Views
5 years ago

Original Article - American Journal of Cancer Research

Original Article - American Journal of Cancer Research

95 43 1879 Hela HCT116

95 43 1879 Hela HCT116 -2.46 -2.92 -2.76 167 Hela RanBPM shRNA (2-6) [3952] HCT RanBPM shRNA (2-8) [2226] 1799 187 1719 RanBPM β-actin Supplementary Figure 1. Analysis of Hela and HCT116 stable cell lines. Top panel. Whole cell extracts from Hela control shRNA, RanBPM shRNA (2-6), and RanBPM shRNA (2-7); and HCT control shRNA and RanBPM shRNA (2-8) were analyzed by western blotting and decreased RanBPM expression was verified by hybridizing with a RanBPM antibody. The fold decrease in mRNA expression for each cell line is indicated below the respective western blot for that cell line. Bottom panel. Venn diagram of differentially expressed genes in RanBPM shRNA cell lines. The total number of differentially expressed genes for each cell line is indicated in square brackets, and the number of genes with altered expression common between cell lines is denoted within overlapping regions of circles. 73 642 Hela RanBPM shRNA (2-7) [2621]

Supplementary Table 1. Primers for candidate gene validation by RT-qPCR Gene Forward Primer Reverse Primer RON (MST1R) 5’ AGGGTGTGGAGCGCTGTTGTG 3’ 5’ CTTCCAGGCCAGGCGGGTTG 3’ ELF3 (ESE-1) 5’ AGAAGAGCAAGCACGCGCCC 3’ 5’ AGCCTCGGAGCGCAGGAAC 3’ MSLN1 5’ AGGCTCAGCGCCACGCACTC 3’ 5’ CCAGGGAGGGAGGCACCGTG 3’ ALDH1A3 5’ AGGCGGAGCGTGGAGTATGC 3’ 5’ ACTGCTTTTGATCAATCTGAGGCCC 3’ CHN1 5’ TTCAAGGTGCATACATTCAGAGGGC 3’ 5’ ACCACAATCTGCACATTTCACTCCC 3’ LAMB3 5’ CCATTGCAGCCAGGCTCCCC 3’ 5’ GCTCGGCTCCTGGCTTCCTC 3’ TG2 (TGM2) 5’ ACCTCATCAAGGTGCGGGCC 3’ 5’ TGGGCTCCCCAAGGATCCGG 3’ L1CAM 5’ CGCAGCAAGGGCGGCAAATAC 3’ 5’ TCTCCAGGGACCTGTACTCGC 3’ PHD3 (EGLN3) 5’ GCCACGTGGACAACCCCAACG 3’ 5’ CAGGATCCCACCATGTAGCTTGGC 3’ MFAP5 (MAGP2) 5’ TCAGCAGCCAAAGGACTCGGTG 3’ 5’ CCCCAGGGGTATCCAGTCAGAGG 3’ RAB27B 5’ CGGGACAAGAGCGGTTCCGG 3’ 5’ GCTTGCAGTTGGCTCATCCAGT 3’ RON, recepteur d'origine nantais/macrophage stimulating receptor 1 (MST1R); ELF3, E74-like factor 3 (ESE-1); MSLN1, mesothelin 1; ALDH1A3, aldehyde dehydrogenase 1 isoform A3; CHN1, chimerin 1; LAMB3, lamininβ 3; TG2, transglutaminase 2 (TGM2); L1CAM, L1 cell adhesion molecule; PHD3, prolyl hydroxylase 3 (EGLN3); MFAP5, microfibrillar associated protein 5 (MAGP2); RAB27B, RAB27B member Ras oncogene family.

original research - University of Alberta Health Sciences Journal
cancer research at peter mac research at the forefront of discovery
RESEARCH REPORT - Peter MacCallum Cancer Centre
Paterson Institute for Cancer Research SCIENTIFIC REPORT 2005
Cancer Research Institute, Slovak Academy of Sciences
Management of stage Ⅳ rectal cancer - World Journal of ...
New approach to anal cancer - World Journal of Gastroenterology
ACID ASE ACID ASE - The Journal of Lipid Research
E - American Academic & Scholarly Research Center
intrOdUCtiOn - McGill Science Undergraduate Research Journal ...
vitamin D - American Institute for Cancer Research
McNair Research Journal - University of St. Thomas
Review Article - American Journal of Cancer Research
Original Article - American Journal of Translational Research
Original Research Article ABSTRACT - GJRMI - Global Journal of ...
View PDF - Journal of Experimental & Clinical Cancer Research
Original Article - Chinese Medical Journal
Journal of Experimental & Clinical Cancer Research - BioMed Central
Journal of Experimental & Clinical Cancer Research - BioMed Central
Original Research - CHEST Publications - American College of ...
Full article - Latin American Journal of Aquatic Research
articles - Journal of the American Society of Nephrology - Journals of ...
This article was originally published in a journal published by ...
Original article - Chinese Medical Journal
Original article - Chinese Medical Journal
View PDF - Journal of Experimental & Clinical Cancer Research