Mechanisms and Development of Antimicrobial ... - Helda - Helsinki.fi

helda.helsinki.fi

Mechanisms and Development of Antimicrobial ... - Helda - Helsinki.fi

Department of Food and Environmental Hygiene

Faculty of Veterinary Medicine

University of Helsinki

Helsinki, Finland

Mechanisms and Development of Antimicrobial

Resistance in Campylobacter with Special

Reference to Ciprofloxacin

Minna Hannula

ACADEMIC DISSERTATION

To be presented, with the permission of the Faculty of Veterinary Medicine, University

of Helsinki, for public examination in Hall 6, Fabianinkatu 33, Helsinki,

on June 4, 2010, at 12 noon.

1


Supervisor

Professor Marja-Liisa Hänninen, DVM, PhD

Department of Food and Environmental Hygiene

Faculty of Veterinary Medicine

University of Helsinki

Helsinki, Finland

Pre-examiners/Reviewers

Professor Séamus Fanning, PhD

School of Agriculture, Food Science & Veterinary Medicine

University College Dublin

Dublin, Ireland

and

Doctor Axel Cloeckaert, PhD

Infectiologie Animale Santé Publique

Institut National de la Recherche Agronomique

Nouzilly, France

Opponent

Docent Antti Hakanen, MD

National Institute for Health and Welfare

Antimicrobial Resistance Unit

Turku, Finland

ISBN 978-952-92-7360-7 (Paperback)

ISBN 978-952-10-6285-8 (PDF)

http://ethesis.helsinki.fi/

Helsinki University Print

Helsinki 2010

2


Abstract

In industrialized countries, campylobacteriosis is the most common cause of human

gastroenteric infection. It is mainly caused by Campylobacter jejuni and Campylobacter

coli, but the pathogenic role of other species, such as Campylobacter hyointestinalis,

remains unclear due to difficulties in cultivating these fastidious bacteria. Humans most

often become infected by ingesting contaminated water or food, especially undercooked

chicken. Campylobacteriosis is normally a self-limiting disease, but in severe cases the

patients are treated with antimicrobial agents. The predominant antimicrobial agents for

treating Campylobacter infections are erythromycin and ciprofloxacin. However, during

the past few decades resistant C. jejuni and C. coli strains have emerged at an alarming

rate due, at least partly, to the large-scale use of these agents in food production animals.

Understanding of the mechanisms underlying bacterial resistance can reveal the risks

involved in using antimicrobials in animal husbandry and ultimately help in preventing

antimicrobial resistance, which has life-threatening implications in human and animal

health. It was therefore the aim of this thesis to study the various resistance mechanisms of

C. jejuni, C. coli and C. hyointestinalis towards antimicrobial agents.

Finnish C. hyointestinalis strains are susceptible to most antimicrobials of veterinary

importance. When susceptibility to 12 different antimicrobials was tested, all the reindeer

strains proved susceptible, but in bovine strains resistance was observed in 32% and 24%

of the strains to streptomycin and sulphonamides, respectively. Since unlike bovines,

reindeer are very rarely treated with antimicrobials, the difference in the susceptibility

profile of the bovine and reindeer strains most probably reflects the veterinary use of these

substances in bovine husbandry, but not in reindeer.

Quinolone resistance in C. jejuni and C. coli has been associated with mutations in the

quinolone resistance-determining region (QRDR) of gyrA. Unlike these two species, C.

hyointestinalis is intrinsically resistant to nalidixic acid. To explain this phenomenon,

studies were conducted with the QRDR of C. hyointestinalis. The QRDR showed 73%

identity with that of C. jejuni, but mutations associated with nalidixic acid resistance in C.

jejuni were not found in C. hyointestinalis. However, inherent nalidixic acid resistance in

C. hyointestinalis was associated with efflux pumps since the efflux pump inhibitor,

PAβN, decreased the nalidixic acid resistance in C. hyointestinalis 2- to 8-fold. However,

susceptibility was not obtained, indicating the presence of other resistance mechanisms.

By inducing ciprofloxacin resistance in C. hyointestinalis, also the nalidixic acid MIC

values increased, indicating significant cross-resistance between these two agents. Highlevel

ciprofloxacin resistance (> 32 mg/l) in C. hyointestinalis was associated with the

same Thr86-Ile mutation in QRDR as in C. jejuni, but QRDR mutations did not explain

resistance at lower ciprofloxacin levels.

An efflux pump system, CmeABC, has been established to play an important role in

the resistance of C. jejuni and C. coli to various antimicrobial agents. When the effect of

efflux pump effectors on antimicrobial susceptibility of C. jejuni and C. coli was

evaluated, the efflux pump inhibitor PAβN emerged as the most potent. It increased the

susceptibility of C. jejuni and C. coli to erythromycin and rifampicin 8- to 32-fold and 8-

to 64-fold, respectively. Another inhibitor, NMP, decreased erythromycin, rifampicin and

3


tetracycline MIC values of C. jejuni and C. coli 1- to 8-fold, 2- to 8-fold and 1- to 4-fold,

respectively. The different results produced by these two inhibitors indicate a different

mode of function for these pump inhibitors. Of the two tested efflux pump inducers,

sodium salicylate produced a modest effect in the MIC values for ciprofloxacin and

rifampicin, and bile salt had no observable effect on the MIC values of the studied

antimicrobials, nor did it have any observable impact on the mutation frequencies of C.

jejuni and C. coli strains.

Since ciprofloxacin and erythromycin resistance in C. jejuni and C. coli involve a

mutation in a target gene, the mutation frequencies of C. jejuni and C. coli strains were

determined. The mutation frequency values differed strongly between different strains,

from hypomutable to strongly hypermutable. The relatively large proportion (25%) of

hypermutable strains may facilitate the adaptation of C. jejuni and C. coli to selective

environments. No correlation was seen between the mutation frequency values and

mutations in the QRDR or the promoter binding region of cmeABC after ciprofloxacin

exposure.

The emergence of QRDR mutations was evaluated by subjecting originally

ciprofloxacin-susceptible C. jejuni strains to low-level (0.125 or 1 mg/l) ciprofloxacin

concentration and determining the changes in ciprofloxacin MIC values and alterations in

the QRDR sequence data. After DNA extraction and sequencing of the QRDR of the

ciprofloxacin-exposed strains, multiple peaks were observed at nucleotide positions 256

and 267 in the QRDR-sequencing chromatograms, possibly reflecting different QRDR

subpopulations. However, some variants produced ciprofloxacin MIC levels of up to

16 mg/l, even though no peaks corresponding to mutated nucleotides in the QRDR were

observed; this suggests the presence of a QRDR-independent resistance mechanism. In

subsequent persistence studies, different QRDR subpopulations were able to persist and

co-exist in both the presence and absence of low-level ciprofloxacin concentration;

however, the QRDR-independent resistance mechanism was quickly replaced by QRDR

mutations in the persistence of ciprofloxacin challenge.

4


Acknowledgements

This study was carried out at the Department of Food and Environmental Hygiene,

Faculty of Veterinary Medicine, University of Helsinki. The work was funded by the

Finnish Graduate School on Applied Biosciences, the Walter Ehrström Foundation and the

Academy of Finland.

My gratitude is due to my supervisor, Professor Marja-Liisa Hänninen, for her time

and guidance. Without her support and trust, this thesis may never have been written.

Professor Séamus Fanning and Doctor Axel Cloeckaert are acknowledged for

reviewing my thesis and Carol Pelli for editing the English language of the manuscript.

I gratefully acknowledge Professor Hannu Korkeala, the Head of the Department of

Food and Environmental Hygiene, for providing high-standard research facilities.

My sincere thanks to all of my colleagues at the department for creating an enjoyable

and relaxed working atmosphere. Special thanks to Urszula Hirvi and Anneli Luoti for

their help in the laboratory, and to Johanna Seppälä for her much needed help with the

administration.

I also thank Doctor Rauni Kivistö for her friendship as well as practical assistance, and

Professor Hilpi Rautelin for supporting my work as well as co-writing one of the articles.

A sincere thank you to Doctor Heidi Hyytiäinen for reviewing and giving valuable

comments on this thesis. It was a pleasure working with you, even if for only a short

while.

A heartfelt thanks to my family for bringing so much joy and love into my life. Thank

you Jani, for being an amazing husband and a father to our gorgeous girls, Pinja and Isla. I

am also obliged to my mother and sister, two strong women who brought me up and to

whom I know I can always turn.

Finally, I dedicate this thesis to the memory of my grandmother, Liisa Nurmento, who

by her example taught me the real values of life.

5


Contents

Abstract 3

Acknowledgements 5

Abbreviations 8

List of original publications 9

1 Introduction 10

2 Review of the literature 12

2.1 Campylobacter spp. 12

2.2 Antimicrobial agents 14

2.2.1 Ciprofloxacin 17

2.2.2 Erythromycin 17

2.2.3 Tetracycline 18

2.3 Multiple drug resistance in Campylobacter 19

2.3.1 Efflux systems and efflux pump effectors 19

2.3.2 Role of the membrane proteins in Campylobacter resistance 21

2.4 Specific resistance mechanisms in Campylobacter 21

2.4.1 Resistance to fluoroquinolones 21

2.4.2 Resistance to macrolides 22

2.4.3 Resistance to tetracyclines 23

2.4.4 Resistance to other antimicrobial agents 23

2.5 Antimicrobial resistance in Campylobacter spp. 24

2.5.1 Intrinsic resistance 24

2.5.2 Incidence of resistance 25

2.5.3 Fitness and pathogenicity of resistant Campylobacter 28

2.5.4 Development of resistance 29

6


3 Aims of the study 31

4 Materials and methods 32

4.1 Bacterial strains and growth conditions 32

4.2 Antimicrobial agents and efflux pump effectors 33

4.3 Antimicrobial susceptibility testing 34

4.4 Estimation of mutation frequencies 35

4.5 DNA extraction, purification and sequencing 36

4.6 Development of mutations after ciprofloxacin challenge 37

5 Results 38

5.1 Susceptibility of C. hyointestinalis to antimicrobial agents 38

5.2 QRDR sequence analysis of C. hyointestinalis 39

5.3 Mutation frequency of C. jejuni and C. coli 40

5.4 cmeR–cmeA sequence analysis of C. jejuni and C. coli 41

5.5 Effect of efflux pump effectors on MIC values 42

5.6 Effect of ciprofloxacin in the development of gyrA mutations 44

6 Discussion 47

6.1 Susceptibility profile of Finnish C. hyointestinalis strains 47

6.2 Quinolone resistance mechanisms in C. hyointestinalis 48

6.3 Spontaneous mutation frequency of C. jejuni and C. coli 49

6.4 cmeR-cmeA sequence analysis of C. jejuni and C. coli 50

6.5 Effect of efflux pump effectors 51

6.5.1 Inhibitors 51

6.5.2 Inducers 52

6.6 Development and emergence of QRDR mutations 53

7 Conclusions 55

8 References 57

7


Abbreviations

AAC aminoglycoside acetyltransferase

AAD aminoglycoside adenyltransferase

Ala alanine

APH aminoglycoside phosphotransferase

Asn asparagine

ATCC American Type Culture Collection

bp base pair

cfu colony forming unit

CLSI Clinical and Laboratory Standards Institute

DDD/1000 inh/day defined daily dose/1000 inhabitants/day

Gly glycine

gyr gyrase

Ile isoleucine

IR inverted repeat

IT intergenic

Lys lysine

MDR multiple drug resistance

MH Mueller-Hinton

MIC minimum inhibitory concentration

MOMP major outer membrane protein

NMP 1-(1-naphthylmethyl)-piperazine

PAβN phenyl-arginine-β-naphthylamide

PCR polymerase chain reaction

Pro proline

QRDR quinolone resistance-determining region

RND resistance nodulation cell division

Ser serine

spp. species

Thr threonine

UV ultraviolet

8


List of original publications

This thesis is based on the following original articles referred to in the text by Roman

numerals I to IV:

I Laatu M, Rautelin H, Hänninen ML. 2005. Susceptibility of

Campylobacter hyointestinalis subsp. hyointestinalis to antimicrobial agents

and characterization of quinolone-resistant strains. Journal of Antimicrobial

Chemotherapy 55:182-7.

II Hänninen ML, Hannula M. 2007. Spontaneous mutation frequency and

emergence of ciprofloxacin resistance in Campylobacter jejuni and

Campylobacter coli. Journal of Antimicrobial Chemotherapy 60:1251-7.

III Hannula M, Hänninen ML. 2008. Effect of putative efflux pump inhibitors

and inducers on the antimicrobial susceptibility of Campylobacter jejuni and

Campylobacter coli. Journal of Medical Microbiology 57:851-5.

IV Hannula M, Hänninen ML. 2008. Effects of low-level ciprofloxacin

challenge in the in vitro development of ciprofloxacin resistance in

Campylobacter jejuni. Microbial Drug Resistance 14:197-201.

The original articles have been reprinted with the permission from their copyright holders:

British Society for Antimicrobial Chemotherapy (I and II), Society for General

Microbiology (III), Mary Ann Liebert, Inc. (IV). In addition, some unpublished material is

included.

9


1 Introduction

Campylobacter species are small, spirally curved and highly motile bacteria that are

commonly found in most animal species. Twenty-one Campylobacter species have

currently been validly characterized, the most important pathogenic species being

Campylobacter jejuni and to a lesser extent Campylobacter coli (Euzéby, 1997;

http://www.bacterio.cict.fr/, accessed December 2009). In humans, they cause illness,

campylobacteriosis, which is the most common cause of human gastroenteric infection in

industrialized countries and is responsible for diarrhoea in an estimated 400–500 million

people globally each year (Allos, 2001; Ruiz-Palacios, 2007). The role of other

Campylobacter species, such as Campylobacter hyointestinalis, in human and animal

disease may be greatly underestimated due to difficulties in cultivating these fastidious

and sensitive bacteria. While their impact on disease burden has earlier been thought to be

negligible, improved identification methods are likely to increase the detected numbers of

these rarer Campylobacter species (Logan et al., 2001).

Some of the Campylobacter species (see Table 1) are zoonotic pathogens, and humans

most often become infected by ingesting contaminated food or water. The most common

sources are raw or uncooked meat, especially poultry, contact with animals, unpasteurized

milk and contaminated drinking water (Harris et al., 1986; Adak et al., 1995; Olson et al.,

2008). Cases are usually sporadic, although outbreaks do occur as a result of, for example,

contamination of drinking water. Infection has been experimentally induced with as few as

500 organisms (Robinson, 1981). After an incubation period of 1–5 days, symptoms,

including diarrhoea, abdominal pain and fever, appear. Campylobacteriosis is normally a

self-limiting disease, and the symptoms usually resolve in a week. In some cases, lateonset

complications may occur, namely reactive arthritis (in 1- to 5% of Campylobacterinfected

patients) (Pope et al., 2007) and Guillain-Barré syndrome (in 0.01–0.03% of

Campylobacter enteritis patients) (McCarthy and Giesecke, 2001; Tam et al., 2006).

In severe cases, patients are treated with antimicrobial agents (Allos, 2001). The most

common antimicrobial agents for treating Campylobacter infections are macrolides, such

as erythromycin, and fluoroquinolones, such as ciprofloxacin (Blaser and Engberg, 2008).

However, resistant Campylobacter strains have recently emerged at an elevated rate due,

at least partly, to the large-scale use of these agents in food production animals (Blaser and

Engberg, 2008).

Although a number of different classes of antimicrobials exist, bacteria possess and are

able to acquire many different mechanisms that allow them to evade the action of these

substances. The rate at which the pharmaceutical industry has been introducing new

antibiotics has been inadequate to guarantee successful therapy against all pathogenic

bacterial strains. Understanding of the mechanisms underlying bacterial resistance could

lead to the development of new agents to challenge bacterial resistance mechanisms.

The aim of this thesis was to study the various resistance mechanisms of C. jejuni, C.

coli and C. hyointestinalis towards antimicrobial agents. Special attention was given to

ciprofloxacin, whose role as a key antimicrobial in the treatment of campylobacteriosis

has lately been compromised due to the rapid and forceful emergence of ciprofloxacinresistant

strains.

10


Specifically, the susceptibility profile of Finnish C. hyointestinalis strains was established

and the effect of antimicrobial use in the host animals was discussed. Differences in

quinolone resistance between C. hyointestinalis and C. jejuni were also investigated. The

predisposition of C. jejuni and C. coli to develop resistance was investigated by

establishing mutation frequencies of these species. The effect of low-level ciprofloxacin

exposure and the development of resistance in C. jejuni and C. coli were evaluated by

observing alterations, variation and development of mutations in the gene fragment coding

for the ciprofloxacin target site subsequent to ciprofloxacin challenge. Finally, the action

of efflux pump effectors on the susceptibility of C. jejuni, C. coli and C. hyointestinalis

towards several antimicrobials was elucidated to assess the efflux mechanism in these

species and to evaluate the potential of the putative efflux pump inhibitors in therapy.

11


2 Review of the literature

2.1 Campylobacter spp.

Bacteria with Campylobacter-like morphology were first isolated from domestic animals

about a century ago (McFadyean and Stockman, 1913), but it was not until the 1970s that

these bacteria began to become more widely recognized as human pathogens (Dekeyser et

al., 1972, Skirrow, 1977). Today, Campylobacter are recognized as the most important

cause of bacterial gastrointestinal infection in humans. In 2008, there were 4453

laboratory-confirmed cases of Campylobacter infection in Finland (National Infectious

Disease Registry, National Institute for Health and Welfare, Finland,

http://www3.ktl.fi/stat/). Approximately 70–80% of these infections were acquired abroad

(EFSA, 2009a).

Campylobacter species belong to the epsilon class of proteobacteria. Twenty-one

validly named Campylobacter species currently exist (Euzéby, 1997;

http://www.bacterio.cict.fr/, accessed December 2009). Members of the family

Campylobacteraceae are Gram-negative, curved or spiral rods, that are 0.2–0.8 µm wide

and 0.5–5 µm long (Debruyne et al., 2008). They require a microaerobic growth

environment and are typically motile with a single unsheathed flagellum at one or both

ends of the cell (Debruyne et al., 2008). Campylobacter spp. have been isolated from a

large variety of different animals, and each Campylobacter species seems to favour certain

animal species.

Campylobacter jejuni has been isolated from many different domestic and wild

animals, where it is considered a harmless commensal of the gastrointestinal tract,

although occasionally it has been associated with animal diseases (Euzéby, 1997;

http://www.bacterio.cict.fr/, accessed December 2009). The avian gut is a particularly

preferred reservoir for C. jejuni because it possesses optimal growth conditions such as a

temperature of 42°C. In humans, C. jejuni is responsible for the great majority of enteric

Campylobacter infections (80–90%) (Fitzgerald et al., 2008). Since broiler chickens are

often colonized with C. jejuni (see Table 6), eating or handling undercooked chicken meat

is considered one of the most important risk factors for human campylobacteriosis (Olson

et al., 2008).

Campylobacter coli is responsible for an estimated 5–10% of Campylobacter

infections (Fitzgerald et al., 2008). C. coli and C. jejuni are closely related and often

difficult to differentiate (Debruyne et al. 2008). Like C. jejuni, C. coli can be isolated from

many animal species, foods and environmental samples. The primary reservoir for C. coli

is pigs, up to 100% of which can be C. coli-positive (Saenz et al., 2000).

Some other Campylobacter species have also been associated with human disease

(Table 1), but in most studies the growth conditions are optimized for the selection of C.

jejuni and C. coli, leaving other Campylobacter species, including Campylobacter

hyointestinalis, often undetected and their actual prevalence underestimated.

12


Table 1. Campylobacter species associated with human disease (Euzéby, 1997;

http://www.bacterio.cict.fr/, accessed December 2009)

Campylobacter

species

Source Human disease Animal disease

C. coli Pigs and other Gastroenteritis,

Gastroenteritis,

domestic animals septicaemia, abortion abortion

C. concisus* Humans Periodontal disease,

gastroenteritis

Not known

C. curvus* Humans Periodontal disease,

gastroenteritis, reflux

disease

Not known

C. fetus Cattle, sheep Septicaemia, systemic

infection, abortion,

Abortion

C. gracilis* Humans Periodontal disease, deep

tissue infection,

abscesses, pneumonia,

empyema, ischial wound

Not known

C. hyointestinalis Cattle, pigs, deer,

humans

Gastroenteritis

Enteritis

C. jejuni Humans, poultry and Gastroenteritis,

Gastroenteritis,

other animals septicaemia, meningitis, hepatitis,

abortion, proctitis,

Guillain-Barré syndrome

abortion

C. lari* Poultry and other Gastroenteritis,

Gastroenteritis

animals

septicaemia

C. rectus* Humans Periodontal disease,

abscesses, reflux disease,

appendicitis

Not known

C. showae* Humans Periodontal disease Not known

C. sputorum* Domestic mammals,

humans

Abscesses, gastroenteritis Not known

C. upsaliensis Dogs, cats, humans Gastroenteritis, abortion,

septicaemia, abscesses

Gastroenteritis

* Pathogenic role unclear

C. hyointestinalis has been commonly isolated from many animals, notably cattle; 32% of

faecal samples tested positive for C. hyointestinalis in a study by Atabay and Corry

(1998), and 17.2% tested positive in a study by Inglis et al. (2005). In Finland, 15.3% of

bovine faecal samples and 6% of reindeer faecal samples have tested positive for this

species (Hänninen et al., 2002; Hakkinen and Hänninen, 2009). C. hyointestinalis has also

been associated with enteritis in pigs (Gebhart et al., 1985a), deer (Hill et al., 1987), cattle

(Diker and Ozlem, 1990) and humans (Fennell et al., 1986; Edmonds et al., 1987; Minet

et al., 1988; Salama et al., 1992; Gorkiewicz et al., 2002). The species C. hyointestinalis

13


includes two subspecies, namely hyointestinalis and lawsonii. The latter has been isolated

from pigs, but its clinical significance is yet unknown, whereas C. hyointestinalis subsp.

hyointestinalis has been associated with animal and human diarrhoea. At the genome

level, C. hyointestinalis is a very diverse species (On and Vandamme, 1997) and is closely

related to Campylobacter fetus, which is a major cause of septic abortion in domestic

animals and is also implicated in human illnesses (Lastovica and Allos, 2008). In this

thesis, C. hyointestinalis refers to C. hyointestinalis subsp. hyointestinalis.

2.2 Antimicrobial agents

Antimicrobial agents are defined as substances able to inhibit or kill micro-organisms.

They can be synthetic or semi-synthetic compounds or antibiotics: substances produced by

other micro-organisms. The major antibacterial classes are listed in Table 2 according to

their mode of function and chemical structure.

Table 2. Major antibacterial classes (Prescott, 2004)

Antibacterial class

Cell wall inhibitors

Exemplary drugs Target

Beta-lactams

Protein synthesis inhibitors

Penicillins: penicillins,

ampicillin, amoxicillin

Cephalosporins: cefalexin

Carbapenems: meropenem

Monobactams: aztreonam

Transpeptidase

Aminoglycosides Gentamicin, streptomycin,

kanamycin

30S ribosomal subunit

Lincosamides Lincomycin, clindamycin 50S ribosomal subunit

Tetracyclines Tetracycline, doxycycline 30S ribosomal subunit

Macrolides Erythromycin, tylosin 50S ribosomal subunit

Phenicols

Nucleic acid inhibitors

Chloramphenicol 50S ribosomal subunit

Sulfonamides Trimethoprim, bactrim Pteroate synthetase

Nitroimidazoles Metronidazole Nucleotides/DNaseI

Quinolones

RNA synthesis inhibitors

Ciprofloxacin, nalidixic acid Type II topoisomerases

Rifamycins Rifampicin RNA polymerase

The discovery of penicillin in 1928 by Alexander Fleming was the beginning of modern

antibiotic medicine. Mass production started in the 1940s, and today hundreds of

antimicrobials are available on the market. An estimated half of the globally produced

14


antimicrobials are used for food animals (World Health Organization, 2002).

Antimicrobials are used in animals as therapeutics, prophylactics and growth promoters.

According to a European survey, in 1997, approximately 100 mg of antimicrobials were

used for every kilogram of meat destined for human consumption, and almost all

antimicrobials used in animals were identical or related to substances used in human

medicine (Committee for Veterinary Medicinal Products, 1999). Table 3 presents recent

information about the amount of meat produced and antimicrobials used in animals in four

European countries.

Table 3. Meat production and animal consumption of antimicrobials in four different

European countries in 2007 or 2008

Country

Slaughtered animals for meat

production in 2008 (Eurostat, 2009)

(tonnes)

Finland 401 300 17.0 a

Sweden 526 200 16.4 b

Denmark 2 013 600 120.2 c

France 5 623 700 1179 d

a In 2008 (Finnish Medicines Agency, 2009b)

b In 2008 (National Veterinary Institute (SVA), 2009)

c In 2008 (DANMAP 2008, 2009), only food animals

d In 2007 (Chevance and Moulin, 2009)

15

Amount of

antimicrobials used in

animals (tonnes)

In 2006, the European Union banned the use of all antibiotics as growth promoters in its

member states. In Finland, the use of antimicrobials in animals has been monitored since

1995, at which time the total consumption was about 18 000 kg. Consumption declined to

its lowest point (about 13 000 kg) in 2003, but has since increased to 16 997 kg in 2008

(Table 3; Finnish Medicines Agency, 2009b). In Finland, β-lactams are the most

commonly used antimicrobials in animals (58%), followed by tetracyclines (18%) and

sulphonamides (17%) (Finnish Medicines Agency, 2009b).

A total of 21.68 defined daily dose/1000 inhabitants/day (DDD/1000 inh/day) of

systemic antibacterials were used in 2008 in human medicine according to Finnish sales

statistics (Finnish Medicines Agency, 2009a). Beta-lactam antibacterials were used most,

9.83 DDD/1000 inh/day, followed by tetracyclines, 4.24 DDD/1000 inh/day (Table 4).

Campylobacteriosis is usually a self-limiting disease, but in certain cases the use of

antimicrobials is justified, e.g. when the disease affects elderly people or people with

underlying illnesses or when the symptoms are prolonged or unusually severe (Allos,

2001). The drug of choice for treating campylobacteriosis is erythromycin, followed by

ciprofloxacin, and alternative therapeutic agents include tetracycline and aminoglycosides

(Blaser and Engberg, 2008; Murray et al., 2009).


Table 4. List of fluoroquinolones, macrolides and tetracyclines on the Finnish market and use of these substances in human and veterinary

medicine in 2008 (Finnish Medicines Agency, 2009a; Finnish Medicines Agency, 2009b)

Fluoroquinolones Macrolides Tetracyclines

Human medicine Veterinary medicine Human medicine Veterinary medicine Human medicine Veterinary medicine

Ciprofloxacin Danofloxacin Azitromycin Spiramycin

Doxicycline Oxytetracycline

Levofloxacin Difloxacin

Claritromycin Tulatromycin Lymecycline Chlortetracycline

Moxifloxacin Enrofloxacin Erythromycin Tylosin

Tetracycline

Norfloxacin Ibafloxacin

Roxitromycin

Tigecycline

Ofloxacin

Telitromycin

1.25

DDD/1000 inh/day a

90 kg b 1.45

847 kg 4.24

3022 kg

DDD/1000 inh/day

DDD/1000 inh/day

a

defined daily dose/1000 inhabitants/day

b

amount of active ingredient

16


2.2.1 Ciprofloxacin

Ciprofloxacin (Figure 1) is structurally a fluoroquinolone antimicrobial. It is a broadspectrum,

synthetic antimicrobial agent commonly used to treat many bacterial infections,

including campylobacteriosis. Nalidixic acid, a predecessor to fluoroquinolone

antimicrobials, belongs to the quinolone class of antimicrobials. Sitafloxacin is a newgeneration

fluoroquinolone that is more effective than ciprofloxacin against C. jejuni

strains, including those with a gyrA mutation (Sato et al., 1992; Lehtopolku et al., 2005),

but its approval in Europe is unlikely because in Caucasians sitafloxacin has been

associated with mild ultraviolet phototoxicity reactions (Dawe et al., 2003). In Finland,

less than 1% of antimicrobials used in animals are fluoroquinolones (Finnish Medicines

Agency, 2009b). The most commonly used fluoroquinolone in animals is enrofloxacin, the

main metabolite of which is ciprofloxacin (Küng et al., 1993). Fluoroquinolones used in

human and veterinary medicine in Finland are presented in Table 4.

Figure 1. Molecular structure of ciprofloxacin

Ciprofloxacin acts by inhibiting DNA synthesis. In a living bacterial cell, DNA is in a

negatively supercoiled form. These negative supercoils are removed by a topoisomerase II

DNA gyrase, and the daughter chromosomes are separated by topoisomerase IV, allowing

replication and transcription to take place (Drlica and Zhao, 1997). Quinolones act by

binding these topoisomerases, and in Gram-negative bacteria the quinolones interact

primarily with gyrase and DNA, thus inhibiting supercoiling and possibly forming a

cytotoxic complex leading to cell death (Maxwell, 1992).

2.2.2 Erythromycin

Erythromycin is a macrolide antibiotic, produced from a strain of Saccharopolyspora

erythraea. Its molecular structure is provided in Figure 2. Macrolides used in human and

veterinary medicine are presented in Table 4. Macrolides and lincosamides represented

about 5% of antimicrobials used in animals in Finland in 2008 (Finnish Medicines

Agency, 2009b).

17


Figure 2. Molecular structure of erythromycin

The mode of action of erythromycin is inhibition of protein synthesis by binding to the

23S rRNA in the 50S ribosomal subunit (Schlunzen et al., 2001). This sterically hinders

the binding of the peptidyl transfer RNA, which results in inhibition of translocation, thus

halting the elongation of the developing peptide chain (Brisson-Noel et al., 1988).

Erythromycin is the drug of choice for treating campylobacteriosis. It is a broad-spectrum,

fairly inexpensive and well-tolerated antibiotic that is effective against Campylobacter

spp. when administered during the first days of illness (Salazar-Lindo et al., 1986).

2.2.3 Tetracycline

Tetracycline (Figure 3) is a broad-spectrum antibiotic produced by bacteria in the genus

Streptomyces. Tetracyclines used in human and veterinary medicine in Finland are

presented in Table 4. Tetracyclines represent about 18% of the antimicrobials used in

animals (Finnish Medicines Agency, 2009b), but in many countries, such as France, it is

the most commonly used antimicrobial class in animals (Chevance and Moulin, 2009).

Figure 3. Molecular structure of tetracycline

Tetracycline binds to Mg

18

2+ cations in order to pass through outer membrane porins of

Gram-negative bacteria. In the periplasmic space, tetracycline dissociates from

magnesium and moves passively into the cytoplasm (Chopra and Roberts, 2001).

Tetracycline acts by binding to discrete sites on the ribosomal 30S subunit (Chopra et al.,

1992). Its primary antimicrobial effect takes place by direct steric hindrance by binding to

the A site in the 30S subunit, thus hindering the movement of transfer RNA (Harms et al.,

2003).


2.3 Multiple drug resistance in Campylobacter

According to definition, a bacterial strain can be considered resistant to a certain

antimicrobial agent if it is able to propagate in higher concentrations in that agent than

other strains of the same species or genus (Guardabassi and Courvalin, 2006). The

resistance level of a particular strain can be established by determining the lowest drug

concentration that completely inhibits the growth of the strain (minimal inhibitory

concentration, MIC).

Multiple drug resistance (MDR) in bacteria is associated with efflux systems and

structural components of the cell membrane. These mechanisms control the transport of

structurally unrelated substances in and out of the cell.

2.3.1 Efflux systems and efflux pump effectors

Energy-dependent drug efflux pumps are used in bacteria for extruding metabolites and

toxic compounds, including antimicrobial agents (Li and Nikaido, 2004). In C. jejuni,

several putative efflux systems have been identified (Parkhill et al., 2000; Ge et al., 2005).

Of these, two systems have been characterized as conferring MDR resistance, namely

CmeABC and CmeDEF (Lin et al., 2002; Pumbwe and Piddock, 2002; Pumbwe et al.,

2005).

Homologous CmeABC system has also been characterized in C. coli (Corcoran et al.,

2005; Ge et al., 2005), and identified in C. lari, C. upsaliensis and C. fetus (Guo et al.,

2010). CmeABC is coded by an operon consisting of three genes, cmeA, cmeB and cmeC,

which code for a periplasmic fusion protein, an inner membrane drug transporter and an

outer membrane protein, respectively (Figure 4) (Lin et al., 2002). CmeB belongs to the

resistance nodulation cell division (RND) family of efflux transporters (Pumbwe and

Piddock, 2002). Inactivation of the CmeABC efflux pump by insertional inactivation of

cmeB or with efflux pump inhibitors leads to increased susceptibility to a variety of

antibiotics, bile acids and other toxic substances, including those to which Campylobacter

are intrinsically resistant, showing that CmeABC plays a key role in both intrinsic and

acquired resistance of Campylobacter (Lin et al., 2002; Pumbwe and Piddock, 2002;

Pumbwe et al., 2004; Pumbwe et al., 2005; Akiba et al., 2006). CmeABC is regulated by

CmeR, which represses the transcription of cmeABC by binding to an inverted repeat

sequence in the 97 bp intergenic (IT) region between cmeR and cmeA (Figure 4) (Lin et

al., 2005a). Upregulation of CmeABC has been associated with inactivation of the cmeR,

substitutions in the substrate binding region of CmeR, a deletion or a mutation in the

inverted repeat sequence of the promoter binding region of the cmeABC and competitive

binding of bile salts to the promoter region of the cmeABC (Pumbwe et al., 2004; Lin et

al., 2005a; Lin et al., 2005b; Cagliero et al., 2007).

Another RND system, CmeDEF, has been identified in C. jejuni. It has a narrower

substrate profile and transports, for instance, bile acids and ampicillin, but not

ciprofloxacin, erythromycin or tetracycline (Pumbwe et al., 2005; Akiba et al., 2006). In a

study comparing CmeABC and CmeDEF systems, cmeF was expressed at a much lower

19


level than CmeABC, but evidence exists of an interaction between these two efflux

systems that promotes viability and resistance of C. jejuni in a hostile environment (Akiba

et al., 2006).

cmeR

cmeA cmeB cmeC

TATAATTAGCCAAAAATTTCTGTAATAAATATTACAATTTTTAATTTAATTTTTCAAGGCAAAACCATG

Figure 4. Genomic organization of the cmeABC operon in C. jejuni strain 81-176. A

part of the sequence of the intergenic (IT) region between cmeR and cmeA is shown.

The start codon (ATG) of cmeA is underlined and the inverted repeat is in bold.

Since efflux pump systems have a key role in the antimicrobial resistance of C. jejuni and

C. coli (Lin et al., 2002; Corcoran et al., 2005), inhibition of efflux would provide an

important means for preventing emerging resistance and multidrug resistance in bacteria.

To achieve this inhibition, synthetic and natural compound libraries have been screened

with the aim of finding substances capable of reversing the action of the efflux pumps.

After screening for efflux pump inhibitors and subsequently optimizing the properties of a

potential compound, Renau et al. (1999) were able to produce a substance called phenylarginine-β-naphthylamide

(PAβN), a broad-spectrum efflux pump inhibitor. It was first

characterized in Pseudomonas aeruginosa (Lomovskaya et al., 2001) and later studied in

several bacteria, including C. jejuni and C. coli (Payot et al., 2004; Cagliero et al., 2005;

Gibreel et al., 2007).

Similarly, by screening of an N-heterocyclic organic compound library for multidrug

reversal activity, Bohnert and Kern (2005) were able to characterize another putative

efflux pump inhibitor, 1-(1-naphthylmethyl)-piperazine (NMP), in Escherichia coli. It has

been shown to partially reverse multidrug resistance in some members of the

Enterobacteriaceae and in Acinetobacter baumannii (Bohnert and Kern, 2005; Pannek et

al., 2006; Schumacher et al., 2006).

Salicylate is a non-steroidal anti-inflammatory pharmaceutical agent and the active

component of aspirin, a prostaglandin synthesis inhibitor drug, commonly taken to relieve

fever and discomfort associated with infections as well as to prevent vascular diseases

(Weissmann, 1991). It is therefore of concern that salicylate has been associated with

increased resistance to multiple antibiotics in several bacteria, such as E. coli and

Salmonella serovar Typhimurium (Price et al., 2000). In E. coli, salicylic acid binds to a

repressor protein, MarR, which leads to over-expression of the global regulatory gene

marA. Subsequent to this, the outer membrane protein OmpF is down-regulated and the

synthesis of the RND multidrug efflux pump AcrAB-TolC increases, which eventually

results in decreased antimicrobial accumulation (Price et al., 2000).

20


Bile salts are antimicrobial compounds naturally present in the animal intestine. Multidrug

efflux pumps, such as CmeABC, contribute to the intrinsic resistance of C. jejuni to bile

salts (Lin et al., 2003). Lin et al. (2005b) have shown that bile salts increase the

expression of cmeABC in C. jejuni by preventing the binding of the transcriptional

repressor CmeR, and therefore, bile salts could be considered efflux pump inducers.

2.3.2 Role of the membrane proteins in Campylobacter resistance

Drugs can cross the bacterial membrane and enter the cell by using porin channels or by

diffusing through the lipid bilayer. Porin channels are postulated to be mainly used by

relatively small drugs, such as β-lactams, tetracycline, chloramphenicol and

fluoroquinolones, whereas large molecules, such as macrolides, diffuse slowly across the

lipid bilayer (Nikaido, 2003). In Campylobacter, two outer membrane porins have been

characterized: in C. jejuni and C. coli, the major outer membrane porin (MOMP) protein,

encoded by porA, and in C. jejuni Omp50 (Pagès et al., 1989; Bolla et al., 2000). Very

limited functional information is available about these porins, and thus far, no evidence

has emerged that they play any role in MDR of Campylobacter (Pumbwe et al., 2004).

2.4 Specific resistance mechanisms in Campylobacter

2.4.1 Resistance to fluoroquinolones

Two known resistance mechanisms that confer resistance in C. jejuni and C. coli to

fluoroquinolones are point mutations in the quinolone-resistance determining region

(QRDR) of gyrA and the function of the multidrug efflux pump CmeABC.

The target for ciprofloxacin activity in C. jejuni is gyrase, which comprises two

subunits encoded by gyrA and gyrB (Higgins et al., 1978). A single mutation in gyrA is

able to confer resistance to ciprofloxacin by reducing the affinity of gyrases to quinolones.

The most commonly found mutation in ciprofloxacin-resistant C. jejuni strains is the

Thr86-Ile mutation, which results from transition of cytosine to thymine at nucleotide 256,

conferring high-level resistance to ciprofloxacin (Charvalos et al., 1996; Mazzariol et al.,

2000; Zirnstein et al., 2000; Hakanen et al., 2002b; Piddock et al., 2003). Other reported

mutations include Thr86-Lys, Thr86-Ala, Ala70-Thr, Pro104-Ser, Asp90-Asn, Asp90-Tyr

and transitions at codon 119 (Charvalos et al., 1996; Ruiz et al., 1998; Zirnstein et al.,

1999; Bachoual et al., 2001; Hakanen et al., 2002b; Yan et al., 2006). These mutations are

less frequently observed and are associated with intermediate-level fluoroquinolone

resistance.

In some instances, QRDR mutations have not been detected in ciprofloxacin-resistant C.

jejuni (Hakanen et al., 2003; Piddock et al., 2003; Pumbwe et al., 2004), suggesting

another mechanism for ciprofloxacin resistance. Studies with mutant strains where the

21


CmeABC efflux pump was inactivated by a cmeB insert showed a 4- to 8-fold increase in

ciprofloxacin susceptibility, and accumulation studies clearly indicated an increased

accumulation of ciprofloxacin compared with the wild-type parent strain (Lin et al., 2002;

Pumbwe and Piddock, 2002). Experiments where MIC values well below the level of

clinical significance were often obtained by insertional inactivation of cmeB in originally

resistant C. jejuni strains possessing various gyrA, suggest the existence of synergism

between these two resistance mechanisms, namely efflux and target mutations (Luo et al.,

2003).

2.4.2 Resistance to macrolides

Macrolide resistance in C. jejuni and C. coli involves two mechanisms, namely target

modification and efflux.

Mutations in 23S rRNA block the interaction of macrolide drugs with the 50S

ribosomal subunit, and thus, confer macrolide resistance. Specifically, mutations at base

positions 2074 and 2075 are associated with high-level macrolide resistance in C. jejuni

and C. coli (Jensen and Aarestrup, 2001; Vacher et al., 2003; Gibreel et al., 2005; Mamelli

et al., 2005). Mutations at these positions are likely to block the binding of macrolides to

their inhibitory site on the 23S ribosomal subunit (Pfister et al., 2004). The predominant

mutation in erythromycin-resistant strains is A2075G (Gibreel and Taylor, 2006), and in

some strains these two mutations have been found to co-exist (Vacher et al., 2003; Vacher

et al., 2005).

The chromosome of C. jejuni and C. coli contains three copies of the 23S rRNA gene

(Fouts et al., 2005). In erythromycin-resistant strains, generally all copies carry macrolide

resistance-associated mutations, but the co-existence of wild-type alleles does not seem to

affect the resistance level (Jensen and Aarestrup, 2001; Gibreel et al., 2005).

In addition to 23S RNA mutations, mutations in ribosomal proteins L4 (G74D) and

L22 (insertions at position 86 or 98) have been implicated in conferring macrolide

resistance to C. jejuni and C. coli (Cagliero et al., 2006b).

The involvement of an efflux system in the macrolide resistance of C. jejuni and C.

coli has been demonstrated in studies using the efflux pump inhibitor β-naphtylamide

(PAβN) (Lomovskaya et al., 2001; Payot et al., 2004; Cagliero et al., 2005; Martinez and

Lin, 2006; Gibreel et al., 2007) and using insertional inactivation of the cmeB gene (Payot

et al., 2004; Cagliero et al., 2005; Gibreel et al., 2007). In C. coli isolates with low-level

erythromycin resistance (MICs 8–16 mg/l), no mutations have been detected in the target

gene (Payot et al., 2004), and in these isolates the inactivation of CmeABC leads to

restored susceptibility to erythromycin, suggesting the involvement of CmeABC in the

intrinsic resistance of Campylobacter (Cagliero et al., 2005; Lin et al., 2007). In isolates

with a high erythromycin resistance level (MIC > 128 mg/l), the resistance is associated

with a mutation in the 23S rRNA gene (Payot et al., 2004). In these isolates, the

inactivation of CmeABC leads to 2- to 4-fold decrease in erythromycin resistance,

implying synergistic action with the target mutations in achieving acquired macrolide

resistance (Cagliero et al., 2005; Cagliero et al., 2006a; Lin et al., 2007).

22


In a study by Lin et al. (2005a), a deletion in the promoter region of the cmeABC operon

was spontaneously obtained by selection on a ciprofloxacin-containing medium. This

resulted in increased resistance to several antimicrobials, including erythromycin,

suggesting a possible role of promoter region mutants in the development of

erythromycin-resistant C. jejuni strains.

2.4.3 Resistance to tetracyclines

Tetracycline resistance in C. jejuni and C. coli involves ribosomal protection and efflux

mechanisms.

The ribosomal protection is mediated by a protection protein termed Tet(O)

(Manavathu et al., 1988) that is structurally related to translational ribosome-binding

proteins (Connell et al., 2003). Tet(O) is coded by a gene located on plasmids of different

sizes and in some strains chromosomally (Lee et al., 1994; Gibreel et al., 2004). Several

studies have demonstrated that tet(O)-carrying plasmids can be transferred via conjugation

between C. jejuni and C. coli strains in vivo and in vitro (Avrain et al., 2004; Batchelor et

al., 2004; Gibreel et al., 2004; Pratt and Korolik, 2005). Tet(O) acts by removing

tetracycline bound to the A-site in the ribosomal 30S subunit (Connell et al., 2002).

Specifically, Tet(O) induces a conformational change, which is functionally opposite to

that of tetracycline and which allosterically distorts the tetracycline-binding site, resulting

in the release of tetracycline (Connell et al., 2003). Even after the Tet(O) has left the

ribosome, the induced conformation persists, thus preventing rebinding of the tetracycline

(Connell et al., 2003).

The multidrug efflux pump CmeABC has been implicated in intrinsic and acquired

tetracycline resistance (Lin et al., 2002; Pumbwe and Piddock, 2002; Gibreel et al., 2007).

Insertional inactivation of the CmeABC pump in a tetracycline-susceptible strain led to an

8-fold increase in susceptibility, and in tetracycline-resistant isolates to a 16- to 128-fold

decrease in tetracycline resistance (Lin et al., 2002; Pumbwe and Piddock, 2002; Gibreel

et al., 2007). Addition of the pump inhibitor PAβN reduced tetracycline resistance less

than 2-fold (Gibreel et al., 2007).

2.4.4 Resistance to other antimicrobial agents

Aminoglycosides act by binding to the decoding region in the A-site of the ribosomal 30S

subunit. This interaction results in aberrant proteins by interfering with accurate codonanticodon

recognition and in disruption of elongation of nascent proteins by inhibiting the

translocation of tRNA from the A-site to the P-site (Jana and Deb, 2006). Aminoglycoside

resistance is mediated by enzymatic modification that diminishes affinity of

aminoglycosides for the rRNA A-site (Llano-Sotelo et al., 2002). These enzymes fall into

three classes: aminoglycoside acetyltransferases (AAC), aminoglycoside

adenyltransferases (AAD) and aminoglycoside phosphotransferases (APH), each of which

has its own characteristic modification sites and substrates (Engberg et al., 2006). APH is

23


the most common enzyme found in C. jejuni and C. coli (Taylor et al., 1988; Tenover et

al., 1992).

β-lactam molecules enter Campylobacter through outer membrane porin channels.

Once inside, β-lactams bind to enzymes involved in cell wall synthesis, preventing crosslinking

of the peptidoglycan network of the cell wall and resulting in the swelling and

eventually bursting of the bacterial cell (Siu, 2002). While Campylobacter spp. are

generally inherently resistant to many β-lactams, they remain susceptible to, for example,

amoxicillin and ampicillin (Tajada et al., 1996). According to the study of Pagès et al.

(1989), the pores of porins in C. jejuni and C. coli are cation-selective and so small that

most of the large, anionic β-lactams are unable to diffuse through them. A vast majority of

C. jejuni and C. coli isolates are also able to produce β-lactamases, which inactivate the βlactam

molecule by hydrolysing the structural lactam ring (Sykes and Matthew, 1976;

Tajada et al., 1996). A third mechanism for β-lactam resistance in C. jejuni is the action of

efflux pumps. Several recent studies have demonstrated a significant increase in

susceptibility to ampicillin in CmeABC-inactivated C. jejuni mutants and a decrease in

susceptibility in CmeABC-overexpressing mutants (Lin et al., 2002; Pumbwe and

Piddock, 2002; Pumbwe et al., 2005), but this phenomenon was less pronounced in

ampicillin-resistant and β-lactamase-positive strains (Lin et al., 2002).

Chloramphenicol inhibits bacterial protein biosynthesis by preventing peptide chain

elongation. It binds reversibly to the peptidyltransferase centre at the 50S ribosomal

subunit (Schlunzen et al., 2001). Chloramphenicol resistance is conferred by a plasmidcarried

cat gene that encodes acetyltransferase, which modifies chloramphenicol in a way

that prevents it from binding to ribosomes (Schwarz et al., 2004). Although

chloramphenicol resistance in Campylobacter is rare, a plasmid-carried chloramphenicol

resistance gene has been reported in C. coli (Wang and Taylor, 1990).

2.5 Antimicrobial resistance in Campylobacter spp.

2.5.1 Intrinsic resistance

C. jejuni, C. coli and C. hyointestinalis are considered intrinsically resistant to at least

polymyxin B, bacitracin, novobiocin, vancomycin, certain cephalosporins and penicillins,

rifampicin, trimethoprim and cycloheximide (Gebhart et al., 1985b; Ng et al., 1985).

Some of these agents are often included in Campylobacter selective media to inhibit the

growth of other bacteria, but it must be noted that not all Campylobacter species have the

same intrinsic resistance profile. For example, C. hyointestinalis is intrinsically

cephalothin-resistant and nalidixic acid-resistant, whereas C. jejuni and C. coli are

nalidixic acid-susceptible and cephalothin-resistant, and Campylobacter upsaliensis is

susceptible to both of these agents and Campylobacter lari is resistant to both of these

agents (Lastovica and Allos, 2008).

24


Intrinsic resistance arises from insensitivity of a bacterial species, due to a structural or

functional characteristic, to a particular antimicrobial agent. This insensitivity in

Campylobacter may be due to the following:

(1) low affinity of the antimicrobial agent for the bacterial target (e.g. trimethoprim,

certain β-lactams)

(2) inability of the antimicrobial agent to cross the outer membrane (e.g. certain β-lactams)

(3) extrusion of the antimicrobial by the bacterial efflux system (e.g. rifampicin,

polymyxin B, certain cephalosporins, novobiocin)

(4) bacterial production of enzymes capable of inactivating the antimicrobial (e.g. βlactamases)

(Tajada et al., 1996; Gibreel and Skold, 1998).

2.5.2 Incidence of resistance

Geographical differences in resistance profiles of C. jejuni are significant; however,

resistance to antimicrobial agents of clinical importance has clearly increased over the last

few decades. For example, in a Canadian study of human C. jejuni samples, the frequency

of tetracycline resistance in 1980 was 6.5% and in 1999–2002 it had reached 50% (Gibreel

et al., 2004). Similarly, in an American study fluoroquinolone resistance in human C.

jejuni samples was found to increase from 0% in 1995 to 40.5% in 2001 (Nachamkin et

al., 2002) and in a Dutch study from 0% in 1982 to 32% in 2002 (van Hees et al., 2007).

In all of the above-cited studies, erythromycin resistance, on the other hand, had remained

at a low level (0–5%), although some studies report up to 18% and 60% resistance to

erythromycin in human and chicken C. jejuni and C. coli isolates, respectively (Li et al.,

1998).

Several studies have shown greater prevalence for erythromycin resistance in C. coli

than in C. jejuni (Gibreel and Taylor, 2006). This may be explained by the pig being a

natural host for C. coli and the chicken for C. jejuni, and macrolides being used more

often on pig farms than on poultry farms. In addition, pigs become more exposed to

macrolides due to their longer production cycles (Lin et al., 2007).

An overview of the studies on resistance prevalence (%) in human C. jejuni and C. coli

samples is presented in Table 5, and in chicken and pig C. jejuni and C. coli isolates in

Table 6.

25


Table 5. Resistance profiles of four antimicrobial agents for C. jejuni and C. coli isolated from human faecal samples in six different

countries, reported as percentage of resistant strains

Country Isolates tested

Erythromycin

C. jejuni C. coli

Ciprofloxacin

C. jejuni C. coli

Tetracycline

C. jejuni C. coli

Gentamicin

C. jejuni C. coli

Finland 1 478 0.2 4.3 0.8 7

Denmark 2 185 1.6 28.1 17.3 0

Taiwan 3 93 10 50 52 75 95 85 1 15

Canada 4 203 0 2 49.8

Germany 5 430 0 29.4 46.2 41.2 38.5 35.3 0 0

France 6 5685 1.4 12.5 25.3 42.0 28.8 53.4 0 0

1

(Schönberg-Norio et al., 2006), domestic strains only, reported as joint values for C. jejuni and C. coli strains

2

(DANMAP 2008, 2009), domestic strains only

3 (Li et al., 1998)

4 (Gibreel et al., 2004)

5 (Luber et al., 2003)

6 (Gallay et al., 2007)

7 Doxycycline

26


Table 6. Percentage of resistant C. jejuni and C. coli isolates isolated from chickens and pigs, respectively, and percentage of Campylobacterpositive

broiler flocks in four different European countries

Country

Campylobacterpositive

animals 1

(%)

Resistance to antimicrobials (%)

Ciprofloxacin Erythromycin Tetracycline Streptomycin Gentamicin

C. jejuni C. coli C. jejuni C. coli C. jejuni C. coli C. jejuni C. coli C. jejuni C. coli

Finland 2 7.1 1.2 8 0 0 0 0 4.9 NA 1.2 0

Sweden 3 12.6 0 30 0 1 0 2 0 57 0 0

Denmark 4 26.8 12.2 7.1 0 15.3 9.8 5.1 4.9 51.0 0 0

France 5 80.2 30.4 55.3 0 13.2 50 78.9 3.6 15.8 0 0

1

In 2007 (European Food Safety Authority, 2009)

2

In 2007 and 2008 (FINRES-Vet 2008, 2009; FINRES-Vet 2007, 2008), 81 C. jejuni and 62 C. coli isolates tested

3

In 2008 (National Veterinary Institute (SVA), 2009), C. coli values are hippurate-negative thermophilic Campylobacter spp. from pigs: 38

C. jejuni and 97 C. coli isolates tested

4

In 2008 (DANMAP 2008, 2009), 82 C. jejuni and 98 C. coli isolates tested

5

In 2007 (EFSA, 2009b), C. coli values from chicken: 56 C. jejuni and 76 C. coli isolates tested

27


2.5.3 Fitness and pathogenicity of resistant Campylobacter

Campylobacter resistance to a particular antimicrobial is often a result of a mutation in the

gene encoding the target site of that antimicrobial. These target sites, such as DNA gyrase

and RNA polymerase, are essential for bacterial propagation, and mutations encoding

these sites may result in reduced fitness of these bacteria in the absence of selective

pressure by antimicrobials (Andersson and Levin, 1999). Contrary to this,

fluoroquinolone-resistant C. jejuni strains showed enhanced fitness and the ability to outcompete

fluoroquinolone-susceptible strains when these two strains were inoculated into

chickens (Luo et al., 2005). This finding is supported by epidemiological studies revealing

the prevalence of fluoroquinolone-resistant C. jejuni and C. coli on chicken farms for at

least 1–4 years after the farms had stopped using fluoroquinolones (Pedersen and

Wedderkopp, 2003; Price et al., 2005). Interestingly, this fitness is not explained by

compensatory mutations, but is directly linked to the Thr86-Ile mutation in gyrA (Luo et

al., 2005). Likewise, tetracycline-resistant C. jejuni strains have shown evidence of

enhanced fitness. Tetracycline resistance in C. jejuni is conferred by the tet(O)-plasmid

obtained by horizontal transfer even in the absence of antimicrobial selection pressure

(Avrain et al., 2004). In studies by Luangtongkum et al. (2008), tetracycline-resistant

Campylobacter strains were able to co-exist or replace tetracycline-susceptible strains on

organic poultry farms.

In contrast to fluoroquinolone- or tetracycline-resistant Campylobacter, erythromycinresistant

Campylobacter are less fit in the absence of the selection pressure, and hence, are

rapidly outcompeted by susceptible wild-type strains (Luangtongkum et al., 2009). Similar

conclusions can be drawn from such countries as Denmark, where by reducing the amount

of macrolides used in food animals the numbers of macrolide-resistant C. coli rapidly

decreased (Aarestrup et al., 2008).

Enhanced fitness of resistant Campylobacter strains causing campylobacteriosis may

have implications for human health. Enhanced fitness of resistant strains is likely to

increase the number of resistant strains also in human clinical samples. In addition, in

some studies fluoroquinolone-resistant Campylobacter strains have been demonstrated to

prolong disease, lengthening the duration of diarrhoea by an average of 3 days, compared

with disease inflicted by fluoroquinolone-susceptible strains (Smith et al., 1999; Engberg

et al., 2004; Nelson et al., 2004). Both quinolone- and macrolide-resistant strains have

been associated with increased risk of invasive illness or death, compared with susceptible

strains. This risk was calculated to be 6-fold greater for quinolone-resistant strains and >5fold

greater for macrolide-resistant strains (Helms et al., 2005). However, the opposite

results have also been obtained, with ciprofloxacin-susceptible isolates being associated

with more severe disease (Feodoroff et al., 2009). In a re-analysis of ciprofloxacinresistant

C. jejuni infections, Wassenaar et al. (2007) concluded that fluoroquinoloneresistant

Campylobacter infections are no more severe than infections with susceptible

bacteria.

28


2.5.4 Development of resistance

Mutations play a major role in Campylobacter resistance. Several mechanisms have been

reported to contribute to the emergence of these mutations:

Whole-genome analyses have revealed that C. jejuni lack many of the genes encoding

DNA repair molecules present in other bacteria, e.g. mutH and mutL (methyl-directed

mismatch repair), sbcB (recombination repair), phr (repair of pyrimidine dimers) and vsr

(very short patch repair), as well as genes protecting from UV-induced mutagenesis

(umuCD) and alkylating agents (ada gene) (Parkhill et al., 2000; Fouts et al., 2005; Zhang

et al., 2006), facilitating the appearance of mutations.

Emergence of mutations conferring fluoroquinolone resistance in C. jejuni has been

associated with Mfd, a transcription-repair coupling factor, as Han et al. (2008) recently

showed that Mfd increases the frequency of mutations associated with fluoroquinolone

resistance and that ciprofloxacin upregulates the mfd gene encoding this molecule.

Finally, the expression level of CmeABC has been demonstrated to affect the

frequency of spontaneous ciprofloxacin mutants in such a way that inactivation of

CmeABC decreases and overexpression of CmeABC increases the frequency of

emergence of mutations conferring ciprofloxacin resistance (Yan et al., 2006).

Mutation frequency for macrolide resistance in C. jejuni and C. coli has been revealed

to be low (~10 -10 /cell/generation) (Lin et al., 2007). This is congruent with a study

showing that a single macrolide treatment of Campylobacter-infected chickens did not

select for erythromycin resistance, in contrast to similar studies conducted with

fluoroquinolones (Lin et al., 2007). However, continuous use of tylosin in chicken feed

did result in emergence of erythromycin-resistant C. jejuni and C. coli (Ladely et al.,

2007; Lin et al., 2007).

Besides spontaneous mutations, Campylobacter are also able to acquire resistance

determinants by natural transformation, transduction or conjugation, e.g. conjugation of

tet(O)-carrying plasmids (Zhang and Plummer, 2008). In the presence of antimicrobial

selection pressure, the bacteria containing these resistance determinants out-compete the

susceptible bacteria, eventually leading to a resistant strain.

A predicted 28% of human patients treated with a fluoroquinolone will develop

resistance against fluoroquinolones (Wistrom and Norrby, 1995; Engberg et al., 2006). In

addition, the emergence of Campylobacter resistance in human clinical samples has been

shown to be closely connected to antimicrobial resistance found in animals (Smith et al.,

1999). The transmission of resistant Campylobacter strains has been contemplated in

several studies, where a temporal association between resistant animal and human strains

has been investigated (Endtz et al., 1991). Antimicrobial agents with clinical significance

to treating campylobacteriosis in humans, such as macrolides, fluoroquinolones and

tetracyclines, have all been used extensively in farm animals as therapeutic agents,

prophylactics or growth promoters. Since the beginning of large-scale use of

fluoroquinolones in the early 1990s, the number of resistant Campylobacter strains has

clearly increased in both farm animals and humans. For example, in a Dutch study,

fluoroquinolone resistance in 1982 was non-existent in broilers and clinical samples, but

by 2002–2004 it had reached 35% in broilers and 34% in human clinical samples (Endtz et

29


al., 1991; van Hees et al., 2007). Similarly, in a Finnish study where antimicrobial

resistance in C. jejuni and C. coli isolates from human clinical samples from 1978–1980

and 1990 were compared, ciprofloxacin resistance was observed to rise from 0% to 9%

over a decade (Rautelin et al., 1991). By 1999, 14 % of human clinical isolates were

ciprofloxacin-resistant (Rautelin et al., 2003).

A summary of characteristics involved in the emergence of fluoroquinolone, macrolide

and tetracycline resistance in C. jejuni is presented in Table 7.

Table 7. Resistance characteristics of C. jejuni to macrolides, fluoroquinolones and

tetracyclines

Characteristic

Macrolide

Antimicrobial class

Fluoroquinolone Tetracycline

Antimicrobial target 50S rRNA Gyrase 30S rRNA

Primary resistance

mechanism

Target mutation Target mutation Protein protection

Emergence of

resistance

Spontaneous

mutation

Spontaneous

mutation

Conjugation

Selection of

resistance

Slow, multistep Rapid, single step Rapid, single step

Fitness

Significant fitness

cost

No fitness cost/

enhanced fitness

No fitness cost/

enhanced fitness

Trends in resistance Slow increase Very rapid increase Very rapid increase

30


3 Aims of the study

The major aim of this thesis was to investigate development of antimicrobial resistance

and resistance mechanisms in C. jejuni, C. coli and C. hyointestinalis, especially with

respect to ciprofloxacin. Specific aims were as follows:

1. To establish the susceptibility profile of Finnish C. hyointestinalis strains to

a panel of antimicrobial agents

2. To study and compare quinolone resistance mechanisms in C. hyointestinalis

and C. jejuni

3. To assess the role of efflux in the development of resistance and the effect of

efflux pump inducers and inhibitors on the antimicrobial susceptibility of C.

coli, C. jejuni and C. hyointestinalis

4. To establish the spontaneous mutation frequencies in a group of C. jejuni

and C. coli strains

5. To characterize the development and emergence of mutations associated

with ciprofloxacin resistance in the QRDR of gyrA and in the promoter

region of the CmeABC-efflux pump

31


4 Materials and methods

4.1 Bacterial strains and growth conditions

The 49 C. hyointestinalis subsp. hyointestinalis strains used in Study I were isolated from

Finnish reindeer and bovine faecal samples. Twenty-four reindeer strains were isolated in

1998 from faeces contained in the rectums of slaughtered animals (Hänninen et al., 2002),

and 25 bovine isolates were obtained from rectal faecal samples collected in

slaughterhouses in Finland in 2003 (Hakkinen et al., 2007), except for strain B704, which

was isolated in 1998. C. jejuni and C. coli strains used in Studies I-IV are listed in Table 8.

Table 8. C. jejuni and C. coli strains used in Studies I–IV

Species Strain no. Source Study

C. jejuni 143483 Reference strain (Hakanen et al., 2002a) I

ATCC 33560 Reference strain (McDermott et al., 2004) II, III, IV

B1 Chicken II, IV

B5 Chicken II, IV

B42 Chicken II, III

B67 Chicken II, III, IV

B68 Chicken IV

BR1 Chicken II

Brt1 Chicken III

FB6371 Chicken II

6507 Chicken II

14/8R Chicken II

49/7R Chicken II, III, IV

49/7RAT Laboratory-induced mutant* II, III, IV

N191 Cattle II

C. coli B25 Chicken II, III

6590 Chicken II, III

6590AT Laboratory-induced mutant* II

S140R Pig II, III

72277 Pig II, III

T72498 Pig II

* Mutants 49/7RAT and 6590AT were obtained by serial passage of strains 49/7R and

6590, respectively, in increasing concentrations of tetracycline and ampicillin

All strains were grown on Mueller-Hinton (MH) agar (Oxoid Ltd., London, UK),

supplemented with 5% horse blood or without agitation in MH broth (Oxoid Ltd.) and

incubated at 37°C for 48 h under microaerobic conditions (5% O2, 10% CO2 and 85% N2).

32


4.2 Antimicrobial agents and efflux pump effectors

Antimicrobial discs and efflux pump effectors used in studies I-III are presented in Table

9.

Table 9. Antimicrobial discs, efflux pump effectors and the employed concentrations used

in Studies I, II and III.

Antimicrobial agents, Study I

Amoxicillin 10 µg

Co-amoxiclav (amoxicillin + potassium clavulanate) 30 µg

Ampicillin 25 µg

Gentamicin 10 µg

Streptomycin 10 µg

Lincomycin 15 µg

Erythromycin 15 µg

Tetracycline 10 µg

Doxycycline hydrochloride 30 µg

Ciprofloxacin 5 µg

Metronidazole 5 µg

Compound S3 (sulfadiazine, sulfathiazole, sulfamerazine) 300 µg

Efflux pump effectors

Phenyl-arginine-β-naphthylamide (PAβN), Studies I, III 50 mg/l

1-(1-naphthylmethyl)-piperazine (NMP), Study III 100 mg/l

Sodium salicylate, Study III 100 mg/l

Sodium deoxycholate, Study III 1 mg/ml

Ox biles, Study II 20 mg/ml

33


4.3 Antimicrobial susceptibility testing

Agar dilution method

Agar dilution was used in all studies and together with broth dilution it is the only

standard susceptibility testing method for Campylobacter approved by the Clinical and

Laboratory Standards Institute (CLSI). However, for Campylobacter, no internationally

accepted minimum inhibitory concentration (MIC) interpretive criteria or resistance cutoff

values have been established for agar dilution or any of the other methods. In these

studies, we used veterinary-specific breakpoints generated for the Enterobacteriaceae by

CLSI (NCCLS, 2002) or epidemiological cut-off values recommended by EUCAST

(http://www.eucast.org) for C. jejuni or C. coli (see Table 10).

The method for agar dilution was adapted from CLSI-recommended guidelines

(NCCLS, 2002). Briefly, a stock solution of antimicrobial agent was prepared and

incorporated in doubling dilutions into Mueller-Hinton (MH) blood agar plates (for

concentration ranges for each antimicrobial agent, see Table 10). C. jejuni, C. coli and C.

hyointestinalis were incubated under microaerophilic conditions in 5 ml of MH broth and

diluted for a turbidity equivalent of 0.5 McFarland standard. Then, by using a 19-point

inoculator, bacterial suspensions from up to 19 Campylobacter strains were inoculated on

MH plates containing different concentrations of antimicrobials, and incubation was

performed at 37 °C for 48 h under microaerophilic conditions. To control contamination

and antimicrobial agent carry-over, agar plates containing no antimicrobial agent were

identically inoculated. After 48 h, for each bacterial suspension the lowest concentration

of antimicrobial agent that completely inhibited bacterial growth was recorded as the MIC

value. Quality control strains ATCC 33560 or 143483, for which quality control ranges

have been established, were included in all studies (Hakanen et al., 2002a; McDermott et

al., 2004).

Table 10. Concentration ranges and cut-off values for MIC determination of the

antimicrobial agents used

Antimicrobial agent Concentration range (mg/l) Cut-off value (mg/l)

Ampicillin 0.125–16 8

Ciprofloxacin 0.032–128 4

Erythromycin 0.032–16 16

Kanamycin 0.5–8 64

Nalidixic acid 1–512 32

Rifampicin 2–2048 4

Tetracycline 0.125–128 16

34


Disc diffusion method

The agar disc diffusion method is a widely used, relatively low-cost method for screening

antimicrobial susceptibility that provides results classifying isolates as resistant,

intermediate or susceptible (Watts and Lindeman, 2006). However, breakpoint values for

resistant Campylobacter have not been established. The agar disc diffusion technique was

used in Study I to characterize the susceptibility profile of 49 C. hyointestinalis strains to

12 antimicrobial agents (Table 9). Disc diffusion testing was performed according to

CLSI-recommended guidelines (Clinical and Laboratory Standards Institute, 2004).

Briefly, fresh bacterial cultures were incubated for 48 h in microaerophilic conditions in

5 ml of MH broth and diluted for a turbidity equivalent of 0.5 McFarland standard. The

bacterial suspension was inoculated on an MH blood agar plate with a sterile swab that

was streaked over the entire agar surface to ensure even distribution of the suspension.

After the excess moisture was absorbed, up to three antimicrobial discs (Table 9) were

applied on one plate with sterile forceps. The plates were incubated at 37°C for 48 h in

microaerophilic conditions. The results were recorded as the diameters of the zones of

inhibition in millimetres. C. jejuni 143483 was used as a control strain.

4.4 Estimation of mutation frequencies

Mutation frequencies in C. jejuni and C. coli were investigated in Study II using the

methods of Björkholm et al. (2001) and Wang et al. (2001), with minor modifications. A

schematic presentation of the process is presented in Figure 5. Briefly, C. jejuni and C.

coli strains were grown in 5 ml of Brucella broth for 48 h. Then, 30 µl of bacterial

suspension was used to inoculate each of the 20 tubes containing 3 ml of a Brucella broth.

Tubes were grown for 48 h at 37°C. After incubation, 500 µl of suspension was spread on

Brucella agar plate containing 1 mg/l of ciprofloxacin. Plates were incubated for 3–4 days

in a microaerobic atmosphere at 37°C, and the colonies were counted. If the number of

colonies was too high, the experiment was repeated using 100 µl of 10-fold dilution for

the inoculation of the ciprofloxacin-containing Brucella plate.

The number of viable bacteria was determined in each experiment by plating 10 –6 , 10 –7

and 10 –8 dilutions from three tubes on non-selective Brucella blood agar plates.

The mutation frequency was calculated as the mean number of colonies found on the

selective agar plates (cfu/ml) divided by the mean of the total number of viable cells found

on the non-selective agar plates.

The effect of ox bile mixture on mutation frequency was determined by comparing two

simultaneously performed experiments using the same bacterial strain. The two

experiments were identical to the procedure presented in Figure 5, except that in one 20 g/l

of ox bile was added to the 20 tubes containing 3 ml of Brucella broth.

35


Figure 5. An overview of the process for calculation of mutation frequencies for a C.

jejuni or a C. coli strain

4.5 DNA extraction, purification and sequencing

DNA was extracted by using the method of Pitcher et al. (1989), modified by Hänninen et

al. (1996).

The quinolone resistance-determining region (QRDR) of gyrA was amplified using

PCR primers and cycling conditions described by Piddock et al. (2003) (Studies I and II)

and Griggs et al. (2005) (Study IV). The intergenic region between cmeR and cmeA was

sequenced using PCR primers and cycling conditions described by Lin et al. (2005a)

(Study II).

PCR products were purified using the QIAquick PCR Purification Kit (Qiagen,

Valencia, CA, USA).

Sequencing was performed using the automated cycle sequencer ABI377XL with Big

Dye terminators (PE Applied Biosystems, Foster City, CA, USA) at the Institute of

Biotechnology, University of Helsinki.

36


4.6 Development of mutations after ciprofloxacin challenge

In Study II, 8 C. jejuni and 2 C. coli strains were subjected to 1 mg/l of ciprofloxacin, and

DNAs from a total of 19 C. jejuni and 8 C. coli colonies were extracted. The promoter

binding region between cmeR and cmeA was amplified by PCR and sequenced.

In Study IV, each of the seven originally ciprofloxacin-susceptible C. jejuni strains

were challenged to 0.125 mg/l of ciprofloxacin in three independent experiments, after

which bacterial DNA was extracted. The seven ciprofloxacin induced strains from one of

the experiments were subcultured on non-selective plates (4 subcultures), on 0.125 mg/l

ciprofloxacin plates (7 subcultures) and on plates containing increasing concentrations of

ciprofloxacin, to a maximum of 8 mg/l. DNA was then extracted from the subcultures, and

the QRDR of gyrA was amplified with primers from Griggs et al. (2005) and sequenced.

The sequencing chromatogram was analyzed for the presence of mutated and multiple

peaks in the QRDR of gyrA.

37


5 Results

5.1 Susceptibility of C. hyointestinalis to antimicrobial agents (I)

Susceptibility of 24 reindeer and 25 bovine C. hyointestinalis strains to 12 antimicrobial

agents (see Table 9) was evaluated by using the agar disc diffusion method. The inhibition

zones were measured in millimeters, and if no inhibition zone was detected, the diameter

value of the disc, 6 mm, was used, and the strain was considered resistant. Sulphonamides,

streptomycin, metronidazole, ciprofloxacin and lincomycin failed to produce inhibition

zones with 6, 8, 1, 1, and 1 C. hyointestinalis strains, respectively, all of which were of

bovine origin. In addition, minimum inhibitory concentration (MIC) values for

ciprofloxacin and nalidixic acid were measured for reindeer strains by using the agar

dilution method. According to the results, all reindeer strains were highly susceptible to

ciprofloxacin, with MIC values ranging from 0.064 to 0.25 mg/l. The MIC value was

32 mg/l for the one ciprofloxacin-resistant bovine strain. The results are summarized in

Table 11.

Table 11. Summary of inhibition zones and MIC values of 49 C. hyointestinalis bovine

and reindeer strains by using disc diffusion and agar dilution methods

Method

Disc diffusion

(inhibition zone, mm)

Agar dilution

(MIC, mg/l)

ND = Not done

Antimicrobial

agent

Bovine strains

(n=25)

Range Mean

Reindeer strains

(n=24)

Range Mean

Gentamicin 27–34 29.6 27–42 33.4

Sulphonamides 6–42 23.7 36–62 43.8

Streptomycin 6–28 17.8 26–36 31.1

Erythromycin 25–39 31.9 28–54 34.7

Metronidazole 6–43 23.0 16–31 22.0

Ampicillin 38–56 49.8 50–69 58.8

Amoxicillin 46–56 51.9 55–72 61.4

Doxycycline 30–45 39.2 36–60 45.5

Co-amoxiclav 36–54 47.2 50–62 55.3

Tetracycline 34–49 42.3 42–57 47.6

Lincomycin 6–31 23.3 11–36 22.3

Ciprofloxacin 6–53 40.9 38–60 43.8

Ciprofloxacin

Nalidixic acid

ND ND

0.064–0.25

64–128

0.125

64

38


5.2 QRDR sequence analysis of C. hyointestinalis (I)

The QRDR of gyrA in three ciprofloxacin-susceptible C. hyointestinalis strains (PO0,

PO61 and PO271) was sequenced. The obtained sequence shared 73% identity with that of

C. jejuni and was most similar (98%) to the respective sequence in C. fetus.

PO0, PO61 and PO271 were subjected to increasing concentrations of ciprofloxacin,

and the QRDR of variants able to grow in 64 mg/l of ciprofloxacin were sequenced as was

that of C. hyointestinalis strain B704, with a ciprofloxacin MIC of 32 mg/l. Sequence

analysis showed a Thr-86–>Ile mutation in all of these four strains as a result of a singlepoint

mutation of cytosine to thymine. No other mutations were detected in the QRDR

region. When PO0, PO61 and PO271 were isolated from plates containing 16 or 32 mg/l

of ciprofloxacin, no mutations were detected in the QRDR of gyrA. When these strains

were subjected to ciprofloxacin (16 mg/l), their resistance to nalidixic acid increased from

64–128 mg/l to ≥ 512 mg/l.

39


5.3 Mutation frequency of C. jejuni and C. coli (II)

Mutation frequency of 11 C. jejuni and 5 C. coli strains was investigated on Brucella

blood agar plates containing 1 mg/l of ciprofloxacin. All of the strains were originally

ciprofloxacin-susceptible (MIC 0.032–0.25 mg/l). The results are summarized in Table 12.

The effect of ox bile salts on the mutation frequency of C. jejuni strains ATCC 33560,

B42, N191, 6507 and B67 and C. coli strain S140R was investigated. The presence of ox

bile salts in the culture medium had no clear effect on the mutation frequency values in

any of these strains (data not shown), compared with the experiments conducted without

bile.

Table 12. Mutation frequency of 11 C. jejuni and 5 C. coli strains obtained from agar

plates containing 1 mg/l of ciprofloxacin.

Species Strain/origin Mutation frequency Mutability a

C. jejuni ATCC 33560 / reference 2.9 ± 1.4 x 10 –6 Strongly hypermutable

FB6371 / chicken 9.8 ± 1.3 x 10 –7 Strongly hypermutable

B5 / chicken 9.4 ± 1.2 x 10 –7 Strongly hypermutable

B1 / chicken 8.1 ± 1.6 x 10 –8 Weakly hypermutable

BR1 / chicken 4.7 ± 1.2 x 10 –8 Weakly hypermutable

49/7R / chicken 1.6 ± 1.8 x 10 –8 Normomutable

B42 / chicken 1.5 ± 1.8 x 10 –8 Normomutable

N191 / cattle 1.5 ± 1.4 x 10 –8 Normomutable

B67 / chicken 1.0 ± 1.2 x 10 –8 Normomutable

6507 / chicken 9.3 ± 1.2 x 10 –9 Normomutable

14/8R /chicken 4.2 ± 1.1 x 10 –9 Hypomutable

C. coli 6590 / chicken 7.0 ± 2.0 x 10 –3 Strongly hypermutable

B25 / chicken 7.4 ± 1.2 x 10 –8 Weakly hypermutable

S140R / pig 6.2 ± 1.3 x 10 –8 Weakly hypermutable

T72277 / pig 1.5 ± 0.8 x 10 –8 Normomutable

T72498 / pig 1.3 ± 1.4 x 10 –8 Normomutable

a As defined by Baquero et al. (2004)

40


5.4 cmeR–cmeA sequence analysis of C. jejuni and C. coli (II)

The intergenic promoter region cmeR-cmeA (Figure 4) was sequenced in 8 C. jejuni and 2

C. coli ciprofloxacin-susceptible strains. We identified three different sequence types for

the inverted repeat (IR) sequence located in this region:

Type 1: TGTAAT AAAT ATTACA

Type 2: TGTAAT AAAA ATTACA

Type 3: TGTAAT AAA– ATTACA

The strains were transferred on Brucella blood agar plates containing 1 mg/l of

ciprofloxacin, and DNA from colonies selected from these plates was extracted and the

promoter-binding region cmeR-cmeA was amplified by PCR and sequenced. The results

are presented in Table 13.

Table 13. IR sequence types of the intergenic promoter-binding region cmeR-cmeA in

susceptible parent strains and in strains selected from Brucella agar plates containing

1 mg/l of ciprofloxacin

Strain/species

Initial IR

sequence

type

Number of colonies

selected from the

selective medium

41

IR sequence type of

colonies selected

from the selective

medium

ATCC 33560 / C. jejuni Type 1 4 All Type 1

N191 / C. jejuni Type 1 2 All Type 1

B67 / C. jejuni Type 2 2 Type 1, Type 2

B5 / C. jejuni Type 1 2 Type 1, Type 2

14/8R / C. jejuni Type 1 1 Type 1

FB6371 / C. jejuni Type 2 1 Type 2

49/7R / C. jejuni Type 2 2 All Type 1

49/7RAT / C. jejuni Type 3 5 All Type 3

6590 / C. coli Type 1 3 All Type 1

6590AT / C. coli Type 1 5 All Type 1


5.5 Effect of efflux pump effectors on MIC-values (I, III)

The effect of putative efflux pump inhibitors PAβN and NMP and putative efflux pump

inducers sodium salicylate and sodium deoxycholate on MIC values of ciprofloxacin,

erythromycin, kanamycin, rifampicin and tetracycline was investigated. In study III, six C.

jejuni strains and four C. coli strains were used as well as six C. jejuni and one C. coli

variants induced in the presence of 1 mg/l of ciprofloxacin. Further, the effect of PAβN on

MIC values of ciprofloxacin and nalidixic acid in 17 C. hyointestinalis strains was

evaluated (Study I). MIC values were obtained by the agar dilution method. An overview

of these results is presented in Table 14.

Table 14. Effect of putative efflux pump inducers and inhibitors on susceptibility of 6 C.

jejuni, 4 C. coli and 17 C. hyointestinalis strains to 6 antimicrobial agents. Values

represent the fold-difference between MIC values obtained in the presence and absence of

the respective efflux pump effector.

Nalidixic acid Ciprofloxacin Erythromycin Kanamycin Rifampicin Tetracycline

C. jejuni

PAβN ND ~* 8–16X ~ 8–64X ~

NMP ND ~ 1–8X ~ 2–4X 1–4X

Salicylate ND 1–4X ~ ~ 1–2X ~

Deoxycholate

C. coli

ND ~ ~ ~ ~ ~

PAβN ND ~ 16–32X ~ 16–32X ~

NMP ND ~ 2–8X ~ 2–8X 1–2X

Salicylate ND 2–4X ~ ~ 1–2X ~

Deoxycholate

C. hyointestinalis

ND ~ ~ ~ ~ ~

PAβN 2–8X ~ ND ND ND ND

MIC values decreased with NMP and PAβN and increased with salicylate and deoxycholate

* The ~ -sign stands for results that did not reproducibly differ from values obtained in the absence

of efflux pump effector.

ND = Not done

The MIC of kanamycin was 4–8 mg/l in C. jejuni strains and 2–8 mg/l in C. coli strains.

None of the putative efflux pump effectors used had any effect on the kanamycin MIC

values.

The MIC of tetracycline was 0.5–8 mg/l in C. jejuni strains and 0.5–64 mg/l in C. coli

strains. In 15 of the 17 C. jejuni and C. coli strains studied, NMP produced a 2- to 4-fold

decrease in the MIC value. The other efflux pump effectors had no effect on the MIC

values of tetracycline.

42


Ciprofloxacin MIC values for the parent strains were 0.063–0.25 mg/l. Ciprofloxacinresistant

variants of these strains were selected on media containing 1 mg/l of

ciprofloxacin. The ciprofloxacin MIC values of these variants were 2–64 mg/l. The only

efflux pump effector producing a change in the ciprofloxacin MIC values was sodium

salicylate. It increased the MIC values of ciprofloxacin 2- to 4-fold in all C. coli strains

and in 7 of the 12 C. jejuni strains.

The effect of PAβN on ciprofloxacin and nalidixic acid MIC values of C.

hyointestinalis was evaluated. No effect was found on ciprofloxacin, but MIC values for

nalidixic acid decreased 2- to 8-fold. MIC values for nalidixic acid were from 64 mg/l to

≥ 512 mg/l, and use of PAβN decreased these values to 16–128 mg/l.

PAβN and NMP had a pronounced effect on erythromycin and rifampicin MIC values

of C. jejuni and C. coli. The results of these studies are summarized in Figures 6 and 7.

MIC mg/l *16 mg/l

5

4,5

4

3,5

3

2,5

2

1,5

1

0,5

0

Figure 6. Erythromycin MIC values in the presence and absence of PAβN or NMP

MIC mg/l

1000

900

800

700

600

500

400

300

200

100

0

Figure 7. Rifampicin MIC values in the presence and absence of PAβN or NMP

43

No inhibitor

PAβN

NMP

No inhibitor

PAβN

NMP


5.6 Effect of ciprofloxacin in the development of gyrA mutations

(II, IV)

Twelve C. jejuni and 6 C. coli ciprofloxacin-susceptible strains were challenged with

0.125 and 1 mg/l of ciprofloxacin and by serial passage in 8 mg/l of ciprofloxacin. The

resulting ciprofloxacin MIC values and corresponding QRDR mutations are presented in

Table 15.

Each strain was challenged with 0.125 mg/l of ciprofloxacin in three repeated

experiments, and the MIC values obtained ranged from 0.25 to 32 mg/l. The presence of

potential multiple peaks and peaks representing mutated nucleotides in the sequencing

chromatograms of QRDR of gyrA was investigated. Examination of the sequencing

chromatogram of QRDR revealed double peaks at codons 86 and 90 in almost every

chromatogram, and in one case there was a triple peak at codon 86. Only in 2/18

experiments were no multiple peaks observed. The observed peaks represented codons

ACA (Thr), ATA (Ile) and GCA (Ala) for amino acid position 86, and codons GAT (Asp),

AAT (Asn) and GGT (Gly) for amino acid position 90 (Table 16).

The results from subsequent studies of the dynamics of the QRDR subpopulations

after subcultivation in either the presence or absence of ciprofloxacin are presented in

Table 16.

44


Table 15. Observed QRDR mutations in gyrA and corresponding MIC ranges and median MIC values after challenging C. jejuni and C. coli

strains with 0.125, 1 or 8 mg/l of ciprofloxacin

Species

CIP

challenge

(mg/l)

No. of

studied

strains/

colonies

No. a

Alterations in amino acid positions 86 and 90 in QRDR of gyrA

No mutations Thr86-Ile Asp90-Asn Other mutations

MIC

range

(mg/l)

Median

MIC

value

No.

C. jejuni 0.125 6/21 14 0.25-16 2 1 8 8 3 8-16 16 3 b 8-32 8

C. jejuni 1 12/40 9 1-16 1 23 1-16 16 7 2-16 4 1 c 2 2

C. coli 1 6/17 5 2-16 2 9 4-8 8 3 4 4 0 0 0

C. jejuni 8 7/7 0 0 0 5 16-64 32 2 16-32 24 0 0 0

a

Number of colonies in this group

b

Other mutations in this group were Thr86-Ala x 2 and Asp90-Gly

c

A double mutation Thr86-Ile + Asp90-Asn

MIC

range

(mg/l)

45

Median

MIC

value

No.

MIC

range

(mg/l)

Median

MIC

value

No.

MIC

range

(mg/l)

Median

MIC

value


Table 16. Chromatogram analysis of QRDR sequence data of gyrA in six C. jejuni strains after ciprofloxacin challenge (0.125 mg/l)

Strain

ATCC

33560

Codon

86

No challenge 0.125 mg/l challenge 4 passages in MH plates 7 passages in selective plates Serial passage up to 8 mg/l

Codon

90

MIC

ACA GAT 0.125

Codon

86

ACA*

ATA

Codon

90

MIC

GAT 16

Codon

86

ACA

ATA

46

Codon

90

MIC

GAT 16

B1 ACA GAT 0.064 ACA GAT 8 ACA GAT 0.5

B5 ACA GAT 0.125 ACA GAT 16 ACA GAT 0.5

B67 ACA GAT 0.125

B68 ACA GAT 0.125

49/7R ACA GAT 0.064

ACA

ATA

ACA

ATA

ACA

ATA

GAT 2

GAT

AAT

AAT

GAT

0.25

8

ATA

ACA

ATA

ACA

ATA

ACA

Codon

86

ACA

ATA

ACA

ATA

ATA

ACA

Codon

90

MIC

Codon

86

Codon

90

MIC

GAT 16 ATA GAT 16

AAT

GAT

16 ACA

AAT

GAT

16

GAT 16 ATA GAT 32

GAT 8 ATA GAT 8 ATA GAT 32

GAT

AAT

GAT

AAT

8

8

ATA

ACA

ATA

AAT

GAT

AAT

8

ACA

ATA

AAT

GAT

32

GAT 8 ATA GAT 64

*Codon represented by the predominant peak is indicated in normal type; codons represented by weaker peaks appear in italics.


6 Discussion

6.1 Susceptibility profile of Finnish C. hyointestinalis strains (I)

C. hyointestinalis is a common Campylobacter species in cattle and reindeer in Finland,

representing 15.3% and 6% of positive faecal samples, respectively (Hänninen et al.,

2002; Hakkinen and Hänninen, 2009). Since these animals are used for food production

and C. hyointestinalis has been associated with human disease, it was deemed important to

establish the susceptibility profile of this species to antimicrobial agents.

Susceptibility of 49 Finnish C. hyointestinalis strains to 12 antimicrobial agents was

investigated. According to the results, Finnish C. hyointestinalis strains are susceptible to

most antimicrobials of veterinary importance, with the exception of sulphonamides (12%

resistant) and streptomycin (16% resistant). In comparison, in a Canadian study involving

tetracycline, erythromycin, ampicillin and ciprofloxacin, 10.7%, 10.1%, 1.1% and 0% of

the 1500 bovine C. hyointestinalis isolates were resistant, respectively (Inglis et al., 2005).

Interestingly, all of the Finnish resistant C. hyointestinalis strains were of bovine origin,

and the reindeer strains in general had larger inhibition zones in disc diffusion tests than

the bovine isolates, suggesting higher susceptibility (Table 11). The mean diameter was at

least 8 mm larger in reindeer strains than in bovine strains for sulphonamides,

streptomycin, ampicillin, co-amoxiclav and amoxicillin. This could be explained by

reindeer living and feeding freely as semi-domesticated animals and only exceptionally

being treated with antimicrobials. Cattle, on the other hand, are treated, when necessary,

mostly with penicillins, but also with e.g. tetracyclines, macrolides, lincosamides,

sulphonamides and aminoglycosides. The overall use of antimicrobials in veterinary

medicine in Finland is moderate (Table 3). A possible explanation for the high resistance

rates for tetracycline and erythromycin in the Canadian study could be the use of

tetracyclines as growth promoters and prophylactics and tylosin as a prophylactic in

Canadian food animal production (Inglis et al., 2005).

C. jejuni was isolated from the same bovine faecal samples as C. hyointestinalis, and

results from the susceptibility determinations are presented in our previous study

(Hakkinen et al., 2007). Congruently with the bovine C. hyointestinalis isolates, the

overall prevalence of antimicrobial resistance in bovine C. jejuni isolates was low, as only

9% of the isolates were resistant to any of the antimicrobial agents tested, most commonly

to nalidixic acid (6%) (Hakkinen et al., 2007).

47


6.2 Quinolone resistance mechanisms in C. hyointestinalis (I)

C. hyointestinalis is inherently nalidixic acid-resistant, but ciprofloxacin-susceptible. Our

studies showed 73% identity of the QRDR in C. hyointestinalis with that of C. jejuni.

Nalidixic acid resistance in C. jejuni has been associated with mutations at Ala-70, Thr-86

or Asp-90 in the QRDR (Wang et al., 1993). However, the mutations associated with

nalidixic acid resistance in C. jejuni were not present in C. hyointestinalis, and thus, did

not explain the mechanism of nalidixic acid resistance in C. hyointestinalis. In C. jejuni

and C. coli, ciprofloxacin resistance is often associated with nalidixic resistance and vice

versa, although exceptions do occur (Bachoual et al., 2001). Similar cross-resistance was

observed in our studies, where challenging originally ciprofloxacin-susceptible C.

hyointestinalis strains with up to 16 mg/l of ciprofloxacin increased the nalidixic acid

resistance of these same strains from 64–128 mg/l to ≥ 512 mg/l.

Possible mechanisms for nalidixic acid resistance include decreased antimicrobial

uptake in the form of increased impermeability of the membrane and action of the efflux

pumps. The latter was supported by our study, where the presence of efflux pump

inhibitor PAβN decreased the MIC of nalidixic acid 2- to 8-fold. However, the pump

inhibitor did not establish complete susceptibility, which could be due to inefficiency of

the pump inhibitor, function of secondary pump systems or presence of other resistance

mechanisms, such as those involved in impermeability of the membrane. Thus far, the

CmeABC-efflux pump has not been characterized in C. hyointestinalis.

By comparing the QRDR sequence of gyrA in ciprofloxacin-susceptible C.

hyointestinalis and respective ciprofloxacin-induced variants, we observed that high-level

ciprofloxacin resistance was associated with the Thr–>Ile mutation in the position

corresponding to codon 86 in C. jejuni. Therefore, the mechanism of high-level

ciprofloxacin resistance was the same in C. hyointestinalis as in C. jejuni and C. coli.

However, this mutation was not observed in variants with MIC of ciprofloxacin < 32 mg/l,

which could indicate the presence of alternative resistance mechanisms for this lower level

ciprofloxacin resistance, such as those discussed for nalidixic acid in the previous

paragraph. The prevalence of this phenomenon was not assessed and possibly Thr86-Ile

mutations could emerge later, as in Study IV conducted with C. jejuni variants. No other

mutations in the QRDR of gyrA associated with ciprofloxacin resistance in C. jejuni or C.

fetus were observed in the C. hyointestinalis strains of this study. Similarly to studies

conducted with C. jejuni and C. coli, the presence of PAβN did not affect the MIC of

ciprofloxacin in C. hyointestinalis.

48


6.3 Spontaneous mutation frequency of C. jejuni and C. coli (II)

Since the majority of resistance mechanisms are associated with target mutations, the rate

at which mutations occur in bacteria has an impact on the emergence of bacterial

resistance. Previous to our study, mutation frequency has been characterized in, for

example, Helicobacter pylori strains and in single C. jejuni and C. coli strains (Taylor et

al., 1985; Gootz and Martin, 1991; Björkholm et al., 2001; Yan et al., 2006). It is difficult

to compare results obtained from different studies for several reasons: 1) the same

antimicrobial is not used in all mutation frequency studies due to different species having

different inherent resistance profiles, 2) different concentrations of selective agents have

been used, although this may not always influence the results (Yan et al., 2006), 3) for

reliable results, the MIC of the bacteria studied to the antimicrobial agent employed

should always be at least 4-fold smaller than the concentration used for selection (Chopra

et al., 2003), 4) different methods have been used to conduct and calculate mutation

frequencies.

Our mutation frequency determinations revealed that mutation frequencies of

fluoroquinolone-susceptible C. jejuni and C. coli strains vary considerably, from

hypomutable to strongly hypermutable. Genetic diversity in general among C. jejuni

strains is extensive (Dorrell et al., 2001), which may facilitate the adaptation of bacteria to

the selective environment. Large variance in mutation frequencies has also been observed

in H. pylori (Björkholm et al., 2001). However, in studies conducted with E. coli, as few

as 0.7% of strains were of the hypermutable type (Baquero et al., 2004). The high number

of hypermutable strains in C. jejuni and C. coli could be explained by the lack of such

repair systems as SOS response and functional methyl-directed mismatch repair (Parkhill

et al., 2000; Fouts et al. 2005; Gaasbeek et al., 2009). In a recent study of a single C.

jejuni strain, three functional DNA repair mechanisms, namely nucleotide excision repair

(NER), base excision repair (BER) and RecA-dependent recombinational repair, were

identified. None of these affected repair of point mutations, which was analysed by

determining mutation frequency for mutations conferring nalidixic acid resistance

(Gaasbeek et al., 2009). Another gene involved in DNA repair in C. jejuni is mfd, which

encodes a transcription-repair coupling factor. In addition, Mfd increases the rate of

spontaneous mutation to ciprofloxacin resistance, and ciprofloxacin induces the expression

of mfd (Han et al., 2008). It is therefore likely that the mutation frequency values obtained

in our study were influenced by the expression of ciprofloxacin-induced mfd.

The obtained mutation frequency values were compared with QRDR and intergenic

promoter binding cmeR-cmeA sequences derived by sequencing these regions from single

colonies collected from selective plates used for mutation frequency calculations.

However, no particular mutation pattern was associated with any of the mutability classes.

49


6.4 cmeR-cmeA sequence analysis of C. jejuni and C. coli (II)

The transcriptional repressor CmeR represses the expression of the CmeABC efflux pump

by directly binding to a 97-bp cmeR-cmeA intergenic (IT) region (Lin et al., 2005a).

Previously, mutations in cmeR have been shown to inhibit the binding of CmeR, resulting

in overexpression of CmeABC and increased resistance to multiple antimicrobials,

including ciprofloxacin (Pumbwe et al., 2004; Lin et al., 2005a). CmeR binding can also

be inhibited by inducing ligands, such as bile salts, which interact with CmeR and cause a

conformational change that makes it unable to bind DNA (Lin et al., 2005b). In a study by

Lin et al. (2005), a spontaneous deletion, and in a study by Cagliero et al. (2007), a

spontaneous transition, in the inverted repeat sequence located in IT, were associated with

increased resistance (see Table 17).

In Study II, sequence Types 1 and 2 in the inverted repeat of IT were identified, as well

as a previously unreported Type 3 (Table 17), both in the original ciprofloxacinsusceptible

C. jejuni and C. coli strains, and in variants selected from plates containing

1 mg/l of ciprofloxacin. The different sequence types were compared with mutations in the

QRDR region and MIC values obtained for ciprofloxacin, but no relationship was

detected. However, sequence Type 3 was exclusively and consistently found in the

49/7RAT strain, a tetracycline- and ampicillin-induced variant of 49/7R, which is of

sequence Type 1. The difference in MIC of ciprofloxacin between these strains

(0.032 mg/l in 49/7R and 0.5 mg/l in 49/7RAT) could be explained by this deletion in the

IT region.

A CmeR structural study revealed that CmeR binds the inverted repeat in a relatively

weak fashion and that CmeR has a very flexible DNA-binding domain, permitting

recognition of several DNA sites (Routh et al., 2009). This is concordant with the role of

CmeR as a pleiotropic regulator (Guo et al., 2008). Taking these observations into

consideration, possibly not all alterations in the inverted repeat sequence bear significance

in the binding of CmeR.

Table 17. IR sequence types observed in different studies of the cmeR-cmeA IT region

IR sequence Reference

TGTAAT AAAT ATTACA (Lin et al., 2005a)

TGTAAT AA–T ATTACA (Lin et al., 2005a)

TGTAAT AAAA ATTACA (Cagliero et al., 2007)

TGTAAT AAAA ATTATA (Cagliero et al., 2007)

TGTAAT AAAT ATTACA Study II (Type 1)

TGTAAT AAAA ATTACA Study II (Type 2)

TGTAAT AAA– ATTACA Study II (Type 3)

50


6.5 Effect of efflux pump effectors (I, III)

6.5.1 Inhibitors

Phenyl-arginine-β-naphthylamide

Of all the putative efflux pump effectors employed in Studies I and III, PAβN had the

most important effect. It was able to decrease the intrinsic resistance of C. hyointestinalis

to nalidixic acid 2- to 8-fold, intrinsic resistance of C. jejuni and C. coli to rifampicin 8- to

64-fold and 16- to 32-fold, respectively, and increase the inherent erythromycin

susceptibility of C. jejuni and C. coli 8- to 16-fold and 16- to 32-fold, respectively. No

reproducible effect on the MIC values of ciprofloxacin, kanamycin and tetracycline was

detected.

Earlier studies of PAβN on resistant and susceptible erythromycin strains have resulted

in an 8- to 128-fold decrease in erythromycin MIC levels (Payot et al., 2004; Cagliero et

al., 2005; Martinez and Lin, 2006; Gibreel et al., 2007). No high-level erythromycinresistant

C. jejuni were included in our investigation, but according to the study of Gibreel

et al. (2007), PAβN failed to decrease resistance of high-level erythromycin-resistant C.

jejuni, which would constitute a major drawback when considering this substance as a

potential drug candidate against development of resistance. Contrary to this, Martinez and

Lin (2006) reported the susceptibility to erythromycin to be restored in resistant strains in

the presence of PAβN.

In a study involving two C. jejuni strains, rifampin resistance decreased considerably,

1024- to 2048-fold, and tetracycline resistance decreased up to 512-fold in the presence of

PAβN (Martinez and Lin, 2006). In our study, no effect of PAβN on tetracycline

susceptibility was observed. The fact that all strains used in our study had low MIC values

for tetracycline, unlike the strain evaluated by Martinez and Lin, may explain this

discrepancy.

The effect of PAβN on ciprofloxacin and nalidixic acid resistance in C. jejuni and C.

coli has been investigated previously. In a study by Corcoran et al. (2005), PAβN at a

concentration of 20 mg/l produced no effect on the MIC of ciprofloxacin or nalidixic acid

in the ciprofloxacin- and nalidixic acid-resistant strain, but in the two evaluated

susceptible strains, it produced a 2-fold and a 2.5- to 4-fold increase in ciprofloxacin and

nalidixic acid susceptibility, respectively. The results obtained by Martinez and Lin (2005)

by the broth dilution method in the presence of 10 µg/ml of PAβN showed up to a 2-fold

and a 4-fold increase in ciprofloxacin and nalidixic acid susceptibility, respectively.

Cagliero et al. (2006b) reported that of the 22 ciprofloxacin-resistant and -susceptible C.

jejuni and C. coli strains only 3 were able to decrease ciprofloxacin MIC values by more

than 2-fold. In studies I and III, PAβN had no effect on the ciprofloxacin MIC values of

resistant and susceptible C. jejuni, C. coli and C. hyointestinalis. It did, however, lower the

nalidixic acid resistance of C. hyointestinalis 2- to 8-fold, indicating different resistance

mechanisms for these two related antimicrobials in C. hyointestinalis.

51


To date, PAβN remains the only broad-spectrum efflux pump inhibitor extensively

characterized in C. jejuni. Unfortunately, its unfavourable pharmacokinetic and

toxicological profiles prohibit its clinical use (Lomovskaya and Bostian, 2006).

1-(1-naphthylmethyl)-piperazine

Studies with NMP inhibitor showed 1- to 16-fold, 2- to 8-fold and 1- to 4-fold decreases in

erythromycin, rifampicin and tetracycline MIC levels, respectively, for C. jejuni and C.

coli. According to these results, NMP is less effective in decreasing MICs of erythromycin

and rifampicin than PAβN, which is congruent to studies conducted with E. coli and

Acinetobacter baumannii (Bohnert and Kern, 2005; Pannek et al., 2006). This also

suggests that the effects conferred by NMP to antimicrobial susceptibility differ from

those conferred by PAβN. Moreover, neither of these substances renders the strains

completely susceptible. In addition, inactivation of the CmeABC efflux pump at the

molecular level has a stronger effect on antimicrobials and impacts a wider range of

antimicrobials than the use of PAβN or the NMP in C. jejuni and C. coli (Cagliero et al.,

2006b). The mechanism underlying the ability of NMP to increase antimicrobial

susceptibility warrants further investigations, and, to our knowledge, the suitability of

NMP for therapeutic use has not been determined.

6.5.2 Inducers

Salicylate

In Study III, sodium salicylate increased ciprofloxacin and rifampicin resistance 1- to 4fold

and 1- to 2-fold, respectively, in C. coli and C. jejuni. A similar small effect on

ciprofloxacin resistance in C. jejuni and C. coli was reported earlier by Randall et al.

(2003). In the same study, Randall et al. observed an increase in tetracycline and

erythromycin MIC levels in the presence of sodium salicylate, but these findings were not

confirmed in our study. Salicylate has been shown to decrease the susceptibility of E. coli

by altering membrane proteins and inducing efflux pumps (Price et al., 2000). This is of

concern since salicylates are common constituents of non-steroidal anti-inflammatory

drugs, which are used in combination with antimicrobials to treat microbial diseases.

Bile salts

The CmeABC efflux pump has been established to confer resistance to bile salts present in

the intestinal tract of the host animal, and bile salt resistance is a prerequisite for

successful colonization of C. jejuni (Lin et al., 2003). Further, various bile salts, including

deoxycholate, strongly increase the expression of CmeABC, mainly by inhibiting the

binding of CmeR to the promoter region of cmeABC (Lin et al., 2005b). The presence of a

bile salt, taurocholate, has been shown to moderately decrease the susceptibility of C.

jejuni to, for instance, ciprofloxacin and erythromycin (2-fold change) (Lin et al., 2005b).

52


Bile salts were included in Studies II and III. In Study II, the effect of ox bile on mutation

frequencies of five C. jejuni and one C. coli strain was investigated by including 20 mg/ml

of ox bile in the culture media, but no marked impact emerged relative to studies

conducted without bile salts. In Study III, the effect of 1 mg/ml of sodium deoxycholate

on the susceptibility of five C. jejuni and four C. coli strains to various antimicrobials was

evaluated. Apart from variable 2-fold increases in rifampicin MIC values found in each

round of testing, deoxycholate had no influence on antimicrobial susceptibility of the

strains examined. Interestingly, although bile salts included in the culture medium of C.

jejuni resulted in a 6- to 16-fold increase in the expression of cmeABC (Lin et al., 2005b),

their effect on ciprofloxacin MIC values was negligible.

6.6 Development and emergence of QRDR mutations (IV)

In Studies II and IV, MIC values and QRDR alterations were investigated after subjecting

originally ciprofloxacin-susceptible C. jejuni and C. coli strains to 1 mg/l or 0.125 mg/l of

ciprofloxacin, respectively. In Study IV, the experiment was extended by investigating the

persistence of these alterations in the presence and absence of ciprofloxacin and also at a

higher concentration of ciprofloxacin (8 mg/l).

Primary challenge

Initial ciprofloxacin challenge of C. jejuni with 0.125 mg/l produced MIC values of 0.25–

32 mg/l, and challenge with 1 mg/l produced MICs of 1–16 mg/l in C. jejuni and 2–

16 mg/l in C. coli. Pumbwe et al. (2005) obtained similar results with a C. jejuni strain

challenged with 0.5 and 1 mg/l of ciprofloxacin, giving rise to MIC levels of 32 mg/l.

Surprisingly, of the 78 colonies studied from 12 C. jejuni and 6 C. coli strains subjected to

0.125 or 1 mg/l of ciprofloxacin, 28 (36%) had no mutation in their QRDR region despite

elevated MIC values from 0.25 to 16 mg/l, the median being 2 mg/l. Resistant strains

without QRDR mutations have previously been reported in clinical and animal isolates

(Piddock et al., 2003; Hakanen et al., 2003). The proportion of colonies not possessing a

QRDR mutation was highest (67%) in colonies subjected to 0.125 mg/l of ciprofloxacin.

The most common mutation type was Thr86-Ile (42%), followed by Asp90-Asn (17%).

Other observed mutation types were Thr86-Ala, Asp90-Gly and the double mutation

Thr86-Ile + Asp90-Asn. Repeated challenges or different colonies of the same strain often

produced different QRDR profiles and MIC values.

In Study IV, primary challenge with 0.125 mg/l of ciprofloxacin generated multiple

peaks in the sequencing chromatogram at mutation-prone codons 86 and 90 in QRDR.

This is indicative of different bacterial subpopulations with variable QRDR sequences that

are most likely present in the susceptible strain already prior to the ciprofloxacin

challenge. When subjected to ciprofloxacin challenge, the QRDR subpopulations

conferring ciprofloxacin resistance became significantly amplified. These findings suggest

that the sequencing results of a QRDR of a ciprofloxacin-resistant strain may, in some

53


cases, be interpreted as not containing a mutation, although actually the sample contains

both QRDR-mutated and unmutated bacteria.

Persistence studies

After the preliminary exposure of strains to 0.125 mg/l of ciprofloxacin, the strains were

either subcultured seven times on plates containing 0.125 mg/l of ciprofloxacin or

transferred on plates without a selective agent and subcultured four times. The presence of

multiple peaks at codons 86 and 90 persisted during several subcultures, both after the

removal of selection pressure and on the selective plates. These results indicate that both

mutated and unmutated bacteria are able to persist in the absence and presence of

0.125 mg/l of ciprofloxacin. The persistence of ciprofloxacin-resistant strains in the

absence of selection pressure has also been reported in vivo (Luo et al., 2005). Apart from

C. jejuni strains B1 and B5, the high MIC values obtained during the preliminary exposure

persisted or increased.

A QRDR-independent resistance mechanism was also activated by the presence of low

ciprofloxacin concentration. The C. jejuni strains B1 and B5 behaved differently from the

other strains. After the primary challenge with ciprofloxacin, they presented wild-type

QRDR sequences and had no multiple peaks at codons 86 and 90, but nevertheless

expressed ciprofloxacin MIC values of 8–16 mg/l. When the selection pressure was

removed, their MIC values decreased to 0.5 mg/l (original MIC 0.125 mg/l), whereas in

other strains showing multiple peaks in the QRDR sequencing chromatogram, the high

MIC values obtained during preliminary exposure persisted or increased. On the other

hand, when the subcultivation of strains B1 and B5 was continued in the presence of

ciprofloxacin, secondary peaks appeared in the sequencing chromatogram, and the MIC of

ciprofloxacin remained at 16 mg/l. The QRDR-independent resistance mechanism may be

speculated to involve the action of an efflux pump, which is then replaced or

supplemented by resistance conferring mutations when selection pressure is prolonged.

The experiment was continued by serial passage of the strains on plates containing

increasing concentrations of ciprofloxacin, until 8 mg/l was attained. This resulted in

strains with either the Thr86-Ile or Asp90-Asn mutation and notably reduced the number

of double peaks in the sequencing chromatogram. The measured ciprofloxacin MIC values

were 16–64 mg/l. The appearance of different mutant types after low-level

fluoroquinolone challenge has also been reported for Mycobacterium by Zhou et al.

(2000). Concordant with our study, low-level fluoroquinolone challenge selected for

QRDR-independent resistant mutants, and increasing the fluoroquinolone concentration

subsequently led to QRDR mutants and reduced the number of different mutant types.

54


7 Conclusions

1. Finnish C. hyointestinalis strains are susceptible to most antimicrobials of veterinary

importance. However, 32% and 24% of bovine strains were resistant to streptomycin and

sulphonamides, respectively. Reindeer strains remained susceptible to all tested

antimicrobials. The difference in the susceptibility profile of bovine and reindeer strains

most probably reflects the veterinary use of these substances in bovine husbandry, but not

in reindeer.

2. The QRDR of gyrA in C. hyointestinalis showed 73% identity with that of C. jejuni.

Mutations associated with nalidixic acid resistance in C. jejuni were not found in the

QRDR of C. hyointestinalis, and thus, do not explain the inherent nalidixic acid resistance

of C. hyointestinalis. Inherent nalidixic acid resistance is partly associated with efflux

pumps since PAβN, an efflux pump inhibitor, decreased the nalidixic acid resistance in C.

hyointestinalis 2- to 8-fold. However, low nalidixic acid MIC values were not obtained,

which indicates the presence of other resistance mechanisms. Cross-resistance between

nalidixic acid and ciprofloxacin was observed in C. hyointestinalis, as induced

ciprofloxacin resistance also increased MIC values for nalidixic acid. High-level

ciprofloxacin resistance (> 32 mg/l) in C. hyointestinalis was associated with the same

Thr86-Ile mutation as in C. jejuni, but no mutations in the QRDR were detected at lower

ciprofloxacin MIC levels.

3. The impact of efflux pump effectors on erythromycin, ciprofloxacin, tetracycline,

rifampicin and kanamycin MIC values in C. jejuni and C. coli was investigated. Efflux

pump inhibitor PAβN increased the susceptibility of C. jejuni and C. coli to erythromycin

and rifampicin 8- to 32-fold and 8- to 64-fold, respectively. In addition, it decreased the

nalidixic acid MIC values of C. hyointestinalis 2- to 8-fold. Another inhibitor, NMP,

produced 1- to 8-fold, 2- to 8-fold and 1- to 4-fold decreases, respectively, in

erythromycin, rifampicin and tetracycline MIC levels for C. jejuni and C. coli. Neither of

these inhibitors had an effect on ciprofloxacin MIC values. The different results produced

by these inhibitors indicate different modes of function for these pump inhibitors.

An efflux pump inducer, sodium salicylate, was only able to increase the MIC values

of one of the antimicrobials evaluated, ciprofloxacin (2- to 4-fold). Bile salts, which are

putative efflux pump inducers, had no observable effect on the MIC values of any of the

antimicrobials, nor did it have a notable impact on the mutation frequencies of C. jejuni

and C. coli strains.

4. Mutation frequencies of C. jejuni and C. coli strains varied considerably, from strongly

hypermutable (2.9 ± 1.4 x 10 –6 ) to hypomutable (4.2 ± 1.1 x 10 –9 ). The proportion of

hypermutable strains was much higher than previous reports for E. coli, which may

facilitate the adaptation of C. jejuni and C. coli to a selective environment. No correlation

was found between mutation frequency and mutations in the QRDR or cmeR-cmeA region.

55


5. Low-level ciprofloxacin concentration (0.125 mg/l) in a medium of originally

ciprofloxacin-susceptible C. jejuni strains gave rise to multiple peaks in the sequencing

chromatograms of QRDR, which may reflect different QRDR subpopulations. Exposure

to 0.125 mg/l of ciprofloxacin resulted in C. jejuni variants with MIC values ranging from

0.25 to 16 mg/l. Mutations in codon 86 (ACA, Thr) of QRDR included ATA (Ile) and

GCA (Ala), and mutations in codon 90 (GAT, Asp) included AAT (Asn) and GGT (Gly).

In two strains, MIC levels of up to 32 mg/l for ciprofloxacin were obtained, but no

mutations or multiple peaks in the sequencing chromatograms of QRDR were observed.

This suggests the presence of a QRDR-independent resistance mechanism. The strains

expressing the resistance mechanism, which involves different QRDR subpopulations, are

able to persist in both the presence and absence of low-level ciprofloxacin concentration.

However, the QRDR-independent resistance mechanism is quickly replaced or

supplemented by the appearance of QRDR mutations if ciprofloxacin challenge persists.

56


8. References

Aarestrup, F. M., McDermott, P. F. & Wegener, H. C. (2008). Transmission of

antibiotic resistance from food animals to humans. In Campylobacter, pp. 645-665. Edited

by I. Nachamkin, C. M. Szymanski & M. J. Blaser. Washington D.C.: American Society

for Microbiology.

Adak, G. K., Cowden, J. M., Nicholas, S. & Evans, H. S. (1995). The Public Health

Laboratory Service national case-control study of primary indigenous sporadic cases of

Campylobacter infection. Epidemiol Infect 115, 15-22.

Akiba, M., Lin, J., Barton, Y. W. & Zhang, Q. (2006). Interaction of CmeABC and

CmeDEF in conferring antimicrobial resistance and maintaining cell viability in

Campylobacter jejuni. J Antimicrob Chemother. 57, 52-60.

Allos, B. M. (2001). Campylobacter jejuni Infections: update on emerging issues and

trends. Clin Infect Dis 32, 1201-1206.

Andersson, D. I. & Levin, B. R. (1999). The biological cost of antibiotic resistance. Curr

Opin Microbiol 2, 489-493.

Atabay, H. I. & Corry, J. E. (1998). The isolation and prevalence of Campylobacters

from dairy cattle using a variety of methods. J Appl Microbiol 84, 733-740.

Avrain, L., Vernozy-Rozand, C. & Kempf, I. (2004). Evidence for natural horizontal

transfer of tetO gene between Campylobacter jejuni strains in chickens. J Appl Microbiol.

97, 134-140.

Bachoual, R., Ouabdesselam, S., Mory, F., Lascols, C., Soussy, C. J. & Tankovic, J.

(2001). Single or double mutational alterations of gyrA associated with fluoroquinolone

resistance in Campylobacter jejuni and Campylobacter coli. Microb Drug Resist 7, 257-

261.

Baquero, M. R., Nilsson, A. I., Turrientes Mdel, C., Sandvang, D., Galan, J. C.,

Martinez, J. L., Frimodt-Moller, N., Baquero, F. & Andersson, D. I. (2004).

Polymorphic mutation frequencies in Escherichia coli: emergence of weak mutators in

clinical isolates. J Bacteriol 186, 5538-5542.

Batchelor, R. A., Pearson, B. M., Friis, L. M., Guerry, P. & Wells, J. M. (2004).

Nucleotide sequences and comparison of two large conjugative plasmids from different

Campylobacter species. Microbiology. 150, 3507-3517.

57


Björkholm, B., Sjölund, M., Falk, P. G., Berg, O. G., Engstrand, L. & Andersson, D.

I. (2001). Mutation frequency and biological cost of antibiotic resistance in Helicobacter

pylori. Proc Natl Acad Sci USA 98, 14607-14612.

Blaser, M. & Engberg, J. (2008). Clinical aspects of Campylobacter jejuni and

Campylobacter coli infections. In Campylobacter, pp. 99-121. Edited by I. Nachamkin, C.

M. Szymanski & M. J. Blaser. Washington D.C.: American Society for Microbiology.

Bohnert, J. A. & Kern, W. V. (2005). Selected arylpiperazines are capable of reversing

multidrug resistance in Escherichia coli overexpressing RND efflux pumps. Antimicrob

Agents Chemother 49, 849-852.

Bolla, J. M., De, E., Dorez, A. & Pages, J. M. (2000). Purification, characterization and

sequence analysis of Omp50, a new porin isolated from Campylobacter jejuni. Biochem J.

3, 637-43.

Brisson-Noel, A., Trieu-Cuot, P. & Courvalin, P. (1988). Mechanism of action of

spiramycin and other macrolides. J Antimicrob Chemother. 22, 13-23.

Cagliero, C., Maurel, M. C., Cloeckaert, A. & Payot, S. (2007). Regulation of the

expression of the CmeABC efflux pump in Campylobacter jejuni: identification of a point

mutation abolishing the binding of the CmeR repressor in an in vitro-selected multidrugresistant

mutant. FEMS Microbiol Lett 267, 89-94.

Cagliero, C., Cloix, L., Cloeckaert, A. & Payot, S. (2006a). High genetic variation in

the multidrug transporter cmeB gene in Campylobacter jejuni and Campylobacter coli. J

Antimicrob Chemother 58, 168-172.

Cagliero, C., Mouline, C., Cloeckaert, A. & Payot, S. (2006b). Synergy between efflux

pump CmeABC and modifications in ribosomal proteins L4 and L22 in conferring

macrolide resistance in Campylobacter jejuni and Campylobacter coli. Antimicrob Agents

Chemother. 50, 3893-3896.

Cagliero, C., Mouline, C., Payot, S. & Cloeckaert, A. (2005). Involvement of the

CmeABC efflux pump in the macrolide resistance of Campylobacter coli. J Antimicrob

Chemother 56, 948-950.

Charvalos, E., Peteinaki, E., Spyridaki, I., Manetas, S. & Tselentis, Y. (1996).

Detection of ciprofloxacin resistance mutations in Campylobacter jejuni gyrA by

nonradioisotopic single-strand conformation polymorphism and direct DNA sequencing. J

Clin Lab Anal. 10, 129-133.

Chevance, A. & Moulin, G. (2009). Suivi des ventes de médicaments vétérinaires

contenant des antibiotiques en France en 2007. Available from URL:

http://www.afssa.fr/Documents/ANMV-Ra-Antibiotiques2007.pdf, accessed December

58


2009. Agence française de sécurité sanitaire des aliments - Agence nationale du

médicament vétérinaire (AFSSA-ANMV).

Chopra, I. & Roberts, M. (2001). Tetracycline antibiotics: mode of action, applications,

molecular biology, and epidemiology of bacterial resistance. Microbiol Mol Biol Rev. 65,

232-260.

Chopra, I., O'Neill, A. J. & Miller, K. (2003). The role of mutators in the emergence of

antibiotic-resistant bacteria. Drug Resist Updat 6, 137-145.

Chopra, I., Hawkey, P. M. & Hinton, M. (1992). Tetracyclines, molecular and clinical

aspects. J Antimicrob Chemother 29, 245-277.

Clinical and Laboratory Standards Institute (2004). Performance standards for

antimicrobial susceptibility testing. 15th international supplement. CLSI/NCCLS

Document M100-S15.

Committee for Veterinary Medicinal Products (1999). Antibiotic Resistance in the

European Union associated with Therapeutic Use of Veterinary Medicines.

EMEA/CVMP/342/99. European Medicines Agency.

Connell, S. R., Trieber, C. A., Dinos, G. P., Einfeldt, E., Taylor, D. E. & Nierhaus, K.

H. (2003). Mechanism of Tet(O)-mediated tetracycline resistance. EMBO J. 22, 945-953.

Connell, S. R., Trieber, C. A., Stelzl, U., Einfeldt, E., Taylor, D. E. & Nierhaus, K. H.

(2002). The tetracycline resistance protein Tet(O) perturbs the conformation of the

ribosomal decoding centre. Mol Microbiol 45, 1463-1472.

Corcoran, D., Quinn, T., Cotter, L., O'Halloran, F. & Fanning, S. (2005).

Characterization of a cmeABC operon in a quinolone-resistant Campylobacter coli isolate

of Irish origin. Microb Drug Resist 11, 303-308.

DANMAP 2008. (2009). Use of antimicrobial agents and occurrence of antimicrobial

resistance in bacteria from food animals, foods and humans in Denmark. Available from

URL: http://www.danmap.org/pdfFiles/Danmap_2008.pdf, last accessed December 2009.

Dawe, R. S., Ibbotson, S. H., Sanderson, J. B., Thomson, E. M. & Ferguson, J. (2003).

A randomized controlled trial (volunteer study) of sitafloxacin, enoxacin, levofloxacin and

sparfloxacin phototoxicity. Br J Dermatol 149, 1232-1241.

Debruyne, L., Gevers, D. & Vandamme, P. (2008). Taxonomy of the Family

Campylobacteraceae. In Campylobacter, pp. 3-25. Edited by I. Nachamkin, C. M.

Szymanski & M. J. Blaser. Washington D.C.: American Society for Microbiology.

59


Dekeyser, P., Gossuin-Detrain, M., Butzler, J. P. & Sternon, J. (1972). Acute enteritis

due to related vibrio: first positive stool cultures. J Infect Dis. 125, 390-392.

Diker, K. S. & Ozlem, M. B. (1990). Bovine diarrhea associated with Campylobacter

hyointestinalis. Zentralbl Veterinarmed B. 37, 158-160.

Dorrell, N., Mangan, J. A., Laing, K. G., Hinds, J., Linton, D., Al-Ghusein, H.,

Barrell, B. G., Parkhill, J., Stoker, N. G., Karlyshev, A. V., Butcher, P. D. & Wren,

B. W. (2001). Whole genome comparison of Campylobacter jejuni human isolates using a

low-cost microarray reveals extensive genetic diversity. Genome Res 11, 1706-1715.

Drlica, K. & Zhao, X. (1997). DNA gyrase, topoisomerase IV, and the 4-quinolones.

Microbiol Mol Biol Rev. 61, 377-392.

Edmonds, P., Patton, C. M., Griffin, P. M., Barrett, T. J., Schmid, G. P., Baker, C.

N., Lambert, M. A. & Brenner, D. J. (1987). Campylobacter hyointestinalis associated

with human gastrointestinal disease in the United States. J Clin Microbiol. 25, 685-691.

EFSA (2009a). Finland 2007 Report on trends and sources of zoonoses. Available from

URL: http://www.efsa.europa.eu/, accessed December 2009. European Food Safety

Authority.

EFSA (2009b). France 2007 Report on trends and sources of zoonoses. Available from

URL: http://www.efsa.europa.eu/, accessed December 2009. European Food Safety

Authority.

Endtz, H. P., Ruijs, G. J., van Klingeren, B., Jansen, W. H., van der Reyden, T. &

Mouton, R. P. (1991). Quinolone resistance in Campylobacter isolated from man and

poultry following the introduction of fluoroquinolones in veterinary medicine. J

Antimicrob Chemother 27, 199-208.

Engberg, J., Keelan, M., Gerner-Smidt, P. & Taylor, D. E. (2006). Antimicrobial

resistance in Campylobacter. In Antimicrobial resistance in bacteria of animal origin, pp.

269-291. Edited by F. M. Aarestrup. Washingtond D.C.: American Society for

Microbiology.

Engberg, J., Neimann, J., Nielsen, E. M., Aerestrup, F. M. & Fussing, V. (2004).

Quinolone-resistant Campylobacter infections: risk factors and clinical consequences.

Emerg Infect Dis 10, 1056-1063.

Eurostat (2009). Slaugthered animals for meat production. Available from URL:

http://epp.eurostat.ec.europa.eu/portal/page/portal/food/data/database, accessed December

2009. European Commission.

60


Euzéby, J. P. (1997). List of Bacterial Names with Standing in Nomenclature: a folder

available on the Internet. Int J Syst Bacteriol 47, 590-592.

Fennell, C. L., Rompalo, A. M., Totten, P. A., Bruch, K. L., Flores, B. M. & Stamm,

W. E. (1986). Isolation of "Campylobacter hyointestinalis" from a human. J Clin

Microbiol. 24, 146-148.

Feodoroff, F. B., Lauhio, A. R., Sarna, S. J., Hänninen, M. L. & Rautelin, H. I.

(2009). Severe diarrhoea caused by highly ciprofloxacin-susceptible Campylobacter

isolates. Clin Microbiol Infect 15, 188-192.

Finnish Medicines Agency (Fimea) (2009a). Drug consumption in years 2005-2008.

Available from URL: http://www.laakelaitos.fi/medicines/drug_consumption, accessed

December 2009.

Finnish Medicines Agency (Fimea) (2009b). Consumption of veterinary medicines 2008.

Available from URL: http://www.laakelaitos.fi/pharma_industry/veterinary_medicinal_

products/20060731150559.html, accessed December 2009.

FINRES-Vet 2007 (2008). Finnish Veterinary Antimicrobial Resistance Monitoring

2007. Available from URL: http://www.evira.fi, accessed December 2009. EVIRA,

Finnish Food Safety Authority.

FINRES-Vet 2008 (2009). Finnish Veterinary Antimicrobial Resistance Monitoring

2008. Available from URL: http://www.evira.fi, accessed December 2009. EVIRA,

Finnish Food Safety Authority.

Fitzgerald, F., Whichard, J. & Nachamkin, I. (2008). Diagnosis and antimicrobial

susceptibility of Campylobacter species. In Campylobacter, pp. 227-243. Edited by I.

Nachamkin, C. M. Szymanski & M. J. Blaser. Washington D.C.: American Society for

Microbiology.

Fouts, D. E., Mongodin, E. F., Mandrell, R. E., Miller, W. G., Rasko, D. A., Ravel, J.,

Brinkac, L. M., DeBoy, R. T., Parker, C. T., Daugherty, S. C., Dodson, R. J., Durkin,

A. S., Madupu, R., Sullivan, S. A., Shetty, J. U., Ayodeji, M. A., Shvartsbeyn, A.,

Schatz, M. C., Badger, J. H., Fraser, C. M. & Nelson, K. E. (2005). Major structural

differences and novel potential virulence mechanisms from the genomes of multiple

Campylobacter species. PLoS Biol. 3, e15.

Gaasbeek, E. J., van der Wal, F. J., van Putten, J. P., de Boer, P., van der Graaf-van

Bloois, L., de Boer, A. G., Vermaning, B. J. & Wagenaar, J. A. (2009). Functional

characterization of excision repair and RecA-dependent recombinational DNA repair in

Campylobacter jejuni. J Bacteriol 191, 3785-3793.

61


Gallay, A., Prouzet-Mauleon, V., Kempf, I., Lehours, P., Labadi, L., Camou, C.,

Denis, M., de Valk, H., Desenclos, J. C. & Megraud, F. (2007). Campylobacter

antimicrobial drug resistance among humans, broiler chickens, and pigs, France. Emerg

Infect Dis 13, 259-266.

Ge, B., McDermott, P. F., White, D. G. & Meng, J. (2005). Role of efflux pumps and

topoisomerase mutations in fluoroquinolone resistance in Campylobacter jejuni and

Campylobacter coli. Antimicrob Agents Chemother 49, 3347-3354.

Gebhart, C. J., Edmonds, P., Ward, G. E., Kurtz, H. J. & Brenner, D. J. (1985a).

"Campylobacter hyointestinalis" sp. nov.: a new species of Campylobacter found in the

intestines of pigs and other animals. J Clin Microbiol 21, 715-720.

Gebhart, C. J., Ward, G. E. & Kurtz, H. J. (1985b). In vitro activities of 47

antimicrobial agents against three Campylobacter spp. from pigs. Antimicrob Agents

Chemother 27, 55-59.

Gibreel, A., Wetsch, N. M. & Taylor, D. E. (2007). Contribution of the CmeABC Efflux

Pump to Macrolide and Tetracycline Resistance in Campylobacter jejuni. Antimicrob

Agents Chemother 51, 3212-3216.

Gibreel, A. & Taylor, D. E. (2006). Macrolide resistance in Campylobacter jejuni and

Campylobacter coli. J Antimicrob Chemother 58, 243-255.

Gibreel, A., Kos, V. N., Keelan, M., Trieber, C. A., Levesque, S., Michaud, S. &

Taylor, D. E. (2005). Macrolide resistance in Campylobacter jejuni and Campylobacter

coli: molecular mechanism and stability of the resistance phenotype. Antimicrob Agents

Chemother 49, 2753-2759.

Gibreel, A., Tracz, D. M., Nonaka, L., Ngo, T. M., Connell, S. R. & Taylor, D. E.

(2004). Incidence of antibiotic resistance in Campylobacter jejuni isolated in Alberta,

Canada, from 1999 to 2002, with special reference to tet(O)-mediated tetracycline

resistance. Antimicrob Agents Chemother 48, 3442-3450.

Gibreel, A. & Skold, O. (1998). High-level resistance to trimethoprim in clinical isolates

of Campylobacter jejuni by acquisition of foreign genes (dfr1 and dfr9) expressing druginsensitive

dihydrofolate reductases. Antimicrob Agents Chemother 42, 3059-3064.

Gootz, T. D. & Martin, B. A. (1991). Characterization of high-level quinolone resistance

in Campylobacter jejuni. Antimicrob Agents Chemother 35, 840-845.

Gorkiewicz, G., Feierl, G., Zechner, R. & Zechner, E. L. (2002). Transmission of

Campylobacter hyointestinalis from a pig to a human. J Clin Microbiol 40, 2601-2605.

62


Griggs, D. J., Johnson, M. M., Frost, J. A., Humphrey, T., Jorgensen, F. & Piddock,

L. J. (2005). Incidence and mechanism of ciprofloxacin resistance in Campylobacter spp.

isolated from commercial poultry flocks in the United Kingdom before, during, and after

fluoroquinolone treatment. Antimicrob Agents Chemother 49, 699-707.

Guo, B., Wang, Y., Shi, F., Barton, Y. W., Plummer, P., Reynolds, D. L., Nettleton,

D., Grinnage-Pulley, T., Lin, J. & Zhang, Q. (2008). CmeR functions as a pleiotropic

regulator and is required for optimal colonization of Campylobacter jejuni in vivo. J

Bacteriol. 190, 1879-1890.

Guo, B., Lin, J., Reynolds, D. L. & Zhang, Q. (2010). Contribution of the multidrug

efflux transporter CmeABC to antibiotic resistance in different Campylobacter species.

Foodborne Pathog Dis. 7, 77-83.

Guordabassi, L. & Courvalin, P. (2006). Modes of antimicrobial action and mechanisms

of bacterial resistance. In Antimicrobial resistance in bacteria of animal origin, pp. 269-

291. Edited by F. M. Aarestrup. Washingtond D.C.: American Society for Microbiology.

Hakanen, A., Huovinen, P., Kotilainen, P., Siitonen, A. & Jousimies-Somer, H.

(2002a). Quality control strains used in susceptibility testing of Campylobacter spp. J Clin

Microbiol 40, 2705-2706.

Hakanen, A., Jalava, J., Kotilainen, P., Jousimies-Somer, H., Siitonen, A. &

Huovinen, P. (2002b). gyrA polymorphism in Campylobacter jejuni: detection of gyrA

mutations in 162 C. jejuni isolates by single-strand conformation polymorphism and DNA

sequencing. Antimicrob Agents Chemother 46, 2644-2647.

Hakanen, A. J., Lehtopolku, M., Siitonen, A., Huovinen, P. & Kotilainen, P. (2003).

Multidrug resistance in Campylobacter jejuni strains collected from Finnish patients

during 1995-2000. J Antimicrob Chemother 52, 1035-1039.

Hakkinen, M. & Hänninen, M. L. (2009). Shedding of Campylobacter spp. in Finnish

cattle on dairy farms. J Appl Microbiol 107, 898-905.

Hakkinen, M., Heiska, H. & Hänninen, M. L. (2007). Prevalence of Campylobacter

spp. in cattle in Finland and antimicrobial susceptibilities of bovine Campylobacter jejuni

strains. Appl Environ Microbiol 73, 3232-3238.

Han, J., Sahin, O., Barton, Y. W. & Zhang, Q. (2008). Key role of Mfd in the

development of fluoroquinolone resistance in Campylobacter jejuni. PLoS Pathog 4,

e1000083.

Hänninen, M. L., Sarelli, L., Sukura, A., On, S. L., Harrington, C. S., Matero, P. &

Hirvelä-Koski, V. (2002). Campylobacter hyointestinalis subsp. hyointestinalis, a

common Campylobacter species in reindeer. J Appl Microbiol 92, 717-723.

63


Hänninen, M. L., Happonen, I., Saari, S. & Jalava, K. (1996). Culture and

characteristics of Helicobacter bizzozeronii, a new canine gastric Helicobacter sp. Int J

Syst Bacteriol 46, 160-166.

Harms, J. M., Bartels, H., Schlunzen, F. & Yonath, A. (2003). Antibiotics acting on the

translational machinery. J Cell Sci 116, 1391-1393.

Harris, N. V., Weiss, N. S. & Nolan, C. M. (1986). The role of poultry and meats in the

etiology of Campylobacter jejuni/coli enteritis. Am J Public Health 76, 407-411.

Helms, M., Simonsen, J., Olsen, K. E. & Molbak, K. (2005). Adverse health events

associated with antimicrobial drug resistance in Campylobacter species: a registry-based

cohort study. J Infect Dis 191, 1050-1055.

Higgins, N. P., Peebles, C. L., Sugino, A. & Cozzarelli, N. R. (1978). Purification of

subunits of Escherichia coli DNA gyrase and reconstitution of enzymatic activity. Proc

Natl Acad Sci USA 75, 1773-1777.

Hill, B. D., Thomas, R. J. & Mackenzie, A. R. (1987). Campylobacter hyointestinalisassociated

enteritis in Moluccan rusa deer (Cervus timorensis subsp. Moluccensis). J

Comp Pathol 97, 687-694.

Inglis, G. D., McAllister, T. A., Busz, H. W., Yanke, L. J., Morck, D. W., Olson, M. E.

& Read, R. R. (2005). Effects of subtherapeutic administration of antimicrobial agents to

beef cattle on the prevalence of antimicrobial resistance in Campylobacter jejuni and

Campylobacter hyointestinalis. Appl Environ Microbiol 71, 3872-3881.

Jana, S. & Deb, J. K. (2006). Molecular understanding of aminoglycoside action and

resistance. Appl Microbiol Biotechnol 70, 140-150.

Jensen, L. B. & Aarestrup, F. M. (2001). Macrolide resistance in Campylobacter coli of

animal origin in Denmark. Antimicrob Agents Chemother 45, 371-372.

Küng, K., Riond, J. L. & Wanner, M. (1993). Pharmacokinetics of enrofloxacin and its

metabolite ciprofloxacin after intravenous and oral administration of enrofloxacin in dogs.

J Vet Pharmacol Ther. 16, 462-468.

Ladely, S. R., Harrison, M. A., Fedorka-Cray, P. J., Berrang, M. E., Englen, M. D. &

Meinersmann, R. J. (2007). Development of macrolide-resistant Campylobacter in

broilers administered subtherapeutic or therapeutic concentrations of tylosin. J Food Prot

70, 1945-1951.

Lastovica, A. J. & Allos, B. M. (2008). Clinical significance of Campylobacter and

related species other than Campylobacter jejuni and Campylobacter coli. In

64


Campylobacter, pp. 123-149. Edited by I. Nachamkin, C. M. Szymanski & M. J. Blaser.

Washington D.C.: American Society for Microbiology.

Lee, C., Tai, C., Lin, S. & Chen, Y. (1994). Occurrence of plasmids and tetracycline

resistance among Campylobacter jejuni and Campylobacter coli isolated from whole

market chickens and clinical samples. Int J Food Microbiol 24, 161-170.

Lehtopolku, M., Hakanen, A. J., Siitonen, A., Huovinen, P. & Kotilainen, P. (2005).

In vitro activities of 11 fluoroquinolones against 226 Campylobacter jejuni strains isolated

from Finnish patients, with special reference to ciprofloxacin resistance. J Antimicrob

Chemother 56, 1134-1138.

Li, C. C., Chiu, C. H., Wu, J. L., Huang, Y. C. & Lin, T. Y. (1998). Antimicrobial

susceptibilities of Campylobacter jejuni and coli by using E-test in Taiwan. Scand J Infect

Dis 30, 39-42.

Li, X. Z. & Nikaido, H. (2004). Efflux-mediated drug resistance in bacteria. Drugs 64,

159-204.

Lin, J., Yan, M., Sahin, O., Pereira, S., Chang, Y. J. & Zhang, Q. (2007). Effect of

macrolide usage on emergence of erythromycin-resistant Campylobacter isolates in

chickens. Antimicrob Agents Chemother 51, 1678-1686.

Lin, J., Akiba, M., Sahin, O. & Zhang, Q. (2005a). CmeR functions as a transcriptional

repressor for the multidrug efflux pump CmeABC in Campylobacter jejuni. Antimicrob

Agents Chemother 49, 1067-1075.

Lin, J., Cagliero, C., Guo, B., Barton, Y. W., Maurel, M. C., Payot, S. & Zhang, Q.

(2005b). Bile salts modulate expression of the CmeABC multidrug efflux pump in

Campylobacter jejuni. J Bacteriol 187, 7417-7424.

Lin, J., Sahin, O., Michel, L. O. & Zhang, Q. (2003). Critical role of multidrug efflux

pump CmeABC in bile resistance and in vivo colonization of Campylobacter jejuni. Infect

Immun 71, 4250-4259.

Lin, J., Michel, L. O. & Zhang, Q. (2002). CmeABC functions as a multidrug efflux

system in Campylobacter jejuni. Antimicrob Agents Chemother 46, 2124-2131.

Llano-Sotelo, B., Azucena, E. F., Kotra, L. P., Mobashery, S. & Chow, C. S. (2002).

Aminoglycosides modified by resistance enzymes display diminished binding to the

bacterial ribosomal aminoacyl-tRNA site. Chem Biol 9, 455-463.

Logan, J. M., Edwards, K. J., Saunders, N. A. & Stanley, J. (2001). Rapid

identification of Campylobacter spp. by melting peak analysis of biprobes in real-time

PCR. J Clin Microbiol 39, 2227-2232.

65


Lomovskaya, O. & Bostian, K. A. (2006). Practical applications and feasibility of efflux

pump inhibitors in the clinic – a vision for applied use. Biochem Pharmacol 71, 910-918.

Lomovskaya, O., Warren, M. S., Lee, A., Galazzo, J., Fronko, R., Lee, M., Blais, J.,

Cho, D., Chamberland, S., Renau, T., Leger, R., Hecker, S., Watkins, W., Hoshino,

K., Ishida, H. & Lee, V. J. (2001). Identification and characterization of inhibitors of

multidrug resistance efflux pumps in Pseudomonas aeruginosa: novel agents for

combination therapy. Antimicrob Agents Chemother 45, 105-116.

Luangtongkum, T., Jeon, B., Han, J., Plummer, P., Catherine, M., Logue, C. M. &

Zhang, Q. (2009). Antibiotic resistance in Campylobacter: emergence, transmission and

persistence. Future Microbiol. 4, 189-200.

Luangtongkum, T., Morishita, T. Y., Martin, L., Choi, I., Sahin, O. & Zhang, Q.

(2008). Prevalence of tetracycline-resistant Campylobacter in organic broilers during a

production cycle. Avian Dis 52, 487-490.

Luber, P., Wagner, J., Hahn, H. & Bartelt, E. (2003). Antimicrobial resistance in

Campylobacter jejuni and Campylobacter coli strains isolated in 1991 and 2001-2002

from poultry and humans in Berlin, Germany. Antimicrob Agents Chemother 47, 3825-

3830.

Luo, N., Pereira, S., Sahin, O., Lin, J., Huang, S., Michel, L. & Zhang, Q. (2005).

Enhanced in vivo fitness of fluoroquinolone-resistant Campylobacter jejuni in the absence

of antibiotic selection pressure. Proc Natl Acad Sci USA 102, 541-546.

Luo, N., Sahin, O., Lin, J., Michel, L. O. & Zhang, Q. (2003). In vivo selection of

Campylobacter isolates with high levels of fluoroquinolone resistance associated with

gyrA mutations and the function of the CmeABC efflux pump. Antimicrob Agents

Chemother 47, 390-394.

Mamelli, L., Prouzet-Mauleon, V., Pages, J. M., Megraud, F. & Bolla, J. M. (2005).

Molecular basis of macrolide resistance in Campylobacter: role of efflux pumps and target

mutations. J Antimicrob Chemother 56, 491-497.

Manavathu, E. K., Hiratsuka, K. & Taylor, D. E. (1988). Nucleotide sequence analysis

and expression of a tetracycline-resistance gene from Campylobacter jejuni. Gene 62, 17-

26.

Martinez, A. & Lin, J. (2006). Effect of an efflux pump inhibitor on the function of the

multidrug efflux pump CmeABC and antimicrobial resistance in Campylobacter.

Foodborne Pathog Dis 3, 393-402.

Maxwell, A. (1992). The molecular basis of quinolone action. J Antimicrob Chemother.

30, 409-414.

66


Mazzariol, A., Tokue, Y., Kanegawa, T. M., Cornaglia, G. & Nikaido, H. (2000).

High-level fluoroquinolone-resistant clinical isolates of Escherichia coli overproduce

multidrug efflux protein AcrA. Antimicrob Agents Chemother 44, 3441-3443.

McCarthy, N. & Giesecke, J. (2001). Incidence of Guillain-Barre syndrome following

infection with Campylobacter jejuni. Am J Epidemiol 153, 610-614.

McDermott, P. F., Bodeis, S. M., Aarestrup, F. M., Brown, S., Traczewski, M.,

Fedorka-Cray, P., Wallace, M., Critchley, I. A., Thornsberry, C., Graff, S., Flamm,

R., Beyer, J., Shortridge, D., Piddock, L. J., Ricci, V., Johnson, M. M., Jones, R. N.,

Reller, B., Mirrett, S., Aldrobi, J., Rennie, R., Brosnikoff, C., Turnbull, L., Stein, G.,

Schooley, S., Hanson, R. A. & Walker, R. D. (2004). Development of a standardized

susceptibility test for Campylobacter with quality-control ranges for ciprofloxacin,

doxycycline, erythromycin, gentamicin, and meropenem. Microb Drug Resist 10, 124-

131.

McFadyean, J. & Stockman, S. (1913). Report of the Departmental Committee

appointed by the Board of Agriculture and Fisheries to inquire into Epizootic Abortion.

III. Abortion in Sheep. London: HMSO.

Minet, J., Grosbois, B. & Megraud, F. (1988). Campylobacter hyointestinalis: an

opportunistic enteropathogen? J Clin Microbiol 26, 2659-2660.

Murray, P. R., Rosenthal, K. S. & Pfaller, M. A. (2009). In Medical Microbiology.

USA: Mosby Elsevier.

Nachamkin, I., Ung, H. & Li, M. (2002). Increasing fluoroquinolone resistance in

Campylobacter jejuni, Pennsylvania, USA, 1982-2001. Emerg Infect Dis 8, 1501-1503.

NCCLS (2002). Performance Standards for Antimmicrobial Disk and Dilution

Susceptibility Tests for Bacteria Isolated from Animals; Approved Standard - Second

Edition.

Nelson, J. M., Smith, K. E., Vugia, D. J., Rabatsky-Ehr, T., Segler, S. D., Kassenborg,

H. D., Zansky, S. M., Joyce, K., Marano, N., Hoekstra, R. M. & Angulo, F. J. (2004).

Prolonged diarrhea due to ciprofloxacin-resistant Campylobacter infection. J Infect Dis

190, 1150-1157.

Ng, L. K., Stiles, M. E. & Taylor, D. E. (1985). Inhibition of Campylobacter coli and

Campylobacter jejuni by antibiotics used in selective growth media. J Clin Microbiol 22,

510-514.

Nikaido, H. (2003). Molecular basis of bacterial outer membrane permeability revisited.

Microbiol Mol Biol Rev. 67, 593-656.

67


Olson, K., Ethelberg, S., van Pelt, W. & Tauxe, R. V. (2008). Epidemiology of

Campylobacter jejuni infections in industrialized nations. In Campylobacter, pp. 163-189.

Edited by I. Nachamkin, C. M. Szymanski & M. J. Blaser. Washington D.C.: American

Society for Microbiology.

On, S. L. W. & Vandamme, P. (1997). Identification and epidemiological typing of

Campylobacter hyointestinalis subspecies by phenotypic and genotypic methods and

description of novel subgroups. Syst Appl Microbiol 20, 238-238-247.

Pagès, W. J., Huyer, G., Huyer, M. & Worobec, E. A. (1989). Characterization of the

porins of Campylobacter jejuni and Campylobacter coli and implications for antibiotic

susceptibility. Antimicrob Agents Chemother 33, 297-303.

Pannek, S., Higgins, P. G., Steinke, P., Jonas, D., Akova, M., Bohnert, J. A., Seifert,

H. & Kern, W. V. (2006). Multidrug efflux inhibition in Acinetobacter baumannii:

comparison between 1-(1-naphthylmethyl)-piperazine and phenyl-arginine-betanaphthylamide.

J Antimicrob Chemother 57, 970-974.

Parkhill, J., Wren, B. W., Mungall, K., Ketley, J. M., Churcher, C., Basham, D.,

Chillingworth, T., Davies, R. M., Feltwell, T., Holroyd, S., Jagels, K., Karlyshev, A.

V., Moule, S., Pallen, M. J., Penn, C. W., Quail, M. A., Rajandream, M. A.,

Rutherford, K. M., van Vliet, A. H., Whitehead, S. & Barrell, B. G. (2000). The

genome sequence of the food-borne pathogen Campylobacter jejuni reveals hypervariable

sequences. Nature 403, 665-668.

Payot, S., Avrain, L., Magras, C., Praud, K., Cloeckaert, A. & Chaslus-Dancla, E.

(2004). Relative contribution of target gene mutation and efflux to fluoroquinolone and

erythromycin resistance, in French poultry and pig isolates of Campylobacter coli. Int J

Antimicrob Agents 23, 468-472.

Pedersen, K. & Wedderkopp, A. (2003). Resistance to quinolones in Campylobacter

jejuni and Campylobacter coli from Danish broilers at farm level. J Appl Microbiol 94,

111-119.

Pfister, P., Jenni, S., Poehlsgaard, J., Thomas, A., Douthwaite, S., Ban, N. & Bottger,

E. C. (2004). The structural basis of macrolide-ribosome binding assessed using

mutagenesis of 23S rRNA positions 2058 and 2059. J Mol Biol 342, 1569-1581.

Piddock, L. J., Ricci, V., Pumbwe, L., Everett, M. J. & Griggs, D. J. (2003).

Fluoroquinolone resistance in Campylobacter species from man and animals: detection of

mutations in topoisomerase genes. J Antimicrob Chemother 51, 19-26.

Pitcher, D. G., Saunders, N. A. & Owen, R. J. (1989). Rapid extraction of bacterial

genomic DNA with guanidium thiocyanate. Lett Appl Microbiol 8, 151-156.

68


Pope, J. E., Krizova, A., Garg, A. X., Thiessen-Philbrook, H. & Ouimet, J. M. (2007).

Campylobacter reactive arthritis: a systematic review. Semin Arthritis Rheum 37, 48-55.

Pratt, A. & Korolik, V. (2005). Tetracycline resistance of Australian Campylobacter

jejuni and Campylobacter coli isolates. J Antimicrob Chemother 55, 452-460.

Prescott, J. F. (2004). Antimicrobial chemotherapy. In Veterinary Microbiology, pp. 26-

43. Edited by D. C. Hirsh, N. J. Maclachlan & R. L. Walker. Iowa USA: Blackwell

Publishing.

Price, C. T., Lee, I. R. & Gustafson, J. E. (2000). The effects of salicylate on bacteria.

Int J Biochem Cell Biol 32, 1029-1043.

Price, L. B., Johnson, E., Vailes, R. & Silbergeld, E. (2005). Fluoroquinolone-resistant

Campylobacter isolates from conventional and antibiotic-free chicken products. Environ

Health Perspect 113, 557-560.

Pumbwe, L., Randall, L. P., Woodward, M. J. & Piddock, L. J. (2005). Evidence for

multiple-antibiotic resistance in Campylobacter jejuni not mediated by CmeB or CmeF.

Antimicrob Agents Chemother 49, 1289-1293.

Pumbwe, L., Randall, L. P., Woodward, M. J. & Piddock, L. J. (2004). Expression of

the efflux pump genes cmeB, cmeF and the porin gene porA in multiple-antibioticresistant

Campylobacter jejuni. J Antimicrob Chemother 54, 341-347.

Pumbwe, L. & Piddock, L. J. (2002). Identification and molecular characterisation of

CmeB, a Campylobacter jejuni multidrug efflux pump. FEMS Microbiol Lett 206, 185-

189.

Randall, L. P., Ridley, A. M., Cooles, S. W., Sharma, M., Sayers, A. R., Pumbwe, L.,

Newell, D. G., Piddock, L. J. & Woodward, M. J. (2003). Prevalence of multiple

antibiotic resistance in 443 Campylobacter spp. isolated from humans and animals. J

Antimicrob Chemother 52, 507-510.

Rautelin, H., Vierikko, A., Hänninen, M. L. & Vaara, M. (2003). Antimicrobial

susceptibilities of Campylobacter strains isolated from Finnish subjects infected

domestically or from those infected abroad. Antimicrob Agents Chemother 47, 102-105.

Rautelin, H., Renkonen, O. V. & Kosunen, T. U. (1991). Emergence of fluoroquinolone

resistance in Campylobacter jejuni and Campylobacter coli in subjects from Finland.

Antimicrob Agents Chemother 35, 2065-2069.

Renau, T. E., Leger, R., Flamme, E. M., Sangalang, J., She, M. W., Yen, R., Gannon,

C. L., Griffith, D., Chamberland, S., Lomovskaya, O., Hecker, S. J., Lee, V. J., Ohta,

T. & Nakayama, K. (1999). Inhibitors of efflux pumps in Pseudomonas aeruginosa

69


potentiate the activity of the fluoroquinolone antibacterial levofloxacin. J Med Chem 42,

4928-4931.

Robinson, D. A. (1981). Infective dose of Campylobacter jejuni in milk. Br Med J (Clin

Res Ed) 282, 1584.

Routh, M. D., Su, C. C., Zhang, Q. & Yu, E. W. (2009). Structures of AcrR and CmeR:

insight into the mechanisms of transcriptional repression and multi-drug recognition in the

TetR family of regulators. Biochim Biophys Acta 1794, 844-851.

Ruiz, J., Goni, P., Marco, F., Gallardo, F., Mirelis, B., Jimenez De Anta, T. & Vila, J.

(1998). Increased resistance to quinolones in Campylobacter jejuni: a genetic analysis of

gyrA gene mutations in quinolone-resistant clinical isolates. Microbiol Immunol. 42, 223-

226.

Ruiz-Palacios, G. M. (2007). The health burden of Campylobacter infection and the

impact of antimicrobial resistance: playing chicken. Clin Infect Dis 44, 701-703.

Saenz, Y., Zarazaga, M., Lantero, M., Gastanares, M. J., Baquero, F. & Torres, C.

(2000). Antibiotic resistance in Campylobacter strains isolated from animals, foods, and

humans in Spain in 1997-1998. Antimicrob Agents Chemother 44, 267-271.

Salama, S. M., Tabor, H., Richter, M. & Taylor, D. E. (1992). Pulsed-field gel

electrophoresis for epidemiologic studies of Campylobacter hyointestinalis isolates. J Clin

Microbiol 30, 1982-1984.

Salazar-Lindo, E., Sack, R. B., Chea-Woo, E., Kay, B. A., Piscoya, Z. A., Leon-

Barua, R. & Yi, A. (1986). Early treatment with erythromycin of Campylobacter jejuniassociated

dysentery in children. J Pediatr 109, 355-360.

Sato, K., Hoshino, K., Tanaka, M., Hayakawa, I. & Osada, Y. (1992). Antimicrobial

activity of DU-6859, a new potent fluoroquinolone, against clinical isolates. Antimicrob

Agents Chemother 36, 1491-1498.

Schlunzen, F., Zarivach, R., Harms, J., Bashan, A., Tocilj, A., Albrecht, R., Yonath,

A. & Franceschi, F. (2001). Structural basis for the interaction of antibiotics with the

peptidyl transferase centre in eubacteria. Nature 413, 814-821.

Schönberg-Norio, D., Hänninen, M. L., Katila, M. L., Kaukoranta, S. S., Koskela,

M., Eerola, E., Uksila, J., Pajarre, S. & Rautelin, H. (2006). Activities of telithromycin,

erythromycin, fluoroquinolones, and doxycycline against Campylobacter strains isolated

from Finnish subjects. Antimicrob Agents Chemother 50, 1086-1088.

Schumacher, A., Steinke, P., Bohnert, J. A., Akova, M., Jonas, D. & Kern, W. V.

(2006). Effect of 1-(1-naphthylmethyl)-piperazine, a novel putative efflux pump inhibitor,

70


on antimicrobial drug susceptibility in clinical isolates of Enterobacteriaceae other than

Escherichia coli. J Antimicrob Chemother 57, 344-348.

Schwarz, S., Kehrenberg, C., Doublet, B. & Cloeckaert, A. (2004). Molecular basis of

bacterial resistance to chloramphenicol and florfenicol. FEMS Microbiol Rev 28, 519-542.

Siu, L. K. (2002). Antibiotics: action and resistance in gram-negative bacteria. J

Microbiol Immunol Infect. 35, 1-11.

Skirrow, M. B. (1977). Campylobacter enteritis: a "new" disease. Br Med J. 2, 9-11.

Smith, K. E., Besser, J. M., Hedberg, C. W., Leano, F. T., Bender, J. B., Wicklund, J.

H., Johnson, B. P., Moore, K. A. & Osterholm, M. T. (1999). Quinolone-resistant

Campylobacter jejuni infections in Minnesota, 1992-1998. Investigation Team. N Engl J

Med 340, 1525-1532.

Sykes, R. B. & Matthew, M. (1976). The beta-lactamases of gram-negative bacteria and

their role in resistance to beta-lactam antibiotics. J Antimicrob Chemother 2, 115-157.

Tajada, P., Gomez-Graces, J. L., Alos, J. I., Balas, D. & Cogollos, R. (1996).

Antimicrobial susceptibilities of Campylobacter jejuni and Campylobacter coli to 12 betalactam

agents and combinations with beta-lactamase inhibitors. Antimicrob Agents

Chemother 40, 1924-1925.

Tam, C. C., Rodrigues, L. C., Petersen, I., Islam, A., Hayward, A. & O'Brien, S. J.

(2006). Incidence of Guillain-Barre syndrome among patients with Campylobacter

infection: a general practice research database study. J Infect Dis 194, 95-97.

Taylor, D. E., Yan, W., Ng, L. K., Manavathu, E. K. & Courvalin, P. (1988). Genetic

characterization of kanamycin resistance in Campylobacter coli. Ann Inst Pasteur

Microbiol 139, 665-676.

Taylor, D. E., Ng, L. K. & Lior, H. (1985). Susceptibility of Campylobacter species to

nalidixic acid, enoxacin, and other DNA gyrase inhibitors. Antimicrob Agents Chemother

28, 708-710.

Tenover, F. C., Fennell, C. L., Lee, L. & LeBlanc, D. J. (1992). Characterization of two

plasmids from Campylobacter jejuni isolates that carry the aphA-7 kanamycin resistance

determinant. Antimicrob Agents Chemother 36, 712-716.

The European Food Safety Authority (2009). The community summary report on trends

and sources of zoonoses and zoonotic agents in the European Union in 2007. The EFSA

Journal 310, 1-278.

71


The National Veterinary Institute (SVA) (2009). SVARM 2008, Swedish Veterinary

Antimicrobial Resistance Monitoring. Uppsala, Sweden. Available from URL:

http://www.sva.se, accessed December 2009.

Vacher, S., Menard, A., Bernard, E., Santos, A. & Megraud, F. (2005). Detection of

mutations associated with macrolide resistance in thermophilic Campylobacter spp. by

real-time PCR. Microb Drug Resist 11, 40-47.

Vacher, S., Menard, A., Bernard, E. & Megraud, F. (2003). PCR-restriction fragment

length polymorphism analysis for detection of point mutations associated with macrolide

resistance in Campylobacter spp. Antimicrob Agents Chemother 47, 1125-1128.

van Hees, B. C., Veldman-Ariesen, M. J., de Jongh, B. M., Tersmette, M. & van Pelt,

W. (2007). Regional and seasonal differences in incidence and antibiotic resistance of

Campylobacter from a nationwide surveillance study in The Netherlands: an overview of

2000-2004. Clin Microbiol Infect 13, 305-310.

Wang, G., Wilson, T. J., Jiang, Q. & Taylor, D. E. (2001). Spontaneous mutations that

confer antibiotic resistance in Helicobacter pylori. Antimicrob Agents Chemother 45, 727-

733.

Wang, Y., Huang, W. M. & Taylor, D. E. (1993). Cloning and nucleotide sequence of

the Campylobacter jejuni gyrA gene and characterization of quinolone resistance

mutations. Antimicrob Agents Chemother 37, 457-463.

Wang, Y. & Taylor, D. E. (1990). Chloramphenicol resistance in Campylobacter coli:

nucleotide sequence, expression, and cloning vector construction. Gene 94, 23-28.

Wassenaar, T. M., Kist, M. & de Jong, A. (2007). Re-analysis of the risks attributed to

ciprofloxacin-resistant Campylobacter jejuni infections. Int J Antimicrob Agents 30, 195-

201.

Watts, J. L. & Lindeman, C. J. (2006). Antimicrobial susceptibility testing of bacteria of

veterinary origin. In Antimicrobial resistance in bacteria of animal origin, pp. 29-35.

Edited by F. M. Aarestrup. Washingtond D.C.: American Society for Microbiology.

Weissmann, G. (1991). Aspirin. Sci Am 264, 84.

Wistrom, J. & Norrby, S. R. (1995). Fluoroquinolones and bacterial enteritis, when and

for whom? J Antimicrob Chemother 36, 23-39.

World Health Organization (2002). Use of antimicrobials outside human medicine and

resultant antimicrobial resistance in humans. Fact sheet 268. Available from URL:

http://www.who.int/mediacentre/factsheets/fs268/en/, accessed December 2009.

72


Yan, M., Sahin, O., Lin, J. & Zhang, Q. (2006). Role of the CmeABC efflux pump in

the emergence of fluoroquinolone-resistant Campylobacter under selection pressure. J

Antimicrob Chemother 58, 1154-1159.

Zhang, Q. & Plummer, P. J. (2008). Mechanism of Antibiotic Resistance in

Campylobacter. In Campylobacter, pp. 263-276. Edited by I. Nachamkin, C. M.

Szymanski & M. J. Blaser. Washington D.C.: American Society for Microbiology.

Zhang, Q., Sahin, O., McDermott, P. F. & Payot, S. (2006). Fitness of antimicrobialresistant

Campylobacter and Salmonella. Microbes Infect 8, 1972-1978.

Zhou, J., Dong, Y., Zhao, X., Lee, S., Amin, A., Ramaswamy, S., Domagala, J.,

Musser, J. M. & Drlica, K. (2000). Selection of antibiotic-resistant bacterial mutants:

allelic diversity among fluoroquinolone-resistant mutations. J Infect Dis 182, 517-525.

Zirnstein, G., Helsel, L., Li, Y., Swaminathan, B. & Besser, J. (2000). Characterization

of gyrA mutations associated with fluoroquinolone resistance in Campylobacter coli by

DNA sequence analysis and MAMA PCR. FEMS Microbiol Lett 190, 1-7.

Zirnstein, G., Li, Y., Swaminathan, B. & Angulo, F. (1999). Ciprofloxacin resistance in

Campylobacter jejuni isolates: detection of gyrA resistance mutations by mismatch

amplification mutation assay PCR and DNA sequence analysis. J Clin Microbiol 37,

3276-3280.

73

More magazines by this user
Similar magazines