology (DGHO), Study Group Interventional
Therapy of Unexplained Fever, Arbeitsgemeinschaft Supportivmassnahmen
in der Onkologie (ASO) of the Deutsche Krebsgesellschaft (DKG-German
Cancer Society). Ann Hematol 2003;82(Suppl 2):S105-S117.
11. Clinical and Laboratory Standards Institute. Performance Standards for
Antimicrobial Susceptibility Testing, Twentieth Informational Supplement.
M100-S20. Wayne, PA, USA, CLSI, 2010.
12. Riikonen P, Saarinen UM, Teppo AM, Metsarinne K, Fyhrquist F, Jalanko H.
Cytokine and acute-phase reactant levels in serum of children with cancer
admitted for fever and neutropenia. J Infect Dis 1992;166:432-436.
13. Akçay A. Association of serum levels of proinflammatory cytokines,
C-reactive protein, procalcitonin and bacterial sepsis in febrile neutropenic
children with cancer. Specialty thesis on pediatric hematology, İstanbul
Medical School, Department of Children’s Health and Diseases, İstanbul,
Turkey, 2009.
14. von Lilienfeld-Toal M, Dietrich MP, Glasmacher A, Lehmann L, Breig P,
Hahn C, Schmidt-Wolf IG, Marklein G, Schroeder S, Stuber F. Markers of
bacteremia in febrile neutropenic patients with hematological malignancies:
procalcitonin and IL-6 are more reliable than C-reactive protein. Eur J Clin
Microbiol Infect Dis 2004;23:539-544.
15. Kawai T. Inflammatory markers, especially the mechanism of increased CRP.
Rinsho Byori 2000;48:719-721a (in Japanese with English abstract).
16. Al-Nawas B, Shah PM. Procalcitonin in patients with and without
immunosuppression and sepsis. Infection 1996;24:434-436.
17. Svaldi M, Hirber J, Lanthaler AI, Mayr O, Faes S, Peer E, Mitterer M.
Procalcitonin reduced sensitivity and specificity in heavily leucopenic and
immunosuppressed patients. Br J Haematol 2001;115:53-57.
18. Secmeer G, Devrim I, Kara A, Ceyhan M, Cengiz B, Kutluk T, Buyukpamukcu
M, Yetgin S, Tuncer M, Uludag AK, Tezer H, Yildirim I. Role of procalcitonin
and CRP in differentiating a stable from a deteriorating clinical course in
pediatric febrile neutropenia. J Pediatr Hematol Oncol 2007;29:107-111.
19. de Bont ES, Vellenga E, Swaanenburg J, Kamps W. Procalcitonin: a diagnostic
marker of bacterial infection in neutropenic cancer patients with fever?
Infection 2000;28:398-400.
20. Fleischhack G, Kambeck I, Cipic D, Hasan C, Bode U. Procalcitonin in
paediatric cancer patients: its diagnostic relevance is superior to that
of C-reactive protein, interleukin 6, interleukin 8, soluble interleukin 2
receptor and soluble tumour necrosis factor receptor II. Br J Haematol
2000;111:1093-1102.
21. Sakr Y, Sponholz C, Tuche F, Brunkhorst F, Reinhart K. The role of
procalcitonin in febrile neutropenic patients: review of the literature.
Infection 2008;36:396-407.
22. Frakking FN, Israëls J, Kremer LC, Kuijpers TW, Caron HN, van de Wetering
MD. Mannose-binding lectin (MBL) and the risk for febrile neutropenia and
infection in pediatric oncology patients with chemotherapy. Pediatr Blood
Cancer 2011;57:89-96.
23. Schlapbach LJ, Aebi C, Otth M, Luethy AR, Leibundgut K, Hirt A, Ammann RA.
Serum levels of mannose binding lectin and the risk of fever in neutropenia
pediatric cancer patients. Pediatr Blood Cancer 2007;49:11-16.
24. Kilpatrick DC, McLintock LA, Allan EK, Copland M, Fujita T, Jordanides
NE, Koch C, Matsushita M, Shiraki H, Stewart K, Tsujimura M, Turner ML,
Franklin IM, Holyoake TL. No strong relationship between mannan binding
lectin or plasma ficolins and chemotherapy-related infections. Clin Exp
Immunol 2003;134:279-284.
25. Bergmann OJ, Christiansen M, Laursen I, Bang P, Hansen NE, Ellegaard J,
Koch C, Andersen V. Low levels of mannose-binding lectin do not affect
occurrence of severe infections or duration of fever in acute myeloid
leukaemia during remission induction therapy. Eur J Haematol 2003;70:91-
97.
26. Horiuchi T, Gondo H, Miyagawa H, Otsuka J, Inaba S, Nagafuji K, Takase
K, Tsukamoto H, Koyama T, Mitoma H, Tamimoto Y, Miyagi Y, Tahira T,
Hayashi K, Hashimura C, Okamura S, Harada M. Association of MBL gene
polymorphisms with major bacterial infection in patients treated with highdose
chemotherapy and autologous PBSCT. Genes Immun 2005;6:162-166.
27. Klostergaard A, Steffensen R, Møller JK, Peterslund N, Juhl-Christensen C,
Mølle I. Sepsis in acute myeloid leukaemia patients receiving high-dose
chemotherapy: no impact of chitotriosidase and mannose-binding lectin
polymorphism. Eur J Haematol 2010;85:58-64.
28. Peterslund NA, Koch C, Jensenius JC, Thiel S. Association between deficiency
of mannose-binding lectin and severe infections after chemotherapy.
Lancet 2001;358:637-638.
29. Neth O, Hann I, Turner MW, Klein NJ. Deficiency of mannose-binding lectin
and burden of infection in children with malignancy: a prospective study.
Lancet 2001;358:614-618.
30. Mullighan CG, Heatley S, Doherty K, Szabo F, Grigg A, Hughes TP, Schwarer
AP, Szer J, Tait BD, Bik To L, Bardy PG. Mannose-binding lectin gene
polymorphisms are associated with major infection following allogeneic
hemopoietic stem cell transplantation. Blood 2002;99:3524-3529.
310

RESEARCH ARTICLE
DOI: 10.4274/tjh.2015.0216
Turk J Hematol 2016;33:311-319
Prospective Evaluation of Infection Episodes in Cancer Patients
in a Tertiary Care Academic Center: Microbiological Features and
Risk Factors for Mortality
Kanser Hastalarındaki Enfeksiyon Ataklarının Prospektif Değerlendirmesi: Mikrobiyolojik
Özellikler ve Mortalite için Risk Faktörleri
Nursel Çalık Başaran 1 , Ergun Karaağaoğlu 2 , Gülşen Hasçelik 3 , Mine Durusu Tanrıöver 1 , Murat Akova 4
1Hacettepe University Faculty of Medicine, Department of Internal Medicine, Ankara, Turkey
2Hacettepe University Faculty of Medicine, Department of Biostatistics, Ankara, Turkey
3Hacettepe University Faculty of Medicine, Department of Basic Microbiology, Ankara, Turkey
4Hacettepe University Faculty of Medicine, Department of Infectious Diseases and Clinical Microbiology, Ankara, Turkey
Abstract
Objective: We aimed to determine the frequency, type, and etiology
of infections and the risk factors for infections and mortality in
hospitalized cancer patients.
Materials and Methods: We prospectively enrolled adult cancer
patients hospitalized in the internal medicine wards of a tertiary
care academic center between January and August 2004. Patients
were followed during their hospitalization periods for neutropenia,
infections, culture results, and mortality.
Results: We followed 473 cancer patients with 818 hospitalization
episodes and 384 infection episodes in total. Seventy-nine percent
of the infections were nosocomial, and febrile neutropenia (FN) was
observed in 196 (51%) of the infection episodes. Bacteremia was
found in 29% of FN episodes and in 8% of nonneutropenic patients.
Gram-positive bacteria were the leading cause of bacteremia in both
neutropenic and nonneutropenic cases (70% and 58%, respectively).
Presence of an indwelling central catheter increased bacteremia risk
by 3-fold. The overall mortality rate was 17%, whereas 34% of the
patients with bloodstream infections died. Presence of bacteremia
and advanced disease stage increased overall mortality by 6.1-fold
and 3.7-fold, respectively.
Conclusion: Nearly half of the cancer patients developed an infection
during their hospital stays, with gram-positive bacteria being the
predominant etiologic microorganisms. This demonstrates the
changing trends in infections considering that, until 2004, gramnegative
bacteria were the most predominant microorganisms among
cancer patients in our institute.
Keywords: Febrile neutropenia, Cancer, Mortality, Risk factors
Öz
Amaç: Enfeksiyonlar, kanser hastalarında önde gelen morbidite ve
mortaliteleri nedeni olmuşlardır. Bu çalışmada hastanede yatan kanser
hastalarında enfeksiyonların sıklığını, tiplerini, etiyolojilerini ve enfeksiyon
gelişimi ve mortalite için risk faktörlerini belirlemeyi amaçladık.
Gereç ve Yöntemler: Üçüncü basamak bir üniversite hastanesinin iç
hastalıkları servislerinde Ocak-Ağustos 2004 tarihleri arasında izlenmiş
olan erişkin kanser hastaları dahil edildi. Yatış süreleri boyunca
nötropeni, enfeksiyonlar, kültür sonuçları ve mortalite açısından
prospektif olarak izlendiler.
Bulgular: Toplam 473 kanser hastasının 818 hastaneye yatış atağı
izlendi. Toplam 818 yatış atağı sırasında 384 (%46) enfeksiyon atağı
gözlendi- %79’u nozokomiyaldi. Febril nötropeni (FN) tüm atakların
196’sında (%51) görüldü. Bakteremi, FN ataklarının %29’unda ve
nötropenik olmayan hastaların %8’inde görüldü. Gram-pozitifler hem
nötropenik olan hem de olmayan hastalardaki bakteremilerin önde
gelen etkeni olarak görüldü (%70 ve %58, sırasıyla). Santral kateter
varlığının bakteremi riskini 3 kat artırdığı görüldü. Toplam mortalite
%17 iken bakteremisi olan hastalarda mortalite %34 saptandı.
Bakteremi varlığı ve ileri evre hastalık toplam mortaliteyi, sırasıyla, 6,1
ve 3,7 kat artırmaktaydı.
Sonuç: Hastanede yatan kanser hastalarının neredeyse yarısında en
azından bir enfeksiyon gelişmektedir ve bu enfeksiyonlarda grampozitifler
hakimdir. Bu bilgiler, 2004 yılına kadar kanser hastalarında
en sık görülen mikroorganizmaların gram-negatif mikroorganizmalar
olduğu göz önüne alındığında, enfeksiyonlarda değişen eğilimler
olduğunu göstermektedir.
Anahtar Sözcükler: Febril nötropeni, Kanser, Mortalite, Risk faktörleri
Address for Correspondence/Yazışma Adresi: Nursel ÇALIK BAŞARAN, M.D.,
Hacettepe University Faculty of Medicine, Department of Internal Medicine, Ankara, Turkey
Phone : +90 312 305 30 29
E-mail : nurselcbasaran@gmail.com
Received/Geliş tarihi: May 25, 2015
Accepted/Kabul tarihi: January 11, 2016
311

Çalık Başaran N, et al: Infection Episodes in Cancer Patients
Turk J Hematol 2016;33:311-319
Introduction
Infections have become the leading cause of mortality and
morbidity of cancer while supportive and curative treatment
strategies prolong life [1,2]. Cancer and its treatment suppress
the immune system, and long and recurrent hospitalizations
predispose patients to various infections.
Predominant infectious pathogens have been variable in
time with changing cancer treatment strategies, antibacterial
prophylaxis practices, and emerging resistance patterns in
bacteria. Until the 1980s, the leading microorganisms in cancer
patients were enteric gram-negative bacteria and Pseudomonas
aeruginosa. As of the 1980s, gram-positive bacteria became the
most common pathogens in these patients [1,3,4]. However,
recently, nonfermenting gram-negative bacteria have emerged
as the leading pathogens in cancer patients.
It is important to know the risk factors for infections,
changing epidemiology, and resistance patterns of pathogenic
microorganisms for the proper management of infections
in cancer patients. In this study, we aimed to determine the
frequency, type, and etiology of infections and the risk factors
for infections and mortality in hospitalized cancer patients.
Materials and Methods
Study Design and Patients
This study was done in the internal medicine wards of a tertiary
care university hospital. The institutional review board approved
the study and adult cancer patients hospitalized between January
and August 2004 were enrolled and followed prospectively.
Demographic data, cancer type and stage, previous stem cell
transplantation history and type, comorbidities, and presence
of antibacterial utilization in the previous month were recorded
upon admission. Presence of indwelling catheters (central or
peripheral venous, arterial, urinary, or drainage), presence of
parenteral nutrition, requirement of intensive care unit and
mechanical ventilation, therapy for cancer (chemotherapy,
radiation, corticosteroids), vital signs, infections, antibiotic
usage, culture results, and neutrophil counts were recorded
throughout the admission episode. Descriptive data and further
analyses were done based on the admission episodes unless
otherwise specified. One patient might have had more than
one admission. The infectious diseases department followed the
patients and the researchers did not intervene in the diagnostic
and therapeutic processes.
Neutropenia was defined as an absolute neutrophil count
below 500/mm 3 or below <1000/mm 3 and expected to decline
rapidly. Neutropenic infections were classified as clinically
or microbiologically documented infection, bloodstream
infection (BSI), or fever of unknown origin [5]. Infections were
classified as nosocomial according to the 1998 definitions of
the Centers for Disease Control and Prevention [6]. Metastatic
solid tumors, newly diagnosed hematological malignancies
with poor prognosis, and relapsed or treatment-resistant
hematological malignancies were defined as advanced disease
stage. Corticosteroid use was defined as the use of prednisolone
at a dose of >20 mg/day (or equivalent) or over a period of 10
days whatever the dose was. Antifungal prophylaxis was defined
as oral fluconazole/itraconazole used in prophylactic doses.
Microbiological Methods
All the cultures were collected from different parts of the body
according to the presumed infections. They were inoculated onto
suitable media and incubated at 37 °C for 24-48 h. Catheter
cultures were studied quantitatively. For blood cultures, a BD
BACTEC 9000 Blood Culture System (Becton Dickinson Diagnostic
Systems, Sparks, MD, USA) was used. All the microorganisms were
identified by gram staining, conventional microbiological tests
(such as hemolysis, catalase, oxidase, and coagulase reaction),
and the Phoenix System (Becton Dickinson Diagnostic Systems).
Antibiotic susceptibility tests were conducted with the Phoenix
System and for Streptococcus pneumoniae by E-test (AB
BIODISK, Solna, Sweden). Results were evaluated according to
the Clinical and Laboratory Standards Institute 2004 standards.
Statistical Analysis
Data were analyzed by SPSS 11.5 for Windows (SPSS Inc.,
Chicago, IL, USA). Distribution of data was analyzed by
Kolmogorov-Smirnov test. Normally distributed data are
presented as mean ± standard deviation, while abnormally
distributed data are presented as median (minimum-maximum).
Categorical variables were compared by chi-square test and
Fischer’s exact test where appropriate, and continuous variables
were analyzed by Student’s t-test. Risk analysis was performed
by Fisher’s exact chi-square test and parameters that were found
to be significant were introduced into a multivariate logistic
regression model. Relative risk was computed for possible risk
factors with 95% confidence interval and p<0.05 was accepted
as statistically significant.
Results
During the study period, 473 cancer patients between 16 and
82 years of age were enrolled and 818 hospitalization episodes
were followed prospectively. Of these patients, 286 (60%) were
male and the mean age was 51 years (16-82 years). Chronic
diseases accompanying admission episodes were as follows:
4.8% coronary artery disease, 2.7% chronic renal failure,
10.2% diabetes mellitus, and 13.4% hypertension. Solid organ
cancer was seen in 254 (53%) patients while the remaining
had hematological diseases (Table 1). Hematopoietic stem
cell transplantation (HSCT) was done in 49 patients with 63
312

Turk J Hematol 2016;33:311-319
Çalık Başaran N, et al: Infection Episodes in Cancer Patients
admission episodes (7.7%) and half of them were allogeneic
HSCTs.
In the course of 818 hospitalization episodes, a total of 384
(46%) infection episodes were observed and 79% of these
were nosocomial. Febrile neutropenia (FN) was observed in
126 patients having 196 (51%) infection episodes. Acute
myeloid leukemia was the most common underlying disease
(n=35, 35/126, 27%) in patients with FN. Mean duration of
neutropenia was longer in patients with an infection (16.2
days) when compared to those without an infection (8.2 days)
(p=0.002). Bacteremia was found in 29% of FN episodes and in
8% of nonneutropenic infections (p<0.05). Sites of infections in
neutropenic and nonneutropenic patients are shown in Table 2.
The mean hospitalization duration was three times longer for
patients with infection (38±31 days) when compared to the
mean of the total hospitalization episodes (13±23 days).
Table 1. Demographic features of all patients and particularly patients with an infection.
Patient Characteristics All Patients
(n=473) n (%)
Age (years)* 51±16 51±16
Male sex 286 (60.5) 161 (59.2)
Duration of hospitalization (days)* 13±23 38±31
Malignancy
Hematological diseases 219 (46.3) 158 (58)
Non-Hodgkin lymphoma 82 (17) 54 (19.9)
Acute myeloblastic leukemia 43 (9.1) 36 (13.2)
Acute lymphoblastic leukemia 17 (3.6) 14 (5.1)
Multiple myeloma 35 (7.4) 23 (8.5)
Hodgkin disease 12 (2.5) 8 (2.9)
Chronic lymphocytic leukemia 13 (2.8) 6 (2.2)
Chronic myelocytic leukemia 5 (1.1) 5 (1.8)
Myelodysplastic syndrome 8 (1.7) 8 (2.9)
Aplastic anemia 4 (0.8) 4 (1.5)
Solid organ malignancies 254 (53.7) 114 (41.9)
*Mean ± standard deviation.
Lung cancer/malignant pleural mesothelioma 69 (14.6) 30 (11)
Colorectal carcinoma 37 (7.8) 15 (5.5)
Head and neck cancer 24 (5) 5 (1.8)
Esophagus/gastric cancer 23 (4.9) 9 (3.3)
Breast cancer 16 (3.4) 8 (2.9)
Cancer of unknown primary origin 13 (2.7) 6 (2.2)
Pancreas cancer 9 (1.9) 5 (1.8)
Ovarian cancer 8 (1.7) 4 (1.5)
Testicular cancer 7 (1.5) 5 (1.8)
Thyroid/adrenal/neuroendocrine tumor 5 (1.1) 2 (0.7)
Sarcoma 5 (1.1) 4 (1.5)
Malign mesenchymal tumor 4 (0.8) 2 (0.7)
Endometrium cancer 3 (0.6) 2 (0.7)
Cervical cancer 4 (0.8) 3 (1.1)
Bladder cancer 3 (0.6) 3 (1.1)
Prostate cancer 1 (0.2) 1 (0.4)
Renal cell cancer 4 (0.8) 2 (0.7)
Intracranial tumor 3 (0.6) 3 (1.1)
Malignant melanoma 3 (0.6) 1 (0.4)
Patients with Infection
(n=272) n (%)
313

Çalık Başaran N, et al: Infection Episodes in Cancer Patients
Turk J Hematol 2016;33:311-319
Fluconazole as antifungal prophylaxis was given in 63 (7.7%)
episodes as a part of the stem cell transplantation regimen.
Corticosteroids were used in 215 (26.4%) of the admission
episodes. Radiation therapy was performed in 5.1% (42) of
hospitalization episodes. Unfortunately, we had no data about
granulocyte colony-stimulating factor use in this study.
Nonneutropenic episodes constituted 71.4% of all the
hospitalization episodes and in 77.3% of these cases an
immunosuppressive treatment, including corticosteroids, was
used. As expected, there was an immunosuppressive treatment
in 94% of neutropenic episodes (p<0.001). Among the
nonneutropenic episodes, infections were more frequently seen
in those patients receiving any immunosuppressive treatment
than in episodes with no immunosuppressive treatment
(p<0.001). However, there was no difference in terms of
mortality (p=0.111).
At least one pathogenic microorganism was isolated from culture
specimens obtained from patients during 187 (48.6%) infection
episodes. Blood cultures were positive in 29.6% of all the
patients and in 60.6% of neutropenic patients. Gram-negative
microorganisms were the most common (51%) isolates among
all the specimens, whereas gram-positive microorganisms were
the most common (65%) among blood culture isolates (Table
3). Fungi were isolated in 5% of all the specimens and 9% of
the specimens from neutropenic patients. When bacteremic
episodes were considered, gram-positive bacteria were the
leading cause in both neutropenic and nonneutropenic cases
(70% and 58%, respectively; p<0.05) (Table 4).
Table 2. Distribution of infection sites in neutropenic and
nonneutropenic patients.
Infection sites n (%)
Neutropenic episodes (n=206)
Fever of unknown origin 72 (34)
Bloodstream infection 59 (29)
Microbiologically documented infection (other than
bloodstream)
14 (7)
Clinical infection 61 (30)
Nonneutropenic episodes (n=279)
Respiratory infection 94 (3)
Urinary tract infection 64 (22.9)
Gastrointestinal system infection 52 (18)
Skin and soft tissue infection 42 (15)
Bloodstream infection 21 (8)
Central nervous system infection 4 (1.4)
Skeletal system infection 2 (0.7)
Some patients may have had more than one neutropenic episode within one hospital
admission. “n” refers to number of infection episodes and % is the percentage within
neutropenic or nonneutropenic episodes.
The resistance patterns of Staphylococcus aureus,
Staphylococcus epidermidis, Escherichia coli, Klebsiella spp.,
and Pseudomonas spp. are listed in Table 5. In neutropenic
patients, rates of extended-spectrum β-lactamase (ESBL)-
producing E. coli and Klebsiella spp. were found to be high
compared to nonneutropenic patients (p<0.05).
Table 3. The results of blood cultures and all cultures.
Blood
Cultures
All
Cultures
Name of microorganism n (%) n (%)
Staphylococcus aureus 8 (5) 26 (4.8)
Staphylococcus aureus (MR) 2 (1.2) 9 (1.6)
Coagulase-negative staphylococci 11 (7) 17 (3.1)
Coagulase-negative staphylococci (MR) 67 (42) 103 (19.2)
Streptococcus pneumoniae 1 (0.6) 7 (1.3)
Streptococcus viridans 2 (1.2) 4 (0.7)
Streptococcus pyogenes 3 (1.9) 1 (0.1)
Streptococcus agalactiae 2 (1.2) 5 (0.9)
Enterococcus faecalis 2 (1.2) 30 (5.5)
Enterococcus faecium 3 (1.9) 9 (1.6)
Enterococcus gallinarum/casseliflavus 0 2 (0.3)
Corynebacterium spp. 1 (0.6) 2 (0.3)
Gram-positive bacteria: total 102 (65) 215 (40)
Moraxella catarrhalis 0 1 (0.1)
Haemophilus influenza 1 (0.6) 8 (1.4)
Escherichia coli 8 (5) 80 (14.9)
Escherichia coli (ESBL+) 6 (3.8) 33 (6.1)
Klebsiella pneumoniae 2 (1.2) 19 (3.5)
Klebsiella oxytoca 4 (2.5) 17 (3.1)
Klebsiella pneumoniae (ESBL+) 4 (2.5) 9 (1.6)
Klebsiella oxytoca (ESBL+) 0 2 (0.3)
Proteus vulgaris 0 7 (1.3)
Enterobacter spp. 2 (1.2) 15 (2.7)
Salmonella spp. 3 (1.9) 3 (0.5)
Pseudomonas aeruginosa 11 (7) 49 (9.1)
Acinetobacter baumannii 2 (1) 13 (2.4)
Other Acinetobacter spp. 0 3 (0.5)
Stenotrophomonas maltophilia 3 (1.9) 9 (1.6)
Aeromonas spp. 1 (0.6) 3 (0.5)
Citrobacter spp. 0 2 (0.3)
Gram-negative bacteria: total 47 (30) 273 (51)
Candida albicans 6 (3.8) 41 (7.6)
Candida tropicalis 0 2 (0.3)
Trichosporon spp. 2 (1.2) 2 (0.3)
Aspergillus spp. 0 1 (0.1)
Candida glabrata/krusei 0 2 (0.3)
Fungi: total 8 (5) 48 (9)
MR: Methicillin-resistant, ESBL+: extended-spectrum β-lactamase positive.
314

Turk J Hematol 2016;33:311-319
Çalık Başaran N, et al: Infection Episodes in Cancer Patients
Possible risk factors for infection in cancer patients were
analyzed by univariate analysis and then the risk factors found
to increase the occurrence of an infection were introduced into
a multivariate logistic regression model (Table 6). We found that
advanced disease stage, neutropenia for more than 7 days, and
radiation were related to an increased frequency of infection
in cancer patients (p<0.05). Presence of an indwelling central
catheter increased bacteremia risk by 3-fold (Table 6).
The overall mortality rate was 17%, whereas 34% of patients
with BSIs died (p<0.05). Among patients with FN, the mortality
rate was 18.4%, and the occurrence of a BSI increased the
mortality rate to 41%. Presence of bacteremia increased overall
mortality 6.1 times and advanced disease stage increased overall
mortality 3.7 times. On the other hand, usage of prophylactic
antifungal therapy decreased mortality 3.3-fold, but the
p-value was found to be statistically insignificant (p=0.055)
(Table 6). Comorbid chronic diseases had no significant effect on
infection or mortality.
Discussion
This study is a landmark study to show the shift of infectious
etiologies in cancer patients from gram-negative to grampositive
bacteria. Afterwards, a long-term multicentric study
was established in Turkey for microbiological surveillance of FN
patients. Such surveillance studies are valuable to implement
systemic changes in individual institutions and countries.
In this prospective observational study we found that 46% of
all cancer patients developed at least one infection and 85% of
neutropenic patients developed at least one FN attack during
their index hospital stay. Among the neutropenic attacks,
65% were documented clinically or microbiologically, and the
Table 4. Isolates of blood cultures in neutropenic and nonneutropenic patients.
Microorganisms Neutropenic, n (%) Nonneutropenic, n (%) p-value
Coagulase-negative staphylococci (MR) 58 (50.8) 9 (21) <0.05
Coagulase-negative staphylococci 6 (5.3) 5 (12) 0.4
Staphylococcus aureus 3 (2.6) 5 (12)
Streptococcus pyogenes 3 (2.6) 0
Enterococcus faecalis 3 (2.6) 1 (2)
Staphylococcus aureus (MR) 2 (1.75) 0
Enterococcus faecium 2 (1.75) 2 (4.6)
Viridans group streptococci 1 (0.9) 1 (2)
Streptococcus agalactiae 1 (0.9) 1 (2)
Corynebacterium spp. 1 (0.9) 0
Streptococcus pneumoniae 0 1 (2)
Gram-positive bacteria: total 80 (70) 25 (58) <0.05
Escherichia coli 6 (5.3) 2 (4.6)
Escherichia coli (ESBL+) 4 (3.5) 2 (4.6)
Pseudomonas aeruginosa 6 (5.3) 5 (12)
Klebsiella pneumoniae (ESBL+) 4 (3.5) 0
Klebsiella pneumoniae 2 (1.75) 0
Stenotrophomonas maltophilia 3 (2.6) 0
Enterobacter cloaca 2 (1.75) 0
Klebsiella oxytoca 1 (0.9) 3 (7)
Acinetobacter baumannii 1 (0.9) 1 (2)
Aeromonas spp. 1 (0.9) 0
Haemophilus influenzae 0 1 (2)
Gram-negative bacteria: total 30 (26.5) 14 (33) <0.05
Candida spp. 4 (3.5) 2 (4.6)
Trichosporon spp. 0 2 (4.6)
Fungi: total 4 (3.5) 4 (9)
Total 114 (100) 43 (100) <0.05
MR: Methicillin-resistant, ESBL: extended-spectrum β-lactamase.
315

Çalık Başaran N, et al: Infection Episodes in Cancer Patients
Turk J Hematol 2016;33:311-319
Table 5. Resistance patterns of microorganisms in neutropenic and nonneutropenic patients.
Resistance Total, n (%) Nonneutropenic, n (%) Neutropenic, n (%) p-value
Escherichia coli ESBL (-) 80 (70.7) 72 (75.7) 8 (44.4)
ESBL(+) 33 (29.3) 23 (24.3) 10 (55.6) <0.05
Klebsiella spp. ESBL (-) 36 (76.5) 30 (85.7) 6 (50)
ESBL (+) 11 (23.5) 5 (14.3) 6 (50) <0.05
Staphylococcus aureus MS 26 (74) 18 (72) 8 (80)
MR 9 (26) 7 (28) 2 (20) NA
Staphylococcus epidermidis MS 2 (3.7) 2 (10.5) 0 (0)
MR 52 (96.3) 17 (89.5) 35 (100) NA
Pseudomonas aeruginosa MDR (-) 23 (71.8) 18 (75) 5 (62.5)
MDR (+) 9 (28.2) 6 (25) 3 (37.5) NA
ESBL: Extended-spectrum β-lactamase, MR: methicillin-resistant, MS: methicillin-sensitive, MDR: multidrug-resistant.
Table 6. Risk factors for infection, bloodstream infection, and mortality.
Infection Bloodstream Infection Mortality
RR (95% CI) p-value RR (95% CI) p-value RR (95% CI) p-value
Advanced disease stage 3.1 (1.3-7.3) 0.009 - - 3.7 (1.2-11.6) 0.021
Duration of neutropenia >7 days 3.9 (1.6-9.5) 0.002 - - - -
Radiation 3.5 (1.2-7.6) 0.017 - - - -
Indwelling central venous catheter - - 3.0 (1.0-8.0) 0.042 - -
Antifungal prophylaxis - - - - 0.3 (0.09-1.0) 0.055
Bloodstream infection - - - - 6.1 (2.8-13.2) <0.001
RR: Relative risk, CI: confidence interval.
BSI rate was 29% among the FN attacks, comparable to that
reported in numerous other studies [5,7,8,9]. Compared to
previous surveillance data from our hospital, both documented
clinical infection and BSI rates were increased, which might be
attributed to increased awareness of FN and appropriate blood
culture techniques [10,11]. The definition of BSI may also have
an influence on infection rates; the criteria used for skin flora
organisms to be pathogens may be a reason for increased BSI
rate.
Methicillin-resistant coagulase-negative staphylococci (MR-
CoNS) were the most commonly isolated microorganisms from
overall and blood culture specimens. The predominance of grampositive
bacteria and MR-CoNS in BSIs in this cohort was parallel
to findings in the literature. In cancer patients BSIs were due to
gram-negative enteric bacteria and Pseudomonas aeruginosa
in the 1960s and 1970s, but by the middle of the 1980s grampositive
bacteria had become predominant [12,13]. Memorial
Sloan-Kettering Cancer Center reported that the incidence of
gram-positive BSIs increased from 14% to 23% between 1977
and 1987 [1,8]. During the same time period, both the European
Organisation for Research and Treatment of Cancer (EORTC) and
the Febrile Neutropenia Study Group reported that 55%-60%
of BSIs were due to gram-positive microorganisms [14]. In 2003,
Wisplinghoff et al. reported that in cancer patients nosocomial
BSIs in 32% of neutropenic cases and 33% of nonneutropenic
cases were due to CoNS [3]. Srinivasan et al. reported that in
stem cell transplantation recipients, gram-positive bacteria,
and especially members of skin flora such as Staphylococcus
epidermidis, were predominant in BSIs [9]. Mikulska et al.
reported the gram-positive to gram-negative ratio as 60%:40%
in BSI infections of cancer patients [15]. In our study, the
MR-CoNS ratio was the ratio between the blood cultures, so
repetitive isolations from a patient should be kept in mind. We
also accepted a CoNS as a pathogen when ≥1 blood culture was
positive in the presence of fever or hypothermia, hypotension,
indwelling catheter, or antibiotics, which could differ from
other studies in the literature [1].
Recent studies revealed that in hematological malignancies
gram-negative microorganisms have again become the most
relevant microorganisms in BSIs. Cattaneo et al. reported
a predominance of gram-negative bacteria (57.3%) in
hematological malignancies between 2004 and 2010 [16].
Gudiol et al. reported that 49% of BSIs in hematological
malignancies were due to gram-negative microorganisms
and it was concluded that gram-positive microorganisms had
decreased after quinolone prophylaxis [17]. A recently published
316

Turk J Hematol 2016;33:311-319
Çalık Başaran N, et al: Infection Episodes in Cancer Patients
paper by Trecarichi et al. also reported the shift from grampositive
to gram-negative bacteria in BSIs in hematologic
malignancies and again they pointed out the increasing
resistance among gram-negative bacteria [18]. Several studies
demonstrated gram-negative predominance either in blood or
other specimen cultures in hematologic or solid cancer patients,
with a frequency ranging between 24.7% and 75.8% in different
geographic places with high resistance rates, including ESBLpositive
Enterobacteriaceae, multidrug-resistant Pseudomonas
aeruginosa, Acinetobacter spp., and Stenotrophomonas
maltophilia [19,20,21,22]. According to surveillance data
between 2005 and 2009 from our institution, gram-negative
bacteria became the predominant BSI etiology in hematological
malignancies with high resistance patterns [23]. Our study
differs from these other studies in two major points: first, in
our study, we followed both hematological and solid cancer
patients, and second, we accepted at least one positive culture
with CoNS in the presence of fever or central venous catheter.
The growing resistance problems, especially among gramnegative
pathogens, require special efforts in infection control
measures and rational antibiotic usage in cancer patients.
In this study ESBL-positive E. coli (55%) and Klebsiella spp. (50%)
were more frequent in neutropenic cases than nonneutropenic
cases. A literature review revealed that ESBL positivity in cancer
patients ranged from 12% to 75% for E. coli and K. pneumoniae
in different studies [23,24,25,26,27,28,29]. It was also shown
that ESBL positivity negatively affects mortality and morbidity
[26,30,31]. Unfortunately, due to low case numbers, we could
not analyze the mortality effect of resistant gram-negative
bacteria.
We found that patients who were neutropenic for 7 or more
days were prone to infection 3.9-fold more so than others. Poor
prognosis and advanced stage solid or hematologic cancers
were also related to an increased infection risk by 3.1-fold.
Radiation was another risk factor for infection. This might
be explained by the characteristics of the patient group that
received radiotherapy: poor performance status, palliation in
advanced disease, advanced age, or total body radiation prior to
stem cell transplantation.
Indwelling central catheter was a risk factor for BSIs. In the last
30 years, increased use of persistent indwelling catheters has
brought about an increased infection risk, especially for CoNS
BSIs [1,12,32,33]. Moreover, BSI was a risk factor for mortality in
our study. In previous studies mortality in cancer patients with
BSIs ranged between 20% and 35% and this changed according
to the pathogenic microorganisms [21,34,35,36,37,38]. This also
points to the importance of implementing catheter bundles to
decrease catheter-associated BSI rates.
Antifungal prophylaxis was part of the prophylaxis regimen in
HSCT patients and it seemed to lower the mortality, although we
could not show statistical significance. There are some reports
showing azole-resistant breakthrough fungemia, but a recent
study from the EORTC revealed that antifungal prophylaxis
was protective in fungemia in cancer patients [39]. As there
are various studies on different oral antifungal prophylaxes
with different outcomes favoring posaconazole, itraconazole,
or fluconazole use in high-risk patients, further studies are
required about which drug to use for which patient and how
long these drugs must be used [40,41,42].
Conclusion
Nearly half of the cancer patients developed an infection during
their hospital stays, with gram-positive bacteria being the
predominant etiologic microorganisms. This demonstrates the
changing trends in infections considering that, until 2004, gramnegative
bacteria were the most predominant microorganisms
among cancer patients in our institute. Each patient must be
evaluated individually for risk factors, and while antibiotic
treatment is being planned, current local surveillance data and
the resistance patterns of the microorganisms should be taken
into account along with individual risk factors.
Acknowledgment
A part of this study was presented as a poster presentation at the
Febrile Neutropenia Symposium, February 2005, Ankara, Turkey,
and the Interscience Conference on Antimicrobial Agents and
Chemotherapy, December 2005, Washington, DC, USA.
Ethics
Ethics Committee Approval: LUT 05/15; Informed Consent: It
was taken.
Authorship Contributions
Concept: Nursel Çalık Başaran, Ergun Karaağaoğlu, Gülşen
Hasçelik, Mine Durusu Tanrıöver, Murat Akova; Design: Nursel
Çalık Başaran, Ergun Karaağaoğlu, Gülşen Hasçelik, Mine Durusu
Tanrıöver, Murat Akova; Data Collection or Processing: Nursel
Çalık Başaran, Ergun Karaağaoğlu, Gülşen Hasçelik, Mine Durusu
Tanrıöver, Murat Akova; Analysis or Interpretation: Nursel Çalık
Başaran, Ergun Karaağaoğlu, Gülşen Hasçelik, Mine Durusu
Tanrıöver, Murat Akova; Literature Search: Nursel Çalık Başaran,
Ergun Karaağaoğlu, Gülşen Hasçelik, Mine Durusu Tanrıöver,
Murat Akova; Writing: Nursel Çalık Başaran, Ergun Karaağaoğlu,
Gülşen Hasçelik, Mine Durusu Tanrıöver, Murat Akova.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
317

Çalık Başaran N, et al: Infection Episodes in Cancer Patients
Turk J Hematol 2016;33:311-319
and/or affiliations relevant to the subject matter or materials
included.
References
1. Koll BS, Brown AE. The changing epidemiology of infections at cancer
hospitals. Clin Infect Dis 1993;17(Suppl 2):S322-328.
2. Soave R, Sepkowitz KZ. The immunocompromised host. In: Reese RE, Betts
RF (eds). A Practical Approach to Infectious Diseases, 3rd ed. Boston, Little,
Brown & Co., 1991.
3. Wisplinghoff H, Seifert H, Wenzel RP, Edmond MB. Current trends in the
epidemiology of nosocomial bloodstream infections in patients with
hematological malignancies and solid neoplasms in hospitals in the United
States. Clin Infect Dis 2003;36:1103-1110.
4. Pizzo PA. Management of fever in patients with cancer and treatmentinduced
neutropenia. N Engl J Med 1993;328:1323-1332.
5. Serody JS. Fever in immunocompromised patients. N Engl J Med
2000;342:217-218.
6. Crowe MJ, Cooke EM. Review of case definitions for nosocomial infection--
towards a consensus. Presentation by the Nosocomial Infection Surveillance
Unit (NISU) to the Hospital Infection Liaison Group, subcommittee of the
Federation of Infection Societies (FIS). J Hosp Infect 1998;39:3-11.
7. Klastersky J. Management of fever in neutropenic patients with different
risks of complications. Clin Infect Dis 2004;39(Suppl 1):S32-37.
8. Madani TA. Clinical infections and bloodstream isolates associated with
fever in patients undergoing chemotherapy for acute myeloid leukemia.
Infection 2000;28:367-373.
9. Srinivasan A, Wang C, Srivastava DK, Burnette K, Shenep JL, Leung W,
Hayden RT. Timeline, epidemiology, and risk factors for bacterial, fungal, and
viral infections in children and adolescents after allogeneic hematopoietic
stem cell transplantation. Biol Blood Marrow Transplant 2013;19:94-101.
10. Akova M, Akan H, Korten V, Biberoğlu K, Hayran M, Ünal S, Kars A, Kansu E.
Comparison of meropenem with amikacin plus ceftazidime in the empirical
treatment of febrile neutropenia: a prospective randomised multicentre
trial in patients without previous prophylactic antibiotics. Meropenem
Study Group of Turkey. Int J Antimicrob Agents 1999;13:15-19.
11. Erman M, Akova M, Akan H, Korten V, Ferhanoğlu B, Köksal I, Çetinkaya Y,
Uzun Ö, Ünal S; Febrile Neutropenia Study Group of Turkey. Comparison of
cefepime and ceftazidime in combination with amikacin in the empirical
treatment of high-risk patients with febrile neutropenia: a prospective,
randomized, multicenter study. Scand J Infect Dis 2001;33:827-831.
12. Gonzalez-Barca E, Fernandez-Sevilla A, Carratala J, Granena A, Gudiol F.
Prospective study of 288 episodes of bacteremia in neutropenic cancer
patients in a single institution. Eur J Clin Microbiol Infect Dis 1996;15:291-
296.
13. Whimbey E, Kiehn TE, Brannon P, Blevins A, Armstrong D. Bacteremia and
fungemia in patients with neoplastic disease. Am J Med 1987;82:723-730.
14. EORTC International Antimicrobial Therapy Cooperative Group. Grampositive
bacteraemia in granulocytopenic cancer patients. Eur J Cancer
1990;26:569-574.
15. Mikulska M, Del Bono V, Raiola AM, Bruno B, Gualandi F, Occhini D, di
Grazia C, Frassoni F, Bacigalupo A, Viscoli C. Blood stream infections in
allogeneic hematopoietic stem cell transplant recipients: reemergence of
Gram-negative rods and increasing antibiotic resistance. Biol Blood Marrow
Transplant 2009;15:47-53.
16. Cattaneo C, Antoniazzi F, Casari S, Ravizzola G, Gelmi M, Pagani C, D’Adda M,
Morello E, Re A, Borlenghi E, Manca N, Rossi G. P. aeruginosa bloodstream
infections among hematological patients: an old or new question? Ann
Hematol 2012;91:1299-1304.
17. Gudiol C, Bodro M, Simonetti A, Tubau F, Gonzalez-Barca E, Cisnal M,
Domingo-Domenech E, Jimenez L, Carratala J. Changing aetiology, clinical
features, antimicrobial resistance, and outcomes of bloodstream infection
in neutropenic cancer patients. Clin Microbiol Infect 2013;19:474-479.
18. Trecarichi EM, Pagano L, Candoni A, Pastore D, Cattaneo C, Fanci R, Nosari
A, Caira M, Spadea A, Busca A, Vianelli N, Tumbarello M; HeMABIS Registry-
SEIFEM Group, Italy. Current epidemiology and antimicrobial resistance
data for bacterial bloodstream infections in patients with hematologic
malignancies: an Italian multicentre prospective survey. Clin Microbiol
Infect 2015;21:337-343.
19. Chen CY, Tsay W, Tang JL, Tien HF, Chen YC, Chang SC, Hsueh PR. Epidemiology
of bloodstream infections in patients with haematological malignancies
with and without neutropenia. Epidemiol Infect 2010;138:1044-1051.
20. Ghosh I, Raina V, Kumar L, Sharma A, Bakhshi S, Thulkar S, Kapil A. Profile of
infections and outcome in high-risk febrile neutropenia: experience from a
tertiary care cancer center in India. Med Oncol 2012;29:1354-1360.
21. Samonis G, Vardakas KZ, Maraki S, Tansarli GS, Dimopoulou D, Kofteridis
DP, Andrianaki AM, Falagas ME. A prospective study of characteristics
and outcomes of bacteremia in patients with solid organ or hematologic
malignancies. Support Care Cancer 2013;21:2521-2526.
22. Poon LM, Jin J, Chee YL, Ding Y, Lee YM, Chng WJ, Chai LY, Tan LK, Hsu
LY. Risk factors for adverse outcomes and multidrug-resistant Gramnegative
bacteraemia in haematology patients with febrile neutropenia in
a Singaporean university hospital. Singapore Med J 2012;53:720-725.
23. Kara Ö, Zarakolu P, Aşçıoğlu S, Etgül S, Uz B, Büyükaşık Y, Akova M.
Epidemiology and emerging resistance in bacterial bloodstream infections
in patients with hematologic malignancies. Infect Dis (Lond) 2015;47:686-
693.
24. Gudiol C, Tubau F, Calatayud L, Garcia-Vidal C, Cisnal M, Sanchez-Ortega
I, Duarte R, Calvo M, Carratala J. Bacteraemia due to multidrug-resistant
Gram-negative bacilli in cancer patients: risk factors, antibiotic therapy and
outcomes. J Antimicrob Chemother 2011;66:657-663.
25. Kim SH, Kwon JC, Choi SM, Lee DG, Park SH, Choi JH, Yoo JH, Cho BS,
Eom KS, Kim YJ, Kim HJ, Lee S, Min CK, Cho SG, Kim DW, Lee JW, Min
WS. Escherichia coli and Klebsiella pneumoniae bacteremia in patients
with neutropenic fever: factors associated with extended-spectrum
beta-lactamase production and its impact on outcome. Ann Hematol
2013;92:533-541.
26. Trecarichi EM, Tumbarello M, Spanu T, Caira M, Fianchi L, Chiusolo P, Fadda
G, Leone G, Cauda R, Pagano L. Incidence and clinical impact of extendedspectrum-β-lactamase
(ESBL) production and fluoroquinolone resistance
in bloodstream infections caused by Escherichia coli in patients with
hematological malignancies. J Infect 2009;58:299-307.
27. Wang SS, Lee NY, Hsueh PR, Huang WH, Tsui KC, Lee HC, Wu CJ, Chang CM,
Huang CC, Huang CF, Ko WC. Clinical manifestations and prognostic factors
in cancer patients with bacteremia due to extended-spectrum β-lactamaseproducing
Escherichia coli or Klebsiella pneumoniae. J Microbiol Immunol
Infect 2011;44:282-288.
28. Mikulska M, Viscoli C, Orasch C, Livermore DM, Averbuch D, Cordonnier C,
Akova M; Fourth European Conference on Infections in Leukemia Group
(ECIL-4), a joint venture of EBMT, EORTC, ICHS, ELN and ESGICH/ESCMID.
Aetiology and resistance in bacteraemias among adult and paediatric
haematology and cancer patients. J Infect 2014;68:321-331.
29. Zarakolu P, Metan G, Hasçelik G, Akova M. Prevalence of extended-spectrum
beta-lactamases in nosocomial Escherichia coli and Klebsiella spp. strains
isolated from blood cultures. Mikrobiyol Bul 2007;41:579-584a (in Turkish
with English abstract).
30. Du B, Long Y, Liu H, Chen D, Liu D, Xu Y, Xie X. Extended-spectrum
beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae
bloodstream infection: risk factors and clinical outcome. Intensive Care
Med 2002;28:1718-1723.
31. Kang CI, Chung DR, Ko KS, Peck KR, Song JH; Korean Network for Study of
Infectious Diseases. Risk factors for infection and treatment outcome of
extended-spectrum β-lactamase-producing Escherichia coli and Klebsiella
pneumoniae bacteremia in patients with hematologic malignancy. Ann
Hematol 2012;91:115-121.
32. Eggimann P, Sax H, Pittet D. Catheter-related infections. Microbes Infect
2004;6:1033-1042.
33. Rosa RG, Goldani LZ, dos Santos RP. Risk factors for multidrug-resistant
318

Turk J Hematol 2016;33:311-319
Çalık Başaran N, et al: Infection Episodes in Cancer Patients
bacteremia in hospitalized cancer patients with febrile neutropenia: a
cohort study. Am J Infect Control 2014;42:74-76.
34. Anatoliotaki M, Valatas V, Mantadakis E, Apostolakou H, Mavroudis D,
Georgoulias V, Rolston KV, Kontoyiannis DP, Galanakis E, Samonis G.
Bloodstream infections in patients with solid tumors: associated factors,
microbial spectrum and outcome. Infection 2004;32:65-71.
35. Mrázová-Studená M, Drgona L, Spánik S, Krúpová I, Baláz M, Pichna P, Koren
P, Sufliarsky J, Mardiak J, Kunová A, Trupl J, Krcméry V Jr. Bacteremia in
neutropenic versus nonneutropenic cancer patients: etiology and outcome
in 401 episodes. Neoplasma 1997;44:314-318.
36. Velasco E, Byington R, Martins CA, Schirmer M, Dias LM, Goncalves VM.
Comparative study of clinical characteristics of neutropenic and nonneutropenic
adult cancer patients with bloodstream infections. Eur J Clin
Microbiol Infect Dis 2006;25:1-7.
37. Marin M, Gudiol C, Ardanuy C, Garcia-Vidal C, Jimenez L, Domingo-
Domenech E, Perez FJ, Carratala J. Factors influencing mortality in
neutropenic patients with haematologic malignancies or solid tumours
with bloodstream infection. Clin Microbiol Infect 2015;21:583-590.
38. Marin M, Gudiol C, Garcia-Vidal C, Ardanuy C, Carratala J. Bloodstream
infections in patients with solid tumors: epidemiology, antibiotic therapy,
and outcomes in 528 episodes in a single cancer center. Medicine (Baltimore)
2014;93:143-149.
39. Cornely OA, Gachot B, Akan H, Bassetti M, Uzun O, Kibbler C, Marchetti O, de
Burghgraeve P, Ramadan S, Pylkkanen L, Ameye L, Paesmans M, Donnelly JP;
EORTC Infectious Diseases Group. Epidemiology and outcome of fungemia
in a cancer cohort of the Infectious Diseases Group (IDG) of the European
Organization for Research and Treatment of Cancer (EORTC 65031). Clin
Infect Dis 2015;61:324-331.
40. Chan TS, Marcella SW, Gill H, Hwang YY, Kwong YL. Posaconazole versus
fluconazole or itraconazole for prevention of invasive fungal diseases in
patients with acute myeloid leukemia or myelodysplastic syndrome: a costeffectiveness
analysis in an Asian teaching hospital. J Med Econ 2016;19:77-83.
41. El-Cheikh J, Crocchiolo R, Vai A, Furst S, Bramanti S, Sarina B, Granata A,
Faucher C, Mohty B, Harbi S, Bouabdallah R, Vey N, Santoro A, Chabannon
C, Castagna L, Blaise D. Comparison of three distinct prophylactic
agents against invasive fungal infections in patients undergoing haploidentical
hematopoietic stem cell transplantation and post-transplant
cyclophosphamide. Mediterr J Hematol Infect Dis 2015;7:e2015048.
42. Bow EJ, Vanness DJ, Slavin M, Cordonnier C, Cornely OA, Marks DI, Pagliuca A,
Solano C, Cragin L, Shaul AJ, Sorensen S, Chambers R, Kantecki M, Weinstein D,
319

RESEARCH ARTICLE
DOI: 10.4274/tjh.2015.0254
Turk J Hematol 2016;33:320-325
Effect of Hereditary Hemochromatosis Gene H63D and C282Y
Mutations on Iron Overload in Sickle Cell Disease Patients
Orak Hücreli Anemi Hastalarında Herediter Hemokromatozis Geni H63D ve C282Y
Mutasyonlarının Demir Birikimi Üzerindeki Etkisi
Yunus Kasım Terzi 1 , Tuğçe Bulakbaşı Balcı 1 , Can Boğa 2 , Zafer Koç 3 , Zerrin Yılmaz Çelik 1 , Hakan Özdoğu 2 , Sema Karakuş 2 , Feride İffet Şahin 1
1Başkent University Faculty of Medicine, Department of Medical Genetics, Ankara, Turkey
2Başkent University Faculty of Medicine, Department of Hematology, Ankara, Turkey
3Başkent University Faculty of Medicine, Department of Radiology, Ankara, Turkey
Abstract
Objective: Hemochromatosis is an autosomal recessive disease that
is one of the most important reasons for iron overload. Sickle cell
disease is a hemoglobinopathy that occurs as a result of a homozygous
mutation in the hemoglobin gene. Erythrocyte transfusion is
frequently used in the treatment of this disease. Iron overload as a
result of transfusion is important in the mortality and morbidity of
sickle cell anemia patients as well as in other hemoglobinopathies.
In this study, the effect of hemochromatosis gene (HFE) p.H63D
and p.C282Y mutations on transfusion-related cardiac and liver
iron overload in sickle cell disease patients who carry homozygous
hemoglobin S mutation has been investigated.
Materials and Methods: This is a prospective single-center crosssectional
study in patients with homozygous hemoglobin S mutation
between the years 2008 and 2013. The patients were divided into
two groups. The first group (group A, n=31) was receiving chelation
therapy and the second group (group B, n=13) was not. Direct and
indirect iron loads were analyzed by magnetic resonance imaging and
biochemically, respectively. HFE gene mutations were analyzed by
polymerase chain reaction-restriction fragment length polymorphism
method. Statistical analyses were performed by independent samples
t-test.
Results: p.H63D mutation was detected in 10 (32.3%) patients in
group A and in only 1 patient (7.7%) in group B. When the 2 groups
were compared for iron overload, iron deposition in the liver was
significantly higher in group B (p=0.046). In addition, in group A, iron
deposition was significantly higher in HFE mutation carriers compared
to patients without the mutation (p=0.05).
Conclusion: Results of this study showed that HFE gene mutations
are important in iron deposition in the liver in patients with sickle
cell disease.
Keywords: Hemochromatosis, HFE gene, Iron overload, p.C282Y,
p.H63D, Sickle cell anemia
Öz
Amaç: Hemokromatozis, demir birikiminin önemli nedenlerinden
biri olan otozomal resesif bir hastalıktır. Orak hücreli anemi,
hemoglobin genindeki homozigot mutasyon sonucu ortaya çıkan bir
hemoglobinopatidir. Eritrosit transfüzyonu, bu hastalığın tedavisinde
sıklıkla kullanılmaktadır. Transfüzyonun yarattığı demir yükü diğer
hemoglobinopatilerde olduğu gibi orak hücreli anemi hastalarının
mortalite ve morbiditesinde önem kazanmaktadır. Bu çalışmada
hemokromatozis geni (HFE) p.H63D ve p.C282Y mutasyonlarının,
homozigot hemoglobin S mutasyonu taşıyan orak hücreli anemi
hastalarında, kalp ve karaciğerde transfüzyonla ilişkili demir
yüklenmesine olan etkisi araştırılmıştır.
Gereç ve Yöntemler: Bu çalışma, homozigot hemoglobin S mutasyonu
olan hastalarda 2008-2013 yıllarını kapsayan prospektif, tek merkezli
kesitsel bir çalışmadır. Hastalar şelasyon tedavisi alan (n=31) ve
almayan (n=13) olarak iki gruba ayrıldı. Hastalarda direk ve endirekt
demir yükü sırasıyla manyetik rezonans görüntüleme ve biyokimyasal
olarak analiz edildi. HFE geni mutasyon analizi polimeraz zincir
reaksiyonu-restriksiyon fragment uzunluk polimorfizmi yöntemleri
ile gerçekleştirildi. İstatistik analizi Independent samples t-testi
uygulanarak gerçekleştirildi.
Bulgular: p.H63D mutasyonu grup A’da 10 hastada (%32,3), grup B’de
ise sadece 1 (%7,7) hastada saptandı. Demir birikimi açısından gruplar
karşılaştırıldığında karaciğerde demir birikiminin grup B’de istatistiksel
olarak anlamlı derecede yüksek olduğu görülmüştür (p<0,05). Grup
A’da, mutasyonu olan bireylerde olmayanlara göre karaciğerdeki
demir birikiminin istatistiksel olarak anlamlı derecede yüksek olduğu
görülmüştür (p=0,05).
Sonuç: Bu çalışmanın sonucu HFE genindeki mutasyonların, orak
hücreli anemi hastalarında karaciğerde demir birikimi üzerinde etkili
olduğunu göstermektedir.
Anahtar Sözcükler: Hemokromatozis, HFE geni, Demir birikimi,
p.C282Y, p.H63D, Orak hücreli anemi
Address for Correspondence/Yazışma Adresi: Feride İffet ŞAHİN, M.D.,
Başkent University Faculty of Medicine, Department of Medical Genetics, Ankara, Turkey
Phone : +90 312 232 44 00
E-mail : feridesahin@hotmail.com
Received/Geliş tarihi: June 27, 2015
Accepted/Kabul tarihi: September 15, 2015
320

Turk J Hematol 2016;33:320-325
Terzi YK, et al: HFE Mutations and Iron Overload
Introduction
Hereditary hemochromatosis (HH) is an autosomal recessive
disease that is one of the important reasons for transfusionunrelated
iron deposition [1]. The hemochromatosis (HFE) gene,
encoding a transferrin receptor binding protein that regulates
iron absorption from the intestine, is responsible for the disease
and its point mutations result in increased iron absorption and
accumulation [2,3].
The penetrance of the disease is low, as only 1% of p.C282Y
homozygous individuals have clinical presentations. The
disease phenotype results from primary or secondary causes.
Primary (hereditary) hemochromatosis is usually due to gene
mutations including the HFE gene as well as other genes
including transferrin receptor-2 and ferroportin. Secondary
hemochromatosis is a result of inherited or acquired anemia
requiring frequent erythrocyte transfusions [1]. The hereditary
causes of secondary hemochromatosis include thalassemia,
hereditary spherocytosis, and sideroblastic anemia, and the
acquired diseases include anemia due to blood loss [1].
Sickle cell anemia is a hemoglobinopathy resulting from
a homozygous point mutation in the hemoglobin gene
characterized by sickling of erythrocytes [4]. Sickling results in
vaso-occlusion, hemolysis, and chronic anemia, which results in
increased cardiac output due to volume overload and hypoxia as
a result of vaso-occlusion, which ends with organ dysfunction
[5]. Erythrocyte and blood transfusions are frequently used in
the treatment of the disease. Transfusion-related iron overload
is important in mortality and morbidity of sickle cell anemia
patients like in other hemoglobinopathies [3,6]. Mutation
frequencies are known to be different between ethnic groups.
In the current study, the relationship between HFE gene p.H63D
and p.C282Y mutations and iron deposition occurring during
sickle cell anemia progress and their effect on cardiac and liver
iron overload have been investigated.
Materials and Methods
Patients
The study was performed as a prospective, single-center, crosssectional
study on homozygous hemoglobin S mutation patients
followed in the adult hematology department between 2008
and 2013. A total of 45 patients aged between 20 and 42 years
were enrolled in the study and divided into two groups according
to administration of chelation treatment. Patients in group A
(n=31) were receiving chelation treatment and those in group B
(n=13) were not. There were 21 male and 10 female patients in
group A and 4 male and 9 female patients in group B. Patients
in group A received deferasirox (Exjade, Novartis, Switzerland)
therapy when they had evidence of chronic transfusional iron
overload. This evidence included the transfusion of at least
100 mL/kg of packed red blood cells, or a serum ferritin level
consistently greater than 1000 µg/L. Initial daily dose was 20
mg/kg, per os. All patients required escalation of 5 to 10 mg/kg
per daily dose to keep serum ferritin from consistently falling
from baseline. If the serum ferritin fell below 500 µg/L, the
therapy was interrupted. Duration of therapy was 30 months
(range: 18-44 months).
Patients with contraindications for magnetic resonance imaging
(MRI) were excluded from the study. Clinical and laboratory
information of the patients was obtained from the hospital
information management system (Nucleus v9.3.39, Monad Ltd.,
Ankara, Turkey).
Hematological and Biochemical Analyses
Blood cell count and aspartate aminotransferase and alanine
aminotransferase levels were analyzed by automatized methods
in the laboratory. Serum iron concentration (normal range: 59-
158 µg/dL), transferrin saturation (normal range: 15%-75%),
serum ferritin (normal range: 40-340 ng/mL for males and
14-150 ng/mL for females), and C-reactive protein levels were
detected by enzyme-linked immunosorbent assays.
Magnetic Resonance Imaging Analyses
All imaging analyses were performed as described previously
with slight modifications, and a 1.5T MRI system was used for
these analyses (Avanto, Siemens, Erlangen, Germany) [7,8,9].
Briefly, liver and myocardial measurements included T2* value
screenings. Screening time was 14 s. The scan duration was 14
s. The T2* of the heart was assessed by a cardiac gated single
breath-hold multiecho technique. Midventricular short-axis
images were obtained using a gradient-echo sequence (FOV,
440 mm; TR, 120 ms; TE, 3.0-21.7 ms [8 echo times]; flip
angle, 20; slice thickness, 10 mm; matrix, 256x104; number of
averages, 1; bandwidth in Hz/pixel, 814). To measure the liver
iron concentration (LIC), phased-array torso coils were used for
signal detection. The lung was excluded on the axial plane as
much as possible. Liver T2* values were assessed by single breathhold
multiecho technique. Axial images through the liver were
obtained using a gradient-echo sequence (FOV, 400; TR, 120 ms;
TE, 4.3-20.2 ms [6 echo times]; flip angle, 20; slice thickness, 10
mm; matrix, 256x80; number of averages, 1; bandwidth in Hz/
pixel, 814). T2* measurements were performed with Thalassemia
Tools (Cardiovascular Imaging Solutions, London, UK). A fullthickness
region of interest was drawn in the interventricular
septum. The signal intensity of this region for each echo time
was measured and plotted as an exponential signal decay curve.
The lower limit of normal for T2* in the detection of myocardial
iron deposition has been reported as 20 ms, and this value was
used as the cut-off in this study [7,8,9]. A T2* value of >20
ms indicated no cardiac iron overload, and ≤20 ms indicated
321

Terzi YK, et al: HFE Mutations and Iron Overload
Turk J Hematol 2016;33:320-325
cardiac iron overload [10]. Liver iron deposition was evaluated
by R2* value (R2*=1000/T2*). The R2* value was converted to
a liver biopsy equation by using the calibration curve drawn
during the study [11]. LIC in dry tissue of >1.6 mg Fe/g was
regarded as hepatic siderosis.
HFE Gene p.H63D and p.C282Y Mutation Analyses
DNA isolation was done from peripheral blood samples of the
patients who were included in the study and signed the informed
consent form. HFE gene p.H63D and p.C282Y mutations were
analyzed by polymerase chain reaction (PCR)-restriction
fragment length polymorphism. Primer sequences and product
sizes for p.H63D and p.C282Y mutations are shown in Table 1.
PCR conditions were 15 min at 95 °C for initial denaturation,
followed by 35 cycles of 45 s at 94 °C, 30 s at 58 °C, and 30 s
at 72 °C. The PCR was completed after a final elongation step
of 7 min at 72 °C. PCR products were digested with BclI and
RsaI restriction endonucleases for H63D and C282Y mutation
analyses, respectively. The band lengths after digestion are
shown in Table 1. A gel image of the digested products is shown
in Figure 1.
Statistical Analysis
A, liver iron deposition was significantly higher in patients
with mutations compared to the patients without mutations
(p=0.05) (Table 4). C282Y mutation was not observed in any of
the patients included in the study (Table 3).
Discussion
Humans do not have a physiologic mechanism to excrete excess
iron absorbed from the intestine. Iron metabolism is strictly
controlled by intestinal absorption [12]. In the case of increased
iron absorption, iron deposits occur in all organs. As iron
accumulation is a problem directly influencing the prognosis
in sickle cell disease patients, we proposed that coexisting HFE
mutations could contribute to the deposition process in these
cases.
HH is characterized by hepatic fibrosis, cirrhosis, diabetes,
skin pigmentation, hypogonadism, and articular and cardiac
disorders and, in advanced stages of the disease, iron deposition
in other organs as a result of increased iron absorption from the
intestines [10]. The disease occurs as a result of HFE gene H63D
and C282Y mutations [13].
The Kolmogorov-Smirnovtest was used to show the normal
distribution of the data. Significant differences between groups
were determined using t tests. Data were expressed as means.
All statistical analyses and tests were performed with the SPSS
statistical package (SPSS 17.0, Chicago, IL, USA) and p<0.05 was
regarded as statistically significant.
Results
A total of 45 patients aged between 20 and 42 years were enrolled
in the study. There were 20 male and 11 female patients in group
A and 5 male and 9 female patients in group B. All patients
were homozygous for the hemoglobin S mutation. Biochemical
and MRI results of group A and group B patients are shown in
Table 2. When the 2 groups were compared for iron deposition
in the liver, iron deposition was found to be significantly lower
in group A (p=0.05). In addition, platelet count was found to be
significantly higher in group A (p<0.03). We did not observe a
statistically significant difference between the 2 groups when
other MRI and biochemical values were compared.
HFE gene H63D mutation was detected in 10 (32.3%) patients
in group A and in 1 (7.7%) patient in group B (Table 3). In group
Figure 1. Gel image of H63D and C282Y mutations analyzed
by polymerase chain reaction-restriction fragment length
polymorphism. Lanes 1 and 5 are uncut polymerase chain
reaction products, lanes 2 and 3 are samples from patients normal
for H63D mutation, and lane 4 is a heterozygous patient sample.
Lanes 6-8 are normal patient samples for C282Y mutation.
Table 1. Primer sequences, amplicon lengths, and restriction enzymes used in the study.
Mutation Forward Primer (5’-3’) Reverse Primer (5’-3’) Amplicon (bp) Restriction
Endonuclease Enzyme
p.H63D ACATGGTTAAGGCCTGTTGC GCCACATCTGGCTTGAAATT 208 BclI
p.C282Y TGGCAAGGGTAACAGATCC CTCAGGCACTCCTCTCAACC 387 RsaI
322

Turk J Hematol 2016;33:320-325
Terzi YK, et al: HFE Mutations and Iron Overload
Table 2. Biochemical and magnetic resonance imaging results of patients in group A and group B. Liver iron deposition and
platelet count were found to be significantly different in group A compared to group B (*p<0.05).
Mean
Distributions
t-test
Group A Group B Highest Lowest p-value
Cardiac MRI (T2*, ms) 20.4 27.7 -19.78 5.03 0.238
Liver MRI (Fe, mg/g) 1.2 2.1 -1.83 -0.02 0.046*
Ferritin (ng/mL) 547.9 809.6 -734.08 210.76 0.259
Transferrin saturation (%) 46.7 27.8 -0.47 38.35 0.055
CRP (mg/L) 14.8 16.1 -15.04 12.44 0.845
ALT (U/L) 23.1 31.0 -20.99 5.10 0.209
AST (U/L) 40.6 48.9 -27.95 11.53 0.377
Leukocyte count (x10 3 /µL) 12.5 11.0 -1.37 4.42 0.290
Platelet number (x10 3 /µL) 430.1 329.6 10.27 190.64 0.030*
Serum albumin (g/dL) 3.9 3.7 -0.57 1.03 0.543
Creatinine (mg/dL) 0.8 0.9 -0.62 0.30 0.483
Hemoglobin (g/dL) 9.2 9.3 -1.32 1.00 0.782
MCV (fL) 89.3 89.9 -11.26 10.02 0.905
MRI: Magnetic resonance imaging, CRP: C-reactive protein, ALT: alanine aminotransferase, AST: aspartate aminotransferase, MCV: mean corpuscular volume.
Table 3. Genotype and allele frequencies of patients in the
2 groups.
Group A
Genotype
Allele frequency (%)
Group B
Genotype
Allele frequency (%)
p.H63D
p.C282Y
CC 21 GG 31
CG 9 GA -
GG 1 AA -
C 82.3 G 100
G 17.7 A 0
CC 13 GG 14
CG 1 GA -
GG - AA -
C 96.4 G 100
G 3.6 A 0
Sickle cell anemia is one of the most frequent hereditary anemias
resulting from a homozygous point mutation in the hemoglobin
gene [14]. Endothelial cell activation and microvascular ischemia
may cause tissue damage in sickle cell anemia, and the spectrum
of clinical outcomes and tissue damage severity varies among
individuals. Because of the above findings, it was suggested that
although sickle cell anemia is a single-gene disease, it should
be assessed as a multifactorial disorder [15]. Blood transfusion
and blood change, used frequently in the treatment of the
disease, cause a decrease in erythrocyte number and sickle
cell hemoglobin polymer formation. However, as a result of
treatment, iron deposition and organ damage occur in patients
[12,16]. In our study, the relationship between iron deposition
and HFE gene H63D and C282Y mutations has been investigated.
A total of 45 patients were enrolled in the study.
HFE gene mutations have been investigated in another
hemoglobinopathy, thalassemia, and the presence of a single
mutation was not found to affect iron overload [3]. The effect
of the presence of these mutations has been also investigated in
sickle cell anemia and they were not found to affect the degree
of iron overload [13,14].
C282Y mutation was observed in 90% of hemochromatosis
patients previously [10]. We did not observe this mutation in
our patients. On the other hand, we observed H63D mutation in
a heterozygous state in 9 patients (29%) and in a homozygous
state in 1 (3%) patient in group A. The mutation was observed
in a heterozygous state in only 1 patient in group B (Table 3).
The effect of H63D mutation on iron deposition has not yet
been clearly identified. Iron deposition in the liver was found
to be significantly higher in group B (p<0.05). In the literature,
in some sickle cell patients who received chelating agents, iron
deposition in tissues was observed, whereas in others it was not
[1,4]. Our results show that genetic backgrounds of patients
affect the results of the treatment and clinical benefits from
treatment.
The C282Y mutation has been reported to be more effective
in iron absorption equilibrium than the H63D mutation [2,10].
As we did not find the C282Y mutation in our patients, we
concluded that the H63D mutation could also be effective on
iron absorption even in the heterozygous state.
323

Terzi YK, et al: HFE Mutations and Iron Overload
Turk J Hematol 2016;33:320-325
Table 4. Biochemical and magnetic resonance imaging measurement results of patients in group A. Liver iron deposition was
found to be significantly higher (*p=0.05) in patients with HFE mutations compared to the patients without HFE mutations.
Mean
t-test
Distributions Highest p-value
HFE Mutation-negative HFE Mutation-positive Lowest
Cardiac MRI (T2*, ms) 19.429 11.061 -7.43 24.17 0.283
Liver MRI (Fe, mg/g) 0.892 2 -1.44 0.00 0.050*
Ferritin (ng/mL) 444.533 599.083 -675.17 366.07 0.528
Transferrin saturation (%) 44.625 35 -56.17 75.42 0.740
CRP (mg/L) 20.652 10 -13.22 34.67 0.364
ALT (U/L) 21.350 20.857 -6.55 7.54 0.886
AST (U/L) 34.650 47.500 -39.96 14.26 0.292
Leukocyte count (x10 3 /µL) 12.271 12.549 -4.48 3.93 0.890
Thrombocyte number (x10 3 /µL) 427.333 434.125 -179.93 166.34 0.932
Serum albumin (g/dL) 3.999 3.823 -1.46 1.81 0.781
Creatinine (mg/dL) 0.893 0.566 -0.31 0.96 0.277
Hemoglobin (g/dL) 9.255 9 -1.31 1.45 0.917
MCV (fL) 90.300 84.025 -8.60 21.15 0.370
MRI: Magnetic resonance imaging, CRP: C-reactive protein, ALT: alanine aminotransferase, AST: aspartate aminotransferase, MCV: mean corpuscular volume, HFE: Hemochromatosis
gene.
Although determination of ferritin level is an indirect method, it
is one of the most valuable tools for follow-up of iron overload in
patients with hemoglobinopathy. The source of the ferritin in the
blood may be different. In the case of high levels of ferritin (3000
µg/L), the possible source is blood and bone marrow; however, if
the measurable level of ferritin is below 3000 µg/L, the possible
source of ferritin is the reticuloendothelial system. Fluctuation of
the measured ferritin level may be observed in the case of infection
or inflammations. It has already been shown that the most accurate
indicator of total body ferritin load is liver ferritin level [9]. Although
liver biopsy was not performed for the patients to determine the
ferritin load of the liver, and this may be considered as a weakness
of the study, MRI is one of the other valuable tools to determine
ferritin load in the liver and heart, and reproducibility is one of the
strong features of this method [11].
Conclusion
HFE gene mutations are effective on iron deposition in the liver
in sickle cell disease patients. In patients for whom recurrent
erythrocyte transfusions are required, genotyping of the HFE
gene will be helpful while management with chelating agents
is being planned.
Acknowledgments
This study was approved by the Başkent University Institutional
Review Board (Project No: KA09/254) and supported by the
Başkent University Research Fund.
Ethics
Ethics Committee Approval: This study was approved by Başkent
University Institutional Review Board (Project no: KA09/254);
Informed Consent: Written informed consent was obtained
from all patients.
Authorship Contributions
Surgical and Medical Practices: Can Boğa, Hakan Özdoğu, Sema
Karakuş, Zafer Koç; Concept: Tuğçe Bulakbaşı Balcı, Feride İffet
Şahin, Zerrin Yılmaz Çelik, Can Boğa, Hakan Özdoğu, Sema
Karakuş; Design: Tuğçe Bulakbaşı Balcı, Feride İffet Şahin,
Zerrin Yılmaz Çelik, Can Boğa, Hakan Özdoğu, Sema Karakuş,
Zafer Koç; Data Collection or Processing: Feride İffet Şahin,
Zerrin Yılmaz Çelik, Can Boğa, Hakan Özdoğu, Sema Karakuş,
Zafer Koç, Yunus Kasım Terzi; Analysis or Interpretation: Yunus
Kasım Terzi, Feride İffet Şahin, Can Boğa, Hakan Özdoğu, Zafer
Koç; Literature Search: Tuğçe Bulakbaşı Balcı, Feride İffet Şahin,
Zerrin Yılmaz Çelik, Can Boğa, Hakan Özdoğu, Zafer Koç, Yunus
Kasım Terzi; Writing: Feride İffet Şahin, Yunus Kasım Terzi, Can
Boğa, Zafer Koç.
Conflict of Interest: No conflict of interest was declared by the
authors.
Financial Disclosure: Support provided by Başkent University
Research Foundation (Project no: KA09/254).
324

Turk J Hematol 2016;33:320-325
Terzi YK, et al: HFE Mutations and Iron Overload
References
1. Beutler E, Hoffbrand AV, Cook JD. Iron deficiency and overload. Hematology
Am Soc Hematol Educ Program 2003:40-61.
2. Press RD. Hereditary hemochromatosis: impact of molecular and iron-based
testing on the diagnosis, treatment, and prevention of a common, chronic
disease. Arch Pathol Lab Med 1999;123:1053-1059.
3. Longo F, Zecchina G, Sbaiz L, Fischer R, Piga A, Camaschella C. The influence
of hemochromatosis mutations on iron overload of thalassemia major.
Haematologica 1999;84:799-803.
4. Harmatz P, Butensky E, Quirolo K, Williams R, Ferrell L, Moyer T, Golden D,
Neumayr L, Vichinsky E. Severity of iron overload in patients with sickle
cell disease receiving chronic red blood cell transfusion therapy. Blood
2000;96:76-79.
5. Karakaş MF, Büyükkaya E, Kurt M, Çelik M, Karakaş E, Büyükkaya S, Akçay
AB, Sen N. Left ventricular dyssynchrony is an early manifestation of heart
involvement in sickle cell anemia. Echocardiography 2013;30:521-526.
6. Boga C, Kozanoglu I, Ozdogu H, Ozyurek E. Plasma exchange in critically ill
patients with sickle cell disease. Transfus Apher Sci 2007;37:17-22.
7. Anderson LJ. Assessment of iron overload with T2* magnetic resonance
imaging. Prog Cardiovasc Dis 2011;54:287-294.
8. Bayraktaroğlu S, Aydinok Y, Yildiz D, Uluer H, Savaş R, Alper H. The
relationship between the myocardial T2* value and left ventricular
volumetric and functional parameters in thalassemia major patients. Diagn
Interv Radiol 2011;17:346-351.
9. Wood JC, Enriquez C, Ghugre N, Tyzka JM, Carson S, Nelson MD, Coates TD.
MRI R2 and R2* mapping accurately estimates hepatic iron concentration
in transfusion-dependent thalassemia and sickle cell disease patients. Blood
2005;106:1460-1465.
10. Yönal O, Hatirnaz O, Akyüz F, Ozbek U, Demir K, Kaymakoglu S, Okten A,
Mungan Z. HFE gene mutation, chronic liver disease, and iron overload in
Turkey. Dig Dis Sci 2007;52:3298-3302.
11. Garbowski MW, Carpenter JP, Smith G, Roughton M, Alam MH, He T, Pennell
DJ, Porter JB. Biopsy-based calibration of T2* magnetic resonance for
estimation of liver iron concentration and comparison with R2 Ferriscan. J
Cardiovasc Magn Reson 2014;16:40.
12. Bozkaya H, Bektas M, Metin O, Erkan O, Ibrahimoglu D, Dalva K, Akbiyik
F, Gurel S, Bozdayi AM, Akay C, Yurdaydin C, Aslan O, Uzunalimoglu O.
Screening for hemochromatosis in Turkey. Dig Dis Sci 2004;49:444-449.
13. Trent RJ, Le H, Yu B, Young G, Bowden DK. DNA testing for haemochromatosis:
diagnostic, predictive and screening implications. Pathology 2000;32:274-
279.
14. Raghupath R, Manvani D, Little JA. Iron overload in sickle cell disease. Adv
Hematol 2010;2010:272940.
15. Kutlar A. Sickle cell disease: a multigenic perspective of a single gene
disorder. Hemoglobin 2007;31:209-224.
16. Jeng MR, Adams-Graves P, Howard TA, Whorton MR, Li CS, Ware RE.
Identification of hemochromatosis gene polymorphisms in chronically
transfused patients with sickle cell disease. Am J Hematol 2003;74:243-248.
325

RESEARCH ARTICLE
DOI: 10.4274/tjh.2015.0356
Turk J Hematol 2016;33:326-330
Health-Related Quality of Life, Depression, Anxiety, and
Self-Image in Acute Lymphocytic Leukemia Survivors
Akut Lenfoblastik Lösemi Tedavisi Almış Çocuklarda Yaşam Kalitesi, Depresyon, Anksiyete
ve Kendilik İmajı Değerlendirmesi
Birol Baytan 1 , Çiğdem Aşut 2 , Arzu Çırpan Kantarcıoğlu 1 , Melike Sezgin Evim 1 , Adalet Meral Güneş 1
1Uludağ University Faculty of Medicine, Department of Pediatrics, Division of Pediatric Hematology, Bursa, Turkey
2Uludağ University Faculty of Medicine, Department of Pediatrics, Bursa, Turkey
Abstract
Objective: With increasing survival rates in childhood acute
lymphocytic leukemia (ALL), the long-term side effects of treatment
have become important. Our aim was to investigate health-related
quality of life, depression, anxiety, and self-image among ALL survivors.
Materials and Methods: Fifty patients diagnosed with ALL and their
siblings were enrolled. The Kovacs Children’s Depression Inventory,
State-Trait Anxiety Inventory, Offer Self-Image Questionnaire, and
Pediatric Quality of Life Inventory TM were used for collecting data.
ANOVA tests were used to determine if there were any significant
differences between groups.
Results: ALL survivors had higher depression, more anxiety symptoms,
lower quality of life, and more negative self-image when compared
to their siblings.
Conclusion: Continuous diagnostic and interventional mental health
services might be necessary for possible emotional side effects of
treatment during and after the treatment. Rehabilitation and followup
programs should be implemented for children during and after
treatment for ALL.
Keywords: Childhood leukemia, Depression, Anxiety, Self-image,
Health-related quality of life
Öz
Amaç: Akut lenfoblastik lösemide (ALL) sağkalım oranlarının
artmasıyla tedavinin uzun süreli yan etkileri önemli hale gelmiştir.
Bu çalışmanın amacı da ALL sağkalanlarında, sağlıkla ilişkili yaşam
kalitesi, depresyon, anksiyete ve kendilik imajını incelemektir.
Gereç ve Yöntemler: ALL tanısı almış 50 çocuk ile onların aynı
sayıdaki sağlıklı kardeşleri çalışmaya dahil edilmiştir. Verileri toplamak
için, Kovaks Çocuklar için Depresyon Anketi, Durumluluk-Sürekli
Kaygı Envanteri, Offer Kendilik İmajı anketi ve Pediatric Quality of
Life Inventory TM kullanılmıştır. Gruplar arası farklar ANOVA yöntemi
kullanılarak araştırılmıştır.
Bulgular: ALL sağkalanlarının, kardeşlerine göre, depresyon ve
anksiyete puanları anlamlı olarak fazladır. Ayrıca, benlik imajlarının
daha olumsuz, yaşam kalitelerinin daha düşük idi.
Sonuç: ALL tedavisi sırasında ve sonrasında olası duygusal yan etkiler
için sürekli tanısal ve girişimsel mental sağlık servisleri gerekli olabilir.
Tedavi sırasında ve sonrasında ALL’li çocuklar için rehabilitasyon ve
izlem programları uygulanmalıdır.
Anahtar Sözcükler: Çocukluk çağı lösemisi, Depresyon, Anksiyete,
Kendilik imajı, Sağlıkla ilişkili yaşam kalitesi
Introduction
Acute lymphoblastic leukemia (ALL) is the most common type
of childhood cancer. Over the past decades, survival rates
have improved substantially [1,2]. Among the advances in ALL
treatment, Health-related quality of life (HRQL), which is a
multidimensional construct that encompasses several domains
such as physical, cognitive, social, and emotional functioning,
was recognized as an important outcome measure of ALL
survivors [3].
Bansal et al. [4] found that children with ALL have significantly
poorer social, physical, and emotional health and well-being
than their peers and siblings. All treatment protocols of ALL
contain higher cumulative doses of asparaginase, vincristine,
and corticosteroids. Significant treatment-related toxicities
might develop during the treatment period. These treatment
outcomes might affect HRQL adversely [5].
Besides poorer HRQL, behavioral and emotional problems,
including withdrawal, depression, anxiety, and attention
problems, have been reported among children with ALL [6].
Address for Correspondence/Yazışma Adresi: Birol BAYTAN, M.D.,
Uludağ University Faculty of Medicine, Department of Pediatrics, Division of Pediatric Hematology, Bursa, Turkey
Phone : +90 224 295 06 03
E-mail : baytanbirol@yahoo.com
Received/Geliş tarihi: October 12, 2015
Accepted/Kabul tarihi: January 11, 2016
326

Turk J Hematol 2016;33:326-330
Baytan B, et al: Emotional Status and Health Quality in Childhood ALL
Some studies determined that long-term survivors of childhood
cancer experience a great number of problems with social
competence and symptoms of depression compared to healthy
children and siblings [7,8].
Another important area of psychological outcome that has not
been studied widely is the impact of cancer on the survivor’s
self-image. This has been defined as a set of self-attitudes that
reflect a description and an evaluation of one’s own behavior
and attributes [9]. Self-image may be influenced by a chronic
illness during childhood that affects physical appearance and
opportunities for social interaction [10]. Having negative selfimage
could be predictive of those survivors with adjustment
problems [11].
In the course of intensive therapy for ALL, there is a significant
impairment in quality of life in the physical and psychosocial
domains, but it improves significantly after a period of time
[4]. Our study includes ALL patients in remission for 2-13 years.
We analyzed the time periods in 3 different groups (2-5 years,
6-10 years, and more than 10 years of survival) to determine the
effect of the time after treatment on behavior and HRQL.
The aim of this study, therefore, was to investigate HRQL, selfimage,
depression, anxiety behaviors, and the impact of time
period after treatment among ALL survivors.
Materials and Methods
The study group contained 50 children in the complete remission
period of ALL. The control group consisted of ALL patients’
siblings. The study group (standard and medium risk group)
had no history of cranial radiation. The patients were treated
with the BFM-9 leukemia protocol. Intrathecal methotrexate
was given for central nervous system prophylaxis. The study
group was composed of 27 (54%) female and 23 (46%) male
participants. The age of the groups ranged between 13 and 18
years, and the average age of the study group was 15.8±1.8
years. The average age of the control group was 14.2±0.8 years.
The control group was chosen from age- and sex-matched
siblings because they shared similar social environmental and
genetic features with the study group, apart from not having
been diagnosed with ALL.
If the family’s monthly income was under 2000 Turkish lira
(TL), participants were considered as a lower income group. If it
was between 2000 and 5000, they were considered as a middle
income group, and if it was above 5000 TL, they were considered
as a higher income group.
The data of the study were gathered from 4 psychometrically
validated self-report instruments. All of them were administered
in one session to each participant separately.
The Kovacs Children’s Depression Inventory (KCDI) is filled out
by the adolescent. In this 27-item scale, there are three choices
for each item. The patient is asked to choose the most relevant
choice for considering the last 2 weeks. Reliability and validity
study of the Turkish version of the KCDI was carried out by Öy
[12] and a score of 19 was identified as the cut-off level.
The State-Trait Anxiety Inventory assesses the anxiety levels
of the participants. It consists of two parts. The State Anxiety
Inventory (SAI) requires the individual to describe how she/
he feels at a given moment and under certain conditions and
to respond to the items considering her/his feelings related to
that specific condition. On the other hand, the Trait Anxiety
Inventory (TAI) makes individuals express how they feel in
general. The total score of each scale ranges between 20 and
80. There are 4 choices for each item. High scores (more than 41
points) indicate high anxiety levels. The reliability and validity
of the Turkish version of the SAI and TAI were studied by Öner
and Le Compte [13].
The Offer Self-Image Questionnaire (OSIQ) was developed to
identify the opinions of adolescents on self-esteem and sense of
identity. Developed by Offer, Ostrov, Howard, and Dolan in 1989,
the OSIQ is a 6-point Likert-type scale (choosing the answer that
the individual identifies with best) and measures individuals’
adaptation in 11 different areas. The 99-item questionnaire
form analyzes the self-image of adolescents in five dimensions
(psychological, social, sexual, familial, and coping). Low scores
(50 points and below) indicate low self-esteem. The reliability
and validity of the Turkish version of the OSIQ were studied by
Savaşır and Şahin [14].
The Pediatric Quality of Life Inventory (PedsQL) examines
individuals’ physical, psychological, and spiritual functioning,
which are the characteristics of general well-being as defined
by the World Health Organization. In addition to these, the scale
also emphasizes school functioning. It consists of two subscales,
which are the total physical health score (TPHS) and total score
of psychosocial health (TSPH), and there is a total scale score,
which is the combination of these two subscales. This scale
does not include a cut-off level but lower scores indicate poor
quality of life. The reliability and validity of the Turkish version
of the PedsQL was studied by Çakın Memik et al. [15].
This research was approved by the Uludağ University Medical
Ethics Committee and therefore the research was performed
in accordance with the ethical standards of the Helsinki
Declaration.
SPSS 22.00 and ANOVA were used to determine if there were
any significant differences between the groups.
Results
The results from patients’ and siblings’ reports are summarized
in Table 1.
327

Baytan B, et al: Emotional Status and Health Quality in Childhood ALL
Turk J Hematol 2016;33:326-330
Mean scores of the study and the control groups for self-report
instruments are shown in Table 2.
Quality of life and self-image scores of ALL survivors were lower
and depression and anxiety scores were higher than in the
siblings. Table 3 shows the comparison of the quality of life,
depression, anxiety, and self-image scores in the groups.
There were significant differences between groups. The study group
Table 1. The demographic features of the study and control
groups.
Study Group
n 50 50
Sex
Education
Non-educated
Primary school
High school
Undergraduate
Graduate
Income
Low
Medium
High
Employment status
Employed
Unemployed
27 girls
23 boys
9
5
30
5
1
9
39
2
6
44
54%
48%
18%
10%
60%
10%
2%
18%
78%
4%
12%
88%
Control Group
27 girls
23 boys
9
9
27
4
1
9
39
2
7
43
54%
48%
18%
18%
54%
8%
2%
18%
78%
4%
14%
86%
had more depression and anxiety symptoms and negative selfimage.
Additionally, physical, psychological, and total qualities of
life were lower than in their siblings. Table 4 shows mean scores of
the depression, anxiety, quality of life, and self-image of survivors
in different time periods after ALL treatment. Comparison of the
depression, anxiety, quality of life, and self-image scores between
ALL survivors and siblings is shown in Table 5.
There were significant differences between the groups’ TvPHS,
STS, TSPH, and KCDI scores according to time period after ALL
treatment. Depression and quality of life scores were lower in
the group of survivors 2-5 years after treatment.
Discussion
According to our study, the total quality of life score of the
ALL survivors was significantly lower compared to their siblings
and they had significantly lower self-concept (including the
psychological, social, sexual, and familial self domains). Our
study also showed that ALL survivors had significantly higher
depression and anxiety symptoms than their siblings. Finally,
our research revealed that the quality of life and depression
scores were significantly lower among survivors 2-5 years after
treatment when compared to 6-9 years and 10 years or more.
Liew et al. [16] reported that adult long-term ALL survivors
had a global HRQL score similar to the general population. van
Litsenburg et al. [8] reported clinically important impaired HRQL
scores of ALL survivors compared to the norms. ALL treatment
impairs daily activities, family life, and school success, leading
to low quality of life [17]. It is known that hospitalization for
chemotherapy leads to problems such as social alienation and
Table 2. Mean scores of the study and control groups for self-report instruments.
Groups TPHS TSPH STS KCDI SAI TAI OSIQ
Study (n=50) Mean 79.36 79.70 80.18 29.56 50.92 51.82 238.16
Standard deviation 16.73 15.15 13.52 5.75 7.31 5.24 50.02
Control (n=50) Mean 95.10 85.46 90.06 22.80 41.58 42.22 281.08
Standard deviation 6.61 11.67 8.17 4.70 4.55 3.89 38.23
TPHS: Total physical health score, TSPH: total score of psychosocial health, STS: scale total score, KCDI: Kovacs Children’s Depression Inventory, SAI: State Anxiety Inventory, TAI: Trait
Anxiety Inventory, OSIQ: Offer Self-Image Questionnaire.
Table 3. The comparison of groups’ quality of life, depression, anxiety, and self-image scores.
Source Sum of Squares df Mean Squares F p
TPHS between groups 6193.69 1 6193.693 38.25 0.00*
2440.36 1 2440.36 19.54 0.00*
TSPH between groups 829.44 1 829.44 4.53 0.00*
KCDI between groups 1142.44 1 1142.40 41.34 0.00*
SAI between groups 2180.89 1 2180.89 58.69 0.00*
TAI between groups 2304 1 2304 107.83 0.00*
OSIQ between groups 46,053.16 1 46,053.16 23.23 0.00*
*: p≤0.05, F: F distribution, df: degrees of freedom, TPHS: total physical health score, TSPH: total score of psychosocial health, KCDI: Kovacs Children’s Depression Inventory, SAI: State
Anxiety Inventory, TAI: Trait Anxiety Inventory, OSIQ: Offer Self-Image Questionnaire.
328

Turk J Hematol 2016;33:326-330
Baytan B, et al: Emotional Status and Health Quality in Childhood ALL
Table 4. Mean scores of depression, anxiety, quality of life, and self-image regarding period after acute lymphocytic leukemia
treatment.
Period after ALL Treatment TPHS STS TSPH KCDI SAI TAI OSIQ
Mean
2-5 years SD
n=12
Mean
6-9 years SD
n=24
Mean
10 and more years SD
n=14
64.58
15.10
81.33
16.72
87.78
8.88
67.33
14.74
83.08
11.34
86.14
8.31
68.91
4.63
81.33
11.88
86.07
9.26
36
5.66
28.75
4.96
51.50
5.14
52.08
8.19
52.500
20.94
52.54
5.54
232.25
41.01
234.79
44.91
ALL: Acute lymphocytic leukemia, SD: standard deviation, TPHS: total physical health score, TSPH: total score of psychosocial health, STS: scale total score, KCDI: Kovacs Children’s
Depression Inventory, SAI: State Anxiety Inventory, TAI: Trait Anxiety Inventory, OSIQ: Offer Self-Image Questionnaire.
25.42
2.31
48.43
6.81
50
4.71
249
65.29
Table 5. Comparison of the depression, anxiety, quality of
life, and self-image scores regarding period after acute
lymphocytic leukemia treatment.
Source
TPHS between
groups
Sum of
Squares
loneliness. For a child, quality of life is likely to be compromised
by the pain of the illness and treatment, lack of energy to
enjoy everyday activities, and fears about the future [18]. After
cancer treatment, we usually observe that children do not
want to attend to school again. Parents also usually have fears
about their children contracting infections in school. The idea
that their children are still vulnerable might be the reason for
social isolation (according to our interviews with parents, ALL
survivors are rarely allowed to join social activities outside the
home), which might affect children’s quality of life negatively.
Self-concept findings are similar to those of other studies, such
as research on self-esteem among 578 pediatric ALL survivors
compared to control groups [9]. According to some other
studies, adult survivors of a variety of childhood cancers were
found to have significantly lower self-esteem [18,19]. However,
according to Maggiolini et al. [20], long-term adolescent ALL
survivors had a more positive and mature self-image compared
to a healthy student group. According to our study, self-image
components such as coping capacity and individual values of
df
Mean
Squares
3760.91 2 1880.45 8.87 0.00*
STS between groups 2680.51 2 1340.25 10.08 0.00*
TSPH between
groups
KCDI between
groups
2027.70 2 1013.85 5.19 0.01*
752.39 2 376.19 20.28 0.00*
SAI between groups 64.42 2 32.21 5.19 0.31
TAI between groups 123.42 2 61.71 1.16 0.32
OSI between groups 2336.51 2 1168.27 0.46 0.64
*: p≤0.05, F: F distribution, df: degrees of freedom, TPHS: total physical health score,
TSPH: total score of psychosocial health, STS: scale total score, KCDI: Kovacs Children’s
Depression Inventory, SAI: State Anxiety Inventory, TAI: Trait Anxiety Inventory.
F
p
these children were stronger when compared to their siblings.
These results indicate that patients undergoing a long and
difficult treatment period, as in leukemia, may be damaged
in some self-image domains, but at the same time that period
may improve their capacity to cope with the problems that they
encounter.
Psychological problems among cancer patients are commonly
reported. Acute stress symptoms, anxiety, depression, panic
attacks, and post-traumatic stress symptoms might be observed
among cancer patients [21,22]. Myers et al. [5] reported
that anxiety was a significant problem in a subpopulation
of patients with ALL immediately after diagnosis, whereas
depression remained a significant problem for at least 1 year.
Kanellopoulos et al. [23] reported that levels of anxiety and
depression remained significantly associated with poor quality
of life. Although major psychiatric disturbances are not common
among survivors of ALL, a few earlier studies showed that this
population has increased risk for mental health and adjustment
problems [24,25,26]. Some studies indicate that the period
after treatment is characterized by a higher risk of psychosocial
problems compared with the actual treatment period. Children
and adolescents who were off treatment reported higher levels
of depression and anxiety.
The quality of life is worse at the time of diagnosis [7]. The period
after treatment is characterized by a higher risk of psychosocial
problems compared with the actual treatment period. Children
and adolescents who were off treatment reported higher levels
of depression [27,28].
There are some limitations of this research. First of all, besides
the siblings who were our control group, a randomized peer
group should have also participated in this research. Meanwhile,
the ALL survivors who participated in this research came from
the local area. A more widespread participant group would give
more information about results.
329

Baytan B, et al: Emotional Status and Health Quality in Childhood ALL
Turk J Hematol 2016;33:326-330
Conclusion
Despite the improved survival rates, cancer still remains a
potentially life-threatening condition and a major challenge
for both the child and the family. During and after the course
of treatment, most children experience unpleasant physical
and emotional side effects. The difficulties faced by children
during and after treatment affect their quality of life, social
life, and emotional status negatively. Continuous diagnostic and
interventional mental health services might be necessary for
possible emotional side effects during and after the treatment.
Rehabilitation and follow-up programs should be implemented
for these children both in the course of treatment and in the
long-term follow-up period.
Ethics
Ethics Committee Approval: The study was approved by the
Uludağ University Local Ethics Committee (protocol number:
2014-2/15).
Authorship Contributions
Concept: Adalet Meral Güneş, Arzu Çırpan Kantarcıoğlu; Design:
Birol Baytan, Arzu Çırpan Kantarcıoğlu; Data Collection or
Processing: Çiğdem Aşut; Analysis or Interpretation: Arzu Çırpan
Kantarcıoğlu; Literature Search: Çiğdem Aşut, Melike Sezgin
Evim; Writing: Adalet Meral Güneş, Birol Baytan.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Lanzkowsky P. Leukemias. In: Lanzkowsky P (ed). Manual of Pediatric
Hematology and Oncology. New York, Churchill Livingstone Press, 2010.
2. Yarış N. Adölesan kanserlerinin epidemiyolojisi. J Curr Pediatr 2007;5:105-
110 (in Turkish).
3. Efficace F, Novik A, Vignetti M, Mandelli F, Cleeland CS. Health-related
quality of life and symptom assessment in clinical research of patients with
hematologic malignancies: where are we now and where do we go from
here? Haematologica 2007;92:1596-1598.
4. Bansal M, Sharma KK, Bakhshi S, Vatsa M. Perception of Indian parents
on health-related quality of life of children during maintenance therapy
of acute lymphoblastic leukemia: a comparison with siblings and healthy
children. J Pediatr Hematol Oncol 2014;36:130-136.
5. Myers RM, Balsamo L, Lu X, Devidas M, Hunger SP, Carroll WL, Winick NJ,
Moloney KW, Kadan-Lottick NS. A prospective study of anxiety, depression,
and behavioural changes in the first year after a diagnosis of childhood
acute lymphoblastic leukemia. Cancer 2014;120:1417-1425.
6. Sharan P, Mehta M, Chaundry VP. Psychiatric morbidity in children suffering
from acute lymphoblastic leukemia. Pediatr Hematol Oncol 1999;16:49-54.
7. Eiser C, Eiser RJ, Stride CB. Quality of life in children newly diagnosed with
cancer and their mothers. Health Qual Life Outcomes 2005;3:29.
8. van Litsenburg RR, Huisman J, Raat H, Kaspers GJ, Gemke RJ. Health-related
quality of life and utility scores in short-term survivors of pediatric acute
lymphoblastic leukemia. Qual Life Res 2012;22:677-681.
9. Seitzman RL, Glover DA, Meadows AT, Mills JL, Nicholson HS, Robison LL,
Byrne J, Zeltzer LK. Self-concept in adult survivors of childhood acute
lymphoblastic leukemia: a cooperative Children’s Cancer Group and
National Institutes of Health study. Pediatr Blood Cancer 2004;42:230-240.
10. Eiser C, Havermans T. Long term social adjustment after treatment for
childhood cancer. Arch Dis Child 1994;70:66-70.
11. Zeltzer LK, Chen E, Weiss R, Guo MD, Robison LL, Meadows AT, Mills JL,
Nicholson HS, Byrne J. Comparison of psychological outcome in adult
survivors of childhood acute lymphoblastic leukemia versus sibling controls:
a cooperative Children’s Cancer Group and National Institutes of Health
study. J Clin Oncol 1997;15:547-556.
12. Öy B. Çocuklar için depresyon ölçeği; geçerlik ve güvenirlik çalışması. Türk
Psikiyatri Dergisi 1991;2:132-136 (in Turkish).
13. Öner N, Le Compte A. Durumluk-Sürekli Kaygı Envanteri El Kitabı. 1st ed.
İstanbul, Boğaziçi Üniversitesi Yayınları, 1993 (in Turkish).
14. Savaşır I, Şahin NH. Bilişsel ve Davranışçı Terapilerde Değerlendirme: Sık
Kullanılan Ölçekler. 1st ed. Ankara, Türk Psikologlar Derneği Yayınları, 1997
(in Turkish).
15. Çakın Memik N, Ağaoğlu B, Çaşkun A, Üneri Ö, Karakaya I. Çocuklar için
yaşam kalitesi ölçeğinin 13-18 yaş ergen formunun geçerlik ve güvenirliği.
Türk Psikiyatri Dergisi 2007;184:353-363 (in Turkish).
16. Liew E, Thyagu S, Atenafu EG, Alibhai SMH, Brandwein JM. Quality of life
following completion of treatment for adult acute lymphoblastic leukemia
with a pediatric-based protocol. Leuk Res 2013;37:1632-1635.
17. Hamidah A, Wong CY, Tamil AM, Zarina LA, Zulkifli ZS, Jamal R. Healthrelated
quality of life (HRQOL) among pediatric leukemia patients in
Malaysia. Pediatr Blood Cancer 2011;57:105-109.
18. Greenberg HS, Kazak AE, Meadows AT. Psychologic functioning in 8- to
16-year-old cancer survivors and their parents. J Pediatr 1989;114:488-493.
19. Koocher GP, O’Malley JE. The Damocles Syndrome. 2nd ed. New York,
McGraw-Hill, 1989.
20. Maggiolini A, Grassi R, Adamoli L, Corbetta A, Charmet GP, Provantini
K, Frascihini D, Jankovic M, Lia R, Spinetta J, Masera G. Self-image of
adolescent survivors of long-term childhood leukemia. J Pediatr Hematol
Oncol 2000;22:417-421.
21. Rabineau KM, Mabe PA, Vega RA. Parenting stress in pediatric oncology
populations. J Pediatr Hematol Oncol 2008;30:358-365.
22. Myers RM, Balsamo L, Lu X, Devidas M, Hunger SP, Carroll WL, Winick NJ,
Maloney KL, Kadan-Lottick NS. A prospective study of anxiety, depression,
and behavioral changes in the first year after a diagnosis of childhood acute
lymphoblastic leukemia. Cancer 2014;120:1417-1425.
23. Kanellopoulos A, Hamre HM, Dahl AA, Fosså SD, Ruud E. Factors associated
with poor quality of life in survivors of childhood acute lymphoblastic
leukemia and lymphoma. Pediatr Blood Cancer 2013;60:849-855.
24. Mackie E, Hill J, Kondryn H, McNally R. Adult psychosocial outcomes in
long-term survivors of acute lymphoblastic leukaemia and Wilms’ tumour a
controlled study. Lancet 2000;355:1310-1314.
25. Wallander JL, Thompson RJ Jr. Psychosocial adjustment of children with
chronic physical conditions. In: Roberts MC, Steele RG (eds). Handbook of
Pediatric Psychology. New York, Guilford Press, 2010.
26. Shelby MD, Nagle RJ, Barnett-Queen LL, Quattlebaum PD, Wuori DF. Parental
reports of psychosocial adjustment and social competence in child survivors
of acute lymphocytic leukemia. Childrens Health Care 1998;27:113-129.
27. von Essen L, Enskår K, Kreuger A, Larsson B, Sjøden PO. Self-esteem,
depression and anxiety among Swedish children and adolescents on and off
treatment. Acta Paediatr 2000;89:229-236.
28. Reinfjell T, Lofstad GE, Nordahl HM, Vikan A, Diseth TH. Children in
remission from acute lymphoblastic leukaemia: mental health psychological
adjustment and parental functioning. Eur J Cancer Care (Engl) 2009;18:364-
370.
330

BRIEF REPORT
DOI: 10.4274/tjh.2016.0008
Turk J Hematol 2016;33:331-334
Clinical Courses of Two Pediatric Patients with Acute Megakaryoblastic
Leukemia Harboring the CBFA2T3-GLIS2 Fusion Gene
CBFA2T3-GLIS2 Füzyon Geni Taşıyan İki Pediatrik Akut Megakaryoblastik Lösemi Hastasının
Klinik Seyri
Mayu Ishibashi 1 , Tomoko Yokosuka 1,2 , Masakatsu D. Yanagimachi 1 , Fuminori Iwasaki 2 , Shin-ichi Tsujimoto 1 , Koji Sasaki 1 , Masanobu
Takeuchi 1 , Reo Tanoshima 1 , Hiromi Kato 1 , Ryosuke Kajiwara 1 , Fumiko Tanaka 1 , Hiroaki Goto 1,2 , Shumpei Yokota 1
1Yokohama City University Faculty of Medicine, Department of Pediatrics, Yokohama, Japan
2Kanagawa Children’s Medical Center, Clinic of Hematology/Oncology and Regenerative Medicine, Yokohama, Japan
Abstract
Acute megakaryoblastic leukemia (AMKL) in children without Down
syndrome (DS) has an extremely poor outcome with 3-year survival
of less than 40%, whereas AMKL in children with DS has an excellent
survival rate. Recently, a novel recurrent translocation involving
CBFA2T3 and GLIS2 was identified in about 30% of children with
non-DS AMKL, and the fusion gene was reported as a strong poor
prognostic factor in pediatric AMKL. We report the difficult clinical
courses of pediatric patients with AMKL harboring the CBFA2T3-GLIS2
fusion gene.
Keywords: Acute megakaryoblastic leukemia without Down syndrome,
CBFA2T3-GLIS2 fusion gene
Öz
Down sendromu (DS) olmayan çocuklarda akut megakaryoblastik
löseminin (AMKL) prognozu çok kötü ve 3 yıllık sağkalım %40’ın altında
iken, DS’li çocuklarda AMKL’nin sağkalım oranı mükemmeldir. Yakın
zamanda, DS olmayan AMKL’li çocukların yaklaşık %30’unda CBFA2T3
ve GLIS2’yi içeren yeni bir tekrarlayan translokasyon tanımlandı ve
füzyon geninin pediatrik AMKL olgularında kötü prognoz ile ilişkili
güçlü bir prognostik belirteç olduğu bildirildi. CBFA2T3-GLIS2 füzyon
genini taşıyan AMKL tanılı pediatrik hastalarda sorunlu klinik seyri
bildiriyoruz.
Anahtar Sözcükler: Down sendromu olmayanlarda akut
megakaryoblastik lösemi, CBFA2T3-GLIS2 füzyon geni
Introduction
Acute megakaryoblastic leukemia (AMKL) is classified as M7
in the FAB (French-American-British) classification. AMKL
accounts for approximately 10% of pediatric acute myeloid
leukemia (AML) cases and 1% of adult AML cases [1,2,3].
Pediatric AMKL is divided into two subgroups: AMKL arising in
patients with Down syndrome (DS-AMKL), and AMKL arising in
patients without DS (non-DS-AMKL). Although patients with
DS-AMKL have an excellent survival rate, patients with non-
DS-AMKL have an extremely poor outcome with 3-year survival
of less than 40% [1,2,4]. Recently, two studies identified a
novel recurrent translocation involving CBFA2T3 and GLIS2 in
about 30% of children with non-DS-AMKL. The CBFA2T3-GLIS2
fusion gene was reported as a strong poor prognostic factor in
pediatric AMKL [5,6]. We report the difficult clinical courses of
two pediatric patients with AMKL harboring the CBFA2T3-GLIS2
fusion gene.
Case Presentation
Between 2003 and 2012, six patients were diagnosed with
AMKL at the Department of Pediatrics of Yokohama City
University Hospital. We analyzed the fusion gene, CBFA2T3-
GLIS2, in the six leukemic samples at the time of diagnosis by
reverse transcription polymerase chain reaction (PCR) and direct
sequencing, according to a previous report [5]. We compared
characteristics between the patients who were diagnosed with
AMKL with or without the CBFA2T3-GLIS2 fusion gene.
Two patients had DS-AMKL harboring a GATA1 mutation and
four had non-DS-AMKL. None of them had inv(16)/t(16;16)
Address for Correspondence/Yazışma Adresi: Masakatsu D. YANAGIMACHI, M.D.,
Yokohama City University Faculty of Medicine, Department of Pediatrics, Yokohama, Japan
Phone : +81-45-787-2800
E-mail : m.yanagimachi@gmail.com
Received/Geliş tarihi: January 07, 2016
Accepted/Kabul tarihi: April 04, 2016
331

Ishibashi M, et al: CBFA2T3-GLIS2 Fusion Gene
Turk J Hematol 2016;33:331-334
chromosomal abnormalities upon G-band karyotyping. Two
patients with non-DS-AMKL (Patient 1 and Patient 3) had the
CBFA2T3-GLIS2 fusion gene (Table 1). Reverse transcription
PCR and direct sequencing revealed that exon 11 of CBFA2T3
was fused to exon 3 of GLIS2 in both cases (Figures 1A and
1B). Neither of them achieved complete remission (CR) after
induction therapies. They died from the primary disease after
stem cell transplantation (SCT). The other 4 patients remain
alive in CR (Table 1).
Patient 1 with the CBFA2T3-GLIS2 fusion gene was treated
under the AML05 protocol of the Japanese Pediatric Leukemia/
Lymphoma Study Group [7] and could not achieve CR after
induction 1 therapy (Figure 1C). After induction 2 therapy, Patient
1 under non-CR conditions was treated with unrelated cord
blood SCT (CBSCT) after a myeloablative conditioning regimen.
Three months after CBSCT, her AMKL relapsed. She underwent
two courses of chemotherapy. She received a haploidentical SCT
Figure 1. Clinical courses of two Acute megakaryoblastic
leukemia patients with the CBFA2T3-GLIS2 fusion gene. A)
Reverse transcription polymerase chain reaction for the CBFA2T3-
GLIS2 fusion gene in our patients. Two patients with non-Down
syndrome-acute megakaryoblastic leukemia (patients 1 and 3)
had the CBFA2T3-GLIS2 fusion gene. NC: Negative control. B)
Direct sequencing for the polymerase chain reaction product
of the CBFA2T3-GLIS2 fusion gene in patient 1 revealed that
exon 11 of CBFA2T3 was fused to exon 3 of GLIS2. C) Clinical
course of patient 1. FLAG: Fludarabine, cytarabine, G-CSF; FK506:
tacrolimus. D) Magnetic resonance imaging of patient 1 revealed
an extramedullary lesion at the thoracic spinal cord (Th9). E)
Clinical course of patient 3. CAG: Cytarabine, aclarubicin, G-CSF;
GO: gemtuzumab ozogamicin; IDA: idarubicin; VPL: vincristine,
prednisolone, L-asparaginase.
332
Table 1. Patient details.
Outcome
Karyotype CD56 (%) CBFA2T3-GLIS2 Sample Clinical
Course
Blasts
(%, BM)
Sex Blasts
(%, PB)
Age at
Onset
(Months)
Patient
No.
Dead (30
months)
1 Non-DS 11 F 9 92 73,XXX,+X,+8,-12,+14,-15,+19,+20,+21 82.7 Positive BM CBSCTx2,
R-BMTx2
Alive (4 years)
24.3 None PBMC UR-BMT, in
1 st CR
2 Non-DS 20 F 19.5 14.5 46XX,-7,add(11) (p11.2)
,-7,21,22,+mar1,+mar2,+mar3,+mar4
98.1 Positive BM UR-BMT Dead (23
months)
3 Non-DS 13 F 5.5 76 46,XX,add(3)(p21),add(4)(q11)14,add(17)
(q25),add(19)(p13),20,+21,+der(?)t(?;14)
(?;q1)/92,idem X2 46, idem, t(1;16)
(q32;p13)
0 None PBMC Chemotherapy Alive (7 years)
4 Non-DS 20 F 42 Dry tap 46XXdel(7)(q?),del(11)(p?),t(12;14)
(q13;p32),16,+mar1
35.5 None PBMC Chemotherapy Alive (6 years)
5 DS 20 M 21 15 47,XY,add(5)(p11),add(q11.2),+der(21)
t(1;21)(q12;q22)ins(21;?)(q22;?)
6 DS 21 M 42.5 70 47XY,+21 N/E None PBMC Chemotherapy Alive (5 years)
BM: Bone marrow, PBMC: peripheral bone marrow cells, DS: Down syndrome, non-DS: patients without Down syndrome, F: female, M: male.

Turk J Hematol 2016;33:331-334
Ishibashi M, et al: CBFA2T3-GLIS2 Fusion Gene
(haplo-SCT) from her mother under non-CR conditions. After
the second transplant, she had leg paralysis and bladder and
rectal disturbance from an extramedullary lesion at the thoracic
spinal cord (Th9) (Figure 1D). Although she underwent radiation
therapy for the Th9 mass, the mass did not disappear. While she
received a second CBSCT and haplo-SCT, she failed to engraft
and died 30 months after the fourth SCT.
Patient 3 with the CBFA2T3-GLIS2 fusion gene was treated
under the AML99 protocol [8] and could not achieve CR
after induction A therapy (Figure 1E). She did not achieve
CR even after several types of chemotherapy. Thereafter, she
underwent chemotherapy with vincristine, prednisolone, and
L-asparaginase (VPL), which is commonly used in therapy for
acute lymphoblastic leukemia (ALL). After the VPL therapy,
the percentage of blastic cells in the bone marrow decreased.
She received unrelated bone marrow transplantation after
a reduced-intensity conditioning regimen. She maintained
remission for about 180 days and thereafter relapsed. Despite
treatment with drugs including imatinib and L-asparaginase,
she died 23 months after bone marrow transplantation.
Discussion
It was reported that CBFA2T3-GLIS2 fusion gene-positive cases
account for about 30% of pediatric patients with AMKL [5,6,9].
In addition, the overall survival rate and the event-free survival
rate were lower in patients with the CBFA2T3-GLIS2 fusion
gene than in those without this fusion gene [5,9,10,11]. There
is little information about the clinical course of these patients.
We encountered two AMKL patients with poor prognostics
harboring the CBFA2T3-GLIS2 fusion gene, even though neither
of them had inv(16)/t(16;16) chromosomal abnormalities upon
G-band karyotyping. Therefore, evaluation of AMKL patients
with this fusion gene without inv(16)/t(16;16) is needed.
CD56 was expressed in leukemic blasts of the two CBFA2T3-
GLIS2-positive patients with AMKL but not in the two CBFA2T3-
GLIS2-negative patients among the non-DS-AMKL patients
in our cohort (Table 1). It was reported that CD41 and CD56
were positive and CD56 was drastically more highly expressed
in patients with CBFA2T3-GLIS2-positive AMKL [6]. Higher
expression of the CD56 antigen was reported as a poor prognostic
marker [9,12,13,14,15,16,17]. Some investigators demonstrated
that patients with CD56 positivity in blasts showed a higher
incidence of extramedullary manifestations [12,13,14,18].
Among our patients with AMKL, CD56 was also more highly
expressed in the two CBFA2T3-GLIS2-positive patients with
AMKL with poor outcomes, and Patient 1 had extramedullary
manifestation that did not regress after irradiation. High CD56
expression may be a surrogate marker of CBFA2T3-GLIS2
positivity in AMKL.
In Patient 3 with CBFA2T3-GLIS2-positive AMKL, chemotherapy
regimens used to treat AML were not effective, but
chemotherapy with VPL, commonly used to treat ALL, seemed
to be more effective. When some of the treatment strategies
commonly used to treat AML are not effective, the type
of chemotherapy used to treat ALL might be effective in a
subpopulation of patients with AMKL. There is a possibility that
the conventional treatment commonly used to treat ALL may be
effective for AMKL with this fusion gene. Eventually, the AMKL
in both of the CBFA2T3-GLIS2-positive patients in our cohort
became intractable to treatment, including SCT. Despite some
chemotherapy regimens and SCT, the two patients with the
CBFA2T3-GLIS2 fusion gene had poor prognosis. As previously
reported, CBFA2T3-GLIS2 expression enhances BMP2/BMP4
signaling [5]. The development of treatments including novel
targeted therapy drugs is desired.
Conclusion
Clinical courses of pediatric patients with AMKL harboring
the CBFA2T3-GLIS2 fusion gene are poor due to resistance to
chemotherapies and SCT. New treatment strategies are necessary.
Ethics
Ethics Committee Approval: The protocol of this survey and
research plan has been approved by the Clinical Ethics Committee
of Yokohama City University (A130725002), Informed Consent:
It was taken from patients and/or their parents.
Authorship Contributions
Concept: Masakatsu D.Yanagimachi; Design: Masakatsu D.
Yanagimachi, Hiroaki Goto, Shumpei Yokota; Data Collection
or Processing: Mayu Ishibashi, Tomoko Yokosuka, Masakatsu D.
Yanagimachi, Fuminori Iwasaki, Shin-ichi Tsujimoto, Koji Sasaki,
Masanobu Takeuchi, Reo Tanoshima, Hiromi Kato, Ryosuke
Kajiwara, Fumiko Tanaka, Hiroaki Goto, Shumpei Yokota;
Analysis or Interpretation: Mayu Ishibashi, Tomoko Yokosuka,
Masakatsu D. Yanagimachi; Literature Search: Mayu Ishibashi,
Tomoko Yokosuka, Masakatsu D. Yanagimachi, Fuminori Iwasaki,
Shin-ichi Tsujimoto, Koji Sasaki, Masanobu Takeuchi, Reo
Tanoshima, Hiromi Kato, Ryosuke Kajiwara, Fumiko Tanaka,
Hiroaki Goto, Shumpei Yokota; Writing: Mayu Ishibashi, Tomoko
Yokosuka, Masakatsu D. Yanagimachi, Fuminori Iwasaki, Shinichi
Tsujimoto, Koji Sasaki, Masanobu Takeuchi, Reo Tanoshima,
Hiromi Kato, Ryosuke Kajiwara, Fumiko Tanaka, Hiroaki Goto,
Shumpei Yokota.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
333

Ishibashi M, et al: CBFA2T3-GLIS2 Fusion Gene
Turk J Hematol 2016;33:331-334
References
1. Athale UH, Razzouk BI, Raimondi SC, Tong X, Behm FG, Head DR, Srivastava
DK, Rubnitz JE, Bowman L, Pui CH, Ribeiro RC. Biology and outcome
of childhood acute megakaryoblastic leukemia: a single institution’s
experience. Blood 2001;97:3727-3732.
2. Barnard DR, Alonzo TA, Gerbing RB, Lange B, Woods WG; Children’s
Oncology Group. Comparison of childhood myelodysplastic syndrome, AML
FAB M6 or M7, CCG 2891: report from the Children’s Oncology Group.
Pediatr Blood Cancer 2007;49:17-22.
3. Tallman MS, Neuberg D, Bennett JM, Francois CJ, Paietta E, Wiernik PH,
Dewald G, Cassileth PA, Oken MM, Rowe JM. Acute megakaryocytic
leukemia: the Eastern Cooperative Oncology Group experience. Blood
2000;96:2405-2411.
4. Creutzig U, Zimmermann M, Ritter J, Reinhardt D, Hermann J, Henze G,
Jurgens H, Kabisch H, Reiter A, Riehm H, Gadner H, Schellong G. Treatment
strategies and long-term results in paediatric patients treated in four
consecutive AML-BFM trials. Leukemia 2005;19:2030-2042.
5. Gruber TA, Larson Gedman A, Zhang J, Koss CS, Marada S, Ta HQ, Chen
SC, Su X, Ogden SK, Dang J, Wu G, Gupta V, Andersson AK, Pounds S, Shi
L, Easton J, Barbato MI, Mulder HL, Manne J, Wang J, Rusch M, Ranade
S, Ganti R, Parker M, Ma J, Radtke I, Ding L, Cazzaniga G, Biondi A,
Kornblau SM, Ravandi F, Kantarjian H, Nimer SD, Döhner K, Döhner H, Ley
TJ, Ballerini P, Shurtleff S, Tomizawa D, Adachi S, Hayashi Y, Tawa A, Shih
LY, Liang DC, Rubnitz JE, Pui CH, Mardis ER, Wilson RK, Downing JR. An
Inv(16)(p13.3q24.3)-encoded CBFA2T3-GLIS2 fusion protein defines an
aggressive subtype of pediatric acute megakaryoblastic leukemia. Cancer
Cell 2012;22:683-697.
6. Thiollier C, Lopez CK, Gerby B, Ignacimouttou C, Poglio S, Duffourd Y,
Guegan J, Rivera-Munoz P, Bluteau O, Mabialah V, Diop M, Wen Q, Petit A,
Bauchet AL, Reinhardt D, Bornhauser B, Gautheret D, Lecluse Y, Landman-
Parker J, Radford I, Vainchenker W, Dastugue N, de Botton S, Dessen P,
Bourquin JP, Crispino JD, Ballerini P, Bernard OA, Pflumio F, Mercher T.
Characterization of novel genomic alterations and therapeutic approaches
using acute megakaryoblastic leukemia xenograft models. J Exp Med
2012;209:2017-2031.
7. Zhu HH, Zhang XH, Qin YZ, Liu DH, Jiang H, Chen H, Jiang Q, Xu LP, Lu J, Han
W, Bao L, Wang Y, Chen YH, Wang JZ, Wang FR, Lai YY, Chai JY, Wang LR,
Liu YR, Liu KY, Jiang B, Huang XJ. MRD-directed risk stratification treatment
may improve outcomes of t(8;21) AML in the first complete remission:
results from the AML05 multicenter trial. Blood 2013;121:4056-4062.
8. Tsukimoto I, Tawa A, Horibe K, Tabuchi K, Kigasawa H, Tsuchida M, Yabe H,
Nakayama H, Kudo K, Kobayashi R, Hamamoto K, Imaizumi M, Morimoto
A, Tsuchiya S, Hanada R. Risk-stratified therapy and the intensive use of
cytarabine improves the outcome in childhood acute myeloid leukemia: the
AML99 trial from the Japanese Childhood AML Cooperative Study Group. J
Clin Oncol 2009;27:4007-4013.
9. Alegretti AP, Bittar CM, Bittencourt R, Piccoli AK, Schneider L, Silla LM,
Bo SD, Xavier RM. The expression of CD56 antigen is associated with poor
prognosis in patients with acute myeloid leukemia. Rev Bras Hematol
Hemoter 2011;33:202-206.
10. Masetti R, Pigazzi M, Togni M, Astolfi A, Indio V, Manara E, Casadio R,
Pession A, Basso G, Locatelli F. CBFA2T3-GLIS2 fusion transcript is a novel
common feature in pediatric, cytogenetically normal AML, not restricted to
FAB M7 subtype. Blood 2013;121:3469-3472.
11. Masetti R, Togni M, Astolfi A, Pigazzi M, Manara E, Indio V, Rizzari C,
Rutella S, Basso G, Pession A, Locatelli F. DHH-RHEBL1 fusion transcript: a
novel recurrent feature in the new landscape of pediatric CBFA2T3-GLIS2-
positive acute myeloid leukemia. Oncotarget 2013;4:1712-1720.
12. Graf M, Reif S, Hecht K, Pelka-Fleischer R, Kroell T, Pfister K, Schmetzer H.
High expression of costimulatory molecules correlates with low relapsefree
survival probability in acute myeloid leukemia (AML). Ann Hematol
2005;84:287-297.
13. Iizuka Y, Aiso M, Oshimi K, Kanemaru M, Kawamura M, Takeuchi J, Horikoshi
A, Ohshima T, Mizoguchi H, Horie T. Myeloblastoma formation in acute
myeloid leukemia. Leuk Res 1992;16:665-671.
14. Kuwabara H, Nagai M, Yamaoka G, Ohnishi H, Kawakami K. Specific skin
manifestations in CD56 positive acute myeloid leukemia. J Cutan Pathol
1999;26:1-5.
15. Rego EM. The expression of the CD56 antigen is associated with poor
prognosis in patients with acute myeloid leukemia. Rev Bras Hematol
Hemoter 2011;33:176-177.
16. Yang DH, Lee JJ, Mun YC, Shin HJ, Kim YK, Cho SH, Chung IJ, Seong CM, Kim
HJ. Predictable prognostic factor of CD56 expression in patients with acute
myeloid leukemia with t(8:21) after high dose cytarabine or allogeneic
hematopoietic stem cell transplantation. Am J Hematol 2007;82:1-5.
17. Raspadori D, Damiani D, Michieli M, Stocchi R, Gentili S, Gozzetti A, Masolini
P, Michelutti A, Geromin A, Fanin R, Lauria F. CD56 and PGP expression
in acute myeloid leukemia: impact on clinical outcome. Haematologica
2002;87:1135-1140.
18. Liang C, Chan KH, Yoon PJ, Lovell MA. Clinicopathological characteristics
of extramedullary acute megakaryoblastic leukemia (AMKL): report
of a case with initial mastoid presentation and review of literature to
compare extramedullary AMKL and non-AMKL cases. Pediatr Dev Pathol
2012;15:385-392.
334

BRIEF REPORT
DOI: 10.4274/tjh.2016.0075
Turk J Hematol 2016;33:335-338
Evaluation of Insulin-like Growth Factor-1 and Insulin-like Growth
Factor Binding Protein-3 Expression Levels in Patients with
Chronic Lymphocytic Leukemia
Kronik Lenfositik Lösemi Hastalarında İnsülin-benzeri Büyüme Faktörü-1 ve İnsülin-benzeri
Büyüme Faktörü Bağlayıcı Protein-3 Düzeylerinin Değerlendirilmesi
Mesut Ayer 1 , Abdullah Sakin 2 , Selim Ay 3 , Aylin Ayer 3 , Elif Gökçen Sazak 4 , Melih Aktan 4
1Haseki Training and Research Hospital, Clinic of Hematology, İstanbul, Turkey
2Okmeydanı Training and Research Hospital, Clinic of Internal Medicine, Oncology Unit, İstanbul, Turkey
3Haseki Training and Research Hospital, Clinic of Internal Medicine, İstanbul, Turkey
4İstanbul University İstanbul Faculty of Medicine, Department of Internal Medicine, Division of Hematology, İstanbul, Turkey
Abstract
Objective: Chronic lymphocytic leukemia (CLL) is a disease of
nonproliferating and mature-appearing B lymphocytes. Insulin-like
growth factor-1 (IGF-1) is a small peptide hormone and has mitogenic
and antiapoptotic effects, and insulin-like growth factor binding
protein-3 (IGFBP-3) has antiproliferative effects on cells. In this study, we
investigated plasma levels of both IGF-1 and IGFBP-3 in patients with CLL
compared with controls, and we compared these plasma levels according
to prognostic factors.
Materials and Methods: Patients with newly diagnosed CLL who were
being followed at the Haseki Training and Research Hospital, İstanbul,
Turkey, and volunteers were included in this study. Patients were stratified
according to the Rai staging system. Statistical analysis was conducted
using SPSS 17.0 for Windows.
Results: Forty-three patients [16 women (37%) and 27 men (63%)] were
enrolled in this study. Twenty-one volunteers (11 women, 10 men) were
included in the control group. The median age of the patients was 65±9
years (range: 18-63 years), and subjects in the control group were 68±8
years old (range: 18-63 years). Even though the plasma levels of IGF-1 were
higher and those of IGFBP-3 were lower and the ratio of IGF-I/IGFBP-3 was
higher in comparison with the control group, these differences were not
statistically significant (p>0.05). In the study group, IGF-1 levels appeared
to be increased in parallel to more advanced Rai stages. There were no
significant differences between the other groups (p=0.105).
Conclusion: Plasma IGF-I levels were found higher in patients than in the
control group and plasma IGFBP-3 levels were lower; however, neither
result was statistically significant. Plasma IGF level increment was observed
in concordance with Rai staging. These results prompted us to think that
plasma IGF-1 levels in CLL patients are correlated with tumor burden and
Rai staging and therefore could be a valuable prognostic factor. Further
comprehensive studies are required to support our results.
Keywords: Chronic lymphocytic leukemia, Insulin-like growth factor-1,
Insulin-like growth factor binding protein-3
Öz
Amaç: Kronik lenfositik lösemi (KLL) olgun görünümlü B lenfositlerin
hastalığıdır. İnsülin-benzeri büyüme faktörü-1 (IGF-1), mitojenik
ve antiapoptotik etkili küçük peptid hormondur ve insülin-benzeri
büyüme faktörü bağlayıcı protein-3 (IGFBP-3) ise hücre üzerinde
antiproliferative etki gösterir. Çalışmamızda, KLL hasta grubu ve
kontrol grubunda plazma IGF-1 ve IGFBP-3 düzeylerini ve prognostik
faktörlerle ilişkisini karşılaştırdık.
Gereç ve Yöntemler: Haseki Eğitim ve Araştırma Hastanesi,
Hematoloji Bölümü’nde takip edilen yeni tanı almış KLL hastaları ile
kontrol grubu çalışmaya dahil edilmiştir. Hastalar Rai sistemine göre
evrelendirilmiştir. İstatistiksel analiz SPSS for Windows version 17.0
kullanılarak yapılmıştır.
Bulgular: Kırk üç hasta [16 kadın (%37) ve 27 erkek (%63)] çalışmaya
alınmıştır. Kontrol grubu 21 kişiden (11 kadın, 10 erkek) oluşmuştur.
Hasta grubunda ortanca yaş 65±9 (18-63), kontrol grubunda 68±8’dir
(18-63). Kontrol grubu ile karşılaştırıldığında; çalışma grubunda
plazma IGF-1 düzeyi yüksek; IGFBP-3 düzeyi düşük, IGF-I/IGFBP-3
oranı ise yüksek olarak bulunmasına rağmen istatistiksel yönden
anlamlı değildi (p>0,05). Çalışma grubunda plazma IGF-1 düzeyi
yüksekliği ile Rai ileri evresi paralellik gösteriyordu. Diğer gruplarla
istatistiksel yönden anlamlı farklılık yoktu (p=0,105).
Sonuç: Çalışma grubunda, plazma IGF-1 düzeyi kontrol grubundan
daha yüksek, IGFBP-3 düzeyi ise düşük bulundu, bununla beraber
istatistiksel yönden anlamlı farklılık yoktu. Plazma IGF-1 düzeyi
yüksekliği ile Rai ileri evresi uyumlu idi. Bu sonuçlar bize, IGF-1
düzeyinin KLL hastalarında tümor yükü ve Rai evresi ile ilişkili olduğunu
ve prognostik faktör olarak değerli olabileceğini düşündürmüştür.
Bu sonuçları destekleyebilmek için daha geniş kapsamlı çalışmalara
ihtiyaç vardır.
Anahtar Sözcükler: Kronik lenfositik lösemi, İnsülin-benzeri büyüme
faktörü-1, insülin benzeri büyüme faktörü bağlayıcı protein-3
Address for Correspondence/Yazışma Adresi: Mesut AYER, M.D.,
Haseki Training and Research Hospital, Clinic of Hematology, İstanbul, Turkey
Phone : +90 212 529 44 00/2048
E-mail : mesutayerdr@hotmail.com
Received/Geliş tarihi: February 22, 2016
Accepted/Kabul tarihi: April 08, 2016
335

Ayer M, et al: Evaluation of IGF-1 and IGFBP-3 Expression Levels in Patients with Chronic Lymphocytic Leukemia
Turk J Hematol 2016;33:335-338
Introduction
Chronic lymphocytic leukemia (CLL) is a disease of
nonproliferating and mature-appearing B lymphocytes. Most
patients with CLL are elderly; just 10% are aged less than
50 years. In the evaluation of the prognosis of patients with
CLL, mutations and cytogenetic abnormalities are crucial and
independent markers in addition to clinical classifications [1,2].
Insulin-like growth factor (IGF) has a pivotal role in the normal
development of fetuses and children. In adulthood, this
growth factor has a role in the inhibition of cell proliferation
and apoptosis, in addition to its role in cellular metabolism.
IGF-1 is a small peptide hormone that has mitogenic and
antiapoptotic effects, but IGF-binding protein 3 (IGFBP-3) has
an antiproliferative effect and negates the mitogenic effects of
IGF-1 by stimulating apoptosis. In several types of tumors, it has
been shown that IGF-1 levels are increased and IGFBP-3 levels
are decreased [3,4].
In this study, we investigated plasma levels of both IGF-1 and
IGFBP-3 in patients with CLL compared with controls and we
compared these plasma levels according to prognostic factors.
Materials and Methods
Patients who were newly diagnosed with CLL at the Haseki
Training and Research Hospital and healthy volunteers were
included in this study. Patients with the following conditions
were excluded from the study: chronic renal disease,
decompensated heart failure, chronic hepatitis, coronary artery
disease, diabetes mellitus with organ damage or uncontrolled
plasma glucose levels, chronic inflammatory disease, and
major trauma in the last the year. Twenty-one volunteers were
included in the control group.
Plasma samples were obtained after centrifugation at 3500
rpm for 8 min and stored at -80 °C until analysis. Plasma IGF-I
detection was performed using an ELISA kit (DRG International,
USA) in accordance with the manufacturer’s protocol. The
sensitivity of the kit was 0.15 ng/mL. IGFBP-3 levels were
measured using a BioSource ELISA Kit with solid-phase enzyme
immunoassay (BioSource, Belgium). The analytical sensitivity of
the kit was 10 μg/mL. Samples were measured using an ELISA
microplate reader (DV-990 BV4, N.T. Laboratory, Italy).
Statistical analysis was conducted using SPSS 17.0 for Windows
(SPSS Inc., Chicago, IL, USA). The Kolmogorov-Smirnov test was
used to determine whether the samples were from a population
with normal distribution. In the comparison of values between
two groups, Student’s t-test was used if the group was distributed
normally. If the group was not normally distributed, the Mann-
Whitney U test was used. In the analysis of proportional data,
the chi-square test was used. Pearson and Spearman correlation
tests were used to compare numerical parameters. One-way
ANOVA testing was used to compare more than two groups;
post hoc Bonferroni testing was used for multiple comparisons.
In all statistical assessments, the cut-off level of statistical
significance was assumed as p<0.05.
Study assessment and methods were approved by the local
institutional ethics committee. Patient demographics and
laboratory data were obtained from patient records upon
obtaining oral informed consent from the patients and their
information was recorded.
Results
Forty-three patients [16 women (37%) and 27 men (63%)] were
enrolled in the study. Twenty-one control subjects who were
demographically compatible (11 women, 10 men) were included
in the control group. The median age of the patient and control
groups was 65±9 years (range: 18-63 years) and 68±8 years
(range: 18-63 years), respectively. There was no statistical
demographic difference between the two groups (p>0.05).
Among the patients, 44% (n=19) had CLL of Rai stage 0, 11%
(n=5) stage I, 20% (n=9) stage II, 16% (n=7) stage III, and 6%
(n=3) stage IV.
Compared with the control group, IGF-1 levels were found
to be higher in the study group (531±246 ng/mL), and IGF-1
levels were also detected to be subsequently higher in every
Rai stage (Rai stage 0, 1… etc.). However, this difference was
not statistically significant (p>0.05). IGFBP-3 levels were found
lower in the study group (3890±324 ng/mL) and IGFBP-3 levels
were also found lower in each sequential Rai stage (Rai stage 0,
1… etc.), but this was not statistically significant (p>0.05). The
IGF-I/IGFBP-3 ratio was higher in the study group (0.32±0.60
ng/mL), although the difference was not statistically significant
(p=0.5) (Table 1).
In patients with CLL, we observed that IGF-1 levels had a
positive correlation with Rai stages (Rs=0.411; p<0.01). The
same correlation was not observed for IGFBP-3 levels (Rs=-
0.075; p=0.6). IGF-1 levels in the patients with CLL appeared to
increase in parallel with more advanced Rai stages. There were
no significant differences among Rai stages (p=0.105). When
IGFBP-3 levels were compared according to stage, there were also
no statistical significant differences (p=0.3) (Figures 1 and 2).
Table 1. Insulin-like growth factor-1 and insulin-like growth
factor binding protein-3 values.
Control Subjects Study Patients p
IGF-1 (ng/mL) 517±173 531±246 0.8
IGFBP-3 (ng/mL) 4314±1996 3890±324 0.4
IGF-1/IGFBP-3 0.23±0.37 0.32±0.60 0.5
IGF-1: Insulin-like growth factor, IGFBP-3: insulin-like growth factor binding protein-3.
336

Turk J Hematol 2016;33:335-338
Ayer M, et al: Evaluation of IGF-1 and IGFBP-3 Expression Levels in Patients with Chronic Lymphocytic Leukemia
In our study, the mean plasma IGF-I levels of the patients
were found higher than those of the control group, but the
difference was not statistically significant. Plasma IGFBP-3
level was lower than in the control group, but this was also not
statistically significant. However, plasma IGF level increments
were in parallel with Rai stages. A reverse correlation was not
observed for IGFBP-3 levels.
Figure 1. Mean insulin-like growth factor-1 values in Rai stages.
Molica et al. measured serum levels of IGF-1 and IGFBP-3 in 77
patients with CLL and found them to be statistically significantly
lower than in the control group. However, no significant
correlation was found between serum levels of either IGF-1 or
IGFBP-3 and clinicohematologic variables including age, sex,
Rai clinical stages, serum levels of lactate dehydrogenase and
beta-2 microglobulin, peripheral blood lymphocyte count, and
lymphocyte doubling time [11].
In our study IGF-1 and IGFBP-3 levels were lower in patients
with Rai stage 0 compared with the control group. Although
IGF-1 levels were found lower in early stages, they increased
significantly in parallel with more advanced Rai stages.
In conclusion, plasma IGF-I levels in CLL patients were found
higher than in the control group and plasma IGFBP-3 levels
were lower. However, neither result was statistically significant.
The increments of plasma IGF-1 level were in parallel with Rai
staging.
Figure 2. Insulin-like growth factor binding protein-3 values in
Rai stages.
Discussion
The IGF system plays a pivotal role in normal growth throughout
fetal and childhood development. In adult life, this system
continues to function by regulating normal cellular metabolism,
proliferation, and differentiation and it protects against
apoptotic signals. However, aberrant stimulation can contribute
to the development and progression of malignant growth
[4,5,6].
It has been shown in cell cultures that IGFBP-3 inhibits DNA
synthesis without IGF. It has been claimed that IGFBP-3 may link
p53 to potential novel autocrine/paracrine signaling pathways
and to processes regulated by or dependent on IGF(s), such as
cellular growth, transformation, and survival. It has also been
asserted that induction of IGFBP-3 gene expression by wildtype,
but not mutant, p53 was associated with enhanced
secretion of an active form of IGFBP-3 capable of inhibiting
mitogenic signaling by IGF-1 [7].
Many studies have reported that high levels of IGF-I, low levels
of IGFBP-3, or increments of the molar ratio of IGF-I/IGFBP-3
were associated with various types of cancers [8,9,10,11].
These results suggest that plasma IGF-1 levels in patients
with CLL are correlated with tumor burden and Rai staging
and therefore might be a valuable prognostic factor. Further
comprehensive studies are required to support our results.
Ethics
Ethics Committee Approval: Study assessment and methods
were approved by the local institutional ethics committee
(21.01.2009/11); Informed Consent: Patient demographics
and laboratory data were obtained from patient records upon
obtaining oral informed consent from the patients and their
information was recorded.
Authorship Contributions
Concept: Mesut Ayer; Design: Mesut Ayer; Data Collection or
Processing: Mesut Ayer, Selim Ay, Abdullah Sakin, Aylin Ayer;
Analysis or Interpretation: Mesut Ayer, Melih Aktan; Literature
Search: Mesut Ayer, Abdullah Sakin, Selim Ay, Aylin Ayer, Elif
Gökçen Sazak, Melih Aktan; Writing: Mesut Ayer, Abdullah
Sakin, Selim Ay, Aylin Ayer, Elif Gökçen Sazak, Melih Aktan.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
337

Ayer M, et al: Evaluation of IGF-1 and IGFBP-3 Expression Levels in Patients with Chronic Lymphocytic Leukemia
Turk J Hematol 2016;33:335-338
References
1. Ishibe N, Sgambati MT, Fontaine L, Goldin LR, Jain N, Weissman N, Marti
GE, Caporaso NE. Clinical characteristics of familial B-CLL in the National
Cancer Institute Familial Registry. Leuk Lymphoma 2001;42:99-108.
2. Hallek M, Cheson BD, Catovsky D, Caligaris-Cappio F, Dighiero G, Döhner
H, Hillmen P, Keating MJ, Montserrat E, Rai KR, Kipps TJ; International
Workshop on Chronic Lymphocytic Leukemia. Guidelines for the diagnosis
and treatment of chronic lymphocytic leukemia: a report from the
International Workshop on Chronic lymphocytic Leukemia updating
the National Cancer Institute-Working Group 1996 guidelines. Blood
2008;111:5446-5456.
3. LeRoith D, Baserga R, Helman L, Roberts CT Jr. Insulin-like growth factors
and cancer. Ann Intern Med 1995;122:54-59.
4. Fürstenberger G, Senn HJ. Insulin-like growth factors and cancer. Lancet
Oncol 2002;3:298-302.
5. Rai KR, Sawitsky A, Cronkite EP, Chanana AD, Levy RN, Pasternack BS.
Clinical staging of chronic lymphocytic leukemia. Blood 1975;46:219-234.
6. Jerome L, Shiry L, Leyland-Jones B. Deregulation of the IGF axis in cancer:
epidemiological evidence and potential therapeutic interventions. Endocr
Relat Cancer 2003;10:561-578.
7. Buckbinder L, Talbott R, Velasco-Miguel S, Takenaka I, Faha B, Seizinger BR,
Kley N. Induction of the growth inhibitor IGF-binding protein 3 by p53.
Nature 1995;377:646-649.
8. Wu X, Yu H, Amos CI, Hong WK, Spitz MR. Joint effect of insulin-like growth
factors and mutagen sensitivity in lung cancer risk. J Natl Cancer Inst
2000;92:737-743.
9. Harman SM, Metter EJ, Blackman MR, Landis PK, Carter HB; Baltimore
Longitudinal Study on Aging. Serum levels of insulin-like growth factor
I (IGF-I), IGF-II, IGF-binding protein-3, and prostate-specific antigen as
predictors of clinical prostate cancer. J Clin Endocrinol Metab 2000;85:4258-
4265.
10. Keleş M, Gündoğdu M, Erdem F, Türkeli M, Yıldız L, Turhan H. IGF-1 and
IGFBP-3 levels in patients with non-Hodgkin’s lymphoma. Fırat Tıp Dergisi
2006;11:98-102 (in Turkish with English abstract).
11. Molica S, Vitelli G, Mirabelli R, Digiesu G, Giannarelli D, Cuneo A, Ribatti D,
Vacca A. Serum insulin-like growth factor is not elevated in patients with
early B-cell chronic lymphocytic leukemia but is still a prognostic factor for
disease progression. Eur J Haematol 2006;76:51-57.
338

BRIEF REPORT
DOI: 10.4274/tjh.2016.0102
Turk J Hematol 2016;33:339-345
The Frequency of HLA-A, HLA-B, and HLA-DRB1 Alleles in
Patients with Acute Lymphoblastic Leukemia in the Turkish
Population: A Case-Control Study
Akut Lenfoblastik Lösemili Hastalarda HLA-A, HLA-B, ve HLA-DRB1 Alellerinin Türk
Toplumundaki Sıklığı: Olgu-Kontrol Çalışması
Türkan Patıroğlu 1,2 , H. Haluk Akar 1
1Erciyes University Faculty of Medicine, Department of Pediatric Immunology, Kayseri, Turkey
2Erciyes University Faculty of Medicine, Human Leukocyte Antigen Tissue Typing Laboratory, Kayseri, Turkey
Abstract
We studied the frequencies of human leukocyte antigen alleles (A,
B, and DRB1) in 90 patients with acute lymphoblastic leukemia (ALL)
and then compared them with 126 controls in this study. Although
the frequencies of the A*03 allele, the DRB1*03 allele, the DRB1*04
allele, the A*02/B*35/DRB1*13 haplotype, and homozygosity of A*02
were higher in patients (p=0.006, p=0.003, p=0.002, p=0.01, and
p=0.02, respectively), the frequencies of the A*23, B*13, B*40, and
DRB1*13 alleles were lower (p=0.002, p=0.07, p=0.002, and p=0.003,
respectively) in patients than controls. The frequencies of the DRB1*04
and DRB1*07 alleles were higher in patients in the high-risk group and
standard-risk group, respectively (p=0.009 and p=0.007, respectively).
This study indicated that the frequency of the A*03 allele, the DRB1*03
allele, the DRB1*04 allele, the A*02/B*35/DRB1*13 haplotype, and A*02
homozygosity may play a predisposing role in patients with ALL in the
Turkish population. The frequency of the DRB1*04 and DRB1*07 alleles
may also be associated with high risk and standard risk in patients
with ALL, respectively.
Keywords: Acute lymphoblastic leukemia, Human leukocyte antigen
alleles, Risk groups
Öz
Bu çalışmada akut lenfoblastik lösemili (ALL) hastalarda insan lökosit
antijeni alellerinin (A, B, ve DRB1) Türk toplumundaki dağılımını
araştırdık. Çalışmaya 90 ALL hastası ve 126 sağlıklı kontrol dahil edildi.
Kontrollerle karşılaştırdığımızda ALL hastalarında A*03, DRB1*03,
DRB1*04 alellerinin, A*02/B*35/DRB1*13 haplotipinin ve homozigot
olarak A*02 alelinin daha sık olarak (sırası ile p=0,006, p=0,003, p=0,002,
p=0,01 ve p=0,02) dağıldığını gözlemledik. Aksine A*23, B*13, B*40
ve DRB1*13 alelleri (sırası ile p=0,002, p=0,07, p=0,002 ve p=0,003)
ise kontrol grubunda daha fazla olarak saptandı. Ayrıca DRB1*04 ve
DRB1*07 alelleri (sırası ile p=0,009 ve p=0,007) risk gruplarına göre
yapılan karşılaştırmada sırası ile yüksek ve standart riskli hastalarda
daha fazla bulundu. Bu çalışma ile ALL hastalarında Türk toplumu
için A*03, DRB1*03, DRB1*04 alelleri, A*02/B*35/DRB1*13 haplotipi
ve homozigot formdaki A*02 alelinin bir risk faktörü olabileceği
gözlemlendi. Ayrıca DRB1*04 ve DRB1*07 alellerinin risk gruplarının
oluşmasında sırası ile yüksek ve standart risk gruplarında daha fazla
bulunabileceği tespit edildi.
Anahtar Sözcükler: Akut lenfoblastik lösemi, İnsan lökosit antijeni
alelleri, Risk grupları
Introduction
Acute leukemia is an uncontrolled clonal disease due to the
increasing of immature hematopoietic cells with a rate of at
least 25% in the bone marrow [1]. Acute lymphoblastic leukemia
(ALL) is the most common cancer in pediatric populations [2]. The
incidence of ALL is about 30 cases per million persons younger
than 20 years. It is also the most common cause of death among
cancers in children [3,4]. Patients with ALL can be classified
into 3 risk groups as follows: a standard-risk group (SRG), a
moderate-risk group (MRG) with adequate early treatment
response, and a high-risk group (HRG) with inadequate response
to induction treatment or Philadelphia chromosome-positive
ALL [4,5]. Human leukocyte antigen (HLA) genes encode cell
surface glycoproteins associated with antigen presentation that
selectively interact with short peptide fragments derived from
Address for Correspondence/Yazışma Adresi: H. Haluk Akar, M.D.,
Erciyes University Faculty of Medicine, Department of Pediatric Immunology, Kayseri, Turkey
Phone : +90 352 207 66 66/25300
E-mail : himmetakar@gmail.com
Received/Geliş tarihi: March 13, 2016
Accepted/Kabul tarihi: April 20, 2016
339

Patıroğlu T and Akar HH; HLA (A, B, and DRB1) Alleles and Acute Lymphoblastic Leukemia
Turk J Hematol 2016;33:339-345
non-self and self-proteins. The HLA class I molecules (A, B, and
C) present intracellular antigens to CD8 + T cells, while class II
molecules (DR, DQ, and DP) present extracellular antigens to
CD4 + T cells, which activate macrophages and B cells. HLA has a
major role in regulating host responses to infections. It has been
hypothesized that the HLA alleles may have an important role in
predisposal to ALL [6]. The HLA genes are the most polymorphic
genes in the human genome [7]. An association between ALL and
HLA alleles has been shown in the literature; however, the data
are not conclusive so far [8,9,10,11,12,13]. There are no identified
consistent leukemia-associated HLA class I genes to date, but
investigations of HLA class II genes such as DRB3, DRB4, and
DRB5 have demonstrated consistent associations in patients
with leukemia [14]. Genome-wide association studies have
also identified some other risk alleles in different genes such as
CDKN2A, PIP4K2A, GATA3, ARID5B, and CEBPE in patients with
ALL [15]. In this study, we aimed to evaluate the association of
HLA alleles, haplotypes, and homozygosity in patients with ALL.
Materials and Methods
Study Population
This retrospective study was performed at the HLA Tissue Typing
Laboratory of Erciyes University in Kayseri, Turkey. Ninety pediatric
ALL patients (58 male patients and 32 female patients, 76 patients
with B-cell and 14 patients with T-cell ALL, aged 7 months to 16
years) and 126 age- and sex-matched unrelated healthy controls
(72 males and 54 females, aged 1-18 years) were enrolled in this
study, all of Turkish ethnic origin. Participants in the control
group were selected from among unrelated healthy donors who
were studied for HLA alleles for transplantation (for solid organ
or hematological malignancies). In the 90 patients with ALL, risk
groups were as follows: 29 patients in the SRG, 37 in the MRG,
and 24 in the HRG.
Human Leukocyte Antigen Typing
Whole venous blood specimens were collected in 2KE tubes with
EDTA for all participants. Genomic DNAs were obtained using
the BioRobot EZ1 (QIAGEN, Hilden, Germany). Genotyping of
HLA alleles was done as low-resolution typing by the polymerase
chain reaction with sequence-specific oligonucleotide probe
(PCR-SSOP) method (Gen-Probe Lifecodes, Stanford, CA, USA).
MATCH IT DNA software version 1.2.0 was used for HLA allele
interpretation.
Statistical Analysis
Statistical analyses were performed using SPSS 22. The association
of alleles, haplotypes, and homozygosity was compared with the
chi-square test (χ 2 ). Two groups were in accordance with Hardy-
Weinberg equilibrium (p>0.005). The Bonferroni correction test
was performed for multiple comparisons in risk groups. A value
of p≤0.05 was accepted to be statistically significant.
Results
The frequencies of A, B, and DRB1 alleles are shown as 2n in Tables
1, 2, and 3. Although the frequencies of the A*03, DRB1*03, and
DRB1*04 alleles were observed to be higher (p=0.006, p=0.003,
and p=0.002, respectively) in patients with ALL, the frequencies
of A*23, B*13, B*40, and DRB1*13 (p=0.002, p=0.07, p=0.002,
and p=0.003, respectively) were observed to be lower. In the
second step, we evaluated the frequency of haplotypes (Table
4). The A*02/B*35/DRB1*13 haplotype was found to be higher in
Table 1. The frequency of HLA-A alleles.
HLA-A ALL (2n=180) Controls (2n=252) p-value OR (95% CI)
A*01
A*02
A*03
A*11
A*23
A*24
A*25
A*26
A*29
A*30
A*31
A*32
A*33
A*68
n Frequency (%) n Frequency (%)
18
30
33
13
2
30
3
6
7
4
4
12
8
10
10
16.7
18.8
7.2
1.1
16.7
1.7
3.3
3.9
2.2
2.2
6.7
4.4
5.6
ALL: Acute lymphoblastic leukemia, CI: confidence interval, NS: nonsignificant, OR: odds ratio.
29
47
23
16
18
48
1
9
9
6
4
7
10
21
11.5
18.7
9.1
6.3
7.1
19
0.4
3.6
3.6
2.4
1.6
2.8
4.0
8.3
NS
NS
0.006
NS
0.002
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
0.45 (0.25-0.79)
NS
6.84 (1.57-29.90)
NS
NS
NS
NS
NS
NS
NS
NS
NS
340

Turk J Hematol 2016;33:339-345
Patıroğlu T and Akar HH; HLA (A, B, and DRB1) Alleles and Acute Lymphoblastic Leukemia
Table 2. The frequency of HLA-B alleles.
HLA-B ALL (2n=180) Controls (2n=252) p-value OR (95% CI)
B*07
B*08
B*13
B*14
B*15
B*17
B*18
B*22
B*27
B*35
B*38
B*39
B*40
B*41
B*44
B*45
B*49
B*50
B*51
B*52
B*55
B*56
B*57
B*58
n Frequency (%) n Frequency (%)
10
4
4
4
5
1
16
2
7
40
2
2
2
4
10
1
7
9
29
6
4
5
2
4
5.6
2.2
2.2
2.2
2.8
0.6
8.9
1.1
3.9
22.2
1.1
1.1
1.1
2.2
5.6
0.6
3.9
5
16.1
3.3
2.2
2.8
1.1
2.2
ALL: Acute lymphoblastic leukemia, CI: confidence interval, NS: nonsignificant, OR: odds ratio.
Table 3. The frequency of HLA-DRB1 alleles.
11
13
21
5
6
2
13
3
6
50
2
3
18
7
10
3
11
12
28
7
6
2
4
5
4.4
5.3
8.3
2.8
3.3
1.1
5.2
1.7
2.4
19.8
0.8
1.2
7.1
2.8
5.6
1.7
4.4
4.8
11.1
2.8
2.4
0.8
1.6
2.0
NS
NS
0.007
NS
NS
NS
NS
NS
NS
NS
NS
NS
0.002
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
4.0 (1.35-11.86)
NS
NS
NS
NS
NS
NS
NS
NS
NS
6.8 (1.57-29.90)
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
HLA-DRB1 ALL (2n=180) Controls (2n=180) p-value OR (95% CI)
DRB1*01
DRB1*03
DRB1*04
DRB1*07
DRB1*08
DRB1*09
DRB1*10
DRB1*11
DRB1*12
DRB1*13
DRB1*14
DRB1*15
DRB1*16
n Frequency (%) n Frequency (%)
16
20
60
29
7
3
8
33
4
6
6
12
6
8.9
11.1
33.3
16.1
3.9
1.7
4.4
18.3
2.2
3.3
3.3
6.7
3.3
ALL: Acute lymphoblastic leukemia, CI: confidence interval, NS: nonsignificant, OR: odds ratio.
19
11
50
28
7
3
5
54
3
28
14
19
11
7.5
4.4
19.8
11.1
2.8
1.2
2.0
21.4
1.2
11.1
5.6
7.5
4.4
NS
0.003
0.002
NS
NS
NS
NS
NS
NS
0.003
NS
NS
NS
NS
0.36 (0.17-0.78)
0.50 (0.32-0.77)
NS
NS
NS
NS
NS
NS
3.62 (1.47-8.95)
NS
NS
NS
frequency in patients with ALL (7.8% vs. 0.8%, p=0.01; Table 4).
In the third step, we investigated the homozygosity of HLA alleles
(Table 5). The most homozygous alleles were A*02 (6.7% vs. 0.8%,
p=0.02) and DRB1*11 (6.7% vs. 4%). The frequency of HLA alleles
was compared among patients according to risk groups in the
last step (Table 6). Although DRB1*04 frequency was observed to
be higher in patients in the HRG (p=0.009), DRB1*07 frequency
was found to be higher in patients in the SRG (p=0.007).
341

Patıroğlu T and Akar HH; HLA (A, B, and DRB1) Alleles and Acute Lymphoblastic Leukemia
Turk J Hematol 2016;33:339-345
Table 4. The frequency of HLA-A, -B, and -DRB1 haplotypes.
Haplotype ALL (n=90) Controls (n=126) p-value OR (95% CI)
A*01/B*08/DRB1*03
A*01/B*18/DRB1*11
A*01/B*35/DRB1*11
A*02/B*08/DRB1*03
A*02/B*14/DRB1*01
A*02/B*35/DRB1*04
A*02/B*35/DRB1*13
A*02/B*40/DRB1*04
A*02/B*44/DRB1*07
A*02/B*44/DRB1*11
A*02/B*50/DRB1*07
A*02/B*51/DRB1*04
A*03/B*35/DRB1*11
A*03/B*51/DRB1*04
A*11/B*51/DRB1*14
A*24/B*18/DRB1*11
A*24/B*35/DRB1*11
A*24/B*51/DRB1*04
A*24/B*51/DRB1*11
A*32/B*35/DRB1*11
A*68/B*35/DRB1*11
n Frequency (%) n Frequency (%)
3
3
1
2
3
2
7
1
0
1
0
1
1
2
1
3
1
1
2
2
1
3.3
3.3
1.1
2.2
3.3
2.2
7.8
1.1
0
1.1
0
1.1
1.1
2.2
1.1
3.3
1.1
1.1
2.2
2.2
1.1
ALL: Acute lymphoblastic leukemia, CI: confidence interval, NS: nonsignificant, OR: odds ratio.
Table 5. The homozygosity of HLA alleles.
4
1
0
3
1
2
1
2
1
2
1
1
4
2
2
0
2
0
4
2
3
3.2
0.8
0
2.4
0.8
1.6
0.8
1.6
0.8
1.6
0.8
0.8
3.2
1.6
1.6
0
1.6
0
3.2
1.6
2.4
NS
NS
NS
NS
NS
NS
0.01
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
0.095 (0.011-0.785) NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
Homozygosity ALL (n=90) Controls (n=126) p-value OR (95% CI)
A*01/A*01
A*02/A*02
A*03/A*03
A*11/A*11
A*23/A*23
A*24/A*24
B*07/B*07
B*18/B*18
B*27/B*27
B*35/B*35
B*38/B*38
B*39/B*39
B*40/B*40
B*44/B*44
B*50/B*50
B*51/B*51
DRB1*03/DRB1*03
DRB1*04/DRB1*04
DRB1*07/DRB1*07
DRB1*11/DRB1*11
DRB1*13/DRB1*13
DRB1*15/DRB1*15
n Frequency (%) n Frequency (%)
1
6
4
0
1
4
1
1
0
4
1
0
0
1
1
4
3
2
2
6
2
0
1.1
6.7
4.4
0
1.1
4.4
1.1
1.1
0
4.4
1.1
0
0
1.1
1.1
4.4
3.3
2.2
2.2
6.7
2.2
0
ALL: Acute lymphoblastic leukemia, CI: confidence interval, NS: nonsignificant, OR: odds ratio.
0
1
2
1
0
4
0
0
1
3
0
1
1
0
0
2
2
3
0
5
0
1
0
0.8
1.6
1.1
0
3.2
0
0
0.8
2.4
0
0.8
0.8
0
0
1.6
1.6
2.4
0
4
0
0.8
NS
0.02
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
0.112 (0.13-0.94)
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
NS
342

Turk J Hematol 2016;33:339-345
Patıroğlu T and Akar HH; HLA (A, B, and DRB1) Alleles and Acute Lymphoblastic Leukemia
Table 6. The frequency of HLA alleles in risk groups.
HLA
ALL (2n=180)
Allele frequencies
in HRG (2n=48)
Allele frequencies
in MRG (2n=74)
Allele frequencies
in SRG (2n=58)
A*01 4 (8.3%) 10 (13.5%) 4 (6.7%) NS
A*02 12 (25%) 15 (20.2%) 13 (22.4%) NS
A*03 7 (14.5%) 11 (14.9%) 10 (17.2%) NS
A*11 5 (10.4%) 3 (4%) 5 (8.6%) NS
A*23 1 (2%) 1 (1.3%) 1 (1.7%) NS
A*24 7 (14.5%) 14 (18.9%) 9 (15.5%) NS
A*25 1 (2%) 1 (1.3%) 1 (1.7%) NS
A*26 1 (2%) 3 (4%) 3 (5.8%) NS
A*29 1 (2%) 3 (4%) 3 (5.8%) NS
A*30 1 (2%) 2 (2.7%) 1 (1.7%) NS
A*31 0 2 (2.7%) 2 (3.4%) NS
A*32 3 (6.25%) 6 (8.1%) 3 (5.8%) NS
A*33 1 (2%) 1 (1.3%) 1 (1.7%) NS
A*66 0 0 0 NS
A*68 4 (8.3%) 2 (2.7%) 2 (3.4%) NS
A*69 0 0 0 NS
B*07 1 (2%) 2 (2.7%) 2 (3.4%) NS
B*08 1 (2%) 2 (2.7%) 1 (1.7%) NS
B*13 1 (2%) 2 (2.7%) 1 (1.7%) NS
B*14 2 (4.1%) 2 (2.7%) 0 NS
B*15 1 (2%) 2 (2.7%) 2 (3.4%) NS
B*17 0 0 1 (1.7%) NS
B*18 2 (4.1%) 9 (12.7%) 5 (8.6%) NS
B*22 0 1 (1.3%) 0 NS
B*27 2 (4.1%) 3 (4%) 2 (3.4%) NS
B*35 10 (21%) 17 (22.3%) 13 (22.4%) NS
B*38 4 (8.3%) 5 (6.8%) 4 (6.7%) NS
B*39 1 (2%) 0 1 (1.7%) NS
B*40 0 1 (1.3%) 1 (1.7%) NS
B*41 1 (2%) 2 (2.7%) 1 (1.7%) NS
B*44 2 (4.1%) 3 (4%) 5 (8.6%) NS
B*45 1 (2%) 0 0 NS
B*49 1 (2%) 2 (2.7%) 2 (3.4%) NS
B*50 2 (4.1%) 2 (2.7%) 5 (8.6%) NS
B*51 10 9 (12.7%) 10 (17.2%) NS
B*52 3 (6.25%) 2 (2.7%) 1 (1.7%) NS
B*55 0 1 (1.3%) 0 NS
B*56 1 (2%) 3 (4%) 1 (1.7%) NS
p-value
343

Patıroğlu T and Akar HH; HLA (A, B, and DRB1) Alleles and Acute Lymphoblastic Leukemia
Turk J Hematol 2016;33:339-345
Table 6. Continuation
B*57 0 1 (1.3%) 0 NS
B*58 1 (2%) 1 (1.3%) 0 NS
B*60 0 1 (1.3%) 0 NS
B*62 1 (2%) 0 0 NS
B*65 0 1 (1.3%) 0 NS
DRB1*01 2 (4.1%) 5 (6.8%) 2 (3.4%) NS
DRB1*03 5 (10.4%) 7 (9.5%) 6 (10.3%) NS
DRB1*04 14 (29.2%) a 12 (16.2%) a,b 4 (6.7%) b 0.009
DRB1*07 3 (6.25%) a 6 (8.1%) a 14 (24.1%) b 0.007
DRB1*08 1 (2%) 2 (2.7%) 1 (1.7%) NS
DRB1*09 1 (2%) 1 (1.3%) 2 (3.4%) NS
DRB1*10 0 2 (2.7%) 2 (3.4%) NS
DRB1*11 9 (18.8%) 14 (18.9%) 10 (17.2%) NS
DRB1*12 0 2 (2.7%) 2 (3.4%) NS
DRB1*13 5 (6.25%) 8 (10.8%) 5 (8.6%) NS
DRB1*14 2 (4.1%) 5 (6.8%) 3 (5.8%) NS
DRB1*15 4 (8.3%) 5 (6.8%) 4 (6.7%) NS
DRB1*16 2 (4.1%) 5 (6.8%) 3 (5.8%) NS
HLA: Human leukocyte antigen, ALL: acute lymphoblastic leukemia, HRG: high-risk group, MRG: moderate-risk group, SRG: standard-risk group, NS: nonsignificant; a, b: superscripted
letters show statistical significance.
Discussion
The underlying mechanisms are not well defined in patients with
ALL [1,16]. The presence of genetic effects on the development
of leukemia was observed in monozygotic twins [16,17]. Some
studies have shown that some HLA alleles may be involved in
the development of leukemia [14,17]. The first HLA association
was reported in 1967, with increased frequency of the A*02
allele in patients with ALL [18]. On this topic, however, the data
remain insufficient. Several associations have been reported
between leukemia and HLA genes such as DRB3, DRB4, and
DRB5 so far [14]. There are some inconsistencies among studies
in the literature. The frequency of DRB1*13 as a protective allele
was reported to be lower in some previously reported studies,
as it was in our study [10,12]. This similarity for the DRB1*13
allele among studies may be explained by geographic proximity
and interactions between Iranian [10] and Turkish populations
[12]. In another Turkish study, the frequency of DRB1*04 was
reported to be higher and the frequency of A*23 was reported
to be lower in patients with ALL, as in our study [11]. In that
study, inconsistent with our data, B*07 frequency was observed
to be lower in patients with ALL. In another Turkish study, a
positive association was reported in some alleles such as A*11
and DRB1*01, which is inconsistent with our results in patients
with ALL [12]. These discrepancies among Turkish studies may
result from the size of study populations. In this study, we
also observed a positive association with A*03, DRB1*03, and
DRB1*04 alleles in patients with ALL. In contrast to our study,
Fernandes et al. [19] reported a negative association between
ALL and DRB1*04 in an adult population. Our results contribute
some new information to the literature about HLA associations
in patients with ALL for the Turkish population. For example, the
frequency of A*03, B*13, B*40, and DRB1*03 was inconsistent
with the results of other reported Turkish studies [11,12]. In
the literature, some HLA haplotypes have also been accepted
as important risk factors for developing leukemia [10,19]. For
example, a negative association with the A*02/B*35/DRB1*13
haplotype was observed in patients with ALL [12]. On the
contrary, A*02/B*35/DRB1*13 haplotype frequency was observed
to be higher in our study as a predisposing factor. Homozygosity
of DRB4*01 was also reported to be a risk factor in children
with leukemia [20]. In this study, the homozygosity of A*02 was
observed to be higher in patients as a predisposing factor. In the
last step of our research, although the frequency of DRB1*04 was
observed to be higher in patients with high risk, the frequency
of the DRB1*07 allele was found to be higher in patients with
standard risk. As a limitation, the number of participants in
our study was not large enough to make conclusive decisions
about HLA association, which may lead to some discrepancies
from other Turkish studies of patients with ALL. Additionally,
some odd ratios (OR) in this study were calculated as lower than
zero (<0.00), such as those for DRB1*03 (OR=0.36), DRB1*04
344

Turk J Hematol 2016;33:339-345
Patıroğlu T and Akar HH; HLA (A, B, and DRB1) Alleles and Acute Lymphoblastic Leukemia
(OR=0.50), the A*02/B*35/DRB1*13 haplotype (OR=0.09), and
A*02/A*02 homozygosity (OR=0.11). The lower OR values can
most likely be explained by the small importance of these data
among the genetic factors predisposing to ALL.
In conclusion, although A*03, DRB1*03, and DRB1*04 were
observed to be susceptible alleles, A*23, B*13, B*40, and
DRB1*13 were found to be protective alleles in patients with
ALL. Although some results of our study support earlier findings,
others are inconsistent. The increasing frequency of DRB1*04
and the decreasing frequency of A*23 and DRB1*13 alleles
support results of earlier Turkish studies [11,12]. As new data,
the frequencies of the A*02/B*35/DRB1*13 haplotype and A*02
homozygosity were observed to be higher as predisposing factors
in patients with ALL. The frequency of DRB1*07 and DRB1*04
was observed to higher in the SRG and HRG, respectively, as
additional predisposing factors.
Ethics
Ethics Committee Approval: Retrospective study; Informed
Consent: It was not required.
Authorship Contributions
Concept: Türkan Patıroğlu, H. Haluk Akar; Design: Türkan
Patıroğlu, H. Haluk Akar; Data Collection or Processing: H. Haluk
Akar; Analysis or Interpretation: Türkan Patıroğlu; Literature
Search: H. Haluk Akar; Writing: Türkan Patıroğlu, H. Haluk Akar.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Wintrobe MM. Clinical Hematology. 20th ed. Philadelphia, Wolters Kluwer-
Lippincott Williams & Wilkins, 2009.
2. Greaves M. Infection, immune responses and the aetiology of childhood
leukaemia. Nat Rev Cancer 2006;6:193-203.
3. Hunger SP, Mullighan CG. Acute lymphoblastic leukemia in children. N Engl
J Med 2015;373:1541-1552.
4. Bradshaw G, Hinds PS, Lensing S, Gattuso JS, Razzouk BI. Cancer-related
deaths in children and adolescents. J Palliat Med 2005;8:86-95.
5. Schrappe M, Reiter A, Ludwig WD, Harbott J, Zimmermann M, Hiddemann
W, Niemeyer C, Henze G, Feldges A, Zintl F, Kornhuber B, Ritter J, Welte K,
Gadner H, Riehm H. Improved outcome in childhood acute lymphoblastic
leukemia despite reduced use of anthracyclines and cranial radiotherapy:
results of trial ALL-BFM 90. German-Austrian-Swiss ALL-BFM Study Group.
Blood 2000;95:3310-3322.
6. Hosking FJ, Leslie S, Dilthey A, Moutsianas L, Wang Y, Dobbins SE,
Papaemmanuil E, Sheridan E, Kinsey SE, Lightfoot T, Roman E, Irving JA,
Allan JM, Taylor M, Greaves M, McVean G, Houlston RS. MHC variation and
risk of childhood B-cell precursor acute lymphoblastic leukemia. Blood
2011;117:1633-1640.
7. Clayton J, Lonjou C. Allele and haplotype frequencies for HLA loci in various
ethnic groups. In: Charron D, (ed). Genetic Diversity of HLA. Functional and
Medical Implications. Paris, Medical and Scientific International, 1997.
8. Khosravi F, Amirzargar A, Sarafnejad A, Nicknam MH, Alimoghadam K,
Dianat S, Solgi G, Nikbin B. HLA class II allele and haplotype frequencies in
Iranian patients with leukemia. Iran J Allergy Asthma Immunol 2007;6:137-
142.
9. Taylor M, Hussain A, Urayama K, Chokkalingam A, Thompson P, Trachtenberg
E, Buffler P. The human major histocompatibility complex and childhood
leukemia: an etiological hypothesis based on molecular mimicry. Blood Cells
Mol Dis 2009;42:129-135.
10. Yari F, Sobhani M, Sabaghi F, Zaman-Vaziri M, Bagheri N, Talebian A.
Frequencies of HLA-DRB1 in Iranian normal population and in patients with
acute lymphoblastic leukemia. Arch Med Res 2008;39:205-208.
11. Ozdilli K, Oguz FS, Anak S, Kekik C, Carin M, Gedikoglu G. The frequency of
HLA class I and II alleles in Turkish childhood acute leukaemia patients. J Int
Med Res 2010;38:1835-1844.
12. Uçar F, Sönmez M, Erkut N, Balcı M, Yücel B, Yılmaz M, Erduran E, Ovalı E.
Relation of HLA-A, -B, -DRB1 alleles and haplotypes in patients with acute
leukemia: a case control study. Arch Med Res 2011;42:305-310.
13. Taylor GM, Hussain A, Lightfoot TJ, Birch JM, Eden TO, Greaves MF. HLAassociated
susceptibility to childhood B-cell precursor ALL: definition and
role of HLA-DPB1 supertypes. Br J Cancer 2008;98:1125-1131.
14. Urayama KY, Thompson PD, Taylor M, Trachtenberg EA, Chokkalingam AP.
Genetic variation in the extended major histocompatibility complex and
susceptibility to childhood acute lymphoblastic leukemia: a review of the
evidence. Front Oncol 2013;3:300.
15. Walsh KM, de Smith AJ, Welch TC, Smirnov I, Cunningham MJ, Ma X,
Chokkalingam AP, Dahl GV, Roberts W, Barcellos LF, Buffler PA, Metayer C,
Wiemels JL. Genomic ancestry and somatic alterations correlate with age
at diagnosis in Hispanic children with B-cell acute lymphoblastic leukemia.
Am J Hematol 2014;89:721-725.
16. Greaves MF, Maia AT, Wiemels JL, Ford AM. Leukemia in twins: lessons in
natural history. Blood 2003;102:2321-2333.
17. Schumacher HR, Alvares CJ, Blough RI, Mazzella F. Acute leukemia. Clin Lab
Med 2002;22:153-192.
18. Curtoni ES, Mattiuz PL, Tosi RM, (eds). Histocompatibility Testing.
Copenhagen, Munksgaard, 1967.
19. Fernandes TA, Fukai R, Souza CA, Lorand-Metze I, Magna LA, Kraemer MH.
Molecular identification of the HLA-DRB1-DQB1 for diagnosis and followup
of acute leukemias. Blood Cells Mol Dis 2010;44:69-73.
20. Dorak MT, Lawson T, Machulla HK, Darke C, Mills KI, Burnett AK. Unraveling
an HLA-DR association in childhood acute lymphoblastic leukemia. Blood
1999;94:694-700.
345

BRIEF REPORT
DOI: 10.4274/tjh.2016.0046
Turk J Hematol 2016;33:346-348
Varicella-Zoster Virus Infections in Pediatric Malignancy Patients:
A Seven-Year Analysis
Pediatrik Malignite Hastalarında Varicella Zoster Virüs Enfeksiyonları: Yedi Yıllık Analiz
Mine Düzgöl 1 , Gülcihan Özek 2 , Nuri Bayram 1 , Yeşim Oymak 2 , Ahu Kara 1 , Bengü Demirağ 2 , Tuba Hilkay Karapınar 2 , Yılmaz Ay 2 ,
Canan Vergin 2 , İlker Devrim 1
1Dr. Behçet Uz Children Training and Research Hospital, Clinic of Pediatric Infectious Diseases, İzmir, Turkey
2Dr. Behçet Uz Children Training and Research Hospital, Clinic of Pediatric Hematology and Oncology, İzmir, Turkey
Abstract
Primary varicella-zoster virus (VZV) infection is a benign self-limited
disease. In this study, we review our experience in focusing on the
outcome and treatment of VZV infection in pediatric malignancy
patients. During the study period, a total of 41 patients with pediatric
malignancy had been hospitalized with the diagnosis of VZV infection.
All the patients were treated with intravenous acyclovir for a median
of 7 days (ranging from 5 to 21 days). The calculated attributable
delay of chemotherapy due to VZV infections was 8 days (ranging
from 2 to 60 days). VZV-related complications were observed in
3 of 41 patients (7%) who suffered from acute respiratory distress
syndrome, and one of them with hemophagocytic lymphohistiocytosis
died due to respiratory failure despite acyclovir and broad-spectrum
antimicrobial treatment plus supportive treatment. VZV infections
are still important contagious diseases in pediatric cancer patients,
because they cause not only significant mortality but also a delay in
chemotherapy.
Keywords: Varicella, Malignancy, Pediatric patient
Öz
Primer varisella zoster virüs (VZV) enfeksiyonu benign, kendi kendini
sınırlayan bir hastalıktır. Bu çalışmada pediatrik malignitesi olan
hastalarda VZV enfeksiyonu ve tedavisine odaklı tecrübelerimizi
gözden geçirmeyi amaçladık. Çalışma süresi boyunca; VZV enfeksiyonu
tanısı alan pediatrik maligniteli toplam 41 hasta hastaneye yatırıldı.
Tüm hastalar ortalama 7 gün (5 ila 21 gün arasında değişen)
intravenöz asiklovir ile tedavi edildi. VZV enfeksiyonlarına bağlı olarak
hesaplanan atfedilebilir kemoterapi gecikmesi ortalama 8 gündü (2 ile
60 gün arasında değişen). VZV enfeksiyonuna bağlı komplikasyonlar 41
hastadan 3’ünde (%7) akut solunum distres sendromu olarak görüldü
ve bu hastalardan hemofagositik lenfohistiyositozu olan bir tanesi
asiklovir, geniş spektrumlu antibiyotik ve destekleyici tedaviye rağmen
solunum yetmezliği nedeniyle kaybedildi. VZV enfeksiyonları, pediatrik
malignite hastalarında hala önemli bulaşıcı hastalıklardan biridir,
çünkü sadece ciddi mortaliteye sebep olmakla kalmayıp kemoterapi
başlangıcını da geciktirmektedir.
Anahtar Sözcükler: Varisella, Malignite, Çocuk hasta
Introduction
Immunocompromised children are at greater risk of suffering
from severe, prolonged, and complicated varicella-zoster virus
(VZV) infection [1]. Before introduction of antiviral therapy,
the mortality rate of VZV infections in children with cancer
was reported to be 7%, with numbers reaching up to 55%
in cases with visceral involvement [2,3,4,5]. In this study, we
aimed to review our experience in focusing on the outcome and
treatment of VZV infections in pediatric malignancy patients.
Materials and Methods
A retrospective cohort study design was used to evaluate pediatric
cancer patients with VZV infections who were hospitalized in the
Pediatric Hematology-Oncology and Infectious Diseases Units
of the Dr. Behçet Uz Children’s Hospital from December 2008
to March 2015. In this study, the attending physician’s clinical
diagnosis of VZV infection was based on case definitions set by
the United States Centers for Disease Control and Prevention and
the Council of State and Territorial Epidemiologists guidelines
reported in 2009 [6,7]. Therapy with intravenous acyclovir (1500
Address for Correspondence/Yazışma Adresi: Mine DÜZGÖL, M.D.,
Dr. Behçet Uz Children Training and Research Hospital, Clinic of Pediatric Infectious Diseases, İzmir, Turkey
Phone : +90 232 489 56 56
E-mail : mineduzgol@gmail.com
Received/Geliş tarihi: January 27, 2016
Accepted/Kabul tarihi: March 28, 2016
346

Turk J Hematol 2016;33:346-348
Düzgöl M, et al: Varicella Infections in Pediatric Malignancy Patients
mg/m 2 /day) in 3 divided doses was started on the first day of the
onset of rash. VZV infection-related complications were defined
as a condition or event occurring within 14 days of the onset of
VZV infection [2]. Statistical analysis was done using SPSS 16.0
(SPSS Inc., Chicago, IL, USA).
Results
During the study period, a total of 41 patients with pediatric
malignancy had been hospitalized with the diagnosis of VZV
infection. Among them, 14 (34.1%) were female and 27 (65.9%)
were male. The mean age was 58.8±32.4 months (within the
range of 8 months to 12 years of age). Of the patients, 29 had
acute lymphoblastic leukemia (ALL) (70.7%), followed by 2
cases of acute myeloblastic leukemia (4.9%), 3 cases of Wilms
tumor (7.3%), 2 cases of hemophagocytic lymphohistiocytosis
(HLH) (4.9%), 2 cases of rhabdomyosarcoma (4.9%), 2 cases of
neuroblastoma (4.9%), and 1 case of hepatoblastoma (2.4%).
Among the ALL patients, 8 (27.5%) of them were in the
induction phase of chemotherapy (ALL REZ-Berlin-Frankfurt-
Münster protocol), 19 (65.5%) of them were in a maintenance
phase, and 2 patients (6.8%) had relapsed ALL. Only 2 children
(4.9%) had a known exposure to siblings in the household who
had developed chickenpox.
Among the 41 patients, neutropenia was present in 18 patients
(43.9%), lymphopenia was present in 27 (65.9%) patients,
thrombocytopenia was present in 10 patients (24.4%), and
anemia was present in 23 (56.1%) patients. Twenty-one patients
had associated fever at the time of diagnosis of VZV infection.
Active vesicular rashes were present in all of the patients at
the time of diagnosis and the median duration of active VZV
infection was 7 days (ranging from 5 to 21 days). All patients
had been admitted to our hospital within the first day of the
onset of rash.
All the patients were treated with intravenous acyclovir for a
median of 7 days (ranging from 5 to 21 days). During acyclovir
treatment, no serious adverse effects including elevation in
blood creatinine and urea levels or hematuria were observed,
while 2 patients (4.8%) had nausea and vomiting that could not
be explained with other reasons.
The median hospital stay was 7 days (ranging from 3 to 35 days)
and the calculated attributable delay of chemotherapy due to
VZV infections was 8 days (ranging from 2 to 60 days). Thirtyeight
patients (93%) showed no complications, but 3 patients
(7%) suffered from Acute respiratory distress syndrome (ARDS).
Two of them required mechanical ventilation and one required
noninvasive ventilation; the patient with HLH (1%) died due
to respiratory failure despite acyclovir and broad-spectrum
antimicrobial treatment plus supportive treatment.
Discussion
Secondary attack rates among susceptible household contacts of
people with VZV are as high as 90%; i.e. 9 out of 10 susceptible
household contacts will become infected [8]. In this study,
only 2 children (4.9%) had a known exposure to siblings in the
household who had developed chickenpox. The majority of the
patients had no known exposure; it was reported that for half
of the ALL cases with varicella infections, the source of infection
was unknown [9]. Our findings suggest that, regarding the high
secondary attack rates of VZV infection, precautions should be
taken for preventing possible contact of malignancy patients
with VZV patients, especially in outpatient clinics including
elevators, playgrounds, etc.
In our study, the most common underlying malignant disease
was ALL (70.7%), supporting the findings of a previous report
[10]. Patients with an underlying diagnosis of ALL and children
less than 5 years of age were reported to develop complications
more than any other age group, which was consistent with
other studies [2]. In our study the ages of the most complicated
cases were above 5 years, which showed that patients in every
age group were at risk of serious VZV infection.
Immunocompromised patients develop serious complications,
such as secondary bacterial infection with invasive
Streptococcus pyogenes [11]. However, in our study, we
experienced Streptococcus pneumoniae sepsis only in one
ALL patient who required noninvasive mechanical ventilation
support. In our study, our patients who underwent intensive
chemotherapy faced complications and even death. Previous
reports showed higher mortality rates than our study, such as
7% in 60 patients who were undergoing chemotherapy due to
primary VZV pneumonitis, with or without acute encephalitis
[11]. Before the introduction of specific antiviral therapy, the
mortality rate of VZV infections in children with cancer was
reported to be 7%-10%, with rates reaching up to 55% in
cases with visceral involvement [2,3,4,5]. Children with acute
leukemia who had VZV infections were reported to have a high
risk for VZV pneumonia, which might occur in up to one-third
of patients with a fatality rate of about 10% [12]. In our study,
three patients (7%) with low absolute neutrophil count suffered
from ARDS and one of them died because of respiratory failure.
The fatality rate was about 2%.
Our study showed that the complicated cases were not
homogeneously distributed regarding their primary diseases. This
visceral dissemination was thought not be related to the type or
status of the malignancy or to the duration of specific anticancer
therapy. VZV was more likely to disseminate in children with
absolute lymphopenia, less than 500 cells per cubic millimeter,
than in patients with higher lymphocyte counts. Patients with
lymphopenia or poor cell-mediated immune responses during
347

Düzgöl M, et al: Varicella Infections in Pediatric Malignancy Patients
Turk J Hematol 2016;33:346-348
VZV infection are said to be at risk for persistent, severe, or even
fatal VZV [13]. Our patients with complicated clinical features
had lymphopenia and neutropenia, suggesting a correlation
between immune status and poor outcome.
Immunocompromised children, particularly those with leukemia,
have more numerous lesions, often with a hemorrhagic base,
and healing takes nearly three times longer than in healthy
children with VZV infections. These patients were reported to
suffer from severe progressive VZV infections characterized by
continuing eruption of lesions and high fever persisting into
the second week of illness [14]. In our study, despite the median
duration of the active chickenpox rash being 7 days, in some
cases active hemorrhagic vesicular lesions were observed until
21 days of disease. During our study the median hospital stay
was 7 days, similar to a previous report of 7.96±3.57 days [13].
Effective treatment with acyclovir is thought to be a significant
factor in reducing the severity and mortality of infection [15];
however, mortality is not the only problem with cancer patients.
One of the most important findings in our study was that,
regardless of the primary disease and chemotherapy protocol,
chemotherapy was delayed for at least for 2 days with a median
of 8 days, which could cause undesirable effects on the overall
chemotherapy protocol in children.
In conclusion, VZV infections are still important contagious
diseases in pediatric cancer patients because they cause not only
significant mortality but also a delay in chemotherapy. Thus,
infection control preventions should be taken in hospitals and
maximum efforts for preventing possible exposure of pediatric
cancer patients to VZV-infected children should be made.
Ethics
Ethics Committee Approval: Retrospective study; Informed
Consent: Retrospective study.
Authorship Contributions
Concept: Mine Düzgöl, Gülcihan Özek, Nuri Bayram, Yeşim
Oymak, Ahu Kara, Bengü Demirağ, Tuba Hilkay Karapınar,
Yılmaz Ay, Canan Vergin, İlker Devrim; Design: Mine Düzgöl,
İlker Devrim; Data Collection or Processing: Mine Düzgöl, İlker
Devrim; Analysis or Interpretation: Mine Düzgöl, İlker Devrim;
Literature Search: Mine Düzgöl; Writing: Mine Düzgöl.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Gunawan S, Linardi P, Tawaluyan K, Mantik MF, Veerman AJ. Varicella
outbreak in a pediatric oncology ward: the Manado experience. Asian Pac J
Cancer Prev 2010;11:289-292.
2. Feldman S, Hughes WT, Daniel CB. Varicella in children with cancer: seventyseven
cases. Pediatrics 1975;56:388-397.
3. Katsimpardi K, Papadakis V, Pangalis A, Parcharidou A, Panagiotou JP, Soutis
M, Papandreou E, Polychronopoulou S, Haidas S. Infections in a pediatric
patient cohort with acute lymphoblastic leukemia during the entire course
of treatment. Support Care Cancer 2006;14:277-284.
4. Matsuzaki A, Suminoe A, Koga Y, Kusuhara K, Hara T, Ogata R, Sata T, Hara
T. Fatal visceral varicella-zoster virus infection without skin involvement
in a child with acute lymphoblastic leukemia. Pediatr Hematol Oncol
2008;25:237-242.
5. Meir HM, Balawi IA, Meer HM, Nayel H, Al-Mobarak MF. Fever and
granulocytopenia in children with acute lymphoblastic leukemia under
induction therapy. Saudi Med J 2001;22:423-427.
6. Centers for Disease Control and Prevention. Epidemiology and Prevention
of Vaccine-Preventable Diseases, 10th ed. Washington DC, Public Health
Foundation, 2008.
7. Council of State and Territorial Epidemiologists. Public Health Reporting
and National Notification for Varicella. Atlanta, Council of State and
Territorial Epidemiologists, 2012.
8. Centers for Disease Control and Prevention. Epidemiology and Prevention
of Vaccine-Preventable Diseases, 13th ed. Washington DC, Public Health
Foundation, 2015.
9. Buda K, Tubergen DG, Levin MJ. The frequency and consequences of varicella
exposure and varicella infection in children receiving maintenance therapy
for acute lymphoblastic leukemia. J Pediatr Hematol Oncol 1996;18:106-112.
10. Alam MM, Qamar FN, Khan ZW, Kumar V, Mushtaq N, Fadoo Z. Risk factors
for complicated varicella infection in pediatric oncology patients at a
tertiary health care facility in Pakistan. J Infect Dev Ctries 2014;8:215-220.
11. Ben-Abraham R, Keller N, Vered R, Harel R, Barzilay Z, Paret G. Invasive
group A streptococcal infections in a large tertiary center: epidemiology,
characteristics and outcome. Infection 2002;30:81-85.
12. Feldman S, Lott L. Varicella in children with cancer: impact of antiviral
therapy and prophylaxis. Pediatrics 1987;80:465-472.
13. Escaño-Gallardo ET, Bravo LC. Varicella in immunocompromised children at the
Philippine general hospital: a six-year review. PIDSP Journal 2011;12:27-39.
14. Cherry J. Feigin and Cherry’s Textbook of Pediatric Infectious Diseases, 5th
ed. Philadelphia, W.B. Saunders, 2004.
15. Carcao MD, Lau RC, Gupta A, Huerter H, Koren G, King SM. Sequential
use of intravenous and oral acyclovir in the therapy of varicella in
immunocompromised children. Pediatr Infect Dis J 1998;17:626-631.
348

IMAGES IN HEMATOLOGY
DOI: 10.4274/tjh.2015.0446
Turk J Hematol 2016;33:349-350
Chediak-Higashi Syndrome in Accelerated Phase Masquerading
as Acute Leukemia
Akut Lösemiyi Taklit Eden Akselere Fazda Chediak Higashi Sendromu
Mili Jain, Ashutosh Kumar, Uma Shankar Singh, Rashmi Kushwaha
King George’s Medical University, Department of Pathology, Uttar Pradesh, India
Figure 1. Peripheral blood smear with Leishman stain at 400 x :
giant granules in neutrophils and lymphocytes.
Figure 2. Hair follicles at 400 x with irregularly sized melanosomes.
We present a 3-year-old female born of a consanguineous
marriage with the complaints of high-grade fever, petechial
spots, abdominal distension, and lymphadenopathy for 20
days. She had pallor, hypopigmented hairs, petechial rashes,
and palpable lymph nodes (up to 1 cm) in the bilateral
inguinal and cervical region. Systemic examination revealed
hepatosplenomegaly. Her hematological profile was as
follows: hemoglobin of 8.4 g/dL, normocytic normochromic
red cell indices, platelet count of 11x10 9 /L, total leukocyte
count of 7x10 9 /L with increased lymphocytes (68.5%), and
lactate dehydrogenase raised at 796 IU/L. The peripheral blood
smear examination revealed giant granules in neutrophils,
lymphocytes, and monocytes (Figure 1). Bone marrow
examination revealed similar granules in myeloid precursors
with moderate hemophagocytosis. Examination of the hair
shafts showed large melanin granules (Figure 2). Her liver
function tests, kidney function tests, and chest X-ray results
were within reference ranges. She was diagnosed with Chediak-
Higashi syndrome (CHS) in the accelerated phase.
CHS is a rare autosomal recessive disorder (gene CHS1/LYST) [1].
The clinical picture includes partial oculocutaneous albinism,
abnormal bleeding time, peripheral neuropathy, and recurrent
severe bacterial infection [2]. The giant lysosomal granules
(formed as a result of cytoplasmic injury, phagocytosis, and
fusion due to microtubular defects) in white blood cells are
pathognomonic for diagnosis [3].
Address for Correspondence/Yazışma Adresi: Mili JAIN, M.D.,
King George’s Medical University, Department of Pathology, Uttar Pradesh, India
Phone : 522 407 59 89
E-mail : milijain786@gmail.com
Received/Geliş tarihi: December 25, 2015
Accepted/Kabul tarihi: January 20, 2016
349

Jain M, et al. Chediak-Higashi Syndrome in Accelerated Phase Masquerading as Acute Leukemia Turk J Hematol 2016;33:349-350
Keywords: Chediak Higashi syndrome, Giant granules,
Immunodeficiency
Anahtar Sözcükler: Chediak Higashi sendromu, Dev granüller,
İmmün yetmezlik
Authorship Contributions
Concept: Mili Jain; Design: Mili Jain, Ashutosh Kumar, Uma Shankar
Singh, Rashmi Kushwaha; Data Collection or Processing: Mili Jain,
Ashutosh Kumar, Uma Shankar Singh, Rashmi Kushwaha; Analysis
or Interpretation: Mili Jain, Ashutosh Kumar, Uma Shankar Singh,
Rashmi Kushwaha; Literature Search: Mili Jain; Writing: Mili Jain.
Conflict of Interest: The authors of this paper have no conflicts of
interest, including specific financial interests, relationships, and/or
affiliations relevant to the subject matter or materials included.
References
1. Antunes H, Pereira A, Cunha I. Chediak-Higashi syndrome: pathognomonic
feature. Lancet 2013;382:1514.
2. Bharti S, Bhatia P, Bansal D, Varma N. The accelerated phase of Chediak-
Higashi syndrome: the importance of hematological evaluation. Turk J
Hematol 2013;30:85-87.
3. Usha HN, Prabhu PD, Sridevi M, Baindur K, Balakrishnan CM. Chediak-
Higashi syndrome. Indian Pediatr 1994;34:1115-1119.
350

IMAGES IN HEMATOLOGY
DOI: 10.4274/tjh.2015.0399
Turk J Hematol 2016;33:351-352
Auer Rod-Like Inclusions in Reactive Plasma Cells in a Case of
Acute Myeloid Leukemia
Akut Miyeloid Lösemili Bir Olguda Reaktif Plazma Hücresinde Auer-Rod Benzeri İnklüzyonlar
Sarita Pradhan
Institute of Medical Sciences and Sum Hospital, Laboratory of Hematology, Bhubaneswar, India
Figure 1. Myeloblasts and plasma cells containing Auer rod-like
inclusions.
Figure 2. Plasma cell showing Auer rod-like inclusions.
Figure 3. A Mott cell.
Address for Correspondence/Yazışma Adresi: Sarita PRADHAN, M.D.,
Institute of Medical Sciences and Sum Hospital, Laboratory of Hematology, Bhubaneswar, India
Phone : 9 776 243 866
E-mail : dr.sarita26@gmail.com
Received/Geliş tarihi: November 17, 2015
Accepted/Kabul tarihi: February 23, 2016
351

Pradhan S: Auer Rod-Like Inclusions in Plasma Cells Turk J Hematol 2016;33:351-352
A 61-year-old female presented with decreasing hemoglobin for
the past 6 months. She had a history of multiple transfusions in
the recent past. Laboratory investigations showed hemoglobin
of 8.6 g/dL, total blood leukocyte count of 1.13x10 9 /L, and
platelets of 80x10 9 /L with the presence of occasional circulating
blasts. Bone marrow examination revealed the presence of
63% myeloblasts with prominent Auer rods and mild reactive
plasmacytosis (6%). Some of the plasma cells showed Auer
rod-like thin slender inclusions (Figures 1, 2, and 3). She
was diagnosed with acute myeloid leukemia. Serum protein
electrophoresis was done, which showed a normal pattern.
Presence of Auer rod-like inclusions has been described in rare
cases of multiple myeloma [1,2], but Auer rod-like inclusions in
reactive plasma cells in a case of acute myeloid leukemia have not
been reported in the literature. The reported patients either had
IgA kappa myeloma or IgG myeloma. Rare cases of Auer rod-like
inclusions in aplastic anemia have been reported [3]. However,
the exact nature of these inclusions needs to be studied further.
Keywords: Auer rods, Acute myeloid leukemia, Plasma cells
Anahtar Sözcükler: Auer cismi, Akut miyeloid lösemi, Plazma
hücreleri
Conflict of Interest: The author of this paper has no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Parmentier S, Radke J. Pseudo Auer rods in a patient with newly diagnosed
IgG myeloma. Blood 2012;119:650.
2. Hütter G, Nowak D, Blau IW, Thiel E. Auer rod like intracytoplasmic
inclusions in multiple myeloma. A case report and review of literature. Int J
Lab Hematol 2009;31:236-240.
3. Lemez P. Auer rod-like inclusions in cells of B-lymphocytic lineage. Acta
Haematol 1988;80:177-178.
352

IMAGES IN HEMATOLOGY
DOI: 10.4274/tjh.2016.0106
Turk J Hematol 2016;33:353-354
Coexistence of Chronic Lymphocytic Leukemia and Acute
Myeloid Leukemia
Kronik Lenfositik Lösemi ile Akut Myeloid Lösemi Birlikteliği
Ivana Milosevic
University of Novi Sad Faculty of Medicine, Clinical Center of Vojvodina, Novi Sad, Serbia
Figure 1. Chronic lymphocytic leukemia cells and acute myeloid
leukemia cells in the peripheral blood smear.
A 76-year-old man presented with leukocytosis (86x10 9 /L),
fever, pneumonia, and significant weight loss. He had a history
of chronic lymphocytic leukemia diagnosed 5 years earlier
and he responded with partial remission to treatment with
continuous low doses of chlorambucil.
Analysis of the blood smear, bone marrow aspiration, and
bone marrow biopsy revealed the predomination of small
lymphocytes, but 22% of the cells were blasts negative with
cytochemical staining (Figure 1). Flow cytometric analysis
showed two distinct populations: 65% of cells were small to
moderate in size and CD19+, CD45+, CD5+, and CD20+/-, while
30% of cells were large, CD34+, CD13+, HLA DR+, CD65+,
CD45+, and MPO weakly positive and CD33, CD14, CD15, and
CD16 negative. Immunophenotyping confirmed the coexistence
of chronic lymphocytic leukemia and poorly differentiated
acute myeloid leukemia. Conventional cytogenetic testing did
not show any chromosomal abnormalities.
The patient was treated with intensive antibiotherapy and
received one course of chemotherapy, but he did not achieve
remission and died 2 months later.
The coexistence of chronic lymphocytic leukemia and acute
myeloid leukemia is rare [1]. Therapy-related acute myeloid
leukemia can develop after treatment of chronic lymphocytic
leukemia with alkylating agents, nucleoside analogs, or
combination chemotherapy, but the two leukemias can also
originate independently [2,3].
Keywords: Chronic lymphocytic leukemia, Acute myeloid
leukemia, Therapy
Address for Correspondence/Yazışma Adresi: Ivana MILOSEVIC, M.D.,
University of Novi Sad Faculty of Medicine, Clinical Center of Vojvodina, Novi Sad, Serbia
E-mail : ivana.milosevic@mf.uns.ac.rs
ivana.ml@mts.rs
Received/Geliş tarihi: March 16, 2016
Accepted/Kabul tarihi: March 23, 2016
353

Milosevic I: Coexistence of Chronic Lymphocytic Leukemia and Acute Myeloid Leukemia Turk J Hematol 2016;33:353-354
Anahtar Sözcükler: Kronik lenfositik lösemi, Akut miyeloid
lösemi, Tedavi
Conflict of Interest: The author of this paper has no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Tambaro FP, Garcia-Manero G, O’Brien SM, Faderl SH, Ferrajoli A,
Burger JA, Pierce S, Wang X, Do KA, Kantarjian HM, Keating MJ, Wierda
WG. Outcomes for patients with chronic lymphocytic leukemia and
acute leukemia or myelodysplastic syndrome. Leukemia 2016;30:325-
330.
2. Morrison VA, Rai KR, Peterson BL, Kolitz JE, Elias L, Appelbaum FR, Hines
JD, Shepherd L, Larson RA, Schiffer CA. Therapy-related myeloid leukemias
as are observed in patients with chronic lymphocytic leukemia after
treatment with fludarabine and chlorambucil: results of an intergroup
study, Cancer and Leukemia Group B 9011. J Clin Oncol 2002;15:3878-
3884.
3. Leone G, Pagano L, Ben-Yehuda D, Voso MT. Therapy-related leukemia and
myelodysplasia: susceptibility and incidence. Haematologica 2007;92:1389-
1398.
354

LETTERS TO THE EDITOR
Turk J Hematol 2016;33:355-370
Evaluation of Knowledge of Patients with Hemophilia Regarding
Their Diseases and Treatment in Iran
İran’daki Hemofili Hastalarının Hastalıkları ve Tedavileri Hakkında Bilgilerinin
Değerlendirilmesi
Mehran Karimi, Tahereh Zarei, Sezaneh Haghpanah, Zohreh Zahedi
Shiraz University of Medical Sciences, Hematology Research Center, Shiraz, Iran
To the Editor,
Hemophilia A and B are hereditary X-chromosomal recessive
disorders affecting 1 in 5000 male births [1,2]. Hemophilia is
classified as severe at F VIII / F IX <1 kIU L -1 , moderate at 1-5 kIU
L -1 , and mild at >5-25 kIU L -1 [3].
During the mid-1970s hemophilia care underwent substantial
improvement to provide more optimal disease management for
bleeding prevention strategies and education programs. This
led to better educational strategies for disease management
[4,5].
Home therapy can be used to manage mild and moderate
bleeding episodes and can help to achieve optimal treatment,
resulting in decreased pain and hospital admissions for
complications [6].
In this cross-sectional study, 30 patients with hemophilia
A and B who were registered at the Hemophilia Center
of Shiraz, Fars Province, southern Iran, were investigated
between March and October of 2013. The data collection
form consisted of two parts including demographic data and
22 specific questions regarding assessment of knowledge
of the patients regarding the disease and treatment. In
this latter section specific topics included appropriate
treatment, disease transmission, physiotherapy application,
management of bleeding, and the most common symptoms
of bleeding.
The correct answer to questions had a sum of 1 to 4 points.
Some of the questions had more than one correct answer.
Total knowledge scores were categorized into three grades:
scores of 1-14 (poor knowledge), 15-29 (fair knowledge), and
30-41 (good knowledge).
This study was approved by the Ethics Committee of Shiraz
University of Medical Sciences.
Data were analyzed by SPSS 17 using the Mann-Whitney U test
and the Pearson correlation test, and p<0.05 was considered as
statistically significant.
Demographic characteristics of the patients including disease
severity and educational level are shown in Table 1.
Participants included 3 female patients and 27 male patients; 26
patients had hemophilia type A and 4 patients had hemophilia
type B.
The median age of the patients was 23.5±6.1 years, ranging
from 8 to 37 years old. Seven patients had a mild/moderate and
23 had a severe form of hemophilia.
Overall, the mean knowledge score of the patients was
determined as 14.7±4.5 (range: 4-26). Considering the three
levels of knowledge classification, all patients fell into the
first category of poor knowledge (score of <30). There was no
significant correlation between the knowledge of the patients
and their ages (p=0.094). The results also revealed no significant
association between the knowledge of patients and disease
severity (p=0.446) or educational level (p>0.999).
There are limited studies that assess the knowledge level of
individual patients regarding the management of hemophilia
[7,8,9]. An important finding of this study was that patients’
knowledge was not correlated with age, educational level, or
disease severity.
Table 1. Demographic characteristics of the patients with
hemophilia, including severity and educational level.
Variables
Severity
Severe
Moderate/mild
Education level
High school Diploma
Undergraduate Diploma
Median
(Interquartile Range)
15 (5.50)
14 (5)
15 (5.63)
15.5 (11.13)
p-value
0.446
>0.999
355

LETTERS TO THE EDITOR Turk J Hematol 2016;33:355-370
Hemophilia associations should be recommended for educational
programs for patients and caregivers. Hematologists and
nongovernmental organizations can work together for lifelong
educational programs. Finally, we recommend holding patient
workshops twice a year as well as publishing simple books or
brochures in each local language to improve the knowledge and
therefore the quality of life of these patients.
Keywords: Knowledge, Hemophilia, Treatment, Disease
Anahtar Sözcükler: Bilgi, Hemofili, Tedavi, Hastalık
Ethics
Ethics Committee Approval: This study was approved by the
Ethics Committee of Shiraz University of Medical Sciences.
Authorship Contributions
Concept: Mehran Karimi; Design: Mehran Karimi; Editing the
Manuscript: Mehran Karimi; Data Collection or Processing:
Zohreh Zahedi; Analysis or Interpretation: Sezaneh Haghpanah;
Literature Search: Tahereh Zarei; Writing: Tahereh Zarei.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Stachnik J. Hemophilia: etiology, complications, and current options in
management. Formulary 2010;45:218.
2. Lee CA, Berntorp EE, Hoots WK. Textbook of Hemophilia. New York, John
Wiley & Sons, 2011.
3. White GC 2nd, Rosendaal F, Aledort LM, Lusher JM, Rothschild C,
Ingerslev J; Factor VIII and Factor IX Subcommittee. Definitions in
hemophilia. Recommendation of the Scientific Subcommittee on Factor
VIII and Factor IX of the Scientific and Standardization Committee of the
International Society on Thrombosis and Haemostasis. Thromb Haemost
2001;85:560.
4. Smith PS, Levine PH. The benefits of comprehensive care of hemophilia: a
five-year study of outcomes. Am J Public Health 1984;74:616-617.
5. Soucie JM, Nuss R, Evatt B, Abdelhak A, Cowan L, Hill H, Kolakoski M,
Wilber N. Mortality among males with hemophilia: relations with source of
medical care. Blood 2000;96:437-442.
6. Teitel J, Barnard D, Israels S, Lillicrap D, Poon MC, Sek J. Home management
of haemophilia. Haemophilia 2004;10:118-133.
7. Lindvall K, Colstrup L, Wollter IM, Klemenz G, Loogna K, Grönhaug S,
Thykjaer H. Compliance with treatment and understanding of own disease in
patients with severe and moderate haemophilia. Haemophilia 2006;12:47-
51.
8. Nazzaro AM, Owens S, Hoots WK, Larson KL. Knowledge, attitudes, and
behaviors of youths in the US hemophilia population: results of a national
survey. Am J Public Health 2006;96:1618-1622.
9. Miller K, Guelcher C, Taylor A. Haemophilia A: patients’ knowledge level
of treatment and sources of treatment‐related information. Haemophilia
2009;15:73-77.
Address for Correspondence/Yazışma Adresi: Mehran KARIMI, M.D.,
Shiraz University of Medical Sciences, Hematology Research Center, Shiraz, Iran
Phone : 00987136473239
E-mail : karimim@suns.ac.ir
Received/Geliş tarihi: January 24, 2016
Accepted/Kabul tarihi: June 02, 2016
DOI: 10.4274/tjh.2016.0041
Therapeutic Plasma Exchange Ameliorates Incompatible
Crossmatches
Çapraz Karşılaştırma Uyumsuzluklarını Ortadan Kaldıran Tedavi Edici Plazma Değişimi
Mehmet Özen 1 , Sinan Erkul 2 , Gülen Sezer Alptekin Erkul 2 , Özlem Genç 3 , Engin Akgül 2 , Ahmet Hakan Vural 2
1Dumlupınar University Faculty of Medicine, Department of Hematology, Kütahya, Turkey
2Dumlupınar University Faculty of Medicine, Department of Cardiac Surgery, Kütahya, Turkey
3Dumlupınar University Faculty of Medicine, Blood Bank Unit, Kütahya, Turkey
To the Editor,
Red blood cell (RBC) transfusion is a risk factor for mortality and
morbidity in coronary artery bypass graft (CABG) surgery, and
transfusion-related adverse effects may be catastrophic in these
patients [1,2,3,4]. Unfortunately, there are no recommendations
for these patients regarding how to proceed in the case of
incompatible crossmatch tests against donors’ blood. To our
knowledge, there is no report about the role of therapeutic
plasma exchange (TPE) in resolving incompatible crossmatches.
A 73-year-old man was admitted to our hospital because of
chest pain. He had no previous medical history of coronary
artery disease or any other diseases, including hemolytic disease
and recent infection. In addition, he used no medication and had
not received blood transfusions. After coronary angiography, a
356

Turk J Hematol 2016;33:355-370
LETTERS TO THE EDITOR
CABG was planned for the patient. Because of critical coronary
artery lesions, he had to undergo the operation as soon as
possible. His laboratory tests revealed mild normocytic anemia
with hemoglobin of 12.8 g/dL, mean corpuscular volume of
82.2 fL, white blood cell count of 9200/µL, and platelet count of
281,000/µL. His biochemical results were normal for renal and
liver function tests. The patient’s blood group was B Rh D positive
based on forward and reverse grouping. Whole blood transfusion
was planned for the CABG procedure by the surgeons as a part
of their conventional approach. However, cross match results
revealed 3+ reactions against B Rh D positive donors’ whole
blood and other B Rh D positive RBCs in the blood bank (Figure
1A). Direct Coombs test results were 2+ AHG and IgG (Figure
1B). Due to the urgency of the planned CABG, we did not wait
for detailed antibody screening test results, and TPE (Infomed,
Geneva, Switzerland) was performed. Total body plasma was
exchanged with fresh frozen plasma within 2 h. After one TPE
procedure, the cross-reaction to donors’ whole blood was 2+.
TPE was performed again 1 day later, and after the second TPE,
the crossmatches were compatible (Figures 1C and 1D). There
was no adverse effect due to TPE. We operated after the second
TPE, used a regular erythrocyte suspension and whole blood,
administered 40 mg/day intravenous methylprednisolone for 4
days, and discharged the patient 1 week after the operation.
Two weeks after the operation, he had no hematological or
antibody-related disease and he had a normal complete blood
count with compatible crossmatches. He also had no antibodies
related to incompatible crossmatches.
Figure 1. A) Crossmatch before therapeutic plasma exchange
(TPE), B) direct Coombs test before TPE, C) crossmatch after one
TPE, D) crossmatch after two TPEs. All tests were performed with
DG gel cards (Grifols) and used the Wadiana automated blood
bank (Grifols, SantCugat del Valles, Barcelona, Spain).
In a patient undergoing CABG, an incompatible blood
transfusion can lead to perioperative hemolysis and increased
mortality [5,6]. Defining the antibodies and finding compatible
blood for a patient with incompatible crossmatches can be a
challenging and time-consuming problem [5,7].
TPE is an important treatment modality for many autoimmune
conditions and helps by removing autoantibodies [8]. Our patient
did not have time to wait and needed CABG urgently. Therefore,
we assumed that the patient had antibody-related autoimmune
hemolytic anemia and treated him with TPE. We report that
this approach may be efficient for patients with incompatible
crossmatch results even if they do not have autoimmune
hemolytic anemia. Therefore, TPE might be reserved for urgent
conditions or when identification of antibodies is inconclusive.
Keywords: Cardiac surgery, Apheresis, Crossmatch, Transfusion
medicine
Anahtar Sözcükler: Kalp cerrahisi, Aferez, Çapraz karşılaştırma,
Transfüzyon tıbbı
Authorship Contributions
Concept: Mehmet Özen, Sinan Erkul; Design: Mehmet Özen,
Ahmet Hakan Vural; Data Collection or Processing: Özlem Genç,
Sinan Erkul, Gülen Sezer Alptekin Erkul, Engin Akgül; Analysis
or Interpretation: Mehmet Özen, Ahmet Hakan Vural; Writing:
Mehmet Özen.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Evanovitch D. A primer in pretransfusion testing. Transfus Apher Sci
2012;46:281-286.
2. Santos AA, Silva JP, Silva Lda F, Sousa AG, Piotto RF, Baumgratz JF.
Therapeutic options to minimize allogeneic blood transfusions and their
adverse effects in cardiac surgery: a systematic review. Rev Bras Cir
Cardiovasc 2014;29:606-621.
3. Senay S, Toraman F, Karabulut H, Alhan C. Is it the patient or the physician
who cannot tolerate anemia? A prospective analysis in 1854 non-transfused
coronary artery surgery patients. Perfusion 2009;24:373-380.
4. Society of Thoracic Surgeons Blood Conservation Guideline Task Force,
Ferraris VA, Ferraris SP, Saha SP, Hessel EA 2nd, Haan CK, Royston BD,
Bridges CR, Higgins RS, Despotis G, Brown JR; Society of Cardiovascular
Anesthesiologists Special Task Force on Blood Transfusion, Spiess BD, Shore-
Lesserson L, Stafford-Smith M, Mazer CD, Bennett-Guerrero E, Hill SE,
Body S. Perioperative blood transfusion and blood conservation in cardiac
surgery: the Society of Thoracic Surgeons and the Society of Cardiovascular
Anesthesiologists clinical practice guidelines. Ann Thorac Surg 2007;83(5
Suppl):27-86.
357

LETTERS TO THE EDITOR Turk J Hematol 2016;33:355-370
5. White MJ, Hazard SW 3rd, Frank SM, Boyd JS, Wick EC, Ness PM, Tobian
AA. The evolution of perioperative transfusion testing and blood ordering.
Anesth Analg 2015;120:1196-1203.
6. Rakic S, Belic B, Erceg S, Jovanovic R, Kulic Z, Stefanovic N, Belic A,
Uzurov V, Spasojevic J. Complications in the use of blood transfusions-
-alloimmunization in polytransfused patients. Med Pregl 1999;52:375-
378.
7. Sanz C, Nomdedeu M, Belkaid M, Martinez I, Nomdedeu B, Pereira A. Red
blood cell alloimmunization in transfused patients with myelodysplastic
syndrome or chronic myelomonocytic leukemia. Transfusion 2013;53:710-715.
8. Sengul Samanci N, Ayer M, Gursu M, Ar MC, Yel K, Ergen A, Dogan EE,
Karadag S, Cebeci E, Toptas M, Kazancioglu R, Ozturk S. Patients treated
with therapeutic plasma exchange: a single center experience. Transfus
Apher Sci 2014;51:83-89.
Address for Correspondence/Yazışma Adresi: Mehmet ÖZEN, M.D.,
Dumlupınar University Faculty of Medicine, Department of Hematology, Kütahya, Turkey
Phone : +90 274 231 66 60
E-mail : kanbilimci@gmail.com
Received/Geliş tarihi: February 06, 2016
Accepted/Kabul tarihi: June 06, 2016
DOI: 10.4274/tjh.2016.0056
Megaloblastic Anemia with Ring Sideroblasts is not Always
Myelodysplastic Syndrome
Halka Sideroblastlı Megaloblastik Anemi Her Zaman Miyelodisplastik Sendrom Olmayabilir
Neha Chopra Narang 1 , Mrinalini Kotru 2 , Kavana Rao 1 , Meera Sikka 1
1University College of Medical Sciences, Department of Pathology, Delhi, India
2University College of Medical Sciences, Department of Hematopathology, Delhi, India
To the Editor,
Ring sideroblasts are morphological hallmarks of hereditary and
acquired sideroblastic anemias [1]. The International Working
Group on Morphology of Myelodysplastic syndrome (MDS)
defined ring sideroblasts as erythroblasts in which a minimum
of five siderotic granules cover at least one-third of the
circumference of the nucleus.
We present the case of an 18-year-old female who had lowgrade
fever, jaundice, nausea, vomiting, and shortness of
breath for 25 days. The patient was not an alcoholic and not
on any drugs. On examination she appeared pale and icteric;
however, no hepatosplenomegaly was noted. A complete blood
count (CBC) and bone marrow examination were performed.
The CBC revealed Hb: 75 g/L, PCV: 0.232%, RBC: 2.15x10 12 /L,
MCV: 108 fL, MCH: 34.8 pg, MCHC: 32.2 g/dL, total leukocyte
count: 2.6x10 9 /L, platelet count: 87x10 9 /L, reticulocyte count:
0.8%, and differential leukocyte count: N74 L26. A peripheral
smear revealed pancytopenia with dimorphic anemia. No coarse
basophilic stippling was noted (as seen in lead poisoning). Bone
marrow aspirate was particulate and hypercellular for age
with erythroid hyperplasia, showing megaloblastic maturation
and dyserythropoiesis (Figure 1). Giant myeloid forms were
seen. Megakaryocytes appeared adequate and were normal in
morphology. Bone marrow iron was increased (grade 3) and
showed 6%-7% ring sideroblasts (Figure 2). A final diagnosis
of megaloblastic anemia with ring sideroblasts was made after
excluding various other causes of the same symptoms. The
patient was put on a therapeutic trial of hematinics (vitamin
B12, folic acid, and pyridoxine) and showed improvement.
After therapy, a CBC revealed Hb: 122 g/L, PCV: 0.432%, RBC:
4.15x10 12 /L, MCV: 85 fL, MCH: 30.8 pg, MCHC: 31.2 g/dL, total
leukocyte count: 5.6x10 9 /L, and platelet count: 177x10 9 /L.
However, a repeat bone marrow examination could not be
performed as the patient did not comply.
Figure 1. Bone marrow aspiration: megaloblastic maturation with
dyserythropoiesis and giant myelocyte (1000 x ).
358

Turk J Hematol 2016;33:355-370
LETTERS TO THE EDITOR
vitamin B12 and folic acid [8]. The presence of ring sideroblasts
does not always point towards impending MDS.
The development of ring sideroblasts in the above case was
related to an absolute or relative deficiency of pyridoxine
associated with vitamin B12 and folate deficiency.
Keywords: Ring sideroblasts, Megaloblastic anemia,
Myelodysplastic syndrome
Anahtar Sözcükler: Halka sideroblastlar, Megaloblastik anemi,
Miyelodisplastik sendrom
Authorship Contributions
Figure 2. Ring sideroblasts; Perl’s stain on bone marrow aspirate
(1000 x ).
Ring sideroblasts are found exclusively in pathological conditions
and should not be confused with ferritin sideroblasts, which are
present in normal bone marrow. The latter are normal erythroblasts
that, upon Prussian blue staining, show a few blue granules
scattered in the cytoplasm, representing endosomes filled with
excess iron not utilized for heme synthesis (siderosomes). While
the iron of ferritin sideroblasts is stored in cytosolic ferritin,
whose subunits are encoded by the FTH1 and FTL genes, the iron
of ring sideroblasts is stored in mitochondrial ferritin, encoded by
the FTMT gene [2]. There are two forms of sideroblastic anemia:
congenital sideroblastic anemia and acquired sideroblastic
anemia. Most acquired sideroblastic anemia cases were included
within MDS. Acquired sideroblastic anemia in MDS is categorized
either as refractory cytopenia with multilineage dysplasia or
refractory anemia with ring sideroblasts, depending on the level
of dysplasia [3]. Causes of acquired reversible sideroblastic anemia
include alcohol use (most common), pyridoxine deficiency, lead
poisoning, copper deficiency, excess zinc that can indirectly
cause sideroblastic anemia by decreasing absorption and
increasing excretion of copper, and antimicrobials like isoniazid,
chloramphenicol, linezolid, and cycloserine [1,4].
Impaired heme synthesis in sideroblastic anemias is associated
with abnormal vitamin B6 metabolism at the level of the
mitochondrion. Megaloblastic anemia due to folic acid deficiency
and ringed sideroblastic anemia have been reported in alcohol
abusers [1,5,6,7]. Vitamin B6 deficiency is associated with the
development of ring sideroblasts in these patients. Patients with
megaloblastic anemia showing the presence of ring sideroblasts
should therefore be supplemented with pyridoxine in addition to
Concept: Neha Chopra Narang, Mrinalini Kotru; Design: Neha
Chopra Narang, Mrinalini Kotru, Kavana Rao, Meera Sikka;
Data Collection or Processing: Neha Chopra Narang, Kavana
Rao; Analysis or Interpretation: Neha Chopra Narang, Mrinalini
Kotru, Kavana Rao, Meera Sikka; Literature Search: Neha Chopra
Narang, Mrinalini Kotru, Kavana Rao, Meera Sikka; Writing:
Neha Chopra Narang, Mrinalini Kotru, Kavana Rao, Meera Sikka.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Hines JD. Reversible megaloblastic and sideroblastic marrow abnormalities
in alcoholic patients. Br J Haematol 1969;16:87-101.
2. Cazzola M, Invernizzi R. Ring sideroblasts and sideroblastic anemia.
Haematologica 2011;96:789-792.
3. Ohba R, Furuyama K, Yoshida K, Fujiwara T, Fukuhara N, Onishi Y, Manabe
A, Ito E, Ozawa K, Kojima S, Ogawa S, Harigae H. Clinical and genetic
characteristics of congenital sideroblastic anemia: comparison with
myelodysplastic syndrome with ring sideroblast (MDS-RS). Ann Hematol
2013;92:1-9.
4. Willekens C, Dumezy F, Boyer T, Renneville A, Rossignol J, Berthon C,
Cotteau-Leroy A, Mehiaoui L, Quesnel B, Preudhomme C. Linezolid induces
ring sideroblasts. Haematologica 2013;98:e138-140.
5. Iwama H, Iwase O, Hayashi S, Nakano M, Toyama K. Macrocytic anemia
with anisocytosis due to alcohol abuse and vitamin B6 deficiency. Rinsho
Ketsueki 1998;39:1127-1130.
6. Solomon LR, Hillman RS. Vitamin B6 metabolism in idiopathic sideroblastic
anaemia and related disorders. Br J Haematol 1979;42:239-253.
7. Lindenbaum J, Roman MJ. Nutritional anemia in alcoholism. Am J Clin Nutr
1980;33:2727-2735.
8. Dawson AM, Holdsworth CD, Pitcher CS. Sideroblastic anaemia in adult
coeliac disease. Gut 1964;5:304-308.
Address for Correspondence/Yazışma Adresi: Mrinalini KOTRU, M.D.,
University College of Medical Sciences, Department of Pathology, Delhi, India
Phone : +91 981 034 52 36
E-mail : mrinalinikotru@gmail.com
Received/Geliş tarihi: March 05, 2016
Accepted/Kabul tarihi: July 28, 2016
DOI: 10.4274/tjh.2016.0090
359

LETTERS TO THE EDITOR Turk J Hematol 2016;33:355-370
Annular Erythematous Patches as the Presenting Sign of
Extranodal Natural Killer/T-Cell Lymphoma
Ekstranodal Doğal Öldürücü/T-Hücreli Lenfomanın Bulgusu Olarak Anüler Eritematöz Yamalar
Can Baykal 1 , Algün Polat Ekinci 1 , Şule Öztürk Sarı 2 , Zeynep Topkarcı 3 , Özgür Demir 1 , Nesimi Büyükbabani 2
1İstanbul University İstanbul Faculty of Medicine, Department of Dermatology and Venereology, İstanbul, Turkey
2İstanbul University İstanbul Faculty of Medicine, Department of Pathology, İstanbul, Turkey
3Bakırköy Dr. Sadi Konuk Training and Research Hospital, Clinic of Dermatology, İstanbul, Turkey
To the Editor,
Extranodal natural killer/T-cell lymphoma (ENKTL) is a distinct
type of lymphoma strongly associated with Epstein-Barr virus
(EBV) infection and showing an aggressive course [1]. It usually
presents as a localized disease in the upper aerodigestive tract,
from the nasal cavity to the hypopharynx [2,3], but it may rapidly
extend to the neighboring tissues and disseminate to various
organs such as the small intestine, epiglottis, testes, adrenal
gland, kidneys, and breasts [4,5]. As nasal/upper aerodigestive
tract involvement may only cause nonspecific symptoms in the
early period, diagnosis may be initially established based upon
skin lesions [6]. We present two ENKTL patients with unusual
dermatological findings.
Patient 1, a 44-year-old male, presented with a widespread
eruption on the trunk, scalp, and arms consisting of annular
erythematous patches (Figure 1a) and hyperpigmented/purpuric
patches circumscribed with erythematous rings (Figure 1b). A
biopsy revealed neoplastic infiltration of atypical lymphocytes
expressing CD56 and granzyme-B but negative for CD2, CD3,
CD8, and CD20. Nasopharyngeal involvement was suspected with
radiologic imaging (magnetic resonance imaging) and ENKTL
was diagnosed after a nasopharyngeal biopsy. Bone marrow
biopsy was normal. Following CHOP chemotherapy, most of
the cutaneous lesions resolved with slight hyperpigmentation,
but complete clearance was not achieved during the 3-month
follow-up period.
Patient 2, a 39-year-old male having a history of infectious
mononucleosis 5 months earlier, presented with widespread
infiltrated plaques on the nose, cheeks, (Figure 1c), forehead,
scalp, trunk, and arms and a deep nodule on the hard palate for 2
months. Annular erythema and purpuric patches circumscribed
with annular rims were remarkable on the back (Figure 1d).
Serum EBV-PCR and EBV VCA-IgG tests revealed positive results.
Punch biopsies performed from both erythematous patches on
the back and infiltrated plaques showed neoplastic lymphocytic
infiltration with EBV-encoded RNA (EBER) positivity by in situ
hybridization, which confirmed the diagnosis of ENKTL (Figures
1e and 1f). A PET-CT examination revealed nasopharynx, palate,
and tonsil involvements and metastatic parenchymatous
nodules in both lungs.
A broad spectrum of skin lesions such as erythematous
indurated plaques, painful subcutaneous nodules, persistent
cellulitis-like or abscess-like swellings, panniculitis-like
lesions, mycosis fungoides-like lesions, and nonhealing
ulcers can be seen in patients with ENKTL [7,8,9]. Three
ENKTL cases were reported in which patients presented
with skin lesions on the trunk and extremities described
as infiltrated erythema, edematous erythema, and dark red
erythema, one of them showing an annular configuration
[8]. An ENKTL case also involving erythematous patches that
developed and regressed over the course of chemotherapy
was reported [10]. However, this was considered as a possible
paraneoplastic sign.
Both of our patients had unusual lesions for cutaneous
lymphoma, namely erythematous patches mostly showing
annular configurations besides the more typical infiltrated
plaques of Patient 2. From a clinical standpoint, the appearance
of these erythematous lesions is like an inflammatory disease
and may be a paraneoplastic sign. However, the lesions were
Figure 1. a, b) Widespread eruption on the trunk consisting of
annular erythematous patches (Patient 1). c) Infiltrated plaque
on the forehead extending to the scalp (Patient 2). d) Annular
erythematous patches and purpuric patches circumscribed with a
thin erythematous ring (Patient 2). e) Dense neoplastic infiltration
of atypical lymphocytes on the mid-deep dermis (hematoxylin
and eosin, 200 x ). f) In situ hybridization for EBER shows positive
signals (EBER, 100 x ) (Patient 2).
360

Turk J Hematol 2016;33:355-370
LETTERS TO THE EDITOR
nonmigratory and had persisted for a long time, in contrast to the
expected course of possible reactive inflammatory dermatoses.
Moreover, in both cases histopathologic examination showed
neoplastic infiltration of ENKTL.
In conclusion, persistent erythematous patches with annular
shape may be among the skin involvement patterns of ENKTL
and awareness of this peculiar finding may avoid delay in its
diagnosis.
Keywords: Extranodal natural killer/T cell lymphoma,
Erythematous indurated plaques, Annular erythematous patch,
Annular erythema
Anahtar Sözcükler: Ekstranodal doğal öldürücü/T hücreli
lenfoma, Eritemli indüre plaklar, Anuler eritemli yama, Anuler
eritem
Authorship Contributions
Concept: Can Baykal, Algün Polat Ekinci, Şule Öztürk Sarı,
Zeynep Topkarcı, Özgür Demir, Nesimi Büyükbabani; Design:
Can Baykal, Algün Polat Ekinci, Şule Öztürk Sarı, Zeynep
Topkarcı, Özgür Demir, Nesimi Büyükbabani; Data Collection
or Processing: Can Baykal, Algün Polat Ekinci, Şule Öztürk Sarı,
Zeynep Topkarcı, Özgür Demir, Nesimi Büyükbabani; Analysis or
Interpretation: Can Baykal, Algün Polat Ekinci, Şule Öztürk Sarı,
Zeynep Topkarcı, Özgür Demir, Nesimi Büyükbabani; Literature
Search: Can Baykal, Algün Polat Ekinci, Şule Öztürk Sarı, Zeynep
Topkarcı, Özgür Demir, Nesimi Büyükbabani; Writing: Can
Baykal, Algün Polat Ekinci, Şule Öztürk Sarı, Zeynep Topkarcı,
Özgür Demir, Nesimi Büyükbabani.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Chan JK, Sin VC, Wong KF, Ng CS, Tsang WY, Chan CH, Cheung MM, Lau
WH. Nonnasal lymphoma expressing the natural killer cell marker CD56: a
clinicopathologic study of 49 cases of an uncommon aggressive neoplasm.
Blood 1997;89:4501-4513.
2. Miyazato H, Nakatsuka S, Dong Z, Takakuwa T, Oka K, Hanamoto H, Tatsumi
Y, Kanamaru A, Aozasa K; Osaka Lymphoma Study Group. NK-cell related
neoplasms in Osaka, Japan. Am J Hematol 2004;76:230-235.
3. Oshimi K, Kawa K, Nakamura S, Suzuki R, Suzumiya J, Yamaguchi M,
Kameoka J, Tagawa S, Imamura N, Ohshima K, Kojya S, Iwatsuki K, Tokura
Y, Sato E, Sugimori H; NK-cell Tumor Study Group. NK-cell neoplasms in
Japan. Hematology 2005;10:237-245.
4. Lim ST, Hee SW, Quek R, Lim LC, Yap SP, Loong EL, Sng I, Tan LH, Ang MK,
Ngeow J, Tham CK, Ngo L, Tan MH, Tao M. Comparative analysis of extranodal
NK/T-cell lymphoma and peripheral T-cell lymphoma: significant
differences in clinical characteristics and prognosis. Eur J Haematol
2008;80:55-60.
5. Li S, Feng X, Li T, Zhang S, Zuo Z, Lin P, Konoplev S, Bueso-Ramos CE, Vega F,
Medeiros LJ, Yin CC. Extranodal NK/T-cell lymphoma, nasal type: a report of
73 cases at MD Anderson Cancer Center. Am J Surg Pathol 2013;37:14-23.
6. Zheng Y, Jia J, Li W, Wang J, Tian Q, Li Z, Yang J, Dong X, Pan P, Xiao S.
Extranodal natural killer/T-cell lymphoma, nasal type, involving the skin,
misdiagnosed as nasosinusitis and a fungal infection: a case report and
literature review. Oncol Lett 2014;8:2253-2262.
7. Lee WJ, Jung JM, Won CH, Chang SE, Choi JH, Chan Moon K, Park CS,
Huh J, Lee MW. Cutaneous extranodal natural killer/T-cell lymphoma:
a comparative clinicohistopathologic and survival outcome analysis
of 45 cases according to the primary tumor site. J Am Acad Dermatol
2014;70:1002-1009.
8. Miyamoto T, Yoshino T, Takehisa T, Hagari Y, Mihara M. Cutaneous
presentation of nasal/nasal type T/NK cell lymphoma: clinicopathological
findings of four cases. Br J Dermatol 1998;139:481-487.
9. Cerroni L. Skin Lymphoma: The Illustrated Guide, Fourth Edition. Singapore,
Blackwell, 2014.
10. Türker B, Uz B, Işık M, Bektaş O, Demiroğlu H, Sayınalp N, Uner A, Ozcebe
Oİ. Nasal natural killer/T-cell lymphoma with skin, eye, and peroneal nerve
involvement. Turk J Hematol 2012;29:413-419.
Address for Correspondence/Yazışma Adresi: Algün POLAT EKİNCİ, M.D.,
İstanbul University İstanbul Faculty of Medicine, Department of Dermatology and Venereology, İstanbul, Turkey
Phone : +90 212 635 29 39
E-mail : algunekinci@yahoo.com
Received/Geliş tarihi: February 19, 2016
Accepted/Kabul tarihi: July 20, 2016
DOI: 10.4274/tjh.2016.0071
361

LETTERS TO THE EDITOR Turk J Hematol 2016;33:355-370
Presentation of Diffuse Large B-Cell Lymphoma Relapse as a
Penile Mass
Penil Kitle ile Başvuran Diffüz Büyük B Hücreli Lenfoma Nüksü
Birgül Öneç 1 , Kürşad Öneç 2 , Ali Ümit Esbah 3 , Onur Esbah 4
1Düzce University Faculty of Medicine, Department of Hematology, Düzce, Turkey
2Düzce University Faculty of Medicine, Department of Nephrology, Düzce, Turkey
3Düzce University Faculty of Medicine, Department of Anesthesia and Intensive Care, Düzce, Turkey
4Düzce University Faculty of Medicine, Department of Medical Oncology, Düzce, Turkey
To the Editor,
Penile malignant tumors constitute less than 1% of all
malignancies in men but penile lymphoma is even rarer in
this population [1]. Presentation with a primary penile mass is
extremely rare for lymphomas, as reported only in case reports
in the literature [2,3,4,5,6,7]. Here we report a case of recurrent
lymphoma presenting with a penile mass lesion.
A 51-year-old man was admitted with the appearance of swelling
and ulcerations of the penis that had started 2 weeks earlier. His
history revealed that he was diagnosed with stage IIIB diffuse
large B-cell lymphoma (DLBCL) 7 years ago, received 6 courses of
R-CHOP, and was assumed to be cured after 5 uneventful years of
follow-up. Swelling at the penis increased within 2 weeks with the
addition of continuous pain, superficial ulcerations, and frequent
and painful urination. Physical examination revealed a diffuse
and indurated swelling at the shaft of the penis with an ulcer. An
enlarged left inguinal lymph node was also palpable. Magnetic
resonance imaging revealed a solid lesion of 55x37 mm in size,
almost completely filling the penile corpus and significantly
narrowing the penile urethra, extending to the glans penis. Tru-
Cut biopsy of the penile lesion was consistent with DLBCL. He
was staged as Ann Arbor IIIE with positron emission tomographycomputed
tomography revealing F-18 fluorodeoxyglucose
involvement in the deep cervical left inguinal lymph nodes and a
solid mass in the corpus penis (Figure 1). Treatment with R-CHOP
started immediately and his complaints rapidly reduced after the
first course. The patient is still having chemotherapy without
complications and autologous stem cell transplantation will be
considered for consolidation after complete remission.
Although most DLBCL patients have nodal presentation at
admission, extranodal involvements are also common. The
classical extranodal involvements sites are the breast, central
nervous system, and testes. Penile involvement is a rare entity
reported in case reports [2,5,7,8,9,10]. Chu et al. reviewed
penile lymphomas and reported only 48 cases, among which
DLBCL was the most frequent subtype with 14 cases [5]. The
most common symptom of penile lymphoma was a painless
mass lesion or nodule in the penis followed by ulcerations
[5,7].
Surgery remains the best approach for penile cancers, whereas
no standard treatment modality has been established for
penile lymphomas. Systemic chemotherapy according to the
subtype is a good treatment option because it preserves penile
functions [2]. In our patient, R-CHOP therapy was initiated
within 2 weeks after admission and obstructive symptoms were
relieved immediately after the first course. Disease-free survival
was reported to be between 6 and 48 months in previous case
series [5], clearly indicating better outcomes than in cases of
metastatic carcinomas.
In conclusion, the possibility of lymphoma involvement
should be kept in mind in patients admitting with penile mass
lesions, especially in patients who have a history of aggressive
lymphomas, in order to avoid aggressive surgical interventions.
It is important to initiate systemic chemotherapy immediately
in order to prevent complications related to urethra obstruction
and to preserve erectile functions.
Keywords: Penis, Lymphoma, Non-Hodgkin lymphoma, Diffuse
large B-cell lymphoma, Penile mass
Anahtar Sözcükler: Penis, Lenfoma, Non-Hodgkin lenfoma,
Diffüz büyük B hücreli lenfoma, Penil kitle
Figure 1. Transaxial fused positron emission tomographycomputed
tomography (A) and computed tomography (B)
images showing the penile soft tissue mass with intense F-18
fluorodeoxyglucose uptake (arrows).
Authorship Contributions
Concept: Birgül Öneç, Kürşad Öneç, Ali Ümit Esbah, Onur Esbah;
Design: Birgül Öneç, Kürşad Öneç; Data Collection or Processing:
Birgül Öneç, Kürşad Öneç; Analysis or Interpretation: Birgül
362

Turk J Hematol 2016;33:355-370
LETTERS TO THE EDITOR
Öneç, Onur Esbah; Literature Search: Birgül Öneç, Ali Ümit
Esbah; Writing: Birgül Öneç, Ali Ümit Esbah.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Schniederjan SD, Osunkoya AO. Lymphoid neoplasms of the urinary tract
and male genital organs: a clinicopathological study of 40 cases. Mod
Pathol 2009;22:1057-1065.
2. Stamatiou K, Pierris N. Lymphoma presenting as cancer of the glans penis:
a case report. Case Rep Pathol 2012;2012:948352.
3. Gentile G, Broccoli A, Brunocilla E, Schiavina R, Borghesi M, Romagnoli D,
Bianchi L, Derenzini E, Agostinelli C, Franceschelli A, Colombo F, Zinzani
PL. An isolated penile mass in a young adult turned out to be a primary
marginal zone lymphoma of the penis. A case report and a review of
literature. Anticancer Res 2013;33:2639-2642.
4. Gong Z, Zhang Y, Chu H, Lian P, Zhang L, Sun P, Chen J. Priapism as the
initial symptom of primary penile lymphoma: a case report. Oncol Lett
2014;8:1929-1932.
5. Chu L, Mao W, Curran Vikramsingh K, Liu X, Qiu HM, Zheng JH, Wang Y,
Yu GP, Xu Q. Primary malignant lymphoma of the glans penis: a rare case
report and review of the literature. Asian J Androl 2013;15:571-572.
6. Karki K, Mohsin R, Mubarak M, Hashmi A. Primary Non-Hodgkin’s
lymphoma of penis masquerading as a non-healing ulcer in the penile
shaft. Nephrourol Mon 2013;5:840-842.
7. Wang GC, Peng B, Zheng JH. Primary penile malignant lymphoma: report of
a rare case. Can Urol Assoc J 2012;6:E277-279.
8. Marks D, Crosthwaite A, Varigos G, Ellis D, Morstyn G. Therapy of primary
diffuse large cell lymphoma of the penis with preservation of function. J
Urol 1988;139:1057-1058.
9. Kim HY, Oh SY, Lee S, Lee DM, Kim SH, Kwon HC, Hong SH, Yoon JH,
Kim HJ. Primary penile diffuse large B cell lymphoma treated by local
excision followed by rituximab-containing chemotherapy. Acta Haematol
2008;120:150-152.
10. Jabr FI. Recurrent lymphoma presenting as a penile ulcer in a patient with
AIDS. Dermatol Online J 2005;11:29.
Address for Correspondence/Yazışma Adresi: Birgül ÖNEÇ, M.D.,
Düzce University Faculty of Medicine, Department of Hematology, Düzce, Turkey
Phone : +90 505 242 81 83
E-mail : birgulonec@gmail.com
Received/Geliş tarihi: March 29, 2016
Accepted/Kabul tarihi: April 13, 2016
DOI: 10.4274/tjh.2016.0132
Successful Treatment of Disseminated Fusariosis with the
Combination of Voriconazole and Liposomal Amphotericin B
Vorikonazol ve Lipozomal Amphoterisin B ile Başarıyla Tedavi Edilen Dissemine
Fusariosis Olgusu
Nur Efe İris 1 , Serkan Güvenç 2 , Tülay Özçelik 2 , Aslıhan Demirel 1 , Safiye Koçulu 1 , Esin Çevik 1 , Mutlu Arat 2
1İstanbul Bilim University Faculty of Medicine, Department of Infectious Diseases and Clinical Microbiology, İstanbul, Turkey
2İstanbul Bilim University Faculty of Medicine, Department of Hematology, İstanbul, Turkey
To the Editor,
Fusarium species are important causes of disseminated
infections in patients with prolonged, severe neutropenia.
Clinical presentation includes refractory fever, skin lesions,
and sinopulmonary infections [1,2]. Disseminated Fusarium
infection (DFI) carries a poor prognosis, which is related to the
angiotropism of Fusarium and its capacity for adventitious
sporulation in tissues [3] and resistance to many antifungal
agents [4].
Here we report a hematopoietic stem cell transplant (HSCT)
recipient with acute myeloid leukemia (AML) and disseminated
fusariosis who was successfully treated using both liposomal
amphotericin B and voriconazole.
A 24-year-old male patient underwent allogeneic HSCT from
his HLA-matched brother for AML in the first remission. At 21
months after HSCT he had extramedullary relapse with a mass
over his humerus. He received radiotherapy plus the FLAG-IDA
salvage regimen. After 4 months, medullary relapse occurred.
When he was hospitalized for the medullary relapse, he received
clofarabine with ARA-C, which caused severe neutropenia
and fever. According to in-house protocol for neutropenia,
piperacillin-tazobactam was initiated. However, on the third
day, he was still febrile and neutropenic, so treatment was
changed to meropenem and 2 days later amikacin was added.
Because of hypotension, we broadened the spectrum with
vancomycin. He was still febrile and he had rectal carbapenemresistant
Klebsiella pneumoniae colonization. Antibiotherapy
was reordered with colistin plus meropenem and vancomycin.
363

LETTERS TO THE EDITOR Turk J Hematol 2016;33:355-370
According to thorax computed tomography findings that showed
a nodule on the base of the left lung and sphenoidal sinusitis,
3 mg/kg liposomal amphotericin B was added empirically to his
treatment. On follow-up, new papular and nodular skin lesions
appeared on his face, head, arms, legs, feet, and anteriorposterior
trunk. Some of these papules had central necrosis
and eschar formations on his feet (Figure 1). These papules and
especially the nodules were extremely painful, and he also had
myalgia. Blood cultures revealed Fusarium solani by the VITEK
system and MALDI-TOF. The diagnosis of DFI was established
and we decided to augment the antifungal therapy on the
seventh day by adding intravenous voriconazole as Fusarium
is a resistant pathogen and the prognosis is especially poor in
neutropenic patients. There were no antifungal susceptibility
test results for amphotericin B or voriconazole. The skin lesions
were not biopsied or cultured. Five days later his skin lesions
began to resolve and on the sixth day of combined antifungal
therapy his fever subsided. He was neutropenic at the time and
neutrophil levels resolved 5 days later when he was afebrile.
Clinical improvement was evident 5 days before the resolution
of neutropenia. Parenteral antifungal treatment was continued
for 21 days and the patient was discharged on oral voriconazole
treatment. After combined antifungal therapy, blood cultures
obtained on the fifth day were negative.
We added voriconazole to the antifungal treatment of this
patient because disseminated fusariosis has a very poor prognosis.
Some investigators have stated that antifungal therapy is rarely
effective and recovery depends on neutrophil recovery, but we
achieved effective control of fusariosis with combined antifungal
therapy before neutrophil recovery [5,6,7,8,9,10].
In conclusion, using combination therapy such as amphotericin
B and voriconazole may be considered as early as possible in
patients who are not responding to antifungal monotherapy.
Figure 1. Eschar formation on the foot and papules over the leg.
Keywords: Invasive fungal infection, Fusariosis, Combined
antifungal treatment, Lyposomal amphotericin B, Voriconazole,
Acute myeloid leukemia
Anahtar Sözcükler: İnvazif mantar enfeksiyonu, Fusariosis,
Kombine antifungal tedavi, Lipozomal amfoterisin B,
Vorikonazol, Akut myeloid lösemi
Authorship Contributions
Concept: Nur Efe İris; Design: Nur Efe İris, Mutlu Arat; Data
Collection or Processing: Nur Efe İris, Serkan Güvenç; Analysis or
Interpretation: Nur Efe İris, Tülay Özçelik, Safiye Koçulu, Aslıhan
Demirel, Esin Çevik; Literature Search: Nur Efe İris; Writing: Nur
Efe İris, Serkan Güvenç.
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Nelson PE, Dignani MC, Anaissie EJ. Taxonomy, biology and clinical aspects
of Fusarium species. Clin Microbiol Rev 1994;7:479-504.
2. Dignani MC, Anaissie E. Human fusariosis. Clin Microbiol Infect
2004;10(Suppl 1):67-75.
3. Liu K, Howell DN, Perfect JR, Schnell WA. Morphologic criteria for the
preliminary identification of Fusarium, Paecilomyces, and Acremonium
species by histopathology. Am J Clin Pathol 1998;109:45-54.
4. Jossi M, Ambrossioni J, Macedo-Vinas Garbino J. Invasive fusariosis with
prolonged fungemia in a patient with acute lymphoblastic leukemia; case
report and review of the literature. Int J Inf Dis 2010;14:e394-e356.
5. Consigny S, Dhedin N, Datry A, Choquet S, Leblond V, Chosidow O.
Successful voriconazole treatment of disseminated Fusarium infection in
an immunocompromised patient. Clin Infect Dis 2003;37:311-313.
6. Bodey G, Boutati EL, Anaissie E. Fusarium, a significant emerging pathogen
in patients with hematologic malignancy: ten years of experience at a
cancer center and implications for management. Blood 1997;3:999-1008.
7. Velasso E, Martis C, Nucci M. Successful treatment of catheter related
fusarial infection in immunocompromised children. Eur J Clin Microbiol
Infect Dis 1995;14:697-699.
8. Dobougogne A, de Hoog S, Lozniewski A, Machounant M. Amphotericin
B and voriconazole susceptibility profiles for the Fusarium solani species
complex: comparison between the E-test and CLSIM38A2 microdilution
methodology. Eur J Clin Microbiol Infect Dis 2012;31:615-618.
9. Compo M, Lewis RE, Kontoyiannis DP. Invasive fusariosis in patients
with hematologic malignancies at a cancer center: 1998-2009. J Infect
2010;60:331-337.
10. Avelino-Silva VI, Ramos JF, Leal FE, Tastograssa L, Novis YS. Disseminated
Fusarium infection in autologous stem cell transplant recipient. Braz J
Infect Dis 2015;19:90-93.
Address for Correspondence/Yazışma Adresi: Nur EFE İRİS, M.D.,
Istanbul Bilim University Faculty of Medicine, Department of Infectious
Diseases and Clinical Microbiology, Istanbul, Turkey
Phone : +90 212 361 88 00
E-mail : nurefeiris@yahoo.com
Received/Geliş tarihi: March 25, 2016
Accepted/Kabul tarihi: June 17, 2016
DOI: 10.4274/tjh.2016.0128
364

Turk J Hematol 2016;33:355-370
LETTERS TO THE EDITOR
NOS3 27-bp and IL4 70-bp VNTR Polymorphisms Do Not
Contribute to the Risk of Sickle Cell Crisis
NOS3 27-bp ve IL4 70-bp VNTR Polimorfizmleri Orak Hücreli Anemide Kriz Riskine
Katkıda Bulunmaz
Henu Verma 1 , Hrishikesh Mishra 1 , P. K. Khodiar 2 , P. K. Patra 1,2 , L. V. K. S. Bhaskar 1
1Sickle Cell Institute Chhattisgarh, Division of Research, Raipur, India
2Pt. JNM Medical College, Department of Biochemistry, Raipur, India
To the Editor,
A great deal of data support the direct involvement of the
vascular endothelium, complex cellular interactions, and global
inflammation-mediated cell activation in triggering vasoocclusive
crisis (VOC) in sickle cell disease (SCD) [1]. In the
transgenic mice model for SCD, it has been shown that nitric
oxide (NO) protects the mice from VOC [2]. Elevated plasma
levels of certain proinflammatory cytokines support a role for
cytokine-driven inflammation in SCD. The aim of the present
study was to evaluate the role of the NOS3 27-bp variable
number tandem repeat (VNTR) and IL4 intron-3 VNTR functional
polymorphisms in the development of crisis in Indian SCD
patients. The study protocol was approved by the Institutional
Ethics Committee of the Sickle Cell Institute Chhattisgarh,
Raipur, India. Written informed consent was obtained from the
study participants. A total of 256 individuals with SCD (55.5%
men) were divided into two groups based on the history of VOC.
The patients hospitalized with recurrent VOC were considered
as the frequent crisis (FC) group (n=140; 54.7%) and patients
who had not experienced any VOC during the past 1 year were
considered as the infrequent crisis (IFC) group (n=116; 45.3%).
Genotyping of the NOS3 27-bp VNTR [3] and IL4 intron-3 VNTR
[4] functional polymorphisms was performed and results were
compared between the FC and IFC groups.
The genotype frequencies were in agreement with Hardy-
Weinberg equilibrium for both the NOS3 27-bp (p=0.063) and
the IL4 70-bp (p=0.614) VNTR. The genotype frequencies were
not significantly different between the FC and IFC groups
(Table 1). Similarly, the risk of frequent crisis was not found
to be different between male and female SCD patients or
between SCD patients with different HbF levels or different
age groups (Table 1). Several lines of evidence suggest that
there is vascular dysfunction and impaired NO bioactivity in
SCD. Although no significant differences were observed in
plasma NO metabolites between controls and SCD patients in
the steady state, a significant reduction was noticed during
VOC or acute chest syndrome [5]. Analysis of three NOS3 gene
polymorphisms did not reveal a significant association with
severe clinical manifestations in Brazilian SCD patients [6].
In contrast to this, in another study a significant association
of NOS3 variants with VOC in SCD patients was reported [7].
However, our results indicate that the NOS3 27-bp VNTR
polymorphism is not associated with the risk of frequent
crises. Although the role of IL4 in SCD is controversial,
increased serum IL4 levels were found in steady-state SCD
patients compared to normal healthy controls [8]. Remarkably
elevated levels of IL4 were noted in a VOC group compared to
steady-state SCD patients and healthy controls [9]. IL4 levels
correlated well with SCD status in Jamaicans, while exhibiting
an ethnic difference between British and Jamaican children
[10]. So far there are no published studies concerning IL4
SNPs and SCD or its complications. As these results conflict
with the biological plausibility that NO and interleukin levels
modulate SCD, they deserve careful interpretation and further
exploration.
Keywords: Sickle cell disease, Crisis, NOS3, IL4
Anahtar Sözcükler: Orak hücre hastalığı, Kriz, NOS3, IL4
Ethics
Ethics Committee Approval: The study protocol was approved
by the Institutional Ethics Committee of the Sickle Cell Institute
Chhattisgarh, Raipur, India, Informed Consent: Written informed
consent was obtained from the study participants.
Authorship Contributions
Concept: L. V. K. S. Bhaskar, P. K. Patra; Design: L. V. K. S. Bhaskar,
P. K. Patra; Data Collection or Processing: Henu Verma, L. V. K. S.
Bhaskar; Analysis or Interpretation: L. V. K. S. Bhaskar; Literature
Search: P. K. Khodiar, Henu Verma, Hrishikesh Mishra; Writing:
Henu Verma, L. V. K. S. Bhaskar.
Conflict of Interest: No conflict of interest was declared by the
authors.
365

LETTERS TO THE EDITOR Turk J Hematol 2016;33:355-370
Table 1. Association between NOS3 27-bp and IL4 70-bp VNTR polymorphisms and development of vaso-occlusive crisis in sickle
cell disease.
Vaso-Occlusive Crisis Unadjusted Adjusted for Age and Sex
Genotype FC IFC OR (95% CI) p-value OR (95% CI) p-value
NOS3 27-bp VNTR
4bb 101 (72.1) 89 (76.7) Reference
4ab 39 (27.9) 26 (22.4) 1.32 (0.75-2.34) 0.339 1.32 (0.75-2.35) 0.338
4aa 0 (0) 1 (0.9) - - - -
IL4 70-bp VNTR
3R3R 83 (59.3) 67 (57.8) Reference
2R3R 51 (36.4) 39 (33.6) 1.06 (0.62-1.79) 0.840 1.04 (0.61-1.76) 0.897
2R2R 6 (4.3) 10 (8.6) 0.48 (0.17-1.40) 0.181 0.49 (0.17-1.41) 0.184
Sex
Male 78 (55.7) 64 (55.2) Reference
Female 62 (44.3) 52 (44.8) 0.98 (0.60-1.61) 0.931 0.97 (0.59-1.59) 0.896
HbF
>20.1% 66 (47.1) 60 (51.7) Reference
10.1%-20% 59 (42.1) 43 (37.1) 1.25 (0.74-2.11) 0.140 1.27 (0.75-2.16) 0.374
<10% 15 (10.7) 13 (11.2) 0.105 (0.46-2.38) 0.909 1.05 (0.46-2.40) 0.916
Age
<10 years 32 (22.9) 20 (17.2) Reference
10.1-20 years 65 (46.41) 76 (65.5) 0.54 (0.28-1.02) 0.059 0.53 (0.27-1.02) 0.056
>20.1 years 43 (30.7) 20 (17.2) 1.34 (0.62-2.90) 0.452 1.33 (0.61-2.88) 0.457
4b: NOS3 VNTR wild-type allele, 4a: NOS3 VNTR mutant allele, 2R: IL4 VNTR 2 repeats, 3R: IL4 VNTR 3 repeats, HbF: fetal hemoglobin, FC: frequent crisis, IFC: infrequent crisis,
VNTR: variable number tandem repeat.
Financial Disclosure: The authors acknowledge funding from the
Sickle Cell Institute Chhattisgarh, Government of Chhattisgarh,
and CCOST, Government of Chhattisgarh (Project Ref. No. 2740/
CCOST/MRP/2015).
References
1. Bunn HF. Pathogenesis and treatment of sickle cell disease. N Engl J Med
1997;337:762-769.
2. Wu D, He L, Chen L. Apelin/APJ system: a promising therapy target for
hypertension. Mol Biol Rep 2014;41:6691-6703.
3. Yoon Y, Song J, Hong SH, Kim JQ. Plasma nitric oxide concentrations and
nitric oxide synthase gene polymorphisms in coronary artery disease. Clin
Chem 2000;46:1626-1630.
4. Jha AN, Singh VK, Kumari N, Singh A, Antony J, van Tong H, Singh S, Pati
SS, Patra PK, Singh R, Toan NL, Song LH, Assaf A, Messias-Reason IJ, Velavan
TP, Singh L, Thangaraj K. IL-4 haplotype -590T, -34T and intron-3 VNTR
R2 is associated with reduced malaria risk among ancestral Indian tribal
populations. PLoS One 2012;7:e48136.
5. Stuart MJ, Setty BN. Sickle cell acute chest syndrome: pathogenesis and
rationale for treatment. Blood 1999;94:1555-1560.
6. Vargas AE, da Silva MA, Silla L, Chies JA. Polymorphisms of chemokine
receptors and eNOS in Brazilian patients with sickle cell disease. Tissue
Antigens 2005;66:683-690.
7. Tantawy AA, Adly AA, Ismail EA, Aly SH. Endothelial nitric oxide synthase
gene intron 4 VNTR polymorphism in sickle cell disease: relation to
vasculopathy and disease severity. Pediatr Blood Cancer 2015;62:389-394.
8. Raghupathy R, Haider MZ, Azizieh F, Abdelsalam R, D’Souza TM, Adekile AD. Th1
and Th2 cytokine profiles in sickle cell disease. Acta Haematol 2000;103:197-202.
9. Musa BO, Onyemelukwe GC, Hambolu JO, Mamman AI, Isa AH. Pattern of
serum cytokine expression and T-cell subsets in sickle cell disease patients
in vaso-occlusive crisis. Clin Vaccine Immunol 2010;17:602-608.
10. Knight-Madden J, Vergani D, Patey R, Sylvester K, Hussain MJ, Forrester T,
Greenough A. Cytokine levels and profiles in children related to sickle cell
disease and asthma status. J Interferon Cytokine Res 2012;32:1-5.
Address for Correspondence/Yazışma Adresi: L. V. K. S. BHASKAR, PhD,
Sickle Cell Institute Chhattisgarh, Division of Research, Raipur, India
E-mail : lvksbhaskar@gmail.com
Received/Geliş tarihi: May 5, 2016
Accepted/Kabul tarihi: July 11, 2016
DOI: 10.4274/tjh.2016.0166
366

Turk J Hematol 2016;33:355-370
LETTERS TO THE EDITOR
Comment: In Response to “Auer Rod-Like Inclusions in Reactive
Plasma Cells in a Case of Acute Myeloid Leukemia”
“Akut Miyeloid Lösemili Olguda Reaktif Plazma Hücrelerinde Auer-Rod Benzeri
İnkülüzyonlar” Adlı Makale ile İlgili Yorum
Smeeta Gajendra
Medanta-The Medicity, Department of Pathology and Laboratory Medicine, Gurgaon, India
To the Editor,
I read the article “Auer Rod-Like Inclusions in Reactive Plasma
Cells in a Case of Acute Myeloid Leukemia” by Pradhan when
it was first published online (http://www.journalagent.com/tjh/
pdfs/TJH-09216-IMAGES_IN_HEMATOLOGY-PRADHAN.pdf).
The manuscript is well written with the description of a rare
presence of Auer rod-like inclusions in reactive plasma cells
in a case of acute myeloid leukemia (AML). However, it is not
the first case of Auer rod-like inclusions in reactive plasma
cells in a case of AML in the literature as was claimed by the
author in the article. Sharma et al. had already described a
case of the presence of this type of plasma cell inclusion in
a case of therapy-related AML. Needle-like or Auer rod-like
intracytoplasmic inclusions in plasma cells were first described
by Steinmann in 1940. A few cases of multiple myeloma
with intracytoplasmic plasma cell inclusions are described
in the literature [1]. Other conditions associated with these
crystalline intracytoplasmic inclusions are plasmacytoma,
chronic lymphocytic leukemia, lymphoplasmacytic lymphoma,
mucosa-associated lymphoid tissue lymphomas, and, rarely,
high-grade lymphomas [2]. Lemez reported a very rare case of
Auer rod-like inclusions in reactive plasma cells in a patient
with aplastic anemia [3]. Some postulations were described
in the literature that these inclusions are related to abnormal
synthesis, trafficking, or excretion of the immunoglobulin or
immunoglobulin light chains that accumulate in excess within
the cytoplasm [4], but immunocytochemical examinations
revealed no reaction with antibodies against immunoglobulins,
light chains, or amyloid A antibodies inside the inclusions [5].
These are positive for α-naphthyl acetate esterase (sensitive to
sodium fluoride treatment) and β-glucuronidase, suggesting
a lysosomal origin [1]. Plasmacytosis in AML occurs in about
7% of cases and the number of plasma cells may vary from
5% to 16%. This plasmacytosis is due to increased production
of IL-6 by leukemic blasts, causing stimulation of plasma cells
resulting in marrow plasmacytosis [6]. A rare case of Auer rodlike
inclusions in reactive plasma cells in a case of AML was
reported by Sharma et al. [7]. This should be diagnosed with
caution to exclude the coexistence of multiple myeloma with
AML. Not only serum and urine protein electrophoresis with
immunofixation but also serum free light-chain assay should be
performed to exclude associated nonsecretory myeloma.
Keywords: Plasma cell, Inclusion, Reactive plasmacytosis
Anahtar Sözcükler: Plazma hücre, İnkülüzyon, Reaktif
plazmositoz
Conflict of Interest: The author of this paper has no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Hütter G, Nowak D, Blau IW, Thiel E. Auer rod-like intracytoplasmic
inclusions in multiple myeloma. A case report and review of the literature.
Int J Lab Hematol 2009;31:236-240.
2. Gupta A, Gupta M, Handoo A, Vaid A. Crystalline inclusions in plasma cells.
Indian J Pathol Microbiol 2011;54:836-837.
3. Lemez P. Auer-rod-like inclusions in cells of B-lymphocytic lineage. Acta
Haematol 1988;80:177-178.
4. Jennette JC, Wilkman AS, Benson JD. IgD myeloma with intracytoplasmic
crystalline inclusions. Am J Clin Pathol 1981;75:231-235.
5. Metzgeroth G, Back W, Maywald O, Schatz M, Willer A, Hehlmann R, Hastka
J. Auer rod-like inclusions in multiple myeloma. Ann Hematol 2003;82:57-
60.
6. Rosenthal NS, Farhi DC. Reactive plasmacytosis and lymphocytosis in acute
myeloid leukemia. Hematol Pathol 1994;8:43-51.
7. Sharma S, Malhan P, Pujani M, Pujani M. Auer rod-like inclusions in
reactive plasmacytosis seen with acute myeloid leukemia. J Postgrad Med
2009;55:197.
Address for Correspondence/Yazışma Adresi: Smeeta GAJENDRA, M.D.,
Medanta-The Medicity, Department of Pathology and Laboratory Medicine, Gurgaon, India
Phone : 0901 359 08 75
E-mail : drsmeeta@gmail.com
Received/Geliş tarihi: March 31, 2016
Accepted/Kabul tarihi: April 05, 2016
DOI: 10.4274/tjh.2016.0139
367

LETTERS TO EDITOR Turk J Hematol 2016;33:355-370
Reply: “Auer Rod-Like Inclusions in Reactive Plasma Cells in a
Case of Acute Myeloid Leukemia”
Cevap: “Akut Myeloid Lösemi Tanılı Bir Olguda Reaktif Plazma Hücrelerinde Auer Rod
Benzeri İnklüzyonlar”
Sarita Pradhan
Institute of Medical Sciences and Sum Hospital, Laboratory of Hematology, Bhubaneswar, India
To the Editor,
First I would like to thank Smeeta Gajendra for scrutinizing
my article in her ‘Comment: In Response to “Auer Rod-Like
Inclusions in Reactive Plasma Cells in a Case of Acute Myeloid
Leukemia”’ published online and for bringing to light the missing
reference of Sharma et al. [1], who reported a case of Auer rodlike
inclusions in plasma cells in a case of therapy-related AML.
I sincerely regret missing that article in my literature search but
I would also like to clarify a few points.
My presented case was not secondary AML and the patient had
no prior history of chemotherapy, unlike the case reported by
Sharma et al. [1]. The aim of my publication was to highlight a
rare and interesting morphological finding, but within a limit of
200 words it was not possible to acknowledge all hematological
malignancies showing similar inclusions in plasma cells.
In conclusion, I would like to again thank Dr. Gajendra for the
elaborate and informative additions made in the commentary.
Conflict of Interest: The author of this paper has no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
Reference
1. Sharma S, Malhan P, Pujani M, Pujani M. Auer rod-like inclusions in
reactive plasmacytosis seen with acute myeloid leukemia. J Postgrad Med
2009;55:197.
Address for Correspondence/Yazışma Adresi: Sarita PRADHAN, M.D.,
Institute of Medical Sciences and Sum Hospital, Laboratory of Hematology, Bhubaneswar, India
Phone : 9 776 243 866
E-mail : dr.sarita26@gmail.com
Received/Geliş tarihi: May 12, 2016
Accepted/Kabul tarihi: May 24, 2016
DOI: 10.4274/tjh.2016.0172
Auer Rods Are Not Seen in Non-Neoplastic Cells
Auer Cismi Neoplastik Olmayan Hücrelerde Görülmez
İrfan Yavaşoğlu, Zahit Bolaman
Adnan Menderes University Faculty of Medicine, Division of Hematology, Aydın, Turkey
To the Editor,
The article entitled “Auer Rod in a Neutrophil in a
Nonmalignant Condition”, written by Chandra et al. [1]
and published in a recent issue of your journal, was quite
interesting. Here we would like to emphasize some relevant
points.
This article demonstrates why peripheral smears, bone marrow
examination, and genetic tests are mandatory. Acute myeloid
leukemia must be excluded. Electron microscopic analyses
would be helpful. The title is overly assertive. It may be called an
Auer rod-like image.
It is not known why Auer rods are not seen in non-neoplastic
cells. However, there have been some hypotheses on the genesis
of Auer rods, including infectious microorganisms, abnormal
nucleoplasm segregation, pathologic forms of azurophilic
granules, and cytoplasmic pH alteration. Unsuccessful results
in Auer body inoculation experiments led to the elimination of
the infectious microorganism theory. Although the conditions
368

Turk J Hematol 2016;33:355-370
LETTERS TO EDITOR
for pH alteration are not known, Ackerman [2] suggested that
cytoplasmic pH alteration occurred in specific leukemia cells,
which allowed the granules to unite into crystal-like rods [3].
Additionally, a titration rate of 1/200 or higher in O antigen
should be considered positive for acute infection diagnosis.
Salmonella Typhi isolation in culture is the gold standard for
diagnosis [4].
Keywords: Auer rods, Non-neoplastic cells
Anahtar Sözcükler: Auer cismi, Neoplastik olmayan hücreler
Conflict of Interest: The authors of this paper have no conflicts
of interest, including specific financial interests, relationships,
and/or affiliations relevant to the subject matter or materials
included.
References
1. Chandra H, Chandra S, Gupta V, Mahajan D. Auer rod in a neutrophil in a
nonmalignant condition. Turk J Hematol 2016;33:167.
2. Ackerman GA. Microscopic and histochemical studies on the Auer bodies in
leukemic cells. Blood 1950;5:847-863.
3. Yoshida Y, Oguma S, Ohno H. John Auer and Auer rods; controversies
revisited. Leuk Res 2009;33:614-616.
4. Mogasale V, Ramani E, Mogasale VV, Park J. What proportion of Salmonella
Typhi cases are detected by blood culture? A systematic literature review.
Ann Clin Microbiol Antimicrob 2016;15:32.
Reply
Dear Sir,
The authors are thankful for considering their manuscript
entitled “Auer Rod in a Neutrophil in a Nonmalignant Condition”
interesting enough for critical analysis. However, the authors
would like to clarify few points:
1. The authors have clearly stated in the manuscript the presence
of Auer rod-like inclusions on peripheral examination.
2. In view of the presence of Auer rods bone marrow examination
was done and which showed only unremarkable features of
normoblastic maturation. There was presence of no leukemia
cells. This clearly excluded the possibility of malignant condition
and nonmalignant diagnosis was considered. Moreover the
patient also responded well to an antibiotic course after
diagnosis of typhoid.
3. Genetic studies were however not done as firstly it was not
considered necessary in view of absolutely normal bone marrow
and secondly also due to financial constraints.
4. The Salmonella Typhi O antigen titre of 1: 160 dilution was
considered positive and patient responded very well to course
of antibiotics. Her clinical follow up was unremarkable and thus
chance of any leukemic process was completely eliminated.
5. The authors agree with the various hypotheses that have
been enlisted by Yavaşoğlu and Bolaman for genesis of Auer rod
in infectious conditions. In the background of these theories
and findings, the presence of clear rod-like structure due to
condensation of azurophilic granules in neutrophil in typhoid
infection led to the consideration of Auer rod in nonmalignant
condition.
Thanking you,
Harish Chandra, Smita Chandra, Vibha Gupta, Divyaa Mahajan
Address for Correspondence/Yazışma Adresi: İrfan YAVAŞOĞLU, M.D.,
Adnan Menderes University Faculty of Medicine, Division of Hematology, Aydın, Turkey
Phone : +90 256 212 00 20
E-mail : dr_yavas@yahoo.com
Received/Geliş tarihi: May 19, 2016
Accepted/Kabul tarihi: May 24, 2016
DOI: 10.4274/tjh.2016.0179
369

LETTERS TO EDITOR Turk J Hematol 2016;33:355-370
Iron and Zinc Treatment in Iron Deficiency
Demir Eksikliğinde Demir ve Çinko Tedavisi
Beuy Joob 1 , Viroj Wiwanitkit 2
1Sanitation 1 Medical Academic Center, Bangkok, Thailand
2Hainan Medical University, Hainan, China
To the Editor,
The recent report by Özhan et al. was very interesting [1]. Özhan
et al. concluded that “iron and zinc treatment instead of only
iron replacement may be considered in cases of iron deficiency”
[1]. The results from their study might support this suggestion.
Nevertheless, we would like to add some comments. First, there
was no complete nutritional evaluation in the patient and
control groups, and there might have been some effects due
to differences of intake among the subjects. In addition, it is
not doubted that the patients had iron deficiency, but there
is still the chance of the coexistence of other hemoglobin
disorders. In Southeast Asia, concurrent iron deficiency and
hemoglobinopathy are very common and can be misdiagnosed
and incorrectly managed [2]. Iron supplementation in the case
of combined iron deficiency and hemoglobinopathy has to be
carefully considered [2,3]. Focusing on the serum zinc level,
there is still no pathogenesis to explain the problem in the case
of iron deficiency, but there is already a report confirming that
hemoglobinopathy can result in low serum zinc levels [4]. Hence,
to apply the recommendation of Özhan et al., further studies are
required for validation, and attention to possible concomitant
hemoglobinopathy is necessary [1].
Keywords: Iron, Zinc, Treatment, Deficiency
Anahtar Sözcükler: Demir, Çinko, Tedavi, Eksiklik
Authorship Contributions
Concept: Beuy Joob, Viroj Wiwanitkit; Design: Beuy Joob,
Viroj Wiwanitkit; Data Collection or Processing: Beuy Joob,
Viroj Wiwanitkit; Analysis or Interpretation: Beuy Joob, Viroj
Wiwanitkit; Literature Search: Beuy Joob, Viroj Wiwanitkit;
Writing: Beuy Joob, Viroj Wiwanitkit.
Conflict of Interest: The authors of this paper have no conflicts of
interest, including specific financial interests, relationships, and/
or affiliations relevant to the subject matter or materials included.
References
1. Özhan O, Erdem N, Aydoğdu İ, Erkurt A, Kuku İ. Serum zinc levels in iron
deficient women: a case-control study. Turk J Hematol 2016;33:156-158.
2. Pansuwan A, Fucharoen G, Fucharoen S, Himakhun B, Dangwiboon S. Anemia,
iron deficiency and thalassemia among adolescents in Northeast Thailand:
results from two independent surveys. Acta Haematol 2011;125:186-192.
3. Burdick C. Combined iron deficiency and thalassemia minor. Am J Clin
Pathol 2013;139:260.
4. Fung EB, Gildengorin G, Talwar S, Hagar L, Lal A. Zinc status affects glucose
homeostasis and insulin secretion in patients with thalassemia. Nutrients
2015;7:4296-4307.
Reply
Dear Dr Joob,
Thank you for your comments and recommendations. We had
evaluated the zinc deficiency in iron deficiency anemia, not in all
anemia types. Serum iron, ferritin, and transferrin saturation levels
were used in diagnosis and whether or not hemoglobinopathy
exists, these patients were diagnosed iron deficiency anemia. And
for possible mechanisms, there are some theories mentioned in the
article. One of them is increase in production of Zn-protoporphyrin
and usage of zinc instead of iron in the protoporphyrin structure
[1], which can explain zinc deficiency in iron deficiency. And in
another study, histopathological changes causing iron and zinc
deficiency in intestinal mucosa were reversed with zinc treatment
and the absorption of zinc and iron was improved [2]. But still as
you mentioned and as we mentioned in our article, further studies
are needed.
References
1. Hastka J, Lassere JJ, Schwarzbeck, Hehlmann R. Central role of zinc
protoporphyrin in staging iron deficiency. Clin Chem 1994;40:768-773.
2. Arcasoy A. İnsan sağlığında çinkonun önemi. TÜBİTAK Bilim ve Teknik
Dergisi 1996;12:56 (in Turkish).
Address for Correspondence/Yazışma Adresi: Beuy JOOB, M.D.,
Sanitation 1 Medical Academic Center, Bangkok, Thailand
E-mail : beuyjoob@hotmail.com
Received/Geliş tarihi: June 27, 2016
Accepted/Kabul tarihi: June 27, 2016
DOI: 10.4274/tjh.2016.0249
370

33 rd Volume Index / 33. Cilt Dizini
SUBJECT INDEX - KONU DİZİNİ 2016
Acute Leukemia
Chronic lymphocytic leukemia / Kronik lenfositik lösemi, 8, 202, 248,
335, 353
Non-Hodgkin’s lymphoma / Non-Hodgkin lenfoma, 8
Cancer / Kanser, 8, 311
Thrombosis / Tromboz, 8, 84
T-cell neoplasms / T-hücreli neoplaziler, 8
B-cell neoplasms / B-hücreli neoplaziler, 8
Acute leukemia / Akut lösemi, 8, 84, 170
Myelodysplastic syndromes / Myelodisplastik sendromlar, 8, 81, 119,
359
Chronic leukemia / Kronik lösemi, 8
HEPA filter / YEPE filtre, 41
Infection / Enfeksiyon, 41, 244, 304
Invasive fungal infection / İnvaziv fungal enfeksiyon, 41, 364
Thiamine / Tiamin, 78
Wernicke’s encephalopathy / Wernicke ensefalopatisi, 78
Acute myeloid leukemia / Akut miyeloid lösemi, 78, 135, 273, 351, 364, 369
Sepsis / Sepsis, 84
Acute lymphoblastic leukemia / Akut lenfoblastik lösemi, 131, 339
Lymphoid cell neoplasm / Lenfoid hücreli neoplazi, 131
Hematopoiesis / Hematopoiez, 131
Chemotherapy / Kemoterapi, 131
Soluble urokinase plasminogen activator receptor / Solubl ürokinaz
plazminojen aktivatör reseptörü, 135
Prognosis / Prognoz, 135, 281
B-cell lymphoblastic lymphoma / B-hücreli lenfoblastik lenfoma, 168
Thoracic spine / Torasik vertebra, 168
Spinal cord compression / Spinal kord basısı, 168
Hepatitis B / Hepatit B, 231
Vaccine / Aşılama, 231
Hematological malignancies / Hematolojik malignite, 231
Azacitidine / Azasitidin, 273
Elderly / Yaşlı, 273
Bone marrow blasts / Kemik iliği blastları, 273
Prognostic factors / Prognostik faktörler, 273
Overall survival / Genel sağkalım, 273
Burkitt’s cell leukemia / Burkitt hücreli lösemi, 281
Childhood leukemia / Çocukluk çağı lösemisi, 326
Depression / Depresyon, 326
Anxiety / Anksiyete, 326
Self-image / Benlik imajı, 326
Health-related quality of life / Sağlıkla ilişkili yaşam kalitesi, 326
Acute megakaryoblastic leukemia without Down syndrome / Down
sendromu olmayanlarda akut megakaryoblastik lösemi, 331
CBFA2T3-GLIS2 fusion gene / CBFA2T3-GLIS2 füzyon geni, 331
Insulin-like growth factor-1 / İnsülin-benzeri büyüme faktörü-1, 335
Insulin-like growth factor binding protein-3 / İnsülin benzeri büyüme
faktörü bağlayıcı protein-3, 335
Human leukocyte antigen alleles / İnsan lökosit antijeni alelleri, 339
Risk groups / Risk grupları, 339
Chediak Higashi syndrome / Chediak Higashi sendromu, 349
Giant granules / Dev granüller, 349
Immunodeficiency / İmmün yetmezlik, 349
Auer rods / Auer cismi, 167, 351, 369
Plasma cells / Plazma hücreleri, 367
Therapy / Tedavi, 353
Ring sideroblasts / Halka sideroblastlar, 359
Megaloblastic anemia / Megaloblastik anemi, 359
Myelodysplastic syndrome / Miyelodisplastik sendrom, 8, 81, 119, 359
Non-neoplastic cells / Neoplastik olmayan hücreler, 369
Anemia
Anemia / Anemi, 86, 156, 263
Elliptocytosis / Eliptositoz, 86
Pyropoikilocytosis / Piropoikilositoz, 86
Iron / Demir, 156, 370
Zinc / Çinko, 156, 370
Women / Kadın, 156
Iron deficiency / Demir eksikliği, 156
Iron deficiency anemia / Demir eksikliği anemisi, 257
Unicentric plasma-cell type / Unisentrik plazma hücreli tip, 257
Castleman’s disease / Castleman hastalığı, 257
Fanconi / Fanconi, 263
Congenital lobar emphysema / Konjenital lober amfizem, 263
Ring sideroblasts / Halka sideroblastlar, 359
Megaloblastic anemia / Megaloblastik anemi, 359
Myelodysplastic syndrome / Miyelodisplastik sendrom, 8, 81, 119, 359
Sickle cell disease / Orak hücre hastalığı, 365
Crisis / Kriz, 365
NOS3 / NOS3, 365
IL4 / IL4, 365
Bleeding Disorders
Bleeding / Kanama, 48
Ankaferd / Ankaferd, 48
Chitosan / Chitosan, 48
Hemostasis / Hemostaz, 48
Platelet aggregation / Trombosit agregasyonu, 127
Chronic myeloid leukemia / Kronik miyelositer lösemi, 127
Imatinib mesylate / İmatinib mesilat, 127
Hyperparathyroidism / Hiperparatiroidism, 293
Platelet function / Trombosit fonksiyonları, 293
P selectin / P selektin, 293
Calcium / Kalsiyum, 293
Bone loss / Kemik kaybı, 293
Chronic Leukemia
Platelet aggregation / Trombosit agregasyonu, 127
Chronic myeloid leukemia / Kronik miyelositer lösemi, 127
Imatinib mesylate / İmatinib mesilat, 127
ZAP70 / ZAP70, 202
Interleukin-4 / İnterlökin-4, 202
Interferon gamma / İnterferon gama, 202
T cells / T hücreleri, 202
B cells / B hücreleri, 202
Chronic lymphocytic leukemia / Kronik lenfositik lösemi, 8, 202, 248,
335, 353
Radiation / Radyasyon, 248
Tumor lysis syndrome / Tümör lizis sendromu, 248
Acute myeloid leukemia / Akut miyeloid lösemi, 78, 135, 273, 351, 364, 369
Therapy / Tedavi, 353

33 rd Volume Index / 33. Cilt Dizini
SUBJECT INDEX - KONU DİZİNİ 2016
Coagulation
Angiogenesis / Anjiyogenez, 88
Haemophilic arthropathy / Hemofilik artropati, 88
Vascular endothelial growth factor / Vasküler endoteliyal büyüme
faktörü, 88
Haemophilia / Hemofili, 88
Infant / Süt çocuğu, 163
Adult / Erişkin, 163
Microparticle / Mikropartikül, 163
Thrombin / Trombin, 163
Superwarfarin / Süpervarfarin, 251
Acquired coagulopathies / Kazanılmış koagülopatiler, 251
Vitamin K / K vitamin, 251
Endothelium / Endotel, 261
Ankaferd / Ankaferd, 261
Estradiol / Estradiol, 261
International normalized ratio / Uluslararası düzeltme oranı, 299
Warfarin / Warfarin, 299
Hypercoagulable conditions / Hiperkoagülabilite durumları, 299
Venous thromboembolism / Venöz tromboembolizm, 299
Knowledge / Bilgi, 356
Hemophilia / Hemofili, 356
Treatment / Tedavi, 187, 356, 370
Disease / Hastalık, 356
Hematological Malignancies
Colonization / Kolonizasyon, 244
Infection / Enfeksiyon, 41, 244, 304
Pediatric malignancy / Pediatrik malignite, 244
Vancomycinresistant enterococci / Vankomisine dirençli enterokok, 244
Immunohematology
Antiphospholipid syndrome / Antifosfolipid sendromu, 1
Complement inhibition / Komplaman inhibisyonu, 1
Eculizumab / Eculizumab, 1
Thrombotic angiopathy / Trombotik anjiyopati, 1
Cardiac surgery / Kalp cerrahisi, 357
Apheresis / Aferez, 357
Crossmatch / Çapraz karşılaştırma, 357
Transfusion medicine / Transfüzyon tıbbı, 148, 357
Iron Disorder
Iron overload / Demir birikimi, 21, 320
Liver / Karaciğer, 21
Pancreas / Pankreas, 21
R2* / R2*, 21
Magnetic resonance imaging-proton density fat fraction / Manyetik
rezonans görüntüleme-proton dansite yağ oranı, 21
Hemochromatosis / Hemokromatozis, 320
HFE gene / HFE geni, 320
p.C282Y / p.C282Y, 320
p.H63D / p.H63D, 320
Sickle cell anemia / Orak hücreli anemi, 320
Iron / Demir, 156, 370
Zinc / Çinko, 156, 370
Treatment / Tedavi, 187, 356, 370
Deficiency / Eksiklik, 370
Infection Disorders
HEPA filter / YEPE filtre, 41
Infection / Enfeksiyon, 41, 244, 304
Invasive fungal infection / İnvaziv fungal enfeksiyon, 41, 364
Antifungal treatment / Antifungal tedavi, 53
Diagnosis / Teşhis, 53
Stem cell transplantation / Kemik iliği transplantasyonu, 53
Neutropenia / Nötropeni, 102
D-index / D-indeks, 102
Cumulative-D-index / Kümülatif-D-indeks, 102
Hematological malignancies / Hematolojik malignite, 102
Invasive fungal infections / İnvaziv fungal enfeksiyon, 102
Coagulation / Koagülasyon, 112
Sepsis / Sepsis, 112
Enoxaparin / Enoksaparin, 112
Acute leukemia / Akut lösemi, 8, 84, 170
Stevens-Johnson syndrome / Stevens-Johnson sendromu, 170
Toxic epidermal necrolysis / Toksik epidermal nekrolizis, 170
Hematopoietic stem cell transplantation / Hematopoetik kök hücre
nakli, 216
Bloodstream infection / Kan akımı enfeksiyonu, 216
Epidemiology / Epidemiyoloji, 216
Resistance / Direnç, 216
Central venous catheter / Santral venöz kateter, 216
BK virus / BK virüs, 223
Hemorrhagic cystitis / Hemorajik sistit, 223
Allogeneic stem cell transplantation/ Allojenik kök hücre
transplantasyonu, 223
Leflunomide / Leflunomid, 223
Hepatitis B / Hepatit B, 231
Vaccine / Aşılama, 231
Hematological malignancies / Hematolojik malignite, 231
Colonization / Kolonizasyon, 244
Infection / Enfeksiyon, 41, 244, 304
Pediatric malignancy / Pediatrik malignite, 244
Vancomycinresistant enterococci / Vankomisine dirençli enterokok, 244
Febrile neutropenia/ Febril nötropeni, 304
Infection/ Enfeksiyon, 41, 244, 304
Mannose-binding lectin/ Mannoz-bağlayıcı lektin, 304
H-ficolin/ H-fikolin, 304
Procalcitonin/ Prokalsitonin, 304
C-reactive protein / C-reaktif protein, 304
Febrile neutropenia / Febril nötropeni, 311
Cancer / Kanser, 8, 311
Mortality / Mortalite, 311
Risk factors / Risk faktörleri, 311
Varicella / Varisella, 346
Malignancy / Malignite, 346
Pediatric patient / Çocuk hasta, 346
Invasive Fungal Infection / İnvazif mantar enfeksiyonu, 41, 364
Fusariosis / Fusariosis, 364
Combined antifungal treatment / Kombine antifungal tedavi, 364
Lyposomal amphotericin B / Lipozomal amfoterisin B, 364
Voriconazole / Vorikonazol, 364
Acute myeloid leukemia / Akut myeloid lösemi, 78, 135, 273, 351, 364, 369

33 rd Volume Index / 33. Cilt Dizini
SUBJECT INDEX - KONU DİZİNİ 2016
Lymphoma
Chronic lymphocytic leukemia / Kronik lenfositik lösemi, 8, 202, 248,
335, 353
Non-Hodgkin’s lymphoma / Non-Hodgkin lenfoma, 8
Cancer / Kanser, 8, 311
Thrombosis / Tromboz, 8
T-cell neoplasms / T-hücreli neoplaziler, 8
B-cell neoplasms / B-hücreli neoplaziler, 8
Acute leukemia / Akut lösemi, 8, 84
Myelodysplastic syndromes / Myelodisplastik sendromlar, 8, 81, 119, 359
Chronic leukemia / Kronik lösemi, 8
Secondary neoplasms / İkincil neoplaziler, 66
Chemoradiotherapy / Kemoradyoterapi, 66
Hodgkin’s lymphoma / Hodgkin lenfoması, 66
Extranodal natural killer/T-cell lymphoma / Ekstranodal natural killer/Thücreli
lenfoma, 74, 361
Non-Hodgkin lymphoma / Hodgkin dışı lenfoma, 74
Parotid gland / Parotis bezi, 75
T-Cell lymphoma / T-Hücreli lenfoma, 75
Auricula / Aurikula, 75
Lymphoma / Lenfoma, 141, 159, 362
Expression / Ekspresyon, 141
Polymorphism / Polimorfizm, 141
Rho-kinase / Rho-kinaz, 141
Acute kidney injury / Akut böbrek hasarı, 159
Hematuria / Hematüri, 159
Renal biopsy / Renal biyopsi, 159
Renal masses / Renal kitle, 159
Diffuse large B-cell lymphoma/ Diffüz büyük B-hücreli lenfoma, 164
Downgraded lymphoma / Geriletilmiş lenfoma, 164
Relapsed/refractory lymphoma / Nüks/dirençli lenfoma, 209
Hematopoietic stem cell transplantation / Hematopoetik kök hücre
nakli, 209
Conditioning regimen / Hazırlama rejimi, 209
bone lymphoma / Primer kemik lenfoma, 254
Ocular adnexal lymphoma / Oküler adneks lenfoma, 254
Diffuse large B-cell lymphoma / Diffüz büyük B hücreli lenfoma, 254
Non-Hodgkin’s lymphoma / Hodgkin dışı lenfoma, 259
Vaginal B-cell lymphoma / Vajinal B-hücreli lenfoma, 259
Postmenopausal bleeding / Postmenopozal kanama, 259
Vaginal discharge / Vajinal akıntı, 259
Childhood Hodgkin’s lymphoma / Çocukluk çağı Hodgkin lenfoma, 265
Prognosis / Prognoz, 265
Autologous hematopoietic stem cell transplantation / Otolog
hematopoetik kök hücre nakli, 265
Prognostic index / Prognostik indeks, 265
Extranodal natural killer/T cell lymphoma / Ekstranodal doğal
öldürücü/T hücreli lenfoma, 74, 361
Erythematous indurated plaques/ Eritemli indüre plaklar, 361
Annular erythematous patch / Anuler eritemli yama, 361
Annular erythema / Anuler eritem, 361
Penis / Penis, 362
Non-Hodgkin lymphoma / Hodgkin dışı lenfoma, 362
Diffuse large B-cell lymphoma / Diffüz büyük B hücreli lenfoma, 362
Penile mass / Penil kitle, 362
Molecular Hematology
Chronic lymphocytic leukemia / Kronik lenfositik lösemi, 8, 202, 248,
335, 353
Non-Hodgkin’s lymphoma / Non-Hodgkin lenfoma, 8
Cancer / Kanser, 8, 311
Thrombosis / Tromboz, 8
T-cell neoplasms / T-hücreli neoplaziler, 8
B-cell neoplasms / B-hücreli neoplaziler, 8
Acute leukemia / Akut lösemi, 8, 84
Myelodysplastic syndromes / Myelodisplastik sendromlar, 8, 81, 119, 359
Chronic leukemia / Kronik lösemi, 8
BACH1 / BACH1, 15
Gene expression / Gen sunumu, 15
Hemoglobin E/β-thalassemia / Hemoglobin E/β-talasemi, 15
Oxidative stress / Oksidatif stres, 15
Red blood cell parameters / Eritrosit değişkenleri, 15
Chronic myeloid leukemia / Kronik myeloid lösemi, 60
Variant Philadelphia / Varyant Philadelphia, 60
Tyrosine kinase inhibitors / Tirozin kinaz inhibitörleri, 60
Prognosis / Prognoz, 60
JAK2V617F mutation / JAK2V617F mutasyonu, 94
Essential thrombocythemia / Esansiyel trombositemi, 94
Primary myelofibrosis / Primer miyelofibrozis, 94
Acute leukemia / Akut lösemi, 8, 84, 170
Stevens-Johnson syndrome / Stevens-Johnson sendromu, 170
Toxic epidermal necrolysis / Toksik epidermal nekrolizis, 170
Genetic variation / Genetik varyasyon, 172
Sequencing / Dizileme, 172
Genomic data / Genomik data, 172
Clinical interpretation / Klinik yorum, 172
ZAP70 / ZAP70, 202
Interleukin-4 / İnterlökin-4, 202
Interferon gamma / İnterferon gama, 202
T cells / T hücreleri, 202
B cells / B hücreleri, 202
Hemochromatosis / Hemokromatozis, 320
HFE gene / HFE geni, 320
Iron overload / Demir birikimi, 320
p.C282Y / p.C282Y, 320
p.H63D / p.H63D, 320
Sickle cell anemia / Orak hücreli anemi, 320
Acute megakaryoblastic leukemia without Down syndrome / Down
sendromu olmayanlarda akut megakaryoblastik lösemi, 331
CBFA2T3-GLIS2 fusion gene / CBFA2T3-GLIS2 füzyon geni, 331
Chronic lymphocytic leukemia / Kronik lenfositik lösemi, 8, 202, 248,
335, 353
Insulin-like growth factor-1 / İnsülin-benzeri büyüme faktörü-1, 335
Insulin-like growth factor binding protein-3 / İnsülin benzeri büyüme
faktörü bağlayıcı protein-3, 335
Acute lymphoblastic leukemia / Akut lenfoblastik lösemi, 131, 339
Human leukocyte antigen alleles / İnsan lökosit antijeni alelleri, 339
Risk groups / Risk grupları, 339
Sickle cell disease / Orak hücre hastalığı, 365
Crisis / Kriz, 365
NOS3 / NOS3, 365

33 rd Volume Index / 33. Cilt Dizini
SUBJECT INDEX - KONU DİZİNİ 2016
IL4 / IL4, 365
Multiple Myeloma
Myeloma and other plasma cell dyscrasias / Miyelom ve diğer plazma
hücre diskrazileri, 286
Neoplasia / Neoplazi, 286
Cytogenetics / Sitogenetik, 286
Gene therapy / Gen terapisi, 286
Molecular hematology / Moleküler hematoloji, 286
Myelodysplastic Syndromes
Erythema annulare centrifugum / Eritem annuler santrifuj, 81
Azacitidine / Azasitidin, 81
Myelodysplastic syndrome / Miyelodisplastik sendrom, 8, 81, 119, 359
International Prognostic Scoring System / Uluslararası Prognostik Skorlama
Sistemi, 119
MD Anderson Prognostic Scoring System / MD Anderson Prognostik
Skorlama Sistemi, 119
World Health Organization Classification-Based Prognostic Scoring
System / Dünya Sağlık Örgütü Sınıflandırması Bazlı Prognostik Skorlama
Sistemi, 119
Revised International Prognostic Scoring System / Yeniden Düzenlenmiş
Uluslararası Prognostik Skorlama Sistemi, 119
Myeloproliferative Disorders
JAK2V617F mutation / JAK2V617F mutasyonu, 94
Essential thrombocythemia / Esansiyel trombositemi, 94
Primary myelofibrosis / Primer miyelofibrozis, 94
Calreticulin mutation / Kalretikülin mutasyonu, 180
Myeloproliferative neoplasms / Miyeloproliferatif neoplazi, 180
Leukemia / Lösemi, 180
Myeloproliferative neoplasms / Miyeloproliferatif hastalıklar, 187
Survival / Sağkalım, 187
Thrombosis / Tromboz, 187
Treatment / Tedavi, 187, 356, 370
Neutropenia
Febrile neutropenia / Febril nötropeni, 304
Infection / Enfeksiyon, 41, 244, 304
Mannose-binding lectin / Mannoz-bağlayıcı lektin, 304
H-ficolin / H-fikolin, 304
Procalcitonin / Prokalsitonin, 304
C-reactive protein / C-reaktif protein, 304
Stem Cell Transplantation
Hematopoietic stem cell transplantation / Hematopoetik kök hücre nakli, 34
Exhaled nitric oxide / Ekshale nitrik oksit, 34
Pulmonary complications / Pulmoner komplikasyonlar, 34
Mortality / Mortalite, 34
Antifungal treatment / Antifungal tedavi, 53
Diagnosis / Teşhis, 53
Stem cell transplantation / Kemik iliği transplantasyonu, 53
Eosinophilia/ Eozinofili,196
Allogeneic hematopoietic stem cell transplantation/ Allojenik
hematopoetik kök hücre nakli, 196
Corticosteroid therapy/ Kortikosteroid tedavisi, 196
Prognostic factor/ Prognostik faktör, 196
Graft versus-host disease/ Graft versus-host hastalığı, 196
Relapsed/refractory lymphoma / Nüks/dirençli lenfoma, 209
Hematopoietic stem cell transplantation / Hematopoetik kök hücre
nakli, 209
Conditioning regimen / Hazırlama rejimi, 209
Hematopoietic stem cell transplantation / Hematopoetik kök hücre
nakli, 216
Bloodstream infection / Kan akımı enfeksiyonu, 216
Epidemiology / Epidemiyoloji, 216
Resistance / Direnç, 216
Central venous catheter / Santral venöz kateter, 216
BK virus / BK virüs, 223
Hemorrhagic cystitis / Hemorajik sistit, 223
Allogeneic stem cell transplantation/ Allojenik kök hücre
transplantasyonu, 223
Leflunomide / Leflunomid, 223
Childhood Hodgkin’s lymphoma / Çocukluk çağı Hodgkin lenfoma, 265
Prognosis / Prognoz, 265
Autologous hematopoietic stem cell transplantation / Otolog
hematopoetik kök hücre nakli, 265
Prognostic index / Prognostik indeks, 265
Thalassemia
BACH1 / BACH1, 15
Gene expression / Gen sunumu, 15
Hemoglobin E/β-thalassemia / Hemoglobin E/β-talasemi, 15
Oxidative stress / Oksidatif stres, 15
Red blood cell parameters / Eritrosit değişkenleri, 15
Thalassemia / Talasemi,56
Hemoglobinopathy / Hemoglobinopati, 56
Hemoglobin H disease / Hemoglobin H hastalığı, 56
Abnormal hemoglobins / Anormal hemoglobinler, 71
Hemoglobin G-Waimanalo / Hemoglobin G-Waimanalo, 71
Hemoglobin Fontainebleau / Hemoglobin Fontainebleau, 71
Thalassemia major / Talasemi majör, 72
Thalassemia minor / Talasemi minör, 72
Serum lipids / Serum lipidleri, 72
Deletional mutations/ Delesyonel mutasyonlar, 107
Turkish inversion/deletion (δβ)0 mutation/ Türk tipi inversiyon/
delesyon (δβ)0 mutasyonu, 107
Gap-PCR, β-Globin gene cluster / Gap-PCR, Beta-globin gen kümesi, 107
Thrombosis
Antiphospholipid syndrome / Antifosfolipid sendromu, 1
Complement inhibition / Komplaman inhibisyonu, 1
Eculizumab / Eculizumab, 1
Thrombotic angiopathy / Trombotik anjiyopati, 1
Microangiopathy / Mikroanjiopati, 83
Kidney functions / Böbrek fonksiyonları, 83
Hemolytic anemia / Hemolitik anemi, 83
Acute leukemia / Akut lösemi, 8, 84
Sepsis / Sepsis, 84
Thrombosis / Tromboz, 84
Intracranial mass / İntrakranial kitle, 255
Cerebral sinovenous thrombosis / Serebral sinovenöz tromboz, 255
Increased intracranial pressure / Artmış intrakranial basınç, 255
Thrombocytopenia

33 rd Volume Index / 33. Cilt Dizini
SUBJECT INDEX - KONU DİZİNİ 2016
Idiopathic thrombocytopenic purpura / İdiyopatik immün
trombositopeni, 77
Glucose-6-phosphate dehydrogenase deficiency / Glukoz-6-fosfat
dehidrogenaz eksikliği, 77
Thrombopoietin mimetic peptide / Trombopoetin uyarıcı peptit, 77
TMP mimetic peptide / TPO uyarıcı peptit, 77
Idiopathic thrombocytopenic purpura/ İdiyopatik trombositopenik
purpura, 153
Regulatory T cells/ Düzenleyici T hücreleri, 153
Chediak Higashi syndrome / Chediak Higashi sendromu, 349
Giant granules / Dev granüller, 349
Immunodeficiency / İmmün yetmezlik, 349
Other
Oxalosis / Oksalozis, 79
Hyperoxaluria / Hiperoksalüri, 79
Bone marrow / Kemik iliği, 79
Thalassemia / Talasemi, 166
Tumor necrosis factor / Tümör nekrozis faktör, 166
Splenectomy / Splenektomi, 166
Pediatric Quality of Life Inventory/ Çocuklar için Yaşam Kalitesi
Ölçeği, 236
Validity / Geçerlilik, 236
Reliability / Güvenirlik, 236
Children / Çocuk, 236
Cancer / Kanser, 236
Pathology
Oxalosis / Oksalozis, 79
Hyperoxaluria / Hiperoksalüri, 79
Bone marrow / Kemik iliği, 79
Auer rods / Auer cismi, 167, 351, 369
Neutrophil / Nötrofil, 167
Typhoid fever / Tifo, 167
Iron deficiency anemia / Demir eksikliği anemisi, 257
Unicentric plasma-cell type / Unisentrik plazma hücreli tip, 257
Castleman’s disease / Castleman hastalığı, 257
Non-neoplastic cells / Neoplastik olmayan hücreler, 369
Acute myeloid leukemia / Akut miyeloid lösemi, 78, 135, 273, 351, 364, 369
Plasma cells / Plazma hücreleri, 367
Inclusion / İnkülüzyon, 367
Reactive plasmacytosis / Reaktif plazmositoz, 367
Autoimmune Disorders
Antiphospholipid syndrome / Antifosfolipid sendromu, 1
Complement inhibition / Komplaman inhibisyonu, 1
Eculizumab / Eculizumab, 1
Thrombotic angiopathy / Trombotik anjiyopati, 1
Idiopathic thrombocytopenic purpura / İdiyopatik immün
trombositopeni, 77
Glucose-6-phosphate dehydrogenase deficiency / Glukoz-6-fosfat
dehidrogenaz eksikliği, 77
Thrombopoietin mimetic peptide / Trombopoetin uyarıcı peptit, 77
TMP mimetic peptide / TPO uyarıcı peptit, 77
Idiopathic thrombocytopenic purpura/ İdiyopatik trombositopenik
purpura, 153
Regulatory T cells/ Düzenleyici T hücreleri, 153
Transfusion
Frozen platelets / Dondurulmuş trombositler, 28
Flow-cytometric analysis / Akım-sitometri testi, 28
In vivo thrombin generation test / İn vivo thrombin jenerasyon testi, 28
Medical audit / Tıbbi denetleme, 148
Transfusion medicine / Transfüzyon tıbbı, 148, 357
Donor selection / Donör seçimi, 148

33 rd Volume Index / 33. Cilt Dizini
AUTHOR INDEX - YAZAR DİZİNİ 2016
Abdel Galil M. Abdel Gader........................ 112
Abdul Kareem Al Momen........................... 112
Abdulaziz H. Alzeer..................................... 112
Abdullah Sakin............................................ 335
Abdullah T. Demiryürek............................. 141
Absia Jabbar................................................. 299
Adalet Meral Güneş..................................... 326
Adeel Arshad............................................... 299
Afak Durur Karakaya.................................. 263
Ahmet Emre Eşkazan.................................. 216
Ahmet Hakan Vural..................................... 356
Ahmet Menteşe............................................ 135
Ahmet Pekoğlu ..............................................28
Ahu Kara..................................................... 346
Akif Selim Yavuz............................................94
Albane Ledoux-Pilon.................................. 259
Alev Akyol Erikçi........................................ 153
Alexandra Agapidou.......................................88
Algün Polat Ekinci....................................... 360
Ali Alkan..................................................... 248
Ali Bay............................................................56
Ali Erkurt.................................................... 156
Ali Fettah..................................................... 263
Ali Haythem................................................ 299
Ali Kaya....................................................... 209
Ali Mert............................................... 216, 304
Ali Pamir.........................................................66
Ali Ümit Esbah............................................ 362
Ali Zahit Bolaman........................................ 187
Alpay Azap.................................................. 102
Alper Koç........................................................75
Alphan Küpesiz........................................... 265
Ammara Arslan........................................... 131
Andrea Tendas................................................77
Anıl Tombak................................................ 273
Arzu Çırpan Kantarcıoğlu........................... 326
Arzu Yaşar................................................... 248
Ashutosh Kumar......................................... 349
Asım Örem.................................................. 135
Aslı Özdemir............................................... 244
Aslıhan Demirel........................................... 363
Atilla Çayır.................................................. 263
Atilla Elhan.................................................. 102
Atsuo Maruta............................................... 196
Aydan Akdeniz............................................ 273
Ayhan Çavdar.................................................66
Ayhan Dağdemir.......................................... 265
Aylin Ayer.................................................... 335
Aynur Dağlar-Aday.........................................94
Ayper Somer................................................ 244
Aysel Pekel......................................................28
Aysen Akalın................................................ 293
Ayşe Hiçsönmez.......................................... 248
Ayşe Işık....................................................... 119
Ayşe Salihoğlu............................................. 216
Ayşe Uysal................................................... 273
Ayşegül Sümer............................................. 135
Ayşegül Tetik............................................... 209
Ayşegül Üner............................................... 119
Ayşegül Ünüvar........................................... 244
Aytekin Ünlü .................................................28
Bahattin Işık...................................................48
Barış Malbora..................................................56
Başak Akadam-Teker......................................94
Başak Doğanavşargil.......................................79
Belgin Coşkun....................................... 41, 102
Bengi Öztürk..................................................41
Bengü Demirağ............................................ 346
Berna Ateşağaoğlu....................................... 251
Betül Ulukol................................................ 163
Beuy Joob..................................................... 370
Bilgül Mete.......................................... 216, 304
Birgül Erkmen................................................28
Birgül Öneç........................................... 75, 362
Birol Baytan................................................. 326
Burak Uz.............................................. 119, 164
Burak Yılmaz............................................... 286
Burhan Ferhanoğlu............................. 216, 304
Bülent Karagöz............................................ 153
Can Acıpayam................................................56
Can Baykal................................................... 360
Can Boğa..................................................... 320
Can Polat Eyigün............................................28
Canan Vergin............................................... 346
Cécile Moluçon-Chabrot............................. 259
Cem Kis....................................................... 273
Cengiz Bal.................................................... 293
Ceyda Aslan................................................. 254
Ceylan Yılmaz................................................94
Chul Soo Kim.............................................. 223
Chunyan Ji.................................................. 180
Cihan Gündoğan......................................... 254
Çiğdem Aşut................................................ 326
Çiğdem Tokyol............................................ 168
Damla Eyüpoğlu.............................................60
Daniil F. Gluzman.............................................8
Daoxin Ma................................................... 180
Deniz Gören Şahin...................................... 273
Deniz Güven...................................................60
Deniz Sünnetçi.................................................8
Derya Aydın................................................. 244
Derya Özyörük.............................................255
Didar Yanardağ Açık................................... 141
Didem Atay.................................................. 265
Divyaa Mahajan........................................... 167
Doruk Erkan.....................................................1

Turk J Hematol 2016;33:323-328
33 rd Volume Index / 33. Cilt Dizini
AUTHOR INDEX - YAZAR DİZİNİ 2016
Füsun Özdemirkıran et al. IL-18 Polymorphisms in CML and CLL Patients
Duran Canatan...............................................71
Durdu Mehmet Köş........................................75
Ebru Karcı................................................... 248
Eda Ataseven......................................... 84, 170
Edip Gali........................................................56
Efthymia Vlachaki..........................................88
Ekrem Ünal................................................. 265
Elif Gökçen Sazak........................................335
Elif Nisa Ünlü.................................................75
Elif Suyanı..................................... 34, 231, 254
Elizabeth George............................................15
Emel Gürkan............................................... 273
Emel Ünal.............................................. 66, 265
Emin Kürekçi.................................................28
Emre Tekgündüz......................................... 209
Engin Akgül................................................ 356
Ercüment Ünlü...............................................78
Erden Atilla............................................. 41, 53
Erdoğan Işıkman............................................66
Erdoğan Nohuz........................................... 259
Eren Yağcı.................................................... 187
Ergun Karaağaoğlu...................................... 311
Eriko Ogusa................................................. 196
Erman Ataş.................................................. 265
Esin Aktaş Çetin.......................................... 202
Esin Çevik................................................... 363
Esra Sarıbacak Can.........................................74
Esra Turan Erkek...........................................81
Esra Yıldızhan............................................. 273
Evren Üstüner............................................. 159
Eylem Eliaçık...................................... 119, 281
Eyüp Naci Tiftik.......................................... 273
Fahri Şahin.................................................. 273
Farja Al Gahtani.......................................... 112
Fatih Beşışık................................................ 257
Fatih Büyükcam.............................................48
Fatih Erbey.................................................. 265
Fatma Deniz Sargın........................................94
Fatma Gümrük ................................. 21, 72, 86
Fatma Yıldırım................................................34
Fehmi Hindilerden...................................... 257
Fehmi Tabak........................................ 216, 304
Feride İffet Şahin......................................... 320
Ferit Avcu.......................................................28
Fevzi Altuntaş.............................................. 209
Feyzullah Akyüz.......................................... 168
Fezan Mutlu................................................ 127
Filiz Şimşek Orhon..................................... 163
Fumiko Tanaka........................................... 331
Fuminori Iwasaki........................................ 331
Gamze Durgun............................................ 209
Garip Şahin.................................................. 293
Gökçe Pınar Reis......................................... 263
Göknur Yorulmaz........................................ 293
Gönül Oktay...................................................56
Gül İlhan........................................................56
Gülcihan Özek............................................ 346
Gülden Yılmaz....................................... 41, 102
Gülen Sezer Alptekin Erkul........................ 356
Gülsan Türköz Sucak.....................................34
Gülsan Yavuz..................................................66
Gülsüm Pamuk...............................................78
Gülsüm Yazıcı................................................71
Gülsün Karasu............................................. 265
Gülşah Kaygusuz......................................... 159
Gülşen Hasçelik........................................... 311
Gülyüz Öztürk............................................ 265
Güngör Utkan............................................. 248
Günhan Gürman............................................41
Günnur Deniz............................................. 202
Gürsel Güneş....................................... 281, 286
H. Haluk Akar............................................. 339
Hacer Aktürk............................................... 244
Hadil A. Al Otair......................................... 112
Hakan Göker............................... 119, 281, 286
Hakan Özdoğu............................................ 320
Hakan Savlı.......................................................8
Haldun Öniz................................................ 265
Hale Ören...................................... 84, 170, 265
Haluk Deda.....................................................66
Haluk Demiroğlu......................... 119, 281, 286
Hamdi Akan.................................... 41, 53, 102
Handan Güleryüz...........................................84
Harika Okutan................................................74
Harish Chandra........................................... 167
Hasan Mücahit Özbaş.................................. 135
Heiwa Kanamori.......................................... 196
Henu Verma................................................. 365
Hiroaki Goto............................................... 331
Hiromi Kato................................................. 331
Hossam A.H. Abdelrazik............................. 112
Hrishikesh Mishra....................................... 365
Hüseyin Yaman..............................................75
Hyeon Gyu Yi.............................................. 223
Itır Şirinoğlu Demiriz.................................. 209
Ivana Milosevic............................................ 353
İbrahim Celalettin Haznedaroğlu......... 60, 119,
..................................................... 261, 281, 286
İbrahim Eker .................................................28
İbrahim Keser........................................ 71, 107
İbrahim Öner Doğan................................... 257
İbrahim Sarı................................................. 141
İlhami Berber............................................... 273
İlhan Ünlü......................................................75
İlkay S. İdilman .............................................21
İlker Devrim................................................ 346

33 rd Volume Index / 33. Cilt Dizini
AUTHOR INDEX - YAZAR DİZİNİ 2016
İlker İnanç Balkan............................... 216, 304
İpek Kıvılcım Oğuzülgen...............................34
İpek Yönal Hindilerden......................... 94, 257
İrfan Kuku................................................... 156
İrfan Yavaşoğlu.................... 166, 187, 273, 368
İsmail Balık.....................................................41
İsmail Haluk Gökçora....................................66
İsmail Sarı.................................................... 273
İsmail Yaşar Avcı ...........................................28
İsmet Aydoğdu............................................ 156
Jameela Sathar................................................15
Jane E. Salmon..................................................1
Jianguo Hao................................................. 180
Jingyi Wang................................................. 180
Joo Han Lim................................................ 223
Kadir Acar........................................... 164, 281
Kavana Rao.................................................. 358
Kemal Aydın...................................................48
Kenan Keven............................................... 159
Kenji Matsumoto......................................... 196
Koji Sasaki................................................... 331
Koray Ceyhan.................................................66
Kutay Sarsar................................................ 244
Kürşad Öneç................................................ 362
L. V. K. S. Bhaskar........................................ 365
Lai Kuan Teh..................................................15
Laura Scaramucci...........................................77
Leylagül Kaynar........................................... 273
Lilia M. Sklyarenko..........................................8
Logeswaran Muniandy...................................15
Luisa De Simone.......................................... 259
M. Akif Yeşilipek................................. 107, 265
M. Cem Ar................................................... 216
Maël Albaut................................................. 259
Maha Abdullah...............................................15
Mahmut Subaşı............................................ 263
Manolya Acar.............................................. 244
Marco Giovannini..........................................77
Maria Haroon.............................................. 131
Masakatsu D. Yanagimachi.......................... 331
Masanobu Takeuchi.................................... 331
Mashael Al Shaikh....................................... 112
Massimiliano Palombi....................................77
Mayu Ishibashi............................................ 331
Meera Sikka................................................. 358
Mehdi Ghasemi........................................... 286
Mehmet Ali Erkurt...................................... 273
Mehmet Ali Özcan...................................... 273
Mehmet Ali Sungur..................................... 273
Mehmet Ali Uçar......................................... 273
Mehmet Gündüz........................... 41, 251, 286
Mehmet Hilmi Doğu........................... 254, 273
Mehmet Özen........................................ 41, 356
Mehmet Sezgin Pepeler............................... 168
Mehmet Sönmez.......................................... 135
Mehmet Yılmaz........................................... 141
Mehran Karimi............................................ 355
Mei I Lai.........................................................15
Melih Aktan......................................... 202, 335
Meliha Nalçacı................................................94
Melike Sezgin Evim..................................... 326
Meral Beksaç................................................ 251
Mesut Ayer.................................................. 335
Metin Uyanık .................................................28
Michael P. Zavelevich ......................................8
Mili Jain....................................................... 349
Mine Durusu Tanrıöver............................... 311
Mine Düzgöl................................................ 346
Mine Hekimgil................................................79
Mithat Haliloğlu ............................................21
Moon Hee Lee............................................. 223
Mrinalini Kotru........................................... 358
Mualla Çetin................................................ 236
Muhammed Evvah Karakılıç..........................48
Muhammet Maden.........................................78
Muhit Özcan.......................................... 41, 273
Murat Akova................................................ 311
Murat Albayrak..............................................74
Murat Duman.................................................84
Murat Elli.................................................... 265
Murat Sezak....................................................79
Murat Sütçü................................................. 244
Murat Yıldırım............................................. 273
Musa Karakükcü......................................... 265
Mustafa Merter.................................... 251, 273
Mustafa Ünübol........................................... 187
Muşturay Karçaaltıncaba ...............................21
Mutlu Arat................................................... 363
Mücahit Yemişen................................. 216, 304
Müge Aydoğdu...............................................34
Müge Sayitoğlu............................................ 172
Mümtaz Yılmaz..............................................79
Münci Yağcı................................................. 231
Na He........................................................... 180
Nabeel Khan Afridi...................................... 131
Naci Çine..........................................................8
Nadir Ali...................................................... 131
Nahide Konuk................................................41
Naila Raza.................................................... 148
Namık Kemal Altınbaş................................ 159
Nazan Özsan..................................................79
Neha Chopra Narang.................................. 358
Nejat Akar..................................... 56, 163, 261
Nergiz Erkut................................................ 135
Nesimi Büyükbabani................................... 360
Neslihan Andıç............................................ 187

Turk J Hematol 2016;33:323-328
33 rd Volume Index / 33. Cilt Dizini
AUTHOR INDEX - YAZAR DİZİNİ 2016
Füsun Özdemirkıran et al. IL-18 Polymorphisms in CML and CLL Patients
Neslihan Erdem........................................... 156
Neşe Saltoğlu....................................... 216, 304
Nilay Ermantaş............................................ 135
Nilgün Işıksaçan.......................................... 202
Nilgün Sayınalp........................... 119, 281, 286
Nur Efe İris.................................................. 363
Nuran Ahu Baysal....................................... 168
Nuran Salman.............................................. 244
Nurdan Köktürk.............................................34
Nurdan Taçyıldız................................... 66, 265
Nuri Bayram................................................ 346
Nursel Çalık Başaran................................... 311
Oğuz Bilgi.................................................... 153
Oğuzhan Erol.............................................. 168
Olga Meltem Akay............... 127, 187, 273, 293
Onur Esbah......................................... 209, 362
Onur Özhan................................................ 156
Oral Nevruz................................................. 273
Osman İlhami Özcebe................. 119, 281, 286
Osman İlhan...................................................41
Osman Yokuş............................................... 254
Ozan Salim.................................................. 273
Ömer Özden...................................................84
Ömer Uluoğlu................................................66
Ömür Kayıkçı.............................................. 209
Önder Arslan..................................................41
Özden Altıok Clark..................................... 107
Özgür Demir............................................... 360
Özgür Mehtap............................................. 273
Özlem Genç................................................. 356
Özlen Bektaş................................................ 119
P. K. Khodiar................................................ 365
P. K. Patra..................................................... 365
Panagiotis Anagnostis....................................88
Paolo de Fabritiis............................................77
Pasquale Niscola.............................................77
Pervin Topçuoğlu...........................................41
Pınar Tarkun............................................... 273
Pushpinderdeep Kahlon.............................. 299
Rafet Eren.................................................... 254
Rahşan Yıldırım........................................... 273
Ramis Ufuk Akkoyunlu....................................8
Rashmi Kushwaha....................................... 349
Rauf Haznedar............................................. 231
Recep Öztürk....................................... 216, 304
Reo Tanoshima............................................ 331
Reşat Özaras........................................ 216, 304
Rıza Aytaç Çetinkaya .....................................28
Ryosuke Kajiwara........................................ 331
Saba Kiremitçi............................................. 159
Safiye Koçulu............................................... 363
Saleem Ahmed Khan................................... 131
Salih Aksu.................................... 119, 281, 286
Salih Subari.................................................. 141
Sarita Pradhan..................................... 351, 368
Savaş Kansoy............................................... 265
Sebahattin Yılmaz ..........................................28
Seda Aydın................................................... 286
Seda Balaban................................................ 281
Selim Ay....................................................... 335
Selma Ünal.....................................................56
Sema Anak................................................... 244
Sema Karakuş.............................................. 320
Semih Alpsoy............................................... 286
Seniz Öngören............................................. 304
Serap Aksoylar............................................. 265
Serap Karaman............................................ 244
Serdar Öztuzcu............................................ 141
Serkan Abacıoğlu............................................48
Serkan Aktürk............................................. 159
Serkan Güvenç............................................ 363
Serkan Tapan .................................................28
Serpil Delibaş..................................................71
Sevgi Başkan................................................ 163
Sevgi Gözdaşoğlu...........................................66
Sevgi Kalayoğlu Beşışık......................... 81, 257
Seyhan Türk................................................ 286
Sezaneh Haghpanah.................................... 355
Sezgin Etgül................................. 119, 281, 286
Shahzaib Nabi.............................................. 299
Shan E. Rauf................................................ 131
Sharif Kullab................................................ 259
Shin-ichi Tsujimoto.................................... 331
Shumpei Yokota.......................................... 331
Sibel Işlak Mutcalı....................................... 304
Simge Erbil.....................................................79
Sinan Erkul.................................................. 356
Sinem Civriz Bozdağ................................... 209
Smeeta Gajendra......................................... 367
Smita Chandra............................................. 167
Soner Sertan Kara........................................ 263
Soner Yılmaz .................................................28
Sophia Vakalopoulou.....................................88
Stella V. Koval...................................................8
Suzan Çınar................................................. 202
Süreyya Bozkurt.................................... 60, 119
Syed M. Khurshid........................................ 112
Şahika Zeynep Akı.........................................34
Şebnem Yılmaz Bengoa................. 84, 170, 265
Şeniz Öngören............................................. 216
Şerife Kocubaba........................................... 209
Şerife Medeni Solmaz.................................. 273
Şinasi Özsoylu................................................83
Şiyar Erdoğmuş........................................... 159
Şule Öztürk Sarı.......................................... 360
Şule Ünal................................................. 72, 86

33 rd Volume Index / 33. Cilt Dizini
AUTHOR INDEX - YAZAR DİZİNİ 2016
Şükrü Atakan................................................286
Tahereh Zarei.............................................. 355
Taner Demirer................................................41
Tayfur Toptaş..................................................56
Tekin Aksu.................................................. 263
Teoman Soysal..................................... 216, 304
Thomas Stavrakis...........................................88
Tiraje Celkan..................................................56
Tomoko Yokosuka....................................... 331
Tuba Hilkay Karapınar................................ 346
Tuğçe Bulakbaşı Balcı.................................. 320
Tuğçe Kütük................................................ 248
Tuncay Aslan....................................... 281, 286
Turan Bayhan.................................................86
Tülay Özçelik.............................................. 363
Tülin Düger................................................. 236
Tülin Fıratlı Tuğlular.................................. 273
Türkan Patıroğlu......................................... 339
Türker Bilgen........................................ 71, 107
Tze Yan Lee....................................................15
Uğur Muşabak................................................28
Uğur Şahin................................................... 251
Uma Shankar Singh..................................... 349
Ural Kaya........................................................48
Ülker Koçak................................................ 265
Ümit Yavuz Malkan............................. 281, 286
Ünsal Han.......................................................74
Vefki Gürhan Kadıköylü............................. 187
Vesile Yıldız Kabak...................................... 236
Vibha Gupta................................................ 167
Vildan Çiftçi...................................................71
Viroj Wiwanitkit......................................... 370
Volkan Hazar............................................... 265
Vural Kesik.................................................. 265
Wataru Yamamoto....................................... 196
Xavier Durando........................................... 259
Yahya Büyükaşık................... 60, 119, 281, 286
Yahya Çelik.....................................................78
Yasemin Ardıçoğlu...................................... 261
Yasemin Işık Balcı...........................................72
Yavuz Yakut................................................. 236
Yelda Dere......................................................79
Yeşim Oymak......................................... 56, 346
Yıldız Aydın................................................. 304
Yılmaz Ay..................................................... 346
Yonca Eğin................................................... 163
Yoshiaki Ishigatsubo.................................... 196
Young Hoon Park........................................ 223
Yunus Kasım Terzi...................................... 320
Zafer Başlar.......................................... 216, 304
Zafer Gülbaş................................................ 127
Zafer Koç..................................................... 320
Zahit Bolaman............................................. 368
Zehra Narlı Özdemir................................... 251
Zerrin Yılmaz Çelik..................................... 320
Zeynel A. Sayıner........................................ 141
Zeynep Arzu Yeğin.........................................34
Zeynep Karakaş........................................... 244
Zeynep Kendi Çelebi................................... 159
Zeynep Öztürk............................................ 107
Zeynep Topkarcı.......................................... 360
Zohair A. Al Aseri........................................ 112
Zohreh Zahedi............................................. 355
Zübeyde Nur Özkurt............................. 34, 231
Zühre Kaya.................................................. 265

Füsun Özdemirkıran et al. IL-18 Polymorphisms in CML and CLL Patients Turk J Hematol 2016;33:323-328
382