Views
5 years ago

Functional characterization of tomato Sl-IAA3 and Sl-hls genes. Role ...

Functional characterization of tomato Sl-IAA3 and Sl-hls genes. Role ...

Chapitre IV:

Chapitre IV: Functional Characterization of Tomato Hookless Genes Sl-HLS2 R (5’ACC GAGATTGAGAGGGTTGTTG3’) Sl-Actin F (5’TGTCCCTATTTA CGAGGGTTATG C3’) Sl-Actin R (5’CAGTTAAATCACGACCAGCAAGAT3’). Actin was used as a reference gene with constitutive expression in various tissues. For Sl-HLS1 and Sl-HLS2, the optimal primer concentration was 900nM and 50 nM respectively. For Actin the primers were used at 50nM concentration. Real- time PCR conditions were as follow: 50°C for 2 min, 95°C for 10 min, then 40 cycles of 95°C for 15 s and 60°C for1 min, and fina lly one cycle at 95°C for 15 s and 60°C for 15 s. For all real-time PCR experiment s, two biological replicates were made and each reaction was run in triplicate. For each sample, a Ct (threshold constant) value was calculated from the amplification curves by selecting the optimal ∆Rn (emission of reporter dye over starting background fluorescence) in the exponential portion of the amplification plot. Relative fold differences were calculated based on the comparative Ct method using the Sl- Actin-51 (accessionNo.Q96483) as an internal standard. To determine relative fold differences for each sample in each experiment, the Ct value for Sl-HLS1 and Sl-HLS2 gene was normalized to the Ct value for Sl-Actin-51 and was calculated relative to a calibrator using the formula 2 -∆∆ Ct . REFERENCES Ecker, J.R. (1995). The ethylene signal transduction pathway in plants. Science 268: 667–675 Goeschl, J.D., Pratt, H.K. and Bonner, B.A. (1967). An effect of light on the production of ethylene and the growth of the plumular portion of etiolated pea seedlings. Plant Physiol 42: 1077–1080. Guzman, P., and Ecker, J.R. (1990). Exploiting the triple response of Arabidopsis to identify ethylene-related mutants. Plant Cell 2, 513–523 Jung-Eun Park, Youn-Sung Kim, Hae-Kyung Yoon, Chung-Mo Park (2007). Functional characterization of a small auxin-up RNA gene in apical hook development in Arabidopsis. Plant Science 172: 150–157 Kieber, J.J., Rothenberg, M., Roman, G., Feldmann, K.A., and Ecker, J.R. (1993). CTR1, a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the raf family of protein kinases. Cell 72, 427–441. Lehman, A., Black, R., and Ecker, J.R. (1996). HOOKLESS1, an ethylene response gene, is required for differential cell elongation in the Arabidopsis hypocotyl. Cell 85, 183–194. 120

Chapitre IV: Functional Characterization of Tomato Hookless Genes Li, H., Johnson, P., Stepanova, A., Alonso, J.M. and Ecker, J.R. (2004). Convergence of signaling pathways in the control of differential cell growth in Arabidopsis. Dev. Cell 7: 193–204. Ohto, M., Hayashi, S., Sawa, S., Hashimoto-Ohta, A ., and Nakamura, K. (2006). Involvement of HLS1 in Sugar and Auxin Signaling in Arabidopsis LeavesPlant Cell Physiol. 47(12): 1603– 1611 Ohme-Takagi, M., and Shinshi, H. (1995). Ethylene inducible DNA binding proteins that interact with an ethylene-responsive element. Plant Cell 7, 173–182. Raz, V., and Ecker, J.R. (1999). Regulation of differential growth in the apical hook of Arabidopsis. Development 126: 3661–3668 Zhou, L., Jank J-C, Jones, T.L., Sheen, J .(1998). Glucose and ethylene signal transduction cross talk revealed by an Arabidopsis glucose-insensitivemutant. Proc Natl Acad Sci USA 95: 10294–1029 121

Characterization of the subtilase gene family in tomato ...
CHARACTERIZING THE ROLES OF CELL POLARITY GENES ...
Characterization of Tomatoes Expressing Anthocyanin in the Fruit
The diageotropica gene of tomato encodes a cyclophilin: a novel ...
Molecular identification and characterization of the tomato flagellin ...
Functional Characterization of OsMADS18, a Member of the AP1 ...
Functional Characterization and Expression ... - Plant Physiology
Molecular Identification and Functional Characterization of ...
Identification, Characterization, and Functional Analysis of a Gene ...
Identification and Characterization of Genes with Specific ...
Genetic and physiological characterization of tomato cv. Micro-Tom
Identification and functional characterization of the Rad23 gene of ...
Gene regulation in parthenocarpic tomato fruit - David Rocke
The expression of tomato prosystemin gene in tobacco plants highly ...
The expression of tomato prosystemin gene in ... - Rosa Rao Lab
Subunit Antisense Gene Expression in Tomato Plants Leads to a ...
Identification and characterization of homeobox genes in ... - SciELO
Characterization and expression of cytokinin signalling genes in ...
Functional characterization of the three genes encoding 1-deoxy-D ...
Determination and characterization of genes involved in toxic ...
Molecular Characterization and Gene Expression Profiling ... - CUSAT
Characterizations of the uro Mutant Suggest that the URO Gene Is ...
Characterization and functional role of voltage ... - Glucagon.com
Functional Characterization of Arabidopsis thaliana WRKY39 in ...
Molecular and functional characterization of ... - URGV - Inra
A Genome-Wide Characterization of MicroRNA Genes in ... - Panzea
Molecular Characterization of Lal2, an SRK-Like Gene ... - Genetics
Characterization of a NAC-like gene that regulates stamen ...
Characterization of transcription factor gene SNAC2 ... - NCPGR