Views
5 years ago

Copyright by Eunyoung Park 2007 - The University of Texas at Austin

Copyright by Eunyoung Park 2007 - The University of Texas at Austin

Table 3.1. Sequence

Table 3.1. Sequence of primers used for SYBG quantitative real time-PCR Target Gene Sense primer (5’-3’) Antisense primer (5’-3’) MMP-1 GATGAAGTCCGGTTTTTCAAAG GCAGCATCGATATGCTTCAC MMP-2 CGGAAAAGATTGATGCGGTA TGCTGGCTGAGTAGATCCAG MMP-7 (127) GGATGGTAGCAGTCTAGGGATTAACT GGAATGTCCCATACCCAAAGAA MMP-9 ATCCGGCACCTCTATGGTC CTGAGGGGTGGACAGTGG MMP-13 CCAGTCTCCGAGGAGAAACA AAAAACAGCTCCGCATCAAC TIMP-1 (128) CTTCTGGCATCCTGTTGTTG AGAAGGCCGTCTGTGGGT GAPDH (129) TGCACCACCAACTGCTAGC GGCATGGACTGTGGTCATGAG 61

FIGURE 3.1. EFFECT OF RETINOL ON ATRA-RESISTANT COLON CANCER CELL MIGRATION AND INVASION. HCT-116 (left column) and SW620 (right column) cells were serum starved for 48 h before seeding at a density of 1 x 10 5 cells/well. Uncoated Boyden chambers were used to assess the effect of retinol on cell migration (A). The upper portion of the chambers contained 0 (ethanol vehicle control), 0.1, 1, or 10 μM retinol. An 8 μm pore-sized filter separated the cells from a lower chamber containing 10% FBS, which served as a chemoattractant. Cell migration was measured after 8 h by propidium iodide staining. All data are reported as mean ± SEM for three (HCT-116) or five (SW620) experiments. Matrigel-coated Boyden chambers were used to examine the effect of retinol on cell invasion (B). The upper portion of the chambers contained 0 (ethanol vehicle control), 1, or 10 μM retinol and the lower portion contained 20 ng/ml HGF and 10% FBS, which served as chemoattractants. Cell invasion was measured after 24 h by propidium iodide staining as described in Materials and Methods. All data are reported as mean ± SEM for n=3. *Significantly different from control, P < 0.05. 62

compact - The University of Texas at Austin
winter - The University of Texas at Austin
EMPATHIC EXPERIENCE DESIGN - The University of Texas at Austin
Jake - The University of Texas at Austin
Psycho - The University of Texas at Austin
Newsletter - The University of Texas at Austin
How to Find a Good Idea - The University of Texas at Austin
Behavioural Markers Workshop - The University of Texas at Austin
7 - Harry Ransom Center - The University of Texas at Austin
CTR Annual Report - The University of Texas at Austin
FREIZEIT UND AUSGEHEN - The University of Texas at Austin
100% ATHLETE The University of Texas at Austin - Community
FMCAD 2011 - Bad Request - The University of Texas at Austin
1l ls ls 2 3 - The University of Texas at Austin
2007 TPWD Annual Report - Texas Parks & Wildlife Department
Copyright by Shreya Mitra 2009 - The University of Texas at Austin
Copyright by Zheng Lu 2007 - The University of Texas at Austin
Copyright by Byungwook Yoo 2007 - The University of Texas at Austin
Copyright by Bo Zhang 2007 - The University of Texas at Austin
Copyright By Bryan Sebok 2007 - The University of Texas at Austin
Copyright by Gregory Krauss 2007 - The University of Texas at Austin
Copyright by Zhinan Jin 2008 - The University of Texas at Austin
Copyright by Himanshu Arora 2011 - The University of Texas at Austin
Copyright by Martin A. Isleem 2012 - The University of Texas at Austin
Copyright by Dorothea Sauer 2008 - The University of Texas at Austin
Copyright by Kihan Kim 2006 - The University of Texas at Austin
Copyright by Honguk Woo 2008 - The University of Texas at Austin
Copyright by Soohee Kim 2010 - The University of Texas at Austin