PDF–165K - National Center for Biotechnology Information ...

ncbi.nlm.nih.gov

PDF–165K - National Center for Biotechnology Information ...

JOURNAL OF CLINICAL MICROBIOLOGY, Jan. 1995, p. 41–44 Vol. 33, No. 1

0095-1137/95/$04.00�0

Copyright � 1995, American Society for Microbiology

Comparison of Three Methods for Extraction of Viral Nucleic

Acids from Blood Cultures

MARK J. ESPY, 1 ROBIN PATEL, 2 CARLOS V. PAYA, 2,3 AND THOMAS F. SMITH 1 *

Division of Clinical Microbiology, 1 Division of Infectious Diseases and Internal Medicine, 2

and Division of Experimental Pathology, 3 Mayo Clinic and

Foundation, Rochester, Minnesota 55905

Received 3 June 1994/Returned for modification 30 August 1994/Accepted 5 October 1994

Reliable nucleic acid extraction techniques for blood specimens are required for the sensitive detection of

viral DNA. Standardized procedures for processing blood specimens for the molecular detection of herpesviruses

(cytomegalovirus [CMV], herpes simplex virus, varicella-zoster virus, and Epstein-Barr virus [EBV])

have not been established. Three methods were used to extract DNA from blood specimens from healthy donors

and asymptomatic immunocompromised patients: (i) IsoQuick treatment of whole blood, (ii) extraction of the

peripheral blood leukocytes by lysis (lysis buffer and proteinase K), and (iii) extraction of peripheral blood

leukocytes with phenol-chloroform (sodium docecyl sulfate solution and proteinase K). All blood specimens

from 25 healthy blood donors were negative for CMV, herpes simplex virus and varicella-zoster virus nucleic

acid sequences, regardless of the extraction method, while three samples (12%) extracted by the lysis technique

were positive for EBV DNA. Of 25 blood samples from asymptomatic immunocompromised patients, CMV and

EBV each were detected in nine specimens by lysis extraction, four each by IsoQuick and four (CMV) and six

(EBV) by the phenol-chloroform method. Our results indicate that the lysis method is optimal for the detection

of CMV and EBV DNA sequences by PCR from the leukocytic fraction of blood specimens. DNA of these viruses

is frequently present in blood specimens from asymptomatic immunocompromised patients and occasionally

from healthy donors.

The importance of detecting herpesviruses (cytomegalovirus

[CMV], herpes simplex virus [HSV], varicella-zoster virus [VZV],

and Epstein-Barr virus [EBV]) in immunocompromised patients

can be difficult to interpret clinically. Detection of CMV

viremia in transplant recipients is the best viral marker to

predict symptomatic infection, including organ involvement (9,

15). Although CMV makes up over 97% of herpesvirus viremic

episodes in immunocompromised patients at our institution,

VZV and HSV are also recovered from blood of symptomatic

patients (2, 16). EBV, which causes lymphoproliferative disease

in immunocompromised hosts, is not recovered in cell

cultures used in routine diagnostic laboratories, thus making it

difficult to conclude the incidence and significance of EBV

viremia in these patients (22).

PCR allows detection of CMV, VZV, HSV, and EBV in

blood specimens. However, standardized procedures for processing

blood specimens for the molecular detection of these

herpesviruses remain to be established. Because of the clinical

importance of these viral infections in organ transplant and

AIDS patients in regard to antiviral prophylaxis, preemptive

treatment, and efficiency of therapy, we have compared three

different procedures for the optimal extraction of herpesvirus

DNA for subsequent PCR analysis: a commercial kit (Iso-

Quick), a lysis extraction procedure which uses a lysis buffer in

conjunction with proteinase K, and a phenol-chloroform extraction

followed by ethanol precipitation of the target nucleic

acid. With these results, we next analyzed the prevalence of

herpesvirus DNA in blood specimens from both healthy and

immunocompromised patients.

* Corresponding author. Mailing address: Division of Clinical Microbiology,

Mayo Clinic, 200 First St. S.W., Rochester, MN 55905.

41

MATERIALS AND METHODS

Clinical samples. Blood samples (5 ml) collected in EDTA-coated tubes were

obtained from 25 healthy blood donors, and 25 samples were collected from 21

consecutive organ transplant recipients who were monitored for the presence of

CMV viremia as part of routine protocols established in each transplant

program. Use of the samples for the evaluation described in this report was

approved by our institutional investigational research board.

Sample preparation. Whole blood was used for the IsoQuick (Microprobe

Corp., Bothell, Wash.) extraction kit (4). The leukocyte fraction of whole blood

was used for the lysis and phenol-chloroform extraction techniques. The

procedure used for leukocyte separation was as follows: 5 ml of whole blood was

layered over 7.5 ml of Histopaque 1119 (Sigma, St. Louis, Mo.), and the

combination was centrifuged at 700 � g for 25 min at 18 to 22�C. The top layer

(plasma) was discarded, and the second layer (leukocytes) was transferred to a

second centrifuge tube containing 5 ml of phosphate-buffered saline. The cells

were centrifuged at 700 � g for 10 min. The supernatant fraction was discarded,

and the cells were resuspended in 5 ml of medium (Eagle’s minimal essential

medium with 10% fetal calf serum). After centrifugation at 700 � g for 10 min,

the cells were resuspended in maintenance medium to a final volume of 2.0 ml

(2).

Inoculation of cell cultures. Leukocyte fractions obtained by Histopaque 1119

were suspended in 2 ml of Eagle’s minimal essential medium. Conventional tube

cell cultures (MRC-5; Viromed, Minneapolis, Minn.) were inoculated with 1 ml

each; three shell vial cell cultures received 0.3 ml each. Tube cell cultures were

incubated at 36�C on a roller drum for 14 days and examined three times a week

for the presence of cytopathic effects characteristic of CMV. Coverslips with

MRC-5 monolayers in shell vials were stained at 16 h postinoculation with

monoclonal antibody specific for the immediate early antigen of CMV (Bartels,

Issaquah, Wash.) by the indirect immunofluorescence test (11).

Serology. Antibodies to each of the herpesviruses were measured by the

anticomplement immunofluorescence test, using virus-infected substrate cells

obtained from Bion Enterprises, Park Ridge, Ill. (CMV, VZV, and HSV), or

Wampole, Cranbury, N.J. (EBV) (20).

Nucleic acid extraction. The IsoQuick extraction procedure was performed

according to the manufacturer’s instructions for processing whole-blood specimens.

Viral nucleic acid was extracted from leukocytes by lysis and phenolchloroform

methods (7, 8, 19) (Fig. 1).

Oligonucleotide primers and probes. Oligonucleotides specific for CMV,

VZV, HSV, and EBV were prepared with a DNA synthesizer (Applied Biosystems)

at the Mayo Clinic Molecular Core Facility, Rochester, Minn. In

addition, to ensure the quality of the nucleic acid extracted from the blood

sample, all specimens were tested for the presence of �-globin sequences by PCR

amplification (18). �-Globin sequences are found in all human tissues, and a


42 ESPY ET AL. J. CLIN. MICROBIOL.

FIG. 1. Procedures for extracting herpesvirus DNA from blood specimens.

The manufacturer’s instructions were followed for the IsoQuick procedure. TE,

Tris-EDTA; SDS, sodium dodecyl sulfate; PBS, phosphate-buffered saline.

positive result after PCR indicated that the extracted material was of sufficient

quality for further PCR testing. Information regarding the primer and probe sets

is given in Table 1.

PCR amplification. The PCR reaction mixture contained the following: 200

�M (each) deoxyribonucleotide triphosphates, 10� buffer (500 mM KCl, 100

mM Tris-Cl [pH 8.3], 15 mM MgCl 2, 2.5 mg of bovine serum albumin per ml),

100 pmol each of the appropriate primer, 25 �g of isopsoralen per ml (IP-10;

HRI Associates, Concord, Calif.), 10% glycerol, and 1.25 U of Taq polymerase.

Each reaction tube received 45 �l of the reaction mixture, 2 drops of mineral oil,

and 5 �l of target DNA. A no-target control reaction tube received 50 �l of

reaction mixture only. Positive controls were included for each target tested. For

CMV, HSV, and VZV, American Type Culture Collection strains were inoculated

into cell cultures. DNA from each virus was extracted by the phenolchloroform

method and diluted such that the preparation produced the last

clearly visible band on gel electrophoresis. DNA extracted from a Burkitt’s

lymphoma cell line (Daudi cells) containing 118 to 224 copies of EBV per cell

and DNA from MRC-5 cells were positive control targets for the virus and for

the �-globulin gene, respectively (18, 21). Reactions were amplified in a DNA

thermal cycler (model 480; Perkin-Elmer Cetus), using the following protocol: 2

min of denaturation at 94�C for 1 cycle and then 1 min of denaturation at 94�C,

1 min of annealing at 60�C, and 1 min of primer extension at 72�C for 60 cycles

(7). After the cycling was completed, the tubes were placed in a UV transilluminator

(HRI-100; HRI Associates) for 15 min at 4�C to activate the IP-10 (8).

Identification of amplicon sequences. PCR products were visualized with UV

light as a single band by staining with ethidium bromide (10 mg/ml) after agarose

gel electrophoresis (3%:1.5% NuSieve [FMC, Rockland, Maine], 1.5% electrophoresis-grade

agarose [Bethesda Research Laboratories, Gaithersburg, Md.]).

The products were then transferred to a nylon membrane (Magnagraph; Fisher)

by Southern blotting. Membranes were prehybridized for 1hat42�C with a

hybridization solution obtained from Amersham (Arlington Heights, Ill.). The

probes were developed by first amplifying a sequence internal to each primer set.

These internal amplicons were then labeled for chemiluminescence with the

Enhanced Chemiluminescence kit from Amersham. The labeled probes were

added and allowed to hybridize to the membrane for 4 h. The membranes were

washed twice with 50 ml of wash buffer (6 M urea, 0.4% sodium dodecyl sulfate,

0.5� SSC [1� SSC is 0.15 M sodium chloride plus 0.015 M sodium citrate]) at

42�C for 20 min and twice with 100 ml of 2� SSC at room temperature for 5 min.

The membranes were then placed in 30 ml of detection reagent provided in the

Enhanced Chemiluminescence detection kit for 1 min at room temperature and

then exposed to X-ray film for 1 h. The film was then developed by a Kodak

X-Omat X-ray film processor.

RESULTS

Healthy blood donor samples. Whole blood (IsoQuick extraction)

and leukocyte fractions (lysis and phenol-chloroform

methods) from healthy blood donors were negative for DNA

sequences by PCR and for detection of viral infectivity in cell

cultures for HSV, CMV, and VZV (Table 2). Of 25 serum

specimens from these donors, 18, 13, and 22 specimens contained

antibodies to HSV, CMV, and VZV, respectively. All

donors were seropositive to EBV. Blood specimens extracted

by IsoQuick and phenol-chloroform were also negative for

TABLE 1. Characteristics and nucleotide base sequences of primers and probes used to detect target nucleic acids

Organism Gene target

GenBank

accession no.

Position

(nucleotides)

Size

(bp)

Sequence

None �-Globin V00499 117–283 168 ACACAACTGTGTTCACTAGCA

TGGTCTCCTTAAACCTGTCTTG

HSV DNA polymerase M16321 2821–3110 291 TACATCGGCGTCATCTGCGGGG Primer

AGTTCGGCGGTGAGGACAAAGT Primer

2855–3049 196 TCAAGGGCGTGGATCTGGTGCG Probe

GGTCGGTGATGCGCCGATGGGC Probe

VZV Gene 29 (major binding protein) 53730–54016 288 ATTATGGACTACGGCTTTTACT Primer

CTTGGTCGGATAGGGTGGTTTC Primer

53761–53960 201 TTAGTCCGCGCGGCCATGAATC Probe

ATAAAACCTCCTCTAGGACATG Probe

CMV Immediate early K01090 1067–1435 370 GGGTGCTGTCCTGCTATGTCTTA Primer

CATCACTCTGCTCACTTTCTTCC Primer

1117–1371 256 CGGCCTCTGATAACCAAGCCTG Probe

AGTCGCGGGTACAGGGGACTCT Probe

EBV Glycoprotein 220 V01555 90030–90268 240 GGCTGGTGTCACCTGTGTTA Primer

V01509 CCTTAGGAGGAACAAGTCCC Primer

V01554 90051–90243 194 ATTTTCACCACCTGTTGGGTGA Probe

AGTAGTTACCAGCCAACCAAAA Probe


VOL. 33, 1995 EXTRACTION OF VIRAL NUCLEIC ACIDS FROM BLOOD CULTURES 43

TABLE 2. Detection of CMV and EBV DNA sequences in blood

specimens from 25 immunocompromised patients a

Virus b

CMV b

EBV c

No. of sequences detected by:

IsoQuickc Lysis Phenol-chloroform

4 9 4

4 9 6

a All specimens were negative for HSV and VZV.

b The gene target was immediate early antigen (370 bp).

c The gene target was glycoprotein 220 (240 bp).

EBV DNA; however, 3 of the 25 (12%) samples extracted by

the lysis technique were positive for this viral DNA target.

Immunocompromised patients. Collectively, of the 50 specimens

tested for CMV and EBV DNA, 8 specimens were

detected by both lysis and IsoQuick; however, 13 specimens

were positive for these viral nucleic acids by lysis but not by

IsoQuick (P � 0.01). Importantly, there were no specimens

that were positive by IsoQuick that were not detected by lysis.

Almost all serum samples were seropositive for both CMV

(23 of 25, 92%) and EBV (21 of 25, 84%). All PCR-positive

results from this patient population were from samples seropositive

to both viruses. All extraction techniques failed to

produce positive results for VZV and HSV DNA after PCR;

nevertheless, these primers consistently amplified these viral

targets in positive control samples and in routine assays performed

with cerebrospinal fluid and other specimens. DNA

specimens from healthy and immunocompromised patients

were positive for the �-globin gene, and control samples (positive

and negative) gave appropriate reactions for all targets

tested.

DISCUSSION

The clinical significance of a viral infection is enhanced by

the laboratory detection of the agent in the blood relative to

specimens obtained from other sources such as the respiratory

or gastrointestinal tract (10, 21, 23). Herpesvirus infections are

a recognized cause of morbidity and mortality in immunocompromised

patients, and PCR technology provides the potential

for the rapid and sensitive detection of these viruses, including

EBV. However, for the virology laboratory to be able to implement

PCR testing for these viruses, the optimal specimen

processing and extraction conditions must be defined for blood

specimens. In the past, preparation of blood specimens for

PCR was designed for use in human genetic analysis in which

the target copy was high (10 3 to 10 5 ) relative to the copies of

viral DNA expected with herpesvirus viremia (�10 1 to 10 2 ).

Therefore, at the present time, methods for the detection of

viremia by PCR have yet to be compared.

CMV and EBV replicate in the leukocyte fraction of blood

and are conventionally considered to be cell associated, with

relatively low levels of extracellular virus detectable in cell

cultures (22). Therefore, we combined the polymorphonuclear

and mononuclear leukocytic fractions and extracted DNA by

both the lysis and the phenol-chloroform procedures. These

two procedures involve an initial treatment with detergents to

solubilize cell components and with proteinase K to digest

histones that would otherwise remain strongly bound to DNA

(12). The phenol-chloroform extraction method would be

expected to reduce the concentration of residual protein and

membrane components which may potentially inhibit Taq

polymerase activity, whereas with the lysis method the leukocytic

fraction is boiled (but not extracted with organic solvents)

after proteolytic digestion. Nevertheless, with separated leukocytes,

we found that phenol-chloroform did not improve the

sensitivity of PCR to detect herpesvirus DNA. Comparatively,

the simpler lysis extraction with subsequent denaturation of

DNA by boiling provided maximum detection of both CMV

and EBV nucleic acid targets.

In our comparison, we included the IsoQuick kit, available

commercially, which is recommended for the extraction of

nucleic acids from blood samples. Since the procedural steps in

the lysis and phenol-chloroform methods are commonly not

uniform among laboratories, we included a technique which

could be easily standardized and accessible to diagnostic laboratories.

The IsoQuick technique utilizes the chaotropic

properties of guanidine thiocyanate, which both disrupts cellular

integrity and inhibits nucleases; the procedure is designed

to extract both DNA and RNA of purity and yield comparable

to that obtained by the phenol-chloroform method but without

the use of hazardous chemicals.

Our goal was to evaluate methods for detection of herpesvirus

DNA from either anticoagulated blood or the separated

leukocytes. However, it has recently been reported that serum

or plasma may be a suitable specimen for the detection of

CMV DNA by PCR (3). Although by culture analysis a small

proportion of extracellular virus is infectious, it is now being

realized that virus-specific DNA may be released in substantial

amounts into the extracellular serum or plasma phases of

blood. It would be fortuitous if the IsoQuick kit, because of its

commercial availability, had application to the rapid and

sensitive detection of herpesvirus DNA in these readily available

specimens in the clinical laboratory.

Because CMV and EBV replicate in peripheral blood leukocytes,

the detection of their nucleic acid in immunocompromised

patients was expected, as demonstrated previously (10).

In immunocompromised transplant recipients, we have previously

demonstrated that DNA sequences of CMV are routinely

present in both the mononuclear and cell-free fractions

(serum and plasma) of peripheral blood. In some cases, the

presence of CMV DNA does not correlate with symptomatic

infection or with culture documentation of viral replication (5,

17). The blood specimens in our study were selected on the

basis of their submission for viral culture and were collected as

part of a routine prospective protocol ongoing in organ

transplant recipients (liver [14], kidney [3], and bone marrow

[2]), and none of the specimens studied correlate with clinical

or microbiological evidence of acute herpesvirus infection.

Conversely, blood specimens from 3 of 25 healthy blood

donors contained EBV but not viral sequences from other

herpesviruses (1). Similarly, in another study, EBV DNA was

detected in 15 of 16 seropositive healthy individuals (24).

These data indicate that the presence of EBV DNA in blood

specimens does not discriminate between infection in the

immunosuppressed and that in the immunologically normal

patient. Subsequent investigations should focus on the quantitative

levels of viral DNA present in blood specimens to

attempt to discriminate between symptomatic patients and

those without disease by using these markers.

Transition of research-based PCR to the routine clinical

laboratory requires strict adherence to technical steps designed

to reduce the likelihood of contamination of specimens containing

target nucleic acids with those samples free of virus.

For this purpose, we designated separate physical rooms for

specimen extraction and analysis of amplified products. In

addition, we use positive-displacement pipettors, together with

disposable gowns and gloves, as previously recommended (14).

Control for PCR contamination occurring prior to amplification

depends on following these recommendations; all extrac-


44 ESPY ET AL. J. CLIN. MICROBIOL.

tion procedures used in our evaluation (IsoQuick, lysis, and

phenol-chloroform) extraction would be expected to be of

equal risk regarding processing steps for potential sample-tosample

contamination. At least one target-free control for

every five patient samples was included in each test run. Most

importantly, post-PCR carryover contamination was controlled

by incorporation of isopsoralen into all reaction mixtures (8).

Reliable nucleic acid extraction techniques for blood specimens

are required for the sensitive detection of CMV infections

in immunocompromised patients. We recommend the

lysis method performed in this study with leukocytic fractions

of blood. Early and sensitive detection of this marker in blood

specimens may allow specific preemptive therapy for patients

at risk for the development of systemic disease due to this virus

(6, 13, 25).

REFERENCES

1. Bitsch, A., H. Kirchner, R. Dupke, and G. Bein. 1992. Failure to detect

human cytomegalovirus DNA in peripheral blood leukocytes of healthy

blood donors by the polymerase chain reaction. Transfusion 32:612–617.

2. Brice, S. L., S. S. Stockert, J. D. Jester, J. C. Huff, J. D. Bunker, and W. L.

Weston. 1992. Detection of herpes simplex virus DNA in the peripheral

blood during acute recurrent herpes labialis. J. Am. Acad. Dermatol. 26:

594–598.

3. Brytting, M., W. Xu, B. Wahren, and V. Sundqvist. 1992. Cytomegalovirus

DNA detection in sera from patients with active cytomegalovirus infections.

J. Clin. Microbiol. 30:1937–1941.

4. Chirgwin, J. M., A. E. Przybyla, R. J. MacDonald, and W. J. Rutter. 1979.

Isolation of biologically active ribonucleic acid from sources enriched in

ribonuclease. Biochemistry 18:5294–5299.

5. Delgado, R., C. Lumbreras, C. Alba, M. A. Pedraza, J. R. Otero, R. Gomez,

E. Moreno, A. R. Noriega, and C. V. Paya. 1992. Low predictive value of

polymerase chain reaction for diagnosis of cytomegalovirus disease in liver

transplant recipients. J. Clin. Microbiol. 30:1876–1878.

6. Drouet, E., A. Boibieux, S. Michelson, R. Ecochard, F. Biron, D. Peyramond,

R. Colimon, and G. Denoyel. 1993. Polymerase chain reaction detection of

cytomegalovirus DNA in peripheral blood leukocytes as predictor of cytomegalovirus

disease in HIV-infected patients. AIDS 7:665–668.

7. Espy, M. J., and T. F. Smith. 1993. PCR detection of cytomegalovirus DNA

sequences in clinical specimens, p. 332–336. In D. H. Persing, T. F. Smith,

F. C. Tenover, and T. J. White (ed.), Diagnostic molecular microbiology:

principles and applications. American Society for Microbiology, Washington,

D.C.

8. Espy, M. J., T. F. Smith, and D. H. Persing. 1993. Dependence of polymerase

chain reaction product inactivation protocols on amplicon length and

sequence composition. J. Clin. Microbiol. 31:2361–2365.

9. Gazlan, J., J.-M. Salord, C. Chouaid, C. Duvivien, O. Pickard, M.-C.

Meyohas, and J.-C. Petil. 1993. Human cytomegalovirus (HCMV) latemRNA

detection in peripheral blood of AIDS patients: diagnostic value for

HCMV disease compared with those of viral culture and HCMV DNA

detection. J. Clin. Microbiol. 31:1943–1945.

10. Gerna, G., D. Zipeto, M. Parea, E. Percivalle, M. Zavattoni, A. Gaballo, and

G. Milanesi. 1991. Early virus isolation, early structural antigen detection

and DNA amplification by the polymerase chain reaction in polymorphonuclear

leukocytes from AIDS patients with human cytomegalovirus viraemia.

Mol. Cell. Probes 5:365–374.

11. Gleaves, C. A., T. F. Smith, E. A. Shuster, and G. R. Pearson. 1985.

Comparison of standard tube and shell vial cell culture techniques for the

detection of cytomegalovirus in clinical specimens. J. Clin. Microbiol. 21:

217–221.

12. Higuchi, R. 1989. Simple and rapid preparation of samples for PCR, p.

31–38. In H. A. Erlich (ed.), PCR technology: principles and applications for

DNA amplification. Stockton Press, New York.

13. Jordan, M. L., R. L. Hrebinko, Jr., J. S. Dummer, D. P. Hickey, R. Shapiro,

C. A. Viwas, R. L. Simmons, T. E. Starzl, and T. R. Hakala. 1992. Therapeutic

use of ganciclovir for invasive cytomegalovirus infection in cadaveric

renal allograft recipients. J. Urol. 148:1388–1392.

14. Kwok, S., and R. Higucki. 1989. Avoiding false-positives with PCR. Nature

(London) 339:237–238.

15. Meyers, J. D., P. Ljungman, and L. D. Fisher. 1990. Cytomegalovirus

excretion as a predictor of cytomegalovirus disease after marrow transplantation:

importance of cytomegalovirus viremia. J. Infect. Dis. 162:373–380.

16. Myers, M. G. 1979. Viremia caused by varicella-zoster virus: association with

malignant progressive varicella. J. Infect. Dis. 140:229–233.

17. Patel, R., T. F. Smith, M. Espy, R. H. Wiesner, R. A. F. Krom, D. Portela,

and C. V. Paya. Detection of cytomegalovirus DNA in sera of liver transplant

recipients. J. Clin. Microbiol. 32:1431–1434.

18. Saiki, R. K., D. H. Gelfand, S. Stoffel, S. J. Scharf, R. Higuchi, G. T. Horn,

K. B. Mullis, and H. A. Erlich. 1988. Primer-directed enzymatic amplification

of DNA with a thermostable DNA polymerase. Science 239:486–491.

19. Shibata, D., W. J. Martin, M. D. Appleman, D. M. Causey, J. M. Leedom,

and N. Arnheim. 1988. Detection of cytomegalovirus DNA in peripheral

blood of patients infected with human immunodeficiency virus. J. Infect. Dis.

158:1185–1192.

20. Smith, T. F. 1983. Viral serology in clinical medicine, p. 31–56. In H. H.

Homburger and J. G. Balsakis (ed.), Clinical laboratory annual. Appleton-

Century-Crofts, New York.

21. Telenti, A., W. F. Marshall, and T. F. Smith. 1990. Detection of Epstein-Barr

virus by polymerase chain reaction. J. Clin. Microbiol. 28:2187–2190.

22. Telenti, A., T. F. Smith, J. Ludwig, M. R. Keating, R. A. F. Krom, and R. H.

Wiesner. 1991. Epstein-Barr virus and persistent graft dysfunction after liver

transplantation. Hepatology 14:282–286.

23. Vilmer, E., M. C. Mazeron, C. Rabian, O. Azogui, A. Devergie, Y. Perol, and

E. Gluckman. 1985. Clinical significance of cytomegalovirus viremia in bone

marrow transplantation. Transplantation 40:30–35.

24. Wagner, H. J., G. Bein, A. Bitsch, and H. Kirchner. 1992. Detection and

quantification of latently infected B lymphocytes in Epstein-Barr virusseropositive,

healthy individuals by polymerase chain reaction. J. Clin.

Microbiol. 30:2826–2829.

25. Zaia, J. A. 1993. Prevention and treatment of cytomegalovirus pneumonia in

transplant recipients. Clin. Infect. Dis. 17(Suppl):5392–5399.

More magazines by this user
Similar magazines