Views
5 years ago

Functional characterization of tomato Sl-IAA3 and Sl-hls genes. Role ...

Functional characterization of tomato Sl-IAA3 and Sl-hls genes. Role ...

Chapitre IV:

Chapitre IV: Functional Characterization of Tomato Hookless Genes AATCAGAGCTG3’). For overexpressing lines, the same sense construct (S- HLS1) (from ATG to the Stop codon) generated for Arabidopsis hls1 complementation was introduced into tomato plants. Agrobacterium tumefaciens- mediated transformation of tomato plants was carried out according to Jones et al. (2002) and transformed lines were selected as in Wang et al. (2005). Cloning of Sl-HLS1 and Sl-HLS2 Two tomatos EST, homologue to Arabidopsis hookless 1 gene, were found in tigr database. The lacked parts of each EST were filled in by 5’ and 3’ rapid amplification of cDNA ends (RACE) according to the manufacturer’s instructions (Clontech, BD SMART RACE cDNA Amplification Kit). Two cDNA was then isolated, amplified, and sequenced. We refer them as Sl-HLS1 and Sl-HLS2. Isolation of the Genomic Clones Genomic DNA was extracted from 1 g of ground tomato (Lycopersicon esculentum) leaves using DNA extraction Kit (Promega). An RNase treatment was done at 37°C for 10 min. A pair of primers was chosen based on the cDNA sequence, and PCRs were performed on the genomic DNA. The amplified fragments were cloned and fully sequenced. Comparative analysis between the genomic clone and cDNA sequences allowed the delimitation of introns and exons. Isolation of Sl-HLS2 Promoter The Universal Genome Walker Kit (Clontech Laboratories, Inc., Palo Alto, CA, USA) was used to isolate the Sl-HLS2 gene promoter region.The tomato genomic DNA fragment with adaptors at the ends was used as a template for the amplification of the promoter region. We used AP1 (5’ GTAATACGACTCACTATAGGGC 3’) and AP2 (5’ ACTATAGGGCACGCGTGGT 3’) primers provided by the Genome Walker kit, and two specific antisens primers for our gene SP1 (5’AAGATAGGAAGCGGCTTAGCTGAATC3’) and SP2 (5’ CTGTTTTT GAC ACCACTCCTCGAGAG3’). The generated PCR product was cloned, fully sequenced and analyzed by PlantCARE, (Lescot et al., 2002). This 118

Chapitre IV: Functional Characterization of Tomato Hookless Genes promoter is then fused to Gus reporter gene in binary vector (plp100) and stably transformed in tomato lines as indicated before. Hormones Treatments Ethylene treatments were performed for 5 h in 25 L sealed glass boxes. 5-days etiolated seedlings were treated with 10 ppm of ethylene. Tomato fruits at the Immature green (IMG), mature green (MG) and breaker (Br) stage were treated with 50 µl.l.1 ethylene. Control seedlings and fruits were exposed to air alone. Auxin treatment was applied during 2 hours on dark-grown seedlings at 25°C. Auxin (IAA) solutions (100µM) were made up in 0.05% ethanol and were adjusted to ph 6 with dilluate NaOH. To disturb seedlings as little as possible, IAA solutions were sprayed onto intact plants as a fine mist. After treatments, different tissues were immediately frozen in liquid nitrogen and stored at -80°C until RNA extraction. For etiolated seedlings, different tissues corresponding to cotyledons, hook, hypocotyls and root were harvest as indicated in figure 11. Greening, Glucose and ABA Test These tests were applied as indicated in ChapitreIII. RNA Extraction and Quantitative RT-PCR RNA from etiolated seedlings was isolated using the Qiagen kit (RNaeasy Plant Mini kit) according to the manufacturer’s instructions. For all the other tissues, RNA was extracted by the phenol–chloroform method according to Zegzouti et al. (1999). DNase-treated RNA (2 mg) was then reverse-transcribed in a total volume of 20 µl using the Omniscript Reverse Transcription Kit (Qiagen, Valencia, CA, USA). Real-time quantitative PCR was performed using cDNAs corresponding to 2.5 ng of total RNA in a 10 µl reaction volume using the SYBR Green PCR Master Mix (PE-Applied Biosystems, Foster City, CA, USA) on an ABI PRISM 7900HT sequence detection system. PRIMER EXPRESS software (PE-Applied Biosystems) was used to design gene-specific primers. The following hookless-specific primers were used: Sl-HLS1 F (5’AAGAGGCTGTGGAGGAACAATC3’) Sl-HLS1 R (5’GGAAAGTTTAGTGAAAACA GGAAGGT3’) Sl-HLS2 F (5’CCTATACCGCCGCCGATACT3’) 119

Characterization of the subtilase gene family in tomato ...
CHARACTERIZING THE ROLES OF CELL POLARITY GENES ...
The diageotropica gene of tomato encodes a cyclophilin: a novel ...
Characterization of Tomatoes Expressing Anthocyanin in the Fruit
Molecular identification and characterization of the tomato flagellin ...
Evolution and Functional Characterization of the RH50 Gene from ...
Functional Characterization and Expression ... - Plant Physiology
Functional Characterization of OsMADS18, a Member of the AP1 ...
Identification, Characterization, and Functional Analysis of a Gene ...
Genetic and physiological characterization of tomato cv. Micro-Tom
Identification and Characterization of Genes with Specific ...
Gene regulation in parthenocarpic tomato fruit - David Rocke
Characterizations of the uro Mutant Suggest that the URO Gene Is ...
Characterization and functional role of voltage ... - Glucagon.com
Identification and functional characterization of the Rad23 gene of ...
Molecular Identification and Functional Characterization of ...
Subunit Antisense Gene Expression in Tomato Plants Leads to a ...
The expression of tomato prosystemin gene in ... - Rosa Rao Lab
The expression of tomato prosystemin gene in tobacco plants highly ...
Characterization and expression of cytokinin signalling genes in ...
Identification and characterization of homeobox genes in ... - SciELO
Analysis and characterization of differential gene expression during ...
Functional characterization of the three genes encoding 1-deoxy-D ...
Determination and characterization of genes involved in toxic ...
Stress-responsive a-dioxygenase expression in tomato roots
Functional Characterization of PaLAX1, a Putative - Plant Physiology
Molecular Characterization and Gene Expression Profiling ... - CUSAT
Characterization of a sub-family of Arabidopsis genes with the SPX ...
There is more to tomato fruit colour than candidate carotenoid genes