29.09.2022 Views

Adventure 234

Spring issue of Adventure: Camping and tramping issue

Spring issue of Adventure: Camping and tramping issue

SHOW MORE
SHOW LESS

Transform your PDFs into Flipbooks and boost your revenue!

Leverage SEO-optimized Flipbooks, powerful backlinks, and multimedia content to professionally showcase your products and significantly increase your reach.

adventure<br />

where actions speak louder than words<br />

where actions speak louder than words<br />

SCALING<br />

EVEREST<br />

"WITH A<br />

LITTLE HELP<br />

FROM<br />

MY FRIENDS"<br />

ISSUE <strong>234</strong><br />

OCT/NOV 2022<br />

NZ $10.90 incl. GST


time to get busy<br />

The effects of global warming will effect us all at some stage<br />

Even when we really try not to be, we are, by nature, selfish<br />

creatures. At our core belief, the instinct of fight or flight is what<br />

has kept us as species alive; there was never an option to give up<br />

and be eaten. But there really is a third option: just ignore it, and it<br />

might go away.<br />

I consider myself a pretty good citizen; they ask us not to speed, I<br />

don’t speed; they ask us to wear a mask, I wear a mask; they ask<br />

us to get vaccinated, and I get vaccinated. But when it comes to<br />

the more significant worldwide issues I can be a little savoir-faire.<br />

Sure, I say the right words or nothing, but if it does not affect me,<br />

then it tends not to mean too much to me.<br />

For example, global warming or climate change, I know it’s been a<br />

hot topic for a while, but it didn’t really worry or affect me – excuse<br />

the weather analogy, but I considered it a bit of a storm in a teacup.<br />

Now that ‘teacup storm’ has spilt over into my saucer.<br />

Enter selfish Steve...<br />

In June this year, we moved to the Central Plateau to ski,<br />

tramp and fish during the winter season. What was evident<br />

from basically day one was how warm it was. We had a nice<br />

early dump of snow, and everything for Ruapehu seemed to be<br />

on track; covid was behind us, lockdowns a thing of the past<br />

and snow was now on the slopes. But with unusually warm<br />

winds blowing in from Australia, which we get sometimes but<br />

not as consistently as this year, weather patterns that had<br />

historically bought snow to the mountain instead bought rain and<br />

continuously washed off whatever snow managed to stick to the<br />

slopes on the chillier days.<br />

Some years we have had a very early dump of snow in May;<br />

everyone since has had expectations of the ski season starting<br />

with everything open, but as it drags out slow to fully open, as it<br />

often does, the optimists among us always maintain - its winter<br />

and snow will come - in 2022 it really didn’t. With Ruapehu<br />

not getting its usual allocation of good snow in 2022, maybe<br />

not be under the banner of global risk; but when you squeeze<br />

past the conspiracy theorist and start looking at global warming<br />

phenomena, there are a lot of bright people making a lot of loud<br />

noises that we should be taking note of.<br />

For every consequence of global warming in 2022, it seems to be<br />

some of the worst in recorded history!<br />

• Sea level will rise by 1-8 feet by 2100<br />

• Weather will become more intense<br />

• Long wildfire season. - Nearly 660,000 hectares of European<br />

are the worst in recorded history<br />

• More intense droughts - As in China right now, the worst in<br />

recorded history.<br />

• Global temperature will continue to rise; 2022 was the 6th<br />

warmest year in recorded history.<br />

• Unexpected heat waves -This year's European heatwave<br />

was the highest on record, with temperatures over 40<br />

degrees.<br />

• Flooding in Pakistan was the worst in recorded history<br />

• Melting glaciers<br />

That brings us back to our internal instinct for survival ‘fight<br />

or flight’. There is nowhere to fly to; we are all stuck here, so<br />

that leaves us to fight. The first punch to be thrown should be<br />

awareness, and we will at <strong>Adventure</strong> do our best in coming issues<br />

to look at some of these implications, opinions and how we can<br />

affect the future.<br />

In my google browsing, one quote stood out to me, and that was<br />

by Barak Obama.<br />

“We are the first generation to feel the effect of climate change<br />

and the last generation who can do something about it.”<br />

Barack Obama, Former US President<br />

Its time to get busy<br />

Steve Dickinson - Editor<br />

your <strong>Adventure</strong> starts with Us<br />

23 Locations Nationwide | www.radcarhire.co.nz | 0800 73 68 23 | adventure@radcarhire.co.nz


page 12<br />

Image by Lauren Murray Image by Eric Skilling<br />

Image by Derek Cheng<br />

page 18<br />

page 24<br />

contents<br />

12//The Joys and Pains of Danger Walking<br />

by Derek Cheng<br />

18//Exploring Arthurs Pass National Park<br />

By Eric Skilling<br />

24//Billion Star Overnight Stays<br />

Eric shares his top camping spots<br />

26//On Thick Ice<br />

Ash Routen explores the frozen surface of Lake Baikai<br />

32//Big Pine Lakes<br />

By Paige Hareb and Lauren Murray<br />

38//Focus on Ruapehu Region<br />

• Paddle the Whanganui Journey<br />

• Taranaki Falls<br />

• The Northern Circuit<br />

70//Expanding Horizons<br />

Matt Butler goes exploring with a rod in hand<br />

76//<strong>Adventure</strong> Travel<br />

• Samoa<br />

• Rarotonga<br />

• Tahiti<br />

• Vanuatu<br />

plus<br />

50. gear guides<br />

93. active adventure<br />

FOLLOW US ON<br />

www.facebook.com/adventuremagnz<br />

adventuremagazine<br />

www.adventuremagazine.co.nz<br />

Nzadventuremag<br />

JOIN THE CONVERSATION<br />

#ADVENTUREMAGAZINE<br />

Image by WSL<br />

page 82<br />

EDITOR & ADVERTISING MANAGER<br />

Steve Dickinson<br />

Mob: 027 577 5014<br />

steve@pacificmedia.co.nz<br />

ART DIRECTOR<br />

Lynne Dickinson<br />

design@pacificmedia.co.nz<br />

SUBSCRIPTION ENQUIRIES<br />

subscribe at www.pacificmedia-shop.co.nz<br />

DISTRIBUTION<br />

Ovato, Ph (09) 979 3000<br />

OTHER PUBLICATIONS (HARDCOPY AND<br />

ONLINE)<br />

www.adventuremagazine.co.nz<br />

www.adventuretraveller.co.nz<br />

www.adventurejobs.co.nz<br />

www.skiandsnow.co.nz<br />

@adventurevanlifenz<br />

PUBLISHERS<br />

NZ <strong>Adventure</strong> Magazine<br />

is published six<br />

times a year by:<br />

Pacific Media Ltd,<br />

11a Swann Beach Road<br />

Stanmore Bay<br />

Whangaparaoa, New Zealand<br />

Ph: 0275775014<br />

Email: steve@pacificmedia.co.nz<br />

advertising rates, demographic<br />

and stats available on request<br />

Contributions of articles and photos are welcome and must be accompanied by a stamped self-addressed envelope. Photographic<br />

material should be on slide, although good quality prints may be considered. All care is taken but no responsibility accepted for<br />

submitted material. All work published may be used on our website. Material in this publication may not be reproduced without<br />

permission. While the publishers have taken all reasonable precautions and made all reasonable effort to ensure the accuracy of<br />

material in this publication, it is a condition of purchase of this magazine that the publisher does not assume any responsibility or<br />

liability for loss or damage which may result from any inaccuracy or omission in this publication, or from the use of information<br />

contained herein and the publishers make no warranties, expressed or implied, with respect to any of the material contained herein.


we ARE tramping<br />

Adelaide Tarn<br />

Kahurangi National Park<br />

Photo: Mark Watson<br />

Whether it’s a day trip with the family or a multi-day adventure deep into the wilderness, Bivouac has the best<br />

gear, from the top brands, to keep you safe, comfortable, warm and dry. Our friendly staff are happy to provide<br />

expert advice, ensuring you get the right equipment and the right fit. If you need it for tramping, we have it,<br />

because at Bivouac Outdoor we ARE tramping.<br />

Supporting Aotearoa's Backcountry Heritage<br />

STORES NATIONWIDE<br />

www.bivouac.co.nz


BEHIND THE COVER...<br />

SCALING<br />

EVEREST<br />

"WITH A<br />

LITTLE HELP<br />

FROM MY<br />

FRIENDS"<br />

Former British soldier and mountaineer,<br />

Hari Budha Magar, is calling on the<br />

climbing community to help him prove that<br />

disability is not a barrier as he attempts<br />

to become the world’s first double abovethe-knee<br />

amputee to climb Everest.<br />

Having served in the British Army’s<br />

Ghurka regiment for 15 years, Hari<br />

turned to mountaineering in 2016 as part<br />

of his recovery having lost both legs in<br />

Afghanistan in 2010 after an Improvised<br />

Explosive Device (IED) exploded while on<br />

patrol.<br />

In preparation for his Everest attempt,<br />

Hari has already been the first double<br />

above knee amputee to climb the Mera<br />

Peak (6,476m); Ben Nevis, trek to Everest<br />

Base Camp, climb Mt Toubkal (4,167m),<br />

and climb Chulu Far East (6,058m).<br />

Hari will take on the world’s tallest<br />

mountain in May 2023 – making history<br />

as the first double above the knee<br />

amputee to do so.<br />

Through his expedition, Hari hopes<br />

to inspire veterans, and others with a<br />

disability, to realise that ANYONE can<br />

achieve their dreams, no matter how big<br />

or impossible they may seem.<br />

To attempt the Everest summit, Hari<br />

needs to raise over £300,000.<br />

To help reach this monumental target,<br />

Hari has launched a Crowdfunder<br />

campaign and is calling on the climbing<br />

community to support his expedition.<br />

“Everest is my ultimate challenge,” said<br />

Hari.<br />

“The human body is just not designed to<br />

operate at that altitude. But add to that my<br />

challenges with mobility and speed, and<br />

there is a whole new layer of difficulty.<br />

“It’ll take me longer than able bodied<br />

climbers, so I’m resigned to the fact that<br />

I’ll be starting earlier and finishing later.<br />

We’ve also planned two extra camps if<br />

they are needed.<br />

“That means more kit, and a greater risk<br />

for all of us on the mountain – so we are<br />

planning out every detail.”<br />

The 43-year-old from Canterbury is being<br />

trained by, and climbing with, Krishna<br />

Thapa, former Chief Mountain Instructor<br />

at the SAS and world-renowned climber,<br />

and Hari now has 9 months to prepare for<br />

the ultimate summit attempt in May 2023.<br />

With reduced mobility, Hari uses three<br />

times more energy than the average<br />

climber, with Everest expecting to take<br />

him three times longer than an ablebodied<br />

mountaineer.<br />

He will climb to the 8,848.86m (29,029ft)<br />

summit of Everest across the South Col<br />

route from Nepal, negotiating some of<br />

the world’s toughest mountaineering<br />

conditions.<br />

Cutting-edge equipment and technology<br />

will be important, but this is a true test of<br />

Hari’s human limits, both physical and<br />

mental.<br />

Hari added: “From specially designed<br />

crampons to the heated sockets around<br />

my stumps and the short prosthetic<br />

legs I’ll be using for the climb – we are<br />

developing new technologies that will<br />

allow me to climb Everest.<br />

“But it’s much more than that, everything<br />

needs to be adapted to get me onto the<br />

mountain right down to made to measure<br />

clothing.”<br />

In 2018, Hari joined forces with other<br />

climbers and disability charities to<br />

successfully overturn a ban on double<br />

amputees and the visually impaired from<br />

climbing Everest at the Supreme Court in<br />

Nepal.<br />

“It’s already been an adventure getting to<br />

this point, but through the climb I hope we<br />

can positively transform the way people<br />

with a disability are perceived, and how<br />

they perceive themselves,” Hari added.<br />

Krishna Thapa, who is not only Hari’s<br />

climbing and expedition leader, but has<br />

also been training with Hari since 2016,<br />

said: “I’ve worked with some tough guys<br />

in my time, but Hari is up there with the<br />

toughest.<br />

“If he puts his mind to a task, you are<br />

damn sure that he’s going to give it every<br />

fibre of his being to get the job done.<br />

“There are no words to describe<br />

the monumental challenge that he’s<br />

undertaking, but we’ll be there every step<br />

of the way – and this time next year I can’t<br />

wait to share that special moment with<br />

Hari on top of the world.”<br />

To support Hari’s Everest expedition, visit:<br />

www.crowdfunder.co.uk/p/harieverest<br />

4//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


Image by Andy Bate<br />

www.andybate.com


PATAGONIA<br />

EARTH IS NOW<br />

OUR ONLY<br />

SHAREHOLDER<br />

All images thanks to Patagonia<br />

Over fifty years ago, Yvon Chouinard started Patagonia, as a<br />

climber more than a businessman, he developed a massive<br />

international clothing and accessory company. In those fifty<br />

years, Patagonia has become one of the most respected and<br />

environmentally responsible companies on earth.<br />

This week Chouinard made the most significant commercial<br />

move in the adventure industry history!<br />

Chouinard, his wife and two adult children have reassigned<br />

their ownership of Patagonia and relinquished it, a value of<br />

about three billion dollars, to a trust called Patagonia Purpose<br />

Trust and a non-profit organisation called Holdfast Collective.<br />

These trusts have been created to ensure that the $100<br />

million-plus of Patagonia’s yearly profits are used to combat<br />

climate change and protect undeveloped land worldwide.<br />

Chouinard has given his company away to the betterment of<br />

the planet.<br />

I have been a fan of Yvon Chouinard since reading his<br />

book "Let My People Go Surfing: The Education of a<br />

Reluctant Businessman", written in 2005. Patagonia,<br />

as a brand, has constantly led the way in environmentpositive<br />

based products and has a loud voice regarding<br />

political issues that affect the environment.<br />

From a piece in the New York Times by David Gelles:<br />

"In some ways, the forfeiture of Patagonia is not<br />

surprising coming from Mr Chouinard. As a pioneering<br />

rock climber in California's Yosemite Valley in the 1960s,<br />

Mr Chouinard lived out of his car and ate damaged cans<br />

of cat food that he bought for five cents apiece. Even<br />

today, he wears raggedy old clothes, drives a beat-up<br />

Subaru, and splits his time between modest homes in<br />

Ventura and Jackson, Wyo. Mr Chouinard does not own<br />

a computer or a cell phone.”<br />

The handing over of the family fortune is not outside of<br />

Chouinard’s long-standing disregard for how the world<br />

does business and his evident love and support for the<br />

world’s environment.<br />

"We are going to give<br />

away the maximum<br />

amount of money<br />

to people who are<br />

actively working on<br />

saving the planet.”<br />

At age 83, Chouinard said, "we are going to give away<br />

the maximum amount of money to people who are<br />

actively working on saving the planet.”<br />

He also said in a recent interview.<br />

‘Hopefully, this will influence a new form of capitalism<br />

that doesn’t end up with a few rich people and a bunch of<br />

poor people.”<br />

The 3-billion-dollar handover was not cheap; the money<br />

was deemed a gift by the US tax department, and that<br />

gift came at the cost of 17.5 million!<br />

6//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


THE ORTLES FAMILY<br />

RELY ON YOUR BEST FRIENDS<br />

ORTLES ASCENT MID GORE-TEX® BOOT<br />

BOBO.CO.NZ/SALEWA


The founder of Patagonia, Yvon Chouinard<br />

Before that handover, Patagonia already donated $50 million<br />

to the Holdfast Collective and will provide another $100 million<br />

this year, making Holdfast already one of the biggest influences<br />

in climate change and global warming.<br />

Succession, for any significant business, is often a headache,<br />

especially if you have been at the forefront of environmental<br />

change, which has been a hardcore foundation of Patagonia.<br />

Chouinard’s children, now in their forties, did not want to take<br />

over the company. Chouinard has an out-spoken view of the<br />

stock market and making a business public, so the gifting of the<br />

3-billion-dollar ownership and the 100 million-a-year profit is a<br />

natural solution for the man that is Yvon Chouinard.<br />

“I didn’t know what to do with the company because I didn’t<br />

ever want a company,” he said. “I did not want to be a<br />

businessman. Now I could die tomorrow, and the company will<br />

continue doing the right thing for the next 50 years, and I do not<br />

have to be around.”<br />

The company has given away 1 per cent of its sales for years<br />

to environmental groups. Recently, the company has become<br />

more politically active, even raising a lawsuit against the Trump<br />

administration to successfully protect the Bears Ears National<br />

Monument San Juan County in South-Eastern Utah.<br />

People like what Patagonia stands for and have continued to<br />

purchase the brand even though it costs more; Patagonia’s<br />

sales continue to soar.<br />

But as Chouinard's net worth continues to climb, it is something<br />

that he is openly uncomfortable about as he is vocal re the rich<br />

and excessive wealth. He said in a recent interview. "I was in<br />

Forbes magazine listed as a billionaire, which pissed me off,”<br />

he said. “I do not have $1 billion in the bank. I do not drive a<br />

Lexus.”<br />

Now that the pathway for Patagonia as a company is clear,<br />

with noble objectives of both being a profitable company and<br />

investing those profits solely in tackling climate change and<br />

environmental issues. However, the question remains, will<br />

Patagonia survive without Chouinard’s driving force and the<br />

unusual situation of the profit going directly into the trusts?<br />

"Instead of “going public” you could<br />

say we’re “going purpose”. Instead<br />

of extracting value from nature and<br />

transforming it into wealth for investers,<br />

we’ll use the wealth Patagonia creates to<br />

protect the source of all wealth."<br />

For Chouinard, this gifting of the company to a trust and a<br />

non-profit organisation is a typically ‘Patagonia’ unique way of<br />

approaching complex issues. This situation, whether successful<br />

or not, will ensure the company profits will continue to be put<br />

to beneficial use. It also resolves the question of what will<br />

happen to Patagonia after its founder is gone, ensuring that the<br />

company's profits will be put to work protecting the planet.<br />

Mr Chouinard summed it up by saying. "I feel relief that I've put<br />

my life in order.”<br />

Will this ‘’gifting of success’’ back to the planet be an example<br />

to others? I guess we will have to wait and see, but if history<br />

has shown us anything regarding Patagonia and its success, it<br />

is that as a moral innovator, Patagonia has motivated a whole<br />

industry since its inception – Chouinard’s legacy maybe is more<br />

than just his contribution.<br />

We will leave you with words from the man himself…<br />

“It’s been nearly 50 years since we began our experiment<br />

in responsible business, and we are just getting started. If<br />

we have any hope of a thriving planet – much less a thriving<br />

business – 50 years from now, it’s going to take all of us doing<br />

what we can with the resources we have. This is another way<br />

we’ve found to do our part.<br />

Despite its immensity, the Earth’s<br />

resources are not infinite, and it’s clear<br />

we’ve exceeded its limits. But it’s also<br />

resilient. We can save our planet if we<br />

commit to it.”<br />

8//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


DISCOVERED<br />

UNDER ICE.<br />

SERVED<br />

OVER ICE.<br />

#OpenFor<strong>Adventure</strong><br />

TheShackletonWhisky.com<br />

Please enjoy Shackleton responsibly


BOULDER BASH<br />

‘SEE NO EVIL ROUTES, HEAR NO EVIL BETA, SPEAK NO NEGATIVITY’<br />

By Zane Bray<br />

AUCKLAND’S BOULDERING SCENE IS BLOWING UP!<br />

Auckland’s seeing a massive resurgence in social boulder<br />

competitions this year in the post covid environment, with the<br />

Auckland Boulder series leading the charge, building up to<br />

the National Indoor Boulder Series, and culminating in the<br />

phenomenal next level annual Northern Rocks Boulder Bash.<br />

On 2nd July Northern Rocks opened their doors to the Boulder<br />

Bash community competition. The stoke was high, the boulders<br />

were fresh and the prize pool was over stacked. It was a perfect<br />

storm of super awesomeness.<br />

Sarah Hay, Northern Rocks Director and General Manager<br />

was the main instigator and team leader, managing juggling a<br />

runaway dog, hungry baby and hundreds of people scrambling<br />

over the walls with aplomb. The MC’ing went to Zahnay (Zane<br />

Bray) the word maker with more energy than Red bull, V and<br />

Monster energy put together. Zane brought high energy to the<br />

MC role, couldn’t read his own handwriting, talked so much the<br />

PA system died, and delivered the hype.<br />

Zane represents the Aotearoa Climbing Access Trust (ACAT)<br />

events team. ACAT.org.nz is a not for profit trust set up to<br />

help gain, maintain, and sustain access to our amazing<br />

outdoor climbing areas with some massive wins lately that<br />

would not have happened if it weren’t for the support of our<br />

sponsors recurring donors in the climbing community, signing<br />

up to support ACAT with as little as $5 a month (more would<br />

be better!) goes a long way to ensure they can keep going.<br />

Northern Rocks is proud to be ACAT’s first corporate sponsor<br />

and looks forward to working together with ACAT this year on<br />

events and initiatives to keep NZ crags open.<br />

Before kicking things off, Zane had competitors put a hand on<br />

their heart and recite the boulderers pledge from the Castle hill<br />

climbing guide bible, with words along the lines of ‘I will See<br />

no evil routes, hear no evil beta, speak no negativity’ or was it<br />

‘Lo, though I walk through the valley of boulders, I shall fear no<br />

route…’<br />

Then it was GO time, participants rushed off to get in the<br />

first send of the day, DJ dynamic duo Movr&Shkr and Almita<br />

dropped the phat beats, everyone racing to get scores on their<br />

sheets, people were climbing, boogieing, shouting support,<br />

sharing beta, making friends, shredding skin and falling all over<br />

the mats. There were fist bumps, laughter, worn skin, fails and<br />

many sends.<br />

The boulders the Northern Rocks team delivered were not<br />

all straight forward, there was a lot of skill required to wrestle<br />

and wrangle your way through the world class setting from the<br />

Northern Rocks setting team, with James FM and Wiz Fineron<br />

creating some stellar magic on the finals routes.<br />

Check out @northernrocks.climbing on Instagram to see their<br />

time lapse video of the comp and some of the rad routes on tap.<br />

As always, Eddie Fowke, world class photographer from the<br />

Circuit climbing was there, snapping all the amazing pictures<br />

you see here.<br />

None of this would be possible without the help of our fantastic<br />

sponsors, Rab Equipment, Mountain <strong>Adventure</strong>, Southern<br />

Approach, Bivouac Outdoor, Musashi, Off Piste, Bootleg Jerky,<br />

Fergs Kayaks Auckland, <strong>Adventure</strong> Magazine, Cx3 Chalk Bags<br />

and Northern Rocks.<br />

“Northern Rocks is an indoor bouldering<br />

facility, we foster community, growth<br />

and positive experiences for people of all<br />

backgrounds, ages and abilities.”<br />

World Class Indoor Climbing<br />

First visit $25* then free for a week!<br />

Fantastic community, beginners<br />

welcome, boulder classes for all ages<br />

and abilities, inquire now.<br />

* Discounts for youths and own gear<br />

Student Mondays, entry $15<br />

www.northernrocks.co.nz<br />

@northernrocks.climbing<br />

Unit 17, 101-111 Diana Drive,<br />

Wairau Valley, Auckland | 09 278 2363


We are<br />

the mountain<br />

people.<br />

e are<br />

e mountain<br />

ople.<br />

Everything we make is designed by climbers,<br />

Everything we make is designed by climbers,<br />

for climbers. Each piece is crafted by peak<br />

for climbers. Each piece is crafted by peak<br />

and crag to give you absolute protection,<br />

and crag to give you absolute protection,<br />

comfort and mobility when you really need it.<br />

comfort and mobility when you really need it.<br />

WWW.RAB.EQUIPMENT<br />

WWW.RAB.EQUIPMENT<br />

Available now from Rab specialist stores throughout NZ.<br />

Hunting And Fishing New Zealand Available stores nationwide. now from Auckland: Rab specialist Living stores Simply, throughout Waikato: NZ. Trek N Travel, Equip Outdoors,<br />

Hunting And Fishing Taupo: New Outdoor Zealand Attitude, stores Wellington: nationwide. Dwights Auckland: Outdoors, Living Motueka: Simply, Waikato: Coppins Trek Outdoors, N Travel, Equip Outdoors,<br />

Nelson: PackGearGo, Taupo: Outdoor Kaikoura: Attitude, Coastal Wellington: Sports, Christchurch: Dwights Outdoors, Complete Motueka: Outdoors, Coppins Greymouth: Outdoors, Colls Sports,<br />

Nelson: PackGearGo, Hokitika: Wild Kaikoura: Outdoorsman, Coastal Wanaka: Sports, Christchurch: MT Outdoors, Complete Queenstown: Outdoors, Small Greymouth: Planet. Colls Sports,<br />

Online: huntingandfishing.co.nz, Hokitika: Wild Outdoorsman, dwights.co.nz, Wanaka: outdooraction.co.nz, MT Outdoors, mtoutdoors.co.nz, Queenstown: Small smallplanetsports.com,<br />

Planet.<br />

Online: huntingandfishing.co.nz, equipoutdoors.co.nz, dwights.co.nz, gearshop.co.nz, outdooraction.co.nz, outfittersstore.nz<br />

mtoutdoors.co.nz, smallplanetsports.com,<br />

Distributed equipoutdoors.co.nz, by Outfitters 0800021732 gearshop.co.nz, www.outfitters.net.nz<br />

outfittersstore.nz<br />

Distributed by Outfitters 0800021732 www.outfitters.net.nz


THE JOYS<br />

& PAINS OF<br />

'DANGER -<br />

WALKING'<br />

Words and photos by Derek Cheng<br />

‘Elbows out’ was the advice I’d been<br />

given for climbing in the European Alps.<br />

This wasn’t related to any particular<br />

style of climbing, but rather what might<br />

help get you to the base of your route<br />

ahead of other climbers. Of the 60<br />

people sardined into the 6.10am cable<br />

car bin heading up the famous Aiguille<br />

du Midi, in the Mont Blanc massif, up to<br />

half of them tend to be climbers.<br />

12//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


Chris Davis surveys the<br />

terrain on the classic Cosmic<br />

Arete, on Aiguille du Midi<br />

in the French Alps, as well<br />

as the several climbers<br />

clogging the way.


Above: A climber negotiates Chèré Couloir, a steep ice gully on Mont Blanc du Tacul in the European Alps.<br />

Right: Classic routes, such as Chèré Couloir, are often congested in Chamonix, France, and it's a race to get there first.<br />

The ride is famous, taking you from 1035m<br />

to 3777m above sea level in a scarcelybelievable<br />

20 minutes. But instead of taking<br />

in the dramatic views of the alps as you<br />

ascend from the small township Chamonix,<br />

France, climbers surreptitiously eyeball each<br />

other while sneakily edging towards the<br />

door.<br />

Our objective was Chèré Couloir: a 155m ice<br />

climb that rises from the snowy valley before<br />

steepening to a narrow chute of 75 degree<br />

ice. It’s rightfully described in the guidebook<br />

as 'one of the busiest routes in Chamonix',<br />

so it was with some nervousness that I<br />

noted several climbers armed with what's<br />

needed - two technical ice tools - to climb<br />

Chèré.<br />

I stiffened and widened my elbows, which<br />

supposedly allows you to gain an inch on<br />

your neighbour, as the bin arrived at the<br />

top. The door opened to a flurry of climbers<br />

bursting forth and running to the start of the<br />

ridgeline, which guards access to the entire<br />

mountain range.<br />

There was no time for faffing. My climbing<br />

partner Chris and I donned our crampons,<br />

roped up, and launched onto the ridge. The<br />

twin ice-tooled party was directly behind us<br />

as we broke trail to the base of Chèré. But<br />

it was my first time at this altitude in years<br />

- the equivalent of Aoraki’s summit - and<br />

with fresh snowfall to plough through, it took<br />

some effort to stay in front. They followed us<br />

all the way to the start of Chèré, and then<br />

started climbing right behind us.<br />

It was my first time ice climbing in years,<br />

and it was fantastic to throw serrated ice tool<br />

blades into the snow-covered ice. I soon<br />

found my rhythm, but I was in a rush, not<br />

wanting to hold up any of the climbers in our<br />

wake.<br />

Ice climbing below another party is<br />

considered foolish because it’s asking to be<br />

smashed in the face by falling ice. Not so in<br />

Chamonix, where it’s apparently standard<br />

etiquette to gang-bang classic routes,<br />

regardless of the consequences; the team<br />

behind us were already being pelted by<br />

falling ice debris.<br />

We made quick work of the climb, and<br />

instead of plugging up the long snow-slope<br />

to the top of the mountain, we decided to<br />

abseil. This is also standard etiquette in<br />

Chamonix, even with several climbers below<br />

who were forced to dodge falling ropes as<br />

we pulled them from abseil point to abseil<br />

point. There were still eight climbers on the<br />

route by the time we arrived back at the<br />

base, with two more about to start.<br />

It was only 11.30am, so we made our way<br />

to another classic: Cosmic Arête. There<br />

were, predictably, at least 20 climbers on it<br />

by the time we got there. Most of the route<br />

isn't too demanding so we climbed ropeless,<br />

scrambling up chutes and crests of granite<br />

while ducking in and around other climbers<br />

and their ropes.<br />

It’s the enviable infrastructure that enables<br />

such access to these famous mountains.<br />

The cable car takes thousands of people to<br />

the top of the Midi everyday. For climbers,<br />

it all but erases the long and arduous<br />

approaches that most alpine climbing<br />

requires.<br />

"Ice climbing below<br />

another party is<br />

considered foolish<br />

because it’s asking<br />

to be smashed in<br />

the face by falling<br />

ice. Not so in<br />

Chamonix, where<br />

it’s apparently<br />

standard etiquette<br />

to gang-bang<br />

classic routes,<br />

regardless of the<br />

consequences"<br />

14//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


Above: Serenity greets a climber topping out a gendarme in the Central Darrans, northern Fiordland, with the Mt Revelation and<br />

Taiaroa Peak on the left and Mts Underwood and Patuki on the right, above the Taoka Icefall.<br />

The Midi gondola is only one of several in the Chamonix<br />

valley. There’s one that takes you to the top of Le Brévent<br />

(2525m), from where you actually walk downhill for 20<br />

minutes to get to the base of the 300m-high rock climbs.<br />

And the Flégère gondola and Index chairlift deposits you, at<br />

2595m, at the base of the Aiguille Rouge range.<br />

But this also transforms one the world’s best places for alpine<br />

climbing into a complete cluster.<br />

It couldn’t be more different in New Zealand, where it’d be<br />

unusual to see other parties in the country’s best mountains<br />

for alpine rock climbing. The Central Darrans, in northern<br />

Fiordland, encompasses the peaks in the Te Puoho cirque,<br />

as well as those surrounding Lake Turner, including the<br />

ridgeline from Mts Patuki to Madeline. The area is gifted<br />

with vertiginous and glaciated walls of hard rhyolite, which is<br />

much more compact than the schist that dominates most of<br />

the Southern Alps.<br />

But getting there is a tad more challenging than standing<br />

in a gondola bin for 20 minutes. Tales of extreme tramping,<br />

known among Darrans climbers as ‘danger-walking’, is<br />

enough to deter anyone from going there. A couple of friends,<br />

for example, ended up taking their ropes and climbing gear<br />

for a massive walk; they managed to get to the fabled bivvy<br />

cave known as Turner’s Eyrie, but it took them two days and<br />

several close shaves to get there, and they needed the third<br />

day to rest before walking out on day four.<br />

The best way in is a matter of debate, but they all invariably<br />

involve snow and glacial travel, rock scrambling, and the<br />

unique Darrans experience of near-vertical plant-pulling.<br />

Our route - from the Lower Hollyford River to The Eyrie in<br />

one push - was a 17-hour day: bush-bash up to Rainbow<br />

Lake from the Hollyford valley, scramble over a col near Mt<br />

Tuhawaiki, drop under Mt Taiaroa, gain and then negotiate<br />

the Te Puoho Glacier to another col, ease nervously down a<br />

tenuous slope known as Lindsay’s Ledges and, finally, cross<br />

to the Karetai-Patuki col and stumble up the final stretch.<br />

By the time we crawled into The Eyrie, etched into the<br />

northwest side of Mt Karetai, it was 11pm. We were fried. My<br />

climbing partner, Jimmy, only made it through half his dinner<br />

before nodding off, still half-seated in his sleeping bag.<br />

The rewards, though, are immediate. The Eyrie looks out<br />

to the snow-capped towers of Tutoko and Madeline and the<br />

rocky spire of Te Wera. We spent a week exploring, including<br />

twice climbing a 300m-high cliff face, scrambling the south<br />

ridge of Te Wera and the north ridge of Karetai, and reaching<br />

the summit of Mt Underwood via the Taoka Icefall.<br />

And all to ourselves. All I knew in the aftermath of the trip<br />

was that I had to return to such a unique place - the country's<br />

most exquisite, with infinite rock and adventure to be<br />

sampled.<br />

It also made me consider the pros and cons of a lack of<br />

infrastructure. Part of the magic of the Central Darrans is<br />

how empty and wild it is. It would be a completely different<br />

experience if there was gondola access, and crowds of<br />

climbers at the base of every rock wall.<br />

But getting there is no picnic. One of New Zealand’s best<br />

climbers told me he has no inclination to explore the area<br />

because of the walk-climb ratio, as in, heaps of ‘dangerwalking’<br />

and relatively little climbing. I didn’t really understand<br />

until I was in Chamonix, where there are massive clusters of<br />

climbers, but the ratio is flipped.<br />

The advantages were never more starkly obvious than when<br />

my climbing partner and I arrived at the south face of the Midi<br />

one morning. Our stiff elbows had helped us to be the first<br />

ones there, and we started unpacking our climbing gear just<br />

as the sun’s first rays enveloped the tower of granite in front<br />

of us.<br />

My stomach turned nauseous, however, when I realised I’d<br />

left my climbing shoes at home. I sprinted back up the snowy<br />

ridge, took the gondola down, raced through town and up<br />

a hill to our apartment, grabbed my shoes, barreled back<br />

down the hill, and stood in a sweaty mess while catching an<br />

ascending gondola bin.<br />

Where else in the world can you rush home to retrieve a<br />

forgotten item and be back at the base of a granite wall,<br />

3700ish metres above sea level, within an hour?<br />

16//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


Right: Jimmy Finlayson enjoying the<br />

solitude of the Central Darrans on the<br />

north ridge of Karetai Peak.<br />

"Part of the magic<br />

of the Central<br />

Darrans is how<br />

empty and wild<br />

it is. It would<br />

be a completely<br />

different<br />

experience if<br />

there was gondola<br />

access, and crowds<br />

of climbers at the<br />

base of every rock<br />

wall. "


18//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


EXPLORING<br />

ARTHURS PASS<br />

NATIONAL PARK<br />

Words and images by Eric Skilling<br />

It’s taken several millennia of earthquakes and glacial<br />

erosion to create the impressive landscapes of Arthurs<br />

Pass National Park, making it a trampers paradise.<br />

From expansively wide, rock-strewn valleys of the<br />

Waimakariri, to gut-busting tracks up forested ridges<br />

with the reward of expansive views of jagged peaks and<br />

glaciers. Within a single day you can clamber up steep<br />

and narrow paths through tranquil beech or podocarp<br />

forests, take in epic views from the top of rocky peaks,<br />

refreshing yourself with the ancient waters of ice-cold<br />

glacial streams. Then cruise home on wide-river flats<br />

alongside those crystal-clear rivers.<br />

Glaciers up to 1,000 metres high have done some<br />

serious and not very subtle sculpting here. Thankfully<br />

several eras have passed since nature’s colossal<br />

earthmovers retreated, allowing the rivers and streams<br />

time to do their bit eroding the tops and depositing<br />

thousands (perhaps millions) of rocks into those steep<br />

valleys. This sets the scene for a huge variety of outdoor<br />

challenges in a relatively small area.<br />

ADVENTUREMAGAZINE.CO.NZ//19


Above: Beginning our descent from Carroll Hut. Far right: Emerging out of the bush with views of the Otira Gorge below.<br />

Inserts: Clambering our the way to Carroll Hut / Stunning alpine bush surrounded Carroll Hut / Enjoying the warmth and comfort of Carroll Hut<br />

Like all Alpine areas, you need to come<br />

well prepared in terms of gear and fitness.<br />

Back in the 90’s a group of us completed<br />

the famous Minga-Deception track during a<br />

cold weekend in late May. On that trip one<br />

of our party hit the proverbial wall several<br />

hundred metres short of the hut. We had to<br />

split his gear amongst three of us and coax<br />

him up the valley to the hut. Next day was a<br />

slog out onto river flats in sleet which turned<br />

to snow just as we reached the car park.<br />

This trip was a complete contrast. We had<br />

based ourselves in Arthurs Pass township<br />

for 9 days over Christmas and New Year,<br />

and even after a full week of exploring, I left<br />

regretting we hadn’t planned a longer stay.<br />

A day-walk to the top of Bealey Spur and<br />

an overnight trip to Carroll hut are probably<br />

two of the best and most contrasting<br />

trips that will whet your appetite for more<br />

adventurous trips in the park, such as<br />

Avalanche Peak (see January issue –<br />

“Decent to Crow valley – the scree slope<br />

from hell”).<br />

The Isolation of Carroll Hut<br />

(3-4 hours each way)<br />

If you find yourself standing on the Otira<br />

lookout north of Arthurs Pass village, take<br />

time to lift your gaze over the viaduct and<br />

the ridges of the Barron Range to a small,<br />

scooped hanging valley in the distance.<br />

It’s heavily- forested headwall plummets<br />

some 500 metres into the Otira Gorge<br />

below. Looking closely, you can see the<br />

tiny light brown spec of the 10-bunk Carroll<br />

Hut looking isolated, frail and insignificant<br />

against the magnificently rugged peaks<br />

and steep glacial valleys surrounding it.<br />

It is difficult to comprehend the contrast<br />

between this track on the west and Bealey<br />

Spur to the east. For starters the trail<br />

begins with a river crossing which will test<br />

the quality of boots and gaiters.<br />

Gone was the wide meandering path of<br />

Bealey Spur. At the start the narrow rocky<br />

path is almost hidden by overhanging<br />

shrubs and ferns which soon widens,<br />

but also gets a lot steeper. For the next<br />

few hours we scrambled, scaled and (for<br />

some) swore our way up an endless series<br />

of head-high (and higher) rocky or muddy<br />

ledges, searching for hand and footholds.<br />

The foliage was a dense mass of gnarled<br />

podocarps with numerous other broadleaf<br />

shrubs. A few sweaty hours later the<br />

canopy above began to thin out, allowing<br />

some sky to peak through. Mount Cook<br />

lilies and daisies appeared on the side of<br />

the narrow path as it widened and started<br />

to traverse across the face of the ridge.<br />

At this point we got our first views of the<br />

spectacularly steep and narrow Otira<br />

Gorge way below us and across the valley<br />

to the Barron Range, it’s ridges scarred by<br />

scree-slopes. The vegetation was steadily<br />

changing again to a mix of snow tussock<br />

and other alpine shrubs. Up ahead the<br />

track disappeared into the occasional mist.<br />

It was getting much cooler.<br />

Carroll hut came into view, looking fragile<br />

and isolated in the expanse of the cirque.<br />

The surrounding peaks were barely visible<br />

in a lumpy cloak of damp, swirling mist.<br />

Painting the hut a creamy brown looked<br />

like an attempt to make it blend in with<br />

the rugged beauty of the tussock and bog<br />

pine in the cirque. Instead, it seemed to<br />

look more foreign and out of place with its<br />

straight edges and dark framed windows.<br />

Once inside it was a different story.<br />

Sleeping bags were unpacked, gas<br />

burners hissed, lunches, coffees and teas<br />

made, and the banter and chatter began.<br />

Outside the weather clagged in, and no one<br />

mentioned anything of the original plans to<br />

venture to the tarns and peaks behind the<br />

hut. It was a pleasure to spend the rest of<br />

the day in the cosy, spacious hut.<br />

Next morning, the weather hadn’t exactly<br />

cleared but the rain had moved on. The<br />

group packed up and then several of us<br />

rugged up in beanies and rain jackets and<br />

walked over the ridge behind the hut and<br />

20//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


Above: Beasley Hut before taking on the tops / Insert: Grace getting in touch with Aaron's beard<br />

into the mists to try to find the tarns and<br />

Kelly Saddle. About 15 minutes later we<br />

were standing on the saddle where we<br />

should have been able to see down to the<br />

Taipo River valley. Instead, we stared into<br />

the eddying mists in vain before turning<br />

back and heading for the tarns.<br />

The botanist in our group was like an<br />

eccentric professor as she explored the<br />

prolific variety of flowering plants that<br />

survive in these unique environments.<br />

A pair of nesting wren chirped their<br />

annoyance at our invasion. You could only<br />

wonder what they thought when one of<br />

our group stripped down to her togs and<br />

waded in for a quick dip. Crazy.<br />

Eventually we moved on back to Carroll Hut,<br />

picked up our packs and began the descent.<br />

I don’t think our botanist noticed us leave.<br />

This a short but quite challenging trip, but<br />

an overnight stay at the hut is well worth<br />

the effort. I believe the views are also<br />

spectacular, but the mist never cleared<br />

during our stay so I will have to wait until<br />

after my next visit before I can comment.<br />

Recovery on Bealey Spur<br />

(4-5 hours return)<br />

A few kilometres south of Arthurs pass<br />

village, Bealey Spur offers awesome views<br />

for the effort involved getting to the top.<br />

Perfect as an introduction to the area, and<br />

as a warm-up after that long lockdown. It is<br />

an exception to the flat-or-steep-and-notmuch-in-between<br />

rule. Mostly.<br />

The track begins a with wide path that<br />

makes a steady climb through native<br />

beech forest. Most of the trees are well<br />

spaced and only a few metres tall, with<br />

plenty of groundcover. Mosses and lichens<br />

such as Aaron’s beard are everywhere.<br />

Thick pockets of manuka line several<br />

clearings where you get to enjoy the wide<br />

expanse of the Waimakariri valley. We<br />

did get to enjoy the call of the occasional<br />

bellbird and the company of a robin, but<br />

birdlife is sparse.<br />

Bealey Spur hut on the edge of the bushline<br />

is worth a brief stop. This bright green<br />

corrugated hut is full of character with<br />

an earth floor, bunks made from wooden<br />

beach-tree and sacking and a tin fireplace.<br />

On our trip a young family had moved into<br />

the hut, filled the shelves with a weeks’<br />

worth of food, and were using it as a base<br />

to explore the region. A great way for young<br />

ones to experience the NZ wilderness.<br />

Once past the hut the terrain changes to a<br />

boggy tussock and bush slope which then<br />

opens-up giving a full view of a towering<br />

Bealey Spur above. At that point two of<br />

our party took one-look at the steep track<br />

ahead and threatened to bail. To be fair<br />

it didn’t take much to persuade them to<br />

continue onward.<br />

We took our time, and it wasn’t long before<br />

they were distracted by the views. The wide<br />

spread of the Waimakariri valley below us<br />

lined with those steep bush-clad ridges. Mt<br />

Foweraker and Dome (1945m) dominated<br />

the skyline to the east, but the landscape to<br />

the west is far more impressive – the jagged<br />

summits and ridges of Mt Bealey, Stewart<br />

and Damfool (2030m) and Mt Rolleston<br />

(2275m) dotted with pockets of ice and the<br />

occasional small glacier.<br />

Around midday we reached the rock cairn<br />

a few hundred metres along the spur. A<br />

perfect spot to take a break to enjoy the<br />

views. I don’t think I would be out of line<br />

saying that the two of our party who had<br />

been intimidated by the climb were now<br />

looking very pleased with themselves.<br />

There is plenty of time for a quick diversion<br />

to the Bealey Hotel on the way back, to<br />

take in the priceless views from the lounge<br />

and to enjoy a refreshing ale and perhaps<br />

dinner – if you have booked.<br />

With thanks to Backcountry Cuisine,<br />

Jetboil, Macpac and Keen.<br />

22//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


We are<br />

the mountain<br />

people.<br />

Everything we make is designed by climbers,<br />

for Everything climbers. we Each make piece is designed is crafted by by climbers, peak<br />

and for climbers. crag to give Each you piece absolute is crafted protection, by peak<br />

comfort and crag and to give mobility you absolute when you protection,<br />

really need it.<br />

comfort and mobility when you really need it.<br />

WWW.RAB.EQUIPMENT<br />

WWW.RAB.EQUIPMENT<br />

Available now from Rab specialist stores throughout NZ.<br />

Hunting And Fishing New Zealand Available stores now nationwide. from Rab Auckland: specialist Living stores Simply, throughout Waikato: NZ. Trek N Travel, Equip Outdoors,<br />

Hunting And Fishing Taupo: New Outdoor Zealand Attitude, stores nationwide. Wellington: Auckland: Dwights Outdoors, Living Simply, Motueka: Waikato: Coppins Trek Outdoors, N Travel, Equip Outdoors,<br />

Nelson: PackGearGo, Taupo: Outdoor Kaikoura: Attitude, Coastal Wellington: Sports, Christchurch: Dwights Outdoors, Complete Motueka: Outdoors, Coppins Greymouth: Outdoors, Colls Sports,<br />

Nelson: PackGearGo, Hokitika: Kaikoura: Wild Outdoorsman, Coastal Sports, Wanaka: Christchurch: MT Outdoors, Complete Queenstown: Outdoors, Small Greymouth: Planet. Colls Sports,<br />

Online: huntingandfishing.co.nz, Hokitika: Wild Outdoorsman, dwights.co.nz, Wanaka: outdooraction.co.nz, MT Outdoors, Queenstown: mtoutdoors.co.nz, Small smallplanetsports.com,<br />

Planet.<br />

Online: huntingandfishing.co.nz, equipoutdoors.co.nz, dwights.co.nz, outdooraction.co.nz, gearshop.co.nz, outfittersstore.nz<br />

mtoutdoors.co.nz, smallplanetsports.com,<br />

Distributed equipoutdoors.co.nz, by Outfitters 0800021732<br />

gearshop.co.nz, outfittersstore.nz<br />

www.outfitters.net.nz<br />

Distributed by Outfitters 0800021732 www.outfitters.net.nz


#2<br />

Old Man Hut, Mt. Richmond Forest Park (spot the campsite clearing in the background)<br />

BILLION STAR<br />

OVERNIGHT<br />

STAYS<br />

By Eric Skilling<br />

Overnighting in 6-star hotels and resorts must be a memorable<br />

occurrence, but I wouldn’t know. I do know about 5-star accommodation<br />

thanks largely to a past life in the corporate world, but the funny thing is I<br />

struggle to remember any details of those stays.<br />

But when it comes to tenting out after a day’s tramping, I can recall great<br />

details of every experience. OK, I must admit that a couple of those nights<br />

I wouldn’t like to repeat, but the vast majority have been unique and<br />

unforgettable stays that I often reflect on, appreciating how lucky I was to<br />

have had the opportunity.<br />

What makes a campsite a great place? For me, unashamedly biased as<br />

they are, I have chosen to rate on these five criteria that are important to<br />

me.<br />

#1: Abel Tasman National Park.<br />

Dawn Chorus 8 | Setting 9 | Sunrise 10 | Sunset 5<br />

Accessibility 10<br />

There are many reasons why the beaches on the Abel<br />

Tasman walk are rated amongst the best in the world.<br />

Usually small and horseshoe shaped, these sheltered<br />

bays are lined with steep ridges clad with native bush,<br />

making a stunning contrast with the golden sand on the<br />

beaches and unbelievably clear blue waters.<br />

Imagine nodding off to sleep as gentle waves slap the<br />

beach just metres away from your tent. Then waking to<br />

the shrill call of a weka and the one-bird orchestra of a<br />

bellbird perched in the tree above your tent. And later,<br />

while still lying in the comfort of your sleeping bag, watch<br />

the horizon turn orange, red and silver.<br />

Choose to enjoy the wide rolling track or if you want to<br />

share this with non-trampers, just catch a water taxi. And<br />

this is one of the few places you can enjoy a sea swim<br />

followed by a freshwater shower. Bliss.<br />

Dawn Chorus: Alarm clocks are nobody’s friend but waking to the<br />

calls of our native birds are probably the single thing that will guarantee<br />

making the list of favourite places to stay. This puts both Abel Tasman and<br />

Richmond Forest Park amongst the best.<br />

Setting: Enjoying a hot meal high above a valley floor with views across<br />

rugged peaks will always make for a memorable night. Remoteness,<br />

ruggedness and sometimes, the chance of having the place to yourselves<br />

are all important. Carroll Hut sits high up on this rating.<br />

Sunrise: One of the most memorable moments I have had was sharing<br />

a golden dawn over Tasman Bay while still snuggled up in sleeping bags<br />

with someone special. On this occasion a weka meandered nonchalantly<br />

mere feet away from our tent, happily engrossed in finding breakfast.<br />

Sunset: Sometimes you find yourself in some idyllic spot where the<br />

morning sun is hidden from you, but the dusk can be just as, or even<br />

more spectacular. Having the chance to watch the sky change colour,<br />

darken and then become sprinkled with a billion stars is a priceless<br />

experience that I never seem to enjoy unless I am out tramping.<br />

Accessibility: As we also know, shared experiences are often the best.<br />

Sometimes you need to put in the grunt to get there, which can limit<br />

who you get to share these moments with, but some can be shared with<br />

inexperienced trampers, or occasionally you can just get the water taxi.<br />

These are some of those places ranked from the very best to just great.<br />

#2 : Old Man Hut, Mt. Richmond Forest Park<br />

Dawn Chorus 10 | Setting 8 | Sunrise 5 | Sunset 9 |<br />

Accessibility 5<br />

If you wanted to hear the morning birdsong as I imagine<br />

many New Zealanders took for granted several decades<br />

ago, this must be the closest we can get to it today. It<br />

was so loud and prolific that I gave up trying to work<br />

out which birds made up the refrain. Robin, tui, bellbird,<br />

weka and so many others competed to welcome in the<br />

day. Quite a difference to the evenings when the silence<br />

was broken by the gentle hoots of morepork.<br />

Nestled in a large clearing surrounded by beech forest,<br />

Old Man hut is towered over by Little Rintoul. Here a<br />

meal can be had while the sun’s shadow creeps up the<br />

slopes of Little Rintoul, turning the rocky face all shades<br />

of red.<br />

Getting here is a bit of a challenge but so worth the<br />

effort. The compensation is the route climbs up through<br />

a well-established podocarp forest and then cool beech.<br />

You will be cheered along by many native birds, and<br />

there are plenty of cool streams crossing the track. Once<br />

on top of the ridge, the views across the Richmond<br />

range are alone worth the exercise.<br />

24//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


#3<br />

Kiwi Saddle Hut, Kaweka Mountain Range<br />

#1<br />

Abel Tasman National Park<br />

"Thanks to modern tents and sleeping bags, more and<br />

more of us are getting out there and discovering the thrill<br />

of overnighting in places as special as these. I know there<br />

will be even more exceptional and memorable locations<br />

that others can name, but at the end of the day we just<br />

need to get out there. And most adventures are even better<br />

when they are shared."<br />

#3 : Kiwi Saddle Hut, Kaweka Mountain Range<br />

Dawn Chorus 6 | Setting 7 | Sunrise 7 Sunset 9 Accessibility 7<br />

Where else can you view nightfall in a blaze of colours over the rugged<br />

profile of Mount Ruapehu and at the same moment a full moon slides up<br />

over the vast expanse of Hawkes Bay. Then next morning, witness the<br />

first rays of dawn light sparkle on the Pacific Ocean.<br />

Also placed in a beech forest, it’s a short walk from the tent sites to the<br />

exposed ridge with wide vistas east and west. Plenty of hard work is<br />

going into making this forest a haven for birds. Trapping is widespread<br />

and the results are already obvious.<br />

#4<br />

Caroll Hut Arthur's Pass National Park<br />

#5<br />

Caves Campsite, Whatipu<br />

#6<br />

Bog Inn, Pureora Forest Park<br />

#4 : Carroll Hut, Arthurs Pass National Park<br />

Dawn Chorus 4 | Setting 9 | Sunrise 5<br />

Sunset 8 | Accessibility 7<br />

My enduring memory of the visit to this site was<br />

the feeling of solitude. This is a bit hard to justify<br />

because it is only 3 hours hiking from a sealed<br />

road. At night you can see the glow of reflected<br />

light from the township some 500 metres below.<br />

Located on the West Coast side of Arthurs Pass,<br />

in a wide and exposed hanging valley with a<br />

precipitous drop to the Otira Gorge. Perhaps the<br />

feeling of remoteness comes from thick but low<br />

alpine shrubs that surround the camping area,<br />

offering little cover if the weather turned foul.<br />

Perhaps it is also the expansive views across<br />

the valley to the jagged peaks which gives a<br />

feeling of settling down high up in the mountains.<br />

Whatever the reasons, overnighting here will be<br />

a memorable experience for anyone who can<br />

appreciate it.<br />

Typical of the West Coast, the track begins in<br />

lush and humid forest. The first two or so hours<br />

are steep with plenty of exposed roots and<br />

some treefall to negotiate, but well within the<br />

capabilities of most trampers. And it’s only 3<br />

hours.<br />

#5 : Caves Campsite, Whatipu<br />

Dawn Chorus 3 | Setting 8 | Sunrise 5 | Sunset 9 | Accessibility 8<br />

The rugged west coast is full of unique and unforgettable places to explore. Even<br />

though this site is some distance across a wide expanse of sand dunes from the<br />

beach, the distant roar of those huge swells exploding onto the beaches helps make<br />

this a special place. A rugged cliff to the east of the site is covered in huge cabbage<br />

trees, nikau palms and flax bushes, adding to that wild-west-coast feeling.<br />

There is no hint that a huge metropolis sits just a few miles to the east as the crow<br />

flies. The trail itself is a relatively easy walk from the car park, past the famous<br />

Whatipu Caves. Be aware that there is no water, so plan to lug in a few extra kilos.<br />

#6 : Bog Inn, Pureora Forest Park<br />

Dawn Chorus 3 | Setting 8 | Sunrise 4 | Sunset 3 | Accessibility 7<br />

Ancient. That is the overriding feeling as you settle back for the night in the heavily<br />

wooded site alongside Bog Inn. The history of the area is a mix of plunder, extreme<br />

hard work and endurance, followed by conflict, sacrifice, financial hardship, and<br />

heartache. Thankfully though the final chapter is one of considerable foresight<br />

which we can get to enjoy and value.<br />

When forestry activities were halted all those decades ago, with the obvious impact<br />

on the local economy and those who survived off the industry, it left behind some of<br />

the most ancient trees now standing in New Zealand. Be inspired by the massive<br />

matai, rimu, totara and miro – mere seedlings in the 13th century. When it comes<br />

to “forest bathing” Pureora can’t be beaten.<br />

ADVENTUREMAGAZINE.CO.NZ//25


A KIWI<br />

ON<br />

THICK<br />

ICE<br />

Words and photos by Ash Routen<br />

For a few months a year, the world's<br />

largest volume freshwater lake freezes,<br />

providing locals and visitors the chance<br />

to walk across its surface. Following in<br />

the steps of a few previous trekkers,<br />

Ash Routen travelled to Russia in 2018<br />

to walk across the frozen surface of<br />

Lake Baikal.<br />

On a cold and overcast afternoon<br />

in a small lakeside resort in Siberia,<br />

my friend Phil and I clumsily drag<br />

our plastic sleds down a small set of<br />

stairs to the frozen surface below. Our<br />

farewell party consists of Eugene, a<br />

local trekking guide and our trusty fixer,<br />

and two Brits, Robbie, and Natalie, who<br />

are new acquaintances.<br />

An hour before, we had been basking<br />

in the comforting warmth of a trendy<br />

local café. "You two look like a right<br />

pair of f****ers," Robbie had quipped<br />

with his strong London accent. I was<br />

glad we at least looked the part, given<br />

we would soon be leaving behind the<br />

sanctuary of the café for a long cold<br />

march ahead.<br />

Trace a finger roughly north of<br />

Ulaanbaatar, the capital of Mongolia,<br />

and you soon hit a vast body of<br />

water. Tucked between mountains<br />

and Siberian hinterland, Lake Baikal<br />

stretches for nearly 700km. Its frigid<br />

depths plumb to a little over 1.6km.<br />

Remarkably, the lake freezes over in<br />

February and March, just enough to<br />

allow a few hardy (or stupid) souls to<br />

walk on its surface.<br />

Heading north on windblown<br />

ice. The surface offers little<br />

resistance for sled hauling.<br />

26//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


"Once you overcome<br />

the initial fear of deep<br />

cold, you almost learn to<br />

love it. It renders the air<br />

crisp and clear. Ice and<br />

snow crunch pleasingly<br />

underfoot. And the light<br />

takes on a different<br />

ethereal quality."<br />

ADVENTUREMAGAZINE.CO.NZ//27


First steps on the ice: I had hoped to<br />

see the curious shapes and methane<br />

bubbles that marble the lake's windblown,<br />

frozen surface, but that first afternoon on<br />

the ice, we were met by compact snow<br />

fields. Phil strode ahead for the first few<br />

hours as I chatted to Robbie and settled<br />

into my 'polar plod.' Elite ultra-runners<br />

Robbie and Natalie were here to scope<br />

out the possibility of running across the<br />

lake in the future. Phil and I simply wanted<br />

to amble across the thing before our<br />

tourist visas expired.<br />

We had arrived at the shores of this winter<br />

curiosity after an intense six months of<br />

sourcing equipment, acquiring visas,<br />

planning the route, and squeezing in some<br />

much-needed training. The latter was<br />

undoubtedly required as I was exchanging<br />

a sedentary office job for twenty-odd days<br />

of pulling two plastic sleds, choc full of food,<br />

fuel, and other necessities. The sleds would<br />

be our lifeline as we trekked across Baikal,<br />

from a small resort village in the southwest<br />

corner to the penultimate settlement in the<br />

north - a journey of some 640km.<br />

The first night on the ice, and the next few<br />

after that, took some getting used to. It<br />

was now just Phil and I, and the twinkling<br />

lights on the shore were distant. Beneath<br />

our sleeping mats, the floor creaked and<br />

groaned. The ice was solid enough that we<br />

had difficulty driving in ice screws to pin<br />

our tent down, but it also appeared to be a<br />

living, breathing beast. Subtly piercing the<br />

overwhelming silence, the faint, haunting<br />

sound of the groaning ice below almost<br />

sounded like shelling on the western front.<br />

This was to be our nightly soundtrack for<br />

the coming weeks.<br />

Life in the freezer: Our plan was to snake<br />

along the lake's western shoreline, only<br />

deviating to navigate around the large<br />

mass of Olkhon Island at more or less<br />

the halfway mark. During the first five<br />

days, we slowly found our rhythm and<br />

were zipping along nicely, reaching close<br />

to 30km of walking on some days. We<br />

strapped small micro spikes to our boots<br />

to gain traction on the bullet-hard ice.<br />

Still, despite being unwieldy and heavy, I<br />

preferred to use my snowshoes as they<br />

dug harder into the surface.<br />

In March, the lake is reassuringly cold,<br />

with the mercury regularly dipping to -20c<br />

and below at night. Thankfully we slept<br />

soundly in our big puffy arctic sleeping<br />

bags. Once you overcome the initial fear<br />

of deep cold, you almost learn to love it.<br />

It renders the air crisp and clear. Ice and<br />

snow crunch pleasingly underfoot. And the<br />

light takes on a different ethereal quality.<br />

During the day, the cold was less of a<br />

worry, as the heat from our movement<br />

kept us warm. Ironically sweat is the<br />

enemy of a cold weather traveller, as it<br />

freezes on your clothing and drops body<br />

temperature. So I was constantly fiddling<br />

with layers, vents, hats, and gloves.<br />

Endless faff.<br />

To the outsider, sled hauling and the<br />

relentless monotony of one step after<br />

another might seem like torture. On<br />

some days, it is. On those days, all you<br />

can do is cinch down your jacket hood,<br />

put your goggles and face mask on and<br />

drive into the biting wind, only looking<br />

up occasionally to scout the way ahead.<br />

But on clear sunny days, it's close to<br />

perfection. The internal battle is replaced<br />

by an overwhelming sense of freedom<br />

as the horizon melts into an endless<br />

expanse.<br />

"I felt like a frontiersman<br />

riding into town during<br />

the expansion of the Wild<br />

West, but thankfully we<br />

weren't met by a guntoting<br />

local sheriff."<br />

The winds on Baikal can be merciless.<br />

On our third full day, hoods were most<br />

definitely down. My goggles repeatedly<br />

fogged over as I worked hard against<br />

the headwind. I tried not to slobber as<br />

I breathed heavily into my ice-stiffened<br />

facemask. No time to stop for long with<br />

the temperatures dropping to 30 below;<br />

just keep moving forward and shovel in a<br />

handful of goodies when you can. We only<br />

made 14km that day, but the miles soon<br />

flew by as the weather was mostly kind<br />

to us.<br />

By day nine, we had sighted the jagged<br />

bulk of Olkhon. "Let's aim for the darker<br />

brown patches to the right," suggested<br />

Phil, "I'll meet you there." Despite being<br />

twenty years older, Phil was in better<br />

shape, so most of the time, during clear<br />

weather, he would take off ahead and<br />

meet at the end of the day. A risky strategy<br />

given we had no radios and I usually<br />

carried our one satellite phone - but it had<br />

worked for us so far and meant we could<br />

both travel at our own comfortable pace.<br />

I had met Phil two years earlier on a polar<br />

training course in Norway. Tall, bearded,<br />

and with a smattering of tattoos, he could<br />

look a little menacing. But I soon learned<br />

he was a gentle soul. Empathetic and<br />

kind, but also tough and very driven. The<br />

sort of person you know you can rely on.<br />

That counts for a lot in the wilderness.<br />

The more I walked, the more I doubted<br />

our plan for the day. We wanted to ‘thread<br />

the eye of the needle’ and navigate<br />

between the mainland and Olkhon's<br />

western flank. Things didn't seem to<br />

add up, though. As the day wore on, the<br />

darker brown side of the island looked too<br />

far to the right to be the passage we were<br />

aiming for.<br />

My feet were screaming from days of<br />

being bashed on the hard ice, and the<br />

sun was dropping ever lower behind the<br />

mountains. I scanned the horizon for Phil.<br />

He had the tent. "Trust yourself, Ash," I<br />

muttered to myself. "Trust the map."<br />

I took a bearing and headed left of the<br />

darker hills, assuring myself that Phil must<br />

have come to the same conclusion. The<br />

negative part of my brain was mulling over<br />

the prospect of a night out in the open,<br />

huddled inside my sled bag, with as much<br />

clothing as possible. That was definitely<br />

not a pleasant prospect.<br />

But just as I began to fear the worst, I<br />

spotted it – our tent - a tiny dark fleck on<br />

the horizon. The pain in my feet melted<br />

away, and I pushed onward, celebrating<br />

and muttering to myself with musings I<br />

have long since forgotten.<br />

A changing landscape: The shoreline of<br />

Baikal isn't without life or interest. Lumpy<br />

rolling hills covered with deep snow and<br />

generous smatterings of dense woodland<br />

filled much of our view before Olkhon.<br />

The ice itself drew us in with its natural<br />

artistry. Trapped methane bubbles and<br />

sweeping white swirls were frozen into<br />

translucent sheets with hypnotic effect,<br />

and the broken ice forced upward by<br />

pressure twinkled with blue and emerald<br />

tones. There were also occasional<br />

Dacha's, wooden summer houses for the<br />

rich or visiting tourists. Olkhon has several<br />

dwellings on its shores, and we took up<br />

the hospitality of one friendly hotelier to<br />

28//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


Top to bottom: Sunrise<br />

through a blade of ice.<br />

A typical camp spot, with the<br />

mountains of the east coast<br />

of Baikal in the background.<br />

Home for a night, a small hut<br />

at a weather station on the<br />

west coast of Baikal.<br />

"Subtly piercing the<br />

overwhelming silence,<br />

the faint haunting sound<br />

of the groaning ice below<br />

almost sounded like<br />

shelling on the western<br />

front. This was to be our<br />

nightly soundtrack for the<br />

coming weeks."<br />

escape into the warmth and refuel. Never<br />

have black tea, honey, bread, and a bowl<br />

of plain white rice tasted so good.<br />

The character of the landscape began<br />

to change after this. Undulating lumps<br />

gave way to huge alpine giants. Steep<br />

buttresses and gullies soared high into<br />

the deep blue sky, and the loose snow<br />

danced around these features as the<br />

wind buffeted their upper flanks. Although<br />

local mountaineering clubs do access<br />

these remote ranges, there are no doubt<br />

many lines that remain unclimbed.<br />

Endless beckoning nothingness to<br />

the right and jagged alpine mountains<br />

piercing the skyline to the left. Now, this<br />

was why I was here.<br />

ADVENTUREMAGAZINE.CO.NZ//29


Interesting encounters: After 15 days<br />

of travel, we had covered nearly 450km.<br />

We happened across a series of remote<br />

huts, one of which was inhabited by a<br />

hardy couple who manned a weather<br />

station. Forgetting any notion of purism,<br />

Phil and I took up the offer of a night<br />

in a small wooden hut. The following<br />

day I started off early and waited for<br />

him to catch up. The catch came much<br />

later than usual, though. A brown bear<br />

had arisen early from hibernation and<br />

descended on the weather station. No<br />

big drama, though, as the sore-headed<br />

bear was chased off by a few warning<br />

shots from our weather station friends.<br />

The wildlife weren't the only interesting<br />

characters on our journey. There were<br />

the locals too. One day out of the haze,<br />

a pair of battered old Soviet vans came<br />

careering toward me on the ice road<br />

that lines part of the lake. "Oh Christ,<br />

what the hell do they want?" I thought.<br />

After screeching to a halt, a great big<br />

bear of a man stepped out. Chattering<br />

away for a moment, he realizes my blank<br />

face means I can't understand what on<br />

earth he's saying. He quickly switches<br />

to English and hurries his clients out of<br />

the van. Before long, I'm surrounded<br />

by tourists asking for photos, as if I<br />

were some kind of curiosity. I must<br />

have looked like a stereotypical "Polar<br />

Explorer" with a fur ruff on my hood and a<br />

weather-beaten face.<br />

After asking where I lived in the UK, an<br />

Austrian chap even managed to talk<br />

about my local soccer team who had<br />

just won the league. But soon enough,<br />

I was thanked for my photographic and<br />

conversational duties and treated to a<br />

shot of local samogon (moonshine). Not<br />

one, however, but three. I daren't decline<br />

their gesture, so as we went our separate<br />

ways, I tottered on, feeling bemused and<br />

a little worse for wear. What on earth had<br />

just happened?!<br />

The home strait: After a few weeks, life<br />

on the ice becomes ingrained. You forget<br />

what it was like before, and you don't<br />

want to imagine what it will be like when<br />

you reach the end. While striking camp<br />

in the morning may have taken several<br />

hours, it now took half the time. The<br />

disciplined routine of cold weather travel<br />

becomes second nature. The ice, wind,<br />

and snow become your entertainment.<br />

Their distinct moods lift or sully your own.<br />

To the indigenous Buryat people and<br />

those who spend a lot of time on the<br />

lake, Baikal is an extraordinary place. "I<br />

physically feel how the positive energy of<br />

Baikal recharges my batteries. For me, it's<br />

not just the biggest freshwater lake – it's<br />

part of my inner world," our fixer Eugene<br />

told me. Several times in his life, he had<br />

attractive job offers in other countries,<br />

and I could now see so well why, on each<br />

occasion, he had turned them down.<br />

The final few hundred kilometers were<br />

not easily won. The snow was deep in<br />

the latter half of the lake, and even with<br />

snowshoes, we struggled. Eventually, after<br />

19 days and 634km, we reached the end.<br />

We trudged into Severobaikalsk, a slightly<br />

grim and rundown town built for workers of<br />

a new railway line in the mid-'70s.<br />

We dragged our sleds onto the main<br />

road into town, past abandoned lakeside<br />

summer houses as the odd mangy dog<br />

or local resident looked on curiously. I felt<br />

like a frontiersman riding into town during<br />

the expansion of the Wild West. Still,<br />

thankfully we weren't met by a gun-toting<br />

local sheriff. As we had found repeatedly<br />

throughout our trek, the people who live<br />

along the shoreline are warm, generous,<br />

and very hospitable.<br />

And just like that, our Siberian wander<br />

was at an end. We spent the next 36<br />

hours chugging past endless taiga on the<br />

Trans-Siberian railway and other lesserknown<br />

lines. A dream safely fulfilled, our<br />

bodies could now relax. We ate, drank,<br />

laughed, and felt satisfied. Despite the<br />

warm toasty sanctuary of our carriage,<br />

I knew before too long we'd both want<br />

to be back out on the ice. Once you<br />

experience this winter pearl of Siberia, it<br />

becomes part of your inner world.<br />

30//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


Phil breaking trail on a hazy day<br />

"After a few weeks, life<br />

on the ice becomes<br />

ingrained. You forget what<br />

it was like before, and you<br />

don't want to imagine<br />

what it will be like when<br />

you reach the end."


BIG PINE LAKES<br />

Words by Paige Hareb | Images by Lauren Murray<br />

While spending two months in America, Lauren and I wanted to do a few road trips<br />

and hikes to explore more of this amazing, huge, crazy and beautiful country. One of<br />

our adventures that really stood out, and we would definitely recommend doing was,<br />

commonly referred to as the Big Pine Lakes trail, the technical trail name is Big Pine<br />

Creek North Fork Trail.<br />

Big Pine Lakes is located in the heart of the Eastern Sierras of California. It is roughly 10<br />

miles (yes miles cause we are in America now folks! About 16kms) west of Big Pine and<br />

around 15 miles (24kms) south of Bishop. It’s not far from the ski town, Mammoth.<br />

32//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


Standing here in this moment, made the previous 3 hours all worth it.<br />

ADVENTUREMAGAZINE.CO.NZ//33


"We asked if we<br />

should buy some<br />

bear spray (yes,<br />

that’s an actual<br />

thing!), but<br />

again, we felt like<br />

they laughed at<br />

us two girls with<br />

funny accents. "<br />

Although we didn't manage to get a photo of the bear on<br />

this hike, a week later we were in Sequoia National Park<br />

and had more time and distance to capture this shot.<br />

We wanted to slowly make our way up and camp<br />

up there overnight but you need to get a permit<br />

for that. To get these you have to plan in advance,<br />

which we aren’t great at doing! So the only 25<br />

permits per night were already booked out. With<br />

Lauren being a professional photographer, she<br />

wanted to make sure we were there for good<br />

lighting, which means either for sunrise or sunset.<br />

Either way, we would have to do a lot of the trail<br />

in the dark. Not my favourite thing to do, let alone<br />

adding bears into the mix!<br />

Because we felt like such innocent, naive little<br />

kiwi girls, we decided to double check at the Inyo<br />

National Park information centre as well as a<br />

hiking store nearby to see what the actual odds<br />

were like of coming across a bear and being<br />

attacked by one. The general answers from them<br />

felt a little bit like when people ask me “have you<br />

ever seen a shark when surfing?” and my answer<br />

is usually a slight laugh with something along the<br />

lines of “yeah, but for the amount of surfing I’ve<br />

done, not that many times and you’re more likely<br />

to have a car accident”. One of their answers was<br />

“you’re more likely to get struck by lightning”. We<br />

also asked if we should buy some bear spray<br />

(yes, that’s an actual thing!), but again, we felt like<br />

they laughed at us two girls with funny accents.<br />

So on that note, we decided to hike up for sunrise.<br />

Bishop is the closest town, about a 30min<br />

drive to the start of the trail, we were already<br />

needing to get up at 2am so decided to stay at<br />

the campground right by the trailhead to get that<br />

extra 30mins of sleep. We knew it would roughly<br />

take us 3 hours up to be safe and arrive with<br />

enough time to set up for sunrise. With no one<br />

else silly enough to get up at that time of the day,<br />

we headed off into the pitch black early hours of<br />

the morning with our head lights on and having<br />

turns at carrying a mini axe, because we had<br />

still scared ourselves about bears and somehow<br />

thought a mini axe would protect us (now that<br />

I’m writing this, I’m embarrassed and laughing at<br />

myself).<br />

With our head lights on, an axe in hand, we were<br />

on our way and still very on edge. The first part<br />

of the trail was a steep rocky and sandy incline<br />

which we felt but coming back down it in daylight,<br />

we both agreed that seeing where we had to climb<br />

up would have been a lot more disheartening. I<br />

think it’s the first hike we have ever done where it<br />

took us the same amount of time climbing up as it<br />

did down (2.5hrs up and 2.5hrs down).<br />

The only explanation we can think of, is that we<br />

were so wired from adrenaline walking up in the<br />

dark and thinking about bears. My neck actually<br />

got sore because I was looking all around the<br />

whole 2.5hrs up, even turning around and looking<br />

behind me every 100 metres to double check<br />

nothing was following us. We also talked the<br />

whole way up as it was a bear survival suggestion<br />

to help let the bears know that we were humans.<br />

It was like we had manifested encountering a<br />

bear. About halfway up I was trailing a few metres<br />

behind Lauren when I heard a fairly loud sound.<br />

We stopped in our tracks instantly and continued<br />

to hear the sound of a bear snoring, yes snoring!<br />

It sounded very deep and loud and like it was just<br />

a few metres off the track from us.<br />

34//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


ADVENTUREMAGAZINE.CO.NZ//35


"Lauren spotted two<br />

eyes up ahead shining<br />

in our head lights<br />

staring right back at<br />

us. I had just finally<br />

relaxed slightly after<br />

the last one, yet here<br />

we were again stopped<br />

in our tracks having<br />

a staring competition<br />

with a bear."<br />

"We ask<br />

should b<br />

bear sp<br />

that’s a<br />

thin<br />

again, we<br />

they lau<br />

us two g<br />

funny a<br />

Above: Lauren testing the freezing cold water, lake three of seven.<br />

Right: We didn’t get to sleep here but someone did, what a ‘pine’<br />

view to wake up to.<br />

We were standing frozen and whispering<br />

deciding whether to carry on or not. We decided<br />

to tip-toe past and for the next half an hour we<br />

were looking behind us more than ever. My<br />

shoelace came undone but we didn’t even want<br />

to stop for that, just wanted to get as far away<br />

as possible and not wake the sleeping bear.<br />

About 30mins more into the hike, roughly just<br />

over half way, still pitch black, Lauren spotted<br />

two eyes up ahead shining in our head lights<br />

staring right back at us. I had just finally relaxed<br />

slightly after the last one, yet here we were<br />

again stopped in our tracks having a staring<br />

competition with a bear. I never in my life<br />

thought I would be able to say that. Luckily<br />

it was up in the distance but because it was<br />

so dark, we couldn’t tell if it was going to be<br />

on the track up ahead. We stood there for<br />

contemplating turning around. Since we were<br />

over halfway and closer to our destination, I<br />

really didn’t want to turn back in pitch black,<br />

walk past the sleeping bear and not see what<br />

we came here for. But I also didn’t want to get<br />

any closer to this bear staring at us. After what<br />

felt like an eternity, we made a bold decision<br />

to carry on a bit further to see where the track<br />

would take us. Thankfully the next turn was in<br />

the opposite direction of the beady-eyed bear.<br />

I think that’s the most excited I’ve ever been<br />

about seeing the first light in the early hours<br />

of the morning. I said to Lauren several times<br />

“Look, look, it’s getting lighter”. You would not<br />

believe how relieved we were when we saw the<br />

first of the seven lakes up there. The first lake<br />

was beautiful but five minutes more and we<br />

made it to the second lake, the one more well<br />

known for it’s majestic beauty. As you can see<br />

in the photos, it almost looks fake and felt like<br />

we were on a movie set. Yes, the water colour<br />

really is that colour! We thought we were the<br />

only ones up there until the light started showing<br />

a few hidden tents around the lake. We decided<br />

to check out the third lake as it was only another<br />

10 minute walk but it was safe to say the second<br />

lake is definitely the most magnificent. We<br />

would of liked to have travelled further into the<br />

hills but the adrenaline was wearing off and we<br />

still had at least another couple of hours to get<br />

back down, as well as the sun rising quickly to<br />

over 100 Fahrenheit (over 37 Celsius).<br />

With over an 11 mile round trip (18.5km) and an<br />

elevation of 786m, a total 5 hours of walking,<br />

we slinked into the car, thankful for minimal bear<br />

encounters and the amazing scenery, and drove<br />

straight to Starbucks for a well-earned iced<br />

Frappuccino.<br />

36//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


ed if we<br />

uy some<br />

ray (yes,<br />

n actual<br />

g!), but<br />

felt like<br />

ghed at<br />

irls with<br />

ccents. "<br />

ADVENTUREMAGAZINE.CO.NZ//37


Paddling 38//WHERE on the ACTIONS Whanganui SPEAK Journey LOUDER THAN WORDS/#<strong>234</strong>


PADDLE THE<br />

WHANGANUI<br />

JOURNEY<br />

NZ'S ONLY GREAT<br />

WALK ON WATER<br />

Nothing really prepares you for the<br />

magnificence of the Whanganui River. As the<br />

world’s first river to be recognised as a living<br />

entity, a personhood with legal rights, there is<br />

a benevolence in the air, a sacredness to the<br />

waters you can’t deny.<br />

As you navigate your way downstream,<br />

it’s as if time stands still and you are fully<br />

immersed in a new rhythm, with each stroke<br />

of the paddle, all your senses come alive.<br />

Slowly, spectacularly, the natural wonders<br />

unfold, and there is a feeling of divinity that<br />

humbles you, so much so that you feel<br />

you ought to whisper in the stillness of the<br />

morning mist or break out in song at the end<br />

of the day as an offer of thanks.<br />

From the deep dramatic gorges to the lush<br />

evergreen ferns hanging over the riverbanks,<br />

there is something otherworldly about the<br />

Whanganui Journey that’s hard to describe<br />

in words, you have to feel it to believe it.<br />

So pack up your hiking boots and let your<br />

paddle do the walking – the life force of the<br />

Whanganui Journey is calling.<br />

Discover New Zealand’s only Great Walk<br />

on water<br />

Sweeping from the North Island to the<br />

bottom of the South, the ten New Zealand<br />

Great Walks are Aotearoa’s premier tracks<br />

for unforgettable walking, hiking and in the<br />

case of the Whanganui Journey, paddling<br />

in off the beaten track, pristine wilderness.<br />

Soak up the magnificent natural landscape,<br />

wildlife, and the rich cultural heritage of<br />

Whanganui River – NZ’s longest navigable<br />

river at 290 km long flowing from Mt<br />

Tongariro towards the Tasman Sea.<br />

ADVENTUREMAGAZINE.CO.NZ//39


Images compliments of Visit Ruapehu<br />

Clockwise from top left: Misty morning on the Whanganui River / A cultural experience at Tīeke Marae/Kāinga<br />

Mangapapapa Campsite along the Whanganui Journey / Taking a break on the Whanganui Journey<br />

Getting to the start of the Whanganui Journey<br />

There are several traditional entry and exit points in Ruapehu for<br />

the Whanganui Journey including the following:<br />

• Taumarunui<br />

• Ohinepane<br />

• Whakahoro<br />

• Pipiriki<br />

Make the most of your experience and enjoy a night or<br />

two before and after the Whanganui Journey and enjoy<br />

connecting with the local communities. With a a wide range of<br />

accommodation and activities on offer in Ruapehu, it’s easy<br />

make the Whanganui Journey a one-of-a-kind holiday.<br />

How long is the Whanganui Journey?<br />

You can choose to do either the 5-day from Taumarunui to<br />

Pipiriki (145 km) or the 3-day journey from Whakahoro to Pipiriki<br />

(88 km). It’s a journey to savour and not meant to be rushed.<br />

Operators are able to provide shuttle transport back to your<br />

accommodation, vehicles, or starting point.<br />

Tour types – canoe, kayak, guided or unguided<br />

There are several ways to experience the Whanganui Journey,<br />

but the majority of people travel by canoe. Going guided also<br />

gives you a deeper insight to the people of the river, the culture,<br />

history, and way of life. If you are not confident on a canoe nor<br />

a confident swimmer, booking a guided Whanganui Journey is<br />

recommended.<br />

When is the Whanganui Journey Great walk season open?<br />

The Whanganui River is accessible year-round, with jetboating<br />

tours operating in the winter months. However, if you want<br />

to complete the Whanganui Journey, the Department of<br />

Conservation (DOC) has specific dates for when the Great Walk<br />

season runs - generally from 1 October to 30 April where you will<br />

need to book your huts and campsites in advance.<br />

What to pack<br />

You can’t purchase food or supplies on the Whanganui Journey<br />

so pack like you are camping and need to be self-sufficient. Gas<br />

cookers, tents, ground sheet and sleeping mat for campsites,<br />

cooking equipment and utensils, food that doesn’t require<br />

refrigeration and drinking water for until you get to the first<br />

campsite or hut. Pack toiletries including toilet paper, a first aid<br />

kit, survival kit, a distress beacon because there is no cell phone<br />

reception, personal medication, warm clothing, and waterproof<br />

layers. Check out a full list of recommended items on the<br />

Department of Conservation website as well as contact a local<br />

river operator. Local river operators will provide a life jacket,<br />

canoe, or kayak, along with paddles, dry bags, and plastic<br />

drums to store your essentials and gear.<br />

What’s accommodation like?<br />

The Department of Conservation operates two huts, eleven<br />

Great Walk campsites and one basic bunkroom along the<br />

Whanganui Journey. During the Great Walk Season, you must<br />

book huts and campsites ahead of time. A highlight of the<br />

journey is a unique stay at Tieke Kāinga, the only DOC hut that<br />

is also used as a marae. Choosing to book a guided cultural<br />

journey means you will be immersed in the culture and history<br />

with the possibility to participate in a traditional Māori pōwhiri.<br />

There are bunks, mattresses, backcountry toilets, a heating<br />

source and water supply at the huts although you will need to<br />

boil the water first before drinking. For some Great Walk Huts,<br />

a hut warden may be present. Campsites have basic facilities<br />

including a water supply, picnic tables, cooking shelters and<br />

toilets. Read up on the latest information about the Whanganui<br />

Journey from the Department of Conservation (DOC) website or<br />

visit a DOC Visitor Centre.<br />

Care for the Whanganui Journey<br />

Leave only footprints, take only memories. Protecting nature,<br />

wildlife and looking out for others is paramount on the<br />

Whanganui Journey. Respecting the environment means<br />

whatever you take in, you must take out with you. Staying safe<br />

also entails being prepared for variable weather conditions and<br />

understanding the Land Safety Code.<br />

Prepare to experience the wonders of the Whanganui Journey<br />

at www.visitruapehu.com<br />

40//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


UNREAL<br />

LANDSCAPES<br />

REAL<br />

MOMENTS<br />

STAY & PLAY IN RUAPEHU FOR YOUR NZ GREAT WALK<br />

ADVENTURES<br />

From adventure lodges, iconic hotels to alpine resorts, wake up with two NZ Great<br />

walks at your doorstep and find your home away from home in Ruapehu.<br />

VISITRUAPEHU.COM


Above: Despite the dull day, the reds and oranges of the surrounding tussock shone brightly<br />

Right: Caitlin at the top of Taranaki Falls<br />

TARANAKI FALLS<br />

Words and images by Lynne Dickinson<br />

I didn’t need to wait till sunrise to check the weather, I had<br />

been listening to the rain fall on the roof all night, it was<br />

just another wet one in the Central Plateau. It seemed to<br />

have been the norm for this winter, not only in my neck of<br />

the woods, but the rest of the country also seemed to be<br />

suffering the same weather patterns.<br />

One of the things I learned whilst on a multi-day hike in<br />

Fiordland, is that not everything is better in sunshine.<br />

Waterfalls, without a doubt, are so much better when<br />

there has been plenty of rainfall. So, with that in mind, we<br />

wrapped up warm and headed out to explore one of the<br />

many day hikes leaving from Whakapapa Village.<br />

The mountain was cloaked in mist and fog, and rain<br />

seemed imminent as we set off toward Taranaki Falls.<br />

The 6km circuit trail leaves from the road behind the<br />

Chateau and can be completed in either direction. We<br />

started at the Skotel and went in an anti-clockwise<br />

direction.<br />

The low light and the red tussock and manuka created<br />

a real autumnal feel before merging with the Waihohonu<br />

horse trail where layers of pumice and ash are still visible<br />

from previous eruptions. The track crossed a series<br />

gullies created by the wind, rain and frost action on the<br />

volcanic soils, before dropping down to the Wairere<br />

Stream. This section of the track was covered in red<br />

tussock and although not clearly visible in the misty light,<br />

we could hear the native birds nearby.<br />

Walking in this direction means you enter the falls from<br />

the top. We climbed as close to the edge as we felt safe<br />

and looked down into the valley below and could see<br />

our trail meandering down in the distance. There are<br />

approximately 100 steps down to the base of the waterfall<br />

and once at the bottom we realized what a great photo it<br />

would be if someone was on the top of the falls. So, Caitlin<br />

volunteered to run back up and around to the top of while I<br />

stayed put to capture the moment.<br />

In summer (or if you are a lot braver) you can walk<br />

behind the falls and even swim in the river, but this was<br />

the middle of winter, and although it’s been a fairly mild<br />

one, we chose to just admire them from a distance. The<br />

falls themselves, especially it the wet weather, were<br />

impressive. According to DOC, the water tumbles 20<br />

meters over the edge of a large andesite lava flow which<br />

erupted from Mt Ruapehu 15,000 years ago.<br />

Unfortunately by now, the rain had begun to fall so we<br />

continued on along the lower track back which gave us<br />

some shelter in the form of the forest consisting of beech<br />

trees, umbrella ferns and mountain toatoa. We crossed<br />

another stream, (fortunately all streams on the track<br />

are bridged) and emerged into the tussock and alpine<br />

shrubland typical of the Central Plateau region. On a<br />

clear day you can see Mt Ruapehu, Ngauruhoe and Mt<br />

Tongariro.<br />

The track only took us 2 hours to complete, and the trail<br />

was well formed and easy to walk throughout, however<br />

Tongariro National Park is notoriously changeable and you<br />

need to be prepared for all weather conditions. Make sure<br />

you have all the correct clothing and equipment regardless<br />

of how the day looks when you start.<br />

TARANAKI FALLS<br />

Length: 6km circuit<br />

Time: 2 hrs<br />

Start: Whakapapa<br />

Village<br />

Tips: Be prepared<br />

for changeable<br />

weather.<br />

Leave someone at<br />

the top of the falls<br />

for a great photo<br />

opportunity.<br />

42//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


ADVENTUREMAGAZINE.CO.NZ//43


Top: Mick on his way to the Devils Staricase<br />

Bottom L-R: We did it, at the Whakapapa I-Site / Next to Emerald Lakes / On top of Red Crater<br />

THE NORTHERN CIRCUIT<br />

IN THE SNOW...WITH THE KIDS!<br />

Words and images by the De Zeeuw Family:<br />

Dad Axel, Mum Lizzy, Mick (7yr old) and Tim (5yr old).<br />

Doing the Tongariro Northern Circuit in the snow.<br />

Why: We’ve been taking the boys on overnight/multi night<br />

trips since January last year (2021). Before that we took<br />

them out on daytrips in the weekend, first in the front/<br />

backpack and later they had to walk themselves. We are<br />

lucky that we live rurally and close to the Waikato River<br />

Trails, so the boys have been doing 5km walks, sometimes<br />

on a daily base, either in the pack, on their (balance) bike or<br />

walking/running.<br />

Last year spring we walked from Desert Rd Carpark to<br />

Oturere Hut and climbed Red Crater from the scree side as<br />

a day trip from Oturere Hut. There was snow and almost<br />

nobody on the Crossing, but because we knew there was<br />

no firewood at Mangatepopo Hut, we’ve decided to stay two<br />

nights in Oturere Hut and walk out to Desert Rd the next<br />

day. Since then, the boys wanted to complete the whole<br />

circuit, Mick wanted to tick it off his list before he turned 8.<br />

I’ve been wanting to this since we arrived in NZ 7 years ago,<br />

but I couldn’t have dreamed doing this with both my boys at<br />

this stage in their life.<br />

Although we’ve been planning it for months, the forecast<br />

looked good on those days that we had a week off, so that<br />

was our gap to go.<br />

When: September 2022<br />

Where: Tongariro Northern Circuit, Tongariro National Park<br />

I wouldn’t say this trip pushed the boys out of their comfort<br />

zone, but it did show them that they are more resilient than<br />

they think. They are both very aware of what was going to<br />

happen and did some tricky tracks already. They know that<br />

there is always the option that you must turn around and<br />

can’t continue what you’ve started, but you always must try.<br />

Mick pushed himself on the last day when he hurt his foot.<br />

Although there were some tears, he pushed himself passed<br />

that and kept walking. He’s a bit older and thinks more<br />

about what effect his actions have, where Tim is always just<br />

carefree and whistles even after a 16km morning.<br />

44//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


Mick: Hello, my name is Mick de<br />

Zeeuw, I am 7 years old and love<br />

hiking. I live in Putaruru and am in year<br />

3 at Te Waotu School. My teacher,<br />

Mrs Topping, always gives me cool<br />

tramping, mountain or nature books<br />

to read. I also love to play soccer<br />

and netball. The mountains I want to<br />

climb are Mt. Everest, Mt. Cook, Mt.<br />

Ngauruhoe and Mt. Ruapehu. When<br />

I am older I want to do the Duke of Edinburgh’s Hillary Award.<br />

My favourite hikes so far are the Tongariro Northern Circuit, Abel<br />

Tasman Coastal track and the Taranaki Summit Route.<br />

Why: I felt enthusiastic trying to do this, because last year we only<br />

climbed Red Crater from Oturere Hut. I thought it would be fun, to<br />

spend time away from home with my family and throw snowballs<br />

in my dads face. I am keen to climb Mt. Everest when I’m older so<br />

I have to start practicing.<br />

What did you learn:<br />

- Slow but steady wins the race<br />

- Don’t give up, even when it gets hard<br />

- If you want it, you can do it<br />

What did you like the most: When I threw a snowball in dads<br />

face and he tripped over, the snowball fight on the top of red<br />

crater with an orc disguised as a guide.<br />

Above: Downhill to Oturere Valley, the snow made the going down a lot easire than last year!<br />

Left: Mick on the South Crater<br />

Most challenging: When I hurt my foot, but I knew I had to keep<br />

walking<br />

Tips:<br />

- Don’t eat yellow snow<br />

- If you can, walk where other people walked so you don’t<br />

sink hip deep in the snow<br />

- Only go when the weather conditions are good and bring<br />

a locator beacon<br />

- Kids can do more than old people think<br />

- Always bring lots of snacks! My favourite are snack<br />

packs with nuts, raisins, cranberry, jellybeans and when<br />

I’m lucky mum makes freeze balls.<br />

- Pick up rubbish if you see it<br />

- Don’t leave your rubbish at the hut but take it home<br />

In my bag I always take: My sleeping bag + liner, my striped long<br />

johns to sleep in, shorts, shirt, fleece jumper, first aid kit, down<br />

jacket, rain gear, spare socks, crocs, a book to read at the hut/<br />

campsite and playing cards, an emergency blanket, my snacks for<br />

the whole trip, water, my compass and a whistle.<br />

I really loved doing the Northern Circuit in winter, but I thought it<br />

was more challenging than when I was climbing to the Taranaki<br />

Summit in January. Next on my bucket list are Mt. Ruapehu<br />

Summit, the Kepler Track, Stewart Island and the North/South<br />

Track in the Kaimais.<br />

ADVENTUREMAGAZINE.CO.NZ//45


Tim: (dictated to mum)<br />

I am Tim and I am 5 years old. I<br />

am in year 1 at Te Waotu School<br />

and I did the Tongariro Northern<br />

Circuit in the snow!<br />

Biggest challenge: When it started snowing from Waihohonu to<br />

Whakapapa, lucky I had my raingear on!<br />

Coolest thing: Building a snowman with mum at Oturere Hut and<br />

walking through the deep snow<br />

Funniest: When mum got stuck in the deep snow and I threw a<br />

snowball in her face.<br />

Best part: Jumping down Red Crater in the deep snow and<br />

playing Chess in the hut<br />

Tips:<br />

- Stay in other people’s footprints<br />

- I might be small, but I can do a lot<br />

- I need more snacks than an adult, I make lots of little<br />

steps<br />

Learned: Slow but steady wins the race<br />

In my bag I always have snacks, water, spare clothes, my jacket,<br />

my raingear, my pj’s, spare socks, my crocs, my sleeping bag and<br />

liner (but sometimes mum or dad will carry it for me if we have a<br />

long day) a book to read, emergency blanket, my compass and<br />

my whistle.<br />

Above: Tim stuck in the snow<br />

Below: Tim climbing the last few meters to the top of Red Crater<br />

Tips for parents:<br />

- Bring plenty of snacks. Our boys have a bag with nuts, lollies<br />

and dried fruit in their pocket/bag and they can grab something<br />

whenever they want. In the beginning we would walk for a while,<br />

and they had to wait till we sat down to eat but know they just<br />

can eat something as we go. If that means they’ll eat a jellybean<br />

at 8:05AM, 5 minutes after you started, so be it. If they’re happy,<br />

you have a fun trip!<br />

- Plenty of layers. Our children are never cold, but they wore a<br />

lot of layers. It’s always easier to take a layer off than to have a<br />

cold, grumpy child.<br />

- Raingear. Although it was sunny, the boys both wore their rain<br />

pants and jacket, with gaiters, a fleece jumper, long johns and<br />

shorts. Their down jacket was too hot, the raingear protected<br />

them from the cold, and they didn’t get wet after falling/playing in<br />

the snow!<br />

- Try to find out if the hut has firewood! After being in the snow<br />

all day, it’s nice that socks/shoes/clothes can dry so they don’t<br />

have to put their wet gear back on the following morning.<br />

- Make sure they know where they sign up for. It’s a challenging<br />

track, even for some adults, although my children show me<br />

every time that they are more versatile than we think.<br />

- Know their limits! Be aware that your children can do a day<br />

of the track in a certain amount of time and don’t make it into<br />

10hour days. That way they can enjoy some downtime at the<br />

next hut and you’re not stressing about getting to the hut before<br />

dark. Stressed parents and grumpy children are not a good<br />

combination. Our longest day was just under 5 ½ hour from<br />

Waihohonu to Whakapapa and it could’ve been faster if Mick<br />

didn’t hurt himself. On the other hand, don’t think they can’t do<br />

it. Most times, our children surprise us in what they can do, but<br />

better try to find out on an easier track and not in the snow.<br />

- Don’t let other people tell you, your children can’t do it.<br />

Especially those children that have been out and about for years<br />

can do more than the average adult.<br />

- Always bring enough supplies, so if you’re stuck an extra day,<br />

you have enough food to keep your children and yourself warm<br />

and fed. Low weight backpacks will come again once they’re old<br />

enough to take half of your gear.<br />

- Most of all, enjoy! We are lucky to have this amazing scenery<br />

on our doorstep and to share this with our children is definitely a<br />

privilege!<br />

- Both boys always carried a laminated paper in their backpack<br />

with their name, date of birth, address, phone number and<br />

emergency contact number, in case of emergency.<br />

46//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


southernapproachnz


Come cycling in stunning<br />

Central Otago and let the<br />

experts look after all your needs<br />

> Lake Dunstan Trail<br />

> Otago Central Rail Trail<br />

> Roxbourgh Gorge Trail<br />

and more...<br />

Because it is all about you<br />

Trail riding Central Otago<br />

Call the experts at Bike It Now!: 0800 245 366<br />

Clyde Bike Shop and Tour office open 7 Days<br />

Cromwell Bike Shop open Monday - Saturday<br />

NEW SHOP NOW OPEN IN WANAKA open 7 days<br />

www.bikeitnow.co.nz<br />

2022


THE GROWTH OF<br />

AN ICONIC KIWI<br />

BUSINESS Reflection by Kathryn Fletcher<br />

Lisa, Duncan and Fletch<br />

It is nine years this month (September<br />

2022) since we, Lisa Joyce, Duncan<br />

Randall and Kathryn Fletcher (Fletch),<br />

opened Bike It Now!, offering bike retail,<br />

bike hire and bike tours in Clyde.<br />

It all began with Lisa and I walking our<br />

dogs along the back lane of Clyde in<br />

September 2012. Dunc was outside a<br />

small bike hire shop and travel agency<br />

called Bike It Now! washing rental bikes.<br />

Duncan had just moved with his family to<br />

Clyde from Dunedin, like Lisa and I had<br />

just done after Lisa secured a job working<br />

for Contact at the Clyde Dam, so we had<br />

that in common from the outset.<br />

Our business connection began on August<br />

23, 2013, with the three of us purchasing<br />

the business from the late and great Ross<br />

McRobie and his wife Petrea; they had two<br />

full-time staff, one of them being Duncan.<br />

When we reopened in September, three<br />

weeks later, we had expanded into retail<br />

and added a workshop as we needed to<br />

create a business that would be able to<br />

look after us all.<br />

Things have changed in the cycling<br />

industry significantly since 2013, and we<br />

have been fortunate to be at the forefront<br />

of this, namely the shift away from 26'<br />

bikes to 27.5' and 29' along with the rise of<br />

E-bikes. We had the first E-Bike for hire, a<br />

Scott E Aspect, out on the Otago Central<br />

Rail trail in 2014; all E-bike riders had to<br />

have a medical reason for riding an E-bike,<br />

as the rules prevented E-Bikes from being<br />

used on DOC managed trails.<br />

DOC's stand changed very quickly, so<br />

by 2015 we had a fleet of E-bikes which<br />

proved popular. We also started to retail<br />

E-bikes at the end of 2014. While this<br />

was going on, John Key was making his<br />

mark on the Cycle tourism industry in NZ<br />

by allocating significant funding to Trail<br />

development, particularly for Great Rides.<br />

Central Otago benefitted through the<br />

Roxburgh Gorge Trail and Clutha Gold<br />

Trail development's initially - remembering<br />

the Otago Central Rail Trail had been<br />

opened in 2000 but was separate from this<br />

funding model.<br />

Roll forward to 2019 when the Lake<br />

Dunstan Trail was started, part of a<br />

unique project; riding from Queenstown<br />

or Wanaka to Dunedin via a trail network<br />

and not having to ride on roads. This is<br />

ongoing, but the Lake Dunstan Trail from<br />

Cromwell to Clyde was opened on May<br />

8 2021. The other linking sections are all<br />

happening over the next few years.<br />

COVID, to the bike industry and Central<br />

Otago in particular, created a very ‘busy<br />

time’, a silver lining, with NZers not<br />

travelling overseas and looking for options<br />

at home. The significant spending on<br />

E-Bikes and then looking for places to<br />

take them for 1/2 day to 9-day rides has<br />

impacted all cycle-based businesses in our<br />

small area. The flow on to accommodation<br />

and hospitality providers has been very<br />

positive as a result.<br />

Relationships have always been essential<br />

to us throughout this time, from our<br />

suppliers of bikes to our accommodation<br />

providers and, most notably, our staff.<br />

Bike It Now! is all about looking after staff,<br />

customers and our community.<br />

Loyalty has always been the backbone to<br />

our business; to our staff, our customers<br />

and our suppliers/reps. I feel I need to<br />

mention mention four people in particular,<br />

Jan who has been creating tours for our<br />

customers for nearly nine years and 3 of<br />

our supplier reps; Ben Vial and Shakey,<br />

who have been with us from the beginning<br />

and are still with us, also Rowan Miller,<br />

who is no longer in the industry but had a<br />

significant impact on all of us.<br />

We have also had a great relationship with<br />

Webstudio in Queenstown and Buchan<br />

Design in Roxburgh since day one, they<br />

always have us covered.<br />

We have always tried to support our local<br />

community and make positive impacts,<br />

whether it be sponsorship or just being<br />

good citizens. We have worked with<br />

Regional Tourism and Tourism NZ and<br />

promoted Central Otago first and foremost<br />

as the place to visit both domestically<br />

and for our international visitors and the<br />

business has expanded to include stores<br />

in both Cromwell and Wanaka.<br />

3<br />

Full-time staff<br />

September<br />

2013<br />

23<br />

Full-time staff<br />

September<br />

2022<br />

2013<br />

Significant moments:<br />

Sept 2013: opened Clyde shop,<br />

retail, hire, workshop and tours.<br />

2016 onwards: Trip Advisor<br />

Excellence Awards, Hall of<br />

Fame 2019 and travellers'<br />

choice 2020, 2021 and 2022.<br />

Nov 2018: gained Qualmark<br />

Gold award, the first self-guided<br />

cycle tour company in New<br />

Zealand to achieve this, and we<br />

have retained this in all reviews.<br />

July 2019: opened Cromwell<br />

Bike shop, with retail, workshop<br />

and hire.<br />

July 2022: opened in Wanaka,<br />

with retail, workshop and hire.<br />

ADVENTUREMAGAZINE.CO.NZ//49


CAMPING<br />

&<br />

TRAMPING<br />

50//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


hydro flask 621ml, 710mL & 946mL Trail Series $69.99-$89.99<br />

WWW.HYDROFLASK.CO.NZ<br />

Klymit Insulated Static V $229.95<br />

WWW.OUTFITTERS.NET.NZ<br />

kiwi camping ruru 4 hiker tent $439.00<br />

WWW.KIWICAMPING.CO.NZ<br />

tasty chicken mash $9.99 - $14.99<br />

WWW.BACKCOUNTRYCUISINE.CO.NZ<br />

black diamond Trail Pro Trek Pole $239.99<br />

WWW.SOUTHERNAPPROACH.CO.NZ<br />

RAB Alpine 600 Sleeping Bag $$699.95 - $759.95<br />

WWW.OUTFITTERS.NET.NZ<br />

Lowe alpine Sirac 65L/ND65 $349.95<br />

WWW.OUTFITTERS.NET.NZ<br />

SALEWA ALP TRAINER 2 MID GTX $429.90<br />

WWW.BOBO.CO.NZ/SALEWA<br />

ADVENTUREMAGAZINE.CO.NZ//51


cotopaxi 16L & 24L Batac Backpack - Del Día $159.99-169.99<br />

A stowable daypack that deploys for fast-and-light daytrips,<br />

hikes, and other micro adventures. Made with 100%<br />

repurposed fabric, making each bag is one-of-a-kind.<br />

WWW.COTOPAXI.CO.NZ/COLLECTIONS/DEL-DIA<br />

Lowe alpine Sirac 50L/ND50 $299.95<br />

Great for weekend or shorter trips<br />

and featuring the adjustable Air<br />

Contour X carry system, hip belt/<br />

front/side pockets, sleeping bag<br />

compartment, rain cover, pole<br />

attachments and lash points.<br />

WWW.OUTFITTERS.NET.NZ<br />

osprey Sportlite 25 $199.99<br />

Confidently step out on the trail with the Sportlite<br />

25, one of our most minimalist technical day packs.<br />

Carry all of your essentials with the convenience<br />

of panel-loading design and simple, clean internal<br />

organization. An AirScape® backpanel and<br />

suspension system moves with you dynamically<br />

and keeps your carry stable and ventilated. Made<br />

with 100% recycled materials. Two size unisex fit.<br />

• Trekking pole loops w/ upper compression strap<br />

capture<br />

• Stretch side water bottle pockets<br />

• Padded hipbelt with one zippered pocket and one<br />

open stretch mesh pocket<br />

Find a Stockist: WWW.SOUTHERNAPPROACH.CO.NZ<br />

Lowe alpine Sirac 65L/ND65 $349.95<br />

The Sirac 65 is a reliable, lightweight,<br />

loaded with features pack with a<br />

strong and stable carry making it<br />

ideal for long backpacking and selfsufficient<br />

treks.<br />

WWW.OUTFITTERS.NET.NZ<br />

Lowe alpine AirZone Trail 35 $299.95<br />

The AirZone Trail 35 features an AirZone carry system,<br />

single buckle entry, compression straps, rain cover, pole<br />

attachments, ice axe loop, front/side pockets and is<br />

hydration compatible.<br />

WWW.OUTFITTERS.NET.NZ<br />

52//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


FEATURED PRODUCT...<br />

equip<br />

yourself!<br />

Rab Aeon LT 25 Pack $199.95<br />

The Aeon LT 25 is the largest Aeon LT pack, offering generous volume to carry all your<br />

gear in wild, mountain terrain. Featuring a responsive and flexible Air Contour back<br />

system keeping the air flowing, double strap harness and moulded back panel provide<br />

a comfortable, secure, bounce-free carry, on-harness walking pole attachments, stretch<br />

bottle pocket, large side stash pocket, front stash pockets, side compression straps,<br />

hydration compatible with space for a 3L bladder, zipped harness pockets and robust<br />

70D construction made with 50% recycled nylon making it ideal for fast-paced, committed<br />

ascents, ultralight bivi’s and hut nights.<br />

WWW.OUTFITTERS.NET.NZ<br />

Low Prices Everyday<br />

Black diamond Trail Pro Trek Pole $239.99<br />

With a huge range of adjustment and a wellbalanced,<br />

durable design, the Trail Pro is a<br />

reliable, high-performance pole for day hikes or<br />

in the mountains.<br />

• SmashLock quick Release technology for<br />

quick deployment and collapsibility<br />

• New FlickLock Pro adjustability—now<br />

featuring aluminum construction that’s lighter<br />

and easier to use<br />

• Updated soft-foam grip with solution strap for<br />

added security and better handling<br />

• Interchangeable carbide Tech Tips, 38mm<br />

Trekking Basket<br />

• Ski compatible ferrule will accept 100mm<br />

powder baskets for deep snow<br />

• Available in Men’s and Women’s design<br />

Find a Stockist:<br />

WWW.SOUTHERNAPPROACH.CO.NZ<br />

Free NZ Shipping on<br />

orders over $150 for<br />

members<br />

Members Earn Equip+<br />

Loyalty Points<br />

shop online or instore<br />

equipoutdoors.co.nz<br />

62 Killarney Road,<br />

Frankton, Hamilton,<br />

New Zealand<br />

P: 0800 22 67 68<br />

E: sales@equipoutdoors.co.nz


GLERUPS HONEY RUBBER AND BLACK RUBBER SHOE $189.00<br />

When you are camping, you need a shoe that is good on<br />

all surfaces including inside the tent or the hut.<br />

Made from 100% natural wool, glerups provides an<br />

instant comfy at home feeling. They are light, versatile,<br />

and well worth the space in your backpack.<br />

Get natural, get cosy and get yourself some glerups.<br />

WWW.GLERUPS.CO.NZ<br />

SALEWA ORTLES ASCENT MID GORE-TEX® $749.90<br />

The Ortles Ascent Mid Gore-Tex® is a solid solution for alpine<br />

mountaineers. Its thick suede leather upper, SALEWA® 3F System with<br />

steel cables and reinforced TPU rand make it exceptionally robust and<br />

durable, while the stiff carbon-loaded nylon fibreglass insole increases<br />

stability during activity. It has been engineered with a dual density<br />

expanded polyurethane midsole with dedicated stiff and cushioned zones,<br />

to ensure both comfort and precision, while the interchangeable layers of<br />

the Multi Fit Footbed Plus (MFF+) allow a customizable fit.<br />

Fit: WIDE Weight: (M) 850 g<br />

WWW.BOBO.CO.NZ/SALEWA<br />

SALEWA WILDFIRE 2 $329.90<br />

Engineered for technical terrain, the Wildfire 2 is a lightweight, agile and<br />

precise tech approach shoe with a breathable recycled synthetic mesh<br />

upper, and a 360° protective rand. It’s equipped with climbing lacing for<br />

fine adjustment in the toe-area and a lateral net system with Kevlar®<br />

cables for better overall performance and sensitivity. The POMOCA®<br />

outsole with Butylic compound rubber is designed for precision and<br />

sensitivity in mixed mountain terrain and ensures good grip on rock in both<br />

dry and wet conditions.<br />

Fit: STANDARD / Weight: (M) 355 g (W) 305 g (pictured)<br />

WWW.BOBO.CO.NZ/SALEWA<br />

SALEWA ALP TRAINER 2 MID GTX $429.90<br />

The Alp Trainer 2 Mid GTX has a suede leather and stretch fabric upper<br />

with a protective rubber rand. Featuring a GORE-TEX® Extended Comfort<br />

lining for optimal waterproofing and breathability, and customizable Multi<br />

Fit Footbed (MFF) with interchangeable layers allows you to adapt it to<br />

the unique shape of your foot; Climbing Lacing right to the toe allows for a<br />

more precise fit, while the Vibram® Hike Approach outsole covers a wide<br />

spectrum of mountain terrain.<br />

Fit: STANDARD / Weight (M) 552 g (W) 482 g (pictured)<br />

WWW.BOBO.CO.NZ/SALEWA<br />

SALEWA WILDFIRE CANVAS $279.90<br />

The breathable recycled cotton and hemp canvas upper is protected<br />

by a full 360° TPU rand. Our 3F system with nylon-coated Kevlar®<br />

cables provides additional support and greater stability at the heel, while<br />

ensuring a precise fit. The dual density eco Ortholite® footbed promotes<br />

superior cushioning, and the Pomoca outsole offers secure grip during<br />

light hiking approach activities.<br />

Fit: STANDARD / Weight: (M) 305 g (W) 256 g (pictured)<br />

WWW.BOBO.CO.NZ/SALEWA<br />

54//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


exped Mira II HL Tent $749.99<br />

2-person, lightweight, 2-door, 3-season tent with a<br />

free-standing canopy design. A ridge pole increases<br />

the space inside for comfortable sitting, large finemesh<br />

panels. Poles, sleeves and fasteners are<br />

colour coded for fast pitching and it comes with a<br />

2-section stuff sack. Packaged weight 1.5kg<br />

WWW.BIVOUAC.CO.NZ<br />

exped Outer Space II Tent $899.99<br />

3-season tent which can be set up in multiple modes.<br />

Features a giant, pole-supported front vestibule that<br />

easily shelters 3 people in camp chairs, a lightweight<br />

table and backpacks. The poles are on the outside of<br />

the fly and allow you to pitch the inner and outer tent<br />

in one go or pitch the fly only without the inner tent.<br />

Packaged weight 2.9kg<br />

WWW.BIVOUAC.CO.NZ<br />

kiwi camping weka 2 hiker tent $339.00<br />

Spacious two-person tent with<br />

vestibule and double entrances. Fits<br />

in a backpack, ideal for all year-round<br />

hiking. 4000mm aqua rated fly with<br />

SPF50 UV coating. 3-year warranty.<br />

WWW.KIWICAMPING.CO.NZ<br />

Kiwi Camping Weka 3 Hiker Tent $379.00<br />

Spacious three-person tent with<br />

vestibule and double entrances. Fits<br />

in a backpack, ideal for all year-round<br />

hiking. 4000mm aqua rated fly with<br />

SPF50 UV coating. 3-year warranty.<br />

WWW.KIWICAMPING.CO.NZ<br />

kiwi camping ruru 4 hiker tent $439.00<br />

The Ruru is a lightweight and easy-pitching hiking tent<br />

with a semi-geodesic alloy frame. Breaks down into<br />

three separate bags for lightweight hiking.<br />

WWW.KIWICAMPING.CO.NZ<br />

56//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


Jetboil mini mo $329.95<br />

It's about cooking. MiniMo delivers<br />

UNMATCHED simmer control, metal<br />

handles, and a low spoon angle for easy<br />

eating! Starting with the innovative new<br />

valve design, MiniMo delivers the finest<br />

simmer control of any upright canister system<br />

on the market. Thanks to our proprietary<br />

regulator technology and enhanced<br />

regulator diaphragm, MiniMo ensures this<br />

consistent performance down to 20ºF (-6ºC).<br />

Its redesigned cooking cup, the perfect<br />

combination of size, sturdy metal handles,<br />

and optimized height, provides users with an<br />

easy-to-eat experience.<br />

WWW.JETBOILNZ.CO.NZ<br />

Klymit Ridgeline Camp Chair High Back<br />

$229.95<br />

The lightweight Ridgeline High<br />

Back Chair features a padded<br />

headrest, an engineered 16’ 5”<br />

high seat and vented mesh panels,<br />

it is perfect for relaxing in.<br />

WWW.OUTFITTERS.NET.NZ<br />

kiwi camping boost lED light $89.99<br />

Bright LED light with power bank to<br />

illuminate your tent and charge devices<br />

on the go. Features 11 light modes<br />

including SOS signal, built-in magnets<br />

and hanging hook.<br />

WWW.KIWICAMPING.CO.NZ<br />

sea to summit Camp Kitchen Tool Kit 10 Piece $69.99<br />

Hang this compact kit in your camp kitchen and you'll<br />

have most things you need on hand to create - and<br />

clean up after - gourmet outdoor meals. The kit<br />

contains everything from empty leakproof bottles for<br />

oils and condiments, to a folding spatula and serving<br />

spoon, to a pot scrubber, washcloth and dishcloth.<br />

Find a Stockist: WWW.SOUTHERNAPPROACH.CO.NZ<br />

Jetboil Flash 2.0 $249.95<br />

BOIL IN SECONDS, NOT<br />

MINUTES Blistering boil times<br />

come standard on our industryleading<br />

Flash. By modelling<br />

the combustion and selecting<br />

materials to optimize efficiency,<br />

we were able to create the<br />

fastest Jetboil ever — cutting a<br />

full minute off our best boil time.<br />

WWW.JETBOILNZ.CO.NZ<br />

Chair Zero High-back $299.99<br />

With a taller back for added support and<br />

comfort, the Chair Zero High-back has the<br />

same DNA as Chair Zero, an ultralight,<br />

compact, go-anywhere chair. The Chair Zero<br />

High-Back is a good choice for activities<br />

where weight saving is top of mind, such as<br />

backpacking, kayak tours, moto-touring or<br />

bikepacking.<br />

WWW.SOUTHERNAPPROACH.CO.NZ<br />

58//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#233<br />

Jetboil stash $299.95<br />

The Lightest and Most Compact<br />

Jetboil Ever. We know your<br />

dreams are big and ambitious.<br />

Which is why we designed the<br />

all-new Stash to be lightweight<br />

and compact, maximizing your<br />

pack space without sacrificing<br />

that iconic Jetboil performance.<br />

At 7.1 oz or 200 g, the .8L Stash<br />

is 40% lighter than the .8L Zip.<br />

WWW.JETBOILNZ.CO.NZ<br />

hydro flask 621ml, 710mL & 946mL Trail Series $69.99-$89.99<br />

Ridiculously light, and durable enough for any trail, our Trail<br />

Series collection is 25% lighter than our other flasks thanks<br />

to an innovative stainless-steel design.<br />

WWW.HYDROFLASK.CO.NZ


The highest level of<br />

performance and<br />

protection meets<br />

sustainability.<br />

The<br />

lightest<br />

system<br />

in its<br />

category<br />

STASH<br />

FEATURE HEAVY<br />

PACKS LIGHT<br />

SO LIGHT YOU MAY<br />

FORGET YOU’RE EVEN<br />

CARRYING IT<br />

WEIGHT<br />

200g<br />

VOLUME<br />

0.8 Liter<br />

POWER<br />

4,500 BTU/h<br />

(1.52 kW)<br />

BOIL TIME<br />

2 minutes<br />

30 sec. per 500ml<br />

www.jetboilnz.co.nz<br />

PreCip® Eco Jacket<br />

marmotnz.co.nz<br />

Learn more about our<br />

sustainability efforts


exped DURA 6R Sleeping Mat (medium) $359.99<br />

Durable, supportive mat insulated with<br />

responsibly-sourced down insulation<br />

for comfort on demanding adventures<br />

in cold conditions, including extended<br />

alpine outings. Recycled 75D/170D<br />

brushed polyester fabric and 7cmthick<br />

chambers with fatter chambers<br />

at the sides to reduce the chance of<br />

rolling off. Certified carbon neutral by<br />

myclimate.<br />

183cm x 52cm. 5.8 R-value. 885g<br />

WWW.BIVOUAC.CO.NZ<br />

exped ULTRA 3R Sleeping Mat (medium) $279.99<br />

Lightweight, packable mat with light insulation<br />

featuring recycled 20D ripstop face fabric, 60gm/2<br />

Texpedloft microfibre insulation and 7cm-thick<br />

chambers with fatter chambers at the sides to<br />

reduce the chance of rolling off. Certified<br />

carbon neutral by myclimate.<br />

183cm x 52cm. 2.9 R-value. 465g<br />

WWW.BIVOUAC.CO.NZ<br />

Rab Alpine 600 Sleeping Bag $699.95 - $759.95<br />

A mid-weight, 650FP three season,<br />

duck down bag with a tough and wind<br />

resistant Pertex® Quantam outer<br />

with recycled nylon lining designed to<br />

maximise warmth.<br />

WWW.OUTFITTERS.NET.NZ<br />

Rumpl NANOLOFT® TRAVEL BLANKET $179.99<br />

This travel sized blanket is perfect for<br />

every adventure - take one with you<br />

wherever you go, from the alpine hut to the<br />

airport.<br />

WWW.RUMPL.CO.NZ<br />

Kiwi Camping Mamaku camper Sleeping Bag<br />

$94.99<br />

The Mamaku Camper is great for hiking<br />

and camping, weighing 1.1kg. The<br />

compression bag allows for easy pack<br />

down while the silver thermal lining<br />

keeps you toasty warm on adventures.<br />

WWW.KIWICAMPING.CO.NZ<br />

Klymit Insulated Static V $229.95<br />

The Insulated Static V packs light and small, has a<br />

4.4 R-value, body-mapped shape and V chamber<br />

design for comfort, lofty Klymalite insulation, and<br />

side rails.<br />

WWW.OUTFITTERS.NET.NZ<br />

kiwi camping Rover Lite 3cm Self-Inflating Mat<br />

$109.00<br />

Compact to pack and carry, the Rover<br />

Lite self-inflates in minutes. The tapered<br />

design can fit in a sleeping bag, 1830mm<br />

long and 550mm wide.<br />

WWW.KIWICAMPING.CO.NZ<br />

60//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


New Zealand’s best<br />

and biggest online store<br />

solely dedicated to Non<br />

Alcoholic adult drinks.<br />

Perfect after a days adventuring - satisfy the taste without<br />

the after effects. Adult drinks that make you feel part of the<br />

socialising yet let you wake up the next day with a clear<br />

head ready for your next adventure.<br />

.<br />

No matter your reason.......we’ve got you covered<br />

Beers - Wines - Spirits - RTD’s - Ciders - All delivered to your door.<br />

www.clearheaddrinks.co.nz


SOBER OCTOBER<br />

Visit the team at Clear Head Drinks for 20% storewide<br />

discount to celebrate Sober October.<br />

WWW.CLEARHEADDRINKS.CO.NZ<br />

ONE FOR THE ROAD - proceed with caution<br />

amber ale $7.95<br />

This all season medium-bodied<br />

lager showcases both malt and<br />

hops. It follows with a toasty malt<br />

character with only a subtle hop<br />

bitterness.


Warthog Classic II Elite Sharpener $199.00<br />

3 Adjustable Angles(20,25 & 30), 325<br />

Grit Natural Diamond Rods, Metal Frame<br />

Construction, Durable Powdercoat Finish,<br />

Finishing Steels.<br />

WWW.KNIFESHARPNERS.NZ<br />

KEA STASH $59.99 - $89.99<br />

The Trash Compacting Bag<br />

for Mess Free <strong>Adventure</strong>s.<br />

100% leak-free, smell-free<br />

and reusable. Fill It - Crush<br />

It - Stash It<br />

WWW.KEAOUTDOORS.COM<br />

BACK COUNTRY CUISINE:<br />

The first thing you’ll notice is that the front label on their pouches<br />

have changed for the better by adding Health Star Ratings and<br />

energy, protein, fat and carbs per pouch. They have also improved<br />

the readability of our back labels.Back Country Cuisine is available at<br />

leading retailers. For more information or to find your nearest stockist<br />

visit: www.backcountrycuisine.co.nz<br />

local dehy hummus $8.00<br />

Roasted Red Pepper &<br />

Sundried Tomato, also<br />

available in Beetroot and<br />

Zesty Lemon. Perfect<br />

for lunches on the trail.<br />

Dehydrated. Vegan. Home<br />

compostable packaging.<br />

WWW.LOCALDEHY.CO.NZ<br />

tasty chicken mash $9.99 - $14.99<br />

With smoky flavoured freeze dried<br />

chicken, cheese and vegetables.<br />

3.5 Health Stars - Gluten Free<br />

Available small serve (90g) or<br />

regular (175g)<br />

WWW.BACKCOUNTRYCUISINE.CO.NZ<br />

Apple & Berry Crumble $13.99<br />

A sweet mix of freeze dried apples<br />

and berries topped with a delicious<br />

gluten free cookie crumb.<br />

3 Health Stars - Gluten Free<br />

WWW.BACKCOUNTRYCUISINE.CO.NZ<br />

INSTANT PASTA $4.99<br />

Just add boiling water for perfectly<br />

cooked pasta.<br />

3.5 Health Stars<br />

Sizes – Family 120g<br />

WWW.BACKCOUNTRYCUISINE.CO.NZ<br />

local dehy kumAra chickpea curry<br />

$17.50<br />

Mildly spiced Indian curry<br />

with spinach & brown rice.<br />

Refuel after a day's adventure!<br />

Dehydrated. Vegan. Home<br />

compostable packaging.<br />

WWW.LOCALDEHY.CO.NZ<br />

rescueme PLB1 $589.98<br />

Wherever you are, at sea, on land,<br />

the rescueME PLB1 provides the<br />

reassurance that global emergency<br />

services can be alerted by the press of<br />

a button.<br />

The rescueMe PLB1 can be operated<br />

with a single hand in even the most<br />

challenging situations. A simple springloaded<br />

flap covers the activation button<br />

preventing inadvertent use. rescueME<br />

PLB1 works with the only officially<br />

recognised worldwide dedicated search<br />

and rescue satellite network (operated<br />

by Cospas Sarsat). As this is funded by<br />

governments there are NO CHARGES<br />

to use this service.<br />

Available through all leading sports and<br />

recreation retailers and online.<br />

WWW.RESCUEME.CO.NZ<br />

sunsaver classic 16,000 mah<br />

solar power bank $119.00<br />

Built tough for the outdoors<br />

and with a massive battery<br />

capacity you can keep all<br />

your devices charged no<br />

matter where your adventure<br />

takes you.<br />

WWW.SUNSAVER.CO.NZ<br />

ADVENTUREMAGAZINE.CO.NZ//63


PROVEN<br />

TO SAVE LIVES<br />

30% (typ) smaller 7 year battery life<br />

66 channel GPS<br />

– Fast accurate positioning<br />

EPIRB1<br />

Essential<br />

for safe<br />

boating<br />

The World’s Most<br />

Compact Emergency<br />

Position Indicating<br />

Radio Beacon<br />

PLB1<br />

Personal<br />

Locator<br />

Beacon<br />

The World’s<br />

smallest PLB<br />

Patagonia Tee-Cycle T-shirt $89.99<br />

All Shirt, no dirt! Patagonia's new Tee-Cycle T-shirts<br />

are part of a circular system, so there's no need<br />

to grow anything new. Made from discarded tees<br />

destined for landfill, they help solve the textile waste<br />

problem and are part of Patagonia's goal to create a<br />

closed-loop process for clothing. Soft and comfortable,<br />

they feature screen-print inks that are PVC – and<br />

phthalate – free, plus are Fair Trade Certified sewn.<br />

WWW.PATAGONIA.CO.NZ<br />

Chickfly Bamboo Leggings High Rise<br />

or Low Rise (USD $119.00)<br />

Chickfly leggings are made<br />

with soft, strong, stretchy<br />

and sustainable bamboo<br />

fabric, coloured with organic<br />

dyes. Our patented fly is held<br />

together by tension, creating<br />

a seamless, flattering, soft,<br />

and easy-to-use feature in the<br />

most comfortable and stylish<br />

black legging that every<br />

woman needs not only for<br />

style but for convenience and<br />

functionality.<br />

WWW.CHICKFLY.COM<br />

rab Filament Pull-on $169.95<br />

Embrace extreme sport with<br />

comfort and confidence. At<br />

213g, the Filament Pull-on is<br />

a lightweight stretch fleece<br />

mid-layer that fully warrants its<br />

place on any high-energy trip.<br />

WWW.OUTFITTERS.NET.NZ<br />

30% (typ) smaller 10 year battery life<br />

LAB0684<br />

5 year warranty 406-link via<br />

satellite to<br />

Emergency Services<br />

www.rescueme.co.nz<br />

Macpac 220 Merino Long Sleeve Top $119.99<br />

A staple for any adventurer, made from<br />

midweight merino wool for natural warmth,<br />

temperature regulation, and odour<br />

resistance.<br />

WWW.MACPAC.CO.NZ<br />

Zerofit Heatrub Ultimate Baselayer (A$129.95)<br />

Independently tested at the Boken Institute in<br />

Osaka, the Ultimate has proven to be five times<br />

warmer than leading competitors, using ‘Heat<br />

Threads’ inside the garment to generate warmth<br />

instantly.<br />

WWW.ZEROFIT.COM.AU


cotopaxi Abrazo Hooded Fleece Jacket $229.99<br />

A cosy jacket that embodies our commitments to<br />

sustainability, the Abrazo is made with recycled fabric<br />

which puts a thoughtful spin on the classic fleece.<br />

WWW.COTOPAXI.CO.NZ<br />

marmot PreCip® Eco Pro Jacket $299.95<br />

Meet the newest addition to our high-performing PreCip<br />

line: the PreCip® Eco Pro Jacket. Waterproof Marmot<br />

MemBrain® and 100% seam taping for zero leaks blocks<br />

the rain as you hike, paddle, or play. The PFC-free coating<br />

keeps you dry while the hood and drawcord hem provide<br />

for extra comfort and coverage. Open up the heat releasing<br />

PitZips when the pace picks up and stash extra gear in the<br />

large pack pockets.<br />

• 20k/20k Marmot MemBrain® lamination with 2-layer<br />

waterproof/breathable fabric repels water and reduces<br />

internal condensation<br />

• PFC-free water-repellent coating keeps you dry and<br />

minimizes environmental pollution; 100% seam taped to<br />

keep water out<br />

• Attached hood with peripheral cord adjustment for extra<br />

coverage<br />

• PitZips provide ventilation to regulate body temperature<br />

• Large pack pockets under a welt for protection<br />

• Zipper with storm flap and adjustable drawcord hem to<br />

block drafts<br />

WWW.MARMOTNZ.CO.NZ<br />

Patagonia Microdini 1/2-Zip Pullover $209.99<br />

Combining two of our favourite materials, Micro D and Houdini,<br />

Patagonia created a lightweight fleece that provides everyday<br />

warmth and comfort. This 1/2-zip fleece pullover with warm standup<br />

collar, features an exterior trimmed in recycled nylon for added<br />

wind protection. Available in cuts for adults and kids, it's Fair Trade<br />

Certified sewn, which means the people who made it earned a<br />

premium for their labour.<br />

WWW.PATAGONIA.CO.NZ<br />

cotopaxi Fuego Down Vest $299.99<br />

Blending responsibly sourced,<br />

water-resistant down with<br />

a streamlined design - our<br />

Fuego Vest is the perfect<br />

spring layer for all adventures<br />

near and far.<br />

WWW.COTOPAXI.CO.NZ<br />

Outdoor Research Vigor Plus Fleece Hoody $249.99<br />

Low-bulk, lightweight, water and wind resistant,<br />

providing comfort, warmth and versatility on<br />

your cold-weather adventures. It is made with a<br />

93%-recycled polyester engineered for amazing<br />

stretch and mobility that has a highly-breathable<br />

high-loft grid interior for active warmth and moisture<br />

wicking on stop-go activities. Other features include<br />

an overlay on the chest for added wind resistance<br />

and pockets to stow small necessities.<br />

WWW.BIVOUAC.CO.NZ<br />

66//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


Zerofit: A personal preference<br />

When a company makes a claim that<br />

its thermal wear product is five times<br />

warmer than the traditional base layer,<br />

that is a big claim.<br />

When Zerofit arrived on the courier,<br />

the very first thing that came to mind<br />

was the weight. Thermal wear that<br />

claims to be five times warmer than<br />

anything else you would expect to<br />

be heavy - it wasn’t. I went through<br />

and read in detail how Zerofit was<br />

supposed to work.<br />

How it works: The Heat Rub uses<br />

“double-loop” barrel fabric to provide<br />

both heat insulation and “friction<br />

heating”. The extra-long bristles<br />

ensure a layer of warm air, and even<br />

a little movement of these bristles<br />

causes friction, which creates heat<br />

which in turn warms you up.<br />

It is stated, “The Heat Rub is twice as<br />

warm as a jumper and is comparable<br />

to a coat but with the ability of ease<br />

of movement for active sports and<br />

working”.<br />

The concept sounds like it would work, but it didn’t<br />

sound very comfortable. Personally, I struggle<br />

with any sort of base layer that has even a merino<br />

component. My partner refers to it as ‘girly skin’,<br />

not very PC. I like to feel it's simply sensitive. So,<br />

the concept of ‘heat rub’ sounded like it was not<br />

going to be for me, but I was wrong.<br />

During the winter months, we move to the Central<br />

Plateau to ski, trout fish, and tramp. I started<br />

using the Zerofit when fishing, it’s light and very<br />

maneuverable. From the moment you put it on, it<br />

is comfortable, which for me personally is a game<br />

changer. I found it super warm and didn’t need<br />

any additional layers; plus it was not bulky at all.<br />

This year the skiing has been limited but those<br />

days we have had on the mountain have been<br />

chilly 2 and 3 degrees, plus often with a severe<br />

wind chill. Once again, the Zerofit kept me warm<br />

and comfortable without the additional weight, I<br />

wore just my Zerofit and a ski shell jacket.<br />

Lastly, we have done several tramps around the<br />

Ruapehu region which are as you would expect in<br />

winter is cold. 50% of the time I needed to remove<br />

my Zerofit because I was simply getting too warm<br />

(better to be too warm than too cold) pulling off the<br />

Zerofit and stashing it in a backpack was easy, it<br />

crushes up small and is super lightweight. If I had<br />

one suggestion for Zerofit it would be to add in<br />

thumb loops.<br />

It’s not often a new product comes on the market<br />

and lives up to the hype Zerofit has delivered all is<br />

promised and more.<br />

For more info visit: www.zerofit.com.au<br />

68//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


You don’t need it, but<br />

you sure will want it -<br />

high quality gear for serious adventures.<br />

www.lightandfast.co.nz


EXPANDING<br />

HORIZONS<br />

EXPLORING WITH<br />

A ROD IN HAND<br />

Words and images by Matt Butler<br />

New Zealand is a place of expansive wonder shaped by<br />

weather and water. Huge rugged peaks give way to cascading<br />

cliffs, with sweeping valleys in which rivers are born and then<br />

flow to feed the vast Pacific Ocean. These rivers form not only<br />

our land, but are also the guiding pathways for our roads and<br />

tracks to follow.<br />

Almost every hiking track in NZ follows a river or stream for<br />

at least some, if not all of their journey. They weave up the<br />

valleys, follow the banks and occasionally pass over with the<br />

help of a rickety swing bridge.<br />

The river is often seen as just an accomplice to the hike,<br />

sometimes nice to look at, swim or drink from but little else.<br />

But what would you think if I told you the water could become<br />

your chief inspiration for adventure? Something that can take<br />

you deep into places you never even realized or imagined you<br />

could go. Places where you are unlikely to see another soul<br />

and where you never have to sleep near a stranger. These are<br />

the places we explore with a Fly Fishing rod in hand, forever<br />

pushing forward not to the end, but just to see what is around<br />

the next bend.<br />

How fly fishing opened me up to the world…<br />

I fell in love with the sport of fly fishing at a young age, not<br />

only because I had a burning desire to fish, but also because<br />

it gave me a motive to explore new places, some of which I<br />

never expected to find. The pursuit of trout was all that was<br />

required to get me out there and more often than not it resulted<br />

in nothing more than a walk beside the river. Regardless of the<br />

outcome, every time I learnt something new, stoking the desire<br />

to go further in search of new water, new landscapes and new<br />

experiences.<br />

Fly fishing is all too often thought of as an old guy standing<br />

in the river for hours on end, flicking back and forth his line,<br />

without so much as a few footsteps. This may have been<br />

common in days gone by but the sport is now growing into an<br />

lauded adventure activity. It’s now common to push the limits of<br />

how far you can go into the wilderness and even something in<br />

which you would choose to travel across the world to pursue.<br />

My love for fly fishing quickly developed into an obsession, as<br />

I spent every available moment exploring the valleys of the<br />

Waikato and Bay Of Plenty. From twisting spring creeks of the<br />

South Waikato, through to thunderous gorges of the Central<br />

Plateau and everything in between. Fly Fishing allowed me<br />

to understand the twists and turns of the region like the back<br />

of my hand. It made me eager to start exploring further and<br />

challenge myself against the best, so it wasn't long until I made<br />

my move to chase trout in the South Island and eventually<br />

around the world.<br />

70//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


I fell in love with the sport of fly fishing at a young age, not only because I had a burning desire to fish, but also<br />

because it gave me a motive to explore new places, some of which I never expected to find.<br />

ADVENTUREMAGAZINE.CO.NZ//71


Above L-R: The diversity of NZ’s landscape is clearly seen when your hunting trout / The fish are often as beautiful as the scenery<br />

Fly fishing can take you to the wildest of places like the depths of Fiordland / Right: Netting a solid trout on a thunderous high country river<br />

At 24 years old I moved to Wanaka to indulge in the spectacular<br />

waters of the Southern Alps. This quickly morphed into wanting<br />

to be out there every day, so I took the leap and became a<br />

Fly Fishing guide. Not only did this allow me to explore further<br />

and deeper into New Zealand than I ever dreamed possible, it<br />

also provided me opportunities to spend my winters fishing in<br />

far flung corners of the world, from Iceland to Japan and many<br />

places in between.<br />

I was never an overly eager tramper, camper or anything of the<br />

sort. Although I loved being out in the wild, I always needed a<br />

reason to be there, rather than just making it to the ‘end’ or to<br />

the ‘top’. It was the river and fly fishing that opened up New<br />

Zealand to me. I now had a reason, a goal for walking three<br />

days into a backcountry valley I had never seen before. Or<br />

even to the otherside of the world into the Alligator infested<br />

everglades to chase Tarpon. It was not the species of fish that<br />

mattered, it was the pursuit of a fish on the fly that gave me<br />

motivation.<br />

---------------<br />

Hiking (or Tramping) in New Zealand is as old as the first<br />

settlers. It was common for local Māori to hike across the<br />

passes from Queenstown to Wanaka for food gathering and for<br />

European explorers to go on a wild goose chase in search of<br />

gold. One thing they all had in common was their single minded<br />

purpose and having a distinct motivation to push further.<br />

These days a hiker's motivation can range from making it to the<br />

next hut, conquering a mountain or completing a great walk and<br />

many other adventures. Although there is nothing wrong with<br />

this, there is still one thing all have in common, they follow a<br />

predetermined path to a set destination. The thing I love most<br />

about fly fishing is a sense of the unknown, the true adventure<br />

of it all. How will you access the water, will you need to cross<br />

the river or climb over a gorge? Can you even get around the<br />

next bend without some goat-like traverses? Is it worth pushing<br />

forward or is it time we should turn back? These questions keep<br />

me exploring.<br />

The variety and abundance of waterways in New Zealand is mindboggling.<br />

From one place to another can often feel like you are<br />

in a different country, as the bush lined green water is replaced<br />

by the crystal blue water in wide open river valleys. Many of<br />

these places have no defined track or trail, requiring instead a<br />

doggedness to venture and figure it out as you go. Just like in my<br />

younger days, these trips often result in nothing more than a nice<br />

walk. But still that feeling of going somewhere you never have<br />

before can fire up more energy than a shot of caffeine.<br />

Fly Fishing in these waters is unlike anywhere else on the<br />

planet, you slowly stalk streamside, eyes fixed on the water in<br />

the hope of seeing a conspicuous shape swaying in the current.<br />

Most of the time you do not see anything, you keep moving,<br />

sometimes covering a serious amount of ground in a day<br />

without even realizing it. Then you find your target, it becomes<br />

a tense battle of cat and mouse as you try to persuade a fish<br />

that your offering is worthy of eating, and if it is then it becomes<br />

full blown hand-to-hand combat. If you're lucky enough to get<br />

a fish successfully in the net, then the best experience of all<br />

is carefully removing the hook and releasing it back into the<br />

water to fight another day. There is little else that can offer such<br />

a fulfilling feeling of accomplishment and appreciation for the<br />

land, animals and water surrounding you.<br />

The sport of Fly Fishing is actually more akin to the feel of<br />

hunting than it’s namesake ‘fishing’. It feels this way as you are<br />

always on the prowl in search for your next target, only stopping<br />

when necessary. You will find yourself scouring over topo maps<br />

in search of that next river to explore. Heading deep into the<br />

backcountry, staying in DOC huts or camping under the stars,<br />

walking for miles into the untouched wilderness. That is what<br />

Fly Fishing in NZ is all about.<br />

---------------<br />

The first step to starting on this new journey is to learn the ins<br />

and outs of the sport. Fly Fishing requires a unique set of skills<br />

that although can take some time to master, they are not hard<br />

to learn. It is not unusual for an angler to spend their whole life<br />

learning the intricacies of a certain species, their behavior and<br />

how best to target them. Luckily in NZ we have an abundance<br />

of both Rainbow & Brown Trout in almost every river and lake.<br />

This means that no matter where you are in the country, it’s<br />

likely you will have a place nearby to start practicing.<br />

Getting started in is not as costly or complicated as you may<br />

have been led to believe, all you need is a few basic things to<br />

get started.With many affordable options on the market these<br />

days, this full setup can be assembled on any budget:<br />

1. Rod, Reel, Line - whatever you can afford is fine;<br />

2. Basic selection of flies - nymphs and dries;<br />

3. Polarized sunglasses; and<br />

4. Fishing Net.<br />

The gear you buy does not define the type of angler you are,<br />

practice is key. So once you are set up, then it’s just about<br />

getting out there, practicing your casting and learning how to<br />

read water. Start in the backyard then head out to explore your<br />

local waterways, access points can easily be found on the Fish<br />

& Game website.<br />

By taking on the pursuit of fly fishing, the country and all its<br />

beauty will open up to you as you explore the far corners in<br />

search of trout. Should you become a lifelong addict like many<br />

anglers are, you will be amazed at just how fulfilling both the<br />

sport and the experience can be, allowing you to explore,<br />

connect and grow.<br />

So as a keen angler says - Enjoy it out there and ‘tight lines!’<br />

If you’re interested in learning more about Fly Fishing and gain<br />

some tips, tricks and advice about how to start and progress<br />

through the angling journey. This is all available on my ‘Live<br />

Wild Journal’ at: www.keaoutdoors.com<br />

72//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


ADVENTUREMAGAZINE.CO.NZ//73


FEED YOUR ADDICTION<br />

Like a ‘perfect storm’, we have seen a dramatic growth and<br />

development in online stores over the past 5 years.<br />

We are dedicating these pages to our client’s online stores; some<br />

you will be able to buy from, some you will be able drool over. Buy,<br />

compare, research and prepare, these online stores are a great way to<br />

feed your adventure addiction.<br />

Never have a dead phone<br />

again! Because now you can<br />

charge straight from the Sun<br />

with SunSaver. Perfect for<br />

that week-long hike, day at<br />

the beach, or back-up for any<br />

emergency. Check us out at:<br />

www.sunsaver.co.nz<br />

Building versatile and reliable gear so you<br />

can adventure with purpose.<br />

www.keaoutdoors.com<br />

Temerature. Taste. Transport.<br />

Hydroflask, more than just a water bottle.<br />

www.hydroflask.co.nz<br />

Our mission is to produce<br />

the best quality beers<br />

possible across a range of<br />

flavours and styles and to<br />

have fun doing it!<br />

www.dcbrewing.co.nz<br />

Gear up in a wide selection of durable, multifunctional<br />

outdoor clothing & gear. Free Returns. Free Shipping.<br />

www.patagonia.co.nz<br />

Stocking an extensive range<br />

of global outdoor adventure<br />

brands for your next big<br />

adventure. See them for travel,<br />

tramping, trekking, alpine and<br />

lifestyle clothing and gear.<br />

www.outfittersstore.nz<br />

Specialists in the sale of Outdoor Camping Equipment, RV,<br />

Tramping & Travel Gear. Camping Tents, <strong>Adventure</strong> Tents,<br />

Packs, Sleeping Bags and more.<br />

www.equipoutdoors.co.nz<br />

Our very own online store where<br />

you will find hard goods to keep you<br />

equipped for any adventure.<br />

www.pacificmedia-shop.co.nz<br />

www.lightandfast.co.nz


Zerofit is a range of base layers<br />

and lifestyle clothing straight<br />

out of science fiction.<br />

Using your body movement, it<br />

keeps you warm and improves<br />

your performance.<br />

www.zerofit.com.au<br />

Meals bursting with flavour, combined with home compostable<br />

packaging, means you really can have it all in the mountains.<br />

Designed by ‘foodies’ for maximum plant-based deliciousness<br />

and wrapped in earth positive, lightweight, packable pouches.<br />

www.localdehy.co.nz<br />

Bivouac Outdoor stock the latest in quality outdoor<br />

clothing, footwear and equipment from the best<br />

brands across New Zealand & the globe.<br />

www.bivouac.co.nz<br />

Shop for the widest range of Merrell footwear, apparel<br />

& accessories across hiking, trail running, sandals &<br />

casual styles. Free shipping for a limited time.<br />

www.merrell.co.nz<br />

Norsk designs and builds ice coolers that without fail,<br />

will not fail. Perfect for your hard out adventures.<br />

Free shipping within New Zealand.<br />

www.norsk.co.nz<br />

Living Simply is an outdoor clothing and equipment<br />

specialty store in Newmarket, Auckland. Your go-to place<br />

for quality footwear, packs, sleeping bags, tents,<br />

outdoor clothing and more.<br />

www.livingsimply.co.nz<br />

www.glerups.co.nz<br />

glerups shoes, slippers<br />

and boots are known for<br />

their exceptional comfort<br />

and unique design.<br />

Over the years we have<br />

perfected the wool mix<br />

by blending Gotland<br />

wool with quality wool<br />

from New Zealand<br />

farmers.<br />

Fast nourishing freeze dried food for adventurers.<br />

www.backcountrycuisine.co.nz<br />

Sustainably designed outdoor gear that fuels both<br />

adventure and global change, by dedicating a<br />

percentage of revenues to nonprofits working to improve<br />

the human condition. www.cotopaxi.com<br />

Supplying tents and<br />

camping gear to Kiwis<br />

for over 30 years, Kiwi<br />

Camping are proud to<br />

be recognised as one of<br />

the most trusted outdoor<br />

brands in New Zealand.<br />

www.kiwicamping.co.nz<br />

With stores in Clyde and<br />

Cromwell, Bike it Now! is<br />

your access point to the<br />

Central Otago Bike trials: T<br />

> Lake Dunstan Trail<br />

> Otago Central Rail Trail<br />

> Roxbourgh Gorge<br />

and more...<br />

New Zealand’s first online<br />

store solely dedicated to<br />

Non Alcoholic adult drinks.<br />

www.clearheaddrinks.co.nz<br />

www.bikeitnow.co.nz


Serving Hot Mexican & Cool Margaritas since 1995<br />

Locations in Alexandra, Cromwell, Dunedin, Invercargill, and Wanaka<br />

See the latest menu and BOOK ONLINE at<br />

www.amigos.co.nz<br />

@amigos_nz


t r a v e l<br />

CLIMBING MT SILISILI<br />

Words and images by Ross Bidmead<br />

The climb began with an ava (kava)<br />

ceremony with the matai (chief). We<br />

were welcomed into his fale (house)and<br />

invited to sit cross-legged on the floor. A<br />

cup made from half a coconut shell was<br />

dipped several times into the ava pot<br />

and poured back to test the colour and<br />

consistency of the ava. Once he was<br />

satisfied with its look, the cup was formally<br />

offered to me, and I raised the cup with<br />

two hands, said "manuia" and drained it.<br />

The bitter liquid numbed my tongue, but<br />

it otherwise had little effect. Margaret and<br />

Tino, in turn, drank a toast from the same<br />

cup before the ceremony continued with<br />

the guide and porters, who drank several<br />

cups as if hydrating for the hot walk<br />

ahead.<br />

Mt Silisili, at the height of 1,858m, is the<br />

highest point in this part of the Pacific;<br />

located on Savai'i, the larger but less<br />

populated of the two main islands<br />

of Samoa, it had always seemed a<br />

fascinating place to explore.<br />

Margaret, who was a friend and client<br />

from a cycle tour, asked if I could organise<br />

a trip; the opportunity was too good to<br />

pass up. Never mind that there was<br />

no route map, and I had heard rumours<br />

of a lack of water, hidden trials and the<br />

need for a guide. Planning and research<br />

are half the fun of any trip; we knew the<br />

starting point and had a phone number for<br />

a local guide.<br />

I called the guide, "Yea, no problem; we<br />

provide sleeping bags, tents, and cooking<br />

equipment. Just bring your own food." It<br />

sounded easy, and we arranged a place<br />

and time to meet. Like with all adventures,<br />

what could go wrong?<br />

Villages own most land in Samoa under<br />

the customary title, and it is usual to<br />

have to pay an access fee. It is, without a<br />

doubt, far better to pay the small access<br />

fee and employ local labour than have<br />

the village need to earn revenue from the<br />

native forest by milling it.<br />

We live in Samoa half the year, running<br />

bike and kayak tours, while Margaret<br />

worked in Apia as an epidemiologist<br />

studying Filariasis (elephantiasis, a<br />

tropical disease carried by mosquitos).<br />

Tino, our leading kayak guide, joined the<br />

group both as an interpreter and to learn<br />

the route.<br />

The recognised route up Mt Silisili starts<br />

at Aopo village. The mountain's highest<br />

settlement, yet it is still only 200m above<br />

sea level. Aopo was on our cycle route<br />

around Savai'i and a regular stopping<br />

point as it was at the top of the steepest<br />

hill of the ride. It was one of the few<br />

villages unable to rely on protein from<br />

fishing and always seemed poorer than<br />

most. The shop seldom stocked soft<br />

drinks but, when asked, would offer beer<br />

instead!<br />

Our instructions were to stop at the church<br />

when we arrived, and the guide would<br />

meet us. There was no one there, so I<br />

phoned the guide. "I live in Apia – I only<br />

organise the trips, but you're expected."<br />

Eventually, the confusion was sorted, and<br />

we were directed to a fale on a dirt road<br />

where we were welcomed by our guide<br />

Talu and porters David and John.<br />

With the ava ceremony complete, Talu<br />

produced tents and sleeping bags for the<br />

trip. Living on the coast in Samoa, I was<br />

used to sleeping under just a sheet, but<br />

we could expect temperatures around<br />

12°C at the campsite. I'd also had to find<br />

a raincoat and jersey, items I didn't usually<br />

need. It can rain in Samoa, but a jacket<br />

with the best Gore-Tex fabrics usually<br />

means getting wet from the inside while<br />

overheating.<br />

I'd expected to leave the car in the village<br />

and start from there, and retrospectively<br />

we should have! But the guide convinced<br />

us that the road was passable and would<br />

save a couple of hours. . With the six of<br />

us and all our gear in our our small AD<br />

Van station wagon, it nearly rested on the<br />

bottom of its suspension and we picked<br />

our way slowly up the steep, overgrown<br />

road. I misjudged and grounded the car<br />

hard on a rock hidden in the grass. With<br />

everyone out and pushing, we cleared it,<br />

but there was a new vibration somewhere.<br />

The van was not an offroad vehicle.<br />

Wishing I had bought the Pajero, we<br />

ground on slowly past taro plantations and<br />

regenerating forest until we reached a<br />

grassy clearing by a stream.<br />

From here, a ground trail led into the<br />

forest. We were soon surrounded by<br />

giant dark trunks up which monsteras<br />

climbed, their vast, holey leaves providing<br />

a green contrast. Everything was wet,<br />

and epiphytes were everywhere. Much of<br />

Samoa must have been covered in this<br />

tropical rainforest, but this was the first<br />

remnant of the original that I had seen.<br />

We climbed on, slowly traversing to the<br />

right as the trees got smaller. There were<br />

almost no track markers, and the route<br />

was not marked on any map.<br />

Without a local guide, it would have been<br />

challenging. At a flat spot on a ridge, there<br />

were obvious signs of a regular camp spot<br />

and a kettle hanging in a tree. The guides<br />

grabbed it as their only cooking pot, and I<br />

was glad I had put in a billy.<br />

Later we emerged from the forest onto<br />

lava fields from the 1902 eruption of Mt<br />

Mata o le Afi. Twisting an ankle here<br />

would be easy, and there is no helicopter<br />

or organised mountain rescue service in<br />

Samoa.<br />

From here, the route opened to the crater<br />

of Mata o le Afi; a deep hole surrounded<br />

by acres of coarse dark sand devoid of<br />

vegetation. A local company had wanted<br />

to quarry the sand and had built an access<br />

route to here (via a different path than the<br />

track we used). Fortunately, the nearby<br />

villages vetoed the plan as they did not<br />

wish to awaken the volcano.<br />

Where the first vestiges of vegetation<br />

reappeared, there were the remains of a<br />

campsite. The two small water tanks with<br />

catchments barely more than a length of<br />

guttering were full, and our water worries<br />

were over. We had arrived here much<br />

earlier than expected, and the weather<br />

gods were smiling on us, granting a<br />

sunny, cloud-free day, a rarity up here.<br />

We continued to the top, following a small<br />

trail meandering around a wetland with<br />

several deep ponds. A short climb through<br />

a spindly forest brought us to the top after<br />

little more than an hour. As there was only<br />

a narrow view inland through the spindly<br />

clouded forest, we headed back to the<br />

campsite after a quick round of photos.<br />

We pitched our tents while the guides<br />

prepared a fire and boiled the kettle found<br />

ADVENTUREMAGAZINE.CO.NZ//77


at the lower camp. But to our surprise,<br />

they made a large pot of tea sweetened<br />

with condensed milk and sugar to the<br />

point where we couldn't drink it. They<br />

then kept the remainder in the pot for their<br />

evening use. So much for "the guides<br />

will bring the cooking gear." It wasn't<br />

like the guiding service we were used to<br />

from Nepal. This was just a difference<br />

in expectations. They were friendly<br />

and helpful but expected us to be selfsufficient<br />

in food and cooking.<br />

The weather was turning on a charm<br />

offensive. When we eventually wandered<br />

over to the crater rim, the stunning views<br />

Always handy to find a spare kettle hanging in a tree<br />

of the coast and the Falealupo Peninsula<br />

at sunset were a good reward for our<br />

additional effort.<br />

Tramping meals are usually a trip<br />

highlight, but with our limited access to<br />

supplies in Samoa and even more limited<br />

access to cooking resources at the camp,<br />

the meal became a slow refuelling stop.<br />

Fortunately, Margaret had lived here long<br />

enough to be unfazed, and the challenge<br />

only added to the adventure.<br />

Walking down was uneventful, but as<br />

we started down the road in the car,<br />

the vibrations got steadily worse. After<br />

dropping off and thanking our guides,<br />

we limped on. The car was in danger of<br />

rattling to death above 30kms/hr, forcing<br />

us to stop in a village and borrow a<br />

hammer. Tino and I took turns to crawl<br />

under the car and bash the recalcitrant<br />

bearing nearer the right place. We gained<br />

some speed but couldn't reach the Samoa<br />

open road limit of 56 km/hr!<br />

The day finished at the Beach Fales at<br />

Manase where we swam and then relaxed<br />

on the beach with a glass of wine and the<br />

setting sun. <strong>Adventure</strong>s are always better<br />

with a few challenges.<br />

Contact Ross and Frances at: office@outdoor.co.nz to organise a custom tour or to join a group.www.outdoorsamoa.com<br />

Sunset towards the Falealupo Peninsula<br />

A great way to end the day<br />

The original vegetation of Samoa and a<br />

clear view to the top of Mt Silisili<br />

Ross, Tino and the guide team - Note the<br />

special jandals for rough and muddy terrain<br />

78//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


Beautiful Samoa awaits you, and we are welcoming our international aiga<br />

with open arms! Experience Samoa’s untouched beauty, unique cultural<br />

experiences and rich heritage. Self drive, bike or stroll through the wonders<br />

that make this island life one to cherish just like the locals do.


Cook Islands.<br />

Lonely Planet’s top place to visit in 2022<br />

Float above the world’s bluest blue<br />

OVERWATER HEAVEN


Images by Steve Dickinson<br />

Surround yourself in an<br />

ocean of beauty while diving<br />

in The Islands of Tahiti. Here<br />

you’ll dive in the presence<br />

of deep-sea giants such<br />

as sharks, rays, turtles and<br />

dolphins.<br />

Our waters are teeming with<br />

life where each dive brings a<br />

new treasure to uncover and<br />

a new story for you to share.<br />

DIVING.TAHITITOURISME.COM


t r a v e l<br />

The stunning backdrop that is Teahupo'o<br />

TEAHUPO'O<br />

MAGESTIC, STUNNING AND TERRYFYING<br />

Words by Steve Dickinson | Images compliments of WSL/ Damien Poullenot<br />

Covid is bad enough, but to see the those two ugly<br />

little lines on your RAT test the day before you are<br />

meant to leave for Tahiti is so frustrating. Weeks of<br />

planning had gone into the coordination of getting us<br />

to Tahiti and to the WSL (World Surf League) event<br />

at the legendary location, Teahupo'o. To make it<br />

worse this year was really special because it was the<br />

first time that female competitors have returned to<br />

compete at Teahupo'o after a 16 year hiatus.<br />

Teahupo'o means ‘The pile of heads’ or ‘The heap of<br />

heads’. It supposedly honours the son of a murdered<br />

chief, who revenged his father's demise by killing<br />

and eating the brain of his father's murderers. It is a<br />

dark name for such a magical place. On the island of<br />

Tahiti Iti, which is linked to the main island of Tahiti by<br />

a slim causeway, you’ll find Teahupo'o. Commonly<br />

known as the end of the road, and it is literally the<br />

end of the road, Teahupo'o is a rural jungle-like<br />

setting with a backdrop of lush green-coloured<br />

mountains. A river flows out from the mountains<br />

through the lagoon and has caused a unique coral<br />

formation, which not only gives some of the best<br />

waves in the world it also creates an amphitheater<br />

for spectators in boats to be close to the breaking<br />

waves.<br />

Unlike soccer or rugby, surfing is a sport basically<br />

done in isolation or with just a few others. There<br />

maybe be crowds on the beach, but not just meters<br />

away, right there on the sideline. But at Teahupo'o, it<br />

is different. Waves can be massive, and you can still<br />

be within a relatively short distance and still be safe<br />

(well, fairly safe).<br />

Teahupo'o is all about the barrel, the breaking wave<br />

that tubes. In many parts of the reef, there is only<br />

50cms of water between the reef and the water<br />

surface, which creates amazing waves but falling off<br />

can be unpleasant.<br />

In simple terms, this magical thick heavy wave<br />

is created by a dramatic change in water depth.<br />

Approximately 50 metres out to sea from the shallow<br />

reef, the sea drops to more than (15 metres). This<br />

means swells coming towards the reef transform<br />

from deep water swells to shallow reef waves in a<br />

markedly short distance. This then causes the wave<br />

to rise up suddenly over the reef before pounding<br />

down with extreme force and then dissipating into<br />

the lagoon.<br />

Teahupo'o is renowned as a thick-lipped wave which<br />

can at times be incredibly hollow. Thick heavy waves<br />

breaking over shallow reef, barrelling, makes for<br />

an amazing visual spectacle, but the surfers need<br />

not only to cope with the wave but the fear the<br />

consequence should they fall onto that shallow reef.<br />

ADVENTUREMAGAZINE.CO.NZ//83


So, with Teahupo'o, not only have you a<br />

magical Pacific setting with clear water and<br />

some of the best waves in the world, you can<br />

also be within meters of the activity. Then add<br />

in the best surfers in the world, and it is an<br />

event we have long been waiting for.<br />

Then came covid.<br />

But we did get to watch the event on<br />

television from the comfort of our couch in<br />

front of a roaring fire. Not quite the real deal<br />

but pretty good none the less. We could not<br />

shoot our own images this year, but thanks to<br />

the WSL for providing them, and as you can<br />

see, it was stunning.<br />

The event is run over a two-week period<br />

where WSL choose the best three days to<br />

run the event. There was an infuriating week<br />

of lay days as the swell just failed to turn up,<br />

but on the Thursday of the second week, the<br />

waves turned on at 5-8 ft. The event was so<br />

exciting, and we could go through each heat<br />

blow by blow.<br />

But the highlights were 50-year-old Kelly<br />

Slater’s flawless run to the semifinals. Nathan<br />

Hedge, who was the 40-year-old wildcard<br />

surfing like a 20-year-old and the humble<br />

Matthew McGillivrays perfect 10 (the best<br />

score you can get in surfing). Spectators<br />

sitting at home and in the flotilla of boats<br />

close to the waves were rewarded for their<br />

weeklong patience with everything you could<br />

want from a season-ending event.<br />

But the biggest story of this event was Kauli<br />

Vaast, the local boy who has won his spot<br />

through the trails, who lives at Teahupo'o<br />

and stormed his way to the finals with the<br />

most dominant performances of the event.<br />

At only 20 years old, he showed his class<br />

when he came up against the 50-year-old<br />

GOAT Kelly Slater, 11 times world champion,<br />

in the semifinals and beat Slater 17.33 to<br />

1.17. Kauli’s charge to the winning post was<br />

stopped by an in-form Miguel Pupo, who<br />

found a 9-point ride in the final to narrowly<br />

beat out the local 17.17 to 15.00.<br />

Two of the event highlights:<br />

Above: Kelly Slater<br />

Right: Nathan Hedge<br />

84//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


ADVENTUREMAGAZINE.CO.NZ//85


Top: Courtney Conlogue took out the Outerknown Tahiti Pro at Teahupoo<br />

Inserts: Kauli Vaast's support crew cheered loudly | Miguel Pupo overcome with emotion after taking the win at Teahupo'o<br />

Bottom right: Kauli Vaast showed how important wave knowledge was at his local break, Teahupo'o<br />

16 years ago, we were there to witness the last time the<br />

women competed at Teahupo'o. Not a lot had changed. The<br />

waves were still mean, and if you got it wrong, there are<br />

profound consequences, so naturally, nerves were on edge.<br />

From the first heat, the woman to beat seemed to be Vahine<br />

Fierro, the local girl who understood Teahupo'o well. But<br />

Vahine was eventually stopped in the semifinals by one of the<br />

regular CT competitors Brisa Hennessey.<br />

The other in-form surfer was Courtney Conlogue, who is<br />

renowned for her athleticism, fitness, and grit. Courtney,<br />

out of all the women, seems to be able to tame the wild and<br />

dangerous beast that is Teahupoo. She convincingly won the<br />

women’s event and proved that women could surf Teahupo'o<br />

just as well as men.<br />

As a side note, with the Olympics looming in 2024, Tahiti is<br />

set to host the surfing for the Paris Olympics, and Teahupo'o<br />

will be where that portion of the competition will be held. This<br />

will be a challenging event for everyone involved but, again,<br />

another huge spectacle.<br />

Surfing is part of the lifestyle in Tahiti; waves are on nearly<br />

every island and surf, (unlike Teahupoo), which can suit<br />

everyone. Teahupo'o to surfers is like Everest is to climbers;<br />

it is the pinnacle of the sport, but not many get to climb or<br />

even want to climb Everest, but there are still lots of other<br />

hills and mountains to climb. Same with surfing in Tahiti,<br />

if Teahupo'o is beyond your skill level (as it is with most<br />

people), then there are a lot of other options, reef breaks,<br />

beach breaks, some remote, some close to town, but the<br />

common denominator is the water is warm and clear, the<br />

people friendly and the waves are always great!<br />

86//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


*


t r a v e l<br />

VANUATU<br />

8 LIFE-CHANGING<br />

HIKING EXPERIENCES<br />

As you might expect from a jungle-covered archipelago, Vanuatu<br />

has some of the best tropical trekking in the world. Where else<br />

can you hike to the rim of an active volcano, sleep in kastom<br />

villages or cool off under roaring waterfalls? From half-day hikes<br />

on the main islands to multi-day jungle treks on the outer rim,<br />

there’s some truly epic scenery to explore in Vanuatu.<br />

1. Nguna Extinct Volcano (pictured: Image by Ben Savage)<br />

(3 hours from the bottom of Nguna)<br />

An hour away from Port Vila’s bustling city centre and resorts<br />

lies Nguna and its sister islands, Pele and Emao. Located in the<br />

crystalline water of the Uduna marine channel, the islands are<br />

home to 16 local communities that have created the Nguna-Pele<br />

Marine Protected Area. This pristine environment of lagoons,<br />

reefs, mangrove forests and bush gardens is the perfect<br />

landscape for following your guide to the top of Mt Taputoara, the<br />

highest of the two extinct volcanoes on Nguna Island. The trek<br />

takes you through several welcoming villages and is a steady<br />

uphill climb to the edge of the crater at 593 metres above sea<br />

level. Some parts of the track are steep, but it is well worth the<br />

effort, as you will be rewarded by sweeping views across the<br />

Shepherd Islands to the north and south to Efate.<br />

2.Dog’s Head Trek, Malekula<br />

(2-day trek departing Norsup)<br />

Malekula is shaped like a sitting dog, and the northern part of<br />

the island, the ‘Dog’s Head’ is crisscrossed with some of the best<br />

hiking trails in Vanuatu. A popular route is known as the Dog’s<br />

Head Trek. It’s a two-day hike from Malekula’s east coast, all<br />

the way over the rugged hinterland mountains, to the charming<br />

western village of Tenmaru. Along the way you’ll meet the Small<br />

Nambas and Big Nambas (two of the island’s major tribes), get<br />

a crash course in Malekula’s history of cannibalism and swim in<br />

cascading river pools, hidden deep within the forest.<br />

3. Mount Garet Hike, Gaua<br />

(3-day trek, starting Gaua Airport) Rising from the sea in the<br />

north of Vanuatu’s archipelago, Gaua is the country’s unofficial<br />

adventure capital. Mount Garet is the island’s highest peak, an<br />

active somma volcano (it last erupted in 2011) surrounded by<br />

a horseshoe caldera, the beautiful Lake Letas. Travellers can<br />

embark on a three-day hike to explore Mount Garet. You’ll climb<br />

to 711 metres above sea level, see bubbling lava and volcanic<br />

mud pools and swim beneath the stunning 120-metre high Santa<br />

Maria waterfall. At night, you can sit around the campfire on the<br />

shores of Lake Letas and swap stories with your local guides.<br />

88//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


ADVENTUREMAGAZINE.CO.NZ//89


4. Benbow Crater Hike, Ambrym<br />

(Pictured above: Image by Ben Savage)<br />

(2-4 day hike)<br />

The island of Ambrym has always been<br />

one of the more mysterious in Vanuatu’s<br />

archipelago. It’s known as the Black<br />

Island, due to its volcanic soil and history<br />

of dark magic. But it’s also home to two<br />

of Vanuatu’s most active volcanoes –<br />

Mount Marum and Mount Benbow. There<br />

are dozens of hiking options through the<br />

surrounding jungle. If you’re feeling fit,<br />

you can try the one-day hike to Benbow’s<br />

crater rim (a 10-hour round trip), or you<br />

can sign up for two, three or four-day<br />

treks that allow you to explore the whole<br />

volcano field. If you’re planning a trekking<br />

holiday on Ambrym, travelling between<br />

August and January is generally best.<br />

7.Losinwei Cascades Walk, Malekula<br />

Not all 6 Vanuatu’s treks require a fullystocked<br />

backpack and several days<br />

up your sleeve. Malekula’s Losinwei<br />

Cascades Walk is the perfect example.<br />

It’s a half-day hike into the misty foothills<br />

of central Malekula. Guides will lead<br />

you through the forest, surrounded by<br />

tiny orchids and flowering irises, to the<br />

picturesque Losinwei Waterfall. You can<br />

swim beneath the falls, climb the rock<br />

face to find hidden limestone pools,<br />

and generally laze the day away before<br />

trekking back down to Losinwei Beach.<br />

5. Trek Tanna, Tanna<br />

(4 hours, starts Mount Yasur ash plains)<br />

In 1774, the sparks of Mt Yasur volcano<br />

attracted Captain James Cook during<br />

his journey through the South Pacific. It<br />

has since been called ‘the Lighthouse<br />

of the Pacific’. Take a once-in-a-lifetime<br />

adventure that follows in the footsteps of<br />

the famous world explorer and barefoot<br />

warriors to the top of exhilarating Mt Yasur<br />

volcano. Start your expedition on the ash<br />

plain and enjoy the breathtaking views;<br />

meet the John Frum cult village; and feel<br />

the power of the volcano as you climb its<br />

slope. As the sun sets after an afternoon<br />

of bushwalking, you will stand close to<br />

the edge of the crater, 361 metres above<br />

sea level, and be rewarded by the most<br />

fascinating and thrilling natural fireworks<br />

and panoramic views.<br />

6. Manbush Trail, Malekula<br />

(4-day hike)<br />

The Manbush trail is an unforgettable<br />

four-day hike from east to west across the<br />

wild highland rainforest of Malekula. The<br />

trek takes you to the stunning South West<br />

Bay and its pristine black and white sand<br />

beaches, passing through the summit of<br />

Mt Laimbele, 850m above sea level with<br />

360-degree views of the archipelago.<br />

Along the way, you will encounter dense,<br />

untapped jungle, traverse incredible<br />

rivers, snack on island bush foods and<br />

climb to an incredible 850 metres above<br />

sea level. At the end of the trek, there’s<br />

still time to cool off in the clear waters<br />

of the Matanoi River. Accompanied by<br />

not-so-ancient tales of cannibalism,<br />

you’ll follow your local guide into the dark<br />

bush and make yourself at home in selfsufficient<br />

remote villages – where you will<br />

sleep in local houses and learn all about<br />

traditional kastom living. The Manbush<br />

trail crosses rivers, passes through deep<br />

bush and climbs steep ground. It is a<br />

challenging expedition for experienced<br />

bushwalkers, taking you on a journey to<br />

a part of the world rarely seen by most<br />

people.<br />

8. Millennium Cave, Espiritu Santo<br />

Millennium Cave is one of Santo’s most<br />

famous natural attractions. It’s also the<br />

largest cave in Vanuatu. The trek to reach<br />

the cave isn’t the longest walk in the world<br />

(it takes around 90 minutes from Vunaspef<br />

village) but the route is challenging. You’ll<br />

be scrambling up slopes, fording streams<br />

and climbing giant river boulders. But it’s<br />

well worth the effort as Millennium Cave<br />

is truly stunning. You’ll explore the cave in<br />

the dark, using nothing but a torch, learn<br />

about local food and kastom, and cool off<br />

in the rock pools outside the cave. It’s one<br />

amazing – if exhausting – Santo day tour.<br />

For More Information: www.vanuatu.travel/nz/experiences/hiking-guide<br />

For Specialised Services contact: vanuatuecotours.com and wreckstorainforest.com<br />

90//WHERE ACTIONS SPEAK LOUDER THAN WORDS/#<strong>234</strong>


9.30am Mt Yasur on Tanna Island<br />

Hiking Diving Culture<br />

Volcanos<br />

Go explore at vanuatu.travel


There’s always something happening at Surreal<br />

3 Levels with the best Rooftop Terrace in town.<br />

House Made Mulled Wine, Mulled Cider and $15 Cocktails sets you up for Apres Ski.<br />

Delicious and affordable crowd pleasing food favourites.<br />

Team that up with an exceptional Bar Menu with the happiest team in town and you’re set!<br />

The heated ROOFTOP TERRACE is always the place to be any night of the week.<br />

Fridays, Saturdays and Sundays we step it up a notch with the hottest DJs in town.<br />

Downstairs offers all your sporting action with entertainment every night of the week.<br />

Check out our website for all the latest info on Events, Specials and Gig Guide.<br />

Surreal Bar and Restaurant - Open from 12 until late.<br />

7 Rees Street, Queenstown<br />

Phone: 03 441 8492 www.surrealbar.co.nz


A l p i n e R e s o r t<br />

Terrace Restaurant & Bar Open daily<br />

5 minutes from Whakapapa Ski field<br />

Backpacker to Superior Family Accommodation<br />

On-Site Ski & Snowboard gear hire<br />

Skotel Alpine Resort | SkotelAlpineResort<br />

Ngauruhoe Place | Whakapapa Village, SH 48<br />

www.skotel.co.nz | info@skotel.co.nz<br />

+64 7 892 3719 | 0800 756 835<br />

Dual Heritage<br />

Tongariro National Park<br />

Sky Waka Hot Deal<br />

2 Nights in a King Studio | Breakfast Daily | 2 x Sightseeing Pass Sky Waka<br />

2 x Mini Golf pass | $50 Food & Beverage Voucher<br />

BYO Bikes & explore our 4 biking trails from National Park Village<br />

Free wifi & parking | From NZD $599<br />

17 Carroll Street, National Park 3948<br />

info@plateaulodge.co.nz | +64 7 8922993<br />

www.plateaulodge.co.nz<br />

The Old Nurses hOme<br />

GuesThOuse<br />

Welcome to The Old Nurses Home Guesthouse<br />

This historic renovated building in Reefton allows you to enjoy the stunning<br />

Victoria Conservation Park with access to outstanding bush walks, historic<br />

mining sites, and withing walking distance to the famous Inangahua River and<br />

some of the best fishing for trout in NZ. White water raft or kayak the exciting<br />

rivers in the area. Reefton offers a perfect base for MTB riders to explore The<br />

Old Ghost Road from Lyell through the ranges to Seddonville on the West Coast.<br />

www.reeftonaccommodation.co.nz<br />

+6437328881<br />

info@reeftonaccommodation.co.nz


get the<br />

professional<br />

edge!<br />

The V-SHARP® CLASSIC II Elite uses two high-quality, 325<br />

grit diamond rods that simultaneously sharpen the blade<br />

on both sides using calibrated Spring Tension. Ideal for<br />

Kitchen, Fillet, Hunting and most other flat-blade knives.<br />

w w w . k n i f e s h a r p n e r s . n z<br />

Boots<br />

Packs<br />

Rainwear<br />

Sleeping Bags<br />

All your tramping & trail essentials!<br />

Same shop & family since 1988.<br />

Keep powered on any adventure<br />

www.sunsaver.co.nz


Reeecoveeer<br />

Fasteeer<br />

OOOOOOOOOOOOFFOOOOOOSS<br />

ffffffffoooooooooooooooottttttttwwweeeeeeeeaaaaaaaarrrrrrrr<br />

ccccuuuusssssssshhhhhhhiiiiiiiioooooooonnnnnnnnssssssss && ssssssssuuuuppppppppppppoooooooorrrrrrrrttttttttssssssss<br />

yyyoooooooouuuurrrrrrrr ffffffffeeeeeeeeeeeeeeeetttttttt,,, aaaaaaaannnnnnnnkklleeeeeeeessssssss,,, kknnnnnnnneeeeeeeeeeeeeeeessssssss<br />

&& hhhhhhhiiiiiiiippppppssssssss bbbyyy aaaaaaaabbbssssssssoooooooorrrrrrrrbbbiiiiiiiinnnnnnnng 37%<br />

mmmoooooooorrrrrrrreeeeeeee iiiiiiiimmmppppppaaaaaaaacccctttttttt tttttttthhhhhhhaaaaaaaannnnnnnn ooooooootttttttthhhhhhheeeeeeeerrrrrrrr<br />

ffffffffoooooooooooooooottttttttwwweeeeeeeeaaaaaaaarrrrrrrr ffffffffooooooooaaaaaaaammmssssssss.. Afffffffftttttttteeeeeeeerrrrrrrr<br />

aaaaaaaannnnnnnnyyy aaaaaaaaddveeeeeeeennnnnnnnttttttttuuuurrrrrrrreeeeeeee,,, ffffffffeeeeeeeeeeeeeeeell tttttttthhhhhhheeeeeeee<br />

ddiiiiiiiiffffffffffffffffeeeeeeeerrrrrrrreeeeeeeennnnnnnncccceeeeeeee wwwiiiiiiiitttttttthhhhhhh eeeeeeeeaaaaaaaacccchhhhhhh<br />

sssssssstttttttteeeeeeeepppppp iiiiiiiinnnnnnnn aaaaaaaa ppppppaaaaaaaaiiiiiiiirrrrrrrr ooooooooffffffff OOOOOOOOOOOOFFOOOOOOSS..<br />

Feed your adventure!<br />

Vegan<br />

Sustainable<br />

Made in Wānaka<br />

Order online: www.localdehy.co.nz<br />

LOCAL DEHY<br />

FOOD FOR THE HILLS HILLS<br />

glerups.co.nz<br />

Find us online and at a stockist near you


“Escape ordinary”<br />

Caring luxury | Local flavour | One of a kind<br />

Mountain bike clean up area and a secure mountain bike storage area available<br />

1191 Pukaki Street, Rotorua<br />

p: +64 7 348 4079 | w: regentrotorua.co.nz<br />

S.A Shuttles are a specialists when it comes to Auckland Airport shuttle<br />

services. We pick-up passengers from the Airport and deliver to; hotels,<br />

motels, CBD and the suburbs (door to door). This service is available to<br />

meet every flight arriving into Auckland Airport.<br />

• BOOKED shuttle services to meet flight<br />

• On demand shuttle services for group bookings<br />

• Direct shuttle for individual needs<br />

• Corporate Transfers for Business Client<br />

We also do tours around the North Island | www.southaucklandshuttles.com | bookings@sashuttles.com | 0800 300 033 (Toll free)


A digital currency<br />

designed for everyday<br />

payments<br />

qoin.world<br />

Available to download on


THE ALL-NEW 7-SEAT

Hooray! Your file is uploaded and ready to be published.

Saved successfully!

Ooh no, something went wrong!