Wealden Times | WT285 | February 2026

PRICELESS

FEBRUARY 2026

285

FEBRUARY 2026

EDUCATION SUPPLEMENT inside

Inspirational Interiors • Fabulous Fashion • Delicious Dishes

Did you know

we also

supply & install

Secondary

Glazing

Energy Efficient

Maintenance Free

Market Leading

Timberlook

Windows and Doors

Home Design Visits

Showroom

Consultations

Local Award Winning

Installation Company

Contemporary Designs

Conservation Projects

Flexible finance options available

01233 367074

Scan here to discover

more about the

Residence Collection

Orbital Park

Ashford

TN24 0TL

MINTERIORS

JMade Designing in and Biddenden handcrafting kitchens by a and family bedrooms business since 1994

jminteriorsuk.uk

Please email or call to make a showroom appointment

info@jminteriorsuk.uk 01580 291221

ifa@financial-advice.co.uk

www.financial-advice.co.uk

Authorised and Regulated by The Financial Conduct Authority

14527 FAS 35 Year Anniversary Ad v3.indd All Pages

Celebrating over 35 years

of trusted financial advice.

A proud milestone of over 3 decades of guiding

individuals and businesses with expertise, integrity and

long-term financial confidence.

Folkestone Office:

01303 273 273

Sterling House, Concept Court, Shearway

Business Park, Folkestone, Kent, CT19 4RG

Maidstone Office:

01622 238 230

5 Tolherst Court East, Turkey Mill,

Ashford Road, Maidstone, Kent, ME14 5SF

07/01/2026 10:31

A.T. Palmer Ltd

Restoration Specialists Est.1949

PROUDLY CELEBRATING 75 YEARS IN BUSINESS

Employed Skilled Workforce | Renovations & Extensions

Conversions & Alteration | Design & Build

T: 01233 770077

Smarden Business Estate,

TN27 8QL

atpalmer.co.uk

Contents

February 2026

34

108

62

12

25

29

32

34

51

53

HOUSE OF THE MONTH

Dream homes on the market

NOTEBOOK

Upcoming events for your diary

THE MUST LIST

Keep up-to-date with the latest

must-see and must-have goodies

THE IMPORTANCE

OF PLANNING

Oliver Streeten from Trueplan

discusses technological advances

VINTAGE GENES

A home with real Retro appeal

GET THE LOOK

Emulate that mid-century vibe

WEDDINGS SUPPLEMENT

Glorious ideas for a gorgeous day

62

77

107

108

114

THE WONDERFUL THING

ABOUT COTCHFORD

An exploration of the former home

of A. A. Milne and Brian Jones

GET THE LOOK

Embrace history for a

cosy, welcoming feel

NEW ROMANTICS

Rebecca Cuffe’s fashion edit

BRING ON THE ZING

Nourishing and healthy

recipes to warm the soul

WHAT HAS K-BEAUTY

DONE FOR US?

Josephine Fairley explores how

Korean beauty trends have

become such a big hit in the UK

Published by Priceless Media Ltd.

Kettle Chambers, 21 Stone Street, Cranbrook, Kent TN17 3HF

Call 01580 714705 | Email info@priceless-group.com Visit priceless-group.com

119

120

122

127

130

EDUCATION

SUPPLEMENT

28 pages of all

things schools,

from nursery

to secondary.

After page 78.

SPORTY FIT

Sarah Maxwell looks into the

many benefits of team sports

NOURISH TO FLOURISH

Charlotte Lau’s monthly

wellbeing tips

THE BRAVEST BLOOMS

Jo Arnell looks at the garden’s

tough little winter heros

WHAT’S ON

Fun-filled February dates

FARM FABLES

Jane Howard’s latest instalment

from Coopers Farm

Copyright © 2026 Priceless Media Ltd. The views of the advertisers & contributors are not necessarily those of Priceless Media Ltd.

sponsored by

7

priceless-magazines.com

M

Y

Y

Y

From the

Editor

Every year, without fail, I Google when spring

starts (20 March BTW). With bulbs now popping

up left, right and centre in my garden, and on

the verges on my drive to school each morning, I am

looking forward to seeing colour begin to return to

the countryside. As we embrace the last few weeks of

winter, we take a tour of two cosy homes with real

welcoming appeal. The first, a Retro lover’s dream is

packed with fascinating curios, furniture and artworks,

whilst the second – once home to Winnie-the-Pooh

author A. A. Milne, and Brian Jones of The Rolling

Stones fame – is sharing its warm charm with lucky

guests, as it’s now available as a holiday rental.

Charlotte Butterworth has put together some deliciously

filling recipes for us, packed with all the good stuff

to weather the chillier months. In health and beauty,

Sarah Maxwell and Charlotte Lau explain how to

keep healthy and active, at any age, and Josephine

Fairley turns her expert eye to Korean makeup and

skincare trends and all the hype surrounding them.

Be sure to check out not one, but two, special

supplements this issue – weddings and

education. Plan your special day with

the help of Rebecca Cuffe, who has put

together themed pages to personalise

your choices. And get informed about

the myriad education options on offer

across the South East and beyond.

CANTERBURY

MAIDSTONE

WINTER SALE

NOW ON

INTER SALE •

WWINTER SALE •

Enjoy your Priceless magazine

Priceless Team

EditorLucy Fleming

Supplements & Features EditorRebecca Cuffe

Sub Editor & Features Writer Emily Pavey

Design & Production DirectorAnthony Boxall

Sales Manager, Surrey HomesLisa Gordon-Hughes

lisa.gordon-hughes@surrey-homes.co.uk

Sales Director, Priceless Group Maria Hurley

maria.hurley@wealdentimes.co.uk

Senior Account ManagerSarah Norwood

Senior Sales ExecutiveAndrew Boughton

Wealden Times Show Director Flo Simpson

Events Manager Liz Miles

Events Sales Director Jude Brown

Financial ControllerStephen Hunt

Accounts Sarah Davies

Social Media ManagerCharlotte Lau

Managing DirectorVivien Cotterill-Lee

Executive Chairman Julie Simpson

Contact number for Wealden Times01580 714705

Contact number for Surrey Homes 01580 236072

9

NEW SEASON. NEW STYLE.

PURE LUXURY.

From the finest Italian leather sofas by Nicoletti

to elegant designs by John Sankey,

sleek dining by Cattetlan Italia, and the

ultimate comfort of Vispring and Relyon beds

— elevate every corner of your home.

CANTERBURY 01227 766 655 / Roper Road, CT2 7EL

MAIDSTONE

01622 753 073 / Sandling Road, ME14 2RF

In-store & Online


OLD FORGE MEWS - SMARDEN

COMING SOON!

AN EXCLUSIVE, QUIET DEVELOPMENT OF NINE BESPOKE SINGLE STOREY HOMES,

SET IN ONE OF THE PRETTIEST VILLAGES IN KENT.

REGISTER YOUR

INTEREST TODAY AT:

info@jarvishomes.com

Call: 01233 421050

OLD FORGE MEWS

SMARDEN, KENT

jarvishomes.com


10

Find us here!

Call 01580 714705 to find your nearest distributor of

Wealden Times or to get free copies delivered for £30 a year.

18,000 copies of Wealden Times are printed

every month. We are available in the

following outlets and are the only

local magazine available at key

commuter stations. If you have any

questions about our distribution please

contact Vivien Cotterill-Lee

vivien.cotterill-lee@priceless-group.com

Alfriston

• Emmett &

White Antiques

& Interiors

Ashford

• Ashford

Designer Outlet

• Eastwell Manor

• Hunters

• Kingsfords

Solicitors

• Northwood

• Perry Court

Farm

• Sainsbury’s

• Secret Garden,

Kent

• The Wife

of Bath

Aylesford

• Tesco Extra

Battle

• British Design

British Made

• Jempson’s

Benenden

• Village Shop

Bexhill

• Sivyers Antique

Emporium

• Wards

Biddenden

• The Bakehouse

• Bloomsburys

• Costcutter

Boughton

Monchelsea

• The Cock Inn

Broadstairs

• Tesco Extra

Bromley

• The Glades

Burwash

• Londis

Canterbury

• Asda Superstore

• Benton Kitchens

• The Duke

William

• Fenwick

• Gibson’s

Farm Shop

• Sainsbury’s

• Whitefriars

Chislehurst

• Sainsbury’s

Cranbrook

• Hartley Coffee

House

• Hartley Dyke

Farmshop

• Pages

Crowborough

• Costa Coffee

Eastbourne

• Waterstones

Eridge

• Fuller’s Farm Shop

Faversham

• Macknade

Fine Foods

• Sainsbury’s

Flimwell

• The Weald

Smokery

Folkestone

• Hunters

• Loaf

• Moda

• Rocksalt

• Sainsbury’s

Goudhurst

• Burfields

House Wealth

Management

Ltd

• Furnish &

Feather

• Goudhurst Inn

• Goudhurst

Newsagents

• Ventisette

Greenhithe

• John Lewis

Food Hall

Haywards

Heath

• Cook

Hastings

• Judges Bakery

• Morrisons

• Respire Living

• Wellington

Centre

Hawkhurst

• Kino Cinema

• Park Farm

Butchers

• Two Chicks

Headcorn

• Sweet William

Florist

Heathfield

• Cuculo Deli

• The Stores

Horsham

• Cook

Hurst Green

• Eggs to Apples

Hythe

• The Chair

Lady

• The Flower

Shop

• Halcyon Days

• Hunters

• Hythe Bay

Seafood

Restaurant

• Nutmeg Café

• Oaks Hair &

Beauty Retreat

• Sainsbury’s

Ickham

• The Duke

William

Kings Hill

• Costa

Lenham

• Corner House

Antiques

Lewes

• Riverside

Shopping Hall

Maidstone

• Tesco

Marden

• Marden

Village Store

Mayfield

• The House

Café

Northiam

• Country

Property Group

• Jempson’s Local

• Will’s Bakery

and Café

Nutley

• Nutley Antiques

Orpington

• Tesco Extra

Peasmarsh

• Jempson’s

Pluckley

• Pluckley

Farm Shop

Robertsbridge

• Vinehall School

Rolvenden

• KM & JM

Linklater

Rushlake Green

• The Stores

Rye

• Adams of Rye

• Jempson’s

• Kino Cinema

• Phillips &

Stubbs

• The White

House

Sandhurst

• Johnson’s of

Sandhurst

Sedlescombe

• Sedlescombe Post

Office and Stores

Sellindge

• Hobbs & Hearts

Sevenoaks

• Cook

• County Clothes

• Sainsbury’s

Sheffield Green

• Trading

Boundaries

Sissinghurst

• TN17 Food

& Wine

Smarden

• West End

House Gallery

St. Leonards

on-Sea

• Sainsbury’s

• Shop

Staplehurst

• Frankie’s

Farm Shop

Stone Cross

• Sharnfold

Farm & Shop

Tenterden

• County

Clothes

• Hunters Estate

Agents

• London

Beach Hotel

• Tenterden

House

Interiors

• Tesco

Superstore

• Warner Gray

• Webbs of

Tenterden

• White Lion

• Woodcocks

Ticehurst

• Londis

Tonbridge

• Cook

• Neptune

Tunbridge Wells

• Fenwick

• Hoopers

• Maddisons

Residential

• Notcutts

• Rencraft

• Sainsbury’s

• The Buzz Lounge,

The Pantiles

• Truffle

Wadhurst

• Jempson’s

Westerham

• Nisa

Whitstable

• Tea & Times

• Tesco Extra

• The Whiting

Post

Winchelsea

• Winchelsea

Farm Kitchen

Wye

• The Wife

of Bath

TRAIN

STATIONS:

• Ashford

International

• Hildenborough

• Maidstone East

• Orpington

• Paddock Wood

• Sevenoaks

• Staplehurst

• Tonbridge

• Tunbridge

Wells

• Wadhurst

• West Malling

HERITAGE SPECIALISTS

BUILT ON REPUTATION & QUALITY

TRADITIONAL & MODERN ROOFING

Ashford &

Cranbrook Roofing

01580 242925

www. c r a n b r o o k r o o f i n g . c o. u k

CLAY TILE , SLATE & CEDAR ROOFING

11


House

Month

of the

£2,500,000

Brasted

Gordon Lee tracks down some of the

finest converted Kentish oasts for sale

The dream: Statement village

home blending historic character

with contemporary design.

Where: Brasted, near Sevenoaks.

Setting: Tucked away down

a quiet lane, backing onto

open greenbelt fields.

Beds: 6 Baths: 4

Special features: This superbly

converted oast house has been

transformed by a striking glass

extension, creating a light-filled living

space with sunken seating and bifold

doors opening onto the garden. The

double-height kitchen/breakfast

room, with bespoke cabinetry, Aga

and Miele appliances, flows into a

vaulted drawing and dining room

– an entertainer’s dream. Upstairs,

the principal suite enjoys open

countryside views, a dressing room and

luxurious en suite, while the roundel

houses a charming home office.

Pleasing details: Underfloor

heating in the main reception rooms

ensures year-round comfort, while

the thoughtful layout balances

grandeur with everyday practicality.

Outside: Landscaped gardens,

terraces, a heated summerhouse, hot

tub and countryside walks starting

right from the door. Gated parking

and garaging complete the picture.

Time to town: Sevenoaks

station (4 miles) has excellent

fast train services to London.

Agents: Knight Frank

01732 809549 knightfrank.co.uk


12

£1,695,000

Biddenden

The dream: Refined family home

in a re-imagined Kentish oast.

Where: Rural location on the

outskirts of Biddenden.

Setting: Within two acres of beautifully

maintained gardens and grounds.

Beds: 4 Baths: 4

Special features: This impressive double squarekiln

oast offers more than 3,400 sq ft of elegant,

light-filled accommodation. Three generous

reception rooms provide space to entertain and

unwind, while the kitchen/breakfast/family room

is the hub of this home. The principal suite is a

calm retreat, complemented by two further en

suite bedrooms and a stylish family bathroom.

Pleasing details: A thoughtful blend of heritage

and modernity runs throughout, creating a home

that feels both characterful yet contemporary.

Outside: With open lawns and mature planting,

the grounds offer privacy, space and a real sense

of escape, yet remain close to village life.

Time to town: Headcorn (4 miles) and Ashford

(12) have direct trains to London, while Tenterden

and Cranbrook are just a short drive away.

Agents: Harpers & Hurlingham 01580 715400

harpersandhurlingham.com

Marden

£1,250,000

The dream: A beautiful twin-roundel oast

conversion with character at every turn.

Where: Rural Marden, approximately

2 miles from Staplehurst high street.

Setting: Tucked behind gates, with

landscaped gardens and wide rural skies.

Beds: 4 Baths: 4

Special features: The vaulted kitchen/breakfast

room, with exposed beams and floor-to-ceiling

glazing, opens onto a sunny terrace that’s perfect

for long summer lunches. The large reception

room with brick chimney and wood-burner

provides a cosy heart in winter, while the principal

suite enjoys its own roundel and en suite.

Pleasing details: Exposed timbers, mellow

brickwork and generous glazing blend period

charm with modern comfort, including underfloor

heating and excellent storage throughout.

Outside: Landscaped gardens, paved terraces

and a bespoke outdoor kitchen create a superb

backdrop for entertaining. Planning permission

is in place for an annexe and triple-bay garage.

Time to town: Staplehurst station has direct trains to

London, making country life effortlessly connected.

Agents: Batcheller Monkhouse 01892 512020

batchellermonkhouse.co.uk

13


SJD 297x210 advert design update 09.25.qxp_Layout 1 11/09/2025 10:09 Page 1

LAND AND DEVELOPMENT

PLOT OR NOT?

UNLOCK THE POTENTIAL OF YOUR LAND OR PROPERTY

We’re actively seeking sites for development on behalf of clients.

For more information, contact Stephen Donnelly:

07739 514 350 I 01892 579 937 I steve@sjd-projects.com

sjd-projects.com

Commercial buildings for residential conversion • Former public houses • Redundant building for development • Buildings for conversion or replacement

Houses for improvement • Large sites on the edge of town • Barn conversions • Large gardens in residential areas • Major regeneration projects

Tenterden £975,000

Executive detached town house in a private close with generous gardens,

plenty of off road parking and carport. EPC Rating C.

Postling, Nr Hythe £1,500,000

Grade II listed farmhouse on the North Downs.

Energy efficiency, Tennis court, range of outbuildings. EPC Rating C.

In all about 9.50 acres.

Cranbrook £1,200,000

Character single storey converted farm building with solar panels,

detached 2 bed annexe, south facing gardens, courtyard and double garage.

EPC Rating E (Annexe and House).

Woodchurch, Nr Tenterden £1,100,000

Grade II listed farmhouse with 3 bed holiday cottage.

EPC Rating F (House). EPC Rating D (Holiday Cottage).

In all about 4.60 acres.

Ashford 01233 506260 | www.hobbsparker.co.uk | Tenterden 01580 766766

Wealden_Times_FEB_2026.indd 1 09/01/2026 14:44:17

Trusted by generations

for generations to come.

With innovative working

practices and a deep legal

understanding, Thomson

Snell & Passmore helps high

and ultra-high net worth

individuals and families

navigate today’s challenges of

asset structures, tax, wills and

estate planning.

www.ts-p.co.uk T 01892 510000

Scan to secure

your future today

Because we understand

that it’s so much more than

bricks and mortar

+44 (0) 1580 713825 | fionapenny.com

Property Search in Kent and East Sussex

Urban & Rural Architects

Planning Applications

Listed Building Applications

Building Control Applications

www.urbanandruralltd.co.uk info@urbanandruralltd.co.uk 01227 272 585

ThomasHaywood

Family Law Solicitors

One couple - One solicitor

Due to the emotions involved in a separation, it is unsurprising that so many divorces result in conflict.

At ThomasHaywood we recognise the negative impact that conflict has on the health of the parties and their children.

The ThomasHaywood One Couple - One Solicitor process allows us to see couples together and to advise you jointly,

providing legal advice to help you to resolve financial matters or arrangements for your children.

If you would like to discuss this further, please contact:

Sarah Haywood on 01892 765013, sarah@thomashaywoodsolicitors.com


18

Retirement Villages is part of AXA IM Alts

Say ‘yes’ to

retiring differently

in Kent

Paramount Place, Tunbridge Wells

From town-centre living at Paramount Place

to the relaxed, green surroundings of The

Willowbury, the Thrive Living collection by

Retirement Villages offers beautifully designed

homes, welcoming shared spaces, and the

confidence to live independently, with the

peace of mind that support is always nearby.

This is retirement living shaped around choice,

wellbeing and a real sense of community.

The Willowbury, West Malling

Scan the QR code to find out more and register for

priority invites to our events and coffee mornings

01732 608 947

retirementvillages.co.uk/kent

WEALDEN TIMES 2026 EVENTS WEALDEN TIMES 2026 EVENTS WEALDEN TIMES 2026 EVENTS

WE

NEW FOR

2026

Save

THE DATES

We’re delighted to unveil our 2026 Fair calendar…

a year of shopping, style and seasonal celebrations you won’t

want to miss! From our new pop‐up experiences to beloved

classics, there’s something for every lover of beautiful things

and memorable days out in the heart of the Weald.

Buy your tickets at wealdentimes-fair.co.uk

Tickets

on sale

NOW

Wealden Times

Pop-Up Spring Fair

15th May 2026

Penshurst Place, Tonbridge

We’re thrilled to be

expanding our pop‐up

series with additional curated

shopping experiences, bringing

the Wealden Times community

together in beautiful historic

settings.

A fresh welcome to spring in

one of Kent’s most enchanting

historic houses, a perfect place

to discover handpicked makers,

fresh season treasures and

inspiring gifts.

Are you an independent brand wishing to expand your event schedule?

Please do get in touch via our website or instagram

TS

WEALDEN TIMES 2026 EVENTS WEALDEN TIMES 2026 EVENTS WEALDEN TIMES 2026 EVENTS

Tickets on

sale NOW

QUOTE CODE

‘SHOP26’

for £2 off

each ticket *

BACK FOR

2026

Follow

us on

Instagram

Wealden Times

Midsummer Fair

11th - 13th June 2026

Hole Park, Rolvenden

Our much‐loved summer

celebration returns to

the glorious gardens of Hole

Park with over 220 stallholders

showcasing fashion, homeware,

artisan food, jewellery and

more... the ultimate start

to summer.

Ticket price includes entry to

Hole Park Gardens.

Wealden Times

Pop-Up Autumn Fair

11th September 2026

Penshurst Place, Tonbridge

More inspiration awaits as

the season turns; shop

the latest collections in the

stunning rooms and gardens of

Penshurst Place.

Tickets will be on sale soon.

Keep an eye on our website for

more information. Ticket prices

will include entrance to the

house and gardens, along with

the opportunity to browse 35

hand-picked exhibitors.

Wealden Times

Midwinter Fair

19th - 21st November 2026

The Hop Farm, Kent

Get ahead of Christmas

with three magical days of

festive shopping, abundant gifts,

seasonal treats and handcrafted

treasures in heated marquees.

Tickets will be on sale soon.

Keep an eye on our website for

more information.

*Adult tickets only

ARCHITECTURE

WWW.KENTDESIGNSTUDIO.CO.UK01580230

ARCHITECTURE


ARCHITECTURE

PLANNING

WWW.KENTDESIGNSTUDIO.CO.UK01580230413INFO@KENTDESIGNSTUDIO.CO.UK

ARCHITECTURE&

EXTENSIONS

MULTI - UNIT SCHEMES

LISTED BUILDINGS

BESPOKE DWELLINGS

EQUESTRIAN FACILITIES

ARCHITECTURE

PLANNING

AGRICULTURAL BUILDINGS

WWW.KENTDESIGNSTUDIO.CO.UK01580230413INFO@KENTDESIGNSTUDIO.CO.UK

COMMERCIAL PROJECTS

BUILDING REGULATIONS

CONSTRUCTION DETAILING



22

THEWOOLSTORE,FULLERSWAY,BIDDE


FREE

Smart

Alarm

plus

5

years

0 APR

payment plans *

Windows and doors

with smart home

security built-in

Real time, smart monitoring with alerts and alarm built-in,

when you order windows and doors from our newly extended

range before the end of February 2026.*

̌ Real time monitoring

̌ Free sensors and app

̌ Instant tamper alerts

̌ Reports lock state of all entry points

̌ Integrates with Alexa and Google

̌ Includes external audible alarm

☎ 01622 631613 fineline-windows.co.uk

Rated Excellent

Claim Offer

WINDOWS

DOORS

GARAGE DOORS

ROOFLINE & CLADDING

EXTENSIONS

CONSERVATORIES

FLAT ROOFS

GARAGE CONVERSIONS

*Offer extended to the end of February 2026. See our website for details.

Stay at Eastbridge Hospital for a

unique blend of history and comfort,

where medieval charm meets

modern convenience just steps

from Canterbury Cathedral and

the city’s rich cultural attractions.

Enjoy an unforgettable stay in one of our five

beautifully appointed apartments, set within the

ancient walls of Eastbridge Hospital. Founded

in 1190 to shelter pilgrims visiting the shrine of

Thomas Becket, this remarkable building now

offers modern-day travellers the rare opportunity

to experience a lovingly restored piece of history

with all the comforts of a contemporary home.

Each apartment sleeps two guests, and,

subject to availability, multiple apartments

can be booked together for larger groups.

To book, simply search

Eastbridge Canterbury on

Cottages.com or Booking.com,

or contact at: 07497637487 /

concierge@eastbridgehospital.org.uk

TTHEEE SAAVEEE

th

DAATTEEE

1100 May 2200226

- 11st

wwwwwwwwwwww...twwwwlf...co...uk

Siignn up forr nneeewss & tttiickeeettt aleeerrtttss


24

Notebook

Take note! We’ve rounded up the

best of what to see and do near you

Wellies &

Woollies

Get those wellies on and celebrate the arrival

of early spring at Hever Castle with First

Signs of Spring, opening as the castle reopens

its gates on 11 February and running until

the end of the month. Visitors can explore

the estate’s beautiful grounds as they awaken

from winter, following a self-guided trail

through the gardens. Along the way, enjoy

the delicate blooms of snowdrops, crocuses,

dogwoods and the fragrant daphnes,

heralding the new season. This seasonal

experience is included with admission. For

full details, please visit hevercastle.co.uk.

Image of Hever Castle courtesy of Hever Castle & Cardens

From the moment you arrive, Art Surrey Art Fair at

Sandown Park promises to ignite the imagination.

Taking place from 20 to 22 March, this exciting

event is curated by Art Surrey in collaboration with

Caiger Art, the team behind the acclaimed Art Surrey

Fair at Epsom Downs Racecourse held in October.

Bringing together 120 contemporary and traditional

artists, the fair presents a carefully curated showcase

of outstanding talent. Visitors can explore an

inspiring breadth of work, from painting and digital

art to mixed media, photography, sculpture, glass

and ceramics. With artworks priced from £50

to £3,000+, Art Surrey offers an accessible and

engaging opportunity for both emerging collectors

and seasoned art buyers to discover their next

statement piece. At Sandown Park you’ll find an

on-site bar and café/restaurant facilities serving

food and refreshments and the venue is fully

wheelchair accessible, ensuring everyone can enjoy

the experience. Now firmly established as one of

the largest art fairs in the South East, Art Surrey

continues to cement its place on the cultural calendar.

Join Art Surrey at Sandown Park for a weekend

of creativity, inspiration and discovery. Tickets

are available to buy from artsurrey.co.uk/tickets/

SHIELD-ON TIMES

Are you in need of a Traitors fix? And maybe a night or two

away? We’ve found the perfect solution! How about a stay in

Battel Hall, Leeds Castle’s five-star holiday retreat – designed

by series 3 Traitors star and interior designer Francesca

Rowan-Plowden. Alternatively, step into a real-life castle

setting with an exclusive stay in Leeds Castle’s iconic State

and Battlement Bedrooms located within the Castle itself, for

a once-in-a-lifetime opportunity full of Traitor-esque vibes!

leeds-castle.com

25


Your

Manor

Landmark

Event

‘Material Encounters:

Contemporary Textiles in Focus’

marks the Landmark Art Centre’s

30th Anniversary with an expanded

three-day textiles festival, bringing

together a curated exhibition of

contemporary works, selected

panels from the UK AIDS

Memorial Quilt, a programme of

workshops and talks, and the return

of our much-loved textiles fair. The

inclusion of panels from the UK

AIDS Memorial Quilt, recently

shown in full at Tate Modern’s

Turbine Hall, offers audiences

the opportunity to encounter this

significant collaborative artwork

in situ with other contemporary

pieces. The Festival provides an

accessible and engaging way to

experience textile art in the heart

of Teddington. Book now via the

website landmarkartscentre.org

The Never Say Never is opening

at Hilden Manor, near Tonbridge!

The latest in the Elite Pubs line-up

officially opens on 31 January and

you’re invited to join in the fun

from 3-11pm for drinks, canapés

and live music. This beautifully

restored historic pub will go on

to welcome the community and

will be taking bookings from

opening day onwards. Find out

what all the fuss is about at

elitepubs.com/venue/the-never-say-never

Have a Ball

Kenward Trust is a remarkable charity doing

life-saving work around addiction and

substance misuse. Their early intervention

programme Think Differently, which

empowers positive choices in youngsters, has

reached 65,000 pupils to date. As part of

their vital fundraising the Kenward Will Save

Lives Ball 2026 will be held at the Mercure

Hotel, Maidstone, on Saturday 7 March.

This promises to be an evening to remember,

a glittering celebration filled with music,

dancing and a delicious two-course meal.

Tickets are available from

kenwardtrust.org.uk/charityball

WHO’S IN TOWN?

We can’t wait for Our Town starring the great Martin

Sheen, a Rose Theatre and Welsh National Theatre

production. Written by Thornton Wilder, it runs from

26 February until 28 March. Grover’s Corners is a

quiet little town, full of ordinary folk, living everyday

lives. They work, they laugh, they sing, they fall in

love and raise their children, and grow old. But within

those moments of everyday life, there are truths that

reach out to us all. This new production sees the story

through a Welsh lens, bringing new life and vivid

resonance for modern audiences. rosetheatre.org

priceless-magazines.com 26

The Canterbury

Auction Galleries

Auctioneers of the rare, the collectible and the exceptional

2 0 2 6 A U C T I O N D A T E S

13th & 14th

February

Consignment deadline

now closed

10th & 11th

April


27th February

5th & 6th

June


24th April

31st July &

1st August


19th June

2nd & 3rd

October


21st August

27th & 28th

November


16th October

Contact us today for a free valuation:

Telephone 01227 763337 Email general@tcag.co.uk

Visit thecanterburyauctiongalleries.com

Wealden - TCAG 2026 February 1:2pp.indd 1 08/01/2026 12:57

WWWWWHHHHHOOO AARE

WHO WE ARE WWWWWE LLaaaaaaaauuuuuuuugggggggghhhhhhhhllllllllaaaaaaaannnnnnnndddddddd JJoooooooonnnnnnnneeeeeeeessssssss iiiiiiiissssssss aaaaaaaannnnnnnn aaaaaaaarrrrrrrrcccccccchhhhhhhhiiiiiiiitttttttteeeeeeeeccccccccttttttttuuuuuuuurrrrrrrraaaaaaaallllllll iiiiiiiinnnnnnnntttttttteeeeeeeerrrrrrrriiiiiiiioooooooorrrrrrrr ddddddddeeeeeeeessssssssiiiiiiiiggggggggnnnnnnnn pppppppprrrrrrrraaaaaaaaccccccccttttttttiiiiiiiicccccccceeeeeeee

Laughland Jones is an architectural interior design practice

ssssssssppppppppaaaaaaaacccccccceeeeeeeessssssss ooooooooffffffff rrrrrrrraaaaaaaarrrrrrrreeeeeeee bbbbbbbbeeeeeeeeaaaaaaaauuuuuuuuttttttttyyyyyyyy aaaaaaaannnnnnnndddddddd ddddddddiiiiiiiissssssssttttttttiiiiiiiinnnnnnnnccccccccttttttttiiiiiiiioooooooonnnnnnnn ffffffffoooooooorrrrrrrr

dedicated to creating ddddddddeeeeeeeeddddddddiiiiiiiiccccccccaaaaaaaatttttttteeeeeeeedddddddd spaces ttttttttoooooooo ccccccccrrrrrrrreeeeeeeeaaaaaaaattttttttiiiiiiiinnnnnnnngggggggg of rare beauty and distinction for

HNWI and UHNWI. Our work spans chalets, villas and the finest

tttttttthhhhhhhheeeeeeee aaaaaaaannnnnnnndddddddd vvvviiiiiiiillllllllllllllllaaaaaaaassssssss cccccccchhhhhhhhaaaaaaaalllllllleeeeeeeettttttttssssssss,,,, ssssssssppppppppaaaaaaaannnnnnnnssssssss wwwwwwwwoooooooorrrrrrrrkkkkkk OOOuuuuuuuurrrrrrrr UHHHHHNNNWWWWWIIIII........ aaaaaaaannnnnnnndddddddd HHHHHNNNWWWWWIIIII residential properties.

pppppppprrrrrrrrooooooooppppppppeeeeeeeerrrrrrrrttttttttiiiiiiiieeeeeeeessssssss........

rrrrrrrreeeeeeeessssssssiiiiiiiiddddddddeeeeeeeennnnnnnnttttttttiiiiiiiiaaaaaaaallllllll ffffffffiiiiiiiinnnnnnnneeeeeeeesssssssstttttttt OOOPPPPOOORTTTTUNNNIIIIITTTTYYY

THE OPPORTUNITY

TTTTHHHHHE SSeeeeeeeeeeeeeeeekkkkkk FFFiiiiiiiilllllllltttttttteeeeeeeerrrrrrrr aaaaaaaannnnnnnndddddddd CCoooooooonnnnnnnnnnnnnnnneeeeeeeecccccccctttttttt wwwwwwwwiiiiiiiitttttttthhhhhhhh tttttttthhhhhhhhoooooooosssssssseeeeeeee wwwwwwwwhhhhhhhhoooooooo aaaaaaaarrrrrrrreeeeeeee aaaaaaaaffffffffffffffffiiiiiiiilllllllliiiiiiiiaaaaaaaatttttttteeeeeeeedddddddd wwwwwwwwiiiiiiiitttttttthhhhhhhh tttttttthhhhhhhheeeeeeee

Seek, filter and connect with those who are affiliated with the

HHHHHNNNWWWWWIIIII mmmmmmmmaaaaaaaarrrrrrrrkkkkkkeeeeeeeettttttttppppppppllllllllaaaaaaaacccccccceeeeeeee aaaaaaaannnnnnnndddddddd iiiiiiiinnnnnnnnttttttttrrrrrrrroooooooodddddddduuuuuuuucccccccceeeeeeee LLaaaaaaaauuuuuuuugggggggghhhhhhhhllllllllaaaaaaaannnnnnnndddddddd JJoooooooonnnnnnnneeeeeeeessssssss........

HNWI marketplace and introduce Laughland Jones.

ooooooootttttttthhhhhhhheeeeeeeerrrrrrrr iiiiiiiinnnnnnnndddddddduuuuuuuussssssssttttttttrrrrrrrriiiiiiiieeeeeeeessssssss ooooooooppppppppeeeeeeeerrrrrrrraaaaaaaattttttttiiiiiiiinnnnnnnngggggggg iiiiiiiinnnnnnnn tttttttthhhhhhhheeeeeeee

We establish relationships with other industries operating in WWWWWeeeeeeee the

eeeeeeeessssssssttttttttaaaaaaaabbbbbbbblllllllliiiiiiiisssssssshhhhhhhh rrrrrrrreeeeeeeellllllllaaaaaaaattttttttiiiiiiiioooooooonnnnnnnnsssssssshhhhhhhhiiiiiiiippppppppssssssss wwwwwwwwiiiiiiiitttttttthhhhhhhh same sphere – generally a receptive ssssssssaaaaaaaammmmmmmmeeeeeeee sssssssspppppppphhhhhhhheeeeeeeerrrrrrrreeeeeeee ––– ggggggggeeeeeeeennnnnnnneeeeeeeerrrrrrrraaaaaaaallllllllllllllllyyyyyyyy aaaaaaaa rrrrrrrreeeeeeeecccccccceeeeeeeeppppppppttttttttiiiiiiiivvvveeeeeeee aaaaaaaannnnnnnndddddddd iiiiiiiinnnnnnnntttttttteeeeeeeerrrrrrrreeeeeeeessssssssttttttttiiiiiiiinnnnnnnngggggggg aaaaaaaauuuuuuuuddddddddiiiiiiiieeeeeeeennnnnnnncccccccceeeeeeee ttttttttoooooooo

and interesting audience to

HHHHHNNNWWWWWIIIII approach, cccccccclllllllliiiiiiiieeeeeeeennnnnnnnttttttttssssssss........

who in turn introduce us aaaaaaaapppppppppppppppprrrrrrrrooooooooaaaaaaaacccccccchhhhhhhh… to wwwwwwwwhhhhhhhhoooooooo iiiiiiiinnnnnnnn the ttttttttuuuuuuuurrrrrrrrnnnnnnnn iiiiiiiinnnnnnnnttttttttrrrrrrrroooooooodddddddduuuuuuuucccccccceeeeeeee HNWI uuuuuuuussssssss ttttttttoooooooo clients.

tttttttthhhhhhhheeeeeeee TTTThhhhhhhheeeeeeee ppppppppooooooootttttttteeeeeeeennnnnnnnttttttttiiiiiiiiaaaaaaaallllllll ‘iiiiiiiinnnnnnnnttttttttrrrrrrrroooooooodddddddduuuuuuuucccccccceeeeeeeerrrrrrrrssssssss’’ aaaaaaaarrrrrrrreeeeeeee ffffffffoooooooouuuuuuuunnnnnnnndddddddd aaaaaaaallllllllllllllll oooooooovvvveeeeeeeerrrrrrrr tttttttthhhhhhhheeeeeeee ppppppppllllllllaaaaaaaacccccccceeeeeeee,,,, ttttttttyyyyyyyyppppppppiiiiiiiiccccccccaaaaaaaallllllllllllllllyyyyyyyy

The potential ‘introducers’ are found all over the place – typically

in the world of real estate, private family offices tttttttthhhhhhhheeeeeeee wwwwwwwwoooooooorrrrrrrrlllllllldddddddd ooooooooffffffff rrrrrrrreeeeeeeeaaaaaaaallllllll eeeeeeeessssssssttttttttaaaaaaaatttttttteeeeeeee,,,, pppppppprrrrrrrriiiiiiiivvvvaaaaaaaatttttttteeeeeeee ffffffffaaaaaaaammmmmmmmiiiiiiiillllllllyyyyyyyy ooooooooffffffffffffffffiiiiiiiicccccccceeeeeeeessssssss,,,, aaaaaaaannnnnnnndddddddd ccccccccoooooooonnnnnnnncccccccciiiiiiiieeeeeeeerrrrrrrrggggggggeeeeeeee

iiiiiiiinnnnnnnn and concierge

MMoooooooonnnnnnnntttttttteeeeeeee

ttttttttyyyyyyyyppppppppeeeeeeee iiiiiiiinnnnnnnndddddddduuuuuuuussssssssttttttttrrrrrrrriiiiiiiieeeeeeeessssssss ––– iiiiiiiinnnnnnnn LLoooooooonnnnnnnnddddddddoooooooonnnnnnnn aaaaaaaannnnnnnndddddddd ooooooootttttttthhhhhhhheeeeeeeerrrrrrrr hhhhhhhhooooooootttttttt ssssssssppppppppoooooooottttttttssssssss,,,, ssssssssuuuuuuuucccccccchhhhhhhh type industries – in London and other hot spots, such as Monte aaaaaaaassssssss Carlo, St Moritz and Mustique: oooooooouuuuuuuurrrrrrrr wwwwwwwwhhhhhhhheeeeeeeerrrrrrrreeeeeeee hhhhhhhhaaaaaaaauuuuuuuunnnnnnnnttttttttssssssss uuuuuuuussssssssuuuuuuuuaaaaaaaallllllll tttttttthhhhhhhheeeeeeee aaaaaaaallllllllllllllll -- MMuuuuuuuussssssssttttttttiiiiiiiiqquuuuuuuueeeeeeee aaaaaaaannnnnnnndddddddd MMoooooooorrrrrrrriiiiiiiittttttttz SStttttttt CCaaaaaaaarrrrrrrrlllllllloooooooo,,,, all the usual haunts where our

wwwwwwwwoooooooorrrrrrrrkkkkkk tttttttthhhhhhhheeeeeeeerrrrrrrreeeeeeeeffffffffoooooooorrrrrrrreeeeeeee aaaaaaaannnnnnnndddddddd cccccccclllllllliiiiiiiieeeeeeeennnnnnnnttttttttssssssss clients and therefore work tends to be. Laughland Jones’ clients cccccccclllllllliiiiiiiieeeeeeeennnnnnnnttttttttssssssss JJoooooooonnnnnnnneeeeeeeessssssss’’ LLaaaaaaaauuuuuuuugggggggghhhhhhhhllllllllaaaaaaaannnnnnnndddddddd bbbbbbbbeeeeeeee........ ttttttttoooooooo tttttttteeeeeeeennnnnnnnddddddddssssssss are those who typically own several homes.

AAfffffffftttttttteeeeeeeerrrrrrrr iiiiiiiinnnnnnnnvvvveeeeeeeessssssssttttttttiiiiiiiiggggggggaaaaaaaattttttttiiiiiiiinnnnnnnngggggggg rrrrrrrreeeeeeeelllllllleeeeeeeevvvvaaaaaaaannnnnnnntttttttt iiiiiiiinnnnnnnnttttttttrrrrrrrroooooooodddddddduuuuuuuucccccccceeeeeeeerrrrrrrrssssssss,,,, ssssssssaaaaaaaayyyyyyyyiiiiiiiinnnnnnnngggggggg ‘HHHHHiiiiiiii’’ wwwwwwwwiiiiiiiitttttttthhhhhhhh aaaaaaaa ccccccccaaaaaaaallllllllllllllll aaaaaaaannnnnnnndddddddd

After investigating relevant introducers, saying ‘Hi’ with a call and

aaaaaaaa mmmmmmmmeeeeeeeessssssssssssssssaaaaaaaaggggggggeeeeeeee uuuuuuuussssssssiiiiiiiinnnnnnnngggggggg oooooooouuuuuuuurrrrrrrr bbbbbbbbeeeeeeeessssssssppppppppooooooookkkkkkeeeeeeee ssssssssooooooooffffffffttttttttwwwwwwwwaaaaaaaarrrrrrrreeeeeeee ––– tttttttthhhhhhhheeeeeeee oooooooobbbbbbbbMeeeeeeeeccccccccttttttttiiiiiiiivvvveeeeeeee iiiiiiiissssssss ttttttttoooooooo sssssssseeeeeeeetttttttt

a message using our bespoke software, the objective is to set

uuuuuuuupppppppp mmmmmmmmeeeeeeeeeeeeeeeettttttttiiiiiiiinnnnnnnnggggggggssssssss ffffffffoooooooorrrrrrrr tttttttthhhhhhhheeeeeeee ddddddddiiiiiiiirrrrrrrreeeeeeeeccccccccttttttttoooooooorrrrrrrr ttttttttoooooooo ggggggggoooooooo ttttttttoooooooo ffffffffuuuuuuuullllllllllllllllyyyyyyyy eeeeeeeeqquuuuuuuuiiiiiiiippppppppppppppppeeeeeeeedddddddd........ YYYoooooooouuuuuuuu wwwwwwwwiiiiiiiillllllllllllllll bbbbbbbbeeeeeeee

up meetings for the director to go to fully equipped. You will be

ooooooooffffffff tttttttthhhhhhhheeeeeeeesssssssseeeeeeee mmmmmmmmeeeeeeeeeeeeeeeettttttttiiiiiiiinnnnnnnngggggggg iiiiiiiinnnnnnnn ppppppppeeeeeeeerrrrrrrrssssssssoooooooonnnnnnnn aaaaaaaassssssss wwwwwwwweeeeeeeellllllllllllllll........

encouraged to take some of these meetings in person as well.

eeeeeeeennnnnnnnccccccccoooooooouuuuuuuurrrrrrrraaaaaaaaggggggggeeeeeeeedddddddd ttttttttoooooooo ttttttttaaaaaaaakkkkkkeeeeeeee ssssssssoooooooommmmmmmmeeeeeeee iiiiiiiissssssss Following aaaaaaaallllllllssssssssoooooooo aaaaaaaa up kkkkkkeeeeeeeeyyyyyyyy

and keeping track of all the loose FFFoooooooolllllllllllllllloooooooowwwwwwwwiiiiiiiinnnnnnnngggggggg ends uuuuuuuupppppppp aaaaaaaannnnnnnndddddddd is kkkkkkeeeeeeeeeeeeeeeeppppppppiiiiiiiinnnnnnnngggggggg ttttttttrrrrrrrraaaaaaaacccccccckkkkkk also ooooooooffffffff aaaaaaaallllllllllllllll a tttttttthhhhhhhheeeeeeee lllllllloooooooooooooooosssssssseeeeeeee key

eeeeeeeennnnnnnnddddddddssssssss

bbbbbbbbuuuuuuuussssssssiiiiiiiinnnnnnnneeeeeeeessssssssssssssss ddddddddeeeeeeeevvvveeeeeeeellllllllooooooooppppppppmmmmmmmmeeeeeeeennnnnnnntttttttt aaaaaaaannnnnnnndddddddd ssssssssuuuuuuuuppppppppppppppppoooooooorrrrrrrrtttttttt

ccccccccoooooooommmmmmmmppppppppoooooooonnnnnnnneeeeeeeennnnnnnntttttttt--IIIIItttttttt’’ssssssss aaaaaaaa ffffffffuuuuuuuullllllllllllllll component – it’s a full blown business development and support

bbbbbbbblllllllloooooooowwwwwwwwnnnnnnnn rrrrrrrroooooooolllllllleeeeeeee........ role.

Our offices are currently in Ashford – soon to be in Wye aaaaaaaarrrrrrrreeeeeeee ccccccccuuuuuuuurrrrrrrrrrrrrrrreeeeeeeennnnnnnnttttttttllllllllyyyyyyyy iiiiiiiinnnnnnnn AAsssssssshhhhhhhhffffffffoooooooorrrrrrrrdddddddd ––– ssssssssoooooooooooooooonnnnnnnn ttttttttoooooooo bbbbbbbbeeeeeeee iiiiiiiinnnnnnnn WWWWWyyyyyyyyeeeeeeee ––– aaaaaaaannnnnnnndddddddd

OOOuuuuuuuurrrrrrrr ooooooooffffffffffffffffiiiiiiiicccccccceeeeeeeessssssss – and

tttttttthhhhhhhheeeeeeee ppppppppoooooooossssssssiiiiiiiittttttttiiiiiiiioooooooonnnnnnnn ccccccccaaaaaaaannnnnnnn bbbbbbbbeeeeeeee ffffffffuuuuuuuullllllllllllllll oooooooorrrrrrrr ppppppppaaaaaaaarrrrrrrrtttttttt ttttttttiiiiiiiimmmmmmmmeeeeeeee........ TTTThhhhhhhheeeeeeee iiiiiiiiddddddddeeeeeeeeaaaaaaaa ooooooooffffffff WWWWWFFFHHHHH ffffffffoooooooorrrrrrrr ssssssssoooooooommmmmmmmeeeeeeee

the position can be full or part time. The idea of WFH for some of

the time is welcomed, but it

bbbbbbbbuuuuuuuutttttttt wwwwwwwweeeeeeeellllllllccccccccoooooooommmmmmmmeeeeeeeedddddddd,,,, iiiiiiiissssssss ttttttttiiiiiiiimmmmmmmmeeeeeeee tttttttthhhhhhhheeeeeeee ooooooooffffffff bbbbbbbbaaaaaaaasssssssseeeeeeeedddddddd........ ooooooooffffffffffffffffiiiiiiiicccccccceeeeeeee mmmmmmmmoooooooossssssssttttttttllllllllyyyyyyyy bbbbbbbbeeeeeeee wwwwwwwwiiiiiiiillllllllllllllll iiiiiiiitttttttt will be mostly office based.

wwwwwwwweeeeeeeellllllllllllllll bbbbbbbbeeeeeeee wwwwwwwwiiiiiiiillllllllllllllll yyyyyyyyoooooooouuuuuuuu ssssssssuuuuuuuucccccccccccccccceeeeeeeessssssssssssssssffffffffuuuuuuuullllllll IIIIIffffffff If successful you will be well remunerated, with a basic and an

aaaaaaaannnnnnnn aaaaaaaannnnnnnndddddddd bbbbbbbbaaaaaaaassssssssiiiiiiiicccccccc aaaaaaaa wwwwwwwwiiiiiiiitttttttthhhhhhhh rrrrrrrreeeeeeeemmmmmmmmuuuuuuuunnnnnnnneeeeeeeerrrrrrrraaaaaaaatttttttteeeeeeeedddddddd,,,, exciting bonus structure based on results.

rrrrrrrreeeeeeeessssssssuuuuuuuullllllllttttttttssssssss oooooooonnnnnnnn bbbbbbbbaaaaaaaasssssssseeeeeeeedddddddd ssssssssttttttttrrrrrrrruuuuuuuuccccccccttttttttuuuuuuuurrrrrrrreeeeeeee bbbbbbbboooooooonnnnnnnnuuuuuuuussssssss eeeeeeee[cccccccciiiiiiiittttttttiiiiiiiinnnnnnnngggggggg WWWWWHHHHHOOO AARE

WHO YOU ARE YYYOOOU YYYoooooooouuuuuuuu wwwwwwwwiiiiiiiillllllllllllllll nnnnnnnneeeeeeeeeeeeeeeedddddddd ttttttttoooooooo bbbbbbbbeeeeeeee ffffffffoooooooorrrrrrrreeeeeeeennnnnnnnssssssssiiiiiiiiccccccccaaaaaaaallllllllllllllllyyyyyyyy oooooooorrrrrrrrggggggggaaaaaaaannnnnnnniiiiiiiisssssssseeeeeeeedddddddd wwwwwwwwiiiiiiiitttttttthhhhhhhh aaaaaaaa rrrrrrrreeeeeeeelllllllleeeeeeeennnnnnnnttttttttlllllllleeeeeeeessssssssssssssssllllllllyyyyyyyy

You will need to be forensically organised with a relentlessly

ddddddddeeeeeeeetttttttteeeeeeeerrrrrrrrmmmmmmmmiiiiiiiinnnnnnnneeeeeeeedddddddd aaaaaaaapppppppppppppppprrrrrrrrooooooooaaaaaaaacccccccchhhhhhhh,,,, aaaaaaaassssssss wwwwwwwweeeeeeeellllllllllllllll aaaaaaaassssssss bbbbbbbbeeeeeeeeiiiiiiiinnnnnnnngggggggg aaaaaaaabbbbbbbblllllllleeeeeeee bbbbbbbbeeeeeeee aaaaaaaabbbbbbbblllllllleeeeeeee ttttttttoooooooo tttttttthhhhhhhhiiiiiiiinnnnnnnnkkkkkk

determined approach, as well as being able to think creatively out

of the box. You’ll enjoy chatting comfortably with anyone and

ccccccccrrrrrrrreeeeeeeeaaaaaaaattttttttiiiiiiiivvvveeeeeeeellllllllyyyyyyyy wwwwwwwwiiiiiiiitttttttthhhhhhhh

ccccccccoooooooommmmmmmmffffffffoooooooorrrrrrrrttttttttaaaaaaaabbbbbbbbllllllllyyyyyyyy cccccccchhhhhhhhaaaaaaaattttttttttttttttiiiiiiiinnnnnnnngggggggg eeeeeeeennnnnnnnMooooooooyyyyyyyy yyyyyyyyoooooooouuuuuuuu’’llllllllllllllll ––– bbbbbbbboooooooo[ tttttttthhhhhhhheeeeeeee ooooooooffffffff oooooooouuuuuuuutttttttt everyone within the HNWI market place.

aaaaaaaannnnnnnnyyyyyyyyoooooooonnnnnnnneeeeeeee aaaaaaaannnnnnnndddddddd eeeeeeeevvvveeeeeeeerrrrrrrryyyyyyyyoooooooonnnnnnnneeeeeeee wwwwwwwwiiiiiiiitttttttthhhhhhhhiiiiiiiinnnnnnnn tttttttthhhhhhhheeeeeeee HHHHHNNNWWWWWIIIII mmmmmmmmaaaaaaaarrrrrrrrkkkkkkeeeeeeeetttttttt ppppppppllllllllaaaaaaaacccccccceeeeeeee........

aaaaaaaarrrrrrrreeeeeeee tttttttthhhhhhhhoooooooosssssssseeeeeeee wwwwwwwwhhhhhhhhoooooooo ttttttttyyyyyyyyppppppppiiiiiiiiccccccccaaaaaaaallllllllllllllllyyyyyyyy oooooooowwwwwwwwnnnnnnnn sssssssseeeeeeeevvvveeeeeeeerrrrrrrraaaaaaaallllllll hhhhhhhhoooooooommmmmmmmeeeeeeeessssssss........

Please send a CV via email, with a short note as to why you see yourself as a good fit, to enquiries@laughlandjones.co.uk

Pllllleeeeeeeeaaaaaaaasssssssseeeeeeee sssssssseeeeeeeennnnnddd aaaaaaaa CV vviiiiiiaaaaaaaa eeeeeeeemaaaaaaaaiiiiiilllll wwiiiiiitttttthhhh aaaaaaaa sssssssshhhhoooooooorrrtttttt nnnnnooooooootttttteeeeeeee aaaaaaaassssssss ttttttoooooooo wwhhhhyyy yyyoooooooouuuuu sssssssseeeeeeeeeeeeeeee yyyoooooooouuuuurrrsssssssseeeeeeeelllllvveeeeeeeessssssss aaaaaaaassssssss aaaaaaaa ggooooooooooooooooddd fiiiiiitttttt, ttttttoooooooo eeeeeeeennnnnquuuuuiiiiiirrriiiiiieeeeeeeessssssss@lllllaaaaaaaauuuuugghhhhlllllaaaaaaaannnnndddjoooooooonnnnneeeeeeeessssssss..coooooooo..uuuuuk

27


Bespoke design from concept

to completion

LAYTONTAYLOR.COM

T. 020 7096 9089

For a romantic date night at home,

Indulge’s Valentine’s Day Meal Kit

is a 6-course gourmet extravaganza

which comes fully prepared and

cooked, and ready to heat up and

plate up. £75 at indulgedining.co.uk

We’ve long been

spritzing Jo Malone’s

iconic fragrances, but

now she has turned

her attention to luxury

vodka, and we are ready to

start collecting some new

bottles. This one, The Artist,

has notes of rose, neroli,

pink peppercorn and sencha.

Pour over ice and top up

with chilled soda water or

tonic and garnish with a rose

petal for a toast to a bright

and bold Lunar New Year,

an indulgent Valentine’s or

whatever else you have going

on this month. £49.99 at

jovodka.com

Dear Gentle Readers, it’s time for

a new season of Bridgerton and

Laurence King Publishing has a

lovely selection of games as well as

this beautiful World of Bridgerton

puzzle, the perfect accompaniment to a viewing

night or two. £18.99 at laurenceking.com

must

The

From must-sees to must-buys and

must-dos, don’t miss this month’s

round up of what to buy, see, do,

and generally get excited about!

Ramp up moisture levels to

combat cold-ravaged skin with

the help of Nourish London’s

gentle serums. Firm favourites with our

editorial team, our pick is the Retinal

Resilience Serum, which, layered

with your moisturiser, delivers a hit of

skin renewing retinaldehyde coupled

with barrier-strengthening ceramides,

super greens antioxidant complex and

probiotic minerals – nourishing indeed.

£35 for 30ml. nourishskinrange.com

For the ultimate hero piece in your

bedroom or living room, design something

entirely unique. Visit Sarah Louise Dix

upholstery studio in Godalming, Surrey,

where you can design a headboard or

footstool using beautiful fabrics from brands

such as Linwood, Lewis & Wood, Colefax

and Fowler, and Romo. Pick the shape, size,

height, design detail and leg options with

help and experience on hand to guide you.

Or you can learn to upholster one yourself

– try a ten week upholstery course from

April or a one-day workshop for beginners

on Saturday 7 February or 7 March.

sarahlouisedix.co.uk

Stuck for a Valentine’s gift? Sometimes

going full throttle into all things pink

and heart shaped is the best way to say,

“I really don’t care if I look silly carrying

this around as long as it makes you

smile.” A giant pink heart-shaped box

of chocolates it is then. The classics are

classic for a reason after all, and the way

to many a heart is through chocolate.

This is Hotel Chocolat’s Straight from

the Heart Box and is £49.95, but there

are plenty more options for all price

ranges and tastes. The only

question is... can you get

your beloved recipient to

share? hotelchocolat.com

For those looking for an

extra special Valentine’s

gift, consider a trip to

the Jewellery Quarter of

Brighton’s famous Lanes.

Here you can have your

special someone select (or

even commission) something

truly special. This 9ct

yellow gold dragon’s claw

ring with heart shaped

pink tourmaline is from

one of our favourites –

Baroque – and is £3,190

at baroquejewellery.com

The 17th is Chinese New

Year and we move forward

with the year of the horse.

If you’re celebrating, try

Cutter & Squidge’s Lunar

New Year Collection. Their

selection of cakes, cookies,

brownies and gifting sets are

inspired by festive flavours

and lucky symbolism for

meaningful sharing moments

and a joyful start to your next

chapter. cutterandsquidge.com

29

If it’s

important

to you, it

matters

to us

LEADING FIRM

UNITED KINGDOM

2025

DESIGNED TO ENDURE

ALL SEASONS

The award-winning Nutshell Growth Fund

A globally diversified, actively managed fund, built for quality

growth across market cycles. Invested in about 30 exceptional

companies, with strong long-term potential. The Nutshell

Growth Fund is a resilient option for growth-focused investors.

Available for ISA, SIPP, and investment accounts.

Invest directly or via leading platforms at nutshellam.com

Capital at Risk. Investments can go up and down.


30

TO DO LIST

*

*

*

*

*

*

Remember Jonty’s rugby boots

Book Pilates class

Confirm numbers for the 22nd

Pick up Pizza dough

Fill up Oil Tank

Book an enquiry to discuss the

suitability of a Heat pump

www.junorenewables.uk 01892 620692

Build Better, Build Faster,

Unlock the flexibility of Modular Construction

• Value for money

• Extra space within days

• Adaptable & flexible to suit your needs

Office space | Educational | Catering | Farms | Welfare Units

www.poppedupgroup.com

01233 535352

31


Planning

The importance of planning

Founder and Managing Director at Trueplan, Oliver Streeten,

speaks to Gordon Lee about how technology continues to advance his company’s offering

“ Ask Oliver

Unofficially, I’m head of research

and development,” says Trueplan

Founder and Managing

Director Oliver Streeten with a smile.

“I’m always on the forums, scouring

the internet for technology that will

further simplify the planning process,

and enhance the plans and 3D models

we produce.” That curiosity, coupled

with technical expertise, are the beating

heart of Trueplan. They are also the

reason the business consistently delivers

plans faster, more accurately and more

cost-effectively than many competitors.

Trueplan were among the first in the

sector to adopt LiDAR technology for

mapping buildings, shopping centres

and plots of land. Light Detection and

Ranging works by sending out laser

pulses and measuring the time it takes

for them to return, creating dense 3D

point clouds that form astonishingly

precise digital models. It is the same

technology used by autonomous

vehicles and robot vacuum cleaners.

For complex or hard-to-reach roofs,

Oliver’s team combine LiDAR with

drone surveys to capture every detail.

Famously, detailed 3D plans like those

produced by Trueplan, enabled Notre-

Dame Cathedral to be rebuilt quickly

and accurately after the devastating fire.

Their range of work is as broad as

it is impressive. “We map buildings

for architects designing extensions;

land for solicitors resolving boundary

disputes; and retail spaces for brands

planning new store openings, from

coffee chains to ice-cream specialists

like Amorino,” Oliver explains.

Around half of Trueplan’s work

supports people selling their homes.

From floorplans and aerial imagery to

video footage and immersive virtualreality

models, the team provide

a complete digital toolkit. “We’re

experts in digitising reality,” says

Oliver. Surprisingly, 3D modelling is

still not standard in residential sales.

Done well, it transforms the buying

experience and can significantly speed

up decision-making compared with

traditional two-dimensional plans.

Food for thought for estate agents.

The company’s technical expertise

also extends naturally into Energy

Performance Certificates and Fire

Information Box Plans – secure, on-site

plans used by emergency services in

blocks of flats, hospitals and care homes.

When every second matters, having

accurate, up-to-date layouts can be

lifesaving. Trueplan can survey and deliver

these plans in days rather than weeks,

so if yours needs updating, call Oliver.

Their topographical work is fascinating.

For a couple of hundred pounds, Oliver

and his team can map your garden

– particularly helpful for landscape

gardeners planning major redesigns.

Putting technology to one side,

Trueplan is very much a human business,

one that Oliver has built in his own

image: logical, thoughtful and genuinely

helpful. That ethos extends to how he

recruits. “We want to take on young

people who don’t necessarily feel that

the typical educational pathway is for

them,” he says. “We’re looking for those

with a logical, spatially aware brain, who

understand people.” It is a refreshing

philosophy, and one that explains the

warmth of their client testimonials, which

consistently note their professionalism

and technical excellence. From mapping

a tower block to surveying a garden

for a landscape redesign, Trueplan’s

work blends cutting-edge technology

with practical, human insight - proof

that precision and personality can,

and should, go hand in hand.

You can reach Oliver on 01892 614881,

plans@trueplan.co.uk, and trueplan.co.uk

Favourite Quote

“Run your own race.”

Favourite Restaurants

The Kentish Hare, Bidborough.

Favourite Books

Treasure Island by Robert

Louis Stevenson

The Count of Monte Cristo

by Alexandre Dumas

Favourite Walk

Hemsted Forest

Favourite TV

Ted Lasso


32

01892 614 881

Surveying

You Can Rely On

At Trueplan, our surveying work

is led by experience, driven by

accuracy and delivered with clarity.

Our Services Include:

• Land Registry Compliant Plans

• Plans, Elevations and Sections

• Garden / Topographical Surveys

• Drone Surveying

BICKNOR ROAD

BEAUFORT WALK

Land Registry Compliant Title Plans

Prepared to HM Land Registry Requirements

Clear, accurate survey drawings

for planning and construction

Trusted by:

Get in touch for a quote

LOCATION PLAN

Property Professionals

Solicitors Developers

0 5 10 20 30 metres

01892 614 881

plans@trueplan.co.uk

Trueplan (UK) Ltd,

8 Beaufort Walk,


Vintage genes

Words: Gordon Lee Photographs: David Merewether

Katherine Atkinson’s mindful renovation of a 1960s house is the perfect showcase for her

love of combining midcentury furniture with retro florals, colour and houseplants

DNA tests have become an

increasingly popular Christmas

gift for those eager to find out

if they have a bit of Viking blood, some

Irish ancestry, or a distant connection

to some exotic location. The wonderful

BBC Sounds series The Gift presents

the other side of these tests and their

often-unintended consequences: sisters

who turned out to be mothers; friends

who turned out to be relatives; and

new brothers and sisters who turned

up, all around the world. The period

just after Christmas when the results

roll in has been referred to as “Sibling

Season” or for those more pleasantly

surprised than shocked to their core,

as their “Christmas Bonus”. If you’re

wondering what on earth this has

to do with Katherine Atkinson’s

extraordinary house, bear with

35


Planning/Listed Building

Applications

Building Control

Tender and Construction

Upholstery Design Studio Services

• Upholstery services & design consultation

• Bespoke headboards & footstools

• Handmade curtains, blinds & soft furnishings

• Upholstery courses & workshops

• Fabric shop - stockists of Linwood, Colefax and Fowler,

Upholstery

Romo, GP&J Baker...

Design

see website

Services

for full list

h m d a

hales marshall design architects

Upcoming upholstery courses:

1 day workshop, 7 Feb | 8 Mar (beginners)

10 week course, April (all abilities)

Book & see more details online image courtesy of Linwood

Walnut House, Offham, Kent ME19 5NJ

info@halesmarshalldesign.co.uk

halesmarshalldesign.co.uk | t. 01732 848795

Passionate about fabric & creating unique furniture

Passionate about fabric & creating unique furniture

sarahlouisedix.co.uk | enquiries@sarahlouisedix.co.uk | 01483 801108

sarahlouisedix.co.uk | enquiries@sarahlouisedix.co.uk | 01483 801108

Handmade Bespoke Kitchens & Interiors. Built, not bought

01622 844484 · www.peteralexandercabinets.co.uk


36

This page: Katherine called on the

services of Pluck to create her dream

kitchen. The table was commissioned

from Hardman Designs and her G-Plan

dining chair collection was completed

with the help of Facebook Marketplace

whilst I stretch this analogy, but

suffice to say that every addition that

Katherine has made to this glorious

home feels like they’re welcoming

a new member to their family.

Most houses tell you very little

about the owners because this is rarely

how they reveal themselves. Most

settle for a neutral colour palette,

practical, contemporary furniture,

and a design aesthetic borrowed

from IKEA, or maybe Heals if

you’re lucky. Very few houses wear

their hearts on their sleeves quite

like the Old Forge does. Katherine

hasn’t so much designed a home

with a vintage feel – it’s more like

the house has evolved in her image.

Her DNA is present in every detail. Old

furniture is hunted down on Facebook

Marketplace, with the same excitement

and enthusiasm that you might track

down an estranged but interesting cousin,

who’s living in some remote and distant

town. Once safely secured this furniture

is then welcomed into their life, like a

long lost relative. Katherine isn’t just

decorating their home; she’s bringing

together a family of fabrics and furniture,

textures and colours. She has cleverly

made this eclectic mix look serendipitous

and organic, when in fact, it’s all very

considered and quite deliberate.

In interior design terms, this is

referred to as the “red thread”, a phrase

borrowed from the Scandinavian den

røde tråd, meaning a clear, continuous

theme that ties a space together. It’s

about coherence; the story that your

home is telling. For some that might be

a spacious and glamorous place to party

or entertain. For others it might be a

family home centred in the kitchen, and

around cooking and eating together.

Or it could be a home with no airs or

graces, where everyone can be themselves.

But practicalities aside, the real story

of a house is how it makes you feel.

37


This page: Throughout the house, midcentury

furniture has been brought to life with playful

pops of colour. The wallpaper is Madame

Ziggle in Yellow and Blue from Ottoline

How colours and materials, form and style, can

create a mood. When your home feels calm,

intentional, and “just works”, then it has a “red

thread”, and the Old Forge certainly has that.

Katherine’s colour palette draws from spring

and autumn, and as a result the Old Forge is

joyful and optimistic like spring, and yet at the

same time warm and comforting like autumn.

The house is playful, witty, and fun: just look at

the fabulous wallpapers from Ottoline and Mini

Moderns. And it definitely doesn’t take itself too

seriously either: witness the magnificent Tiki

Bar and husband Tom’s collection of Tiki mugs

in their conservatory. The flying ducks on the

wall behind the bar will make you smile too.

But the Old Forge is also traditional,

deferential, and sincere – you can see that

in the way that Katherine has lovingly recovered

footstools, re-upholstered chairs, and

rescued, and revived, the fabulous G-Plan

dining chairs that now sit around her bespoke

dining table. “I love the simplicity and

elegance of midcentury design,” she says.

Last year, Katherine finally had the chance to

create her dream kitchen and dining space.

38

Friendly

Local &

Trusted

Creative Architecture

John Bullock Design

Tunbridge Wells

01892 525732

enquiries@johnbullockdesign.com

www.johnbullockdesign.com

Garden Landscaping

inktobarrow.co.uk

07938 917501

11 Ashford Rd, Tenterden

Complex Separation Matrimonial shouldn’t financial cost your claims?

future.

Cut through the legal noise.

Get Safeguard clear pragmatic what’s advice.

yours.

Stephen Smith

Partner, Family Law

+44 (0) 7359 484739

stephen.smith@mezzlelaw.com

39


Specialist divorce & family law solicitors

If you are going through a separation or thinking about divorce,

getting expert advice at the right time is crucial.

At Thomas Mansfield Solicitors, we pride ourselves on our practical and compassionate approach.

Our years of specialised experience, outstanding client feedback, and track record

of achieving the best outcomes for our clients speak for themselves.

Contact us to start a simple, important conversation about your future.

Call us on 01892 337540

familylaw@thomasmansfield.co.uk

tmfamilylaw.co.uk

Separation & Divorce • Finances • Children • Mediation • Cohabitation • Prenuptial Agreements • Wills & Inheritance Planning

T: 01233 630000

W: www.mageegammon.com

Working WITH YOU, not just FOR YOU!

Accounting services

Audit

Bookkeeping

Business & Personal Taxation

Estate & IHT planning

Wills, LPA’s & Trusts

Payroll & Company Secretarial

Business & Financial planning

Wealden Times Half page MG 2024 Ad.indd 1 20/08/2024 12:05:45

40


Walls were knocked down and the

room was opened up. Pluck provided

the vintage-style kitchen, including an

island with hob and downward extractor,

the pipework for which had to be taken

underground. It’s a wonderfully modern

addition that illustrates Katherine’s love

of function, not just form. Something

that extends to her deep affection for her

G-Plan dining chairs. They aren’t just

there because they look nice – they are

a pleasure to sit on too. With this space

expanded, there was now room for a big

dining table that could seat friends and

extended family. The perfect dining table

can be hard to find, so one of Katherine’s

great indulgences was to get hers made,

bespoke from walnut, by Hardman

This page: A colour palette of buttercup

yellow, soft pink and turquoise work

together to create a relaxing sitting room

vibe. A daffodil table lamp by Bliss

Home illuminates a workspace neatly

tucked beneath the stairs. The wallpaper

is Alice in Mustard by Mini Moderns

41


This page: The conservatory now serves as the perfect

bar and seating space. Katherine’s husband’s collection of

Tiki mugs are neatly arranged behind the vintage bamboo

bar that Katherine sourced locally and restored

Designs. It is a thing of beauty and, texturally and visually,

works well with the teak furniture that’s close by.

Katherine already had six of these lovely, curved back

dining chairs but was on the lookout for two more, which

Facebook Marketplace duly found for her in Margate,

and that she then collected on her way to a Libertines

gig in the town. Although they’re made by G-Plan, these

dining chairs are not a style that you see very often, so

this discovery was particularly satisfying. If you share

Katherine’s love of midcentury design, then try and

track down a copy of The G-Plan Revolution by Basil

Hyman and Steven Braggs. “I think there is something

so pleasing about a midcentury sideboard,” she smiles.

Katherine puts a lot of love, thought, and a great

deal of care into upcycling and repurposing numerous

pieces of furniture – like the bureau that became a

drinks cabinet – making them feel part of the family,

which in turn makes this home what it is. Katherine’s

design aesthetic, together with her passion and

authenticity, are why more than 58,000 people follow

her Instagram account that details her transformation

of the Old Forge. She is definitely one to follow.

You can see her love and respect for tradition and family

connections in the art that fills the walls. Katherine’s

grandmother was a keen photographer, who entered her


42

A reputation built on

quality craftsmanship

and service

The Old Bank

84 High Street

Rye, East Sussex

TN31 7ER

01797 360353

19-21 West Street

New Alresford

Hampshire

SO24 9AB

01962 734504

www.handmaderugs.co.uk

www.rugsandkelimsplus.com

Kent Peg Tiling, Listed Building

& Conservation Specialists.

High quality work by experienced

award winning craftsmen.

01797 270 268 | kentpegs.com

Hand knotted Afghan rug 300 x 250cm £3190

We have a vast collection of rugs, including

oversize rugs, in our showroom. We can also

weave rugs in any design, size and colour in our

workshops in Afghanistan, India and Nepal.

43


Above: The downstairs loo has recently been

redecorated with candy stripe tiles and Improvisation

Number 1 wallpaper by Ottoline

Above right: Katherine commissioned a local carpenter

to create some useful shoe and coat storage

Right: The utility room is papered with rolls of original

Retro floral wallpaper that Katherine found online

photos in competitions. Amongst the collage of pictures

in the principal bedroom is a wonderful landscape

photograph of the Lake District, taken from one of their

annual family walking holidays. The painting of the

swans brings back fond childhood memories from its

time in her mother’s bedroom, whilst the primroses were

painted by a beloved great aunt. As for the sunflower,

well that’s just big, bold, and happy. The vintage art sits

well next to the linocut prints by contemporary artists

like Clare Curtis, Angela Harding and Maidstone’s Judith

Westrup. Like most things in this house, Katherine’s art

is very personal, reverential, and always a lot of fun.


BESPOKE JOINERY SINCE 2002

Nothing short of perfection

We are masters in wood — designers and

craftsmen that engineer wood to create

beauty. Whether it’s kitchen cabinetry,

windows and doors or an elaborate staircase,

if it’s wood, we will make it outstanding.

We combine creative acumen with meticulous

craftmanship to ensure that what we create for

your project is nothing short of perfection.

Call 01580 242996 or

email office@creative-joinery.com

Oak bookshelves and staircase project.

Image by davidmerewether.co.uk

CREATIVE JOINERY

FINE ENGLISH CRAFTSMANSHIP

creative.joinery

Equity Release and Inheritance Tax Planning

ADVERTISEMENT FEATURE

When considering Equity Release

there has to be a good reason

for releasing money – and this

could for any number of things. It could

be to repay an Interest Only Mortgage,

gift to family, buy a specific item or carry

out home improvements. The list goes on!

In addition, Equity Release can also be

a very useful addition to conversations

about Inheritance Tax planning.

For many people, the family home

is their largest asset — yet in many

circumstances it remains fully

exposed for Inheritance Tax.

Equity release, when used

strategically and responsibly, can:

• Release capital to gift to family

• Reduce the value of a taxable estate

• Improve cash flow in later life

• Avoid forced property sales or

downsizing if care is needed.

When used correctly, it can be a very

useful financial planning tool — but

one that requires specialist advice.

I can help in situations where:

• People are “asset-rich

but cash-poor”

• People would like to gift to

family but don’t have the

funds available to do so

• People are concerned about their

property being exposed to IHT

• Downsizing is impractical or

people do not want to move.

As with any financial decision, it

is advisable to talk to a qualified

professional regarding what may

be suitable for your personal

circumstances. Sarah is happy to visit

your home, chat by telephone or

meet via remote video conference

to provide a free consultation.

Call Sarah on

01622 631372 or 07789 007447

or e-mail her at

sarah@ferrellfinancial.co.uk

You may find answers to

some of your questions at

www.ferrellfinancial.co.uk

Ferrell Financial Limited is an Appointed Representative of The Right Mortgage Ltd, which is authorised and regulated by the Financial Conduct Authority.

This is a lifetime mortgage. To understand the features and risks, please ask for a personalised illustration. Check that this mortgage will meet your

needs if you want to move or sell your home or you want your family to inherit it. If you are in any doubt, seek independent advice.

There may be a fee for mortgage advice. The precise amount will depend upon your circumstances. Registration number: 678768.

Companies House registration number: 11192749 registered in England & Wales. Registered address: The Bluff, Roundwell, Bearsted, Maidstone, Kent, ME14 4EU

45


This page: The main bedroom and en suite share a palette of

dusky pinks and yellows. Katherine added yellow fringing to

the light shade above the bed to fit with her colour scheme

Although Katherine’s son may not 100% agree with the

last point. On a family trip to Aldeburgh, Katherine and

husband Tom bought the seascape picture that adorns the

wall with the yellow wallpaper. After underestimating the

size of picture and overestimating the space in their car,

they soon realised they would struggle to drive it back, so

her son kindly offered to get the train home to Kent!

“If I’ve decorated a room and there aren’t any plants

in it, I don’t think it looks finished,” says Katherine. The

vintage look that she has mastered so expertly extends to

the greenery that completes each room. Monsteras have a

Retro look that is very much in keeping with the rest of the

house. They bring a softness, as well a calming hue, whilst

their shadows give off a real 60s vibe. If you’re a plant lover

like Katherine, you may well share her view that some plants

like you and others don’t. Alocasias being one of the latter.

Katherine convinces me that Calatheas are divas, but that

they are with everyone, so that’s something she can live with.

You’d expect a house with this much style and character,

to have its own soundtrack – one based on a really cool

record collection. And so, it proves. Music is an important

part of the family’s lives and that of the house. Katherine is a

90s indie kid at heart – the concert tickets and her extensive

Converse collection, arranged in rainbow colour order

like a piece of wall art in her office, give that away. Music

is a passion she now shares with her children, that peaked

last year with trips to see Pulp, and Oasis at Wembley.

To create a house this stylish and with so much

personality takes a keen eye, and a commitment

to constantly improve and update. Katherine is on

permanent lookout for more. Consequently, the

algorithms on Facebook Marketplace, Vinted


0333 011 3333 |

Limited time only

Adverts 2026.qxp_Feb 26 06/01/2026 2:48 pm Page 1

25% OFF PLUS

Briony 4 Seater

now from £1480

Holly 2.5 Seater

now from £985

Rose 3 Seater

now from £1195

- SALE NOW ON - SALE NOW ON - SALE NOW ON - SALE NOW ON - SALE NOW ON - SALE NOW ON -

116 South Street, Eastbourne NOW ON SHOW

BN21 4LZ

01323 722921

www.davidsalmon.co.uk

This page, top left & right: Katherine’s office, filled with trinkets and

objets that she loves, is home to her extensive collection of Converse

Above left & right: The family bathroom features Mustard Made

lockers, one in a rich berry colour which is echoed on the ceiling

and eBay understand her design DNA. They know what she’s looking

for. And they regularly connect her to vintage furniture, fabrics and

homeware that will soon become part of not just the Old Forge but

her family too. They are to her what Ancestry.com is to those looking

to connect with their past and bring newfound joy to their future.

Address Book:

Follow Katherine’s Instagram

@theoldforgeincolour

Bespoke dining table: hardmandesigns.com

Kitchen: pluck.co.uk

Lino cut artists: clarecurtis.co.uk /

angelaharding.co.uk / judithwestrup.com

Wallpaper: ottoline.co.uk / minimoderns.com

49


HUE HOUSE

CURTAINS | BLINDS | AWNINGS | AUTOMATION

HUE HOUSE


URBAN & GREY

BESPOKE ALUMINIUM GLAZING

Specialists in the supply & installation of contemporary bespoke

aluminium glazing systems. Our showroom & offices are based in

a historical boatyard overlooking the River Thames in Hampton.

Specified by Architects, recommended by Contractors, referred by Clients.

Urban & Grey Ltd

Constable’s Boatyard

5-9 Thames Street

Hampton

TW12 2EW

Telephone: 020 8979 6367

info@urbanandgrey.co.uk

www.urbanandgrey.co.uk

HUE HOUSE

HUE HOUSE

Sliding Doors • Bifold Doors • Flush Casement Windows

Steel Replacement Doors, Screens & Windows

Frameless Glazing • Frameless Fixed Rooflights

Venting, Lantern & Walk-on Rooflights

Front Doors, Pivot Doors • Glazed Garden Rooms & Verandas



HUE HOUSE


Our curtains, blinds, pelmets and Our cushions curtains, are blinds, beautifully pelmets handmade in our Kent wor

Experts in motorisation, roof cushions blinds and are awnings. beautifully All handmade prof

ofessionally sionally in measured ed and fi

our Kent workroom.

Please call to make an appointment at our showr

wroom.

Experts in motorisation, roof blinds

Our curtains, blinds, pelmets and cushions are beautifully Scan handmade me to view our in our company Kent video

workroom.

and awnings. All professionally

Experts in motorisation, roof blinds and awnings. All professionally measured measured and fitted.

and fitted.

Please call to make an appointment at Please our showroom.

call to make an appointment

at our showroom.

Scan me to view our company video


, blinds, pelmets and cushions are beautifully Hue House handmade Ltd, 109 in Worlds our Kent End workroom.

Lane, Hue Orpington, House Ltd, 109 Kent Worlds BR6 End 6AE

Lane, Orpington, Kent BR6 6AE

motorisation, Our curtains, roof blinds blinds, and pelmets awnings. T and 01689 All cushions professionally 851093 are beautifully E measured sales@huehouse.co.uk handmade T 01689 fitted.

in our 851093 W Kent huehouse.co.uk

workroom.

E sales@huehouse.co.uk W huehouse.co.uk

@huehousedesigns

@huehouseshading

Please Experts call in to motorisation, make an appointment roof blinds at our and @huehousedesigns

showroom.

awnings. All professionally @huehouseshading

measured and fitted.

Scan me to Please view our call company to make video

an appointment at our showroom.


Scan me to view our company video50

Our curtains, blinds, pelmets and cushions are beautifully handmade in our Kent workroom.

oom.

Experts in motorisation, roof blinds and awnings. All prof

ofessionally sionally measured ed and fi tted.

Please call to make an appointment at our showr

wroom.


Get the

LOOK

1 Fringed rattan pendant light in natural £145 French Bedroom frenchbedroom.co.uk 2 Wavy

Retro wallpaper £90.60/roll Hovia hovia.com 3 Newbury Jade Green glass flush wall light

£34.99 ValueLights valuelights.co.uk 4 NZ native bird hooks set of 3 $150nzd lisasarah

lisasarah.com 5 The Skinny lockers in Chalk £289 Mustard uk.mustardmade.com 6 Olsen

mid century six-seater dining table in Dark Brown Acacia Wood £699 Swoon Editions

swooneditions.com 7 Kensal stackable dining chair in Vintage Green faux leather and Black £99

Cult Furniture cultfurniture.com 8 Quarry Flame Red tiles 57.78/ m² Topps Tiles toppstiles.co.uk

51


CODE: 61085

CODE: 61201

CODE: 60199

CODE: 61067

Switch on something Special for 2026

Showroom

Elstead House, Mill Lane,

Alton, Hampshire GU34 2QJ

Showroom opening hours

9am - 5pm: Monday - Friday

9am - 1pm: Saturday

Tel: 01420 590510

Web: distinctivelightinguk.com

52

Surrey Homes FP Feb 2026.indd 1 06/01/2026 10:56:51

WEDDINGS

istockphoto.com/ beorm


A contemporary Sussex wedding venue set within the High Weald

Wedding and Events Venue

briarhousebarns.co.uk

info@briarhousebarns.co.uk

01892 853155

Dewlands Hill

Rotherfield

Crowborough

East Sussex

TN6 3RU

Weddings Open Evening

Thursday 19th February 2026 * 5 - 9pm

Discover outside & inside the venue at night * Enjoy Cocktails, Canapés, Fairy Lights & Music *

A magical destination with Indian charm

Getting married?

Register your interest for the Open Evening using the link below...

Trading Boundaries, Nr Fletching, East Sussex TN22 3RB

01825 790200 - e: weddings@tradingboundaries.com - www.tradingboundaries.com/weddings


54

7 steps to...

Fairytale

Fantasy

Feel like fairytale

heroes on your big

day with heaps of

whimsy, magic and

natural beauty

1 THE SETTING

To put the fair in fairytale, opt for a

setting with nature at its heart like a

flowery meadow, a romantic forest

or a rustic barn. Our pick? Trading

Boundaries offers traditional elegance

and captivating charm. Situated in a

Georgian Grade II listed coach house,

with spectacular marquees and subtle

touches of India around the grounds,

its a joyful outdoorsy delight. The

venue is licensed for both registrar

and celebrant-led ceremonies, and

you can exchange vows in the arbour,

lawn, marquee or coach house. Indian

marquees host wedding breakfasts of

40 to 160 guests. The mix of formal

and relaxed creates a magical weddingday

atmosphere, with croquet and fire

pits in the grounds and a first-class

evening party venue in the house

with professional sound and lighting.

Accommodation includes eight rooms

in the courtyard and 4 two-bedroom

cottages. tradingboundaries.com

2 THE RING

This gold and rainbow moonstone

cow parsley stem ring looks full of

midnight magic and natural charm.

£2,760 at lucysylvester.co.uk

3 THE TABLE

Highlight your natural setting with

colourful fanciful dining using candles

and fairy lights to brighten things

up. This table is by Talking Tables

and various items are available at

talkingtables.co.uk

4 THE SHOES

For your Cinderella moment, imitate

the glass slipper look (with a bit

more modern comfort). These sling

backs from Blue Velvet achieve the

transparent style with a sheer mesh

and with a low heel they will be a

lot more wearable than Cinderella’s.

£189.99 at bluevelvetshoes.com

5 THE PLANNER

Every Cinderella needs a fairy

godmother to make the magic

happen. Based in the Kent

countryside, The Country Blush

specialises in beautifully curated

marquee weddings and celebrations,

held at private homes and estates

across the South East. From

full planning to wedding day

management, Evie West works closely

with you to design a heartfelt, bespoke

celebration that feels effortlessly you.

thecountryblush.co.uk

6 THE DRESS

Feel like a princess with a flowing

gown like this Lily dress by E & W

Couture Bridal. We love its dramatic

sheer bishop sleeves, full-circle skirt

and leaf print. Find it at Vicki’s Bridal

Boutique, Tenterden. vickisbride.co.uk

7 THE DECORATIONS

Give your outdoorsy setting plenty of

decorations. This can be done with

flowers, lights or decorations like this

beautiful entrance created using a gold

flower backdrop. £32 merimeri.co.uk

Francesca Hill Photography

55


7 steps to...

Operatic

Opulence

The Opera look is trending this year and for those who enjoy a

darker, dramatic look, it makes for excellent wedding inspiration

1 THE SCENERY

A venue with some historical grandeur

will give you the perfect operatic

backdrop. Hever Castle is our pick with

options of the Astor Wing, the lakeside

Italian Garden, or of course the Castle

itself, to set your scene. At this one-ofa-kind

venue, you could get pictures

on the drawbridge, dine in the Castle

Great Hall or tie the knot overlooking

the magical lake. All this means that

capacities vary with the maximum

being the 250 guests you could have

at a Marquee Wedding at The Winter

Garden Lawn and there is also plenty

of accommodation too. To book,

download a brochure or find out more

visit hevercastle.co.uk

2 SOMETHING OLD

Use antique-style items to create

an operatic setting. This antiqued

gold metal easel, for example, would

be perfect for displaying a seating

arrangement, a welcome poster or a

beautiful portrait of the happy couple.

£94.99 at glasstonefurniture.co.uk

3 THE ACCESSORIES

For groom’s attire, go bold and stylish.

Cravats, velvets, tuxes, braces, all are

welcome here and why shouldn’t the

groom have a bit of fun with the theme

too? This look comes from Dapper &

Suave, whose collection includes neck

ties, bowties, cravats, pocket squares,

and feather lapels. Shop via Esty at

dapperandsuave.uk

4 THE BACKSTAGE LOOK

Operatic brides get ready like a star

and get lots of backstage pics. And this

pure silk kimono dressing gown is the

perfect glamorous coverup to get you in

character. £275 helenloveday.com

5 SOMETHING BLUE

Opt for intricate jewellery and

colourful gems for a luxuriously

glamorous look. These Dalia Earrings

from KATA jewellery will stun with

their blue sapphires surrounded by a

continuous flow of diamonds. £6,900

at katajewellery.com

6 THE DRESS

With this theme you can entirely throw

away the rulebook for your bridal look

– a cape, a surprising colour, a dramatic

train – think of what makes you feel

like a leading lady and go for it! This

Vivienne Westwood Tabitha off-theshoulder

gown makes for a dramatic

entrance with its vibrant draped

duchess silk-satin, impeccable corsetry

and voluminous skirt. It makes all the

right classical references while still being

a surprising modern bridal choice.

£9,310, exclusively at net-a-porter.com

7 THE RING

Select rings with classical references and

a modern twist. This one by Baroque

has a ‘salt & pepper’ rose cut hexagon

diamond with two shoulder diamonds,

all ethically sourced and set in recycled

gold. £7,015 baroquejewellery.com


56

701233483ÿ8453ÿÿ7ÿ881823423549 3!1

UK WEDDING AND PARTY PLANNER

Planning Marquee

Celebrations in the

Working closely with clients to plan

beautiful, bespoke weddings and

celebrations as unforgettable as

the love stories they represent

CELEBRATIONS with MEANING

www.thecountryblush.co.uk

Lottie Topping Photography

57


Wedding Showcase

SUNDAY 8 FEBRUARY 2026 | 12PM – 3PM

hevercastle.co.uk

LFW TEAM

LFW 2026

TEAM

2026

WEDDING

makeup & hair

Elevate your wedding day with

bespoke makeup and hair services

for the modern bride and bridal

party.

By By Lorna Ive

Ive

Book your 2026/27 trial today and

let let your beauty shine!

AN EXPERIENCE TO REMEMBER

Kent/Sussex/London &

& 07540494248

South East

@bylornaive

www.bylornaive.com

Specialists in Jewellery Remodelling | Bespoke Design | Repairs & Alterations

0% Finance Now Available

both online & instore

on ready-to-wear, bespoke & art

subject to status, terms and conditions apply

Explore our range of

Ethical Luxury Jewellery

& Bespoke Designs

by our On-Site Master Craftsmen

KATA Jewellery | 48C St. Explore John’s Road our range of

Royal Tunbridge Wells Ready-to-Wear Jewellery

TN4 9NY & Bespoke Designs by

our on-site Mastercraftsmen

01892 482 659 | katajewellery.com

katajewellery.com | KATA Jewellery | 48C St. John’s Road | Royal Tunbridge Wells | TN4 9NY | 01892 482 659

KATA Jewellery is an Introducer Appointed Representative of Ideal Sales Solutions Ltd, t/a Ideal4Finance. Ideal Sales Solutions Ltd is a credit broker & not a lender (FRN 703401). Finance available subject to status. Rate offered is always provisional & will depend upon your personal circumstances, the loan amount & the term.


58

7 steps to...

Regency

Romance

If you’re loving Bridgerton

you may love to add an

Austen-inspired touch of

elegance to your big day

1 A HISTORICAL SETTING

Set within 400 acres of rolling Surrey

countryside, Foxhills is a place where

love unfolds naturally and beautifully.

The historic Manor House and its

elegant Orangery offer a setting of

timeless romance, filled with warmth

and character. Tree-lined paths, open

lawns and hidden corners create

endless moments for Bridgertonworthy

photography, with each frame

shaped by nature and light. Every

wedding is thoughtfully tailored, with

bespoke packages, award-winning food

and a dedicated wedding coordinator

guiding every step. Many couples

choose to arrive early, for spa rituals,

elevated dining and quiet moments

together, so you can sashay elegantly

into the big day with a sense of ease

and joyful anticipation. foxhills.co.uk

2 THE PEARLS

With lower necklines and updos a

signature of Regency style, a tasteful

necklace is the perfect adornment.

This one from ORA Pearls is £460

at their new shop, The Pearl Shop

Whitstable, or at orapearls.com

3 THE DRESS

Regency brides would simply wear

their best dress – in any colour or

pattern – but as directors and costume

designers have since taken creative

license with this, you can too. Try

something with an empire line to feel

a little more Austen, but less is more

with this look, keep it comfortable and

flattering. Lace is currently trending

so you could go with something like

this Evangeline Bridal Gown by Alie

Street London – just £289 at Wolf &

Badger wolfandbadger.com

4 THE RING

Floral designs in gold were favoured

in this time period so consider

something like this pre-loved yellow

gold and diamond ring available for

£1,595 at shopprestige.com

5 THE ACCESSORIES

Complete your Bridgerton bridal look

with a pair of long white gloves. These

are from Dents, an English brand that

has been going since 1777, and thus

the perfect place to find a traditional

pair. £20 at dentsgloves.com

6 THE DRESS CODE

Let your guests know that hats are

more than welcome and they can all

enjoy your theme too. This timeless,

elegant one by Mille Fleurs features a

stunning gold flower spray handmade

from delicate organza, for a luxurious

and soft shimmer. It is £645 at

millefleurs.uk

7 THE INVITES

These Beatrice invites by Feel Good

Invites are elegant and classic and the

stick-on wax seals are brilliant for

a 19th century feel with modern

convenience, plus you can even

get them personalised with your

initials. feelgoodinvites.com

59


7 steps to...

RomCom

Contemporary

If you’re looking to have a good time with plenty of laughs, take

a contemporary attitude that doesn’t take things too seriously

and instead focuses on making the big day a fun day

1 THE VENUE

To star in your very own rom-com,

a modern customisable venue will

allow you to add plenty of personality.

Set along a quiet rural lane in

Rotherfield, East Sussex, Briar House

Barns balances generous scale and

understated elegance. At its heart is

The Great Barn, a contemporary

blank canvas with floor-to-ceiling

windows, neutral tones and classic

lighting for a modern yet bright and

welcoming space. It’s very versatile –

equally suited to intimate gatherings

and larger celebrations. An 80-foot

terrace and sweeping lawns open the

space up to 40 acres of open farmland,

a picturesque backdrop with views

across the High Weald. Ceremonies

can be held in a characterful Stone

Barn or at two outdoor locations.

Family-run with a highly experienced

team, Briar House Barns is the place

for an individual day with thoughtful

guidance and care at every stage of

the journey. briarhousebarns.co.uk

2 THE INVITES

Start things off with the right tone

with some colourful and playful

invitations. These Retro ones from

Feel Good Invites are just the ticket

– literally! feelgoodinvites.com

3 THE TREATS

For extra fun be sure to get your

friends involved. These Laines London

slippers come with bridesmaid

brooches – perfect for a hen do or

for getting ready for the wedding,

and your friends can keep them and

remember the big day long after it’s

over. £59 at wolfandbadger.com

4 THE DRESS

Our fun-loving brides need something

comfortable to move in that will

look amazing as they dance the night

away. Go for something like this

effortlessly cool Parker dress by E&W

Couture. It’s stocked at Vicki’s Bridal

Boutique, Tenterden. vickisbride.co.uk

5 THE ACCESSORIES

For whimsical accessories check

out British luxury designer Sophia

Webster. This gorgeous Cleo ivory

marble Perspex bag will come in

handy for keeping a spare bit of

makeup, phone and maybe a little

snack! £450 at sophiawebster.com

6 THE DANCING SHOES

While the bride is dancing her

way through the reception she

needs some comfy footwear to

keep her smiling. Opt for bridal

trainers like these Jimmy Choos

to make them both wearable and

special. £525 at net-a-porter.com

7 SECOND HAND SPARKLES

Modern couples are often looking to

shop pre-loved – from dresses and

suits to decorations and accessories.

These morganite and diamond drop

earrings are a lovely touch of colour

and are £1,495 at shopprestige.com

Francesca Hill Photography


60

Your Perfect

Barn Wedding

Awaits

Nestled in the Surrey Hills,

Gildings Barns offers a

stunning rustic setting for

your unforgettable day.

gildingsbarns.co.uk

Say “I do”

to a Foxhills fairytale

Celebrate your special day at Foxhills Club & Resort.

Nestled within 400 acres of beautiful Surrey

countryside, Foxhills has over 50 years of experience

creating dream weddings.

Exchange vows in our timeless 19th-century

Manor House or charming outdoor gazebo, before

celebrating with your loved ones in the elegant

Orangery or modern Clubhouse.

Book your wedding between January and March

2026 and enjoy two complimentary enhancements of

your choice. Terms apply.

From Foxhills to forever.

Stonehill Road, Ottershaw, Surrey, KT16 0EL

foxhills.co.uk/weddings | 01932 872050 | #WhereYouBelong

61


The wonderful thing

about Cotchford

Words: Jo Arnell Photographs: David Merewether


62

Previously home to Winnie-the-Pooh author A. A. Milne and Brian Jones of The Rolling

Stones, Cotchford Farm certainly has a story or two to tell. After an extensive and sensitive

refurbishment by its current owners, the house is now available as a holiday rental for

groups and families who wish to experience the magic of Ashdown Forest (The Hundred

Acre Wood) and the surrounding area, with Pooh Sticks Bridge a brief stroll away

Cotchford Farm is an old

building and the fact that it

once belonged to not just one

but two iconic figures from the last

century makes taking it on a daunting

prospect. You are not just restoring a

home, but preserving a notable piece of

cultural history. Such was the situation

the current owners and their family

found themselves in. “We had been

looking to relocate from London,”

they explain, “After two years of

searching, we got the train down, met

the owners and went from there.”

In 1924 another family had fallen

under Cotchford’s spell, also looking

for a retreat, somewhere soothing to

escape to from their busy London life.

This was once A. A. Milne’s country

home, where he and his family lived

for over 30 years, where he wrote

Winnie-the-Pooh, and other stories, and

where – forty years later – Brian Jones

of The Rolling Stones met his untimely

end. This house is right on the edge of

Ashdown Forest, aka The Hundred Acre

Wood. We are on hallowed ground.

Milne’s son Christopher Robin

remembered arriving there all

those years ago, little knowing the

effect it would have on their lives,

but sensing how special the house

and the surroundings were:

“Cotchford was different. Cotchford

was ours, and on an autumn morning

we drove down to take possession.

No, I have got it wrong. It was

Cotchford that took possession of us.”

From Christopher Robin’s

memoir Enchanted Places

63


TICKETS

ON SALE

wealdentimes-fair.co.uk

Wealden Times

Midsummer

Fa i r

wealdentimes-fair.co.uk

SUMMER SHOPPING EVENT

11th-13th JUNE 2026

Hole Park, Rolvenden, Kent TN17 4JB

£2 off

each ticket*

QUOTE CODE

‘SHOP26’

when

booking

*Adult tickets only

Previous pages: The impressive oak

panelled dining room is perfect for family

gatherings Above: Comfy seating gathers

around a large inglenook in the drawing

room. Little pops of colour come courtesy

of stained glass windows on the back wall,

installed during Brian Jones’ occupation

Right: An informal dining area is to one

side of the drawing room. Books and curios

relating to A. A. Milne are displayed in the

custom-made book cases Below: Winniethe-Pooh

illustrations line the hallway

Cotchford Farm is Grade II listed, with

obvious historical significance. “The

original structure was built around

1540,” the current owners say. “The

house was progressively added on to

over the years. It went horizontally at

first, and then ended up as a U-shaped

dwelling.” Timber framed, with red brick

infill on the ground floor, where once

there was wattle and daub, the main part

of the house is three storeys high, with

a double height wing and single storey

kitchen extension – making the quirky

U-shape around a small courtyard.

“At the turn of the century the

building was occupied by multiple

families. Then came A. A. Milne

and it became a single family

dwelling during Milne’s tenure.”

Inside, the house has a split-level

drawing room with inglenook fireplace,

and views over the garden to the east and

south and the courtyard to the north.

There is also an oak-panelled dining

room on the ground floor. Upstairs are

six bedrooms, four on the first level

and two above on the second floor.

The Milnes carried out a substantial

amount of work during their time,

adding the kitchen and refurbishing,

in order to create a family home.

65


Fitted Furniture expertly made

Beautiful gates

Handmade for you

Your entrance, Your way.

When it comes to deciding on a new gate for your

property, one size does not fit all. A bespoke gate

design tailored to your property’s unique character

is key. So if you are considering a new gate for your

property we look forward to hearing from you.

On-site consultation Bespoke design

Fabrication Installation After care

For your gate consultation or for more information

call us on 01233 720 074 or email info@pqfassured.co.uk

PQF Assured, Goodcheap Farm, Goodcheap Ln, Ashford, TN25 5NS

www.pqfassured.co.uk

Richard Wigdahl Furniture,

specialising in bespoke fitted

cabinetry, kitchens, bookcases,

wardrobes, free standing

furniture and storage solutions.

Full service from concept

through installation

Get in touch for a personal

consultation and quote

07775 694 657

wigdahlfurniture@gmail.com

RICHARD

WIGDAHL

FURNITURE

RICHARDWIGDAHLFURNITURE

We lighten beams

without mess,

dust or damage.

07494 130270

Info@beams-renovation.com

www.beams-renovation.com


66

This page: The well-equipped kitchen

is perfect for cosy, informal breakfasts

The swimming pool was installed

by the next owners and, after that,

Cotchford was bought by Brian

Jones. In true psychedelic fashion,

Jones installed coloured lighting and

replaced some of the windows with

stained glass. He lived here during a

tumultuous time, that saw his split

from the band, and met his tragic end,

drowning in the pool aged just 27.

Unfortunately the materials used

to repair and update the house in the

twentieth century were doing more

harm than good to its structure and

the house was run down when the

current owners took possession. “The

house had lovely flow with a wholesome

feel,” they explain. “The gardens were

beautiful, but the house needed lots of

TLC. We bought it because we loved

it, but we invested in a significant

undertaking – we are cultural custodians

as much as owners of this place.”

It was clear that if they were to

preserve the house for posterity, a

major refurbishment would be needed.

“We spent a long time planning

67


This page: The downstairs loo, painted a deep

navy is home to a sizeable stone basin. There are

nods to Brian Jones throughout the house

“We bought it because we loved

it, but we invested in a significant

undertaking – we are cultural custodians

as much as owners of this place”

the restoration, so that it could be

preserved for generations to come. We

had to undo a lot of damage. After

two years contemplating we rolled

up our sleeves and set to work.”

They installed underfloor heating,

replaced floors with reclaimed wooden

floorboards and replaced cement with

lime mortar to help the building

breathe. The exposed beams were iceblasted,

a process required as part of the

listing, that freezes and cleans the beams,

then uses air to extract the debris. They

rewired and re-plastered, then painted

throughout with breathable paints

and distemper, in soft and understated

colours of muted tones, mainly from

Farrow & Ball and Earthborn.

It is easy to skip through these

endeavours in a sentence or two, but

in reality this sort of work entails

channelling into walls, making dust,

mess and general upheaval – for

weeks on end. Added to this is the

fact that in an old house you often

uncover more that needs to be done,

or undone, or redone, in the process

– “once you tug on one thing it’s

like an old jumper unravelling”.

The current owners project managed

the whole restoration, with the help

of Andy and his team at St. Pierre

Contractors, preserving what they could

from the occupation of both A. A. Milne

and Brian Jones. “Some things from the

time of the Milnes still survive – there’s

a gilded hand painted cupboard door

that’s been repurposed for a wardrobe

in what was once A. A. Milne’s wife

Daphne’s bathroom, but unfortunately

there were a number of items that were

beyond repair.” A few features from

Brian Jones’s days have been retained,

although sadly he didn’t own the house

for very long. “There are glimpses of

them, but anything too damaged or

not appropriate has been sealed within

the fabric of the house for posterity.”

“We have a small amount of

furniture that we’ve curated,” the

owners continue, “a few pieces


68

CLARK’S

Amtico Specialists

Clark’s carpets, fine floor coverings and rugs

No more draughty, rotten,

inefficient sash windows

d.clark@clarkscanterbury.com

10%OFF

ALL RUGS

Canterbury 12 Roper Road, CT2 7EH, 01227 788588

Whitstable 89 High Street, CT5 1AY, 01227 772774

www.clarkscanterbury.com

Using revolutionary 10mm thick

double glazed units we can retro

fit sash windows, retaining the

original appearance but with

the benefits of double glazing.

Improve insulation

Save money on heating bills

Call 01892 532273 for a

FREE site survey & quote sashwindowheritage.co.uk

SashWindowHeritageWT187.indd 1 15/08/2017 15:18

ClarksRugNationWT205.indd 1 06/02/2019 14:55

A Kentish Manor House,

featured in our

Fine Art & Interiors Sale,

Auctioneers since 1929

10 March

Free, no-obligation

valuations of fine art,

furniture, jewellery,

ceramics & Asian art

01273 472 503

www.gorringes.co.uk

clientservices@gorringes.co.uk

69


Trrrrrraaaadddddiiiiiiiitttttiiiiiiiioooooonnnnnnnaaaall

&

Jooooooiiiiiiiinnnnnnneeeeeeeerrrrrryy

uuuuunnnnnnniiiiiiiiquuuuueeeeeeee

Haaaannnnnnnddddd-cccrrrrrraaaafttttteeeeeeeeddddd,

dddddeeeeeeeessiiiiiiiignnnnnnneeeeeeeeddddd tttttoooooo

ppiiiiiiiieeeeeeeeccceeeeeeeess

Fuuuuurrrrrrnnnnnnniiiiiiiitttttuuuuurrrrrreeeeeeee

wwwwwwwww...dddeaaaccoonnnaaannndddssaaannndddyss...ccoo...uk

cccoooooommmpplliiiiiiiimmmeeeeeeeennnnnnnttttt yyoooooouuuuurrrrrr hoooooommmeeeeeeee.

SSiiiiiiiinnnnnnnncccccceeeeeeee 1978,,,, Deeeeeeeeaaaaaaaaccccccoooooooonnnnnnnn & SSaaaaaaaannnnnnnndddddddyyyysssssss

haaaaaaaavveeeeeeee beeeeeeeeeeeeeeeennnnnnnn ccccccrrrrrrrreeeeeeeeaaaaaaaattttttttiiiiiiiinnnnnnnng dddddddiiiiiiiisssssssttttttttiiiiiiiinnnnnnnnccccccttttttttiiiiiiiivveeeeeeee,,,,

ttttttttrrrrrrrraaaaaaaadddddddiiiiiiiittttttttiiiiiiiioooooooonnnnnnnnaaaaaaaalll jjooooooooiiiiiiiinnnnnnnneeeeeeeerrrrrrrryyyy aaaaaaaannnnnnnnddddddd fuuuuuurrrrrrrrnnnnnnnniiiiiiiittttttttuuuuuurrrrrrrreeeeeeee,,,,

ttttttttaaaaaaaaiiiiiiiillloooooooorrrrrrrreeeeeeeeddddddd ttttttttoooooooo oooooooouuuuuurrrrrrrr ccccccllliiiiiiiieeeeeeeennnnnnnnttttttttsssssss nnnnnnnneeeeeeeeeeeeeeeedddddddsssssss.

Caaaaaaaallllll uuuuuusssssss ttttttttoooooooodddddddaaaaaaaayyyy ttttttttoooooooo dddddddiiiiiiiisssssssccccccuuuuuussssssssssssss yyyyoooooooouuuuuurrrrrrrr

oooooooownnnnnnnn

prrrrrrrroooooooojjeeeeeeeecccccctttttttt aaaaaaaannnnnnnnddddddd rrrrrrrreeeeeeeequuuuuuiiiiiiiirrrrrrrreeeeeeeemeeeeeeeennnnnnnnttttttttsssssss,,,,

oooooooorrrrrrrr ttttttttoooooooo booooooooooooooooN aaaaaaaannnnnnnn aaaaaaaappooooooooiiiiiiiinnnnnnnnttttttttmeeeeeeeennnnnnnntttttttt aaaaaaaatttttttt

oooooooouuuuuurrrrrrrr prrrrrrrreeeeeeeemiiiiiiiissssssseeeeeeeesssssss iiiiiiiinnnnnnnn 5oooooooolllvveeeeeeeennnnnnnndddddddeeeeeeeennnnnnnn

Keeeeeeeennnnnnnntttttttt.

-01580 243331- -info@deaconandsandys.co.uk-

AMERICAN

LAUNDRY

HOT DEALS!

LOOKING FOR SOME LARGER

LAUNDRY OPTIONS?

Look no further!

We supply new & new graded

commercial laundry at discounted prices

112, Pattens Lane, Rochester, ME1 2RA | 01634 847473

www.evansappliances.com


70

This page: The spacious principal bedroom with its luxurious en suite

“We undertook a full restoration of the bedrooms and they now have integrated en

suites,” say the current owners. One of the bathrooms is particularly resplendent,

but it looks as if it might have been a bit of a challenge to install. “Ah yes, the

main bathroom was expensive – we elected to implement a high-end design

into a quirky space – it was the hardest room in the house,” they smile.

provide stylistic content for the house.

Interesting little things – photographs,

first edition Milnes... We bought

all his biographies and did lots of

literary research on both Milne and

Brian Jones in order to get it right.”

It is important to the current owners

and their family that the house is a

home, rather than a museum or shrine

to the Milnes or to Brian Jones, but

they also wanted to showcase some

of the essence of these prestigious

occupants for visitors to Cotchford,

because, for the moment at least, the

house and grounds are available to rent

as luxury holiday accommodation.

On the ground floor the dining room,

kitchen and bathroom were left more

or less as they were. “The kitchen was

fully functional, it just needed decorative

changes, but the drawing room was

two rooms – there was originally a

doorway next to the staircase and at

the end of the corridor through which

71


This page: The bedrooms cover two floors, with staff accommodation at the top of the house – one bedroom originally for the cook and one for the

nanny. The current owners used local craftspeople where possible to add extra bathrooms, whilst preserving the charm and history of the rooms

you could enter A. A. Milne’s study and the drawing room.

The drawing room/study is now a large open space, with

the library at one end and a cosy fireplace at the other. “We

re-inserted the wall posts and reinstated what we could to

demarcate A. A. Milne’s study, where he wrote many of his

books, poems and plays,” the current owners explain, “but

we needed to maintain the space as modern and functional

too.” From there you go up the stairs, but perhaps you’ll sit

for a while halfway up, because these are the very stairs that

inspired Milne’s famous poem, Halfway Down the Stairs.

The bedrooms are arranged over two floors. “On the first

floor is Christopher Robin’s, A. A. Milne’s bedroom and the

principal suite, which was Daphne’s.” On the top floor there

were originally two bedrooms, for staff – the cook and the

nanny. These have now been turned into bedroom five. The

attic area was reserved for Christopher Robin’s woodcraft.

“We undertook a full restoration of the bedrooms

and they now have integrated en suites,” say the current

owners. One of the bathrooms is particularly resplendent,

but it looks as if it might have been a bit of a challenge to

install. “Ah yes, the main bathroom was expensive – we

elected to implement a high-end design into a quirky

space – it was the hardest room in the house,” they smile.

No expense was spared here though – bathing luxury is

important when you are on holiday. “This bathroom was

installed with the support of West One Bathrooms and

there are Catchpole & Rye pieces throughout the house.”

The owners were keen to use local craftspeople whenever they

could. Local craftsman and bespoke furniture maker Ian Parker

made the main bookcase for the library and there is a collection

of fabrics by Molly Mahon, the talented textile designer and

printmaker (who lives in nearby Forest Row), throughout the house.

Outside there are extensive grounds with access into

Ashdown Forest at the end of the lane. The gardens cover


Discover Sunshower

Pure infrared indulgence

Bathrooms. Steam. Sauna.

Design. Supply. Install.

01732 350911 | townsbathrooms.co.uk

TB061g Towns Wealden Times full page ad (210x297) Dec25 aw.indd 1 12/11/2025 12:18

Dreaming of your

perfect garden?

Make your ideas a reality

with help from our April

issue Gardens Supplement


This page: There is a collection of fabrics by Molly Mahon (who lives

in nearby Forest Row) throughout the house. A roll top bath fits neatly

under the eaves on the top floor

Imagine being able to sit in A. A. Milne’s

study, sleep in Christopher Robin’s bedroom,

rest halfway down the stairs...

nearly two acres. There are terraced

formal gardens near to the house,

leading out towards three acres of

forest. In total the holding is 15 acres

including three fields and a stable block.

The gardens are a credit to Daphne

Milne who commissioned the design

from a local landscape architect

(Raymond Berrow from Wadhurst)

and together with Daphne and her

gardener they installed and maintained

truly lovely grounds. “Daphne was

the driving force behind the gardens,”

say the current owners. “Within them

some things remain – the sundial

and statue of Christopher Robin and

an owl statue – but a large number

of artefacts were stolen when Brian

Jones passed.” Apparently hordes

of people descended on the house

and carried away mementoes.

“We have worked hard to preserve

the gardens with the different sections

and have expanded them with the

addition of a tennis court and wild

flower meadow – and we’ve embraced

a small tributary as a water feature.”

The river Medway tributary borders the

property to the south and the iconic

‘Pooh Sticks Bridge’ is just along the

road, still in existence and available for

endless happy games of Pooh sticks.

Ashdown Forest is as big a part of the

Winnie-the-Pooh legacy as Cotchford

House is. The current owners continue

to collaborate with the Conservators

of Ashdown Forest and The Ashdown

Forest Foundation and with local

businesses – such as Pooh Corner

Café, where Neil the owner also has

the “Poohtorium” for those wanting

an extra dose of all things Pooh.

Well over a million people flock

from all over the world to visit every

year – and looking after an ancient

forest landscape takes upkeep and

stewardship. The current owners are

working with Ashdown Forest to host

an open gardens event in aid of the

Forest for the centenary of Winnie-the-

Pooh in 2026. This will be an important

fundraiser and all profits will go to The

Ashdown Forest Foundation. “We try to

work carefully and collaboratively with

the conservators. It’s a partnership.”

It is clear that the current owners

and their family have a firm intention

to look after the house and its

surroundings and to do their best to

support their like-minded neighbours

– which includes the many devotees

of A. A. Milne’s creations and the

legacy of rock legend Brian Jones.

75


This page: A Crittal-style sliding door leads neatly into an en suite. Throughout the house contemporary furnishings and lighting have been

mixed with traditional to complement the charm of the building’s original features. A statue of Christopher Robin and a Winnie-the-Pooh

sundial can be tracked down in the expansive gardens

“We purchased the house as our family home,” say the

current owners, “and it is our intention to return to the

district, but in the meantime we are delighted to be able

to offer the property for short term experience rentals so

others can also enjoy the magic of Cotchford Farm.”

You are invited to stay at Cotchford and to experience

what it is to live in Pooh country. Imagine being able

to sit in A. A. Milne’s study, sleep in Christopher

Robin’s bedroom, rest halfway down the stairs... To

share in the enchantment and enjoy a small piece

of literary history in the privacy of this beautifully

restored home is a magical thing. Tiddely pom.

Address Book:

To find out more about immersing yourself in the world of

Winnie the Pooh by booking a stay at Cotchford Farm, see

cotchfordfarm.com.


Get the

LOOK

1 Albany clear glass schoolhouse 10 Inch pendant light with brass holder £169 Industville industville.co.uk

2 Peacock Navy dark blue paint £44.95/2.5l Victory Colours victorycolours.co.uk 3 W3-014 2-Arm Denton wall

light with medium backplate £690 Besselink & Jones besselink.com 4 Gold Nordborg mirror £50 JYSK jysk.co.uk

5 Lazenby corner sofa from £1,299 SCS scs.co.uk 6 Denim Blue sheep wool cushion £45 J.J. Textile jjtextile.co.uk

7 Newham Chesterfield armchair with real brown leather seat and wooden legs with wheels £829 Where Saints Go

wheresaintsgo.co.uk 8 Timber Roble wood effect matt porcelain floor tile £17.95/m 2 Tile Mountain tilemountain.co.uk

77


M

Y

Y

Y

sponsored by

Dare to

CHALLENGE

Open Morning

Saturday 14 th March – 9.30am

Explore starting school life in Reception

Find out how joining in Year 5 sets pupils up for success

Learn about our outstanding Year 7 entry programme

Book today!

An outstanding prep school in all areas, where every child’s potential comes to life

admissions@hazelwoodschool.com

Oxted, Surrey | hazelwoodschool.co.uk

251203 Hazelwood_Absolutely London_Open Day ad_A4_Sports.indd 1 14/12/2025 15:57

The Priceless Education Supplement sponsored by

The

We’ve got the latest on education

from across the South East

Co-Education at SWPS

With thanks to St

Andrew’s Prep for our

cover image

Green Lights at Slindon College

Sir William Perkins’s School (SWPS) will open its doors

to boys from September 2026 as the school begins their

journey to full co-education. This Chertsey school delivers

exceptional education for ages 11–18. In 2025, 85% of

GCSE grades were 9–7 and 86% of A Levels were A*–B.

Boys will initially join years 7 and 12 (and applications

to do so are now open) with plans to progress to being

fully co-educational by 2030. This decision has been

made to create a more inclusive community to reflect the

modern world. Book March Open Mornings to discover

how SWPS helps every student thrive at swps.org.uk

At Slindon College young people are inspired

to excel in science, technology, engineering and

maths through a unique challenge: to design, build

and race an electric car. Through UK charity

Greenpower Education Trust, pupils compete at

Greenpower events, including at nearby Goodwood

Motor Circuit. This year, their two electric-powered

Greenpower cars both achieved top-ten finishes in

their races, with a particular highlight being 2nd

place in the F24 race at Dunsfold Park. At the

Greenpower International Final, Sixth Form car

Lightning 1 recorded the fastest lap time out of 180

cars and went on to secure an impressive 8th place

overall. F24 car Burby also performed strongly,

finishing 11th out of 80 in its race. slindoncollege.co.uk

New Sports Facilities

at Tormead School

Tormead School celebrated a historic milestone

with the official opening of its new Urnfield Sports

Ground in September. The day featured a primary

school hockey festival with over 80 pupils from four

local schools, football and athletics fixtures with

partners Guildford County School, and exhibition

matches alongside Guildford Hockey Club. Olympians

Marilyn Okoro and Kate Richardson-Walsh officially

opened the state-of-the-art facilities which include

a six-lane athletics track, cricket nets, as well as

hockey and football pitches. tormeadschool.org.uk

83


sponsors The Priceless Education Supplement

Delight for Surrey Success

in Arts-based Learning

TASIS Celebrates Fifty Years

Celebrating 50 years this year, TASIS England

inspires students from over 70 nationalities to become

curious, confident, and globally-minded. Founded by

visionary educator Mary Crist Fleming, the Surrey

campus blends historic charm with modern facilities

and London accessibility. Small classes, rigorous

academics (International Baccalaureate Diploma

Programme, Advanced Placement courses, and a

broad American-based academic program), plus 50+

co-curricular activities, foster creativity, leadership,

and life-long friendships. Discover TASIS England

for yourself – explore their campus, meet inspiring

teachers and students, and see where ambition,

curiosity, and global perspectives come to life.

There will be an Open Day on Saturday 7th

March from 9.30am to 12.30pm. Visit the website

to learn more about life at an international

school and to book your place on the open day.

Alternatively you can arrange a personal tour,

make an online appointment with the admissions

team or watch a webinar from the comfort of your

own home. Find out more at tasisengland.org

Leading arts-based learning charity, Delight, is

celebrating another successful year. The charity’s

Impact Report: Levelling the Playing Field, released

this week, shows how thousands of Surrey pupils across

26 schools have benefitted from dance, drama, art and

storytelling programmes. Their approach of partnering

with professional artists, providing vital teacher training

and focusing on inclusion could provide a tested model

to encourage schools to utilise the transformative power

of the arts to achieve outcomes in engagement with

learning and wellbeing.

Delight has spent the last decade developing

programmes that not only positively impact children

facing multiple disadvantages but also support

educators, providing them with the confidence to be

able to teach creative lessons and learn the skills to

help embed creativity across the rest of the curriculum.

In partnership with professional actors, dancers,

artists and storytellers, the charity delivers joyful and

inspiring sessions that are specifically designed to level

the playing field for all children, including those with

SEND. Find out more at delightcharity.org.uk

Celebrating 450 Years of

Sutton Valence School

At the end of November, Sutton Valence School marked

its 450th anniversary year with the launch of To 450

& Beyond, a beautifully produced coffee-table book

celebrating the school’s rich history and enduring spirit.

Guests enjoyed a photographic exhibition and selected

readings, delivered by academic scholars and Heads of

School, bringing stories from across the centuries vividly

to life. Author Richard Harvey (1963 Co) shared insights

into the inspiration behind the book, before the evening

concluded with drinks and conversation in the Theatre

foyer. The book sparked fond memories and lively

discussion, reflecting 450 years of tradition, community

and ambition. svs.org.uk


84

Broadening horizons.

Since 1576.

OPEN MORNINGS

SATURDAY 7 MARCH 2026 (11-18)

COME AND VISIT

BOOK

FRIDAY OPEN

13 MORNINGS

MARCH 2026 ONLINE

(2-11)

SVS.ORG.UK/ADMISSIONS

BOOK ONLINE

CO-EDUCATIONAL DAY & BOARDING SCHOOL FOR PUPILS AGED 2-18

85


Open Mornings

Nursery & Pre-Prep: Friday 8 May

Junior School: Saturday 9 May

Senior School: Saturday 16 May

Co-educational, day, flexi and full boarding for pupils aged 3-18

Wealden Times_King's_February 26.indd 1 07/01/2026 10:22:54


Softly

Softly

We hear about the

importance of soft

skills and wellbeing

“Pupils publish

original poetry and

fiction in Mind’s Eye,

the School’s in-house

creative writing

magazine, providing

a platform for literary

expression and

imaginative thinking”

At The King’s School

Canterbury...

the development of soft skills is woven

seamlessly into school life, reflecting

a belief that academic excellence and

personal growth go hand in hand.

An exceptionally broad curriculum,

with 33 A Level subjects and 32

at GCSE, encourages intellectual

curiosity and adaptability, while a rich

programme of academic enrichment

builds confidence, independence and

clarity of thought. Essay competitions,

research symposia, Oxbridge-style

tutorials and visiting lectures invite

pupils to test ideas, refine arguments

and engage thoughtfully with others.

For Sixth Formers, the opportunity

to gain the ILM Level 3 Leadership

and Management qualification adds

a distinctive dimension, developing

strategic thinking, ethical leadership

and real-world project skills.

From Year 9, the Global Perspectives

course introduces pupils to ethical

reasoning and informed debate through

contemporary global issues such as AI,

migration and climate justice. Oracy

is a defining strength of the King’s

experience, with every pupil taking

part in debating, public speaking

and quizzing. Success in national

competitions sits alongside everyday

classroom discussion, ensuring these

skills are developed across all ages and

abilities. Creativity is equally valued.

Pupils publish original poetry and

fiction in Mind’s Eye, the School’s

in-house creative writing magazine,

providing a platform for literary

expression and imaginative thinking,

while aspiring scientists present original

research at the Young Scientists Journal

Conference hosted at King’s.

Beyond the classroom, an extensive

co-curricular programme of sport,

music, drama and service develops

teamwork, resilience and self-belief,

supported by strong pastoral care

and PSHE. Pupil voice is given real

weight through the King’s Council and

initiatives such as the Pupil Futures

Fair, which offers practical experience

of CV writing, interviews and

professional communication. Together,

these experiences prepare pupils to

leave King’s as confident, articulate

and reflective young people, ready to

contribute with purpose in the wider

world. kings-school.co.uk

87



At Hilden Grange...

giving brings more in return than you

might imagine.

At a time when the cost of living

makes parents question whether

independent schooling offers real

value, it is worth reflecting on what

we truly value. Naturally, we want

our children to thrive. Academic

achievement matters, and Hilden

Grange has long delivered excellent

11+ results and impressive scholarships

across academics, sports, and the arts.

But success doesn’t come from hothousing

or endless drilling. Children

cannot flourish in that environment.

While regular monitoring and

assessment are essential, there is

another, often overlooked ingredient

“Acts of generosity boost dopamine and serotonin,

enhancing wellbeing and performance.”

that propels pupils further: happiness.

Happy children are motivated,

resilient, and willing to take the

risks that lead to growth. They feel

supported by those around them and

strive confidently toward their goals.

One powerful route to happiness

is giving. Acts of generosity boost

dopamine and serotonin, enhancing

wellbeing and performance. At

Hilden Grange, giving is woven into

school life. The School Council not

only voices pupils’ ideas but leads

initiatives supporting the wider

community—from packing donations

for the Sustain foodbank to collecting

toys for the Mayor’s Appeal. Their

excitement in giving is unmistakable.

Even Hildy the tortoise, created for

the Tonbridge Town Trail, symbolises

this joyful community spirit.

Embedding giving into a school’s

culture creates a virtuous cycle of

purpose, positivity and motivation–

fuel that ultimately strengthens

academic success.

hildengrange.co.uk


88

JOIN US FOR OUR OPEN

DAY

Friday, 13th March | 9:00am

Hilden Grange is an exceptional co-educational

preparatory school for children aged 3 to 13

located in the heart of Tonbridge, Kent.

The school ensures every child reaches their potential

www.hildengrange.co.uk

1212656549875806 - Hilden Grange School - Press Ad-V3.indd 1 2026/01/08 16:39

Wheeree exceptional

meeeets outstanding

DOYRMS

KENT

education

opportunities

BECOME A DUKIE

A co-educational school for students aged 11-18-years

www.doyrms.com | +44 (0)1304 245073 | admissions@doyrms.com

See why families are calling us great value for money

wealden ad_jan 26_185x130mm_PR.pdf 1 14/01/2026 14:48

C

M

Y

CM

MY

CY

CMY

K


90


How do

they do it?

When it comes to sport, some

schools just seem to have the

magic to set them on a winning

streak, so we’re asking some of

the best to tell us how it’s done

Millfield

First up to bat, Millfield is one of the largest

co-educational boarding and day schools in

the UK and winner of the co-educational

independent school of the year 2024. This

school is synonymous with sporting prowess

so let’s find out what they’re up to! Learn

more about Millfield at millfieldschool.com

All About

the Staff

Going

Swimmingly

Millfield Swimming has supported the

journey of 33 Olympians in its short

history, and has had a swimmer at

every Olympics since 1968 including

champions like Duncan Goodhew,

Mark Foster and James Guy.

Strength in

Numbers

300 students compete

at regional standard each

year

60 students compete at

youth international level

each year

30 different sports to

take part in

50m pool chosen by

Olympians training for

Paris 2024

14 Millfield athletes

and coaches took part in

the 2024 Paris Olympics

7 Olympic medals were

brought home

Stabling for 90 horses at

the equestrian centre

The Millfield sports staff boasts...

14 full-time Heads of Sport

200 sports staff

5 Olympians

A combined 1,850

years of coaching experience

90% hold the highest

qualification in their sport

29% work for their

National Governing body

12 UEFA A or B licensed

coaches – offering the same level

of expertise you would find in an

EFL Championship academy

US Success

29 students gained

scholarships at prestigious US

universities in 2025, including

notable colleges:

University of Chicago

Stanford

Columbia University

Cornell

Duke

UPenn

The University of Florida

Princeton

9% of

NCAA athletes

are from

Millfield



Sacred Heart

Early Kick

Off

Sport is thriving at Sacred Heart School, Wadhurst!

Boys and girls achieve a high

level of skill under the excellent

direction of our specialist games

teacher.

From the Foundation Stage,

carefully planned activities

enable the children to improve

co-ordination and proficiency in

basic skills which are transferred

into games situations as they

progress through the school.

We play matches regularly

against other schools in the area

and we enter teams in festivals,

tournaments and competitions

locally and further afield as

members of the ISA. Year 5 and

6 have their fixtures weekly on

Wednesdays and year 3 and 4

on Thursdays. All the children

in these years get to experience

matches.

sacredheartwadhurst.org.uk

The Joy of

the games

Through encouragement,

inclusive training and an

emphasis on teamwork

and enjoyment, every child

is supported to find their

place. They get 3 lessons

a week with a specialist

teacher. Talent is developed,

participation is celebrated,

and sport is truly woven into

daily school life.

Something for

Everyone

Every child benefits from specialist

coaching that nurtures confidence,

commitment and steady improvement,

even those who may initially find sport

challenging. There is a broad range of

sports available including:

• Rugby

• Football

• Hockey

• Netball

• Swimming

• Cross Country

• Pop Lacrosse

• Cricket

Winning

Attitude

Sacred Heart are immensely proud of

their achievements and look forward to

further success in netball and rugby in

the new year. These accomplishments

reflect more than sporting ability. Recent

wins include...

• The girls’ U11 football team were

crowned ISA National Champions

before going on to win the Girls

North Wealden Football title,

securing their place in the District

Finals in January.

• The boys’ U11 side have qualified

for the National Finals at St George’s

Park in March.

• Boys 5 a side football team qualified

for the National Finals putting them

in the top 16 in the entire country

• Bronze medal at the ISA National

Skiing Competition

• 11/10 Girls North Wealden

Football. A massive 1–0 victory over

Ashdown at the final! They will go

to district finals late in January

• On Tuesday 30th September, Sacred

Heart girls made history at the ISA

Girls U11 Football Festival, hosted

at LVS Ascot. Final Result: Sacred

Heart – ISA U11 Girls Champions

2025!

• This season has also been highly

successful for their netball teams,

with both the U11 and U9 squads

winning their tournaments at the

Webster Cup hosted by Battle

Abbey, proudly bringing home the

trophies in their respective age

groups.


92

Book your place on a tour:

01892 783414 admin@sacredheartwadhurst.org.uk

DISCOVER

BOOK NOW

OPEN DAY

29 APRIL

A school where every child is happy

100% of children and 100% of parents agree

(ISI Inspection Report 2025)

High adult-to-child ratio

Small classes with full time Teaching Assistants

in every class

A nurturing environment

Every child is known, valued and supported

Strong academic outcomes

Our Kent Test average score this year was 392,

a range of scholarships are awarded every year

Wide range of extra curricular activities

Including Bushcraft, Coding and STEM

Sport and Performing Arts opportunities

Including Regional and National Tournaments,

LAMDA, ABRSM exams

Thriving Little Hearts Nursery

Fantastic, purpose built facilities, from 2yrs old

www.sacredheartwadhurst.org.uk

2026 ADMISSIONS

NOW OPEN

Day | Boarding | Co-Educational | Ages 11-19

Nestled in 150 acres of Kent countryside, yet

only 30 minutes from Central London.

Our school blends heritage, ambition and

opportunity.

With full-time places, immersion programmes,

and short-stay courses, we offer

flexible pathways for every learner.

JOIN US AT OUR OPEN

MORNING IN MARCH 2026

AND DISCOVER WHAT

MAKES US DIFFERENT

93


ADVERTISEMENT FEATURE

What is the best way to reduce your

exposure to Inheritance Tax?

Fiona Higgott, Partner, Wills, Estate & Tax Planning, Thomson Snell & Passmore

Inheritance Tax (IHT) is increasingly

been targeted as a way of increasing

revenue, with around £7 billion

currently being collected in a given tax

year with the intention of increasing

this by around £2.45 billion every year

by 2029-2030. So, what is the best

way to reduce your exposure to IHT?

The first thing everyone should do is

have an up to date will to prevent your

estate passing under the intestacy

rules, which often produce unintended

tax consequences.

1. How do IHT exemptions

work?

There are various exemptions to IHT.

Gifts to spouses, whether during

your lifetime or after death, are free

of IHT. Although this only applies

to those who are married or in a

civil partnership and there are some

restrictions for spouses who are not

long-term resident in the UK.

Everyone has a Nil-Rate-Band of

£325,000. You may also have a

Residence Nil-Rate Band if you are,

broadly, leaving your main home to

children or grandchildren and your

estate is worth under £2 million.

This provides an additional £175,000

allowance. These allowances can be

transferred between spouses, which

means that up to £1 million could be

passed on free of IHT to children or

grandchildren. Above these amounts,

IHT is usually charged at 40%. Be

aware that gifts made during your

lifetime can reduce the amount of the

Nil-Rate Band available on your death.

Other exemptions include reliefs

on business property (Business

Relief) and agricultural property

(Agricultural Relief). Although, from

6 April 2026, there will be a £2.5

million cap where IHT is charged on

business and/or agricultural property

at 0% and, above that, IHT will be

charged at an effective rate of 20%.

Any unused proportion of this £2.5

million allowance will be transferable

between spouses.

Any money gifted to a registered UK

charity is also exempt from IHT, and a

lower IHT rate of 36% also generally

applies to your estate so long as 10%

of your residuary estate passes to

charity.

2. Lifetime gifting and IHT

Gifting assets is a simple way to

reduce your estate. This includes

gifting property, but there are strict

rules around this including that you

cannot continue to benefit from it –

for example by still living in it. These

gifts are usually Potentially Exempt

Transfers (PETs) and will not be liable

for IHT so long as you do not die

within seven years of making them.

You can also make various gifts

outside of this seven year rule, which

will not attract an IHT charge. For

example each person can give away

£3,000 a year. It is also possible to

make regular gifts out of income,

which are exempt from IHT, but you

must be able to prove these form part

of your normal expenditure, are from

income and not capital and do not

impact your standard of living.

3. Can trusts help with IHT?

Placing assets in certain types of

trust can mean they are no longer

considered part of an estate when

it comes to IHT. Creating a trust is

a chargeable lifetime transfer so is

immediately subject to IHT if the

value settled is above your available

allowances.

If a beneficiary inherits from an

estate, but wishes to remove that

inheritance from their own estate

for IHT purposes, a deed of variation

can be used to create a trust, and the

beneficiary will potentially still be able

to benefit from the inheritance going

forward.

You can also nominate a trust to

receive death-in-service benefits or

place life insurance policies into a

trust with the funds remaining fully

available to your family should they

need them, without incurring an IHT

liability.

A Family Investment Company is a

bespoke private company, which can

be used as a tax-efficient alternative

to trusts if there is a large amount of

cash involved.

Following the October 2024 Budget,

the position regarding pensions is less

clear with the Government’s intention

that, from 6 April 2027, any unused

pension will be subject to IHT on

death.

With all of these elements, it is

essential to take expert advice. If you

have any questions, our expert team

at Thomson Snell & Passmore is here

to help. Scan the QR code for more

information.


How to Support your Child

There are many ways to help youngsters navigate school life,

here school staff give us some handy pointers

Top Tips from Churcher’s College Junior School

& Nursery for Smooth, Stress-Free Learning

Supporting your child’s learning journey doesn’t have to feel like

a battleground. As Ffion Robinson, Head of Churcher’s College

Junior School & Nursery, often reminds parents, homework

in the primary years is about building habits, confidence and

independence – not perfection. Here are some warm, practical

tips to help make learning at home more positive and productive:

1. Start with a chat

Spend a minute discussing what the task is and how your

child will know they’ve succeeded – clarity calms nerves.

2. Try a simple checklist

A short “What to do when I’ve finished” list helps children

check their own work without feeling corrected.

3. Use a timer to boost focus

Short bursts of effort can make tasks feel lighter and less

overwhelming.

4. Celebrate independence

If they don’t want help, that’s a win! Let teachers handle

accuracy - independence is half the journey.

5. Prioritise the basics

Reading, times tables and spellings matter most. If anything

else becomes too much, let the teacher know.

6. Remember the bigger picture

Homework now is gentle preparation for the increased

expectations of Year 7– not a measure of ability. With calm

routines, encouragement and realistic expectations, home

learning can become a positive part of family life.

Find out more at churcherscollege.com

95



Marlborough House Vinehall’s top tips to help

parents be involved in their child’s learning

Gone are the days of factoryproduced

children who spent each

waking hour at school reading and

copying from a black board. Times

have changed, and with the change

in time has been a shift in education

and pedagogy.

Much learning in prep schools today

is often cross-curricular and project

based. More and more schools are

attempting to teach soft skills whilst

equipping their young people with

as much academic knowledge as

they can. And with a change in the

methods of teaching has also been a

change in the involvement of parents.

Whilst once parents were nothing

more than bill payers and someone to

collect at the end of a term, a good

prep school in the 21 st century sees a

parent as a key stakeholder; a partner

in a child’s school journey. Parents

today, rightly, want to know how

their child is progressing and want

to be reassured that the school has a

good handle on their academic and

pastoral needs.

Find out more at mhvschool.co.uk

1. Trust the school

Trust that the Head and the

teachers know their craft and can

deliver what you’re paying for.

2. Talk to the school

Reach out to teachers and ask how

you can support at home. Don’t

wait for parents’ evening.

3. Show that you’re also committed

to the learning journey

Take some time to work with your

child and make statements such

as, “Wow, I never knew that.” This

shows them that learning doesn’t

stop when you finish school.

4. Be positive and supportive

Kids will have bad days from time

to time. Who doesn’t? It’s ok to

go out for pizza and pick up the

books later. Sometimes, a reset is

all it takes.

5. Be proud of your child no

matter what

The more pressure you put

on them to get it right all the

time, the less likely they are to

enjoy their learning. We all know

that engagement turns something

we have to do into something we

want to do.


Ms Justine Earl, Deputy Head

Academic at Spring Grove

School in Wye’s tips

1. Read to your children.

Most important of all, read to

them beyond the early years, even

beyond primary school if they will

let you! Sharing and discussing

texts with your child has proven

benefits such as building a rich

vocabulary, developing listening and

meaning-making skills, and helping

your child to develop confidence

in dealing with complex material.

2. Actively listen

Listen to your child as much

as possible, without the

distraction of screens.

3. Encourage your child’s curiosity

Think about the language you use;

less telling and more speculating ...

'How do we know?' 'What might

happen if...?' 'Shall we try...?

4. Work with your child's school

Attend meetings, read newsletters,

support school routines and

expectations, bring up concerns

early and see how you can work in

partnership to help your child.

Find out more at springgroveschool.co.uk

all

heroes

of their ownstory

BOOK NOW

OPEN WEEK

16th—20th

MARCH

2026

2 – 13 YEARS | DAY & BOARDING | 50–WEEK WRAPAROUND CARE FOR NURSERY-YEAR 2

mhvschool.co.uk | admissions@mhvschool.co.uk | 01580 880413

Marlborough House Vinehall, Robertsbridge, East Sussex, TN32 5JL

5486 WEALDEN TIMES 185x 130.indd 1

DISCOVER

BRILLIANCE

millfieldschool.com/open-days

Open Days

28 February

and 9 May

GIRLS AND BOYS, DAY AND

BOARDING, AGES 2-18

Millfield_SurreyHomes_Nov25_185x130_Izzzy_Bailey.indd 1 12/11/2025 09:49

97


Don’t miss our next

Education Supplement

in the June issue of

Wealden Times

For advertising opportunities,

call Andrew Boughton on

01580 236073 or email

Andrew.Boughton@priceless-group.com

A Great

Place to

Grow

Open Morning

Saturday 14 March 9.30am-12pm

Register online at www.springgroveschool.co.uk

In-person and Online Courses for…

Reception class

TEENS

KIDS

‘Stay and Play’

Friday 6 March

ADULTS

GCSE/A LEVEL

info@spangles.org

Starting in Feb 26 www.spangles.org 07534740868

Spring Grove School,

Harville Road, Wye, Kent

9-10am

01233 812337

office@springgroveschool.co.uk

Prep & Nursery

Open Morning

Saturday 7th March

Nestled in the beautiful Surrey countryside, just 30 miles from

London, Lingfield College Prep is more than just a school - it is

an inspiring place to begin a child’s educational journey.

Set in an environment that inspires growth and learning, we

empower children to develop a love for knowledge, preparing

them for exciting futures full of possibilities. Discover a school

where education goes beyond the classroom – where every

child is encouraged to dream big and achieve more.

For further information, to

book a space on our open

morning or to arrange a

personal tour, visit our

website.

www.lingfieldcollege.co.uk


98


Awesome Stuff

We hear about STEM – where

sparks fly and imaginations fire

HALLIFORD SCHOOL...

Each year at Halliford School a dedicated enrichment

week is held, including a full Robotics Day during

which students learn hands-on skills such as soldering

a PCB board and building a flashlight. They also

work with a range of robotic technologies, from

drones to bomb disposal robots, giving

them exposure to real-world applications

of engineering and programming.

A standout success story from last

year was a Hallifordian who earned

a place on the National Physical

Laboratory (NPL) summer internship

programme, one of only a small number

from 1,000 applicants. During the

placement, he worked on a cutting-edge single

electron pump project, gaining invaluable experience

in experimental research and data analysis.

STEM at Halliford is all about inspiring curiosity

and creating opportunities for innovation. Our

students achieve incredible things, from an Old

Hallifordian graduating with a First in Engineering

“We aim to create

‘WOW’ moments

that make science

come alive for

students”

from the University of Cambridge to an Upper

Sixth securing a placement at IBM. Creativity

thrives here too, with one of our Lower Sixth

students being a BAFTA Young Games Designer

finalist for two consecutive years. Even our youngest

learners take part in extraordinary projects like

AstroPi, where Year 7 students write code that runs

on the International Space Station.

At Halliford, STEM is not just a

subject, it is a gateway to the future.

Halliford places a strong emphasis

on practical science experiences.

We aim to create ‘WOW’ moments

that make science come alive for

students, leaving lasting memories and

inspiring curiosity. These activities

are designed to deepen understanding, develop

problem-solving skills, and show how science

connects to the world beyond the classroom.

For more information about the

exceptional opportunities at Halliford

School visit hallifordschool.co.uk

99



SOMERHILL STEM...

STEM at Somerhill begins in Saplings, where our

youngest learners experience engineering in its purest

form. At Forest School, children cut down a dying tree to

craft a wooden toy, learning where materials come from

and the importance of sustainability. This hands-on start

builds respect for resources and sparks curiosity about

design and construction.

As pupils progress, STEM becomes increasingly

ambitious. Reception children explore coding basics, while

Years 1 and 2 design toy cars, create spinning thaumatrope

toys and develop storage solutions for the community,

building resilience, critical thinking and collaboration.

By Prep, engineering and science take centre stage with

robotics, CAD design, Python coding and projects such

as energy-efficient homes and F1 in Schools. Supported

by expert teachers and lab technicians, pupils experiment,

innovate and embrace AI-enhanced learning. Set in 150

acres of parkland, Somerhill ensures children grow into

confident, creative thinkers ready to shape the future.

Find out more at somerhill.org

WEALDEN TIMES

STEM BOOK CHOICE

We love Lisa Rajan’s Tara Binns series published

by Collins Big Cat. ‘When Tara Binns opens her

dressing up box something exciting happens …’

These fun books – beautifully illustrated by

Alessia Trunfio – broaden horizons, challenge

stereotypes and introduce young readers to a

wonderful variety of STEM professions. There are

eighteen in the series including Big Idea Engineer,

Roving Robotics Genius, Visionary Volcanologist,

Clued-up Detective and High-flying Pilot.

They are suitable for KS2 but if your little one

is younger fear not... Tara has a little sister called

Dani who stars in another series by Lisa Rajan

written for KS1. Dani also explores careers via

her dressing up box. Titles include Dani Binns

Fearless Firefighter, Dani Binns Amazing Architect

and Dani Binns Problem-solving Plumber. You

can find out more at collins.co.uk/pages/tara-binns


100

Discover

more

We grow amazing people

Pre-School | Pre-Prep | Prep | Year 7 & 8

Tonbridge, Kent

Endless opportunities

admissions@somerhill.org | 01732 375951 | somerhill.org

A beautifully unique independent prep school for girls and boys aged 2-13

No. 1

Independent

School in

Sussex for

Value Added*

Prep School Open Morning

Saturday 14 March

9.30am to noon

Boys and girls 3 months to 13 years

IAPS – Boarding, flexi-boarding and day

To register or to book a personal visit please contact:

prep.admissions@bedes.org

T 01323 356939

bedes.org

Senior School Open Morning

Saturday 7 March

9.30am to noon

Boys and girls 13 to 18 years

HMC – Day, weekly and full boarding

To register or to book a personal visit, please contact:

admissions@bedes.org

T 01323 356609

Where every child finds joy in their

pursuit of brilliance.

Bede’s Senior School

Upper Dicker

East Sussex BN27 3QH

Bede’s Prep School

Duke’s Drive, Eastbourne

East Sussex BN20 7XL

* At Key Stage 5


What’s Next?

Sixth form is a crucial stage with decisions to be made.

We hear from two schools about how they prepare students

for their onward journey

School 1: Bede’s

At Bede’s, while we focus on a

joyful school experience, we also

recognise the need to look to the

future. We guide our pupils to

make appropriate choices and applications

for higher education via academic or

vocational pathways.

“The UCAS Specialists at Bede’s

were instrumental in my university

application process. They provided

comprehensive guidance, considering

my academic profile, desired

location, course specifics and

university rankings. The teachers

and Sixth Form team also offered

expert advice on choosing the right

universities and crafting a broad

UCAS application, including crucial

insurance choices. Essentially, they

made sure I wasn’t just guessing.”

– Sixth Former Movido

We navigate our Sixth Form pupils every

step of the way through the UCAS process

to produce timely, high quality, personalised

and competitive university applications. For

pupils looking to study internationally or

at specialist institutions, we offer tailored

guidance throughout the application

process. Bede’s leavers pursue a wide and

diverse range of destinations, securing places

at top institutions globally.

A significant number attend Russell Group

universities. Reflecting our strengths,

many also progress to specialist colleges

for Creative and Performing Arts, such

as Rambert School of Dance, various Art

Foundation courses, and sports-focused

degrees. The true measure of success is

the diversity of subjects chosen, spanning

traditional fields like Economics and

Mathematics to vocational degrees like

Architecture and Veterinary Nursing.

We actively promote the benefits of

apprenticeships, including degree level,

and in recent years have seen pupils

progress onto degree apprenticeships with

organisations such as Ernst & Young,

PriceWaterhouseCoopers, and Rolls Royce.

We create inspiring opportunities for pupils

to engage with local and national employers

from a diverse range of industries. We do

this via profession focused seminars, events

and trips throughout the year, and by

holding our flagship annual Universities

and Careers Fair.

We take time to understand each pupil’s

individual strengths and qualities when

exploring future career paths, to provide

meaningful and bespoke career action

plans throughout their Sixth Form

journey. We start the UCAS application

process in earnest in the Spring term

of the Lower Sixth, with applications

submitted by Christmas of the Upper

Sixth, to ensure pupils’ applications are

well researched and considered, and they

have taken the opportunity to develop

academic enrichment opportunities such

as masterclasses, university taster seminars,

work experience and industry insight events

for a competitive application. We encourage

pupils to attend open days where possible

from April - November each year, and also

to book up early! bedes.org

103



School 2: The Malling School

At The Malling School, we are committed to providing an

engaging and ambitious curriculum that ignites a passion

for learning, fosters personal growth, and prepares students

for a successful future. Embracing excellence is at the heart

of what we do. As the first non-fee-paying/

non-grammar school in Europe to offer the

prestigious International Baccalaureate Careerrelated

Programme (IBCP) and International

Baccalaureate Diploma Programme (IBDP)

qualifications in our Sixth Form, we provide

our students with access to the world’s premier

post-16 academic qualification and the most

flexible Sixth Form vocational qualification

in the UK. These qualifications open doors

to top universities and exciting career

opportunities and develop students into well

rounded young people who are ready for life after compulsory

education.

In addition to these prestigious qualifications, we also

recognise not all our students fit this mould therefore,

“we hope to

launch our Golf

Academy in

time for the next

academic year”

we also offer a triple BTEC in Sport. This pathway is

undergoing exciting development and we hope to launch

our Golf Academy in time for the next academic year.

In addition to this we have a bespoke Level 2 route that

accommodates a small number of pupils who

have additional learning needs.

At The Malling School we pride ourselves

in providing students with robust academic

and pastoral support. We are fortunate to

have a talented and experienced pastoral

team to ensure our students reach their full

potential and are in the enviable position of

having two Level 6 qualified careers advisors

who ensure all our KS5 students secure

meaningful destinations after they leave us.

Applications can be made through Kent Choices but if

you would like to find out more please email:

6thform@themallingschool.kent.sch.uk or visit:

themallingschool.kent.sch.uk


104

Discover ‘The

Malling School Way’

Caring, Determined, Reflective

At The Malling School education is the key to boundless

opportunities. Our engaging curriculum sparks a love

for learning and equips students for a successful future.

With diverse subjects and pathways, every student finds

their passion and reaches their potential.

OPEN MORNING TOURS 2026

FOR YEAR 5 STUDENTS – STARTING MARCH

To book an Open Morning Tour please call 01732 840995

or email office@themallingschool.kent.sch.uk

Unlock a world of limitless opportunities

The Malling School, Beech Road, East Malling, Kent, ME19 6DH

www.themallingschool.kent.sch.uk

105


Ask me about your

dream honeymoon ...

01580 713189

Cranbrook, Kent TN17 3PS

Everything you need for life in the country.

Honeymoons

LUXURIOUS ESCAPES

New Arrivals From Seasalt

01372 240 056

www.travelcounsellors.co.uk/soozie.wilson

BLUE VELVET SHOES

Visit Blue Velvet Shoes at 174 Kings Road, SW3 4UP or buy online www.bluevelvetshoes.com


106

The Very

Collection maxi

lace blouse £35

Very very.co.uk

Tahitian pearl Padma

pendant £3,300

KATA Jewellery

katajewellery.com

9ct yellow gold octopus pendant

with white pearl £695 Baroque

Jewellery baroquejewellery.com

Jaeger-LeCoultre Rendez-

Vous Night Day watch

with mother-of-pearl dial

£12,995 Shop Prestige

shopprestige.com

Navy satin lace maxi skirt £52

Wolf & Badger wolfandbadger.com

Satin V-neck

cami £32.99

La Redoute

laredoute.co.uk

The Very

Collection floral

lace top £25 Very

very.co.uk

Pearl choker with 18ct gold

heart £2,445 Lulu & Boo

luluandboojewellery.co.uk

Molten heart pearl drop

earrings £1,295 Lulu & Boo

luluandboojewellery.co.uk

New R omantics

If you’re feeling inspired by Bridgerton as Valentine’s Day

approaches, style the trends of lovely lace and delicate

pearls with a mix of Regency and contemporary

Jennifer Behr Presley

faux pearl hair clip

£210 Net-a-Porter

net-a-porter.com

Esme mother of pearl ring

£46 Maudella maudella.co.uk

Louche Rufaro lace

trim short sleeve blouse

£49 Wolf & Badger

wolfandbadger.com

Lina Sheer Polka Dot Lace Blouse in

black £55 Monsoon monsoon.co.uk

Maude black lace midi dress £89

FatFace fatface.com

Pearl moissanite platinum

plated silver brooch £325 Jian

London jianlondon.co.uk

De Beers mother of pearl

Enchanted Lotus bracelet £5,495

Shop Prestige shopprestige.com

Mother of pearl clover cross

bracelet £99 Merci Maman

mercimamanboutique.com

White baroque pearl

stud earrings £140 ORA

Pearls orapearls.com

istockphoto.com/ olgatroy1 istockphoto.com/

Pluvia pearl earrings

£440 ORA Pearls

orapearls.com

DÔEN Lavon lace-trimmed

silk-satin wide-leg pants £420

Net-a-Porter net-a-porter.com

Rosalind pearl mid

block sandal £237.50

Sophia Webster

sophiawebster.com

Adela gemstone

embellished tassel

purse £39 Monsoon

monsoon.co.uk

Opera Mules 80 £199 Blue Velvet

Shoes bluevelvetshoes.com

107


Bring on the zing!

Recipe developer, cookery teacher, caterer and all round superfoodie

Charlotte Butterworth (aka @theneedy.greedy)

spices up winter with sunshine-filled dishes that warm and nourish

Recipes: Charlotte Butterworth, aka @theneeedy.greedy Photographs: David Merewether

Prawn & chickpea harissa stew

Serves 4

This is the kind of food I love… It ticks every box

for me and what is at the heart of my recipes that I

create to share through @theneedy.greedy. It is actually

incredibly good for you, with lots fibre and protein.

Most importantly it is utterly SUBLIME. The secret

is using really good jarred chickpeas if you can, I love

Bold Bean Co. You can make most of it ahead just

adding the chickpeas and prawns at the last minute. Or

have a more leisurely cook – it takes about 30 mins.

• 2 red onions, thinly sliced

• 2 cloves of sliced garlic

• small bunch of fresh coriander, with the longer stalks

chopped – don’t stress if you don’t have any fresh,

I sometimes add frozen coriander in near the end

• 1 tsp harissa powder

• 1 tsp each of ground cumin and turmeric,

• handful of cherry tomatoes,

chopped in half – optional!

• 1 tin chopped tomatoes

• 1 jar Queen chickpeas (Bold Bean Co.)

• 1 pack large cooked prawns (or you can

use raw and just cook in the sauce)

• lemon and fresh coriander, toasted

flaked almonds etc to serve

1. In a large pan, gently cook your onion slowly in

olive oil. When soft, add the garlic, coriander stalks,

harissa and spices. Cook for a few moments.

2. Add the tinned tomatoes. Cook for 5 mins,

then add the cherry tomatoes. Cook for a further

15-20 mins. You can then leave until later.

3. When close to serving, heat the sauce, prawns

and chickpeas. Add some water if not enough sauce.

Cook through (it will take 5-10 mins). Serve with

sprinkled coriander and a wedge of lemon. To up

the protein content I served this alongside quinoa,

but use rice, cous cous or whatever you fancy.

Spicy red lentil & roasted pepper soup (next page)

Serves 2-3

A delicious, hearty and healthy soup recipe. The red

lentils make the soup so creamy and using ready roasted

peppers in a jar makes this a breeze. Do future you a

favour and make a batch and freeze in portions, you’ll

have a warming dinner ready when you most need

it. Do omit the chili of you prefer a less spicy soup.

• olive oil

• 1 onion, roughly chopped

• 2 carrots, roughly chopped

• 1 stick celery, roughly chopped

• 2 cloves garlic

• 1 tsp each of chili flakes, turmeric, ground cumin,

ground coriander

• 100g red lentils, rinsed

• 2 tbsp tomato purée /concentrate

• 750ml veg stock

• 2 large roasted red peppers from a jar (pat dry with

kitchen roll)

• ½ tsp apple cider vinegar

• Greek, natural or coconut yogurt, to serve

109

1. Warm the olive oil in a large saucepan, add the

onions and gently allow to cook and soften for 5

mins at least. Add the carrots, celery, garlic and cook

for a further five mins, stirring to make sure they

don’t burn. Add the spices mix, cook for a further

5 mins. Throw in the lentils and the tomato purée,

give it all a good stir and then add the stock.

2. Bring to the boil and cook gently for 20

mins or until the lentils are soft. You many

need to check that there is enough water.

3. Finally add the red peppers and allow

to warm through. Add the splash of

apple cider vinegar, it just lifts it!

4. Blend with a stick blender, season

generously, taste and season again.

5. Serve with yoghurt and/or chopped coriander.

I also decorated with Cornish Sea Salt Co's

Everything Bagel, a totally delicious seasoning

that is a blend of seeds and smoked sea salt.



Ginger chicken with lime

& spicy bashed cucumber

Serves 4

This is a delicious, simple chicken

dish that can be enjoyed by the

whole family. The lime is essential

for bringing out the flavour.

Serving alongside the fresh

cucumber gives extra pep. And by

the way, bashing the cucumber

isn’t just a stress reliever, slightly

breaking it up means it absorbs

those beautiful flavours better.

• 800g-1kg of chicken thigh

fillets, diced into bitesized

pieces

For the marinade:

• 2 tbsp soy sauce

• 2 tsp sesame oil

• 2 tbsp honey

• 1 tsp of Chiu Chow chili

(or use squeezed chili

for even chili flakes)

• 2 large garlic cloves crushed

• 1-2 tbsp minced ginger

• 2 tsp sesame seeds

• 100g mange tout

• 1 lime, cut into wedges

for squeezing

• fresh coriander

• 200g Thai black rice (I found

mine in Waitrose but you

can use any rice you like)

For the chicken:

1. Combine all the marinade

ingredients in a bowl. Add

the chicken pieces and allow

to marinate for a few mins,

or longer if you can.

2. Heat some oil in a large

frying pan. Cook for 8-10

minutes. Give it a turn every

few mins so it cooks evenly. Add

the mange tout for the last

couple of mins of

cooking. Stir through so they are

warmed and coated in the sauce.

Sprinkle over the sesame seeds.

3. Cook the Thai black rice

as per the packet instructions

– it takes about 20 mins.

4. Serve on the black rice

with a generous squeeze

of lime and coriander.

For the cucumber:

• 1 cucumber

• 1 tbsp rice vinegar

• 1 tbsp soy sauce

• 1 tsp caster sugar

• ½ tsp chili flakes

• 1 tsp Nigella seeds

1. Bash the cucumber with

a rolling pin, so it is slightly

broken. Cut the cucumber

in half lengthways, and

then again so you have

four quarters. Slice

into chunks.

2. Mix all the

other ingredients

together, add

the cucumber.

Serve chilled.

111


Roast pineapple with lime, toasted

almonds & coconut yoghurt

Serves: 4

A light and zingy pudding that is perfect to pep up your tastebuds

and a beautiful way to end a meal. Roasting the pineapple and then

stirring through lime zest and agave nectar gives an extra depth to

this tropical favourite. The toasted almonds give a welcome crunch,

while the coconut yoghurt is so light and complements the pineapple

perfectly. It's a fabulous dairy free and vegan option too. The pineapple

can be prepared up to 8 hours before serving, and the almonds

toasted several days in advance and kept in an airtight container.

• 1 large pineapple

• 4 tbsp of agave nectar

• 1 lime

• 1 generous handful of flaked almonds

• 1 pot of coconut yoghurt – I love The Coconut Collab

1. Preheat the oven to 180°C.

2. Top and tail the pineapple and stand on a board.

3. Using a sharp knife, remove the skin by cutting down the pineapple.

Take care to remove all the brown spots. While still upright, cut the

pineapple in half lengthways, then into quarters and then again so you

have 8 long wedges. If there is a woody core, remove from each edge.

4. Pop the pieces on a baking tray and roast for 20 mins.

5. Meanwhile, scatter the flaked almonds over another baking

tray and roast for 6-7 mins until they're golden brown.

Set a timer as they burn very easily. Allow to cool.

6. When the pineapple is cooked, allow to cool. Then cut into bite size

pieces, mixing with the agave nectar. Zest the lime over the pineapple.

7. Serve with a generous spoonful of coconut yoghurt and scatter with

toasted almonds. Zest over more lime for decoration if you like.

About Charlotte Butterworth

aka @theneedy.greedy

Charlotte is a private caterer,

cookery teacher and recipe

creator sharing her original

recipes on Instagram and

Facebook as @theneedy.greedy.

She trained as a Cordon Bleu

cook, but has developed her own

signature style of using lots of

vegetables, big flavours and love

of Mediterranean style cooking.

Charlotte runs cookery

workshops and teaches

individuals in her lovely kitchen

in Cranbrook, helping people

rediscover their culinary mojo with

new ideas for delicious, healthy

and easy meals for everyday and

entertaining. Visit her Instagram

to find her workshop schedules

and to speak to her about tuition.

She also caters for everything

from intimate dinners and family

celebrations to drinks parties and

corporate events. Charlotte is also

co-founder of the Small Business

Supper Club Kent, which holds

monthly events to bring small

business owners, creatives and sole

traders together. Do contact her at

charlotte@butterworth.co.uk

for more information about

catering, teaching or supper clubs.

113



Beauty

What has K-Beauty

done for us?

Josephine Fairley explores the revolutionary

effect that the booming Korean beauty and

skincare industry has had on products that

are now readily available in UK stores

istockphoto.com/ shockshots korea / Ekaterina Klishevnik

I

don’t know about you, but my life does not allow for a 12-step

skincare routine. (And I’m pretty sure that my complexion

would rebel, if I were to embrace one.) But for the past decade,

South Korea has been ahead of the curve on skincare innovation

– big-time. Indeed, as one expert – Dr. Christine Hall, a Londonbased

aesthetic doctor of South Korean heritage – observes: ‘South

Korea is estimated to be a good 10 to 12 years ahead of us when it

comes to beauty technology, ingredients and aesthetic treatments.’

At first glance, it all seems so complicated, and perhaps really

rather wearying. Double cleansing (with an oil-based, then a

water-based cleanser). Applying an essence (sort of a souped-up,

moisturising toner), as well as ampoules to fix breakouts or other

specific beauty concerns such as age spots/sun spots. You might have an entire

arsenal of single-use sheet masks at your disposal, for different occasions and skin

crises. Why, at the extreme end, K-beauty fans are invited to indulge in ‘latte art

wash-off packs’ which mimic barista foam, slather on a snail mucin cream or apply

a treatment derived from bee venom or (yes) swift saliva. So far, so… gross?

But stay with me here – because actually, K-beauty’s philosophy is really sound, with the

core idea of transforming skin so that it looks better without make-up – something we can

all aspire to. Indeed, the Koreans are behind the idea of ‘skipcare’ – avoiding exfoliating

acids and other actives which can harm the skin barrier, opting instead for gentle to

protect all-important skin barrier (the focus of my column last September); it’s all about

developing a consistent ritual, rather than turning to aggressive quick fixes.

I think we can avoid over-cluttering the bathroom shelf by cherrypicking

the ‘best bits’ from K-beauty – so, here are my suggestions…

Do try double cleansing. I’m much too lazy to do this every night (and I

remain unconvinced that’s a good idea), but I know that my skin benefits

from this deep-cleansing double-whammy a couple of times a week.

Double cleansing helps to reduce congestion and allows anything you apply

afterwards to penetrate better. Do it at night, rather than the morning. The

idea is initially to melt away make-up, skin debris, pollution and general

gunk via a cleansing oil or a balm; you’ve probably got at least one of those

already, but I’m currently loving citrus-and-white-flowers-scented Emma

Hardie Vit C Brilliance Cleansing Balm, £52 for a hefty 100g

tub (and it comes with its own super-soft cloth) and

Liz Earle Superskin Advanced Nourishing

Cleansing Balm,

£39 for 100ml,

115


Inspected and rated

Good

9.9

12

9

Every minute at

Halden Heights is centred

around your care and well-being

From everyday support to engaging

activities that brighten each day.

Our team provides skilled, attentive

care that’s always centred around you

and your needs

3

6

Our Services & Amenities

Skilled

Nursing Care

Dementia

Care

Palliative

Care

Beautiful

Garden

Delicious and

Nutritious Meals

Located in the heart of Ashford, Halden Heights Nursing Home provides a tranquil

and serene environment where exceptional care meets high nursing standards.

To arrange a visit or speak to our team, please get in touch.

Ashford Road High Halden,

Ashford TN26 3BP

haldenheights@eleanorcare.co.uk

012 3385 1136

SCAN HERE TO

VISIT WEBSITE

while for cleansing oils, I like Biossance Squalane +

Antioxidant Cleansing Oil, £25 for 200ml (soft wafts of

lavender and orange, here), and MALIN+GOETZ Facial

Cleansing Oil, £38 for 120ml. These are all best removed

with warm-to-hot water, and a fluffy facecloth or flannel.

This is followed by the second phase – a low-foam,

non-stripping gel or cream to remove the last traces

of the balm or oil – I don’t think you can beat the very

affordably-priced CeraVe Hydrating Cleanser, £12.50 for

236ml, or for a natural option, COSMOS-certified organic

Green People Scent Free Cleanser, £29 for 150ml, which is so

gentle that it’s suitable even for sensitive or rosacea-prone skins.

Experiment with milky toners. Well, let’s say ‘hello’ to an entirely new

beauty category! But you know what? These cloudy liquids – thicker than

normal toners, but lighter in weight than a moisturiser – are great, particularly in

this peak central heating season when their cargo of ceramides, moisture-attracting humectants

like glycerine and peptides can ramp up levels quite impressively. BYOMA Hydrating

Milky Toner, £12 for 150ml and PIXI Milky Tonic, £10 for 100ml, are non-bankbreaking

options, with Rhode Glazing Milk, from £20 for 65ml, just a tad pricier.

Enjoy some fabulous textures! Korean products can literally spark joy on the basis of their

sensorial pleasures, I find. Maybe there’s a bit of a wobble going on, or a jelly-like

wibble. Maybe it ‘bounces’. At its most basic, a product might have a cream-gel

texture – an ultra-luscious, whipped (and yes, still slightly wobbly!) texture that

somehow feels super skin-quenching. And indeed, these ‘jelly’ formulations

do deliver a mega-dose of hydration, thanks to some clever tech.

One particularly bestselling example (thanks, ahem, to TikTok) is Medicube

Collagen Jelly Cream, £27.90 for 100ml at pureseoul.co.uk, one of the online

retailers in the UK which specialises in K-beauty innovations. A bunch of shops

has opened in London focused on these, too, in particular in Soho and Covent

Garden – but personally I find them utterly overwhelming to step inside; a

much more navigable edit can be found on Space NK’s website, where among

100 or so Korean imports you’ll find cult-like Then I Met You Bong 2 Bounce

Cream, £17 for 15ml – and I can report that the pleasure factor of using this,

with its instant burst of hydration, is sky-high, even though the price isn’t.

Learn your alphabet (creams). This is one aspect of Korean beauty

that has become indispensable, for me. Erborian is my go-to – a brand

that is actually a fusion of Korean and French beauty traditions (and

which deserves a much higher profile than it has, in my book). By

evening out skintone, the result is that you may well need less make-up

(notably foundation) than usual, if at all. Erborian target several different skin

challenges with their portfolio of alphabet creams, with Erborian CC Dull Correct and Erborian CC Red Correct

putting on a great performance when it comes to radiance-boosting and toning down the appearance of broken veins or

rosacea, respectively. (They are each priced £19 for 15ml, with larger sizes available – but a little goes a long way). The

superhero in the range, though, for me, is Erborian BB Cream, from £19 for 15ml, now available in a range of shades

that spans all complexions, which revs up the skin with ginseng, offers an SPF20 and quite simply blurs imperfections

in a flash. Use it under foundation, if you choose – but as I say, you may simply find you don’t need that at all.

And do slap on a sheet mask. There exist targeted masks for just about every area of the face, from the ‘11’ lines

between the brows to laugh lines via saggy jowls, as well as full-face options. Now, I worry about the environmental

impact of these; the foil sachets are generally not recyclable, even when the mask itself biodegrades – but I concede

that for a quick moisture fix and temporary plumping of lines, nothing comes close. The sheet – sometimes nothing

more than a sheet of gel that you press into the contours of your face – somehow works to ‘push’ ingredients into

skin, be that hyaluronic acid, peptides, collagen, Centella Asiatica… And some great options include Biodance

Bio Collagen – Real Deep Mask, £14.90 for four, Erborian BB Shot Mask, £6.50 (for a ’baby skin’ effect), and

Torriden DIVE-IN Low Molecular Hyaluronic Acid Mask, £2.60, from a top-selling Korean brand.

The bottom line is that there really is no need to add in endless steps to your skincare ritual in order to enjoy and benefit from

K-Beauty. But then again, just when you think you’ve seen it all, South Korea seems to take it up a notch. So, watch this space.

And maybe leave a bit of extra room on your bathroom shelf…

117


NOW OPEN!

A luxurious and

thoughtfully designed

home providing comfort,

care and compassion

Herne Bay Manor provides 67 stunning

en suite bedrooms, plus exquisite communal

spaces. It offers residential, dementia,

nursing and respite care services.

This is not just a care home, but a lifestyle

defined by quality, dignity and exceptional

standards of care.

To find out more or book an appointment,

please contact Trisha King on 01227 937400

or email enquiries@dunhamcarehomes.com.

dunhamcarehomes.com

Mei-Ling with her girls

Learn more

about gifts

in Wills

Gifts in Wills fund

over a third of our

work, like the

research study

Mei-Ling took part in.

Thanks to research,

she can see her girls grow up.

Find out more at

cruk.org/giftsinwills

Cancer Research UK is a registered charity in England and Wales

(1089464), Scotland (SC041666), the Isle of Man (1103) and Jersey

(247). Registered address: 2 Redman Place, London, E20 1JQ.


118

Health

Sporty fit

Sarah Maxwell explains how team sports can revolutionise your fitness

This is the year for swapping

boring monotonous treadmills

for the real thing. Participation

in team sport can pack far more

punches for aspiring fitness fanatics as

2026 unfolds – whether that is rolling

back the years to engage in a long-lost

school sport or taking the bold plunge

to get out of your comfort zone and

trying something completely new.

Currently there is a resurgence in

team sports that not only provide

fantastic physical and mental benefits

but, more importantly, the fun that

takes the edge off increasingly stressful

lifestyles. There’s also the challenge,

and the sense of community spirit

and achievement, that comes with it.

Let’s have a look at what’s on offer:

Football – including the walking

version for seniors – is great for all

ages, with the latter making it super

accessible for older adults or those

easing back into exercise. This is a

great cardio workout that enhances

heart health, endurance, and aerobic

capacity while reducing body fat and

improving muscle tone, strength,

flexibility and bone health.

It boosts coordination, balance and

mood through endorphin release,

reducing stress and enhancing mental

wellbeing. Cognitively, it sharpens

decision-making, concentration,

working memory and quick reflexes,

while promoting teamwork.

Local clubs include Kent United

Football Club (a club where

everyone is welcome) and Surrey

FA (a charitable organisation

which is responsible for leading

the development of grassroots

football within Surrey), while

the Sussex Walking Football

provide ample opportunities for

the more laidback seniors.

Netball is another great option,

offering a fast-paced game, ideal for

building agility and team vibes. The

sport delivers a comprehensive fullbody

experience through running,

jumping and rapid direction changes,

enhancing cardiovascular fitness,

agility, coordination, strength,

endurance and muscle tone.

It can also improve mental health

by fostering social connections

and releasing endorphins, which

elevate mood, reduce anxiety

and boost confidence.

The Kent Netball Association,

Surrey Netball League and Sussex

Netball should be the first port of call.

Then there is pickleball, one of

the fastest growing sports, which is

low-impact, very social, and rather

addictive! It’s relatively gentle on joints,

improving cardiovascular health,

balance, hand-eye coordination,

agility, flexibility, strength and

overall fitness – and it’s great for

all ages, including seniors.

This fun sport also goes a long

way in improving mental wellbeing

and helping people socialise in

an easygoing environment. For

brain health, it boosts strategic

planning, focus, decision-making,

memory, reaction times, and helps

slow cognitive decline, supporting

sharper thinking via better blood

flow and neural stimulation.

Surrey Pickleboard and East Sussex

Pickleboard clubs set the agenda.

Finally, but not least, hockey is a

dynamic sport that is brilliant

for cardio and teamwork.

Again the health benefits

are extraordinary.

Fitness, breathing,

weight management,

stamina, coordination,

balance and overall

physical conditioning provide plenty

of incentives. It also builds mental

resilience, self-esteem, energy levels,

better sleep and emotional wellbeing

through team spirit and physical

activity. Executive function, teamwork

skills, and mental agility improve, with

the sheer speed of the game sharpening

up all aspects of decision making.

Find clubs through englandhockey.

co.uk, the Kent Hockey

Association and Sussex Hockey.

Whether you’re after low-key

sessions or full-on games, sports clubs

and leisure centres are a great

starting point to find

something local. So

why not dive in,

have a laugh and

treat your mind

and body with

the richness it

deserves. And

have a load of

fun in the

process!

Sarah

Maxwell is a multiaward

winning Lifestyle

Wellbeing and Fitness coach. You

can find her at sarahmaxwell.com

Get in touch via email at

sarahmaxwell@mail.com

and on social

@sarahmaxlife

119

Small changes big results

Nutrition & Lifestyle Coach Charlotte Lau

explores the benefits of a colourful diet

istockphoto.ocm/ PeopleImages

February can feel like the greyest month of the

year… and not just outside. Mood, energy

and motivation often dips in these midwinter

weeks, especially after the initial health focus (and

pressure) that January often encourages.

So this month’s simple shift is as

colourful as it is powerful: Eat one

extra colour of fruit or veg each day.

It’s not about rules or restriction; it’s about adding in, not

taking away. Each natural colour in fruits and vegetables

represents different antioxidants and phytochemicals

that support your immune system, digestion, skin health

and even your mood… the more variety, the better!

The Science of Colourful Food

Different pigments signal different plant

compounds with unique health benefits:

• Red (tomatoes, berries) are rich in lycopene

which supports heart health.

• Orange/yellow (carrots, butternut squash) are high

in beta-carotene, supporting immunity and skin.

• Green (spinach, kale, broccoli) are packed with

folate, fibre and anti-inflammatory compounds.

• Blue/purple (blueberries, beetroot) are loaded with

anthocyanins, which support brain health and circulation.

• White (garlic, onions, cauliflower) are rich in allicin and sulphur

compounds, which support immune health and digestion.

Eating a wider variety of colourful fruits and vegetables

does more than brighten your plate… it boosts your

intake of nutrients that work together to support gut

health, energy and even mood. Colourful plants are rich

in fibre, which feeds beneficial gut bacteria and helps keep

digestion regular. Many also contain compounds that

help stabilise blood sugar and enhance the absorption of

other nutrients, so your body gets more from the food

you eat. Rather than focusing on rigid rules, simply asking

“what colour can I add today?” is an easy, joyful way to

nourish yourself through these midwinter months.

Why Now?

February is often when energy wanes, digestion gets

sluggish and comfort eating creeps in. Supporting

your body with diverse plant foods is a gentle way to

improved your diet without needing to be ‘perfect’.

3 Easy Ways to Add Colour This Month

1. Frozen berries in the morning. Stir into your

porridge or yoghurt for an antioxidant hit.

2. Rainbow soup. Make a big batch with whatever’s

in season… carrots, leeks, squash, greens.

3. Salad boosters. Add something unexpected:

red cabbage, grated beetroot, pomegranate seeds

or orange segments with a citrus dressing.

Charlotte runs Plume Nutrition, where she offers support and advice

for weight management, controlling cravings, sleeplessness, stress

and increasing energy levels. Find out more at plumenutrition.com


Looking for healthy,

nutritious recipes?

Women’s Health &

Medical Aesthetics

Clinic

Empowering women

on their hormonal

journey through

personalised care,

compassion, and

evidence-based

treatment

Hot

smoked

trout lettuce

bowl by

Jo Arnell

Visit priceless-magazines.com for inspiration

SERVICES WE PROVIDE

Perimenopause

Menopause

Testosterone

Vaginal Health

BOOK A CONSULTATION

www.anpmedical.co.uk

welcome@anpmedical.co.uk

07932 038 011

Blood tests

Vitamin Injections

Medical Aesthetics &

Skin Care

Opus Care

Our Care homes are designed and built by medical professionals

based here, in Kent. With over 20 years’ experience, we provide

modern, elegant, homely surroundings where our elderly

residents benefit from first-class care and companionship.

Brabourne Care Centre

209 Hythe Rd

Ashford TN24 0QJ

Call 01233 643555

Individual care packages are created for each resident.

Folkestone Care Centre

50-52 Shorncliffe Rd

Folkestone CT20 2NB

Call 01303 765700

www.opuscare.co.uk

Care services include:

•Residential • Dementia

• Palliative • Respite care

• Nursing care

Our facilities:

• Landscaped gardens

• In-house chef • Library areas

• Wellbeing team • Hair salon

• En-suite facilities

For when nursing care, companionship and support matter most.

121


The Bravest

Banish the winter blues – cheer up pots and borders with some

welcome early flowers with expert advice from Jo Arnell

istockphoto.com/ mick blakey / Tom Meaker

February is a short, sharp month – some years shorter

(and sharper) than others – but the light is coming

back and, when the sun shines, it does feel spring-like.

Let’s not be fooled: the earth is still tilted away from the sun

here in the UK and losing more heat than it gains. Frosts

are never far away, but there are uplifting signs that nature is

getting ready for the season of growth, there’s a rustle in the

wings and some brave little buds are bursting into bloom.

Winter carpets

The earliest of the hardy bulbs, tubers and rhizomatous

perennials are tiny, but resilient, naturalising and spreading

easily, even across difficult terrain. These little treasures

are best seen in massed throngs beneath the trees, where

they make the most of the light in winter and early spring,

before the dense canopy of leaves closes over them, or, in

the case of sun lovers, before the ground dries too much.

Snowdrops – These tough little plants will push up through

frozen ground, spreading in snowy carpets among the trees.

They adapt and naturalise more easily when planted ‘in the

green’ – which means planting them once flowering is over,

but before they dry out. Snowdrops prefer slightly shaded,

humus rich soil. They are woodlanders, blooming early to

make the most of the light before the leaves appear and block

out their light. We romanticise these tiny flowers – some

Galanthophiles (official term for lovers of snowdrops) admire

and covet particular cultivars to the point of obsession, paying

hundreds of pounds for a single plant. Is it because they

flower so miraculously early and give us hope? Or that they

are so delicate, each one a minute work of art? They seem

to symbolise resilience and strength, the continuation of life

despite the hardest of conditions. I admire their devotion,

but am just as happy with the ordinary Galanthus nivalis.

Cyclamen coum – Not to be mistaken for Cyclamen

hederifolium, which is the autumn version. You’d be

forgiven though because C. coum is very similar – the

obvious difference is that it flowers in late winter/early

spring, it is also less vigorous and will be swamped by

its enthusiastic autumn cousin, so plant them away

from one another. They are among the bravest though,

spreading quietly into the dry shade under the trees,

daring to grow among the roots and in dusty corners.

Winter Aconite – another diminutive woodland spreader,

its bright egg-yolk yellow flowers cheerfully shining

out in the winter gloom beneath trees and hedges.

Dwarf Iris (Iris reticulata) – these look delicate, a

miniature version of bigger Iris varieties, but the bulbous

Iris reticulata start flowering in February – much earlier

than their sun-loving rhizomatous relations. Grow

at the front of borders, in rockeries or, perhaps, best

of all, in pots where you can see them up close. The

flowers are usually in shades of mauve and blue, with

splashes of yellow and white. I saw a variety the other

day called ‘Frozen Planet’, it was the palest blue and

white, like something Elsa and Anna would grow.

Narcissus ‘February Gold’ is one of the earliest daffodils,

there is another even earlier – flowering in December

called Narcissus ‘Rijnveld’s Early Sensation’. Daffodils do

seem to be flowering earlier these days, but the thronging

rush will always be in March. They are a welcome sight,

however early – a true sign that spring is on the way.

Heroic hellebores

Hellebores are good and hardy, often flowering where

not much else will and are a great asset in the garden

at this time of the year. Helleborus niger (the Christmas

Rose) flowers in midwinter, These are usually white, but

Helleborus orientalis – and hybridus cultivars – bloom

later, most often in pink shades, from pale to the darkest

burgundy. Newer cultivars can be speckled, double petalled

and upward facing, although I like the ones that shyly

hang their heads and hide their beauty, so that you have

to lie on the ground to see them properly – or, more

decorously, cut and display them floating about in a bowl

of water. Keep Hellebores looking good by cutting off last

year’s tatty leaves before the new shoots start to show.

Steely shrubs

Many of the early flowering shrubs are scented, their pale

blossom appearing along bare stems or under the shelter of

evergreen leaves. The scent can be powerful too, pumping

out a strong message to the few brave beetles, bugs and early

bumblebees that appear on sunny winter days – a fragrant

signal to guide them towards much needed nectar.


122

Garden

Blooms

123


Sarcococca – There are several varieties of this low growing evergreen available, but they all look fairly similar,

with small leathery leaves – it is often called ‘Christmas box’ because it looks like a more unruly version of a box

bush. Often overlooked and grown at the base of showier shrubs and trees, Sarcococca has an almost overpowering

perfume – on a still and cold winter’s day the scent is uplifting (or off-putting, depending on your sensitivities).

Hamamelis (Witch Hazel) – Spidery blossom creeps along the bare stems of Witch Hazels, long before the leaves appear.

They are from North America and not related to our native hazels, the leaves are similar, but that’s about all. They’re not

related to witches either, although the astringent properties have been used for thousands of years as a natural medicine.

They make good specimen shrubs – as well as early blooms, they have good autumn colour – topping and tailing the

year with a warm glow. Underplant with carpets of late winter bulbs and flowers like those mentioned above.

Coronilla valentina subsp. glauca ‘Citrina’ – (or call it by its

common name – less of a mouthful, but rather disturbing –

bastard Senna ‘Citrina’). Anyway, this lax little evergreen

– I want to call it a climber,

but it doesn’t quite

climb, more just

hopefully leans

up against things

– should be better

known, especially

because it flowers

so early in the year.

Coronilla ‘Citrina’

has pretty grey-green

leaves and pale yellow,

pea-blossom flowers that

emit a citrus scent. It looks

delicate, but once established

is very hardy, although it

would probably prefer a

sheltered wall in order

to flower well.

Coronilla

valentina

Camellia – If you don’t have acidic soil a Camellia is best grown in a large pot with ericaceous compost to stop the

leaves becoming chloritic and turning a sickly yellow. Position away from frosty early morning sunlight, which can burn

and brown the petals. Grown well they are a glorious sight, with glossy evergreen leaves and impressive flowers.

Viburnum – There are many useful shrubs in this family, the earliest flowering are the Viburnum x bodnatense varieties

– these are deciduous, with the highly scented flowers appearing on bare stems throughout the winter. The best known

are probably Viburnum bodnatense ‘Dawn’, with pink blossom, or ‘Charles Lamont’, similar, but a bit more vigorous.

Plant scented shrubs near to paths and doorways so that you don’t miss their best days, or cut a few stems and bring a vase

of them inside to enjoy. Even a single snowdrop in an egg cup can do the trick. While we are waiting for the weather to

warm up it is a positive act to plant a winter or early spring flowering shrub – it gets us outside for one thing – and somehow

brings the spring closer too. These first few brave blooms are a hopeful sign that winter is finally losing its icy grip.

Jo’s new gardening courses are now booking. For information, call 07923 969634 and see hornbrookmanor.co.uk.


124

CREATING BEAUTIFUL LANDSCAPES

Bespoke design & build treehouses, playhouses

Bespoke design

and elevated build treehouses,

platforms.

playhouses

Commercial &

and

International

elevated platforms.

commissions welcomed

Commercial International commissions welcomed

gardenproud.co.uk

DESIGN | CONSTRUCT | MAINTAIN

TEL: 01403 732452

www.cheekymonkeytreehouses.co.uk

www.cheekymonkeytreehouses.co.uk

Pond/Lake Construction | Bank Repair | Silt Removal | Pond Cleaning | Fish Removal

Aquatic Weed Removal | Aeration Installations | Supplier of Coarse Fish

AFTER

AFTER

AFTER

BEFORE

BEFORE

BEFORE

COMMERCIAL AND RESIDENTIAL WORK UNDERTAKEN

Based in Kent and covering Kent, Sussex, Surrey, South East London

07746 137468 email: info@hubbleaquacare.co.uk

125


Gifts generously left in Wills provide care for one in

every five patients supported by Hospice in the Weald.

Help us to protect the future of the Hospice and

ensure that the care and support we provide lives on

by leaving a legacy of love.

Leave a Gift in your Will at

hospiceintheweald.org.uk/gifts-in-wills

Registered Charity No.280276

Registered Charity No.280276

DISCOVERY WEEK AT GODSTONE FARM

SNOWDROP DAYS AT

GATTON PARK

CREATING

HABITATS AT

WISLEY

What’s On

in February

CARS

Sun 8 Feb

Brooklands Museum,

Brooklands Drive, Weybridge,

Surrey, KT13 0SL

VINTAGE SPORTS CAR

CLUB DRIVING TESTS

Head to historic and atmospheric

Brooklands to see pre-1955 cars

tackle a dozen different tests

around complicated courses

laid out around the historic

Brooklands site including Test

Hill and Members Banking, with

drivers competing against the

clock while trying to avoid any

penalty-attracting mistakes.

As with all VSCC events, the

competition will boast an

eclectic mix of pre-1955 cars.

The competition will be rife

throughout the field with many

drivers returning looking to hold

on to previous titles while new

competitors will be eager to make

a name for themselves. Tests will

run throughout the day, starting

from 10am, with a break for lunch.

brooklandsmuseum.com

HALF TERM

Sat 14 to Sun 22 Feb

Leeds Castle, Maidstone,

Kent, ME17 1PL

A RIGHT ROYAL

FEBRUARY HALF TERM

AT LEEDS CASTLE

This half term Leeds Castle

opens its doors to families for an

enchanting exploration of the

Medieval court! This exciting event,

included with your admission

ticket, invites you to dive into the

fascinating world of a Royal ball.

Prepare for a captivating

experience, where families will

embark on a journey to learn the

essential skills and processes that

defined Royal existence in Medieval

times. Guided by the charming

Lord Hugo, Groom of the Stool

to King Edward I (yes, he did

assist the King with his… stools),

and the lovely Lady Mary, Queen

Eleanor of Castile’s chief Lady in

Waiting, visitors will engage in

a series of enriching activities.

leeds-castle.com

Sat 14 – Sun 22 Feb

Godstone Farm,

Tilburstow Hill Road

Godstone, Surrey RH9 8LX

DISCOVERY WEEK AT

GODSTONE FARM

All through half term your little

one can get stuck into the mud,

mischief and marvellous jobs of

farm life at Godstone Farm!

Whether you’re feeding pigs

together, collecting eggs or

scooping the poop (someone’s

got to do it!), this is their chance

to experience life on the farm

in a way that’s totally handson

and full of fun. Learn and

laugh together as you complete a

range of exciting farmyard tasks

– can you tick them all off?

With full farm park access

included in your Discovery Week

tickets, there’s plenty of time to

play and see all 500+ animals

too. We can’t wait for Discovery

Week – who knows WHAT you’ll

discover about yourselves?!

godstonefarm.co.uk

GARDENS

Various dates throughout Feb

Gatton Park, Reigate,

Surrey, RH2 0TW

SNOWDROP DAYS AT

GATTON PARK

Gatton Park is best known for the

work that was carried out between

1762 and 1766 by English

landscape designer Lancelot

‘Capability’ Brown. The rock

garden was constructed in 1912

by J Pulham & Sons. Check the

website to find dates and book

places on Snowdrop Open Days

when the Park and Gardens are

open to view a spectacular display

of snowdrops, heralding the

first glimpes of Spring. Gatton

Hall will open for cake and

refreshments, plus a plant sale.

gattonpark.co.uk

Tues 24 & Weds 25 Feb

10.30am-1.30pm

RHS Garden Wisley, Woking,,

Surrey GU23 6QB

CREATING HABITATS

FOR BIODIVERSITY AT

WISLEY GARDENS

Are you looking to increase

biodiversity in your garden?

Tempt more wildlife your way?

Come along to the RHS flagship

garden and learn how to create

dead hedges, log walls and habitat

towers in an ornamental way

that are both pleasing to look

at and beneficial to wildlife.

These one-day sessions will be

held entirely outdoors so please

make sure you are dressed for the

weather with appropriate footwear.

For the practical work in the

garden, please bring gardening

gloves if you have them.

rhs.org.uk/gardens/wisley

Tickets: £38 book in advance

istockphoto.com/ tenra & Matthew J Thomas & DDurich & Leo Malsam & Giovanni Magdalinos

127


20-22 MARCH 2026

3331-Bugs&Boots-2026-90x130mm-Wealden&Surrey.indd 1 17/12/2025 3319-First-signs-of-spring-90x130mm-Wealden&Surrey.indd 09:51

1 17/12/2025 10:20

MATERIAL

ENCOUNTERS:

CONTEMPORARY

TEXTILES IN

FOCUS

FEATURING:

CURATED EXHIBITION

TEXTILES FAIR

WORKSHOPS

& SELECTED PANELS FROM

AIDS QUILT UK

HTTPS://WWW.LANDMARKARTSCENTRE.ORG/SHOWS/CONTEMPORARYTEXTILES/

020 8977 7558 £5 ENTRY, £4 CONCESSION, FREE FOR U16 & LANDMARK FRIENDS

LANDMARK ARTS CENTRE, FERRY ROAD, TEDDINGTON, TW11 9NN


128

THEATRE

Fri 20 & Sat 21 Feb

Marlowe Theatre, The Friars,

Canterbury CT1 2AS

MÁM AT THE MARLOWE

A great opportunity to see

MÁM – featuring 12 dancers

and the music of virtuoso Irish

traditional concertina player

Cormac Begley and European

classical contemporary collective

s t a r g a z e. Their composition

includes 16 traditional West

Kerry folk songs, from The Races

of Ballyhooly to The Morning

Dew. Nominated for an Olivier

Award, MÁM has enjoyed sellout

performances at Sadler’s Wells,

London and across festivals worldwide.

The production will come to

the Marlowe Theatre, on its debut

UK tour for Dance Consortium.

marlowetheatre.com

Thur 26 Feb 7.30pm

Centenary Hall, Hemsted Park,

Benenden School, Cranbrook

Kent TN17 4AA

ATTENTION ALL SHIPPING:

A CELEBRATION OF THE

SHIPPING FORECAST

As the shipping forecast

embarks on its second century

Charlie Connelly’s hilarious

and informative show brings

the quirky broadcast vividly

to life, celebrating what he

firmly believes to be the greatest

invention of the modern age.

How did a weather forecast for

ships capture the hearts of a nation,

from salty old sea dog to insomniac

landlubber? How is it possible

for ‘rain later’ to be ‘good’? And

where the hell is North Utsire?

Delving into the history of the

forecast and the extraordinary

people who made it, Charlie

explains what those curious

phrases really mean.

Entry: From £22.50

hemstedpark.com/events

Thur 26 Feb 7.30pm

Gulbenkian Theatre,

University of Kent,

Canterbury, Kent CT2 7NB

MATT FORDE: DEFYING

CALAMITY

The absolutely brilliant political

impersonator and comedian, Matt

Forde (Spitting Image, Have I Got

News For You, The Royal Variety

performance and various fabulous

podcasts) is on his biggest tour

to date and is not to be missed!

Join him in Canterbury as he

finds positivity in life despite all

the evidence to the contrary in

politics and his own health!

Entry: £25

thegulbenkian.co.uk

Sat 28 Feb

G Live London Rd,

Guildford, GU1 2AA

ROSS NOBLE – CRANIUM

OF CURIOSITIES AT G LIVE

Roll up, roll up! Or use a more

conventional form of transport to

get to the show. It’s entirely your

choice. Unless you accidentally

become trapped in a barrel. Should

that happen, then just find an

incline and start rolling to see

the one and only Ross Noble!

He is the Wizard of Waffle, The

Rambler Royale, The Noodlers’

Noodler, and he’s back to tour a

tornado of tangents. What the

show will be about is anybody’s

guess, but that’s all part of the fun.

trafalgartickets.com/glive-guildford

VALENTINE’S

Fri 13 & Sat 14 Feb

Balfour Winery, Five Oak

Lane, Staplehurst, Tonbridge,

Kent, TN12 0HT.

VALENTINE’S DAY AT

BALFOUR’S WINEMAKER’S

KITCHEN

Celebrate with Balfour Winery

this Valentine’s Day in their

Winemaker’s Kitchen. Their

chefs will be serving a selection

of Valentine’s specials – beautiful

seasonal dishes designed to pair

perfectly with their award-winning

wines. Whether it’s a first date, a

forever date, or a night out with

someone you love, join them for an

evening that’s all about great food,

great wine, and great company.

Their regular à la carte menu

will be available as well as

our Valentine’s specials.

balfourwinery.com

Sun 15 Feb

Silent Pool Distillery, Shere Road,

Albury, Surrey GU5 9BW

PERFECT PAIRINGS:

VALENTINE’S EXPERIENCE

Love is in the air! Bring your

beloved and share Silent Pool

Gin cocktails and wines from

Albury Vineyard, paired with

a selection of canapés and led

by their wine and gin experts.

We meet in the tasting room

of Albury Vineyard to discover

and sample the exquisite wines

grown on the estate, including

award-winning sparkling wine.

Then it’s a short walk to the

Silent Pool Distillery where

you’ll enjoy a selection of Silent

Pool Gin cocktails and gins as

our gin expert introduces you

to the Silent Pool Gin range.

silentpooldistillers.com

Listings are correct at time of going to press

but may be subject to change. Readers are

advised to check with venues before making

arrangements. We can list your event in

the next issue of Wealden Times for only

£75+VAT. Please supply up to 200 words

that should include date, time, venue,

contact for enquiries and any entry price to

whatson@priceless-group.com or send with

payment (cheques payable to Priceless Media

Ltd.) to What’s On, Priceless Media, Kettle

Chambers, 21 Stone Street, Cranbrook,

Kent TN17 3HF. Priceless Media reserves

the right to edit text to fit space allocated.

Deadline for the next issue is 3rd February

VALENTINE’S DAT AT BALFOUR

WINEMAKER’S KITCHEN

MAM AT THE MARLOWE

ATTENTION

ALL SHIPPING

129


Jane weathers a spell of bad luck at Coopers Farm as she

and the animals recover from a fox attack, a robbery and

a disappointing pregnancy rate amongst the sheep

istockphoto.com/ Lidia Shapoval

Well we’ve had a few unfortunate occurrences

in the past few weeks, three to be specific so

that should be it and we can move on.

First off it happened. We never thought it would. The fox

visited the hen house. It was a very cold wet night, husband

Adrian had gone to bed with a cold and I’d gone out with

the girls. Untypically we’d not done our usual “have you shut

the hens up” routine, so no one did and we paid the price.

The dogs woke us up about 3am, we opened the bedroom

windows and made an impressive hullabaloo

but not before he or she had run off with

our new cockerel! Poor Collins (seemed an

appropriate name for Phil’s replacement),

he’d only just started to crow, more of an

adolescent squawk, and had developed

some of those wonderful petrol blue/

green tail feathers that only cockerels have.

But his was a short lived tenure. Bother.

And you might remember. He was

rather special. We have a small flock of

exceedingly rare Brown Sussex chickens.

We were given them by Malcolm the

sheep scan man and chicken fancier and

every year when he visits (he’s just been,

more of which later) he reminds us that he only knows

of two flocks in the country. Ours and those belonging

to Jonathan Crump, a dairy farmer in Worcestershire.

So last summer a visit to the Three Counties Show in

Malvern involved picking up some of Jonathan’s fertilised

eggs and bringing them back to Coopers Farm to place

under a broody hen. Seven hatched, two cockerels, but

one was taken by a crow, leaving Collins with the super

important responsibility of keeping the breed going. And

now he’s gone. Other cockerels have been offered but

Malcolm explained

that he had seen a lot

of empty ewes which

had been tupped

(put to the ram) early

who had not held to

service and this might

be due to the very

long hot summer

luckily, we’re off to a birthday party in Brecon later this

month and Jonathan happens to have a spare cockerel. So

we shall arrive for the weekend with a feathered passenger

(Adrian not thrilled as says car will smell like a farmyard,

which it probably will), but, all being well, Collins 2 can

pick up where Phil left off and the show will go on.

Next visitors also arrived at 3am. The dogs also barked.

We thought it was probably the fox again but as the hens

were safely shut up, we through it would be OK so rather

smugly rolled over and went back to sleep.

Hmm sadly they were two legged visitors

this time. They sawed through two padlocks

and got away with chainsaws, strimmers,

drills etc. Deeply annoying, such an afront

and then there’s all the bother of finding

receipts, filing a claim and wondering who

the scummy freeloaders might be. But

hey ho, no one hurt and life goes on.

And then there was Malcolm’s annual

visit to scan the ewes to ascertain whether

they’re carrying singles, twins, triplets

or nothing. There will always be a few

empty ones but this year there were far

more than expected. Malcolm explained

that he had seen a lot of empty ewes which had been

tupped (put to the ram) early who had not held to service

and this might be due to the very long hot summer.

Can’t be sure, but it didn’t start raining till late October,

and with the rain came the grass which would have

improved ovulation and conception. Another blow, but

being rather sentimental farmers and feeling responsible

for taking the rams out too soon we decided to put the

rams back in and can look forward to some summer

lambs. And hopefully to a less eventful time ahead.


Photo by: Matt Ebbage Photography

We take pride in being your trusted solicitors.

Here to support you, your family, and your

business every step of the way

At Bridger’s Law, we’re here to make life’s big moments stress-free. Whether you’re

planning for the future with a Prenup or Postnup, securing peace of mind with Wills and

LPAs, or taking your first steps onto the property ladder, our friendly and experienced

team will guide you every step of the way. We’re committed to achieving the best possible

outcome for you - so you can focus on what truly matters.

Prenups or Postnups | Divorce & Child Matters | Cohabitation | Wills &

Probate | Lasting Powers of Attorney | Criminal | Residential &

Commercial Property | Corporate | Company Secretarial

1st Office

2nd Floor, 3 Jubilee Way

Faversham

Kent, ME13 8GD

SRA Number: 832950

Ground Floor Rear

Unit 10, Conqueror

Court Sittingbourne

Kent, ME10 5BB

SRA Number: 656360

Tel: 01795 505992 | helpme@bridgerslaw.co.uk | www.bridgerslaw.co.uk

COASTAL LIVING AWAITS

Apartments and Beach Houses | Under an hour from Central London

Viewings available every day | 01303 760 940 | sales@folkestoneharbour.com

shorelinefolkestone.co.uk

Wealden Times | WT285 | February 2026 | Education Supplement inside

Transform your PDFs into Flipbooks and boost your revenue!

Wealden Times | WT285 | February 2026 | Education Supplement inside

Transform your PDFs into Flipbooks and boost your revenue!

Delete template?

Save as template ?