Views
5 years ago

Functional characterization of tomato Sl-IAA3 and Sl-hls genes. Role ...

Functional characterization of tomato Sl-IAA3 and Sl-hls genes. Role ...

Chapitre IV:

Chapitre IV: Functional Characterization of Tomato Hookless Genes genes show normal de-etioleted phenotype (Figure 3). Moreover, overexppression of tomato hookless genes promote normal opening of green cotyledons even after prolonged time in the dark, under which conditions the wild type control seedlings failed to green (Figure 7B). These data strongly support the implication of hookless gene in normal greening process. It has been shown previously that At-HLS1 is a positive regulator of the glucose repression of germination, cotyledon greening and expansion and true leaf development. Complemented Sl-HLS1 and Sl-HLS2 plants, like wild type seedlings, undergo growth arrest when cultivated in the presence of 6.5% of glucose. Tomato overexpressed plants show hypersensitivity to glucose. This result further supports the evidence that HLS gene plays an important role in germination and development of cotyledons and true leaves. Although a number of hookless like sequences from Arabidopsis and other plant spicies are available in the gene database, there is no experimental evidence regarding their putative N-acetyl transferase activity. We have identified two cDNA, Sl-HLS1 and Sl-HLS2 that show high similarity to Arabidopsis HLS1. Sl-HLS2 is much more abundant than Sl-HLS1 and display a differential expression pattern in etiolated seedlings upon hormones treatments. Although the protein products of both cDNAs complement the hls1 mutant of Arabidopsis in all phenotype tested, it’s not clear whether Sl-HLS1 and Sl-HLS2 exert the same function in tomato seedlings. In conclusion, the identification of two HLS genes from tomato and the demonstration that their encoded proteins are functional homologs of the Arabidopsis HLS protein confirm the importance of HLS in the regulation in the hook closure, greening, glucose and ABA signalling pathway. Elucidating the mode of action of HLS will, therefore, help to explain the mechanism controlling formation of the apical hook and managing different signalling pathway. 116

METHODS Plant Material Arabidopsis transformation Chapitre IV: Functional Characterization of Tomato Hookless Genes hls1-1 in the Columbia ecotype were obtained from the Nottingham Arabidopsis Stock Center. Wild type (Columbia ecotype) was used as control. Plants were grown under standard green house condition. Agrobacterium tumefaciens- mediated transformation was carried out using the pGreen 2935SOMCaMVT (Dr julie cullimore, INRA toulouse) binary vector according to Bird et al. (1988). The sense construct was generated by cloning the full Sl-HLS1 and Sl-HLS2 open reading frame under the transcriptional control of the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator (Sl-HLS1 F 5’ ATGATGGCGGT TAATGAACAAGTGAG3’; Sl-HLS1 R 5’ TTAAAATTCTCTGGGATCAACAAAGAT AG; Sl-HLS2 F 5’ ATGGTGGAGAATGGTGATTTGGTTGTGTCG 3’; Sl-HLS2 R 5’ T TAGACTTCTCTAG GATCAACAAATATAGAAAG3’). The transformation protocol of hls1 Arabidopsis mutant was as described by Leclerc et al. (2002). The selection of putative transformants was done on a 70 mg L _ 1 kanamycin- containing agar medium. Tomato transformation Tomato (Solanum lycopersicum cv MicroTom) plants were grown under standard greenhouse conditions. For growth in chamber rooms, the conditions are as follow: 14 h day/10 h night cycle, 25/208C day/night temperature, 80% hygrometry, 250 µmolm _ 2 s _ 1 intense luminosity. To generate an antisense Sl-HLS1 (AS-HLS1) and antisense Sl-HLS2 (AS-HLS2) transgenic plants, forward and reverse primers were used to amplify a specific partial clone of each gene (AS-HLS1 F 5’CCGGGTCAAAATCTCAAAATCCG 3’; AS-HLS1 R 5’GCGGATTCGTTAAGAACTCGTTG3’; AS-HLS2 F 5’ TCGGGTCCGGGTATCTA GTCG 3’; AS-HLS2 R CGGATGAACCAAGAAATCTTCTAC. Moreover, a highly conserved sequence between HLS1 and HLS2 was used to downregulate both of these genes. We called this construction AS-HLS1+2. The primers used were AS-HLS1+2 (F 5’ ATGGTGGAGAATGGTGATTTGGTTG and R 5’GCGGCTTAGCTG 117

Characterization of the subtilase gene family in tomato ...
CHARACTERIZING THE ROLES OF CELL POLARITY GENES ...
The diageotropica gene of tomato encodes a cyclophilin: a novel ...
Characterization of Tomatoes Expressing Anthocyanin in the Fruit
Molecular identification and characterization of the tomato flagellin ...
Functional Characterization and Expression ... - Plant Physiology
Functional Characterization of OsMADS18, a Member of the AP1 ...
Evolution and Functional Characterization of the RH50 Gene from ...
Identification, Characterization, and Functional Analysis of a Gene ...
Identification and Characterization of Genes with Specific ...
Identification and functional characterization of the Rad23 gene of ...
Genetic and physiological characterization of tomato cv. Micro-Tom
Gene regulation in parthenocarpic tomato fruit - David Rocke
The expression of tomato prosystemin gene in tobacco plants highly ...
The expression of tomato prosystemin gene in ... - Rosa Rao Lab
Subunit Antisense Gene Expression in Tomato Plants Leads to a ...
Identification and characterization of homeobox genes in ... - SciELO
Characterization and expression of cytokinin signalling genes in ...
Molecular Identification and Functional Characterization of ...
Characterizations of the uro Mutant Suggest that the URO Gene Is ...
Characterization and functional role of voltage ... - Glucagon.com
Functional characterization of the three genes encoding 1-deoxy-D ...
Determination and characterization of genes involved in toxic ...
Molecular Characterization and Gene Expression Profiling ... - CUSAT
Analysis and characterization of differential gene expression during ...
Stress-responsive a-dioxygenase expression in tomato roots
Functional Characterization of PaLAX1, a Putative - Plant Physiology
Functional Characterization of Arabidopsis thaliana WRKY39 in ...
Molecular and functional characterization of ... - URGV - Inra