Views
5 years ago

Development of Real-Time Multiplex NASBA® for the - Journal of ...

Development of Real-Time Multiplex NASBA® for the - Journal of ...

120 125 130 135 140 145

120 125 130 135 140 145 Real-time NASBA Real-time mono NASBA reactions were performed using the NucliSens Basic Kit amplification module (bioMérieux) as described previously (18, 19, 20). In negative control reactions, target nucleic acid was replaced by RNase-/DNase-free water. Amplification reactions were incubated in a fluorescent reader, the NucliSens EasyQ Analyzer (bioMérieux) and results calculated with the Ascent software (bioMérieux). U1A, a low abundance mRNA derived from a human cellular house keeping gene, encoding the ‘A’ protein present in the human U1 (U1A) small nuclear ribonucleoprotein (snRNP) particle, (23) NASBA -to verify the presence of nucleic acid after nucleic acid extraction of specimens- was performed using the NucliSens Basic Kit® amplification module (bioMérieux) on all nucleic acid extracts according to the instructions of the manufacturer in a separate reaction tube. Real-time multiplex NASBA: Besides the species specific P1 primers described previously (18, 19, 20), a generic P2 primer, 5'-GATGCAAGGTCGCATA TGAGAATTTGA TCCTGGCTCAG-3' was designed. The three P1 primers and this generic P2 primer were used in the real-time multiplex NASBA reaction. ACCEPTED The following molecular beacons for real-time detection were used: 5’FAM- CCATGGGTTGAAAGACTAGCTAATACCATGG-Dabcyl3’ for the detection of M. pneumoniae, 5’ROX-CCGATCGTGTAGTG TAATTAGGCATCTAATATCGATCGG- Dabcyl3’ for the detection of C. pneumoniae, and 5’ Cy5- CCGAGCTGAGTAACGCGTAGGAATATGCTCGG-Dabcyl 3’ for the detection of Legionella spp. The final concentration of each primer in the amplification reaction was 0.2µM. To determine the cut off for real-time mono and multiplex NASBA detection, the results of the 142 different individual truly negative samples were measured. The mean was calculated. A sample was considered to be M. pneumoniae, C. pneumoniae and/or Legionella positive when the signal was above the mean of the negative samples plus 20%. 6

150 155 160 165 170 PCR: M. pneumoniae (12) and C. pneumoniae PCR (29) targeting the P1 cytadhesin gene and the PstI fragment, respectively, were done as described previously after nucleic acid extraction using the QiaAmp DNA blood minikit (Qiagen, Hilden, Germany). L. pneumophila real-time PCR was targeted at the mip gene. Four microliters of the nucleic acid extracts were used in a 20 µl real-time PCR reaction using the LightCycler (Roche Diagnostics GmbH, Mannheim, Germany). Ten pmol of primers MIP1 (5'CAACCGATGCCACATCATTA3') and MIP2 (5' TAGCCATTGCTTCCGGATTA3'), 4 pmol of probes MIPFL (5'GCCTTGATTTTTAAAATTCTTCCCAA FLU3') and MIPLC (5' LCRed640TCGGCACCAATGCTATAAGACAACT3') were used in combination with the LightCycler Faststart DNA hybridization probes kit (Roche Diagnostics) according to the instructions of the manufacturer. DNA was amplified by 1 incubation step at 94°C for 60 sec, 45 cycles at 95°C for 10 seconds, 60°C for 10 sec and 72°C for 20 sec each and 1 final incubation step at 40°C for 30 sec. Sample preparation, set up of the reactions and product-analysis were done in separate rooms. As a control, negative samples were processed simultaneously. ACCEPTED Sensitivity study For the generation of wild type (WT) RNA, cDNA from part of the 16S rRNA from each organism, obtained by PCR using adapted versions of the NASBA primers, containing an EcoRI site and a Csp45I site, was inserted into plasmid pG3O, a modified pGEM vector. The plasmids were transfected in Escherichia coli DH5α and used for large-scale generation of runoff transcripts after linearization with BamHI (Pharmacia Biotech). In vitro RNA was generated from these constructs with T7 RNA polymerase (Pharmacia Biotech) as described previously (16, 19, 20) The RNA was quantified by spectroscopy and from the OD the number of molecules was calculated. The analytical sensitivity of the multiplex real-time NASBA was studied on 10-fold dilutions in water of wild type in vitro generated RNA as single targets or as 7

Developing a Real-time Agricultural Drought Monitoring System for ...
Developing Improved Travel Time Reliability Measures For Real ...
Presto combined qualitative real time CT/NG assay - Invitech
development of conventional and real-time multiplex pcr - SciELO
Real-Time Multiplex PCR Assay for Detection - Journal of Clinical ...
Real-time NASBA detection of SARS-associated coronavirus and ...
Development of a real-time multiplex RSV detection assay ... - Covaris
Development of a panel of multiplex real-time polymerase chain ...
Application of a NASBA Real-time assay using molecular beacon for ...
Title: Development of Real-time, multiplex PCR/RT-PCR assays for ...
Detection by Multiplex Real-Time Polymerase Chain Reaction ...
Improved Real-Time Multiplex Polymerase Chain Reaction ...
Real-time multiplex PCR assay for detection of Yer... - Helsinki.fi
Shadow Multiplexing for Real-Time Silhouette ... - EDM - UHasselt
Preclinical Validation of a Monochrome Real-Time Multiplex Assay ...
Multiplex real time PCR: pro's and con's - NIBSC
Development of multiplex nucleic acid sequence-based ...
Real-Time Multiplex PCR Assays - Department of Mathematics ...
1 Resistant Enterobacteriaceae (CRE) - Journal of Clinical ...
Multiplex GMO Screening: a Unique 4-Target Real-Time PCR
Multiplex real time PCR: pro's and con's - NIBSC
Real-Time Multiplex PCR from Genomic DNA Using - Bio-Rad
Factors Influencing Multiplex Real-Time PCR - Applied Biosystems
The first universal kit for quantitative, real-time, multiplex PCR
Development of a pan-Simbu real-time reverse ... - Virology Journal
Development of a Multiplex PCR for the simultaneous amplification ...
Real-Time Multiplex PCR from Genomic DNA Using - Bio-Rad
Development of a multiplex Polymerase Chain Reaction ... - CRDEEP
Method for Real Time Text Extraction of Digital ... - CSC Journals