Adventure 234

adventure
where actions speak louder than words
where actions speak louder than words
SCALING
EVEREST
"WITH A
LITTLE HELP
FROM
MY FRIENDS"
ISSUE 234
OCT/NOV 2022
NZ $10.90 incl. GST

time to get busy
The effects of global warming will effect us all at some stage
Even when we really try not to be, we are, by nature, selfish
creatures. At our core belief, the instinct of fight or flight is what
has kept us as species alive; there was never an option to give up
and be eaten. But there really is a third option: just ignore it, and it
might go away.
I consider myself a pretty good citizen; they ask us not to speed, I
don’t speed; they ask us to wear a mask, I wear a mask; they ask
us to get vaccinated, and I get vaccinated. But when it comes to
the more significant worldwide issues I can be a little savoir-faire.
Sure, I say the right words or nothing, but if it does not affect me,
then it tends not to mean too much to me.
For example, global warming or climate change, I know it’s been a
hot topic for a while, but it didn’t really worry or affect me – excuse
the weather analogy, but I considered it a bit of a storm in a teacup.
Now that ‘teacup storm’ has spilt over into my saucer.
Enter selfish Steve...
In June this year, we moved to the Central Plateau to ski,
tramp and fish during the winter season. What was evident
from basically day one was how warm it was. We had a nice
early dump of snow, and everything for Ruapehu seemed to be
on track; covid was behind us, lockdowns a thing of the past
and snow was now on the slopes. But with unusually warm
winds blowing in from Australia, which we get sometimes but
not as consistently as this year, weather patterns that had
historically bought snow to the mountain instead bought rain and
continuously washed off whatever snow managed to stick to the
slopes on the chillier days.
Some years we have had a very early dump of snow in May;
everyone since has had expectations of the ski season starting
with everything open, but as it drags out slow to fully open, as it
often does, the optimists among us always maintain - its winter
and snow will come - in 2022 it really didn’t. With Ruapehu
not getting its usual allocation of good snow in 2022, maybe
not be under the banner of global risk; but when you squeeze
past the conspiracy theorist and start looking at global warming
phenomena, there are a lot of bright people making a lot of loud
noises that we should be taking note of.
For every consequence of global warming in 2022, it seems to be
some of the worst in recorded history!
• Sea level will rise by 1-8 feet by 2100
• Weather will become more intense
• Long wildfire season. - Nearly 660,000 hectares of European
are the worst in recorded history
• More intense droughts - As in China right now, the worst in
recorded history.
• Global temperature will continue to rise; 2022 was the 6th
warmest year in recorded history.
• Unexpected heat waves -This year's European heatwave
was the highest on record, with temperatures over 40
degrees.
• Flooding in Pakistan was the worst in recorded history
• Melting glaciers
That brings us back to our internal instinct for survival ‘fight
or flight’. There is nowhere to fly to; we are all stuck here, so
that leaves us to fight. The first punch to be thrown should be
awareness, and we will at Adventure do our best in coming issues
to look at some of these implications, opinions and how we can
affect the future.
In my google browsing, one quote stood out to me, and that was
by Barak Obama.
“We are the first generation to feel the effect of climate change
and the last generation who can do something about it.”
Barack Obama, Former US President
Its time to get busy
Steve Dickinson - Editor
your Adventure starts with Us
23 Locations Nationwide | www.radcarhire.co.nz | 0800 73 68 23 | adventure@radcarhire.co.nz

page 12
Image by Lauren Murray Image by Eric Skilling
Image by Derek Cheng
page 18
page 24
contents
12//The Joys and Pains of Danger Walking
by Derek Cheng
18//Exploring Arthurs Pass National Park
By Eric Skilling
24//Billion Star Overnight Stays
Eric shares his top camping spots
26//On Thick Ice
Ash Routen explores the frozen surface of Lake Baikai
32//Big Pine Lakes
By Paige Hareb and Lauren Murray
38//Focus on Ruapehu Region
• Paddle the Whanganui Journey
• Taranaki Falls
• The Northern Circuit
70//Expanding Horizons
Matt Butler goes exploring with a rod in hand
76//Adventure Travel
• Samoa
• Rarotonga
• Tahiti
• Vanuatu
plus
50. gear guides
93. active adventure
FOLLOW US ON
www.facebook.com/adventuremagnz
adventuremagazine
www.adventuremagazine.co.nz
Nzadventuremag
JOIN THE CONVERSATION
#ADVENTUREMAGAZINE
Image by WSL
page 82
EDITOR & ADVERTISING MANAGER
Steve Dickinson
Mob: 027 577 5014
steve@pacificmedia.co.nz
ART DIRECTOR
Lynne Dickinson
design@pacificmedia.co.nz
SUBSCRIPTION ENQUIRIES
subscribe at www.pacificmedia-shop.co.nz
DISTRIBUTION
Ovato, Ph (09) 979 3000
OTHER PUBLICATIONS (HARDCOPY AND
ONLINE)
www.adventuremagazine.co.nz
www.adventuretraveller.co.nz
www.adventurejobs.co.nz
www.skiandsnow.co.nz
@adventurevanlifenz
PUBLISHERS
NZ Adventure Magazine
is published six
times a year by:
Pacific Media Ltd,
11a Swann Beach Road
Stanmore Bay
Whangaparaoa, New Zealand
Ph: 0275775014
Email: steve@pacificmedia.co.nz
advertising rates, demographic
and stats available on request
Contributions of articles and photos are welcome and must be accompanied by a stamped self-addressed envelope. Photographic
material should be on slide, although good quality prints may be considered. All care is taken but no responsibility accepted for
submitted material. All work published may be used on our website. Material in this publication may not be reproduced without
permission. While the publishers have taken all reasonable precautions and made all reasonable effort to ensure the accuracy of
material in this publication, it is a condition of purchase of this magazine that the publisher does not assume any responsibility or
liability for loss or damage which may result from any inaccuracy or omission in this publication, or from the use of information
contained herein and the publishers make no warranties, expressed or implied, with respect to any of the material contained herein.

we ARE tramping
Adelaide Tarn
Kahurangi National Park
Photo: Mark Watson
Whether it’s a day trip with the family or a multi-day adventure deep into the wilderness, Bivouac has the best
gear, from the top brands, to keep you safe, comfortable, warm and dry. Our friendly staff are happy to provide
expert advice, ensuring you get the right equipment and the right fit. If you need it for tramping, we have it,
because at Bivouac Outdoor we ARE tramping.
Supporting Aotearoa's Backcountry Heritage
STORES NATIONWIDE
www.bivouac.co.nz

BEHIND THE COVER...
SCALING
EVEREST
"WITH A
LITTLE HELP
FROM MY
FRIENDS"
Former British soldier and mountaineer,
Hari Budha Magar, is calling on the
climbing community to help him prove that
disability is not a barrier as he attempts
to become the world’s first double abovethe-knee
amputee to climb Everest.
Having served in the British Army’s
Ghurka regiment for 15 years, Hari
turned to mountaineering in 2016 as part
of his recovery having lost both legs in
Afghanistan in 2010 after an Improvised
Explosive Device (IED) exploded while on
patrol.
In preparation for his Everest attempt,
Hari has already been the first double
above knee amputee to climb the Mera
Peak (6,476m); Ben Nevis, trek to Everest
Base Camp, climb Mt Toubkal (4,167m),
and climb Chulu Far East (6,058m).
Hari will take on the world’s tallest
mountain in May 2023 – making history
as the first double above the knee
amputee to do so.
Through his expedition, Hari hopes
to inspire veterans, and others with a
disability, to realise that ANYONE can
achieve their dreams, no matter how big
or impossible they may seem.
To attempt the Everest summit, Hari
needs to raise over £300,000.
To help reach this monumental target,
Hari has launched a Crowdfunder
campaign and is calling on the climbing
community to support his expedition.
“Everest is my ultimate challenge,” said
Hari.
“The human body is just not designed to
operate at that altitude. But add to that my
challenges with mobility and speed, and
there is a whole new layer of difficulty.
“It’ll take me longer than able bodied
climbers, so I’m resigned to the fact that
I’ll be starting earlier and finishing later.
We’ve also planned two extra camps if
they are needed.
“That means more kit, and a greater risk
for all of us on the mountain – so we are
planning out every detail.”
The 43-year-old from Canterbury is being
trained by, and climbing with, Krishna
Thapa, former Chief Mountain Instructor
at the SAS and world-renowned climber,
and Hari now has 9 months to prepare for
the ultimate summit attempt in May 2023.
With reduced mobility, Hari uses three
times more energy than the average
climber, with Everest expecting to take
him three times longer than an ablebodied
mountaineer.
He will climb to the 8,848.86m (29,029ft)
summit of Everest across the South Col
route from Nepal, negotiating some of
the world’s toughest mountaineering
conditions.
Cutting-edge equipment and technology
will be important, but this is a true test of
Hari’s human limits, both physical and
mental.
Hari added: “From specially designed
crampons to the heated sockets around
my stumps and the short prosthetic
legs I’ll be using for the climb – we are
developing new technologies that will
allow me to climb Everest.
“But it’s much more than that, everything
needs to be adapted to get me onto the
mountain right down to made to measure
clothing.”
In 2018, Hari joined forces with other
climbers and disability charities to
successfully overturn a ban on double
amputees and the visually impaired from
climbing Everest at the Supreme Court in
Nepal.
“It’s already been an adventure getting to
this point, but through the climb I hope we
can positively transform the way people
with a disability are perceived, and how
they perceive themselves,” Hari added.
Krishna Thapa, who is not only Hari’s
climbing and expedition leader, but has
also been training with Hari since 2016,
said: “I’ve worked with some tough guys
in my time, but Hari is up there with the
toughest.
“If he puts his mind to a task, you are
damn sure that he’s going to give it every
fibre of his being to get the job done.
“There are no words to describe
the monumental challenge that he’s
undertaking, but we’ll be there every step
of the way – and this time next year I can’t
wait to share that special moment with
Hari on top of the world.”
To support Hari’s Everest expedition, visit:
www.crowdfunder.co.uk/p/harieverest
4//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

Image by Andy Bate
www.andybate.com

PATAGONIA
EARTH IS NOW
OUR ONLY
SHAREHOLDER
All images thanks to Patagonia
Over fifty years ago, Yvon Chouinard started Patagonia, as a
climber more than a businessman, he developed a massive
international clothing and accessory company. In those fifty
years, Patagonia has become one of the most respected and
environmentally responsible companies on earth.
This week Chouinard made the most significant commercial
move in the adventure industry history!
Chouinard, his wife and two adult children have reassigned
their ownership of Patagonia and relinquished it, a value of
about three billion dollars, to a trust called Patagonia Purpose
Trust and a non-profit organisation called Holdfast Collective.
These trusts have been created to ensure that the $100
million-plus of Patagonia’s yearly profits are used to combat
climate change and protect undeveloped land worldwide.
Chouinard has given his company away to the betterment of
the planet.
I have been a fan of Yvon Chouinard since reading his
book "Let My People Go Surfing: The Education of a
Reluctant Businessman", written in 2005. Patagonia,
as a brand, has constantly led the way in environmentpositive
based products and has a loud voice regarding
political issues that affect the environment.
From a piece in the New York Times by David Gelles:
"In some ways, the forfeiture of Patagonia is not
surprising coming from Mr Chouinard. As a pioneering
rock climber in California's Yosemite Valley in the 1960s,
Mr Chouinard lived out of his car and ate damaged cans
of cat food that he bought for five cents apiece. Even
today, he wears raggedy old clothes, drives a beat-up
Subaru, and splits his time between modest homes in
Ventura and Jackson, Wyo. Mr Chouinard does not own
a computer or a cell phone.”
The handing over of the family fortune is not outside of
Chouinard’s long-standing disregard for how the world
does business and his evident love and support for the
world’s environment.
"We are going to give
away the maximum
amount of money
to people who are
actively working on
saving the planet.”
At age 83, Chouinard said, "we are going to give away
the maximum amount of money to people who are
actively working on saving the planet.”
He also said in a recent interview.
‘Hopefully, this will influence a new form of capitalism
that doesn’t end up with a few rich people and a bunch of
poor people.”
The 3-billion-dollar handover was not cheap; the money
was deemed a gift by the US tax department, and that
gift came at the cost of 17.5 million!
6//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

THE ORTLES FAMILY
RELY ON YOUR BEST FRIENDS
ORTLES ASCENT MID GORE-TEX® BOOT
BOBO.CO.NZ/SALEWA

The founder of Patagonia, Yvon Chouinard
Before that handover, Patagonia already donated $50 million
to the Holdfast Collective and will provide another $100 million
this year, making Holdfast already one of the biggest influences
in climate change and global warming.
Succession, for any significant business, is often a headache,
especially if you have been at the forefront of environmental
change, which has been a hardcore foundation of Patagonia.
Chouinard’s children, now in their forties, did not want to take
over the company. Chouinard has an out-spoken view of the
stock market and making a business public, so the gifting of the
3-billion-dollar ownership and the 100 million-a-year profit is a
natural solution for the man that is Yvon Chouinard.
“I didn’t know what to do with the company because I didn’t
ever want a company,” he said. “I did not want to be a
businessman. Now I could die tomorrow, and the company will
continue doing the right thing for the next 50 years, and I do not
have to be around.”
The company has given away 1 per cent of its sales for years
to environmental groups. Recently, the company has become
more politically active, even raising a lawsuit against the Trump
administration to successfully protect the Bears Ears National
Monument San Juan County in South-Eastern Utah.
People like what Patagonia stands for and have continued to
purchase the brand even though it costs more; Patagonia’s
sales continue to soar.
But as Chouinard's net worth continues to climb, it is something
that he is openly uncomfortable about as he is vocal re the rich
and excessive wealth. He said in a recent interview. "I was in
Forbes magazine listed as a billionaire, which pissed me off,”
he said. “I do not have $1 billion in the bank. I do not drive a
Lexus.”
Now that the pathway for Patagonia as a company is clear,
with noble objectives of both being a profitable company and
investing those profits solely in tackling climate change and
environmental issues. However, the question remains, will
Patagonia survive without Chouinard’s driving force and the
unusual situation of the profit going directly into the trusts?
"Instead of “going public” you could
say we’re “going purpose”. Instead
of extracting value from nature and
transforming it into wealth for investers,
we’ll use the wealth Patagonia creates to
protect the source of all wealth."
For Chouinard, this gifting of the company to a trust and a
non-profit organisation is a typically ‘Patagonia’ unique way of
approaching complex issues. This situation, whether successful
or not, will ensure the company profits will continue to be put
to beneficial use. It also resolves the question of what will
happen to Patagonia after its founder is gone, ensuring that the
company's profits will be put to work protecting the planet.
Mr Chouinard summed it up by saying. "I feel relief that I've put
my life in order.”
Will this ‘’gifting of success’’ back to the planet be an example
to others? I guess we will have to wait and see, but if history
has shown us anything regarding Patagonia and its success, it
is that as a moral innovator, Patagonia has motivated a whole
industry since its inception – Chouinard’s legacy maybe is more
than just his contribution.
We will leave you with words from the man himself…
“It’s been nearly 50 years since we began our experiment
in responsible business, and we are just getting started. If
we have any hope of a thriving planet – much less a thriving
business – 50 years from now, it’s going to take all of us doing
what we can with the resources we have. This is another way
we’ve found to do our part.
Despite its immensity, the Earth’s
resources are not infinite, and it’s clear
we’ve exceeded its limits. But it’s also
resilient. We can save our planet if we
commit to it.”
8//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

DISCOVERED
UNDER ICE.
SERVED
OVER ICE.
#OpenForAdventure
TheShackletonWhisky.com
Please enjoy Shackleton responsibly

BOULDER BASH
‘SEE NO EVIL ROUTES, HEAR NO EVIL BETA, SPEAK NO NEGATIVITY’
By Zane Bray
AUCKLAND’S BOULDERING SCENE IS BLOWING UP!
Auckland’s seeing a massive resurgence in social boulder
competitions this year in the post covid environment, with the
Auckland Boulder series leading the charge, building up to
the National Indoor Boulder Series, and culminating in the
phenomenal next level annual Northern Rocks Boulder Bash.
On 2nd July Northern Rocks opened their doors to the Boulder
Bash community competition. The stoke was high, the boulders
were fresh and the prize pool was over stacked. It was a perfect
storm of super awesomeness.
Sarah Hay, Northern Rocks Director and General Manager
was the main instigator and team leader, managing juggling a
runaway dog, hungry baby and hundreds of people scrambling
over the walls with aplomb. The MC’ing went to Zahnay (Zane
Bray) the word maker with more energy than Red bull, V and
Monster energy put together. Zane brought high energy to the
MC role, couldn’t read his own handwriting, talked so much the
PA system died, and delivered the hype.
Zane represents the Aotearoa Climbing Access Trust (ACAT)
events team. ACAT.org.nz is a not for profit trust set up to
help gain, maintain, and sustain access to our amazing
outdoor climbing areas with some massive wins lately that
would not have happened if it weren’t for the support of our
sponsors recurring donors in the climbing community, signing
up to support ACAT with as little as $5 a month (more would
be better!) goes a long way to ensure they can keep going.
Northern Rocks is proud to be ACAT’s first corporate sponsor
and looks forward to working together with ACAT this year on
events and initiatives to keep NZ crags open.
Before kicking things off, Zane had competitors put a hand on
their heart and recite the boulderers pledge from the Castle hill
climbing guide bible, with words along the lines of ‘I will See
no evil routes, hear no evil beta, speak no negativity’ or was it
‘Lo, though I walk through the valley of boulders, I shall fear no
route…’
Then it was GO time, participants rushed off to get in the
first send of the day, DJ dynamic duo Movr&Shkr and Almita
dropped the phat beats, everyone racing to get scores on their
sheets, people were climbing, boogieing, shouting support,
sharing beta, making friends, shredding skin and falling all over
the mats. There were fist bumps, laughter, worn skin, fails and
many sends.
The boulders the Northern Rocks team delivered were not
all straight forward, there was a lot of skill required to wrestle
and wrangle your way through the world class setting from the
Northern Rocks setting team, with James FM and Wiz Fineron
creating some stellar magic on the finals routes.
Check out @northernrocks.climbing on Instagram to see their
time lapse video of the comp and some of the rad routes on tap.
As always, Eddie Fowke, world class photographer from the
Circuit climbing was there, snapping all the amazing pictures
you see here.
None of this would be possible without the help of our fantastic
sponsors, Rab Equipment, Mountain Adventure, Southern
Approach, Bivouac Outdoor, Musashi, Off Piste, Bootleg Jerky,
Fergs Kayaks Auckland, Adventure Magazine, Cx3 Chalk Bags
and Northern Rocks.
“Northern Rocks is an indoor bouldering
facility, we foster community, growth
and positive experiences for people of all
backgrounds, ages and abilities.”
World Class Indoor Climbing
First visit $25* then free for a week!
Fantastic community, beginners
welcome, boulder classes for all ages
and abilities, inquire now.
* Discounts for youths and own gear
Student Mondays, entry $15
www.northernrocks.co.nz
@northernrocks.climbing
Unit 17, 101-111 Diana Drive,
Wairau Valley, Auckland | 09 278 2363

We are
the mountain
people.
e are
e mountain
ople.
Everything we make is designed by climbers,
Everything we make is designed by climbers,
for climbers. Each piece is crafted by peak
for climbers. Each piece is crafted by peak
and crag to give you absolute protection,
and crag to give you absolute protection,
comfort and mobility when you really need it.
comfort and mobility when you really need it.
WWW.RAB.EQUIPMENT
WWW.RAB.EQUIPMENT
Available now from Rab specialist stores throughout NZ.
Hunting And Fishing New Zealand Available stores nationwide. now from Auckland: Rab specialist Living stores Simply, throughout Waikato: NZ. Trek N Travel, Equip Outdoors,
Hunting And Fishing Taupo: New Outdoor Zealand Attitude, stores Wellington: nationwide. Dwights Auckland: Outdoors, Living Motueka: Simply, Waikato: Coppins Trek Outdoors, N Travel, Equip Outdoors,
Nelson: PackGearGo, Taupo: Outdoor Kaikoura: Attitude, Coastal Wellington: Sports, Christchurch: Dwights Outdoors, Complete Motueka: Outdoors, Coppins Greymouth: Outdoors, Colls Sports,
Nelson: PackGearGo, Hokitika: Wild Kaikoura: Outdoorsman, Coastal Wanaka: Sports, Christchurch: MT Outdoors, Complete Queenstown: Outdoors, Small Greymouth: Planet. Colls Sports,
Online: huntingandfishing.co.nz, Hokitika: Wild Outdoorsman, dwights.co.nz, Wanaka: outdooraction.co.nz, MT Outdoors, mtoutdoors.co.nz, Queenstown: Small smallplanetsports.com,
Planet.
Online: huntingandfishing.co.nz, equipoutdoors.co.nz, dwights.co.nz, gearshop.co.nz, outdooraction.co.nz, outfittersstore.nz
mtoutdoors.co.nz, smallplanetsports.com,
Distributed equipoutdoors.co.nz, by Outfitters 0800021732 gearshop.co.nz, www.outfitters.net.nz
outfittersstore.nz
Distributed by Outfitters 0800021732 www.outfitters.net.nz

THE JOYS
& PAINS OF
'DANGER -
WALKING'
Words and photos by Derek Cheng
‘Elbows out’ was the advice I’d been
given for climbing in the European Alps.
This wasn’t related to any particular
style of climbing, but rather what might
help get you to the base of your route
ahead of other climbers. Of the 60
people sardined into the 6.10am cable
car bin heading up the famous Aiguille
du Midi, in the Mont Blanc massif, up to
half of them tend to be climbers.
12//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

Chris Davis surveys the
terrain on the classic Cosmic
Arete, on Aiguille du Midi
in the French Alps, as well
as the several climbers
clogging the way.

Above: A climber negotiates Chèré Couloir, a steep ice gully on Mont Blanc du Tacul in the European Alps.
Right: Classic routes, such as Chèré Couloir, are often congested in Chamonix, France, and it's a race to get there first.
The ride is famous, taking you from 1035m
to 3777m above sea level in a scarcelybelievable
20 minutes. But instead of taking
in the dramatic views of the alps as you
ascend from the small township Chamonix,
France, climbers surreptitiously eyeball each
other while sneakily edging towards the
door.
Our objective was Chèré Couloir: a 155m ice
climb that rises from the snowy valley before
steepening to a narrow chute of 75 degree
ice. It’s rightfully described in the guidebook
as 'one of the busiest routes in Chamonix',
so it was with some nervousness that I
noted several climbers armed with what's
needed - two technical ice tools - to climb
Chèré.
I stiffened and widened my elbows, which
supposedly allows you to gain an inch on
your neighbour, as the bin arrived at the
top. The door opened to a flurry of climbers
bursting forth and running to the start of the
ridgeline, which guards access to the entire
mountain range.
There was no time for faffing. My climbing
partner Chris and I donned our crampons,
roped up, and launched onto the ridge. The
twin ice-tooled party was directly behind us
as we broke trail to the base of Chèré. But
it was my first time at this altitude in years
- the equivalent of Aoraki’s summit - and
with fresh snowfall to plough through, it took
some effort to stay in front. They followed us
all the way to the start of Chèré, and then
started climbing right behind us.
It was my first time ice climbing in years,
and it was fantastic to throw serrated ice tool
blades into the snow-covered ice. I soon
found my rhythm, but I was in a rush, not
wanting to hold up any of the climbers in our
wake.
Ice climbing below another party is
considered foolish because it’s asking to be
smashed in the face by falling ice. Not so in
Chamonix, where it’s apparently standard
etiquette to gang-bang classic routes,
regardless of the consequences; the team
behind us were already being pelted by
falling ice debris.
We made quick work of the climb, and
instead of plugging up the long snow-slope
to the top of the mountain, we decided to
abseil. This is also standard etiquette in
Chamonix, even with several climbers below
who were forced to dodge falling ropes as
we pulled them from abseil point to abseil
point. There were still eight climbers on the
route by the time we arrived back at the
base, with two more about to start.
It was only 11.30am, so we made our way
to another classic: Cosmic Arête. There
were, predictably, at least 20 climbers on it
by the time we got there. Most of the route
isn't too demanding so we climbed ropeless,
scrambling up chutes and crests of granite
while ducking in and around other climbers
and their ropes.
It’s the enviable infrastructure that enables
such access to these famous mountains.
The cable car takes thousands of people to
the top of the Midi everyday. For climbers,
it all but erases the long and arduous
approaches that most alpine climbing
requires.
"Ice climbing below
another party is
considered foolish
because it’s asking
to be smashed in
the face by falling
ice. Not so in
Chamonix, where
it’s apparently
standard etiquette
to gang-bang
classic routes,
regardless of the
consequences"
14//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

Above: Serenity greets a climber topping out a gendarme in the Central Darrans, northern Fiordland, with the Mt Revelation and
Taiaroa Peak on the left and Mts Underwood and Patuki on the right, above the Taoka Icefall.
The Midi gondola is only one of several in the Chamonix
valley. There’s one that takes you to the top of Le Brévent
(2525m), from where you actually walk downhill for 20
minutes to get to the base of the 300m-high rock climbs.
And the Flégère gondola and Index chairlift deposits you, at
2595m, at the base of the Aiguille Rouge range.
But this also transforms one the world’s best places for alpine
climbing into a complete cluster.
It couldn’t be more different in New Zealand, where it’d be
unusual to see other parties in the country’s best mountains
for alpine rock climbing. The Central Darrans, in northern
Fiordland, encompasses the peaks in the Te Puoho cirque,
as well as those surrounding Lake Turner, including the
ridgeline from Mts Patuki to Madeline. The area is gifted
with vertiginous and glaciated walls of hard rhyolite, which is
much more compact than the schist that dominates most of
the Southern Alps.
But getting there is a tad more challenging than standing
in a gondola bin for 20 minutes. Tales of extreme tramping,
known among Darrans climbers as ‘danger-walking’, is
enough to deter anyone from going there. A couple of friends,
for example, ended up taking their ropes and climbing gear
for a massive walk; they managed to get to the fabled bivvy
cave known as Turner’s Eyrie, but it took them two days and
several close shaves to get there, and they needed the third
day to rest before walking out on day four.
The best way in is a matter of debate, but they all invariably
involve snow and glacial travel, rock scrambling, and the
unique Darrans experience of near-vertical plant-pulling.
Our route - from the Lower Hollyford River to The Eyrie in
one push - was a 17-hour day: bush-bash up to Rainbow
Lake from the Hollyford valley, scramble over a col near Mt
Tuhawaiki, drop under Mt Taiaroa, gain and then negotiate
the Te Puoho Glacier to another col, ease nervously down a
tenuous slope known as Lindsay’s Ledges and, finally, cross
to the Karetai-Patuki col and stumble up the final stretch.
By the time we crawled into The Eyrie, etched into the
northwest side of Mt Karetai, it was 11pm. We were fried. My
climbing partner, Jimmy, only made it through half his dinner
before nodding off, still half-seated in his sleeping bag.
The rewards, though, are immediate. The Eyrie looks out
to the snow-capped towers of Tutoko and Madeline and the
rocky spire of Te Wera. We spent a week exploring, including
twice climbing a 300m-high cliff face, scrambling the south
ridge of Te Wera and the north ridge of Karetai, and reaching
the summit of Mt Underwood via the Taoka Icefall.
And all to ourselves. All I knew in the aftermath of the trip
was that I had to return to such a unique place - the country's
most exquisite, with infinite rock and adventure to be
sampled.
It also made me consider the pros and cons of a lack of
infrastructure. Part of the magic of the Central Darrans is
how empty and wild it is. It would be a completely different
experience if there was gondola access, and crowds of
climbers at the base of every rock wall.
But getting there is no picnic. One of New Zealand’s best
climbers told me he has no inclination to explore the area
because of the walk-climb ratio, as in, heaps of ‘dangerwalking’
and relatively little climbing. I didn’t really understand
until I was in Chamonix, where there are massive clusters of
climbers, but the ratio is flipped.
The advantages were never more starkly obvious than when
my climbing partner and I arrived at the south face of the Midi
one morning. Our stiff elbows had helped us to be the first
ones there, and we started unpacking our climbing gear just
as the sun’s first rays enveloped the tower of granite in front
of us.
My stomach turned nauseous, however, when I realised I’d
left my climbing shoes at home. I sprinted back up the snowy
ridge, took the gondola down, raced through town and up
a hill to our apartment, grabbed my shoes, barreled back
down the hill, and stood in a sweaty mess while catching an
ascending gondola bin.
Where else in the world can you rush home to retrieve a
forgotten item and be back at the base of a granite wall,
3700ish metres above sea level, within an hour?
16//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

Right: Jimmy Finlayson enjoying the
solitude of the Central Darrans on the
north ridge of Karetai Peak.
"Part of the magic
of the Central
Darrans is how
empty and wild
it is. It would
be a completely
different
experience if
there was gondola
access, and crowds
of climbers at the
base of every rock
wall. "

18//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

EXPLORING
ARTHURS PASS
NATIONAL PARK
Words and images by Eric Skilling
It’s taken several millennia of earthquakes and glacial
erosion to create the impressive landscapes of Arthurs
Pass National Park, making it a trampers paradise.
From expansively wide, rock-strewn valleys of the
Waimakariri, to gut-busting tracks up forested ridges
with the reward of expansive views of jagged peaks and
glaciers. Within a single day you can clamber up steep
and narrow paths through tranquil beech or podocarp
forests, take in epic views from the top of rocky peaks,
refreshing yourself with the ancient waters of ice-cold
glacial streams. Then cruise home on wide-river flats
alongside those crystal-clear rivers.
Glaciers up to 1,000 metres high have done some
serious and not very subtle sculpting here. Thankfully
several eras have passed since nature’s colossal
earthmovers retreated, allowing the rivers and streams
time to do their bit eroding the tops and depositing
thousands (perhaps millions) of rocks into those steep
valleys. This sets the scene for a huge variety of outdoor
challenges in a relatively small area.
ADVENTUREMAGAZINE.CO.NZ//19

Above: Beginning our descent from Carroll Hut. Far right: Emerging out of the bush with views of the Otira Gorge below.
Inserts: Clambering our the way to Carroll Hut / Stunning alpine bush surrounded Carroll Hut / Enjoying the warmth and comfort of Carroll Hut
Like all Alpine areas, you need to come
well prepared in terms of gear and fitness.
Back in the 90’s a group of us completed
the famous Minga-Deception track during a
cold weekend in late May. On that trip one
of our party hit the proverbial wall several
hundred metres short of the hut. We had to
split his gear amongst three of us and coax
him up the valley to the hut. Next day was a
slog out onto river flats in sleet which turned
to snow just as we reached the car park.
This trip was a complete contrast. We had
based ourselves in Arthurs Pass township
for 9 days over Christmas and New Year,
and even after a full week of exploring, I left
regretting we hadn’t planned a longer stay.
A day-walk to the top of Bealey Spur and
an overnight trip to Carroll hut are probably
two of the best and most contrasting
trips that will whet your appetite for more
adventurous trips in the park, such as
Avalanche Peak (see January issue –
“Decent to Crow valley – the scree slope
from hell”).
The Isolation of Carroll Hut
(3-4 hours each way)
If you find yourself standing on the Otira
lookout north of Arthurs Pass village, take
time to lift your gaze over the viaduct and
the ridges of the Barron Range to a small,
scooped hanging valley in the distance.
It’s heavily- forested headwall plummets
some 500 metres into the Otira Gorge
below. Looking closely, you can see the
tiny light brown spec of the 10-bunk Carroll
Hut looking isolated, frail and insignificant
against the magnificently rugged peaks
and steep glacial valleys surrounding it.
It is difficult to comprehend the contrast
between this track on the west and Bealey
Spur to the east. For starters the trail
begins with a river crossing which will test
the quality of boots and gaiters.
Gone was the wide meandering path of
Bealey Spur. At the start the narrow rocky
path is almost hidden by overhanging
shrubs and ferns which soon widens,
but also gets a lot steeper. For the next
few hours we scrambled, scaled and (for
some) swore our way up an endless series
of head-high (and higher) rocky or muddy
ledges, searching for hand and footholds.
The foliage was a dense mass of gnarled
podocarps with numerous other broadleaf
shrubs. A few sweaty hours later the
canopy above began to thin out, allowing
some sky to peak through. Mount Cook
lilies and daisies appeared on the side of
the narrow path as it widened and started
to traverse across the face of the ridge.
At this point we got our first views of the
spectacularly steep and narrow Otira
Gorge way below us and across the valley
to the Barron Range, it’s ridges scarred by
scree-slopes. The vegetation was steadily
changing again to a mix of snow tussock
and other alpine shrubs. Up ahead the
track disappeared into the occasional mist.
It was getting much cooler.
Carroll hut came into view, looking fragile
and isolated in the expanse of the cirque.
The surrounding peaks were barely visible
in a lumpy cloak of damp, swirling mist.
Painting the hut a creamy brown looked
like an attempt to make it blend in with
the rugged beauty of the tussock and bog
pine in the cirque. Instead, it seemed to
look more foreign and out of place with its
straight edges and dark framed windows.
Once inside it was a different story.
Sleeping bags were unpacked, gas
burners hissed, lunches, coffees and teas
made, and the banter and chatter began.
Outside the weather clagged in, and no one
mentioned anything of the original plans to
venture to the tarns and peaks behind the
hut. It was a pleasure to spend the rest of
the day in the cosy, spacious hut.
Next morning, the weather hadn’t exactly
cleared but the rain had moved on. The
group packed up and then several of us
rugged up in beanies and rain jackets and
walked over the ridge behind the hut and
20//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

Above: Beasley Hut before taking on the tops / Insert: Grace getting in touch with Aaron's beard
into the mists to try to find the tarns and
Kelly Saddle. About 15 minutes later we
were standing on the saddle where we
should have been able to see down to the
Taipo River valley. Instead, we stared into
the eddying mists in vain before turning
back and heading for the tarns.
The botanist in our group was like an
eccentric professor as she explored the
prolific variety of flowering plants that
survive in these unique environments.
A pair of nesting wren chirped their
annoyance at our invasion. You could only
wonder what they thought when one of
our group stripped down to her togs and
waded in for a quick dip. Crazy.
Eventually we moved on back to Carroll Hut,
picked up our packs and began the descent.
I don’t think our botanist noticed us leave.
This a short but quite challenging trip, but
an overnight stay at the hut is well worth
the effort. I believe the views are also
spectacular, but the mist never cleared
during our stay so I will have to wait until
after my next visit before I can comment.
Recovery on Bealey Spur
(4-5 hours return)
A few kilometres south of Arthurs pass
village, Bealey Spur offers awesome views
for the effort involved getting to the top.
Perfect as an introduction to the area, and
as a warm-up after that long lockdown. It is
an exception to the flat-or-steep-and-notmuch-in-between
rule. Mostly.
The track begins a with wide path that
makes a steady climb through native
beech forest. Most of the trees are well
spaced and only a few metres tall, with
plenty of groundcover. Mosses and lichens
such as Aaron’s beard are everywhere.
Thick pockets of manuka line several
clearings where you get to enjoy the wide
expanse of the Waimakariri valley. We
did get to enjoy the call of the occasional
bellbird and the company of a robin, but
birdlife is sparse.
Bealey Spur hut on the edge of the bushline
is worth a brief stop. This bright green
corrugated hut is full of character with
an earth floor, bunks made from wooden
beach-tree and sacking and a tin fireplace.
On our trip a young family had moved into
the hut, filled the shelves with a weeks’
worth of food, and were using it as a base
to explore the region. A great way for young
ones to experience the NZ wilderness.
Once past the hut the terrain changes to a
boggy tussock and bush slope which then
opens-up giving a full view of a towering
Bealey Spur above. At that point two of
our party took one-look at the steep track
ahead and threatened to bail. To be fair
it didn’t take much to persuade them to
continue onward.
We took our time, and it wasn’t long before
they were distracted by the views. The wide
spread of the Waimakariri valley below us
lined with those steep bush-clad ridges. Mt
Foweraker and Dome (1945m) dominated
the skyline to the east, but the landscape to
the west is far more impressive – the jagged
summits and ridges of Mt Bealey, Stewart
and Damfool (2030m) and Mt Rolleston
(2275m) dotted with pockets of ice and the
occasional small glacier.
Around midday we reached the rock cairn
a few hundred metres along the spur. A
perfect spot to take a break to enjoy the
views. I don’t think I would be out of line
saying that the two of our party who had
been intimidated by the climb were now
looking very pleased with themselves.
There is plenty of time for a quick diversion
to the Bealey Hotel on the way back, to
take in the priceless views from the lounge
and to enjoy a refreshing ale and perhaps
dinner – if you have booked.
With thanks to Backcountry Cuisine,
Jetboil, Macpac and Keen.
22//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

We are
the mountain
people.
Everything we make is designed by climbers,
for Everything climbers. we Each make piece is designed is crafted by by climbers, peak
and for climbers. crag to give Each you piece absolute is crafted protection, by peak
comfort and crag and to give mobility you absolute when you protection,
really need it.
comfort and mobility when you really need it.
WWW.RAB.EQUIPMENT
WWW.RAB.EQUIPMENT
Available now from Rab specialist stores throughout NZ.
Hunting And Fishing New Zealand Available stores now nationwide. from Rab Auckland: specialist Living stores Simply, throughout Waikato: NZ. Trek N Travel, Equip Outdoors,
Hunting And Fishing Taupo: New Outdoor Zealand Attitude, stores nationwide. Wellington: Auckland: Dwights Outdoors, Living Simply, Motueka: Waikato: Coppins Trek Outdoors, N Travel, Equip Outdoors,
Nelson: PackGearGo, Taupo: Outdoor Kaikoura: Attitude, Coastal Wellington: Sports, Christchurch: Dwights Outdoors, Complete Motueka: Outdoors, Coppins Greymouth: Outdoors, Colls Sports,
Nelson: PackGearGo, Hokitika: Kaikoura: Wild Outdoorsman, Coastal Sports, Wanaka: Christchurch: MT Outdoors, Complete Queenstown: Outdoors, Small Greymouth: Planet. Colls Sports,
Online: huntingandfishing.co.nz, Hokitika: Wild Outdoorsman, dwights.co.nz, Wanaka: outdooraction.co.nz, MT Outdoors, Queenstown: mtoutdoors.co.nz, Small smallplanetsports.com,
Planet.
Online: huntingandfishing.co.nz, equipoutdoors.co.nz, dwights.co.nz, outdooraction.co.nz, gearshop.co.nz, outfittersstore.nz
mtoutdoors.co.nz, smallplanetsports.com,
Distributed equipoutdoors.co.nz, by Outfitters 0800021732
gearshop.co.nz, outfittersstore.nz
www.outfitters.net.nz
Distributed by Outfitters 0800021732 www.outfitters.net.nz

#2
Old Man Hut, Mt. Richmond Forest Park (spot the campsite clearing in the background)
BILLION STAR
OVERNIGHT
STAYS
By Eric Skilling
Overnighting in 6-star hotels and resorts must be a memorable
occurrence, but I wouldn’t know. I do know about 5-star accommodation
thanks largely to a past life in the corporate world, but the funny thing is I
struggle to remember any details of those stays.
But when it comes to tenting out after a day’s tramping, I can recall great
details of every experience. OK, I must admit that a couple of those nights
I wouldn’t like to repeat, but the vast majority have been unique and
unforgettable stays that I often reflect on, appreciating how lucky I was to
have had the opportunity.
What makes a campsite a great place? For me, unashamedly biased as
they are, I have chosen to rate on these five criteria that are important to
me.
#1: Abel Tasman National Park.
Dawn Chorus 8 | Setting 9 | Sunrise 10 | Sunset 5
Accessibility 10
There are many reasons why the beaches on the Abel
Tasman walk are rated amongst the best in the world.
Usually small and horseshoe shaped, these sheltered
bays are lined with steep ridges clad with native bush,
making a stunning contrast with the golden sand on the
beaches and unbelievably clear blue waters.
Imagine nodding off to sleep as gentle waves slap the
beach just metres away from your tent. Then waking to
the shrill call of a weka and the one-bird orchestra of a
bellbird perched in the tree above your tent. And later,
while still lying in the comfort of your sleeping bag, watch
the horizon turn orange, red and silver.
Choose to enjoy the wide rolling track or if you want to
share this with non-trampers, just catch a water taxi. And
this is one of the few places you can enjoy a sea swim
followed by a freshwater shower. Bliss.
Dawn Chorus: Alarm clocks are nobody’s friend but waking to the
calls of our native birds are probably the single thing that will guarantee
making the list of favourite places to stay. This puts both Abel Tasman and
Richmond Forest Park amongst the best.
Setting: Enjoying a hot meal high above a valley floor with views across
rugged peaks will always make for a memorable night. Remoteness,
ruggedness and sometimes, the chance of having the place to yourselves
are all important. Carroll Hut sits high up on this rating.
Sunrise: One of the most memorable moments I have had was sharing
a golden dawn over Tasman Bay while still snuggled up in sleeping bags
with someone special. On this occasion a weka meandered nonchalantly
mere feet away from our tent, happily engrossed in finding breakfast.
Sunset: Sometimes you find yourself in some idyllic spot where the
morning sun is hidden from you, but the dusk can be just as, or even
more spectacular. Having the chance to watch the sky change colour,
darken and then become sprinkled with a billion stars is a priceless
experience that I never seem to enjoy unless I am out tramping.
Accessibility: As we also know, shared experiences are often the best.
Sometimes you need to put in the grunt to get there, which can limit
who you get to share these moments with, but some can be shared with
inexperienced trampers, or occasionally you can just get the water taxi.
These are some of those places ranked from the very best to just great.
#2 : Old Man Hut, Mt. Richmond Forest Park
Dawn Chorus 10 | Setting 8 | Sunrise 5 | Sunset 9 |
Accessibility 5
If you wanted to hear the morning birdsong as I imagine
many New Zealanders took for granted several decades
ago, this must be the closest we can get to it today. It
was so loud and prolific that I gave up trying to work
out which birds made up the refrain. Robin, tui, bellbird,
weka and so many others competed to welcome in the
day. Quite a difference to the evenings when the silence
was broken by the gentle hoots of morepork.
Nestled in a large clearing surrounded by beech forest,
Old Man hut is towered over by Little Rintoul. Here a
meal can be had while the sun’s shadow creeps up the
slopes of Little Rintoul, turning the rocky face all shades
of red.
Getting here is a bit of a challenge but so worth the
effort. The compensation is the route climbs up through
a well-established podocarp forest and then cool beech.
You will be cheered along by many native birds, and
there are plenty of cool streams crossing the track. Once
on top of the ridge, the views across the Richmond
range are alone worth the exercise.
24//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

#3
Kiwi Saddle Hut, Kaweka Mountain Range
#1
Abel Tasman National Park
"Thanks to modern tents and sleeping bags, more and
more of us are getting out there and discovering the thrill
of overnighting in places as special as these. I know there
will be even more exceptional and memorable locations
that others can name, but at the end of the day we just
need to get out there. And most adventures are even better
when they are shared."
#3 : Kiwi Saddle Hut, Kaweka Mountain Range
Dawn Chorus 6 | Setting 7 | Sunrise 7 Sunset 9 Accessibility 7
Where else can you view nightfall in a blaze of colours over the rugged
profile of Mount Ruapehu and at the same moment a full moon slides up
over the vast expanse of Hawkes Bay. Then next morning, witness the
first rays of dawn light sparkle on the Pacific Ocean.
Also placed in a beech forest, it’s a short walk from the tent sites to the
exposed ridge with wide vistas east and west. Plenty of hard work is
going into making this forest a haven for birds. Trapping is widespread
and the results are already obvious.
#4
Caroll Hut Arthur's Pass National Park
#5
Caves Campsite, Whatipu
#6
Bog Inn, Pureora Forest Park
#4 : Carroll Hut, Arthurs Pass National Park
Dawn Chorus 4 | Setting 9 | Sunrise 5
Sunset 8 | Accessibility 7
My enduring memory of the visit to this site was
the feeling of solitude. This is a bit hard to justify
because it is only 3 hours hiking from a sealed
road. At night you can see the glow of reflected
light from the township some 500 metres below.
Located on the West Coast side of Arthurs Pass,
in a wide and exposed hanging valley with a
precipitous drop to the Otira Gorge. Perhaps the
feeling of remoteness comes from thick but low
alpine shrubs that surround the camping area,
offering little cover if the weather turned foul.
Perhaps it is also the expansive views across
the valley to the jagged peaks which gives a
feeling of settling down high up in the mountains.
Whatever the reasons, overnighting here will be
a memorable experience for anyone who can
appreciate it.
Typical of the West Coast, the track begins in
lush and humid forest. The first two or so hours
are steep with plenty of exposed roots and
some treefall to negotiate, but well within the
capabilities of most trampers. And it’s only 3
hours.
#5 : Caves Campsite, Whatipu
Dawn Chorus 3 | Setting 8 | Sunrise 5 | Sunset 9 | Accessibility 8
The rugged west coast is full of unique and unforgettable places to explore. Even
though this site is some distance across a wide expanse of sand dunes from the
beach, the distant roar of those huge swells exploding onto the beaches helps make
this a special place. A rugged cliff to the east of the site is covered in huge cabbage
trees, nikau palms and flax bushes, adding to that wild-west-coast feeling.
There is no hint that a huge metropolis sits just a few miles to the east as the crow
flies. The trail itself is a relatively easy walk from the car park, past the famous
Whatipu Caves. Be aware that there is no water, so plan to lug in a few extra kilos.
#6 : Bog Inn, Pureora Forest Park
Dawn Chorus 3 | Setting 8 | Sunrise 4 | Sunset 3 | Accessibility 7
Ancient. That is the overriding feeling as you settle back for the night in the heavily
wooded site alongside Bog Inn. The history of the area is a mix of plunder, extreme
hard work and endurance, followed by conflict, sacrifice, financial hardship, and
heartache. Thankfully though the final chapter is one of considerable foresight
which we can get to enjoy and value.
When forestry activities were halted all those decades ago, with the obvious impact
on the local economy and those who survived off the industry, it left behind some of
the most ancient trees now standing in New Zealand. Be inspired by the massive
matai, rimu, totara and miro – mere seedlings in the 13th century. When it comes
to “forest bathing” Pureora can’t be beaten.
ADVENTUREMAGAZINE.CO.NZ//25

A KIWI
ON
THICK
ICE
Words and photos by Ash Routen
For a few months a year, the world's
largest volume freshwater lake freezes,
providing locals and visitors the chance
to walk across its surface. Following in
the steps of a few previous trekkers,
Ash Routen travelled to Russia in 2018
to walk across the frozen surface of
Lake Baikal.
On a cold and overcast afternoon
in a small lakeside resort in Siberia,
my friend Phil and I clumsily drag
our plastic sleds down a small set of
stairs to the frozen surface below. Our
farewell party consists of Eugene, a
local trekking guide and our trusty fixer,
and two Brits, Robbie, and Natalie, who
are new acquaintances.
An hour before, we had been basking
in the comforting warmth of a trendy
local café. "You two look like a right
pair of f****ers," Robbie had quipped
with his strong London accent. I was
glad we at least looked the part, given
we would soon be leaving behind the
sanctuary of the café for a long cold
march ahead.
Trace a finger roughly north of
Ulaanbaatar, the capital of Mongolia,
and you soon hit a vast body of
water. Tucked between mountains
and Siberian hinterland, Lake Baikal
stretches for nearly 700km. Its frigid
depths plumb to a little over 1.6km.
Remarkably, the lake freezes over in
February and March, just enough to
allow a few hardy (or stupid) souls to
walk on its surface.
Heading north on windblown
ice. The surface offers little
resistance for sled hauling.
26//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

"Once you overcome
the initial fear of deep
cold, you almost learn to
love it. It renders the air
crisp and clear. Ice and
snow crunch pleasingly
underfoot. And the light
takes on a different
ethereal quality."
ADVENTUREMAGAZINE.CO.NZ//27

First steps on the ice: I had hoped to
see the curious shapes and methane
bubbles that marble the lake's windblown,
frozen surface, but that first afternoon on
the ice, we were met by compact snow
fields. Phil strode ahead for the first few
hours as I chatted to Robbie and settled
into my 'polar plod.' Elite ultra-runners
Robbie and Natalie were here to scope
out the possibility of running across the
lake in the future. Phil and I simply wanted
to amble across the thing before our
tourist visas expired.
We had arrived at the shores of this winter
curiosity after an intense six months of
sourcing equipment, acquiring visas,
planning the route, and squeezing in some
much-needed training. The latter was
undoubtedly required as I was exchanging
a sedentary office job for twenty-odd days
of pulling two plastic sleds, choc full of food,
fuel, and other necessities. The sleds would
be our lifeline as we trekked across Baikal,
from a small resort village in the southwest
corner to the penultimate settlement in the
north - a journey of some 640km.
The first night on the ice, and the next few
after that, took some getting used to. It
was now just Phil and I, and the twinkling
lights on the shore were distant. Beneath
our sleeping mats, the floor creaked and
groaned. The ice was solid enough that we
had difficulty driving in ice screws to pin
our tent down, but it also appeared to be a
living, breathing beast. Subtly piercing the
overwhelming silence, the faint, haunting
sound of the groaning ice below almost
sounded like shelling on the western front.
This was to be our nightly soundtrack for
the coming weeks.
Life in the freezer: Our plan was to snake
along the lake's western shoreline, only
deviating to navigate around the large
mass of Olkhon Island at more or less
the halfway mark. During the first five
days, we slowly found our rhythm and
were zipping along nicely, reaching close
to 30km of walking on some days. We
strapped small micro spikes to our boots
to gain traction on the bullet-hard ice.
Still, despite being unwieldy and heavy, I
preferred to use my snowshoes as they
dug harder into the surface.
In March, the lake is reassuringly cold,
with the mercury regularly dipping to -20c
and below at night. Thankfully we slept
soundly in our big puffy arctic sleeping
bags. Once you overcome the initial fear
of deep cold, you almost learn to love it.
It renders the air crisp and clear. Ice and
snow crunch pleasingly underfoot. And the
light takes on a different ethereal quality.
During the day, the cold was less of a
worry, as the heat from our movement
kept us warm. Ironically sweat is the
enemy of a cold weather traveller, as it
freezes on your clothing and drops body
temperature. So I was constantly fiddling
with layers, vents, hats, and gloves.
Endless faff.
To the outsider, sled hauling and the
relentless monotony of one step after
another might seem like torture. On
some days, it is. On those days, all you
can do is cinch down your jacket hood,
put your goggles and face mask on and
drive into the biting wind, only looking
up occasionally to scout the way ahead.
But on clear sunny days, it's close to
perfection. The internal battle is replaced
by an overwhelming sense of freedom
as the horizon melts into an endless
expanse.
"I felt like a frontiersman
riding into town during
the expansion of the Wild
West, but thankfully we
weren't met by a guntoting
local sheriff."
The winds on Baikal can be merciless.
On our third full day, hoods were most
definitely down. My goggles repeatedly
fogged over as I worked hard against
the headwind. I tried not to slobber as
I breathed heavily into my ice-stiffened
facemask. No time to stop for long with
the temperatures dropping to 30 below;
just keep moving forward and shovel in a
handful of goodies when you can. We only
made 14km that day, but the miles soon
flew by as the weather was mostly kind
to us.
By day nine, we had sighted the jagged
bulk of Olkhon. "Let's aim for the darker
brown patches to the right," suggested
Phil, "I'll meet you there." Despite being
twenty years older, Phil was in better
shape, so most of the time, during clear
weather, he would take off ahead and
meet at the end of the day. A risky strategy
given we had no radios and I usually
carried our one satellite phone - but it had
worked for us so far and meant we could
both travel at our own comfortable pace.
I had met Phil two years earlier on a polar
training course in Norway. Tall, bearded,
and with a smattering of tattoos, he could
look a little menacing. But I soon learned
he was a gentle soul. Empathetic and
kind, but also tough and very driven. The
sort of person you know you can rely on.
That counts for a lot in the wilderness.
The more I walked, the more I doubted
our plan for the day. We wanted to ‘thread
the eye of the needle’ and navigate
between the mainland and Olkhon's
western flank. Things didn't seem to
add up, though. As the day wore on, the
darker brown side of the island looked too
far to the right to be the passage we were
aiming for.
My feet were screaming from days of
being bashed on the hard ice, and the
sun was dropping ever lower behind the
mountains. I scanned the horizon for Phil.
He had the tent. "Trust yourself, Ash," I
muttered to myself. "Trust the map."
I took a bearing and headed left of the
darker hills, assuring myself that Phil must
have come to the same conclusion. The
negative part of my brain was mulling over
the prospect of a night out in the open,
huddled inside my sled bag, with as much
clothing as possible. That was definitely
not a pleasant prospect.
But just as I began to fear the worst, I
spotted it – our tent - a tiny dark fleck on
the horizon. The pain in my feet melted
away, and I pushed onward, celebrating
and muttering to myself with musings I
have long since forgotten.
A changing landscape: The shoreline of
Baikal isn't without life or interest. Lumpy
rolling hills covered with deep snow and
generous smatterings of dense woodland
filled much of our view before Olkhon.
The ice itself drew us in with its natural
artistry. Trapped methane bubbles and
sweeping white swirls were frozen into
translucent sheets with hypnotic effect,
and the broken ice forced upward by
pressure twinkled with blue and emerald
tones. There were also occasional
Dacha's, wooden summer houses for the
rich or visiting tourists. Olkhon has several
dwellings on its shores, and we took up
the hospitality of one friendly hotelier to
28//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

Top to bottom: Sunrise
through a blade of ice.
A typical camp spot, with the
mountains of the east coast
of Baikal in the background.
Home for a night, a small hut
at a weather station on the
west coast of Baikal.
"Subtly piercing the
overwhelming silence,
the faint haunting sound
of the groaning ice below
almost sounded like
shelling on the western
front. This was to be our
nightly soundtrack for the
coming weeks."
escape into the warmth and refuel. Never
have black tea, honey, bread, and a bowl
of plain white rice tasted so good.
The character of the landscape began
to change after this. Undulating lumps
gave way to huge alpine giants. Steep
buttresses and gullies soared high into
the deep blue sky, and the loose snow
danced around these features as the
wind buffeted their upper flanks. Although
local mountaineering clubs do access
these remote ranges, there are no doubt
many lines that remain unclimbed.
Endless beckoning nothingness to
the right and jagged alpine mountains
piercing the skyline to the left. Now, this
was why I was here.
ADVENTUREMAGAZINE.CO.NZ//29

Interesting encounters: After 15 days
of travel, we had covered nearly 450km.
We happened across a series of remote
huts, one of which was inhabited by a
hardy couple who manned a weather
station. Forgetting any notion of purism,
Phil and I took up the offer of a night
in a small wooden hut. The following
day I started off early and waited for
him to catch up. The catch came much
later than usual, though. A brown bear
had arisen early from hibernation and
descended on the weather station. No
big drama, though, as the sore-headed
bear was chased off by a few warning
shots from our weather station friends.
The wildlife weren't the only interesting
characters on our journey. There were
the locals too. One day out of the haze,
a pair of battered old Soviet vans came
careering toward me on the ice road
that lines part of the lake. "Oh Christ,
what the hell do they want?" I thought.
After screeching to a halt, a great big
bear of a man stepped out. Chattering
away for a moment, he realizes my blank
face means I can't understand what on
earth he's saying. He quickly switches
to English and hurries his clients out of
the van. Before long, I'm surrounded
by tourists asking for photos, as if I
were some kind of curiosity. I must
have looked like a stereotypical "Polar
Explorer" with a fur ruff on my hood and a
weather-beaten face.
After asking where I lived in the UK, an
Austrian chap even managed to talk
about my local soccer team who had
just won the league. But soon enough,
I was thanked for my photographic and
conversational duties and treated to a
shot of local samogon (moonshine). Not
one, however, but three. I daren't decline
their gesture, so as we went our separate
ways, I tottered on, feeling bemused and
a little worse for wear. What on earth had
just happened?!
The home strait: After a few weeks, life
on the ice becomes ingrained. You forget
what it was like before, and you don't
want to imagine what it will be like when
you reach the end. While striking camp
in the morning may have taken several
hours, it now took half the time. The
disciplined routine of cold weather travel
becomes second nature. The ice, wind,
and snow become your entertainment.
Their distinct moods lift or sully your own.
To the indigenous Buryat people and
those who spend a lot of time on the
lake, Baikal is an extraordinary place. "I
physically feel how the positive energy of
Baikal recharges my batteries. For me, it's
not just the biggest freshwater lake – it's
part of my inner world," our fixer Eugene
told me. Several times in his life, he had
attractive job offers in other countries,
and I could now see so well why, on each
occasion, he had turned them down.
The final few hundred kilometers were
not easily won. The snow was deep in
the latter half of the lake, and even with
snowshoes, we struggled. Eventually, after
19 days and 634km, we reached the end.
We trudged into Severobaikalsk, a slightly
grim and rundown town built for workers of
a new railway line in the mid-'70s.
We dragged our sleds onto the main
road into town, past abandoned lakeside
summer houses as the odd mangy dog
or local resident looked on curiously. I felt
like a frontiersman riding into town during
the expansion of the Wild West. Still,
thankfully we weren't met by a gun-toting
local sheriff. As we had found repeatedly
throughout our trek, the people who live
along the shoreline are warm, generous,
and very hospitable.
And just like that, our Siberian wander
was at an end. We spent the next 36
hours chugging past endless taiga on the
Trans-Siberian railway and other lesserknown
lines. A dream safely fulfilled, our
bodies could now relax. We ate, drank,
laughed, and felt satisfied. Despite the
warm toasty sanctuary of our carriage,
I knew before too long we'd both want
to be back out on the ice. Once you
experience this winter pearl of Siberia, it
becomes part of your inner world.
30//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

Phil breaking trail on a hazy day
"After a few weeks, life
on the ice becomes
ingrained. You forget what
it was like before, and you
don't want to imagine
what it will be like when
you reach the end."

BIG PINE LAKES
Words by Paige Hareb | Images by Lauren Murray
While spending two months in America, Lauren and I wanted to do a few road trips
and hikes to explore more of this amazing, huge, crazy and beautiful country. One of
our adventures that really stood out, and we would definitely recommend doing was,
commonly referred to as the Big Pine Lakes trail, the technical trail name is Big Pine
Creek North Fork Trail.
Big Pine Lakes is located in the heart of the Eastern Sierras of California. It is roughly 10
miles (yes miles cause we are in America now folks! About 16kms) west of Big Pine and
around 15 miles (24kms) south of Bishop. It’s not far from the ski town, Mammoth.
32//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

Standing here in this moment, made the previous 3 hours all worth it.
ADVENTUREMAGAZINE.CO.NZ//33

"We asked if we
should buy some
bear spray (yes,
that’s an actual
thing!), but
again, we felt like
they laughed at
us two girls with
funny accents. "
Although we didn't manage to get a photo of the bear on
this hike, a week later we were in Sequoia National Park
and had more time and distance to capture this shot.
We wanted to slowly make our way up and camp
up there overnight but you need to get a permit
for that. To get these you have to plan in advance,
which we aren’t great at doing! So the only 25
permits per night were already booked out. With
Lauren being a professional photographer, she
wanted to make sure we were there for good
lighting, which means either for sunrise or sunset.
Either way, we would have to do a lot of the trail
in the dark. Not my favourite thing to do, let alone
adding bears into the mix!
Because we felt like such innocent, naive little
kiwi girls, we decided to double check at the Inyo
National Park information centre as well as a
hiking store nearby to see what the actual odds
were like of coming across a bear and being
attacked by one. The general answers from them
felt a little bit like when people ask me “have you
ever seen a shark when surfing?” and my answer
is usually a slight laugh with something along the
lines of “yeah, but for the amount of surfing I’ve
done, not that many times and you’re more likely
to have a car accident”. One of their answers was
“you’re more likely to get struck by lightning”. We
also asked if we should buy some bear spray
(yes, that’s an actual thing!), but again, we felt like
they laughed at us two girls with funny accents.
So on that note, we decided to hike up for sunrise.
Bishop is the closest town, about a 30min
drive to the start of the trail, we were already
needing to get up at 2am so decided to stay at
the campground right by the trailhead to get that
extra 30mins of sleep. We knew it would roughly
take us 3 hours up to be safe and arrive with
enough time to set up for sunrise. With no one
else silly enough to get up at that time of the day,
we headed off into the pitch black early hours of
the morning with our head lights on and having
turns at carrying a mini axe, because we had
still scared ourselves about bears and somehow
thought a mini axe would protect us (now that
I’m writing this, I’m embarrassed and laughing at
myself).
With our head lights on, an axe in hand, we were
on our way and still very on edge. The first part
of the trail was a steep rocky and sandy incline
which we felt but coming back down it in daylight,
we both agreed that seeing where we had to climb
up would have been a lot more disheartening. I
think it’s the first hike we have ever done where it
took us the same amount of time climbing up as it
did down (2.5hrs up and 2.5hrs down).
The only explanation we can think of, is that we
were so wired from adrenaline walking up in the
dark and thinking about bears. My neck actually
got sore because I was looking all around the
whole 2.5hrs up, even turning around and looking
behind me every 100 metres to double check
nothing was following us. We also talked the
whole way up as it was a bear survival suggestion
to help let the bears know that we were humans.
It was like we had manifested encountering a
bear. About halfway up I was trailing a few metres
behind Lauren when I heard a fairly loud sound.
We stopped in our tracks instantly and continued
to hear the sound of a bear snoring, yes snoring!
It sounded very deep and loud and like it was just
a few metres off the track from us.
34//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

ADVENTUREMAGAZINE.CO.NZ//35

"Lauren spotted two
eyes up ahead shining
in our head lights
staring right back at
us. I had just finally
relaxed slightly after
the last one, yet here
we were again stopped
in our tracks having
a staring competition
with a bear."
"We ask
should b
bear sp
that’s a
thin
again, we
they lau
us two g
funny a
Above: Lauren testing the freezing cold water, lake three of seven.
Right: We didn’t get to sleep here but someone did, what a ‘pine’
view to wake up to.
We were standing frozen and whispering
deciding whether to carry on or not. We decided
to tip-toe past and for the next half an hour we
were looking behind us more than ever. My
shoelace came undone but we didn’t even want
to stop for that, just wanted to get as far away
as possible and not wake the sleeping bear.
About 30mins more into the hike, roughly just
over half way, still pitch black, Lauren spotted
two eyes up ahead shining in our head lights
staring right back at us. I had just finally relaxed
slightly after the last one, yet here we were
again stopped in our tracks having a staring
competition with a bear. I never in my life
thought I would be able to say that. Luckily
it was up in the distance but because it was
so dark, we couldn’t tell if it was going to be
on the track up ahead. We stood there for
contemplating turning around. Since we were
over halfway and closer to our destination, I
really didn’t want to turn back in pitch black,
walk past the sleeping bear and not see what
we came here for. But I also didn’t want to get
any closer to this bear staring at us. After what
felt like an eternity, we made a bold decision
to carry on a bit further to see where the track
would take us. Thankfully the next turn was in
the opposite direction of the beady-eyed bear.
I think that’s the most excited I’ve ever been
about seeing the first light in the early hours
of the morning. I said to Lauren several times
“Look, look, it’s getting lighter”. You would not
believe how relieved we were when we saw the
first of the seven lakes up there. The first lake
was beautiful but five minutes more and we
made it to the second lake, the one more well
known for it’s majestic beauty. As you can see
in the photos, it almost looks fake and felt like
we were on a movie set. Yes, the water colour
really is that colour! We thought we were the
only ones up there until the light started showing
a few hidden tents around the lake. We decided
to check out the third lake as it was only another
10 minute walk but it was safe to say the second
lake is definitely the most magnificent. We
would of liked to have travelled further into the
hills but the adrenaline was wearing off and we
still had at least another couple of hours to get
back down, as well as the sun rising quickly to
over 100 Fahrenheit (over 37 Celsius).
With over an 11 mile round trip (18.5km) and an
elevation of 786m, a total 5 hours of walking,
we slinked into the car, thankful for minimal bear
encounters and the amazing scenery, and drove
straight to Starbucks for a well-earned iced
Frappuccino.
36//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

ed if we
uy some
ray (yes,
n actual
g!), but
felt like
ghed at
irls with
ccents. "
ADVENTUREMAGAZINE.CO.NZ//37

Paddling 38//WHERE on the ACTIONS Whanganui SPEAK Journey LOUDER THAN WORDS/#234

PADDLE THE
WHANGANUI
JOURNEY
NZ'S ONLY GREAT
WALK ON WATER
Nothing really prepares you for the
magnificence of the Whanganui River. As the
world’s first river to be recognised as a living
entity, a personhood with legal rights, there is
a benevolence in the air, a sacredness to the
waters you can’t deny.
As you navigate your way downstream,
it’s as if time stands still and you are fully
immersed in a new rhythm, with each stroke
of the paddle, all your senses come alive.
Slowly, spectacularly, the natural wonders
unfold, and there is a feeling of divinity that
humbles you, so much so that you feel
you ought to whisper in the stillness of the
morning mist or break out in song at the end
of the day as an offer of thanks.
From the deep dramatic gorges to the lush
evergreen ferns hanging over the riverbanks,
there is something otherworldly about the
Whanganui Journey that’s hard to describe
in words, you have to feel it to believe it.
So pack up your hiking boots and let your
paddle do the walking – the life force of the
Whanganui Journey is calling.
Discover New Zealand’s only Great Walk
on water
Sweeping from the North Island to the
bottom of the South, the ten New Zealand
Great Walks are Aotearoa’s premier tracks
for unforgettable walking, hiking and in the
case of the Whanganui Journey, paddling
in off the beaten track, pristine wilderness.
Soak up the magnificent natural landscape,
wildlife, and the rich cultural heritage of
Whanganui River – NZ’s longest navigable
river at 290 km long flowing from Mt
Tongariro towards the Tasman Sea.
ADVENTUREMAGAZINE.CO.NZ//39

Images compliments of Visit Ruapehu
Clockwise from top left: Misty morning on the Whanganui River / A cultural experience at Tīeke Marae/Kāinga
Mangapapapa Campsite along the Whanganui Journey / Taking a break on the Whanganui Journey
Getting to the start of the Whanganui Journey
There are several traditional entry and exit points in Ruapehu for
the Whanganui Journey including the following:
• Taumarunui
• Ohinepane
• Whakahoro
• Pipiriki
Make the most of your experience and enjoy a night or
two before and after the Whanganui Journey and enjoy
connecting with the local communities. With a a wide range of
accommodation and activities on offer in Ruapehu, it’s easy
make the Whanganui Journey a one-of-a-kind holiday.
How long is the Whanganui Journey?
You can choose to do either the 5-day from Taumarunui to
Pipiriki (145 km) or the 3-day journey from Whakahoro to Pipiriki
(88 km). It’s a journey to savour and not meant to be rushed.
Operators are able to provide shuttle transport back to your
accommodation, vehicles, or starting point.
Tour types – canoe, kayak, guided or unguided
There are several ways to experience the Whanganui Journey,
but the majority of people travel by canoe. Going guided also
gives you a deeper insight to the people of the river, the culture,
history, and way of life. If you are not confident on a canoe nor
a confident swimmer, booking a guided Whanganui Journey is
recommended.
When is the Whanganui Journey Great walk season open?
The Whanganui River is accessible year-round, with jetboating
tours operating in the winter months. However, if you want
to complete the Whanganui Journey, the Department of
Conservation (DOC) has specific dates for when the Great Walk
season runs - generally from 1 October to 30 April where you will
need to book your huts and campsites in advance.
What to pack
You can’t purchase food or supplies on the Whanganui Journey
so pack like you are camping and need to be self-sufficient. Gas
cookers, tents, ground sheet and sleeping mat for campsites,
cooking equipment and utensils, food that doesn’t require
refrigeration and drinking water for until you get to the first
campsite or hut. Pack toiletries including toilet paper, a first aid
kit, survival kit, a distress beacon because there is no cell phone
reception, personal medication, warm clothing, and waterproof
layers. Check out a full list of recommended items on the
Department of Conservation website as well as contact a local
river operator. Local river operators will provide a life jacket,
canoe, or kayak, along with paddles, dry bags, and plastic
drums to store your essentials and gear.
What’s accommodation like?
The Department of Conservation operates two huts, eleven
Great Walk campsites and one basic bunkroom along the
Whanganui Journey. During the Great Walk Season, you must
book huts and campsites ahead of time. A highlight of the
journey is a unique stay at Tieke Kāinga, the only DOC hut that
is also used as a marae. Choosing to book a guided cultural
journey means you will be immersed in the culture and history
with the possibility to participate in a traditional Māori pōwhiri.
There are bunks, mattresses, backcountry toilets, a heating
source and water supply at the huts although you will need to
boil the water first before drinking. For some Great Walk Huts,
a hut warden may be present. Campsites have basic facilities
including a water supply, picnic tables, cooking shelters and
toilets. Read up on the latest information about the Whanganui
Journey from the Department of Conservation (DOC) website or
visit a DOC Visitor Centre.
Care for the Whanganui Journey
Leave only footprints, take only memories. Protecting nature,
wildlife and looking out for others is paramount on the
Whanganui Journey. Respecting the environment means
whatever you take in, you must take out with you. Staying safe
also entails being prepared for variable weather conditions and
understanding the Land Safety Code.
Prepare to experience the wonders of the Whanganui Journey
at www.visitruapehu.com
40//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

UNREAL
LANDSCAPES
REAL
MOMENTS
STAY & PLAY IN RUAPEHU FOR YOUR NZ GREAT WALK
ADVENTURES
From adventure lodges, iconic hotels to alpine resorts, wake up with two NZ Great
walks at your doorstep and find your home away from home in Ruapehu.
VISITRUAPEHU.COM

Above: Despite the dull day, the reds and oranges of the surrounding tussock shone brightly
Right: Caitlin at the top of Taranaki Falls
TARANAKI FALLS
Words and images by Lynne Dickinson
I didn’t need to wait till sunrise to check the weather, I had
been listening to the rain fall on the roof all night, it was
just another wet one in the Central Plateau. It seemed to
have been the norm for this winter, not only in my neck of
the woods, but the rest of the country also seemed to be
suffering the same weather patterns.
One of the things I learned whilst on a multi-day hike in
Fiordland, is that not everything is better in sunshine.
Waterfalls, without a doubt, are so much better when
there has been plenty of rainfall. So, with that in mind, we
wrapped up warm and headed out to explore one of the
many day hikes leaving from Whakapapa Village.
The mountain was cloaked in mist and fog, and rain
seemed imminent as we set off toward Taranaki Falls.
The 6km circuit trail leaves from the road behind the
Chateau and can be completed in either direction. We
started at the Skotel and went in an anti-clockwise
direction.
The low light and the red tussock and manuka created
a real autumnal feel before merging with the Waihohonu
horse trail where layers of pumice and ash are still visible
from previous eruptions. The track crossed a series
gullies created by the wind, rain and frost action on the
volcanic soils, before dropping down to the Wairere
Stream. This section of the track was covered in red
tussock and although not clearly visible in the misty light,
we could hear the native birds nearby.
Walking in this direction means you enter the falls from
the top. We climbed as close to the edge as we felt safe
and looked down into the valley below and could see
our trail meandering down in the distance. There are
approximately 100 steps down to the base of the waterfall
and once at the bottom we realized what a great photo it
would be if someone was on the top of the falls. So, Caitlin
volunteered to run back up and around to the top of while I
stayed put to capture the moment.
In summer (or if you are a lot braver) you can walk
behind the falls and even swim in the river, but this was
the middle of winter, and although it’s been a fairly mild
one, we chose to just admire them from a distance. The
falls themselves, especially it the wet weather, were
impressive. According to DOC, the water tumbles 20
meters over the edge of a large andesite lava flow which
erupted from Mt Ruapehu 15,000 years ago.
Unfortunately by now, the rain had begun to fall so we
continued on along the lower track back which gave us
some shelter in the form of the forest consisting of beech
trees, umbrella ferns and mountain toatoa. We crossed
another stream, (fortunately all streams on the track
are bridged) and emerged into the tussock and alpine
shrubland typical of the Central Plateau region. On a
clear day you can see Mt Ruapehu, Ngauruhoe and Mt
Tongariro.
The track only took us 2 hours to complete, and the trail
was well formed and easy to walk throughout, however
Tongariro National Park is notoriously changeable and you
need to be prepared for all weather conditions. Make sure
you have all the correct clothing and equipment regardless
of how the day looks when you start.
TARANAKI FALLS
Length: 6km circuit
Time: 2 hrs
Start: Whakapapa
Village
Tips: Be prepared
for changeable
weather.
Leave someone at
the top of the falls
for a great photo
opportunity.
42//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

ADVENTUREMAGAZINE.CO.NZ//43

Top: Mick on his way to the Devils Staricase
Bottom L-R: We did it, at the Whakapapa I-Site / Next to Emerald Lakes / On top of Red Crater
THE NORTHERN CIRCUIT
IN THE SNOW...WITH THE KIDS!
Words and images by the De Zeeuw Family:
Dad Axel, Mum Lizzy, Mick (7yr old) and Tim (5yr old).
Doing the Tongariro Northern Circuit in the snow.
Why: We’ve been taking the boys on overnight/multi night
trips since January last year (2021). Before that we took
them out on daytrips in the weekend, first in the front/
backpack and later they had to walk themselves. We are
lucky that we live rurally and close to the Waikato River
Trails, so the boys have been doing 5km walks, sometimes
on a daily base, either in the pack, on their (balance) bike or
walking/running.
Last year spring we walked from Desert Rd Carpark to
Oturere Hut and climbed Red Crater from the scree side as
a day trip from Oturere Hut. There was snow and almost
nobody on the Crossing, but because we knew there was
no firewood at Mangatepopo Hut, we’ve decided to stay two
nights in Oturere Hut and walk out to Desert Rd the next
day. Since then, the boys wanted to complete the whole
circuit, Mick wanted to tick it off his list before he turned 8.
I’ve been wanting to this since we arrived in NZ 7 years ago,
but I couldn’t have dreamed doing this with both my boys at
this stage in their life.
Although we’ve been planning it for months, the forecast
looked good on those days that we had a week off, so that
was our gap to go.
When: September 2022
Where: Tongariro Northern Circuit, Tongariro National Park
I wouldn’t say this trip pushed the boys out of their comfort
zone, but it did show them that they are more resilient than
they think. They are both very aware of what was going to
happen and did some tricky tracks already. They know that
there is always the option that you must turn around and
can’t continue what you’ve started, but you always must try.
Mick pushed himself on the last day when he hurt his foot.
Although there were some tears, he pushed himself passed
that and kept walking. He’s a bit older and thinks more
about what effect his actions have, where Tim is always just
carefree and whistles even after a 16km morning.
44//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

Mick: Hello, my name is Mick de
Zeeuw, I am 7 years old and love
hiking. I live in Putaruru and am in year
3 at Te Waotu School. My teacher,
Mrs Topping, always gives me cool
tramping, mountain or nature books
to read. I also love to play soccer
and netball. The mountains I want to
climb are Mt. Everest, Mt. Cook, Mt.
Ngauruhoe and Mt. Ruapehu. When
I am older I want to do the Duke of Edinburgh’s Hillary Award.
My favourite hikes so far are the Tongariro Northern Circuit, Abel
Tasman Coastal track and the Taranaki Summit Route.
Why: I felt enthusiastic trying to do this, because last year we only
climbed Red Crater from Oturere Hut. I thought it would be fun, to
spend time away from home with my family and throw snowballs
in my dads face. I am keen to climb Mt. Everest when I’m older so
I have to start practicing.
What did you learn:
- Slow but steady wins the race
- Don’t give up, even when it gets hard
- If you want it, you can do it
What did you like the most: When I threw a snowball in dads
face and he tripped over, the snowball fight on the top of red
crater with an orc disguised as a guide.
Above: Downhill to Oturere Valley, the snow made the going down a lot easire than last year!
Left: Mick on the South Crater
Most challenging: When I hurt my foot, but I knew I had to keep
walking
Tips:
- Don’t eat yellow snow
- If you can, walk where other people walked so you don’t
sink hip deep in the snow
- Only go when the weather conditions are good and bring
a locator beacon
- Kids can do more than old people think
- Always bring lots of snacks! My favourite are snack
packs with nuts, raisins, cranberry, jellybeans and when
I’m lucky mum makes freeze balls.
- Pick up rubbish if you see it
- Don’t leave your rubbish at the hut but take it home
In my bag I always take: My sleeping bag + liner, my striped long
johns to sleep in, shorts, shirt, fleece jumper, first aid kit, down
jacket, rain gear, spare socks, crocs, a book to read at the hut/
campsite and playing cards, an emergency blanket, my snacks for
the whole trip, water, my compass and a whistle.
I really loved doing the Northern Circuit in winter, but I thought it
was more challenging than when I was climbing to the Taranaki
Summit in January. Next on my bucket list are Mt. Ruapehu
Summit, the Kepler Track, Stewart Island and the North/South
Track in the Kaimais.
ADVENTUREMAGAZINE.CO.NZ//45

Tim: (dictated to mum)
I am Tim and I am 5 years old. I
am in year 1 at Te Waotu School
and I did the Tongariro Northern
Circuit in the snow!
Biggest challenge: When it started snowing from Waihohonu to
Whakapapa, lucky I had my raingear on!
Coolest thing: Building a snowman with mum at Oturere Hut and
walking through the deep snow
Funniest: When mum got stuck in the deep snow and I threw a
snowball in her face.
Best part: Jumping down Red Crater in the deep snow and
playing Chess in the hut
Tips:
- Stay in other people’s footprints
- I might be small, but I can do a lot
- I need more snacks than an adult, I make lots of little
steps
Learned: Slow but steady wins the race
In my bag I always have snacks, water, spare clothes, my jacket,
my raingear, my pj’s, spare socks, my crocs, my sleeping bag and
liner (but sometimes mum or dad will carry it for me if we have a
long day) a book to read, emergency blanket, my compass and
my whistle.
Above: Tim stuck in the snow
Below: Tim climbing the last few meters to the top of Red Crater
Tips for parents:
- Bring plenty of snacks. Our boys have a bag with nuts, lollies
and dried fruit in their pocket/bag and they can grab something
whenever they want. In the beginning we would walk for a while,
and they had to wait till we sat down to eat but know they just
can eat something as we go. If that means they’ll eat a jellybean
at 8:05AM, 5 minutes after you started, so be it. If they’re happy,
you have a fun trip!
- Plenty of layers. Our children are never cold, but they wore a
lot of layers. It’s always easier to take a layer off than to have a
cold, grumpy child.
- Raingear. Although it was sunny, the boys both wore their rain
pants and jacket, with gaiters, a fleece jumper, long johns and
shorts. Their down jacket was too hot, the raingear protected
them from the cold, and they didn’t get wet after falling/playing in
the snow!
- Try to find out if the hut has firewood! After being in the snow
all day, it’s nice that socks/shoes/clothes can dry so they don’t
have to put their wet gear back on the following morning.
- Make sure they know where they sign up for. It’s a challenging
track, even for some adults, although my children show me
every time that they are more versatile than we think.
- Know their limits! Be aware that your children can do a day
of the track in a certain amount of time and don’t make it into
10hour days. That way they can enjoy some downtime at the
next hut and you’re not stressing about getting to the hut before
dark. Stressed parents and grumpy children are not a good
combination. Our longest day was just under 5 ½ hour from
Waihohonu to Whakapapa and it could’ve been faster if Mick
didn’t hurt himself. On the other hand, don’t think they can’t do
it. Most times, our children surprise us in what they can do, but
better try to find out on an easier track and not in the snow.
- Don’t let other people tell you, your children can’t do it.
Especially those children that have been out and about for years
can do more than the average adult.
- Always bring enough supplies, so if you’re stuck an extra day,
you have enough food to keep your children and yourself warm
and fed. Low weight backpacks will come again once they’re old
enough to take half of your gear.
- Most of all, enjoy! We are lucky to have this amazing scenery
on our doorstep and to share this with our children is definitely a
privilege!
- Both boys always carried a laminated paper in their backpack
with their name, date of birth, address, phone number and
emergency contact number, in case of emergency.
46//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

southernapproachnz

Come cycling in stunning
Central Otago and let the
experts look after all your needs
> Lake Dunstan Trail
> Otago Central Rail Trail
> Roxbourgh Gorge Trail
and more...
Because it is all about you
Trail riding Central Otago
Call the experts at Bike It Now!: 0800 245 366
Clyde Bike Shop and Tour office open 7 Days
Cromwell Bike Shop open Monday - Saturday
NEW SHOP NOW OPEN IN WANAKA open 7 days
www.bikeitnow.co.nz
2022

THE GROWTH OF
AN ICONIC KIWI
BUSINESS Reflection by Kathryn Fletcher
Lisa, Duncan and Fletch
It is nine years this month (September
2022) since we, Lisa Joyce, Duncan
Randall and Kathryn Fletcher (Fletch),
opened Bike It Now!, offering bike retail,
bike hire and bike tours in Clyde.
It all began with Lisa and I walking our
dogs along the back lane of Clyde in
September 2012. Dunc was outside a
small bike hire shop and travel agency
called Bike It Now! washing rental bikes.
Duncan had just moved with his family to
Clyde from Dunedin, like Lisa and I had
just done after Lisa secured a job working
for Contact at the Clyde Dam, so we had
that in common from the outset.
Our business connection began on August
23, 2013, with the three of us purchasing
the business from the late and great Ross
McRobie and his wife Petrea; they had two
full-time staff, one of them being Duncan.
When we reopened in September, three
weeks later, we had expanded into retail
and added a workshop as we needed to
create a business that would be able to
look after us all.
Things have changed in the cycling
industry significantly since 2013, and we
have been fortunate to be at the forefront
of this, namely the shift away from 26'
bikes to 27.5' and 29' along with the rise of
E-bikes. We had the first E-Bike for hire, a
Scott E Aspect, out on the Otago Central
Rail trail in 2014; all E-bike riders had to
have a medical reason for riding an E-bike,
as the rules prevented E-Bikes from being
used on DOC managed trails.
DOC's stand changed very quickly, so
by 2015 we had a fleet of E-bikes which
proved popular. We also started to retail
E-bikes at the end of 2014. While this
was going on, John Key was making his
mark on the Cycle tourism industry in NZ
by allocating significant funding to Trail
development, particularly for Great Rides.
Central Otago benefitted through the
Roxburgh Gorge Trail and Clutha Gold
Trail development's initially - remembering
the Otago Central Rail Trail had been
opened in 2000 but was separate from this
funding model.
Roll forward to 2019 when the Lake
Dunstan Trail was started, part of a
unique project; riding from Queenstown
or Wanaka to Dunedin via a trail network
and not having to ride on roads. This is
ongoing, but the Lake Dunstan Trail from
Cromwell to Clyde was opened on May
8 2021. The other linking sections are all
happening over the next few years.
COVID, to the bike industry and Central
Otago in particular, created a very ‘busy
time’, a silver lining, with NZers not
travelling overseas and looking for options
at home. The significant spending on
E-Bikes and then looking for places to
take them for 1/2 day to 9-day rides has
impacted all cycle-based businesses in our
small area. The flow on to accommodation
and hospitality providers has been very
positive as a result.
Relationships have always been essential
to us throughout this time, from our
suppliers of bikes to our accommodation
providers and, most notably, our staff.
Bike It Now! is all about looking after staff,
customers and our community.
Loyalty has always been the backbone to
our business; to our staff, our customers
and our suppliers/reps. I feel I need to
mention mention four people in particular,
Jan who has been creating tours for our
customers for nearly nine years and 3 of
our supplier reps; Ben Vial and Shakey,
who have been with us from the beginning
and are still with us, also Rowan Miller,
who is no longer in the industry but had a
significant impact on all of us.
We have also had a great relationship with
Webstudio in Queenstown and Buchan
Design in Roxburgh since day one, they
always have us covered.
We have always tried to support our local
community and make positive impacts,
whether it be sponsorship or just being
good citizens. We have worked with
Regional Tourism and Tourism NZ and
promoted Central Otago first and foremost
as the place to visit both domestically
and for our international visitors and the
business has expanded to include stores
in both Cromwell and Wanaka.
3
Full-time staff
September
2013
23
Full-time staff
September
2022
2013
Significant moments:
Sept 2013: opened Clyde shop,
retail, hire, workshop and tours.
2016 onwards: Trip Advisor
Excellence Awards, Hall of
Fame 2019 and travellers'
choice 2020, 2021 and 2022.
Nov 2018: gained Qualmark
Gold award, the first self-guided
cycle tour company in New
Zealand to achieve this, and we
have retained this in all reviews.
July 2019: opened Cromwell
Bike shop, with retail, workshop
and hire.
July 2022: opened in Wanaka,
with retail, workshop and hire.
ADVENTUREMAGAZINE.CO.NZ//49

CAMPING
&
TRAMPING
50//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

hydro flask 621ml, 710mL & 946mL Trail Series $69.99-$89.99
WWW.HYDROFLASK.CO.NZ
Klymit Insulated Static V $229.95
WWW.OUTFITTERS.NET.NZ
kiwi camping ruru 4 hiker tent $439.00
WWW.KIWICAMPING.CO.NZ
tasty chicken mash $9.99 - $14.99
WWW.BACKCOUNTRYCUISINE.CO.NZ
black diamond Trail Pro Trek Pole $239.99
WWW.SOUTHERNAPPROACH.CO.NZ
RAB Alpine 600 Sleeping Bag $$699.95 - $759.95
WWW.OUTFITTERS.NET.NZ
Lowe alpine Sirac 65L/ND65 $349.95
WWW.OUTFITTERS.NET.NZ
SALEWA ALP TRAINER 2 MID GTX $429.90
WWW.BOBO.CO.NZ/SALEWA
ADVENTUREMAGAZINE.CO.NZ//51

cotopaxi 16L & 24L Batac Backpack - Del Día $159.99-169.99
A stowable daypack that deploys for fast-and-light daytrips,
hikes, and other micro adventures. Made with 100%
repurposed fabric, making each bag is one-of-a-kind.
WWW.COTOPAXI.CO.NZ/COLLECTIONS/DEL-DIA
Lowe alpine Sirac 50L/ND50 $299.95
Great for weekend or shorter trips
and featuring the adjustable Air
Contour X carry system, hip belt/
front/side pockets, sleeping bag
compartment, rain cover, pole
attachments and lash points.
WWW.OUTFITTERS.NET.NZ
osprey Sportlite 25 $199.99
Confidently step out on the trail with the Sportlite
25, one of our most minimalist technical day packs.
Carry all of your essentials with the convenience
of panel-loading design and simple, clean internal
organization. An AirScape® backpanel and
suspension system moves with you dynamically
and keeps your carry stable and ventilated. Made
with 100% recycled materials. Two size unisex fit.
• Trekking pole loops w/ upper compression strap
capture
• Stretch side water bottle pockets
• Padded hipbelt with one zippered pocket and one
open stretch mesh pocket
Find a Stockist: WWW.SOUTHERNAPPROACH.CO.NZ
Lowe alpine Sirac 65L/ND65 $349.95
The Sirac 65 is a reliable, lightweight,
loaded with features pack with a
strong and stable carry making it
ideal for long backpacking and selfsufficient
treks.
WWW.OUTFITTERS.NET.NZ
Lowe alpine AirZone Trail 35 $299.95
The AirZone Trail 35 features an AirZone carry system,
single buckle entry, compression straps, rain cover, pole
attachments, ice axe loop, front/side pockets and is
hydration compatible.
WWW.OUTFITTERS.NET.NZ
52//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

FEATURED PRODUCT...
equip
yourself!
Rab Aeon LT 25 Pack $199.95
The Aeon LT 25 is the largest Aeon LT pack, offering generous volume to carry all your
gear in wild, mountain terrain. Featuring a responsive and flexible Air Contour back
system keeping the air flowing, double strap harness and moulded back panel provide
a comfortable, secure, bounce-free carry, on-harness walking pole attachments, stretch
bottle pocket, large side stash pocket, front stash pockets, side compression straps,
hydration compatible with space for a 3L bladder, zipped harness pockets and robust
70D construction made with 50% recycled nylon making it ideal for fast-paced, committed
ascents, ultralight bivi’s and hut nights.
WWW.OUTFITTERS.NET.NZ
Low Prices Everyday
Black diamond Trail Pro Trek Pole $239.99
With a huge range of adjustment and a wellbalanced,
durable design, the Trail Pro is a
reliable, high-performance pole for day hikes or
in the mountains.
• SmashLock quick Release technology for
quick deployment and collapsibility
• New FlickLock Pro adjustability—now
featuring aluminum construction that’s lighter
and easier to use
• Updated soft-foam grip with solution strap for
added security and better handling
• Interchangeable carbide Tech Tips, 38mm
Trekking Basket
• Ski compatible ferrule will accept 100mm
powder baskets for deep snow
• Available in Men’s and Women’s design
Find a Stockist:
WWW.SOUTHERNAPPROACH.CO.NZ
Free NZ Shipping on
orders over $150 for
members
Members Earn Equip+
Loyalty Points
shop online or instore
equipoutdoors.co.nz
62 Killarney Road,
Frankton, Hamilton,
New Zealand
P: 0800 22 67 68
E: sales@equipoutdoors.co.nz

GLERUPS HONEY RUBBER AND BLACK RUBBER SHOE $189.00
When you are camping, you need a shoe that is good on
all surfaces including inside the tent or the hut.
Made from 100% natural wool, glerups provides an
instant comfy at home feeling. They are light, versatile,
and well worth the space in your backpack.
Get natural, get cosy and get yourself some glerups.
WWW.GLERUPS.CO.NZ
SALEWA ORTLES ASCENT MID GORE-TEX® $749.90
The Ortles Ascent Mid Gore-Tex® is a solid solution for alpine
mountaineers. Its thick suede leather upper, SALEWA® 3F System with
steel cables and reinforced TPU rand make it exceptionally robust and
durable, while the stiff carbon-loaded nylon fibreglass insole increases
stability during activity. It has been engineered with a dual density
expanded polyurethane midsole with dedicated stiff and cushioned zones,
to ensure both comfort and precision, while the interchangeable layers of
the Multi Fit Footbed Plus (MFF+) allow a customizable fit.
Fit: WIDE Weight: (M) 850 g
WWW.BOBO.CO.NZ/SALEWA
SALEWA WILDFIRE 2 $329.90
Engineered for technical terrain, the Wildfire 2 is a lightweight, agile and
precise tech approach shoe with a breathable recycled synthetic mesh
upper, and a 360° protective rand. It’s equipped with climbing lacing for
fine adjustment in the toe-area and a lateral net system with Kevlar®
cables for better overall performance and sensitivity. The POMOCA®
outsole with Butylic compound rubber is designed for precision and
sensitivity in mixed mountain terrain and ensures good grip on rock in both
dry and wet conditions.
Fit: STANDARD / Weight: (M) 355 g (W) 305 g (pictured)
WWW.BOBO.CO.NZ/SALEWA
SALEWA ALP TRAINER 2 MID GTX $429.90
The Alp Trainer 2 Mid GTX has a suede leather and stretch fabric upper
with a protective rubber rand. Featuring a GORE-TEX® Extended Comfort
lining for optimal waterproofing and breathability, and customizable Multi
Fit Footbed (MFF) with interchangeable layers allows you to adapt it to
the unique shape of your foot; Climbing Lacing right to the toe allows for a
more precise fit, while the Vibram® Hike Approach outsole covers a wide
spectrum of mountain terrain.
Fit: STANDARD / Weight (M) 552 g (W) 482 g (pictured)
WWW.BOBO.CO.NZ/SALEWA
SALEWA WILDFIRE CANVAS $279.90
The breathable recycled cotton and hemp canvas upper is protected
by a full 360° TPU rand. Our 3F system with nylon-coated Kevlar®
cables provides additional support and greater stability at the heel, while
ensuring a precise fit. The dual density eco Ortholite® footbed promotes
superior cushioning, and the Pomoca outsole offers secure grip during
light hiking approach activities.
Fit: STANDARD / Weight: (M) 305 g (W) 256 g (pictured)
WWW.BOBO.CO.NZ/SALEWA
54//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

exped Mira II HL Tent $749.99
2-person, lightweight, 2-door, 3-season tent with a
free-standing canopy design. A ridge pole increases
the space inside for comfortable sitting, large finemesh
panels. Poles, sleeves and fasteners are
colour coded for fast pitching and it comes with a
2-section stuff sack. Packaged weight 1.5kg
WWW.BIVOUAC.CO.NZ
exped Outer Space II Tent $899.99
3-season tent which can be set up in multiple modes.
Features a giant, pole-supported front vestibule that
easily shelters 3 people in camp chairs, a lightweight
table and backpacks. The poles are on the outside of
the fly and allow you to pitch the inner and outer tent
in one go or pitch the fly only without the inner tent.
Packaged weight 2.9kg
WWW.BIVOUAC.CO.NZ
kiwi camping weka 2 hiker tent $339.00
Spacious two-person tent with
vestibule and double entrances. Fits
in a backpack, ideal for all year-round
hiking. 4000mm aqua rated fly with
SPF50 UV coating. 3-year warranty.
WWW.KIWICAMPING.CO.NZ
Kiwi Camping Weka 3 Hiker Tent $379.00
Spacious three-person tent with
vestibule and double entrances. Fits
in a backpack, ideal for all year-round
hiking. 4000mm aqua rated fly with
SPF50 UV coating. 3-year warranty.
WWW.KIWICAMPING.CO.NZ
kiwi camping ruru 4 hiker tent $439.00
The Ruru is a lightweight and easy-pitching hiking tent
with a semi-geodesic alloy frame. Breaks down into
three separate bags for lightweight hiking.
WWW.KIWICAMPING.CO.NZ
56//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

Jetboil mini mo $329.95
It's about cooking. MiniMo delivers
UNMATCHED simmer control, metal
handles, and a low spoon angle for easy
eating! Starting with the innovative new
valve design, MiniMo delivers the finest
simmer control of any upright canister system
on the market. Thanks to our proprietary
regulator technology and enhanced
regulator diaphragm, MiniMo ensures this
consistent performance down to 20ºF (-6ºC).
Its redesigned cooking cup, the perfect
combination of size, sturdy metal handles,
and optimized height, provides users with an
easy-to-eat experience.
WWW.JETBOILNZ.CO.NZ
Klymit Ridgeline Camp Chair High Back
$229.95
The lightweight Ridgeline High
Back Chair features a padded
headrest, an engineered 16’ 5”
high seat and vented mesh panels,
it is perfect for relaxing in.
WWW.OUTFITTERS.NET.NZ
kiwi camping boost lED light $89.99
Bright LED light with power bank to
illuminate your tent and charge devices
on the go. Features 11 light modes
including SOS signal, built-in magnets
and hanging hook.
WWW.KIWICAMPING.CO.NZ
sea to summit Camp Kitchen Tool Kit 10 Piece $69.99
Hang this compact kit in your camp kitchen and you'll
have most things you need on hand to create - and
clean up after - gourmet outdoor meals. The kit
contains everything from empty leakproof bottles for
oils and condiments, to a folding spatula and serving
spoon, to a pot scrubber, washcloth and dishcloth.
Find a Stockist: WWW.SOUTHERNAPPROACH.CO.NZ
Jetboil Flash 2.0 $249.95
BOIL IN SECONDS, NOT
MINUTES Blistering boil times
come standard on our industryleading
Flash. By modelling
the combustion and selecting
materials to optimize efficiency,
we were able to create the
fastest Jetboil ever — cutting a
full minute off our best boil time.
WWW.JETBOILNZ.CO.NZ
Chair Zero High-back $299.99
With a taller back for added support and
comfort, the Chair Zero High-back has the
same DNA as Chair Zero, an ultralight,
compact, go-anywhere chair. The Chair Zero
High-Back is a good choice for activities
where weight saving is top of mind, such as
backpacking, kayak tours, moto-touring or
bikepacking.
WWW.SOUTHERNAPPROACH.CO.NZ
58//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#233
Jetboil stash $299.95
The Lightest and Most Compact
Jetboil Ever. We know your
dreams are big and ambitious.
Which is why we designed the
all-new Stash to be lightweight
and compact, maximizing your
pack space without sacrificing
that iconic Jetboil performance.
At 7.1 oz or 200 g, the .8L Stash
is 40% lighter than the .8L Zip.
WWW.JETBOILNZ.CO.NZ
hydro flask 621ml, 710mL & 946mL Trail Series $69.99-$89.99
Ridiculously light, and durable enough for any trail, our Trail
Series collection is 25% lighter than our other flasks thanks
to an innovative stainless-steel design.
WWW.HYDROFLASK.CO.NZ

The highest level of
performance and
protection meets
sustainability.
The
lightest
system
in its
category
STASH
FEATURE HEAVY
PACKS LIGHT
SO LIGHT YOU MAY
FORGET YOU’RE EVEN
CARRYING IT
WEIGHT
200g
VOLUME
0.8 Liter
POWER
4,500 BTU/h
(1.52 kW)
BOIL TIME
2 minutes
30 sec. per 500ml
www.jetboilnz.co.nz
PreCip® Eco Jacket
marmotnz.co.nz
Learn more about our
sustainability efforts

exped DURA 6R Sleeping Mat (medium) $359.99
Durable, supportive mat insulated with
responsibly-sourced down insulation
for comfort on demanding adventures
in cold conditions, including extended
alpine outings. Recycled 75D/170D
brushed polyester fabric and 7cmthick
chambers with fatter chambers
at the sides to reduce the chance of
rolling off. Certified carbon neutral by
myclimate.
183cm x 52cm. 5.8 R-value. 885g
WWW.BIVOUAC.CO.NZ
exped ULTRA 3R Sleeping Mat (medium) $279.99
Lightweight, packable mat with light insulation
featuring recycled 20D ripstop face fabric, 60gm/2
Texpedloft microfibre insulation and 7cm-thick
chambers with fatter chambers at the sides to
reduce the chance of rolling off. Certified
carbon neutral by myclimate.
183cm x 52cm. 2.9 R-value. 465g
WWW.BIVOUAC.CO.NZ
Rab Alpine 600 Sleeping Bag $699.95 - $759.95
A mid-weight, 650FP three season,
duck down bag with a tough and wind
resistant Pertex® Quantam outer
with recycled nylon lining designed to
maximise warmth.
WWW.OUTFITTERS.NET.NZ
Rumpl NANOLOFT® TRAVEL BLANKET $179.99
This travel sized blanket is perfect for
every adventure - take one with you
wherever you go, from the alpine hut to the
airport.
WWW.RUMPL.CO.NZ
Kiwi Camping Mamaku camper Sleeping Bag
$94.99
The Mamaku Camper is great for hiking
and camping, weighing 1.1kg. The
compression bag allows for easy pack
down while the silver thermal lining
keeps you toasty warm on adventures.
WWW.KIWICAMPING.CO.NZ
Klymit Insulated Static V $229.95
The Insulated Static V packs light and small, has a
4.4 R-value, body-mapped shape and V chamber
design for comfort, lofty Klymalite insulation, and
side rails.
WWW.OUTFITTERS.NET.NZ
kiwi camping Rover Lite 3cm Self-Inflating Mat
$109.00
Compact to pack and carry, the Rover
Lite self-inflates in minutes. The tapered
design can fit in a sleeping bag, 1830mm
long and 550mm wide.
WWW.KIWICAMPING.CO.NZ
60//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

New Zealand’s best
and biggest online store
solely dedicated to Non
Alcoholic adult drinks.
Perfect after a days adventuring - satisfy the taste without
the after effects. Adult drinks that make you feel part of the
socialising yet let you wake up the next day with a clear
head ready for your next adventure.
.
No matter your reason.......we’ve got you covered
Beers - Wines - Spirits - RTD’s - Ciders - All delivered to your door.
www.clearheaddrinks.co.nz

SOBER OCTOBER
Visit the team at Clear Head Drinks for 20% storewide
discount to celebrate Sober October.
WWW.CLEARHEADDRINKS.CO.NZ
ONE FOR THE ROAD - proceed with caution
amber ale $7.95
This all season medium-bodied
lager showcases both malt and
hops. It follows with a toasty malt
character with only a subtle hop
bitterness.

Warthog Classic II Elite Sharpener $199.00
3 Adjustable Angles(20,25 & 30), 325
Grit Natural Diamond Rods, Metal Frame
Construction, Durable Powdercoat Finish,
Finishing Steels.
WWW.KNIFESHARPNERS.NZ
KEA STASH $59.99 - $89.99
The Trash Compacting Bag
for Mess Free Adventures.
100% leak-free, smell-free
and reusable. Fill It - Crush
It - Stash It
WWW.KEAOUTDOORS.COM
BACK COUNTRY CUISINE:
The first thing you’ll notice is that the front label on their pouches
have changed for the better by adding Health Star Ratings and
energy, protein, fat and carbs per pouch. They have also improved
the readability of our back labels.Back Country Cuisine is available at
leading retailers. For more information or to find your nearest stockist
visit: www.backcountrycuisine.co.nz
local dehy hummus $8.00
Roasted Red Pepper &
Sundried Tomato, also
available in Beetroot and
Zesty Lemon. Perfect
for lunches on the trail.
Dehydrated. Vegan. Home
compostable packaging.
WWW.LOCALDEHY.CO.NZ
tasty chicken mash $9.99 - $14.99
With smoky flavoured freeze dried
chicken, cheese and vegetables.
3.5 Health Stars - Gluten Free
Available small serve (90g) or
regular (175g)
WWW.BACKCOUNTRYCUISINE.CO.NZ
Apple & Berry Crumble $13.99
A sweet mix of freeze dried apples
and berries topped with a delicious
gluten free cookie crumb.
3 Health Stars - Gluten Free
WWW.BACKCOUNTRYCUISINE.CO.NZ
INSTANT PASTA $4.99
Just add boiling water for perfectly
cooked pasta.
3.5 Health Stars
Sizes – Family 120g
WWW.BACKCOUNTRYCUISINE.CO.NZ
local dehy kumAra chickpea curry
$17.50
Mildly spiced Indian curry
with spinach & brown rice.
Refuel after a day's adventure!
Dehydrated. Vegan. Home
compostable packaging.
WWW.LOCALDEHY.CO.NZ
rescueme PLB1 $589.98
Wherever you are, at sea, on land,
the rescueME PLB1 provides the
reassurance that global emergency
services can be alerted by the press of
a button.
The rescueMe PLB1 can be operated
with a single hand in even the most
challenging situations. A simple springloaded
flap covers the activation button
preventing inadvertent use. rescueME
PLB1 works with the only officially
recognised worldwide dedicated search
and rescue satellite network (operated
by Cospas Sarsat). As this is funded by
governments there are NO CHARGES
to use this service.
Available through all leading sports and
recreation retailers and online.
WWW.RESCUEME.CO.NZ
sunsaver classic 16,000 mah
solar power bank $119.00
Built tough for the outdoors
and with a massive battery
capacity you can keep all
your devices charged no
matter where your adventure
takes you.
WWW.SUNSAVER.CO.NZ
ADVENTUREMAGAZINE.CO.NZ//63

PROVEN
TO SAVE LIVES
30% (typ) smaller 7 year battery life
66 channel GPS
– Fast accurate positioning
EPIRB1
Essential
for safe
boating
The World’s Most
Compact Emergency
Position Indicating
Radio Beacon
PLB1
Personal
Locator
Beacon
The World’s
smallest PLB
Patagonia Tee-Cycle T-shirt $89.99
All Shirt, no dirt! Patagonia's new Tee-Cycle T-shirts
are part of a circular system, so there's no need
to grow anything new. Made from discarded tees
destined for landfill, they help solve the textile waste
problem and are part of Patagonia's goal to create a
closed-loop process for clothing. Soft and comfortable,
they feature screen-print inks that are PVC – and
phthalate – free, plus are Fair Trade Certified sewn.
WWW.PATAGONIA.CO.NZ
Chickfly Bamboo Leggings High Rise
or Low Rise (USD $119.00)
Chickfly leggings are made
with soft, strong, stretchy
and sustainable bamboo
fabric, coloured with organic
dyes. Our patented fly is held
together by tension, creating
a seamless, flattering, soft,
and easy-to-use feature in the
most comfortable and stylish
black legging that every
woman needs not only for
style but for convenience and
functionality.
WWW.CHICKFLY.COM
rab Filament Pull-on $169.95
Embrace extreme sport with
comfort and confidence. At
213g, the Filament Pull-on is
a lightweight stretch fleece
mid-layer that fully warrants its
place on any high-energy trip.
WWW.OUTFITTERS.NET.NZ
30% (typ) smaller 10 year battery life
LAB0684
5 year warranty 406-link via
satellite to
Emergency Services
www.rescueme.co.nz
Macpac 220 Merino Long Sleeve Top $119.99
A staple for any adventurer, made from
midweight merino wool for natural warmth,
temperature regulation, and odour
resistance.
WWW.MACPAC.CO.NZ
Zerofit Heatrub Ultimate Baselayer (A$129.95)
Independently tested at the Boken Institute in
Osaka, the Ultimate has proven to be five times
warmer than leading competitors, using ‘Heat
Threads’ inside the garment to generate warmth
instantly.
WWW.ZEROFIT.COM.AU

cotopaxi Abrazo Hooded Fleece Jacket $229.99
A cosy jacket that embodies our commitments to
sustainability, the Abrazo is made with recycled fabric
which puts a thoughtful spin on the classic fleece.
WWW.COTOPAXI.CO.NZ
marmot PreCip® Eco Pro Jacket $299.95
Meet the newest addition to our high-performing PreCip
line: the PreCip® Eco Pro Jacket. Waterproof Marmot
MemBrain® and 100% seam taping for zero leaks blocks
the rain as you hike, paddle, or play. The PFC-free coating
keeps you dry while the hood and drawcord hem provide
for extra comfort and coverage. Open up the heat releasing
PitZips when the pace picks up and stash extra gear in the
large pack pockets.
• 20k/20k Marmot MemBrain® lamination with 2-layer
waterproof/breathable fabric repels water and reduces
internal condensation
• PFC-free water-repellent coating keeps you dry and
minimizes environmental pollution; 100% seam taped to
keep water out
• Attached hood with peripheral cord adjustment for extra
coverage
• PitZips provide ventilation to regulate body temperature
• Large pack pockets under a welt for protection
• Zipper with storm flap and adjustable drawcord hem to
block drafts
WWW.MARMOTNZ.CO.NZ
Patagonia Microdini 1/2-Zip Pullover $209.99
Combining two of our favourite materials, Micro D and Houdini,
Patagonia created a lightweight fleece that provides everyday
warmth and comfort. This 1/2-zip fleece pullover with warm standup
collar, features an exterior trimmed in recycled nylon for added
wind protection. Available in cuts for adults and kids, it's Fair Trade
Certified sewn, which means the people who made it earned a
premium for their labour.
WWW.PATAGONIA.CO.NZ
cotopaxi Fuego Down Vest $299.99
Blending responsibly sourced,
water-resistant down with
a streamlined design - our
Fuego Vest is the perfect
spring layer for all adventures
near and far.
WWW.COTOPAXI.CO.NZ
Outdoor Research Vigor Plus Fleece Hoody $249.99
Low-bulk, lightweight, water and wind resistant,
providing comfort, warmth and versatility on
your cold-weather adventures. It is made with a
93%-recycled polyester engineered for amazing
stretch and mobility that has a highly-breathable
high-loft grid interior for active warmth and moisture
wicking on stop-go activities. Other features include
an overlay on the chest for added wind resistance
and pockets to stow small necessities.
WWW.BIVOUAC.CO.NZ
66//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

Zerofit: A personal preference
When a company makes a claim that
its thermal wear product is five times
warmer than the traditional base layer,
that is a big claim.
When Zerofit arrived on the courier,
the very first thing that came to mind
was the weight. Thermal wear that
claims to be five times warmer than
anything else you would expect to
be heavy - it wasn’t. I went through
and read in detail how Zerofit was
supposed to work.
How it works: The Heat Rub uses
“double-loop” barrel fabric to provide
both heat insulation and “friction
heating”. The extra-long bristles
ensure a layer of warm air, and even
a little movement of these bristles
causes friction, which creates heat
which in turn warms you up.
It is stated, “The Heat Rub is twice as
warm as a jumper and is comparable
to a coat but with the ability of ease
of movement for active sports and
working”.
The concept sounds like it would work, but it didn’t
sound very comfortable. Personally, I struggle
with any sort of base layer that has even a merino
component. My partner refers to it as ‘girly skin’,
not very PC. I like to feel it's simply sensitive. So,
the concept of ‘heat rub’ sounded like it was not
going to be for me, but I was wrong.
During the winter months, we move to the Central
Plateau to ski, trout fish, and tramp. I started
using the Zerofit when fishing, it’s light and very
maneuverable. From the moment you put it on, it
is comfortable, which for me personally is a game
changer. I found it super warm and didn’t need
any additional layers; plus it was not bulky at all.
This year the skiing has been limited but those
days we have had on the mountain have been
chilly 2 and 3 degrees, plus often with a severe
wind chill. Once again, the Zerofit kept me warm
and comfortable without the additional weight, I
wore just my Zerofit and a ski shell jacket.
Lastly, we have done several tramps around the
Ruapehu region which are as you would expect in
winter is cold. 50% of the time I needed to remove
my Zerofit because I was simply getting too warm
(better to be too warm than too cold) pulling off the
Zerofit and stashing it in a backpack was easy, it
crushes up small and is super lightweight. If I had
one suggestion for Zerofit it would be to add in
thumb loops.
It’s not often a new product comes on the market
and lives up to the hype Zerofit has delivered all is
promised and more.
For more info visit: www.zerofit.com.au
68//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

You don’t need it, but
you sure will want it -
high quality gear for serious adventures.
www.lightandfast.co.nz

EXPANDING
HORIZONS
EXPLORING WITH
A ROD IN HAND
Words and images by Matt Butler
New Zealand is a place of expansive wonder shaped by
weather and water. Huge rugged peaks give way to cascading
cliffs, with sweeping valleys in which rivers are born and then
flow to feed the vast Pacific Ocean. These rivers form not only
our land, but are also the guiding pathways for our roads and
tracks to follow.
Almost every hiking track in NZ follows a river or stream for
at least some, if not all of their journey. They weave up the
valleys, follow the banks and occasionally pass over with the
help of a rickety swing bridge.
The river is often seen as just an accomplice to the hike,
sometimes nice to look at, swim or drink from but little else.
But what would you think if I told you the water could become
your chief inspiration for adventure? Something that can take
you deep into places you never even realized or imagined you
could go. Places where you are unlikely to see another soul
and where you never have to sleep near a stranger. These are
the places we explore with a Fly Fishing rod in hand, forever
pushing forward not to the end, but just to see what is around
the next bend.
How fly fishing opened me up to the world…
I fell in love with the sport of fly fishing at a young age, not
only because I had a burning desire to fish, but also because
it gave me a motive to explore new places, some of which I
never expected to find. The pursuit of trout was all that was
required to get me out there and more often than not it resulted
in nothing more than a walk beside the river. Regardless of the
outcome, every time I learnt something new, stoking the desire
to go further in search of new water, new landscapes and new
experiences.
Fly fishing is all too often thought of as an old guy standing
in the river for hours on end, flicking back and forth his line,
without so much as a few footsteps. This may have been
common in days gone by but the sport is now growing into an
lauded adventure activity. It’s now common to push the limits of
how far you can go into the wilderness and even something in
which you would choose to travel across the world to pursue.
My love for fly fishing quickly developed into an obsession, as
I spent every available moment exploring the valleys of the
Waikato and Bay Of Plenty. From twisting spring creeks of the
South Waikato, through to thunderous gorges of the Central
Plateau and everything in between. Fly Fishing allowed me
to understand the twists and turns of the region like the back
of my hand. It made me eager to start exploring further and
challenge myself against the best, so it wasn't long until I made
my move to chase trout in the South Island and eventually
around the world.
70//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

I fell in love with the sport of fly fishing at a young age, not only because I had a burning desire to fish, but also
because it gave me a motive to explore new places, some of which I never expected to find.
ADVENTUREMAGAZINE.CO.NZ//71

Above L-R: The diversity of NZ’s landscape is clearly seen when your hunting trout / The fish are often as beautiful as the scenery
Fly fishing can take you to the wildest of places like the depths of Fiordland / Right: Netting a solid trout on a thunderous high country river
At 24 years old I moved to Wanaka to indulge in the spectacular
waters of the Southern Alps. This quickly morphed into wanting
to be out there every day, so I took the leap and became a
Fly Fishing guide. Not only did this allow me to explore further
and deeper into New Zealand than I ever dreamed possible, it
also provided me opportunities to spend my winters fishing in
far flung corners of the world, from Iceland to Japan and many
places in between.
I was never an overly eager tramper, camper or anything of the
sort. Although I loved being out in the wild, I always needed a
reason to be there, rather than just making it to the ‘end’ or to
the ‘top’. It was the river and fly fishing that opened up New
Zealand to me. I now had a reason, a goal for walking three
days into a backcountry valley I had never seen before. Or
even to the otherside of the world into the Alligator infested
everglades to chase Tarpon. It was not the species of fish that
mattered, it was the pursuit of a fish on the fly that gave me
motivation.
---------------
Hiking (or Tramping) in New Zealand is as old as the first
settlers. It was common for local Māori to hike across the
passes from Queenstown to Wanaka for food gathering and for
European explorers to go on a wild goose chase in search of
gold. One thing they all had in common was their single minded
purpose and having a distinct motivation to push further.
These days a hiker's motivation can range from making it to the
next hut, conquering a mountain or completing a great walk and
many other adventures. Although there is nothing wrong with
this, there is still one thing all have in common, they follow a
predetermined path to a set destination. The thing I love most
about fly fishing is a sense of the unknown, the true adventure
of it all. How will you access the water, will you need to cross
the river or climb over a gorge? Can you even get around the
next bend without some goat-like traverses? Is it worth pushing
forward or is it time we should turn back? These questions keep
me exploring.
The variety and abundance of waterways in New Zealand is mindboggling.
From one place to another can often feel like you are
in a different country, as the bush lined green water is replaced
by the crystal blue water in wide open river valleys. Many of
these places have no defined track or trail, requiring instead a
doggedness to venture and figure it out as you go. Just like in my
younger days, these trips often result in nothing more than a nice
walk. But still that feeling of going somewhere you never have
before can fire up more energy than a shot of caffeine.
Fly Fishing in these waters is unlike anywhere else on the
planet, you slowly stalk streamside, eyes fixed on the water in
the hope of seeing a conspicuous shape swaying in the current.
Most of the time you do not see anything, you keep moving,
sometimes covering a serious amount of ground in a day
without even realizing it. Then you find your target, it becomes
a tense battle of cat and mouse as you try to persuade a fish
that your offering is worthy of eating, and if it is then it becomes
full blown hand-to-hand combat. If you're lucky enough to get
a fish successfully in the net, then the best experience of all
is carefully removing the hook and releasing it back into the
water to fight another day. There is little else that can offer such
a fulfilling feeling of accomplishment and appreciation for the
land, animals and water surrounding you.
The sport of Fly Fishing is actually more akin to the feel of
hunting than it’s namesake ‘fishing’. It feels this way as you are
always on the prowl in search for your next target, only stopping
when necessary. You will find yourself scouring over topo maps
in search of that next river to explore. Heading deep into the
backcountry, staying in DOC huts or camping under the stars,
walking for miles into the untouched wilderness. That is what
Fly Fishing in NZ is all about.
---------------
The first step to starting on this new journey is to learn the ins
and outs of the sport. Fly Fishing requires a unique set of skills
that although can take some time to master, they are not hard
to learn. It is not unusual for an angler to spend their whole life
learning the intricacies of a certain species, their behavior and
how best to target them. Luckily in NZ we have an abundance
of both Rainbow & Brown Trout in almost every river and lake.
This means that no matter where you are in the country, it’s
likely you will have a place nearby to start practicing.
Getting started in is not as costly or complicated as you may
have been led to believe, all you need is a few basic things to
get started.With many affordable options on the market these
days, this full setup can be assembled on any budget:
1. Rod, Reel, Line - whatever you can afford is fine;
2. Basic selection of flies - nymphs and dries;
3. Polarized sunglasses; and
4. Fishing Net.
The gear you buy does not define the type of angler you are,
practice is key. So once you are set up, then it’s just about
getting out there, practicing your casting and learning how to
read water. Start in the backyard then head out to explore your
local waterways, access points can easily be found on the Fish
& Game website.
By taking on the pursuit of fly fishing, the country and all its
beauty will open up to you as you explore the far corners in
search of trout. Should you become a lifelong addict like many
anglers are, you will be amazed at just how fulfilling both the
sport and the experience can be, allowing you to explore,
connect and grow.
So as a keen angler says - Enjoy it out there and ‘tight lines!’
If you’re interested in learning more about Fly Fishing and gain
some tips, tricks and advice about how to start and progress
through the angling journey. This is all available on my ‘Live
Wild Journal’ at: www.keaoutdoors.com
72//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

ADVENTUREMAGAZINE.CO.NZ//73

FEED YOUR ADDICTION
Like a ‘perfect storm’, we have seen a dramatic growth and
development in online stores over the past 5 years.
We are dedicating these pages to our client’s online stores; some
you will be able to buy from, some you will be able drool over. Buy,
compare, research and prepare, these online stores are a great way to
feed your adventure addiction.
Never have a dead phone
again! Because now you can
charge straight from the Sun
with SunSaver. Perfect for
that week-long hike, day at
the beach, or back-up for any
emergency. Check us out at:
www.sunsaver.co.nz
Building versatile and reliable gear so you
can adventure with purpose.
www.keaoutdoors.com
Temerature. Taste. Transport.
Hydroflask, more than just a water bottle.
www.hydroflask.co.nz
Our mission is to produce
the best quality beers
possible across a range of
flavours and styles and to
have fun doing it!
www.dcbrewing.co.nz
Gear up in a wide selection of durable, multifunctional
outdoor clothing & gear. Free Returns. Free Shipping.
www.patagonia.co.nz
Stocking an extensive range
of global outdoor adventure
brands for your next big
adventure. See them for travel,
tramping, trekking, alpine and
lifestyle clothing and gear.
www.outfittersstore.nz
Specialists in the sale of Outdoor Camping Equipment, RV,
Tramping & Travel Gear. Camping Tents, Adventure Tents,
Packs, Sleeping Bags and more.
www.equipoutdoors.co.nz
Our very own online store where
you will find hard goods to keep you
equipped for any adventure.
www.pacificmedia-shop.co.nz
www.lightandfast.co.nz

Zerofit is a range of base layers
and lifestyle clothing straight
out of science fiction.
Using your body movement, it
keeps you warm and improves
your performance.
www.zerofit.com.au
Meals bursting with flavour, combined with home compostable
packaging, means you really can have it all in the mountains.
Designed by ‘foodies’ for maximum plant-based deliciousness
and wrapped in earth positive, lightweight, packable pouches.
www.localdehy.co.nz
Bivouac Outdoor stock the latest in quality outdoor
clothing, footwear and equipment from the best
brands across New Zealand & the globe.
www.bivouac.co.nz
Shop for the widest range of Merrell footwear, apparel
& accessories across hiking, trail running, sandals &
casual styles. Free shipping for a limited time.
www.merrell.co.nz
Norsk designs and builds ice coolers that without fail,
will not fail. Perfect for your hard out adventures.
Free shipping within New Zealand.
www.norsk.co.nz
Living Simply is an outdoor clothing and equipment
specialty store in Newmarket, Auckland. Your go-to place
for quality footwear, packs, sleeping bags, tents,
outdoor clothing and more.
www.livingsimply.co.nz
www.glerups.co.nz
glerups shoes, slippers
and boots are known for
their exceptional comfort
and unique design.
Over the years we have
perfected the wool mix
by blending Gotland
wool with quality wool
from New Zealand
farmers.
Fast nourishing freeze dried food for adventurers.
www.backcountrycuisine.co.nz
Sustainably designed outdoor gear that fuels both
adventure and global change, by dedicating a
percentage of revenues to nonprofits working to improve
the human condition. www.cotopaxi.com
Supplying tents and
camping gear to Kiwis
for over 30 years, Kiwi
Camping are proud to
be recognised as one of
the most trusted outdoor
brands in New Zealand.
www.kiwicamping.co.nz
With stores in Clyde and
Cromwell, Bike it Now! is
your access point to the
Central Otago Bike trials: T
> Lake Dunstan Trail
> Otago Central Rail Trail
> Roxbourgh Gorge
and more...
New Zealand’s first online
store solely dedicated to
Non Alcoholic adult drinks.
www.clearheaddrinks.co.nz
www.bikeitnow.co.nz

Serving Hot Mexican & Cool Margaritas since 1995
Locations in Alexandra, Cromwell, Dunedin, Invercargill, and Wanaka
See the latest menu and BOOK ONLINE at
www.amigos.co.nz
@amigos_nz

t r a v e l
CLIMBING MT SILISILI
Words and images by Ross Bidmead
The climb began with an ava (kava)
ceremony with the matai (chief). We
were welcomed into his fale (house)and
invited to sit cross-legged on the floor. A
cup made from half a coconut shell was
dipped several times into the ava pot
and poured back to test the colour and
consistency of the ava. Once he was
satisfied with its look, the cup was formally
offered to me, and I raised the cup with
two hands, said "manuia" and drained it.
The bitter liquid numbed my tongue, but
it otherwise had little effect. Margaret and
Tino, in turn, drank a toast from the same
cup before the ceremony continued with
the guide and porters, who drank several
cups as if hydrating for the hot walk
ahead.
Mt Silisili, at the height of 1,858m, is the
highest point in this part of the Pacific;
located on Savai'i, the larger but less
populated of the two main islands
of Samoa, it had always seemed a
fascinating place to explore.
Margaret, who was a friend and client
from a cycle tour, asked if I could organise
a trip; the opportunity was too good to
pass up. Never mind that there was
no route map, and I had heard rumours
of a lack of water, hidden trials and the
need for a guide. Planning and research
are half the fun of any trip; we knew the
starting point and had a phone number for
a local guide.
I called the guide, "Yea, no problem; we
provide sleeping bags, tents, and cooking
equipment. Just bring your own food." It
sounded easy, and we arranged a place
and time to meet. Like with all adventures,
what could go wrong?
Villages own most land in Samoa under
the customary title, and it is usual to
have to pay an access fee. It is, without a
doubt, far better to pay the small access
fee and employ local labour than have
the village need to earn revenue from the
native forest by milling it.
We live in Samoa half the year, running
bike and kayak tours, while Margaret
worked in Apia as an epidemiologist
studying Filariasis (elephantiasis, a
tropical disease carried by mosquitos).
Tino, our leading kayak guide, joined the
group both as an interpreter and to learn
the route.
The recognised route up Mt Silisili starts
at Aopo village. The mountain's highest
settlement, yet it is still only 200m above
sea level. Aopo was on our cycle route
around Savai'i and a regular stopping
point as it was at the top of the steepest
hill of the ride. It was one of the few
villages unable to rely on protein from
fishing and always seemed poorer than
most. The shop seldom stocked soft
drinks but, when asked, would offer beer
instead!
Our instructions were to stop at the church
when we arrived, and the guide would
meet us. There was no one there, so I
phoned the guide. "I live in Apia – I only
organise the trips, but you're expected."
Eventually, the confusion was sorted, and
we were directed to a fale on a dirt road
where we were welcomed by our guide
Talu and porters David and John.
With the ava ceremony complete, Talu
produced tents and sleeping bags for the
trip. Living on the coast in Samoa, I was
used to sleeping under just a sheet, but
we could expect temperatures around
12°C at the campsite. I'd also had to find
a raincoat and jersey, items I didn't usually
need. It can rain in Samoa, but a jacket
with the best Gore-Tex fabrics usually
means getting wet from the inside while
overheating.
I'd expected to leave the car in the village
and start from there, and retrospectively
we should have! But the guide convinced
us that the road was passable and would
save a couple of hours. . With the six of
us and all our gear in our our small AD
Van station wagon, it nearly rested on the
bottom of its suspension and we picked
our way slowly up the steep, overgrown
road. I misjudged and grounded the car
hard on a rock hidden in the grass. With
everyone out and pushing, we cleared it,
but there was a new vibration somewhere.
The van was not an offroad vehicle.
Wishing I had bought the Pajero, we
ground on slowly past taro plantations and
regenerating forest until we reached a
grassy clearing by a stream.
From here, a ground trail led into the
forest. We were soon surrounded by
giant dark trunks up which monsteras
climbed, their vast, holey leaves providing
a green contrast. Everything was wet,
and epiphytes were everywhere. Much of
Samoa must have been covered in this
tropical rainforest, but this was the first
remnant of the original that I had seen.
We climbed on, slowly traversing to the
right as the trees got smaller. There were
almost no track markers, and the route
was not marked on any map.
Without a local guide, it would have been
challenging. At a flat spot on a ridge, there
were obvious signs of a regular camp spot
and a kettle hanging in a tree. The guides
grabbed it as their only cooking pot, and I
was glad I had put in a billy.
Later we emerged from the forest onto
lava fields from the 1902 eruption of Mt
Mata o le Afi. Twisting an ankle here
would be easy, and there is no helicopter
or organised mountain rescue service in
Samoa.
From here, the route opened to the crater
of Mata o le Afi; a deep hole surrounded
by acres of coarse dark sand devoid of
vegetation. A local company had wanted
to quarry the sand and had built an access
route to here (via a different path than the
track we used). Fortunately, the nearby
villages vetoed the plan as they did not
wish to awaken the volcano.
Where the first vestiges of vegetation
reappeared, there were the remains of a
campsite. The two small water tanks with
catchments barely more than a length of
guttering were full, and our water worries
were over. We had arrived here much
earlier than expected, and the weather
gods were smiling on us, granting a
sunny, cloud-free day, a rarity up here.
We continued to the top, following a small
trail meandering around a wetland with
several deep ponds. A short climb through
a spindly forest brought us to the top after
little more than an hour. As there was only
a narrow view inland through the spindly
clouded forest, we headed back to the
campsite after a quick round of photos.
We pitched our tents while the guides
prepared a fire and boiled the kettle found
ADVENTUREMAGAZINE.CO.NZ//77

at the lower camp. But to our surprise,
they made a large pot of tea sweetened
with condensed milk and sugar to the
point where we couldn't drink it. They
then kept the remainder in the pot for their
evening use. So much for "the guides
will bring the cooking gear." It wasn't
like the guiding service we were used to
from Nepal. This was just a difference
in expectations. They were friendly
and helpful but expected us to be selfsufficient
in food and cooking.
The weather was turning on a charm
offensive. When we eventually wandered
over to the crater rim, the stunning views
Always handy to find a spare kettle hanging in a tree
of the coast and the Falealupo Peninsula
at sunset were a good reward for our
additional effort.
Tramping meals are usually a trip
highlight, but with our limited access to
supplies in Samoa and even more limited
access to cooking resources at the camp,
the meal became a slow refuelling stop.
Fortunately, Margaret had lived here long
enough to be unfazed, and the challenge
only added to the adventure.
Walking down was uneventful, but as
we started down the road in the car,
the vibrations got steadily worse. After
dropping off and thanking our guides,
we limped on. The car was in danger of
rattling to death above 30kms/hr, forcing
us to stop in a village and borrow a
hammer. Tino and I took turns to crawl
under the car and bash the recalcitrant
bearing nearer the right place. We gained
some speed but couldn't reach the Samoa
open road limit of 56 km/hr!
The day finished at the Beach Fales at
Manase where we swam and then relaxed
on the beach with a glass of wine and the
setting sun. Adventures are always better
with a few challenges.
Contact Ross and Frances at: office@outdoor.co.nz to organise a custom tour or to join a group.www.outdoorsamoa.com
Sunset towards the Falealupo Peninsula
A great way to end the day
The original vegetation of Samoa and a
clear view to the top of Mt Silisili
Ross, Tino and the guide team - Note the
special jandals for rough and muddy terrain
78//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

Beautiful Samoa awaits you, and we are welcoming our international aiga
with open arms! Experience Samoa’s untouched beauty, unique cultural
experiences and rich heritage. Self drive, bike or stroll through the wonders
that make this island life one to cherish just like the locals do.

Cook Islands.
Lonely Planet’s top place to visit in 2022
Float above the world’s bluest blue
OVERWATER HEAVEN

Images by Steve Dickinson
Surround yourself in an
ocean of beauty while diving
in The Islands of Tahiti. Here
you’ll dive in the presence
of deep-sea giants such
as sharks, rays, turtles and
dolphins.
Our waters are teeming with
life where each dive brings a
new treasure to uncover and
a new story for you to share.
DIVING.TAHITITOURISME.COM

t r a v e l
The stunning backdrop that is Teahupo'o
TEAHUPO'O
MAGESTIC, STUNNING AND TERRYFYING
Words by Steve Dickinson | Images compliments of WSL/ Damien Poullenot
Covid is bad enough, but to see the those two ugly
little lines on your RAT test the day before you are
meant to leave for Tahiti is so frustrating. Weeks of
planning had gone into the coordination of getting us
to Tahiti and to the WSL (World Surf League) event
at the legendary location, Teahupo'o. To make it
worse this year was really special because it was the
first time that female competitors have returned to
compete at Teahupo'o after a 16 year hiatus.
Teahupo'o means ‘The pile of heads’ or ‘The heap of
heads’. It supposedly honours the son of a murdered
chief, who revenged his father's demise by killing
and eating the brain of his father's murderers. It is a
dark name for such a magical place. On the island of
Tahiti Iti, which is linked to the main island of Tahiti by
a slim causeway, you’ll find Teahupo'o. Commonly
known as the end of the road, and it is literally the
end of the road, Teahupo'o is a rural jungle-like
setting with a backdrop of lush green-coloured
mountains. A river flows out from the mountains
through the lagoon and has caused a unique coral
formation, which not only gives some of the best
waves in the world it also creates an amphitheater
for spectators in boats to be close to the breaking
waves.
Unlike soccer or rugby, surfing is a sport basically
done in isolation or with just a few others. There
maybe be crowds on the beach, but not just meters
away, right there on the sideline. But at Teahupo'o, it
is different. Waves can be massive, and you can still
be within a relatively short distance and still be safe
(well, fairly safe).
Teahupo'o is all about the barrel, the breaking wave
that tubes. In many parts of the reef, there is only
50cms of water between the reef and the water
surface, which creates amazing waves but falling off
can be unpleasant.
In simple terms, this magical thick heavy wave
is created by a dramatic change in water depth.
Approximately 50 metres out to sea from the shallow
reef, the sea drops to more than (15 metres). This
means swells coming towards the reef transform
from deep water swells to shallow reef waves in a
markedly short distance. This then causes the wave
to rise up suddenly over the reef before pounding
down with extreme force and then dissipating into
the lagoon.
Teahupo'o is renowned as a thick-lipped wave which
can at times be incredibly hollow. Thick heavy waves
breaking over shallow reef, barrelling, makes for
an amazing visual spectacle, but the surfers need
not only to cope with the wave but the fear the
consequence should they fall onto that shallow reef.
ADVENTUREMAGAZINE.CO.NZ//83

So, with Teahupo'o, not only have you a
magical Pacific setting with clear water and
some of the best waves in the world, you can
also be within meters of the activity. Then add
in the best surfers in the world, and it is an
event we have long been waiting for.
Then came covid.
But we did get to watch the event on
television from the comfort of our couch in
front of a roaring fire. Not quite the real deal
but pretty good none the less. We could not
shoot our own images this year, but thanks to
the WSL for providing them, and as you can
see, it was stunning.
The event is run over a two-week period
where WSL choose the best three days to
run the event. There was an infuriating week
of lay days as the swell just failed to turn up,
but on the Thursday of the second week, the
waves turned on at 5-8 ft. The event was so
exciting, and we could go through each heat
blow by blow.
But the highlights were 50-year-old Kelly
Slater’s flawless run to the semifinals. Nathan
Hedge, who was the 40-year-old wildcard
surfing like a 20-year-old and the humble
Matthew McGillivrays perfect 10 (the best
score you can get in surfing). Spectators
sitting at home and in the flotilla of boats
close to the waves were rewarded for their
weeklong patience with everything you could
want from a season-ending event.
But the biggest story of this event was Kauli
Vaast, the local boy who has won his spot
through the trails, who lives at Teahupo'o
and stormed his way to the finals with the
most dominant performances of the event.
At only 20 years old, he showed his class
when he came up against the 50-year-old
GOAT Kelly Slater, 11 times world champion,
in the semifinals and beat Slater 17.33 to
1.17. Kauli’s charge to the winning post was
stopped by an in-form Miguel Pupo, who
found a 9-point ride in the final to narrowly
beat out the local 17.17 to 15.00.
Two of the event highlights:
Above: Kelly Slater
Right: Nathan Hedge
84//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

ADVENTUREMAGAZINE.CO.NZ//85

Top: Courtney Conlogue took out the Outerknown Tahiti Pro at Teahupoo
Inserts: Kauli Vaast's support crew cheered loudly | Miguel Pupo overcome with emotion after taking the win at Teahupo'o
Bottom right: Kauli Vaast showed how important wave knowledge was at his local break, Teahupo'o
16 years ago, we were there to witness the last time the
women competed at Teahupo'o. Not a lot had changed. The
waves were still mean, and if you got it wrong, there are
profound consequences, so naturally, nerves were on edge.
From the first heat, the woman to beat seemed to be Vahine
Fierro, the local girl who understood Teahupo'o well. But
Vahine was eventually stopped in the semifinals by one of the
regular CT competitors Brisa Hennessey.
The other in-form surfer was Courtney Conlogue, who is
renowned for her athleticism, fitness, and grit. Courtney,
out of all the women, seems to be able to tame the wild and
dangerous beast that is Teahupoo. She convincingly won the
women’s event and proved that women could surf Teahupo'o
just as well as men.
As a side note, with the Olympics looming in 2024, Tahiti is
set to host the surfing for the Paris Olympics, and Teahupo'o
will be where that portion of the competition will be held. This
will be a challenging event for everyone involved but, again,
another huge spectacle.
Surfing is part of the lifestyle in Tahiti; waves are on nearly
every island and surf, (unlike Teahupoo), which can suit
everyone. Teahupo'o to surfers is like Everest is to climbers;
it is the pinnacle of the sport, but not many get to climb or
even want to climb Everest, but there are still lots of other
hills and mountains to climb. Same with surfing in Tahiti,
if Teahupo'o is beyond your skill level (as it is with most
people), then there are a lot of other options, reef breaks,
beach breaks, some remote, some close to town, but the
common denominator is the water is warm and clear, the
people friendly and the waves are always great!
86//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

*

t r a v e l
VANUATU
8 LIFE-CHANGING
HIKING EXPERIENCES
As you might expect from a jungle-covered archipelago, Vanuatu
has some of the best tropical trekking in the world. Where else
can you hike to the rim of an active volcano, sleep in kastom
villages or cool off under roaring waterfalls? From half-day hikes
on the main islands to multi-day jungle treks on the outer rim,
there’s some truly epic scenery to explore in Vanuatu.
1. Nguna Extinct Volcano (pictured: Image by Ben Savage)
(3 hours from the bottom of Nguna)
An hour away from Port Vila’s bustling city centre and resorts
lies Nguna and its sister islands, Pele and Emao. Located in the
crystalline water of the Uduna marine channel, the islands are
home to 16 local communities that have created the Nguna-Pele
Marine Protected Area. This pristine environment of lagoons,
reefs, mangrove forests and bush gardens is the perfect
landscape for following your guide to the top of Mt Taputoara, the
highest of the two extinct volcanoes on Nguna Island. The trek
takes you through several welcoming villages and is a steady
uphill climb to the edge of the crater at 593 metres above sea
level. Some parts of the track are steep, but it is well worth the
effort, as you will be rewarded by sweeping views across the
Shepherd Islands to the north and south to Efate.
2.Dog’s Head Trek, Malekula
(2-day trek departing Norsup)
Malekula is shaped like a sitting dog, and the northern part of
the island, the ‘Dog’s Head’ is crisscrossed with some of the best
hiking trails in Vanuatu. A popular route is known as the Dog’s
Head Trek. It’s a two-day hike from Malekula’s east coast, all
the way over the rugged hinterland mountains, to the charming
western village of Tenmaru. Along the way you’ll meet the Small
Nambas and Big Nambas (two of the island’s major tribes), get
a crash course in Malekula’s history of cannibalism and swim in
cascading river pools, hidden deep within the forest.
3. Mount Garet Hike, Gaua
(3-day trek, starting Gaua Airport) Rising from the sea in the
north of Vanuatu’s archipelago, Gaua is the country’s unofficial
adventure capital. Mount Garet is the island’s highest peak, an
active somma volcano (it last erupted in 2011) surrounded by
a horseshoe caldera, the beautiful Lake Letas. Travellers can
embark on a three-day hike to explore Mount Garet. You’ll climb
to 711 metres above sea level, see bubbling lava and volcanic
mud pools and swim beneath the stunning 120-metre high Santa
Maria waterfall. At night, you can sit around the campfire on the
shores of Lake Letas and swap stories with your local guides.
88//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

ADVENTUREMAGAZINE.CO.NZ//89

4. Benbow Crater Hike, Ambrym
(Pictured above: Image by Ben Savage)
(2-4 day hike)
The island of Ambrym has always been
one of the more mysterious in Vanuatu’s
archipelago. It’s known as the Black
Island, due to its volcanic soil and history
of dark magic. But it’s also home to two
of Vanuatu’s most active volcanoes –
Mount Marum and Mount Benbow. There
are dozens of hiking options through the
surrounding jungle. If you’re feeling fit,
you can try the one-day hike to Benbow’s
crater rim (a 10-hour round trip), or you
can sign up for two, three or four-day
treks that allow you to explore the whole
volcano field. If you’re planning a trekking
holiday on Ambrym, travelling between
August and January is generally best.
7.Losinwei Cascades Walk, Malekula
Not all 6 Vanuatu’s treks require a fullystocked
backpack and several days
up your sleeve. Malekula’s Losinwei
Cascades Walk is the perfect example.
It’s a half-day hike into the misty foothills
of central Malekula. Guides will lead
you through the forest, surrounded by
tiny orchids and flowering irises, to the
picturesque Losinwei Waterfall. You can
swim beneath the falls, climb the rock
face to find hidden limestone pools,
and generally laze the day away before
trekking back down to Losinwei Beach.
5. Trek Tanna, Tanna
(4 hours, starts Mount Yasur ash plains)
In 1774, the sparks of Mt Yasur volcano
attracted Captain James Cook during
his journey through the South Pacific. It
has since been called ‘the Lighthouse
of the Pacific’. Take a once-in-a-lifetime
adventure that follows in the footsteps of
the famous world explorer and barefoot
warriors to the top of exhilarating Mt Yasur
volcano. Start your expedition on the ash
plain and enjoy the breathtaking views;
meet the John Frum cult village; and feel
the power of the volcano as you climb its
slope. As the sun sets after an afternoon
of bushwalking, you will stand close to
the edge of the crater, 361 metres above
sea level, and be rewarded by the most
fascinating and thrilling natural fireworks
and panoramic views.
6. Manbush Trail, Malekula
(4-day hike)
The Manbush trail is an unforgettable
four-day hike from east to west across the
wild highland rainforest of Malekula. The
trek takes you to the stunning South West
Bay and its pristine black and white sand
beaches, passing through the summit of
Mt Laimbele, 850m above sea level with
360-degree views of the archipelago.
Along the way, you will encounter dense,
untapped jungle, traverse incredible
rivers, snack on island bush foods and
climb to an incredible 850 metres above
sea level. At the end of the trek, there’s
still time to cool off in the clear waters
of the Matanoi River. Accompanied by
not-so-ancient tales of cannibalism,
you’ll follow your local guide into the dark
bush and make yourself at home in selfsufficient
remote villages – where you will
sleep in local houses and learn all about
traditional kastom living. The Manbush
trail crosses rivers, passes through deep
bush and climbs steep ground. It is a
challenging expedition for experienced
bushwalkers, taking you on a journey to
a part of the world rarely seen by most
people.
8. Millennium Cave, Espiritu Santo
Millennium Cave is one of Santo’s most
famous natural attractions. It’s also the
largest cave in Vanuatu. The trek to reach
the cave isn’t the longest walk in the world
(it takes around 90 minutes from Vunaspef
village) but the route is challenging. You’ll
be scrambling up slopes, fording streams
and climbing giant river boulders. But it’s
well worth the effort as Millennium Cave
is truly stunning. You’ll explore the cave in
the dark, using nothing but a torch, learn
about local food and kastom, and cool off
in the rock pools outside the cave. It’s one
amazing – if exhausting – Santo day tour.
For More Information: www.vanuatu.travel/nz/experiences/hiking-guide
For Specialised Services contact: vanuatuecotours.com and wreckstorainforest.com
90//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#234

9.30am Mt Yasur on Tanna Island
Hiking Diving Culture
Volcanos
Go explore at vanuatu.travel

There’s always something happening at Surreal
3 Levels with the best Rooftop Terrace in town.
House Made Mulled Wine, Mulled Cider and $15 Cocktails sets you up for Apres Ski.
Delicious and affordable crowd pleasing food favourites.
Team that up with an exceptional Bar Menu with the happiest team in town and you’re set!
The heated ROOFTOP TERRACE is always the place to be any night of the week.
Fridays, Saturdays and Sundays we step it up a notch with the hottest DJs in town.
Downstairs offers all your sporting action with entertainment every night of the week.
Check out our website for all the latest info on Events, Specials and Gig Guide.
Surreal Bar and Restaurant - Open from 12 until late.
7 Rees Street, Queenstown
Phone: 03 441 8492 www.surrealbar.co.nz

A l p i n e R e s o r t
Terrace Restaurant & Bar Open daily
5 minutes from Whakapapa Ski field
Backpacker to Superior Family Accommodation
On-Site Ski & Snowboard gear hire
Skotel Alpine Resort | SkotelAlpineResort
Ngauruhoe Place | Whakapapa Village, SH 48
www.skotel.co.nz | info@skotel.co.nz
+64 7 892 3719 | 0800 756 835
Dual Heritage
Tongariro National Park
Sky Waka Hot Deal
2 Nights in a King Studio | Breakfast Daily | 2 x Sightseeing Pass Sky Waka
2 x Mini Golf pass | $50 Food & Beverage Voucher
BYO Bikes & explore our 4 biking trails from National Park Village
Free wifi & parking | From NZD $599
17 Carroll Street, National Park 3948
info@plateaulodge.co.nz | +64 7 8922993
www.plateaulodge.co.nz
The Old Nurses hOme
GuesThOuse
Welcome to The Old Nurses Home Guesthouse
This historic renovated building in Reefton allows you to enjoy the stunning
Victoria Conservation Park with access to outstanding bush walks, historic
mining sites, and withing walking distance to the famous Inangahua River and
some of the best fishing for trout in NZ. White water raft or kayak the exciting
rivers in the area. Reefton offers a perfect base for MTB riders to explore The
Old Ghost Road from Lyell through the ranges to Seddonville on the West Coast.
www.reeftonaccommodation.co.nz
+6437328881
info@reeftonaccommodation.co.nz

get the
professional
edge!
The V-SHARP® CLASSIC II Elite uses two high-quality, 325
grit diamond rods that simultaneously sharpen the blade
on both sides using calibrated Spring Tension. Ideal for
Kitchen, Fillet, Hunting and most other flat-blade knives.
w w w . k n i f e s h a r p n e r s . n z
Boots
Packs
Rainwear
Sleeping Bags
All your tramping & trail essentials!
Same shop & family since 1988.
Keep powered on any adventure
www.sunsaver.co.nz

Reeecoveeer
Fasteeer
OOOOOOOOOOOOFFOOOOOOSS
ffffffffoooooooooooooooottttttttwwweeeeeeeeaaaaaaaarrrrrrrr
ccccuuuusssssssshhhhhhhiiiiiiiioooooooonnnnnnnnssssssss && ssssssssuuuuppppppppppppoooooooorrrrrrrrttttttttssssssss
yyyoooooooouuuurrrrrrrr ffffffffeeeeeeeeeeeeeeeetttttttt,,, aaaaaaaannnnnnnnkklleeeeeeeessssssss,,, kknnnnnnnneeeeeeeeeeeeeeeessssssss
&& hhhhhhhiiiiiiiippppppssssssss bbbyyy aaaaaaaabbbssssssssoooooooorrrrrrrrbbbiiiiiiiinnnnnnnng 37%
mmmoooooooorrrrrrrreeeeeeee iiiiiiiimmmppppppaaaaaaaacccctttttttt tttttttthhhhhhhaaaaaaaannnnnnnn ooooooootttttttthhhhhhheeeeeeeerrrrrrrr
ffffffffoooooooooooooooottttttttwwweeeeeeeeaaaaaaaarrrrrrrr ffffffffooooooooaaaaaaaammmssssssss.. Afffffffftttttttteeeeeeeerrrrrrrr
aaaaaaaannnnnnnnyyy aaaaaaaaddveeeeeeeennnnnnnnttttttttuuuurrrrrrrreeeeeeee,,, ffffffffeeeeeeeeeeeeeeeell tttttttthhhhhhheeeeeeee
ddiiiiiiiiffffffffffffffffeeeeeeeerrrrrrrreeeeeeeennnnnnnncccceeeeeeee wwwiiiiiiiitttttttthhhhhhh eeeeeeeeaaaaaaaacccchhhhhhh
sssssssstttttttteeeeeeeepppppp iiiiiiiinnnnnnnn aaaaaaaa ppppppaaaaaaaaiiiiiiiirrrrrrrr ooooooooffffffff OOOOOOOOOOOOFFOOOOOOSS..
Feed your adventure!
Vegan
Sustainable
Made in Wānaka
Order online: www.localdehy.co.nz
LOCAL DEHY
FOOD FOR THE HILLS HILLS
glerups.co.nz
Find us online and at a stockist near you

“Escape ordinary”
Caring luxury | Local flavour | One of a kind
Mountain bike clean up area and a secure mountain bike storage area available
1191 Pukaki Street, Rotorua
p: +64 7 348 4079 | w: regentrotorua.co.nz
S.A Shuttles are a specialists when it comes to Auckland Airport shuttle
services. We pick-up passengers from the Airport and deliver to; hotels,
motels, CBD and the suburbs (door to door). This service is available to
meet every flight arriving into Auckland Airport.
• BOOKED shuttle services to meet flight
• On demand shuttle services for group bookings
• Direct shuttle for individual needs
• Corporate Transfers for Business Client
We also do tours around the North Island | www.southaucklandshuttles.com | bookings@sashuttles.com | 0800 300 033 (Toll free)

A digital currency
designed for everyday
payments
qoin.world
Available to download on

THE ALL-NEW 7-SEAT