EAU Programme - edizioni scripta manent planet

It’s easy to save money on your flights if you fly the Star Alliance 

network. Simply quote the event code SK01A57 when you make your 

booking with any Star Alliance member airline and you’ll automatically 

get a discount of up to 20%. 

The Star Alliance network has 27 member airlines with over 21,900 

flights a day so we can offer you a lot more choice when planning your 

travel. For more information about our member airlines and contact 

details, please visit our website at staralliance.com/conventionsplus 

staralliance.com 

Information correct as at 11/2012

Contents 

Welcome 3 

EAU Sponsors and Contributors 4 

Synopsis & Venue 

EAU Award Winners 6 

Acknowledgement of Abstract reviewers 9 

Floorplans 12 

Synopsis 15 

Exhibition Floorplans 30 

Alphabetical list of Exhibitors 34 

General 

General Information 39 

Speaker Guidelines 46 

CME Accreditation 47 

EU-ACME Programme 48 

Congress Hotels 49 

EAU Programme Friday, 15 March 53 

EAU Programme Saturday, 16 March 75 

EAU Programme Sunday, 17 March 143 

EAU Programme Monday, 18 March 233 

EAU Programme Tuesday, 19 March 317 

ESU Courses and Hands-on Training Courses 

ESU Courses 321 

ESU/ESUT Hands-on Training Courses 373 

Sponsored Sessions 397 

About EAU 

EAU Membership 423 

EAU Offices 424 

Historical Overview EAU Congresses 427 

Indices 

Abstract Authors 429 

Abstracts sorted by Topic 467 

Sessions sorted by Topic 470 

List of Speakers (not abstracts) 471 

“The EAU Scientific Congress Office is responsible for the scientific 

congress programme (with the exception of the sponsored sessions). 

However, the opinions and recommendations expressed by 

the presenters and planners of educational content in this programme 

are their own and do not necessarily represent the viewpoint 

of the EAU” 

2 Programme Book

Welcome to Milan 

by the EAU Secretary General and the Congress President 

Dear friends and colleagues, 

We are delighted to have you here with us at the 28th Annual EAU Congress, in the beautiful 

city of Milan! The congress thrives on your enthusiastic participation and continuous support 

and we thank you for bringing your experience and your ideas to this international gathering. 

Milan is a wonderful host city and we are very excited to return to the recently renovated venue 

of MiCo – Milano Congressi. It features all the latest facilities to accommodate an event of this 

scope and we believe that it will provide a perfect setting for our forward-looking discussions. 

From a full-day live surgery event in the eURO Auditorium to the state-of-the art technology 

shown on the exhibition floor, the congress will draw much of its inspiration from the promises 

of the future. 

The scientific programme of the congress is once again very diverse – both in format and 

content. We have made sure to meet the needs of the whole urological community and address 

a wide range of pressing topics. At the same time we will be continuing some of the ongoing 

discussions, such as screening for prostate cancer and adding new evidence and experience to 

these controversial topics. Over 1,500 faculty members will be delivering the latest information 

in urology and sharing the most relevant best practices in the course of five days – a scientific 

effort of an incredible scale, which will certainly inspire many of us to further grow within this 

field and contribute to its development. 

If you are looking for practical information and a hands-on experience, the European School of 

Urology has prepared nearly 40 courses to choose from. Highly interactive and always popular, 

the courses are a great chance not only to learn, but also to meet new colleagues and build 

new contacts. 

We hope that your time in Milan will be productive and that it will be a source of great inspiration 

and knowledge for the year to come. We also wish you to have a very pleasant stay in 

Milan a city known for its architecture, exquisite restaurants and fashion! 

On behalf of the European Association of Urology, 

Per-Anders 

Abrahamsson 

EAU Secretary 

General 

Francesco 

Montorsi 

Congress 

President 

EAU Milan 2013 

3

EAU Sponsors & Contributors 

EAU Platinum Corporate sponsors 

AMGEN 

ASTELLAS 

GLAXOSMITHKLINE 

IPSEN 

EAU Gold Corporate Sponsors 

AMERICAN MEDICAL SYSTEMS 

ELI LILLY AND COMPANY 

FERRING PHARMACEUTICALS 

INTUITIVE SURGICAL 

JANSSEN PHARMACEUTICAL COMPANIES OF JOHNSON & JOHNSON 

KARL STORZ GMBH & CO.KG 

MILLENNIUM: THE TAKEDA ONCOLOGY COMPANY 

OLYMPUS EUROPA HOLDING GMBH 

PIERRE FABRE MÉDICAMENT 

SANOFI ONCOLOGY 

EAU Congress Contributors 

ALLERGAN 

BAYER HEALTHCARE PHARMACEUTICALS 

IBSA INSTITUTE BIOCHEMIQUE SA 

LUMENIS 

MENARINI 

NOVARTIS ONCOLOGY 

OM PHARMA 

PFIZER 

PORGÈS – A COLOPLAST DIVISION 

PRIME ONCOLOGY 

RECORDATI 

STEBA BIOTECH 


EAU Member 

Benefits at EAU 2013! 

EAU members are kindly invited to collect the following complementary 

items: 

EAU Pocket Guidelines 

The Pocket Guidelines - a booklet and CD including the EAU Guidelines 2013 - 

can be collected at OLYMPUS booth C01. 

The distribution is supported by OLYMPUS. 

EAU members are kindly invited to the EAU booth H17 to collect 

the following complementary items: 

EAU Extended Guidelines 

The EAU Extended urological guidelines edition 2013, are distributed at the 

EAU Square. 

De Historia Urologiae Europaeae Vol. 20 

This year marks the 20th edition of De Historia Urologiae Europaeae, the EAU History 

Office’s annual edited volume of Europe’s urological history. Beside the regular 

contributors from the History Office, newcomers tackle a broad range of fascinating 

topics. 

Congress delegates are kindly invited to collect the following 

complementary items: 

EAU Abstract CD 2013 

A CD containing all presented abstracts during the 28th Annual EAU Congress can be 

collected at FERRING booth E42. 

Supported by an educational grant from FERRING PHARMACEUTICALS. 

ESU Courses CD 2013 

A CD including all presentations and course materials of the ESU Courses given 

during the congress can be collected at MILLENIUM: The TAKEDA Oncology 

company, booth D30. 

Supported by an educational grant from MILLENIUM: The TAKEDA Oncology Company. 

EAU Poster DVD 2013 

A DVD containing the majority of the posters presented during the 28th Annual EAU 

Congress. The EAU Poster DVD can be collected at AMGEN booth D20. 

Supported by an unrestricted educational grant from AMGEN. 

European 

Association 

of Urology 

Guidelines 

2013 edition 

European 

Association 

of Urology 

Pocket Guidelines 

2013 edition 

EUROPEAN EUROPEAN UROLOGY UROLOGY 

EAU Posters 2013 

28th Annual EAU Congress 

EU-ACME 

accredited content 

SUPPLEMENTS 

SUPPLEMENTS 

Volume 12 Issue 1 March 2013 

ESU Courses 2013 

28th Annual EAU Congress 

Abstracts 28th Annual EAU Congress

Awards 

EAU Award Winners 

EAU Willy Gregoir Medal 2013 

For a significant contribution to the development of the urological specialty in Europe 

C-C. Abbou, Creteil, France 

EAU Frans Debruyne Life Time Achievement Award 2013 

For a longstanding and important contribution to the activities and development of the EAU 

J. Breza, Bratislava, Slovakia 

EAU Crystal Matula Award 2013 

For a young promising European urologist 

P. Boström, Turku, Finland 

Supported by an unrestricted educational grant from LABORIE 

EAU Hans Marberger Award 2013 

For the best European paper published on Minimally Invasive Surgery (in Urology) 

J. Rassweiler, Heilbronn, Germany 

iPad-Assisted Percutaneous Access to the Kidney Using Marker-Based Navigation: Initial 

Clinical Experience 

M. Müller, M. Fangerau, J. Klein, A. Goezen, P. Pereira, H-P. Meinzer, D. Teber (Heilbronn, 

Germany) 

European Urology (2012), doi 10.1016/j.eururo.2011.12.024 

Supported by an unrestricted educational grant from KARL STORZ GMBH & CO.KG 

EAU Innovators in Urology Award 2013 

For inventions and clinical contributions which have had a major impact on influencing the 

treatment and/or diagnosis of a urological disease 

U. Studer, Berne, Switzerland 

EAU Prostate Cancer Research Award 2013 

For the best paper published on clinical or experimental studies in prostate cancer 

I. Ahmad, Glasgow, United Kingdom 

HER2 overcomes PTEN (loss) - induced senescence to cause aggressive prostate cancer 

R. Patel, L. Babloo Singh, C. Nixon, M. Seywright, R. Barnetson, V. Brunton, W. Muller, 

J. Edwards, O. Sansom, H. Leung (Glasgow, Edinburgh, United Kingdom; Montreal, 

Canada) 

PNAS | September 27, 2011 | vol. 108 | no. 39 | 16397 

Supported by an unrestricted educational grant from the FRITZ H. SCHRÖDER FOUNDATION 

Prize for the Best Paper published on Fundamental Research in the Urological Literature 

E. Martens, S. Jalava, N. Dits, G. Van Leenders, S. Møller, J. Trapman, C. Bangma, 

T. Litman, T. Visakorpi, G. Jenster (Rotterdam, The Netherlands; Tampere, Finland; 

Vedbeak, Denmark) 

Diagnostic and prognostic signatures from the small non-coding RNA transcriptome in 

prostate cancer 

Oncogene (2012) 31, 978-991 – doi: 10.1038/onc.2011.304 

Prize for the Best Paper published on Clinical Research in the Urological Literature 

S. Shariat, M. Rink, B. Ehdaie, E. Xylinas, M. Babjuk, A. Merseburger, R. Svatek, E. Cha, 

S. Tagawa, H. Fajkovic, G. Novara, P. Karakiewicz, Q-D. Trinh, S. Daneshmand, Y. Lotan, 

W. Kassouf, H-M. Fritsche, F. Chun, G. Sonpavde, A. Joual, D. Scherr, M. Gonen (New 

York, San Antonio, Los Angeles, Dallas, Houston, United States of America; Hamburg, 

Hanover, Regensburg, Germany; Paris, France; Prague, Czech Republic; Padua, Italy; 

Montreal, Canada; Casablanca, Morocco) 

Pathologic Nodal Staging Score for Bladder Cancer: A Decision Tool for Adjuvant Therapy 

After Radical Cystectomy 

European Urology (2012) – accepted June 5, 2012 - doi: 10.1016/j.eururo.2012.06.008 

Prize for the Best Scientific Paper published in European Urology ® in 2012 

R. Rosenblatt, A. Sherif, E. Rintala, R. Wahlqvist, A. Ullén, S. Nilsson, P-U. Malmström, 

The Nordic Urothelial Cancer Group (Katrineholm, Stockholm, Uppsala, Sweden; Helsinki, 

Finland; Oslo, Norway) 

Pathologic Downstaging Is a Surrogate Marker for Efficacy and Increased Survival Following 

Neoadjuvant Chemotherapy and Radical Cystectomy for Muscle-Invasive Urothelial Bladder 

Cancer 

European Urology, Volume 61, Issue 6, June 2012, Pages 1229-1238 

Supported by an unrestricted educational grant from ELSEVIER 


Prize for the Best Scientific Paper published on Fundamental Research in European 

Urology ® by a young urologist (max. 35 years) in 2012 

R. Kandimalla, A. Van Tilborg, L. Kompier, D. Stumpel, R. Stam, C. Bangma, E. Zwarthoff 

(Rotterdam, The Netherlands) 

Genome-wide Analysis of CpG Island Methylation in Bladder Cancer Identified TBX2, TBX3, 

GATA2, and ZIC4 as pTa-Specific Prognostic Markers 

European Urology, Volume 61, Issue 6, June 2012, Pages 1245-1256 

Supported by an unrestricted educational grant from ELSEVIER 

Prize for the Best Scientific Paper published on Clinical Research in European Urology ® by 

a young urologist (max. 35 years) in 2012 

M. Rink, B. Ehdaie, E. Cha, D. Green, P. Karakiewicz, M. Babjuk, V. Margulis, J. Raman, 

R. Svatek, H. Fajkovic, R. Lee, G. Novara, J. Hansen, S. Daneshmand, Y. Lotan, W. Kassouf, 

H-M. Fritsche, A. Pycha, M. Fisch, D. Scherr, S. Shariat (New York, Dallas, Hershey, 

San Antonio, Los Angeles, Houston, United States of America; Hamburg, Regensburg, 

Germany; Montreal, Canada; Prague, Czech Republic; St. Poelten, Austria; Padua, Bolzano, 

Italy) 

Stage-Specific Impact of Tumor Location on Oncologic Outcomes in Patients With Upper and 

Lower Tract Urothelial Carcinoma Following Radical Surgery 

European Urology, Volume 62, Issue 4, October 2012, Pages 677-684 

First Prize for the Best Abstract (Oncology) 

J. Moll, R. Van Soest, J. Kumagai, R. Graeser, I. Hickson, G. Jenster, W. Van Weerden 

(Rotterdam, The Netherlands; Beerse, Belgium) - Abstract 824 

Abiraterone is able to block AR activation induced by accumulating levels of precursor 

hormones resulting from CYP17A1 inhibition 

Second Prize for the Best Abstract (Oncology) 

P. Sooriakumaran, L. Haendler, T. Nyberg, I. Heus, M. Olsson, S. Carlsson, M. Roobol, 

P. Wiklund (Stockholm, Sweden; Rotterdam, The Netherlands) - Abstract 912 

Comparative oncologic effectiveness of radical prostatectomy and radiotherapy in prostate 

cancer: An analysis of mortality outcomes in 34,515 patients treated with up to 15 years 

follow-up 

Third Prize for the Best Abstract (Oncology) 

H. Uemura, T. Kimura, K. Yoshimura, T. Minami, M. Nozawa, T. Nakagawa, H. Fujimoto, 

S. Egawa, A. Yamada, K. Itoh (Osaka, Tokyo, Fukuoka, Japan) - Abstract 98 

Combination therapy of peptide vaccines and dexamethasone for chemotherapy naïve 

castration resistant prostate cancer - a randomized phase-2 study 

First Prize for the Best Abstract (Non-Oncology) 

M. Lanz, C. Birchall, A. Ali, K. Walton, C.Townes, L. Lim, S. Roushias, P. Aldridge, 

R. Pickard, J. Hall (Newcastle Upon Tyne, United Kingdom) - Abstract 623 

Bacterial motility and NF-κB activation by clinical isolates from urinary tract infections 

Second Prize for the Best Abstract (Non-Oncology) 

K. Filipski, K. Deckmann, T. Bschleipfer, G. Krasteva-Christ, T. Papadakis, A. Rafiq, 

M. Wolff, I. Ibanez-Tallon, B. Schütz, E. Weihe, W. Kummer (Giessen, Berlin, Marburg, 

Germany) - Abstract 62 

A new cell in the urogenital tract - cholinergic chemosensory brush cells are sentinels of the 

urethra 

Third Prize for the Best Abstract (Non-Oncology) 

Y. Song, H. Lee, J. An, J. Yun, J. Kim, S. Doo, W. Yang, S. Kim (Seoul, South Korea) 

Abstract 325 

Repair of erectile dysfunction using transplantation of human mesenchymal stem cells 

cultivated on the surface of nanofibrous meshes in rats with cavernous nerve injury 

The European Urology ® Platinum Award 2013 

P-A. Abrahamsson, Malmö, Sweden 

W. Artibani, Verona, Italy 

J. Roelofswaard, Arnhem, The Netherlands 

M. Schlief, Arnhem, The Netherlands 

C. Schulman, Brussels, Belgium 

P. Teillac, Toulouse, France 

H. Van Poppel, Leuven, Belgium 

M. Wirth, Dresden, Germany 


7 

Awards

Awards 

EAU Award Winners 

First Prize for the Best Abstract by a resident 

G. Shaw, D. Lewis, J. Boren, A. Ramos-Montoya, D. Soloviev, R. Bielik, K. Brindle, D. Neal (Cambridge, United Kingdom) 

Abstract 833 

Monitoring the effects of therapeutic fatty acid synthase inhibition in prostate canecr using 11C acetate PET 

Second Prize for the Best Abstract by a resident 

F. Castiglione, P. Hedlund, F. Van Der Aa, T. Bivalacqua, M. Albersen (Milan, Italy; Leuven, Belgium; Baltimore, United 

States of America) - Abstract 324 

Intratunical injection of human adipose tissue-derived stem cells prevents fibrosis and is associated with improved erectile 

function in a rat model of Peyronie’s disease 

Third Prize for the Best Abstract by a resident 

A. Ingels, A. Thong, M. Saar, M. Valta, R. Nolley, J. Santos, H. Zhao, D. Peehl (Stanford, United States of America) 

Abstract 975 

Pre-clinical trial of a new dual mTOR inhibitor: INK128 for renal cell carcinoma 

Resident’s Corner Award for the Best Scientific Paper published in European Urology ® by a resident (2 awards) 

T. Hambrock, C. Hoeks, C. Hulsbergen-Van de Kaa, T. Scheenen, J. Fütterer, S. Bouwense, I. Van Oort, F. Schröder, 

H. Huisman, J. Barentsz (Nijmegen, Rotterdam, The Netherlands) 

Prospective Assessment of Prostate Cancer Aggressiveness Using 3-T Diffusion-Weighted Magnetic Resonance Imaging–Guided 

Biopsies Versus a Systematic 10-Core Transrectal Ultrasound Prostate Biopsy Cohort 

European Urology, Volume 61, Issue 1, January 2012, Pages 177-184 

E. Cha, L-A. Tirsar, C. Schwentner, P. Christos, C. Mian, J. Hennenlotter, T. Martini, A. Stenzl, A. Pycha, S. Shariat, 

B. Schmitz-Dräger (New York, United States of America; Nürnberg, Tübingen, Germany; Bolzano, Italy) 

Immunocytology Is a Strong Predictor of Bladder Cancer Presence in Patients With Painless Hematuria: A Multicentre Study 

European Urology, Volume 61, Issue 1, January 2012, Pages 185-192 

First video prize 

O. Ukimura, A. De Castro Abreu, M. Nakamoto, S. Shoji, S. Leslie, A. Berger, A. Goh, M. Desai, M. Aron, I. Gill (Los Angeles, 

United States of America) - Video: V79 

Novel surgical tile-pro navigation with 3D prostate cancer model during robot-assisted radical prostatectomy 

Second video prize 

A. Rao, R. Gray, H. Motiwala, M. Laniado, O. Karim (Wexham, United Kingdom) - Video: V78 

Sequential occlusion angiography using contrast enhanced ultrasound scan (CEUS) demonstrating the avascular plane of 

Brodel: An adjunct to a novel technique of zero-ischaemia robot-assisted partial nephrectomy 

Third video prize 

S. Crouzet, Lyon, France - Video: V77 

Alternative solution to current MIS robotic system 

EUSP Best Scholar Award 

L.F. Arenas Da Silva, Mullheim an der Ruhr, Germany 

Urethral Reconstruction using tissue Engineering Techniques 

8 Programme Book 

The 28th Annual EAU Congress features an EAU Award Gallery. Here you can find a 

complete overview of all EAU Awards that will be handed out during the Congress. 

It will also list the past winners of the most prestigious urology prizes. 

The EAU Award Gallery provides a great opportunity to take in all the important 

developments and breakthroughs in recent years. It can be found on Level S2 (between 

eURO Auditorium and the catering point), be sure to visit it!

Acknowledgement of Abstract reviewers 

The abstract sessions have been composed by and under the responsibility of the members of the EAU Scientific 

Congress Office & Video Committee (see page 425) who wish to acknowledge the following reviewers for their 

important contribution to the 28th Annual EAU Congress. 

H. Abol-Enein, Mansoura (EG) 

L.M. Abranches Monteiro, Lisbon (PT) 

E. Akkus, Istanbul (TR) 

P.C. Albertsen, Farmington (US) 

K. Albrecht, Hanover (DE) 

G.J. Alivizatos, Athens (GR) 

F.E. Ameye, Ghent (BE) 

K.M. Anson, London (GB) 

A. Apostolidis, Thessaloniki (GR) 

M. Auprich, Graz (AT) 

A. Avelino, Porto (PT) 

A.R. Azzouzi, Angers (FR) 

M. Babjuk, Prague (CZ) 

J. Baniel, Petach Tikva (IL) 

G. Barbagli, Arezzo (IT) 

J. Barkin, Toronto (CA) 

R. Bauer, Munich (DE) 

J. Bedke, Tübingen (DE) 

D. Behr-Roussel, Orsay (FR) 

J. Bellmunt, Barcelona (ES) 

M. Bennamoun, Paris (FR) 

A. Bex, Amsterdam (NL) 

C. Bolenz, Mannheim (DE) 

T.A. Borkowski, Warsaw (PL) 

A. Bossi, Villejuif (FR) 

M. Brausi, Modena (IT) 

A. Breda, Barcelona (ES) 

M. Brehmer, Stockholm (SE) 

E.K. Bres-Niewada, Warsaw (PL) 

S.D. Brookman-May, Regensburg (DE) 

R.T. Bryan, Birmingham (GB) 

R.J. Bryant, Oxford (GB) 

V. Bucuras, Timisoara (RO) 

M. Burger, Würzburg (DE) 

F.J. Burgos Revilla, Madrid (ES) 

I. Cagiannos, Ottawa (CA) 

F. Calais Da Silva Junior, Lisbon (PT) 

U. Capitanio, Milan (IT) 

S.V.C. Carlsson, Gothenburg (SE) 

D.M. Castro-Diaz, Santa Cruz de Tenerife (ES) 

I.T.R. Cavarretta, Milan (IT) 

Y. Ceder, Malmö (SE) 

H.M. Çek, Istanbul (TR) 

A. Cestari, Milan (IT) 

M.B. Chancellor, Royal Oak (US) 

E. Chartier-Kastler, Paris (FR) 

A.B. Chkhotua, Tbilisi (GE) 

P. Chlosta, Cracow (PL) 

F.K-H. Chun, Hamburg (DE) 

L. Cindolo, Vasto-Chieti (IT) 

M. Colombel, Lyon (FR) 

C.B. Congregado Ruiz, Seville (ES) 

M.R. Cooperberg, San Francisco (US) 

J-N.L. Cornu, Paris (FR) 

C.S.R. Costa, Porto (PT) 

S. Crouzet, Lyon (FR) 

C.D. Cruz, Porto (PT) 

B. Cuzin, Lyon (FR) 

J-E. Damber, Gothenburg (SE) 

R. De Gier, Nijmegen (NL) 

J.M. De La Morena Gallego, Madrid (ES) 

C. De Nunzio, Rome (IT) 

T.M. De Reijke, Amsterdam (NL) 

M. De Santis, Vienna (AT) 

S.G.G. De Wachter, Antwerp (BE) 

A. Descazeaud, Limoges (FR) 

F. Desgrandchamps, Paris (FR) 

T. Diemer, Giessen (DE) 

J. Dobruch, Warsaw (PL) 

B. Dore, Poitiers (FR) 

T.A. Drewa, Bydgoszcz (PL) 

B.A. Dybowski, Warsaw (PL) 

L. Dyrskjøt, Århus (DK) 

C.L. Eaton, Sheffield (GB) 

A.W. El-Kassaby, Cairo (EG) 

T. Esen, Istanbul (TR) 

K. Everaert, Ghent (BE) 

R. Favaretto, Sao Paulo (BR) 

A. Feyaerts, Brussels (BE) 

A.J. Figueiredo, Coimbra (PT) 

M.M. Fisch, Hamburg (DE) 

M. Fröhner, Dresden (DE) 

F. Fusco, Naples (IT) 

S. Füssel, Dresden (DE) 

A. Galan, Alicante (ES) 

A. Galfano, Milan (IT) 

A. Gallina, Monza (IT) 

R. Ganzer, Regensburg (DE) 

E. García-Cruz, Barcelona (ES) 

P.A. Geavlete, Bucharest (RO) 

G. Giannarini, Berne (CH) 

M. Giessing, Düsseldorf (DE) 

V. Gomez Dos Santos, Madrid (ES) 

F. Gómez Veiga, A Coruna (ES) 

P. Gontero, Turin (IT) 

A. Govorov, Moscow (RU) 


9 

Reviewers

Reviewers 

Acknowledgement of Abstract reviewers 

M. Graefen, Hamburg (DE) 

C. Gratzke, Munich (DE) 

F. Greco, Leipzig (DE) 

I. Gruenwald, Haifa (IL) 

O.W. Hakenberg, Rostock (DE) 

T. Hanus, Prague (CZ) 

H. Hashim, Bristol (GB) 

K. Hatzimouratidis, Pefka (GR) 

S.A. Haukaas, Bergen (NO) 

A. Heidenreich, Aachen (DE) 

T.R.W. Herrmann, Hanover (DE) 

P. Hoffmann, Brussels (BE) 

M. Hohenfellner, Heidelberg (DE) 

S. Holmäng, Gothenburg (SE) 

W. Horninger, Innsbruck (AT) 

A. Hoznek, Creteil (FR) 

J. Huguet Pérez, Barcelona (ES) 

C. Imbimbo, Naples (IT) 

D. Jacqmin, Strasbourg (FR) 

G. Jenster, Rotterdam (NL) 

S.G. Joniau, Leuven (BE) 

V. Joulin, Brest (FR) 

K. Junker, Jena (DE) 

T.M. Kessler, Zurich (CH) 

M. Khodari, Nanterre (FR) 

E. Kiely, Cork (IE) 

T. Klatte, Vienna (AT) 

M. Knowles, Leeds (GB) 

E. Kocjancic, Chicago (US) 

Z. Kopa, Budapest (HU) 

G. Kramer, Vienna (AT) 

M.P. Laguna, Amsterdam (NL) 

S. Larré, Reims (FR) 

T.A. Leslie, Oxford (GB) 

H.Y. Leung, Glasgow (GB) 

H. Leyh, Garmisch-Partenkirchen (DE) 

E. Liatsikos, Patras (GR) 

J.E. Lingeman, Indianapolis (US) 

B. Ljungberg, Umeå (SE) 

E. Lledo García, Madrid (ES) 

C. Llorente, Madrid (ES) 

T. Loch, Flensburg (DE) 

N. Longo, Naples (IT) 

J.J. Lopez-Tello Garcia, Madrid (ES) 

Y. Lotan, Dallas (US) 

N. Lumen, Ghent (BE) 

S. Madersbacher, Vienna (AT) 

N. Malats, Madrid (ES) 

P-U. Malmström, Uppsala (SE) 

M. Margreiter, Vienna (AT) 

J.I. Martínez Salamanca, Madrid (ES) 

M.P. Matikainen, Helsinki (FI) 


J. Mattelaer, Kortrijk (BE) 

M. Matuszewski, Gdansk (PL) 

M. May, Regensburg (DE) 

S. McClinton, Aberdeen (GB) 

R. Medina López, Seville (ES) 

A.S. Merseburger, Hanover (DE) 

R. Miano, Rome (IT) 

S. Micic, Belgrade (RS) 

G. Mickisch, Bremen (DE) 

K. Miller, Berlin (DE) 

A. Minervini, Florence (IT) 

K. Monastyrskaya, Berne (CH) 

N. Mondaini, Florence (IT) 

N. Mottet, Saint Etienne (FR) 

A. Mottrie, Aalst (BE) 

A. Muneer, London (GB) 

M. Muntener, Zurich (CH) 

F.J. Murat, Lyon (FR) 

V.W. Nitti, New York (US) 

G. Novara, Padua (IT) 

P.J. Nyirády, Budapest (HU) 

S. Oehlschläger, Dresden (DE) 

M. Oelke, Hanover (DE) 

S. Oudard, Paris (FR) 

D. Oxley, Bristol (GB) 

P. Palma, Campinas (BR) 

J.I. Pascual Piedrola, Pamplona (ES) 

A. Patel, London (GB) 

H. Payne, London (GB) 

S. Perner, Bonn (DE) 

D. Pushkar, Moscow (RU) 

R. Rabenalt, Düsseldorf (DE) 

M. Ramirez Backhaus, Valencia (ES) 

J. Ramon, Tel Aviv (IL) 

J. Rassweiler, Heilbronn (DE) 

P. Rehder, Innsbruck (AT) 

I. Rehman, Sheffield (GB) 

Y. Reisman, Amstelveen (NL) 

M. Remzi, Vienna (AT) 

D. Rengifo Abbad, Madrid (ES) 

C.A. Rentsch, Basel (CH) 

M.J. Ribal, Barcelona (ES) 

J.P. Rioja Zuazu, Zaragoza (ES) 

P. Rocchi, Vancouver (CA) 

B. Rocco, Milan (IT) 

E.A. Rodrigues De Lima, Porto (PT) 

O. Rodriguez Faba, Barcelona (ES) 

I. Romics, Budapest (HU) 

M.J. Roobol, Rotterdam (NL) 

A. Rosales, Barcelona (ES) 

M. Roscigno, Bergamo (IT) 

M. Rouprêt, Paris (FR)

J. Rubio Briones, Valencia (ES) 

A. Ruffion, Pierre-Bénite (FR) 

R.E. Sanchez Salas, Paris (FR) 

M. Sanchez-Carbayo, Madrid (ES) 

F.R. Santer, Innsbruck (AT) 

T. Schlomm, Hamburg (DE) 

H-P. Schmid, St. Gallen (CH) 

J. Schmidbauer, Vienna (AT) 

A. Schröder, Toronto (CA) 

C. Schwentner, Tübingen (DE) 

F.P. Secin, Buenos Aires (AR) 

J. Seibold, Tübingen (DE) 

E. Serafetinides, Athens (GR) 

K-D. Sievert, Tübingen (DE) 

D.J. Smith, Sheffield (GB) 

E. Solsona, Valencia (ES) 

R. Sosnowski, Warsaw (PL) 

M. Spahn, Berne (CH) 

R.S. Stefanescu, Paris (FR) 

M. Stöckle, Homburg (DE) 

W.L. Strohmaier, Coburg (DE) 

M.E. Sullivan, Oxford (GB) 

T. Sulser, Zurich (CH) 

D.J. Summerton, Leicester (GB) 

A. Tasca, Vicenza (IT) 

P. Tenke, Budapest (HU) 

H.G. Tiselius, Stockholm (SE) 

A. Tubaro, Rome (IT) 

L.N. Türkeri, Istanbul (TR) 

D. Ulmert, New York (US) 

B. Uvelius, Malmö (SE) 

G. Van Koeveringe, Maastricht (NL) 

E. Van Laecke, Ghent (BE) 

G.J.L.H. Van Leenders, Rotterdam (NL) 

K.M.L. Van Renterghem, Hasselt (BE) 

B. Van Rhijn, Amsterdam (NL) 

M. Vandenbossche, Brussels (BE) 

F. Villacampa Auba, Madrid (ES) 

A. Villers, Lille (FR) 

A. Volpe, Turin (IT) 

A. Vuksanovic, Belgrade (RS) 

F.M.E. Wagenlehner, Giessen (DE) 

A. Wagg, Edmonton (CA) 

J. Walz, Marseille (FR) 

R.W.G. Watson, Dublin (IE) 

E. Wespes, Charleroi (BE) 

P. Whelan, Leeds (GB) 

T. Wiegel, Ulm (DE) 

D.N. Wood, London (GB) 

B. Wullt, Lund (SE) 

J.J. Wyndaele, Antwerp (BE) 

O. Yossepowitch, Petach Tikva (IL) 

S. Zastrow, Dresden (DE) 

P.C. Zehnder, Berne (CH) 

P. Zimmern, Dallas (US) 


11 

Reviewers

Floorplan 

South Levels 

Amber Hall 3-4 

Tower Room 


EAU Award 

Gallery 

First Aid 

Education & Innovation 

Booth 

Internet Corner 2 

Exhibition 

Hall 


eURO Auditorium 

ATM 

EAU Booth 

Prayer Room 

Brown 

Hall 3 

Brown 

Hall 1-2 

SANOFI-HS3 


Amber Hall 6 

TAKEDA-HS2 

AMS-HS1 

Amber 

Hall 5 

Duomo 

Rooms 13-15 

EAU Video Library 

ASTELLAS 

Gold View Lounge 

European Urology Booth 

Internet Corner 1 

Platinum Hall 

COOK MEDICAL 

Panorama Lounge 

S3 

S2 

Elevator to 

S2 ASTELLAS Gold View Lounge 

S3 COOK MEDICAL Panorama Lounge 

Connection 

Level S0 - N1 

S1 

S0 

Connection 

Level S2 - N2 

Connection 

Level S0 - N0

Connection 

Level S0 - N1 

Connection 

Level S0 - N0 

Connection 

Level S2 - N2 

EAU Press Centre 

Silver Hall 

Press Conference Room 

Regional Meetings: Best Posters Area Yellow Hall 1-2-3 

Blue Hall 1-2 

Red Hall 2 

Red Hall 1 

Duomo 

Room 1 

Duomo 

Room 2 Meeting Corner 

Speaker Service Centre 

Best Posters 

Upcoming Meetings Area 

Sponsored Sessions Promotion Area 

Turquoise 

Hall 2 

Registration 

Turquoise 

Hall 1 

Presentation 

Training 

Duomo 

Room 11 

Centre 

Orange 

Hall 1 

Duomo 

Room 4 Duomo 

Room 5 

Duomo 

Rooms 7-10 

Duomo 

Room 12 

Green 

Hall 1 

Orange 

Hall 2 

Duomo 

Room 6 

Orange 

Hall 3 

Charge and Connect Area 

ATM 

Bank and Exchange 

EAU Information Desk 

Green 

Hall 2 

Green 

Hall 3 

Duomo 

Room 3 

MAIN ENTRANCE 

Taxi rank & shuttle 

busses to metro 

Company busses 

& Car Park 

ESU Booth 

North Levels 

N2 

N1 

N0 

N1 


13 

Floorplan

All sessions showing the webcast symbol 

will be available online. 

Register now at www.eaumilan2013.org

Programme Friday, 15 March 

eURO Auditorium Brown Hall 1-2 Brown Hall 3 Amber Hall 1-2 Amber Hall 7-8 Red Hall 1 Red Hall 2 Blue Hall 1-2 Yellow Hall 1-2-3 

9.00 09.00-16.15 

Special Session 

9.30 

10.00 

10.30 10.30-13.00 

Urology beyond 

Europe 

11.00 

11.30 

12.00 

12.30 

13.00 

Joint Session of the 

European Association 

of Urology (EAU) and 

the Chinese Urological 

Association (CUA) 

page 56 

13.15 13.15-15.45 


Europe 

13.30 

14.00 

14.30 

15.00 

15.30 

15.45 

16.00 



of Urology (EAU) 

and the Japanese 

Urological Association 

(JUA) 

page 65 

10.30-13.00 


Europe 




the Korean Urological 

Association (KUA) 

page 57 

13.15-15.45 


Europe 




the Confederación 

Americana de 

Urología (CAU) 

page 67 

16.15 16.15-17.45 

Symposium 

16.30 

17.00 

17.30 

17.45 

18.00 18.00-21.00 

21.00 

EAU Opening 

Ceremony 

page 72 

Metastatic castrationresistant 

prostate 

cancer: Integrating 

new learnings to 

optimise treatment 

outcomes 

SANOFI 

page 401 

10.30-13.00 


Europe 




the Urological Society 

of India (USI) 

page 59 

13.15-15.45 


Europe 

EAU - International: 

Caucasus and Central 

Asia Session 

page 68 

16.15-17.45 

Symposium 

Urological challenges 

in managing patients 

with angiomyolipoma 

(AML) 

NOVARTIS ONCOLOGY 

page 399 

International 

Conference on 

Prostate Cancer 

Prevention 2013 with 

Consensus Conference 

on Chemoprevention 

of Prostate Cancer 

page 53 

10.30-13.00 


Europe 




the Iranian Urological 

Association (IUA) 

page 61 

13.15-15.45 


Europe 




and the Pan-African 

Urological Surgeons’ 

Association (PAUSA) 

page 69 

16.15-17.45 

Symposium 

Extending survival 

outcomes in RCC 

and CRPC: Current 

evidence and future 

horizons 

BAYER HEALTHCARE 

page 397 

13.15-15.45 


Europe 




the Maghreb Union 

Countries 

page 70 

16.15-17.45 

Symposium 

Innovations in clinical 

urology 

OLYMPUS 

page 400 

10.30-13.00 


Europe 




the Arab Association 

of Urology (AAU) 

page 63 

13.15-15.45 


Europe 




and the Indonesian 

Urological Association 

(IUAI) 

page 71 

16.15-17.45 

Symposium 

New data in 

metastatic RCC: 

Applying the evidence 

to clinical practice 


ONCOLOGY 

page 398 


15 

Synopsis

Synopsis 

Programme Saturday, 16 March, Morning 

eURO Auditorium Platinum Hall Brown Hall 1-2 Brown Hall 3 Amber Hall 1-2 Amber Hall 7-8 Silver Hall Red Hall 1 Red Hall 2 

7.30 07.30-08.30 

8.00 

8.30 08.30-10.15 

Plenary Session 1 

9.00 

9.30 

Urology: From young 

to old 

08.30-08.35 

Introduction 

08.35-08.50 

Update 

The management 

and long-term 

outcomes of 

vesicoureteral reflux 

08.50-09.05 

Update 

The long-term 

outcomes of genital 

surgery in boys 

09.05-09.40 

Debate 

Pelvic floor implants: 

Artificial mesh or 

autologous fascia? 

09.40-09.55 

State-of-the-art 

lecture 

Incontinence and age 

page 96 

EAU General 

Assembly 

page 75 


08.30-10.00 

Poster Session 1 

Prostate cancer 

screening 

1-12 

page 99 

08.30-10.00 


Laparoscopy: 

Training, new 

technologies and 

techniques 

13-26 

page 102 

08.30-10.00 


Male infertility: Basic 

science 

27-37 

08.30-10.00 


History of urology 1 

38-49 

08.30-10.00 


Urothelial cancer: 

Tumour biology 

and experimental 

therapies 

50-61 

08.30-10.00 


Neuro-urology: Basic 

research 

09.55-10.15 


page 78 

page 80 

page 82 

page 84 

page 85 

page 87 

10.00 lecture 

Is ageing a disease? 

10.00-16.30 

Residents Day - 

organised by the 

Young Urologists 

Office (YUO) in 

page 76 

collaboration with 

the European Society 

10.15 10.15-17.15 

Meeting of the EAU 

10.15-14.00 

Meeting of the EAU 

10.15-14.00 

Meeting of the 

10.15-14.00 

Joint Meeting of 

10.15-14.00 


of Residents in 

Urology (ESRU) 

Section of Uro- 

Section of Female EAU Section of 

the the European EAU Section of 

Technology (ESUT) 

and Functional Urolithiasis (EULIS) 

Organisation for Transplantation 

in cooperation with 

Urology (ESFFU) and 

Research and Urology (ESTU) 

10.30 

ERUS and EULIS 

the EAU Section of 

Urological Imaging 

Urolithiasis - on our 

way to personalised 

Treatment of Cancer 

Genito-Urinary Improving 

What is new in 

(ESUI) 

management 

Cancer Group (EORTC outcomes in kidney 

endourology, 

GUCG), the EAU transplantation 

laparoscopy and 

Imaging in female 

Section of Urological 

10.45 

robotics 

and functional 

urology 

Research (ESUR), 

the EAU Section 

COOK, INTUITIVE 

of Oncological 

SURGICAL, IPSEN, 

Urology (ESOU) and 

KARL STORZ GMBH 


& CO.KG, NEOTRACT, 

of Uropathology 

11.00 OLYMPUS, QUANTA 

SYSTEM, ROCAMED 

(ESUP) 

11.30 

12.00 

page 108 

62-73 

page 104 

page 93

Blue Hall 1-2 Yellow Hall 1-2-3 Green Hall 1 Green Hall 2 Green Hall 3 Orange Hall 1 Orange Hall 2 Orange Hall 3 Turquoise 2 Amber Hall 5 

08.30-10.00 


Non-surgical 

treatment 

of advanced 

urothelial cancer 

74-85 

page 89 

10.15-14.00 


EAU Section of 

Genito-Urinary 

Reconstructive 

Surgeons 

(ESGURS) 

Urethral 

reconstruction 

and complication 

management 

after radical 

prostatectomy 

page 110 

08.30-10.00 


Nephron sparing 

surgery and risk 

scoring systems 

86-96 

page 91 

10.15-14.00 



Infections in 

Urology (ESIU) and 


of Andrological 

Urology (ESAU) 

Urogenital 

infections and 

andrology 

page 106 

09.00-10.30 

HOT 

ESU/ESUT Handson 

training in 

Green light laser 

vaporisation; 

Technique and 

standard cases - 

Basic course 1 

AMERICAN 

MEDICAL SYSTEMS 

page 373 

10.45-12.15 

HOT 


training in 


vaporisation; 

Technique and 



AMERICAN 


page 374 

09.00-10.30 

HOT 

ESU/ESUT 

Hands-on training 

Endourology 

course 1 

OLYMPUS EUROPA 

HOLDING GMBH 

page 377 

11.00-12.30 

HOT 

ESU/ESUT 


Endourology 

course 2 


HOLDING GMBH 

page 378 


7.30 

8.00 

8.30 

9.00 

9.30 

10.00 

10.15 

10.30 

10.45 

11.00 

11.30 

12.00 

17 

Synopsis

Synopsis 

Programme Saturday, 16 March, Afternoon 

eURO Auditorium Platinum Hall Brown Hall 1-2 Brown Hall 3 Amber Hall 1-2 Amber Hall 7-8 Silver Hall Red Hall 1 Red Hall 2 Blue Hall 1-2 

12.00 10.15-17.15 



Uro-Technology 

(ESUT) in 

cooperation with 

ERUS and EULIS 

12.15 

12.30 

13.00 

13.30 

14.00 


endourology, 

laparoscopy and 

robotics 

COOK, INTUITIVE 

SURGICAL, IPSEN, 

KARL STORZ 

GMBH & CO.KG, 

NEOTRACT, 

OLYMPUS, 

QUANTA SYSTEM, 

ROCAMED 

14.15 14.15-15.45 

Video Session 1 

14.30 

15.00 

15.30 

15.45 

page 96 

LESS & NOTES 

V1-V9 

page 113 

16.00 16.00-17.30 


16.30 

17.00 

17.15 

17.30 

17.45 

18.00 18.00-19.30 

Symposium 

19.30 

Navigating the 

new landscape 

in CRPC 

ASTELLAS 

page 402 

Improving 

minimally 

invasive radical 

prostatectomy 

V10-V17 

page 127 

18.00-19.30 

Symposium 

Risk stratification 

to optimize the 

management 

of men with 

symptomatic 

BPH at risk of 

progression 


page 404 


10.15-14.00 


EAU Section 

of Female and 

Functional Urology 

(ESFFU) and the 


Urological Imaging 

(ESUI) 

Imaging in female 

and functional 

urology 

page 99 

14.15-15.45 


New therapies in 

castration resistant 


97-108 

page 114 

16.00-17.30 


Radical treatment 

of prostate 

cancer, beyond 

prostatectomy 

180-192 

page 128 

18.00-19.30 

Symposium 

LUTS/BPH and 

sexual health - 

Bridging the gap 

ELI LILLY AND 

COMPANY 

page 403 

10.15-14.00 


EAU Section 

of Urolithiasis 

(EULIS) 

Urolithiasis - on 

our way to 

personalised 

management 

page 102 

18.00-19.30 

Symposium 

Transurethral 

resection of 

bladder tumor: 

How to reach 

excellence 

IPSEN 

page 406 

14.15-15.45 


Pelvic organ 

prolapse: From 

bench to bedside 

109-119 

page 116 

16.00-17.30 


Renal tumours: 

Basic research 

in prognostic 

markers 

193-204 

page 130 

18.00-19.30 

Symposium 

Increasing 

evidence of 

effectiveness of 

GAG therapy in 

different forms of 

cystitis 

IBSA INSTITUT 

BIOCHIMIQUE 

page 405 

14.15-15.45 


Men’s sexual 

health 

120-132 

page 117 

16.00-17.30 


Men’s sexual 

health: 

Testosterone 

and premature 

ejaculation 

205-216 

page 132 

10.15-14.00 

Joint Meeting of 

the the European 

Organisation 

for Research 

and Treatment 

of Cancer 


Cancer Group 

(EORTC GUCG), 


of Urological 

Research (ESUR), 


of Oncological 

Urology (ESOU) 

and the EAU 

Section of 

Uropathology 

(ESUP) 

page 108 

14.15-15.45 


Diagnostics in 

early prostate 

cancer 

133-143 

page 119 

16.00-17.30 


Improving 

diagnosis in 


217-228 

page 134 

10.15-14.00 



Transplantation 

Urology (ESTU) 

Improving 

outcomes 

in kidney 

transplantation 

page 104 

14.15-15.45 


Bladder cancer: 

Gene expression 

and molecular 

classification 

144-157 

page 121 

16.00-17.30 


Bladder cancer 

demographics and 

biomarkers 

229-242 

page 136 

10.00-16.30 

Residents Day - 

organised by the 

Young Urologists 

Office (YUO) in 

collaboration with 

the European 

Society of 

Residents in 

Urology (ESRU) 

page 93 

10.15-14.00 




Reconstructive 

Surgeons 

(ESGURS) 

Urethral 


and complication 

management 

after radical 

prostatectomy 

page 110 

14.15-15.45 


Urological 

infection 

innovations 

158-169 

page 123 

16.00-17.30 


Cell based therapy 

in pelvic floor 

dysfunction 

243-253 

page 138

Yellow Hall 1-2-3 Green Hall 1 Green Hall 2 Green Hall 3 Orange Hall 1 Orange Hall 2 Orange Hall 3 Turquoise 2 Amber Hall 5 Amber Hall 6 

10.15-14.00 



Infections in 

Urology (ESIU) and 


of Andrological 

Urology (ESAU) 

Urogenital 

infections and 

andrology 

page 106 

14.15-15.45 


Partial 

nephrectomy 

and surveillance: 

Surveys and 

comparisons 

170-179 

page 125 

16.00-17.30 


Robot-assisted 

partial 

nephrectomy 

254-264 

page 140 

18.00-19.30 

Symposium 

Premature 

ejaculation 

treatment: New 

perspectives for 

the couple 

MENARINI 

page 408 

13.00-14.00 

Urology in 

Italian art 

page 112 

14.30-17.30 

ESU Course 1 


– Screening, 

diagnosis and 

staging 

page 321 

14.30-17.30 

ESU Course 2 

Advanced 

management of 

urethral stricture 

surgery 

page 322 

14.30-17.30 

ESU Course 3 

Metastatic prostate 

cancer 

page 323 

14.30-17.30 

ESU Course 4 

Retropubic radical 

prostatectomy – 

Tips, tricks and 

pitfalls 

page 324 

14.30-17.30 

ESU Course 5 

Office 

management 

of male sexual 

dysfunction 

page 325 

14.30-17.30 

ESU Course 6 

Prolapse 

management and 

female pelvic floor 

problems 

page 326 

10.45-12.15 

HOT 


training in 


vaporisation; 

Technique and 



AMERICAN 


page 374 

12.30-14.00 

HOT 


training in 


vaporisation; 

Technique and 



AMERICAN 


page 375 

14.15-15.45 

HOT 


training in 


vaporisation; 

Technique and 



AMERICAN 


page 376 

11.00-12.30 

HOT 

ESU/ESUT 


Endourology 

course 2 


HOLDING GMBH 

page 378 

18.00-19.30 

Workshop 

Holmium Life 

Enhancing Plan 

(HoLEP) - The 

real BPH lifetime 

solution 

LUMENIS 

page 407 


12.00 

12.15 

12.30 

13.00 

13.30 

14.00 

14.15 

14.30 

15.00 

15.30 

15.45 

16.00 

16.30 

17.00 

17.15 

17.30 

17.45 

18.00 

19.30 

19 

Synopsis

Synopsis 

Programme Sunday, 17 March, Morning 

eURO Auditorium Platinum Hall Brown Hall 1-2 Brown Hall 3 Amber Hall 1-2 Amber Hall 6 Amber Hall 7-8 Silver Hall Red Hall 1 Red Hall 2 

7.30 07.30-11.00 


8.00 

8.30 

Upper urinary 

tract 

07.30-08.00 

Highlight session 1 

08.00-08.05 

Introduction 

08.05-08.25 

Update 

The dilemmas in 

diagnosing upper 

tract urothelial 

cancer 

08:25-09.05 

Debate 

How much surgery 

for upper tract 

urothelial cancer? 

9.00 

09.05-09.35 

EAU Guidelines 

Office case 

discussion 

Upper urinary tract 

9.15 

tumours 

09.15-10.45 

9.30 

10.00 

10.30 

10.45 

09.35-09.55 

Société 

Internationale 

d’Urologie (SIU) 

lecture 

The role of ESWL 

in upper urinary 

tract stones 

09.55-10.10 

Update 

Interventional 

imaging in upper 

urinary tract stone 

disease: What’s 

new? 

10.10-10.50 

Case discussion 

From above or 

below: Flexible, 

rigid or percutaneous 

management 

of upper urinary 

tract stones 

10.50-11.00 

Update 

Observation 

and deferred 

intervention in the 

management of 

stones 

page 143 

11.00 11.00-12.00 

Thematic Session 6 

11.30 

12.00 

Small renal 

masses: To treat or 

not to treat? 

page 168 



kidney surgery 

V18-V25 

page 146 

11.00-13.00 

European Urology 

Session 

Surgery in Motion 

page 172 


09.15-10.45 


Prostate cancer: 

Active surveillance 

265-275 

page 147 

11.00-12.00 


EAU Guidelines 

Office: 

Recommendation 

updates 2013 

page 161 

09.15-10.45 



Pathology 

276-287 

page 149 

11.00-12.00 


Management 

of surgical 

complications 

page 170 

09.15-10.45 



Surgery outcomes 

288-299 

page 151 

11.00-12.00 


Non-muscle 

invasive bladder 

cancer 

page 165 

09.15-10.45 


Treatment of 

neurogenic LUTD 

300-310 

page 153 

11.00-12.00 


Paediatric urology 

page 171 

09.15-10.45 


Stones: Basic 

research, imaging 

and training 

models 

311-323 

page 155 

11.00-12.00 


Joint session with 

the European 

Society of Nuclear 

Medicine: 

Diagnostics and 

therapy of bone 

metastases in 

patients with 

advanced prostate 

cancer 

page 167

Blue Hall 1-2 Yellow Hall 1-2-3 Green Hall 1 Green Hall 2 Green Hall 3 Orange Hall 1 Orange Hall 2 Orange Hall 3 Turquoise 1 Turquoise 2 Amber Hall 5 

09.15-10.45 

Poster 

Session 28 

Preclinical 

innovation - the 

future of erectile 

dysfunction 

treatment? 

324-335 

page 157 

11.00-12.00 

Thematic 

Session 3 

From bench to 

bedside: What 

will be replacing 

PSA? 

page 164 

09.15-10.45 

Poster 

Session 29 

Renal tumour 

diagnosis: From 

new techniques 

to follow-up 

336-349 

page 159 

11.00-12.00 

Thematic 

Session 2 

What are the 

limitations 

of minimally 

invasive surgery? 

page 163 

08.30-11.30 

ESU Course 7 

Management 

of small renal 

tumours 

page 327 

08.30-10.30 

ESU Course 8 

Renal 

transplantation: 

Technical 

aspects, 

diagnosis and 

management 

of early and 

late urological 

complications 

page 328 

08.30-11.30 

ESU Course 9 

Advanced course 

on upper tract 

laparoscopy 

(UPJ, adrenal 

and stones) 

page 329 

08.30-11.30 

ESU Course 10 


on laparoscopic 

nephrectomy 

page 331 

08.30-11.30 

ESU Course 11 

Painful bladder 

/ chronic pelvic 

pain; In men and 

women 

page 333 

08.30-11.30 

ESU Course 12 

Lower 

urinary tract 

dysfunction and 

urodynamics 

page 334 

09.00-11.00 

HOT 

ESU/ESUT 

Hands-on 

training 

Laparoscopy 

course 1 

KARL STORZ 

GMBH & CO.KG 

and COOK 

MEDICAL 

page 379 

11.30-13.30 

HOT 

ESU/ESUT 

Hands-on 

training 

Laparoscopy 

course 2 

KARL STORZ 

GMBH & CO.KG 

and COOK 

MEDICAL 

page 380 

09.00-10.30 

HOT 

ESU/ERUS 

Hands-on 

training on 

Robotic surgery 

course 1 

INTUITIVE 

SURGICAL 

page 383 

11.00-12.30 

HOT 

ESU/ERUS 

Hands-on 

training on 


course 2 

INTUITIVE 

SURGICAL 

page 384 

09.00-10.30 

HOT 

ESU/ESUT 

Hands-on 

training 

Laparoscopy 

course 1 

OLYMPUS 

EUROPA 

HOLDING GMBH 

page 381 

11.00-12.30 

HOT 

ESU/ESUT 

Hands-on 

training 

Laparoscopy 

course 2 

OLYMPUS 

EUROPA 

HOLDING GMBH 

page 382 


7.30 

8.00 

8.30 

9.00 

9.15 

9.30 

10.00 

10.30 

10.45 

11.00 

11.30 

12.00 

21 

Synopsis

Synopsis 

Programme Sunday, 17 March, Afternoon 


12.00 11.00-13.00 


Session 

12.15 12.15-13.45 


12.30 

13.00 

Challenging 

robotic surgery 

V26-V32 

Surgery in Motion 

page 172 

13.15 13.15-15.15 


13.30 

13.45 

page 174 

14.00 14.00-15.30 


14.15 

14.30 

15.00 

15.15 

15.30 

21st century stone 

management 

V33-V40 

page 193 

15.45 15.45-17.15 


16.00 

16.30 

17.00 

17.15 

17.30 

Laparoscopic renal 

surgery 

V41-V48 

page 212 

17.45 17.45-19.15 

Symposium 

19.15 

Management of 

OAB: Electing the 

right candidate for 

the right patient 

ASTELLAS 

page 410 

3D Video and live 

narration - da 

Vinci partial 

nephrectomy 

with Firefly 

fluorescence 

imaging 

INTUITIVE 

SURGICAL 

page 173 


12.15-13.45 


New methods 

in imaging and 

targeting prostate 

cancer 

350-361 

page 175 

14.00-15.30 


How to optimise 

staging in prostate 

cancer? 

465-476 

page 194 

15.45-17.15 


Focal therapy in 


treatment 

578-589 

page 213 

17.45-19.15 

Symposium 

Silodosin: A first 

choice for the 

pharmacological 

treatment of BPH 

RECORDATI 

page 416 

12.15-13.45 


Making the 

diagnosis of 

bladder cancer 

362-373 

page 177 

14.00-15.30 



Imaging and 

resection 

477-488 

page 196 

15.45-17.15 


Diagnostic imaging 

for bladder cancer 

590-601 

page 215 

17.45-19.15 

Symposium 

Towards 

individualisation 

of prostate cancer 

treatments: From 

bench to bedside 

IPSEN 

page 412 

12.15-13.45 


Kidney 

transplantation: 

Technique and 

outcome 

374-386 

page 179 

14.00-15.30 


Living donor 

nephrectomy and 

tumours on kidney 

transplanted 

patients 

489-501 

page 198 

15.45-17.15 


Research in kidney 

transplant 

602-613 

page 217 

17.45-19.15 

Symposium 

Burden of illness 

and optimal 

management of 

recurrent cystitis 

OM PHARMA SA 

page 414 

12.00-15.00 

HOT 

ESU Hands-on 

training course on 

Urodynamics 

MEDIWATCH 

page 385 

17.45-19.15 

Workshop 

Urinary 

incontinence - 

Optimising the 

patient experience 

and improving 

outcomes 

ALLERGAN 

and PORGÈS, 

a COLOPLAST 

division 

page 409 

12.15-13.45 


Advances in the 

treatment of penile 

cancer 

387-400 

page 181 

14.00-15.30 


News in prostate 

and bladder 

infections 

502-513 

page 200 

15.45-17.15 


Urological 

infections 

614-625 

page 219 

17.45-19.15 

Symposium 

Focal therapy in 

localised prostate 

cancer 

STEBA BIOTECH 

page 417 

12.15-13.45 


Nocturia, OAB, 

metabolic 

syndrome - 

towards a new 

management 

401-412 

page 183 

14.00-15.30 


TURP and beyond 

514-525 

page 202 

15.45-17.15 


New and old 

minimally invasive 

BPH therapies 

626-638 

page 221 

17.45-19.15 

Symposium 

Clinical 

conundrums in 

the treatment 

of metastatic 

castration-resistant 


JANSSEN 

PHARMACEUTICAL 

COMPANIES 

OF JOHNSON & 

JOHNSON 

page 413 

12.15-13.45 


Paediatric 

hypospadias 

repair 

413-425 

page 185 

14.00-15.30 


Paediatric urology: 

What’s new? 

526-537 

page 204 

15.45-17.15 



developments 

639-650 

page 223 

17.45-19.15 

Symposium 

BPH and 

inflammation, 

from lab to clinic 

PIERRE FABRE 

MEDICAMENT 

page 415 

12.15-13.45 


Stones: URS and 

imaging 

426-439 

page 187 

14.00-15.30 


Stones: ESWL and 

PCNL 

538-551 

page 206 

15.45-17.15 


Stones: ESWL, 

epidemiology and 

training 

651-662 

page 225


12.15-13.45 

Poster 

Session 37 

Exploring 

pharmacological 

targets in OAB 

440-451 

page 189 

14.00-15.30 

Poster 

Session 46 

Uro-genital 


and trauma 

552-565 

page 208 

15.45-17.15 

Poster 

Session 55 

From bench to 

bedside in pain 

and OAB 

663-673 

page 227 

12.15-13.45 

Poster 

Session 38 

Surgery for RCC 

and the adrenal 

gland 

452-464 

page 191 

14.00-15.30 

Poster 

Session 47 

Urothelial 

cancer: 

Transurethral 

surgery and 

intravesical 

recurrence 

566-577 

page 210 

15.45-17.15 

Poster 

Session 56 

Androgen 

deprivation 

therapy, still to 

improve... 

674-684 

page 229 

17.45-19.15 

Symposium 

Nocturia: Definitive 

diagnosis for 

better patient 

outcomes 

FERRING PHAR- 

MACEUTICALS 

page 411 

12.00-14.00 

ESU Course 13 

Pathology 

(prostate, 

bladder/UUT, 

kidney, testicles/ 

penis) 

page 335 

14.30-17.30 

ESU Course 19 

Robot renal 

surgery 

page 342 

12.00-14.00 

ESU Course 14 

Surgical 

management of 

locally advanced 

and metastatic 

renal cancer 

page 337 

14.30-17.30 

ESU Course 20 

How to write a 

manuscript and 

get it published 

in European 

Urology 

page 343 

12.00-14.00 

ESU Course 15 

Laparoscopy for 

beginners 

page 338 

14.30-17.30 

ESU Course 21 

Advanced 

vaginal 


page 345 

12.00-14.00 

ESU Course 16 

Testicular cancer 

page 339 

14.30-17.30 

ESU Course 22 

Radical 

cystectomy 

and orthotopic 

bladder 

substitution 

– Surgical 

tricks and 

management of 

complications 

page 347 

12.00-14.00 

ESU Course 17 

Management 

and outcome 

in invasive and 



page 340 

14.30-17.30 

ESU Course 23 

Surgery or 

radiotherapy for 

localised and 



page 348 

14.30-17.30 

ESU Course 24 

Flexible ureterorenoscopy 

and 

retrograde intrarenal 

surgery: 

Instrumentation, 

technique, 

tips and tricks, 

indications 

page 350 

11.30-13.30 

HOT 

ESU/ESUT 

Hands-on 

training 

Laparoscopy 

course 2 

KARL STORZ 

GMBH & CO.KG 

and COOK 

MEDICAL 

page 380 

14.00-15.30 

HOT 

ESU/ESUT/ 

EULIS Hands-on 

training Ureterorenoscopy 

course 1 

KARL STORZ 

GMBH & CO.KG 

and COOK 

MEDICAL 

page 386 

11.00-12.30 

HOT 

ESU/ERUS 

Hands-on 

training on 


course 2 

INTUITIVE 

SURGICAL 

page 384 

11.00-12.30 

HOT 

ESU/ESUT 

Hands-on 

training 

Laparoscopy 

course 2 

OLYMPUS 

EUROPA 

HOLDING GMBH 

page 382 


12.00 

12.15 

12.30 

13.00 

13.15 

13.30 

13.45 

14.00 

14.15 

14.30 

15.00 

15.15 

15.30 

15.45 

16.00 

16.30 

17.00 

17.15 

17.30 

17.45 

19.15 

23 

Synopsis

Synopsis 

Programme Monday, 18 March, Morning 


7.30 07.30-11.00 


8.00 

8.30 

Lower urinary 

tract management: 

How to balance 

benefits with 

side-effects 

07.30-08.00 

Highlight Session 2 

08.00-08.05 

Introduction 

08.05-08.25 

Update 

Pelvic floor 

anatomy for 

urologists 

08.25-09.05 

Debate 

The role of urodynamic 

assessment 

in contemporary 

practice 

9.00 

09.05-09.25 

American 

Urological 

Association (AUA) 

Lecture 

Cellular-based 

9.15 therapy of urinary 

09.15-10.45 

incontinence 


9.30 

09.25-10.05 


Sling, sphincter 

or balloon for 

male urinary 

incontinence 

10.00 10.00-12.00 

10.30 

10.45 

10.05-10.45 

Debate 

What the practising 

urologist needs 

to know about 

new therapies 

for LUTS. When, 

where and how do 

they work? 

10.45-11.00 


lecture 

Is TURP the gold 

standard for 

benign prostatic 

obstruction? 

page 233 

11.00 11.00-12.00 

Thematic 

Session 10 

11.30 

12.00 

Andrology 

page 256 

da Vinci Robotic 

Surgery 

Live surgery: 

da Vinci 

prostatectomy - 

The Martini Klinik 

Technique 

INTUITIVE 

SURGICAL 

page 254 


Management of 

high risk prostate 

cancer 

685-696 

page 237 

11.00-12.00 

Thematic 

Session 15 

Management of 

pain in urology 

page 262 

07.30-09.00 


Miscellaneous 

V49-V56 

page 236 

09.15-10.45 


Urothelial cancer 

treatment: 

Intravesical 

approaches 

697-708 

page 239 

09.15-10.45 



biopsies and 

pathology 

709-721 

page 241 

11.00-12.00 

Thematic 

Session 16 

Urological surgery 

in renal transplant 

patients 

page 263 

09.15-10.45 


Update on SUI 

722-735 

page 243 

09.15-10.45 


Current and new 

treatments of OAB 

and LUTS 

736-747 

page 245 

11.00-12.00 

Thematic 

Session 11 

Systemic therapy 

in urological 

cancers 

page 258 

09.15-10.45 



treatment: 

Predicting 

outcomes 

748-760 

page 247 

11.00-12.00 

Thematic 

Session 12 

A session by the 

European Society 

of Urogenital 

Radiology 

page 259 

09.15-10.45 



Basic research on 

pathogenesis 

761-774 

page 249 

11.00-12.00 

Thematic 

Session 13 

Prevention 

and treatment 

of urological 

infections 

page 260


09.15-10.45 

Poster 

Session 64 

OAB in women 

775-786 

page 251 

11.00-12.00 

Thematic 

Session 14 

Neurourology 

page 261 

09.15-10.45 

Poster 

Session 65 

Urethral stricture 

management 

787-798 

page 253 

11.00-12.00 

Thematic 

Session 9 

Expert 

challenges the 

expert 

page 255 

08.30-11.30 

ESU Course 25 

The infertile 

couple - 

Urological 

aspects 

page 352 

08.30-11.30 

ESU Course 26 

Update on stone 

disease 

page 353 

08.30-11.30 

ESU Course 27 

Diagnosis and 

management 

of non-muscle 

invasive bladder 

cancer (NMIBC) 

page 354 

08.30-11.30 

ESU Course 28 


laparoscopic 

prostatectomy 

page 356 

08.30-11.30 

ESU Course 29 

Minimally 

invasive 

treatment 

for localized 


page 358 

08.30-11.30 

ESU Course 30 

Paediatric 

urology for the 

adult urologist: 

A practical 

update 

page 360 

09.00-10.30 

HOT 

ESU/ESUT/ 

EULIS Hands-on 

training Ureterorenoscopy 

course 2 

KARL STORZ 

GMBH & CO.KG 

and COOK 

MEDICAL 

page 387 

11.00-12.30 

HOT 

ESU/ESUT 


Transurethral 

therapy of LUTS 

- Bipolar TURP 

course 1 

KARL STORZ GMBH 

& CO.KG and COOK 

MEDICAL 

page 392 

09.00-10.30 

HOT 

ESU/ERUS 

Hands-on 

training on 


course 3 

INTUITIVE 

SURGICAL 

page 394 

11.00-12.30 

HOT 

ESU/ERUS Handson 

training on 


course 4 

INTUITIVE 

SURGICAL 

page 395 

09.00-10.30 

HOT 

ESU/ESUT 

Hands-on 

training in 


vaporisation; 

Technique and 

large adenoma 

- Advance 

course 1 

AMERICAN 

MEDICAL 

SYSTEMS 

page 388 

11.00-12.30 

HOT 

ESU/ESUT 


in Green light 

laser vaporisation; 

Technique and 

large adenoma - 

Advance course 2 

AMERICAN 


page 389 


7.30 

8.00 

8.30 

9.00 

9.15 

9.30 

10.00 

10.30 

10.45 

11.00 

11.30 

12.00 

25 

Synopsis

Synopsis 

Programme Monday, 18 March, Afternoon 

12.00 


12.15 12.15-13.45 


12.30 

13.00 

13.15 

13.30 

13.45 

Developments in 

cancer diagnosis 

and management 

V57-V64 

page 264 

14.00 14.00-15.30 


14.30 

15.00 

15.30 

Challenging 

reconstructive 

surgery 

V65-V72 

page 282 

15.45 15.45-17.15 


Highlights & 

awards 

16.00 

16.30 

17.00 

17.15 

17.30 

V73-V79 

page 300 

14.00-16.00 

da Vinci Robotic 

Surgery 

Live surgery: 

da Vinci 

prostatectomy 

- Early 

neurovascular 

bundles release 

INTUITIVE 

SURGICAL 

page 254 


12.15-13.45 


Radical 

prostatectomy: 

New techniques 

799-810 

page 265 

14.00-15.30 


Surgical 

approaches for 


911-922 

page 283 

15.45-17.15 



treatment: 

Comorbidities and 

complications 

1011-1024 

page 301 

12.15-13.45 


Advanced 

urothelial cancer: 

Disease outcomes 

811-822 

page 267 

14.00-15.30 


Radical surgery for 

bladder cancer: 

Patient outcomes 

923-934 

page 285 

15.45-17.15 


Radical surgery for 

bladder cancer: 

Technical aspects 

1025-1038 

page 303 

12.15-13.45 


Evidence-based 


therapies in 

cellular and 

animal models 

823-835 

page 269 

14.00-15.30 



cell biology and 

signaling 

935-947 

page 287 

15.45-17.15 



biomarkers 

and outcome 

prediction 

1039-1050 

page 305 

17.45 17.45-19.15 

Workshop 

19.15 

Urinary 

incontinence - 

Optimising the 

patient experience 

and improving 

outcomes 

ALLERGAN 

and PORGÈS, 

a COLOPLAST 

division 

page 418 

12.15-13.45 


Male infertility: 

Clinical issues 

836-847 

page 271 

14.00-17.00 

European 

Urological 

Scholarship 

Programme (EUSP) 

Session 

page 299 

12.15-13.45 



Biomarkers 

848-861 

page 272 

14.00-15.30 


Nephrectomy for 

RCC: Minimally 

invasive 

techniques, renal 

function, lymph 

node dissection 

and prognostic 

factors 

948-960 

page 289 

15.45-17.15 


Evolving concepts 

in testicular 

cancer 

1051-1060 

page 307 

17.45-19.15 

Symposium 

Interactive debate: 

How seriously 

should I take male 

LUTS? 

ASTELLAS 

page 419 

12.15-13.45 


Complex urological 

reconstructions 

and tissue 

engineering 

862-874 

page 274 

14.00-15.30 


Stones: PCNL 

961-974 

page 291 

15.45-17.15 


Stones: URS and 

stents 

1061-1072 

page 309 

12.15-13.45 


How to reduce 

warm ischemia 

in partial 

nephrectomy 

875-887 

page 276 

14.00-15.30 



Drug related basic 

research 

975-986 

page 293 

15.45-17.15 


History of 

urology 2 

1073-1084 

page 311 

17.45-19.15 

Symposium 

Castrationresistant 

prostate 

cancer in 2013: 

Analysing the 

good, the bad and 

the ugly 

PRIME ONCOLOGY 

page 421


12.15-13.45 

Poster 

Session 73 


female urology 

888-898 

page 278 

14.00-15.30 

Poster 

Session 81 

How to diagnose 

LUTS, BPH and 

obstruction? 

987-998 

page 295 

15.45-17.15 

Poster Session 

89 

Pharmacotherapy 

of male LUTS 

1085-1096 

page 312 

12.15-13.45 

Poster 

Session 74 

BPH: Genes, 

biomarkers and 

beyond 

899-910 

page 280 

14.00-15.30 

Poster 

Session 82 

Male 

incontinence: 

Prediction and 

management 

999-1010 

page 297 

15.45-17.15 

Poster 

Session 90 

Medical 

treatment 

of RCC 

1097-1108 

page 314 

17.45-19.15 

Symposium 

New data on 

androgen 

deprivation with 

a GnRH antagonist: 

Improving 

patient outcomes 

in prostate 

cancer 

FERRING PHAR- 

MACEUTICALS 

page 420 

12.00-14.00 

ESU Course 31 

Current concepts 

and controversy 

in the 

diagnosis and 

management 

of upper tract 

urothelial 

carcinoma 

(UTUC) 

page 361 

14.30-16.30 

ESU Course 37 

Post-surgical 

urinary 

incontinence in 

males 

page 369 

12.00-14.00 

ESU Course 32 


on laparoscopic 

prostatectomy 

page 363 

14.30-16.30 

ESU Course 38 

General neurourology 

page 370 

12.00-15.00 

ESU Course 33 

Modern 

management 

of BPH 

page 365 

12.00-14.00 

ESU Course 34 

Urinary tract and 

genital trauma 

page 366 

14.30-17.30 

ESU Course 39 

Percutaneous 

nephrolithotripsy 

(PCNL) 

page 371 

12.00-14.00 

ESU Course 35 

Ultrasound for 

the urologist - 

TRUS and TRUS 

guided biopsies 

page 367 

14.30-17.30 

ESU Course 40 

Single port 

– NOTES and 

minilaparoscopy: 

Is this the way 

to go? 

page 372 

12.00-15.00 

ESU Course 36 

Laparoscopic 

and robotassisted 

laparoscopic 

radical 

cystectomy 

page 368 

11.00-12.30 

HOT 

ESU/ESUT 

Hands-on 

training 

Transurethral 



course 1 

KARL STORZ 

GMBH & CO.KG 

and COOK 

MEDICAL 

page 392 

13.00-14.30 

HOT 

ESU/ESUT 

Hands-on 

training 

Transurethral 



course 2 

KARL STORZ 

GMBH & CO.KG 

and COOK 

MEDICAL 

page 393 

11.00-12.30 

HOT 

ESU/ERUS 

Hands-on 

training on 


course 4 

INTUITIVE 

SURGICAL 

page 395 

11.00-12.30 

HOT 

ESU/ESUT 




Technique and 



AMERICAN 


page 389 

13.00-14.30 

HOT 

ESU/ESUT 




Technique and 



AMERICAN 


page 390 

13.00-14.30 

HOT 

ESU/ESUT 




Technique and 



AMERICAN 


page 391 


12.00 

12.15 

12.30 

13.00 

13.15 

13.30 

13.45 

14.00 

14.30 

15.00 

15.30 

15.45 

16.00 

16.30 

17.00 

17.15 

17.30 

17.45 

19.15 

27 

Synopsis

Synopsis 

Programme Tuesday, 19 March 


eURO Auditorium 

08.00 08.00-13.10 


13.10 

Souvenir sessions/Hot topics in prostate cancer 

08.00-09.30 

Souvenir session by the EAU Scientific Congress Office 

09.30-09.40 

EAU policy on live surgery 

09.40-09.45 

Introduction to the plenary session 

09.45-10.00 

Update 

New urological weapons in the treatment of CRPC 

10.00-10.20 

Late breaking news I 

10.20-10.40 

State-of-the-art lecture 

Is there a role for intermittent androgen deprivation? 

10.40-11.20 

Debate 

High risk PC: Surgery vs radiation vs systemic therapy 

11.20-11.35 

Late breaking news II 

11.35-12.15 

Debate 

Why focal therapy instead of active surveillance for low risk prostate cancer 

12.15-12.35 

Report on the Consensus Statement for Prostate Cancer Prevention 

12.35-13.05 

Update 

European PSA screening 

13.05-13.10 

Closing remarks 

page 317

EAUN Programme Overview, 16-18 March 2013 

16 March 

Saturday 

17 March 

Sunday 

18 March 

Monday 

Room Amber Hall 3-4 - Level S2 Tower Room - Level S2 Amber Hall 3-4 - Level S2 Tower Room - Level S2 Amber Hall 3-4 - Level S2 Tower Room - Level S2 

08.00 

08.15 

08.30 

08.45 

09.00 

09.15 

09.30 

09.45 

10.00 

10.15 

10.30 

10.45 

11.00 

11.15 

11.30 

11.45 

12.00 

12.15 

12.30 

12.45 

13.00 

13.15 

13.30 

13.45 

14.00 

14.15 

14.30 

14.45 

15.00 

15.15 

15.30 

15.45 

16.00 

16.15 

16.30 

16.45 

17.00 

17.15 

17.30 

17.45 

18.00 

18.15 

18.30 

18.45 

19.00 

20.30 

24.00 

EAUN Workshop 

Writing evidence-based 

guidelines 

Break 


Bladder instillation for 

interstitial cystitis and 

radiation cystitis 

Break 

EAU-ESU Course - 1 

Prostate diseases and 

treatments 

Part I 

Break 

EAU-ESU Course - 1 

Prostate diseases and 

treatments 

Part II 

EAUN Opening 


Intermittent catheterisation 

and dilatation 

Break 

AIURO Lecture 

Urological nursing in Italy: The 

national association, clinical 

research and education in the 

European context 

EAUN Lecture 

Who takes care of the 

caretakers 


Nursing solutions in difficult 

cases & Case discussions 


Market place session: 

Embarrassing issues in 

urology. Everything you always 

wanted to know, but were 

afraid to ask 

Break 

Panel discussion 


Debate 

Prostate cancer screening 


Alternative approaches for the 

improvement of daily life in 

urological patients 

Break 

EAUN Session 

EAUN Nursing Research 

Competition 

EAUN State-of-the-art lecture 

The gender aspect 

EAUN Lecture 

ESU-EAUN Cystoscopy 

Workshop 

ESU Course - 2 

Bladder diseases and 

treatments 

Part I 

Break 

ESU Course - 2 

Bladder diseases and 

treatments 

Part II 

Break 


Palliative care in urology 


Transition from paediatric to 

adult urology 

EAUN General Assembly 

The online diary as a 

Break communication tool for 

patients and nurses 

Break 

Poster viewing 

Poster Abstract Session 1 


Health economics 

Break 

Symposium 

CIC experience- making 

dreams a reality 

WELLSPECT HEALTHCARE 

Welcome reception 

Sponsored by WELLSPECT 

HEALTHCARE 

Location: In front of Amber 

Hall 7-8 

Break 


Nutritional aspects of preoperative 

interventions 

Break 


Penile carcinoma 


Brachytherapy in 

urological cancer 


Urological disorders that 

challenge the surgeon 

Break 

Break Break Award Session 


Bladder dysfunction: 

Overactive bladder syndrome, 

nocturia and pelvic 

floor issues 


Complimentary medicine 

in oncology 

Break 

EAUN Round table discussion 

Meeting the challenges of 

cancer related bone health 

Supported with an educational 

grant by AMGEN 

Urowalk 

18.30 - 20.30 

Nurses’ dinner 

20.30 - 24.00 

Poster viewing 

Poster Abstract Session 2 

Break 

Workshop 

Safety in urinary 

catheterization 

B. BRAUN 

EAUN Session 

Inside the body - surgery in 

motion (videos) 


29 

Synopsis

Exhibition 


ENTRANCE/EXIT 

EXHIBITION 

NORTH LEVELS 

EXHIBITION HAL 

CIG 

SMU 

OCEANA 

ISTEM 

MEDIKAL 

A 

CUA 

CANADA 

TO OTHER 

LEVELS 

INTERNET 

CORNER 1 

GALIL MEDICAL 

CUA 

CHINA 

MEDICA 

MENARINI 

TERUMO 

WFIP 

MEDKONSULT 

OPKO 

EUROPA 

UOMO 

PHYSION ESSM 

RUDOLF 

MEDICAL 

HEALUX NEXUS 

EXHIBITION HALL - SOUTH LEVEL S0 

CIG 

SMU 

OCEANA 

ISTEM 

MEDIKAL 

A 

INTERNET 

CORNER 1 

GALIL MEDICAL MEDKONSULT 

MEDICA 

EUROPA 

WFIP 

UOMO 

MENARINI 

CUA CUA 

CANADA CHINA 

TERUMO AUA 

THERA- 

COAT 

MEDAC 

ASCLEPION MCUBE SIU 

ERBE 

ELEKTROMEDIZIN AYMED 

HOLOGIC 

GEN-PROBE 

BECKMAN 

COULTER 

KLS MARTIN GROUP 

ELMED 

ANGIO- 

DYNAMICS 

LISA 

SILIMED 

LASER 

NOVARTIS 

PROMEPLA 

MEDA (ROCAMED) CRYOLIFE 

MEDCOM LABORIE 

ROTTAPHARM 

MADAUS 

PHYSION ESSM 

BAYER ENDOCONTROL 

HEALTHCARE TRUMPF 

RUDOLF 

MEDISPEC 

MEDICAL 

TIME 

HEALUX NEXUS 

RESEARCH ERASMUS DENDREON 

OPKO 

LAMIDEY 

NOURY 

COOK MEDICAL 

M.A.S. 

LIMMER 

LASER 

CONMED/ 

VIKING 

SCOMEDICA 

DIREX 

RECORDATI 

HITACHI 

MEDICAL 

SYSTEMS 

EUROPE / 

HITACHI 

ALOKA 

WISEPRESS 

MMS 

EUROPEAN 

UROLOGY 

UROTECH 

& 

UROVISION 

RICHARD WOLF 

EDAP TMS 

TELEFLEX 

MEDI- 

WATCH 

ZEPHYR 

OM 

SIEMENS PHARMA 

ISMH 

MEL PAJUNK 

CL MEDICAL 

ASPIDE 

MÉDICAL 

COLOPLAST - PORGÈS ALLERGAN 

PFIZER 

AUA 

INTERNET 

CORNER 2 

BN IMMUNO 

THERAPEUTICS FOTONA 

APOGEPHA 

TO OTHER 

LEVELS 

QUANTA SYSTEM BOSTON SCIENTIFIC 

ANATOMY 

FOR 

UROLOGY 

THERA- 

COAT 

HANGZHOU 

HAWK 

ASCLEPION MCUBE 

ERBE 

ELEKTROMEDIZIN 

BAYER 

HEALTHCARE 

TIME 

RESEARCH ERASMUS 

EMD 

TAEWOONG 

MEDICAL 


BECKMAN 

COULTER 

ELMED 

CATERING 

EAU 

BOOTH: 

EAU MEMBERSHIP 

HISTORICAL EXHIBITION 

RESEARCH FOUNDATION 

EAU STOCKHOLM 2014 

EBU 

YOUNG UROLOGISTS / 

RESIDENTS CORNER 

STARMEDTEC TRIBUTE KITALPHA A.M.I. 

IBSA 

KOELIS PROMEDON DEXTÉRITÉ 

SONACARE ELSEVIER CARESONO 

BK MEDICAL 

UROTISS 

B. BRAUN AESCULAP 

ALLIUM 

BARD 

LUMENIS 

LENUS 

BIOLITEC INFORMA NAMED 

PHARMA 

EMS HC ITALY TRISTEL 

WELLSPECT 

HEALTHCARE 

HISTOSCANNING 

BY AMD 

B C D E F G H 

OLYMPUS 

ASTELLAS 

ASTELLAS 

SHENZHEN 

HUIKANG SONY 

IPSEN 

MILLENNIUM: 

THE TAKEDA 

ONCOLOGY COMPANY 

AMGEN 


FERRING 



EIGEN 


EIGEN 

KARL STORZ STORZ MEDICAL 

JANSSEN 

PHARMA- 

CEUTICALS 

JANSSEN PHARMACEUTICALS 

UROMED 

MEDTRONIC 

DORNIER MEDTECH EUROPE 

SMOKING 

AREA 

SILIMED 

MEDAC 

SIU 

AYMED 

HOLOGIC 

GEN-PROBE 

ANGIO- 

DYNAMICS 

LISA 

LASER 

ENDOCONTROL 

TRUMPF 

DENDREON 


SIU ITALIA 

CURAN 

LUT 

ANDRO- 

MEDA 

T-DOC 

MYRIAD 

NEOTRACT 

INTEGRA 

SPHINX 

VISION 

SCIENCES 

NEOMEDIC 

NOVARTIS 

B 

MEDA 

MEDCOM 

ROTTAPHARM 

MADAUS 

MEDISPEC 

LAMIDEY 

NOURY 

PROMEPLA 

(ROCAMED) 

LABORIE 

COOK MEDICAL 

M.A.S. 

DIREX 

RECORDATI 

CRYOLIFE 

LIMMER 

LASER 

CONMED/ 

VIKING 

SCOMEDICA 

OLYMPUS 

C 

HITACHI 

MEDICAL 

SYSTEMS 

EUROPE / 

HITACHI 

ALOKA 

ENTRANCE/EXIT 

EXHIBITION 

NORTH LEVELS 

WISEP 

MMS 

BJ

HALL - SOUTH LEVEL 

M.A.S. 

EPLAPROMEPLA 

MED) (ROCAMED) CRYOLIFE CRYOLIFE 

LIMMER 

ORIE LABORIE 

LASER 

DIREX 

CONMED/ 

VIKING 

SCOMEDICA SCOMEDICA 

RECORDATI RECORDATI 

EDICAL COOK MEDICAL 

M.A.S. 

DIREX 

OLYMPUS OLYMPUS 

LIMMER 

LASER 

CONMED/ 

VIKING 

HITACHI HITACHI 

MEDICAL MEDICAL 

SYSTEMS SYSTEMS 

EUROPE / 

HITACHI 

ALOKA 

WISEPRESS WISEPRESS 

MMS 

ENTRANCE/EXIT 

ENTRANCE/EXIT 

EXHIBITION EXHIBITION 

NORTH NORTH LEVELS LEVELS 

BJUI/WILEY-BLACKWELL 


EUROPE / 

HITACHI 

ALOKA 

MMS 

UROTECH UROTECH 

& & 

UROVISION UROVISION 

RICHARD WOLF RICHARD WOLF 

ASTELLAS ASTELLAS 

EUROPEAN EUROPEAN 

UROLOGY UROLOGY 

TO OTHER TO OTHER 

LEVELS LEVELS 

EDAP TMS EDAP TMS 

SHENZHEN SHENZHEN 

HUIKANG HUIKANG SONY SONY TELEFLEX TELEFLEX 

GLAXOSMITHKLINE GLAXOSMITHKLINE 

MEDI- 

WATCH 

MEL PAJUNK MEL PAJUNK 

CL MEDICAL CL MEDICAL 

STARMEDTEC STARMEDTEC TRIBUTE TRIBUTE KITALPHA KITALPHA A.M.I. A.M.I. 

ASPIDE ASPIDE 

MÉDICAL MÉDICAL 

COLOPLAST COLOPLAST - PORGÈS - PORGÈS ALLERGAN ALLERGAN 

PFIZER 

IBSA 


31 

Exhibition 

INT 

COR 

BN IMMUN 

THERAPEUT T 

B 

TO OTHER TO O 

LEVELS LE 

C C D D E E F F 

ASTELLAS ASTELLAS 

OM OM 

ZEPHYR ZEPHYR 

SIEMENS SIEMENS PHARMA PHARMA 

ISMH 

IPSEN 

MILLENNIUM: MILLENNIUM: 

THE TAKEDA THE TAKEDA 

ONCOLOGY ONCOLOGY COMPANY COMPANY 

AMGEN 

IPSEN 

AMGEN 

MEDI- 

WATCH 

ISMH 

FERRING FERRING 

INTUITIVE SURGICAL INTUITIVE SURGICAL 

PFIZER 

AMERICAN AMERICAN MEDICAL SYSTEMS MEDICAL SYSTEMS 

IBSA 

KARL 

QUANT 

JANSSEN J 

PHARMA- P 

CEUTICALSCE

IE 

HALL - SOUTH LEVEL 

Exhibition 

LA 

ED) 

RECORDATI 

DICAL 

M.A.S. 

DIREX 

CRYOLIFE 

LIMMER 

LASER 

CONMED/ 

VIKING 

SCOMEDICA 

OLYMPUS 

HITACHI 

MEDICAL 

SYSTEMS 

EUROPE / 

HITACHI 

ALOKA 

ENTRANCE/EXIT 

PHYSION ESSM 

BAYER 

HEALTHCARE 

RUDOLF 

MEDICAL 

TIME 

HEALUX NEXUS 

RESEARCH 

EXHIBITION 

NORTH LEVELS 

WISEPRESS 

MMS 


EUROPEAN 

M.A.S. UROLOGY 


UROTECH 

& 

UROVISION 

RICHARD WOLF 

ASTELLAS 

TO OTHER 

LEVELS 

EDAP TMS 

SHENZHEN 

HUIKANG 

SIEMENS 

SONY 

OM 

PHARMA 

TELEFLEX 


ZEPHYR 

MEDI- 

WATCH 

MEL PAJUNK 

CL MEDICAL 

ASPIDE 

MÉDICAL 


C D E F 

ASTELLAS 

ENTRANCE/EXIT 

EXHIBITION 

NORTH LEVELS 

TO OTHER 

LEVELS 

IPSEN 

MILLENNIUM: 

THE TAKEDA 


EXHIBITION HALL - SOUTH LEVEL S0 

CIG 

SMU 

OCEANA 

ISTEM 

MEDIKAL 

A 

INTERNET 

CORNER 1 

GALIL MEDICAL MEDKONSULT 

MEDICA 

EUROPA 

WFIP 

UOMO 

MENARINI 

OPKO 

CUA CUA 

CANADA CHINA 

TERUMO AUA 

THERA- 

COAT 

MEDAC 

ASCLEPION MCUBE SIU 

ERBE 

ELEKTROMEDIZIN AYMED 

HOLOGIC 

GEN-PROBE 

BECKMAN 

COULTER 


ELMED 

ANGIO- 

DYNAMICS 

LISA 

SILIMED 

LASER 

ENDOCONTROL 

TRUMPF 

ERASMUS DENDREON 

NOVARTIS 

PROMEPLA 

MEDA (ROCAMED) CRYOLIFE 

MEDCOM LABORIE 

ROTTAPHARM 

MADAUS 

MEDISPEC 

LAMIDEY 

NOURY 

COOK MEDICAL 

LIMMER 

LASER 

CONMED/ 

VIKING 

SCOMEDICA 

DIREX 

RECORDATI 

HITACHI 

MEDICAL 

SYSTEMS 

EUROPE / 

HITACHI 

ALOKA 

WISEPRESS 

MMS 

RICHARD WOLF 

EUROPEAN 

UROLOGY 

UROTECH 

& 

UROVISION 

EDAP TMS 

TELEFLEX 

MEDI- 

WATCH 

ZEPHYR 

OM 

SIEMENS PHARMA 

ISMH 

MEL PAJUNK 

CL MEDICAL 


PFIZER 

AMGEN 

ISMH 

FERRING 


INTE 

COR 

BN IMMUNO 

THERAPEUTIC 

TO OTHER 

LEVELS 

QUANTA 


IBSA 

KO 

ASPIDE 

MÉDICAL 

INTERNET 

CORNER 2 

BN IMMUNO 

THERAPEUTICS FOTONA 

APOGEPHA 

TO OTHER 

LEVELS 


EMD 

TAEWOONG 

MEDICAL 


CATERING 


BOOTH: 





EBU 




IBSA 



BK MEDICAL 

UROTISS 


ALLIUM 

BARD 

LUMENIS 

LENUS 

BIOLITEC INFORMA NAMED 

PHARMA 

EMS HC ITALY TRISTEL 

WELLSPECT 

HEALTHCARE 

HISTOSCANNING 

BY AMD 

B C D E F G H 

OLYMPUS 

ASTELLAS 

ASTELLAS 

SHENZHEN 

HUIKANG SONY 

IPSEN 

MILLENNIUM: 

THE TAKEDA 


AMGEN 


FERRING 



EIGEN 


EIGEN 


JANSSEN 

PHARMA- 

CEUTICALS 


UROMED 

MEDTRONIC 


SMOKING 

AREA 

SIU ITALIA 

CURAN 

LUT 

ANDRO- 

MEDA 

T-DOC 

MYRIAD 

NEOTRACT 

INTEGRA 

SPHINX 

VISION 

SCIENCES 

NEOMEDIC 

PFIZER 


JANSSEN 

PHARMA- 

CEUTICALS 

BK 

KARL S 

P

ICAL 

SYSTEMS 

ASPIDE 

MÉDICAL 

ALLERGAN 

IBSA 

VEL S0 

TO OTHER 

LEVELS 

INTERNET 

CORNER 2 

BN IMMUNO 

THERAPEUTICS 

BK MEDICAL 

FOTONA 

APOGEPHA 

UROTISS 



ALLIUM 

TAEWOONG 

MEDICAL 

BARD 

LUMENIS 

CATERING 


BOOTH: 





EBU 





EMD 


BIOLITEC 

INFORMA NAMED 

EMS 

WELLSPECT 

HEALTHCARE 

HISTOSCANNING 

BY AMD 

LENUS 

PHARMA 

HC ITALY TRISTEL 

UROMED 

MEDTRONIC 

F G H 

JANSSEN 

PHARMA- 

CEUTICALS 

EIGEN 


EIGEN 




SMOKING 

AREA 

SIU ITALIA 

CURAN 

LUT 

ANDRO- 

MEDA 

T-DOC 

MYRIAD 

NEOTRACT 

INTEGRA 

SPHINX 

ELMEDICAL 

VISION 

SCIENCES 

NEOMEDIC 


33 

Exhibition

Exhibitors 

Alphabetical list of Exhibitors 

Please note that this list and the floor plans on the previous pages will not be comprehensive due to the printing date of this programme book 

(list and floor plans are updated through 30 January 2013). 

EXHIBITOR BOOTH NR. 

A 

A.M.I. GMBH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . E02 

ALLERGAN . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .F31 

ALLIUM LTD. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .G48 

AMERICAN MEDICAL SYSTEMS, INC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . E06 

AMERICAN UROLOGICAL ASSOCIATION (AUA) ..........................................................................A06 

AMGEN (EUROPE) GMBH .................................................................................................D20 

ANATOMY FOR UROLOGY - PRIMAL PICTURES LTD .....................................................................B59 

ANDROMEDA MEDIZINISCHE SYSTEME GMBH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H26 

ANGIODYNAMICS ..........................................................................................................B65 

APOGEPHA ARZNEIMITTEL GMBH .......................................................................................G35 

ASCLEPION LASER TECHNOLOGIES . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B47 

ASPIDE MÉDICAL ...........................................................................................................F47 

ASTELLAS PHARMA EUROPE LTD. ................................................................................ C04 & C20 

AYMED MEDICAL TECHNOLOGY . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B41 

B 

B. BRAUN AESCULAP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .G50 

BARD LTD . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G34 

BAYER HEALTHCARE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B31 

BECKMAN COULTER, INC. .................................................................................................B09 

BIOLITEC BIOMEDICAL TECHNOLOGY GMBH ............................................................................H47 

BJUI / WILEY-BLACKWELL . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C72 

BK MEDICAL . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . F38 

BN IMMUNOTHERAPEUTICS ..............................................................................................F44 

BOSTON SCIENTIFIC ........................................................................................................G11 

C 

CANADIAN UROLOGICAL ASSOCIATION (CUA CANADA) ................................................................A00 

CARESONO TECHNOLOGY CO., LTD. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H01 

CHINESE UROLOGICAL ASSOCIATION (CUA CHINA) .....................................................................A02 

CL MEDICAL ................................................................................................................E70 

COCHRANE INCONTINENCE REVIEW GROUP (CIG) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A07 

COLOPLAST - PORGÈS. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . E54 

CONMED / VIKING .........................................................................................................C25 

COOK MEDICAL . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B02 

CRYOLIFE EUROPA, LTD. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C35 

CURAN MEDICAL BV . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H32 

D 

DENDREON CORPORATION . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B25 

DEXTÉRITÉ SURGICAL .....................................................................................................G01 

DIREX GMBH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .C21 

DORNIER MEDTECH EUROPE GMBH .....................................................................................H05 


E 

EAU BOOTH .................................................................................................................H17 

EAU HISTORICAL EXHIBITION . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .H17 

EAU STOCKHOLM 2014 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .H17 

EAU RESEARCH FOUNDATION ............................................................................................H17 

EDAP TMS ..................................................................................................................D41 

EIGEN . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G31 

ELI LILLY AND COMPANY ..................................................................................................G06 

ELMED LITHOTRIPSY SYSTEMS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .B05 

ELMEDICAL LTD ............................................................................................................H10 

ELSEVIER ...................................................................................................................H03 

EMD MEDICAL . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .G44 

EMS ELECTRO MEDICAL SYSTEMS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H45 

ENDOCONTROL ............................................................................................................B33 

ERASMUS S.A. .............................................................................................................B27 

ERBE ELEKTROMEDIZIN GMBH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B45 

ESSM . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A32 

EUROPA UOMO ............................................................................................................A50 

EUROPEAN BOARD OF UROLOGY . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .H17 

EUROPEAN UROLOGY .....................................................................................................C02 

F 

FERRING INTERNATIONAL CENTER S.A. .................................................................................E42 

FOTONA B.B.. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . F48 

G 

GALIL MEDICAL ............................................................................................................A14 

GLAXOSMITHKLINE ........................................................................................................D06 

H 

HANGZHOU HAWK OPTICAL ELECTRONIC INSTRUMENTS CO., LTD. ...................................................B55 

HC ITALY ....................................................................................................................H41 

HEALUX . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A24 

HISTOSCANNING BY AMD . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H29 

HITACHI MEDICAL SYSTEMS EUROPE / HITACHI ALOKA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C48 

HOLOGIC GEN-PROBE .....................................................................................................B17 

I 

IBSA INSTITUT BIOCHIMIQUE SA. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .F01 

INFORMA HEALTHCARE ...................................................................................................H49 

INTEGRA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H14 

INTERNET CORNERS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .A22 & F54 

INTUITIVE SURGICAL ......................................................................................................E30 

IPSEN .......................................................................................................................D42 

ISMH (INTERNATIONAL SOCIETY OF MEN’S HEALTH) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . E43 

ISTEM MEDIKAL . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A01 

J 

JANSSEN PHARMACEUTICALS ....................................................................................F06 & G05 


35 

Exhibitors

Exhibitors 

Alphabetical list of Exhibitors 

K 

KARL STORZ GMBH & CO. KG . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . F26 

KITALPHA MED LTD ........................................................................................................ E01 

KLS MARTIN GROUP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .B11 

KOELIS ......................................................................................................................F02 

L 

LABORIE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B28 

LAMIDEY NOURY MEDICAL . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B10 

LENUS PHARMA GESMBH ................................................................................................H53 

LIMMER LASER GMBH ....................................................................................................C29 

LISA LASER PRODUCTS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B63 

LUMENIS DEUTSCHLAND GMBH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G18 

LUT GMBH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .H30 

M 

M.A.S. ...................................................................................................................... C37 

MCUBE TECHNOLOGY .....................................................................................................B49 

MEDA CO., LTD .............................................................................................................B32 

MEDAC GMBH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B53 

MEDCOM GMBH ...........................................................................................................B26 

MEDICA S.P.A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A12 

MEDICAL MEASUREMENT SYSTEMS B.V. ................................................................................C40 

MEDISPEC LTD . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B12 

MEDIWATCH PLC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . E47 

MEDKONSULT ..............................................................................................................A16 

MEDTRONIC INTERNATIONAL TRADING SÀRL . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H25 

MENARINI . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .A44 

MEXICAN SOCIETY OF UROLOGY (SMU) .................................................................................A05 

MILLENNIUM: THE TAKEDA ONCOLOGY COMPANY . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . D30 

MYRIAD GENETICS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H18 

N 

NAMED S.P.A. ..............................................................................................................H51 

NEOMEDIC INTERNATIONAL S.L. .........................................................................................H02 

NEOTRACT, INC. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H16 

NEXUS S.R.L. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A28 

NOVARTIS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B01 

O 

OCEANA THERAPEUTICS ..................................................................................................A03 

OLYMPUS MEDICAL SYSTEMS EUROPA GMBH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C01 

OM PHARMA SA ...........................................................................................................D64 

OPKO DIAGNOSTICS .......................................................................................................A10 

P 

PAJUNK GMBH ..............................................................................................................E37 

PFIZER INTERNATIONAL OPERATIONS ...................................................................................E22 

PHYSION . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A34 

PIERRE FABRE MÉDICAMENT . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . F30 

PROMEDON S.A. ...........................................................................................................G03 

PROMEPLA (ROCAMED) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B30 


Q 

QUANTA SYSTEM SPA ..................................................................................................... F22 

R 

RECORDATI .................................................................................................................C09 

RICHARD WOLF GMBH ....................................................................................................D51 

ROTTAPHARM | MADAUS .................................................................................................B22 

RUDOLF MEDICAL GMBH + CO. KG . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A30 

S 

SCOMEDICA ................................................................................................................C23 

SHENZHEN HUIKANG MEDICAL APPARATUS CO., LTD. .................................................................D70 

SIEMENS AG HEALTHCARE SECTOR ......................................................................................D54 

SILIMED INDUSTRIA DE IMPLANTES LTDA. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B61 

SIU SOCIETÀ ITALIANA DI UROLOGIA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H36 

SOCIÉTÉ INTERNATIONALE D’UROLOGIE (SIU) ..........................................................................B51 

SONACARE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G02 

SONY EUROPE LIMITED ...................................................................................................D72 

SPHINX MEDICAL LTD . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H12 

STARMEDTEC GMBH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . D02 

STORZ MEDICAL AG .......................................................................................................F26 

SYNERGO-MEDICAL ENTERPRISES ......................................................................................E39 

T 

T-DOC COMPANY, LLC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H24 

TAEWOONG MEDICAL, CO. LTD ...........................................................................................G42 

TELEFLEX ..................................................................................................................D74 

TERUMO EUROPE N.V. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .A04 

THERACOAT . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B57 

TIME RESEARCH LIMITED .................................................................................................B29 

TRIBUTE ....................................................................................................................E03 

TRISTEL SOLUTIONS .......................................................................................................H39 

TRUMPF ....................................................................................................................B33 

U 

UROMED KURT DREWS KG . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H35 

UROTECH GMBH & UROVISION GMBH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . D61 

UROTISS GMBH ...........................................................................................................G35 

V 

VISION-SCIENCES, INC. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .H06 

W 

WELLSPECT HEALTHCARE .................................................................................................H33 

WISEPRESS ONLINE BOOKSHOP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C42 

WORLD FEDERATION OF INCONTINENT PATIENTS - WFIP .............................................................A48 

Y 

YOUNG UROLOGISTS / RESIDENTS CORNER . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .H17 

Z 

ZEPHYR SURGICAL IMPLANTS .............................................................................................E41 


37 

Exhibitors

General information 

Abstracts 

More than 1.200 abstracts have been accepted for 

presentation during poster and video sessions in Milan. 

The EAU Abstract CD 2013 will be distributed to all 

congress delegates by FERRING PHARMACEUTICALS 

(booth E42 in the exhibition on level S0). The EAU 

Poster DVD 2013 will be distributed to all congress 

delegates by AMGEN (booth D20 in the exhibition on 

level S0). All abstracts and PDFs of the posters are 

available online at www.eaumilan2013.org/scientificprogramme. 

Abstracts are also available through the 

congress App. 

The EAU Poster DVD 2013 is supported by an 

unrestricted educational grant from AMGEN 

The EAU Abstract CD 2013 is supported by an 

educational grant from FERRING PHARMACEUTICALS 

Access to the Session Rooms 

Seating is regulated on a first-come, first-served basis. 

We recommend delegates to go to the session room 

well in advance of the session. Due to safety 

regulations, the organisers will close the session 

room when all seats are taken. It is not allowed for 

delegates to stand in the aisles of the rooms. 

Address and Accessibility 

Congress Centre 

The MiCo – Milano Congressi can be well reached by 

public transport. The public transport system is easy 

to use and a very efficient way to get around the city. 

Congress delegates may collect a complimentary 

transportation pass in the registration area on level N0. 

See also “Transportation Pass”. 

Address congress centre: 

MiCo - Milano Congressi 

Via Gattamelata 5 (Gate 14) 

20149, Milan, Italy 

T: +39 02 43 42 62 75 

F: +39 02 48 01 02 70 

www.micmilano.it 

By metro: 

The nearest metro station is “Amendola”. From there 

complimentary shuttle busses (see also “Shuttle Bus”) 

will bring participants to the main entrance of the 

congress venue. 

By car: 

From the ring roads circling Milan, follow the signs 

to “Fieramilanocity”. There is a car parking onsite 

(accessible through gate 17) or there are large Park & 

Ride car parks located close to the following Metro 

stops: Cascina Gobba (Green Line), San Donato (Yellow 

Line), Famagosta (Green Line), Bisceglie (Red Line), 

Lampugnano (Red Line) 

Airport Shuttle Bus 

From Milan Central Station (Stazione Centrale = 

Garibaldi Station) a shuttle bus goes directly to Linate 

(+/- 25 minutes) and Malpensa airport (+/- 60 

minutes). 

Malpensa 

The Malpensa shuttle bus operates between 03.45 and 

00.30 from Milan Central Station. The tickets cost € 10 

and can be purchased on board. The Malpensa shuttle 

bus to the airport departs every 20 minutes. The 

closest bus stop from the congress venue is at Viale 

Teodorico. 

Linate 

The Linate shuttle bus operates between 06.00 until 

23.00 from Milan Central Station. The tickets cost € 5 

and can be purchased on board. The bus to Milan 

Linate airport departs every 30 minutes. 

App - Your smart congress 

companion 

The Congress App will bring the 28th Annual 

EAU Congress to your smartphone. The 

application offers the best mobile overview of 

this scientific event with instant access to congress 

abstracts, exhibition booth locations and the latest 

news from before, during and after the meeting! This 

year you will find a whole new set of features and you 

won’t need constant internet access to navigate the 

information. Please, check under EAU 2013 in your App 

Store or Android market to get your smart congress 

companion. 

Award Gallery 

At the EAU Award Gallery you will find a complete 

overview of all awards that were handed out by the 

European Association of Urology this year (see page 

6-8 for an overview of the award winners). It also 

features information on past winners of the most 

prestigious EAU prizes. 

The EAU Award Gallery provides a great opportunity to 

take in all the important developments and breakthroughs 

in recent years. It can be found on level S2 

between the eURO Auditorium and the catering point, 

be sure to visit it! 


39 

General

General 


Badge Tracking System 

Congress delegates have a barcode on their badge 

which enables them to leave their contact details with 

exhibitors in a quick and easy way. The barcode will 

also be scanned at the entrance of the session rooms 

to gather CME and statistic information. 

Badges 

The badge classification is as follows: 

Blue badge : EAU member 

White badge : Delegate 

Brown badge : Nurse 

Green badge : Exhibitor 

Red badge : Press 

Purple badge : Accompanying person 

Yellow badge : Organising staff 

Bank, Exchange and Credit Cards 

The national currency in Italy is the Euro (€). Two ATM 

machines are available at the MiCo; one in the North 

wing on level N1 and one on in the South wing on 

level S1 on the balcony in the exhibition. A bank 

including an exchange office is available in the 

congress venue on level N0 near the entrance to the 

registration area. There are also banks near the 

congress centre, please go to the EAU Information Desk 

on level N0 for detailed information. 

Best Posters 

The Best Posters wall features the best scientific 

posters of the Milan Congress. This high-tech plasma 

wall is accessible during congress hours on level N0. 

The best posters can also be viewed through the 

congress website during and after the congress. 

Business Centre 

There is a Business Centre located on level S1 

(balcony) of the exhibition which offers facilities such 

as computers, printers, copiers and internet. 

Congress Hours 


Certificate of Attendance 

A Certificate of Attendance for the Milan Congress can 

be printed online at www.eaumilan2013.org as of 20 

March 2013. You will need your registration number 

(under barcode on the badge) to print the Certificate of 

Attendance. Information on CME accreditation is 

available in this programme book on page 47. 

Cloakroom / Luggage 

The cloakroom is located in the registration area on 

level N0 and open during congress hours. Please be 

sure to collect all personal belongings at the end of 

the day. 

CME Accreditation 

The 28th Annual EAU Congress is accredited by the 

UEMS/EACCME through the European Board of Urology. 

More information on national credit systems and 

credits recognition is available in this programme book 

on page 47-48. See also “EU-ACME Desk”. 

Congress Bag 

Each delegate can collect a congress bag in the registration 

area on level N0. 

The congress bags are sponsored by ASTELLAS 

Daily Congress Newsletter: 

European Urology Today Special 

Edition 

Special daily congress newsletters are available on 

Saturday 16, Sunday 17 and Monday 18 March. The 

newsletters cover on-site news, congress session 

information and background information on a 

variety of subjects. The first edition also contains an 

Exhibition Overview. The newsletters will also be 

available online at www.eaumilan2013.org during and 

after the congress. 

Speaker Service Registration Sessions Sponsored Exhibition Cloakroom 

Centre 

sessions 

Thursday, 14 March 14.00-19.00 08.00-20.00 

Friday, 15 March 08.00-19.00 07.00-20.00 09.00-21.00 16.15-17.45 07.00-21.30 

Saturday, 16 March 07.00-19.30 07.00-20.00 07.30-19.30 18.00-19.30 09.15-18.15 07.00-19.45 

Sunday, 17 March 07.00-19.30 07.00-19.30 07.30-19.15 17.45-19.15 09.15-18.15 07.00-19.30 

Monday, 18 March 07.00-19.30 07.00-19.30 07.30-19.15 17.45-19.15 09.15-18.15 07.00-19.30 

Tuesday, 19 March 07.00-13.10 07.00-13.30 08.00-13.10 07.30-13.30

EAU Congress Office 

Managing Directors 

Jacqueline Roelofswaard 

j.roelofswaard@uroweb.org 

Maurice Schlief 

m.schlief@uroweb.org 

Congress Manager 

Patricia de Bont 

p.debont@congressconsultants.com 

Exhibition Manager 

Henriet Wieringa 

h.wieringa@congressconsultants.com 

Manager Business Relations 

Peter Hazenberg 

p.hazenberg@uroweb.org 

Congress Consultants B.V. 

PO Box 30016 

6803 AA Arnhem 

The Netherlands 

T +31 (0)26 389 1751 

F +31 (0)26 389 1752 

info@congressconsultants.com 

www.eaumilan2013.org 

EAU Education Office 

(European School of 

Urology) 

The European School of Urology (ESU), working with 

European faculties, aims to provide high quality international 

educational courses in urology. The ESU has a 

special booth on level N-1 with extensive information 

on its activities. Registration for the courses can be 

made at the ESU registration desks in the registration 

area on level N0. The ESU Courses CD 2013 is 

distributed at the EAU desk next to the MILLENNIUM: 

THE TAKEDA ONCOLOGY COMPANY booth (booth D30 in 

the exhibition on level S0) to all congress delegates. 

The ESU Courses CD 2013 is supported by an 

unrestricted educational grant from MILLENNIUM: 

THE TAKEDA ONCOLOGY COMPANY 

Fees ESU Courses (for congress registered delegates 

only) 

2 hrs. 3 hrs. 

EAU members € 32 € 47 

Non-EAU members € 47 € 69 

Residents (members/non-members) € 21 € 21 

Prices are excl. 21% VAT 

Hands-on training sessions on Laparoscopy, 

Ureterorenoscopy, Bipolar TURP, Robotic surgery, 

Endourology, Urodynamics and Green light laser are 

organised by the ESU in cooperation with the EAU 

Robotic Urology Section (ERUS), the EAU Section 

of Uro-Technology (ESUT) and the EAU Section of 

Urolithiasis (EULIS). 

The registration fee is € 25 per hands-on training (excl. 

VAT). 

Registration for hands-on trainings and courses can 

be made at the ESU registration desks and in the Self 

Service Area in the registration area on level N0. 

The Hands-on training sessions are supported by 

educational grants from AMERICAN MEDICAL SYSTEMS, 

INTUITIVE SURGICAL, KARL STORZ GMBH & CO.KG, 

MEDIWATCH and OLYMPUS EUROPA HOLDING GMBH 

E-BLUS (European training in Basic Laparoscopic 

Urological Skills) 

One of the main goals of the EAU is to establish 

and introduce common standards for training and 

European urological practice in order to improve 

patient care. 

The E-BLUS exam tests certifies a basic level of 

laparoscopic urological skills. The exercises address 

bimanual dexterity, depth perception, suturing, 

clipping and cutting skills. Clinical application is found 

in such procedures as partial nephrectomy, total 

nephrectomy, pyeloplasty and radical prostatectomy. 

To aid in the training of these skills and to prepare for 

this E-BLUS exam, the exercises to be performed can 

be found in the instructional videos at 

http://hot.uroweb.org/exercises/. 

At the EAU Annual Congress several exam sessions 

will be organised where you can demonstrate your 

skills and be awarded with a certificate if you pass the 

defined criteria. Interest usually exceeds the number 

of available positions, participation in the exam is 

therefore by invitation. 

For more information: http://hot.uroweb.org or at the 

ESU booth. 


41 

General

General 


EAU Booth 

The EAU Booth (booth H17 in the exhibition on level S0) 

consists of the EAU Membership Booth, EBU Corner, 

Young Urologists/ Residents Corner, EAU Stockholm 

2014 Promotion Counter, EAU Research Foundation 

and the EAU Historical Exhibition. 

There is also information on European Urology and 

other EAU publications. The EAU Membership Booth 

provides information on membership status and 

membership benefits. Non-members are welcome to 

visit the EAU Booth for further information and to 

apply for EAU membership. 

EAU Research 

Foundation 

The EAU Central Research Office initiates and 

coordinates, as well as refines investigator initiated 

and other clinical research protocols. It also acts to 

facilitate all aspects of clinical research and expand 

the current network of active research centres and 

investigators - basic and clinical - both within the 

EAU member states and its international affiliates. The 

office coordinates clinical and translational research in 

close liaison with the EAU Research Foundation. The 

EAU Research Foundation can be visited at the EAU 

Booth (booth H17) in the exhibition on level S0. 

Education & 

Innovation 

The EAU Education & Innovation booth, located in 

the exhibition on level S1 (Balcony), represents a 

joint effort of the European School of Urology, the 

EAU Section of Uro-technology, the EAU Section on 

Urolithiasis and the EAU Robotic Urology Section, 

which offers urologists a hands-on experience with 

notable technological innovations in urological 

treatment and training. 

Electricity 

The electricity in Italy runs on 220 volts and the 

frequency is 50 Hz. Plugs have two or 3 round pins. 

A plug adaptor will be required if incompatible 

electronic devices are used. 

Emergency Phone Numbers 

In case of an emergency please call 113 for police, 115 

for fire brigade or 118 for ambulance service. In case of 

an emergency in the congress centre please call 

+39 02 4342 7210 or contact a security guard 

immediately. See also “First Aid”. 


EU-ACME Desk 

Information on the EU-ACME programme, CME/CPD 

credits, membership status & benefits, accredited CME 

activities and national CME credits systems can be 

obtained at the EU-ACME Desk in the registration area. 

For more information see page 48. 

European Association of 

Urology Nurses (EAUN) 

The 14th International Meeting of the European 

Association of Urology Nurses (EAUN) is a 3-day 

scientific meeting that will be held in conjunction with 

the 28th Annual EAU Congress from 16-18 March in 

support of their goal to continually upgrade the nursing 

skills of urology nurses. Scheduled are for example 

abstract sessions and panel discussions and expert 

nurses and urologists will give lectures, workshops 

and courses. See page 29 for the EAUN programme. 

There is also a special EAUN congress App available; 

search for EAUN 2013 in your App Store or Android 

market. 

European Board of 

Urology (EBU) 

The European Board of Urology (EBU) operates as an 

independent section of the UEMS (European Union of 

Medical Specialists) charged with regulatory matters. 

Visit the EBU Corner at the EAU Booth (booth H17 in the 

exhibition on level S0) to obtain more information on 

EBU’s core activities: 

• European Board Examinations in Urology (FEBU) 

• In-Service Assessment 

• Accreditation of Continuing Medical Education & 

Professional Development (CME & CPD) 

• Certification of Sub-Specialty Centres and 

Residency Training Programmes in Urology. 


European Urology, the official journal of the EAU, has 

been a respected urological forum for over 20 years 

and is currently read by more than 10,000 

urologists across the globe. With an impact factor of 

8.493 the Platinum Journal remains the leading 

scientific publication in the field of urology. To keep up 

with the rapidly evolving world of medicine, 

technology and surgical techniques, European Urology 

is constantly updating and innovating its features and 

layout in order to provide the best clinical guidance, 

research and education for urologists across Europe 

and the world. The recently implemented electronic 

features and platforms make reading the articles 

and viewing the videos even more interesting! Come

see European Urology for yourself - visit either the 

European Urology (booth C02) or the EAU Booth (booth 

H17) in the exhibition on level S0. 

Excursions and Milan Information 

Information on Milan and excursions will be available 

at the Milan Info & Excursions Desk in the registration 

area on level N0. 

Exhibition 

An extensive technical exhibition will be held jointly 

with the congress. The exhibition is open to technical 

equipment manufacturers, pharmaceutical companies 

and scientific publishers. 

Exhibition Hours 

Saturday, 16 March 09.15-18.15 hrs 

Sunday, 17 March 09.15-18.15 hrs 

Monday, 18 March 09.15-18.15 hrs 

First Aid 

There is a medical unit present for first aid on level 

S1 indicated on the directional signs with . In case 

of emergency, contact a security guard immediately 

or call +39 02 4342 7210. See also “Emergency Phone 

Numbers”. 

Guidelines 

EAU Extended guidelines 

The EAU extended urological guidelines edition 2013, 

are distributed at the EAU Booth (booth H17 in the 

exhibition on level S0). Members can collect the 

guidelines free of charge. This publication is also 

available for purchase. 

EAU Pocket guidelines 

EAU urological guidelines in pocket format 

including a CD are distributed by Olympus (booth C01 

in the exhibition on level S0) to EAU members only. 

The distribution of the EAU Pocket Guidelines 2013 is 

supported by OLYMPUS 

Historical Exhibition 

The EAU History Office has set up an historical exhibit 

located at the EAU Booth (booth H17 in the exhibition 

on level S0). The exhibit will present “My other 

passion. The urologist as a collector”. 

Hospitality Suites Companies 

AMS Hospitality Suite 1; MiCo South 

Level S2 

ASTELLAS Gold View Lounge; MiCo South 

level S2 

COOK MEDICAL Panorama Lounge; MiCo South 

level S3 

TAKEDA Hospitality Suite 2; MiCo South 

Level S2 

SANOFI Hospitality Suite 3: MiCo South 

Level S2 

Hotel Accommodation 

The EAU has contracted the company K.I.T. Group 

GmbH to deal with the housing for the congress. K.I.T. 

staff will be available at the Hotel Desk in the 

registration area on level N0. 

Insurance 

The organisers do not accept responsibility for any 

personal damage. Participants are strongly 

recommended to arrange their own personal 

insurance. 

Internet Corners 

The EAU Internet Corners are at your disposal at 

different locations in the exhibition on level S0 (booth 

A22 and booth F54). The internet corners offer free use 

of internet and printers. See also “WiFi / Charge and 

Connect Area”. 

Language 

All presentations during the EAU Congress will be 

conducted in English, the official language of the EAU. 

There will be no translation provided. 

Learning Objectives EAU Congress 

The EAU Congress provides a forum for presenting 

original unpublished data and sharing ideas for 

urological innovation as well as disseminating 

evidence-based knowledge of primary clinical 

relevance. 

Urologists and affiliated professionals attending the 

EAU Congress will be able to: 

• Review innovative techniques and scientific 

advances in the field of urology and its sub- 

specialities 

• Review the latest data and emerging trends from 

studies in clinical and translational research 

• Enhance their knowledge of evidence-based 

approaches to the management of urological 

disease 


43 

General

General 


• Gain new knowledge on emerging diagnostic and 

risk-assessment strategies in the management of 

urological disease 

• Enhance their practical knowledge and skills by 

educational activities, including hands-on-training 

and courses 

• Gain exposure to new developments in drugs 

and new cutting edge technology in the field of 

pharmaceutical research and medical technology 

through visiting the EAU Congress Exhibition 

• Communicate, collaborate and network with 

representatives of a large international 

audience – medical professionals, national 

urological societies, patient groups, medical 

industry and the media. 

Lost and Found 

Found items should be returned to the Information 

Desk in the main entrance hall on level N0. If you lose 

something, please report to this desk for assistance. 

Media Policy 

Photography, filming and interviews during the congress 

(with the exception of the EAU Press Centre and 

EAU Press Conference Room) are prohibited without 

written permission from the EAU Communication 

Officer Ms. Ivanka Moerkerken (i.moerkerken@uroweb. 

org). 

Mobile Phones 

Mobile phones must be switched off during all 

sessions. 

Personal Planner 

Do not miss anything during this year’s congress, use 

the EAU Personal Planner! 

• It is fully integrated with the scientific programme 

of the congress. 

• You can select your priority sessions and add your 

private appointments. 

• If you are presenting at the congress – your faculty 

appointments will be automatically displayed. 

• You can export it to your Outlook, Google Calendar 

or print it out. 

For more information, please visit the congress 

website: http://www.eaumilan2013.org/scientificprogramme/eau-personal-planner/ 

Poster Builder Service 

Poster presenters who created their posters for the 

Milan Congress through the EAU Online Poster Builder 

Service, can collect their posters at the Speaker Service 


Centre on level N0. 

Poster DVD 

A DVD with a collection of scientific posters from the 

Milan Congress will be distributed by AMGEN (booth 

D20 in the exhibition on level S0). 

The EAU Poster DVD 2013 is supported by an unrestricted 

educational grant from AMGEN 

Prayer Room 

A special room dedicated to prayer is located on level 

S3 (follow the signage on this level). 

Presentation Training Centre 

Mr. Paul Casella (Iowa, USA) gives Individual 

Presentation Skills Training Sessions to help improve 

presentation and delivery skills. The one-on-one half 

hour sessions are free of charge and available to all 

speakers. Appointments for this very popular training 

session can be made at the Speaker Service Centre 

(level N0). 

Press Centre 

Journalists and medical/science writers can obtain 

free registration to the Congress. Journalists receive a 

press pack, to be collected at the EAU Press Centre in 

White Hall 1 on level N1. All press are invited to report 

to the EAU Press Centre to obtain the assistance and 

information they require. Internet access, printer and 

photocopier are provided. 

Resource Centre 

Urology Science and Learning 

The Resource Centre is a website 

(www.eauresourcecentre.org) that delivers EAU 

content to users on-demand and allows to select 

content and webcasts of lectures and presentations 

that might otherwise be missed. 

Restaurant Reservations 

The choices for eating out in Milan are endlessly varied. 

Traditional Milanese cooking is made up of 

unpretentious but tasty dishes offered in numerous 

trattorias, inns and restaurants (including very luxury 

ones). 

Popular dishes are Risotto alla Milanese (made with a 

bull-bodied beef broth), Cassouela (an extremely 

filling meat dish with cabbage and other vegetables) 

and Cotoletta alla Milanese (a crunchy veal cutlet). 

Enjoy also an aperitif during ‘happy hour’, a ritual in 

Milan. The local classic is a Negroni, a potent blend of 

bitter Campari, gin, red Martini and ice. In many bars

and restaurants the aperitif is accompanied by tasty 

appetizers. 

To place your restaurant booking go to the Restaurant 

Reservations Desk in the registration area on level N0. 

Safety 

All bags may be subject to inspection. Security is 

present for your safety. Please take all personal effects 

with you when leaving a session room. 

Smoking Policy 

Smoking is prohibited inside the congress centre and 

in the exhibition area. An outside smoking area is 

available via an exit in the exhibition hall (level S0) 

between booth H01 and H02. Outside exhibition 

opening hours smoking is only allowed in front of the 

main entrance of the congress centre on level N0. 


For extensive speaker information see page 46. 

Taxi Service 

There is a taxi rank available in front of the main 

entrance of the congress centre – Via Gattamelata 5 

(Gate 14). 

In order to book a taxi please go to the Milan Info & 

Excursions desk in the registration area (Level N0), 

they can guarantee the official rates are applied for the 

reservations made though them. 

Rates: 

- From the congress centre to airport Malpensa 

approx. € 90 

- From the congress centre to airport Linate 

approx. € 25/30 

If you wish to book a taxi in Milan by phone we 

recommend to call the following companies: 

Yellow Taxi: +39 02 69 69 or Radio Taxi +39 02 8585/ 

+39 02 4040/+39 02 6969. 

It is also possible to book car transfers to the airports 

at the TBlu desk in the main entrance (level N0). 

Transportation Pass 

Congress delegates may collect a complimentary transportation 

pass in the registration area (level N0) which 

is valid for unlimited travels from 15-19 March 2013. 

The pass covers underground, tram and bus within 

the city limits of Milan. The airport cannot be reached 

with this transportation pass. See also “Airport Shuttle 

Bus”. 

Upcoming Meetings 

Posters and other information on upcoming meetings 

can be displayed in the “Upcoming Meetings” 

promotion area on level N0. It is strictly forbidden to 

put up promotional material at any other location in 

the building. 

Video Library 

The EAU Video Library is located on South level S2, in 

the passage between North and South. A wide choice 

of EAU videos, including all videos presented in Milan 

and at previous EAU Congresses, can be viewed on 

individual monitors. 

All videos can be copied to a DVD which can be 

collected at the ASTELLAS booth during exhibition 

hours (booth C20 in the exhibition on level S0), a 

service that is provided free of charge to all congress 

delegates. 

On Tuesday 19 March DVD’s can be collected in the 

registration area. 

Video library hours: 

Friday, 15 March 12.00-18.00 

Saturday, 16 March 09.00-17.45 

Sunday, 17 March 09.00-17.45 

Monday, 18 March 09.00-17.45 

The Video Library is supported by an unrestricted 

educational grant from ASTELLAS 

Webcasts ( ) & Live Streams ( ) 

Many sessions will be webcasted via 

www.eaumilan 2013.org. The webcasted sessions are 

indicated with a special logo in the synopsis and will 

be online within several hours after the session. 

The webcasts have not been edited and are exactly as 

presented. The statements and the opinions featured 

in the webcasts are solely those of the individual 

presenters and not of the European Association of 

Urology (EAU). Webcasts are not accredited and no 

CME credits can be obtained by watching the webcasts. 

In addition to the webcasts there will be live streams 

of several sessions available at the congress website: 

www.eaumilan2013.org. These sessions are also indicated 

in the synopsis with a special logo. 

WiFi / Charge and Connect Area 

Free wireless internet will be available throughout the 

congress centre except in the exhibition areas. Please 

search for the “EAU” WiFi. 

A special “Charge and Connect Area” with tables and 

power outlets is available on level N1. The “Charge 

and Connect Area” allows you to recharge your laptops 

and phones while using WiFi. 


45 

General

General 

Speaker guidelines 


Only digital presentations will be accepted during the 

congress and all presentations should be handed in 

at least three hours prior to the start of the session 

at the Speaker Service Centre (Level 0 - North Wing). 

Failure to do so could result in presentations not being 

available for projection when required. If you have an 

early presentation, please hand in your presentation the 

previous day! 

Opening hours 

Thursday, 14 March 14.00 - 19.00 

Friday, 15 March 08.00 - 19.00 

Saturday, 16 March 07.00 - 19.30 

Sunday, 17 March 07.00 - 19.30 

Monday, 18 March 07.00 - 19.30 

Tuesday, 19 March 07.00 - 13.30 

If you are a chair person 

Locate your session room in time. Please be in your 

session room at least 15 minutes prior to the start of 

the session. 

Kindly note that: 

• Speakers should strictly observe timing. 

• Discussants should first clearly state their name, 

institution and country of origin. 

If you are presenting a poster 

Posters must be put up in the room 15 minutes prior 

to the start of the session. The poster boards are 

numbered and your poster should be mounted on the 

board which corresponds with your abstract number. 

Pushpins are available in the session room. Please 

remove your poster immediately at the end of the 

session. A maximum of 5 PowerPoint slides is allowed 

during extended poster presentation. For standard 

poster presentations, a maximum of 2 PowerPoint 

slides is allowed. 

Disclose links to the industry 

The EAU Scientific Congress Office requests that you 

disclose to the audience any links you may have with 

the industry related to the topic of your lecture at 

the beginning of your session. A link can be: Being a 

member of an advisory board or having a consultancy 

agreement with a specific company. 

Presentation Training Centre 

Mr. Paul Casella (Iowa, USA) gives Individual 

Presentation Skills Training Sessions to help improve 

presentation and delivery skills. The one-on-one half 

hour sessions are free of charge and available to all 


speakers. Please go to the Speaker Service Centre to 

make an appointment for this popular training session.


Accreditation of the EAU Congress 

The request for the European accreditation of the 28th 

Annual EAU Congress will be submitted to the UEMS/ 

EACCME. 

The ‘28th Annual EAU Congress’ is designated for 

a maximum of 27 hours of European external CME 

credits. 

Each medical specialist should claim only those hours 

of credit that he/she actually spent in the educational 

activity. 

CME credits 

The EACCME/EBU credit system is based on 1 ECMEC 

per hour with a maximum of 3 ECMECs for half a day 

and 6 ECMECs for a full-day event. 

Please scan your EAU congress badge when entering 

the lecture room to have CME credits registered automatically. 

The CME credit registration is carried out by 

the EUACME Office and during the congress you can 

find their desk at the registration area. 

CME credits per Country 

The EBU/EACCME CME credits are recognised by most 

of the national CME authorities in Europe, which have 

agreed to cooperate in this European system. 

All CME activities approved by the EBU/EACCME 

are recognised in the following countries: Austria, 

Belgium, Cyprus, Czech Republic, Finland (ProMedico), 

Georgia, Greece, Hungary, Ireland, Luxembourg, Malta, 

The Netherlands, Norway, Italy (Region Lombardia), 

Romania, Slovakia, Slovenia, Spain, Sweden (IPULS), 

Turkey and United Kingdom. 

CME credits per Speciality 

All CME activities approved by the EBU/EACCME are 

recognised in the following specialities: Dermatology 

and Venerology, Paediatric Surgery, Physical and 

Rehabilitation Medicine, Anaesthesiology, Child 

and Adolescent Psychiatry and Psychotherapy, 

Endocrinology, Geriatrics, Intensive Care (MJC), 

Internal Medicine, Neurology, Neurosurgery, Nuclear 

Medicine, Oral and Maxillofacial Surgery, Pathology, 

Plastic Surgery, Cardiology (EBAC), Sports Medicine 

(MJC), Genetics (MJC), Emergency Medicine (MJC), 

Microbiology, Hand Surgery (MJC), Pneumology 

(EBAP), Infectious Diseases (EBAID), Surgery, Urology, 

Oncology (ACCO), Vascular Surgery, Gastroenterology, 

Allergology. 

If your country or speciality is not listed above please 

either contact the EU-ACME Office for more information 

or send a copy of the attendance certificate to 

your National Urological Society and/or National 

Accreditation Body. 

CME credits outside Europe 

Through an agreement between the European Union 

of Medical Specialists and the American Medical 

Association, physicians may convert EACCME 

credits to an equivalent number of AMA PRA Category 

1 Credits. Information on the process to convert 

EACCME credit to AMA credit can be found at 

www.ama-assn.org/go/internationalcme. 

If you attended a conference in Europe and received 

a certificate for EACCME credit you can convert it to 

the AMA PRA Category 1 Credit. To receive the credit, 

the conference must appear on the list of approved 

activities posted in the EACCME section of the UEMS 

Website. 

To apply for conversion of EACCME credit to AMA PRA 

Category 1 Credit, download the Application for 

EACCME Credit Conversion and submit the completed 

application by fax or mail, a copy of the EACCME credit 

certificate and appropriate processing fee. A certificate 

of AMA PRA Category 1 Credit will be mailed within 

four weeks. 

If you wish to receive information about the conversion 

procedure of EACCME credits to AMA PRA category 1 

credits, please contact the AMA. 

Live educational activities, occurring outside of 

Canada, recognised by the UEMS-EACCME for ECMEC 

credits are deemed to be Accredited Group Learning 

Activities (Section 1) as defined by the Maintenance 

of Certification Program of The Royal College of 

Physicians and Surgeons of Canada. 


47 

General

General 

EU-ACME Programme 

The EU-ACME Programme - the initiative resulting 

from a close collaboration between the European 

Board of Urology (EBU) and the European Association 

of Urology (EAU) - stands for European Urology - 

Accredited Continuing Medical Education. Its primary 

task is assistance in the implementation, promotion 

and organization of Continuing Medical Education 

(CME) and Continuing Professional Development (CPD) 

among European urologists. Urologists have access to 

an online system - in compliance with the EBU/UEMS 

regulations - which helps them to keep track of their 

educational activities, irrespective of the country they 

practice in or where they have participated in 

accredited CME/CPD activities. 

CME/CPD activities are generally geared towards 

practising physicians and are designed to provide 

information that is both relevant and essential to 

medical practice. 

The EU-ACME office acts as a central ‘institution’ 

where all information forwarded by urologists, (inter) 

national urological associations and CME organisers/ 

providers is kept. 

As a service institution the EU-ACME office offers: 

• registration of credit points for members of the 

urological society participating in the EU ACME 

programme, 

• access to the online CME/CPD credit system via 

webpage www.eu-acme.org, 

• the EU ACME membership card for urologist participating 

in the programme, 

• yearly Credit Registry Report listing all collected 

CME/CPD credit points, 

• registration of accredited on national and/or 

European level CME events, 

• assistance in obtaining European Accreditation. 


The international urological societies as European 

Association of Urology, European Society of Paediatric 

Urology and International Continence Society as well 

as national urological societies from: Austria, Czech 

Republic, Cyprus, Denmark, Egypt, Estonia, Greece, 

Hungary, Italy, Latvia, Malta, The Netherlands, Poland, 

Portugal, Romania, Serbia, Slovakia, Slovenia, Spain 

have already joined the programme. For more information, 

please visit the website: www.eu-acme.org. 

Information on the EU-ACME programme, your 

acquired CME/CPD credits and membership cards can 

be obtained at the EU-ACME information desk in the 

registration are.

Congress hotels 

AC Milano 

Via Tazzoli, 2 

20154 Milan 

T +39 0220424211 

F +39 0220424212 

www.ac-hotels.com 

Metro M2 Garibaldi 

Adi Hotel Poliziano 

Fiera 

Via Poliziano, 11 

20154 Milan 

T +39 023191911 

F +39 023191931 

www.hotelpolizianofiera.it 

1.1 km walking distance 

Admiral Hotel 

Via Domodossola, 16 

20145 Milan 

T +39 023492151 

F +39 0233106660 

www.admiralhotel.it 


Antares Hotel 

Accademia 

Viale Certosa, 68 

20155 Milan 

T +39 0239211122 

F +39 0233103878 

www.antareshotels.com 


Antares Hotel Milan 

Rubens 

Via Rubens, 21 

20148 Milan 

T +39 0240302 

F +39 0248193114 

www.antareshotels.com 

Metro M1 De Angeli 

Art Hotel Navigli 

Via Angelo Fumagalli, 4 

20143 Milan 

T +39 0289438 

F +39 0258115066 

www.arthotelnavigli.com 

Metro M2 Porta Genova 

ATA Hotel Executive 

Viale Luigi Sturzo, 45 

20154 Milan 

T +39 02895261 

F +39 0229010238 

www.atahotels.it 


ATA Hotel Expo Fiera 

Via Giovanni Keplero, 12 

20016 Milan 

T +39 02895261 

F +39 023535959 


Metro M1 Pero 

ATA Hotel Quark 

Via Lampedusa, 11/3 

20141 Milan 

T +39 02895262 

F +39 028464190 


Metro M2 Abbiategrasso 

Atlantic Quality Hotel 

Via Torriani Napo, 24 

20124 Milan 

T +39 026691941 

F +39 026691833 

www.hotelatlanticmilan.com 

Metro M2 Centrale 

Auriga Hotel 

Via Giovanni Battista Pirelli, 7 

20124 Milan 

T +39 0266985851 

F +39 0266980698 

www.auriga-milano.com 


Best Western Astoria 

Hotel 

Viale Murillo, 9 

20149 Milan 

T +39 0240090095 

F +39 0240074642 

www.astoriahotelmilano.com 


Best Western 

Cristoforo Colombo 

Hotel 

Corso Buenos Aires, 3 

20124 Milan 

T +39 0229406214 

F +39 0229516096 

www.hotelcristoforocolombo.com 

Metro M1 Porta Venezia 

Best Western Felice 

Casati Hotel 

Via Felice Casati, 18 

20124 Milan 

T +39 0229404208 

F +39 0229404618 

www.hotelfelicecasati.com 

Metro M1 Lima 

Best Western Galles 

Hotel 

Piazza Lima, 2 

20124 Milan 

T +39 02204841 

F +39 022048422 

www.galles.it 

Metro M1 Lima 

Best Western Madison 

Hotel 

Via Leopoldo Gasparotto, 8 

20124 Milan 

T +39 0267074150 

F +39 0267075059 

www.madisonhotelmilano.com 

Metro M3 Sondrio 

Best Western Major 

Hotel 

Viale Isonzo, 2 

20135 Milan 

T +39 0255188335 

F +39 0255183140 

www.bwhotelmajor-mi.it 

Metro M3 Lodi TIBB 


49 

General

General 


Best Western Mozart 

Hotel 

Piazza Gerusalemme, 6 

20154 Milan 

T +39 0233104215 

F +39 0233103231 

www.hotelmozartmilan.com 


Capitol World Class 

Hotel 

Via Domenico Cimarosa, 6 

20144 Milan 

T +39 02438591 

F +39 02438591 

www.hotelcapitolmilano.com 

Metro M1 Pagano 

Carrobbio Hotel 

Via Medici, 3 

20123 Milan 

T +39 0289010740 

F +39 028053334 

www.hotelcarrobbiomilano.com 

Metro M3 Italia Missori 

Cavour Hotel 

Via Fatebenefratelli, 21 

20121 Milan 

T +39 02620001 

F +39 026592263 

www.hotelcavour.it 

Tram 61 Via Fatebenefratelli 

C.so di P.ta Nuova 

Crowne Plaza Milan 

City 

Via Melchiorre Gioia, 73 

20124 Milan 

T +39 0266717715 

F +39 0266703483 

www.crowneplazamilan.com 

Metro M3 Sondrio 

Dei Cavallieri Duomo 

Hotel 

Piazza Missori, 1 

20123 Milan 

T +39 0288571 

F +39 0272021683 

www.hoteldeicavalieri.com 

Metro M3 San Donato 


Doria Grand Hotel 

Viale Andrea Doria, 22 

20124 Milan 

T +39 0267411411 

F +39 026696669 

www.doriagrandhotel.it 

Metro M2 Caiazzo 

DoubleTree by Hilton 

Hotel Milan 

Via Ludovico di Breme, 77 

20156 Milan 

T +39 02928831 

F +39 0292883883 

www.hotel-cosmopolita.com 

Tram 14 Vle Certosa Via Casella 

Enterprise Hotel 

Corso Sempione, 91 

20149 Milan 

T +39 0231818 1 

F +39 0231818811 

www.enterprisehotel.com 

1 km walking distance 

Four Points by 

Sheraton Milan 

Via Gerolamo Cardano, 1 

20124 Milan 

T +39 0231818 811 

F +39 0231818 398 

www.fourpointsmilan.com 

Metro M2 Goioa 

Grand Visconti Palace 

Viale Isonzo, 14 

20135 Milan 

T +39 02540341 

F +39 0254069523 

www.grandviscontipalace.com 

Metro M3 Lodi TIBB 

Hermitage Hotel 

Via Messina, 10 

20154 Milan 

T +39 02318170 

F +39 0233107399 

www.monrifhotels.it 

Metro M2 Moscova 

Hilton Milan 

Via Luigi Galvani, 12 

20124 Milan 

T +39 0269831 

F +39 0266531 

www.hilton.com 

Metro M2 Gioia 

Holiday Inn Milan 

Garibaldi Station 

Via Ugo Bassi, 1/A 

20159 Milan 

T +39 026076801 

F +39 026880764 

www.holidayinn.com 


Hotel Johnny 

Via Giovanni Prati, 6 

20145 Milan 

T +39 02341812 

F +39 0233610521 

www.hoteljohnny.com 


Ibis Milano Ca’Granda 

Viale Giovanni Suzzani, 13 

20162 Milan 

T +39 0266103000 

F +39 0266102797 

www.accorhotels.com 

Tram 51 V.le Suzzani V.le Berbera 

Ibis Milano Centro 

Via Camillo Finocchiaro Aprile, 2 

20124 Milan 

T +39 0263151 

F +39 026598026 

www.ibishotel.com 

Metro M3 Republica 

Marriott Milan 

Via Washington, 66 

20146 Milan 

T +39 0248521 

F +39 024818925 

www.marriott.com 

Metro M1 Wagner

Mediolanum Hotel 

Via Mauro Macchi, 1 

20124 Milan 

T +39 026705312 

F +39 0266981921 

www.mediolanumhotel.com 

Metro M3 Republica 

Melia Milano 

Via Tommaso Masaccio, 19 

20149 Milan 

T +39 0244406 

F +39 0244406600 

www.melia-milano.com 


Mini Hotel La Spezia 

Via la Spezia, 25 

20142 Milan 

T +39 0284800660 

F +39 0236504276 

www.hotellaspeziamilano.it 

Metro M2 Famagosta 

Mini Hotel Portello 

Via G. Silva, 12 

20149 Milan 

T +39 024814944 

F +39 024819243 

www.hotelportellomilano.it 

Metro M1 Lotto Fiera 

Mini Hotel Tiziano 

Via Tiziano, 6 

20145 Milan 

T +39 024699035 

F +39 024812153 

www.hoteltizianomilano.it 

Metro M1 Buonarroti 

Mirage Hotel 

Viale Certosa, 104/106 

20156 Milan 

T +39 0239210471 

F +39 0239210589 

www.hotelmirage-milano.com 


Nasco Hotel 

Corso Sempione, 69 

20149 Milan 

T +39 0231951 

F +39 0231952777 

www.hotelnascomilano.it 


NH Fiera Milano 

Viale degli Alberghi s/n 

20017 Milan 

T +39 02300371 

F +39 02300300 

www.nh-hotels.com 

Metro M1 Rho Feira 

NH Grand Hotel Verdi 

Via Melchiorre Gioia, 6 

20124 Milan 

T +39 0262371 

F +39 02300300 


Metro M2 Gioia 

NH Machiavelli 

Via Lazzaretto, 5 

20124 Milan 

T +39 02631141 

F +39 02300300 



NH Milano Touring 

Via Ugo Tarchetti, 2 

20121 Milan 

T +39 0263351 

F +39 02300300 


Metro M3 Repubblica 

NH President 

Largo Augusto, 10 

20122 Milan 

T +39 0277461 

F +39 02300300 


Metro M1 San Babila 

Nhow Milano 

Via Tortona, 35 

20144 Milan 

T +39 024898861 

F +39 02300300 


Metro M2 Porta Genova 

Novotel Milano 

Ca’Granda 

Viale Suzzani, 13 

20162 Milan 

T +39 02641151 

F +39 0266101961 

www.novotel.com 

Metro M3 Maciachini 

Palazzo Delle Stelline 

Hotel 

Corso Magenta, 61 

20123 Milan 

T +39 024818431 

F +39 0248519097 

www.hotelpalazzostelline.it 

Metro M1 Conciliazione 

Radisson Blu Hotel 

Milan 

Via Villapizzone, 24 

20156 Milan 

T +39 023631888 

F +39 023631870 

www.radissonblu.com 

Metro M1 QT8 

Raffaello Hotel 

Viale Certosa, 108 

20156 Milan 

T +39 02392431 

F +39 02392235 

www.hotel-raffaello.it 


Ramada Plaza 

Via Stamira D’Ancona, 27a 

20127 Milan 

T +39 02288541 

F +39 02282563 

www.ramadaplazamilano.it 

metro M1 Turro 


51 

General

General 


Regency Milan Hotel 

Via G. Arimondi, 12 

20155 Milan 

T +39 0239216021 

F +39 0239217734 

www.regency-milano.com 


Regina Hotel 

Via Cesare Correnti, 13 

20123 Milan 

T +39 0258106913 

F +39 0258106563 

www.hotelregina.it 

Metro M2 Sant Ambrogio 

Royal Garden Hotel 

Via G. Di Vittorio 

20090 Milan 

T +39 02457811 

F +39 0245702901 

www.monrifhotels.it 

Metro M2 Famagosta 

Sanpi Milano Hotel 

Via Lazzaro Palazzi, 18 

20124 Milan 

T +39 0229513341 

F +39 0229402451 

www.hotelsanpimilano.it 


Sheraton Diana 

Majestic 

Viale Piave, 42 

20129 Milan 

T +39 0220581 

F +39 0220545 

www.sheratondianamajestic.com 


Starhotels Anderson 

Hotel 

Piazza Luigi di Savoia, 20 

20124 Milan 

T +39 026690141 

F +39 026690331 

www.starhotels.com 



Starhotels E.C.H.O 

Viale Andrea Doria, 4 

20124 Milan 

T +39 0267891 

F +39 0266713369 


Metro M2 Caiazzo 

Starhotels Ritz 

Via Spallanzani, 40 

20129 Milan 

T +39 0220551 

F +39 0229518679 


Metro M1 Lima 

Starhotels Rosa Grand 

Piazza Fontana, 3 

20122 Milan 

T +39 0288311 

F +39 028057964 


Metro M1 Duomo 

Sunflower 

Piazzale Lugano, 10 

20158 Milan 

T +39 0239314071 

F +39 0239320377 

www.hotelsunflower.it 

Tram 91 P.le Lugano 

The Hub Hotel 

Via Privata Polonia, 10 

20157 Milan 

T +39 0278627000 

F +39 0278627070 

www.thehubhotel.com 

Tram 560 Stephenson - Polonia 

The Westin Palace 

Piazza della Repubblica, 20 

20124 Milan 

T +39 0263361 

F +39 02654485 

www.westinpalacemilan.com 

Metro M3 Repubblica 

UNA Hotel Century 

Via Fabio Filzi, 25/B 

20124 Milan 

T +39 02675041 

F +39 0266980602 

www.unahotels.it 


UNA Hotel Cusani 

Via Cusani, 13 

20121 Milan 

T +39 0285601 

F +39 028693601 


Metro M1 Cairoli 

UNA Hotel 

Mediterraneo 

Via L. Muratori, 14 

20135 Milan 

T +39 02550071 

F +39 02550072217 


Metro M3 Porta Romana 

UNA Hotel 

Scandinavia 

Via G.B. Fauché, 15 

20154 Milan 

T +39 02336391 

F +39 0233104510 



UNA Hotel Tocq 

Via A. De Tocqueville, 7/D 

20154 Milan 

T +39 0262071 

F +39 026570780 



Uptown Palace 

Via Santa Sofia, 10 

20122 Milan 

T +39 02305131 

F +39 0230513333 

www.uptownpalace.com 

Metro M3 Crocetta

Friday, 15 March - EAU Programme 


09.00 - 16.15 International Conference on Prostate Cancer Prevention 2013 with 

Consensus Conference on Chemoprevention of Prostate Cancer 

Amber Hall 7-8 - Level S2 

09.00 - 10.30 Session 1: Scientific considerations in prostate cancer prevention 

Chair: P. Brown, Houston (US) 

09.00 - 09.15 Biology and natural history of prostate cancer - Overview 

L. Holmberg, Uppsala (SE) 

09.15 - 10.30 Risk prediction: Biomarkers 

09.15 - 09.30 Serum Kallikrein markers 

H.G. Lilja, New York (US) 

09.30 - 09.45 Urinary PCA3 

H. Rittenhouse, Los Osos (US) 

09.45 - 10.00 TMPRSS2-ERG 

S. Perner, Bonn (DE) 

10.00 - 10.15 Non-PCA3 urinary biomarkers 

J.A. Schalken, Nijmegen (NL) 

10.15 - 10.30 GWAS 

R.A. Eeles, London (GB) 

10.30 - 10.45 Break 

10.45 - 11.15 Session 2: Early detection 

Chair: A. Stenzl, Tübingen (DE) 

10.45 - 11.00 Screening - Current status (ERSPC) 

F.H. Schröder, Rotterdam (NL) 

11.00 - 11.15 Screening - Current status (PLCO) 

G. Andriole, St. Louis (US) 

11.15 - 12.15 Session 3: Prognosis and management of low grade disease 

Chair: C. Parker, London (GB) 

11.15 - 11.30 Cell cycle progression markers 

J. Cuzick, London (GB) 

11.30 - 11.45 Distinguishing aggressive from indolent prostate cancer 

Z. Culig, Innsbruck (AT) 

11.45 - 12.00 Management of Gleason 6 (PIVOT) 

T.J. Wilt, Minneapolis (US) 


53 

Friday

Friday 

12.00 - 12.15 Management of Gleason 6 

B. Tombal, Brussels (BE) 

12.15 - 13.15 Session 4: Review of chemoprevention trials 


Chair: L. Minasian, Bethesda (US) 

12.15 - 12.45 Outlook for 5a reductase inhibitors 

Finasteride/Dutasteride 

12.15 - 12.30 Review of data and European perspective 

M. Marberger, Vienna (AT) 

12.30 - 12.45 Review of data and North American perspective 

O.W. Brawley, Atlanta (US) 

12.45 - 13.00 Vitamin E and Selenium - SELECT trial 

L. Ford, Bethesda (US) 

13.00 - 13.15 Other chemoprevention trials 

H. Parnes, Bethesda (US) 

13.15 - 14.15 Lunch and poster viewing / meet the faculty 

14.15 - 15.45 Session 5: Prostate cancer: Chemoprevention - Novel agents 

Chair: F. Meyskens, Irvine (US) 

14.15 - 14.30 Bisphosphonates 

G. Rennert, Haifa (IL) 

14.30 - 14.45 Polyamines and DFMO 

F. Meyskens, Irvine (US) 

14.45 - 15.00 Lycopene 

D. Illic, Melbourne (AU) 

15.00 - 15.15 Aspirin, NSAIDs and COX2 

P. Rothwell, Oxford (GB) 

15.15 - 15.30 Antioxidants and nutrition (EPIC) 

T. Key, Oxford (GB) 

15.30 - 15.45 Lifestyle and dietary factors 

A. Wolk, Stockholm (SE)

15.45 - 16.15 Session 6: Panel discussion: Current policy for prostate cancer screening and chemoprevention 

Chair: O.W. Brawley, Atlanta (US) 

P. Brown, Houston (US) 

G. Gordon, Abbott Park, IL (US) 

F.C. Hamdy, Oxford (GB) 

F. Meyskens, Irvine (US) 

L. Minasian, Bethesda (US) 

C. Parker, London (GB) 

H. Parnes, Bethesda (US) 



R. Smith, Atlanta (US) 

B.J. Schmitz-Dräger, Fürth (DE) 

A. Stenzl, Tübingen (DE) 


The conference has been awarded 9 credit points for continuing medical education by ACOE (Accreditation 

Council of Oncology in Europe) and has been granted European endorsement by the UEMS (European Union 

of Medical Specialists) clearing house system, the EACCME and awarded 9 European Continuing Medical 

Education Credits (ECMEC). An accreditation of the UEMS (EACCME) is also recognised by the AMA (American 

Medical Association) and the PRA (Physicians Recognition Award) in the US as well as by the respective 

accreditation boards in China and Japan. 

Co-sponsored by ISCaP, EAU, National Cancer Institute (USA), Cancer Research UK, Prostate Cancer UK, AICR 


55 

Friday

Friday 



Urology beyond Europe 

10.30 - 13.00 Joint Session of the European Association of Urology (EAU) and the 

Chinese Urological Association (CUA) 

Brown Hall 1-2 - Level S2 

Chairs: C.R. Chapple, Sheffield (GB) 

L-P. Xie, Hangzhou (CN) 

10.30 - 11.20 Session 1: Endoscopic management of complex renal calculi 

10.30 - 10.45 PCNL combined RIRS for complex renal calculi 

G-H. Zeng, Guangzhou (CN) 

10.45 - 11.00 Retrograde flexible ureteroscopy for complex renal calculus: Current concepts and future directions 

O. Traxer, Paris (FR) 

11.00 - 11.20 Discussion 

11.20 - 12.10 Session 2: Reconstructive urology 

11.20 - 11.35 One stage oral mucosal graft urethroplasty for treatment of male anterior urethral strictures: A ten-year 

study from a single centre 

Y.L. Sa, Shanghai (CN) 

11.35 - 11.50 Substitution urethroplasty: Current concepts and future directions - A review of the conclusions of the 

International Consultation of Urethral Stricture Disease 

C.R. Chapple, Sheffield (GB) 


12.10 - 13.00 Session 3: Recent developments relating to surgery for benign prostatic hyperplasia 

12.10 - 12.25 Transurethral vapour enucleation and resection of the prostate with a plasma button electrode: A new 

technique 

L-P. Xie, Hangzhou (CN) 

12.25 - 12.40 Laser prostatectomy: Has this come of age? 

O. Reich, Munich (DE) 

12.40 - 13.00 Discussion




Korean Urological Association (KUA) 

Brown Hall 3 - Level S2 

Chairs: D. Jacqmin, Strasbourg (FR) 

G.T. Sung, Busan (KR) 

10.30 - 10.35 Introduction 

S.W. Han, Seoul (KR) 


10.35 - 11.25 Session 1: Small renal masses 

Moderators: J. Cheon, Seoul (KR) 


10.35 - 10.55 Surgery or surveillance 

D.D. Kwon, Gwangju (KR) 

10.55 - 11.15 Percutaneous ablative therapy 

A. Gangi, Strasbourg (FR) 

11.15 - 11.25 Clinical cases 

11.25 - 12.05 Session 2: LUTS 

Case presenter: S.I. Seo, Seoul (KR) 

Panel: B.H. Chung, Seoul (KR) 

A. Gangi, Strasbourg (FR) 

D.D. Kwon, Gwangju (KR) 

Moderators: M.K. Chung, Yangsan (KR) 

J.M.O. N’Dow, Aberdeen (GB) 

11.25 - 11.45 Medical management of LUTS 


11.45 - 12.05 Surgical management of LUTS 

D.K. Kim, Daejeon (KR) 

12.05 - 12.55 Session 3: Hormone refractory prostate cancer 

Moderators: J. Bellmunt, Barcelona (ES) 

G.T. Sung, Busan (KR) 

12.05 - 12.25 What is the evidence? 

S.J. Hong, Seoul (KR) 

12.25 - 12.45 What is the best sequence? 



57 

Friday

Friday 

12.45 - 12.55 Clinical cases 


Case presenter: D-H. Seong, Incheon (KR) 

Panel: S.J. Hong, Seoul (KR) 

C. Kim, Seoul (KR) 


12.55 - 13.00 Closing remarks 

S.W. Han, Seoul (KR) 

D. Jacqmin, Strasbourg (FR)




Urological Society of India (USI) 


Chairs: R. Meyyappan, Chennai (IN) 



R. Meyyappan, Chennai (IN) 


10.35 - 10.55 Turning the page - Past, present and future of urological journals in Europe and India 

Moderators: R. Meyyappan, Chennai (IN) 


10.35 - 10.45 IJU perspective 

N. Kekre, Vellore Tamilnadu (IN) 

10.45 - 10.55 European Urology Today perspective 

M. Wirth, Dresden (DE) 

10.55 - 11.25 Renal disease management 

Moderators: T. Esen, Istanbul (TR) 


10.55 - 11.10 European perspectives: Management of the small renal mass 

A. Volpe, Novara (IT) 

11.10 - 11.25 Indian perspective: Minimally invasive management of renal calculus disease in anomalous kidneys and in 

patients with musculo-skeletal deformities 

A. Srivastava, Lucknow (IN) 

11.25 - 12.05 Young Urologists Challenge 

Panel: M.R. Desai, Naidad (IN) 


N. Kekre, Vellore Tamilnadu (IN) 


11.25 - 11.35 High grade non-muscle invasive bladder cancer - role of second TURBT 

F. Sridhar, Ludhiana (IN) 

11.35 - 11.45 MRI guided focal cryo therapy: Salvage after failed radiotherapy 

J.P.M. Sedelaar, Nijmegen (NL) 

11.45 - 11.55 Emphysematous pyelonephritis 

P. Hariharan, Puducherry (IN) 

11.55 - 12.05 Is there a place for bladder screening? 



59 

Friday

Friday 

12.05 - 12.30 Words of Wisdom lecture 1: Percutaneous renal stone management - Evolution and current status, 

challenges, future prospects? 

M.R. Desai, Naidad (IN) 

12.30 - 12.55 Words of Wisdom lecture 2: PSA based prostate cancer screening - Current status, challenges, future 

prospects? 


12.55 - 13.00 Conclusion 







Iranian Urological Association (IUA) 

Red Hall 1 - Level N1 

Chairs: W. Artibani, Verona (IT) 

S.J. Hosseini, Tehran (IR) 


W. Artibani, Verona (IT) 


10.35 - 11.10 Prostate cancer 

Moderators: W. Artibani, Verona (IT) 


10.35 - 10.50 How to manage high risk prostate cancer 

A. Briganti, Milan (IT) 

10.50 - 11.10 Interactive case discussion 

S. Shakeri, Shiraz (IR) 

M. Ayati, Tehran (IR) 

11.10 - 11.45 Muscle-invasive bladder cancer 



11.10 - 11.25 Contemporary management of muscle-invasive bladder cancer 

B. Djavan, Vienna (AT) 


A. Basiri, Tehran (IR) 

S.M. Sanadizadeh, Tehran (IR) 

11.45 - 12.20 Female urology 



11.45 - 12.00 Female stress urinary incontinence surgery in 2013 



M. Emami, Tehran (IR) 

S. Shakeri, Shiraz (IR) 

12.20 - 12.55 Reconstructive urology 




61 

Friday

Friday 

12.20 - 12.35 Posterior urethral strictures management 



E. Palminteri, Arezzo (IT) 








Arab Association of Urology (AAU) 

Yellow Hall 1-2-3 - Level N1 

Chairs: H. Abol-Enein, Mansoura (EG) 

R.B. Khauli, Beirut (LB) 


10.30 - 10.35 Welcome 



10.35 - 11.05 Prostate sparing cystectomy 

Pro 

G. Vallancien, Paris (FR) 

Con 


11.05 - 11.35 PT1 G3 bladder cancer 

Early cystectomy 

M. Bulbul, Beirut (LB) 

Conservative treatment 


11.35 - 12.05 Positive margin after radical prostatectomy 

Adjuvant radiotherapy 

P. Dirix, Leuven (BE) 


D. Rabah, Riyadh (SA) 

12.05 - 12.55 Case presentations 

Moderators: A. Morsy, Cairo (EG) 

N. Msessa, Tripoli (LY) 

12.05 - 12.30 Renal cysts - How to treat? 

Y. Nouira, Ariana (TN) 

Panel: I.H. Al Nono, Sana’a (YE) 

S.M. Moudouni, Marrakech (MA) 

12.30 - 12.55 Renal tumors, radical or partial nephrectomy 

A. Al Naimi, Doha (QA) 

Panel: M.R. El Halaby, Cairo (EG) 

R.B. Khauli, Beirut (LB) 


63 

Friday

Friday 







Japanese Urological Association (JUA) 


Chairs: H. Kakizaki, Asahikawa (JP) 

H. Van Poppel, Leuven (BE) 

13.15 - 13.20 Opening 

Y. Homma, Tokyo (JP) 


13.20 - 13.50 Session 1: High risk prostate cancer 

Moderators: N.W. Clarke, Manchester (GB) 

Y. Tomita, Yamagata (JP) 

13.20 - 13.35 Incidence, definition and diagnosis of high risk prostate cancer 

K. Ito, Gunma (JP) 

13.35 - 13.50 The place of surgery in the management of high risk prostate cancer 


13.50 - 14.20 Session 2: Robot-assisted surgery 

Moderators: K. Tanabe, Tokyo (JP) 


13.50 - 14.05 Robot assisted radical prostatectomy 

R. Shiroki , Aichi (JP) 

14.05 - 14.20 Robot assisted nephron sparing surgery 


14.20 - 14.50 Session 3: Metastatic prostate cancer 

Moderators: A. Mottrie, Aalst (BE) 

M. Oya, Tokyo (JP) 

14.20 - 14.35 Hormonal micro-environment of prostate cancer 

M. Oya, Tokyo (JP) 

14.35 - 14.50 Prediction, prevention and intervention in metastatic prostate cancer 

N.W. Clarke, Manchester (GB) 

14.50 - 15.20 Session 4: Voiding dysfunction 

Moderators: D.J.M.K. De Ridder, Leuven (BE) 

H. Kakizaki, Asahikawa (JP) 

14.50 - 15.05 Regenerative treatment of stress urinary incontinence using autologous adipose-derived stem cells 

M. Gotoh, Nagoya (JP) 


65 

Friday

Friday 

15.05 - 15.20 Molecular mechanisms of OAB 

D.J.M.K. De Ridder, Leuven (BE) 

15.20 - 15.40 Session 5: Cases on RCC 


Moderator: Y. Tomita, Yamagata (JP) 

Panel: N.W. Clarke, Manchester (GB) 

M. Eto, Kumamoto (JP) 

G. Kimura, Tokyo (JP) 



Y. Homma, Tokyo (JP) 

H. Van Poppel, Leuven (BE)




Confederación Americana de Urología (CAU) 


Chairs: F.R. Cruz, Porto (PT) 

H. Villavicencio Mavrich, Barcelona (ES) 

13.15 - 13.20 Welcome address 

F.R. Cruz, Porto (PT) 


13.20 - 13.40 Surgery of prostate cancer in stage 3: Better than radiotherapy? 

U.E. Studer, Berne (CH) 

13.40 - 14.00 Bladder cancer: From the lab to the patient. Where are we? 

J. Palou, Barcelona (ES) 

14.00 - 14.20 OAB: Antimuscarinics, Beta 3-agonists or Botulinum toxin: Which should be first? 

J.P.F.A. Heesakkers, Nijmegen (NL) 

14.20 - 14.40 Stress incontinence: From Burch to mini sling 


14.40 - 15.00 Endourology 2013: How are we progressing? 

J. Gutierrez, Guadelajara (MX) 

15.00 - 15.20 New technologies in urology 


15.20 - 15.40 Urethroplasty update 






67 

Friday

Friday 




13.15 - 15.45 EAU - International: Caucasus and Central Asia Session 


Chairs: M.K. Alchinbayev, Almaty (KZ) 


I. Nusratulloev Sr., Dushanbe (TJ) 

Coordinator: N. Turmanidze, Tbilisi (GE) 

13.15 - 14.15 Hot issues in uro-gynaecology 


Z. Tchanturaia, Tbilisi (GE) 

13.15 - 13.30 Update on mesh and mesh use 


13.30 - 13.45 Management of uro-gynaecological fistula today 

B.U. Shalekenov, Almaty (KZ) 

13.45 - 14.15 Case discussion: Uro-gynaecological fistula 

Moderator: C.R. Chapple, Sheffield (GB) 

Panel: W. Artibani, Verona (IT) 

F. Akilov, Tashkent (UZ) 

R. Hovhannisyan, Yerevan (AM) 

Z. Khakimkhodzhaev, Bishkek (KG) 

14.15 - 15.45 The treatment of renal cell cancer is changing 

Moderator: G. Janetschek, Salzburg (AT) 

S. Javad-Zada, Baku (AZ) 

14.15 - 14.35 The management of small renal masses 

H-C. Klingler, Vienna (AT) 

14.35 - 14.55 Management of T1B (partical nephrectomy or nephrectomy?) 

A.R. Pertia, Tbilisi (GE) 

14.55 - 15.15 The limits of laparoscopic management renal masses 

G. Janetschek, Salzburg (AT) 

15.15 - 15.45 Case discussion: Management of localised renal tumours today 

Moderator: M. Marberger, Vienna (AT) 

Panel: G. Janetschek, Salzburg (AT) 

S. Javad-Zada, Baku (AZ) 

H-C. Klingler, Vienna (AT) 

D. Salikov, Dushanbe (TJ)




Pan-African Urological Surgeons’ Association (PAUSA) 


Chairs: M. Eissa, Cairo (EG) 


13.15 - 13.20 Welcome and introduction 

M. Eissa, Cairo (EG) 


13.20 - 13.35 Guest lecture: Urology in ancient Egypt 

M.S Elrefaie, Alexandria (EG) 

13.35 - 14.15 Round table 1: Renal trauma 

Moderators: S.D. Mante, Accra (GH) 

K. Nyarko, () 

13.35 - 13.55 Diagnosis and staging 

M.Y. Elgammal, Cairo (EG) 

13.55 - 14.15 Treatment 


14.15 - 14.55 Round table 2: Avoiding complications of radical surgery 

Moderator: S.M. Gueye, Dakar (SN) 

14.15 - 14.35 Medical complications 

G.N. Thalmann, Berne (CH) 

14.35 - 14.55 Surgical complications 

E. Oluwabunmi Olapade-Olaopa, Ibadan (NG) 

14.55 - 15.45 Round table 3: Paediatric urology 

Moderators: M. Eissa, Cairo (EG) 

I. Vaz, Maputo (MZ) 

14.55 - 15.05 Congenital anomalies in adults 

I. Vaz, Maputo (MZ) 

15.05 - 15.20 Antibiotic prophylaxis 

M. Grabe, Malmö (SE) 

15.20 - 15.30 Pyeloplasty, open versus lap 

M. Eissa, Cairo (EG) 

15.30 - 15.45 Curved penis 

I.A.E. Mokhless, Alexandria (EG) 


69 

Friday

Friday 





Maghreb Union Countries 

Blue Hall 1-2 - Level N1 

Chairs: A. Joual, Casablanca (MA) 

J.W. Thüroff, Mainz (DE) 



13.20 - 14.45 Session 1: Bladder cancer 

Moderators: C-C. Abbou, Creteil (FR) 

A. Joual, Casablanca (MA) 

13.20 - 13.40 Bladder tumours in the Maghreb 

Y. Ahallal, Meknes (MA) 

13.40 - 14.00 Management of non invasive bladder tumours 

S.F. Shariat, New York (US) 

14.00 - 14.20 Radical cystectomy and bladder replacement 

W. Hassen, Al Ain (AE) 

14.20 - 14.40 Adjuvant and neoadjuvant chemotherapy 

Y. Loriot, Villejeuf (FR) 


14.45 - 15.40 Session 2: Panel case discussion 

Panel: K. Atallah, Tunis (TN) 

K. Hachi, Alger (DZ) 

A. Joual, Casablanca (MA) 

T. Lebret, Suresnes (FR) 

S.M. Moudouni, Marrakech (MA) 




J.W. Thüroff, Mainz (DE)




Indonesian Urological Association (IUAI) 


Chairs: V. Mirone, Naples (IT) 

S. Sugandi, Bandung (ID) 


V. Mirone, Naples (IT) 


13.20 - 13.40 Sperm retrieval vs obstruction release in obstructive Azoospermia 

D.M. Soebadi, Surabaya (ID) 

13.40 - 14.00 Varicocele repair and male infertility: Indications and new evidences 

N. Sofikitis, Ioannina (GR) 

14.00 - 14.20 The impact of medical management of BPH on erectile dysfunction 

P. Birowo, Jakarta (ID) 

14.20 - 14.40 New acquisitions concerning the physio-pathological correlation between LUTS and erectile dysfunction 

F. Giuliano, Garches (FR) 

14.40 - 15.00 The influence of hormonal changes on bladder function 

T. Romdam, Bandung (ID) 

15.00 - 15.20 The role of testosterone replacement therapy in the ageing male 

C.C. Schulman, Brussels (BE) 

15.20 - 15.45 Panel discussion and clinical case presentation 

Moderators: V. Mirone, Naples (IT) 


Panel: P. Birowo, Jakarta (ID) 


T. Romdam, Bandung (ID) 

C.C. Schulman, Brussels (BE) 

D.M. Soebadi, Surabaya (ID) 



71 

Friday

Friday 


18.00 - 19.30 EAU Opening Ceremony 


eURO Auditorium - Level S2 

Performance by the Cameristi del Teatro alla Scala - Part 1 

Gioachino Rossini 

Il barbiere di Siviglia 

Una voce poco fa 

Gaetano Donizetti 

Don Pasquale 

Tornami a dir che m’ami 

Opening addresses 

F. Montorsi, Milan (IT), EAU Congress President 

P-A. Abrahamsson, Malmö (SE), EAU Secretary General 

Announcement of the new EAU Honorary Members 

Citation by P-A. Abrahamsson, Malmö (SE) 

New Honorary Members: P. Rigatti, Milan (IT) 

I. Sinescu, Bucharest (RO) 

R. Umbas, Jakarta (ID) 

Presentation of the EAU Willy Gregoir Medal 2013 


Presented to: C-C. Abbou, Creteil (FR) 

The EAU is proud to present the Willy Gregoir Medal to an important senior urologist who contributed in an 

extraordinary way to the development of urology in Europe 

Presentation of the EAU Frans Debruyne Life Time Achievement Award 2013 


Presented to: J. Breza Sr., Bratislava (SK) 

The EAU wishes both to honour and acknowledge the important and longstanding contribution by a 

distinguished colleague to the activities and development of the EAU 

Presentation of the EAU Crystal Matula Award 2013 


Presented to: P.J. Boström, Turku (FI) 

This prestigious prize is granted to a promising younger urological academician 

Supported by an unrestricted educational grant from LABORIE 

Presentation of the EAU Hans Marberger Award 2013 


Presented to: J. Rassweiler, Heilbronn (DE) 

The Hans Marberger Award is awarded for the best European paper published in 2012 on minimally 

invasive surgery in urology 

Supported by an unrestricted educational grant from KARL STORZ GMBH & CO.KG

Presentation of the EAU Innovators in Urology Award 2013 


Presented to: U.E. Studer, Berne (CH) 

The Innovators in Urology Award is to acknowledge and highlight inventions and clinical contributions 

which have had a major impact on influencing the treatment and/or diagnosis of a urological disease 

Presentation of the EAU Prostate Cancer Research Award 2013 


Presented to: I. Ahmad, Glasgow (GB) 

The EAU Prostate Cancer Research Award is awarded for the best paper published on clinical or 

experimental studies in prostate cancer 

Supported by an unrestricted educational grant from the FRITZ H. SCHRÖDER FOUNDATION 

Performance by the Cameristi del Teatro alla Scala – Part II 

Giuseppe Verdi 

Rigoletto 

Caro nome 

La donna è mobile 

Giacomo Puccini 

Gianni Schicchi 

O mio babbino caro 

Giuseppe Verdi 

La Traviata 

Libiam ai lieti calici 

19.30 - 21.00 Get-together to renew ties with colleagues from all over the world 

Foyer eURO Auditorium – Level S2 


73 

Friday

Friday 

Friday, 15 March - Sponsored Sessions 


Symposia Overview 

16.15 - 17.45 Extending survival outcomes in RCC and CRPC: Current evidence and future horizons page 397 

Red Hall 2 - Level N1 Sponsored by BAYER HEALTHCARE 

16.15 - 17.45 New data in metastatic RCC: Applying the evidence to clinical practice page 398 

Yellow Hall 1-2-3 - Level N1 Sponsored by GLAXOSMITHKLINE ONCOLOGY 

16.15 - 17.45 Urological challenges in managing patients with angiomyolipoma (AML) page 399 

Amber Hall 1-2 - Level S2 Sponsored by NOVARTIS ONCOLOGY 

16.15 - 17.45 Innovations in clinical urology page 400 

Blue Hall 1-2 - Level N1 Sponsored by OLYMPUS 

16.15 - 17.45 Metastatic castration-resistant prostate cancer: Integrating new learnings to optimise 

treatment outcomes page 401 

Brown Hall 3 - Level S2 Sponsored by SANOFI

Saturday, 16 March - EAU Programme 


07.30 - 08.30 EAU General Assembly 

Platinum Hall - Level S3 

Welcome by the EAU Secretary General 

Approval minutes General Assembly of 25 February 2012, Paris, France 

General report by the EAU Secretary General 

P-A. Abrahamsson, Malmö (SE) 

Report by the EAU Treasurer 


Specific reports on the EAU Offices by the EAU Executive 

Report by the Secretary General on the EAU Membership Office 

• Approval new EAU members 

• Approval new Honorary members 

Other business 

Future Congresses 

Presentation of the 29th Annual EAU Congress in Stockholm, 11-15 April 2014 


75 

Saturday

Saturday 




08.30 - 10.15 Urology: From young to old 


Chairs: W. Artibani, Verona (IT) 


08.30 - 08.35 Introduction to the plenary session 


08.35 - 08.50 Update The management and long-term outcomes of vesicoureteral reflux 

G. Lackgren, Uppsala (SE) 

Aims and objectives 

The introduction of endoscopic treatment with bulking agents and particularly the introduction of Deflux (a 

non-animal stabilised hyaluronic acid/dextranomer gel) has changed the treatment strategy of vesicoureteral 

reflux (VUR) in children. This treatment offers the chance of curing children with even high grade reflux 

(IV-V), and eliminating the need for long-term medication or repeat VCUGs. More importantly it reduces 

the number of children requiring open surgery. In our long-term follow-up (mean 16 years) study we have 

found that only 25% of the children with primary grade IV-V reflux have been submitted to open surgery 

(reimplantation) and that there are few adverse events in the long term after treatment. Results from the 

ongoing clinical study will be presented. 

08.50 - 09.05 Update The long-term outcomes of genital surgery in boys 

A.R. Mundy, London (GB) 


Other than circumcision and orchidopexy the commonest genital surgery in boys is hypospadias. This 

presentation will concentrate on hypospadias with some mention of extrophy/epispadias and circumcision. 

The long term outcome of hypospadias surgery in boys is not as good as is presented in the literature. 

I shall propose for discussion that excepting serious deformities genital surgery should be postponed until 

the boy himself can take part in his counselling process. 

09.05 - 09.40 Debate Pelvic floor implants: Artificial mesh or autologous fascia? 

Moderator: F.R. Cruz, Porto (PT) 

Panel: Gynaecologist U. Peschers, Munich (DE) 

Urologist F. Haab, Paris (FR) 


This session will discuss the long term data of artificial mesh implantation for correction of SUI of pelvic 

organ prolapse. Many patients are now expected to carry artificial meshes for several decades. The long-term 

results of SUI of pelvic organ prolapse with artificial mesh will be discussed. The potential consequences of 

a long-term exposure to foreign material during ageing will also be addressed. 

09.40 - 09.55 State-of-the-art lecture Incontinence and age 



Following this presentation the attendee will be able to demonstrate:

- an understanding of the impact of comorbid conditions on continence in older people 

- an awareness of the impact of polypharmacy on continence status is older people 

- the impact of anticholinergic medications for bladder dysfunction on cognitive status in older people 

09.55 - 10.15 State-of-the-art lecture Is ageing a disease? 

M. Kirby, London (GB) 


77 

Saturday

Saturday 



Abstract Session 

08.30 - 10.00 Prostate cancer screening 



Chairs: J.E. Hugosson, Gothenburg (SE) 

M.J. Roobol, Rotterdam (NL) 

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes 

in length, followed by 2 minutes for discussion. 

1 Screening for prostate cancer: Results of the Rotterdam section of the European Randomized study of 

Screening for Prostate Cancer (ERSPC) 

M.J. Roobol, C.H. Bangma, F.H. Schröder (Rotterdam, The Netherlands) 

2 Incidence and mortality of prostate cancer after termination of PSA based screening 

A.L.A. Grenabo, E. Holmberg, S. Moss, J. Hugosson (Gothenburg, Sweden; London, United Kingdom) 

3 Repeat transrectal prostate biopsies incorporating targeted anterior zone sampling – is template biopsy 

really necessary? 

A. Pandit, H. Thomas, C. O’Brien, J. Featherstone, N. Fenn, P. Bose (Swansea, United Kingdom) 

4 Men with total PSA levels between 1-2.99 ng/mL at initial screening have an elevated risk of future 

prostate cancer diagnosis: Results from the Gothenburg randomized screening trial 

M. Frånlund, S. Carlsson, H. Lilja, J. Hugosson (Gothenburg, Sweden; New York, United States of America) 

5 Disease-specific survival of men with screen-detected prostate cancer: Comparison of first round vs 

second round cancers in an European randomized screening trial 

X. Zhu, M. Bul, L.P. Bokhorst, C.H. Bangma, F.H. Schröder, M.J. Roobol (Rotterdam, The Netherlands) 

6 Serum cholesterol mediates in the mechanism of statins to prevent prostate cancer 

C. Konstantinidis Garay, I. Iztueta, F. Agreda, A. Celma, J.M. Bastarós, J. Placer, J. Planas, J. Morote 

(Barcelona, Spain) 

7 PSA-Isoforms-Velocity. Evaluation of a novel approach in the early diagnosis of prostate cancer. Results 

from the Tyrol PSA screening project 

I. Heidegger, H. Klocker, V. Skradski, M. Ladurner, E. Steiner, G. Schaefer, W. Horninger, J. Bektic (Innsbruck, 

Austria) 

8 Cost-benefit analysis in Japanese PSA screening in 5-years aged ranking 

K. Okihara, K. Ito, T. Miki, S. Kazuhiro, T. Iinuma (Kyoto, Maebashi, Tokyo, Japan) 

9 Performance of inherited genetic markers to predict prostate biopsy outcomes in Chinese men 

H.W. Jiang, F. Liu, L. Zhang, H. Zhang, R. Na, X. Lin, Q. Ding, J. Xu (Shanghai, China) 

10 Prospective randomized controlled trial of the role of PSA and PCA3 testing in a sequential manner in an 

opportunistic screening programme for prostate cancer 

J. Rubio Briones, J. Casanova, R. Dumont, A. Fernández-Serra, I. Casanova-Salas, J. Domínguez-Escrig, 

M. Ramírez-Backhaus, A. Collado, A. Gómez-Ferrer, I. Iborra, J.V. Ricós, J.L. Monrós, E. Solsona, J.A. López- 

Guerrero (Valencia, Spain) 

11 One-year results of a multidisciplinary prostate cancer unit: Management changes in comparison with a 

monodisciplinary unit 

A. Sciarra, V. Gentile, S. Salciccia, A. Gentilucci, S. Cattarino, V. Gentile, V. Panebianco (Rome, Italy)

12 Discrepancies between guidelines and clinical practice regarding prostate-specific antigen (PSA) testing 

E.H.J. Hamoen, D.F.M. Reukers, J.O. Barentsz, M.M. Rovers, J.A. Witjes (Nijmegen, The Netherlands) 

Summary 

J.E. Hugosson, Gothenburg (SE) 


79 

Saturday

Saturday 




08.30 - 10.00 Laparoscopy: Training, new technologies and techniques 



Chairs: C-C. Abbou, Creteil (FR) 

H.G. Van Der Poel, Amsterdam (NL) 



13 The laparoscopic training of the European urology residents – results of a pan-European survey 

F. Furriel, M.P. Laguna, A.J.C. Figueiredo, P.T.C. Nunes, L.S.O. Marconi, J. Rassweiler (Coimbra, Portugal; 

Amsterdam, The Netherlands; Heilbronn, Germany) 

14 Learning curves for urological procedures - a systematic review 

H. Abboudi, M. Khan, K. Guru, S. Froghi, G. De Win, H. Van Poppel, P. Dasgupta, K. Ahmed (Brighton, 

London, United Kingdom; Buffalo, United States of America; Antwerp, Leuven, Belgium) 

15 Avoidable iatrogenic complications of urethral catheterisation and inadequate intern training: A 4-year 

follow up post implementation of an intern training programme 

J.F. Sullivan, J.C. Forde, A.Z. Thomas, T.C. Creagh (Dublin, Ireland) 

16 Mental training or virtual reality simulation as enhancing methods to laparoscopic box training: A 

randomized controlled trial on novices 

P. Grange, D. Eldred-Evans, A. Chang, J. Makanjuola, M. Mulla, P. Rouse, D.M Sharma, M. Arya, S. Ayis, 

M. Immenroth (London, United Kingdom; Hamburg, Germany) 

17 The importance of training in laparoscopic nephrectomy for residents before participating at the open 

procedure 

D.M. Dumitrache, C.S. Gutue, I.D. Chira, J. Aurelian, V. Jinga (Bucharest, Romania) 

18 Achieving proficiency in robotically assisted minimally invasive surgery: The contribution of laparoscopic 

surgical experience in developing robotic proficiency 

H. Abdul-Muhsin, R. Smith, V. Patel (Celebration, United States of America) 

19 Educational impact of robot assisted surgical training program 

S.A.A. Khan, S.J.R. Raza, K. Ahmed, R. Din, A. Stegemann, M. Bienko, A. Chowriappa, T. Kesavadas, 

M. Bhandari, K.A. Guru (London, United Kingdom; Buffalo, United States of America) 

20 Fundamental Skills of Robotic Surgery (FSRS): A multi-institutional randomized controlled trial for 

validation of a simulation-based curriculum 

K. Ahmed, A. Stegemann, J. Syed, S. Rehman, K. Ghani, R. Autorino, M. Sharif, A. Rao, Y. Shi, G. Wilding, 

J. Hassett, A. Chowriappa, T. Kesavadas, J. Peabody, M. Menon, J. Kaouk, K. Guru (London, United Kingdom; 

Buffalo, Detroit, Cleveland, United States of America) 

21 Effectiveness of 3D-imaging system on simple and suturing tasks for laparoscopic training 

M. Iwamura, A. Ito, A. Hoshi, A. Miyajima, K. Nakagawa, H. Kinoshita, Y. Arai, T. Terachi, S. Baba, 

T. Matsuda (Sagamihara, Sendai, Isehara, Tokyo, Hirakata, Japan) 

22 A prospective randomized study of a new articulating laparoscopy device (Kymerax-Terumo) in the dry lab 

- part 1: Learning curve and objective skills assessment 

S. Hruby, R. Pann, R. Bernecker, Y. Landkammer, T. Schätz, L. Lusuardi, S. Jeschke, A. Wicker, G. Janetschek 

(Salzburg, Austria)

23 Evaluation of a new operating platform (ETHOS) for laparoscopic surgery in a training room setting 

A.S. Gözen, O. Plekhanova, A. Jalal, T. Tokas, J. Klein, J. Rassweiler (Heilbronn, Germany; Moscow, Russia) 

24 Robotic-assisted laparoscopic suturing of an U-shaped ileum-neobladder with ENDOSEW® - report of an 

experimental setting 

A. Martinschek, M. Ritter, E. Heinrich, L. Trojan (Ulm, Mannheim, Göttingen, Germany) 

25 Magnetic tracking technology used to compare ergonomics of single site and conventional laparoscopic 

surgery: Preliminary results 

I. Georgiopoulos, L. Rentzos, I. Kyriazis, P. Kallidonis, G. Chryssolouris, E. Liatsikos (Patras, Greece) 

26 Laparoendoscopic single-site versus conventional laparoscopic total extraperitoneal hernia repair - a 

prospective randomized clinical trial 

Y.C. Tsai (New Taipei City, Taiwan) 


81 

Saturday

Saturday 




08.30 - 10.00 Male infertility: Basic science 



Chairs: Z. Kopa, Budapest (HU) 

W.H.G. Weidner, Giessen (DE) 


in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed 

by 2 minutes for discussion. 

* 27 The sperm protamine mRNA ratio as a clinical parameter to estimate the fertilizing potential of men taking 

part in an ART program 

N. Rogenhofer, T. Dansranjavin, M. Schorsch, A. Spiess, H. Wang, V. Von Schönfeldt, H. Cappallo-Obermann, 

V. Baukloh, H. Yang, A. Paradowska, B. Chen, C. Thaler, W. Weidner, H-C. Schuppe, K.S. Steger (Munich, 

Giessen, Wiesbaden, Hamburg, Germany; Shanghai, China) 

28 Withdrawn 

29 Testicular morphology and spermatozoids in hypertensive rats treated or not with enalapril 

G.R. Bechara, M. Simões, B. Felix-Patrício, J.L. Medeiros Jr, B.M. Gregório, D.B. De Souza, W.S. Costa, 

F.J. Sampaio (Rio de Janeiro, Brazil) 

30 Diet rich in polyunsaturated fatty acid induces overweight but improves the testicular morphology in adult 

rats 

P.C. Silva, A. Furriel, N.C. Machado, E.F. Alves, D.B. De Souza, B.M. Gregório, F.J.B. Sampaio, W.S. Costa (Rio 

de Janeiro, Brazil) 

* 31 Significant role of TET2 and TET3 in production of fertile sperm: First evidence for link between 

5-cytosine-hydroxymethylation and proper spermatogenesis 

T. Dansranjavin, K. Steger, J. Deuker, W. Weidner, A. Spiess, M. Schorsch, U. Schagdarsurengin (Giessen, 

Hamburg, Wiesbaden, Germany) 

32 The depletion of H4K12ac within developmentally relevant promoters is not accompanied by alteration of 

DNA methylation in sperm of subfertile men. 

A. Paradowska-Dogan, M. Vieweg, K. Hortova, D. Miller, H-C. Schuppe, W. Weidner, K. Steger (Giessen, 

Germany; Prague, Czech Republic; Leeds, United Kingdom) 

33 RAPGEF6 function in mouse spermatogenesis 

K. Okada, K. Yamaguchi, N. Enatsu, F. Li, K. Matsushita, K. Chiba, H. Miyake, K. Maeta, S. Bilasy, 

H. Edamatsu, T. Kataoka, M. Fujisawa (Kobe, Japan; Ismailia, Egypt) 

34 Inhibin B predicts maturation arrest and sperm retrieval 

A. Ciudin, J.M. Corral, M.G. Diaconu, D. Gosalbez, M. Piqueras, J. Balasch, M. Guimerá, A. Carap, 

V. Constantin, R. Alvarez-Vijande, J.L. Ballesca, A. Alcaraz (Barcelona, Spain; Bucharest, Romania) 

35 Candesartan ameliorates cisplatin induced testicular damage and change of expression pattern of 

testicular podocin 

N. Enatsu, K. Yamaguchi, K. Okada, K. Matsushita, F. Li, K. Chiba, H. Miyake, M. Fujisawa (Kobe City, Japan) 

36 Withdrawn

37 Do serotonergic antidepressants affect semen quality? 

V. Boulos, H. Hassan (Cairo, Egypt) 

Summary: Words of wisdom: Future sperm management 



83 

Saturday

Saturday 




08.30 - 10.00 History of urology 1 



Chairs: A. Jardin, Paris (FR) 

D. Schultheiss, Giessen (DE) 



38 The story of the stent 

C.P. Hobbs, J.R. Bhatt, I.R.G. Wood (Oxford, United Kingdom) 

39 Historical development of diagnosis and treatment of bladder cancer 

M. Alsudani, A. Mohammed (Kettering, United Kingdom) 

40 Watercolors to save lives: The original drawings of “Étude sur le Rein des Urinaires” painted by Joaquin 

María Albarrán to become Doctor at the Faculty of Medicine in Paris 

J.C. Angulo, M. Perez, I. Otero, L. Fariña, M. Fernandez (Madrid, Spain) 

41 Practicing urology in Athens (1910-1950) 

A. Rempelakos, C. Tsiamis, C. Alamanis, E. Poulakou-Rebelakou (Athens, Greece) 

42 The evolution in our understanding of prostatic anatomy and its surgical management 

A. Christofides, J. Goddard (Leicester, United Kingdom) 

43 Dimitrie Gerota – anatomist in love with sculpture or urologist rebel against the king 

S. Poletajew, K. Poletajew, P. Radziszewski (Warsaw, Poland) 

44 The evolution of penile fracture management over the last century: A short and snappy review! 

Z. Ali, S. Miah, I. Dukic, I. Pearce (Salford, Sheffield, Manchester, United Kingdom) 

45 The urinary catheter; a relieving history 

I.R.G. Wood, C.P. Hobbs, J.R. Bhatt (Oxford, United Kingdom) 

46 Turning points in world history. Did Napoleon Bonaparte have a cystitis during the battle of Waterloo and 

was the battle lost because of that? 

M. Hatzinger (Frankfurt, Germany) 

47 Blood and grit: The impact of the bladder stone on history, music and science 

V. Sahdev, J.S. Thomas, A. Jones, P.V.S. Kumar (Reading, United Kingdom) 

48 The use of sutures in urology 

A. Pai, P.V.S. Kumar, A. Jones (Reading, United Kingdom) 

49 The rise and fall of Edward Gibbon’s hydrocele 

F.K. Khan, W. Mahmalji, S. Madaan, I.K. Dickinson, S. Sriprasad (Kent, United Kingdom)



08.30 - 10.00 Urothelial cancer: Tumour biology and experimental therapies 

Silver Hall - Level N2 


Chairs: M. Knowles, Leeds (GB) 

D. Theodorescu, Aurora (US) 




* 50 Silencing Notch-1 and Notch-3 promotes epithelial-to-mesenchymal transition (EMT) and self-renewal 

potential in human bladder cancer 

W. Jaeger, T. Hayashi, S. Awrey, K.M. Gust, T. Cordonnier, N. Li, R. Buttyan, T.H. Van Der Kwast, B.W. Van 

Rhijn, J.W. Thüroff, P.C. Black (Vancouver, Toronto, Canada; Frankfurt, Mainz, Germany; Amsterdam, The 

Netherlands) 

51 Epigenetic alterations associated with neo-adjuvant chemotherapy resistance in bladder cancer 

A. Feber, W.S. Tan, P. De Winter, A. Freeman, K. King, P. Gurung, C. Jameson, R. Bryan, N. James, S. Beck, 

J. Kelly (London, United Kingdom) 

52 MicroRNA expression signatures in bladder cancer: MicroRNA-145 function as a tumor suppressor and its 

mediated cancer pathways 

H. Yoshino, N. Seki, H. Hidaka, T. Yamasaki, T. Idesako, H. Enokida, M. Nakagawa (Kagoshima, Chiba, Japan) 

53 A ‘4-miR’ signature in urine identifies recurrent bladder cancer in patients undergoing surveillance 

N. Sapre, H. Lewis, G. Macintyre, A. Kowlaczyk, A.J. Costello, N.M. Corcoran, C.M. Hovens (Melbourne, 

Australia) 

54 Validation of TBX2, TBX3, GATA2, and ZIC4 as pTa-specific prognostic bladder cancer markers 

W. Beukers, R. Kandimalla, R. Masius, M. Vermeij, E.C. Zwarthoff (Rotterdam, The Netherlands) 

55 Circulating tumor cells and their prognostic significance in non-muscle invasive bladder cancer: A cell 

search analysis 

G.M. Busetto, A. Gradilone, C. Nicolazzo, A. Petracca, P. Gazzaniga, V. Gentile, E. De Berardinis (Rome, Italy) 

56 Specific changes in the DNA methylation pattern enable an early assessment of the metastatic risk of 

primary bladder tumours 

B. Stubendorff, K. Wilhelm, S. Dubey, E. Dudziec, J.W.F. Catto, M. Gajda, M-O. Grimm, K. Junker (Jena, 

Homburg, Germany; Oxford, Sheffield, United Kingdom) 

57 Ritonavir and bortezomib inhibit bladder cancer growth by inducing endoplasmic reticulum stress and 

ubiquitinated protein accumulation synergistically 

A. Sato, T. Asano, K. Ito, T. Asano (Tokorozawa, Japan) 

58 DNA damage response (DDR) genes are predictive of response to radiotherapy for muscle invasive bladder 

cancer 

P.M.S. Gurung, N. Counsell, J. Douglas, W. Tan, A. Feber, S. Short, S. Crabb, C. West, P. Hoskin, L. Beltran, 

A. Freeman, T. Powles, J. Kelly (London, Southampton, Leeds, Manchester, United Kingdom) 

59 Enhancement of γδ T cell antitumor activity against bladder cancer cell through 4-1BB and PD-1 mediated 

activation 

T. Suzuki, H. Yoshihide, K. Akihiro, N. Michio, Y. Shingo (Nishinomiya, Japan) 


85 

Saturday

Saturday 


60 Genomic landscapes of BBN-induced bladder cancer in rodents, and its application to human bladder 

cancer: Gene amplification and overexpression of Cyp2a5/CYP2A6 in invasive bladder cancer 

K. Kazuhiro, F. Katsuhiro, O. Koji, K. Yae, K. Masaru, K. Kenjiro, N. Hitoshi (Nagoya, Tokyo, Japan) 

61 UCyt+/ImmunoCyt and cytology in the detection of urothelial carcinoma: An update on 7,422 analyses 

E. Comploj, C. Mian, A. Spaltro Ambrosini, C. Dechet, S. Palermo, E. Trenti, M. Lodde, W. Horninger, 

A. Pycha (Bolzano, Italy; Salt Lake City, United States of America; Innsbruck, Austria)



08.30 - 10.00 Neuro-urology: Basic research 



Chairs: B. Uvelius, Lund (SE) 





62 A new cell in the urogenital tract - cholinergic chemosensory brush cells are sentinels of the urethra 

K. Filipski, K. Deckmann, T. Bschleipfer, G. Krasteva-Christ, T. Papadakis, A. Rafiq, M. Wolff, I. Ibanez-Tallon, 

B. Schütz, E. Weihe, W. Kummer (Giessen, Berlin-Buch, Marburg, Germany) 

63 TRPV4 mediates bladder afferent pathways; a spinal c-fos study 

D.A.W. Janssen, J.G. Hoenderop, J.P. Heesakkers, J.A. Schalken (Nijmegen, The Netherlands) 

64 Effects of silodosin, a selective α1A-adrenoceptor antagonist, on the single primary bladder afferent 

activity of the rat 

N. Aizawa, Y. Homma, Y. Igawa (Tokyo, Japan) 

* 65 Role of NGF in bladder inflammation-induced pain behavior and TRPV1 traffic 

A. Coelho, A.S. Wolf-Johnston, S. Shinde, A. Avelino, C.D. Cruz, F. Cruz, L. Birder (Porto, Portugal; 

Pittsburgh, United States of America) 

66 Parathyroid hormone related peptide is endogenous relaxant of spontaneous detrusor smooth muscle 

contraction 

N Nishikawa, A. Kanematsu, H. Negoro, M. Imamura, Y. Sugino, T. Okinami, K. Yoshimura, H. Hashitani, 

O. Ogawa (Kyoto, Nishinomiya, Nagoya, Japan) 

* 67 Peripheral inhibition of fatty acid amide hydrolase depresses activities of single primary bladder 

mechanosensitive afferents of the rat 

N. Aizawa, C. Füllhase, P. Hedlund, Y. Homma, Y. Igawa (Tokyo, Japan; Munich, Germany; Milan, Italy) 

68 Urodynamic effects of fatty acid amide (FAAH) inhibition are mediated via central nervous cannabinoid 

type 2 (CB2) receptors 

C. Füllhase, A. Giese, M. Schmidt, C. Gratzke, C. Stief, K.E. Andersson, P. Hedlund (Munich, Germany; 

Winston-Salem, United States of America; Milan, Italy) 

69 The peripheral active fatty acid amide hydrolase (FAAH) inhibitor urb937 counteracts detrusor overactivity 

in two different animal models 

G. Gandaglia, F. Benigni, R. Buono, F. Mistretta, A. Nini, F. Castiglione, P. Hedlund (Milan, Italy) 

70 Supraspinal control of urine storage and micturition in men – an fMRI study 

L. Michels, J. Wöllner, F. Gregorini, M. Kurz, T.M. Kessler, B. Schurch, S. Kollias, U. Mehnert (Zurich, 

Winterthur, Lausanne, Switzerland) 

71 Piezo1, a novel mechanosensor in the bladder urothelium, transmits signals of bladder sensation 

T.M. Miyamoto, H. Nakagomi, S. Kira, T. Mochizuki, S. Koizumi, M. Tominaga, M. Takeda (Chuo, Okazaki, 

Japan) 


87 

Saturday

Saturday 


72 Compensation mechanisms in bladder outlet obstruction (BOO): The “heart-disease” of the lower urinary 

tract 

S.H. Alloussi, G. Peters, W. Arafat, Y. Al-Bulushi, T. Blessig, C. Lang, S. Alloussi (Neunkirchen, Germany) 

73 Withdrawn



08.30 - 10.00 Non-surgical treatment of advanced urothelial cancer 



Chairs: J. Bellmunt, Barcelona (ES) 





* 74 Interval between cystectomy and start of adjuvant chemotherapy is an independent prognostic factor for 

patients with locally advanced or lymph node positive carcinoma of the urinary bladder 

C.H. Ohlmann, J. Kamradt, B. Burgard, M. Saar, I. Azone, S. Siemer, M. Stöckle, J. Lehmann (Homburg, Kiel, 

Germany) 

75 Eligibility for neoadjuvant/adjuvant cisplatin-based chemotherapy among radical cystectomy patients 

R.H. Thompson, S.A. Boorjian, S. Kim, J.C. Cheville, P. Thapa, R. Tarrel, I. Frank (Rochester, United States of 

America) 

76 Risk factors for intravesical tumor recurrence in muscle-invasive bladder cancer patients treated with 

selective bladder-sparing approaches 

F. Koga, Y. Fujii, J-I. Ishioka, Y. Matsuoka, N. Numao, K. Saito, H. Masuda, S. Kawakami, K. Kihara (Tokyo, 

Japan) 

77 Predicting responses to neoadjuvant chemotherapy for muscle invasive bladder cancers for prospective 

study 

Y. Kato, H. Zembutsu, R. Takata, K. Iwasaki, W. Obara, Y. Nakamura, T. Fujioka (Morioka, Sapporo, Japan; 

Chicago, United States of America) 

78 Impact of renal function on eligibility for chemotherapy and survival in patients who underwent radical 

nephroureterectomy 

E.N. Xylinas, M. Rink, L.A. Kluth, V. Margulis, R.K. Lee, E. Comploj, G. Novara, J.D. Raman, Y. Lotan, 

A. Weizer, M. Roupret, A. Pycha, D. Scherr, C. Seitz, V. Ficarra, Q-D. Trinh, P.I. Karakiewicz, F. Montorsi, 

M. Zerbib, S.F. Shariat (New York, Dallas, Hershey, Ann Arbor, United States of America; Bolzano, Padua, 

Milan, Italy; Paris, France; Vienna, Austria; Montreal, Canada) 

79 Sequential chemotherapy with gemcitabine plus carboplatin followed by additional docetaxel for aged 

patients with advanced bladder cancer 

T. Yoneyama, Y. Suzuki, N. Sugiyama, H. Yamamoto, A. Okamoto, Y. Tobisawa, T. Yoneyama, A. Imai, 

K. Mori, S. Hatakeyama, Y. Hashimoto, T. Koie, C. Ohyama (Hirosaki, Japan) 

* 80 Adjuvant radiotherapy with or without chemotherapy for advanced upper tract transitional cell carcinoma 

S. Park, M. Shim, D. Yoo, C. Song, B. Hong, J.H. Hong, C.S. Kim, H. Ahn (Seoul, South Korea) 

81 Peri-operative chemotherapy or surveillance in upper tract urothelial cancer (POUT - CRUK/11/027) - a 

randomised controlled trial to define standard post-operative management 

A. Birtle, R. Lewis, J. Chester, J. Donovan, M. Johnson, R. Jones, R. Kockelbergh, T. Powles, R. Bryan, J. Catto, 

E. Jones, E. Hall (Preston, Surrey, Cardiff, Bristol, Newcastle, Glasgow, Leicester, London, Birmingham, 

Sheffield, United Kingdom) 


89 

Saturday

Saturday 


82 Sequential chemotherapy with gemcitabine plus carboplatin, followed by additional docetaxel for aged 

patients with advanced upper-tract urothelial cancer 

T. Yoneyama, Y. Suzuki, N. Sugiyama, Y. Tobisawa, T. Yoneyama, A. Okamoto, H. Yamamoto, A. Imai, 

S. Hatakeyama, K. Mori, Y. Hashimoto, T. Koie, C. Ohyama (Hirosaki, Japan) 

83 Long-term efficacy and safety outcomes of the modified (simplified) combination of methotrexate, 

vinblastine, doxorubicin, and cisplatin (MVAC) as front-line therapy for unresectable or metastatic 

urothelial cancer (UC) 

A. Necchi, L. Mariani, P. Giannatempo, D. Raggi, E. Farè, G. Pizzocaro, L. Piva, D. Biasoni, T. Torelli, 

M. Catanzaro, S. Stagni, A. Milani, A. Gianni, F. De Braud, N. Nicolai, R. Salvioni (Milan, Italy) 

84 Comparative effectiveness of gemcitabine and paclitaxel versus best supportive care in metastatic 

urothelial carcinoma who have previously been treated with platinum based chemotherapy 

S. Kudou, H.Z. Zakouji, M.T. Takeda (Chuo Yamanashi, Japan) 

85 Management of local recurrences in the irradiated bladder: A systematic review 

N. Sapre, P. Anderson, F.F. Foroudi (Melbourne, Australia)



08.30 - 10.00 Nephron sparing surgery and risk scoring systems 



Chairs: M.P. Laguna, Amsterdam (NL) 

P.J. Nyirády, Budapest (HU) 




86 Nephron sparing surgery for small renal masses: Are we doing our best? 

M. Ciuffreda, V.A.C. Ramani (Manchester, United Kingdom) 

87 Morbidity, functional and oncological outcomes after nephron sparing surgery for cT2 renal tumours 

P. Bigot, J.F. Hetet, T. Fardoun, J. Rouffilange, E. Xylinas, G. Ploussard, I. Ouzaid, E. Robine, F. Audenet, 

O. Merigot De Treigny, C. Maurin, M. Ammi, S. Lebdai, L. Brureau, L. Bastien, J.A. Long, M. Roupret, 

Y. Neuzillet, P. Mongiat-Artus, G. Verhoest, M. Zerbib, V. Ravery, J. Rigaud, L. Bellec, H. Baumert, 

K. Bensalah, B. Escudier, N. Grenier, P. Paparel, N. Rioux-Leclercq, J.C. Bernhard, A-R. Azzouzi, M. Soulié, 

J.J. Patard (Angers, Nantes, Rennes, Bordeaux, Paris, Toulouse, Le Kremlin-Bicêtre, Suresnes, Grenoble, 

Lyon, France) 

88 Functional results of partial nephrectomy in patients with renal tumors 

M.I. Volkova, V.B. Matveev, I.Y. Skvortsov (Moscow, Russia) 

89 R.E.N.A.L. nephrometry score for laparoscopic partial nephrectomy in renal cell cancer and its correlation 

with ischemia time and complications 

B.M. Wrobel, C. Dogan, M.S. Erdogan, S. Deger (Ostfildern, Germany; Istanbul, Turkey) 

90 Withdrawn 

* 91 Optimal outcome of laparoendoscopic single-site partial nephrectomy: Analysis of predictive factors in a 

multi-institutional dataset 

R. Autorino, F. Greco, L. Cindolo, T. Herrmann, E. Liatsikos, U. Nagele, J-U. Stolzenburg, K. Rha, I. Darweesh, 

S. Rais-Bahrami, Y. Sun, L. Richstone, L. Wang, S.T. Young, C. Springer, P. Kallidonis, L. Schips, P. Fornara, 

J. Kaouk (Cleveland, La Jolla, New Hyde Park, United States of America; Halle, Hanover, Leipzig, Germany; 

Vasto, Italy; Patras, Greece; Hall in Tirol, Austria; Seoul, South Korea; Shanghai, China) 

92 Initial experience of an application of a novel high-speed 3-D image/volume analyzer to clampless partial 

nephrectomy 

Y. Komai, Y. Sakai, N. Gotohda, T. Kobayashi, N. Saito (Chiba, Japan) 

93 Pathological characteristics and prognostic impact of peritumoral capsule penetration in renal cell 

carcinoma after tumor enucleation 

A. Minervini, M.R. Raspollini, A. Tuccio, C. Di Cristofano, G. Siena, M. Salvi, G. Vittori, L. Masieri, A. Raugei, 

A. Lapini, S. Serni, M. Carini (Florence, Rome, Italy) 

94 Partial nephrectomy for metastatic renal cell carcinoma 

O. Stakhovskyi, Y. Vitruk, O. Voilenko, V. Kotov, P. Vukalovich, O. Yatsyna, E. Stakhovsky (Kiev, Ukraine) 

* 95 Management of renal cancer in a contemporary series of patients affected by Von Hippel-Lindau disease 

P. Destefanis, B. Lucatello, M. Maccario, A. Veltri, B. Pasini, A. Battaglia, M. Allasia, A. Gonella, A. Bosio, 

B. Lillaz, B. Frea, D. Fontana (Turin, Italy) 


91 

Saturday

Saturday 

* 96 Partial nephrectomy for renal tumors of more than 7 cm: Oncological, morbidity and renal function 

outcomes 

J. Rouffilange, L. Donon, G. Capon, M. Vergnolles, O. Renard, L. Ferretti, G. Robert, G. Pasticier, P. Ballanger, 

J-M. Ferrière, J-C. Bernhard (Bordeaux, France) 


Discussion on poster 96 

M.P. Laguna, Amsterdam (NL)



10.00 - 16.30 Residents Day - organised by the Young Urologists Office (YUO) in 

collaboration with the European Society of Residents in Urology 

(ESRU) 


Chairs: J.P.M. Sedelaar, Nijmegen (NL) 

Z. Tandogdu, Istanbul (TR) 





10.10 - 10.40 Laparoscopy and robot during training 

Moderators: F. Furriel, Coimbra (PT) 

S. Hruby, Salzburg (AT) 

10.10 - 10.25 Robot assisted laparoscopy training for young trainees 


10.25 - 10.40 Basic skills video presentation for laparoscopy 

B.S.E.P. Van Cleynenbreugel, Leuven (BE) 

10.40 - 11.30 Post residency training 

Moderators: S. Larré, Reims (FR) 

M. Sochaj, Lodz (PL) 

10.40 - 10.55 European experience and pathway 

A.G. Van Der Heijden, Nijmegen (NL) 

10.55 - 11.10 North American experience and pathway 

G. Godoy, New York (US) 

11.10 - 11.20 Global scholarship opportunities 

H. Fajkovic, St. Pölten (AT) 

11.20 - 11.30 European Urology Scholarship Programme (EUSP) scholarship opportunities 


11.30 - 12.05 Post-residency life 

Moderators: L.G. Martinez Bustamante, Koper (SI) 


11.30 - 11.40 Academic urology 

S. Al-Hayek, Cambridge (GB) 

11.40 - 11.50 Private practice 

E.B. Cornel, Hengelo (NL) 


93 

Saturday

Saturday 

11.50 - 12.05 Debate: Academic and private practice 


Panel: S. Al-Hayek, Cambridge (GB) 

E.B. Cornel, Hengelo (NL) 

L.G. Martinez Bustamante, Koper (SI) 


12.05 - 12.30 The present and the future of the young urologist in Europe 

12.05 - 12.15 The current status of young urologists in Europe: Results of a survey 

F. Sanguedolce, Barcelona (ES) 

12.15 - 12.25 Comments from the panel on the present and future of young urologists 

Panel: T. Esen, Istanbul (TR) 



12.25 - 12.30 What is the future for young urologists? 

Panel: T. Esen, Istanbul (TR) 




12.30 - 13.00 Campbell Team Challenge Quiz 

13.00 - 13.15 Break 

Quizmasters: T.N. Garmanova, Moscow (RU) 

J.L. Vasquez, Copenhagen (DK) 

Panel: L. Lund, Viborg (DK) 


13.15 - 13.30 Progress in guidelines evidence analysis: An update 

K.F. Parsons, Liverpool (GB) 

13.30 - 14.00 What does a resident need to know? 

Moderators: K. Hendricksen, Nijmegen (NL) 

P.P. Swiniarski, Bydgoszcz (PL) 


K. Hendricksen, Nijmegen (NL) 

P.P. Swiniarski, Bydgoszcz (PL) 

13.35 - 13.45 Curriculum Presentation 

S. Müller, Bonn (DE) 

13.45 - 14.00 Debate: What should be the limits of residency training? Do you have to know it all? Are there upper and 

lower limits? 

Panel: M. Brehmer, Stockholm (SE) 



H. Van Poppel, Leuven (BE)

14.00 - 15.30 What is the evidence? 

Moderators: C.G.A. Ruf, Hamburg (DE) 

M. Skrodzka, Białystok (PL) 

14.00 - 14.15 Oncology: How to do a TRUS guided prostate biopsy 


14.15 - 14.30 Mini-Perc technique 


14.30 - 14.45 Genitourinary infections: Wise antibiotic use in urology patients 


14.45 - 15.00 Paediatrics: Trends in paediatric endourology 

M.S. Silay, Istanbul (TR) 

15.00 - 15.15 Infertility: Diagnostic approach to an infertile couple 

J.O.R. Sonksen, Herlev (DK) 

15.15 - 15.30 Functional urology: Sling surgery, indications, tips and tricks 

M.J. Drake, Bristol (GB) 

15.30 - 16.15 Nightmare session: Presentations of clinical problems that have perplexed residents 

Case presentators: T. Oedekoven, Memmingen (DE) 

S. Reinhardt, Herlev (DK) 

S.M. Monagas Arteaga, León (ES) 

Panel: T.E. Bjerklund Johansen, Århus (DK) 


M. Fode, Herlev (DK) 

16.15 - 16.30 Prizes and awards 


95 

Saturday

Saturday 

Saturday, 16 March - EAU Section Meetings 


Meeting of the EAU Section of Uro-Technology 

(ESUT) in cooperation with ERUS and EULIS 

10.15 - 17.15 What is new in endourology, laparoscopy and robotics 


Chair: J. Rassweiler, Heilbronn (DE) 

10.15 - 17.15 Live broadcasts from the Department of Urology, San Raffaele Turro Hospital, Vita-Salute San Raffaele 

University 

Coordinators at San Raffaele 


A. Cestari, Milan (IT) 


Coordinators in eURO Auditorium 

V. Bucuras, Timisoara (RO) 

T. Frede, Müllheim (DE) 

R. Muschter, Rotenburg (DE) 


ESUT J. Rassweiler, Heilbronn (DE) 

ERUS P. Wiklund, Stockholm (SE) 

EULIS P.J. Osther, Fredericia (DK) 

10.20 - 10.30 Ethics of live surgery / Cases from last year 



10.30 - 13.00 Live surgery Part 1 

Moderators: C-C. Abbou, Creteil (FR) 

T. Knoll, Sindelfingen (DE) 


P. Wiklund, Stockholm (SE) 

10.30 - 11.00 LESS robotic pyeloplasty 

G. Guazzoni, Milan (IT) 

11.00 - 11.20 3D retroperitoneal laparoscopic partial nephrectomy 

J-U. Stolzenburg, Leipzig (DE) 

11.20 - 11.40 Laparoscopic radical nephrectomy - the Gazi technique 

L. Tunc, Ankara (TR) 

11.40 - 12.10 Robotic partial nephrectomy - the standard technique 


12.10 - 12.30 Retrograde management of a stone in a caliceal diverticulum 


12.30 - 12.50 Flexible ureteroscopy and supine PCNL 


G. Giusti, Milan (IT)

12.50 - 13.00 Laparoscopic decompression of pudendal nerve (video) 

T. Erdogru, Istanbul (TR) 

13.00 - 15.00 Live surgery part 2 


P. Dasgupta, London (GB) 


A. Skolarikos, Athens (GR) 

13.00 - 13.20 RALP in advanced stage (part 1) 


13.20 - 13.40 NOTES - nephrectomy with 3D 

A. Alcaraz, Barcelona (ES) 

M.J. Ribal , Barcelona (ES) 

13.40 - 14.00 Mini-laparoscopic pyeloplasty 

F. Porpiglia, Turin (IT) 

14.00 - 14.20 Robot-assisted extended pelvic lymph node dissection in prostate cancer 

P.T. Piechaud, Bordeaux (FR) 

14.20 - 14.40 NBI, PDD and digital endoscopy of the bladder 

B. Malavaud, Toulouse (FR) 

14.40 - 15.00 PDD, SPIES-imaging and bipolar resection of a bladder tumour - new techniques 

A. Lapini, Florence (IT) 

15.00 - 17.05 Live surgery Part 3 

Moderators: C.M. Annerstedt, Herlev (DK) 

M. Burchardt, Greifswald (DE) 

J.J.M.C.H. De La Rosette, Amsterdam (NL) 

M.S. Michel, Mannheim (DE) 

15.00 - 15.20 RALP in advanced stage (part 2) 


15.20 - 15.40 Greenlight laser of the prostate 

A. Bachmann, Basel (CH) 


15.40 - 15.55 Urolift for BPH 


H. Woo, Sydney (AU) 

15.55 - 16.15 3D - LESS - nephrectomy 


16.15 - 16.30 TULEP procedure 

L. Camignani, Milan (IT) 

16.30 - 16.45 Prostate vaporisation 

J. Pfitzenmaier, Bielefeld (DE) 

16.45 - 16.55 Robot-assisted ureteroscopy (video) 

R. Saglam, Ankara (TR) 


97 

Saturday

Saturday 

16.55 - 17.05 ICG-assisted pelvic lymph node dissection (video) 



R.F. Van Velthoven, Brussels (BE) 



Following a more than 10 year tradition of live surgery sessions, the EAU Section of Uro-Technology 

(ESUT) presents an ambitious programme focussing on novel techniques in percutaneous, endourological, 

laparoscopic, and robotic-assisted procedures. This year, with “What is new in endourology, laparoscopy 

and robotics” we want to focus on novel technology improving the performance of video-assisted surgery 

in all fields of urology. This session is conducted in collaboration with the EAU Section of Robotic Surgery in 

Urology (ERUS) and the EAU Section of Urolithiasis (EULIS). 

In the laparoscopic and robot-assisted cases, we will compare new access techniques (LESS versus SMART/ 

Mini-LAP versus NOTES) as well as new instruments and devices (3D imaging) improving the ergonomics of 

laparoscopy. 

Finally, the latest digital developments for flexible endoscopy of the upper urinary tract for diagnosis and 

treatment of tumours and calculi are demonstrated also in combination with supine PCNL using the novel 

split screen technology. 

The meeting faculty consists of internationally well-known experts serving as surgeons and moderators. 

The different surgical procedures will be transmitted from the San Raffaele Hospital, University of Milan 

in high definition quality. A split-screen will allow the delegates to follow the uncommented procedures. 

Traditionally, the format of ESUT live surgery will allow all delegates to directly communicate with the 

surgeons to ask questions and to discuss every aspect of the procedure. Moreover, the ESUT session will be 

available online. 

Supported by unrestricted educational grants from COOK, INTUITIVE SURGICAL, IPSEN, KARL STORZ GMBH 

& CO.KG, NEOTRACT, OLYMPUS, QUANTA SYSTEM, ROCAMED


Meeting of the EAU Section of Female and 

Functional Urology (ESFFU) and the EAU Section 

of Urological Imaging (ESUI) 

10.15 - 14.00 Imaging in female and functional urology 


Chairs: J.P.F.A. Heesakkers, Nijmegen (NL) 





10.20 - 11.30 Female urology 

Chairs: F.R. Cruz, Porto (PT) 

C. Trombetta, Trieste (IT) 

10.20 - 10.50 How to visualise the female pelvic floor? 

10.20 - 10.30 Ultrasound 

M.X. Ferreira Coelho, Lisbon (PT) 

10.30 - 10.40 MRI 

M. Halaska, Prague (CZ) 

10.40 - 10.50 Video urodynamics 

P.F.W.M. Rosier, Utrecht (NL) 

10.50 - 11.10 What is new in the management of: 

10.50 - 11.00 Stress urinary incontinence? 


11.00 - 11.10 Pelvic organ prolapse? 


11.10 - 11.30 How to evaluate results after incontinence and prolapse surgery? 

11.10 - 11.20 Imaging in the evaluation of incontinence and prolapse surgery 


11.20 - 11.30 How to correct complications after incontinence and prolapse surgery? 

E. Petri, Greifswald (DE) 

11.30 - 12.20 Functional urology and male incontinence 

Chairs: D.M Castro-Diaz, Santa Cruz de Tenerife (ES) 



99 

Saturday

Saturday 

11.30 - 11.50 Male incontinence 

11.30 - 11.40 Imaging for post-prostatectomy incontinence 


11.40 - 11.50 Management of post-prostatectomy incontinence 

R. Bauer, Munich (DE) 

11.50 - 12.20 Overactive bladder and LUTS 

11.50 - 12.00 Imaging as a non-invasive diagnostic tool in LUTS 

H. Wijkstra, Amsterdam (NL) 

12.00 - 12.10 Imaging in the management of overactive bladder 

F. Farag, Nijmegen (NL) 

12.10 - 12.20 What is new in the management of LUTS and OAB? 

P. Radziszewski, Warsaw (PL) 

12.20 - 12.30 Break 

12.30 - 13.10 EAU Section of Urological Imaging (ESUI) 


Chairs: B.M. Carey, Leeds (GB) 


12.30 - 12.40 ESUI Vision Award 2013 

Sponsored by an unrestricted educational grant from HITACHI MEDICAL SYSTEMS EUROPE 

12.40 - 13.10 What is new in imaging in 2013? 

12.40 - 12.50 Prostate 

H. Heynemann, Halle/Saale (DE) 

12.50 - 13.00 Kidney; Bladder 

S. Siracusano, Trieste (IT) 

13.00 - 13.10 Lymph nodes; Testis and penis 

G. Salomon, Hamburg (DE) 

13.10 - 13.50 EAU Section of Female and Functional Urology (ESFFU) 

13.10 - 13.50 What is new in neurourology in 2013? 

Chair: J.P.F.A. Heesakkers, Nijmegen (NL) 

13.10 - 13.30 FMRI 

T.M. Kessler, Zürich (CH) 

13.30 - 13.50 New treatment options 

R. Hamid, London (GB) 

13.50 - 14.00 Summary 


J. Walz, Marseille (FR)


The role of imaging in the study of female pelvic floor is fundamental. Every urologist has to know how to 

visualise the female pelvic floor by means of ultrasound, MRI and video urodynamics. 

Moreover today imaging is also mandatory in the evaluation of female incontinence and prolapse surgery, 

male incontinence, overactive bladder and LUTS expecially to evaluate the results of more recent surgical and 

non surgical therapies. 

During the session the ESUI Vision Award will be given to the author of the most innovative imaging study 

published in the last year. 


101 

Saturday

Saturday 



Meeting of the EAU Section of Urolithiasis (EULIS) 

10.15 - 14.00 Urolithiasis - on our way to personalised management 


Chair: P.J. Osther, Fredericia (DK) 


P.J. Osther, Fredericia (DK) 

10.20 - 11.20 Increasing stone prevention compliance through patient education 

Moderators: T. Bach, Hamburg (DE) 

S. Oehlschläger, Dresden (DE) 

J.M. Reis Santos, Lisbon (PT) 

10.20 - 10.40 How precisely do we really inform our patients regarding pathophysiology, nutrition and medication? 

B. Hess, Zurich (CH) 

10.40 - 11.00 Rapid screening of diet in renal stone formers 

A. Trinchieri, Lecco (IT) 

11.00 - 11.20 Modulation of urolithiasis risk through lifestyle changes: An internet based tool for patient selfmanagement 

D.J. Kok, Rotterdam (NL) 

11.20 - 12.30 Role of stone analysis in the personalised management of upper urinary tract stone disease 

Moderators: H-M. Fritsche, Regensburg (DE) 

C.M. Scoffone, Turin (IT) 

R. Siener, Bonn (DE) 

11.20 - 11.40 Recent changes in renal stone compositions: Data from over 2000,000 stone analyses 


11.40 - 12.10 Imaging for pre-treatment evaluation of stone composition and fragility 

J.C. Williams, Indianapolis (US) 

12.10 - 12.30 ERA lecture: How can stone analysis guide you towards effective metaphylaxis? 

G. Gambaro, Rome (IT) 

12.30 - 13.50 Complications in stone management: Individualised treatment strategies besed on case presentations: 

Metabolic/medical headaches; SWL catastrophes; Nightmare scenarios of endoscopic stone removal 

Moderators: P.J. Osther, Fredericia (DK) 


Panel: N.N-P. Buchholz, London (GB) 


F. Keeley, Bristol (GB) 

S. Lahme, Pforzheim (DE) 

K. Sarica, Istanbul (TR) 


M. Straub, Munich (DE) 

H.G. Tiselius, Stockholm (SE)

13.50 - 14.00 Announcements and final remarks 



The stone disease is extremely diverse – from single stone formers with spontaneous stone passage to 

staghorn stones and stone diseases associated with severe metabolic abnormalities such as renal tubular 

acidosis and primary hyperoxaluria. It is obvious that these different conditions should be dealt with 

selectively. For elimination of stones present in the upper urinary tract we have a multitude of modalities 

including SWL, PCNL, flexible and semirigid URS, litholysis etc. Recent years have brought us powerful tools 

to select the right patient for the right treatment. In this EULIS session we will explore into the modern 

concept of personalised stone management including life-style management, role of imaging and stone 

analysis as well as individualised complication management. 


103 

Saturday

Saturday 



Meeting of the EAU Section of Transplantation 

Urology (ESTU) 

10.15 - 14.00 Improving outcomes in kidney transplantation 


Chairs: A.J. Figueiredo, Coimbra (PT) 





10.25 - 11.40 Organ donation 

Moderators: F.J. Burgos Revilla, Madrid (ES) 

K. Dreikorn, Bremen (DE) 

10.25 - 10.40 National Spanish Consensus Document of expanded criteria donor kidneys 


10.40 - 10.55 NHBD: Technique of organ retrieval and choice of the optimal recipient 

C. Terrone, Turin (IT) 

10.55 - 11.10 Altruistic paired donation: Where do we stand? 

O. Rodriguez Faba, Barcelona (ES) 

11.10 - 11.25 Matching of donor and recipient: Immunology, age, BMI, gender 



11.40 - 12.55 Immunology 

Moderators: E. Lledo García, Madrid (ES) 

P. Di Tonno, Bari (IT) 

11.40 - 11.55 Transplant tolerance: Myth or reality? 

A.B. Chkhotua, Tbilisi (GE) 

11.55 - 12.10 Protocol biopsies - when, how, why / complications and management 


12.10 - 12.25 CMV in KTX - prophylaxis and therapy 

F. Kleinclauss, Besançon (FR) 

12.25 - 12.40 Attitude towards the non-functioning graft: Removal or persistence? 

P.T. Coelho Nunes, Coimbra (PT) 


12.55 - 13.50 Management of the transplanted patient 

Moderators: A.J. Figueiredo, Coimbra (PT) 

M. Giessing, Düsseldorf (DE)

12.55 - 13.10 Robotic prostatectomy after KTX 

G. Karam, Nantes (FR) 

13.10 - 13.25 Psychological impact and QoL of recipients of deceased donor kidneys 

V. Gomez, Madrid (ES) 

13.25 - 13.40 Dermatology: Skin cancer and KTX 

S. Piaserico, Padova (IT) 






Organ transplantation is a fascinating area of medicine and advances come about in several complementary 

fields. All starts in donation and there are many ways of increasing the number of donors, both deceased 

ones and living donors. Advances in the understanding of transplant immunology are fundamental for 

achieving better results. On top of all that, looking beyond the graft in the management of the transplanted 

patient is paramount for the success of the transplantation. 


105 

Saturday

Saturday 



Meeting of the EAU Section of Infections 

in Urology (ESIU) and the EAU Section of 

Andrological Urology (ESAU) 

10.15 - 14.00 Urogenital infections and andrology 


Chairs: T.E. Bjerklund Johansen, Århus (DK) 



T.E. Bjerklund Johansen, Århus (DK) 

10.20 - 11.40 ESIU: 10 years GPIU anniversary programme 

Chairs: M. Grabe, Malmö (SE) 


10.20 - 10.35 Urosepsis - the real emergency 


10.35 - 10.50 Fournier’s gangrene - the most lethal acute situation 

R. Bartoletti, Florence (IT) 

10.50 - 11.05 Use of antibiotics and the role of guidelines 


11.05 - 11.20 Prevalence, susceptibility and resistance in urogenital infections 


11.20 - 11.35 Prevention and control of antimicrobial resistance in Europe: The role of ECDC 

D. Monnet, Stockholm (SE) 


11.40 - 12.30 Joint session ESIU and ESAU: Urogenital infections in andrology 

Chairs: 

ESIU K.G. Naber, Straubing (DE) 

ESAU D. Ralph, London (GB) 

11.40 - 11.55 Prostatitis 

R.S. Pickard, Newcastle upon Tyne (GB) 

11.55 - 12.10 Epididymo-orchitis and male infertility 


12.10 - 12.25 Infections of the penile shaft and outcome for sexual function 

C. Bettocchi, Bari (IT)


12.30 - 13.55 ESAU: News for the andrologist in 2013 

Chairs: N. Sofikitis, Ioannina (GR) 

E. Wespes, Charleroi (BE) 

12.30 - 12.45 Varicocele therapy improves the male fertility status: What is proven? 

G.R. Dohle, Rotterdam (NL) 

12.45 - 13.00 Metabolic syndrome and erectile dysfunction/hypogonadism 

E.J.H. Meuleman, Amsterdam (NL) 

13.00 - 13.15 New drugs in male infertility, ejaculatory and erectile dysfunction 

F. Fusco, Naples (IT) 

13.15 - 13.30 Whats is new in Peyronie’s disease? 

A. Kadioglu, Istanbul (TR) 

13.30 - 13.45 New aspects of sexual medicine for the andrological urologist 

E.A. Jannini, L’Aquila (IT) 





This joint section session will provide an up-to-date discussion of the most lethal infective complications 

in urology, raising antimicrobial resistance and the prudent use of antibiotics. Infections and infective 

complications in all male sex organs will be discussed from an infectious and andrological perspective. 

An extensive update will be given on the most important topics in andrology like varicocele, metabolic 

syndrome, erectile dysfunction, Peyronie`s disease and sexual medicine. All topics will be addressed by key 

international experts and opinion leaders. 

Upon the completion of this joint session, the delegates will know how to deal with urosepsis and Fournier`s 

gangrene and understand the basis for prudent use of antibiotics. The delegates will be educated on how to 

avoid and treat infective complications in andrological surgery and be familiar with state of the art diagnostic 

work-up and treatment of the most important conditions in andrology. 


107 

Saturday

Saturday 


10.15 - 14.00 


Joint Meeting of the European Organisation 

for Research and Treatment of Cancer Genito- 

Urinary Cancer Group (EORTC GUCG), the EAU 

Section of Urological Research (ESUR), the EAU 

Section of Oncological Urology (ESOU) and the 

EAU Section of Uropathology (ESUP) 


10.15 - 12.00 EORTC GUCG Group and ESUR: Personalised medicine 

Chairs: Z. Culig, Innsbruck (AT) 



Z. Culig, Innsbruck (AT)) 


10.20 - 10.35 Personalised medicine in prostate cancer 

T. Van Der Kwast, Toronto (CA) 

10.35 - 10.50 EORTC risk calculator and beyond; How to improve strategies to individualise therapy in NMIBC 

R.J. Sylvester, Brussels (BE) 

10.50 - 11.05 Personalised approach in renal cancer 

B. Escudier, Villejuif (FR) 

11.05 - 11.20 Personalising surgery in advanced renal cell carcinoma 


11.20 - 11.35 Individual approach in bladder cancer 

D. Theodorescu, Aurora (US) 

11.35 - 11.50 Postoperative radiotherapy after radical prostatectomy: What has been learned from prospective trials and 

will never be learned from retrospective ones? 


11.50 - 12.00 Close 

Z. Culig, Innsbruck (AT)) 


12.00 - 14.00 ESOU and ESUP: Clinical forum in prostate and renal cancer 

Chairs: M. Brausi, Modena (IT) 

A. Lopez-Beltran, Cordoba (ES) 



A. Lopez-Beltran, Cordoba (ES)

12.05 - 13.00 Clinical forum: Diagnosis and treatment of small foci of PCa 

Moderator: M. Brausi, Modena (IT) 

12.05 - 12.20 New tools for diagnosis 

G. Villeirs, Ghent (BE) 

12.20 - 12.35 Pathologic characteristics of low risk PCa: Multifocality and prognostic factors 

R. Montironi, Torrette Di Ancona (IT) 

12.35 - 12.50 Treatments of low risk PCa 



13.00 - 14.00 Clinical forum: Locally advanced renal cancer 

Moderator: A. Lopez-Beltran, Cordoba (ES) 

13.00 - 13.15 The role of biopsy in renal masses 


13.15 - 13.30 Pathological prognostic factors 

F. Algaba, Barcelona (ES) 

13.30 - 13.45 Treatment of small renal masses 

H.A. Özen, Ankara (TR) 


13.55 - 14.00 Close 


A. Lopez-Beltran, Cordoba (ES) 


EORTC GUCG and ESUR: 

Clinical trials should be based on targeting molecules which are overexpressed in a disease and functionally 

associated with its development and progression. In several human cancers, expression of target candidates 

is specific in individual patient tissues and not the same in primary lesions and metastases of one patient. 

The purpose of the joint session is to convince the audience that biologically-based clinical trials should 

be carried out. Results obtained with experimental models open the ways to use novel agents in cancer 

therapy, however there should be an appropriate information about expression of possible targets and 

related signaling pathways in clinical specimens available. In addition, new trial methodologies will have to 

be developed to clinically assess the response of the cancer to these drugs. This will be done by embedding 

traditional endpoints, such as progression free survival and overall survival, with modern functional imaging 

endpoints. 


109 

Saturday

Saturday 



Meeting of the EAU Section of Genito-Urinary 

Reconstructive Surgeons (ESGURS) 

10.15 - 14.00 Urethral reconstruction and complication management after radical 

prostatectomy 


Chair: S. Deger, Ostfildern (DE) 

10.15 - 11.00 Debate: Dorsal versus ventral grafting for urethroplasty 

Moderator: M.M. Fisch, Hamburg (DE) 

10.15 - 10.30 Dorsal grafting 

D.E. Andrich, London (GB) 

10.30 - 10.45 Ventral grafting, when and why? 


10.45 - 11.00 Closing remarks from chair and panel 

D.E. Andrich, Kingston upon Thames (GB) 




11.00 - 11.45 Part 2 

Moderators: B.M. Alici, Istanbul (TR) 

O.Z. Shenfeld, Jerusalem (IL) 

11.00 - 11.15 Failed IPP surgery 

R.P. Djinovic, Belgrade (RS) 

11.15 - 11.30 Management of cavernosal tissue fibrosis after failed IPP treatment 

I. Moncada, Madrid (ES) 

11.30 - 11.45 Hypospadias cripple - which techniques are optimal for initial repair and re-dos 

A. Zhivov, St. Petersburg (RU) 

11.45 - 12.40 Part 3 

Moderators: S. Deger, Ostfildern (DE) 

O. Demirkesen, Istanbul (TR) 

11.45 - 12.00 The posterior urethral complications of the treatment of prostate cancer 


12.00 - 12.15 Endoscopic management of vesicourethral anasthomosis contracture? York-Mason procedure with buccal 

mucosa for a recto urinary fistula 

V. Pansadoro, Rome (IT) 


12.25 - 12.40 A tribute to Edoardo Austoni, the urologist; a man; our friend 

V. Pansadoro, Rome (IT)

12.40 - 14.00 Part 4 

Moderators: D.E. Andrich, London (GB) 


12.40 - 13.00 Grafts in urethral reconstruction: Which grafts? How to harvest? 

N. Lumen, Ghent (BE) 

13.00 - 13.20 Penile skin replacement with reversed mesh graft 

P. Hoebeke, Ghent (BE) 

13.20 - 13.40 First results of the urethroplasty with tissue engineered buccal mucosa 

R. Dahlem, Hamburg (DE) 

13.40 - 13.55 Buccal mucosa after radiation therapy? 

S. Ahyai, Hamburg (DE) 

13.55 - 14.00 ESGURS activities 2013-2014 

S. Deger, Ostfildern (DE) 


We want to share new developments in grafts for urethral reconstruction and go for an interesting debate on 

dorsal versus ventral grafting. Penile surgery for IPP will be another interesting part. Facing complications 

for radical prostatectomy can always be challenging. Options and tips will be presented from experts. 


111 

Saturday

Saturday 




13.00 - 14.00 Urology in Italian art 

Green Hall 1 - Level N1 

Chair: D. Schultheiss, Giessen (DE) 

13.00 - 13.20 State-of-the-art-lecture Castrati singers and the birth of opera 

M. Hatzinger, Frankfurt (DE) 

13.20 - 13.40 State-of-the-art-lecture Urological aspects in the anatomical work of Leonardo da Vinci 


13.40 - 14.00 State-of-the-art-lecture The phallus in Italian art 

J. Mattelaer, Kortrijk (BE)



14.15 - 15.45 LESS & NOTES 



Chairs: H-P. Beerlage, ‘s-Hertogenbosch (NL) 


All presentations have a maximum length of 10 minutes, followed by 4 minutes of discussion. 

V1 Clampless laparoendoscopic single-site partial nephrectomy for renal cancer with low PADUA score: 

Technique and surgical outcomes 

F. Greco, D. Veneziano, C. Springer, A. Inferrera, P. Fornara (Halle Saale, Germany) 

V2 Robotic transrectal hybrid NOTES nephrectomy: Initial experience in a cadaver model 

R. Eyraud, H. Laydner, R. Autorino, S. Hillyer, J.A. Long, K. Panumatrassamee, A. Khalifeh, R. Stein, 

G.P. Haber, J. Kaouk (Cleveland, United States of America) 

V3 First clinical application: Transvaginal hybrid NOTES robotic donor nephrectomy 

R. Autorino, A. Khalifeh, H. Laydner, S. Hillyer, D. Samarasekera, K. Panumatrassamee, H. Goldman, 

C. Modlin, J. Kaouk (Cleveland, United States of America) 

V4 Hybrid transvaginal nephrectomy: Development of our technique 

I. Georgiopoulos, P. Kallidonis, I. Kyriazis, J-U. Stolzenburg, E. Liatsikos (Patras, Greece; Leipzig, Germany) 

V5 Umbilical laparoendoscopic radical nephrectomy (LESS-RN) with KeyPort system and duo-rotate 

instruments 

P.M. Cabrera, F. Caceres, E. Mateo, J.M. Garcia-Mediero, F. Lista, J.C. Angulo (Madrid, Spain) 

V6 Laparo-endoscopic single site transvesical bladder cuff excision 

R. Sotelo Noguera, G. Fernandez, J. Arriaga, O. Carmona, R. De Andrade, C. Giedelman, Z. Pascal, B. Irwin, 

A. Monish, M. Desai, I. Gill, J. Saavedra (Caracas, Venezuela; Los Angeles, United States of America) 

V7 Umbilical radical nephroureterectomy, bladder cuff excision and lymphadenectomy with KeyPort system in 

a case of upper urinary tract urothelial cancer 

F. Caceres, P. Cabrera, A. García-Tello, G. Andres, E. Mateo, J.C. Angulo (Madrid, Spain) 

V8 Laparoendoscopic radical cystectomy with orthotopic ileal neobladder through umbilical single port 

F. Caceres, P.M. Cabrera, A. Garcia-Tello, I. Arance, I. Romero, J.C. Angulo (Madrid, Spain) 

V9 LESS partial cystectomy with extended pelvic lymph node dissection for invasive bladder cancer in a 

diverticulum 

P.M. Cabrera, F. Caceres, F. Ramon De Fata, A. Garcia-Tello, H. Gimbernat, J.C. Angulo (Madrid, Spain) 


113 

Saturday

Saturday 




14.15 - 15.45 New therapies in castration resistant prostate cancer 



Chairs: T.A. Borkowski, Warsaw (PL) 





* 97 Updated interim analysis (IA): Results of randomized phase 3 study COU-AA-302 of abiraterone acetate 

(AA) in metastatic castration-resistant prostate cancer (mCRPC) patients (pts) without prior chemotherapy 

H. Van Poppel, D. Rathkopf, M.R. Smith, J.S. De Bono, C.J. Logothetis, N.D. Shore, P. De Souza, K. Fizazi, 

P.F.A. Mulders, P. Mainwaring, J.D. Hainsworth, T.M. Beer, S. North, Y. Fradet, T. Griffin, Y.C. Park, T. Kheoh, 

E.J. Small, H.I. Scher, A. Molina, C.J. Ryan (Leuven, Belgium; New York, Boston, Houston, Myrtle Beach, 

Nashville, Portland, Los Angeles, Raritan, San Francisco, United States of America; Sutton, United Kingdom; 

Liverpool, Brisbane, Australia; Villejuif, France; Nijmegen, The Netherlands; Edmonton, Quebec, Canada) 

* 98 Combination therapy of peptide vaccines and dexamethasone for chemotherapy naïve castration resistant 

prostate cancer - a randomized phase-2 study 

H. Uemura, T. Kimura, K. Yoshimura, T. Minami, M. Nozawa, T. Nakagawa, H. Fujimoto, S. Egawa, 

A. Yamada, K. Itoh (Osaka, Tokyo, Fukuoka, Japan) 

99 The impact of bone metastases on pain: Results from a phase III denosumab study in men with 

nonmetastatic castration-resistant prostate cancer 

D. Patrick, M.R. Smith, C. Cleeland, L. Fallowfield, B. Tombal, S. Oudard, N. Shore, F. Saad, G. Marx, 

R. Coleman, F. Gómez-Veiga, R. Damião, Y. Zhou, J. Arellano, A. Braun, Y. Qian (Seattle, Boston, Houston, 

Myrtle Beach, Thousand Oaks, United States of America; Brighton, Sheffield, United Kingdom; Brussels, 

Belgium; Paris, France; Montreal, Canada; Wahroonga, Australia; A Coruna, Spain; Rio de Janeiro, Brazil) 

100 Investigational single agent orteronel (ortl, TAK-700) in patients with nonmetastatic castration-resistant 

prostate cancer (nmCRPC): Updated results 

M. Hussain, P.G. Corn, D. Michaelson, H.J. Hammers, J.J. Alumkal, C.J. Ryan, J.Y. Bruce, S. Moran, 

D. Maclean, S-Y. Lee, P. Mortimer, D.J. George (Ann Arbor, Houston, Boston, Baltimore, Portland, San 

Francisco, Madison, Cambridge, Durham, United States of America; London, United Kingdom) 

101 Updated analysis of radium-223 dichloride (Ra-223) impact on pain, skeletal-related events (SRE), and 

survival from the phase 3 randomized trial (ALSYMPCA) in patients with castration-resistant prostate 

cancer (CRPC) and bone metastases 

D. Heinrich, S.I. Helle, A. Chodacki, P. Wiechno, J. Garcia-Vargas, K. Staudacher, C. Parker (Lørenskog, 

Bergen, Oslo, Norway; Chomutov, Czech Republic; Warsaw, Poland; Montville, New Jersey, United States of 

America; Sutton, United Kingdom) 

102 GTx-758, an ERα agonist, reduces serum free testosterone lower than can be achieved by leuprolide with 

a significantly lower rate of hot flashes in men with advanced prostate cancer 

R.H. Getzenberg, C.C. Coss, M.L. Hancock, J.T. Dalton, M.S. Steiner (Memphis, United States of America) 

103 P10-1 open-label, multicenter study of sipuleucel-T in metastatic castrate-resistant prostate cancer 

(mCRPC) patients (pts) previously treated with sipuleucel-T: Evaluation of antigen-presenting cell (APC) 

activation and cellular immune response data 

T.M. Beer, J. Corman, R. Sims, Y. Wang, C. De La Rosa, N. Sheikh (Portland, Seattle, United States of 

America)

104 Overall survival with cabazitaxel is strongly related to PSA response: Results of a retrospective registry in 

metastatic castration resistant prostate cancer (mCRPC) 

A. Angelergues, F. Mercier, A. Flechon, A. Guillot, S. Le Moulec, G. Gravis, P. Beuzeboc, C. Massard, 

K. Fizazi, T. De La Motte Rouge, R. Elaidi, S. Oudard (Paris, Port-Mort, Lyon, St-Etienne, Marseille, Villejuif, 

France) 

105 Exploratory analysis of the visceral disease patient subset in COU-AA-301, a phase III study of abiraterone 

acetate (AA) in metastatic castration-resistant prostate cancer (mCRPC) 

H. Suttmann, P.F.A. Mulders, A. Molina, O.B. Goodman, Jr., T.W. Flaig, J. Li, T. Kheoh, J.S. De Bono, H.I. Scher 

(Hamburg, Germany; Nijmegen, The Netherlands; Los Angeles, Las Vegas, Aurora, Raritan, New York, 

United States of America; Sutton, United Kingdom) 

106 Cabazitaxel adverse events are manageable in senior adults with metastatic castration-resistant prostate 

cancer (mCRPC): Results of the European Compassionate Use Programme 

A. Heidenreich, S. Bracarda, M. Mason, H. Ozen, L. Sengelov, W. Gerritsen, C. Papandreou, S. Fossa, 

S. Hitier, M. Climent (Aachen, Germany; Arezzo, Italy; Wales, United Kingdom; Ankara, Turkey; Herlev, 

Denmark; Nijmegen, The Netherlands; Larissa, Greece; Olso, Norway; Paris, France; Valencia, Spain) 

107 Evaluation of circulating tumor cells to predict metastatic progression in men treated with abirateron 

acetat for castration resistant prostate cancer: A sub-analysis of the German named patient program 

T. Steuber, P. Stroelin, T. Schlomm, H. Heinzer, K. Pantel, S. Riethdorf (Hamburg, Germany) 

108 Denosumab in men with non-metastatic castration-resistant prostate cancer (CRPC) and PSA doubling time 

(PSADT) ≤6 months 

K. Miller, M.R. Smith, D. Dearnaley, L. Dogliotti, B. Egerdie, K. Fizazi, F. Kueppers, L. Montes De Oca, 

J. Morote, I. Pavlik, P. Sieber, T.L. Tammela, H. Van Poppel, M. Wirth, S. Wong, Z. Ye, A. Braun (Berlin, 

Dresden, Germany; Boston, Lancaster, Thousand Oaks, United States of America; Sutton, United Kingdom; 

Orbassano, Italy; Kitchener, Canada; Villejuif, France; Christchurch, New Zealand; Buenos Aires, Argentina; 

Barcelona, Spain; Prague, Czech Republic; Tampere, Finland; Leuven, Belgium; Footscray, Australia) 


115 

Saturday

Saturday 




14.15 - 15.45 Pelvic organ prolapse: From bench to bedside 



Chairs: V. Gomez Dos Santos, Madrid (ES) 

F. Haab, Paris (FR) 




* 109 In vivo assessment of the acute host response against a novel tissue engineered to treat stress urinary 

incontinence and pelvic organ prolapse 

S. Roman, N. Osman, A.J. Bullock, C.R. Chapple, S. Macneil (Sheffield, United Kingdom) 

110 Development of tissue engineered bio-absorbable cellularised mesh for stress urinary incontinence and 

pelvic organ prolapse: The effect of chemical and mechanical stimulation on improving tensile properties 

N. Osman, S. Roman, G. Gigliobianco, A. Bullock, C. Chapple, S. Macneil (Sheffield, United Kingdom) 

111 A novel technique for anterior vaginal wall prolapse repair; anterior vaginal wall darn (AVWD) 

O. Köse, H.S. Saglam, S. Kumsar, S. Budak, Ö. Adsan (Sakarya, Turkey) 

112 Impact of laparoscopic sacrocolpopexy: A multicentric prospective analysis 

F.J.P. Thibault, L. Wagner, R. Thanigasalam, G. Seni, M. Brouzyine, L. Cayzergues, R. De Tayrac, S. Droupy, 

P. Costa (Vandoeuvre Les Nancy, Nîmes, Paris, La Talaudière, France) 

113 A.M.I. pelvic floor repair system. A novel system for full reconstruction of complex pelvic floor prolapse 

E.A. Fes Ascanio, D. Alonso Rodriguez, L. Fernandez Barranco, T. Vicens Vicens, F. Garcia Montes (Palma de 

Mallorca, Spain) 

114 Quality of life after an anterior vaginal wall suspension procedure to correct urinary incontinence with 

concomitant anterior compartment prolapse based on type of incontinence at baseline 

P. Zimmern, C. Bascu, B.E. Dillon, D. Lee, A. Christie, X-J. Xie (Dallas, United States of America) 

* 115 Risk factors associated with perioperative and mesh-related complications for patients undergoing pelvic 

organ prolapse surgery: Analysis of 677 cases 

G.R. Kasyan, K.N. Abramyan, A.A. Popov, D.Y. Pushkar (Moscow, Russia) 

116 Impact of midurethral sling procedure on couple’s sexual function 

P.H. Song, J.W. Choi, Y.S. Ji, Y.H. Ko, K.H. Moon, H.C. Jung (Daegu, South Korea) 

117 Evaluation of sexual functions in females receiving renal replacement therapies 

R. Demir, Y. Bostanci, F. Atac, E. Ozden, C. Kaya, S. Sarikaya, Y.K. Yakupoglu (Samsun, Turkey) 

118 Withdrawn 

119 Utilization and peri-operative outcomes of robot-assisted and open vaginal vault suspension 

H. Li, J.D. Sammon, M. Ehlert, K.R. Ghani, S. Sukumar, H. Atiemo, M. Menon (Detroit, United States of 

America) 

Discussion on robotics, is it the future? 

F. Haab, Paris (FR)



14.15 - 15.45 Men’s sexual health 



Chairs: I. Gruenwald, Haifa (IL) 

Y. Reisman, Amstelveen (NL) 




* 120 The risk of developing erectile dysfunction increases successively with increasing age: A longitudinal study 

in men aged 45 years and above 

C.J. Stranne, U.G.H. Malmsten, B. Areskoug, I. Milsom, U. Molander, R. Peeker (Gothenburg, Sweden) 

121 Expectations for sexual life after radical prostatectomy: Dissociation between patients and partners 

Y. Sato, H. Tanda, H. Nakajima, T. Nitta, K. Akagashi, T. Hanzawa, M. Tobe, K. Haga, K. Uchida, I. Honma 

(Sapporo, Japan) 

122 Treatment effect of PDE5-inhibitors may improve with time following radical prostatectomy 

M. Fode, J. Sønksen, H. Jakobsen (Herlev, Denmark) 

123 Withdrawn 

124 Serum C-reactive protein levels and response rate to tadalafil 5 mg once daily in erectile dysfunction 

patients with diabetes 

H.J. Park, N.C. Park, S.M. Kang (Busan, South Korea) 

125 Prospective evaluation of the systemic mistakes in oral intake of the phosphodiesterase inhibitors ten 

years after their release 

B. García Gómez, J. Romero Otero, E. Jiménez Alcaide, L. García González, E. García Cruz, A. Leibar Tamayo, 

A. Rodríguez Antolín (Madrid, Spain) 

126 The frequencies and characteristics of men receiving medical intervention for erectile dysfunction: Analysis 

of 6.2 million patients 

O. Cakir, H. Aurora, T. Helfand, T. McVary (Chicago, Evanston, United States of America) 

127 Erectile function after nerve-sparing radical prostatectomy: Concepts for rehabilitation in Germany 

A. Bannowsky, S. Ückert, N. Mosaheb, A. Raileanu, H. Van Ahlen (Osnabrück, Hanover, Germany) 

128 The correlation between obstructive sleep apnea syndrome and erectile dysfunction 

H. Tokgoz, E. Akyurek, T. Ornek, R. Altin, B. Akduman, N.A. Mungan (Zonguldak, Turkey) 

129 Penile prosthesis insertion in patients with refractory ischemic priapism: Immediate versus delayed 

implantation 

E. Zacharakis, G. Garaffa, A.A. Raheem, A. Muneer, N. Christopher, S. Minhas, D. Ralph (London, United 

Kingdom) 

130 Does psychosexual counselling significantly influence organic and erotic functions after penile prosthesis 

implantation? Preliminary results of a two-arm controlled trial 

F. Pisano, C. Fiorito, F. Soria, A.M. Abbona, F. Peraldo, P. Gontero (Turin, Italy) 


117 

Saturday

Saturday 

131 Mid-term analysis (6 months) of the effect of penile low intensity shock-wave therapy for ED patients with 

varying etiology and severity 

B. Appel, I. Gruenwald, Y. Vardi (Haifa, Israel) 

132 Cavernous vein leakage: Diagnosis with 3D CT cavernosography reveals promising treatment by DVC 

bunching 

Y. Kawanishi, R. Tomida, H. Mori, T. Nakashima, H. Yamamoto, M. Yamanaka, H. Muguruma, S. Kawanishi 

(Takamatsu, Japan) 




14.15 - 15.45 Diagnostics in early prostate cancer 



Chairs: A. Govorov, Moscow (RU) 

A. Villers, Lille (FR) 




133 PSA-pyramid in men with low range PSA: PCa incidence and mortality - a plea for risk-based prostate 

cancer screening strategy in the European Randomized study of Screening for Prostate Cancer (ERSPC), 

Aarau 

M. Randazzo, D Seiler, J. Beatrice, M. Baumgartner, A. Huber, R. Grobholz, L. Manka, F. Recker, 

M. Kwiatkowski (Aarau, Switzerland; Braunschweig, Germany) 

134 Withdrawn 

135 Psychological impact of PSA testing and biopsy using the impact of event scale 

E.T. Kok, E.L. Turner, M.J. Davis, C. Metcalfe, J.A. Lane, D.E. Neal, F.C. Hamdy, J.L. Donovan (Utrecht, The 

Netherlands; Bristol, Cambridge, Oxford, United Kingdom) 

136 A randomized multicenter trial comparing 12 to 20-core prostate biopsy protocol 

J. Irani, P. Blanchet, L. Salomon, P. Coloby, J. Hubert, B. Malavaud, N. Mottet (Poitiers, Guadeloupe, Creteil, 

Pontoise, Nancy, Toulouse, Saint-Etienne, France) 

137 PHI (Prostate Health Index) and %p2PSA for prediction of prostate cancer in men younger than 60 years of 

age. A nested-case control study from PROpsa Multicentric European Study (PROMEtheuS project) 

T. McNicholas, M. Lazzeri, A. Haese, A. De La Taille, J. Palou, G. Lughezzani, V. Scattoni, G. Lista, A. Larcher, 

A. Cestari, N. Buffi, M. Freschi, L. Fowler, J.W. Roux, A. Renter, M. Graefen, P.O. Bosset, P. Le Corvoisier, 

A. Breda, P. De La Torre, V. Bini, G. Guazzoni (Stevenage, United Kingdom; Milan, Perugia, Italy; Hamburg, 

Germany; Creteil, France; Barcelona, Spain) 

* 138 Standards in reporting of MRI-targeted prostate biopsies (START): Recommendations from an international 

working party 

V. Kasivisvanathan, C.M. Moore, S. Eggener, M. Emberton, J.F. Futterer, I. Gill, R. Grubb, B. Hadaschik, 

L. Klotz, D. Margolis, L. Marks, J. Melamed, A. Oto, S. Palmer, P. Pinto, P. Pueche, S. Punwani, 

A. Rosenkrantz, I. Shoots, R. Simon, S. Taneja, B. Turkbey, O. Ukimura, J. Van Der Meulen, A. Villers, 

Y. Watanabe (London, Chicago, United Kingdom; Nijmegen, Rotterdam, The Netherlands; Los Angeles, 

St Louis, New York, Chicago, Bethesda, United States of America; Heidelberg, Germany; Toronto, Canada; 

Lille, France; Kurashiki, Japan) 

139 Reducing unnecessary biopsies for suspicion of prostate cancer: Extension and validation of an ERSPC 

based risk calculator with Phi 

M.J. Roobol, D. Nieboer, A. Houlgatte, S. Vincendeau, M. Lazzeri, G. Guazzoni, C. Stephan, A. Semjonow, 

A. Haese, M. Graefen, E.W. Steyerberg (Rotterdam, The Netherlands; Paris, Rennes, France; Milan, Italy; 

Berlin, Munster, Hamburg, Germany) 

140 Diabetes mellitus increases the risk of poorly differentiated tumor in prostate cancer patients 

A. Nini, M. Sun, P.I. Karakiewicz, M. Bianchi, N.M. Passoni, A. Salonia, A. Galllina, F. Castiglione, N. Fossati, 

R. Matloob, G. La Croce, F. Abdollah (Milan, Italy; Montreal, Canada) 


119 

Saturday

Saturday 

141 Pre-biopsy magnetic resonance imaging and prostate cancer detection: Comparison of random and MRItargeted 

biopsies using three different techniques of MRI-TRUS image registration 

N. Barry Delongchamps, M. Peyromaure, A. Schull, F. Beuvon, N. Bouazza, T. Flam, M. Zerbib, P. Legman, 

F. Cornud (Paris, France) 

* 142 Performance of MRI-TRUS fusion in transperineal template prostate re-biopsy 

S.Y.W. Tang, E.M. Lawrence, B. Koo, A.W. Nelson, K. Wadhwa, T. Barrett, A. Warren, R. Axell, A. Doble, 

F.A. Gallagher, V.J. Gnanapragasam, E. Sala, C. Kastner (Cambridge, United Kingdom) 

143 An evaluation of Real-Time-Elastography (RTE): Its detection rate of prostate cancer compared to multiple 

core biopsies and its dependance of PSA and the volume of the prostate 

O. Lenherr, A. Fayyazi, P. Liske, S. Lahme (Pforzheim, Germany) 


Summary - How reliable is imaging for screening 

A. Villers, Lille (FR)



14.15 - 15.45 Bladder cancer: Gene expression and molecular classification 



Chairs: P.J. Boström, Turku (FI) 




144 Bortezomib synergizes with vorinostat to cause ubiquitinated protein accumulation and histone acetylation 

in bladder cancer cells 


145 Whole transcriptome sequencing reveals dynamic changes in gene expression of progressive, lethal 


N. Sapre, G. Macintyre, J. Pedersen, A. Ryan, A. Kowalczyk, P. Anderson, A.J. Costello, N.M. Corcoran, 

C.M. Hovens (Melbourne, Australia) 

146 Cell membrane glycosphingolipids are involved in the control of bladder cancer invasive properties 

A. Bettiga, M. Aureli, G. Colciago, D. Canals, M. Moschini, P. Hedlund, S. Sonnino, Y.A. Hannon, F. Benigni 

(Milan, Italy; Charleston, South Carolina, United States of America) 

147 In vitro cell viability and proliferation of electrospun scaffold made of PCL and PHBV for tissue engineered 

urinary diversions 

A. Vianello, A. Giannantoni, V. Maulà, C. Del Gaudio, A. Bianco, G. Bellezza, M. Porena (Perugia, Rome, 

Italy) 

148 B-cell translocation gene 2: A tumor suppressor gene is upregulated by resveratrol in bladder carcinoma 

cells 

H-H. Juang, P-L. Chang, K-H. Tsui (Kwei-Shan, Tao-Yuan, Taiwan) 

149 CIP2A is associated with human bladder cancer aggressivity 

Y. Xue, X. Zou, B. Jiang, G. Zhang, Y. Liao, G. Wu, X. Wang, F. Liu, J. Yang, H. Xu, M. Liu (Ganzhou, China) 

150 High expression of HuR in cytoplasm, but not nuclei, associated with malignant aggressiveness and 

prognosis in non-muscle invasive bladder cancer 

Y. Miyata, K. Ohba, T. Matsuo, K. Mitsunari, Y. Sagara, H. Sakai (Nagasaki, Japan) 

151 Association of the expression of T-cell coregulatory proteins with clinical outcomes in patients with 

urothelial carcinoma of the bladder 

E.N. Xylinas, B.D. Robinson, L.A. Kluth, G. Volkmer, R. Hautmann, R. Kufer, M. Zerbib, E. Kwon, 

H. Thompson, S.A. Boorjian, S.F. Shariat (New York, Rochester, United States of America; Kassel, Ulm, 

Göppingen, Germany; Paris, France) 

152 Targeting DNA repair mechanisms increases efficiency of intravesical chemotherapy in an orthotopic rat 

bladder cancer model 

C.J. Arum, O.A. Gederaas, S. Bachke, T. Viset, M. Otterlei (Trondheim, Norway) 

153 The effect of photochemical internalization of bleomycin in the treatment of urothelial carcinoma of the 

bladder: An in vitro study 

H.C. Arentsen, J. Falke, A. Høgset, E. Oosterwijk, J.A. Witjes (Nijmegen, The Netherlands; Oslo, Norway) 


121 

Saturday

Saturday 

154 MAC387 positive tumor-associated macrophage count is an independent predictor of poor survival after 

radical cystectomy for urothelial bladder cancer 

M.M. Boström, P.J. Boström, H. Irjala, T. Mirtti, P. Taimen, S. Jalkanen (Turku, Finland) 

155 The expression of the receptor of hyaluronan mediated motility (RHAMM) is associated with reduced 

disease-specific survival in patients with bladder cancer 

C. Niedworok, I. Kretschmer, F. Vom Dorp, T. Szarvas, J. Heß, T. Freudenberger, A. Melchior-Becker, 

J.W. Fischer, H. Rübben (Essen, Düsseldorf, Germany) 

156 Prediction and reversibility of cisplatin-resistance in bladder cancer: HOXA9 a novel epigenetic biomarker 

E.N. Xylinas, T. Clozel, D. Zhuang, J.J. Crivelli, L.A. Kluth, B.D. Robinson, D.S. Scherr, O. Elemento, 

S.F. Shariat (New York, United States of America) 

157 Differential expression of Oct4 variants in urothelial cancer 

F. Wezel, J. Pearson, L. Kirkwood, J. Southgate (York, United Kingdom) 




14.15 - 15.45 Urological infection innovations 



Chairs: M. Chrisofos, Athens (GR) 





158 Socioeconomic trends and utilization in the emergency department treatment of urinary tract infections 

J.D. Sammon, K.R. Ghani, S. Sukumar, J.O. Peabody, M. Menon, Q-D. Trinh (Detroit, United States of 

America) 

159 The etiology of recurrent urinary tract infections in women and relation with recurrence rate 

M. Kolesnyk, N. Stepanova, V. Kruglikov, L. Lebid, O. Romanenko (Kiev, Ukraine) 

* 160 Risk factors analysis in patients with chronic prostatitis/chronic pelvic pain syndrome (CP/CPPS) from 

Finland, Germany, Italy and Switzerland: Results of a multinational observational study 

F.M.E. Wagenlehner, M. Spangenberg, V. Magri, A. Mehik, W. Hochreiter, H. Bödecker, W. Weidner, 

G. Perletti (Giessen, Germany; Milan, Busto A./Varese, Italy; Oulu, Finland; Aarau, Switzerland) 

161 A pilot study of the ageing urinary microbiome 

J.P. Williams, D. Lewis, R. Brown, J.R. Marchesi, M.J. Drake (Bristol, United Kingdom) 

162 The influence of urinary pH on ciprofloxacin efficacy against bacterial uropathogen biofilms 

L. Yang, K. Wang, H. Li, H.S. Chen, J. Denstedt, P. Cadieux (Chengdu, China; London, Canada) 

163 Risk factors for systemic inflammatory response syndrome following percutaneous nephrolithotomy 

T. Erdil, Y. Bostanci, E. Ozden, F. Atac, Y.K. Yakupoglu, A.F. Yilmaz, S. Sarikaya (Samsun, Turkey) 

164 Withdrawn 

165 Excellent control of infective complications after transrectal prostate biopsy with cephalosporin-based 

prophylactic antibiotics and the simple use of suppository-type povidone-iodine 

O. Jong Jin, D.S. Park, J.H. Hwang, Y.K. Hong, S.J. Park (Seongnam, Seoul, South Korea) 

166 Biofilm producing bacteria and chronic bacterial prostatitis: Results from a longitudinal cohort study 

R. Bartoletti, T. Cai, C. D’Elia, N. Mondaini, G. Nesi, S. Mazzoli, K. Naber (Florence, Trento, Italy; Munich, 

Germany) 

167 Application of isothermal microcalorimetry for rapid mycobacterial detection and anti-tuberculosis drug 

susceptibility testing - implication for urogenital tuberculosis and other mycobacterial infections 

G. Bonkat, A. Solokhina, M. Rieken, G. Müller, S. Wyler, T. Gasser, A. Bachmann (Basel, Switzerland) 

* 168 Influence of time course antibiotic administration on growth and biofilm formation from bacteria related to 

urinary tract infections in women 

L. Gandee, J.T. Hsieh, V. Sperandio, C. Moreira, P. Zimmern (Dallas, United States of America) 


123 

Saturday

Saturday 

169 Spectrum and antibiotic resistance dynamics of uropathogens isolated from children and adolescents with 

community-acquired urinary tract infections in Russia: 2000 - 2011 

I. Palagin, M. Sukhorukova, M. Edelstein, R. Kozlov, A. Shevelev, T. Perepanova, A. Grinyov, A. Dekhnich 

(Smolensk, Moscow, Russia) 




14.15 - 15.45 Partial nephrectomy and surveillance: Surveys and comparisons 



Chairs: J.J. Patard, Le Kremin Bicetre (FR) 

D. Rengifo Abbad, Madrid (ES) 




170 National survey on the use of partial nephrectomy in France. Data from the multicenter prospective 

NEPHRON study 

J-C. Bernhard, G. Pignot, H. Lang, P. Bigot, M. Crepel, J. Rigaud, L. Bellec, P. Gimel, L. Zini, L. Salomon, 

C. Vaessen, J. Berger, F. Bruyere, X. Martin, M. Zerbib, M. Rouprêt, F. Salome, J-L. Jung, J. Hubert, C. Pfister, 

N. Mottet, H. Baumert, A. Mejean, J-J. Patard (Bordeaux, Le Kremlin Bicetre, Strasbourg, Angers, Rennes, 

Toulouse, Cabestany, Lille, Creteil, Paris, Limoges, Tours, Lyon, Colmar, Nancy, Rouen, Saint-Etienne, France) 

171 Partial nephrectomy (PN): Complications and warm ischemia time in a French multicentre study 

H. Baumert, N. Korahanis, R. Thanigasalam, A. Mejean, J.M. Lang, J.C. Bernhard, G. Pignot, L. Zini, 

M. Crepel, J. Rigaud, L. Salomon, L. Bellec, C. Vaessen, M. Rouprêt, J.L. Jung, E. Mourey, X. Martin, P. Bigot, 

F. Bruyere, J. Berger, J.P. Ansieau, P. Gimel, F. Salome, J. Hubert, C. Pfister, F. Trifard, J.J. Patard (Paris, 

Strasbourg, Bordeaux, Lille, Reims, Nantes, Creteil, Toulouse, Colmar, Dijon, Lyon, Angers, Tours, Limoges, 

Mulhouse, Cabestany, Vandoeuvre Les Nancy, Rouen, Saint-Brieuc, France) 

* 172 Simple enucleation versus standard partial nephrectomy for clinical T1 renal tumors: Intraoperative, early 

post-operative and pathological outcomes from a prospective multicenter comparative study (RECORd 

Project) 

P. Verze, F. Fusco, A. Minervini, A. Antonelli, G. Bianchi, A. Bocciardi, S. Cosciani Cunico, V. Ficarra, C. Fiori, 

S. Giancane, N. Longo, G. Martorana, G. Novara, F. Porpiglia, F. Rocco, B. Rovereto, R. Schiavina, S. Serni, 

C. Simeone, A. Volpe, M. Carini (Naples, Florence, Brescia, Modena, Pavia, Padua, Bologna, Turin, Milan, 

Novara, Italy) 

173 Renal and cardiovascular morbidity after partial or radical nephrectomy in patients with kidney tumors up 

to 7 centimeters: Implications on overall mortality 

M. Roscigno, R. Naspro, U. Capitanio, R. Matloob, C. Carenzi, E. Di Trapani, F. Ceresoli, M. Nicolai, 

G. Deiana, P. Rigatti, F. Montorsi, L.F. Da Pozzo, R. Bertini (Bergamo, Milan, Italy) 

174 Active surveillance of small renal masses: First Italian prospective study 

A. Volpe, S. Munegato, L. Zegna, A. Di Domenico, P. De Angelis, P. Mondino, C. Terrone (Novara, Italy) 

175 A treatment delay in surgical intervention for elderly patients with small renal masses does not impact 

oncological outcomes 

A. Becker, A. Abdo, M. Meskawi, F. Roghmann, Z. Tian, H. Lavigueur-Blouin, M. Sun (Montreal, Canada; 

Herne, Germany) 

176 Partial nephrectomy: Is there a “center effect”? 

J-P. Couapel, J-C. Bernhard, G. Pignot, L. Zini, H. Lang, J. Rigaud, L. Salomon, L. Bellec, M. Soulié, 

C. Vaessen, M. Rouprêt, J-L. Jung, E. Mourey, P. Bigot, F. Bruyère, J. Berger, J-P. Ansieau, P. Gimel, 

F. Salome, J. Hubert, C. Pfister, H. Baumert, A. Méjean, J.J. Patard, K. Bensalah (Rennes, Bordeaux, Paris, 

Lille, Strasbourg, Nantes, Creteil, Toulouse, Colmar, Dijon, Angers, Tours, Limoges, Mulhouse, Cabestany, 

Vandoeuvre-Lès-Nancy, Rouen, France) 


125 

Saturday

Saturday 

177 Analysis of Fuhrman grade according to the anatomic location in clinical stage T1 clear cell renal cell 

carcinoma 

W.S. Ham, T.Y. Shin, J. Kim, K.H. Rha, S.C. Yang, S.J. Hong, Y.D. Choi, S.Y. Park (Seoul, South Korea) 

* 178 A postoperative morbidity assessment amongst elderly T1 renal cell carcinoma individuals: Comparison 

between laparoscopic radical nephrectomy vs partial nephrectomy 

A. Becker, F. Roghmann, Z. Tian, M. Meskawi, A. Abdo, P.I. Karakiewicz, M. Sun (Montreal, Canada; Herne, 

Germany) 

* 179 Nephrectomy versus active surveillance for small renal masses: Cancer-specific mortality and competingrisks 

of death 

M. Sun, H. Lavigueur-Blouin, F. Abdollah, Q-D. Trinh (Montreal, Canada; Milan, Italy) 


Discussion on posters 178 & 179 

J.J. Patard, Le Kremin Bicetre (FR)



16.00 - 17.30 Improving minimally invasive radical prostatectomy 



Chairs: I.J. De Jong, Groningen (NL) 

R.J.A. Van Moorselaar, Amsterdam (NL) 


V10 Nuances in nerve sparing during RARP 

C. Giedelman, H. Abdul Muhsin, O. Schatloff, S. Chauhan, A. Sivaraman, R. Coelho, B. Rocco, S. Samavedi, 

K. Palmer, V. Patel (Celebration, United States of America) 

V11 Robotic extended “modified” lymph node dissection during radical prostatectomy: Points of technique 

F. Porpiglia, I. Morra, M. Poggio, S. Grande, F. Mele, M. Manfredi, D. Garrou, R. Bertolo, M. Lucci Chiarissi, 

C. Fiori (Orbassano, Italy) 

V12 Novel tissue simulator for robotic assisted radical prostatectomy: Face, content, and construct validation 

and stepwise instructions for creation 

M. Alemozaffar, R. Narayanan, A. Percy, B. Minnillo, K. Matthes, A. Wagner (Los Angeles, Boston, United 

States of America) 

V13 Use of the prostatic vasculature for refining nerve sparing during robot assisted radical prostatectomy 

O. Schatloff, S. Samavedi, H. Abdul-Muhsin, K. Palmer, V. Patel (Celebration, United States of America) 

V14 Bimanual examination of retrieved specimen and selective hypothermia during robot-assisted radical 

prostatectomy 

W. Jeong, K.R. Ghani, A. Sood, R.K. Kumar, S. Dusik, N.S. Gupta, P. Dasgupta, C.G. Rogers, J.O. Peabody, 

M. Menon (Detroit, United States of America; London, United Kingdom) 

V15 Technical challenges of salvage robotic assisted radical prostatectomy 

A.E. El Hajj, A. De Fourmestraux, J. Rode, D. Vordos, A. Hoznek, L. Salomon, C.C. Abbou, A. De La Taille 

(Creteil, France) 

V16 Failure analysis and management of iatrogenic injuries occurring during robot assisted radical 

prostatectomy 

M. Addali, V. Zugor, A. Abdulhak, S. Poth, A. Schütte, C. Wagner, J.H. Witt (Gronau (Westfalen), Germany) 

V17 Intrafascial nerve-sparing endoscopic extraperitoneal radical prostatectomy (nsEERPE) with 3-D 

visualisation 

J.U. Stolzenburg, M. Do, T. Haefner, A. Dietel, R.M. Long, E. Liatsikos, R. Ganzer, H. Qazi (Leipzig, 

Regensburg, Germany; Patras, Greece) 


127 

Saturday

Saturday 




16.00 - 17.30 Radical treatment of prostate cancer, beyond prostatectomy 



Chairs: A. Bossi, Villejuif (FR) 




180 Radical prostatectomy versus high intensity focused ultrasound: Oncological results of 723 patients treated 

between 2000 and 2005 in the same department 

S. Crouzet, J-M. Marechal, M. Colombel, R. Bouvier, F. Mege-Lechevallier, O. Rouviere, X. Martin, A. Gelet 

(Lyon, France) 

181 Can the findings of randomised clinical trials concerning the efficacy of prostate cancer therapy in men 

with early disease be replicated in national cancer registries? 

P. Cathcart, J. Van Der Meulen, M. Emberton (London, United Kingdom) 

182 Development and internal validation of a nomogram predicting biochemical recurrence after early salvage 

radiotherapy in prostate cancer patients treated with radical prostatectomy 

A. Briganti, M. Bianchi, S. Joniau, C. Cozzarini, B. Tombal, K. Haustermans, W. Hinkelbein, N. Di Muzio, 

N. Suardi, H. Van Poppel, T. Wiegel (Milan, Italy; Leuven, Brussels, Belgium; Ulm, Germany) 

183 Pelvic lymph-nodal irradiation improves biochemical relapse-free survival of node-negative patients 

treated with high-dose salvage radiotherapy after radical prostatectomy. A single-institute analysis of 206 

patients 

F. Zerbetto, C. Cozzarini, C. Fiorino, M. La Macchia, N.A. Iacovelli, A. Bolognesi, A. Chiara, A. Briganti, 

A. Gallina, P. Rigatti, N.G. Di Muzio (Milan, Italy) 

184 Factors predicting severe (Grade 3-4) late urinary toxicity after post-prostatectomy irradiation. A single 

institution analysis of 1151 patients treated with adjuvant or salvage radiotherapy with different radiation 

techniques and fractionations 

C. Cozzarini, C. Fiorino, A. Briganti, V. Carillo, C. Deantoni, M. La Macchia, B. Noris Chiorda, N. Suardi, 

F. Zerbetto, P. Rigatti, N.G. Di Muzio (Milan, Italy) 

185 Reliability and ideal cut-off of PSA doubling time in patients candidate to timely salvage radiotherapy for a 

biochemical recurrence after prostatectomy 

P. Rancoita, C. Cozzarini, F. Zerbetto, A. Briganti, F. Abdollah, A. Nonis, C. Deantoni, N.A. Iacovelli, P. Rigatti, 

C. Di Serio, N.G. Di Muzio (Milan, Italy) 

186 Indication and extension of pelvic lymph node dissection during robot-assisted radical prostatectomy. An 

analysis of 5 institutions 

N. Suardi, A. Haese, V. Ficarra, A. Govorov, N.M. Buffi, J. Walz, B. Rocco, M. Borghesi, A.Mottrie, T. Steuber, 

G. Guazzoni, D. Pushkar, H. Van Der Poel (Milan, Padua, Italy; Hamburg, Germany; Moscow, Russia; 

Marseille, France; Aalst, Belgium; Amsterdam, The Netherlands) 

187 A competing risks analysis of long term survival on node positive prostate cancer patients treated with 

radical prostatectomy 

F. Abdollah, R.J. Karnes, M. Bianchi, A. Gallina, G. La Croce, N.M. Passoni, C. Cozzarini, N. Di Muzio, 

R. Lucianò, M. Freschi, A. Salonia, P. Rigatti, A. Briganti (Milan, Italy; Rochester, United States of America)

188 Salvage lymph node dissection for patients treated with radical prostatectomy with biochemical recurrence 

and imaging-detected nodal metastases 

N. Suardi, J.R. Karnes, S. Joniau, K.A. Touijer, D. Osmonov, A. Aksenov, A. Briganti, P. Rigatti, H. Van 

Poppel, K.P. Jünemann (Milan, Italy; Rochester, New York, United States of America; Leuven, Belgium; Kiel, 

Germany) 

189 Is a fatal family history or the apparent mode of disease transmission of prostate cancer a prognostic 

factor for survival? 

K. Herkommer, E. Donel, J.E. Gschwend, M. Kron (Munich, Ulm, Germany) 

190 Radical prostate cancer therapy is associated with a survival benefit in the older man 

J. Cathcart, J. Van Der Meulen (London, United Kingdom) 

191 High-dose intensity-modulated arc radiotherapy for lymph node metastasized prostate cancer: Toxicity and 

early clinical outcome 

V. Fonteyne, N. Lumen, C. Van Praet, P. Ost, K. Decaestecker, G. De Meerleer (Ghent, Belgium) 

192 The 10-years follow-up of the ARO 96-02/AUO AP 09/95 trial on adjuvant radiotherapy (ART) versus waitand-see 

(WS) after prostatectomy for pT3 cancer – subgroup analysis 

T. Wiegel, D. Bottke, D. Bartkowiak, C. Bronner, U. Steiner, A. Siegmann, R. Golz, S. Störkel, N. Willich, 

A. Semjonow, M. Stöckle, C. Rübe, P. Althaus, U. Rebmann, T. Kälble, H.J. Feldmann, M. Wirth, A. Hinke, 

W. Hinkelbein, K. Miller (Ulm, Berlin, Wuppertal, Münster, Homburg Saar, Dessau, Fulda, Dresden, 

Langenfeld, Germany) 




129 

Saturday

Saturday 




16.00 - 17.30 Renal tumours: Basic research in prognostic markers 



Chairs: P.F.A. Mulders, Nijmegen (NL) 

S. Zastrow, Dresden (DE) 




* 193 High cytoplasmic and low nuclear expression of HIF-2α are associated with worse cancer specific survival 

(CSS) in clear cell renal cell carcinoma 

N. Kroeger, D.B. Seligson, S. Signoretti, H. Yu, F.D. Birkhäuser, C.E. Magyar, J. Huang, J. Riss, F.F. Kabbinavar, 

A.S. Belldegrun, A.J. Pantuck (Los Angeles and Greifswald, Los Angeles, Boston, United States of America) 

194 Identification of high risk patients with clear cell renal cell carcinoma based on interphase-FISH 

J. Sanjmyatav, S. Matthes, M. Mühr, D. Sava, M. Sternal, H. Wunderlich, M. Gajda, M-O. Grimm, K. Junker 

(Jena, Eisenach, Homburg, Germany) 

195 Prognostic significance of EpCAM expression in renal tumors: A clinicopathological study of 948 cases 

M. Maruschke, A. Zimpfer, S. Rehn, G. Kundt, A. Litzensberger, F. Dammert, H. Zettl, C. Stephan, 

A. Erbersdobler, O.W. Hakenberg (Rostock, Berlin, Germany) 

196 Prognostic significance of platelet derived growth factor-β receptor in localized clear cell renal cell 

carcinoma 

S. Park, M. Shim, D. Yoo, C. Song, B. Hong, J.H. Hong, C-S. Kim, H. Ahn (Seoul, South Korea) 

197 Aberrant glycosylation of N-glycan on immunoglobulin closely relates survival of the patients with renal 

cell carcinoma 

S. Hatakeyama, Y. Tobisawa, T. Yoneyama, K. Mori, T. Yoneyama, Y. Hashimoto, T. Koie, N. Tsuchiya, 

T. Habuchi, M. Amano, S-I. Nishimura, C. Ohyama (Hirosaki, Akita, Hokkaido, Japan) 

* 198 Hsa-mir-124-3 CpG island methylation is associated with advanced tumours and disease recurrence of 

patients with clear cell renal cell carcinoma 

H. Tezval, K. Gebauer, I. Peters, N. Dubrowinskaja, J. Hennenlotter, M. Abbas, R. Scherer, A.S. Merseburger, 

A. Stenzl, M.A. Kuczyk, J. Serth (Hanover, Tübingen, Germany) 

199 Vasohibin-1 is a novel independent predictor of disease-free survival in curatively operated renal cell 

carcinoma patients 

Y. Miyaji, N. Kanomata, Y. Sato, S. Kin, S. Ohira, M. Fujita, H. Yakushiji, K. Fukumoto, S. Shimizu, M. Kaifu, 

T. Fujii, Y. Jo, T. Yokoyama, T. Moriya, A. Nagai (Kurashiki, Sendai, Japan) 

200 Expression of MHC molecule CD1d in renal cell carcinoma (RCC) is associated poorer cancer-specific and 

overall survival 

T.W. Chong, M.Y. Sim, H.H. Huang, A.R. Lazaro, A.A. Thike, P.H. Tan (Singapore, Singapore) 

201 Withdrawn 

202 Phosphodiesterase-5- inhibition protects against ischemia-reperfusion acute kidney injury: In-vivo study 

O. Nativ, I. Sukhotnik, R. Suhotnik, H. Awad, S. Heyman, Z. Abassi, O. Nativ (Haifa, Jerusalem, Israel)

203 Partial nephrectomy compared to total unilateral nephrectomy slows down atherosclerosis progression in 

apolipoprotein E deficient mice 

O. Ivanovski, I.G. Nikolov, O. Davceva, K. Gjorgjievska, G. Petrusevska (Skopje, Macedonia) 

204 Kidney injury following clampless laparoscopic partial nephrectomy: Is an early detection of acute 

postoperative damage possible? A preliminary experience 

F. Porpiglia, D. Amparore, R. Bertolo, E. Aroasio, F. Ragni, C. Fiori (Orbassano (Turin), Italy) 

Summary 

P.F.A. Mulders, Nijmegen (NL) 


131 

Saturday

Saturday 




16.00 - 17.30 Men’s sexual health: Testosterone and premature ejaculation 



Chairs: B. Cuzin, Lyon (FR) 

K. Hatzimouratidis, Pefka (GR) 




205 Withdrawn 

* 206 Results of the CO-SDT study: Prevalence and risk factors of coronary artery disease in a cohort of 2508 

men with testosterone deficiency syndrome 

E. García-Cruz, O. Cardeñosa, M.P. Luque, A. Alcaraz (Barcelona, Spain) 

* 207 Effects of long-term treatment with testosterone undecanoate injections in hypogonadal men on waist 

circumference, body weight and BMI 

D.J. Yassin, A. Haider, M. Zitzmann, A. Yassin, P.G. Hammerer, F. Saad (Braunschweig, Bremerhaven, 

Münster, Norderstedt, Berlin, Germany) 

208 Relationship between erectile dysfunction and coronary anatomy in patients with ischemic heart disease 

debut 

E. Garcia-Cruz, A. Bonet, I. Asiain, P. Luque, R. Freixa, A. Alcaraz (Barcelona, Sant Joan Despí, Spain) 

209 The characteristics of testosterone deficiency syndrome in men with end-stage renal disease and male 

renal transplant recipients; a cross-sectional study 

M.G. Park, J.K. Yeo, W.Y. Cho, D.Y. Cho (Seoul, Busan, South Korea) 

210 Endothelial function in patients with metabolic syndrome and erectile dysfunction: A question of 

Angiopoietin imbalance? 

N. Tomada, I. Tomada, F. Botelho, L. Pacheco-Figueiredo, T. Lopes, R. Negrão, F. Cruz (Porto, Portugal) 

211 Sexual dysfunction, aging male symptoms and their relationship to testosterone (T) in the Registry of 

Hypogonadism in Men (RHYME) 

R.C. Rosen, S. Arver, H.M. Behre, R. Chang, T. Curto, T.H. Jones, M. Maggi, J. Martha, A. Martin-Morales, 

E.J. Meuleman, H. Porst, F.C.W. Wu, A.B. Araujo (Watertown, Massachusetts, United States of America; 

Stockholm, Sweden; Halle, Hamburg, Germany; South Yorkshire, Manchester, United Kingdom; Florence, 

Italy; Malaga, Spain; Amsterdam, The Netherlands) 

212 A new indication for varicocelectomy? 

A.A. Afoko, H. De Wall, M. Kogan (Tamale, Ghana; Rostov on Don, Russia) 

213 Comparison between on-demand dosing of dapoxetine alone and dapoxetine plus mirodenafil in patients 

with lifelong premature ejaculation; multicenter, prospective, randomized, double-blind, and placebocontrolled 

C. Yoo, W.Y. Cho, J.S. Cho, W.K. Lee, S.K. Lee, Y.G. Lee, Y.S. Lee, K.K. Kim, D.Y. Yang, H.Y. Kim, S.Y. Kim 

(Anyang, Busan, Chuncheon, Seoul, South Korea)

214 On demand use of tramadol, sildenafil, paroxetine or local anesthetics for management of premature 

ejaculation, a randomized placebo-controlled clinical trial 

T.A. Gameel, A.M. Tawfik, M.G. Soliman, M.A. El-Bendary, M. Abo-Elenen, T.I. Tawfik, A. El-Gamasy (Tanta, 

Egypt) 

215 A real-time motion analysis of human ejaculation with Turbo-FLASH MR imaging system 

J.S. Jintetsu, Y. Naya, O Ochiai, Y. Naitoh, N. Kanemitsu, K. Kamoi, A. Kawauchi, T. Miki (Kyoto, Japan) 

216 Associations between asymptomatic prostatitis and erectile dysfunction in middle-aged male 

K. Ausmees, R. Mändar, G. Timberg, M. Punab (Tartu, Estonia) 


133 

Saturday

Saturday 




16.00 - 17.30 Improving diagnosis in prostate cancer 



Chairs: P. Macek, Prague (CZ) 

M.P. Matikainen, Helsinki (FI) 




217 Structured reporting of multiparametric MRI in detecting prostate cancer: Accuracy and inter-observer 

variability 

R. Van Soest, R.S. Dwarkasing, G.J.L.H. Van Leenders, H.J. Teertstra, P. De Koekkoek, S.W.T.P. Heijmink, 

M. Wildhagen, H.G. Van Der Poel, E.W. Steyerberg, C.H. Bangma (Rotterdam, Amsterdam, The Netherlands) 

218 Association of level of suspicion of prostate cancer on multi-parametric MRI with detection rate of prostate 

cancer 

V. Kasivisvanathan, R. Dufour, C.M. Moore, H.U. Ahmed, M.A. Abd-Alazeez, S. Charman, A. Freeman, 

A. Kirkham, C. Allen, J. Van Der Meulen, M. Emberton (London, United Kingdom) 

* 219 Diagnostic accuracy of multiparametric MRI in detection of clinically significant prostate cancer 

F. Porpiglia, C. Fiori, F. Mele, M. Manfredi, R. Bertolo, S. Grande, M. Poggio, D. Garrou, G. Cattaneo, 

E. Bollito, M. Papotti, F. Russo, D. Regge (Orbassano (Turin), Candiolo (Turin), Italy) 

220 Initial experience of 200 men undergoing 3 dimensional ultrasound prostate biopsy in analysis between 

systematic and MR-fusion biopsy 

A. Marien, A. Villers, S. Palmer, S. Leslie, H. Ahmadi, A.L. De Castro Abreu, S. Shoji, M. Aron, M.M. Desai, 

I.S. Gill, O. Ukimura (Los Angeles, United States of America; Lille, France) 

221 Diagnosis of anterior prostate cancer using MRI/TRUS soft image fusion 

E. Baco, E. Rud, D. Klotz, H.B. Eggesbø (Oslo, Norway) 

* 222 Detecting clinically significant prostate cancer by MRI-targeted TRUS-guided transperineal fusion biopsy 

T.H. Kuru, M. Roethke, T. Simpfendoerfer, S. Boxler, J. Seidenader, H-P. Schlemmer, M. Hohenfellner, 

B. Hadaschik (Heidelberg, Germany) 

223 Objective differentiation of prostate cancer from normal prostate tissue: Diagnostic usefulness of 

discriminant analysis of T2 and diffusion-weighted MR imaging 

R. Nemoto (Tottori, Japan) 

* 224 Incremental benefit of 3T diffusion weighted MRI for pre-operative prostate cancer staging: A prospective 

dual reader study 

E.M. Lawrence, F.A. Gallagher, T. Barrett, A. Warren, A.N. Priest, E. Sala, V.J. Gnanapragasam (Cambridge, 

United Kingdom; Toronto, Canada; New York, United States of America) 

225 Identification of patient subgroups with the highest benefit from real-time-sonoelastography (RTE) 

targeted biopsy of the prostate 

J. Bründl, H-M. Fritsche, M. Gierth, A. Brandtner, W.F. Wieland, R. Ganzer (Regensburg, Germany)

226 Shearwave elastography of the prostate: Assessment of prostate cancer nodules elasticity thresholds and 

localization of cancer lesions: Implication for targeted biopsies and active surveillance protocols 

K. Boehm, G. Salomon, B. Beyer, J. Schiffmann, H. Isbarn, M. Sandmann, L. Budaeus (Hamburg, Germany) 

227 [ 68 Ga]Gallium labelled ligands of the prostate specific membrane antigen as novel validated PET-tracer for 

the diagnosis of prostate cancer 

S. Boxler, T.H. Kuru, A. Afshar-Oromieh, M. Hohenfellner, U. Haberkorn, B.A. Hadaschik (Heidelberg, 

Germany) 

228 Console-integrated stereoscopic OsiriX 3D volume-rendered images for da Vinci S robotic-assisted radical 

prostatectomy 

Y. Shiga, M. Sugimoto, S. Minagawa, H. Morikawa, S. Okada, Y. Kawano, H. Yokoyama, K. Umeda, K. Hariu, 

Y. Ooiwa, H. Watanabe, M. Shimbori, R. Yamamoto, K. Yoshioka (Tokyo, Kobe, Japan) 


135 

Saturday

Saturday 




16.00 - 17.30 Bladder cancer demographics and biomarkers 



Chairs: P. Bastian, Düsseldorf (DE) 

R. Bryan, Birmingham (GB) 



229 Work in the textile and bladder cancer 

D. Garcia-Rojo, C. Serra, M. Kogevinas, D. Silverman, N. Malats, A. Gelabert, A. Carrato, N. Rothman, 

O. Bielsa, J. Prats, R. Abascal, L. Ceccini, A. Prera, F. Taño, J.M. Rodriguez De Vera, J.L. Guate, J. Fernandez, 

M. Rivas, A. Mateos, J.M. Malet, P. Muntañola, M. Cespedes, J.F. Gonzalez Huergo, J. Mosquera, C. Abad, 

F.X. Real (Sabadell, Barcelona, Elche, Oviedo, Badalona, Santa Cruz de Tenerife, Aviles, Gijon, Manresa, 

Mieres, Sant Boli Llobregat, Coaña, Cangas, Spain; Bethesda, United States of America) 

230 Bladder cancer incidence is falling, but mortality is static in significant subgroups of the English population 

M.F. Eylert, L.S. Hounsome, J. Verne, A. Bahl, E.R. Jefferies, R.A. Persad, H. Mostafid (Swansea, Bristol, 

Cheltenham, Basingstoke, United Kingdom) 

231 What do patients know about the causal role of cigarette smoking in bladder cancer? 

R. Rogel Berto, J.L. Ruiz Cerda, A. Polo Rodrigo, B. Plaza Viguer, A.M. Soto Poveda, J.L. Pontones Moreno, 

F. Boronat Tormo (Valencia, Spain) 

232 Clinical and pathological features of newly diagnosed bladder cancer in Spain 

B. Miñana, J.M. Cozar, J. Palou, R. Medina, J. Subirá, F. De La Rosa, V. Chantada, F. Lozano, M.J. Ribal 

(Murcia, Granada, Barcelona, Sevilla, Zaragoza, Madrid, La Coruña, Spain) 

233 Distribution of metastatic sites in bladder cancer: A population-based analysis 

A. Abdo, M. Meskawi, H. Lavigueur-Blouin, F. Roghmann, P.I. Karakiewicz, Q-D. Trinh (Montreal, Canada; 


234 Identification and clinical outcomes of aristolochic acid-induced upper tract urothelial carcinoma 

C.H. Chen, K.G. Dickman, C.Y. Huang, C.T. Shun, A.P. Grollman, Y.S. Pu (Taipei, Taiwan; New York, United 


235 Should we systematically screen for HNPCC in patients with upper urinary tract transitional cell 

carcinoma? 

G. Pignot, A. Rouquette, A. Vieillefond, G. Olagui, D. Amsellem-Ouazana, N. Barry De Longchamps, 

M. Zerbib, B. Terris (Le Kremlin Bicetre, Paris, France) 

236 Using microRNA profiling in urine samples to develop a non-invasive test for bladder cancer 

L. Mengual, J.J. Lozano, M. Ingelmo-Torres, C. Gazquez, M.J. Ribal, A. Alcaraz (Barcelona, Spain) 

237 MicroRNA signature associated with poor outcome in upper urinary tract tumours 

L. Izquierdo Reyes, M. Ingelmo, C. Mallofre, J.J. Lozano, M. Verhasselt-Crinquette, X. Leroy, P. Colin, 

E. Comperat, M. Rouprêt, A. Alcaraz, L. Mengual (Barcelona, Spain; Lille, Paris, France) 

238 Urinary biomarkers in the follow-up of low grade non-muscle invasive bladder cancer patients: Update on 

the FP7 UROMOL project 

T.C.M. Zuiverloon, W. Beukers, K.A. Van Der Keur, N. Malats, P. Malmstrom, U. Segersten, L. Dyrskjot, 

T. Orntoft, E.C. Zwarthoff (The Hague, The Netherlands; Madrid, Spain; Uppsala, Sweden; Århus, Denmark)

239 The unattainability of bladder cancer biomarkers: Utility-based assessment of a hypothetical non-invasive 

surveillance tool for bladder cancer recurrence 

D. Nekeman, L.J. Billingham, N.K. Aaronson, N.D. James, K.K. Cheng, R.T. Bryan, M.P.A. Zeegers 

(Birmingham, United Kingdom; Amsterdam, The Netherlands) 

240 The ADC value is a prognostic biomarker of upper urinary tract cancer: Potential application to 

preoperative risk stratification 

S. Yoshida, S. Kobayashi, F. Koga, J. Ishioka, C. Ishii, H. Tanaka, Y. Nakanishi, Y. Matsuoka, N. Numao, 

K. Saito, H. Masuda, Y. Fujii, K. Kihara (Tokyo, Japan) 

241 Preoperativ serum C-reactive protein: A prognostic marker in patients with upper urinary tract urothelial 

carcinoma 

B. Stein, A.J. Schrader, G. Wegener, C. Seidel, M.A. Kuczyk, S. Steffens (Hanover, Ulm, Germany) 

242 The predictive value of C-reactive protein on prognosis of patients with upper tract urothelial carcinoma 

treated with radical nephroureterectomy: Multi-institutional study 

E. Kikuchi, N. Tanaka, S. Shirotake, K. Matsumoto, H. Kobayashi, Y. Miyazaki, H. Ide, J. Obata, K. Hoshino, 

N. Hayakawa, Y. Ito, K. Kanao, A. Miyajima, T. Momma, K. Nakagawa, M. Ueno, M. Oya (Tokyo, Saitama, 

Japan) 


137 

Saturday

Saturday 




16.00 - 17.30 Cell based therapy in pelvic floor dysfunction 



Chairs: K-E. Andersson, Winston Salem (US) 

D. Eberli, Zurich (CH) 




* 243 Effects of injected undifferentiated or differentiated mesenchymal stem cells on the continence mechanism 

L. Lisa, M. Martin, S. Sabine, A. Stenzl, K-D. Sievert (Tübingen, Germany) 

* 244 Stem cell therapy for stress urinary incontinence: Comparison of bone marrow and adipose derived stem 

cells in animal model 

O. El Yazami Adli, O. Loutochin, R. Caremel, J. Corcos (Montreal, Canada) 

245 Urodynamic and histologic effects of autologous adipose derived stem cells endoscopically injected in a 

porcin model of intrinsic sphincter deficiency 

R. Boissier, L. Giraudo, J. Veran, J. Magalon, F. Sabatier, S. Giusiano, S. Garcia, L. Arnaud, F. Dignat-George, 

G. Magalon, E. Lechevallier, S. Berdah, G. Karsenty (Marseille, France) 

246 The role of donor age and gender on the success of autologous human muscle precursor cell 

transplantation for sphincter insufficiency 

M.N.L. Stölting, L.J. Hefermehl, M. Tremp, F.Z. Azzabi, T. Sulser, D. Eberli (Zürich, Switzerland) 

247 A novel three-dimensional tubular biodegradable scaffolds for tissue engineering of the urethra 

X.Q. Wang, Q.H. Chen, J.H. Hu, Y.C. Hou, C.X. Wang (Changchun, China) 

248 Stabilization strategies of tissue engineered urothelium and its application in nude rats and minipigs 

M. Vaegler, S. Maurer, L. Daum, K-D. Sievert (Tübingen, Germany) 

249 Proliferation and contractility modulation of bladder smooth muscle cells under physiological stretch 

K.J. Wang, T. Wu, Y. Tian, X. Yue, L. Cheng, H. Li (Chengdu, China) 

250 Tubular matrices for biohybrids 

V. Seifarth, J. Grosse, M. Gossmann, I. Heschel, W. Zang, G.M. Artmann, A.T. Artmann (Jülich, Aachen, 

Herzogenrath, Germany) 

251 Improving bioperformance of meshes for SUI and POP by coating with autologous plasma - results of a 

long term animal study 

H.G. Gerullis, M. Boros, B. Klosterhalfen, G. Heusch, E. Georgas, C. Eimer, T. Otto (Neuss, Düren, Essen, 

Germany; Szeged, Hungary) 

252 High-frequency micro-ultrasound, spot test, bladder leakage capacity, and time to leakage to determine 

the functional alteration in different rat models of stress urinary incontinence 

L. Hakim, M. Endo, A. Feola, P. Uvin, D. Soebadi, J. Deprest, D. De Ridder, M. Albersen, F. Van Der Aa 

(Leuven, Belgium; Surabaya, Indonesia)

253 Synergistic property of triple combination pre-differentiated cell transplantation for urethral sphincter 

regeneration 

B.S. Kim, J.N. Lee, S.Y. Kwon, H.T. Kim, E.S. Yoo, S.K. Chung, B.W. Kim, Y.K. Park, J.Y. Choi, S.H. Choi, 

T.H. Kim, J.B. Kwon, T.G. Kwon (Daegu, South Korea) 

Summary on stem cell therapy in the near future? 

D. Eberli, Zurich (CH) 


139 

Saturday

Saturday 




16.00 - 17.30 Robot-assisted partial nephrectomy 



Chairs: H. Baumert, Paris (FR) 

M.E. Sullivan, Oxford (GB) 




* 254 Margin, Ischemia, and Complications (MIC) System to report perioperative outcomes of robot-assisted 

partial nephrectomy: An European Multicenter Observational Study (EMOS project) 

N.M. Buffi, G. Lista, V. Ficarra, A. Mottrie, J. Porter, G. Lughezzani, A. Larcher, F.A. Mistretta, A. Cestari, 

M. Lazzeri, G. Guazzoni (Milan, Padua, Italy; Aalst, Belgium; Seattle, United States of America) 

255 Robotic partial nephrectomy for completely endophytic renal masses 

R. Autorino, A. Khalifeh, H. Laydner, D. Samarasekera, R. Stein, G-P. Haber, J. Kaouk (Cleveland, United 


256 Robot assisted partial nephrectomy for hilar tumors: Perioperative outcomes 

R. Eyraud, J-A. Long, S-L. Devon, R. Autorino, S. Hillyer, J. Klink, E. Rizkala, R. Stein, J. Kaouk, G-P. Haber 

(Cleveland, United States of America) 

257 Robotic partial nephrectomy: Imperative vs elective indications 

J-A. Long, B. Lee, R. Eyraud, R. Autorino, S. Hillyer, R. Stein, J. Kaouk, G-P. Haber (Cleveland, United States 

of America) 

258 Functional outcome six months after robot-assisted partial nephrectomy 

V. Ficarra, E. Frumenzio, M. Borghesi, M. Gan, G. Novara, A. Mottrie (Aalst, Belgium; Padua, Italy) 

* 259 Robotic-assisted versus open partial nephrectomy: A prospective multicenter comparison study of 

perioperative outcomes (AGILE project) 

A. Minervini, G. Vittori, A. Antonelli, A. Celia, S. Crivellaro, D. Dente, V. Di Santo, B. Frea, M. Gacci, A. Gritti, 

L. Masieri, A. Morlacco, A. Porreca, B. Rocco, P. Parma, S. Serni, C. Simeone, S. Zaramella, M. Carini 

(Florence, Brescia, Bassano del Grappa, Udine, Abano Terme, Milan, Mantova, Novara, Italy) 

260 Outcomes for open and minimally invasive partial nephrectomy since the introduction of robotic partial 

nephrectomy: Results from the Nationwide Inpatient Sample 

K.R. Ghani, S. Sukumar, J.D. Sammon, W. Jeong, C.G. Rogers, M. Menon (Detroit, United States of America) 

* 261 A prospective comparison of surgical and pathological outcomes obtained after robot-assisted or pure 

laparoscopic partial nephrectomy in moderate to complex renal tumors: Results from a French multicentric 

collaborative study 

A. Masson-Lecomte, K. Bensalah, E. Seringe, C. Vaessen, A. De La Taille, N. Doumerc, P. Rischmann, 

F. Bruyere, L. Soustelle, S. Droupy, M. Rouprêt (Creteil, Rennes, Paris, Toulouse, Tours, Nîmes, France) 

262 Postoperative complications after open, robotic-assisted, and laparoscopic partial nephrectomy in elderly 

patients 

F. Roghmann, H. Lavigueur-Blouin, M. Meskawi, Z. Tian, A. Abdo, M. Sun (Montreal, Canada)

263 Laparoscopic vs open partial nephrectomy for T1 renal tumors: Evaluation of the long-term oncologic and 

functional outcomes in 340 patients 

C. Springer, P. Fornara, F. Greco (Halle Saale, Austria) 

264 Open versus laparoscopic partial nephrectomy for clinical T1a renal tumors: A prospective multicenter 

comparative study (RECORd project) 

A. Minervini, S. Serni, A. Antonelli, G. Bianchi, A.M. Bocciardi, A. Chindemi, R. Fantechi, V. Ficarra, 

C. Fiori, G. Martorana, M. Medica, V. Mirone, G. Novara, F. Porpiglia, B. Rovereto, R. Schiavina, C. Simeone, 

C. Terrone, A. Volpe, M. Carini (Florence, Brescia, Modena, Milan, Padua, Turin, Bologna, Sestri Levante, 

Naples, Pavia, Novara, Italy) 

Summary 

H. Baumert, Paris (FR) 

. 


141 

Saturday

Saturday 

Saturday, 16 March - Sponsored Sessions 


Workshop Overview 

18.00 - 19.30 Holmium Life Enhancing Plan (HoLEP) - The real BPH lifetime solution page 407 

Amber Hall 6 - Level S2 Sponsored by LUMENIS 


18.00 - 19.30 Navigating the new landscape in CRPC page 402 

eURO Auditorium - Level S2 Sponsored by ASTELLAS 

18.00 - 19.30 LUTS/BPH and sexual health - Bridging the gap page 403 

Brown Hall 1-2 - Level S2 Sponsored by ELI LILLY AND COMPANY 

18.00 - 19.30 Risk stratification to optimize the management of men with symptomatic BPH at risk of 

progression page 404 

Platinum Hall - Level S3 Sponsored by GLAXOSMITHKLINE 

18.00 - 19.30 Increasing evidence of effectiveness of GAG therapy in different forms of cystitis page 405 

Amber Hall 1-2 - Level S2 Sponsored by IBSA INSTITUT BIOCHIMIQUE 

18.00 - 19.30 Transurethral resection of bladder tumor: How to reach excellence page 406 

Brown Hall 3 - Level S2 Sponsored by IPSEN 

18.00 - 19.30 Premature ejaculation treatment: New perspectives for the couple page 408 

Yellow Hall 1-2-3 - Level N1 Sponsored by MENARINI

Sunday, 17 March - EAU Programme 


07.30 - 11.00 Upper urinary tract 


Chairs: F.C. Hamdy, Oxford (GB) 

F. Montorsi, Milan (IT) 

07.30 - 08.00 Highlight session 1 

Prostate disease 

A. Descazeaud, Limoges (FR) 

Female urology 


Reconstruction 

C. Surcel, Bucharest (RO) 



08.05 - 08.25 Update The dilemmas in diagnosing upper tract urothelial cancer 



Upper tract urothelial cancer accounts for a very small percentage of all urological malignancies. It has 

traditionally been characterised for an aggressive phenotype and late diagnosis. However advances in 

cross sectional imaging, miniaturisation of endoscopic instruments, and developments of additional optical 

visualisation methods and cytological biomarkers has resulted in a shift in stage at presentation. 

Accuracy and opportunity of the different diagnostic methods from suspicion of upper urinary tract tumor to 

confirmation of urothelial cancer will be discussed. 

08.25 - 09.05 Debate How much surgery for upper tract urothelial cancer? 

Moderator: T.S. O’Brien, London (GB) 

Nephroureterectomy or partial ureterectomy? 


Endoscopy is enough 


Lymphadenectomy helps the patients? 



Delegates will hear the pros and cons of organ sparing approaches in UUTUC debated. Does nephron sparing 

surgery deserve a more prominent role in the management of UUTUC? The place of conservative ureteric 

excision with re-implantation, and endoscopic ablation will be critically addressed. Which patients are 

suitable for which approach? 

When patients have to undergo radical surgery, how radical does that surgery need to be? The place of 

lymphadenectomy is debated in all urological cancers and UUTUC is no different. Prof Brausi will address 


143 

Sunday

Sunday 


the evidence for lymphadenectomy and delegates should leave with a clear understanding of which patients 

have most to gain from lymphatic clearance and how extensive that clearance needs to be. 

09.05 - 09.35 EAU Guidelines Office case discussion Upper urinary tract tumours 

Moderator: M. Rouprêt, Paris (FR) 

Panel: J. Palou, Barcelona (ES) 

R.E. Zigeuner, Graz (AT) 


The new version of the European Association of Urology (EAU) guidelines on upper urinary tract tumours 

known as urothelial carcinomas of the upper tract (UTUCs) are likely to be released in 2013. The EAU 

Guideline working group for UTUCs has prepared current guidelines to provide evidence-based information 

for the clinical management of these rare tumours and to help clinicians incorporate these recommendations 

into their practice. Through clinical cases, we will emphasize the most important Take-Home messages and 

address concrete issues. 

09.35 - 09.55 Société Internationale d’Urologie (SIU) lecture The role of ESWL in upper urinary tract stones 

M.R. Desai, Naidad (IN) 

09.55 - 10.10 Update Interventional imaging in upper urinary tract stone disease: What’s new? 



Endourological treatment of urolithiasis is a field where the concept of image-guided therapy has the chance 

to display all its value. In fact, interventional imaging during the endoscopic treatment of ureteral and pyelocalyceal 

stones is fundamental for the performance of a safe and effective procedure. The integrated use of 

fluoroscopy, ultrasound, computed tomography, magnetic resonance and endoscopic vision will be discussed, 

as well as the most recent advances and innovations regarding these consolidated techniques (rotational 3D 

fluoroscopy, Doppler, 3D and 4D ultrasound, flat-panel volume CT and CT/pyelography, open configuration 

MRI, image fusion techniques, HD endoscopic imaging) and the need for a multidisciplinary cooperation 

between endourologist and radiologist. The issue of radioprotection will also be addressed (including 

the X-ray-free percutaneous access), as well as the correlation of the mentioned tools with preoperative 

diagnostic work up. 

10.10 - 10.50 Case discussion From above or below: Flexible, rigid or percutaneous management of upper urinary tract 

stones 

Moderator: P.J. Osther, Fredericia (DK) 

PCNL 


Flexible 

E.K. Bres-Niewada, Warsaw (PL) 

What is the best energy for fragmentation? 

T. Bach, Hamburg (DE) 


Rapid technological developments continuously set new standards in stone treatment. The combined 

introduction of digital flexible ureteroscopes, new laser settings, superflexible utensils and pressurecontrolled 

irrigation with the possibility of on-demand flushing clearly has expanded the indications for 

ureteroscopic renal stone management. In complex cases combined (antegrade – retrograde) procedures 

are increasingly being used. In this session we will – through case discussions – explore pros and cons of 

different approaches to the endourological treatment of renal stones: which cases are most suitable for a

combined approach?, which cases are best treated from below or from above?, and which type of stone 

fragmentation energy should be applied in the different situations? 

10.50 - 11.00 Update Observation and deferred intervention in the management of stones 



Is it all about intervention? This lecture reviews current concepts of stone observation and medical expulsive 

therapy. It will try to give decision algorithms when active treatment should be initiated and which treatment 

options could be chosen. 


145 

Sunday

Sunday 




09.15 - 10.45 Robot-assisted kidney surgery 



Chairs: A. Carbone, Latina (IT) 



V18 Robot-assisted partial nephrectomy: Fluorescence imaging and zero ischemia for complex hilar and 

intrarenal tumours 

N. Harke, A. Kunz, F. Schiefelbein, G. Schoen (Würzburg, Germany) 

V19 Robotic anatrophic incision for nephron sparing surgery for complete intrarenal tumor in the renal sinus 

R. Sotelo Noguera, R. Cisneros, O. Carmona, R. De Andrade, G. Fernández, J. Castro, R. Garza (Caracas, 

Venezuela) 

V20 The use of semiflexible and flexible intraoperative laparoscopic ultrasound transducers during robotassisted 

laparoscopic partial nephrectomy 

S. Poth, C. Wagner, A.P. Labanaris, A. Schütte, J.H. Witt (Gronau (Westfalen), Germany) 

V21 New 3-dimensional head-mounted display system (RoboSurgeon system) applied to gasless, single-port 

access, clampless partial nephrectomy 

K. Kihara, Y. Fujii, H. Masuda, K. Saito, F. Koga, N. Numao, Y. Matsuoka (Tokyo, Japan) 

V22 Robot-assisted suturless unclamped partial nephrectomy by enucleation 

R. Eyraud, E. Rizkala, R. Autorino, H. Laydner, A. Khalifeh, R. Stein, J. Kaouk, G-P. Haber (Cleveland, United 


V23 Zero ischemia robot assisted laparoscopic partial nephrectomy for a totally endophytic renal tumor 

G. Simone, R. Papalia, M. Ferriero, S. Guaglianone, M. Costantini, E. Forastiere, M. Gallucci (Rome, Italy) 

V24 Complications during robot-assisted kidney surgery 

R.K. Kumar, B.F. Kaczmarek, M. Menon, C.G. Rogers (Detroit, United States of America) 

V25 Robotic partial nephrectomy with cold ischemia and early tumor extraction: Recapitulating the open 

approach 

C.G. Rogers, R.K. Kumar, K.R. Ghani, W. Jeong, M. Menon (Detroit, United States of America)



09.15 - 10.45 Prostate cancer: Active surveillance 



Chairs: L.M. Campos Pinheiro, Lisboa (PT) 





* 265 Monitoring of three-dimensionally mapped biopsy-proven image-visible lesions of prostate cancer on 

active surveillance: 11 year experience 

S. Shoji, O. Ukimura, A.L. De Castroabreu, S. Leslie, T. Uchida, I. Gill, D. Bahn (Los Angeles, United States of 

America; Hachioji, Japan) 

* 266 Role of multiparametric 3.0 Tesla magnetic resonance imaging in prostate cancer patients eligible for 

active surveillance 

B.H. Park, S.H. Choo, H.J. Jang, Y.S. Suh, U.S. Jeong, W. Song, H.G. Jeon, B.C. Jeong, S.I. Seo, S.S. Jeon, 

H.Y. Choi, K.S. Lee, H.M. Lee (Seoul, South Korea) 

267 Radiological progression in men with prostate cancer on active surveillance 

A.J. Ridout, D. Stevens, C. Allen, A. Kirkham, A. Freeman, C. Jamieson, M. Emberton, C.M. Moore (London, 

United Kingdom) 

268 Impact of multiparametric prostate MRI on the selection of active surveillance patients 

F. Sanguedolce, A.R. Padhani, N. Anyamene, J. Beatty, G. Hellawell (London, United Kingdom) 

269 Low risk prostate cancer patients without visible tumor (T1c) on diffusion-weighted MRI could qualify for 

active surveillance candidate regardless of inclusion criteria of active surveillance protocol 

D.H. Lee, K.H. Kim, S.H. Lee, K.H. Rha, Y.D. Choi, S.J. Hong, B.H. Chung (Seoul, South Korea) 

270 The significance of finding no prostate cancer on the active surveillance confirmatory biopsy: Implications 

for pathological re-classification 

L.M. Wong, G. Trottier, N. Lawrentschuk, N.E. Fleshner, G. Kulkarni, A.R. Zlotta, J. Trachtenberg, A. Toi, 

N. Timilshina, A. Finelli (Toronto, Canada) 

271 The value of histological revision of biopsy cores in patients suitable for active surveillance: Comparison 

with surgical specimens after radical prostatectomy and clinical follow-up 

R. Schiavina, M. Fiorentino, E. Brunocilla, M.S. Rossi, S. Rizzi, D. Romagnoli, L. Bianchi, M. Borghesi, 

D. Diazzi, H. Dababneh, G. Passaretti, G. Martorana (Bologna, Italy) 

272 The HAROW study - an observational health service study, capturing current low-risk-prostate cancer 

treatment practice patterns in Germany 

A. Becker, L.A. Kluth, S. Beermann, D. Seiler, F. Recker, F.K. Chun, L. Weissbach (Hamburg, Berlin, Germany; 

Aarau, Switzerland) 

* 273 Is PSA doubling time reliable as a progression risk criterion for patients with low-risk prostate cancer in 

an active surveillance programme? 

F.B. Thomsen, I.J. Christensen, M.A. Røder, K. Brasso, P. Iversen (Copenhagen, Denmark) 


147 

Sunday

Sunday 

* 274 Prostate cancer active surveillance: Health-related quality of life in the Finnish arm of the prospective 

PRIAS-study. Three year update 

U. Lokman, H. Vasarainen, K. Lahdensuo, A.M. Erickson, K. Taari, T.K. Mirtti, A. Rannikko (Helsinki, Finland) 

275 The prevalence of depression and anxiety in men undergoing active surveillance for prostate cancer 

S.D. Watts, G. Leydon, A.J. Ridout, E.J. Arden-Close, C.M. Moore, A. Richardson, B. Birch, G. Lewith 

(Southampton, London, United Kingdom) 




09.15 - 10.45 Bladder cancer: Pathology 



Chairs: P-U. Malmström, Uppsala (SE) 

Y.M. Osman, Mansoura (EG) 




276 Impact of histological variants on oncological outcomes of patients with urothelial carcinoma of the 

bladder treated with radical cystectomy 

E.N. Xylinas, M. Rink, L. Kluth, B.D. Robinson, Y. Lotan, M. Babjuk, A. Brisuda, D.A. Green, A. Pycha, 

Y. Fradet, R.K. Lee, P.I. Karakiewicz, M. Zerbib, D.S. Scherr, S.F. Shariat (New York, Dallas, United States of 

America; Prague, Czech Republic; Bolzano, Italy; Quebec City, Montreal, Canada; Paris, France) 

277 Methylation of tumor suppressor genes predict recurrence and subclassify non muscle-invasive disease: 

PTA low grade versus pt1 low grade and pt1 high grade bladder tumors 

R. Sacristan, C. Gonzalez, J.M. Fernandez-Gomez, F. Fresno, S. Escaf, M. Sanchez-Carbayo (Madrid, Spain) 

278 Could a mutational status of fibroblast growth factor receptor 3 (FGFR3) gene in bladder cancer tissue 

improve accuracy of clinical staging? 

A.I. Rolevich, M.P. Smal, S.A. Krasny, R.I. Goncharova, S.L. Polyakov, T.I. Nabebina (Minsk, Belarus) 

279 Practical potential of immunohistochemical staining with anti-smoothelin, anti-vimentin and anticaldesmon 

antibodies in pathological staging of urothelial bladder carcinoma 

S. Poletajew, E. Wilczek, D. Łukasik, A. Wasiutynski, B. Górnicka (Warsaw, Poland) 

280 Micropapillary variant of urothelial carcinoma in the upper urinary tract 

H.H. Sung, J.J. Kim, K.S. Lee, S.H. Choo, H.J. Jang, Y.S. Suh, S. Jeong, W. Song, J. Cho, G.Y. Kwon, H.G. Jeon, 

B.C. Jeong, S.I. Seo, S.S. Jeon, H-Y. Choi, H.M. Lee (Seoul, South Korea) 

281 Multivariate analysis of clinical and pathological predictive factors of understaging, in patients undergoing 

radical cystectomy 

A. De Gracia, O. Rodriguez Faba, J. Palou, F. Algaba, J.M. Gaya, A. Breda, L.I. Gausa, A. Wong, 

H. Villavicencio (Barcelona, Spain) 

282 Outcome of radical cystectomy for muscle-invasive bladder cancer secondary to previous non muscleinvasive 

stages is comparable to primary muscle-invasive bladder cancer and impacted by EORTC riskscore 

A. Aziz, M. Gierth, H-M. Fritsche, M. May, W. Otto, W. Wieland, S. Denzinger, A. Merseburger, H. Riedmiller, 

A. Kocot, M. Burger (Regensburg, Straubing, Hanover, Würzburg, Germany) 


149 

Sunday

Sunday 

283 Incidence and prognostic impact of prostate cancer on cystectomy specimens: Results of a French 

multicenter study 

G. Pignot, L. Salomon, Y. Neuzillet, A. Masson-Lecomte, C. Lebacle, J-J. Patard, P. Lunardi, P. Rischmann, 

G. Pasticier, J-C. Bernhard, J. Cohen, M-O. Timsit, B. Peyronnet, G. Verhoest, C. Legoux, M. Zerbib, 

F. Brecheteau, P. Bigot, S. Larre, T. Murez, R. Thuret, E. Lacarriere, C. Champy, M. Rouprêt, E. Comperat, 

J. Berger, A. Descazeaud, S. Lavilledieu, C. Avances, F. Delage, A. Valeri, B. Molimard, X. Durand, 

A. Houlgatte, P. Gres, A. Donnaint, F. Kleinclauss, S. Legal, A. Doerfler, N. Koutlidis, L. Cormier, J-F. Hetet, 

P. Colls, A. Arvin-Berod, J-J. Rambeaud, H. Quintens, M. Soulie, C. Pfister (Le Kremlin Bicetre, Creteil, 

Suresnes, Toulouse, Bordeaux, Paris, Rennes, Angers, Montpellier, Rouen, Limoges, Nimes, Brest, Niort, 

Besançon, Caen, Dijon, Nantes, Grenoble, Saint-Laurent-Du-Var, France) 

* 284 The role of preoperative prostatic urethral biopsy in clinical decision-making at the time of radical 

cystectomy 

J.M. Gaya, G.M. Badalato, G. Hruby, D.D. Holder, J.M. McKiernan (Barcelona, Spain; New York, United States 

of America) 

285 Precystectomy nomogram predicting risk of regional lymph node metastases in bladder cancer patients 

L.V. Mirylenka, O.G. Sukonko, A.V. Pravorov, A.I. Rolevich (Minsk Region, Belarus) 

286 Clinical and pathological nodal staging score for urothelial carcinoma of the bladder are valid decision 

tools for risk assessment and clinical decision-making: An external validation 

M.S. Gierth, H.M. Fritsche, H. Buchner, M. May, A. Aziz, W. Otto, C. Bolenz, L. Trojan, E. Hermann, 

A. Tiemann, S.C. Müller, J Ellinger, S. Brookman-May, C. Stief, D. Tilki, P. Nuhn, T. Höfner, M. Hohenfellner, 

A. Haferkamp, J. Roigas, M. Zacharias, W.F. Wieland, H. Riedmiller, S. Denzinger, P. Bastian, M. Burger 

(Regensburg, Munich, Straubing, Mannheim, Göttingen, Münster, Bonn, Heidelberg, Frankfurt, Berlin, 

Würzburg, Germany) 

287 A consensus study on invasiveness of bladder cancer using virtual microscopy and heatmaps (pT1 ENUP 

(European Network of UroPathology) study 

E. Compérat, L. Egevad, A. Lopez-Beltran, P. Camparo, F. Algaba, M. Amin, J. Epstein, H. Hamberg, 

C. Hulsbergen-Van De Kaa, G. Kristiansen, R. Montironi, C.C. Pan, K. Treurniet, J. Sykes, T. Van Der Kwast 

(Paris, Amiens, France; Stockholm, Uppsala, Sweden; Cordoba, Barcelona, Spain; Los Angeles, Baltimore, 

United States of America; Nijmegen, Rotterdam, The Netherlands; Bonn, Germany; Ancona, Italy; Tapei, 

Taiwan; Toronto, Canada) 




09.15 - 10.45 Prostate cancer: Surgery outcomes 



Chairs: R. Ganzer, Regensburg (DE) 





* 288 Urodynamic evaluation of urethral function after robot-assisted laparoscopic radical prostatectomy: A 

comparison with laparoscopic radical prostatectomy 

Y. Matsukawa, Y. Yoshino, M. Kato, N. Sassa, K. Matsuo, S. Takai, M. Gotoh (Nagoya, Japan) 

289 Preoperative functional status predicts urinary continence recovery after radical prostatectomy 

P. Dell’Oglio, G. Gandaglia, U. Capitanio, V. Scattoni, N. Suardi, A. Russo, N.M. Passoni, F. Abdollah, 

A. Salonia, V. Mirone, R. Damiano, G. Guazzoni, A. Gallina (Milan, Naples, Catanzaro, Italy) 

* 290 Survival, continence and potency (SCP) outcomes 5-years after robot-assisted radical prostatectomy 

A. Mottrie, M. Borghesi, E. Frumenzio, G. Novara, M. Gan, V. Ficarra (Aalst, Belgium; Padua, Italy) 

291 Quality of life and treatment options for low risk prostate cancer 

I.C. Acar, C. Schoffelmeer, C. Tillier, W. De Blok, E. Van Muilekom, H. Van Der Poel (Amsterdam, The 

Netherlands) 

292 Delay of curative treatment for prostate cancer and outcomes: Cohort analysis and literature review 

R.C.N. Van Den Bergh, C. Schoffelmeer, H.G. Van Der Poel (Utrecht, Amsterdam, The Netherlands) 

293 Secondary radiotherapy after radical prostatectomy does not compromise urinary continence 

M. Adam, P. Wenzel, D. Lanwehr, M. Graefen, U. Michl, A. Faried, H. Huland, T. Schlomm, P. Tennstedt, 

A. Becker, R. Schwarz (Hamburg, Germany) 

294 Capsular incision during radical prostatectomy does not affect early biochemical recurrence rates 

P. Tennstedt, A. Haese, M. Graefen (Hamburg, Germany) 

295 Inverse stage migration of clinically localized prostate cancer still continues and is most pronounced in 

elder patients 

M.C. Butea-Bocu, H. Huland, U. Michl, G. Salomon, T. Steuber (Hamburg, Germany) 

296 The Worcestershire prostate cancer survivorship programme: A new concept for holistic long term support 

and follow up 

S. Goonewardene, M. Symons, A. Sullivan, V. Milner, G. McCormack, A. Makar (Worcester, United Kingdom) 

297 Accuracy of phased-array 3.0-T MR imaging in predicting extracapsular extension and influence on the 

decision to preserve neurovascular bundles at robotic assisted laparoscopic radical prostatectomy 

B.H. Park, S.H. Choo, H.J. Jang, Y.S. Suh, U.S. Jeong, W. Song, H.G. Jeon, B.C. Jeong, S.I. Seo, H.Y. Choi, 

H.M. Lee, K.S. Lee, S.S. Jeon (Seoul, South Korea) 

298 PUKA study: A snapshot of radical prostatectomy practice in the UK 

A. Laird, S. Fowler, D. Cahill, S.F. Brewster, T. O’Brien, S.A. McNeill (Edinburgh, London, Oxford, United 

Kingdom) 


151 

Sunday

Sunday 

299 Perioperative, functional and oncological outcomes after robot-assisted radical prostatectomy in men 70 

years of age and over with localized prostate cancer 

C. Giedelman, H. Abdul-Muhsin, O. Schatloff, S. Samavedi, R. Coelho, A. Sivaraman, S. Chauhan, 

K.J. Palmer, G. Ebra, V. Patel (Celebration, United States of America) 




09.15 - 10.45 Treatment of neurogenic LUTD 



Chairs: V.W. Nitti, New York (US) 

A. Reitz, Zurich (CH) 




* 300 Desmopressin in the treatment of nocturia in patients affected by Parkinson’s disease 

S. Proietti, M. Gubbiotti, J.A. Rossi De Vermandois, A. Giannantoni (Rozzano, Perugia, Italy) 

301 Treatment of neurogenic detrusor overactivity (NDO) by combined low dosed antimuscarinics: Four years 

experience 

M. Spinelli, M. Citeri, C. Guerrer, L. Zanollo (Milan, Italy) 

302 Lower urinary tract symptoms and urodynamic dysfunctions in clinically isolated syndromes suggestive of 

multiple sclerosis 

S. Proietti, M. Di Filippo, P. Sarchielli, M Gubbiotti, J.A. Rossi De Vermandois, L. Gaetani, P. Calabresi, 

A. Giannantoni (Milan, Perugia, Italy) 

303 Urinary symptoms and sexual dysfunction in patients affected by multiple sclerosis 

A. Giannantoni, S. Proietti, M. Gubbiotti, J.A. Rossi De Vermandois, M. Porena (Perugia, Rozzano (mi), Italy) 

* 304 Long term functional outcomes after continent cutaneous urinary diversion in patients with neurological 

disease: A monocentric experience 

M.A. Perrouin-Verbe, V. Phé, M. Rouprêt, A. Even, F. Giuliano, G. Robain, P. Denys, M-O. Bitker, E. Chartier- 

Kastler (Paris, Garches, France) 

305 Effects of anticholinergic agents on efficacy of penile vibratory stimulation to obtain ejaculation in spinal 

cord injured males 

M. Spinelli, C. Guerrer, L. Zanollo, M. Citeri, L. Rizzato (Milan, Italy) 

306 Investigation to restore innervation of the lower urinary tract of spinal cord injured patients: A European 

single-center retrospective study with long-term follow-up 

K-D. Sievert, B. Amend, F. Roser, A. Badke, A. Baron, J. Bedke, S. Kruck, H. Kaps, A. Stenzl, M. Tatagiba 

(Tübingen, Germany) 

307 PNE versus staged test trials for sacral neuromodulation: Sensitivity, specificity and predictive values of 

each technique 

A. Banakhar, M. Hassouna (Jeddah, Saudi Arabia; Toronto, Canada) 

308 Patient-reported goal achievement after onabotulinumtoxinA treatment in patients with neurogenic 

detrusor overactivity 

E. Chartier-Kastler, V. Khullar, E. Rovner, M. Chancellor, C. Corbell, J. Jin, D. Globe (Paris, France; London, 

United Kingdom; Charleston, Royal Oak, Irvine, United States of America) 


153 

Sunday

Sunday 

309 Withdrawn 

310 Sacral neuromodulation for refractory lower urinary tract dysfunction: A prospective series of 98 patients 

undergoing tined lead test stimulation at a single center 

D.S. Engeler, D. Abt, D. Meyer, H-P. Schmid (St. Gallen, Switzerland) 


Summary - How to improve the treatment of neurogenic LUTD? 

V.W. Nitti, New York (US)



09.15 - 10.45 Stones: Basic research, imaging and training models 



Chairs: S. Oehlschläger, Dresden (DE) 

T. Sulser, Zürich (CH) 




* 311 Active phagocytosis and processing of calcium oxalate monohydrate crystals in an in vitro macrophage 

model 

A. Okada, T. Yasui, L. Zuo, K. Taguchi, Y. Fujii, Y. Itoh, Y. Hirose, M. Usami, K. Niimi, R. Ando, T. Kobayashi, 

S. Hamamoto, M. Hirose, Y. Itoh, K. Tozawa, K. Kohri (Nagoya, Japan) 

312 Effects of aminobisphosphonates and thiazides in patients with hypercalciuria, recurrent renal calcium 

lithiasis and osteopenia/osteoporosis 

M.A. Arrabal Polo, S. Gonzalez-Torres, F. Lopez Carmona, C. Lahoz Garcia, J. Moreno Jimenez, A. Zuluaga 

Gomez, M. Arrabal Martin (Granada, Spain) 

313 The Randall plaques - a new marker for metabolic syndrome? 

A. Ciudin, P. Luque, M.G. Diaconu, R. Salvador, A. Franco, R. Alvarez-Vijande, C. Nicolau, A. Alcaraz 


314 Using bisphosphonates to effectively inhibit calcium oxalate crystal aggregation 

S.E. Allen, S. Choong, C.H. Fry, W.G. Robertson (London, United Kingdom) 

315 Detecting micro stones in urine after ESWL with quantitative micro-raman spectroscopy 

Y.C. Chiu, H.K. Chiang, S-H. Lu, A.W. Chiu (Taipei, Taiwan) 

316 What is the best method to evaluate urine pH? A trial of three clinical urine pH measurement devices in a 

stone clinic 

R. Ilyas, K. Chow, J.G. Young (Manchester, United Kingdom) 

317 In vitro study on ureteral smooth muscle relaxation with tamsulosin, nifedipine, and terpene mixure 

(Rowatinex®) 

J.W. Lee, M.Y. Lee, S.C. Park, J.S. Rim, I.Y. Seo (Iksan, South Korea) 

318 Incidence of Computed Tomography (CT) detected urolithiasis: An update 

S.L. Lee, L.T. Koh, K.K. Ng, F.C. Ng (Singapore, Singapore) 

319 Radiation exposure of the patient submitted to endourologic treatment for ureteral calculi 

F. Nigro, P. Ferrarese, G. Benedetto, E. Bratti, E. Scremin, S. Savastano, A. Tasca (Vicenza, Italy) 

320 Evaluation of a novel fascial dilator modified with scale marker in PCNL for reduction of x-ray exposure: 

A randomized clinical study 

Z. Guohua, Z. Zhao, W. Zhong, W. Chen, W. Wu, D. Qi, C. Xiao, Y. Liu (Guangzhou, China) 

321 Customized protocols for the Uro Dyna-CT reduce radiation exposure of endourological patients 

M-C. Rassweiler, R. Banckwitz, C. Koehler, B. Mueller-Allisaat, M.S. Michel, A. Haecker, M. Ritter 

(Mannheim, Forchheim, Germany) 


155 

Sunday

Sunday 

322 Accuracy in measuring renal stones using the Uro Dyna-CT 

B. Meister, M-C. Rassweiler, C. Weiss, M.-S. Michel, A. Häcker, M. Ritter (Mannheim, Germany) 

323 Stones of different compositions – depiction in the Uro Dyna-CT 

B. Meister, M-C. Rassweiler, M-S. Michel, M. Ritter (Mannheim, Germany) 




09.15 - 10.45 Preclinical innovation - the future of erectile dysfunction treatment? 



Chairs: C.S.R. Costa, Porto (PT) 

E. Wespes, Brussels (BE) 




* 324 Intratunical injection of human adipose tissue-derived stem cells prevents fibrosis and is associated with 

improved erectile function in a rat model of Peyronie’s disease 

F. Castiglione, P. Hedlund, F. Van Der Aa, T.J. Bivalacqua, M. Albersen (Milan, Italy; Leuven, Belgium; 

Baltimore, United States of America) 

* 325 Repair of erectile dysfunction using transplantation of human mesenchymal stem cells cultivated on the 

surface of nanofibrous meshes in rats with cavernous nerve injury 

Y.S. Song, H.J. Lee, J. An, J.H. Yun, J.H. Kim, S.W. Doo, W.J. Yang, S.U. Kim (Seoul, South Korea) 

326 Galanin, a trophic neuropeptide, is upregulated in the rat major pelvic ganglia following cavernous nerve 

crush injury 

M. Albersen, J. Hannan, L. Hakim, X. Liu, F. Castiglione, F. Van Der Aa, P. Hedlund, T.J. Bivalacqua (Leuven, 

Belgium; Baltimore, United States of America; Milan, Italy) 

327 Time-dependent changes in the regulation of neurotrophin expression and neurite sprouting in the rat 

major pelvic ganglion following cavernous nerve injury 

J. Hannan, M. Albersen, B.L. Stopak, X. Liu, A.L. Burnett, P. Hedlund, F. Van Der Aa, T.J. Bivalacqua 

(Baltimore, United States of America; Leuven, Belgium; Milan, Italy) 

328 Inhibition of the fatty acid amide hydrolase (FAAH) reduces in vivo spontaneous seminal vesicle 

contractions and increases latency to apomorphine-induced ejaculation 

G. La Croce, A. Bettiga, R. Buono, G. Colciago, F. Benigni, F. Mistretta, F. Castiglione, M. Albersen, 

P. Hedlund (Milan, Italy; Leuven, Belgium) 

329 Expression of the transient receptor potential cationic channel A1 (TRPA1) in the human seminal vesicles - 

an immunohistochemical and molecular biology study 

S. Ückert, A. Simon, J.E. Sonnenberg, A.S. Merseburger, M.A. Kuczyk, P. Hedlund (Hanover, Barsinghausen, 

Germany; Milan, Italy) 

330 Occlusion of the seminal vesicles increases sexual activity in male mice: Results of a novel mouse 

experiment 

F.D. Birkhäuser, C. Schumacher, R. Seiler, L. De Meuron, P. Zehnder, B. Roth, A. Wetterwald, G.N. Thalmann, 

M.G. Cecchini, U.E. Studer (Berne, Switzerland) 

331 Cannabinoid receptors in the human seminal vesicles 

M. Moschini, A. Bettiga, R. Luciano, M. Freschi, P. Hedlund, S. Uckert (Milan, Italy; Hanover, Germany) 

332 Involvement of Rho-kinase/LIM-kinase/cofilin signaling pathway in erectile dysfunction and corporal 

fibrosis after cavernous nerve injury in male rats 

M.C. Cho, S.H. Song, S.Y. Cho, K. Park, S.W. Kim, J-S. Paick (Goyang, Seoul, South Korea) 


157 

Sunday

Sunday 

333 Adrenomedullin and angiopoietin-1 additively restore erectile function in diabetic rats: Comparison with 

the combination therapy with vascular endothelial growth factor and angiopoietin-1 

H. Nishimatsu, E. Suzuki, A. Nomiya, A. Niimi, H. Fukuhara, T. Fujimura, M. Suzuki, H. Kume, Y. Homma 

(Tokyo, Kawasaki, Japan) 

334 Usefulness of tropomyosin as a marker of response to 5-phosphodiesterase inhibitors 

R. Brime Menendez, L. San José Manso, I. Galante Romo, J.J. Leon Zamorano, P. Rodriguez Sierra, P. Jimenez 

Mateos-Cáceres, L. Calatrava Ledrado, P. Anastasio De Las Heras, A. Lopez Farre, C. Olivier Gómez (Madrid, 

Spain) 

335 Testosterone replacement therapy can increase circulating endothelial progenitor cell number in men with 

late-onset hypogonadism 

C.T. Wu, C.H. Liao, S.P. Liu, Y.N. Wu, H.S. Chiang (Taipei, New Taipei City, Taiwan) 




09.15 - 10.45 Renal tumour diagnosis: From new techniques to follow-up 



Chairs: A. Cestari, Milan (IT) 

J.M. De La Morena Gallego, Madrid (ES) 



336 Sorafenib decreases Indium-111-girentuximab tumor uptake in clear cell renal cell carcinoma patients 

C.H.J. Muselaers, O.C. Boerman, A.B. Stillebroer, I.M.E. Desar, M.J. Boers-Sonderen, C.M.L. Van Herpen, 

J.F. Langenhuijsen, E. Oosterwijk, W.P.J. Leenders, W.J.G. Oyen, P.F.A. Mulders (Nijmegen, The Netherlands) 

337 Clinicopathological characteristics of Xp11 translocation renal cell carcinoma in adults: Diagnosis using 

FISH analysis in conjunction with TFE3 immunostaining 

M. Hirobe, N. Masumori, T. Tanaka, H. Kitamura, A. Tonooka, T. Hasegawa, T. Tsukamoto (Sapporo, Japan) 

338 Do small renal cell carcinomas have a higher prevalance of locally advanced growth and distant 

metastases? A large multicentre study 

S. Steffens, M. Janssen, F.C. Roos, F. Becker, S. Schumacher, R. Hofmann, G. Wegener, S. Siemer, M. Stöckle, 

J.W. Thüroff, M. Schrader, K. Junker, M.A. Kuczyk, A.J. Schrader (Hanover, Homburg/Saar, Mainz, Homburg, 

Ulm, Marburg, Germany) 

339 Histopathological and molecular predictors of chronic kidney disease progression and its related mortality 

after radical nephrectomy 

T. Sejima, H. Iwamoto, T. Masago, S. Morizane, A. Yao, T. Isoyama, A. Takenaka (Yonago, Japan) 

340 Independent validation of the 2010 TNM staging system for renal cell carcinoma: Does it improves 

predictive accuracy in cancer-specific mortality compared to 2002 TNM? 

M. Roscigno, S. Shariat, M. May, R. Zigeuner, T. Chromecki, C. Stief, L. Schips, O. De Cobelli, B. Rocco, C. De 

Nunzio, B. Feciche, M. Truss, S. Pahernik, S. Zastrow, G. Novara, A. Minervini, A. Antonelli, V. Mirone, 

A. Simonato, R. Bertini, V. Ficarra, S. Brookman-May (Bergamo, Vasto, Milan, Rome, Padua, Florence, 

Brescia, Naples, Genova, Italy; New York, United States of America; Straubing, Munich, Dortmund, 

Heidelberg, Dresden, Regensburg, Germany; Graz, Austria; Cluj-Napoca, Romania; Aalst, Belgium) 

341 Interdisciplinary counseling service for renal malignancies: Patients and physicians view of a new model 

of care 

J. Huber, A. Ihrig, E. Winkler, C. Gruellich, P. Hallscheidt, M. Zeier, S. Pahernik, M. Hohenfellner (Heidelberg, 

Germany) 

342 Is it necessary to perform long term follow up in patients after surgery for renal cell carcinoma pT1 and 

pT2? 

S. Nestler (Mainz, Germany) 

343 Prevalence of Computed Tomography (CT) detected solid renal masses: An update 

S.L. Lee, L.T. Koh, K.K. Ng, F.C. Ng (Singapore, Singapore) 

344 Preoperative decision-making for renal cell carcinoma: Cystic morphology in cross sectional imaging 

predicts lower malignant potential 

J. Huber, A. Winkler, T. Bruckner, W. Roth, P. Hallscheidt, K. Daneshvar, M. Hohenfellner, S. Pahernik 

(Heidelberg, Germany) 


159 

Sunday

Sunday 

345 Diffusion weigthed MRI of the kidney as surrogate marker for the prediction of the aggressiveness of renal 

carcinoma 

S. Sevcenco, F.E. Kuehhas, P. Weibl, T. Szarvas, G. Kramer, G. Heinz-Peer, D. Javor, L. Ponhold, P. Baltzer, 

H.C. Klingler (Vienna, Austria) 

346 Use of contrast-enhanced ultrasonography in diagnosis of renal masses and concordance with computed 

tomography 

S. Alvarez Rodríguez, E. Sanz Mayayo, L. López-Fando Lavalle, L.A. Córdoba Martínez, V. Hevia Palacios, 

F. Arias Fúnez, R. Rodríguez-Patrón Rodríguez, F.J. Burgos Revilla (Madrid, Spain) 

347 A large scale validation study proposes high pre-operative plasma fibrinogen levels as an independent 

negative prognostic factor regarding cancer-specific, metastasis-free, as well as overall survival in a 

European cohort of renal cell carcinoma patients 

G.C. Hutterer, M. Pichler, C. Stoeckigt, T. Chromecki, T. Stojakovic, S. Golbeck, S. Mannweiler, K. Pummer, 

R. Zigeuner (Graz, Austria) 

348 Validation of CRP as prognostic marker for renal cell carcinoma in a large series of patients 

S. Steffens, A. Köhler, R. Rudolph, H. Eggers, C. Seidel, M. Janssen, G. Wegener, M. Schrader, M.A. Kuczyk, 

A.J. Schrader (Hanover, Ulm, Homburg, Germany) 

349 Clinical significance of preoperative thrombocytosis in patient performed radical nephrectomy for nonmetastatic 

renal cell carcinoma 

P.H. Song, Y.S. Ji, K.H. Kim, Y.H. Ko, K.H. Moon, H.C. Jung (Daegu, Gyeongju, South Korea) 




11.00 - 12.00 EAU Guidelines Office: Recommendation updates 2013 


Chair: K.F. Parsons, Liverpool (GB) 

11.00 - 11.20 Update Renal cell cancer guidelines 

B. Ljungberg, Umeå (SE) 


The current update 2013 of the guidelines on Renal Cell Carcinoma is a first attempt to use a systematic review 

strategy of available literature. The literature search strategy includes the construction of screening questions 

using PICO elements for the evaluation. Using structured screening, flow diagrams present eligibility of 

studies, and data from included studies will be summarized. Based on the results recommendations can be 

presented based on the current knowledge. The update presents recommendations on diagnosis, treatment 

strategies including last releases on medical therapy used in renal cell carcinoma. 

11.20 - 11.40 Update Imaging in Urology – a European and United States perspective 

P. Fulgham, Dallas (US) 


This portion of the lecture will demonstrate the variability of imaging terminology used in a single document 

regarding imaging in the management of ureteral calculous disease. The technology assessment analysed 

was written by four authors considered experts on urologic imaging, working closely together as the 

Ureteral Imaging Task Force under the aegis of the American Urological Association Guidelines Panel. We 

show that a single imaging modality such as computed tomography may have as many as 16 variations 

within a single document. Analysis of root terms and synonyms provides insight into how these varied terms 

may be subcategorised. A standardised nomenclature would facilitate the meta-analysis of the world’s 

literature regarding that imaging modality and thereby produce more robust recommendations for its use. 

Standardisation of imaging nomenclature would be particularly helpful in developing guidelines shared by 

varied organisations. Although currently primarily descriptive, a standardised imaging terminology could 

become prescriptive if combined with performance parameters. 



With the evolution of imaging in Urology, there has been an exponential growth in research and considerable 

clinical interest in utilizing imaging techniques in clinical practice. It is a multidisciplinary process with 

contributions from investigators and clinicians of varied backgrounds: physics and engineering, informatics, 

urology, and radiology. However, the terminology used in this area is not uniform. As a consequence, there 

are often multiple abbreviations and synonyms for similar investigations with overlapping definitions that 

can potentially confuse or misdirect clinicians and researchers alike. As a contribution to the literature, 

clinical practice, and investigative urology, the Guideline Office (GO) of the EAU with its imaging panel has 

compiled a standard set of medical terms that are recommended to be used in clinical and investigative 

urology practice. 

11.40 - 12.00 Update The pros and cons of urological thromboprophylaxis 

K.A.O. Tikkinen, Helsinki (FI) 


161 

Sunday

Sunday 



Decisions regarding both nonpharmacologic and pharmacologic peri-operative prophylaxis to prevent venous 

thromboembolism in patients undergoing urologic surgery are controversial, and practices differ substantially. 

Reasons for not using thromboprophylaxis include increased risk of bleeding, burden of interventions, 

and lack of knowledge. We will present the first EAU Guideline addressing thromboprophylaxis: provide 

evidence-based recommendations based on a systematic literature search. Our goals include estimation of 

baseline risk of symptomatic VTE and bleeding, and estimation of treatment effects of thromboprophylaxis. 

Finally, we will also present guidance on management of patients using anticoagulant medication for other 

reasons (bridging therapy).



11.00 - 12.00 What are the limitations of minimally invasive surgery? 


Chair: A. Breda, Barcelona (ES) 

11.00 - 11.15 State-of-the art lecture Do long-term outcomes of robot-assisted radical prostatectomy justify the costs? 

M. Stöckle, Homburg (DE) 

11.15 - 11.30 State-of-the-art lecture What are the limits of laparoscopic nephron-sparing surgery? 



In experienced hands laparoscopic partial nephrectomy (LPN) for localised renal tumors achieves similar 

oncologic outcomes of open partial nephrectomy, with the known advantages of minimal invasiveness. 

However, LPN is a challenging technique which is associated with a higher risk of complications and a longer 

warm ischemia time, with the related potential effects on postoperative renal function. Modern techniques 

can limit or even avoid ischemia during LPN, but their feasibility in the hands of less experienced surgeons 

has not been assessed. Overall, the limits of LPN significantly depend on the laparoscopic experience and 

skills of each single surgeon. Although formal cost analysis and longer follow-up are needed, the ability 

of robotic assistance to reduce the technical challenges and overcome the limits of the pure laparoscopic 

approach are already being realised and are likely to become more evident with time and increasing 

expertise. 

11.30 - 11.45 State-of-the-art lecture Open vs robot-assisted radical cystectomy and urinary diversion 


11.45 - 12.00 Abstract presentations: Special selection from the poster sessions 

261 A prospective comparison of surgical and pathological outcomes obtained after robot-assisted or pure 

laparoscopic partial nephrectomy in moderate to complex renal tumors: Results from a French multicentric 

collaborative study 

A. Masson-Lecomte, K. Bensalah, E. Seringe, C. Vaessen, A. De La Taille, N. Doumerc, P. Rischmann, 

F. Bruyere, L. Soustelle, S. Droupy, M. Rouprêt (Creteil, Rennes, Paris, Toulouse, Tours, Nîmes, France) 

1017 Prospective randomised study comparing transperitoneal and extraperitoneal approach during robotic 

prostatectomy: Anesthesiologic effects 

F. Dal Moro, C. Valotto, A. Mangano, R. Soncin, A. Crestani, A. Guttilla, G.M. Pittoni, F. Zattoni (Padova, Italy) 


163 

Sunday

Sunday 




11.00 - 12.00 From bench to bedside: What will be replacing PSA? 


Chair: Z. Culig, Innsbruck (AT) 

11.00 - 11.15 State-of-the-art lecture Gene fusions in prostate cancer: Is it helping? 

T. Visakorpi, Tampere (FI) 


The finding of TMPRSS2:ERG fusion immediately raised the question could it be utilized in the treatment of 

prostate cancer, either as a drug target or as a biomarker. What is good about the fusion genes as biomarkers, 

is that they are genetic alterations. As such they are cancer specific and do not exist in normal cells. There 

has been a large number of publications interrogating whether the TMPRSS2:ERG fusion detected in tissue 

specimen is associated with prognosis. Most of the studies suggest it is not. There have also been a few 

studies detecting the fusion from blood, circulating tumor cells (CTCs), and urine. And, it seems that in a 

combination with PCA3, TMPRSS2:ERG could improve the utility of serum PSA to detect clinically significant 

cancer. Also other fusion genes than TMPRSS2:ERG have been and will be identified in prostate cancer. 

Common factor for these fusions is that they are rare. Thus, they will unlikely have a potential of being 

biomarkers alone. However, they may turn out to be useful in selecting targeted drugs if available. 

11.15 - 11.30 State-of-the-art lecture The role of the pathologist in clinical prognosis 

G. Kristiansen, Bonn (DE) 

11.30 - 11.45 State-of-the-art lecture MicroRNA in prostate cancer diagnosis 

H. Sültmann, Heidelberg (DE) 


miRNAs are small non-coding RNAs involved in posttranscriptional regulation of gene expression. While 

recent studies have suggested the usefulness of miRNAs in tissues and body fluids for tumor diagnosis, 

prognosis, and prediction, technical parameters, e.g. nucleic acid recovery from limited sources of 

biomaterial, sample standardisation, data normalisation, as well as independent validation of screening 

data, are still challenging. The presentation will highlight the potential as well as obstacles for translating 

miRNA markers into diagnostic applications for prostate cancer. 


1045 Urinary PCA3 and TMPRSS2:ERG help predict biopsy outcome prior to initial prostate biopsy using a risk 

group analysis 

J.R. Day, L.A. Jones, S.E. Meyer, P.N. Hodge, J. Aussie, D.R. Saltzstein, J.C. Groskopf (San Diego, San Antonio, 

United States of America) 

139 Reducing unnecessary biopsies for suspicion of prostate cancer: Extension and validation of an ERSPC 

based risk calculator with Phi 

M.J. Roobol, D. Nieboer, A. Houlgatte, S. Vincendeau, M. Lazzeri, G. Guazzoni, C. Stephan, A. Semjonow, 

A. Haese, M. Graefen, E.W. Steyerberg (Rotterdam, The Netherlands; Paris, Rennes, France; Milan, Italy; 

Berlin, Munster, Hamburg, Germany)



11.00 - 12.00 Non-muscle invasive bladder cancer 


Chair: J.W.F. Catto, Sheffield (GB) 

11.00 - 11.15 State-of-the-art lecture Molecular sub-classification of bladder cancer 



As early events in bladder carcinogenesis, methylation and other epigenetic alterations would provide 

diagnostic power complementing previously described genetic factors. As related to different steps in 

tumor progression, they could also provide clinical utility for tumour sub-classification. Our group has 

been working over the past years on characterising whether hypermethylation of profiles, focused panels 

of tumor suppressor genes and individual candidates could classify bladder cancer subgroups according not 

only to pathologic or clinical criteria but also to patient outcome. Part of our studies is aiming to evaluate 

the clinical utility of CpG hypermethylation for the molecular classification of bladder tumours based on 

their aggressiveness and clinical behaviour: from comprehensive CpG array methylation profiling, to several 

multiplexed panels of TSGs, and finally characterising specific individual methylated candidates. In this 

talk, the major results of these three strategies for bladder cancer sub-classification will be summarised: 

using CpG arrays, methylation specific multiplex ligation-dependent probe amplification (MS-MLPA), and 

methylation specific polymerase chain reactions (MS-PCR) analyses. 

11.15 - 11.30 State-of-the-art lecture Photodynamic diagnosis: Fact or fiction? 



The aims of this presentation is a comprehensive depiction of currently available data on the use of 

photodynamic diagnosis in bladder cancer and a critical debate and evaluation of the evidence. The 

first objective is the depiction of the potential impact of any method improving cystoscopic detection of 

bladder cancer. The second objective is the description, the mode of action and debate of the feasibility 

of photodynamic diagnosis. The third objective is an overview of currently available data on potential 

improvements of detection and recurrence rates compared to standard white light cystoscopy. The fourth 

objective is the debate of potential overall benefit for patients. The fifth objective is to pinpoint questions 

unanswered to date and the sixth objective is the critical evaluation of what we know so far and a debate on 

potential benefits and uncertainties. 

11.30 - 11.45 State-of-the-art lecture New advances in perioperative instillation therapy in NMIBC 

J.A. Witjes, Nijmegen (NL) 


The initial resection of bladder tumors is a very important diagnostic and therapeutic tool. Therefore, optimal 

initial treatment, including pre-, per-, or postoperative intravesical instillations or other means of help, is an 

absolute must in bladder cancer treatment 


165 

Sunday

Sunday 


708 Side effects of BCG in the treatment of intermediate and high risk Ta T1 papillary carcinoma of the bladder: 

Results from EORTC GU Cancers Group randomised study 30962 comparing 1/3 dose vs full dose during 1 

or 3 years 

M. Brausi, J. Oddens, R. Sylvester, S. Colette, P. Gontero, A. Bono, L. Turkeri (Modena, Torino, Varese, Italy; 

‘s-Hertogenbosch, The Netherlands; Brussels, Belgium; Istanbul, Turkey) 


74 Interval between cystectomy and start of adjuvant chemotherapy is an independent prognostic factor for 

patients with locally advanced or lymph node positive carcinoma of the urinary bladder 

C.H. Ohlmann, J. Kamradt, B. Burgard, M. Saar, I. Azone, S. Siemer, M. Stöckle, J. Lehmann (Homburg, Kiel, 

Germany)



11.00 - 12.00 Joint session with the European Society of Nuclear Medicine: 

Diagnostics and therapy of bone metastases in patients with 

advanced prostate cancer 


Chairs: A. Chiti, Rozzano (IT) 


11.00 – 11.30 Choline & Fluoride imaging of bone metastases in prostate cancer 

W. Langsteger, Linz (AT) 

11.30 – 11.45 Treatment of bone metastases 

B. Djavan, Vienna 

11.45 – 12.00 Alpharadin: New horizons in systemic therapy 



Radium-223 is a novel alpha-pharmaceutical that has been tested in men with bone metastases from 

advanced prostate cancer. Radium-223 is very similar to calcium, and so is rapidly taken up in bone, and 

particularly in bone metastases. It emits very high-energy alpha particles that cause lethal damage to 

adjacent tumour cells. 

The ALSYMPCA trial was a Phase III, randomised, double-blind, placebo-controlled study of radium-223 plus 

best standard care compared with placebo plus best standard care in 921 patients with castrate resistant 

prostate cancer (CRPC) and bone metastases. Radium-223 was associated with an overall survival benefit, 

a delay in time to first skeletal-related event, an improvement in quality of life and a favourable safety 

profile. 

These results suggest that radium-223 may provide a new standard of care for the treatment of men with 

CRPC and bone metastases. 


167 

Sunday

Sunday 




11.00 - 12.00 Small renal masses: To treat or not to treat? 


Chair: P.F.A. Mulders, Nijmegen (NL) 

11.00 - 11.15 State-of-the-art lecture Needle biopsy of renal masses: When and how 

M. Kuczyk, Hanover (DE) 


During recent years a revival of the biopsy of renal masses can be observed. On one hand this is due to 

the increasing frequency of incidentally detected small renal masses that are, in part, treated by ablative 

techniques. However, the histological differentiation of small renal masses is benign in up to 30% of cases. 

The individual patient should not be subjected to a treatment that is associated with a distinct complication 

rate until malignancy has been proven. Today, an organ-preserving strategy is the standard of care during 

the treatment of small renal masses. In case of an unfavourable localisation of renal tumours that might 

make organ-preservation difficult, biopsy can be recommended to prove a malignant differentiation upfront 

surgery. 

11.15 - 11.20 Case presentation: A patient with an incidentaloma of the kidney 


11.20 - 11.50 Debate How to survive a small renal mass 

11.20 - 11.35 Pro Observation 

M. Jewett, Toronto (CA) 


Small Renal Mass (SRM) is the most common presentation for RCC but not all SRMs are malignant. Needle core 

biopsy is an accurate and safe diagnostic method that is underutilised. The standard for treatment is partial 

nephrectomy with ablation in selected cases. Most RCC SRMs grow slowly so that initial active surveillance 

(AS) using serial imaging with delayed treatment for progression is an option, particularly in the older and 

infirm. Markers of progression are poorly understood and currently we depend on rapid growth as the main 

trigger for treatment. We are in the early phase of personalising AS strategies by tumour characteristics 

including histology and host comorbidity status. Urologists should have a current understanding of this 

new clinical entity SRM to better manage new RCC patients with a disease that is increasing due to image 

detection of incidental lesions. Most are RCC which is the most lethal of GU malignancies and can not be 

cured if metastatic. This concern is probably leading to unnecessary treatment of many SRM that could be 

managed by AS. 

11.35 - 11.50 Con Minimally invasive partial nephrectomy 

I.S. Gill, Los Angeles (US) 


My lecture will present the data and the rationale for surgical treatment of small renal masses in the healthy 

patient with projected longevity. Pros and cons of active surveillance will be presented. The inadequacy of 

imaging in diagnosing cancer, and the emerging role of needle biopsy will be discussed.

11.50 - 12.00 Rebuttal 


M. Jewett, Toronto (CA) 


169 

Sunday

Sunday 




11.00 - 12.00 Management of surgical complications 


Chairs: J. Rassweiler, Heilbronn (DE) 


11.00 - 11.15 Tips and tricks Bowel perforation during puncture (suprapubic + percutaneous catheter) 


11.15 - 11.30 Tips and tricks Hemorrhagic cystitis 


11.30 - 11.45 Tips and tricks Complications of flank incisions 



Still in the era of laparoscopy and robotics flank incisions represents the predominantly used access for open 

access to the upper urinary tract. However, it is associated with complications effecting quality of life - the 

most important being paraesthesia, neuralgia, hernia, and flank bulge. Concerning flank bulge, an incidence 

of up to 50% has been described. For most of these complications bounded nerve function is suggested as 

underlying mechanism. 

The lecture summarises the underlying relevant anatomy of the flank with special regard to the nervous 

system. Furthermore it deals with the aetiology and incidence of the complications caused by flank incision. 

It presents the current available literature in the field, shows how to identify patients at risk and explains 

how to manage existing complications. Finally it gives the most important information which is: How best 

to prevent them. 

11.45 - 12.00 Tips and tricks Symptomatic lymphocele 

D.A. Schilling, Tübingen (DE) 


Lymphoceles following retroperitoneal surgery are frequent and can be bothersome and evoke severe 

complications such as thromboebolic disease. 

Objective of the lecture is to identify risk factors for lymphocele formation, discuss preventive measures and 

point out treatment strategies in persisting symptomatic lymphorrhoea.



11.00 - 12.00 Paediatric urology 


Chair: W.F.J. Feitz, Nijmegen (NL) 

11.00 - 11.15 State-of-the-art lecture Update on minimal-invasive treatment options 

R. Subramaniam, Leeds (GB) 


Present an appraisal of minimally invasive treatment options that are applicable to children. I shall present 

some videos of procedures and talk about different approaches used in the procedures. We will also look at 

the evidence for the application of minimally invasive procedures and discuss the pros and cons. 

11.15 - 11.30 State-of-the-art lecture Neuropathic bladders: Treatment strategies and transfer in adulthood 

R. Stein, Mainz (DE) 


Close follow-up (ultrasound of the upper and lower urinary tract, urodynamic investigations starting 

shortly after birth) is essential. There are 4 different types of bladder sphincter dysfunction in patients with 

NB. 2 major pillars of conservative treatment: clean intermittent catheterisation (CIC) and treatment with 

anticholinergics/antimuscarinics. As long as the patient is under the care of their parents or other caregivers, 

compliance is generally good. 

During adolescence, patients prefer more independence and compliance relating to medical treatment and 

regular CIC decreases as does the sense of importance for regular follow-up investigations. This usually leads 

to a deterioration of upper and lower urinary tract function. It is our responsibility to guarantee lifelong 

follow-up for these patients to prevent complications 

11.30 - 11.45 State-of-the-art lecture Hypospadias in children, adolescents and adults 

G.A. Manzoni, Milan (IT) 


This presentation will provide an overview of present strategies in modern treatment of hypospadias in the 

pediatric population with definition of the timing and type of surgical repairs. A critical analysis of present 

and most popular techniques will be discussed. Goals and importance of long-term follow-up will be 

stressed with special relevance for the adolescent patient (functional and psycho-sexual aspects). Finally the 

adult hypospadias problems will be discussed both for the controversial aspects of long-term complications 

and for the “virgin” patient presenting in adulthood. 

11.45 - 12.00 State-of-the-art lecture Regenerative urology for children and adults 

D. Eberli, Zürich (CH) 


Tissue Engineering is one of the major approaches of regenerative medicine and a growing and exciting 

field of research. In combination with better understanding of structure, biology, physiology and cell culture 

techniques tissue engineering may offer new treatment options for patients in need of replacement or repair 

of a deteriorated organ. 

The principle is to dissociate cells from a tissue biopsy, to expand these cells in culture, and to seed them 

onto the scaffold material in vitro in order to form a living tissue construct prior to implantation into the 

recipient. 


171 

Sunday

Sunday 




11.00 - 13.00 Surgery in Motion 


Moderators: M. Graefen, Hamburg (DE) 








11.05 - 11.30 Neurovascular structure adjacent frozen-section examination (neurosafe) increases nerve-sparing frequency 

and reduces positive surgical margins in open and robot-assisted laparoscopic radical prostatectomy. 

Experience after 11,069 consecutive patients 

T. Schlomm, Hamburg (DE) 

11.30 - 11.55 Robot assisted laparoscopic partial nephrectomy: Step by step contemporary technique and surgical 

outcomes at a single high-volume institution 

J.H. Kaouk, Cleveland (US) 

11.55 - 12.20 LESS partial nephrectomy without ischemia for very small, exophytic renal masses: Surgical details and 

functional outcomes 

L. Schips, Vasto (IT) 

12.20 - 12.45 Robotic intracorporeal orthotopic ileal neobladder: Replicating open surgical principles 

A. Goh, Houston (US) 

12.45 - 13.00 Discussion



13.15 - 15.15 3D Video and live narration - da Vinci partial nephrectomy with 

Firefly fluorescence imaging 


Operator: G. Schön, Würzburg (DE) 

Moderators: A. Mottrie, Aalst (BE) 

J. Porter, Seattle (US) 

C. Vaessen, Paris (FR) 

Sponsored by INTUITIVE SURGICAL 


173 

Sunday

Sunday 




12.15 - 13.45 Challenging robotic surgery 



Chairs: S.D. Kim, Busan (KR) 



V26 Robotic cystoprostatectomy with nerve-sparing approach and intracorporeal construction of Hautmann 

neobladder: Saint Augustin technique 

D. Rey, E. Helou, M. Oderda, L. Lopez, P-T. Piechaud (Bordeaux, France) 

V27 Robotic intracorporeal ileal conduit in the female utilizing transvaginal assistance 

R. Eyraud, E. Rizkala, R. Autorino, H. Laydner, A. Khalifeh, J. Kaouk, G-P. Haber (Cleveland, United States of 

America) 

V28 Robot assisted laparoscopic placement of an artificial urinary sphincter for a female patient 

V. Flamand, T. Ghoneim, F. Marcelli, P. Vandaele, A. Villers (Lille, France) 

V29 Robotic-assisted anterior pelvectomy with intracorporeal ileal conduit: Saint Augustin technique 

D. Rey, E. Helou, M. Oderda, L. Lopez, P-T. Piechaud (Bordeaux, France) 

V30 Robot-assisted laparoscopic renal artery aneurysm repair: Demonstration of the surgical technique 

R. Autorino, D. Samarasekera, A. Khalifeh, J. Kaouk (Cleveland, United States of America) 

V31 Robot-assisted adrenalectomy - a single center series from Homburg 

M.W. Janssen, A. Treiyer, J. Kamradt, S. Siemer, M. Stöckle, T. Gebhardt, C.H. Ohlmann (Homburg, Germany) 

V32 Robotic realization of double Yang-Monti ileal conduit and bladder augmentation: Saint Augustin technique 

D. Rey, E. Helou, M. Oderda, L. Lopez, P-T. Piechaud (Bordeaux, France)



12.15 - 13.45 New methods in imaging and targeting prostate cancer 



Chairs: B.M. Carey, Leeds (GB) 





350 Validation of histoscanning system to detect and characterize prostate cancer 

A. Govorov, D. Pushkar, M. Kovylina, A. Vasilyev, T. Moiseenko (Moscow, Russia) 

351 Prostate HistoScanning for assessment of tumour volume and pathological stage prior to radical 

prostatectomy: What is its role in routine clinical practice? 

S. Javed, E. Chadwick, S. Beveridge, S. Bott, C. Eden, S. Langley (Guildford, Frimley, United Kingdom) 

352 Prostate histoscanning as a tool for decision making 

P. Macek, E. Barret, R.E. Sanchez Salas, M. Galiano, F. Rozet, Y. Ahallal, J.M Gaya, M. Durand, L. Mascle, 

C. Giedelman, L. Lunelli, X. Cathelineau (Paris, France) 

* 353 Prostate histoscanning for the detection, localization and volume estimation of prostate cancer- PHS02 

blind phase results 

L.A.M. Simmons, HU Ahmed, F. Zát’ura, M. Winkler, J. Braeckman, I. Meiers, D. Nir, P. Autier, S. Charman, 

M. Emberton (London, United Kingdom; Olomouc, Czech Republic; Brussels, Waterloo, Belgium; Lyon, 

France) 

354 CP OCT imaging of prostate neurovascular bundle 

D. Ledyaev, V. Atduev, L. Shkalova, E. Zagaynova (Nizhny Novgorod, Russia) 

355 Parametric diffusion weighted imaging at 3 tesla accurately predicts histological outcomes in men 

presenting for a TRUS-guided biopsy of the prostate 

D.C. Moran, L. Marignol, A. Perry, A. Fagan, E. Gaffney, J.F. Meaney, D. Hollywood, T.H. Lynch (Dublin, 

Ireland) 

356 Does 3 Tesla endorectal PET/MRI change the operative tactics in prostate cancer? 

J. Klein, J. Hauser, J-P. Vallee, C. Iselin (Geneva, Switzerland) 

357 Choline positron emission tomography (PET) or PET/computed tomography (CT) and biochemical relapse of 

prostate cancer (PCa): A meta-analysis of literature 

A. Guttilla, F. Zattoni, L. Evangelista, G. Saladini, F. Zattoni (Padua, Italy) 

* 358 PET-CT in recurrent prostate cancer 

D.K. Osmonov, A.V. Aksenov, D. Heimann, C.M. Naumann, K-P. Jünemann (Kiel, Germany) 

359 Identification of apparent-diffusion-coefficient (ADC) cut-offs during DWI-MRI in prostate cancer lymph 

node metastasis: Implication for daily clinical practice 

L. Budäus, S-R. Leyh-Bannurah, C. Seiwerts, B. Beyer, G. Salomon, H. Heinzer, M. Graefen, G. Adam, 

M. Regier (Hamburg, Germany) 


175 

Sunday

Sunday 

360 Choline PET-CT and diffusion-weighted MRI for nodal staging in prostate cancer at high risk for nodal 

metastases 

S. Joniau, L. Van Den Bergh, E. Lerut, R. Oyen, C.M. Deroose, T. Budiharto, F. Ameye, K. Haustermans, 

S. Isebaert, H. Van Poppel (Leuven, Belgium) 

361 Intra-operative prostatic swelling and intra-prostatic shift of targeted points within the prostate during 

high-intensity focused ultrasound: Implication for targeted focal therapy 

S. Shoji, T. Uchida, M. Nakamoto, A.L. De Castro Abreu, S. Leslie, Y. Sato, I. Gill, O. Ukimura (Los Angeles, 

United States of America; Hachioji, Osaka, Japan) 




12.15 - 13.45 Making the diagnosis of bladder cancer 



Chairs: J. Irani, Poitiers (FR) 

T.S. O’Brien, London (GB) 




* 362 Incidental diagnosis of bladder cancer in an obervational study: Clinical stage migration 

J.M. Gaya Sopena, J. Palou, B. Miñana, J.M. Cózar, R. Medina, I. De Zaragoza, F. De La Rosa, I. Ip De Coruña, 

I. Ip De Vall D’Hebron, M.J. Ribal (Barcelona, Murcia, Granada, Sevilla, Zaragoza, Madrid, La Coruña, Spain) 

363 The role of antiplatelet and anticoagulant therapy in the diagnosis of bladder cancer 

M. Moschini, A. Bettiga, G. Burgio, C. Maccagnano, L. Rocchini, F. Pellucchi, G. La Croce, R. Colombo (Milan, 

Italy) 

364 Expedient combination of urine markers enhances their diagnostic performance in the detection of 

urothelial carcinoma 

T. Todenhöfer, J. Hennenlotter, U. Kühs, S. Mohrhardt, M. Esser, S. Aufderklamm, J. Mundhenk, G. Gakis, 

A. Stenzl, C. Schwentner (Tübingen, Germany) 

365 Point-of-care testing for bladder cancer – the UBC rapid test on the concile ® Ω100 reader platform 

provides quantitative results 

T. Todenhöfer, J. Hennenlotter, R. Ritter, U. Hoffmann, P. Blutbacher, A. Deja, A. Hohneder, A. Stenzl, 

C. Schwentner (Tübingen, Germany) 

366 Bladder cancer detection by autofluorescence (ultraviolet) at 308nm (preliminary results) 

C. Egrot, M. Sibony, S.M. Al-Qahtani, O. Cussenot (Paris, France) 

367 Removing routine urine cytology assessment in the one stop haematuria clinic 

J.S. Phull, A.C. Carter, J.D. Osborne, T. Lloyd, S. Sloan, V. Shah (Newport, United Kingdom) 

368 Hematuria one stop clinic: First experience in Italy with 303 cases 

L. Carmignani, S. Casellato, S. Picozzi, G. Bozzini, C. Marenghi, V. Nicosia, M. Cosentino (San Donato 

Milanese, Italy) 

369 Acute imaging for hematuria in the United States: Costs and predictors from the Nationwide Emergency 

Department Sample 

K.R. Ghani, S. Sukumar, J.D. Sammon, W. Jeong, A. Sood, J.O. Peabody, M. Menon, Q-D. Trinh (Detroit, 


370 Visible haematuria in patients under 40 years of age: Where do we stand 

O. Aboumarzouk, S. Mishriki, B. Somani, R. Vint, T. Lam (Aberdeen, United Kingdom) 

371 Preventive medical care in bladder cancer is possible: Risk-adapted screening in urology performed by 

IQUO-Germany 

G.C. Lüdecke, G. Geiges, F. König (Giessen, Berlin, Germany) 


177 

Sunday

Sunday 

372 Ultrasonography and cytology in the follow up of grade 1 non-muscle invasive bladder cancer (NMIBC) 

J. Palou Redorta, S. Skrobot, G. Luccarelli, O. Rodriguez Faba, J.M. Gaya, L. Gausa, R. Parada, A. Breda, 

H. Villavicencio (Barcelona, Spain) 

373 Biopsy in flexible ureterorenoscopy: Comparison of biopsy specimen quality using different biopsy forceps 

P. Liske, A. Fayyazi, V. Zimmermanns, S. Lahme (Pforzheim, Germany) 


Summary 

J. Irani, Poitiers (FR)



12.15 - 13.45 Kidney transplantation: Technique and outcome 



Chairs: G. Karam, Nantes (FR) 

M. Musquera Felip, Barcelona (ES) 




374 Does it really matter which definition of delayed graft function we use after renal transplantation? 

N.J. Dempster, C. Ceresa, E. Aitken, D. Kingsmore (Glasgow, United Kingdom) 

375 Simultaneous native nephrectomy and transplantation in autosomal dominant polycystic kidney disease: 

Efficacy and safety 

L. Marconi, P. Nunes, A. Figueiredo, F. Furriel, A. Roseiro, A. Mota (Coimbra, Portugal) 

376 The treatment of ureteral strictures complicating kidney transplantation. An outcome analysis 

A. Bosio, F. Lasaponara, E. Dalmasso, A. Buffardi, E. Alessandria, S. Santià, G. Pasquale, O. Sedigh, D. Righi, 

L. Biancone, G.P. Segoloni, D. Fontana, B. Frea (Turin, Italy) 

377 Renal transplantation outcomes in elderly patients 


378 Kidney autotransplantation and revascularization surgery - still a good option 

D. Gosalbez Garcia, A. Ciudin, M. Musquera, L. Peri, J. Huguet, M.J. Ribal, A. Alcaraz, C. Mestre, M. Vera 


* 379 Economic impact of pulsatile hypothermic perfusion in an expanded criteria donor transplant program. 

Analysis of the first year since its introduction 

V. Gomez, F. Arias, V. Diez, E. Fernandez, M. Jimenez, R. Rodriguez, C. Galeano, A. Gomis, F.J. Burgos 

(Madrid, Spain) 

* 380 Influence of pre-transplant diuresis in the development of lower urinary tract dysfunction in renal 

transplant patients 

F.A. Escórcio De Almeida, J. Cabral, F. Branco, M. Ramos, S. Ribeiro, A. Fraga (Porto, Portugal) 

381 Evaluation of sexual functions in males receiving renal replacement therapies 

R. Demir, Y. Bostanci, F. Atac, E. Ozden, A. Karatas, S. Sarikaya, Y.K. Yakupoglu (Samsun, Turkey) 

382 An urgent revision of the kidney transplant allocation system is required in order to improve long term 

graft survival results 

G. Pini, N. Mohammed, F. Greco, A. Schumann, F. Kawan, L. Ascalone, K. Weigand, P. Fornara (Halle, 

Germany) 

383 Urological and surgical complications following kidney transplantation from non-heart beating donors 

R. Castañeda-Argáiz, L. Peri Cusi, M. Musquera Felip, E. Sanchez Escudero, D. Paredes, E. García Cruz, 

A. Carrión Puig, A. Alcaraz (Barcelona, Spain) 


179 

Sunday

Sunday 

384 Comparative urological complications of ureteroneocystostomy in kidney transplantation: Transvesical 

Leadbetter-Politano versus extravesical Lich-Gregoir technique 

C. Baston, M. Harza, B. Stefan, A. Preda, I. Manea, B.C. Haineala, S.S. Margaritis Guler, B.G. Badescu, 

A. Omer, I. Sinescu (Bucharest, Romania) 

385 Lich-Gregoir technique and routine use of double J catheter as the best combination to avoid urinary 

complications in kidney transplantation 

E.H. Olarte Barragán, C. Moreno Alarcón, P.A. López González, P. López Cubillana, C.P. Pinzón Navarrete, 

P.F. Gutiérrez Gutiérrez, H.L. Martínez Peralta, G. Gómez Gómez (Murcia, Spain) 

386 Real time-contrast enhanced ultrasound voiding cystography as a screening examination for vesicoureteral 

reflux of renal transplant recipients 

F. Kurtz, M. Straub, J.E. Gschwend, K. Stock (Munich, Germany) 




12.15 - 13.45 Advances in the treatment of penile cancer 



Chairs: S. Egawa, Tokyo (JP) 

R. Salvioni, Milan (IT) 



387 Surgical complications after inguinal lymphadenectomy in penile cancer – an explorative historical cohort 

study for risk factors 

M.M. Stuiver, R.S. Djajadiningrat, N.M. Graafland, A.D. Vincent, C. Lucas, S. Horenblas (Amsterdam, The 

Netherlands) 

388 The characteristics of inguinal lymph nodes may predict pelvic lymph nodes involvement in penile cancer: 

A single-institutional experience 

M. Catanzaro, G. Lughezzani, N. Nicolai, L. Piva, T. Torelli, D. Biasoni, S. Stagni, A. Necchi, P. Giannatempo, 

D. Raggi, E. Farè, M. Colecchia, R. Salvioni (Milan, Italy) 

389 Factors associated with non-sentinel node metastasis in patients with squamous cell carcinoma of the 

penis: A two-institution prospective analysis of 174 inguinal basins with positive sentinel node biopsy 

W. Lam, R. Djajadiningrat, V. Sakalis, H.M. Alnajjar, C. Corbishley, M. Perry, D. Sharma, S. Horenblas, 

N. Watkin (London, United Kingdom; Amsterdam, The Netherlands) 

390 Disease specific mortality after pelvic lymph node dissection containing tumour-positive nodes in penile 

cancer 

R.S. Djajadiningrat, S. Horenblas (Amsterdam, The Netherlands) 

391 Zonal mapping of inguinal lymph nodes using SPECT - implications for lymphadenectomy for penile 

carcinoma 

S. Omorphos, Z. Saad, S. Minhas, A. Kirkham, J. Bomanji, A. Muneer (Nottingham, United Kingdom) 

392 Contemporary survival of penile squamous cell carcinoma: Experience with 1000 patients 

R.S. Djajadiningrat, N.M. Graafland, E. Van Werkhoven, W. Meinhardt, A. Bex, H.G. Van Der Poel, 

S. Horenblas (Amsterdam, The Netherlands) 

393 How reliable is tumor grading in penile cancer – results of a European grading study 

C. Kakies, C. Protzel, L.C. Horn, A.K. Hoehn, G. Kristiansen, J. Koellermann, E. Comperat, A. Lopez Belltram, 

A. Erbersdobler, O.W. Hakenberg (Rostock, Leipzig, Bonn, Hamburg, Germany; Paris, France; Cordoba, 

Spain) 

394 Value of dynamic sentinel node biopsy, ultrasound and fine needle aspiration in the detection of metastatic 

lymph nodes in penile cancer 

R.S. Djajadiningrat, H.J. Teertstra, B.W.G. Van Rhijn, W. Meinhardt, A. Bex, H.G. Van Der Poel, S. Horenblas 

(Amsterdam, The Netherlands) 

395 A comparison of techniques in sentinel lymph node biopsy for penile cancer 

S.H. Shillito, V.K.S Sangar, B. Murby, D. Ashworth, N.R. Parr, B. Taylor, M.W. Lau (Manchester, United 

Kingdom) 

396 Paclitaxel in pretreated metastatic penile cancer: Final results of a phase 2 study 

P. Verze, G. Di Lorenzo, C. Imbimbo, N. Longo, A. Palmieri, F. Fusco, S. De Placido, V. Mirone (Naples, Italy) 


181 

Sunday

Sunday 

397 Early results of the pilot study with the anti-Epidermal Growth-Factor Receptor (EGFR) monoclonal 

antibody panitumumab in patients (pts) with multi-relapsed or refractory squamous cell carcinoma (SCC) 

of the penis 

P. Giannatempo, N. Nicolai, D. Raggi, E. Farè, M. Colecchia, M. Catanzaro, T. Torelli, D. Biasoni, S. Stagni, 

L. Piva, R. Salvioni, A. Necchi (Milan, Italy) 

398 Long-term oncological outcomes of partial penectomy in the treatment of penile cancer: A 30-year singleinstitutional 

experience 

M. Catanzaro, G. Lughezzani, N. Nicolai, T. Torelli, D. Biasoni, S. Stagni, A. Necchi, P. Giannatempo, 

D. Raggi, E. Farè, M. Colecchia, L. Piva, R. Salvioni (Milan, Italy) 

399 Expression patterns of vimentin and e-cadherin in ephitelial-mesenchymal transition: A potential 

prognostic factor in penile cancer 

G. Guimaraes, M.J.L. Souza, W.H. Costa, R.A.R. Oliveira, S.C. Zequi, R.S.M. Campos, T.B.M. Santana, 

I.W. Cunha, F.A. Soares, A. Lopes (Sao Paulo, Brazil) 

400 The treatment of penile carcinoma-in-situ within a UK supraregional network 

M. Lucky, M. Kusuma, B. Rogers, S. Jones, M. Lau, V. Sangar, N. Parr (Wirral, Manchester, United Kingdom) 




12.15 - 13.45 Nocturia, OAB, metabolic syndrome - towards a new management 



Chairs: P. Abrams, Bristol (GB) 

B.A. Dybowski, Warsaw (PL) 




* 401 The incidence of antimuscarinic-associated side effects in overactive bladder (OAB) patients treated with 

mirabegron: Results of a pooled analysis of 3 randomised phase 3 trials 

V. Nitti, C.R. Chapple, G. Amarenco, P. Radziszewski, J. Angulo, M.B. Blauwet, E. Siddiqui, N. Martin (New 

York, Northbrook, United States of America; Sheffield, Chertsey, United Kingdom; Paris, France; Warsaw, 

Poland; Madrid, Spain) 

402 Tolenix (THVD-201), a novel combination of muscarinic agonist (tolterodine) and muscarinic agonist 

(pilocarpine), is efficacious in OAB with less dry mouth compared to tolterodine alone 

R. Dmochowski, K. Duchin, T. Tremblay, M. Paborji, R. Flugel (Nashville, Mountain View, United States of 

America) 

403 The assessment of a novel Transdermal Amplitude Modulated Signal (TAMS) for the treatment of overactive 

bladder syndrome 

M. Slovak, A.T. Barker, C.R. Chapple (Sheffield, United Kingdom) 

404 Clinical efficacy and safety evaluation of imidafenacin as add-on treatment for residual overactive bladder 

symptoms in BPH patients with nocturia; addition study sub-analysis 

M. Gotoh, M. Takeda, O. Nishizawa, M. Yoshida, S. Takahashi, N. Masumori (Nagoya, Yamanashi, 

Matsumoto, Ohbu, Tokyo, Sapporo, Japan) 

* 405 ‘My sleep pattern is a series of naps’. Subjective patient-reported data on what is most bothersome about 

nocturia 

T. Holm-Larsen, C. Albei, F. Andersson, J.P. Nørgaard (Farum, Copenhagen, Denmark; Parsippany, United 


406 Nocturia has a strong impact on productivity - a comparison with different chronic diseases 

F. Andersson, A. Blemings, T. Holm-Larsen, J.P. Nörgaard (Copenhagen, Farum, Denmark) 

407 Predictors of improvement amongst men with a predominant complaint of nocturia 

O.O. Cäkir, B.T. Helfand, K.T. McVary (Chicago, Evanston, United States of America) 

408 An assessment of actual medical management of BPH in a cross-sectional study performed with 

administrative health services databases 

L. Cindolo, C. Fanizza, M. Romero, L. Pirozzi, F. Berardinelli, C. De Nunzio, P. Sountoulides, L. Schips (Vasto- 

Chieti, Rome, Italy; Veria, Greece) 

409 Impact of concurrent statins and 5α-reductase inhibitors use on serum PSA and prostate volume in BPH 

patients 

K.J. Joo, Y.S. Cho, C.H. Kwon, H.J. Park (Seoul, South Korea) 


183 

Sunday

Sunday 

410 Efficacy and safety of tadalafil 5mg administered once daily in men with erectile dysfunction and lower 

urinary tract symptoms; comparative study between metabolic syndrome patients and non–metabolic 

syndrome patients 

A. Kim, B.J. Lim, S. Hong, G. Song, S. Park, J.Y. Joung, T.Y. Ahn (Seoul, Cheonan, Ulsan, South Korea; New 

Brunswick, United States of America) 

411 Metabolic syndrome is correlated with prostatic inflammation in men with severe LUTS related to benign 

prostatic hyperplasia: Results of a preclinical and clinical experimental study 

L. Vignozzi, M. Gacci, I. Cellai, A. Sebastianelli, M. Salvi, R. Santi, A. Morelli, G. Rastrelli, P. Comeglio, 

E. Maneschi, G. Corona, G. Nesi, C. De Nunzio, A. Tubaro, M. Carini, M. Maggi (Florence, Bologna, Rome, 

Italy) 

412 Metabolic syndrome and lower urinary tract symptoms: A possible link to storage symptoms 

C. De Nunzio, M. Gacci, L.C. Costantino, A. Brassetti, F. Cancrini, F. Esperto, R. Lombardo, F. Presicce, 

L. Cindolo, F. Pellegrini, L. Schips, D. Amore, A. Tubaro (Rome, Florence, Vasto, Italy) 




12.15 - 13.45 Paediatric hypospadias repair 



Chairs: S.W. Han, Seoul (KR) 

G. Lackgren, Uppsala (SE) 




413 Changes in erectile, connective tissue, and neural components of the human fetal penis at various 

gestational ages 

C.B.M. Gallo, L.E.M. Cardoso, A. Furriel, B.M.G. Gregório, W.S. Costa, F.J.B. Sampaio (Rio de Janeiro, Brazil) 

414 Urinary tract reconstruction using regenerated oral mucosa sheets made with amniotic membrane as 

matrix 

Y. Naitoh, A. Kawauchi, K. Kamoi, J. Soh, T. Miki (Kyoto, Japan) 

* 415 Long-term functional, cosmetic and sexual outcomes of hypospadias correction performed in childhood 

S. Thiry, S. Dormeus, B. Tombal, F. Wese, A. Feyaerts (Brussels, Belgium) 

416 One stage lingual augmented urethroplasty in repair of distal penile hypospadias 

E.R. Elsayed, A.M. Eliwa, A.A. Teelab, T. Dawood, M. Omran, L. Elbendary, S. Khalil (Zagazig, Egypt) 

417 Distribution of androgen, and estrogen receptors in foreskins of children with or without hypospadias 

H. Kocaturk, S. Adanur, T. Ziypak, C. Gündogdu, Y. Aksoy, G. Okyar (Erzurum, Turkey) 

418 A prospective study to evaluate the role of different variables in results of TIPU 

A.L. Bhat, M. Bhat, R.K. Saran, M. Singla, K.V. Sabbarwal, R. Upadhaya, V. Kumar (Bikaner, India) 

419 Long term results of anastomotic urethroplasty performed in children 

M.I. Kogan, V.V. Mitusov, A.V. Shangichev, V.V. Sizonov, A.V. Hasigov (Rostov on Don, Russia) 

420 Evaluation of nonstented distally folded onlay flap in distal penile hypospadias 

M. Soliman, M.H. Radwan, A.M. Tawfik, A.R. Ramadan, O.Z. Gamal, H. Al Wadaani (Tanta, Egypt; Al Ahsa, 

Saudi Arabia) 

421 Comparison of results of TIPU repair for hypospadias with spongioplasty alone and spongioplasty with 

dorsal Dartos flap 

A.L. Bhat, M. Singla, M. Bhat, R.K. Saran, K.V. Sabharwal, V. Kumar, R. Upadhaya (Bikaner, India) 

422 Combination of techniques for severe hypospadias trying to reduce the morbidity of the repairing surgery 

C. Moreno Alarcón, G. Zambudio Carmona, M.J. Guirao Piñera, K. Cabrejos Perotti, P.Y. Reyes Ríos, 

M. Fernández Ibieta, I. Martínez Castaño, J.I. Ruiz Jiménez (Murcia, Spain) 

423 The use of a perimeatal-based penile skin flaps for cover the repair of a TIP urethroplasty. From 

experimental surgery to clinical practice 

S. Gardikis, K. Kampouri, A. Giatromanolaki, M. Agelidou, C. Kalaitzis, S. Giannakopoulos, S. Touloupidis, 

G. Vaos (Alexandroupolis, Greece) 


185 

Sunday

Sunday 

424 Correlation of severity of congenital penile torsion with type of hypospadias and management by urethral 

plate with spongiosum/urethral mobilization 

A.L. Bhat, R.K. Saran, M. Bhat, K.V. Sabharwal, M. Singla, R. Upadhaya, V. Kumar (Bikaner, India) 

425 Management of hypospadias cripples: Complication rates of the two-staged buccal mucosa repair in 

Bracka technique 

S. Riechardt, R. Dahlem, M. Fisch (Hamburg, Germany) 




12.15 - 13.45 Stones: URS and imaging 



Chairs: E.A. Rodrigues de Lima, Porto (PT) 




426 The efficiency and the safety of flexible ureterorenoscopy is not impacted by stone location 

B. Jacquemet, E. Chabannes, G. Guichard, S. Bernardini, N. Bardonnaud, P. Pillot, H. Bittard, F. Kleinclauss 

(Besancon, France) 

427 Preoperative ureteral stenting is associated with higher stone-free rate after flexible ureterorenoscopy for 

urinary lithiasis 

J.F. Dessyn, P. Pillot, N. Bardonnaud, G. Guichard, S. Bernardini, E. Chabannes, H. Bittard, F. Kleinclauss 

(Besancon, France) 

428 Effects of percutaneous nephrostomy tube during flexible ureteroscopy for renal stone management 

S.Y. Kwon, B.S. Kim, J.N. Lee, H.T. Kim, E.S. Yoo, S.K. Chung, B.W. Kim, T.H. Kim, T.G. Kwon, J.B. Kwon, 

Y.K. Park (Daegu, South Korea) 

429 Impact of surgical experience on safety and efficiency of flexible uretero-renoscopy for urinary stone 

management 

F. Kleinclauss, P. Pillot, N. Bardonnaud, E. Chabannes, S. Bernardini, G. Guichard, H. Bittard (Besancon, 

France) 

430 Comparative study of treatment of renal stones with flexible ureterorenoscopy in obese, morbidly obese 

and normal weight patients 

S. Doizi, C. Bonneau, S. Gil Diez De Medina, O. Traxer (Paris, France) 

431 Retrograde intrarenal surgery (RIRS) in spinal anesthesia: A feasible and effective stone treatment in oneday 

surgery 

A. Bosio, P. Destefanis, E. Alessandria, M. Carchedi, A. Buffardi, E. Dalmasso, S. Santià, F. Fop, A. Bisconti, 

C. Ceruti, D. Fontana, B. Frea (Turin, Italy) 

432 Complications of flexible ureterorenoscopy classified by the modified Clavien grading system (a single 

center’s experience over 10 years) 

S.M. Al Qahtani, G. Raynal, T. Saussez, S.G.D. De Midina, M. Tligui, O. Traxer (Paris, France) 

433 Withdrawn 

434 Decreasing the cost of flexible ureterorenoscopic (FURS) procedures using disposable laser fiber: A cost 

comparison analysis 

A. Chapman, B.K. Somani, S. Healy, A. Robertson, S.G. Kata (Dundee, Southampton, United Kingdom) 

435 Predictive value of preoperative unenhenced computed tomography during ureteroscopic lithotripsy: 

Single institute experience 

S. Kim, D.K. Lee, G.E. Min, H.L. Lee, J.H. Lee, G.H. Yoo (Seoul, South Korea) 


187 

Sunday

Sunday 

436 Predicting urinary stone composition – a radiological study made by urologists 

A. Ciudin, P. Luque, M.G. Diaconu, R. Salvador, A. Franco, R. Alvarez-Vijande, C. Nicolau, A. Alcaraz 


437 Terpene compound drug as medical expulsive therapy for ureterolithiasis: A meta-analysis 

M. Chua, J. Park, J. Castillo, M. Morales (Quezon City, Manila City, Taguig City, Philippines) 

438 CalcuLithiasis: Computer assisted metabolic workup of stone disease 

A. Hoznek, J-P. Haymann, C. Borgogno, O. Traxer (Creteil, Paris, Pontoise, France) 

439 Chemical and mineralogical analysis of ureteral stent encrustation and associated risk factors 

M.C. Sighinolfi, E Galli, G.P. Sighinolfi, S. Micali, A. Mofferdin, N. Nyek Ntep, N. Ferrari, G. Bianchi (Modena, 

Italy) 




12.15 - 13.45 Exploring pharmacological targets in OAB 



Chairs: C.D. Cruz, Porto (PT) 

G. Van Koeveringe, Maastricht (NL) 




* 440 Effects of the combination of β3-adrenoceptor agonists and antimuscarinics on EFS-induced contractions 

of rat isolated urinary bladder 

M. Rekik, C. Rouget, S. Palea, P. Lluel, E.H. Ohlstein, T.D. Westfall (Toulouse, France; Malvern, United States 

of America) 

* 441 Why anticholinergics fail: Oxybutynin and fesoterodine induce a shift from muscarinergic to purinergic 

transmission in the rat bladder 

P. Uvin, M. Boudes, J. Franken, A. Menigoz, S.J. Pinto, T. Gevaert, R. Verplaetse, J. Tytgat, R. Vennekens, 

T. Voets, D. De Ridder (Leuven, Belgium) 

442 A novel neurite outgrowth enhancer, TAC-302 improved voiding dysfunction in rats with STZ-induced 

diabetes 

T. Noma, S. Yoshida, A. Hakozaki, N. Orimoto, E. Sasaki, Y. Hayashi (Tsukuba-Shi, Ibaraki, Japan) 

443 Inhibition of spinal cord fatty acid amide hydrolase reduces bladder overactivity in rats 

C. Fuellhase, A. Russo, F. Castiglione, L. Campeau, A. Bettiga, K-E. Andersson, C. Gratzke, P. Hedlund 

(Munich, Germany; Milan, Italy; Wake Forest, United States of America) 

444 Upregulation of angitensin II type I receptor and connexin 43 in the bladder and urethra of aged rats with 

bladder dysfunction 

M. Ken-Ichi, S. Tobu, M. Noguchi, Y. Sumino, F. Sato, H. Mimata, N. Yoshimura (Pittsburgh, United States of 

America; Saga, Oita, Japan) 

445 Protective effect of cyanidin-3-O-beta-D-glucopyranoside fraction from mulberry fruit pigment against 

oidative damage in streptozotocin-induced diabetic rat bladder 

W.J. Bae, U.S. Ha, J.H. Bae, Y.S. Choi, S.J. Kim, H.J. Cho, S.H. Hong, J.Y. Lee, T-K. Hwang, S.W. Kim (Seoul, 

South Korea) 

446 Alpha1A-adrenoceptor antagonist improves bladder function by increasing bladder blood flow in rat 

model of lower urinary tract dysfunction with or without bladder outlet obstruction 

Y. Goi, M. Nomiya, K. Sagawa, K. Aikawa, Y. Tomiyama, S. Tatemichi, K. Maruyama, M. Kobayashi, 

H. Kusama, O. Yamaguchi (Azumino, Fukushima, Koriyama, Japan) 

447 Micturition is controlled by neuronal cannabinoid receptor type 1 – a urodynamic evaluation of a CB1 

knockout mouse model 

C. Fullhase, L. Campeau, A. Sibaev, M. Storr, C. Gratzke, C. Stief, P. Hedlund, K.E. Andersson (Munich, 

Germany; Winston-Salem, United States of America; Milan, Italy) 


189 

Sunday

Sunday 

448 Quotient of non-micturition-associated and micturition-associated detrusor events determined by 

radiotelemetered cystometry (RTC) as a possible parameter in a Göttingen minipig (GM) model of 

infravesical obstruction (BOO) 

N. Huppertz, C. Fera, D. Leonhäuser, K. Strick, I. Zraik, S. Hirshman, U. Schwantes, R. Kirschner-Hermanns, 

R. Tolba, J. Grosse (Aachen, Bamberg, Bonn, Germany) 

449 Bladder and erectile dysfunctions in the type 2 diabetic goto-kakizaki rat 

D. Behr-Roussel, S. Oger, S. Caisey, M. Kergoat, A. Audet, J. Bernabé, L. Alexandre, F. Giuliano (Montigny- 

Le-Bretonneux, Chilly-Mazarin, France) 

450 Ca2+ sensitization without activation of G protein is independent of calmodulin in contraction of human 

detrusor smooth muscle 

S. Kajioka, N. Shahab, M. Hayashi, R. Takahashi, S. Naito (Fukuoka, Japan; Jakarta, Indonesia) 

451 Chronic treatment with a rho-kinase inhibitor restores ureter peristaltic amplitudes, halts bladder 

enlargement, but does not affect urodynamics in rats with partial outflow obstruction 

R. Buono, F. Benigni, L. Villa (Milan, Italy) 




12.15 - 13.45 Surgery for RCC and the adrenal gland 



Chairs: E. Barret, Paris (FR) 

A. Vuksanovic, Belgrade (RS) 




452 Oncological outcome and complications in patients with renal cell cancer and inferior vena cava thrombus 

C. Piper, D. Porres, D. Pfister, A. Heidenreich (Aachen, Germany) 

453 Resection of renal cell carcinoma with atrio-caval extension: A single centre experience 

J.D. Evans, A.M. Ranasinghe, T.R. Graham, S.J. Rooney, R.I. Bhatt (Birmingham, United Kingdom) 

454 The impact of fat infiltration and renal vein thrombosis on cancer-specific survival in T3a kidney tumors 

R. Schiavina, G.C. Rocca, M. Borghesi, C. Pultrone, F. Chessa, L. Della Mora, G. Saraceni, E. Brunocilla, 

M. Garofalo, F. Manferrari, G. Martorana (Bologna, Italy) 

455 Liver mobilisation reduces the need for cardiopulmonary bypass in renal tumours with inferior vena cava 

extension 

A.A. Mohammed, R.C. Kockelbergh (Kettering, Leicester, United Kingdom) 

456 Comparison of overall survival between the life expectancy and the estimated outcome in patients who 

underwent radical nephrectomy or partial nephrectomy for renal cell carcinoma 

N. Tanaka, Y. Hirao, K. Fujimoto (Kashihara, Japan) 

457 Withdrawn 

458 Predictive factors of severe renal insufficiency after nephrectomy 

J. Berger, Y. Brakbi, Z. Daher Abdi, X. Plainard, M. Lanoe, J. Centi, J.P. Dumas, A. Rousseau, M. Essig, 

A. Descazeaud (Limoges, France) 

459 Complication and conversion rate in a large multicenter series of 222 patients undergoing laparoscopic 

radical nephrectomy for large renal cell carcinoma (> 7 cm) 

L.G. Luciani, V. Vattovani, C. D’Elia, G. Giusti, D. Tiscione, R. Peschechera, A. Celia, C. Fiori, F. Porpiglia, 

P. Parma, T. Cai, G. Malossini (Trento, Milan, Bassano Del Grappa, Orbassano, Mantova, Italy) 

460 Prognostic significance of preoperative neutrophil-to-lymphocyte ratio to predict recurrence in patients 

with non-metastatic clear cell renal cell carcinoma 

S.I. Kim, K.B. Lee, H.S. Ahn, S.J. Kim (Suwon, South Korea) 

* 461 Laparoscopic adrenalectomy in urologic centres – the experience of the German Laparoscopic Working 

Group 

C. Springer, J. Rassweiler, D. Fahlenkamp, N. Kutta, D. Nesius, J. Thüroff, A. Krause, W. Strohmaier, 

A. Bachmann, L. Hertle, G. Popken, S. Deger, D. Jocham, C. Doehn, T. Loch, S. Lahme, V. Janitzky, C. Gilfrich, 

T. Klotz, B. Kopper, U. Rebmann, T. Kälbe, U. Wetterauer, A. Leitenberger, J. Raßler, P. Fornara, F. Greco 

(Halle Saale, Austria; Heilbronn, Chemnitz, Trier, Mainz, Freiberg, Coburg, Münster, Berlin, Lübeck, 

Flensburg, Pforzheim, Pirna, Straubing, Weiden, Kaiserslautern, Dessau, Fulda, Freiburg, Wolfsburg, 

Leipzig, Germany; Basel, Switzerland) 


191 

Sunday

Sunday 

462 Patient-reported satisfaction and cosmesis outcomes following laparoscopic adrenalectomy: LESS vs 

conventional laparoscopic surgery 

S. Inoue, K. Ikeda, K. Hieda, K. Shoji, K. Miyamoto, S. Ohara, K. Kobayashi, M. Kajiwara, J. Teishima, 

A. Matsubara (Hiroshima, Japan) 

463 Anti-hypertensive effect of laparoscopic adrenalectomy (LA) for the patients with primary aldosteronism 

(PA) is limited despite of the accurate determination of responsible lesion by adrenal venous sampling 

(AVS) 

H. Yamamoto, S. Hatakeyama, N. Sugiyama, Y. Suzuki, A. Okamoto, A. Imai, T. Yoneyama, Y. Hashimoto, 

T. Koie, T. Nigawara, K. Terui, S. Sakihara, C. Ohyama (Hirosaki, Japan) 

464 Clinical characteristics of adrenal injury in trauma patients 

K.J. Oh, W.S. Jang, I. Hwang, E.C. Hwang, H.S. Yu, S.O. Kim, S.I. Jung, T.W. Kang, D.D. Kwon, K. Park 

(Gwangju, South Korea) 




14.00 - 15.30 21st century stone management 



Chairs: N.N-P. Buchholz, London (GB) 



V33 Laparoendoscopic single-site (LESS) pyelolitecthomy in a horseshore kidney using conventional rigid 

laparoscopic instruments 

A. Perez-Lanzac De Lorca, J. Soto Villalva, J. Rosety Rodriguez, Z. Okhunov, A. Lusch, A. Conde Giles, 

M.J. Ledo Cepero, R. Garcia-Baquero Garcia De Paredes, B. Madurga Patuel, J.L. Alvarez-Ossorio Fernandez 

(Cadiz, Spain) 

V34 Robot-assisted combined intrarenal surgery for the treatment of a complex kidney stone formation 

S. Poth, C. Wagner, A. Schütte, A.P. Labanaris, J. Zinke, J.H. Witt (Gronau (Westfalen), Germany) 

V35 Combined endoscopic surgery: Flexible retrograde ureteroscopy with percutaneous access in the supine 

position: Endovision 

O. Angerri, J.M. Santillana, F. Sanchez-Martín, F. Millan, H. Villavicencion (Barcelona, Spain) 

V36 Totally ultrasonography guided percutaneous nephrolithotomy: Key steps overview 

J.A. Agudelo, M.G. Finol, E. Arias, N. Ktech, L. Sanchez, R. Montiel, E. Peña, M. Riveros (Maracaibo, 

Venezuela) 

V37 Retrograde flexible ureteroscopic approach combined with Ho:YAG laser lithotripsy for renal stones: How 

large is too large? 

D.R. Multescu, G. Nita, B.F. Geavlete, V. Mirciulescu, P.A. Geavlete (Bucharest, Romania) 

V38 Robotic assisted laparoscopic anatrophic nephrolithotomy: First case report 

R. Sotelo Noguera, O. Carmona, R. De Andrade, C. Rodriguez, G. Fernández, R. Clavijo, R. Garza (Caracas, 

Venezuela) 

V39 Single session bilateral percutaneous nephrolithotomy – applicability of the simplified technique 

J.A. Agudelo, E. Arias, N. Ktech, L. Sanchez, E. Pena, R. Montiel, M. Rivero (Maracaibo, Venezuela) 

V40 Ultra-mini PCNL (UMP) 

J. Desai, R. Solanki (Ahmedabad, India) 


193 

Sunday

Sunday 




14.00 - 15.30 How to optimise staging in prostate cancer? 



Chairs: C.B. Congregado Ruiz, Sevilla (ES) 





* 465 High-Grade Prostatic Intraepithelial Neoplasia (HGPIN) topographical distribution in 1374 prostate 

specimens: Existence of topographical relationship between prostate cancer and HGPIN 

O. Eminaga, R. Hinkelammert, E. Eltze, O. Bettendorf, U. Titze, A. Semjonow (Cologne, Muenster, 

Saarbruecken, Schüttorf, Germany) 

466 Clinical significance of benign prostatic tissue at the soft tissue margin in robotic and open radical 

prostatectomy 

S. Park, M. Shim, D. Yoo, C. Song, C-S. Kim, H. Ahn (Seoul, South Korea) 

467 Are the efforts towards prostate cancer early detection associated with a significant reduction in tumor 

volume? An analysis stratified according to risk categories 

N. Suardi, A. Gallina, U. Capitanio, M. Tutolo, N. Fossati, R. Matloob, A. Russo, A. Salonia, R. Bertini, V. Di 

Girolamo, M. Freschi, C. Doglioni, G. Guazzoni, A. Briganti (Milan, Italy) 

* 468 Cancer volume is an independent predictor for biochemical progression and clinical failure in high-risk 

prostate cancer patients following radical prostatectomy: A single centre experience 

L. Hakim, M. Spahn, P. Gontero, S. Van Bruwaene, A. Briganti, C.Y. Hsu, K. Jeffrey, S. Joniau (Leuven, 

Belgium; Berne, Switzerland; Milan, Italy; Puli, Taiwan; Rochester, United States of America) 

469 Impact of statin use on biochemical recurrence after radical prostatectomy for prostate cancer 

S. Park, M. Shim, D. Yoo, J. Kim, C. Song, J.H. Hong, C-S. Kim, H. Ahn (Seoul, South Korea) 

470 Simple prediction model of side-specific extracapsular extension based on percent positive biopsy cores 

and tumor contact length with the capsule on MRI 

Y. Matsuoka, J. Ishioka, N. Numao, H. Tanaka, S. Yoshida, M. Yokoyama, F. Koga, K. Saito, H. Masuda, 

Y. Fujii, K. Kihara (Tokyo, Japan) 

* 471 Risk stratification among men undergoing radical prostatectomy for high-risk prostate cancer in a US 

cohort: An EMPaCT validation study 

J. Karnes, A. Briganti, P. Gontero, M. Spahn, S. Joniau (Rochester, United States of America; Milan, Turin, 

Italy; Berne, Switzerland; Leuven, Belgium) 

472 Laparoscopic sentinel lymph node (SLN) dissection correlated to extended pelvic lymph node dissection for 

clinically localized prostate cancer (PC): 200 patients 

T.G.M. Rousseau, J. Lacoste, E. Potiron, G. Le Coguic, G. Aillet, M. Lacombe, L. Campion, C. Rousseau (Saint 

Herblain, Nantes, France) 

* 473 Pathological nodal staging score for prostate cancer: A tool to address adequate nodal dissection in men 

treated with radical prostatectomy 

A. Briganti, A. Nonis, C. Brombin, L.A. Kluth, F.K.H. Chun, S.F. Shariat, U. Capitanio, A. Gallina, A. Nini, 

M. Bianchi, M. Tutolo, M. Freschi, C. Doglioni, G. Guazzoni, A. Salonia, P. Rigatti, C. Di Serio (Milan, Italy; 

Hamburg, Germany; New York, United States of America)

474 Pathologic nodal staging scores (pNSS) for prostate cancer: A decision tool for adjuvant therapy after 

radical prostatectomy 

L.A. Kluth, E. Xylinas, F. Abdollah, N. Passoni, H. Fajkovic, T. Faison, M. Sun, P.I. Karakiewicz, C. Seitz, 

P. Schramek, M. Herman, M. Schmid, Y. Lotan, D.S. Scherr, F.K.H. Chun, M. Graefen, A. Tewari, A. Briganti, 

S.F. Shariat (New York, Dallas, United States of America; Milan, Italy; St.Poelten, Viena, Austria; Montreal, 

Canada; Hamburg, Germany) 

475 Does private health insurance status affect the pathological outcomes in patients undergoing radical 

prostatectomy in the United Kingdom? 

S. Robinson, A. Omar, D. Summers, H. Motiwala, A. Rao, O. Karim, M. Laniado (Slough, Berkshire, United 

Kingdom) 

476 Examining the health status of informal caregivers of European patients with prostate cancer 

A. Goren, M. Lees, I. Gilloteau (New York, Princeton, United States of America; Rueil-Malmaison, France) 


195 

Sunday

Sunday 




14.00 - 15.30 Bladder cancer: Imaging and resection 



Chairs: P. Black, Vancouver (CA) 





477 Assessing the value of PET scans in the preoperative staging of bladder cancer 

A.I. Goodfellow, Z. Viney, P. Hughes, S. Hughes, S. Rankin, T. Kay, P. Dasgupta, T.S. O’Brien, M.S. Khan 

(London, United Kingdom) 

* 478 Accuracy of FDG PET-CT compared with conventional CT for the lymph node staging in muscle invasive 

bladder cancer: Prospective study of 58 patients with extended lymphadenectomy 

I.G. Jeong, J.H. Lim, S. Hong, D. You, J.Y. Joung, B. Hong, J.H. Hong, H. Ahn, C-S. Kim (Seoul, South Korea; 

New Brunswick, United States of America) 

479 The accuracy of fluorine-18 fluorodeoxyglucose ([18f]fdg) positron emission tomography in the diagnosis 

of lymph node metastasis for patients undergoing radical cystectomy and extended lymph node dissection 

for invasive bladder cancer 

F. Gevher, C. Demirdag, M. Gezer, M. Halac, K. Sonmezoglu, S. Ataus, C. Obek (Istanbul, Turkey) 

480 The staging role of 18FDG PET-CT in patients with muscle-invasive bladder cancer selected for radical 

cystectomy 

M.C. Ferriero, G. Simone, R. Papalia, S. Guaglianone, R. Sciuto, C.L. Maini, M. Gallucci (Rome, Italy) 

481 PETCT for preoperative evaluation of bladder cancer before cystectomy - localisation of positive 

lymphnodes 

F. Aljabery, G. Lindblom, S. Jahnson (Linköping, Sweden) 

482 Extended results of the use of diffusion-weighted magnetic resonance imaging in the diagnosis of lymph 

node invasion in bladder cancer 

E. De La Peña, B. López, V. Hernández, I. Sola, C. Blázquez, F.J. Díaz, J. Borrego, J. Martel, C. Llorente 

(Madrid, Spain) 

* 483 Prognostic interest to discriminate muscularis mucosae invasion (T1a vs. T1b) in non-muscle-invasive 

bladder carcinomas: Results from a national multicentre study with a central pathology review 

M. Rouprêt, T. Seisen, S. Larre, E. Comperat, C. Mazerolles, G. Fromont, O. Celhay, B. Faivre D’Arcier, 

F. Rozet, J. Irani, M. Soulie, C. Pfister (Paris, Reims, Toulouse, Poitiers, Tours, Rouen, France) 

484 Applications of a flexible ultrasound bronchoscope in the staging of bladder transitional cell tumors: Initial 

experiences 

C. Xu, Z. Zhang, Y. Sun (Shanghai, China) 

485 The prognostic effect of a repeat transurethral resection prior to neoadjuvant chemotherapy for urothelial 

carcinoma of the bladder 

J.M. Gaya, D.D. Holder, M.C. Benson, G.W. Hruby, J. De Castro, J.M. McKiernan (Barcelona, Spain; New York, 

United States of America)

486 Narrow band imaging (NBI) cystoscopy and NBI assisted bipolar TURBT: Does it improve detection rates in 

low and high risk non muscle invasive bladder cancer? The RUA’s experience 

R. Giulianelli, B.C. Gentile, G. Vincenti, S. Nardoni, T. Shestani, L. Mavilla, L. Albanesi, F. Attisani, 

G. Mirabile, F. Pisanti, D. Granata, M. Schettini (Rome, Italy) 

487 Significance of random bladder biopsies in patients undergoing transurethral resection of non-muscle 

invasive bladder cancer 

M. Kumano, Y. Nakano, H. Miyake, M. Fujisawa (Kobe, Japan) 

488 Is transurethral surgery for bladder tumor or BPH safe to operator? 

J.P. Park, C. Zhao, Y.S. Shin, M.K. Kim, H.J. Kim (Jeonju, South Korea; Shanghai, China) 


197 

Sunday

Sunday 




14.00 - 15.30 Living donor nephrectomy and tumours on kidney transplanted 

patients 



Chairs: A. Breda, Barcelona (ES) 





* 489 Transvaginally notes-assisted living donor nephrectomy: Experience after 50 cases 

L. Peri Cusi, M. Musquera Felip, A. Vilaseca Cabo, E. Garcia-Cruz, M.J. Ribal Caparrós, J. Huguet Pérez, 

R. Alvarez-Vijande, A. Alcaraz Asensio (Barcelona, Spain) 

490 Clinical situations requiring right-sided living donor nephrectomy and the safety of hand-assisted living 

donor nephrectomy; single-center experience 

B.J. Lim, A. Kim, D. Choi, G. Song, W. Kim, I.G. Jeong, D.J. Han, B. Hong (Seoul, Busan, South Korea) 

491 Results of ABO-incompatible kidney transplant after five years of experience 

M. Musquera Felip, A. Sanchez-Escudero, L. Peri, F. Diekmann, I. Revuelta, J. Cid, M. Lozano, M. Blasco, 

D. Paredes, J.M. Campistol, A. Alcaraz, F. Oppenheimer (Barcelona, Spain) 

492 Results of the elderly unrelated ABO incompatible kidney transplantation 

T. Kimura, T. Yagisawa, N. Ishikawa, Y. Sakuma, T. Fujiwara, A. Nukui (Shimotsuke, Japan) 

493 Decreasing operating times and complication rates after laparoscopic donor nephrectomy by different 

techniques in highly experienced surgical teams 

E.M.P. Broers, J.F. Langenhuijsen, H.W. Kloke, M.C. Warlé, M.F.P. Van Der Jagt, F.C.H. D’Ancona (Nijmegen, 

The Netherlands) 

494 LESS living donor nephrectomy 

L. Peri Cusi, A. Vilaseca Cabo, M. Musquera Felip, M.J. Ribal Caparrós, J. Huguet Pérez, R. Álvarez-Vijande, 

A. Alcaraz Asensio (Barcelona, Spain) 

495 The impact of socioeconomic status, ethnicity, age and location of transplant centre on live donor kidney 

transplant access and outcomes in the West of Scotland 


496 Effectiveness of our living donor kidney transplant program. evaluation of discarded living donor in kidney 


M. Musquera Felip, I. Revuelta, L. Peri, F. Diekmann, A. Sanchez-Escudero, M.C. Sebastia, R. Salvador, 

D. Paredes, C. Monsalve, A. Alcaraz, J. Campistol, F. Oppenheimer (Barcelona, Spain) 

497 Live donor nephrectomy vs kidney transplants in minority populations: A population based analysis of 

trends 

J.D. Sammon, K.R. Ghani, S. Sukumar, S. Staley, J.O. Peabody, C.G. Rogers, M. Menon, Q-D. Trinh (Detroit, 

United States of America)

* 498 De novo parenchymal renal graft tumors. Multicenter descriptive national study with 25585 renal 

transplants 

F. Gómez Veiga, J. Ponce Diaz-Reixa, E. Lledó, J Blazquez, A. Breda, P. Pardo, M. Musquera, A. Alcaraz, 

J. García-Olaverri Rodríguez, C. Pertusa Peña, F. Burgos, C. García, L. Riera Canals, J. Cózar, A. Rodríguez, 

A. Aguilera, C. Hernández, P. Gutierrez (A Coruña, Madrid, Barcelona, Bilbao, Sevilla, Granada, Tenerife, 

Spain) 

499 Pathologic characteristics and prognosis of renal cell carcinoma in kidney transplant recipients’ native 

kidney: Case-control study 

M. Sodano, N. Arrighi, L. Cristinelli, S. Sandrini, S. Cosciani Cunico, C. Simeone, A. Antonelli (Brescia, Italy) 

500 Prostate carcinoma in solid organ transplant recipients 

X. Tillou, K. Guleryuz, J. Fumey, C. Orczyk, B. Hurault De Ligny, L. Chiche, H. Bensadoun, A. Doerfler (Caen, 

Bordeaux, France) 

501 Urological de novo malignancies after renal transplantation: Incidence and management 

V. Hevia Palacios, V. Gómez Dos Santos, S. Álvarez Rodríguez, V. Díez Nicolás, C. Gómez Del Cañizo, 

C. Galeano Álvarez, A. Gomis Couto, A. Fernández Fernández, R. Marcén Letosa, F.J. Burgos Revilla (Madrid, 

Spain) 


199 

Sunday

Sunday 




14.00 - 15.30 News in prostate and bladder infections 



Chairs: N. Mondaini, Florence (IT) 





502 Bacteraemia during TURP: Is it more prevalent than previously thought? 

A. Mohee, D. Gascoyne-Binzi, J. Sandoe, I. Eardley (Leeds, United Kingdom) 

503 Additional amikacin is effective as a targeted antibiotic prophylaxis for transrectal prostate biopsy in 

patients with fluoroquinolone-resistant E. coli in rectal flora 

Y. Nasu, A. Takamoto, M. Sugimoto, N. Ono (Okayama, Kochi, Japan) 

504 Prostatic penetration of meropenem in humans, and dosage considerations for prostatitis based on sitespecific 

pharmacokinetic-pharmacodynamic evaluation 

G. Nishikawa, K. Ikawa, K. Nakamura, Y. Yamada, K. Zennami, K. Ikeda, N. Morikawa, M. Sumitomo 

(Nagakute, Hiroshima, Kani, Japan) 

505 The Influence of urinary pH on antibiotic efficacy against bacterial uropathogens 

L. Yang, K. Wang, H. Li, J Denstedt, P Cadieux (Chengdu, China; London, Canada) 

506 Identification of bacteria in human urine from the profile of emitted volatile organic compounds 

J.P. Williams, K. Vaughan, B. De Lacy Costello, N.M. Ratcliffe, M.J. Drake (Bristol, United Kingdom) 

507 Psychosomatic disorders in patients with chronic bacterial prostatitis 

O. Banyra, O. Ivanenko, O.D. Nikitin, O.O. Stroy (Lviv, Kiev, Ukraine) 

508 Human papillomavirus infection is not related with prostatitis-realted symptoms in young heterosexual 

men: Results from a population-based case-control study 

R. Bartoletti, E. Meliani, F. Meacci, S. Mazzoli, T. Cai (Florence, Trento, Italy) 

509 Effects of pollen extract in association with vitamins (deprox 500®) for pain relief in patients affected by 

chronic prostatitis/chronic pelvic pain syndrome: Results from a randomized, controlled study 

T. Cai, G.L. Luciani, C. D’Elia, N. Mondaini, G. Malossini, S. Mazzoli, R. Bartoletti (Trento, Florence, Italy) 

* 510 Prospective study assessing the presence of endotoxaemia in patients undergoing transrectal prostate 

biopsy 

S. Sheehan, J. Philpott-Howard, W. Wang, H. Nemade, P.M. Thompson (London, United Kingdom; Beijing, 

China) 

511 Prevalence of prostatitis in men treated with prostatectomy (open prostatectomy, transurethral resection of 

prostate) for benign prostatic hyperplasia induced bladder outlet obstruction 

H. Khairy Salem, H. El Fayoumy, H. Shaker, A. Lotfi, E. Anis (Cairo, Egypt) 

512 Early experience of safety and efficacy of sodium hyaluronate-chondroitin sulfate solution in chronic 

painful conditions in the bladder 

H. Yoon, Y.J. Byun, B.S. Shim, W.S. Chung, D.H. Lee, Y.Y. Park (Seoul, South Korea)

* 513 Characterisation of the inflammatory infiltrate in bladders from patients with bladder pain syndrome, 

multiple sclerosis and mitomycin instillations 

T. Gevaert, T. Roskams, D. De Ridder (Leuven, Belgium) 


201 

Sunday

Sunday 




14.00 - 15.30 TURP and beyond 



Chairs: T. Esen, Istanbul (TR) 





514 Can we forecast the postoperative results in patients with bladder outlet obstruction (BOO)? 

S.H. Alloussi, G. Peters, Y. Al-Bulushi, W. Arafat, C. Lang, S. Alloussi (Neunkirchen, Germany) 

* 515 Is the resected prostate weight a predictive factor of the need for continual medication or reoperation for 

lower urinary tract symptom after transurethral resection of the prostate? A study by applying nationwide 

population based database 

C.C. Lin, A.T.L. Lin, H.J. Chung, Y.H. Huang, K.K. Chen, T.Z. Chen (Taipei, Taiwan) 

516 The management of acute chronic urinary retention: Factors influencing treatment decisions 

W. Green, N. Campain, R. Parkinson (Derby, Nottingham, United Kingdom) 

517 Transurethral resection of prostate and the role of pharmacological treatment with dutasteride in 

decreasing surgical blood loss 

A.L. Pastore, G. Palleschi, V. Petrozza, S. Mariani, M.A. Valentini, F. Barrese, M. Cappa, A. Carbone (Latina, 

Rome, Italy) 

518 Impact of medical therapy on transurethral resection of the prostate (TURP): Two decades of change 

A. Argirovic, D. Argirovic (Belgrade, Serbia) 

519 Clinical characters of patients continuing medical therapy after transurethral prostate surgery for benign 

prostatic hyperplasia with lower urinary tract symptoms 

W.J. Ko, H.H. Han, T.Y. Jung, T.K. Yoo, D.Y. Kim, T.H. Oh, S.S. Byun, S.I. Kim, D.D. Kwon (Gyeonggi-Do, Seoul, 

Daegu, Changwon, Gyeonggido, Chonnam, South Korea) 

520 Bipolar resection versus standard transurethral resection of the prostate: A prospective randomized study 

with 2-year follow-up 

M. Oussama, J. Ghorbel, R. Hedi, M. Zouari, T. Kilani, J. Maaroufi, M. Ben Ali, H. Khouni, M. Dridi, R. Khiari, 

S. Ghozzi, N. Ben Rais (Tunis, La Marsa Tunis, Tunisia) 

* 521 Bipolar vs monopolar TURP: Impact on the overall sexual function and midterm safety-efficacy results of 

an international multicentre randomized controlled trial 

C. Mamoulakis, A. Skolarikos, M. Schulze, C. Scoffone, J. Rassweiler, G. Alivizatos, R. Scarpa, J. De La 

Rosette (Amsterdam, The Netherlands; Athens, Greece; Heilbronn, Germany; Turin, Italy) 

522 Two-year prospective, randomized comparison between the bipolar plasma enucleation of the prostate 

and open prostatectomy in BPH cases over 80 mL 

B.F. Geavlete, F.A. Stanescu, C. Iacoboaie, P.A. Geavlete (Bucharest, Romania) 

523 Systematic review and meta-analysis of the clinical effectiveness of bipolar compared to monopolar 

transurethral resection of the prostate 

M.I. Omar, T. Lam, C.E. Alexander, J. Graham, C. Mamoulakis, M. Imamura, S. MacLennan, F. Stewart, 

J. N’Dow (Aberdeen, United Kingdom; Crete, Greece)

524 Prospective study to compare safety and outcomes of open retropubic adenomectomy and extraperitoneal 

laparoscopic adenomectomy 

A. Garcia-Segui, F. Ramon De Fata, F. Lista, G. Andres, M. Sánchez-Chapado, J.C. Angulo (Mahon, Madrid, 

Spain) 

525 Single port transvesical adenomectomy for BPH 

M. Hisano, F.C. Vicentini, T.S. Agresta, P.K. Mota, M.A. Di Napoli, C.B. Murta, J.F.A. Claro (Sao Paulo, Brazil) 


203 

Sunday

Sunday 




14.00 - 15.30 Paediatric urology: What’s new? 



Chairs: M. De Gennaro, Rome (IT) 

Z. Tchanturaia, Tbilisi (GE) 




526 Prevalence and temporal trends in admissions for urolithiasis in children 

F.J. Penna, J.D. Sammon, K.R. Ghani, S. Sukumar, J.O. Peabody, M. Menon, J.S. Elder (Detroit, United States 

of America) 

* 527 What is the best option for 10- 20 mm renal pelvic stones undergoing ESWL in pediatric population: 

Stenting, alpha blockers or conservative follow-up? 

E. Süer, M. Mermerkaya, F. Afandiyev, E. Öztürk, C. Özcan, B. Burgu, T. Soygür (Ankara, Turkey) 

528 Pediatric ureteroscopy with two guide wires technique 

W. Gamal, A. Mmdouh, M. Husein, A. Hammdy, M. Aldahshoury, E. Moursy, M. Diaa (Sohag, Egypt) 

529 Does previous open nephrolithotomy affect the outcomes of the percutaneous nephrolithotomy in children? 

B. Onal, F. Gevher, B. Argun, C. Dogan, S Citgez, A.U. Onder, A. Erozenci (Istanbul, Turkey) 

530 Assessment of pediatric and adult percutaneous nephrolithtomy complications by modified Clavien grading 

system. A comparative study 

Z. Alam, M.B. Baig, T.W. Saad, S.Z. Zaidi (Karachi, Pakistan) 

531 Percutaneous cystolithotomy in pediatric bladder enlargement and continent reservoirs 

E. Llorens De Knecht, A. Bujons, J. Caffarati, J.M. Garat, H. Villavicencio (Barcelona, Spain) 

532 Lithiasis development in bladder continent reservoirs 

J.M. Lopez, J. Pelegrí, A. Bujons, J. Caffaratti, L.J. Saldaña, M. Cosentino, J.M. Garat, H. Villavicencio 


533 Predictors of renal functional improvement after pyeloplasty in ureteropelvic junction obstruction: Clinical 

value of visually assessed renal parenchymal tracer transit time in 99mTc-mercaptoacetyltriglycine (99mTc- 

MAG3) renography? 

S. Pak, S.H. Song, A. Kim, B. Lim, D. Kim, S. Park, K.S. Kim (Seoul, Ulsan, South Korea) 

* 534 Correction of ureteropelvic junction obstruction in children: National trends and comparative effectiveness 

in operative outcomes 

S. Sukumar, A. Abdo, F.J. Penna, A.A. Friedman, J.D. Sammon, K.R. Ghani, J.O. Peabody, M. Menon, 

Q-D. Trinh, J.S. Elder (Detroit, United States of America; Montreal, Canada) 

535 Inguinal approach for the management of non-palpable testis: Is diagnostic laparoscopy necessary? 

J-S. Park, H.J. Jung, K-H. Bae, C-I. Kim (Daegu, South Korea) 

536 Evaluation of laparoscopy in the diagnosis and management of non-palpable testis 

K. Mursi, A. Salem, M.N. El-Ghoneimy, A.M. Abdel-Hakim, I.R. Saad (Cairo, Egypt)

537 Laparoendoscopic single-site surgery (LESS) for treatment of different urologic pathologies in pediatrics: 

Initial experience 

A. Abdel-Karim, A. Moussa, M. Elmissery, A. Abolfotoh, W. Mahfouz, S. Elsalmy (Alexandria, Egypt) 


205 

Sunday

Sunday 




14.00 - 15.30 Stones: ESWL and PCNL 



Chairs: S. McClinton, Aberdeen (GB) 

H.G. Tiselius, Stockholm (SE) 



538 Withdrawn 

539 Superior ureteric stone clearance with shockwave lithotripsy under anaesthesia: A review of 106 cases 

D.R. Lenaghan, C. Kaiser, J.R. Goad, A.H. Clarke (Melbourne, Australia) 

540 Urgent shock wave lithotripsy as first-line treatment for ureteral stones: A meta-analysis of 570 patients 

S. Picozzi, C. Ricci, S. Casellato, R. Stubinski, G. Bozzini, S. Maruccia, L. Carmignani (San Donato Milanese, 

Italy) 

541 A prospective randomized study comparing the effect of escalating and fixed voltage treatment on stone 

comminution and renal injury during ESWL 

N. Ghosh, S. Mandal, D. Karmakar, S. Bakshi (Kolkata, India) 

542 Shock wave lithotripsy vs flexible ureteroscopy for the treatment of renal stones – a single center 

experience 

C. Persu, V. Mirciulescu, G. Nita, A. Mihalache, P. Geavlete (Bucharest, Romania) 

543 Is it possible to improve the efficacy of ESWL in the treatment of urinary lithiasis? 

E.J. Moran Pascual, M.A. Conca, A. Budia, P. Bahilo, G. García, F. Boronat (Valencia, Spain) 

544 Withdrawn 

545 The Locator: Clinical experience with a novel PCNL navigation device 

J.M. Lazarus, L. Kaestner (Cape Town, South Africa) 

546 “5-PANG system”-version 2: A multiutility system for percutaneous renal access 

A.V. Rawandale, L.G. Patni, P.A. Patil (Dhule, India) 

547 Renal access under computer tomography guidance in percutaneous nephrolithotomy 

P. Sarkis, G. Nawfal, G. Kamel, A. Chemaly (Beirut, Lebanon) 

548 Complications after percutaneous nephrolithotomy using the De La Rosette categorization of the Clavien- 

Dindo system. Single centre experience in 145 cases 

N. Ferakis, K. Bouropoulos, P. Nasopoulou, P. Sinos, P. Anastasopoulos, M. Stavropoulos, F. Venetsanos, 

A. Farmakis, I. Poulias (Athens, Greece) 

549 A new method of objectively assessing the necessity of draining the ureter after mini-PCNL 

J. Rode, U. Nagele, M. Kufner, U. Walcher, M.N. Kimuli, A. Hoznek (Creteil, France; Hall in Tirol, Austria; 

Leeds, United Kingdom) 

550 A novel paraboloid pneumatic intracorporeal lithotriptor: Computer assisted (CAD) analysis and invitro 

comparison with holmium laser 

A.V. Rawandale, L.G. Patni, P.A. Patil (Dhule, India)

551 Effect of epinephrine mix saline irrigation in percutaneous nephrolithotripsy surgery 

J.H. Yoon, T.S. Kim, J.S. Jeung, C.K. Oh, H.K. Ha, S. Kim (Busan, South Korea) 


207 

Sunday

Sunday 




14.00 - 15.30 Uro-genital reconstruction and trauma 



Chairs: J.J. Lopez-Tello Garcia, Madrid (ES) 

D.N. Wood, London (GB) 



552 Laparoendoscopic single site pyeloplasty: A multi-institutional cumulative analysis 

R. Autorino, E. Rizkala, J. Cadeddu, S. Rais-Bahrami, V. Tugcu, A. Kawauchi, A. Abdel-Karim, I. Darweesh, 

A. George, A. Bagrodia, R. Kopp, L. Richstone, R. Stein, J. Kaouk (Cleveland, Dallas, New Hyde Park, La Jolla, 

United States of America; Istanbul, Turkey; Kyoto, Japan; Alexandria, Egypt) 

553 Laparoendoscopic single-site (LESS) versus conventional transperitoneal laparoscopic pyeloplasty: A 

prospective randomized study 

V. Tugcu, Y.O. Ilbey, E. Sonmezay, A.I. Tasci (Istanbul, Turkey) 

554 How long is it necessary to stent after laparoscopic or robot assisted dismembered pyeloplasty? Results of 

a prospective randomized study 

C. Germann, A. Mattei, P. Stucki, M. Behrendt, H. Danuser (Luzern, Switzerland) 

555 Long-term renal function after urinary diversion: A retrospective study 

F.C. Burkhard, J. Xiao-Dong, S. Röthlisberger, F.J. Frey, U.E. Studer (Berne, Switzerland) 

556 Iatrogenic ureteral stricture: Laparoscopic ureteral reimplantation 

J. Gómez Rivas, S. Alonso Y Gregorio, D. López Sánchez, J. Pons Viver, A. Tabernero Gómez, J. Cisneros Ledo, 

J.J De La Peña Barthel (Madrid, Spain) 

557 Late functional results of double-barreled wet colostomy after 169 procedures: Single-institution 

experience 

G.C. Guimaraes, R.A.R. Oliveira, L.Y. Kumagai, G. Baiocchi, S. Aguiar, T.B.M. Santana, S.C. Zequi, 

R.L. Favaretto, W.H. Costa, A. Lopes (Sao Paulo, Brazil) 

558 Urologic complications of cytoreductive surgery and intraperitoneal hyperthermic chemotherapy for 

peritoneal surface malignancy; incidence, risk factors, and management in 934 consecutive procedures 

L. Craven, M. Mirzazadeh, P. Shen, E. Levine, K. Votanopoulos, J. Stewart Iv (Winston Salem, United States 

of America) 

559 Gender reassignment surgery - a 13 year review of surgical outcomes 

R. Rossi Neto, F. Hintz, S. Krege, H. Rübben, F. Vom Dorp, J. Hess (Essen, Krefeld, Germany) 

560 Gender reassignment surgery: A 20 years review of surgical outcomes 

D. Arcaniolo, P. Verze, C. Imbimbo, N. Longo, A. Palmieri, F. Fusco, F. Mangiapia, F. Bottone, V. Mirone 

(Naples, Italy) 

561 Multicentric study of reconstructive after partial amputation of the penis for squamous cell carcinoma 

R. Leonardi, S. Pecoraro, S. Sansalone, M. Silvani, A. Zucchi (Catania, Avellino, Rome, Biella, Perugia, Italy) 

562 Long-term results of 50 ureteral replacements with ileum 

B.K. Komyakov, V.A. Ochelenko (Saint-Petersburg, Russia)

563 High grade renal injury: Non operative management of urinary extravasation and prediction of long-term 

outcomes 

J.A. Long, G. Fiard, V.A Arnoux, J.L. Descotes, O. Skowron, N. Terrier, J.J. Rambeaud (Grenoble, France) 

564 Indications, successes and complications of arterial embolization in renal trauma 

G. Fiard, N. Terrier, C. Sengel, M. Chodez, J-L. Descotes, J-J. Rambeaud, J-A. Long (Grenoble, France) 

565 Accuracy of magnetic resonance imaging for diagnosis of penile fracture – comparison with intraoperative 

findings 

G. Hatzichristodoulou, J.E. Gschwend, K. Herkommer, N. Zantl (Munich, Germany) 


209 

Sunday

Sunday 




14.00 - 15.30 Urothelial cancer: Transurethral surgery and intravesical recurrence 



Chairs: M. Babjuk, Prague (CZ) 

B. Van Rhijn, Amsterdam (NL) 




* 566 Risks and complications of trans-urethral resection of bladder tumour in patients taking anti-platelet 

agents for cardiovascular disease 

S. Casellato, S. Picozzi, G. Bozzini, S. Maruccia, L. Carmignani (San Donato Milanese, Italy) 

567 Is it oncologically safe performing simultaneous transurethral resection of the bladder and prostate? A 

meta-analysis on 1,234 patients 

S. Picozzi, C. Ricci, S. Casellato, G. Bozzini, S. Maruccia, D. Ratti, L. Carmignani (San Donato Milanese, 

Milan, Italy) 

568 Snapshot of transurethral resection of new bladder tumours in the UK audit - STUKA 

A. Patel, J. Catto, D. Rosario, C. Gan, T.S. O’Brien (London, Sheffield, United Kingdom) 

569 TaG1 bladder tumours: One third of all primary tumours and 80% of all recurrent tumours can be treated 

in the office under local anaesthesia 

E.F. Sabir, S. Holmäng (Gothenburg, Sweden) 

570 Comparative therapeutic impact and long-term NMIBC recurrence rates specific for HAL blue light 

cystoscopy, combined NBI–bipolar plasma vaporization and the standard approach in randomized clinical 

settings 

B.F. Geavlete, R.D. Multescu, D.A. Georgescu, M. Jecu, F.A. Stanescu, C. Moldoveanu, P.A. Geavlete 

(Bucharest, Romania) 

571 Long-term follow-up of patients with tumours of the renal pelvis and ureter: How often is a bladder 

tumour diagnosed after 5 tumour-free years? 

S. Holmäng, S.L. Johansson (Gothenburg, Sweden; Omaha, Nebraska, United States of America) 

572 Risk stratification model for predicting bladder recurrence after radical nephroureterectomy for upper 

urinary tract urothelial carcinoma 

J. Ishioka, K. Saito, Y. Matsuoka, N. Numao, F. Koga, H. Masuda, Y. Fujii, Y. Sakai, T. Okuno, C. Arisawa, 

S. Kamata, K. Nagahama, J. Yonese, A. Noro, T. Tsujii, S. Morimoto, Y. Higashi, I. Fukui, K. Kihara (Tokyo, 

Chiba, Ibaraki, Saitama, Japan) 

573 Prediction of intravesical recurrence after radical nephroureterectomy: Development of a clinical decisionmaking 

tool 

E.N. Xylinas, L.A. Kluth, D.S. Scherr, G. Novara, E. Comploj, A. Pycha, H-M. Fritsche, Q-D. Trinh, 

P.I. Karakiewicz, A. Weizer, J.D. Raman, W. Kassouf, M. Zerbib, S.F. Shariat (New York, Ann Arbor, Hershey, 

United States of America; Padua, Bolzano, Italy; Regensburg, Germany; Montreal, Canada; Paris, France) 

574 Detection of factors affecting early bladder recurrence after nephroureterectomy in patients with N0M0 

upper urinary tract urothelial carcinoma 

K. Kuroda, J. Asakuma, A. Horiguchi, S. Tasaki, A. Sato, K. Seguchi, K. Ito, T. Asano (Tokorozawa, Saitama, 

Japan)

575 Segmental ureterectomy versus radical nephroureterectomy for urothelial cancer of the ureter: A matchedpair 

analysis 

T. Klatte, R.E. Zigeuner, M. Rouprêt, M. Babjuk, U. Capitanio, E. Cha, P. Colin, E. Comploj, O. Dalpiaz, 

H.-M. Fritsche, T.R. Herrmann, M. Hora, W. Hübner, A.S. Merseburger, F. Montorsi, L. Nison, G. Novara, 

M. Roscigno, S.F. Shariat, M. Remzi (Vienna, Graz, Korneuburg, Austria; Paris, Lille, France; Prague, Plze˘n, 

Czech Republic; Milan, Bolzano, Padua, Bergamo, Italy; New York, United States of America; Regensburg, 

Hanover, Germany) 

576 Prediction of cancer-specific survival after radical nephroureterectomy for upper tract urothelial 

carcinoma: Development of an optimized post-operative nomogram using decision curve analysis 

M. Rouprêt, V. Hupertan, T. Seisen, P. Colin, E. Xylinas, D. Yates, H. Fajkovic, Y. Lotan, J. Raman, R. Zigeuner, 

M. Remzi, C. Bolenz, G. Novara, W. Kassouf, A. Ouzzane, F. Rozet, O. Cussenot, J. Martinez-Salamanca, 

H-M. Fritsche, T. Walton, C. Wood, K. Bensalah, P. Karakiewicz, F. Montorsi, V. Margulis, S. Shariat (Paris, 

Lille, Rennes, France; New-York, Dallas, Hershey, Texas, United States of America; Graz, Korneuburg, 

Austria; Manheim, Regensburg, Germany; Bergamo, Milan, Italy; Montreal, Canada; Madrid, Spain; 

Nottingham, United Kingdom) 

* 577 Photodynamic diagnosis of non-muscle invasive bladder cancer with hexaminolevulinate cystoscopy: A 

meta-analysis 

M. Burger, H.B. Grossman, M. Droller, J. Schmidbauer, G. Hermann, O. Drăgoescu, E. Ray, F.J. Witjes, 

A. Karl, A. Stenzl, Y. Fradet, J. Burgués, D. Jocham (Würzburg, Munich, Tübingen, Lübeck, Germany; 

Houston, New York, United States of America; Vienna, Austria; Copenhagen, Denmark; Craivoa, Romania; 

London, United Kingdom; Nijmegen, The Netherlands; Quebec, Canada; Palma de Mallorca, Spain) 




211 

Sunday

Sunday 




15.45 - 17.15 Laparoscopic renal surgery 



Chairs: A. Celia, Bassano del Grappa (IT) 



V41 Laparoscopic nephrectomy with cavotomy for right renal cell carcinoma with venous thrombus 

F. Vigués, J.I. Pérez-Reggeti, M. Serrallach, E. Llorens, R. Rodriguez-Malatesta, M.A. López-Costea, E. Franco 


V42 Alternative laparoscopic approaches for kidney neoplasms with tumor thrombus 

L. Rodriguez Villamil, M. Rivas Del Fresno, S. Fernandez-Pello Montes, I. Gonzalez Rodriguez, P. Benito 

Garcia, J. Cuervo Calvo (Gijon, Spain) 

V43 Laparoscopic partial nephrectomy with radiofrequency ablation 

B.Y. Alekseev, A.N. Andrianov, K.M. Nyushko, A.S. Kalpinskiy, N.V. Vorobyev, V.A. Polyakov (Moscow, Russia) 

V44 Left laparoscopic radical nephrectomy: Step-by-step 

R. Sotelo Noguera, O. Carmona, R. De Andrade, F. Santinelli, D. Subira, C. Ignacio, G. Fernández, R. Garza, 

J. Castro, F. Birkhauser, R. Cisneros, D. Canes, R. Clayman (Caracas, Venezuela; Buenos Aires, Argentina; 

Madrid, Spain; Boston, Irvine, United States of America) 

V45 Renovascular and tumor 3-D reconstruction to facilitate robot-assisted anatomical partial nephrectomy 

O. Ukimura, A.L. De Castro Abreu, M. Nakamoto, S. Shoji, S. Leslie, A. Berger, A. Dharmaraja, M. Patil, 

M. Aron, M. Desai, I. Gill (Los Angeles, United States of America) 

V46 Laparoscopic partial nephrectomy with superselective microdissection 

G. Simone, R. Papalia, M. Ferriero, S. Guaglianone, M. Costantini, E. Forastiere, M. Gallucci (Rome, Italy) 

V47 ‘Off-clamp, non-renorrhaphy’ laparoscopic partial nephrectomy with perirenal fat and Gerota’s fascia 

reapproximation: Initial experience of a novel technique 

T.S. Kim, H.Y. Rhew, J.H. Oh, S.H. Kang, S. Kim, H.K. Ha, J. Yoon (Busan, South Korea) 

V48 Selective arterial clamping with aid of near-infrared fluorescence during laparoscopic partial nephrectomy 

P. Macek, F. Rozet, E. Barret, R.E. Sanchez-Salas, M. Galiano, Y. Ahallal, X. Cathelineau (Paris, France)



15.45 - 17.15 Focal therapy in prostate cancer treatment 



Chairs: H.U. Ahmed, London (GB) 




578 Focal therapy for prostate cancer using I125seed implantation: Hemiablative brachytherapy for patients 

selected using extended biopsy and MRI 

K. Saito, T. Kijima, S. Yoshida, M. Yokoyama, J. Ishioka, Y. Matsuoka, N. Numao, F. Koga, H. Masuda, Y. Fujii, 

K. Hayashi, H. Shibuya, K. Kihara (Tokyo, Japan) 

579 Treatment of prostate cancer by 125iodine interstitial brachytherapy: A single center experience 

F. Palmieri, C. Di Stefano, M. Del Duca, G. Mazzotti, M. Morelli, G. Bruno, E. Lamanna, R. Pernetti, S. Voce 

(Ravenna, Italy) 

580 Robotic HIFU: Focus on early complications and imaging evaluation with D-CE-MR after 3 years experience 

F. Pisanti, R. Del Vescovo, F. Attisani, B.B. Zobel, R. Giulianelli (Rome, Italy) 

581 HIFU therapy for castration-resistant prostate cancer 

V.A. Solovov, L.V. Shaplygin, M.O. Vozdvozhenskiy (Samara, Russia) 

582 MR-guided focal cryoablation of prostate cancer recurrence following radiotherapy: A feasibility study 

J. Futterer, J. Bomers, D. Yakar, N.J.T. Van Lin, H. Vergunst, F. De Lange, J.O. Barentsz, J.P. Sedelaar 

(Nijmegen, The Netherlands) 

583 Definition of mid-term MRI follow-up after focal therapy for clinically localized low risk prostate cancer 

F. Mistretta, A. Losa, G. Cardone, M. Lazzeri, G.M. Gadda, G. Lista, A. Larcher, A. Abrate, G. Balconi, 

G. Guazzoni (Milan, Italy) 

584 Early clinical experience of focal therapy for localised prostate cancer using irreversible electroporation 

C.L. Dickinson, M. Valerio, H.U. Ahmed, A. Freeman, C. Allen, M. Emberton (London, United Kingdom) 

585 Focal therapy targeted to the index lesion in multifocal prostate cancer: A prospective development study 

C.L. Dickinson, H.U Ahmed, R.G Hindley, M. Sahu, S. Charman, S. Weir, N. McCartan, A. Freeman, 

A.P Kirkham, C. Allen, J. Van Der Meulen, M. Emberton (London, Basingstoke, United Kingdom) 

586 Candidate selection for quadrant-ablation focal therapy of prostate cancer through a combination of 

extended 14-core biopsy and MRI 

Y. Matsuoka, N. Numao, K. Saito, H. Tanaka, S. Yoshida, M. Yokoyama, J. Ishioka, F. Koga, H. Masuda, 

Y. Fujii, K. Kihara (Tokyo, Japan) 

587 Focal HIFU treatment for prostate cancer. Initial results 

M. Borghi, E. Becher, L. Montes De Oca, V. Chernobilsky (Buenos Aires, Argentina) 

588 Initial results of MR guided laser focal therapy for prostate cancer 

U. Lindner, S.R.H. Davidson, N.E. Fleshner, A. Finelli, A.R. Zlotta, M.A.S. Jewett, T.H. Van Der Kwast, 

M.R. Gertner, E. Hlasny, S.A. McCluskey, W. Kucharczyk, M.A. Haider, J. Trachtenberg (Toronto, Canada) 


213 

Sunday

Sunday 

589 Limitation of the current criteria for biochemical recurrence (BCR) after high intensity ultrasound (HIFU) in 

localized prostate cancer 

R.E. Sanchez Salas, D. Prapotnich, F. Secin, E. Barret, F. Rozet, M. Galiano, A. Mombet, N. Cathala, 

X. Cathelineau (Paris, France; Buenos Aires, Argentina) 


Is focal therapy a real competitor of watchful waiting? 

B. Malavaud, Toulouse (FR)



15.45 - 17.15 Diagnostic imaging for bladder cancer 



Chairs: M. Burger, Würzburg (DE) 

V. Matveev, Moscow (RU) 




* 590 Precision of CT urography in diagnosis of transitional cell carcinoma 

B. Horsburgh, J. Belfield, C. Lynch (Liverpool, United Kingdom) 

591 CT cystography (CTC) with virtual cystoscopy (VC): A new technique in the detection of bladder lesion 

G.M. Busetto, V. Panebianco, R. Giovannone, R. Passariello, V. Gentile, E. De Berardinis (Rome, Italy) 

* 592 A comparison of hexaminolaevulinate (hexvix®) fluorescence cystoscopy and white light cystoscopy for the 

detection of bladder cancer: Results of the HeRo observational study 

A. Lapini, A. Minervini, A. Masala, L. Schips, A. Pycha, L. Cindolo, R. Giannella, T. Martini, G. Vittori, D. Zani, 

F. Bellomo, S. Cosciani Cunico (Florence, Naples, Vasto, Bolzano, Brescia, Milan, Italy) 

593 Narrow band imaging improves the detection of new and recurrent bladder cancers and carcinoma in-situ 

W. Lam, B. Ayres, A. Fernando, M. Perry (London, United Kingdom) 

594 In vivo optical coherence tomography for the evaluation of upper urinary tract urothelial carcinoma: Initial 

results from a pilot study 

M.T.J. Bus, B.G. Muller, D.M. De Bruin, D.J. Faber, M.P. Laguna-Pes, T.G. Van Leeuwen, T.M. De Reijke, 

J.J.M.C.H. De La Rosette (Amsterdam, The Netherlands) 

595 Air versus water as an optical transmission medium in cystoscopy – back to the origins? 

A. Ciudin, M.G. Diaconu, D. Gosalvez, L. Mateu, I. Aisain, A. Garcia-Larrosa, L. Peri, E. Garcia-Cruz, 

A. Franco, A. Alcaraz (Barcelona, Viladecans, Spain) 

596 Feasibility of transurethral resection of the bladder (TURB) done by narrow-band imaging (NBI) 

F. Longo, M. Delor, B. Mangiarotti, A. Del Nero, E. Montanari (Milan, Italy) 

597 Molecular characteristics of tumour tissue, fluorescent tissue during PDD, blood and urine in non-muscle 

invasive bladder cancer patients 

B. Dobrowolska-Glazar, M. Kozakowska, W. Lipczynski, A. Jozkowicz, J. Dulak, Z. Dobrowolski (Cracow, 

Poland) 

598 Comparison of optics and performance of a distal sensor high definition cystoscope, a distal sensor 

standard definition cystoscope and a fiberoptic cystoscope 

A. Lusch, P. Greene, R. Alipanah, A. Perez-Lanzac De Lorca, E.M. McDougall, J. Landman (Orange, United 


599 Photodynamic diagnosis of upper urinary tract urothelial cell cancer 

O. Aboumarzouk, S. Ahmad, B. Somani, H. Moseley, G. Nabi, S. Kata (Dundee, United Kingdom) 

600 Photo-dynamic therapy (PDD) and flexible uretero-renoscopy (FURS) for upper tract TCC 

S. Agrawal, E. Havrenak, D. Hrouda, A. Shamsuddin (London, United Kingdom) 


215 

Sunday

Sunday 

601 Role of conventional cytology in the treatment of upper tract urothelial carcinoma (OSS-UTUC): Results 

from the multi-institutional organ-sparing-UTUC collaboration 

E. Comploj, M. Babjuk, U. Capitanio, E. Cha, P. Colin, H-M. Fritsche, T. Herrmann, W. Hübner, T. Klatte, 

A. Merseburger, F. Montorsi, A. Pycha, M. Roscigno, M. Rouprêt, S. Shariat, R. Zigeuner, M. Remzi 

(Bozen, Milan, Bergamo, Italy; Prague, Czech Republic; New York, United States of America; Lille, France; 

Regensburg, Hanover, Germany; Korneuburg, Vienna, Graz, Austria) 




15.45 - 17.15 Research in kidney transplant 



Chairs: A.B. Chkhotua, Tbilisi (GE) 





602 Blood group antigen-targeting peptide suppresses anti-blood group antibody binding to antigen in renal 

glomerular capillaries after ABO-incompatible blood reperfusion 

T. Yoneyama, S. Hatakeyama, Y. Tobisawa, H. Yamamoto, K. Imanishi, T. Okamoto, N. Tokui, N. Sugiyama, 

Y. Suzuki, S. Kudo, T. Yoneyama, Y. Hashimoto, T. Koie, N. Kamimura, M. N Fukuda, C. Ohyama (Hirosaki, 

Japan; La Jolla, United States of America) 

603 Heat shock protein 90 is involved in antibody-mediated rejection and is a potential target of anti-rejection 

therapy in kidney transplantation 

T. Tanaka, H. Ishida, M. Furusawa, Y. Tamura, H. Kitamura, S. Takahashi, N. Masumori, K. Tanabe, N. Sato, 

T. Tsukamoto (Sapporo, Tokyo, Japan) 

* 604 Ischemic post-conditioning attenuates renal ischemic reperfusion injury via down-regulation of toll-like 

receptor 4 

B.O. Jiang, Q. Chen, D. Kong, X. Liu, Z. Chen (Xianning, Wuhan, China) 

605 Mechanisms of toll-like receptor 4 (TLR4)-mediated inflammation after cold ischemia/reperfusion in the 

kidney 

B.O. Jiang, Q. Chen, L. Hu, W. Zou, X. Liu (Xianning, Wuhan, China) 

606 Beneficial effect of a short-period of hypothermic pulsatile machine perfusion of warm ischemic kidneys 

just before the transplant. Experimental study 

B. Humanes-Sanchez, A. Lazaro-Fernandez, J.C. Jado, M. Mojena-Sanchez, D. Ramirez-Martin, C. Agra, 

E. Alvarez, J.F. Del Cañizo-Lopez, C. Hernandez-Fernandez, A. Tejedor-Jorge, E. Lledo-Garcia (Madrid, Spain) 

607 Experimental evaluation of renal oxygen consumption and antioxidant activity in the post-transplant 

period of kidneys with initial warm ischemia 

A. Lazaro-Fernandez, B. Humanes-Sanchez, M. Mojena, J.C. Jado, D. Ramirez-Martin, C. Agra, 

C. Hernandez-Fernandez, A. Tejedor-Jorge, E. Lledo-Garcia (Madrid, Spain) 

608 The fibrinopeptide Bβ 15-42 attenuates early ischemia reperfusion injury in the mouse kidney 

A. Urbschat, K. Zacharowski, N. Obermueller, K. Rupprecht, P. Paulus (Frankfurt am Main, Germany) 

609 Renoprotective effects of aliskiren following ischemia reperfusion injury 

F. Hammad, S. Al-Salam, L. Lubbad (Al Ain, United Arab Emirates) 

610 Comparison of the clinical outcome and systemic inflammatory marker levels between retroperitoneal and 

transperitoneal laparoscopic donor nephrectomy 

M. Saito, N. Tsuchiya, S. Narita, K. Numakura, S. Akihama, T. Inoue, S. Satoh, T. Habuchi (Akita, Japan) 


217 

Sunday

Sunday 

611 Change in renal function after donor nephrectomy: An assessment using TC 99m-DTPA glomerular filtration 

rate 

H.J. Cho, Y.S. Choi, W.J. Bae, J.H. Bae, S.J. Kim, S-H. Hong, J.Y. Lee, S.W. Kim, T-K. Hwang (Seoul, South 

Korea) 

* 612 Comparison of postoperative estimated glomerular filtration rate between donor and radical nephrectomy 

patients 

D.S. Kim, S. Jung, S.J. Lee, Y.Y. Park, S.H. Jeon (Seoul, South Korea) 

613 Post-transplant renal function is closely correlated with aortic calcification index (ACI) progression rate in 

renal transplant recipients 

S. Hatakeyama, T. Yoneyama, T. Koie, Y. Hashimoto, T. Fujita, R. Murakami, H. Saitoh, T. Funyu, S. Narumi, 

C. Ohyama (Hirosaki, Japan) 




15.45 - 17.15 Urological infections 



Chairs: H.M. Çek, Istanbul (TR) 

R.S. Pickard, Newcastle upon Tyne (GB) 




614 Fournier’s gangrene: Prognostic aspects and predisposing risk factors 

G. Liguori, N. Pavan, A. Rinaldi, S. Bucci, M. Rizzo, S. Siracusano, C. Trombetta (Trieste, Italy) 

615 Comparison of different scoring systems for outcome prediction in patients with Fournier’s gangrene: Our 

experience with 50 patients 

A. Tuncel, T. Keten, Y. Aslan, M. Kayali, A. Erkan, M. Yildiz, A. Atan (Ankara, Turkey) 

616 Our experiences of Fournier’s gangrene: 71 cases 

T. Ziypak, S. Adanur, F. Ozkaya, T. Yapanoglu, G. Okyar (Erzurum, Turkey) 

617 Bacteremia during catheter manipulation: A prospective study 

A. Mohee, D. Gascoyne-Binzi, J. Sandoe, I. Eardley (Leeds, United Kingdom) 

618 Growth quantification and rapid drug susceptibility testing of uropathogenic Candida albicans by 

isothermal microcalorimetry 

G. Bonkat, L. Wernli, O. Braissant, M. Rieken, G. Müller, S. Wyler, T. Gasser, A. Bachmann (Basel, 

Switzerland) 

* 619 Effect of human papillomavirus and chlamydia trachomatis coinfection on sperm parameters in young 

heterosexual men with chronic prostatitis-related symptoms 

T. Cai, F. Wagenlehner, N. Mondaini, C. D’Elia, G. Malossini, S. Mazzoli, R. Bartoletti (Trento, Florence, Italy; 

Giessen, Germany) 

620 Diagnosis of bladder tuberculosis 

E. Kulchavenya (Novosibirsk, Russia) 

621 Phytotherapy in the prevention of recurrent uncomplicated urinary tract infection in women 

V.I. Vashchula, D.M. Nitkin, A.I. Viliukha (Minsk, Belarus) 

622 A prospective observational cohort study on patients with PSA levels ranging from 4 to 10 ng/ml at 

opportunistic screening: Management and responses to ciprofloxacin 1000 mg 

P. Verze, C. Imbimbo, D. Arcaniolo, M. Franco, R. Bianco, A. Palmieri, F. Mangiapia, V. Mirone (Naples, Italy) 

* 623 Bacterial motility and NF-κB activation by clinical isolates from urinary tract infections 

M. Lanz, C. Birchall, A.S.M. Ali, K. Walton, C.L. Townes, L.Y. Lim, S. Roushias, P. Aldridge, R.S. Pickard, 

J. Hall (Newcastle upon Tyne, United Kingdom) 

624 HPV-contamination of laser smoke during laser treatment of condylomata acuminata 

I. Akbarov, A. Tok, U. Wieland, U. Engelmann, S. Wille (Cologne, Germany) 


219 

Sunday

Sunday 

625 Predictors of admission in patients presenting to the emergency department with urinary tract infection 


America) 




15.45 - 17.15 New and old minimally invasive BPH therapies 



Chairs: S. Madersbacher, Vienna (AT) 

K.M.L. Van Renterghem, Hasselt (BE) 



626 NX-1207 for the treatment of lower urinary tract symptoms due to benign prostatic hyperplasia (BPH) 

N.D. Shore, R.F. Tutrone Jr. (Myrtle Beach, South Carolina, Baltimore, Maryland, United States of America) 

627 Effect of onabotulinum toxin type A intraprostatic injection on the outcome of BPH patients refractory to 

medical therapy: A 2-year study 

T. Gorgal Rodrigues De Carvalho, J. Silva, R. Pinto, P. Dinis, F. Cruz (Porto, Portugal) 

628 Clinical outcome of prostatic arterial embolization for patients with benign prostatic hyperplasia and 

moderate to severe lower urinary tract symptoms – 365 cases 

L. Campos Pinheiro, J. Pisco, H. Rio Tinto, T. Bilhim, L. Fernandes, M. Duarte, J. Preira, A. Gouveia Oliveira 

(Lisbon, Portugal) 

629 The Prostatic Urethral Lift (PUL), a minimal-invasive transurethrally-placed implant, proves its efficacy in 

the treatment of LUTS in patients with BPH in daily clinic practice outside of studies 

F. Miller, M. Schönthaler, R. Berges, C. Gratzke, B. Amend, J. Bedke, S. Kruck, J. Zumbé, U. Wetterauer, 

C. Stief, A. Stenzl, K-D. Sievert (Tübingen, Freiburg, Cologne, Munich, Leverkusen, Germany) 

630 The MediTate® temporary implantable nitinol device (TIND) proves safe and effective in relieving bladder 

outlet obstruction related to benign prostatic hyperplasia 

F. Porpiglia, D. Amparore, C. Fiori (Orbassano (Turin), Italy) 

631 Transurethral water vapor therapy for BPH; initial clinical results of the first in man trial and Rezūm I 

pilot study 

C. Dixon, E. Rijo Cedano, D. Pacik, V. Vit, G. Varga, L. Mynderse, D. Hanson, T. Larson (New York, Rochester, 

United States of America; La Romana, Dominican Republic; Brno, Czech Republic) 

632 The factors associated with occurrence and recovery of transient urinary incontinence after holmium laser 

enucleation of the prostate 

J-Y. Han, S-W. Park, L. Sang Don, M.K. Chung (Yangsan, South Korea) 

633 Evaluating the efficacy and impact on quality of life of 120 Watts KTP LASER for treating bladder outlet 

obstruction 

D. Kaushal (Taree, Australia) 

634 Photoselective vaporisation of the prostate using the 180W lithium triborate laser in the treatment of 

benign prostatic obstruction: An international multicenter experience 

A.S. Chung, A. Bachmann, E. Collins, F. Gomez Sancha, S. Tabatabaei, H.H. Woo (Sydney, Australia; Basel, 

Switzerland; San Francisco, Boston, United States of America; Madrid, Spain) 

635 Significant absorption of irrigation fluid is frequently detectable during high-power Greenlight laser 

vaporization of the prostate: Results from a prospective investigation using the expired breath ethanol test 

M.S. Wettstein, N. Grossmann, C.D. Fankhauser, L.J. Hefermehl, J.C. Capol, M. Zimmermann, T. Sulser, 

A. Müller, T. Hermanns (Zürich, Switzerland) 


221 

Sunday

Sunday 

636 Thulium VapoEnucleation of the prostate in patients on oral anticoagulation 

C. Netsch, M. Stöhrer, S. Knipper, T. Bach, T.R.W. Herrmann, A.J. Gross (Hamburg, Hanover, Germany) 

637 Extent of tissue ablation following pure transurethral bipolar plasma vaporization compared to monopolar 

resection of the prostate: 12 months-results of a transrectal three-dimensional ultrasound volumetry study 

B. Kranzbühler, O. Gross, C.D. Fankhauser, M.S. Wettstein, N. Grossmann, L.J. Hefermehl, C. Poyet, R. Largo, 

M. Zimmermann, T. Sulser, A. Müller, T. Hermanns (Zürich, Switzerland) 

638 Greenlight HPS-120W vs Greenlight XPS-180W laser vaporization of the prostate for benign prostatic 

hyperplasia: A global, multi-center, and prospective comparative analysis according to prostate size 

P.A. Hueber, D. Liberman, T. Ben-Zvi, H. Woo, M.A. Hai, A.E. Te, B. Chughtai, R. Lee, M. Rutman, 

R.R. Gonzalez, N. Barber, K.C. Zorn (Montreal, Canada; Sydney, Australia; Wayne, New York, Houston, 

United States of America; Frimley, Surrey, United Kingdom) 


Summary and outlook 

S. Madersbacher, Vienna (AT)



15.45 - 17.15 Paediatric urology developments 



Chairs: G.A. Bogaert, Leuven (BE) 

S. Tekgül, Ankara (TR) 




639 Pediatric extreme weight kidney transplantation 

M. Musquera Felip, A. Vila, L. Peri, M. Piqueras, R. Alvarez-Vijande, L. Garcia, J.A. Camacho, A. Alcaraz 


* 640 Long-term follow up of adult female patients (16-28 years old) with history of bladder exstrophy (BE) 

repair in childhood: Urological and fertility function outcome 

H.K. Salem, M. Eisa (Giza Cairo, Egypt) 

641 Withdrawn 

* 642 Continent ileal tube technique: A simple catheterizable channel construction using ileum when appendix is 

not available 

S. Tekgul, H.S. Dogan, A. Koni, M. Hascicek (Ankara, Turkey) 

643 Histologic responses of different bulking agents which are used for endoscopic reflux treatment, on rats’ 

bladder and subcutanous tissue 

A.C. Bozaci, F.T. Aki, D. Zeybek, S. Muftuoglu, H.S. Dogan, S. Tekgul (Ankara, Turkey) 

644 Endoscopic treatment of occult vesicoureteric reflux significantly reduces risk of febrile urinary tract 

infection 

R. Pichler, C. Berger, D. Oswald, T. Becker, M. Koen, I. Heidegger, A. Strasak, B. Schlenck, W. Horninger, 

J. Oswald (Innsbruck, Linz, Salzburg, Austria) 

645 Previous endoscopic injection significantly reduces reimplantation success: Critical retrospective analysis 

of 398 patients 

A.C.B. Bozaci, B. Ozdemir, S. Tonyali, H.S. Dogan, S. Tekgul (Ankara, Turkey) 

646 Can factors affecting complication rates for urethral reimplantation be predicted? Use of Clavien 

classification system in pediatric population 

E. Süer, C. Özcan, M. Mermerkaya, E. Öztürk, Ö. Gülpınar, B. Burgu, T. Soygür (Ankara, Turkey) 

647 Effects of transforming growth factor on the developing embryonic ureter: An in-vitro megaureter model 

in mice 

E. Öztürk, B. Burgu, Ö. Gülpınar, T. Soygür (Ankara, Turkey) 

648 Long term follow-up after transurethral treatment of infravesical obstruction in boys 

P.M.L. Hennus, J.H. Kieft, E. Hoenjet, S.P. Rynja, T.P.V.M. Jong, J.L.H.R. Bosch, L.M.O. De Kort (Utrecht, The 

Netherlands) 

649 The impact of internal spermatic artery preservation during laparoscopic varicocelectomy on recurrence 

and catch-up growth rate in adolescent 

S. Park, L. Chunwoo, S. Sang Hoon, L. Hunju, M. Kyung Hyun, K. Kun Suk (Ulsan, Seoul, South Korea) 


223 

Sunday

Sunday 

650 Comparative analysis of the long-term oncological results of radical nephrectomy after chemotherapy by 

the videolaparoscopic technique with those of the open technique, for the treatment of Wilms’ tumor 

R. Duarte, F.T. Denes, L.M. Cristofani, A.M. Giron, V. Odone-Filho, U. Tannuri, M. Srougi (Sao Paulo, Brazil) 




15.45 - 17.15 Stones: ESWL, epidemiology and training 



Chairs: M.R. Desai, Naidad (IN) 





651 Transient potential cation channel V4 (TRPV4) is involved in regulation of intraluminal pressure of the 

normal and obstructed ureter 

N. Fossati, L. Villa, R. Buono, F. Benigni, P. Zygmunt, P. Hedlund (Milan, Italy; Lund, Sweden) 

* 652 Effect of tadalafil and diltiazem on ESWL induced kidney injury in rats 

H. Vuruskan, B. Aytac, G. Ozmerdiven, M. Danısoglu, H. Kilicarslan (Bursa, Turkey) 

653 In vivo stone comminution produced by a modified acoustic lens for electromagnetic lithotripters 

A. Neisius, N. Smith, N. Kuntz, T. Schykowski, G. Astroza, M. Lipkin, W. Simmons, G. Preminger, P. Zhong 

(Durham, United States of America) 

* 654 Procedural performance and assessment of technical skills in percutaneous renal access: Using an 

assessment tool in Virtual Reality Perc-Mentor trainer 

F. Zaman, I. Junaid, S. Kachrilas, A. Goyal, A. Bourdoumis, C. Bach, N. Buchholz, J. Masood (London, United 

Kingdom) 

655 Construction and validation of a novel indigenous PCNL simulator: An innovative approach to training 

A.V. Rawandale, L.G. Patani, P.A. Patil (Dhule, India) 

656 Improved porcine ex-vivo organ model for percutaneous renal surgery (sandwich-model) using a 

laparoscopy-training-box (SITUS Box) 

S. Jutzi, F. Imkamp, M.A. Kuczyk, M. Wolters, M. Stoehrer, S. Kruck, U. Walcher, U. Nagele, T.R.W. Herrmann 

(Hanover, Tübingen, Germany; Hall, Austria) 

657 It’s getting hot in here! Monthly variation in emergency department visits for upper urinary tract calculi in 

the United States 

K.R. Ghani, J.D. Sammon, S. Sukumar, W. Jeong, J.O. Peabody, M. Menon, Q-D. Trinh (Detroit, United States 

of America) 

* 658 Percutaneous nephrolithotomy in England: Practice and outcomes described in the Hospital Episode 

Statistics database 

J.N. Armitage, J. Withington, J.H.P. Van Der Meulen, D. Cromwell, J. Glass, W.G. Finch, S.O. Irving, 

N.A. Burgess (Cambridge, London, Norwich, United Kingdom) 

* 659 Trends in utilization and outcomes for percutaneous nephrolithotomy in the United States 

K.R. Ghani, J.D. Sammon, S. Sukumar, D. Pucheril, R. Littleton, J.O. Peabody, N. Bhojani, M. Menon, 

Q-D. Trinh (Detroit, United States of America; Montreal, Canada) 

660 Use of flexible ureteroscopy in the clinical practice for the treatment of renal stones: Results from a large 

European survey 

F. Sanguedolce, E. Liatsikos, P. Verze, S. Hruby, A. Breda, M. Binbay, T. Knoll (London, United Kingdom; 

Patras, Greece; Naples, Italy; Salzburg, Austria; Barcelona, Spain; Istanbul, Turkey; Sindelfingen, Germany) 


225 

Sunday

Sunday 

661 Treatment response in stone patients with gouthy diathesis stratified by BMI 

G. Astroza, A. Neisius, M. Tsivian, N. Kuntz, M. Iqbal, G. Preminger, M. Lipkin (Santiago, Chile; Durham, 


662 Relief more than 2 weeks after ureteral obstruction is a risk factor for long-term renal function 

deterioration 

G. Lucarelli, P. Ditonno, R. De Nola, A. Vavallo, M. Rutigliano, M. Spilotros, S. Impedovo, C. Bettocchi, 

F.P. Selvaggi, M. Battaglia (Bari, Italy) 




15.45 - 17.15 From bench to bedside in pain and OAB 



Chairs: A. Giannantoni, Perugia (IT) 

K. Monastyrskaya, Berne (CH) 




663 Significant biomarker for lower urinary tract symptoms or pain from chronic prostatitis 

K. Shigemura, F. Yamamichi, M. Matsumoto, T. Shirakawa, H. Miyake, S. Arakawa, K. Tanaka, M. Fujisawa 

(Kobe, Japan) 

664 Cytokine responses in BPS/IC type 3C 

Y. Logadottir, C. Lindholm, I. Gjertsson, M. Fall, D. Delbro, R. Peeker (Gothenburg, Örebro, Sweden) 

665 Chronic pelvic pain syndrome in men is associated with reduction of relative gray matter volume in the 

anterior cingulate cortex compared to healthy controls 

L. Mordasini, C. Weisstanner, C. Rummel, G.N. Thalmann, R.K. Verma, R. Wiest, T.M. Kessler (Berne, 

Switzerland) 

666 Therapeutic efficacy of narrow band imaging-assisted transurethral electrocoagulation for ulcer-type 

interstitial cystitis/painful bladder syndrome 

M. Kajiwara, S. Inoue, K. Kobayashi, S. Ohara, J. Teishima, A. Matsubara (Hiroshima, Japan) 

667 Laser ablation of leukoplakia of the bladder 

S.K. Al-Shukri, M.N. Slesarevskaya, A.V. Zharkikh, A. Sokolov (St. Petersburg, Russia) 

668 Posterior tibial nerve stimulation (PTNS) for treatment of non-neurogenic detrusor overactivity and chronic 

pelvic pain 

M. Aggamy, M.A. Gomha, A. Aldayel, R. Almousa, A. Abdelbary, A. Masoud (Dammam, Saudi Arabia; 

Benisuef, Egypt) 

669 Ulcerative and non-ulcerative forms of BPS/IC have a similar response to trigonal onabotulinum toxin A 

injection 

R.M. Correia De Almeida Pinto, T. Antunes Lopes, J. Alturas Silva, C. Martins Silva, P. Dinis, F. Cruz (Porto, 

Portugal) 

670 The efficacy and safety of a multimodal therapy for chronic prostatitis/chronic pelvic pain: A prospective 

randomized study 

A. Giannantoni, S. Proietti, M. Gubbiotti, J.A. Rossi De Vermandois, M. Porena (Perugia, Rozzano, Italy) 

671 Efficacy of Canephron® N against bacterial adhesion, inflammation and bladder hyperactivity 

G. Künstle, C. Brenneis, J. Haunschild (Neumarkt, Germany) 

* 672 Urinary brain-derived neurotrophic factor (BDNF) level does not correlate with detrusor overactivity 

A. Bhide, V. Gopalan, R. Cartwright, A. Digesu, F. Puccini, C. De Nunzio, A. Tubaro, V. Khullar (London, 

United Kingdom; Rome, Italy) 


227 

Sunday

Sunday 

* 673 Urinary levels of neurotrophins differ between women with stress urinary incontinence and women with 

urgency urinary incontinence 

T. Antunes Lopes, R. Pinto, S. Carvalho-Barros, C.M. Silva, C.D. Cruz, F. Cruz (Porto, Portugal) 


Discussion on posters 672 & 673 

A. Giannantoni, Perugia (IT)



15.45 - 17.15 Androgen deprivation therapy, still to improve.. 



Chairs: F. Calais Da Silva Junior, Lisbon (PT) 





* 674 Enzalutamide monotherapy: Results from a phase 2 study in hormone naive prostate cancer patients 

B. Tombal, M. Borre, P. Rathenborg, P. Werbrouck, A. Heidenreich, P. Iversen, E. Baskin-Bey, F. Perabo, 

D. Phung, M.R. Smith (Brussel, Kortrijk, Belgium; Skejby, Herlev, Copenhagen, Denmark; North-Rhine 

Westphalia, Germany; Staines, United Kingdom; Northbrook, Boston, United States of America; Leiderdorp, 

The Netherlands) 

* 675 Survival and metastases among non-metastatic prostate cancer patients treated with androgen 

deprivation therapy (ADT) in Denmark, 1997-2010 

M. Nguyen-Nielsen, M.L. Maegbaek, R.K. Hernandez, H.T. Sørensen, V. Ehrenstein, A. Liede (Århus, 

Denmark; Thousand Oaks, South San Francisco, United States of America) 

676 Polymorphisms of androgen transporting gene SLCO2B1 may participate in hormone-resistance and ethnic 

difference in response to androgen deprivation therapy 

N. Fujimoto, T. Kubo, H. Bui, T. Yoshida, T. Matsumoto (Kitakyushu, Japan) 

677 Lower risk of cardiovascular (CV) events and death in men receiving ADT by gonadotropin releasing 

hormone (GnRH) antagonist, degarelix, compared with luteinising hormone-releasing (LHRH) agonists 

B. Tombal, P. Albertsen, A. De La Taille, E. Van Der Meulen, B-E. Persson, T.K. Olesen, J. Nilsson (Brussels, 

Belgium; Farmington, United States of America; Paris, France; Copenhagen, Denmark; St Prex, Switzerland; 

Lund, Sweden) 

678 Disease control-related outcomes from an analysis of six comparative randomised clinical trials of 

degarelix versus luteinising hormone-releasing hormone (LHRH) agonists 

K. Miller, E.D. Crawford, N. Shore, C. Karup, E. Van Der Meulen, B-E. Persson (Berlin, Germany; Aurora, 

Myrtle Beach, United States of America; Copenhagen, Denmark; St Prex, Switzerland) 

679 PSA patterns during off-time treatment period in patients undergoing intermittent androgen deprivation. 

Is PSA doubling time reliable in every case? 

R.E. Sanchez Salas, D. Prapotnich, F. Olivier, M. Fhima, P. Descamps, S. David, F. Secin, E. Barret, 

M. Galiano, F. Rozet, X. Cathelineau (Paris, France; Buenos Aires, Argentina) 

680 Intermittent versus continuous cyproterone acetate in bone metastatic prostate cancer: Results of a 

randomized trial 

P.C.M.S. Verhagen, M.F. Wildhagen, A.M. Verkerk, W.A.B.M. Bolle, E. Vjaters, H. Pagi, L. Kukk, D. Bratus, 

R. Fiala, C.H. Bangma, F.H. Schröder, G.H. Mickisch (Rotterdam, The Netherlands; Riga, Latvia; Tallinn, 

Estonia; Maribor, Slovenia; Olomouc, Czech Republic; Bremen, Germany) 

681 Correlation between information provided by urologists and messages understood by patients when 

starting androgen blockade for advanced prostate cancer 

T. Lebret, B. Duclos-Morlaes, D. Comet, S. Droupy (Suresnes, Levallois-Perret, Nanterre, Nîmes, France) 


229 

Sunday

Sunday 

682 When to start antiresorptive treatment in prostate cancer patients on androgen suppression 

D. Lorente Garcia, J. Planas, A. Celma, F. Agreda, C. Konstantinidis, I. Iztueta, J. Placer, J. Morote, G. Encabo 


683 Androgen deprivation therapy improve disease free survival in patients treated with salvage radiotherapy 

- a national Danish study 

M. Ervandian, M. Høyer, S. Elleberg Petersen, L. Sengeløv, S. Hansen, M. Holmberg, J. Svejstrup, P. Meidahl 

Petersen, M. Borre (Århus, Herlev, Odense, Aalborg, Copenhagen, Denmark) 

684 Digoxin lowers the incidence of prostate cancer - a nationwide population-based study 

W.J. Huang, W.Y.H. Chang, W.C.P. Lin, A.T.L. Lin, K.K. Chen (Taipei, Taiwan) 


Summary on androgen deprivation therapy and its side effects 

L.N. Türkeri, Istanbul (TR)

Sunday, 17 March - Sponsored Sessions 


17.45 - 19.15 Urinary incontinence - Optimising the patient experience and improving outcomes page 409 

Amber Hall 6 - Level S2 Sponsored by ALLERGAN and PORGÈS, a COLOPLAST division 


17.45 - 19.15 Management of OAB: Electing the right candidate for the right patient page 410 

eURO Auditorium - Level S2 Sponsored by ASTELLAS 

17.45 - 19.15 Nocturia: Definitive diagnosis for better patient outcomes page 411 

Yellow Hall 1-2-3 - Level N1 Sponsored by FERRING PHARMACEUTICALS 

17.45 - 19.15 Towards individualisation of prostate cancer treatments: From bench to bedside page 412 

Brown Hall 3 - Level S2 Sponsored by IPSEN 

17.45 - 19.15 Clinical conundrums in the treatment of metastatic castration-resistant prostate cancer page 413 

Silver Hall - Level N2 Sponsored by JANSSEN PHARMACEUTICAL COMPANIES OF JOHNSON & JOHNSON 

17.45 - 19.15 Burden of illness and optimal management of recurrent cystitis page 414 

Amber Hall 1-2 - Level S2 Sponsored by OM PHARMA SA 

17.45 - 19.15 BPH and inflammation, from lab to clinic page 415 

Red Hall 1 - Level N1 Sponsored by PIERRE FABRE MEDICAMENT 

17.45 - 19.15 Silodosin: A first choice for the pharmacological treatment of BPH page 416 

Brown Hall 1-2 - Level S2 Sponsored by RECORDATI 

17.45 - 19.15 Focal therapy in localised prostate cancer page 417 

Amber Hall 7-8 - Level S2 Sponsored by STEBA BIOTECH 


231 

Sunday

Monday, 18 March - EAU Programme 


07.30 - 11.00 Lower urinary tract management: How to balance benefits with 

side-effects 


Chairs: P. Radziszewski, Warsaw (PL) 


07.30 - 08.00 Highlight Session 2 

Oncology 


Stone disease 

P. Chlosta, Wroclaw (PL) 

Andrology 

M. Fode, Herlev (DK) 



08.05 - 08.25 Update Pelvic floor anatomy for urologists 

H. Fritsch, Innsbruck (AT) 


It is common knowledge that the pelvis displays the most marked skeletal differences between males and 

females; hence, the anatomy of the male and female pelvic floor differs widely as to the striated muscles, 

the urinary organs, the striated sphincters and the subperitoneal connective tissue as well as topographical 

relationships. These differences will be pointed out thoroughly with regard to urinary continence. 

08.25 - 09.05 Debate The role of urodynamic assessment in contemporary practice 

Moderator: M. Lucas, Swansea (GB) 

What do we mean by urodynamics? 

M. Lucas, Swansea (GB) 

Pro - Invasive urodynamics are essential in all patients undergoing surgical intervention 

P. Abrams, Bristol (GB) 

Con - Invasive urodynamics are essential in all patients undergoing surgical intervention 

S. Herschorn, Toronto (CA) 


Urodynamic testing has become, over a period of 30 years, an accepted part of the workup of patients before 

surgery for either urinary incontinence or prostatic obstruction. The framework of thinking that they provide 

about bladder and urethral function underpins our understanding of the pathophysiology, and the way we 

plan treatment. 

However, recent statements and new trials have raised questions about the clinical utility of urodynamics. 

Are they essential? Are they worthless? - or can their use be rationalised according to the clinical problem? 


233 

Monday

Monday 

09.05 - 09.25 American Urological Association (AUA) Lecture Cellular-based therapy of urinary incontinence 


L. Rodriguez, Los Angeles (US) 


The aim of the lecture is to provide an update on the scientific advances made to date in cellular and stem 

cell based therapies for the treatment of urinary incontinence. Available laboratory, pre-clinical and human 

data will be reviewed. The objectives of the lecture are: 1) To help understand the clinical problem of SUI, 

2) To help familiarise the audience with the potential benefits and pitfalls of stem cell based therapies, 3) 

To provide an update on the current state of the art of cell based therapies for the treatment of urinary 

incontinence. 

09.25 - 10.05 Case discussion Sling, sphincter or balloon for male urinary incontinence 

Moderator: J.W. Thüroff, Mainz (DE) 

Sphincter K-D. Sievert, Tübingen (DE) 

Balloon E. Chartier-Kastler, Paris (FR) 

Sling P. Rehder, Innsbruck (AT) 


The case discussion panel on surgical treatment options for male sphincteric incontinence aims at providing 

detailed insight into mechanism of action of the different surgical strategies and their respective advantages 

and disadvantages. This will eventually translate into defining criteria and/or tests for securing the indications 

for each surgical technique and their respective limitations (contra-indications). Clinical examples are 

presented and the best possible solutions for the individual cases are discussed. 

10.05 - 10.45 Debate What the practising urologist needs to know about new therapies for LUTS. When, where and how 

do they work? 

Moderator: C.R. Chapple, Sheffield (GB) 

Introduction to new therapies for lower urinary tract symptoms - setting the scene 


PDE5 inhibitors in the management of LUTS 


Beta-3 agonist therapy 


Botulinum toxin therapy - which agent? 

T.M. Kessler, Zürich (CH) 

New avenues (neurotoxins and combination therapy) in treating the “BPH” patient 

M.J. Speakman, Taunton (GB) 

Discussion on how these new approaches relate to contemporary therapy 


To provide the practising clinician with a comprehensive update on what they need to know about the latest 

new therapies for LUTS. 

The participants will provide a detailed overview on how these therapies are thought to work and the 

evidence base relating to their use. 

These treatments will be discussed against the backdrop of existing therapy and a detailed discussion will 

be held as to:- 

• the role of these therapies in the context of existing pharmacotherapy, will they replace it and if so in which 

patients 

• how they are thought to exert their effect

• what the potential is for combination therapy using existing agents and do these therapies add further 

possibilities 

Take home message 

A clear understanding on contemporary pharmacotherapy for both the male and female patient with LUTS 

and how to most effective treat them in 2013. 

10.45 - 11.00 State-of-the-art lecture Is TURP the gold standard for benign prostatic obstruction? 



235 

Monday

Monday 




07.30 - 09.00 Miscellaneous 



Chairs: P. Albers, Düsseldorf (DE) 

I. Eardley, Leeds (GB) 


V49 Laparoscopic living donor nephrectomy with the use of 3 mm instruments and laparoscope: Early 

experience at a tertiary center 

A. Breda, G. Lucarelli, O. Rodriguez-Faba, L. Gausa, J. Ponce De Leon, H. Villavicencio (Barcelona, Spain) 

V50 Right-sided terminal hand assisted laparoscopic donor nephrectomy. The Halle experience 

G. Pini, N. Mohammed, F. Greco, A. Schumann, F. Kawan, L. Ascalone, K. Weigand, P. Fornara (Halle, 

Germany) 

V51 Robotic microsurgical targeted denervation of the spermatic cord for chronic groin pain 

A. Gudeloglu, J. Brahmbhatt, K. Priola, S. Parekattil (Winter Haven, United States of America) 

V52 Robotic assisted microsurgical vasectomy reversal 

J. Brahmbhatt, A. Gudeloglu, K. Priola, S. Parekattil (Winter Haven, United States of America) 

V53 Laparoscopic resection of a large functional paraganglioma in the organ of Zuckerkandl (PZ) 

D. Veneziano, O. Sicuro, E. Sgrò, L. Carbone, P. Cozzupoli (Reggio Calabria, Italy) 

V54 Modified surgical reconstructive technique in male-to-female gender reassignment minimizes 

postoperative risks and improves final outcome 

B. Amend, J. Seibold, A. Stenzl, K-D. Sievert (Tübingen, Germany) 

V55 Use of bowel for savage vaginoplasty in male to female transsexual 

C. Trombetta, C. Imbimbo, G. Liguori, P. Verze, N. Pavan, V. Mirone (Trieste, Naples, Italy) 

V56 Corpora cavernosa reconstruction with porcine dermal matrix graft and inflatable penile prosthesis 

implant in a case of massive, post-infective penile fibrosis 

F. Colombo, G. Gentile, R. Djinovic, A. Franceschelli (Bologna, Italy; Belgrade, Serbia)



09.15 - 10.45 Management of high risk prostate cancer 



Chairs: M. Ramirez Backhaus, Valencia (ES) 





685 Risk-factors for biochemical recurrence- and clinical metastasis-free survival in D’Amico high-risk patients 

after radical prostatectomy 

A. Becker, P. Tennstedt, T. Steuber, M. Graefen, H. Heinzer (Hamburg, Germany) 

* 686 Association between time to biochemical recurrence and cancer specific and other cause mortality in men 

with high risk prostate cancer treated with radical prostatectomy without adjuvant treatments. A multiinstitutional 

analysis 

M. Bianchi, J.R. Karnes, S. Joniau, M. Spahn, P. Gontero, F.K. Chun, J. Hansen, G. Marchioro, F. Abdollah, 

B. Tombal, U. Capitanio, P. Bastian, H. Van Der Poel, R. Sanchez-Salas, A. Briganti (Milan, Turin, Novara, 

Italy; Rochester, United States of America; Leuven, Brussels, Belgium; Berne, Switzerland; Hamburg, 

Munich, Germany; Amsterdam, The Netherlands; Paris, France) 

687 A competing-risks analysis of survival after alternative treatment modalities for locally advanced prostate 

cancer patients: A population-based study 

F. Abdollah, M. Bianchi, N.M. Passoni, A. Nini, P. Dell’Oglio, S. Corti, R. Colombo, C. Cozzarini, R. Damiano, 

N. Di Muzio, M. Sun, A. Briganti (Milan, Catanzaro, Italy; Montreal, Canada) 

* 688 Predicting prostate cancer specific outcome after radical prostatectomy among men with (very) high-risk, 

locally advanced PCa with or without additional high risk factors: A multi-institutional retrospective cohort 

study of 1644 patients 

S. Joniau, A.R. Alberts, F. Moltzahn, A. Briganti, J. Karnes, P. Gontero, E. Weyne, C-Y. Hsu, G. Marchioro, 

B. Tombal, J. Chun, P. Bastian, H. Van Der Poel, R. Sanchez-Salas, M. Spahn (Leuven, Brussels, Belgium; 

Berne, Switzerland; Milan, Turin, Novara, Italy; Rochester, United States of America; Puli, Taiwan; Hamburg, 

Munich, Germany; Amsterdam, The Netherlands; Paris, France) 

689 Impact of surgery delay in patients diagnosed with high grade prostate cancer 

S. Samavedi, H. Abdul-Muhsin, O. Schatloff, K. Palmer, G. Ebra, V. Patel (Celebration, United States of 

America) 

690 Can immediate adjuvant therapy be avoided in patients with prostate specimen Gleason ≥ 8, organ 

confined disease, absence of positive lymph nodes and surgical margins, who undergo robot-assisted 

laparoscopic radical prostatectomy? 

A.P. Labanaris, V. Zugor, J.H. Witt (Gronau, Germany) 

691 Comparison of the survival rate between prostate cancer patients with Gleason score 8 and those with 

score 9 or higher for different therapeutic approaches 

H.K. Ha, J.Y. Ku, J.H. Ahn, S.M. Kang, C.H. Lee, S.D. Kim, T.S. Kim, J.H. Yoon, M.K. Chung, D.S. Kim, 

J.M. Chung, J.Z. Lee (Busan, South Korea) 

692 Radio-guided surgery: Our experience in sentinel lymph node removal in prostate cancer 

M. Grasso, S. Blanco, A.A.C. Grasso, G. Bovo, A. Crespi, M. Arosio (Monza, Milan, Italy) 


237 

Monday

Monday 

693 External validation of the updated nomogram predicting lymph node invasion in patients with prostate 

cancer undergoing extended pelvic lymph node dissection 

M. Gacci, M. Lanciotti, R. Schiavina, L. Masieri, S. Serni, V. Vagnoni, F. Abdollah, M. Carini, G. Martorana, 

F. Montorsi (Florence, Bologna, Milan, Italy) 

694 Prediction of long-term cancer recurrence after radical prostatectomy in patients with lymph node 

invasion: Results of conditional survival analysis 

F. Abdollah, A. Briganti, F. Castiglione, N. Suardi, C. Cozzarini, N. Di Muzio, R. Lucianò, G. Gandaglia, 

A. Nini, G. Zanni, M. Freschi, J. Karnes (Milan, Italy; Rochester, United States of America) 

695 Impact of stage migration on node positive prostate cancer rate and features: A 20-year, single institution 

analysis in men treated with extended pelvic lymph node dissection 

N. Fossati, F. Abdollah, A. Gallina, U. Capitanio, N. Suardi, A. Salonia, L. Villa, M. Tutolo, E. Di Trapani, V. Di 

Girolamo, V. Scattoni, G. Guazzoni, P. Rigatti, A. Briganti (Milan, Italy) 

696 10 year German experience of cryoablation for primary high risk localized prostate cancer using 17 gauge 

cryoneedles technology 

U. Witzsch, W. Dillenburg, E. Becht (Frankfurt am Main, Germany) 




09.15 - 10.45 Urothelial cancer treatment: Intravesical approaches 



Chairs: A. Noon, Sheffield (GB) 

M. Rouprêt, Paris (FR) 




697 Prognostic factors and risk groups in T1G3 patients initially treated with BCG: Results of a multicenter 

retrospective series in 1743 patients 

P. Gontero, R. Sylvester, F. Pisano, S. Joniau, K. Van Der Eeckt, V. Serretta, S. Larré, S. Di Stasi, B. Van Rhijn, 

A. Witjes, A. Grotenhuis, R. Colombo, A. Briganti, M. Babjuk, V. Soukup, P.U. Malmstrom, J. Irani, N. Malats, 

J. Baniel, R. Mano, T. Cai, E. Cha, P. Ardelt, J. Varkarakis, R. Bartoletti, M. Spahn, G. Dalbagni, S. Shariat, 

J. Karnes, J. Palou (Turin, Palermo, Rome, Milan, Trento, Florence, Italy; Brussels, Leuven, Belgium; Oxford, 

United Kingdom; Amsterdam, Nijmegen, The Netherlands; Prague, Czech Republic; Uppsala, Sweden; 

Poitiers, France; Madrid, Barcelona, Spain; Tel Aviv, Israel; New York, Rochester, United States of America; 

Freiburg, Würzburg, Germany; Athens, Greece) 

698 Intravesical sequential BCG and electromotive mitomycin versus BCG alone for stage pT1 urothelial bladder 

cancer 

S.M. Di Stasi, C. Verri, E. Liberati, F. Masedu, M. Valenti (Rome, L’Aquila, Italy) 

699 A prospective comparative study of intravesical Bacillus Calmette-Guérin therapy for non-muscle invasive 

bladder cancer: Tokyo strain vs Connaught strain 

A. Sengiku, M. Ito, Y. Miyazaki, H. Sawazaki, T. Takahashi, K. Ogura (Otsu, Japan) 

700 Results of a phase-1 dose escalation study of intravesical TMX-101 in patients with non-muscle invasive 


J. Falke, J.M. Lammers, H.C. Arentsen, M. Ravic, R. Pozzi, E.B. Cornel, H. Vergunst, T.M. De Reijke, J.A. Witjes 

(Nijmegen, Hengelo, Amsterdam, The Netherlands; London, United Kingdom; Bioggio, Switzerland) 

701 Statin use is not associated with prognosis or BCG-response in patients with non-muscle invasive bladder 

cancer 

E.N. Xylinas, J.J Crivelli, L.A Kluth, N. Passoni, S. Holmang, P.I. Karakiewicz, E. Comploj, A. Pycha, Y. Lotan, 

M. Zerbib, D.S. Scherr, S.F. Shariat (New York, Dallas, United States of America; Milan, Bolzano, Italy; 

Gothenburg, Sweden; Montreal, Canada; Paris, France) 

702 Is there any influence on the real number of BCG instillations applied on the outcome of high-grade nonmuscle-invasive 

bladder cancer (NMIBC)? 

J.A. Portillo Martin, R. Madero, E. Solsona, J.M. Fernández, L. Martínez-Piñeiro, M. Montesino, M. Unda, 

A. Ojea, J. Rodríguez, J. Palou, J.A. Martínez-Piñeiro (Santander, Madrid, Valencia, Oviedo, Pamplona, 

Bilbao, Vigo, Barcelona, Spain) 

703 Flow cytometry based immunoassay to monitor the BCG-therapy of the non muscle invasive bladder 

cancer 

J. Elsaesser, M. Janssen, F. Becker, H. Suttmann, C-H. Ohlmann, U. Sester, M. Stöckle, M. Sester (Homburg, 

Neunkirchen, Hamburg, Germany) 


239 

Monday

Monday 

704 Tumour recurrence and intravesical BCG significantly impact upon health related quality of life in patients 

undergoing conservative management for superficial bladder cancer 

N. Sapre, A. Wooten, H. Siddons, A.J. Costello, C.M. Hovens, N.M. Corcoran, P. Anderson (Melbourne, 

Australia) 

705 BCG induced bladder and systemic adverse events assessed by weekly self-administered questionnaire 

can predict SAEs and course interruption 

B. Tamarelle, A. Picard, N. Arfi, A. Pages, X. Martin, M. Colombel (Lyon, France) 

706 Early vs delayed mitomycin C instillations after TUR in patients with non-muscle invasive bladder tumours: 

A prospective multicentre randomised trial 

T. Van Ginkel, J. Nieuwenhuijzen, R. Ter Haar, D. Newling, R.J.A. Van Moorselaar (Amsterdam, The 

Netherlands) 

707 Organ preservation in high- and extreme high risk non-muscle-invasive bladder cancer (NMIBC): Outcome 

analysis of an interventional cohort study of the German Hyperthermia Chemotherapy Group in efficacy 

and side effects 

G.C. Lüdecke, L. Schäfer, W. Weidner, F. Hasner, H. Hanitzsch, M. Schmidt (Giessen, Munich, Bonn, 

Germany) 

* 708 Side effects of BCG in the treatment of intermediate and high risk Ta T1 papillary carcinoma of the bladder: 

Results from EORTC GU Cancers Group randomized study 30962 comparing 1/3 dose vs full dose during 1 

or 3 years 

M. Brausi, J. Oddens, R. Sylvester, S. Colette, P. Gontero, A. Bono, L. Turkeri (Modena, Turin, Varese, Italy; 

Hertogenbosh, The Netherlands; Brussels, Belgium; Istanbul, Turkey) 



M. Rouprêt, Paris (FR)



09.15 - 10.45 Prostate cancer biopsies and pathology 



Chairs: F. Gómez Veiga, A Coruna (ES) 

V. Scattoni, Milan (IT) 




709 Bimanual examination of retrieved specimen during robot-assisted radical prostatectomy: A novel 

technique for reducing the positive surgical margin 

W. Jeong, A. Sood, S. Dusik, N.S. Gupta, C.G. Rogers, P. Dasgupta, J.O. Peabody, M. Menon (Detroit, United 

States of America; London, United Kingdom) 

710 Repeated prostate biopsy: Evaluation of a new diagnostic pathway using mp-MRI, PCA3 and pro-PSA in 

the selection of patients 

F. Porpiglia, C. Fiori, M. Manfredi, F. Mele, R. Bertolo, S. Grande, F. Russo, D. Regge, E. Bollito, M. Papotti 

(Orbassano (Turin), Candiolo (Turin), Italy) 

711 Detection of nodal micro-metastases with serial section, immunohistochemistry and real time polymerase 

chain reaction in intermediate and high risk prostate cancer patients submitted to radical prostatectomy 

with extended pelvic lymph node dissection: A perspective study 

R. Schiavina, E. Capizzi, G. Passaretti, D. Romagnoli, A. Bertaccini, E. Brunocilla, F. Manferrari, M. Garofalo, 

V. Vagnoni, G.C. Rocca, C.N. Bizzarri, F. Chessa, L. Bianchi, M. Borghesi, M. Fiorentino, G. Martorana 

(Bologna, Italy) 

712 The novel complexity measures in the objective grading of prostate cancer 

P. Waliszewski, M. Tanase, F. Wagenlehner, S. Gattenloehner, W. Weidner (Giessen, Germany; Bucharest, 

Romania) 

713 Presence of intraductal carcinoma of the prostate on needle biopsy can be a significant prognostic factor 

K. Masashi, K. Kyosuke, T. Toyonori, F. Yasuhito, F. Takashi, S. Naoto, M. Yoshihisa, Y. Yasushi, Y. Tokunori, 

G. Momokazu (Nagoya, Japan) 

714 Spatial distribution of positive cores decreases misclassification rates of patients with low risk prostate 

cancer candidate for active surveillance 

E. Di Trapani, F. Castiglione, N.M. Passoni, U. Capitanio, A. Gallina, M. Tutolo, M. Bianchi, N. Finocchio, 

E. Farina, G. Gandaglia, L. Villa, N. Suardi, V. Mirone, F. Abdollah (Milan, Naples, Italy) 

* 715 Can transrectal needle biopsy be optimized to detect nearly all prostate cancer with volume ≥ 0.5 cc? A 

three-dimensional analysis 

K. Kanao, J.A. Eastham, P.T. Scardino, M. Sumitomo, V.E. Reuter, S.W. Fine (New York, United States of 

America; Nagakute, Japan) 

716 Biopsy Gleason score ≤ 6. How to predict final pathological specimen Gleason score? 

T. Seisen, F. Roudot Thoraval, P.O. Bosset, A. Campeggi, Y. Allory, D. Vordos, A. Hoznek, C-C. Abbou, A. De 

La Taille, L. Salomon (Creteil, France) 


241 

Monday

Monday 

717 Transperineal MRI-targeted biopsy versus transperineal template prostate mapping biopsy in the detection 

of localised radio-recurrent prostate cancer 

A. Kanthabalan, M. Abl-Azzeez, M. Arya, A. Freeman, C. Allen, A. Kirkham, S. Punwani, M. Emberton, 

H. Ahmed (London, United Kingdom) 

718 The impact of multiple biopsies on erectile and voiding function after radical prostatectomy: A populationbased 

assessment 

F. Roghmann, H. Lavigueur-Blouin, M. Meskawi, A. Becker, Z. Tian, J. Noldus, M. Sun (Montreal, Canada; 

Hamburg, Herne, Germany) 

719 Evidence for a cell cycle proliferation “field effect” in prostate cancer 

F. Carvalho, W. Welbourn, J. Reid, E. Humphries, M. Han, J. Lanchbury, A. Gutin, S. Stone, D.M. Berman 

(Baltimore, Salt Lake City, United States of America; Kingston, Canada) 

720 Low percentage (H10%) of positive biopsy core (PBC) is not a predictor of lower risk for PSA recurrence in 

cT1c prostate cancer treated with radical prostatectomy in contemporary Japanese population 

S. Hatakeyama, T. Koie, T. Yoneyama, Y. Hashimoto, K. Mitsuzuka, S. Kawamura, S. Narita, N. Tsuchiya, 

T. Habuchi, Y. Arai, C. Ohyama (Hirosaki, Sendai, Akita, Japan) 

721 The advantages of using 3D guidance for localizing prostate biopsies by endo-rectal route: Feasibility and 

preliminary results 

A. De Gorski, G.J. Wirth, C.E. Iselin (Geneva, Switzerland) 




09.15 - 10.45 Update on SUI 



Chairs: C. Gratzke, Munich (DE) 

D.A.O. Waltregny, Liège (BE) 



722 The effect of aging on voiding function in women with stress-predominant urinary incontinence prior to 

surgical intervention 

P. Zimmern, H. Litman, G.E. Lemack, H. Richter, L. Sirls, S. Kraus (Dallas, Watertown, Birmingham, Royal 

Oak, San Antonio, United States of America) 

723 Changes in urinary incontinence during postpartum and associated factors 

S.R. Chang, M.I. Lin, H.H. Lin, K.H. Chen, W.A. Lin (Taipei, Taichung, Taiwan) 

724 A cost-effectiveness analysis of tension-free vaginal tape vs transobturator tape for female stress urinary 

incontinence 

M.A. Laudano, S. Seklehner, D. Xie, E.C. Osterberg, B. Chughtai, R.K. Lee (New York, United States of 

America) 

725 Obesity is not associated with urodynamic stress incontinence 

F. Puccini, A. Tubaro, C. De Nunzio, A. Digesu, A. Bhide, C. Hendricken, R. Fernando, V. Khullar (Rome, Italy; 

London, United Kingdom) 

726 TVT-O for the treatment of pure urodynamics stress incontinence in females: Efficacy and adverse events 

at 5 years follow-up 

M. Serati, R.M. Bauer, J.N.L. Cornu, E. Cattoni, A. Braga, G. Siesto, D. Lizée, F. Haab, M. Torella, S. Salvatore 

(Varese, Milan, Naples, Italy; Munich, Germany; Paris, France) 

727 Affect outcomes of mid-urethral sling procedures for stress urinary Incontinence according to body mass 

index 

L.H. Sung, C.H. Noh, J.Y. Chung, J.H. Yu (Seoul, South Korea) 

728 TOT approach in stress urinary incontinence (SUI) – are there differences in obese females? 

F. Ludt, C. Frohme, P. Olbert, R. Hofmann, A. Hegele (Marburg, Germany) 

729 Deterioration of continence after TOT when the follow-up is extended: Results from a randomised 

controlled study 

E. Costantini, M. Lazzeri, A. Zucchi, R. Bruno, E. Salvini, A. Pietropaolo, M. Del Zingaro, M. Porena (Perugia, 

Italy) 

730 Urodynamic repercussions of the treatment of the female stress urinary incontinence by suburethral tapes 

S. Garcia Barreras, N. Garcia Garcia, M. Téllez Martínez Fornés, M. Cervero Jiménez, L. Fiter Gómez, 

C. Fernández Lucas (Leganés, Spain) 

731 Results of repeat midurethral sling for the treatment of recurrent female stress urinary incontinence 

T. Charles, Y. Sow, S. Christian (Strasbourg, France; Dakar, Senegal) 


243 

Monday

Monday 

732 Can one global quality of life question simplify the overall outcome assessment after surgery for stress 

predominant urinary incontinence in women? 

C. Bacsu, A. Gomelsky, P. Zimmern (Dallas, Shreveport, United States of America) 

733 Does the type of physiotherapy affect the quality of life and clinical outcomes in female urinary 

incontinence? A comparative study of two physiotherapy schemes 

E. Konstantinidou, M. Kalaitzi, K-V. Mytilekas, E-I. Ioannides, D. Hatzichristou, A. Apostolidis (Thessaloniki, 

Greece) 

734 Long-term functional outcomes obtained after artificial urinary sphincter implantation in women with 

stress urinary incontinence: A single center experience 

S. Benadiba, V. Phé, M. Rouprêt, B. Granger, F. Richard, E. Chartier-Kastler (Paris, France) 

735 Patients with urinary incontinence are more likely to develop upper urinary tract stone: A nation-wide 

population-based study with 8-year follow-up 

H.J. Chung, A.T.L. Lin, C.C. Lin, T.J. Chen, K.K. Chen (Taipei, Taiwan) 




09.15 - 10.45 Current and new treatments of OAB and LUTS 



Chairs: M.J. Drake, Bristol (GB) 





736 The clustering of lower urinary tract syndrome. Is the overactive bladder a distinct clinical syndrome? 

P.O. Pal, B.H. Maraj, M. Ghei, J. Malone-Lee (London, United Kingdom) 

737 Developing a psychometrically validated urinary diary 

E. Bright, N. Cotterill, M. Drake, P. Abrams (Bristol, United Kingdom) 

* 738 Urinary retention following anticholinergics in patients with BPH, do comorbidities matter? A nationwide 

population-based study 

E.Y-H Huang, C-C. Lin, H-J. Chung, J-P. Lin, A.T. Lin, K-K. Chen (Taipei, Taiwan) 

739 Cardiovascular (CV) assessments in short- and long-term Phase 3 mirabegron trials in patients with 

overactive bladder (OAB) 

S. Herschorn, P. Kowey, V. Nitti, I. Milsom, S.M. Auerbach, M.B. Blauwet, C. Dorrepaal, M. Weber, J.S. Borer, 

W. Fitzsimmons, N. Martin (Toronto, Canada; Wynnewood, New York, Newport Beach, Northbrook, United 

States of America; Gothenburg, Sweden; Leiderdorp, The Netherlands) 

740 A randomised controlled trial of fesoterodine in subjects with overactive bladder and suboptimal response 

to tolterodine extended release: Results from the AFTER study 

L. Cardozo, S. Kaplan, S. Herschorn, L. Grenabo, M. Carlsson, D. Arumi, T.J. Crook, L. Whelan, F. Ntanios 

(London, Walton Oaks, United Kingdom; New York, United States of America; Toronto, Canada; Gothenburg, 

Sweden; Madrid, Spain) 

741 Pivotal phase 3 study in overactive bladder (OAB) patients with urinary incontinence confirms 

onabotulinumtoxinA 100U significantly improves all OAB symptoms and patients’ quality of life 

C. Chapple, K-D. Sievert, S. MacDiarmid, V. Khullar, P. Radziszewski, C. Nardo, C. Thompson, J. Zhou, 

C. Haag-Molkenteller (Sheffield, London, Marlow, United Kingdom; Tübingen, Germany; Greensboro, Irvine, 

United States of America; Warsaw, Poland) 

742 A prospective randomized comparative study of first-line tolterodine and doxazosin monotherapy for men 

with predominant storage symptoms 

C.H. Liao, H-C. Kuo (New Taipei City, Hualien, Taiwan) 

743 Prevalence and management of overactive bladder patients in the French general population in 2012 

P. Grise, G. Amarenco, A. Bellessort, F. Bruyère, E. Chartier-Kastler, B. Fatton, F. Haab, A. Serikoff (Rouen, 

Paris, Levallois-Perret, Tours, Nimes, France) 

744 OnabotulinumtoxinA 100U demonstrates similar treatment effect in overactive bladder patients with 

urinary incontinence regardless of number of prior anticholinergics taken or reason for their inadequate 

management of patients’ overactive bladder 

C. Chapple, K-D. Sievert, S. Herschorn, C. Thompson, C. Nardo, J. Zhou, C. Haag-Molkenteller, V. Nitti 

(Sheffield, Marlow, United Kingdom; Tübingen, Germany; Toronto, Canada; Irvine, New York, United States 

of America) 


245 

Monday

Monday 

745 Withdrawn 

746 Is there concordance between clinical overactive bladder and detrusor overactivity in male with storage 

symptoms? 

M. Esteban, D. Castro-Diaz, J. Salinas, S. Arlandis, A. Franco, M.A. Jiménez, L. Prieto, C. Gutierrez, (Toledo, 

Santa Cruz de Tenerife, Madrid, Valencia, Barcelona, Alicante, Spain) 

747 Contribution of sleep disorders to nocturia-specific QOL (N-QOL) and the efficacy of treatment with 

anticholinergic drug in overactive bladder patients with nocturia 

M. Yoshida, M. Takeda, S. Takahashi, O. Nishizawa, M. Gotoh, N. Masumori (Obu, Aichi, Kofu, Tokyo, 

Matsumoto, Nagoya, Sapporo, Japan) 


Summary 

H. Hashim, Bristol (GB)



09.15 - 10.45 Urothelial cancer treatment: Predicting outcomes 



Chairs: S.F. Shariat, New York (US) 




748 Clinical impact of grade on both recurrence and progression in T1 bladder cancer: Comparison between 

WHO 1973 and WHO 2004 histological classification 

F. Pellucchi, L. Rocchini, C. Maccagnano, G. Zanni, G. La Croce, M. Moschini, M. Bianchi, P. Rigatti, 

R. Colombo (Milan, Italy) 

749 Clinical outcome in patients with T1 micropapillary carcinoma of the bladder 

M. Spaliviero, G. Dalbagni, B.H. Bochner, B.Y. Poon, T.F. Donahue, H.A. Al-Ahmadie, J.M. Taylor, J.J. Meeks, 

D.D. Sjoberg, S.M. Donat, H.W. Herr (New York, United States of America) 

750 Leucocyte infiltration is a prognostic factor in bladder cancer stage T1 

O. Patschan, P.O. Bendahl, G. Chebil, H. Engilbertsson, S. Gudjonsson, P. Kollberg, F. Liedberg (Malmö, 

Lund, Helsingborg, Sweden) 

751 T1 urinary bladder cancer - long time observation population-based material 

S. Jahnson, S. Holmang, F. Liedberg, B Ljungberg, A. Hosseini-Aliabad (Linköping, Gothenburg, Malmö, 

Umeå, Stockholm, Sweden) 

752 Female gender is associated with higher risk of disease recurrence in patients with primary T1 high grade 


L.A. Kluth, E. Xylinas, J.J. Crivelli, H. Fajkovic, N. Passoni, M. Rouprêt, A. Becker, E. Comploj, A. Pycha, 

S. Holmang, A. Gupta, Y. Lotan, P.I. Karakiewicz, P. Gontero, F.K.H. Chun, M. Fisch, D.S. Scherr, S. Shariat 

(New York, Iowa City, Dallas, United States of America; St.Poelten, Austria; Milan, Bolzano, Turin, Italy; 

Paris, France; Montreal, Canada; Gothenburg, Sweden; Hamburg, Germany) 

753 Oncological outcome of radical cystectomy for BCG failure compared to primary invasive disease 

A. Masson-Lecomte, D. Vordos, R. Yiou, Y. Allory, C.C. Abbou, A. De La Taille, L. Salomon (Creteil, France) 

754 Accuracy of the EORTC risk tables and of the CUETO scoring model to predict outcomes in non muscleinvasive 


E.N. Xylinas, M. Kent, L.A. Kluth, D. Sjoberg, A. Pycha, E. Comploj, Y. Lotan, R.S. Svatek, Q.D. Trinh, 

P.I. Karakiewicz, S. Holmang, D.S. Scherr, M. Zerbib, S.F. Shariat (New York, Dallas, United States of 

America; Bolzano, Italy; Montreal, Canada; Gothenburg, Sweden; Paris, France) 

755 Prediction of recurrence probabilities after intravesical treatment in patients with non-muscle-invasive 


R.J.M. Lammers, J.C.M. Hendriks, J. Palou, W.P.J. Witjes, J.A. Witjes (Nijmegen, Arnhem, The Netherlands; 

Barcelona, Spain) 

756 Prediction of progression in patients with non-muscle invasive bladder cancer based on histologic grade, T 

stage, recurrence rate and bladder neck involvement: The BN-GTR model 

Y. Fujii, S. Kobayashi, F. Koga, M. Yokoyama, S. Yoshida, J. Ishioka, Y. Matsuoka, N. Numao, K. Saito, 

H. Masuda, K. Kihara (Tokyo, Japan) 


247 

Monday

Monday 

757 An active surveillance program in recurrent non muscle-invasive bladder tumor. Oncological safety and 

predictive factors to remain under surveillance 

V. Hernández, E. De La Peña, C. Blázquez, E. Pérez, F.J. Díaz, C. Llorente (Alcorcón (Madrid), Spain) 

758 Association of cytotoxic T-lymphocyte antigen-4 gene polymorphisms with increased likelihood of 

recurrence in non-muscle invasive bladder cancer 

E. Chiong, A. Wong, N. Kesavan, Y.H. Chan, K. Esuvaranathan, R. Mahendran (Singapore, Singapore) 

759 Prognostic value of sex-hormone receptors expression in bladder tumor 

J.K. Nam, S.W. Park, M.K. Chung (Yangsan, South Korea) 

760 Retrospective study of the upper urinary tract urothelial carcinoma (UUT-UC) Spanish Collaborative Group 

alerts endocavitary BCG/MMC instillations, in unsuitable patients, could be deleterious in terms of survival 

F. Ramon De Fata, R. Cansino, J. Palou, J.H. Amón, V. Chantada, F.J. Burgos, C. Rioja, A. Serrano, L. Fariña, 

M. Cosentino, J.C. Angulo (Madrid, Barcelona, Valladolid, La Coruña, Zaragoza, Guadalajara, Vigo, Spain) 


Summary 

S.F. Shariat, New York (US)



09.15 - 10.45 Renal tumours: Basic research on pathogenesis 



Chairs: F. Jankevicius, Vilnius (LT) 

K. Junker, Jena (DE) 



761 Establishing primary renal cancer cell cultures in vitro linked to a corresponding orthotopic in vivo model 

M. Saar, H. Zhao, A. Thong, A. Ingels, M. Valta, S.R. Young, R. Nolley, D.M. Peehl (Homburg/Saar, Germany) 

762 Dietary selenium and lower risk of developing renal cancer – a prospective cohort study using food diaries 

in EPIC Norfolk 

B.J.R. Barrass, M.A. Rochester, R. Pillai, R. Luben, K.T. Khaw, A.R. Hart (Norwich, Cambridge, United 

Kingdom) 

763 Renal cell cancer in young adults: Prevalence, characteristics, and impact of Xp11.2/TFE3 translocation 

carcinoma diagnosis 

L. Donon, M. Yacoub, G. Robert, C. Deminière, G. Pasticier, J-M. Ferrière, P. Ballanger, J-C. Bernhard 

(Bordeaux, France) 

764 Integrative analysis of clear cell renal cell carcinoma 

Y. Sato, S. Maekawa, Y. Okuno, Y. Shiraishi, A. Sato, G. Nagae, T. Shimamura, Y. Nagata, K. Yoshida, 

M. Sanada, H. Kume, H. Aburatani, S. Sugano, S. Ogawa, Y. Homma (Tokyo, Japan) 

765 The important role of glycine N-methyltransferase (GNMT) in the proliferation of renal cell carcinoma 

Y. Song, M. Shiota, A. Yokomizo, K. Tatsugami, K. Kuroiwa, S. Naito (Fukuoka, Japan) 

766 Proteomic intra-tumoural heterogeneity and differential expression between primary and metastatic renal 

cancer tissue 

A. Laird, F.C. O’Mahony, L. Eory, J. Nanda, A.C.P. Riddick, M. O’Donnell, R.R. Meehan, G.D. Stewart, 

D.J. Harrison (Edinburgh, St Andrews, United Kingdom) 

767 Identification of antigenic peptides from novel renal cancer stem cell antigen, DNAJB8 

N. Satoshi, Y. Hirohashi, T. Torigoe, H. Kusumoto, K. Kikkawa, Y. Kodama, M. Ko, N. Matsumura, 

Y. Kohjimoto, N. Sato, I. Hara (Wakayama, Sapporo, Japan) 

768 Gene expression profile changes in response to overexpression or silencing of the hhavcr-1/kim-1 gene in 

the 769-p and 786-o ccRCC cell lines 

E. Trilla, D. Lorente, M.A. López-Pacios, T. Cuadros, M. Vilà, I. De Torres, J. Vilardell, N. Ben Messaoud, 

M. Salcedo, E. Sarró, J. López-Hellin, S. Ramón Y Cajal, E. Itarte, A. Meseguer, J. Morote (Barcelona, Spain) 

769 Cancer stem cell characteristics may be correlated to the renal cell carcinoma intratumoral heterogeneity 

S. Bombelli, M.A. Zipeto, C. Bianchi, B. Torsello, V. Di Stefano, P. Viganò, G. Bovo, G. Cattoretti, G. Strada, 

R. Perego (Monza, Milan, Italy) 

770 CD39 is highly involved in mediating the suppression activity of tumor infiltrating CD8 + T regulatory 

lymphocytes in renal and bladder cancer 

P. Traverso, A. Parodi, F. Battaglia, F. Ferrera, S. Tardito, S. Stringara, G. Conteduca, S. Negrini, A. Simonato, 

D. Fenoglio, G. Carmignani, G. Filaci (Genoa, Italy) 


249 

Monday

Monday 

771 Regulatory T cells in clinically localized renal cell carcinoma: Comparison with an age-matched healthy 

control 

I.G. Jeong, J.H. Yoon, K.H. Kim, D. You, S. Park, J.H. Hong, H. Ahn, C-S. Kim (Seoul, Ulsan, South Korea) 

772 The functional significance and cancer pathways of EMT-related microRNA-200-family in renal cell 

carcinoma 

H. Yoshino, N. Seki, H. Hidaka, T. Yamasaki, H. Enokida, M. Nakagawa (Kagoshima, Chiba, Japan) 

773 Analysis of molecular profiling of renal cell carcinoma (RCC). Identification of a 4-microRNA signature as a 

prognostic value in patients with stage I-II 

L. Diez Sicilia, F. Villacampa Aubá, B. García Gómez, J. Medina Polo, M. Dominguez Esteban, A. Tejido 

Sánchez, G. De Velasco, F. De La Rosa Kehrmann, D. Castellano, R. Díaz González (Madrid, Spain) 

774 Analysis of site specific miRNA expression in distant metastases of clear cell renal cell carcinoma 

J. Heinzelmann, S. Baumgart, U. Wickmann, A. Szendroi, A. Unrein, M.R. Gajda, M-O. Grimm, M. Stöckle, 

K. Junker (Homburg/Saar, Jena, Germany; Budapest, Hungary) 




09.15 - 10.45 OAB in women 



Chairs: P. Dinis Oliveira, Porto (PT) 

T. Hanus, Prague (CZ) 




* 775 Sacral Nerve Stimulation (SNS) for the treatment of idiopathic refractory overactive bladder: Costeffectiveness 

compared to optimal medical therapy, botulinum toxin A (BoNT-A) and percutaneous tibial 

nerve stimulation (PTNS) 

J. Jenks, R. Hamid, P.J.R. Shah, T.J. Greenwell, C. Betts, S. Walleser, N. Hallas, J.L. Ockrim (London, Salford, 

United Kingdom; Tolochenaz, Switzerland) 

776 Tined lead versus percutaneous nerve evaluation for sacral nerve stimulator assessment 

J. Jenks, R. Hamid, P.J.R. Shah, T.J. Greenwell, J.L. Ockrim (London, United Kingdom) 

777 Affect on bowel symptoms in patients having sacral neuromodulation for detrusor overactivity 

A. Gulamhusein, J. Fielding, R. Simmons, S.V. Reid (Sheffield, United Kingdom) 

778 Transcutaneous posterior tibial nerve stimulation: Evaluation of therapeutic option in overactive bladder 

syndrom 

M. Ammi, P. Bigot, D. Chautard, S. Larre, T. Culty, C. Pinon, A. Azzouzi (Angers, France) 

779 Objective efficacy of mirabegron on storage and voiding function in patients with overactive bladder, 

based on a urodynamic study 

Y. Matsukawa, Y. Funahashi, S. Takai, Y. Yoshino, T. Yamamoto, M. Gotoh (Nagoya, Japan) 

* 780 Overactive bladder syndrome in elderly: Is there a place for detrusor Botox injections? 

V.M. Keppenne, D. Waltregny, S. Sanjurjo (Liege, Belgium) 

781 Discontinuation rates and inter-injection interval for repeated intravesical botulinum toxin type A 

injections in detrusor overactivity 

R. Veeratterapillay, C. Harding, N. Vasdev, L. Teo, A. Abroaf, R. Pickard, T. Dorkin, T. Hasan, A. Thorpe 

(Newcastle upon Tyne, United Kingdom) 

782 The effect of solifenacin on bladder wall thickness in women with overactive bladder and detrusor 

overactivity: Results from the SHRINK study 

D. Robinson, M. Oelke, R. Tretter, B. Stow, G. Compion, A. Tubaro (London, Chertsey, United Kingdom; 

Hanover, Germany; Leiderdorp, The Netherlands; Rome, Italy) 

783 Single surgeon experience of clam ileocystoplasty for refractory idiopathic detrusor overactivity 

S. Pisipati, F. Khan, R.B. Kinder (Cheltenham, United Kingdom) 

784 The characteristics and prognosis for impaired detrusor contractility in non-geriatric patients 

C-W. Yang, Y-H. Fan, C-C. Lin, J.S. Huang, T.L. Ling, K-K. Chen (Taipei, Taiwan) 


251 

Monday

Monday 

785 A multi-centre randomized controlled study comparing surgical and pharmacological therapy to treat 

mixed urinary incontinence 

R. Caremel, L.M. Tu, K. Baker, O. El Yazami Adli, O. Loutochin, J. Corcos (Montreal, Sherbrooke, Ottawa, 

Canada) 

786 The surgical outcomes of transobturator tape in patients with stress urinary incontinence concomitant with 

overactive bladder 

C. Yoo, H.Y. Choi, J.S. Cho, S.H. Lee, J.W. Hwang, C.Y. Oh, J.H. Han, Y.G. Lee (Anyang-Si, Guri, South Korea) 




09.15 - 10.45 Urethral stricture management 



Chairs: S.J. Hosseini, Tehran (IR) 




787 Value of MRI in diagnostic study in patients with urethral stricture: Impact on subsequent surgery 

M.I. Kogan, E.L. Banchik, V.I. Dombrovsky, V. Mitusov (Rostov on Don, Russia) 

788 Urethral ultrasound versus magnetic resonance urethrography versus retrograde urethrography in the 

evaluation of anterior urethral stricture: A prospective study 

M.A.A. Abdullah (Assiut, Egypt) 

789 Withdrawn 

790 Stricture recurrence after the urethroplasty with buccal mucosal graft: What next? 

A. Pandey, C. Raita, J. Beier, H. Keller (Hof, Germany) 

791 Seeding a biodegradable collagen cell carrier and its use for urethroplasty in a urethral stricture minipig 

model 

L. Lisa, M. Vaegler, S. Maurer, K-D. Sievert (Tübingen, Germany) 

792 Histological evidence of balanitis xerotica obliterans (BXO) complicating cases of failed hypospadias repair 

M. Selim, E. Elsherif, S. Yones, M. Sultan (Shibin Elkom, Egypt) 

793 Management of pananterior urethral strictures due to LS/BXO by single stage dorsal buccal onlay 

urethroplasty 

A. El-Kassaby, E.A. Eltahawy (Cairo, Little Rock, Egypt) 

794 Relationship between development of urethral stricture after transurethral resection of prostate and 

glycemic control 

˛S. Kumsar, H.S. Saglam, O. Köse, S. Budak, O. Adsan (Sakarya, Turkey) 

795 The two-staged urethral and penile reconstruction using vasularised scrotal flap and buccal mucosal graft 

A. Pandey, C. Raita, J. Beier, H. Keller (Hof, Germany) 

796 Time and stages survival of oral mucosa grafts on 3 different feeding beds - an experimental model in rats 

S.V. Kotov, S.V. Belomyttcev, E.I. Veliev, O.B. Loran (Moscow, Russia) 

797 Comparison of urethroplasty results using oral mucosa graft and tunica vaginalis flap in anterior urethral 

stricture 

M.I. Kogan, V.V. Mitusov, A.V. Shangichev, R.E. Ametov, S.V. Naranov (Rostov on Don, Russia) 

798 Contemporary urethral stricture characteristics in the developed world 

E. Palminteri, E. Berdondini, C. De Nunzio, S. Maruccia, G. Bozzini, L. Carmignani, G. Barbanti (Arezzo, 

Rome, Milan, Siena, Italy) 

Summary 



253 

Monday

Monday 




10.00 - 16.00 da Vinci Robotic Surgery 


10.00 - 12.00 Live surgery: da Vinci prostatectomy - The Martini Klinik Technique 

Operator: A. Haese, Hamburg (DE) 

Moderators: M. Graefen, Hamburg (DE) 


14.00 - 16.00 Live surgery: da Vinci prostatectomy - Early neurovascular bundles release 

Operator: A. Cestari, Milan (IT) 

Moderators: C.M. Annerstedt, Herlev (DK) 


Sponsored by INTUITIVE SURGICAL



11.00 - 12.00 Expert challenges the expert 


Chair: A. De La Taille, Creteil (FR) 

11.00 - 11.30 Case presentation How I do a nerve-sparing cystectomy 


Challenger: 


11.30 - 12.00 Case presentation How I do a laparoscopic partial nephrectomy 



My lecture will present the technical nuances and details of laparoscopic and robotic partial nephrectomy. 

The techniques presented will include all 3 types of partial nephrectomy: Conventional-clamping, earlyunclamping 

and zero-ischemia techniques. 

Challenger: 



Robot-assisted partial nephrectomy is today a standardised technique offering precise resection of the 

tumour and quick reconstruction of the defect. This is done under warm ischemia clamping the main renal 

artery and wherever possible clamping of a secundary or tertiary branch. Bleeding is so minor and vision 

superior. After inner renorrhaphy closure, early unclamping can be performed allowing warm ischemia 

times to be low without significant clinical consequences for the renal function 


255 

Monday

Monday 


11.00 - 12.00 Andrology 




Chair: J.O.R. Sonksen, Herlev (DK) 

11.00 - 11.15 State-of-the-art lecture Modern management of ejaculatory disorders 

A. Salonia, Milan (IT) 


Despite copious findings on the physiology of ejaculation, as well as on the pathophysiology of Premature 

Ejaculation (PE), treatment of early ejaculation is still not well-outlined, with only a minor proportion of 

patients complaining of primary PE being actively treated. These discrepancies may be considered as the 

unfortunate result of a combination of several factors: 1) PE per se is often underdiagnosed in clinical 

practice; 2) Urologists do not follow the guidelines for the treatment of PE in their everyday clinical practice; 

3) The lack of a widely recognised gold standard treatment, as well as the presence of a number of potential 

side effects which characterise almost all the compounds available for PE. In this context, off-label daily 

dosing of paroxetine, sertraline, citalopram, fluoxetine, or clomipramine are regarded as first line treatments 

for PE worldwide. Recently, dapoxetine hydrochloride - a short-acting SSRI with a pharmacokinetic profile 

favourable for on-demand treatment of PE has been launched on the market as the first on-demand and 

on-label treatment for PE. 

11.15 - 11.30 State-of-the-art lecture Current treatment possibilities for erectile dysfunction 



This lecture will discuss new treatment options for a man with erectile dysfunction and will critically evaluate 

the evidence for these therapies. The discussion will include both medical and physical therapies. 

11.30 - 11.45 State-of-the-art lecture Developments in the diagnosis and therapy of priapism 

A. Muneer, London (GB) 


This session will aim to highlight the recent developments in diagnostic imaging and surgical interventions 

for the three sub-types of priapism; ischaemic, non-ischaemic and stuttering. 

Both clinical studies and in vitro studies have helped to formulate novel theories in order to explain the 

development of priapism and suggest effective management strategies. For a long time, the management of 

priapism has been based on anecdotal reports and therefore therapeutic guidelines vary globally. The use of 

both in vivo and in vitro models of priapism have now helped our understanding of the pathophysiology of 

this condition and helped develop alternative therapeutic interventions, particularly in the area of refractory 

ischaemic priapism and stuttering priapism. By understanding the fundamental changes at a molecular 

level, clinicians will be able to develop an evidence based treatment algorithm for difficult cases 


324 Intratunical injection of human adipose tissue-derived stem cells prevents fibrosis and is associated with 

improved erectile function in a rat model of Peyronie’s disease 

F. Castiglione, P. Hedlund, F. Van Der Aa, T.J. Bivalacqua, M. Albersen (Milan, Italy; Leuven, Belgium; 

Baltimore, United States of America)

325 Repair of erectile dysfunction using transplantation of human mesenchymal stem cells cultivated on the 

surface of nanofibrous meshes in rats with cavernous nerve injury 

Y.S. Song, H.J. Lee, J. An, J.H. Yun, J.H. Kim, S.W. Doo, W.J. Yang, S.U. Kim (Seoul, South Korea) 


257 

Monday

Monday 




11.00 - 12.00 Systemic therapy in urological cancers 


Chair: M. De Santis, Vienna (AT) 

11.00 - 11.15 State-of-the-art lecture Risk stratification integrating clinical and genomic data 

A. Bjartell, Malmö (SE) 


There is an urgent need for improved selection of patient for new therapies such as inhibition of androgen 

signaling and angiogenesis, and for immunotherapy. Prediction models for risk stratification of recurrence 

after treatment for different malignancies have become increasingly popular. Nomograms developed at 

Memorial Sloan-Kettering Cancer Center, MSKCC (www.nomograms.org) and other prediction models are 

frequently used today. Despite numerous publications on promising biomakers, multiplex signatures and 

gene panels, only PSA in blood is routinely incorporated in prediction models. This lecture will focus on 

the integration of biomarkers and genomic data with clinical characteristics today and what we can expect 

tomorrow. 

11.15 - 11.30 State-of-the-art lecture When is chemotherapy indicated in prostate cancer? 

P. Albers, Düsseldorf (DE) 

11.30 - 11.45 State-of-the-art lecture Systemic therapy for renal cell cancer 



Emerging from a largely cytokine-based era, the clinical development of the last decade has led to a dramatic 

change in the therapeutic landscape of renal cell carcinoma. Molecularly targeted and antiangiogenic agents 

now form the backbone of most therapeutic strategies for patients with advanced metastatic renal cell 

carcinoma. This lecture focuses on the clinical efficacy of systemic therapy in RCC patients and gives a brief 

overview on novel areas of development and emerging substances including vaccine and immunotherapies 

which hold promise to improve therapeutic outcomes for patients with mRCC. 

11.45 - 12.00 State-of-the-art lecture Second-line chemotherapy for urothelial cancer 



Bladder cancer is a chemotherapy sensitive disease and cisplatin based combination treatment has been the 

standard for many years. Only about 15% of patients experience long term remissions. For those who fail 

first-line chemotherapy the prognosis usually is dismal. Second-line chemotherapy data are highly variable. 

Only recently, three prognostic factors have been established, resulting in 4 prognostic groups. A reasonable 

strategy in the second-line setting is to rechallenge former cisplatin sensitive patients if progression occurs 

at least 6-12 months after first treatment. The only phase III trial in this context explored vinflunine plus best 

supportive care (BSC) randomised against BSC alone in patients failing first-line platinum based combination 

chemotherapy. The results showed a survival benefit in favour of vinflunine, which was statistically significant 

in the eligible patient population. Currently, vinflunine is the only approved second-line treatment in Europe. 

Recent advances and future strategies and studies will be summarised and critically discussed.



11.00 - 12.00 A session by the European Society of Urogenital Radiology 


Chair: G. Heinz-Peer, Vienna (AT) 

11.00 - 11.20 State-of-the-art lecture Multiparametric MRI – a step forward in the diagnosis of prostate cancer 

A. Turgut, Ankara (TR) 


The main objective of this session is to outline the role of MRI in the clinical management of patients with 

prostate cancer. In this regard, multiparametric MRI involving conventional as well as functional techniques 

for the imaging of prostate cancer will be described. Importantly, the clinical indications for the use of 

prostate MRI will be discussed. Also, typical MRI findings of prostate cancer will be reviewed and the 

current advances in prostate MRI providing anatomical and functional data about prostate cancer will be 

summarised. Accordingly, a structured reporting system (PI-RADS) for the MRI findings of prostate cancer 

will be presented. Finally, future prospects for the impact of prostate MRI on the diagnosis and treatment of 

prostate cancer will be discussed. 

11.20 - 11.40 State-of-the-art lecture The role of imaging in urothelial cancer 

N. Cowan, Oxford (GB) 

11.40 - 12.00 State-of-the-art lecture Characterisation and management of incidental adrenal masses 

G. Heinz-Peer, Vienna (AT) 


259 

Monday

Monday 




11.00 - 12.00 Prevention and treatment of urological infections 


Chair: T.E. Bjerklund Johansen, Århus (DK) 

11.00 - 11.15 State-of-the-art lecture Antibiotics - the urological time bomb 

G. Kahlmeter, Växjö (SE) 


Antimicrobial prophylaxis and therapy are an integral part of modern medicine. Without them much of 

what we perceive as modern medicine will be either impossible or very difficult to continue. Galloping 

antimicrobial resistance development together with an almost complete lack of development of truly new 

antibacterials threaten to undermine both prophylaxis and management of infections in modern medicine. 

The aim of this lecture is to update the audience on antimicrobial resistance development, development of 

new antibacterials, possible measures to counteract resistance development and their effectiveness and 

alternative strategies. 

11.15 - 11.30 State-of-the-art lecture Antiobiotic prophylaxis in endoscopic urological interventions 



The risk of infectious complications associated with urological diagnostic and therapeutic procedures are 

related to the bacterial contamination level and several other factors. A model of classification of these 

procedures in different classes of contamination will be presented as will the subsequent strategy for 

antibiotic prophylaxis, with focus on urological endoscopic interventions. 

11.30 - 11.45 State-of-the-art lecture Antibiotics in prostate biopsies 



Prostate biopsy is currently an essential procedure for prostate cancer diagnosis and is a frequently performed 

procedure in urology with an estimated 1.000.000 cases each year in Europe. The aim of this presentation is 

to highlight current developments with regard to increasing infectious complications after prostate biopsies 

and possible strategies for improvement. 


158 Socioeconomic trends and utilization in the emergency department treatment of urinary tract infections 


America) 

615 Comparison of different scoring systems for outcome prediction in patients with Fournier’s gangrene: Our 

experience with 50 patients 

A. Tuncel, T. Keten, Y. Aslan, M. Kayali, A. Erkan, M. Yildiz, A. Atan (Ankara, Turkey)



11.00 - 12.00 Neurourology 


Chair: F.C. Burkhard, Berne (CH) 

11.00 - 11.15 State-of-the-art lecture Spinal cord injury: The initial management of the bladder 

G. Del Popolo, Florence (IT) 


After spinal cord lesion we observe a period of spinal shock during which we must ensure the drainage of 

the bladder using an indwelling catheter, the bladder rehabilitation provide the removal of the indwelling 

catheter starting intermittent catheterisation. Further investigations are needed such as renal function tests, 

ultrasound, neurophysiological tests, urodynamic examination. Clinical and instrumental tests are mandatory 

to optimise rehabilitation management with the use of intermittent catheterism, conservative management, 

medical therapy and to prevent neurological bladder complications 

11.15 - 11.30 State-of-the-art lecture Pharmacotherapy for neurogenic bladder 



The lecture will cover practical aspects of pharmacotherapy of different lower urinary tract conditions 

in patients with neurogenic bladder. The new compounds will be critically evaluated and guidelines on 

pharamacotherapy will be presented. The main focus will be on proper decision/treatment pathways and 

management of tolerability/efficay issues. 

11.30 - 11.45 State-of-the-art lecture Renal transplantation into a reconstructed bladder 

P. Lopez Pereira, Madrid (ES) 


Not many years ago, patients with congenital abnormalities of the lower urinary tract or bladder dysfunction 

were denied Renal Transplant (RT) because they were considered very high risk recipients. However, in 

the last few decades we have learnt that in patients with low-capacity-poorly compliant bladders an 

Augmentation Cystoplasty (AC) will create a compliant low-pressure reservoir that will protect the kidney 

graft. The incidence of symptomatic UTI may be increased in transplanted patients with AC but UTI is more 

related with CIC non-compliance or VUR to the native kidneys than with the AC itself and usually does not 

lead to impairment of graft function. Today, patients with a bladder reconstruction can be transplanted with 

the same outcome (graft survival and function) as those with normal bladders, although the risk of malignant 

transformation in the augmented segment may be increased in these patients. 


300 Desmopressin in the treatment of nocturia in patients affected by Parkinson’s disease 

S. Proietti, M. Gubbiotti, J.A. Rossi De Vermandois, A. Giannantoni (Rozzano, Perugia, Italy) 

441 Why anticholinergics fail: Oxybutynin and fesoterodine induce a shift from muscarinergic to purinergic 

transmission in the rat bladder 

P. Uvin, M. Boudes, J. Franken, A. Menigoz, S.J. Pinto, T. Gevaert, R. Verplaetse, J. Tytgat, R. Vennekens, 

T. Voets, D. De Ridder (Leuven, Belgium) 


261 

Monday

Monday 




11.00 - 12.00 Management of pain in urology 


Chair: P. Bader, Karlsruhe (DE) 

11.00 - 11.20 State-of-the-art lecture Neuroanatomy, neurophysiology and molecular basis of pain 

K. Everaert, Ghent (BE) 


We will supply an overview of neuroanatomy, neurophysiology and molecular basis of pain and will relate 

this to existing therapeutic options 

11.20 - 11.40 State-of-the-art lecture Management of pain after urological procedures 

E.J. Messelink, Groningen (NL) 


This presentation will pay attention to pain mechanisms in abdominal and pelvic pain after surgery. 

Prevention of pain and adequate treatment will be discussed. The most important part will be the prevention 

of chronification of the pain. This requires pain management which is always multidisciplinary in nature. The 

role of the psychologist and physiotherapist will also be addressed. 

11.40 - 12.00 State-of-the-art lecture Tumour-related pain 

A. Paez Borda, Madrid (ES)



11.00 - 12.00 Urological surgery in renal transplant patients 


Chairs: F.J. Burgos Revilla, Madrid (ES) 


11.00 - 11.15 State-of-the-art lecture Therapeutic options facing graft lithiasis 

J.D. Olsburgh, London (GB) 


To highlight rate of incidental kidney stones in potential living kidney donors and rates of stones in transplant 

patients. 

To discuss issues in kidney donors and recipients including patient selection, stone management options 

and outcomes. 

To discuss management strategies for stone treatment in transplanted kidneys and outcomes. 

11.15 - 11.30 State-of-the-art lecture Management of allograft renal tumours 

M. Musquera Felip, Barcelona (ES) 

11.30 - 11.45 State-of-the-art lecture Treatment of ureteral stenosis 



Transplant ureter strictures, occurring in about 5% of recipients after renal transplantation, can be treated 

with mulitple techniques. The presentation will name the different interventions as well as their success 

rates, from minimal invasive to open surgical approaches. Knowledge of these factors and interventional 

strategies will help to improve long term transplant outcome. 

11.45 - 12.00 State-of-the-art lecture Open versus minimally invasive living donor nephrectomy 

L. Salomon, Creteil (FR) 


Living donor graft procures the best results in renal transplantation. However, perioperative morbidity 

with major and minor complications can occur during this challenging procedure. Open surgery with 

transabdominal or retroperitoneal approach provide up to 22% of complications to the donor. Development 

of minimally invasive surgery in urology began in 1991 with the first laparoscopic radical nephrectomy. From 

then on, living donor nephrectomy has been performed with evolving surgical technics: transperitoneal, 

extraperitoneal, hand assisted robotic assisted, single site, natural orifice living donor laparoscopic 

nephrectomy. The aim of this lecture is to evaluate the results of these new procedures by comparaison with 

those of open surgery: not only have we compared these results for the donor but also for the receiver as 

well as the long term results of renal transplantation 


263 

Monday

Monday 




12.15 - 13.45 Developments in cancer diagnosis and management 



Chairs: R. Medina López, Seville (ES) 

D. Burke, Manchester (GB) 


V57 Aggressive bladder neck sparing in laparoscopic radical prostatectomy 

M.J. Smolski, N. McLeod, J. Graham, A. Manjunath, R. Brough, N. Oakley (Stockport, United Kingdom) 

V58 Intravesical and transperitoneal laparoscopy in the management of tumor in the residual ureter 

A.W. Branco, L. Stunitz, S. Nichele, P.H. Douat, M. Luiz, L.T. Nassif (Curitiba, Brazil) 

V59 En-bloc resection of non-muscle invasive bladder tumours with the combination instrument HybridKnife® 

J. Mundhenk, S.H. Alloussi, F. Miller, J. Hennenlotter, G. Gakis, D. Schilling, A. Stenzl, C. Schwentner 

(Tübingen, Neunkirchen, Germany) 

V60 Initial series of video endoscopic inguinal lymphadenectomy and description of the technique 

S. Monagas Arteaga, M.A. Alonso Prieto, F. García Diez, M. De Arriba Alonso, F.J. Gallo Rolania (Leon, Spain) 

V61 New 3-dimensional head-mounted display system (RoboSurgeon system) applied to gasless, single-port 

access adrenalectomy 

K. Kihara, Y. Fujii, H. Masuda, K. Saito, F. Koga, N. Numao, Y. Matsuoka (Tokyo, Japan) 

V62 Multiparametric MRI–US fusion targeted prostate biopsies with Varian brachytherapy software: Precision 

prostate cancer diagnostics 

P. Sturch, K. Duong, J. Kinsella, M. McGovern, A. Robinson, A. Polson, A. Chandra, G. Rottenberg, S. Morris, 

R. Popert (London, United Kingdom) 

V63 Renal tumor with cava thrombus type III-IV 

M.A. López-Costea, J.I. Pérez-Reggeti, J. Fabregat Prous, R. Rodriguez-Malatesta, E. Llorens, F. Vigués, 

E. Franco (Barcelona, Spain) 

V64 Prostate-sparing radical cystectomy with prostatic capsule and vasa deferentia sparing by means of Millin 

prostatectomy 

R.E. Sanchez Salas, P. Macek, F. Rozet, E. Barret, M. Galiano, L. Lunelli, X. Cathelineau (Paris, France)



12.15 - 13.45 Radical prostatectomy: New techniques 



Chairs: A. Heidenreich, Aachen (DE) 




799 Vessel sealing device with nano-coating significantly reduces heat spread for neurovascular bundle 

preparation 

R. Mackenzie, J. Skorucak, A. Mortezavi, J. Vörös, D. Eberli (Zürich, Switzerland) 

800 The single-knot running vesico-urethral anastomosis ten years after its introduction: Evaluation of its 

application, feasibility and complication rate in an international survey 

S. Albisinni, K. Limani, E. Hawaux, A. Peltier, R. Van Velthoven (Brussels, Belgium) 

801 Palliative radical (cysto)prostatectomy in locally advanced castration-resistant prostate cancer 

D. Porres, T. Van Erps, C. Piper, D. Pfister, A. Heidenreich (Aachen, Germany) 

802 Presence of disseminated tumor cells at time of radical prostatectomy is not associated with more 

advanced or poorly differentiated disease in patients with localized prostate cancer; potential sources of 

relapse? 

H. Isbarn, K. Effenberger, T. Schlomm, M. Rink, F.K.H. Chun, M. Fisch, H. Huland, M. Graefen, K. Pantel 

(Hamburg, Germany) 

803 Immunohistochemical ERG status is not predictive for biochemical recurrence after radical prostatectomy 

with positive surgical margin 

M. Ladurner Rennau, H. Klocker, I. Heidegger, V. Skradski, G. Schäfer, W. Horninger, J. Bektic (Innsbruck, 

Austria) 

804 Functional and quality of life analysis in a prospective series of 51 brachytherapies and 42 robotic 

prostatectomies. Comparative analysis 

C. Garcia-Sanchez, J.M. Conde-Sanchez, C.B. Congregado-Ruiz, I. Osman-Garcia, J.M. Pena-Outeiriño, 

E. Arguelles-Salido, R.A. Medina-Lopez (Seville, Spain) 

805 Biological significance of perineural invasion in radical prostatectomy specimens: Study of its prognostic 

significance in biochemical recurrence 

J.L. Ruiz Cerda, R. Rogel Berto, J.V. Salom Fuster, A. Gallego Matey, B. Plaza Viguer, A. Polo Rodrigo, 

F. Boronat Tormo (Valencia, Spain) 

806 Predictors of early biochemical recurrence after radical prostatectomy and adjuvant radiotherapy in men 

with pT3 N0 prostate cancer. Implications for multi-modal therapies 

M. Bianchi, A. Briganti, T. Wiegel, S. Joniau, F. Abdollah, M. Tutolo, C. Cozzarini, B. Tombal, K. Haustermans, 

W. Hinkelbein, N. Di Muzio, H. Van Poppel (Milan, Italy; Ulm, Berlin, Germany; Leuven, Louvain, Belgium) 

807 Characteristics of anterior predominant prostate cancer and the usefulness of multiparametric MRI in 

diagnosis 

S. Pak, S.J. Park, S.H. Song, D. You, I.G. Jeong, C. Song, J.H. Hong, C.S. Kim, H. Ahn (Seoul, South Korea) 


265 

Monday

Monday 

808 Effects of surgeon variability on oncological and functional outcomes in a population-based setting 

S. Carlsson, A. Berglund, D. Sjoberg, A. Khatami, J. Stranne, S. Bergdahl, G. Aus, J. Hugosson (New York, 

United States of America; Stockholm, Gothenburg, Sweden) 

809 Ink marked intraoperative frozen section of the prostate during open radical prostatectomy – prospective 

analysis of diagnostic and therapeutic efficacy 

G. Hatzichristodoulou, G. Weirich, S. Wagenpfeil, K. Herkommer, M. Autenrieth, T. Maurer, M. Thalgott, 

T. Horn, M. Heck, J.E. Gschwend, H. Kübler (Munich, Germany) 

810 Withdrawn 


Summary - does the technique matter? 

A. Heidenreich, Aachen (DE)



12.15 - 13.45 Advanced urothelial cancer: Disease outcomes 



Chairs: F. Liedberg, Malmö (SE) 

J. Huang, Guangzhou (CN) 




811 Serum β-HCG predicts recurrence post radical cystectomy 

J.W.R. Douglas, T. Drake, M. Sommerlad, M. Hayes, S. Crabb (Southampton, United Kingdom) 

812 External validation of a multicenter prognostic model for risk stratification in pT2N0 bladder cancer 

T. Todenhöfer, M. Renninger, B. Al-Matar, M.F. Abdelhafez, A. Stenzl, G. Gakis (Tübingen, Germany) 

813 Time to disease recurrence is a strong predictor of cancer-specific mortality in upper tract urothelial 

carcinoma 

M. Rink, D. Sjoberg, E. Xylinas, V. Margulis, L.A. Kluth, E.K. Cha, J.D. Raman, M. Remzi, K. Bensalah, 

G. Novara, F.K. Chun, E. Kikuchi, W. Kassouf, J. Martinez-Salamanca, Y. Lotan, C. Seitz, A. Pycha, 

R. Zigeuner, D.S. Scherr, A.J. Vickers, S.F. Shariat (Hamburg, Germany; New York, Dallas, Hershey, United 

States of America; Korneuburg, Vienna, Graz, Austria; Rennes, France; Padua, Bolzano, Italy; Tokyo, Japan; 

Monteal, Canada; Madrid, Spain) 

814 Combining smoking information and molecular markers improves prognostication in patients with 


E.N. Xylinas, L. Wang, M. Kent, D. Sjoberg, L. Kluth, M. Rink, P.I. Karakiewicz, G. Novara, M. Zerbib, 

D. Scherr, Y. Lotan, S.F. Shariat (New York, Dallas, United States of America; Montreal, Canada; Padua, Italy; 

Paris, France) 

815 Validation of prognostic value of Bajorin criteria for cancer-specific survival in patients who have disease 

recurrence after radical cystectomy for urothelial carcinoma of the bladder 

L.A. Kluth, E. Xylinas, M. Rink, M. Kent, D. Sjoberg, M. Babjuk, A. Brisuda, A. Aziz, H-M. Fritsche, 

E. Comploj, A. Pycha, D. Sundi, T. Bivalacqua, G. Novara, J. Baniel, R. Mano, P. Gontero, R.S. Svatek, 

L. Lusuardi, A. Mitra, S. Daneshmand, Y. Lotan, D.S. Scherr, S.F. Shariat (New York, Baltimore, San Antonio, 

Los Angeles, Dallas, United States of America; Hamburg, Regensburg, Germany; Prague, Czech Republic; 

Bolzano, Padua, Turin, Italy; Petah-Tikva, Israel; Salzburg, Austria) 

816 Long-term outcomes of laparoscopic nephroureterectomy: 10-year follow-up 

J-A. Long, D. Snow-Lisy, R. Eyraud, R. Miocinovic, R. Stein, J. Kaouk, G-P. Haber (Cleveland, United States of 

America) 

817 Elective segmental ureterectomy for transitional cell carcinoma of the ureter: Long term follow-up in a 73 

patients series 

A. Simonato, A. Benelli, V. Varca, A. Gregori, M. Ennas, A. Lissiani, M. Gacci, S. De Stefani, M. Rosso, 

S. Benvenuto, G. Siena, E. Belgrano, F. Gaboardi, M. Carini, G. Bianchi, G. Carmignani (Genoa, Milan, 

Trieste, Florence, Modena, Italy) 


267 

Monday

Monday 

818 Site specific pattern of metastatic behavior in upper tract urothelial carcinoma treated with radical 


K. Ishioka, E. Kikuchi, N. Tanaka, K. Kanao, K. Matsumoto, H. Kobayashi, H. Ide, Y. Miyazaki, J. Obata, 

S. Shirotake, H. Akita, T. Kosaka, A. Miyajima, T. Momma, Y. Nakajima, S. Hasegawa, K. Nakagawa, 

M. Jinzaki, M. Oya (Tokyo, Saitama, Tochigi, Kanagawa, Japan) 

819 Equivalent survival after distal ureterectomy compared to nephroureterectomy in patients with urothelial 

carcinoma of the distal ureter: A propensity score-matched multi-center study 

H. Fukushima, K. Saito, J. Ishika, Y. Matsuoka, N. Numao, F. Koga, H. Masuda, Y. Fujii, Y. Sakai, C. Arisawa, 

T. Okuno, J. Yonese, S. Kamata, K. Nagahama, A. Noro, S. Morimoto, T. Tsujii, S. Kitahara, S. Gotoh, 

Y. Higashi, K. Kihara (Tokyo, Chiba, Ibaraki, Saitama, Shizuoka, Japan) 

820 A population-based competing-risks analysis of survival after nephroureterectomy for upper tract 

urothelial carcinoma 

A. Abdo, F. Roghmann, A. Becker, M. Meskawi, P.I. Karakiewicz, N. Hanna, M. Sun (Montreal, Canada; 

Herne, Hamburg, Germany) 

* 821 Therapeutic benefit from template-based lymphadenectomy in urothelial carcinoma of the renal pelvis - 

multi-institutional prospective study 

T. Kondo, I. Hara, T. Takagi, Y. Kodama, Y. Hashimoto, J. Iizuka, K. Omae, E. Ikezawa, K. Yoshida, K. Tanabe 

(Tokyo, Wakayama, Japan) 

822 Prognostic factors and outcomes after definitive treatment for primary urethral cancer: Results from the 

International Collaboration on Primary Urethral Carcinoma (ICPUC) 

G. Gakis, S. Daneshmand, J.A. Efstathiou, B. Ali-El-Dein, J. Hrbacek, K.A. Keegan, S. Galland, R. Clayman, 

L. Weissbach, J. Brunner, T. Todenhöfer, M. Rink, H-M. Fritsche, M. Babjuk, G.N. Thalmann, A. Stenzl 

(Tübingen, Hamburg, Regensburg, Germany; Los Angeles, Boston, Nashville, United States of America; 

Mansoura, Egypt; Prague, Czech Republic; Berne, Switzerland) 


Summary 

R. Inman, Sheffield (GB)



12.15 - 13.45 Evidence-based prostate cancer therapies in cellular and animal 

models 



Chairs: F.R. Santer, Innsbruck (AT) 

T. Visakorpi, Tampere (FI) 




823 Transcriptional down-regulation of the androgen receptor by promoter G-quadruplex stabilisation; a 

potential alternative treatment in castrate-resistant prostate cancer 

T.J. Mitchell, A. Ramos-Montoya, M. Di Antonio, P. Murat, S. Ohnmacht, M. Micco, L. Fryer, 

S. Balasubramanian, S. Neidle, D.E. Neal (Cambridge, London, United Kingdom) 

* 824 Abiraterone is able to block AR activation induced by accumulating levels of precursor hormones resulting 

from CYP17A1 inhibition 

J.M. Moll, R.J. Van Soest, J. Kumagai, R. Graeser, I. Hickson, G.W. Jenster, W.M. Van Weerden (Rotterdam, 

The Netherlands; Beerse, Belgium) 

825 Modification of the integrins a2, a5 and b1 plays a particularly critical role in metastatic spread of RAD001resistant 

prostate cancer cells 

I. Tsaur, J. Makarevic, M. Kurosch, M. Reiter, G. Bartsch, A. Haferkamp, R. Blaheta (Frankfurt, Germany) 

826 Targeting STAT3 in castration-resistant prostate cancer - identification of STAT3 as a direct target of the 

fungal metabolite galiellalactone 

N. Don-Doncow, M. Johansson, Z. Escobar, O. Sterner, A. Bjartell, R. Hellsten (Malmö, Lund, Sweden) 

827 Novel anticancer effect of proteasome inhibitor on prostate cancer cells targeting prostate-specific 

membrane antigen and androgen receptor 

K. Kuroda, A. Horiguchi, T. Asano, S. Tasaki, J. Asakuma, A. Sato, K. Seguchi, K. Ito, T. Asano (Tokorozawa, 

Saitama, Japan) 

828 Antitumor activity of nanovectors encapsulating zoledronic acid (ZOL) in 3D prostate carcinoma spheroids 

J. Schmidt, J. Kamradt, M. Stöckle, G. Derosa, A. Lombardi, M. Caraglia, G. Unteregger (Homburg, Germany; 

Naples, Italy) 

829 Improvement of efficacy of insulin-like growth-factor receptor (IGF)-targeting-therapies by co-targeting 

insulin receptor A in prostate cancer 

I. Heidegger, J. Kern, P. Massoner, H. Klocker (Innsbruck, Austria) 

830 Resistance towards temsirolimus is counteracted by epigenetic intervention 

J. Makarevic, I. Tsaur, E. Jüngel, A. Haferkamp, R. Blaheta (Frankfurt, Germany) 

831 Mesenchymal stem cells carrying prodrug-activating enzymes inhibit tumor growth in immune-competent, 

prostate cancer-bearing mice 

A. Abrate, R. Buono, F Benigni, P. Hedlund, I.T.R. Cavarretta (Milan, Italy) 


269 

Monday

Monday 

832 Mesenchymal stem cell mediated cancer therapy in the transgenic adenocarcinoma of the mouse prostate 

(TRAMP) model 

R. Buono, A. Abrate, A. Esposito, T. Canu, A. Del Maschio, F. Benigni, P. Hedlund, I.T.R. Cavarretta (Milan, 

Italy) 

833 Monitoring the effects of therapeutic fatty acid synthase inhibition in prostate canecr using 11C acetate PET 

G.L. Shaw, D. Lewis, J. Boren, A. Ramos-Montoya, D. Soloviev, R. Bielik, K. Brindle, D. Neal (Cambridge, 


834 5-aminolevulinic acid-mediated photodynamic therapy for prostate cancer 

H. Fukuhara, K. Inoue, T. Shuin (Nankoku, Japan) 

835 IL-15 inhibits expression of killer inhibitory NK receptors and upregulates expression of NKG2D on NK and 

NKT cells in prostate cancer-PBMC cocultures 

O. Elhage, C-A. Sakellariou, O. Ukimura, I. Gill, R.A.G. Smith, C. Galustian, P. Dasgupta (London, United 

Kingdom; Los Angeles, United States of America) 




12.15 - 13.45 Male infertility: Clinical issues 



Chairs: W. Aulitzky, Vienna (AT) 




836 The validity of testicular aspirate cytology and DNA image analysis of the aspirate in the assessment of 

infertile men 

S.E. Abou Hashem, E. Sabaa, S. Mostafa, A. Abdalla, H. Maramhy, M. Mostafa, D. Elsayed, E. Ibrahim, 

A. Maroof, M. Eladl (Zagazig, Egypt; Almadena Almonawarah, Saudi Arabia) 

837 Withdrawn 

838 Should older patients be offered varicocele repair to improve their fertility? 

G. Ollandini, G. Liguori, G. Mazzon, S. Benvenuto, B. De Concilio, S. Bucci, R. Napoli, M. Rizzo, P. Umari, 

N. Pavan, G. Chiriacò, C. Trombetta (Trieste, Italy) 

839 Laparoendoscopic single-site surgery with a single channel versus conventional laparoscopic varicocele 

ligation: A prospective randomized study 

B.X. Xue, Y.X. Shan, J. Wang, J. Zhu, W. Tao, Y. Cui, Q. Yao (Suzhou, China) 

840 Standardization of varicocele: Is it possible? 

X.K. Wang, W.L. Wang, H.Z. Wang, L. Che, D.J. Fu, M.K. Lai, Y.P. Liu (Xiamen, Beijing, China) 

841 Robotic assisted re-do vasectomy reversal for previously failed pure microsurgical reversal 

A. Gudeloglu, J. Brahmbhatt, T. Patel, K. Priola, S. Parekattil (Winter Haven, United States of America) 

842 Clinical assessment of microdissection testicular sperm extraction in 313 patients with non-obstructive 

azoospermia 

K. Yamaguchi, K. Chiba, K. Matsushita, K. Okada, N. Enatsu, H. Miyake, M. Fujisawa (Kobe, Japan) 

843 Do cell phones affect semen quality? 

V. Boulos, H. Hassan (Cairo, Egypt) 

844 Endoscopy of the vas deference – a new diagnostic and therapeutic tool in andrology 

M. Trottmann, A. Becker, B. Liedl, C. Stief, M. Graw, C. Braun, S. Kölle (Munich, Germany) 

845 Choice of antibiotic therapy for chronic bacterial prostatitis in patients with infertility 

M.I. Kogan, H.S. Ibishev, Y.L. Naboka, K.A. Shiranov, A.H. Ferzauli, I.A. Gudima (Rostov on Don, Russia) 

846 EAU guideline reduces unnecessary post vasectomy semen analyses 

E.M. Gordon, S.A Gordon, A. Hatton, J. Kasraie, N.N.K Lynn (Shrewsbury, Colchester, United Kingdom) 

847 Probe–based Confocal Laser Endomicroscopy (pCLE) - a new imaging technique for in situ localization of 

vital spermatozoa 

M. Trottmann, B. Liedl, A. Becker, C. Gratzke, C. Füllhase, C. Stief, S. Kölle (Munich, Germany) 




271 

Monday

Monday 




12.15 - 13.45 Prostate cancer: Biomarkers 



Chairs: S. Crouzet, Lyon (FR) 

A. Haese, Hamburg (DE) 



848 Clinical performance of serum isoform [-2]proPSA (p2PSA) and its derivatives, namely %p2PSA and PHI 

(Prostate Health Index) in men with family history of prostate cancer. Results from a multicentric European 

study (PROMEtheuS project) 

M. Lazzeri, G. Lughezzani, G. Lista, A. Larcher, A. Cestari, N. Buffi, A. Haese, A. Renter, A. De La Taille, 

P.O. Bosset, P. Le Corvoisier, T. McNicholas, L. Fowler, J.W. Roux, J. Palou, A. Breda, P. De La Torre, V. Bini, 

M. Graefen, G. Guazzoni (Milan, Perugia, Italy; Hamburg, Germany; Creteil, France; Stevenage, United 

Kingdom; Barcelona, Spain) 

849 Decreasing cancer specific PSA density (CaPSAD) is a hallmark of local prostate tumour progression 

with prognostic relevance independent of serum PSA, and reflects a systematic alteration in androgen 

signalling 

N.M. Corcoran, M.K.H. Hong, N. Sapre, C.J. Nowell, J. Pedersen, G. Macintyre, R.K. Gaire, A. Kowalczyk, 

L.M. Harewood, J.S. Peters, A.J. Costello, C.M. Hovens (Melbourne, Australia) 

850 A prediction based on levels of four kallikrein markers in blood improves preoperative prediction of 

indolent versus 

S. Carlsson, A. Maschino, E. Steyerberg, T. Van Der Kwast, A. Van Leenders, A. Vickers, H. Lilja, M. Roobol 

(New York, United States of America; Rotterdam, The Netherlands) 

851 Lower PCA3 scores in prostate cancer patients with metastatic disease than in patients with nonmetastatic 

disease: Baseline data from the Triptocare study 

L. Martínez-Piñeiro, J. Schalken, A. De La Taille (Madrid, Spain; Nijmegen, The Netherlands; Creteil, France) 

852 Cost evaluation of introducing the Prostate Health Index (phi) in the management of prostate cancer 

diagnostic 

C. Castelli, R. Mathieu, T. Fardoun, K. Bensalah, S. Vincendeau (Nimes, Rennes, France) 

853 [-2]proPSA and prostate health index (phi) improve detection of prostate cancer at initial and repeated 

biopsies in young men (≤ 60 year old) preferentially detecting clinically significant cancer 

C. Stephan, S. Vincendeau, A. Houlgatte, K. Miller, A. Semjonow (Berlin, Münster, Germany; Rennes, Paris, 

France) 

854 PSA determinations with microfluidics: A novel point-of-service bioassay 

M.S. Zappala, J. Libertino, A. Wein, E.D. Vaughan, P. Scardino (Andover, Burlington, Philadelphia, New York, 


855 Definition of the Limit of Detection (LoD) for serum isoform [-2]proPSA in patients with recurrent prostate 

cancer after radical prostatectomy: An analytic study 

F. Ceriotti, M. Pontillo, L. Fasoli, M. Lazzeri, G. Lughezzani, G. Lista, A. Larcher, A. Cestari, N. Buffi, G. Fuzzi, 

G. Guazzoni (Milan, Florence, Italy)

856 Reducing the number of prostate biopsies – validation of a four kallikrein panel to predict prostate cancer 

in a population-based referral cohort 

K. Braun, H.G. Lilja, A.J. Vickers, D. Sjoberg, A. Bjartell (Herne, Germany; New York, United States of 

America; Malmö, Sweden) 

857 Relationship between PSA level and impairment of proteinase-inhibitory balance of key proteolytic 

systems during androgen-deprivation therapy for prostate cancer 

M.I. Kogan, M.B. Chibichyan, E.A. Chernogubova (Rostov on Don, Russia) 

858 Baseline PSA level in prediction of prostate cancer risk and aggressiveness: A Danish population-based 

cohort study 

S. Benzon Larsen, K. Brasso, S.O. Dalton, J. Christensen, M. Christiansen, S. Calsson, H. Lilja, S. Friis, 

A. Tjønneland, P. Iversen (Copenhagen, Denmark; New York, United States of America) 

859 Parallel measurement of urinary PCA3 and TMPRSS2:ERG with serum [-2]proPSA based Phi for prostate 

cancer detection 

C. Stephan, A. Semjonow, K. Schulze-Forster, H. Cammann, X. Hu, K. Miller, K. Jung, F. Friedersdorff (Berlin, 

Münster, Luckenwalde, Germany) 

860 Influence of metabolic syndrome on prostate volume and prostate specific antigen 

W.S. Choi, C.J. Lee, S.B. Ha, S.Y. Cho, N.J. Heo, H. Jeong, J.S. Paick, H. Son (Seoul, South Korea) 

861 Chemopreventive properties of the flavonoids genistein and quercetin in men with rising PSA: First results 

of a double-blind, randomized, placebo-controlled trial (QUERGEN trial) 

A. Galasso, S. Aufderklamm, A. Damms-Machado, F. Miller, S.C. Bischoff, A. Stenzl, G. Gakis (Hohenheim, 

Tübingen, Germany) 


273 

Monday

Monday 




12.15 - 13.45 Complex urological reconstructions and tissue engineering 



Chairs: T.A. Drewa, Bydgoszcz (PL) 

S.G. Joniau, Leuven (BE) 



862 Health related quality of life after radical cystectomy: Comparative study between orthotopic sigmoid 

versus ileal neobladders 

H. Miyake, J. Furukawa, M. Muramaki, M. Fujisawa (Kobe, Japan) 

863 Ileocecal cup patch plasty as secondary continence mechanism in selected cases of outlet failure in 

continent cutaneous urinary diversion: Surgical technique and clinical results 

D.C. Vergho, C. Bauer, A. Kocot, A. Loeser, H. Riedmiller (Würzburg, Germany) 

864 Y-neobladder: An update of a multi-institutional retrospective study. Analysis of late complications 

through Clavien-Dindo classification 

P. Destefanis, A. Bosio, M.T. Carchedi, A. Battaglia, M. Allasia, A. Gonella, G. Fasolis, M. Bellina, M. Mari, 

S. Crivellaro, B. Frea, G. Marchioro, C. Terrone, M. Maffezzini, G. Carrieri, G. Morgia, D. Fontana (Turin, 

Alba, Rivoli, Udine, Novara, Genua, Foggia, Messina, Italy) 

865 Long term follow up for ileal conduit urinary diversion: Patients perspective in the absence of guidelines 

A.M. Abdelbaky, J. O’Donovan, R. Pickard (Newcastle upon Tyne, United Kingdom) 

866 Modified Y/V-plasty for the treatment of recurrent bladder neck contracture: Outcome and patient 

satisfaction 

C.P. Reiss, P. Schriefer, W. Struss, B. Schwaiger, H. Isbarn, O. Engel, S. Riechardt, M. Fisch, S. Ahyai, 

R. Dahlem (Hamburg, Germany) 

867 Outcome of Y-V plasty as a final option in patients with recurrent bladder neck sclerosis after failed 

endoscopic treatment 

K.A.M. Sayedahmed, M. Salman, M. Aragona, R. Seibel, J. Ekrutt, M. Reichert, R. Olianas (Lueneburg, 

Germany) 

868 Longterm cell-demanded release of TG-VEGF for the development of mature vascular networks for 

sphincter muscle engineering in vivo 

J. Marshall, R. Largo, A. Mortezavi, A. Sala, A. Banfi, M. Ehrbar, D. Eberli (Zürich, Basel, Switzerland) 

869 The novel biocomposite enhanced urinary bladder regeneration by inducing smooth muscle regrowth and 

preventing scar tissue formation – animal model study 

J.A. Adamowicz, J.T. Tworkiewicz, T.K. Kowalczyk, M.P. Pokrywczyńska, M.B. Bodnar, A.M. Marszałek, 

T.D. Drewa (Bydgoszcz, Warsaw, Poland) 

870 Prenatal coverage of an experimental spina bifida defect by gluing a growth factor loaded collagen 

scaffold improves neurological outcome 

L.A.J. Roelofs, A.J. Eggink, W.F. Daamen, T.H. Kuppevelt, M.M.Y. Lammens, A.J. Crevels, L.H. Olde Damink, 

I. Heschel, P.J. Geutjes, W.F.J. Feitz (Nijmegen, Rotterdam, The Netherlands; Herzogenrath, Germany)

871 Bladder wall substitution with autologously seeded collagen scaffolds “Optimaix” in a Göttingen minipig 

model 

D. Leonhäuser, V. Seifarth, K. Strick, N. Gaisa, I. Heschel, R.H. Tolba, A. Artmann, J.O. Grosse (Aachen, 

Jülich, Herzogenrath, Germany) 

872 Tubular constructs for urinary diversion: A feasibility study in pigs 

M. Sloff, P.J. Geutjes, H.R. Hoogenkamp, V. Simaioforidis, T.H. Van Kuppevelt, W.F. Daamen, E. Oosterwijk, 

W.F. Feitz (Nijmegen, The Netherlands) 

873 Reducing the risk in the production of tissue engineered buccal mucosa for urethral reconstruction 

A.J. Bullock, C.R. Chapple, S. MacNeil (Sheffield, United Kingdom) 

874 Bioengineered skeletal muscle for the treatment of sphincter insufficiency characterized by MRI 

relaxometry 

F. Azzabi, N. Chuck, A. Boss, D. Eberli (Zürich, Switzerland) 

Summary on tissue engineering 

T.A. Drewa, Bydgoszcz (PL) 


275 

Monday

Monday 




12.15 - 13.45 How to reduce warm ischemia in partial nephrectomy 



Chairs: H-C. Klingler, Vienna (AT) 





* 875 To clamp or not to clamp during laparoscopic partial nephrectomy: A scintigraphic study of impact on renal 

function 

F. Porpiglia, I. Morra, R. Bertolo, D. Amparore, C. Fiori (Turin, Italy) 

876 Perioperative and functional outcomes of robotic assisted partial nephrectomy without hilar clamping: A 

multi-institutional propensity score analysis 

B. Kaczmarek, R. Kumar, Y. Tanagho, S. Hillyer, J. Mullins, M. Diaz, Q-D. Trinh, S. Bhayani, M. Stifelman, 

J. Kaouk, C. Rogers (Detroit, Saint Louis, Cleveland, Baltimore, New York, United States of America) 

877 A clinical study of laparoscopic nephron-sparing partial nephrectomy with temporary blocking-up 

segmental branch of renal artery technique 

F. Chen (Guiyang, China) 

878 Application of vasculature model and standardization of renal hilar approach in laparoscopic partial 

nephrectomy with precise segmental artery clamping 

C.J. Yin (Nanjing, China) 

879 Towards zero ischaemia laparoscopic partial nephrectomy: Single centre experience 

J.K. Makanjuola, A. Qteishat, M. Lynch, A. Rao, C. Brown, C. Kouriefs, M. Arya, P. Grange (London, United 

Kingdom) 

880 Functional outcome of nephron sparing surgery: Impact of warm ischemia less than 30 min vs no ischemia 

and role of endothelin-1 

A. Morlacco, S. Crivellaro, G. Romano, L. Tosco, B. Frea (Udine, Italy) 

881 Feasibility and safety of zero ischemia robotic assisted partial nephrectomy with controlled hypotension 

for tumors larger than 4 cm 

R. Papalia, G. Simone, M. Ferriero, S. Guaglianone, E. Forastiere, M. Gallucci (Rome, Italy) 

882 Early unclamping surgical technique for robot-assisted partial nephrectomy: A multicenter prospective 

experience 

A.A. Wagner, K. Zeeck, P. Chang, A. Percy, G. Rao, K. Attwood, D. Mehedint, L. Digiorgio, T. Schwaab 

(Boston, Buffalo, United States of America) 

883 Near-infrared fluorescence for laparoscopic partial nephrectomy 

P. Macek, E. Barret, F. Rozet, R.E. Sanchez-Salas, M. Galiano, P. Ahallal, J.M. Gaya, X. Cathelineau (Paris, 

France) 

884 Laparoscopic partial nephrectomy without ischemia using a new 1,318 nm diode laser in a porcine 

survival model: Histological results after 4 weeks survival 

R.P. Zimmermann, E.E. Foditsch, M. Hager, L. Lusuardi, B. Hoinoiu, G. Janetschek (Salzburg, Austria; 

Timisoara, Romania)

885 Intracorporeal cooling and extraction (I.C.E.) technique of robotic partial nephrectomy: Emulating the open 

approach 

C.G. Rogers, K.R. Ghani, R.K. Kumar, W. Jeong, M. Menon (Detroit, United States of America) 

886 Partial nephrectomy for the treatment of renal cell carcinoma and the risk of end stage renal disease 

S.A. Yap, S.M. Alibhai, G.A. Tomlinson, D.R. Urbach, A. Finelli (Toronto, Canada) 

887 Efficacy of floseal® vs tachosil® vs no hemostatic agents for partial nephrectomy: A prospective 

multicenter comparative study (RECORd Project) 

A. Antonelli, A. Minervini, N. Arrighi, G. Bianchi, S. Cosciani Cunico, V. Ficarra, C. Fiori, G. Martorana, 

A. Lapini, M. Medica, V. Mirone, N. Pinzi, F. Porpiglia, F. Rocco, B. Rovereto, R. Schiavina, S. Serni, 

C. Simeone, C. Terrone, A. Volpe, F. Zattoni, M. Carini (Brescia, Florence, Modena, Padua, Orbassano, 

Bologna, Sestri Levante, Naples, Lucca, Milan, Pavia, Novara, Italy) 


277 

Monday

Monday 




12.15 - 13.45 What is new in female urology 



Chairs: K-D. Sievert, Tübingen (DE) 





888 Psychometric validation of a 3-day bladder diary model for lower urinary tract symptoms 

L. López-Fando Lavalle, M.A. Jimenez Cidre, M. Esteban Fuertes, F.J. Llorens Martinez, J. Salinas Casado, 

D. Castro Diaz, C. Müller Arteaga, J.M. Adot Zurbano, F. Rodriguez Escobar, M.A. Bonillo Garcia, B. Madurga 

Patuel, M. Leva Vallejo, L. Peri Cusi, J. Conejero Sugrañes, J. Jiménez Calvo (Madrid, Toledo, Elche, Tenerife, 

Vigo, Burgos, Barcelona, Valencia, Cádiz, Cordoba, Sevilla, Spain) 

889 The Multiple Array Probe (MAPLe): A new tool capable of measuring EMG and differentiate between 

individual pelvic floor muscles 

P.J. Voorham-Van der Zalm, H.C. Voorham, C.W.L. Van Den Bos, H. Putter, M.C. De Ruiter, R.C.M. Pelger 

(Leiden, The Netherlands) 

890 Catheterless long-term urodynamics with three devices 

S. Wille, J. Hamacher, D. Tenholte, N. Muthen, M. Al Mahmid, J. Mehner, U.H. Engelmann (Cologne, 

Chemnitz, Germany) 

891 Does structural differences in type I synthetic slings have an impact on biocompatibility? Long-term 

evaluation of tissue reaction to two synthetic slings in an animal model: TVT-O® vs I-STOP® 

O. El Yazami Adli, O. Loutochin, W. Mahfouz, M. Caremel, J. Corcos (Montreal, Canada) 

892 Oral lactobacilli vs antibiotic prophylaxis for recurrent urinary tract infections in premenopausal women 

N. Stepanova, V. Kruglikov, L. Lebid, M. Kolesnyk (Kiev, Ukraine) 

893 Asymptomatic bacteriuria in pregnant women 

A. Lavrinenko, S. Kuderinov, I. Azizov, I. Belyaev, Y. Serbo, P. Deriglazova (Karaganda, Kazakhstan) 

894 Recurrent urinary tract infections in adult women: A pilot study with oral d-mannose 

D. Porru, A. Parmigiani, D. Barletta, D. Choussos, S. Bassi, O. Miller, B. Gardella, R.E. Nappi, A. Spinillo, 

B. Rovereto (Pavia, Italy) 

895 Altis® single-incision sling procedure for stress urinary incontinence: Short term outcomes from a single 

centre 

J. Dias, A.R. Freitas, R.F. Amorim, P. Espiridião, L. Xambre, L. Costa, L. Ferraz (Gaia, Oporto, Portugal) 

* 896 Mid-term follow-up after Ajust single incision sling implantation for women stress urinary incontinence: 

Efficacy, complications and prognostic factors 

J-N.L. Cornu, D. Lizée, L. Peyrat, C. Ciofu, N. Henry, P. Sèbe, O. Cussenot, F. Haab (Paris, France) 

897 The “Tissue Fixation mini-sling System (TFS)” – a novel system for reconstructive surgery of pelvic floor 

dysfunctions in women, following the Integral-Theory. First results in 54 women 

F.M.E. Wagenlehner, O. Fröhlich, T. Bschleipfer, B. Altinkilic, A. Gunnemann, B. Liedl, W. Weidner (Giessen, 

Detmold, Munich, Germany)

* 898 Mini-Arc for the treatment of female stress urinary incontinence: Long-term evaluation by patient 

reported outcomes 

R.M. Oliveira, A.O. Resende, C.M. Silva, P.D. Oliveira, F.M. Cruz (Porto, Portugal) 

Where do we go with mini-slings 



279 

Monday

Monday 




12.15 - 13.45 BPH: Genes, biomarkers and beyond 



Chairs: A. Bachmann, Basel (CH) 

R.W.G. Watson, Dublin (IE) 




899 Surface CD24 distinguishes undifferentiated from transit-amplifying cells in the basal layer of the human 

prostate 

N. Petkova, J. Hennenlotter, T. Todenhöfer, M. Sobiesiak, S. Aufderklamm, M. Scharpf, A. Stenzl, H. Bühring, 


* 900 Targeting both the dynamic and static components of LUTS/BPH using a soluble guanylate cyclase 

stimulator compared to vardenafil: Preclinical evidences 

D. Behr-Roussel, A. Oudot, S. Oger, D. Gorny, P. Sandner, J. Bernabé, L. Alexandre, F. Giuliano (Montigny-Le- 

Bretonneux, France; Wuppertal, Germany) 

901 SRD5A1 and SRD5A2 genes are associated with the treatment for benign prostatic hyperplasia with the 

combination of 5α-reductase inhibitors and α-adrenergic-receptor antagonist 

X. Gu, R. Na, W. Li, S. Tao, L. Tian, Z. Chen, Y. Jiao, J. Kang, S. Zheng, J. Xu, J. Sun, J. Qi (Shanghai, China; 

Winston-Salem, United States of America) 

902 Is the androgen receptor the link between inflammation and benign prostatic hyperplasia? 

J.M. Willder, V.C. Walker, T. Christ, G.L. Halbert, C.P.C, Dick, C. Orange, T. Qayyum, P.G. Horgan, 

M.A. Underwood, J. Edwards (Glasgow, United Kingdom) 

903 Different high-fat diets induce overweight, insulin resistance and structural alterations on prostate rats 

A. Furriel, P.C. Silva, P.C.G.P. Silva, D.B. De Souza, W.S. Costa, F.J.B. Sampaio, B.M. Gregório (Rio de Janeiro, 

Brazil) 

904 Is the cyclic AMP signaling a pivotal player in the control of prostate smooth muscle? A biochemical and 

functional approach 

S. Ückert, E.S. Waldkirch, G.T. Kedia, M.A. Kuczyk (Hanover, Germany) 

* 905 Phosphorylation of the androgen receptor at serine 308 may link benign prostate enlargement to 

cardiovascular disease 

J.M. Willder, V. Walker, T. Christ, G.L. Halbert, C.P.C. Dick, C. Orange, P.G. Horgan, M.A. Underwood, 

J. Edwards (Glasgow, United Kingdom) 

906 Inhibition of EFS-, phenylephrine-, and thromboxane-induced contraction of human prostate smooth 

muscle by the receptor antagonist, picotamide 

M. Hennenberg, M. Miljak, F. Strittmatter, Y. Hocaoglu, B. Rutz, C. Füllhase, C.G. Stief, C. Gratzke (Munich, 

Germany) 

907 Noradrenaline induces binding of clathrin light chain A to alpha1A-adrenoceptors in the human prostate 

M. Hennenberg, J. Miersch, B. Rutz, F. Strittmatter, S. Walther, R. Waidelich, A. Roosen, C.G. Stief, C. Gratzke 

(Munich, Germany)

908 The alteration of matrix metalloproteinase - 2, 9 and the expression of prostate specific antigen within the 

prostatic tissue following acute urinary retention of non-malignant etiology in rats 

W. Djatisoesanto, I.K. Sudiana, D.M. Soebadi (Surabaya, Indonesia) 

909 The effects of soluble guanylyl cyclase stimulator alone and in combination with a phosphodiesterase type 

5 inhibitor in normal rats and rats with partial urethral obstruction induced bladder overacticvity 

C. Fullhase, M. Hennenberg, P. Sandner, R. Soler, C. Stief, K.E. Andersson (Munich, Wuppertal, Germany; 

Sao Paulo, Brazil; Winston-Salem, United States of America) 

910 A systematic review and meta-analysis of candidate gene association studies of lower urinary tract 

symptoms in men 

A. Mangera, R. Cartwright, K.A.O. Tikkinen, T. Palmer, J. Pesonen, P. Rajan, C. Ambrose, A.C. Kirby, 

G. Thiagamoorthy, V. Khullar, P.R. Bennett, A. Walley, M-R. Jarvelin, C.R. Chapple (Sheffield, London, 

Bristol, Glasgow, United Kingdom; Hamilton, Canada; Tampere, Finland; San Diego, United States of 

America) 

Summary: Results from the Goliath study 

A. Bachmann, Basel (CH) 


281 

Monday

Monday 




14.00 - 15.30 Challenging reconstructive surgery 



Chairs: L. Peri Cusi, Barcelona (ES) 

G.A.N. Pignot, Le Kremlin Bicetre (FR) 


V65 Laparoscopic bladder augmentation and Mitrofanoff appendicovesicostomy: Saint Augustin technique 

D. Rey, M. Oderda, E. Helou, L. Lopez, P.T. Piechaud (Bordeaux, France) 

V66 Laparoscopic ureteric reimplantation for missed ureteric injury after gynaecological surgery 

M.J. Smolski, N. McLeod, S.C. Brown, N. Oakley (Stockport, United Kingdom) 

V67 Repair of recto-urethral fistula with perineal approach and interposition of gracilis muscle 

R. Sanseverino, G. Napodano, O. Intilla, U. Di Mauro, G. Molisso, T. Realfonso (Nocera Inferiore, Italy) 

V68 Transanal repair of rectovesical fistula after radical prostatectomy using the modified Latzko technique 

T. Nomura, M. Kawaguchi, K. Kayanuma, S. Suzuki, J. Kobayashi, H. Ishikawa (Yamanashi, Japan) 

V69 Mini-invasive transrectal repair of recto-urinary fistula after radical prostatectomy 

G. Nicita, V. Li Marzi, M. Mencarini, A. Cocci, D. Villari, M. Marzocco (Florence, Italy) 

V70 Reconstruction of complicated redo-hypospadia in two stages with buccal mucosal graft 

J. Beier, A. Pandey, H. Keller (Hof, Germany) 

V71 Combined therapy of stress urinary incontinence and erectile dysfunction with the implantation of Advance 

(XP) and AMS 700 in a single procedure 

B. Amend, S. Kruck, S.K. Wilson, L. Hakim, B.S. Christine, J. Brady, E.R. Castane, C. Rojas-Cruz, A. Stenzl, 

J. Bedke, K-D. Sievert (Tübingen, Germany; Indio, Cleveland, Homewood, Orlando, United States of America; 

Barcelona, Spain) 

V72 Laparoscopic ureteral reimplantation in Hautmann’s neobladder 

J.A. Peña, M. Oliveira, J.M. Santillana, A. Rosales, J. Palou, H. Villavicencio (Barcelona, Spain)



14.00 - 15.30 Surgical approaches for prostate cancer 



Chairs: M. Burchardt, Greifswald (DE) 

B. Rocco, Milano (IT) 




* 911 Oncological outcome and prognostic factors for locally advanced prostate cancer treated with radical 

prostatectomy: An EMPaCT study 

C.Y. Hsu, M. Spahn, A. Briganti, J. Karnes, P. Gontero, G. Marchioro, B. Tombal, J. Chun, P. Bastian, H. Van 

Der Poel, R. Sanchez-Salas, S. Joniau (Taichung, Taiwan; Berne, Switzerland; Milan, Turin, Novara, Italy; 

Rochester, United States of America; Brussels, Leuven, Belgium; Hamburg, Munich, Germany; Amsterdam, 

The Netherlands; Paris, France) 

* 912 Comparative oncologic effectiveness of radical prostatectomy and radiotherapy in prostate cancer: An 

analysis of mortality outcomes in 34,515 patients treated with up to 15 years follow-up 

P. Sooriakumaran, L. Haendler, T. Nyberg, I. Heus, M. Olsson, S. Carlsson, M. Roobol, P. Wiklund (Stockholm, 

Sweden; Rotterdam, The Netherlands) 

913 Trifecta and SCP classification after robot-assisted radical prostatectomy 

M.B. Borghesi, V. Ficarra, G. Novara, E. Frumenzio, M. Gan, A. Mottrie (Aalst, Belgium; Padua, Italy) 

914 A prospective randomized study to compare functional outcomes of radiofrequency and ultracision 

scalpels in videolaparoscopic radical prostatectomy 

A.L. Pastore, G. Palleschi, V. Petrozza, L. Silvestri, A. Leto, A. Ripoli, D. Autieri, A. Carbone (Latina, Italy) 

915 Robot-assisted vs open radical prostatectomy: A comparison of outcomes across procedure type and 

volume quartile 

J.D. Sammon, S. Sukumar, P. Ravi, K.R. Ghani, J.O. Peabody, M. Menon, Q-D. Trinh (Detroit, United States of 

America) 

916 Impact of length of positive surgical margins (PSM) on biochemical recurrence (BCR) after robotic-assisted 

radical prostatectomy (RARP), in a single center series with a minimum follow-up of five years 

A. Ploumidis, P. Sooriakumaran, L. Haendler, T. Nyberg, M. Olsson, S. Carlsson, G. Steineck, P. Wiklund 

(Stockholm, Sweden) 

917 Comparative analysis of a consecutive series of 160 brachytherapies and 153 robotic prostatectomies 

J.M. Conde-Sanchez, C. Garcia-Sanchez, B. Congregado-Ruiz, I. Osman-Garcia, E. Argüelles-Salido, 

J.M. Pena-Outeiriño, R.A. Medina-Lopez (Seville, Spain) 

918 Is robotic assisted radical prostatectomy the real alternative to active surveillance? Results of perioperative 

and functional outcome analyses 

A. Gallina, N.M. Passoni, A. Nini, A. Salonia, P. Dell’Oglio, M. Tutolo, D. Di Trapani, R. Colombo, R. Damiano, 

N. Finocchio, V. Scattoni, G. Guazzoni, N. Suardi (Milan, Catanzaro, Italy) 

919 Increasing cost-effectiveness in DaVinci-robot-assisted radical prostatectomy by reducing the utilization of 

robotic and laparoscopic instruments and disposables: Experience of two high-volume robotic European 

centers 

A. Haese, B. Rocco (Hamburg, Germany; Milan, Italy) 


283 

Monday

Monday 

920 SAFE-R: A novel score, accounting for oncological safe nerve-sparing 

A. Becker, P. Tennstedt, M. Adam, J. Hansen, H. Heinzer, M. Graefen, T. Schlomm (Hamburg, Germany) 

921 The impact of trainees on surgical outcomes following robotic assisted radical prostatectomy (RARP) 

L.S. Lee, B. Thomas, N.C. Shah (Singapore, Singapore; Cambridge, United Kingdom) 

922 5-year oncologic outcomes of endoscopic extraperitoneal radical prostatectomy (EERPE) for prostate 

cancer: The benefits of a mentored fellowship programme 

D.W. Good, S.A. McNeill, G.D. Stewart, J.U. Stolzenburg (Edinburgh, United Kingdom; Leipzig, Germany) 




14.00 - 15.30 Radical surgery for bladder cancer: Patient outcomes 



Chairs: M. Brausi, Modena (IT) 





923 Results of a prospective study on a new fast track regimen for patients undergoing radical cystectomy for 


A. Karl, A. Buchner, A. Becker, T. Grimm, C.G. Stief (Munich, Germany) 

* 924 Comparative performance of comorbidity indices for estimating perioperative and 5-year all-cause 

mortality following radical cystectomy 

S. Boorjian, S.P. Kim, M.K. Tollefson, A. Carrasco, J.C. Cheville, R.H. Thompson, P. Thapa, I. Frank (Rochester, 


925 The prognostic impact of pre-operative hematological disorders and a risk stratification model in bladder 

cancer patients treated with radical cystectomy 

T. Sejima, H. Iwamoto, T. Masago, S. Morizane, A. Yao, T. Isoyama, T. Koumi, A. Takenaka (Yonago, Matsue, 

Japan) 

* 926 Are patients at nutritional risk more prone to complications after major urological surgery? 

Y. Cerantola, M. Valerio, M. Hubner, K. Iglesias Rutishauser, L. Vaucher, P. Jichlinski (Lausanne, Switzerland) 

927 Benefit in regionalization of care for patients treated with radical cystectomy: A nationwide inpatient 

sample based analyses 

H. Lavigueur-Blouin, M. Meskawi, F. Roghmann, Z. Tian, N. Hanna, M. Sun (Montreal, Canada; Herne, 

Germany) 

928 Risk factors of hospital readmissions following open radical cystectomy and urinary diversion: Analysis of 

1000 consecutive patients 

S. El-Halwagy, A. Haraz, Y.M. Osman, M. Laymon, A. Mosbah, A. Shaaban (Mansoura, Egypt) 

929 Obesity heads to worse outcomes in patients with T1 high grade urothelial carcinoma of the bladder 

L.A. Kluth, E. Xylinas, J.J. Crivelli, N. Passoni, P.I. Karakiewicz, E. Comploj, A. Pycha, S. Holmang, T. Faison, 

P. Gontero, Y. Lotan, F.K.H. Chun, R. Dahlem, D.S. Scherr, S.F. Shariat (New York, Dallas, United States of 

America; Milan, Bolzano, Turin, Italy; Montreal, Canada; Gothenburg, Sweden; Hamburg, Germany) 

930 Magnetic resonance imaging: Postoperative anatomic measurements association with urinary continence 

in orthotopic ileal neobladder after radical cystoprostatectomy for bladder cancer 

J. Lopater, A. Scherrer, V. Delmas, S. Gey, Y. Neuzillet, T. Lebret (Suresnes, Paris, France) 

931 A comparison of 90-day complications between ileal conduit and neobladder reconstruction after radical 

cystectomy: A multi-institutional retrospective study in Japan 

R. Matsumoto, T. Abe, N. Takada, N. Shinohara, A. Sazawa, S. Maruyama, T. Osawa, T. Shibata, T. Yutaka, 

Y. Shinno, S. Sato, H. Matsuda, T. Sato, K. Sugishita, S. Kamota, T. Yamashita, J. Ishizaki, T. Kaneda, 

S. Kanzaki, G. Mouri, T. Ono, N. Miyajima, T. Sakuta, T. Mochizuki, T. Aoyagi, Y. Kanno, H. Katano, T. Akino, 

H. Seki, K. Hirakawa, K. Minami, T. Seki, M. Togashi, H. Sano, K. Nonomura (Sapporo, Japan) 


285 

Monday

Monday 

932 Experimental studies of relationship between configuration and urodynamics of ileal reservoirs 

Y.J. Yan, Y.F. Shi, J.M. Li, J. Chen, J.H. Liu (Kunmiing, China) 

933 In vivo tissue-engineered augmentation cystoplasty with electrospun scaffold made of PCL and PHA: 6 

months results in rats 

A. Vianello, L. Mearini, A. Zucchi, A. Bianco, C. Del Gaudio, G. Bellezza, A. Sidoni, M. Porena (Perugia, 

Rome, Italy) 

934 Impact of nocturnal incontinence and chronic urinary retention after radical cystectomy and neobladder 

reconstruction on health related quality of life in women 

M.H. Zahran, A.S. El-Hefnawy, E.M. Zidan, M.A. El-Bilsha, D-E. Taha, B. Ali-El-Dein (Mansoura, Egypt) 


Summary 

O.W. Hakenberg, Rostock (DE)



14.00 - 15.30 Prostate cancer cell biology and signaling 



Chairs: G. Jenster, Rotterdam (NL) 

H.Y. Leung, Glasgow (GB) 



935 Activation of HIF1α promotes androgen independent prostate cancer cell growth 

M. Tran, F. Lo, A. Ramos-Montoya, H. Scott, S. Menon, T. Carroll, M. Osborne, J. Hadfield, S. Cheung, 

A. Warren, D. Shukla, C. Massie, P. Maxwell, I. Mills, D. Neal (Cambridge, United Kingdom) 

936 MiR-221 targets IRF2 and SOCS3 - two negative regulators of the JAK/STAT pathway - and inhibits their 

expression in prostate cancer 

M. Spahn, M. Krebs, M. Schubert, H. Riedmiller, B. Kneitz (Berne, Switzerland; Würzburg, Germany) 

937 Wnt signaling protein (Wisp2/CCN5) stimulates angiogenesis and invasion in prostate cancer 

Y. Hashimoto, R. Singh, B. Lokeshwar (Tokyo, Japan; Miami, United States of America) 

938 Metformin inhibits the proliferation of human prostate cancer PC-3 cells via down-regulation of the 

insulin-like growth factor 1 receptor 

H. Kato, Y. Sekine, Y. Miyazawa, Y. Furuya, H. Koike, K. Suzuki (Maebashi, Japan) 

939 ERp46 mediates prostate cancer tumorigenesis in vitro by inhibiting adiponectin-induced tumorsuppressive 

effects - linking obesity to prostate cancer 

J. Pinthus, S. Hopmans, A. Paschos, R. Austin, W. Duivenvoorden (Hamilton, Canada) 

940 Sonic hedgehog signaling and androgens are linked in tumor-stromal interaction through Epithelial- 

Mesenchymal Transition (EMT) in prostate cancer progression 

K. Shigemura, F. Yamamichi, T. Shirakawa, H. Miyake, K. Tanaka, M. Fujisawa (Kobe, Japan) 

941 Loss of Dickkopf-3 expression impairs prostate acinar morphogenesis via aberrant TGF-β/Smad signalling 

activation 

Y. Kawano, D. Romero, N. Bengoa, N. Maltry, M. Walker, M. Eto, J. Waxman, C. Niehrs, R. Kypta (Kumamoto, 

Japan; London, United Kingdom; Bilbao, Spain; Heidelberg, Germany) 

942 Cancer cell specific transcriptome analysis of stroma-cancer interactions in mouse xenograft models of 

bone metastasis 

G.N. Thalmann, J. Hensel, B. Özdemir, A. Wetterwald, M. Delorenzi, M.G. Cecchini (Berne, Lausanne, 

Switzerland) 

943 Epigenetic and transcriptional mechanisms by which MYC regulates rRNA levels 

M. Uemura, S. Yegnasubramanian, W.G Nelson, N. Nonomura, A.M De Marzo (Suita, Japan; Baltimore, 


944 Computerized quantification and planimetry of prostatic capsular nerves in relation to adjacent cancer foci 

J. Bründl, S. Schneider, F. Zeman, W.F. Wieland, R. Ganzer (Regensburg, Germany) 

945 The genomic evolution of prostate cancer under the selective pressure of anti-androgen therapy 

J.R. Gsponer, T. Dietsche, A. Rufle, E. Lenkiewicz, T. Zellweger, A. Bachmann, M.T. Barrett, C.A. Rentsch, 

C. Ruiz, L. Bubendorf (Basel, Switzerland; Scottsdale, United States of America) 


287 

Monday

Monday 

946 Identification of castrate-resistant cancer repopulating cells in localised prostate tumours 

D.G. Murphy, R. Toivanen, M. Frydenberg, J. Pedersen, A. Ryan, D. Pook, M. Berman, R.A. Taylor, 

G.P. Risbridger (Melbourne, Clayton, Mount Waverley, Australia; Kingston, Ontario, Canada) 

947 Distinct role of the CTCF-binding site in IGF2/H19-ICR and of the differential methylated region in IGF2promoter 

0 in LOI and IGF2-expression in prostate cancer 

T. Dansranjavin, F. Wagenlehner, P. Waliszewski, K. Steger, W. Weidner, S. Gattenloehner, 

U. Schagdarsurengin (Giessen, Germany) 


Summary 

H.Y. Leung, Glasgow (GB)



14.00 - 15.30 Nephrectomy for RCC: Minimally invasive techniques, renal function, 

lymph node dissection and prognostic factors 



Chairs: J. Ramon, Tel Aviv (IL) 

R.E. Zigeuner, Graz (AT) 




* 948 Hybrid transvaginal natural orifice transluminal endoscopic surgery (NOTES) nephrectomy: Our experience 

X. Zou, G. Zhang, Y. Xue, R. Xiao, Y. Yuan, G. Wu, X. Wang, D. Long, Y. Wu, F. Liu, Y. Liao (Ganzhou, China) 

949 Laparoendoscopic single-site and conventional laparoscopic radical nephrectomy result in an equivalent 

surgical trauma: Preliminary results of a single-centre retrospective controlled study 

F. Greco, C. Springer, P. Fornara (Halle Saale, Germany) 

950 Novel three-dimensional head-mounted display system (RoboSurgeon System) - application to the initial 

60 cases of gasless single-port access urologic surgeries 

K. Kihara, H. Takeshita, H. Masuda, F. Koga, K. Saito, Y. Matsuoka, N. Numao, Y. Fujii (Tokyo, Japan) 

951 Renal functional deterioration caused by radical nephrectomy affect comprehensive prognosis in patients 

with T1 renal cell carcinoma 

T. Sejima, H. Iwamoto, T. Masago, S. Morizane, A. Yao, T. Isoyama, A. Takenaka (Yonago, Japan) 

952 Lymphadenopathy with renal carcinoma: Pathologic or reactive? 

A. Raja, H. Stunell, T.F. Aho, S.S. Connolly (Cambridge, United Kingdom) 

953 When to perform lymph node dissection in renal cell carcinoma patients: A novel approach to 

preoperatively assess the risk of lymph node invasion at surgery and nodal progression during follow up 

U. Capitanio, F. Abdollah, R. Matloob, A. Gallina, F. Pellucchi, A. Russo, P. Capogrosso, M. Moschini, E. Di 

Trapani, C. Carenzi, M. Roscigno, P. Rigatti, R. Bertini (Milan, Bergamo, Italy) 

954 The role of cytoreductive nephrectomy in patients with metastatic renal cell carcinoma (mRCC) who are the 

candidates for targeted therapy 

A.V. Klimov, V. Matveev, M. Volkova, V.I. Shirokorad, M. Peters (Moscow, Russia) 

955 Preoperative R.E.N.A.L. nephrometry score as a predictor of pathologic stage in renal cell carcinoma 

J.Y. Chae, J.W. Kim, J.W. Kim, M.M. Oh, D.G. Moon, C.Y. Yoon (Seoul, South Korea) 

956 Benefit in regionalization of care for patients treated with nephrectomy: A nationwide inpatient sample 

A. Abdo, N. Hanna, P.I. Karakiewicz, A. Becker, F. Roghmann, M. Meskawi, Q-D. Trinh (Montreal, Canada; 


957 The impact of non-clear cell histology on outcome for patients with renal cell carcinoma and venous tumor 

thrombus 

S. Boorjian, D. Kaushik, R.H. Thompson, M.S. Eisenberg, C.M. Lohse, J. Cheville, B.C. Leibovich (Rochester, 


958 Prognostic factors and risk groups in primary extensive renal cell carcinoma 

A.V. Poluyanchik, L.V. Mirylenka, O.G. Sukonko, A.I. Rolevich, A. Minich (Minsk, Belarus) 


289 

Monday

Monday 

959 Visceral obesity is associated with better recurrence-free survival after surgeries for localized clear cell 


G. Kaneko, A. Miyajima, K. Yuge, M. Hasegawa, E. Kikuchi, K. Nakagawa, M. Oya (Tokyo, Japan) 

960 Conditional survival of patients with renal cell carcinoma treated with nephrectomy: A population based 

analysis 

M. Bianchi, H. Lavigueur-Blouin, A. Becker, Z. Tian, F. Roghmann, N. Hanna, M. Sun (Montreal, Canada; 





14.00 - 15.30 Stones: PCNL 



Chairs: V. Bucuras, Timisoara (RO) 

G. Giusti, Milan (IT) 



961 Mini-percutaneous nephrolithotomy for upper urinary tract calculi in children (report of 134 cases) 

D.Z. Long, X.F. Zou, Y.T. Wu, R.H. Xiao, Y.H. Yuan, X.N. Wang, G.X. Zhang, G.Q. Wu, J. Yang, Y.J. Xue 

(Ganzhou, China) 

962 Minimal invasive PCNL (MPCNL) – update on efficacy and safety after 745 consecutive patients 

V. Zimmermanns, I. Aydin, P. Liske, P. Ober, S. Lahme (Pforzheim, Germany) 

963 A prospective randomized study of prone versus The Barts “flank free” modified supine position for 

percutaneous nephrolithotomy (PCNL) 

C. Bach, S. Kachrilas, A. Goyal, F. Zaman, A. Bourdoumis, R. McGregor, N. Buchholz, J. Masood (London, 

United Kingdom; Montego Bay, Jamaica) 

964 Efficacy and safety in the treatment of large renal calculi with minimally invasive or conventional large 

bore PCNL: A retrospective comparison of two longitudinal databases 

M.F. Abdelhafez, G. Wendt-Nordahl, J. Bedke, B. Amend, P. Honeck, A. Stenzl, T. Knoll, D. Schilling 

(Tübingen, Boeblingen, Germany) 

965 Withdrawn 

966 Endovascular treatment of percutaneous nephrolithotomy haemorrhagic complications 

V. Jinga, S. Youssef, B. Braticevici, M. Mohanad, D. Diaconescu, D. Radavoi (Bucharest, Romania) 

967 Does body mass index impact the outcomes of tubeless percutaneous nephrolithotomy? 

N. Kuntz, A. Neisius, G. Astroza, M. Tsivian, M. Iqbal, M. Ferrandino, G. Preminger, M. Lipkin (Durham, 

United States of America; Santiago, Chile) 

968 Percutaneous renal collecting system access using a novel electromagnetic tracking: First experience in 

vivo pig model 

E.A. Rodrigues De Lima, C. Oliveira, P. Rodrigues, E. Dias, J. Correia-Pinto, J. Vilaça (Braga, Braga- 

Guimarães, Portugal) 

969 Inferior renal displacement using ureteric balloon catheter -UBC technique- in accessing supracostal 

calyces during start to finish prone PCNL 

A. Vint, K Nalagatla (Airdrie, United Kingdom) 

970 Management of caliceal diverticulum with stones - our experience 

A.K. Chawla (Manipal, India) 

971 Percutaneous nephrolithotripsy in the Galdakao-modified supine versus prone position 

K. Petkova, I. Saltirov, T. Petkov (Sofia, Bulgaria) 

972 Standard-tract combined with mini-tract in percutaneous nephrolithotomy for renal staghorn calculi 

Y.B. Wang, N. Xu, H.F. Zhang, C.X. Wang (Changchun, China) 


291 

Monday

Monday 

973 Percutaneous nephrolithotomy without hydrodistension 

M. Villalobos-Gollas, E. Cruz-Nuricumbo, L. Gómez-De-Regil (Merida, Mexico) 

974 Is standard percutaneous nephrolithotomy still standard? Comparison of surgical outcomes between 

tubeless and standard percutaneous nephrolithotomy 

J.K. Oh, C.H. Kim, S.C. Lee, K.T. Kim, T.B. Kim, K.H. Kim, S.J. Yoon, H. Jung (Incheon, South Korea) 




14.00 - 15.30 Renal tumours: Drug related basic research 



Chairs: F. Birkhäuser, Berne (CH) 

T. Klatte, Vienna (AT) 




975 Pre-clinical trial of a new dual mTOR inhibitor: INK128 for renal cell carcinoma 

A. Ingels, A. Thong, M. Saar, M.P. Valta, R. Nolley, J. Santos, H. Zhao, D. Peehl (Stanford, United States of 

America) 

976 Panobinostat and bortezomib inhibit renal cancer growth in vitro and in vivo by inducing endoplasmic 

reticulum stress and ubiquitinated protein accumulation synergistically 


977 Ritonavir, a potent inhibitor of CYP3A4, enhances the anticancer effects of panobinostat in renal cancer 

cells in vitro and in vivo 


978 A novel therapeutic approach for renal cell cancer cells using orally available phenylpiperazine derivative 

naftopidil 

Y. Iwamoto, H. Kanda, M. Kato, T. Sasaki, K. Ishii, K. Arima, T. Shiraishi, Y. Sugimura (Tsu, Japan) 

979 Zoledronic acid sensitizes renal cell carcinoma cells to radiation by downregulating STAT1 

T. Kijima, F. Koga, Y. Fujii, S. Yoshida, M. Tatokoro, K. Kihara (Tokyo, Japan) 

* 980 Optimization of Lutetium-177-G250 radioimmunotherapy in an intraperitoneal clear cell renal cell 

carcinoma xenograft model 

C.H.J. Muselaers, O.C. Boerman, D.L. Bos, W.J.G. Oyen, E. Oosterwijk, P.F.A. Mulders (Nijmegen, The 

Netherlands) 

981 Predictive value of angiogenic biomarkers in tuberous sclerosis complex (TSC) patients with renal 

angiomyolipoma (AML) 

K. Budde, J.C. Kingswood, T. Brechenmacher, K. Stein, D. Chen, J.J. Bissler (Berlin, Germany; Brighton, 

United Kingdom; Rueil-Malmaison, France; East Hanover, New Jersey, Cincinnati, Ohio, United States of 

America) 

982 Sorafenib enhances the anti-tumor effect of anti-CTLA-4 antibody to kidney cancer 

T. Motoshima, Y. Komohara, Y. Kawano, Y. Wada, M. Eto (Kumamoto, Japan) 

983 Acquired resistance to sunitinib in human renal cell carcinoma cells is mediated by constitutive activation 

of signal transduction pathways associated with tumor cell proliferation 

H. Miyake, I. Sakai, M. Fujisawa (Kobe, Japan) 

* 984 Potential predictive markers for a response to sunitinib and their association with survival of patients with 

metastatic renal cell carcinoma 

J. Dornbusch, M. Meinhardt, K. Erdmann, A. Zacharis, S. Zastrow, S. Füssel, M.P. Wirth (Dresden, Germany) 


293 

Monday

Monday 

985 Acquired resistance to temsirolimus in human renal cell carcinoma cells is mediated by constitutive 

activation of signal transduction pathways through mammalian target of rapamycin complex-2 

K. Harada (Kobe, Japan) 

986 Relationship between sunitinib effect and immature blood vessel ratio in metastatic renal cell cancer 

B.H. Kim, C.I. Kim, J.Y. Ha, C.H. Park, K.H. Kim, M.S. Choe, H.R. Jung (Daegu, Gyeongju, South Korea) 




14.00 - 15.30 How to diagnose LUTS, BPH and obstruction? 



Chairs: G. Novara, Padua (IT) 

D.S. Park, Sungnam (KR) 



987 Withdrawn 

988 Obesity associated with larger prostate volume but not with worse urinary symptoms: Analysis of a large 

cohort undergoing trans-rectal ultrasound 

B. Bhindi, G. Trottier, K. Fernandes, K.M. Hersey, A. Finelli, J. Trachtenberg, A. Toi, A. Evans, T.H. Van Der 

Kwast, N.E. Fleshner (Toronto, Canada) 

989 Body mass index predicts failure of surgical management in benign prostate hyperplasia 

J.M. Willder, V. Walker, G.L. Halbert, C.P.C. Dick, C. Orange, T. Qayyum, P.G. Horgan, M.A. Underwood, 

J. Edwards (Glasgow, United Kingdom) 

990 Prediction of bladder outlet obstruction: Development of a clinical nomogram 

C. De Nunzio, R. Autorino, A. Bachmann, A. Briganti, S. Carter, F. Chun, G. Novara, R. Sosnowski, 

N. Thiruchelvam, A. Tubaro, S. Ahyai (Rome, Naples, Milan, Padua, Italy; Basel, Switzerland; London, 

Cambridge, United Kingdom; Hamburg, Germany; Warsaw, Poland) 

991 Clinical predictors of bladder outlet obstruction in men with acute urinary retention 

M. Rom, M.J. Waldert, H-C. Klingler, T. Klatte (Vienna, Austria) 

992 Identification of prevalence and combined risk-factors for LUTS and ED in a population of 50plus: Results 

of a health-screening project with validated questionnaires 

A. Ponholzer, C. Wehrberger, S. Madersbacher (Vienna, Austria) 

* 993 Can ultrasound replace urodynamics in the study of bladder outlet obstruction? A prospective study and 

development of a clinical score 

A. Ciudin, M.G. Diaconu, L. Peri, E. Garcia-Cruz, D. Gosalbez, A. Carrion, A. Garcia-Larrosa, A. Gomez, 

A. Franco, A. Alcaraz (Barcelona, Viladecans, Spain) 

994 Reliability of estimating nocturia based on IPSS 

J.W. Kim, M.M. Oh, J.W. Kim, J.Y. Chae, C.Y. Yoon, D.G. Moon (Seoul, South Korea) 

995 Noninvasive monitoring of detrusor contractions using ultrasound 

T. Idzenga, F. Farag, J.P.F.A. Heesakkers, W.F.J. Feitz, C.L. De Korte (Nijmegen, The Netherlands) 

996 Free uroflowmetry vs do-it-yourself uroflowmetry in the assessment of patients with lower urinary tract 

symptoms 

G. Mombelli, D. Ratti, L. Carmignani (Magenta (Milan), San Donato (Milan), Italy) 

997 Usefulness of prostate volume estimation by CT using ellipsoid formula 

J.H. Jung, Y.J. Kim, S.H. Ryang, T.W. Kang, H.C. Chung, Y.Y. Park, J.M. Song (Wonju, Seoul, South Korea) 


295 

Monday

Monday 

998 The combination of values obtained by transrectal ultrasonography is useful for predicting bladder outlet 

obstruction in patients with lower urinary tract symptoms suggestive of benign prostatic hyperplasia 

T. Suzuki, A. Otsuka, Y. Kurita, H. Shinbo, R. Matsumoto, S. Takada, S. Ozono (Hamamatsu, Japan) 




14.00 - 15.30 Male incontinence: Prediction and management 



Chairs: R. Bauer, Munich (DE) 

P. Rehder, Innsbruck (AT) 




* 999 Safety, efficacy and QOL in a European multi-center prospective study of the AdVance male sling: 2-year 

results 

D. De Ridder, P. Chauveau, R.M. Bauer, H. Fassi-Fehri, O. Haillot, P. Arano, A.N. Bader, F. Haab (Leuven, 

Belgium; Nantes, Lyon, Tours, Paris, France; Munich, Germany; Barcelona, Spain; Minnetonka, United States 

of America) 

* 1000 Influence of pre- and post versus postoperative pelvic floor muscle training on urinary incontinence after 

open and robotic radical prostatectomy: A randomized controlled trial 

I. Geraerts, H. Van Poppel, N. Devoogdt, S. Joniau, B. Van Cleynenbreugel, M. Van Kampen (Leuven, 

Belgium) 

1001 Changes of pelvic floor muscles and bladder neck before and after obtaining continence after radical 

prostatectomy 

D.W. Sohn, J.S. Chung, J.Y. Joung, K.H. Lee, H.K. Seo (Seoul, Goyang, South Korea) 

1002 Treatment of stress urinary incontinence: Outcome and risk factor analysis of AMS 800©: A prospective 

analysis 

T.A. Ludwig, R. Dahlem, P. Reiss, S. Riechardt, M. Fisch, S.A. Ahyai (Hamburg, Germany) 

1003 Development and validation of nomograms to predict the recovery of urinary continence after radical 

prostatectomy: Comparisons between immediate, early, and late continence 

S.J. Jeong, H.S. Lee, K.B. Kim, J.K. Lee, B.K. Lee, J.W. Jeong, W.H. Cha, S.C. Lee, C.W. Jeong, S.K. Hong, 

S-S. Byun, S.E. Lee (Seongnam, Gyeonggi, South Korea) 

1004 Primary artificial urinary sphincter implantation for male non-neurogenic stress urinary incontinence: 

Early and midterm results of a multicenter contemporary series 

J-N.L. Cornu, M.J. Drake, F. Haab, E. Haab, S.A. Ahyai, L. Kluth, R.K. Lee, B. Chughtai, A. Bachmann, 

N. Thiruchelvam, J.I. Martínez-Salamanca, S. Larré, T. Pichon, C. De Nunzio, M. Favro, R.M. Bauer, F. Van 

Der Aa (Paris, Reims, Angers, France; Bristol, Cambridge, United Kingdom; Hamburg, Munich, Germany; 

New York, United States of America; Basel, Switzerland; Madrid, Spain; Rome, Novara, Italy; Leuven, 

Belgium) 

1005 Anticholinergics improved voiding symptom after radical prostatectomy in patients with prostate cancer 

J. Kim, S. Pak, M. Shim, J. Park, S.M. Lee, K.O. Huh, C. Song, M-S. Choo, H. Ahn (Seoul, Daejeon, South 

Korea) 

1006 The impact of 3 week clinical rehabilitation program after radical prostatectomy on early continence status 

M. Adam, E. Eichelberg, L. Budäus, G. Salomon, H. Isbarn, T. Steuber, T. Schlomm, U. Michl, H. Heinzer 

(Hamburg, Germany) 


297 

Monday

Monday 

1007 Intensive preoperatory Pelvic Floor Muscle Training reduce duration and severity of stress urinary 

incontinence after radical prostatectomy: A randomized controlled trial 

A. Collado Serra, M. Pellicer Cabo, M. Ramirez Backhaus, J. Dominguez-Escrig, J. Rubio-Briones, A. Gomez- 

Ferrer, I. Iborra Juan, J. Casanova Ramón-Borja, J.V. Ricos Torrent, J.L. Monros Lliso, R. Dumont Martinez, 

E. Solsona Narbón (Valencia, Spain) 

1008 Anatomic evaluation with 3T magnetic resonance imaging of continent and incontinent patients treated 

with advance male sling 

D. Pistolesi, V. Zampa, C. Gozzi, M. Santarsieri, I. Bardelli, C. Mariani, L. Faggioni, C. Bartolozzi, C. Selli 

(Pisa, Bressanone, Italy) 

1009 More than 3 years of clinical experience with an adjustable transobturator male system (ATOMS) for 

treatment of stress urinary incontinence after radical prostatectomy: Results of a multicenter prospective 

observational study 

R. Hoda, G. Primus, C. Brössner, W. Bauer (Kleinmachnow, Germany; Graz, Vienna, Austria) 

1010 Preoperative sphincter function and morphology of prostate apex influence recovery of urinary continence 

after radical prostatectomy 

J. Kim, S. Pak, M. Shim, J. Park, C. Song, H. Ahn (Seoul, Daejeon, South Korea) 




14.00 - 17.00 European Urological Scholarship Programme (EUSP) Session 


Chairs: L. Martínez Piñeiro, Madrid (ES) 




14.10 - 16.00 Presentations of sections - Centres of excellence - New directions and opportunities 

14.10 - 14.20 ESAU Andrological Urology 


14.20 - 14.30 ESFFU Female and Functional Urology 


14.30 - 14.40 ESTU Transplantation Urology 


14.40 - 14.50 ESUR Urological Research 


14.50 - 15.00 ESGURS Reconstructive Urology Surgeons 

S. Deger, Ostfildern (DE) 

15.00 - 15.10 ERUS Robotic Urology 


15.10 - 15.20 ESOU Oncological Urology 


15.20 - 15.30 ESUI Urological Imaging 


15.30 - 15.40 EULIS Urolithiasis 


15.40 - 15.50 ESIU Infections in Urology 


15.50 - 16.00 ESUT Uro-Technology 


16.00 - 16.05 Award presentation: Best scholar 


16.05 - 17.00 Poster viewing and EUSP get together 


299 

Monday

Monday 




15.45 - 17.15 Highlights & awards 



Chairs: A. Messas, Nanterre (FR) 



V73 Laparoscopic construction of continent Mitrofanoff appendicovesicostomy: Saint Augustin technique 

D. Rey, M. Oderda, E. Helou, L. Lopez, P-T. Piechaud (Bordeaux, France) 

V74 Single incision pyeloplasty – results of the initial 22 cases 

F. Imkamp, M.A. Kuczyk, U. Nagele, T.R.W. Herrmann (Hanover, Germany; Hall in Tirol, Austria) 

V75 Deep bladder endometriosis: Laparoscopic partial cystectomy with endoscopic delimitation 

R. Cabello, C. Quicios, C. Simón, P. Charry, M. Rodríguez, C. González (Madrid, Spain) 

V76 Robotic assisted lego® construction for microsurgical skills training 

A. Gudeloglu, J. Brahmbhatt, K. Priola, S. Parekattil (Winter Haven, United States of America) 

Prize winning videos 

V77 Third Video Prize 

Alternative solution to current MIS robotic system 

S. Crouzet (Lyon, France) 

V78 Second Video Prize 

Sequential occlusion angiography using contrast enhanced ultrasound scan (CEUS) demonstrating the 

avascular plane of Brodel: An adjunct to a novel technique of zero-ischaemia robot-assisted partial 

nephrectomy 

A.R. Rao, R. Gray, H. Motiwala, M. Laniado, O. Karim (Wexham, United Kingdom) 

V79 First Video Prize 

Novel surgical tile-pro navigation with 3D prostate cancer model during robot-assisted radical 

prostatectomy 

O. Ukimura, A.L. De Castro Abreu, M. Nakamoto, S. Shoji, S. Leslie, A. Berger, A. Goh, M. Desai, M. Aron, 

I. Gill (Los Angeles, United States of America)



15.45 - 17.15 Prostate cancer treatment: Comorbidities and complications 



Chairs: M. Graefen, Hamburg (DE) 




1011 Health-related quality of life after radical prostatectomy is independent of patient’s age and comorbidities 

K. Herkommer, H. Schulwitz, T. Klorek, S. Schmid, C. Hofer, J.E. Gschwend, M. Kron (Munich, Ulm, Germany) 

1012 Analysis on overall, cancer-specific and non-cancer-specific survivals according to Charlson comorbidity 

index in prostate cancer patients who underwent radical prostatectomy 

J.Y. Lee, K.H. Kim, J.W. Park, R.R. Diaz, K.H. Kim, H.Y. Lee, W.S. Ham, N.H. Cho, Y.D. Choi, K.S. Cho (Seoul, 

South Korea) 

1013 Perioperative and early oncological outcomes after robotic assisted radical prostatectomy in morbidly 

obese patients: A propensity matched study 

H. Abdul-Muhsin, C. Giedelman, S. Samavedi, O. Schatloff, S. Chauhan, A. Sivaraman, R. Coelho, K. Palmer, 

G. Ebra, V. Patel (Celebration, United States of America) 

1014 The impact of abdominal obesity on surgical complications and functional outcomes in men treated with 

radical prostatectomy for prostate cancer: Results of an Italian multicentre survey (M.I.R.R.O.R.) 

M. Gacci, A. Sebastianelli, M. Salvi, C. De Nunzio, R. Schiavina, A. Simonato, A. Tubaro, V. Mirone, M. Carini, 

G. Carmignani (Florence, Rome, Bologna, Genova, Naples, Italy) 

1015 Cardiovascular disease and prostate cancer: A competing-risks analysis 

J. Hansen, F.K. Chun, M. Rink, S.F. Shariat, M. Graefen, M. Sun (Hamburg, Germany; New York City, United 

States of America; Montreal, Canada) 

1016 Is extended venous thrombo-embolism pharmacological prophylaxis required following laparoscopic 

radical prostatectomy? 

B. Horsburgh, V. Srinivasan (Denbighshire, United Kingdom) 

1017 Prospective randomized study comparing transperitoneal and extraperitoneal approach during robotic 

prostatectomy: Anesthesiologic effects 

F. Dal Moro, C. Valotto, A. Mangano, R. Soncin, A. Crestani, A. Guttilla, G.M. Pittoni, F. Zattoni (Padua, Italy) 

1018 Difficult radical prostatectomy did not cause inferior functional outcome 

U.H.G. Michl, M. Graefen, A. Haese, G. Salomon, H. Heinzer, T. Schlomm, T. Steuber, H. Huland (Hamburg, 

Germany) 

1019 Invasiveness and post aggression metabolism in DaVinci prostatectomies - the iPOD study 

A. Martinschek, L. Stumm, M. Ritter, E. Heinrich, L. Trojan (Ulm, Mannheim, Göttingen, Germany) 

1020 Characterization, incidence and severity of surgical complications using Clavien system in patients treated 

with minimally invasive radical prostatectomy 

A.M. Autran, R.E. Sanchez Salas, E. Barret, F. Rozet, D. Prapotnich, M. Galiano, N. Cathala, A. Mombet, 

F. Secin, X. Cathelineau (Paris, France; Buenos Aires, Argentina) 


301 

Monday

Monday 

1021 The Clavien-Dindo classification of complications used for a comparison between retropubic, endoscopic 

and robot-assisted radical prostatectomy on the basis of a matched-pair analysis 

M. Hiess, C. Seitz, A. Ponholzer, M. Lamche, P. Schramek (Vienna, Austria) 

1022 Bilateral peritoneal incision in open retropubic prostatectomy does not seem to lower rates of symptomatic 

lymphoceles 

J. Mundhenk, F. Miller, J. Hennenlotter, L.F. Arenas Da Silva, T. Todenhoefer, G. Gakis, C. Schwentner, 

A. Stenzl, D. Schilling (Tübingen, Germany) 

1023 Impact of a polysaccharide hemostat on bleeding complications and pelvic lymphocele rates after radical 

prostatectomy: Initial results of a prospective randomized trial 

B. Beyer, S-R. Leyh-Bannurah, H. Isbarn, P. Tennstedt, G. Salomon, U. Michl, H. Heinzer, H. Huland, 

M. Graefen, L. Budäus (Hamburg, Germany) 

1024 Re-assessment of 30-, 60- and 90-day mortality rates in non-metastatic prostate cancer patients treated 

either with radical prostatectomy or radiation therapy 

M. Meskawi, A. Abdo, H. Lavigueur-Blouin, Z. Tian, F. Roghmann, P.I. Karakiewicz (Montreal, Canada; 





15.45 - 17.15 Radical surgery for bladder cancer: Technical aspects 



Chairs: H. Abol-Enein, Mansoura (EG) 




1025 Promising approach in the treatment of bladder cancer: Radical cystectomy and urinary diversion in 

regional anesthesia 

M. Friedrich-Freksa, E. Schulz, T. Nitzke, O. Wenzel, G. Popken (Berlin, Germany) 

1026 A restrictive fluid regimen combined with norepinephrine during open radical cystectomy decreases the 

postoperative complication rate and accelerates recovery 

F.C. Burkhard, U.E. Studer, G.N. Thalmann, P.Y. Wüthrich (Berne, Switzerland) 

1027 Withdrawn 

1028 Factors predicting acute kidney injury and wound complications after open radical cystectomy: Analysis of 

1000 patients 

Y.M. Osman, A.M. Harraz, S. El-Halwagy, M. Laymon, T. Samir, A. Mosbah, A. Shaaban (Mansoura, Egypt) 

1029 Transurethral resection of bladder tumour (TURBT) causes seeding of cancer cells into patient blood 

stream 

H. Engilbertsson, O. Patschan, S. Björnsson, T. Kristmundsson, L. Rydén, K. Aaltonen, S. Gudjónsson 

(Malmö, Lund, Sweden) 

1030 Pilot feasibility study of umbilical laparoendoscopic single-site radical cystectomy for muscle-invasive 

bladder cancer with additional 10 mm trocar and extracorporeal urinary diversion 

J.C. Angulo, P. Cabrera, E. Mateo, G. Andres, A. Garcia-Tello, F. Ramon De Fata (Madrid, Spain) 

1031 Intra-corporeal versus extra-corporeal urinary diversion after robot-assisted radical cystectomy: Results 

from the International Robotic Cystectomy Consortium 

K. Ahmed, S.A. Khan, M.H. Hayn, A.P. Stegemann, P.K. Agarwal, K.K. Badani, M.D. Balbay, E.P. Castle, 

P. Dasgupta, R. Ghavamian, K. Guru, A.K. Hemal, B.K. Hollenbeck, D. Josephson, A.K. Kader, A.S. Kibel, 

M. Menon, A. Mottrie, K. Nepple, J.G. Pattaras, J.O. Peabody, V. Poulakis, R.S. Pruthi, J. Palou Redorta, 

K.H. Rha, L. Richstone, M. Saar, D.S. Scherr, S. Siemer, M. Stöckle, A.Z. Weizer, P. Wiklund, T. Wilson, 

M. Woods, M.S. Khan (London, United Kingdom; Portland, Buffalo, Bethesda, New York, Scottsdale, Bronx, 

Winston-Salem, Ann Arbor, Duarte, San Diego, St. Louis, Detroit, Atlanta, Chapel Hill, Newark, Maywood, 

United States of America; Istanbul, Turkey; Aalst, Belgium; Athens, Greece; Barcelona, Spain; Seoul, South 

Korea; Homburg, Germany; Stockholm, Sweden) 

1032 Influence of institution volume on outcomes after robot-assisted radical cystectomy: An analysis of 1118 

patients from the International Robotic Cystectomy Consortium 

S.A.A. Khan, K. Ahmed, S. Shariat, P.K. Agarwal, K.K. Badani, D. Balbay, E.P. Castle, P. Dasgupta, K.A. Guru, 

M.H. Hayn, A.K. Hemal, D. Josephson, A.K. Kader, A.S. Kibel, A. Mottrie, K.G. Nepple, J.G. Pattaras, 

J.O. Peabody, V. Poulakis, R.S. Pruthi, J. Palou, K-H. Rha, L. Richstone, M. Saar, A.P. Stegemann, M. Stoeckle, 

E.M. Wallen, P. Wiklund, T. Wilson, M. Woods, B. Yuh, D.S. Scherr (London, United Kingdom; New York, 

Detroit, Scottsdale, Buffalo, Winston-Salem, Duarte, St. Louis, Saint Louis, Atlanta, Detroit, Chapel Hill, 

New Hyde Park, Buffalo, Duarte, Maywood, United States of America; Ankara, Turkey; Aalst, Belgium; 

Athens, Greece; Redorta, Barcelona, Spain; Seoul, South Korea; Homburg, Germany; Stockholm, Sweden) 


303 

Monday

Monday 

1033 A pilot prospective single-centre 3-arm randomised controlled trial of open, robotic and laparoscopic 

(CORAL) radical cystectomy for bladder cancer 

C. Gan, F. Ismail, G. Cheung, A. Patel, P. Dasgupta, P. Rimington, J. Watkins, T. O’Brien, P. Hegarty, M.S. Khan 

(London, Eastbourne, United Kingdom) 

1034 Comparative study between laparoscopic and open radical cystectomy with orthotopic ileal reservoir 

E. Mateo, A. Garcia-Tello, F. Caceres, I. Romero, M. Sanchez Chapado, J.C. Angulo (Madrid, Spain) 

1035 The Karolinska experience in 67 robot-assisted radical cystectomies with totally intracorporeal formation 

of an ileal neobladder. Oncological and complication outcomes 

S. Tyritzis, J. Collins, D. Khazaeli, M. Jonsson, C. Adding, A. Hosseini-Aliabad, N.P. Wiklund (Stockholm, 

Sweden) 

1036 Laparoscopic radical cystectomy with prostate capsule sparing. Oncologic and functional results: Our 

experience 

J. Gómez Rivas, S. Alonso Y Gregorio, D. López Sánchez, A. Tabernero Gómez, J. Cisneros Ledo, J.J. De La 

Peña Barthel (Madrid, Spain) 

1037 Oncological outcomes with a median follow-up of 32 months after laparoscopic radical cystectomy for 


T.J.N. Hermans, S. Van Aarle, L.M.C.L. Fossion (Veldhoven, The Netherlands) 

1038 Extended versus super-extended PLND during radical cystectomy: Comparison of two prospective series 

G. Simone, H. Abol Enein, M. Ferriero, R. Papalia, S. Guaglianone, A. Mosbah, M. Abdel-Latif, 

M. Abdelrahim, M. Ghoneim, M. Gallucci (Rome, Italy; Mansoura, Egypt) 

. 




15.45 - 17.15 Prostate cancer biomarkers and outcome prediction 



Chairs: B. Djavan, Vienna (AT) 





* 1039 Genetic testing in identification of BPH patients developing later prostate cancer 

L. Saaristo, T. Wahlfors, J. Schleutker, H. Lilja, T. Tammela, M. Matikainen (Tampere, Turku, Helsinki, 

Finland) 

1040 Expression of candidate susceptibility genes in the development and progression of prostate cancer 

C. Debiais-Delpech, J. Godet, N. Pedretti, J. Irani, X. Cathelineau, G. Fromont (Poitiers, Gençay, Paris, France) 

1041 Neurofuzzy system for prostate cancer risk evaluation 

L. Benecchi, F. Bocchi, M. Potenzoni, F. Russo, L. Perucchini, M. Quarta, M. Tonghini, P. Bocchi, C. Del Boca 

(Cremona, Parma, Italy) 

1042 Detection of prostate cancer associated α2,3 sialyated free PSA in serum is more higher specificity than 

conventional PSA test 

T. Yoneyama, Y. Tobisawa, K. Mori, S. Hatakeyama, H. Yamamoto, T. Okamoto, A. Okamoto, F. Ishimura, 

T. Yoneyama, T. Koie, N. Kamimura, C. Ohyama (Hirosaki, Japan) 

1043 Association of blood level omega-3 fatty acids with risk of prostate cancer: A meta-analysis 

M. Chua, M.C. Sio, M. Sorongon, M.J. Morales (Quezon City, Philippines) 

1044 Frequency and prognostic significance of TMPRSS2-ERG gene fusion in prostate cancers with positive 

lymph nodes 

A. Fleischmann, I. Zlobec, T. Visakorpi, G.N. Thalmann (Berne, Switzerland; Tampere, Finland) 

* 1045 Urinary PCA3 and TMPRSS2:ERG help predict biopsy outcome prior to initial prostate biopsy using a risk 

group analysis 

J.R. Day, L.A. Jones, S.E. Meyer, P.N. Hodge, J. Aussie, D.R. Saltzstein, J.C. Groskopf (San Diego, San Antonio, 


1046 A new medical device for in vivo isolation of circulating tumor cells in prostate cancer patients 

G. Theil, M.R. Hoda, K. Fischer, K. Haubold, T. Krahn, N.G. Morgenthaler, K. Lücke, P. Fornara (Halle/Saale, 

Potsdam, Berlin, Germany) 

1047 Expression of epithelial-mesenchymal transition markers in localized prostate cancer: Impact on 

clinicopathological outcomes in patients undergoing radical prostatectomy 

H. Miyake, H. Behnsawy, M. Fujisawa (Kobe, Japan) 

1048 CSAG4 and NOL4 are novel biomarkers to indicate aggressiveness of prostate cancer 

S. Takahashi, T. Shiraishi, B.J. Trock, P. Kulkarni, R. Getzenberg, T. Tominaga, Y. Homma (Tokyo, Japan; 

Maryland, United States of America) 


305 

Monday

Monday 

1049 RANKL pathway proteins as risk parameters for biochemical recurrence in patients undergoing radical 

prostatectomy 

T. Todenhöfer, J. Hennenlotter, A. Wald, P. Leidenberger, G. Blumenstock, S. Aufderklamm, J. Mundhenk, 

G. Gakis, U. Kühs, A. Hohneder, A. Stenzl, C. Schwentner (Tübingen, Germany) 

1050 Prostate cancer microparticles: A novel blood based prognosticator of metastasis 

A. Al-Zahrani, H.S. Leong, V. Yutkin, N. Power, J. Izawa, J. Lewis, J. Chin (Dammam, Saudi Arabia; London, 

Edmonton, Canada) 



There is an increasing number of potential biomarkers in prostate cancer. Most contributions in this session 

focus on combining information obtained by analysis of several markers in order to identify a more aggressive 

disease and assess the risk.



15.45 - 17.15 Evolving concepts in testicular cancer 



Chairs: N. Nicolai, Milan (IT) 

A.R. Zlotta, Toronto (CA) 




1051 Multi-focality of testicular germ cell tumours – the findings of the last 100 cases at a tertiary referral 

centre 

J.W.R. Douglas, S. Dockree, M. Hayes, J. Theaker (Southampton, United Kingdom) 

* 1052 Differentiation of microvessels and lymphatic vessels in non seminomatous testicular germ cell tumors 

using lymph specific markers: Morphologic characteristics and clinical implications 

J. Heinzelbecker, M. Gross-Weege, C. Weiss, M. Liebhardt, M. Trunk, A. Haecker, C. Bolenz (Mannheim, 

Germany) 

* 1053 External validation of the Heidenreich criteria for the selection of patients for unilateral or bilateral post 

chemotherapy retroperitoneal lymph node dissection for residual masses of testicular cancer 

C. Vallier, P-H. Savoie, J.R. Delpero, F. Bladou, G. Gravis, N. Salem, J. Walz (Marseille, Toulon, France; 

Montreal, Canada) 

1054 Bilateral laparoscopic post-chemotherapy retroperitoneal lymph-node dissection in non-seminomatous 

germ cell tumors – a comparison to template dissection 

S. Aufderklamm, T. Todenhöfer, J Hennenlotter, J. Mischinger, G. Gakis, J. Mundhenk, J. Bedke, A. Stenzl, 


1055 Modified cisplatin, etoposide and ifosfamide (PEI) salvage therapy for male germ-cell tumors (GCT). Longterm 

efficacy and safety outcomes 

A. Necchi, L. Mariani, N. Nicolai, D. Raggi, E. Farè, P. Giannatempo, L. Piva, D. Biasoni, M. Catanzaro, 

T. Torelli, S. Stagni, G. Pizzocaro, A. Gianni, R. Salvioni (Milan, Italy) 

1056 Sequential chemotherapy for advanced testicular cancer, Japanese high volume center experience 

T. Nakamura, Y. Kimura, T. Ueda, Y. Naya, F. Hongo, T. Miki (Kyoto, Japan) 

1057 Persistence of CD30 expression by embryonal carcinoma (EC) in the treatment time course. A retrospective 

series of multi-relapsing germ-cell tumors (GCT) 

P. Giannatempo, M. Colecchia, B. Paolini, N. Nicolai, D. Raggi, E. Farè, M. Catanzaro, D. Biasoni, T. Torelli, 

S. Stagni, L. Piva, R. Salvioni, A. Gianni, A. Necchi (Milan, Italy) 

1058 Favorable long-term outcome in 21 patients with inguinoscrotal sarcomas 

M. Fröhner, R.R. Schober, A. Lossnitzer, M.P. Wirth (Dresden, Germany) 

1059 Elastography shows promise in cancer testicular detection 

A. Marsaud, C. Raffaelli, X. Carpentier, N. Mentine, M. Durand, E. Fontas, J.F. Michiels, J. Amiel, 

D. Chevallier (Nice, France) 


307 

Monday

Monday 

1060 Thoracic metastectomy for nonseminomatous testicular tumors (NSTT): Long term survival and prognostic 

factors 

D. Argirovic, A. Argirovic, V. Stanic (Belgrade, Serbia) 


Summary 

N. Nicolai, Milan (IT)



15.45 - 17.15 Stones: URS and stents 



Chairs: B. Dore, Poitiers (FR) 

A. Tasca, Vicenza (IT) 




* 1061 Flexible ureteroscopy for upper urinary tract calculi in children 

Y. Wu, X. Zou, R. Xiao, Y. Yuan, X. Wang, G. Zhang, G. Wu, D. Long, J. Yang, Y. Xue (Ganzhou, China) 

1062 Nanotechnology: 1.2F baskets further enhance irrigation flow in flexible ureterorenoscopy 

J. Bedke, U. Leichtle, A. Lorenz, U. Nagele, A. Stenzl, S. Kruck (Tübingen, Germany; Hall in Tirol, Austria) 

1063 Laser lithotripsy retropulsion varies with stone mass 

M. Robinson, J.M.H. Teichman (Vancouver, Canada) 

1064 Is prophylactic antibiotics necessary in patients with pre-operative sterile urine undergoing ureteroscopic 

procedures for ureteral stones ? 

C.D. Lin, S-J.C. Chang, S.S-D. Yang, C-H. Hsieh (Taipei, Taiwan) 

1065 Withdrawn 

1066 Is endoscopic evaluation at the end of retrograde intrarenal surgery (RIRS) a valid predictor of stone 

treatment outcome? 

A. Bosio, P. Destefanis, E. Alessandria, A. Buffardi, E. Dalmasso, M. Carchedi, S. Santià, A. Bisconti, F. Fop, 


1067 Post-ureteroscopic lesion scale: Multicentre video-based evaluation of inter-rater reliability 

M. Schoenthaler, N. Buchholz, E. Farin, H. Ather, C. Bach, T. Bach, J.D. Denstedt, H.-M. Fritsche, M. Grasso, 

O. Hakenberg, R. Herwig, T. Knoll, F.E. Kuehhas, E. Liatsikos, P. Liske, P.J.S. Osther, J.M. Reis-Santos, 

K. Sarica, C. Seitz, M. Straub, O. Traxer, A. Trinchieri, B. Turney, A. Miernik (Freiburg, Hamburg, Regensburg, 

Rostock, Sindelfingen, Pforzheim, Munich, Germany; London, Oxford, United Kingdom; Karachi, Pakistan; 

London, Canada; New York, United States of America; Vienna, Austria; Patras, Greece; Fredericia, Denmark; 

Lisbon, Portugal; Istanbul, Turkey; Paris, France; Lecco, Italy) 

1068 Analysis for predictive factors for the success of ureteroscopy as day-case surgical procedure for the 

treatment of ureteral calculi 

R. Molina, N. Gonzalez, M. Alvarez, L. Crespo, R. Alarcon, M. Dorado, A. Paez (Madrid, Spain) 

* 1069 Does indwelling ureteral stent preserve renal function after relief of obstructive uropathy? 

A.R. Elnahas, A.M. Harraz, M.H. Zahran, H. Abol-Enein (Mansoura, Egypt) 

1070 Trends in utilization and comparative outcomes for infected upper urinary tract stones in the United States: 

PCN vs stent 


America) 


309 

Monday

Monday 

1071 Prospective evaluation of stent symptoms after uncomplicated ureteroscopy using a validated 

questionnaire 

A. Bosio, P. Destefanis, E. Alessandria, E. Dalmasso, A. Bisconti, M. Carchedi, A. Buffardi, S. Santià, 


1072 Easy ureteral stent removal without cystoscopy after ureteroscopic stone removal (URS) 

J.H. Son, G.S. Lim, S.H. Jang, J.W. Lee, D.S. Cho (Seong Nam, South Korea) 




15.45 - 17.15 History of urology 2 



Chairs: A.J. Figueiredo, Coimbra (PT) 




1073 Review of the urological aspects in the work of Giovanni Da Vigo 

J. Medina-Polo, I. Otero Tejero, E. Jiménez Alcaíde, R. Díaz González (Madrid, Guadalajara, Spain) 

1074 The history, evolution and development of male urinary incontinence management 

R.C. Nayar, A. Deshpande, I.P. Wharton (Birmingham, United Kingdom) 

1075 Albucasis: The revelation of urological surgical instruments in the 10th century Islamic world 

F. Khan, W.Mahmalji, S. Madaan, I.K. Dickinson, S. Sriprasad (Kent, United Kingdom) 

1076 From Lister to laparoscopy: 100 years of urology at King’s College Hospital 

J.K. Makanjuola, I.K. Dickinson, A.J. Yates-Bell, J. Philpott-Howard, P.M. Thompson (London, Kent, United 

Kingdom) 

1077 Glove at first sight – history of the first surgical rubber glove 

J.R. Bhatt, I.R.G. Wood, C.P. Hobbs, S. Brewster (Oxford, United Kingdom) 

1078 “Peyronies’ disease”, “hottentot apron” and “kidney stones” in the Italian “urologists” of the middle ages 

S. Musitelli, I. Bossi (Zibido San Giocomo, Italy) 

1079 Reynaldo dos Santos: From aortography to modern urology 

L. Marconi, A. Figueiredo, F. Furriel, P. Dinis, A. Mota (Coimbra, Portugal) 

1080 Sir Denis Browne: A titan of paediatric urology 

H.L. Ratan (Derby, United Kingdom) 

1081 A tribute to the life and accomplishments of Mathieu Jaboulay 

F. Khan, W. Mahmalji, S. Sriprasad, I.K. Dickinson (Kent, United Kingdom) 

1082 The history of the adrenal glands – from The Bible to Jerome Conn 

F. Furriel, A.J.C. Figueiredo, L.S.O. Marconi, D.J.S. Castelo, G.H.A. Gomes, V.M.N. Dias (Coimbra, Portugal) 

1083 The last EAU Congress in Central Europe, Budapest 1986 

I. Romics, M. Romics (Budapest, Hungary) 

1084 Urological papers and issues arising from the early years of the Chinese medical journal 

K.A. Wong, J. Chatterton, M.F. Bultitude (London, United Kingdom) 


311 

Monday

Monday 




15.45 - 17.15 Pharmacotherapy of male LUTS 



Chairs: C.G. Roehrborn, Dallas (US) 





* 1085 Adverse event profiles of alpha-1 blocker agents for male patients: Data mining of the public version of the 

FDA adverse event reporting system 

K. Yoshimura, K. Kadoyama, T. Sakaeda, Y. Sugino, O. Ogawa, Y. Okuno (Kyoto, Japan) 

1086 Acute urinary retention risk in BPH patients treated with tamsulosin vs watchful waiting: A 5 year 

prospective community based study 

K. Lokshin, M. Davidov, I. Gorbunova (Moscow, Perm, Russia) 

1087 The Silodosin in Real-life Evaluation (SiRE) study: Baseline characteristics of the patients enrolled in a 

European phase IV clinical study with silodosin in the treatment of LUTS/BPH 

C.R. Chapple (Sheffield, United Kingdom) 

1088 Urinary retention following anticholinergics in patients with BPH in real life practice - a nationwide 

population-based study 

E.Y-H. Huang, C-C. Lin, H.-. Chung, J-P. Lin, A.T. Lin, K-K. Chen (Taipei, Taiwan) 

* 1089 Quality of life analyses from NEPTUNE, a phase 3 trial of combination therapy with tamsulosin OCAS and 

solifenacin in men with lower urinary tract symptoms 

M.J. Drake, R. Sokol, M. Klaver, T. Drogendijk, Z. Hakimi, I. Odeyemi, P.E.V. Van Kerrebroeck (Bristol, 

Chertsey, United Kingdom; Trencin, Slovakia; Leiderdorp, Maastricht, The Netherlands) 

1090 Predictors of successful first-line antimuscarinics monotherapy in men with enlarged prostate and 

predominant storage symptoms 

C.H. Liao, H.C. Kuo (New Taipei City, Hualien, Taiwan) 

1091 Effects of add-on mirabegron on storage symptoms in men with lower urinary tract symptoms receiving 

alpha-1 blocker therapy 

K. Ogura, A. Sengiku, Y. Miyazaki, H. Sawazaki, T. Takahashi (Otsu, Japan) 

1092 Combination therapy with dutasteride and tadalafil in men with moderate-to-severe benign prostatic 

hyperplasia 

H.J. Park, N.C. Park (Busan, South Korea) 

1093 Clinical effects of dutasteride and finasteride: Are they different or equivalent? Results from record-linkage 

and match-paired analyses 

L. Cindolo, C. Fanizza, M. Romero, L. Pirozzi, R. Autorino, F. Berardinelli, L. Schips (Vasto-Chieti, Santa 

Maria Imbaro-Chieti, Naples, Italy) 

1094 Clinical outcomes after combined therapy with 5alpha-reductase inhibitors and alpha-blockers or either 

monotherapy in men with benign prostatic hyperplasia: 4-year results from a record-linkage analysis 

L. Cindolo, C. Fanizza, M. Romero, L. Pirozzi, R. Autorino, F. Berardinelli, C. De Nunzio, L. Schips (Vasto- 

Chieti, Santa Maria Imbaro-Chieti, Naples, Rome, Italy)

1095 Nocturia improvement in the Combination of Avodart® and Tamsulosin (CombAT) study 

M. Oelke, C. Roehrborn, T.H. Wilson, J-M. Palacios, R. Castro (Hanover, Germany; Dallas, North Carolina, 

Pennsylvania, United States of America; Madrid, Spain) 

1096 Combination therapy with finasteride and tadalafil once daily for 6 months: A randomized, placebocontrolled 

study in men with lower urinary tract symptoms secondary to benign prostatic hyperplasia 

A.R. Casabe, C. Roehrborn, L.F. Da Pozza, S. Zepeda, R. Henderson, S. Sorsaburu, C. Henneges, D. Wong, 

L. Viktrup (Buenos Aires, Argentina; Dallas, Shreveport, Indianapolis, United States of America; Bergamo, 

Italy; Saltillo, Mexico; Bad Homburg, Germany) 


313 

Monday

Monday 




15.45 - 17.15 Medical treatment of RCC 



Chairs: G. Kramer, Vienna (AT) 

H. Uemura, Osaka (JP) 




1097 Prognostic factors for patients with metastatic renal cell carcinoma in the era of targeted therapy 

D. You, I.G. Jeong, S. Park, J.Y. Joung, J.H. Hong, H. Ahn, C-S. Kim (Seoul, Ulsan, South Korea; New 

Brunswick, United States of America) 

1098 Tumor growth rate should be applied in the definition of progression disease during molecular targeted 

therapy in patients with metastatic renal cell carcinoma 

H.L. Zhang, D.W. Ye, G.H. Shi (Shanghai, China) 

1099 Individualization of medical treatment in metastasized renal cell carcinoma by measuring the plasma levels 

of sunitinib, sorafenib and pazopanib – first clinical experiences 

C. Keil, A. Nockher, L. Götze, P. Olbert, R. Hofmann, A. Hegele (Marburg, Germany) 

1100 Association of pharmacokinetics of sunitinib with treatment outcome and adverse events in advanced 

renal cell carcinoma patients 

N. Tsuchiya, N. Fujiyama, S. Narita, T. Inoue, K. Numakura, S. Akihama, M. Saito, S. Satoh, M. Miura, 

T. Habuchi (Akita, Japan) 

1101 Identification of a potential molecular marker of response to high-dose interleukin-2 in metastatic renal 

cell carcinoma patients 

C.D. Jacobs, G. Lipowska-Bhalla, N. Dalal, F. Thistlethwaite, R.E. Hawkins, D.G. Rothwell (Manchester, 


1102 Body-mass-index and survival of patients with metastastic renal cell carcinoma: Data from the German 

prospective RCC Registry 

P.J. Goebell, L. Müller, U. Von Verschuer, H.J. Hurtz, M. Franzem, M. Vogt, N. Marschner (Erlangen, Leer, 

Essen, Halle (Saale), Freiburg, Germany) 

1103 FDG PET/CT as imaging biomarker for advanced renal cell carcinoma 

N. Nakaigawa, M. Yao, N. Hayashi, U. Tateishi, T. Inoue, Y. Kubota (Yokohama, Japan) 

1104 Frequency and risk factors of sorafenib-induced high-grade skin rash in Japanese patients with advanced 


N. Tsuchiya, S. Narita, T. Inoue, N. Hasunuma, K. Numakura, M. Saito, S. Satoh, T. Notoya, N. Fujishima, 

S. Hatakeyama, C. Ohyama, T. Habuchi (Akita, Japan) 

1105 Neoadjuvant targeted molecular therapies in patients undergoing nephrectomy and inferior vena cava 

thrombectomy. A French retrospective study of 13 cases 

P. Bigot, J.C. Bernhard, E. Xylinas, T. Fardoun, J. Berger, M. Rouprêt, S. Lagabrielle, S. Lebdai, M. Ammi, 

H. Baumert, K. Bensalah, B. Escudier, N. Grenier, J.F. Hetet, J.A. Long, P. Paparel, N. Rioux-Leclercq, 

A-R. Azzouzi, M. Soulié, J-J. Patard (Angers, Bordeaux, Paris, Rennes, Limoges, Villejuif, Nantes, Grenoble, 

Lyon, Toulouse, Le Kremlin-Bicêtre, France)

1106 The German mRCC registry – aims and results after the first 1000 patients 

P.J. Goebell, L. Müller, K. Blumenstengel, A. Hübner, A. Lück, M. Vogt, N. Marschner (Erlangen, Leer, 

Eisenach, Rostock, Freiburg, Germany) 

* 1107 Outcomes of patients with non clear cell renal cell carcinoma treated with targeted therapy and 

prognostication using the International mRCC Database Consortium Criteria 

N. Kroeger, W. Xie, J-L. Lee, G.A. Bjarnason, J.J. Knox, M.J. Mackenzie, L. Wood, S. Srinivas, 

U.N. Vaishamayan, S.Y. Rha, S.K. Pal, T. Yuasa, F. Donskov, N. Agarwal, C.K. Kollmannsberger, M.H. Tan, 

S.A. North, B.I. Rini, T.K. Choueiri, D.Y.C. Heng (Calgary, Toronto, Halifax, Vancouver, Edmonton, Canada; 

Boston, Stanford, Detroit, Utah, Cleveland, United States of America; Asan, Seoul, Duarte, South Korea; 

London, United Kingdom; Ariake, Tokyo, Japan; Århus, Denmark; Singapore, Singapore) 

* 1108 Clinical role of MHC-class I peptide vaccines for metastatic renal cell carcinoma 

T. Minami, T. Minami, N. Shimizu, Y. Yamamoto, M. De Velasco, T. Hayashi, H. Tsuji, M. Nozawa, 

K. Yoshimura, T. Ishii, H. Uemura (Osaka-Sayama, Japan) 


315 

Monday

Monday 

Monday, 18 March - Sponsored Sessions 



17.45 - 19.15 Urinary incontinence - Optimising the patient experience and improving outcomes page 418 

Amber Hall 6 - Level S2 Sponsored by ALLERGAN and PORGÈS, a COLOPLAST division 


17.45 - 19.15 Interactive debate: How seriously should I take male LUTS? page 419 

Silver Hall - Level N2 Sponsored by ASTELLAS 

17.45 - 19.15 New data on androgen deprivation with a GnRH antagonist: Improving patient outcomes in 

prostate cancer page 420 

Yellow Hall 1-2-3 - Level N1 Sponsored by FERRING PHARMACEUTICALS 

17.45 - 19.15 Castration-resistant prostate cancer in 2013: Analysing the good, the bad and the ugly page 421 

Red Hall 2 - Level N1 Sponsored by PRIME ONCOLOGY

Tuesday, 19 March - EAU Programme 


08.00 - 13.10 Souvenir sessions/Hot topics in prostate cancer 


Chairs: A. Stenzl, Tübingen (DE) 


08.00 - 09.30 Souvenir session by the EAU Scientific Congress Office 

Prostate disease 





J.W.F. Catto, Sheffield (GB) 

Renal, testicular and penile cancer 


Neurourology, voiding dysfunction and incontinence 

F.C. Burkhard, Berne (CH) 

Stone disease 



W.F.J. Feitz, Nijmegen (NL) 

Andrology 

J.O.R. Sonksen, Herlev (DK) 

Reconstruction, transplantation and trauma 

L. Martínez Piñeiro, Madrid (ES) 

09.30 - 09.40 EAU policy on live surgery 

K.F. Parsons, Liverpool (GB) 


In mid 2012, the EAU established a panel of internationally recognised experts to address the issue of the 

ethics of live surgical demonstrations in urology. 

The culmination of their work is a formal EAU policy statement which will be presented to the Congress on 

their behalf. This will include the underpinning governance documents which have been formulated. 

The methodology, including the supporting literature review and the Delphi process used to determine the 

consensus view, will be shown, together with proposals for continuing prospective audit of all live surgical 

events undertaken under the auspices, and with the endorsement of the EAU. 



09.45 - 10.00 Update New urological weapons in the treatment of CRPC 



317 

Tuesday

Tuesday 

10.00 - 10.20 Late breaking news I 


Can Zometa prevent bone metastases in high risk prostate cancer patients? First Results of the Zometa 

European Study (ZEUS). 


Prostate cancer in China 

Y-H. Sun, Shanghai (CN) 

10.20 - 10.40 State-of-the-art lecture Is there a role for intermittent androgen deprivation? 

T.L.J. Tammela, Tampere (FI) 

10.40 - 11.20 Debate High risk PC: Surgery vs radiation vs systemic therapy 

Moderator: M. Jewett, Toronto (CA) 

Surgery: H. Van Poppel, Leuven (BE) 

Radiation: A. Bossi, Villejuif (FR) 

Systemic therapy: P. Iversen, Copenhagen (DK) 


The optimal management for men presenting with high risk prostate cancer remains controversial. 

Experts will debate the merits of radical prostatectomy, radiation therapy and systemic therapy alone or in 

combination. At the end of the session, the delegates will better understand how to personalize the care of 

the individual patient presenting with this life threatening disease to achieve the best chance of cure while 

minimizing the burden of treatment. 

11.20 - 11.35 Late breaking news II 

Swedish Registry Study 


11.35 - 12.15 Debate Why focal therapy instead of active surveillance for low risk prostate cancer 

Moderator: F.C. Hamdy, Oxford (GB) 

Pro: M. Emberton, London (GB) 

Con: M. Wirth, Dresden (DE) 

12.15 - 12.35 Report on the Consensus Statement for Prostate Cancer Prevention 

J. Cuzick, London (GB) 

12.35 - 13.05 Update European PSA screening 

ERSPC perspective 

J.E. Hugosson, Göteborg (SE) 


Screening for prostate cancer is controversial. While a large randomized study has shown a benefit 

of screening in terms of prostate cancer mortality. Generally accepted evidence on a proper balance on 

advantages and disadvantages is lacking. The purpose of this session will be to inform on the present status 

of screening and proper decision taking.

Patient perspective 

T. Hudson, Dublin (IE) 

EAU perspective 


12.50 - 13.05 Debate on European PSA screening 


J.E. Hugosson, Göteborg (SE) 

T. Hudson, Dublin (IE) 


• Prostate cancer is a major health problem, and the main cause of male cancer deaths. However, current 

published data are insufficient to recommend the adoption of population screening for prostate cancer 

as a public health policy due to the large over-treatment effect. Before screening is considered by 

national health authorities, the level of current opportunistic screening, overdiagnosis, overtreatment, 

quality of life, costs, and cost-effectiveness should be taken into account. 

• Overdiagnosis of prostate cancer leads potentially to significant overtreatment. Health professionals, 

especially urologists, should avoid overtreatment by developing safe methods of cancer surveillance/ 

monitoring without invasive therapy. Invasive therapies should be tailored to patients’ needs and the 

prognosis of cancers diagnosed. 

• Current screening algorithms are insufficient for population screening or individual early diagnosis 

due to a lack of specificity and lack of selectivity for aggressive cancers which require treatment. The 

development of novel diagnostic and prognostic markers and imaging modalities is needed urgently to 

enhance the predictive value of screening tools. 

• In the absence of population screening, the EAU advises men who consider screening by PSA testing 

and prostate biopsy to obtain information on the risks and benefits of screening and individual risk 

assessment. 

• The European Association of Urology and the ERSPC study group represent essential European 

stakeholders to further develop health strategies for prostate cancer screening. 

• The EAU promotes the quality of care for prostate cancer patients in Europe in collaboration with the 

patient support organization Europa Uomo (www.europa-uomo.org) through the development of 

information and guidelines. 

• The EAU wishes to support and foster research needed to develop reliable active surveillance protocols 

for low-risk prostate cancers, prognostic markers, and targeted therapies in order to deliver optimal 

patient care. 




319 

Tuesday

ESU Courses, 16 March 

ESU Course 1 

14.30 - 17.30 Prostate cancer – Screening, diagnosis and staging 

Green Hall 1 - Level N-1 

Screening 


Diagnosis 


Staging 


Chair: F.C. Hamdy, Oxford (GB) 


The incidence of prostate cancer has increased dramatically over the last 10 to 15 years and it is now the 

most common cancer in males in developed countries. The increase is mainly caused by the growing use 

of opportunistic screening or case-finding based on the use of prostate-specific antigen (PSA) testing in 

serum. Using this approach, prostate cancer is detected 5 to 10 years before giving rise to symptoms and on 

average 17 years before causing the death of the patient. While this has led to detection of prostate cancer 

at a potentially curable stage, it has also led to substantial overdiagnosis, i.e. detection of cancers that 

would not surface clinically in the absence of screening. This is confounded by recent evidence that screening 

reduces disease-specific mortality. A major challenge is thus to identify the cases that need to be treated 

while avoiding diagnosing patients who will not benefit from being diagnosed and who will only suffer from 

the stigma of being a cancer patient. Therefore, prognostic markers, which can predict those patients who 

need to be diagnosed and those who do not, are of major importance. This course is designed for urological 

trainees and established urologists, who wish to update themselves on the latest information regarding 

screening, diagnosis and staging in prostate cancer. The course allows interaction with the audience and is 

in part based on case-scenarios for discussion with the delegates, followed by state-of-the-art presentations. 

In addition, emphasis will be placed on controversial issues and recent progress in terms of diagnostic tools, 

staging procedures and prognostic factors. At the end of the course, the participants should have obtained 

good insights on the following: 

• What are the best approaches to screening and early detection of prostate? 

• How can we reduce the risk of overdiagnosis and overtreatment? 

• How can we identify patients who are best managed by active monitoring/surveillance rather than 

immediate more active treatment? 

Registration fee excluding VAT 

EAU members € 47 

Non-EAU members € 69 

Residents (members/non-members) € 21 


321 

ESU Courses

ESU Courses 



ESU Course 2 

14.30 - 17.30 Advanced course on urethral stricture surgery 


Chair: C.R. Chapple, Sheffield (GB) 

Management of anterior urethral stricture disease – an evidence based approach. 


Urethroplasty for posterior urethral injuries –an evidence based approach 

S.G.Joniau, Leuven (BE) 

Female strictures 



A Roosen, Munich (DE) 

Round table discussion 

The panel 


· To be able to counsel and advise a patient on the therapeutic options available. 

· To review the treatments available for urethral stricture disease and to do so in the context of different 

patient based scenarios, in an interactive fashion. 

· To provide a clearer understanding of the role and potential for both anastomotic and substitution 

urethroplasty in the management of urethral stricture disease. 

· To review the different materials and techniques used in substitution urethroplasty 

· To outline the principles of the surgical management of patients with urethras that have been injured by 

trauma. 

Participants of the course will obtain a clear view on the current role of surgery for the management of 

urethral stenosis affecting both the anterior and posterior urethra in contemporary clinical practice. 




Residents (members/non-members) € 21


ESU Course 3 

14.30 - 17.30 Metastatic prostate cancer 


Chair: K. Pummer, Graz (AT) 

First and second line hormonal therapy: What should be considered? 


What is the role of chemotherapy and immunotherapy in patients with CRPC? 


New therapeutic options for patients with CRPC – more possibilities, more questions? 

K. Pummer, Graz (AT) 




K. Pummer, Graz (AT) 


The aim of this course is to provide comprehensive state-of-the-art information about the optimal 

management of patients with metastatic prostate cancer. 

The first lecture will give an overview of the various forms of currently available androgen deprivation 

therapies such as LHRH analogs and antagonists, address the potential advantages or disadvantages of 

intermittent treatment, as well as outline the optimal timing of hormonal therapy. In addition, the role of 

possible second-line hormonal manipulations will be presented. 

The second lecture will present and critically discuss the role of chemotherapy as well as immunotherapy 

at the time when hormone resistance has developed with a special emphasis on efficacy, side effects, 

sequencing and patients` selection. 

The third lecture will address recent achievements as well as future challenges by reviewing the mode of 

action and the current role of newer therapeutic options such as testosterone synthesis inhibitors, androgen 

receptor antagonists, or radionuclide therapy. 

At the end of the course, interactive cases will be discussed together with the audience and there will be 

plenty of time for questions and answers. 






323 

ESU Courses

ESU Courses 



ESU Course 4 

14.30 - 17.30 Retropubic radical prostatectomy – Tips, tricks and pitfalls 

Orange Hall 1 - Level N-1 

Surgical anatomy 


Chair: H. Van Poppel, Leuven (BE) 

Step by step radical retropubic prostatectomy 


Tips, tricks and pitfalls 


Treatment of complications 


Discussion and interaction 

Faculty 


In many parts of Europe, open retropubic radical prostatectomy is still the gold standard for treating 

localised prostate cancer. Although laparoscopic, eventually robot assisted, radical prostatectomy is getting 

more popular in selected centres, and the open surgical approach is still the most often performed operative 

procedure in many countries throughout Europe. Localised prostate cancer is being more and more detected 

in its earlier stages and surgery undoubtedly offers the best local control. The urologist’s surgical skill must be 

outstanding and the urological community is responsible for guaranteeing optimal surgical quality through 

adequate training. The competition with external beam radiotherapy, brachytherapy and novel minimally 

invasive techniques like cryosurgery and HIFU, should encourage young urologists to optimally perform the 

surgical resection with the best possible tumour control and the least impact on continence and potency. 

This course aims to bring to the modern urologist the different technical steps of the classical ‘retropubic 

prostatectomy’ with an emphasis on the preservation of continence and potency and discusses the special tips 

and tricks that must enable every contemporary urologist to obtain good results with minimal complications. 

Also, the prevention and treatment of complications are discussed. 

This teaching course is a must for the elder resident and the younger urologist beginning his career but well 

trained urologists who do not treat many patients with localised prostate cancer, will benefit. The participants 

will get inside the detailed surgical anatomy, the pre-operative measures and the intra-operative steps of a 

very systematic and safe operation. Also the experienced uro-oncological surgeon will enjoy the tricks and 

pitfalls and will learn how to solve intra- and postoperative complications. 






ESU Course 5 

14.30 - 17.30 Office management of male sexual dysfunction 


Diagnostics - What is necessary? 


Testosterone replacement 

C. Stief, Munich (DE) 

Oral therapy for ED 


Therapy of ED when pills fail 

D. Ralph, London (GB) 

Chair: C. Stief, Munich (DE) 

Medical therapy for premature ejaculation 


Surgical topics: Penile implants, priapism, Peyronie’s 

D. Ralph, London (GB) 

What to do after radical prostatectomy? 



The course is aimed at providing practical advice on how to diagnose and treat a patient with premature 

ejaculation or ED. It will allow an up-to-date understanding of the underlying mechanisms of the erectile 

process and the aetiology of ED. The recent development of various orally available drugs with different 

modes of action and distinctly different side-effect profiles enables individually tailored therapies. However, 

an individually adopted regimen requires an adequate work up that will be comprehensively presented. 

Although currently available and future oral drugs will be covered in depth, alternative options such as 

testosterone supplementation, local pharmacotherapy or various devices will be presented with special 

emphasis since their adequate indication and appropriate use by the urologist makes the distinctive 

difference in comparison to other specialists in the field. The indications for, and specific aspects for penile 

prosthesis will be discussed since prostheses still represent an important option for select patients. Then, 

specific topics with high practical importance as the cardiovascular patient with ED or the post-prostatectomy 

case will be covered. 

The course will be very interactive allowing in-depth information on the various aspects of the cutting edge 

of ED. 






325 

ESU Courses

ESU Courses 



ESU Course 6 

14.30 - 17.30 Prolapse management and female pelvic floor problems 


Introduction 


Vaginal surgical anatomy for urologists 


Investigations and imaging for POP 


Vaginal native tissue repair 


Vaginal mesh repair 


Open/laparoscopic/robotic repair 

E. Costantini, Perugia (IT) 

The politics of mesh repair 


Management of complications 

E. Costantini, Perugia (IT) 

Chair: D.J.M.K. De Ridder, Leuven (BE) 


This course gives practical information about prolapse management by urologists. From anatomy to mesh 

implant and the management of complications. 

The recent turmoil on the vaginal mesh implantation will be discussed in detail. Also laparoscopic and 

robotic approaches will be evaluated. 






ESU Course 7 

08.30 - 11.30 Management of small renal tumours 




Ablative therapies 


Surgery 


Chair: P. Gontero, Turin (IT) 


The aims of this course are to review the various therapeutic strategies in small localised RCC. 

The techniques such as surgery (open and laparoscopy) radical and nephron sparing, cryotherapy, 

radiofrequency and HIFU will be presented. Their respective indications including surveillance will be 

discussed. An overview of the published results will be presented and analysed. Interaction is the most 

important way to have an efficient course. 

Video and clinical cases will be used as a tool to stimulate exchange. 

We hope to meet you in Milan during the EAU Annual Congress to enjoy lots of discussions on this interesting 

topic. 






327 

ESU Courses

ESU Courses 



ESU Course 8 

08.30 - 10.30 Renal transplantation: Technical aspects, diagnosis and management 

of early and late urological complications 


Chair: F.J. Burgos Revilla, Madrid (ES) 

Selection and urological preparation of transplant recipients; surgical aspects of nephrectomy in living and 

deceased donor 


Laparoscopic living donor nephrectomy: Technical aspects and controversies 


Avoiding complications by proper techniques of renal transplantation; tricks and tips 


How to diagnose and manage postoperative and long-term complications following renal transplantation 



Given the dramatic improvement in short- and long-term graft and patient survival, renal transplantation 

has become the most effective treatment of end stage renal failure. Recipients considered for transplantation 

are currently older and pose more problems than in the past, in some cases requiring specific urological 

preparation. We would like to share our experience concerning the selected items with the audience. These 

include how to select and to prepare transplant recipients with surgical or urological problems, how to 

choose the most safe technique for performing deceased donor and living donor nephrectomy, how to deal 

with unusual situations of renal procurement or transplantation and finally, for urologists, how to diagnose 

and manage postoperative and long-term urological and other complications. 






ESU Course 9 

08.30 - 11.30 Advanced course on upper tract laparoscopy (UPJ, adrenal and 

stones) 


Chair: G. Janetschek, Salzburg (AT) 

Transperitoneal approach to the kidney and adrenal gland: Standard technique and modifications 


Retroperitoneoscopy: Lateral and posterior approach 


Dismembered pyeloplasty: Technique, problems, complications 


Non-dismembered pyeloplasty: Indication, technique 


Adrenalectomy 


Partial adrenalectomy 


Stone surgery 


Questions and discussion 

Faculty 


Surgery of the kidney and adrenal gland by means of laparoscopy has become standard of care. Most 

frequently this surgery is performed transperitoneally; this approach has been standardized. However, the 

anatomy of the right and left side differs substantially which has to be taken into consideration. Also several 

modifications have been developed such as a direct approach to the left renal pelvis through the colonic 

mesentery. Retroperitoneoscopy is an alternative which should be mastered as well. 

Adrenalectomy was the first widely recognized indication for laparoscopy in urology, and open surgery 

has almost vanished for this indication. Partial adrenalectomy may be considered as an alternative 

in benign solitary tumours such as Conn adenoma but is strongly recommended in familial bilateral 

pheochromocytoma. 

For the treatment of UPJ obstruction laparoscopy has to compete with both open surgery and endopyelotomy. 

Compared to open surgery the results are the same but morbidity is lower. Morbidity of endopyelotomy is 

lower, however, but the results are not as good in the long-term. The technique of dismembered and nondismembered 

pyeloplasty will be discussed in detail. 

Laparoscopic stone surgery is usually not a first line therapy. In specific situations it may be helpful, 

however. 


329 

ESU Courses

ESU Courses 


All the mentioned techniques will be presented in an interactive way. Essential steps will be highlighted by 

video clips. 






ESU Course 10 

08.30 - 11.30 Advanced course on laparoscopic nephrectomy 


Introduction 

H.P. Beerlage, ‘s-Hertogenbosch (NL) 


Indications for laparoscopic nephrectomy 


Transperitoneal access 


Extraperitoneal access 



Chair: V. Pansadoro, Rome (IT) 

Transperitoneal safe control of the renal pedicle 


Extraperitoneal safe control of the renal pedicle 


Hemostatis 


High energy tools 


Critical view of safety 


Indications and technique for partial nephrectomy 


Indications and technique for partial nephrectomy. The Padua score 


Pedicle control. Advantages and disadvantages of the different systems. (Vascular clamp, tourniquet, bulldog 

clamp) 



331 

ESU Courses

ESU Courses 


Classical laparoscopy or robotic enucleation? 



Parenchymal clamping 


Surgical tips for the nephroureterectomy 


Conversions 


Vascular emergencies during renal surgery 



Conclusion 




Different access to radical nephrectomy will be discussed. 

Best way to control the pedicle with the different approaches. 

Indications and surgical technique to partial nephrectomy. 

Pedicle control and efficient hemostasis. 

All the subjects will be discussed from a practical point of view with tips, tricks and pitfalls. 






ESU Course 11 

08.30 - 11.30 Painful bladder / chronic pelvic pain; In men and women 


Welcome 


Chair: J.J. Wyndaele, Antwerp (BE) 

Neurophysiology of chronic pelvic pain, causes and confusable diseases 


Chronic prostatitis and chronic pelvic pain in men 

S. Elneil, London (GB) 

Bladder pain syndrome BPS/IC 


Discussion, case presentations and conclusion 

Faculty 


Painful diseases of the pelvis are not rare. The clinical entity is not an easy one, both in diagnosis and in 

treatment. Interactions between organs complicate the approach. The list of ‘confusable’ diseases is long and 

the most direct way to the most probable diagnosis needs to be determined while avoiding the danger of 

overlooking another dangerous pathology. 

An increase in knowledge has been important during the last couple of years. The scope of the course is to 

bring participants up to date, so that after the course they can perform the most optimal evaluation of the 

patients with chronic pelvic pain and give the treatment best adapted to our actual knowledge. 






333 

ESU Courses

ESU Courses 



ESU Course 12 

08.30 - 11.30 Lower urinary tract dysfunction and urodynamics 


The scientific basics of urodynamics 


Chair: P. Abrams, Bristol (GB) 

Urodynamics - Getting philosophy and technique correct 


Urodynamics in neurourology 


Urodynamics in female urology 


Urodynamics in the child and in men 



Having attended the course, the attendee should: 

• Understand the basic physical principles referable to urodynamics 

• Be able to assess the quality of a urodynamic trace 

• Recognise common artefacts and know how to correct them 

• Know the indications for urodynamic studies in children, men, women and neurological patients. 






ESU Course 13 

12.00 - 14.00 Pathology (prostate, bladder/UUT, kidney, testicles/penis) 


Chair: E. Compérat, Paris (FR) 

How to get best results for your patient. Challenges in pathology of the prostate and bladder 

E. Compérat, Paris (FR) 

New insights and changes in pathology of the kidney and testis 

F. Algaba, Barcelona (ES) 


This course for urologists will treat prostate, bladder, kidney and testicular pathology. It is not a course of 

pathology, but wants to improve the urologist-pathologist interaction. The attended aim is to get correct 

diagnosis, understand as well problems which pathologists may encounter, as the most important details 

mentioned in a pathology report. 

Several question frequently asked by urologists will be treated: 

I.) Clinical practice and optimal handling of pathology specimen. 

Is my clinical practice optimal to obtain best pathology report, how can I improve the interaction with the 

pathologist? 

- The importance of clinical information and well edited, good sampling will be explained, especially limits 

of diagnosis in case of artefacts. Solutions how to avoid them will be discussed. 

- Which information has to be exchanged between the urologists and the pathologists? The importance of 

clinical information and history will be underlined. 

- Robustness of pathology reports and when urologists should ask for a second opinion will be discussed. 

II.) When ask for frozen sections and biopsies that are possible results. 

Evaluation of surgical margins 

- The indication of frozen sections and biopsies is a topic of major concern. Indications of frozen sections 

have to be precise and useful; otherwise it becomes an expensive and time spending procedure. We point 

out the right indications. 

- Another important point which overlaps with the above mentioned is the evaluation of the surgical margins, 

limits in pathology and how we can improve. 

- We also want to discuss the usefulness of biopsies in kidney tumours, prostate, bladder and upper urinary 

tract. Where are our limits, what do urologists expect expectations and how to proceed to get optimal 

results? 

III.) Pathology report. How to read and understand all included information 

The aim is to discuss the major items of a pathology report. 

- Am I using all the information which is in a pathological report? 

- Do I know the latest staging and grading? 

- Which information do I have to expect and ask in case of absence? 

- Understand why the pathologist does immunohistochemistry. 

- The most important antibodies (understanding of which antibody is in favour of which lesion and evokes 

which hypothesis). 

IV.) Novelties in Uro-Onco Pathology. Applications in daily practice 

- Many new acquisitions are regularly made in Uro-Oncological Pathology. The latest news in burning 

research topic will briefly be discussed. 


335 

ESU Courses

ESU Courses 


- The presentation of new pathological entities with clinical implications will be treated. 

We will discuss the correlation between morphology and biology which special emphasis about the role that 

the pathologist plays in the detection of the therapeutic targets, especially in renal cell cancer. 






ESU Course 14 

12.00 - 14.00 Surgical management of locally advanced and metastatic renal cancer 


Chair: M. Kuczyk, Hanover (DE) 

State of the art regarding systemic treatment of matastasized renal cancer 

S. Osanto, Leiden (NL) 

Surgical options for metastasized renal cell cancer 


Surgical treatment of locally advanced renal cell cancer 



Although most renal cancers are small and incidentally found, a significant proportion of patients still present 

with locally advanced or even metastatic renal cell carcinoma (RCC) at first diagnosis or develop metastatic 

spread during the further course of the disease. 

RCC is a unique disease where we had important developments in the last 2 decades both in surgical as 

well as nonsurgical and systemic therapies. Although we have now at least 7 drugs with proven efficacy in 

metastatic RCC, surgery still remains the only curative therapy. 

The first aim of this course is to highlight the role of surgery versus a conservative therapeutic approach. 

The efficacy of metastasectomy, for example, will be weighed against that of a medical treatment that is 

mainly based on anti – VEGF – directed agents. In addition, new therapeutic concepts including neoadjuvant 

treatment upfront surgery for locally advanced disease including patients with intracaval thrombosis will be 

highlighted. 

Surgery for locally advanced disease particularly in patients with vena caval thrombus is a challenging 

situation and tips and tricks of this type of surgery including the clinical results that can be achieved by 

an aggressive surgical management will be indicated. And finally, the place of cytoreductive nephrectomy 

during the treatment of metastatic RCC and the role of surgery for the treatment of locally recurrent disease 

will be discussed. 

This course is an excellent opportunity to learn what the urologist can offer to renal cancer patients with 

difficult tumours and metastatic RCC. The course is an ideal opportunity for all; residents, the practicing 

urologist and the oncologic urologist. Don’t miss this course if you see patients with advanced RCC in your 

practice! 






337 

ESU Courses

ESU Courses 



ESU Course 15 

12.00 - 14.00 Laparoscopy for beginners 


Indications for laparoscopy 

A.D. Joyce, Leeds (GB) 

Instrumentation and haemostasis 

X. Cathelineau, Paris (FR) 

Chair: A.D. Joyce, Leeds (GB) 

Peritoneal access and effects of pneumoperitoneum 


Avoiding complications 



Urologists interested in undertaking laparoscopy must be properly trained in order to minimise the risk of 

potential complications and to ensure patient safety. Currently training in urological laparoscopy is limited 

due to several factors: 

• A shortage of designated training centres 

• A shortage of recognised trainers 

• Lack of either appropriate facilities, limitations of equipment, expertise or support 

All of which restrict the trainee from access to high quality training. This course aims to provide the potential 

trainee with the recognised core knowledge with regard to case selection, correct use of the equipment and 

imaging systems, and the important protocols for accessing and exiting the abdomen, including how to 

recognise and avoid potential complications prior to starting with the skills acquisition. The central highlight 

of the course is the use of video clips to illustrate many of the essential points and to promote discussion 

amongst the delegates. 






ESU Course 16 

12.00 - 14.00 Testicular cancer 


Testis cancer – Early stages 


Testis cancer – Case discussion 


Testis cancer – Advanced stages 


Testis cancer – Case discussion 


Chair: P. Albers, Düsseldorf (DE) 


The EAU guidelines on testicular cancer have been updated for 2012. Based on this European consensus, 

this ESU course will provide the auditorium with the latest information on diagnostic tools, staging and 

treatment of testis cancer stage by stage. In early-stage cancer, organ-sparing surgery, the question of 

testicular microlithiasis, the conflicting issue of testis biopsy and current histopathological prognostic factors 

for surveillance and individualised treatment options will be discussed with the auditorium including case 

presentations. The role of conventional as well as laparoscopic RPLND in early stages will be clarified. 

In advanced-stage cancer, the course participants will learn about stage by stage treatment according to 

IGCCCG classification. Detailed information on chemotherapy regimens and the handling of side-effects will 

be provided. In this section of the course, tips and tricks of residual tumour resection will be presented 

using case reports and intraoperative pictures. In addition, salvage strategies will be discussed in cases of 

treatment failures. Participants will have enough time to ask questions and discuss their own cases. 






339 

ESU Courses

ESU Courses 



ESU Course 17 

12.00 - 14.00 Management and outcome in invasive and locally advanced bladder 

cancer 


Chair: A. Alcaraz, Barcelona (ES) 

Cystectomy in the management of bladder invasive and locally advanced bladder cancer 


Case discussion on cystectomy in the management of bladder invasive and locally advanced bladder cancer 


Bladder sparing approaches to muscle invasive bladder cancer 


Case discussion on bladder sparing approaches to muscle invasive bladder cancer 


Cytotoxic chemotherapy in bladder cancer: Neoadjuvant and adjuvant setting and treatment of metastatic 

disease 



Bladder cancer is the second most common oncological malignancy in Europe. Invasive and locally advanced 

bladder tumour is the urological malignancy with the highest mortality. 

The course will begin with the definition of the disease and different prognostic factors. Among 

prognosticators of outcome will be discussed the role of early cystectomy in T1 patients with poor prognosis 

indicators and the limitations of cystectomy in elderly and poor performance status patients. The course will 

continue with the discussion of the different treatment options. Rationale for considering cystectomy as gold 

standard, as well as a clear definition of multidisciplinary strategies for bladder sparing treatments with 

special emphasis in patient selection and potential limitations will be discussed. Finally, the role of systemic 

chemotherapy in the neoadjuvant and adjuvant to cystectomy setting will be presented, as well as in the 

treatment of metastatic disease. 

Specially recommended for elder residents and young urologists starting their career in the field of urooncology. 

Also experienced uro-oncological surgeons will benefit from this course through an update, 

focused on clinical issues and a practical approach. 

At the conclusion of this course, the participants should get better insights in terms of: 

- Stratifying the patients with invasive and locally advanced bladder cancer in different groups of risk. 

- Understanding the rationales outcome and limitations of cystectomy and bladder sparing treatments. 

- Defining the current role of neoadjuvant and adjuvant chemotherapy for invasive and locally advanced 

bladder cancer. 

- Measuring the benefits of systemic chemotherapy in terms of progression free survival and overall 

survival.






341 

ESU Courses

ESU Courses 



ESU Course 19 

14.30 - 17.30 Robot renal surgery 


Introduction 


Pyeloplasty 


Chair: A. Mottrie, Aalst (BE) 

Clinical cases UPJ Obstruction; Nephrectomy for RCC 

J. Hubert, Nancy (FR) 

Partial nephrectomy 


Clinical cases RCC; Nephroureterectomy 

J. Hubert, Nancy (FR) 

Conclusion 



1. Explain the advantages of robotics over classical laparoscopy in surgery of the upper urinary system 

2. Teach the different operations step-to-step 

3. Discuss difficult clinical cases 






ESU Course 20 

14.30 - 17.30 How to write a manuscript and get it published in European Urology 


Chair: F. Montorsi, Milan (IT) 

How to get your manuscript published in European Urology 


Why publishing (and publishing on European Urology) is important for you 


Clinical research original article: How to write the introduction and methods section 

G. Novara, Padova (IT) 

The importance of statistical design and analysis 

R.J. Sylvester, Brussels (BE) 

Clinical research original article: How to write the results and discussion sections 


Clinical research original article: The editor’s tricks 


How to write a basic research article to be relevant for the readers of European Urology 


How your submission will be evaluated by European Urology reviewers: Reviewer template and publication 

guidelines 


Surgery in Motion: How to combine the best possible manuscript and video for the Surgery in Motion 

Section 


Questions and answers 


The objectives of the course are to provide the principles of writing the two key types of publication: the 

review article and the clinical study report. Specifically covered will be how to decide whether you should 

actually publish your data and how to choose the most suitable journal once that decision is made. The ‘How 

to do it’ for a scientific paper will represent the core of the course. This will be illustrated with case studies 

on each aspect of the paper with a workshop style discussion with attendees. How to use references in your 

article and the different options for easy referencing will also be discussed. The tips and tricks section will 

provide ‘insider’ information to help in your writing. Finally, we all have to deal with reviewer’s comments 

and information will be presented on how this should be carried out to best advantage. Attendees are-on 


343 

ESU Courses

ESU Courses 


expected to leave the course with a full knowledge of the fundamental requirements to be successful in 

having a scientific paper accepted by a major journal. 






ESU Course 21 

14.30 - 17.30 Advanced vaginal reconstruction 


Chair: D. Pushkar, Moscow (RU) 

Introduction: Are you involved in reconstructive urology? 


Midurethral slings in 2012-2013: The current status 


Management of urinary incontinence associated with urethral loss 


Obstructive slings: What to do? 



Management of mesh complications 



Management of non-index stress urinary incontinence (recurrent cases, intrinsic sphincter deficiency, mixed 

incontinence). 


Modern approach to vesicovaginal fistulae and urethral diverticulae (comprehensive video presentation) 


Adjournment 



Clinicians involved in the care of female patients should know vaginal surgery. A specific goal of the faculty 

is to employ scientific principles, published information and clinical experience to describe and position 

newly developed techniques in current management of urinary incontinence. Special attention will be given 

to new techniques that use synthetics tapes in SUI surgery. This course will also cover the management of 

complications of surgery for stress incontinence and mesh complications. Treatment of recurrent urinary 

incontinence and incontinence with mixed symptoms also will be under discussion. 

Management of vesicovaginal fistulas, urethral diverticulae and some rare conditions will be shown both 

during podium and video presentations. An interactive course means active participation by the audience and 

participants are encouraged to prepare and present interesting and challenging clinical cases for consultation 

by the faculty. After this course, participants should know how to apply the newest technique in patients with 

stress incontinence, urethral loss and iatrogenic injuries of lower urinary tract. This course will facilitate the 

decision making process for those who are just starting their careers and for advanced surgeons. 


345 

ESU Courses

ESU Courses 







ESU Course 22 

14.30 - 17.30 Radical cystectomy and orthotopic bladder substitution – Surgical 

tricks and management of complications 


Chair: U.E. Studer, Berne (CH) 

Preoperative investigations and selection of patients for orthotopic bladder substitution 

J.E. Gschwend, Munich (DE) 

Arguments for nerve sparing cystectomy with orthotopic bladder substitution 


How to do a nerve-sparing cystectomy in male and female patients, surgical tricks to avoid complications 

with orthotopic bladder substitution 


Tips on how to obtain good functional results in female patients 


Active post-operative management is the most important step 


How to treat complications during follow-up 


Discussion 

Faculty 


In this course, special emphasis is placed on patient selection and on practical surgical steps: on how to 

do meticulous pelvic lymph node dissection and nerve-sparing cystectomy in male and female patients, as 

well as how to do various types of orthotopic bladder substitutes with good long-term functional results. 

The course is aimed to be interactive with 50% of the time reserved for questions and discussions with the 

audience. At the end of the course, participants should know all the essential and practical steps needed in 

order to achieve good results with cystectomy and orthotopic bladder substitution. 






347 

ESU Courses

ESU Courses 



ESU Course 23 

14.30 - 17.30 Surgery or radiotherapy for localised and locally advanced prostate 

cancer 


Localised prostate cancer 

Introduction 


Chair: B. Djavan, Vienna (AT) 

Treatment options and strategies in localised prostate cancer 


How and when to use nomograms and networks 


Oncological and functional results of radical prostatectomy 


Oncology results of radiation therapy 


Advanced prostate cancer 

Radiotherapy with or without hormonal treatment in advanced PCA 


Results of radical prostatectomy for T3 disease 


Adjuvant therapies following radical prostatectomy: What is the standard and what is new? 


Take home messages 



The decision process towards surgery/active surveillance or radiation is a constantly evolving matter that 

requires a multitude of various information and inputs. In localised disease old habits have been jeopardised 

and surgical management seems to be fused with active surveillance in an increasing number of patients 

with good prognosticators. This course will summarise the decision process and indications for patients 

with clinically localised disease and help select the optimal treatment based on most recent oncological and 

functional data. 

In locally advanced disease, growing evidence supports the notion of radical surgery to improve outcome. 

US and European data endorse this policy in a selected group of patients. New radiation protocols and

strategies combined with hormone therapy offer as much adequate alternatives. In the second part of this 

course, controversies regarding the optimal management of locally advanced prostate cancer patients will be 

discussed and clear recommendations made to facilitate patient counselling and treatment. 






349 

ESU Courses

ESU Courses 



ESU Course 24 

14.30 - 17.30 Flexible ureterorenoscopy and retrograde intrarenal surgery: 

Instrumentation, technique, tips and tricks, indications 


Chair: O. Traxer, Paris (FR) 

Welcome message and introduction of the course 


Instrumentation: Endoscopes 


Instrumentation: Laser and lithotripsy devices 

M. Grasso, New York (US) 

Instrumentation: Disposable (wires, retrieving devices, UAS, irrigation devices and others) 


Technique: Stones 


Technique: Urothelial tumours and strictures 

M. Grasso, New York (US) 

Tips and tricks and special circumstances 


Indications (guidelines) and clinical cases 


Conclusions 



This course will teach the principles of evidence based medicine (EBM) in the context of daily decisionmaking 

in urology. We will introduce urology-relevant resources to search and retrieve the latest clinical 

research studies and provide the tools to systematically evaluate these studies for the quality of evidence they 

provide. In practical exercises, we will first demonstrate how to assess a study’s methodological strengths 

and weaknesses to determine how much confidence we can place in its results. Second, we will analyze 

the actual study results and the degree of certainty with which they are reported. Finally, we will discuss 

important considerations when deciding whether the results of a given study can and should be applied to 

the care of an individual patient. 

A workshop-style, interactive format is chosen to teach this course. The educational objective is to empower 

participants to independently search and appraise clinical research studies and retrieve high quality evidence 

as it becomes available. This course is therefore of exceptional value to all urologists that are seeking to 

enhance their EBM skills and thereby improve patient care.






351 

ESU Courses

ESU Courses 



ESU Course 25 

08.30 - 11.30 The infertile couple - Urological aspects 


Diagnostic work-up, medical treatment 


Chair: W. Aulitzky, Vienna (AT) 

Pathophysiology, diagnosis and treatment of varicocele 

W. Aulitzky, Vienna (AT) 

Microsurgical refertilisation 

W. Aulitzky, Vienna (AT) 

Sperm retrieval techniques and genetic aspects of IVF/ICSI 



This course provides state-of-the-art information on urological aspects of diagnosis and therapy of modern 

reproductive medicine. Diagnostic procedures should be standardised and coordinated in a timely fashion 

for both partners, focussing on the possible urological, hormonal and genetic causes of male infertility. In 

terms of therapy, this course will provide updated information on evidence based data and will discuss the 

importance of varicoceles in male infertility. We will show microsurgical techniques on video and explain 

why proper training and skills perfection is key to successful case management. A successful IVF/ICSI outcome 

depends upon the use of state-of-the-art techniques for sperm retrieval and sperm preparation. We will 

also provide information on genetic aspects and stress the responsibility of the urologist as an adviser and 

gatekeeper for the treatment of the infertile couple. 






ESU Course 26 

08.30 - 11.30 Update on stone disease 


Introduction 


Medical aspects of urinary stones 

F. Millán-Rodríguez, Barcelona (ES) 

SWL 

N.N-P. Buchholz, London (GB) 

Uretero-Renoscopy 


Chair: A. Patel, London (GB) 

Percutaneous nephrolithotomy and questions and answers 


Interactive case discussion 


Modern stone therapy has eliminated much of the previously devastating burden of upper tract urolithiasis, 

and is gradually also changing the clinical presentation. Complex stones are becoming rarer, and therapy is 

moving to the outpatient setting. Nevertheless, successful management requires competence in all aspects 

of stone management. The challenge today is employing the ideal approach for the specific situation. 

After a brief review of new developments present treatment strategies are demonstrated in detailed case 

presentations. 






353 

ESU Courses

ESU Courses 



ESU Course 27 

08.30 - 11.30 Diagnosis and management of non-muscle invasive bladder cancer 

(NMIBC) 


Introduction and objective of course 


Chair: J.A. Witjes, Nijmegen (NL) 

Diagnosis of bladder cancer (including markers and importance of TUR) and case discussion 


New diagnostic tools such as PDD and NBI 


Guideline treatment and follow-up including case discussion 


Comments on guideline treatment recommendations including case example and discussion 


BCG failures and treatment options, including case discussion 


What to do with extravesical urothelial cancer and case discussion 


Closure and evaluation 


With the comments of the last years this course will again fine tuned and obviously it will be updated 

according to the 2013 EAU guideline and latest literature. The emphasis lies on the discussion of problems 

seen in daily practice, when dealing with patients with non muscle-invasive bladder cancer (NMIBC). Many 

of these problems have been raised in previous courses and are the basis for the current presentations and 

case discussions. We have learned that discussion of these problems with the audience is very productive, 

interactive and highly appreciated. So, although the emphasis is on what one should do (the EAU guideline 

and its recommendations), we often see patients in daily practice that do not fit into guideline rules and need 

a different approach. We will present potential options for these patients and discuss cases like that with the 

audience to illustrate the possibilities beyond the guideline diagnosis and treatment solutions. 

As can be seen in the program subjects that will be lectured, discussed and illustrated with cases are (1) 

diagnostics (white light cystoscopy; cytology and markers; (re-)TUR technique), (2) diagnostic innovations 

(PDD, NBI), (3) risk classification and therapy/follow per risk group, (4) potential exceptions to the guideline 

recommendations (e.g. single post-TUR instillation, BCG maintenance therapy), (5) BCG failures, and finally 

(6) urothelial carcinoma outside the bladder.

The objective of this course is that attendees will know when to follow the guideline in NMIBC, when there 

are points of discussion, and what potential alternatives might be. 






355 

ESU Courses

ESU Courses 



ESU Course 28 

08.30 - 11.30 Robot-assisted laparoscopic prostatectomy 


Introduction 


Chair: P.T. Piechaud, Bordeaux (FR) 

General principles of robotic radical prostatectomy 



Step by step operative procedure 

Bladder neck approach 



Posterior dissection 



Lateral dissection 




Apex and DVC 




Anastomosis 




Lymphadenectomy 


Specific situations 


Postoperative complications 

P. Dasgupta, London (GB)

Anatomical and functional results 


Conclusion 



The course about the technique of robotic radical prostatectomy has for main goal to give the participants all 

the technical elements of this surgery. 

The procedure will be described step by step by the various speakers. 

Different versions of the standard technique will be also described. 

The technique of this surgery in particular situations will be precised (prostatecomy post TURP, salvage 

prostatectomy). 

The main complications of this surgery will be explained and an analysis of the anatomical and functional 

results will be presented at the end of the course. 






357 

ESU Courses

ESU Courses 



ESU Course 29 

08.30 - 11.30 Minimally invasive treatment for localized prostate cancer 


Introduction 

S.F.M. Thüroff, Munich (DE) 

Brachytherapy – Update 2013 

S. Machtens, Bergisch Gladbach (DE) 


Cryotherapy – Update 2013 



HIFU therapy – Update 2013 



Focal brachy 



Focal cryotherapy 



Focal HIFU 



What do EAU guidelines say? 


Clinical cases and discussion 




Chair: S.F.M. Thüroff, Munich (DE)

Conclusion 



Today, earlier diagnosis of localized prostate cancer has caused as a trend to more low risk, early stage as 

an elevated number of prostate cancers at first diagnosis. While surgery and radiation therapy are „golden 

standard“ therapies choosen by the urologist, modern less invasive technologies are greeted with ever 

more enthusiasm by patients. This simply creates a dilemma. In this course about minimal invasive PCa 

therapy status quo and long term results, indispensible for correct oncological evidence based evaluation are 

reported, as well as presentation and discussion of pilotstudies in specific indications, not yet subject to local 

minimal invasive treatment today. 

Brachy-, Cryo- and HIFU-therapy as representatives for low invasive minimal invasive technologies are not 

„experimental“ but „investational“, clinically available therapies for urologists and derserving attention. 

Urologists have to be informed about their potential, side effects and limitations to give „updated“ 

informations to their patients. 

This course will demonstrate these technologies, their results and complications on the other side highlight, 

why in selected cases „hightech prostate cancer therapy“ might be equal or individually superior to 

conventional therapeutic approaches. Discussion about „focal therapy“, „clinical cases“ and current guideline 

status quo -as exchange of opinions with the participants-will close this 3 hour course. 






359 

ESU Courses

ESU Courses 



ESU Course 30 

08.30 - 11.30 Paediatric urology for the adult urologist: A practical update 


Chair: J.M. Nijman, Groningen (NL) 

Obstructive uropathy: What to do when, from neonate till puberty 

G.A. Bogaert, Leuven (BE) 

How to deal with congenital malformations of the external genitalia, when is surgery indicated and how to 

do it 

S. Tekgül, Ankara (TR) 

Urinary infection, reflux and voiding dysfunction: New insights in pathology, diagnostic work-up and 

management 

J.M. Nijman, Groningen (NL) 


During this course an update is provided on common problems of the genito-urinary tract in children 

by means of state-of-the-art lectures, cases and interactive participation. Also the interaction between 

paediatric urologist, adult urologist, gynaecologist and paediatrician will be discussed. Corrections of 

congenital malformations of the urogenital tract have major implications for the quality of life, but also for 

long-term follow-up, future interventions and treatment of complications. Over the past few years our ideas 

about treatment of reflux and obstructive uropathy have changed; many so-called dogmas had to be revised. 

During this 3 hour course we will try to give an overview of the latest developments in the field of paediatric 

urology, focussing on topics of interest to the general urologist. 

The course is of particular interest to general urologists and those in training. Participants are encouraged to 

participate in the course as much as possible and there will be ample time for discussion and presentation 

of cases. 






ESU Course 31 

12.00 - 14.00 Current concepts and controversy in the diagnosis and management of 

upper tract urothelial carcinoma (UTUC) 


Epidemiology, diagnosis, evaluation 

M. Roupret, Paris (FR) 

Prognostic and predictive factors, pathology 


Chair: S.F. Shariat, New York (US) 

Treatment of low risk cancer (high grade Ta, T1 and CIS) 

M. Roupret, Paris (FR) 

Treatment of localized high risk (invasive) and metastatic cancer 



Upper tract urothelial carcinoma (UTUC) is an uncommon disease with little evidence-based data to 

guide clinical decision-making. Recently, the tools available for the diagnosis and management of UTUC 

have improved significantly, complementing a growing understanding of the biology of this disease. UTUC 

requires appropriate management at all stages, since both the cure rate and morbidity are very sensitive 

to nuances of treatment. Yet proper risk stratification remains a challenge owing to the difficulty of clinical 

staging. This course will address contemporary concepts and controversies, including the timely and accurate 

diagnosis of UTUC, emphasizing the integration of pathologic and radiographic variables for appropriate 

risk stratification. Important features regarding the natural history of UTUC will also be emphasized; the 

role of imaging and endoscopy in clinical decision making, diagnosis, staging and follow-up; and, common 

pathways of metastatic spread. Up-to-date information regarding boundaries of surgical resection, indication 

and extent of lymphadenectomy, clinical staging of UTUC, and the role of neoadjuvant chemotherapy in 

patients with high risk UTUC will be detailed. Patient selection and treatment options for patients with UTUC 

such as endoscopic management, distal ureterectomy, radical nephroureterectomy and chemotherapy will 

be discussed. 

Objectives: After attending this course, participants should be able to: 

• identify problems associated with clinical staging of UTUC 

• illustrate importance of accurate staging techniques and their role in clinical decision making maximize 

ureteroscopic diagnostic biopsy and tumor resection 

• be aware of newer modalities such as endoluminal ultrasound and other novel staging methods 

• cite current concepts and controversies in the management of low-stage and high-stage UTUC 

• discuss and compare the risk, benefit, and side effects of laparoscopic and open radical 


• understand the management of the bladder cuff 

• understand the current role of multimodal therapy for high risk patients- integration of systemic therapy – 

neo-adjuvant vs. adjuvant treatment 

• discuss the need and boundaries of the recommended lymph node dissection 


361 

ESU Courses

ESU Courses 







ESU Course 32 

12.00 - 14.00 Advanced course on laparoscopic prostatectomy 


Introduction 


Chair: J-U. Stolzenburg, Leipzig (DE) 

Anatomy of the prostate and urethral sphincter 

K. Touijer, New York (US) 

Anatomy of the neurovascular bundles and fascias - extrafascial, interfascial, intrafascial – where is the 

difference 


Operative set-up, access, trocar position: Extra versus transperitoneal approach 



Pelvic lymphadenectomy – how to perform 


Steps of the procedure (video): Endoscopic extraperitoneal radical prostatectomy 


Steps of the procedure (video): Transperitoneal laparoscopic radical prostatectomy 


How can we reduce the positive margins? 



Management of complications (based on real cases) 



Tips and tricks for difficult cases 



Conclusion 



Laparoscopic/endoscopic radical prostatectomy needs to be well standardised to be reproduced. Besides the 

approaches the results of radical prostatectomy are based on our understanding of the prostatic anatomy. 


363 

ESU Courses

ESU Courses 


Thus, we will first give precise information on the anatomy of the prostate, the sphincter muscle, fascias 

and the bundles in order to have a better understanding of the operative laparoscopic anatomy. The experts 

will then go through each step of the surgery. For this, short well-selected video clips will be presented and 

discussed e.g. the best way to perform the space for the extraperitoneal approach, how to spare the bladder 

neck, to make easy dorsal vein complex control, the apical dissection and the anastomosis. Different aspects 

(interfascial, intrafascial) of nerve-sparing surgery will be addressed. The participants will be aware of the 

risk of complications or difficulties for each part of the procedure. The tricks for shortening the operative time 

will also be discussed. Finally, complications and their management will be addressed and discussed on the 

basis of real cases. At the end of the session, the participants, if they are beginners, should have a better 

comprehension of each step of the technique. If they are experienced, the course should help to improve 

their technique by picking out some important tricks. 






ESU Course 33 

12.00 - 15.00 Modern management of BPH 


Introduction/scene setting BPH 2013 


Assessment and medical management 


Surgical management – Electrosurgery 


Chair: K.M. Anson, London (GB) 

Surgical management – Lasers and less invasive options 

R.M. Kuntz, Berlin (DE) 

Case presentations 



• To help delegates understand the basic principles behind the assessment of a BPH patient 

• To summarise the evidence base for both the medical and surgical management of BPH 

• To help delegates understand the patient factors that influence treatment choices using case presentations 

and delegate participation 

• To debate the different health care system factors across Europe that influence patient and surgeon choice 

of treatment modalities 






365 

ESU Courses

ESU Courses 



ESU Course 34 

12.00 - 14.00 Urinary tract and genital trauma 


Introduction 


Blunt and penetrating renal trauma 


Chair: L. Martínez Piñeiro, Madrid (ES) 

Ureteric, bladder, and genital (penile and testicular) trauma. Aetiology, diagnosis and treatment 



1. To review the current classifications of renal, bladder and genital trauma 

2. To outline the principles of diagnosis and management of renal, bladder and genital trauma 

3. To provide a clearer understanding of the role of the treatments which are available for specific patient 

scenarios 

4. To interact with the audience and discuss together management and treatment of real cases 

Participants of the course will obtain a clear view on the current management of blunt and penetrating 

injuries affecting the kidney, bladder or genitals in contemporary clinical practice. 

More than 50% of the time of the course will be spent with the discussion of real clinical cases. 






ESU Course 35 

12.00 - 14.00 Ultrasound for the urologist - TRUS and TRUS guided biopsies 


Indications for TRUS and biopsy 

P. Hammerer, Braunschweig (DE) 

Chair: P. Hammerer, Braunschweig (DE) 

Practical aspects of TRUS and TRUS guided biopsies 


Indications for rebiopsy 


Update on new technical developments 



The purpose of this ESU course is to define the optimal transrectal ultrasound and to discuss new ultrasound 

techniques for prostate cancer detection, as well as defining a new standard for transrectal ultrasoundguided 

prostate biopsies. In addition, techniques to reduce morbidity and to increase patient acceptance will 

be discussed. Transrectal ultrasound has been performed for more than 15 years, and this technique is now 

an important part of prostate cancer diagnosis and staging. Anatomic studies of prostatectomy specimens 

that defined the zonal anatomy of the prostate and provided a detailed mapping of the tumour location 

have increased our understanding of transrectal ultrasound images, as well as enabling optimal placement 

of the biopsy needles. The stage migration revealed by PSA-based screening has resulted in most tumours 

being non-palpable at diagnosis. Therefore in the PSA arena, with tumours at an early stage (non-palpable 

and sometimes ultrasonografically isoechoic) transrectal ultrasound is needed to enable sampling of all 

relevant areas of the prostate including those that appear normal. The systematic sampling of the prostate 

by the sextant biopsy technique improved the detection rate of prostate cancer over sampling hypoechoic or 

palpable suspicious lesions. However, in men with initially negative biopsies a second set of sextant biopsies 

will be positive in about 20-30%. Several groups have demonstrated that the sextant technique is inadequate 

for sampling of larger prostates and they advocated additional samples. Will an increase of prostate biopsies 

result in patient discomfort? Although some studies report no additional morbidity from the more extensive 

biopsy protocols, it seems likely that discomfort for the patient would be increased. What can be done to 

reduce pain and discomfort and improve tolerance for additional biopsies? Simple and efficacious methods 

are now available to provide anaesthesia in men undergoing prostate biopsies. 






367 

ESU Courses

ESU Courses 



ESU Course 36 

12.00 - 15.00 Laparoscopic and robot-assisted laparoscopic radical cystectomy 


Chair: P. Wiklund, Stockholm (SE) 

Introduction laparoscopic cystectomy; Pre-surgery considerations 


Introduction robot-assisted laparoscopic cystectomy 


Female cystectomy 


Male cystectomy 


Lymph node dissection 


Extracorporeal urinary diversion 


Intracorporeal urinary diversion 


Outcome after laparoscopic cystectomy; Oncological, functional and complications 


Outcome after robot-assisted laparoscopic cystectomy; Oncological, functional and complications 



At the conclusion of this educational activity, participants should be able to: 

• Identify the current indications and contraindications for laparoscopic and robot assisted laparoscopic 

radical cystectomy with extended lymph node dissection. 

• Illustrate the operative steps and techniques for laparoscopic and robot assisted laparoscopic radical 

cystectomy and extended pelvic lymph node dissection. 

• Identify the current indications and contraindications for laparoscopic and robot assisted laparoscopic 

creation of an intracorporeal and extracorporeal urinary diversion. 

• Discuss surgical tricks and tips learned from review of video clips of laparoscopic and robot assisted 

laparoscopic radical cystectomy. 






ESU Course 37 

14.30 - 16.30 Post-surgical urinary incontinence in males 


Etiology and workup 

F.A. Van der Aa, Leuven (BE) 

Chair: M.M. Fisch, Hamburg (DE) 

Management of overactive bladder and conservative management of stress incontinence 

F.A. Van der Aa, Leuven (BE) 

Surgical management of stress incontinence 





Post-surgical incontinence has a severe impact on the social life of the patient. This course will answer 

the questions, how much and which investigations are needed for an adequate diagnosis and what the 

therapeutic options are that can we offer to the patient. The available conservative therapy is described and 

data on success and failure rates are provided. There is also a focus on new and alternative treatment options. 

The surgical procedures to solve the problem are presented and data of the literature critically analysed. An 

important part of the course will be the interactive case discussion with the panel and participants. 

At the end of the course the participants should know: 

• How to diagnose post surgical urinary incontinence and how to make symptoms objective 

• Which conservative therapy should be offered and for how long 

• Which operative procedures will provide the best long-term results for the individual situation of the 

patient 






369 

ESU Courses

ESU Courses 



ESU Course 38 

14.30 - 16.30 General neuro-urology 


Introduction 


Diagnostics 


Therapy 



Chair: F.R. Cruz, Porto (PT) 


The course aims at introducing neuro-urology to urologists and other caregivers in training and at refreshing 

the topic to those who consider this subspeciality important for their current clinical practice. 

For many urologists neuro-urology is a less well known subspeciality that is considered less appealing 

due to the use of a specific terminology, methods of diagnosis and evaluation and a treatment that very 

frequently requires individualisation. For many urologists neuro-urology is not part of their training. However 

as patients with micturition problems of neurogenic cause have nowadays a life span very close to that of 

normal individuals, expertise in this field will be an inevitable requisite for the average urologist. 

Terminology has been updated in recent years and its familiarity is necessary not only in order to facilitate 

communication between caregivers but also to increase access to relevant literature. This will be the object of 

a complete review. Investigation is a decisive part of the management of patients with micturition problems 

of neurogenic origin. This is not intended as a urodynamic course but rather as a useful session in which the 

use of urodynamic and other tools will be clarified. Finally, management of these patients will be reviewed, 

from the more classic to the more experimental approaches, always keeping in mind that the expected 

audience will be the average urologist who is willing to increase their knowledge in the field. Thus the 

different therapeutic approaches will be presented in a more practical and useful way instead of a classical 

pharmacological approach. This is expected to facilitate the transfer the available information into everyday 

practice. Particular attention will be given to the use of botulinum toxin. Ultimately, different conditions will 

be simulated in order to rehearse the main topics. 

By the end of the course it is expected that participants will be able to adequately investigate and manage 

the most frequent neuro-urological situations. 






ESU Course 39 

14.30 - 17.30 Percutaneous nephrolithotripsy (PCNL) 


Chair: E. Liatsikos, Patras (GR) 

PCNL instrumentation – Suite organisation, wires, dilators and lithotriptors 


From Skin to Stone: Step-by-Step access using only fluoroscopy (Prone position) 


From Skin to Stone: Step-by-Step access using US and fluoroscopy (Supine position) 


MiniPerc - Indications, equipment and technique 


Management of complications; In the OR and in the wards 


Tips and tricks in PCNL 


PCNL versus ESWL versus URS: The debate continues 


Analysis of demanding / unusual cases 


Round table discussion 

Faculty 


The objective of the course is to provide an overview of the key points of PCNL technique and its 

implementation. A step-by-step approach to access methods will be emphasized, allowing beginners to 

familiarize themselves with the details of the techniques. The debate surrounding optimal patient positioning 

will be addressed, with extensive information on prone and supine PCNL techniques. A presentation on 

MiniPerc will showcase the equipments and indications of this alternative method. The identification and 

management of immediate and delayed complications will be reviewed. Also, challenging PCNL cases will 

be presented, demonstrating the frontiers of PCNL for experienced surgeons. Finally, tips and tricks of the 

technique will be shown, offering practical shortcuts to frequent problems encountered in PCNL. 






371 

ESU Courses

ESU Courses 



ESU Course 40 

14.30 - 17.30 Single port – NOTES and minilaparoscopy: Is this the way to go? 


Instrumentation - Access 

A. Rane, Redhill (GB) 

Chair: A. Rane, Redhill (GB) 

Nephrectomy: Single port, hybrid techniques 


Pyeloplasty: Sinlge port, hybrid technique 


Adrenalectomy: Single port 


Partial nephrectomy: Single port, hybrid technique 


Robotic single port: Upper tract, prostatectomy 


Complications - How do we avoid them? 


Why single port? Are you convinced? 



The objective is to introduce single port surgery principles to the attendees. The presentations are made 

in a step by step fashion so that everyone can have a clear idea of the procedures, and can be exposed to 

tips and tricks that would make these procedures more appealing to them. The true indications of single 

port are presented as well as its integration with other hybrid procedures. Three mm instruments or hybrid 

tansvaginal approach are also issues that are addressed. The main purpose of this course is to convince the 

attendees about the usefulness and feasibility of single port surgery and its combination with other hybrid 

procedures. Single port surgery should not be considered a “mission impossible” and this is certainly the 

main goal of our endeavor. 





ESU Hands-on, 16 March 

09.00 - 10.30 ESU/ESUT Hands-on training in Green light laser vaporisation; 

Technique and standard cases - Basic course 1 

Turquoise Hall 2 - Level N-1 

Chairs: G.H. Fournier, Brest (FR) 

J.A. Thomas, Bridgend (GB) 

C.M. Capitan Manjon, Madrid (ES) 


TBC 


The European School of Urology (ESU) and the European Section of Uro-Technology (ESUT) offer an intensive 

hands-on training course with different models focussing on the endoscopic management of LUTS. The 

delegates will be taken through a sequential programme of Green-light-laservaporisation using virtual 

reality models. A video demonstrating the different steps and tasks of the procedures will be presented 

and afterwards the delegates will be instructed according to their level of experience in small teams at 

the models. Finally, all remaining questions can be answered and discussed with all tutors including the 

demonstration of tips and tricks. 

Registration fee excluding VAT € 25 

Supported by an unrestricted educational grant from AMERICAN MEDICAL SYSTEMS 


373 

ESU Hands-on

ESU Hands-on 






Chairs: G.H. Fournier, Brest (FR) 

J.A. Thomas, Bridgend (GB) 



TBC 










Supported by an unrestricted educational grant from AMERICAN MEDICAL SYSTEMS







F. Schiefelbein, Wurzburg (DE) 

U. Witzsch, Frankfurt am Main (DE) 

TBC 












375 

ESU Hands-on

ESU Hands-on 








F. Schiefelbein, Wurzburg (DE) 

U. Witzsch, Frankfurt am Main (DE) 

TBC 












09.00 - 10.30 ESU/ESUT Hands-on training Endourology course 1 

Amber 5 - Level S2 

Chair: N.N-P. Buchholz, London (GB) 




T. Sulser, Zurich (CH) 


Laparoscopic procedures are continuously evolving in urology based on the increasing expertise of urologic 

surgeons. This includes ablative procedures, such as radical nephrectomy as well as reconstructive 

techniques, such as pyeloplasty. Some advanced procedures (i.e. radical prostatectomy, radical cystectomy) 

have both, ablative and reconstructive steps. Since the number of centres with laparoscopic expertise is 

still limited in Europe, laparoscopic training programmes have become very important. Hands-on training 

courses at the pelvi-trainer represent one of the main steps of such courses. Finally, all remaining questions 

can be answered and discussed with all tutors including the demonstration of tips and tricks. 


Supported by an unrestricted educational grant from OLYMPUS EUROPA HOLDING GMBH 


377 

ESU Hands-on

ESU Hands-on 


11.00 - 12.30 ESU/ESUT Hands-on training Endourology course 2 



Chair: R. Muschter, Rotenburg (DE) 

A.J. Gross, Hamburg (DE) 

A.G. Martov, Moscow (RU) 

P. Rischmann, Toulouse (FR) 

G.G. Tailly, Brasschaat (BE) 










Supported by an unrestricted educational grant from OLYMPUS EUROPA HOLDING GMBH


09.00 - 11.00 ESU/ESUT Hands-on training Laparoscopy course 1 


Chair: D. Teber, Heidelberg (DE) 

R.T. Bardan, Timisoara (RO) 


U. Nagele, Hall in Tirol (AT) 

L. Tunc, Ankara (TR) 










Supported by an unrestricted educational grant from KARL STORZ GMBH & CO.KG and COOK MEDICAL 


379 

ESU Hands-on

ESU Hands-on 





Chair: E. Liatsikos, Patras (GR) 

P. Chlosta, Wroclaw (PL) 

B. Guillonneau, Paris (FR) 


C. Schwentner, Tübingen (DE) 










Supported by an unrestricted educational grant from KARL STORZ GMBH & CO.KG and COOK MEDICAL




Chair: M. Burchardt, Greifswald (DE) 

A.S. Gözen, Heilbronn (DE) 

A. Minervini, Florence (IT) 


B.S.E.P. Van Cleynenbreugel, Leuven (BE) 










Supported by an unrestricted educational grant from OLYMPUS EUROPA HOLDING GMBH 


381 

ESU Hands-on

ESU Hands-on 





Chair: F. Gaboardi, Milan (IT) 

T. Kalogeropoulos, Athens (GR) 

P. Macek, Prague (CZ) 


TBC 










Supported by an unrestricted educational grant from OLYMPUS EUROPA HOLDING GMBH


09.00 - 10.30 ESU/ERUS Hands-on training on Robotic surgery course 1 


Chair: H.G. Van Der Poel, Amsterdam (NL) 

N.M. Buffi, Genova (IT) 

N.D. Doumerc, Toulouse (FR) 

N.S. Patel, Oxfordshire (GB) 


The European School of Urology (ESU) and the EAU Robotic Urology Section (ERUS) offer an intensive handson 

training course. We will provide training using simulators. The main aims of this 90 minutes course are: 

improving the participants´ control-skills and hand-eye-coordination, as well as an objective benchmarking 

of console performance and an introduction into standardized surgical steps in robot-assisted procedures. 

Therefore, each course is limited to the small number of 8 participants, to facilitate an optimal training 

setting with only 2 participants per faculty. 


Supported by an unrestricted educational grant from INTUITIVE SURGICAL and MIMIC 


383 

ESU Hands-on

ESU Hands-on 





Chair: J.H. Witt, Gronau (DE) 

N.M. Buffi, Genova (IT) 

N.D. Doumerc, Toulouse (FR) 

N.S. Patel, Oxfordshire (GB) 









Supported by an unrestricted educational grant from INTUITIVE SURGICAL and MIMIC


12.00 - 15.00 ESU Hands-on training course on Urodynamics 

Amber Hall 6 - Level S2 

Chair: H. Hashim, Bristol (GB) 


J. Ellis Jones, Bristol (GB) 

A. Gammie, Bristol (GB) 


This workshop aims to provide a practical course offering an interactive “hands-on” environment for doctors, 

nurses and technicians to improve their skills in urodynamics, with an emphasis on practical aspects 

including equipment used, interpretation of traces, quality control and trouble-shooting. The use of recorded 

tests, access to equipment and small groups means that individual problems can be addressed. All the 

speakers are involved in similar “hands-on” courses, which have ran successfully in the United Kingdom 

and abroad. The small group format has been shown to work well in addressing individual needs. Access to 

teaching aids and equipment will simulate the clinical scenario as much as possible within the constraints 

of the conference setting. At the end of the workshop delegates should feel more confident in their practice 

of urodynamics. 


Supported by an unrestricted educational grant from MEDIWATCH 


385 

ESU Hands-on

ESU Hands-on 


14.00 - 15.30 ESU/ESUT/EULIS Hands-on training Ureterorenoscopy course 1 



Chair: A. Skolarikos, Athens (GR) 


G. Giusti, Milan (IT) 

P. Krombach, Mannheim (DE) 


The European School of Urology (ESU), the EAU Section of Uro-Technology (ESUT) and the EAU Section 

of Urolithiasis (EULIS) offer an intensive hands-on training course with different models focussing on the 

endoscopic management of urolithiasis. The delegates will be taken through a sequential programme of 

Ureterorenoscopy using normal endoscopic instruments in different models. The use of various guide-wires, 

baskets and intracorporeal lithotripters will be demonstrated. The ESUT and the EULIS faculty consist of 

experienced surgeons in the field of Ureterorenoscopy. A video demonstrating the different steps and tasks 

of the procedures will be presented and afterwards the delegates will be instructed according to their level 

of experience in small teams at the models. Finally, all remaining questions can be answered and discussed 

with all tutors including the demonstration of tips and tricks. 




09.00 - 10.30 ESU/ESUT/EULIS Hands-on training Ureterorenoscopy course 2 


Chair: P.J. Osther, Fredericia (DK) 



B. Turna, Izmir (TR) 


The European School of Urology (ESU), the EAU Section of Uro-Technology (ESUT) and the EAU Section 

of Urolithiasis (EULIS) offer an intensive hands-on training course with different models focussing on the 

endoscopic management of urolithiasis. The delegates will be taken through a sequential programme of 

Ureterorenoscopy using normal endoscopic instruments in different models. The use of various guide-wires, 

baskets and intracorporeal lithotripters will be demonstrated. The ESUT and the EULIS faculty consist of 

experienced surgeons in the field of Ureterorenoscopy. A video demonstrating the different steps and tasks 

of the procedures will be presented and afterwards the delegates will be instructed according to their level 

of experience in small teams at the models. Finally, all remaining questions can be answered and discussed 

with all tutors including the demonstration of tips and tricks. 




387 

ESU Hands-on

ESU Hands-on 



Technique and large adenoma - Advanced course 1 



Chair: G. Muir, London (GB) 



F. Gomez Sancha, Madrid (ES) 

TBC 




delegates will be taken through a sequential programme of Green-light-laservaporisation using a virtual 

reality model, especially focussing on more complicated applications (ie large intravesical obstructing middle 

lobes, patients under anti-coagulation, cardiological considerations) A video demonstrating the different 

steps and tasks of the procedures will be presented and afterwards the delegates will be instructed according 

to their level of experience in small teams at the models. Treatment of high risk patients will be discussed 

(anticoagulant). Finally, all remaining questions can be answered and discussed with all tutors including the 








Chair: G. Muir, London (GB) 



F. Gomez Sancha, Madrid (ES) 

TBC 














389 

ESU Hands-on

ESU Hands-on 






Chair: A. Bachmann, Basel (CH) 

N. Barber, Canterbury (GB) 

S. Carl, Emmendingen (DE) 

TBC 








to their level of experience in small teams at the models. Treatment of high risk patients will be discussed ( 

anticoagulant ). Finally, all remaining questions can be answered and discussed with all tutors including the 








Chair: A. Bachmann, Basel (CH) 

N. Barber, Canterbury (GB) 

S. Carl, Emmendingen (DE) 

TBC 














391 

ESU Hands-on

ESU Hands-on 


11.00 - 12.30 ESU/ESUT Hands-on training Transurethral therapy of LUTS - Bipolar 

TURP course 1 



Chair: C.M. Scoffone, Turin (IT) 



TBC 


The European School of Urology (ESU) and the EAU Section of Uro-Technology (ESUT) offer an intensive handson 

training course with different models focussing on the endoscopic management of LUTS. The delegates 

will be taken through a sequential programme of Bipolar TURP using normal endoscopic instruments in 

different models. A video demonstrating the different steps and tasks of the procedures will be presented 







13.00 - 14.30 ESU/ESUT Hands-on training Transurethral therapy of LUTS - Bipolar 

TURP course 2 


Chair: V. Bucuras, Timisoara (RO) 

A. De La Taille, Creteil (FR) 

S. Gravas, Larissa (GR) 

A. Lapini, Florence (IT) 


The European School of Urology (ESU) and the EAU Section of Uro-Technology (ESUT) offer an intensive handson 

training course with different models focussing on the endoscopic management of LUTS. The delegates 

will be taken through a sequential programme of Bipolar TURP using normal endoscopic instruments in 

different models. A video demonstrating the different steps and tasks of the procedures will be presented 







393 

ESU Hands-on

ESU Hands-on 





Chair: C.M. Annerstedt, Stockholm (SE) 

F. Annino, Arezzo (IT) 

G. De Naeyer, Aalst (BE) 

C. Wijburg, Arnhem (NL) 









Supported by an unrestricted educational grant from INTUITIVE SURGICAL and MIMIC




Chair: H. John, Winterthur (CH) 

F. Annino, Arezzo (IT) 

G. De Naeyer, Aalst (BE) 

C. Wijburg, Arnhem (NL) 









Supported by an unrestricted educational grant from INTUITIVE SURGICAL and MIMIC 


395 

ESU Hands-on

Webcasts of sponsored sessions have been approved by the sponsoring company. 

The EAU is not responsible for the content of these webcasts.

Friday, 15 March 

Sponsored Session 

16.15 - 17.45 Extending survival outcomes in RCC and CRPC: Current evidence and 

future horizons 


Symposium 

Chair: B. Tombal, Brussels (BE) 

What can we learn from the latest data in RCC? 


How should we tailor the RCC treatment strategy for individual patients? 

C. Porta, Pavia (IT) 

Unmet treatment needs in CRPC: Where are we now? 

S. Gillessen, St. Gallen (CH) 

Future horizons in CRPC: Where are we going? 


Panel discussion and meeting close 



• Review recent progress in metastatic Renal Cell Carcinoma (RCC) and Castration-Resistant Prostate Cancer 

(CRPC), with particular focus on survival improvements, and in managing bone metastases in CRPC. 

• Evaluate current unmet needs in these disease settings, and consider where additional treatment options 

are required to improve patient care. 

• Examine how the latest data in RCC, and emerging agents in CRPC, will help shape future treatment 

paradigms. 

Sponsored by BAYER HEALTHCARE 


397 

Sponsored Sessions

Sponsored Sessions 




16.15 - 17.45 New data in metastatic RCC: Applying the evidence to clinical practice 


Symposium 

Chair: A. Mejean, Paris (FR) 

Welcome and introduction 

A. Mejean, Paris (FR) 

First-line treatment selection: Weighing up the evidence 

T. Powles, London (GB) 

Impact of treatment decisions: The patient experience 

P. Schöffski, Leuven (BE) 

Applying the latest evidence to clinical practice 


I. Duran, Madrid (ES) 

Q&A session 





• To review the latest head-to-head data in mRCC and explore the clinical implications through patient case 

discussions 

• To highlight the importance of proactive detection and management of side-effects 

• To discuss the importance of taking a holistic approach to treatment decisions 

Sponsored by GLAXOSMITHKLINE ONCOLOGY



16.15 - 17.45 Urological challenges in managing patients with angiomyolipoma 

(AML) 


Symposium 

Chair: K. Budde, Berlin (DE) 


K. Budde, Berlin (DE) 

Case study presentation: Surgical option for the treatment of AML 

A.L. Serra, Zurich (CH) 

Overview of AML and the urologic challenges 

B. Zonnenberg, Utrecht (NL) 

Clinical data on mTOR inhibition for the management of AML 

K. Budde, Berlin (DE) 

Integrating surgical approaches with pharmacotherapy in the management of AML 

M. Staehler, Munich (DE) 

Case study: Individualising care for patients with TSC 

A.L. Serra, Zurich (CH) 



• Increase understanding of current treatment approaches for the management of AML; the unmet needs; 

and integration of current therapeutic approaches for the treatment of angiomyolipomas (AMLs) for 

improved patient outcomes 

• Increase the understanding of advances in the molecular basic of AML and the potential for integrating 

pharmacotherapy into the management of AML 

• Highlight the importance of treatment selection on an individualized, case-by-case basis 

Sponsored by NOVARTIS ONCOLOGY 


399 

Sponsored Sessions





16.15 - 17.45 Innovations in clinical urology 


Symposium 

Chair: B. Malavaud, Toulouse (FR) 

Digital FURS loves big stones 


A balanced review of PDD and NBI in bladder cancer 


Plasma-button long-term outcomes and recent advances - A ‘green light’ to become standard BPH treatment 

in 2013? 

B. Geavlete, Bucharest (RO) 

The potential benefits of 3D laparoscopy for EERPE 


Complex renal surgery using 3D vision 



Discover clinical innovations by Olympus. The Olympus symposium will focus on innovations in clinical 

urology: 3D Laparoscopy, beyond laser; TUR with bipolar plasma, improving NMIBC detection by NBI and the 

latest in stone management. We look forward to your participation. 

Sponsored by OLYMPUS



16.15 - 17.45 Metastatic castration-resistant prostate cancer: Integrating new 

learnings to optimise treatment outcomes 


Symposium 

Chair: J.M. Fitzpatrick, Dublin (IE) 


J.M. Fitzpatrick, Dublin (IE) 

The evolving mCRPC landscape: Challenges and opportunities 

N. Mottet, Saint Etienne (FR) 

The androgen signaling pathway in mCRPC: Implications in daily practice 


Tailoring therapy to optimise treatment outcomes in mCRPC 

S. Oudard, Paris (FR) 

Managing mCRPC in real life practice 

A. Bahl, Bristol (GB) 




The objectives of this symposium are (1) to discuss the current and emerging treatment options in metastatic 

castration-resistant prostate cancer, (2) to reach a better understanding of the complexity of androgen 

receptor signaling pathway and how these new agents interfere with it, and (3) to share views on how to 

best sequence or combine available therapies. 

Sponsored by SANOFI 


401 

Sponsored Sessions


Saturday, 16 March 



18.00 - 19.30 Navigating the new landscape in CRPC 


Symposium 

Chairs: A. Heidenreich, Aachen (DE) 

C.N. Sternberg, Rome (IT) 

Introduction to symposium 


CRPC: The rationale for targeting the androgen receptor 

J.A. Schalken, Nijmegen (NL) 

New and emerging post-chemotherapy CRPC treatments: Clinical experience 


Implications of the evolving pre-chemotherapy landscape 


Interactive Q&A discussion session: Optimising patient care in the new CRPC era 


Closing summary 



• To provide the rationale for targeting the androgen receptor in CRPC 

• To present clinical experience of new and emerging therapies in patients with CRPC who have received 

prior chemotherapy 

• To highlight and discuss the implications of emerging treatments for patients with CRPC who have not 

received prior chemotherapy 

• To discuss the potential impact of new and emerging therapies on the CRPC treatment landscape, patient 

pathway and the dynamics of the multidisciplinary team 

Sponsored by ASTELLAS



18.00 - 19.30 LUTS/BPH and sexual health - Bridging the gap 


Symposium 

Chair: H. Porst, Hamburg (DE) 


H. Porst, Hamburg (DE) 

Sexual health and male LUTS - Tackling a sensitive issue 


Tadalfil 5mg once daily - Which patients benefit most? 


Discussion 

Challenging questions: Tadalafil once-daily in BPH/LUTS - and now? 




Wrap-up 



The Eli Lilly satellite symposium “LUTS/BPH and Sexual Health – Bridging the Gap” will provide insights into 

recent progress been made in the deeper understanding of the pathophysiology of male LUTS, in particular 

its strong link to erectile dysfunction and other co-morbidities. 

A wealth of evidence has been published on innovative pharmacological approaches for male LUTS, recently 

having led to the approval of Tadalafil 5 mg once daily, for the treatment of the signs and symptoms of 

benign prostatic hyperplasia in adult males’, in addition to the existing indication for erectile dysfunction. 

The faculty will discuss the pathophysiological link of ED and LUTS/BPH, the current spectrum of available 

medical treatment options for LUTS/BPH with a particular focus on sexual quality of life and will define their 

position on the expected role of Tadalafil 5 mg once daily in the current treatment algorithm for male LUTS. 

Sponsored by ELI LILLY AND COMPANY 


403 

Sponsored Sessions





18.00 - 19.30 Risk stratification to optimize the management of men with 

symptomatic BPH at risk of progression 


Symposium 

Chair: V. Mirone, Naples (IT) 

Session outline 


Why is BPH progression important and how can we use risk factors to identify patients at risk of 

progression? 


What is the evidence for treating patients with BPH based on their risk of progression? 

M. Emberton, London (GB) 

Benefit/risk of treatments for patients with BPH at risk of progression 

G. Andriole, St. Louis (US) 

Case study discussions: Implications in daily practice for BPH management 

Q&A session 


To evaluate and argue on the risk/benefit profile of currently recommended medical treatment options for 

patients at risk of BPH progression debating the most recent scientific evidence and with a focus to the latest 

evidence on risk factors that categorize BPH as a progressive disease and risk stratification that allows the 

right allocation of treatment to patients 

Sponsored by GLAXOSMITHKLINE



18.00 - 19.30 Increasing evidence of effectiveness of GAG therapy in different forms 

of cystitis 


Symposium 

Chair: P.F. Bassi, Rome (IT) 

The scenario of bladder dysfunctions: Insights into the therapeutic potential of GAG therapy 

P.F. Bassi, Rome (IT) 

Management of interstitial cystitis/bladder pain syndrome with GAGs 

M. Cervigni, Rome (IT) 

Efficacy of GAGS treatment in chemical and radiation cystitis 

E. Finazzi Agro, Rome (IT) 

Management of recurrent urinary tract infections with IALURIL® 

R. Damiano, Catanzaro (IT) 

Clinical experience with IALURIL®: Results of a multicentric survey 

R. Tomaskin, Martin (SK) 

Final remarks 

P.F. Bassi, Rome (IT) 

Discussion 


Glycosaminoglycan (GAG) therapy is now being studied for the treatment of a wide variety of acquired and 

inherited diseases in different therapeutic areas, including bladder disorders such as urinary tract infections, 

painful bladder syndrome/interstitial cystitis, cystitis following radiation therapy or chemical agents. 

The positive outcomes obtained with a combination of hyaluronic acid and chondroitin sulphate administered 

intravesically in patients with an history of bladder damage, with the aim of restoring the integrity of the 

glycosaminoglycan layer of the urothelium, suggest that such therapeutic approach might be beneficial. A 

faculty of experts will review the results of the recent clinical investigations with this GAG combination and 

discuss its therapeutic applications. 

Sponsored by IBSA INSTITUT BIOCHIMIQUE 


405 

Sponsored Sessions





18.00 - 19.30 Transurethral resection of bladder tumor: How to reach excellence 


Symposium 

Chair: M. Brausi, Modena (IT) 

Introduction 


Improving the diagnosis and treatment of non-muscle invasive bladder cancer (NMIBC) 


Reviewing the data: The hexaminolevulinate-guided blue light cystoscopy metaanalysis 


Blue-light cystoscopy for treatment of NMIBC: Further cost-effectiveness analysis 


New developments in instillation therapy 

S.M. Di Stasi, Rome (IT) 

Tying it together: Reaching excellence 



The goal of this symposium is to present recent developments in the diagnosis and treatment of nonmuscle 

invasive bladder cancer (NMIBC) and discuss how these can impact the patient’s prognosis. Accurate 

diagnosis, staging and treatment of NMIBC could be more important than any possible adjuvant therapy. 

An increasing body of data shows that blue-light cystoscopy is extremely helpful in improving diagnosis 

accuracy and reducing the recurrence rate. In this symposium this new modality and alternative treatments 

of NMIBC will be described and discussed. New data on cost-effectiveness of blue-light cystoscopy will be 

presented and commented. Interaction will be the main characteristic of the symposium. 

Sponsored by IPSEN



18.00 - 19.30 Holmium Life Enhancing Plan (HoLEP) - The real BPH lifetime solution 


Workshop 

Chair: T. Aho, Cambridge (GB) 

Introduction 

T. Aho, Cambridge (GB) 

Tips on getting started: Business plan, equipment, instruments, training 

G. Rix, Colchester (GB) 

Why HoLEP - How he has chosen HoLEP 


HoLEP technique: Surgical videos and animation 

I. Vavassori, Treviglio (IT) 

HoLEP for very large prostates, urinary retention, anticoagulated patients. Tips and literature review 

R.M. Kuntz, Berlin (DE) 

A review of the RCTs 

M. Cynk, Tunbridge Wells (GB) 

Comparison of laser techniques for BPH (illustrated with videos) 


Conclusions and discussion 



The aim of our symposium is to provide the urologists a better understanding of the HoLEP (Holmium Laser 

Enucleation of the Prostate). HoLEP is the only technique for the treatment of BPH (Benign Prostate Symptoms) 

with clinical publications of 10 year follow up. During the symposium, some experts from different regions 

around Europe, will cover all the relevant points of HoLEP. We want to show that HoLEP is the gold standard 

of BPH treatment and a lifetime solution to the patients. 

Sponsored by LUMENIS 


407 

Sponsored Sessions





18.00 - 19.30 Premature ejaculation treatment: New perspectives for the couple 


Symposium 

Chair: I. Moncada, Madrid (ES) 

Opening and welcome 


Premature ejaculation: Looking beyond a male sexual dysfunction 

A. Graziottin, Milan (IT) 

Premature ejaculation diagnosis and treatment in daily practice 


Premature ejaculation on demand treatment with dapoxetine: From clinical evidence to real practice 

D.G. Hatzichristou, Thessaloniki (GR) 

Q&A and closing remarks 



Premature Ejaculation (PE) is the most prevalent male sexual dysfunction that affects multiple dimensions 

of the patient’s life, ranging from personal to relational domains, with a major effect on couple sexual 

relationship as demonstrated by observational studies. Despite of that, significant barriers to obtaining 

assistance from physicians exist and PE remains often under-diagnosed and consequently under-treated so, 

further efforts to promptly identify and approach PE are required. 

Dapoxetine is a fast-acting SSRI, specifically developed for the on demand treatment of PE. Its clinical efficacy 

and safety have been demonstrated in 5 phase III clinical trials that involved 6,081 men diagnosed with PE, 

in over 25 countries, showing an improvement in IELT and subjective measures of perceived amelioration in 

terms of control over ejaculation, satisfaction with sexual intercourse, personal distress and interpersonal 

difficulty. Recent trials provided interesting findings on the effect of Dapoxetine in daily practice, strengthen 

its positive safety profile and provide a preliminary picture of the trend of utilization in real life. 

Sponsored by MENARINI

Sunday, 17 March 


17.45 - 19.15 Urinary incontinence - Optimising the patient experience and 

improving outcomes 


Workshop 

Chair: K.P. Jünemann, Kiel (DE) 

Introduction and welcome 

K.P. Jünemann, Kiel (DE) 

Injecting with DIGNITY in the long term 


Injecting tips for managing urinary incontinence with botulinum toxin type A 

M. Spinelli, Milan (IT) 

Injecting with botulinum toxin type A in the bladder and BoNee® needle - Patient case video 


Injecting to improve patient outcomes - Standardisation of the procedure 

G. Karsenty, Marseille (FR) 

Chair summary and close 



• Provide an update and review the DIGNITY long-term extension study data 

• Presentations of practical guidance on the use of botulinum toxin type A for neurogenic detrusor overactivity 

(NDO) in clinical practice 

• Demonstration, via a pre-filmed injection video, of botulinum toxin type A injection procedure in the 

bladder 

• Discussions on standardising the injection technique, including appropriate needle selection, in order to 

improve outcomes 

Sponsored by ALLERGAN and PORGÈS, a COLOPLAST division 


409 

Sponsored Sessions





17.45 - 19.15 Management of OAB: Electing the right candidate for the right patient 


Symposium 

Chair: M.J. Speakman, Taunton (GB) 

Chairman’s introduction 


Historic milestones in the management of OAB 


The heritage party policy 

I. Milsom, Gothenburg (SE) 

F. Haab, Paris (FR) 

The new party policy 



Putting policies into practice - case study discussion 






Closing remarks from each party 



Chairman’s summary 



With the arrival of additional therapeutic options for OAB, this symposium will provide a topical and 

interactive evaluation of current and future treatments and consider how they may fit in future treatment 

algorithms, utilising clinical data, experience and case studies. 

Sponsored by ASTELLAS



17.45 - 19.15 Nocturia: Definitive diagnosis for better patient outcomes 


Symposium 

Chair: P.E. Van Kerrebroeck, Maastricht (NL) 


P.E. Van Kerrebroeck, Maastricht (NL) 

Breaking the patient stereotype 

A.J. Wein, Philadelphia (US) 

What is different about nocturia? 


Non-antidiuretic vs antidiuretic pharmacotherapy for nocturia 

J. Weiss, New York (US) 

Round-up of patient case studies 

P.E. Van Kerrebroeck, Maastricht (NL) 



This Ferring Pharmaceuticals-sponsored symposium aims to provide an overview of the variety of clinical 

characteristics of patients with nocturia, and the multifactorial nature of the mechanism of the disease. The 

symposium will: 

• Provide an overview of the prevalence and consequences of nocturia (Philip Van Kerrebroeck, the 

Netherlands) 

• Discuss case studies of patients with nocturia and their diagnoses through audience interaction (Alan Wein, 

USA) 

• Review current understanding of the mechanism of nocturia and discuss treatment algorithms and 

guidelines (Matthias Oelke, Germany) 

• Summarise the evidence for efficacy of available pharmacotherapies for nocturia (Jeffrey Weiss, USA) 

Sponsored by FERRING PHARMACEUTICALS 


411 

Sponsored Sessions





17.45 - 19.15 Towards individualisation of prostate cancer treatments: From bench 

to bedside 


Symposium 

Chair: P. Hammerer, Braunschweig (DE) 

Introduction 


Learnings from breast cancer management in treatment indivualisation (biology and treatment strategy) 

G. Curigliano, Milan (IT) 

Biology on prostate cancer: Will future biomarkers kill PSA? 


A. Thompson, London (GB) 

Enhanced individualisation through new strategies in CRPC 

M. Eisenberger, Baltimore (US) 

Treatment individualisation up to patient support 



The goal of this symposium is to promote the individualized approach of prostate cancer treatment. Learning 

from the treatment individualization approach in breast cancer management could generate new possibilities 

to stratify prostate cancer with regards to its aggressiveness. The introduction of targeted therapeutics into 

the clinical therapeutic arsenal generates major opportunities for further development of cancer biomarkers. 

Finally, the arrival of new hormonal pathway targeting drugs will stimulate the development of new 

treatment strategies leading to a more individualized treatment of prostate cancer patients. 

Sponsored by IPSEN



17.45 - 19.15 Clinical conundrums in the treatment of metastatic castrationresistant 



Symposium 

Chair: P.F.A. Mulders, Nijmegen (NL) 

Moderator: C. Hood, London (GB) 

Introduction 


Defining disease progression in metastatic CRPC 


The role of corticosteroids in the treatment of metastatic CRPC 



Emerging treatment options for the chemotherapy naive patient 


Q&A session. Summary and close 






Recently a number of therapies have been approved providing more options for treatment and improving 

outcomes for men with advanced prostate cancer. The satellite symposium sponsored by Janssen 

Pharmaceutical Companies of Johnson & Johnson entitled Clinical conundrums in the treatment of metastatic 

castration-resistant prostate cancer will address key topics on the management of patients with metastatic 

castration-resistant prostate cancer (CRPC) in daily clinical practice. The different definitions of disease 

progression in metastatic CRPC, and ways in which progression in the clinic is monitored will be explored. 

The role of corticosteroids in the treatment of metastatic CRPC will be considered and the latest data for 

androgen biosynthesis inhibition in the pre-chemotherapy setting will also be presented. 

Throughout the symposium you will be invited to participate in an interactive activity to provide your views 

on key topics in management of patients with metastatic CRPC. A panel discussion is also included in the 

program to encourage you to ask questions, exchange ideas, and to share experiences relevant to everyday 

clinical practice. 

Sponsored by JANSSEN PHARMACEUTICAL COMPANIES OF JOHNSON & JOHNSON 


413 

Sponsored Sessions





17.45 - 19.15 Burden of illness and optimal management of recurrent cystitis 


Symposium 

Chair: K.G. Naber, Straubing (DE) 

Antimicrobial susceptibility and resistance in urological infections worldwide: Surveillance and prevention 


Guidelines in urinary tract infections (UTI): The place of immunoactive-prophylaxis in recurrent UTI 

management 

K.G. Naber, Straubing (DE) 

Burden of illness of recurrent UTI: Clinical benefit of oral immunostimulation and impact on patients’ quality 

of life 

B. Wullt, Lund (SE) 

Responders profile and evidence in clinical practice 



Progressive increase of antibiotic resistance is a major concern worldwide. Resistance surveillance programs 

and infection control measures may be useful in delaying resistance, but rarely capable to reduce the incidence 

of infections caused by multi-drug resistant (MDR) organisms. On the other hand, new antimicrobials will not 

likely become available before the next decade. Specifically, with regard to recurrent urinary tract infection 

(rUTI), the increasing resistance to several antibiotic classes support the need to use alternative preventative 

approaches in order to spare the limited antibiotic armamentarium. 

European Association of Urology (EAU) Guidelines recommend: i) counseling and behavioral modifications 

to eliminate modifiable risk factors for rUTI and ii) non-antimicrobial prophylaxis before any antibiotic 

prevention. Several non-antimicrobial measures that do not increase antibiotic resistance are currently 

available with different grades of recommendation according to the scientific level of evidence. 

The oral immunoactive prophylaxis with E.coli extracts (OM-89) deserves the highest grade of recommendation 

in the EAU Guidelines compared to other alternative strategies because its efficacy is sufficiently well 

documented in several randomized double blind placebo controlled studies and 2 meta-analysis. 

The immunological properties and the clinical safety and efficacy of oral bacterial lysates (OM-89) will be 

addressed in details in the symposium. Furthermore the detrimental impact of recurrent cystitis on patients’ 

quality of life will also be highlighted and the beneficial effects of the immunoactive therapy on life quality 

indicators will be presented. 

There is some evidence that specific populations, including patients at higher risk for recurrent cystitis, could 

benefit more by immunoprophylaxis but further controlled studies are desirable. In the meantime, useful 

evidence comes from daily clinical practice; some case studies will be shown and debated. 

Sponsored by OM PHARMA SA



17.45 - 19.15 BPH and inflammation, from lab to clinic 


Symposium 

Chair: R. Bartoletti, Florence (IT) 

State of the art: The link between BPH and inflammation 


Clinical approach: Why and how to evaluate prostatic inflammation? 

V. Ficarra, Padua (IT) 

Therapeutic approach: How to take charge of prostatic inflammation? 



Emerging evidence indicates that prostatic inflammation may contribute to prostate growth. During this 

symposium, the relation between inflammation and BPH will be discussed. 

Some authors found a strong correlation between the amount of inflammatory infiltrate, IPSS, prostate 

volume and BPH progression. If inflammation is correlated with BPH, the ability of detecting inflammation 

without analysing prostate tissue specimens can be discussed. Finally, it is of interest to determine if 

inflammation could be considered as a therapeutic target for BPH, and with which therapeutic approaches. 

Sponsored by PIERRE FABRE MEDICAMENT 


415 

Sponsored Sessions





17.45 - 19.15 Silodosin: A first choice for the pharmacological treatment of BPH 


Symposium 

Chair: F. Montorsi, Milan (IT) 

Opening remarks 


BPH: Where we are today 


Which patient and why - An analysis of pooled data from the phase III studies in EU and US 

H. Lepor, New York (US) 

G. Novara, Padova (IT) 

The ‘real life’ profile of the BPH patient 

H. Botto, Suresnes (FR) 

Clinical cases and discussion 


Concluding remarks 



This symposium will discuss the potential role of silodosin, a highly selective alpha 1a-antagonist, 

with reference to its usefulness as a first line pharmacological treatment of BPH. 

This innovative and interactive programme will include a review of the latest pooled data analysis from 

studies across the EU and US, highlighting the efficacy and safety of silodosin in a large patient population 

and in particular subpopulations. 

It will look at the ‘real life profile’ of a patient with BPH with a presentation emphasizing the appropriate 

clinical management of patients presenting with symptoms of LUTS/BPH. The faculty will also present 

interactive clinical cases and the audience will be encouraged to participate in the discussions around 

appropriate management of these patients. 

Sponsored by RECORDATI



17.45 - 19.15 Focal therapy in localised prostate cancer 


Symposium 

Chair: C. Stief, Munich (DE) 

Guest of honour 


Welcome and opening remarks 


Mechanism of action 


Phase II studies meta-analysis (safety, efficacy and quality of life) 


4 years results of the phase II studies/Retreatments (no loss of chance) 

E. Barret, Paris (FR) 

European phase III trial update 

A.R. Azzouzi, Angers (FR) 

Focal therapy for prostate cancer ‘a new paradigm’ 


Questions/answers and panel discussion 


The current choice for men with localized prostate cancer is either radical therapy or active surveillance. 

In the last decade a new therapeutic approach, aiming at the focal treatment of the cancer, has gained 

increasing use. 

TOOKAD ® Soluble Vascular Targeted Photodynamic (VTP) therapy is a novel focal therapeutic modality that 

enables the occlusion of the entire tumor vasculature in a few minutes of treatment, which results in the 

necrosis of the prostatic tumor. 

During this symposium, participants will hear new information regarding this new molecule: TOOKAD® 

Soluble, gain a good understanding of the mechanism of action, efficacy, safety and tolerability of the 

product, and will receive updated information on the ongoing European Phase III study. 

Sponsored by STEBA BIOTECH 


417 

Sponsored Sessions


Monday, 18 March 



17.45 - 19.15 Urinary incontinence - Optimising the patient experience and 

improving outcomes 


Workshop 

Chair: K.P. Jünemann, Kiel (DE) 

Introduction and welcome 


Injecting with DIGNITY in the long term 


Injecting tips for managing urinary incontinence with botulinum toxin type A 

M. Spinelli, Milan (IT) 

Injecting with botulinum toxin type A in the bladder and BoNee® needle - Patient case video 


Injecting to improve patient outcomes - Standardisation of the procedure 

G. Karsenty, Marseille (FR) 

Chair summary and close 



• Provide an update and review the DIGNITY long-term extension study data 

• Presentations of practical guidance on the use of botulinum toxin type A for neurogenic detrusor overactivity 

(NDO) in clinical practice 

• Demonstration, via a pre-filmed injection video, of botulinum toxin type A injection procedure in the 

bladder 

• Discussions on standardising the injection technique, including appropriate needle selection, in order to 

improve outcomes 

Sponsored by ALLERGAN and PORGÈS, a COLOPLAST division



17.45 - 19.15 Interactive debate: How seriously should I take male LUTS? 


Symposium 

Chair: K-D. Sievert, Tübingen (DE) 

Introduction 


Entertaining debate on male LUTS, covering topics you are confronted with in daily clinical practice, such as 

quality of life impairment, changing regulations and EU budget cuts 

P. Dixon, London (GB) 


R. Elliott, Nottingham (GB) 

R. Bergstrom, Brussels (BE) 


• Are you still not interested in a condition that affects most men at some point in life? 

• Do you want to be part of something completely different? 

• Do you enjoy when evidence is challenged in a dynamic way? 

Then join this debate on male LUTS, covering topics you are confronted with in daily clinical practice. 

Don’t miss the interactive and provocative keynote from Patrick Dixon, futurist and top stand-up moderator, 

proven to tell a good story!. It will change your view on male LUTS. 

Enjoy the debate “LUTS/BPH is an unimportant medical condition and no-one cares about it. Why should it 

be reimbursed?” where Patrick Dixon will challenge the faculty of 2 urologists, a health economics expert 

and the Director General of the EFPIA about issues such as changes in priorities of government budgets for 

spending on LUTS. 

Sponsored by ASTELLAS 


419 

Sponsored Sessions





17.45 - 19.15 New data on androgen deprivation with a GnRH antagonist: 

Improving patient outcomes in prostate cancer 


Symposium 

Chairs: T.M. De Reijke, Amsterdam (NL) 



Radiotherapy with androgen deprivation: A combined approach to improve outcomes 


Is intermittent androgen deprivation really equivalent to continuous therapy? 

I.J. De Jong, Groningen (NL) 

Disease control: Comparative data from degarelix vs LHRH agonists 


Cardiovascular risk and ADT: New data, new insights 

P.C. Albertsen, Farmington (US) 

Panel discussion and concluding remarks 



To present the latest data on androgen deprivation therapy for prostate cancer, in a clinically meaningful way 

that will facilitate improved patient care 

Sponsored by FERRING PHARMACEUTICALS



17.45 - 19.15 Castration-resistant prostate cancer in 2013: Analysing the good, the 

bad and the ugly 


Symposium 

Chairs: K. Miller, Berlin (DE) 



Making the most of the multidisciplinary team for castration-resistant prostate cancer (CRPC) 

S. Joniau, Leuven (BE) 

New treatment options for metastatic CRPC 

J. Bellmunt, Barcelona (ES) 

Questions & answers 

Bone metastases: A defining feature of clinical course in CRPC 


Bone-targeted therapy: A new era 

K. Fizazi, Villejuif (FR) 

Interactive faculty panel discussion 

Concluding remarks 



Target audience 

This educational activity is appropriate for urologists, radiation oncologists, clinical oncologists, medical 

oncologists, and other healthcare professionals interested in the treatment of patients with castrationresistant 

prostate cancer (CRPC). The goal of this educational activity is to improve participants’ ability to 

provide optimal medical care for patients with CRPC. 

Learning objectives 

At the conclusion of this activity, participants should be able to: 

• Evaluate strategies for effectively collaborating in a multidisciplinary team when managing patients with 

castration-resistant prostate cancer (CRPC) 

• Select optimal second-line therapies for patients with docetaxel-resistant CRPC 

• Employ best practices when managing bone metastases in men with CRPC 

• Integrate novel bone-directed therapies and approaches when treating men with CRPC 

Sponsored by PRIME ONCOLOGY 


421 

Sponsored Sessions

A new vision to understanding medicine 

Handbook of 

Clinical Gender 

Medicine 

Editors 

Karin Schenck-Gustafsson, Stockholm 

Paula R. DeCola; Donald W. Pfaff , New York, N.Y. 

David S. Pisetsky, Durham, N.C. 

In well-referenced chapters, experts cogently and concisely explain how the incorporation 

of gender issues into research can affect the medical understanding and treatment 

of heart disease, osteoporosis, arthritis, pain as well as malaria among other conditions. 

This intriguing and unique medical textbook provides readers with a valuable new perspective 

on how to incorporate gender issues into the different branches of medicine. 

• Pay-per-View and Subscriber 

• Access to Full Text 

• Full Table of Contents 

• Full Editorial Board 

• Free Abstracts and Selected Articles 

• Online Sample Issue 

• Submission/Guidelines for Authors 

• Subscription Details 

• Free Alert Service 

• Online Library Recommendation 

S. Karger AG, P.O. Box 

CH–4009 Basel 

(Switzerland) 

Fax. +41 61 306 12 34 

E-Mail orders@karger.com 

www.karger.com 

ATCCAATGATAAGCATCACGGTAT ATCCAATGATAAGCATGATAAGCTCACGGTATCCAA AATGATAAGCATCA 

GCATGATAAGCTCACGGTATCCAAT ATGATAAGCATCACGGTATCCAATGATAAGCATGAT ATAAGCTCACGGT 

GCATCACGGTATCCAATGATAAGCATGATAAGCGT 

G ATCCAATGATAAGCATCACGGTATCC CCAATGATAAG 

GTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCCACGGTATCCAATGA GATAAGCATC 

ATAAGCATGATAAGCTCACGGTATCCAATG TGATAAGCATCACGGTATCCAATGATAAGCATGATA TAAGCTCA 

GCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATC TCCAATG 

GCTCACGGTATCCAATGATAAGCATCACGGTAT ATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGA 

ATCCAATGATAAGCATGATAAGCTCACGGTATCCA CAATGATAAGCATCACGGTATCCAATGATAAGCAT ATGA 

AATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCA 

A CGGTATCCAATGATAAGCATCACGG GGT 

GCATGATAAGCTCACGGTATCCAATGATAAGCATCAC ACGGTATCCAATGATAAGCATGATAAGCTCACGGT 

GCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATG 

GCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGA GATAAGCATGATAAGCTCACGGTATCAGCATG 

ATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATA TAAGCTCACGGTATCCAATGATAAGCATCAC 

GCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATC TCCAATGATAAGCATGATAAGCTCACGGT 

GCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAG 

A CATCACGGTATCCAATG 

GCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCA CATGATAAGTCACGGTATCCAATGAT 

ATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCA CACGGTATCCAATGATAAGCATGAT 

AATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTA TATCCAATGATAAGCATCACGGT 

GCATGATAAGCCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAA TAAGCATGATAAGCTCACGGTA 

GCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAA AAGCATCACGGTATCCAATG 

GCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAG AGCTCACGGTATCCAATGA 

ATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATC TCCAATGATAAGCATGA 

AATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATG TGATAAGCATCACGGT 

GCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGA GATAAGCTCACGGT 

GCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCAC ACGGTATCCAATG 

GCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGA 

ATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGAT ATAAGCATGA 

A 

AATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCAT ATCACGGT 

GCATGATAAGCGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGT GTATCCA 

GTATCCAATGATAAGCATGATAAGCCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGC GCATG 

ATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCAT ATCA 

GCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGT 



TCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGA 

GCATCACGGTATCC 

GCATCACGGTATCC 

TGA GA 

AATGATAAGCATCACGGTATCCAATGATAAG 

CACGGTATCCAATG 

CACGGTATCCAATG 

GGT GGT 





AATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGT 

GCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGTCACGGTA 


GCCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGAT 


AAGCATGAT 

AGCATGAT 

ATCCAATGATAAG 

ATCCAATGATA TAAG 

CAATGATA 

CAATGATAA 


ATCACGGT 

GCATGATAAGCTC 

GCATGATAAGCTC 

TGATAAGC 

TGATAAGC 


GCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAAT 

CATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATG 

GCATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTA 

GCATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTAT 

ATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCA 

GTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCAT 

AATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGAT 

ATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGAT 

TCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCA 

TGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAA 

TGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAA 

GCATGATAAGCTCACGGTATCCAATGATAAGCATCACCGGTATCCAATGATAAGCATGATAAGCTCACGGT 

CGGTATCCAATGATAAGCATGATAA CTCACGGT 

GCATCACGGTATCCAATGATAAGCATGATAAGCGTATTCCAATGATAAGCATCACGGTATCCAATGATAAG 

CCAATGA AAGCATCACGGTAT CAATGATAAG 

GTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCCACGGTATCCAATGATAAGCATC 

ATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCA 

GCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGAGTATCCAAT 


ATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGA 




GCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCAGCATG 

Handbook of 

Clinical Gender 

Medicine 

Editors 

Karin Schenck-Gustafsson 

Paula R. DeCola 

Donald W. Pfaff 

David S. Pisetsky 

ACGG ACGGT ACGGT ACGGT ACGG ACGGT ACGGT ACGG AC ACG CG CG TATCCAAT TGA GA GA GAT GAT GAT GAT GAT GAT GAT ATAA AA AA AAG AA AA AA AA AA AAAG 

GCA 

ACGG ACGG ACG ACGG ACG ACGG ACGG ACG ACGG ACGG ACGG ACG ACG ACG ACG A GGT 

GTTATCCA ATCCA ATCCA ATCCA ATCCA ATCCA ATCCA ATCCA TCCA TCCA TCCA TCCA CCA CCA CCAATGATAAG 

AAAAAAAAA GCA GCA GCA GCA GCA GCATG CCA 

CA CA CA CA CATG 

TG TGA TGA TGAT TGA TG TGA TGA TGA TG GG 

TAAAG 

ATCACGGTGT 

AGCATTCACGGTAT AAAAAAACCCCCGG CCGG GGG GG ATCCAATGATA 

CCA CAAAAAAAAAAAT AT A 

AGCAT AG CACGGTATCCAATGATAAGCATGATAAG 

TATCCCAATGATA 

XVI + 522 p., 62 fig., 4 in color, 63 tab.,soft cover, 2012 

CHF 69.– / EUR 51.– / USD 69.00 

ISBN 978–3–8055–9929–0, e-ISBN 978–3–8055–9930–6 

Prices subject to change 

EUR price for Germany, USD price for USA only 

More information and sample essays at: 

www.karger.com/Gender_Medicine 

An independent international forum for clinically oriented research 

Editors 

M.P. Wirth, Dresden 

M. Porena, Perugia 

O.W. Hakenberg, Rostock 

D. Castro-Diaz, 

Santa Cruz de Tenerife 

B. Wullich, Erlangen 

More information at: 

www.karger.com/uin 

Deutsche Gesellschaft für Urologie 

KI13635

EAU Membership 

What are benefits of being 

a member of the European 

Association of Urology? 

EAU Members benefit from many advantages: 

Publications 

• European Urology, the official scientific EAU 

journal (12 issues per year, plus all published 

supplements). 

• European Urology Today, the official EAU 

newsletter (6 issues each year). This publication 

aims at distributing information about the 

Association and about European urology in the 

broadest sense. 

• European Urology Video Journal, a quarterly 

published DVD aiming to distribute the best 

information on urological diseases and techniques. 

• The EAU Urology Updates, an educational 

publication, quarterly published as a 

supplement of European Urology. 

• EAU Guidelines, a extensive series of guidelines 

on many urological diseases produced by 

the EAU Health Care Office. 

• Historia Urologiae Europaeae (one volume 

each year on European historical subjects). 

• Uroweb, the official EAU website, on which 

members have access to all different activities 

and programmes, such as slide library, 

European Urology on-line, webcasts of the 

congresses, on-line ESU courses etc. 

EAU Congress and Meetings 

EAU Members will receive regular information on the 

Annual EAU Congress, as well as the 

meetings organised by the different EAU Sections, the 

EAU Education Office and the EAU Regional Office. 

Moreover, members will be able to receive a considerable 

discount on the registration fees of all EAU related 

meetings and events. 

EAU Education Programme 

EAU Members will receive regular information on all 

the activities organised by the European School of 

Urology, the EAU Office of Education. Members will 

be able to participate in the post-graduate teaching 

activities at reduced registration fees. EAU Members 

are also entitled to apply for the European Urological 

Scholarship Programme, which provides grants and 

organises clinical fellowships, short term visits and 

scholarship programmes. 

EU-ACME Programme 

Active, Active International, Junior and Junior 

International member of the EAU will be automatically 

participating in the European Urology - Accredited 

Continuing Medical Education (EU-ACME) Programme. 

The EU-ACME Programme is based on the EBU/UEMS 

rules and its primary task is the implementation, 

promotion and organisation of Continual Medical 

Education (CME) among European Urologists. It provides 

the urologists with the system which helps them 

to keep track of their educational activities, irrespective 

of the country they practice in or where they have 

participated in CME and/or CPD activities. For more 

information see also page 46 and 47. 

So if you are not yet an EAU member, make certain to 

become one in Milan and visit the EAU Booth H17 in 

the exibition on level S0. 


423 

About EAU


EAU Offices 

EAU Board 

Executive Committee 

Secretary General 


Adjunct Secretary General 

Executive Member related to Science 


Adjunct Secretary General 

Executive Member related to 

Education 


Treasurer and Executive Member 

related to Communication 


Board Members 

C. Chapple, Sheffield (GB) 




I. Korneyev, St. Petersburg (RU) 

L. Martínez-Piñeiro, Madrid (ES) 


R. Nijman, Groningen (NL) 


K. Parsons, Liverpool (GB) 



Offices related to education 

EAU Education Office (ESU) 

Chairman 


Members 


M. Drake, Bristol (GB) 




H. Van Der Poel, Amsterdam (NL) 

J. Van Moorselaar, Amsterdam (NL) 

Consultant 



Ex-officio Members 




EU-ACME Office 

Chairman 

R. Nijman, Groningen (NL) 

Members 

M. Brehmer, Stockholm (SE) 

A. Figueiredo, Coimbra (PT) 


P. Nyirády, Budapest (HU) 



Ex-officio Member 


European Urological Scholarship 

Programme Office 

Chairman 


Past Chairman 

C-C. Abbou, Creteil (FR) 

Members 

T. Borkowski, Warsaw (PL) 

M. Burchardt, Greifswald (DE) 

M. Ribal, Barcelona (ES) 

J. Witjes, Nijmegen (NL) 




J. Schalken, Nijmegen (NL) 


Guidelines Office 

Chairman 


Members 

M. Fall, Gotenborg (SE) 

J. Irani, Poitiers (FR) 


J. N’Dow, Aberdeen (GB) 

R. Sylvester, Brussels (BE) 



Young Urologists Office 

Chairman 


Chair Italian Resident Organisation 

G. Patruno, Rome (IT) 

Chair UK Resident Organisation 

B. Grey, Salford (GB) 

Chair French Resident Organisation 

J-E. Terrier, Lyon (FR) 

Chair Turkish Resident Organisation 

O. Ergün, Isparta (TR) 

Chair German Resident Organisation 

S. Schöne, Neustadt an der 

Weinstrasse (DE) 

Chair Spanish Resident Organisation 

A. Vilaseca Cabo, Barcelona (ES) 

ESRU Secretary 

G. Martinez, Koper (SL) 

ESRU Chair 

Z. Tando˘gdu, Istanbul (TR) 

ESRU Chair Elect 

C. Ruf, Hamburg (DE) 

Young Academic Urologists 



M. Sedelaar, Nijmegen (NL) 



Offices related to science 

Regional Office 

Chairman 

B. Djavan, Vienna (AT)

Scientific Congress Office 

Chairman 


Members 


C. Bangma, Rotterdam (NL) 


F. Burkhard, Berne (CH) 


J. Catto, Sheffield (GB) 



D. De Ridder, Leuven (BE) 

W. Feitz, Nijmegen (NL) 


S. Michel, Mannheim (DE) 


J. Sønksen, Herlev (DK) 


Consultant 












Video Congress Committee 

Chairman 

A. Messas, Nanterre (FR) 

Members 

A. Carbone, Latina (IT) 

I. De Jong, Groningen (NL) 

P. Geavlete, Bucharest (RO) 

F. Van Der Aa, Leuven (BE) 

Section Office 

Chairman 


Chairmen Sections 

ERUS: A. Mottrie, Aalst (BE) 

ESAU: W. Weidner, 

Giessen (DE) 

ESFFU: J. Heesakkers, 

Nijmegen (NL) 

ESGURS: S. Deger, 

Ostfildern (DE) 

ESIU: T. Bjerklund Johansen, 

Århus (DK) 

ESOU: M. Brausi, Modena (IT) 

ESTU: A. Figueiredo, 

Coimbra (PT) 

ESUI: J. Walz, Marseille (FR) 

ESUP: A. Lopez-Beltran, 

Cordoba (ES) 

ESUR: Z. Culig, Innsbruck (AT) 

ESUT: J. Rassweiler, 

Heilbronn (DE) 

EULIS: P. Osther, 

Fredericia (DK) 

Offices related to communication 

History Office 

Chairman 


Members 

C. Alamanis, Athens (GR) 

J. Elo, Helsinki (FI) 

R. Engel, Baltimore (US) 

L. Fariña-Pérez, Vigo (ES) 

J. Felderhof, Hoofddorp (NL) 

P. Figdor, Vienna (AT) 

A. Figueiredo, Coimbra (PT) 

A. Jardin, Paris (FR) 


S. Musitelli, Milan (IT) 

P. Rathert, Düren (DE) 

I. Romics, Budapest (HU) 

M. Skopec, Vienna (AT) 


P. Thompson, London (GB) 

A. Verit, San Liurfa (TR) 

Offices related to governance 

International Relations Office 

Chairman 


Consultants 

F. Cruz, Porto (PT) 




J. Thüroff, Mainz (DE) 

Ex-Officio Members 





Membership Office 

Chairman 

I. Korneyev, St. Petersburg (RU) 

Strategy Planning Office 

Chairman 


Members 


S. Buntrock, Bad Wildungen (DE) 



C. Surcel, Bucharest (RO) 

H-G. Tiselius, Stockholm (SE) 



Search & Nomination Committee 

2012/2013 

Chairman 


Members 

R. Ackermann, Düsseldorf (DE) 






425 



Additional 

EAU Foundation for Urological 

Research 

Chairman 

P. Mulders, Nijmegen (NL) 

Members 

T. Bjerklund Johansen, Århus (DK) 

M. Colombel, Lyon (FR) 



B. Watson, Dublin (IE) 

W. Witjes, Arnhem (NL) 

Ex-Officio Member 

V. Mirone, Napels (IT) 

Academy of Urology 

Chairman 

R. Ackermann, Düsseldorf (DE) 

Members 

P. Alken, Mannheim (DE) 

L. Boccon-Gibod, Paris (FR) 

A. Borkowski, Warsaw (PL) 

F. Debruyne, Arnhem (NL) 

P. Ekman, Stockholm (SE) 

U. Jonas, Hanover (DE) 

U. Studer, Berne (CH) 

P. Van Cangh, Brussels (BE) 

R. Vela Navarrete, Madrid (ES) 


Official journal of the EAU 

Editor in chief 



Historical Overview EAU Congresses 

1974 12-14 September Padua, Italy 

1976 24-26 September Prague, Czech Republic 

1978 14-16 June Monte Carlo, Monaco 

1980 21-30 May Athens, Greece 

1982 12-15 May Vienna, Austria 

1984 23-26 May Copenhagen, Denmark 

1986 26-28 June Budapest, Hungary 

1988 18-21 May London, United Kingdom 

1990 10-16 June Amsterdam, The Netherlands 

1992 22-25 July Genoa, Italy 

1994 13-16 July Berlin, Germany 

1996 1-4 September Paris, France 

1998 21-25 March Barcelona, Spain 

1999 7-10 April Stockholm, Sweden 

2000 12-15 April Brussels, Belgium 

2001 7-10 April Geneva, Switzerland 

2002 23-26 February Birmingham, United Kingdom 

2003 12-15 March Madrid, Spain 

2004 24-27 March Vienna, Austria 

2005 16-19 March Istanbul, Turkey 

2006 5-8 April Paris, France 

2007 21-24 March Berlin, Germany 

2008 26-29 March Milan, Italy 

2009 17-21 March Stockholm, Sweden 

2010 16-20 April Barcelona, Spain 

2011 18-22 March Vienna, Austria 

2012 24-28 February Paris, France 

2013 15-19 March Milan, Italy 


427 


Join the European Association of 

Urology, become a member, 

get involved! 

The EAU is the voice of European urologists, a non-profit 

scientific organisation dedicated to serving their members 

and representing their professional interests! 

Learn about the many benefits of being a member of the 

European Association of Urology. 

Free subscriptions to: 

• EAU Scientific Journal: European Urology, 

Supplements, EAU-EBU Update Series 

• EAU 

• Historia 


• European 

• Member 

• Registration 


Newsletter: European Urology Today 

Urologiae Europaeae 

Guidelines 

Urology Video Journal 

discounts on EAU products and services 

benefits for EAU meetings 

ID Card for automatic registration of 

EU-ACME credit points 

The EAU has a number of membership categories catering 

to all professionals involved in the speciality of urology. 

We invite you to become a member today! 

www.uroweb.org

Abstract authors 

A 

Aaltonen K. 1029 

Aaronson N.K. 239 

Abad C. 229 

Abascal R. 229 

Abassi Z. 202 

Abbas M. 198 

Abbona A.M. 130 

Abbou C-C. 716, 753, V15 

Abboudi H. 14 

Abd-Alazeez M.A 218 

Abdalla A. 836 

Abdel Naeim M.A.A. 788 

Abdel-Hakim A.M. 536 

Abdel-Karim A. 537, 552 

Abdel-Latif M. 1038 

Abdelbaky A.M. 865 

Abdelbary A. 668 

Abdelhafez M.F. 812, 964 

Abdelrahim M. 1038 

Abdo A. 175, 178, 233, 262, 534, 

820, 956, 1024 

Abdollah F. 140, 179, 185, 187, 289, 

474, 686, 687, 693, 694, 695, 

714, 806, 953 

Abdul-Muhsin H. 18, 299, 689, 

1013, V10, V13 

Abdulhak A. V16 

Abe T. 931 

Abl-Azzeez M. 717 

Abo-Elenen M. 214 

Abol Enein H. 1038, 1069 

Abolfotoh A. 537 

Abou Hashem S.E. 836 

Aboumarzouk O. 370, 599 

Abrams P. 737 

Abramyan K.N. 115 

Abrate A. 583, 831, 832 

Abroaf A. 781 

Abt D. 310 

Aburatani H. 764 

Acar I.C. 291 

Adam G. 359 

Adam M. 293, 920, 1006 

Adamowicz J.A. 869 

Adanur S. 417, 616 

Addali M. V16 

Adding C. 1035 

Adot Zurbano J.M. 888 

Adsan Ö. 111, 794 

Afandiyev F. 527 

Afoko A.A. 212 

Afshar-Oromieh A. 227 

Agarwal N. 1107 

Agarwal P.K. 1031, 1032 

Agarwal V. 1027 

Agelidou M. 423 

Aggamy M. 668 

Agra C. 606, 607 

Agrawal S. 600 

Agreda F. 6, 682 

Agresta T.S. 525 

Agudelo J.A. V36, V39 

Aguiar S. 557 

Aguilera A. 498 

Ahallal P. 883 

Ahallal Y. 352, V48 

Ahmad S. 599 

Ahmadi H. 220 

Ahmed H.U. 218, 353, 584, 585 

Ahmed H. 717 

Ahmed K. 14, 19, 20, 1031, 1032 

Ahn H. 80, 196, 466, 469, 478, 771, 

807, 1005, 1010, 1097 

Ahn H.S. 460 

Ahn J.H. 691 

Ahn T.Y. 410 

Aho T.F. 952 

Ahyai S.A. 866, 990, 1002, 1004 

Aikawa K. 446 

Aillet G. 472 

Aisain I. 595 

Aitken E. 374, 377, 495 

Aizawa N. 64, 67 

Akagashi K. 121 

Akbarov I.A. 624 

Akduman B. 128 

Aki F.T. 643 

Akihama S.A. 610, 1100 

Akihiro K. 59 

Akino T. 931 

Akita H. 818 

Aksenov A.V. 188, 358 

Aksoy Y. 417 

Akyurek E. 128 

Al Mahmid M. 890 

Al Qahtani S.M. 432 

Al Wadaani H. 420 

Al-Ahmadie H.A. 749 

Al-Bulushi Y. 72, 514 

Al-Matar B. 812 

Al-Qahtani S.M. 366 

Al-Salam S. 609 

Al-Shukri S.K. 667 

Al-Zahrani A. 1050 

Alam Z. 530 

Alamanis C. 41 

Alarcon R. 1068 

Albanesi L. 486 

Albei C. 405 

Albersen M. 252, 324, 326, 327, 328 

Alberts A.R. 688 

Albertsen P. 677 

Albisinni S. 800 

Alcaraz A. 34, 206, 208, 236, 237, 

313, 378, 383, 436, 489, 491, 

494, 496, 498, 595, 639, 993 

Aldahshoury M. 528 

Aldayel A. 668 

Aldridge P. 623 

Alekseev B.Y. V43 

Alemozaffar M. V12 

Alessandria E. 376, 431, 1066, 1071 

Alexander C.E. 523 

Alexandre L. 449, 900 

Algaba F. 281, 287 

Ali A.S.M. 623 

Ali Z. 44 

Ali-El-Dein B. 822, 934 

Alibhai S.M. 886 

Alipanah R. 598 

Alivizatos G. 521 

Aljabery F. 481 

Allasia M. 95, 864 

Allen C. 218, 267, 584, 585, 717 

Allen S.E. 314 

Allory Y. 716, 753 

Alloussi S.H. 72, 514, V59 

Alloussi S. 72, 514 

Almousa R. 668 

Alnajjar H.M. 389 

Alonso Prieto M.A. V60 

Alonso Rodriguez D. 113 

Alonso Y Gregorio S. 556, 1036 

Alsudani M. 39 

Althaus P. 192 

Altin R. 128 

Numbers refer to abstract numbers 


429 

Indices

Indices 


Altinkilic B. 897 

Alturas Silva J. 669 

Alumkal J.J. 100 

Alvarez E. 606 

Alvarez M. 1068 

Alvarez Rodríguez S. 346, 501 

Alvarez-Ossorio Fernandez J.L. V33 

Alvarez-Vijande R. 34, 313, 436, 

489, 494, 639 

Alves E.F. 30 

Amano M. 197 

Amarenco G. 401, 743 

Ambrose C. 910 

Amend B. 306, 629, 964, V54, V71 

Ametov R.E. 797 

Ameye F. 360 

Amiel J. 1059 

Amin M. 287 

Ammi M. 87, 778, 1105 

Amore D. 412 

Amorim R.F. 895 

Amparore D. 204, 630, 875 

Amsellem-Ouazana D. 235 

Amón J.H. 760 

An J. 325 

Anastasio De Las Heras P. 334 

Anastasopoulos P. 548 

Anderson P. 85, 145, 704 

Andersson F. 405, 406 

Andersson K-E. 68, 443, 447, 909 

Ando R. 311 

Andres G. 524, 1030, V7 

Andrianov A.N. V43 

Angelergues A. 104 

Angerri O. V35 

Angulo J. 40, 401, 524, 760, 1030, 

1034, V5, V7, V8, V9 

Anis E. 511 

Ansieau J-P. 171, 176 

Antonelli A. 172, 259, 264, 340, 

499, 887 

Antunes Lopes T. 669, 673 

Anyamene N. 268 

Aoyagi T. 931 

Apostolidis A. 733 

Appel B. 131 

Arafat W. 72, 514 

Aragona M. 867 

Arai Y. 21, 720 


Arakawa S. 663 

Arance I. V8 

Arano P. 999 

Araujo A.B. 211 

Arcaniolo D. 560, 622 

Ardelt P. 697 

Arden-Close E.J. 275 

Arellano J. 99 

Arenas Da Silva L.F. 1022 

Arentsen H.C. 153, 700 

Areskoug B. 120 

Arfi N. 705 

Argirovic A. 518, 1060 

Argirovic D. 518, 1060 

Arguelles-Salido E. 804 

Argun B. 529 

Argüelles-Salido E. 917 

Arias E. V36, V39 

Arias Fúnez F. 346, 379 

Arima K. 978 

Arisawa C. 572, 819 

Arlandis S. 746 

Armitage J.N. 658 

Arnaud L. 245 

Arnoux V.A 563 

Aroasio E. 204 

Aron M. 220, V45, V79 

Arosio M. 692 

Arrabal Martin M. 312 

Arrabal Polo M.A. 312 

Arriaga J. V6 

Arrighi N. 499, 887 

Artmann A. 250, 871 

Artmann G.M. 250 

Arum C.J. 152 

Arumi D. 740 

Arver S. 211 

Arvin-Berod A. 283 

Arya M. 16, 717, 879 

Asakuma J. 574, 827 

Asano T. 57, 144, 827, 976, 977 

Asano T. 57, 144, 574, 827, 976, 977 

Ascalone L. 382, V50 

Ashworth D. 395 

Asiain I. 208 

Aslan Y. 615 

Astroza G. 653, 661, 967 

Atac F. 117, 163, 381 

Atan A. 615 

Ataus S. 479 

Atduev V. 354 

Ather H. 1067 

Atiemo H. 119 

Attisani F. 486, 580 

Attwood K. 882 

Audenet F. 87 

Audet A. 449 

Auerbach S.M. 739 

Aufderklamm S. 364, 861, 899, 

1049, 1054 

Aureli M. 146 

Aurelian J. 17 

Aurora H. 126 

Aus G. 808 

Ausmees K. 216 

Aussie J. 1045 

Austin R. 939 

Autenrieth M. 809 

Autier P. 353 

Autieri D. 914 

Autorino R. 20, 91, 255, 256, 257, 

552, 990, 1093, 1094, V2, V3, 

V22, V27, V30 

Autran A.M. 1020 

Avances C. 283 

Avelino A. 65 

Awad H. 202 

Awrey S. 50 

Axell R. 142 

Aydin I. 962 

Ayis S. 16 

Ayres B. 593 

Aytac B. 652 

Aziz A. 282, 286, 815 

Azizov I. 893 

Azone I. 74 

Azzabi F.Z. 246, 874 

Azzouzi A.R. 87, 778, 1105 

B 

Baba S. 21 

Babjuk M. 276, 575, 601, 697, 815, 

822 

Bach C. 654, 963, 1067 

Bach T. 636, 1067 

Bachke S. 152 

Bachmann A. 167, 461, 618, 634, 

945, 990, 1004 

Numbers refer to abstract numbers

Baco E. 221 

Bacsu C. 732 

Badalato G.M. 284 

Badani K.K. 1031, 1032 

Bader A.N. 999 

Badescu B.G. 384 

Badke A. 306 

Bae J.H. 445, 611 

Bae K-H. 535 

Bae W.J. 445, 611 

Bagrodia A. 552 

Bahilo P. 543 

Bahl A. 230 

Bahn D. 265 

Baig M.B. 530 

Baiocchi G. 557 

Baker K. 785 

Bakshi S. 541 

Balasch J. 34 

Balasubramanian S. 823 

Balbay M.D. 1031, 1032 

Balconi G. 583 

Ballanger P. 96, 763 

Ballesca J.L. 34 

Baltzer P. 345 

Banakhar A. 307 

Banchik E.L. 787 

Banckwitz R. 321 

Banfi A. 868 

Bangma C.H. 1, 5, 217, 680 

Baniel J. 697, 815 

Bannowsky A. 127 

Banyra O. 507 

Barbanti G. 798 

Barber N. 638 

Bardelli I. 1008 

Bardonnaud N. 426, 427, 429 

Barentsz J.O. 12, 582 

Barker A.T. 403 

Barletta D. 894 

Baron A. 306 

Barrass B.J.R. 762 

Barrese F. 517 

Barret E. 352, 589, 679, 883, 1020, 

V48, V64 

Barrett M.T. 945 

Barrett T. 142, 224 

Barry Delongchamps N. 141, 235 

Bartkowiak D. 192 

Bartoletti R. 166, 508, 509, 619, 

697 

Bartolozzi C. 1008 

Bartsch G. 825 

Bascu C. 114 

Baskin-Bey E. 674 

Bassi S. 894 

Bastarós J.M. 6 

Bastian P. 286, 686, 688, 911 

Bastien L. 87 

Baston C. 384 

Battaglia A. 95, 864 

Battaglia F. 770 

Battaglia M. 662 

Bauer C. 863 

Bauer R.M. 726, 999, 1004 

Bauer W. 1009 

Baukloh V. 27 

Baumert H. 87, 170, 171, 176, 

1105 

Baumgart S. 774 

Baumgartner M. 133 

Beatrice J. 133 

Beatty J. 268 

Bechara G.R. 29 

Becher E. 587 

Becht E. 696 

Beck S. 51 

Becker A. 175, 178, 272, 293, 685, 

718, 752, 820, 920, 956, 960 

Becker A. 844, 847, 923 

Becker F. 338, 703 

Becker T. 644 

Bedke J. 306, 629, 964, 1054, 1062, 

V71 

Beer T.M. 97, 103 

Beermann S. 272 

Behnsawy H. 1047 

Behr-Roussel D. 449, 900 

Behre H.M. 211 

Behrendt M. 554 

Beier J. 790, 795, V70 

Bektic J. 7, 803 

Belfield J. 590 

Belgrano E. 817 

Belldegrun A.S. 193 

Bellec L. 87, 170, 171, 176 

Bellessort A. 743 

Bellezza G. 147, 933 

Bellina M. 864 

Bellomo F. 592 

Belomyttcev S.V. 796 

Beltran L. 58 

Belyaev I. 893 

Ben Ali M. 520 

Ben Messaoud N. 768 

Ben Rais N. 520 

Ben-Zvi T. 638 

Benadiba S. 734 

Bendahl P.O. 750 

Benecchi L. 1041 

Benedetto G. 319 

Benelli A. 817 

Bengoa N. 941 

Benigni F. 69, 146, 328, 451, 651, 

831, 832 

Benito Garcia P. V42 

Bennett P.R. 910 

Bensadoun H. 500 

Bensalah K. 87, 176, 261, 576, 

813, 852, 1105 

Benson M.C. 485 

Benvenuto S. 838 

Benvenuto S. 817 

Benzon Larsen S. 858 

Berardinelli F.B. 408, 1093, 1094 

Berdah S. 245 

Berdondini E. 798 

Bergdahl S. 808 

Berger A. V45, V79 

Berger C. 644 

Berger J. 170, 171, 176, 283, 458, 

1105 

Berges R. 629 

Berglund A. 808 

Berman M. 719, 946 

Bernabé J. 449, 900 

Bernardini S. 426, 427, 429 

Bernecker R. 22 

Bernhard J-C. 87, 96, 170, 171, 

176, 283, 763, 1105 

Bertaccini A. 711 

Bertini R. 173, 340, 467, 953 

Bertolo R. 204, 219, 710, 875, V11 

Bettendorf O. 465 

Bettiga A. 146, 328, 331, 363, 443 

Bettocchi C. 662 

Betts C. 775 



431 

Indices

Indices 


Beukers W. 54, 238 

Beuvon F. 141 

Beuzeboc P. 104 

Beveridge S. 351 

Bex A. 392, 394 

Beyer B. 226, 359, 1023 

Bhandari M. 19 

Bhat A.L. 418, 421, 424 

Bhat M. 418, 421, 424 

Bhatt J.R. 38, 45, 1077 

Bhatt R.I. 453 

Bhayani S. 876 

Bhide A. 672, 725 

Bhindi B. 988 

Bhojani N. 659 

Bianchi C. 769 

Bianchi G. 172, 264, 439, 817, 887 

Bianchi L. 271, 711 

Bianchi M. 140, 182, 187, 473, 686, 

687, 714, 748, 806, 960 

Bianco A. 147, 933 

Bianco R. 622 

Biancone L. 376 

Biasoni D. 83, 388, 397, 398, 1055, 

1057 

Bielik R. 833 

Bielsa O. 229 

Bienko M. 19 

Bigot P. 87, 170, 171, 176, 283, 778, 

1105 

Bilasy S.E. 33 

Bilhim T. 628 

Billingham L.J. 239 

Binbay M. 660 

Bini V. 137, 848 

Birch B. 275 

Birchall C. 623 

Birder L. 65 

Birkhäuser F.D. 193, 330, V44 

Birtle A. 81 

Bischoff S.C. 861 

Bisconti A. 431, 1066, 1071 

Bissler J.J. 981 

Bitker M-O. 304 

Bittard H. 426, 427, 429 

Bivalacqua T.J. 324, 326, 327, 815 

Bizzarri C.N. 711 

Bjarnason G.A. 1107 

Bjartell A. 826, 856 


Björnsson S. 1029 

Black P.C. 50 

Bladou F. 1053 

Blaheta R. 825, 830 

Blanchet P. 136 

Blanco S. 692 

Blasco M. 491 

Blauwet M.B. 401, 739 

Blazquez J 498 

Blemings A. 406 

Blessig T. 72 

Blumenstengel K. 1106 

Blumenstock G. 1049 

Blutbacher P. 365 

Blázquez C. 482, 757 

Bocchi F. 1041 

Bocchi P. 1041 

Bocciardi A.M. 172, 264 

Bochner B.H. 749 

Bödecker H. 160 

Bodnar M.B. 869 

Boehm K. 226 

Boerman O.C. 336, 980 

Boers-Sonderen M.J. 336 

Boissier R. 245 

Bokhorst L.P. 5 

Bolenz C. 286, 576, 1052 

Bolle W.A.B.M. 680 

Bollito E. 219, 710 

Bolognesi A. 183 

Bomanji J. 391 

Bombelli S. 769 

Bomers J. 582 

Bonet A. 208 

Bonillo Garcia M.A. 888 

Bonkat G. 167, 618 

Bonneau C. 430 

Bono A. 708 

Boorjian S.A. 75, 151, 924, 957 

Boren J. 833 

Borer J.S. 739 

Borghesi M. 186, 258, 271, 290, 454, 

711, 913 

Borghi M. 587 

Borgogno C. 438 

Boronat Tormo F. 231, 543, 805 

Boros M. 251 

Borre M. 674, 683 

Borrego J. 482 

Bos D.L. 980 

Bosch J.L.H.R. 648 

Bose P. 3 

Bosio A. 95, 376, 431, 864, 1066, 

1071 

Boss A. 874 

Bosset P.O. 137, 716, 848 

Bossi I. 1078 

Bostanci Y. 117, 163, 381 

Boström M.M. 154 

Boström P.J. 154 

Botelho F. 210 

Bott S. 351 

Bottke D. 192 

Bottone F. 560 

Bouazza N. 141 

Boudes M. 441 

Boulos V. 37, 843 

Bourdoumis A. 654, 963 

Bouropoulos K. 548 

Bouvier R. 180 

Bovo G. 692, 769 

Boxler S. 222, 227 

Bozaci A.C.B. 643, 645 

Bozzini G. 368, 540, 566, 567, 798 

Bracarda S. 106 

Brady J. V71 

Braeckman J. 353 

Braga A. 726 

Brahmbhatt J. 841, V51, V52, V76 

Braissant O. 618 

Brakbi Y. 458 

Branco A.W. V58 

Branco F. 380 

Brandtner A. 225 

Brassetti A. 412 

Brasso K. 273, 858 

Braticevici B. 966 

Bratti E. 319 

Bratus D. 680 

Braun A. 99, 108 

Braun C. 844 

Braun K. 856 

Brausi M. 708 

Brechenmacher T. 981 

Brecheteau F. 283 

Breda A. 137, 281, 372, 498, 660, 

848, V49 

Brenneis C. 671 


Brewster S.F. 298, 1077 

Briganti A. 182, 183, 184, 185, 187, 

188, 467, 468, 471, 473, 474, 

686, 687, 688, 694, 695, 697, 

806, 911, 990 

Bright E. 737 

Brime Menendez R. 334 

Brindle K. 833 

Brisuda A. 276, 815 

Broers E.M.P. 493 

Brombin C. 473 

Bronner C. 192 

Brookman-May S. 286, 340 

Brough R. V57 

Brouzyine M. 112 

Brown C. 879 

Brown R. 161 

Brown S.C. V66 

Bruce J.Y. 100 

Bruckner T. 344 

Brunner J. 822 

Bruno G. 579 

Bruno R. 729 

Brunocilla E. 271, 454, 711 

Brureau L. 87 

Bruyère F. 170, 171, 176, 261, 743 

Bryan R. 51, 81, 239 

Brössner C. 1009 

Bründl J. 225, 944 

Bschleipfer T. 62, 897 

Bubendorf L. 945 

Bucci S. 614, 838 

Buchholz N. 654, 963, 1067 

Buchner A. 923 

Buchner H. 286 

Budak S. 111, 794 

Budde K. 981 

Budia A. 543 

Budiharto T. 360 

Budäus L. 226, 359, 1006, 1023 

Buffardi A. 376, 431, 1066, 1071 

Buffi N.M. 137, 186, 254, 848, 855 

Bühring H. 899 

Bui H. 676 

Bujons A. 531, 532 

Bul M. 5 

Bullock A.J. 109, 110, 873 

Bultitude M.F. 1084 

Buono R. 69, 328, 451, 651, 831, 

832 

Burgard B. 74 

Burger M. 282, 286, 577 

Burgess N.A. 658 

Burgio G. 363 

Burgos Revilla F.J 346, 379, 498, 

501, 760 

Burgu B. 527, 646, 647 

Burgués J.B. 577 

Burkhard F.C. 555, 1026 

Burnett A.L. 327 

Bus M.T.J. 594 

Busetto G.M. 55, 591 

Butea-Bocu M.C. 295 

Buttyan R. 50 

Buvat J. 123 

Byun S.S. 519, 1003 

Byun Y.J. 512 

C 

Cabello R. V75 

Cabral J. 380 

Cabrejos Perotti K. 422 

Cabrera P.M. 1030, V5, V7, V8, V9 

Caceres F. 1034, V5, V7, V8, V9 

Cadeddu J. 552 

Cadieux P 162, 505 

Caffaratti J. 531, 532 

Cahill D. 298 

Cai T. 166, 459, 508, 509, 619, 697 

Caisey S. 449 

Cäkir O.O. 126, 407 

Calabresi P. 302 

Calatrava Ledrado L. 334 

Calsson S. 858 

Camacho J. A. 639 

Cammann H. 859 

Campain N. 516 

Camparo P. 287 

Campeau L. 443, 447 

Campeggi A. 716 

Campion L. 472 

Campistol J.M. 491, 496 

Campos R.S.M. 399 

Campos Pinheiro L. 628 

Canals D. 146 

Cancrini F. 412 

Canes D. V44 

Cansino R. 760 

Canu T. 832 

Capitanio U. 173, 289, 467, 473, 575, 

601, 686, 695, 714, 953 

Capizzi E. 711 

Capogrosso P. 953 

Capol J.C. 635 

Capon G. 96 

Cappa M. 517 

Cappallo-Obermann H. 27 

Caraglia M. 828 

Carap A. 34 

Carbone A. 517, 914 

Carbone L. V53 

Carchedi M.T. 431, 864, 1066, 1071 

Cardeñosa O. 206 

Cardone G. 583 

Cardoso L.E.M. 413 

Cardozo L. 740 

Caremel R. 244, 785 

Carenzi C. 173, 953 

Carillo V. 184 

Carini M. 93, 172, 259, 264, 411, 

693, 817, 887, 1014 

Carlsson M. 740 

Carlsson S. 4, 808, 850 

Carlsson S. 912, 916 

Carmel M. 891 

Carmignani G. 770, 817, 1014 

Carmignani L. 368, 540, 566, 567, 

798, 996 

Carmona O. V6, V19, V38, V44 

Carpentier X. 1059 

Carrasco A. 924 

Carrato A. 229 

Carrieri G. 864 

Carrión Puig A. 383, 993 

Carroll T. 935 

Carter A.C. 367 

Carter S. 990 

Cartwright R. 672, 910 

Carvalho F. 719 

Carvalho-Barros S. 673 

Casabe A.R. 1096 

Casanova Ramón-Borja J. 10, 1007 

Casanova-Salas I. 10 

Casellato S. 368, 540, 566, 567 

Castane E.R. V71 

Castañeda-Argáiz R. 383 



433 

Indices

Indices 


Castellano D. 773 

Castelli C. 852 

Castelo D.J.S. 1082 

Castiglione F. 69, 140, 324, 326, 328, 

443, 694, 714 

Castillo J. 437 

Castle E.P. 1031, 1032 

Castro J. V19, V44 

Castro R. 1095 

Castro Diaz D. 746, 888 

Catanzaro M. 83, 388, 397, 398, 

1055, 1057 

Cathala N. 589, 1020 

Cathcart J. 181, 190 

Cathelineau X. 352, 589, 679, 883, 

1020, 1040, V48, V64 

Cattaneo G. 219 

Cattarino S. 11 

Catto J. 56, 81, 568 

Cattoni E. 726 

Cattoretti G. 769 

Cavarretta I.T.R. 831, 832 

Cayzergues L. 112 

Cecchini M.G. 330, 942 

Ceccini L. 229 

Celhay O. 483 

Celia A. 259, 459 

Cellai I. 411 

Celma A. 6, 682 

Centi J. 458 

Cerantola Y. 926 

Ceresa C. 374, 377, 495 

Ceresoli F. 173 

Ceriotti F. 855 

Ceruti C. 431, 1066, 1071 

Cervero Jiménez M. 730 

Cespedes M. 229 

Cestari A. 137, 254, 848, 855 

Cha E.K. 575, 601, 697, 813 

Cha W.H. 1003 

Chabannes E. 426, 427, 429 

Chadwick E. 351 

Chae J.Y. 955, 994 

Champy C. 283 

Chan Y.H. 758 

Chancellor M. 308 

Chandra A. V62 

Chang A. 16 

Chang P. 882 


Chang P-L. 148 

Chang R. 211 

Chang S-J. 1064 

Chang S.R. 723 

Chang W.Y.H. 684 

Chantada V. 232, 760 

Chapman A. 434 

Chapple C.R. 109, 110, 401, 403, 

741, 744, 873, 910, 1087 

Charles T. 731 

Charman S. 218, 353, 585 

Charry P. V75 

Chartier-Kastler E. 304, 308, 734, 

743 

Chatterton J. 1084 

Chauhan S. 299, 1013, V10 

Chautard D. 778 

Chauveau P. 999 

Chawla A.K. 970 

Che L. 840 

Chebil G. 750 

Chemaly A. 547 

Chen B. 27, 28, 36, 837 

Chen C.H. 234 

Chen D. 981 

Chen F. 877 

Chen H.S. 162 

Chen J. 932 

Chen K-K. 515, 684, 723, 735, 738, 

784, 1088 

Chen Q.H. 247 

Chen Q. 604, 605 

Chen T.J. 515, 735 

Chen W. 320 

Chen Z. 604 

Chen Z. 901 

Cheng K.K. 239 

Cheng L. 249 

Chernobilsky V. 587 

Chernogubova E.A. 857 

Chernyaev V. 90 

Chessa F. 454, 711 

Chester J. 81 

Cheung G. 1033 

Cheung S. 935 

Chevallier D. 1059 

Cheville J. 75, 924, 957 

Chiang H.S. 335 

Chiang H.K. 315 

Chiara A. 183 

Chiba K. 33, 35, 842 

Chibichyan M.B. 857 

Chiche L. 500 

Chin J. 1050 

Chindemi A. 264 

Chiong E. 758 

Chira I.D. 17 

Chiriacò G. 838 

Chiu A.W. 315 

Chiu Y.C. 315 

Cho D.S. 1072 

Cho D.Y. 209, 544 

Cho H.J. 445, 611 

Cho J.S. 213, 786 

Cho J. 280 

Cho K.S. 1012 

Cho M.C. 332 

Cho N.H. 1012 

Cho S.Y. 332, 860 

Cho W.Y. 209, 213 

Cho Y.S. 409 

Chodacki A. 101 

Chodez M. 564 

Choe M.S. 986 

Choi D. 490 

Choi H.Y. 266, 280, 297, 786 

Choi J.Y. 253 

Choi J.W. 116 

Choi S.H. 253 

Choi W.S. 860 

Choi Y.S. 445, 611 

Choi Y.D. 177, 269, 810, 1012 

Chong T.W. 200 

Choo M-S. 1005 

Choo S.H. 266, 280, 297, 538 

Choong S. 314 

Choueiri T.K. 1107 

Choussos D. 894 

Chow K. 316 

Chowriappa A. 19, 20 

Christ T. 902, 905 

Christensen I.J. 273 

Christensen J. 858 

Christian S. 731 

Christiansen M. 858 

Christie A. 114 

Christine B.S. V71 

Christofides A. 42 


Christopher N. 129 

Chromecki T. 340, 347 

Chryssolouris G. 25 

Chua M. 437, 1043 

Chuck N. 874 

Chughtai B. 638, 724, 1004 

Chun F.K. 272, 473, 474, 686, 752, 

802, 813, 929, 990, 1015 

Chun J. 688, 911 

Chung A.S. 634 

Chung B.H. 269, 810 

Chung H.J. 515, 735, 738, 1088 

Chung H.C. 997 

Chung J.M. 691 

Chung J.Y. 727 

Chung J.S. 1001 

Chung M.K. 632, 691, 759 

Chung S.K. 253, 428 

Chung W.S. 512 

Chunwoo L. 649 

Cid J. 491 

Cindolo L. 91, 408, 412, 592, 1093, 

1094 

Ciofu C. 896 

Cisneros R. V19, V44 

Cisneros Ledo J. 556, 1036 

Citeri M. 301, 305 

Citgez S 529 

Ciudin A. 34, 313, 378, 436, 595, 

993 

Ciuffreda M. 86 

Clarke A.H. 539 

Claro J.F.A. 525 

Clavijo R. V38 

Clayman R. V44 

Clayman R. 822 

Cleeland C. 99 

Climent M. 106 

Clozel T. 156 

Cocci A. V69 

Coelho A. 65 

Coelho R. 299, 1013, V10 

Cohen J. 283 

Colciago G. 146, 328 

Colecchia M. 388, 397, 398, 1057 

Coleman R. 99 

Colette S. 708 

Colin P. 237, 575, 576, 601 

Collado Serra A. 10, 1007 

Collins E. 634 

Collins J. 1035 

Colls P. 283 

Coloby P. 136 

Colombel M. 180, 705 

Colombo F. V56 

Colombo R. 363, 687, 697, 748, 918 

Comeglio P. 411 

Comet D. 681 

Comperat E. 237, 283, 393, 483 

Compion G. 782 

Comploj E. 61, 78, 573, 575, 601, 

701, 752, 754, 815, 929 

Compérat E. 287 

Conca M.A. 543 

Conde Giles A. V33 

Conde-Sanchez J.M. 804, 917 

Conejero Sugrañes J. 888 

Congregado-Ruiz B. 804, 917 

Connolly S.S. 952 

Constantin V. 34 

Conteduca G. 770 

Corbell C. 308 

Corbishley C. 389 

Corcoran N.M 53, 145, 704, 849 

Corcos J. 244, 785, 891 

Córdoba Martínez L.A. 346 

Cordonnier T. 50 

Corman J. 103 

Cormier L. 283 

Corn P.G. 100 

Cornel E.B. 700 

Cornu J-N.L. 726, 896, 1004 

Cornud F. 141 

Corona G. 411 

Corral J.M. 34 

Correia de Almeida Pinto R.M. 669 

Correia-Pinto J. 968 

Corti S. 687 

Cosciani Cunico S. 172, 499, 592, 

887 

Cosentino M. 532, 760 

Cosentino M. 368 

Coss C.C. 102 

Costa L. 895 

Costa P. 112 

Costa W.S. 29, 30, 413, 903 

Costa W.H. 399, 557 

Costantini E. 729 

Costantini M. V23, V46 

Costantino L.C. 412 

Costello A.J 53, 145, 704, 849 

Cotterill N. 737 

Couapel J-P. 176 

Counsell N. 58 

Cózar J.M. 232, 362, 498 

Cozzarini C. 182, 183, 184, 185, 187, 

687, 694, 806 

Cozzupoli P. V53 

Crabb S. 58, 811 

Craven L. 558 

Crawford E.D. 678 

Creagh T.C. 15 

Crepel M. 170, 171 

Crespi A. 692 

Crespo L. 1068 

Crestani A. 1017 

Crevels A.J. 870 

Cristinelli L. 499 

Cristofani L.M. 650 

Crivellaro S. 259, 864, 880 

Crivelli J.J 156, 701, 752, 929 

Cromwell D. 658 

Crook T.J. 740 

Crouzet S. 180, V77 

Cruz C.D. 65, 673 

Cruz F. 65, 210, 627, 669, 673, 898 

Cruz-Nuricumbo E. 973 

Cuadros T. 768 

Cuervo Calvo J. V42 

Cui Y.C 839 

Culty T. 778 

Cunha I.W. 399 

Curto T. 211 

Cussenot O. 366, 576, 896 

D 

Da Pozza L.F. 173, 1096 

Daamen W.F. 870, 872 

Dababneh H. 271 

Daher Abdi Z. 458 

Dahlem R. 425, 866, 929, 1002 

Dal Moro F. 1017 

Dalal N. 1101 

Dalbagni G. 697, 749 

Dalmasso E. 376, 431, 1066, 1071 

Dalpiaz O. 575 

Dalton J.T. 102 



435 

Indices

Indices 


Dalton S.O. 858 

Damaj B. 123 

Damiano R. 289, 687, 918 

Damião R. 99 

Dammert F. 195 

Damms-Machado A. 861 

D'Ancona F.C.H. 493 

Daneshmand S. 815, 822 

Daneshvar K. 344 

Dansranjavin T. 27, 31, 947 

Danuser H. 554 

Danısoglu M. 652 

Darweesh I. 91, 552 

Dasgupta P. 14, 477, 709, 835, 1031, 

1032, 1033, V14 

Daum L. 243, 248, 791 

Davceva O. 203 

David S. 679 

Davidov M. 1086 

Davidson S.R.H. 588 

Davis M.J 135 

Dawood T. 416 

Day J.R. 1045 

De Andrade R. V6, V19, V38, V44 

De Angelis P. 174 

De Arriba Alonso M. V60 

De Berardinis E. 55, 591 

De Blok W. 291 

De Bono J.S. 97, 105 

De Braud F. 83 

De Bruin D.M. 594 

De Castro J. 485 

De Castro Abreu A.L. 220, 265, 361, 

V45, V79 

De Cobelli O. 340 

De Concilio B. 838 

De Fourmestraux A. V15 

De Gorski A. 721 

De Gracia A. 281 

De Koekkoek P. 217 

De Kort L.M.O. 648 

De Korte C.L. 995 

De La Motte Rouge T. 104 

De La Peña E. 482, 757 

De La Peña Barthel J.J 556, 1036 

De La Rosa C. 103 

De La Rosa F. 232, 362, 773 

De La Rosette J. 521, 594 


De La Taille A. 137, 261, 677, 716, 

753, 848, 851, V15 

De La Torre P. 137, 848 

De Lacy Costello B. 506 

De Lange F. 582 

De Marzo A.M 943 

De Meerleer G. 191 

De Meuron L. 330 

De Midina S.G.D. 432 

De Nola R. 662 

De Nunzio C. 340, 408, 411, 412, 

672, 725, 798, 990, 1004, 1014, 

1094 

De Placido S. 396 

De Reijke T.M. 594, 700 

De Ridder D. 252, 441, 513, 999 

De Ruiter M.C. 889 

De Souza D.B. 29, 30, 903 

De Souza P. 97 

De Stefani S. 817 

De Tayrac R. 112 

De Torres I. 768 

De Velasco G. 773 

De Velasco M. 1108 

De Wall H. 212 

De Win G. 14 

De Winter P. 51 

De Zaragoza I. 362 

Deantoni C. 184, 185 

Dearnaley D. 108 

Debiais-Delpech C. 1040 

Decaestecker K. 191 

Dechet C. 61 

Deckmann K. 62 

Deger S. 89, 461 

Deiana G. 173 

Deja A. 365 

Dekhnich A. 169 

Del Boca C. 1041 

Del Cañizo-Lopez J.F. 606 

Del Duca M. 579 

Del Gaudio C. 147, 933 

Del Maschio A. 832 

Del Nero A. 596 

Del Vescovo R. 580 

Del Zingaro M. 729 

Delage F. 283 

Delbro D. 664 

D'Elia C. 166, 459, 509, 619 

Della Mora L. 454 

Dell'Oglio P. 289, 687, 918 

Delmas V. 930 

Delor M. 596 

Delorenzi M. 942 

Delpero J.R. 1053 

Deminière C. 763 

Demir R. 117, 381 

Demirdag C. 479 

Dempster N.J. 374, 377, 495 

Denes F.T. 650 

Denstedt J.D. 162, 505, 1067 

Dente D. 259 

Denys P. 304 

Denzinger S. 282, 286 

Deprest J. 252 

Deriglazova P. 893 

Deroose C.M 360 

Derosa G. 828 

Desai J. V40 

Desai M. 220, V6, V45, V79 

Desar I.M.E. 336 

Descamps P. 679 

Descazeaud A. 283, 458 

Descotes J.L. 563, 564 

Deshpande A. 1074 

Dessyn J.F. 427 

Destefanis P. 95, 431, 864, 1066, 

1071 

Deuker J. 31 

Devon S-L. 256 

Devoogdt N. 1000 

Dharmaraja A. V45 

Di Antonio M. 823 

Di Cristofano C. 93 

Di Domenico A. 174 

Di Filippo M. 302 

Di Girolamo V. 467, 695 

Di Lorenzo G. 396 

Di Mauro U. V67 

Di Muzio N.G. 182, 183, 184, 185, 

187, 687, 694, 806 

Di Napoli M.A. 525 

Di Santo V. 259 

Di Serio C. 185, 473 

Di Stasi S.M. 697, 698 

Di Stefano C. 579 

Di Stefano V. 769 

Di Trapani D. 918 


Di Trapani E. 173, 695, 714, 953 

Diaa M. 528 

Diaconescu D. 966 

Diaconu M.G. 34, 313, 436, 595, 993 

Dias E. 968 

Dias J. 895 

Dias V.M.N. 1082 

Díaz F.J. 482, 757 

Diaz M. 876 

Diaz R.R. 1012 

Díaz González R. 773, 1073 

Diazzi D. 271 

Dick C.P.C. 902, 905, 989 

Dickinson I.K. 49, 1075, 1076, 1081 

Dickinson C.L. 584, 585 

Dickman K.G. 234 

Diekmann F. 491, 496 

Dietel A. V17 

Dietsche T. 945 

Díez Nicolás V. 379, 501 

Diez Sicilia L. 773 

Digesu A. 672, 725 

Digiorgio L. 882 

Dignat-George F. 245 

Dillenburg W. 696 

Dillon B.E. 114 

Din R. 19 

Ding Q. 9 

Dinis P. 627, 669, 1079 

Ditonno P. 662 

Dixon C. 631 

Djajadiningrat R.S. 387, 389, 390, 

392, 394 

Djatisoesanto W. 908 

Djinovic R. V56 

Dmochowski R. 402 

Do M. V17 

Doble A. 142 

Dobrowolska-Glazar B. 597 

Dobrowolski Z. 597 

Dockree S. 1051 

Doehn C. 461 

Doerfler A. 283, 500 

Dogan C. 89, 529 

Dogan H.S. 642, 643, 645 

Doglioni C. 467, 473 

Dogliotti L. 108 

Doizi S. 430 

Dombrovsky V.I. 787 

Dominguez Esteban M. 773 

Domínguez-Escrig J. 10, 1007 

Don-Doncow N. 826 

Donahue T.F. 749 

Donat S.M. 749 

Donel E. 189 

Donnaint A. 283 

Donon L. 96, 763 

Donovan J. 81, 135 

Donskov F. 1107 

Doo S.W. 325 

Dorado M. 1068 

Dorkin T. 781 

Dormeus S. 415 

Dornbusch J. 984 

Dorrepaal C. 739 

Douat P.H. V58 

Douglas J. 58, 811, 1051 

Doumerc N. 261 

Drăgoescu O.D. 577 

Drake M.J. 161, 506, 737, 1004, 

1089 

Drake T. 811 

Drewa T.D. 869 

Dridi M. 520 

Drogendijk T. 1089 

Droller M. 577 

Droupy S. 112, 261, 681 

Duarte M. 628 

Duarte R. 650 

Dubey S. 56 

Dubrowinskaja N. 198 

Duchin K. 402 

Duclos-Morlaes B. 681 

Dudziec E. 56 

Dufour R. 218 

Duivenvoorden W. 939 

Dukic I. 44 

Dulak J. 597 

Dumas J.P 458 

Dumitrache D.M. 17 

Dumont Martinez R. 10, 1007 

Duong K. V62 

Durand M. 352, 1059 

Durand X. 283 

Dusik S. 709, V14 

Dwarkasing R.S. 217 

Dyrskjot L. 238 

E 

Eardley I. 502, 617 

Eastham J.A. 715 

Eberli D. 246, 799, 868, 874 

Ebra G. 299, 689, 1013 

Edamatsu H. 33 

Edelstein M. 169 

Eden C. 351 

Edwards J. 902, 905, 989 

Effenberger K. 802 

Efstathiou J.A. 822 

Egawa S. 98 

Egerdie B. 108 

Egevad L. 287 

Eggener S. 138 

Eggers H. 348 

Eggesbø H.B. 221 

Eggink A.J. 870 

Egrot C. 366 

Ehlert M. 119 

Ehrbar M. 868 

Ehrenstein V. 675 

Eichelberg E. 1006 

Eimer C. 251 

Eisa M. 640 

Eisenberg M.S. 957 

Ekrutt J. 867 

El Fayoumy H. 511 

El Hajj A.E. V15 

El Yazami Adli O. 244, 785, 891 

El-Bendary M.A. 214 

El-Bilsha M.A. 934 

El-Gamasy A. 214 

El-Ghoneimy M.N. 536 

El-Halwagy S. 928, 1028 

El-Hefnawy A.S. 934 

Eladl M. 836 

Elaidi R. 104 

Elbendary L. 416 

Elder J.S. 526, 534 

Eldred-Evans D. 16 

Elemento O. 156 

Elhage O. 835 

Eliwa A.M. 416 

Elkassaby A. 793 

Elleberg Petersen S. 683 

Ellinger J 286 

Elmissery M. 537 

Elnahas A.R. 1069 



437 

Indices

Indices 


Elsaesser J. 703 

Elsalmy S. 537 

Elsayed D. 836 

Elsayed E.R. 416 

Elsherif E. 792 

Eltahawy E.A. 793 

Eltze E. 465 

Emberton M. 138, 181, 218, 267, 

353, 584, 585, 717 

Eminaga O. 465 

Enatsu N. 33, 35, 842 

Encabo G. 682 

Endo M. 252 

Engel O. 866 

Engeler D.S. 310 

Engelmann U.H. 624, 890 

Engilbertsson H. 750, 1029 

Ennas M. 817 

Enokida H. 52, 772 

Eory L. 766 

Epstein J. 287 

Erbersdobler A. 195, 393 

Erdil T. 163 

Erdmann K. 984 

Erdogan M.S. 89 

Erickson A.M. 274 

Erkan A. 615 

Erozenci A. 529 

Ervandian M. 683 

Escaf S. 277 

Escobar Z. 826 

Escudier B. 87, 1105 

Escórcio De Almeida F.A. 380 

Esperto F. 412 

Espiridião P. 895 

Esposito A. 832 

Esser M. 364 

Essig M. 458 

Esteban M. 746 

Esteban Fuertes M. 888 

Esuvaranathan K. 758 

Eto M. 941, 982 

Evangelista L. 357 

Evans A. 988 

Evans J.D. 453 

Even A. 304 

Eylert M.F. 230 

Eyraud R. 256, 257, 816, V2, V22, 

V27 


F 

Faber D.J. 594 

Fabregat Prous J. V63 

Fagan A. 355 

Faggioni L. 1008 

Fahlenkamp D. 461 

Fahmy B.M. 641 

Faison T. 474, 929 

Faivre D'Arcier B. 483 

Fajkovic H. 474, 576, 752 

Falke J. 153, 700 

Fall M. 664 

Fallowfield L. 99 

Fan Y-H. 784 

Fanizza C.F. 408, 1093, 1094 

Fankhauser C.D. 635, 637 

Fantechi R. 264 

Farag F. 995 

Fardoun T. 87, 852, 1105 

Farè E. 83, 388, 397, 398, 1055, 

1057 

Faried A. 293 

Farin E. 1067 

Farina E. 714 

Fariña L. 40, 760 

Farmakis A. 548 

Fasoli L. 855 

Fasolis G. 864 

Fassi-Fehri H. 999 

Fatton B. 743 

Favaretto R.L. 557 

Favro M. 1004 

Fayyazi A. 143, 373 

Featherstone J. 3 

Feber A. 51, 58 

Feciche B. 340 

Feitz W.F.J. 870, 872, 995 

Feldmann H.J. 192 

Felix-Patrício B. 29 

Feng T. 36, 837 

Fenn N. 3 

Fenoglio D. 770 

Feola A. 252 

Fera C. 448 

Ferakis N. 548 

Fernandes K. 988 

Fernandes L. 628 

Fernandez E. 379 

Fernandez J. 229 

Fernandez M. 40 

Fernandez Barranco L. 113 

Fernandez-Gomez J.M. 277 

Fernandez-Pello Montes S. V42 

Fernando A. 593 

Fernando R. 725 

Fernando Y. 123 

Fernández G. V19, V38, V44 

Fernández J.M. 702 

Fernández Fernández A. 501 

Fernández Ibieta M. 422 

Fernández Lucas C. 730 

Fernández-Serra A. 10 

Ferrandino M. 967 

Ferrarese P. 319 

Ferrari N. 439 

Ferraz L. 895 

Ferrera F. 770 

Ferretti L. 96 

Ferriero M.C. 480, 881, 1038, V23, 

V46 

Ferrière J-M. 96, 763 

Ferzauli A.H. 845 

Fes Ascanio E.A. 113 

Feyaerts A. 415 

Fhima M. 679 

Fiala R. 680 

Fiard G. 563, 564 

Ficarra V. 78, 172, 186, 254, 258, 

264, 290, 340, 887, 913 

Fielding J. 777 

Figueiredo A.J.C. 13, 375, 1079, 

1082 

Figurin K. 90 

Filaci G. 770 

Filipski K. 62 

Finch W.G. 658 

Fine S.W. 715 

Finelli A. 270, 588, 886, 988 

Finocchio N. 714, 918 

Finol M.G. V36 

Fiorentino M. 271, 711 

Fiori C. 172, 204, 219, 264, 459, 630, 

710, 875, 887, V11 

Fiorino C. 183, 184 

Fiorito C. 130 

Fisch M. 425, 752, 802, 866, 1002 

Fischer J.W. 155 

Fischer K. 1046 


Fiter Gómez L. 730 

Fitzsimmons W. 739 

Fizazi K. 97, 104, 108 

Flaig T.W. 105 

Flam T. 141 

Flamand V. V28 

Flechon A. 104 

Fleischmann A. 1044 

Fleshner N.E. 270, 588, 988 

Flugel R. 402 

Fode M. 122 

Foditsch E.E. 884 

Fontana D. 95, 376, 431, 864, 1066, 

1071 

Fontas E. 1059 

Fonteyne V. 191 

Fop F. 431, 1066 

Forastiere E. 881, V23, V46 

Forde J.C. 15 

Fornara P. 91, 263, 382, 461, 949, 

1046, V1, V50 

Foroudi F.F 85 

Fossa S. 106 

Fossati N. 140, 467, 651, 695 

Fossion L.M.C.L. 1037 

Fowler L. 137, 848 

Fowler S. 298 

Fradet Y. 97, 276, 577 

Fraga A. 380 

Franceschelli A. V56 

Franco A. 313, 436, 595, 746, 993 

Franco E. V41, V63 

Franco M. 622 

Frank D. 123 

Frank I. 75, 924 

Franken J. 441 

Frånlund M. 4 

Franzem M. 1102 

Frea B. 95, 259, 376, 431, 864, 880, 

1066, 1071 

Freeman A. 51, 58, 218, 267, 584, 

585, 717 

Freitas A.R. 895 

Freixa R. 208 

Freschi M. 137, 187, 331, 467, 473, 

694 

Fresno F. 277 

Freudenberger T. 155 

Frey F.J. 555 

Friedersdorff F. 859 

Friedman A.A. 534 

Friedrich-Freksa M. 1025 

Friis S. 858 

Fritsche H-M. 225, 282, 286, 573, 

575, 576, 601, 815, 822, 1067 

Froghi S. 14 

Fröhlich O. 897 

Frohme C. 728 

Fröhner M. 1058 

Fromont G. 483, 1040 

Frumenzio E. 258, 290, 913 

Fry C.H. 314 

Frydenberg M. 946 

Fryer L. 823 

Fu D.J. 840 

Fuellhase C. 443 

Fuessel S. 984 

Fujii T. 199 

Fujii Y. 311 

Fujii Y. 76, 240, 470, 572, 578, 586, 

756, 819, 950, 979, V21, V61 

Fujimoto H. 98 

Fujimoto K. 456 

Fujimoto N. 676 

Fujimura T. 333 

Fujioka T. 77 

Fujisawa M. 33, 35, 487, 663, 842, 

862, 940, 983, 1047 

Fujishima N. 1104 

Fujita M. 199 

Fujita T. 613 

Fujiwara T. 492 

Fujiyama N. 1100 

Fukuhara H. 834 

Fukuhara H. 333 

Fukui I. 572 

Fukumoto K. 199 

Fukushima H. 819 

Füllhase C. 67, 68, 447, 847, 906, 

909 

Fumey J. 500 

Funahashi Y. 779 

Funyu T. 613 

Furriel A. 30, 413, 903 

Furriel F. 13, 375, 1079, 1082 

Furukawa J. 862 

Furusawa M. 603 

Furuya Y. 938 

Fusco F. 172, 396, 560 

Futterer J.F 138, 582 

Fuzzi G. 855 

G 

Gaboardi F. 817 

Gacci M. 259, 411, 412, 693, 817, 

1014 

Gadda G.M. 583 

Gaetani L. 302 

Gaffney E. 355 

Gaire R.K. 849 

Gaisa N. 871 

Gajda M. 56, 194, 774 

Gakis G. 364, 812, 822, 861, 1022, 

1049, 1054, V59 

Galante Romo I. 334 

Galasso A. 861 

Galeano Álvarez C. 379, 501 

Galiano M. 352, 589, 679, 883, 1020, 

V48, V64 

Gallagher F.A. 142, 224 

Galland S. 822 

Gallego Matey A. 805 

Galli E 439 

Gallina A. 140, 183, 187, 289, 467, 

473, 695, 714, 918, 953 

Gallo C.B.M. 413 

Gallo Rolania F.J. V60 

Gallucci M. 480, 881, 1038, V23, 

V46 

Galustian C. 835 

Gamal O.Z. 420 

Gamal W. 528 

Gameel T.A. 214 

Gan C. 1033 

Gan M. 258, 290, 913 

Gandaglia G. 69, 289, 694, 714 

Gandee L. 168 

Ganzer R. 225, 944, V17 

Garaffa G. 129 

Garat J.M. 531, 532 

García C. 498 

García G. 543 

Garcia L. 639 

Garcia S. 245 

Garcia Barreras S. 730 

García-Cruz E. 125, 206, 383 

García Diez F. V60 



439 

Indices

Indices 


Garcia Garcia N. 730 

García González L. 125 

García Gómez B. 125, 773 

Garcia Montes F. 113 

Garcia-Baquero Garcia De Paredes 

R. V33 

Garcia-Cruz E. 208, 489, 595, 993 

Garcia-Larrosa A. 595, 993 

Garcia-Mediero J.M. V5 

García-Olaverri Rodríguez J. 498 

Garcia-Rojo D. 229 

Garcia-Sanchez C. 804, 917 

Garcia-Segui A. 524 

García-Tello A. 1030, 1034, V7, V8, 

V9 

Garcia-Vargas J. 101 

Gardella B. 894 

Gardikis S. 423 

Garofalo M. 454, 711 

Garrou D. 219, V11 

Garza R. V19, V38, V44 

Gascoyne-Binzi D. 502, 617 

Gasser T. 167, 618 

Gattenloehner S. 712, 947 

Gausa L. 281, 372, V49 

Gaya J.M. 281, 284, 352, 362, 372, 

485, 883 

Gazquez C. 236 

Gazzaniga P. 55 

Geavlete B.F. 522, 570, V37 

Geavlete P.A. 522, 542, 570, V37 

Gebauer K. 198 

Gebhardt T. V31 

Gederaas O.A. 152 

Geiges G. 371 

Gelabert A. 229 

Gelet A. 180 

Gentile B.C. 486 

Gentile G. V56 

Gentile V. 11, 11, 55, 591 

Gentilucci A. 11 

Georgas E. 251 

George A. 552 

George D.J. 100 

Georgescu D.A. 570 

Georgiopoulos I. 25, V4 

Geraerts I. 1000 

Germann C. 554 

Gerritsen W. 106 


Gertner M.R. 588 

Gerullis H.G. 251 

Getzenberg R.H. 102, 1048 

Geutjes P.J. 870, 872 

Gevaert T. 441, 513 

Gevher F. 479, 529 

Gey S. 930 

Gezer M. 479 

Ghani K.R. 20, 119, 158, 260, 369, 

497, 526, 534, 625, 657, 659, 

885, 915, 1070, V14, V25 

Ghavamian R. 1031 

Ghei M. 736 

Ghoneim M. 1038 

Ghoneim T. V28 

Ghorbel J. 520 

Ghosh N. 541 

Ghozzi S. 520 

Giancane S. 172 

Giannakopoulos S. 423 

Giannantoni A. 147, 300, 302, 303, 

670 

Giannatempo P. 83, 388, 397, 398, 

1055, 1057 

Giannella R. 592 

Gianni A. 83, 1055, 1057 

Giatromanolaki A. 423 

Giedelman C. 299, 352, 1013, V6, 

V10 

Gierth M.S. 225, 282, 286 

Giese A 68 

Gigliobianco G. 110 

Gil Diez De Medina S. 430 

Gilfrich C. 461 

Gill I.S. 138, 220, 265, 361, 835, V6, 

V45, V79 

Gilloteau I. 476 

Gimbernat H. V9 

Gimel P. 170, 171, 176 

Giovannone R. 591 

Giraudo L. 245 

Giron A.M. 650 

Giulianelli R. 486, 580 

Giuliano F. 304, 449, 900 

Giusiano S. 245 

Giusti G. 459 

Gjertsson I. 664 

Gjorgjievska K. 203 

Glass J. 658 

Globe D. 308 

Gnanapragasam V.J. 142, 224 

Goad J.R. 539 

Goddard J. 42 

Godet J. 1040 

Goebell P.J. 1102, 1106 

Goh A. V79 

Goi Y. 446 

Golbeck S. 347 

Goldman H. V3 

Goldstein I. 123 

Golz R. 192 

Gomelsky A. 732 

Gomes G.H.A. 1082 

Gomez A. 993 

Gomez V. 379 

Gómez Del Cañizo C. 501 

Gómez-De-Regil L. 973 

Gómez Dos Santos V. 501 

Gómez Gómez G. 385 

Gómez-Ferrer A. 10, 1007 

Gómez Rivas J. 556, 1036 

Gomez Sancha F. 634 

Gómez-Veiga F. 99, 498 

Gomha M.A. 668 

Gomis A. 379 

Gomis Couto A. 501 

Goncharova R.I. 278 

Gonella A. 95, 864 

Gontero P. 130, 468, 471, 686, 688, 

697, 708, 752, 815, 911, 929 

Gonzalez C. 277 

Gonzalez N. 1068 

Gonzalez R.R. 638 

Gonzalez Huergo J.F. 229 

Gonzalez Rodriguez I. V42 

Gonzalez-Torres S. 312 

González C. V75 

Good D.W. 922 

Goodfellow A.I. 477 

Goodman, Jr. O.B. 105 

Goonewardene S. 296 

Gopalan V. 672 

Gorbunova I. 1086 

Gordon E.M. 846 

Gordon S.A 846 

Goren A. 476 

Gorgal Rodrigues De Carvalho T. 

627 


Górnicka B. 279 

Gorny D. 900 

Gosalbez Garcia D. 34, 378, 595, 

993 

Gossmann M. 250 

Gotoh M. 288, 404, 747, 779 

Gotoh S. 819 

Gotohda N. 92 

Götze L. 1099 

Gouveia Oliveira A. 628 

Govorov A. 186, 350 

Goyal A. 654, 963 

Gözen A.S. 23 

Gozzi C. 1008 

Graafland N.M. 387, 392 

Gradilone A. 55 

Graefen M. 137, 139, 293, 294, 359, 

474, 685, 802, 848, 920, 1015, 

1018, 1023 

Graeser R. 824 

Graham J. V57 

Graham J. 523 

Graham T.R. 453 

Granata D. 486 

Grande S. 219, 710, V11 

Grange P. 16, 879 

Granger B. 734 

Grasso A.A.C. 692 

Grasso M. 692 

Grasso M. 1067 

Gratzke C. 68, 443, 447, 629, 847, 

906, 907 

Gravis G. 104, 1053 

Graw M. 844 

Gray R. V78 

Greco F. 91, 263, 382, 461, 949, V1, 

V50 

Green D.A. 276 

Green W. 516 

Greene P. 598 

Greenwell T.J. 775, 776 

Gregori A. 817 

Gregorini F. 70 

Gregório B.M. 29, 30, 413, 903 

Grenabo A.L.A. 2 

Grenabo L. 740 

Grenier N. 87, 1105 

Gres P. 283 

Griffin T. 97 

Grimm M-O. 56, 194, 774 

Grimm T. 923 

Grinyov A. 169 

Grise P. 743 

Gritti A. 259 

Grobholz R. 133 

Grollman A.P. 234 

Groskopf J.C. 1045 

Gross A.J. 636 

Gross O. 637 

Gross-Weege M. 1052 

Grosse J. 250, 448, 871 

Grossman H.B. 577 

Grossmann N. 635, 637 

Grotenhuis A. 697 

Grubb R. 138 

Gruellich C. 341 

Gruenwald I. 131 

Gschwend J.E. 189, 386, 565, 809, 

1011 

Gsponer J.R. 945 

Gu X. 901 

Guaglianone S. 480, 881, 1038, V23, 

V46 

Guate J.L. 229 

Guazzoni G. 137, 139, 186, 254, 289, 

467, 473, 583, 695, 848, 855, 

918 

Gubbiotti M. 300, 302, 303, 670 

Gudeloglu A. 841, V51, V52, V76 

Gudima I.A. 845 

Gudjónsson S. 750, 1029 

Guerrer C. 301, 305 

Guichard G. 426, 427, 429 

Guillot A. 104 

Guimaraes G.C. 399, 557 

Guimerá M. 34 

Guirao Piñera M.J. 422 

Gulamhusein A. 777 

Guleryuz K. 500 

Gülpınar Ö. 646, 647 

Gündogdu C. 417 

Gunnemann A. 897 

Guohua Z. 320 

Gupta A. 752 

Gupta N.S. 709, V14 

Guru K. 14, 19, 20, 1031, 1032 

Gurung P.M.S. 51, 58 

Gust K.M. 50 

Gutierrez C. 746 

Gutierrez P. 498 

Gutin A. 719 

Gutiérrez Gutiérrez P.F. 385 

Guttilla A. 357, 1017 

Gutue C.S. 17 

H 

Ha H.K. 551, 691, V47 

Ha J.Y. 986 

Ha S.B. 860 

Ha U.S. 445 

Haab E. 1004 

Haab F. 726, 743, 896, 999, 1004 

Haag-Molkenteller C. 741, 744 

Haber G-P. 255, 256, 257, 816, V2, 

V22, V27 

Haberkorn U. 227 

Habuchi T. 197, 610, 720, 1100, 

1104 

Häcker A. 321, 322, 1052 

Hadaschik B. 138, 222, 227 

Hadfield J. 935 

Haefner T. V17 

Haendler L. 912, 916 

Haese A. 137, 139, 186, 294, 848, 

919, 1018 

Haferkamp A. 286, 825, 830 

Haga K. 121 

Hager M. 884 

Hai M.A. 638 

Haider A. 207 

Haider M.A. 588 

Haillot O. 999 

Haineala B.C. 384 

Hainsworth J.D. 97 

Hakenberg O.W. 195, 393, 1067 

Hakim L. V71 

Hakim L. 252, 326, 468 

Hakimi Z. 1089 

Hakozaki A. 442 

Halac M. 479 

Halbert G.L. 902, 905, 989 

Hall E. 81 

Hall J. 623 

Hallas N. 775 

Hallscheidt P. 341, 344 

Ham W.S. 177, 1012 

Hamacher J. 890 



441 

Indices

Indices 


Hamamoto S. 311 

Hamberg H. 287 

Hamdy F.C. 135 

Hamid R. 775, 776 

Hammad F. 609 

Hammdy A. 528 

Hammerer P.G. 207 

Hammers H.J. 100 

Hamoen E.H.J. 12 

Han D.H. 538 

Han D.J. 490 

Han H.H. 519 

Han J-Y. 632 

Han J.H. 786 

Han M 719 

Han Y.F. 36 

Hancock M.L. 102 

Hanitzsch H. 707 

Hanna N. 820, 927, 956, 960 

Hannan J. 326, 327 

Hannon Y.A. 146 

Hansen J. 686, 920, 1015 

Hansen S. 683 

Hanson D. 631 

Hanzawa T. 121 

Hara I. 767, 821 

Harada K. 985 

Haraz A. 928 

Harding C. 781 

Harewood L.M. 849 

Hariu K. 228 

Harke N. V18 

Harraz A.M. 1028, 1069 

Harrison D.J. 766 

Hart A.R. 762 

Harza M. 384 

Hasan T. 781 

Hascicek M. 642 

Hasegawa M. 959 

Hasegawa S. 818 

Hasegawa T. 337 

Hashimoto Y. 79, 82, 197, 463, 602, 

613, 720 

Hashimoto Y. 821. 937 

Hashitani H. 66 

Hasigov A.V. 419 

Hasner F. 707 

Hassan H. 37, 843 

Hassett J. 20 


Hassouna M. 307 

Hasunuma N. 1104 

Hatakeyama S. 79, 82, 197, 463, 

602, 613, 720, 1042, 1104 

Hatton A. 846 

Hatzichristodoulou G. 565, 809 

Hatzichristou D. 733 

Hatzinger M. 46 

Haubold K. 1046 

Haunschild J. 671 

Hauser J. 356 

Haustermans K. 182, 360, 806 

Hautmann R. 151 

Havrenak E. 600 

Hawaux E. 800 

Hawkins R.E. 1101 

Hayakawa N. 242 

Hayashi K. 578 

Hayashi M. 450 

Hayashi N. 1103 

Hayashi T. 1108 

Hayashi T. 50 

Hayashi Y. 442 

Hayes M. 811, 1051 

Haymann J-P. 438 

Hayn M.H. 1031, 1032 

Healy S. 434 

Heck M. 809 

Hedi R. 520 

Hedlund P. 67, 68, 69, 146, 324, 326, 

327, 328, 329, 331, 443, 447, 

651, 831, 832 

Heesakkers J.P. 63, 995 

Hefermehl L.J. 246, 635, 637 

Hegarty P. 1033 

Hegele A. 728, 1099 

Heidegger I. 7, 644, 803, 829 

Heidenreich A. 106, 452, 674, 801 

Heijmink S.W.T.P. 217 

Heimann D. 358 

Heinrich D. 101 

Heinrich E. 24, 1019 

Heinz-Peer G. 345 

Heinzelbecker J. 1052 

Heinzelmann J. 774 

Heinzer H. 107, 359, 685, 920, 1006, 

1018, 1023 

Helfand T. 126, 407 

Hellawell G. 268 

Helle S.I. 101 

Hellsten R. 826 

Helou E. V26, V29, V32, V65, V73 

Hemal A.K. 1031, 1032 

Henderson R. 1096 

Hendricken C. 725 

Hendriks J.C.M. 755 

Heng D.Y.C. 1107 

Henneges C. 1096 

Hennenberg M. 906, 907, 909 

Hennenlotter J. 198, 364, 365, 899, 

1022, 1049, 1054, V59 

Hennus P.M.L. 648 

Henry N. 896 

Hensel J. 942 

Heo N.J. 860 

Herkommer K. 189, 565, 809, 1011 

Herman M. 474 

Hermann E. 286 

Hermann G.H. 577 

Hermanns T. 635, 637 

Hermans T.J.N. 1037 

Hernandez R.K. 675 

Hernandez-Fernandez C. 606, 607 

Hernández C. 498 

Hernández V. 482, 757 

Herr H.W. 749 

Herrmann T.R.W. 91, 575, 601, 636, 

656, V74 

Herschorn S. 739, 740, 744 

Hersey K.M. 988 

Hertle L. 461 

Herwig R. 1067 

Heschel I. 250, 870, 871 

Hess J. 559 

Hetet J-F. 87, 283, 1105 

Heus I. 912 

Heusch G. 251 

Hevia Palacios V. 346, 501 

Heyman S. 202 

Heß J. 155 

Hickson I. 824 

Hidaka H. 52, 772 

Hieda K. 462 

Hiess M. 1021 

Higashi Y. 572, 819 

Hillyer S. 256, 257, 876, V2, V3 

Hindley R.G. 585 

Hinke A. 192 


Hinkelammert R. 465 

Hinkelbein W. 182, 192, 806 

Hintz F. 559 

Hirakawa K. 931 

Hirao Y. 456 

Hirobe M. 337 

Hirohashi Y. 767 

Hirose M. 311 

Hirose Y. 311 

Hirshman S. 448 

Hisano M. 525 

Hitier S. 106 

Hitoshi N. 60 

Hlasny E. 588 

Hobbs C.P. 38, 45, 1077 

Hocaoglu Y. 906 

Hochreiter W. 160 

Hoda R. 1009, 1046 

Hodge P.N. 1045 

Hoehn A.K. 393 

Hoenderop J.G. 63 

Hoenjet E. 648 

Hofer C. 1011 

Hoffmann U. 365 

Hofmann R. 338, 728, 1099 

Höfner T. 286 

Høgset A. 153 

Hohenfellner M. 222, 227, 286, 341, 

344 

Hohneder A. 365, 1049 

Hoinoiu B. 884 

Holder D.D. 284, 485 

Hollenbeck B.K. 1031 

Hollywood D. 355 

Holm-Larsen T. 405, 406 

Holmäng S. 569, 571, 701, 751, 752, 

754, 929 

Holmberg E. 2 

Holmberg M. 683 

Homma Y. 64, 67, 333, 764, 1048 

Honeck P. 964 

Hong B. 80, 196, 478, 490 

Hong J.H. 80, 196, 469, 478, 771, 

807, 1097 

Hong M.K.H 849 

Hong S-H. 445, 611 

Hong S.J. 177, 269, 810 

Hong S.K. 1003 

Hong S. 410, 478 

Hong Y.K. 165 

Hongo F. 1056 

Honma I. 121 

Hoogenkamp H.R. 872 

Hopmans S. 939 

Hora M. 575 

Horenblas S. 387, 389, 390, 392, 

394 

Horgan P.G. 902, 905, 989 

Horiguchi A. 574, 827 

Horn L.C. 393 

Horn T. 809 

Horninger W. 7, 61, 644, 803 

Horsburgh B. 590, 1016 

Hortova K. 32 

Hoshi A. 21 

Hoshino K. 242 

Hoskin P. 58 

Hosseini-Aliabad A. 751, 1035 

Hou Y.C. 247 

Houlgatte A. 139, 283, 853 

Hounsome L.S. 230 

Hovens C.M. 53, 145, 704, 849 

Høyer M. 683 

Hoznek A. 438, 549, 716, V15 

Hrbacek J. 822 

Hrouda D. 600 

Hruby G.W. 284, 485 

Hruby S. 22, 660 

Hsieh C-H. 1064 

Hsieh J.T. 168 

Hsu C.Y. 468, 688, 911 

Hu J.H. 247 

Hu K. 28, 36, 837 

Hu L. 605 

Hu X. 859 

Huang C.Y. 234 

Huang C-H. 205 

Huang C-N. 205 

Huang E.Y-H. 738, 1088 

Huang H.H. 200 

Huang J. 193 

Huang S-P. 205 

Huang J.S. 684, 784 

Huang Y.H. 515 

Huang Y.R. 28, 36, 837 

Huber A. 133 

Huber J. 341, 344 

Hubert J. 136, 170, 171, 176 

Hübner A. 1106 

Hubner M. 926 

Hübner W. 575, 601 

Hueber P.A. 638 

Hughes P. 477 

Hughes S. 477 

Hugosson J. 2, 4, 808 

Huguet Pérez J. 378, 489, 494 

Huh K.O. 1005 

Huland H. 293, 295, 802, 1018, 1023 

Hulsbergen-Van De Kaa C. 287 

Humanes-Sanchez B. 606, 607 

Humphries E. 719 

Hunju L. 649 

Hupertan V. 576 

Huppertz N. 448 

Hurault De Ligny B. 500 

Hurtz H.J. 1102 

Husein M. 528 

Hussain M. 100 

Hutterer G.C. 347 

Hwang E.C. 464 

Hwang I. 464 

Hwang J.H. 165 

Hwang J.W. 786 

Hwang T-K. 445, 611 

I 

Iacoboaie C. 522 

Iacovelli N.A. 183, 185 

Ibanez-Tallon I. 62 

Ibishev H.S. 845 

Iborra Juan I. 10, 1007 

Ibrahim E. 836 

Ide H. 242, 818 

Idesako T. 52 

Idzenga T. 995 

Ifu G. 746, 888 

Igawa Y. 64, 67 

Iglesias Rutishauser K. 926 

Ignacio C. V44 

Ihrig A. 341 

Iinuma T. 8 

Iizuka J. 821 

Ikawa K. 504 

Ikeda K. 504 

Ikeda K. 462 

Ikezawa E. 821 

Ilbey Y.O. 553 



443 

Indices

Indices 


Ilyas R. 316 

Imai A. 79, 82, 463 

Imamura M. 523 

Imamura M. 66 

Imanishi K. 602 

Imbimbo C. 396, 560, 622, V55 

Imkamp F. 656, V74 

Immenroth M. 16 

Impedovo S. 662 

Inferrera A. V1 

Ingelmo-Torres M. 236, 237 

Ingels A. 761, 975 

Inoue K. 834 

Inoue S. 462, 666 

Inoue T. 610, 1100, 1104 

Inoue T. 1103 

Intilla O. V67 

Ioannides E-I. 733 

Ip De Coruña I. 362 

Ip De Vall D'Hebron I. 362 

Iqbal M. 661, 967 

Irani J. 136, 483, 697, 1040 

Irjala H. 154 

Irving S.O. 658 

Irwin B. V6 

Isbarn H. 226, 802, 866, 1006, 1023 

Isebaert S. 360 

Iselin C.E. 356, 721 

Ishida H. 603 

Ishii C. 240 

Ishii K. 978 

Ishii T. 1108 

Ishika J. 819 

Ishikawa H. V68 

Ishikawa N. 492 

Ishimura F. 1042 

Ishioka J-I. 76, 240, 470, 572, 578, 

586, 756 

Ishioka K. 818 

Ishizaki J. 931 

Ismail F. 1033 

Isoyama T. 339, 925, 951 

Itarte E. 768 

Ito A. 21 

Ito K. 8 

Ito K. 57, 144, 574, 827, 976, 977 

Ito M. 699 

Ito Y. 242 

Itoh K. 98 


Itoh Y. 311 

Itoh Y. 311 

Ivanenko O. 507 

Ivanovski O. 203 

Iversen P. 273, 674, 858 

Iwamoto H. 339, 925, 951 

Iwamoto Y. 978 

Iwamura M. 21 

Iwasaki K. 77 

Izawa J. 1050 

Izquierdo Reyes L. 237 

Iztueta I. 6, 682 

J 

Jacobs C.D. 1101 

Jacquemet B. 426 

Jado J.C. 606, 607 

Jaeger W. 50 

Jahnson S. 481, 751, 751 

Jakobsen H. 122 

Jalal A. 23 

Jalkanen S. 154 

James N. 51, 239 

Jameson C. 51, 267 

Janetschek G. 22, 884 

Jang H.J. 266, 280, 297, 538 

Jang S.H. 1072 

Jang W.S. 464 

Janitzky V. 461 

Janssen D.A.W. 63 

Janssen M. 338, 348, 703, V31 

Jarvelin M-R. 910 

Javed S. 351 

Javor D. 345 

Jecu M. 570 

Jefferies E.R. 230 

Jeffrey K. 468 

Jenks J. 775, 776 

Jenster G.W. 824 

Jeon H.G. 266, 280, 297 

Jeon S.S. 266, 280, 297 

Jeon S.H. 612 

Jeong B.C. 266, 280, 297 

Jeong C.W. 1003 

Jeong H. 860 

Jeong I.G. 478, 490, 771, 807, 1097 

Jeong J.W. 1003 

Jeong S.J. 1003 

Jeong U.S. 266, 280, 297, 538 

Jeong W. 260, 369, 657, 709, 885, 

V14, V25 

Jeschke S. 22 

Jeung J.S. 551 

Jewett M.A.S. 588 

Ji Y. S. 116, 349 

Jiang B. 149, 604, 605 

Jiang H.W. 9 

Jiao Y. 901 

Jichlinski P. 926 

Jiménez Cidre M.A. 379, 746, 888 

Jimenez Mateos-Cáceres P. 334 

Jiménez Alcaíde E. 125, 1073 

Jiménez Calvo J. 888 

Jin J. 308 

Jin Y. 36, 837 

Jinga V. 17, 966 

Jintetsu J.S. 215 

Jinzaki M. 818 

Jo Y. 199 

Jocham D. 461, 577 

Johansson M. 826 

Johansson S.L. 571 

Johnson M. 81 

Jones A. 47, 48 

Jones E. 81 

Jones L.A. 1045 

Jones R. 81 

Jones S. 400 

Jones T.H. 211 

Jong T.P.V.M. 648 

Jong Jin O. 165 

Joniau S. 182, 188, 360, 468, 471, 

686, 688, 697, 806, 911, 1000 

Jonsson M. 1035 

Joo K.J. 409 

Josephson D. 1031, 1032 

Joung J.Y. 410, 478, 1001, 1097 

Jozkowicz A. 597 

Juang H-H. 148 

Junaid I. 654 

Jünemann K.P. 188, 358 

Jung H. 974 

Jung H.C. 116, 349 

Jung H.R. 986 

Jung H.J. 535 

Jung J.H. 997 

Jung J-L. 170, 171, 176 

Jung K. 859 


Jung S. 612 

Jung S.I. 464 

Jung T.Y. 519 

Jüngel E. 830 

Junker K. 56, 194, 338, 774 

Jutzi S. 656 

K 

Kabbinavar F.F. 193 

Kachrilas S. 654, 963 

Kaczmarek B. 876, V24 

Kader A.K. 1031, 1032 

Kadoyama K. 1085 

Kaestner L. 545 

Kaifu M. 199 

Kaiser C. 539 

Kajioka S. 450 

Kajiwara M. 462, 666 

Kakies C. 393 

Kalaitzi M. 733 

Kalaitzis C. 423 

Kälble T. 192, 461 

Kallidonis P. 25, 91, V4 

Kalpinskiy A.S. V43 

Kamata S. 572, 819 

Kamel G. 547 

Kamimura N. 602, 1042 

Kamoi K. 215, 414 

Kamota S. 931 

Kampouri K. 423 

Kamradt J. 74, 828, V31 

Kanao K. 242, 715, 818 

Kanda H. 978 

Kandimalla R. 54 

Kaneda T. 931 

Kaneko G. 959 

Kanematsu A. 66 

Kanemitsu N. 215 

Kang J. 901 

Kang S.M. 124, 691 

Kang S.H. V47 

Kang T.W. 464, 997 

Kanno Y. 931 

Kanomata N. 199 

Kanthabalan A. 717 

Kanzaki S. 931 

Kaouk J. 20, 91, 255, 256, 257, 552, 

816, 876, V2, V3, V22, V27, V30 

Kaplan S. 740 

Kapoor R. 1027 

Kaps H. 306 

Karakiewicz P. 78, 140, 178, 233, 

276, 474, 573, 576, 701, 752, 

754, 814, 820, 929, 956, 1024 

Karatas A. 381 

Karim O. 475, V78 

Karl A. 577, 923 

Karmakar D. 541 

Karnes J.R. 187, 188, 471, 686, 688, 

694, 697, 911 

Karsenty G. 245 

Karup C. 678 

Kasivisvanathan V 138, 218 

Kasraie J. 846 

Kassouf W. 573, 576, 813 

Kastner C. 142 

Kasyan G.R. 115 

Kata S. 434, 599 

Katano H. 931 

Kataoka T. 33 

Kato H. 938 

Kato M. 978 

Kato M. 288 

Kato Y. 77 

Katsuhiro F. 60 

Kaushal D. 633 

Kaushik D. 957 

Kawaguchi M. V68 

Kawakami S. 76 

Kawamura S. 720 

Kawan F. 382, V50 

Kawanishi S. 132 

Kawanishi Y. 132 

Kawano Y. 941, 982 

Kawano Y. 228 

Kawauchi A. 215, 414, 552 

Kay T. 477 

Kaya C. 117 

Kayali M. 615 

Kayanuma K. V68 

Kazuhiro K. 60 

Kazuhiro S. 8 

Kedia G.T. 904 

Keegan K.A. 822 

Keil C. 1099 

Keller H. 790, 795, V70 

Kelly J. 51, 58 

Ken-Ichi M.K. 444 

Kenjiro K. 60 

Kent M. 754, 814, 815 

Keppenne V.M. 780 

Kergoat M. 449 

Kern J. 829 

Kesavadas T. 19, 20 

Kesavan N. 758 

Kessler T.M. 70, 665 

Keten T. 615 

Khairy Salem H. 511 

Khalifeh A. 255, V2, V3, V22, V27, 

V30 

Khalil S. 416 

Khan F. 49, 1075, 1081 

Khan F. 783 

Khan M.S. 14, 1031, 1033 

Khan S.A. 19, 1031, 1032 

Khan M.S. 477 

Khatami A. 808 

Khaw K.T. 762 

Khazaeli D. 1035 

Kheoh T. 97, 105 

Khiari R. 520 

Khouni H. 520 

Khullar V. 308, 672, 725, 741, 910 

Kibel A.S. 1031, 1032 

Kieft J.H. 648 

Kihara K. 76, 240, 470, 572, 578, 

586, 756, 819, 950, 979, V21, 

V61 

Kijima T. 578, 979 

Kikkawa K. 767 

Kikuchi E. 242, 813, 818, 959 

Kilani T. 520 

Kilicarslan H. 652 

Kim A. 410, 490, 533 

Kim B.S. 253, 428 

Kim B.W. 253, 428 

Kim B.H. 986 

Kim C.H. 974 

Kim C-S. 80, 196, 466, 469, 478, 771, 

807, 1097 

Kim C.I. 535, 986 

Kim D. 533 

Kim D.S. 612, 691 

Kim D.Y. 519 

Kim H.Y. 213 

Kim H.J. 488 

Kim H.T. 253, 428 



445 

Indices

Indices 


Kim J.H. 325 

Kim J.W. 955, 994 

Kim J. 177 

Kim J. 469, 1005, 1010 

Kim J.W. 955, 994 

Kim J.J. 280 

Kim K.H. 974 

Kim K.B. 1003 

Kim K.H. 349, 986 

Kim K.K. 213 

Kim K.S. 533 

Kim K.H. 269, 771, 810, 1012 

Kim K.T. 974 

Kim K.H. 1012 

Kim M.K. 488 

Kim S.W. 445, 611 

Kim S.D. 691 

Kim S.J. 460 

Kim S.U. 325 

Kim S.P. 75, 924 

Kim S. 551 

Kim S.W. 332 

Kim S. V47 

Kim S.J. 445, 611 

Kim S. 435 

Kim S.Y. 213 

Kim S.I. 460, 519 

Kim S.O. 464 

Kim T.B. 974 

Kim T.H. 253, 428 

Kim T.S. 551, 691, V47 

Kim W. 490 

Kim Y.J. 997 

Kimuli M.N. 549 

Kimura T. 492 

Kimura T. 98 

Kimura Y. 1056 

Kin S. 199 

Kinder R.B. 783 

King K. 51 

Kingsmore D. 374, 377, 495 

Kingswood J.C. 981 

Kinoshita H. 21 

Kinsella J. V62 

Kira S. 71 

Kirby A.C. 910 

Kirkham A.P. 218, 267, 391, 585, 

717 

Kirkwood L. 157 


Kirschner-Hermanns R. 448 

Kitahara S. 819 

Kitamura H. 337, 603 

Klatte T. 575, 601, 991 

Klaver M. 1089 

Klein J. 356 

Klein J. 23 

Kleinclauss F. 283, 426, 427, 429 

Klimov A.V. 954 

Klingler H-C. 345, 991 

Klink J. 256 

Klocker H. 7, 803, 829 

Kloke H.W. 493 

Klorek T. 1011 

Klosterhalfen B. 251 

Klotz D. 221 

Klotz L. 138 

Klotz T. 461 

Kluth L.A. 78, 151, 156, 276, 473, 

474, 573, 701, 724, 752, 754, 

813, 814, 815, 929, 1004 

Kneitz B. 936 

Knipper S. 636 

Knoll T. 660, 964, 1067 

Knox J.J. 1107 

Ko M. 767 

Ko W.J. 519 

Ko Y.H. 116, 349 

Kobayashi H. 242, 818 

Kobayashi J. V68 

Kobayashi K. 462, 666 

Kobayashi M. 446 

Kobayashi S. 240, 756 

Kobayashi T. 311 

Kobayashi T. 92 

Kocaturk H. 417 

Kockelbergh R.C. 81, 455 

Kocot A. 282, 863 

Kodama Y. 767, 821 

Koehler C. 321 

Koellermann J. 393 

Koen M. 644 

Koga F. 76, 240, 470, 572, 578, 586, 

756, 819, 950, 979, V21, V61 

Kogan M.I. 212, 419, 787, 797, 845, 

857 

Kogevinas M. 229 

Koh L.T. 318, 343 

Kohjimoto Y. 767 

Köhler A. 348 

Kohri K. 311 

Koie T. 79, 82, 197, 463, 602, 613, 

720, 1042 

Koike H. 938 

Koizumi S. 71 

Koji O. 60 

Kok E.T. 135 

Kolesnyk M. 159, 892 

Kollberg P. 750 

Kölle S. 844, 847 

Kollias S. 70 

Kollmannsberger C.K. 1107 

Komai Y. 92 

Komohara Y. 982 

Komyakov B.K. 562 

Kondo T. 821 

Kong D. 604 

Koni A. 642 

König F. 371 

Konstantinidis C. 6, 682 

Konstantinidou E. 733 

Koo B. 142 

Kopp R. 552 

Kopper B. 461 

Korahanis N. 171 

Kosaka T. 818 

Köse O. 111, 794 

Kotov S.V. 796 

Kotov V. 94 

Koumi T. 925 

Kouriefs C. 879 

Koutlidis N. 283 

Kovylina M. 350 

Kowalczyk A. 145, 849 

Kowalczyk T.K. 869 

Kowey P. 739 

Kowlaczyk A. 53 

Kozakowska M. 597 

Kozlov R. 169 

Krahn T. 1046 

Kramer G. 345 

Kranzbühler B. 637 

Krasny S.A. 278 

Krasteva-Christ G. 62 

Kraus S. 722 

Krause A. 461 

Krebs M. 936 

Krege S. 559 


Kretschmer I. 155 

Kristiansen G. 287, 393 

Kristmundsson T. 1029 

Kroeger N. 193, 1107 

Kron M. 189, 1011 

Kruck S. 306, 629, 656, 1062, V71 

Kruglikov V. 159, 892 

Ktech N. V36, V39 

Ku J.Y. 691 

Kübler H. 809 

Kubo T. 676 

Kubota Y. 1103 

Kucharczyk W. 588 

Kuczyk M.A. 198, 241, 329, 338, 

348, 656, 904, V74 

Kuderinov S. 893 

Kudo S. 602 

Kudou S. 84 

Kuehhas F.E. 345, 1067 

Kueppers F. 108 

Kufer R. 151 

Kufner M. 549 

Kühs U. 364, 1049 

Kukk L. 680 

Kulchavenya E. 620 

Kulkarni G. 270 

Kulkarni P. 1048 

Kumagai J. 824 

Kumagai L.Y. 557 

Kumano M.K. 487 

Kumar R. 876, 885, V14, V24, V25 

Kumar P.V.S. 47, 48 

Kumar V. 418, 421, 424 

Kume H. 333, 764 

Kummer W. 62 

Kumsar ¸S. 111, 794 

Künstle G. 671 

Kun Suk K. 649 

Kundt G. 195 

Kuntz N.J. 653, 661, 967 

Kunz A. V18 

Kuo H-C. 742, 1090 

Kuppevelt T.H. 870 

Kurita Y. 998 

Kuroda K. 574, 827 

Kuroiwa K. 765 

Kurosch M. 825 

Kurtz F. 386 

Kuru T.H. 222, 227 

Kurz M. 70 

Kusama H. 446 

Kusuma M. 400 

Kusumoto H. 767 

Kutta N. 461 

Kwiatkowski M. 133 

Kwon C.H. 409 

Kwon D.D. 464, 519 

Kwon E. 151 

Kwon G.Y. 280 

Kwon J.B. 253, 428 

Kwon S.Y. 253, 428 

Kwon T.G. 253, 428 

Kyosuke K. 713 

Kypta R. 941 

Kyriazis I. 25, V4 

Kyung Hyun M. 649 

L 

La Croce G. 140, 187, 328, 363, 748 

La Macchia M. 183, 184 

Labanaris A.P. 690, V20, V34 

Lacarriere E. 283 

Lacombe M. 472 

Lacoste J. 472 

Ladurner Rennau M. 7, 803 

Lagabrielle S. 1105 

Laguna-Pes M.P. 13, 594 

Lahdensuo K. 274 

Lahme S. 143, 373, 461, 962 

Lahoz Garcia C. 312 

Lai M.K. 840 

Laird A. 298, 766 

Lam T. 370, 523 

Lam W. 389, 593 

Lamanna E. 579 

Lamche M. 1021 

Lammens M.M.Y. 870 

Lammers R.J.M. 700, 755 

Lanchbury J. 719 

Lanciotti M. 693 

Landkammer Y. 22 

Landman J. 598 

Lane J.A. 135 

Lang C. 72, 514 

Lang H. 170, 176 

Lang J.M. 171 

Langenhuijsen J.F. 336, 493 

Langley S. 351 

Laniado M. 475, V78 

Lanoe M. 458 

Lanwehr D. 293 

Lanz M. 623 

Lapini A. 93, 592, 887 

Larcher A. 137, 254, 583, 848, 855 

Largo R. 637, 868 

Larré S. 283, 483, 697, 778, 1004 

Larson T. 631 

Lasaponara F. 376 

Lau M.W. 395, 400 

Laudano M.A. 724 

Lavigueur-Blouin H. 175, 179, 233, 

262, 718, 927, 960, 1024 

Lavilledieu S. 283 

Lavrinenko A. 893 

Lawrence E.M. 142, 224 

Lawrentschuk N. 270 

Laydner H. 255, V2, V3, V22, V27 

Laymon M. 928, 1028 

Lazaro A.R. 200 

Lazaro-Fernandez A. 606, 607 

Lazarus J.M. 545 

Lazzeri M. 137, 139, 254, 583, 729, 

848, 855 

Le Coguic G. 472 

Le Corvoisier P. 137, 848 

Le Moulec S. 104 

Lebacle C. 283 

Lebdai S. 87, 1105 

Lebid L. 159, 892 

Lebret T. 681, 930 

Lechevallier E. 245 

Ledo Cepero M.J. V33 

Ledyaev D. 354 

Lee B. 257 

Lee B.K. 1003 

Lee C.J. 860 

Lee C.H. 691 

Lee D. 114 

Lee D.H. 269, 512 

Lee D.K. 435 

Lee H.J. 325 

Lee H.L. 435 

Lee H.M. 266, 280, 297 

Lee H.S. 1003 

Lee H.Y. 1012 

Lee J.H. 435 

Lee J.K. 1003 



447 

Indices

Indices 


Lee J-L. 1107 

Lee J.N. 253, 428 

Lee J.W. 317, 1072 

Lee J.Y. 445, 611 

Lee J.Y. 810, 1012 

Lee J.Z. 691 

Lee K.H. 1001 

Lee K.B. 460 

Lee K.S. 266, 280, 297, 538 

Lee L.S. 921 

Lee M.Y. 317 

Lee R.K 78, 276, 638, 724, 1004 

Lee S.C. 974, 1003 

Lee S.E. 1003 

Lee S.K. 213 

Lee S.M. 1005 

Lee S.H. 786 

Lee S.H. 269 

Lee S.J. 612 

Lee S.L. 318, 343 

Lee S-W. 538 

Lee S-Y. 100 

Lee W.K. 213 

Lee Y-C. 205 

Lee Y.G. 213, 786 

Lee Y.S. 213 

Leenders W.P.J. 336 

Lees M. 476 

Legal S. 283 

Legman P. 141 

Legoux C. 283 

Lehmann J. 74 

Leibar Tamayo A. 125 

Leibovich B.C. 957 

Leichtle U. 1062 

Leidenberger P. 1049 

Leitenberger A. 461 

Lemack G.E. 722 

Lenaghan D.R. 539 

Lenherr O. 143 

Lenkiewicz E. 945 

Leon Zamorano J.J. 334 

Leonardi R. 561 

Leong H.S. 1050 

Leonhäuser D. 448, 871 

Leroy X. 237 

Lerut E. 360 

Leslie S. 220, 265, 361, V45, V79 

Leto A. 914 


Leva Vallejo M. 888 

Levine E. 558 

Lewis D. 833 

Lewis D. 161 

Lewis H. 53 

Lewis J. 1050 

Lewis R. 81 

Lewith G. 275 

Leydon G. 275 

Leyh-Bannurah S-R. 359, 1023 

Li F. 33, 35 

Li H. 119 

Li H. 162, 249, 505 

Li J. 105 

Li J.M. 932 

Li N. 50 

Li W. 901 

Li Marzi V. V69 

Liao C.H. 335, 742, 1090 

Liao Y. 149, 948 

Liatsikos E. 25, 91, 660, 1067, V4, 

V17 

Liberati E. 698 

Liberman D. 638 

Libertino J. 854 

Liebhardt M. 1052 

Liedberg F. 750, 751 

Liede A. 675 

Liedl B. 844, 847, 897 

Liguori G. 614, 838, V55 

Lilja H. 4, 850, 856, 858, 1039 

Lillaz B. 95 

Lim B.J. 410, 490, 533 

Lim G.S. 1072 

Lim J.H. 478 

Lim L.Y. 623 

Lim S.K. 810 

Lima E.A.R. 968 

Limani K. 800 

Lin A.T.L. 515, 684, 735, 738, 1088 

Lin C.D. 1064 

Lin C-C. 515, 735, 738, 784, 1088 

Lin H.H. 723 

Lin J-P. 738, 1088 

Lin M.I. 723 

Lin W.A. 723 

Lin W.C.P. 684 

Lin X. 9 

Lindblom G. 481 

Lindholm C. 664 

Lindner U. 588 

Ling T.L. 784 

Lipczyński W. 597 

Lipkin M.E. 653, 661, 967 

Lipowska-Bhalla G. 1101 

Liske P. 143, 373, 962, 1067 

Lissiani A. 817 

Lista F. 524, V5 

Lista G. 137, 254, 583, 848, 855 

Litman H. 722 

Littleton R. 659 

Litzensberger A. 195 

Liu C.C. 205 

Liu F. 9 

Liu F. 149, 948 

Liu J.H. 932 

Liu M. 149 

Liu S.P. 335 

Liu X. 326, 327 

Liu X. 604, 605 

Liu Y. 320 

Liu Y.P. 840 

Lizée D. 726, 896 

Ljungberg B 751 

Lledo-Garcia E. 498, 606, 607 

Llorens De Knecht E. 531, V41, V63 

Llorens Martinez F.J. 888 

Llorente C. 482, 757 

Lloyd T. 367 

Lluel P. 440 

Lo F. 935 

Loch T. 461 

Lodde M. 61 

Loeser A. 863 

Logadottir Y. 664 

Logothetis C.J. 97 

Lohse C.M. 957 

Lokeshwar B. 937 

Lokman U. 274 

Lokshin K. 1086 

Lombardi A. 828 

Lombardo R. 412 

Long D. 948, 961, 1061 

Long J.A. 87, 256, 257, 563, 564, 

816, 1105, V2 

Long R.M. V17 

Longo F. 596 

Longo N. 172, 396, 560 


Lopater J. 930 

Lopes A. 399, 557 

Lopes T. 210 

López B. 482 

Lopez J.M. 532 

Lopez L. V26, V29, V32, V65, V73 

Lopez-Beltran A. 287, 393 

Lopez Carmona F. 312 

López-Costea M.A. V41, V63 

López Cubillana P. 385 

López-Fando Lavalle L. 346, 888 

Lopez Farre A. 334 

López González P. A. 385 

López-Guerrero J.A. 10 

López-Hellin J. 768 

López-Pacios M.A. 768 

López Sánchez D. 556, 1036 

Loran O.B. 796 

Lorente Garcia D. 682, 768 

Lorenz A. 1062 

Losa A. 583 

Lossnitzer A. 1058 

Lotan Y. 78, 276, 474, 576, 701, 752, 

754, 813, 814, 815, 929 

Lotfi A. 511 

Loutochin O. 244, 785, 891 

Lozano F. 232 

Lozano J.J. 236, 237 

Lozano M. 491 

Lu S-H. 315 

Lubbad L. 609 

Luben R. 762 

Lucarelli G. 662, V49 

Lucas C. 387 

Lucatello B. 95 

Luccarelli G.L. 372 

Lucci Chiarissi M. V11 

Luciani L.G. 459, 509 

Lucianò R. 187, 331, 694 

Lück A. 1106 

Lücke K. 1046 

Lucky M. 400 

Lüdecke G.C. 371, 707 

Ludt F. 728 

Ludwig T.A. 1002 

Lughezzani G. 137, 254, 388, 398, 

848, 855 

Luiz M. V58 

Łukasik D. 279 

Lumen N. 191 

Lunardi P. 283 

Lunelli L. 352, V64 

Luque M.P. 206, 208, 313, 436 

Lusch A. 598, V33 

Lusuardi L. 22, 815, 884 

Lv Y.Q. 28 

Lynch C. 590 

Lynch M. 879 

Lynch T.H. 355 

Lynn N.N.K 846 

M 

Maaroufi J. 520 

Maccagnano C. 363, 748 

Maccario M. 95 

Macdiarmid S. 741 

Macek P. 352, 883, V48, V64 

Machado N.C. 30 

Macintyre G. 53, 145, 849 

Mackenzie M.J. 1107 

Mackenzie R. 799 

Maclean D. 100 

Maclennan S. 523 

MacNeil S. 109, 110, 873 

Madaan S. 49, 1075 

Madero R. 702 

Madersbacher S. 992 

Madurga Patuel B. 888, V33 

Maegbaek M.L. 675 

Maekawa S. 764 

Maeta K. 33 

Maffezzini M. 864 

Magalon G. 245 

Magalon J. 245 

Maggi M. 211, 411 

Magri V. 160 

Magyar C.E. 193 

Mahendran R. 758 

Mahfouz W. 537, 891 

Mahmalji W. 49 

Maini C.L. 480 

Mainwaring P. 97 

Makanjuola J.K 16, 879, 1076 

Makar A. 296 

Makarevic J. 825, 830 

Malats N. 229, 238, 697 

Malavaud B. 136 

Malet J.M. 229 

Mallofre C. 237 

Malmsten U.G.H. 120 

Malmstrom P. 238, 697 

Malone-Lee J. 736 

Malossini G. 459, 509, 619 

Maltry N. 941 

Mamoulakis C. 521, 523 

Mandal S. 541 

Mändar R. 216 

Mandhani A. 1027 

Manea I. 384 

Maneschi E. 411 

Manferrari F. 454, 711 

Manfredi M. 219, 710, V11 

Mangano A. 1017 

Mangera A. 910 

Mangiapia F. 560, 622 

Mangiarotti B. 596 

Manjunath A. V57 

Manka L. 133 

Mannweiler S. 347 

Mano R. 697, 815 

Maraj B.H. 736 

Maramhy H. 836 

Marcelli F. V28 

Marchesi J.R. 161 

Marchioro G. 686, 688, 864, 911 

Marconi L.S.O. 13, 375, 1079, 1082 

Marcén Letosa R. 501 

Marechal J-M. 180 

Marenghi C. 368 

Margaritis Guler S.S. 384 

Margolis D. 138 

Margulis V. 78, 576, 813 

Mari M. 864 

Mariani C. 1008 

Mariani L. 83, 1055 

Mariani S. 517 

Marien A. 220 

Marignol L. 355 

Marks L. 138 

Maroof A. 836 

Marsaud A. 1059 

Marschner N. 1102, 1106 

Marshall J. 868 

Marszałek A.M. 869 

Martel J. 482 

Martha J. 211 

Martin N. 401, 739 



449 

Indices

Indices 


Martin X. 170, 171, 180, 705 

Martin-Morales A. 211 

Martínez Castaño I. 422 

Martínez Peralta H.L. 385 

Martínez-Piñeiro J.A. 702 

Martínez-Piñeiro L. 702, 851 

Martínez-Salamanca J.I. 576, 813, 

1004 

Martini T. 592 

Martins Silva C. 669 

Martinschek A. 24, 1019 

Martorana G. 172, 264, 271, 454, 

693, 711, 887 

Maruccia S. 540, 566, 567, 798 

Maruschke M. 195 

Maruyama K. 446 

Maruyama S. 931 

Marx G. 99 

Marzocco M. V69 

Masago T. 339, 925, 951 

Masala A. 592 

Masaru K. 60 

Masashi K. 713 

Maschino A. 850 

Mascle L. 352 

Masedu F. 698 

Masieri L. 93, 259, 693 

Masius R. 54 

Mason M. 106 

Masood J. 654, 963 

Masoud A. 668 

Massard C. 104 

Massie C. 935 

Masson-Lecomte A. 261, 283, 753 

Massoner P. 829 

Masuda H. 76, 240, 470, 572, 578, 

586, 756, 819, 950, V21, V61 

Masumori N. 337, 404, 603, 747 

Mateo E. 1030, 1034, V5, V7 

Mateos A. 229 

Mateu L. 595 

Mathieu R. 852 

Matikainen M. 1039 

Matloob R. 140, 173, 467, 953 

Matsubara A. 462, 666 

Matsuda H. 931 

Matsuda T. 21 

Matsukawa Y. 288, 779 

Matsumoto K. 242, 818 


Matsumoto M. 663 

Matsumoto R. 998 

Matsumoto R. 931 

Matsumoto T. 676 

Matsumura N. 767 

Matsuo K. 288 

Matsuo T. 150 

Matsuoka Y. 76, 240, 470, 572, 578, 

586, 756, 819, 950, V21, V61 

Matsushita K. 33, 35, 842 

Mattei A. 554 

Matthes K. V12 

Matthes S. 194 

Matveev B. 90 

Matveev V.B. 88, 90, 954 

Maulà V. 147 

Maurer S. 243, 248, 791 

Maurer T. 809 

Maurin C. 87 

Mavilla L. 486 

Maxwell P. 935 

May M. 282, 286, 340 

Mazerolles C. 483 

Mazzoli S. 166, 508, 509, 619 

Mazzon G. 838 

Mazzotti G. 579 

McCartan N. 585 

McCluskey S.A. 588 

McCormack G. 296 

McDougall E.M. 598 

McGovern M. V62 

McGregor R. 963 

McKiernan J.M. 284, 485 

McLeod N. V57, V66 

McNeill S.A. 298, 922 

McNicholas T. 137, 848 

McVary T. 126, 407 

Meacci F. 508 

Meaney J.F. 355 

Mearini L. 933 

Medeiros Jr J.L. 29 

Medica M. 264, 887 

Medina R. 232, 362 

Medina-Lopez R.A. 804, 917 

Medina-Polo J. 773, 1073 

Meehan R.R. 766 

Meeks J.J. 749 

Mege-Lechevallier F. 180 

Mehedint D. 882 

Mehik A. 160 

Mehner J. 890 

Mehnert U. 70 

Meidahl Petersen P. 683 

Meiers I. 353 

Meinhardt M. 984 

Meinhardt W. 392, 394 

Meister B. 322, 323 

Méjean A. 170, 171, 176 

Melamed J. 138 

Melchior-Becker A. 155 

Mele F. 219, 710, V11 

Meliani E. 508 

Mencarini M. V69 

Mengual L. 236, 237 

Menigoz A. 441 

Menon M. 20, 119, 158, 260, 369, 

497, 526, 534, 625, 657, 659, 

709, 885, 915, 1031, 1070, V14, 

V24, V25 

Menon S. 935 

Mentine N. 1059 

Mercier F. 104 

Merigot De Treigny O. 87 

Mermerkaya M. 527, 646 

Merseburger A.S. 198, 282, 329, 

575, 601 

Meseguer A. 768 

Meskawi M. 175, 178, 233, 262, 

718, 820, 927, 956, 1024 

Mestre C. 378 

Metcalfe C. 135 

Meuleman E.J. 211 

Meyer D. 310 

Meyer S.E. 1045 

Miah S. 44 

Mian C. 61 

Micali S. 439 

Micco M. 823 

Michaelson D. 100 

Michel M.S. 321, 322, 323 

Michels L. 70 

Michiels J.F. 1059 

Michio N. 59 

Michl U.H.G. 293, 295, 1006, 1018, 

1023 

Mickisch G.H. 680 

Miernik A. 1067 

Miersch J. 907 


Mihalache A. 542 

Miki T. 8, 215, 414, 1056 

Milani A. 83 

Miljak M. 906 

Millan F. V35 

Miller D. 32 

Miller F. 629, 861, 1022, V59 

Miller K. 108, 192, 678, 853, 859 

Miller O. 894 

Mills I. 935 

Milner V. 296 

Milsom I. 120, 739 

Mimata H. 444 

Min G.E. 435 

Minagawa S. 228 

Minami K. 931 

Minami T. 98, 1108 

Minami T. 1108 

Minervini A. 93, 172, 259, 264, 340, 

592, 887 

Minhas S. 129, 391 

Minich A. 958 

Minnillo B. V12 

Miocinovic R. 816 

Mirabile G. 486 

Mirciulescu V. 542, V37 

Mirone V. 264, 289, 340, 396, 560, 

622, 714, 887, 1014, V55 

Mirtti T.K. 154, 274 

Mirylenka L.V. 285, 958 

Mirzazadeh M. 558 

Mischinger J. 1054 

Mishriki S. 370 

Mistretta F.A. 69, 254, 328, 583 

Mitchell T.J. 823 

Mitra A. 815 

Mitsunari K. 150 

Mitsuru S. 610 

Mitsuzuka K. 720 

Mitusov V. 419, 787, 797 

Miura M. 1100 

Miyaji Y. 199 

Miyajima A. 21, 242, 818, 959 

Miyajima N. 931 

Miyake H. 33, 35, 487, 663, 842, 

862, 940, 983, 1047 

Miyamoto K. 462 

Miyamoto T. 71 

Miyata Y. 150 

Miyazaki Y. 242, 818 

Miyazaki Y. 699, 1091 

Miyazawa Y. 938 

Miñana B. 232, 362 

Mmdouh A. 528 

Mochizuki T. 931 

Mochizuki T. 71 

Modlin C. V3 

Mofferdin A. 439 

Mohammed A.A. 455 

Mohammed N. 382, V50 

Mohanad M. 966 

Mohee A. 502, 617 

Mohrhardt S. 364 

Moiseenko T. 350 

Mojena-Sanchez M. 606, 607 

Molander U. 120 

Moldoveanu C. 570 

Molimard B. 283 

Molina A. 97, 105 

Molina R. 1068 

Molisso G. V67 

Moll J.M. 824 

Moltzahn F. 688 

Mombelli G. 996 

Mombet A. 589, 1020 

Momma T. 242, 818 

Momokazu G. 713 

Monagas Arteaga S. V60 

Mondaini N. 166, 509, 619 

Mondino P. 174 

Mongiat-Artus P. 87 

Monish A. V6 

Monrós Lliso J.L. 10, 1007 

Monsalve C. 496 

Montanari E. 596 

Montes De Oca L. 108, 587 

Montesino M. 702 

Montiel R. V36, V39 

Montironi R. 287 

Montorsi F. 78, 173, 575, 576, 601, 

693 

Moon D.G. 955, 994 

Moon K.H. 116, 349 

Moon S.H. 538 

Moore C. 138, 218, 267, 275 

Morales M. 437, 1043 

Moran D.C. 355 

Moran S. 100 

Moran Pascual E.J. 543 

Mordasini L. 665 

Moreira C. 168 

Morelli A. 411, 579 

Moreno Alarcón C. 385, 422 

Moreno Jimenez J. 312 

Morgenthaler N.G. 1046 

Morgia G. 864 

Mori H. 132 

Mori K. 79, 82, 197, 1042 

Morikawa H. 228 

Morikawa N. 504 

Morimoto S. 572, 819 

Moriya T. 199 

Morizane S. 339, 925, 951 

Morlacco A. 880 

Morlacco A. 259 

Morote J. 6, 108, 682, 768 

Morra I. 875, V11 

Morris S. V62 

Mortezavi A. 799, 868 

Mortimer P. 100 

Mosaheb N. 127 

Mosbah A. 928, 1028, 1038 

Moschini M. 146, 331, 363, 748, 953 

Moseley H. 599 

Mosquera J. 229 

Moss S. 2 

Mostafa M. 836 

Mostafa S. 836 

Mostafid H. 230 

Mota A. 375, 1079 

Mota P.K. 525 

Motiwala H. 475, V78 

Motoshima T. 982 

Mottet N. 136, 170 

Mottrie A. 254, 1031, 1032 

Mottrie A. 186, 258, 290, 913 

Mourey E. 171, 176 

Mouri G. 931 

Moursy E. 528 

Moussa A. 537 

Mueller-Allisaat B. 321 

Muftuoglu S. 643 

Muguruma H. 132 

Mühr M. 194 

Mulders P.F.A. 97, 105, 336, 980 

Mulhall J. 123 

Mulla M. 16 



451 

Indices

Indices 


Müller A. 635, 637 

Muller B.G. 594 

Müller G. 167, 618 

Müller L. 1102, 1106 

Müller S.C. 286 

Müller Arteaga C. 888 

Mullins J. 876 

Multescu R.D. 570, V37 

Mundhenk J. 364, 1022, 1049, 1054, 

V59 

Muneer A. 129, 391 

Munegato S. 174 

Mungan N.A. 128 

Muntañola P. 229 

Murakami R. 613 

Muramaki M. 862 

Murat P. 823 

Murby B. 395 

Murez T. 283 

Murphy D.G. 946 

Mursi K. 536 

Murta C.B. 525 

Muselaers C.H.J. 336, 980 

Musitelli S. 1078 

Musquera Felip M. 378, 383, 489, 

491, 494, 496, 498, 639 

Muthen N. 890 

Mynderse L. 631 

Mytilekas K-V. 733 

N 

Na R. 9, 901 

Nabebina T.I. 278 

Naber K. 166 

Nabi G. 599 

Naboka Y.L. 845 

Nagae G. 764 

Nagahama K. 572, 819 

Nagai A. 199 

Nagata Y. 764 

Nagele U. 91, 549, 656, 1062, V74 

Naito S. 450, 765 

Naitoh Y. 215, 414 

Nakagawa K. 21, 242, 818, 959 

Nakagawa M. 52, 772 

Nakagawa T. 98 

Nakagomi H. 71 

Nakaigawa N. 1103 

Nakajima H. 121 


Nakajima Y. 818 

Nakamoto M. 361, V45, V79 

Nakamura K. 504 

Nakamura T. 1056 

Nakamura Y. 77 

Nakanishi Y. 240 

Nakano Y.N. 487 

Nakashima T. 132 

Nalagatla K 969 

Nam J.K. 759 

Nanda J. 766 

Naoto S. 713 

Napodano G. V67 

Napoli R. 838 

Nappi R.E. 894 

Naranov S.V. 797 

Narayanan R. V12 

Nardo C. 741, 744 

Nardoni S. 486 

Narita S. 610, 720, 1100, 1104 

Narumi S. 613 

Nasopoulou P. 548 

Naspro R. 173 

Nassif L.T. V58 

Nasu Y. 503 

Nativ O. 202 

Nativ O. 202 

Naumann C.M. 358 

Nawfal G. 547 

Naya Y. 215, 1056 

Nayar R.C. 1074 

N'Dow J. 523 

Neal D. 135, 823, 833, 935 

Necchi A. 83, 388, 397, 398, 1055, 

1057 

Negoro H. 66 

Negrini S. 770 

Negrão R. 210 

Neidle S. 823 

Neisius A. 653, 661, 967 

Nekeman D. 239 

Nelson A.W. 142 

Nelson W.G 943 

Nemade H. 510 

Nemoto R. 223 

Nepple K. 1031, 1032 

Nesi G. 166, 411 

Nesius D. 461 

Nestler S. 342 

Netsch C. 636 

Neuzillet Y. 87, 283, 930 

Newling D. 706 

N Fukuda M. 602 

Nguyen-Nielsen M. 675 

Ni K. 837 

Nichele S. V58 

Nicita G. V69 

Nicolai M. 173 

Nicolai N. 83, 388, 397, 398, 1055, 

1057 

Nicolau C. 313, 436 

Nicolazzo C. 55 

Nicosia V. 368 

Nieboer D. 139 

Niedworok C. 155 

Niehrs C. 941 

Nieuwenhuijzen J. 706 

Nigawara T. 463 

Nigro F. 319 

Niimi A. 333 

Niimi K. 311 

Nikitin O.D. 507 

Nikolov I.G. 203 

Nilsson J. 677 

Nini A. 69, 140, 473, 687, 694, 918 

Nir D. 353 

Nishikawa G. 504 

Nishikawa N 66 

Nishimatsu H. 333 

Nishimura S-I. 197 

Nishizawa O. 404, 747 

Nishizawa S. 767 

Nison L. 575 

Nita G. 542, V37 

Nitkin D.M. 621 

Nitta T. 121 

Nitti V. 401, 739, 744 

Nitzke T. 1025 

Nockher A. 1099 

Noguchi M.N. 444 

Noh C.H. 727 

Noldus J. 718 

Nolley R. 761, 975 

Noma T. 442 

Nomiya A. 333 

Nomiya M. 446 

Nomura T. V68 

Nonis A. 185, 473 


Nonomura K. 931 

Nonomura N. 943 

Nørgaard J.P. 405, 406 

Noris Chiorda B. 184 

Noro A. 572, 819 

North S. 97, 1107 

Notoya T. 1104 

Novara G. 78, 172, 258, 264, 290, 

340, 573, 575, 576, 813, 814, 

815, 913, 990 

Nowell C.J. 849 

Nozawa M. 98, 1108 

Ntanios F. 740 

Nuhn P. 286 

Nukui A. 492 

Numakura K. 610, 1100, 1104 

Numao N. 76, 240, 470, 572, 578, 

586, 756, 819, 950, V21, V61 

Nunes P.T.C. 13, 375 

Nyberg T. 912, 916 

Nyek Ntep N. 439 

Nyushko K.M. V43 

O 

Oakley N. V57, V66 

Obara W. 77 

Obata J. 242, 818 

Obek C. 479 

Ober P. 962 

Obermueller N. 608 

O'Brien C. 3 

O'Brien T. 298, 477, 568, 1033 

Ochelenko V.A. 562 

Ochiai A. 215 

Ockrim J.L. 775, 776 

Oddens J. 708 

Oderda M. V26, V29, V32, V65, V73 

Odeyemi I. 1089 

Odone-Filho V. 650 

O'Donnell M. 766 

O'Donovan J. 865 

Oelke M. 782, 1095 

Ogawa O. 66, 1085 

Ogawa S. 764 

Oger S. 449, 900 

Ogura K. 699, 1091 

Oh C.Y. 786 

Oh C.K. 551 

Oh J.H. V47 

Oh J.K. 974 

Oh K.J. 464 

Oh M.M. 955, 994 

Oh T.H. 519 

Ohara S. 462, 666 

Ohba K. 150 

Ohira S. 199 

Ohlmann C-H. 74, 703, V31 

Ohlstein E.H. 440 

Ohnmacht S. 823 

Ohyama C. 79, 82, 197, 463, 602, 

613, 720, 1042, 1104 

Ojea A. 702 

Okada A. 311 

Okada K. 33, 35, 842 

Okada S. 228 

Okamoto A. 79, 82, 463, 1042 

Okamoto T. 602, 1042 

Okhunov Z. V33 

Okihara K. 8 

Okinami T. 66 

Okuno T. 572, 819 

Okuno Y. 1085 

Okuno Y. 764 

Okyar G. 417, 616 

Olagui G. 235 

Olarte Barragán E.H. 385 

Olbert P. 728, 1099 

Olde Damink L.H. 870 

Olesen T.K. 677 

Olianas R. 867 

Oliveira C. 968 

Oliveira M. V72 

Oliveira P.D. 898 

Oliveira R.A.R. 399, 557 

Oliveira R.M. 898 

Olivier F. 679 

Olivier Gómez C. 334 

Ollandini G. 838 

Olsson M. 912, 916 

Omae K. 821 

O'Mahony F.C. 766 

Omar A. 475 

Omar M.I. 523 

Omer A. 384 

Omorphos S. 391 

Omran M. 416 

Onal B. 529 

Onder A.U. 529 

Ono N. 503 

Ono T. 931 

Ooiwa Y. 228 

Oosterwijk E. 153, 336, 872, 980 

Oppenheimer F. 491, 496 

Orange C. 902, 905, 989 

Orczyk C. 500 

Orimoto N. 442 

Ornek T. 128 

Orntoft T. 238 

Osawa T. 931 

Osborne J.D. 367 

Osborne M. 935 

Osman N. 109, 110 

Osman Y.M. 928, 1028 

Osman-Garcia I. 804, 917 

Osmonov D.K. 188, 358 

Ost P. 191 

Osterberg E.C. 724 

Osther P.J.S. 1067 

Oswald D. 644 

Oswald J. 644 

Otero Tejero I. 40, 1073 

Oto A. 138 

Otsuka A. 998 

Otterlei M. 152 

Otto T. 251 

Otto W. 282, 286 

Oudard S. 99, 104 

Oudot A. 900 

Oussama M. 520 

Ouzaid I. 87 

Ouzzane A. 576 

Oya M. 242, 818, 959 

Oyen R. 360 

Oyen W.J.G. 336, 980 

Özcan C. 527, 646 

Ozdemir B. 645 

Özdemir B. 942 

Ozden E. 117, 163, 381 

Ozen H. 106 

Ozkaya F. 616 

Ozmerdiven G. 652 

Ozono S. 998 

Öztürk E. 527, 646, 647 

P 

Paborji M. 402 

Pacheco-Figueiredo L. 210 



453 

Indices

Indices 


Pacik D. 631 

Padhani A.R. 268 

Paez A. 1068 

Pages A. 705 

Pagi H. 680 

Pahernik S. 340, 341, 344 

Pai A. 48 

Paick J.S. 332, 860 

Pak S. 533, 807, 1005, 1010 

Pal P.O. 736 

Pal S.K. 1107 

Palacios J-M. 1095 

Palagin I. 169 

Palea S. 440 

Palermo S. 61 

Palleschi G. 517, 914 

Palmer K.J. 299, 689, 1013, V10, 

V13 

Palmer S. 138, 220 

Palmer T. 910 

Palmieri A. 396, 560, 622 

Palmieri F. 579 

Palminteri E. 798 

Palou Redorta J. 137, 232, 281, 362, 

372, 697, 702, 755, 760, 848, 

1031, 1032, V72 

Pan C.C. 287 

Pandey A. 790, 795, V70 

Pandit A. 3 

Panebianco V. 11, 591 

Pann R. 22 

Pantel K. 107, 802 

Pantuck A.J. 193 

Panumatrassamee K. V2, V3 

Paolini B. 1057 

Papadakis T. 62 

Papalia R. 480, 881, 1038, V23, V46 

Papandreou C. 106 

Paparel P. 87, 1105 

Papotti M. 219, 710 

Parada R. 372 

Paradowska-Dogan A. 27, 32 

Pardo P. 498 

Paredes D. 383, 491, 496 

Parekattil S. 841, V51, V52, V76 

Park B.H. 266, 297 

Park C.H. 986 

Park D.S. 165 

Park H.J. 409 


Park H.J. 124, 1092 

Park J-S. 535 

Park J.W. 1012 

Park J. 437 

Park J. 1005, 1010 

Park J.P. 488 

Park K. 464 

Park K. 332 

Park M.G. 209, 544 

Park N.C. 124, 1092 

Park S. 80, 196, 466, 469, 807 

Park S. 410, 533, 649, 771, 1097 

Park S.C. 317 

Park S.J. 165 

Park S.W. 632, 759 

Park S.Y. 177 

Park Y.K. 253, 428 

Park Y.C. 97 

Park Y.Y. 512, 612, 997 

Parker C. 101 

Parkinson R. 516 

Parma P. 259, 459 

Parmigiani A. 894 

Parodi A. 770 

Parr N. 395, 400 

Pascal Z. V6 

Paschos A. 939 

Pasini B. 95 

Pasquale G. 376 

Passaretti G. 271, 711 

Passariello R. 591 

Passoni N.M. 140, 187, 289, 474, 

687, 701, 714, 752, 918, 929 

Pasticier G. 96, 283, 763 

Pastore A.L. 517, 914 

Patani L.G. 655 

Patard J.J. 87, 170, 171, 176, 283, 

1105 

Patel A. 568, 1033 

Patel T. 841 

Patel V. 18, 299, 689, 1013, V10, 

V13 

Patil M. V45 

Patil P.A. 546, 550, 655 

Patni L.G 546, 550 

Patrick D. 99 

Patschan O. 750, 1029 

Pattaras J.G. 1031, 1032 

Paulus P. 608 

Pavan N. 614, 838, V55 

Pavlik I. 108 

Peabody J.O. 20, 158, 369, 497, 526, 

534, 625, 657, 659, 709, 915, 

1031, 1032, 1070, V14 

Pearce I. 44 

Pearson J. 157 

Pecoraro S. 561 

Pedersen J. 145, 849, 946 

Pedretti N. 1040 

Peehl D.M. 761, 975 

Peeker R. 120, 664 

Pelegrí J. 532 

Pelger R.C.M. 889 

Pellegrini F. 412 

Pellicer Cabo M. 1007 

Pellucchi F. 363, 748, 953 

Peltier A. 800 

Pena E. V39 

Pena-Outeiriño J.M. 804, 917 

Penna F.J. 526, 534 

Perabo F. 674 

Peraldo F. 130 

Percy A. 882, V12 

Perego R. 769 

Perepanova T. 169 

Pérez E. 757 

Perez M. 40 

Perez-Lanzac De Lorca A. 598, V33 

Pérez-Reggeti J.I. V41, V63 

Peri Cusi L. 378, 383, 489, 491, 494, 

496, 595, 639, 888, 993 

Perletti G. 160 

Pernetti R. 579 

Perrouin-Verbe M.A. 304 

Perry A. 355 

Perry M. 389, 593 

Persad R.A. 230 

Persson B-E. 677, 678 

Persu C. 542 

Pertusa Peña C. 498 

Perucchini L. 1041 

Peschechera R. 459 

Pesonen J. 910 

Peters G. 72, 514 

Peters I. 198 

Peters J.S. 849 

Peters M. 954 

Petkov T. 971 


Petkova K. 971 

Petkova N. 899 

Petracca A. 55 

Petrozza V. 517, 914 

Petrusevska G. 203 

Peyrat L. 896 

Peyromaure M. 141 

Peyronnet B. 283 

Peña E. V36 

Peña J.A. V72 

Pfister C. 170, 171, 176, 283, 483 

Pfister D. 452, 801 

Philpott-Howard J. 510, 1076 

Phull J.S. 367 

Phung D. 674 

Phé V. 304, 734 

Picard A. 705 

Pichler M. 347 

Pichler R. 644 

Pichon T. 1004 

Pickard R.S. 623, 781, 865 

Picozzi S. 368, 540, 566, 567 

Piechaud P-T. V26, V29, V32, V65, 

V73 

Pietropaolo A. 729 

Pignot G. 170, 171, 176, 235, 283 

Pillot P. 426, 427, 429 

Pini G. 382, V50 

Pinon C. 778 

Pinthus J. 939 

Pinto P. 138 

Pinto R. 627, 673 

Pinto S.J. 441 

Pinzi N. 887 

Pinzón Navarrete C.P. 385 

Piper C. 452, 801 

Piqueras M. 34, 639 

Pirozzi L.P. 408, 1093, 1094 

Pisano F. 130, 697 

Pisanti F. 486, 580 

Pisco J. 628 

Pisipati S. 783 

Pistolesi D. 1008 

Pittoni G.M. 1017 

Piva L. 83, 388, 397, 398, 1055, 

1057 

Pizzocaro G. 83, 1055 

Placer J. 6, 682 

Plainard X. 458 

Planas J. 6, 682 

Plaza Viguer B. 231, 805 

Plekhanova O. 23 

Ploumidis A. 916 

Ploussard G. 87 

Poggio M. 219, V11 

Pokrywczyńska M. 869 

Poletajew K. 43 

Poletajew S. 43, 279 

Polo Rodrigo A. 231, 805 

Polson A. V62 

Poluyanchik A.V. 958 

Polyakov S.L. 278 

Polyakov V.A. V43 

Ponce De Leon J. V49 

Ponce Diaz-Reixa J. 498 

Ponhold L. 345 

Ponholzer A. 992, 1021 

Pons Viver J. 556 

Pontillo M. 855 

Pontones Moreno J.L. 231 

Pook D. 946 

Poon B.Y. 749 

Popert R. V62 

Popken G. 461, 1025 

Popov A.A. 115 

Porena M. 147, 303, 670, 729, 933 

Porpiglia F. 172, 204, 219, 264, 459, 

630, 710, 875, 887, V11 

Porreca A. 259 

Porres D. 452, 801 

Porru D. 894 

Porst H. 211 

Porter J. 254 

Portillo Martin J.A. 702 

Potenzoni M. 1041 

Poth S. V16, V20, V34 

Potiron E. 472 

Poulakis V. 1031, 1032 

Poulakou-Rebelakou E. 41 

Poulias I. 548 

Power N. 1050 

Powles T. 58, 81 

Poyet C. 637 

Pozzi R. 700 

Prapotnich D. 589, 679, 1020 

Prats J. 229 

Pravorov A.V. 285 

Preda A. 384 

Preira J. 628 

Preminger G. 653, 661, 967 

Prera A. 229 

Presicce F. 412 

Priest A.N. 224 

Prieto L. 746 

Primus G. 1009 

Priola K. 841, V51, V52, V76 

Proietti S. 300, 302, 303, 670 

Protzel C. 393 

Pruthi R.S. 1031, 1032 

Pu Y.S. 234 

Puccini F. 672, 725 

Pucheril D. 659 

Pueche P. 138 

Pultrone C. 454 

Pummer K. 347 

Punab M. 216 

Punwani S. 138, 717 

Pushkar D.Y. 115, 186, 350 

Putter H. 889 

Pycha A. 61, 78, 276, 573, 592, 601, 

701, 752, 754, 813, 815, 929 

Q 

Qayyum T. 902, 989 

Qazi H. V17 

Qi D. 320 

Qi J. 901 

Qian Y. 99 

Qteishat A. 879 

Quarta M. 1041 

Quicios C. V75 

Quintens H. 283 

R 

Radavoi D. 966 

Radwan M.H. 420 

Radziszewski P. 43, 401, 741 

Raffaelli C. 1059 

Rafiq A. 62 

Raggi D. 83, 388, 397, 398, 1055, 

1057 

Ragni F. 204 

Raheem A.A. 129 

Raileanu A. 127 

Rais-Bahrami S. 91, 552 

Raita C. 790, 795 

Raja A. 952 



455 

Indices

Indices 


Rajan P. 910 

Ralph D. 129 

Ramadan A.R. 420 

Raman J.D. 78, 573, 576, 813 

Ramani V.A.C. 86 

Rambeaud J.J. 283, 563, 564 

Ramirez Backhaus M. 1007 

Ramirez-Martin D. 606, 607 

Ramon De Fata F. 524, 760, 1030, 

V9 

Ramos M. 380 

Ramos-Montoya A. 823, 833, 935 

Ramírez-Backhaus M. 10 

Ramón Y Cajal S. 768 

Ranasinghe A.M. 453 

Rancoita P. 185 

Randazzo M. 133 

Rankin S. 477 

Rannikko A. 274 

Rao A.R. 20, 475, 879, V78 

Rao G. 882 

Raspollini M.R. 93 

Rassweiler J. 13, 23, 461, 521 

Rassweiler M.C. 321, 322, 323 

Rastrelli G. 411 

Ratan H.L. 1080 

Ratcliffe N.M. 506 

Rathenborg P. 674 

Rathkopf D. 97 

Ratti D. 567, 996 

Raugei A. 93 

Ravery V. 87 

Ravi P. 915 

Ravic M. 700 

Rawandale A.V. 546, 550, 655 

Ray E.R. 577 

Raynal G. 432 

Raza S.J.R. 19 

Raßler J. 461 

Real F.X. 229 

Realfonso T. V67 

Rebmann U. 192, 461 

Recker F. 133, 272 

Regge D. 219, 710 

Regier M. 359 

Rehman S. 20 

Rehn S. 195 

Reichert M. 867 

Reid J. 719 


Reid S.V. 777 

Reis-Santos J.M. 1067 

Reiss P. 866, 1002 

Reiter M. 825 

Rekik M. 440 

Rempelakos A. 41 

Remzi M. 575, 576, 601, 813 

Renard O. 96 

Renninger M. 812 

Renter A. 137, 848 

Rentsch C.A. 945 

Rentzos L. 25 

Resende A.O. 898 

Reukers D.F.M. 12 

Reuter V.E. 715 

Revuelta I. 491, 496 

Rey D. V26, V29, V32, V65, V73 

Reyes Ríos P.Y. 422 

Rha K.H. 91, 177, 269, 810, 1031, 

1032 

Rha S.Y. 1107 

Rhew H.Y. V47 

Ribal Caparrós M.J. 232, 236, 362, 

378, 489, 494 

Ribeiro S. 380 

Ricci C. 540, 567 

Richard F. 734 

Richardson A. 275 

Richstone L. 91, 552, 1031, 1032 

Richter H. 722 

Ricós Torrent J.V. 10, 1007 

Riddick A.C.P. 766 

Ridout A.J. 267, 275 

Riechardt S. 425, 866, 1002 

Riedmiller H. 282, 286, 863, 936 

Rieken M. 167, 618 

Riera Canals L. 498 

Riethdorf S. 107 

Rigatti P. 173, 183, 184, 185, 187, 

188, 473, 695, 748, 953 

Rigaud J. 87, 170, 171, 176 

Righi D. 376 

Rijo Cedano E. 631 

Rim J.S. 317 

Rimington P. 1033 

Rinaldi A. 614 

Rini B.I. 1107 

Rink M. 78, 276, 802, 813, 814, 815, 

822, 1015 

Rio Tinto H. 628 

Rioja C. 760 

Rioux-Leclercq N. 87, 1105 

Ripoli A. 914 

Risbridger G.P. 946 

Rischmann P. 261, 283 

Riss J. 193 

Ritter M. 24, 321, 322, 323, 1019 

Ritter R. 365 

Rivas Del Fresno M. 229, V42 

Riveros M. V36, V39 

Rizkala E. 256, 552, V22, V27 

Rizzato L. 305 

Rizzi S. 271 

Rizzo M. 614, 838 

Robain G. 304 

Robert G. 96, 763 

Robertson A. 434 

Robertson W.G. 314 

Robine E. 87 

Robinson A. V62 

Robinson B.D. 151, 156, 276 

Robinson D. 782 

Robinson M. 1063 

Robinson S. 475 

Rocca G.C. 454, 711 

Rocchini L. 363, 748 

Rocco B. 186, 259, 340, 919, V10 

Rocco F. 172, 887 

Rochester M.A. 762 

Rode J. 549, V15 

Røder M.A. 273 

Rodrigues P. 968 

Rodriguez C. V38 

Rodríguez J. 702 

Rodríguez M. V75 

Rodríguez Antolín A. 125, 498 

Rodriguez De Vera J.M. 229 

Rodriguez Escobar F. 888 

Rodriguez Faba O. 281, 372, V49 

Rodríguez-Patrón Rodríguez R. 

346, 379 

Rodriguez Sierra P. 334 

Rodriguez Villamil L. V42 

Rodriguez-Malatesta R. V41, V63 

Roehrborn C. 1095, 1096 

Roelofs L.A.J. 870 

Roethke M. 222 

Rogel Berto R. 231, 805 


Rogenhofer N. 27 

Rogers B. 400 

Rogers C. 260, 497, 709, 876, 885, 

V14, V24, V25 

Roghmann F. 175, 178, 233, 262, 

718, 820, 927, 956, 960, 1024 

Roigas J. 286 

Rojas-Cruz C. V71 

Rolevich A.I. 278, 285, 958 

Rom M. 991 

Romagnoli D. 271, 711 

Roman S. 109, 110 

Romanenko O. 159 

Romano G. 880 

Romero D. 941 

Romero I. 1034, V8 

Romero M.R. 408, 1093, 1094 

Romero Otero J. 125 

Romics I. 1083 

Romics M. 1083 

Roobol M. 1, 5, 139, 850, 912 

Rooney S.J. 453 

Roos F.C. 338 

Roosen A. 907 

Rosales A. V72 

Rosario D. 568 

Roscigno M. 173, 340, 575, 601, 953 

Roseiro A. 375 

Rosen R.C. 211 

Rosenkrantz A. 138 

Roser F. 306 

Rosety Rodriguez J. V33 

Roskams T. 513 

Rossi M.S. 271 

Rossi De Vermandois J.A. 300, 302, 

303, 670 

Rossi Neto R. 559 

Rosso M. 817 

Roth B. 330 

Roth W. 344 

Röthlisberger S. 555 

Rothman N. 229 

Rothwell D.G. 1101 

Rottenberg G. V62 

Roudot Thoraval F. 716 

Rouffilange J. 87, 96 

Rouget C. 440 

Rouprêt M. 78, 87, 170, 171, 176, 

237, 261, 283, 304, 483, 575, 

576, 601, 734, 752, 1105 

Rouquette A. 235 

Rouse P. 16 

Roushias S. 623 

Rousseau A. 458 

Rousseau C. 472 

Rousseau T.G.M. 472 

Rouviere O. 180 

Roux J.W. 137, 848 

Rovereto B. 172, 264, 887, 894 

Rovers M.M. 12 

Rovner E. 308 

Rozet F. 352, 483, 576, 589, 679, 

883, 1020, V48, V64 

Rübben H. 155, 559 

Rübe C. 192 

Rubio-Briones J. 10, 1007 

Rud E. 221 

Rudolph R. 348 

Rufle A. 945 

Ruiz C. 945 

Ruiz Cerda J.L. 231, 805 

Ruiz Jiménez J.I. 422 

Rummel C. 665 

Rupprecht K. 608 

Russo A. 289, 443, 467, 953 

Russo F. 1041 

Russo F. 219, 710 

Rutigliano M. 662 

Rutman M. 638 

Rutz B. 906, 907 

Ryan A. 145, 946 

Ryan C.J. 97, 100 

Ryang S.H. 997 

Rydén L. 1029 

Rynja S.P. 648 

S 

Saad F. 207 

Saad F. 99 

Saad I.R. 536 

Saad T.W. 530 

Saad Z. 391 

Saar M. 74, 761, 975, 1031, 1032 

Saaristo L. 1039 

Saavedra J. V6 

Sabaa E. 836 

Sabatier F. 245 

Sabharwal K.V. 418, 421, 424 

Sabir E.F. 569 

Sacristan R. 277 

Sagara Y. 150 

Sagawa K. 446 

Sahdev V. 47 

Sahu M. 585 

Saito K. 76, 240, 470, 572, 578, 586, 

756, 819, 950, V21, V61 

Saito M. 1100, 1104 

Saito N. 92 

Saitoh H. 613 

Sakaeda T. 1085 

Sakai H. 150 

Sakai I. 983 

Sakai Y. 92, 572, 819 

Sakalis V. 389 

Sakellariou C-A. 835 

Sakihara S. 463 

Sakuma Y. 492 

Sakuta T. 931 

Sala A. 868 

Sala E. 142, 224 

Saladini G. 357 

Salcedo M. 768 

Salciccia S. 11 

Saldaña L.J. 532 

Salem A. 536 

Salem H.K. 640 

Salem N. 1053 

Salinas Casado J. 746, 888 

Salman M. 867 

Salom Fuster J.V. 805 

Salome F. 170, 171, 176 

Salomon G. 226, 295, 359, 1006, 

1018, 1023 

Salomon L. 136, 170, 171, 176, 283, 

716, 753, V15 

Salonia A. 140, 187, 289, 467, 473, 

695, 918 

Saltirov I. 971 

Saltzstein D.R. 1045 

Salvador R. 313, 436, 496 

Salvatore S. 726 

Salvi M. 93, 411, 1014 

Salvini E. 729 

Salvioni R. 83, 388, 397, 398, 1055, 

1057 



457 

Indices

Indices 


Samarasekera D. 255, V3, V30 

Samavedi S. 299, 689, 1013, V10, 

V13 

Samir T. 1028 

Sammon J.D. 119, 158, 260, 369, 

497, 526, 534, 625, 657, 659, 

915, 1070 

Sampaio F.J.B. 29, 30, 413, 903 

San José Manso L. 334 

Sanada M. 764 

Sanchez L. V36, V39 

Sanchez- Carbayo M. 277 

Sánchez-Chapado M. 524, 1034 

Sanchez Escudero E. 383 

Sanchez-Escudero A. 491, 496 

Sanchez-Martín F. V35 

Sanchez-Salas R.E. 352, 589, 679, 

686, 688, 883, 911, 1020, V48, 

V64 

Sandmann M. 226 

Sandner P. 900, 909 

Sandoe J. 502, 617 

Sandrini S. 499 

Sang Don L. 632 

Sang Hoon S. 649 

Sangar V. 395, 400 

Sanguedolce F. 268, 660 

Sanjmyatav J. 194 

Sanjurjo S. 780 

Sano H. 931 

Sansalone S. 561 

Sanseverino R. V67 

Santana T.B.M. 399, 557 

Santarsieri M. 1008 

Santi R. 411 

Santillana J.M. V35, V72 

Santinelli F. V44 

Santià S. 376, 431, 1066, 1071 

Santos J. 975 

Sanz Mayayo E. 346 

Sapre N 53, 85, 145, 704, 849 

Saraceni G. 454 

Saran R.K. 418, 421, 424 

Sarchielli P. 302 

Sarica K. 1067 

Sarikaya S. 117, 163, 381 

Sarkis P 547 

Sarró E. 768 

Sasaki E. 442 


Sasaki T. 978 

Sassa N. 288 

Sato A. 764 

Sato A. 57, 144, 574, 827, 976, 977 

Sato F.S. 444 

Sato N. 603, 767 

Sato S. 931 

Sato T. 931 

Sato Y. 199 

Sato Y. 121 

Sato Y. 361 

Sato Y. 764 

Satoh S. 610, 1100, 1104 

Saussez T. 432 

Sava D. 194 

Savastano S. 319 

Savoie P-H. 1053 

Sawazaki H. 699, 1091 

Sayedahmed K.A.M. 867 

Sazawa A. 931 

Sa˘glam H.S. 111, 794 

Scardino P. 715, 854 

Scarpa R. 521 

Scattoni V. 137, 289, 695, 918 

Schäfer G. 7, 803 

Schäfer L. 707 

Schagdarsurengin U. 31, 947 

Schalken J.A. 63, 851 

Scharpf M. 899 

Schatloff O. 299, 689, 1013, V10, 

V13 

Schätz T. 22 

Scher H.I. 97, 105 

Scherer R. 198 

Scherr D.S. 78, 156, 276, 474, 573, 

701, 752, 754, 813, 814, 815, 

929, 1031, 1032 

Scherrer A. 930 

Schettini M. 486 

Schiavina R. 172, 264, 271, 454, 

693, 711, 887, 1014 

Schiefelbein F. V18 

Schiffmann J. 226 

Schilling D. 964, 1022, V59 

Schips L. 91, 340, 408, 412, 592, 

1093, 1094 

Schlemmer H-P. 222 

Schlenck B. 644 

Schleutker J. 1039 

Schlomm T. 107, 293, 802, 920, 

1006, 1018 

Schmid H-P. 310 

Schmid M. 474 

Schmid S. 1011 

Schmidbauer J.S. 577 

Schmidt J. 828 

Schmidt M. 707 

Schmidt M. 68 

Schneider S. 944 

Schober R.R. 1058 

Schoen G. V18 

Schoenthaler M. 1067 

Schoffelmeer C. 291, 292 

Schönthaler M. 629 

Schorsch M. 27, 31 

Schrader A. J. 241, 338, 348 

Schrader M. 338, 348 

Schramek P. 474, 1021 

Schriefer P. 866 

Schröder F.H. 1, 5, 680 

Schubert M. 936 

Schull A. 141 

Schulwitz H. 1011 

Schulz E. 1025 

Schulze M. 521 

Schulze-Forster K. 859 

Schumacher C. 330 

Schumacher S. 338 

Schumann A. 382, V50 

Schuppe H-C. 27, 32 

Schurch B. 70 

Schütte A. V16, V20, V34 

Schütz B. 62 

Schwaab T. 882 

Schwaiger B. 866 

Schwantes U. 448 

Schwarz R. 293 

Schwentner C. 364, 365, 899, 1022, 

1049, 1054, V59 

Schykowski T. 653 

Sciarra A. 11 

Sciuto R. 480 

Scoffone C. 521 

Scott H. 935 

Scremin E. 319 

Sebastia M.C. 496 

Sebastianelli A. 411, 1014 

Sèbe P. 896 


Secin F. 589, 679, 1020 

Sedelaar J.P. 582 

Sedigh O. 376 

Segersten U. 238 

Segoloni G.P. 376 

Seguchi K. 574, 827 

Seibel R. 867 

Seibold J. V54 

Seidel C. 241, 348 

Seidenader J. 222 

Seifarth V. 250, 871 

Seiler D 133, 272 

Seiler R. 330 

Seisen T. 483, 576, 716 

Seitz C. 78, 474, 813, 1021, 1067 

Seiwerts C. 359 

Sejima T. 339, 925, 951 

Seki H. 931 

Seki N. 52, 772 

Seki T. 931 

Sekine Y. 938 

Seklehner S. 724 

Seligson D.B. 193 

Selim M. 792 

Selli C. 1008 

Selvaggi F.P. 662 

Semjonow A. 139, 192, 465, 853, 

859 

Sengel C. 564 

Sengeløv L. 106, 683 

Sengiku A. 699, 1091 

Seni G. 112 

Seo H.K. 1001 

Seo I.Y. 317 

Seo S.I. 266, 280, 297 

Serati M. 726 

Serbo Y. 893 

Serikoff A. 743 

Seringe E. 261 

Serni S. 93, 172, 259, 264, 693, 887 

Serra C. 229 

Serrallach M. V41 

Serrano A. 760 

Serretta V. 697 

Serth J. 198 

Sester M. 703 

Sester U. 703 

Sevcenco S. 345 

Sgrò E. V53 

Shaaban A. 928, 1028 

Shah P.J.R. 775, 776 

Shah N.C. 921 

Shah V. 367 

Shahab N. 450 

Shaker H. 511 

Shamsuddin A. 600 

Shan Y.X. 839 

Shangichev A.V. 419, 797 

Shaplygin L.V. 581 

Shariat S.F. 78, 151, 156, 276, 340, 

473, 474, 573, 575, 576, 601, 

697, 701, 752, 754, 813, 814, 

815, 929, 1015, 1032 

Sharif M. 20 

Sharma D. 16, 389 

Shaw G.L. 833 

Sheehan S. 510 

Sheikh N. 103 

Shen P. 558 

Shestani T. 486 

Shevelev A. 169 

Shi G.H. 1098 

Shi Y. 20 

Shi Y.F. 932 

Shibata T. 931 

Shibuya H. 578 

Shiga Y. 228 

Shigemura K. 663, 940 

Shillito S.H. 395 

Shim B.S. 512 

Shim M. 80, 196, 466, 469, 1005, 

1010 

Shimamura T. 764 

Shimbori M. 228 

Shimizu N. 1108 

Shimizu S. 199 

Shin T-Y. 177, 810 

Shin Y.S. 488 

Shinbo H. 998 

Shinde S. 65 

Shingo Y. 59 

Shinno Y. 931 

Shinohara N. 931 

Shiota M. 765 

Shiraishi T. 978 

Shiraishi T. 1048 

Shiraishi Y. 764 

Shirakawa T. 663, 940 

Shiranov K.A. 845 

Shirokorad V.I. 954 

Shirotake S. 242, 818 

Shkalova L. 354 

Shoji K. 462 

Shoji S. 220, 265, 361, V45, V79 

Shoots I. 138 

Shore N. 97, 99, 626, 678 

Short S. 58 

Shuin T. 834 

Shukla D. 935 

Shun C.T. 234 

Sibaev A. 447 

Sibony M. 366 

Sicuro O. V53 

Siddiqui E. 401 

Siddons H. 704 

Sidoni A. 933 

Sieber P. 108 

Siegmann A. 192 

Siemer S. 74, 338, 1031, V31 

Siena G. 93, 817 

Siesto G. 726 

Sievert K-D. 243, 248, 306, 629, 741, 

744, 791, V54, V71 

Sighinolfi G.P. 439 

Sighinolfi M.C. 439 

Signoretti S. 193 

Silva C.M. 673, 898 

Silva J. 627 

Silva P.C. 30, 903 

Silva P.C.G.P. 903 

Silvani M. 561 

Silverman D. 229 

Silvestri L. 914 

Sim M.Y. 200 

Simaioforidis V. 872 

Simeone C. 172, 259, 264, 499, 887 

Simmons L.A.M. 353 

Simmons R. 777 

Simmons W. 653 

Simon A. 329 

Simon R. 138 

Simonato A. 340, 770, 817, 1014 

Simone G. 480, 881, 1038, V23, V46 

Simpfendoerfer T. 222 

Sims R. 103 

Simón C. V75 

Simões M. 29 



459 

Indices

Indices 


Sinescu I. 384 

Singh R. 937 

Singla M. 418, 421, 424 

Sinos P. 548 

Sio M.C. 1043 

Siracusano S. 614 

Sirls L. 722 

Sivaraman A. 299, 1013, V10 

Sizonov V.V. 419 

Sjoberg D. 754, 814, 815 

Sjoberg D. 749, 808, 813, 856 

Skolarikos A. 521 

Skorucak J. 799 

Skowron O. 563 

Skradski V. 7, 803 

Skrobot S.S. 372 

Skvortsov I.Y. 88, 90 

Slesarevskaya M.N. 667 

Sloan S. 367 

Sloff M. 872 

Slovak M. 403 

Smal M.P. 278 

Small E.J. 97 

Smith M.R. 97, 99, 108, 674 

Smith N. 653 

Smith R.A.G. 835 

Smith R. 18 

Smolski M.J. V57, V66 

Snow-Lisy D. 816 

Soares F.A. 399 

Sobiesiak M. 899 

Sodano M. 499 

Soebadi D. 252, 908 

Soh J. 414 

Sohn D.W. 1001 

Sokol R. 1089 

Sokolov A. 667 

Sola I. 482 

Solanki R. V40 

Soler R. 909 

Soliman M.G. 214, 420 

Solokhina A. 167 

Soloviev D. 833 

Solovov V.A. 581 

Solsona Narbón E. 10, 702, 1007 

Somani B. 370, 434, 599 

Sommerlad M. 811 

Son H. 860 

Son J.H. 1072 


Soncin R. 1017 

Song C. 80, 196, 466, 469, 807, 

1005, 1010 

Song G. 410, 490 

Song J.M. 997 

Song P.H. 116, 349 

Song S.H. 332, 533, 807 

Song W. 266, 280, 297, 538 

Song Y. 765 

Song Y.S. 325 

Sønksen J. 122 

Sonmezay E. 553 

Sonmezoglu K. 479 

Sonnenberg J.E. 329 

Sonnino S. 146 

Sood A. 369, 709, V14 

Sooriakumaran P. 912, 916 

Sørensen H.T. 675 

Soria F. 130 

Sorongon M. 1043 

Sorsaburu S. 1096 

Sosnowski R. 990 

Sotelo Noguera R. V6, V19, V38, 

V44 

Soto Poveda A.M. 231 

Soto Villalva J. V33 

Soukup V. 697 

Soulié M. 87, 176, 283, 483, 1105 

Sountoulides P. 408 

Soustelle L. 261 

Southgate J. 157 

Souza M.J.L. 399 

Sow Y. 731 

Soygür T. 527, 646, 647 

Spahn M. 468, 471, 686, 688, 911, 

936 

Spaliviero M. 749 

Spaltro Ambrosini A. 61 

Spangenberg M. 160 

Sperandio V. 168 

Sphan M. 697 

Spiess A. 27, 31 

Spilotros M. 662 

Spinelli M. 301, 305 

Spinillo A. 894 

Springer C. 91, 263, 461, 949, V1 

Srinivas S. 1107 

Srinivasan V. 1016 

Sriprasad S. 49, 1075, 1081 

Srougi M. 650 

Stagni S. 83, 388, 397, 398, 1055, 

1057 

Stakhovsky E. 94 

Stakhovskyi O. 94 

Staley S. 497 

Stanescu F.A. 522, 570 

Stanic V. 1060 

Staudacher K. 101 

Stavropoulos M. 548 

Stefan B. 384 

Steffens S. 241, 338, 348 

Stegemann A.P. 19, 20, 1031, 1032 

Steger K.S. 27, 31, 32, 947 

Stein B. 241 

Stein K. 981 

Stein R. 255, 256, 257, 552, 816, 

V2, V22 

Steineck G. 916 

Steiner E. 7 

Steiner M.S. 102 

Steiner U. 192 

Stenzl A. 198, 243, 306, 364, 365, 

577, 629, 812, 822, 861, 899, 

964, 1022, 1049, 1054, 1062, 

V54, V59, V71 

Stepanova N. 159, 892 

Stephan C. 139, 195, 853, 859 

Sternal M. 194 

Sterner O. 826 

Steuber T. 107, 186, 295, 685, 1006, 

1018 

Stevens D. 267 

Stewart F. 523 

Stewart G.D. 766, 922 

Stewart Iv J. 558 

Steyerberg E.W. 139, 217, 850 

Stief C.G. 68, 286, 340, 447, 629, 

844, 847, 906, 907, 909, 923 

Stifelman M. 876 

Stillebroer A.B. 336 

Stock K. 386 

Stöckle M. 74, 192, 338, 703, 774, 

828, 1031, 1032, V31 

Stoeckigt C. 347 

Stoehrer M. 656 

Stojakovic T. 347 

Stolzenburg J.U. 91, 922, V4, V17 

Stone S. 719 


Stopak B.L. 327 

Storr M. 447 

Stow B. 782 

Strada G. 769 

Stranne J. 120, 808 

Strasak A. 644 

Straub M. 386, 1067 

Strick K. 448, 871 

Stringara S. 770 

Strittmatter F. 906, 907 

Stroelin P. 107 

Strohmaier W. 461 

Stöhrer M. 636 

Stölting M.N.L. 246 

Störkel S. 192 

Stroy O.O. 507 

Struss W. 866 

Stubendorff B. 56 

Stubinski R. 540 

Stucki P. 554 

Studer U.E. 330, 555, 1026 

Stuiver M.M. 387 

Stumm L. 1019 

Stunell H. 952 

Stunitz L. V58 

Sturch P. V62 

Suardi N. 182, 184, 186, 188, 289, 

467, 694, 695, 714, 918 

Subira D. V44 

Subirá J. 232 

Sudiana I.K. 908 

Süer E. 527, 646 

Sugano S. 764 

Sugimoto M. 228 

Sugimoto M. 503 

Sugimura Y. 978 

Sugino Y. 66, 1085 

Sugishita K. 931 

Sugiyama N. 79, 82, 463, 602 

Suh Y.S. 266, 280, 297, 538 

Suhotnik R. 202 

Sukhorukova M. 169 

Sukhotnik I. 202 

Sukonko O.G. 285, 958 

Sukumar S. 119, 158, 260, 369, 497, 

526, 534, 625, 657, 659, 915, 

1070 

Sullivan A. 296 

Sullivan J.F. 15 

Sulser T. 246, 635, 637 

Sultan M. 792 

Sumino Y.S. 444 

Sumitomo M. 504, 715 

Summers D. 475 

Sun J. 901 

Sun M. 140, 175, 178, 179, 262, 474, 

687, 718, 820, 927, 960, 1015 

Sun Y. 91, 484 

Sundi D. 815 

Sung H.H. 280, 538 

Sung L.H. 727 

Suttmann H. 105, 703 

Suzuki E. 333 

Suzuki K. 938 

Suzuki M. 333 

Suzuki S. V68 

Suzuki T. 998 

Suzuki T. 59 

Suzuki Y. 79, 82, 463, 602 

Svatek R.S. 754, 815 

Svejstrup J. 683 

Syed J. 20 

Sykes J. 287 

Sylvester R. 697, 708 

Symons M. 296 

Szarvas T. 155, 345 

Szendroi A. 774 

T 

Taari K. 274 

Tabatabaei S. 634 

Tabernero Gómez A. 556, 1036 

Taguchi K. 311 

Taha D-E. 934 

Taimen P. 154 

Takada N. 931 

Takada S. 998 

Takagi T. 821 

Takahashi R. 450 

Takahashi S. 404, 747 

Takahashi S. 603 

Takahashi S. 1048 

Takahashi T. 699, 1091 

Takai S. 288, 779 

Takamoto A. 503 

Takashi F. 713 

Takata R. 77 

Takeda M. 71, 84, 404, 747 

Takenaka A. 339, 925, 951 

Takeshita H. 950 

Tamarelle B. 705 

Tammela T.L. 108, 1039 

Tamura Y. 603 

Tan M.H. 1107 

Tan P.H. 200 

Tan W. 51, 58 

Tanabe K. 603, 821 

Tanagho Y. 876 

Tanaka H. 240, 470, 586 

Tanaka K. 663, 940 

Tanaka N. 456 

Tanaka N. 242, 818 

Tanaka T. 337, 603 

Tanase M. 712 

Tanda H. 121 

Taneja S. 138 

Tang S.Y.W. 142 

Tannuri U. 650 

Taño F. 229 

Tao S. 901 

Tao W. 839 

Tardito S. 770 

Tarrel R. 75 

Tasaki S. 574, 827 

Tasca A. 319 

Tasci A.I. 553 

Tatagiba M. 306 

Tateishi U. 1103 

Tatemichi S. 446 

Tatokoro M. 979 

Tatsugami K. 765 

Tawfik A.M. 214, 420 

Tawfik T.I. 214 

Taylor B. 395 

Taylor J.M. 749 

Taylor R.A. 946 

Te A.E. 638 

Teelab A.A. 416 

Teertstra H.J. 217, 394 

Teichman J.M.H. 1063 

Teishima J. 462, 666 

Tejedor-Jorge A. 606, 607 

Tejido Sánchez A. 773 

Tekgul S. 642, 643, 645 

Téllez Martínez Fornés M. 730 

Tenholte D. 890 



461 

Indices

Indices 


Tennstedt P. 293, 294, 685, 920, 

1023 

Teo L. 781 

Ter Haar R. 706 

Terachi T. 21 

Terrier N. 563, 564 

Terris B. 235 

Terrone C. 174, 264, 864, 887 

Terui K. 463 

Tewari A. 474 

Tezval H. 198 

Thaler C. 27 

Thalgott M. 809 

Thalmann G.N. 330, 665, 822, 942, 

1026, 1044 

Thanigasalam R. 112, 171 

Thapa P. 75, 924 

Theaker J. 1051 

Theil G. 1046 

Thiagamoorthy G. 910 

Thibault F.J.P. 112 

Thike A.A. 200 

Thiruchelvam N. 990, 1004 

Thiry S. 415 

Thistlethwaite F. 1101 

Thomas A.Z. 15 

Thomas B. 921 

Thomas H. 3 

Thomas J.S. 47 

Thompson C. 741, 744 

Thompson H. 75, 151 

Thompson P.M. 510, 1076 

Thompson R.H. 924, 957 

Thomsen F.B. 273 

Thong A. 761, 975 

Thorpe A. 781 

Thuret R. 283 

Thüroff J.W. 50, 338, 461 

Tian L. 901 

Tian Y. 249 

Tian Z. 175, 178, 262, 718, 927, 960, 

1024 

Tiemann A. 286 

Tikkinen K.A.O. 910 

Tilki D. 286 

Tillier C. 291 

Tillou X 500 

Timberg G. 216 

Timilshina N. 270 


Timsit M-O. 283 

Tiscione D. 459 

Titze U. 465 

Tjønneland A. 858 

Tligui M. 432 

Tobe M. 121 

Tobisawa Y. 79, 82, 197, 602, 1042 

Tobu S.T. 444 

Todenhöfer T. 364, 365, 812, 822, 

899, 1022, 1049, 1054 

Togashi M. 931 

Toi A. 270, 988 

Toivanen R. 946 

Tok A.T. 624 

Tokas T. 23 

Tokgoz H. 128 

Tokui N. 602 

Tokunori Y. 713 

Tolba R.H. 448, 871 

Tollefson M.K. 924 

Tomada I. 210 

Tomada N. 210 

Tombal B. 99, 182, 415, 674, 677, 

686, 688, 806, 911 

Tomida R. 132 

Tominaga M. 71 

Tominaga T. 1048 

Tomiyama Y. 446 

Tomlinson G.A. 886 

Tonghini M. 1041 

Tonooka A. 337 

Tonyali S. 645 

Torella M. 726 

Torelli T. 83, 388, 397, 398, 1055, 

1057 

Torigoe T. 767 

Torsello B. 769 

Tosco L. 880 

Touijer K.A. 188 

Touloupidis S. 423 

Townes C.L. 623 

Toyonori T. 713 

Tozawa K. 311 

Trachtenberg J. 270, 588, 988 

Tran M. 935 

Traverso P. 770 

Traxer O. 430, 432, 438, 1067 

Treiyer A. V31 

Tremblay T. 402 

Tremp M. 246 

Trenti E. 61 

Tretter R. 782 

Treurniet K. 287 

Trifard F. 171 

Trilla E. 768 

Trinchieri A. 1067 

Trinh Q-D. 78, 158, 179, 233, 369, 

497, 534, 573, 625, 657, 659, 

754, 876, 915, 956, 1070 

Trock B.J. 1048 

Trojan L. 24, 286, 1019 

Trombetta C. 614, 838, V55 

Trottier G. 270, 988 

Trottmann M. 844, 847 

Trunk M. 1052 

Truss M. 340 

Tsai Y.C. 26 

Tsaur I. 825, 830 

Tsiamis C. 41 

Tsivian M. 661, 967 

Tsuchiya N. 197, 610, 720, 1100, 

1104 

Tsui K-H. 148 

Tsuji H. 1108 

Tsujii T. 572, 819 

Tsukamoto T. 337, 603 

Tu L.M. 785 

Tubaro A. 411, 412, 672, 725, 782, 

990, 1014 

Tuccio A. 93 

Tugcu V. 552, 553 

Tuncel A. 615 

Turkbey B. 138 

Turkeri L. 708 

Turner E.L. 135 

Turney B. 1067 

Tutolo M. 467, 473, 695, 714, 806, 

918 

Tutrone Jr. R.F. 626 

Tworkiewicz J.T. 869 

Tyritzis S. 1035 

Tytgat J. 441 

U 

Uchida K. 121 

Uchida T. 265, 361 

Uckert S. 127, 329, 331, 904 

Ueda T. 1056 


Uemura H. 98, 1108 

Uemura M. 943 

Ueno M. 242 

Ukimura O. 138, 220, 265, 361, 835, 

V45, V79 

Umari P. 838 

Umeda K. 228 

Unda M. 702 

Underwood M.A. 902, 905, 989 

Unrein A. 774 

Unteregger G. 828 

Upadhaya R. 418, 421, 424 

Urbach D.R. 886 

Urbschat A. 608 

Usami M. 311 

Uvin P. 252, 441 

V 

Vaegler M. 243, 248, 791 

Vaessen C. 170, 171, 176, 261 

Vagnoni V. 693, 711 

Vaishamayan U.N. 1107 

Valenti M. 698 

Valentini M.A. 517 

Valeri A. 283 

Valerio M. 584, 926 

Vallee J-P. 356 

Vallier C. 1053 

Valotto C. 1017 

Valta M.P. 761, 975 

Van Aarle S. 1037 

Van Ahlen H. 127 

Van Bruwaene S. 468 

Van Cleynenbreugel B. 1000 

Van Den Bergh L. 360 

Van Den Bergh R.C.N. 292 

Van Den Bos C.W.L. 889 

Van Der Aa F. 252, 324, 326, 327, 

1004 

Van Der Eeckt K. 697 

Van Der Jagt M.F.P. 493 

Van Der Keur K.A. 238 

Van Der Kwast T. 50, 287, 588, 850, 

988 

Van Der Meulen E. 677, 678 

Van Der Meulen J.H.P. 138, 181, 190, 

218, 585, 658 

Van Der Poel H.G. 186, 217, 291, 

292, 392, 394, 686, 688, 911 

Van Erps T. 801 

Van Ginkel T. 706 

Van Herpen C.M.L. 336 

Van Kampen M. 1000 

Van Kerrebroeck P.E.V. 1089 

Van Kuppevelt T.H. 872 

Van Leenders G.J.L.H. 217, 850 

Van Leeuwen T.G. 594 

Van Lin N.J.T. 582 

Van Moorselaar R.J.A. 706 

Van Muilekom E. 291 

Van Poppel H. 14, 97, 108, 182, 188, 

360, 806, 1000 

Van Praet C. 191 

Van Rhijn B.W.G. 50, 394, 697 

Van Soest R. 217, 824 

Van Velthoven R. 800 

Van Weerden W.M. 824 

Van Werkhoven E. 392 

Vandaele P. V28 

Vaos G. 423 

Varca V. 817 

Vardi Y. 131 

Varga G. 631 

Varkarakis J. 697 

Vasarainen H. 274 

Vasdev N. 781 

Vashchula V.I. 621 

Vasilyev A. 350 

Vattovani V. 459 

Vaucher L. 926 

Vaughan E.D. 854 

Vaughan K. 506 

Vavallo A. 662 

Veeratterapillay R. 781 

Veliev E.I. 796 

Veltri A. 95 

Venetsanos F. 548 

Veneziano D. V1, V53 

Vennekens R. 441 

Vera M. 378 

Veran J. 245 

Vergho D.C. 863 

Vergnolles M. 96 

Vergunst H. 582, 700 

Verhagen P.C.M.S. 680 

Verhasselt-Crinquette M. 237 

Verhoest G. 87, 283 

Verkerk A.M. 680 

Verma R.K. 665 

Vermeij M. 54 

Verne J. 230 

Verplaetse R. 441 

Verri C. 698 

Verze P. 172, 396, 560, 622, 660, 

V55 

Vianello A. 147, 933 

Vicens Vicens T. 113 

Vicentini F.C. 525 

Vickers A.J. 813, 850, 856 

Vieillefond A. 235 

Vieweg M. 32 

Viganò P. 769 

Vignozzi L. 411 

Vigués F. V41, V63 

Viktrup L. 1096 

Vila A. 639 

Vilardell J. 768 

Vilaseca Cabo A. 489, 494 

Vilaça J. 968 

Viliukha A.I. 621 

Villa L. 451, 651, 695, 714 

Villacampa Aubá F. 773 

Villalobos-Gollas M. 973 

Villari D. V69 

Villavicencio H. 281, 372, 531, 532, 

V35, V49, V72 

Villers A. 138, 220, V28 

Vilà M. 768 

Vincendeau S. 139, 852, 853 

Vincent A.D. 387 

Vincenti G. 486 

Viney Z. 477 

Vint R. 370, 969 

Visakorpi T. 1044 

Viset T. 152 

Vit V. 631 

Vitruk Y. 94 

Vittori G. 93, 259, 592 

Vjaters E. 680 

Voce S. 579 

Voets T. 441 

Vogt M. 1102, 1106 

Voilenko O. 94 

Volkmer G. 151 

Volkova M.I. 88, 90, 954 

Volpe A. 172, 174, 264, 887 

Vom Dorp F. 155, 559 



463 

Indices

Indices 


Von Schönfeldt V. 27 

Von Verschuer U. 1102 

Voorham H.C. 889 

Voorham-Van der Zalm P.J. 889 

Vordos D. 716, 753, V15 

Vorobyev N.V. V43 

Vörös J. 799 

Votanopoulos K. 558 

Vozdvozhenskiy M.O. 581 

Vukalovich P. 94 

Vuruskan H. 652 

W 

Wada Y. 982 

Wadhwa K. 142 

Wagenlehner F.M.E. 160, 619, 712, 

897, 947 

Wagenpfeil S. 809 

Wagner A. 882, V12 

Wagner C. V16, V20, V34 

Wagner L. 112 

Wahlfors T. 1039 

Waidelich R. 907 

Walcher U. 549, 656 

Wald A. 1049 

Waldert M.J. 991 

Waldkirch E.S. 904 

Waliszewski P. 712, 947 

Walker M. 941 

Walker V.C. 902, 905, 989 

Wallen E.M. 1032 

Walleser S. 775 

Walley A. 910 

Walther S. 907 

Walton K. 623 

Walton T. 576 

Waltregny D. 780 

Walz J. 186, 1053 

Wang C-J. 205 

Wang C.X. 247, 972 

Wang H. 27, 28, 36, 837 

Wang H.Z. 840 

Wang J.W. 839 

Wang K. 162, 249, 505 

Wang L. 91, 814 

Wang W. 510 

Wang W.L. 840 

Wang X. 149, 948, 961, 1061 

Wang X.Q. 247 


Wang X.K. 840 

Wang Y.B. 972 

Wang Y. 103 

Wang Y.X. 28, 36, 837 

Warlé M.C. 493 

Warren A. 142, 224, 935 

Wasiutyński A. 279 

Watanabe H. 228 

Watanabe Y. 138 

Watkin N. 389 

Watkins J. 1033 

Watts S.D. 275 

Waxman J. 941 

Weber M. 739 

Wegener G. 241, 338, 348 

Wehrberger C. 992 

Weibl P. 345 

Weidner W. 27, 31, 32, 160, 707, 

712, 897, 947 

Weigand K. 382, V50 

Weihe E. 62 

Wein A. 854 

Weir S. 585 

Weirich G. 809 

Weiss C. 322, 1052 

Weissbach L. 822 

Weissbach L. 272 

Weisstanner C. 665 

Weizer A.Z. 78, 573, 1031 

Welbourn W. 719 

Wendt-Nordahl G. 964 

Wenzel O. 1025 

Wenzel P. 293 

Werbrouck P. 674 

Wernli L. 618 

Wese F. 415 

West C. 58 

Westfall T.D. 440 

Wetterauer U. 461, 629 

Wetterwald A. 330, 942 

Wettstein M.S. 635, 637 

Weyne E. 688 

Wezel F. 157 

Wharton I.P. 1074 

Whelan L. 740 

Wicker A. 22 

Wickmann U. 774 

Wiechno P. 101 

Wiegel T. 182, 192, 806 

Wieland U.W. 624 

Wieland W.F. 225, 282, 286, 944 

Wiest R. 665 

Wiklund N.P. 1035 

Wiklund P. 912, 916, 1031, 1032 

Wilczek E. 279 

Wildhagen M. 217, 680 

Wilding G. 20 

Wilhelm K. 56 

Willder J.M. 902, 905, 989 

Wille S. 624, 890 

Williams J.P. 161, 506 

Willich N. 192 

Wilson S.K. V71 

Wilson T.H. 1031, 1032, 1095 

Winkler A. 344 

Winkler E. 341 

Winkler M. 353 

Wirth G.J. 721 

Wirth M. 108, 192, 984, 1058 

Withington J. 658 

Witjes J.A. 12, 153, 577, 697, 700, 

755 

Witjes W.P.J. 755 

Witt J.H. 690, V16, V20, V34 

Witzsch U. 696 

Wolff M. 62 

Wolf-Johnston A. 65 

Wöllner J. 70 

Wolters M. 656 

Wong A. 758 

Wong A. 281 

Wong D. 1096 

Wong K.A. 1084 

Wong L.M. 270 

Wong S. 108 

Woo H.H. 634, 638 

Wood C. 576 

Wood I.R.G. 38, 45, 1077 

Wood L. 1107 

Woods M. 1031, 1032 

Wooten A. 704 

Wrobel B.M. 89 

Wu C.T. 335 

Wu F.C.W. 211 

Wu G. 149, 948, 961, 1061 

Wu T. 249 

Wu W-J. 205 

Wu W. 320 


Wu Y.N. 335 

Wu Y. 948, 961, 1061 

Wunderlich H. 194 

Wüthrich P.Y. 1026 

Wyler S. 167, 618 

X 

Xambre L. 895 

Xiao C. 320 

Xiao R. 948, 961, 1061 

Xiao-Dong J. 555 

Xie D. 724 

Xie W. 1107 

Xie X-J. 114 

Xu C. 484 

Xu H. 149 

Xu J. 9, 901 

Xu N. 972 

Xue B.X. 839 

Xue Y. 149, 948, 961, 1061 

Xylinas E. 78, 87, 151, 156, 276, 

474, 573, 576, 701, 752, 754, 

813, 814, 815, 929, 1105 

Y 

Yacoub M. 763 

Yadav A. 1027 

Yae K. 60 

Yagisawa T. 492 

Yakar D. 582 

Yakupoglu Y.K. 117, 163, 381 

Yakushiji H. 199 

Yamada A. 98 

Yamada Y. 504 

Yamaguchi K. 33, 35, 842 

Yamaguchi O. 446 

Yamamichi F. 663, 940 

Yamamoto H. 79, 82, 463, 602, 1042 

Yamamoto H. 132 

Yamamoto R. 228 

Yamamoto T. 779 

Yamamoto Y. 1108 

Yamanaka M. 132 

Yamasaki T. 52, 772 

Yamashita T. 931 

Yan Y.J. 932 

Yang C-W. 784 

Yang D.Y. 213 

Yang H. 27, 36, 837 

Yang J. 149, 961, 1061 

Yang L. 162, 505 

Yang S.C. 177 

Yang S.S-D. 1064 

Yang W. J. 325 

Yao A. 339, 925, 951 

Yao M. 1103 

Yao Q.Y 839 

Yap S.A. 886 

Yapanoglu T. 616 

Yassin A. 207 

Yassin D.J. 207 

Yasuhito F. 713 

Yasui T. 311 

Yasushi Y. 713 

Yates D. 576 

Yates-Bell A.J 1076 

Yatsyna O. 94 

Ye D.W. 1098 

Ye Z. 108 

Yegnasubramanian S. 943 

Yeh H-C. 205 

Yeo J.K. 209, 544 

Yildiz M. 615 

Yilmaz A.F. 163 

Yin C.J. 878 

Yiou R. 753 

Yokomizo A. 765 

Yokoyama H. 228 

Yokoyama M. 470, 578, 586, 756 

Yokoyama T. 199 

Yones S. 792 

Yonese J. 572, 819 

Yoneyama T. 79, 82, 197, 463, 602, 

613, 720, 1042 

Yoneyama T. 79, 82, 197, 602, 1042 

Yoo C. 213, 786 

Yoo D. 80, 196, 466, 469 

Yoo E.S. 253, 428 

Yoo G.H. 435 

Yoo T.K. 519 

Yoon C.Y. 955, 994 

Yoon H. 512 

Yoon J. 551, V47 

Yoon J.H. 691, 771 

Yoon S.J. 974 

Yoshida K. 821 

Yoshida K. 764 

Yoshida M. 404, 747 

Yoshida S. 442 

Yoshida S. 240, 470, 578, 586, 756, 

979 

Yoshida T. 676 

Yoshihide H. 59 

Yoshihisa M. 713 

Yoshimura K. 98, 1108 

Yoshimura K. 66, 1085 

Yoshimura N.Y. 444 

Yoshino H. 52, 772 

Yoshino Y. 288, 779 

Yoshioka K. 228 

You D. 478, 771, 807, 1097 

Young J.G. 316 

Young S.R. 761 

Young S.T. 91 

Youssef S. 966 

Yu H. 193 

Yu H.S. 464 

Yu J.H. 727 

Yuan Y. 948, 961, 1061 

Yuasa T. 1107 

Yue X. 249 

Yuge K. 959 

Yuh B. 1032 

Yun J.H. 325 

Yutaka T. 931 

Yutkin V. 1050 

Z 

Zacharakis E. 129 

Zacharias M. 286 

Zacharis A. 984 

Zacharowski K. 608 

Zagaynova E. 354 

Zahran M.H. 934, 1069 

Zaidi S.Z. 530 

Zakouji H. 84 

Zaman F. 654, 963 

Zambudio Carmona G. 422 

Zampa V. 1008 

Zang W. 250 

Zani D. 592 

Zanni G. 694, 748 

Zanollo L. 301, 305 

Zantl N. 565 

Zappala M.S. 854 

Zaramella S. 259 

Zastrow S. 340, 984 



465 

Indices

Indices 


Zattoni F. 357 

Zattoni F. 357, 887, 1017 

Zát'ura F. 353 

Zeeck K. 882 

Zeegers M.P.A. 239 

Zegna L. 174 

Zehnder P. 330 

Zeier M. 341 

Zellweger T. 945 

Zeman F. 944 

Zembutsu H. 77 

Zennami K. 504 

Zepeda S. 1096 

Zequi S.C. 399, 557 

Zerbetto F. 183, 184, 185 

Zerbib M. 78, 87, 141, 151, 170, 

235, 276, 283, 573, 701, 754, 

814 

Zettl H. 195 

Zeybek D. 643 

Zhang G. 149, 948, 961, 1061 

Zhang H.F. 972 

Zhang H.L. 1098 

Zhang H. 9 

Zhang L. 9 

Zhang T. 36 

Zhang Z. 484 

Zhao C. 488 

Zhao H. 761, 975 

Zhao Z. 320 

Zharkikh A.V. 667 

Zheng S. 901 

Zhong P. 653 

Zhong W. 320 

Zhou J. 741, 744 

Zhou Y. 99 

Zhu J.Z 839 

Zhu X. 5 

Zhuang D. 156 

Zidan E.M. 934 

Zigeuner R. 340, 347, 575, 576, 601, 

813 

Zimmermann M. 635, 637 

Zimmermann R.P. 884 

Zimmermanns V. 373, 962 

Zimmern P. 114, 168, 722, 732 

Zimpfer A. 195 

Zini L. 170, 171, 176 

Zinke J. V34 


Zipeto M.A. 769 

Zitzmann M. 207 

Ziypak T. 417, 616 

Zlobec I. 1044 

Zlotta A.R. 270, 588 

Zobel B.B. 580 

Zorn K.C. 638 

Zou W. 605 

Zou X. 149, 948, 961, 1061 

Zouari M. 520 

Zraik I. 448 

Zucchi A. 561, 729, 933 

Zugor V. 690, V16 

Zuiverloon T.C.M. 238 

Zuluaga Gomez A. 312 

Zumbé J. 629 

Zuo L. 311 

Zwarthoff E.C. 54, 238 

Zygmunt P. 651 


Abstract sorted by Topic 

Adrenals 

25, 26, 461, 462, 463, V31, V53, V61 

BPH 


250, 411, 451, 899, 900, 901, 902, 

903, 904, 905, 906, 907, 908, 910, 

995 

Evaluation 

72, 407, 412, 519, 633, 988, 989, 

990, 991, 992, 993, 994, 996, 997, 

998, 1087 

Intervention therapy 

516, 520, 521, 522, 523, 524, 525, 

627, 628, 629, 630, 631, 632, 634, 

635, 636, 637, 638, 1096 

Medical therapy 

68, 404, 408, 409, 410, 514, 515, 

517, 518, 626, 742, 909, 1085, 1086, 

1088, 1089, 1090, 1091, 1092, 1093, 

1094, 1095 

Female urology 


109, 110, 243, 244, 245, 252, 672, 

723, 725, 889, 890, 891 

Diagnosis 

673, 722, 735, 888 

Treatment 

111, 112, 113, 114, 115, 116, 119, 

246, 666, 667, 724, 726, 727, 728, 

729, 730, 731, 732, 733, 734, 775, 

776, 777, 778, 779, 780, 781, 782, 

783, 784, 785, 786, 893, 894, 895, 

896, 897, 898, V28, V75 

History of urology 

38, 39, 40, 41, 42, 43, 44, 45, 46, 

47, 48, 49, 1073, 1074, 1075, 1076, 

1077, 1078, 1079, 1080, 1081, 1082, 

1083, 1084 

Infectious diseases 

158, 159, 160, 161, 162, 163, 165, 

166, 167, 168, 169, 502, 503, 504, 

505, 506, 507, 508, 509, 510, 511, 

512, 513, 614, 615, 616, 617, 618, 

619, 620, 621, 622, 623, 624, 625, 

644, 663, 891 

Infertility 

27, 28, 29, 30, 31, 32, 33, 34, 35, 

36, 37, 836, 837, 838, 839, 840, 841, 

842, 843, 844, 845, 846, 847, V52 

Kidney 



491, 602, 603, 604, 605, 606, 607, 

608, 609 

Clinical 

117, 374, 375, 376, 377, 378, 379, 

380, 381, 382, 383, 384, 385, 386, 

489, 490, 492, 493, 494, 495, 496, 

497, 498, 499, 500, 501, 610, 611, 

612, 613, V3, V49, V50 

Male incontinence 

999, 1000, 1001, 1002, 1003, 1004, 

1005, 1006, 1007, 1008, 1009, 1010 

Neuro-urology 


62, 63, 64, 65, 66, 67, 69, 70, 71, 

251, 253 

Diagnosis and treatment 

300, 301, 302, 303, 304, 305, 306, 

307, 308, 310, 401, 402, 403, 405, 

406, 665, V32, V51, V65, V73 

Non-neurogenic 

voiding dysfunction 


440, 441, 442, 443, 444, 445, 446, 

447, 448, 449, 450, 664, 671 


668, 669, 670, 736, 737, 738, 739, 

740, 741, 743, 744, 746, 747 

Paediatrics 

413, 414, 415, 416, 417, 418, 419, 

420, 421, 422, 423, 424, 526, 527, 

528, 529, 530, 531, 532, 533, 534, 

535, 536, 537, 639, 640, 641, 642, 

643, 645, 646, 647, 648, 649, 650 

Penis/testis 

Penile disorders (excluding 

urethra) 

387, 388, 389, 390, 391, 392, 393, 

394, 395, 396, 397, 398, 399 

Testis tumours 

400, 1051, 1052, 1053, 1054, 1055, 

1056, 1057, 1058, 1059, 1060 


Cell biology 

935, 936, 937, 938, 939, 940, 941, 

942, 943, 944, 945, 946, 947, 1043 

Novel biomarkers 

1039, 1040, 1041, 1042, 1044, 1045, 

1046, 1047, 1048, 1049, 1050 

Basic research: Novel therapies 

191, 823, 824, 825, 826, 827, 828, 

829, 830, 831, 832, 833, 834, 835 

Imaging and new techniques 

217, 218, 219, 220, 221, 222, 223, 

224, 225, 226, 227, 228, 350, 351, 

352, 353, 354, 355, 356, 357, 358, 

359, 361, 582, 587, 588, 589, 696, 

861, V14, V17, V77, V79 

Management of metastatic 

disease 

97, 98, 99, 100, 101, 102, 103, 104, 

105, 106, 107, 108, 188, 674, 676, 

677, 678, 679, 680, 681, 682, 

Management of non-metastatic 

disease: Active surveillance 

265, 266, 267, 268, 269, 270, 271, 

272, 273, 274, 275 


disease: Focal therapy 

192, 578, 579, 580, 581, 583, 584, 

585, 586, 675 


disease: Radical non surgical 

treatment 

181, 182, 183, 184, 185, 190, 683, 

684, 806, 807 


disease: Radical surgical 

treatment 

180, 186, 187, 189, 288, 289, 290, 

291, 292, 293, 294, 295, 296, 297, 

298, 299, 685, 686, 687, 688, 689, 



467 

Indices

Indices 

Abstract sorted by Topic 

690, 691, 692, 693, 694, 695, 799, 800, 801, 802, 803, 

804, 805, 808, 809, 810, 911, 912, 913, 914, 915, 916, 

917, 918, 919, 920, 921, 922, 1011, 1012, 1013, 1014, 

1015, 1016, 1017, 1018, 1019, 1020, 1021, 1022, 1023, 

1024, V10, V11, V13, V15, V16, V7 

Pathology and biopsies 

709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 

720, V62 

PSA and related markers 

848, 849, 850, 851, 852, 853, 854, 855, 856, 857, 858, 

859, 860 

Screening/diagnosis: Diagnosis 

3, 133, 135, 136, 137, 138, 139, 140, 141, 142, 143, 474 

Screening/diagnosis: Screening 

1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 721 

Staging 

360, 465, 466, 467, 468, 469, 470, 471, 472, 473, 475, 

476 

Renal tumours 


193, 194, 195, 196, 197, 198, 199, 200, 202, 203, 204, 

339, 343, 761, 762, 764, 765, 766, 767, 768, 769, 770, 

771, 772, 773, 774, 884, 975, 976, 977, 978, 979, 980, 

981, 982, 983, 984, 985, 986, V2 

Diagnosis 

336, 337, 338, 340, 341, 342, 344, 345, 346, 347, 348, 

349, 763 

Medical treatment 

1097, 1098, 1099, 1100, 1101, 1102, 1103, 1104, 1105, 

1106, 1107, 1108 

Non surgical treatment 

95, 174, 175 

Surgical treatment: Non organ sparing 

452, 453, 454, 455, 456, 458, 459, 460, 948, 950, 951, 

952, 953, 954, 955, 956, 957, 958, 959, 960, V4, V41, 

V42, V44, V5, V63 

Surgical treatment: Organ sparing 

452, 453, 454, 455, 456, 458, 459, 460, 948, 950, 951, 

952, 953, 954, 955, 956, 957, 958, 959, 960, V4, V41, 

V42, V44, V5, V63, 883, 885, 886, 887, V1, V18, V19, V20, 

V21, V22, V23, V24, V25, V43, V45, V46, V47, V48, V78 


Sexual dysfunction 


324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 

335 


120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 

131, 132, 205, 206, 207, 208, 209, 210, 211, 212, 213, 

214, 215, 216, V71 

Stones 

ESWL 

538, 539, 540, 541, 542, 543, 544, 652 

Medical/research 

311, 312, 313, 314, 315, 316, 317, 318, 321, 436, 437, 

438, 439, 550, 651, 653, 655, 657, 661 

Open and percutaneous 

320, 322, 323, 545, 546, 547, 548, 549, 551, 654, 656, 

658, 659, 962, 963, 964, 966, 967, 968, 969, 970, 971, 

972, 973, 974, V35, V36, V39, V40 

Upper tract benign disease 

961, 1061, 1069, 1070, V34 

Ureteroscopy 

319, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 

660, 1062, 1063, 1064, 1066, 1067, 1068, 1071, 1072, 

V37 

Trauma 

464, 562, 563, 564, 565, 662, 949, V66 

Unclassified and miscellaneous 

research 

13, 14, 15, 16, 17, 18, 19, 20, 21, 23, V12, V30, V33, V38, 

V60, V67 

Urethral strictures 

247, 248, 787, 788, 790, 791, 792, 793, 794, 795, 796, 

797, 798 

Uro-genital reconstruction 

249, 425, 552, 553, 554, 555, 556, 557, 558, 559, 560, 

561, 862, 863, 864, 865, 866, 867, 868, 869, 870, 871, 

872, 873, 874, 1026, V54, V55, V56, V57, V68, V69, V70, 

V74, V76 


Urothelial tumours 


50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 144, 145, 

146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 

157 

Diagnosis 

229, 230, 232, 233, 234, 235, 236, 237, 238, 239, 240, 

241, 242, 282, 287, 362, 363, 364, 365, 366, 367, 368, 

369, 370, 371, 372, 373, 479, 572, 574, 590, 591, 592, 

593, 594, 595, 596, 597, 598, 599, 600, 601, 759 

Management of infiltrative/advanced tumours: Non 

surgical management 

74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85 

Management of infiltrative/advanced tumours: 

Surgical management 

24, 753, 811, 812, 813, 814, 815, 816, 817, 818, 819, 820, 

821, 822, 923, 924, 925, 926, 927, 928, 929, 930, 931, 

932, 933, 934, 1025, 1027, 1028, 1029, 1030, 1031, 1032, 

1033, 1034, 1035, 1036, 1037, 1038, V26, V27, V29, V58, 

V6, V64, V72, V8, V9 

Management of superficial tumours 

231, 487, 488, 566, 567, 568, 569, 570, 571, 575, 577, 

697, 698, 699, 700, 701, 702, 703, 704, 705, 706, 707, 

708, 748, 749, 750, 751, 752, 754, 755, 756, 757, 758, 

760, V59 

Staging 

276, 277, 278, 279, 280, 281, 283, 284, 285, 286, 477, 

478, 480, 481, 482, 483, 484, 485, 486, 573, 576 



469 

Indices

Indices 

Sessions sorted by Topic 

Andrology 

71, 82, 83, 95, 106, 107, 117, 118, 132, 133, 157, 158, 

233, 256, 257, 271, 317, 325, 352, 408 


59, 61, 63, 67, 70, 108, 121, 122, 136, 137, 149, 150, 

165, 166, 177, 178, 196, 197, 215, 216, 264, 285, 286, 

303, 304, 340, 354, 400, 406 

BPH 

202, 203, 221, 222, 235, 280, 281, 295, 296, 312, 313, 

365, 400, 403, 404, 407, 415, 416 

Functional urology 

61, 65, 67, 68, 76, 87, 88, 95, 99, 100, 116, 138, 139, 

143, 153, 154, 183, 184, 189, 190, 227, 228, 233, 234, 

235, 243, 244, 245, 246, 251, 252, 261, 278, 279, 297, 

298, 317, 322, 326, 334, 345, 347, 369, 370, 409, 410, 

411, 418, 419 

History 

84, 112, 311 

Infections 

95, 106, 123, 124, 200, 201, 219, 220, 260, 405, 414 

Kidney transplantation 

104, 105, 179, 180, 190, 191, 263, 317, 328 


69, 76, 95, 171, 185, 186, 204, 205, 223, 224, 317, 360 

Penis/testis 

181, 182, 307, 308, 317, 339 


53, 54, 55, 57, 60, 61, 63, 65, 67, 78, 95, 108, 114, 115, 

119, 120, 127, 128, 129, 134, 135, 143, 147, 148, 151, 

152, 164, 167, 175, 176, 194, 195, 200, 201, 213, 214, 

229, 230, 233, 237, 238, 241, 242, 258, 259, 264, 265, 

266, 269, 270, 272, 273, 283, 284, 287, 288, 301, 302, 

305, 306, 317, 318, 319, 321, 323, 324, 348, 356, 357, 

358, 359, 363, 364, 367, 401, 402, 412, 413, 417, 420, 

421 

Reconstructive urology 

56, 61, 110, 111, 143, 208, 209, 274, 275, 282, 317 


Renal tumours 

63, 66, 68, 91, 92, 108, 109, 125, 126, 130, 131, 140, 

141, 146, 159, 160, 161, 168, 169, 191, 192, 212, 217, 

218, 249, 250, 255, 258, 259, 264, 276, 277, 289, 290, 

293, 294, 314, 315, 317, 327, 337, 342, 372, 397, 398, 

399 


65, 93, 96, 146, 172, 173, 174, 254, 342, 356, 357, 368 

Stones 

60, 67, 102, 144, 145, 155, 156, 187, 188, 193, 206, 207, 

225, 226, 233, 291, 292, 309, 310, 317, 329, 330, 350, 

353, 371, 400 

Trauma 

208, 209, 317, 366 

Urothelial tumours 

85, 86, 89, 90, 143, 144, 210, 211, 239, 240, 247, 248, 

258, 259, 267, 268, 317, 361 

Numbers refer to page numbers

List of Speakers (not abstracts) 

A 

Abbou C-C., 70, 72, 80, 96 

Abol-Enein H., 63, 303, 366 

Abrahamsson P-A., 72, 75, 319 

Abrams P., 183, 233, 334, 410 

Ahallal Y., 70 

Ahmed H.U., 213 

Aho T., 407 

Ahyai S., 111 

Al-Hayek S., 93 

Al Naimi A., 63 

Al Nono I.H., 63 

Albers P., 236, 258, 339 

Alcaraz A., 97, 340, 400 

Algaba F., 109, 335 

Alici B.M., 110 

Alivizatos G.J., 390 

Andersson K-E., 138 

Andrich D.E., 110, 111 

Andriole G., 53, 404 

Annerstedt C.M., 97, 254 

Anson K.M., 365 

Artibani W., 61, 68, 76, 96, 99, 254, 

356 

Atallah K., 70 

Aulitzky W., 271, 352 

Ayati M., 61 

Azzouzi A.R., 417 

B 

Babjuk M., 210, 354 

Bach T., 102, 144 

Bachmann A., 97, 280, 375, 390 

Bader P., 262 

Bahl A., 401 

Barber N., 390 

Bardan R.T., 379 

Barret E., 191, 417 

Bartoletti R., 106, 415 

Basiri A., 61 

Bassi P.F., 405 

Bastian P., 136 

Bauer R., 100, 297 

Baumert H., 140, 329 

Beerlage H.P., 113, 331 

Bellmunt J., 57, 89, 421 

Bergstrom R., 419 

Bettocchi C., 106 

Bex A., 108, 337 

Birkhäuser F., 293 

Birowo P., 71 

Bjartell A., 258 

Bjerklund Johansen T.E., 106, 260, 

299, 365 

Black P., 196 

Bogaert G.A., 223, 360 

Borkowski T.A., 114 

Bossi A., 128, 318, 348 

Boström P.J., 72, 121 

Botto H., 416 

Brausi M., 108, 143, 170, 285, 299, 

406 

Brawley O.W., 54 

Breda A., 96, 163, 198, 353, 386 

Brehmer M., 94, 377 

Briganti A., 61, 317 

Brown P., 53, 55 

Bryan R., 136 

Buchholz N.N-P., 102, 193, 353, 377 

Bucuras V., 96, 291, 393 

Budde K., 399 

Buffi N.M., 383 

Bulbul M., 63 

Burchardt M., 97, 283, 381 

Burger M., 165, 215, 406 

Burgos Revilla F.J., 104, 263, 328 

Burke D., 264 

Burkhard F.C., 261, 317, 345 

C 

Camignani L., 97 

Campos Pinheiro L.M., 147 

Capitan Manjon C.M., 373 

Carbone A., 146 

Carey B.M., 100, 175 

Carl S., 390 

Castro-Diaz D., 99 

Cathelineau X., 338 

Catto J.W.F., 165, 317, 343 

Çek H.M., 219 

Celia A., 212 

Cervigni M., 405 

Cestari A., 96, 159, 254 

Chapple C.R., 56, 67, 234, 322, 410 

Cheon J., 57 

Chiti A., 167 

Chkhotua A.B., 104, 217 

Chlosta P., 233, 380 

Chrisofos M., 123 

Chung B.H., 57 

Chung M.K., 57 

Clarke N.W., 65, 108, 339, 402 

Coelho Nunes P.T., 104 

Compérat E., 335 

Congregado Ruiz C.B., 194 

Cornel E.B., 93 

Costa C.S.R., 157 

Costantini E., 326 

Cowan N., 259 

Cresswell J., 379 

Crouzet S., 272 

Cruz C.D., 189 

Cruz F.R., 67, 76, 99, 370, 409, 418 

Culig Z., 53, 108, 164, 299 

Curigliano G., 412 

Cuzick J., 53, 318 

Cuzin B., 132 

Cynk M., 407 

D 

Dahlem R., 111 

Damiano R., 405 

Dasgupta P., 97, 356 

De Gennaro M., 204 

De Jong I.J., 127, 420 

De La Morena Gallego J.M., 159 

De La Rosette J.M.C.H., 97, 102, 

327, 403 

De La Taille A., 255, 393, 415 

De Reijke T.M., 147, 420 

De Ridder D.J.M.K., 65, 76, 99, 326 

De Santis M., 114, 258, 413 

Deger S., 110, 299 

Del Popolo G., 261 

Demirkesen O., 110 

Desai M.R., 59, 144, 225 

Di Stasi S.M., 406 

Di Tonno P., 104 

Dinis Oliveira P., 251 

Dirix P., 63 

Dixon P., 419 

Djavan B., 61, 109, 167, 305, 348 

Djinovic R.P., 110 

Dohle G.R., 107 

Dore B., 309 

Doumerc N.D., 383 

Drake M.J., 95, 245, 370, 385, 419 

Numbers refer to page numbers 


471 

Indices

Indices 


Dreikorn K., 104 

Drewa T.A., 274 

Duran I., 398 

Dybowski B.A., 183 

E 

Eardley I., 236, 256, 325, 408 

Eberli D., 138, 171 

Eeles R.A., 53 

Egawa S., 181 

Eisenberger M., 412 

El Halaby M.R., 63 

Elliott R., 419 

Elneil S., 333 

Emami M., 61 

Emberton M., 318, 404 

Erdogru T., 97 

Escudier B., 108 

Esen T., 59, 93, 202 

Everaert K., 262 

F 

Fajkovic H., 93 

Farag F., 100 

Feitz W.F.J., 171, 317 

Ferreira Coelho M.X., 99 

Ficarra V., 415 

Figueiredo A.J., 104, 263, 299, 311, 

328 

Finazzi Agro E., 405 

Fisch M.M., 110, 369 

Fitzpatrick J.M., 401 

Fode M., 95, 233 

Ford L., 54 

Fournier G.H., 373 

Frede T., 96 

Fritsche H-M., 102 

Fulgham P., 161 

Furriel F., 93 

Fusco F., 107 

G 

Gaboardi F., 382 

Gambaro G., 102 

Gangi A., 57 

Ganzer R., 151 

Garmanova T.N., 94 

Geavlete B., 400 

Geavlete P.A., 99, 193, 300, 377 


Giannantoni A., 227 

Giessing M., 104, 198, 263 

Gill I.S., 168, 255 

Gillessen S., 397 

Giuliano F., 71, 403 

Giusti G., 96, 291, 386 

Godoy G., 93 

Goh A., 172 

Gomez V., 105 

Gomez Dos Santos V., 116 

Gomez Sancha F., 388 

Gómez Veiga F., 241 

Gontero P., 89, 327 

Gordon G., 55 

Gözen A.S., 381 

Grabe M., 69, 106, 123, 260 

Graefen M., 172, 254, 301 

Grasso M., 350 

Gratzke C., 243, 343, 373, 388, 410 

Graziottin A., 408 

Greco F., 196 

Gross A.J., 378 

Gruenwald I., 117 

Gschwend J.E., 347, 413 

Guazzoni G., 96, 342 

Guillonneau B., 380 

Gutierrez J., 67 

H 

Haab F., 76, 116, 410 

Hachi K., 70 

Haese A., 254, 272 

Hakenberg O.W., 285, 324 

Halaska M., 99 

Hamdy F.C., 55, 143, 318, 321, 416 

Hamid R., 100 

Hammerer P., 367, 412 

Han S.W., 57, 185 

Hanus T., 251 

Hariharan P., 59 

Hashim H., 143, 245, 385 

Hatzichristou D.G., 408 

Hatzimouratidis K., 132 

Hatzinger M., 112 

Heesakkers J.P.F.A., 67, 99, 299 

Heidenreich A., 265, 317, 402 

Heinz-Peer G., 259 

Hendricksen K., 94 

Herrmann T.R.W., 372, 392 

Hess B., 102 

Heynemann H., 100 

Hoebeke P., 111 

Holmberg L., 53 

Hong S.J., 57 

Hood C., 413 

Hosseini S.J., 61, 253 

Hoznek A., 96, 387 

Hruby S., 93 

Huang J., 267 

Hubert J., 342 

Hudson T., 319 

Hugosson J.E., 78, 318 

I 

Illic D., 54 

Irani J., 177 

Iversen P., 318 

J Jacqmin D., 57 

Janetschek G., 68, 98, 317, 329 

Jankevicius F., 249 

Jannini E.A., 107 

Jardin A., 84 

Jenster G., 287 

Jewett M., 168, 318 

Joniau S.G., 274, 322 

Joual A., 70 

Joyce A.D., 338, 377 

Junker K., 249 

Jünemann K.P., 409, 418 

K 

Kadioglu A., 107 

Kahlmeter G., 260 

Kalogeropoulos T., 382 

Kaouk J.H., 172, 372 

Karam G., 105, 179 

Karsenty G., 409, 418 

Keeley F., 102, 327, 377 

Kekre N., 59 

Kessler T.M., 100, 234 

Key T., 54 

Khauli R.B., 63 

Kim C., 58 

Kim D.K., 57 

Kim S.D., 174 

Kirby M., 77 


Klatte T., 293 

Kleinclauss F., 104 

Klingler H-C., 68, 276 

Knoll T., 96, 102, 145, 371, 387 

Knowles M., 85 

Kocjancic E., 326 

Kok D.J., 102 

Kopa Z., 82 

Kristiansen G., 164 

Kuczyk M., 168, 337, 397 

Kuntz R.M., 365, 407 

Kwon D.D., 57 

L 

Lackgren G., 76, 185 

Laguna M.P., 91, 97, 143 

Lahme S., 102 

Langsteger W., 167 

Lapini A., 97, 393 

Larré S., 59, 93 

Lebret T., 70 

Lepor H., 416 

Leung H.Y., 287 

Liatsikos E., 96, 151, 371, 380 

Liedberg F., 267 

Lilja H.G., 53 

Ljungberg B., 161 

Lledo García E., 104, 217 

Llorente C., 69, 253 

Loch T., 99, 161 

Lopez Pereira P., 261 

Lopez-Beltran A., 108 

Lopez-Tello Garcia J.J., 208 

Loriot Y., 70 

Lumen N., 111 

Lund L., 94 

M 

Macek P., 134, 382 

Machtens S., 358 

Madersbacher S., 221, 334 

Malavaud B., 97, 213, 340, 400 

Malmström P-U., 149 

Manzoni G.A., 171 

Marberger M., 54, 68, 94, 235, 404 

Martinez Bustamante L.G., 93 

Martov A.G., 378 

Martínez Piñeiro L., 299, 317, 366, 

412 

Matikainen M.P., 134 

Mattelaer J., 112, 311 

Matveev V., 215 

McClinton S., 206 

Medina López R., 264 

Mejean A., 398 

Merseburger A.S., 128, 233, 258 

Messas A., 300 

Messelink E.J., 262 

Meuleman E.J.H., 107 

Meyskens F., 54 

Meyyappan R., 59 

Michel M.S., 97, 170, 317 

Micic S., 271 

Mickisch G., 323 

Miller K., 323, 421 

Millán-Rodríguez F., 353 

Milsom I., 410 

Minasian L., 54 

Minervini A., 381 

Mirone V., 71, 94, 299, 404 

Monagas Arteaga S.M., 95 

Monastyrskaya K., 227 

Moncada I., 110, 408 

Mondaini N., 200 

Monnet D., 106 

Montironi R., 109 

Montorsi F., 72, 143, 172, 343, 416 

Morsy A., 63 

Mottet N., 401 

Mottrie A., 65, 93, 96, 172, 255, 265, 

299, 342 

Moudouni S.M., 63, 70 

Msessa N., 63 

Muir G., 389 

Mulders P.F.A., 130, 168, 413 

Müller S., 94 

Mundy A.R., 76, 110 

Muneer A., 256 

Muschter R., 96, 378 

Musquera Felip M., 179, 263 

N 

Naber K.G., 106, 414 

Nagele U., 379 

Nicolai N., 307 

Nijman J.M., 360 

Nitti V.W., 153 

Noon A., 239 

Nouira Y., 63 

Novara G., 295, 343, 416 

Nyirády P.J., 91 

N’Dow J.M.O., 57, 69 

O 

Oedekoven T., 95 

Oehlschläger S., 102, 155 

Oelke M., 202, 234, 411 

Olsburgh J.D., 263 

Osanto S., 337 

Osman Y.M., 149 

Osther P.J., 96, 102, 144, 299, 350, 

387 

Oudard S., 401 

Özen H.A., 109 

O’Brien T.S., 143, 177 

P 

Paez Borda A., 262 

Palma P., 67, 417 

Palminteri E., 62, 110 

Palou J., 67, 94, 144, 354 

Pansadoro V., 110, 331 

Park D.S., 295 

Parker C., 53, 55, 167, 413 

Parnes H., 54 

Parsons K.F., 94, 161, 317 

Patard J.J., 125 

Patel A., 59, 353 

Patel N.S., 383 

Peri Cusi L., 282 

Perner S., 53 

Peschers U., 76 

Petri E., 99 

Pfitzenmaier J., 97 

Piaserico S., 105 

Pickard R.S., 106, 219 

Piechaud P.T., 97, 146, 356 

Pignot G.A.N., 282 

Porpiglia F., 97, 276, 329, 380 

Porst H., 403 

Porta C., 397 

Porter J., 173 

Powles T., 398 

Pummer K., 323 

Pushkar D., 345, 407 



473 

Indices

Indices 


R 

Rabah D., 63 

Rabenalt R., 113, 382 

Radziszewski P., 100, 233, 261 

Ralph D., 106, 325 

Ramirez Backhaus M., 237 

Ramon J., 289 

Rane A., 372 

Rassweiler J., 67, 72, 96, 102, 170, 

225, 299, 368, 417 

Rehder P., 234, 297 

Reich O., 56, 375 

Reinhardt S., 95 

Reis Santos J.M., 102 

Reisman Y., 117 

Reitz A., 153 

Rengifo Abbad D., 125 

Rennert G., 54 

Ribal M.J., 97, 212, 381, 415 

Rischmann P., 378 

Rittenhouse H., 53 

Rix G., 407 

Rocco B., 283 

Rodrigues de Lima E.A., 187 

Rodriguez Faba O., 104 

Roehrborn C.G., 312 

Romdam T., 71 

Roobol M.J., 78 

Rosier P.F.W.M., 99 

Rothwell P., 54 

Rouprêt M., 144, 239, 361 

Ruf C.G.A., 95 

S 

Sa Y.L., 56 

Saglam R., 97 

Salomon G., 100 

Salomon L., 263 

Salonia A., 256 

Salvioni R., 181 

Sanadizadeh S.M., 61 

Sanchez Salas R.E., 255, 301 

Sanchez-Carbayo M., 121, 165 

Sanguedolce F., 94 

Santer F.R., 269 

Sarica K., 102 

Scattoni V., 241, 367 

Schalken J.A., 53, 402 

Schilling D.A., 170 


Schips L., 172 

Schlomm T., 172 

Schmid H-P., 55, 194 

Schmitz-Dräger B.J., 55 

Schröder F.H., 53, 55, 59 

Schulman C.C., 71 

Schultheiss D., 84, 112 

Schwentner C., 380 

Schöffski P., 398 

Schön G., 173 

Scoffone C.M., 102, 144, 371, 392 

Sedelaar J.P.M., 59, 93, 358 

Seo S.I., 57 

Seong D-H., 58 

Serra A.L., 399 

Shakeri S., 61 

Shariat S.F., 70, 143, 247, 343, 361 

Shenfeld O.Z., 110 

Siener R., 102 

Sievert K-D., 97, 111, 234, 278, 392, 

419 

Silay M.S., 95 

Siracusano S., 100 

Skolarikos A., 97, 102, 144, 170, 386 

Smith R., 55 

Sochaj M., 93 

Soebadi D.M., 71 

Sofikitis N., 71, 106 

Solsona E., 303, 417 

Sonksen J.O.R., 95, 256, 317 

Sosnowski R., 247 

Speakman M.J., 234, 312, 410 

Spinelli M., 409, 418 

Sridhar F., 59 

Srivastava A., 59 

Staehler M., 399 

Stein R., 171 

Stenzl A., 53, 55, 317, 347 

Sternberg C.N., 402 

Stief C., 325, 417 

Stöckle M., 163 

Stolzenburg J-U., 96, 363, 400 

Straub M., 102 

Studer U.E., 67, 73, 347 

Subramaniam R., 171 

Sugandi S., 71 

Sulser T., 155 

Sültmann H., 164 

Sun Y-H., 318 

Sung G.T., 57 

Swiniarski P.P., 94 

Sylvester R.J., 108, 343 

T Tailly G.G., 378 

Tammela T.L.J., 318 

Tandogdu Z., 93, 106 

Tasca A., 309 

Tchanturaia Z., 68, 204 

Teber D., 379 

Tekgül S., 223, 360 

Tenke P., 106, 414 

Terrone C., 104 

Thalmann G.N., 69, 255, 305 

Theodorescu D., 85, 108 

Thomas J.A., 373 

Thompson A., 412 

Thüroff J.W., 70, 234 

Thüroff S.F.M., 358 

Tikkinen K.A.O., 161 

Tiselius H.G., 102, 206 

Tomaskin R., 405 

Tombal B., 54, 57, 108, 317, 397 

Touijer K., 363 

Traxer O., 56, 95, 143, 187, 350, 400 

Trinchieri A., 102 

Trombetta C., 99 

Tubaro A., 87, 97 

Tunc L., 96, 379 

Turgut A., 259 

Türkeri L.N., 95, 229 

U Uvelius B., 87 

V Vaessen C., 173 

Vallancien G., 63 

Van Cleynenbreugel B.S.E.P., 93, 

381 

Van Der Aa F.A., 369 

Van Der Heijden A.G., 93 

Van Der Kwast T., 108 

Van Der Poel H.G., 80, 172, 343, 

383, 417 

Van Kerrebroeck P.E., 411 

Van Koeveringe G., 189 

Van Moorselaar R.J.A., 127, 348 


Van Poppel H., 65, 94, 317, 324 

Van Renterghem K.M.L., 221 

Van Rhijn B., 210 

Van Velthoven R.F., 98, 170, 174, 

368 

Vasquez J.L., 94 

Vavassori I., 407 

Villavicencio Mavrich H., 67 

Villeirs G., 109 

Visakorpi T., 164, 269 

Volpe A., 59, 109, 163 

Vuksanovic A., 191 

W 

Wagenlehner F.M.E., 95, 106, 200, 

260, 414 

Wagg A., 76, 278 

Waltregny D.A.O., 243 

Walz J., 99, 175, 299 

Watson R.W.G., 280 

Weidner W.H.G., 82, 106, 352 

Wein A.J., 411 

Weiss J., 411 

Wespes E., 107, 157 

Wiegel T., 237, 420 

Wijkstra H., 100 

Wiklund P., 96, 163, 172, 254, 318, 

368 

Williams J.C., 102 

Wilt T.J., 53 

Wirth M., 59, 63, 75, 167, 233, 318 

Witjes J.A., 165, 354, 406 

Witt J.H., 384 

Wolk A., 54 

Woo H., 97 

Wood D.N., 208 

Wullt B., 414 

Wyndaele J.J., 333 

X Xie L-P., 56 

Z Zastrow S., 130 

Zeng G-H., 56 

Zhivov A., 110 

Zigeuner R.E., 144, 289 

Zlotta A.R., 307, 321 

Zonnenberg B., 399 



475 

Indices

EAU Programme - edizioni scripta manent planet

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?