Biologia Molecular – QBQ3401 Química-Noturno 2009

www2.iq.usp.br

Biologia Molecular – QBQ3401 Química-Noturno 2009

Professora:

Nadja Cristhina de Souza Pinto

Monitores:

Carolina Domeniche Romagna

Débora da Silva Freitas

Universidade de São Paulo

Instituto de Química

Biologia Molecular QBQ3401

Química-Noturno

2009


QBQ-3401

Biologia Molecular

Química-Noturno - 2009

DOCENTE RESPONSÁVEL:

Prof. Nadja Cristhina de Souza Pinto (sala 1065 − Bloco 10 superior)

MONITORES:

Carolina D. Romagna (sala 1065 Bloco 10 superior)

Débora da Silva Freitas (sala Bloco

2

QBQ-3401 / Biologia Molecular 2008

HORÁRIO E SALAS:

Aulas Expositivas e Exercícios (Discussão): 6 as feiras das 19 às 22:40h - Sala 10 - Bloco 6 inferior

Aulas Práticas: 6 as feiras das 19 às 22:40h - Laboratório Didático - Bloco 7 superior

ORGANIZAÇÃO DO CURSO:

O Curso envolve aulas expositivas, períodos para resolução e discussão de exercícios e aulas práticas.

Utilizando as informações das aulas expositivas e a bibliografia recomendada, os alunos deverão resolver os

exercícios e entregar as resoluções à professora. Os exercícios serão discutidos em sala de aula com

acompanhamento da professora e das monitoras.

Nas aulas práticas serão realizadas experiências que envolvem algumas técnicas básicas utilizadas em

Biologia Molecular. Os alunos serão divididos em grupos e cada grupo deverá apresentar um RELATÓRIO

contendo os resultados obtidos e a resolução das questões correspondentes. Só serão aceitos relatórios de

alunos que realizaram as aulas práticas. POR RAZÕES DE SEGURANÇA, O USO DO AVENTAL NAS

AULAS PRÁTICAS É OBRIGATÓRIO.

AVALIAÇÃO:

A avaliação será feita através da média ponderada das notas obtidas nas duas provas (P1, P2), nos

quatro relatórios (R) e nos exercícios (E), de acordo com a fórmula abaixo:

Nota final= (P1 x 2) + (P2 x 2) + (média dos 4 relatórios)+ (média dos exercícios)

6

A matéria das provas será CUMULATIVA. No final do curso, será oferecida uma prova substitutiva para

alunos que tenham sido impossibilitados de fazer uma das provas por motivo de doença, que incluirá toda a

matéria do curso. Um atestado médico deverá ser entregue neste caso. O peso da prova substitutiva será igual

ao da prova perdida.

Os alunos que não atingirem Nota Final ≥ 5,0, porém atingirem ≥ 3,0 e 75% de frequência poderão realizar a

prova de recuperação, que será administrada em fevereiro 2010.

A FREQUÊNCIA OBRIGATÓRIA MINÍMA ÀS AULAS É DE 75%.


CRONOGRAMA QBQ-3401

3

QBQ-3401 / Biologia Molecular 2008

21/8 Aula1 - Introdução à Biologia Molecular. Estrutura e Função dos Ácidos

Nucléicos. Exercício 1

28/8 Aula 2 - Replicação do DNA. Exercício 2

04/9 Experiência 1: Extração de DNA de E. coli

11/9 Aula 3 - Mutação e Reparo de DNA. Exercício 3

18/09 Aula 4 - Estrutura gênica e Transcrição. Exercício 4

25/09 Experiência 2: Reação em Cadeia da Polimerase (PCR) para detecção

de genes

02/10 Aula 5 - Código Genético. Exercício 5

09/10 Prova 1

16/10 Aula 6 - Processamento do RNA e Tradução/Síntese de Proteínas.

Exercício 6

23/10 Aula 7 - Regulação da Expressão Gênica. Exercício 7

30/10 Experiência 3: Transformação de bactérias com plasmídeos

06/11 Aula 8 - Transdução de Sinal e Câncer. Exercício 8

13/11 Aula 9 - Tecnologia do DNA recombinante. Exercício 9

20/11 CONSCIÊNCIA NEGRA Não haverá aula

27/11 Experiência 4: Indução de Beta-galactosidase com IPTG

04/12 Prova 2

11/12 Prova substitutiva

BIBLIOGRAFIA RECOMENDADA:

Inglês:

• Biochemistry - D. Voet & J.G. Voet - John Wiley & Sons 3rd edition. 2004.

• Biochemistry J. M. Berg, J.L. Tymoczko & L. Stryer. W.H.Freeman 6th edition - 2006.

• Genes IX Lewis, B. Jones & Bartlett Publishers; 9th edition. 2007

• Lehninger Principles of Biochemistry - D.L. Nelson & M.M. Cox. Worth Publishers 4th edition 2004.

Molecular Biology of the Gene. James D. Watson, Nancy H. Hopkins, Jeffrey W. Roberts, Joan

Argetsinger Steitz ,Alan M. Weiner. 5th Edition - 2003

Português:

• Bases Moleculares da Biotecnologia. A.H.Ulrich, W. Coli; P.L.Ho;M. Faria;C.A. Trujillo. Editora Roca.1°

Edição. 2008

Biologia Molecular Básica A. Zaha. Editora Mercado Aberto. - 3a edição. 2003

Biologia Molecular do Gene. James D. Watson, Nancy H. Hopkins, Jeffrey W. Roberts, Joan Argetsinger

Steitz ,Alan M. Weiner. Editora Artmed. 5a edição. 2006

• Bioquímica - L. Stryer - Editora Guanabara Koogan - 5a edição. - 2004.

• Fundamentos de Bioquímica D. Voet, J. G. Voet & C. W. Pratt Editora Artmed. 3a edição. 2006.

• Princípios de Bioquímica - A.L. Lehninger, D.L. Nelson & M.M. Cox. Editora Sarvier -4a edição. 2007.


Exercícios

4

QBQ-3401 / Biologia Molecular 2008


Exercício 1. Estrutura e Função dos Ácidos Nucleicos

5

QBQ-3401 / Biologia Molecular 2008

1.Quais as diferenças de composição e estrutura entre RNA e DNA. Como se distingue entre uracila e

timina, e entre ribose e desoxirribose?

2. RNA é facilmente hidrolizado por álcali, enquanto DNA não o é. Por que?

3.Escreva a seqüência de bases da fita complementar do DNA dupla fita que apresenta uma fita com a

seqüência:

(5') ATGCCGTATGCATTGCATTC (3')

Exprima, em porcentagem, a composição de bases do DNA de fita dupla.

4. Uma molécula de ácido nucleico tem a composição de bases abaixo. O que você pode afirmar sobre

esta molécula?

C = 24,1% G = 18,5% T = 24,6% A = 32,8%

5. Explique por que ácidos nucleicos são desnaturados quando submetidos a alta temperatura ou pHs

extremos? Uma molécula de DNA desnaturada por aquecimento pode ser renaturada? Como?

6. O valor de Tm para o DNA pode ser calculado usando-se a fórmula:

Tm = 69,3 + 0,41(%GC), onde GC é a porcentagem de Guanina + Citosina

a) DNA de E. coli contém 50% GC. Calcular o Tm para o DNA desta bactéria.

b) As curvas de fusão da maioria dos DNAs que ocorrem naturalmente revelam que o Tm é

normalmente maior do que 65 o C. Por que isto é importante para a maioria dos organismos?

c) Como varia o Tm com a força iônica da solução?

d) O que acontece com Tm quando se adiciona etanol à solução de DNA?

7. Quais das seguintes afirmações sobre o DNA isolado de um cromossomo eucariótico são corretas?

- É resistente à quebra durante a extração por seu grande tamanho.

- É linear e não ramificado

- É uma molécula única

- Pode ter tamanho superior a 100 Mb

8. O núcleo de uma célula humana tem 6µm de diâmetro e a extensão total do DNA dos seus 46

cromossomos soma 1,8m. Como é resolvida a discrepância entre estas duas grandezas?


Exercício 2. Replicação do DNA

6

QBQ-3401 / Biologia Molecular 2008

1. Combine as características da coluna da direita com o tipo de hélice do DNA da coluna da esquerda

(a) A-DNA (1) As pirimidinas estão na configuração anti

(b) B DNA (2) Os fosfatos na cadeia estão em ziguezague

(c) Z-DNA (3) A sua formação é favorecida por superenovelamento negativo

(4) Apresenta um sulco maior relativamente largo e profundo

(5) Apresenta uma estrutura helicoidal no sentido dextrógiro

(6) Tem 10,4 pares de bases por volta

(7) Tem a estrutura similar àquela do RNA de fita dupla

(8) As fitas na hélice são anti-paralelas

2. Descreva o experimento de Meselson-Stahl. Qual seria o resultado deste experimento se a replicação

do DNA fosse conservativa?

3. Combine as propriedades ou funções na coluna à direita com a DNA polimerase na coluna da

esquerda:

(a) DNA polimerase I (1) envolvida na replicação

(b) DNA polimerase II (2) requer um iniciador e um molde

(c) DNA polimerase III (3) envolvida no reparo de DNA

(4) sintetiza a maior parte do DNA durante a replicação

(5) remove o iniciador e preenche as lacunas durante a replicação

4. O fragmento de DNA no esquema abaixo é de fita dupla em ambas as extremidades, porém de fita

simples no meio. As extremidades da fita superior estão indicadas.

5'____________________________3'

__________P HO_________

a) O fosfato (P) indicado na fita inferior está na extremidade 5' ou 3' do fragmento ao qual ele pertence

? (Indique no esquema).

b) Como você esperaria que a lacuna fosse preenchida pelos processos de reparo do DNA "in vivo" ?

c) Quantos fragmentos você esperaria encontrar na fita inferior se o experimento fosse realizado "in

vitro", na presença de todos os desoxirribonucleotídeos-trifosfato e DNA polimerase, mas na ausência

de DNA ligase?

5. Explique porque certas variedades mutantes da DNA polimerase I podem apresentar atividade de

DNA polimerase praticamente ausente, mas podem ter atividade de exonuclease 5' → 3' praticamente

normal.

6. Qual a atividade da DNA polimerase III que é responsável pela editoração durante a replicação? Por

que essa atividade é importante?

7. Que propriedades do DNA e da DNA polimerase sugerem que a duas fitas não podem ser replicadas

pelo crescimento no mesmo sentido (como mostra a figura abaixo)? Como a célula supera o problema?

Esquematize a formação da ligação fosfodiester durante a replicação a partir do nucleotídeo trifosfato

livre, mostrando o grupo fosfato que é incorporado.


7

QBQ-3401 / Biologia Molecular 2008

8. A técnica de PCR (polymerase chain reaction) é utilizada para obter grandes quantidades de DNA a

partir de amostras contendo quantidades ínfimas de DNA.

a) Descreva os passos envolvidos nesta técnica.

b) Quais as características da DNA polimerase utilizada? Porque essas características são fundamentais

ao desenvolvimento dessa técnica?

c) Exemplifique aplicações desta técnica.


Exercício 3. Mutação e Reparo do DNA

8

QBQ-3401 / Biologia Molecular 2008

1. Quais os principais tipos de reparo de excisão e qual a especificidade de lesões de cada via?

2. Descreva brevemente as etapas de reparo do DNA lesado por luz UV e as enzimas nelas envolvidas.

3. Como os dímeros de timina podem ser diretamente removidos do DNA?

4. Como a maquinaria de reparo de E. coli identifica a fita de DNA que tem um nucleotídeo não

complementar incorporado durante a replicação?

5. Bromouracila é um mutagênico que produz troca de bases, enquanto acridina causa adições ou

deleções de uma base no DNA. Mutações causadas por acridina frequentemente podem ser

compensadas por mutações secundárias, distantes vários nucleotídeos da primeira mutação, enquanto

aquelas causadas por bromouracila geralmente requerem mudanças dentro do mesmo codon. Explique.

6. Explique como algumas cepas da bactéria Salmonella são usadas para detectar substâncias

carcinogênicas. Por que extrato de fígado de mamífero está envolvido no teste?

7. Que propriedade da DNA polimerase I é responsável pela observação de que bactérias mutantes

polA1 são mais sensíveis à luz ultravioleta ? Explique.

8. Por que a taxa de mutacao observada em E.coli é de 10 -8 a 10 -10 / par de bases replicado, apesar das

taxas de erro da Pol I e Pol III serem de 10 -6 a 10 -7 /par de bases replicado?


Exercício 4. Estrutura gênica e Transcrição

9

QBQ-3401 / Biologia Molecular 2008

1. Genes de eucariotos são geralmente constituídos de introns e exons. Estas seqüências são tanto

transcritas como traduzidas? A remoção dos íntrons (splicing) tem que ser um processo extremamente

preciso. Por que? Dê um exemplo de "splicing" aberrante que leva a um tipo de talassemia em

humanos.

2. As DNA polimerases necessitam de um iniciador, ao qual se liga um novo nucleotídeo para o

crescimento da cadeia polinucleotídica. É necessário um iniciador para a ação da RNA polimerase?

3. Que subunidades da RNA polimerase bacteriana são necessárias para a iniciação da transcrição a

partir de um promotor? E para a terminação da transcrição? Explique como uma mutação poderia dar

origem a uma E. coli resistente ao antibiótico rifamicina.

4. A seguinte fita simples de DNA vai se transcrita in vitro:

5'- ATGTACCGAAGTGGTTT - 3'

Coloque os grupos fosfato e um asterisco naqueles que serão radiativos quando a transcrição for feita

na presença de [γ 32

P]-ATP

(a?)

b) Faça o mesmo para [α 32

P]-UTP

5. Defina "promotor", enumere as suas propriedades e diga como podem ser localizados através da

técnica de "footprinting".

6. Combine as descrições na coluna da direita com a RNA pol DNA-dependente eucariótica

apropriada:

a) RNA pol I (1) localizada no nucléolo

(2) localizada no nucleoplasma

(3) sintetiza hnRNA

b) RNA pol II (4) sintetiza tRNA

(5) sintetiza rRNA

(6) sintetiza precursores do rRNA

c) RNA pol III (7) inibida por α-amanitina

(8) sintetiza RNA na direção 5'-3'

(9) composta de várias subunidades

7. Você usaria num paciente, como agente terapêutico anti-bacteriano, qual destes antibióticos: a)

rifamicina ou b) actinomicina D ? Justifique a sua escolha.

8. Quais as principais características das seqüências de promotores de genes eucarióticos transcritos em

mRNAs? Qual a função dos fatores de transcrição e “enhancers”?


Exercício 5: O Código Genético

10

QBQ-3401 / Biologia Molecular 2008

1. No desenho abaixo, da esquerda para a direita, indique as pontas 5' e 3' em cada uma das fitas. Selecione

uma das opções abaixo e explique o porquê de suas escolhas:

fita codificadora de DNA

___________________________________________________

fita complementar ou fita molde de DNA

___________________________________________________

fita de mRNA

___________________________________________________

fita de tRNA (anticódon para Metionina)

2. Faça um x no ácido nucleico (pode ser mais de um) que corresponde aos conceitos abaixo:

código genético ( ) DNA ( ) mRNA ( ) rRNA ( ) tRNA

códon ( ) DNA ( ) mRNA ( ) rRNA ( ) tRNA

anti-códon ( ) DNA ( ) mRNA ( ) rRNA ( ) tRNA

moldura de leitura ( ) DNA ( ) mRNA ( ) rRNA ( ) tRNA

3. Baseando-se na lista de códons e amino ácidos abaixo, quais das seguintes afirmações são corretas?

AGU = serina

AGC = serina

AAG = lisina

AAA = lisina

AUG = metionina

AUA = isoleucina

a) O código genético é degenerado

b) A alteração de um único nucleotídeo no DNA que dirige a síntese destes códons poderia levar à

substituição de uma isoleucina por uma lisina no polipeptídeo.

c) A alteração de um único nucleotídeo no DNA que dirige a síntese destes códons necessariamente levaria

à substituição de um aminoácido no polipeptídeo codificado.

4. Um tRNA com o anticódon ACU se ligaria a um ribossomo na presença de um dos códons da questão 3.

Qual? Olhando a tabela ao final deste exercício faça a previsão do anti-códon para terminação da tradução

e a seqüência das bases correspondentes no DNA codificador .

5. Uma globina de 146 aminoácidos sofreu uma mutação no códon correspondente ao sexto aminoácido da

cadeia (ver tabela ao final do exercício). A análise do DNA indicou uma mudança de TTC para TAC na

fita molde. Pergunta- se:


11

QBQ-3401 / Biologia Molecular 2008

a) A mutação provocou a troca de um aminoácido por outro? Em caso afirmativo, quais são estes

aminoácidos?

b) Quais as implicações para a estrutura da proteína?

6. Uma fita de um fragmento de DNA isolado de E. coli tem a seguinte sequência

5'...AGGTTACCTAGTTGC...3'

Qual é a sequência do polipeptídeo que seria codificado pelo mRNA sintetizado na questão 3 (não

intendi!). Assuma que o quadro de leitura começa com o primeiro nucleotídeo.

7. Abaixo está anotado o gene completo da insulina como se encontra no Banco de dados NCBI. Para

facilitar a leitura e a contagem, há um número que denota a primeira base da fila e as bases estão separadas

por um espaço colocado a cada 10 bases. O códon de iniciação e o códon de terminação estão sublinhados

e em negrito. Qual o número de aminoácidos na proteína resultante da transcrição desta seqüência?

Explique porque.

1 gctgcatcag aagaggccat caagcacatc actgtccttc tgccatggcc ctgtggatgc

61 gcctcctgcc cctgctggcg ctgctggccc tctggggacc tgacccagcc gcagcctttg

121 tgaaccaaca cctgtgcggc tcacacctgg tggaagctct ctacctagtg tgcggggaac

181 gaggcttctt ctacacaccc aagacccgcc gggaggcaga ggacctgcag gtggggcagg

241 tggagctggg cgggggccct ggtgcaggca gcctgcagcc cttggccctg gaggggtccc

301 tgcagaagcg tggcattgtg gaacaatgct gtaccagcat ctgctccctc taccagctgg

361 agaactactg caactagacg cagcccgcag gcagcccccc acccgccgcc tcctgcaccg

421 agagagatgg aataaagccc ttgaaccagc

8. O gene de uma proteína, cuja seqüência parcial está indicada abaixo, sofreu uma série de mutações

pontuais independentes, o que levará à produção de diferentes RNAs mensageiros, Indique a seqüência de

aminoácidos do peptídeo correspondente (a tabela se encontra no fim dos exercícios) e explique a

conseqüência do tipo de mutação que ocorreu em cada um dos RNAs resultantes.

5'UUCACACAGGAAACAGCUAUGCGAAGCGUGGCUUGUAACU....3'

(a) 5'UUCACACAGGAAACAGCUAUGCGAAGCGGGGCUUGUAACU....3'

(b) 5'UUCACACAGGAAACAGCUAUGCGAAGCAUGGCUUGUAACU.....3'

(c) 5'UUCACACAGGAAACAGCUAUGCGAAGCGUCGCUGUAUACU......3'

(d) 5'UUCACACAGGAAACAGCUAUGCGAAGCGUUGGCUUGUAACU....3'


12

QBQ-3401 / Biologia Molecular 2008


Exercícios 6. Síntese de proteínas

13

QBQ-3401 / Biologia Molecular 2008

1. Considere a seguinte sequência de um fragmento de DNA isolado de bactéria:

5'CTGATAAGGGATTTAAATTATGTGTCAATCACGAATGCTAATCGCTTAACACTTC 3'

a) Assumindo que esta seqüência corresponde à seqüência da fita codificadora, qual seria a seqüência

de aminoácidos do polipeptídeo produzido quando um mRNA transcrito deste gene for traduzido? Que

características na seqüência do mRNA determinam qual é o códon iniciador? Considere a primeira

base como o início da transcrição.

b) De acordo com o princípio de oscilação no pareamento de bases ("wobble"), qual o número mínimo

de tRNAs necessário para decodificar os seis códons de leucina - UUA, UUG, CUU, CUC, CUA e

CUG ? Explique.

2. Num sistema de síntese de proteínas in vitro, que permita o início e término da síntese em qualquer

seqüência de RNA, que peptídeo seria produzido pelo poli-ribonucleotídeo 5'-UUUGUUUUUGUU-3'?

Indique qual o aminoácido N-terminal e o C-terminal do polipeptídeo obtido.

3. O códon AUG funciona tanto para iniciar uma cadeia polipeptídica quanto para dirigir a

incorporação de uma metionina em posições internas de uma proteína. Quais os mecanismos de

seleção do códon AUG para a iniciação da tradução em procariotos?

4. No que consiste a sequência de Shine Dalgarno? Ela é universal? Explique.

5. Escreva os produtos finais das seguintes reações:

a) valina + ATP + tRNA Val + valil-tRNA sintetase

b) valina + ATP + tRNA Ile + isoleucil-tRNA sintetase

6. Explique quais são os mecanismos de ação dos antibióticos que agem na célula procariótica. Se

muitos antibióticos exercem sua ação por inibição da síntese protéica, como alguns destes antibióticos

podem ser usados em humanos para combater infecções microbianas sem causar efeitos tóxicos devido

à inibição da síntese protéica eucariótica?

7. O que se entende por chaperona?

8. Quais eventos podem acontecer com uma proteína depois de terminada sua síntese?


Exercício 7. Regulação da Expressão Gênica

1. Compare a expressão gênica em procariotos e eucariotos quanto a:

a) grau de acoplamento da transcrição e da tradução.

b) número de produtos gênicos em um transcrito primário.

c) número de proteínas resultantes da tradução de um transcrito primário.

d) proporção de seqüências codificadoras no DNA.

e) organização de genes em operons.

14

QBQ-3401 / Biologia Molecular 2008

2. Defina expressão gênica constitutiva. Compare expressão gênica induzida com repressão gênica.

Use o esquema proposto por Jacob e Monod para o operon da lactose e defina os termos operon, gene

estrutural, gene regulador, operador, promotor, indutor, repressor e co-repressor.

3. Numa cultura de E.coli em um meio contendo tanto lactose quanto glicose, qual dos açúcares é

metabolizado preferencialmente? Qual é o mecanismo que permite esta seletividade? O que acontece

quando a glicose se esgota durante o crescimento da bactéria?

4. Para o cultivo de E.coli utilizaram-se meios contendo além dos sais necessários, os componentes:

a) lactose d) glicose + cAMP

b) lactose + glicose e) lactose + glicose + cAMP

c) glicose

Analise a produção de β- galactosidase em cada caso, justificando a resposta segundo o modelo de

Jacob e Monod.

5. Qual o efeito da deleção do gene regulador do operon lac? Haveria outro tipo de mutação resultando

no mesmo efeito?

6. Um mutante incapaz de crescer tanto em galactose quanto em arabinose, além de diversas outras

fontes de carbono, foi isolado de uma cultura de E. coli do tipo selvagem. Que tipo de mutação pode

ter produzido estes resultados?

7. Demonstrou-se que o operon para a biossíntese do aminoácido fenilalanina de certa bactéria é

regulado por um mecanismo de atenuação. O que pode ser afirmado sobre a seqüência de aminoácidos

do peptídeo líder para este operon? Explique.

8. A cromatina que é ativa transcricionalmente (eucromatina) tem estrutura dispersa, enquanto a

cromatina que é inativa (heterocromatina) é compacta. Quando núcleos de células de galinha

produzindo globina foram tratados brevemente com DNase pancreática, os genes de globina de adultos

foram seletivamente destruídos, mas os genes para globina embriônica e ovalbumina permaneceram

intactos. Quando os núcleos de células de oviduto foram tratadas com DNase, os genes de ovalbumina

foram destruídos. Explique estes resultados.


Exercício 8. Transdução de Sinal e Câncer

1. Descreva o mecanismo de ativação:

a. das Proteínas G pelos receptores serpentina

b. da Proteína Quinase A por cAMP

15

QBQ-3401 / Biologia Molecular 2008

2. O que são protooncogenes e oncogenes? Que tipos de proteínas estes genes podem codificar?

3. A proteína c-src é homóloga à proteína viral oncogênica conhecida com v-src e atua como tirosina

quinase citossólica, cuja atividade é regulada por fosforilação. Qual a característica de v-src que a torna

uma proteína oncogênica.

4. Qual o tipo de modificação covalente reversível em proteínas mais frequente nas cascatas de

sinalização intracelular? Quais são as enzimas que catalisam esta modificação?

5. O cAMP (AMP cíclico) é um importante mensageiro secundário para muitos hormônios. Como

pode ocorrer a ativação da enzima adenilato ciclase após ativação de um receptor hormonal?

6. Como a transcrição de certos genes pode ser influenciada em resposta a um sinal extracelular?

7 A predisposição ao câncer pode ser hereditária. Explique este fato lembrando-se que existem

proteínas que agem como supressores do crescimento celular.

8. Retinoblastoma, um câncer de retina que aflige crianças, está asssociado a uma deleção no

cromossomo 13. Proponha uma possível função para o gene selvagem (Rb) e que codifica uma

proteína de 105 kD localizada no núcleo e capaz de se ligar ao DNA.


Exercício 9. Tecnologia do DNA recombinante

16

QBQ-3401 / Biologia Molecular 2008

1. A figura na página seguinte mostra o autorradiograma de um gel de sequenciamento de DNA pelo

método de Sanger. Escreva a seqüência deste fragmento de DNA lendo o gel de baixo para cima.

Traduza a seqüência obtida, considerando as três fases de leitura. O que aconteceria se durante a leitura

do gel você tivesse omitido uma base? Como você faria para ter segurança absoluta da seqüência deste

fragmento de DNA?

2. O que a diferencia a técnica de Southern blot da técnica de Northern blot?

3. Você gostaria de analisar os níveis de expressão do gene que codifica a proteína A de um fungo em

resposta ao estresse hipertérmico. Que metodologias poderia utilizar? Por outro lado, se você quiser

analisar simultaneamente os níveis de expressão de milhares de genes deste fungo na mesma condição,

qual seria a metodologia mais adequada?

4. Qual a diferença entre uma biblioteca genômica e uma biblioteca de cDNA? Explique como a

presença de íntrons em genes eucarióticos complica a geração de produtos protéicos que eles codificam

quando a expressão é feita em bactéria. Como se pode resolver este problema?

5. A partir de uma biblioteca de cDNA você isolou um cDNA completo que codifica para uma proteína

que é um potente estimulador do sistema imunológico. Agora você deseja clonar este cDNA em um

vetor de expressão para produzir grande quantidade desta proteína em E. coli. O cDNA possui nas

suas extremidades sítios para enzima BamHI e você planeja cloná-lo no sítio de BamHI do vetor de

expressão. Esta é sua primeira vez com experimentos de clonagem e você decide seguir

cuidadosamente as instruções do manual de clonagem que recomenda que o vetor digerido deve ser

tratado com fosfatase alcalina para remover o fosfato da extremidade 5’.

a) Por que deve ser feito o tratamento com fosfatase alcalina?

b) Como você analisaria se a clonagem foi bem sucedida?

c) A proteína de seu interesse afeta o crescimento das bactérias. Como você faria para obter grande

quantidade desta proteína recombinante?


G A T C

17

QBQ-3401 / Biologia Molecular 2008


18

QBQ-3401 / Biologia Molecular 2008

6. O gene completo (contendo todos os exons e íntrons) do hormônio de crescimento de ratos pode ser

expresso em camundongos sob o controle de um promotor indutível por Cd 2+ . Como podem ser

obtidos tais camundongos transgênicos? Quais as suas características? Como você explica o fato da

expressão do gene do rato ser expresso perfeitamente em camundongos?

7. Planeje a obtenção de cabras transgênicas que possam produzir o hormônio de crescimento humano

em seu leite.

8. Há poucos anos, cientistas europeus realizaram a clonagem de uma ovelha (Dolly), a partir de

células de uma ovelha adulta. Compare este tipo de experiência com a obtenção de um animal

transgênico.


ROTEIRO PARA AS

AULAS PRÁTICAS

19

QBQ-3401 / Biologia Molecular 2008


RECOMENDAÇÕES:

ROTEIRO PARA AULAS PRÁTICAS

20

QBQ-3401 / Biologia Molecular 2008

1. Por razões de segurança não será permitido ao aluno frequentar as aulas sem avental. É PROIBIDO

COMER, BEBER E FUMAR NO LABORATÓRIO.

2. Leia com detalhe o protocolo e preste atenção às instruções fornecidas antes de iniciar a experiência.

3. Procure utilizar reagentes, vidraria e equipamentos disponíveis com cuidado, para evitar desperdício

e quebra.

4. Mantenha sua área de trabalho organizada. Ao terminar a experiência passe água na vidraria

utilizada e coloque-a no local indicado.

5. O relatório individual deverá ser entregue no final de cada uma das aulas práticas. O relatório deverá

ser feito de acordo com modelo ao final de cada protocolo experimental. Após preenchidas, as

respectivas folhas devem ser destacadas e entregues.

6. Qualquer dúvida ou acidente peça auxílio às técnicas, às monitoras ou à professora.

USO DO AVENTAL NAS AULAS PRÁTICAS

É OBRIGATÓRIO.


21

QBQ-3401 / Biologia Molecular 2008

EXPERIÊNCIA N o. 1: EXTRAÇÃO DE DNA (E RNA) DE Escherichia coli.

Fundamento

Freqüentemente é necessária a purificação de DNA de alto peso molecular para sua

manipulação e análise subsequentes. Procedimentos mais comuns para preparação de DNA genômico

bacteriano consistem na lise das bactérias com a utilização de lisozima e/ou detergente, seguida de

extrações com solventes orgânicos (fenol/clorofórmio) para remoção de proteínas. Os ácidos nucléicos

são então precipitados com etanol na presença de concentrações relativamente altas de sal (0,1M

0,5M). Na obtenção de DNA de alto peso molecular (molécula longa e fibrosa) devem ser tomados

cuidados para se evitar sua fragmentação.

Material

- 2 Tubos de ensaio médio

- 1 Proveta de 50 mL

- 1 cálice graduado

- 1 bastão de vidro

- 1 tubo de centrifuga

- 1 recipiente de descarte c/ lisoforme

- 10 mL de SDS 10%

- 10 mL de NaCl 1%

- 1 frasco de Clorofórmio c/ Álcool Isoamílico na Capela

- 1 frasco de Etanol no freezer -20 °C

Procedimento Experimental

Será utilizada uma cultura de bactérias E.coli HB101 que foi inoculada ontem no final da tarde em

meio de cultura líquido esterilizado (meio LB: triptona 1%, extrato de levedura 0,5%, NaCl 1%, pH

final ajustado para 7,5 com NaOH) e mantida sob agitação vigorosa a 37°C até hoje pela manhã,

quando a cultura foi transferida para a geladeira.

1. Coletar as bactérias pela centrifugação de 20mL da cultura a 5000rpm por 5 min. Descartar o meio

de cultura em um frasco contendo Lisoform a 10 %. Secar bem o tubo, invertendo-o sobre papel

absorvente. Balancear os tubos!

2. Adicionar 6mL da solução I (citrato de sódio 0,015M, NaCl 0,15M, pH final ajustado para 7,0 com

HCl). Tampar o tubo e ressuspender o precipitado de bactérias por inversão.

3. Remover a tampa e adicionar 0,7mL da solução II [Dodecil Sulfato de Sódio (SDS) 10% (m/V)].

Fechar o tubo e incubá-lo em banho-maria a 60°C por 10 min, com agitação manual suave.

4. Retirar o tubo do banho, abrir e deixá-lo a temperatura ambiente por 5min. Adicionar igual volume

(6,7mL) da solução III (Clorofórmio:alcool isoamílico 24:1 V/V). Não pipetar com a boca! Fechar

muito bem o tubo. Agitar suavemente por 10 min à temperatura ambiente. Esta etapa deve ser realizada

na capela de exaustão.


5. Centrifugar 5 minutos a 5000 rpm.

22

QBQ-3401 / Biologia Molecular 2008

6. Remover delicadamente a fase aquosa (fase superior) com pipeta Pasteur de ponta grossa para uma

proveta. Estimar o volume e transferir para um cálice graduado.

7. Medir, na mesma proveta, 2 volumes de etanol resfriado a -20°C e adicioná-lo lentamente com

pipeta Pasteur, pela parede do cálice.

8. "Enrolar" o DNA com uma pipeta Pasteur de ponta curva. Transferí-lo para um tubo de ensaio

contendo 10mL de Solução IV (NaCl 1%). Aquecer a 50 o C, por 10-20 minutos, até completa

dissolução.

9. Identificar o tubo com o número do grupo. Tomar uma alíquota e diluir em 1 mL de água. Medir a

D.O.260nm e D.O.280nm e calcular a relação D.O.260nm /D.O.280nm. Estimar a quantidade de DNA obtida

assumindo que D.O.260nm (Densidade Óptica a 260nm) = 1 equivale a 50µg DNA/mL.


RELATÓRIO - EXPERIÊNCIA N o. 1

Grupo N o. Data

Nomes dos Integrantes do Grupo:

OBJETIVO DA EXPERIÊNCIA:_________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

RESULTADOS OBTIDOS :_____________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

23

QBQ-3401 / Biologia Molecular 2008


QUESTÕES:

24

QBQ-3401 / Biologia Molecular 2008

1. Qual a função do SDS, Clorofórmio: Álcool Isoamílico e Etanol nas etapas da purificação?

Consultar tabela (no fim da apostila).

2. Por que é possível "enrolar" o DNA no bastão de vidro?

3. Cite dois cuidados importantes para o sucesso da experiência realizada.

4. Se compararmos as medidas de absorção a 260nm e a 280nm da amostra de DNA obtida e de uma

solução de DNA puro obtido a partir do mesmo volume inicial de cultura de bactérias, o que

observaríamos? Por que?


25

QBQ-3401 / Biologia Molecular 2008

5. Qual o espectro de absorção do DNA na luz ultravioleta. Como se compara com o espectro de

absorção de albumina?

6. Como você faria para obter DNA puro a partir dessa preparação que contém DNA e RNA?

7. Por que ocorre o efeito hipercrômico na desnaturação do DNA?


26

QBQ-3401 / Biologia Molecular 2008

EXPERIÊNCIA N o. 2: TRANSFORMAÇÃO DE BACTÉRIAS COM

PLASMÍDEOS CONTENDO GENES DE RESISTÊNCIA A ANTIBIÓTICOS.

Fundamento

A técnica de transformação permite a introdução de plasmídeo em uma bactéria e sua

manutenção como um elemento autônomo auto-replicativo. Este plasmídeo pode conferir à bactéria

hospedeira certas propriedades (por exemplo, resistência a drogas) que podem ter valor seletivo no

meio. Várias técnicas são disponíveis para transformar uma bactéria. Na aula prática usaremos o

método do CaCl2. Neste método as bactérias são submetidas a um tratamento num meio hipotônico

contendo cálcio que as torna competentes para a transformação pelo DNA plasmidial. Usaremos o

plasmídeo pBR322 (ver mapa abaixo).

O plasmídio pBR322 é comumente usado para clonagem de genes inteiros ou de fragmentos de

genes. Além da origem de replicação que permite sua propagação em bactérias (E. coli) o pBR322

apresenta duas marcas genéticas, ou seja, genes que codificam para proteínas que conferem resistência

a ampicilina (ampr) e tetraciclina (tetr). Portanto a introdução de pBR322 em E. coli que normalmente

é sensível tanto à ampicilina como à tetraciclina, leva ao aparecimento de bactérias capazes de crescer

em meio (líquido ou sólido) contendo estes antibióticos.

Note que a introdução de genes exógenos no sítio da enzima de restrição Pst I leva à perda da

resistência à ampicilina, uma vez que este sítio está localizado na região ampr. Da mesma forma,

clonagem no sítio da enzima Bam HI leva à perda da resistência a tetraciclina.

Transformação de bactérias que são sensíveis a um antibiótico, em resistentes, será revelada

através de plaqueamento (inoculação) de bactérias em placas de ágar contendo meio LB (meio rico de

Luria Bertani) na ausência e na presença de antibióticos (ampicilina ou tetraciclina).

Procedimento Experimental


27

QBQ-3401 / Biologia Molecular 2008

O ideal seria fazermos a experiência em condições estéreis, para evitar contaminação. Como isto não

será possível, manipule convenientemente o material estéril fornecido. NÃO ABRA AS PLACAS DE

ÁGAR ATÉ O MOMENTO DE USO.

As bactérias competentes para transformação foram preparadas a partir de uma cultura em fase

exponencial do crescimento e através de sucessivas lavagens do precipitado de bactérias com uma

solução de CaCl2 e mantidas congelads a -80 o C.

1. Inocular 5 ml de meio LB líquido com uma colônia de bactérias HB101 (E. coli) e incubar à 37°C

até o dia seguinte sob forte agitação (200-250 rpm).

2. Diluir a pré-cultura 1/10 em 10 ml de meio LB, incubar à 37°C sob agitação até OD600nm =0,3 (fase

logarítmica de crescimento).

3. Transferir a cultura para o gelo, coletar as bactérias por centrifugação (4000 rpm, 5min).

Ressuspender o sedimento de bactérias em 10 ml de tampão acetato de sódio (frio) 20 mM pH 6,5

contendo CaCl2 0,1M. Incubar no gelo por 20 minutos.

4. Coletar as bactérias (4000 rpm, 5 min) e ressuspender em 1 ml do mesmo tampão (frio).

5. Após pelo menos 30 min no gelo estas BACTÉRIAS COMPETENTES podem ser transformadas.

6. Para transformar, distribuir 0,1 mL/tubo da suspensão de bactérias competentes para cada um de 2

tubos. Adicionar o DNA transformante (0,5 µg DNA de pBR322 em 10 µl de tampão 10 mM Tris pH

7,5 contendo 1 mM EDTA) a um dos tubos. O outro tubo será usado como controle (bactéria apenas).

7. Incubar em gelo por 15 min antes de dar o choque térmico (42°C por exatamente 90 segundos).

Transferir os tubos novamente para o gelo por 2 min.

8. Adicionar 0,9 ml/tubo de meio LB e incubar a 37°C sem agitação, em banho-maria, por uma hora.

9. Transferir 25µl ou 250µl da suspensão para placas de ágar LB e LB-A (LB contendo ampicilina ou

carbenicilina) previamente identificadas conforme a tabela abaixo. Espalhar as bactérias com o auxílio

de uma alça de vidro, previamente flambada e em seguida resfriada na própria tampa da placa de Petri.

10. Incubar as placas por __ h e contar as colônias formadas.

Número de colônias/ placa Placa LB Placa LB-A

#1 Bactérias controle 25µL

#2 Bactérias controle 250µL

#3 Bactérias transformadas 25µL

#4 Bactérias transformadas 250µL


RELATÓRIO - EXPERIÊNCIA N o. 2

Nome:

Grupo N o. Data

OBJETIVO DA EXPERIÊNCIA:________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

RESULTADOS OBTIDOS:

1. Preencher a tabela com o número de colônias obtido em cada caso.

#1 Bactérias controle 25µL

#2 Bactérias controle 250µL

#3 Bactérias transformadas 25µL

#4 Bactérias transformadas 250µL

28

Número de colônias/ placa

QBQ-3401 / Biologia Molecular 2008

Placa LB Placa LB-A

2. Qual a eficiência de transformação obtida, em termos de n° de colônias/ug de DNA?

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________


Nome:

QUESTÕES:

29

QBQ-3401 / Biologia Molecular 2008

1. Por que se usa cultura em fase exponencial de crescimento para obter bactérias competentes?

2. Qual o papel do choque térmico?

3. Por que as bactérias devem ser incubadas por 60 min a 37°C antes de espalhá-las em placas de ágar?

4. Que utilidade teria esta técnica do ponto de vista biotecnológico? Dê um exemplo.


30

QBQ-3401 / Biologia Molecular 2008

EXPERIÊNCIA N o. 3: INDUÇÃO DA β-GALAGTOSIDASE POR IPTG.

Fundamento

A β-galactosidase de E.coli é uma enzima indutível que hidrolisa β-D-galactosídeos. A atividade desta

enzima pode ser medida com substratos cromogênicos que quando hidrolisados dão origem a produtos

coloridos. Um exemplo é o orto-nitrofenil-β-D-galactosídeo (ONPG) que é incolor, mas na presença de

β-galactosidase é convertido a galactose e orto-nitrofenol. O orto-nitrofenol é amarelo e sua absorção

pode ser medida a 420nm. Altos níveis de β-galactosidase só são medidos em culturas crescendo na

presença de lactose ou de um indutor não metabolizável, o IPTG (isopropil-tiogalactosídeo).

Procedimento Experimental

Será utilizada uma pré-cultura de bactérias E.coli CSH23 que foi semeada ontem no final da tarde em

meio de cultura líquido esteril e mantida até hoje pela manhã, quando a cultura foi transferida para

geladeira.

1. Tomar uma alíquota da pré-cultura de bactérias e diluir em meio líquido na presença e ausência de

IPTG (1mM) sob agitação vigorosa a 37°C até a cultura atingir D.O.600nm (Densidade Óptica a 600nm)

= 0,7. Esfrie as culturas no gelo por 20 min.

2. Retirar 0µL, 50µL e 100µL de cada cultura, transferindo separadamente para 3 tubos Eppendorf

previamente identificados. Complete com água para um volume final de 100µL. Adicione 0,7mL de

tampão de ensaio (tampão fosfato de sódio 0,1M pH 7,0 contendo KCl 10mM, MgSO4 1mM e βmercaptoetanol

50mM).

Não descarte o restante das culturas, mantendo-as no gelo.

3. Adicionar 50 µL de cloroformio. Agitar bem. Incubar os tubos em banho de água a 30 o C por 5 min.

-IPTG +IPTG

Cultura - 50µl 100µl 50µl 100µl

H2O 100µl 50µl - 50µl -

T.E. 700µl 700µl 700µl 700µl 700µl

Clorofórmio 50µl 50µl 50µl 50µl 50µl


31

QBQ-3401 / Biologia Molecular 2008

4. Iniciar a reação pela adição de 200 µL de ONPG (4mg/mL) e incubar a mistura de reação em banho

de água a 30 o C por 10 min.

5. Interromper a reação adicionando 0,4mL de Na2CO3 1M.

6. Centrifuguar os tubos por 5 minutos na minicentrífuga.

7. Remover delicadamente o sobrenadante de cada tubo para a cubeta sem retirar o clorofórmio, e faça

a leitura da D.O.420nm (Densidade Óptica a 420nm). Enxaguar as cubetas com água entre a cada leitura.

8. Fazer uma diluição 1:10 das culturas de E.coli e faça a leitura da D.O.600nm (Densidade Óptica a

600nm).

9. Calcular a atividade de β-galactosidase das duas culturas:

Atividade de β-galactosidase =

1000 × D.

O.

420nm

tempo (min) × volume ( mL)

× D.

O.

600nm

RELATÓRIO - EXPERIÊNCIA N o. 3

UNIDADES

da cultura


Nome:

Grupo N o. Data

OBJETIVO DA EXPERIÊNCIA:________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

RESULTADOS OBTIDOS :_____________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

32

QBQ-3401 / Biologia Molecular 2008


Nome:

QUESTÕES:

1. O que você pode concluir sobre o genótipo da cepa CSH23?

33

QBQ-3401 / Biologia Molecular 2008

2. O que você esperaria encontrar em um experimento semelhante utilizando uma cepa cujo genótipo é

I - O + Z + ? E no caso de uma cepa I + O - Z + ? Proponha um experimento para distinguir entre estas cepas.


34

QBQ-3401 / Biologia Molecular 2008

EXPERIÊNCIA N o. 4: DIGESTÃO DE DNA PLASMIDIAL COM ENZIMAS DE

RESTRIÇÃO e ELETROFORESE DE DNA EM GEL DE AGAROSE

Fundamento

Preparações de DNA plasmidial ou cromossomal purificadas podem ser submetidas a digestão com

enzimas de restrição para identificação e caracterização do DNA. A escolha das enzimas de restrição

deve ser baseada no mapa de restrição (quando disponível) ou opta-se pelo emprego de um conjunto de

enzimas de forma a permitir a caracterização do DNA em questão, ou seja, obter seu mapa físico. As

enzimas de restrição classificam-se em 3 gupos quanto a força iônica para a atividade (alta, média e

baixa). As enzimas de restrição comercialmente disponíveis costumam vir acompanhadas do tampão

correspondente e instruções para realizar a reação.

Procedimento experimental

A - Digestão do DNA com enzimas de restrição

Na experiência a ser realizada o DNA do plasmídeo será digerido com 4 enzimas de restrição

diferentes.

Cada grupo (ver tabela abaixo) receberá um tubo Eppendorf contendo os componentes da

reação com exceção do DNA plasmidial. Manter o tubo em banho de gelo.

- Cada aluno deverá providenciar uma folha de papel monolog para construção do gráfico

(Questão 3).

1. Acrescentar 10µL da solução de plasmídeo (DBQ1, 150ng/10µL) no tubo.

GRUPOS 1,7,13,19 2,8,14,20 3,9,15,21 4,10,16,22 5,11,17,23 6,12,18,24

EcoRI BglII EcoRI e EcoRI e BglII e sem enzima

BglII XbaI XbaI

H2O 7 µL 7 µL 6 µL 6 µL 6 µL 10µL

Tampão da

enzima (10X)

2 µL 2 µL 2 µL 2 µL 2 µL -

Enzima (1 U) 1µL 1µL 1µL / 1µL 1µL / 1µL 1µL / 1µL -

Plasmídeo 10µL 10µL 10µL 10µL 10µL 10µL

Volume total 20µL 20µL 20µL 20µL 20µL 20µL

2. Misturar o conteúdo dos tubos por agitação e centrifugação rápida.

3. Incubar a reação em banho maria a 37°C durante 60min.

4. Interromper a reação pela adição de 1µL EDTA 0,1 M (Opcional). Transferir o tubo para um banho

a 65°C, durante 15min. Retirar o tubo do banho e rapidamente colocá-lo em gelo.

5. Adicionar a cada um dos tubos 5µL de tampão da amostra. Misturar e centrifugar. A amostra está

pronta para ser analisada em eletroforese em gel de agarose.


35

QBQ-3401 / Biologia Molecular 2008

Tampão de digestão 10X Tampão da amostra

Tris-HCl 100mM - 500mM* Tris 10mM pH 8,

NaCl 500mM-1M* EDTA 1mM pH 8,

MgCl2 100mM azul de bromofenol 0,25% p/v

DTT 10mM xileno cianol 0,25% p/v

*(depende da enzima) sacarose 40% p/v

B. Fracionamento do DNA em gel de agarose.

Preparo do gel de agarose 1,0%

OBS: Serão montados dois géis com espaço para aplicação de até 14 amostras

1. Pesar 1,0 g de agarose. Adicionar 100mL de tampão TBE (Tris-borato 89mM, EDTA 2mM pH 8).

2. Aquecer em banho fervente e misturar até completa dissolução da agarose. Enquanto espera-se a

dissolução da agarose, preparar a forma para o gel. Resfriar até 40°C (até conseguir segurar com as

mãos) e acrescentar 5µL de uma solução de brometo de etídio 10mg/mL. CUIDADO BROMETO DE

ETÍDIO É CARCINOGÊNICO!

Despejar sobre a forma para o gel previamente preparada, incluindo a colocação do pente. Deixar

solidificar por pelo menos 30min.

3. Retirar o pente e transferir o gel para a cuba. Adicionar tampão TBE à cuba de modo a cobrir o gel

com menor volume possível.

4. Aplicar as amostras preparadas na experiência anterior. Ligar a fonte de eletroforese e aplicar

aproximadamente 100V. Cuidado para não tocar o tampão.

5. Interromper a eletroforese quando o corante azul estiver a 0,5cm do fim do gel.

6. Tranferir o gel para o transiluminador e, em seguida observar o gel sob luz UV, utilizando óculos

protetores. Fotografar o padrão de bandas observado com uma régua posicionada na lateral do gel.

OBS: Ordem de aplicação das amostras nos géis

GEL 1: 1 - 2 - 3 - 4 -5 6 - Padrão de tamanho - 7 - 8 - 9 10 11- 12

GEL 2: 13 - 14 -15 16 17 18 - Padrão de tamanho - 19 20 21 22 23 24


RELATÓRIO - EXPERIÊNCIA N o. 4

Nome:

Grupo N o. Data

OBJETIVO DA EXPERIÊNCIA:________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

RESULTADOS OBTIDOS: :____________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

_____________________________________________________________________

36

QBQ-3401 / Biologia Molecular 2008


Nome:

QUESTÕES:

1. Por que se observam duas bandas no plasmídeo que não foi incubado com a enzima?

2. Por que se utiliza EtBr (Brometo de Etídio) no gel e no tampão da eletroforese?

37

QBQ-3401 / Biologia Molecular 2008

3. Géis de agarose podem ser usados para análise de fragmentos de DNA que tenham entre 70 e

800.000 pares de base. Assim, é possível estimar o tamanho e a quantidade dos fragmentos de DNA. O

tamanho pode ser estimado tomando-se por base a sua mobilidade em relação à de outros de tamanho

conhecido. Se o gel foi fotografado com uma régua ao lado, a mobilidade relativa pode ser lida

diretamente da foto. O gráfico da mobilidade em cm (M) contra o tamanho em pb (L) dará uma curva

que pode ser usada para leitura do tamanho com relação a uma determinada mobilidade. Entretanto, a

interpolação é muito mais precisa se a função puder ser encontrada em uma linha reta: gráfico de log L

versus M. Desenhe a reta utilizando papel monolog (eixo x, mobilidade em cm, eixo y, tamanho em

pb). Usando-se a mistura de padrões de tamanho em pb conhecida calcule o tamanho dos fragmentos

obtidos da digestão do pQBQ com as enzimas utilizadas. Faça um desenho do pQBQ indicando a

posição dos sítios de clivagem para estas enzimas.


Força iônica

baixa ("Salting in")

alta ("salting out)

Meio ácido 0,5N

(brando) à frio

Meio alcalino brando

(0,3N KOH; 37°C; 18h)

Solvente orgânico

(cte dieletr. < que da H 2 O)

ex.: etanol, isopropanol

Agentes desnaturantes que

quebram pontes de H

ex.: formamida, uréia

Luz UV (260 nm)

Calor

Nucleases

38

QBQ-3401 / Biologia Molecular 2008

PROPRIEDADES FÍSICO-QUÍMICAS DOS ÁCIDOS NUCLEICOS

Solubiliza

Precipita

Precipita

Despurina

ss: estável

ds: desnatura

Precipita

ss: estável

ds: desnatura

DNA RNA

ss: absorve mais

ds: absorve menos

ss: estável

ds: desnatura (T m )

Solubiliza

Precipita

Precipita

Despurina

Hidrolisa

2' e 3'nucleosídeos

Precipita

1ária: estável

2ária: destruída

Absorve

1ária: estável

2ária: destruída

Exonucleases + +

Endonucleases + +


ANTIBIÓTICOS

INIBIDORES DE TRANSCRIÇÃO OU DE TRADUÇÃO

39

QBQ-3401 / Biologia Molecular 2008

Rifamicina (Streptomyces) Rifampicina (sintética)

Inibe iniciação da transcrição (impede a formação da la. ligação fosfódieser) mas não inibe

elongação da cadeia de mRNA. Liga-se à subunidade β de RNAP.

Actinomicina D: Estrutura: 2 peptídeos + 3 anéis benzeno fenoxazona (ver p 715 Stryer). Extraída de

Streptomyces. Inibe transcrição. Liga-se a dsDNA impedindo que seja usado como template. Anéis

fenoxazona intercalam-se entre as bases nitrogenadas do RNA. Usado em tratamento de câncer.

α-Amanitina (octapeptídeo cíclico) de um cogumelo (Amanita)

Inibe RNAPII (muito) e III (um pouco, em maior concentração).

Liga-se a RNAPII bloqueando a formação de mRNA ou de precursores de mRNA. Inibe

elongação.

Puromicina: Inibe tradução. Análogo de aminoacil-tRNA. Liga-se ao sítio A do ribossomo, impedindo

a entrada de aminoacil-tRNAS.

Foma ligação peptídica com a cadeia polipeptídica nascente (peptidil transferase). Peptidilpuromicina:

peptídeo liberado do ribossomo contendo puromicina ligada covalentemente ao Cterminal.

Tetraciclina: Liga-se ao sítio A do ribossomo, impede ligação de aminoacil-tRNA neste sítio.

Cloranfenicol: Só inibe a síntese de proteínas de procariotos e mitocôndira (não inibe a síntese protéica

extramitocondrial de eucariotos).

Cicloheximida: Inibe a formação dos ribossomos de eucariotos (80S), mas não de procariotos (70S).

Estreptomicina: Causa leitura incorreta do código genético.

TOXINAS

Diftérica: Inibe síntese protéica. Alvo é EF 2 que cataliza a translocação do peptídeo.

O fragmento A da toxina cataliza a transferência de ADP para EF2 (ADP-ribosilação)

inativando este fator de elongação da cadeia polipeptídica.

Ricina: Inativa a subunidade 60S dos ribossomos eucarióticos.


cadeia.

CÓDIGO GENÉTICO

UUU Phe UCU Ser UAU Tyr UGU Cys

UUC Phe UCC Ser UAC Tyr UGC Cys

UUA Leu UCA Ser UAA STOP UGA STOP

UUG Leu UCG Ser UAG STOP UGG Trp

CUU Leu CCU Pro CAU His CGU Arg

CUC Leu CCC Pro CAC His CGC Arg

CUA Leu CCA Pro CAA Gln CGA Arg

CUG Leu CCG Pro CAG Gln CGG Arg

AUU Ile ACU Thr AAU Asn AGU Ser

AUC Ile ACC Thr AAC Asn AGC Ser

AUA Ile ACA Thr AAA Lys AGA Arg

AUG Met ACG Thr AAG Lys AGG Arg

GUU Val GCU Ala GAU Asp GGU Gly

GUC Val GCC Ala GAC Asp GGC Gly

GUA Val GCA Ala GAA Glu GGA Gly

GUG Val GCG Ala GAG Glu GGG Gly

40

QBQ-3401 / Biologia Molecular 2008

AUG é parte do sinal de iniciação e também é o códon para as metioninas internas à

More magazines by this user
Similar magazines