Dosis 4/2018

omnipress

Farmaseuttinen aikakauskirja DOSIS 4/2018 vol.34 Suomen Farmasialiitto ry

Farmaseuttinen aikakauskirja

Vol. 34 | 4/2018

PÄÄKIRJOITUS

Katri Hämeen-Anttila, Ulla Närhi

Verkostot Rationaalisen lääkehoidon toimeenpano-ohjelmaa jalkauttamassa..............................261

ALKUPERÄISTUTKIMUKSET

Kim Rattay, Hanna Kauppinen, Riitta Ahonen, Johanna Timonen:

Mielipiteitä sähköisen reseptin tietosuojasta – kyselytutkimus apteekkien asiakkaille.............264

Suvi T. Häkkinen, Kirsi-Marja Oksman-Caldentey:

Skopolamiinia tuottavien karvajuurien metabolinen

stabiilisuus 16 vuoden ylläpidon jälkeen................................................................................................... 276

KATSAUKSET

Niina Laine, Kirsi Kvarnström, Lotta Schepel

Farmasian ammattilaisten rooli sairaaloiden mikrobilääkehoidon ohjauksessa...........................288

Pirkko Paakkari, Marja Forsell

Munuaisten vajaatoiminta – huomaamatta jäävä lääkehoidon ongelma?......................................296

VÄITÖSKIRJAKATSAUS

Kati Sarnola

Lääkkeiden saatavuus ja saavutettavuus – lääkkeiden saatavuusongelmat

Suomessa ja harvinaislääkkeiden saavutettavuus Euroopassa.........................................................304

Refereet 2018.....................................................................................................................................................316

© Suomen Farmasialiitto ry 259

© DOSIS nr0 4/2018


Farmaseuttinen aikakauskirja

Vol. 34 | 4/2018

Julkaisija

Suomen Farmasialiitto ry /

viestintä

Asemamiehenkatu 2

00520 Helsinki

Päätoimittaja

Dosentti Anneli Ritala-Nurmi

VTT

Tietotie 2

Espoo

dosis@farmasialiitto.fi

Toimituskunta

Dosentti Katri Hämeen-Anttila

Proviisori, toksikologi Antti Kataja

Farmasian tohtori Anne Lecklin

Farmasian tohtori Minna Matikainen

Dosentti Ulla Närhi

Farmasian tohtori Joni Palmgrén

Farmasian tohtori Marika Pohjanoksa-Mäntylä

Ulkoasu

Omnipress Oy

Oona Kavasto/Hank,

www.omnipress.fi

ISSN 0783-4233

© DOSIS nr0 4/2018 260

© Suomen Farmasialiitto ry


PÄÄKIRJOITUS

Verkostot Rationaalisen

lääkehoidon toimeenpanoohjelmaa

jalkauttamassa

Rationaalisen lääkehoidon loppuraportti

ja työryhmien raportit

on julkaistu alkuvuodesta 2018

(https://stm.fi/rationaalinenlaakehoito/julkaisut),

kuten Dosiksen

numerossa 2/2018 todettiin. Samalla

tuotiin esille, että lääkealan kaikkia toimijoita

tarvitaan yhteisten tavoitteiden käytäntöön viemiseen,

etteivät ne jää vain raportteihin kirjatuiksi, käytännössä

toteutumattomiksi tavoitteiksi.

Kansallisesti laajin yhteenliittymä näitä yhteisiä

tavoitteita toteuttamassa on Lääkeinformaatioverkosto.

Sen työryhmät (https://www.innokyla.fi/

web/hanke167840) ovat omalta osaltaan lähteneet

viemään käytäntöön Rationaalisen lääkehoidon toimeenpano-ohjelmaa.

Itse asiassa kyseinen toimeenpano-ohjelma

on työryhmien tärkein ohjenuora toimintakaudella

2018–2020. Läpileikkaavana teemana

on kaikilla työryhmillä ”Lääkehoito on kumppanuutta”,

joka on nostettu Rationaalisen lääkehoidon toimeenpano-ohjelmassa

keskiöön. Konkreettisia esimerkkejä

eri työryhmien toiminnasta ovat seuraavat:

• ”Potilaan ja eri ammattilaisten rooli lääkehoitoprosessissa”

sanomasta viestiminen esimerkiksi potilasjärjestöjen

lehdissä ja koulutuksissa

• Hyvien, lääkehoidon järkevöittämiseen suuntautuvien

toimintamallien esiin nostaminen terveydenhuollon

ammattilaisille suunnatuissa tilaisuuksissa

• Moniammatillisen yhteistyön edistäminen eri

ammattilaisten koulutuksen kautta

Tutkimuksen näkökulmasta Lääkehoito on kumppanuutta

-tavoite haastaa tutkimaan lääkkeiden käyt-

© Suomen Farmasialiitto ry 261

© DOSIS nr0 4/2018


täjien arkea. Ymmärrystä tarvitaan laajemmista ilmiöistä

– esimerkiksi siitä, millaisia lääkekäsityksiä tai

lääkkeiden käyttötapoja on väestötasolla. Tutkimuksen

avulla tunnistetaan lääkehoitojen toteutumisen

ongelmakohtia, jotta näihin voidaan hakea ratkaisuja.

Toisaalta tietoa ja osaamista tarvitaan potilaan yksilölliseen

kohtaamiseen. Tutkimustietoa tarvitaan

myös tukemaan terveydenhuollon ammattilaisten

vuorovaikutustaitojen koulutusta erilaisten potilasja

väestöryhmien kohtaamisessa.

Rationaalisen lääkehoidon aihealueella tehtävää

tutkimusta on lähdetty edistämään Rationaalisen

lääkehoidon tutkimusverkostossa (https://www.

fimea.fi/kehittaminen/tutkimus/rationaalisenlaakehoidon-tutkimusverkosto).

Fimean koordinoiman

verkoston tavoitteena on toteuttaa Rationaalisen

lääkehoidon tutkimusstrategiaa ja lisätä yhteistyötä

tämän aihepiirin tutkimuksessa. Tutkimusverkoston

toiminta muotoutuu aihepiirin tutkijoiden

aktiivisuuden ja tarpeiden mukaisesti. Helmikuussa

2019 kokoonnutaan verkostoitumistilaisuuteen

Tahkovuorelle pohtimaan, mitkä rationaalisen lääkehoidon

tutkimusteemoista ovat sellaisia, joista voisi

muodostua laajempaa tutkimusyhteistyötä ja jopa

konsortiotutkimuksia. Lisäksi tilaisuudessa tunnistetaan

rahoitusinstrumentteja, joista olisi mahdollista

hakea rahoitusta näihin teemoihin. Verkostoitumistilaisuuksia

järjestetään jatkossa eri puolella Suomea.

Verkoston toimintaan pääsee mukaan tilaamalla uutiskirjeen

Fimean verkkosivuilta (https://www.fimea.

fi/tietoa_fimeasta/ajankohtaista/uutiskirjetilaus).

Fimea on selvittänyt sosiaali- ja terveysministeriön

toimeksiannosta reaalimaailman datan käyttöä lääkkeiden

ja lääkinnällisten laitteiden säätelyn, terveydenhuollon

menetelmien arvioinnin ja lääkehoitojen

kansallisen ohjauksen näkökulmista. Tämä selvitystyö

luo pohjaa Rationaalisen lääkehoidon toimeenpano-ohjelman

ensimmäisen linjauksen ”Lääkehoitoa

ja lääkehuoltoa johdetaan tiedolla kansallisesti, alueellisesti

ja palveluyksiköissä” toteutukseen. Selvitystyössä

kuvataan tietotarpeet, keskeiset hankkeet, toimintaympäristö

ja tietovarannot sekä rajoitukset reaalimaailman

datan käytössä. Sote-tietovarantoihin,

kuten terveydenhuollon rekistereihin, potilastietojärjestelmiin

ja Kanta-palveluun, kertyvää reaalimaailman

dataa voidaan hyödyntää muun muassa hoidon

hyötyjen ja haittojen sekä palveluiden ja voimavarojen

käytön tutkimiseen. Kaikki tämä luo perustan päätöksenteolle

ja resurssien käytön ohjaamiselle terveydenhuollossamme.

Reaalimaailman datan käyttöön

liittyy myös monenlaisia haasteita ja rajoituksia, joihin

tutkimusta tekevän tulee olla perehtynyt. Reaalimaailman

dataa tutkimuksessaan käyttävällä tulee olla

paitsi ymmärrys eri tietovarantojen datan laadusta

ja kattavuudesta, myös menetelmäosaamista aineiston

muodostamiseen ja analysointiin.

Rationaalisen lääkehoidon toimeenpano-ohjelman

jalkauttaminen siis jatkuu monella tasolla. Toimeenpano-ohjelmassa

asetettiin toiminnan tavoitteita

vuoteen 2022 mennessä – näitä kohti edetään

monen eri tahon yhteistyöllä, työkaluina sekä ohjaus,

neuvonta että säädösvalmistelu.

LÄHTEET

Lääkealan turvallisuus- ja kehittämiskeskus

Fimea. Rationaalisen lääkehoidon tutkimusverkosto

kokoontuu verkostoitumistilaisuuteen (verkkouutinen):

https://www.fimea.fi/-/rationaalisenlaakehoidon-tutkimusverkosto-kokoontuuverkostoitumistilaisuuteen-14-2-2019-

tahkovuorelle-tule-mukaan- (13.11.2018)

Närhi U., Palmgren J. Linjauksista käytäntöön.

Pääkirjoitus. Dosis 2:101–102, 2018

Rationaalisen lääkehoidon toimeenpanoohjelman

loppuraportti (8.11.2018)

http://urn.fi/URN:ISBN:978-952-00-3915-8

Tutkimustieto hyötykäyttöön: Rationaalisen lääkehoidon

tutkimusstrategia 2018–2022 (8.11.2018)

http://urn.fi/URN:ISBN:978-952-00-3905-9

Rannanheimo P, Jauhonen H-M. Mihin reaalimaailman

dataa tarvitaan? Näkökulmana

lääkkeiden ja lääkinnällisten laitteiden valvonta,

arviointi (HTA) ja kansallinen ohjaus.

Sosiaali- ja terveysministeriön raportteja ja

muistioita 44/2018, Helsinki 2018

http://urn.fi/URN:ISBN:978-952-00-3998-1

(27.11.2018)

➔ Katri Hämeen-Anttila

FaT, dosentti,

tutkimus- ja kehittämispäällikkö,

Lääkealan turvallisuus- ja

kehittämiskeskus Fimea

➔ Ulla Närhi

FaT, dosentti,

neuvotteleva virkamies,

hyvinvointi- ja palveluosasto,

sosiaali- ja terveysministeriö

© DOSIS nr0 4/2018 262

© Suomen Farmasialiitto ry


Dosis – alansa ainoa

suomenkielinen

tieteellinen julkaisu

Dosiksessa julkaistaan farmasian ja sen

lähialojen alkuperäistutkimuksia, katsauksia,

tieteellisiä kommentteja ja referaatteja

sekä väitöskirjojen tiivistelmiä.

Dosis on avoin verkkolehti ja se ilmestyy neljä

kertaa vuodessa osoitteessa www.dosis.fi

Sitä kustantaa ja julkaisee Suomen Farmasialiitto.

Dosiksen julkaisut löytyvät myös Terveysportin

kautta Duodecimin lääketietokannasta:

http://www.terveysportti.fi/terveysportti/dlr_laake.koti


Mielipiteitä sähköisen

reseptin tietosuojasta

– kyselytutkimus apteekkien

asiakkaille

➔ Kim Rattay*

Proviisori

Farmasian laitos

Terveystieteiden tiedekunta

Itä-Suomen yliopisto

kim.rattay@outlook.com

➔ Hanna Kauppinen * , **

FaT, projektitutkija

Farmasian laitos

Itä-Suomen yliopisto

hanna.kauppinen@uef.fi

➔ Riitta Ahonen

Apteekkiopin professori

Farmasian laitos

Terveystieteiden tiedekunta

Itä-Suomen yliopisto

riitta.ahonen@uef.fi

➔ Johanna Timonen

FaT, yliopistotutkija

Farmasian laitos

Terveystieteiden tiedekunta

Itä-Suomen yliopisto

johanna.timonen@uef.fi

* Yhdenvertainen kirjoittajuus

** Kirjeenvaihto

© DOSIS n:0 4/2018 264

© Suomen Farmasialiitto ry


TIIVISTELMÄ

Johdanto: Sähköinen resepti on Suomessa laajamittaisessa käytössä. Reseptitiedot ovat arkaluontoisia terveystietoja,

joten potilailla tulee olla luottamus yksityisyydensuojaan ja reseptitietojensa asianmukaiseen

käyttöön. Tämän tutkimuksen tavoitteena oli selvittää apteekkien asiakkaiden mielipiteitä sähköisen reseptin

turvallisuudesta ja tietosuojasta sekä lääkäreiden ja apteekkien farmaseuttisen henkilöstön katseluoikeudesta

sähköisiin resepteihin.

Aineisto ja menetelmät: Kyselytutkimus toteutettiin syksyllä 2015. Kohderyhmänä olivat 18 vuotta täyttäneet

sähköisellä reseptillä itselleen lääkkeitä hakeneet apteekkien asiakkaat. Kyselylomakkeita jaettiin yhteensä

2 915 eri puolelta Suomea sijainneista apteekeista (n=18). Tutkimuksessa käytettiin Likert-asteikollisia

väittämiä ja avointa kysymystä. Likert-asteikon vastaukset analysoitiin suorina jakaumina, ristiintaulukoina,

sekä X

2- ja Fisherin tarkalla nelikenttä -testillä. Avoimen kysymyksen vastaukset luokiteltiin, koodattiin

ja analysoitiin suorina jakaumina.

Tulokset: Tutkimusaineisto koostui 1 288 (vastausprosentti 44 %) kyselylomakkeesta. Lähes kaikkien kyselyyn

vastanneiden apteekkien asiakkaiden mielestä sähköisen reseptin käyttäminen oli turvallista (97 %). Kyselyyn

vastanneet eivät pelänneet reseptitietojensa päätymistä asiattomien käsiin (77 %) tai reseptitietojensa

väärinkäyttöä (82 %). Suurin osa vastaajista piti tärkeänä, että lääkärit (98 %) ja apteekkien farmaseutit/proviisorit

(96 %) pääsevät heidän reseptitietoihinsa. Avoimessa kysymyksessä vastaajat toivat yleisimmin esille,

että heillä on vaikeuksia päästä Omakantaan tai ettei sen käyttöön ole mahdollisuutta.

Johtopäätökset: Apteekkien asiakkaat pitävät sähköistä reseptiä pääsääntöisesti turvallisena ja luottavat

reseptitietojensa asianmukaiseen käyttöön. Osa kuitenkin pelkää reseptitietojensa päätymistä asiattomien

käsiin. Lääkäreiden ja farmaseuttisen henkilöstön pääsyä reseptitietoihin pidetään tärkeänä. Osalla apteekkien

asiakkaista on vaikeuksia päästä katsomaan omia reseptitietojaan Omakannasta. Apteekkien asiakkaille,

joilla on pelkoja tietojensa väärinkäytöstä tai vaikeuksia Omakannan käytössä, tulisi tarjota enemmän tietoa

ja neuvontaa sähköisestä reseptistä ja Omakannan käytöstä.

Avainsanat: sähköinen resepti, tietosuoja, lääkitysturvallisuus, asiakas, apteekki, kysely

© Suomen Farmasialiitto ry 265

© DOSIS n:0 4/2018


JOHDANTO

Sähköinen resepti on otettu Suomessa vaiheittain

käyttöön vuodesta 2010 alkaen (laki sähköisestä lääkemääräyksestä

61/2007). Sähköisten reseptien käyttö

kasvoi nopeasti, ja vuonna 2015 sähköisten reseptien

osuus oli yli 90 prosenttia kaikista noin 55 miljoonasta

toimitetusta reseptistä (Fimea ja Kela 2016,

Kanta 2018a). Sen käyttö on ollut pakollista koko suomalaisessa

sosiaali- ja terveydenhuollossa vuodesta

2017.

Yksi sähköisen reseptin käyttöönoton keskeisistä

tavoitteista on parantaa potilas- ja lääkitysturvallisuutta

(laki sähköisestä lääkemääräyksestä 61/2007).

Reseptien tallentaminen Reseptikeskukseen parantaa

potilas- ja lääkitysturvallisuutta, koska se mahdollistaa

potilaan suostumuksella hänen kokonaislääkityksensä

selvittämisen ja huomioimisen lääkehoitoa toteutettaessa

(HE 250/2006). Reseptikeskuksessa olevat

potilaan reseptitiedot ovat arkaluonteista terveystietoa,

ja niiden katselu- ja käsittelyoikeudet ovat

tarkoin rajatut (laki sähköisestä lääkemääräyksestä

61/2007). Turvallisen lääkehoidon varmistamiseksi

terveydenhuollon henkilöstöllä tulee kuitenkin olla

pääsy potilaan reseptitietoihin. Potilailla pitää olla

luottamus yksityisyydensuojansa säilymiseen sekä

tietojensa asianmukaiseen käyttöön.

Lääkärillä on oikeus katsoa ja käsitellä potilaan

suostumuksella Reseptikeskukseen talletettuja tietoja

lääkkeen määräämisen yhteydessä ja hoitosuhteen

ollessa voimassa (Kanta 2018b). Apteekeissa farmaseuttinen

henkilöstö voi katsoa ja käsitellä Reseptikeskuksessa

olevia asiakkaan reseptitietoja reseptintoimituksen

yhteydessä asiakkaan suostumuksella

(laki sähköisestä lääkemääräyksestä 61/2007). Reseptikeskuksen

tietojen katselusta ja käsittelystä tallentuu

aina merkintä (lokitieto), joten jälkikäteen voidaan

selvittää, mihin tarkoitukseen tietoja on käytetty

ja ketkä ovat niitä käsitelleet (Kanta 2018c). Potilaat

voivat tarkastella omia potilas- ja reseptitietojaan

Omakannassa (Kanta 2018d).

Apteekkien asiakkaiden kokemuksia sähköisestä

reseptistä on tutkittu jonkin verran (esim. Hammar

ym. 2011, Cochran ym. 2015, Schleiden ym. 2015, Sääskilahti

ym. 2016, Lämsä ym. 2017, Lämsä ym. 2018a).

Tutkimusten mukaan sähköiseen reseptiin on oltu

pääosin tyytyväisiä (Hammar ym. 2011, Frail ym. 2014,

Cochran ym. 2015, Lämsä ym. 2018a). Sen on koettu

olevan paperireseptiä vaivattomampi sekä helpottavan

ja nopeuttavan apteekissa asiointia (Duffy ym.

2010, Hammar ym. 2011, Cochran ym. 2015, Sääskilahti

ym. 2016). Lisäksi potilas- ja lääkitysturvallisuuden

on koettu parantuneen (Duffy ym. 2010, Hammar

ym. 2011, Schleiden ym. 2015). Monista sähköisen

reseptin eduista huolimatta apteekkien asiakkaat

ovat kokeneet vaikeuksia pysyä ajan tasalla omasta

lääkehoidostaan (Sääskilahti ym. 2016, Lämsä ym.

2017). Lisäksi potilaiden hoitoon sitoutumisen on raportoitu

heikentyneen sähköisen reseptin aikakaudella

(Bergeron ym. 2013). Terveydenhuollon digitalisoitumisen

myötä osa kuluttajista on huolissaan yksityisyydensuojastaan

ja terveystietojensa päätymisestä

asiattomien käsiin (Pouyan ja Murali 2017). Tutkimustietoa

sähköisen reseptin turvallisuudesta tietosuojan

näkökulmasta on julkaistu vain vähän (Hammar

ym. 2011, Frail ym. 2014, Cochran ym. 2015). Tämän

tutkimuksen tavoitteena oli tutkia suomalaisten

apteekkien asiakkaiden mielipiteitä sähköisen reseptin

turvallisuudesta ja tietosuojasta sekä lääkäreiden

ja apteekkien farmaseuttisen henkilöstön oikeudesta

sähköisten reseptitietojen katseluun.

Tässä tutkimuksessa tietosuojalla tarkoitetaan henkilön

yksityisyyden suojaamista ja henkilötietojen käsittelyä

siten, että henkilöön yhdistettävissä olevat

tiedot eivät päädy ulkopuolisten käytettäviksi tai käsiteltäviksi

(Ruotsalainen 2006). Tietosuoja toteutetaan

teknisten tai muiden keinojen avulla. Lääkitysturvallisuudella

tarkoitetaan lääkkeiden käyttöön ja

lääkehoidon toteuttamiseen liittyvää turvallisuutta

(Stakes ja Rohto 2006, Terveyden ja hyvinvoinnin laitos

2011). Se käsittää toimintaperiaatteita ja toimenpiteitä

lääkkeiden käyttöön liittyvien haittatapahtumien

ehkäisemiseksi, välttämiseksi ja korjaamiseksi

lääkehoitoketjun eri vaiheissa.

AINEISTO JA MENETELMÄT

Syksyllä 2015 toteutettiin kyselytutkimus 18 vuotta

täyttäneille apteekkien asiakkaille, jotka hakivat sähköisellä

reseptillä lääkettä itselleen. Tutkimukseen

valittiin 18 apteekkia siten, että jokaiselta Aluehallintoviraston

toimialuejaon mukaiselta alueelta (Aluehallintovirasto

2016) otettiin mukaan reseptuuriltaan

yksi iso ja yksi pieni yksityinen apteekki, sekä yksi Yliopiston

Apteekin toimipiste. Ahvenanmaa jätettiin

tutkimuksen ulkopuolelle, koska tutkimusajankohtana

sähköinen resepti ei ollut siellä yleisesti käytössä.

Kyselylomakkeita toimitettiin apteekkeihin niiden

päivittäiseen reseptuuriin suhteutettu määrä (30–200

lomaketta/apteekki) sekä ohjeet niiden jakamiseen.

Apteekin henkilökunta kertoi asiakkaille tutkimuksesta

ja tarjosi mahdollisuutta osallistua siihen asiakastapahtuman

päätteeksi. Asiakas täytti kyselylomakkeen

kotona ja palautti sen valmiiksi maksetus-

© DOSIS n:0 4/2018 266

© Suomen Farmasialiitto ry


sa postikuoressa tutkimusryhmälle. Tutkimuksesta

kieltäytyneistä ei pidetty kirjaa. Apteekit jakoivat lomakkeita

kahden viikon ajan ja ilmoittivat sen jälkeen

jakamatta jääneiden lomakkeiden lukumäärän

tutkimusryhmälle vastausprosentin laskemista varten.

Vastaavaa tutkimusmenetelmää on käytetty aiemmin

esimerkiksi tutkittaessa lääkkeiden käyttäjien

kokemuksia lääkevaihdosta (Heikkilä ym. 2007).

Nelisivuinen kyselylomake sisälsi yhteensä 26

strukturoitua, avointa ja Likert-asteikollista kysymystä.

Lomake suunniteltiin lain tavoitteiden (laki sähköisestä

lääkemääräyksestä 61/2007), sähköisen reseptin

oletettujen vaikutusten (HE 250/2006) sekä aikaisempien

tutkimusten perusteella (Hyppönen ym.

2006, Hammar ym. 2011). Kyselylomake pilotoitiin

paikallisessa apteekissa samalla kohderyhmällä kuin

varsinainen tutkimus keväällä 2015. Tutkijat haastattelivat

kyselylomakkeen täyttäneitä asiakkaita kysymysten

ymmärrettävyydestä. Pilotoinnin perusteella

kyselylomakkeeseen tehtiin vähäisiä muutoksia.

Tässä artikkelissa raportoidaan vastaukset kyselylomakkeen

kahdesta kysymyksestä. Mielipiteitä sähköisen

reseptin turvallisuudesta sekä reseptitietojen

katseluoikeuksista kysyttiin Likert-asteikollisella kysymyksellä.

Kysymys sisälsi viisi väittämää: Sähköisen

reseptin käyttäminen on turvallista; On tärkeää, että

lääkäri pääsee katsomaan myös muiden lääkäreiden

minulle sähköisillä resepteillä määräämät lääkkeet;

On tärkeää, että apteekin farmaseutti/proviisori pääsee

näkemään kaikki minulle sähköisillä resepteillä

määrätyt lääkkeet; Pelkään, että asiattomat henkilöt

saattavat katsella tai käyttää reseptitietoja, ja Pelkään,

että sähköisten reseptien tietoja käytetään väärin.

Väittämiin pyydettiin vastaamaan viisiportaisella

asteikolla: 1 = Täysin samaa mieltä, 2 = Jokseenkin

samaa mieltä, 3 = Jokseenkin eri mieltä, 4 = Täysin

eri mieltä ja 5 = En osaa sanoa. Toinen raportoitava

kysymys oli kyselylomakkeen lopussa ollut avoin

kysymys ”Tähän voitte kirjoittaa kommentteja tästä

kyselystä sekä kokemuksianne sähköisestä reseptistä

ja Omakanta-palvelusta”. Avoimen kysymyksen vastauksista

tutkimukseen sisällytettiin sähköistä reseptiä

tietosuojan ja lääkitysturvallisuuden näkökulmasta

käsittelevät vastaukset. Tällaisia vastauksia olivat

esimerkiksi sähköisen reseptiin turvallisuuteen liittyvät

huolet tai lääkitysturvallisuuteen liittyvät ongelmat,

kuten vaikeus pysyä ajan tasalla resepteistä.

Vastaajien taustatiedoista sukupuoli, asuinalue, koulutus

ja lääkityksen säännöllisyys kysyttiin strukturoiduilla

kysymyksillä ja syntymävuosi avoimella kysymyksellä.

Analysointi

Kyselylomakkeen lopussa olleen avoimen kysymyksen

vastaukset analysoitiin vapaamuotoisella sisällönanalyysilla

(Hämeen-Anttila ja Katajavuori 2008).

Analyysissa käytettiin sekä aineistolähtöistä (induktiivinen)

että teorialähtöistä (deduktiivinen) lähestymistapaa

(Hämeen-Anttila ja Katajavuori 2008, Kylmä

ja Juvakka 2014). Analyysi aloitettiin lukemalla vastauksia

ja kirjaamalla tietosuojaan ja lääkitysturvallisuuteen

liittyvät vastaukset Microsoft Excel for Office

2016 -taulukkolaskentaohjelmaan. Taulukkoon kirjattuja

vastauksia luettiin läpi ja tarvittaessa yksittäinen

vastaus eroteltiin useaksi analyysiyksiköksi. Analyysiyksikkönä

oli sana, lause tai lausejoukko, joka kuvasi

yhden tutkimuskysymyksen kannalta oleellisen asian

(Hämeen-Anttila ja Katajavuori 2008). Näin ollen yksi

vastaus saattoi sisältää useamman analyysiyksikön.

Analyysiyksiköitä tarkasteltiin samankaltaisuuksien

mukaan ja ne ryhmiteltiin luokkiin. Syntyneet luokat

nimettiin, jolloin saatiin alaluokat. Alaluokista etsittiin

yhtäläisyyksiä ja samankaltaiset alaluokat yhdistettiin

omiksi yläluokikseen. Esimerkiksi kommentti:

"Ihmettelen, ketkä pääsevät katsomaan reseptejäni ja

Omakanta-tietojani" ryhmiteltiin alaluokkaan ”kuka

näkee/saa katsoa potilaan reseptitietoja”, joka puolestaan

ryhmiteltiin yläluokkaan ”tietosuojaan liittyvät

epäilykset ja epäselvyydet”. Luokittelun jälkeen kaikki

vastaukset koodattiin syntyneisiin yläluokkiin ja tallennettiin

IBM SPSS for Windows (versio 23.0) -tilasto-ohjelmaan.

Yläluokat analysoitiin suorina jakaumina.

Luokittelun teki yksi tutkija (KR), mutta siitä käytiin

säännöllisesti keskustelua tutkimusryhmässä.

Likert-väittämäsarjan vastaukset analysoitiin SPSS

for Windows -tilasto-ohjelmalla. Analysoinnissa käytettiin

suoria jakaumia, ristiintaulukointia, X

2 - ja Fisherin

tarkkaa nelikenttä -testiä. Tilastollisesti merkitsevänä

tasona oli p < 0,05. Analyysissa viisiportaisen

Likert-asteikon vastausvaihtoehdoista yhdistettiin

Täysin samaa mieltä ja Jokseenkin samaa mieltä

sekä Jokseenkin eri mieltä ja Täysin eri mieltä, koska

osa vastausten lukumääristä oli pieniä ja siten ryhmien

väliset vertailut eivät olleet mahdollisia. Testauksen

ulkopuolelle jätettiin myös väittämäsarjan En

osaa sanoa -vastausvaihtoehto, koska se voidaan tulkita

vastaamatta jätetyksi. Lisäksi osa En osaa sanoa

-vastausten lukumääristä oli hyvin pieniä, joten ryhmien

väliset vertailut eivät olleet mahdollisia.

Tutkimuksen eettisyys

Tutkimus ei sisältynyt niihin ei-lääketieteellisiin ihmisiin

kohdistuviin tutkimuksiin, jotka vaativat Itä-

© Suomen Farmasialiitto ry 267

© DOSIS n:0 4/2018


Suomen yliopiston Tutkimuseettisen toimikunnan

lausunnon (Itä-Suomen yliopisto 2017). Tutkimuksessa

noudatettiin Tutkimuseettisen neuvottelukunnan

laatimia eettisiä periaatteita ihmistieteisiin liittyvissä

tutkimuksissa (Tutkimuseettinen neuvottelukunta

2009).

TULOKSET

Kyselylomakkeita jaettiin yhteensä 2 915, ja näistä palautui

1 290. Kaksi kyselylomaketta poistettiin aineistosta,

koska vastaajat eivät olleet täysi-ikäisiä. Näin

ollen lopullinen otos oli 2 913 apteekkien asiakasta,

joista 1 288 (44 %) vastasi kyselyyn. Vastanneiden

taustatiedot on esitetty taulukossa 1.

Valtaosa (97 %) kyselyyn vastanneista apteekkien

asiakkaista piti sähköisen reseptin käyttämistä turvallisena

(Taulukko 2). Suurin osa (77 %) vastaajista ei

pelännyt asiattomien henkilöiden saattavan katsella

tai käyttää reseptitietoja. Lähes neljännes (23 %) vastaajista

kuitenkin pelkäsi asiattomien katselevan tai

käyttävän reseptitietoja. Enemmistö (82 %) vastaajista

ei myöskään pelännyt sähköisten reseptitietojen väärinkäyttöä.

Alemman koulutuksen saaneet vastaajat

pelkäsivät omien reseptitietojensa päätymistä asiattomien

käsiin (p = 0,013) ja tietojensa väärinkäyttöä

(p = 0,001) yleisemmin kuin korkeammin koulutetut.

Lähes kaikkien vastanneiden mielestä oli tärkeää,

että lääkäri (98 %) ja apteekkien farmaseuttinen henkilöstö

(96 %) pääsevät katsomaan asiakkaiden sähköisiä

reseptejä (Taulukko 2).

Iäkkäämmät vastaajat pitivät nuorempia vastaajia

yleisemmin tärkeänä farmaseuttisen henkilöstön

oikeutta nähdä asiakkaiden kaikki reseptitiedot (p =

0,002). Lisäksi alhaisemman koulutuksen saaneet

vastaajat pitivät korkeamman koulutuksen saaneita

vastaajia yleisemmin tärkeänä farmaseuttisen henkilöstön

oikeutta nähdä asiakkaiden kaikki reseptitiedot

(p ≤ 0,000).

Kaikista kyselyyn vastanneista 301 (23 %) kirjoitti

mielipiteitään kyselylomakkeen lopussa olleeseen

avoimeen kysymykseen. Näistä 177 eli 59 prosenttia

vastauksista (14 % kaikista kyselyyn vastanneista) käsitteli

tietosuojaan ja lääkitysturvallisuuteen liittyviä

asioita ja sisällytettiin tämän tutkimuksen aineistoon.

Lopullisessa aineistossa oli yhteensä 201 luokiteltua

vastausta (Taulukko 3). Yleisimmin apteekkien

asiakkaat toivat esille, että Omakantaan pääseminen

oli vaikeaa tai heillä ei ollut mahdollisuutta käyttää

sitä (23 %). Syynä mainittiin esimerkiksi tietokoneen,

internet-yhteyden tai verkkopankkitunnuksien

puuttuminen. Vastaajista 18 prosenttia toi esille,

ettei Omakanta ollut heille lainkaan tuttu. Lisäksi

osalla vastaajista (13 %) oli epäilyksiä tai epäselvyyksiä

sähköisen reseptin tietosuojasta, kuten sähköisen reseptin

turvallisuudesta ja eri tahojen katseluoikeuksista.

Vastaajista 13 prosenttia koki vaikeuksia pysyä

ajan tasalla omasta lääkityksestään. Esimerkiksi reseptitietojen

seuraaminen koettiin hankalaksi sähköisen

reseptin aikana ilman paperista dokumenttia.

POHDINTA

Lähes kaikki apteekkien asiakkaat pitivät sähköistä reseptiä

turvallisena. He luottivat reseptitietojensa asianmukaiseen

käyttöön sekä siihen, että reseptitiedot ovat

asiattomilta suojassa. Vastaajat pitivät tärkeänä, että

terveydenhuollon ammattilaiset pääsevät katsomaan

heidän reseptitietojaan. Noin neljännes vastanneista

kuitenkin pelkäsi reseptitietojensa väärinkäyttöä tai

niiden joutumista asiattomien käsiin. Pienellä osalla

apteekkien asiakkaista oli myös vaikeuksia päästä

Omakantaan itse katselemaan reseptitietojaan.

Tämän tutkimuksen mukaan apteekkien asiakkaat

kokivat sähköisen reseptin käyttämisen turvalliseksi.

Ruotsissa ja Yhdysvalloissa tehdyissä tutkimuksissa

on saatu samankaltaisia tuloksia (Hammar ym.

2011, Frail ym. 2014, Cochran ym. 2015). Tässä tutkimuksessa

noin neljännes vastanneista kuitenkin

pelkäsi reseptitietojensa päätymistä asiattomien käsiin.

Tätä tulosta tukee tuore apteekkien asiakkaiden

tiedonsaantia sähköisestä reseptistä käsitellyt tutkimus,

jonka mukaan asiakkaat toivovat enemmän tietoa

sähköisen reseptin tietosuojasta ja siitä, kuka heidän

tietojaan pääsee katsomaan (Lämsä ym. 2018b).

Apteekkien asiakkaiden tiedon lisääminen sähköisen

reseptin tietosuojasta mahdollisesti vähentäisi siihen

liittyviä epäselvyyksiä ja pelkoja. Tietosuojaan liittyvät

pelot näyttäisivät kuitenkin vähentyneen sähköisen

reseptin laajamittaisen käytön myötä, sillä tietosuojan

ja tietoturvan puutteellisuus sekä tietojen

väärinkäyttö koettiin merkittävinä sähköisen reseptin

uhkina reseptijärjestelmän pilotointivaiheessa

(Hyppönen ym. 2006). Lisäksi tuoreemmissa suomalaisen

väestön mielipiteitä sosiaali- ja terveydenhuollon

sähköisistä asiointipalveluista selvittäneissä

tutkimuksissa valtaosa vastaajista ei ole ollut huolissaan

henkilökohtaisten tietojensa väärinkäytöstä

tai terveystietojensa päätymisestä asiattomien käsiin

(Hyppönen ym. 2014, Apteekkariliitto, Lääkäriliitto

ja Lääketietokeskus 2017). Luottamuksesta sähköisiin

asiointipalveluihin ja sähköisen reseptin tietosuojaan

voi myös kertoa se, että vuonna 2017 Kela

ei saanut yhtään ilmoitusta Reseptikeskukseen tal-

© DOSIS n:0 4/2018 268

© Suomen Farmasialiitto ry


Taulukko 1. Kyselytutkimukseen vastanneiden apteekkien asiakkaiden (n = 1 288) taustatiedot a .

Vastaajat % (n)

Sukupuoli

Nainen

Mies

Ikä (vuotta)

18–34

35–59

60–74

75-

Asuinalue

Etelä-Suomi

Pohjois-Suomi

Lounais-Suomi

Länsi- ja Sisä-Suomi

Itä-Suomi

Lappi

Koulutus

Perusasteen koulutus

(perus-, keski- ja kansakoulu)

Keskiasteen koulutus

(ammatillinen perustutkinto,

opistotutkinto tai ylioppilastutkinto)

Korkea-asteen koulutus (alempi

tai ylempi korkeakoulututkinto)

Reseptilääkkeiden

käytön säännöllisyys

Säännöllisesti käytettäviä

reseptilääkkeitä

Sekä säännöllisesti että tilapäisesti

käytettäviä reseptilääkkeitä

Vain tilapäisesti käytettäviä

reseptilääkkeitä

n = 1287

75 (965)

25 (322)

n = 1167

12 (137)

33 (379)

41 (476)

15 (175)

n = 1276

24 (301)

20 (256)

16 (208)

16 (205)

14 (183)

10 (123)

n = 1263

22 (274)

48 (611)

30 (378)

n = 1272

56 (715)

35 (440)

9 (117)

a Kaikki vastaajat eivät ilmoittaneet sukupuolta, ikää, asuinaluetta, koulutusta tai reseptilääkkeiden käytön säännöllisyyttä.

© Suomen Farmasialiitto ry 269

© DOSIS n:0 4/2018


lennettujen tietojen väärinkäytöksistä (Kanta 2018e).

Samana vuonna selvityspyyntöjä potilaan reseptitietojen

katseluista tehtiin varsin vähän (noin 80 selvityspyyntöä).

Tämän tutkimuksen mukaan apteekkien asiakkaat

pitivät tärkeänä, että lääkärit ja farmaseuttinen henkilöstö

pääsevät heidän reseptitietoihinsa. Sähköisen

reseptijärjestelmän pilotointivaiheen tutkimukseen

osallistuneista apteekkien asiakkaista vain hieman

yli puolet kannatti ajatusta apteekkien työntekijöiden

oikeudesta nähdä potilaiden sähköiset reseptit

(Hyppönen ym. 2006). Tämän tutkimuksen tulos

tukee suunnitteilla olevan valtakunnallisen Lääkityslistan

näkymistä kaikille potilaan hoitoon osallistuville

tahoille, myös apteekkien farmaseuttiselle

henkilöstölle (Virkkunen ym. 2018). Valtakunnallisen

Lääkityslistan tavoitteena on muun muassa koota

yhteenveto potilaan ajantasaisesta lääkityksestä, jota

terveydenhuollon ammattilaiset pääsevät tarkastelemaan

ja ylläpitämään. Tämä on tärkeää sen vuoksi,

että potilaiden lääkitystietojen on raportoitu poikkeavan

merkittävästi lääkkeiden todellisesta käytöstä

(Tiihonen ym. 2016), eivätkä Reseptikeskuksen tiedot

ole välttämättä olleet ajan tasalla (Timonen ym.

2016, Kauppinen ym. 2017). Ajantasainen tieto potilaan

lääkehoidosta on yksi keskeisimmistä potilas- ja

lääkitysturvallisuutta edistävistä tekijöistä. Apteekkien

asiakkaiden kannalta olisikin tärkeää, että apteekkien

farmaseuttisella henkilöstöllä olisi mahdollisuus

päivittää asiakkaan lääkityslistaa tämän suostumuksella.

Tällöin apteekissa voisi kirjata lääkityslistaan

myös potilaan käyttämät itsehoitolääkkeet.

Pienellä osalla apteekkien asiakkaista Omakantaan

pääsy oli vaikeaa, tai heillä ei ollut siihen mahdollisuutta,

mikä saattaa vaikeuttaa ajan tasalla pysymistä

omista lääkkeistään. Aikaisemmassa suomalaistutkimuksessa

on arveltu, että erityisesti henkilöillä,

joilla ei ole käytössään tietokonetta, internetiä

tai verkkopankkitunnuksia, oli vaikeuksia omien reseptitietojen

seuraamisessa (Sääskilahti ym. 2016).

Yhdysvalloissa tehdyn tutkimuksen mukaan sähköisen

reseptin käyttöönoton on myös raportoitu

vähentävän apteekkien asiakkaiden tietoa omista

lääkkeistään ja lääkkeiden oikeasta käyttötavasta

(Bergeron ym. 2013). Ne apteekkien asiakkaat, joilla

on vaikeuksia päästä Omakantaan, tulisi tunnistaa

ja heille tulisi kehittää Omakannan rinnalle muita

keinoja reseptitietojensa seurantaan. Asiakkaat tarvitsevat

edelleen tietoa ja neuvontaa sähköisestä reseptistä

ja Omakannan käytöstä. Lisäksi reseptitietojen

seurantaa voisi helpottaa paperille tulostettava

yhteenveto reseptitiedoista ja helppokäyttöinen mobiilisovellus

(Sääskilahti ym. 2016).

Tämän kyselytutkimuksen otos oli suuri ja kyselylomakkeita

jaettiin eri puolelta Suomea. Vastausprosentti

(44 %) on tavanomainen menetelmällä, jolla

uusintakyselyä ei voida järjestää (esim. Heikkilä ym.

2007, Tiihonen 2010). Menetelmän vahvuutena oli

halutun kohderyhmän tavoittaminen: Vastaajat olivat

apteekkien asiakkaita, jotka hakivat lääkkeitä itselleen

sähköisellä reseptillä. Lomakkeen kysymykset

suunniteltiin lain tavoitteiden (laki sähköisestä lääkemääräyksestä

61/2007), sähköisen reseptin oletettujen

vaikutusten (HE 250/2006) sekä aikaisempien

tutkimusten pohjalta (Hyppönen ym. 2006, Hammar

ym. 2011), ja ne vastasivat hyvin tämän tutkimuksen

tavoitteisiin. Lisäksi kyselyn toteutumisen

aikaan sähköinen resepti oli laajamittaisessa käytössä

Suomessa (Fimea ja Kela 2016, Kanta 2018a), joten

vastaajilla oli kokemusta sähköisen reseptin käytöstä.

Vastaajien edustavuutta perusjoukkoon on kuitenkin

vaikea arvioida, sillä vertailukelpoista tietoa

perusjoukosta ei ole saatavilla. Tässä tutkimuksessa

vastaajat olivat kuitenkin ikä- ja sukupuolijakaumaltaan

vastaavia kuin apteekkien asiakkaille tehdyssä

lääkevaihtoa käsitelleessä kyselytutkimuksessa (Heikkilä

ym. 2007). Vastaajat todennäköisesti edustivat

hyvin reseptilääkkeitä ostavia apteekkien asiakkaita

Suomessa.

JOHTOPÄÄTÖKSET

Apteekkien asiakkaat pitävät sähköistä reseptiä pääsääntöisesti

turvallisena ja luottavat reseptitietojensa

asianmukaiseen käyttöön. Toisaalta neljänneksellä

esiintyy pelkoja reseptitietojensa väärinkäytöksistä.

Apteekkien asiakkaiden mielestä on tärkeää, että

lääkärit ja farmaseuttinen henkilöstö pääsevät katsomaan

heidän reseptitietojaan. Osalla apteekkien

asiakkaista on kuitenkin vaikeuksia päästä itse katsomaan

tietojaan Omakannassa. Apteekkien asiakkaille,

joilla on pelkoja tietojensa väärinkäytöksistä tai

vaikeuksia Omakannan käytössä tulisi tarjota enemmän

tietoa ja neuvontaa sähköisestä reseptistä sekä

Omakannan käytöstä.

© DOSIS n:0 4/2018 270

© Suomen Farmasialiitto ry


Taulukko 2. Apteekkien asiakkaiden (N = 1288) mielipiteitä sähköisen reseptin turvallisuudesta ja reseptitietojen

katseluoikeuksista. Ryhmien välisiä eroja on tarkasteltu sukupuolen, iän ja koulutuksen mukaan

(vain tilastollisesti merkitsevät erot (p < 0,05) on merkitty taulukkoon).

Kaikki Sukupuoli Ikä (vuotta) Koulutus

Mies Nainen 18–34 35–59 60–74 75- Perus- Keski- Korkeaasteen

asteen asteen

koulutus a koulutus b koulutus c

% (n) % (n) % (n) % (n) % (n) % (n) % (n) % (n) % (n) % (n)

Sähköisen reseptin käyttäminen on turvallista d

Täysin/Jokseenkin

samaa mieltä 97 (1161) 97 (291) 97 (869) 94 (123) 97 (347) 98 (438) 98 (149) 99 (244) 96 (549) 97 (347)

Täysin/jokseenkin

eri mieltä 3 (34) 3 (9) 3 (25) 6 (8) 3 (12) 2 (8) 2 (3) 1 (2) 4 (20) 3 (12)

Kaikki 100 (1195) 100 (300) 100 (894) 100 (131) 100 (359) 100 (446) 100 (152) 100 (246) 100 (569) 100 (359)

On tärkeää, että lääkäri pääsee katsomaan myös muiden lääkäreiden minulle sähköisillä resepteillä määräämät lääkkeet d

Täysin/Jokseenkin

samaa mieltä 98 (1224) 96 (301) 98 (922) 99 (132) 97 (367) 98 (458) 98 (157) 98 (249) 98 (589) 97 (362)

Täysin/jokseenkin

eri mieltä 2 (30) 4 (11) 2 (19) 1 (2) 3 (10) 2 (7) 2 (4) 2 (4) 2 (14) 3 (11)

Kaikki 100 (1254) 100 (312) 100 (941) 100 (134) 100 (377) 100 (465) 100 (161) 100 (253) 100 (603) 100 (373)

On tärkeää, että apteekin farmaseutti/proviisori pääsee näkemään kaikki minulle sähköisellä resepteillä määrätyt lääkkeet d

Täysin/Jokseenkin

samaa mieltä 96 (1213) 95 (296) 96 (916) 93 (127) 94 (352) 99 (462) 97 (166) 99 (266) 96 (577) 93 (347)

Täysin/jokseenkin

eri mieltä 4 (54) (17) 4 (37) 7 (9) 6 (21) 1 (6) 3 (6) 1 (2) 4 (24) 7 (27)

Kaikki 100 (1267) 100 (313) 100 (953) 100 (136) 100 (373) 100 (468) 100 (172) 100 (268) 100 (601) 100 (374)

p = 0,002 p ≤ 0,000

Pelkään, että asiattomat henkilöt saattavat katsella tai käyttää reseptitietoja d

Täysin/Jokseenkin

samaa mieltä 23 (252) 22 (61) 24 (191) 25 (32) 20 (67) 23 (87) 26 (34) 27 (56) 25 (128) 18 (61)

Täysin/jokseenkin

eri mieltä 77 (831) 78 (215) 76 (615) 75 (37) 80 (272) 77 (295) 74 (98) 73 (149) 75 (388) 82 (284)

Kaikki 100 (1083) 100 (276) 100 (806) 100 (129) 100 (339) 100 (382) 100 (132) 100 (205) 100 (516) 100 (345)

p = 0,013

Pelkään, että sähköisten reseptien tietoja käytetään väärin d

Täysin/Jokseenkin

samaa mieltä 18 (191) 16 (43) 18 (148) 16 (20) 14 (49) 18 (69) 21 (27) 24 (49) 19 (97) 12 (40)

Täysin/jokseenkin

eri mieltä 82 (880) 84 (223) 82 (656) 84 (105) 86 (290) 82 (307) 79 (104) 76 (156) 81 (412) 88 (302)

Kaikki 100 (1071) 100 (266) 100 (804) 100 (125) 100 (339) 100 (376) 100 (131) 100 (205) 100 (509) 100 (342)

p = 0,001

a Perus-, keski- tai kansakoulu

b Ammatillinen perustutkinto, opistotutkinto tai ylioppilastutkinto

c Alempi tai ylempi korkeakoulututkinto

d Väittämäsarjan vastauksista En osaa sanoa -vastaukset jätettiin testauksen ulkopuolelle pienten lukumäärien vuoksi.

© Suomen Farmasialiitto ry 271

© DOSIS n:0 4/2018


Taulukko 3. Apteekkien asiakkaiden kokemuksia ja mielipiteitä (n = 201 a )

sähköisestä reseptistä tietosuojan ja lääkitysturvallisuuden näkökulmasta.

Yläluokat

(Yläluokkia kuvaavia esimerkkejä)

% (n)

Omakantaan pääsy on vaikeaa /

Ei ole mahdollisuutta käyttää Omakantaa

(Omakantaan kirjautuminen hankalaa, ei ole

mahdollisuutta käyttää tietokonetta tai internetiä) 23 (46)

Omakanta ei ole tuttu 18 (36)

Tietosuojaan liittyvät epäilykset ja epäselvyydet

(Turvallisuus arveluttaa, tietojen väärinkäyttö huolestuttaa,

epäselvyys siitä, kuka näkee potilaan reseptitietoja) 13 (26)

Ajan tasalla pysyminen omasta lääkityksestä on vaikeaa

(Reseptitietojen seuraaminen hankalaa,

paperisen dokumentin puuttuminen) 13 (26)

Omakannan käytettävyyden ongelmia

(Omakannan epäselvä näkymä, reseptien

tulostaminen hankalaa) 13 (26)

Omakannan käytettävyyden etuja

(Helppo asioida, omien reseptien

seuraaminen helppoa) 6 (12)

Toisen puolesta asiointi Omakannassa

ei onnistu tai on hankalaa

(Alaikäisten tietojen katselu ei onnistu vanhemmilta) 6 (12)

Sähköinen resepti koetaan turvalliseksi 4 (7)

Muut

(Toiveet, että lääkäri/farmaseuttinen henkilöstö

näkee potilaan kokonaislääkityksen, toiveet lääkkeiden

yhteensopivuuden tarkistamisesta) 5 (10)

a) Yksi vastaus on voinut sisältää useamman luokan.

© DOSIS n:0 4/2018 272

© Suomen Farmasialiitto ry


SUMMARY

Opinions on the Data Protection

of Electronic Prescriptions –

a Survey Among Pharmacy

Customers in Finland

➔ Kim Rattay*

M.Sc. (Pharm)

School of Pharmacy

Faculty of Health Sciences

University of Eastern Finland

kim.rattay@outlook.com

➔ Hanna Kauppinen * , **

Ph.D. (Pharm), project researcher

School of Pharmacy

University of Eastern Finland

hanna.kauppinen@uef.fi

➔ Riitta Ahonen

Professor of Pharmacy Practice

School of Pharmacy

Faculty of Health Sciences

University of Eastern Finland

riitta.ahonen@uef.fi

➔ Johanna Timonen

Ph.D. (Pharm), Senior researcher

School of Pharmacy

Faculty of Health Sciences

University of Eastern Finland

johanna.timonen@uef.fi

* Equal contribution

** Correspondence

Introduction: Electronic prescriptions (ePrescriptions)

are widely used in Finland. As prescriptions

may contain sensitive health information, patients

must be able to trust in privacy policies and the intended

use of their personal information. The aim

of this study was to examine pharmacy customers’

opinions concerning the safety of ePrescriptions and

the rights of physicians and pharmacists to view their

ePrescriptions.

Methods: A survey was conducted in autumn 2015.

Adult pharmacy customers (aged ≥18 years) purchasing

medicines for themselves with an ePrescription

were included in the study. Questionnaires (n=2915)

were distributed from 18 pharmacies located in different

parts of Finland. Frequencies, cross-tabulations,

Chi-square test Fisher’s exact test, categorization,

and encoding were used the analysis.

Results: A total of 1288 (44%) questionnaires were

returned. The vast majority of the respondents (97%)

felt that ePrescriptions were safe to use. Most did not

fear unauthorized persons could get access to their

prescriptions (77%) or that someone would misuse

their prescription information (82%). Respondents

considered it important for physicians (98%) and

pharmacists (96%) to have the right to access their

ePrescriptions. In the open question, respondents

mentioned either that they had difficulty accessing

the My Kanta service, or that they were unable to use

the service at all (23%).

Conclusions: In general, pharmacy customers consider

ePrescriptions to be safe and trust that their

prescription information is used properly. However,

about a quarter of respondents feared an unauthorized

access to their prescription information. Respondents

consider it important for physicians and

pharmacists to have the right to access their prescriptions.

Some customers experienced difficulty in accessing

the My Kanta service. Customers concerned

about the misuse of their ePrescription information

or who have difficulty using the My Kanta service

should be given more information and guidance

about ePrescriptions and the My Kanta service.

Keywords: electronic prescription, data protection,

medication safety, customer, pharmacy, survey

© Suomen Farmasialiitto ry 273

© DOSIS n:0 4/2018


KIRJALLISUUS

Aluehallintovirasto: Toimialueet. Haettu

Internetistä 20.9.2016. www.avi.fi/web/avi/

toiminta-alue#.V_KAC4V0H8c

Apteekkariliitto, Lääkäriliitto, Lääketietokeskus:

Tuhat Suomalaista –tutkimus, Syyskuu 2017.

Haettu Internetistä 30.1.2018. http://sal.mail-pv.

fi/archive/file/7b5a897718aeabb40a2e0bffd7

6c3675/2017_10_05_digiterveyspalvelut.pdf

Bergeron A, Webb J, Serper M ym.: Impact of

electronic prescribing on medication use in

ambulatory care. Am J Manag Care 19: 1012–1017,

2013

Cochran G, Lander L, Morien M ym.: Consumer

opinions of health information exchange,

e-prescribing, and personal health records.

Perspect Health Inf Manag 12: 1e, 2015

Duffy R, YIu S, Molokhia E, Walker R, Perkins R:

Effects of electronic prescribing on the clinical

practice of a family medicine residency. Fam Med

42: 358–363, 2010

Fimea, Kela: Suomen Lääketilasto 2015.

Lääkealan turvallisuus- ja kehittämiskeskus Fimea

ja Kansaneläkelaitos. Helsinki 2016

Frail C, Kline M, Snyder M: Patient perceptions of

e-prescribing and its impact on their relationships

with providers: A qualitative analysis. J Am Pharm

Assoc 54: 630–633, 2014

Hammar T, Nyström S, Petersson G, Åstrand B,

Rydberg T: Patients satisfied with eprescribing

in Sweden: a survey of a nationwide

implementation. J Pharm Health Serv Res 2:

97–105, 2011

HE 250/2006: Hallituksen esitys Eduskunnalle

laiksi sähköisestä lääkemääräyksestä sekä laiksi

lääkelain 57 ja 57 a §:n muuttamisesta.

Heikkilä R, Mäntyselkä P, Hartikainen-Herranen K,

Ahonen R: Customers' and physicians' opinions of

and experiences with generic substitution during

the first year in Finland. Health Policy 82: 66–374,

2007

Hyppönen H, Hyry J, Valta K, Ahlgren S:

Sosiaali- ja terveydenhuollon sähköinen asiointi.

Kansalaisten kokemukset ja tarpeet. Raportti

33/2014. Terveyden ja hyvinvoinnin laitos, Helsinki

2014

Hyppönen H, Pajukoski M, Tenhunen E: Potilaiden

tyytyväisyys järjestelmään, potilaiden tarpeet ja

oikeudet. Julkaisussa: Sähköisen reseptin pilotin

arviointi II (2005–2006), Stakesin raportteja

11/2006. s. 47–70. Toim. Hyppönen H, Stakes,

Helsinki 2006

Hämeen-Anttila K, Katajavuori N: Laadullisen

aineiston analyysi. Kirjassa: Yhteiskunnallinen

lääketutkimus – ideasta näyttöön. 1. painos, s.

193–205. Toim. Hämeen-Anttila K ja Katajavuori

N, Gaudeamus, Tampere, 2008

Itä-Suomen yliopisto: Yliopiston tutkimuseettisen

toimikunnan ohjeet. Haettu Internetistä 19.10.2017.

www.uef.fi/tutkimus/ohjeet-ja-lomakkeet

Kanta: Tilastot, 2018a. Haettu Internetistä

16.8.2018. www.kanta.fi/tilastot

Kanta: Potilaan tietojen katselu, 2018b. Haettu

Internetistä 30.1.2018. www.kanta.fi/web/

ammattilaisille/potilaan-tietojen-katselu

Kanta: Tietojen käyttö ja valvonta, 2018c. Haettu

Internetistä 16.8.2018. www.kanta.fi/ammattilaiset/

tietojen-kaytto-ja-valvonta

Kanta: Omakanta, 2018d. Haettu Internetistä

16.8.10218. www.kanta.fi/omakanta

Kanta: Tiedotteet: Vuonna 2017: 61,4 miljoonaa

lääketoimitusta – 80 lokitietokyselyä, 2018e.

Haettu Internetistä 16.8.2018. www.kanta.fi/fi/

tiedote/-/asset_publisher/cf6QCnduV1x6/content/

vuonna-2017-61-4-miljoonaa-laaketoimitusta-80-

lokitietokyselya

Kauppinen H, Ahonen R, Mäntyselkä P, Timonen

J: Medication safety and the usability of electronic

prescribing as perceived by physicians - A

semistructured interview among primary health

care physicians in Finland. J Eval Clin Pract 23:

1187-1194, 2017

Kylmä J, Juvakka T: Laadullinen terveystutkimus.

1.-3. painos, s. 110–126. Edita publishing Oy,

Porvoo 2014

© DOSIS n:0 4/2018 274

© Suomen Farmasialiitto ry


Lämsä E, Timonen J, Mäntyselkä P, Ahonen

R: Pharmacy customers’ experiences with the

national online service for viewing electronic

prescriptions in Finland. Int J Med Inform 97: 221–

228, 2017

Lämsä E, Timonen J, Ahonen T. Pharmacy

Customers' Experiences with Electronin

Prescriptions: Cross-Sectional Survey on the

Nationwide Implementation in Finland. J Med

Internet Res 20: e68, 2018a

Lämsä E, Timonen J, Ahonen R: Information

received and information needed on

electronic prescriptions – Finnish pharmacy

customers’ experiences during the nationwide

implementation. J Pharm Health Serv Res 2018b

(hyväksytty julkaistavaksi) DOI 10.1111/jphs.12275

Pouyan E, Murali S: Patients’ support for health

information exchange: a literature review and

classification of key factors. BMC Med Inform

Decis Mak 17(33), 2017

Ruotsalainen P: Suositukset terveydenhuollon

asiakastietojen tietoturvalliselle sähköiselle

arkistoinnille. Usean toimiyksikön yhteinen

käyttäjän ja käyttöoikeuksien hallinta – periaatteet

ja suositukset. s. 23. Stakesin raportteja

4/2006, Sosiaali- ja terveysalan tutkimus- ja

kehittämiskeskus (Stakes), Helsinki 2006

Tiihonen M, Heikkinen A-M, Leppänen H-M,

Ahonen R. Information sources used by women

in Finland who use hormonal contraceptives.

Pharm World Sci 32: 66–72, 2010

Tiihonen M, Nykänen I, Ahonen R, Hartikainen

S: Discrepancies between in-home interviews

and electronic medical records on regularly

used drugs among home care clients.

Pharmacoepidemiol Drug Saf 25: 100–105, 2016

Timonen J, Kauppinen H, Ahonen R: Sähköisen

reseptin ongelmat ja kehittämiskohteet –

kyselytutkimus apteekkien farmaseuttiselle

henkilöstölle. Suom Lääkäril 71: 152–159, 2016

Tutkimuseettinen neuvottelukunta: Humanistisen,

yhteiskuntatieteellisen ja käyttäytymistieteellisen

tutkimuksen eettiset periaatteet ja ehdotus

eettisen ennakkoarvioinnin järjestämiseksi.

Helsinki, 2009

Virkkunen H, Nurmi H, Kärkkäinen A,

Mäkelä-Bengs P, Vuokko R, Suvanen R:

Lääkitysmäärittelyt – Periaatteet, linjaukset ja

rajaukset. Versio 0.9 (25.3.2018). Operatiivisen

toiminnan ohjaus yksikkö (OPER), Terveyden ja

hyvinvoinnin laitos, Helsinki 2018

Schleiden L, Odukoya O, Chui M: Older adults’

perception of e-Prescribing: impact on patient

care. Perspect Health Inf Manag 12: 1d, 2015

Stakes ja Rohto: Potilas- ja lääkehoidon

turvallisuussanasto. Stakesin työpapereita

28/2006, Sosiaali- ja terveysalan tutkimusja

kehittämiskeskus Stakes ja Lääkehoidon

kehittämiskeskus Rohto, Helsinki 2006

Sääskilahti M, Ahonen R, Lämsä E, Timonen

J: Sähköisen reseptin edut ja ongelmat –

kyselytutkimus apteekkien asiakkaille. Dosis 32:

129–141, 2016

Terveyden ja hyvinvoinnin

laitos: Potilasturvallisuusopas.

Potilasturvallisuuslainsäädännön ja -strategian

toimeenpanon tueksi. THL:n Opas 15/2011,

Terveyden ja hyvinvoinnin laitos, Helsinki 2011

© Suomen Farmasialiitto ry 275

© DOSIS n:0 4/2018


Skopolamiinia

tuottavien karvajuurien

metabolinen stabiilisuus

16 vuoden ylläpidon jälkeen

➔ Suvi T. Häkkinen*

Erikoistutkija, TkT

VTT, PL 1000 Tietotie 2,

02044 VTT, Espoo

suvi.hakkinen@vtt.fi

➔ Kirsi-Marja Oksman-Caldentey

Tutkimuspäällikkö, Dos. (Farm.)

VTT, PL 1000 Tietotie 2,

02044 VTT, Espoo

*Kirjeenvaihto

© DOSIS n:0 4/2018 276

© Suomen Farmasialiitto ry


TIIVISTELMÄ

Kasvit ovat yksi tärkeimmistä uusien lääkeaineiden, niin sanottujen lead-yhdisteiden ja hienokemikaalien

lähteitä. Kasvien soluviljelmät taas ovat mielenkiintoinen väline kasvien pienyhdisteaineenvaihdunnan tutkimiselle

ja mahdollistavat arvokkaiden yhdisteiden suuren mittakaavan tuottamisen. Esimerkiksi syöpälääkkeenä

käytetty paklitakseli, jota valmistetaan soluviljelytekniikkaa käyttäen, on kaupallisessa käytössä. Usein

rajoitteena erilaistumattomien kasvisoluviljelmien käytössä pidetään niiden geneettistä labiiliutta. Lisäksi viljelmien

tuottokapasiteetti usein ajan mittaan heikentyy. Karvajuuret ovat kasvien tuumorikudosta, joka syntyy

luonnossa esiintyvän Agrobakteeri-infektion tuloksena. Karvajuuret ovat hyvä vaihtoehto kasvien pienyhdisteiden

tuottamiselle, koska ne jakaantuvat nopeasti, eivät tarvitse kasvihormoneja kasvaakseen ja ovat

yleisesti stabiilimpia kuin erilaistumattomat viljelmät. Vaikka tämä geneettinen ja metabolinen stabiilius on

yleisesti tunnettu karvajuurten ominaisuus, kirjallisuudessa on vain muutama esimerkki pitkään viljeltyjen

karvajuurten tuottokapasiteeteista. Tässä tutkimuksessa karvajuuria, jotka tuottavat suuria määriä tropa-alkaloideja,

seurattiin 16 vuoden ajan laboratorio-olosuhteissa. Villikaalin (Hyoscyamus muticus L.) karvajuurille

kehitettiin myös pakastusmenetelmä, jolla voidaan välttää työläs jatkuva siirrostaminen. Vaikka pakastuksen

jälkeinen elävyys jäi heikoksi, siirtogeenin ilmentyminen pysyi muuttumattomana pakastetuissa soluissa.

Tässä tutkimuksessa osoitettiin, että vaikka karvajuurten tuotossa tapahtuu vaihtelua ajan mittaan, jopa

erittäin pitkäaikainen siirrostaminen ei aiheuttanut merkittävää alenemista metabolisessa aktiivisuudessa.

Avainsanat: Kasvisoluviljelmä, karvajuuri, hyoskyamiini 6β-hydroksylaasi, skopolamiini, stabiilius, pakastaminen

© Suomen Farmasialiitto ry 277

© DOSIS n:0 4/2018


JOHDANTO

Kasvit tarjoavat valtavan suuret määrät mahdollisuuksia

erilaisten ihmisille mielenkiintoisten sovellusten

suhteen uusina lääkeaineina, biopolymeereinä,

arvokkaina kemiallisina yhdisteinä, ravintona ja

rehuna. Koska kasvit ovat ”täysin vihreitä”, ne tarjoavat

lähtökohtaisesti ympäristöystävällisen ja kestävän

tuotantomahdollisuuden. Sen sijaan, että viljeltäisiin

kokonaisia kasveja, kasvisoluja voidaan viljellä synteettisellä

ravintoalustalla, jolloin ne mahdollistavat

käytön erilaisissa bioteknisissä sovelluksissa. Soluviljelmien

etuina on solubiomassan tai metaboliittien

tuotto kontrolloiduissa olosuhteissa. Laboratoriossa

tai bioreaktoreissa viljely mahdollistaa tuottoprosessit,

jotka ovat riippumattomia ilmasto-olosuhteista,

ja toisaalta mahdollistavat erilaisten tuottoparametrien

optimoinnin.

Karvajuuret ovat kasvien luonnossa esiintyvä sairaus,

joka johtuu Agrobacterium rhizogenes -maabakteerin

infektiosta (Sevón ja Oksman-Caldentey,

2002). Tämä bakteeri kantaa Ri-plasmidia (Root

inducing), jonka avulla se siirtää osan plasmidi-

DNA:staan kasvisolun tumaan. Erittäin monimutkaisen

geneettisen järjestelmän tuloksena infektiokohtaan

syntyy karvajuuri. Jokainen erillinen karvajuuri

on oma klooninsa, ja juuret voidaan irrottaa

kasvista jatkoviljelyä varten. Tässä työssä villikaalia

(Hyoscyamus muticus) infektoitiin Agrobacterium

rhizogenes -bakteerilla, joka kantaa hyoskyamiini

6β-hydroksylaasia (h6h). Tämä geeni on eristetty

H. niger -kasvista, ja se koodaa entsyymiä, joka muuttaa

hyoskyamiinin skopolamiiniksi kaksivaiheisessa

prosessissa. Tämä H6H -entsyymin hydroksylaasiaktiivisuus

tuottaen 6β-hydroxyhyoskyamiinia on

paljon korkeampi kuin epoksidaasiaktiivisuus, joka

muuttaa 6β-hydroxyhyoskyamiinin skopolamiiniksi

(Yun ym., 1992). Kymmenien vuosien tutkimustyö

on johtanut tämän karvajuurituumorin käyttöön erilaisissa

arvokkaissa bioteknisissä sovelluksissa (Georgiev

ym., 2007; Häkkinen ym., 2014; Vasilev ym.,

2014). Karvajuuria on saatu indusoitua monissa eri

kasveissa, ja niitä on käytetty pienyhdisteiden kaupalliseen

tuotantoon soveltuvassa mittakaavassa. Lisäksi

karvajuuret kasvattavat nopeasti biomassaa ja niillä

on yksinkertaiset ravintoalustavaatimukset (Jouhikainen

ym., 1999; Guillon ym., 2006; Srivastava ja Srivastava,

2007; Häkkinen ym., 2005). Esimerkki kaupallisesta

toimijasta on ranskalainen Samabriva (entinen

Root Lines Technology) (www.samabriva.com).

Joissakin tapauksissa pienyhdisteiden tuotto rajoittuu

erityisiin solukoihin ja erilaistumattomissa

soluissa tuotto on vähäistä. Tämä ilmiö tunnetaan

myös tropa-alkaloidien osalta. Luultavasti taustalla

on tropa-alkaloidien biosynteesigeenien ilmenemisen

lokalisaatio, joka tapahtuu juurissa ja joista tropaalkaloidit

kuljetetaan kasvin muihin osiin (Hashimoto

ym., 1986). Geneettinen stabiilius on liitetty myös

kromosomaalitasolle (Weber ym., 2008; Weber ym.,

2010; Dehghan ym., 2012). Lisäksi sillä, että karvajuuria

viljellään ilman kasvihormoneja, on merkitystä.

Kun erilaistunut solukko joutuu kosketuksiin

kasvihormonien kanssa, usein havaitaan muutoksia

kromosomiluvussa ja somaklonaalinen vaihtelu lisääntyy

(Baíza ym., 1999). Kuitenkin myös erilaisia

tuloksia on raportoitu. Guivarc’h ym. (1999) havaitsivat,

että porkkanan (Daucus carota) karvajuuret olivat

hyvin epästabiileja sekä fenotyypiltään että kyvyltään

ilmentää siirtogeeniä kahden vuoden seurannan aikana.

Samoin Mano ym. (1986) havaitsivat, että tropaalkaloidien

tuotto oli epätasaista Scopolia japonican

karvajuurissa, tosin varsin lyhyellä kahden kuukauden

seuranta-ajalla, joka vastaa viljelyolosuhteiden

muutoksiin vaadittavaa adaptaatioaikaa. Pitkäaikaista

seurantaa karvajuurien tuottokyvystä on julkaistu

vain muutamassa tutkimuksessa. Peebles ym. (2009)

raportoivat 5-vuotistutkimuksen punatalvion (Catharanthus

roseus) laboratorio-olosuhteissa viljellyillä

karvajuurilla, jotka osoittautuivat olevan sekä geneettisesti

että metabolisesti stabiileita tutkittuna aikana.

Samoin Maldonado-Mendoza ym. (1993) analysoivat

tropa-alkaloidien tuottoa Datura stramonium -karvajuurilla

viiden vuoden ajan ja osoittivat sekä kasvunopeuden

että alkaloidituoton pysyneen stabiilina.

Tässä työssä osoitamme ensimmäistä kertaa geneettisen

ja metabolisen aktiivisuuden seurannan siirtogeenisillä

karvajuurilla, joita on viljelty laboratoriossa

jatkuvalla siirrostamisella 16 vuoden ajan. Sen jälkeen

kun tämä karvajuurilinja pystytettiin 16 vuotta sitten

(Jouhikainen ym., 1999), sen tuottokapasiteettia on

tutkittu kerran vuonna 2005 (Häkkinen ym., 2005)

ja vastikään (Häkkinen ym., 2016).

Soluviljelmien pystyttäminen ja ylläpito on aikaa

vievää ja työlästä. Pakastus eli kryosäilöntä on menetelmä,

jossa soluja tai solukkoja säilötään ultra-alhaisissa

lämpötiloissa, usein nestetypessä (-196 °C),

joka pysäyttää kaikki metaboliset prosessit ja näin

mahdollistaa solujen säilymisen muuttumattomina.

Kuitenkin pakastus on kasvisolujen osalta vielä

varsin empiiristä testausta ja onnistuneen menetelmän

pystyttäminen on työlästä, kun jokaiselle solulinjalle

vaaditaan erillinen optimointiprosessi. Eräs

tärkeimmistä tekijöistä on solunsisäisen veden mää-

© DOSIS n:0 4/2018 278

© Suomen Farmasialiitto ry


än optimointi, koska kasvisolujen tilavuudesta jopa

90 prosenttia voi olla vettä. Solunsisäinen neste

laajenee kiteytyessään lämpötilan laskiessa, ja tämä

saattaa rikkoa solunsisäisiä kalvorakenteita. Solunsisäisen

nesteen määrää voidaan vähentää monin eri

tavoin. Osmoottinen esikäsittely tapahtuu usein sokereiden

tai sokerialkoholien avulla, jotka kuivattavat

solua. Kuivattaminen voi tapahtua myös hitaalla

pakastamisella. Vaihtoehtoisesti solut voidaan suojata

muun muassa alginaatilla ja kuivaus voi tapahtua

silikageelin tai ilmavirran avulla. Vitrifikaatiotekniikassa

solunsisäisen nesteen määrää vähennetään

voimakkaiden osmoottisten ja kryoprotektanttiliuosten

avulla. Vaikka useille kasvisolulinjoille on pystytty

kehittämään onnistunut pakastusmenetelmä,

menetelmän kehittäminen vaatii aina paljon kokeellista

työtä ja optimointia (Reed 2008). Kirjallisuudesta

löytyy menetelmiä Beta vulgaris ja Nicotiana rustica

(Yoshimatsu ym., 1996), Artemisia annua (Teoh

ym., 1996), Eruca sativa ja Gentiana macrophylla (Xue

ym., 2008), Panax ginseng (Yoshimatsu ym., 1996), Armoracia

rusticana (Phunchindawan ym., 1997; Hirata

ym., 1998), Maesa lanceolata ja Medicago truncatula

(Lambert ym., 2009) karvajuurten pakastukselle,

mutta tähän mennessä villikaalille ei ole raportoitu

menetelmää. Tässä työssä kehitimme helpon vitrifikaatioon

perustuvan pakastusmenetelmän villikaalin

karvajuurille. Menetelmä ei vaadi erityistä pakastuslaitteistoa.

Lisäksi ensimmäistä kertaa osoitamme,

kuinka skopolamiinia tuottavat karvajuuret säilyttävät

metabolisen aktiivisuutensa 16 vuoden seuranatajakson

aikana, kun niitä on ylläpidetty siirrostamalla

laboratoriossa.

AINEISTO JA MENETELMÄT

Kasvisolut ja niiden viljely

Villikaalin (Hyoscyamus muticus L. strain Cairo) karvajuuriklooni

KB7 (aiemmin 13A7) aloitettiin käyttäen

A. rhizogenes LBA9402 pLAL21 kantaa (jossa

on 35S-h6h) (Jouhikainen ym., 1999). Karvajuurilinjaa

viljeltiin siirrostamalla neljän viikon välein kiinteälle

modifioidulle Gamborg B5 -kasvatusalustalle

(Oksman-Caldentey ym., 1991; Jouhikainen ym.,

1999). Karvajuuren ymppi kasvatuksissa oli 100 mg ±

5 mg (tuorepainoa) 20 ml:ssa kasvatusalustaa ja kasvatus

tapahtui 100 ml:n erlenmeyer -pullossa ravistelijassa

(100 rpm, +25 °C, 8h/16h pimeä/valosykli).

Analyysit PCR ja RT-PCR -reaktioita sekä kemiallisia

analyysejä varten tehtiin 28 vuorokauden ikäisistä

nestekasvatetuista juurista. Siirtogeeni (h6h) sekä

karvajuurifenotyypistä vastaava rolB geenit varmistettiin

PCR-reaktioilla (Häkkinen ym., 2005; Sevón

ym., 1995). Karvajuurien puhtaus varmistettiin virD:n

poissaololla Hamill ym. (1991) kuvaamilla alukkeilla ja

reaktio suoritettiin seuraavasti: denaturaatio 95 °C, 1

min, 35 sykliä (denaturaatio 95 °C, 30 s, anniilaus 59

°C, 1 min, ekstensio 72 °C, 1.5 min, jonka jälkeen loppuekstensio

72 °C, 7 min.

RT-PCR

Karvajuurinäytteiden kokonais-RNA:n eristystä varten

juuret kerättiin ja upotettiin nestetyppeen, jonka

jälkeen ne säilöttiin -80 °C:een. RNA eristettiin käyttäen

ARNzol kittiä (REAL, Valencia, Spain). cDNA

valmistettiin käänteis-transkriptiolla käyttäen Super-

Script II Reverse Transcriptase -entsyymiä (Invitrogen,

Carlsbad, CA). Alukesekvenssit 18S geeniä varten

olivat 5’-ATGATAACTCGACGGATCGC-3’ ja 5’-CTT-

GGATGTGGTAGCCGTTT-3’ (Zhang, 2007). Alukesekvenssit

h6h geeniä varten olivat 5’- ACATCTGT-

GAAGGACTTGGGGC-3’ ja 5’-GAACTTGGGTCT-

GGGCATGG-3’ ja ne suunniteltiin BT1 Gene Tool

Lite (1.0.0.1 version) ohjelmaa käyttäen. RT-PCR

suoritettiin käyttäen SYBR Green PCR Mastermix

(Roche Applied Science, Mannheim, Germany) seosta

ja reaktiot tehtiin 384- kaivoissa (LightCycler 480

Instrument; Roche Applied Science). Kontrollina

käytettiin 18S-geeniä. Datan analysointiin käytettiin

LightCycler480 1.5.0 SP3 -ohjelmaa (Roche). Tilastollinen

analyysi tehtiin R-ympäristössä (R Core Team,

2013). Tilastolliseen vertailuun käytettiin t-testiä ja

merkitsevyystasoksi valittiin P-arvo < 0.05.

Tropa-alkaloidien uutto ja analyysi

Tropa-alkaloidit skopolamiini, hyoskyamiini ja

6β-hydroksyhyoskyamiini uutettiin 28 päivän ikäisistä

villikaalin karvajuurista aiemmin kuvatulla menetelmällä

(Häkkinen ym., 2005). Analyysit tehtiin käyttäen

Agilent 7890A kaasukromatografia yhdistettynä

5975C massadetektoriin (MSD) käyttäen Rtx®-5MS

silica-kapillaari-kolonnia (15 m, 0.25 mm i.d., 0.25 µm

faasinpaksuus) (Restek, Bellefonte, PA, USA). Uunin

lämpötila nostettiin 70°C:sta 270°C:een 10°C min-

1. Heliumia käytettiin kantajakaasuna vakiovirtausnopeudella

1.2 mL min-1. Injektorin, ionilähteen ja

interfacen lämpötilat olivat 250°C, 230°C ja 240°C,

ja split-suhde 25:1. Näytteet (1 µL) injisoitiin käyttäen

Gerstel Maestro MPS2 automaattista näytteenannostelijaa

(Gerstel GmbH & Co. KG, Müllheim an der

Ruhr, Germany). MSD toimi elektroni-impakti-taajuudella

(EI) 70 eV ja kokonaisskannaus (m/z 40-600)

tehtiin käyttäen nopeutta 2.6 skannausta s -1 . Yhdis-

© Suomen Farmasialiitto ry 279

© DOSIS n:0 4/2018


teiden identifiointi tehtiin käyttäen standardiyhdisteitä

l-hyoskyamiini (Merck 3031407), (-)-skopolamiini

hydrobromidi (Sigma S1875) sekä retentioaikoja,

massaspektrikirjastoa ja kirjallisuutta. Sisäisenä standardina

käytettiin DL-homatropiinia (Sigma H-0126).

Kromatografinen data kerättiin ja käsiteltiin käyttäen

Chemstation -ohjelmistoa (Agilent Technologies,

USA).

Pakastus (kryosäilytys)

Useita eri pakastusmenetelmiä tutkittiin villikaalin

karvajuurten pitkäaikaissäilytystä varten. Kokeellinen

suunnitelma on esitetty Kuvassa 1.

TULOKSET

Karvajuurten geneettinen stabiilius

PCR ja RT-PCR -tulosten valossa

PCR:n avulla voitiin osoittaa, että sekä siirtogeeni

h6h että karvajuurifenotyypistä vastaava rolB -alue

olivat säilyneet villikaalin karvajuurissa, joita oli viljelty

16 vuoden ajan siirrostamalla laboratoriossa (Kuva

2A). Odotetusti virD -amplifiointi, joka osoittaa

mahdollisen bakteriaalisen perimän läsnäolon, oli

negatiivinen. RT-PCR osoittaen h6h-geenin ilmentymisen

tehtiin käyttäen alkuperäistä KB7 sekä pakastettua

linjaa (Kuva 2B). h6h:n ilmentymisessä ei

havaittu tilastollisesti merkitsevää eroa alkuperäisen

ja pakastetun välillä (P=0.8538).

Karvajuurten kasvu ja

metaboliittituoton stabiilius

Villikaalin KB7-linja perustettiin vuonna 1998 (Jouhikainen

ym., 1999), ja linjaa on ylläpidetty siirrostamalla

sen jälkeen 4 viikon välein laboratoriossa. Kuten

kuvattiin 16 vuotta sitten, karvajuuret ovat edelleen

vaaleita, ja niillä on korkea kasvunopeus – niiden

biomassa monistuu 65–67-kertaiseksi 28 päivässä.

Taulukossa 1 on esitetty tropa-alkaloidien esiintyminen

sekä kasvu 16 vuoden seurannan aikana. Ensimmäinen

tutkimus KB7-linjasta julkaistiin vuonna

1999 (Jouhikainen ym., 1999), jolloin tuotot olivat 125

mg/l hyoskyamiinille ja 14 mg/l skopolamiinille. Tuolloin

hyoskyamiini analysoitiin käyttäen radioimmunomääritystä

ja skopolamiini käyttäen entsyymilinkattua

immunosorbenttimenetelmää (ELISA). Välituotetta

6β-hydroksihyoskyamiinia ei analysoitu. Kuusi

vuotta myöhemmin julkaisimme tutkimuksen, jossa

verrattiin tupakan (Nicotiana tabacum) ja villikaalin

karvajuurten konversiokapasiteettia, kun molempiin

oli yliekspressoitu sama h6h geeni. Myös KB7 karvajuurilinja

analysoitiin. Vaikka kasvunopeus ja hyoskyamiinin

tuottonopeus olivat pysyneet samana, skopolamiinin

tuotto oli yli kaksinkertaistunut verrattuna

ensimmäiseen julkaistuun arvoon. Tämä tulos osoittaa,

että jostain syystä H6H-entsyymin aktiivisuus oli

noussut. Lopulta viimeisimmässä tutkimuksessamme

sekä kasvu että alkaloidien tuotto olivat hieman matalampia

kuin edeltävällä kerralla (Taulukko 1). Verrattu-

PAKASTUS I

(mukaillen Teoh et al., 1996)

PAKASTUS II

(Panis et al., 2005)

PAKASTUS III

(Schmale et al., 2006)

PAKASTUS IV

(Ogawa et al., 2012)

Sulatus I

• Kryoprotektantti

laimennetaan 6-vaiheisesti

• Juurenpäät kiinteälle alustalle

steriilin suodatinpaperin päälle

Sulatus II

• Juurenpäät kiinteälle alustalle

steriilin suodatinpaperin päälle

• Uudelle alustalle ilman suodatinpaperia

3 vrk:n kuluttua

Menetelmä I

• Juurenpäät PVS2-kuplan

sisällä folion päällä

• Upotus nestetyppeen


Menetelmä II

• Juurenpäät PVS2-liuoksessa

kryoputkiin

• Upotus nestetyppeen

Sulatus III

• Juurenpäät kiinteälle alustalle

steriilin suodatinpaperin päälle

• Uudelle alustalle ilman suodatinpaperia

3 vrk:n kuluttua

Sulatus IV

• Juurenpäät pestään

kasvatusalustalla

• Uudelle alustalle ilman

suodatinpaperia

Kuva 1. Kryopakastuskokeet. Muutokset alkuperäiseen menetelmään on merkitty laatikoihin. Menetelmät,

joiden avulla saavutettiin sulatuksen jälkeinen kasvu, on merkitty tummennetulla laatikolla.

© DOSIS n:0 4/2018 280

© Suomen Farmasialiitto ry


na alkuperäiseen tulokseen hyoskyamiinitasot olivat

80 prosenttia alkuperäisestä, kun taas skopolamiinitasot

olivat pysyneet samoina. Kuitenkin kun tarkastellaan

vain solukohtaista tuottokapasiteettia (ilmaistaan

mg/g kuivapainoa kohden), havaitaan, että ensimmäisen

ja viimeisen mittauksen välissä ei ole eroa (Kuva

3). On selvää, että Taulukossa 1 esitetty alempi tuottavuus

(ilmaistaan mg/l) johtuu alemmasta kasvusta.

Karvajuurten pakastus

Karvajuuret pakastettiin onnistuneesti käyttäen hidasta

pakastusta (Pakastus I). Juurenpäät, jotka oli sulatettu

neljännellä (Sulatus IV) menetelmällä, osoittivat kasvua

kaksi viikkoa sulatuksen jälkeen, tosin kasvavien juurten

osuus oli suhteellisen pieni (10 %). Samoin vitrifikaation

(Pakastus IV) jälkeen kahden viikon kuluttua sulatuksesta

juurissa havaittiin kasvua, mutta edellistä alemmalla

osuudella (2 %). Sulatuksen jälkeen kasvaneet juuret

viljeltiin kiinteällä alustalla ja h6h:n ilmentyminen analysoitiin

21 vuorokauden kuluttua (Kuva 4). Odotetusti

pakastetuissa soluissa ei havaittu muutoksia H6H:n ilmentymisessä,

niin kuin Kuvassa 3 esitetään. Tämän

johdosta voidaan sanoa, että kryopakastus on hyvä keino

säilöä biologista materiaalia.

POHDINTA

Usein siirtogeenisten soluviljelmien haasteena on geenien

hiljentyminen, joka useimmiten johtuu transkriptionaalisesta

inaktivaatiosta tai transkription jälkeisistä

tapahtumista (Guivarc’h ym., 1999). On mielenkiintoista,

että vaikka h6h-geeni, jota käytettiin tässä

tutkimuksessa, on alkuperältään eristetty samasta

kasviperheestä kuin isäntäkasvi Hyoscyamus, geenin

hiljentymistä ei havaittu 16 vuoden seurannan aika-

Kuva 2 (A) Kuva geelistä, jolla näkyy villikaalin (H. muticus) karvajuurten ja Agrobakteerin PCR-reaktion

tulos: h6h (1150 bp), rolB (780 bp) ja virD (450 bp). 1: A. rhizogenes pLAL21 jossa h6h; 2: H. muticus

kontrollikarvajuuri; 3: H. muticus karvajuurilinja KB7 jossa h6h; M: molekyylimarkkeri (Gene Ruler 100 bp

Plus), (B) Suhteelliset RT-PCR ekspressiotasot geeneistä h6h ja 18S alkuperäisessä ja kryopakastetussa

KB7-linjassa. Kuvassa esitetty keskiarvot kolmesta analyyttisestä rinnakkaisesta sekä keskihajonta.

© Suomen Farmasialiitto ry 281

© DOSIS n:0 4/2018


Taulukko 1. Villikaalin karvajuurilinjan KB7 tuottamat tropa-alkaloidipitoisuudet 16 vuoden

seurannan aikana. Datassa huomioitu kolme rinnakkaista biologista näytettä ±SD; *n=3, **n=9.

Vuosi

Hyoskyamiini

(mg/l)

6β-hydroksyhyoskyamiini

(mg/l)

Skopolamiini

(mg/l)

Kasvu

(g/l kuivap.)

Viite

1999*

2005*

2016**

125±12.0

124±6.2

99±17.7

NA

38±1.9

14±3.3

14±1.3

37±1.9

12±2.3

17

17

14

Jouhikainen ym. 1999

Häkkinen ym. 2005

Häkkinen ym. 2016

NA: ei analysoitu.

na. Kun viiden eri Solanaceae-heimoon kuuluvan lajin,

joilla kaikilla on endogeeninen h6h-geeni, nukleotidisevenssejä

verrattiin H. niger -kasvin h6h-geeniin,

samankaltaisuus vaihteli korkeimman 99,2 prosentin

(Brugmansia candida) ja 84,9 prosentin (Datura stramonium)

välillä (Liite 1). On huomioitavaa, että korkein

yhtenevyys proteiinitasolla havaittiin B. candidan

kanssa (100 %), kun taas toinen Hyoscyamus -laji H. senescensin

kanssa yhtenevyys oli jokseenkin alhaisempi,

96,5 prosenttia. H. muticus -kasvin h6h geenin sekvenssi

ei ole tiedossa, mutta muiden sukulaiskasvien

tiedon perusteella on oletettavaa, että yhtenevyys on

korkeaa, joten mahdollisuus homologiaan perustuvalle

hiljentymiselle on olemassa.

Alkaloideja – koska ovat kasvien pienyhdisteitä –

tuotetaan usein pieniä määriä, ja tuotto on epästabiilia

erilaistumattomissa soluissa. Pienyhdistetuotto korreloi

usein erilaistumiseen (Sevón ym. 1998), ja tämän

vuoksi niin kuin tässä työssäkin havaittiin, karvajuurisolukko

on lupaava systeemi bioteknologiselle alkaloidituotolle.

Tässä työssä, ensimmäistä kertaa, laboratoriossa

ylläpidettyjen ja siirrostettujen karvajuurten

geneettinen sekä metabolinen stabiilius osoitettiin 16

vuoden seurannan aikana. Alkaloidituotto määritettiin

vuosina 1999, 2005 ja 2016. Ensimmäiset analyysit tehtiin

käyttäen immunologisia määritysmenetelmiä, kun

taas myöhemmin alkaloideja analysoitiin GC-MS:llä.

Vaikka kokeellista dataa näiden kahden analyyttisen

menetelmän korrelaatiosta ei ole, on hyvä huomioida,

että sekä EIA/RIA ja GC-MS ovat erittäin spesifisiä ja

herkkiä näille analysoiduille metaboliiteille, joten molemmista

saatu data vertautuu hyvin tuloksiin.

Vaikka aiempia raportteja kryopakastetuista karvajuurista

on julkaistu, tähän mennessä villikaalin

karvajuurien pakastusta ei ole julkaistu. Karvajuurten

pakastuksen ja sulatuksen jälkeinen kasvuosuus

on vaihdellut 6 prosentin (Xue ym. 2008) ja 90 prosentin

(Lambert ym., 2009) välillä, riippuen lajista ja

käytetystä menetelmästä. Kuten Xue ym. (2008) raportoivat,

menetelmä, joka oli kutakuinkin toimiva

Eruca sativa (73 % pakastuksenjälkeinen elävyys) ja

Astragalus membranaceus (6 % pakastuksenjälkeinen

elävyys) -viljelmille, ei toiminut Gentiana macrophylla

-karvajuurille. Tämä ilmiö tunnetaan hyvin kasvisolujen

ja -solukkojen pakastuksen yhteydessä, ja

sen vuoksi sopivan pakastusmenetelmän löytäminen

vaatii usein järjestelmällistä empiiristä kokeilua.

JOHTOPÄÄTÖKSET

Tämän tutkimuksen perusteella voidaan sanoa, että

H. muticus karvajuurten kryopakastus on erittäin

haastavaa. Saatujen tulosten perusteella ei vielä voida

luoda luotettavaa teolliseen tuotantoon soveltuvaa

pakastusohjeistusta. Menetelmän pystyttäminen on

hyvin empiiristä, ja usein tulokset eivät suoraan näytä

suuntaa, mihin optimoinnissa tulisi edetä. Kuten

useat alan tutkijat ovat todenneet, ongelmat toistettavuudessa

rajoittavat kryopakastuksen rutiinikäyttöä

(Panis ym., 2005; Reed ym. 2001). Työläs leikkaaminen

ja käsittely herkkien solukoiden, kuten karvajuurten

apikaalisten meristeemien osalta, on selkeä

este high-throughput-testaukselle. Tässä työssä kuitenkin

osoitimme, että kryopakastus itsessään ei estä

siirtogeenin toimintaa kyseisessä solukossa. Sikäli

kuin mahdollista, kryopakastus on paras vaihtoehto

kasvien solujen ja solukoiden pitkäaikaissäilytykselle.

Pakastamalla vältetään jatkuvasta siirrostamisesta

johtuvat kontaminaatioriskit ja sillä voidaan parantaa

prosessin tuottavuutta. Toisaalta niin kuin tässä työssä

osoitimme, karvajuurten jatkuva siirrostaminen

jopa hyvin pitkän ajan kuluessa ei vähentänyt merkittävästi

entsymaattista tai metabolista aktiivisuutta.

© DOSIS n:0 4/2018 282

© Suomen Farmasialiitto ry


Kuva 3. Solunsisäiset alkaloidimäärät (mg/g kuivapainoa kohden) eri vuosina.

Tähdet ilmaisevat tilastollisesti merkitseviä eroja (t-testi, (***): P


SUMMARY

Exploring the metabolic stability

of engineered hairy roots after

16 years maintenance

➔ Suvi T. Häkkinen*

Senior Scientist, PhD(Tech)

VTT Technical Research Centre of Finland,

P.O.Box 1000, Tietotie2, FI-02044-VTT, Espoo

suvi.hakkinen@vtt.fi

Keywords: plant cell culture, hairy roots,

hyoscyamine 6β-hydroxylase, scopolamine,

stability, cryopreservation

Kiitokset: Kiitämme Elisabeth Moyanoa ja

Rosa M. Cusidóa erinomaisesta yhteistyöstä.

Kiitämme Tuulikki Seppänen-Laaksoa

analyyttisestä osaamisesta ja Siv Matomaata ja

Airi Hyrkästä teknisestä avusta.

➔ Kirsi-Marja Oksman-Caldentey

Resarch Manager, Docent

VTT Technical Research Centre of Finland, P.O.Box

1000, Tietotie2, FI-02044-VTT, Espoo

*Correspondence

Plants remain a major source of new drugs, leads and

fine chemicals. Cell cultures deriving from plants offer

a fascinating tool to study plant metabolic pathways

and offer large scale production systems for valuable

compounds – commercial examples include

compounds such as paclitaxel. The major constraint

with undifferentiated cell cultures is that they are

generally considered to be genetically unstable and

cultured cells tend to produce low yields of secondary

metabolites especially over time. Hairy roots, a

tumour tissue caused by infection of Agrobacterium

rhizogenes is a relevant alternative for plant secondary

metabolite production for being fast growing,

able to grow without phytohormones, and displaying

higher stability than undifferentiated cells. Although

genetic and metabolic stability has often been

connected to transgenic hairy roots, there are only

few reports on how a very long-term subculturing effects

on the production capacity of hairy roots. In this

study, hairy roots producing high tropane alkaloid

levels were subjected to 16 -year follow-up in relation

to genetic and metabolic stability. Cryopreservation

method for hairy roots of H. muticus was developed

to replace laborious subculturing, and although the

post-thaw recovery rates remained low, the expression

of transgene remained unaltered in cryopreserved

roots. It was shown that although displaying

some fluctuation in the metabolite yields, even an

exceedingly long-term subculturing was successfully

applied without significant loss of metabolic activity.

© DOSIS n:0 4/2018 284

© Suomen Farmasialiitto ry


KIRJALLISUUS

B Baíza A, Quiroz-Moreno A, Ruíz J, Loyola-

Vargas V: Genetic stability of hairy root cultures of

Datura stramonium. Plant Cell Tissue Organ Cult

59: 9–17, 1999

Benson EE, Hamill JD: Cryopreservation and post

freeze molecular and biosynthetic stability in

transformed roots of Beta vulgaris and Nicotiana

rustica. Plant Cell Tissue Organ Cult 24: 163–172,

1991

Dehghan E, Häkkinen ST, Oksman-Caldentey

KM, Ahmadi FS: Production of tropane alkaloids

in diploid and tetraploid plants and in vitro hairy

root cultures of Egyptian henbane (Hyoscyamus

muticus L.). Plant Cell Tissue Organ Cult 110:

35–44, 2012

Georgiev MI, Pavlov AI, Bley T: Hairy root type

plant in vitro systems as sources of bioactive

substances. Appl Microbiol Biotechnol 74: 1175–

1185, 2007

Guillon S, Trémouillaux-Guiller J, Pati PK, Rideau

M, Gantet P: Hairy root research: recent scenario

and exciting prospects. Curr Opin Plant Biol 9:

341–346, 2006

Guivarc’h A, Boccara M, Prouteau M, Chriqui D:

Instability of phenotype and gene expression in

long-term culture of carrot hairy root clones. Plant

Cell Rep 19: 43–50, 1999

Häkkinen ST, Moyano E, Cusidó RM, Oksman-

Caldentey K-M: Exploring the metabolic

stability of engineered hairy roots after 16 years

maintenance. Front Plant Sci 7: 1486, 2016

Häkkinen ST, Moyano E, Cusidó RM, Palazón

J, Piñol MT, Oksman-Caldentey KM: Enhanced

secretion of tropane alkaloids in Nicotiana

tabacum hairy roots expressing heterologous

hyoscyamine-6β-hydroxylase. J Exp Bot 56: 2611–

2618, 2005

Häkkinen ST, Raven N, Henquet M, ym.:

Molecular farming in tobacco hairy roots by

triggering the secretion of a pharmaceutical

antibody. Biotechnol Bioeng 111: 336–346, 2014

Hamill JD, Rounsley S, Spencer A, Todd G,

Rhodes MJC: The use of the polymerase chain

reaction in plant transformation studies. Plant Cell

Rep 10: 221–224, 1991

Hashimoto T, Yamada Y: Hyoscyamine 6betahydroxylase,

a 2-oxoglutarate-dependent

dioxygenase, in alkaloid-producing root cultures.

Plant Physiol 81: 619–625, 1986

Hirata K, Goda S, Phunchindawan M, Ishio

M, Sakai A, Miyamoto K: Cryopreservation of

horseradish hairy root cultures by encapsulationdehydration.

J Ferment Bioeng 86: 418–420,

1998

Jouhikainen K, Lindgren L, Jokelainen T,

Hiltunen R, Teeri TH, Oksman-Caldentey KM:

Enhancement of scopolamine production in

Hyoscyamus muticus L. hairy root cultures by

genetic engineering. Planta 208: 545–551, 1999

Moriuchi H, Okamoto C, Nishihama R, Yamashita

I, Machida Y, Tanaka N: Nuclear localization and

interaction of RolB with plant 14-3-3 proteins

correlates with induction of adventitious roots by

the oncogene rolB. Plant J 38: 260–275, 2004

Ogawa Y, Sakurai N, Oikawa A, Kai K, Morishita Y,

Mori K, ym.: High-throughput cryopreservation of

plant cell cultures for functional genomics. Plant

Cell Physiol 53: 943–952, 2012

Oksman-Caldentey KM, Kivelä O, Hiltunen

R: Spontaneous shoot organogenesis and

plant regeneration from hairy root cultures of

Hyoscyamus muticus. Plant Sci 78: 129–136, 1991

Panis B, Piette B, Swennen R: Droplet vitrification

of apical meristems: A cryopreservation protocol

applicable to all Musaceae. Plant Sci 168: 45–55,

2005

Peebles CAM, Sander GW, Li M, Shanks J

V., San KY: Five year maintenance of the

inducible expression of anthranilate synthase

in Catharanthus roseus hairy roots. Biotechnol

Bioeng 102: 1521–1525, 2009

Reed BM: Plant cryopreservation: A practical

guide. 2008

© Suomen Farmasialiitto ry 285

© DOSIS n:0 4/2018


Schmale K, Rademacher T, Fischer R, Hellwig S:

Towards industrial usefulness - cryo-cell-banking

of transgenic BY-2 cell cultures. J Biotechnol 124:

302–311, 2006.

Sevón N, Oksman-Caldentey KM, Hiltunen R:

Efficient plant regeneration from hairy rootderived

protoplasts of Hyoscyamus muticus. Plant

Cell Rep 14: 738–742, 1995

Sevón N, Oksman-Caldentey KM: Agrobacterium

rhizogenes-mediated transformation: Root

cultures as a source of alkaloids. Planta Med 68:

859–868, 2002

Srivastava S, Srivastava AK: Hairy root culture

for mass-production of high-value secondary

metabolites. Crit Rev Biotechnol 27: 29–43, 2007

Teoh KH, Weathers PJ, Cheetham RD, Walcerz

DB: Cryopreservation of transformed (hairy) roots

of Artemisia annua. Cryobiology 33: 106–117, 1996

Vasilev N, Schmitz C, Dong L, ym.: Comparison

of plant-based expression platforms for the

heterologous production of geraniol. Plant Cell

Tissue Organ Cult 117: 373–380, 2014

Weber J, Georgiev V, Haas C, Bley T, Pavlov A:

Ploidy levels in Beta vulgaris (red beet) plant

organs and in vitro systems. Eng Life Sci 10: 139–

147, 2010

Weber J, Georgiev V, Pavlov A, Bley T: Flow

cytometric investigations of diploid and tetraploid

plants and in vitro cultures of Datura stramonium

and Hyoscyamus niger. Cytom Part A 73: 931–

939, 2008

Yoshimatsu K, Yamaguchi H, Shimomura K: Traits

of Panax ginseng hairy roots after cold storage

and cryopreservation. Plant Cell Rep 15: 555–

560, 1996

Yun D-J, Hashimoto T, Yamada Y: Metabolic

engineering of medicinal plants: Transgenic

Atropa belladonna with an improved alkaloid

composition. Appl Biol Sci 89: 11799–11803, 1992

© DOSIS n:0 4/2018 286

© Suomen Farmasialiitto ry


#

Liite1. Viiden Solanaceae -heimoon kuuluvan lajin h6h -geenien sekvenssit.

Liite1. Viiden Solanaceae -heimoon kuuluvan lajin h6h -geenien sekvenssit.

tävästi entsymaattista tai metabolista aktiivisuutta.

H.niger

--------------------------TACTAAGAGTGTTTCCGAAAGCTTTATAGCACCA

A.luridus ------------------------------------------------------------

D.stramonium ----------------------GGTCTACAAACAATGTCTCTGAAAGCTTTATAGCACCA

A.belladonna ATGGCTACTCTTGTCTCAAATTGGTCTACAAACAATGTTTCTGAAAGTTTTGTAGCACCA

B.candida

--------------------------------------------------------ACCA

H.senecionis ATGGCTACTTTTGTCTCAAATTGGTCTACTAAGAGTGTTACTGAAAGCTTTATAGCACCA

H.niger

A.luridus

D.stramonium

A.belladonna

B.candida

H.senecionis

H.niger

A.luridus

D.stramonium

A.belladonna

B.candida

H.senecionis

H.niger

A.luridus

D.stramonium

A.belladonna

B.candida

H.senecionis

H.niger

A.luridus

D.stramonium

A.belladonna

B.candida

H.senecionis

H.niger

A.luridus

D.stramonium

A.belladonna

B.candida

H.senecionis

H.niger

A.luridus

D.stramonium

A.belladonna

B.candida

H.senecionis

H.niger

A.luridus

D.stramonium

A.belladonna

B.candida

H.senecionis

H.niger

A.luridus

D.stramonium

A.belladonna

B.candida

H.senecionis

H.niger

A.luridus

D.stramonium

A.belladonna

B.candida

TTACAGAAAAGAGCAGAAAAAGATGTTCCCGTAGGAAATGATGTCCCTATTATTGATCTC

----------GGGCAGAAAAGGAAGTTCCCTTAGGAAATGATGACCCTATCATTGATCTC

TTAGAGAAAAGGGCAGAAAAGGATGTTGCTTTAGGAAATGATGTCCCTATTATTGATCTC

TTAGAGAAAAGGGCAGAAAATGATGTTCCTTTAGGAAATGATGTGCCTATCATTGATCTC

TTACAGAAAAGAGCAGAAAAAGATGTTCCCGTAGGAAATGATGTCCCTATTATTGATCTC

TTACAGAAAAGAGCAGAAAAAGATGTTCCCATAGGAAATGGTGTCCCTATTATTGATCTC

*.******** **:*** * *********.**: ***** *********

CAACAACATCATCATCTTCTTGTTCAACAAATCACCAAAGCTTGTCAAGATTTTGGTCTC

CAACAAGATCACCATTTTGTTGTTCAACAAATCACCAAAGCTTGTAAAGATTTTGGTCTC

CAACAAGATCACCTTCTTATTGTTCAACAAATCACCAAAGCTTGTCAAGATTTTGGTCTC

CAACAAGATCACCTTGTTGTTGTTCAACAAATCACCAAAGCTTGTCAAGATTTTGGTCTC

CAACAACATCATCATCTTCTTGTTCAACAAATCACCAAAGCTTGTCAAGATTTTGGTCTC

CAACAACACCATCATCTTCTTGTCCAACAAATCACCAAAGCTTGTCAAGATTTTGGTCTC

****** * ** *:* ** **** *********************.**************

TTTCAGGTGATCAATCATGGATTTCCAGAAGAACTAATGTTAGAGACAATGGAAGTGTGC

TTTCAGGTGATCAACCATGGATTTCCAGAAAACCTAATGGCAGAGACAATGAAATTGTGC

TTTCAGGTGATCAATCATGGAGTCCCAGAAAAGCTAATGGTAGAGGCAATGGAAGTGTAC

TTTCAGGTGATCAACCATGGATTACCAGAAAAGCTGATGGCAGAAACAATGGATGTGTGC

TTTCAGGTGATCAATCATGGATTTCCAGAAGAGCTAATGTTAGAGACAATGGAAGTGTGC

TTTCAGGTGATCAATCATGGATTTCCAGAAGAACTAATGTTAGAAACAATGGAGGTATGC

************** ****** * ******.* **.*** ***..*****.* *.*.*

AAAGAGTTCTTTGCACTGCCAGCTGAGGAAAAGGAAAAGTTTAAGCCAAAAGGAGAGGCA

AAAGAGTTTTTTGCACTGCCTGCTGAGGAGAAAGAAAAGCTTCAGCCAAAAGGAAAGCCA

AAAGAGTTTTTTGCATTGCCTGCTGAGGAAAAAGAAAAGTTTCAGCCAAAAGGAGAGCCA

AAAGAATTTTTTGCACTGCCTGCTGAGGAGAAAGAAAAGCTTCAACCAAAAGGAGAGCCA

AAAGAGTTCTTTGCACTGCCAGCTGAGGAAAAGGAAAAGTTTAAGCCAAAAGGAGAGGCA

AAAGAGTTCTTTGCACTGCCAGCTGAGGAAAAGGAGAAGTTTAAGCCAAAAGGAGAGGCA

*****.** ****** ****:********.**.**.*** **.*.*********.** **

GCTAAATTTGAACTTCCTCTTGAGCAGAAAGCAAAGCTATATGTTGAAGGAGAACAACTC

GCTAAATTTGAACTTCCTCTCGAGCAGAAAGCAAAGCTATATATTGAAGGAGAACAACTC

GCTAAATTTGAACTTCCACTTGAGCAGAAAGCAAAACTCTATGTTGAAGGGGAACGACGC

GCTAAATTTGAGCTTCCACTTGAGCAGAAAGCAAAGCTTTATGTTGAAGGAGAACAACTC

GCTAAATTTGAACTTCCTCTTGAGCAGAAAGCAAAGCTATATGTTGAAGGAGAACAACTC

GCTAAATTTGAACTTCCTTTGGAGCAGAAAGCAAAGCTATATATTGAAGGAGAACAACTC

***********.*****: * **************.** ***.*******.****.** *

TCTAACGAGGAGTTCTTATACTGGAAAGACACTTTGGCTCATGGTTGTCATCCTCTTGAT

TCTAACGATGAGTTCTTTTACTGGAAAGACACTTTGGCTCATGGTTGTCATCCTCTGGAT

TGTAATGAGGAGTTTTTGTACTGGAAAGACACTTTGGCTCATGGTTGTTATCCTCTTCAT

TCTGATGAAGCGTTCCTTTACTGGAAGGACACTTTGGCTCATGGTTGTCATCCTCTTGAT

TCTAACGAGGAGTTCTTATACTGGAAAGACACTTTGGCTCATGGTTGTCATCCTCTTGAT

TCCAATGAAGAATTCTTGTACTGGAAAGACACTTTGGCTCATGGTTGCCATCCTCTTGAC

* .* ** *..** * ********.******************** ******* *

CAAGACTTAGTCAATTCCTGGCCTGAAAAACCAGCAAAATATAGAGAGGTGGTTGCTAAA

GAAGAGTTAGTCAACTCCTGGCCTGAAAAACCAACAACCTATAGAGAGGTGGCGGCTAAA

GAAGAGTTACTTAACTCCTGGCCAGAAAAACCACCAACATATAGAGATGTGATAGCTAAA

GAAGAGTTAGTCAACTCCTGGCCTGAAAAACCAGCAACATATAGAGAGGTGGTGGCTAAA

CAAGACTTAGTCAATTCCTGGCCTGAAAAACCAGCAAAATATAGAGAGGTGGTTGCTAAA

CAAGACTTAGTTAATTCCTGGCCTGAAAAACCAGCAAAATATAGAGAGGTGGTGGCTAAA

**** *** * ** ********:********* ***..******** ***. ******

TATTCAGTAGAAGTGAGGAAGTTGACCATGAGGATGCTGGACTACATCTGTGAAGGACTT

TATTCAGTGGAAGCGAGGAAGTTGACCATGAGGATGCTGGACTACATCTGTGAAGGACTT

TATTCAGTGGAAGTGAGGAAGTTGACGATGAGGATCCTGGACTACATATGTGAAGGACTC

TATTCAGTGGAAGTGAGGAAGTTGACCATGAGGATCCTGGACTACATCTGTGAAGGACTT

TATTCAGTAGAAGTGAGGAAGTTGACCATGAGGATGCTGGACTACATCTGTGAAGGACTT

TATTCAGTAGAAGTGAGGAAGTTAACTATGAGGATGCTGGACTACATCAGTGAAGGACTT

********.**** *********.** ******** ***********.:**********

GGGCTTAAATTGGGCTACTTTGATAATGAACTTAGCCAAATTCAGATGATGCTGACTAAC

GGGCTTAAATTGGGCCACTTTGATAATGAGCTTAGCCAAATTCAGATGATGCTGACTAAC

GGGCTTAAATTGGGCTACTTTGATAATGAGCTTACCCAAATTCAGATGTTGCTGGCTAAC

GGGCTTAAATTGGGCTACTTTGATAATGAGCTTAGCCAAATTCAGATGATGCTGACTAAC

GGGCTTAAATTGGGCTACTTTGATAATGAACTTAGCCAAATTCAGATGATGCTGACTAAC

© Suomen Farmasialiitto ry 287

© DOSIS n:0 4/2018


Farmasian ammattilaisten

rooli sairaaloiden

mikrobilääkehoidon

ohjauksessa

➔ Niina Laine* 1, 2

FaT

niina.laine@helsinki.fi

➔ Kirsi Kvarnström 3, 4

Osastofarmasian kehittämisestä

vastaava proviisori

tohtorikoulutettava

➔ Lotta Schepel 3, 4

Lääkitysturvallisuuskoordinaattori,

proviisori,

tohtorikoulutettava

1

Lastenklinikka, HUS

2

Farmakologian ja lääkehoidon

osasto, Farmasian tiedekunta,

Helsingin yliopisto

3 HUS Apteekki, Helsingin

yliopistollinen sairaala (HUS)

4

Sairaala- ja terveyskeskusfarmasian

erikoistumiskoulutus,

Farmasian tiedekunta,

Helsingin yliopisto

*Kirjeenvaihto

© DOSIS n:0 4/2018 288

© Suomen Farmasialiitto ry


TIIVISTELMÄ

Uusi rationaalista mikrobilääkehoitoa käsittelevä EU-direktiivi korostaa farmasian ammattilaisten mukaan

ottamista taistelussa antibioottiresistenssiä vastaan. Direktiivi suosittaa kansallisen mikrobilääkeresistenssin

torjumisstrategian luomista ja farmasian ammattilaisten osallistamista mikrobilääkkeiden käyttöön niin

sairaaloissa kuin avoterveydenhuollossa. Kansainvälisen Joint Commission International (JCI) -laatustandardien

yhtenä keskeisenä osa-alueena on moniammatillinen ja näyttöön perustuva mikrobilääkkeiden käytön

ohjausohjelma. JCI korostaa farmasian ammattilaisten roolia mikrobilääkkeiden käytön moniammatillisessa

ohjauksessa sekä lääkemääräyksen asianmukaisuuden varmistamisessa. Tavoite on yhteneväinen EU:n direktiivin

kanssa. JCI:n mukaista terveydenhuollon laatusertifikaattia on Suomessa päättänyt ensimmäisenä

hakea muun muassa Helsingin yliopistollisen sairaalan (HUS) Lasten- ja nuorten sairauksien tulosyksikkö.

Kliinisen farmasian väitöstutkimuksessa selvitettiin vuosina 2012–2017 mikrobilääkehoidon oikeellisuutta,

laatua ja turvallisuutta HUS Lastenklinikalla niin sairaalatasolla kuin yksittäisten potilaiden kohdalla. Väitöstyössä

havaittiin, että farmasian ammattilaisia kannattaisi hyödyntää osana moniammatillista mikrobilääkkeiden

käytönohjaustiimiä. Mikrobilääkkeiden järkevän ja asianmukaisen käytön edistämiseksi tarvitaan

EU:n direktiivin antamien suositusten täytäntöönpanoa. Suomessa farmasian ammattilaisten osaamista tulisi

hyödyntää entistä enemmän rationaalisen mikrobilääkehoidon varmistamisessa sairaaloissa.

Avainsanat: antibioottiresistenssi, mikrobilääkkeiden käytön ohjaus, kliininen farmasia, osastofarmasia,

sairaalafarmasia, infektiolääkehoitoon erikoistunut farmasian ammattilainen

© Suomen Farmasialiitto ry 289

© DOSIS n:0 4/2018


Farmasian ammattilaiset rationaalisen

mikrobilääkkeiden käytön portinvartijoina

Uusi rationaalista mikrobilääkkeiden käyttöä käsittelevä

EU:n direktiivi korostaa farmasian ammattilaisten

roolia mikrobilääkehoidon oikeellisuuden

varmistamisessa (EU 2017). Direktiivi suosittaa kansallisen

mikrobilääkeresistenssin torjumisstrategian

luomista WHO:n toimintasuunnitelman mukaisesti.

Strategiassa tulisi huomioida mikrobilääkkeiden

saatavuuden ja käytön sääntely, mikrobilääkkeiden

määrääminen ja hallinta sekä terveydenhuollon ammattilaisten

koulutus.

Osa EU:n direktiivin suosituksista toteutuu jo

Suomessa. Esimerkiksi antibioottien käyttö vaatii

lääkärin määräyksen, ja avoapteekeissa asiakkaita

neuvotaan antibioottihoidon pituudesta, antibioottien

oikeasta käytöstä, yhteisvaikutuksista sekä mahdollisista

haittavaikutuksista. Sairaaloissa sitä vastoin

farmasian ammattilaisten osallistuminen mikrobilääkkeiden

käytön ohjaukseen on vielä vähäistä.

Vaikka antibioottien kulutus Suomen sairaaloissa

on laskenut hieman viime vuosina useisiin muihin

EU-maihin verrattuna (ECDC 2017), monissa muissa

maissa, kuten Hollannissa, Virossa ja Ruotsissa, käytetään

sairaaloissa merkittävästi vähemmän antibiootteja

Suomeen verrattuna.

EU:n direktiivi on eurooppalaisille sairaalafarmasisteille

sekä haaste että mahdollisuus (Wiffen 2017).

Farmasian ammattilaisten tulisi direktiivin mukaan

olla mukana sairaalan moniammatillisessa mikrobilääkkeiden

käytön ohjausryhmässä ja valvoa mikrobilääkkeiden

asianmukaista käyttöä erityisesti erityisryhmien

kohdalla (esim. lapset). Avoapteekeissa tehdään

jo paljonkin työtä rationaalisen mikrobilääkehoidon

toteutumisen puolesta, mutta proviisorien ja

farmaseuttien rooli suomalaisissa sairaaloissa vaatii

vielä kirkastamista. Voisimmeko ottaa mallia esimerkiksi

Isosta-Britanniasta, Yhdysvalloista ja Australiasta,

joissa on jo infektiolääkehoitoon erikoistuneita

proviisoreita ja pitkälle vietyjä moniammatillisia mikrobilääkkeiden

käytön ohjausohjelmia (antimicrobial

stewardship programs)?

Joint Commission International –

kansainväliset laatustandardit sairaaloiden

mikrobilääkehoidon ohjaukseen

Joint Commission International on johtava kansainvälinen

terveydenhuollon laadun ja potilasturvallisuuden

akkreditointiorganisaatio (Joint Commission

International 2018). Yhdysvalloissa Joint Commissioniin

(JC) on akkreditoinut noin 1 800 organisaatiota

ja sen kansainväliseen yksikköön Joint Commission

Internationaliin (JCI) noin 800 organisaatiota tai terveydenhuollon

hoito-ohjelmaa. Euroopassa akkreditointeja

on lukumääräisesti eniten Irlannissa, Italiassa

ja Espanjassa. Yliopistollisista keskuksista Euroopassa

tunnetuimpia ovat Amsterdam ja Utrecht.

Suomalaisista toimijoista HUS Lasten- ja nuorten

sairauksien tulosyksikkö lähtee ensimmäisten joukossa

tavoittelemaan JCI-akkreditointia.

JCI:n lääkehoitostandardien yhtenä keskeisenä

osa-alueena on moniammatillinen ja näyttöön perustuva

mikrobilääkkeiden käytön ohjausohjelma

ja työryhmä (Joint Commission International 2016).

Prosentti (%)

30

23

15

8

0

< 750g 750–1 000g 1 001–1 500g 1501–2000g

Painoluokka

Kuva 1. Off-label mikrobilääkkeiden käytön prosentuaalinen osuus esitettynä vastasyntyneitten eri painoryhmissä.

Vastasyntyneet (400–2000 g, n=282) ja off-label mikrobilääkehoidot (käytössä yksi tai useampi

off-label mikrobilääke), jotka määrättiin veriviljelypositiivisten infektioiden hoitoon 30 vuorokauden

sisällä lapsen syntymästä.

© DOSIS n:0 4/2018 290

© Suomen Farmasialiitto ry


Ohjelmalle asetetaan tavoitteet, joiden toteutumista

seurataan ja arvioidaan säännöllisesti (esim. epätarkoituksenmukaisten

mikrobilääkkeiden käytön

ja mikrobilääkeresistenssin lasku). Kasvavan mikrobilääkeresistenssin

lisäksi huomiota tulee kiinnittää

haitta- ja sivuvaikutuksiin sekä mikrobilääkkeiden

turvalliseen ja järkevään käyttöön, kuten liian

pitkiin kuureihin, liian laajakirjoisten antibioottien

käyttöön, määräysvirheisiin (väärä lääke, väärä annos)

ja liian pitkään antibioottiprofylaksiaan. JCI korostaa

farmasian ammattilaisten roolia mikrobilääkkeiden

käytön moniammatillisessa ohjauksessa sekä

lääkemääräyksen asianmukaisuuden varmistamisessa

(appropriateness review). Nykyisinkin sairaaloissa

joidenkin mikrobilääkkeiden käyttö vaatii infektiolääkärin

määräyksen tai konsultaation, mutta farmaseutteja

ja proviisoreita voisi hyödyntää enemmän

niiden mikrobilääkkeiden kaksoistarkastuksessa, joihin

ei tarvitse infektiolääkärin määräystä.

Tuore väitöstutkimus avaa farmasian

ammattilaisten mahdollisia uusia toimenkuvia

mikrobilääkkeiden käytön ohjauksessa

Tuoreessa kliinisen farmasian väitöstutkimuksessa

(Laine 2017) tutkittiin mikrobilääkkeiden käyttöä

HUS Lastenklinikalla ja sitä, kuinka mikrobilääkkeiden

käytön ohjausta voitaisiin jatkossa toteuttaa paremmin.

Väitöskirjan osatöissä kartoitettiin mikrobilääkehoidon

oikeellisuutta, laatua ja turvallisuutta

niin sairaalatasolla kuin yksittäisten potilaiden

kohdalla (Laine ym. 2015, Laine ym. 2016, Laine ym.

2017).

Taulukko 1. Havaittuja tyypillisiä lääkeaine- tai lääkevalmistekohtaisia lääkityspoikkeamia.

Lääkeaine

Lääkeaineen osuus

kaikista poikkeamista

(mikrobilääkepoikkeamat

n = 157)

Lääkeaineelle tai

lääkkeelle ominainen

poikkeamatyyppi

(ja sen yleisyys)

Poikkeamaan

johtaneita syitä

Amoksisilliini

n=12 (8 %)

Kaksinkertainen

annostus (4/157)

Kaksi erivahvuista oraaliliuosta,

50 mg/ml ja 100

mg/ml. Hoitajat annostelivat

väärää vahvuutta.

Flukonatsoli

n=5 (3 %)

Määrättiin potilaalle,

jolla oli pidentynyt

QT-aika (1/157)

Lääkäri määräsi väärin.

Kefuroksiimi

Keftatsidiimi

Keftriaksoni

n=15 (10 %)

n=9 (6 %)

n=4 (3 %)

Kefalosporiinien

sekoittaminen

keskenään (5/157)

Kefalosporiinit ovat tunnettuja

LASA-lääkkeitä.

Hoitajat laimensivat väärän

kefalosporiinin.

Siprofloksasiini

n=3 (2 %)

Annostelu yhdessä

ravinto- tai kalsiumvalmisteiden

kanssa johti

sakan muodostumiseen

(3/157)

Tiedonpuute siprofloksasiinin

yhteisvaikutuksista.

Hoitajat annostelivat

lääkkeen väärin.

Teikoplaniini

n=3 (2 %)

Hoidon alun latausannosten

annostelu

liian tiheästi (1/157)

Poikkeuksellisesti tällä

lääkkeellä hoidon alussa

latausannokset.

Hoitajat annostelivat

lääkkeen väärin.

LASA* = look-alike ja sound-alike -lääke

© Suomen Farmasialiitto ry 291

© DOSIS n:0 4/2018


Väitöstutkimus osoitti, että mikrobilääkehoito oli

vuosina 2005–2012 epäasianmukaista 17 prosentilla

tutkimukseen osallistuneista potilaista, joilla oli veriviljelypositiivinen

infektio (26/149). Liian laajakirjoista

mikrobilääkehoitoa sai puolet näistä potilaista,

ja kolmen potilaan mikrobilääkehoito oli täysin

tehotonta (Laine ym. 2015).

Vuosina 2003–2013 resistenssi useita beeta-laktaamiantibiootteja

kohtaan kasvoi Lastenklinikalla.

Merkittävin muutos oli karbapeneemien käytön

kasvu (110 %) (Laine ym. 2016). Mikrobilääkkeiden

off-label-käyttö (ei myyntiluvan mukainen käyttö)

puolestaan liittyi yleisimmin meropeneemin käyttöön

alle 2000 grammaa painavilla keskosilla (Laine

ym. 2017). Mitä pienipainoisempi keskonen oli,

sen todennäköisemmin mikrobilääkehoito oli offlabel

(Kuva 1).

Vuosina 2009–2014 raportoiduista 157 mikrobilääkityspoikkeamasta

suurin osa liittyi eniten käytettyihin

mikrobilääkkeisiin, kuten kefuroksiimiin

ja G-penisilliiniin (Laine 2017). Mikrobilääkkeiden

annostelun unohtaminen oli tyypillisin poikkeamatyyppi.

Taulukossa 1 on esitelty tyypillisiä mikrobilääkehoidon

poikkeamia.

Väitöstutkimus (Laine 2017) antoi hyödyllisen

yleiskuvan mikrobilääkehoidosta ja mikrobilääkkeiden

käytöstä Lastenklinikalla. Asianmukaiseen

mikrobilääkehoitoon ja lääkkeenmäärääjien koulutukseen

tulisi kiinnittää enemmän huomiota. Mikrobilääkehoidon

seuranta ei aina toteudu asianmukaisesti,

ja potilaat jäivät joskus ilman toimivaa

mikrobilääkehoitoa ja toisaalta saivat paikoitellen

tarpeettoman laajakirjoisia antibiootteja. Väitöstyö

tarjosi myös näkökulman tekijöihin, jotka heikentävät

sairaalainfektioiden hoidon laatua lastensairaalassa

ja edistävät koordinoidumman mikrobilääkkeiden

käytön ohjausjärjestelmän rakentamista uuteen

lastensairaalaan.

Farmasian ammattilaisten osaamista tulisi hyödyntää

entistä enemmän sairaaloiden mikrobilääkehoitojen

laadun ja asianmukaisuuden varmistamisessa

(Laine 2017). Sairaalan mikrobilääkkeiden käytön

ohjausryhmässä tulisi olla vähintään lääkäreitä, hygieniahoitajia,

mikrobiologeja ja farmasian ammattilaisia.

Sairaaloiden osastoilla ja hoitoyksiköissä työskentelevät

osastofarmaseutit ja klinikkaproviisorit

voivat myös osaltaan kaksoistarkastaa mikrobilääkemääräyksiä

(Taulukko 2).

Taulukko 2. Farmasian ammattilaisille sopivia toimenkuvia sairaaloissa liittyen mikrobilääkkeiden käytön

ohjaukseen

• seurata mikrobilääkkeiden kulutusta ja tiedottaa siitä säännöllisesti lääkkeen määrääjiä

• seurata mikrobilääkehoidon kustannuksia ja ylläpitää sopivaa lääkevalikoimaa yhteistyössä

infektiolääkäreiden kanssa

• varmentaa/kaksoistarkistaa lääkemääräyksiä (mm. annos, antoreitti, antoajankohdat,

yhteisvaikutukset, vasta-aiheet, pitoisuusseuranta, herkkyysmääritykset, laimennosohjeet,

valikoiman ja suositusten mukaisuus, hoidon kesto)

• tehdä retrospektiivistä analyysiä ja auditointeja koskien toteutuneen mikrobilääkehoidon laatua.

Tämä voi kattaa esimerkiksi:

– erilaisissa infektioissa käytetyt mikrobilääkkeet ja sairaalan suositusten noudattaminen

– mikrobilääkehoidon de-eskalaation valvominen – eli laboratoriotulosten tullessa, mikrobilääke

tulee aina mahdollisuuksien mukaan vaihtaa vähemmän laajakirjoiseen lääkkeeseen sairaalan

suositusten mukaisesti

– valitun mikrobilääkeprofylaksin leikkausten yhteydessä ja sairaalan suositusten noudattamisen

– terapeuttisen pitoisuusseurannan asianmukaisen toteutumisen valvonta esimerkiksi

aminoglykosidi- ja glykopeptidiantibiooteilla

– erilaisten mikrobilääkehoitojen keston seurannan

• huolehtia, että parenteraalinen mikrobilääkehoito vaihdetaan oraaliseen heti kun mahdollista

• analysoida mikrobilääkkeisiin liittyviä lääkityspoikkeamia

• kouluttaa henkilökuntaa mikrobilääkkeistä

• tehdä toimintaohjeita ja suosituksia yhdessä muun mikrobilääkkeiden käytön ohjaustiimin kanssa

© DOSIS n:0 4/2018 292

© Suomen Farmasialiitto ry


YHTEENVETO

Mikrobilääkkeiden järkevän ja asianmukaisen käytön

edistämiseksi tarvitaan EU:n direktiivin antamien

suositusten täytäntöönpanoa. Tarvitsemme

kansallista mikrobilääkestrategiaa, joka ohjaa mikrobilääkkeiden

oikeaa käyttöä niin sairaaloissa kuin

avoterveydenhuollossakin. Farmasian ammattilaisten

tulee toimia aktiivisesti mikrobilääkeresistenssin

ehkäisemiseksi ja ottaa paikkansa sairaaloiden rationaalisen

mikrobilääkkeiden käytön hallinnassa EUdirektiivin

mukaisesti.

© Suomen Farmasialiitto ry 293

© DOSIS n:0 4/2018


SUMMARY

The Role of Pharmacy Professionals

in Hospitals' Antimicrobial

Stewardship Programs

➔ Niina Laine* 1, 2

PhD in Clin Pharm

niina.laine@helsinki.fi

➔ Kvarnström Kirsi 3, 4

Senior Pharmacist-in-Charge

(M.Sc. Pharm.; PhD student)

➔ Schepel Lotta 3, 4

Medication Safety Coordinator

(M.Sc. Pharm.; PhD student

1

Children´s Hospital,

Helsinki University Central Hospital

2

Division of Pharmacology and Pharmacotherapy,

Faculty of Pharmacy, University of Helsinki

3

HUS Pharmacy, Helsinki University Hospital (HUS)

4

Sairaala- ja terveyskeskusfarmasian

erikoistumiskoulutus, Farmasian tiedekunta,

Helsingin yliopisto

*Correspondence

New EU directive dealing with prudent use of antimicrobials

highlights the role of pharmacists when battling

against antimicrobial resistance. The directive

recommends creating a national strategy to battle antimicrobial

resistance and involve pharmacy professionals,

both inpatient and outpatient settings. One

aim of international Joint Commission International

(JCI) – health care quality standards is to have an

evidence-based antimicrobial stewardship program.

JCI highlights the role of pharmacists in multidisciplinary

antimicrobial stewardship programs and in

verifying the appropriateness of antimicrobial prescriptions.

This goal is uniform with the EU directive.

In Finland, one of the first organizations that have

decided to apply the JCI quality accreditation is The

Pediatric and Adolescent Units in the Helsinki University

Hospital District (HUS). PhD research focusing

on clinical pharmacy investigated the appropriateness,

quality and safety of antimicrobial therapy

in HUS Children's Hospital between 2012 and 2017. It

was discovered that pharmacists’ knowledge should

be utilized as a part of multidisciplinary antimicrobial

stewardship program. To promote the rational

use of antimicrobials, implementing the recommendations

of the EU directive is needed. The knowledge

and skills of pharmacists should be better utilized

in order to ensure rational antimicrobial therapy in

Finnish hospitals.

Key words: antibiotic resistance, antimicrobial

stewardship program, clinical pharmacy, hospital

pharmacy, infectious diseases pharmacist

Sidonnaisuudet: N. Laine: Toimitusjohtaja,

Aino ja Eino Lääkehoitopalvelut Oy

© DOSIS n:0 4/2018 294

© Suomen Farmasialiitto ry


KIRJALLISUUS

ECDC: Summary of the latest data on antibiotic

consumption in EU: 2017. www.ecdc.europa.eu.

Haettu internetistä 12.3.2018.

EU Guidelines for the prudent use of

antimicrobials in human health. 2017. Commission

notice 2017/C212/01.

Joint Commission International: Who is JCI.

Haettu internetistä 6.3.2018:

https://www.jointcommissioninternational.org/

about-jci/who-is-jci/

Joint Commission International Accreditation

Standards for Hospitals (including standards for

academic medical center hospitals). 6th edition,

2016.

Laine N: Use of Antimicrobials in a Tertiary

Children’s Hospital. Väitöskirja. Helsingin yliopisto,

2017, URN:ISSN:ISSN 2342-317X

Laine N, Hoppu K., Airaksinen M., Saxen H:

Antimicrobial consumption in a tertiary children’s

hospital in Finland (2003–2013), Eur J Hosp

Pharm, 2016, doi: 10.1136/ejhpharm-2015-000766

Laine N, Kaukonen A-M, Hoppu K, Airaksinen

M, Saxen H: Off-label use of antimicrobials in

neonates in a tertiary children’s hospital. Eur J

Clin Pharmacol 73: 609–614, 2017

Laine N, Vaara M, AnttilaV-J ym.: Evaluation of

antimicrobial therapy of blood culture positive

healthcare-associated infections in children,

PlosOne, 2015, doi:10.1371/journal.pone.0141555

Wiffen P: Pharmacists are the gatekeepers to the

use of antimicrobials. Eur J Hosp Pharm 24: 313,

2017

© Suomen Farmasialiitto ry 295

© DOSIS n:0 4/2018


Munuaisten vajaatoiminta

– huomaamatta jäävä

lääkehoidon ongelma?

➔ Pirkko Paakkari*

LKT, asiantuntijalääkäri

Kustannus Oy Duodecim

pirkko.paakkari@duodecim.fi

➔ Marja Forsell

FM, toimituspäällikkö

Kustannus Oy Duodecim

*Kirjeenvaihto

Munaisten kroonisen vajaatoiminnan havaitsemiseksi GFR-arvo olisi hyvä määrittää yli 65-vuotiailta lääkitystä

aloitettaessa. Jos vajaatoimintaa havaitaan, niin sitä tulisi myös seurata säännöllisesti. Näin ei valitettavasti

vielä aina tehdä. Toivommekin, että farmasian ammattilaiset voisivat omalta osaltaan olla edistämässä

tietoisuuden lisääntymistä tästä asiasta muissakin tilanteissa kuin lääkehoidon arviointien yhteydessä.

© DOSIS n:0 4/2018 296

© Suomen Farmasialiitto ry


TIIVISTELMÄ

Munuaisten vajaatoiminta yleistyy väestössä ikääntymisen myötä, mutta se jää kuitenkin usein huomaamatta.

Yhdysvalloissa ja Euroopassa tehdyissä tutkimuksissa selvisi, että vain murto-osa potilaista tiesi sairastavansa

munuaisten vajaatoimintaa. Jos munuaisten vajaatoimintaa ei oteta huomioon lääkehoidossa, tuloksena

on usein lääkkeen haittavaikutusten lisääntyminen sekä joskus myös lääkkeen tehon heikkeneminen.

Tavallisia lääkeryhmiä, joihin kuuluvien lääkkeiden annos pitäisi tarkistaa ainakin vaikeaa munuaisten

vajaatoimintaa sairastavan kohdalla, ovat muun muassa verenpainelääkkeet (etenkin ACE:n estäjät), opioidit

ja tulehduskipulääkkeet. Tulehduskipulääkkeitä ei suositella vaikeaa munuaisten vajaatoimintaa sairastaville

potilaille. Heille itsehoidon vaihtoehtoja ovat lähinnä paikallisesti käytettävät tulehduskipugeelit tai

parasetamoli.

Vajaatoiminnan havaitsemiseksi munuaisten toiminta (glomerulusfiltraatio, GFR-arvo) olisi hyvä määrittää

aina kun potilaan kreatiiniarvo on koholla sekä yli 65-vuotiaiden lääkityksen aloituksen yhteydessä. Munuaisen

vajaatoiminnan hoidossa on tärkeää yrittää estää taudin eteneminen sekä vajaatoimintaan liittyvät

komplikaatiot.

Terveysportin Lääkkeet ja munuaiset -sovelluksessa on GFR-laskuri, josta löytyy myös tietoa Suomessa

myyntiluvallisten lääkkeiden annossuosituksista munuaisten vajaatoiminnassa sekä myös lukuisien erityislupavalmisteiden

annossuositukset kroonisessa munuaisten vajaatoiminnassa.

Avainsanat: munuaiset, munuaisten vajaatoiminta, verenpainelääkkeet opioidit, tulehduskipulääkkeet

© Suomen Farmasialiitto ry 297

© DOSIS n:0 4/2018


JOHDANTO

Eri maiden tutkimuksissa koko väestöstä 10–15 prosentilla

on munuaisten vajaatoiminta, ja sen esiintyvyys

lisääntyy ikääntymiseen liittyvien sairauksien,

erityisesti diabeteksen sekä verenkierron muutosten

myötä. Noin 30–40 prosentilla yli 65-vuotiaista munuaisten

toiminta on heikentynyt (Eckardt ym. 2013,

Hill 2016).

Vajaatoiminta määritetään munuaisten hiussuonikerästen

suodatusnopeuden (glomerulusfiltraatio,

GFR) perusteella: GFR 90–60 ml/min on lievä, 60–30

ml/min keskivaikea ja 30–15 ml/min vaikea vajaatoiminta.

Alle 15 ml/min arvoilla tarvitaan jo dialyysihoitoa

(loppuvaiheen vajaatoiminta).

Vajaatoiminta jää usein huomaamatta. Oregonin

osavaltiossa tehdyn selvityksen mukaan perusterveydenhuollossa

tila oli jäänyt toteamatta puolella munuaisten

vajaatoimintaa sairastavista (Rao ym. 2013).

Maailmalla julkaistujen tutkimusten mukaan ihmiset

eivät välttämättä tiedä munuaisten vajaatoiminnastaan

edes sen jälkeen, kun tila on jossakin todettu.

Lähes 3 000 munuaisten vajaatoimintapotilaan tutkimuksessa

lievää vajaatoimintaa sairastavista vain

5 prosenttia ja vaikeaa vajaatoimintaa sairastavista

40 prosenttia oli selvillä vajaatoiminnastaan (Plantinga

ym. 2008). Edes kliinisten löydösten (mm. albuminuria,

hyperkalemia, hyperfosfatemia, anemia)

olemassaolo ei näytä parantavan tilannetta olennaisesti.

Vaikka potilailla oli 2–4 vajaatoimintaan liittyvää

löydöstä, 90 prosenttia ei tiennyt siitä (Tuot ym.

2011). Sairaalaan joutuneista amerikkalaisista potilaista,

joilla oli munuaisten vajaatoiminta, vain kolmannes

osasi kertoa, että heillä on ’munuaisongelmia’.

Vaikeaa vajaatoimintaa sairastavista 48 prosenttia

tiesi tästä ongelmastaan (Saunders MR ym. 2015).

Tilanne ei näytä paremmalta eurooppalaisissakaan

tutkimuksissa. Saksalaisista vähintään keskivaikeaa

munuaisten vajaatoimintaa sairastavista henkilöistä

vajaa kolmannes (28 %) oli tietoinen vajaatoiminnastaan

(Girndt ym. 2016).

Munuaisten vajaatoimintaan liittyviä

tavallisia ongelmalääkkeitä

Verenpainelääkkeet

Angiotensiiniä konvertoivan entsyymin estäjät

(ACE:n estäjät) ja angiotensiinireseptorin (AT-reseptorin)

salpaajat ovat hyödyllisiä verenpainelääkkeitä

diabetesta ja varhaista munuaistautia sairastavien verenpaineen

hoidossa, mutta ne voivat etenkin suurina

annoksina myös aiheuttaa munuaisten vajaatoiminnan

pahenemista. Vaara on suurin potilailla, joilla

on myös sydämen vajaatoiminta tai jotka käyttävät

samanaikaisesti diureetteja tai tulehduskipulääkkeitä

(Dreischulte ym. 2015). Mitä vaikeampi munuaisten

tai sydämen vajaatoiminta, sitä varovaisemmin hoito

on aloitettava ja munuaisten toimintaa on seurattava

tiheästi. Hypovolemia esimerkiksi oksentelun tai

ripulin yhteydessä voi romahduttaa munuaisten toiminnan

potilaalla, joka tavallisesti sietää hyvin ACE:n

estäjää tai AT-reseptorin salpaajaa (Ahmed ym. 2016).

Hydroklooritiatsidi eliminoituu lähes täysin virtsaan,

ja sen puoliintumisaika pitenee huomattavasti

munuaisten vajaatoiminnassa, joten sen ylläpitoannoksia

täytyy pienentää, ja munuaisten toimintaa

ja elektrolyyttitasapainoa on seurattava tarkoin. Vaikeassa

munuaisten vajaatoiminnassa tiatsidin teho

heikkenee.

Opioidit

Useimmat opioidit, muun muassa morfiini, tramadoli,

kodeiini, petidiini ja metadoni kumuloituvat

munuaisten vajaatoiminnassa ja aiheuttavat muun

muassa sekavuutta ja muita keskushermostoperäisiä

haittavaikutuksia käyttäjille, ellei annosta soviteta

glomerulussuodoksen mukaan. Morfiinin ja kodeiinin

epävarman kinetiikan ja kumuloituvien toksisten

metaboliittien vuoksi niitä, samoin kuin pitkävaikutteista

tramadolia, pitäisi käyttää erittäin varoen munuaispotilailla,

ja niiden käyttöä olisi viisainta välttää

kokonaan viimeistään keskivaikeassa vajaatoiminnassa

(Mercandante & Arcuri 2004, Lee ym. 2016).

Tulehduskipulääkkeet

Tulehduskipulääkkeet eivät ole suositeltavia munuaispotilaille.

Viimeistään vaikeaa vajaatoimintaa sairastaville

pitäisi löytää turvallisempia kivun hoidon

vaihtoehtoja, kuten paikallisesti käytettävät tulehduskipulääkegeelit

tai parasetamoli. Erityisen haitallista

on tulehduskipulääkkeiden käyttäminen samanaikaisesti

reniini-angiotensiinijärjestelmän estäjien

kanssa.

Tulehduskipulääkkeet vähentävät glomerulusfiltraatiota,

mutta nuorilla ja terveillä vaikutus on tavallisesti

vähäinen ja ohimenevä. Ne voivat kuitenkin

aiheuttaa myös vakavaa, jopa pysyvää munuaisvauriota,

ja akuutin munuaisten vajaatoiminnan riski

on tulehduskipulääkkeiden käyttäjillä tutkimuksesta

riippuen kaksin-kolmikertainen verrattuna ei-käyttäjiin;

munuaisten vajaatoimintaa sairastavilla jopa

viisinkertainen (Huerta ym. 2005, Zhang ym. 2017).

Muita haittoja ovat natriumin ja kaliumin erittymisen

väheneminen munuaisissa, mikä voi johtaa ve-

© DOSIS n:0 4/2018 298

© Suomen Farmasialiitto ry


enpaineen kohoamiseen ja turvotuksiin. Koksibien

munuaisvaikutukset ovat samanlaisia kuin epäselektiivisillä

tulehduskipulääkkeillä (Swan ym. 2000).

Lievässä vajaatoiminnassa lyhytaikainen tulehduskipulääkkeen

käyttö on yleensä haitatonta, ainakin

jos käyttäjällä ei ole nestevajausta tai sydämen vajaatoimintaa.

Pitkäaikaisessa käytössä munuaisten

toimintaa pitäisi seurata. Iäkkäillä jopa mini-ASAannos

voi heikentää munuaisten toimintaa. (Segal

ym. 2006).

Muistetaanko munuaiset lääkehoidossa?

Ranskassa tehtiin kolmen kaupungin asukkaille laaja

terveystutkimus, jossa mitattiin myös munuaisten

toiminta ja selvitettiin lääkehistoria. Kaikkiaan yli 10

prosenttia väestöstä käytti lääkettä, jonka annostusta

olisi pitänyt muuttaa munuaisten vajaatoiminnan takia.

Aineistossa oli noin 8 000 yli 65-vuotiasta, joista

noin 1 200:lla GFR oli alle 60 ml/min, eli heillä oli vähintään

keskivaikea munuaisten vajaatoiminta. Lievää

tai keskivaikeaa vajaatoimintaa sairastavista henkilöistä

puolella oli munuaisten kannalta sopimaton

lääke tai lääkkeen annos, vaikeaa vajaatoimintaa sairastavista

lähes kaikilla (96 %; vasta-aiheinen lääke

oli 48 %:lla) (Breton ym. 2011).

Yli 65-vuotiaista vaikeaa munuaisten vajaatoimintaa

sairastavista amerikkalaisista veteraaneista kolmanneksella

oli vähintään yksi munuaisten vajaatoiminnan

kannalta sopimaton lääke tai väärä annos.

Ranitidiini, allopurinoli ja metformiini ja gemfibrotsiili

kuuluivat yleisimpiin näistä lääkkeistä (Chang

ym. 2015).

Lääkkeiden sopivuuden tarkistaminen ei onnistu

aina edes iäkkäiden hoitolaitoksissa. Saksalaisessa

tutkimuksessa 21 hoitokodin 852 vanhuspotilaasta liki

puolella (48,2 %) oli keskivaikea ja 15,5 prosentilla

vaikea munuaisten vajaatoiminta; tieto munuaisten

toiminnasta puuttui 20 prosentilta asukeista. Noin

puolet hoitolaitoksissa käytetyistä lääkkeistä edellytti

annoksen muutosta tai oli vasta-aiheisia munuaisten

vajaatoiminnassa. Kaikista potilaista joka viides

käytti vakituisesti lääkettä, joka oli vasta-aiheinen tai

jonka annos oli väärä. Yleisimpiä epäsopivia lääkkeitä

olivat metformiini, ramipriili ja kalium (Hoffmann

ym. 2016).

Myös tuore australialaistutkimus osoitti, että munuaisten

vajaatoiminta jää usein huomiotta ja lääkitys

sovittamatta. Retrospektiivisesti tutkittiin noin 30

000:n yli 65-vuotiaan potilaan tiedot, joista kävi ilmi,

että dokumentoitua tietoa munuaisten toiminnasta

löytyi vain 25 prosentilta potilaista (n = 7 625). Näistä

potilaista yli puolelle oli määrätty vähintään yhtä

tutkituista 31:stä munuaisten kautta eliminoituvasta

lääkkeestä, ja edelleen, heistä vajaalle kolmannekselle

annoksella, joka ei ollut asianmukaisesti sovitettu

munuaisten toiminnan mukaan. Tavallisimpia ongelmalääkkeitä

olivat diabeteslääkkeet, bisfosfonaatit

ja reniini-angiotensiinijärjestelmää estävät lääkkeet

(Khanal ym. 2015).

Pohjois-Ruotsissa käytiin läpi 428:n yli 65-vuotiaan

sairaalaan otetun potilaan sairaus- ja lääkehistoria,

jossa kiinnitettiin huomiota erityisesti munuaisten

kautta erittyviin lääkkeisiin. Munuaisten toiminta oli

heikentynyt (alle 60 ml/min) 65,4 prosentilla otoksesta.

Epäsopivia lääkityksiä oli vähemmän kuin saksalaisissa

tutkimuksissa: noin 10 prosentilla potilaista

munuaisten toiminnan edellyttämää muutosta ei ollut

huomioitu (Sönnerstam ym. 2016).

Seuraamuksia munuaisten unohtamisesta

Krooninen munuaisten vajaatoiminta vaikuttaa

useimpien lääkkeiden eliminaatioon. Mitä suurempi

osuus lääkkeen eliminaatiosta tapahtuu munuaisten

kautta, sitä enemmän munuaistoiminnan heikkeneminen

pidentää lääkkeen puoliintumisaikaa ja

lisää lääkkeen kumuloitumisen vaaraa.

Jos annosta ei soviteta munuaisten toiminnan mukaan,

tuloksena on useimmiten lääkkeelle ominaisten

haittavaikutusten lisääntyminen, mutta joskus

myös lääkkeen tehon heikkeneminen; muun muassa

hydroklooritiatsidin ja nitrofurantoiinin teho heikkenee

vaikeassa munuaisten kroonisessa vajaatoiminnassa.

Lääkkeen toksisten metaboliittien kumuloituminen

voi tuottaa lääkkeen tavallisista haitoista

poikkeavia ongelmia. Munuaisten vajaatoimintaan

voi lisäksi liittyä lääkkeitä metaboloivien entsyymien,

kuljetinproteiinien tai lääkkeiden proteiineihin

sitoutumisen muutoksia. Nämä tekijät voivat muuttaa

myös muiden kuin pääosin munuaisten kautta

poistuvien lääkkeiden eliminaatiota. Loppuvaiheen

vajaatoiminnassa dialyysi voi edellyttää uusia lääkeannosten

muutoksia.

Norjalaisessa tutkimuksessa selvitettiin munuaisten

kannalta riskin aiheuttavien lääkkeiden käytön

yleisyyttä ja niihin liittyviä ongelmia viiteen sairaalaan

otetuilla potilailla (n= 808). Potilaista 201:llä oli

vähintään keskivaikea munuaisten vajaatoiminta, ja

heistä 62 prosentilla oli vasta-aiheisesta tai väärällä

annoksella annetusta lääkkeestä johtuva haittavaikutus.

Yleisimpiä riskilääkkeitä olivat ACE:n estäjät,

opioidit, tulehduskipulääkkeet, antitromboottiset

lääkkeet ja mikrobilääkkeet (Blix ym. 2006).

© Suomen Farmasialiitto ry 299

© DOSIS n:0 4/2018


Amerikkalaisessa tutkimuksessa käytiin läpi kuuteen

sairaalaan otetun 110 000 potilaan munuaisten

toiminta ja munuaisten kautta eliminoituvien

tai munuaistoksisten lääkkeiden käyttö. Noin 18 000

potilaalla oli munuaisten vajaatoiminta, ja heistä valittiin

satunnaisesti 900 henkilöä, joiden mahdolliset

lääkehaitat käytiin läpi. Heistä 498 oli altistunut

lääkkeelle, joka olisi voinut aiheuttaa haittaa, ja

90:llä todettiin lääkkeestä aiheutunut haittavaikutus.

Haittavaikutuksista 91 prosenttia olisi ollut estettävissä

tarkistamalla munuaisten toiminnan edellyttämä

annos. Huomattavaa on, että haittavaikutuksista

51 prosenttia oli vakavia, 44 prosenttia merkittäviä

ja 4,5 prosenttia henkeä uhkaavia (Hug ym.

2009).

Vuonna 2016 julkaistussa tutkimuksessa todettiin

500 000 kanadalaisen aikuispotilaan aineistosta, että

kroonista munuaisten vajaatoimintaa sairastavan

potilaan riski saada sairaalahoidon aikainen komplikaatio

oli kaksinkertainen verrattuna munuaisten

suhteen terveisiin potilaisiin. Vaikeaa vajaatoimintaa

sairastavilla riski oli 80 prosenttia suurempi. Yhtenä

syynä tähän pidettiin sitä, että munuaisten vajaatoimintaa

ja sen edellyttämiä lääkityksen muutoksia ei

ollut huomioitu riittävästi (Bohlouli 2016).

Vaikka tulehduskipulääkkeiden haitallisuus munuaisille

tunnetaan hyvin, niitä kuitenkin käytetään

yleisesti. Amerikkalaisen ja australialaisen tutkimuksen

mukaan vähintään vaikeaa kroonista munuaisten

vajaatoimintaa sairastavista henkilöistä yli 15 prosentille

oli määrätty tulehduskipulääkkeitä, englantilaisessa

tutkimuksessa yli 11 prosentille (Patel ym. 2012,

Hull ym. 2014, Adams ym. 2011).

Saksassa tutkittiin noin 700:aa hoitokodeissa olevaa

iäkästä henkilöä, joista 15 prosentilla oli vaikea

munuaisten vajaatoiminta (GFR alle 30 ml/min). Kaikista

tutkituista 20 prosenttia oli hoidettu vähintään

yhdellä tulehduskipulääkkeellä. Myös vaikeaa vajaatoimintaa

sairastavilla luku oli 21 prosenttia huolimatta

siitä, että käyttö oli myös valmisteyhteenvetojen

mukaan vasta-aiheista (Dörks ym. 2016).

Munuaisten vajaatoiminnan

pahenemisen ehkäisy

Vajaatoiminnan havaitsemiseksi GFR olisi hyvä määrittää

aina kun potilaan kreatiniiniarvo on koholla sekä

yli 65-vuotiaiden lääkitystä aloitettaessa. Kun munuaisten

toiminta on heikentynyt, on tärkeää yrittää

estää taudin eteneminen ja välttää vajaatoimintaan

liittyviä komplikaatioita. Tähän pyritään muun muassa

verenpaineen ja diabeteksen hyvällä hoidolla,

kalsium–fosforitasapainon seuraamisella ja anemian

korjaamisella.

Akuuttia munuaisten lisävauriota voivat aiheuttaa

kuivuminen esimerkiksi oksentelun, ripulin tai

fyysisen rasituksen yhteydessä, sekä munuaistoksiset

lääkkeet. Iäkkäillä vajaatoiminnan pahenemisen riski

on suurentunut paitsi ikään liittyvän munuaisten

toiminnan heikkenemisen myös monien sairauksien,

kuten diabeteksen ja sydämen vajaatoiminnan sekä

monilääkityksen myötä.

Munuaisten kautta eliminoituvien lääkkeiden

kohdalla on tarkistettava annoksen muutoksen tarve

ja sovitettava se munuaisten toiminnan ja potilaan

vasteen mukaan. Joskus voi olla tarpeen seurata lääkkeen

pitoisuuksia seerumissa. Munuaissairailla pitää

kiinnittää huomiota myös itsehoitolääkkeiden, erityisesti

tulehduskipulääkkeiden, käyttöön.

Lääketieto munuaisista Terveysportissa

Kaikkia asioita ei onneksi tarvitse muistaa itse. Terveysportissa

olevassa Lääkkeet ja munuaiset -tietokannassa

(renbase © ) on GFR-laskuri, jonka avulla voi

arvioida munuaisten toiminnan, jos tiedetään potilaan

sukupuoli, kreatiniiniarvo ja ikä. Tietokannasta

löytyvät kaikkien Suomessa kaupan olevien lääkkeiden

annossuositukset munuaisten vajaatoiminnan

eri asteissa, myös dialyysipotilaalle, jos kyseistä

tietoa on kirjallisuudessa löydettävissä. Lisäksi tietokannasta

löytyy satojen erityisluvalla käytettävien

lääkeaineiden annostiedot kroonisessa munuaisten

vajaatoiminnassa. Annossuositusten lisäksi tietokannassa

on myös muuta munuaisten kannalta oleellista

tietoa, esimerkiksi tieto lääkkeen munuaistoksisuudesta

tai lääkkeen turvallisen käytön edellyttämästä

seurannasta.

JOHTOPÄÄTÖKSET

Munuaisten kroonisen vajaatoiminnan havaitsemiseksi

GFR-arvo olisi hyvä määrittää yli 65-vuotiailta

lääkitystä aloitettaessa. Jos vajaatoimintaa havaitaan,

niin sitä tulisi myös seurata säännöllisesti.

Näin ei valitettavasti vielä aina tehdä. Toivommekin,

että farmasian ammattilaiset voisivat omalta

osaltaan olla edistämässä tietoisuuden lisääntymistä

tästä asiasta muissakin tilanteissa kuin lääkehoidon

arviointien yhteydessä.

© DOSIS n:0 4/2018 300

© Suomen Farmasialiitto ry


SUMMARY

Renal failure – an unnoticed

problem in drug therapy?

➔ Pirkko Paakkari*

MD, PhD, Medical Expert

Duodecim Medical Publications LTD

pirkko.paakkari@duodecim.fi

➔ Marja Forsell

MA, Managing Editor

Duodecim Medical Publications LTD

*Correspondence

Renal failure becomes more common with age but

remains unnoticed too often. Studies in USA and

Europe revealed that only a fraction of people were

aware of their renal failure. Negligence of renal failure

when planning patient's medical treatment often

leads to adverse drug reactions, and sometimes also

to reduced efficacy of the drug.

Common drug classes that call for checking the

dosage at least for patients with severe renal failure

include antihypertensives (especially ACE inhibitors),

opioids and anti-inflammatory analgesics. The patients

with severe renal failure should not use anti-inflammatory

analgesics. Topical analgesics and

paracetamol are safer non-prescription alternatives

for them.

In order to detect renal failure, glomerular filtration

rate (GFR) should be determined whenever patient's

creatine level is elevated, or new medication is

prescribed for a patient over 65 years old. In patients

with kidney failure it is essential to prevent progression

of the disease and complications.

The Renbase © database includes a GFR calculator.

From the database, GFR dependent dose recommendations

can be found for the licensed drugs in Finland

as well as dosage recommendations for many

drugs with special permission for compassionate use.

Key words: kidneys, renal failure, antihypertensive

drugs, opioids, non-steroidal anti-inflammatory drugs

© Suomen Farmasialiitto ry 301

© DOSIS n:0 4/2018


KIRJALLISUUS

Adams RJ, Appleton SL, Gill TK, Taylor AW, Wilson

DH, Hill CL: Cause for concern in the use of nonsteroidal

anti-inflammatory medications in the

community – a population-based study. BMC

Family Practise 12: 70, 2011

Ahmed A, Jorna T, Bhandari S: Should we STOP

Angiotensin Converting Enzyme Inhibitors/

Angiotensin Receptor Blockers in advanced

kidney disease? Nephron 133: 147–58, 2016

Blix HS, Viktil KK, Moger TA, Reikvam A: Use

of renal risk drugs in hospitalized patients with

impaired renal function – an underestimated

problem? Nephrol Dial Transplant 21:

3164–3171, 2006

Bohlouli B, Tonelli M, Jackson T, Hemmelgam

B, Klarenbach S: Risk of hospital-aquired

complications in patients with chronic kidney

disease. Clin J Am Soc Nephrol 11: 956–963,

2016

Breton G, Froissart M, Janus N ym.: Inappropriate

drug use and mortality in community-dwelling

elderly with impaired kidney function – the

Three-City population-based study. Nephrol Dial

Transplant 26: 2852–2859, 2011

Chang F, O’Hare AM, Miao Y, Steinman MA:

Use of renally inappropriate medications in older

veterans: A national study. J Am Geriatr Soc 63:

2290–2297, 2015

Dreischulte T, Morales DR, Bell S: Combined

use of nonsteroidal anti-inflammatory drugs

with diuretics and/or renin-angiotensin system

inhibitors in the community increases the risk of

acute kidney injury. Kidney Int 88: 396–403, 2015

Dörks M, Herget-Rosenthal S, Scmiemann,

Hoffmann F: Use of nonsteroidal antiinflammatory

drugs and renal failure in

nursing home residents-results of the study

"Inappropriate medication in patients with renal

insufficiency in nursing homes". Wien Klin

Wochenschr 128: 287–290, 2016

Eckardt KU, Coresh J, Devuyst O ym.:

Evolving importance of kidney disease:

from subspecialty to global health burden.

Lancet 382: 158–169, 2013

Girndt M, Trocchi P, Scheidt-Nave C, Markau

S, Stang A: The prevalence of renal failure

– results from the German Health Interview

and Examination Survey for Adults, 2008-2011

(DEGS1) Dtsch Arztebl Int 113: 85–91, 2016

Hill NR, Fatoba ST, Oke JL, hirst JA, O´Callaghan

CA, Lasserson DS: Global prevalence of chronic

kidney disease – A systematic review and metaaAnalysis.

PLoS One 11(7), 2016

Hoffmann F, Boeschen D, Dörks M ym.: Renal

insufficiency and medication in nursing home

residents—a cross-sectional study (IMREN) Dtsch

Arztebl Int 113: 92–98, 2016

Huerta C, Castellsague J, Varas-Lorenzo

C, Garcia rodriguez LA: Nonsteroidal antiinflammatory

drugs and risk of ARF in the general

population. Am J Kidney Dis 45: 531–539, 2005

Hug BL, Witkowski DJ, Sox CM

ym.: Occurrence of adverse,

often preventable, events in community

hospitals involving nephrotoxic drugs or those

excreted by the kidney. Kidney Int 76:

1192–1198, 2009

Hull S, Mathur R, Dreyer G ym.: Evaluating ethnic

differences in the prescription of NSAIDs for

chronic kidney disease: a cross-sectional survey

of patients in general practice. Br J Gen Pract

64(624):e448-e455, 2014

Khanal A, Peterson GM, Castelino RL, Jose MD:

Potentially inappropriate prescribing of renally

cleared drugs in elderly patients in community

and aged care settings. Drugs Aging 32:

391–400, 2015

Lee KA, Ganta N, Horton JR, Chai E: Evidence for

neurotoxicity due to morphine or hydromorphone

use in renal impairment: A systematic review. J

Palliat Med Nov 19: 1179–1187, 2016

Mercandante S, Arcuri E. Opioids and renal

function. J Pain 5: 2–19, 2004

Patel K, Diamantidis C, Zhan M: The influence of

creatinine versus GFR on NSAID prescriptions in

CKD. Am J Nephrol 36: 19–26, 2012

© DOSIS n:0 4/2018 302

© Suomen Farmasialiitto ry


Plantinga LC, Boulware LE, Coresh J ym.: Patient

awareness of chronic kidney disease: trends and

predictors. Arch Intern Med 168: 2268–2275,

2008

Rao MK, Morris CD, O’Malley JP, davis MM, Mori

M, Anderson S: Documentation and management

of CKD in rural primary care. Clin J Am Soc

Nephrol 8: 739–748, 2013

Saunders MR, Kim SD, Patel N, Meltzer DO, Chin

MH: Hospitalized Patients Frequently Unaware

of Their Chronic Kidney Disease J Hosp Med 10:

619–622, 2015

Segal R, Lubart E, Leibovitz A, Iaina A, Caspi

D: Renal effects of low dose aspirin in elderly

patients. Isr Med Assoc J 8: 679–682, 2006

Swan SK, Rudy DW, Lasseter KC ym.: Effect of

cyclo-oxygenase-2 inhibition on renal function

in elderly persons receiving a low-salt diet. Ann

Intern Med 133:1–9, 2000

Sönnerstam E, Sjölander M, Gustafsson M:

Inappropriate prescription and renal function

among older patients with cognitive impairment.

Drugs Aging 33: 889–899, 2016

Tuot DS, Plantinga LC, Hsu CY ym.: Chronic

kidney disease awareness among individuals

with clinical markers of kidney dysfunction. Clin J

Am Soc Nephrol 6: 1838–1844, 2011

Zhang X, Donnan PT, Bell S, Guthrie D: Nonsteroidal

anti-inflammatory drug induced acute

kidney injury in the community dwelling general

population and people with chronic kidney

disease: systematic review and meta-analysis.

MC Nephrol 18: 256, 2017

© Suomen Farmasialiitto ry 303

© DOSIS n:0 4/2018


Lääkkeiden saatavuus

ja saavutettavuus –

lääkkeiden saatavuusongelmat

Suomessa ja harvinaislääkkeiden

saavutettavuus Euroopassa

➔ Kati Sarnola

Tutkija, FaT, LHA

Lääkealan turvallisuus- ja

kehittämiskeskus Fimea

kati.sarnola@fimea.fi

Proviisori Kati Sarnolan sosiaalifarmasian oppiaineeseen kuulunut väitöskirja ”Lääkkeiden saatavuus ja saavutettavuus,

Tutkimus lääkkeiden saatavuusongelmista Suomessa ja harvinaislääkkeiden saavutettavuudesta

Euroopassa” (Availability and accessibility of medicines, A study of medicine shortages in Finland and accessibility

of orphan medicines in Europe) tarkastettiin Itä-Suomen yliopistossa terveystieteiden tiedekunnassa

17.8.2018. Vastaväittäjänä toimi professori Erkki Palva ja tilaisuuden valvojana Johanna Timonen Itä-Suomen

yliopistosta. Väitöskirja on luettavissa kokonaisuudessaan Itä-Suomen yliopiston UEF Electronic Publications

-palvelussa: http://epublications.uef.fi/index.php

Väitöskirja perustuu seuraaviin julkaisuihin:

• Heiskanen K, Ahonen R, Karttunen P, Kanerva R, Timonen J:

Medicine shortages – A study of community pharmacies in Finland. Health Pol 119: 232–238, 2015

• Heiskanen K, Ahonen R, Kanerva R, Karttunen P, Timonen J:

The reasons behind medicine shortages from the perspective of pharmaceutical companies

and pharmaceutical wholesalers in Finland. PLoS One 12(6): e0179479, 2017

• Sarnola K, Ahonen R, Martikainen JE, Timonen J:

Policies and availability of orphan medicines in outpatient care in 24 European countries.

Eur J Clin Pharmacol 74(7): 895–902, 2018

© DOSIS n:0 4/2018 304

© Suomen Farmasialiitto ry


TIIVISTELMÄ

Johdanto: Lääkkeiden hyvä saatavuus on viime aikoina noussut kansainväliseen keskusteluun. Tutkimuksessa

selvitettiin lääkkeiden saatavuusongelmien yleisyyttä, syitä ja vaikutuksia suomalaisille apteekeille sekä

saatavuusongelmien syitä lääkeyritysten ja lääketukkukauppojen näkökulmasta Suomessa. Lisäksi selvitettiin,

onko harvinaislääkkeille käytössä erillistä hinta- tai korvattavuussääntelyä, sekä tutkittiin kymmenen

harvinaislääkkeen saatavuutta, jakelukanavia ja potilaan omavastuukäytäntöä avohoidossa Euroopassa.

Aineistot ja menetelmät: Lääkkeiden saatavuusongelmien yleisyyttä, syitä ja vaikutuksia tutkittiin 129 suomalaisen

apteekin (66 %, n=195) raportoinneista. Saatavuusongelmien syitä selvitettiin lisäksi haastattelututkimuksella

Suomessa toimivien lääkeyritysten ja lääketukkukauppojen edustajille (n=30). Harvinaislääkkeiden

saavutettavuutta tutkittiin viranomaiskyselyllä 24:ssä Euroopan maassa.

Tulokset: Lähes 80 prosentilla apteekeista oli saatavuusongelmia päivittäin tai lähes päivittäin. Saatavuusongelmien

syy oli tiedossa apteekeille 11 prosentissa saatavuuskatkostapauksista. Kolmasosa tapauksista aiheutti

ongelmia apteekeille. Lääkkeiden saatavuusongelmien syynä olivat tavallisimmin Suomen lääkemarkkinoiden

pieni koko (n=29) ja äkilliset kysynnän muutokset (n=28). Suurimmassa osassa Euroopan maista ei ollut

erillistä hinta- (n=20) tai korvattavuussääntelyä (n=22) harvinaislääkkeille. Kymmenestä harvinaislääkkeestä

keskimäärin viisi oli saatavilla. Lääkkeet toimitettiin yleisimmin apteekeista. Apteekeista toimitetuista lääkkeistä

potilaat maksoivat yleensä osan lääkkeen hinnasta itse. Muista terveydenhuollon yksiköistä potilaat

saivat lääkkeet yleensä veloituksetta.

Johtopäätökset: Lääkkeiden saatavuusongelmat ovat yleisiä suomalaisille apteekeille. Valtaosa saatavuuskatkostapauksista

ei aiheuta ongelmia apteekeille. Lääkkeiden saatavuusongelmien taustalta löytyi tyypillisemmin

tarjonnasta kuin kysynnästä johtuvia syitä. Suurimmassa osassa Euroopan maista ei ole erillistä sääntelyä

päätettäessä harvinaislääkkeiden hinnasta tai korvattavuudesta. Kymmenen tutkimuksessa tarkastellun

harvinaislääkkeen saatavuus, jakelukanavat ja potilaan omavastuukäytäntö vaihtelevat maittain.

Avainsanat: lääkkeet; saatavuus; saavutettavuus; puutteet; harvinaiset taudit; lääkepolitiikka; kyselytutkimus;

haastattelututkimus

© Suomen Farmasialiitto ry 305

© DOSIS n:0 4/2018


JOHDANTO

Lääkkeiden hyvän saatavuuden turvaaminen on viime

vuosina noussut kansainväliseen keskusteluun,

sillä potilaat eivät aina saa tarvitsemiaan lääkkeitä

käyttöönsä. Lääke on potilaan saatavilla, kun se on

olemassa, sille on myönnetty myyntilupa ja se on tuotu

markkinoille (Thieren 2005, Habl ja Bachner 2011).

Lääkkeen saatavuusongelmalla tarkoitetaan hankintaongelmaa,

joka vaikuttaa potilaan hoitoon ja jonka

johdosta tavanomaisia hankinta- ja toimintatapoja

joudutaan muuttamaan (Besançon ja Chaar 2013).

Kansainvälisten tutkimusten mukaan lääkkeiden

saatavuusongelmat ovat sairaaloissa yleisiä ja niiden

määrä on kasvussa (Claus ym. 2015). Saatavuusongelmia

esiintyy yleisesti käytetyissä lääkeryhmissä, kuten

keskushermostoon vaikuttavissa lääkkeissä ja infektiolääkkeissä.

Avohoidossa lääkkeiden saatavuusongelmien

yleisyydestä ja lääkeryhmistä, joita ongelmat

koskettavat, on vain vähän tietoa, sillä aiheesta

on julkaistu vasta yksittäisiä tutkimuksia (esim. Canadian

Pharmacists’ Association 2010).

Lääkkeiden saatavuusongelmien tiedetään vaikuttavan

negatiivisesti esimerkiksi potilaiden hoitoon ja

terveydenhuollon ammattilaisten työhön (McLaughlin

ym. 2013, Tan ym. 2016). Saatavuusongelmat aiheuttavat

esimerkiksi lääkehoidon ja leikkauksien

viivästymistä ja lisäävät terveydenhuollon ammattilaisten

työtaakkaa. Saatavuusongelmat lisäävät myös

terveydenhuollon kustannuksia, sillä niiden vuoksi

voidaan joutua valitsemaan lääkehoito, joka on alkuperäistä

hoitoa kalliimpi (Kaakeh ym. 2011). Vaikka

saatavuusongelmien haitalliset vaikutukset tunnetaan,

niiden taustalla olevat syyt ovat harvoin tiedossa

(Hawley ym. 2016). Ongelmien taustalla voivat olla

esimerkiksi tuotannolliset syyt, raaka-ainepuutokset

tai kysynnän muutokset (Claus ym. 2015, Hawley

ym. 2016).

Lääkkeiden hyvän saatavuuden turvaaminen voi

olla erityinen haaste tietyille potilasryhmille, kuten

harvinaissairauksia sairastaville potilaille. Harvinaissairaudet

ovat hengenvaarallisia tai kroonisesti invalidisoivia

sairauksia, joita sairastaa Euroopan unionin

alueella enintään viisi potilasta 10 000 asukasta kohti

(European Commission 2000). Harvinaissairauksia

sairastavia potilaita on Euroopassa noin 30 miljoonaa

ja Suomessa yli 300 000 (Penttilä 2016). Harvinaislääkkeet

ovat näiden sairauksien hoitoon, ennaltaehkäisyyn

tai diagnosointiin tarkoitettuja lääkkeitä

(European Medicines Agency 2017).

Markkinoille tuotujen harvinaislääkkeiden määrä

oli vähäinen vielä 2000-luvun alkupuolella (Tiwari

2015). Euroopassa vuonna 2000 käyttöönotettu harvinaislääkeasetus

on vauhdittanut harvinaislääkkeiden

kehittämistä, ja harvinaislääkestatuksen ja myyntiluvan

saaneiden harvinaislääkkeiden määrä on lisääntynyt

merkittävästi (European Medicines Agency

2018). Harvinaislääkkeiden kustannukset potilaille

ja yhteiskunnalle ovat kuitenkin korkeat (Gammie

ym. 2015). Esimerkiksi vuosina 2002–2010 markkinoille

tuotujen harvinaislääkkeiden keskimääräiset

kustannukset potilasta kohden olivat yli 32 000 euroa

vuodessa (Schey ym. 2011). Lääkkeen korkea hinta

ja korvattavuuden puuttuminen heikentävät lääkkeiden

saavutettavuutta eli potilaan mahdollisuuksia

hankkia lääke ilman hallinnollisia tai taloudellisia esteitä

(WHO Collaborating Centre for Pharmaceutical

Pricing and Reimbursement Policies 2018).

Tässä tutkimuksessa selvitettiin lääkkeiden saatavuusongelmien

yleisyyttä, syitä ja vaikutuksia suomalaisille

apteekeille sekä saatavuusongelmien syitä

lääkeyritysten ja lääketukkukauppojen näkökulmasta

Suomessa. Lisäksi selvitettiin, onko harvinaislääkkeille

käytössä erillistä hinta- tai korvattavuussääntelyä,

sekä tutkittiin kymmenen harvinaislääkkeen saatavuutta,

jakelukanavia ja potilaan omavastuukäytäntöä

avohoidossa Euroopassa.

AINEISTOT JA MENETELMÄT

Tutkimus apteekeille

Apteekit raportoivat tilauksistaan saamatta jääneet

lääkkeet sekä saatavuusongelmien syyt ja vaikutukset

apteekille lähes kuukauden mittaisen seurantajakson

aikana syys–lokakuussa 2013. Tutkimukseen

kutsutut yksityiset apteekit (n=194) valittiin satunnaisotannalla

Suomen Apteekkariliiton jäsenrekisteristä

niin, että ne edustivat kolmasosaa jäsenrekisterin

apteekeista. Tutkimukseen kutsuttiin lisäksi yksi

yliopiston apteekin toimipiste. Aineisto analysoitiin

kuvailevalla analyysilla käyttäen suoria jakaumia ja

ristiintaulukointia (IBM SPSS Statistics 21.0).

Tutkimus lääkeyritysten ja

lääketukkukauppojen edustajille

Haastattelututkimus Suomessa toimivien lääkeyritysten

ja lääketukkukauppojen edustajille toteutettiin

maalis–kesäkuussa 2016. Tutkimukseen kutsuttiin

41 toimijaa; lääkeyrityksistä Lääketeollisuus ry:n

(n=30) ja Rinnakkaislääketeollisuus ry:n jäsenyritykset

(n=7) sekä lääkeyritys, joka on merkittävä toimija

Suomen lääkemarkkinoilla, mutta joka ei kuulu edellä

mainittuihin etujärjestöihin. Lääketukkukaupoista

tutkimukseen kutsuttiin ne, joilla on koko maan kat-

© DOSIS n:0 4/2018 306

© Suomen Farmasialiitto ry


tava jakeluverkosto (n=3). Haastattelut toteutettiin

puolistrukturoituina puhelinhaastatteluina. Haastattelujen

riittävä määrä varmistettiin saturaatiolla

(Hennink ym. 2016). Haastattelut nauhoitettiin haastateltavien

suostumuksella ja litteroitiin sanatarkasti.

Aineisto analysoitiin teemoittelemalla (Microsoft

Office 2016 Word) (Hirsjärvi ja Hurme 2014, s. 173).

Saatavuusongelmien syiden tyypillisyyden selvittämiseen

käytettiin laskemista ja taulukointia (Hirsjärvi

ja Hurme 2014, s. 172).

Tutkimus lääkkeiden hinta- ja

korvattavuusviranomaisille

Sähköinen kysely Pharmaceutical Pricing and Reimbursement

Information (PPRI) -verkostoon kuuluville

lääkkeiden hinta- ja korvattavuusviranomaisille

46 maassa lähetettiin huhtikuussa 2016. Kysely sisälsi

kysymyksiä harvinaislääkkeiden hinnoitteluja

korvattavuuspäätöksiin liittyvistä säännöksistä

sekä kysymyksiä kymmenen harvinaislääkkeen

saatavuudesta, jakelukanavista ja potilaan omavastuukäytännöstä.

Tutkimukseen valituilla harvinaislääkkeillä

(Taulukko 1) oli keskitetty myyntilupa ja

harvinaislääkestatus. Lääkkeet poimittiin Euroopan

lääkeviraston julkisten arviointiraporttien rekisteristä

(EPAR) myyntiluvan myöntämispäivämäärän

mukaisessa takautuvassa järjestyksessä vuoden

2013 lopusta. Vuosi 2013 valittiin myöhäisimmäksi

myyntiluvan myöntämisajankohdaksi, jotta lääkkeiden

hintataso ja korvattavuuskäytännöt olisivat

tutkimushetkellä vakiintuneet. Tutkimus keskittyi

avohoidossa käytettäviin harvinaislääkkeisiin ja näin

ollen injektiot ja infuusiot rajattiin tutkimuksen ulkopuolelle.

Aineisto analysoitiin kuvailevalla analyysilla

käyttäen suoria jakaumia (IBM SPSS Statistics

23.0). Aineiston säännönmukaisuuksien tunnistamiseen

käytettiin lisäksi taulukointia (Microsoft Office

2016 Excel).

TULOKSET

Tutkimus apteekeille

Tutkimukseen osallistui 129 apteekkia (66 % kutsutuista),

jotka edustivat reseptuuriltaan ja sijainniltaan

hyvin kaikkia Suomen apteekkeja. Aineisto koostui

3 311 raportointilomakkeesta.

Seurantajakson aikana lähes 80 prosentilla apteekeista

oli saatavuusongelmia päivittäin tai lähes

päivittäin. Lääkkeiden saatavuusongelmia oli yleisimmin

keskushermostoon vaikuttavissa lääkkeissä

(31 %) ja sydän- ja verisuonisairauksien lääkkeissä

(18 %). Saatavuusongelmien syy oli tiedossa apteekeissa

11 prosentissa saatavuuskatkostapauksista.

Apteekkien henkilökunnan mukaan tavallisin saatavuusongelmien

syy oli tuotteen loppuminen toimittajalta

(49 %). Lääkkeiden saatavuusongelmat

aiheuttivat ongelmia apteekeille kolmasosassa saatavuuskatkostapauksista.

Tavallisimmin saatavuusongelmat

aiheuttivat tyytymättömyyttä asiakkaissa

(54 %) ja pitkittivät asiakaspalvelutilanteita (53 %).

Lääkkeiden saatavuusongelmat eivät aiheuttaneet

ongelmia apteekeille kahdessa kolmasosassa saatavuuskatkostapauksista,

useimmiten koska korvaava

valmiste oli saatavilla (49 %).

Tutkimus lääkeyritysten ja

lääketukkukauppojen edustajille

Tutkimukseen osallistui 30 yritystä; 27 lääkeyritystä

ja 3 lääketukkukauppaa. Tutkimushaastatteluun

osallistui yksi henkilö kustakin yrityksestä lukuun

ottamatta kahta yritystä, joiden toiveesta haastatteluun

osallistui kaksi henkilöä, jotka edustivat yrityksen

eri lääkkeiden saatavuuteen liittyviä toimintoja.

Aineisto saturoitui 22 haastattelun jälkeen. Haastattelut

kestivät keskimäärin 34 minuuttia (vaihteluväli

21–58 minuuttia).

Lääkkeiden saatavuusongelmien taustalla oli

monia syitä, jotka jakautuivat kahteen kategoriaan:

”Tarjontaan liittyvät syyt” ja ”Kysyntään liittyvät

syyt” (Kuva 1). Tarjonnasta johtuvista syistä yleisin

lääkkeiden saatavuusongelmien syy oli Suomen

lääkemarkkinoiden pieni koko (n=29). Haastateltavat

kertoivat, että Suomen lääkemarkkinat ovat pienet

verrattuna muun Euroopan tai maailman lääkemarkkinoihin.

Tarjonnasta johtuvista syistä myös

varastojen pieni koko missä tahansa lääkejakeluverkoston

osassa (n=25) aiheutti saatavuusongelmia.

Haastateltavien mukaan lääkkeiden varastointi on

Suomessa kalliimpaa kuin joissakin muissa Euroopan

maissa, mikä saattaa vähentää lääkeyritysten tai

lääketukkukauppojen halukkuutta pitää suuria varastoja

Suomessa.

Kysynnästä johtuvat syyt liittyivät yleisimmin

muutoksiin kysynnässä. Haastateltavien mukaan

äkilliset kysynnän muutokset (n=28) aiheutuivat yleisimmin

tuotteiden myynnin kausivaihtelusta tai toisten

lääkeyritysten tuotteiden saatavuusongelmista.

Tuotteiden myynnin kausivaihtelua voidaan ennustaa

melko luotettavasti, mutta toisten lääkeyritysten

tuotteiden saatavuusongelmista saadaan harvoin tietoa

etukäteen. Näin ollen lääkeyritysten on vaikea ennakoida

omien tuotteiden kysynnän äkillistä kasvua

ja syntyy saatavuusongelmia.

© Suomen Farmasialiitto ry 307

© DOSIS n:0 4/2018


Taulukko 1. Tutkimukseen valitut harvinaislääkkeet.

Valmistenimi

Vaikuttava aine

Indikaatio

Myyntiluvan

myöntämispäivämäärä

Bosulif

bosutinibi

krooninen myelooinen

leukemia

27.3.2013

Bronchitol

mannitoli

kystinen fibroosi

13.4.2013

Iclusig

ponatinibi

akuutti lymfoblastinen

leukemia, krooninen

myelooinen leukemia

1.7.2013

Imnovid

pomalidomidi

multippeli myelooma

5.8.2013

Kalydeco

ivakaftori

kystinen fibroosi

23.7.2012

Opsumit

masitentaani

pulmonaarihypertensio

20.12.2013

Orphacol

koolihappo

synnynnäiset

aineenvaihdunnan

häiriöt ja sairaudet

12.9.2013

Procysbi

merkaptamiinibitartraatti

kystinoosi

6.9.2013

Vyndaqel

tafamidisiinimeglumiini

amyloidoosi

16.11.2011

Xaluprine

merkaptopuriinimonohydraatti

lymfoidinen leukemia

9.3.2012

© DOSIS n:0 4/2018 308

© Suomen Farmasialiitto ry


Lääkkeiden saatavuusongelmien

taustalla olevat syyt

Tarjontaan

liittyvät syyt

Kysyntään

liittyvät syyt

Lääkemarkkinoiden

rakenne

Logistiset ja jakeluun

liittyvät syyt

Tuotannolliset

syyt

Viranomaismääräykset

Tiedonkulku

ja valvonta

Muutokset

kysynnässä

Kysynnän

rakenne

Epätyypillinen

kysyntä

Heikentynyt

ostovoima

Lääkemarkkinoiden

pieni

koko (n=29)

Pitkä toimitusaika

(n=23)

Riippuvaisuus

ulkomaisesta

tuotannosta

(n=22)

Toimijoiden

rajallinen

määrä (n=19)

Pieni kielialue,

jossa kaksi

kansalliskieltä

ja spesifiset

pakkausvaatimukset

(n=16)

Velvoitevarastointi

(n=13)

Varastojen

pieni koko

missä tahansa

lääkejakeluverkoston

osassa (n=25)

Maantieteellinen

sijainti ja

pitkät välimatkat

(n=12)

Jakeluvirheet

(n=5)

Pitkä tai monimutkainen

toimitusketju

(n=23)

Raaka-ainepuutokset

(n=21)

Tuotanto-ongelmat

(n=19)

Kapasiteettiongelmat

(n=18)

Laatu- ja prosessiongelmat

(n=16)

Myyntiluvanhaltijan

muutokset

(n=13)

Tuotantopaikan

muutokset (n=7)

Luonnonkatastrofit

(n=3)

Tiukentuneet

viranomaismääräykset

(n=16)

Riittämätön

tiedonkulku

ja inhimilliset

virheet

(n=3)

Äkilliset

kysynnän

muutokset

(n=28)

Sairaalakauppa

(n=18)

Korvattavuushaasteet

(n=13)

Lääkevaihto

ja viitehintajärjestelmä

(n=7)

Kaupalliset

syyt

Rinnakkaisvienti

ja -tuonti

(n=6)

Matala hintataso ja heikko

kannattavuus (n=21)

Maiden tai markkinaalueiden

priorisointi (n=19)

Lääkeyritysten

priorisointi (n=6)

Spot-kauppa (n=5)

Rajallinen

halukkuus

tai kyky

maksaa

lääkkeistä

(n=4)

Kuva 1. Lääkkeiden saatavuusongelmien syyt Suomessa. (n = niiden haastattelujen lukumäärä, joissa

kyseinen syy tuotiin spontaanisti esille, tehdystä 30 haastattelusta Suomessa toimivien lääkeyritysten ja

lääketukkukauppojen edustajille. (Sarnola 2018, kuva julkaistu ensimmäisen kerran Itä-Suomen yliopiston

”Publications of the University of Eastern Finland – Dissertations in Health Sciences” -julkaisusarjassa)

© Suomen Farmasialiitto ry 309

© DOSIS n:0 4/2018


Tutkimus lääkkeiden hinta- ja

korvattavuusviranomaisille

Yhden muistutuksen jälkeen kyselyyn vastasi 24

maata (52 % kutsutuista). Kaikki tutkimukseen osallistuneet

maat olivat Euroopan maita, ja niistä 18 oli

Euroopan unionin jäsenmaita, jotka hyväksyvät Euroopan

lääkeviraston myöntämät myyntiluvat sellaisenaan.

Vastanneet maat ja tulokset yksittäisistä vastaajamaista

löytyvät kokonaisuudessaan alkuperäisjulkaisusta

Sarnola ym. (2018).

Suurimmassa osassa Euroopan maista ei ollut erillistä

hinta- (n=20) tai korvattavuussääntelyä (n=22)

harvinaislääkkeille, vaan päätökset tehtiin samalla tavalla

kuin muissakin lääkkeissä. Joissain maissa (n=13)

oli kuitenkin otettu käyttöön muita harvinaislääkkeiden

hinnoittelu- tai korvattavuuspäätöksiin liittyviä

järjestelyitä, kuten erilliset budjetit, joista harvinaislääkkeitä

korvataan.

Kymmenen harvinaislääkkeen saatavuutta ja jakelukanavia

koskeviin kysymyksiin vastasi 23 maata.

Kymmenestä lääkkeestä keskimäärin viisi oli saatavilla

kyselyyn vastanneissa maissa. Vaihtelu maiden

välillä oli kuitenkin suurta. Valtaosa lääkkeistä oli saatavilla

monessa Keski- ja Länsi-Euroopan maassa, ja

esimerkiksi Alankomaissa, Maltalla ja Puolassa kaikki

kymmenen lääkettä olivat saatavilla. Sen sijaan joissakin

Itä-Euroopan maissa lääkkeistä oli saatavilla alle

puolet ja neljässä maassa (Latvia, Liettua, Turkki

ja Valko-Venäjä) ei yhtään kymmenestä lääkkeestä.

Harvinaislääkkeet toimitettiin potilaille tavallisimmin

apteekeista (n=8). Myös toimittaminen muista

terveydenhuollon yksiköistä, kuten sairaaloista tai

terveyskeskuksista oli yleistä (n=5).

Kymmenen harvinaislääkkeen potilaan omavastuuta

koskeviin kysymyksiin vastasi 19 maata. Vastauksia

potilaan omavastuuta koskeviin kysymyksiin

pyydettiin silloin, kun lääkkeet olivat saatavilla avohoidossa

kyseisessä maassa. 14 maassa potilaat maksoivat

yleensä osan lääkkeen hinnasta itse tai saivat

lääkkeet veloituksetta. Kun lääkkeet toimitettiin potilaille

apteekeista, potilaat maksoivat yleensä osan

niiden hinnasta itse. Kun lääkkeet toimitettiin potilaille

muista terveydenhuollon yksiköistä, potilaat

saivat ne yleensä veloituksetta. Viidessä maassa lääkkeet

olivat pääosin ei-korvattavia, eli potilaat maksoivat

lääkkeiden hinnan kokonaan itse. Lääkkeet toimitettiin

potilaille apteekeista ja muista terveydenhuollon

yksiköistä.

POHDINTA

Lääkkeiden saatavuusongelmat

Suomessa

Lääkkeiden saatavuusongelmat ovat yleisiä suomalaisille

apteekeille, ja niitä esiintyy yleisesti käytetyissä

lääkeryhmissä. Valtaosa lääkkeiden saatavuuskatkostapauksista

ei aiheuta ongelmia apteekeille. Saatavuusongelmilla

voi silti olla merkittävä vaikutus apteekkien

arkeen. Tutkimuksen tulokset korostavatkin

hyvän tiedonkulun tärkeyttä. Puutteelliset tiedot

lääkkeiden saatavuusongelmien syistä ja lääkkeiden

seuraavista toimitusajankohdista vaikeuttavat apteekkihenkilökunnan

työtä asiakaspalvelutilanteissa

ja vievät työaikaa. Siksi tiedonkulkua lääkeyrityksiltä

ja lääketukkukaupoilta apteekkeihin tulisi parantaa.

Tietoa voidaan jakaa esimerkiksi apteekkien

tietojärjestelmien kautta, jolloin se on käytettävissä

asiakasta palveltaessa.

Lääkkeiden saatavuusongelmien taustalla on monia

syitä, jotka voivat vaikuttaa myös samanaikaisesti.

Suomen lääkemarkkinoiden koko on pieni verrattuna

moneen muuhun maahan. Markkinoiden pieni

koko voi vähentää markkinoilla olevien toimijoiden

määrää ja pienentää lääkkeiden varastointimääriä

(Besançon ja Chaar 2013). Pienet varastointimäärät

missä tahansa lääkejakeluverkoston osassa voivat

puolestaan ehtyä nopeasti ja aiheuttaa saatavuusongelmia.

Lisäksi äkilliset kysynnän muutokset heikentävät

lääkeyritysten omien tuotteiden kysynnän

ennakoitavuutta. Lääkeyritysten näkökulmasta liiketoiminnan

heikko ennustettavuus voi vähentää

yritysten halukkuutta tuoda lääkkeitä markkinoille

(Besançon ja Chaar 2013). Tässä tutkimuksessa esille

tulleet saatavuusongelmien syyt korostavat varautumissuunnittelun

merkitystä. Saatavuusongelmiin

varaudutaan Suomessa esimerkiksi lainsäädännöllä

(laki lääkkeiden velvoitevarastoinnista 979/2008).

Velvoitevarastointilaki turvaa erityisesti suurten terapiaryhmien

lääkkeiden saatavuutta (Juhola 2017).

Saatavuusongelmiin varaudutaan lisäksi viranomaistoimin.

Viranomaiset arvioivat esimerkiksi saatavuushäiriöiden

vaikutuksia ja tekevät kansallisen riskiarvion

jälkitoimitukseen jääneen lääkkeen kriittisyydestä

(Linnolahti 2017). Potilaiden hoidon kannalta

kriittisten lääkkeiden saatavuus voidaan turvata

esimerkiksi myyntiluvanhaltijoille myönnettävillä

poikkeusluvilla.

© DOSIS n:0 4/2018 310

© Suomen Farmasialiitto ry


Harvinaislääkkeiden saavutettavuus

Euroopassa

Euroopan maissa on harvoin käytössä erillistä hintatai

korvattavuussääntelyä harvinaislääkkeille. Sääntelyn

tarpeesta käydään kuitenkin kansainvälistä keskustelua,

koska nykyiset lääkkeiden hinnoittelu- ja

korvausjärjestelmät eivät välttämättä sovellu harvinaislääkkeille

(Schlander ym. 2016). Ratkaisuna tähän

on ehdotettu esimerkiksi eurooppalaista yhteistyötä

harvinaislääkkeiden hinnoittelu- ja korvattavuuspäätöksiä

varten tehtävässä arvioinnissa (Habl ja Bachner

2011, Euroopan parlamentti 2017). Tämä voisi vähentää

päällekkäistä työtä ja mahdollistaa harvinaislääkkeiden

arvioinnin nykyistä keskitetymmin.

Tutkimukseen valittujen kymmenen harvinaislääkkeen

saatavuus, jakelukanavat ja potilaan omavastuukäytäntö

vaihtelevat Euroopan maiden välillä.

Suurin osa lääkkeistä on saatavilla Keski- ja Länsi-Euroopan

maissa, kun taas Itä-Euroopassa lääkkeitä

on saatavilla vähemmän tai ei lainkaan. Tämä

voi johtua siitä, että Keski- ja Länsi-Euroopan maiden

korkeammat bruttokansantuotteet ja suuremmat

tervey denhuollon budjetit mahdollistavat myös

kalliiden lääkkeiden sisällyttämisen korvausjärjestelmään,

jolloin lääkkeitä saatetaan tuoda markkinoille

enemmän (OECD 2008, Habl ja Bachner 2011). Lääkkeiden

sisällyttäminen korvausjärjestelmään voi paitsi

lisätä markkinoille tuotavien lääkkeiden määrää,

myös parantaa lääkkeiden saavutettavuutta potilaiden

näkökulmasta, sillä potilaat eivät tällöin joudu

maksamaan apteekeista toimitettavien lääkkeiden

hintaa kokonaan itse (Gammie ym. 2015). Toisaalta

harvinaislääkkeiden jakeleminen sairaaloista tai terveyskeskuksista

voi parantaa niiden saavutettavuutta,

sillä tällöin potilaat saavat lääkkeet usein veloituksetta.

Lääkkeiden saavutettavuutta voidaan kuitenkin

arvioida luotettavasti vasta, kun lääkkeiden hinta

sekä potilaan omavastuuosuuden suuruus, tulotaso

ja muut terveydenhuollon kulut otetaan huomioon

(EURORDIS 2011). Näin ollen olisi tärkeää, että harvinaislääkkeiden

rahoitus- ja jakelukanavia tarkasteltaisiin

kokonaisuutena.

JOHTOPÄÄTÖKSET

Lääkkeiden saatavuusongelmat ovat yleisiä suomalaisille

apteekeille. Vaikka valtaosa saatavuuskatkostapauksista

ei aiheuta ongelmia apteekeille, saatavuusongelmilla

voi olla merkittävä vaikutus apteekkien

arkeen. Tiedonkulun parantaminen lääkealan toimijoiden

välillä voisi sujuvoittaa asiakaspalvelutilanteita

ja helpottaa siten lääkkeiden saatavuusongelmien

käsittelemistä apteekeissa.

Lääkkeiden saatavuusongelmien taustalla on monia

syitä, kuten Suomen lääkemarkkinoiden pieni koko

ja äkilliset kysynnän muutokset. Tutkimuksen tulokset

korostavat varautumissuunnittelun tärkeyttä,

jotta lääkkeiden hyvä saatavuus saadaan turvattua.

Euroopassa on harvoin käytössä erillistä sääntelyä

päätettäessä harvinaislääkkeiden hinnasta tai korvattavuudesta.

Tutkimukseen valittujen kymmenen

harvinaislääkkeen saatavuus, jakelukanavat ja potilaan

omavastuukäytäntö vaihtelevat maittain. Harvinaislääkkeiden

saavutettavuutta tulee tutkia sekä

arvioida lisää kansallisella ja kansainvälisellä tasolla.

Lisää tietoa tarvitaan esimerkiksi siitä, miten harvinaislääkkeiden

hinnoittelu- ja korvattavuuspäätöksiä

varten tehtävä arviointi tulisi toteuttaa sekä siitä,

mitkä ovat lääkkeiden saavutettavuuden ja lääkehoidon

vaikuttavuuden kannalta sopivimmat jakelu- ja

rahoituskanavat harvinaislääkkeille.

© Suomen Farmasialiitto ry 311

© DOSIS n:0 4/2018


SUMMARY

Availability and accessibility of

medicines – Medicine shortages

in Finland and accessibility of

orphan medicines in Europe

➔ Kati Sarnola

Research scientist, PhD (Pharm.),

Specialist in Medication Review

Finnish Medicines Agency

kati.sarnola@fimea.fi

M.Sc. (Pharm.) Kati Sarnola’s Doctoral Thesis

”Availability and accessibility of medicines,

A study of medicine shortages in Finland and

accessibility of orphan medicines in Europe” was

inspected in the University of Eastern Finland,

Faculty of Health Sciences, School of Pharmacy

(social pharmacy) in August 17th 2018. Professor

Erkki Palva acted as the opponent and Johanna

Timonen from the University of Eastern Finland

acted as custodian. The Doctoral Thesis can be

found from University of Eastern Finland UEF

Electronic Publications -database: http://epublications.uef.fi/index.php

Background: Availability of medicines has become

one of the priority health issues worldwide. This

study aimed to explore the frequency, the reasons

behind and the consequences of medicine shortages

to Finnish community pharmacies, and the reasons

behind shortages from the perspective of pharmaceutical

companies and pharmaceutical wholesalers

in Finland. Additionally, this study aimed to study,

whether special policies had been implemented for

assessing the reimbursement status or pricing of orphan

medicines, and the availability and distribution

settings of ten recently authorised orphan products

suitable for outpatient care, and whether patients receive

these products free of charge or have to pay

some or all of the costs themselves.

was studied by a survey to competent authorities in

24 European countries.

Results: Almost 80% of the pharmacies had medicine

shortages daily or almost daily. The reasons behind

medicine shortages were reported to the pharmacies

in 11% of the shortage cases. One third of

shortage cases caused problems to the pharmacies.

Medicine shortages were most commonly caused by

the small size of the pharmaceutical market (n=29)

and sudden or fluctuating demand (n=28). Most European

countries had not implemented specific pricing

(n=20) or reimbursement (n=22) policies for orphan

medicines. Of the ten studied orphan medicines,

the average number of available products per

country was five. Products were most commonly dispensed

from community pharmacies. When products

were dispensed from community pharmacies,

patients typically paid part of the price themselves.

Products dispensed from other health care units

were often free of charge for the patients.

Conclusions: Medicine shortages are common to

Finnish community pharmacies. Majority of medicine

shortages don’t cause problems for the pharmacies.

The reasons behind shortages are rarely reported

to the pharmacies. The reasons behind shortages

are more often supply-related than demand-related.

Special policies on pricing and reimbursement on orphan

medicines are rarely implemented in European

countries. Availability, distribution settings and

patients’ share of the costs of ten orphan medicines

varies between countries.

Keywords: medicines; availability; accessibility;

medicine shortages; health policy; surveys and

questionnaires, interviews

Methods: The frequency, the reasons behind, and

the consequences of medicine shortages were studied

by reporting from 129 pharmacies (66%, n=195).

The reasons behind shortages were also studied by

interviewing 30 representatives of pharmaceutical

companies and pharmaceutical wholesalers operating

in Finland. The accessibility of orphan medicines

© DOSIS n:0 4/2018 312

© Suomen Farmasialiitto ry


KIRJALLISUUSVIITTEET

Besançon L, Chaar B: Report of the international

summit on medicines shortage. International

Pharmaceutical Federation (FIP), Toronto 2013

Canadian Pharmacists Association: Canadian

Drug Shortages Survey – Final report, Ottawa

2010

Claus B, Pauwels K, Baert M ym.: [Drug shortages

in the hospital: management, causes and budget

impact]. J Pharm Belg 1: 24–34, 2015

Euroopan parlamentti: P8_TA-PROV(2017)0061.

Vaihtoehdot lääkkeiden saatavuuden

parantamiseksi. Euroopan parlamentin

päätöslauselma 2. maaliskuuta 2017 EU:n

vaihtoehdoista lääkkeiden saatavuuden

parantamiseksi (2016/2057(INI))

European Commission: Regulation (EC) No.

141/2000 of the European Parliament and of

the Council of 16 November 1999 on orphan

medicinal products

European Medicines Agency: Orphan

designation. 2017 (viitattu 9.10.2018).

Saatavilla Internetissä: www.ema.europa.

eu/ema/index.jsp?curl=pages/regulation/

general/general_content_000029.

jsp&mid=WC0b01ac0580b18a41

European Medicines Agency: Orphan medicines

figures 2000-2017. 2018 (viitattu 9.10.2018).

Saatavilla Internetissä: www.ema.europa.eu/

docs/en_GB/document_library/Other/2015/04/

WC500185766.pdf

EURORDIS: Position Paper. Patients’ Priorities and

Needs for Rare Disease Research 2014–2020,

Amsterdam 2011

Gammie T, Lu CY, Babar ZU-D: Access to orphan

drugs: A Compehensive Review on Legislations,

Regulations and Policies in 35 countries. PLoS

One 10(10): e0140002, 2015

Habl C, Bachner F: EMINET – Initial investigation

to assess the feasibility of a coordinated system

to access orphan medicines. Commissioned by

the European commission, Directorate-General

Enterprise and Industry, Vienna 2011

Hawley KL, Mazer-Amirshahi M, Zocchi MS, Fox

ER, Pines JM: Longitudinal Trends in U.S. Drug

Shortages for Medications Used in Emergency

Departments (2001-2014). Acad Emerg Med 23:

63–69, 2016

Hennink NM, Kaiser BN, Marconi VC: Code

Saturation versus Meaning Saturation: How Many

Interviews are Enough? Qual Health Res 1–18,

2016

Hirsjärvi S, Hurme H: Tutkimushaastattelu –

Teemahaastattelun teoria ja käytäntö. Gaudeamus

Helsinki University Press, Helsinki 2014

Juhola R: Lääkkeiden velvoitevarastointi

varmistaa lääkehuollon jatkuvuutta. SIC! 3–4:

24–25, 2017

Kaakeh R, Sweet BV, Reilly C: Impact of drug

shortages on U.S. health systems. Am J Health

Syst Pharm 68: 1811–1819, 2011

Linnolahti J: Fimean toiminta lääkkeiden

saatavuuden turvaamiseksi. SIC! 3–4: 6–10, 2017

McLaughlin M, Kotis D, Thomson K ym.: Effects on

patient care caused by drug shortages: a survey.

J Manag Care Spec Pharm 19: 783–788, 2013

OECD: OECD Health Policy Studies:

Pharmaceutical Pricing Policies in the Global

Market, Paris 2008

Penttilä K: Harvinaislääkkeiden kehitystä tuetaan

Euroopassa. SIC! 4: 1–6, 2016

Sarnola K: Lääkkeiden saatavuus ja

saavutettavuus: tutkimus lääkkeiden

saatavuusongelmista Suomessa ja

harvinaislääkkeiden saavutettavuudesta

Euroopassa. Publications of the University of

Eastern Finland. Dissertations in Health Sciences

470, University of Eastern Finland, Kuopio 2018

Schlander M, Garattini S, Kolominsky-Rabas P ym.:

Determining the value of medical technologies to

treat ultra-rare disorders: a consensus statement.

J Mark Access Health Policy 4: 33039, 2016

Tan YX, Moles RJ, Chaar BB: Medicine shortages

in Australia: causes, impact and management

strategies in the community setting. Int J Clin

Pharm 38: 1133–1141, 2016

© Suomen Farmasialiitto ry 313

© DOSIS n:0 4/2018


Thieren M: World Health Organization. Technical

Meeting for the Development of a Framework

for Universal Access to HIV/Aids Prevention,

Treatment and Care in the Health Sector.

Background paper on the concept of universal

access, Geneva 2005

Tiwari J: Navigating through orphan medicinal

product regulations in EU and US – Similarities

and differences. Regul Toxicol Pharmacol 71:

63–67, 2015

WHO Collaborating Centre for Pharmaceutical

Pricing and Reimbursement Policies: Preferred

terms. (viitattu 9.10.2018). Saatavilla Internetissä:

http://whocc.goeg.at/Glossary/PreferredTerms/

Access

© DOSIS n:0 4/2018 314

© Suomen Farmasialiitto ry


Onko sinulla

julkaistavaksi

sopivaa materiaalia

tai aihevinkkejä?

Dosis on ainoa suomenkielinen farmasian

alan tieteellinen lehti. Siinä julkaistaan farmasian

ja sen lähialojen alkuperäistutkimuksia, katsauksia,

tieteellisiä kommentteja ja referaatteja sekä

väitöskirjojen tiivistelmiä.

Jos sinulla on Dosikseen soveltuvaa materiaalia tai

aihevinkkejä, lähetä sähköpostia osoitteeseen

dosis@farmasialiitto.fi tai anneli.ritala@vtt.fi

DOSIKSEN TOIMITUSKUNTA

Päätoimittaja

Dosentti Anneli Ritala-Nurmi

Toimituskunnan jäsenet

Dosentti Katri Hämeen-Anttila

Proviisori, toksikologi Antti Kataja

Yliopistonlehtori Anne Lecklin

Farmasian tohtori Minna Matikainen

Neuvotteleva virkamies, farmasian tohtori Ulla Närhi

Farmasian tohtori Joni Palmgrén

Farmasian tohtori Marika Pohjanoksa-Mäntylä

www.dosis.fi


Refereet

2018

Marja Airaksinen

Maarit Dimitrow

Yvonne Holm

Anna-Riia Holmström

Katri Hämeen-Anttila

Liisa Kaartinen

Antti Kataja

Nina Katajavuori

Anne Lecklin

Ulla Lofthjelm

Minna Matikainen

Niina Mononen

Ulla Närhi

Joni Palmgrén

Marikki Peltoniemi

Kirsi Pietilä

Marika Pohjanoksa-Mäntylä

Marja Raekallio

Jenni Repo

Anneli Ritala-Nurmi

Leena Riukka

Outi Salminen

Anu Seisto

Pekka Suhonen

Virpi Sulosaari

Teemu Teeri

Miia Tiihonen

Anna Westerling

Julkaisemme vuosikerran viimeisessä Dosiksessa

listan kyseisen vuoden julkaisuun tarjottujen artikkelien

refereenä toimineista henkilöistä. Nimet on listattu

sukunimen mukaan aakkosjärjestyksessä.

More magazines by this user