Mutatieanalyse voor longcarcinoom patienten Nils 't Hart ... - VAP

More documents

Recommendations

Info

Van DNA naar eiwit DNA bestaat uit 4 basen: A, T, C en G CTTGGAGCTGGTGGCGTAGGC DNA wordt dmv. codons vertaald in aminozuren: CTT GGA GCT GGT GGC GTA GGC Leu Gly Ala Gly Gly Val Gly Meerdere aminozuren vormen polypeptide keten ‐> Meerdere polypeptides vormen eiwit
EGFR mutaties
Page 1: Mutatieanalyse voor longcarcinoom p
Page 4 and 5: Theoretische achtergrond
Page 8 and 9: Klassieke PCR
Page 10 and 11: Ladder PCR
Page 12 and 13: Sanger sequencing
Page 14 and 15: De longcarcinoom patiënt
Page 16 and 17: Probleem Verkrijgen geschikt mater
Page 18 and 19: A: Microdissectie
Page 20 and 21: Real‐time PCR en HRM
Page 22 and 23: Binding tussen nucleotiden
Page 24 and 25: Blot na PCR en HRM
Page 26 and 27: Pyrosequencing
Page 28 and 29: Beschikbare technieken Klassieke P
Page 30 and 31: Aantallen EGFR/KRAS analyses op FNA
Page 32 and 33: Een HE-voor en -na wordt gemaakt te
Page 34 and 35: Positieve controle HRM voor KRAS co
Page 36 and 37: Basis lijn / wild-type HRM voor EGF
Page 38 and 39: Casus in duplo HRM voor EGFR exon 1
Page 40 and 41: Casus 1 Primerpaar 745 746 747 748
Page 42 and 43: Voorbeeld verslag Moleculaire analy
Page 44 and 45: Casus 2, pyrogram KRAS wildtype KRA
Page 46 and 47: KRAS mutaties Puntmutaties in codo

Mutatieanalyse voor longcarcinoom patienten Nils 't Hart ... - VAP

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?