17.06.2013 Views

EAU 2013 - Programme Book - YouMed

EAU 2013 - Programme Book - YouMed

EAU 2013 - Programme Book - YouMed

SHOW MORE
SHOW LESS

You also want an ePaper? Increase the reach of your titles

YUMPU automatically turns print PDFs into web optimized ePapers that Google loves.

It’s easy to save money on your flights if you fly the Star Alliance<br />

network. Simply quote the event code SK01A57 when you make your<br />

booking with any Star Alliance member airline and you’ll automatically<br />

get a discount of up to 20%.<br />

The Star Alliance network has 27 member airlines with over 21,900<br />

flights a day so we can offer you a lot more choice when planning your<br />

travel. For more information about our member airlines and contact<br />

details, please visit our website at staralliance.com/conventionsplus<br />

staralliance.com<br />

Information correct as at 11/2012


Contents<br />

Welcome 3<br />

<strong>EAU</strong> Sponsors and Contributors 4<br />

Synopsis & Venue<br />

<strong>EAU</strong> Award Winners 6<br />

Acknowledgement of Abstract reviewers 9<br />

Floorplans 12<br />

Synopsis 15<br />

Exhibition Floorplans 30<br />

Alphabetical list of Exhibitors 34<br />

General<br />

General Information 39<br />

Speaker Guidelines 46<br />

CME Accreditation 47<br />

EU-ACME <strong>Programme</strong> 48<br />

Congress Hotels 49<br />

<strong>EAU</strong> <strong>Programme</strong> Friday, 15 March 53<br />

<strong>EAU</strong> <strong>Programme</strong> Saturday, 16 March 75<br />

<strong>EAU</strong> <strong>Programme</strong> Sunday, 17 March 143<br />

<strong>EAU</strong> <strong>Programme</strong> Monday, 18 March 233<br />

<strong>EAU</strong> <strong>Programme</strong> Tuesday, 19 March 317<br />

ESU Courses and Hands-on Training Courses<br />

ESU Courses 321<br />

ESU/ESUT Hands-on Training Courses 373<br />

Sponsored Sessions 397<br />

About <strong>EAU</strong><br />

<strong>EAU</strong> Membership 423<br />

<strong>EAU</strong> Offices 424<br />

Historical Overview <strong>EAU</strong> Congresses 427<br />

Indices<br />

Abstract Authors 429<br />

Abstracts sorted by Topic 467<br />

Sessions sorted by Topic 470<br />

List of Speakers (not abstracts) 471<br />

“The <strong>EAU</strong> Scientific Congress Office is responsible for the scientific<br />

congress programme (with the exception of the sponsored sessions).<br />

However, the opinions and recommendations expressed by<br />

the presenters and planners of educational content in this programme<br />

are their own and do not necessarily represent the viewpoint<br />

of the <strong>EAU</strong>”<br />

2 <strong>Programme</strong> <strong>Book</strong>


Welcome to Milan<br />

by the <strong>EAU</strong> Secretary General and the Congress President<br />

Dear friends and colleagues,<br />

We are delighted to have you here with us at the 28th Annual <strong>EAU</strong> Congress, in the beautiful<br />

city of Milan! The congress thrives on your enthusiastic participation and continuous support<br />

and we thank you for bringing your experience and your ideas to this international gathering.<br />

Milan is a wonderful host city and we are very excited to return to the recently renovated venue<br />

of MiCo – Milano Congressi. It features all the latest facilities to accommodate an event of this<br />

scope and we believe that it will provide a perfect setting for our forward-looking discussions.<br />

From a full-day live surgery event in the eURO Auditorium to the state-of-the art technology<br />

shown on the exhibition floor, the congress will draw much of its inspiration from the promises<br />

of the future.<br />

The scientific programme of the congress is once again very diverse – both in format and<br />

content. We have made sure to meet the needs of the whole urological community and address<br />

a wide range of pressing topics. At the same time we will be continuing some of the ongoing<br />

discussions, such as screening for prostate cancer and adding new evidence and experience to<br />

these controversial topics. Over 1,500 faculty members will be delivering the latest information<br />

in urology and sharing the most relevant best practices in the course of five days – a scientific<br />

effort of an incredible scale, which will certainly inspire many of us to further grow within this<br />

field and contribute to its development.<br />

If you are looking for practical information and a hands-on experience, the European School of<br />

Urology has prepared nearly 40 courses to choose from. Highly interactive and always popular,<br />

the courses are a great chance not only to learn, but also to meet new colleagues and build<br />

new contacts.<br />

We hope that your time in Milan will be productive and that it will be a source of great inspiration<br />

and knowledge for the year to come. We also wish you to have a very pleasant stay in<br />

Milan a city known for its architecture, exquisite restaurants and fashion!<br />

On behalf of the European Association of Urology,<br />

Per-Anders<br />

Abrahamsson<br />

<strong>EAU</strong> Secretary<br />

General<br />

Francesco<br />

Montorsi<br />

Congress<br />

President<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

3


<strong>EAU</strong> Sponsors & Contributors<br />

<strong>EAU</strong> Platinum Corporate sponsors<br />

AMGEN<br />

ASTELLAS<br />

GLAXOSMITHKLINE<br />

IPSEN<br />

<strong>EAU</strong> Gold Corporate Sponsors<br />

AMERICAN MEDICAL SYSTEMS<br />

ELI LILLY AND COMPANY<br />

FERRING PHARMACEUTICALS<br />

INTUITIVE SURGICAL<br />

JANSSEN PHARMACEUTICAL COMPANIES OF JOHNSON & JOHNSON<br />

KARL STORZ GMBH & CO.KG<br />

MILLENNIUM: THE TAKEDA ONCOLOGY COMPANY<br />

OLYMPUS EUROPA HOLDING GMBH<br />

PIERRE FABRE MÉDICAMENT<br />

SANOFI ONCOLOGY<br />

<strong>EAU</strong> Congress Contributors<br />

ALLERGAN<br />

BAYER HEALTHCARE PHARMACEUTICALS<br />

IBSA INSTITUTE BIOCHEMIQUE SA<br />

LUMENIS<br />

MENARINI<br />

NOVARTIS ONCOLOGY<br />

OM PHARMA<br />

PFIZER<br />

PORGÈS – A COLOPLAST DIVISION<br />

PRIME ONCOLOGY<br />

RECORDATI<br />

STEBA BIOTECH<br />

4 <strong>Programme</strong> <strong>Book</strong>


<strong>EAU</strong> Member<br />

Benefits at <strong>EAU</strong> <strong>2013</strong>!<br />

<strong>EAU</strong> members are kindly invited to collect the following complementary<br />

items:<br />

<strong>EAU</strong> Pocket Guidelines<br />

The Pocket Guidelines - a booklet and CD including the <strong>EAU</strong> Guidelines <strong>2013</strong> -<br />

can be collected at OLYMPUS booth C01.<br />

The distribution is supported by OLYMPUS.<br />

<strong>EAU</strong> members are kindly invited to the <strong>EAU</strong> booth H17 to collect<br />

the following complementary items:<br />

<strong>EAU</strong> Extended Guidelines<br />

The <strong>EAU</strong> Extended urological guidelines edition <strong>2013</strong>, are distributed at the<br />

<strong>EAU</strong> Square.<br />

De Historia Urologiae Europaeae Vol. 20<br />

This year marks the 20th edition of De Historia Urologiae Europaeae, the <strong>EAU</strong> History<br />

Office’s annual edited volume of Europe’s urological history. Beside the regular<br />

contributors from the History Office, newcomers tackle a broad range of fascinating<br />

topics.<br />

Congress delegates are kindly invited to collect the following<br />

complementary items:<br />

<strong>EAU</strong> Abstract CD <strong>2013</strong><br />

A CD containing all presented abstracts during the 28th Annual <strong>EAU</strong> Congress can be<br />

collected at FERRING booth E42.<br />

Supported by an educational grant from FERRING PHARMACEUTICALS.<br />

ESU Courses CD <strong>2013</strong><br />

A CD including all presentations and course materials of the ESU Courses given<br />

during the congress can be collected at MILLENIUM: The TAKEDA Oncology<br />

company, booth D30.<br />

Supported by an educational grant from MILLENIUM: The TAKEDA Oncology Company.<br />

<strong>EAU</strong> Poster DVD <strong>2013</strong><br />

A DVD containing the majority of the posters presented during the 28th Annual <strong>EAU</strong><br />

Congress. The <strong>EAU</strong> Poster DVD can be collected at AMGEN booth D20.<br />

Supported by an unrestricted educational grant from AMGEN.<br />

European<br />

Association<br />

of Urology<br />

Guidelines<br />

<strong>2013</strong> edition<br />

European<br />

Association<br />

of Urology<br />

Pocket Guidelines<br />

<strong>2013</strong> edition<br />

EUROPEAN EUROPEAN UROLOGY UROLOGY<br />

<strong>EAU</strong> Posters <strong>2013</strong><br />

28th Annual <strong>EAU</strong> Congress<br />

EU-ACME<br />

accredited content<br />

SUPPLEMENTS<br />

SUPPLEMENTS<br />

Volume 12 Issue 1 March <strong>2013</strong><br />

ESU Courses <strong>2013</strong><br />

28th Annual <strong>EAU</strong> Congress<br />

Abstracts 28th Annual <strong>EAU</strong> Congress


Awards<br />

<strong>EAU</strong> Award Winners<br />

<strong>EAU</strong> Willy Gregoir Medal <strong>2013</strong><br />

For a significant contribution to the development of the urological specialty in Europe<br />

C-C. Abbou, Creteil, France<br />

<strong>EAU</strong> Frans Debruyne Life Time Achievement Award <strong>2013</strong><br />

For a longstanding and important contribution to the activities and development of the <strong>EAU</strong><br />

J. Breza, Bratislava, Slovakia<br />

<strong>EAU</strong> Crystal Matula Award <strong>2013</strong><br />

For a young promising European urologist<br />

P. Boström, Turku, Finland<br />

Supported by an unrestricted educational grant from LABORIE<br />

<strong>EAU</strong> Hans Marberger Award <strong>2013</strong><br />

For the best European paper published on Minimally Invasive Surgery (in Urology)<br />

J. Rassweiler, Heilbronn, Germany<br />

iPad-Assisted Percutaneous Access to the Kidney Using Marker-Based Navigation: Initial<br />

Clinical Experience<br />

M. Müller, M. Fangerau, J. Klein, A. Goezen, P. Pereira, H-P. Meinzer, D. Teber (Heilbronn,<br />

Germany)<br />

European Urology (2012), doi 10.1016/j.eururo.2011.12.024<br />

Supported by an unrestricted educational grant from KARL STORZ GMBH & CO.KG<br />

<strong>EAU</strong> Innovators in Urology Award <strong>2013</strong><br />

For inventions and clinical contributions which have had a major impact on influencing the<br />

treatment and/or diagnosis of a urological disease<br />

U. Studer, Berne, Switzerland<br />

<strong>EAU</strong> Prostate Cancer Research Award <strong>2013</strong><br />

For the best paper published on clinical or experimental studies in prostate cancer<br />

I. Ahmad, Glasgow, United Kingdom<br />

HER2 overcomes PTEN (loss) - induced senescence to cause aggressive prostate cancer<br />

R. Patel, L. Babloo Singh, C. Nixon, M. Seywright, R. Barnetson, V. Brunton, W. Muller,<br />

J. Edwards, O. Sansom, H. Leung (Glasgow, Edinburgh, United Kingdom; Montreal,<br />

Canada)<br />

PNAS | September 27, 2011 | vol. 108 | no. 39 | 16397<br />

Supported by an unrestricted educational grant from the FRITZ H. SCHRÖDER FOUNDATION<br />

Prize for the Best Paper published on Fundamental Research in the Urological Literature<br />

E. Martens, S. Jalava, N. Dits, G. Van Leenders, S. Møller, J. Trapman, C. Bangma,<br />

T. Litman, T. Visakorpi, G. Jenster (Rotterdam, The Netherlands; Tampere, Finland;<br />

Vedbeak, Denmark)<br />

Diagnostic and prognostic signatures from the small non-coding RNA transcriptome in<br />

prostate cancer<br />

Oncogene (2012) 31, 978-991 – doi: 10.1038/onc.2011.304<br />

Prize for the Best Paper published on Clinical Research in the Urological Literature<br />

S. Shariat, M. Rink, B. Ehdaie, E. Xylinas, M. Babjuk, A. Merseburger, R. Svatek, E. Cha,<br />

S. Tagawa, H. Fajkovic, G. Novara, P. Karakiewicz, Q-D. Trinh, S. Daneshmand, Y. Lotan,<br />

W. Kassouf, H-M. Fritsche, F. Chun, G. Sonpavde, A. Joual, D. Scherr, M. Gonen (New<br />

York, San Antonio, Los Angeles, Dallas, Houston, United States of America; Hamburg,<br />

Hanover, Regensburg, Germany; Paris, France; Prague, Czech Republic; Padua, Italy;<br />

Montreal, Canada; Casablanca, Morocco)<br />

Pathologic Nodal Staging Score for Bladder Cancer: A Decision Tool for Adjuvant Therapy<br />

After Radical Cystectomy<br />

European Urology (2012) – accepted June 5, 2012 - doi: 10.1016/j.eururo.2012.06.008<br />

Prize for the Best Scientific Paper published in European Urology ® in 2012<br />

R. Rosenblatt, A. Sherif, E. Rintala, R. Wahlqvist, A. Ullén, S. Nilsson, P-U. Malmström,<br />

The Nordic Urothelial Cancer Group (Katrineholm, Stockholm, Uppsala, Sweden; Helsinki,<br />

Finland; Oslo, Norway)<br />

Pathologic Downstaging Is a Surrogate Marker for Efficacy and Increased Survival Following<br />

Neoadjuvant Chemotherapy and Radical Cystectomy for Muscle-Invasive Urothelial Bladder<br />

Cancer<br />

European Urology, Volume 61, Issue 6, June 2012, Pages 1229-1238<br />

Supported by an unrestricted educational grant from ELSEVIER<br />

6 <strong>Programme</strong> <strong>Book</strong>


Prize for the Best Scientific Paper published on Fundamental Research in European<br />

Urology ® by a young urologist (max. 35 years) in 2012<br />

R. Kandimalla, A. Van Tilborg, L. Kompier, D. Stumpel, R. Stam, C. Bangma, E. Zwarthoff<br />

(Rotterdam, The Netherlands)<br />

Genome-wide Analysis of CpG Island Methylation in Bladder Cancer Identified TBX2, TBX3,<br />

GATA2, and ZIC4 as pTa-Specific Prognostic Markers<br />

European Urology, Volume 61, Issue 6, June 2012, Pages 1245-1256<br />

Supported by an unrestricted educational grant from ELSEVIER<br />

Prize for the Best Scientific Paper published on Clinical Research in European Urology ® by<br />

a young urologist (max. 35 years) in 2012<br />

M. Rink, B. Ehdaie, E. Cha, D. Green, P. Karakiewicz, M. Babjuk, V. Margulis, J. Raman,<br />

R. Svatek, H. Fajkovic, R. Lee, G. Novara, J. Hansen, S. Daneshmand, Y. Lotan, W. Kassouf,<br />

H-M. Fritsche, A. Pycha, M. Fisch, D. Scherr, S. Shariat (New York, Dallas, Hershey,<br />

San Antonio, Los Angeles, Houston, United States of America; Hamburg, Regensburg,<br />

Germany; Montreal, Canada; Prague, Czech Republic; St. Poelten, Austria; Padua, Bolzano,<br />

Italy)<br />

Stage-Specific Impact of Tumor Location on Oncologic Outcomes in Patients With Upper and<br />

Lower Tract Urothelial Carcinoma Following Radical Surgery<br />

European Urology, Volume 62, Issue 4, October 2012, Pages 677-684<br />

First Prize for the Best Abstract (Oncology)<br />

J. Moll, R. Van Soest, J. Kumagai, R. Graeser, I. Hickson, G. Jenster, W. Van Weerden<br />

(Rotterdam, The Netherlands; Beerse, Belgium) - Abstract 824<br />

Abiraterone is able to block AR activation induced by accumulating levels of precursor<br />

hormones resulting from CYP17A1 inhibition<br />

Second Prize for the Best Abstract (Oncology)<br />

P. Sooriakumaran, L. Haendler, T. Nyberg, I. Heus, M. Olsson, S. Carlsson, M. Roobol,<br />

P. Wiklund (Stockholm, Sweden; Rotterdam, The Netherlands) - Abstract 912<br />

Comparative oncologic effectiveness of radical prostatectomy and radiotherapy in prostate<br />

cancer: An analysis of mortality outcomes in 34,515 patients treated with up to 15 years<br />

follow-up<br />

Third Prize for the Best Abstract (Oncology)<br />

H. Uemura, T. Kimura, K. Yoshimura, T. Minami, M. Nozawa, T. Nakagawa, H. Fujimoto,<br />

S. Egawa, A. Yamada, K. Itoh (Osaka, Tokyo, Fukuoka, Japan) - Abstract 98<br />

Combination therapy of peptide vaccines and dexamethasone for chemotherapy naïve<br />

castration resistant prostate cancer - a randomized phase-2 study<br />

First Prize for the Best Abstract (Non-Oncology)<br />

M. Lanz, C. Birchall, A. Ali, K. Walton, C.Townes, L. Lim, S. Roushias, P. Aldridge,<br />

R. Pickard, J. Hall (Newcastle Upon Tyne, United Kingdom) - Abstract 623<br />

Bacterial motility and NF-κB activation by clinical isolates from urinary tract infections<br />

Second Prize for the Best Abstract (Non-Oncology)<br />

K. Filipski, K. Deckmann, T. Bschleipfer, G. Krasteva-Christ, T. Papadakis, A. Rafiq,<br />

M. Wolff, I. Ibanez-Tallon, B. Schütz, E. Weihe, W. Kummer (Giessen, Berlin, Marburg,<br />

Germany) - Abstract 62<br />

A new cell in the urogenital tract - cholinergic chemosensory brush cells are sentinels of the<br />

urethra<br />

Third Prize for the Best Abstract (Non-Oncology)<br />

Y. Song, H. Lee, J. An, J. Yun, J. Kim, S. Doo, W. Yang, S. Kim (Seoul, South Korea)<br />

Abstract 325<br />

Repair of erectile dysfunction using transplantation of human mesenchymal stem cells<br />

cultivated on the surface of nanofibrous meshes in rats with cavernous nerve injury<br />

The European Urology ® Platinum Award <strong>2013</strong><br />

P-A. Abrahamsson, Malmö, Sweden<br />

W. Artibani, Verona, Italy<br />

J. Roelofswaard, Arnhem, The Netherlands<br />

M. Schlief, Arnhem, The Netherlands<br />

C. Schulman, Brussels, Belgium<br />

P. Teillac, Toulouse, France<br />

H. Van Poppel, Leuven, Belgium<br />

M. Wirth, Dresden, Germany<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

7<br />

Awards


Awards<br />

<strong>EAU</strong> Award Winners<br />

First Prize for the Best Abstract by a resident<br />

G. Shaw, D. Lewis, J. Boren, A. Ramos-Montoya, D. Soloviev, R. Bielik, K. Brindle, D. Neal (Cambridge, United Kingdom)<br />

Abstract 833<br />

Monitoring the effects of therapeutic fatty acid synthase inhibition in prostate canecr using 11C acetate PET<br />

Second Prize for the Best Abstract by a resident<br />

F. Castiglione, P. Hedlund, F. Van Der Aa, T. Bivalacqua, M. Albersen (Milan, Italy; Leuven, Belgium; Baltimore, United<br />

States of America) - Abstract 324<br />

Intratunical injection of human adipose tissue-derived stem cells prevents fibrosis and is associated with improved erectile<br />

function in a rat model of Peyronie’s disease<br />

Third Prize for the Best Abstract by a resident<br />

A. Ingels, A. Thong, M. Saar, M. Valta, R. Nolley, J. Santos, H. Zhao, D. Peehl (Stanford, United States of America)<br />

Abstract 975<br />

Pre-clinical trial of a new dual mTOR inhibitor: INK128 for renal cell carcinoma<br />

Resident’s Corner Award for the Best Scientific Paper published in European Urology ® by a resident (2 awards)<br />

T. Hambrock, C. Hoeks, C. Hulsbergen-Van de Kaa, T. Scheenen, J. Fütterer, S. Bouwense, I. Van Oort, F. Schröder,<br />

H. Huisman, J. Barentsz (Nijmegen, Rotterdam, The Netherlands)<br />

Prospective Assessment of Prostate Cancer Aggressiveness Using 3-T Diffusion-Weighted Magnetic Resonance Imaging–Guided<br />

Biopsies Versus a Systematic 10-Core Transrectal Ultrasound Prostate Biopsy Cohort<br />

European Urology, Volume 61, Issue 1, January 2012, Pages 177-184<br />

E. Cha, L-A. Tirsar, C. Schwentner, P. Christos, C. Mian, J. Hennenlotter, T. Martini, A. Stenzl, A. Pycha, S. Shariat,<br />

B. Schmitz-Dräger (New York, United States of America; Nürnberg, Tübingen, Germany; Bolzano, Italy)<br />

Immunocytology Is a Strong Predictor of Bladder Cancer Presence in Patients With Painless Hematuria: A Multicentre Study<br />

European Urology, Volume 61, Issue 1, January 2012, Pages 185-192<br />

First video prize<br />

O. Ukimura, A. De Castro Abreu, M. Nakamoto, S. Shoji, S. Leslie, A. Berger, A. Goh, M. Desai, M. Aron, I. Gill (Los Angeles,<br />

United States of America) - Video: V79<br />

Novel surgical tile-pro navigation with 3D prostate cancer model during robot-assisted radical prostatectomy<br />

Second video prize<br />

A. Rao, R. Gray, H. Motiwala, M. Laniado, O. Karim (Wexham, United Kingdom) - Video: V78<br />

Sequential occlusion angiography using contrast enhanced ultrasound scan (CEUS) demonstrating the avascular plane of<br />

Brodel: An adjunct to a novel technique of zero-ischaemia robot-assisted partial nephrectomy<br />

Third video prize<br />

S. Crouzet, Lyon, France - Video: V77<br />

Alternative solution to current MIS robotic system<br />

EUSP Best Scholar Award<br />

L.F. Arenas Da Silva, Mullheim an der Ruhr, Germany<br />

Urethral Reconstruction using tissue Engineering Techniques<br />

8 <strong>Programme</strong> <strong>Book</strong><br />

The 28th Annual <strong>EAU</strong> Congress features an <strong>EAU</strong> Award Gallery. Here you can find a<br />

complete overview of all <strong>EAU</strong> Awards that will be handed out during the Congress.<br />

It will also list the past winners of the most prestigious urology prizes.<br />

The <strong>EAU</strong> Award Gallery provides a great opportunity to take in all the important<br />

developments and breakthroughs in recent years. It can be found on Level S2 (between<br />

eURO Auditorium and the catering point), be sure to visit it!


Acknowledgement of Abstract reviewers<br />

The abstract sessions have been composed by and under the responsibility of the members of the <strong>EAU</strong> Scientific<br />

Congress Office & Video Committee (see page 425) who wish to acknowledge the following reviewers for their<br />

important contribution to the 28th Annual <strong>EAU</strong> Congress.<br />

H. Abol-Enein, Mansoura (EG)<br />

L.M. Abranches Monteiro, Lisbon (PT)<br />

E. Akkus, Istanbul (TR)<br />

P.C. Albertsen, Farmington (US)<br />

K. Albrecht, Hanover (DE)<br />

G.J. Alivizatos, Athens (GR)<br />

F.E. Ameye, Ghent (BE)<br />

K.M. Anson, London (GB)<br />

A. Apostolidis, Thessaloniki (GR)<br />

M. Auprich, Graz (AT)<br />

A. Avelino, Porto (PT)<br />

A.R. Azzouzi, Angers (FR)<br />

M. Babjuk, Prague (CZ)<br />

J. Baniel, Petach Tikva (IL)<br />

G. Barbagli, Arezzo (IT)<br />

J. Barkin, Toronto (CA)<br />

R. Bauer, Munich (DE)<br />

J. Bedke, Tübingen (DE)<br />

D. Behr-Roussel, Orsay (FR)<br />

J. Bellmunt, Barcelona (ES)<br />

M. Bennamoun, Paris (FR)<br />

A. Bex, Amsterdam (NL)<br />

C. Bolenz, Mannheim (DE)<br />

T.A. Borkowski, Warsaw (PL)<br />

A. Bossi, Villejuif (FR)<br />

M. Brausi, Modena (IT)<br />

A. Breda, Barcelona (ES)<br />

M. Brehmer, Stockholm (SE)<br />

E.K. Bres-Niewada, Warsaw (PL)<br />

S.D. Brookman-May, Regensburg (DE)<br />

R.T. Bryan, Birmingham (GB)<br />

R.J. Bryant, Oxford (GB)<br />

V. Bucuras, Timisoara (RO)<br />

M. Burger, Würzburg (DE)<br />

F.J. Burgos Revilla, Madrid (ES)<br />

I. Cagiannos, Ottawa (CA)<br />

F. Calais Da Silva Junior, Lisbon (PT)<br />

U. Capitanio, Milan (IT)<br />

S.V.C. Carlsson, Gothenburg (SE)<br />

D.M. Castro-Diaz, Santa Cruz de Tenerife (ES)<br />

I.T.R. Cavarretta, Milan (IT)<br />

Y. Ceder, Malmö (SE)<br />

H.M. Çek, Istanbul (TR)<br />

A. Cestari, Milan (IT)<br />

M.B. Chancellor, Royal Oak (US)<br />

E. Chartier-Kastler, Paris (FR)<br />

A.B. Chkhotua, Tbilisi (GE)<br />

P. Chlosta, Cracow (PL)<br />

F.K-H. Chun, Hamburg (DE)<br />

L. Cindolo, Vasto-Chieti (IT)<br />

M. Colombel, Lyon (FR)<br />

C.B. Congregado Ruiz, Seville (ES)<br />

M.R. Cooperberg, San Francisco (US)<br />

J-N.L. Cornu, Paris (FR)<br />

C.S.R. Costa, Porto (PT)<br />

S. Crouzet, Lyon (FR)<br />

C.D. Cruz, Porto (PT)<br />

B. Cuzin, Lyon (FR)<br />

J-E. Damber, Gothenburg (SE)<br />

R. De Gier, Nijmegen (NL)<br />

J.M. De La Morena Gallego, Madrid (ES)<br />

C. De Nunzio, Rome (IT)<br />

T.M. De Reijke, Amsterdam (NL)<br />

M. De Santis, Vienna (AT)<br />

S.G.G. De Wachter, Antwerp (BE)<br />

A. Descazeaud, Limoges (FR)<br />

F. Desgrandchamps, Paris (FR)<br />

T. Diemer, Giessen (DE)<br />

J. Dobruch, Warsaw (PL)<br />

B. Dore, Poitiers (FR)<br />

T.A. Drewa, Bydgoszcz (PL)<br />

B.A. Dybowski, Warsaw (PL)<br />

L. Dyrskjøt, Århus (DK)<br />

C.L. Eaton, Sheffield (GB)<br />

A.W. El-Kassaby, Cairo (EG)<br />

T. Esen, Istanbul (TR)<br />

K. Everaert, Ghent (BE)<br />

R. Favaretto, Sao Paulo (BR)<br />

A. Feyaerts, Brussels (BE)<br />

A.J. Figueiredo, Coimbra (PT)<br />

M.M. Fisch, Hamburg (DE)<br />

M. Fröhner, Dresden (DE)<br />

F. Fusco, Naples (IT)<br />

S. Füssel, Dresden (DE)<br />

A. Galan, Alicante (ES)<br />

A. Galfano, Milan (IT)<br />

A. Gallina, Monza (IT)<br />

R. Ganzer, Regensburg (DE)<br />

E. García-Cruz, Barcelona (ES)<br />

P.A. Geavlete, Bucharest (RO)<br />

G. Giannarini, Berne (CH)<br />

M. Giessing, Düsseldorf (DE)<br />

V. Gomez Dos Santos, Madrid (ES)<br />

F. Gómez Veiga, A Coruna (ES)<br />

P. Gontero, Turin (IT)<br />

A. Govorov, Moscow (RU)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

9<br />

Reviewers


Reviewers<br />

Acknowledgement of Abstract reviewers<br />

M. Graefen, Hamburg (DE)<br />

C. Gratzke, Munich (DE)<br />

F. Greco, Leipzig (DE)<br />

I. Gruenwald, Haifa (IL)<br />

O.W. Hakenberg, Rostock (DE)<br />

T. Hanus, Prague (CZ)<br />

H. Hashim, Bristol (GB)<br />

K. Hatzimouratidis, Pefka (GR)<br />

S.A. Haukaas, Bergen (NO)<br />

A. Heidenreich, Aachen (DE)<br />

T.R.W. Herrmann, Hanover (DE)<br />

P. Hoffmann, Brussels (BE)<br />

M. Hohenfellner, Heidelberg (DE)<br />

S. Holmäng, Gothenburg (SE)<br />

W. Horninger, Innsbruck (AT)<br />

A. Hoznek, Creteil (FR)<br />

J. Huguet Pérez, Barcelona (ES)<br />

C. Imbimbo, Naples (IT)<br />

D. Jacqmin, Strasbourg (FR)<br />

G. Jenster, Rotterdam (NL)<br />

S.G. Joniau, Leuven (BE)<br />

V. Joulin, Brest (FR)<br />

K. Junker, Jena (DE)<br />

T.M. Kessler, Zurich (CH)<br />

M. Khodari, Nanterre (FR)<br />

E. Kiely, Cork (IE)<br />

T. Klatte, Vienna (AT)<br />

M. Knowles, Leeds (GB)<br />

E. Kocjancic, Chicago (US)<br />

Z. Kopa, Budapest (HU)<br />

G. Kramer, Vienna (AT)<br />

M.P. Laguna, Amsterdam (NL)<br />

S. Larré, Reims (FR)<br />

T.A. Leslie, Oxford (GB)<br />

H.Y. Leung, Glasgow (GB)<br />

H. Leyh, Garmisch-Partenkirchen (DE)<br />

E. Liatsikos, Patras (GR)<br />

J.E. Lingeman, Indianapolis (US)<br />

B. Ljungberg, Umeå (SE)<br />

E. Lledo García, Madrid (ES)<br />

C. Llorente, Madrid (ES)<br />

T. Loch, Flensburg (DE)<br />

N. Longo, Naples (IT)<br />

J.J. Lopez-Tello Garcia, Madrid (ES)<br />

Y. Lotan, Dallas (US)<br />

N. Lumen, Ghent (BE)<br />

S. Madersbacher, Vienna (AT)<br />

N. Malats, Madrid (ES)<br />

P-U. Malmström, Uppsala (SE)<br />

M. Margreiter, Vienna (AT)<br />

J.I. Martínez Salamanca, Madrid (ES)<br />

M.P. Matikainen, Helsinki (FI)<br />

10 <strong>Programme</strong> <strong>Book</strong><br />

J. Mattelaer, Kortrijk (BE)<br />

M. Matuszewski, Gdansk (PL)<br />

M. May, Regensburg (DE)<br />

S. McClinton, Aberdeen (GB)<br />

R. Medina López, Seville (ES)<br />

A.S. Merseburger, Hanover (DE)<br />

R. Miano, Rome (IT)<br />

S. Micic, Belgrade (RS)<br />

G. Mickisch, Bremen (DE)<br />

K. Miller, Berlin (DE)<br />

A. Minervini, Florence (IT)<br />

K. Monastyrskaya, Berne (CH)<br />

N. Mondaini, Florence (IT)<br />

N. Mottet, Saint Etienne (FR)<br />

A. Mottrie, Aalst (BE)<br />

A. Muneer, London (GB)<br />

M. Muntener, Zurich (CH)<br />

F.J. Murat, Lyon (FR)<br />

V.W. Nitti, New York (US)<br />

G. Novara, Padua (IT)<br />

P.J. Nyirády, Budapest (HU)<br />

S. Oehlschläger, Dresden (DE)<br />

M. Oelke, Hanover (DE)<br />

S. Oudard, Paris (FR)<br />

D. Oxley, Bristol (GB)<br />

P. Palma, Campinas (BR)<br />

J.I. Pascual Piedrola, Pamplona (ES)<br />

A. Patel, London (GB)<br />

H. Payne, London (GB)<br />

S. Perner, Bonn (DE)<br />

D. Pushkar, Moscow (RU)<br />

R. Rabenalt, Düsseldorf (DE)<br />

M. Ramirez Backhaus, Valencia (ES)<br />

J. Ramon, Tel Aviv (IL)<br />

J. Rassweiler, Heilbronn (DE)<br />

P. Rehder, Innsbruck (AT)<br />

I. Rehman, Sheffield (GB)<br />

Y. Reisman, Amstelveen (NL)<br />

M. Remzi, Vienna (AT)<br />

D. Rengifo Abbad, Madrid (ES)<br />

C.A. Rentsch, Basel (CH)<br />

M.J. Ribal, Barcelona (ES)<br />

J.P. Rioja Zuazu, Zaragoza (ES)<br />

P. Rocchi, Vancouver (CA)<br />

B. Rocco, Milan (IT)<br />

E.A. Rodrigues De Lima, Porto (PT)<br />

O. Rodriguez Faba, Barcelona (ES)<br />

I. Romics, Budapest (HU)<br />

M.J. Roobol, Rotterdam (NL)<br />

A. Rosales, Barcelona (ES)<br />

M. Roscigno, Bergamo (IT)<br />

M. Rouprêt, Paris (FR)


J. Rubio Briones, Valencia (ES)<br />

A. Ruffion, Pierre-Bénite (FR)<br />

R.E. Sanchez Salas, Paris (FR)<br />

M. Sanchez-Carbayo, Madrid (ES)<br />

F.R. Santer, Innsbruck (AT)<br />

T. Schlomm, Hamburg (DE)<br />

H-P. Schmid, St. Gallen (CH)<br />

J. Schmidbauer, Vienna (AT)<br />

A. Schröder, Toronto (CA)<br />

C. Schwentner, Tübingen (DE)<br />

F.P. Secin, Buenos Aires (AR)<br />

J. Seibold, Tübingen (DE)<br />

E. Serafetinides, Athens (GR)<br />

K-D. Sievert, Tübingen (DE)<br />

D.J. Smith, Sheffield (GB)<br />

E. Solsona, Valencia (ES)<br />

R. Sosnowski, Warsaw (PL)<br />

M. Spahn, Berne (CH)<br />

R.S. Stefanescu, Paris (FR)<br />

M. Stöckle, Homburg (DE)<br />

W.L. Strohmaier, Coburg (DE)<br />

M.E. Sullivan, Oxford (GB)<br />

T. Sulser, Zurich (CH)<br />

D.J. Summerton, Leicester (GB)<br />

A. Tasca, Vicenza (IT)<br />

P. Tenke, Budapest (HU)<br />

H.G. Tiselius, Stockholm (SE)<br />

A. Tubaro, Rome (IT)<br />

L.N. Türkeri, Istanbul (TR)<br />

D. Ulmert, New York (US)<br />

B. Uvelius, Malmö (SE)<br />

G. Van Koeveringe, Maastricht (NL)<br />

E. Van Laecke, Ghent (BE)<br />

G.J.L.H. Van Leenders, Rotterdam (NL)<br />

K.M.L. Van Renterghem, Hasselt (BE)<br />

B. Van Rhijn, Amsterdam (NL)<br />

M. Vandenbossche, Brussels (BE)<br />

F. Villacampa Auba, Madrid (ES)<br />

A. Villers, Lille (FR)<br />

A. Volpe, Turin (IT)<br />

A. Vuksanovic, Belgrade (RS)<br />

F.M.E. Wagenlehner, Giessen (DE)<br />

A. Wagg, Edmonton (CA)<br />

J. Walz, Marseille (FR)<br />

R.W.G. Watson, Dublin (IE)<br />

E. Wespes, Charleroi (BE)<br />

P. Whelan, Leeds (GB)<br />

T. Wiegel, Ulm (DE)<br />

D.N. Wood, London (GB)<br />

B. Wullt, Lund (SE)<br />

J.J. Wyndaele, Antwerp (BE)<br />

O. Yossepowitch, Petach Tikva (IL)<br />

S. Zastrow, Dresden (DE)<br />

P.C. Zehnder, Berne (CH)<br />

P. Zimmern, Dallas (US)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

11<br />

Reviewers


Floorplan<br />

South Levels<br />

Amber Hall 3-4<br />

Tower Room<br />

Amber Hall 1-2<br />

<strong>EAU</strong> Award<br />

Gallery<br />

First Aid<br />

Education & Innovation<br />

Booth<br />

Internet Corner 2<br />

Exhibition<br />

Hall<br />

12 <strong>Programme</strong> <strong>Book</strong><br />

eURO Auditorium<br />

ATM<br />

<strong>EAU</strong> Booth<br />

Prayer Room<br />

Brown<br />

Hall 3<br />

Brown<br />

Hall 1-2<br />

SANOFI-HS3<br />

Amber Hall 7-8<br />

Amber Hall 6<br />

TAKEDA-HS2<br />

AMS-HS1<br />

Amber<br />

Hall 5<br />

Duomo<br />

Rooms 13-15<br />

<strong>EAU</strong> Video Library<br />

ASTELLAS<br />

Gold View Lounge<br />

European Urology Booth<br />

Internet Corner 1<br />

Platinum Hall<br />

COOK MEDICAL<br />

Panorama Lounge<br />

S3<br />

S2<br />

Elevator to<br />

S2 ASTELLAS Gold View Lounge<br />

S3 COOK MEDICAL Panorama Lounge<br />

Connection<br />

Level S0 - N1<br />

S1<br />

S0<br />

Connection<br />

Level S2 - N2<br />

Connection<br />

Level S0 - N0


Connection<br />

Level S0 - N1<br />

Connection<br />

Level S0 - N0<br />

Connection<br />

Level S2 - N2<br />

<strong>EAU</strong> Press Centre<br />

Silver Hall<br />

Press Conference Room<br />

Regional Meetings: Best Posters Area Yellow Hall 1-2-3<br />

Blue Hall 1-2<br />

Red Hall 2<br />

Red Hall 1<br />

Duomo<br />

Room 1<br />

Duomo<br />

Room 2 Meeting Corner<br />

Speaker Service Centre<br />

Best Posters<br />

Upcoming Meetings Area<br />

Sponsored Sessions Promotion Area<br />

Turquoise<br />

Hall 2<br />

Registration<br />

Turquoise<br />

Hall 1<br />

Presentation<br />

Training<br />

Duomo<br />

Room 11<br />

Centre<br />

Orange<br />

Hall 1<br />

Duomo<br />

Room 4 Duomo<br />

Room 5<br />

Duomo<br />

Rooms 7-10<br />

Duomo<br />

Room 12<br />

Green<br />

Hall 1<br />

Orange<br />

Hall 2<br />

Duomo<br />

Room 6<br />

Orange<br />

Hall 3<br />

Charge and Connect Area<br />

ATM<br />

Bank and Exchange<br />

<strong>EAU</strong> Information Desk<br />

Green<br />

Hall 2<br />

Green<br />

Hall 3<br />

Duomo<br />

Room 3<br />

MAIN ENTRANCE<br />

Taxi rank & shuttle<br />

busses to metro<br />

Company busses<br />

& Car Park<br />

ESU Booth<br />

North Levels<br />

N2<br />

N1<br />

N0<br />

N1<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

13<br />

Floorplan


All sessions showing the webcast symbol<br />

will be available online.<br />

Register now at www.eaumilan<strong>2013</strong>.org


<strong>Programme</strong> Friday, 15 March<br />

eURO Auditorium Brown Hall 1-2 Brown Hall 3 Amber Hall 1-2 Amber Hall 7-8 Red Hall 1 Red Hall 2 Blue Hall 1-2 Yellow Hall 1-2-3<br />

9.00 09.00-16.15<br />

Special Session<br />

9.30<br />

10.00<br />

10.30 10.30-13.00<br />

Urology beyond<br />

Europe<br />

11.00<br />

11.30<br />

12.00<br />

12.30<br />

13.00<br />

Joint Session of the<br />

European Association<br />

of Urology (<strong>EAU</strong>) and<br />

the Chinese Urological<br />

Association (CUA)<br />

page 56<br />

13.15 13.15-15.45<br />

Urology beyond<br />

Europe<br />

13.30<br />

14.00<br />

14.30<br />

15.00<br />

15.30<br />

15.45<br />

16.00<br />

Joint Session of the<br />

European Association<br />

of Urology (<strong>EAU</strong>)<br />

and the Japanese<br />

Urological Association<br />

(JUA)<br />

page 65<br />

10.30-13.00<br />

Urology beyond<br />

Europe<br />

Joint Session of the<br />

European Association<br />

of Urology (<strong>EAU</strong>) and<br />

the Korean Urological<br />

Association (KUA)<br />

page 57<br />

13.15-15.45<br />

Urology beyond<br />

Europe<br />

Joint Session of the<br />

European Association<br />

of Urology (<strong>EAU</strong>) and<br />

the Confederación<br />

Americana de<br />

Urología (CAU)<br />

page 67<br />

16.15 16.15-17.45<br />

Symposium<br />

16.30<br />

17.00<br />

17.30<br />

17.45<br />

18.00 18.00-21.00<br />

21.00<br />

<strong>EAU</strong> Opening<br />

Ceremony<br />

page 72<br />

Metastatic castrationresistant<br />

prostate<br />

cancer: Integrating<br />

new learnings to<br />

optimise treatment<br />

outcomes<br />

SANOFI<br />

page 401<br />

10.30-13.00<br />

Urology beyond<br />

Europe<br />

Joint Session of the<br />

European Association<br />

of Urology (<strong>EAU</strong>) and<br />

the Urological Society<br />

of India (USI)<br />

page 59<br />

13.15-15.45<br />

Urology beyond<br />

Europe<br />

<strong>EAU</strong> - International:<br />

Caucasus and Central<br />

Asia Session<br />

page 68<br />

16.15-17.45<br />

Symposium<br />

Urological challenges<br />

in managing patients<br />

with angiomyolipoma<br />

(AML)<br />

NOVARTIS ONCOLOGY<br />

page 399<br />

International<br />

Conference on<br />

Prostate Cancer<br />

Prevention <strong>2013</strong> with<br />

Consensus Conference<br />

on Chemoprevention<br />

of Prostate Cancer<br />

page 53<br />

10.30-13.00<br />

Urology beyond<br />

Europe<br />

Joint Session of the<br />

European Association<br />

of Urology (<strong>EAU</strong>) and<br />

the Iranian Urological<br />

Association (IUA)<br />

page 61<br />

13.15-15.45<br />

Urology beyond<br />

Europe<br />

Joint Session of the<br />

European Association<br />

of Urology (<strong>EAU</strong>)<br />

and the Pan-African<br />

Urological Surgeons’<br />

Association (PAUSA)<br />

page 69<br />

16.15-17.45<br />

Symposium<br />

Extending survival<br />

outcomes in RCC<br />

and CRPC: Current<br />

evidence and future<br />

horizons<br />

BAYER HEALTHCARE<br />

page 397<br />

13.15-15.45<br />

Urology beyond<br />

Europe<br />

Joint Session of the<br />

European Association<br />

of Urology (<strong>EAU</strong>) and<br />

the Maghreb Union<br />

Countries<br />

page 70<br />

16.15-17.45<br />

Symposium<br />

Innovations in clinical<br />

urology<br />

OLYMPUS<br />

page 400<br />

10.30-13.00<br />

Urology beyond<br />

Europe<br />

Joint Session of the<br />

European Association<br />

of Urology (<strong>EAU</strong>) and<br />

the Arab Association<br />

of Urology (AAU)<br />

page 63<br />

13.15-15.45<br />

Urology beyond<br />

Europe<br />

Joint Session of the<br />

European Association<br />

of Urology (<strong>EAU</strong>)<br />

and the Indonesian<br />

Urological Association<br />

(IUAI)<br />

page 71<br />

16.15-17.45<br />

Symposium<br />

New data in<br />

metastatic RCC:<br />

Applying the evidence<br />

to clinical practice<br />

GLAXOSMITHKLINE<br />

ONCOLOGY<br />

page 398<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

15<br />

Synopsis


Synopsis<br />

<strong>Programme</strong> Saturday, 16 March, Morning<br />

eURO Auditorium Platinum Hall Brown Hall 1-2 Brown Hall 3 Amber Hall 1-2 Amber Hall 7-8 Silver Hall Red Hall 1 Red Hall 2<br />

7.30 07.30-08.30<br />

8.00<br />

8.30 08.30-10.15<br />

Plenary Session 1<br />

9.00<br />

9.30<br />

Urology: From young<br />

to old<br />

08.30-08.35<br />

Introduction<br />

08.35-08.50<br />

Update<br />

The management<br />

and long-term<br />

outcomes of<br />

vesicoureteral reflux<br />

08.50-09.05<br />

Update<br />

The long-term<br />

outcomes of genital<br />

surgery in boys<br />

09.05-09.40<br />

Debate<br />

Pelvic floor implants:<br />

Artificial mesh or<br />

autologous fascia?<br />

09.40-09.55<br />

State-of-the-art<br />

lecture<br />

Incontinence and age<br />

page 96<br />

<strong>EAU</strong> General<br />

Assembly<br />

page 75<br />

16 <strong>Programme</strong> <strong>Book</strong><br />

08.30-10.00<br />

Poster Session 1<br />

Prostate cancer<br />

screening<br />

1-12<br />

page 99<br />

08.30-10.00<br />

Poster Session 2<br />

Laparoscopy:<br />

Training, new<br />

technologies and<br />

techniques<br />

13-26<br />

page 102<br />

08.30-10.00<br />

Poster Session 3<br />

Male infertility: Basic<br />

science<br />

27-37<br />

08.30-10.00<br />

Poster Session 4<br />

History of urology 1<br />

38-49<br />

08.30-10.00<br />

Poster Session 5<br />

Urothelial cancer:<br />

Tumour biology<br />

and experimental<br />

therapies<br />

50-61<br />

08.30-10.00<br />

Poster Session 6<br />

Neuro-urology: Basic<br />

research<br />

09.55-10.15<br />

State-of-the-art<br />

page 78<br />

page 80<br />

page 82<br />

page 84<br />

page 85<br />

page 87<br />

10.00 lecture<br />

Is ageing a disease?<br />

10.00-16.30<br />

Residents Day -<br />

organised by the<br />

Young Urologists<br />

Office (YUO) in<br />

page 76<br />

collaboration with<br />

the European Society<br />

10.15 10.15-17.15<br />

Meeting of the <strong>EAU</strong><br />

10.15-14.00<br />

Meeting of the <strong>EAU</strong><br />

10.15-14.00<br />

Meeting of the<br />

10.15-14.00<br />

Joint Meeting of<br />

10.15-14.00<br />

Meeting of the<br />

of Residents in<br />

Urology (ESRU)<br />

Section of Uro-<br />

Section of Female <strong>EAU</strong> Section of<br />

the the European <strong>EAU</strong> Section of<br />

Technology (ESUT)<br />

and Functional Urolithiasis (EULIS)<br />

Organisation for Transplantation<br />

in cooperation with<br />

Urology (ESFFU) and<br />

Research and Urology (ESTU)<br />

10.30<br />

ERUS and EULIS<br />

the <strong>EAU</strong> Section of<br />

Urological Imaging<br />

Urolithiasis - on our<br />

way to personalised<br />

Treatment of Cancer<br />

Genito-Urinary Improving<br />

What is new in<br />

(ESUI)<br />

management<br />

Cancer Group (EORTC outcomes in kidney<br />

endourology,<br />

GUCG), the <strong>EAU</strong> transplantation<br />

laparoscopy and<br />

Imaging in female<br />

Section of Urological<br />

10.45<br />

robotics<br />

and functional<br />

urology<br />

Research (ESUR),<br />

the <strong>EAU</strong> Section<br />

COOK, INTUITIVE<br />

of Oncological<br />

SURGICAL, IPSEN,<br />

Urology (ESOU) and<br />

KARL STORZ GMBH<br />

the <strong>EAU</strong> Section<br />

& CO.KG, NEOTRACT,<br />

of Uropathology<br />

11.00 OLYMPUS, QUANTA<br />

SYSTEM, ROCAMED<br />

(ESUP)<br />

11.30<br />

12.00<br />

page 108<br />

62-73<br />

page 104<br />

page 93


Blue Hall 1-2 Yellow Hall 1-2-3 Green Hall 1 Green Hall 2 Green Hall 3 Orange Hall 1 Orange Hall 2 Orange Hall 3 Turquoise 2 Amber Hall 5<br />

08.30-10.00<br />

Poster Session 7<br />

Non-surgical<br />

treatment<br />

of advanced<br />

urothelial cancer<br />

74-85<br />

page 89<br />

10.15-14.00<br />

Meeting of the<br />

<strong>EAU</strong> Section of<br />

Genito-Urinary<br />

Reconstructive<br />

Surgeons<br />

(ESGURS)<br />

Urethral<br />

reconstruction<br />

and complication<br />

management<br />

after radical<br />

prostatectomy<br />

page 110<br />

08.30-10.00<br />

Poster Session 8<br />

Nephron sparing<br />

surgery and risk<br />

scoring systems<br />

86-96<br />

page 91<br />

10.15-14.00<br />

Meeting of the<br />

<strong>EAU</strong> Section of<br />

Infections in<br />

Urology (ESIU) and<br />

the <strong>EAU</strong> Section<br />

of Andrological<br />

Urology (ESAU)<br />

Urogenital<br />

infections and<br />

andrology<br />

page 106<br />

09.00-10.30<br />

HOT<br />

ESU/ESUT Handson<br />

training in<br />

Green light laser<br />

vaporisation;<br />

Technique and<br />

standard cases -<br />

Basic course 1<br />

AMERICAN<br />

MEDICAL SYSTEMS<br />

page 373<br />

10.45-12.15<br />

HOT<br />

ESU/ESUT Handson<br />

training in<br />

Green light laser<br />

vaporisation;<br />

Technique and<br />

standard cases -<br />

Basic course 2<br />

AMERICAN<br />

MEDICAL SYSTEMS<br />

page 374<br />

09.00-10.30<br />

HOT<br />

ESU/ESUT<br />

Hands-on training<br />

Endourology<br />

course 1<br />

OLYMPUS EUROPA<br />

HOLDING GMBH<br />

page 377<br />

11.00-12.30<br />

HOT<br />

ESU/ESUT<br />

Hands-on training<br />

Endourology<br />

course 2<br />

OLYMPUS EUROPA<br />

HOLDING GMBH<br />

page 378<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

7.30<br />

8.00<br />

8.30<br />

9.00<br />

9.30<br />

10.00<br />

10.15<br />

10.30<br />

10.45<br />

11.00<br />

11.30<br />

12.00<br />

17<br />

Synopsis


Synopsis<br />

<strong>Programme</strong> Saturday, 16 March, Afternoon<br />

eURO Auditorium Platinum Hall Brown Hall 1-2 Brown Hall 3 Amber Hall 1-2 Amber Hall 7-8 Silver Hall Red Hall 1 Red Hall 2 Blue Hall 1-2<br />

12.00 10.15-17.15<br />

Meeting of the<br />

<strong>EAU</strong> Section of<br />

Uro-Technology<br />

(ESUT) in<br />

cooperation with<br />

ERUS and EULIS<br />

12.15<br />

12.30<br />

13.00<br />

13.30<br />

14.00<br />

What is new in<br />

endourology,<br />

laparoscopy and<br />

robotics<br />

COOK, INTUITIVE<br />

SURGICAL, IPSEN,<br />

KARL STORZ<br />

GMBH & CO.KG,<br />

NEOTRACT,<br />

OLYMPUS,<br />

QUANTA SYSTEM,<br />

ROCAMED<br />

14.15 14.15-15.45<br />

Video Session 1<br />

14.30<br />

15.00<br />

15.30<br />

15.45<br />

page 96<br />

LESS & NOTES<br />

V1-V9<br />

page 113<br />

16.00 16.00-17.30<br />

Video Session 2<br />

16.30<br />

17.00<br />

17.15<br />

17.30<br />

17.45<br />

18.00 18.00-19.30<br />

Symposium<br />

19.30<br />

Navigating the<br />

new landscape<br />

in CRPC<br />

ASTELLAS<br />

page 402<br />

Improving<br />

minimally<br />

invasive radical<br />

prostatectomy<br />

V10-V17<br />

page 127<br />

18.00-19.30<br />

Symposium<br />

Risk stratification<br />

to optimize the<br />

management<br />

of men with<br />

symptomatic<br />

BPH at risk of<br />

progression<br />

GLAXOSMITHKLINE<br />

page 404<br />

18 <strong>Programme</strong> <strong>Book</strong><br />

10.15-14.00<br />

Meeting of the<br />

<strong>EAU</strong> Section<br />

of Female and<br />

Functional Urology<br />

(ESFFU) and the<br />

<strong>EAU</strong> Section of<br />

Urological Imaging<br />

(ESUI)<br />

Imaging in female<br />

and functional<br />

urology<br />

page 99<br />

14.15-15.45<br />

Poster Session 9<br />

New therapies in<br />

castration resistant<br />

prostate cancer<br />

97-108<br />

page 114<br />

16.00-17.30<br />

Poster Session 16<br />

Radical treatment<br />

of prostate<br />

cancer, beyond<br />

prostatectomy<br />

180-192<br />

page 128<br />

18.00-19.30<br />

Symposium<br />

LUTS/BPH and<br />

sexual health -<br />

Bridging the gap<br />

ELI LILLY AND<br />

COMPANY<br />

page 403<br />

10.15-14.00<br />

Meeting of the<br />

<strong>EAU</strong> Section<br />

of Urolithiasis<br />

(EULIS)<br />

Urolithiasis - on<br />

our way to<br />

personalised<br />

management<br />

page 102<br />

18.00-19.30<br />

Symposium<br />

Transurethral<br />

resection of<br />

bladder tumor:<br />

How to reach<br />

excellence<br />

IPSEN<br />

page 406<br />

14.15-15.45<br />

Poster Session 10<br />

Pelvic organ<br />

prolapse: From<br />

bench to bedside<br />

109-119<br />

page 116<br />

16.00-17.30<br />

Poster Session 17<br />

Renal tumours:<br />

Basic research<br />

in prognostic<br />

markers<br />

193-204<br />

page 130<br />

18.00-19.30<br />

Symposium<br />

Increasing<br />

evidence of<br />

effectiveness of<br />

GAG therapy in<br />

different forms of<br />

cystitis<br />

IBSA INSTITUT<br />

BIOCHIMIQUE<br />

page 405<br />

14.15-15.45<br />

Poster Session 11<br />

Men’s sexual<br />

health<br />

120-132<br />

page 117<br />

16.00-17.30<br />

Poster Session 18<br />

Men’s sexual<br />

health:<br />

Testosterone<br />

and premature<br />

ejaculation<br />

205-216<br />

page 132<br />

10.15-14.00<br />

Joint Meeting of<br />

the the European<br />

Organisation<br />

for Research<br />

and Treatment<br />

of Cancer<br />

Genito-Urinary<br />

Cancer Group<br />

(EORTC GUCG),<br />

the <strong>EAU</strong> Section<br />

of Urological<br />

Research (ESUR),<br />

the <strong>EAU</strong> Section<br />

of Oncological<br />

Urology (ESOU)<br />

and the <strong>EAU</strong><br />

Section of<br />

Uropathology<br />

(ESUP)<br />

page 108<br />

14.15-15.45<br />

Poster Session 12<br />

Diagnostics in<br />

early prostate<br />

cancer<br />

133-143<br />

page 119<br />

16.00-17.30<br />

Poster Session 19<br />

Improving<br />

diagnosis in<br />

prostate cancer<br />

217-228<br />

page 134<br />

10.15-14.00<br />

Meeting of the<br />

<strong>EAU</strong> Section of<br />

Transplantation<br />

Urology (ESTU)<br />

Improving<br />

outcomes<br />

in kidney<br />

transplantation<br />

page 104<br />

14.15-15.45<br />

Poster Session 13<br />

Bladder cancer:<br />

Gene expression<br />

and molecular<br />

classification<br />

144-157<br />

page 121<br />

16.00-17.30<br />

Poster Session 20<br />

Bladder cancer<br />

demographics and<br />

biomarkers<br />

229-242<br />

page 136<br />

10.00-16.30<br />

Residents Day -<br />

organised by the<br />

Young Urologists<br />

Office (YUO) in<br />

collaboration with<br />

the European<br />

Society of<br />

Residents in<br />

Urology (ESRU)<br />

page 93<br />

10.15-14.00<br />

Meeting of the<br />

<strong>EAU</strong> Section of<br />

Genito-Urinary<br />

Reconstructive<br />

Surgeons<br />

(ESGURS)<br />

Urethral<br />

reconstruction<br />

and complication<br />

management<br />

after radical<br />

prostatectomy<br />

page 110<br />

14.15-15.45<br />

Poster Session 14<br />

Urological<br />

infection<br />

innovations<br />

158-169<br />

page 123<br />

16.00-17.30<br />

Poster Session 21<br />

Cell based therapy<br />

in pelvic floor<br />

dysfunction<br />

243-253<br />

page 138


Yellow Hall 1-2-3 Green Hall 1 Green Hall 2 Green Hall 3 Orange Hall 1 Orange Hall 2 Orange Hall 3 Turquoise 2 Amber Hall 5 Amber Hall 6<br />

10.15-14.00<br />

Meeting of the<br />

<strong>EAU</strong> Section of<br />

Infections in<br />

Urology (ESIU) and<br />

the <strong>EAU</strong> Section<br />

of Andrological<br />

Urology (ESAU)<br />

Urogenital<br />

infections and<br />

andrology<br />

page 106<br />

14.15-15.45<br />

Poster Session 15<br />

Partial<br />

nephrectomy<br />

and surveillance:<br />

Surveys and<br />

comparisons<br />

170-179<br />

page 125<br />

16.00-17.30<br />

Poster Session 22<br />

Robot-assisted<br />

partial<br />

nephrectomy<br />

254-264<br />

page 140<br />

18.00-19.30<br />

Symposium<br />

Premature<br />

ejaculation<br />

treatment: New<br />

perspectives for<br />

the couple<br />

MENARINI<br />

page 408<br />

13.00-14.00<br />

Urology in<br />

Italian art<br />

page 112<br />

14.30-17.30<br />

ESU Course 1<br />

Prostate cancer<br />

– Screening,<br />

diagnosis and<br />

staging<br />

page 321<br />

14.30-17.30<br />

ESU Course 2<br />

Advanced<br />

management of<br />

urethral stricture<br />

surgery<br />

page 322<br />

14.30-17.30<br />

ESU Course 3<br />

Metastatic prostate<br />

cancer<br />

page 323<br />

14.30-17.30<br />

ESU Course 4<br />

Retropubic radical<br />

prostatectomy –<br />

Tips, tricks and<br />

pitfalls<br />

page 324<br />

14.30-17.30<br />

ESU Course 5<br />

Office<br />

management<br />

of male sexual<br />

dysfunction<br />

page 325<br />

14.30-17.30<br />

ESU Course 6<br />

Prolapse<br />

management and<br />

female pelvic floor<br />

problems<br />

page 326<br />

10.45-12.15<br />

HOT<br />

ESU/ESUT Handson<br />

training in<br />

Green light laser<br />

vaporisation;<br />

Technique and<br />

standard cases -<br />

Basic course 2<br />

AMERICAN<br />

MEDICAL SYSTEMS<br />

page 374<br />

12.30-14.00<br />

HOT<br />

ESU/ESUT Handson<br />

training in<br />

Green light laser<br />

vaporisation;<br />

Technique and<br />

standard cases -<br />

Basic course 3<br />

AMERICAN<br />

MEDICAL SYSTEMS<br />

page 375<br />

14.15-15.45<br />

HOT<br />

ESU/ESUT Handson<br />

training in<br />

Green light laser<br />

vaporisation;<br />

Technique and<br />

standard cases -<br />

Basic course 4<br />

AMERICAN<br />

MEDICAL SYSTEMS<br />

page 376<br />

11.00-12.30<br />

HOT<br />

ESU/ESUT<br />

Hands-on training<br />

Endourology<br />

course 2<br />

OLYMPUS EUROPA<br />

HOLDING GMBH<br />

page 378<br />

18.00-19.30<br />

Workshop<br />

Holmium Life<br />

Enhancing Plan<br />

(HoLEP) - The<br />

real BPH lifetime<br />

solution<br />

LUMENIS<br />

page 407<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

12.00<br />

12.15<br />

12.30<br />

13.00<br />

13.30<br />

14.00<br />

14.15<br />

14.30<br />

15.00<br />

15.30<br />

15.45<br />

16.00<br />

16.30<br />

17.00<br />

17.15<br />

17.30<br />

17.45<br />

18.00<br />

19.30<br />

19<br />

Synopsis


Synopsis<br />

<strong>Programme</strong> Sunday, 17 March, Morning<br />

eURO Auditorium Platinum Hall Brown Hall 1-2 Brown Hall 3 Amber Hall 1-2 Amber Hall 6 Amber Hall 7-8 Silver Hall Red Hall 1 Red Hall 2<br />

7.30 07.30-11.00<br />

Plenary Session 2<br />

8.00<br />

8.30<br />

Upper urinary<br />

tract<br />

07.30-08.00<br />

Highlight session 1<br />

08.00-08.05<br />

Introduction<br />

08.05-08.25<br />

Update<br />

The dilemmas in<br />

diagnosing upper<br />

tract urothelial<br />

cancer<br />

08:25-09.05<br />

Debate<br />

How much surgery<br />

for upper tract<br />

urothelial cancer?<br />

9.00<br />

09.05-09.35<br />

<strong>EAU</strong> Guidelines<br />

Office case<br />

discussion<br />

Upper urinary tract<br />

9.15<br />

tumours<br />

09.15-10.45<br />

9.30<br />

10.00<br />

10.30<br />

10.45<br />

09.35-09.55<br />

Société<br />

Internationale<br />

d’Urologie (SIU)<br />

lecture<br />

The role of ESWL<br />

in upper urinary<br />

tract stones<br />

09.55-10.10<br />

Update<br />

Interventional<br />

imaging in upper<br />

urinary tract stone<br />

disease: What’s<br />

new?<br />

10.10-10.50<br />

Case discussion<br />

From above or<br />

below: Flexible,<br />

rigid or percutaneous<br />

management<br />

of upper urinary<br />

tract stones<br />

10.50-11.00<br />

Update<br />

Observation<br />

and deferred<br />

intervention in the<br />

management of<br />

stones<br />

page 143<br />

11.00 11.00-12.00<br />

Thematic Session 6<br />

11.30<br />

12.00<br />

Small renal<br />

masses: To treat or<br />

not to treat?<br />

page 168<br />

Video Session 3<br />

Robot-assisted<br />

kidney surgery<br />

V18-V25<br />

page 146<br />

11.00-13.00<br />

European Urology<br />

Session<br />

Surgery in Motion<br />

page 172<br />

20 <strong>Programme</strong> <strong>Book</strong><br />

09.15-10.45<br />

Poster Session 23<br />

Prostate cancer:<br />

Active surveillance<br />

265-275<br />

page 147<br />

11.00-12.00<br />

Thematic Session 1<br />

<strong>EAU</strong> Guidelines<br />

Office:<br />

Recommendation<br />

updates <strong>2013</strong><br />

page 161<br />

09.15-10.45<br />

Poster Session 24<br />

Bladder cancer:<br />

Pathology<br />

276-287<br />

page 149<br />

11.00-12.00<br />

Thematic Session 7<br />

Management<br />

of surgical<br />

complications<br />

page 170<br />

09.15-10.45<br />

Poster Session 25<br />

Prostate cancer:<br />

Surgery outcomes<br />

288-299<br />

page 151<br />

11.00-12.00<br />

Thematic Session 4<br />

Non-muscle<br />

invasive bladder<br />

cancer<br />

page 165<br />

09.15-10.45<br />

Poster Session 26<br />

Treatment of<br />

neurogenic LUTD<br />

300-310<br />

page 153<br />

11.00-12.00<br />

Thematic Session 8<br />

Paediatric urology<br />

page 171<br />

09.15-10.45<br />

Poster Session 27<br />

Stones: Basic<br />

research, imaging<br />

and training<br />

models<br />

311-323<br />

page 155<br />

11.00-12.00<br />

Thematic Session 5<br />

Joint session with<br />

the European<br />

Society of Nuclear<br />

Medicine:<br />

Diagnostics and<br />

therapy of bone<br />

metastases in<br />

patients with<br />

advanced prostate<br />

cancer<br />

page 167


Blue Hall 1-2 Yellow Hall 1-2-3 Green Hall 1 Green Hall 2 Green Hall 3 Orange Hall 1 Orange Hall 2 Orange Hall 3 Turquoise 1 Turquoise 2 Amber Hall 5<br />

09.15-10.45<br />

Poster<br />

Session 28<br />

Preclinical<br />

innovation - the<br />

future of erectile<br />

dysfunction<br />

treatment?<br />

324-335<br />

page 157<br />

11.00-12.00<br />

Thematic<br />

Session 3<br />

From bench to<br />

bedside: What<br />

will be replacing<br />

PSA?<br />

page 164<br />

09.15-10.45<br />

Poster<br />

Session 29<br />

Renal tumour<br />

diagnosis: From<br />

new techniques<br />

to follow-up<br />

336-349<br />

page 159<br />

11.00-12.00<br />

Thematic<br />

Session 2<br />

What are the<br />

limitations<br />

of minimally<br />

invasive surgery?<br />

page 163<br />

08.30-11.30<br />

ESU Course 7<br />

Management<br />

of small renal<br />

tumours<br />

page 327<br />

08.30-10.30<br />

ESU Course 8<br />

Renal<br />

transplantation:<br />

Technical<br />

aspects,<br />

diagnosis and<br />

management<br />

of early and<br />

late urological<br />

complications<br />

page 328<br />

08.30-11.30<br />

ESU Course 9<br />

Advanced course<br />

on upper tract<br />

laparoscopy<br />

(UPJ, adrenal<br />

and stones)<br />

page 329<br />

08.30-11.30<br />

ESU Course 10<br />

Advanced course<br />

on laparoscopic<br />

nephrectomy<br />

page 331<br />

08.30-11.30<br />

ESU Course 11<br />

Painful bladder<br />

/ chronic pelvic<br />

pain; In men and<br />

women<br />

page 333<br />

08.30-11.30<br />

ESU Course 12<br />

Lower<br />

urinary tract<br />

dysfunction and<br />

urodynamics<br />

page 334<br />

09.00-11.00<br />

HOT<br />

ESU/ESUT<br />

Hands-on<br />

training<br />

Laparoscopy<br />

course 1<br />

KARL STORZ<br />

GMBH & CO.KG<br />

and COOK<br />

MEDICAL<br />

page 379<br />

11.30-13.30<br />

HOT<br />

ESU/ESUT<br />

Hands-on<br />

training<br />

Laparoscopy<br />

course 2<br />

KARL STORZ<br />

GMBH & CO.KG<br />

and COOK<br />

MEDICAL<br />

page 380<br />

09.00-10.30<br />

HOT<br />

ESU/ERUS<br />

Hands-on<br />

training on<br />

Robotic surgery<br />

course 1<br />

INTUITIVE<br />

SURGICAL<br />

page 383<br />

11.00-12.30<br />

HOT<br />

ESU/ERUS<br />

Hands-on<br />

training on<br />

Robotic surgery<br />

course 2<br />

INTUITIVE<br />

SURGICAL<br />

page 384<br />

09.00-10.30<br />

HOT<br />

ESU/ESUT<br />

Hands-on<br />

training<br />

Laparoscopy<br />

course 1<br />

OLYMPUS<br />

EUROPA<br />

HOLDING GMBH<br />

page 381<br />

11.00-12.30<br />

HOT<br />

ESU/ESUT<br />

Hands-on<br />

training<br />

Laparoscopy<br />

course 2<br />

OLYMPUS<br />

EUROPA<br />

HOLDING GMBH<br />

page 382<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

7.30<br />

8.00<br />

8.30<br />

9.00<br />

9.15<br />

9.30<br />

10.00<br />

10.30<br />

10.45<br />

11.00<br />

11.30<br />

12.00<br />

21<br />

Synopsis


Synopsis<br />

<strong>Programme</strong> Sunday, 17 March, Afternoon<br />

eURO Auditorium Platinum Hall Brown Hall 1-2 Brown Hall 3 Amber Hall 1-2 Amber Hall 6 Amber Hall 7-8 Silver Hall Red Hall 1 Red Hall 2<br />

12.00 11.00-13.00<br />

European Urology<br />

Session<br />

12.15 12.15-13.45<br />

Video Session 4<br />

12.30<br />

13.00<br />

Challenging<br />

robotic surgery<br />

V26-V32<br />

Surgery in Motion<br />

page 172<br />

13.15 13.15-15.15<br />

Special Session<br />

13.30<br />

13.45<br />

page 174<br />

14.00 14.00-15.30<br />

Video Session 5<br />

14.15<br />

14.30<br />

15.00<br />

15.15<br />

15.30<br />

21st century stone<br />

management<br />

V33-V40<br />

page 193<br />

15.45 15.45-17.15<br />

Video Session 6<br />

16.00<br />

16.30<br />

17.00<br />

17.15<br />

17.30<br />

Laparoscopic renal<br />

surgery<br />

V41-V48<br />

page 212<br />

17.45 17.45-19.15<br />

Symposium<br />

19.15<br />

Management of<br />

OAB: Electing the<br />

right candidate for<br />

the right patient<br />

ASTELLAS<br />

page 410<br />

3D Video and live<br />

narration - da<br />

Vinci partial<br />

nephrectomy<br />

with Firefly<br />

fluorescence<br />

imaging<br />

INTUITIVE<br />

SURGICAL<br />

page 173<br />

22 <strong>Programme</strong> <strong>Book</strong><br />

12.15-13.45<br />

Poster Session 30<br />

New methods<br />

in imaging and<br />

targeting prostate<br />

cancer<br />

350-361<br />

page 175<br />

14.00-15.30<br />

Poster Session 39<br />

How to optimise<br />

staging in prostate<br />

cancer?<br />

465-476<br />

page 194<br />

15.45-17.15<br />

Poster Session 48<br />

Focal therapy in<br />

prostate cancer<br />

treatment<br />

578-589<br />

page 213<br />

17.45-19.15<br />

Symposium<br />

Silodosin: A first<br />

choice for the<br />

pharmacological<br />

treatment of BPH<br />

RECORDATI<br />

page 416<br />

12.15-13.45<br />

Poster Session 31<br />

Making the<br />

diagnosis of<br />

bladder cancer<br />

362-373<br />

page 177<br />

14.00-15.30<br />

Poster Session 40<br />

Bladder cancer:<br />

Imaging and<br />

resection<br />

477-488<br />

page 196<br />

15.45-17.15<br />

Poster Session 49<br />

Diagnostic imaging<br />

for bladder cancer<br />

590-601<br />

page 215<br />

17.45-19.15<br />

Symposium<br />

Towards<br />

individualisation<br />

of prostate cancer<br />

treatments: From<br />

bench to bedside<br />

IPSEN<br />

page 412<br />

12.15-13.45<br />

Poster Session 32<br />

Kidney<br />

transplantation:<br />

Technique and<br />

outcome<br />

374-386<br />

page 179<br />

14.00-15.30<br />

Poster Session 41<br />

Living donor<br />

nephrectomy and<br />

tumours on kidney<br />

transplanted<br />

patients<br />

489-501<br />

page 198<br />

15.45-17.15<br />

Poster Session 50<br />

Research in kidney<br />

transplant<br />

602-613<br />

page 217<br />

17.45-19.15<br />

Symposium<br />

Burden of illness<br />

and optimal<br />

management of<br />

recurrent cystitis<br />

OM PHARMA SA<br />

page 414<br />

12.00-15.00<br />

HOT<br />

ESU Hands-on<br />

training course on<br />

Urodynamics<br />

MEDIWATCH<br />

page 385<br />

17.45-19.15<br />

Workshop<br />

Urinary<br />

incontinence -<br />

Optimising the<br />

patient experience<br />

and improving<br />

outcomes<br />

ALLERGAN<br />

and PORGÈS,<br />

a COLOPLAST<br />

division<br />

page 409<br />

12.15-13.45<br />

Poster Session 33<br />

Advances in the<br />

treatment of penile<br />

cancer<br />

387-400<br />

page 181<br />

14.00-15.30<br />

Poster Session 42<br />

News in prostate<br />

and bladder<br />

infections<br />

502-513<br />

page 200<br />

15.45-17.15<br />

Poster Session 51<br />

Urological<br />

infections<br />

614-625<br />

page 219<br />

17.45-19.15<br />

Symposium<br />

Focal therapy in<br />

localised prostate<br />

cancer<br />

STEBA BIOTECH<br />

page 417<br />

12.15-13.45<br />

Poster Session 34<br />

Nocturia, OAB,<br />

metabolic<br />

syndrome -<br />

towards a new<br />

management<br />

401-412<br />

page 183<br />

14.00-15.30<br />

Poster Session 43<br />

TURP and beyond<br />

514-525<br />

page 202<br />

15.45-17.15<br />

Poster Session 52<br />

New and old<br />

minimally invasive<br />

BPH therapies<br />

626-638<br />

page 221<br />

17.45-19.15<br />

Symposium<br />

Clinical<br />

conundrums in<br />

the treatment<br />

of metastatic<br />

castration-resistant<br />

prostate cancer<br />

JANSSEN<br />

PHARMACEUTICAL<br />

COMPANIES<br />

OF JOHNSON &<br />

JOHNSON<br />

page 413<br />

12.15-13.45<br />

Poster Session 35<br />

Paediatric<br />

hypospadias<br />

repair<br />

413-425<br />

page 185<br />

14.00-15.30<br />

Poster Session 44<br />

Paediatric urology:<br />

What’s new?<br />

526-537<br />

page 204<br />

15.45-17.15<br />

Poster Session 53<br />

Paediatric urology<br />

developments<br />

639-650<br />

page 223<br />

17.45-19.15<br />

Symposium<br />

BPH and<br />

inflammation,<br />

from lab to clinic<br />

PIERRE FABRE<br />

MEDICAMENT<br />

page 415<br />

12.15-13.45<br />

Poster Session 36<br />

Stones: URS and<br />

imaging<br />

426-439<br />

page 187<br />

14.00-15.30<br />

Poster Session 45<br />

Stones: ESWL and<br />

PCNL<br />

538-551<br />

page 206<br />

15.45-17.15<br />

Poster Session 54<br />

Stones: ESWL,<br />

epidemiology and<br />

training<br />

651-662<br />

page 225


Blue Hall 1-2 Yellow Hall 1-2-3 Green Hall 1 Green Hall 2 Green Hall 3 Orange Hall 1 Orange Hall 2 Orange Hall 3 Turquoise 1 Turquoise 2 Amber Hall 5<br />

12.15-13.45<br />

Poster<br />

Session 37<br />

Exploring<br />

pharmacological<br />

targets in OAB<br />

440-451<br />

page 189<br />

14.00-15.30<br />

Poster<br />

Session 46<br />

Uro-genital<br />

reconstruction<br />

and trauma<br />

552-565<br />

page 208<br />

15.45-17.15<br />

Poster<br />

Session 55<br />

From bench to<br />

bedside in pain<br />

and OAB<br />

663-673<br />

page 227<br />

12.15-13.45<br />

Poster<br />

Session 38<br />

Surgery for RCC<br />

and the adrenal<br />

gland<br />

452-464<br />

page 191<br />

14.00-15.30<br />

Poster<br />

Session 47<br />

Urothelial<br />

cancer:<br />

Transurethral<br />

surgery and<br />

intravesical<br />

recurrence<br />

566-577<br />

page 210<br />

15.45-17.15<br />

Poster<br />

Session 56<br />

Androgen<br />

deprivation<br />

therapy, still to<br />

improve...<br />

674-684<br />

page 229<br />

17.45-19.15<br />

Symposium<br />

Nocturia: Definitive<br />

diagnosis for<br />

better patient<br />

outcomes<br />

FERRING PHAR-<br />

MACEUTICALS<br />

page 411<br />

12.00-14.00<br />

ESU Course 13<br />

Pathology<br />

(prostate,<br />

bladder/UUT,<br />

kidney, testicles/<br />

penis)<br />

page 335<br />

14.30-17.30<br />

ESU Course 19<br />

Robot renal<br />

surgery<br />

page 342<br />

12.00-14.00<br />

ESU Course 14<br />

Surgical<br />

management of<br />

locally advanced<br />

and metastatic<br />

renal cancer<br />

page 337<br />

14.30-17.30<br />

ESU Course 20<br />

How to write a<br />

manuscript and<br />

get it published<br />

in European<br />

Urology<br />

page 343<br />

12.00-14.00<br />

ESU Course 15<br />

Laparoscopy for<br />

beginners<br />

page 338<br />

14.30-17.30<br />

ESU Course 21<br />

Advanced<br />

vaginal<br />

reconstruction<br />

page 345<br />

12.00-14.00<br />

ESU Course 16<br />

Testicular cancer<br />

page 339<br />

14.30-17.30<br />

ESU Course 22<br />

Radical<br />

cystectomy<br />

and orthotopic<br />

bladder<br />

substitution<br />

– Surgical<br />

tricks and<br />

management of<br />

complications<br />

page 347<br />

12.00-14.00<br />

ESU Course 17<br />

Management<br />

and outcome<br />

in invasive and<br />

locally advanced<br />

bladder cancer<br />

page 340<br />

14.30-17.30<br />

ESU Course 23<br />

Surgery or<br />

radiotherapy for<br />

localised and<br />

locally advanced<br />

prostate cancer<br />

page 348<br />

14.30-17.30<br />

ESU Course 24<br />

Flexible ureterorenoscopy<br />

and<br />

retrograde intrarenal<br />

surgery:<br />

Instrumentation,<br />

technique,<br />

tips and tricks,<br />

indications<br />

page 350<br />

11.30-13.30<br />

HOT<br />

ESU/ESUT<br />

Hands-on<br />

training<br />

Laparoscopy<br />

course 2<br />

KARL STORZ<br />

GMBH & CO.KG<br />

and COOK<br />

MEDICAL<br />

page 380<br />

14.00-15.30<br />

HOT<br />

ESU/ESUT/<br />

EULIS Hands-on<br />

training Ureterorenoscopy<br />

course 1<br />

KARL STORZ<br />

GMBH & CO.KG<br />

and COOK<br />

MEDICAL<br />

page 386<br />

11.00-12.30<br />

HOT<br />

ESU/ERUS<br />

Hands-on<br />

training on<br />

Robotic surgery<br />

course 2<br />

INTUITIVE<br />

SURGICAL<br />

page 384<br />

11.00-12.30<br />

HOT<br />

ESU/ESUT<br />

Hands-on<br />

training<br />

Laparoscopy<br />

course 2<br />

OLYMPUS<br />

EUROPA<br />

HOLDING GMBH<br />

page 382<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

12.00<br />

12.15<br />

12.30<br />

13.00<br />

13.15<br />

13.30<br />

13.45<br />

14.00<br />

14.15<br />

14.30<br />

15.00<br />

15.15<br />

15.30<br />

15.45<br />

16.00<br />

16.30<br />

17.00<br />

17.15<br />

17.30<br />

17.45<br />

19.15<br />

23<br />

Synopsis


Synopsis<br />

<strong>Programme</strong> Monday, 18 March, Morning<br />

eURO Auditorium Platinum Hall Brown Hall 1-2 Brown Hall 3 Amber Hall 1-2 Amber Hall 6 Amber Hall 7-8 Silver Hall Red Hall 1 Red Hall 2<br />

7.30 07.30-11.00<br />

Plenary Session 3<br />

8.00<br />

8.30<br />

Lower urinary<br />

tract management:<br />

How to balance<br />

benefits with<br />

side-effects<br />

07.30-08.00<br />

Highlight Session 2<br />

08.00-08.05<br />

Introduction<br />

08.05-08.25<br />

Update<br />

Pelvic floor<br />

anatomy for<br />

urologists<br />

08.25-09.05<br />

Debate<br />

The role of urodynamic<br />

assessment<br />

in contemporary<br />

practice<br />

9.00<br />

09.05-09.25<br />

American<br />

Urological<br />

Association (AUA)<br />

Lecture<br />

Cellular-based<br />

9.15 therapy of urinary<br />

09.15-10.45<br />

incontinence<br />

Poster Session 57<br />

9.30<br />

09.25-10.05<br />

Case discussion<br />

Sling, sphincter<br />

or balloon for<br />

male urinary<br />

incontinence<br />

10.00 10.00-12.00<br />

10.30<br />

10.45<br />

10.05-10.45<br />

Debate<br />

What the practising<br />

urologist needs<br />

to know about<br />

new therapies<br />

for LUTS. When,<br />

where and how do<br />

they work?<br />

10.45-11.00<br />

State-of-the-art<br />

lecture<br />

Is TURP the gold<br />

standard for<br />

benign prostatic<br />

obstruction?<br />

page 233<br />

11.00 11.00-12.00<br />

Thematic<br />

Session 10<br />

11.30<br />

12.00<br />

Andrology<br />

page 256<br />

da Vinci Robotic<br />

Surgery<br />

Live surgery:<br />

da Vinci<br />

prostatectomy -<br />

The Martini Klinik<br />

Technique<br />

INTUITIVE<br />

SURGICAL<br />

page 254<br />

24 <strong>Programme</strong> <strong>Book</strong><br />

Management of<br />

high risk prostate<br />

cancer<br />

685-696<br />

page 237<br />

11.00-12.00<br />

Thematic<br />

Session 15<br />

Management of<br />

pain in urology<br />

page 262<br />

07.30-09.00<br />

Video Session 7<br />

Miscellaneous<br />

V49-V56<br />

page 236<br />

09.15-10.45<br />

Poster Session 58<br />

Urothelial cancer<br />

treatment:<br />

Intravesical<br />

approaches<br />

697-708<br />

page 239<br />

09.15-10.45<br />

Poster Session 59<br />

Prostate cancer<br />

biopsies and<br />

pathology<br />

709-721<br />

page 241<br />

11.00-12.00<br />

Thematic<br />

Session 16<br />

Urological surgery<br />

in renal transplant<br />

patients<br />

page 263<br />

09.15-10.45<br />

Poster Session 60<br />

Update on SUI<br />

722-735<br />

page 243<br />

09.15-10.45<br />

Poster Session 61<br />

Current and new<br />

treatments of OAB<br />

and LUTS<br />

736-747<br />

page 245<br />

11.00-12.00<br />

Thematic<br />

Session 11<br />

Systemic therapy<br />

in urological<br />

cancers<br />

page 258<br />

09.15-10.45<br />

Poster Session 62<br />

Urothelial cancer<br />

treatment:<br />

Predicting<br />

outcomes<br />

748-760<br />

page 247<br />

11.00-12.00<br />

Thematic<br />

Session 12<br />

A session by the<br />

European Society<br />

of Urogenital<br />

Radiology<br />

page 259<br />

09.15-10.45<br />

Poster Session 63<br />

Renal tumours:<br />

Basic research on<br />

pathogenesis<br />

761-774<br />

page 249<br />

11.00-12.00<br />

Thematic<br />

Session 13<br />

Prevention<br />

and treatment<br />

of urological<br />

infections<br />

page 260


Blue Hall 1-2 Yellow Hall 1-2-3 Green Hall 1 Green Hall 2 Green Hall 3 Orange Hall 1 Orange Hall 2 Orange Hall 3 Turquoise 1 Turquoise 2 Amber Hall 5<br />

09.15-10.45<br />

Poster<br />

Session 64<br />

OAB in women<br />

775-786<br />

page 251<br />

11.00-12.00<br />

Thematic<br />

Session 14<br />

Neurourology<br />

page 261<br />

09.15-10.45<br />

Poster<br />

Session 65<br />

Urethral stricture<br />

management<br />

787-798<br />

page 253<br />

11.00-12.00<br />

Thematic<br />

Session 9<br />

Expert<br />

challenges the<br />

expert<br />

page 255<br />

08.30-11.30<br />

ESU Course 25<br />

The infertile<br />

couple -<br />

Urological<br />

aspects<br />

page 352<br />

08.30-11.30<br />

ESU Course 26<br />

Update on stone<br />

disease<br />

page 353<br />

08.30-11.30<br />

ESU Course 27<br />

Diagnosis and<br />

management<br />

of non-muscle<br />

invasive bladder<br />

cancer (NMIBC)<br />

page 354<br />

08.30-11.30<br />

ESU Course 28<br />

Robot-assisted<br />

laparoscopic<br />

prostatectomy<br />

page 356<br />

08.30-11.30<br />

ESU Course 29<br />

Minimally<br />

invasive<br />

treatment<br />

for localized<br />

prostate cancer<br />

page 358<br />

08.30-11.30<br />

ESU Course 30<br />

Paediatric<br />

urology for the<br />

adult urologist:<br />

A practical<br />

update<br />

page 360<br />

09.00-10.30<br />

HOT<br />

ESU/ESUT/<br />

EULIS Hands-on<br />

training Ureterorenoscopy<br />

course 2<br />

KARL STORZ<br />

GMBH & CO.KG<br />

and COOK<br />

MEDICAL<br />

page 387<br />

11.00-12.30<br />

HOT<br />

ESU/ESUT<br />

Hands-on training<br />

Transurethral<br />

therapy of LUTS<br />

- Bipolar TURP<br />

course 1<br />

KARL STORZ GMBH<br />

& CO.KG and COOK<br />

MEDICAL<br />

page 392<br />

09.00-10.30<br />

HOT<br />

ESU/ERUS<br />

Hands-on<br />

training on<br />

Robotic surgery<br />

course 3<br />

INTUITIVE<br />

SURGICAL<br />

page 394<br />

11.00-12.30<br />

HOT<br />

ESU/ERUS Handson<br />

training on<br />

Robotic surgery<br />

course 4<br />

INTUITIVE<br />

SURGICAL<br />

page 395<br />

09.00-10.30<br />

HOT<br />

ESU/ESUT<br />

Hands-on<br />

training in<br />

Green light laser<br />

vaporisation;<br />

Technique and<br />

large adenoma<br />

- Advance<br />

course 1<br />

AMERICAN<br />

MEDICAL<br />

SYSTEMS<br />

page 388<br />

11.00-12.30<br />

HOT<br />

ESU/ESUT<br />

Hands-on training<br />

in Green light<br />

laser vaporisation;<br />

Technique and<br />

large adenoma -<br />

Advance course 2<br />

AMERICAN<br />

MEDICAL SYSTEMS<br />

page 389<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

7.30<br />

8.00<br />

8.30<br />

9.00<br />

9.15<br />

9.30<br />

10.00<br />

10.30<br />

10.45<br />

11.00<br />

11.30<br />

12.00<br />

25<br />

Synopsis


Synopsis<br />

<strong>Programme</strong> Monday, 18 March, Afternoon<br />

12.00<br />

eURO Auditorium Platinum Hall Brown Hall 1-2 Brown Hall 3 Amber Hall 1-2 Amber Hall 6 Amber Hall 7-8 Silver Hall Red Hall 1 Red Hall 2<br />

12.15 12.15-13.45<br />

Video Session 8<br />

12.30<br />

13.00<br />

13.15<br />

13.30<br />

13.45<br />

Developments in<br />

cancer diagnosis<br />

and management<br />

V57-V64<br />

page 264<br />

14.00 14.00-15.30<br />

Video Session 9<br />

14.30<br />

15.00<br />

15.30<br />

Challenging<br />

reconstructive<br />

surgery<br />

V65-V72<br />

page 282<br />

15.45 15.45-17.15<br />

Video Session 10<br />

Highlights &<br />

awards<br />

16.00<br />

16.30<br />

17.00<br />

17.15<br />

17.30<br />

V73-V79<br />

page 300<br />

14.00-16.00<br />

da Vinci Robotic<br />

Surgery<br />

Live surgery:<br />

da Vinci<br />

prostatectomy<br />

- Early<br />

neurovascular<br />

bundles release<br />

INTUITIVE<br />

SURGICAL<br />

page 254<br />

26 <strong>Programme</strong> <strong>Book</strong><br />

12.15-13.45<br />

Poster Session 66<br />

Radical<br />

prostatectomy:<br />

New techniques<br />

799-810<br />

page 265<br />

14.00-15.30<br />

Poster Session 75<br />

Surgical<br />

approaches for<br />

prostate cancer<br />

911-922<br />

page 283<br />

15.45-17.15<br />

Poster Session 83<br />

Prostate cancer<br />

treatment:<br />

Comorbidities and<br />

complications<br />

1011-1024<br />

page 301<br />

12.15-13.45<br />

Poster Session 67<br />

Advanced<br />

urothelial cancer:<br />

Disease outcomes<br />

811-822<br />

page 267<br />

14.00-15.30<br />

Poster Session 76<br />

Radical surgery for<br />

bladder cancer:<br />

Patient outcomes<br />

923-934<br />

page 285<br />

15.45-17.15<br />

Poster Session 84<br />

Radical surgery for<br />

bladder cancer:<br />

Technical aspects<br />

1025-1038<br />

page 303<br />

12.15-13.45<br />

Poster Session 68<br />

Evidence-based<br />

prostate cancer<br />

therapies in<br />

cellular and<br />

animal models<br />

823-835<br />

page 269<br />

14.00-15.30<br />

Poster Session 77<br />

Prostate cancer<br />

cell biology and<br />

signaling<br />

935-947<br />

page 287<br />

15.45-17.15<br />

Poster Session 85<br />

Prostate cancer<br />

biomarkers<br />

and outcome<br />

prediction<br />

1039-1050<br />

page 305<br />

17.45 17.45-19.15<br />

Workshop<br />

19.15<br />

Urinary<br />

incontinence -<br />

Optimising the<br />

patient experience<br />

and improving<br />

outcomes<br />

ALLERGAN<br />

and PORGÈS,<br />

a COLOPLAST<br />

division<br />

page 418<br />

12.15-13.45<br />

Poster Session 69<br />

Male infertility:<br />

Clinical issues<br />

836-847<br />

page 271<br />

14.00-17.00<br />

European<br />

Urological<br />

Scholarship<br />

<strong>Programme</strong> (EUSP)<br />

Session<br />

page 299<br />

12.15-13.45<br />

Poster Session 70<br />

Prostate cancer:<br />

Biomarkers<br />

848-861<br />

page 272<br />

14.00-15.30<br />

Poster Session 78<br />

Nephrectomy for<br />

RCC: Minimally<br />

invasive<br />

techniques, renal<br />

function, lymph<br />

node dissection<br />

and prognostic<br />

factors<br />

948-960<br />

page 289<br />

15.45-17.15<br />

Poster Session 86<br />

Evolving concepts<br />

in testicular<br />

cancer<br />

1051-1060<br />

page 307<br />

17.45-19.15<br />

Symposium<br />

Interactive debate:<br />

How seriously<br />

should I take male<br />

LUTS?<br />

ASTELLAS<br />

page 419<br />

12.15-13.45<br />

Poster Session 71<br />

Complex urological<br />

reconstructions<br />

and tissue<br />

engineering<br />

862-874<br />

page 274<br />

14.00-15.30<br />

Poster Session 79<br />

Stones: PCNL<br />

961-974<br />

page 291<br />

15.45-17.15<br />

Poster Session 87<br />

Stones: URS and<br />

stents<br />

1061-1072<br />

page 309<br />

12.15-13.45<br />

Poster Session 72<br />

How to reduce<br />

warm ischemia<br />

in partial<br />

nephrectomy<br />

875-887<br />

page 276<br />

14.00-15.30<br />

Poster Session 80<br />

Renal tumours:<br />

Drug related basic<br />

research<br />

975-986<br />

page 293<br />

15.45-17.15<br />

Poster Session 88<br />

History of<br />

urology 2<br />

1073-1084<br />

page 311<br />

17.45-19.15<br />

Symposium<br />

Castrationresistant<br />

prostate<br />

cancer in <strong>2013</strong>:<br />

Analysing the<br />

good, the bad and<br />

the ugly<br />

PRIME ONCOLOGY<br />

page 421


Blue Hall 1-2 Yellow Hall 1-2-3 Green Hall 1 Green Hall 2 Green Hall 3 Orange Hall 1 Orange Hall 2 Orange Hall 3 Turquoise 1 Turquoise 2 Amber Hall 5<br />

12.15-13.45<br />

Poster<br />

Session 73<br />

What is new in<br />

female urology<br />

888-898<br />

page 278<br />

14.00-15.30<br />

Poster<br />

Session 81<br />

How to diagnose<br />

LUTS, BPH and<br />

obstruction?<br />

987-998<br />

page 295<br />

15.45-17.15<br />

Poster Session<br />

89<br />

Pharmacotherapy<br />

of male LUTS<br />

1085-1096<br />

page 312<br />

12.15-13.45<br />

Poster<br />

Session 74<br />

BPH: Genes,<br />

biomarkers and<br />

beyond<br />

899-910<br />

page 280<br />

14.00-15.30<br />

Poster<br />

Session 82<br />

Male<br />

incontinence:<br />

Prediction and<br />

management<br />

999-1010<br />

page 297<br />

15.45-17.15<br />

Poster<br />

Session 90<br />

Medical<br />

treatment<br />

of RCC<br />

1097-1108<br />

page 314<br />

17.45-19.15<br />

Symposium<br />

New data on<br />

androgen<br />

deprivation with<br />

a GnRH antagonist:<br />

Improving<br />

patient outcomes<br />

in prostate<br />

cancer<br />

FERRING PHAR-<br />

MACEUTICALS<br />

page 420<br />

12.00-14.00<br />

ESU Course 31<br />

Current concepts<br />

and controversy<br />

in the<br />

diagnosis and<br />

management<br />

of upper tract<br />

urothelial<br />

carcinoma<br />

(UTUC)<br />

page 361<br />

14.30-16.30<br />

ESU Course 37<br />

Post-surgical<br />

urinary<br />

incontinence in<br />

males<br />

page 369<br />

12.00-14.00<br />

ESU Course 32<br />

Advanced course<br />

on laparoscopic<br />

prostatectomy<br />

page 363<br />

14.30-16.30<br />

ESU Course 38<br />

General neurourology<br />

page 370<br />

12.00-15.00<br />

ESU Course 33<br />

Modern<br />

management<br />

of BPH<br />

page 365<br />

12.00-14.00<br />

ESU Course 34<br />

Urinary tract and<br />

genital trauma<br />

page 366<br />

14.30-17.30<br />

ESU Course 39<br />

Percutaneous<br />

nephrolithotripsy<br />

(PCNL)<br />

page 371<br />

12.00-14.00<br />

ESU Course 35<br />

Ultrasound for<br />

the urologist -<br />

TRUS and TRUS<br />

guided biopsies<br />

page 367<br />

14.30-17.30<br />

ESU Course 40<br />

Single port<br />

– NOTES and<br />

minilaparoscopy:<br />

Is this the way<br />

to go?<br />

page 372<br />

12.00-15.00<br />

ESU Course 36<br />

Laparoscopic<br />

and robotassisted<br />

laparoscopic<br />

radical<br />

cystectomy<br />

page 368<br />

11.00-12.30<br />

HOT<br />

ESU/ESUT<br />

Hands-on<br />

training<br />

Transurethral<br />

therapy of LUTS<br />

- Bipolar TURP<br />

course 1<br />

KARL STORZ<br />

GMBH & CO.KG<br />

and COOK<br />

MEDICAL<br />

page 392<br />

13.00-14.30<br />

HOT<br />

ESU/ESUT<br />

Hands-on<br />

training<br />

Transurethral<br />

therapy of LUTS<br />

- Bipolar TURP<br />

course 2<br />

KARL STORZ<br />

GMBH & CO.KG<br />

and COOK<br />

MEDICAL<br />

page 393<br />

11.00-12.30<br />

HOT<br />

ESU/ERUS<br />

Hands-on<br />

training on<br />

Robotic surgery<br />

course 4<br />

INTUITIVE<br />

SURGICAL<br />

page 395<br />

11.00-12.30<br />

HOT<br />

ESU/ESUT<br />

Hands-on training<br />

in Green light<br />

laser vaporisation;<br />

Technique and<br />

large adenoma -<br />

Advance course 2<br />

AMERICAN<br />

MEDICAL SYSTEMS<br />

page 389<br />

13.00-14.30<br />

HOT<br />

ESU/ESUT<br />

Hands-on training<br />

in Green light<br />

laser vaporisation;<br />

Technique and<br />

large adenoma -<br />

Advance course 3<br />

AMERICAN<br />

MEDICAL SYSTEMS<br />

page 390<br />

13.00-14.30<br />

HOT<br />

ESU/ESUT<br />

Hands-on training<br />

in Green light<br />

laser vaporisation;<br />

Technique and<br />

large adenoma -<br />

Advance course 4<br />

AMERICAN<br />

MEDICAL SYSTEMS<br />

page 391<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

12.00<br />

12.15<br />

12.30<br />

13.00<br />

13.15<br />

13.30<br />

13.45<br />

14.00<br />

14.30<br />

15.00<br />

15.30<br />

15.45<br />

16.00<br />

16.30<br />

17.00<br />

17.15<br />

17.30<br />

17.45<br />

19.15<br />

27<br />

Synopsis


Synopsis<br />

<strong>Programme</strong> Tuesday, 19 March<br />

28 <strong>Programme</strong> <strong>Book</strong><br />

eURO Auditorium<br />

08.00 08.00-13.10<br />

Plenary Session 4<br />

13.10<br />

Souvenir sessions/Hot topics in prostate cancer<br />

08.00-09.30<br />

Souvenir session by the <strong>EAU</strong> Scientific Congress Office<br />

09.30-09.40<br />

<strong>EAU</strong> policy on live surgery<br />

09.40-09.45<br />

Introduction to the plenary session<br />

09.45-10.00<br />

Update<br />

New urological weapons in the treatment of CRPC<br />

10.00-10.20<br />

Late breaking news I<br />

10.20-10.40<br />

State-of-the-art lecture<br />

Is there a role for intermittent androgen deprivation?<br />

10.40-11.20<br />

Debate<br />

High risk PC: Surgery vs radiation vs systemic therapy<br />

11.20-11.35<br />

Late breaking news II<br />

11.35-12.15<br />

Debate<br />

Why focal therapy instead of active surveillance for low risk prostate cancer<br />

12.15-12.35<br />

Report on the Consensus Statement for Prostate Cancer Prevention<br />

12.35-13.05<br />

Update<br />

European PSA screening<br />

13.05-13.10<br />

Closing remarks<br />

page 317


<strong>EAU</strong>N <strong>Programme</strong> Overview, 16-18 March <strong>2013</strong><br />

16 March<br />

Saturday<br />

17 March<br />

Sunday<br />

18 March<br />

Monday<br />

Room Amber Hall 3-4 - Level S2 Tower Room - Level S2 Amber Hall 3-4 - Level S2 Tower Room - Level S2 Amber Hall 3-4 - Level S2 Tower Room - Level S2<br />

08.00<br />

08.15<br />

08.30<br />

08.45<br />

09.00<br />

09.15<br />

09.30<br />

09.45<br />

10.00<br />

10.15<br />

10.30<br />

10.45<br />

11.00<br />

11.15<br />

11.30<br />

11.45<br />

12.00<br />

12.15<br />

12.30<br />

12.45<br />

13.00<br />

13.15<br />

13.30<br />

13.45<br />

14.00<br />

14.15<br />

14.30<br />

14.45<br />

15.00<br />

15.15<br />

15.30<br />

15.45<br />

16.00<br />

16.15<br />

16.30<br />

16.45<br />

17.00<br />

17.15<br />

17.30<br />

17.45<br />

18.00<br />

18.15<br />

18.30<br />

18.45<br />

19.00<br />

20.30<br />

24.00<br />

<strong>EAU</strong>N Workshop<br />

Writing evidence-based<br />

guidelines<br />

Break<br />

<strong>EAU</strong>N Workshop<br />

Bladder instillation for<br />

interstitial cystitis and<br />

radiation cystitis<br />

Break<br />

<strong>EAU</strong>-ESU Course - 1<br />

Prostate diseases and<br />

treatments<br />

Part I<br />

Break<br />

<strong>EAU</strong>-ESU Course - 1<br />

Prostate diseases and<br />

treatments<br />

Part II<br />

<strong>EAU</strong>N Opening<br />

<strong>EAU</strong>N Workshop<br />

Intermittent catheterisation<br />

and dilatation<br />

Break<br />

AIURO Lecture<br />

Urological nursing in Italy: The<br />

national association, clinical<br />

research and education in the<br />

European context<br />

<strong>EAU</strong>N Lecture<br />

Who takes care of the<br />

caretakers<br />

<strong>EAU</strong>N Workshop<br />

Nursing solutions in difficult<br />

cases & Case discussions<br />

<strong>EAU</strong>N Workshop<br />

Market place session:<br />

Embarrassing issues in<br />

urology. Everything you always<br />

wanted to know, but were<br />

afraid to ask<br />

Break<br />

Panel discussion<br />

Bladder cancer<br />

Debate<br />

Prostate cancer screening<br />

<strong>EAU</strong>N Workshop<br />

Alternative approaches for the<br />

improvement of daily life in<br />

urological patients<br />

Break<br />

<strong>EAU</strong>N Session<br />

<strong>EAU</strong>N Nursing Research<br />

Competition<br />

<strong>EAU</strong>N State-of-the-art lecture<br />

The gender aspect<br />

<strong>EAU</strong>N Lecture<br />

ESU-<strong>EAU</strong>N Cystoscopy<br />

Workshop<br />

ESU Course - 2<br />

Bladder diseases and<br />

treatments<br />

Part I<br />

Break<br />

ESU Course - 2<br />

Bladder diseases and<br />

treatments<br />

Part II<br />

Break<br />

<strong>EAU</strong>N State-of-the-art lecture<br />

Palliative care in urology<br />

<strong>EAU</strong>N State-of-the-art lecture<br />

Transition from paediatric to<br />

adult urology<br />

<strong>EAU</strong>N General Assembly<br />

The online diary as a<br />

Break communication tool for<br />

patients and nurses<br />

Break<br />

Poster viewing<br />

Poster Abstract Session 1<br />

<strong>EAU</strong>N State-of-the-art lecture<br />

Health economics<br />

Break<br />

Symposium<br />

CIC experience- making<br />

dreams a reality<br />

WELLSPECT HEALTHCARE<br />

Welcome reception<br />

Sponsored by WELLSPECT<br />

HEALTHCARE<br />

Location: In front of Amber<br />

Hall 7-8<br />

Break<br />

<strong>EAU</strong>N State-of-the-art lecture<br />

Nutritional aspects of preoperative<br />

interventions<br />

Break<br />

<strong>EAU</strong>N State-of-the-art lecture<br />

Penile carcinoma<br />

<strong>EAU</strong>N State-of-the-art lecture<br />

Brachytherapy in<br />

urological cancer<br />

<strong>EAU</strong>N State-of-the-art lecture<br />

Urological disorders that<br />

challenge the surgeon<br />

Break<br />

Break Break Award Session<br />

Panel discussion<br />

Bladder dysfunction:<br />

Overactive bladder syndrome,<br />

nocturia and pelvic<br />

floor issues<br />

<strong>EAU</strong>N State-of-the-art lecture<br />

Complimentary medicine<br />

in oncology<br />

Break<br />

<strong>EAU</strong>N Round table discussion<br />

Meeting the challenges of<br />

cancer related bone health<br />

Supported with an educational<br />

grant by AMGEN<br />

Urowalk<br />

18.30 - 20.30<br />

Nurses’ dinner<br />

20.30 - 24.00<br />

Poster viewing<br />

Poster Abstract Session 2<br />

Break<br />

Workshop<br />

Safety in urinary<br />

catheterization<br />

B. BRAUN<br />

<strong>EAU</strong>N Session<br />

Inside the body - surgery in<br />

motion (videos)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

29<br />

Synopsis


Exhibition<br />

30 <strong>Programme</strong> <strong>Book</strong><br />

ENTRANCE/EXIT<br />

EXHIBITION<br />

NORTH LEVELS<br />

EXHIBITION HAL<br />

CIG<br />

SMU<br />

OCEANA<br />

ISTEM<br />

MEDIKAL<br />

A<br />

CUA<br />

CANADA<br />

TO OTHER<br />

LEVELS<br />

INTERNET<br />

CORNER 1<br />

GALIL MEDICAL<br />

CUA<br />

CHINA<br />

MEDICA<br />

MENARINI<br />

TERUMO<br />

WFIP<br />

MEDKONSULT<br />

OPKO<br />

EUROPA<br />

UOMO<br />

PHYSION ESSM<br />

RUDOLF<br />

MEDICAL<br />

HEALUX NEXUS<br />

EXHIBITION HALL - SOUTH LEVEL S0<br />

CIG<br />

SMU<br />

OCEANA<br />

ISTEM<br />

MEDIKAL<br />

A<br />

INTERNET<br />

CORNER 1<br />

GALIL MEDICAL MEDKONSULT<br />

MEDICA<br />

EUROPA<br />

WFIP<br />

UOMO<br />

MENARINI<br />

CUA CUA<br />

CANADA CHINA<br />

TERUMO AUA<br />

THERA-<br />

COAT<br />

MEDAC<br />

ASCLEPION MCUBE SIU<br />

ERBE<br />

ELEKTROMEDIZIN AYMED<br />

HOLOGIC<br />

GEN-PROBE<br />

BECKMAN<br />

COULTER<br />

KLS MARTIN GROUP<br />

ELMED<br />

ANGIO-<br />

DYNAMICS<br />

LISA<br />

SILIMED<br />

LASER<br />

NOVARTIS<br />

PROMEPLA<br />

MEDA (ROCAMED) CRYOLIFE<br />

MEDCOM LABORIE<br />

ROTTAPHARM<br />

MADAUS<br />

PHYSION ESSM<br />

BAYER ENDOCONTROL<br />

HEALTHCARE TRUMPF<br />

RUDOLF<br />

MEDISPEC<br />

MEDICAL<br />

TIME<br />

HEALUX NEXUS<br />

RESEARCH ERASMUS DENDREON<br />

OPKO<br />

LAMIDEY<br />

NOURY<br />

COOK MEDICAL<br />

M.A.S.<br />

LIMMER<br />

LASER<br />

CONMED/<br />

VIKING<br />

SCOMEDICA<br />

DIREX<br />

RECORDATI<br />

HITACHI<br />

MEDICAL<br />

SYSTEMS<br />

EUROPE /<br />

HITACHI<br />

ALOKA<br />

WISEPRESS<br />

MMS<br />

EUROPEAN<br />

UROLOGY<br />

UROTECH<br />

&<br />

UROVISION<br />

RICHARD WOLF<br />

EDAP TMS<br />

TELEFLEX<br />

MEDI-<br />

WATCH<br />

ZEPHYR<br />

OM<br />

SIEMENS PHARMA<br />

ISMH<br />

MEL PAJUNK<br />

CL MEDICAL<br />

ASPIDE<br />

MÉDICAL<br />

COLOPLAST - PORGÈS ALLERGAN<br />

PFIZER<br />

AUA<br />

INTERNET<br />

CORNER 2<br />

BN IMMUNO<br />

THERAPEUTICS FOTONA<br />

APOGEPHA<br />

TO OTHER<br />

LEVELS<br />

QUANTA SYSTEM BOSTON SCIENTIFIC<br />

ANATOMY<br />

FOR<br />

UROLOGY<br />

THERA-<br />

COAT<br />

HANGZHOU<br />

HAWK<br />

ASCLEPION MCUBE<br />

ERBE<br />

ELEKTROMEDIZIN<br />

BAYER<br />

HEALTHCARE<br />

TIME<br />

RESEARCH ERASMUS<br />

EMD<br />

TAEWOONG<br />

MEDICAL<br />

ELI LILLY AND COMPANY<br />

BECKMAN<br />

COULTER<br />

ELMED<br />

CATERING<br />

<strong>EAU</strong><br />

BOOTH:<br />

<strong>EAU</strong> MEMBERSHIP<br />

HISTORICAL EXHIBITION<br />

RESEARCH FOUNDATION<br />

<strong>EAU</strong> STOCKHOLM 2014<br />

EBU<br />

YOUNG UROLOGISTS /<br />

RESIDENTS CORNER<br />

STARMEDTEC TRIBUTE KITALPHA A.M.I.<br />

IBSA<br />

KOELIS PROMEDON DEXTÉRITÉ<br />

SONACARE ELSEVIER CARESONO<br />

BK MEDICAL<br />

UROTISS<br />

B. BRAUN AESCULAP<br />

ALLIUM<br />

BARD<br />

LUMENIS<br />

LENUS<br />

BIOLITEC INFORMA NAMED<br />

PHARMA<br />

EMS HC ITALY TRISTEL<br />

WELLSPECT<br />

HEALTHCARE<br />

HISTOSCANNING<br />

BY AMD<br />

B C D E F G H<br />

OLYMPUS<br />

ASTELLAS<br />

ASTELLAS<br />

SHENZHEN<br />

HUIKANG SONY<br />

IPSEN<br />

MILLENNIUM:<br />

THE TAKEDA<br />

ONCOLOGY COMPANY<br />

AMGEN<br />

GLAXOSMITHKLINE<br />

FERRING<br />

INTUITIVE SURGICAL<br />

AMERICAN MEDICAL SYSTEMS<br />

EIGEN<br />

PIERRE FABRE MÉDICAMENT<br />

EIGEN<br />

KARL STORZ STORZ MEDICAL<br />

JANSSEN<br />

PHARMA-<br />

CEUTICALS<br />

JANSSEN PHARMACEUTICALS<br />

UROMED<br />

MEDTRONIC<br />

DORNIER MEDTECH EUROPE<br />

SMOKING<br />

AREA<br />

SILIMED<br />

MEDAC<br />

SIU<br />

AYMED<br />

HOLOGIC<br />

GEN-PROBE<br />

ANGIO-<br />

DYNAMICS<br />

LISA<br />

LASER<br />

ENDOCONTROL<br />

TRUMPF<br />

DENDREON<br />

KLS MARTIN GROUP<br />

SIU ITALIA<br />

CURAN<br />

LUT<br />

ANDRO-<br />

MEDA<br />

T-DOC<br />

MYRIAD<br />

NEOTRACT<br />

INTEGRA<br />

SPHINX<br />

VISION<br />

SCIENCES<br />

NEOMEDIC<br />

NOVARTIS<br />

B<br />

MEDA<br />

MEDCOM<br />

ROTTAPHARM<br />

MADAUS<br />

MEDISPEC<br />

LAMIDEY<br />

NOURY<br />

PROMEPLA<br />

(ROCAMED)<br />

LABORIE<br />

COOK MEDICAL<br />

M.A.S.<br />

DIREX<br />

RECORDATI<br />

CRYOLIFE<br />

LIMMER<br />

LASER<br />

CONMED/<br />

VIKING<br />

SCOMEDICA<br />

OLYMPUS<br />

C<br />

HITACHI<br />

MEDICAL<br />

SYSTEMS<br />

EUROPE /<br />

HITACHI<br />

ALOKA<br />

ENTRANCE/EXIT<br />

EXHIBITION<br />

NORTH LEVELS<br />

WISEP<br />

MMS<br />

BJ


HALL - SOUTH LEVEL<br />

M.A.S.<br />

EPLAPROMEPLA<br />

MED) (ROCAMED) CRYOLIFE CRYOLIFE<br />

LIMMER<br />

ORIE LABORIE<br />

LASER<br />

DIREX<br />

CONMED/<br />

VIKING<br />

SCOMEDICA SCOMEDICA<br />

RECORDATI RECORDATI<br />

EDICAL COOK MEDICAL<br />

M.A.S.<br />

DIREX<br />

OLYMPUS OLYMPUS<br />

LIMMER<br />

LASER<br />

CONMED/<br />

VIKING<br />

HITACHI HITACHI<br />

MEDICAL MEDICAL<br />

SYSTEMS SYSTEMS<br />

EUROPE /<br />

HITACHI<br />

ALOKA<br />

WISEPRESS WISEPRESS<br />

MMS<br />

ENTRANCE/EXIT<br />

ENTRANCE/EXIT<br />

EXHIBITION EXHIBITION<br />

NORTH NORTH LEVELS LEVELS<br />

BJUI/WILEY-BLACKWELL<br />

BJUI/WILEY-BLACKWELL<br />

EUROPE /<br />

HITACHI<br />

ALOKA<br />

MMS<br />

UROTECH UROTECH<br />

& &<br />

UROVISION UROVISION<br />

RICHARD WOLF RICHARD WOLF<br />

ASTELLAS ASTELLAS<br />

EUROPEAN EUROPEAN<br />

UROLOGY UROLOGY<br />

TO OTHER TO OTHER<br />

LEVELS LEVELS<br />

EDAP TMS EDAP TMS<br />

SHENZHEN SHENZHEN<br />

HUIKANG HUIKANG SONY SONY TELEFLEX TELEFLEX<br />

GLAXOSMITHKLINE GLAXOSMITHKLINE<br />

MEDI-<br />

WATCH<br />

MEL PAJUNK MEL PAJUNK<br />

CL MEDICAL CL MEDICAL<br />

STARMEDTEC STARMEDTEC TRIBUTE TRIBUTE KITALPHA KITALPHA A.M.I. A.M.I.<br />

ASPIDE ASPIDE<br />

MÉDICAL MÉDICAL<br />

COLOPLAST COLOPLAST - PORGÈS - PORGÈS ALLERGAN ALLERGAN<br />

PFIZER<br />

IBSA<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

31<br />

Exhibition<br />

INT<br />

COR<br />

BN IMMUN<br />

THERAPEUT T<br />

B<br />

TO OTHER TO O<br />

LEVELS LE<br />

C C D D E E F F<br />

ASTELLAS ASTELLAS<br />

OM OM<br />

ZEPHYR ZEPHYR<br />

SIEMENS SIEMENS PHARMA PHARMA<br />

ISMH<br />

IPSEN<br />

MILLENNIUM: MILLENNIUM:<br />

THE TAKEDA THE TAKEDA<br />

ONCOLOGY ONCOLOGY COMPANY COMPANY<br />

AMGEN<br />

IPSEN<br />

AMGEN<br />

MEDI-<br />

WATCH<br />

ISMH<br />

FERRING FERRING<br />

INTUITIVE SURGICAL INTUITIVE SURGICAL<br />

PFIZER<br />

AMERICAN AMERICAN MEDICAL SYSTEMS MEDICAL SYSTEMS<br />

IBSA<br />

KARL<br />

QUANT<br />

JANSSEN J<br />

PHARMA- P<br />

CEUTICALSCE


IE<br />

HALL - SOUTH LEVEL<br />

Exhibition<br />

LA<br />

ED)<br />

RECORDATI<br />

DICAL<br />

M.A.S.<br />

DIREX<br />

CRYOLIFE<br />

LIMMER<br />

LASER<br />

CONMED/<br />

VIKING<br />

SCOMEDICA<br />

OLYMPUS<br />

HITACHI<br />

MEDICAL<br />

SYSTEMS<br />

EUROPE /<br />

HITACHI<br />

ALOKA<br />

ENTRANCE/EXIT<br />

PHYSION ESSM<br />

BAYER<br />

HEALTHCARE<br />

RUDOLF<br />

MEDICAL<br />

TIME<br />

HEALUX NEXUS<br />

RESEARCH<br />

EXHIBITION<br />

NORTH LEVELS<br />

WISEPRESS<br />

MMS<br />

BJUI/WILEY-BLACKWELL<br />

EUROPEAN<br />

M.A.S. UROLOGY<br />

32 <strong>Programme</strong> <strong>Book</strong><br />

UROTECH<br />

&<br />

UROVISION<br />

RICHARD WOLF<br />

ASTELLAS<br />

TO OTHER<br />

LEVELS<br />

EDAP TMS<br />

SHENZHEN<br />

HUIKANG<br />

SIEMENS<br />

SONY<br />

OM<br />

PHARMA<br />

TELEFLEX<br />

GLAXOSMITHKLINE<br />

ZEPHYR<br />

MEDI-<br />

WATCH<br />

MEL PAJUNK<br />

CL MEDICAL<br />

ASPIDE<br />

MÉDICAL<br />

COLOPLAST - PORGÈS ALLERGAN<br />

C D E F<br />

ASTELLAS<br />

ENTRANCE/EXIT<br />

EXHIBITION<br />

NORTH LEVELS<br />

TO OTHER<br />

LEVELS<br />

IPSEN<br />

MILLENNIUM:<br />

THE TAKEDA<br />

ONCOLOGY COMPANY<br />

EXHIBITION HALL - SOUTH LEVEL S0<br />

CIG<br />

SMU<br />

OCEANA<br />

ISTEM<br />

MEDIKAL<br />

A<br />

INTERNET<br />

CORNER 1<br />

GALIL MEDICAL MEDKONSULT<br />

MEDICA<br />

EUROPA<br />

WFIP<br />

UOMO<br />

MENARINI<br />

OPKO<br />

CUA CUA<br />

CANADA CHINA<br />

TERUMO AUA<br />

THERA-<br />

COAT<br />

MEDAC<br />

ASCLEPION MCUBE SIU<br />

ERBE<br />

ELEKTROMEDIZIN AYMED<br />

HOLOGIC<br />

GEN-PROBE<br />

BECKMAN<br />

COULTER<br />

KLS MARTIN GROUP<br />

ELMED<br />

ANGIO-<br />

DYNAMICS<br />

LISA<br />

SILIMED<br />

LASER<br />

ENDOCONTROL<br />

TRUMPF<br />

ERASMUS DENDREON<br />

NOVARTIS<br />

PROMEPLA<br />

MEDA (ROCAMED) CRYOLIFE<br />

MEDCOM LABORIE<br />

ROTTAPHARM<br />

MADAUS<br />

MEDISPEC<br />

LAMIDEY<br />

NOURY<br />

COOK MEDICAL<br />

LIMMER<br />

LASER<br />

CONMED/<br />

VIKING<br />

SCOMEDICA<br />

DIREX<br />

RECORDATI<br />

HITACHI<br />

MEDICAL<br />

SYSTEMS<br />

EUROPE /<br />

HITACHI<br />

ALOKA<br />

WISEPRESS<br />

MMS<br />

RICHARD WOLF<br />

EUROPEAN<br />

UROLOGY<br />

UROTECH<br />

&<br />

UROVISION<br />

EDAP TMS<br />

TELEFLEX<br />

MEDI-<br />

WATCH<br />

ZEPHYR<br />

OM<br />

SIEMENS PHARMA<br />

ISMH<br />

MEL PAJUNK<br />

CL MEDICAL<br />

COLOPLAST - PORGÈS ALLERGAN<br />

PFIZER<br />

AMGEN<br />

ISMH<br />

FERRING<br />

INTUITIVE SURGICAL<br />

INTE<br />

COR<br />

BN IMMUNO<br />

THERAPEUTIC<br />

TO OTHER<br />

LEVELS<br />

QUANTA<br />

STARMEDTEC TRIBUTE KITALPHA A.M.I.<br />

IBSA<br />

KO<br />

ASPIDE<br />

MÉDICAL<br />

INTERNET<br />

CORNER 2<br />

BN IMMUNO<br />

THERAPEUTICS FOTONA<br />

APOGEPHA<br />

TO OTHER<br />

LEVELS<br />

QUANTA SYSTEM BOSTON SCIENTIFIC<br />

EMD<br />

TAEWOONG<br />

MEDICAL<br />

ELI LILLY AND COMPANY<br />

CATERING<br />

<strong>EAU</strong><br />

BOOTH:<br />

<strong>EAU</strong> MEMBERSHIP<br />

HISTORICAL EXHIBITION<br />

RESEARCH FOUNDATION<br />

<strong>EAU</strong> STOCKHOLM 2014<br />

EBU<br />

YOUNG UROLOGISTS /<br />

RESIDENTS CORNER<br />

STARMEDTEC TRIBUTE KITALPHA A.M.I.<br />

IBSA<br />

KOELIS PROMEDON DEXTÉRITÉ<br />

SONACARE ELSEVIER CARESONO<br />

BK MEDICAL<br />

UROTISS<br />

B. BRAUN AESCULAP<br />

ALLIUM<br />

BARD<br />

LUMENIS<br />

LENUS<br />

BIOLITEC INFORMA NAMED<br />

PHARMA<br />

EMS HC ITALY TRISTEL<br />

WELLSPECT<br />

HEALTHCARE<br />

HISTOSCANNING<br />

BY AMD<br />

B C D E F G H<br />

OLYMPUS<br />

ASTELLAS<br />

ASTELLAS<br />

SHENZHEN<br />

HUIKANG SONY<br />

IPSEN<br />

MILLENNIUM:<br />

THE TAKEDA<br />

ONCOLOGY COMPANY<br />

AMGEN<br />

GLAXOSMITHKLINE<br />

FERRING<br />

INTUITIVE SURGICAL<br />

AMERICAN MEDICAL SYSTEMS<br />

EIGEN<br />

PIERRE FABRE MÉDICAMENT<br />

EIGEN<br />

KARL STORZ STORZ MEDICAL<br />

JANSSEN<br />

PHARMA-<br />

CEUTICALS<br />

JANSSEN PHARMACEUTICALS<br />

UROMED<br />

MEDTRONIC<br />

DORNIER MEDTECH EUROPE<br />

SMOKING<br />

AREA<br />

SIU ITALIA<br />

CURAN<br />

LUT<br />

ANDRO-<br />

MEDA<br />

T-DOC<br />

MYRIAD<br />

NEOTRACT<br />

INTEGRA<br />

SPHINX<br />

VISION<br />

SCIENCES<br />

NEOMEDIC<br />

PFIZER<br />

AMERICAN MEDICAL SYSTEMS<br />

JANSSEN<br />

PHARMA-<br />

CEUTICALS<br />

BK<br />

KARL S<br />

P


ICAL<br />

SYSTEMS<br />

ASPIDE<br />

MÉDICAL<br />

ALLERGAN<br />

IBSA<br />

VEL S0<br />

TO OTHER<br />

LEVELS<br />

INTERNET<br />

CORNER 2<br />

BN IMMUNO<br />

THERAPEUTICS<br />

BK MEDICAL<br />

FOTONA<br />

APOGEPHA<br />

UROTISS<br />

QUANTA SYSTEM BOSTON SCIENTIFIC<br />

B. BRAUN AESCULAP<br />

ALLIUM<br />

TAEWOONG<br />

MEDICAL<br />

BARD<br />

LUMENIS<br />

CATERING<br />

<strong>EAU</strong><br />

BOOTH:<br />

<strong>EAU</strong> MEMBERSHIP<br />

HISTORICAL EXHIBITION<br />

RESEARCH FOUNDATION<br />

<strong>EAU</strong> STOCKHOLM 2014<br />

EBU<br />

YOUNG UROLOGISTS /<br />

RESIDENTS CORNER<br />

KOELIS PROMEDON DEXTÉRITÉ<br />

SONACARE ELSEVIER CARESONO<br />

EMD<br />

ELI LILLY AND COMPANY<br />

BIOLITEC<br />

INFORMA NAMED<br />

EMS<br />

WELLSPECT<br />

HEALTHCARE<br />

HISTOSCANNING<br />

BY AMD<br />

LENUS<br />

PHARMA<br />

HC ITALY TRISTEL<br />

UROMED<br />

MEDTRONIC<br />

F G H<br />

JANSSEN<br />

PHARMA-<br />

CEUTICALS<br />

EIGEN<br />

PIERRE FABRE MÉDICAMENT<br />

EIGEN<br />

KARL STORZ STORZ MEDICAL<br />

JANSSEN PHARMACEUTICALS<br />

DORNIER MEDTECH EUROPE<br />

SMOKING<br />

AREA<br />

SIU ITALIA<br />

CURAN<br />

LUT<br />

ANDRO-<br />

MEDA<br />

T-DOC<br />

MYRIAD<br />

NEOTRACT<br />

INTEGRA<br />

SPHINX<br />

ELMEDICAL<br />

VISION<br />

SCIENCES<br />

NEOMEDIC<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

33<br />

Exhibition


Exhibitors<br />

Alphabetical list of Exhibitors<br />

Please note that this list and the floor plans on the previous pages will not be comprehensive due to the printing date of this programme book<br />

(list and floor plans are updated through 30 January <strong>2013</strong>).<br />

EXHIBITOR BOOTH NR.<br />

A<br />

A.M.I. GMBH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . E02<br />

ALLERGAN . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .F31<br />

ALLIUM LTD. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .G48<br />

AMERICAN MEDICAL SYSTEMS, INC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . E06<br />

AMERICAN UROLOGICAL ASSOCIATION (AUA) ..........................................................................A06<br />

AMGEN (EUROPE) GMBH .................................................................................................D20<br />

ANATOMY FOR UROLOGY - PRIMAL PICTURES LTD .....................................................................B59<br />

ANDROMEDA MEDIZINISCHE SYSTEME GMBH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H26<br />

ANGIODYNAMICS ..........................................................................................................B65<br />

APOGEPHA ARZNEIMITTEL GMBH .......................................................................................G35<br />

ASCLEPION LASER TECHNOLOGIES . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B47<br />

ASPIDE MÉDICAL ...........................................................................................................F47<br />

ASTELLAS PHARMA EUROPE LTD. ................................................................................ C04 & C20<br />

AYMED MEDICAL TECHNOLOGY . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B41<br />

B<br />

B. BRAUN AESCULAP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .G50<br />

BARD LTD . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G34<br />

BAYER HEALTHCARE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B31<br />

BECKMAN COULTER, INC. .................................................................................................B09<br />

BIOLITEC BIOMEDICAL TECHNOLOGY GMBH ............................................................................H47<br />

BJUI / WILEY-BLACKWELL . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C72<br />

BK MEDICAL . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . F38<br />

BN IMMUNOTHERAPEUTICS ..............................................................................................F44<br />

BOSTON SCIENTIFIC ........................................................................................................G11<br />

C<br />

CANADIAN UROLOGICAL ASSOCIATION (CUA CANADA) ................................................................A00<br />

CARESONO TECHNOLOGY CO., LTD. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H01<br />

CHINESE UROLOGICAL ASSOCIATION (CUA CHINA) .....................................................................A02<br />

CL MEDICAL ................................................................................................................E70<br />

COCHRANE INCONTINENCE REVIEW GROUP (CIG) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A07<br />

COLOPLAST - PORGÈS. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . E54<br />

CONMED / VIKING .........................................................................................................C25<br />

COOK MEDICAL . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B02<br />

CRYOLIFE EUROPA, LTD. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C35<br />

CURAN MEDICAL BV . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H32<br />

D<br />

DENDREON CORPORATION . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B25<br />

DEXTÉRITÉ SURGICAL .....................................................................................................G01<br />

DIREX GMBH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .C21<br />

DORNIER MEDTECH EUROPE GMBH .....................................................................................H05<br />

34 <strong>Programme</strong> <strong>Book</strong>


E<br />

<strong>EAU</strong> BOOTH .................................................................................................................H17<br />

<strong>EAU</strong> HISTORICAL EXHIBITION . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .H17<br />

<strong>EAU</strong> STOCKHOLM 2014 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .H17<br />

<strong>EAU</strong> RESEARCH FOUNDATION ............................................................................................H17<br />

EDAP TMS ..................................................................................................................D41<br />

EIGEN . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G31<br />

ELI LILLY AND COMPANY ..................................................................................................G06<br />

ELMED LITHOTRIPSY SYSTEMS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .B05<br />

ELMEDICAL LTD ............................................................................................................H10<br />

ELSEVIER ...................................................................................................................H03<br />

EMD MEDICAL . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .G44<br />

EMS ELECTRO MEDICAL SYSTEMS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H45<br />

ENDOCONTROL ............................................................................................................B33<br />

ERASMUS S.A. .............................................................................................................B27<br />

ERBE ELEKTROMEDIZIN GMBH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B45<br />

ESSM . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A32<br />

EUROPA UOMO ............................................................................................................A50<br />

EUROPEAN BOARD OF UROLOGY . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .H17<br />

EUROPEAN UROLOGY .....................................................................................................C02<br />

F<br />

FERRING INTERNATIONAL CENTER S.A. .................................................................................E42<br />

FOTONA B.B.. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . F48<br />

G<br />

GALIL MEDICAL ............................................................................................................A14<br />

GLAXOSMITHKLINE ........................................................................................................D06<br />

H<br />

HANGZHOU HAWK OPTICAL ELECTRONIC INSTRUMENTS CO., LTD. ...................................................B55<br />

HC ITALY ....................................................................................................................H41<br />

HEALUX . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A24<br />

HISTOSCANNING BY AMD . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H29<br />

HITACHI MEDICAL SYSTEMS EUROPE / HITACHI ALOKA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C48<br />

HOLOGIC GEN-PROBE .....................................................................................................B17<br />

I<br />

IBSA INSTITUT BIOCHIMIQUE SA. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .F01<br />

INFORMA HEALTHCARE ...................................................................................................H49<br />

INTEGRA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H14<br />

INTERNET CORNERS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .A22 & F54<br />

INTUITIVE SURGICAL ......................................................................................................E30<br />

IPSEN .......................................................................................................................D42<br />

ISMH (INTERNATIONAL SOCIETY OF MEN’S HEALTH) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . E43<br />

ISTEM MEDIKAL . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A01<br />

J<br />

JANSSEN PHARMACEUTICALS ....................................................................................F06 & G05<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

35<br />

Exhibitors


Exhibitors<br />

Alphabetical list of Exhibitors<br />

K<br />

KARL STORZ GMBH & CO. KG . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . F26<br />

KITALPHA MED LTD ........................................................................................................ E01<br />

KLS MARTIN GROUP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .B11<br />

KOELIS ......................................................................................................................F02<br />

L<br />

LABORIE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B28<br />

LAMIDEY NOURY MEDICAL . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B10<br />

LENUS PHARMA GESMBH ................................................................................................H53<br />

LIMMER LASER GMBH ....................................................................................................C29<br />

LISA LASER PRODUCTS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B63<br />

LUMENIS DEUTSCHLAND GMBH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G18<br />

LUT GMBH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .H30<br />

M<br />

M.A.S. ...................................................................................................................... C37<br />

MCUBE TECHNOLOGY .....................................................................................................B49<br />

MEDA CO., LTD .............................................................................................................B32<br />

MEDAC GMBH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B53<br />

MEDCOM GMBH ...........................................................................................................B26<br />

MEDICA S.P.A. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A12<br />

MEDICAL MEASUREMENT SYSTEMS B.V. ................................................................................C40<br />

MEDISPEC LTD . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B12<br />

MEDIWATCH PLC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . E47<br />

MEDKONSULT ..............................................................................................................A16<br />

MEDTRONIC INTERNATIONAL TRADING SÀRL . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H25<br />

MENARINI . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .A44<br />

MEXICAN SOCIETY OF UROLOGY (SMU) .................................................................................A05<br />

MILLENNIUM: THE TAKEDA ONCOLOGY COMPANY . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . D30<br />

MYRIAD GENETICS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H18<br />

N<br />

NAMED S.P.A. ..............................................................................................................H51<br />

NEOMEDIC INTERNATIONAL S.L. .........................................................................................H02<br />

NEOTRACT, INC. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H16<br />

NEXUS S.R.L. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A28<br />

NOVARTIS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B01<br />

O<br />

OCEANA THERAPEUTICS ..................................................................................................A03<br />

OLYMPUS MEDICAL SYSTEMS EUROPA GMBH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C01<br />

OM PHARMA SA ...........................................................................................................D64<br />

OPKO DIAGNOSTICS .......................................................................................................A10<br />

P<br />

PAJUNK GMBH ..............................................................................................................E37<br />

PFIZER INTERNATIONAL OPERATIONS ...................................................................................E22<br />

PHYSION . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A34<br />

PIERRE FABRE MÉDICAMENT . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . F30<br />

PROMEDON S.A. ...........................................................................................................G03<br />

PROMEPLA (ROCAMED) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B30<br />

36 <strong>Programme</strong> <strong>Book</strong>


Q<br />

QUANTA SYSTEM SPA ..................................................................................................... F22<br />

R<br />

RECORDATI .................................................................................................................C09<br />

RICHARD WOLF GMBH ....................................................................................................D51<br />

ROTTAPHARM | MADAUS .................................................................................................B22<br />

RUDOLF MEDICAL GMBH + CO. KG . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A30<br />

S<br />

SCOMEDICA ................................................................................................................C23<br />

SHENZHEN HUIKANG MEDICAL APPARATUS CO., LTD. .................................................................D70<br />

SIEMENS AG HEALTHCARE SECTOR ......................................................................................D54<br />

SILIMED INDUSTRIA DE IMPLANTES LTDA. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B61<br />

SIU SOCIETÀ ITALIANA DI UROLOGIA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H36<br />

SOCIÉTÉ INTERNATIONALE D’UROLOGIE (SIU) ..........................................................................B51<br />

SONACARE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G02<br />

SONY EUROPE LIMITED ...................................................................................................D72<br />

SPHINX MEDICAL LTD . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H12<br />

STARMEDTEC GMBH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . D02<br />

STORZ MEDICAL AG .......................................................................................................F26<br />

SYNERGO-MEDICAL ENTERPRISES ......................................................................................E39<br />

T<br />

T-DOC COMPANY, LLC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H24<br />

TAEWOONG MEDICAL, CO. LTD ...........................................................................................G42<br />

TELEFLEX ..................................................................................................................D74<br />

TERUMO EUROPE N.V. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .A04<br />

THERACOAT . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B57<br />

TIME RESEARCH LIMITED .................................................................................................B29<br />

TRIBUTE ....................................................................................................................E03<br />

TRISTEL SOLUTIONS .......................................................................................................H39<br />

TRUMPF ....................................................................................................................B33<br />

U<br />

UROMED KURT DREWS KG . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . H35<br />

UROTECH GMBH & UROVISION GMBH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . D61<br />

UROTISS GMBH ...........................................................................................................G35<br />

V<br />

VISION-SCIENCES, INC. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .H06<br />

W<br />

WELLSPECT HEALTHCARE .................................................................................................H33<br />

WISEPRESS ONLINE BOOKSHOP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C42<br />

WORLD FEDERATION OF INCONTINENT PATIENTS - WFIP .............................................................A48<br />

Y<br />

YOUNG UROLOGISTS / RESIDENTS CORNER . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .H17<br />

Z<br />

ZEPHYR SURGICAL IMPLANTS .............................................................................................E41<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

37<br />

Exhibitors


General information<br />

Abstracts<br />

More than 1.200 abstracts have been accepted for<br />

presentation during poster and video sessions in Milan.<br />

The <strong>EAU</strong> Abstract CD <strong>2013</strong> will be distributed to all<br />

congress delegates by FERRING PHARMACEUTICALS<br />

(booth E42 in the exhibition on level S0). The <strong>EAU</strong><br />

Poster DVD <strong>2013</strong> will be distributed to all congress<br />

delegates by AMGEN (booth D20 in the exhibition on<br />

level S0). All abstracts and PDFs of the posters are<br />

available online at www.eaumilan<strong>2013</strong>.org/scientificprogramme.<br />

Abstracts are also available through the<br />

congress App.<br />

The <strong>EAU</strong> Poster DVD <strong>2013</strong> is supported by an<br />

unrestricted educational grant from AMGEN<br />

The <strong>EAU</strong> Abstract CD <strong>2013</strong> is supported by an<br />

educational grant from FERRING PHARMACEUTICALS<br />

Access to the Session Rooms<br />

Seating is regulated on a first-come, first-served basis.<br />

We recommend delegates to go to the session room<br />

well in advance of the session. Due to safety<br />

regulations, the organisers will close the session<br />

room when all seats are taken. It is not allowed for<br />

delegates to stand in the aisles of the rooms.<br />

Address and Accessibility<br />

Congress Centre<br />

The MiCo – Milano Congressi can be well reached by<br />

public transport. The public transport system is easy<br />

to use and a very efficient way to get around the city.<br />

Congress delegates may collect a complimentary<br />

transportation pass in the registration area on level N0.<br />

See also “Transportation Pass”.<br />

Address congress centre:<br />

MiCo - Milano Congressi<br />

Via Gattamelata 5 (Gate 14)<br />

20149, Milan, Italy<br />

T: +39 02 43 42 62 75<br />

F: +39 02 48 01 02 70<br />

www.micmilano.it<br />

By metro:<br />

The nearest metro station is “Amendola”. From there<br />

complimentary shuttle busses (see also “Shuttle Bus”)<br />

will bring participants to the main entrance of the<br />

congress venue.<br />

By car:<br />

From the ring roads circling Milan, follow the signs<br />

to “Fieramilanocity”. There is a car parking onsite<br />

(accessible through gate 17) or there are large Park &<br />

Ride car parks located close to the following Metro<br />

stops: Cascina Gobba (Green Line), San Donato (Yellow<br />

Line), Famagosta (Green Line), Bisceglie (Red Line),<br />

Lampugnano (Red Line)<br />

Airport Shuttle Bus<br />

From Milan Central Station (Stazione Centrale =<br />

Garibaldi Station) a shuttle bus goes directly to Linate<br />

(+/- 25 minutes) and Malpensa airport (+/- 60<br />

minutes).<br />

Malpensa<br />

The Malpensa shuttle bus operates between 03.45 and<br />

00.30 from Milan Central Station. The tickets cost € 10<br />

and can be purchased on board. The Malpensa shuttle<br />

bus to the airport departs every 20 minutes. The<br />

closest bus stop from the congress venue is at Viale<br />

Teodorico.<br />

Linate<br />

The Linate shuttle bus operates between 06.00 until<br />

23.00 from Milan Central Station. The tickets cost € 5<br />

and can be purchased on board. The bus to Milan<br />

Linate airport departs every 30 minutes.<br />

App - Your smart congress<br />

companion<br />

The Congress App will bring the 28th Annual<br />

<strong>EAU</strong> Congress to your smartphone. The<br />

application offers the best mobile overview of<br />

this scientific event with instant access to congress<br />

abstracts, exhibition booth locations and the latest<br />

news from before, during and after the meeting! This<br />

year you will find a whole new set of features and you<br />

won’t need constant internet access to navigate the<br />

information. Please, check under <strong>EAU</strong> <strong>2013</strong> in your App<br />

Store or Android market to get your smart congress<br />

companion.<br />

Award Gallery<br />

At the <strong>EAU</strong> Award Gallery you will find a complete<br />

overview of all awards that were handed out by the<br />

European Association of Urology this year (see page<br />

6-8 for an overview of the award winners). It also<br />

features information on past winners of the most<br />

prestigious <strong>EAU</strong> prizes.<br />

The <strong>EAU</strong> Award Gallery provides a great opportunity to<br />

take in all the important developments and breakthroughs<br />

in recent years. It can be found on level S2<br />

between the eURO Auditorium and the catering point,<br />

be sure to visit it!<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

39<br />

General


General<br />

General information<br />

Badge Tracking System<br />

Congress delegates have a barcode on their badge<br />

which enables them to leave their contact details with<br />

exhibitors in a quick and easy way. The barcode will<br />

also be scanned at the entrance of the session rooms<br />

to gather CME and statistic information.<br />

Badges<br />

The badge classification is as follows:<br />

Blue badge : <strong>EAU</strong> member<br />

White badge : Delegate<br />

Brown badge : Nurse<br />

Green badge : Exhibitor<br />

Red badge : Press<br />

Purple badge : Accompanying person<br />

Yellow badge : Organising staff<br />

Bank, Exchange and Credit Cards<br />

The national currency in Italy is the Euro (€). Two ATM<br />

machines are available at the MiCo; one in the North<br />

wing on level N1 and one on in the South wing on<br />

level S1 on the balcony in the exhibition. A bank<br />

including an exchange office is available in the<br />

congress venue on level N0 near the entrance to the<br />

registration area. There are also banks near the<br />

congress centre, please go to the <strong>EAU</strong> Information Desk<br />

on level N0 for detailed information.<br />

Best Posters<br />

The Best Posters wall features the best scientific<br />

posters of the Milan Congress. This high-tech plasma<br />

wall is accessible during congress hours on level N0.<br />

The best posters can also be viewed through the<br />

congress website during and after the congress.<br />

Business Centre<br />

There is a Business Centre located on level S1<br />

(balcony) of the exhibition which offers facilities such<br />

as computers, printers, copiers and internet.<br />

Congress Hours<br />

40 <strong>Programme</strong> <strong>Book</strong><br />

Certificate of Attendance<br />

A Certificate of Attendance for the Milan Congress can<br />

be printed online at www.eaumilan<strong>2013</strong>.org as of 20<br />

March <strong>2013</strong>. You will need your registration number<br />

(under barcode on the badge) to print the Certificate of<br />

Attendance. Information on CME accreditation is<br />

available in this programme book on page 47.<br />

Cloakroom / Luggage<br />

The cloakroom is located in the registration area on<br />

level N0 and open during congress hours. Please be<br />

sure to collect all personal belongings at the end of<br />

the day.<br />

CME Accreditation<br />

The 28th Annual <strong>EAU</strong> Congress is accredited by the<br />

UEMS/EACCME through the European Board of Urology.<br />

More information on national credit systems and<br />

credits recognition is available in this programme book<br />

on page 47-48. See also “EU-ACME Desk”.<br />

Congress Bag<br />

Each delegate can collect a congress bag in the registration<br />

area on level N0.<br />

The congress bags are sponsored by ASTELLAS<br />

Daily Congress Newsletter:<br />

European Urology Today Special<br />

Edition<br />

Special daily congress newsletters are available on<br />

Saturday 16, Sunday 17 and Monday 18 March. The<br />

newsletters cover on-site news, congress session<br />

information and background information on a<br />

variety of subjects. The first edition also contains an<br />

Exhibition Overview. The newsletters will also be<br />

available online at www.eaumilan<strong>2013</strong>.org during and<br />

after the congress.<br />

Speaker Service Registration Sessions Sponsored Exhibition Cloakroom<br />

Centre<br />

sessions<br />

Thursday, 14 March 14.00-19.00 08.00-20.00<br />

Friday, 15 March 08.00-19.00 07.00-20.00 09.00-21.00 16.15-17.45 07.00-21.30<br />

Saturday, 16 March 07.00-19.30 07.00-20.00 07.30-19.30 18.00-19.30 09.15-18.15 07.00-19.45<br />

Sunday, 17 March 07.00-19.30 07.00-19.30 07.30-19.15 17.45-19.15 09.15-18.15 07.00-19.30<br />

Monday, 18 March 07.00-19.30 07.00-19.30 07.30-19.15 17.45-19.15 09.15-18.15 07.00-19.30<br />

Tuesday, 19 March 07.00-13.10 07.00-13.30 08.00-13.10 07.30-13.30


<strong>EAU</strong> Congress Office<br />

Managing Directors<br />

Jacqueline Roelofswaard<br />

j.roelofswaard@uroweb.org<br />

Maurice Schlief<br />

m.schlief@uroweb.org<br />

Congress Manager<br />

Patricia de Bont<br />

p.debont@congressconsultants.com<br />

Exhibition Manager<br />

Henriet Wieringa<br />

h.wieringa@congressconsultants.com<br />

Manager Business Relations<br />

Peter Hazenberg<br />

p.hazenberg@uroweb.org<br />

Congress Consultants B.V.<br />

PO Box 30016<br />

6803 AA Arnhem<br />

The Netherlands<br />

T +31 (0)26 389 1751<br />

F +31 (0)26 389 1752<br />

info@congressconsultants.com<br />

www.eaumilan<strong>2013</strong>.org<br />

<strong>EAU</strong> Education Office<br />

(European School of<br />

Urology)<br />

The European School of Urology (ESU), working with<br />

European faculties, aims to provide high quality international<br />

educational courses in urology. The ESU has a<br />

special booth on level N-1 with extensive information<br />

on its activities. Registration for the courses can be<br />

made at the ESU registration desks in the registration<br />

area on level N0. The ESU Courses CD <strong>2013</strong> is<br />

distributed at the <strong>EAU</strong> desk next to the MILLENNIUM:<br />

THE TAKEDA ONCOLOGY COMPANY booth (booth D30 in<br />

the exhibition on level S0) to all congress delegates.<br />

The ESU Courses CD <strong>2013</strong> is supported by an<br />

unrestricted educational grant from MILLENNIUM:<br />

THE TAKEDA ONCOLOGY COMPANY<br />

Fees ESU Courses (for congress registered delegates<br />

only)<br />

2 hrs. 3 hrs.<br />

<strong>EAU</strong> members € 32 € 47<br />

Non-<strong>EAU</strong> members € 47 € 69<br />

Residents (members/non-members) € 21 € 21<br />

Prices are excl. 21% VAT<br />

Hands-on training sessions on Laparoscopy,<br />

Ureterorenoscopy, Bipolar TURP, Robotic surgery,<br />

Endourology, Urodynamics and Green light laser are<br />

organised by the ESU in cooperation with the <strong>EAU</strong><br />

Robotic Urology Section (ERUS), the <strong>EAU</strong> Section<br />

of Uro-Technology (ESUT) and the <strong>EAU</strong> Section of<br />

Urolithiasis (EULIS).<br />

The registration fee is € 25 per hands-on training (excl.<br />

VAT).<br />

Registration for hands-on trainings and courses can<br />

be made at the ESU registration desks and in the Self<br />

Service Area in the registration area on level N0.<br />

The Hands-on training sessions are supported by<br />

educational grants from AMERICAN MEDICAL SYSTEMS,<br />

INTUITIVE SURGICAL, KARL STORZ GMBH & CO.KG,<br />

MEDIWATCH and OLYMPUS EUROPA HOLDING GMBH<br />

E-BLUS (European training in Basic Laparoscopic<br />

Urological Skills)<br />

One of the main goals of the <strong>EAU</strong> is to establish<br />

and introduce common standards for training and<br />

European urological practice in order to improve<br />

patient care.<br />

The E-BLUS exam tests certifies a basic level of<br />

laparoscopic urological skills. The exercises address<br />

bimanual dexterity, depth perception, suturing,<br />

clipping and cutting skills. Clinical application is found<br />

in such procedures as partial nephrectomy, total<br />

nephrectomy, pyeloplasty and radical prostatectomy.<br />

To aid in the training of these skills and to prepare for<br />

this E-BLUS exam, the exercises to be performed can<br />

be found in the instructional videos at<br />

http://hot.uroweb.org/exercises/.<br />

At the <strong>EAU</strong> Annual Congress several exam sessions<br />

will be organised where you can demonstrate your<br />

skills and be awarded with a certificate if you pass the<br />

defined criteria. Interest usually exceeds the number<br />

of available positions, participation in the exam is<br />

therefore by invitation.<br />

For more information: http://hot.uroweb.org or at the<br />

ESU booth.<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

41<br />

General


General<br />

General information<br />

<strong>EAU</strong> Booth<br />

The <strong>EAU</strong> Booth (booth H17 in the exhibition on level S0)<br />

consists of the <strong>EAU</strong> Membership Booth, EBU Corner,<br />

Young Urologists/ Residents Corner, <strong>EAU</strong> Stockholm<br />

2014 Promotion Counter, <strong>EAU</strong> Research Foundation<br />

and the <strong>EAU</strong> Historical Exhibition.<br />

There is also information on European Urology and<br />

other <strong>EAU</strong> publications. The <strong>EAU</strong> Membership Booth<br />

provides information on membership status and<br />

membership benefits. Non-members are welcome to<br />

visit the <strong>EAU</strong> Booth for further information and to<br />

apply for <strong>EAU</strong> membership.<br />

<strong>EAU</strong> Research<br />

Foundation<br />

The <strong>EAU</strong> Central Research Office initiates and<br />

coordinates, as well as refines investigator initiated<br />

and other clinical research protocols. It also acts to<br />

facilitate all aspects of clinical research and expand<br />

the current network of active research centres and<br />

investigators - basic and clinical - both within the<br />

<strong>EAU</strong> member states and its international affiliates. The<br />

office coordinates clinical and translational research in<br />

close liaison with the <strong>EAU</strong> Research Foundation. The<br />

<strong>EAU</strong> Research Foundation can be visited at the <strong>EAU</strong><br />

Booth (booth H17) in the exhibition on level S0.<br />

Education &<br />

Innovation<br />

The <strong>EAU</strong> Education & Innovation booth, located in<br />

the exhibition on level S1 (Balcony), represents a<br />

joint effort of the European School of Urology, the<br />

<strong>EAU</strong> Section of Uro-technology, the <strong>EAU</strong> Section on<br />

Urolithiasis and the <strong>EAU</strong> Robotic Urology Section,<br />

which offers urologists a hands-on experience with<br />

notable technological innovations in urological<br />

treatment and training.<br />

Electricity<br />

The electricity in Italy runs on 220 volts and the<br />

frequency is 50 Hz. Plugs have two or 3 round pins.<br />

A plug adaptor will be required if incompatible<br />

electronic devices are used.<br />

Emergency Phone Numbers<br />

In case of an emergency please call 113 for police, 115<br />

for fire brigade or 118 for ambulance service. In case of<br />

an emergency in the congress centre please call<br />

+39 02 4342 7210 or contact a security guard<br />

immediately. See also “First Aid”.<br />

42 <strong>Programme</strong> <strong>Book</strong><br />

EU-ACME Desk<br />

Information on the EU-ACME programme, CME/CPD<br />

credits, membership status & benefits, accredited CME<br />

activities and national CME credits systems can be<br />

obtained at the EU-ACME Desk in the registration area.<br />

For more information see page 48.<br />

European Association of<br />

Urology Nurses (<strong>EAU</strong>N)<br />

The 14th International Meeting of the European<br />

Association of Urology Nurses (<strong>EAU</strong>N) is a 3-day<br />

scientific meeting that will be held in conjunction with<br />

the 28th Annual <strong>EAU</strong> Congress from 16-18 March in<br />

support of their goal to continually upgrade the nursing<br />

skills of urology nurses. Scheduled are for example<br />

abstract sessions and panel discussions and expert<br />

nurses and urologists will give lectures, workshops<br />

and courses. See page 29 for the <strong>EAU</strong>N programme.<br />

There is also a special <strong>EAU</strong>N congress App available;<br />

search for <strong>EAU</strong>N <strong>2013</strong> in your App Store or Android<br />

market.<br />

European Board of<br />

Urology (EBU)<br />

The European Board of Urology (EBU) operates as an<br />

independent section of the UEMS (European Union of<br />

Medical Specialists) charged with regulatory matters.<br />

Visit the EBU Corner at the <strong>EAU</strong> Booth (booth H17 in the<br />

exhibition on level S0) to obtain more information on<br />

EBU’s core activities:<br />

• European Board Examinations in Urology (FEBU)<br />

• In-Service Assessment<br />

• Accreditation of Continuing Medical Education &<br />

Professional Development (CME & CPD)<br />

• Certification of Sub-Specialty Centres and<br />

Residency Training <strong>Programme</strong>s in Urology.<br />

European Urology<br />

European Urology, the official journal of the <strong>EAU</strong>, has<br />

been a respected urological forum for over 20 years<br />

and is currently read by more than 10,000<br />

urologists across the globe. With an impact factor of<br />

8.493 the Platinum Journal remains the leading<br />

scientific publication in the field of urology. To keep up<br />

with the rapidly evolving world of medicine,<br />

technology and surgical techniques, European Urology<br />

is constantly updating and innovating its features and<br />

layout in order to provide the best clinical guidance,<br />

research and education for urologists across Europe<br />

and the world. The recently implemented electronic<br />

features and platforms make reading the articles<br />

and viewing the videos even more interesting! Come


see European Urology for yourself - visit either the<br />

European Urology (booth C02) or the <strong>EAU</strong> Booth (booth<br />

H17) in the exhibition on level S0.<br />

Excursions and Milan Information<br />

Information on Milan and excursions will be available<br />

at the Milan Info & Excursions Desk in the registration<br />

area on level N0.<br />

Exhibition<br />

An extensive technical exhibition will be held jointly<br />

with the congress. The exhibition is open to technical<br />

equipment manufacturers, pharmaceutical companies<br />

and scientific publishers.<br />

Exhibition Hours<br />

Saturday, 16 March 09.15-18.15 hrs<br />

Sunday, 17 March 09.15-18.15 hrs<br />

Monday, 18 March 09.15-18.15 hrs<br />

First Aid<br />

There is a medical unit present for first aid on level<br />

S1 indicated on the directional signs with . In case<br />

of emergency, contact a security guard immediately<br />

or call +39 02 4342 7210. See also “Emergency Phone<br />

Numbers”.<br />

Guidelines<br />

<strong>EAU</strong> Extended guidelines<br />

The <strong>EAU</strong> extended urological guidelines edition <strong>2013</strong>,<br />

are distributed at the <strong>EAU</strong> Booth (booth H17 in the<br />

exhibition on level S0). Members can collect the<br />

guidelines free of charge. This publication is also<br />

available for purchase.<br />

<strong>EAU</strong> Pocket guidelines<br />

<strong>EAU</strong> urological guidelines in pocket format<br />

including a CD are distributed by Olympus (booth C01<br />

in the exhibition on level S0) to <strong>EAU</strong> members only.<br />

The distribution of the <strong>EAU</strong> Pocket Guidelines <strong>2013</strong> is<br />

supported by OLYMPUS<br />

Historical Exhibition<br />

The <strong>EAU</strong> History Office has set up an historical exhibit<br />

located at the <strong>EAU</strong> Booth (booth H17 in the exhibition<br />

on level S0). The exhibit will present “My other<br />

passion. The urologist as a collector”.<br />

Hospitality Suites Companies<br />

AMS Hospitality Suite 1; MiCo South<br />

Level S2<br />

ASTELLAS Gold View Lounge; MiCo South<br />

level S2<br />

COOK MEDICAL Panorama Lounge; MiCo South<br />

level S3<br />

TAKEDA Hospitality Suite 2; MiCo South<br />

Level S2<br />

SANOFI Hospitality Suite 3: MiCo South<br />

Level S2<br />

Hotel Accommodation<br />

The <strong>EAU</strong> has contracted the company K.I.T. Group<br />

GmbH to deal with the housing for the congress. K.I.T.<br />

staff will be available at the Hotel Desk in the<br />

registration area on level N0.<br />

Insurance<br />

The organisers do not accept responsibility for any<br />

personal damage. Participants are strongly<br />

recommended to arrange their own personal<br />

insurance.<br />

Internet Corners<br />

The <strong>EAU</strong> Internet Corners are at your disposal at<br />

different locations in the exhibition on level S0 (booth<br />

A22 and booth F54). The internet corners offer free use<br />

of internet and printers. See also “WiFi / Charge and<br />

Connect Area”.<br />

Language<br />

All presentations during the <strong>EAU</strong> Congress will be<br />

conducted in English, the official language of the <strong>EAU</strong>.<br />

There will be no translation provided.<br />

Learning Objectives <strong>EAU</strong> Congress<br />

The <strong>EAU</strong> Congress provides a forum for presenting<br />

original unpublished data and sharing ideas for<br />

urological innovation as well as disseminating<br />

evidence-based knowledge of primary clinical<br />

relevance.<br />

Urologists and affiliated professionals attending the<br />

<strong>EAU</strong> Congress will be able to:<br />

• Review innovative techniques and scientific<br />

advances in the field of urology and its sub-<br />

specialities<br />

• Review the latest data and emerging trends from<br />

studies in clinical and translational research<br />

• Enhance their knowledge of evidence-based<br />

approaches to the management of urological<br />

disease<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

43<br />

General


General<br />

General information<br />

• Gain new knowledge on emerging diagnostic and<br />

risk-assessment strategies in the management of<br />

urological disease<br />

• Enhance their practical knowledge and skills by<br />

educational activities, including hands-on-training<br />

and courses<br />

• Gain exposure to new developments in drugs<br />

and new cutting edge technology in the field of<br />

pharmaceutical research and medical technology<br />

through visiting the <strong>EAU</strong> Congress Exhibition<br />

• Communicate, collaborate and network with<br />

representatives of a large international<br />

audience – medical professionals, national<br />

urological societies, patient groups, medical<br />

industry and the media.<br />

Lost and Found<br />

Found items should be returned to the Information<br />

Desk in the main entrance hall on level N0. If you lose<br />

something, please report to this desk for assistance.<br />

Media Policy<br />

Photography, filming and interviews during the congress<br />

(with the exception of the <strong>EAU</strong> Press Centre and<br />

<strong>EAU</strong> Press Conference Room) are prohibited without<br />

written permission from the <strong>EAU</strong> Communication<br />

Officer Ms. Ivanka Moerkerken (i.moerkerken@uroweb.<br />

org).<br />

Mobile Phones<br />

Mobile phones must be switched off during all<br />

sessions.<br />

Personal Planner<br />

Do not miss anything during this year’s congress, use<br />

the <strong>EAU</strong> Personal Planner!<br />

• It is fully integrated with the scientific programme<br />

of the congress.<br />

• You can select your priority sessions and add your<br />

private appointments.<br />

• If you are presenting at the congress – your faculty<br />

appointments will be automatically displayed.<br />

• You can export it to your Outlook, Google Calendar<br />

or print it out.<br />

For more information, please visit the congress<br />

website: http://www.eaumilan<strong>2013</strong>.org/scientificprogramme/eau-personal-planner/<br />

Poster Builder Service<br />

Poster presenters who created their posters for the<br />

Milan Congress through the <strong>EAU</strong> Online Poster Builder<br />

Service, can collect their posters at the Speaker Service<br />

44 <strong>Programme</strong> <strong>Book</strong><br />

Centre on level N0.<br />

Poster DVD<br />

A DVD with a collection of scientific posters from the<br />

Milan Congress will be distributed by AMGEN (booth<br />

D20 in the exhibition on level S0).<br />

The <strong>EAU</strong> Poster DVD <strong>2013</strong> is supported by an unrestricted<br />

educational grant from AMGEN<br />

Prayer Room<br />

A special room dedicated to prayer is located on level<br />

S3 (follow the signage on this level).<br />

Presentation Training Centre<br />

Mr. Paul Casella (Iowa, USA) gives Individual<br />

Presentation Skills Training Sessions to help improve<br />

presentation and delivery skills. The one-on-one half<br />

hour sessions are free of charge and available to all<br />

speakers. Appointments for this very popular training<br />

session can be made at the Speaker Service Centre<br />

(level N0).<br />

Press Centre<br />

Journalists and medical/science writers can obtain<br />

free registration to the Congress. Journalists receive a<br />

press pack, to be collected at the <strong>EAU</strong> Press Centre in<br />

White Hall 1 on level N1. All press are invited to report<br />

to the <strong>EAU</strong> Press Centre to obtain the assistance and<br />

information they require. Internet access, printer and<br />

photocopier are provided.<br />

Resource Centre<br />

Urology Science and Learning<br />

The Resource Centre is a website<br />

(www.eauresourcecentre.org) that delivers <strong>EAU</strong><br />

content to users on-demand and allows to select<br />

content and webcasts of lectures and presentations<br />

that might otherwise be missed.<br />

Restaurant Reservations<br />

The choices for eating out in Milan are endlessly varied.<br />

Traditional Milanese cooking is made up of<br />

unpretentious but tasty dishes offered in numerous<br />

trattorias, inns and restaurants (including very luxury<br />

ones).<br />

Popular dishes are Risotto alla Milanese (made with a<br />

bull-bodied beef broth), Cassouela (an extremely<br />

filling meat dish with cabbage and other vegetables)<br />

and Cotoletta alla Milanese (a crunchy veal cutlet).<br />

Enjoy also an aperitif during ‘happy hour’, a ritual in<br />

Milan. The local classic is a Negroni, a potent blend of<br />

bitter Campari, gin, red Martini and ice. In many bars


and restaurants the aperitif is accompanied by tasty<br />

appetizers.<br />

To place your restaurant booking go to the Restaurant<br />

Reservations Desk in the registration area on level N0.<br />

Safety<br />

All bags may be subject to inspection. Security is<br />

present for your safety. Please take all personal effects<br />

with you when leaving a session room.<br />

Smoking Policy<br />

Smoking is prohibited inside the congress centre and<br />

in the exhibition area. An outside smoking area is<br />

available via an exit in the exhibition hall (level S0)<br />

between booth H01 and H02. Outside exhibition<br />

opening hours smoking is only allowed in front of the<br />

main entrance of the congress centre on level N0.<br />

Speaker Service Centre<br />

For extensive speaker information see page 46.<br />

Taxi Service<br />

There is a taxi rank available in front of the main<br />

entrance of the congress centre – Via Gattamelata 5<br />

(Gate 14).<br />

In order to book a taxi please go to the Milan Info &<br />

Excursions desk in the registration area (Level N0),<br />

they can guarantee the official rates are applied for the<br />

reservations made though them.<br />

Rates:<br />

- From the congress centre to airport Malpensa<br />

approx. € 90<br />

- From the congress centre to airport Linate<br />

approx. € 25/30<br />

If you wish to book a taxi in Milan by phone we<br />

recommend to call the following companies:<br />

Yellow Taxi: +39 02 69 69 or Radio Taxi +39 02 8585/<br />

+39 02 4040/+39 02 6969.<br />

It is also possible to book car transfers to the airports<br />

at the TBlu desk in the main entrance (level N0).<br />

Transportation Pass<br />

Congress delegates may collect a complimentary transportation<br />

pass in the registration area (level N0) which<br />

is valid for unlimited travels from 15-19 March <strong>2013</strong>.<br />

The pass covers underground, tram and bus within<br />

the city limits of Milan. The airport cannot be reached<br />

with this transportation pass. See also “Airport Shuttle<br />

Bus”.<br />

Upcoming Meetings<br />

Posters and other information on upcoming meetings<br />

can be displayed in the “Upcoming Meetings”<br />

promotion area on level N0. It is strictly forbidden to<br />

put up promotional material at any other location in<br />

the building.<br />

Video Library<br />

The <strong>EAU</strong> Video Library is located on South level S2, in<br />

the passage between North and South. A wide choice<br />

of <strong>EAU</strong> videos, including all videos presented in Milan<br />

and at previous <strong>EAU</strong> Congresses, can be viewed on<br />

individual monitors.<br />

All videos can be copied to a DVD which can be<br />

collected at the ASTELLAS booth during exhibition<br />

hours (booth C20 in the exhibition on level S0), a<br />

service that is provided free of charge to all congress<br />

delegates.<br />

On Tuesday 19 March DVD’s can be collected in the<br />

registration area.<br />

Video library hours:<br />

Friday, 15 March 12.00-18.00<br />

Saturday, 16 March 09.00-17.45<br />

Sunday, 17 March 09.00-17.45<br />

Monday, 18 March 09.00-17.45<br />

The Video Library is supported by an unrestricted<br />

educational grant from ASTELLAS<br />

Webcasts ( ) & Live Streams ( )<br />

Many sessions will be webcasted via<br />

www.eaumilan <strong>2013</strong>.org. The webcasted sessions are<br />

indicated with a special logo in the synopsis and will<br />

be online within several hours after the session.<br />

The webcasts have not been edited and are exactly as<br />

presented. The statements and the opinions featured<br />

in the webcasts are solely those of the individual<br />

presenters and not of the European Association of<br />

Urology (<strong>EAU</strong>). Webcasts are not accredited and no<br />

CME credits can be obtained by watching the webcasts.<br />

In addition to the webcasts there will be live streams<br />

of several sessions available at the congress website:<br />

www.eaumilan<strong>2013</strong>.org. These sessions are also indicated<br />

in the synopsis with a special logo.<br />

WiFi / Charge and Connect Area<br />

Free wireless internet will be available throughout the<br />

congress centre except in the exhibition areas. Please<br />

search for the “<strong>EAU</strong>” WiFi.<br />

A special “Charge and Connect Area” with tables and<br />

power outlets is available on level N1. The “Charge<br />

and Connect Area” allows you to recharge your laptops<br />

and phones while using WiFi.<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

45<br />

General


General<br />

Speaker guidelines<br />

Speaker Service Centre<br />

Only digital presentations will be accepted during the<br />

congress and all presentations should be handed in<br />

at least three hours prior to the start of the session<br />

at the Speaker Service Centre (Level 0 - North Wing).<br />

Failure to do so could result in presentations not being<br />

available for projection when required. If you have an<br />

early presentation, please hand in your presentation the<br />

previous day!<br />

Opening hours<br />

Thursday, 14 March 14.00 - 19.00<br />

Friday, 15 March 08.00 - 19.00<br />

Saturday, 16 March 07.00 - 19.30<br />

Sunday, 17 March 07.00 - 19.30<br />

Monday, 18 March 07.00 - 19.30<br />

Tuesday, 19 March 07.00 - 13.30<br />

If you are a chair person<br />

Locate your session room in time. Please be in your<br />

session room at least 15 minutes prior to the start of<br />

the session.<br />

Kindly note that:<br />

• Speakers should strictly observe timing.<br />

• Discussants should first clearly state their name,<br />

institution and country of origin.<br />

If you are presenting a poster<br />

Posters must be put up in the room 15 minutes prior<br />

to the start of the session. The poster boards are<br />

numbered and your poster should be mounted on the<br />

board which corresponds with your abstract number.<br />

Pushpins are available in the session room. Please<br />

remove your poster immediately at the end of the<br />

session. A maximum of 5 PowerPoint slides is allowed<br />

during extended poster presentation. For standard<br />

poster presentations, a maximum of 2 PowerPoint<br />

slides is allowed.<br />

Disclose links to the industry<br />

The <strong>EAU</strong> Scientific Congress Office requests that you<br />

disclose to the audience any links you may have with<br />

the industry related to the topic of your lecture at<br />

the beginning of your session. A link can be: Being a<br />

member of an advisory board or having a consultancy<br />

agreement with a specific company.<br />

Presentation Training Centre<br />

Mr. Paul Casella (Iowa, USA) gives Individual<br />

Presentation Skills Training Sessions to help improve<br />

presentation and delivery skills. The one-on-one half<br />

hour sessions are free of charge and available to all<br />

46 <strong>Programme</strong> <strong>Book</strong><br />

speakers. Please go to the Speaker Service Centre to<br />

make an appointment for this popular training session.


CME Accreditation<br />

Accreditation of the <strong>EAU</strong> Congress<br />

The request for the European accreditation of the 28th<br />

Annual <strong>EAU</strong> Congress will be submitted to the UEMS/<br />

EACCME.<br />

The ‘28th Annual <strong>EAU</strong> Congress’ is designated for<br />

a maximum of 27 hours of European external CME<br />

credits.<br />

Each medical specialist should claim only those hours<br />

of credit that he/she actually spent in the educational<br />

activity.<br />

CME credits<br />

The EACCME/EBU credit system is based on 1 ECMEC<br />

per hour with a maximum of 3 ECMECs for half a day<br />

and 6 ECMECs for a full-day event.<br />

Please scan your <strong>EAU</strong> congress badge when entering<br />

the lecture room to have CME credits registered automatically.<br />

The CME credit registration is carried out by<br />

the EUACME Office and during the congress you can<br />

find their desk at the registration area.<br />

CME credits per Country<br />

The EBU/EACCME CME credits are recognised by most<br />

of the national CME authorities in Europe, which have<br />

agreed to cooperate in this European system.<br />

All CME activities approved by the EBU/EACCME<br />

are recognised in the following countries: Austria,<br />

Belgium, Cyprus, Czech Republic, Finland (ProMedico),<br />

Georgia, Greece, Hungary, Ireland, Luxembourg, Malta,<br />

The Netherlands, Norway, Italy (Region Lombardia),<br />

Romania, Slovakia, Slovenia, Spain, Sweden (IPULS),<br />

Turkey and United Kingdom.<br />

CME credits per Speciality<br />

All CME activities approved by the EBU/EACCME are<br />

recognised in the following specialities: Dermatology<br />

and Venerology, Paediatric Surgery, Physical and<br />

Rehabilitation Medicine, Anaesthesiology, Child<br />

and Adolescent Psychiatry and Psychotherapy,<br />

Endocrinology, Geriatrics, Intensive Care (MJC),<br />

Internal Medicine, Neurology, Neurosurgery, Nuclear<br />

Medicine, Oral and Maxillofacial Surgery, Pathology,<br />

Plastic Surgery, Cardiology (EBAC), Sports Medicine<br />

(MJC), Genetics (MJC), Emergency Medicine (MJC),<br />

Microbiology, Hand Surgery (MJC), Pneumology<br />

(EBAP), Infectious Diseases (EBAID), Surgery, Urology,<br />

Oncology (ACCO), Vascular Surgery, Gastroenterology,<br />

Allergology.<br />

If your country or speciality is not listed above please<br />

either contact the EU-ACME Office for more information<br />

or send a copy of the attendance certificate to<br />

your National Urological Society and/or National<br />

Accreditation Body.<br />

CME credits outside Europe<br />

Through an agreement between the European Union<br />

of Medical Specialists and the American Medical<br />

Association, physicians may convert EACCME<br />

credits to an equivalent number of AMA PRA Category<br />

1 Credits. Information on the process to convert<br />

EACCME credit to AMA credit can be found at<br />

www.ama-assn.org/go/internationalcme.<br />

If you attended a conference in Europe and received<br />

a certificate for EACCME credit you can convert it to<br />

the AMA PRA Category 1 Credit. To receive the credit,<br />

the conference must appear on the list of approved<br />

activities posted in the EACCME section of the UEMS<br />

Website.<br />

To apply for conversion of EACCME credit to AMA PRA<br />

Category 1 Credit, download the Application for<br />

EACCME Credit Conversion and submit the completed<br />

application by fax or mail, a copy of the EACCME credit<br />

certificate and appropriate processing fee. A certificate<br />

of AMA PRA Category 1 Credit will be mailed within<br />

four weeks.<br />

If you wish to receive information about the conversion<br />

procedure of EACCME credits to AMA PRA category 1<br />

credits, please contact the AMA.<br />

Live educational activities, occurring outside of<br />

Canada, recognised by the UEMS-EACCME for ECMEC<br />

credits are deemed to be Accredited Group Learning<br />

Activities (Section 1) as defined by the Maintenance<br />

of Certification Program of The Royal College of<br />

Physicians and Surgeons of Canada.<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

47<br />

General


General<br />

EU-ACME <strong>Programme</strong><br />

The EU-ACME <strong>Programme</strong> - the initiative resulting<br />

from a close collaboration between the European<br />

Board of Urology (EBU) and the European Association<br />

of Urology (<strong>EAU</strong>) - stands for European Urology -<br />

Accredited Continuing Medical Education. Its primary<br />

task is assistance in the implementation, promotion<br />

and organization of Continuing Medical Education<br />

(CME) and Continuing Professional Development (CPD)<br />

among European urologists. Urologists have access to<br />

an online system - in compliance with the EBU/UEMS<br />

regulations - which helps them to keep track of their<br />

educational activities, irrespective of the country they<br />

practice in or where they have participated in<br />

accredited CME/CPD activities.<br />

CME/CPD activities are generally geared towards<br />

practising physicians and are designed to provide<br />

information that is both relevant and essential to<br />

medical practice.<br />

The EU-ACME office acts as a central ‘institution’<br />

where all information forwarded by urologists, (inter)<br />

national urological associations and CME organisers/<br />

providers is kept.<br />

As a service institution the EU-ACME office offers:<br />

• registration of credit points for members of the<br />

urological society participating in the EU ACME<br />

programme,<br />

• access to the online CME/CPD credit system via<br />

webpage www.eu-acme.org,<br />

• the EU ACME membership card for urologist participating<br />

in the programme,<br />

• yearly Credit Registry Report listing all collected<br />

CME/CPD credit points,<br />

• registration of accredited on national and/or<br />

European level CME events,<br />

• assistance in obtaining European Accreditation.<br />

48 <strong>Programme</strong> <strong>Book</strong><br />

The international urological societies as European<br />

Association of Urology, European Society of Paediatric<br />

Urology and International Continence Society as well<br />

as national urological societies from: Austria, Czech<br />

Republic, Cyprus, Denmark, Egypt, Estonia, Greece,<br />

Hungary, Italy, Latvia, Malta, The Netherlands, Poland,<br />

Portugal, Romania, Serbia, Slovakia, Slovenia, Spain<br />

have already joined the programme. For more information,<br />

please visit the website: www.eu-acme.org.<br />

Information on the EU-ACME programme, your<br />

acquired CME/CPD credits and membership cards can<br />

be obtained at the EU-ACME information desk in the<br />

registration are.


Congress hotels<br />

AC Milano<br />

Via Tazzoli, 2<br />

20154 Milan<br />

T +39 0220424211<br />

F +39 0220424212<br />

www.ac-hotels.com<br />

Metro M2 Garibaldi<br />

Adi Hotel Poliziano<br />

Fiera<br />

Via Poliziano, 11<br />

20154 Milan<br />

T +39 023191911<br />

F +39 023191931<br />

www.hotelpolizianofiera.it<br />

1.1 km walking distance<br />

Admiral Hotel<br />

Via Domodossola, 16<br />

20145 Milan<br />

T +39 023492151<br />

F +39 0233106660<br />

www.admiralhotel.it<br />

0.5 km walking distance<br />

Antares Hotel<br />

Accademia<br />

Viale Certosa, 68<br />

20155 Milan<br />

T +39 0239211122<br />

F +39 0233103878<br />

www.antareshotels.com<br />

1.7 km walking distance<br />

Antares Hotel Milan<br />

Rubens<br />

Via Rubens, 21<br />

20148 Milan<br />

T +39 0240302<br />

F +39 0248193114<br />

www.antareshotels.com<br />

Metro M1 De Angeli<br />

Art Hotel Navigli<br />

Via Angelo Fumagalli, 4<br />

20143 Milan<br />

T +39 0289438<br />

F +39 0258115066<br />

www.arthotelnavigli.com<br />

Metro M2 Porta Genova<br />

ATA Hotel Executive<br />

Viale Luigi Sturzo, 45<br />

20154 Milan<br />

T +39 02895261<br />

F +39 0229010238<br />

www.atahotels.it<br />

Metro M2 Garibaldi<br />

ATA Hotel Expo Fiera<br />

Via Giovanni Keplero, 12<br />

20016 Milan<br />

T +39 02895261<br />

F +39 023535959<br />

www.atahotels.it<br />

Metro M1 Pero<br />

ATA Hotel Quark<br />

Via Lampedusa, 11/3<br />

20141 Milan<br />

T +39 02895262<br />

F +39 028464190<br />

www.atahotels.it<br />

Metro M2 Abbiategrasso<br />

Atlantic Quality Hotel<br />

Via Torriani Napo, 24<br />

20124 Milan<br />

T +39 026691941<br />

F +39 026691833<br />

www.hotelatlanticmilan.com<br />

Metro M2 Centrale<br />

Auriga Hotel<br />

Via Giovanni Battista Pirelli, 7<br />

20124 Milan<br />

T +39 0266985851<br />

F +39 0266980698<br />

www.auriga-milano.com<br />

Metro M2 Centrale<br />

Best Western Astoria<br />

Hotel<br />

Viale Murillo, 9<br />

20149 Milan<br />

T +39 0240090095<br />

F +39 0240074642<br />

www.astoriahotelmilano.com<br />

1.6 km walking distance<br />

Best Western<br />

Cristoforo Colombo<br />

Hotel<br />

Corso Buenos Aires, 3<br />

20124 Milan<br />

T +39 0229406214<br />

F +39 0229516096<br />

www.hotelcristoforocolombo.com<br />

Metro M1 Porta Venezia<br />

Best Western Felice<br />

Casati Hotel<br />

Via Felice Casati, 18<br />

20124 Milan<br />

T +39 0229404208<br />

F +39 0229404618<br />

www.hotelfelicecasati.com<br />

Metro M1 Lima<br />

Best Western Galles<br />

Hotel<br />

Piazza Lima, 2<br />

20124 Milan<br />

T +39 02204841<br />

F +39 022048422<br />

www.galles.it<br />

Metro M1 Lima<br />

Best Western Madison<br />

Hotel<br />

Via Leopoldo Gasparotto, 8<br />

20124 Milan<br />

T +39 0267074150<br />

F +39 0267075059<br />

www.madisonhotelmilano.com<br />

Metro M3 Sondrio<br />

Best Western Major<br />

Hotel<br />

Viale Isonzo, 2<br />

<strong>2013</strong>5 Milan<br />

T +39 0255188335<br />

F +39 0255183140<br />

www.bwhotelmajor-mi.it<br />

Metro M3 Lodi TIBB<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

49<br />

General


General<br />

Congress hotels<br />

Best Western Mozart<br />

Hotel<br />

Piazza Gerusalemme, 6<br />

20154 Milan<br />

T +39 0233104215<br />

F +39 0233103231<br />

www.hotelmozartmilan.com<br />

1.1 km walking distance<br />

Capitol World Class<br />

Hotel<br />

Via Domenico Cimarosa, 6<br />

20144 Milan<br />

T +39 02438591<br />

F +39 02438591<br />

www.hotelcapitolmilano.com<br />

Metro M1 Pagano<br />

Carrobbio Hotel<br />

Via Medici, 3<br />

20123 Milan<br />

T +39 0289010740<br />

F +39 028053334<br />

www.hotelcarrobbiomilano.com<br />

Metro M3 Italia Missori<br />

Cavour Hotel<br />

Via Fatebenefratelli, 21<br />

20121 Milan<br />

T +39 02620001<br />

F +39 026592263<br />

www.hotelcavour.it<br />

Tram 61 Via Fatebenefratelli<br />

C.so di P.ta Nuova<br />

Crowne Plaza Milan<br />

City<br />

Via Melchiorre Gioia, 73<br />

20124 Milan<br />

T +39 0266717715<br />

F +39 0266703483<br />

www.crowneplazamilan.com<br />

Metro M3 Sondrio<br />

Dei Cavallieri Duomo<br />

Hotel<br />

Piazza Missori, 1<br />

20123 Milan<br />

T +39 0288571<br />

F +39 0272021683<br />

www.hoteldeicavalieri.com<br />

Metro M3 San Donato<br />

50 <strong>Programme</strong> <strong>Book</strong><br />

Doria Grand Hotel<br />

Viale Andrea Doria, 22<br />

20124 Milan<br />

T +39 0267411411<br />

F +39 026696669<br />

www.doriagrandhotel.it<br />

Metro M2 Caiazzo<br />

DoubleTree by Hilton<br />

Hotel Milan<br />

Via Ludovico di Breme, 77<br />

20156 Milan<br />

T +39 02928831<br />

F +39 0292883883<br />

www.hotel-cosmopolita.com<br />

Tram 14 Vle Certosa Via Casella<br />

Enterprise Hotel<br />

Corso Sempione, 91<br />

20149 Milan<br />

T +39 0231818 1<br />

F +39 0231818811<br />

www.enterprisehotel.com<br />

1 km walking distance<br />

Four Points by<br />

Sheraton Milan<br />

Via Gerolamo Cardano, 1<br />

20124 Milan<br />

T +39 0231818 811<br />

F +39 0231818 398<br />

www.fourpointsmilan.com<br />

Metro M2 Goioa<br />

Grand Visconti Palace<br />

Viale Isonzo, 14<br />

<strong>2013</strong>5 Milan<br />

T +39 02540341<br />

F +39 0254069523<br />

www.grandviscontipalace.com<br />

Metro M3 Lodi TIBB<br />

Hermitage Hotel<br />

Via Messina, 10<br />

20154 Milan<br />

T +39 02318170<br />

F +39 0233107399<br />

www.monrifhotels.it<br />

Metro M2 Moscova<br />

Hilton Milan<br />

Via Luigi Galvani, 12<br />

20124 Milan<br />

T +39 0269831<br />

F +39 0266531<br />

www.hilton.com<br />

Metro M2 Gioia<br />

Holiday Inn Milan<br />

Garibaldi Station<br />

Via Ugo Bassi, 1/A<br />

20159 Milan<br />

T +39 026076801<br />

F +39 026880764<br />

www.holidayinn.com<br />

Metro M2 Garibaldi<br />

Hotel Johnny<br />

Via Giovanni Prati, 6<br />

20145 Milan<br />

T +39 02341812<br />

F +39 0233610521<br />

www.hoteljohnny.com<br />

0.6 km walking distance<br />

Ibis Milano Ca’Granda<br />

Viale Giovanni Suzzani, 13<br />

20162 Milan<br />

T +39 0266103000<br />

F +39 0266102797<br />

www.accorhotels.com<br />

Tram 51 V.le Suzzani V.le Berbera<br />

Ibis Milano Centro<br />

Via Camillo Finocchiaro Aprile, 2<br />

20124 Milan<br />

T +39 0263151<br />

F +39 026598026<br />

www.ibishotel.com<br />

Metro M3 Republica<br />

Marriott Milan<br />

Via Washington, 66<br />

20146 Milan<br />

T +39 0248521<br />

F +39 024818925<br />

www.marriott.com<br />

Metro M1 Wagner


Mediolanum Hotel<br />

Via Mauro Macchi, 1<br />

20124 Milan<br />

T +39 026705312<br />

F +39 0266981921<br />

www.mediolanumhotel.com<br />

Metro M3 Republica<br />

Melia Milano<br />

Via Tommaso Masaccio, 19<br />

20149 Milan<br />

T +39 0244406<br />

F +39 0244406600<br />

www.melia-milano.com<br />

1.1 km walking distance<br />

Mini Hotel La Spezia<br />

Via la Spezia, 25<br />

20142 Milan<br />

T +39 0284800660<br />

F +39 0236504276<br />

www.hotellaspeziamilano.it<br />

Metro M2 Famagosta<br />

Mini Hotel Portello<br />

Via G. Silva, 12<br />

20149 Milan<br />

T +39 024814944<br />

F +39 024819243<br />

www.hotelportellomilano.it<br />

Metro M1 Lotto Fiera<br />

Mini Hotel Tiziano<br />

Via Tiziano, 6<br />

20145 Milan<br />

T +39 024699035<br />

F +39 024812153<br />

www.hoteltizianomilano.it<br />

Metro M1 Buonarroti<br />

Mirage Hotel<br />

Viale Certosa, 104/106<br />

20156 Milan<br />

T +39 0239210471<br />

F +39 0239210589<br />

www.hotelmirage-milano.com<br />

2.1 km walking distance<br />

Nasco Hotel<br />

Corso Sempione, 69<br />

20149 Milan<br />

T +39 0231951<br />

F +39 0231952777<br />

www.hotelnascomilano.it<br />

0.8 km walking distance<br />

NH Fiera Milano<br />

Viale degli Alberghi s/n<br />

20017 Milan<br />

T +39 02300371<br />

F +39 02300300<br />

www.nh-hotels.com<br />

Metro M1 Rho Feira<br />

NH Grand Hotel Verdi<br />

Via Melchiorre Gioia, 6<br />

20124 Milan<br />

T +39 0262371<br />

F +39 02300300<br />

www.nh-hotels.com<br />

Metro M2 Gioia<br />

NH Machiavelli<br />

Via Lazzaretto, 5<br />

20124 Milan<br />

T +39 02631141<br />

F +39 02300300<br />

www.nh-hotels.com<br />

Metro M1 Porta Venezia<br />

NH Milano Touring<br />

Via Ugo Tarchetti, 2<br />

20121 Milan<br />

T +39 0263351<br />

F +39 02300300<br />

www.nh-hotels.com<br />

Metro M3 Repubblica<br />

NH President<br />

Largo Augusto, 10<br />

20122 Milan<br />

T +39 0277461<br />

F +39 02300300<br />

www.nh-hotels.com<br />

Metro M1 San Babila<br />

Nhow Milano<br />

Via Tortona, 35<br />

20144 Milan<br />

T +39 024898861<br />

F +39 02300300<br />

www.nh-hotels.com<br />

Metro M2 Porta Genova<br />

Novotel Milano<br />

Ca’Granda<br />

Viale Suzzani, 13<br />

20162 Milan<br />

T +39 02641151<br />

F +39 0266101961<br />

www.novotel.com<br />

Metro M3 Maciachini<br />

Palazzo Delle Stelline<br />

Hotel<br />

Corso Magenta, 61<br />

20123 Milan<br />

T +39 024818431<br />

F +39 0248519097<br />

www.hotelpalazzostelline.it<br />

Metro M1 Conciliazione<br />

Radisson Blu Hotel<br />

Milan<br />

Via Villapizzone, 24<br />

20156 Milan<br />

T +39 023631888<br />

F +39 023631870<br />

www.radissonblu.com<br />

Metro M1 QT8<br />

Raffaello Hotel<br />

Viale Certosa, 108<br />

20156 Milan<br />

T +39 02392431<br />

F +39 02392235<br />

www.hotel-raffaello.it<br />

2.3 km walking distance<br />

Ramada Plaza<br />

Via Stamira D’Ancona, 27a<br />

20127 Milan<br />

T +39 02288541<br />

F +39 02282563<br />

www.ramadaplazamilano.it<br />

metro M1 Turro<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

51<br />

General


General<br />

Congress hotels<br />

Regency Milan Hotel<br />

Via G. Arimondi, 12<br />

20155 Milan<br />

T +39 0239216021<br />

F +39 0239217734<br />

www.regency-milano.com<br />

1.5 km walking distance<br />

Regina Hotel<br />

Via Cesare Correnti, 13<br />

20123 Milan<br />

T +39 0258106913<br />

F +39 0258106563<br />

www.hotelregina.it<br />

Metro M2 Sant Ambrogio<br />

Royal Garden Hotel<br />

Via G. Di Vittorio<br />

20090 Milan<br />

T +39 02457811<br />

F +39 0245702901<br />

www.monrifhotels.it<br />

Metro M2 Famagosta<br />

Sanpi Milano Hotel<br />

Via Lazzaro Palazzi, 18<br />

20124 Milan<br />

T +39 0229513341<br />

F +39 0229402451<br />

www.hotelsanpimilano.it<br />

Metro M1 Porta Venezia<br />

Sheraton Diana<br />

Majestic<br />

Viale Piave, 42<br />

20129 Milan<br />

T +39 0220581<br />

F +39 0220545<br />

www.sheratondianamajestic.com<br />

Metro M1 Porta Venezia<br />

Starhotels Anderson<br />

Hotel<br />

Piazza Luigi di Savoia, 20<br />

20124 Milan<br />

T +39 026690141<br />

F +39 026690331<br />

www.starhotels.com<br />

Metro M2 Centrale<br />

52 <strong>Programme</strong> <strong>Book</strong><br />

Starhotels E.C.H.O<br />

Viale Andrea Doria, 4<br />

20124 Milan<br />

T +39 0267891<br />

F +39 0266713369<br />

www.starhotels.com<br />

Metro M2 Caiazzo<br />

Starhotels Ritz<br />

Via Spallanzani, 40<br />

20129 Milan<br />

T +39 0220551<br />

F +39 0229518679<br />

www.starhotels.com<br />

Metro M1 Lima<br />

Starhotels Rosa Grand<br />

Piazza Fontana, 3<br />

20122 Milan<br />

T +39 0288311<br />

F +39 028057964<br />

www.starhotels.com<br />

Metro M1 Duomo<br />

Sunflower<br />

Piazzale Lugano, 10<br />

20158 Milan<br />

T +39 0239314071<br />

F +39 0239320377<br />

www.hotelsunflower.it<br />

Tram 91 P.le Lugano<br />

The Hub Hotel<br />

Via Privata Polonia, 10<br />

20157 Milan<br />

T +39 0278627000<br />

F +39 0278627070<br />

www.thehubhotel.com<br />

Tram 560 Stephenson - Polonia<br />

The Westin Palace<br />

Piazza della Repubblica, 20<br />

20124 Milan<br />

T +39 0263361<br />

F +39 02654485<br />

www.westinpalacemilan.com<br />

Metro M3 Repubblica<br />

UNA Hotel Century<br />

Via Fabio Filzi, 25/B<br />

20124 Milan<br />

T +39 02675041<br />

F +39 0266980602<br />

www.unahotels.it<br />

Metro M2 Centrale<br />

UNA Hotel Cusani<br />

Via Cusani, 13<br />

20121 Milan<br />

T +39 0285601<br />

F +39 028693601<br />

www.unahotels.it<br />

Metro M1 Cairoli<br />

UNA Hotel<br />

Mediterraneo<br />

Via L. Muratori, 14<br />

<strong>2013</strong>5 Milan<br />

T +39 02550071<br />

F +39 02550072217<br />

www.unahotels.it<br />

Metro M3 Porta Romana<br />

UNA Hotel<br />

Scandinavia<br />

Via G.B. Fauché, 15<br />

20154 Milan<br />

T +39 02336391<br />

F +39 0233104510<br />

www.unahotels.it<br />

2.0 km walking distance<br />

UNA Hotel Tocq<br />

Via A. De Tocqueville, 7/D<br />

20154 Milan<br />

T +39 0262071<br />

F +39 026570780<br />

www.unahotels.it<br />

Metro M2 Garibaldi<br />

Uptown Palace<br />

Via Santa Sofia, 10<br />

20122 Milan<br />

T +39 02305131<br />

F +39 0230513333<br />

www.uptownpalace.com<br />

Metro M3 Crocetta


Friday, 15 March - <strong>EAU</strong> <strong>Programme</strong><br />

Special Session<br />

09.00 - 16.15 International Conference on Prostate Cancer Prevention <strong>2013</strong> with<br />

Consensus Conference on Chemoprevention of Prostate Cancer<br />

Amber Hall 7-8 - Level S2<br />

09.00 - 10.30 Session 1: Scientific considerations in prostate cancer prevention<br />

Chair: P. Brown, Houston (US)<br />

09.00 - 09.15 Biology and natural history of prostate cancer - Overview<br />

L. Holmberg, Uppsala (SE)<br />

09.15 - 10.30 Risk prediction: Biomarkers<br />

09.15 - 09.30 Serum Kallikrein markers<br />

H.G. Lilja, New York (US)<br />

09.30 - 09.45 Urinary PCA3<br />

H. Rittenhouse, Los Osos (US)<br />

09.45 - 10.00 TMPRSS2-ERG<br />

S. Perner, Bonn (DE)<br />

10.00 - 10.15 Non-PCA3 urinary biomarkers<br />

J.A. Schalken, Nijmegen (NL)<br />

10.15 - 10.30 GWAS<br />

R.A. Eeles, London (GB)<br />

10.30 - 10.45 Break<br />

10.45 - 11.15 Session 2: Early detection<br />

Chair: A. Stenzl, Tübingen (DE)<br />

10.45 - 11.00 Screening - Current status (ERSPC)<br />

F.H. Schröder, Rotterdam (NL)<br />

11.00 - 11.15 Screening - Current status (PLCO)<br />

G. Andriole, St. Louis (US)<br />

11.15 - 12.15 Session 3: Prognosis and management of low grade disease<br />

Chair: C. Parker, London (GB)<br />

11.15 - 11.30 Cell cycle progression markers<br />

J. Cuzick, London (GB)<br />

11.30 - 11.45 Distinguishing aggressive from indolent prostate cancer<br />

Z. Culig, Innsbruck (AT)<br />

11.45 - 12.00 Management of Gleason 6 (PIVOT)<br />

T.J. Wilt, Minneapolis (US)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

53<br />

Friday


Friday<br />

12.00 - 12.15 Management of Gleason 6<br />

B. Tombal, Brussels (BE)<br />

12.15 - 13.15 Session 4: Review of chemoprevention trials<br />

54 <strong>Programme</strong> <strong>Book</strong><br />

Chair: L. Minasian, Bethesda (US)<br />

12.15 - 12.45 Outlook for 5a reductase inhibitors<br />

Finasteride/Dutasteride<br />

12.15 - 12.30 Review of data and European perspective<br />

M. Marberger, Vienna (AT)<br />

12.30 - 12.45 Review of data and North American perspective<br />

O.W. Brawley, Atlanta (US)<br />

12.45 - 13.00 Vitamin E and Selenium - SELECT trial<br />

L. Ford, Bethesda (US)<br />

13.00 - 13.15 Other chemoprevention trials<br />

H. Parnes, Bethesda (US)<br />

13.15 - 14.15 Lunch and poster viewing / meet the faculty<br />

14.15 - 15.45 Session 5: Prostate cancer: Chemoprevention - Novel agents<br />

Chair: F. Meyskens, Irvine (US)<br />

14.15 - 14.30 Bisphosphonates<br />

G. Rennert, Haifa (IL)<br />

14.30 - 14.45 Polyamines and DFMO<br />

F. Meyskens, Irvine (US)<br />

14.45 - 15.00 Lycopene<br />

D. Illic, Melbourne (AU)<br />

15.00 - 15.15 Aspirin, NSAIDs and COX2<br />

P. Rothwell, Oxford (GB)<br />

15.15 - 15.30 Antioxidants and nutrition (EPIC)<br />

T. Key, Oxford (GB)<br />

15.30 - 15.45 Lifestyle and dietary factors<br />

A. Wolk, Stockholm (SE)


15.45 - 16.15 Session 6: Panel discussion: Current policy for prostate cancer screening and chemoprevention<br />

Chair: O.W. Brawley, Atlanta (US)<br />

P. Brown, Houston (US)<br />

G. Gordon, Abbott Park, IL (US)<br />

F.C. Hamdy, Oxford (GB)<br />

F. Meyskens, Irvine (US)<br />

L. Minasian, Bethesda (US)<br />

C. Parker, London (GB)<br />

H. Parnes, Bethesda (US)<br />

F.H. Schröder, Rotterdam (NL)<br />

H-P. Schmid, St. Gallen (CH)<br />

R. Smith, Atlanta (US)<br />

B.J. Schmitz-Dräger, Fürth (DE)<br />

A. Stenzl, Tübingen (DE)<br />

CME Accreditation<br />

The conference has been awarded 9 credit points for continuing medical education by ACOE (Accreditation<br />

Council of Oncology in Europe) and has been granted European endorsement by the UEMS (European Union<br />

of Medical Specialists) clearing house system, the EACCME and awarded 9 European Continuing Medical<br />

Education Credits (ECMEC). An accreditation of the UEMS (EACCME) is also recognised by the AMA (American<br />

Medical Association) and the PRA (Physicians Recognition Award) in the US as well as by the respective<br />

accreditation boards in China and Japan.<br />

Co-sponsored by ISCaP, <strong>EAU</strong>, National Cancer Institute (USA), Cancer Research UK, Prostate Cancer UK, AICR<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

55<br />

Friday


Friday<br />

Friday, 15 March - <strong>EAU</strong> <strong>Programme</strong><br />

56 <strong>Programme</strong> <strong>Book</strong><br />

Urology beyond Europe<br />

10.30 - 13.00 Joint Session of the European Association of Urology (<strong>EAU</strong>) and the<br />

Chinese Urological Association (CUA)<br />

Brown Hall 1-2 - Level S2<br />

Chairs: C.R. Chapple, Sheffield (GB)<br />

L-P. Xie, Hangzhou (CN)<br />

10.30 - 11.20 Session 1: Endoscopic management of complex renal calculi<br />

10.30 - 10.45 PCNL combined RIRS for complex renal calculi<br />

G-H. Zeng, Guangzhou (CN)<br />

10.45 - 11.00 Retrograde flexible ureteroscopy for complex renal calculus: Current concepts and future directions<br />

O. Traxer, Paris (FR)<br />

11.00 - 11.20 Discussion<br />

11.20 - 12.10 Session 2: Reconstructive urology<br />

11.20 - 11.35 One stage oral mucosal graft urethroplasty for treatment of male anterior urethral strictures: A ten-year<br />

study from a single centre<br />

Y.L. Sa, Shanghai (CN)<br />

11.35 - 11.50 Substitution urethroplasty: Current concepts and future directions - A review of the conclusions of the<br />

International Consultation of Urethral Stricture Disease<br />

C.R. Chapple, Sheffield (GB)<br />

11.50 - 12.10 Discussion<br />

12.10 - 13.00 Session 3: Recent developments relating to surgery for benign prostatic hyperplasia<br />

12.10 - 12.25 Transurethral vapour enucleation and resection of the prostate with a plasma button electrode: A new<br />

technique<br />

L-P. Xie, Hangzhou (CN)<br />

12.25 - 12.40 Laser prostatectomy: Has this come of age?<br />

O. Reich, Munich (DE)<br />

12.40 - 13.00 Discussion


Friday, 15 March - <strong>EAU</strong> <strong>Programme</strong><br />

Urology beyond Europe<br />

10.30 - 13.00 Joint Session of the European Association of Urology (<strong>EAU</strong>) and the<br />

Korean Urological Association (KUA)<br />

Brown Hall 3 - Level S2<br />

Chairs: D. Jacqmin, Strasbourg (FR)<br />

G.T. Sung, Busan (KR)<br />

10.30 - 10.35 Introduction<br />

S.W. Han, Seoul (KR)<br />

D. Jacqmin, Strasbourg (FR)<br />

10.35 - 11.25 Session 1: Small renal masses<br />

Moderators: J. Cheon, Seoul (KR)<br />

D. Jacqmin, Strasbourg (FR)<br />

10.35 - 10.55 Surgery or surveillance<br />

D.D. Kwon, Gwangju (KR)<br />

10.55 - 11.15 Percutaneous ablative therapy<br />

A. Gangi, Strasbourg (FR)<br />

11.15 - 11.25 Clinical cases<br />

11.25 - 12.05 Session 2: LUTS<br />

Case presenter: S.I. Seo, Seoul (KR)<br />

Panel: B.H. Chung, Seoul (KR)<br />

A. Gangi, Strasbourg (FR)<br />

D.D. Kwon, Gwangju (KR)<br />

Moderators: M.K. Chung, Yangsan (KR)<br />

J.M.O. N’Dow, Aberdeen (GB)<br />

11.25 - 11.45 Medical management of LUTS<br />

J.M.O. N’Dow, Aberdeen (GB)<br />

11.45 - 12.05 Surgical management of LUTS<br />

D.K. Kim, Daejeon (KR)<br />

12.05 - 12.55 Session 3: Hormone refractory prostate cancer<br />

Moderators: J. Bellmunt, Barcelona (ES)<br />

G.T. Sung, Busan (KR)<br />

12.05 - 12.25 What is the evidence?<br />

S.J. Hong, Seoul (KR)<br />

12.25 - 12.45 What is the best sequence?<br />

B. Tombal, Brussels (BE)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

57<br />

Friday


Friday<br />

12.45 - 12.55 Clinical cases<br />

58 <strong>Programme</strong> <strong>Book</strong><br />

Case presenter: D-H. Seong, Incheon (KR)<br />

Panel: S.J. Hong, Seoul (KR)<br />

C. Kim, Seoul (KR)<br />

B. Tombal, Brussels (BE)<br />

12.55 - 13.00 Closing remarks<br />

S.W. Han, Seoul (KR)<br />

D. Jacqmin, Strasbourg (FR)


Friday, 15 March - <strong>EAU</strong> <strong>Programme</strong><br />

Urology beyond Europe<br />

10.30 - 13.00 Joint Session of the European Association of Urology (<strong>EAU</strong>) and the<br />

Urological Society of India (USI)<br />

Amber Hall 1-2 - Level S2<br />

Chairs: R. Meyyappan, Chennai (IN)<br />

A. Patel, London (GB)<br />

10.30 - 10.35 Introduction<br />

R. Meyyappan, Chennai (IN)<br />

A. Patel, London (GB)<br />

10.35 - 10.55 Turning the page - Past, present and future of urological journals in Europe and India<br />

Moderators: R. Meyyappan, Chennai (IN)<br />

A. Patel, London (GB)<br />

10.35 - 10.45 IJU perspective<br />

N. Kekre, Vellore Tamilnadu (IN)<br />

10.45 - 10.55 European Urology Today perspective<br />

M. Wirth, Dresden (DE)<br />

10.55 - 11.25 Renal disease management<br />

Moderators: T. Esen, Istanbul (TR)<br />

R. Meyyappan, Chennai (IN)<br />

10.55 - 11.10 European perspectives: Management of the small renal mass<br />

A. Volpe, Novara (IT)<br />

11.10 - 11.25 Indian perspective: Minimally invasive management of renal calculus disease in anomalous kidneys and in<br />

patients with musculo-skeletal deformities<br />

A. Srivastava, Lucknow (IN)<br />

11.25 - 12.05 Young Urologists Challenge<br />

Panel: M.R. Desai, Naidad (IN)<br />

T. Esen, Istanbul (TR)<br />

N. Kekre, Vellore Tamilnadu (IN)<br />

F.H. Schröder, Rotterdam (NL)<br />

11.25 - 11.35 High grade non-muscle invasive bladder cancer - role of second TURBT<br />

F. Sridhar, Ludhiana (IN)<br />

11.35 - 11.45 MRI guided focal cryo therapy: Salvage after failed radiotherapy<br />

J.P.M. Sedelaar, Nijmegen (NL)<br />

11.45 - 11.55 Emphysematous pyelonephritis<br />

P. Hariharan, Puducherry (IN)<br />

11.55 - 12.05 Is there a place for bladder screening?<br />

S. Larré, Reims (FR)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

59<br />

Friday


Friday<br />

12.05 - 12.30 Words of Wisdom lecture 1: Percutaneous renal stone management - Evolution and current status,<br />

challenges, future prospects?<br />

M.R. Desai, Naidad (IN)<br />

12.30 - 12.55 Words of Wisdom lecture 2: PSA based prostate cancer screening - Current status, challenges, future<br />

prospects?<br />

F.H. Schröder, Rotterdam (NL)<br />

12.55 - 13.00 Conclusion<br />

R. Meyyappan, Chennai (IN)<br />

A. Patel, London (GB)<br />

60 <strong>Programme</strong> <strong>Book</strong>


Friday, 15 March - <strong>EAU</strong> <strong>Programme</strong><br />

Urology beyond Europe<br />

10.30 - 13.00 Joint Session of the European Association of Urology (<strong>EAU</strong>) and the<br />

Iranian Urological Association (IUA)<br />

Red Hall 1 - Level N1<br />

Chairs: W. Artibani, Verona (IT)<br />

S.J. Hosseini, Tehran (IR)<br />

10.30 - 10.35 Introduction<br />

W. Artibani, Verona (IT)<br />

S.J. Hosseini, Tehran (IR)<br />

10.35 - 11.10 Prostate cancer<br />

Moderators: W. Artibani, Verona (IT)<br />

S.J. Hosseini, Tehran (IR)<br />

10.35 - 10.50 How to manage high risk prostate cancer<br />

A. Briganti, Milan (IT)<br />

10.50 - 11.10 Interactive case discussion<br />

S. Shakeri, Shiraz (IR)<br />

M. Ayati, Tehran (IR)<br />

11.10 - 11.45 Muscle-invasive bladder cancer<br />

Moderators: W. Artibani, Verona (IT)<br />

S.J. Hosseini, Tehran (IR)<br />

11.10 - 11.25 Contemporary management of muscle-invasive bladder cancer<br />

B. Djavan, Vienna (AT)<br />

11.25 - 11.45 Interactive case discussion<br />

A. Basiri, Tehran (IR)<br />

S.M. Sanadizadeh, Tehran (IR)<br />

11.45 - 12.20 Female urology<br />

Moderators: W. Artibani, Verona (IT)<br />

S.J. Hosseini, Tehran (IR)<br />

11.45 - 12.00 Female stress urinary incontinence surgery in <strong>2013</strong><br />

W. Artibani, Verona (IT)<br />

12.00 - 12.20 Interactive case discussion<br />

M. Emami, Tehran (IR)<br />

S. Shakeri, Shiraz (IR)<br />

12.20 - 12.55 Reconstructive urology<br />

Moderators: W. Artibani, Verona (IT)<br />

S.J. Hosseini, Tehran (IR)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

61<br />

Friday


Friday<br />

12.20 - 12.35 Posterior urethral strictures management<br />

S.J. Hosseini, Tehran (IR)<br />

12.35 - 12.55 Interactive case discussion<br />

E. Palminteri, Arezzo (IT)<br />

12.55 - 13.00 Conclusion<br />

W. Artibani, Verona (IT)<br />

S.J. Hosseini, Tehran (IR)<br />

62 <strong>Programme</strong> <strong>Book</strong>


Friday, 15 March - <strong>EAU</strong> <strong>Programme</strong><br />

Urology beyond Europe<br />

10.30 - 13.00 Joint Session of the European Association of Urology (<strong>EAU</strong>) and the<br />

Arab Association of Urology (AAU)<br />

Yellow Hall 1-2-3 - Level N1<br />

Chairs: H. Abol-Enein, Mansoura (EG)<br />

R.B. Khauli, Beirut (LB)<br />

M. Wirth, Dresden (DE)<br />

10.30 - 10.35 Welcome<br />

H. Abol-Enein, Mansoura (EG)<br />

M. Wirth, Dresden (DE)<br />

10.35 - 11.05 Prostate sparing cystectomy<br />

Pro<br />

G. Vallancien, Paris (FR)<br />

Con<br />

H. Abol-Enein, Mansoura (EG)<br />

11.05 - 11.35 PT1 G3 bladder cancer<br />

Early cystectomy<br />

M. Bulbul, Beirut (LB)<br />

Conservative treatment<br />

M. Wirth, Dresden (DE)<br />

11.35 - 12.05 Positive margin after radical prostatectomy<br />

Adjuvant radiotherapy<br />

P. Dirix, Leuven (BE)<br />

Active surveillance<br />

D. Rabah, Riyadh (SA)<br />

12.05 - 12.55 Case presentations<br />

Moderators: A. Morsy, Cairo (EG)<br />

N. Msessa, Tripoli (LY)<br />

12.05 - 12.30 Renal cysts - How to treat?<br />

Y. Nouira, Ariana (TN)<br />

Panel: I.H. Al Nono, Sana’a (YE)<br />

S.M. Moudouni, Marrakech (MA)<br />

12.30 - 12.55 Renal tumors, radical or partial nephrectomy<br />

A. Al Naimi, Doha (QA)<br />

Panel: M.R. El Halaby, Cairo (EG)<br />

R.B. Khauli, Beirut (LB)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

63<br />

Friday


Friday<br />

12.55 - 13.00 Closing remarks<br />

H. Abol-Enein, Mansoura (EG)<br />

64 <strong>Programme</strong> <strong>Book</strong>


Friday, 15 March - <strong>EAU</strong> <strong>Programme</strong><br />

Urology beyond Europe<br />

13.15 - 15.45 Joint Session of the European Association of Urology (<strong>EAU</strong>) and the<br />

Japanese Urological Association (JUA)<br />

Brown Hall 1-2 - Level S2<br />

Chairs: H. Kakizaki, Asahikawa (JP)<br />

H. Van Poppel, Leuven (BE)<br />

13.15 - 13.20 Opening<br />

Y. Homma, Tokyo (JP)<br />

H. Van Poppel, Leuven (BE)<br />

13.20 - 13.50 Session 1: High risk prostate cancer<br />

Moderators: N.W. Clarke, Manchester (GB)<br />

Y. Tomita, Yamagata (JP)<br />

13.20 - 13.35 Incidence, definition and diagnosis of high risk prostate cancer<br />

K. Ito, Gunma (JP)<br />

13.35 - 13.50 The place of surgery in the management of high risk prostate cancer<br />

H. Van Poppel, Leuven (BE)<br />

13.50 - 14.20 Session 2: Robot-assisted surgery<br />

Moderators: K. Tanabe, Tokyo (JP)<br />

H. Van Poppel, Leuven (BE)<br />

13.50 - 14.05 Robot assisted radical prostatectomy<br />

R. Shiroki , Aichi (JP)<br />

14.05 - 14.20 Robot assisted nephron sparing surgery<br />

A. Mottrie, Aalst (BE)<br />

14.20 - 14.50 Session 3: Metastatic prostate cancer<br />

Moderators: A. Mottrie, Aalst (BE)<br />

M. Oya, Tokyo (JP)<br />

14.20 - 14.35 Hormonal micro-environment of prostate cancer<br />

M. Oya, Tokyo (JP)<br />

14.35 - 14.50 Prediction, prevention and intervention in metastatic prostate cancer<br />

N.W. Clarke, Manchester (GB)<br />

14.50 - 15.20 Session 4: Voiding dysfunction<br />

Moderators: D.J.M.K. De Ridder, Leuven (BE)<br />

H. Kakizaki, Asahikawa (JP)<br />

14.50 - 15.05 Regenerative treatment of stress urinary incontinence using autologous adipose-derived stem cells<br />

M. Gotoh, Nagoya (JP)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

65<br />

Friday


Friday<br />

15.05 - 15.20 Molecular mechanisms of OAB<br />

D.J.M.K. De Ridder, Leuven (BE)<br />

15.20 - 15.40 Session 5: Cases on RCC<br />

66 <strong>Programme</strong> <strong>Book</strong><br />

Moderator: Y. Tomita, Yamagata (JP)<br />

Panel: N.W. Clarke, Manchester (GB)<br />

M. Eto, Kumamoto (JP)<br />

G. Kimura, Tokyo (JP)<br />

A. Mottrie, Aalst (BE)<br />

15.40 - 15.45 Closing remarks<br />

Y. Homma, Tokyo (JP)<br />

H. Van Poppel, Leuven (BE)


Friday, 15 March - <strong>EAU</strong> <strong>Programme</strong><br />

Urology beyond Europe<br />

13.15 - 15.45 Joint Session of the European Association of Urology (<strong>EAU</strong>) and the<br />

Confederación Americana de Urología (CAU)<br />

Brown Hall 3 - Level S2<br />

Chairs: F.R. Cruz, Porto (PT)<br />

H. Villavicencio Mavrich, Barcelona (ES)<br />

13.15 - 13.20 Welcome address<br />

F.R. Cruz, Porto (PT)<br />

H. Villavicencio Mavrich, Barcelona (ES)<br />

13.20 - 13.40 Surgery of prostate cancer in stage 3: Better than radiotherapy?<br />

U.E. Studer, Berne (CH)<br />

13.40 - 14.00 Bladder cancer: From the lab to the patient. Where are we?<br />

J. Palou, Barcelona (ES)<br />

14.00 - 14.20 OAB: Antimuscarinics, Beta 3-agonists or Botulinum toxin: Which should be first?<br />

J.P.F.A. Heesakkers, Nijmegen (NL)<br />

14.20 - 14.40 Stress incontinence: From Burch to mini sling<br />

P. Palma, Campinas (BR)<br />

14.40 - 15.00 Endourology <strong>2013</strong>: How are we progressing?<br />

J. Gutierrez, Guadelajara (MX)<br />

15.00 - 15.20 New technologies in urology<br />

J. Rassweiler, Heilbronn (DE)<br />

15.20 - 15.40 Urethroplasty update<br />

C.R. Chapple, Sheffield (GB)<br />

15.40 - 15.45 Closing remarks<br />

F.R. Cruz, Porto (PT)<br />

H. Villavicencio Mavrich, Barcelona (ES)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

67<br />

Friday


Friday<br />

Friday, 15 March - <strong>EAU</strong> <strong>Programme</strong><br />

68 <strong>Programme</strong> <strong>Book</strong><br />

Urology beyond Europe<br />

13.15 - 15.45 <strong>EAU</strong> - International: Caucasus and Central Asia Session<br />

Amber Hall 1-2 - Level S2<br />

Chairs: M.K. Alchinbayev, Almaty (KZ)<br />

M. Marberger, Vienna (AT)<br />

I. Nusratulloev Sr., Dushanbe (TJ)<br />

Coordinator: N. Turmanidze, Tbilisi (GE)<br />

13.15 - 14.15 Hot issues in uro-gynaecology<br />

Moderators: W. Artibani, Verona (IT)<br />

Z. Tchanturaia, Tbilisi (GE)<br />

13.15 - 13.30 Update on mesh and mesh use<br />

C.R. Chapple, Sheffield (GB)<br />

13.30 - 13.45 Management of uro-gynaecological fistula today<br />

B.U. Shalekenov, Almaty (KZ)<br />

13.45 - 14.15 Case discussion: Uro-gynaecological fistula<br />

Moderator: C.R. Chapple, Sheffield (GB)<br />

Panel: W. Artibani, Verona (IT)<br />

F. Akilov, Tashkent (UZ)<br />

R. Hovhannisyan, Yerevan (AM)<br />

Z. Khakimkhodzhaev, Bishkek (KG)<br />

14.15 - 15.45 The treatment of renal cell cancer is changing<br />

Moderator: G. Janetschek, Salzburg (AT)<br />

S. Javad-Zada, Baku (AZ)<br />

14.15 - 14.35 The management of small renal masses<br />

H-C. Klingler, Vienna (AT)<br />

14.35 - 14.55 Management of T1B (partical nephrectomy or nephrectomy?)<br />

A.R. Pertia, Tbilisi (GE)<br />

14.55 - 15.15 The limits of laparoscopic management renal masses<br />

G. Janetschek, Salzburg (AT)<br />

15.15 - 15.45 Case discussion: Management of localised renal tumours today<br />

Moderator: M. Marberger, Vienna (AT)<br />

Panel: G. Janetschek, Salzburg (AT)<br />

S. Javad-Zada, Baku (AZ)<br />

H-C. Klingler, Vienna (AT)<br />

D. Salikov, Dushanbe (TJ)


Friday, 15 March - <strong>EAU</strong> <strong>Programme</strong><br />

Urology beyond Europe<br />

13.15 - 15.45 Joint Session of the European Association of Urology (<strong>EAU</strong>) and the<br />

Pan-African Urological Surgeons’ Association (PAUSA)<br />

Red Hall 1 - Level N1<br />

Chairs: M. Eissa, Cairo (EG)<br />

C. Llorente, Madrid (ES)<br />

13.15 - 13.20 Welcome and introduction<br />

M. Eissa, Cairo (EG)<br />

C. Llorente, Madrid (ES)<br />

13.20 - 13.35 Guest lecture: Urology in ancient Egypt<br />

M.S Elrefaie, Alexandria (EG)<br />

13.35 - 14.15 Round table 1: Renal trauma<br />

Moderators: S.D. Mante, Accra (GH)<br />

K. Nyarko, ()<br />

13.35 - 13.55 Diagnosis and staging<br />

M.Y. Elgammal, Cairo (EG)<br />

13.55 - 14.15 Treatment<br />

J.M.O. N’Dow, Aberdeen (GB)<br />

14.15 - 14.55 Round table 2: Avoiding complications of radical surgery<br />

Moderator: S.M. Gueye, Dakar (SN)<br />

14.15 - 14.35 Medical complications<br />

G.N. Thalmann, Berne (CH)<br />

14.35 - 14.55 Surgical complications<br />

E. Oluwabunmi Olapade-Olaopa, Ibadan (NG)<br />

14.55 - 15.45 Round table 3: Paediatric urology<br />

Moderators: M. Eissa, Cairo (EG)<br />

I. Vaz, Maputo (MZ)<br />

14.55 - 15.05 Congenital anomalies in adults<br />

I. Vaz, Maputo (MZ)<br />

15.05 - 15.20 Antibiotic prophylaxis<br />

M. Grabe, Malmö (SE)<br />

15.20 - 15.30 Pyeloplasty, open versus lap<br />

M. Eissa, Cairo (EG)<br />

15.30 - 15.45 Curved penis<br />

I.A.E. Mokhless, Alexandria (EG)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

69<br />

Friday


Friday<br />

Friday, 15 March - <strong>EAU</strong> <strong>Programme</strong><br />

70 <strong>Programme</strong> <strong>Book</strong><br />

Urology beyond Europe<br />

13.15 - 15.45 Joint Session of the European Association of Urology (<strong>EAU</strong>) and the<br />

Maghreb Union Countries<br />

Blue Hall 1-2 - Level N1<br />

Chairs: A. Joual, Casablanca (MA)<br />

J.W. Thüroff, Mainz (DE)<br />

13.15 - 13.20 Introduction<br />

J.W. Thüroff, Mainz (DE)<br />

13.20 - 14.45 Session 1: Bladder cancer<br />

Moderators: C-C. Abbou, Creteil (FR)<br />

A. Joual, Casablanca (MA)<br />

13.20 - 13.40 Bladder tumours in the Maghreb<br />

Y. Ahallal, Meknes (MA)<br />

13.40 - 14.00 Management of non invasive bladder tumours<br />

S.F. Shariat, New York (US)<br />

14.00 - 14.20 Radical cystectomy and bladder replacement<br />

W. Hassen, Al Ain (AE)<br />

14.20 - 14.40 Adjuvant and neoadjuvant chemotherapy<br />

Y. Loriot, Villejeuf (FR)<br />

14.40 - 14.45 Discussion<br />

14.45 - 15.40 Session 2: Panel case discussion<br />

Panel: K. Atallah, Tunis (TN)<br />

K. Hachi, Alger (DZ)<br />

A. Joual, Casablanca (MA)<br />

T. Lebret, Suresnes (FR)<br />

S.M. Moudouni, Marrakech (MA)<br />

S.F. Shariat, New York (US)<br />

J.W. Thüroff, Mainz (DE)<br />

15.40 - 15.45 Closing remarks<br />

J.W. Thüroff, Mainz (DE)


Friday, 15 March - <strong>EAU</strong> <strong>Programme</strong><br />

Urology beyond Europe<br />

13.15 - 15.45 Joint Session of the European Association of Urology (<strong>EAU</strong>) and the<br />

Indonesian Urological Association (IUAI)<br />

Yellow Hall 1-2-3 - Level N1<br />

Chairs: V. Mirone, Naples (IT)<br />

S. Sugandi, Bandung (ID)<br />

13.15 - 13.20 Introduction<br />

V. Mirone, Naples (IT)<br />

S. Sugandi, Bandung (ID)<br />

13.20 - 13.40 Sperm retrieval vs obstruction release in obstructive Azoospermia<br />

D.M. Soebadi, Surabaya (ID)<br />

13.40 - 14.00 Varicocele repair and male infertility: Indications and new evidences<br />

N. Sofikitis, Ioannina (GR)<br />

14.00 - 14.20 The impact of medical management of BPH on erectile dysfunction<br />

P. Birowo, Jakarta (ID)<br />

14.20 - 14.40 New acquisitions concerning the physio-pathological correlation between LUTS and erectile dysfunction<br />

F. Giuliano, Garches (FR)<br />

14.40 - 15.00 The influence of hormonal changes on bladder function<br />

T. Romdam, Bandung (ID)<br />

15.00 - 15.20 The role of testosterone replacement therapy in the ageing male<br />

C.C. Schulman, Brussels (BE)<br />

15.20 - 15.45 Panel discussion and clinical case presentation<br />

Moderators: V. Mirone, Naples (IT)<br />

S. Sugandi, Bandung (ID)<br />

Panel: P. Birowo, Jakarta (ID)<br />

F. Giuliano, Garches (FR)<br />

T. Romdam, Bandung (ID)<br />

C.C. Schulman, Brussels (BE)<br />

D.M. Soebadi, Surabaya (ID)<br />

N. Sofikitis, Ioannina (GR)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

71<br />

Friday


Friday<br />

Friday, 15 March - <strong>EAU</strong> <strong>Programme</strong><br />

18.00 - 19.30 <strong>EAU</strong> Opening Ceremony<br />

72 <strong>Programme</strong> <strong>Book</strong><br />

eURO Auditorium - Level S2<br />

Performance by the Cameristi del Teatro alla Scala - Part 1<br />

Gioachino Rossini<br />

Il barbiere di Siviglia<br />

Una voce poco fa<br />

Gaetano Donizetti<br />

Don Pasquale<br />

Tornami a dir che m’ami<br />

Opening addresses<br />

F. Montorsi, Milan (IT), <strong>EAU</strong> Congress President<br />

P-A. Abrahamsson, Malmö (SE), <strong>EAU</strong> Secretary General<br />

Announcement of the new <strong>EAU</strong> Honorary Members<br />

Citation by P-A. Abrahamsson, Malmö (SE)<br />

New Honorary Members: P. Rigatti, Milan (IT)<br />

I. Sinescu, Bucharest (RO)<br />

R. Umbas, Jakarta (ID)<br />

Presentation of the <strong>EAU</strong> Willy Gregoir Medal <strong>2013</strong><br />

Citation by P-A. Abrahamsson, Malmö (SE)<br />

Presented to: C-C. Abbou, Creteil (FR)<br />

The <strong>EAU</strong> is proud to present the Willy Gregoir Medal to an important senior urologist who contributed in an<br />

extraordinary way to the development of urology in Europe<br />

Presentation of the <strong>EAU</strong> Frans Debruyne Life Time Achievement Award <strong>2013</strong><br />

Citation by P-A. Abrahamsson, Malmö (SE)<br />

Presented to: J. Breza Sr., Bratislava (SK)<br />

The <strong>EAU</strong> wishes both to honour and acknowledge the important and longstanding contribution by a<br />

distinguished colleague to the activities and development of the <strong>EAU</strong><br />

Presentation of the <strong>EAU</strong> Crystal Matula Award <strong>2013</strong><br />

Citation by P-A. Abrahamsson, Malmö (SE)<br />

Presented to: P.J. Boström, Turku (FI)<br />

This prestigious prize is granted to a promising younger urological academician<br />

Supported by an unrestricted educational grant from LABORIE<br />

Presentation of the <strong>EAU</strong> Hans Marberger Award <strong>2013</strong><br />

Citation by P-A. Abrahamsson, Malmö (SE)<br />

Presented to: J. Rassweiler, Heilbronn (DE)<br />

The Hans Marberger Award is awarded for the best European paper published in 2012 on minimally<br />

invasive surgery in urology<br />

Supported by an unrestricted educational grant from KARL STORZ GMBH & CO.KG


Presentation of the <strong>EAU</strong> Innovators in Urology Award <strong>2013</strong><br />

Citation by P-A. Abrahamsson, Malmö (SE)<br />

Presented to: U.E. Studer, Berne (CH)<br />

The Innovators in Urology Award is to acknowledge and highlight inventions and clinical contributions<br />

which have had a major impact on influencing the treatment and/or diagnosis of a urological disease<br />

Presentation of the <strong>EAU</strong> Prostate Cancer Research Award <strong>2013</strong><br />

Citation by P-A. Abrahamsson, Malmö (SE)<br />

Presented to: I. Ahmad, Glasgow (GB)<br />

The <strong>EAU</strong> Prostate Cancer Research Award is awarded for the best paper published on clinical or<br />

experimental studies in prostate cancer<br />

Supported by an unrestricted educational grant from the FRITZ H. SCHRÖDER FOUNDATION<br />

Performance by the Cameristi del Teatro alla Scala – Part II<br />

Giuseppe Verdi<br />

Rigoletto<br />

Caro nome<br />

La donna è mobile<br />

Giacomo Puccini<br />

Gianni Schicchi<br />

O mio babbino caro<br />

Giuseppe Verdi<br />

La Traviata<br />

Libiam ai lieti calici<br />

19.30 - 21.00 Get-together to renew ties with colleagues from all over the world<br />

Foyer eURO Auditorium – Level S2<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

73<br />

Friday


Friday<br />

Friday, 15 March - Sponsored Sessions<br />

74 <strong>Programme</strong> <strong>Book</strong><br />

Symposia Overview<br />

16.15 - 17.45 Extending survival outcomes in RCC and CRPC: Current evidence and future horizons page 397<br />

Red Hall 2 - Level N1 Sponsored by BAYER HEALTHCARE<br />

16.15 - 17.45 New data in metastatic RCC: Applying the evidence to clinical practice page 398<br />

Yellow Hall 1-2-3 - Level N1 Sponsored by GLAXOSMITHKLINE ONCOLOGY<br />

16.15 - 17.45 Urological challenges in managing patients with angiomyolipoma (AML) page 399<br />

Amber Hall 1-2 - Level S2 Sponsored by NOVARTIS ONCOLOGY<br />

16.15 - 17.45 Innovations in clinical urology page 400<br />

Blue Hall 1-2 - Level N1 Sponsored by OLYMPUS<br />

16.15 - 17.45 Metastatic castration-resistant prostate cancer: Integrating new learnings to optimise<br />

treatment outcomes page 401<br />

Brown Hall 3 - Level S2 Sponsored by SANOFI


Saturday, 16 March - <strong>EAU</strong> <strong>Programme</strong><br />

Special Session<br />

07.30 - 08.30 <strong>EAU</strong> General Assembly<br />

Platinum Hall - Level S3<br />

Welcome by the <strong>EAU</strong> Secretary General<br />

Approval minutes General Assembly of 25 February 2012, Paris, France<br />

General report by the <strong>EAU</strong> Secretary General<br />

P-A. Abrahamsson, Malmö (SE)<br />

Report by the <strong>EAU</strong> Treasurer<br />

M. Wirth, Dresden (DE)<br />

Specific reports on the <strong>EAU</strong> Offices by the <strong>EAU</strong> Executive<br />

Report by the Secretary General on the <strong>EAU</strong> Membership Office<br />

• Approval new <strong>EAU</strong> members<br />

• Approval new Honorary members<br />

Other business<br />

Future Congresses<br />

Presentation of the 29th Annual <strong>EAU</strong> Congress in Stockholm, 11-15 April 2014<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

75<br />

Saturday


Saturday<br />

Saturday, 16 March - <strong>EAU</strong> <strong>Programme</strong><br />

76 <strong>Programme</strong> <strong>Book</strong><br />

Plenary Session 1<br />

08.30 - 10.15 Urology: From young to old<br />

eURO Auditorium - Level S2<br />

Chairs: W. Artibani, Verona (IT)<br />

D.J.M.K. De Ridder, Leuven (BE)<br />

08.30 - 08.35 Introduction to the plenary session<br />

W. Artibani, Verona (IT)<br />

08.35 - 08.50 Update The management and long-term outcomes of vesicoureteral reflux<br />

G. Lackgren, Uppsala (SE)<br />

Aims and objectives<br />

The introduction of endoscopic treatment with bulking agents and particularly the introduction of Deflux (a<br />

non-animal stabilised hyaluronic acid/dextranomer gel) has changed the treatment strategy of vesicoureteral<br />

reflux (VUR) in children. This treatment offers the chance of curing children with even high grade reflux<br />

(IV-V), and eliminating the need for long-term medication or repeat VCUGs. More importantly it reduces<br />

the number of children requiring open surgery. In our long-term follow-up (mean 16 years) study we have<br />

found that only 25% of the children with primary grade IV-V reflux have been submitted to open surgery<br />

(reimplantation) and that there are few adverse events in the long term after treatment. Results from the<br />

ongoing clinical study will be presented.<br />

08.50 - 09.05 Update The long-term outcomes of genital surgery in boys<br />

A.R. Mundy, London (GB)<br />

Aims and objectives<br />

Other than circumcision and orchidopexy the commonest genital surgery in boys is hypospadias. This<br />

presentation will concentrate on hypospadias with some mention of extrophy/epispadias and circumcision.<br />

The long term outcome of hypospadias surgery in boys is not as good as is presented in the literature.<br />

I shall propose for discussion that excepting serious deformities genital surgery should be postponed until<br />

the boy himself can take part in his counselling process.<br />

09.05 - 09.40 Debate Pelvic floor implants: Artificial mesh or autologous fascia?<br />

Moderator: F.R. Cruz, Porto (PT)<br />

Panel: Gynaecologist U. Peschers, Munich (DE)<br />

Urologist F. Haab, Paris (FR)<br />

Aims and objectives<br />

This session will discuss the long term data of artificial mesh implantation for correction of SUI of pelvic<br />

organ prolapse. Many patients are now expected to carry artificial meshes for several decades. The long-term<br />

results of SUI of pelvic organ prolapse with artificial mesh will be discussed. The potential consequences of<br />

a long-term exposure to foreign material during ageing will also be addressed.<br />

09.40 - 09.55 State-of-the-art lecture Incontinence and age<br />

A. Wagg, Edmonton (CA)<br />

Aims and objectives<br />

Following this presentation the attendee will be able to demonstrate:


- an understanding of the impact of comorbid conditions on continence in older people<br />

- an awareness of the impact of polypharmacy on continence status is older people<br />

- the impact of anticholinergic medications for bladder dysfunction on cognitive status in older people<br />

09.55 - 10.15 State-of-the-art lecture Is ageing a disease?<br />

M. Kirby, London (GB)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

77<br />

Saturday


Saturday<br />

Saturday, 16 March - <strong>EAU</strong> <strong>Programme</strong><br />

78 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

08.30 - 10.00 Prostate cancer screening<br />

Brown Hall 1-2 - Level S2<br />

Poster Session 1<br />

Chairs: J.E. Hugosson, Gothenburg (SE)<br />

M.J. Roobol, Rotterdam (NL)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion.<br />

1 Screening for prostate cancer: Results of the Rotterdam section of the European Randomized study of<br />

Screening for Prostate Cancer (ERSPC)<br />

M.J. Roobol, C.H. Bangma, F.H. Schröder (Rotterdam, The Netherlands)<br />

2 Incidence and mortality of prostate cancer after termination of PSA based screening<br />

A.L.A. Grenabo, E. Holmberg, S. Moss, J. Hugosson (Gothenburg, Sweden; London, United Kingdom)<br />

3 Repeat transrectal prostate biopsies incorporating targeted anterior zone sampling – is template biopsy<br />

really necessary?<br />

A. Pandit, H. Thomas, C. O’Brien, J. Featherstone, N. Fenn, P. Bose (Swansea, United Kingdom)<br />

4 Men with total PSA levels between 1-2.99 ng/mL at initial screening have an elevated risk of future<br />

prostate cancer diagnosis: Results from the Gothenburg randomized screening trial<br />

M. Frånlund, S. Carlsson, H. Lilja, J. Hugosson (Gothenburg, Sweden; New York, United States of America)<br />

5 Disease-specific survival of men with screen-detected prostate cancer: Comparison of first round vs<br />

second round cancers in an European randomized screening trial<br />

X. Zhu, M. Bul, L.P. Bokhorst, C.H. Bangma, F.H. Schröder, M.J. Roobol (Rotterdam, The Netherlands)<br />

6 Serum cholesterol mediates in the mechanism of statins to prevent prostate cancer<br />

C. Konstantinidis Garay, I. Iztueta, F. Agreda, A. Celma, J.M. Bastarós, J. Placer, J. Planas, J. Morote<br />

(Barcelona, Spain)<br />

7 PSA-Isoforms-Velocity. Evaluation of a novel approach in the early diagnosis of prostate cancer. Results<br />

from the Tyrol PSA screening project<br />

I. Heidegger, H. Klocker, V. Skradski, M. Ladurner, E. Steiner, G. Schaefer, W. Horninger, J. Bektic (Innsbruck,<br />

Austria)<br />

8 Cost-benefit analysis in Japanese PSA screening in 5-years aged ranking<br />

K. Okihara, K. Ito, T. Miki, S. Kazuhiro, T. Iinuma (Kyoto, Maebashi, Tokyo, Japan)<br />

9 Performance of inherited genetic markers to predict prostate biopsy outcomes in Chinese men<br />

H.W. Jiang, F. Liu, L. Zhang, H. Zhang, R. Na, X. Lin, Q. Ding, J. Xu (Shanghai, China)<br />

10 Prospective randomized controlled trial of the role of PSA and PCA3 testing in a sequential manner in an<br />

opportunistic screening programme for prostate cancer<br />

J. Rubio Briones, J. Casanova, R. Dumont, A. Fernández-Serra, I. Casanova-Salas, J. Domínguez-Escrig,<br />

M. Ramírez-Backhaus, A. Collado, A. Gómez-Ferrer, I. Iborra, J.V. Ricós, J.L. Monrós, E. Solsona, J.A. López-<br />

Guerrero (Valencia, Spain)<br />

11 One-year results of a multidisciplinary prostate cancer unit: Management changes in comparison with a<br />

monodisciplinary unit<br />

A. Sciarra, V. Gentile, S. Salciccia, A. Gentilucci, S. Cattarino, V. Gentile, V. Panebianco (Rome, Italy)


12 Discrepancies between guidelines and clinical practice regarding prostate-specific antigen (PSA) testing<br />

E.H.J. Hamoen, D.F.M. Reukers, J.O. Barentsz, M.M. Rovers, J.A. Witjes (Nijmegen, The Netherlands)<br />

Summary<br />

J.E. Hugosson, Gothenburg (SE)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

79<br />

Saturday


Saturday<br />

Saturday, 16 March - <strong>EAU</strong> <strong>Programme</strong><br />

80 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

08.30 - 10.00 Laparoscopy: Training, new technologies and techniques<br />

Brown Hall 3 - Level S2<br />

Poster Session 2<br />

Chairs: C-C. Abbou, Creteil (FR)<br />

H.G. Van Der Poel, Amsterdam (NL)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion.<br />

13 The laparoscopic training of the European urology residents – results of a pan-European survey<br />

F. Furriel, M.P. Laguna, A.J.C. Figueiredo, P.T.C. Nunes, L.S.O. Marconi, J. Rassweiler (Coimbra, Portugal;<br />

Amsterdam, The Netherlands; Heilbronn, Germany)<br />

14 Learning curves for urological procedures - a systematic review<br />

H. Abboudi, M. Khan, K. Guru, S. Froghi, G. De Win, H. Van Poppel, P. Dasgupta, K. Ahmed (Brighton,<br />

London, United Kingdom; Buffalo, United States of America; Antwerp, Leuven, Belgium)<br />

15 Avoidable iatrogenic complications of urethral catheterisation and inadequate intern training: A 4-year<br />

follow up post implementation of an intern training programme<br />

J.F. Sullivan, J.C. Forde, A.Z. Thomas, T.C. Creagh (Dublin, Ireland)<br />

16 Mental training or virtual reality simulation as enhancing methods to laparoscopic box training: A<br />

randomized controlled trial on novices<br />

P. Grange, D. Eldred-Evans, A. Chang, J. Makanjuola, M. Mulla, P. Rouse, D.M Sharma, M. Arya, S. Ayis,<br />

M. Immenroth (London, United Kingdom; Hamburg, Germany)<br />

17 The importance of training in laparoscopic nephrectomy for residents before participating at the open<br />

procedure<br />

D.M. Dumitrache, C.S. Gutue, I.D. Chira, J. Aurelian, V. Jinga (Bucharest, Romania)<br />

18 Achieving proficiency in robotically assisted minimally invasive surgery: The contribution of laparoscopic<br />

surgical experience in developing robotic proficiency<br />

H. Abdul-Muhsin, R. Smith, V. Patel (Celebration, United States of America)<br />

19 Educational impact of robot assisted surgical training program<br />

S.A.A. Khan, S.J.R. Raza, K. Ahmed, R. Din, A. Stegemann, M. Bienko, A. Chowriappa, T. Kesavadas,<br />

M. Bhandari, K.A. Guru (London, United Kingdom; Buffalo, United States of America)<br />

20 Fundamental Skills of Robotic Surgery (FSRS): A multi-institutional randomized controlled trial for<br />

validation of a simulation-based curriculum<br />

K. Ahmed, A. Stegemann, J. Syed, S. Rehman, K. Ghani, R. Autorino, M. Sharif, A. Rao, Y. Shi, G. Wilding,<br />

J. Hassett, A. Chowriappa, T. Kesavadas, J. Peabody, M. Menon, J. Kaouk, K. Guru (London, United Kingdom;<br />

Buffalo, Detroit, Cleveland, United States of America)<br />

21 Effectiveness of 3D-imaging system on simple and suturing tasks for laparoscopic training<br />

M. Iwamura, A. Ito, A. Hoshi, A. Miyajima, K. Nakagawa, H. Kinoshita, Y. Arai, T. Terachi, S. Baba,<br />

T. Matsuda (Sagamihara, Sendai, Isehara, Tokyo, Hirakata, Japan)<br />

22 A prospective randomized study of a new articulating laparoscopy device (Kymerax-Terumo) in the dry lab<br />

- part 1: Learning curve and objective skills assessment<br />

S. Hruby, R. Pann, R. Bernecker, Y. Landkammer, T. Schätz, L. Lusuardi, S. Jeschke, A. Wicker, G. Janetschek<br />

(Salzburg, Austria)


23 Evaluation of a new operating platform (ETHOS) for laparoscopic surgery in a training room setting<br />

A.S. Gözen, O. Plekhanova, A. Jalal, T. Tokas, J. Klein, J. Rassweiler (Heilbronn, Germany; Moscow, Russia)<br />

24 Robotic-assisted laparoscopic suturing of an U-shaped ileum-neobladder with ENDOSEW® - report of an<br />

experimental setting<br />

A. Martinschek, M. Ritter, E. Heinrich, L. Trojan (Ulm, Mannheim, Göttingen, Germany)<br />

25 Magnetic tracking technology used to compare ergonomics of single site and conventional laparoscopic<br />

surgery: Preliminary results<br />

I. Georgiopoulos, L. Rentzos, I. Kyriazis, P. Kallidonis, G. Chryssolouris, E. Liatsikos (Patras, Greece)<br />

26 Laparoendoscopic single-site versus conventional laparoscopic total extraperitoneal hernia repair - a<br />

prospective randomized clinical trial<br />

Y.C. Tsai (New Taipei City, Taiwan)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

81<br />

Saturday


Saturday<br />

Saturday, 16 March - <strong>EAU</strong> <strong>Programme</strong><br />

82 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

08.30 - 10.00 Male infertility: Basic science<br />

Amber Hall 1-2 - Level S2<br />

Poster Session 3<br />

Chairs: Z. Kopa, Budapest (HU)<br />

W.H.G. Weidner, Giessen (DE)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

* 27 The sperm protamine mRNA ratio as a clinical parameter to estimate the fertilizing potential of men taking<br />

part in an ART program<br />

N. Rogenhofer, T. Dansranjavin, M. Schorsch, A. Spiess, H. Wang, V. Von Schönfeldt, H. Cappallo-Obermann,<br />

V. Baukloh, H. Yang, A. Paradowska, B. Chen, C. Thaler, W. Weidner, H-C. Schuppe, K.S. Steger (Munich,<br />

Giessen, Wiesbaden, Hamburg, Germany; Shanghai, China)<br />

28 Withdrawn<br />

29 Testicular morphology and spermatozoids in hypertensive rats treated or not with enalapril<br />

G.R. Bechara, M. Simões, B. Felix-Patrício, J.L. Medeiros Jr, B.M. Gregório, D.B. De Souza, W.S. Costa,<br />

F.J. Sampaio (Rio de Janeiro, Brazil)<br />

30 Diet rich in polyunsaturated fatty acid induces overweight but improves the testicular morphology in adult<br />

rats<br />

P.C. Silva, A. Furriel, N.C. Machado, E.F. Alves, D.B. De Souza, B.M. Gregório, F.J.B. Sampaio, W.S. Costa (Rio<br />

de Janeiro, Brazil)<br />

* 31 Significant role of TET2 and TET3 in production of fertile sperm: First evidence for link between<br />

5-cytosine-hydroxymethylation and proper spermatogenesis<br />

T. Dansranjavin, K. Steger, J. Deuker, W. Weidner, A. Spiess, M. Schorsch, U. Schagdarsurengin (Giessen,<br />

Hamburg, Wiesbaden, Germany)<br />

32 The depletion of H4K12ac within developmentally relevant promoters is not accompanied by alteration of<br />

DNA methylation in sperm of subfertile men.<br />

A. Paradowska-Dogan, M. Vieweg, K. Hortova, D. Miller, H-C. Schuppe, W. Weidner, K. Steger (Giessen,<br />

Germany; Prague, Czech Republic; Leeds, United Kingdom)<br />

33 RAPGEF6 function in mouse spermatogenesis<br />

K. Okada, K. Yamaguchi, N. Enatsu, F. Li, K. Matsushita, K. Chiba, H. Miyake, K. Maeta, S. Bilasy,<br />

H. Edamatsu, T. Kataoka, M. Fujisawa (Kobe, Japan; Ismailia, Egypt)<br />

34 Inhibin B predicts maturation arrest and sperm retrieval<br />

A. Ciudin, J.M. Corral, M.G. Diaconu, D. Gosalbez, M. Piqueras, J. Balasch, M. Guimerá, A. Carap,<br />

V. Constantin, R. Alvarez-Vijande, J.L. Ballesca, A. Alcaraz (Barcelona, Spain; Bucharest, Romania)<br />

35 Candesartan ameliorates cisplatin induced testicular damage and change of expression pattern of<br />

testicular podocin<br />

N. Enatsu, K. Yamaguchi, K. Okada, K. Matsushita, F. Li, K. Chiba, H. Miyake, M. Fujisawa (Kobe City, Japan)<br />

36 Withdrawn


37 Do serotonergic antidepressants affect semen quality?<br />

V. Boulos, H. Hassan (Cairo, Egypt)<br />

Summary: Words of wisdom: Future sperm management<br />

W.H.G. Weidner, Giessen (DE)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

83<br />

Saturday


Saturday<br />

Saturday, 16 March - <strong>EAU</strong> <strong>Programme</strong><br />

84 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

08.30 - 10.00 History of urology 1<br />

Amber Hall 7-8 - Level S2<br />

Poster Session 4<br />

Chairs: A. Jardin, Paris (FR)<br />

D. Schultheiss, Giessen (DE)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion.<br />

38 The story of the stent<br />

C.P. Hobbs, J.R. Bhatt, I.R.G. Wood (Oxford, United Kingdom)<br />

39 Historical development of diagnosis and treatment of bladder cancer<br />

M. Alsudani, A. Mohammed (Kettering, United Kingdom)<br />

40 Watercolors to save lives: The original drawings of “Étude sur le Rein des Urinaires” painted by Joaquin<br />

María Albarrán to become Doctor at the Faculty of Medicine in Paris<br />

J.C. Angulo, M. Perez, I. Otero, L. Fariña, M. Fernandez (Madrid, Spain)<br />

41 Practicing urology in Athens (1910-1950)<br />

A. Rempelakos, C. Tsiamis, C. Alamanis, E. Poulakou-Rebelakou (Athens, Greece)<br />

42 The evolution in our understanding of prostatic anatomy and its surgical management<br />

A. Christofides, J. Goddard (Leicester, United Kingdom)<br />

43 Dimitrie Gerota – anatomist in love with sculpture or urologist rebel against the king<br />

S. Poletajew, K. Poletajew, P. Radziszewski (Warsaw, Poland)<br />

44 The evolution of penile fracture management over the last century: A short and snappy review!<br />

Z. Ali, S. Miah, I. Dukic, I. Pearce (Salford, Sheffield, Manchester, United Kingdom)<br />

45 The urinary catheter; a relieving history<br />

I.R.G. Wood, C.P. Hobbs, J.R. Bhatt (Oxford, United Kingdom)<br />

46 Turning points in world history. Did Napoleon Bonaparte have a cystitis during the battle of Waterloo and<br />

was the battle lost because of that?<br />

M. Hatzinger (Frankfurt, Germany)<br />

47 Blood and grit: The impact of the bladder stone on history, music and science<br />

V. Sahdev, J.S. Thomas, A. Jones, P.V.S. Kumar (Reading, United Kingdom)<br />

48 The use of sutures in urology<br />

A. Pai, P.V.S. Kumar, A. Jones (Reading, United Kingdom)<br />

49 The rise and fall of Edward Gibbon’s hydrocele<br />

F.K. Khan, W. Mahmalji, S. Madaan, I.K. Dickinson, S. Sriprasad (Kent, United Kingdom)


Saturday, 16 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

08.30 - 10.00 Urothelial cancer: Tumour biology and experimental therapies<br />

Silver Hall - Level N2<br />

Poster Session 5<br />

Chairs: M. Knowles, Leeds (GB)<br />

D. Theodorescu, Aurora (US)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

* 50 Silencing Notch-1 and Notch-3 promotes epithelial-to-mesenchymal transition (EMT) and self-renewal<br />

potential in human bladder cancer<br />

W. Jaeger, T. Hayashi, S. Awrey, K.M. Gust, T. Cordonnier, N. Li, R. Buttyan, T.H. Van Der Kwast, B.W. Van<br />

Rhijn, J.W. Thüroff, P.C. Black (Vancouver, Toronto, Canada; Frankfurt, Mainz, Germany; Amsterdam, The<br />

Netherlands)<br />

51 Epigenetic alterations associated with neo-adjuvant chemotherapy resistance in bladder cancer<br />

A. Feber, W.S. Tan, P. De Winter, A. Freeman, K. King, P. Gurung, C. Jameson, R. Bryan, N. James, S. Beck,<br />

J. Kelly (London, United Kingdom)<br />

52 MicroRNA expression signatures in bladder cancer: MicroRNA-145 function as a tumor suppressor and its<br />

mediated cancer pathways<br />

H. Yoshino, N. Seki, H. Hidaka, T. Yamasaki, T. Idesako, H. Enokida, M. Nakagawa (Kagoshima, Chiba, Japan)<br />

53 A ‘4-miR’ signature in urine identifies recurrent bladder cancer in patients undergoing surveillance<br />

N. Sapre, H. Lewis, G. Macintyre, A. Kowlaczyk, A.J. Costello, N.M. Corcoran, C.M. Hovens (Melbourne,<br />

Australia)<br />

54 Validation of TBX2, TBX3, GATA2, and ZIC4 as pTa-specific prognostic bladder cancer markers<br />

W. Beukers, R. Kandimalla, R. Masius, M. Vermeij, E.C. Zwarthoff (Rotterdam, The Netherlands)<br />

55 Circulating tumor cells and their prognostic significance in non-muscle invasive bladder cancer: A cell<br />

search analysis<br />

G.M. Busetto, A. Gradilone, C. Nicolazzo, A. Petracca, P. Gazzaniga, V. Gentile, E. De Berardinis (Rome, Italy)<br />

56 Specific changes in the DNA methylation pattern enable an early assessment of the metastatic risk of<br />

primary bladder tumours<br />

B. Stubendorff, K. Wilhelm, S. Dubey, E. Dudziec, J.W.F. Catto, M. Gajda, M-O. Grimm, K. Junker (Jena,<br />

Homburg, Germany; Oxford, Sheffield, United Kingdom)<br />

57 Ritonavir and bortezomib inhibit bladder cancer growth by inducing endoplasmic reticulum stress and<br />

ubiquitinated protein accumulation synergistically<br />

A. Sato, T. Asano, K. Ito, T. Asano (Tokorozawa, Japan)<br />

58 DNA damage response (DDR) genes are predictive of response to radiotherapy for muscle invasive bladder<br />

cancer<br />

P.M.S. Gurung, N. Counsell, J. Douglas, W. Tan, A. Feber, S. Short, S. Crabb, C. West, P. Hoskin, L. Beltran,<br />

A. Freeman, T. Powles, J. Kelly (London, Southampton, Leeds, Manchester, United Kingdom)<br />

59 Enhancement of γδ T cell antitumor activity against bladder cancer cell through 4-1BB and PD-1 mediated<br />

activation<br />

T. Suzuki, H. Yoshihide, K. Akihiro, N. Michio, Y. Shingo (Nishinomiya, Japan)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

85<br />

Saturday


Saturday<br />

86 <strong>Programme</strong> <strong>Book</strong><br />

60 Genomic landscapes of BBN-induced bladder cancer in rodents, and its application to human bladder<br />

cancer: Gene amplification and overexpression of Cyp2a5/CYP2A6 in invasive bladder cancer<br />

K. Kazuhiro, F. Katsuhiro, O. Koji, K. Yae, K. Masaru, K. Kenjiro, N. Hitoshi (Nagoya, Tokyo, Japan)<br />

61 UCyt+/ImmunoCyt and cytology in the detection of urothelial carcinoma: An update on 7,422 analyses<br />

E. Comploj, C. Mian, A. Spaltro Ambrosini, C. Dechet, S. Palermo, E. Trenti, M. Lodde, W. Horninger,<br />

A. Pycha (Bolzano, Italy; Salt Lake City, United States of America; Innsbruck, Austria)


Saturday, 16 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

08.30 - 10.00 Neuro-urology: Basic research<br />

Red Hall 1 - Level N1<br />

Poster Session 6<br />

Chairs: B. Uvelius, Lund (SE)<br />

A. Tubaro, Rome (IT)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

62 A new cell in the urogenital tract - cholinergic chemosensory brush cells are sentinels of the urethra<br />

K. Filipski, K. Deckmann, T. Bschleipfer, G. Krasteva-Christ, T. Papadakis, A. Rafiq, M. Wolff, I. Ibanez-Tallon,<br />

B. Schütz, E. Weihe, W. Kummer (Giessen, Berlin-Buch, Marburg, Germany)<br />

63 TRPV4 mediates bladder afferent pathways; a spinal c-fos study<br />

D.A.W. Janssen, J.G. Hoenderop, J.P. Heesakkers, J.A. Schalken (Nijmegen, The Netherlands)<br />

64 Effects of silodosin, a selective α1A-adrenoceptor antagonist, on the single primary bladder afferent<br />

activity of the rat<br />

N. Aizawa, Y. Homma, Y. Igawa (Tokyo, Japan)<br />

* 65 Role of NGF in bladder inflammation-induced pain behavior and TRPV1 traffic<br />

A. Coelho, A.S. Wolf-Johnston, S. Shinde, A. Avelino, C.D. Cruz, F. Cruz, L. Birder (Porto, Portugal;<br />

Pittsburgh, United States of America)<br />

66 Parathyroid hormone related peptide is endogenous relaxant of spontaneous detrusor smooth muscle<br />

contraction<br />

N Nishikawa, A. Kanematsu, H. Negoro, M. Imamura, Y. Sugino, T. Okinami, K. Yoshimura, H. Hashitani,<br />

O. Ogawa (Kyoto, Nishinomiya, Nagoya, Japan)<br />

* 67 Peripheral inhibition of fatty acid amide hydrolase depresses activities of single primary bladder<br />

mechanosensitive afferents of the rat<br />

N. Aizawa, C. Füllhase, P. Hedlund, Y. Homma, Y. Igawa (Tokyo, Japan; Munich, Germany; Milan, Italy)<br />

68 Urodynamic effects of fatty acid amide (FAAH) inhibition are mediated via central nervous cannabinoid<br />

type 2 (CB2) receptors<br />

C. Füllhase, A. Giese, M. Schmidt, C. Gratzke, C. Stief, K.E. Andersson, P. Hedlund (Munich, Germany;<br />

Winston-Salem, United States of America; Milan, Italy)<br />

69 The peripheral active fatty acid amide hydrolase (FAAH) inhibitor urb937 counteracts detrusor overactivity<br />

in two different animal models<br />

G. Gandaglia, F. Benigni, R. Buono, F. Mistretta, A. Nini, F. Castiglione, P. Hedlund (Milan, Italy)<br />

70 Supraspinal control of urine storage and micturition in men – an fMRI study<br />

L. Michels, J. Wöllner, F. Gregorini, M. Kurz, T.M. Kessler, B. Schurch, S. Kollias, U. Mehnert (Zurich,<br />

Winterthur, Lausanne, Switzerland)<br />

71 Piezo1, a novel mechanosensor in the bladder urothelium, transmits signals of bladder sensation<br />

T.M. Miyamoto, H. Nakagomi, S. Kira, T. Mochizuki, S. Koizumi, M. Tominaga, M. Takeda (Chuo, Okazaki,<br />

Japan)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

87<br />

Saturday


Saturday<br />

88 <strong>Programme</strong> <strong>Book</strong><br />

72 Compensation mechanisms in bladder outlet obstruction (BOO): The “heart-disease” of the lower urinary<br />

tract<br />

S.H. Alloussi, G. Peters, W. Arafat, Y. Al-Bulushi, T. Blessig, C. Lang, S. Alloussi (Neunkirchen, Germany)<br />

73 Withdrawn


Saturday, 16 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

08.30 - 10.00 Non-surgical treatment of advanced urothelial cancer<br />

Blue Hall 1-2 - Level N1<br />

Poster Session 7<br />

Chairs: J. Bellmunt, Barcelona (ES)<br />

P. Gontero, Turin (IT)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

* 74 Interval between cystectomy and start of adjuvant chemotherapy is an independent prognostic factor for<br />

patients with locally advanced or lymph node positive carcinoma of the urinary bladder<br />

C.H. Ohlmann, J. Kamradt, B. Burgard, M. Saar, I. Azone, S. Siemer, M. Stöckle, J. Lehmann (Homburg, Kiel,<br />

Germany)<br />

75 Eligibility for neoadjuvant/adjuvant cisplatin-based chemotherapy among radical cystectomy patients<br />

R.H. Thompson, S.A. Boorjian, S. Kim, J.C. Cheville, P. Thapa, R. Tarrel, I. Frank (Rochester, United States of<br />

America)<br />

76 Risk factors for intravesical tumor recurrence in muscle-invasive bladder cancer patients treated with<br />

selective bladder-sparing approaches<br />

F. Koga, Y. Fujii, J-I. Ishioka, Y. Matsuoka, N. Numao, K. Saito, H. Masuda, S. Kawakami, K. Kihara (Tokyo,<br />

Japan)<br />

77 Predicting responses to neoadjuvant chemotherapy for muscle invasive bladder cancers for prospective<br />

study<br />

Y. Kato, H. Zembutsu, R. Takata, K. Iwasaki, W. Obara, Y. Nakamura, T. Fujioka (Morioka, Sapporo, Japan;<br />

Chicago, United States of America)<br />

78 Impact of renal function on eligibility for chemotherapy and survival in patients who underwent radical<br />

nephroureterectomy<br />

E.N. Xylinas, M. Rink, L.A. Kluth, V. Margulis, R.K. Lee, E. Comploj, G. Novara, J.D. Raman, Y. Lotan,<br />

A. Weizer, M. Roupret, A. Pycha, D. Scherr, C. Seitz, V. Ficarra, Q-D. Trinh, P.I. Karakiewicz, F. Montorsi,<br />

M. Zerbib, S.F. Shariat (New York, Dallas, Hershey, Ann Arbor, United States of America; Bolzano, Padua,<br />

Milan, Italy; Paris, France; Vienna, Austria; Montreal, Canada)<br />

79 Sequential chemotherapy with gemcitabine plus carboplatin followed by additional docetaxel for aged<br />

patients with advanced bladder cancer<br />

T. Yoneyama, Y. Suzuki, N. Sugiyama, H. Yamamoto, A. Okamoto, Y. Tobisawa, T. Yoneyama, A. Imai,<br />

K. Mori, S. Hatakeyama, Y. Hashimoto, T. Koie, C. Ohyama (Hirosaki, Japan)<br />

* 80 Adjuvant radiotherapy with or without chemotherapy for advanced upper tract transitional cell carcinoma<br />

S. Park, M. Shim, D. Yoo, C. Song, B. Hong, J.H. Hong, C.S. Kim, H. Ahn (Seoul, South Korea)<br />

81 Peri-operative chemotherapy or surveillance in upper tract urothelial cancer (POUT - CRUK/11/027) - a<br />

randomised controlled trial to define standard post-operative management<br />

A. Birtle, R. Lewis, J. Chester, J. Donovan, M. Johnson, R. Jones, R. Kockelbergh, T. Powles, R. Bryan, J. Catto,<br />

E. Jones, E. Hall (Preston, Surrey, Cardiff, Bristol, Newcastle, Glasgow, Leicester, London, Birmingham,<br />

Sheffield, United Kingdom)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

89<br />

Saturday


Saturday<br />

90 <strong>Programme</strong> <strong>Book</strong><br />

82 Sequential chemotherapy with gemcitabine plus carboplatin, followed by additional docetaxel for aged<br />

patients with advanced upper-tract urothelial cancer<br />

T. Yoneyama, Y. Suzuki, N. Sugiyama, Y. Tobisawa, T. Yoneyama, A. Okamoto, H. Yamamoto, A. Imai,<br />

S. Hatakeyama, K. Mori, Y. Hashimoto, T. Koie, C. Ohyama (Hirosaki, Japan)<br />

83 Long-term efficacy and safety outcomes of the modified (simplified) combination of methotrexate,<br />

vinblastine, doxorubicin, and cisplatin (MVAC) as front-line therapy for unresectable or metastatic<br />

urothelial cancer (UC)<br />

A. Necchi, L. Mariani, P. Giannatempo, D. Raggi, E. Farè, G. Pizzocaro, L. Piva, D. Biasoni, T. Torelli,<br />

M. Catanzaro, S. Stagni, A. Milani, A. Gianni, F. De Braud, N. Nicolai, R. Salvioni (Milan, Italy)<br />

84 Comparative effectiveness of gemcitabine and paclitaxel versus best supportive care in metastatic<br />

urothelial carcinoma who have previously been treated with platinum based chemotherapy<br />

S. Kudou, H.Z. Zakouji, M.T. Takeda (Chuo Yamanashi, Japan)<br />

85 Management of local recurrences in the irradiated bladder: A systematic review<br />

N. Sapre, P. Anderson, F.F. Foroudi (Melbourne, Australia)


Saturday, 16 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

08.30 - 10.00 Nephron sparing surgery and risk scoring systems<br />

Yellow Hall 1-2-3 - Level N1<br />

Poster Session 8<br />

Chairs: M.P. Laguna, Amsterdam (NL)<br />

P.J. Nyirády, Budapest (HU)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

86 Nephron sparing surgery for small renal masses: Are we doing our best?<br />

M. Ciuffreda, V.A.C. Ramani (Manchester, United Kingdom)<br />

87 Morbidity, functional and oncological outcomes after nephron sparing surgery for cT2 renal tumours<br />

P. Bigot, J.F. Hetet, T. Fardoun, J. Rouffilange, E. Xylinas, G. Ploussard, I. Ouzaid, E. Robine, F. Audenet,<br />

O. Merigot De Treigny, C. Maurin, M. Ammi, S. Lebdai, L. Brureau, L. Bastien, J.A. Long, M. Roupret,<br />

Y. Neuzillet, P. Mongiat-Artus, G. Verhoest, M. Zerbib, V. Ravery, J. Rigaud, L. Bellec, H. Baumert,<br />

K. Bensalah, B. Escudier, N. Grenier, P. Paparel, N. Rioux-Leclercq, J.C. Bernhard, A-R. Azzouzi, M. Soulié,<br />

J.J. Patard (Angers, Nantes, Rennes, Bordeaux, Paris, Toulouse, Le Kremlin-Bicêtre, Suresnes, Grenoble,<br />

Lyon, France)<br />

88 Functional results of partial nephrectomy in patients with renal tumors<br />

M.I. Volkova, V.B. Matveev, I.Y. Skvortsov (Moscow, Russia)<br />

89 R.E.N.A.L. nephrometry score for laparoscopic partial nephrectomy in renal cell cancer and its correlation<br />

with ischemia time and complications<br />

B.M. Wrobel, C. Dogan, M.S. Erdogan, S. Deger (Ostfildern, Germany; Istanbul, Turkey)<br />

90 Withdrawn<br />

* 91 Optimal outcome of laparoendoscopic single-site partial nephrectomy: Analysis of predictive factors in a<br />

multi-institutional dataset<br />

R. Autorino, F. Greco, L. Cindolo, T. Herrmann, E. Liatsikos, U. Nagele, J-U. Stolzenburg, K. Rha, I. Darweesh,<br />

S. Rais-Bahrami, Y. Sun, L. Richstone, L. Wang, S.T. Young, C. Springer, P. Kallidonis, L. Schips, P. Fornara,<br />

J. Kaouk (Cleveland, La Jolla, New Hyde Park, United States of America; Halle, Hanover, Leipzig, Germany;<br />

Vasto, Italy; Patras, Greece; Hall in Tirol, Austria; Seoul, South Korea; Shanghai, China)<br />

92 Initial experience of an application of a novel high-speed 3-D image/volume analyzer to clampless partial<br />

nephrectomy<br />

Y. Komai, Y. Sakai, N. Gotohda, T. Kobayashi, N. Saito (Chiba, Japan)<br />

93 Pathological characteristics and prognostic impact of peritumoral capsule penetration in renal cell<br />

carcinoma after tumor enucleation<br />

A. Minervini, M.R. Raspollini, A. Tuccio, C. Di Cristofano, G. Siena, M. Salvi, G. Vittori, L. Masieri, A. Raugei,<br />

A. Lapini, S. Serni, M. Carini (Florence, Rome, Italy)<br />

94 Partial nephrectomy for metastatic renal cell carcinoma<br />

O. Stakhovskyi, Y. Vitruk, O. Voilenko, V. Kotov, P. Vukalovich, O. Yatsyna, E. Stakhovsky (Kiev, Ukraine)<br />

* 95 Management of renal cancer in a contemporary series of patients affected by Von Hippel-Lindau disease<br />

P. Destefanis, B. Lucatello, M. Maccario, A. Veltri, B. Pasini, A. Battaglia, M. Allasia, A. Gonella, A. Bosio,<br />

B. Lillaz, B. Frea, D. Fontana (Turin, Italy)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

91<br />

Saturday


Saturday<br />

* 96 Partial nephrectomy for renal tumors of more than 7 cm: Oncological, morbidity and renal function<br />

outcomes<br />

J. Rouffilange, L. Donon, G. Capon, M. Vergnolles, O. Renard, L. Ferretti, G. Robert, G. Pasticier, P. Ballanger,<br />

J-M. Ferrière, J-C. Bernhard (Bordeaux, France)<br />

92 <strong>Programme</strong> <strong>Book</strong><br />

Discussion on poster 96<br />

M.P. Laguna, Amsterdam (NL)


Saturday, 16 March - <strong>EAU</strong> <strong>Programme</strong><br />

Special Session<br />

10.00 - 16.30 Residents Day - organised by the Young Urologists Office (YUO) in<br />

collaboration with the European Society of Residents in Urology<br />

(ESRU)<br />

Red Hall 2 - Level N1<br />

Chairs: J.P.M. Sedelaar, Nijmegen (NL)<br />

Z. Tandogdu, Istanbul (TR)<br />

10.00 - 10.10 Introduction<br />

T. Esen, Istanbul (TR)<br />

J.P.M. Sedelaar, Nijmegen (NL)<br />

Z. Tandogdu, Istanbul (TR)<br />

10.10 - 10.40 Laparoscopy and robot during training<br />

Moderators: F. Furriel, Coimbra (PT)<br />

S. Hruby, Salzburg (AT)<br />

10.10 - 10.25 Robot assisted laparoscopy training for young trainees<br />

A. Mottrie, Aalst (BE)<br />

10.25 - 10.40 Basic skills video presentation for laparoscopy<br />

B.S.E.P. Van Cleynenbreugel, Leuven (BE)<br />

10.40 - 11.30 Post residency training<br />

Moderators: S. Larré, Reims (FR)<br />

M. Sochaj, Lodz (PL)<br />

10.40 - 10.55 European experience and pathway<br />

A.G. Van Der Heijden, Nijmegen (NL)<br />

10.55 - 11.10 North American experience and pathway<br />

G. Godoy, New York (US)<br />

11.10 - 11.20 Global scholarship opportunities<br />

H. Fajkovic, St. Pölten (AT)<br />

11.20 - 11.30 European Urology Scholarship <strong>Programme</strong> (EUSP) scholarship opportunities<br />

S. Larré, Reims (FR)<br />

11.30 - 12.05 Post-residency life<br />

Moderators: L.G. Martinez Bustamante, Koper (SI)<br />

J.P.M. Sedelaar, Nijmegen (NL)<br />

11.30 - 11.40 Academic urology<br />

S. Al-Hayek, Cambridge (GB)<br />

11.40 - 11.50 Private practice<br />

E.B. Cornel, Hengelo (NL)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

93<br />

Saturday


Saturday<br />

11.50 - 12.05 Debate: Academic and private practice<br />

94 <strong>Programme</strong> <strong>Book</strong><br />

Panel: S. Al-Hayek, Cambridge (GB)<br />

E.B. Cornel, Hengelo (NL)<br />

L.G. Martinez Bustamante, Koper (SI)<br />

J.P.M. Sedelaar, Nijmegen (NL)<br />

12.05 - 12.30 The present and the future of the young urologist in Europe<br />

12.05 - 12.15 The current status of young urologists in Europe: Results of a survey<br />

F. Sanguedolce, Barcelona (ES)<br />

12.15 - 12.25 Comments from the panel on the present and future of young urologists<br />

Panel: T. Esen, Istanbul (TR)<br />

V. Mirone, Naples (IT)<br />

J. Palou, Barcelona (ES)<br />

12.25 - 12.30 What is the future for young urologists?<br />

Panel: T. Esen, Istanbul (TR)<br />

V. Mirone, Naples (IT)<br />

J. Palou, Barcelona (ES)<br />

F. Sanguedolce, Barcelona (ES)<br />

12.30 - 13.00 Campbell Team Challenge Quiz<br />

13.00 - 13.15 Break<br />

Quizmasters: T.N. Garmanova, Moscow (RU)<br />

J.L. Vasquez, Copenhagen (DK)<br />

Panel: L. Lund, Viborg (DK)<br />

M. Marberger, Vienna (AT)<br />

13.15 - 13.30 Progress in guidelines evidence analysis: An update<br />

K.F. Parsons, Liverpool (GB)<br />

13.30 - 14.00 What does a resident need to know?<br />

Moderators: K. Hendricksen, Nijmegen (NL)<br />

P.P. Swiniarski, Bydgoszcz (PL)<br />

13.30 - 13.35 Introduction<br />

K. Hendricksen, Nijmegen (NL)<br />

P.P. Swiniarski, Bydgoszcz (PL)<br />

13.35 - 13.45 Curriculum Presentation<br />

S. Müller, Bonn (DE)<br />

13.45 - 14.00 Debate: What should be the limits of residency training? Do you have to know it all? Are there upper and<br />

lower limits?<br />

Panel: M. Brehmer, Stockholm (SE)<br />

H.M. Çek, Istanbul (TR)<br />

S. Müller, Bonn (DE)<br />

H. Van Poppel, Leuven (BE)


14.00 - 15.30 What is the evidence?<br />

Moderators: C.G.A. Ruf, Hamburg (DE)<br />

M. Skrodzka, Białystok (PL)<br />

14.00 - 14.15 Oncology: How to do a TRUS guided prostate biopsy<br />

L.N. Türkeri, Istanbul (TR)<br />

14.15 - 14.30 Mini-Perc technique<br />

O. Traxer, Paris (FR)<br />

14.30 - 14.45 Genitourinary infections: Wise antibiotic use in urology patients<br />

F.M.E. Wagenlehner, Giessen (DE)<br />

14.45 - 15.00 Paediatrics: Trends in paediatric endourology<br />

M.S. Silay, Istanbul (TR)<br />

15.00 - 15.15 Infertility: Diagnostic approach to an infertile couple<br />

J.O.R. Sonksen, Herlev (DK)<br />

15.15 - 15.30 Functional urology: Sling surgery, indications, tips and tricks<br />

M.J. Drake, Bristol (GB)<br />

15.30 - 16.15 Nightmare session: Presentations of clinical problems that have perplexed residents<br />

Case presentators: T. Oedekoven, Memmingen (DE)<br />

S. Reinhardt, Herlev (DK)<br />

S.M. Monagas Arteaga, León (ES)<br />

Panel: T.E. Bjerklund Johansen, Århus (DK)<br />

T. Esen, Istanbul (TR)<br />

M. Fode, Herlev (DK)<br />

16.15 - 16.30 Prizes and awards<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

95<br />

Saturday


Saturday<br />

Saturday, 16 March - <strong>EAU</strong> Section Meetings<br />

96 <strong>Programme</strong> <strong>Book</strong><br />

Meeting of the <strong>EAU</strong> Section of Uro-Technology<br />

(ESUT) in cooperation with ERUS and EULIS<br />

10.15 - 17.15 What is new in endourology, laparoscopy and robotics<br />

eURO Auditorium - Level S2<br />

Chair: J. Rassweiler, Heilbronn (DE)<br />

10.15 - 17.15 Live broadcasts from the Department of Urology, San Raffaele Turro Hospital, Vita-Salute San Raffaele<br />

University<br />

Coordinators at San Raffaele<br />

A. Breda, Barcelona (ES)<br />

A. Cestari, Milan (IT)<br />

E. Liatsikos, Patras (GR)<br />

Coordinators in eURO Auditorium<br />

V. Bucuras, Timisoara (RO)<br />

T. Frede, Müllheim (DE)<br />

R. Muschter, Rotenburg (DE)<br />

10.15 - 10.20 Welcome and introduction<br />

ESUT J. Rassweiler, Heilbronn (DE)<br />

ERUS P. Wiklund, Stockholm (SE)<br />

EULIS P.J. Osther, Fredericia (DK)<br />

10.20 - 10.30 Ethics of live surgery / Cases from last year<br />

W. Artibani, Verona (IT)<br />

A. Hoznek, Creteil (FR)<br />

10.30 - 13.00 Live surgery Part 1<br />

Moderators: C-C. Abbou, Creteil (FR)<br />

T. Knoll, Sindelfingen (DE)<br />

J. Rassweiler, Heilbronn (DE)<br />

P. Wiklund, Stockholm (SE)<br />

10.30 - 11.00 LESS robotic pyeloplasty<br />

G. Guazzoni, Milan (IT)<br />

11.00 - 11.20 3D retroperitoneal laparoscopic partial nephrectomy<br />

J-U. Stolzenburg, Leipzig (DE)<br />

11.20 - 11.40 Laparoscopic radical nephrectomy - the Gazi technique<br />

L. Tunc, Ankara (TR)<br />

11.40 - 12.10 Robotic partial nephrectomy - the standard technique<br />

A. Mottrie, Aalst (BE)<br />

12.10 - 12.30 Retrograde management of a stone in a caliceal diverticulum<br />

O. Traxer, Paris (FR)<br />

12.30 - 12.50 Flexible ureteroscopy and supine PCNL<br />

A. Breda, Barcelona (ES)<br />

G. Giusti, Milan (IT)


12.50 - 13.00 Laparoscopic decompression of pudendal nerve (video)<br />

T. Erdogru, Istanbul (TR)<br />

13.00 - 15.00 Live surgery part 2<br />

Moderators: W. Artibani, Verona (IT)<br />

P. Dasgupta, London (GB)<br />

M.P. Laguna, Amsterdam (NL)<br />

A. Skolarikos, Athens (GR)<br />

13.00 - 13.20 RALP in advanced stage (part 1)<br />

P. Wiklund, Stockholm (SE)<br />

13.20 - 13.40 NOTES - nephrectomy with 3D<br />

A. Alcaraz, Barcelona (ES)<br />

M.J. Ribal , Barcelona (ES)<br />

13.40 - 14.00 Mini-laparoscopic pyeloplasty<br />

F. Porpiglia, Turin (IT)<br />

14.00 - 14.20 Robot-assisted extended pelvic lymph node dissection in prostate cancer<br />

P.T. Piechaud, Bordeaux (FR)<br />

14.20 - 14.40 NBI, PDD and digital endoscopy of the bladder<br />

B. Malavaud, Toulouse (FR)<br />

14.40 - 15.00 PDD, SPIES-imaging and bipolar resection of a bladder tumour - new techniques<br />

A. Lapini, Florence (IT)<br />

15.00 - 17.05 Live surgery Part 3<br />

Moderators: C.M. Annerstedt, Herlev (DK)<br />

M. Burchardt, Greifswald (DE)<br />

J.J.M.C.H. De La Rosette, Amsterdam (NL)<br />

M.S. Michel, Mannheim (DE)<br />

15.00 - 15.20 RALP in advanced stage (part 2)<br />

P. Wiklund, Stockholm (SE)<br />

15.20 - 15.40 Greenlight laser of the prostate<br />

A. Bachmann, Basel (CH)<br />

A. Tubaro, Rome (IT)<br />

15.40 - 15.55 Urolift for BPH<br />

K-D. Sievert, Tübingen (DE)<br />

H. Woo, Sydney (AU)<br />

15.55 - 16.15 3D - LESS - nephrectomy<br />

E. Liatsikos, Patras (GR)<br />

16.15 - 16.30 TULEP procedure<br />

L. Camignani, Milan (IT)<br />

16.30 - 16.45 Prostate vaporisation<br />

J. Pfitzenmaier, Bielefeld (DE)<br />

16.45 - 16.55 Robot-assisted ureteroscopy (video)<br />

R. Saglam, Ankara (TR)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

97<br />

Saturday


Saturday<br />

16.55 - 17.05 ICG-assisted pelvic lymph node dissection (video)<br />

G. Janetschek, Salzburg (AT)<br />

17.05 - 17.15 Conclusion<br />

R.F. Van Velthoven, Brussels (BE)<br />

98 <strong>Programme</strong> <strong>Book</strong><br />

Aims and objectives<br />

Following a more than 10 year tradition of live surgery sessions, the <strong>EAU</strong> Section of Uro-Technology<br />

(ESUT) presents an ambitious programme focussing on novel techniques in percutaneous, endourological,<br />

laparoscopic, and robotic-assisted procedures. This year, with “What is new in endourology, laparoscopy<br />

and robotics” we want to focus on novel technology improving the performance of video-assisted surgery<br />

in all fields of urology. This session is conducted in collaboration with the <strong>EAU</strong> Section of Robotic Surgery in<br />

Urology (ERUS) and the <strong>EAU</strong> Section of Urolithiasis (EULIS).<br />

In the laparoscopic and robot-assisted cases, we will compare new access techniques (LESS versus SMART/<br />

Mini-LAP versus NOTES) as well as new instruments and devices (3D imaging) improving the ergonomics of<br />

laparoscopy.<br />

Finally, the latest digital developments for flexible endoscopy of the upper urinary tract for diagnosis and<br />

treatment of tumours and calculi are demonstrated also in combination with supine PCNL using the novel<br />

split screen technology.<br />

The meeting faculty consists of internationally well-known experts serving as surgeons and moderators.<br />

The different surgical procedures will be transmitted from the San Raffaele Hospital, University of Milan<br />

in high definition quality. A split-screen will allow the delegates to follow the uncommented procedures.<br />

Traditionally, the format of ESUT live surgery will allow all delegates to directly communicate with the<br />

surgeons to ask questions and to discuss every aspect of the procedure. Moreover, the ESUT session will be<br />

available online.<br />

Supported by unrestricted educational grants from COOK, INTUITIVE SURGICAL, IPSEN, KARL STORZ GMBH<br />

& CO.KG, NEOTRACT, OLYMPUS, QUANTA SYSTEM, ROCAMED


Saturday, 16 March - <strong>EAU</strong> Section Meetings<br />

Meeting of the <strong>EAU</strong> Section of Female and<br />

Functional Urology (ESFFU) and the <strong>EAU</strong> Section<br />

of Urological Imaging (ESUI)<br />

10.15 - 14.00 Imaging in female and functional urology<br />

Brown Hall 1-2 - Level S2<br />

Chairs: J.P.F.A. Heesakkers, Nijmegen (NL)<br />

J. Walz, Marseille (FR)<br />

10.15 - 10.20 Introduction<br />

J.P.F.A. Heesakkers, Nijmegen (NL)<br />

J. Walz, Marseille (FR)<br />

10.20 - 11.30 Female urology<br />

Chairs: F.R. Cruz, Porto (PT)<br />

C. Trombetta, Trieste (IT)<br />

10.20 - 10.50 How to visualise the female pelvic floor?<br />

10.20 - 10.30 Ultrasound<br />

M.X. Ferreira Coelho, Lisbon (PT)<br />

10.30 - 10.40 MRI<br />

M. Halaska, Prague (CZ)<br />

10.40 - 10.50 Video urodynamics<br />

P.F.W.M. Rosier, Utrecht (NL)<br />

10.50 - 11.10 What is new in the management of:<br />

10.50 - 11.00 Stress urinary incontinence?<br />

D.J.M.K. De Ridder, Leuven (BE)<br />

11.00 - 11.10 Pelvic organ prolapse?<br />

W. Artibani, Verona (IT)<br />

11.10 - 11.30 How to evaluate results after incontinence and prolapse surgery?<br />

11.10 - 11.20 Imaging in the evaluation of incontinence and prolapse surgery<br />

T. Loch, Flensburg (DE)<br />

11.20 - 11.30 How to correct complications after incontinence and prolapse surgery?<br />

E. Petri, Greifswald (DE)<br />

11.30 - 12.20 Functional urology and male incontinence<br />

Chairs: D.M Castro-Diaz, Santa Cruz de Tenerife (ES)<br />

P.A. Geavlete, Bucharest (RO)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

99<br />

Saturday


Saturday<br />

11.30 - 11.50 Male incontinence<br />

11.30 - 11.40 Imaging for post-prostatectomy incontinence<br />

P.A. Geavlete, Bucharest (RO)<br />

11.40 - 11.50 Management of post-prostatectomy incontinence<br />

R. Bauer, Munich (DE)<br />

11.50 - 12.20 Overactive bladder and LUTS<br />

11.50 - 12.00 Imaging as a non-invasive diagnostic tool in LUTS<br />

H. Wijkstra, Amsterdam (NL)<br />

12.00 - 12.10 Imaging in the management of overactive bladder<br />

F. Farag, Nijmegen (NL)<br />

12.10 - 12.20 What is new in the management of LUTS and OAB?<br />

P. Radziszewski, Warsaw (PL)<br />

12.20 - 12.30 Break<br />

12.30 - 13.10 <strong>EAU</strong> Section of Urological Imaging (ESUI)<br />

100 <strong>Programme</strong> <strong>Book</strong><br />

Chairs: B.M. Carey, Leeds (GB)<br />

J. Walz, Marseille (FR)<br />

12.30 - 12.40 ESUI Vision Award <strong>2013</strong><br />

Sponsored by an unrestricted educational grant from HITACHI MEDICAL SYSTEMS EUROPE<br />

12.40 - 13.10 What is new in imaging in <strong>2013</strong>?<br />

12.40 - 12.50 Prostate<br />

H. Heynemann, Halle/Saale (DE)<br />

12.50 - 13.00 Kidney; Bladder<br />

S. Siracusano, Trieste (IT)<br />

13.00 - 13.10 Lymph nodes; Testis and penis<br />

G. Salomon, Hamburg (DE)<br />

13.10 - 13.50 <strong>EAU</strong> Section of Female and Functional Urology (ESFFU)<br />

13.10 - 13.50 What is new in neurourology in <strong>2013</strong>?<br />

Chair: J.P.F.A. Heesakkers, Nijmegen (NL)<br />

13.10 - 13.30 FMRI<br />

T.M. Kessler, Zürich (CH)<br />

13.30 - 13.50 New treatment options<br />

R. Hamid, London (GB)<br />

13.50 - 14.00 Summary<br />

J.P.F.A. Heesakkers, Nijmegen (NL)<br />

J. Walz, Marseille (FR)


Aims and objectives<br />

The role of imaging in the study of female pelvic floor is fundamental. Every urologist has to know how to<br />

visualise the female pelvic floor by means of ultrasound, MRI and video urodynamics.<br />

Moreover today imaging is also mandatory in the evaluation of female incontinence and prolapse surgery,<br />

male incontinence, overactive bladder and LUTS expecially to evaluate the results of more recent surgical and<br />

non surgical therapies.<br />

During the session the ESUI Vision Award will be given to the author of the most innovative imaging study<br />

published in the last year.<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

101<br />

Saturday


Saturday<br />

Saturday, 16 March - <strong>EAU</strong> Section Meetings<br />

102 <strong>Programme</strong> <strong>Book</strong><br />

Meeting of the <strong>EAU</strong> Section of Urolithiasis (EULIS)<br />

10.15 - 14.00 Urolithiasis - on our way to personalised management<br />

Brown Hall 3 - Level S2<br />

Chair: P.J. Osther, Fredericia (DK)<br />

10.15 - 10.20 Introduction<br />

P.J. Osther, Fredericia (DK)<br />

10.20 - 11.20 Increasing stone prevention compliance through patient education<br />

Moderators: T. Bach, Hamburg (DE)<br />

S. Oehlschläger, Dresden (DE)<br />

J.M. Reis Santos, Lisbon (PT)<br />

10.20 - 10.40 How precisely do we really inform our patients regarding pathophysiology, nutrition and medication?<br />

B. Hess, Zurich (CH)<br />

10.40 - 11.00 Rapid screening of diet in renal stone formers<br />

A. Trinchieri, Lecco (IT)<br />

11.00 - 11.20 Modulation of urolithiasis risk through lifestyle changes: An internet based tool for patient selfmanagement<br />

D.J. Kok, Rotterdam (NL)<br />

11.20 - 12.30 Role of stone analysis in the personalised management of upper urinary tract stone disease<br />

Moderators: H-M. Fritsche, Regensburg (DE)<br />

C.M. Scoffone, Turin (IT)<br />

R. Siener, Bonn (DE)<br />

11.20 - 11.40 Recent changes in renal stone compositions: Data from over 2000,000 stone analyses<br />

T. Knoll, Sindelfingen (DE)<br />

11.40 - 12.10 Imaging for pre-treatment evaluation of stone composition and fragility<br />

J.C. Williams, Indianapolis (US)<br />

12.10 - 12.30 ERA lecture: How can stone analysis guide you towards effective metaphylaxis?<br />

G. Gambaro, Rome (IT)<br />

12.30 - 13.50 Complications in stone management: Individualised treatment strategies besed on case presentations:<br />

Metabolic/medical headaches; SWL catastrophes; Nightmare scenarios of endoscopic stone removal<br />

Moderators: P.J. Osther, Fredericia (DK)<br />

J. Rassweiler, Heilbronn (DE)<br />

Panel: N.N-P. Buchholz, London (GB)<br />

J.J.M.C.H. De La Rosette, Amsterdam (NL)<br />

F. Keeley, Bristol (GB)<br />

S. Lahme, Pforzheim (DE)<br />

K. Sarica, Istanbul (TR)<br />

A. Skolarikos, Athens (GR)<br />

M. Straub, Munich (DE)<br />

H.G. Tiselius, Stockholm (SE)


13.50 - 14.00 Announcements and final remarks<br />

P.J. Osther, Fredericia (DK)<br />

Aims and objectives<br />

The stone disease is extremely diverse – from single stone formers with spontaneous stone passage to<br />

staghorn stones and stone diseases associated with severe metabolic abnormalities such as renal tubular<br />

acidosis and primary hyperoxaluria. It is obvious that these different conditions should be dealt with<br />

selectively. For elimination of stones present in the upper urinary tract we have a multitude of modalities<br />

including SWL, PCNL, flexible and semirigid URS, litholysis etc. Recent years have brought us powerful tools<br />

to select the right patient for the right treatment. In this EULIS session we will explore into the modern<br />

concept of personalised stone management including life-style management, role of imaging and stone<br />

analysis as well as individualised complication management.<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

103<br />

Saturday


Saturday<br />

Saturday, 16 March - <strong>EAU</strong> Section Meetings<br />

104 <strong>Programme</strong> <strong>Book</strong><br />

Meeting of the <strong>EAU</strong> Section of Transplantation<br />

Urology (ESTU)<br />

10.15 - 14.00 Improving outcomes in kidney transplantation<br />

Red Hall 1 - Level N1<br />

Chairs: A.J. Figueiredo, Coimbra (PT)<br />

E. Lledo García, Madrid (ES)<br />

10.15 - 10.25 Introduction<br />

A.J. Figueiredo, Coimbra (PT)<br />

E. Lledo García, Madrid (ES)<br />

10.25 - 11.40 Organ donation<br />

Moderators: F.J. Burgos Revilla, Madrid (ES)<br />

K. Dreikorn, Bremen (DE)<br />

10.25 - 10.40 National Spanish Consensus Document of expanded criteria donor kidneys<br />

E. Lledo García, Madrid (ES)<br />

10.40 - 10.55 NHBD: Technique of organ retrieval and choice of the optimal recipient<br />

C. Terrone, Turin (IT)<br />

10.55 - 11.10 Altruistic paired donation: Where do we stand?<br />

O. Rodriguez Faba, Barcelona (ES)<br />

11.10 - 11.25 Matching of donor and recipient: Immunology, age, BMI, gender<br />

F.J. Burgos Revilla, Madrid (ES)<br />

11.25 - 11.40 Discussion<br />

11.40 - 12.55 Immunology<br />

Moderators: E. Lledo García, Madrid (ES)<br />

P. Di Tonno, Bari (IT)<br />

11.40 - 11.55 Transplant tolerance: Myth or reality?<br />

A.B. Chkhotua, Tbilisi (GE)<br />

11.55 - 12.10 Protocol biopsies - when, how, why / complications and management<br />

A.J. Figueiredo, Coimbra (PT)<br />

12.10 - 12.25 CMV in KTX - prophylaxis and therapy<br />

F. Kleinclauss, Besançon (FR)<br />

12.25 - 12.40 Attitude towards the non-functioning graft: Removal or persistence?<br />

P.T. Coelho Nunes, Coimbra (PT)<br />

12.40 - 12.55 Discussion<br />

12.55 - 13.50 Management of the transplanted patient<br />

Moderators: A.J. Figueiredo, Coimbra (PT)<br />

M. Giessing, Düsseldorf (DE)


12.55 - 13.10 Robotic prostatectomy after KTX<br />

G. Karam, Nantes (FR)<br />

13.10 - 13.25 Psychological impact and QoL of recipients of deceased donor kidneys<br />

V. Gomez, Madrid (ES)<br />

13.25 - 13.40 Dermatology: Skin cancer and KTX<br />

S. Piaserico, Padova (IT)<br />

13.40 - 13.50 Discussion<br />

13.50 - 14.00 Closing remarks<br />

A.J. Figueiredo, Coimbra (PT)<br />

E. Lledo García, Madrid (ES)<br />

Aims and objectives<br />

Organ transplantation is a fascinating area of medicine and advances come about in several complementary<br />

fields. All starts in donation and there are many ways of increasing the number of donors, both deceased<br />

ones and living donors. Advances in the understanding of transplant immunology are fundamental for<br />

achieving better results. On top of all that, looking beyond the graft in the management of the transplanted<br />

patient is paramount for the success of the transplantation.<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

105<br />

Saturday


Saturday<br />

Saturday, 16 March - <strong>EAU</strong> Section Meetings<br />

106 <strong>Programme</strong> <strong>Book</strong><br />

Meeting of the <strong>EAU</strong> Section of Infections<br />

in Urology (ESIU) and the <strong>EAU</strong> Section of<br />

Andrological Urology (ESAU)<br />

10.15 - 14.00 Urogenital infections and andrology<br />

Yellow Hall 1-2-3 - Level N1<br />

Chairs: T.E. Bjerklund Johansen, Århus (DK)<br />

W.H.G. Weidner, Giessen (DE)<br />

10.15 - 10.20 Welcome and introduction<br />

T.E. Bjerklund Johansen, Århus (DK)<br />

10.20 - 11.40 ESIU: 10 years GPIU anniversary programme<br />

Chairs: M. Grabe, Malmö (SE)<br />

P. Tenke, Budapest (HU)<br />

10.20 - 10.35 Urosepsis - the real emergency<br />

F.M.E. Wagenlehner, Giessen (DE)<br />

10.35 - 10.50 Fournier’s gangrene - the most lethal acute situation<br />

R. Bartoletti, Florence (IT)<br />

10.50 - 11.05 Use of antibiotics and the role of guidelines<br />

Z. Tandogdu, Istanbul (TR)<br />

11.05 - 11.20 Prevalence, susceptibility and resistance in urogenital infections<br />

H.M. Çek, Istanbul (TR)<br />

11.20 - 11.35 Prevention and control of antimicrobial resistance in Europe: The role of ECDC<br />

D. Monnet, Stockholm (SE)<br />

11.35 - 11.40 Discussion<br />

11.40 - 12.30 Joint session ESIU and ESAU: Urogenital infections in andrology<br />

Chairs:<br />

ESIU K.G. Naber, Straubing (DE)<br />

ESAU D. Ralph, London (GB)<br />

11.40 - 11.55 Prostatitis<br />

R.S. Pickard, Newcastle upon Tyne (GB)<br />

11.55 - 12.10 Epididymo-orchitis and male infertility<br />

N. Sofikitis, Ioannina (GR)<br />

12.10 - 12.25 Infections of the penile shaft and outcome for sexual function<br />

C. Bettocchi, Bari (IT)


12.25 - 12.30 Discussion<br />

12.30 - 13.55 ESAU: News for the andrologist in <strong>2013</strong><br />

Chairs: N. Sofikitis, Ioannina (GR)<br />

E. Wespes, Charleroi (BE)<br />

12.30 - 12.45 Varicocele therapy improves the male fertility status: What is proven?<br />

G.R. Dohle, Rotterdam (NL)<br />

12.45 - 13.00 Metabolic syndrome and erectile dysfunction/hypogonadism<br />

E.J.H. Meuleman, Amsterdam (NL)<br />

13.00 - 13.15 New drugs in male infertility, ejaculatory and erectile dysfunction<br />

F. Fusco, Naples (IT)<br />

13.15 - 13.30 Whats is new in Peyronie’s disease?<br />

A. Kadioglu, Istanbul (TR)<br />

13.30 - 13.45 New aspects of sexual medicine for the andrological urologist<br />

E.A. Jannini, L’Aquila (IT)<br />

13.45 - 13.55 Discussion<br />

13.55 - 14.00 Conclusion<br />

W.H.G. Weidner, Giessen (DE)<br />

Aims and objectives<br />

This joint section session will provide an up-to-date discussion of the most lethal infective complications<br />

in urology, raising antimicrobial resistance and the prudent use of antibiotics. Infections and infective<br />

complications in all male sex organs will be discussed from an infectious and andrological perspective.<br />

An extensive update will be given on the most important topics in andrology like varicocele, metabolic<br />

syndrome, erectile dysfunction, Peyronie`s disease and sexual medicine. All topics will be addressed by key<br />

international experts and opinion leaders.<br />

Upon the completion of this joint session, the delegates will know how to deal with urosepsis and Fournier`s<br />

gangrene and understand the basis for prudent use of antibiotics. The delegates will be educated on how to<br />

avoid and treat infective complications in andrological surgery and be familiar with state of the art diagnostic<br />

work-up and treatment of the most important conditions in andrology.<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

107<br />

Saturday


Saturday<br />

Saturday, 16 March - <strong>EAU</strong> Section Meetings<br />

10.15 - 14.00<br />

108 <strong>Programme</strong> <strong>Book</strong><br />

Joint Meeting of the European Organisation<br />

for Research and Treatment of Cancer Genito-<br />

Urinary Cancer Group (EORTC GUCG), the <strong>EAU</strong><br />

Section of Urological Research (ESUR), the <strong>EAU</strong><br />

Section of Oncological Urology (ESOU) and the<br />

<strong>EAU</strong> Section of Uropathology (ESUP)<br />

Silver Hall - Level N2<br />

10.15 - 12.00 EORTC GUCG Group and ESUR: Personalised medicine<br />

Chairs: Z. Culig, Innsbruck (AT)<br />

B. Tombal, Brussels (BE)<br />

10.15 - 10.20 Introduction<br />

Z. Culig, Innsbruck (AT))<br />

B. Tombal, Brussels (BE)<br />

10.20 - 10.35 Personalised medicine in prostate cancer<br />

T. Van Der Kwast, Toronto (CA)<br />

10.35 - 10.50 EORTC risk calculator and beyond; How to improve strategies to individualise therapy in NMIBC<br />

R.J. Sylvester, Brussels (BE)<br />

10.50 - 11.05 Personalised approach in renal cancer<br />

B. Escudier, Villejuif (FR)<br />

11.05 - 11.20 Personalising surgery in advanced renal cell carcinoma<br />

A. Bex, Amsterdam (NL)<br />

11.20 - 11.35 Individual approach in bladder cancer<br />

D. Theodorescu, Aurora (US)<br />

11.35 - 11.50 Postoperative radiotherapy after radical prostatectomy: What has been learned from prospective trials and<br />

will never be learned from retrospective ones?<br />

N.W. Clarke, Manchester (GB)<br />

11.50 - 12.00 Close<br />

Z. Culig, Innsbruck (AT))<br />

B. Tombal, Brussels (BE)<br />

12.00 - 14.00 ESOU and ESUP: Clinical forum in prostate and renal cancer<br />

Chairs: M. Brausi, Modena (IT)<br />

A. Lopez-Beltran, Cordoba (ES)<br />

12.00 - 12.05 Introduction<br />

M. Brausi, Modena (IT)<br />

A. Lopez-Beltran, Cordoba (ES)


12.05 - 13.00 Clinical forum: Diagnosis and treatment of small foci of PCa<br />

Moderator: M. Brausi, Modena (IT)<br />

12.05 - 12.20 New tools for diagnosis<br />

G. Villeirs, Ghent (BE)<br />

12.20 - 12.35 Pathologic characteristics of low risk PCa: Multifocality and prognostic factors<br />

R. Montironi, Torrette Di Ancona (IT)<br />

12.35 - 12.50 Treatments of low risk PCa<br />

B. Djavan, Vienna (AT)<br />

12.50 - 13.00 Discussion<br />

13.00 - 14.00 Clinical forum: Locally advanced renal cancer<br />

Moderator: A. Lopez-Beltran, Cordoba (ES)<br />

13.00 - 13.15 The role of biopsy in renal masses<br />

A. Volpe, Novara (IT)<br />

13.15 - 13.30 Pathological prognostic factors<br />

F. Algaba, Barcelona (ES)<br />

13.30 - 13.45 Treatment of small renal masses<br />

H.A. Özen, Ankara (TR)<br />

13.45 - 13.55 Discussion<br />

13.55 - 14.00 Close<br />

M. Brausi, Modena (IT)<br />

A. Lopez-Beltran, Cordoba (ES)<br />

Aims and objectives<br />

EORTC GUCG and ESUR:<br />

Clinical trials should be based on targeting molecules which are overexpressed in a disease and functionally<br />

associated with its development and progression. In several human cancers, expression of target candidates<br />

is specific in individual patient tissues and not the same in primary lesions and metastases of one patient.<br />

The purpose of the joint session is to convince the audience that biologically-based clinical trials should<br />

be carried out. Results obtained with experimental models open the ways to use novel agents in cancer<br />

therapy, however there should be an appropriate information about expression of possible targets and<br />

related signaling pathways in clinical specimens available. In addition, new trial methodologies will have to<br />

be developed to clinically assess the response of the cancer to these drugs. This will be done by embedding<br />

traditional endpoints, such as progression free survival and overall survival, with modern functional imaging<br />

endpoints.<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

109<br />

Saturday


Saturday<br />

Saturday, 16 March - <strong>EAU</strong> Section Meetings<br />

110 <strong>Programme</strong> <strong>Book</strong><br />

Meeting of the <strong>EAU</strong> Section of Genito-Urinary<br />

Reconstructive Surgeons (ESGURS)<br />

10.15 - 14.00 Urethral reconstruction and complication management after radical<br />

prostatectomy<br />

Blue Hall 1-2 - Level N1<br />

Chair: S. Deger, Ostfildern (DE)<br />

10.15 - 11.00 Debate: Dorsal versus ventral grafting for urethroplasty<br />

Moderator: M.M. Fisch, Hamburg (DE)<br />

10.15 - 10.30 Dorsal grafting<br />

D.E. Andrich, London (GB)<br />

10.30 - 10.45 Ventral grafting, when and why?<br />

E. Palminteri, Arezzo (IT)<br />

10.45 - 11.00 Closing remarks from chair and panel<br />

D.E. Andrich, Kingston upon Thames (GB)<br />

M.M. Fisch, Hamburg (DE)<br />

A.R. Mundy, London (GB)<br />

E. Palminteri, Arezzo (IT)<br />

11.00 - 11.45 Part 2<br />

Moderators: B.M. Alici, Istanbul (TR)<br />

O.Z. Shenfeld, Jerusalem (IL)<br />

11.00 - 11.15 Failed IPP surgery<br />

R.P. Djinovic, Belgrade (RS)<br />

11.15 - 11.30 Management of cavernosal tissue fibrosis after failed IPP treatment<br />

I. Moncada, Madrid (ES)<br />

11.30 - 11.45 Hypospadias cripple - which techniques are optimal for initial repair and re-dos<br />

A. Zhivov, St. Petersburg (RU)<br />

11.45 - 12.40 Part 3<br />

Moderators: S. Deger, Ostfildern (DE)<br />

O. Demirkesen, Istanbul (TR)<br />

11.45 - 12.00 The posterior urethral complications of the treatment of prostate cancer<br />

A.R. Mundy, London (GB)<br />

12.00 - 12.15 Endoscopic management of vesicourethral anasthomosis contracture? York-Mason procedure with buccal<br />

mucosa for a recto urinary fistula<br />

V. Pansadoro, Rome (IT)<br />

12.15 - 12.25 Discussion<br />

12.25 - 12.40 A tribute to Edoardo Austoni, the urologist; a man; our friend<br />

V. Pansadoro, Rome (IT)


12.40 - 14.00 Part 4<br />

Moderators: D.E. Andrich, London (GB)<br />

K-D. Sievert, Tübingen (DE)<br />

12.40 - 13.00 Grafts in urethral reconstruction: Which grafts? How to harvest?<br />

N. Lumen, Ghent (BE)<br />

13.00 - 13.20 Penile skin replacement with reversed mesh graft<br />

P. Hoebeke, Ghent (BE)<br />

13.20 - 13.40 First results of the urethroplasty with tissue engineered buccal mucosa<br />

R. Dahlem, Hamburg (DE)<br />

13.40 - 13.55 Buccal mucosa after radiation therapy?<br />

S. Ahyai, Hamburg (DE)<br />

13.55 - 14.00 ESGURS activities <strong>2013</strong>-2014<br />

S. Deger, Ostfildern (DE)<br />

Aims and objectives<br />

We want to share new developments in grafts for urethral reconstruction and go for an interesting debate on<br />

dorsal versus ventral grafting. Penile surgery for IPP will be another interesting part. Facing complications<br />

for radical prostatectomy can always be challenging. Options and tips will be presented from experts.<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

111<br />

Saturday


Saturday<br />

Saturday, 16 March - <strong>EAU</strong> <strong>Programme</strong><br />

112 <strong>Programme</strong> <strong>Book</strong><br />

Special Session<br />

13.00 - 14.00 Urology in Italian art<br />

Green Hall 1 - Level N1<br />

Chair: D. Schultheiss, Giessen (DE)<br />

13.00 - 13.20 State-of-the-art-lecture Castrati singers and the birth of opera<br />

M. Hatzinger, Frankfurt (DE)<br />

13.20 - 13.40 State-of-the-art-lecture Urological aspects in the anatomical work of Leonardo da Vinci<br />

D. Schultheiss, Giessen (DE)<br />

13.40 - 14.00 State-of-the-art-lecture The phallus in Italian art<br />

J. Mattelaer, Kortrijk (BE)


Saturday, 16 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

14.15 - 15.45 LESS & NOTES<br />

Platinum Hall - Level S3<br />

Video Session 1<br />

Chairs: H-P. Beerlage, ‘s-Hertogenbosch (NL)<br />

R. Rabenalt, Düsseldorf (DE)<br />

All presentations have a maximum length of 10 minutes, followed by 4 minutes of discussion.<br />

V1 Clampless laparoendoscopic single-site partial nephrectomy for renal cancer with low PADUA score:<br />

Technique and surgical outcomes<br />

F. Greco, D. Veneziano, C. Springer, A. Inferrera, P. Fornara (Halle Saale, Germany)<br />

V2 Robotic transrectal hybrid NOTES nephrectomy: Initial experience in a cadaver model<br />

R. Eyraud, H. Laydner, R. Autorino, S. Hillyer, J.A. Long, K. Panumatrassamee, A. Khalifeh, R. Stein,<br />

G.P. Haber, J. Kaouk (Cleveland, United States of America)<br />

V3 First clinical application: Transvaginal hybrid NOTES robotic donor nephrectomy<br />

R. Autorino, A. Khalifeh, H. Laydner, S. Hillyer, D. Samarasekera, K. Panumatrassamee, H. Goldman,<br />

C. Modlin, J. Kaouk (Cleveland, United States of America)<br />

V4 Hybrid transvaginal nephrectomy: Development of our technique<br />

I. Georgiopoulos, P. Kallidonis, I. Kyriazis, J-U. Stolzenburg, E. Liatsikos (Patras, Greece; Leipzig, Germany)<br />

V5 Umbilical laparoendoscopic radical nephrectomy (LESS-RN) with KeyPort system and duo-rotate<br />

instruments<br />

P.M. Cabrera, F. Caceres, E. Mateo, J.M. Garcia-Mediero, F. Lista, J.C. Angulo (Madrid, Spain)<br />

V6 Laparo-endoscopic single site transvesical bladder cuff excision<br />

R. Sotelo Noguera, G. Fernandez, J. Arriaga, O. Carmona, R. De Andrade, C. Giedelman, Z. Pascal, B. Irwin,<br />

A. Monish, M. Desai, I. Gill, J. Saavedra (Caracas, Venezuela; Los Angeles, United States of America)<br />

V7 Umbilical radical nephroureterectomy, bladder cuff excision and lymphadenectomy with KeyPort system in<br />

a case of upper urinary tract urothelial cancer<br />

F. Caceres, P. Cabrera, A. García-Tello, G. Andres, E. Mateo, J.C. Angulo (Madrid, Spain)<br />

V8 Laparoendoscopic radical cystectomy with orthotopic ileal neobladder through umbilical single port<br />

F. Caceres, P.M. Cabrera, A. Garcia-Tello, I. Arance, I. Romero, J.C. Angulo (Madrid, Spain)<br />

V9 LESS partial cystectomy with extended pelvic lymph node dissection for invasive bladder cancer in a<br />

diverticulum<br />

P.M. Cabrera, F. Caceres, F. Ramon De Fata, A. Garcia-Tello, H. Gimbernat, J.C. Angulo (Madrid, Spain)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

113<br />

Saturday


Saturday<br />

Saturday, 16 March - <strong>EAU</strong> <strong>Programme</strong><br />

114 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

14.15 - 15.45 New therapies in castration resistant prostate cancer<br />

Brown Hall 1-2 - Level S2<br />

Poster Session 9<br />

Chairs: T.A. Borkowski, Warsaw (PL)<br />

M. De Santis, Vienna (AT)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

* 97 Updated interim analysis (IA): Results of randomized phase 3 study COU-AA-302 of abiraterone acetate<br />

(AA) in metastatic castration-resistant prostate cancer (mCRPC) patients (pts) without prior chemotherapy<br />

H. Van Poppel, D. Rathkopf, M.R. Smith, J.S. De Bono, C.J. Logothetis, N.D. Shore, P. De Souza, K. Fizazi,<br />

P.F.A. Mulders, P. Mainwaring, J.D. Hainsworth, T.M. Beer, S. North, Y. Fradet, T. Griffin, Y.C. Park, T. Kheoh,<br />

E.J. Small, H.I. Scher, A. Molina, C.J. Ryan (Leuven, Belgium; New York, Boston, Houston, Myrtle Beach,<br />

Nashville, Portland, Los Angeles, Raritan, San Francisco, United States of America; Sutton, United Kingdom;<br />

Liverpool, Brisbane, Australia; Villejuif, France; Nijmegen, The Netherlands; Edmonton, Quebec, Canada)<br />

* 98 Combination therapy of peptide vaccines and dexamethasone for chemotherapy naïve castration resistant<br />

prostate cancer - a randomized phase-2 study<br />

H. Uemura, T. Kimura, K. Yoshimura, T. Minami, M. Nozawa, T. Nakagawa, H. Fujimoto, S. Egawa,<br />

A. Yamada, K. Itoh (Osaka, Tokyo, Fukuoka, Japan)<br />

99 The impact of bone metastases on pain: Results from a phase III denosumab study in men with<br />

nonmetastatic castration-resistant prostate cancer<br />

D. Patrick, M.R. Smith, C. Cleeland, L. Fallowfield, B. Tombal, S. Oudard, N. Shore, F. Saad, G. Marx,<br />

R. Coleman, F. Gómez-Veiga, R. Damião, Y. Zhou, J. Arellano, A. Braun, Y. Qian (Seattle, Boston, Houston,<br />

Myrtle Beach, Thousand Oaks, United States of America; Brighton, Sheffield, United Kingdom; Brussels,<br />

Belgium; Paris, France; Montreal, Canada; Wahroonga, Australia; A Coruna, Spain; Rio de Janeiro, Brazil)<br />

100 Investigational single agent orteronel (ortl, TAK-700) in patients with nonmetastatic castration-resistant<br />

prostate cancer (nmCRPC): Updated results<br />

M. Hussain, P.G. Corn, D. Michaelson, H.J. Hammers, J.J. Alumkal, C.J. Ryan, J.Y. Bruce, S. Moran,<br />

D. Maclean, S-Y. Lee, P. Mortimer, D.J. George (Ann Arbor, Houston, Boston, Baltimore, Portland, San<br />

Francisco, Madison, Cambridge, Durham, United States of America; London, United Kingdom)<br />

101 Updated analysis of radium-223 dichloride (Ra-223) impact on pain, skeletal-related events (SRE), and<br />

survival from the phase 3 randomized trial (ALSYMPCA) in patients with castration-resistant prostate<br />

cancer (CRPC) and bone metastases<br />

D. Heinrich, S.I. Helle, A. Chodacki, P. Wiechno, J. Garcia-Vargas, K. Staudacher, C. Parker (Lørenskog,<br />

Bergen, Oslo, Norway; Chomutov, Czech Republic; Warsaw, Poland; Montville, New Jersey, United States of<br />

America; Sutton, United Kingdom)<br />

102 GTx-758, an ERα agonist, reduces serum free testosterone lower than can be achieved by leuprolide with<br />

a significantly lower rate of hot flashes in men with advanced prostate cancer<br />

R.H. Getzenberg, C.C. Coss, M.L. Hancock, J.T. Dalton, M.S. Steiner (Memphis, United States of America)<br />

103 P10-1 open-label, multicenter study of sipuleucel-T in metastatic castrate-resistant prostate cancer<br />

(mCRPC) patients (pts) previously treated with sipuleucel-T: Evaluation of antigen-presenting cell (APC)<br />

activation and cellular immune response data<br />

T.M. Beer, J. Corman, R. Sims, Y. Wang, C. De La Rosa, N. Sheikh (Portland, Seattle, United States of<br />

America)


104 Overall survival with cabazitaxel is strongly related to PSA response: Results of a retrospective registry in<br />

metastatic castration resistant prostate cancer (mCRPC)<br />

A. Angelergues, F. Mercier, A. Flechon, A. Guillot, S. Le Moulec, G. Gravis, P. Beuzeboc, C. Massard,<br />

K. Fizazi, T. De La Motte Rouge, R. Elaidi, S. Oudard (Paris, Port-Mort, Lyon, St-Etienne, Marseille, Villejuif,<br />

France)<br />

105 Exploratory analysis of the visceral disease patient subset in COU-AA-301, a phase III study of abiraterone<br />

acetate (AA) in metastatic castration-resistant prostate cancer (mCRPC)<br />

H. Suttmann, P.F.A. Mulders, A. Molina, O.B. Goodman, Jr., T.W. Flaig, J. Li, T. Kheoh, J.S. De Bono, H.I. Scher<br />

(Hamburg, Germany; Nijmegen, The Netherlands; Los Angeles, Las Vegas, Aurora, Raritan, New York,<br />

United States of America; Sutton, United Kingdom)<br />

106 Cabazitaxel adverse events are manageable in senior adults with metastatic castration-resistant prostate<br />

cancer (mCRPC): Results of the European Compassionate Use <strong>Programme</strong><br />

A. Heidenreich, S. Bracarda, M. Mason, H. Ozen, L. Sengelov, W. Gerritsen, C. Papandreou, S. Fossa,<br />

S. Hitier, M. Climent (Aachen, Germany; Arezzo, Italy; Wales, United Kingdom; Ankara, Turkey; Herlev,<br />

Denmark; Nijmegen, The Netherlands; Larissa, Greece; Olso, Norway; Paris, France; Valencia, Spain)<br />

107 Evaluation of circulating tumor cells to predict metastatic progression in men treated with abirateron<br />

acetat for castration resistant prostate cancer: A sub-analysis of the German named patient program<br />

T. Steuber, P. Stroelin, T. Schlomm, H. Heinzer, K. Pantel, S. Riethdorf (Hamburg, Germany)<br />

108 Denosumab in men with non-metastatic castration-resistant prostate cancer (CRPC) and PSA doubling time<br />

(PSADT) ≤6 months<br />

K. Miller, M.R. Smith, D. Dearnaley, L. Dogliotti, B. Egerdie, K. Fizazi, F. Kueppers, L. Montes De Oca,<br />

J. Morote, I. Pavlik, P. Sieber, T.L. Tammela, H. Van Poppel, M. Wirth, S. Wong, Z. Ye, A. Braun (Berlin,<br />

Dresden, Germany; Boston, Lancaster, Thousand Oaks, United States of America; Sutton, United Kingdom;<br />

Orbassano, Italy; Kitchener, Canada; Villejuif, France; Christchurch, New Zealand; Buenos Aires, Argentina;<br />

Barcelona, Spain; Prague, Czech Republic; Tampere, Finland; Leuven, Belgium; Footscray, Australia)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

115<br />

Saturday


Saturday<br />

Saturday, 16 March - <strong>EAU</strong> <strong>Programme</strong><br />

116 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

14.15 - 15.45 Pelvic organ prolapse: From bench to bedside<br />

Amber Hall 1-2 - Level S2<br />

Poster Session 10<br />

Chairs: V. Gomez Dos Santos, Madrid (ES)<br />

F. Haab, Paris (FR)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

* 109 In vivo assessment of the acute host response against a novel tissue engineered to treat stress urinary<br />

incontinence and pelvic organ prolapse<br />

S. Roman, N. Osman, A.J. Bullock, C.R. Chapple, S. Macneil (Sheffield, United Kingdom)<br />

110 Development of tissue engineered bio-absorbable cellularised mesh for stress urinary incontinence and<br />

pelvic organ prolapse: The effect of chemical and mechanical stimulation on improving tensile properties<br />

N. Osman, S. Roman, G. Gigliobianco, A. Bullock, C. Chapple, S. Macneil (Sheffield, United Kingdom)<br />

111 A novel technique for anterior vaginal wall prolapse repair; anterior vaginal wall darn (AVWD)<br />

O. Köse, H.S. Saglam, S. Kumsar, S. Budak, Ö. Adsan (Sakarya, Turkey)<br />

112 Impact of laparoscopic sacrocolpopexy: A multicentric prospective analysis<br />

F.J.P. Thibault, L. Wagner, R. Thanigasalam, G. Seni, M. Brouzyine, L. Cayzergues, R. De Tayrac, S. Droupy,<br />

P. Costa (Vandoeuvre Les Nancy, Nîmes, Paris, La Talaudière, France)<br />

113 A.M.I. pelvic floor repair system. A novel system for full reconstruction of complex pelvic floor prolapse<br />

E.A. Fes Ascanio, D. Alonso Rodriguez, L. Fernandez Barranco, T. Vicens Vicens, F. Garcia Montes (Palma de<br />

Mallorca, Spain)<br />

114 Quality of life after an anterior vaginal wall suspension procedure to correct urinary incontinence with<br />

concomitant anterior compartment prolapse based on type of incontinence at baseline<br />

P. Zimmern, C. Bascu, B.E. Dillon, D. Lee, A. Christie, X-J. Xie (Dallas, United States of America)<br />

* 115 Risk factors associated with perioperative and mesh-related complications for patients undergoing pelvic<br />

organ prolapse surgery: Analysis of 677 cases<br />

G.R. Kasyan, K.N. Abramyan, A.A. Popov, D.Y. Pushkar (Moscow, Russia)<br />

116 Impact of midurethral sling procedure on couple’s sexual function<br />

P.H. Song, J.W. Choi, Y.S. Ji, Y.H. Ko, K.H. Moon, H.C. Jung (Daegu, South Korea)<br />

117 Evaluation of sexual functions in females receiving renal replacement therapies<br />

R. Demir, Y. Bostanci, F. Atac, E. Ozden, C. Kaya, S. Sarikaya, Y.K. Yakupoglu (Samsun, Turkey)<br />

118 Withdrawn<br />

119 Utilization and peri-operative outcomes of robot-assisted and open vaginal vault suspension<br />

H. Li, J.D. Sammon, M. Ehlert, K.R. Ghani, S. Sukumar, H. Atiemo, M. Menon (Detroit, United States of<br />

America)<br />

Discussion on robotics, is it the future?<br />

F. Haab, Paris (FR)


Saturday, 16 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

14.15 - 15.45 Men’s sexual health<br />

Amber Hall 7-8 - Level S2<br />

Poster Session 11<br />

Chairs: I. Gruenwald, Haifa (IL)<br />

Y. Reisman, Amstelveen (NL)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

* 120 The risk of developing erectile dysfunction increases successively with increasing age: A longitudinal study<br />

in men aged 45 years and above<br />

C.J. Stranne, U.G.H. Malmsten, B. Areskoug, I. Milsom, U. Molander, R. Peeker (Gothenburg, Sweden)<br />

121 Expectations for sexual life after radical prostatectomy: Dissociation between patients and partners<br />

Y. Sato, H. Tanda, H. Nakajima, T. Nitta, K. Akagashi, T. Hanzawa, M. Tobe, K. Haga, K. Uchida, I. Honma<br />

(Sapporo, Japan)<br />

122 Treatment effect of PDE5-inhibitors may improve with time following radical prostatectomy<br />

M. Fode, J. Sønksen, H. Jakobsen (Herlev, Denmark)<br />

123 Withdrawn<br />

124 Serum C-reactive protein levels and response rate to tadalafil 5 mg once daily in erectile dysfunction<br />

patients with diabetes<br />

H.J. Park, N.C. Park, S.M. Kang (Busan, South Korea)<br />

125 Prospective evaluation of the systemic mistakes in oral intake of the phosphodiesterase inhibitors ten<br />

years after their release<br />

B. García Gómez, J. Romero Otero, E. Jiménez Alcaide, L. García González, E. García Cruz, A. Leibar Tamayo,<br />

A. Rodríguez Antolín (Madrid, Spain)<br />

126 The frequencies and characteristics of men receiving medical intervention for erectile dysfunction: Analysis<br />

of 6.2 million patients<br />

O. Cakir, H. Aurora, T. Helfand, T. McVary (Chicago, Evanston, United States of America)<br />

127 Erectile function after nerve-sparing radical prostatectomy: Concepts for rehabilitation in Germany<br />

A. Bannowsky, S. Ückert, N. Mosaheb, A. Raileanu, H. Van Ahlen (Osnabrück, Hanover, Germany)<br />

128 The correlation between obstructive sleep apnea syndrome and erectile dysfunction<br />

H. Tokgoz, E. Akyurek, T. Ornek, R. Altin, B. Akduman, N.A. Mungan (Zonguldak, Turkey)<br />

129 Penile prosthesis insertion in patients with refractory ischemic priapism: Immediate versus delayed<br />

implantation<br />

E. Zacharakis, G. Garaffa, A.A. Raheem, A. Muneer, N. Christopher, S. Minhas, D. Ralph (London, United<br />

Kingdom)<br />

130 Does psychosexual counselling significantly influence organic and erotic functions after penile prosthesis<br />

implantation? Preliminary results of a two-arm controlled trial<br />

F. Pisano, C. Fiorito, F. Soria, A.M. Abbona, F. Peraldo, P. Gontero (Turin, Italy)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

117<br />

Saturday


Saturday<br />

131 Mid-term analysis (6 months) of the effect of penile low intensity shock-wave therapy for ED patients with<br />

varying etiology and severity<br />

B. Appel, I. Gruenwald, Y. Vardi (Haifa, Israel)<br />

132 Cavernous vein leakage: Diagnosis with 3D CT cavernosography reveals promising treatment by DVC<br />

bunching<br />

Y. Kawanishi, R. Tomida, H. Mori, T. Nakashima, H. Yamamoto, M. Yamanaka, H. Muguruma, S. Kawanishi<br />

(Takamatsu, Japan)<br />

118 <strong>Programme</strong> <strong>Book</strong>


Saturday, 16 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

14.15 - 15.45 Diagnostics in early prostate cancer<br />

Silver Hall - Level N2<br />

Poster Session 12<br />

Chairs: A. Govorov, Moscow (RU)<br />

A. Villers, Lille (FR)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

133 PSA-pyramid in men with low range PSA: PCa incidence and mortality - a plea for risk-based prostate<br />

cancer screening strategy in the European Randomized study of Screening for Prostate Cancer (ERSPC),<br />

Aarau<br />

M. Randazzo, D Seiler, J. Beatrice, M. Baumgartner, A. Huber, R. Grobholz, L. Manka, F. Recker,<br />

M. Kwiatkowski (Aarau, Switzerland; Braunschweig, Germany)<br />

134 Withdrawn<br />

135 Psychological impact of PSA testing and biopsy using the impact of event scale<br />

E.T. Kok, E.L. Turner, M.J. Davis, C. Metcalfe, J.A. Lane, D.E. Neal, F.C. Hamdy, J.L. Donovan (Utrecht, The<br />

Netherlands; Bristol, Cambridge, Oxford, United Kingdom)<br />

136 A randomized multicenter trial comparing 12 to 20-core prostate biopsy protocol<br />

J. Irani, P. Blanchet, L. Salomon, P. Coloby, J. Hubert, B. Malavaud, N. Mottet (Poitiers, Guadeloupe, Creteil,<br />

Pontoise, Nancy, Toulouse, Saint-Etienne, France)<br />

137 PHI (Prostate Health Index) and %p2PSA for prediction of prostate cancer in men younger than 60 years of<br />

age. A nested-case control study from PROpsa Multicentric European Study (PROMEtheuS project)<br />

T. McNicholas, M. Lazzeri, A. Haese, A. De La Taille, J. Palou, G. Lughezzani, V. Scattoni, G. Lista, A. Larcher,<br />

A. Cestari, N. Buffi, M. Freschi, L. Fowler, J.W. Roux, A. Renter, M. Graefen, P.O. Bosset, P. Le Corvoisier,<br />

A. Breda, P. De La Torre, V. Bini, G. Guazzoni (Stevenage, United Kingdom; Milan, Perugia, Italy; Hamburg,<br />

Germany; Creteil, France; Barcelona, Spain)<br />

* 138 Standards in reporting of MRI-targeted prostate biopsies (START): Recommendations from an international<br />

working party<br />

V. Kasivisvanathan, C.M. Moore, S. Eggener, M. Emberton, J.F. Futterer, I. Gill, R. Grubb, B. Hadaschik,<br />

L. Klotz, D. Margolis, L. Marks, J. Melamed, A. Oto, S. Palmer, P. Pinto, P. Pueche, S. Punwani,<br />

A. Rosenkrantz, I. Shoots, R. Simon, S. Taneja, B. Turkbey, O. Ukimura, J. Van Der Meulen, A. Villers,<br />

Y. Watanabe (London, Chicago, United Kingdom; Nijmegen, Rotterdam, The Netherlands; Los Angeles,<br />

St Louis, New York, Chicago, Bethesda, United States of America; Heidelberg, Germany; Toronto, Canada;<br />

Lille, France; Kurashiki, Japan)<br />

139 Reducing unnecessary biopsies for suspicion of prostate cancer: Extension and validation of an ERSPC<br />

based risk calculator with Phi<br />

M.J. Roobol, D. Nieboer, A. Houlgatte, S. Vincendeau, M. Lazzeri, G. Guazzoni, C. Stephan, A. Semjonow,<br />

A. Haese, M. Graefen, E.W. Steyerberg (Rotterdam, The Netherlands; Paris, Rennes, France; Milan, Italy;<br />

Berlin, Munster, Hamburg, Germany)<br />

140 Diabetes mellitus increases the risk of poorly differentiated tumor in prostate cancer patients<br />

A. Nini, M. Sun, P.I. Karakiewicz, M. Bianchi, N.M. Passoni, A. Salonia, A. Galllina, F. Castiglione, N. Fossati,<br />

R. Matloob, G. La Croce, F. Abdollah (Milan, Italy; Montreal, Canada)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

119<br />

Saturday


Saturday<br />

141 Pre-biopsy magnetic resonance imaging and prostate cancer detection: Comparison of random and MRItargeted<br />

biopsies using three different techniques of MRI-TRUS image registration<br />

N. Barry Delongchamps, M. Peyromaure, A. Schull, F. Beuvon, N. Bouazza, T. Flam, M. Zerbib, P. Legman,<br />

F. Cornud (Paris, France)<br />

* 142 Performance of MRI-TRUS fusion in transperineal template prostate re-biopsy<br />

S.Y.W. Tang, E.M. Lawrence, B. Koo, A.W. Nelson, K. Wadhwa, T. Barrett, A. Warren, R. Axell, A. Doble,<br />

F.A. Gallagher, V.J. Gnanapragasam, E. Sala, C. Kastner (Cambridge, United Kingdom)<br />

143 An evaluation of Real-Time-Elastography (RTE): Its detection rate of prostate cancer compared to multiple<br />

core biopsies and its dependance of PSA and the volume of the prostate<br />

O. Lenherr, A. Fayyazi, P. Liske, S. Lahme (Pforzheim, Germany)<br />

120 <strong>Programme</strong> <strong>Book</strong><br />

Summary - How reliable is imaging for screening<br />

A. Villers, Lille (FR)


Saturday, 16 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

14.15 - 15.45 Bladder cancer: Gene expression and molecular classification<br />

Red Hall 1 - Level N1<br />

Poster Session 13<br />

Chairs: P.J. Boström, Turku (FI)<br />

M. Sanchez-Carbayo, Madrid (ES)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion.<br />

144 Bortezomib synergizes with vorinostat to cause ubiquitinated protein accumulation and histone acetylation<br />

in bladder cancer cells<br />

A. Sato, T. Asano, K. Ito, T. Asano (Tokorozawa, Japan)<br />

145 Whole transcriptome sequencing reveals dynamic changes in gene expression of progressive, lethal<br />

bladder cancer<br />

N. Sapre, G. Macintyre, J. Pedersen, A. Ryan, A. Kowalczyk, P. Anderson, A.J. Costello, N.M. Corcoran,<br />

C.M. Hovens (Melbourne, Australia)<br />

146 Cell membrane glycosphingolipids are involved in the control of bladder cancer invasive properties<br />

A. Bettiga, M. Aureli, G. Colciago, D. Canals, M. Moschini, P. Hedlund, S. Sonnino, Y.A. Hannon, F. Benigni<br />

(Milan, Italy; Charleston, South Carolina, United States of America)<br />

147 In vitro cell viability and proliferation of electrospun scaffold made of PCL and PHBV for tissue engineered<br />

urinary diversions<br />

A. Vianello, A. Giannantoni, V. Maulà, C. Del Gaudio, A. Bianco, G. Bellezza, M. Porena (Perugia, Rome,<br />

Italy)<br />

148 B-cell translocation gene 2: A tumor suppressor gene is upregulated by resveratrol in bladder carcinoma<br />

cells<br />

H-H. Juang, P-L. Chang, K-H. Tsui (Kwei-Shan, Tao-Yuan, Taiwan)<br />

149 CIP2A is associated with human bladder cancer aggressivity<br />

Y. Xue, X. Zou, B. Jiang, G. Zhang, Y. Liao, G. Wu, X. Wang, F. Liu, J. Yang, H. Xu, M. Liu (Ganzhou, China)<br />

150 High expression of HuR in cytoplasm, but not nuclei, associated with malignant aggressiveness and<br />

prognosis in non-muscle invasive bladder cancer<br />

Y. Miyata, K. Ohba, T. Matsuo, K. Mitsunari, Y. Sagara, H. Sakai (Nagasaki, Japan)<br />

151 Association of the expression of T-cell coregulatory proteins with clinical outcomes in patients with<br />

urothelial carcinoma of the bladder<br />

E.N. Xylinas, B.D. Robinson, L.A. Kluth, G. Volkmer, R. Hautmann, R. Kufer, M. Zerbib, E. Kwon,<br />

H. Thompson, S.A. Boorjian, S.F. Shariat (New York, Rochester, United States of America; Kassel, Ulm,<br />

Göppingen, Germany; Paris, France)<br />

152 Targeting DNA repair mechanisms increases efficiency of intravesical chemotherapy in an orthotopic rat<br />

bladder cancer model<br />

C.J. Arum, O.A. Gederaas, S. Bachke, T. Viset, M. Otterlei (Trondheim, Norway)<br />

153 The effect of photochemical internalization of bleomycin in the treatment of urothelial carcinoma of the<br />

bladder: An in vitro study<br />

H.C. Arentsen, J. Falke, A. Høgset, E. Oosterwijk, J.A. Witjes (Nijmegen, The Netherlands; Oslo, Norway)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

121<br />

Saturday


Saturday<br />

154 MAC387 positive tumor-associated macrophage count is an independent predictor of poor survival after<br />

radical cystectomy for urothelial bladder cancer<br />

M.M. Boström, P.J. Boström, H. Irjala, T. Mirtti, P. Taimen, S. Jalkanen (Turku, Finland)<br />

155 The expression of the receptor of hyaluronan mediated motility (RHAMM) is associated with reduced<br />

disease-specific survival in patients with bladder cancer<br />

C. Niedworok, I. Kretschmer, F. Vom Dorp, T. Szarvas, J. Heß, T. Freudenberger, A. Melchior-Becker,<br />

J.W. Fischer, H. Rübben (Essen, Düsseldorf, Germany)<br />

156 Prediction and reversibility of cisplatin-resistance in bladder cancer: HOXA9 a novel epigenetic biomarker<br />

E.N. Xylinas, T. Clozel, D. Zhuang, J.J. Crivelli, L.A. Kluth, B.D. Robinson, D.S. Scherr, O. Elemento,<br />

S.F. Shariat (New York, United States of America)<br />

157 Differential expression of Oct4 variants in urothelial cancer<br />

F. Wezel, J. Pearson, L. Kirkwood, J. Southgate (York, United Kingdom)<br />

122 <strong>Programme</strong> <strong>Book</strong>


Saturday, 16 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

14.15 - 15.45 Urological infection innovations<br />

Blue Hall 1-2 - Level N1<br />

Poster Session 14<br />

Chairs: M. Chrisofos, Athens (GR)<br />

M. Grabe, Malmö (SE)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

158 Socioeconomic trends and utilization in the emergency department treatment of urinary tract infections<br />

J.D. Sammon, K.R. Ghani, S. Sukumar, J.O. Peabody, M. Menon, Q-D. Trinh (Detroit, United States of<br />

America)<br />

159 The etiology of recurrent urinary tract infections in women and relation with recurrence rate<br />

M. Kolesnyk, N. Stepanova, V. Kruglikov, L. Lebid, O. Romanenko (Kiev, Ukraine)<br />

* 160 Risk factors analysis in patients with chronic prostatitis/chronic pelvic pain syndrome (CP/CPPS) from<br />

Finland, Germany, Italy and Switzerland: Results of a multinational observational study<br />

F.M.E. Wagenlehner, M. Spangenberg, V. Magri, A. Mehik, W. Hochreiter, H. Bödecker, W. Weidner,<br />

G. Perletti (Giessen, Germany; Milan, Busto A./Varese, Italy; Oulu, Finland; Aarau, Switzerland)<br />

161 A pilot study of the ageing urinary microbiome<br />

J.P. Williams, D. Lewis, R. Brown, J.R. Marchesi, M.J. Drake (Bristol, United Kingdom)<br />

162 The influence of urinary pH on ciprofloxacin efficacy against bacterial uropathogen biofilms<br />

L. Yang, K. Wang, H. Li, H.S. Chen, J. Denstedt, P. Cadieux (Chengdu, China; London, Canada)<br />

163 Risk factors for systemic inflammatory response syndrome following percutaneous nephrolithotomy<br />

T. Erdil, Y. Bostanci, E. Ozden, F. Atac, Y.K. Yakupoglu, A.F. Yilmaz, S. Sarikaya (Samsun, Turkey)<br />

164 Withdrawn<br />

165 Excellent control of infective complications after transrectal prostate biopsy with cephalosporin-based<br />

prophylactic antibiotics and the simple use of suppository-type povidone-iodine<br />

O. Jong Jin, D.S. Park, J.H. Hwang, Y.K. Hong, S.J. Park (Seongnam, Seoul, South Korea)<br />

166 Biofilm producing bacteria and chronic bacterial prostatitis: Results from a longitudinal cohort study<br />

R. Bartoletti, T. Cai, C. D’Elia, N. Mondaini, G. Nesi, S. Mazzoli, K. Naber (Florence, Trento, Italy; Munich,<br />

Germany)<br />

167 Application of isothermal microcalorimetry for rapid mycobacterial detection and anti-tuberculosis drug<br />

susceptibility testing - implication for urogenital tuberculosis and other mycobacterial infections<br />

G. Bonkat, A. Solokhina, M. Rieken, G. Müller, S. Wyler, T. Gasser, A. Bachmann (Basel, Switzerland)<br />

* 168 Influence of time course antibiotic administration on growth and biofilm formation from bacteria related to<br />

urinary tract infections in women<br />

L. Gandee, J.T. Hsieh, V. Sperandio, C. Moreira, P. Zimmern (Dallas, United States of America)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

123<br />

Saturday


Saturday<br />

169 Spectrum and antibiotic resistance dynamics of uropathogens isolated from children and adolescents with<br />

community-acquired urinary tract infections in Russia: 2000 - 2011<br />

I. Palagin, M. Sukhorukova, M. Edelstein, R. Kozlov, A. Shevelev, T. Perepanova, A. Grinyov, A. Dekhnich<br />

(Smolensk, Moscow, Russia)<br />

124 <strong>Programme</strong> <strong>Book</strong>


Saturday, 16 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

14.15 - 15.45 Partial nephrectomy and surveillance: Surveys and comparisons<br />

Yellow Hall 1-2-3 - Level N1<br />

Poster Session 15<br />

Chairs: J.J. Patard, Le Kremin Bicetre (FR)<br />

D. Rengifo Abbad, Madrid (ES)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

170 National survey on the use of partial nephrectomy in France. Data from the multicenter prospective<br />

NEPHRON study<br />

J-C. Bernhard, G. Pignot, H. Lang, P. Bigot, M. Crepel, J. Rigaud, L. Bellec, P. Gimel, L. Zini, L. Salomon,<br />

C. Vaessen, J. Berger, F. Bruyere, X. Martin, M. Zerbib, M. Rouprêt, F. Salome, J-L. Jung, J. Hubert, C. Pfister,<br />

N. Mottet, H. Baumert, A. Mejean, J-J. Patard (Bordeaux, Le Kremlin Bicetre, Strasbourg, Angers, Rennes,<br />

Toulouse, Cabestany, Lille, Creteil, Paris, Limoges, Tours, Lyon, Colmar, Nancy, Rouen, Saint-Etienne, France)<br />

171 Partial nephrectomy (PN): Complications and warm ischemia time in a French multicentre study<br />

H. Baumert, N. Korahanis, R. Thanigasalam, A. Mejean, J.M. Lang, J.C. Bernhard, G. Pignot, L. Zini,<br />

M. Crepel, J. Rigaud, L. Salomon, L. Bellec, C. Vaessen, M. Rouprêt, J.L. Jung, E. Mourey, X. Martin, P. Bigot,<br />

F. Bruyere, J. Berger, J.P. Ansieau, P. Gimel, F. Salome, J. Hubert, C. Pfister, F. Trifard, J.J. Patard (Paris,<br />

Strasbourg, Bordeaux, Lille, Reims, Nantes, Creteil, Toulouse, Colmar, Dijon, Lyon, Angers, Tours, Limoges,<br />

Mulhouse, Cabestany, Vandoeuvre Les Nancy, Rouen, Saint-Brieuc, France)<br />

* 172 Simple enucleation versus standard partial nephrectomy for clinical T1 renal tumors: Intraoperative, early<br />

post-operative and pathological outcomes from a prospective multicenter comparative study (RECORd<br />

Project)<br />

P. Verze, F. Fusco, A. Minervini, A. Antonelli, G. Bianchi, A. Bocciardi, S. Cosciani Cunico, V. Ficarra, C. Fiori,<br />

S. Giancane, N. Longo, G. Martorana, G. Novara, F. Porpiglia, F. Rocco, B. Rovereto, R. Schiavina, S. Serni,<br />

C. Simeone, A. Volpe, M. Carini (Naples, Florence, Brescia, Modena, Pavia, Padua, Bologna, Turin, Milan,<br />

Novara, Italy)<br />

173 Renal and cardiovascular morbidity after partial or radical nephrectomy in patients with kidney tumors up<br />

to 7 centimeters: Implications on overall mortality<br />

M. Roscigno, R. Naspro, U. Capitanio, R. Matloob, C. Carenzi, E. Di Trapani, F. Ceresoli, M. Nicolai,<br />

G. Deiana, P. Rigatti, F. Montorsi, L.F. Da Pozzo, R. Bertini (Bergamo, Milan, Italy)<br />

174 Active surveillance of small renal masses: First Italian prospective study<br />

A. Volpe, S. Munegato, L. Zegna, A. Di Domenico, P. De Angelis, P. Mondino, C. Terrone (Novara, Italy)<br />

175 A treatment delay in surgical intervention for elderly patients with small renal masses does not impact<br />

oncological outcomes<br />

A. Becker, A. Abdo, M. Meskawi, F. Roghmann, Z. Tian, H. Lavigueur-Blouin, M. Sun (Montreal, Canada;<br />

Herne, Germany)<br />

176 Partial nephrectomy: Is there a “center effect”?<br />

J-P. Couapel, J-C. Bernhard, G. Pignot, L. Zini, H. Lang, J. Rigaud, L. Salomon, L. Bellec, M. Soulié,<br />

C. Vaessen, M. Rouprêt, J-L. Jung, E. Mourey, P. Bigot, F. Bruyère, J. Berger, J-P. Ansieau, P. Gimel,<br />

F. Salome, J. Hubert, C. Pfister, H. Baumert, A. Méjean, J.J. Patard, K. Bensalah (Rennes, Bordeaux, Paris,<br />

Lille, Strasbourg, Nantes, Creteil, Toulouse, Colmar, Dijon, Angers, Tours, Limoges, Mulhouse, Cabestany,<br />

Vandoeuvre-Lès-Nancy, Rouen, France)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

125<br />

Saturday


Saturday<br />

177 Analysis of Fuhrman grade according to the anatomic location in clinical stage T1 clear cell renal cell<br />

carcinoma<br />

W.S. Ham, T.Y. Shin, J. Kim, K.H. Rha, S.C. Yang, S.J. Hong, Y.D. Choi, S.Y. Park (Seoul, South Korea)<br />

* 178 A postoperative morbidity assessment amongst elderly T1 renal cell carcinoma individuals: Comparison<br />

between laparoscopic radical nephrectomy vs partial nephrectomy<br />

A. Becker, F. Roghmann, Z. Tian, M. Meskawi, A. Abdo, P.I. Karakiewicz, M. Sun (Montreal, Canada; Herne,<br />

Germany)<br />

* 179 Nephrectomy versus active surveillance for small renal masses: Cancer-specific mortality and competingrisks<br />

of death<br />

M. Sun, H. Lavigueur-Blouin, F. Abdollah, Q-D. Trinh (Montreal, Canada; Milan, Italy)<br />

126 <strong>Programme</strong> <strong>Book</strong><br />

Discussion on posters 178 & 179<br />

J.J. Patard, Le Kremin Bicetre (FR)


Saturday, 16 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

16.00 - 17.30 Improving minimally invasive radical prostatectomy<br />

Platinum Hall - Level S3<br />

Video Session 2<br />

Chairs: I.J. De Jong, Groningen (NL)<br />

R.J.A. Van Moorselaar, Amsterdam (NL)<br />

All presentations have a maximum length of 10 minutes, followed by 4 minutes of discussion.<br />

V10 Nuances in nerve sparing during RARP<br />

C. Giedelman, H. Abdul Muhsin, O. Schatloff, S. Chauhan, A. Sivaraman, R. Coelho, B. Rocco, S. Samavedi,<br />

K. Palmer, V. Patel (Celebration, United States of America)<br />

V11 Robotic extended “modified” lymph node dissection during radical prostatectomy: Points of technique<br />

F. Porpiglia, I. Morra, M. Poggio, S. Grande, F. Mele, M. Manfredi, D. Garrou, R. Bertolo, M. Lucci Chiarissi,<br />

C. Fiori (Orbassano, Italy)<br />

V12 Novel tissue simulator for robotic assisted radical prostatectomy: Face, content, and construct validation<br />

and stepwise instructions for creation<br />

M. Alemozaffar, R. Narayanan, A. Percy, B. Minnillo, K. Matthes, A. Wagner (Los Angeles, Boston, United<br />

States of America)<br />

V13 Use of the prostatic vasculature for refining nerve sparing during robot assisted radical prostatectomy<br />

O. Schatloff, S. Samavedi, H. Abdul-Muhsin, K. Palmer, V. Patel (Celebration, United States of America)<br />

V14 Bimanual examination of retrieved specimen and selective hypothermia during robot-assisted radical<br />

prostatectomy<br />

W. Jeong, K.R. Ghani, A. Sood, R.K. Kumar, S. Dusik, N.S. Gupta, P. Dasgupta, C.G. Rogers, J.O. Peabody,<br />

M. Menon (Detroit, United States of America; London, United Kingdom)<br />

V15 Technical challenges of salvage robotic assisted radical prostatectomy<br />

A.E. El Hajj, A. De Fourmestraux, J. Rode, D. Vordos, A. Hoznek, L. Salomon, C.C. Abbou, A. De La Taille<br />

(Creteil, France)<br />

V16 Failure analysis and management of iatrogenic injuries occurring during robot assisted radical<br />

prostatectomy<br />

M. Addali, V. Zugor, A. Abdulhak, S. Poth, A. Schütte, C. Wagner, J.H. Witt (Gronau (Westfalen), Germany)<br />

V17 Intrafascial nerve-sparing endoscopic extraperitoneal radical prostatectomy (nsEERPE) with 3-D<br />

visualisation<br />

J.U. Stolzenburg, M. Do, T. Haefner, A. Dietel, R.M. Long, E. Liatsikos, R. Ganzer, H. Qazi (Leipzig,<br />

Regensburg, Germany; Patras, Greece)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

127<br />

Saturday


Saturday<br />

Saturday, 16 March - <strong>EAU</strong> <strong>Programme</strong><br />

128 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

16.00 - 17.30 Radical treatment of prostate cancer, beyond prostatectomy<br />

Brown Hall 1-2 - Level S2<br />

Poster Session 16<br />

Chairs: A. Bossi, Villejuif (FR)<br />

A.S. Merseburger, Hanover (DE)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion.<br />

180 Radical prostatectomy versus high intensity focused ultrasound: Oncological results of 723 patients treated<br />

between 2000 and 2005 in the same department<br />

S. Crouzet, J-M. Marechal, M. Colombel, R. Bouvier, F. Mege-Lechevallier, O. Rouviere, X. Martin, A. Gelet<br />

(Lyon, France)<br />

181 Can the findings of randomised clinical trials concerning the efficacy of prostate cancer therapy in men<br />

with early disease be replicated in national cancer registries?<br />

P. Cathcart, J. Van Der Meulen, M. Emberton (London, United Kingdom)<br />

182 Development and internal validation of a nomogram predicting biochemical recurrence after early salvage<br />

radiotherapy in prostate cancer patients treated with radical prostatectomy<br />

A. Briganti, M. Bianchi, S. Joniau, C. Cozzarini, B. Tombal, K. Haustermans, W. Hinkelbein, N. Di Muzio,<br />

N. Suardi, H. Van Poppel, T. Wiegel (Milan, Italy; Leuven, Brussels, Belgium; Ulm, Germany)<br />

183 Pelvic lymph-nodal irradiation improves biochemical relapse-free survival of node-negative patients<br />

treated with high-dose salvage radiotherapy after radical prostatectomy. A single-institute analysis of 206<br />

patients<br />

F. Zerbetto, C. Cozzarini, C. Fiorino, M. La Macchia, N.A. Iacovelli, A. Bolognesi, A. Chiara, A. Briganti,<br />

A. Gallina, P. Rigatti, N.G. Di Muzio (Milan, Italy)<br />

184 Factors predicting severe (Grade 3-4) late urinary toxicity after post-prostatectomy irradiation. A single<br />

institution analysis of 1151 patients treated with adjuvant or salvage radiotherapy with different radiation<br />

techniques and fractionations<br />

C. Cozzarini, C. Fiorino, A. Briganti, V. Carillo, C. Deantoni, M. La Macchia, B. Noris Chiorda, N. Suardi,<br />

F. Zerbetto, P. Rigatti, N.G. Di Muzio (Milan, Italy)<br />

185 Reliability and ideal cut-off of PSA doubling time in patients candidate to timely salvage radiotherapy for a<br />

biochemical recurrence after prostatectomy<br />

P. Rancoita, C. Cozzarini, F. Zerbetto, A. Briganti, F. Abdollah, A. Nonis, C. Deantoni, N.A. Iacovelli, P. Rigatti,<br />

C. Di Serio, N.G. Di Muzio (Milan, Italy)<br />

186 Indication and extension of pelvic lymph node dissection during robot-assisted radical prostatectomy. An<br />

analysis of 5 institutions<br />

N. Suardi, A. Haese, V. Ficarra, A. Govorov, N.M. Buffi, J. Walz, B. Rocco, M. Borghesi, A.Mottrie, T. Steuber,<br />

G. Guazzoni, D. Pushkar, H. Van Der Poel (Milan, Padua, Italy; Hamburg, Germany; Moscow, Russia;<br />

Marseille, France; Aalst, Belgium; Amsterdam, The Netherlands)<br />

187 A competing risks analysis of long term survival on node positive prostate cancer patients treated with<br />

radical prostatectomy<br />

F. Abdollah, R.J. Karnes, M. Bianchi, A. Gallina, G. La Croce, N.M. Passoni, C. Cozzarini, N. Di Muzio,<br />

R. Lucianò, M. Freschi, A. Salonia, P. Rigatti, A. Briganti (Milan, Italy; Rochester, United States of America)


188 Salvage lymph node dissection for patients treated with radical prostatectomy with biochemical recurrence<br />

and imaging-detected nodal metastases<br />

N. Suardi, J.R. Karnes, S. Joniau, K.A. Touijer, D. Osmonov, A. Aksenov, A. Briganti, P. Rigatti, H. Van<br />

Poppel, K.P. Jünemann (Milan, Italy; Rochester, New York, United States of America; Leuven, Belgium; Kiel,<br />

Germany)<br />

189 Is a fatal family history or the apparent mode of disease transmission of prostate cancer a prognostic<br />

factor for survival?<br />

K. Herkommer, E. Donel, J.E. Gschwend, M. Kron (Munich, Ulm, Germany)<br />

190 Radical prostate cancer therapy is associated with a survival benefit in the older man<br />

J. Cathcart, J. Van Der Meulen (London, United Kingdom)<br />

191 High-dose intensity-modulated arc radiotherapy for lymph node metastasized prostate cancer: Toxicity and<br />

early clinical outcome<br />

V. Fonteyne, N. Lumen, C. Van Praet, P. Ost, K. Decaestecker, G. De Meerleer (Ghent, Belgium)<br />

192 The 10-years follow-up of the ARO 96-02/AUO AP 09/95 trial on adjuvant radiotherapy (ART) versus waitand-see<br />

(WS) after prostatectomy for pT3 cancer – subgroup analysis<br />

T. Wiegel, D. Bottke, D. Bartkowiak, C. Bronner, U. Steiner, A. Siegmann, R. Golz, S. Störkel, N. Willich,<br />

A. Semjonow, M. Stöckle, C. Rübe, P. Althaus, U. Rebmann, T. Kälble, H.J. Feldmann, M. Wirth, A. Hinke,<br />

W. Hinkelbein, K. Miller (Ulm, Berlin, Wuppertal, Münster, Homburg Saar, Dessau, Fulda, Dresden,<br />

Langenfeld, Germany)<br />

Discussion on poster 192<br />

A. Bossi, Villejuif (FR)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

129<br />

Saturday


Saturday<br />

Saturday, 16 March - <strong>EAU</strong> <strong>Programme</strong><br />

130 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

16.00 - 17.30 Renal tumours: Basic research in prognostic markers<br />

Amber Hall 1-2 - Level S2<br />

Poster Session 17<br />

Chairs: P.F.A. Mulders, Nijmegen (NL)<br />

S. Zastrow, Dresden (DE)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

* 193 High cytoplasmic and low nuclear expression of HIF-2α are associated with worse cancer specific survival<br />

(CSS) in clear cell renal cell carcinoma<br />

N. Kroeger, D.B. Seligson, S. Signoretti, H. Yu, F.D. Birkhäuser, C.E. Magyar, J. Huang, J. Riss, F.F. Kabbinavar,<br />

A.S. Belldegrun, A.J. Pantuck (Los Angeles and Greifswald, Los Angeles, Boston, United States of America)<br />

194 Identification of high risk patients with clear cell renal cell carcinoma based on interphase-FISH<br />

J. Sanjmyatav, S. Matthes, M. Mühr, D. Sava, M. Sternal, H. Wunderlich, M. Gajda, M-O. Grimm, K. Junker<br />

(Jena, Eisenach, Homburg, Germany)<br />

195 Prognostic significance of EpCAM expression in renal tumors: A clinicopathological study of 948 cases<br />

M. Maruschke, A. Zimpfer, S. Rehn, G. Kundt, A. Litzensberger, F. Dammert, H. Zettl, C. Stephan,<br />

A. Erbersdobler, O.W. Hakenberg (Rostock, Berlin, Germany)<br />

196 Prognostic significance of platelet derived growth factor-β receptor in localized clear cell renal cell<br />

carcinoma<br />

S. Park, M. Shim, D. Yoo, C. Song, B. Hong, J.H. Hong, C-S. Kim, H. Ahn (Seoul, South Korea)<br />

197 Aberrant glycosylation of N-glycan on immunoglobulin closely relates survival of the patients with renal<br />

cell carcinoma<br />

S. Hatakeyama, Y. Tobisawa, T. Yoneyama, K. Mori, T. Yoneyama, Y. Hashimoto, T. Koie, N. Tsuchiya,<br />

T. Habuchi, M. Amano, S-I. Nishimura, C. Ohyama (Hirosaki, Akita, Hokkaido, Japan)<br />

* 198 Hsa-mir-124-3 CpG island methylation is associated with advanced tumours and disease recurrence of<br />

patients with clear cell renal cell carcinoma<br />

H. Tezval, K. Gebauer, I. Peters, N. Dubrowinskaja, J. Hennenlotter, M. Abbas, R. Scherer, A.S. Merseburger,<br />

A. Stenzl, M.A. Kuczyk, J. Serth (Hanover, Tübingen, Germany)<br />

199 Vasohibin-1 is a novel independent predictor of disease-free survival in curatively operated renal cell<br />

carcinoma patients<br />

Y. Miyaji, N. Kanomata, Y. Sato, S. Kin, S. Ohira, M. Fujita, H. Yakushiji, K. Fukumoto, S. Shimizu, M. Kaifu,<br />

T. Fujii, Y. Jo, T. Yokoyama, T. Moriya, A. Nagai (Kurashiki, Sendai, Japan)<br />

200 Expression of MHC molecule CD1d in renal cell carcinoma (RCC) is associated poorer cancer-specific and<br />

overall survival<br />

T.W. Chong, M.Y. Sim, H.H. Huang, A.R. Lazaro, A.A. Thike, P.H. Tan (Singapore, Singapore)<br />

201 Withdrawn<br />

202 Phosphodiesterase-5- inhibition protects against ischemia-reperfusion acute kidney injury: In-vivo study<br />

O. Nativ, I. Sukhotnik, R. Suhotnik, H. Awad, S. Heyman, Z. Abassi, O. Nativ (Haifa, Jerusalem, Israel)


203 Partial nephrectomy compared to total unilateral nephrectomy slows down atherosclerosis progression in<br />

apolipoprotein E deficient mice<br />

O. Ivanovski, I.G. Nikolov, O. Davceva, K. Gjorgjievska, G. Petrusevska (Skopje, Macedonia)<br />

204 Kidney injury following clampless laparoscopic partial nephrectomy: Is an early detection of acute<br />

postoperative damage possible? A preliminary experience<br />

F. Porpiglia, D. Amparore, R. Bertolo, E. Aroasio, F. Ragni, C. Fiori (Orbassano (Turin), Italy)<br />

Summary<br />

P.F.A. Mulders, Nijmegen (NL)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

131<br />

Saturday


Saturday<br />

Saturday, 16 March - <strong>EAU</strong> <strong>Programme</strong><br />

132 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

16.00 - 17.30 Men’s sexual health: Testosterone and premature ejaculation<br />

Amber Hall 7-8 - Level S2<br />

Poster Session 18<br />

Chairs: B. Cuzin, Lyon (FR)<br />

K. Hatzimouratidis, Pefka (GR)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

205 Withdrawn<br />

* 206 Results of the CO-SDT study: Prevalence and risk factors of coronary artery disease in a cohort of 2508<br />

men with testosterone deficiency syndrome<br />

E. García-Cruz, O. Cardeñosa, M.P. Luque, A. Alcaraz (Barcelona, Spain)<br />

* 207 Effects of long-term treatment with testosterone undecanoate injections in hypogonadal men on waist<br />

circumference, body weight and BMI<br />

D.J. Yassin, A. Haider, M. Zitzmann, A. Yassin, P.G. Hammerer, F. Saad (Braunschweig, Bremerhaven,<br />

Münster, Norderstedt, Berlin, Germany)<br />

208 Relationship between erectile dysfunction and coronary anatomy in patients with ischemic heart disease<br />

debut<br />

E. Garcia-Cruz, A. Bonet, I. Asiain, P. Luque, R. Freixa, A. Alcaraz (Barcelona, Sant Joan Despí, Spain)<br />

209 The characteristics of testosterone deficiency syndrome in men with end-stage renal disease and male<br />

renal transplant recipients; a cross-sectional study<br />

M.G. Park, J.K. Yeo, W.Y. Cho, D.Y. Cho (Seoul, Busan, South Korea)<br />

210 Endothelial function in patients with metabolic syndrome and erectile dysfunction: A question of<br />

Angiopoietin imbalance?<br />

N. Tomada, I. Tomada, F. Botelho, L. Pacheco-Figueiredo, T. Lopes, R. Negrão, F. Cruz (Porto, Portugal)<br />

211 Sexual dysfunction, aging male symptoms and their relationship to testosterone (T) in the Registry of<br />

Hypogonadism in Men (RHYME)<br />

R.C. Rosen, S. Arver, H.M. Behre, R. Chang, T. Curto, T.H. Jones, M. Maggi, J. Martha, A. Martin-Morales,<br />

E.J. Meuleman, H. Porst, F.C.W. Wu, A.B. Araujo (Watertown, Massachusetts, United States of America;<br />

Stockholm, Sweden; Halle, Hamburg, Germany; South Yorkshire, Manchester, United Kingdom; Florence,<br />

Italy; Malaga, Spain; Amsterdam, The Netherlands)<br />

212 A new indication for varicocelectomy?<br />

A.A. Afoko, H. De Wall, M. Kogan (Tamale, Ghana; Rostov on Don, Russia)<br />

213 Comparison between on-demand dosing of dapoxetine alone and dapoxetine plus mirodenafil in patients<br />

with lifelong premature ejaculation; multicenter, prospective, randomized, double-blind, and placebocontrolled<br />

C. Yoo, W.Y. Cho, J.S. Cho, W.K. Lee, S.K. Lee, Y.G. Lee, Y.S. Lee, K.K. Kim, D.Y. Yang, H.Y. Kim, S.Y. Kim<br />

(Anyang, Busan, Chuncheon, Seoul, South Korea)


214 On demand use of tramadol, sildenafil, paroxetine or local anesthetics for management of premature<br />

ejaculation, a randomized placebo-controlled clinical trial<br />

T.A. Gameel, A.M. Tawfik, M.G. Soliman, M.A. El-Bendary, M. Abo-Elenen, T.I. Tawfik, A. El-Gamasy (Tanta,<br />

Egypt)<br />

215 A real-time motion analysis of human ejaculation with Turbo-FLASH MR imaging system<br />

J.S. Jintetsu, Y. Naya, O Ochiai, Y. Naitoh, N. Kanemitsu, K. Kamoi, A. Kawauchi, T. Miki (Kyoto, Japan)<br />

216 Associations between asymptomatic prostatitis and erectile dysfunction in middle-aged male<br />

K. Ausmees, R. Mändar, G. Timberg, M. Punab (Tartu, Estonia)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

133<br />

Saturday


Saturday<br />

Saturday, 16 March - <strong>EAU</strong> <strong>Programme</strong><br />

134 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

16.00 - 17.30 Improving diagnosis in prostate cancer<br />

Silver Hall - Level N2<br />

Poster Session 19<br />

Chairs: P. Macek, Prague (CZ)<br />

M.P. Matikainen, Helsinki (FI)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

217 Structured reporting of multiparametric MRI in detecting prostate cancer: Accuracy and inter-observer<br />

variability<br />

R. Van Soest, R.S. Dwarkasing, G.J.L.H. Van Leenders, H.J. Teertstra, P. De Koekkoek, S.W.T.P. Heijmink,<br />

M. Wildhagen, H.G. Van Der Poel, E.W. Steyerberg, C.H. Bangma (Rotterdam, Amsterdam, The Netherlands)<br />

218 Association of level of suspicion of prostate cancer on multi-parametric MRI with detection rate of prostate<br />

cancer<br />

V. Kasivisvanathan, R. Dufour, C.M. Moore, H.U. Ahmed, M.A. Abd-Alazeez, S. Charman, A. Freeman,<br />

A. Kirkham, C. Allen, J. Van Der Meulen, M. Emberton (London, United Kingdom)<br />

* 219 Diagnostic accuracy of multiparametric MRI in detection of clinically significant prostate cancer<br />

F. Porpiglia, C. Fiori, F. Mele, M. Manfredi, R. Bertolo, S. Grande, M. Poggio, D. Garrou, G. Cattaneo,<br />

E. Bollito, M. Papotti, F. Russo, D. Regge (Orbassano (Turin), Candiolo (Turin), Italy)<br />

220 Initial experience of 200 men undergoing 3 dimensional ultrasound prostate biopsy in analysis between<br />

systematic and MR-fusion biopsy<br />

A. Marien, A. Villers, S. Palmer, S. Leslie, H. Ahmadi, A.L. De Castro Abreu, S. Shoji, M. Aron, M.M. Desai,<br />

I.S. Gill, O. Ukimura (Los Angeles, United States of America; Lille, France)<br />

221 Diagnosis of anterior prostate cancer using MRI/TRUS soft image fusion<br />

E. Baco, E. Rud, D. Klotz, H.B. Eggesbø (Oslo, Norway)<br />

* 222 Detecting clinically significant prostate cancer by MRI-targeted TRUS-guided transperineal fusion biopsy<br />

T.H. Kuru, M. Roethke, T. Simpfendoerfer, S. Boxler, J. Seidenader, H-P. Schlemmer, M. Hohenfellner,<br />

B. Hadaschik (Heidelberg, Germany)<br />

223 Objective differentiation of prostate cancer from normal prostate tissue: Diagnostic usefulness of<br />

discriminant analysis of T2 and diffusion-weighted MR imaging<br />

R. Nemoto (Tottori, Japan)<br />

* 224 Incremental benefit of 3T diffusion weighted MRI for pre-operative prostate cancer staging: A prospective<br />

dual reader study<br />

E.M. Lawrence, F.A. Gallagher, T. Barrett, A. Warren, A.N. Priest, E. Sala, V.J. Gnanapragasam (Cambridge,<br />

United Kingdom; Toronto, Canada; New York, United States of America)<br />

225 Identification of patient subgroups with the highest benefit from real-time-sonoelastography (RTE)<br />

targeted biopsy of the prostate<br />

J. Bründl, H-M. Fritsche, M. Gierth, A. Brandtner, W.F. Wieland, R. Ganzer (Regensburg, Germany)


226 Shearwave elastography of the prostate: Assessment of prostate cancer nodules elasticity thresholds and<br />

localization of cancer lesions: Implication for targeted biopsies and active surveillance protocols<br />

K. Boehm, G. Salomon, B. Beyer, J. Schiffmann, H. Isbarn, M. Sandmann, L. Budaeus (Hamburg, Germany)<br />

227 [ 68 Ga]Gallium labelled ligands of the prostate specific membrane antigen as novel validated PET-tracer for<br />

the diagnosis of prostate cancer<br />

S. Boxler, T.H. Kuru, A. Afshar-Oromieh, M. Hohenfellner, U. Haberkorn, B.A. Hadaschik (Heidelberg,<br />

Germany)<br />

228 Console-integrated stereoscopic OsiriX 3D volume-rendered images for da Vinci S robotic-assisted radical<br />

prostatectomy<br />

Y. Shiga, M. Sugimoto, S. Minagawa, H. Morikawa, S. Okada, Y. Kawano, H. Yokoyama, K. Umeda, K. Hariu,<br />

Y. Ooiwa, H. Watanabe, M. Shimbori, R. Yamamoto, K. Yoshioka (Tokyo, Kobe, Japan)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

135<br />

Saturday


Saturday<br />

Saturday, 16 March - <strong>EAU</strong> <strong>Programme</strong><br />

136 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

16.00 - 17.30 Bladder cancer demographics and biomarkers<br />

Red Hall 1 - Level N1<br />

Poster Session 20<br />

Chairs: P. Bastian, Düsseldorf (DE)<br />

R. Bryan, Birmingham (GB)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion.<br />

229 Work in the textile and bladder cancer<br />

D. Garcia-Rojo, C. Serra, M. Kogevinas, D. Silverman, N. Malats, A. Gelabert, A. Carrato, N. Rothman,<br />

O. Bielsa, J. Prats, R. Abascal, L. Ceccini, A. Prera, F. Taño, J.M. Rodriguez De Vera, J.L. Guate, J. Fernandez,<br />

M. Rivas, A. Mateos, J.M. Malet, P. Muntañola, M. Cespedes, J.F. Gonzalez Huergo, J. Mosquera, C. Abad,<br />

F.X. Real (Sabadell, Barcelona, Elche, Oviedo, Badalona, Santa Cruz de Tenerife, Aviles, Gijon, Manresa,<br />

Mieres, Sant Boli Llobregat, Coaña, Cangas, Spain; Bethesda, United States of America)<br />

230 Bladder cancer incidence is falling, but mortality is static in significant subgroups of the English population<br />

M.F. Eylert, L.S. Hounsome, J. Verne, A. Bahl, E.R. Jefferies, R.A. Persad, H. Mostafid (Swansea, Bristol,<br />

Cheltenham, Basingstoke, United Kingdom)<br />

231 What do patients know about the causal role of cigarette smoking in bladder cancer?<br />

R. Rogel Berto, J.L. Ruiz Cerda, A. Polo Rodrigo, B. Plaza Viguer, A.M. Soto Poveda, J.L. Pontones Moreno,<br />

F. Boronat Tormo (Valencia, Spain)<br />

232 Clinical and pathological features of newly diagnosed bladder cancer in Spain<br />

B. Miñana, J.M. Cozar, J. Palou, R. Medina, J. Subirá, F. De La Rosa, V. Chantada, F. Lozano, M.J. Ribal<br />

(Murcia, Granada, Barcelona, Sevilla, Zaragoza, Madrid, La Coruña, Spain)<br />

233 Distribution of metastatic sites in bladder cancer: A population-based analysis<br />

A. Abdo, M. Meskawi, H. Lavigueur-Blouin, F. Roghmann, P.I. Karakiewicz, Q-D. Trinh (Montreal, Canada;<br />

Herne, Germany)<br />

234 Identification and clinical outcomes of aristolochic acid-induced upper tract urothelial carcinoma<br />

C.H. Chen, K.G. Dickman, C.Y. Huang, C.T. Shun, A.P. Grollman, Y.S. Pu (Taipei, Taiwan; New York, United<br />

States of America)<br />

235 Should we systematically screen for HNPCC in patients with upper urinary tract transitional cell<br />

carcinoma?<br />

G. Pignot, A. Rouquette, A. Vieillefond, G. Olagui, D. Amsellem-Ouazana, N. Barry De Longchamps,<br />

M. Zerbib, B. Terris (Le Kremlin Bicetre, Paris, France)<br />

236 Using microRNA profiling in urine samples to develop a non-invasive test for bladder cancer<br />

L. Mengual, J.J. Lozano, M. Ingelmo-Torres, C. Gazquez, M.J. Ribal, A. Alcaraz (Barcelona, Spain)<br />

237 MicroRNA signature associated with poor outcome in upper urinary tract tumours<br />

L. Izquierdo Reyes, M. Ingelmo, C. Mallofre, J.J. Lozano, M. Verhasselt-Crinquette, X. Leroy, P. Colin,<br />

E. Comperat, M. Rouprêt, A. Alcaraz, L. Mengual (Barcelona, Spain; Lille, Paris, France)<br />

238 Urinary biomarkers in the follow-up of low grade non-muscle invasive bladder cancer patients: Update on<br />

the FP7 UROMOL project<br />

T.C.M. Zuiverloon, W. Beukers, K.A. Van Der Keur, N. Malats, P. Malmstrom, U. Segersten, L. Dyrskjot,<br />

T. Orntoft, E.C. Zwarthoff (The Hague, The Netherlands; Madrid, Spain; Uppsala, Sweden; Århus, Denmark)


239 The unattainability of bladder cancer biomarkers: Utility-based assessment of a hypothetical non-invasive<br />

surveillance tool for bladder cancer recurrence<br />

D. Nekeman, L.J. Billingham, N.K. Aaronson, N.D. James, K.K. Cheng, R.T. Bryan, M.P.A. Zeegers<br />

(Birmingham, United Kingdom; Amsterdam, The Netherlands)<br />

240 The ADC value is a prognostic biomarker of upper urinary tract cancer: Potential application to<br />

preoperative risk stratification<br />

S. Yoshida, S. Kobayashi, F. Koga, J. Ishioka, C. Ishii, H. Tanaka, Y. Nakanishi, Y. Matsuoka, N. Numao,<br />

K. Saito, H. Masuda, Y. Fujii, K. Kihara (Tokyo, Japan)<br />

241 Preoperativ serum C-reactive protein: A prognostic marker in patients with upper urinary tract urothelial<br />

carcinoma<br />

B. Stein, A.J. Schrader, G. Wegener, C. Seidel, M.A. Kuczyk, S. Steffens (Hanover, Ulm, Germany)<br />

242 The predictive value of C-reactive protein on prognosis of patients with upper tract urothelial carcinoma<br />

treated with radical nephroureterectomy: Multi-institutional study<br />

E. Kikuchi, N. Tanaka, S. Shirotake, K. Matsumoto, H. Kobayashi, Y. Miyazaki, H. Ide, J. Obata, K. Hoshino,<br />

N. Hayakawa, Y. Ito, K. Kanao, A. Miyajima, T. Momma, K. Nakagawa, M. Ueno, M. Oya (Tokyo, Saitama,<br />

Japan)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

137<br />

Saturday


Saturday<br />

Saturday, 16 March - <strong>EAU</strong> <strong>Programme</strong><br />

138 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

16.00 - 17.30 Cell based therapy in pelvic floor dysfunction<br />

Blue Hall 1-2 - Level N1<br />

Poster Session 21<br />

Chairs: K-E. Andersson, Winston Salem (US)<br />

D. Eberli, Zurich (CH)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

* 243 Effects of injected undifferentiated or differentiated mesenchymal stem cells on the continence mechanism<br />

L. Lisa, M. Martin, S. Sabine, A. Stenzl, K-D. Sievert (Tübingen, Germany)<br />

* 244 Stem cell therapy for stress urinary incontinence: Comparison of bone marrow and adipose derived stem<br />

cells in animal model<br />

O. El Yazami Adli, O. Loutochin, R. Caremel, J. Corcos (Montreal, Canada)<br />

245 Urodynamic and histologic effects of autologous adipose derived stem cells endoscopically injected in a<br />

porcin model of intrinsic sphincter deficiency<br />

R. Boissier, L. Giraudo, J. Veran, J. Magalon, F. Sabatier, S. Giusiano, S. Garcia, L. Arnaud, F. Dignat-George,<br />

G. Magalon, E. Lechevallier, S. Berdah, G. Karsenty (Marseille, France)<br />

246 The role of donor age and gender on the success of autologous human muscle precursor cell<br />

transplantation for sphincter insufficiency<br />

M.N.L. Stölting, L.J. Hefermehl, M. Tremp, F.Z. Azzabi, T. Sulser, D. Eberli (Zürich, Switzerland)<br />

247 A novel three-dimensional tubular biodegradable scaffolds for tissue engineering of the urethra<br />

X.Q. Wang, Q.H. Chen, J.H. Hu, Y.C. Hou, C.X. Wang (Changchun, China)<br />

248 Stabilization strategies of tissue engineered urothelium and its application in nude rats and minipigs<br />

M. Vaegler, S. Maurer, L. Daum, K-D. Sievert (Tübingen, Germany)<br />

249 Proliferation and contractility modulation of bladder smooth muscle cells under physiological stretch<br />

K.J. Wang, T. Wu, Y. Tian, X. Yue, L. Cheng, H. Li (Chengdu, China)<br />

250 Tubular matrices for biohybrids<br />

V. Seifarth, J. Grosse, M. Gossmann, I. Heschel, W. Zang, G.M. Artmann, A.T. Artmann (Jülich, Aachen,<br />

Herzogenrath, Germany)<br />

251 Improving bioperformance of meshes for SUI and POP by coating with autologous plasma - results of a<br />

long term animal study<br />

H.G. Gerullis, M. Boros, B. Klosterhalfen, G. Heusch, E. Georgas, C. Eimer, T. Otto (Neuss, Düren, Essen,<br />

Germany; Szeged, Hungary)<br />

252 High-frequency micro-ultrasound, spot test, bladder leakage capacity, and time to leakage to determine<br />

the functional alteration in different rat models of stress urinary incontinence<br />

L. Hakim, M. Endo, A. Feola, P. Uvin, D. Soebadi, J. Deprest, D. De Ridder, M. Albersen, F. Van Der Aa<br />

(Leuven, Belgium; Surabaya, Indonesia)


253 Synergistic property of triple combination pre-differentiated cell transplantation for urethral sphincter<br />

regeneration<br />

B.S. Kim, J.N. Lee, S.Y. Kwon, H.T. Kim, E.S. Yoo, S.K. Chung, B.W. Kim, Y.K. Park, J.Y. Choi, S.H. Choi,<br />

T.H. Kim, J.B. Kwon, T.G. Kwon (Daegu, South Korea)<br />

Summary on stem cell therapy in the near future?<br />

D. Eberli, Zurich (CH)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

139<br />

Saturday


Saturday<br />

Saturday, 16 March - <strong>EAU</strong> <strong>Programme</strong><br />

140 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

16.00 - 17.30 Robot-assisted partial nephrectomy<br />

Yellow Hall 1-2-3 - Level N1<br />

Poster Session 22<br />

Chairs: H. Baumert, Paris (FR)<br />

M.E. Sullivan, Oxford (GB)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

* 254 Margin, Ischemia, and Complications (MIC) System to report perioperative outcomes of robot-assisted<br />

partial nephrectomy: An European Multicenter Observational Study (EMOS project)<br />

N.M. Buffi, G. Lista, V. Ficarra, A. Mottrie, J. Porter, G. Lughezzani, A. Larcher, F.A. Mistretta, A. Cestari,<br />

M. Lazzeri, G. Guazzoni (Milan, Padua, Italy; Aalst, Belgium; Seattle, United States of America)<br />

255 Robotic partial nephrectomy for completely endophytic renal masses<br />

R. Autorino, A. Khalifeh, H. Laydner, D. Samarasekera, R. Stein, G-P. Haber, J. Kaouk (Cleveland, United<br />

States of America)<br />

256 Robot assisted partial nephrectomy for hilar tumors: Perioperative outcomes<br />

R. Eyraud, J-A. Long, S-L. Devon, R. Autorino, S. Hillyer, J. Klink, E. Rizkala, R. Stein, J. Kaouk, G-P. Haber<br />

(Cleveland, United States of America)<br />

257 Robotic partial nephrectomy: Imperative vs elective indications<br />

J-A. Long, B. Lee, R. Eyraud, R. Autorino, S. Hillyer, R. Stein, J. Kaouk, G-P. Haber (Cleveland, United States<br />

of America)<br />

258 Functional outcome six months after robot-assisted partial nephrectomy<br />

V. Ficarra, E. Frumenzio, M. Borghesi, M. Gan, G. Novara, A. Mottrie (Aalst, Belgium; Padua, Italy)<br />

* 259 Robotic-assisted versus open partial nephrectomy: A prospective multicenter comparison study of<br />

perioperative outcomes (AGILE project)<br />

A. Minervini, G. Vittori, A. Antonelli, A. Celia, S. Crivellaro, D. Dente, V. Di Santo, B. Frea, M. Gacci, A. Gritti,<br />

L. Masieri, A. Morlacco, A. Porreca, B. Rocco, P. Parma, S. Serni, C. Simeone, S. Zaramella, M. Carini<br />

(Florence, Brescia, Bassano del Grappa, Udine, Abano Terme, Milan, Mantova, Novara, Italy)<br />

260 Outcomes for open and minimally invasive partial nephrectomy since the introduction of robotic partial<br />

nephrectomy: Results from the Nationwide Inpatient Sample<br />

K.R. Ghani, S. Sukumar, J.D. Sammon, W. Jeong, C.G. Rogers, M. Menon (Detroit, United States of America)<br />

* 261 A prospective comparison of surgical and pathological outcomes obtained after robot-assisted or pure<br />

laparoscopic partial nephrectomy in moderate to complex renal tumors: Results from a French multicentric<br />

collaborative study<br />

A. Masson-Lecomte, K. Bensalah, E. Seringe, C. Vaessen, A. De La Taille, N. Doumerc, P. Rischmann,<br />

F. Bruyere, L. Soustelle, S. Droupy, M. Rouprêt (Creteil, Rennes, Paris, Toulouse, Tours, Nîmes, France)<br />

262 Postoperative complications after open, robotic-assisted, and laparoscopic partial nephrectomy in elderly<br />

patients<br />

F. Roghmann, H. Lavigueur-Blouin, M. Meskawi, Z. Tian, A. Abdo, M. Sun (Montreal, Canada)


263 Laparoscopic vs open partial nephrectomy for T1 renal tumors: Evaluation of the long-term oncologic and<br />

functional outcomes in 340 patients<br />

C. Springer, P. Fornara, F. Greco (Halle Saale, Austria)<br />

264 Open versus laparoscopic partial nephrectomy for clinical T1a renal tumors: A prospective multicenter<br />

comparative study (RECORd project)<br />

A. Minervini, S. Serni, A. Antonelli, G. Bianchi, A.M. Bocciardi, A. Chindemi, R. Fantechi, V. Ficarra,<br />

C. Fiori, G. Martorana, M. Medica, V. Mirone, G. Novara, F. Porpiglia, B. Rovereto, R. Schiavina, C. Simeone,<br />

C. Terrone, A. Volpe, M. Carini (Florence, Brescia, Modena, Milan, Padua, Turin, Bologna, Sestri Levante,<br />

Naples, Pavia, Novara, Italy)<br />

Summary<br />

H. Baumert, Paris (FR)<br />

.<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

141<br />

Saturday


Saturday<br />

Saturday, 16 March - Sponsored Sessions<br />

142 <strong>Programme</strong> <strong>Book</strong><br />

Workshop Overview<br />

18.00 - 19.30 Holmium Life Enhancing Plan (HoLEP) - The real BPH lifetime solution page 407<br />

Amber Hall 6 - Level S2 Sponsored by LUMENIS<br />

Symposia Overview<br />

18.00 - 19.30 Navigating the new landscape in CRPC page 402<br />

eURO Auditorium - Level S2 Sponsored by ASTELLAS<br />

18.00 - 19.30 LUTS/BPH and sexual health - Bridging the gap page 403<br />

Brown Hall 1-2 - Level S2 Sponsored by ELI LILLY AND COMPANY<br />

18.00 - 19.30 Risk stratification to optimize the management of men with symptomatic BPH at risk of<br />

progression page 404<br />

Platinum Hall - Level S3 Sponsored by GLAXOSMITHKLINE<br />

18.00 - 19.30 Increasing evidence of effectiveness of GAG therapy in different forms of cystitis page 405<br />

Amber Hall 1-2 - Level S2 Sponsored by IBSA INSTITUT BIOCHIMIQUE<br />

18.00 - 19.30 Transurethral resection of bladder tumor: How to reach excellence page 406<br />

Brown Hall 3 - Level S2 Sponsored by IPSEN<br />

18.00 - 19.30 Premature ejaculation treatment: New perspectives for the couple page 408<br />

Yellow Hall 1-2-3 - Level N1 Sponsored by MENARINI


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Plenary Session 2<br />

07.30 - 11.00 Upper urinary tract<br />

eURO Auditorium - Level S2<br />

Chairs: F.C. Hamdy, Oxford (GB)<br />

F. Montorsi, Milan (IT)<br />

07.30 - 08.00 Highlight session 1<br />

Prostate disease<br />

A. Descazeaud, Limoges (FR)<br />

Female urology<br />

H. Hashim, Bristol (GB)<br />

Reconstruction<br />

C. Surcel, Bucharest (RO)<br />

08.00 - 08.05 Introduction to the plenary session<br />

F. Montorsi, Milan (IT)<br />

08.05 - 08.25 Update The dilemmas in diagnosing upper tract urothelial cancer<br />

M.P. Laguna, Amsterdam (NL)<br />

Aims and objectives<br />

Upper tract urothelial cancer accounts for a very small percentage of all urological malignancies. It has<br />

traditionally been characterised for an aggressive phenotype and late diagnosis. However advances in<br />

cross sectional imaging, miniaturisation of endoscopic instruments, and developments of additional optical<br />

visualisation methods and cytological biomarkers has resulted in a shift in stage at presentation.<br />

Accuracy and opportunity of the different diagnostic methods from suspicion of upper urinary tract tumor to<br />

confirmation of urothelial cancer will be discussed.<br />

08.25 - 09.05 Debate How much surgery for upper tract urothelial cancer?<br />

Moderator: T.S. O’Brien, London (GB)<br />

Nephroureterectomy or partial ureterectomy?<br />

S.F. Shariat, New York (US)<br />

Endoscopy is enough<br />

O. Traxer, Paris (FR)<br />

Lymphadenectomy helps the patients?<br />

M. Brausi, Modena (IT)<br />

Aims and objectives<br />

Delegates will hear the pros and cons of organ sparing approaches in UUTUC debated. Does nephron sparing<br />

surgery deserve a more prominent role in the management of UUTUC? The place of conservative ureteric<br />

excision with re-implantation, and endoscopic ablation will be critically addressed. Which patients are<br />

suitable for which approach?<br />

When patients have to undergo radical surgery, how radical does that surgery need to be? The place of<br />

lymphadenectomy is debated in all urological cancers and UUTUC is no different. Prof Brausi will address<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

143<br />

Sunday


Sunday<br />

144 <strong>Programme</strong> <strong>Book</strong><br />

the evidence for lymphadenectomy and delegates should leave with a clear understanding of which patients<br />

have most to gain from lymphatic clearance and how extensive that clearance needs to be.<br />

09.05 - 09.35 <strong>EAU</strong> Guidelines Office case discussion Upper urinary tract tumours<br />

Moderator: M. Rouprêt, Paris (FR)<br />

Panel: J. Palou, Barcelona (ES)<br />

R.E. Zigeuner, Graz (AT)<br />

Aims and objectives<br />

The new version of the European Association of Urology (<strong>EAU</strong>) guidelines on upper urinary tract tumours<br />

known as urothelial carcinomas of the upper tract (UTUCs) are likely to be released in <strong>2013</strong>. The <strong>EAU</strong><br />

Guideline working group for UTUCs has prepared current guidelines to provide evidence-based information<br />

for the clinical management of these rare tumours and to help clinicians incorporate these recommendations<br />

into their practice. Through clinical cases, we will emphasize the most important Take-Home messages and<br />

address concrete issues.<br />

09.35 - 09.55 Société Internationale d’Urologie (SIU) lecture The role of ESWL in upper urinary tract stones<br />

M.R. Desai, Naidad (IN)<br />

09.55 - 10.10 Update Interventional imaging in upper urinary tract stone disease: What’s new?<br />

C.M. Scoffone, Turin (IT)<br />

Aims and objectives<br />

Endourological treatment of urolithiasis is a field where the concept of image-guided therapy has the chance<br />

to display all its value. In fact, interventional imaging during the endoscopic treatment of ureteral and pyelocalyceal<br />

stones is fundamental for the performance of a safe and effective procedure. The integrated use of<br />

fluoroscopy, ultrasound, computed tomography, magnetic resonance and endoscopic vision will be discussed,<br />

as well as the most recent advances and innovations regarding these consolidated techniques (rotational 3D<br />

fluoroscopy, Doppler, 3D and 4D ultrasound, flat-panel volume CT and CT/pyelography, open configuration<br />

MRI, image fusion techniques, HD endoscopic imaging) and the need for a multidisciplinary cooperation<br />

between endourologist and radiologist. The issue of radioprotection will also be addressed (including<br />

the X-ray-free percutaneous access), as well as the correlation of the mentioned tools with preoperative<br />

diagnostic work up.<br />

10.10 - 10.50 Case discussion From above or below: Flexible, rigid or percutaneous management of upper urinary tract<br />

stones<br />

Moderator: P.J. Osther, Fredericia (DK)<br />

PCNL<br />

A. Skolarikos, Athens (GR)<br />

Flexible<br />

E.K. Bres-Niewada, Warsaw (PL)<br />

What is the best energy for fragmentation?<br />

T. Bach, Hamburg (DE)<br />

Aims and objectives<br />

Rapid technological developments continuously set new standards in stone treatment. The combined<br />

introduction of digital flexible ureteroscopes, new laser settings, superflexible utensils and pressurecontrolled<br />

irrigation with the possibility of on-demand flushing clearly has expanded the indications for<br />

ureteroscopic renal stone management. In complex cases combined (antegrade – retrograde) procedures<br />

are increasingly being used. In this session we will – through case discussions – explore pros and cons of<br />

different approaches to the endourological treatment of renal stones: which cases are most suitable for a


combined approach?, which cases are best treated from below or from above?, and which type of stone<br />

fragmentation energy should be applied in the different situations?<br />

10.50 - 11.00 Update Observation and deferred intervention in the management of stones<br />

T. Knoll, Sindelfingen (DE)<br />

Aims and objectives<br />

Is it all about intervention? This lecture reviews current concepts of stone observation and medical expulsive<br />

therapy. It will try to give decision algorithms when active treatment should be initiated and which treatment<br />

options could be chosen.<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

145<br />

Sunday


Sunday<br />

Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

146 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

09.15 - 10.45 Robot-assisted kidney surgery<br />

Platinum Hall - Level S3<br />

Video Session 3<br />

Chairs: A. Carbone, Latina (IT)<br />

P.T. Piechaud, Bordeaux (FR)<br />

All presentations have a maximum length of 10 minutes, followed by 4 minutes of discussion.<br />

V18 Robot-assisted partial nephrectomy: Fluorescence imaging and zero ischemia for complex hilar and<br />

intrarenal tumours<br />

N. Harke, A. Kunz, F. Schiefelbein, G. Schoen (Würzburg, Germany)<br />

V19 Robotic anatrophic incision for nephron sparing surgery for complete intrarenal tumor in the renal sinus<br />

R. Sotelo Noguera, R. Cisneros, O. Carmona, R. De Andrade, G. Fernández, J. Castro, R. Garza (Caracas,<br />

Venezuela)<br />

V20 The use of semiflexible and flexible intraoperative laparoscopic ultrasound transducers during robotassisted<br />

laparoscopic partial nephrectomy<br />

S. Poth, C. Wagner, A.P. Labanaris, A. Schütte, J.H. Witt (Gronau (Westfalen), Germany)<br />

V21 New 3-dimensional head-mounted display system (RoboSurgeon system) applied to gasless, single-port<br />

access, clampless partial nephrectomy<br />

K. Kihara, Y. Fujii, H. Masuda, K. Saito, F. Koga, N. Numao, Y. Matsuoka (Tokyo, Japan)<br />

V22 Robot-assisted suturless unclamped partial nephrectomy by enucleation<br />

R. Eyraud, E. Rizkala, R. Autorino, H. Laydner, A. Khalifeh, R. Stein, J. Kaouk, G-P. Haber (Cleveland, United<br />

States of America)<br />

V23 Zero ischemia robot assisted laparoscopic partial nephrectomy for a totally endophytic renal tumor<br />

G. Simone, R. Papalia, M. Ferriero, S. Guaglianone, M. Costantini, E. Forastiere, M. Gallucci (Rome, Italy)<br />

V24 Complications during robot-assisted kidney surgery<br />

R.K. Kumar, B.F. Kaczmarek, M. Menon, C.G. Rogers (Detroit, United States of America)<br />

V25 Robotic partial nephrectomy with cold ischemia and early tumor extraction: Recapitulating the open<br />

approach<br />

C.G. Rogers, R.K. Kumar, K.R. Ghani, W. Jeong, M. Menon (Detroit, United States of America)


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

09.15 - 10.45 Prostate cancer: Active surveillance<br />

Brown Hall 1-2 - Level S2<br />

Poster Session 23<br />

Chairs: L.M. Campos Pinheiro, Lisboa (PT)<br />

T.M. De Reijke, Amsterdam (NL)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

* 265 Monitoring of three-dimensionally mapped biopsy-proven image-visible lesions of prostate cancer on<br />

active surveillance: 11 year experience<br />

S. Shoji, O. Ukimura, A.L. De Castroabreu, S. Leslie, T. Uchida, I. Gill, D. Bahn (Los Angeles, United States of<br />

America; Hachioji, Japan)<br />

* 266 Role of multiparametric 3.0 Tesla magnetic resonance imaging in prostate cancer patients eligible for<br />

active surveillance<br />

B.H. Park, S.H. Choo, H.J. Jang, Y.S. Suh, U.S. Jeong, W. Song, H.G. Jeon, B.C. Jeong, S.I. Seo, S.S. Jeon,<br />

H.Y. Choi, K.S. Lee, H.M. Lee (Seoul, South Korea)<br />

267 Radiological progression in men with prostate cancer on active surveillance<br />

A.J. Ridout, D. Stevens, C. Allen, A. Kirkham, A. Freeman, C. Jamieson, M. Emberton, C.M. Moore (London,<br />

United Kingdom)<br />

268 Impact of multiparametric prostate MRI on the selection of active surveillance patients<br />

F. Sanguedolce, A.R. Padhani, N. Anyamene, J. Beatty, G. Hellawell (London, United Kingdom)<br />

269 Low risk prostate cancer patients without visible tumor (T1c) on diffusion-weighted MRI could qualify for<br />

active surveillance candidate regardless of inclusion criteria of active surveillance protocol<br />

D.H. Lee, K.H. Kim, S.H. Lee, K.H. Rha, Y.D. Choi, S.J. Hong, B.H. Chung (Seoul, South Korea)<br />

270 The significance of finding no prostate cancer on the active surveillance confirmatory biopsy: Implications<br />

for pathological re-classification<br />

L.M. Wong, G. Trottier, N. Lawrentschuk, N.E. Fleshner, G. Kulkarni, A.R. Zlotta, J. Trachtenberg, A. Toi,<br />

N. Timilshina, A. Finelli (Toronto, Canada)<br />

271 The value of histological revision of biopsy cores in patients suitable for active surveillance: Comparison<br />

with surgical specimens after radical prostatectomy and clinical follow-up<br />

R. Schiavina, M. Fiorentino, E. Brunocilla, M.S. Rossi, S. Rizzi, D. Romagnoli, L. Bianchi, M. Borghesi,<br />

D. Diazzi, H. Dababneh, G. Passaretti, G. Martorana (Bologna, Italy)<br />

272 The HAROW study - an observational health service study, capturing current low-risk-prostate cancer<br />

treatment practice patterns in Germany<br />

A. Becker, L.A. Kluth, S. Beermann, D. Seiler, F. Recker, F.K. Chun, L. Weissbach (Hamburg, Berlin, Germany;<br />

Aarau, Switzerland)<br />

* 273 Is PSA doubling time reliable as a progression risk criterion for patients with low-risk prostate cancer in<br />

an active surveillance programme?<br />

F.B. Thomsen, I.J. Christensen, M.A. Røder, K. Brasso, P. Iversen (Copenhagen, Denmark)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

147<br />

Sunday


Sunday<br />

* 274 Prostate cancer active surveillance: Health-related quality of life in the Finnish arm of the prospective<br />

PRIAS-study. Three year update<br />

U. Lokman, H. Vasarainen, K. Lahdensuo, A.M. Erickson, K. Taari, T.K. Mirtti, A. Rannikko (Helsinki, Finland)<br />

275 The prevalence of depression and anxiety in men undergoing active surveillance for prostate cancer<br />

S.D. Watts, G. Leydon, A.J. Ridout, E.J. Arden-Close, C.M. Moore, A. Richardson, B. Birch, G. Lewith<br />

(Southampton, London, United Kingdom)<br />

148 <strong>Programme</strong> <strong>Book</strong>


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

09.15 - 10.45 Bladder cancer: Pathology<br />

Brown Hall 3 - Level S2<br />

Poster Session 24<br />

Chairs: P-U. Malmström, Uppsala (SE)<br />

Y.M. Osman, Mansoura (EG)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

276 Impact of histological variants on oncological outcomes of patients with urothelial carcinoma of the<br />

bladder treated with radical cystectomy<br />

E.N. Xylinas, M. Rink, L. Kluth, B.D. Robinson, Y. Lotan, M. Babjuk, A. Brisuda, D.A. Green, A. Pycha,<br />

Y. Fradet, R.K. Lee, P.I. Karakiewicz, M. Zerbib, D.S. Scherr, S.F. Shariat (New York, Dallas, United States of<br />

America; Prague, Czech Republic; Bolzano, Italy; Quebec City, Montreal, Canada; Paris, France)<br />

277 Methylation of tumor suppressor genes predict recurrence and subclassify non muscle-invasive disease:<br />

PTA low grade versus pt1 low grade and pt1 high grade bladder tumors<br />

R. Sacristan, C. Gonzalez, J.M. Fernandez-Gomez, F. Fresno, S. Escaf, M. Sanchez-Carbayo (Madrid, Spain)<br />

278 Could a mutational status of fibroblast growth factor receptor 3 (FGFR3) gene in bladder cancer tissue<br />

improve accuracy of clinical staging?<br />

A.I. Rolevich, M.P. Smal, S.A. Krasny, R.I. Goncharova, S.L. Polyakov, T.I. Nabebina (Minsk, Belarus)<br />

279 Practical potential of immunohistochemical staining with anti-smoothelin, anti-vimentin and anticaldesmon<br />

antibodies in pathological staging of urothelial bladder carcinoma<br />

S. Poletajew, E. Wilczek, D. Łukasik, A. Wasiutynski, B. Górnicka (Warsaw, Poland)<br />

280 Micropapillary variant of urothelial carcinoma in the upper urinary tract<br />

H.H. Sung, J.J. Kim, K.S. Lee, S.H. Choo, H.J. Jang, Y.S. Suh, S. Jeong, W. Song, J. Cho, G.Y. Kwon, H.G. Jeon,<br />

B.C. Jeong, S.I. Seo, S.S. Jeon, H-Y. Choi, H.M. Lee (Seoul, South Korea)<br />

281 Multivariate analysis of clinical and pathological predictive factors of understaging, in patients undergoing<br />

radical cystectomy<br />

A. De Gracia, O. Rodriguez Faba, J. Palou, F. Algaba, J.M. Gaya, A. Breda, L.I. Gausa, A. Wong,<br />

H. Villavicencio (Barcelona, Spain)<br />

282 Outcome of radical cystectomy for muscle-invasive bladder cancer secondary to previous non muscleinvasive<br />

stages is comparable to primary muscle-invasive bladder cancer and impacted by EORTC riskscore<br />

A. Aziz, M. Gierth, H-M. Fritsche, M. May, W. Otto, W. Wieland, S. Denzinger, A. Merseburger, H. Riedmiller,<br />

A. Kocot, M. Burger (Regensburg, Straubing, Hanover, Würzburg, Germany)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

149<br />

Sunday


Sunday<br />

283 Incidence and prognostic impact of prostate cancer on cystectomy specimens: Results of a French<br />

multicenter study<br />

G. Pignot, L. Salomon, Y. Neuzillet, A. Masson-Lecomte, C. Lebacle, J-J. Patard, P. Lunardi, P. Rischmann,<br />

G. Pasticier, J-C. Bernhard, J. Cohen, M-O. Timsit, B. Peyronnet, G. Verhoest, C. Legoux, M. Zerbib,<br />

F. Brecheteau, P. Bigot, S. Larre, T. Murez, R. Thuret, E. Lacarriere, C. Champy, M. Rouprêt, E. Comperat,<br />

J. Berger, A. Descazeaud, S. Lavilledieu, C. Avances, F. Delage, A. Valeri, B. Molimard, X. Durand,<br />

A. Houlgatte, P. Gres, A. Donnaint, F. Kleinclauss, S. Legal, A. Doerfler, N. Koutlidis, L. Cormier, J-F. Hetet,<br />

P. Colls, A. Arvin-Berod, J-J. Rambeaud, H. Quintens, M. Soulie, C. Pfister (Le Kremlin Bicetre, Creteil,<br />

Suresnes, Toulouse, Bordeaux, Paris, Rennes, Angers, Montpellier, Rouen, Limoges, Nimes, Brest, Niort,<br />

Besançon, Caen, Dijon, Nantes, Grenoble, Saint-Laurent-Du-Var, France)<br />

* 284 The role of preoperative prostatic urethral biopsy in clinical decision-making at the time of radical<br />

cystectomy<br />

J.M. Gaya, G.M. Badalato, G. Hruby, D.D. Holder, J.M. McKiernan (Barcelona, Spain; New York, United States<br />

of America)<br />

285 Precystectomy nomogram predicting risk of regional lymph node metastases in bladder cancer patients<br />

L.V. Mirylenka, O.G. Sukonko, A.V. Pravorov, A.I. Rolevich (Minsk Region, Belarus)<br />

286 Clinical and pathological nodal staging score for urothelial carcinoma of the bladder are valid decision<br />

tools for risk assessment and clinical decision-making: An external validation<br />

M.S. Gierth, H.M. Fritsche, H. Buchner, M. May, A. Aziz, W. Otto, C. Bolenz, L. Trojan, E. Hermann,<br />

A. Tiemann, S.C. Müller, J Ellinger, S. Brookman-May, C. Stief, D. Tilki, P. Nuhn, T. Höfner, M. Hohenfellner,<br />

A. Haferkamp, J. Roigas, M. Zacharias, W.F. Wieland, H. Riedmiller, S. Denzinger, P. Bastian, M. Burger<br />

(Regensburg, Munich, Straubing, Mannheim, Göttingen, Münster, Bonn, Heidelberg, Frankfurt, Berlin,<br />

Würzburg, Germany)<br />

287 A consensus study on invasiveness of bladder cancer using virtual microscopy and heatmaps (pT1 ENUP<br />

(European Network of UroPathology) study<br />

E. Compérat, L. Egevad, A. Lopez-Beltran, P. Camparo, F. Algaba, M. Amin, J. Epstein, H. Hamberg,<br />

C. Hulsbergen-Van De Kaa, G. Kristiansen, R. Montironi, C.C. Pan, K. Treurniet, J. Sykes, T. Van Der Kwast<br />

(Paris, Amiens, France; Stockholm, Uppsala, Sweden; Cordoba, Barcelona, Spain; Los Angeles, Baltimore,<br />

United States of America; Nijmegen, Rotterdam, The Netherlands; Bonn, Germany; Ancona, Italy; Tapei,<br />

Taiwan; Toronto, Canada)<br />

150 <strong>Programme</strong> <strong>Book</strong>


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

09.15 - 10.45 Prostate cancer: Surgery outcomes<br />

Silver Hall - Level N2<br />

Poster Session 25<br />

Chairs: R. Ganzer, Regensburg (DE)<br />

E. Liatsikos, Patras (GR)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

* 288 Urodynamic evaluation of urethral function after robot-assisted laparoscopic radical prostatectomy: A<br />

comparison with laparoscopic radical prostatectomy<br />

Y. Matsukawa, Y. Yoshino, M. Kato, N. Sassa, K. Matsuo, S. Takai, M. Gotoh (Nagoya, Japan)<br />

289 Preoperative functional status predicts urinary continence recovery after radical prostatectomy<br />

P. Dell’Oglio, G. Gandaglia, U. Capitanio, V. Scattoni, N. Suardi, A. Russo, N.M. Passoni, F. Abdollah,<br />

A. Salonia, V. Mirone, R. Damiano, G. Guazzoni, A. Gallina (Milan, Naples, Catanzaro, Italy)<br />

* 290 Survival, continence and potency (SCP) outcomes 5-years after robot-assisted radical prostatectomy<br />

A. Mottrie, M. Borghesi, E. Frumenzio, G. Novara, M. Gan, V. Ficarra (Aalst, Belgium; Padua, Italy)<br />

291 Quality of life and treatment options for low risk prostate cancer<br />

I.C. Acar, C. Schoffelmeer, C. Tillier, W. De Blok, E. Van Muilekom, H. Van Der Poel (Amsterdam, The<br />

Netherlands)<br />

292 Delay of curative treatment for prostate cancer and outcomes: Cohort analysis and literature review<br />

R.C.N. Van Den Bergh, C. Schoffelmeer, H.G. Van Der Poel (Utrecht, Amsterdam, The Netherlands)<br />

293 Secondary radiotherapy after radical prostatectomy does not compromise urinary continence<br />

M. Adam, P. Wenzel, D. Lanwehr, M. Graefen, U. Michl, A. Faried, H. Huland, T. Schlomm, P. Tennstedt,<br />

A. Becker, R. Schwarz (Hamburg, Germany)<br />

294 Capsular incision during radical prostatectomy does not affect early biochemical recurrence rates<br />

P. Tennstedt, A. Haese, M. Graefen (Hamburg, Germany)<br />

295 Inverse stage migration of clinically localized prostate cancer still continues and is most pronounced in<br />

elder patients<br />

M.C. Butea-Bocu, H. Huland, U. Michl, G. Salomon, T. Steuber (Hamburg, Germany)<br />

296 The Worcestershire prostate cancer survivorship programme: A new concept for holistic long term support<br />

and follow up<br />

S. Goonewardene, M. Symons, A. Sullivan, V. Milner, G. McCormack, A. Makar (Worcester, United Kingdom)<br />

297 Accuracy of phased-array 3.0-T MR imaging in predicting extracapsular extension and influence on the<br />

decision to preserve neurovascular bundles at robotic assisted laparoscopic radical prostatectomy<br />

B.H. Park, S.H. Choo, H.J. Jang, Y.S. Suh, U.S. Jeong, W. Song, H.G. Jeon, B.C. Jeong, S.I. Seo, H.Y. Choi,<br />

H.M. Lee, K.S. Lee, S.S. Jeon (Seoul, South Korea)<br />

298 PUKA study: A snapshot of radical prostatectomy practice in the UK<br />

A. Laird, S. Fowler, D. Cahill, S.F. Brewster, T. O’Brien, S.A. McNeill (Edinburgh, London, Oxford, United<br />

Kingdom)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

151<br />

Sunday


Sunday<br />

299 Perioperative, functional and oncological outcomes after robot-assisted radical prostatectomy in men 70<br />

years of age and over with localized prostate cancer<br />

C. Giedelman, H. Abdul-Muhsin, O. Schatloff, S. Samavedi, R. Coelho, A. Sivaraman, S. Chauhan,<br />

K.J. Palmer, G. Ebra, V. Patel (Celebration, United States of America)<br />

152 <strong>Programme</strong> <strong>Book</strong>


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

09.15 - 10.45 Treatment of neurogenic LUTD<br />

Red Hall 1 - Level N1<br />

Poster Session 26<br />

Chairs: V.W. Nitti, New York (US)<br />

A. Reitz, Zurich (CH)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

* 300 Desmopressin in the treatment of nocturia in patients affected by Parkinson’s disease<br />

S. Proietti, M. Gubbiotti, J.A. Rossi De Vermandois, A. Giannantoni (Rozzano, Perugia, Italy)<br />

301 Treatment of neurogenic detrusor overactivity (NDO) by combined low dosed antimuscarinics: Four years<br />

experience<br />

M. Spinelli, M. Citeri, C. Guerrer, L. Zanollo (Milan, Italy)<br />

302 Lower urinary tract symptoms and urodynamic dysfunctions in clinically isolated syndromes suggestive of<br />

multiple sclerosis<br />

S. Proietti, M. Di Filippo, P. Sarchielli, M Gubbiotti, J.A. Rossi De Vermandois, L. Gaetani, P. Calabresi,<br />

A. Giannantoni (Milan, Perugia, Italy)<br />

303 Urinary symptoms and sexual dysfunction in patients affected by multiple sclerosis<br />

A. Giannantoni, S. Proietti, M. Gubbiotti, J.A. Rossi De Vermandois, M. Porena (Perugia, Rozzano (mi), Italy)<br />

* 304 Long term functional outcomes after continent cutaneous urinary diversion in patients with neurological<br />

disease: A monocentric experience<br />

M.A. Perrouin-Verbe, V. Phé, M. Rouprêt, A. Even, F. Giuliano, G. Robain, P. Denys, M-O. Bitker, E. Chartier-<br />

Kastler (Paris, Garches, France)<br />

305 Effects of anticholinergic agents on efficacy of penile vibratory stimulation to obtain ejaculation in spinal<br />

cord injured males<br />

M. Spinelli, C. Guerrer, L. Zanollo, M. Citeri, L. Rizzato (Milan, Italy)<br />

306 Investigation to restore innervation of the lower urinary tract of spinal cord injured patients: A European<br />

single-center retrospective study with long-term follow-up<br />

K-D. Sievert, B. Amend, F. Roser, A. Badke, A. Baron, J. Bedke, S. Kruck, H. Kaps, A. Stenzl, M. Tatagiba<br />

(Tübingen, Germany)<br />

307 PNE versus staged test trials for sacral neuromodulation: Sensitivity, specificity and predictive values of<br />

each technique<br />

A. Banakhar, M. Hassouna (Jeddah, Saudi Arabia; Toronto, Canada)<br />

308 Patient-reported goal achievement after onabotulinumtoxinA treatment in patients with neurogenic<br />

detrusor overactivity<br />

E. Chartier-Kastler, V. Khullar, E. Rovner, M. Chancellor, C. Corbell, J. Jin, D. Globe (Paris, France; London,<br />

United Kingdom; Charleston, Royal Oak, Irvine, United States of America)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

153<br />

Sunday


Sunday<br />

309 Withdrawn<br />

310 Sacral neuromodulation for refractory lower urinary tract dysfunction: A prospective series of 98 patients<br />

undergoing tined lead test stimulation at a single center<br />

D.S. Engeler, D. Abt, D. Meyer, H-P. Schmid (St. Gallen, Switzerland)<br />

154 <strong>Programme</strong> <strong>Book</strong><br />

Summary - How to improve the treatment of neurogenic LUTD?<br />

V.W. Nitti, New York (US)


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

09.15 - 10.45 Stones: Basic research, imaging and training models<br />

Red Hall 2 - Level N1<br />

Poster Session 27<br />

Chairs: S. Oehlschläger, Dresden (DE)<br />

T. Sulser, Zürich (CH)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

* 311 Active phagocytosis and processing of calcium oxalate monohydrate crystals in an in vitro macrophage<br />

model<br />

A. Okada, T. Yasui, L. Zuo, K. Taguchi, Y. Fujii, Y. Itoh, Y. Hirose, M. Usami, K. Niimi, R. Ando, T. Kobayashi,<br />

S. Hamamoto, M. Hirose, Y. Itoh, K. Tozawa, K. Kohri (Nagoya, Japan)<br />

312 Effects of aminobisphosphonates and thiazides in patients with hypercalciuria, recurrent renal calcium<br />

lithiasis and osteopenia/osteoporosis<br />

M.A. Arrabal Polo, S. Gonzalez-Torres, F. Lopez Carmona, C. Lahoz Garcia, J. Moreno Jimenez, A. Zuluaga<br />

Gomez, M. Arrabal Martin (Granada, Spain)<br />

313 The Randall plaques - a new marker for metabolic syndrome?<br />

A. Ciudin, P. Luque, M.G. Diaconu, R. Salvador, A. Franco, R. Alvarez-Vijande, C. Nicolau, A. Alcaraz<br />

(Barcelona, Spain)<br />

314 Using bisphosphonates to effectively inhibit calcium oxalate crystal aggregation<br />

S.E. Allen, S. Choong, C.H. Fry, W.G. Robertson (London, United Kingdom)<br />

315 Detecting micro stones in urine after ESWL with quantitative micro-raman spectroscopy<br />

Y.C. Chiu, H.K. Chiang, S-H. Lu, A.W. Chiu (Taipei, Taiwan)<br />

316 What is the best method to evaluate urine pH? A trial of three clinical urine pH measurement devices in a<br />

stone clinic<br />

R. Ilyas, K. Chow, J.G. Young (Manchester, United Kingdom)<br />

317 In vitro study on ureteral smooth muscle relaxation with tamsulosin, nifedipine, and terpene mixure<br />

(Rowatinex®)<br />

J.W. Lee, M.Y. Lee, S.C. Park, J.S. Rim, I.Y. Seo (Iksan, South Korea)<br />

318 Incidence of Computed Tomography (CT) detected urolithiasis: An update<br />

S.L. Lee, L.T. Koh, K.K. Ng, F.C. Ng (Singapore, Singapore)<br />

319 Radiation exposure of the patient submitted to endourologic treatment for ureteral calculi<br />

F. Nigro, P. Ferrarese, G. Benedetto, E. Bratti, E. Scremin, S. Savastano, A. Tasca (Vicenza, Italy)<br />

320 Evaluation of a novel fascial dilator modified with scale marker in PCNL for reduction of x-ray exposure:<br />

A randomized clinical study<br />

Z. Guohua, Z. Zhao, W. Zhong, W. Chen, W. Wu, D. Qi, C. Xiao, Y. Liu (Guangzhou, China)<br />

321 Customized protocols for the Uro Dyna-CT reduce radiation exposure of endourological patients<br />

M-C. Rassweiler, R. Banckwitz, C. Koehler, B. Mueller-Allisaat, M.S. Michel, A. Haecker, M. Ritter<br />

(Mannheim, Forchheim, Germany)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

155<br />

Sunday


Sunday<br />

322 Accuracy in measuring renal stones using the Uro Dyna-CT<br />

B. Meister, M-C. Rassweiler, C. Weiss, M.-S. Michel, A. Häcker, M. Ritter (Mannheim, Germany)<br />

323 Stones of different compositions – depiction in the Uro Dyna-CT<br />

B. Meister, M-C. Rassweiler, M-S. Michel, M. Ritter (Mannheim, Germany)<br />

156 <strong>Programme</strong> <strong>Book</strong>


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

09.15 - 10.45 Preclinical innovation - the future of erectile dysfunction treatment?<br />

Blue Hall 1-2 - Level N1<br />

Poster Session 28<br />

Chairs: C.S.R. Costa, Porto (PT)<br />

E. Wespes, Brussels (BE)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

* 324 Intratunical injection of human adipose tissue-derived stem cells prevents fibrosis and is associated with<br />

improved erectile function in a rat model of Peyronie’s disease<br />

F. Castiglione, P. Hedlund, F. Van Der Aa, T.J. Bivalacqua, M. Albersen (Milan, Italy; Leuven, Belgium;<br />

Baltimore, United States of America)<br />

* 325 Repair of erectile dysfunction using transplantation of human mesenchymal stem cells cultivated on the<br />

surface of nanofibrous meshes in rats with cavernous nerve injury<br />

Y.S. Song, H.J. Lee, J. An, J.H. Yun, J.H. Kim, S.W. Doo, W.J. Yang, S.U. Kim (Seoul, South Korea)<br />

326 Galanin, a trophic neuropeptide, is upregulated in the rat major pelvic ganglia following cavernous nerve<br />

crush injury<br />

M. Albersen, J. Hannan, L. Hakim, X. Liu, F. Castiglione, F. Van Der Aa, P. Hedlund, T.J. Bivalacqua (Leuven,<br />

Belgium; Baltimore, United States of America; Milan, Italy)<br />

327 Time-dependent changes in the regulation of neurotrophin expression and neurite sprouting in the rat<br />

major pelvic ganglion following cavernous nerve injury<br />

J. Hannan, M. Albersen, B.L. Stopak, X. Liu, A.L. Burnett, P. Hedlund, F. Van Der Aa, T.J. Bivalacqua<br />

(Baltimore, United States of America; Leuven, Belgium; Milan, Italy)<br />

328 Inhibition of the fatty acid amide hydrolase (FAAH) reduces in vivo spontaneous seminal vesicle<br />

contractions and increases latency to apomorphine-induced ejaculation<br />

G. La Croce, A. Bettiga, R. Buono, G. Colciago, F. Benigni, F. Mistretta, F. Castiglione, M. Albersen,<br />

P. Hedlund (Milan, Italy; Leuven, Belgium)<br />

329 Expression of the transient receptor potential cationic channel A1 (TRPA1) in the human seminal vesicles -<br />

an immunohistochemical and molecular biology study<br />

S. Ückert, A. Simon, J.E. Sonnenberg, A.S. Merseburger, M.A. Kuczyk, P. Hedlund (Hanover, Barsinghausen,<br />

Germany; Milan, Italy)<br />

330 Occlusion of the seminal vesicles increases sexual activity in male mice: Results of a novel mouse<br />

experiment<br />

F.D. Birkhäuser, C. Schumacher, R. Seiler, L. De Meuron, P. Zehnder, B. Roth, A. Wetterwald, G.N. Thalmann,<br />

M.G. Cecchini, U.E. Studer (Berne, Switzerland)<br />

331 Cannabinoid receptors in the human seminal vesicles<br />

M. Moschini, A. Bettiga, R. Luciano, M. Freschi, P. Hedlund, S. Uckert (Milan, Italy; Hanover, Germany)<br />

332 Involvement of Rho-kinase/LIM-kinase/cofilin signaling pathway in erectile dysfunction and corporal<br />

fibrosis after cavernous nerve injury in male rats<br />

M.C. Cho, S.H. Song, S.Y. Cho, K. Park, S.W. Kim, J-S. Paick (Goyang, Seoul, South Korea)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

157<br />

Sunday


Sunday<br />

333 Adrenomedullin and angiopoietin-1 additively restore erectile function in diabetic rats: Comparison with<br />

the combination therapy with vascular endothelial growth factor and angiopoietin-1<br />

H. Nishimatsu, E. Suzuki, A. Nomiya, A. Niimi, H. Fukuhara, T. Fujimura, M. Suzuki, H. Kume, Y. Homma<br />

(Tokyo, Kawasaki, Japan)<br />

334 Usefulness of tropomyosin as a marker of response to 5-phosphodiesterase inhibitors<br />

R. Brime Menendez, L. San José Manso, I. Galante Romo, J.J. Leon Zamorano, P. Rodriguez Sierra, P. Jimenez<br />

Mateos-Cáceres, L. Calatrava Ledrado, P. Anastasio De Las Heras, A. Lopez Farre, C. Olivier Gómez (Madrid,<br />

Spain)<br />

335 Testosterone replacement therapy can increase circulating endothelial progenitor cell number in men with<br />

late-onset hypogonadism<br />

C.T. Wu, C.H. Liao, S.P. Liu, Y.N. Wu, H.S. Chiang (Taipei, New Taipei City, Taiwan)<br />

158 <strong>Programme</strong> <strong>Book</strong>


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

09.15 - 10.45 Renal tumour diagnosis: From new techniques to follow-up<br />

Yellow Hall 1-2-3 - Level N1<br />

Poster Session 29<br />

Chairs: A. Cestari, Milan (IT)<br />

J.M. De La Morena Gallego, Madrid (ES)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion.<br />

336 Sorafenib decreases Indium-111-girentuximab tumor uptake in clear cell renal cell carcinoma patients<br />

C.H.J. Muselaers, O.C. Boerman, A.B. Stillebroer, I.M.E. Desar, M.J. Boers-Sonderen, C.M.L. Van Herpen,<br />

J.F. Langenhuijsen, E. Oosterwijk, W.P.J. Leenders, W.J.G. Oyen, P.F.A. Mulders (Nijmegen, The Netherlands)<br />

337 Clinicopathological characteristics of Xp11 translocation renal cell carcinoma in adults: Diagnosis using<br />

FISH analysis in conjunction with TFE3 immunostaining<br />

M. Hirobe, N. Masumori, T. Tanaka, H. Kitamura, A. Tonooka, T. Hasegawa, T. Tsukamoto (Sapporo, Japan)<br />

338 Do small renal cell carcinomas have a higher prevalance of locally advanced growth and distant<br />

metastases? A large multicentre study<br />

S. Steffens, M. Janssen, F.C. Roos, F. Becker, S. Schumacher, R. Hofmann, G. Wegener, S. Siemer, M. Stöckle,<br />

J.W. Thüroff, M. Schrader, K. Junker, M.A. Kuczyk, A.J. Schrader (Hanover, Homburg/Saar, Mainz, Homburg,<br />

Ulm, Marburg, Germany)<br />

339 Histopathological and molecular predictors of chronic kidney disease progression and its related mortality<br />

after radical nephrectomy<br />

T. Sejima, H. Iwamoto, T. Masago, S. Morizane, A. Yao, T. Isoyama, A. Takenaka (Yonago, Japan)<br />

340 Independent validation of the 2010 TNM staging system for renal cell carcinoma: Does it improves<br />

predictive accuracy in cancer-specific mortality compared to 2002 TNM?<br />

M. Roscigno, S. Shariat, M. May, R. Zigeuner, T. Chromecki, C. Stief, L. Schips, O. De Cobelli, B. Rocco, C. De<br />

Nunzio, B. Feciche, M. Truss, S. Pahernik, S. Zastrow, G. Novara, A. Minervini, A. Antonelli, V. Mirone,<br />

A. Simonato, R. Bertini, V. Ficarra, S. Brookman-May (Bergamo, Vasto, Milan, Rome, Padua, Florence,<br />

Brescia, Naples, Genova, Italy; New York, United States of America; Straubing, Munich, Dortmund,<br />

Heidelberg, Dresden, Regensburg, Germany; Graz, Austria; Cluj-Napoca, Romania; Aalst, Belgium)<br />

341 Interdisciplinary counseling service for renal malignancies: Patients and physicians view of a new model<br />

of care<br />

J. Huber, A. Ihrig, E. Winkler, C. Gruellich, P. Hallscheidt, M. Zeier, S. Pahernik, M. Hohenfellner (Heidelberg,<br />

Germany)<br />

342 Is it necessary to perform long term follow up in patients after surgery for renal cell carcinoma pT1 and<br />

pT2?<br />

S. Nestler (Mainz, Germany)<br />

343 Prevalence of Computed Tomography (CT) detected solid renal masses: An update<br />

S.L. Lee, L.T. Koh, K.K. Ng, F.C. Ng (Singapore, Singapore)<br />

344 Preoperative decision-making for renal cell carcinoma: Cystic morphology in cross sectional imaging<br />

predicts lower malignant potential<br />

J. Huber, A. Winkler, T. Bruckner, W. Roth, P. Hallscheidt, K. Daneshvar, M. Hohenfellner, S. Pahernik<br />

(Heidelberg, Germany)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

159<br />

Sunday


Sunday<br />

345 Diffusion weigthed MRI of the kidney as surrogate marker for the prediction of the aggressiveness of renal<br />

carcinoma<br />

S. Sevcenco, F.E. Kuehhas, P. Weibl, T. Szarvas, G. Kramer, G. Heinz-Peer, D. Javor, L. Ponhold, P. Baltzer,<br />

H.C. Klingler (Vienna, Austria)<br />

346 Use of contrast-enhanced ultrasonography in diagnosis of renal masses and concordance with computed<br />

tomography<br />

S. Alvarez Rodríguez, E. Sanz Mayayo, L. López-Fando Lavalle, L.A. Córdoba Martínez, V. Hevia Palacios,<br />

F. Arias Fúnez, R. Rodríguez-Patrón Rodríguez, F.J. Burgos Revilla (Madrid, Spain)<br />

347 A large scale validation study proposes high pre-operative plasma fibrinogen levels as an independent<br />

negative prognostic factor regarding cancer-specific, metastasis-free, as well as overall survival in a<br />

European cohort of renal cell carcinoma patients<br />

G.C. Hutterer, M. Pichler, C. Stoeckigt, T. Chromecki, T. Stojakovic, S. Golbeck, S. Mannweiler, K. Pummer,<br />

R. Zigeuner (Graz, Austria)<br />

348 Validation of CRP as prognostic marker for renal cell carcinoma in a large series of patients<br />

S. Steffens, A. Köhler, R. Rudolph, H. Eggers, C. Seidel, M. Janssen, G. Wegener, M. Schrader, M.A. Kuczyk,<br />

A.J. Schrader (Hanover, Ulm, Homburg, Germany)<br />

349 Clinical significance of preoperative thrombocytosis in patient performed radical nephrectomy for nonmetastatic<br />

renal cell carcinoma<br />

P.H. Song, Y.S. Ji, K.H. Kim, Y.H. Ko, K.H. Moon, H.C. Jung (Daegu, Gyeongju, South Korea)<br />

160 <strong>Programme</strong> <strong>Book</strong>


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Thematic Session 1<br />

11.00 - 12.00 <strong>EAU</strong> Guidelines Office: Recommendation updates <strong>2013</strong><br />

Brown Hall 1-2 - Level S2<br />

Chair: K.F. Parsons, Liverpool (GB)<br />

11.00 - 11.20 Update Renal cell cancer guidelines<br />

B. Ljungberg, Umeå (SE)<br />

Aims and objectives<br />

The current update <strong>2013</strong> of the guidelines on Renal Cell Carcinoma is a first attempt to use a systematic review<br />

strategy of available literature. The literature search strategy includes the construction of screening questions<br />

using PICO elements for the evaluation. Using structured screening, flow diagrams present eligibility of<br />

studies, and data from included studies will be summarized. Based on the results recommendations can be<br />

presented based on the current knowledge. The update presents recommendations on diagnosis, treatment<br />

strategies including last releases on medical therapy used in renal cell carcinoma.<br />

11.20 - 11.40 Update Imaging in Urology – a European and United States perspective<br />

P. Fulgham, Dallas (US)<br />

Aims and objectives<br />

This portion of the lecture will demonstrate the variability of imaging terminology used in a single document<br />

regarding imaging in the management of ureteral calculous disease. The technology assessment analysed<br />

was written by four authors considered experts on urologic imaging, working closely together as the<br />

Ureteral Imaging Task Force under the aegis of the American Urological Association Guidelines Panel. We<br />

show that a single imaging modality such as computed tomography may have as many as 16 variations<br />

within a single document. Analysis of root terms and synonyms provides insight into how these varied terms<br />

may be subcategorised. A standardised nomenclature would facilitate the meta-analysis of the world’s<br />

literature regarding that imaging modality and thereby produce more robust recommendations for its use.<br />

Standardisation of imaging nomenclature would be particularly helpful in developing guidelines shared by<br />

varied organisations. Although currently primarily descriptive, a standardised imaging terminology could<br />

become prescriptive if combined with performance parameters.<br />

T. Loch, Flensburg (DE)<br />

Aims and objectives<br />

With the evolution of imaging in Urology, there has been an exponential growth in research and considerable<br />

clinical interest in utilizing imaging techniques in clinical practice. It is a multidisciplinary process with<br />

contributions from investigators and clinicians of varied backgrounds: physics and engineering, informatics,<br />

urology, and radiology. However, the terminology used in this area is not uniform. As a consequence, there<br />

are often multiple abbreviations and synonyms for similar investigations with overlapping definitions that<br />

can potentially confuse or misdirect clinicians and researchers alike. As a contribution to the literature,<br />

clinical practice, and investigative urology, the Guideline Office (GO) of the <strong>EAU</strong> with its imaging panel has<br />

compiled a standard set of medical terms that are recommended to be used in clinical and investigative<br />

urology practice.<br />

11.40 - 12.00 Update The pros and cons of urological thromboprophylaxis<br />

K.A.O. Tikkinen, Helsinki (FI)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

161<br />

Sunday


Sunday<br />

162 <strong>Programme</strong> <strong>Book</strong><br />

Aims and objectives<br />

Decisions regarding both nonpharmacologic and pharmacologic peri-operative prophylaxis to prevent venous<br />

thromboembolism in patients undergoing urologic surgery are controversial, and practices differ substantially.<br />

Reasons for not using thromboprophylaxis include increased risk of bleeding, burden of interventions,<br />

and lack of knowledge. We will present the first <strong>EAU</strong> Guideline addressing thromboprophylaxis: provide<br />

evidence-based recommendations based on a systematic literature search. Our goals include estimation of<br />

baseline risk of symptomatic VTE and bleeding, and estimation of treatment effects of thromboprophylaxis.<br />

Finally, we will also present guidance on management of patients using anticoagulant medication for other<br />

reasons (bridging therapy).


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Thematic Session 2<br />

11.00 - 12.00 What are the limitations of minimally invasive surgery?<br />

Yellow Hall 1-2-3 - Level N1<br />

Chair: A. Breda, Barcelona (ES)<br />

11.00 - 11.15 State-of-the art lecture Do long-term outcomes of robot-assisted radical prostatectomy justify the costs?<br />

M. Stöckle, Homburg (DE)<br />

11.15 - 11.30 State-of-the-art lecture What are the limits of laparoscopic nephron-sparing surgery?<br />

A. Volpe, Novara (IT)<br />

Aims and objectives<br />

In experienced hands laparoscopic partial nephrectomy (LPN) for localised renal tumors achieves similar<br />

oncologic outcomes of open partial nephrectomy, with the known advantages of minimal invasiveness.<br />

However, LPN is a challenging technique which is associated with a higher risk of complications and a longer<br />

warm ischemia time, with the related potential effects on postoperative renal function. Modern techniques<br />

can limit or even avoid ischemia during LPN, but their feasibility in the hands of less experienced surgeons<br />

has not been assessed. Overall, the limits of LPN significantly depend on the laparoscopic experience and<br />

skills of each single surgeon. Although formal cost analysis and longer follow-up are needed, the ability<br />

of robotic assistance to reduce the technical challenges and overcome the limits of the pure laparoscopic<br />

approach are already being realised and are likely to become more evident with time and increasing<br />

expertise.<br />

11.30 - 11.45 State-of-the-art lecture Open vs robot-assisted radical cystectomy and urinary diversion<br />

P. Wiklund, Stockholm (SE)<br />

11.45 - 12.00 Abstract presentations: Special selection from the poster sessions<br />

261 A prospective comparison of surgical and pathological outcomes obtained after robot-assisted or pure<br />

laparoscopic partial nephrectomy in moderate to complex renal tumors: Results from a French multicentric<br />

collaborative study<br />

A. Masson-Lecomte, K. Bensalah, E. Seringe, C. Vaessen, A. De La Taille, N. Doumerc, P. Rischmann,<br />

F. Bruyere, L. Soustelle, S. Droupy, M. Rouprêt (Creteil, Rennes, Paris, Toulouse, Tours, Nîmes, France)<br />

1017 Prospective randomised study comparing transperitoneal and extraperitoneal approach during robotic<br />

prostatectomy: Anesthesiologic effects<br />

F. Dal Moro, C. Valotto, A. Mangano, R. Soncin, A. Crestani, A. Guttilla, G.M. Pittoni, F. Zattoni (Padova, Italy)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

163<br />

Sunday


Sunday<br />

Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

164 <strong>Programme</strong> <strong>Book</strong><br />

Thematic Session 3<br />

11.00 - 12.00 From bench to bedside: What will be replacing PSA?<br />

Blue Hall 1-2 - Level N1<br />

Chair: Z. Culig, Innsbruck (AT)<br />

11.00 - 11.15 State-of-the-art lecture Gene fusions in prostate cancer: Is it helping?<br />

T. Visakorpi, Tampere (FI)<br />

Aims and objectives<br />

The finding of TMPRSS2:ERG fusion immediately raised the question could it be utilized in the treatment of<br />

prostate cancer, either as a drug target or as a biomarker. What is good about the fusion genes as biomarkers,<br />

is that they are genetic alterations. As such they are cancer specific and do not exist in normal cells. There<br />

has been a large number of publications interrogating whether the TMPRSS2:ERG fusion detected in tissue<br />

specimen is associated with prognosis. Most of the studies suggest it is not. There have also been a few<br />

studies detecting the fusion from blood, circulating tumor cells (CTCs), and urine. And, it seems that in a<br />

combination with PCA3, TMPRSS2:ERG could improve the utility of serum PSA to detect clinically significant<br />

cancer. Also other fusion genes than TMPRSS2:ERG have been and will be identified in prostate cancer.<br />

Common factor for these fusions is that they are rare. Thus, they will unlikely have a potential of being<br />

biomarkers alone. However, they may turn out to be useful in selecting targeted drugs if available.<br />

11.15 - 11.30 State-of-the-art lecture The role of the pathologist in clinical prognosis<br />

G. Kristiansen, Bonn (DE)<br />

11.30 - 11.45 State-of-the-art lecture MicroRNA in prostate cancer diagnosis<br />

H. Sültmann, Heidelberg (DE)<br />

Aims and objectives<br />

miRNAs are small non-coding RNAs involved in posttranscriptional regulation of gene expression. While<br />

recent studies have suggested the usefulness of miRNAs in tissues and body fluids for tumor diagnosis,<br />

prognosis, and prediction, technical parameters, e.g. nucleic acid recovery from limited sources of<br />

biomaterial, sample standardisation, data normalisation, as well as independent validation of screening<br />

data, are still challenging. The presentation will highlight the potential as well as obstacles for translating<br />

miRNA markers into diagnostic applications for prostate cancer.<br />

11.45 - 12.00 Abstract presentations: Special selection from the poster sessions<br />

1045 Urinary PCA3 and TMPRSS2:ERG help predict biopsy outcome prior to initial prostate biopsy using a risk<br />

group analysis<br />

J.R. Day, L.A. Jones, S.E. Meyer, P.N. Hodge, J. Aussie, D.R. Saltzstein, J.C. Groskopf (San Diego, San Antonio,<br />

United States of America)<br />

139 Reducing unnecessary biopsies for suspicion of prostate cancer: Extension and validation of an ERSPC<br />

based risk calculator with Phi<br />

M.J. Roobol, D. Nieboer, A. Houlgatte, S. Vincendeau, M. Lazzeri, G. Guazzoni, C. Stephan, A. Semjonow,<br />

A. Haese, M. Graefen, E.W. Steyerberg (Rotterdam, The Netherlands; Paris, Rennes, France; Milan, Italy;<br />

Berlin, Munster, Hamburg, Germany)


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Thematic Session 4<br />

11.00 - 12.00 Non-muscle invasive bladder cancer<br />

Silver Hall - Level N2<br />

Chair: J.W.F. Catto, Sheffield (GB)<br />

11.00 - 11.15 State-of-the-art lecture Molecular sub-classification of bladder cancer<br />

M. Sanchez-Carbayo, Madrid (ES)<br />

Aims and objectives<br />

As early events in bladder carcinogenesis, methylation and other epigenetic alterations would provide<br />

diagnostic power complementing previously described genetic factors. As related to different steps in<br />

tumor progression, they could also provide clinical utility for tumour sub-classification. Our group has<br />

been working over the past years on characterising whether hypermethylation of profiles, focused panels<br />

of tumor suppressor genes and individual candidates could classify bladder cancer subgroups according not<br />

only to pathologic or clinical criteria but also to patient outcome. Part of our studies is aiming to evaluate<br />

the clinical utility of CpG hypermethylation for the molecular classification of bladder tumours based on<br />

their aggressiveness and clinical behaviour: from comprehensive CpG array methylation profiling, to several<br />

multiplexed panels of TSGs, and finally characterising specific individual methylated candidates. In this<br />

talk, the major results of these three strategies for bladder cancer sub-classification will be summarised:<br />

using CpG arrays, methylation specific multiplex ligation-dependent probe amplification (MS-MLPA), and<br />

methylation specific polymerase chain reactions (MS-PCR) analyses.<br />

11.15 - 11.30 State-of-the-art lecture Photodynamic diagnosis: Fact or fiction?<br />

M. Burger, Würzburg (DE)<br />

Aims and objectives<br />

The aims of this presentation is a comprehensive depiction of currently available data on the use of<br />

photodynamic diagnosis in bladder cancer and a critical debate and evaluation of the evidence. The<br />

first objective is the depiction of the potential impact of any method improving cystoscopic detection of<br />

bladder cancer. The second objective is the description, the mode of action and debate of the feasibility<br />

of photodynamic diagnosis. The third objective is an overview of currently available data on potential<br />

improvements of detection and recurrence rates compared to standard white light cystoscopy. The fourth<br />

objective is the debate of potential overall benefit for patients. The fifth objective is to pinpoint questions<br />

unanswered to date and the sixth objective is the critical evaluation of what we know so far and a debate on<br />

potential benefits and uncertainties.<br />

11.30 - 11.45 State-of-the-art lecture New advances in perioperative instillation therapy in NMIBC<br />

J.A. Witjes, Nijmegen (NL)<br />

Aims and objectives<br />

The initial resection of bladder tumors is a very important diagnostic and therapeutic tool. Therefore, optimal<br />

initial treatment, including pre-, per-, or postoperative intravesical instillations or other means of help, is an<br />

absolute must in bladder cancer treatment<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

165<br />

Sunday


Sunday<br />

11.45 - 12.00 Abstract presentations: Special selection from the poster sessions<br />

708 Side effects of BCG in the treatment of intermediate and high risk Ta T1 papillary carcinoma of the bladder:<br />

Results from EORTC GU Cancers Group randomised study 30962 comparing 1/3 dose vs full dose during 1<br />

or 3 years<br />

M. Brausi, J. Oddens, R. Sylvester, S. Colette, P. Gontero, A. Bono, L. Turkeri (Modena, Torino, Varese, Italy;<br />

‘s-Hertogenbosch, The Netherlands; Brussels, Belgium; Istanbul, Turkey)<br />

166 <strong>Programme</strong> <strong>Book</strong><br />

74 Interval between cystectomy and start of adjuvant chemotherapy is an independent prognostic factor for<br />

patients with locally advanced or lymph node positive carcinoma of the urinary bladder<br />

C.H. Ohlmann, J. Kamradt, B. Burgard, M. Saar, I. Azone, S. Siemer, M. Stöckle, J. Lehmann (Homburg, Kiel,<br />

Germany)


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Thematic Session 5<br />

11.00 - 12.00 Joint session with the European Society of Nuclear Medicine:<br />

Diagnostics and therapy of bone metastases in patients with<br />

advanced prostate cancer<br />

Red Hall 2 - Level N1<br />

Chairs: A. Chiti, Rozzano (IT)<br />

M. Wirth, Dresden (DE)<br />

11.00 – 11.30 Choline & Fluoride imaging of bone metastases in prostate cancer<br />

W. Langsteger, Linz (AT)<br />

11.30 – 11.45 Treatment of bone metastases<br />

B. Djavan, Vienna<br />

11.45 – 12.00 Alpharadin: New horizons in systemic therapy<br />

C. Parker, London (GB)<br />

Aims and objectives<br />

Radium-223 is a novel alpha-pharmaceutical that has been tested in men with bone metastases from<br />

advanced prostate cancer. Radium-223 is very similar to calcium, and so is rapidly taken up in bone, and<br />

particularly in bone metastases. It emits very high-energy alpha particles that cause lethal damage to<br />

adjacent tumour cells.<br />

The ALSYMPCA trial was a Phase III, randomised, double-blind, placebo-controlled study of radium-223 plus<br />

best standard care compared with placebo plus best standard care in 921 patients with castrate resistant<br />

prostate cancer (CRPC) and bone metastases. Radium-223 was associated with an overall survival benefit,<br />

a delay in time to first skeletal-related event, an improvement in quality of life and a favourable safety<br />

profile.<br />

These results suggest that radium-223 may provide a new standard of care for the treatment of men with<br />

CRPC and bone metastases.<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

167<br />

Sunday


Sunday<br />

Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

168 <strong>Programme</strong> <strong>Book</strong><br />

Thematic Session 6<br />

11.00 - 12.00 Small renal masses: To treat or not to treat?<br />

eURO Auditorium - Level S2<br />

Chair: P.F.A. Mulders, Nijmegen (NL)<br />

11.00 - 11.15 State-of-the-art lecture Needle biopsy of renal masses: When and how<br />

M. Kuczyk, Hanover (DE)<br />

Aims and objectives<br />

During recent years a revival of the biopsy of renal masses can be observed. On one hand this is due to<br />

the increasing frequency of incidentally detected small renal masses that are, in part, treated by ablative<br />

techniques. However, the histological differentiation of small renal masses is benign in up to 30% of cases.<br />

The individual patient should not be subjected to a treatment that is associated with a distinct complication<br />

rate until malignancy has been proven. Today, an organ-preserving strategy is the standard of care during<br />

the treatment of small renal masses. In case of an unfavourable localisation of renal tumours that might<br />

make organ-preservation difficult, biopsy can be recommended to prove a malignant differentiation upfront<br />

surgery.<br />

11.15 - 11.20 Case presentation: A patient with an incidentaloma of the kidney<br />

P.F.A. Mulders, Nijmegen (NL)<br />

11.20 - 11.50 Debate How to survive a small renal mass<br />

11.20 - 11.35 Pro Observation<br />

M. Jewett, Toronto (CA)<br />

Aims and objectives<br />

Small Renal Mass (SRM) is the most common presentation for RCC but not all SRMs are malignant. Needle core<br />

biopsy is an accurate and safe diagnostic method that is underutilised. The standard for treatment is partial<br />

nephrectomy with ablation in selected cases. Most RCC SRMs grow slowly so that initial active surveillance<br />

(AS) using serial imaging with delayed treatment for progression is an option, particularly in the older and<br />

infirm. Markers of progression are poorly understood and currently we depend on rapid growth as the main<br />

trigger for treatment. We are in the early phase of personalising AS strategies by tumour characteristics<br />

including histology and host comorbidity status. Urologists should have a current understanding of this<br />

new clinical entity SRM to better manage new RCC patients with a disease that is increasing due to image<br />

detection of incidental lesions. Most are RCC which is the most lethal of GU malignancies and can not be<br />

cured if metastatic. This concern is probably leading to unnecessary treatment of many SRM that could be<br />

managed by AS.<br />

11.35 - 11.50 Con Minimally invasive partial nephrectomy<br />

I.S. Gill, Los Angeles (US)<br />

Aims and objectives<br />

My lecture will present the data and the rationale for surgical treatment of small renal masses in the healthy<br />

patient with projected longevity. Pros and cons of active surveillance will be presented. The inadequacy of<br />

imaging in diagnosing cancer, and the emerging role of needle biopsy will be discussed.


11.50 - 12.00 Rebuttal<br />

I.S. Gill, Los Angeles (US)<br />

M. Jewett, Toronto (CA)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

169<br />

Sunday


Sunday<br />

Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

170 <strong>Programme</strong> <strong>Book</strong><br />

Thematic Session 7<br />

11.00 - 12.00 Management of surgical complications<br />

Brown Hall 3 - Level S2<br />

Chairs: J. Rassweiler, Heilbronn (DE)<br />

R.F. Van Velthoven, Brussels (BE)<br />

11.00 - 11.15 Tips and tricks Bowel perforation during puncture (suprapubic + percutaneous catheter)<br />

A. Skolarikos, Athens (GR)<br />

11.15 - 11.30 Tips and tricks Hemorrhagic cystitis<br />

M. Brausi, Modena (IT)<br />

11.30 - 11.45 Tips and tricks Complications of flank incisions<br />

M.S. Michel, Mannheim (DE)<br />

Aims and objectives<br />

Still in the era of laparoscopy and robotics flank incisions represents the predominantly used access for open<br />

access to the upper urinary tract. However, it is associated with complications effecting quality of life - the<br />

most important being paraesthesia, neuralgia, hernia, and flank bulge. Concerning flank bulge, an incidence<br />

of up to 50% has been described. For most of these complications bounded nerve function is suggested as<br />

underlying mechanism.<br />

The lecture summarises the underlying relevant anatomy of the flank with special regard to the nervous<br />

system. Furthermore it deals with the aetiology and incidence of the complications caused by flank incision.<br />

It presents the current available literature in the field, shows how to identify patients at risk and explains<br />

how to manage existing complications. Finally it gives the most important information which is: How best<br />

to prevent them.<br />

11.45 - 12.00 Tips and tricks Symptomatic lymphocele<br />

D.A. Schilling, Tübingen (DE)<br />

Aims and objectives<br />

Lymphoceles following retroperitoneal surgery are frequent and can be bothersome and evoke severe<br />

complications such as thromboebolic disease.<br />

Objective of the lecture is to identify risk factors for lymphocele formation, discuss preventive measures and<br />

point out treatment strategies in persisting symptomatic lymphorrhoea.


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Thematic Session 8<br />

11.00 - 12.00 Paediatric urology<br />

Red Hall 1 - Level N1<br />

Chair: W.F.J. Feitz, Nijmegen (NL)<br />

11.00 - 11.15 State-of-the-art lecture Update on minimal-invasive treatment options<br />

R. Subramaniam, Leeds (GB)<br />

Aims and objectives<br />

Present an appraisal of minimally invasive treatment options that are applicable to children. I shall present<br />

some videos of procedures and talk about different approaches used in the procedures. We will also look at<br />

the evidence for the application of minimally invasive procedures and discuss the pros and cons.<br />

11.15 - 11.30 State-of-the-art lecture Neuropathic bladders: Treatment strategies and transfer in adulthood<br />

R. Stein, Mainz (DE)<br />

Aims and objectives<br />

Close follow-up (ultrasound of the upper and lower urinary tract, urodynamic investigations starting<br />

shortly after birth) is essential. There are 4 different types of bladder sphincter dysfunction in patients with<br />

NB. 2 major pillars of conservative treatment: clean intermittent catheterisation (CIC) and treatment with<br />

anticholinergics/antimuscarinics. As long as the patient is under the care of their parents or other caregivers,<br />

compliance is generally good.<br />

During adolescence, patients prefer more independence and compliance relating to medical treatment and<br />

regular CIC decreases as does the sense of importance for regular follow-up investigations. This usually leads<br />

to a deterioration of upper and lower urinary tract function. It is our responsibility to guarantee lifelong<br />

follow-up for these patients to prevent complications<br />

11.30 - 11.45 State-of-the-art lecture Hypospadias in children, adolescents and adults<br />

G.A. Manzoni, Milan (IT)<br />

Aims and objectives<br />

This presentation will provide an overview of present strategies in modern treatment of hypospadias in the<br />

pediatric population with definition of the timing and type of surgical repairs. A critical analysis of present<br />

and most popular techniques will be discussed. Goals and importance of long-term follow-up will be<br />

stressed with special relevance for the adolescent patient (functional and psycho-sexual aspects). Finally the<br />

adult hypospadias problems will be discussed both for the controversial aspects of long-term complications<br />

and for the “virgin” patient presenting in adulthood.<br />

11.45 - 12.00 State-of-the-art lecture Regenerative urology for children and adults<br />

D. Eberli, Zürich (CH)<br />

Aims and objectives<br />

Tissue Engineering is one of the major approaches of regenerative medicine and a growing and exciting<br />

field of research. In combination with better understanding of structure, biology, physiology and cell culture<br />

techniques tissue engineering may offer new treatment options for patients in need of replacement or repair<br />

of a deteriorated organ.<br />

The principle is to dissociate cells from a tissue biopsy, to expand these cells in culture, and to seed them<br />

onto the scaffold material in vitro in order to form a living tissue construct prior to implantation into the<br />

recipient.<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

171<br />

Sunday


Sunday<br />

Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

172 <strong>Programme</strong> <strong>Book</strong><br />

Special Session<br />

11.00 - 13.00 Surgery in Motion<br />

Platinum Hall - Level S3<br />

Moderators: M. Graefen, Hamburg (DE)<br />

F. Montorsi, Milan (IT)<br />

A. Mottrie, Aalst (BE)<br />

H.G. Van Der Poel, Amsterdam (NL)<br />

P. Wiklund, Stockholm (SE)<br />

11.00 - 11.05 Introduction<br />

F. Montorsi, Milan (IT)<br />

H.G. Van Der Poel, Amsterdam (NL)<br />

11.05 - 11.30 Neurovascular structure adjacent frozen-section examination (neurosafe) increases nerve-sparing frequency<br />

and reduces positive surgical margins in open and robot-assisted laparoscopic radical prostatectomy.<br />

Experience after 11,069 consecutive patients<br />

T. Schlomm, Hamburg (DE)<br />

11.30 - 11.55 Robot assisted laparoscopic partial nephrectomy: Step by step contemporary technique and surgical<br />

outcomes at a single high-volume institution<br />

J.H. Kaouk, Cleveland (US)<br />

11.55 - 12.20 LESS partial nephrectomy without ischemia for very small, exophytic renal masses: Surgical details and<br />

functional outcomes<br />

L. Schips, Vasto (IT)<br />

12.20 - 12.45 Robotic intracorporeal orthotopic ileal neobladder: Replicating open surgical principles<br />

A. Goh, Houston (US)<br />

12.45 - 13.00 Discussion


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Special Session<br />

13.15 - 15.15 3D Video and live narration - da Vinci partial nephrectomy with<br />

Firefly fluorescence imaging<br />

Platinum Hall - Level S3<br />

Operator: G. Schön, Würzburg (DE)<br />

Moderators: A. Mottrie, Aalst (BE)<br />

J. Porter, Seattle (US)<br />

C. Vaessen, Paris (FR)<br />

Sponsored by INTUITIVE SURGICAL<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

173<br />

Sunday


Sunday<br />

Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

174 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

12.15 - 13.45 Challenging robotic surgery<br />

eURO Auditorium - Level S2<br />

Video Session 4<br />

Chairs: S.D. Kim, Busan (KR)<br />

R.F. Van Velthoven, Brussels (BE)<br />

All presentations have a maximum length of 10 minutes, followed by 4 minutes of discussion.<br />

V26 Robotic cystoprostatectomy with nerve-sparing approach and intracorporeal construction of Hautmann<br />

neobladder: Saint Augustin technique<br />

D. Rey, E. Helou, M. Oderda, L. Lopez, P-T. Piechaud (Bordeaux, France)<br />

V27 Robotic intracorporeal ileal conduit in the female utilizing transvaginal assistance<br />

R. Eyraud, E. Rizkala, R. Autorino, H. Laydner, A. Khalifeh, J. Kaouk, G-P. Haber (Cleveland, United States of<br />

America)<br />

V28 Robot assisted laparoscopic placement of an artificial urinary sphincter for a female patient<br />

V. Flamand, T. Ghoneim, F. Marcelli, P. Vandaele, A. Villers (Lille, France)<br />

V29 Robotic-assisted anterior pelvectomy with intracorporeal ileal conduit: Saint Augustin technique<br />

D. Rey, E. Helou, M. Oderda, L. Lopez, P-T. Piechaud (Bordeaux, France)<br />

V30 Robot-assisted laparoscopic renal artery aneurysm repair: Demonstration of the surgical technique<br />

R. Autorino, D. Samarasekera, A. Khalifeh, J. Kaouk (Cleveland, United States of America)<br />

V31 Robot-assisted adrenalectomy - a single center series from Homburg<br />

M.W. Janssen, A. Treiyer, J. Kamradt, S. Siemer, M. Stöckle, T. Gebhardt, C.H. Ohlmann (Homburg, Germany)<br />

V32 Robotic realization of double Yang-Monti ileal conduit and bladder augmentation: Saint Augustin technique<br />

D. Rey, E. Helou, M. Oderda, L. Lopez, P-T. Piechaud (Bordeaux, France)


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

12.15 - 13.45 New methods in imaging and targeting prostate cancer<br />

Brown Hall 1-2 - Level S2<br />

Poster Session 30<br />

Chairs: B.M. Carey, Leeds (GB)<br />

J. Walz, Marseille (FR)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

350 Validation of histoscanning system to detect and characterize prostate cancer<br />

A. Govorov, D. Pushkar, M. Kovylina, A. Vasilyev, T. Moiseenko (Moscow, Russia)<br />

351 Prostate HistoScanning for assessment of tumour volume and pathological stage prior to radical<br />

prostatectomy: What is its role in routine clinical practice?<br />

S. Javed, E. Chadwick, S. Beveridge, S. Bott, C. Eden, S. Langley (Guildford, Frimley, United Kingdom)<br />

352 Prostate histoscanning as a tool for decision making<br />

P. Macek, E. Barret, R.E. Sanchez Salas, M. Galiano, F. Rozet, Y. Ahallal, J.M Gaya, M. Durand, L. Mascle,<br />

C. Giedelman, L. Lunelli, X. Cathelineau (Paris, France)<br />

* 353 Prostate histoscanning for the detection, localization and volume estimation of prostate cancer- PHS02<br />

blind phase results<br />

L.A.M. Simmons, HU Ahmed, F. Zát’ura, M. Winkler, J. Braeckman, I. Meiers, D. Nir, P. Autier, S. Charman,<br />

M. Emberton (London, United Kingdom; Olomouc, Czech Republic; Brussels, Waterloo, Belgium; Lyon,<br />

France)<br />

354 CP OCT imaging of prostate neurovascular bundle<br />

D. Ledyaev, V. Atduev, L. Shkalova, E. Zagaynova (Nizhny Novgorod, Russia)<br />

355 Parametric diffusion weighted imaging at 3 tesla accurately predicts histological outcomes in men<br />

presenting for a TRUS-guided biopsy of the prostate<br />

D.C. Moran, L. Marignol, A. Perry, A. Fagan, E. Gaffney, J.F. Meaney, D. Hollywood, T.H. Lynch (Dublin,<br />

Ireland)<br />

356 Does 3 Tesla endorectal PET/MRI change the operative tactics in prostate cancer?<br />

J. Klein, J. Hauser, J-P. Vallee, C. Iselin (Geneva, Switzerland)<br />

357 Choline positron emission tomography (PET) or PET/computed tomography (CT) and biochemical relapse of<br />

prostate cancer (PCa): A meta-analysis of literature<br />

A. Guttilla, F. Zattoni, L. Evangelista, G. Saladini, F. Zattoni (Padua, Italy)<br />

* 358 PET-CT in recurrent prostate cancer<br />

D.K. Osmonov, A.V. Aksenov, D. Heimann, C.M. Naumann, K-P. Jünemann (Kiel, Germany)<br />

359 Identification of apparent-diffusion-coefficient (ADC) cut-offs during DWI-MRI in prostate cancer lymph<br />

node metastasis: Implication for daily clinical practice<br />

L. Budäus, S-R. Leyh-Bannurah, C. Seiwerts, B. Beyer, G. Salomon, H. Heinzer, M. Graefen, G. Adam,<br />

M. Regier (Hamburg, Germany)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

175<br />

Sunday


Sunday<br />

360 Choline PET-CT and diffusion-weighted MRI for nodal staging in prostate cancer at high risk for nodal<br />

metastases<br />

S. Joniau, L. Van Den Bergh, E. Lerut, R. Oyen, C.M. Deroose, T. Budiharto, F. Ameye, K. Haustermans,<br />

S. Isebaert, H. Van Poppel (Leuven, Belgium)<br />

361 Intra-operative prostatic swelling and intra-prostatic shift of targeted points within the prostate during<br />

high-intensity focused ultrasound: Implication for targeted focal therapy<br />

S. Shoji, T. Uchida, M. Nakamoto, A.L. De Castro Abreu, S. Leslie, Y. Sato, I. Gill, O. Ukimura (Los Angeles,<br />

United States of America; Hachioji, Osaka, Japan)<br />

176 <strong>Programme</strong> <strong>Book</strong>


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

12.15 - 13.45 Making the diagnosis of bladder cancer<br />

Brown Hall 3 - Level S2<br />

Poster Session 31<br />

Chairs: J. Irani, Poitiers (FR)<br />

T.S. O’Brien, London (GB)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

* 362 Incidental diagnosis of bladder cancer in an obervational study: Clinical stage migration<br />

J.M. Gaya Sopena, J. Palou, B. Miñana, J.M. Cózar, R. Medina, I. De Zaragoza, F. De La Rosa, I. Ip De Coruña,<br />

I. Ip De Vall D’Hebron, M.J. Ribal (Barcelona, Murcia, Granada, Sevilla, Zaragoza, Madrid, La Coruña, Spain)<br />

363 The role of antiplatelet and anticoagulant therapy in the diagnosis of bladder cancer<br />

M. Moschini, A. Bettiga, G. Burgio, C. Maccagnano, L. Rocchini, F. Pellucchi, G. La Croce, R. Colombo (Milan,<br />

Italy)<br />

364 Expedient combination of urine markers enhances their diagnostic performance in the detection of<br />

urothelial carcinoma<br />

T. Todenhöfer, J. Hennenlotter, U. Kühs, S. Mohrhardt, M. Esser, S. Aufderklamm, J. Mundhenk, G. Gakis,<br />

A. Stenzl, C. Schwentner (Tübingen, Germany)<br />

365 Point-of-care testing for bladder cancer – the UBC rapid test on the concile ® Ω100 reader platform<br />

provides quantitative results<br />

T. Todenhöfer, J. Hennenlotter, R. Ritter, U. Hoffmann, P. Blutbacher, A. Deja, A. Hohneder, A. Stenzl,<br />

C. Schwentner (Tübingen, Germany)<br />

366 Bladder cancer detection by autofluorescence (ultraviolet) at 308nm (preliminary results)<br />

C. Egrot, M. Sibony, S.M. Al-Qahtani, O. Cussenot (Paris, France)<br />

367 Removing routine urine cytology assessment in the one stop haematuria clinic<br />

J.S. Phull, A.C. Carter, J.D. Osborne, T. Lloyd, S. Sloan, V. Shah (Newport, United Kingdom)<br />

368 Hematuria one stop clinic: First experience in Italy with 303 cases<br />

L. Carmignani, S. Casellato, S. Picozzi, G. Bozzini, C. Marenghi, V. Nicosia, M. Cosentino (San Donato<br />

Milanese, Italy)<br />

369 Acute imaging for hematuria in the United States: Costs and predictors from the Nationwide Emergency<br />

Department Sample<br />

K.R. Ghani, S. Sukumar, J.D. Sammon, W. Jeong, A. Sood, J.O. Peabody, M. Menon, Q-D. Trinh (Detroit,<br />

United States of America)<br />

370 Visible haematuria in patients under 40 years of age: Where do we stand<br />

O. Aboumarzouk, S. Mishriki, B. Somani, R. Vint, T. Lam (Aberdeen, United Kingdom)<br />

371 Preventive medical care in bladder cancer is possible: Risk-adapted screening in urology performed by<br />

IQUO-Germany<br />

G.C. Lüdecke, G. Geiges, F. König (Giessen, Berlin, Germany)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

177<br />

Sunday


Sunday<br />

372 Ultrasonography and cytology in the follow up of grade 1 non-muscle invasive bladder cancer (NMIBC)<br />

J. Palou Redorta, S. Skrobot, G. Luccarelli, O. Rodriguez Faba, J.M. Gaya, L. Gausa, R. Parada, A. Breda,<br />

H. Villavicencio (Barcelona, Spain)<br />

373 Biopsy in flexible ureterorenoscopy: Comparison of biopsy specimen quality using different biopsy forceps<br />

P. Liske, A. Fayyazi, V. Zimmermanns, S. Lahme (Pforzheim, Germany)<br />

178 <strong>Programme</strong> <strong>Book</strong><br />

Summary<br />

J. Irani, Poitiers (FR)


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

12.15 - 13.45 Kidney transplantation: Technique and outcome<br />

Amber Hall 1-2 - Level S2<br />

Poster Session 32<br />

Chairs: G. Karam, Nantes (FR)<br />

M. Musquera Felip, Barcelona (ES)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

374 Does it really matter which definition of delayed graft function we use after renal transplantation?<br />

N.J. Dempster, C. Ceresa, E. Aitken, D. Kingsmore (Glasgow, United Kingdom)<br />

375 Simultaneous native nephrectomy and transplantation in autosomal dominant polycystic kidney disease:<br />

Efficacy and safety<br />

L. Marconi, P. Nunes, A. Figueiredo, F. Furriel, A. Roseiro, A. Mota (Coimbra, Portugal)<br />

376 The treatment of ureteral strictures complicating kidney transplantation. An outcome analysis<br />

A. Bosio, F. Lasaponara, E. Dalmasso, A. Buffardi, E. Alessandria, S. Santià, G. Pasquale, O. Sedigh, D. Righi,<br />

L. Biancone, G.P. Segoloni, D. Fontana, B. Frea (Turin, Italy)<br />

377 Renal transplantation outcomes in elderly patients<br />

N.J. Dempster, C. Ceresa, E. Aitken, D. Kingsmore (Glasgow, United Kingdom)<br />

378 Kidney autotransplantation and revascularization surgery - still a good option<br />

D. Gosalbez Garcia, A. Ciudin, M. Musquera, L. Peri, J. Huguet, M.J. Ribal, A. Alcaraz, C. Mestre, M. Vera<br />

(Barcelona, Spain)<br />

* 379 Economic impact of pulsatile hypothermic perfusion in an expanded criteria donor transplant program.<br />

Analysis of the first year since its introduction<br />

V. Gomez, F. Arias, V. Diez, E. Fernandez, M. Jimenez, R. Rodriguez, C. Galeano, A. Gomis, F.J. Burgos<br />

(Madrid, Spain)<br />

* 380 Influence of pre-transplant diuresis in the development of lower urinary tract dysfunction in renal<br />

transplant patients<br />

F.A. Escórcio De Almeida, J. Cabral, F. Branco, M. Ramos, S. Ribeiro, A. Fraga (Porto, Portugal)<br />

381 Evaluation of sexual functions in males receiving renal replacement therapies<br />

R. Demir, Y. Bostanci, F. Atac, E. Ozden, A. Karatas, S. Sarikaya, Y.K. Yakupoglu (Samsun, Turkey)<br />

382 An urgent revision of the kidney transplant allocation system is required in order to improve long term<br />

graft survival results<br />

G. Pini, N. Mohammed, F. Greco, A. Schumann, F. Kawan, L. Ascalone, K. Weigand, P. Fornara (Halle,<br />

Germany)<br />

383 Urological and surgical complications following kidney transplantation from non-heart beating donors<br />

R. Castañeda-Argáiz, L. Peri Cusi, M. Musquera Felip, E. Sanchez Escudero, D. Paredes, E. García Cruz,<br />

A. Carrión Puig, A. Alcaraz (Barcelona, Spain)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

179<br />

Sunday


Sunday<br />

384 Comparative urological complications of ureteroneocystostomy in kidney transplantation: Transvesical<br />

Leadbetter-Politano versus extravesical Lich-Gregoir technique<br />

C. Baston, M. Harza, B. Stefan, A. Preda, I. Manea, B.C. Haineala, S.S. Margaritis Guler, B.G. Badescu,<br />

A. Omer, I. Sinescu (Bucharest, Romania)<br />

385 Lich-Gregoir technique and routine use of double J catheter as the best combination to avoid urinary<br />

complications in kidney transplantation<br />

E.H. Olarte Barragán, C. Moreno Alarcón, P.A. López González, P. López Cubillana, C.P. Pinzón Navarrete,<br />

P.F. Gutiérrez Gutiérrez, H.L. Martínez Peralta, G. Gómez Gómez (Murcia, Spain)<br />

386 Real time-contrast enhanced ultrasound voiding cystography as a screening examination for vesicoureteral<br />

reflux of renal transplant recipients<br />

F. Kurtz, M. Straub, J.E. Gschwend, K. Stock (Munich, Germany)<br />

180 <strong>Programme</strong> <strong>Book</strong>


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

12.15 - 13.45 Advances in the treatment of penile cancer<br />

Amber Hall 7-8 - Level S2<br />

Poster Session 33<br />

Chairs: S. Egawa, Tokyo (JP)<br />

R. Salvioni, Milan (IT)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion.<br />

387 Surgical complications after inguinal lymphadenectomy in penile cancer – an explorative historical cohort<br />

study for risk factors<br />

M.M. Stuiver, R.S. Djajadiningrat, N.M. Graafland, A.D. Vincent, C. Lucas, S. Horenblas (Amsterdam, The<br />

Netherlands)<br />

388 The characteristics of inguinal lymph nodes may predict pelvic lymph nodes involvement in penile cancer:<br />

A single-institutional experience<br />

M. Catanzaro, G. Lughezzani, N. Nicolai, L. Piva, T. Torelli, D. Biasoni, S. Stagni, A. Necchi, P. Giannatempo,<br />

D. Raggi, E. Farè, M. Colecchia, R. Salvioni (Milan, Italy)<br />

389 Factors associated with non-sentinel node metastasis in patients with squamous cell carcinoma of the<br />

penis: A two-institution prospective analysis of 174 inguinal basins with positive sentinel node biopsy<br />

W. Lam, R. Djajadiningrat, V. Sakalis, H.M. Alnajjar, C. Corbishley, M. Perry, D. Sharma, S. Horenblas,<br />

N. Watkin (London, United Kingdom; Amsterdam, The Netherlands)<br />

390 Disease specific mortality after pelvic lymph node dissection containing tumour-positive nodes in penile<br />

cancer<br />

R.S. Djajadiningrat, S. Horenblas (Amsterdam, The Netherlands)<br />

391 Zonal mapping of inguinal lymph nodes using SPECT - implications for lymphadenectomy for penile<br />

carcinoma<br />

S. Omorphos, Z. Saad, S. Minhas, A. Kirkham, J. Bomanji, A. Muneer (Nottingham, United Kingdom)<br />

392 Contemporary survival of penile squamous cell carcinoma: Experience with 1000 patients<br />

R.S. Djajadiningrat, N.M. Graafland, E. Van Werkhoven, W. Meinhardt, A. Bex, H.G. Van Der Poel,<br />

S. Horenblas (Amsterdam, The Netherlands)<br />

393 How reliable is tumor grading in penile cancer – results of a European grading study<br />

C. Kakies, C. Protzel, L.C. Horn, A.K. Hoehn, G. Kristiansen, J. Koellermann, E. Comperat, A. Lopez Belltram,<br />

A. Erbersdobler, O.W. Hakenberg (Rostock, Leipzig, Bonn, Hamburg, Germany; Paris, France; Cordoba,<br />

Spain)<br />

394 Value of dynamic sentinel node biopsy, ultrasound and fine needle aspiration in the detection of metastatic<br />

lymph nodes in penile cancer<br />

R.S. Djajadiningrat, H.J. Teertstra, B.W.G. Van Rhijn, W. Meinhardt, A. Bex, H.G. Van Der Poel, S. Horenblas<br />

(Amsterdam, The Netherlands)<br />

395 A comparison of techniques in sentinel lymph node biopsy for penile cancer<br />

S.H. Shillito, V.K.S Sangar, B. Murby, D. Ashworth, N.R. Parr, B. Taylor, M.W. Lau (Manchester, United<br />

Kingdom)<br />

396 Paclitaxel in pretreated metastatic penile cancer: Final results of a phase 2 study<br />

P. Verze, G. Di Lorenzo, C. Imbimbo, N. Longo, A. Palmieri, F. Fusco, S. De Placido, V. Mirone (Naples, Italy)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

181<br />

Sunday


Sunday<br />

397 Early results of the pilot study with the anti-Epidermal Growth-Factor Receptor (EGFR) monoclonal<br />

antibody panitumumab in patients (pts) with multi-relapsed or refractory squamous cell carcinoma (SCC)<br />

of the penis<br />

P. Giannatempo, N. Nicolai, D. Raggi, E. Farè, M. Colecchia, M. Catanzaro, T. Torelli, D. Biasoni, S. Stagni,<br />

L. Piva, R. Salvioni, A. Necchi (Milan, Italy)<br />

398 Long-term oncological outcomes of partial penectomy in the treatment of penile cancer: A 30-year singleinstitutional<br />

experience<br />

M. Catanzaro, G. Lughezzani, N. Nicolai, T. Torelli, D. Biasoni, S. Stagni, A. Necchi, P. Giannatempo,<br />

D. Raggi, E. Farè, M. Colecchia, L. Piva, R. Salvioni (Milan, Italy)<br />

399 Expression patterns of vimentin and e-cadherin in ephitelial-mesenchymal transition: A potential<br />

prognostic factor in penile cancer<br />

G. Guimaraes, M.J.L. Souza, W.H. Costa, R.A.R. Oliveira, S.C. Zequi, R.S.M. Campos, T.B.M. Santana,<br />

I.W. Cunha, F.A. Soares, A. Lopes (Sao Paulo, Brazil)<br />

400 The treatment of penile carcinoma-in-situ within a UK supraregional network<br />

M. Lucky, M. Kusuma, B. Rogers, S. Jones, M. Lau, V. Sangar, N. Parr (Wirral, Manchester, United Kingdom)<br />

182 <strong>Programme</strong> <strong>Book</strong>


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

12.15 - 13.45 Nocturia, OAB, metabolic syndrome - towards a new management<br />

Silver Hall - Level N2<br />

Poster Session 34<br />

Chairs: P. Abrams, Bristol (GB)<br />

B.A. Dybowski, Warsaw (PL)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

* 401 The incidence of antimuscarinic-associated side effects in overactive bladder (OAB) patients treated with<br />

mirabegron: Results of a pooled analysis of 3 randomised phase 3 trials<br />

V. Nitti, C.R. Chapple, G. Amarenco, P. Radziszewski, J. Angulo, M.B. Blauwet, E. Siddiqui, N. Martin (New<br />

York, Northbrook, United States of America; Sheffield, Chertsey, United Kingdom; Paris, France; Warsaw,<br />

Poland; Madrid, Spain)<br />

402 Tolenix (THVD-201), a novel combination of muscarinic agonist (tolterodine) and muscarinic agonist<br />

(pilocarpine), is efficacious in OAB with less dry mouth compared to tolterodine alone<br />

R. Dmochowski, K. Duchin, T. Tremblay, M. Paborji, R. Flugel (Nashville, Mountain View, United States of<br />

America)<br />

403 The assessment of a novel Transdermal Amplitude Modulated Signal (TAMS) for the treatment of overactive<br />

bladder syndrome<br />

M. Slovak, A.T. Barker, C.R. Chapple (Sheffield, United Kingdom)<br />

404 Clinical efficacy and safety evaluation of imidafenacin as add-on treatment for residual overactive bladder<br />

symptoms in BPH patients with nocturia; addition study sub-analysis<br />

M. Gotoh, M. Takeda, O. Nishizawa, M. Yoshida, S. Takahashi, N. Masumori (Nagoya, Yamanashi,<br />

Matsumoto, Ohbu, Tokyo, Sapporo, Japan)<br />

* 405 ‘My sleep pattern is a series of naps’. Subjective patient-reported data on what is most bothersome about<br />

nocturia<br />

T. Holm-Larsen, C. Albei, F. Andersson, J.P. Nørgaard (Farum, Copenhagen, Denmark; Parsippany, United<br />

States of America)<br />

406 Nocturia has a strong impact on productivity - a comparison with different chronic diseases<br />

F. Andersson, A. Blemings, T. Holm-Larsen, J.P. Nörgaard (Copenhagen, Farum, Denmark)<br />

407 Predictors of improvement amongst men with a predominant complaint of nocturia<br />

O.O. Cäkir, B.T. Helfand, K.T. McVary (Chicago, Evanston, United States of America)<br />

408 An assessment of actual medical management of BPH in a cross-sectional study performed with<br />

administrative health services databases<br />

L. Cindolo, C. Fanizza, M. Romero, L. Pirozzi, F. Berardinelli, C. De Nunzio, P. Sountoulides, L. Schips (Vasto-<br />

Chieti, Rome, Italy; Veria, Greece)<br />

409 Impact of concurrent statins and 5α-reductase inhibitors use on serum PSA and prostate volume in BPH<br />

patients<br />

K.J. Joo, Y.S. Cho, C.H. Kwon, H.J. Park (Seoul, South Korea)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

183<br />

Sunday


Sunday<br />

410 Efficacy and safety of tadalafil 5mg administered once daily in men with erectile dysfunction and lower<br />

urinary tract symptoms; comparative study between metabolic syndrome patients and non–metabolic<br />

syndrome patients<br />

A. Kim, B.J. Lim, S. Hong, G. Song, S. Park, J.Y. Joung, T.Y. Ahn (Seoul, Cheonan, Ulsan, South Korea; New<br />

Brunswick, United States of America)<br />

411 Metabolic syndrome is correlated with prostatic inflammation in men with severe LUTS related to benign<br />

prostatic hyperplasia: Results of a preclinical and clinical experimental study<br />

L. Vignozzi, M. Gacci, I. Cellai, A. Sebastianelli, M. Salvi, R. Santi, A. Morelli, G. Rastrelli, P. Comeglio,<br />

E. Maneschi, G. Corona, G. Nesi, C. De Nunzio, A. Tubaro, M. Carini, M. Maggi (Florence, Bologna, Rome,<br />

Italy)<br />

412 Metabolic syndrome and lower urinary tract symptoms: A possible link to storage symptoms<br />

C. De Nunzio, M. Gacci, L.C. Costantino, A. Brassetti, F. Cancrini, F. Esperto, R. Lombardo, F. Presicce,<br />

L. Cindolo, F. Pellegrini, L. Schips, D. Amore, A. Tubaro (Rome, Florence, Vasto, Italy)<br />

184 <strong>Programme</strong> <strong>Book</strong>


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

12.15 - 13.45 Paediatric hypospadias repair<br />

Red Hall 1 - Level N1<br />

Poster Session 35<br />

Chairs: S.W. Han, Seoul (KR)<br />

G. Lackgren, Uppsala (SE)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

413 Changes in erectile, connective tissue, and neural components of the human fetal penis at various<br />

gestational ages<br />

C.B.M. Gallo, L.E.M. Cardoso, A. Furriel, B.M.G. Gregório, W.S. Costa, F.J.B. Sampaio (Rio de Janeiro, Brazil)<br />

414 Urinary tract reconstruction using regenerated oral mucosa sheets made with amniotic membrane as<br />

matrix<br />

Y. Naitoh, A. Kawauchi, K. Kamoi, J. Soh, T. Miki (Kyoto, Japan)<br />

* 415 Long-term functional, cosmetic and sexual outcomes of hypospadias correction performed in childhood<br />

S. Thiry, S. Dormeus, B. Tombal, F. Wese, A. Feyaerts (Brussels, Belgium)<br />

416 One stage lingual augmented urethroplasty in repair of distal penile hypospadias<br />

E.R. Elsayed, A.M. Eliwa, A.A. Teelab, T. Dawood, M. Omran, L. Elbendary, S. Khalil (Zagazig, Egypt)<br />

417 Distribution of androgen, and estrogen receptors in foreskins of children with or without hypospadias<br />

H. Kocaturk, S. Adanur, T. Ziypak, C. Gündogdu, Y. Aksoy, G. Okyar (Erzurum, Turkey)<br />

418 A prospective study to evaluate the role of different variables in results of TIPU<br />

A.L. Bhat, M. Bhat, R.K. Saran, M. Singla, K.V. Sabbarwal, R. Upadhaya, V. Kumar (Bikaner, India)<br />

419 Long term results of anastomotic urethroplasty performed in children<br />

M.I. Kogan, V.V. Mitusov, A.V. Shangichev, V.V. Sizonov, A.V. Hasigov (Rostov on Don, Russia)<br />

420 Evaluation of nonstented distally folded onlay flap in distal penile hypospadias<br />

M. Soliman, M.H. Radwan, A.M. Tawfik, A.R. Ramadan, O.Z. Gamal, H. Al Wadaani (Tanta, Egypt; Al Ahsa,<br />

Saudi Arabia)<br />

421 Comparison of results of TIPU repair for hypospadias with spongioplasty alone and spongioplasty with<br />

dorsal Dartos flap<br />

A.L. Bhat, M. Singla, M. Bhat, R.K. Saran, K.V. Sabharwal, V. Kumar, R. Upadhaya (Bikaner, India)<br />

422 Combination of techniques for severe hypospadias trying to reduce the morbidity of the repairing surgery<br />

C. Moreno Alarcón, G. Zambudio Carmona, M.J. Guirao Piñera, K. Cabrejos Perotti, P.Y. Reyes Ríos,<br />

M. Fernández Ibieta, I. Martínez Castaño, J.I. Ruiz Jiménez (Murcia, Spain)<br />

423 The use of a perimeatal-based penile skin flaps for cover the repair of a TIP urethroplasty. From<br />

experimental surgery to clinical practice<br />

S. Gardikis, K. Kampouri, A. Giatromanolaki, M. Agelidou, C. Kalaitzis, S. Giannakopoulos, S. Touloupidis,<br />

G. Vaos (Alexandroupolis, Greece)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

185<br />

Sunday


Sunday<br />

424 Correlation of severity of congenital penile torsion with type of hypospadias and management by urethral<br />

plate with spongiosum/urethral mobilization<br />

A.L. Bhat, R.K. Saran, M. Bhat, K.V. Sabharwal, M. Singla, R. Upadhaya, V. Kumar (Bikaner, India)<br />

425 Management of hypospadias cripples: Complication rates of the two-staged buccal mucosa repair in<br />

Bracka technique<br />

S. Riechardt, R. Dahlem, M. Fisch (Hamburg, Germany)<br />

186 <strong>Programme</strong> <strong>Book</strong>


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

12.15 - 13.45 Stones: URS and imaging<br />

Red Hall 2 - Level N1<br />

Poster Session 36<br />

Chairs: E.A. Rodrigues de Lima, Porto (PT)<br />

O. Traxer, Paris (FR)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion.<br />

426 The efficiency and the safety of flexible ureterorenoscopy is not impacted by stone location<br />

B. Jacquemet, E. Chabannes, G. Guichard, S. Bernardini, N. Bardonnaud, P. Pillot, H. Bittard, F. Kleinclauss<br />

(Besancon, France)<br />

427 Preoperative ureteral stenting is associated with higher stone-free rate after flexible ureterorenoscopy for<br />

urinary lithiasis<br />

J.F. Dessyn, P. Pillot, N. Bardonnaud, G. Guichard, S. Bernardini, E. Chabannes, H. Bittard, F. Kleinclauss<br />

(Besancon, France)<br />

428 Effects of percutaneous nephrostomy tube during flexible ureteroscopy for renal stone management<br />

S.Y. Kwon, B.S. Kim, J.N. Lee, H.T. Kim, E.S. Yoo, S.K. Chung, B.W. Kim, T.H. Kim, T.G. Kwon, J.B. Kwon,<br />

Y.K. Park (Daegu, South Korea)<br />

429 Impact of surgical experience on safety and efficiency of flexible uretero-renoscopy for urinary stone<br />

management<br />

F. Kleinclauss, P. Pillot, N. Bardonnaud, E. Chabannes, S. Bernardini, G. Guichard, H. Bittard (Besancon,<br />

France)<br />

430 Comparative study of treatment of renal stones with flexible ureterorenoscopy in obese, morbidly obese<br />

and normal weight patients<br />

S. Doizi, C. Bonneau, S. Gil Diez De Medina, O. Traxer (Paris, France)<br />

431 Retrograde intrarenal surgery (RIRS) in spinal anesthesia: A feasible and effective stone treatment in oneday<br />

surgery<br />

A. Bosio, P. Destefanis, E. Alessandria, M. Carchedi, A. Buffardi, E. Dalmasso, S. Santià, F. Fop, A. Bisconti,<br />

C. Ceruti, D. Fontana, B. Frea (Turin, Italy)<br />

432 Complications of flexible ureterorenoscopy classified by the modified Clavien grading system (a single<br />

center’s experience over 10 years)<br />

S.M. Al Qahtani, G. Raynal, T. Saussez, S.G.D. De Midina, M. Tligui, O. Traxer (Paris, France)<br />

433 Withdrawn<br />

434 Decreasing the cost of flexible ureterorenoscopic (FURS) procedures using disposable laser fiber: A cost<br />

comparison analysis<br />

A. Chapman, B.K. Somani, S. Healy, A. Robertson, S.G. Kata (Dundee, Southampton, United Kingdom)<br />

435 Predictive value of preoperative unenhenced computed tomography during ureteroscopic lithotripsy:<br />

Single institute experience<br />

S. Kim, D.K. Lee, G.E. Min, H.L. Lee, J.H. Lee, G.H. Yoo (Seoul, South Korea)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

187<br />

Sunday


Sunday<br />

436 Predicting urinary stone composition – a radiological study made by urologists<br />

A. Ciudin, P. Luque, M.G. Diaconu, R. Salvador, A. Franco, R. Alvarez-Vijande, C. Nicolau, A. Alcaraz<br />

(Barcelona, Spain)<br />

437 Terpene compound drug as medical expulsive therapy for ureterolithiasis: A meta-analysis<br />

M. Chua, J. Park, J. Castillo, M. Morales (Quezon City, Manila City, Taguig City, Philippines)<br />

438 CalcuLithiasis: Computer assisted metabolic workup of stone disease<br />

A. Hoznek, J-P. Haymann, C. Borgogno, O. Traxer (Creteil, Paris, Pontoise, France)<br />

439 Chemical and mineralogical analysis of ureteral stent encrustation and associated risk factors<br />

M.C. Sighinolfi, E Galli, G.P. Sighinolfi, S. Micali, A. Mofferdin, N. Nyek Ntep, N. Ferrari, G. Bianchi (Modena,<br />

Italy)<br />

188 <strong>Programme</strong> <strong>Book</strong>


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

12.15 - 13.45 Exploring pharmacological targets in OAB<br />

Blue Hall 1-2 - Level N1<br />

Poster Session 37<br />

Chairs: C.D. Cruz, Porto (PT)<br />

G. Van Koeveringe, Maastricht (NL)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

* 440 Effects of the combination of β3-adrenoceptor agonists and antimuscarinics on EFS-induced contractions<br />

of rat isolated urinary bladder<br />

M. Rekik, C. Rouget, S. Palea, P. Lluel, E.H. Ohlstein, T.D. Westfall (Toulouse, France; Malvern, United States<br />

of America)<br />

* 441 Why anticholinergics fail: Oxybutynin and fesoterodine induce a shift from muscarinergic to purinergic<br />

transmission in the rat bladder<br />

P. Uvin, M. Boudes, J. Franken, A. Menigoz, S.J. Pinto, T. Gevaert, R. Verplaetse, J. Tytgat, R. Vennekens,<br />

T. Voets, D. De Ridder (Leuven, Belgium)<br />

442 A novel neurite outgrowth enhancer, TAC-302 improved voiding dysfunction in rats with STZ-induced<br />

diabetes<br />

T. Noma, S. Yoshida, A. Hakozaki, N. Orimoto, E. Sasaki, Y. Hayashi (Tsukuba-Shi, Ibaraki, Japan)<br />

443 Inhibition of spinal cord fatty acid amide hydrolase reduces bladder overactivity in rats<br />

C. Fuellhase, A. Russo, F. Castiglione, L. Campeau, A. Bettiga, K-E. Andersson, C. Gratzke, P. Hedlund<br />

(Munich, Germany; Milan, Italy; Wake Forest, United States of America)<br />

444 Upregulation of angitensin II type I receptor and connexin 43 in the bladder and urethra of aged rats with<br />

bladder dysfunction<br />

M. Ken-Ichi, S. Tobu, M. Noguchi, Y. Sumino, F. Sato, H. Mimata, N. Yoshimura (Pittsburgh, United States of<br />

America; Saga, Oita, Japan)<br />

445 Protective effect of cyanidin-3-O-beta-D-glucopyranoside fraction from mulberry fruit pigment against<br />

oidative damage in streptozotocin-induced diabetic rat bladder<br />

W.J. Bae, U.S. Ha, J.H. Bae, Y.S. Choi, S.J. Kim, H.J. Cho, S.H. Hong, J.Y. Lee, T-K. Hwang, S.W. Kim (Seoul,<br />

South Korea)<br />

446 Alpha1A-adrenoceptor antagonist improves bladder function by increasing bladder blood flow in rat<br />

model of lower urinary tract dysfunction with or without bladder outlet obstruction<br />

Y. Goi, M. Nomiya, K. Sagawa, K. Aikawa, Y. Tomiyama, S. Tatemichi, K. Maruyama, M. Kobayashi,<br />

H. Kusama, O. Yamaguchi (Azumino, Fukushima, Koriyama, Japan)<br />

447 Micturition is controlled by neuronal cannabinoid receptor type 1 – a urodynamic evaluation of a CB1<br />

knockout mouse model<br />

C. Fullhase, L. Campeau, A. Sibaev, M. Storr, C. Gratzke, C. Stief, P. Hedlund, K.E. Andersson (Munich,<br />

Germany; Winston-Salem, United States of America; Milan, Italy)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

189<br />

Sunday


Sunday<br />

448 Quotient of non-micturition-associated and micturition-associated detrusor events determined by<br />

radiotelemetered cystometry (RTC) as a possible parameter in a Göttingen minipig (GM) model of<br />

infravesical obstruction (BOO)<br />

N. Huppertz, C. Fera, D. Leonhäuser, K. Strick, I. Zraik, S. Hirshman, U. Schwantes, R. Kirschner-Hermanns,<br />

R. Tolba, J. Grosse (Aachen, Bamberg, Bonn, Germany)<br />

449 Bladder and erectile dysfunctions in the type 2 diabetic goto-kakizaki rat<br />

D. Behr-Roussel, S. Oger, S. Caisey, M. Kergoat, A. Audet, J. Bernabé, L. Alexandre, F. Giuliano (Montigny-<br />

Le-Bretonneux, Chilly-Mazarin, France)<br />

450 Ca2+ sensitization without activation of G protein is independent of calmodulin in contraction of human<br />

detrusor smooth muscle<br />

S. Kajioka, N. Shahab, M. Hayashi, R. Takahashi, S. Naito (Fukuoka, Japan; Jakarta, Indonesia)<br />

451 Chronic treatment with a rho-kinase inhibitor restores ureter peristaltic amplitudes, halts bladder<br />

enlargement, but does not affect urodynamics in rats with partial outflow obstruction<br />

R. Buono, F. Benigni, L. Villa (Milan, Italy)<br />

190 <strong>Programme</strong> <strong>Book</strong>


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

12.15 - 13.45 Surgery for RCC and the adrenal gland<br />

Yellow Hall 1-2-3 - Level N1<br />

Poster Session 38<br />

Chairs: E. Barret, Paris (FR)<br />

A. Vuksanovic, Belgrade (RS)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

452 Oncological outcome and complications in patients with renal cell cancer and inferior vena cava thrombus<br />

C. Piper, D. Porres, D. Pfister, A. Heidenreich (Aachen, Germany)<br />

453 Resection of renal cell carcinoma with atrio-caval extension: A single centre experience<br />

J.D. Evans, A.M. Ranasinghe, T.R. Graham, S.J. Rooney, R.I. Bhatt (Birmingham, United Kingdom)<br />

454 The impact of fat infiltration and renal vein thrombosis on cancer-specific survival in T3a kidney tumors<br />

R. Schiavina, G.C. Rocca, M. Borghesi, C. Pultrone, F. Chessa, L. Della Mora, G. Saraceni, E. Brunocilla,<br />

M. Garofalo, F. Manferrari, G. Martorana (Bologna, Italy)<br />

455 Liver mobilisation reduces the need for cardiopulmonary bypass in renal tumours with inferior vena cava<br />

extension<br />

A.A. Mohammed, R.C. Kockelbergh (Kettering, Leicester, United Kingdom)<br />

456 Comparison of overall survival between the life expectancy and the estimated outcome in patients who<br />

underwent radical nephrectomy or partial nephrectomy for renal cell carcinoma<br />

N. Tanaka, Y. Hirao, K. Fujimoto (Kashihara, Japan)<br />

457 Withdrawn<br />

458 Predictive factors of severe renal insufficiency after nephrectomy<br />

J. Berger, Y. Brakbi, Z. Daher Abdi, X. Plainard, M. Lanoe, J. Centi, J.P. Dumas, A. Rousseau, M. Essig,<br />

A. Descazeaud (Limoges, France)<br />

459 Complication and conversion rate in a large multicenter series of 222 patients undergoing laparoscopic<br />

radical nephrectomy for large renal cell carcinoma (> 7 cm)<br />

L.G. Luciani, V. Vattovani, C. D’Elia, G. Giusti, D. Tiscione, R. Peschechera, A. Celia, C. Fiori, F. Porpiglia,<br />

P. Parma, T. Cai, G. Malossini (Trento, Milan, Bassano Del Grappa, Orbassano, Mantova, Italy)<br />

460 Prognostic significance of preoperative neutrophil-to-lymphocyte ratio to predict recurrence in patients<br />

with non-metastatic clear cell renal cell carcinoma<br />

S.I. Kim, K.B. Lee, H.S. Ahn, S.J. Kim (Suwon, South Korea)<br />

* 461 Laparoscopic adrenalectomy in urologic centres – the experience of the German Laparoscopic Working<br />

Group<br />

C. Springer, J. Rassweiler, D. Fahlenkamp, N. Kutta, D. Nesius, J. Thüroff, A. Krause, W. Strohmaier,<br />

A. Bachmann, L. Hertle, G. Popken, S. Deger, D. Jocham, C. Doehn, T. Loch, S. Lahme, V. Janitzky, C. Gilfrich,<br />

T. Klotz, B. Kopper, U. Rebmann, T. Kälbe, U. Wetterauer, A. Leitenberger, J. Raßler, P. Fornara, F. Greco<br />

(Halle Saale, Austria; Heilbronn, Chemnitz, Trier, Mainz, Freiberg, Coburg, Münster, Berlin, Lübeck,<br />

Flensburg, Pforzheim, Pirna, Straubing, Weiden, Kaiserslautern, Dessau, Fulda, Freiburg, Wolfsburg,<br />

Leipzig, Germany; Basel, Switzerland)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

191<br />

Sunday


Sunday<br />

462 Patient-reported satisfaction and cosmesis outcomes following laparoscopic adrenalectomy: LESS vs<br />

conventional laparoscopic surgery<br />

S. Inoue, K. Ikeda, K. Hieda, K. Shoji, K. Miyamoto, S. Ohara, K. Kobayashi, M. Kajiwara, J. Teishima,<br />

A. Matsubara (Hiroshima, Japan)<br />

463 Anti-hypertensive effect of laparoscopic adrenalectomy (LA) for the patients with primary aldosteronism<br />

(PA) is limited despite of the accurate determination of responsible lesion by adrenal venous sampling<br />

(AVS)<br />

H. Yamamoto, S. Hatakeyama, N. Sugiyama, Y. Suzuki, A. Okamoto, A. Imai, T. Yoneyama, Y. Hashimoto,<br />

T. Koie, T. Nigawara, K. Terui, S. Sakihara, C. Ohyama (Hirosaki, Japan)<br />

464 Clinical characteristics of adrenal injury in trauma patients<br />

K.J. Oh, W.S. Jang, I. Hwang, E.C. Hwang, H.S. Yu, S.O. Kim, S.I. Jung, T.W. Kang, D.D. Kwon, K. Park<br />

(Gwangju, South Korea)<br />

192 <strong>Programme</strong> <strong>Book</strong>


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

14.00 - 15.30 21st century stone management<br />

eURO Auditorium - Level S2<br />

Video Session 5<br />

Chairs: N.N-P. Buchholz, London (GB)<br />

P.A. Geavlete, Bucharest (RO)<br />

All presentations have a maximum length of 10 minutes, followed by 4 minutes of discussion.<br />

V33 Laparoendoscopic single-site (LESS) pyelolitecthomy in a horseshore kidney using conventional rigid<br />

laparoscopic instruments<br />

A. Perez-Lanzac De Lorca, J. Soto Villalva, J. Rosety Rodriguez, Z. Okhunov, A. Lusch, A. Conde Giles,<br />

M.J. Ledo Cepero, R. Garcia-Baquero Garcia De Paredes, B. Madurga Patuel, J.L. Alvarez-Ossorio Fernandez<br />

(Cadiz, Spain)<br />

V34 Robot-assisted combined intrarenal surgery for the treatment of a complex kidney stone formation<br />

S. Poth, C. Wagner, A. Schütte, A.P. Labanaris, J. Zinke, J.H. Witt (Gronau (Westfalen), Germany)<br />

V35 Combined endoscopic surgery: Flexible retrograde ureteroscopy with percutaneous access in the supine<br />

position: Endovision<br />

O. Angerri, J.M. Santillana, F. Sanchez-Martín, F. Millan, H. Villavicencion (Barcelona, Spain)<br />

V36 Totally ultrasonography guided percutaneous nephrolithotomy: Key steps overview<br />

J.A. Agudelo, M.G. Finol, E. Arias, N. Ktech, L. Sanchez, R. Montiel, E. Peña, M. Riveros (Maracaibo,<br />

Venezuela)<br />

V37 Retrograde flexible ureteroscopic approach combined with Ho:YAG laser lithotripsy for renal stones: How<br />

large is too large?<br />

D.R. Multescu, G. Nita, B.F. Geavlete, V. Mirciulescu, P.A. Geavlete (Bucharest, Romania)<br />

V38 Robotic assisted laparoscopic anatrophic nephrolithotomy: First case report<br />

R. Sotelo Noguera, O. Carmona, R. De Andrade, C. Rodriguez, G. Fernández, R. Clavijo, R. Garza (Caracas,<br />

Venezuela)<br />

V39 Single session bilateral percutaneous nephrolithotomy – applicability of the simplified technique<br />

J.A. Agudelo, E. Arias, N. Ktech, L. Sanchez, E. Pena, R. Montiel, M. Rivero (Maracaibo, Venezuela)<br />

V40 Ultra-mini PCNL (UMP)<br />

J. Desai, R. Solanki (Ahmedabad, India)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

193<br />

Sunday


Sunday<br />

Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

194 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

14.00 - 15.30 How to optimise staging in prostate cancer?<br />

Brown Hall 1-2 - Level S2<br />

Poster Session 39<br />

Chairs: C.B. Congregado Ruiz, Sevilla (ES)<br />

H-P. Schmid, St. Gallen (CH)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

* 465 High-Grade Prostatic Intraepithelial Neoplasia (HGPIN) topographical distribution in 1374 prostate<br />

specimens: Existence of topographical relationship between prostate cancer and HGPIN<br />

O. Eminaga, R. Hinkelammert, E. Eltze, O. Bettendorf, U. Titze, A. Semjonow (Cologne, Muenster,<br />

Saarbruecken, Schüttorf, Germany)<br />

466 Clinical significance of benign prostatic tissue at the soft tissue margin in robotic and open radical<br />

prostatectomy<br />

S. Park, M. Shim, D. Yoo, C. Song, C-S. Kim, H. Ahn (Seoul, South Korea)<br />

467 Are the efforts towards prostate cancer early detection associated with a significant reduction in tumor<br />

volume? An analysis stratified according to risk categories<br />

N. Suardi, A. Gallina, U. Capitanio, M. Tutolo, N. Fossati, R. Matloob, A. Russo, A. Salonia, R. Bertini, V. Di<br />

Girolamo, M. Freschi, C. Doglioni, G. Guazzoni, A. Briganti (Milan, Italy)<br />

* 468 Cancer volume is an independent predictor for biochemical progression and clinical failure in high-risk<br />

prostate cancer patients following radical prostatectomy: A single centre experience<br />

L. Hakim, M. Spahn, P. Gontero, S. Van Bruwaene, A. Briganti, C.Y. Hsu, K. Jeffrey, S. Joniau (Leuven,<br />

Belgium; Berne, Switzerland; Milan, Italy; Puli, Taiwan; Rochester, United States of America)<br />

469 Impact of statin use on biochemical recurrence after radical prostatectomy for prostate cancer<br />

S. Park, M. Shim, D. Yoo, J. Kim, C. Song, J.H. Hong, C-S. Kim, H. Ahn (Seoul, South Korea)<br />

470 Simple prediction model of side-specific extracapsular extension based on percent positive biopsy cores<br />

and tumor contact length with the capsule on MRI<br />

Y. Matsuoka, J. Ishioka, N. Numao, H. Tanaka, S. Yoshida, M. Yokoyama, F. Koga, K. Saito, H. Masuda,<br />

Y. Fujii, K. Kihara (Tokyo, Japan)<br />

* 471 Risk stratification among men undergoing radical prostatectomy for high-risk prostate cancer in a US<br />

cohort: An EMPaCT validation study<br />

J. Karnes, A. Briganti, P. Gontero, M. Spahn, S. Joniau (Rochester, United States of America; Milan, Turin,<br />

Italy; Berne, Switzerland; Leuven, Belgium)<br />

472 Laparoscopic sentinel lymph node (SLN) dissection correlated to extended pelvic lymph node dissection for<br />

clinically localized prostate cancer (PC): 200 patients<br />

T.G.M. Rousseau, J. Lacoste, E. Potiron, G. Le Coguic, G. Aillet, M. Lacombe, L. Campion, C. Rousseau (Saint<br />

Herblain, Nantes, France)<br />

* 473 Pathological nodal staging score for prostate cancer: A tool to address adequate nodal dissection in men<br />

treated with radical prostatectomy<br />

A. Briganti, A. Nonis, C. Brombin, L.A. Kluth, F.K.H. Chun, S.F. Shariat, U. Capitanio, A. Gallina, A. Nini,<br />

M. Bianchi, M. Tutolo, M. Freschi, C. Doglioni, G. Guazzoni, A. Salonia, P. Rigatti, C. Di Serio (Milan, Italy;<br />

Hamburg, Germany; New York, United States of America)


474 Pathologic nodal staging scores (pNSS) for prostate cancer: A decision tool for adjuvant therapy after<br />

radical prostatectomy<br />

L.A. Kluth, E. Xylinas, F. Abdollah, N. Passoni, H. Fajkovic, T. Faison, M. Sun, P.I. Karakiewicz, C. Seitz,<br />

P. Schramek, M. Herman, M. Schmid, Y. Lotan, D.S. Scherr, F.K.H. Chun, M. Graefen, A. Tewari, A. Briganti,<br />

S.F. Shariat (New York, Dallas, United States of America; Milan, Italy; St.Poelten, Viena, Austria; Montreal,<br />

Canada; Hamburg, Germany)<br />

475 Does private health insurance status affect the pathological outcomes in patients undergoing radical<br />

prostatectomy in the United Kingdom?<br />

S. Robinson, A. Omar, D. Summers, H. Motiwala, A. Rao, O. Karim, M. Laniado (Slough, Berkshire, United<br />

Kingdom)<br />

476 Examining the health status of informal caregivers of European patients with prostate cancer<br />

A. Goren, M. Lees, I. Gilloteau (New York, Princeton, United States of America; Rueil-Malmaison, France)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

195<br />

Sunday


Sunday<br />

Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

196 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

14.00 - 15.30 Bladder cancer: Imaging and resection<br />

Brown Hall 3 - Level S2<br />

Poster Session 40<br />

Chairs: P. Black, Vancouver (CA)<br />

F. Greco, Leipzig (DE)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

477 Assessing the value of PET scans in the preoperative staging of bladder cancer<br />

A.I. Goodfellow, Z. Viney, P. Hughes, S. Hughes, S. Rankin, T. Kay, P. Dasgupta, T.S. O’Brien, M.S. Khan<br />

(London, United Kingdom)<br />

* 478 Accuracy of FDG PET-CT compared with conventional CT for the lymph node staging in muscle invasive<br />

bladder cancer: Prospective study of 58 patients with extended lymphadenectomy<br />

I.G. Jeong, J.H. Lim, S. Hong, D. You, J.Y. Joung, B. Hong, J.H. Hong, H. Ahn, C-S. Kim (Seoul, South Korea;<br />

New Brunswick, United States of America)<br />

479 The accuracy of fluorine-18 fluorodeoxyglucose ([18f]fdg) positron emission tomography in the diagnosis<br />

of lymph node metastasis for patients undergoing radical cystectomy and extended lymph node dissection<br />

for invasive bladder cancer<br />

F. Gevher, C. Demirdag, M. Gezer, M. Halac, K. Sonmezoglu, S. Ataus, C. Obek (Istanbul, Turkey)<br />

480 The staging role of 18FDG PET-CT in patients with muscle-invasive bladder cancer selected for radical<br />

cystectomy<br />

M.C. Ferriero, G. Simone, R. Papalia, S. Guaglianone, R. Sciuto, C.L. Maini, M. Gallucci (Rome, Italy)<br />

481 PETCT for preoperative evaluation of bladder cancer before cystectomy - localisation of positive<br />

lymphnodes<br />

F. Aljabery, G. Lindblom, S. Jahnson (Linköping, Sweden)<br />

482 Extended results of the use of diffusion-weighted magnetic resonance imaging in the diagnosis of lymph<br />

node invasion in bladder cancer<br />

E. De La Peña, B. López, V. Hernández, I. Sola, C. Blázquez, F.J. Díaz, J. Borrego, J. Martel, C. Llorente<br />

(Madrid, Spain)<br />

* 483 Prognostic interest to discriminate muscularis mucosae invasion (T1a vs. T1b) in non-muscle-invasive<br />

bladder carcinomas: Results from a national multicentre study with a central pathology review<br />

M. Rouprêt, T. Seisen, S. Larre, E. Comperat, C. Mazerolles, G. Fromont, O. Celhay, B. Faivre D’Arcier,<br />

F. Rozet, J. Irani, M. Soulie, C. Pfister (Paris, Reims, Toulouse, Poitiers, Tours, Rouen, France)<br />

484 Applications of a flexible ultrasound bronchoscope in the staging of bladder transitional cell tumors: Initial<br />

experiences<br />

C. Xu, Z. Zhang, Y. Sun (Shanghai, China)<br />

485 The prognostic effect of a repeat transurethral resection prior to neoadjuvant chemotherapy for urothelial<br />

carcinoma of the bladder<br />

J.M. Gaya, D.D. Holder, M.C. Benson, G.W. Hruby, J. De Castro, J.M. McKiernan (Barcelona, Spain; New York,<br />

United States of America)


486 Narrow band imaging (NBI) cystoscopy and NBI assisted bipolar TURBT: Does it improve detection rates in<br />

low and high risk non muscle invasive bladder cancer? The RUA’s experience<br />

R. Giulianelli, B.C. Gentile, G. Vincenti, S. Nardoni, T. Shestani, L. Mavilla, L. Albanesi, F. Attisani,<br />

G. Mirabile, F. Pisanti, D. Granata, M. Schettini (Rome, Italy)<br />

487 Significance of random bladder biopsies in patients undergoing transurethral resection of non-muscle<br />

invasive bladder cancer<br />

M. Kumano, Y. Nakano, H. Miyake, M. Fujisawa (Kobe, Japan)<br />

488 Is transurethral surgery for bladder tumor or BPH safe to operator?<br />

J.P. Park, C. Zhao, Y.S. Shin, M.K. Kim, H.J. Kim (Jeonju, South Korea; Shanghai, China)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

197<br />

Sunday


Sunday<br />

Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

198 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

14.00 - 15.30 Living donor nephrectomy and tumours on kidney transplanted<br />

patients<br />

Amber Hall 1-2 - Level S2<br />

Poster Session 41<br />

Chairs: A. Breda, Barcelona (ES)<br />

M. Giessing, Düsseldorf (DE)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

* 489 Transvaginally notes-assisted living donor nephrectomy: Experience after 50 cases<br />

L. Peri Cusi, M. Musquera Felip, A. Vilaseca Cabo, E. Garcia-Cruz, M.J. Ribal Caparrós, J. Huguet Pérez,<br />

R. Alvarez-Vijande, A. Alcaraz Asensio (Barcelona, Spain)<br />

490 Clinical situations requiring right-sided living donor nephrectomy and the safety of hand-assisted living<br />

donor nephrectomy; single-center experience<br />

B.J. Lim, A. Kim, D. Choi, G. Song, W. Kim, I.G. Jeong, D.J. Han, B. Hong (Seoul, Busan, South Korea)<br />

491 Results of ABO-incompatible kidney transplant after five years of experience<br />

M. Musquera Felip, A. Sanchez-Escudero, L. Peri, F. Diekmann, I. Revuelta, J. Cid, M. Lozano, M. Blasco,<br />

D. Paredes, J.M. Campistol, A. Alcaraz, F. Oppenheimer (Barcelona, Spain)<br />

492 Results of the elderly unrelated ABO incompatible kidney transplantation<br />

T. Kimura, T. Yagisawa, N. Ishikawa, Y. Sakuma, T. Fujiwara, A. Nukui (Shimotsuke, Japan)<br />

493 Decreasing operating times and complication rates after laparoscopic donor nephrectomy by different<br />

techniques in highly experienced surgical teams<br />

E.M.P. Broers, J.F. Langenhuijsen, H.W. Kloke, M.C. Warlé, M.F.P. Van Der Jagt, F.C.H. D’Ancona (Nijmegen,<br />

The Netherlands)<br />

494 LESS living donor nephrectomy<br />

L. Peri Cusi, A. Vilaseca Cabo, M. Musquera Felip, M.J. Ribal Caparrós, J. Huguet Pérez, R. Álvarez-Vijande,<br />

A. Alcaraz Asensio (Barcelona, Spain)<br />

495 The impact of socioeconomic status, ethnicity, age and location of transplant centre on live donor kidney<br />

transplant access and outcomes in the West of Scotland<br />

N.J. Dempster, C. Ceresa, E. Aitken, D. Kingsmore (Glasgow, United Kingdom)<br />

496 Effectiveness of our living donor kidney transplant program. evaluation of discarded living donor in kidney<br />

transplantation<br />

M. Musquera Felip, I. Revuelta, L. Peri, F. Diekmann, A. Sanchez-Escudero, M.C. Sebastia, R. Salvador,<br />

D. Paredes, C. Monsalve, A. Alcaraz, J. Campistol, F. Oppenheimer (Barcelona, Spain)<br />

497 Live donor nephrectomy vs kidney transplants in minority populations: A population based analysis of<br />

trends<br />

J.D. Sammon, K.R. Ghani, S. Sukumar, S. Staley, J.O. Peabody, C.G. Rogers, M. Menon, Q-D. Trinh (Detroit,<br />

United States of America)


* 498 De novo parenchymal renal graft tumors. Multicenter descriptive national study with 25585 renal<br />

transplants<br />

F. Gómez Veiga, J. Ponce Diaz-Reixa, E. Lledó, J Blazquez, A. Breda, P. Pardo, M. Musquera, A. Alcaraz,<br />

J. García-Olaverri Rodríguez, C. Pertusa Peña, F. Burgos, C. García, L. Riera Canals, J. Cózar, A. Rodríguez,<br />

A. Aguilera, C. Hernández, P. Gutierrez (A Coruña, Madrid, Barcelona, Bilbao, Sevilla, Granada, Tenerife,<br />

Spain)<br />

499 Pathologic characteristics and prognosis of renal cell carcinoma in kidney transplant recipients’ native<br />

kidney: Case-control study<br />

M. Sodano, N. Arrighi, L. Cristinelli, S. Sandrini, S. Cosciani Cunico, C. Simeone, A. Antonelli (Brescia, Italy)<br />

500 Prostate carcinoma in solid organ transplant recipients<br />

X. Tillou, K. Guleryuz, J. Fumey, C. Orczyk, B. Hurault De Ligny, L. Chiche, H. Bensadoun, A. Doerfler (Caen,<br />

Bordeaux, France)<br />

501 Urological de novo malignancies after renal transplantation: Incidence and management<br />

V. Hevia Palacios, V. Gómez Dos Santos, S. Álvarez Rodríguez, V. Díez Nicolás, C. Gómez Del Cañizo,<br />

C. Galeano Álvarez, A. Gomis Couto, A. Fernández Fernández, R. Marcén Letosa, F.J. Burgos Revilla (Madrid,<br />

Spain)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

199<br />

Sunday


Sunday<br />

Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

200 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

14.00 - 15.30 News in prostate and bladder infections<br />

Amber Hall 7-8 - Level S2<br />

Poster Session 42<br />

Chairs: N. Mondaini, Florence (IT)<br />

F.M.E. Wagenlehner, Giessen (DE)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

502 Bacteraemia during TURP: Is it more prevalent than previously thought?<br />

A. Mohee, D. Gascoyne-Binzi, J. Sandoe, I. Eardley (Leeds, United Kingdom)<br />

503 Additional amikacin is effective as a targeted antibiotic prophylaxis for transrectal prostate biopsy in<br />

patients with fluoroquinolone-resistant E. coli in rectal flora<br />

Y. Nasu, A. Takamoto, M. Sugimoto, N. Ono (Okayama, Kochi, Japan)<br />

504 Prostatic penetration of meropenem in humans, and dosage considerations for prostatitis based on sitespecific<br />

pharmacokinetic-pharmacodynamic evaluation<br />

G. Nishikawa, K. Ikawa, K. Nakamura, Y. Yamada, K. Zennami, K. Ikeda, N. Morikawa, M. Sumitomo<br />

(Nagakute, Hiroshima, Kani, Japan)<br />

505 The Influence of urinary pH on antibiotic efficacy against bacterial uropathogens<br />

L. Yang, K. Wang, H. Li, J Denstedt, P Cadieux (Chengdu, China; London, Canada)<br />

506 Identification of bacteria in human urine from the profile of emitted volatile organic compounds<br />

J.P. Williams, K. Vaughan, B. De Lacy Costello, N.M. Ratcliffe, M.J. Drake (Bristol, United Kingdom)<br />

507 Psychosomatic disorders in patients with chronic bacterial prostatitis<br />

O. Banyra, O. Ivanenko, O.D. Nikitin, O.O. Stroy (Lviv, Kiev, Ukraine)<br />

508 Human papillomavirus infection is not related with prostatitis-realted symptoms in young heterosexual<br />

men: Results from a population-based case-control study<br />

R. Bartoletti, E. Meliani, F. Meacci, S. Mazzoli, T. Cai (Florence, Trento, Italy)<br />

509 Effects of pollen extract in association with vitamins (deprox 500®) for pain relief in patients affected by<br />

chronic prostatitis/chronic pelvic pain syndrome: Results from a randomized, controlled study<br />

T. Cai, G.L. Luciani, C. D’Elia, N. Mondaini, G. Malossini, S. Mazzoli, R. Bartoletti (Trento, Florence, Italy)<br />

* 510 Prospective study assessing the presence of endotoxaemia in patients undergoing transrectal prostate<br />

biopsy<br />

S. Sheehan, J. Philpott-Howard, W. Wang, H. Nemade, P.M. Thompson (London, United Kingdom; Beijing,<br />

China)<br />

511 Prevalence of prostatitis in men treated with prostatectomy (open prostatectomy, transurethral resection of<br />

prostate) for benign prostatic hyperplasia induced bladder outlet obstruction<br />

H. Khairy Salem, H. El Fayoumy, H. Shaker, A. Lotfi, E. Anis (Cairo, Egypt)<br />

512 Early experience of safety and efficacy of sodium hyaluronate-chondroitin sulfate solution in chronic<br />

painful conditions in the bladder<br />

H. Yoon, Y.J. Byun, B.S. Shim, W.S. Chung, D.H. Lee, Y.Y. Park (Seoul, South Korea)


* 513 Characterisation of the inflammatory infiltrate in bladders from patients with bladder pain syndrome,<br />

multiple sclerosis and mitomycin instillations<br />

T. Gevaert, T. Roskams, D. De Ridder (Leuven, Belgium)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

201<br />

Sunday


Sunday<br />

Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

202 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

14.00 - 15.30 TURP and beyond<br />

Silver Hall - Level N2<br />

Poster Session 43<br />

Chairs: T. Esen, Istanbul (TR)<br />

M. Oelke, Hanover (DE)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

514 Can we forecast the postoperative results in patients with bladder outlet obstruction (BOO)?<br />

S.H. Alloussi, G. Peters, Y. Al-Bulushi, W. Arafat, C. Lang, S. Alloussi (Neunkirchen, Germany)<br />

* 515 Is the resected prostate weight a predictive factor of the need for continual medication or reoperation for<br />

lower urinary tract symptom after transurethral resection of the prostate? A study by applying nationwide<br />

population based database<br />

C.C. Lin, A.T.L. Lin, H.J. Chung, Y.H. Huang, K.K. Chen, T.Z. Chen (Taipei, Taiwan)<br />

516 The management of acute chronic urinary retention: Factors influencing treatment decisions<br />

W. Green, N. Campain, R. Parkinson (Derby, Nottingham, United Kingdom)<br />

517 Transurethral resection of prostate and the role of pharmacological treatment with dutasteride in<br />

decreasing surgical blood loss<br />

A.L. Pastore, G. Palleschi, V. Petrozza, S. Mariani, M.A. Valentini, F. Barrese, M. Cappa, A. Carbone (Latina,<br />

Rome, Italy)<br />

518 Impact of medical therapy on transurethral resection of the prostate (TURP): Two decades of change<br />

A. Argirovic, D. Argirovic (Belgrade, Serbia)<br />

519 Clinical characters of patients continuing medical therapy after transurethral prostate surgery for benign<br />

prostatic hyperplasia with lower urinary tract symptoms<br />

W.J. Ko, H.H. Han, T.Y. Jung, T.K. Yoo, D.Y. Kim, T.H. Oh, S.S. Byun, S.I. Kim, D.D. Kwon (Gyeonggi-Do, Seoul,<br />

Daegu, Changwon, Gyeonggido, Chonnam, South Korea)<br />

520 Bipolar resection versus standard transurethral resection of the prostate: A prospective randomized study<br />

with 2-year follow-up<br />

M. Oussama, J. Ghorbel, R. Hedi, M. Zouari, T. Kilani, J. Maaroufi, M. Ben Ali, H. Khouni, M. Dridi, R. Khiari,<br />

S. Ghozzi, N. Ben Rais (Tunis, La Marsa Tunis, Tunisia)<br />

* 521 Bipolar vs monopolar TURP: Impact on the overall sexual function and midterm safety-efficacy results of<br />

an international multicentre randomized controlled trial<br />

C. Mamoulakis, A. Skolarikos, M. Schulze, C. Scoffone, J. Rassweiler, G. Alivizatos, R. Scarpa, J. De La<br />

Rosette (Amsterdam, The Netherlands; Athens, Greece; Heilbronn, Germany; Turin, Italy)<br />

522 Two-year prospective, randomized comparison between the bipolar plasma enucleation of the prostate<br />

and open prostatectomy in BPH cases over 80 mL<br />

B.F. Geavlete, F.A. Stanescu, C. Iacoboaie, P.A. Geavlete (Bucharest, Romania)<br />

523 Systematic review and meta-analysis of the clinical effectiveness of bipolar compared to monopolar<br />

transurethral resection of the prostate<br />

M.I. Omar, T. Lam, C.E. Alexander, J. Graham, C. Mamoulakis, M. Imamura, S. MacLennan, F. Stewart,<br />

J. N’Dow (Aberdeen, United Kingdom; Crete, Greece)


524 Prospective study to compare safety and outcomes of open retropubic adenomectomy and extraperitoneal<br />

laparoscopic adenomectomy<br />

A. Garcia-Segui, F. Ramon De Fata, F. Lista, G. Andres, M. Sánchez-Chapado, J.C. Angulo (Mahon, Madrid,<br />

Spain)<br />

525 Single port transvesical adenomectomy for BPH<br />

M. Hisano, F.C. Vicentini, T.S. Agresta, P.K. Mota, M.A. Di Napoli, C.B. Murta, J.F.A. Claro (Sao Paulo, Brazil)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

203<br />

Sunday


Sunday<br />

Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

204 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

14.00 - 15.30 Paediatric urology: What’s new?<br />

Red Hall 1 - Level N1<br />

Poster Session 44<br />

Chairs: M. De Gennaro, Rome (IT)<br />

Z. Tchanturaia, Tbilisi (GE)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

526 Prevalence and temporal trends in admissions for urolithiasis in children<br />

F.J. Penna, J.D. Sammon, K.R. Ghani, S. Sukumar, J.O. Peabody, M. Menon, J.S. Elder (Detroit, United States<br />

of America)<br />

* 527 What is the best option for 10- 20 mm renal pelvic stones undergoing ESWL in pediatric population:<br />

Stenting, alpha blockers or conservative follow-up?<br />

E. Süer, M. Mermerkaya, F. Afandiyev, E. Öztürk, C. Özcan, B. Burgu, T. Soygür (Ankara, Turkey)<br />

528 Pediatric ureteroscopy with two guide wires technique<br />

W. Gamal, A. Mmdouh, M. Husein, A. Hammdy, M. Aldahshoury, E. Moursy, M. Diaa (Sohag, Egypt)<br />

529 Does previous open nephrolithotomy affect the outcomes of the percutaneous nephrolithotomy in children?<br />

B. Onal, F. Gevher, B. Argun, C. Dogan, S Citgez, A.U. Onder, A. Erozenci (Istanbul, Turkey)<br />

530 Assessment of pediatric and adult percutaneous nephrolithtomy complications by modified Clavien grading<br />

system. A comparative study<br />

Z. Alam, M.B. Baig, T.W. Saad, S.Z. Zaidi (Karachi, Pakistan)<br />

531 Percutaneous cystolithotomy in pediatric bladder enlargement and continent reservoirs<br />

E. Llorens De Knecht, A. Bujons, J. Caffarati, J.M. Garat, H. Villavicencio (Barcelona, Spain)<br />

532 Lithiasis development in bladder continent reservoirs<br />

J.M. Lopez, J. Pelegrí, A. Bujons, J. Caffaratti, L.J. Saldaña, M. Cosentino, J.M. Garat, H. Villavicencio<br />

(Barcelona, Spain)<br />

533 Predictors of renal functional improvement after pyeloplasty in ureteropelvic junction obstruction: Clinical<br />

value of visually assessed renal parenchymal tracer transit time in 99mTc-mercaptoacetyltriglycine (99mTc-<br />

MAG3) renography?<br />

S. Pak, S.H. Song, A. Kim, B. Lim, D. Kim, S. Park, K.S. Kim (Seoul, Ulsan, South Korea)<br />

* 534 Correction of ureteropelvic junction obstruction in children: National trends and comparative effectiveness<br />

in operative outcomes<br />

S. Sukumar, A. Abdo, F.J. Penna, A.A. Friedman, J.D. Sammon, K.R. Ghani, J.O. Peabody, M. Menon,<br />

Q-D. Trinh, J.S. Elder (Detroit, United States of America; Montreal, Canada)<br />

535 Inguinal approach for the management of non-palpable testis: Is diagnostic laparoscopy necessary?<br />

J-S. Park, H.J. Jung, K-H. Bae, C-I. Kim (Daegu, South Korea)<br />

536 Evaluation of laparoscopy in the diagnosis and management of non-palpable testis<br />

K. Mursi, A. Salem, M.N. El-Ghoneimy, A.M. Abdel-Hakim, I.R. Saad (Cairo, Egypt)


537 Laparoendoscopic single-site surgery (LESS) for treatment of different urologic pathologies in pediatrics:<br />

Initial experience<br />

A. Abdel-Karim, A. Moussa, M. Elmissery, A. Abolfotoh, W. Mahfouz, S. Elsalmy (Alexandria, Egypt)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

205<br />

Sunday


Sunday<br />

Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

206 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

14.00 - 15.30 Stones: ESWL and PCNL<br />

Red Hall 2 - Level N1<br />

Poster Session 45<br />

Chairs: S. McClinton, Aberdeen (GB)<br />

H.G. Tiselius, Stockholm (SE)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion.<br />

538 Withdrawn<br />

539 Superior ureteric stone clearance with shockwave lithotripsy under anaesthesia: A review of 106 cases<br />

D.R. Lenaghan, C. Kaiser, J.R. Goad, A.H. Clarke (Melbourne, Australia)<br />

540 Urgent shock wave lithotripsy as first-line treatment for ureteral stones: A meta-analysis of 570 patients<br />

S. Picozzi, C. Ricci, S. Casellato, R. Stubinski, G. Bozzini, S. Maruccia, L. Carmignani (San Donato Milanese,<br />

Italy)<br />

541 A prospective randomized study comparing the effect of escalating and fixed voltage treatment on stone<br />

comminution and renal injury during ESWL<br />

N. Ghosh, S. Mandal, D. Karmakar, S. Bakshi (Kolkata, India)<br />

542 Shock wave lithotripsy vs flexible ureteroscopy for the treatment of renal stones – a single center<br />

experience<br />

C. Persu, V. Mirciulescu, G. Nita, A. Mihalache, P. Geavlete (Bucharest, Romania)<br />

543 Is it possible to improve the efficacy of ESWL in the treatment of urinary lithiasis?<br />

E.J. Moran Pascual, M.A. Conca, A. Budia, P. Bahilo, G. García, F. Boronat (Valencia, Spain)<br />

544 Withdrawn<br />

545 The Locator: Clinical experience with a novel PCNL navigation device<br />

J.M. Lazarus, L. Kaestner (Cape Town, South Africa)<br />

546 “5-PANG system”-version 2: A multiutility system for percutaneous renal access<br />

A.V. Rawandale, L.G. Patni, P.A. Patil (Dhule, India)<br />

547 Renal access under computer tomography guidance in percutaneous nephrolithotomy<br />

P. Sarkis, G. Nawfal, G. Kamel, A. Chemaly (Beirut, Lebanon)<br />

548 Complications after percutaneous nephrolithotomy using the De La Rosette categorization of the Clavien-<br />

Dindo system. Single centre experience in 145 cases<br />

N. Ferakis, K. Bouropoulos, P. Nasopoulou, P. Sinos, P. Anastasopoulos, M. Stavropoulos, F. Venetsanos,<br />

A. Farmakis, I. Poulias (Athens, Greece)<br />

549 A new method of objectively assessing the necessity of draining the ureter after mini-PCNL<br />

J. Rode, U. Nagele, M. Kufner, U. Walcher, M.N. Kimuli, A. Hoznek (Creteil, France; Hall in Tirol, Austria;<br />

Leeds, United Kingdom)<br />

550 A novel paraboloid pneumatic intracorporeal lithotriptor: Computer assisted (CAD) analysis and invitro<br />

comparison with holmium laser<br />

A.V. Rawandale, L.G. Patni, P.A. Patil (Dhule, India)


551 Effect of epinephrine mix saline irrigation in percutaneous nephrolithotripsy surgery<br />

J.H. Yoon, T.S. Kim, J.S. Jeung, C.K. Oh, H.K. Ha, S. Kim (Busan, South Korea)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

207<br />

Sunday


Sunday<br />

Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

208 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

14.00 - 15.30 Uro-genital reconstruction and trauma<br />

Blue Hall 1-2 - Level N1<br />

Poster Session 46<br />

Chairs: J.J. Lopez-Tello Garcia, Madrid (ES)<br />

D.N. Wood, London (GB)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion.<br />

552 Laparoendoscopic single site pyeloplasty: A multi-institutional cumulative analysis<br />

R. Autorino, E. Rizkala, J. Cadeddu, S. Rais-Bahrami, V. Tugcu, A. Kawauchi, A. Abdel-Karim, I. Darweesh,<br />

A. George, A. Bagrodia, R. Kopp, L. Richstone, R. Stein, J. Kaouk (Cleveland, Dallas, New Hyde Park, La Jolla,<br />

United States of America; Istanbul, Turkey; Kyoto, Japan; Alexandria, Egypt)<br />

553 Laparoendoscopic single-site (LESS) versus conventional transperitoneal laparoscopic pyeloplasty: A<br />

prospective randomized study<br />

V. Tugcu, Y.O. Ilbey, E. Sonmezay, A.I. Tasci (Istanbul, Turkey)<br />

554 How long is it necessary to stent after laparoscopic or robot assisted dismembered pyeloplasty? Results of<br />

a prospective randomized study<br />

C. Germann, A. Mattei, P. Stucki, M. Behrendt, H. Danuser (Luzern, Switzerland)<br />

555 Long-term renal function after urinary diversion: A retrospective study<br />

F.C. Burkhard, J. Xiao-Dong, S. Röthlisberger, F.J. Frey, U.E. Studer (Berne, Switzerland)<br />

556 Iatrogenic ureteral stricture: Laparoscopic ureteral reimplantation<br />

J. Gómez Rivas, S. Alonso Y Gregorio, D. López Sánchez, J. Pons Viver, A. Tabernero Gómez, J. Cisneros Ledo,<br />

J.J De La Peña Barthel (Madrid, Spain)<br />

557 Late functional results of double-barreled wet colostomy after 169 procedures: Single-institution<br />

experience<br />

G.C. Guimaraes, R.A.R. Oliveira, L.Y. Kumagai, G. Baiocchi, S. Aguiar, T.B.M. Santana, S.C. Zequi,<br />

R.L. Favaretto, W.H. Costa, A. Lopes (Sao Paulo, Brazil)<br />

558 Urologic complications of cytoreductive surgery and intraperitoneal hyperthermic chemotherapy for<br />

peritoneal surface malignancy; incidence, risk factors, and management in 934 consecutive procedures<br />

L. Craven, M. Mirzazadeh, P. Shen, E. Levine, K. Votanopoulos, J. Stewart Iv (Winston Salem, United States<br />

of America)<br />

559 Gender reassignment surgery - a 13 year review of surgical outcomes<br />

R. Rossi Neto, F. Hintz, S. Krege, H. Rübben, F. Vom Dorp, J. Hess (Essen, Krefeld, Germany)<br />

560 Gender reassignment surgery: A 20 years review of surgical outcomes<br />

D. Arcaniolo, P. Verze, C. Imbimbo, N. Longo, A. Palmieri, F. Fusco, F. Mangiapia, F. Bottone, V. Mirone<br />

(Naples, Italy)<br />

561 Multicentric study of reconstructive after partial amputation of the penis for squamous cell carcinoma<br />

R. Leonardi, S. Pecoraro, S. Sansalone, M. Silvani, A. Zucchi (Catania, Avellino, Rome, Biella, Perugia, Italy)<br />

562 Long-term results of 50 ureteral replacements with ileum<br />

B.K. Komyakov, V.A. Ochelenko (Saint-Petersburg, Russia)


563 High grade renal injury: Non operative management of urinary extravasation and prediction of long-term<br />

outcomes<br />

J.A. Long, G. Fiard, V.A Arnoux, J.L. Descotes, O. Skowron, N. Terrier, J.J. Rambeaud (Grenoble, France)<br />

564 Indications, successes and complications of arterial embolization in renal trauma<br />

G. Fiard, N. Terrier, C. Sengel, M. Chodez, J-L. Descotes, J-J. Rambeaud, J-A. Long (Grenoble, France)<br />

565 Accuracy of magnetic resonance imaging for diagnosis of penile fracture – comparison with intraoperative<br />

findings<br />

G. Hatzichristodoulou, J.E. Gschwend, K. Herkommer, N. Zantl (Munich, Germany)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

209<br />

Sunday


Sunday<br />

Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

210 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

14.00 - 15.30 Urothelial cancer: Transurethral surgery and intravesical recurrence<br />

Yellow Hall 1-2-3 - Level N1<br />

Poster Session 47<br />

Chairs: M. Babjuk, Prague (CZ)<br />

B. Van Rhijn, Amsterdam (NL)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

* 566 Risks and complications of trans-urethral resection of bladder tumour in patients taking anti-platelet<br />

agents for cardiovascular disease<br />

S. Casellato, S. Picozzi, G. Bozzini, S. Maruccia, L. Carmignani (San Donato Milanese, Italy)<br />

567 Is it oncologically safe performing simultaneous transurethral resection of the bladder and prostate? A<br />

meta-analysis on 1,234 patients<br />

S. Picozzi, C. Ricci, S. Casellato, G. Bozzini, S. Maruccia, D. Ratti, L. Carmignani (San Donato Milanese,<br />

Milan, Italy)<br />

568 Snapshot of transurethral resection of new bladder tumours in the UK audit - STUKA<br />

A. Patel, J. Catto, D. Rosario, C. Gan, T.S. O’Brien (London, Sheffield, United Kingdom)<br />

569 TaG1 bladder tumours: One third of all primary tumours and 80% of all recurrent tumours can be treated<br />

in the office under local anaesthesia<br />

E.F. Sabir, S. Holmäng (Gothenburg, Sweden)<br />

570 Comparative therapeutic impact and long-term NMIBC recurrence rates specific for HAL blue light<br />

cystoscopy, combined NBI–bipolar plasma vaporization and the standard approach in randomized clinical<br />

settings<br />

B.F. Geavlete, R.D. Multescu, D.A. Georgescu, M. Jecu, F.A. Stanescu, C. Moldoveanu, P.A. Geavlete<br />

(Bucharest, Romania)<br />

571 Long-term follow-up of patients with tumours of the renal pelvis and ureter: How often is a bladder<br />

tumour diagnosed after 5 tumour-free years?<br />

S. Holmäng, S.L. Johansson (Gothenburg, Sweden; Omaha, Nebraska, United States of America)<br />

572 Risk stratification model for predicting bladder recurrence after radical nephroureterectomy for upper<br />

urinary tract urothelial carcinoma<br />

J. Ishioka, K. Saito, Y. Matsuoka, N. Numao, F. Koga, H. Masuda, Y. Fujii, Y. Sakai, T. Okuno, C. Arisawa,<br />

S. Kamata, K. Nagahama, J. Yonese, A. Noro, T. Tsujii, S. Morimoto, Y. Higashi, I. Fukui, K. Kihara (Tokyo,<br />

Chiba, Ibaraki, Saitama, Japan)<br />

573 Prediction of intravesical recurrence after radical nephroureterectomy: Development of a clinical decisionmaking<br />

tool<br />

E.N. Xylinas, L.A. Kluth, D.S. Scherr, G. Novara, E. Comploj, A. Pycha, H-M. Fritsche, Q-D. Trinh,<br />

P.I. Karakiewicz, A. Weizer, J.D. Raman, W. Kassouf, M. Zerbib, S.F. Shariat (New York, Ann Arbor, Hershey,<br />

United States of America; Padua, Bolzano, Italy; Regensburg, Germany; Montreal, Canada; Paris, France)<br />

574 Detection of factors affecting early bladder recurrence after nephroureterectomy in patients with N0M0<br />

upper urinary tract urothelial carcinoma<br />

K. Kuroda, J. Asakuma, A. Horiguchi, S. Tasaki, A. Sato, K. Seguchi, K. Ito, T. Asano (Tokorozawa, Saitama,<br />

Japan)


575 Segmental ureterectomy versus radical nephroureterectomy for urothelial cancer of the ureter: A matchedpair<br />

analysis<br />

T. Klatte, R.E. Zigeuner, M. Rouprêt, M. Babjuk, U. Capitanio, E. Cha, P. Colin, E. Comploj, O. Dalpiaz,<br />

H.-M. Fritsche, T.R. Herrmann, M. Hora, W. Hübner, A.S. Merseburger, F. Montorsi, L. Nison, G. Novara,<br />

M. Roscigno, S.F. Shariat, M. Remzi (Vienna, Graz, Korneuburg, Austria; Paris, Lille, France; Prague, Plze˘n,<br />

Czech Republic; Milan, Bolzano, Padua, Bergamo, Italy; New York, United States of America; Regensburg,<br />

Hanover, Germany)<br />

576 Prediction of cancer-specific survival after radical nephroureterectomy for upper tract urothelial<br />

carcinoma: Development of an optimized post-operative nomogram using decision curve analysis<br />

M. Rouprêt, V. Hupertan, T. Seisen, P. Colin, E. Xylinas, D. Yates, H. Fajkovic, Y. Lotan, J. Raman, R. Zigeuner,<br />

M. Remzi, C. Bolenz, G. Novara, W. Kassouf, A. Ouzzane, F. Rozet, O. Cussenot, J. Martinez-Salamanca,<br />

H-M. Fritsche, T. Walton, C. Wood, K. Bensalah, P. Karakiewicz, F. Montorsi, V. Margulis, S. Shariat (Paris,<br />

Lille, Rennes, France; New-York, Dallas, Hershey, Texas, United States of America; Graz, Korneuburg,<br />

Austria; Manheim, Regensburg, Germany; Bergamo, Milan, Italy; Montreal, Canada; Madrid, Spain;<br />

Nottingham, United Kingdom)<br />

* 577 Photodynamic diagnosis of non-muscle invasive bladder cancer with hexaminolevulinate cystoscopy: A<br />

meta-analysis<br />

M. Burger, H.B. Grossman, M. Droller, J. Schmidbauer, G. Hermann, O. Drăgoescu, E. Ray, F.J. Witjes,<br />

A. Karl, A. Stenzl, Y. Fradet, J. Burgués, D. Jocham (Würzburg, Munich, Tübingen, Lübeck, Germany;<br />

Houston, New York, United States of America; Vienna, Austria; Copenhagen, Denmark; Craivoa, Romania;<br />

London, United Kingdom; Nijmegen, The Netherlands; Quebec, Canada; Palma de Mallorca, Spain)<br />

Discussion on poster 577<br />

M. Babjuk, Prague (CZ)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

211<br />

Sunday


Sunday<br />

Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

212 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

15.45 - 17.15 Laparoscopic renal surgery<br />

eURO Auditorium - Level S2<br />

Video Session 6<br />

Chairs: A. Celia, Bassano del Grappa (IT)<br />

M.J. Ribal, Barcelona (ES)<br />

All presentations have a maximum length of 10 minutes, followed by 4 minutes of discussion.<br />

V41 Laparoscopic nephrectomy with cavotomy for right renal cell carcinoma with venous thrombus<br />

F. Vigués, J.I. Pérez-Reggeti, M. Serrallach, E. Llorens, R. Rodriguez-Malatesta, M.A. López-Costea, E. Franco<br />

(Barcelona, Spain)<br />

V42 Alternative laparoscopic approaches for kidney neoplasms with tumor thrombus<br />

L. Rodriguez Villamil, M. Rivas Del Fresno, S. Fernandez-Pello Montes, I. Gonzalez Rodriguez, P. Benito<br />

Garcia, J. Cuervo Calvo (Gijon, Spain)<br />

V43 Laparoscopic partial nephrectomy with radiofrequency ablation<br />

B.Y. Alekseev, A.N. Andrianov, K.M. Nyushko, A.S. Kalpinskiy, N.V. Vorobyev, V.A. Polyakov (Moscow, Russia)<br />

V44 Left laparoscopic radical nephrectomy: Step-by-step<br />

R. Sotelo Noguera, O. Carmona, R. De Andrade, F. Santinelli, D. Subira, C. Ignacio, G. Fernández, R. Garza,<br />

J. Castro, F. Birkhauser, R. Cisneros, D. Canes, R. Clayman (Caracas, Venezuela; Buenos Aires, Argentina;<br />

Madrid, Spain; Boston, Irvine, United States of America)<br />

V45 Renovascular and tumor 3-D reconstruction to facilitate robot-assisted anatomical partial nephrectomy<br />

O. Ukimura, A.L. De Castro Abreu, M. Nakamoto, S. Shoji, S. Leslie, A. Berger, A. Dharmaraja, M. Patil,<br />

M. Aron, M. Desai, I. Gill (Los Angeles, United States of America)<br />

V46 Laparoscopic partial nephrectomy with superselective microdissection<br />

G. Simone, R. Papalia, M. Ferriero, S. Guaglianone, M. Costantini, E. Forastiere, M. Gallucci (Rome, Italy)<br />

V47 ‘Off-clamp, non-renorrhaphy’ laparoscopic partial nephrectomy with perirenal fat and Gerota’s fascia<br />

reapproximation: Initial experience of a novel technique<br />

T.S. Kim, H.Y. Rhew, J.H. Oh, S.H. Kang, S. Kim, H.K. Ha, J. Yoon (Busan, South Korea)<br />

V48 Selective arterial clamping with aid of near-infrared fluorescence during laparoscopic partial nephrectomy<br />

P. Macek, F. Rozet, E. Barret, R.E. Sanchez-Salas, M. Galiano, Y. Ahallal, X. Cathelineau (Paris, France)


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

15.45 - 17.15 Focal therapy in prostate cancer treatment<br />

Brown Hall 1-2 - Level S2<br />

Poster Session 48<br />

Chairs: H.U. Ahmed, London (GB)<br />

B. Malavaud, Toulouse (FR)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion.<br />

578 Focal therapy for prostate cancer using I125seed implantation: Hemiablative brachytherapy for patients<br />

selected using extended biopsy and MRI<br />

K. Saito, T. Kijima, S. Yoshida, M. Yokoyama, J. Ishioka, Y. Matsuoka, N. Numao, F. Koga, H. Masuda, Y. Fujii,<br />

K. Hayashi, H. Shibuya, K. Kihara (Tokyo, Japan)<br />

579 Treatment of prostate cancer by 125iodine interstitial brachytherapy: A single center experience<br />

F. Palmieri, C. Di Stefano, M. Del Duca, G. Mazzotti, M. Morelli, G. Bruno, E. Lamanna, R. Pernetti, S. Voce<br />

(Ravenna, Italy)<br />

580 Robotic HIFU: Focus on early complications and imaging evaluation with D-CE-MR after 3 years experience<br />

F. Pisanti, R. Del Vescovo, F. Attisani, B.B. Zobel, R. Giulianelli (Rome, Italy)<br />

581 HIFU therapy for castration-resistant prostate cancer<br />

V.A. Solovov, L.V. Shaplygin, M.O. Vozdvozhenskiy (Samara, Russia)<br />

582 MR-guided focal cryoablation of prostate cancer recurrence following radiotherapy: A feasibility study<br />

J. Futterer, J. Bomers, D. Yakar, N.J.T. Van Lin, H. Vergunst, F. De Lange, J.O. Barentsz, J.P. Sedelaar<br />

(Nijmegen, The Netherlands)<br />

583 Definition of mid-term MRI follow-up after focal therapy for clinically localized low risk prostate cancer<br />

F. Mistretta, A. Losa, G. Cardone, M. Lazzeri, G.M. Gadda, G. Lista, A. Larcher, A. Abrate, G. Balconi,<br />

G. Guazzoni (Milan, Italy)<br />

584 Early clinical experience of focal therapy for localised prostate cancer using irreversible electroporation<br />

C.L. Dickinson, M. Valerio, H.U. Ahmed, A. Freeman, C. Allen, M. Emberton (London, United Kingdom)<br />

585 Focal therapy targeted to the index lesion in multifocal prostate cancer: A prospective development study<br />

C.L. Dickinson, H.U Ahmed, R.G Hindley, M. Sahu, S. Charman, S. Weir, N. McCartan, A. Freeman,<br />

A.P Kirkham, C. Allen, J. Van Der Meulen, M. Emberton (London, Basingstoke, United Kingdom)<br />

586 Candidate selection for quadrant-ablation focal therapy of prostate cancer through a combination of<br />

extended 14-core biopsy and MRI<br />

Y. Matsuoka, N. Numao, K. Saito, H. Tanaka, S. Yoshida, M. Yokoyama, J. Ishioka, F. Koga, H. Masuda,<br />

Y. Fujii, K. Kihara (Tokyo, Japan)<br />

587 Focal HIFU treatment for prostate cancer. Initial results<br />

M. Borghi, E. Becher, L. Montes De Oca, V. Chernobilsky (Buenos Aires, Argentina)<br />

588 Initial results of MR guided laser focal therapy for prostate cancer<br />

U. Lindner, S.R.H. Davidson, N.E. Fleshner, A. Finelli, A.R. Zlotta, M.A.S. Jewett, T.H. Van Der Kwast,<br />

M.R. Gertner, E. Hlasny, S.A. McCluskey, W. Kucharczyk, M.A. Haider, J. Trachtenberg (Toronto, Canada)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

213<br />

Sunday


Sunday<br />

589 Limitation of the current criteria for biochemical recurrence (BCR) after high intensity ultrasound (HIFU) in<br />

localized prostate cancer<br />

R.E. Sanchez Salas, D. Prapotnich, F. Secin, E. Barret, F. Rozet, M. Galiano, A. Mombet, N. Cathala,<br />

X. Cathelineau (Paris, France; Buenos Aires, Argentina)<br />

214 <strong>Programme</strong> <strong>Book</strong><br />

Is focal therapy a real competitor of watchful waiting?<br />

B. Malavaud, Toulouse (FR)


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

15.45 - 17.15 Diagnostic imaging for bladder cancer<br />

Brown Hall 3 - Level S2<br />

Poster Session 49<br />

Chairs: M. Burger, Würzburg (DE)<br />

V. Matveev, Moscow (RU)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

* 590 Precision of CT urography in diagnosis of transitional cell carcinoma<br />

B. Horsburgh, J. Belfield, C. Lynch (Liverpool, United Kingdom)<br />

591 CT cystography (CTC) with virtual cystoscopy (VC): A new technique in the detection of bladder lesion<br />

G.M. Busetto, V. Panebianco, R. Giovannone, R. Passariello, V. Gentile, E. De Berardinis (Rome, Italy)<br />

* 592 A comparison of hexaminolaevulinate (hexvix®) fluorescence cystoscopy and white light cystoscopy for the<br />

detection of bladder cancer: Results of the HeRo observational study<br />

A. Lapini, A. Minervini, A. Masala, L. Schips, A. Pycha, L. Cindolo, R. Giannella, T. Martini, G. Vittori, D. Zani,<br />

F. Bellomo, S. Cosciani Cunico (Florence, Naples, Vasto, Bolzano, Brescia, Milan, Italy)<br />

593 Narrow band imaging improves the detection of new and recurrent bladder cancers and carcinoma in-situ<br />

W. Lam, B. Ayres, A. Fernando, M. Perry (London, United Kingdom)<br />

594 In vivo optical coherence tomography for the evaluation of upper urinary tract urothelial carcinoma: Initial<br />

results from a pilot study<br />

M.T.J. Bus, B.G. Muller, D.M. De Bruin, D.J. Faber, M.P. Laguna-Pes, T.G. Van Leeuwen, T.M. De Reijke,<br />

J.J.M.C.H. De La Rosette (Amsterdam, The Netherlands)<br />

595 Air versus water as an optical transmission medium in cystoscopy – back to the origins?<br />

A. Ciudin, M.G. Diaconu, D. Gosalvez, L. Mateu, I. Aisain, A. Garcia-Larrosa, L. Peri, E. Garcia-Cruz,<br />

A. Franco, A. Alcaraz (Barcelona, Viladecans, Spain)<br />

596 Feasibility of transurethral resection of the bladder (TURB) done by narrow-band imaging (NBI)<br />

F. Longo, M. Delor, B. Mangiarotti, A. Del Nero, E. Montanari (Milan, Italy)<br />

597 Molecular characteristics of tumour tissue, fluorescent tissue during PDD, blood and urine in non-muscle<br />

invasive bladder cancer patients<br />

B. Dobrowolska-Glazar, M. Kozakowska, W. Lipczynski, A. Jozkowicz, J. Dulak, Z. Dobrowolski (Cracow,<br />

Poland)<br />

598 Comparison of optics and performance of a distal sensor high definition cystoscope, a distal sensor<br />

standard definition cystoscope and a fiberoptic cystoscope<br />

A. Lusch, P. Greene, R. Alipanah, A. Perez-Lanzac De Lorca, E.M. McDougall, J. Landman (Orange, United<br />

States of America)<br />

599 Photodynamic diagnosis of upper urinary tract urothelial cell cancer<br />

O. Aboumarzouk, S. Ahmad, B. Somani, H. Moseley, G. Nabi, S. Kata (Dundee, United Kingdom)<br />

600 Photo-dynamic therapy (PDD) and flexible uretero-renoscopy (FURS) for upper tract TCC<br />

S. Agrawal, E. Havrenak, D. Hrouda, A. Shamsuddin (London, United Kingdom)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

215<br />

Sunday


Sunday<br />

601 Role of conventional cytology in the treatment of upper tract urothelial carcinoma (OSS-UTUC): Results<br />

from the multi-institutional organ-sparing-UTUC collaboration<br />

E. Comploj, M. Babjuk, U. Capitanio, E. Cha, P. Colin, H-M. Fritsche, T. Herrmann, W. Hübner, T. Klatte,<br />

A. Merseburger, F. Montorsi, A. Pycha, M. Roscigno, M. Rouprêt, S. Shariat, R. Zigeuner, M. Remzi<br />

(Bozen, Milan, Bergamo, Italy; Prague, Czech Republic; New York, United States of America; Lille, France;<br />

Regensburg, Hanover, Germany; Korneuburg, Vienna, Graz, Austria)<br />

216 <strong>Programme</strong> <strong>Book</strong>


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

15.45 - 17.15 Research in kidney transplant<br />

Amber Hall 1-2 - Level S2<br />

Poster Session 50<br />

Chairs: A.B. Chkhotua, Tbilisi (GE)<br />

E. Lledo García, Madrid (ES)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

602 Blood group antigen-targeting peptide suppresses anti-blood group antibody binding to antigen in renal<br />

glomerular capillaries after ABO-incompatible blood reperfusion<br />

T. Yoneyama, S. Hatakeyama, Y. Tobisawa, H. Yamamoto, K. Imanishi, T. Okamoto, N. Tokui, N. Sugiyama,<br />

Y. Suzuki, S. Kudo, T. Yoneyama, Y. Hashimoto, T. Koie, N. Kamimura, M. N Fukuda, C. Ohyama (Hirosaki,<br />

Japan; La Jolla, United States of America)<br />

603 Heat shock protein 90 is involved in antibody-mediated rejection and is a potential target of anti-rejection<br />

therapy in kidney transplantation<br />

T. Tanaka, H. Ishida, M. Furusawa, Y. Tamura, H. Kitamura, S. Takahashi, N. Masumori, K. Tanabe, N. Sato,<br />

T. Tsukamoto (Sapporo, Tokyo, Japan)<br />

* 604 Ischemic post-conditioning attenuates renal ischemic reperfusion injury via down-regulation of toll-like<br />

receptor 4<br />

B.O. Jiang, Q. Chen, D. Kong, X. Liu, Z. Chen (Xianning, Wuhan, China)<br />

605 Mechanisms of toll-like receptor 4 (TLR4)-mediated inflammation after cold ischemia/reperfusion in the<br />

kidney<br />

B.O. Jiang, Q. Chen, L. Hu, W. Zou, X. Liu (Xianning, Wuhan, China)<br />

606 Beneficial effect of a short-period of hypothermic pulsatile machine perfusion of warm ischemic kidneys<br />

just before the transplant. Experimental study<br />

B. Humanes-Sanchez, A. Lazaro-Fernandez, J.C. Jado, M. Mojena-Sanchez, D. Ramirez-Martin, C. Agra,<br />

E. Alvarez, J.F. Del Cañizo-Lopez, C. Hernandez-Fernandez, A. Tejedor-Jorge, E. Lledo-Garcia (Madrid, Spain)<br />

607 Experimental evaluation of renal oxygen consumption and antioxidant activity in the post-transplant<br />

period of kidneys with initial warm ischemia<br />

A. Lazaro-Fernandez, B. Humanes-Sanchez, M. Mojena, J.C. Jado, D. Ramirez-Martin, C. Agra,<br />

C. Hernandez-Fernandez, A. Tejedor-Jorge, E. Lledo-Garcia (Madrid, Spain)<br />

608 The fibrinopeptide Bβ 15-42 attenuates early ischemia reperfusion injury in the mouse kidney<br />

A. Urbschat, K. Zacharowski, N. Obermueller, K. Rupprecht, P. Paulus (Frankfurt am Main, Germany)<br />

609 Renoprotective effects of aliskiren following ischemia reperfusion injury<br />

F. Hammad, S. Al-Salam, L. Lubbad (Al Ain, United Arab Emirates)<br />

610 Comparison of the clinical outcome and systemic inflammatory marker levels between retroperitoneal and<br />

transperitoneal laparoscopic donor nephrectomy<br />

M. Saito, N. Tsuchiya, S. Narita, K. Numakura, S. Akihama, T. Inoue, S. Satoh, T. Habuchi (Akita, Japan)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

217<br />

Sunday


Sunday<br />

611 Change in renal function after donor nephrectomy: An assessment using TC 99m-DTPA glomerular filtration<br />

rate<br />

H.J. Cho, Y.S. Choi, W.J. Bae, J.H. Bae, S.J. Kim, S-H. Hong, J.Y. Lee, S.W. Kim, T-K. Hwang (Seoul, South<br />

Korea)<br />

* 612 Comparison of postoperative estimated glomerular filtration rate between donor and radical nephrectomy<br />

patients<br />

D.S. Kim, S. Jung, S.J. Lee, Y.Y. Park, S.H. Jeon (Seoul, South Korea)<br />

613 Post-transplant renal function is closely correlated with aortic calcification index (ACI) progression rate in<br />

renal transplant recipients<br />

S. Hatakeyama, T. Yoneyama, T. Koie, Y. Hashimoto, T. Fujita, R. Murakami, H. Saitoh, T. Funyu, S. Narumi,<br />

C. Ohyama (Hirosaki, Japan)<br />

218 <strong>Programme</strong> <strong>Book</strong>


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

15.45 - 17.15 Urological infections<br />

Amber Hall 7-8 - Level S2<br />

Poster Session 51<br />

Chairs: H.M. Çek, Istanbul (TR)<br />

R.S. Pickard, Newcastle upon Tyne (GB)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

614 Fournier’s gangrene: Prognostic aspects and predisposing risk factors<br />

G. Liguori, N. Pavan, A. Rinaldi, S. Bucci, M. Rizzo, S. Siracusano, C. Trombetta (Trieste, Italy)<br />

615 Comparison of different scoring systems for outcome prediction in patients with Fournier’s gangrene: Our<br />

experience with 50 patients<br />

A. Tuncel, T. Keten, Y. Aslan, M. Kayali, A. Erkan, M. Yildiz, A. Atan (Ankara, Turkey)<br />

616 Our experiences of Fournier’s gangrene: 71 cases<br />

T. Ziypak, S. Adanur, F. Ozkaya, T. Yapanoglu, G. Okyar (Erzurum, Turkey)<br />

617 Bacteremia during catheter manipulation: A prospective study<br />

A. Mohee, D. Gascoyne-Binzi, J. Sandoe, I. Eardley (Leeds, United Kingdom)<br />

618 Growth quantification and rapid drug susceptibility testing of uropathogenic Candida albicans by<br />

isothermal microcalorimetry<br />

G. Bonkat, L. Wernli, O. Braissant, M. Rieken, G. Müller, S. Wyler, T. Gasser, A. Bachmann (Basel,<br />

Switzerland)<br />

* 619 Effect of human papillomavirus and chlamydia trachomatis coinfection on sperm parameters in young<br />

heterosexual men with chronic prostatitis-related symptoms<br />

T. Cai, F. Wagenlehner, N. Mondaini, C. D’Elia, G. Malossini, S. Mazzoli, R. Bartoletti (Trento, Florence, Italy;<br />

Giessen, Germany)<br />

620 Diagnosis of bladder tuberculosis<br />

E. Kulchavenya (Novosibirsk, Russia)<br />

621 Phytotherapy in the prevention of recurrent uncomplicated urinary tract infection in women<br />

V.I. Vashchula, D.M. Nitkin, A.I. Viliukha (Minsk, Belarus)<br />

622 A prospective observational cohort study on patients with PSA levels ranging from 4 to 10 ng/ml at<br />

opportunistic screening: Management and responses to ciprofloxacin 1000 mg<br />

P. Verze, C. Imbimbo, D. Arcaniolo, M. Franco, R. Bianco, A. Palmieri, F. Mangiapia, V. Mirone (Naples, Italy)<br />

* 623 Bacterial motility and NF-κB activation by clinical isolates from urinary tract infections<br />

M. Lanz, C. Birchall, A.S.M. Ali, K. Walton, C.L. Townes, L.Y. Lim, S. Roushias, P. Aldridge, R.S. Pickard,<br />

J. Hall (Newcastle upon Tyne, United Kingdom)<br />

624 HPV-contamination of laser smoke during laser treatment of condylomata acuminata<br />

I. Akbarov, A. Tok, U. Wieland, U. Engelmann, S. Wille (Cologne, Germany)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

219<br />

Sunday


Sunday<br />

625 Predictors of admission in patients presenting to the emergency department with urinary tract infection<br />

J.D. Sammon, K.R. Ghani, S. Sukumar, J.O. Peabody, M. Menon, Q-D. Trinh (Detroit, United States of<br />

America)<br />

220 <strong>Programme</strong> <strong>Book</strong>


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

15.45 - 17.15 New and old minimally invasive BPH therapies<br />

Silver Hall - Level N2<br />

Poster Session 52<br />

Chairs: S. Madersbacher, Vienna (AT)<br />

K.M.L. Van Renterghem, Hasselt (BE)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion.<br />

626 NX-1207 for the treatment of lower urinary tract symptoms due to benign prostatic hyperplasia (BPH)<br />

N.D. Shore, R.F. Tutrone Jr. (Myrtle Beach, South Carolina, Baltimore, Maryland, United States of America)<br />

627 Effect of onabotulinum toxin type A intraprostatic injection on the outcome of BPH patients refractory to<br />

medical therapy: A 2-year study<br />

T. Gorgal Rodrigues De Carvalho, J. Silva, R. Pinto, P. Dinis, F. Cruz (Porto, Portugal)<br />

628 Clinical outcome of prostatic arterial embolization for patients with benign prostatic hyperplasia and<br />

moderate to severe lower urinary tract symptoms – 365 cases<br />

L. Campos Pinheiro, J. Pisco, H. Rio Tinto, T. Bilhim, L. Fernandes, M. Duarte, J. Preira, A. Gouveia Oliveira<br />

(Lisbon, Portugal)<br />

629 The Prostatic Urethral Lift (PUL), a minimal-invasive transurethrally-placed implant, proves its efficacy in<br />

the treatment of LUTS in patients with BPH in daily clinic practice outside of studies<br />

F. Miller, M. Schönthaler, R. Berges, C. Gratzke, B. Amend, J. Bedke, S. Kruck, J. Zumbé, U. Wetterauer,<br />

C. Stief, A. Stenzl, K-D. Sievert (Tübingen, Freiburg, Cologne, Munich, Leverkusen, Germany)<br />

630 The MediTate® temporary implantable nitinol device (TIND) proves safe and effective in relieving bladder<br />

outlet obstruction related to benign prostatic hyperplasia<br />

F. Porpiglia, D. Amparore, C. Fiori (Orbassano (Turin), Italy)<br />

631 Transurethral water vapor therapy for BPH; initial clinical results of the first in man trial and Rezūm I<br />

pilot study<br />

C. Dixon, E. Rijo Cedano, D. Pacik, V. Vit, G. Varga, L. Mynderse, D. Hanson, T. Larson (New York, Rochester,<br />

United States of America; La Romana, Dominican Republic; Brno, Czech Republic)<br />

632 The factors associated with occurrence and recovery of transient urinary incontinence after holmium laser<br />

enucleation of the prostate<br />

J-Y. Han, S-W. Park, L. Sang Don, M.K. Chung (Yangsan, South Korea)<br />

633 Evaluating the efficacy and impact on quality of life of 120 Watts KTP LASER for treating bladder outlet<br />

obstruction<br />

D. Kaushal (Taree, Australia)<br />

634 Photoselective vaporisation of the prostate using the 180W lithium triborate laser in the treatment of<br />

benign prostatic obstruction: An international multicenter experience<br />

A.S. Chung, A. Bachmann, E. Collins, F. Gomez Sancha, S. Tabatabaei, H.H. Woo (Sydney, Australia; Basel,<br />

Switzerland; San Francisco, Boston, United States of America; Madrid, Spain)<br />

635 Significant absorption of irrigation fluid is frequently detectable during high-power Greenlight laser<br />

vaporization of the prostate: Results from a prospective investigation using the expired breath ethanol test<br />

M.S. Wettstein, N. Grossmann, C.D. Fankhauser, L.J. Hefermehl, J.C. Capol, M. Zimmermann, T. Sulser,<br />

A. Müller, T. Hermanns (Zürich, Switzerland)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

221<br />

Sunday


Sunday<br />

636 Thulium VapoEnucleation of the prostate in patients on oral anticoagulation<br />

C. Netsch, M. Stöhrer, S. Knipper, T. Bach, T.R.W. Herrmann, A.J. Gross (Hamburg, Hanover, Germany)<br />

637 Extent of tissue ablation following pure transurethral bipolar plasma vaporization compared to monopolar<br />

resection of the prostate: 12 months-results of a transrectal three-dimensional ultrasound volumetry study<br />

B. Kranzbühler, O. Gross, C.D. Fankhauser, M.S. Wettstein, N. Grossmann, L.J. Hefermehl, C. Poyet, R. Largo,<br />

M. Zimmermann, T. Sulser, A. Müller, T. Hermanns (Zürich, Switzerland)<br />

638 Greenlight HPS-120W vs Greenlight XPS-180W laser vaporization of the prostate for benign prostatic<br />

hyperplasia: A global, multi-center, and prospective comparative analysis according to prostate size<br />

P.A. Hueber, D. Liberman, T. Ben-Zvi, H. Woo, M.A. Hai, A.E. Te, B. Chughtai, R. Lee, M. Rutman,<br />

R.R. Gonzalez, N. Barber, K.C. Zorn (Montreal, Canada; Sydney, Australia; Wayne, New York, Houston,<br />

United States of America; Frimley, Surrey, United Kingdom)<br />

222 <strong>Programme</strong> <strong>Book</strong><br />

Summary and outlook<br />

S. Madersbacher, Vienna (AT)


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

15.45 - 17.15 Paediatric urology developments<br />

Red Hall 1 - Level N1<br />

Poster Session 53<br />

Chairs: G.A. Bogaert, Leuven (BE)<br />

S. Tekgül, Ankara (TR)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

639 Pediatric extreme weight kidney transplantation<br />

M. Musquera Felip, A. Vila, L. Peri, M. Piqueras, R. Alvarez-Vijande, L. Garcia, J.A. Camacho, A. Alcaraz<br />

(Barcelona, Spain)<br />

* 640 Long-term follow up of adult female patients (16-28 years old) with history of bladder exstrophy (BE)<br />

repair in childhood: Urological and fertility function outcome<br />

H.K. Salem, M. Eisa (Giza Cairo, Egypt)<br />

641 Withdrawn<br />

* 642 Continent ileal tube technique: A simple catheterizable channel construction using ileum when appendix is<br />

not available<br />

S. Tekgul, H.S. Dogan, A. Koni, M. Hascicek (Ankara, Turkey)<br />

643 Histologic responses of different bulking agents which are used for endoscopic reflux treatment, on rats’<br />

bladder and subcutanous tissue<br />

A.C. Bozaci, F.T. Aki, D. Zeybek, S. Muftuoglu, H.S. Dogan, S. Tekgul (Ankara, Turkey)<br />

644 Endoscopic treatment of occult vesicoureteric reflux significantly reduces risk of febrile urinary tract<br />

infection<br />

R. Pichler, C. Berger, D. Oswald, T. Becker, M. Koen, I. Heidegger, A. Strasak, B. Schlenck, W. Horninger,<br />

J. Oswald (Innsbruck, Linz, Salzburg, Austria)<br />

645 Previous endoscopic injection significantly reduces reimplantation success: Critical retrospective analysis<br />

of 398 patients<br />

A.C.B. Bozaci, B. Ozdemir, S. Tonyali, H.S. Dogan, S. Tekgul (Ankara, Turkey)<br />

646 Can factors affecting complication rates for urethral reimplantation be predicted? Use of Clavien<br />

classification system in pediatric population<br />

E. Süer, C. Özcan, M. Mermerkaya, E. Öztürk, Ö. Gülpınar, B. Burgu, T. Soygür (Ankara, Turkey)<br />

647 Effects of transforming growth factor on the developing embryonic ureter: An in-vitro megaureter model<br />

in mice<br />

E. Öztürk, B. Burgu, Ö. Gülpınar, T. Soygür (Ankara, Turkey)<br />

648 Long term follow-up after transurethral treatment of infravesical obstruction in boys<br />

P.M.L. Hennus, J.H. Kieft, E. Hoenjet, S.P. Rynja, T.P.V.M. Jong, J.L.H.R. Bosch, L.M.O. De Kort (Utrecht, The<br />

Netherlands)<br />

649 The impact of internal spermatic artery preservation during laparoscopic varicocelectomy on recurrence<br />

and catch-up growth rate in adolescent<br />

S. Park, L. Chunwoo, S. Sang Hoon, L. Hunju, M. Kyung Hyun, K. Kun Suk (Ulsan, Seoul, South Korea)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

223<br />

Sunday


Sunday<br />

650 Comparative analysis of the long-term oncological results of radical nephrectomy after chemotherapy by<br />

the videolaparoscopic technique with those of the open technique, for the treatment of Wilms’ tumor<br />

R. Duarte, F.T. Denes, L.M. Cristofani, A.M. Giron, V. Odone-Filho, U. Tannuri, M. Srougi (Sao Paulo, Brazil)<br />

224 <strong>Programme</strong> <strong>Book</strong>


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

15.45 - 17.15 Stones: ESWL, epidemiology and training<br />

Red Hall 2 - Level N1<br />

Poster Session 54<br />

Chairs: M.R. Desai, Naidad (IN)<br />

J. Rassweiler, Heilbronn (DE)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

651 Transient potential cation channel V4 (TRPV4) is involved in regulation of intraluminal pressure of the<br />

normal and obstructed ureter<br />

N. Fossati, L. Villa, R. Buono, F. Benigni, P. Zygmunt, P. Hedlund (Milan, Italy; Lund, Sweden)<br />

* 652 Effect of tadalafil and diltiazem on ESWL induced kidney injury in rats<br />

H. Vuruskan, B. Aytac, G. Ozmerdiven, M. Danısoglu, H. Kilicarslan (Bursa, Turkey)<br />

653 In vivo stone comminution produced by a modified acoustic lens for electromagnetic lithotripters<br />

A. Neisius, N. Smith, N. Kuntz, T. Schykowski, G. Astroza, M. Lipkin, W. Simmons, G. Preminger, P. Zhong<br />

(Durham, United States of America)<br />

* 654 Procedural performance and assessment of technical skills in percutaneous renal access: Using an<br />

assessment tool in Virtual Reality Perc-Mentor trainer<br />

F. Zaman, I. Junaid, S. Kachrilas, A. Goyal, A. Bourdoumis, C. Bach, N. Buchholz, J. Masood (London, United<br />

Kingdom)<br />

655 Construction and validation of a novel indigenous PCNL simulator: An innovative approach to training<br />

A.V. Rawandale, L.G. Patani, P.A. Patil (Dhule, India)<br />

656 Improved porcine ex-vivo organ model for percutaneous renal surgery (sandwich-model) using a<br />

laparoscopy-training-box (SITUS Box)<br />

S. Jutzi, F. Imkamp, M.A. Kuczyk, M. Wolters, M. Stoehrer, S. Kruck, U. Walcher, U. Nagele, T.R.W. Herrmann<br />

(Hanover, Tübingen, Germany; Hall, Austria)<br />

657 It’s getting hot in here! Monthly variation in emergency department visits for upper urinary tract calculi in<br />

the United States<br />

K.R. Ghani, J.D. Sammon, S. Sukumar, W. Jeong, J.O. Peabody, M. Menon, Q-D. Trinh (Detroit, United States<br />

of America)<br />

* 658 Percutaneous nephrolithotomy in England: Practice and outcomes described in the Hospital Episode<br />

Statistics database<br />

J.N. Armitage, J. Withington, J.H.P. Van Der Meulen, D. Cromwell, J. Glass, W.G. Finch, S.O. Irving,<br />

N.A. Burgess (Cambridge, London, Norwich, United Kingdom)<br />

* 659 Trends in utilization and outcomes for percutaneous nephrolithotomy in the United States<br />

K.R. Ghani, J.D. Sammon, S. Sukumar, D. Pucheril, R. Littleton, J.O. Peabody, N. Bhojani, M. Menon,<br />

Q-D. Trinh (Detroit, United States of America; Montreal, Canada)<br />

660 Use of flexible ureteroscopy in the clinical practice for the treatment of renal stones: Results from a large<br />

European survey<br />

F. Sanguedolce, E. Liatsikos, P. Verze, S. Hruby, A. Breda, M. Binbay, T. Knoll (London, United Kingdom;<br />

Patras, Greece; Naples, Italy; Salzburg, Austria; Barcelona, Spain; Istanbul, Turkey; Sindelfingen, Germany)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

225<br />

Sunday


Sunday<br />

661 Treatment response in stone patients with gouthy diathesis stratified by BMI<br />

G. Astroza, A. Neisius, M. Tsivian, N. Kuntz, M. Iqbal, G. Preminger, M. Lipkin (Santiago, Chile; Durham,<br />

United States of America)<br />

662 Relief more than 2 weeks after ureteral obstruction is a risk factor for long-term renal function<br />

deterioration<br />

G. Lucarelli, P. Ditonno, R. De Nola, A. Vavallo, M. Rutigliano, M. Spilotros, S. Impedovo, C. Bettocchi,<br />

F.P. Selvaggi, M. Battaglia (Bari, Italy)<br />

226 <strong>Programme</strong> <strong>Book</strong>


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

15.45 - 17.15 From bench to bedside in pain and OAB<br />

Blue Hall 1-2 - Level N1<br />

Poster Session 55<br />

Chairs: A. Giannantoni, Perugia (IT)<br />

K. Monastyrskaya, Berne (CH)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

663 Significant biomarker for lower urinary tract symptoms or pain from chronic prostatitis<br />

K. Shigemura, F. Yamamichi, M. Matsumoto, T. Shirakawa, H. Miyake, S. Arakawa, K. Tanaka, M. Fujisawa<br />

(Kobe, Japan)<br />

664 Cytokine responses in BPS/IC type 3C<br />

Y. Logadottir, C. Lindholm, I. Gjertsson, M. Fall, D. Delbro, R. Peeker (Gothenburg, Örebro, Sweden)<br />

665 Chronic pelvic pain syndrome in men is associated with reduction of relative gray matter volume in the<br />

anterior cingulate cortex compared to healthy controls<br />

L. Mordasini, C. Weisstanner, C. Rummel, G.N. Thalmann, R.K. Verma, R. Wiest, T.M. Kessler (Berne,<br />

Switzerland)<br />

666 Therapeutic efficacy of narrow band imaging-assisted transurethral electrocoagulation for ulcer-type<br />

interstitial cystitis/painful bladder syndrome<br />

M. Kajiwara, S. Inoue, K. Kobayashi, S. Ohara, J. Teishima, A. Matsubara (Hiroshima, Japan)<br />

667 Laser ablation of leukoplakia of the bladder<br />

S.K. Al-Shukri, M.N. Slesarevskaya, A.V. Zharkikh, A. Sokolov (St. Petersburg, Russia)<br />

668 Posterior tibial nerve stimulation (PTNS) for treatment of non-neurogenic detrusor overactivity and chronic<br />

pelvic pain<br />

M. Aggamy, M.A. Gomha, A. Aldayel, R. Almousa, A. Abdelbary, A. Masoud (Dammam, Saudi Arabia;<br />

Benisuef, Egypt)<br />

669 Ulcerative and non-ulcerative forms of BPS/IC have a similar response to trigonal onabotulinum toxin A<br />

injection<br />

R.M. Correia De Almeida Pinto, T. Antunes Lopes, J. Alturas Silva, C. Martins Silva, P. Dinis, F. Cruz (Porto,<br />

Portugal)<br />

670 The efficacy and safety of a multimodal therapy for chronic prostatitis/chronic pelvic pain: A prospective<br />

randomized study<br />

A. Giannantoni, S. Proietti, M. Gubbiotti, J.A. Rossi De Vermandois, M. Porena (Perugia, Rozzano, Italy)<br />

671 Efficacy of Canephron® N against bacterial adhesion, inflammation and bladder hyperactivity<br />

G. Künstle, C. Brenneis, J. Haunschild (Neumarkt, Germany)<br />

* 672 Urinary brain-derived neurotrophic factor (BDNF) level does not correlate with detrusor overactivity<br />

A. Bhide, V. Gopalan, R. Cartwright, A. Digesu, F. Puccini, C. De Nunzio, A. Tubaro, V. Khullar (London,<br />

United Kingdom; Rome, Italy)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

227<br />

Sunday


Sunday<br />

* 673 Urinary levels of neurotrophins differ between women with stress urinary incontinence and women with<br />

urgency urinary incontinence<br />

T. Antunes Lopes, R. Pinto, S. Carvalho-Barros, C.M. Silva, C.D. Cruz, F. Cruz (Porto, Portugal)<br />

228 <strong>Programme</strong> <strong>Book</strong><br />

Discussion on posters 672 & 673<br />

A. Giannantoni, Perugia (IT)


Sunday, 17 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

15.45 - 17.15 Androgen deprivation therapy, still to improve..<br />

Yellow Hall 1-2-3 - Level N1<br />

Poster Session 56<br />

Chairs: F. Calais Da Silva Junior, Lisbon (PT)<br />

L.N. Türkeri, Istanbul (TR)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

* 674 Enzalutamide monotherapy: Results from a phase 2 study in hormone naive prostate cancer patients<br />

B. Tombal, M. Borre, P. Rathenborg, P. Werbrouck, A. Heidenreich, P. Iversen, E. Baskin-Bey, F. Perabo,<br />

D. Phung, M.R. Smith (Brussel, Kortrijk, Belgium; Skejby, Herlev, Copenhagen, Denmark; North-Rhine<br />

Westphalia, Germany; Staines, United Kingdom; Northbrook, Boston, United States of America; Leiderdorp,<br />

The Netherlands)<br />

* 675 Survival and metastases among non-metastatic prostate cancer patients treated with androgen<br />

deprivation therapy (ADT) in Denmark, 1997-2010<br />

M. Nguyen-Nielsen, M.L. Maegbaek, R.K. Hernandez, H.T. Sørensen, V. Ehrenstein, A. Liede (Århus,<br />

Denmark; Thousand Oaks, South San Francisco, United States of America)<br />

676 Polymorphisms of androgen transporting gene SLCO2B1 may participate in hormone-resistance and ethnic<br />

difference in response to androgen deprivation therapy<br />

N. Fujimoto, T. Kubo, H. Bui, T. Yoshida, T. Matsumoto (Kitakyushu, Japan)<br />

677 Lower risk of cardiovascular (CV) events and death in men receiving ADT by gonadotropin releasing<br />

hormone (GnRH) antagonist, degarelix, compared with luteinising hormone-releasing (LHRH) agonists<br />

B. Tombal, P. Albertsen, A. De La Taille, E. Van Der Meulen, B-E. Persson, T.K. Olesen, J. Nilsson (Brussels,<br />

Belgium; Farmington, United States of America; Paris, France; Copenhagen, Denmark; St Prex, Switzerland;<br />

Lund, Sweden)<br />

678 Disease control-related outcomes from an analysis of six comparative randomised clinical trials of<br />

degarelix versus luteinising hormone-releasing hormone (LHRH) agonists<br />

K. Miller, E.D. Crawford, N. Shore, C. Karup, E. Van Der Meulen, B-E. Persson (Berlin, Germany; Aurora,<br />

Myrtle Beach, United States of America; Copenhagen, Denmark; St Prex, Switzerland)<br />

679 PSA patterns during off-time treatment period in patients undergoing intermittent androgen deprivation.<br />

Is PSA doubling time reliable in every case?<br />

R.E. Sanchez Salas, D. Prapotnich, F. Olivier, M. Fhima, P. Descamps, S. David, F. Secin, E. Barret,<br />

M. Galiano, F. Rozet, X. Cathelineau (Paris, France; Buenos Aires, Argentina)<br />

680 Intermittent versus continuous cyproterone acetate in bone metastatic prostate cancer: Results of a<br />

randomized trial<br />

P.C.M.S. Verhagen, M.F. Wildhagen, A.M. Verkerk, W.A.B.M. Bolle, E. Vjaters, H. Pagi, L. Kukk, D. Bratus,<br />

R. Fiala, C.H. Bangma, F.H. Schröder, G.H. Mickisch (Rotterdam, The Netherlands; Riga, Latvia; Tallinn,<br />

Estonia; Maribor, Slovenia; Olomouc, Czech Republic; Bremen, Germany)<br />

681 Correlation between information provided by urologists and messages understood by patients when<br />

starting androgen blockade for advanced prostate cancer<br />

T. Lebret, B. Duclos-Morlaes, D. Comet, S. Droupy (Suresnes, Levallois-Perret, Nanterre, Nîmes, France)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

229<br />

Sunday


Sunday<br />

682 When to start antiresorptive treatment in prostate cancer patients on androgen suppression<br />

D. Lorente Garcia, J. Planas, A. Celma, F. Agreda, C. Konstantinidis, I. Iztueta, J. Placer, J. Morote, G. Encabo<br />

(Barcelona, Spain)<br />

683 Androgen deprivation therapy improve disease free survival in patients treated with salvage radiotherapy<br />

- a national Danish study<br />

M. Ervandian, M. Høyer, S. Elleberg Petersen, L. Sengeløv, S. Hansen, M. Holmberg, J. Svejstrup, P. Meidahl<br />

Petersen, M. Borre (Århus, Herlev, Odense, Aalborg, Copenhagen, Denmark)<br />

684 Digoxin lowers the incidence of prostate cancer - a nationwide population-based study<br />

W.J. Huang, W.Y.H. Chang, W.C.P. Lin, A.T.L. Lin, K.K. Chen (Taipei, Taiwan)<br />

230 <strong>Programme</strong> <strong>Book</strong><br />

Summary on androgen deprivation therapy and its side effects<br />

L.N. Türkeri, Istanbul (TR)


Sunday, 17 March - Sponsored Sessions<br />

Workshop Overview<br />

17.45 - 19.15 Urinary incontinence - Optimising the patient experience and improving outcomes page 409<br />

Amber Hall 6 - Level S2 Sponsored by ALLERGAN and PORGÈS, a COLOPLAST division<br />

Symposia Overview<br />

17.45 - 19.15 Management of OAB: Electing the right candidate for the right patient page 410<br />

eURO Auditorium - Level S2 Sponsored by ASTELLAS<br />

17.45 - 19.15 Nocturia: Definitive diagnosis for better patient outcomes page 411<br />

Yellow Hall 1-2-3 - Level N1 Sponsored by FERRING PHARMACEUTICALS<br />

17.45 - 19.15 Towards individualisation of prostate cancer treatments: From bench to bedside page 412<br />

Brown Hall 3 - Level S2 Sponsored by IPSEN<br />

17.45 - 19.15 Clinical conundrums in the treatment of metastatic castration-resistant prostate cancer page 413<br />

Silver Hall - Level N2 Sponsored by JANSSEN PHARMACEUTICAL COMPANIES OF JOHNSON & JOHNSON<br />

17.45 - 19.15 Burden of illness and optimal management of recurrent cystitis page 414<br />

Amber Hall 1-2 - Level S2 Sponsored by OM PHARMA SA<br />

17.45 - 19.15 BPH and inflammation, from lab to clinic page 415<br />

Red Hall 1 - Level N1 Sponsored by PIERRE FABRE MEDICAMENT<br />

17.45 - 19.15 Silodosin: A first choice for the pharmacological treatment of BPH page 416<br />

Brown Hall 1-2 - Level S2 Sponsored by RECORDATI<br />

17.45 - 19.15 Focal therapy in localised prostate cancer page 417<br />

Amber Hall 7-8 - Level S2 Sponsored by STEBA BIOTECH<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

231<br />

Sunday


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Plenary Session 3<br />

07.30 - 11.00 Lower urinary tract management: How to balance benefits with<br />

side-effects<br />

eURO Auditorium - Level S2<br />

Chairs: P. Radziszewski, Warsaw (PL)<br />

M. Wirth, Dresden (DE)<br />

07.30 - 08.00 Highlight Session 2<br />

Oncology<br />

A.S. Merseburger, Hanover (DE)<br />

Stone disease<br />

P. Chlosta, Wroclaw (PL)<br />

Andrology<br />

M. Fode, Herlev (DK)<br />

08.00 - 08.05 Introduction to the plenary session<br />

M. Wirth, Dresden (DE)<br />

08.05 - 08.25 Update Pelvic floor anatomy for urologists<br />

H. Fritsch, Innsbruck (AT)<br />

Aims and objectives<br />

It is common knowledge that the pelvis displays the most marked skeletal differences between males and<br />

females; hence, the anatomy of the male and female pelvic floor differs widely as to the striated muscles,<br />

the urinary organs, the striated sphincters and the subperitoneal connective tissue as well as topographical<br />

relationships. These differences will be pointed out thoroughly with regard to urinary continence.<br />

08.25 - 09.05 Debate The role of urodynamic assessment in contemporary practice<br />

Moderator: M. Lucas, Swansea (GB)<br />

What do we mean by urodynamics?<br />

M. Lucas, Swansea (GB)<br />

Pro - Invasive urodynamics are essential in all patients undergoing surgical intervention<br />

P. Abrams, Bristol (GB)<br />

Con - Invasive urodynamics are essential in all patients undergoing surgical intervention<br />

S. Herschorn, Toronto (CA)<br />

Aims and objectives<br />

Urodynamic testing has become, over a period of 30 years, an accepted part of the workup of patients before<br />

surgery for either urinary incontinence or prostatic obstruction. The framework of thinking that they provide<br />

about bladder and urethral function underpins our understanding of the pathophysiology, and the way we<br />

plan treatment.<br />

However, recent statements and new trials have raised questions about the clinical utility of urodynamics.<br />

Are they essential? Are they worthless? - or can their use be rationalised according to the clinical problem?<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

233<br />

Monday


Monday<br />

09.05 - 09.25 American Urological Association (AUA) Lecture Cellular-based therapy of urinary incontinence<br />

234 <strong>Programme</strong> <strong>Book</strong><br />

L. Rodriguez, Los Angeles (US)<br />

Aims and objectives<br />

The aim of the lecture is to provide an update on the scientific advances made to date in cellular and stem<br />

cell based therapies for the treatment of urinary incontinence. Available laboratory, pre-clinical and human<br />

data will be reviewed. The objectives of the lecture are: 1) To help understand the clinical problem of SUI,<br />

2) To help familiarise the audience with the potential benefits and pitfalls of stem cell based therapies, 3)<br />

To provide an update on the current state of the art of cell based therapies for the treatment of urinary<br />

incontinence.<br />

09.25 - 10.05 Case discussion Sling, sphincter or balloon for male urinary incontinence<br />

Moderator: J.W. Thüroff, Mainz (DE)<br />

Sphincter K-D. Sievert, Tübingen (DE)<br />

Balloon E. Chartier-Kastler, Paris (FR)<br />

Sling P. Rehder, Innsbruck (AT)<br />

Aims and objectives<br />

The case discussion panel on surgical treatment options for male sphincteric incontinence aims at providing<br />

detailed insight into mechanism of action of the different surgical strategies and their respective advantages<br />

and disadvantages. This will eventually translate into defining criteria and/or tests for securing the indications<br />

for each surgical technique and their respective limitations (contra-indications). Clinical examples are<br />

presented and the best possible solutions for the individual cases are discussed.<br />

10.05 - 10.45 Debate What the practising urologist needs to know about new therapies for LUTS. When, where and how<br />

do they work?<br />

Moderator: C.R. Chapple, Sheffield (GB)<br />

Introduction to new therapies for lower urinary tract symptoms - setting the scene<br />

C.R. Chapple, Sheffield (GB)<br />

PDE5 inhibitors in the management of LUTS<br />

M. Oelke, Hanover (DE)<br />

Beta-3 agonist therapy<br />

C.R. Chapple, Sheffield (GB)<br />

Botulinum toxin therapy - which agent?<br />

T.M. Kessler, Zürich (CH)<br />

New avenues (neurotoxins and combination therapy) in treating the “BPH” patient<br />

M.J. Speakman, Taunton (GB)<br />

Discussion on how these new approaches relate to contemporary therapy<br />

Aims and objectives<br />

To provide the practising clinician with a comprehensive update on what they need to know about the latest<br />

new therapies for LUTS.<br />

The participants will provide a detailed overview on how these therapies are thought to work and the<br />

evidence base relating to their use.<br />

These treatments will be discussed against the backdrop of existing therapy and a detailed discussion will<br />

be held as to:-<br />

• the role of these therapies in the context of existing pharmacotherapy, will they replace it and if so in which<br />

patients<br />

• how they are thought to exert their effect


• what the potential is for combination therapy using existing agents and do these therapies add further<br />

possibilities<br />

Take home message<br />

A clear understanding on contemporary pharmacotherapy for both the male and female patient with LUTS<br />

and how to most effective treat them in <strong>2013</strong>.<br />

10.45 - 11.00 State-of-the-art lecture Is TURP the gold standard for benign prostatic obstruction?<br />

M. Marberger, Vienna (AT)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

235<br />

Monday


Monday<br />

Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

236 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

07.30 - 09.00 Miscellaneous<br />

Brown Hall 3 - Level S2<br />

Video Session 7<br />

Chairs: P. Albers, Düsseldorf (DE)<br />

I. Eardley, Leeds (GB)<br />

All presentations have a maximum length of 10 minutes, followed by 4 minutes of discussion.<br />

V49 Laparoscopic living donor nephrectomy with the use of 3 mm instruments and laparoscope: Early<br />

experience at a tertiary center<br />

A. Breda, G. Lucarelli, O. Rodriguez-Faba, L. Gausa, J. Ponce De Leon, H. Villavicencio (Barcelona, Spain)<br />

V50 Right-sided terminal hand assisted laparoscopic donor nephrectomy. The Halle experience<br />

G. Pini, N. Mohammed, F. Greco, A. Schumann, F. Kawan, L. Ascalone, K. Weigand, P. Fornara (Halle,<br />

Germany)<br />

V51 Robotic microsurgical targeted denervation of the spermatic cord for chronic groin pain<br />

A. Gudeloglu, J. Brahmbhatt, K. Priola, S. Parekattil (Winter Haven, United States of America)<br />

V52 Robotic assisted microsurgical vasectomy reversal<br />

J. Brahmbhatt, A. Gudeloglu, K. Priola, S. Parekattil (Winter Haven, United States of America)<br />

V53 Laparoscopic resection of a large functional paraganglioma in the organ of Zuckerkandl (PZ)<br />

D. Veneziano, O. Sicuro, E. Sgrò, L. Carbone, P. Cozzupoli (Reggio Calabria, Italy)<br />

V54 Modified surgical reconstructive technique in male-to-female gender reassignment minimizes<br />

postoperative risks and improves final outcome<br />

B. Amend, J. Seibold, A. Stenzl, K-D. Sievert (Tübingen, Germany)<br />

V55 Use of bowel for savage vaginoplasty in male to female transsexual<br />

C. Trombetta, C. Imbimbo, G. Liguori, P. Verze, N. Pavan, V. Mirone (Trieste, Naples, Italy)<br />

V56 Corpora cavernosa reconstruction with porcine dermal matrix graft and inflatable penile prosthesis<br />

implant in a case of massive, post-infective penile fibrosis<br />

F. Colombo, G. Gentile, R. Djinovic, A. Franceschelli (Bologna, Italy; Belgrade, Serbia)


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

09.15 - 10.45 Management of high risk prostate cancer<br />

Brown Hall 1-2 - Level S2<br />

Poster Session 57<br />

Chairs: M. Ramirez Backhaus, Valencia (ES)<br />

T. Wiegel, Ulm (DE)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

685 Risk-factors for biochemical recurrence- and clinical metastasis-free survival in D’Amico high-risk patients<br />

after radical prostatectomy<br />

A. Becker, P. Tennstedt, T. Steuber, M. Graefen, H. Heinzer (Hamburg, Germany)<br />

* 686 Association between time to biochemical recurrence and cancer specific and other cause mortality in men<br />

with high risk prostate cancer treated with radical prostatectomy without adjuvant treatments. A multiinstitutional<br />

analysis<br />

M. Bianchi, J.R. Karnes, S. Joniau, M. Spahn, P. Gontero, F.K. Chun, J. Hansen, G. Marchioro, F. Abdollah,<br />

B. Tombal, U. Capitanio, P. Bastian, H. Van Der Poel, R. Sanchez-Salas, A. Briganti (Milan, Turin, Novara,<br />

Italy; Rochester, United States of America; Leuven, Brussels, Belgium; Berne, Switzerland; Hamburg,<br />

Munich, Germany; Amsterdam, The Netherlands; Paris, France)<br />

687 A competing-risks analysis of survival after alternative treatment modalities for locally advanced prostate<br />

cancer patients: A population-based study<br />

F. Abdollah, M. Bianchi, N.M. Passoni, A. Nini, P. Dell’Oglio, S. Corti, R. Colombo, C. Cozzarini, R. Damiano,<br />

N. Di Muzio, M. Sun, A. Briganti (Milan, Catanzaro, Italy; Montreal, Canada)<br />

* 688 Predicting prostate cancer specific outcome after radical prostatectomy among men with (very) high-risk,<br />

locally advanced PCa with or without additional high risk factors: A multi-institutional retrospective cohort<br />

study of 1644 patients<br />

S. Joniau, A.R. Alberts, F. Moltzahn, A. Briganti, J. Karnes, P. Gontero, E. Weyne, C-Y. Hsu, G. Marchioro,<br />

B. Tombal, J. Chun, P. Bastian, H. Van Der Poel, R. Sanchez-Salas, M. Spahn (Leuven, Brussels, Belgium;<br />

Berne, Switzerland; Milan, Turin, Novara, Italy; Rochester, United States of America; Puli, Taiwan; Hamburg,<br />

Munich, Germany; Amsterdam, The Netherlands; Paris, France)<br />

689 Impact of surgery delay in patients diagnosed with high grade prostate cancer<br />

S. Samavedi, H. Abdul-Muhsin, O. Schatloff, K. Palmer, G. Ebra, V. Patel (Celebration, United States of<br />

America)<br />

690 Can immediate adjuvant therapy be avoided in patients with prostate specimen Gleason ≥ 8, organ<br />

confined disease, absence of positive lymph nodes and surgical margins, who undergo robot-assisted<br />

laparoscopic radical prostatectomy?<br />

A.P. Labanaris, V. Zugor, J.H. Witt (Gronau, Germany)<br />

691 Comparison of the survival rate between prostate cancer patients with Gleason score 8 and those with<br />

score 9 or higher for different therapeutic approaches<br />

H.K. Ha, J.Y. Ku, J.H. Ahn, S.M. Kang, C.H. Lee, S.D. Kim, T.S. Kim, J.H. Yoon, M.K. Chung, D.S. Kim,<br />

J.M. Chung, J.Z. Lee (Busan, South Korea)<br />

692 Radio-guided surgery: Our experience in sentinel lymph node removal in prostate cancer<br />

M. Grasso, S. Blanco, A.A.C. Grasso, G. Bovo, A. Crespi, M. Arosio (Monza, Milan, Italy)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

237<br />

Monday


Monday<br />

693 External validation of the updated nomogram predicting lymph node invasion in patients with prostate<br />

cancer undergoing extended pelvic lymph node dissection<br />

M. Gacci, M. Lanciotti, R. Schiavina, L. Masieri, S. Serni, V. Vagnoni, F. Abdollah, M. Carini, G. Martorana,<br />

F. Montorsi (Florence, Bologna, Milan, Italy)<br />

694 Prediction of long-term cancer recurrence after radical prostatectomy in patients with lymph node<br />

invasion: Results of conditional survival analysis<br />

F. Abdollah, A. Briganti, F. Castiglione, N. Suardi, C. Cozzarini, N. Di Muzio, R. Lucianò, G. Gandaglia,<br />

A. Nini, G. Zanni, M. Freschi, J. Karnes (Milan, Italy; Rochester, United States of America)<br />

695 Impact of stage migration on node positive prostate cancer rate and features: A 20-year, single institution<br />

analysis in men treated with extended pelvic lymph node dissection<br />

N. Fossati, F. Abdollah, A. Gallina, U. Capitanio, N. Suardi, A. Salonia, L. Villa, M. Tutolo, E. Di Trapani, V. Di<br />

Girolamo, V. Scattoni, G. Guazzoni, P. Rigatti, A. Briganti (Milan, Italy)<br />

696 10 year German experience of cryoablation for primary high risk localized prostate cancer using 17 gauge<br />

cryoneedles technology<br />

U. Witzsch, W. Dillenburg, E. Becht (Frankfurt am Main, Germany)<br />

238 <strong>Programme</strong> <strong>Book</strong>


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

09.15 - 10.45 Urothelial cancer treatment: Intravesical approaches<br />

Brown Hall 3 - Level S2<br />

Poster Session 58<br />

Chairs: A. Noon, Sheffield (GB)<br />

M. Rouprêt, Paris (FR)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

697 Prognostic factors and risk groups in T1G3 patients initially treated with BCG: Results of a multicenter<br />

retrospective series in 1743 patients<br />

P. Gontero, R. Sylvester, F. Pisano, S. Joniau, K. Van Der Eeckt, V. Serretta, S. Larré, S. Di Stasi, B. Van Rhijn,<br />

A. Witjes, A. Grotenhuis, R. Colombo, A. Briganti, M. Babjuk, V. Soukup, P.U. Malmstrom, J. Irani, N. Malats,<br />

J. Baniel, R. Mano, T. Cai, E. Cha, P. Ardelt, J. Varkarakis, R. Bartoletti, M. Spahn, G. Dalbagni, S. Shariat,<br />

J. Karnes, J. Palou (Turin, Palermo, Rome, Milan, Trento, Florence, Italy; Brussels, Leuven, Belgium; Oxford,<br />

United Kingdom; Amsterdam, Nijmegen, The Netherlands; Prague, Czech Republic; Uppsala, Sweden;<br />

Poitiers, France; Madrid, Barcelona, Spain; Tel Aviv, Israel; New York, Rochester, United States of America;<br />

Freiburg, Würzburg, Germany; Athens, Greece)<br />

698 Intravesical sequential BCG and electromotive mitomycin versus BCG alone for stage pT1 urothelial bladder<br />

cancer<br />

S.M. Di Stasi, C. Verri, E. Liberati, F. Masedu, M. Valenti (Rome, L’Aquila, Italy)<br />

699 A prospective comparative study of intravesical Bacillus Calmette-Guérin therapy for non-muscle invasive<br />

bladder cancer: Tokyo strain vs Connaught strain<br />

A. Sengiku, M. Ito, Y. Miyazaki, H. Sawazaki, T. Takahashi, K. Ogura (Otsu, Japan)<br />

700 Results of a phase-1 dose escalation study of intravesical TMX-101 in patients with non-muscle invasive<br />

bladder cancer<br />

J. Falke, J.M. Lammers, H.C. Arentsen, M. Ravic, R. Pozzi, E.B. Cornel, H. Vergunst, T.M. De Reijke, J.A. Witjes<br />

(Nijmegen, Hengelo, Amsterdam, The Netherlands; London, United Kingdom; Bioggio, Switzerland)<br />

701 Statin use is not associated with prognosis or BCG-response in patients with non-muscle invasive bladder<br />

cancer<br />

E.N. Xylinas, J.J Crivelli, L.A Kluth, N. Passoni, S. Holmang, P.I. Karakiewicz, E. Comploj, A. Pycha, Y. Lotan,<br />

M. Zerbib, D.S. Scherr, S.F. Shariat (New York, Dallas, United States of America; Milan, Bolzano, Italy;<br />

Gothenburg, Sweden; Montreal, Canada; Paris, France)<br />

702 Is there any influence on the real number of BCG instillations applied on the outcome of high-grade nonmuscle-invasive<br />

bladder cancer (NMIBC)?<br />

J.A. Portillo Martin, R. Madero, E. Solsona, J.M. Fernández, L. Martínez-Piñeiro, M. Montesino, M. Unda,<br />

A. Ojea, J. Rodríguez, J. Palou, J.A. Martínez-Piñeiro (Santander, Madrid, Valencia, Oviedo, Pamplona,<br />

Bilbao, Vigo, Barcelona, Spain)<br />

703 Flow cytometry based immunoassay to monitor the BCG-therapy of the non muscle invasive bladder<br />

cancer<br />

J. Elsaesser, M. Janssen, F. Becker, H. Suttmann, C-H. Ohlmann, U. Sester, M. Stöckle, M. Sester (Homburg,<br />

Neunkirchen, Hamburg, Germany)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

239<br />

Monday


Monday<br />

704 Tumour recurrence and intravesical BCG significantly impact upon health related quality of life in patients<br />

undergoing conservative management for superficial bladder cancer<br />

N. Sapre, A. Wooten, H. Siddons, A.J. Costello, C.M. Hovens, N.M. Corcoran, P. Anderson (Melbourne,<br />

Australia)<br />

705 BCG induced bladder and systemic adverse events assessed by weekly self-administered questionnaire<br />

can predict SAEs and course interruption<br />

B. Tamarelle, A. Picard, N. Arfi, A. Pages, X. Martin, M. Colombel (Lyon, France)<br />

706 Early vs delayed mitomycin C instillations after TUR in patients with non-muscle invasive bladder tumours:<br />

A prospective multicentre randomised trial<br />

T. Van Ginkel, J. Nieuwenhuijzen, R. Ter Haar, D. Newling, R.J.A. Van Moorselaar (Amsterdam, The<br />

Netherlands)<br />

707 Organ preservation in high- and extreme high risk non-muscle-invasive bladder cancer (NMIBC): Outcome<br />

analysis of an interventional cohort study of the German Hyperthermia Chemotherapy Group in efficacy<br />

and side effects<br />

G.C. Lüdecke, L. Schäfer, W. Weidner, F. Hasner, H. Hanitzsch, M. Schmidt (Giessen, Munich, Bonn,<br />

Germany)<br />

* 708 Side effects of BCG in the treatment of intermediate and high risk Ta T1 papillary carcinoma of the bladder:<br />

Results from EORTC GU Cancers Group randomized study 30962 comparing 1/3 dose vs full dose during 1<br />

or 3 years<br />

M. Brausi, J. Oddens, R. Sylvester, S. Colette, P. Gontero, A. Bono, L. Turkeri (Modena, Turin, Varese, Italy;<br />

Hertogenbosh, The Netherlands; Brussels, Belgium; Istanbul, Turkey)<br />

240 <strong>Programme</strong> <strong>Book</strong><br />

Discussion on poster 708<br />

M. Rouprêt, Paris (FR)


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

09.15 - 10.45 Prostate cancer biopsies and pathology<br />

Amber Hall 1-2 - Level S2<br />

Poster Session 59<br />

Chairs: F. Gómez Veiga, A Coruna (ES)<br />

V. Scattoni, Milan (IT)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

709 Bimanual examination of retrieved specimen during robot-assisted radical prostatectomy: A novel<br />

technique for reducing the positive surgical margin<br />

W. Jeong, A. Sood, S. Dusik, N.S. Gupta, C.G. Rogers, P. Dasgupta, J.O. Peabody, M. Menon (Detroit, United<br />

States of America; London, United Kingdom)<br />

710 Repeated prostate biopsy: Evaluation of a new diagnostic pathway using mp-MRI, PCA3 and pro-PSA in<br />

the selection of patients<br />

F. Porpiglia, C. Fiori, M. Manfredi, F. Mele, R. Bertolo, S. Grande, F. Russo, D. Regge, E. Bollito, M. Papotti<br />

(Orbassano (Turin), Candiolo (Turin), Italy)<br />

711 Detection of nodal micro-metastases with serial section, immunohistochemistry and real time polymerase<br />

chain reaction in intermediate and high risk prostate cancer patients submitted to radical prostatectomy<br />

with extended pelvic lymph node dissection: A perspective study<br />

R. Schiavina, E. Capizzi, G. Passaretti, D. Romagnoli, A. Bertaccini, E. Brunocilla, F. Manferrari, M. Garofalo,<br />

V. Vagnoni, G.C. Rocca, C.N. Bizzarri, F. Chessa, L. Bianchi, M. Borghesi, M. Fiorentino, G. Martorana<br />

(Bologna, Italy)<br />

712 The novel complexity measures in the objective grading of prostate cancer<br />

P. Waliszewski, M. Tanase, F. Wagenlehner, S. Gattenloehner, W. Weidner (Giessen, Germany; Bucharest,<br />

Romania)<br />

713 Presence of intraductal carcinoma of the prostate on needle biopsy can be a significant prognostic factor<br />

K. Masashi, K. Kyosuke, T. Toyonori, F. Yasuhito, F. Takashi, S. Naoto, M. Yoshihisa, Y. Yasushi, Y. Tokunori,<br />

G. Momokazu (Nagoya, Japan)<br />

714 Spatial distribution of positive cores decreases misclassification rates of patients with low risk prostate<br />

cancer candidate for active surveillance<br />

E. Di Trapani, F. Castiglione, N.M. Passoni, U. Capitanio, A. Gallina, M. Tutolo, M. Bianchi, N. Finocchio,<br />

E. Farina, G. Gandaglia, L. Villa, N. Suardi, V. Mirone, F. Abdollah (Milan, Naples, Italy)<br />

* 715 Can transrectal needle biopsy be optimized to detect nearly all prostate cancer with volume ≥ 0.5 cc? A<br />

three-dimensional analysis<br />

K. Kanao, J.A. Eastham, P.T. Scardino, M. Sumitomo, V.E. Reuter, S.W. Fine (New York, United States of<br />

America; Nagakute, Japan)<br />

716 Biopsy Gleason score ≤ 6. How to predict final pathological specimen Gleason score?<br />

T. Seisen, F. Roudot Thoraval, P.O. Bosset, A. Campeggi, Y. Allory, D. Vordos, A. Hoznek, C-C. Abbou, A. De<br />

La Taille, L. Salomon (Creteil, France)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

241<br />

Monday


Monday<br />

717 Transperineal MRI-targeted biopsy versus transperineal template prostate mapping biopsy in the detection<br />

of localised radio-recurrent prostate cancer<br />

A. Kanthabalan, M. Abl-Azzeez, M. Arya, A. Freeman, C. Allen, A. Kirkham, S. Punwani, M. Emberton,<br />

H. Ahmed (London, United Kingdom)<br />

718 The impact of multiple biopsies on erectile and voiding function after radical prostatectomy: A populationbased<br />

assessment<br />

F. Roghmann, H. Lavigueur-Blouin, M. Meskawi, A. Becker, Z. Tian, J. Noldus, M. Sun (Montreal, Canada;<br />

Hamburg, Herne, Germany)<br />

719 Evidence for a cell cycle proliferation “field effect” in prostate cancer<br />

F. Carvalho, W. Welbourn, J. Reid, E. Humphries, M. Han, J. Lanchbury, A. Gutin, S. Stone, D.M. Berman<br />

(Baltimore, Salt Lake City, United States of America; Kingston, Canada)<br />

720 Low percentage (H10%) of positive biopsy core (PBC) is not a predictor of lower risk for PSA recurrence in<br />

cT1c prostate cancer treated with radical prostatectomy in contemporary Japanese population<br />

S. Hatakeyama, T. Koie, T. Yoneyama, Y. Hashimoto, K. Mitsuzuka, S. Kawamura, S. Narita, N. Tsuchiya,<br />

T. Habuchi, Y. Arai, C. Ohyama (Hirosaki, Sendai, Akita, Japan)<br />

721 The advantages of using 3D guidance for localizing prostate biopsies by endo-rectal route: Feasibility and<br />

preliminary results<br />

A. De Gorski, G.J. Wirth, C.E. Iselin (Geneva, Switzerland)<br />

242 <strong>Programme</strong> <strong>Book</strong>


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

09.15 - 10.45 Update on SUI<br />

Amber Hall 7-8 - Level S2<br />

Poster Session 60<br />

Chairs: C. Gratzke, Munich (DE)<br />

D.A.O. Waltregny, Liège (BE)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion.<br />

722 The effect of aging on voiding function in women with stress-predominant urinary incontinence prior to<br />

surgical intervention<br />

P. Zimmern, H. Litman, G.E. Lemack, H. Richter, L. Sirls, S. Kraus (Dallas, Watertown, Birmingham, Royal<br />

Oak, San Antonio, United States of America)<br />

723 Changes in urinary incontinence during postpartum and associated factors<br />

S.R. Chang, M.I. Lin, H.H. Lin, K.H. Chen, W.A. Lin (Taipei, Taichung, Taiwan)<br />

724 A cost-effectiveness analysis of tension-free vaginal tape vs transobturator tape for female stress urinary<br />

incontinence<br />

M.A. Laudano, S. Seklehner, D. Xie, E.C. Osterberg, B. Chughtai, R.K. Lee (New York, United States of<br />

America)<br />

725 Obesity is not associated with urodynamic stress incontinence<br />

F. Puccini, A. Tubaro, C. De Nunzio, A. Digesu, A. Bhide, C. Hendricken, R. Fernando, V. Khullar (Rome, Italy;<br />

London, United Kingdom)<br />

726 TVT-O for the treatment of pure urodynamics stress incontinence in females: Efficacy and adverse events<br />

at 5 years follow-up<br />

M. Serati, R.M. Bauer, J.N.L. Cornu, E. Cattoni, A. Braga, G. Siesto, D. Lizée, F. Haab, M. Torella, S. Salvatore<br />

(Varese, Milan, Naples, Italy; Munich, Germany; Paris, France)<br />

727 Affect outcomes of mid-urethral sling procedures for stress urinary Incontinence according to body mass<br />

index<br />

L.H. Sung, C.H. Noh, J.Y. Chung, J.H. Yu (Seoul, South Korea)<br />

728 TOT approach in stress urinary incontinence (SUI) – are there differences in obese females?<br />

F. Ludt, C. Frohme, P. Olbert, R. Hofmann, A. Hegele (Marburg, Germany)<br />

729 Deterioration of continence after TOT when the follow-up is extended: Results from a randomised<br />

controlled study<br />

E. Costantini, M. Lazzeri, A. Zucchi, R. Bruno, E. Salvini, A. Pietropaolo, M. Del Zingaro, M. Porena (Perugia,<br />

Italy)<br />

730 Urodynamic repercussions of the treatment of the female stress urinary incontinence by suburethral tapes<br />

S. Garcia Barreras, N. Garcia Garcia, M. Téllez Martínez Fornés, M. Cervero Jiménez, L. Fiter Gómez,<br />

C. Fernández Lucas (Leganés, Spain)<br />

731 Results of repeat midurethral sling for the treatment of recurrent female stress urinary incontinence<br />

T. Charles, Y. Sow, S. Christian (Strasbourg, France; Dakar, Senegal)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

243<br />

Monday


Monday<br />

732 Can one global quality of life question simplify the overall outcome assessment after surgery for stress<br />

predominant urinary incontinence in women?<br />

C. Bacsu, A. Gomelsky, P. Zimmern (Dallas, Shreveport, United States of America)<br />

733 Does the type of physiotherapy affect the quality of life and clinical outcomes in female urinary<br />

incontinence? A comparative study of two physiotherapy schemes<br />

E. Konstantinidou, M. Kalaitzi, K-V. Mytilekas, E-I. Ioannides, D. Hatzichristou, A. Apostolidis (Thessaloniki,<br />

Greece)<br />

734 Long-term functional outcomes obtained after artificial urinary sphincter implantation in women with<br />

stress urinary incontinence: A single center experience<br />

S. Benadiba, V. Phé, M. Rouprêt, B. Granger, F. Richard, E. Chartier-Kastler (Paris, France)<br />

735 Patients with urinary incontinence are more likely to develop upper urinary tract stone: A nation-wide<br />

population-based study with 8-year follow-up<br />

H.J. Chung, A.T.L. Lin, C.C. Lin, T.J. Chen, K.K. Chen (Taipei, Taiwan)<br />

244 <strong>Programme</strong> <strong>Book</strong>


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

09.15 - 10.45 Current and new treatments of OAB and LUTS<br />

Silver Hall - Level N2<br />

Poster Session 61<br />

Chairs: M.J. Drake, Bristol (GB)<br />

H. Hashim, Bristol (GB)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

736 The clustering of lower urinary tract syndrome. Is the overactive bladder a distinct clinical syndrome?<br />

P.O. Pal, B.H. Maraj, M. Ghei, J. Malone-Lee (London, United Kingdom)<br />

737 Developing a psychometrically validated urinary diary<br />

E. Bright, N. Cotterill, M. Drake, P. Abrams (Bristol, United Kingdom)<br />

* 738 Urinary retention following anticholinergics in patients with BPH, do comorbidities matter? A nationwide<br />

population-based study<br />

E.Y-H Huang, C-C. Lin, H-J. Chung, J-P. Lin, A.T. Lin, K-K. Chen (Taipei, Taiwan)<br />

739 Cardiovascular (CV) assessments in short- and long-term Phase 3 mirabegron trials in patients with<br />

overactive bladder (OAB)<br />

S. Herschorn, P. Kowey, V. Nitti, I. Milsom, S.M. Auerbach, M.B. Blauwet, C. Dorrepaal, M. Weber, J.S. Borer,<br />

W. Fitzsimmons, N. Martin (Toronto, Canada; Wynnewood, New York, Newport Beach, Northbrook, United<br />

States of America; Gothenburg, Sweden; Leiderdorp, The Netherlands)<br />

740 A randomised controlled trial of fesoterodine in subjects with overactive bladder and suboptimal response<br />

to tolterodine extended release: Results from the AFTER study<br />

L. Cardozo, S. Kaplan, S. Herschorn, L. Grenabo, M. Carlsson, D. Arumi, T.J. Crook, L. Whelan, F. Ntanios<br />

(London, Walton Oaks, United Kingdom; New York, United States of America; Toronto, Canada; Gothenburg,<br />

Sweden; Madrid, Spain)<br />

741 Pivotal phase 3 study in overactive bladder (OAB) patients with urinary incontinence confirms<br />

onabotulinumtoxinA 100U significantly improves all OAB symptoms and patients’ quality of life<br />

C. Chapple, K-D. Sievert, S. MacDiarmid, V. Khullar, P. Radziszewski, C. Nardo, C. Thompson, J. Zhou,<br />

C. Haag-Molkenteller (Sheffield, London, Marlow, United Kingdom; Tübingen, Germany; Greensboro, Irvine,<br />

United States of America; Warsaw, Poland)<br />

742 A prospective randomized comparative study of first-line tolterodine and doxazosin monotherapy for men<br />

with predominant storage symptoms<br />

C.H. Liao, H-C. Kuo (New Taipei City, Hualien, Taiwan)<br />

743 Prevalence and management of overactive bladder patients in the French general population in 2012<br />

P. Grise, G. Amarenco, A. Bellessort, F. Bruyère, E. Chartier-Kastler, B. Fatton, F. Haab, A. Serikoff (Rouen,<br />

Paris, Levallois-Perret, Tours, Nimes, France)<br />

744 OnabotulinumtoxinA 100U demonstrates similar treatment effect in overactive bladder patients with<br />

urinary incontinence regardless of number of prior anticholinergics taken or reason for their inadequate<br />

management of patients’ overactive bladder<br />

C. Chapple, K-D. Sievert, S. Herschorn, C. Thompson, C. Nardo, J. Zhou, C. Haag-Molkenteller, V. Nitti<br />

(Sheffield, Marlow, United Kingdom; Tübingen, Germany; Toronto, Canada; Irvine, New York, United States<br />

of America)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

245<br />

Monday


Monday<br />

745 Withdrawn<br />

746 Is there concordance between clinical overactive bladder and detrusor overactivity in male with storage<br />

symptoms?<br />

M. Esteban, D. Castro-Diaz, J. Salinas, S. Arlandis, A. Franco, M.A. Jiménez, L. Prieto, C. Gutierrez, (Toledo,<br />

Santa Cruz de Tenerife, Madrid, Valencia, Barcelona, Alicante, Spain)<br />

747 Contribution of sleep disorders to nocturia-specific QOL (N-QOL) and the efficacy of treatment with<br />

anticholinergic drug in overactive bladder patients with nocturia<br />

M. Yoshida, M. Takeda, S. Takahashi, O. Nishizawa, M. Gotoh, N. Masumori (Obu, Aichi, Kofu, Tokyo,<br />

Matsumoto, Nagoya, Sapporo, Japan)<br />

246 <strong>Programme</strong> <strong>Book</strong><br />

Summary<br />

H. Hashim, Bristol (GB)


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

09.15 - 10.45 Urothelial cancer treatment: Predicting outcomes<br />

Red Hall 1 - Level N1<br />

Poster Session 62<br />

Chairs: S.F. Shariat, New York (US)<br />

R. Sosnowski, Warsaw (PL)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion.<br />

748 Clinical impact of grade on both recurrence and progression in T1 bladder cancer: Comparison between<br />

WHO 1973 and WHO 2004 histological classification<br />

F. Pellucchi, L. Rocchini, C. Maccagnano, G. Zanni, G. La Croce, M. Moschini, M. Bianchi, P. Rigatti,<br />

R. Colombo (Milan, Italy)<br />

749 Clinical outcome in patients with T1 micropapillary carcinoma of the bladder<br />

M. Spaliviero, G. Dalbagni, B.H. Bochner, B.Y. Poon, T.F. Donahue, H.A. Al-Ahmadie, J.M. Taylor, J.J. Meeks,<br />

D.D. Sjoberg, S.M. Donat, H.W. Herr (New York, United States of America)<br />

750 Leucocyte infiltration is a prognostic factor in bladder cancer stage T1<br />

O. Patschan, P.O. Bendahl, G. Chebil, H. Engilbertsson, S. Gudjonsson, P. Kollberg, F. Liedberg (Malmö,<br />

Lund, Helsingborg, Sweden)<br />

751 T1 urinary bladder cancer - long time observation population-based material<br />

S. Jahnson, S. Holmang, F. Liedberg, B Ljungberg, A. Hosseini-Aliabad (Linköping, Gothenburg, Malmö,<br />

Umeå, Stockholm, Sweden)<br />

752 Female gender is associated with higher risk of disease recurrence in patients with primary T1 high grade<br />

urothelial carcinoma of the bladder<br />

L.A. Kluth, E. Xylinas, J.J. Crivelli, H. Fajkovic, N. Passoni, M. Rouprêt, A. Becker, E. Comploj, A. Pycha,<br />

S. Holmang, A. Gupta, Y. Lotan, P.I. Karakiewicz, P. Gontero, F.K.H. Chun, M. Fisch, D.S. Scherr, S. Shariat<br />

(New York, Iowa City, Dallas, United States of America; St.Poelten, Austria; Milan, Bolzano, Turin, Italy;<br />

Paris, France; Montreal, Canada; Gothenburg, Sweden; Hamburg, Germany)<br />

753 Oncological outcome of radical cystectomy for BCG failure compared to primary invasive disease<br />

A. Masson-Lecomte, D. Vordos, R. Yiou, Y. Allory, C.C. Abbou, A. De La Taille, L. Salomon (Creteil, France)<br />

754 Accuracy of the EORTC risk tables and of the CUETO scoring model to predict outcomes in non muscleinvasive<br />

urothelial carcinoma of the bladder<br />

E.N. Xylinas, M. Kent, L.A. Kluth, D. Sjoberg, A. Pycha, E. Comploj, Y. Lotan, R.S. Svatek, Q.D. Trinh,<br />

P.I. Karakiewicz, S. Holmang, D.S. Scherr, M. Zerbib, S.F. Shariat (New York, Dallas, United States of<br />

America; Bolzano, Italy; Montreal, Canada; Gothenburg, Sweden; Paris, France)<br />

755 Prediction of recurrence probabilities after intravesical treatment in patients with non-muscle-invasive<br />

bladder cancer<br />

R.J.M. Lammers, J.C.M. Hendriks, J. Palou, W.P.J. Witjes, J.A. Witjes (Nijmegen, Arnhem, The Netherlands;<br />

Barcelona, Spain)<br />

756 Prediction of progression in patients with non-muscle invasive bladder cancer based on histologic grade, T<br />

stage, recurrence rate and bladder neck involvement: The BN-GTR model<br />

Y. Fujii, S. Kobayashi, F. Koga, M. Yokoyama, S. Yoshida, J. Ishioka, Y. Matsuoka, N. Numao, K. Saito,<br />

H. Masuda, K. Kihara (Tokyo, Japan)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

247<br />

Monday


Monday<br />

757 An active surveillance program in recurrent non muscle-invasive bladder tumor. Oncological safety and<br />

predictive factors to remain under surveillance<br />

V. Hernández, E. De La Peña, C. Blázquez, E. Pérez, F.J. Díaz, C. Llorente (Alcorcón (Madrid), Spain)<br />

758 Association of cytotoxic T-lymphocyte antigen-4 gene polymorphisms with increased likelihood of<br />

recurrence in non-muscle invasive bladder cancer<br />

E. Chiong, A. Wong, N. Kesavan, Y.H. Chan, K. Esuvaranathan, R. Mahendran (Singapore, Singapore)<br />

759 Prognostic value of sex-hormone receptors expression in bladder tumor<br />

J.K. Nam, S.W. Park, M.K. Chung (Yangsan, South Korea)<br />

760 Retrospective study of the upper urinary tract urothelial carcinoma (UUT-UC) Spanish Collaborative Group<br />

alerts endocavitary BCG/MMC instillations, in unsuitable patients, could be deleterious in terms of survival<br />

F. Ramon De Fata, R. Cansino, J. Palou, J.H. Amón, V. Chantada, F.J. Burgos, C. Rioja, A. Serrano, L. Fariña,<br />

M. Cosentino, J.C. Angulo (Madrid, Barcelona, Valladolid, La Coruña, Zaragoza, Guadalajara, Vigo, Spain)<br />

248 <strong>Programme</strong> <strong>Book</strong><br />

Summary<br />

S.F. Shariat, New York (US)


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

09.15 - 10.45 Renal tumours: Basic research on pathogenesis<br />

Red Hall 2 - Level N1<br />

Poster Session 63<br />

Chairs: F. Jankevicius, Vilnius (LT)<br />

K. Junker, Jena (DE)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion.<br />

761 Establishing primary renal cancer cell cultures in vitro linked to a corresponding orthotopic in vivo model<br />

M. Saar, H. Zhao, A. Thong, A. Ingels, M. Valta, S.R. Young, R. Nolley, D.M. Peehl (Homburg/Saar, Germany)<br />

762 Dietary selenium and lower risk of developing renal cancer – a prospective cohort study using food diaries<br />

in EPIC Norfolk<br />

B.J.R. Barrass, M.A. Rochester, R. Pillai, R. Luben, K.T. Khaw, A.R. Hart (Norwich, Cambridge, United<br />

Kingdom)<br />

763 Renal cell cancer in young adults: Prevalence, characteristics, and impact of Xp11.2/TFE3 translocation<br />

carcinoma diagnosis<br />

L. Donon, M. Yacoub, G. Robert, C. Deminière, G. Pasticier, J-M. Ferrière, P. Ballanger, J-C. Bernhard<br />

(Bordeaux, France)<br />

764 Integrative analysis of clear cell renal cell carcinoma<br />

Y. Sato, S. Maekawa, Y. Okuno, Y. Shiraishi, A. Sato, G. Nagae, T. Shimamura, Y. Nagata, K. Yoshida,<br />

M. Sanada, H. Kume, H. Aburatani, S. Sugano, S. Ogawa, Y. Homma (Tokyo, Japan)<br />

765 The important role of glycine N-methyltransferase (GNMT) in the proliferation of renal cell carcinoma<br />

Y. Song, M. Shiota, A. Yokomizo, K. Tatsugami, K. Kuroiwa, S. Naito (Fukuoka, Japan)<br />

766 Proteomic intra-tumoural heterogeneity and differential expression between primary and metastatic renal<br />

cancer tissue<br />

A. Laird, F.C. O’Mahony, L. Eory, J. Nanda, A.C.P. Riddick, M. O’Donnell, R.R. Meehan, G.D. Stewart,<br />

D.J. Harrison (Edinburgh, St Andrews, United Kingdom)<br />

767 Identification of antigenic peptides from novel renal cancer stem cell antigen, DNAJB8<br />

N. Satoshi, Y. Hirohashi, T. Torigoe, H. Kusumoto, K. Kikkawa, Y. Kodama, M. Ko, N. Matsumura,<br />

Y. Kohjimoto, N. Sato, I. Hara (Wakayama, Sapporo, Japan)<br />

768 Gene expression profile changes in response to overexpression or silencing of the hhavcr-1/kim-1 gene in<br />

the 769-p and 786-o ccRCC cell lines<br />

E. Trilla, D. Lorente, M.A. López-Pacios, T. Cuadros, M. Vilà, I. De Torres, J. Vilardell, N. Ben Messaoud,<br />

M. Salcedo, E. Sarró, J. López-Hellin, S. Ramón Y Cajal, E. Itarte, A. Meseguer, J. Morote (Barcelona, Spain)<br />

769 Cancer stem cell characteristics may be correlated to the renal cell carcinoma intratumoral heterogeneity<br />

S. Bombelli, M.A. Zipeto, C. Bianchi, B. Torsello, V. Di Stefano, P. Viganò, G. Bovo, G. Cattoretti, G. Strada,<br />

R. Perego (Monza, Milan, Italy)<br />

770 CD39 is highly involved in mediating the suppression activity of tumor infiltrating CD8 + T regulatory<br />

lymphocytes in renal and bladder cancer<br />

P. Traverso, A. Parodi, F. Battaglia, F. Ferrera, S. Tardito, S. Stringara, G. Conteduca, S. Negrini, A. Simonato,<br />

D. Fenoglio, G. Carmignani, G. Filaci (Genoa, Italy)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

249<br />

Monday


Monday<br />

771 Regulatory T cells in clinically localized renal cell carcinoma: Comparison with an age-matched healthy<br />

control<br />

I.G. Jeong, J.H. Yoon, K.H. Kim, D. You, S. Park, J.H. Hong, H. Ahn, C-S. Kim (Seoul, Ulsan, South Korea)<br />

772 The functional significance and cancer pathways of EMT-related microRNA-200-family in renal cell<br />

carcinoma<br />

H. Yoshino, N. Seki, H. Hidaka, T. Yamasaki, H. Enokida, M. Nakagawa (Kagoshima, Chiba, Japan)<br />

773 Analysis of molecular profiling of renal cell carcinoma (RCC). Identification of a 4-microRNA signature as a<br />

prognostic value in patients with stage I-II<br />

L. Diez Sicilia, F. Villacampa Aubá, B. García Gómez, J. Medina Polo, M. Dominguez Esteban, A. Tejido<br />

Sánchez, G. De Velasco, F. De La Rosa Kehrmann, D. Castellano, R. Díaz González (Madrid, Spain)<br />

774 Analysis of site specific miRNA expression in distant metastases of clear cell renal cell carcinoma<br />

J. Heinzelmann, S. Baumgart, U. Wickmann, A. Szendroi, A. Unrein, M.R. Gajda, M-O. Grimm, M. Stöckle,<br />

K. Junker (Homburg/Saar, Jena, Germany; Budapest, Hungary)<br />

250 <strong>Programme</strong> <strong>Book</strong>


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

09.15 - 10.45 OAB in women<br />

Blue Hall 1-2 - Level N1<br />

Poster Session 64<br />

Chairs: P. Dinis Oliveira, Porto (PT)<br />

T. Hanus, Prague (CZ)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

* 775 Sacral Nerve Stimulation (SNS) for the treatment of idiopathic refractory overactive bladder: Costeffectiveness<br />

compared to optimal medical therapy, botulinum toxin A (BoNT-A) and percutaneous tibial<br />

nerve stimulation (PTNS)<br />

J. Jenks, R. Hamid, P.J.R. Shah, T.J. Greenwell, C. Betts, S. Walleser, N. Hallas, J.L. Ockrim (London, Salford,<br />

United Kingdom; Tolochenaz, Switzerland)<br />

776 Tined lead versus percutaneous nerve evaluation for sacral nerve stimulator assessment<br />

J. Jenks, R. Hamid, P.J.R. Shah, T.J. Greenwell, J.L. Ockrim (London, United Kingdom)<br />

777 Affect on bowel symptoms in patients having sacral neuromodulation for detrusor overactivity<br />

A. Gulamhusein, J. Fielding, R. Simmons, S.V. Reid (Sheffield, United Kingdom)<br />

778 Transcutaneous posterior tibial nerve stimulation: Evaluation of therapeutic option in overactive bladder<br />

syndrom<br />

M. Ammi, P. Bigot, D. Chautard, S. Larre, T. Culty, C. Pinon, A. Azzouzi (Angers, France)<br />

779 Objective efficacy of mirabegron on storage and voiding function in patients with overactive bladder,<br />

based on a urodynamic study<br />

Y. Matsukawa, Y. Funahashi, S. Takai, Y. Yoshino, T. Yamamoto, M. Gotoh (Nagoya, Japan)<br />

* 780 Overactive bladder syndrome in elderly: Is there a place for detrusor Botox injections?<br />

V.M. Keppenne, D. Waltregny, S. Sanjurjo (Liege, Belgium)<br />

781 Discontinuation rates and inter-injection interval for repeated intravesical botulinum toxin type A<br />

injections in detrusor overactivity<br />

R. Veeratterapillay, C. Harding, N. Vasdev, L. Teo, A. Abroaf, R. Pickard, T. Dorkin, T. Hasan, A. Thorpe<br />

(Newcastle upon Tyne, United Kingdom)<br />

782 The effect of solifenacin on bladder wall thickness in women with overactive bladder and detrusor<br />

overactivity: Results from the SHRINK study<br />

D. Robinson, M. Oelke, R. Tretter, B. Stow, G. Compion, A. Tubaro (London, Chertsey, United Kingdom;<br />

Hanover, Germany; Leiderdorp, The Netherlands; Rome, Italy)<br />

783 Single surgeon experience of clam ileocystoplasty for refractory idiopathic detrusor overactivity<br />

S. Pisipati, F. Khan, R.B. Kinder (Cheltenham, United Kingdom)<br />

784 The characteristics and prognosis for impaired detrusor contractility in non-geriatric patients<br />

C-W. Yang, Y-H. Fan, C-C. Lin, J.S. Huang, T.L. Ling, K-K. Chen (Taipei, Taiwan)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

251<br />

Monday


Monday<br />

785 A multi-centre randomized controlled study comparing surgical and pharmacological therapy to treat<br />

mixed urinary incontinence<br />

R. Caremel, L.M. Tu, K. Baker, O. El Yazami Adli, O. Loutochin, J. Corcos (Montreal, Sherbrooke, Ottawa,<br />

Canada)<br />

786 The surgical outcomes of transobturator tape in patients with stress urinary incontinence concomitant with<br />

overactive bladder<br />

C. Yoo, H.Y. Choi, J.S. Cho, S.H. Lee, J.W. Hwang, C.Y. Oh, J.H. Han, Y.G. Lee (Anyang-Si, Guri, South Korea)<br />

252 <strong>Programme</strong> <strong>Book</strong>


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

09.15 - 10.45 Urethral stricture management<br />

Yellow Hall 1-2-3 - Level N1<br />

Poster Session 65<br />

Chairs: S.J. Hosseini, Tehran (IR)<br />

C. Llorente, Madrid (ES)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion.<br />

787 Value of MRI in diagnostic study in patients with urethral stricture: Impact on subsequent surgery<br />

M.I. Kogan, E.L. Banchik, V.I. Dombrovsky, V. Mitusov (Rostov on Don, Russia)<br />

788 Urethral ultrasound versus magnetic resonance urethrography versus retrograde urethrography in the<br />

evaluation of anterior urethral stricture: A prospective study<br />

M.A.A. Abdullah (Assiut, Egypt)<br />

789 Withdrawn<br />

790 Stricture recurrence after the urethroplasty with buccal mucosal graft: What next?<br />

A. Pandey, C. Raita, J. Beier, H. Keller (Hof, Germany)<br />

791 Seeding a biodegradable collagen cell carrier and its use for urethroplasty in a urethral stricture minipig<br />

model<br />

L. Lisa, M. Vaegler, S. Maurer, K-D. Sievert (Tübingen, Germany)<br />

792 Histological evidence of balanitis xerotica obliterans (BXO) complicating cases of failed hypospadias repair<br />

M. Selim, E. Elsherif, S. Yones, M. Sultan (Shibin Elkom, Egypt)<br />

793 Management of pananterior urethral strictures due to LS/BXO by single stage dorsal buccal onlay<br />

urethroplasty<br />

A. El-Kassaby, E.A. Eltahawy (Cairo, Little Rock, Egypt)<br />

794 Relationship between development of urethral stricture after transurethral resection of prostate and<br />

glycemic control<br />

˛S. Kumsar, H.S. Saglam, O. Köse, S. Budak, O. Adsan (Sakarya, Turkey)<br />

795 The two-staged urethral and penile reconstruction using vasularised scrotal flap and buccal mucosal graft<br />

A. Pandey, C. Raita, J. Beier, H. Keller (Hof, Germany)<br />

796 Time and stages survival of oral mucosa grafts on 3 different feeding beds - an experimental model in rats<br />

S.V. Kotov, S.V. Belomyttcev, E.I. Veliev, O.B. Loran (Moscow, Russia)<br />

797 Comparison of urethroplasty results using oral mucosa graft and tunica vaginalis flap in anterior urethral<br />

stricture<br />

M.I. Kogan, V.V. Mitusov, A.V. Shangichev, R.E. Ametov, S.V. Naranov (Rostov on Don, Russia)<br />

798 Contemporary urethral stricture characteristics in the developed world<br />

E. Palminteri, E. Berdondini, C. De Nunzio, S. Maruccia, G. Bozzini, L. Carmignani, G. Barbanti (Arezzo,<br />

Rome, Milan, Siena, Italy)<br />

Summary<br />

C. Llorente, Madrid (ES)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

253<br />

Monday


Monday<br />

Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

254 <strong>Programme</strong> <strong>Book</strong><br />

Special Session<br />

10.00 - 16.00 da Vinci Robotic Surgery<br />

Platinum Hall - Level S3<br />

10.00 - 12.00 Live surgery: da Vinci prostatectomy - The Martini Klinik Technique<br />

Operator: A. Haese, Hamburg (DE)<br />

Moderators: M. Graefen, Hamburg (DE)<br />

P. Wiklund, Stockholm (SE)<br />

14.00 - 16.00 Live surgery: da Vinci prostatectomy - Early neurovascular bundles release<br />

Operator: A. Cestari, Milan (IT)<br />

Moderators: C.M. Annerstedt, Herlev (DK)<br />

W. Artibani, Verona (IT)<br />

Sponsored by INTUITIVE SURGICAL


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Thematic Session 9<br />

11.00 - 12.00 Expert challenges the expert<br />

Yellow Hall 1-2-3 - Level N1<br />

Chair: A. De La Taille, Creteil (FR)<br />

11.00 - 11.30 Case presentation How I do a nerve-sparing cystectomy<br />

G.N. Thalmann, Berne (CH)<br />

Challenger:<br />

R.E. Sanchez Salas, Paris (FR)<br />

11.30 - 12.00 Case presentation How I do a laparoscopic partial nephrectomy<br />

I.S. Gill, Los Angeles (US)<br />

Aims and objectives<br />

My lecture will present the technical nuances and details of laparoscopic and robotic partial nephrectomy.<br />

The techniques presented will include all 3 types of partial nephrectomy: Conventional-clamping, earlyunclamping<br />

and zero-ischemia techniques.<br />

Challenger:<br />

A. Mottrie, Aalst (BE)<br />

Aims and objectives<br />

Robot-assisted partial nephrectomy is today a standardised technique offering precise resection of the<br />

tumour and quick reconstruction of the defect. This is done under warm ischemia clamping the main renal<br />

artery and wherever possible clamping of a secundary or tertiary branch. Bleeding is so minor and vision<br />

superior. After inner renorrhaphy closure, early unclamping can be performed allowing warm ischemia<br />

times to be low without significant clinical consequences for the renal function<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

255<br />

Monday


Monday<br />

Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

11.00 - 12.00 Andrology<br />

256 <strong>Programme</strong> <strong>Book</strong><br />

Thematic Session 10<br />

eURO Auditorium - Level S2<br />

Chair: J.O.R. Sonksen, Herlev (DK)<br />

11.00 - 11.15 State-of-the-art lecture Modern management of ejaculatory disorders<br />

A. Salonia, Milan (IT)<br />

Aims and objectives<br />

Despite copious findings on the physiology of ejaculation, as well as on the pathophysiology of Premature<br />

Ejaculation (PE), treatment of early ejaculation is still not well-outlined, with only a minor proportion of<br />

patients complaining of primary PE being actively treated. These discrepancies may be considered as the<br />

unfortunate result of a combination of several factors: 1) PE per se is often underdiagnosed in clinical<br />

practice; 2) Urologists do not follow the guidelines for the treatment of PE in their everyday clinical practice;<br />

3) The lack of a widely recognised gold standard treatment, as well as the presence of a number of potential<br />

side effects which characterise almost all the compounds available for PE. In this context, off-label daily<br />

dosing of paroxetine, sertraline, citalopram, fluoxetine, or clomipramine are regarded as first line treatments<br />

for PE worldwide. Recently, dapoxetine hydrochloride - a short-acting SSRI with a pharmacokinetic profile<br />

favourable for on-demand treatment of PE has been launched on the market as the first on-demand and<br />

on-label treatment for PE.<br />

11.15 - 11.30 State-of-the-art lecture Current treatment possibilities for erectile dysfunction<br />

I. Eardley, Leeds (GB)<br />

Aims and objectives<br />

This lecture will discuss new treatment options for a man with erectile dysfunction and will critically evaluate<br />

the evidence for these therapies. The discussion will include both medical and physical therapies.<br />

11.30 - 11.45 State-of-the-art lecture Developments in the diagnosis and therapy of priapism<br />

A. Muneer, London (GB)<br />

Aims and objectives<br />

This session will aim to highlight the recent developments in diagnostic imaging and surgical interventions<br />

for the three sub-types of priapism; ischaemic, non-ischaemic and stuttering.<br />

Both clinical studies and in vitro studies have helped to formulate novel theories in order to explain the<br />

development of priapism and suggest effective management strategies. For a long time, the management of<br />

priapism has been based on anecdotal reports and therefore therapeutic guidelines vary globally. The use of<br />

both in vivo and in vitro models of priapism have now helped our understanding of the pathophysiology of<br />

this condition and helped develop alternative therapeutic interventions, particularly in the area of refractory<br />

ischaemic priapism and stuttering priapism. By understanding the fundamental changes at a molecular<br />

level, clinicians will be able to develop an evidence based treatment algorithm for difficult cases<br />

11.45 - 12.00 Abstract presentations: Special selection from the poster sessions<br />

324 Intratunical injection of human adipose tissue-derived stem cells prevents fibrosis and is associated with<br />

improved erectile function in a rat model of Peyronie’s disease<br />

F. Castiglione, P. Hedlund, F. Van Der Aa, T.J. Bivalacqua, M. Albersen (Milan, Italy; Leuven, Belgium;<br />

Baltimore, United States of America)


325 Repair of erectile dysfunction using transplantation of human mesenchymal stem cells cultivated on the<br />

surface of nanofibrous meshes in rats with cavernous nerve injury<br />

Y.S. Song, H.J. Lee, J. An, J.H. Yun, J.H. Kim, S.W. Doo, W.J. Yang, S.U. Kim (Seoul, South Korea)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

257<br />

Monday


Monday<br />

Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

258 <strong>Programme</strong> <strong>Book</strong><br />

Thematic Session 11<br />

11.00 - 12.00 Systemic therapy in urological cancers<br />

Silver Hall - Level N2<br />

Chair: M. De Santis, Vienna (AT)<br />

11.00 - 11.15 State-of-the-art lecture Risk stratification integrating clinical and genomic data<br />

A. Bjartell, Malmö (SE)<br />

Aims and objectives<br />

There is an urgent need for improved selection of patient for new therapies such as inhibition of androgen<br />

signaling and angiogenesis, and for immunotherapy. Prediction models for risk stratification of recurrence<br />

after treatment for different malignancies have become increasingly popular. Nomograms developed at<br />

Memorial Sloan-Kettering Cancer Center, MSKCC (www.nomograms.org) and other prediction models are<br />

frequently used today. Despite numerous publications on promising biomakers, multiplex signatures and<br />

gene panels, only PSA in blood is routinely incorporated in prediction models. This lecture will focus on<br />

the integration of biomarkers and genomic data with clinical characteristics today and what we can expect<br />

tomorrow.<br />

11.15 - 11.30 State-of-the-art lecture When is chemotherapy indicated in prostate cancer?<br />

P. Albers, Düsseldorf (DE)<br />

11.30 - 11.45 State-of-the-art lecture Systemic therapy for renal cell cancer<br />

A.S. Merseburger, Hanover (DE)<br />

Aims and objectives<br />

Emerging from a largely cytokine-based era, the clinical development of the last decade has led to a dramatic<br />

change in the therapeutic landscape of renal cell carcinoma. Molecularly targeted and antiangiogenic agents<br />

now form the backbone of most therapeutic strategies for patients with advanced metastatic renal cell<br />

carcinoma. This lecture focuses on the clinical efficacy of systemic therapy in RCC patients and gives a brief<br />

overview on novel areas of development and emerging substances including vaccine and immunotherapies<br />

which hold promise to improve therapeutic outcomes for patients with mRCC.<br />

11.45 - 12.00 State-of-the-art lecture Second-line chemotherapy for urothelial cancer<br />

M. De Santis, Vienna (AT)<br />

Aims and objectives<br />

Bladder cancer is a chemotherapy sensitive disease and cisplatin based combination treatment has been the<br />

standard for many years. Only about 15% of patients experience long term remissions. For those who fail<br />

first-line chemotherapy the prognosis usually is dismal. Second-line chemotherapy data are highly variable.<br />

Only recently, three prognostic factors have been established, resulting in 4 prognostic groups. A reasonable<br />

strategy in the second-line setting is to rechallenge former cisplatin sensitive patients if progression occurs<br />

at least 6-12 months after first treatment. The only phase III trial in this context explored vinflunine plus best<br />

supportive care (BSC) randomised against BSC alone in patients failing first-line platinum based combination<br />

chemotherapy. The results showed a survival benefit in favour of vinflunine, which was statistically significant<br />

in the eligible patient population. Currently, vinflunine is the only approved second-line treatment in Europe.<br />

Recent advances and future strategies and studies will be summarised and critically discussed.


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Thematic Session 12<br />

11.00 - 12.00 A session by the European Society of Urogenital Radiology<br />

Red Hall 1 - Level N1<br />

Chair: G. Heinz-Peer, Vienna (AT)<br />

11.00 - 11.20 State-of-the-art lecture Multiparametric MRI – a step forward in the diagnosis of prostate cancer<br />

A. Turgut, Ankara (TR)<br />

Aims and objectives<br />

The main objective of this session is to outline the role of MRI in the clinical management of patients with<br />

prostate cancer. In this regard, multiparametric MRI involving conventional as well as functional techniques<br />

for the imaging of prostate cancer will be described. Importantly, the clinical indications for the use of<br />

prostate MRI will be discussed. Also, typical MRI findings of prostate cancer will be reviewed and the<br />

current advances in prostate MRI providing anatomical and functional data about prostate cancer will be<br />

summarised. Accordingly, a structured reporting system (PI-RADS) for the MRI findings of prostate cancer<br />

will be presented. Finally, future prospects for the impact of prostate MRI on the diagnosis and treatment of<br />

prostate cancer will be discussed.<br />

11.20 - 11.40 State-of-the-art lecture The role of imaging in urothelial cancer<br />

N. Cowan, Oxford (GB)<br />

11.40 - 12.00 State-of-the-art lecture Characterisation and management of incidental adrenal masses<br />

G. Heinz-Peer, Vienna (AT)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

259<br />

Monday


Monday<br />

Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

260 <strong>Programme</strong> <strong>Book</strong><br />

Thematic Session 13<br />

11.00 - 12.00 Prevention and treatment of urological infections<br />

Red Hall 2 - Level N1<br />

Chair: T.E. Bjerklund Johansen, Århus (DK)<br />

11.00 - 11.15 State-of-the-art lecture Antibiotics - the urological time bomb<br />

G. Kahlmeter, Växjö (SE)<br />

Aims and objectives<br />

Antimicrobial prophylaxis and therapy are an integral part of modern medicine. Without them much of<br />

what we perceive as modern medicine will be either impossible or very difficult to continue. Galloping<br />

antimicrobial resistance development together with an almost complete lack of development of truly new<br />

antibacterials threaten to undermine both prophylaxis and management of infections in modern medicine.<br />

The aim of this lecture is to update the audience on antimicrobial resistance development, development of<br />

new antibacterials, possible measures to counteract resistance development and their effectiveness and<br />

alternative strategies.<br />

11.15 - 11.30 State-of-the-art lecture Antiobiotic prophylaxis in endoscopic urological interventions<br />

M. Grabe, Malmö (SE)<br />

Aims and objectives<br />

The risk of infectious complications associated with urological diagnostic and therapeutic procedures are<br />

related to the bacterial contamination level and several other factors. A model of classification of these<br />

procedures in different classes of contamination will be presented as will the subsequent strategy for<br />

antibiotic prophylaxis, with focus on urological endoscopic interventions.<br />

11.30 - 11.45 State-of-the-art lecture Antibiotics in prostate biopsies<br />

F.M.E. Wagenlehner, Giessen (DE)<br />

Aims and objectives<br />

Prostate biopsy is currently an essential procedure for prostate cancer diagnosis and is a frequently performed<br />

procedure in urology with an estimated 1.000.000 cases each year in Europe. The aim of this presentation is<br />

to highlight current developments with regard to increasing infectious complications after prostate biopsies<br />

and possible strategies for improvement.<br />

11.45 - 12.00 Abstract presentations: Special selection from the poster sessions<br />

158 Socioeconomic trends and utilization in the emergency department treatment of urinary tract infections<br />

J.D. Sammon, K.R. Ghani, S. Sukumar, J.O. Peabody, M. Menon, Q-D. Trinh (Detroit, United States of<br />

America)<br />

615 Comparison of different scoring systems for outcome prediction in patients with Fournier’s gangrene: Our<br />

experience with 50 patients<br />

A. Tuncel, T. Keten, Y. Aslan, M. Kayali, A. Erkan, M. Yildiz, A. Atan (Ankara, Turkey)


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Thematic Session 14<br />

11.00 - 12.00 Neurourology<br />

Blue Hall 1-2 - Level N1<br />

Chair: F.C. Burkhard, Berne (CH)<br />

11.00 - 11.15 State-of-the-art lecture Spinal cord injury: The initial management of the bladder<br />

G. Del Popolo, Florence (IT)<br />

Aims and objectives<br />

After spinal cord lesion we observe a period of spinal shock during which we must ensure the drainage of<br />

the bladder using an indwelling catheter, the bladder rehabilitation provide the removal of the indwelling<br />

catheter starting intermittent catheterisation. Further investigations are needed such as renal function tests,<br />

ultrasound, neurophysiological tests, urodynamic examination. Clinical and instrumental tests are mandatory<br />

to optimise rehabilitation management with the use of intermittent catheterism, conservative management,<br />

medical therapy and to prevent neurological bladder complications<br />

11.15 - 11.30 State-of-the-art lecture Pharmacotherapy for neurogenic bladder<br />

P. Radziszewski, Warsaw (PL)<br />

Aims and objectives<br />

The lecture will cover practical aspects of pharmacotherapy of different lower urinary tract conditions<br />

in patients with neurogenic bladder. The new compounds will be critically evaluated and guidelines on<br />

pharamacotherapy will be presented. The main focus will be on proper decision/treatment pathways and<br />

management of tolerability/efficay issues.<br />

11.30 - 11.45 State-of-the-art lecture Renal transplantation into a reconstructed bladder<br />

P. Lopez Pereira, Madrid (ES)<br />

Aims and objectives<br />

Not many years ago, patients with congenital abnormalities of the lower urinary tract or bladder dysfunction<br />

were denied Renal Transplant (RT) because they were considered very high risk recipients. However, in<br />

the last few decades we have learnt that in patients with low-capacity-poorly compliant bladders an<br />

Augmentation Cystoplasty (AC) will create a compliant low-pressure reservoir that will protect the kidney<br />

graft. The incidence of symptomatic UTI may be increased in transplanted patients with AC but UTI is more<br />

related with CIC non-compliance or VUR to the native kidneys than with the AC itself and usually does not<br />

lead to impairment of graft function. Today, patients with a bladder reconstruction can be transplanted with<br />

the same outcome (graft survival and function) as those with normal bladders, although the risk of malignant<br />

transformation in the augmented segment may be increased in these patients.<br />

11.45 - 12.00 Abstract presentations: Special selection from the poster sessions<br />

300 Desmopressin in the treatment of nocturia in patients affected by Parkinson’s disease<br />

S. Proietti, M. Gubbiotti, J.A. Rossi De Vermandois, A. Giannantoni (Rozzano, Perugia, Italy)<br />

441 Why anticholinergics fail: Oxybutynin and fesoterodine induce a shift from muscarinergic to purinergic<br />

transmission in the rat bladder<br />

P. Uvin, M. Boudes, J. Franken, A. Menigoz, S.J. Pinto, T. Gevaert, R. Verplaetse, J. Tytgat, R. Vennekens,<br />

T. Voets, D. De Ridder (Leuven, Belgium)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

261<br />

Monday


Monday<br />

Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

262 <strong>Programme</strong> <strong>Book</strong><br />

Thematic Session 15<br />

11.00 - 12.00 Management of pain in urology<br />

Brown Hall 1-2 - Level S2<br />

Chair: P. Bader, Karlsruhe (DE)<br />

11.00 - 11.20 State-of-the-art lecture Neuroanatomy, neurophysiology and molecular basis of pain<br />

K. Everaert, Ghent (BE)<br />

Aims and objectives<br />

We will supply an overview of neuroanatomy, neurophysiology and molecular basis of pain and will relate<br />

this to existing therapeutic options<br />

11.20 - 11.40 State-of-the-art lecture Management of pain after urological procedures<br />

E.J. Messelink, Groningen (NL)<br />

Aims and objectives<br />

This presentation will pay attention to pain mechanisms in abdominal and pelvic pain after surgery.<br />

Prevention of pain and adequate treatment will be discussed. The most important part will be the prevention<br />

of chronification of the pain. This requires pain management which is always multidisciplinary in nature. The<br />

role of the psychologist and physiotherapist will also be addressed.<br />

11.40 - 12.00 State-of-the-art lecture Tumour-related pain<br />

A. Paez Borda, Madrid (ES)


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Thematic Session 16<br />

11.00 - 12.00 Urological surgery in renal transplant patients<br />

Amber Hall 1-2 - Level S2<br />

Chairs: F.J. Burgos Revilla, Madrid (ES)<br />

A.J. Figueiredo, Coimbra (PT)<br />

11.00 - 11.15 State-of-the-art lecture Therapeutic options facing graft lithiasis<br />

J.D. Olsburgh, London (GB)<br />

Aims and objectives<br />

To highlight rate of incidental kidney stones in potential living kidney donors and rates of stones in transplant<br />

patients.<br />

To discuss issues in kidney donors and recipients including patient selection, stone management options<br />

and outcomes.<br />

To discuss management strategies for stone treatment in transplanted kidneys and outcomes.<br />

11.15 - 11.30 State-of-the-art lecture Management of allograft renal tumours<br />

M. Musquera Felip, Barcelona (ES)<br />

11.30 - 11.45 State-of-the-art lecture Treatment of ureteral stenosis<br />

M. Giessing, Düsseldorf (DE)<br />

Aims and objectives<br />

Transplant ureter strictures, occurring in about 5% of recipients after renal transplantation, can be treated<br />

with mulitple techniques. The presentation will name the different interventions as well as their success<br />

rates, from minimal invasive to open surgical approaches. Knowledge of these factors and interventional<br />

strategies will help to improve long term transplant outcome.<br />

11.45 - 12.00 State-of-the-art lecture Open versus minimally invasive living donor nephrectomy<br />

L. Salomon, Creteil (FR)<br />

Aims and objectives<br />

Living donor graft procures the best results in renal transplantation. However, perioperative morbidity<br />

with major and minor complications can occur during this challenging procedure. Open surgery with<br />

transabdominal or retroperitoneal approach provide up to 22% of complications to the donor. Development<br />

of minimally invasive surgery in urology began in 1991 with the first laparoscopic radical nephrectomy. From<br />

then on, living donor nephrectomy has been performed with evolving surgical technics: transperitoneal,<br />

extraperitoneal, hand assisted robotic assisted, single site, natural orifice living donor laparoscopic<br />

nephrectomy. The aim of this lecture is to evaluate the results of these new procedures by comparaison with<br />

those of open surgery: not only have we compared these results for the donor but also for the receiver as<br />

well as the long term results of renal transplantation<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

263<br />

Monday


Monday<br />

Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

264 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

12.15 - 13.45 Developments in cancer diagnosis and management<br />

eURO Auditorium - Level S2<br />

Video Session 8<br />

Chairs: R. Medina López, Seville (ES)<br />

D. Burke, Manchester (GB)<br />

All presentations have a maximum length of 10 minutes, followed by 4 minutes of discussion.<br />

V57 Aggressive bladder neck sparing in laparoscopic radical prostatectomy<br />

M.J. Smolski, N. McLeod, J. Graham, A. Manjunath, R. Brough, N. Oakley (Stockport, United Kingdom)<br />

V58 Intravesical and transperitoneal laparoscopy in the management of tumor in the residual ureter<br />

A.W. Branco, L. Stunitz, S. Nichele, P.H. Douat, M. Luiz, L.T. Nassif (Curitiba, Brazil)<br />

V59 En-bloc resection of non-muscle invasive bladder tumours with the combination instrument HybridKnife®<br />

J. Mundhenk, S.H. Alloussi, F. Miller, J. Hennenlotter, G. Gakis, D. Schilling, A. Stenzl, C. Schwentner<br />

(Tübingen, Neunkirchen, Germany)<br />

V60 Initial series of video endoscopic inguinal lymphadenectomy and description of the technique<br />

S. Monagas Arteaga, M.A. Alonso Prieto, F. García Diez, M. De Arriba Alonso, F.J. Gallo Rolania (Leon, Spain)<br />

V61 New 3-dimensional head-mounted display system (RoboSurgeon system) applied to gasless, single-port<br />

access adrenalectomy<br />

K. Kihara, Y. Fujii, H. Masuda, K. Saito, F. Koga, N. Numao, Y. Matsuoka (Tokyo, Japan)<br />

V62 Multiparametric MRI–US fusion targeted prostate biopsies with Varian brachytherapy software: Precision<br />

prostate cancer diagnostics<br />

P. Sturch, K. Duong, J. Kinsella, M. McGovern, A. Robinson, A. Polson, A. Chandra, G. Rottenberg, S. Morris,<br />

R. Popert (London, United Kingdom)<br />

V63 Renal tumor with cava thrombus type III-IV<br />

M.A. López-Costea, J.I. Pérez-Reggeti, J. Fabregat Prous, R. Rodriguez-Malatesta, E. Llorens, F. Vigués,<br />

E. Franco (Barcelona, Spain)<br />

V64 Prostate-sparing radical cystectomy with prostatic capsule and vasa deferentia sparing by means of Millin<br />

prostatectomy<br />

R.E. Sanchez Salas, P. Macek, F. Rozet, E. Barret, M. Galiano, L. Lunelli, X. Cathelineau (Paris, France)


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

12.15 - 13.45 Radical prostatectomy: New techniques<br />

Brown Hall 1-2 - Level S2<br />

Poster Session 66<br />

Chairs: A. Heidenreich, Aachen (DE)<br />

A. Mottrie, Aalst (BE)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion.<br />

799 Vessel sealing device with nano-coating significantly reduces heat spread for neurovascular bundle<br />

preparation<br />

R. Mackenzie, J. Skorucak, A. Mortezavi, J. Vörös, D. Eberli (Zürich, Switzerland)<br />

800 The single-knot running vesico-urethral anastomosis ten years after its introduction: Evaluation of its<br />

application, feasibility and complication rate in an international survey<br />

S. Albisinni, K. Limani, E. Hawaux, A. Peltier, R. Van Velthoven (Brussels, Belgium)<br />

801 Palliative radical (cysto)prostatectomy in locally advanced castration-resistant prostate cancer<br />

D. Porres, T. Van Erps, C. Piper, D. Pfister, A. Heidenreich (Aachen, Germany)<br />

802 Presence of disseminated tumor cells at time of radical prostatectomy is not associated with more<br />

advanced or poorly differentiated disease in patients with localized prostate cancer; potential sources of<br />

relapse?<br />

H. Isbarn, K. Effenberger, T. Schlomm, M. Rink, F.K.H. Chun, M. Fisch, H. Huland, M. Graefen, K. Pantel<br />

(Hamburg, Germany)<br />

803 Immunohistochemical ERG status is not predictive for biochemical recurrence after radical prostatectomy<br />

with positive surgical margin<br />

M. Ladurner Rennau, H. Klocker, I. Heidegger, V. Skradski, G. Schäfer, W. Horninger, J. Bektic (Innsbruck,<br />

Austria)<br />

804 Functional and quality of life analysis in a prospective series of 51 brachytherapies and 42 robotic<br />

prostatectomies. Comparative analysis<br />

C. Garcia-Sanchez, J.M. Conde-Sanchez, C.B. Congregado-Ruiz, I. Osman-Garcia, J.M. Pena-Outeiriño,<br />

E. Arguelles-Salido, R.A. Medina-Lopez (Seville, Spain)<br />

805 Biological significance of perineural invasion in radical prostatectomy specimens: Study of its prognostic<br />

significance in biochemical recurrence<br />

J.L. Ruiz Cerda, R. Rogel Berto, J.V. Salom Fuster, A. Gallego Matey, B. Plaza Viguer, A. Polo Rodrigo,<br />

F. Boronat Tormo (Valencia, Spain)<br />

806 Predictors of early biochemical recurrence after radical prostatectomy and adjuvant radiotherapy in men<br />

with pT3 N0 prostate cancer. Implications for multi-modal therapies<br />

M. Bianchi, A. Briganti, T. Wiegel, S. Joniau, F. Abdollah, M. Tutolo, C. Cozzarini, B. Tombal, K. Haustermans,<br />

W. Hinkelbein, N. Di Muzio, H. Van Poppel (Milan, Italy; Ulm, Berlin, Germany; Leuven, Louvain, Belgium)<br />

807 Characteristics of anterior predominant prostate cancer and the usefulness of multiparametric MRI in<br />

diagnosis<br />

S. Pak, S.J. Park, S.H. Song, D. You, I.G. Jeong, C. Song, J.H. Hong, C.S. Kim, H. Ahn (Seoul, South Korea)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

265<br />

Monday


Monday<br />

808 Effects of surgeon variability on oncological and functional outcomes in a population-based setting<br />

S. Carlsson, A. Berglund, D. Sjoberg, A. Khatami, J. Stranne, S. Bergdahl, G. Aus, J. Hugosson (New York,<br />

United States of America; Stockholm, Gothenburg, Sweden)<br />

809 Ink marked intraoperative frozen section of the prostate during open radical prostatectomy – prospective<br />

analysis of diagnostic and therapeutic efficacy<br />

G. Hatzichristodoulou, G. Weirich, S. Wagenpfeil, K. Herkommer, M. Autenrieth, T. Maurer, M. Thalgott,<br />

T. Horn, M. Heck, J.E. Gschwend, H. Kübler (Munich, Germany)<br />

810 Withdrawn<br />

266 <strong>Programme</strong> <strong>Book</strong><br />

Summary - does the technique matter?<br />

A. Heidenreich, Aachen (DE)


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

12.15 - 13.45 Advanced urothelial cancer: Disease outcomes<br />

Brown Hall 3 - Level S2<br />

Poster Session 67<br />

Chairs: F. Liedberg, Malmö (SE)<br />

J. Huang, Guangzhou (CN)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

811 Serum β-HCG predicts recurrence post radical cystectomy<br />

J.W.R. Douglas, T. Drake, M. Sommerlad, M. Hayes, S. Crabb (Southampton, United Kingdom)<br />

812 External validation of a multicenter prognostic model for risk stratification in pT2N0 bladder cancer<br />

T. Todenhöfer, M. Renninger, B. Al-Matar, M.F. Abdelhafez, A. Stenzl, G. Gakis (Tübingen, Germany)<br />

813 Time to disease recurrence is a strong predictor of cancer-specific mortality in upper tract urothelial<br />

carcinoma<br />

M. Rink, D. Sjoberg, E. Xylinas, V. Margulis, L.A. Kluth, E.K. Cha, J.D. Raman, M. Remzi, K. Bensalah,<br />

G. Novara, F.K. Chun, E. Kikuchi, W. Kassouf, J. Martinez-Salamanca, Y. Lotan, C. Seitz, A. Pycha,<br />

R. Zigeuner, D.S. Scherr, A.J. Vickers, S.F. Shariat (Hamburg, Germany; New York, Dallas, Hershey, United<br />

States of America; Korneuburg, Vienna, Graz, Austria; Rennes, France; Padua, Bolzano, Italy; Tokyo, Japan;<br />

Monteal, Canada; Madrid, Spain)<br />

814 Combining smoking information and molecular markers improves prognostication in patients with<br />

urothelial carcinoma of the bladder<br />

E.N. Xylinas, L. Wang, M. Kent, D. Sjoberg, L. Kluth, M. Rink, P.I. Karakiewicz, G. Novara, M. Zerbib,<br />

D. Scherr, Y. Lotan, S.F. Shariat (New York, Dallas, United States of America; Montreal, Canada; Padua, Italy;<br />

Paris, France)<br />

815 Validation of prognostic value of Bajorin criteria for cancer-specific survival in patients who have disease<br />

recurrence after radical cystectomy for urothelial carcinoma of the bladder<br />

L.A. Kluth, E. Xylinas, M. Rink, M. Kent, D. Sjoberg, M. Babjuk, A. Brisuda, A. Aziz, H-M. Fritsche,<br />

E. Comploj, A. Pycha, D. Sundi, T. Bivalacqua, G. Novara, J. Baniel, R. Mano, P. Gontero, R.S. Svatek,<br />

L. Lusuardi, A. Mitra, S. Daneshmand, Y. Lotan, D.S. Scherr, S.F. Shariat (New York, Baltimore, San Antonio,<br />

Los Angeles, Dallas, United States of America; Hamburg, Regensburg, Germany; Prague, Czech Republic;<br />

Bolzano, Padua, Turin, Italy; Petah-Tikva, Israel; Salzburg, Austria)<br />

816 Long-term outcomes of laparoscopic nephroureterectomy: 10-year follow-up<br />

J-A. Long, D. Snow-Lisy, R. Eyraud, R. Miocinovic, R. Stein, J. Kaouk, G-P. Haber (Cleveland, United States of<br />

America)<br />

817 Elective segmental ureterectomy for transitional cell carcinoma of the ureter: Long term follow-up in a 73<br />

patients series<br />

A. Simonato, A. Benelli, V. Varca, A. Gregori, M. Ennas, A. Lissiani, M. Gacci, S. De Stefani, M. Rosso,<br />

S. Benvenuto, G. Siena, E. Belgrano, F. Gaboardi, M. Carini, G. Bianchi, G. Carmignani (Genoa, Milan,<br />

Trieste, Florence, Modena, Italy)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

267<br />

Monday


Monday<br />

818 Site specific pattern of metastatic behavior in upper tract urothelial carcinoma treated with radical<br />

nephroureterectomy<br />

K. Ishioka, E. Kikuchi, N. Tanaka, K. Kanao, K. Matsumoto, H. Kobayashi, H. Ide, Y. Miyazaki, J. Obata,<br />

S. Shirotake, H. Akita, T. Kosaka, A. Miyajima, T. Momma, Y. Nakajima, S. Hasegawa, K. Nakagawa,<br />

M. Jinzaki, M. Oya (Tokyo, Saitama, Tochigi, Kanagawa, Japan)<br />

819 Equivalent survival after distal ureterectomy compared to nephroureterectomy in patients with urothelial<br />

carcinoma of the distal ureter: A propensity score-matched multi-center study<br />

H. Fukushima, K. Saito, J. Ishika, Y. Matsuoka, N. Numao, F. Koga, H. Masuda, Y. Fujii, Y. Sakai, C. Arisawa,<br />

T. Okuno, J. Yonese, S. Kamata, K. Nagahama, A. Noro, S. Morimoto, T. Tsujii, S. Kitahara, S. Gotoh,<br />

Y. Higashi, K. Kihara (Tokyo, Chiba, Ibaraki, Saitama, Shizuoka, Japan)<br />

820 A population-based competing-risks analysis of survival after nephroureterectomy for upper tract<br />

urothelial carcinoma<br />

A. Abdo, F. Roghmann, A. Becker, M. Meskawi, P.I. Karakiewicz, N. Hanna, M. Sun (Montreal, Canada;<br />

Herne, Hamburg, Germany)<br />

* 821 Therapeutic benefit from template-based lymphadenectomy in urothelial carcinoma of the renal pelvis -<br />

multi-institutional prospective study<br />

T. Kondo, I. Hara, T. Takagi, Y. Kodama, Y. Hashimoto, J. Iizuka, K. Omae, E. Ikezawa, K. Yoshida, K. Tanabe<br />

(Tokyo, Wakayama, Japan)<br />

822 Prognostic factors and outcomes after definitive treatment for primary urethral cancer: Results from the<br />

International Collaboration on Primary Urethral Carcinoma (ICPUC)<br />

G. Gakis, S. Daneshmand, J.A. Efstathiou, B. Ali-El-Dein, J. Hrbacek, K.A. Keegan, S. Galland, R. Clayman,<br />

L. Weissbach, J. Brunner, T. Todenhöfer, M. Rink, H-M. Fritsche, M. Babjuk, G.N. Thalmann, A. Stenzl<br />

(Tübingen, Hamburg, Regensburg, Germany; Los Angeles, Boston, Nashville, United States of America;<br />

Mansoura, Egypt; Prague, Czech Republic; Berne, Switzerland)<br />

268 <strong>Programme</strong> <strong>Book</strong><br />

Summary<br />

R. Inman, Sheffield (GB)


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

12.15 - 13.45 Evidence-based prostate cancer therapies in cellular and animal<br />

models<br />

Amber Hall 1-2 - Level S2<br />

Poster Session 68<br />

Chairs: F.R. Santer, Innsbruck (AT)<br />

T. Visakorpi, Tampere (FI)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

823 Transcriptional down-regulation of the androgen receptor by promoter G-quadruplex stabilisation; a<br />

potential alternative treatment in castrate-resistant prostate cancer<br />

T.J. Mitchell, A. Ramos-Montoya, M. Di Antonio, P. Murat, S. Ohnmacht, M. Micco, L. Fryer,<br />

S. Balasubramanian, S. Neidle, D.E. Neal (Cambridge, London, United Kingdom)<br />

* 824 Abiraterone is able to block AR activation induced by accumulating levels of precursor hormones resulting<br />

from CYP17A1 inhibition<br />

J.M. Moll, R.J. Van Soest, J. Kumagai, R. Graeser, I. Hickson, G.W. Jenster, W.M. Van Weerden (Rotterdam,<br />

The Netherlands; Beerse, Belgium)<br />

825 Modification of the integrins a2, a5 and b1 plays a particularly critical role in metastatic spread of RAD001resistant<br />

prostate cancer cells<br />

I. Tsaur, J. Makarevic, M. Kurosch, M. Reiter, G. Bartsch, A. Haferkamp, R. Blaheta (Frankfurt, Germany)<br />

826 Targeting STAT3 in castration-resistant prostate cancer - identification of STAT3 as a direct target of the<br />

fungal metabolite galiellalactone<br />

N. Don-Doncow, M. Johansson, Z. Escobar, O. Sterner, A. Bjartell, R. Hellsten (Malmö, Lund, Sweden)<br />

827 Novel anticancer effect of proteasome inhibitor on prostate cancer cells targeting prostate-specific<br />

membrane antigen and androgen receptor<br />

K. Kuroda, A. Horiguchi, T. Asano, S. Tasaki, J. Asakuma, A. Sato, K. Seguchi, K. Ito, T. Asano (Tokorozawa,<br />

Saitama, Japan)<br />

828 Antitumor activity of nanovectors encapsulating zoledronic acid (ZOL) in 3D prostate carcinoma spheroids<br />

J. Schmidt, J. Kamradt, M. Stöckle, G. Derosa, A. Lombardi, M. Caraglia, G. Unteregger (Homburg, Germany;<br />

Naples, Italy)<br />

829 Improvement of efficacy of insulin-like growth-factor receptor (IGF)-targeting-therapies by co-targeting<br />

insulin receptor A in prostate cancer<br />

I. Heidegger, J. Kern, P. Massoner, H. Klocker (Innsbruck, Austria)<br />

830 Resistance towards temsirolimus is counteracted by epigenetic intervention<br />

J. Makarevic, I. Tsaur, E. Jüngel, A. Haferkamp, R. Blaheta (Frankfurt, Germany)<br />

831 Mesenchymal stem cells carrying prodrug-activating enzymes inhibit tumor growth in immune-competent,<br />

prostate cancer-bearing mice<br />

A. Abrate, R. Buono, F Benigni, P. Hedlund, I.T.R. Cavarretta (Milan, Italy)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

269<br />

Monday


Monday<br />

832 Mesenchymal stem cell mediated cancer therapy in the transgenic adenocarcinoma of the mouse prostate<br />

(TRAMP) model<br />

R. Buono, A. Abrate, A. Esposito, T. Canu, A. Del Maschio, F. Benigni, P. Hedlund, I.T.R. Cavarretta (Milan,<br />

Italy)<br />

833 Monitoring the effects of therapeutic fatty acid synthase inhibition in prostate canecr using 11C acetate PET<br />

G.L. Shaw, D. Lewis, J. Boren, A. Ramos-Montoya, D. Soloviev, R. Bielik, K. Brindle, D. Neal (Cambridge,<br />

United Kingdom)<br />

834 5-aminolevulinic acid-mediated photodynamic therapy for prostate cancer<br />

H. Fukuhara, K. Inoue, T. Shuin (Nankoku, Japan)<br />

835 IL-15 inhibits expression of killer inhibitory NK receptors and upregulates expression of NKG2D on NK and<br />

NKT cells in prostate cancer-PBMC cocultures<br />

O. Elhage, C-A. Sakellariou, O. Ukimura, I. Gill, R.A.G. Smith, C. Galustian, P. Dasgupta (London, United<br />

Kingdom; Los Angeles, United States of America)<br />

270 <strong>Programme</strong> <strong>Book</strong>


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

12.15 - 13.45 Male infertility: Clinical issues<br />

Amber Hall 7-8 - Level S2<br />

Poster Session 69<br />

Chairs: W. Aulitzky, Vienna (AT)<br />

S. Micic, Belgrade (RS)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion.<br />

836 The validity of testicular aspirate cytology and DNA image analysis of the aspirate in the assessment of<br />

infertile men<br />

S.E. Abou Hashem, E. Sabaa, S. Mostafa, A. Abdalla, H. Maramhy, M. Mostafa, D. Elsayed, E. Ibrahim,<br />

A. Maroof, M. Eladl (Zagazig, Egypt; Almadena Almonawarah, Saudi Arabia)<br />

837 Withdrawn<br />

838 Should older patients be offered varicocele repair to improve their fertility?<br />

G. Ollandini, G. Liguori, G. Mazzon, S. Benvenuto, B. De Concilio, S. Bucci, R. Napoli, M. Rizzo, P. Umari,<br />

N. Pavan, G. Chiriacò, C. Trombetta (Trieste, Italy)<br />

839 Laparoendoscopic single-site surgery with a single channel versus conventional laparoscopic varicocele<br />

ligation: A prospective randomized study<br />

B.X. Xue, Y.X. Shan, J. Wang, J. Zhu, W. Tao, Y. Cui, Q. Yao (Suzhou, China)<br />

840 Standardization of varicocele: Is it possible?<br />

X.K. Wang, W.L. Wang, H.Z. Wang, L. Che, D.J. Fu, M.K. Lai, Y.P. Liu (Xiamen, Beijing, China)<br />

841 Robotic assisted re-do vasectomy reversal for previously failed pure microsurgical reversal<br />

A. Gudeloglu, J. Brahmbhatt, T. Patel, K. Priola, S. Parekattil (Winter Haven, United States of America)<br />

842 Clinical assessment of microdissection testicular sperm extraction in 313 patients with non-obstructive<br />

azoospermia<br />

K. Yamaguchi, K. Chiba, K. Matsushita, K. Okada, N. Enatsu, H. Miyake, M. Fujisawa (Kobe, Japan)<br />

843 Do cell phones affect semen quality?<br />

V. Boulos, H. Hassan (Cairo, Egypt)<br />

844 Endoscopy of the vas deference – a new diagnostic and therapeutic tool in andrology<br />

M. Trottmann, A. Becker, B. Liedl, C. Stief, M. Graw, C. Braun, S. Kölle (Munich, Germany)<br />

845 Choice of antibiotic therapy for chronic bacterial prostatitis in patients with infertility<br />

M.I. Kogan, H.S. Ibishev, Y.L. Naboka, K.A. Shiranov, A.H. Ferzauli, I.A. Gudima (Rostov on Don, Russia)<br />

846 <strong>EAU</strong> guideline reduces unnecessary post vasectomy semen analyses<br />

E.M. Gordon, S.A Gordon, A. Hatton, J. Kasraie, N.N.K Lynn (Shrewsbury, Colchester, United Kingdom)<br />

847 Probe–based Confocal Laser Endomicroscopy (pCLE) - a new imaging technique for in situ localization of<br />

vital spermatozoa<br />

M. Trottmann, B. Liedl, A. Becker, C. Gratzke, C. Füllhase, C. Stief, S. Kölle (Munich, Germany)<br />

Discussion on poster 847<br />

S. Micic, Belgrade (RS)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

271<br />

Monday


Monday<br />

Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

272 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

12.15 - 13.45 Prostate cancer: Biomarkers<br />

Silver Hall - Level N2<br />

Poster Session 70<br />

Chairs: S. Crouzet, Lyon (FR)<br />

A. Haese, Hamburg (DE)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion.<br />

848 Clinical performance of serum isoform [-2]proPSA (p2PSA) and its derivatives, namely %p2PSA and PHI<br />

(Prostate Health Index) in men with family history of prostate cancer. Results from a multicentric European<br />

study (PROMEtheuS project)<br />

M. Lazzeri, G. Lughezzani, G. Lista, A. Larcher, A. Cestari, N. Buffi, A. Haese, A. Renter, A. De La Taille,<br />

P.O. Bosset, P. Le Corvoisier, T. McNicholas, L. Fowler, J.W. Roux, J. Palou, A. Breda, P. De La Torre, V. Bini,<br />

M. Graefen, G. Guazzoni (Milan, Perugia, Italy; Hamburg, Germany; Creteil, France; Stevenage, United<br />

Kingdom; Barcelona, Spain)<br />

849 Decreasing cancer specific PSA density (CaPSAD) is a hallmark of local prostate tumour progression<br />

with prognostic relevance independent of serum PSA, and reflects a systematic alteration in androgen<br />

signalling<br />

N.M. Corcoran, M.K.H. Hong, N. Sapre, C.J. Nowell, J. Pedersen, G. Macintyre, R.K. Gaire, A. Kowalczyk,<br />

L.M. Harewood, J.S. Peters, A.J. Costello, C.M. Hovens (Melbourne, Australia)<br />

850 A prediction based on levels of four kallikrein markers in blood improves preoperative prediction of<br />

indolent versus<br />

S. Carlsson, A. Maschino, E. Steyerberg, T. Van Der Kwast, A. Van Leenders, A. Vickers, H. Lilja, M. Roobol<br />

(New York, United States of America; Rotterdam, The Netherlands)<br />

851 Lower PCA3 scores in prostate cancer patients with metastatic disease than in patients with nonmetastatic<br />

disease: Baseline data from the Triptocare study<br />

L. Martínez-Piñeiro, J. Schalken, A. De La Taille (Madrid, Spain; Nijmegen, The Netherlands; Creteil, France)<br />

852 Cost evaluation of introducing the Prostate Health Index (phi) in the management of prostate cancer<br />

diagnostic<br />

C. Castelli, R. Mathieu, T. Fardoun, K. Bensalah, S. Vincendeau (Nimes, Rennes, France)<br />

853 [-2]proPSA and prostate health index (phi) improve detection of prostate cancer at initial and repeated<br />

biopsies in young men (≤ 60 year old) preferentially detecting clinically significant cancer<br />

C. Stephan, S. Vincendeau, A. Houlgatte, K. Miller, A. Semjonow (Berlin, Münster, Germany; Rennes, Paris,<br />

France)<br />

854 PSA determinations with microfluidics: A novel point-of-service bioassay<br />

M.S. Zappala, J. Libertino, A. Wein, E.D. Vaughan, P. Scardino (Andover, Burlington, Philadelphia, New York,<br />

United States of America)<br />

855 Definition of the Limit of Detection (LoD) for serum isoform [-2]proPSA in patients with recurrent prostate<br />

cancer after radical prostatectomy: An analytic study<br />

F. Ceriotti, M. Pontillo, L. Fasoli, M. Lazzeri, G. Lughezzani, G. Lista, A. Larcher, A. Cestari, N. Buffi, G. Fuzzi,<br />

G. Guazzoni (Milan, Florence, Italy)


856 Reducing the number of prostate biopsies – validation of a four kallikrein panel to predict prostate cancer<br />

in a population-based referral cohort<br />

K. Braun, H.G. Lilja, A.J. Vickers, D. Sjoberg, A. Bjartell (Herne, Germany; New York, United States of<br />

America; Malmö, Sweden)<br />

857 Relationship between PSA level and impairment of proteinase-inhibitory balance of key proteolytic<br />

systems during androgen-deprivation therapy for prostate cancer<br />

M.I. Kogan, M.B. Chibichyan, E.A. Chernogubova (Rostov on Don, Russia)<br />

858 Baseline PSA level in prediction of prostate cancer risk and aggressiveness: A Danish population-based<br />

cohort study<br />

S. Benzon Larsen, K. Brasso, S.O. Dalton, J. Christensen, M. Christiansen, S. Calsson, H. Lilja, S. Friis,<br />

A. Tjønneland, P. Iversen (Copenhagen, Denmark; New York, United States of America)<br />

859 Parallel measurement of urinary PCA3 and TMPRSS2:ERG with serum [-2]proPSA based Phi for prostate<br />

cancer detection<br />

C. Stephan, A. Semjonow, K. Schulze-Forster, H. Cammann, X. Hu, K. Miller, K. Jung, F. Friedersdorff (Berlin,<br />

Münster, Luckenwalde, Germany)<br />

860 Influence of metabolic syndrome on prostate volume and prostate specific antigen<br />

W.S. Choi, C.J. Lee, S.B. Ha, S.Y. Cho, N.J. Heo, H. Jeong, J.S. Paick, H. Son (Seoul, South Korea)<br />

861 Chemopreventive properties of the flavonoids genistein and quercetin in men with rising PSA: First results<br />

of a double-blind, randomized, placebo-controlled trial (QUERGEN trial)<br />

A. Galasso, S. Aufderklamm, A. Damms-Machado, F. Miller, S.C. Bischoff, A. Stenzl, G. Gakis (Hohenheim,<br />

Tübingen, Germany)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

273<br />

Monday


Monday<br />

Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

274 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

12.15 - 13.45 Complex urological reconstructions and tissue engineering<br />

Red Hall 1 - Level N1<br />

Poster Session 71<br />

Chairs: T.A. Drewa, Bydgoszcz (PL)<br />

S.G. Joniau, Leuven (BE)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion.<br />

862 Health related quality of life after radical cystectomy: Comparative study between orthotopic sigmoid<br />

versus ileal neobladders<br />

H. Miyake, J. Furukawa, M. Muramaki, M. Fujisawa (Kobe, Japan)<br />

863 Ileocecal cup patch plasty as secondary continence mechanism in selected cases of outlet failure in<br />

continent cutaneous urinary diversion: Surgical technique and clinical results<br />

D.C. Vergho, C. Bauer, A. Kocot, A. Loeser, H. Riedmiller (Würzburg, Germany)<br />

864 Y-neobladder: An update of a multi-institutional retrospective study. Analysis of late complications<br />

through Clavien-Dindo classification<br />

P. Destefanis, A. Bosio, M.T. Carchedi, A. Battaglia, M. Allasia, A. Gonella, G. Fasolis, M. Bellina, M. Mari,<br />

S. Crivellaro, B. Frea, G. Marchioro, C. Terrone, M. Maffezzini, G. Carrieri, G. Morgia, D. Fontana (Turin,<br />

Alba, Rivoli, Udine, Novara, Genua, Foggia, Messina, Italy)<br />

865 Long term follow up for ileal conduit urinary diversion: Patients perspective in the absence of guidelines<br />

A.M. Abdelbaky, J. O’Donovan, R. Pickard (Newcastle upon Tyne, United Kingdom)<br />

866 Modified Y/V-plasty for the treatment of recurrent bladder neck contracture: Outcome and patient<br />

satisfaction<br />

C.P. Reiss, P. Schriefer, W. Struss, B. Schwaiger, H. Isbarn, O. Engel, S. Riechardt, M. Fisch, S. Ahyai,<br />

R. Dahlem (Hamburg, Germany)<br />

867 Outcome of Y-V plasty as a final option in patients with recurrent bladder neck sclerosis after failed<br />

endoscopic treatment<br />

K.A.M. Sayedahmed, M. Salman, M. Aragona, R. Seibel, J. Ekrutt, M. Reichert, R. Olianas (Lueneburg,<br />

Germany)<br />

868 Longterm cell-demanded release of TG-VEGF for the development of mature vascular networks for<br />

sphincter muscle engineering in vivo<br />

J. Marshall, R. Largo, A. Mortezavi, A. Sala, A. Banfi, M. Ehrbar, D. Eberli (Zürich, Basel, Switzerland)<br />

869 The novel biocomposite enhanced urinary bladder regeneration by inducing smooth muscle regrowth and<br />

preventing scar tissue formation – animal model study<br />

J.A. Adamowicz, J.T. Tworkiewicz, T.K. Kowalczyk, M.P. Pokrywczyńska, M.B. Bodnar, A.M. Marszałek,<br />

T.D. Drewa (Bydgoszcz, Warsaw, Poland)<br />

870 Prenatal coverage of an experimental spina bifida defect by gluing a growth factor loaded collagen<br />

scaffold improves neurological outcome<br />

L.A.J. Roelofs, A.J. Eggink, W.F. Daamen, T.H. Kuppevelt, M.M.Y. Lammens, A.J. Crevels, L.H. Olde Damink,<br />

I. Heschel, P.J. Geutjes, W.F.J. Feitz (Nijmegen, Rotterdam, The Netherlands; Herzogenrath, Germany)


871 Bladder wall substitution with autologously seeded collagen scaffolds “Optimaix” in a Göttingen minipig<br />

model<br />

D. Leonhäuser, V. Seifarth, K. Strick, N. Gaisa, I. Heschel, R.H. Tolba, A. Artmann, J.O. Grosse (Aachen,<br />

Jülich, Herzogenrath, Germany)<br />

872 Tubular constructs for urinary diversion: A feasibility study in pigs<br />

M. Sloff, P.J. Geutjes, H.R. Hoogenkamp, V. Simaioforidis, T.H. Van Kuppevelt, W.F. Daamen, E. Oosterwijk,<br />

W.F. Feitz (Nijmegen, The Netherlands)<br />

873 Reducing the risk in the production of tissue engineered buccal mucosa for urethral reconstruction<br />

A.J. Bullock, C.R. Chapple, S. MacNeil (Sheffield, United Kingdom)<br />

874 Bioengineered skeletal muscle for the treatment of sphincter insufficiency characterized by MRI<br />

relaxometry<br />

F. Azzabi, N. Chuck, A. Boss, D. Eberli (Zürich, Switzerland)<br />

Summary on tissue engineering<br />

T.A. Drewa, Bydgoszcz (PL)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

275<br />

Monday


Monday<br />

Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

276 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

12.15 - 13.45 How to reduce warm ischemia in partial nephrectomy<br />

Red Hall 2 - Level N1<br />

Poster Session 72<br />

Chairs: H-C. Klingler, Vienna (AT)<br />

F. Porpiglia, Turin (IT)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

* 875 To clamp or not to clamp during laparoscopic partial nephrectomy: A scintigraphic study of impact on renal<br />

function<br />

F. Porpiglia, I. Morra, R. Bertolo, D. Amparore, C. Fiori (Turin, Italy)<br />

876 Perioperative and functional outcomes of robotic assisted partial nephrectomy without hilar clamping: A<br />

multi-institutional propensity score analysis<br />

B. Kaczmarek, R. Kumar, Y. Tanagho, S. Hillyer, J. Mullins, M. Diaz, Q-D. Trinh, S. Bhayani, M. Stifelman,<br />

J. Kaouk, C. Rogers (Detroit, Saint Louis, Cleveland, Baltimore, New York, United States of America)<br />

877 A clinical study of laparoscopic nephron-sparing partial nephrectomy with temporary blocking-up<br />

segmental branch of renal artery technique<br />

F. Chen (Guiyang, China)<br />

878 Application of vasculature model and standardization of renal hilar approach in laparoscopic partial<br />

nephrectomy with precise segmental artery clamping<br />

C.J. Yin (Nanjing, China)<br />

879 Towards zero ischaemia laparoscopic partial nephrectomy: Single centre experience<br />

J.K. Makanjuola, A. Qteishat, M. Lynch, A. Rao, C. Brown, C. Kouriefs, M. Arya, P. Grange (London, United<br />

Kingdom)<br />

880 Functional outcome of nephron sparing surgery: Impact of warm ischemia less than 30 min vs no ischemia<br />

and role of endothelin-1<br />

A. Morlacco, S. Crivellaro, G. Romano, L. Tosco, B. Frea (Udine, Italy)<br />

881 Feasibility and safety of zero ischemia robotic assisted partial nephrectomy with controlled hypotension<br />

for tumors larger than 4 cm<br />

R. Papalia, G. Simone, M. Ferriero, S. Guaglianone, E. Forastiere, M. Gallucci (Rome, Italy)<br />

882 Early unclamping surgical technique for robot-assisted partial nephrectomy: A multicenter prospective<br />

experience<br />

A.A. Wagner, K. Zeeck, P. Chang, A. Percy, G. Rao, K. Attwood, D. Mehedint, L. Digiorgio, T. Schwaab<br />

(Boston, Buffalo, United States of America)<br />

883 Near-infrared fluorescence for laparoscopic partial nephrectomy<br />

P. Macek, E. Barret, F. Rozet, R.E. Sanchez-Salas, M. Galiano, P. Ahallal, J.M. Gaya, X. Cathelineau (Paris,<br />

France)<br />

884 Laparoscopic partial nephrectomy without ischemia using a new 1,318 nm diode laser in a porcine<br />

survival model: Histological results after 4 weeks survival<br />

R.P. Zimmermann, E.E. Foditsch, M. Hager, L. Lusuardi, B. Hoinoiu, G. Janetschek (Salzburg, Austria;<br />

Timisoara, Romania)


885 Intracorporeal cooling and extraction (I.C.E.) technique of robotic partial nephrectomy: Emulating the open<br />

approach<br />

C.G. Rogers, K.R. Ghani, R.K. Kumar, W. Jeong, M. Menon (Detroit, United States of America)<br />

886 Partial nephrectomy for the treatment of renal cell carcinoma and the risk of end stage renal disease<br />

S.A. Yap, S.M. Alibhai, G.A. Tomlinson, D.R. Urbach, A. Finelli (Toronto, Canada)<br />

887 Efficacy of floseal® vs tachosil® vs no hemostatic agents for partial nephrectomy: A prospective<br />

multicenter comparative study (RECORd Project)<br />

A. Antonelli, A. Minervini, N. Arrighi, G. Bianchi, S. Cosciani Cunico, V. Ficarra, C. Fiori, G. Martorana,<br />

A. Lapini, M. Medica, V. Mirone, N. Pinzi, F. Porpiglia, F. Rocco, B. Rovereto, R. Schiavina, S. Serni,<br />

C. Simeone, C. Terrone, A. Volpe, F. Zattoni, M. Carini (Brescia, Florence, Modena, Padua, Orbassano,<br />

Bologna, Sestri Levante, Naples, Lucca, Milan, Pavia, Novara, Italy)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

277<br />

Monday


Monday<br />

Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

278 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

12.15 - 13.45 What is new in female urology<br />

Blue Hall 1-2 - Level N1<br />

Poster Session 73<br />

Chairs: K-D. Sievert, Tübingen (DE)<br />

A. Wagg, Edmonton (CA)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

888 Psychometric validation of a 3-day bladder diary model for lower urinary tract symptoms<br />

L. López-Fando Lavalle, M.A. Jimenez Cidre, M. Esteban Fuertes, F.J. Llorens Martinez, J. Salinas Casado,<br />

D. Castro Diaz, C. Müller Arteaga, J.M. Adot Zurbano, F. Rodriguez Escobar, M.A. Bonillo Garcia, B. Madurga<br />

Patuel, M. Leva Vallejo, L. Peri Cusi, J. Conejero Sugrañes, J. Jiménez Calvo (Madrid, Toledo, Elche, Tenerife,<br />

Vigo, Burgos, Barcelona, Valencia, Cádiz, Cordoba, Sevilla, Spain)<br />

889 The Multiple Array Probe (MAPLe): A new tool capable of measuring EMG and differentiate between<br />

individual pelvic floor muscles<br />

P.J. Voorham-Van der Zalm, H.C. Voorham, C.W.L. Van Den Bos, H. Putter, M.C. De Ruiter, R.C.M. Pelger<br />

(Leiden, The Netherlands)<br />

890 Catheterless long-term urodynamics with three devices<br />

S. Wille, J. Hamacher, D. Tenholte, N. Muthen, M. Al Mahmid, J. Mehner, U.H. Engelmann (Cologne,<br />

Chemnitz, Germany)<br />

891 Does structural differences in type I synthetic slings have an impact on biocompatibility? Long-term<br />

evaluation of tissue reaction to two synthetic slings in an animal model: TVT-O® vs I-STOP®<br />

O. El Yazami Adli, O. Loutochin, W. Mahfouz, M. Caremel, J. Corcos (Montreal, Canada)<br />

892 Oral lactobacilli vs antibiotic prophylaxis for recurrent urinary tract infections in premenopausal women<br />

N. Stepanova, V. Kruglikov, L. Lebid, M. Kolesnyk (Kiev, Ukraine)<br />

893 Asymptomatic bacteriuria in pregnant women<br />

A. Lavrinenko, S. Kuderinov, I. Azizov, I. Belyaev, Y. Serbo, P. Deriglazova (Karaganda, Kazakhstan)<br />

894 Recurrent urinary tract infections in adult women: A pilot study with oral d-mannose<br />

D. Porru, A. Parmigiani, D. Barletta, D. Choussos, S. Bassi, O. Miller, B. Gardella, R.E. Nappi, A. Spinillo,<br />

B. Rovereto (Pavia, Italy)<br />

895 Altis® single-incision sling procedure for stress urinary incontinence: Short term outcomes from a single<br />

centre<br />

J. Dias, A.R. Freitas, R.F. Amorim, P. Espiridião, L. Xambre, L. Costa, L. Ferraz (Gaia, Oporto, Portugal)<br />

* 896 Mid-term follow-up after Ajust single incision sling implantation for women stress urinary incontinence:<br />

Efficacy, complications and prognostic factors<br />

J-N.L. Cornu, D. Lizée, L. Peyrat, C. Ciofu, N. Henry, P. Sèbe, O. Cussenot, F. Haab (Paris, France)<br />

897 The “Tissue Fixation mini-sling System (TFS)” – a novel system for reconstructive surgery of pelvic floor<br />

dysfunctions in women, following the Integral-Theory. First results in 54 women<br />

F.M.E. Wagenlehner, O. Fröhlich, T. Bschleipfer, B. Altinkilic, A. Gunnemann, B. Liedl, W. Weidner (Giessen,<br />

Detmold, Munich, Germany)


* 898 Mini-Arc for the treatment of female stress urinary incontinence: Long-term evaluation by patient<br />

reported outcomes<br />

R.M. Oliveira, A.O. Resende, C.M. Silva, P.D. Oliveira, F.M. Cruz (Porto, Portugal)<br />

Where do we go with mini-slings<br />

K-D. Sievert, Tübingen (DE)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

279<br />

Monday


Monday<br />

Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

280 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

12.15 - 13.45 BPH: Genes, biomarkers and beyond<br />

Yellow Hall 1-2-3 - Level N1<br />

Poster Session 74<br />

Chairs: A. Bachmann, Basel (CH)<br />

R.W.G. Watson, Dublin (IE)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

899 Surface CD24 distinguishes undifferentiated from transit-amplifying cells in the basal layer of the human<br />

prostate<br />

N. Petkova, J. Hennenlotter, T. Todenhöfer, M. Sobiesiak, S. Aufderklamm, M. Scharpf, A. Stenzl, H. Bühring,<br />

C. Schwentner (Tübingen, Germany)<br />

* 900 Targeting both the dynamic and static components of LUTS/BPH using a soluble guanylate cyclase<br />

stimulator compared to vardenafil: Preclinical evidences<br />

D. Behr-Roussel, A. Oudot, S. Oger, D. Gorny, P. Sandner, J. Bernabé, L. Alexandre, F. Giuliano (Montigny-Le-<br />

Bretonneux, France; Wuppertal, Germany)<br />

901 SRD5A1 and SRD5A2 genes are associated with the treatment for benign prostatic hyperplasia with the<br />

combination of 5α-reductase inhibitors and α-adrenergic-receptor antagonist<br />

X. Gu, R. Na, W. Li, S. Tao, L. Tian, Z. Chen, Y. Jiao, J. Kang, S. Zheng, J. Xu, J. Sun, J. Qi (Shanghai, China;<br />

Winston-Salem, United States of America)<br />

902 Is the androgen receptor the link between inflammation and benign prostatic hyperplasia?<br />

J.M. Willder, V.C. Walker, T. Christ, G.L. Halbert, C.P.C, Dick, C. Orange, T. Qayyum, P.G. Horgan,<br />

M.A. Underwood, J. Edwards (Glasgow, United Kingdom)<br />

903 Different high-fat diets induce overweight, insulin resistance and structural alterations on prostate rats<br />

A. Furriel, P.C. Silva, P.C.G.P. Silva, D.B. De Souza, W.S. Costa, F.J.B. Sampaio, B.M. Gregório (Rio de Janeiro,<br />

Brazil)<br />

904 Is the cyclic AMP signaling a pivotal player in the control of prostate smooth muscle? A biochemical and<br />

functional approach<br />

S. Ückert, E.S. Waldkirch, G.T. Kedia, M.A. Kuczyk (Hanover, Germany)<br />

* 905 Phosphorylation of the androgen receptor at serine 308 may link benign prostate enlargement to<br />

cardiovascular disease<br />

J.M. Willder, V. Walker, T. Christ, G.L. Halbert, C.P.C. Dick, C. Orange, P.G. Horgan, M.A. Underwood,<br />

J. Edwards (Glasgow, United Kingdom)<br />

906 Inhibition of EFS-, phenylephrine-, and thromboxane-induced contraction of human prostate smooth<br />

muscle by the receptor antagonist, picotamide<br />

M. Hennenberg, M. Miljak, F. Strittmatter, Y. Hocaoglu, B. Rutz, C. Füllhase, C.G. Stief, C. Gratzke (Munich,<br />

Germany)<br />

907 Noradrenaline induces binding of clathrin light chain A to alpha1A-adrenoceptors in the human prostate<br />

M. Hennenberg, J. Miersch, B. Rutz, F. Strittmatter, S. Walther, R. Waidelich, A. Roosen, C.G. Stief, C. Gratzke<br />

(Munich, Germany)


908 The alteration of matrix metalloproteinase - 2, 9 and the expression of prostate specific antigen within the<br />

prostatic tissue following acute urinary retention of non-malignant etiology in rats<br />

W. Djatisoesanto, I.K. Sudiana, D.M. Soebadi (Surabaya, Indonesia)<br />

909 The effects of soluble guanylyl cyclase stimulator alone and in combination with a phosphodiesterase type<br />

5 inhibitor in normal rats and rats with partial urethral obstruction induced bladder overacticvity<br />

C. Fullhase, M. Hennenberg, P. Sandner, R. Soler, C. Stief, K.E. Andersson (Munich, Wuppertal, Germany;<br />

Sao Paulo, Brazil; Winston-Salem, United States of America)<br />

910 A systematic review and meta-analysis of candidate gene association studies of lower urinary tract<br />

symptoms in men<br />

A. Mangera, R. Cartwright, K.A.O. Tikkinen, T. Palmer, J. Pesonen, P. Rajan, C. Ambrose, A.C. Kirby,<br />

G. Thiagamoorthy, V. Khullar, P.R. Bennett, A. Walley, M-R. Jarvelin, C.R. Chapple (Sheffield, London,<br />

Bristol, Glasgow, United Kingdom; Hamilton, Canada; Tampere, Finland; San Diego, United States of<br />

America)<br />

Summary: Results from the Goliath study<br />

A. Bachmann, Basel (CH)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

281<br />

Monday


Monday<br />

Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

282 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

14.00 - 15.30 Challenging reconstructive surgery<br />

eURO Auditorium - Level S2<br />

Video Session 9<br />

Chairs: L. Peri Cusi, Barcelona (ES)<br />

G.A.N. Pignot, Le Kremlin Bicetre (FR)<br />

All presentations have a maximum length of 10 minutes, followed by 4 minutes of discussion.<br />

V65 Laparoscopic bladder augmentation and Mitrofanoff appendicovesicostomy: Saint Augustin technique<br />

D. Rey, M. Oderda, E. Helou, L. Lopez, P.T. Piechaud (Bordeaux, France)<br />

V66 Laparoscopic ureteric reimplantation for missed ureteric injury after gynaecological surgery<br />

M.J. Smolski, N. McLeod, S.C. Brown, N. Oakley (Stockport, United Kingdom)<br />

V67 Repair of recto-urethral fistula with perineal approach and interposition of gracilis muscle<br />

R. Sanseverino, G. Napodano, O. Intilla, U. Di Mauro, G. Molisso, T. Realfonso (Nocera Inferiore, Italy)<br />

V68 Transanal repair of rectovesical fistula after radical prostatectomy using the modified Latzko technique<br />

T. Nomura, M. Kawaguchi, K. Kayanuma, S. Suzuki, J. Kobayashi, H. Ishikawa (Yamanashi, Japan)<br />

V69 Mini-invasive transrectal repair of recto-urinary fistula after radical prostatectomy<br />

G. Nicita, V. Li Marzi, M. Mencarini, A. Cocci, D. Villari, M. Marzocco (Florence, Italy)<br />

V70 Reconstruction of complicated redo-hypospadia in two stages with buccal mucosal graft<br />

J. Beier, A. Pandey, H. Keller (Hof, Germany)<br />

V71 Combined therapy of stress urinary incontinence and erectile dysfunction with the implantation of Advance<br />

(XP) and AMS 700 in a single procedure<br />

B. Amend, S. Kruck, S.K. Wilson, L. Hakim, B.S. Christine, J. Brady, E.R. Castane, C. Rojas-Cruz, A. Stenzl,<br />

J. Bedke, K-D. Sievert (Tübingen, Germany; Indio, Cleveland, Homewood, Orlando, United States of America;<br />

Barcelona, Spain)<br />

V72 Laparoscopic ureteral reimplantation in Hautmann’s neobladder<br />

J.A. Peña, M. Oliveira, J.M. Santillana, A. Rosales, J. Palou, H. Villavicencio (Barcelona, Spain)


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

14.00 - 15.30 Surgical approaches for prostate cancer<br />

Brown Hall 1-2 - Level S2<br />

Poster Session 75<br />

Chairs: M. Burchardt, Greifswald (DE)<br />

B. Rocco, Milano (IT)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

* 911 Oncological outcome and prognostic factors for locally advanced prostate cancer treated with radical<br />

prostatectomy: An EMPaCT study<br />

C.Y. Hsu, M. Spahn, A. Briganti, J. Karnes, P. Gontero, G. Marchioro, B. Tombal, J. Chun, P. Bastian, H. Van<br />

Der Poel, R. Sanchez-Salas, S. Joniau (Taichung, Taiwan; Berne, Switzerland; Milan, Turin, Novara, Italy;<br />

Rochester, United States of America; Brussels, Leuven, Belgium; Hamburg, Munich, Germany; Amsterdam,<br />

The Netherlands; Paris, France)<br />

* 912 Comparative oncologic effectiveness of radical prostatectomy and radiotherapy in prostate cancer: An<br />

analysis of mortality outcomes in 34,515 patients treated with up to 15 years follow-up<br />

P. Sooriakumaran, L. Haendler, T. Nyberg, I. Heus, M. Olsson, S. Carlsson, M. Roobol, P. Wiklund (Stockholm,<br />

Sweden; Rotterdam, The Netherlands)<br />

913 Trifecta and SCP classification after robot-assisted radical prostatectomy<br />

M.B. Borghesi, V. Ficarra, G. Novara, E. Frumenzio, M. Gan, A. Mottrie (Aalst, Belgium; Padua, Italy)<br />

914 A prospective randomized study to compare functional outcomes of radiofrequency and ultracision<br />

scalpels in videolaparoscopic radical prostatectomy<br />

A.L. Pastore, G. Palleschi, V. Petrozza, L. Silvestri, A. Leto, A. Ripoli, D. Autieri, A. Carbone (Latina, Italy)<br />

915 Robot-assisted vs open radical prostatectomy: A comparison of outcomes across procedure type and<br />

volume quartile<br />

J.D. Sammon, S. Sukumar, P. Ravi, K.R. Ghani, J.O. Peabody, M. Menon, Q-D. Trinh (Detroit, United States of<br />

America)<br />

916 Impact of length of positive surgical margins (PSM) on biochemical recurrence (BCR) after robotic-assisted<br />

radical prostatectomy (RARP), in a single center series with a minimum follow-up of five years<br />

A. Ploumidis, P. Sooriakumaran, L. Haendler, T. Nyberg, M. Olsson, S. Carlsson, G. Steineck, P. Wiklund<br />

(Stockholm, Sweden)<br />

917 Comparative analysis of a consecutive series of 160 brachytherapies and 153 robotic prostatectomies<br />

J.M. Conde-Sanchez, C. Garcia-Sanchez, B. Congregado-Ruiz, I. Osman-Garcia, E. Argüelles-Salido,<br />

J.M. Pena-Outeiriño, R.A. Medina-Lopez (Seville, Spain)<br />

918 Is robotic assisted radical prostatectomy the real alternative to active surveillance? Results of perioperative<br />

and functional outcome analyses<br />

A. Gallina, N.M. Passoni, A. Nini, A. Salonia, P. Dell’Oglio, M. Tutolo, D. Di Trapani, R. Colombo, R. Damiano,<br />

N. Finocchio, V. Scattoni, G. Guazzoni, N. Suardi (Milan, Catanzaro, Italy)<br />

919 Increasing cost-effectiveness in DaVinci-robot-assisted radical prostatectomy by reducing the utilization of<br />

robotic and laparoscopic instruments and disposables: Experience of two high-volume robotic European<br />

centers<br />

A. Haese, B. Rocco (Hamburg, Germany; Milan, Italy)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

283<br />

Monday


Monday<br />

920 SAFE-R: A novel score, accounting for oncological safe nerve-sparing<br />

A. Becker, P. Tennstedt, M. Adam, J. Hansen, H. Heinzer, M. Graefen, T. Schlomm (Hamburg, Germany)<br />

921 The impact of trainees on surgical outcomes following robotic assisted radical prostatectomy (RARP)<br />

L.S. Lee, B. Thomas, N.C. Shah (Singapore, Singapore; Cambridge, United Kingdom)<br />

922 5-year oncologic outcomes of endoscopic extraperitoneal radical prostatectomy (EERPE) for prostate<br />

cancer: The benefits of a mentored fellowship programme<br />

D.W. Good, S.A. McNeill, G.D. Stewart, J.U. Stolzenburg (Edinburgh, United Kingdom; Leipzig, Germany)<br />

284 <strong>Programme</strong> <strong>Book</strong>


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

14.00 - 15.30 Radical surgery for bladder cancer: Patient outcomes<br />

Brown Hall 3 - Level S2<br />

Poster Session 76<br />

Chairs: M. Brausi, Modena (IT)<br />

O.W. Hakenberg, Rostock (DE)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

923 Results of a prospective study on a new fast track regimen for patients undergoing radical cystectomy for<br />

bladder cancer<br />

A. Karl, A. Buchner, A. Becker, T. Grimm, C.G. Stief (Munich, Germany)<br />

* 924 Comparative performance of comorbidity indices for estimating perioperative and 5-year all-cause<br />

mortality following radical cystectomy<br />

S. Boorjian, S.P. Kim, M.K. Tollefson, A. Carrasco, J.C. Cheville, R.H. Thompson, P. Thapa, I. Frank (Rochester,<br />

United States of America)<br />

925 The prognostic impact of pre-operative hematological disorders and a risk stratification model in bladder<br />

cancer patients treated with radical cystectomy<br />

T. Sejima, H. Iwamoto, T. Masago, S. Morizane, A. Yao, T. Isoyama, T. Koumi, A. Takenaka (Yonago, Matsue,<br />

Japan)<br />

* 926 Are patients at nutritional risk more prone to complications after major urological surgery?<br />

Y. Cerantola, M. Valerio, M. Hubner, K. Iglesias Rutishauser, L. Vaucher, P. Jichlinski (Lausanne, Switzerland)<br />

927 Benefit in regionalization of care for patients treated with radical cystectomy: A nationwide inpatient<br />

sample based analyses<br />

H. Lavigueur-Blouin, M. Meskawi, F. Roghmann, Z. Tian, N. Hanna, M. Sun (Montreal, Canada; Herne,<br />

Germany)<br />

928 Risk factors of hospital readmissions following open radical cystectomy and urinary diversion: Analysis of<br />

1000 consecutive patients<br />

S. El-Halwagy, A. Haraz, Y.M. Osman, M. Laymon, A. Mosbah, A. Shaaban (Mansoura, Egypt)<br />

929 Obesity heads to worse outcomes in patients with T1 high grade urothelial carcinoma of the bladder<br />

L.A. Kluth, E. Xylinas, J.J. Crivelli, N. Passoni, P.I. Karakiewicz, E. Comploj, A. Pycha, S. Holmang, T. Faison,<br />

P. Gontero, Y. Lotan, F.K.H. Chun, R. Dahlem, D.S. Scherr, S.F. Shariat (New York, Dallas, United States of<br />

America; Milan, Bolzano, Turin, Italy; Montreal, Canada; Gothenburg, Sweden; Hamburg, Germany)<br />

930 Magnetic resonance imaging: Postoperative anatomic measurements association with urinary continence<br />

in orthotopic ileal neobladder after radical cystoprostatectomy for bladder cancer<br />

J. Lopater, A. Scherrer, V. Delmas, S. Gey, Y. Neuzillet, T. Lebret (Suresnes, Paris, France)<br />

931 A comparison of 90-day complications between ileal conduit and neobladder reconstruction after radical<br />

cystectomy: A multi-institutional retrospective study in Japan<br />

R. Matsumoto, T. Abe, N. Takada, N. Shinohara, A. Sazawa, S. Maruyama, T. Osawa, T. Shibata, T. Yutaka,<br />

Y. Shinno, S. Sato, H. Matsuda, T. Sato, K. Sugishita, S. Kamota, T. Yamashita, J. Ishizaki, T. Kaneda,<br />

S. Kanzaki, G. Mouri, T. Ono, N. Miyajima, T. Sakuta, T. Mochizuki, T. Aoyagi, Y. Kanno, H. Katano, T. Akino,<br />

H. Seki, K. Hirakawa, K. Minami, T. Seki, M. Togashi, H. Sano, K. Nonomura (Sapporo, Japan)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

285<br />

Monday


Monday<br />

932 Experimental studies of relationship between configuration and urodynamics of ileal reservoirs<br />

Y.J. Yan, Y.F. Shi, J.M. Li, J. Chen, J.H. Liu (Kunmiing, China)<br />

933 In vivo tissue-engineered augmentation cystoplasty with electrospun scaffold made of PCL and PHA: 6<br />

months results in rats<br />

A. Vianello, L. Mearini, A. Zucchi, A. Bianco, C. Del Gaudio, G. Bellezza, A. Sidoni, M. Porena (Perugia,<br />

Rome, Italy)<br />

934 Impact of nocturnal incontinence and chronic urinary retention after radical cystectomy and neobladder<br />

reconstruction on health related quality of life in women<br />

M.H. Zahran, A.S. El-Hefnawy, E.M. Zidan, M.A. El-Bilsha, D-E. Taha, B. Ali-El-Dein (Mansoura, Egypt)<br />

286 <strong>Programme</strong> <strong>Book</strong><br />

Summary<br />

O.W. Hakenberg, Rostock (DE)


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

14.00 - 15.30 Prostate cancer cell biology and signaling<br />

Amber Hall 1-2 - Level S2<br />

Poster Session 77<br />

Chairs: G. Jenster, Rotterdam (NL)<br />

H.Y. Leung, Glasgow (GB)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion.<br />

935 Activation of HIF1α promotes androgen independent prostate cancer cell growth<br />

M. Tran, F. Lo, A. Ramos-Montoya, H. Scott, S. Menon, T. Carroll, M. Osborne, J. Hadfield, S. Cheung,<br />

A. Warren, D. Shukla, C. Massie, P. Maxwell, I. Mills, D. Neal (Cambridge, United Kingdom)<br />

936 MiR-221 targets IRF2 and SOCS3 - two negative regulators of the JAK/STAT pathway - and inhibits their<br />

expression in prostate cancer<br />

M. Spahn, M. Krebs, M. Schubert, H. Riedmiller, B. Kneitz (Berne, Switzerland; Würzburg, Germany)<br />

937 Wnt signaling protein (Wisp2/CCN5) stimulates angiogenesis and invasion in prostate cancer<br />

Y. Hashimoto, R. Singh, B. Lokeshwar (Tokyo, Japan; Miami, United States of America)<br />

938 Metformin inhibits the proliferation of human prostate cancer PC-3 cells via down-regulation of the<br />

insulin-like growth factor 1 receptor<br />

H. Kato, Y. Sekine, Y. Miyazawa, Y. Furuya, H. Koike, K. Suzuki (Maebashi, Japan)<br />

939 ERp46 mediates prostate cancer tumorigenesis in vitro by inhibiting adiponectin-induced tumorsuppressive<br />

effects - linking obesity to prostate cancer<br />

J. Pinthus, S. Hopmans, A. Paschos, R. Austin, W. Duivenvoorden (Hamilton, Canada)<br />

940 Sonic hedgehog signaling and androgens are linked in tumor-stromal interaction through Epithelial-<br />

Mesenchymal Transition (EMT) in prostate cancer progression<br />

K. Shigemura, F. Yamamichi, T. Shirakawa, H. Miyake, K. Tanaka, M. Fujisawa (Kobe, Japan)<br />

941 Loss of Dickkopf-3 expression impairs prostate acinar morphogenesis via aberrant TGF-β/Smad signalling<br />

activation<br />

Y. Kawano, D. Romero, N. Bengoa, N. Maltry, M. Walker, M. Eto, J. Waxman, C. Niehrs, R. Kypta (Kumamoto,<br />

Japan; London, United Kingdom; Bilbao, Spain; Heidelberg, Germany)<br />

942 Cancer cell specific transcriptome analysis of stroma-cancer interactions in mouse xenograft models of<br />

bone metastasis<br />

G.N. Thalmann, J. Hensel, B. Özdemir, A. Wetterwald, M. Delorenzi, M.G. Cecchini (Berne, Lausanne,<br />

Switzerland)<br />

943 Epigenetic and transcriptional mechanisms by which MYC regulates rRNA levels<br />

M. Uemura, S. Yegnasubramanian, W.G Nelson, N. Nonomura, A.M De Marzo (Suita, Japan; Baltimore,<br />

United States of America)<br />

944 Computerized quantification and planimetry of prostatic capsular nerves in relation to adjacent cancer foci<br />

J. Bründl, S. Schneider, F. Zeman, W.F. Wieland, R. Ganzer (Regensburg, Germany)<br />

945 The genomic evolution of prostate cancer under the selective pressure of anti-androgen therapy<br />

J.R. Gsponer, T. Dietsche, A. Rufle, E. Lenkiewicz, T. Zellweger, A. Bachmann, M.T. Barrett, C.A. Rentsch,<br />

C. Ruiz, L. Bubendorf (Basel, Switzerland; Scottsdale, United States of America)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

287<br />

Monday


Monday<br />

946 Identification of castrate-resistant cancer repopulating cells in localised prostate tumours<br />

D.G. Murphy, R. Toivanen, M. Frydenberg, J. Pedersen, A. Ryan, D. Pook, M. Berman, R.A. Taylor,<br />

G.P. Risbridger (Melbourne, Clayton, Mount Waverley, Australia; Kingston, Ontario, Canada)<br />

947 Distinct role of the CTCF-binding site in IGF2/H19-ICR and of the differential methylated region in IGF2promoter<br />

0 in LOI and IGF2-expression in prostate cancer<br />

T. Dansranjavin, F. Wagenlehner, P. Waliszewski, K. Steger, W. Weidner, S. Gattenloehner,<br />

U. Schagdarsurengin (Giessen, Germany)<br />

288 <strong>Programme</strong> <strong>Book</strong><br />

Summary<br />

H.Y. Leung, Glasgow (GB)


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

14.00 - 15.30 Nephrectomy for RCC: Minimally invasive techniques, renal function,<br />

lymph node dissection and prognostic factors<br />

Silver Hall - Level N2<br />

Poster Session 78<br />

Chairs: J. Ramon, Tel Aviv (IL)<br />

R.E. Zigeuner, Graz (AT)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

* 948 Hybrid transvaginal natural orifice transluminal endoscopic surgery (NOTES) nephrectomy: Our experience<br />

X. Zou, G. Zhang, Y. Xue, R. Xiao, Y. Yuan, G. Wu, X. Wang, D. Long, Y. Wu, F. Liu, Y. Liao (Ganzhou, China)<br />

949 Laparoendoscopic single-site and conventional laparoscopic radical nephrectomy result in an equivalent<br />

surgical trauma: Preliminary results of a single-centre retrospective controlled study<br />

F. Greco, C. Springer, P. Fornara (Halle Saale, Germany)<br />

950 Novel three-dimensional head-mounted display system (RoboSurgeon System) - application to the initial<br />

60 cases of gasless single-port access urologic surgeries<br />

K. Kihara, H. Takeshita, H. Masuda, F. Koga, K. Saito, Y. Matsuoka, N. Numao, Y. Fujii (Tokyo, Japan)<br />

951 Renal functional deterioration caused by radical nephrectomy affect comprehensive prognosis in patients<br />

with T1 renal cell carcinoma<br />

T. Sejima, H. Iwamoto, T. Masago, S. Morizane, A. Yao, T. Isoyama, A. Takenaka (Yonago, Japan)<br />

952 Lymphadenopathy with renal carcinoma: Pathologic or reactive?<br />

A. Raja, H. Stunell, T.F. Aho, S.S. Connolly (Cambridge, United Kingdom)<br />

953 When to perform lymph node dissection in renal cell carcinoma patients: A novel approach to<br />

preoperatively assess the risk of lymph node invasion at surgery and nodal progression during follow up<br />

U. Capitanio, F. Abdollah, R. Matloob, A. Gallina, F. Pellucchi, A. Russo, P. Capogrosso, M. Moschini, E. Di<br />

Trapani, C. Carenzi, M. Roscigno, P. Rigatti, R. Bertini (Milan, Bergamo, Italy)<br />

954 The role of cytoreductive nephrectomy in patients with metastatic renal cell carcinoma (mRCC) who are the<br />

candidates for targeted therapy<br />

A.V. Klimov, V. Matveev, M. Volkova, V.I. Shirokorad, M. Peters (Moscow, Russia)<br />

955 Preoperative R.E.N.A.L. nephrometry score as a predictor of pathologic stage in renal cell carcinoma<br />

J.Y. Chae, J.W. Kim, J.W. Kim, M.M. Oh, D.G. Moon, C.Y. Yoon (Seoul, South Korea)<br />

956 Benefit in regionalization of care for patients treated with nephrectomy: A nationwide inpatient sample<br />

A. Abdo, N. Hanna, P.I. Karakiewicz, A. Becker, F. Roghmann, M. Meskawi, Q-D. Trinh (Montreal, Canada;<br />

Hamburg, Herne, Germany)<br />

957 The impact of non-clear cell histology on outcome for patients with renal cell carcinoma and venous tumor<br />

thrombus<br />

S. Boorjian, D. Kaushik, R.H. Thompson, M.S. Eisenberg, C.M. Lohse, J. Cheville, B.C. Leibovich (Rochester,<br />

United States of America)<br />

958 Prognostic factors and risk groups in primary extensive renal cell carcinoma<br />

A.V. Poluyanchik, L.V. Mirylenka, O.G. Sukonko, A.I. Rolevich, A. Minich (Minsk, Belarus)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

289<br />

Monday


Monday<br />

959 Visceral obesity is associated with better recurrence-free survival after surgeries for localized clear cell<br />

renal cell carcinoma<br />

G. Kaneko, A. Miyajima, K. Yuge, M. Hasegawa, E. Kikuchi, K. Nakagawa, M. Oya (Tokyo, Japan)<br />

960 Conditional survival of patients with renal cell carcinoma treated with nephrectomy: A population based<br />

analysis<br />

M. Bianchi, H. Lavigueur-Blouin, A. Becker, Z. Tian, F. Roghmann, N. Hanna, M. Sun (Montreal, Canada;<br />

Hamburg, Herne, Germany)<br />

290 <strong>Programme</strong> <strong>Book</strong>


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

14.00 - 15.30 Stones: PCNL<br />

Red Hall 1 - Level N1<br />

Poster Session 79<br />

Chairs: V. Bucuras, Timisoara (RO)<br />

G. Giusti, Milan (IT)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion.<br />

961 Mini-percutaneous nephrolithotomy for upper urinary tract calculi in children (report of 134 cases)<br />

D.Z. Long, X.F. Zou, Y.T. Wu, R.H. Xiao, Y.H. Yuan, X.N. Wang, G.X. Zhang, G.Q. Wu, J. Yang, Y.J. Xue<br />

(Ganzhou, China)<br />

962 Minimal invasive PCNL (MPCNL) – update on efficacy and safety after 745 consecutive patients<br />

V. Zimmermanns, I. Aydin, P. Liske, P. Ober, S. Lahme (Pforzheim, Germany)<br />

963 A prospective randomized study of prone versus The Barts “flank free” modified supine position for<br />

percutaneous nephrolithotomy (PCNL)<br />

C. Bach, S. Kachrilas, A. Goyal, F. Zaman, A. Bourdoumis, R. McGregor, N. Buchholz, J. Masood (London,<br />

United Kingdom; Montego Bay, Jamaica)<br />

964 Efficacy and safety in the treatment of large renal calculi with minimally invasive or conventional large<br />

bore PCNL: A retrospective comparison of two longitudinal databases<br />

M.F. Abdelhafez, G. Wendt-Nordahl, J. Bedke, B. Amend, P. Honeck, A. Stenzl, T. Knoll, D. Schilling<br />

(Tübingen, Boeblingen, Germany)<br />

965 Withdrawn<br />

966 Endovascular treatment of percutaneous nephrolithotomy haemorrhagic complications<br />

V. Jinga, S. Youssef, B. Braticevici, M. Mohanad, D. Diaconescu, D. Radavoi (Bucharest, Romania)<br />

967 Does body mass index impact the outcomes of tubeless percutaneous nephrolithotomy?<br />

N. Kuntz, A. Neisius, G. Astroza, M. Tsivian, M. Iqbal, M. Ferrandino, G. Preminger, M. Lipkin (Durham,<br />

United States of America; Santiago, Chile)<br />

968 Percutaneous renal collecting system access using a novel electromagnetic tracking: First experience in<br />

vivo pig model<br />

E.A. Rodrigues De Lima, C. Oliveira, P. Rodrigues, E. Dias, J. Correia-Pinto, J. Vilaça (Braga, Braga-<br />

Guimarães, Portugal)<br />

969 Inferior renal displacement using ureteric balloon catheter -UBC technique- in accessing supracostal<br />

calyces during start to finish prone PCNL<br />

A. Vint, K Nalagatla (Airdrie, United Kingdom)<br />

970 Management of caliceal diverticulum with stones - our experience<br />

A.K. Chawla (Manipal, India)<br />

971 Percutaneous nephrolithotripsy in the Galdakao-modified supine versus prone position<br />

K. Petkova, I. Saltirov, T. Petkov (Sofia, Bulgaria)<br />

972 Standard-tract combined with mini-tract in percutaneous nephrolithotomy for renal staghorn calculi<br />

Y.B. Wang, N. Xu, H.F. Zhang, C.X. Wang (Changchun, China)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

291<br />

Monday


Monday<br />

973 Percutaneous nephrolithotomy without hydrodistension<br />

M. Villalobos-Gollas, E. Cruz-Nuricumbo, L. Gómez-De-Regil (Merida, Mexico)<br />

974 Is standard percutaneous nephrolithotomy still standard? Comparison of surgical outcomes between<br />

tubeless and standard percutaneous nephrolithotomy<br />

J.K. Oh, C.H. Kim, S.C. Lee, K.T. Kim, T.B. Kim, K.H. Kim, S.J. Yoon, H. Jung (Incheon, South Korea)<br />

292 <strong>Programme</strong> <strong>Book</strong>


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

14.00 - 15.30 Renal tumours: Drug related basic research<br />

Red Hall 2 - Level N1<br />

Poster Session 80<br />

Chairs: F. Birkhäuser, Berne (CH)<br />

T. Klatte, Vienna (AT)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

975 Pre-clinical trial of a new dual mTOR inhibitor: INK128 for renal cell carcinoma<br />

A. Ingels, A. Thong, M. Saar, M.P. Valta, R. Nolley, J. Santos, H. Zhao, D. Peehl (Stanford, United States of<br />

America)<br />

976 Panobinostat and bortezomib inhibit renal cancer growth in vitro and in vivo by inducing endoplasmic<br />

reticulum stress and ubiquitinated protein accumulation synergistically<br />

A. Sato, T. Asano, K. Ito, T. Asano (Tokorozawa, Japan)<br />

977 Ritonavir, a potent inhibitor of CYP3A4, enhances the anticancer effects of panobinostat in renal cancer<br />

cells in vitro and in vivo<br />

A. Sato, T. Asano, K. Ito, T. Asano (Tokorozawa, Japan)<br />

978 A novel therapeutic approach for renal cell cancer cells using orally available phenylpiperazine derivative<br />

naftopidil<br />

Y. Iwamoto, H. Kanda, M. Kato, T. Sasaki, K. Ishii, K. Arima, T. Shiraishi, Y. Sugimura (Tsu, Japan)<br />

979 Zoledronic acid sensitizes renal cell carcinoma cells to radiation by downregulating STAT1<br />

T. Kijima, F. Koga, Y. Fujii, S. Yoshida, M. Tatokoro, K. Kihara (Tokyo, Japan)<br />

* 980 Optimization of Lutetium-177-G250 radioimmunotherapy in an intraperitoneal clear cell renal cell<br />

carcinoma xenograft model<br />

C.H.J. Muselaers, O.C. Boerman, D.L. Bos, W.J.G. Oyen, E. Oosterwijk, P.F.A. Mulders (Nijmegen, The<br />

Netherlands)<br />

981 Predictive value of angiogenic biomarkers in tuberous sclerosis complex (TSC) patients with renal<br />

angiomyolipoma (AML)<br />

K. Budde, J.C. Kingswood, T. Brechenmacher, K. Stein, D. Chen, J.J. Bissler (Berlin, Germany; Brighton,<br />

United Kingdom; Rueil-Malmaison, France; East Hanover, New Jersey, Cincinnati, Ohio, United States of<br />

America)<br />

982 Sorafenib enhances the anti-tumor effect of anti-CTLA-4 antibody to kidney cancer<br />

T. Motoshima, Y. Komohara, Y. Kawano, Y. Wada, M. Eto (Kumamoto, Japan)<br />

983 Acquired resistance to sunitinib in human renal cell carcinoma cells is mediated by constitutive activation<br />

of signal transduction pathways associated with tumor cell proliferation<br />

H. Miyake, I. Sakai, M. Fujisawa (Kobe, Japan)<br />

* 984 Potential predictive markers for a response to sunitinib and their association with survival of patients with<br />

metastatic renal cell carcinoma<br />

J. Dornbusch, M. Meinhardt, K. Erdmann, A. Zacharis, S. Zastrow, S. Füssel, M.P. Wirth (Dresden, Germany)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

293<br />

Monday


Monday<br />

985 Acquired resistance to temsirolimus in human renal cell carcinoma cells is mediated by constitutive<br />

activation of signal transduction pathways through mammalian target of rapamycin complex-2<br />

K. Harada (Kobe, Japan)<br />

986 Relationship between sunitinib effect and immature blood vessel ratio in metastatic renal cell cancer<br />

B.H. Kim, C.I. Kim, J.Y. Ha, C.H. Park, K.H. Kim, M.S. Choe, H.R. Jung (Daegu, Gyeongju, South Korea)<br />

294 <strong>Programme</strong> <strong>Book</strong>


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

14.00 - 15.30 How to diagnose LUTS, BPH and obstruction?<br />

Blue Hall 1-2 - Level N1<br />

Poster Session 81<br />

Chairs: G. Novara, Padua (IT)<br />

D.S. Park, Sungnam (KR)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion.<br />

987 Withdrawn<br />

988 Obesity associated with larger prostate volume but not with worse urinary symptoms: Analysis of a large<br />

cohort undergoing trans-rectal ultrasound<br />

B. Bhindi, G. Trottier, K. Fernandes, K.M. Hersey, A. Finelli, J. Trachtenberg, A. Toi, A. Evans, T.H. Van Der<br />

Kwast, N.E. Fleshner (Toronto, Canada)<br />

989 Body mass index predicts failure of surgical management in benign prostate hyperplasia<br />

J.M. Willder, V. Walker, G.L. Halbert, C.P.C. Dick, C. Orange, T. Qayyum, P.G. Horgan, M.A. Underwood,<br />

J. Edwards (Glasgow, United Kingdom)<br />

990 Prediction of bladder outlet obstruction: Development of a clinical nomogram<br />

C. De Nunzio, R. Autorino, A. Bachmann, A. Briganti, S. Carter, F. Chun, G. Novara, R. Sosnowski,<br />

N. Thiruchelvam, A. Tubaro, S. Ahyai (Rome, Naples, Milan, Padua, Italy; Basel, Switzerland; London,<br />

Cambridge, United Kingdom; Hamburg, Germany; Warsaw, Poland)<br />

991 Clinical predictors of bladder outlet obstruction in men with acute urinary retention<br />

M. Rom, M.J. Waldert, H-C. Klingler, T. Klatte (Vienna, Austria)<br />

992 Identification of prevalence and combined risk-factors for LUTS and ED in a population of 50plus: Results<br />

of a health-screening project with validated questionnaires<br />

A. Ponholzer, C. Wehrberger, S. Madersbacher (Vienna, Austria)<br />

* 993 Can ultrasound replace urodynamics in the study of bladder outlet obstruction? A prospective study and<br />

development of a clinical score<br />

A. Ciudin, M.G. Diaconu, L. Peri, E. Garcia-Cruz, D. Gosalbez, A. Carrion, A. Garcia-Larrosa, A. Gomez,<br />

A. Franco, A. Alcaraz (Barcelona, Viladecans, Spain)<br />

994 Reliability of estimating nocturia based on IPSS<br />

J.W. Kim, M.M. Oh, J.W. Kim, J.Y. Chae, C.Y. Yoon, D.G. Moon (Seoul, South Korea)<br />

995 Noninvasive monitoring of detrusor contractions using ultrasound<br />

T. Idzenga, F. Farag, J.P.F.A. Heesakkers, W.F.J. Feitz, C.L. De Korte (Nijmegen, The Netherlands)<br />

996 Free uroflowmetry vs do-it-yourself uroflowmetry in the assessment of patients with lower urinary tract<br />

symptoms<br />

G. Mombelli, D. Ratti, L. Carmignani (Magenta (Milan), San Donato (Milan), Italy)<br />

997 Usefulness of prostate volume estimation by CT using ellipsoid formula<br />

J.H. Jung, Y.J. Kim, S.H. Ryang, T.W. Kang, H.C. Chung, Y.Y. Park, J.M. Song (Wonju, Seoul, South Korea)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

295<br />

Monday


Monday<br />

998 The combination of values obtained by transrectal ultrasonography is useful for predicting bladder outlet<br />

obstruction in patients with lower urinary tract symptoms suggestive of benign prostatic hyperplasia<br />

T. Suzuki, A. Otsuka, Y. Kurita, H. Shinbo, R. Matsumoto, S. Takada, S. Ozono (Hamamatsu, Japan)<br />

296 <strong>Programme</strong> <strong>Book</strong>


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

14.00 - 15.30 Male incontinence: Prediction and management<br />

Yellow Hall 1-2-3 - Level N1<br />

Poster Session 82<br />

Chairs: R. Bauer, Munich (DE)<br />

P. Rehder, Innsbruck (AT)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

* 999 Safety, efficacy and QOL in a European multi-center prospective study of the AdVance male sling: 2-year<br />

results<br />

D. De Ridder, P. Chauveau, R.M. Bauer, H. Fassi-Fehri, O. Haillot, P. Arano, A.N. Bader, F. Haab (Leuven,<br />

Belgium; Nantes, Lyon, Tours, Paris, France; Munich, Germany; Barcelona, Spain; Minnetonka, United States<br />

of America)<br />

* 1000 Influence of pre- and post versus postoperative pelvic floor muscle training on urinary incontinence after<br />

open and robotic radical prostatectomy: A randomized controlled trial<br />

I. Geraerts, H. Van Poppel, N. Devoogdt, S. Joniau, B. Van Cleynenbreugel, M. Van Kampen (Leuven,<br />

Belgium)<br />

1001 Changes of pelvic floor muscles and bladder neck before and after obtaining continence after radical<br />

prostatectomy<br />

D.W. Sohn, J.S. Chung, J.Y. Joung, K.H. Lee, H.K. Seo (Seoul, Goyang, South Korea)<br />

1002 Treatment of stress urinary incontinence: Outcome and risk factor analysis of AMS 800©: A prospective<br />

analysis<br />

T.A. Ludwig, R. Dahlem, P. Reiss, S. Riechardt, M. Fisch, S.A. Ahyai (Hamburg, Germany)<br />

1003 Development and validation of nomograms to predict the recovery of urinary continence after radical<br />

prostatectomy: Comparisons between immediate, early, and late continence<br />

S.J. Jeong, H.S. Lee, K.B. Kim, J.K. Lee, B.K. Lee, J.W. Jeong, W.H. Cha, S.C. Lee, C.W. Jeong, S.K. Hong,<br />

S-S. Byun, S.E. Lee (Seongnam, Gyeonggi, South Korea)<br />

1004 Primary artificial urinary sphincter implantation for male non-neurogenic stress urinary incontinence:<br />

Early and midterm results of a multicenter contemporary series<br />

J-N.L. Cornu, M.J. Drake, F. Haab, E. Haab, S.A. Ahyai, L. Kluth, R.K. Lee, B. Chughtai, A. Bachmann,<br />

N. Thiruchelvam, J.I. Martínez-Salamanca, S. Larré, T. Pichon, C. De Nunzio, M. Favro, R.M. Bauer, F. Van<br />

Der Aa (Paris, Reims, Angers, France; Bristol, Cambridge, United Kingdom; Hamburg, Munich, Germany;<br />

New York, United States of America; Basel, Switzerland; Madrid, Spain; Rome, Novara, Italy; Leuven,<br />

Belgium)<br />

1005 Anticholinergics improved voiding symptom after radical prostatectomy in patients with prostate cancer<br />

J. Kim, S. Pak, M. Shim, J. Park, S.M. Lee, K.O. Huh, C. Song, M-S. Choo, H. Ahn (Seoul, Daejeon, South<br />

Korea)<br />

1006 The impact of 3 week clinical rehabilitation program after radical prostatectomy on early continence status<br />

M. Adam, E. Eichelberg, L. Budäus, G. Salomon, H. Isbarn, T. Steuber, T. Schlomm, U. Michl, H. Heinzer<br />

(Hamburg, Germany)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

297<br />

Monday


Monday<br />

1007 Intensive preoperatory Pelvic Floor Muscle Training reduce duration and severity of stress urinary<br />

incontinence after radical prostatectomy: A randomized controlled trial<br />

A. Collado Serra, M. Pellicer Cabo, M. Ramirez Backhaus, J. Dominguez-Escrig, J. Rubio-Briones, A. Gomez-<br />

Ferrer, I. Iborra Juan, J. Casanova Ramón-Borja, J.V. Ricos Torrent, J.L. Monros Lliso, R. Dumont Martinez,<br />

E. Solsona Narbón (Valencia, Spain)<br />

1008 Anatomic evaluation with 3T magnetic resonance imaging of continent and incontinent patients treated<br />

with advance male sling<br />

D. Pistolesi, V. Zampa, C. Gozzi, M. Santarsieri, I. Bardelli, C. Mariani, L. Faggioni, C. Bartolozzi, C. Selli<br />

(Pisa, Bressanone, Italy)<br />

1009 More than 3 years of clinical experience with an adjustable transobturator male system (ATOMS) for<br />

treatment of stress urinary incontinence after radical prostatectomy: Results of a multicenter prospective<br />

observational study<br />

R. Hoda, G. Primus, C. Brössner, W. Bauer (Kleinmachnow, Germany; Graz, Vienna, Austria)<br />

1010 Preoperative sphincter function and morphology of prostate apex influence recovery of urinary continence<br />

after radical prostatectomy<br />

J. Kim, S. Pak, M. Shim, J. Park, C. Song, H. Ahn (Seoul, Daejeon, South Korea)<br />

298 <strong>Programme</strong> <strong>Book</strong>


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Special Session<br />

14.00 - 17.00 European Urological Scholarship <strong>Programme</strong> (EUSP) Session<br />

Amber Hall 7-8 - Level S2<br />

Chairs: L. Martínez Piñeiro, Madrid (ES)<br />

V. Mirone, Naples (IT)<br />

14.00 - 14.10 Introduction<br />

V. Mirone, Naples (IT)<br />

14.10 - 16.00 Presentations of sections - Centres of excellence - New directions and opportunities<br />

14.10 - 14.20 ESAU Andrological Urology<br />

W.H.G. Weidner, Giessen (DE)<br />

14.20 - 14.30 ESFFU Female and Functional Urology<br />

J.P.F.A. Heesakkers, Nijmegen (NL)<br />

14.30 - 14.40 ESTU Transplantation Urology<br />

A.J. Figueiredo, Coimbra (PT)<br />

14.40 - 14.50 ESUR Urological Research<br />

Z. Culig, Innsbruck (AT)<br />

14.50 - 15.00 ESGURS Reconstructive Urology Surgeons<br />

S. Deger, Ostfildern (DE)<br />

15.00 - 15.10 ERUS Robotic Urology<br />

A. Mottrie, Aalst (BE)<br />

15.10 - 15.20 ESOU Oncological Urology<br />

M. Brausi, Modena (IT)<br />

15.20 - 15.30 ESUI Urological Imaging<br />

J. Walz, Marseille (FR)<br />

15.30 - 15.40 EULIS Urolithiasis<br />

P.J. Osther, Fredericia (DK)<br />

15.40 - 15.50 ESIU Infections in Urology<br />

T.E. Bjerklund Johansen, Århus (DK)<br />

15.50 - 16.00 ESUT Uro-Technology<br />

J. Rassweiler, Heilbronn (DE)<br />

16.00 - 16.05 Award presentation: Best scholar<br />

V. Mirone, Naples (IT)<br />

16.05 - 17.00 Poster viewing and EUSP get together<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

299<br />

Monday


Monday<br />

Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

300 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

15.45 - 17.15 Highlights & awards<br />

eURO Auditorium - Level S2<br />

Video Session 10<br />

Chairs: A. Messas, Nanterre (FR)<br />

P.A. Geavlete, Bucharest (RO)<br />

All presentations have a maximum length of 10 minutes, followed by 4 minutes of discussion.<br />

V73 Laparoscopic construction of continent Mitrofanoff appendicovesicostomy: Saint Augustin technique<br />

D. Rey, M. Oderda, E. Helou, L. Lopez, P-T. Piechaud (Bordeaux, France)<br />

V74 Single incision pyeloplasty – results of the initial 22 cases<br />

F. Imkamp, M.A. Kuczyk, U. Nagele, T.R.W. Herrmann (Hanover, Germany; Hall in Tirol, Austria)<br />

V75 Deep bladder endometriosis: Laparoscopic partial cystectomy with endoscopic delimitation<br />

R. Cabello, C. Quicios, C. Simón, P. Charry, M. Rodríguez, C. González (Madrid, Spain)<br />

V76 Robotic assisted lego® construction for microsurgical skills training<br />

A. Gudeloglu, J. Brahmbhatt, K. Priola, S. Parekattil (Winter Haven, United States of America)<br />

Prize winning videos<br />

V77 Third Video Prize<br />

Alternative solution to current MIS robotic system<br />

S. Crouzet (Lyon, France)<br />

V78 Second Video Prize<br />

Sequential occlusion angiography using contrast enhanced ultrasound scan (CEUS) demonstrating the<br />

avascular plane of Brodel: An adjunct to a novel technique of zero-ischaemia robot-assisted partial<br />

nephrectomy<br />

A.R. Rao, R. Gray, H. Motiwala, M. Laniado, O. Karim (Wexham, United Kingdom)<br />

V79 First Video Prize<br />

Novel surgical tile-pro navigation with 3D prostate cancer model during robot-assisted radical<br />

prostatectomy<br />

O. Ukimura, A.L. De Castro Abreu, M. Nakamoto, S. Shoji, S. Leslie, A. Berger, A. Goh, M. Desai, M. Aron,<br />

I. Gill (Los Angeles, United States of America)


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

15.45 - 17.15 Prostate cancer treatment: Comorbidities and complications<br />

Brown Hall 1-2 - Level S2<br />

Poster Session 83<br />

Chairs: M. Graefen, Hamburg (DE)<br />

R.E. Sanchez Salas, Paris (FR)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion.<br />

1011 Health-related quality of life after radical prostatectomy is independent of patient’s age and comorbidities<br />

K. Herkommer, H. Schulwitz, T. Klorek, S. Schmid, C. Hofer, J.E. Gschwend, M. Kron (Munich, Ulm, Germany)<br />

1012 Analysis on overall, cancer-specific and non-cancer-specific survivals according to Charlson comorbidity<br />

index in prostate cancer patients who underwent radical prostatectomy<br />

J.Y. Lee, K.H. Kim, J.W. Park, R.R. Diaz, K.H. Kim, H.Y. Lee, W.S. Ham, N.H. Cho, Y.D. Choi, K.S. Cho (Seoul,<br />

South Korea)<br />

1013 Perioperative and early oncological outcomes after robotic assisted radical prostatectomy in morbidly<br />

obese patients: A propensity matched study<br />

H. Abdul-Muhsin, C. Giedelman, S. Samavedi, O. Schatloff, S. Chauhan, A. Sivaraman, R. Coelho, K. Palmer,<br />

G. Ebra, V. Patel (Celebration, United States of America)<br />

1014 The impact of abdominal obesity on surgical complications and functional outcomes in men treated with<br />

radical prostatectomy for prostate cancer: Results of an Italian multicentre survey (M.I.R.R.O.R.)<br />

M. Gacci, A. Sebastianelli, M. Salvi, C. De Nunzio, R. Schiavina, A. Simonato, A. Tubaro, V. Mirone, M. Carini,<br />

G. Carmignani (Florence, Rome, Bologna, Genova, Naples, Italy)<br />

1015 Cardiovascular disease and prostate cancer: A competing-risks analysis<br />

J. Hansen, F.K. Chun, M. Rink, S.F. Shariat, M. Graefen, M. Sun (Hamburg, Germany; New York City, United<br />

States of America; Montreal, Canada)<br />

1016 Is extended venous thrombo-embolism pharmacological prophylaxis required following laparoscopic<br />

radical prostatectomy?<br />

B. Horsburgh, V. Srinivasan (Denbighshire, United Kingdom)<br />

1017 Prospective randomized study comparing transperitoneal and extraperitoneal approach during robotic<br />

prostatectomy: Anesthesiologic effects<br />

F. Dal Moro, C. Valotto, A. Mangano, R. Soncin, A. Crestani, A. Guttilla, G.M. Pittoni, F. Zattoni (Padua, Italy)<br />

1018 Difficult radical prostatectomy did not cause inferior functional outcome<br />

U.H.G. Michl, M. Graefen, A. Haese, G. Salomon, H. Heinzer, T. Schlomm, T. Steuber, H. Huland (Hamburg,<br />

Germany)<br />

1019 Invasiveness and post aggression metabolism in DaVinci prostatectomies - the iPOD study<br />

A. Martinschek, L. Stumm, M. Ritter, E. Heinrich, L. Trojan (Ulm, Mannheim, Göttingen, Germany)<br />

1020 Characterization, incidence and severity of surgical complications using Clavien system in patients treated<br />

with minimally invasive radical prostatectomy<br />

A.M. Autran, R.E. Sanchez Salas, E. Barret, F. Rozet, D. Prapotnich, M. Galiano, N. Cathala, A. Mombet,<br />

F. Secin, X. Cathelineau (Paris, France; Buenos Aires, Argentina)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

301<br />

Monday


Monday<br />

1021 The Clavien-Dindo classification of complications used for a comparison between retropubic, endoscopic<br />

and robot-assisted radical prostatectomy on the basis of a matched-pair analysis<br />

M. Hiess, C. Seitz, A. Ponholzer, M. Lamche, P. Schramek (Vienna, Austria)<br />

1022 Bilateral peritoneal incision in open retropubic prostatectomy does not seem to lower rates of symptomatic<br />

lymphoceles<br />

J. Mundhenk, F. Miller, J. Hennenlotter, L.F. Arenas Da Silva, T. Todenhoefer, G. Gakis, C. Schwentner,<br />

A. Stenzl, D. Schilling (Tübingen, Germany)<br />

1023 Impact of a polysaccharide hemostat on bleeding complications and pelvic lymphocele rates after radical<br />

prostatectomy: Initial results of a prospective randomized trial<br />

B. Beyer, S-R. Leyh-Bannurah, H. Isbarn, P. Tennstedt, G. Salomon, U. Michl, H. Heinzer, H. Huland,<br />

M. Graefen, L. Budäus (Hamburg, Germany)<br />

1024 Re-assessment of 30-, 60- and 90-day mortality rates in non-metastatic prostate cancer patients treated<br />

either with radical prostatectomy or radiation therapy<br />

M. Meskawi, A. Abdo, H. Lavigueur-Blouin, Z. Tian, F. Roghmann, P.I. Karakiewicz (Montreal, Canada;<br />

Herne, Germany)<br />

302 <strong>Programme</strong> <strong>Book</strong>


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

15.45 - 17.15 Radical surgery for bladder cancer: Technical aspects<br />

Brown Hall 3 - Level S2<br />

Poster Session 84<br />

Chairs: H. Abol-Enein, Mansoura (EG)<br />

E. Solsona, Valencia (ES)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion.<br />

1025 Promising approach in the treatment of bladder cancer: Radical cystectomy and urinary diversion in<br />

regional anesthesia<br />

M. Friedrich-Freksa, E. Schulz, T. Nitzke, O. Wenzel, G. Popken (Berlin, Germany)<br />

1026 A restrictive fluid regimen combined with norepinephrine during open radical cystectomy decreases the<br />

postoperative complication rate and accelerates recovery<br />

F.C. Burkhard, U.E. Studer, G.N. Thalmann, P.Y. Wüthrich (Berne, Switzerland)<br />

1027 Withdrawn<br />

1028 Factors predicting acute kidney injury and wound complications after open radical cystectomy: Analysis of<br />

1000 patients<br />

Y.M. Osman, A.M. Harraz, S. El-Halwagy, M. Laymon, T. Samir, A. Mosbah, A. Shaaban (Mansoura, Egypt)<br />

1029 Transurethral resection of bladder tumour (TURBT) causes seeding of cancer cells into patient blood<br />

stream<br />

H. Engilbertsson, O. Patschan, S. Björnsson, T. Kristmundsson, L. Rydén, K. Aaltonen, S. Gudjónsson<br />

(Malmö, Lund, Sweden)<br />

1030 Pilot feasibility study of umbilical laparoendoscopic single-site radical cystectomy for muscle-invasive<br />

bladder cancer with additional 10 mm trocar and extracorporeal urinary diversion<br />

J.C. Angulo, P. Cabrera, E. Mateo, G. Andres, A. Garcia-Tello, F. Ramon De Fata (Madrid, Spain)<br />

1031 Intra-corporeal versus extra-corporeal urinary diversion after robot-assisted radical cystectomy: Results<br />

from the International Robotic Cystectomy Consortium<br />

K. Ahmed, S.A. Khan, M.H. Hayn, A.P. Stegemann, P.K. Agarwal, K.K. Badani, M.D. Balbay, E.P. Castle,<br />

P. Dasgupta, R. Ghavamian, K. Guru, A.K. Hemal, B.K. Hollenbeck, D. Josephson, A.K. Kader, A.S. Kibel,<br />

M. Menon, A. Mottrie, K. Nepple, J.G. Pattaras, J.O. Peabody, V. Poulakis, R.S. Pruthi, J. Palou Redorta,<br />

K.H. Rha, L. Richstone, M. Saar, D.S. Scherr, S. Siemer, M. Stöckle, A.Z. Weizer, P. Wiklund, T. Wilson,<br />

M. Woods, M.S. Khan (London, United Kingdom; Portland, Buffalo, Bethesda, New York, Scottsdale, Bronx,<br />

Winston-Salem, Ann Arbor, Duarte, San Diego, St. Louis, Detroit, Atlanta, Chapel Hill, Newark, Maywood,<br />

United States of America; Istanbul, Turkey; Aalst, Belgium; Athens, Greece; Barcelona, Spain; Seoul, South<br />

Korea; Homburg, Germany; Stockholm, Sweden)<br />

1032 Influence of institution volume on outcomes after robot-assisted radical cystectomy: An analysis of 1118<br />

patients from the International Robotic Cystectomy Consortium<br />

S.A.A. Khan, K. Ahmed, S. Shariat, P.K. Agarwal, K.K. Badani, D. Balbay, E.P. Castle, P. Dasgupta, K.A. Guru,<br />

M.H. Hayn, A.K. Hemal, D. Josephson, A.K. Kader, A.S. Kibel, A. Mottrie, K.G. Nepple, J.G. Pattaras,<br />

J.O. Peabody, V. Poulakis, R.S. Pruthi, J. Palou, K-H. Rha, L. Richstone, M. Saar, A.P. Stegemann, M. Stoeckle,<br />

E.M. Wallen, P. Wiklund, T. Wilson, M. Woods, B. Yuh, D.S. Scherr (London, United Kingdom; New York,<br />

Detroit, Scottsdale, Buffalo, Winston-Salem, Duarte, St. Louis, Saint Louis, Atlanta, Detroit, Chapel Hill,<br />

New Hyde Park, Buffalo, Duarte, Maywood, United States of America; Ankara, Turkey; Aalst, Belgium;<br />

Athens, Greece; Redorta, Barcelona, Spain; Seoul, South Korea; Homburg, Germany; Stockholm, Sweden)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

303<br />

Monday


Monday<br />

1033 A pilot prospective single-centre 3-arm randomised controlled trial of open, robotic and laparoscopic<br />

(CORAL) radical cystectomy for bladder cancer<br />

C. Gan, F. Ismail, G. Cheung, A. Patel, P. Dasgupta, P. Rimington, J. Watkins, T. O’Brien, P. Hegarty, M.S. Khan<br />

(London, Eastbourne, United Kingdom)<br />

1034 Comparative study between laparoscopic and open radical cystectomy with orthotopic ileal reservoir<br />

E. Mateo, A. Garcia-Tello, F. Caceres, I. Romero, M. Sanchez Chapado, J.C. Angulo (Madrid, Spain)<br />

1035 The Karolinska experience in 67 robot-assisted radical cystectomies with totally intracorporeal formation<br />

of an ileal neobladder. Oncological and complication outcomes<br />

S. Tyritzis, J. Collins, D. Khazaeli, M. Jonsson, C. Adding, A. Hosseini-Aliabad, N.P. Wiklund (Stockholm,<br />

Sweden)<br />

1036 Laparoscopic radical cystectomy with prostate capsule sparing. Oncologic and functional results: Our<br />

experience<br />

J. Gómez Rivas, S. Alonso Y Gregorio, D. López Sánchez, A. Tabernero Gómez, J. Cisneros Ledo, J.J. De La<br />

Peña Barthel (Madrid, Spain)<br />

1037 Oncological outcomes with a median follow-up of 32 months after laparoscopic radical cystectomy for<br />

bladder cancer<br />

T.J.N. Hermans, S. Van Aarle, L.M.C.L. Fossion (Veldhoven, The Netherlands)<br />

1038 Extended versus super-extended PLND during radical cystectomy: Comparison of two prospective series<br />

G. Simone, H. Abol Enein, M. Ferriero, R. Papalia, S. Guaglianone, A. Mosbah, M. Abdel-Latif,<br />

M. Abdelrahim, M. Ghoneim, M. Gallucci (Rome, Italy; Mansoura, Egypt)<br />

.<br />

304 <strong>Programme</strong> <strong>Book</strong>


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

15.45 - 17.15 Prostate cancer biomarkers and outcome prediction<br />

Amber Hall 1-2 - Level S2<br />

Poster Session 85<br />

Chairs: B. Djavan, Vienna (AT)<br />

G.N. Thalmann, Berne (CH)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

* 1039 Genetic testing in identification of BPH patients developing later prostate cancer<br />

L. Saaristo, T. Wahlfors, J. Schleutker, H. Lilja, T. Tammela, M. Matikainen (Tampere, Turku, Helsinki,<br />

Finland)<br />

1040 Expression of candidate susceptibility genes in the development and progression of prostate cancer<br />

C. Debiais-Delpech, J. Godet, N. Pedretti, J. Irani, X. Cathelineau, G. Fromont (Poitiers, Gençay, Paris, France)<br />

1041 Neurofuzzy system for prostate cancer risk evaluation<br />

L. Benecchi, F. Bocchi, M. Potenzoni, F. Russo, L. Perucchini, M. Quarta, M. Tonghini, P. Bocchi, C. Del Boca<br />

(Cremona, Parma, Italy)<br />

1042 Detection of prostate cancer associated α2,3 sialyated free PSA in serum is more higher specificity than<br />

conventional PSA test<br />

T. Yoneyama, Y. Tobisawa, K. Mori, S. Hatakeyama, H. Yamamoto, T. Okamoto, A. Okamoto, F. Ishimura,<br />

T. Yoneyama, T. Koie, N. Kamimura, C. Ohyama (Hirosaki, Japan)<br />

1043 Association of blood level omega-3 fatty acids with risk of prostate cancer: A meta-analysis<br />

M. Chua, M.C. Sio, M. Sorongon, M.J. Morales (Quezon City, Philippines)<br />

1044 Frequency and prognostic significance of TMPRSS2-ERG gene fusion in prostate cancers with positive<br />

lymph nodes<br />

A. Fleischmann, I. Zlobec, T. Visakorpi, G.N. Thalmann (Berne, Switzerland; Tampere, Finland)<br />

* 1045 Urinary PCA3 and TMPRSS2:ERG help predict biopsy outcome prior to initial prostate biopsy using a risk<br />

group analysis<br />

J.R. Day, L.A. Jones, S.E. Meyer, P.N. Hodge, J. Aussie, D.R. Saltzstein, J.C. Groskopf (San Diego, San Antonio,<br />

United States of America)<br />

1046 A new medical device for in vivo isolation of circulating tumor cells in prostate cancer patients<br />

G. Theil, M.R. Hoda, K. Fischer, K. Haubold, T. Krahn, N.G. Morgenthaler, K. Lücke, P. Fornara (Halle/Saale,<br />

Potsdam, Berlin, Germany)<br />

1047 Expression of epithelial-mesenchymal transition markers in localized prostate cancer: Impact on<br />

clinicopathological outcomes in patients undergoing radical prostatectomy<br />

H. Miyake, H. Behnsawy, M. Fujisawa (Kobe, Japan)<br />

1048 CSAG4 and NOL4 are novel biomarkers to indicate aggressiveness of prostate cancer<br />

S. Takahashi, T. Shiraishi, B.J. Trock, P. Kulkarni, R. Getzenberg, T. Tominaga, Y. Homma (Tokyo, Japan;<br />

Maryland, United States of America)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

305<br />

Monday


Monday<br />

1049 RANKL pathway proteins as risk parameters for biochemical recurrence in patients undergoing radical<br />

prostatectomy<br />

T. Todenhöfer, J. Hennenlotter, A. Wald, P. Leidenberger, G. Blumenstock, S. Aufderklamm, J. Mundhenk,<br />

G. Gakis, U. Kühs, A. Hohneder, A. Stenzl, C. Schwentner (Tübingen, Germany)<br />

1050 Prostate cancer microparticles: A novel blood based prognosticator of metastasis<br />

A. Al-Zahrani, H.S. Leong, V. Yutkin, N. Power, J. Izawa, J. Lewis, J. Chin (Dammam, Saudi Arabia; London,<br />

Edmonton, Canada)<br />

306 <strong>Programme</strong> <strong>Book</strong><br />

Aims and objectives<br />

There is an increasing number of potential biomarkers in prostate cancer. Most contributions in this session<br />

focus on combining information obtained by analysis of several markers in order to identify a more aggressive<br />

disease and assess the risk.


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

15.45 - 17.15 Evolving concepts in testicular cancer<br />

Silver Hall - Level N2<br />

Poster Session 86<br />

Chairs: N. Nicolai, Milan (IT)<br />

A.R. Zlotta, Toronto (CA)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

1051 Multi-focality of testicular germ cell tumours – the findings of the last 100 cases at a tertiary referral<br />

centre<br />

J.W.R. Douglas, S. Dockree, M. Hayes, J. Theaker (Southampton, United Kingdom)<br />

* 1052 Differentiation of microvessels and lymphatic vessels in non seminomatous testicular germ cell tumors<br />

using lymph specific markers: Morphologic characteristics and clinical implications<br />

J. Heinzelbecker, M. Gross-Weege, C. Weiss, M. Liebhardt, M. Trunk, A. Haecker, C. Bolenz (Mannheim,<br />

Germany)<br />

* 1053 External validation of the Heidenreich criteria for the selection of patients for unilateral or bilateral post<br />

chemotherapy retroperitoneal lymph node dissection for residual masses of testicular cancer<br />

C. Vallier, P-H. Savoie, J.R. Delpero, F. Bladou, G. Gravis, N. Salem, J. Walz (Marseille, Toulon, France;<br />

Montreal, Canada)<br />

1054 Bilateral laparoscopic post-chemotherapy retroperitoneal lymph-node dissection in non-seminomatous<br />

germ cell tumors – a comparison to template dissection<br />

S. Aufderklamm, T. Todenhöfer, J Hennenlotter, J. Mischinger, G. Gakis, J. Mundhenk, J. Bedke, A. Stenzl,<br />

C. Schwentner (Tübingen, Germany)<br />

1055 Modified cisplatin, etoposide and ifosfamide (PEI) salvage therapy for male germ-cell tumors (GCT). Longterm<br />

efficacy and safety outcomes<br />

A. Necchi, L. Mariani, N. Nicolai, D. Raggi, E. Farè, P. Giannatempo, L. Piva, D. Biasoni, M. Catanzaro,<br />

T. Torelli, S. Stagni, G. Pizzocaro, A. Gianni, R. Salvioni (Milan, Italy)<br />

1056 Sequential chemotherapy for advanced testicular cancer, Japanese high volume center experience<br />

T. Nakamura, Y. Kimura, T. Ueda, Y. Naya, F. Hongo, T. Miki (Kyoto, Japan)<br />

1057 Persistence of CD30 expression by embryonal carcinoma (EC) in the treatment time course. A retrospective<br />

series of multi-relapsing germ-cell tumors (GCT)<br />

P. Giannatempo, M. Colecchia, B. Paolini, N. Nicolai, D. Raggi, E. Farè, M. Catanzaro, D. Biasoni, T. Torelli,<br />

S. Stagni, L. Piva, R. Salvioni, A. Gianni, A. Necchi (Milan, Italy)<br />

1058 Favorable long-term outcome in 21 patients with inguinoscrotal sarcomas<br />

M. Fröhner, R.R. Schober, A. Lossnitzer, M.P. Wirth (Dresden, Germany)<br />

1059 Elastography shows promise in cancer testicular detection<br />

A. Marsaud, C. Raffaelli, X. Carpentier, N. Mentine, M. Durand, E. Fontas, J.F. Michiels, J. Amiel,<br />

D. Chevallier (Nice, France)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

307<br />

Monday


Monday<br />

1060 Thoracic metastectomy for nonseminomatous testicular tumors (NSTT): Long term survival and prognostic<br />

factors<br />

D. Argirovic, A. Argirovic, V. Stanic (Belgrade, Serbia)<br />

308 <strong>Programme</strong> <strong>Book</strong><br />

Summary<br />

N. Nicolai, Milan (IT)


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

15.45 - 17.15 Stones: URS and stents<br />

Red Hall 1 - Level N1<br />

Poster Session 87<br />

Chairs: B. Dore, Poitiers (FR)<br />

A. Tasca, Vicenza (IT)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

* 1061 Flexible ureteroscopy for upper urinary tract calculi in children<br />

Y. Wu, X. Zou, R. Xiao, Y. Yuan, X. Wang, G. Zhang, G. Wu, D. Long, J. Yang, Y. Xue (Ganzhou, China)<br />

1062 Nanotechnology: 1.2F baskets further enhance irrigation flow in flexible ureterorenoscopy<br />

J. Bedke, U. Leichtle, A. Lorenz, U. Nagele, A. Stenzl, S. Kruck (Tübingen, Germany; Hall in Tirol, Austria)<br />

1063 Laser lithotripsy retropulsion varies with stone mass<br />

M. Robinson, J.M.H. Teichman (Vancouver, Canada)<br />

1064 Is prophylactic antibiotics necessary in patients with pre-operative sterile urine undergoing ureteroscopic<br />

procedures for ureteral stones ?<br />

C.D. Lin, S-J.C. Chang, S.S-D. Yang, C-H. Hsieh (Taipei, Taiwan)<br />

1065 Withdrawn<br />

1066 Is endoscopic evaluation at the end of retrograde intrarenal surgery (RIRS) a valid predictor of stone<br />

treatment outcome?<br />

A. Bosio, P. Destefanis, E. Alessandria, A. Buffardi, E. Dalmasso, M. Carchedi, S. Santià, A. Bisconti, F. Fop,<br />

C. Ceruti, D. Fontana, B. Frea (Turin, Italy)<br />

1067 Post-ureteroscopic lesion scale: Multicentre video-based evaluation of inter-rater reliability<br />

M. Schoenthaler, N. Buchholz, E. Farin, H. Ather, C. Bach, T. Bach, J.D. Denstedt, H.-M. Fritsche, M. Grasso,<br />

O. Hakenberg, R. Herwig, T. Knoll, F.E. Kuehhas, E. Liatsikos, P. Liske, P.J.S. Osther, J.M. Reis-Santos,<br />

K. Sarica, C. Seitz, M. Straub, O. Traxer, A. Trinchieri, B. Turney, A. Miernik (Freiburg, Hamburg, Regensburg,<br />

Rostock, Sindelfingen, Pforzheim, Munich, Germany; London, Oxford, United Kingdom; Karachi, Pakistan;<br />

London, Canada; New York, United States of America; Vienna, Austria; Patras, Greece; Fredericia, Denmark;<br />

Lisbon, Portugal; Istanbul, Turkey; Paris, France; Lecco, Italy)<br />

1068 Analysis for predictive factors for the success of ureteroscopy as day-case surgical procedure for the<br />

treatment of ureteral calculi<br />

R. Molina, N. Gonzalez, M. Alvarez, L. Crespo, R. Alarcon, M. Dorado, A. Paez (Madrid, Spain)<br />

* 1069 Does indwelling ureteral stent preserve renal function after relief of obstructive uropathy?<br />

A.R. Elnahas, A.M. Harraz, M.H. Zahran, H. Abol-Enein (Mansoura, Egypt)<br />

1070 Trends in utilization and comparative outcomes for infected upper urinary tract stones in the United States:<br />

PCN vs stent<br />

J.D. Sammon, K.R. Ghani, S. Sukumar, J.O. Peabody, M. Menon, Q-D. Trinh (Detroit, United States of<br />

America)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

309<br />

Monday


Monday<br />

1071 Prospective evaluation of stent symptoms after uncomplicated ureteroscopy using a validated<br />

questionnaire<br />

A. Bosio, P. Destefanis, E. Alessandria, E. Dalmasso, A. Bisconti, M. Carchedi, A. Buffardi, S. Santià,<br />

C. Ceruti, D. Fontana, B. Frea (Turin, Italy)<br />

1072 Easy ureteral stent removal without cystoscopy after ureteroscopic stone removal (URS)<br />

J.H. Son, G.S. Lim, S.H. Jang, J.W. Lee, D.S. Cho (Seong Nam, South Korea)<br />

310 <strong>Programme</strong> <strong>Book</strong>


Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

Abstract Session<br />

15.45 - 17.15 History of urology 2<br />

Red Hall 2 - Level N1<br />

Poster Session 88<br />

Chairs: A.J. Figueiredo, Coimbra (PT)<br />

J. Mattelaer, Kortrijk (BE)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion.<br />

1073 Review of the urological aspects in the work of Giovanni Da Vigo<br />

J. Medina-Polo, I. Otero Tejero, E. Jiménez Alcaíde, R. Díaz González (Madrid, Guadalajara, Spain)<br />

1074 The history, evolution and development of male urinary incontinence management<br />

R.C. Nayar, A. Deshpande, I.P. Wharton (Birmingham, United Kingdom)<br />

1075 Albucasis: The revelation of urological surgical instruments in the 10th century Islamic world<br />

F. Khan, W.Mahmalji, S. Madaan, I.K. Dickinson, S. Sriprasad (Kent, United Kingdom)<br />

1076 From Lister to laparoscopy: 100 years of urology at King’s College Hospital<br />

J.K. Makanjuola, I.K. Dickinson, A.J. Yates-Bell, J. Philpott-Howard, P.M. Thompson (London, Kent, United<br />

Kingdom)<br />

1077 Glove at first sight – history of the first surgical rubber glove<br />

J.R. Bhatt, I.R.G. Wood, C.P. Hobbs, S. Brewster (Oxford, United Kingdom)<br />

1078 “Peyronies’ disease”, “hottentot apron” and “kidney stones” in the Italian “urologists” of the middle ages<br />

S. Musitelli, I. Bossi (Zibido San Giocomo, Italy)<br />

1079 Reynaldo dos Santos: From aortography to modern urology<br />

L. Marconi, A. Figueiredo, F. Furriel, P. Dinis, A. Mota (Coimbra, Portugal)<br />

1080 Sir Denis Browne: A titan of paediatric urology<br />

H.L. Ratan (Derby, United Kingdom)<br />

1081 A tribute to the life and accomplishments of Mathieu Jaboulay<br />

F. Khan, W. Mahmalji, S. Sriprasad, I.K. Dickinson (Kent, United Kingdom)<br />

1082 The history of the adrenal glands – from The Bible to Jerome Conn<br />

F. Furriel, A.J.C. Figueiredo, L.S.O. Marconi, D.J.S. Castelo, G.H.A. Gomes, V.M.N. Dias (Coimbra, Portugal)<br />

1083 The last <strong>EAU</strong> Congress in Central Europe, Budapest 1986<br />

I. Romics, M. Romics (Budapest, Hungary)<br />

1084 Urological papers and issues arising from the early years of the Chinese medical journal<br />

K.A. Wong, J. Chatterton, M.F. Bultitude (London, United Kingdom)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

311<br />

Monday


Monday<br />

Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

312 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

15.45 - 17.15 Pharmacotherapy of male LUTS<br />

Blue Hall 1-2 - Level N1<br />

Poster Session 89<br />

Chairs: C.G. Roehrborn, Dallas (US)<br />

M.J. Speakman, Taunton (GB)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

* 1085 Adverse event profiles of alpha-1 blocker agents for male patients: Data mining of the public version of the<br />

FDA adverse event reporting system<br />

K. Yoshimura, K. Kadoyama, T. Sakaeda, Y. Sugino, O. Ogawa, Y. Okuno (Kyoto, Japan)<br />

1086 Acute urinary retention risk in BPH patients treated with tamsulosin vs watchful waiting: A 5 year<br />

prospective community based study<br />

K. Lokshin, M. Davidov, I. Gorbunova (Moscow, Perm, Russia)<br />

1087 The Silodosin in Real-life Evaluation (SiRE) study: Baseline characteristics of the patients enrolled in a<br />

European phase IV clinical study with silodosin in the treatment of LUTS/BPH<br />

C.R. Chapple (Sheffield, United Kingdom)<br />

1088 Urinary retention following anticholinergics in patients with BPH in real life practice - a nationwide<br />

population-based study<br />

E.Y-H. Huang, C-C. Lin, H.-. Chung, J-P. Lin, A.T. Lin, K-K. Chen (Taipei, Taiwan)<br />

* 1089 Quality of life analyses from NEPTUNE, a phase 3 trial of combination therapy with tamsulosin OCAS and<br />

solifenacin in men with lower urinary tract symptoms<br />

M.J. Drake, R. Sokol, M. Klaver, T. Drogendijk, Z. Hakimi, I. Odeyemi, P.E.V. Van Kerrebroeck (Bristol,<br />

Chertsey, United Kingdom; Trencin, Slovakia; Leiderdorp, Maastricht, The Netherlands)<br />

1090 Predictors of successful first-line antimuscarinics monotherapy in men with enlarged prostate and<br />

predominant storage symptoms<br />

C.H. Liao, H.C. Kuo (New Taipei City, Hualien, Taiwan)<br />

1091 Effects of add-on mirabegron on storage symptoms in men with lower urinary tract symptoms receiving<br />

alpha-1 blocker therapy<br />

K. Ogura, A. Sengiku, Y. Miyazaki, H. Sawazaki, T. Takahashi (Otsu, Japan)<br />

1092 Combination therapy with dutasteride and tadalafil in men with moderate-to-severe benign prostatic<br />

hyperplasia<br />

H.J. Park, N.C. Park (Busan, South Korea)<br />

1093 Clinical effects of dutasteride and finasteride: Are they different or equivalent? Results from record-linkage<br />

and match-paired analyses<br />

L. Cindolo, C. Fanizza, M. Romero, L. Pirozzi, R. Autorino, F. Berardinelli, L. Schips (Vasto-Chieti, Santa<br />

Maria Imbaro-Chieti, Naples, Italy)<br />

1094 Clinical outcomes after combined therapy with 5alpha-reductase inhibitors and alpha-blockers or either<br />

monotherapy in men with benign prostatic hyperplasia: 4-year results from a record-linkage analysis<br />

L. Cindolo, C. Fanizza, M. Romero, L. Pirozzi, R. Autorino, F. Berardinelli, C. De Nunzio, L. Schips (Vasto-<br />

Chieti, Santa Maria Imbaro-Chieti, Naples, Rome, Italy)


1095 Nocturia improvement in the Combination of Avodart® and Tamsulosin (CombAT) study<br />

M. Oelke, C. Roehrborn, T.H. Wilson, J-M. Palacios, R. Castro (Hanover, Germany; Dallas, North Carolina,<br />

Pennsylvania, United States of America; Madrid, Spain)<br />

1096 Combination therapy with finasteride and tadalafil once daily for 6 months: A randomized, placebocontrolled<br />

study in men with lower urinary tract symptoms secondary to benign prostatic hyperplasia<br />

A.R. Casabe, C. Roehrborn, L.F. Da Pozza, S. Zepeda, R. Henderson, S. Sorsaburu, C. Henneges, D. Wong,<br />

L. Viktrup (Buenos Aires, Argentina; Dallas, Shreveport, Indianapolis, United States of America; Bergamo,<br />

Italy; Saltillo, Mexico; Bad Homburg, Germany)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

313<br />

Monday


Monday<br />

Monday, 18 March - <strong>EAU</strong> <strong>Programme</strong><br />

314 <strong>Programme</strong> <strong>Book</strong><br />

Abstract Session<br />

15.45 - 17.15 Medical treatment of RCC<br />

Yellow Hall 1-2-3 - Level N1<br />

Poster Session 90<br />

Chairs: G. Kramer, Vienna (AT)<br />

H. Uemura, Osaka (JP)<br />

Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes<br />

in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed<br />

by 2 minutes for discussion.<br />

1097 Prognostic factors for patients with metastatic renal cell carcinoma in the era of targeted therapy<br />

D. You, I.G. Jeong, S. Park, J.Y. Joung, J.H. Hong, H. Ahn, C-S. Kim (Seoul, Ulsan, South Korea; New<br />

Brunswick, United States of America)<br />

1098 Tumor growth rate should be applied in the definition of progression disease during molecular targeted<br />

therapy in patients with metastatic renal cell carcinoma<br />

H.L. Zhang, D.W. Ye, G.H. Shi (Shanghai, China)<br />

1099 Individualization of medical treatment in metastasized renal cell carcinoma by measuring the plasma levels<br />

of sunitinib, sorafenib and pazopanib – first clinical experiences<br />

C. Keil, A. Nockher, L. Götze, P. Olbert, R. Hofmann, A. Hegele (Marburg, Germany)<br />

1100 Association of pharmacokinetics of sunitinib with treatment outcome and adverse events in advanced<br />

renal cell carcinoma patients<br />

N. Tsuchiya, N. Fujiyama, S. Narita, T. Inoue, K. Numakura, S. Akihama, M. Saito, S. Satoh, M. Miura,<br />

T. Habuchi (Akita, Japan)<br />

1101 Identification of a potential molecular marker of response to high-dose interleukin-2 in metastatic renal<br />

cell carcinoma patients<br />

C.D. Jacobs, G. Lipowska-Bhalla, N. Dalal, F. Thistlethwaite, R.E. Hawkins, D.G. Rothwell (Manchester,<br />

United Kingdom)<br />

1102 Body-mass-index and survival of patients with metastastic renal cell carcinoma: Data from the German<br />

prospective RCC Registry<br />

P.J. Goebell, L. Müller, U. Von Verschuer, H.J. Hurtz, M. Franzem, M. Vogt, N. Marschner (Erlangen, Leer,<br />

Essen, Halle (Saale), Freiburg, Germany)<br />

1103 FDG PET/CT as imaging biomarker for advanced renal cell carcinoma<br />

N. Nakaigawa, M. Yao, N. Hayashi, U. Tateishi, T. Inoue, Y. Kubota (Yokohama, Japan)<br />

1104 Frequency and risk factors of sorafenib-induced high-grade skin rash in Japanese patients with advanced<br />

renal cell carcinoma<br />

N. Tsuchiya, S. Narita, T. Inoue, N. Hasunuma, K. Numakura, M. Saito, S. Satoh, T. Notoya, N. Fujishima,<br />

S. Hatakeyama, C. Ohyama, T. Habuchi (Akita, Japan)<br />

1105 Neoadjuvant targeted molecular therapies in patients undergoing nephrectomy and inferior vena cava<br />

thrombectomy. A French retrospective study of 13 cases<br />

P. Bigot, J.C. Bernhard, E. Xylinas, T. Fardoun, J. Berger, M. Rouprêt, S. Lagabrielle, S. Lebdai, M. Ammi,<br />

H. Baumert, K. Bensalah, B. Escudier, N. Grenier, J.F. Hetet, J.A. Long, P. Paparel, N. Rioux-Leclercq,<br />

A-R. Azzouzi, M. Soulié, J-J. Patard (Angers, Bordeaux, Paris, Rennes, Limoges, Villejuif, Nantes, Grenoble,<br />

Lyon, Toulouse, Le Kremlin-Bicêtre, France)


1106 The German mRCC registry – aims and results after the first 1000 patients<br />

P.J. Goebell, L. Müller, K. Blumenstengel, A. Hübner, A. Lück, M. Vogt, N. Marschner (Erlangen, Leer,<br />

Eisenach, Rostock, Freiburg, Germany)<br />

* 1107 Outcomes of patients with non clear cell renal cell carcinoma treated with targeted therapy and<br />

prognostication using the International mRCC Database Consortium Criteria<br />

N. Kroeger, W. Xie, J-L. Lee, G.A. Bjarnason, J.J. Knox, M.J. Mackenzie, L. Wood, S. Srinivas,<br />

U.N. Vaishamayan, S.Y. Rha, S.K. Pal, T. Yuasa, F. Donskov, N. Agarwal, C.K. Kollmannsberger, M.H. Tan,<br />

S.A. North, B.I. Rini, T.K. Choueiri, D.Y.C. Heng (Calgary, Toronto, Halifax, Vancouver, Edmonton, Canada;<br />

Boston, Stanford, Detroit, Utah, Cleveland, United States of America; Asan, Seoul, Duarte, South Korea;<br />

London, United Kingdom; Ariake, Tokyo, Japan; Århus, Denmark; Singapore, Singapore)<br />

* 1108 Clinical role of MHC-class I peptide vaccines for metastatic renal cell carcinoma<br />

T. Minami, T. Minami, N. Shimizu, Y. Yamamoto, M. De Velasco, T. Hayashi, H. Tsuji, M. Nozawa,<br />

K. Yoshimura, T. Ishii, H. Uemura (Osaka-Sayama, Japan)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

315<br />

Monday


Monday<br />

Monday, 18 March - Sponsored Sessions<br />

316 <strong>Programme</strong> <strong>Book</strong><br />

Workshop Overview<br />

17.45 - 19.15 Urinary incontinence - Optimising the patient experience and improving outcomes page 418<br />

Amber Hall 6 - Level S2 Sponsored by ALLERGAN and PORGÈS, a COLOPLAST division<br />

Symposia Overview<br />

17.45 - 19.15 Interactive debate: How seriously should I take male LUTS? page 419<br />

Silver Hall - Level N2 Sponsored by ASTELLAS<br />

17.45 - 19.15 New data on androgen deprivation with a GnRH antagonist: Improving patient outcomes in<br />

prostate cancer page 420<br />

Yellow Hall 1-2-3 - Level N1 Sponsored by FERRING PHARMACEUTICALS<br />

17.45 - 19.15 Castration-resistant prostate cancer in <strong>2013</strong>: Analysing the good, the bad and the ugly page 421<br />

Red Hall 2 - Level N1 Sponsored by PRIME ONCOLOGY


Tuesday, 19 March - <strong>EAU</strong> <strong>Programme</strong><br />

Plenary Session 4<br />

08.00 - 13.10 Souvenir sessions/Hot topics in prostate cancer<br />

eURO Auditorium - Level S2<br />

Chairs: A. Stenzl, Tübingen (DE)<br />

H. Van Poppel, Leuven (BE)<br />

08.00 - 09.30 Souvenir session by the <strong>EAU</strong> Scientific Congress Office<br />

Prostate disease<br />

M.S. Michel, Mannheim (DE)<br />

Prostate cancer<br />

A. Briganti, Milan (IT)<br />

Urothelial cancer<br />

J.W.F. Catto, Sheffield (GB)<br />

Renal, testicular and penile cancer<br />

G. Janetschek, Salzburg (AT)<br />

Neurourology, voiding dysfunction and incontinence<br />

F.C. Burkhard, Berne (CH)<br />

Stone disease<br />

B. Tombal, Brussels (BE)<br />

Paediatric urology<br />

W.F.J. Feitz, Nijmegen (NL)<br />

Andrology<br />

J.O.R. Sonksen, Herlev (DK)<br />

Reconstruction, transplantation and trauma<br />

L. Martínez Piñeiro, Madrid (ES)<br />

09.30 - 09.40 <strong>EAU</strong> policy on live surgery<br />

K.F. Parsons, Liverpool (GB)<br />

Aims and objectives<br />

In mid 2012, the <strong>EAU</strong> established a panel of internationally recognised experts to address the issue of the<br />

ethics of live surgical demonstrations in urology.<br />

The culmination of their work is a formal <strong>EAU</strong> policy statement which will be presented to the Congress on<br />

their behalf. This will include the underpinning governance documents which have been formulated.<br />

The methodology, including the supporting literature review and the Delphi process used to determine the<br />

consensus view, will be shown, together with proposals for continuing prospective audit of all live surgical<br />

events undertaken under the auspices, and with the endorsement of the <strong>EAU</strong>.<br />

09.40 - 09.45 Introduction to the plenary session<br />

A. Stenzl, Tübingen (DE)<br />

09.45 - 10.00 Update New urological weapons in the treatment of CRPC<br />

A. Heidenreich, Aachen (DE)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

317<br />

Tuesday


Tuesday<br />

10.00 - 10.20 Late breaking news I<br />

318 <strong>Programme</strong> <strong>Book</strong><br />

Can Zometa prevent bone metastases in high risk prostate cancer patients? First Results of the Zometa<br />

European Study (ZEUS).<br />

M. Wirth, Dresden (DE)<br />

Prostate cancer in China<br />

Y-H. Sun, Shanghai (CN)<br />

10.20 - 10.40 State-of-the-art lecture Is there a role for intermittent androgen deprivation?<br />

T.L.J. Tammela, Tampere (FI)<br />

10.40 - 11.20 Debate High risk PC: Surgery vs radiation vs systemic therapy<br />

Moderator: M. Jewett, Toronto (CA)<br />

Surgery: H. Van Poppel, Leuven (BE)<br />

Radiation: A. Bossi, Villejuif (FR)<br />

Systemic therapy: P. Iversen, Copenhagen (DK)<br />

Aims and objectives<br />

The optimal management for men presenting with high risk prostate cancer remains controversial.<br />

Experts will debate the merits of radical prostatectomy, radiation therapy and systemic therapy alone or in<br />

combination. At the end of the session, the delegates will better understand how to personalize the care of<br />

the individual patient presenting with this life threatening disease to achieve the best chance of cure while<br />

minimizing the burden of treatment.<br />

11.20 - 11.35 Late breaking news II<br />

Swedish Registry Study<br />

P. Wiklund, Stockholm (SE)<br />

11.35 - 12.15 Debate Why focal therapy instead of active surveillance for low risk prostate cancer<br />

Moderator: F.C. Hamdy, Oxford (GB)<br />

Pro: M. Emberton, London (GB)<br />

Con: M. Wirth, Dresden (DE)<br />

12.15 - 12.35 Report on the Consensus Statement for Prostate Cancer Prevention<br />

J. Cuzick, London (GB)<br />

12.35 - 13.05 Update European PSA screening<br />

ERSPC perspective<br />

J.E. Hugosson, Göteborg (SE)<br />

Aims and objectives<br />

Screening for prostate cancer is controversial. While a large randomized study has shown a benefit<br />

of screening in terms of prostate cancer mortality. Generally accepted evidence on a proper balance on<br />

advantages and disadvantages is lacking. The purpose of this session will be to inform on the present status<br />

of screening and proper decision taking.


Patient perspective<br />

T. Hudson, Dublin (IE)<br />

<strong>EAU</strong> perspective<br />

P-A. Abrahamsson, Malmö (SE)<br />

12.50 - 13.05 Debate on European PSA screening<br />

P-A. Abrahamsson, Malmö (SE)<br />

J.E. Hugosson, Göteborg (SE)<br />

T. Hudson, Dublin (IE)<br />

Aims and objectives<br />

• Prostate cancer is a major health problem, and the main cause of male cancer deaths. However, current<br />

published data are insufficient to recommend the adoption of population screening for prostate cancer<br />

as a public health policy due to the large over-treatment effect. Before screening is considered by<br />

national health authorities, the level of current opportunistic screening, overdiagnosis, overtreatment,<br />

quality of life, costs, and cost-effectiveness should be taken into account.<br />

• Overdiagnosis of prostate cancer leads potentially to significant overtreatment. Health professionals,<br />

especially urologists, should avoid overtreatment by developing safe methods of cancer surveillance/<br />

monitoring without invasive therapy. Invasive therapies should be tailored to patients’ needs and the<br />

prognosis of cancers diagnosed.<br />

• Current screening algorithms are insufficient for population screening or individual early diagnosis<br />

due to a lack of specificity and lack of selectivity for aggressive cancers which require treatment. The<br />

development of novel diagnostic and prognostic markers and imaging modalities is needed urgently to<br />

enhance the predictive value of screening tools.<br />

• In the absence of population screening, the <strong>EAU</strong> advises men who consider screening by PSA testing<br />

and prostate biopsy to obtain information on the risks and benefits of screening and individual risk<br />

assessment.<br />

• The European Association of Urology and the ERSPC study group represent essential European<br />

stakeholders to further develop health strategies for prostate cancer screening.<br />

• The <strong>EAU</strong> promotes the quality of care for prostate cancer patients in Europe in collaboration with the<br />

patient support organization Europa Uomo (www.europa-uomo.org) through the development of<br />

information and guidelines.<br />

• The <strong>EAU</strong> wishes to support and foster research needed to develop reliable active surveillance protocols<br />

for low-risk prostate cancers, prognostic markers, and targeted therapies in order to deliver optimal<br />

patient care.<br />

13.05 - 13.10 Closing remarks<br />

P-A. Abrahamsson, Malmö (SE)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

319<br />

Tuesday


ESU Courses, 16 March<br />

ESU Course 1<br />

14.30 - 17.30 Prostate cancer – Screening, diagnosis and staging<br />

Green Hall 1 - Level N-1<br />

Screening<br />

F.C. Hamdy, Oxford (GB)<br />

Diagnosis<br />

A.R. Zlotta, Toronto (CA)<br />

Staging<br />

A.R. Zlotta, Toronto (CA)<br />

Chair: F.C. Hamdy, Oxford (GB)<br />

Aims and objectives<br />

The incidence of prostate cancer has increased dramatically over the last 10 to 15 years and it is now the<br />

most common cancer in males in developed countries. The increase is mainly caused by the growing use<br />

of opportunistic screening or case-finding based on the use of prostate-specific antigen (PSA) testing in<br />

serum. Using this approach, prostate cancer is detected 5 to 10 years before giving rise to symptoms and on<br />

average 17 years before causing the death of the patient. While this has led to detection of prostate cancer<br />

at a potentially curable stage, it has also led to substantial overdiagnosis, i.e. detection of cancers that<br />

would not surface clinically in the absence of screening. This is confounded by recent evidence that screening<br />

reduces disease-specific mortality. A major challenge is thus to identify the cases that need to be treated<br />

while avoiding diagnosing patients who will not benefit from being diagnosed and who will only suffer from<br />

the stigma of being a cancer patient. Therefore, prognostic markers, which can predict those patients who<br />

need to be diagnosed and those who do not, are of major importance. This course is designed for urological<br />

trainees and established urologists, who wish to update themselves on the latest information regarding<br />

screening, diagnosis and staging in prostate cancer. The course allows interaction with the audience and is<br />

in part based on case-scenarios for discussion with the delegates, followed by state-of-the-art presentations.<br />

In addition, emphasis will be placed on controversial issues and recent progress in terms of diagnostic tools,<br />

staging procedures and prognostic factors. At the end of the course, the participants should have obtained<br />

good insights on the following:<br />

• What are the best approaches to screening and early detection of prostate?<br />

• How can we reduce the risk of overdiagnosis and overtreatment?<br />

• How can we identify patients who are best managed by active monitoring/surveillance rather than<br />

immediate more active treatment?<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 47<br />

Non-<strong>EAU</strong> members € 69<br />

Residents (members/non-members) € 21<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

321<br />

ESU Courses


ESU Courses<br />

ESU Courses, 16 March<br />

322 <strong>Programme</strong> <strong>Book</strong><br />

ESU Course 2<br />

14.30 - 17.30 Advanced course on urethral stricture surgery<br />

Green Hall 2 - Level N-1<br />

Chair: C.R. Chapple, Sheffield (GB)<br />

Management of anterior urethral stricture disease – an evidence based approach.<br />

C.R. Chapple, Sheffield (GB)<br />

Urethroplasty for posterior urethral injuries –an evidence based approach<br />

S.G.Joniau, Leuven (BE)<br />

Female strictures<br />

C.R. Chapple, Sheffield (GB)<br />

Case discussion<br />

A Roosen, Munich (DE)<br />

Round table discussion<br />

The panel<br />

Aims and objectives<br />

· To be able to counsel and advise a patient on the therapeutic options available.<br />

· To review the treatments available for urethral stricture disease and to do so in the context of different<br />

patient based scenarios, in an interactive fashion.<br />

· To provide a clearer understanding of the role and potential for both anastomotic and substitution<br />

urethroplasty in the management of urethral stricture disease.<br />

· To review the different materials and techniques used in substitution urethroplasty<br />

· To outline the principles of the surgical management of patients with urethras that have been injured by<br />

trauma.<br />

Participants of the course will obtain a clear view on the current role of surgery for the management of<br />

urethral stenosis affecting both the anterior and posterior urethra in contemporary clinical practice.<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 47<br />

Non-<strong>EAU</strong> members € 69<br />

Residents (members/non-members) € 21


ESU Courses, 16 March<br />

ESU Course 3<br />

14.30 - 17.30 Metastatic prostate cancer<br />

Green Hall 3 - Level N-1<br />

Chair: K. Pummer, Graz (AT)<br />

First and second line hormonal therapy: What should be considered?<br />

K. Miller, Berlin (DE)<br />

What is the role of chemotherapy and immunotherapy in patients with CRPC?<br />

G. Mickisch, Bremen (DE)<br />

New therapeutic options for patients with CRPC – more possibilities, more questions?<br />

K. Pummer, Graz (AT)<br />

Case discussion<br />

G. Mickisch, Bremen (DE)<br />

K. Miller, Berlin (DE)<br />

K. Pummer, Graz (AT)<br />

Aims and objectives<br />

The aim of this course is to provide comprehensive state-of-the-art information about the optimal<br />

management of patients with metastatic prostate cancer.<br />

The first lecture will give an overview of the various forms of currently available androgen deprivation<br />

therapies such as LHRH analogs and antagonists, address the potential advantages or disadvantages of<br />

intermittent treatment, as well as outline the optimal timing of hormonal therapy. In addition, the role of<br />

possible second-line hormonal manipulations will be presented.<br />

The second lecture will present and critically discuss the role of chemotherapy as well as immunotherapy<br />

at the time when hormone resistance has developed with a special emphasis on efficacy, side effects,<br />

sequencing and patients` selection.<br />

The third lecture will address recent achievements as well as future challenges by reviewing the mode of<br />

action and the current role of newer therapeutic options such as testosterone synthesis inhibitors, androgen<br />

receptor antagonists, or radionuclide therapy.<br />

At the end of the course, interactive cases will be discussed together with the audience and there will be<br />

plenty of time for questions and answers.<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 47<br />

Non-<strong>EAU</strong> members € 69<br />

Residents (members/non-members) € 21<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

323<br />

ESU Courses


ESU Courses<br />

ESU Courses, 16 March<br />

324 <strong>Programme</strong> <strong>Book</strong><br />

ESU Course 4<br />

14.30 - 17.30 Retropubic radical prostatectomy – Tips, tricks and pitfalls<br />

Orange Hall 1 - Level N-1<br />

Surgical anatomy<br />

O.W. Hakenberg, Rostock (DE)<br />

Chair: H. Van Poppel, Leuven (BE)<br />

Step by step radical retropubic prostatectomy<br />

H. Van Poppel, Leuven (BE)<br />

Tips, tricks and pitfalls<br />

O.W. Hakenberg, Rostock (DE)<br />

Treatment of complications<br />

H. Van Poppel, Leuven (BE)<br />

Discussion and interaction<br />

Faculty<br />

Aims and objectives<br />

In many parts of Europe, open retropubic radical prostatectomy is still the gold standard for treating<br />

localised prostate cancer. Although laparoscopic, eventually robot assisted, radical prostatectomy is getting<br />

more popular in selected centres, and the open surgical approach is still the most often performed operative<br />

procedure in many countries throughout Europe. Localised prostate cancer is being more and more detected<br />

in its earlier stages and surgery undoubtedly offers the best local control. The urologist’s surgical skill must be<br />

outstanding and the urological community is responsible for guaranteeing optimal surgical quality through<br />

adequate training. The competition with external beam radiotherapy, brachytherapy and novel minimally<br />

invasive techniques like cryosurgery and HIFU, should encourage young urologists to optimally perform the<br />

surgical resection with the best possible tumour control and the least impact on continence and potency.<br />

This course aims to bring to the modern urologist the different technical steps of the classical ‘retropubic<br />

prostatectomy’ with an emphasis on the preservation of continence and potency and discusses the special tips<br />

and tricks that must enable every contemporary urologist to obtain good results with minimal complications.<br />

Also, the prevention and treatment of complications are discussed.<br />

This teaching course is a must for the elder resident and the younger urologist beginning his career but well<br />

trained urologists who do not treat many patients with localised prostate cancer, will benefit. The participants<br />

will get inside the detailed surgical anatomy, the pre-operative measures and the intra-operative steps of a<br />

very systematic and safe operation. Also the experienced uro-oncological surgeon will enjoy the tricks and<br />

pitfalls and will learn how to solve intra- and postoperative complications.<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 47<br />

Non-<strong>EAU</strong> members € 69<br />

Residents (members/non-members) € 21


ESU Courses, 16 March<br />

ESU Course 5<br />

14.30 - 17.30 Office management of male sexual dysfunction<br />

Orange Hall 2 - Level N-1<br />

Diagnostics - What is necessary?<br />

I. Eardley, Leeds (GB)<br />

Testosterone replacement<br />

C. Stief, Munich (DE)<br />

Oral therapy for ED<br />

I. Eardley, Leeds (GB)<br />

Therapy of ED when pills fail<br />

D. Ralph, London (GB)<br />

Chair: C. Stief, Munich (DE)<br />

Medical therapy for premature ejaculation<br />

I. Eardley, Leeds (GB)<br />

Surgical topics: Penile implants, priapism, Peyronie’s<br />

D. Ralph, London (GB)<br />

What to do after radical prostatectomy?<br />

C. Stief, Munich (DE)<br />

Aims and objectives<br />

The course is aimed at providing practical advice on how to diagnose and treat a patient with premature<br />

ejaculation or ED. It will allow an up-to-date understanding of the underlying mechanisms of the erectile<br />

process and the aetiology of ED. The recent development of various orally available drugs with different<br />

modes of action and distinctly different side-effect profiles enables individually tailored therapies. However,<br />

an individually adopted regimen requires an adequate work up that will be comprehensively presented.<br />

Although currently available and future oral drugs will be covered in depth, alternative options such as<br />

testosterone supplementation, local pharmacotherapy or various devices will be presented with special<br />

emphasis since their adequate indication and appropriate use by the urologist makes the distinctive<br />

difference in comparison to other specialists in the field. The indications for, and specific aspects for penile<br />

prosthesis will be discussed since prostheses still represent an important option for select patients. Then,<br />

specific topics with high practical importance as the cardiovascular patient with ED or the post-prostatectomy<br />

case will be covered.<br />

The course will be very interactive allowing in-depth information on the various aspects of the cutting edge<br />

of ED.<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 47<br />

Non-<strong>EAU</strong> members € 69<br />

Residents (members/non-members) € 21<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

325<br />

ESU Courses


ESU Courses<br />

ESU Courses, 16 March<br />

326 <strong>Programme</strong> <strong>Book</strong><br />

ESU Course 6<br />

14.30 - 17.30 Prolapse management and female pelvic floor problems<br />

Orange Hall 3 - Level N-1<br />

Introduction<br />

D.J.M.K. De Ridder, Leuven (BE)<br />

Vaginal surgical anatomy for urologists<br />

E. Kocjancic, Chicago (US)<br />

Investigations and imaging for POP<br />

D.J.M.K. De Ridder, Leuven (BE)<br />

Vaginal native tissue repair<br />

D.J.M.K. De Ridder, Leuven (BE)<br />

Vaginal mesh repair<br />

E. Kocjancic, Chicago (US)<br />

Open/laparoscopic/robotic repair<br />

E. Costantini, Perugia (IT)<br />

The politics of mesh repair<br />

D.J.M.K. De Ridder, Leuven (BE)<br />

Management of complications<br />

E. Costantini, Perugia (IT)<br />

Chair: D.J.M.K. De Ridder, Leuven (BE)<br />

Aims and objectives<br />

This course gives practical information about prolapse management by urologists. From anatomy to mesh<br />

implant and the management of complications.<br />

The recent turmoil on the vaginal mesh implantation will be discussed in detail. Also laparoscopic and<br />

robotic approaches will be evaluated.<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 47<br />

Non-<strong>EAU</strong> members € 69<br />

Residents (members/non-members) € 21


ESU Courses, 17 March<br />

ESU Course 7<br />

08.30 - 11.30 Management of small renal tumours<br />

Green Hall 1 - Level N-1<br />

Active surveillance<br />

P. Gontero, Turin (IT)<br />

Ablative therapies<br />

J.J.M.C.H. De La Rosette, Amsterdam (NL)<br />

Surgery<br />

F. Keeley, Bristol (GB)<br />

Chair: P. Gontero, Turin (IT)<br />

Aims and objectives<br />

The aims of this course are to review the various therapeutic strategies in small localised RCC.<br />

The techniques such as surgery (open and laparoscopy) radical and nephron sparing, cryotherapy,<br />

radiofrequency and HIFU will be presented. Their respective indications including surveillance will be<br />

discussed. An overview of the published results will be presented and analysed. Interaction is the most<br />

important way to have an efficient course.<br />

Video and clinical cases will be used as a tool to stimulate exchange.<br />

We hope to meet you in Milan during the <strong>EAU</strong> Annual Congress to enjoy lots of discussions on this interesting<br />

topic.<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 47<br />

Non-<strong>EAU</strong> members € 69<br />

Residents (members/non-members) € 21<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

327<br />

ESU Courses


ESU Courses<br />

ESU Courses, 17 March<br />

328 <strong>Programme</strong> <strong>Book</strong><br />

ESU Course 8<br />

08.30 - 10.30 Renal transplantation: Technical aspects, diagnosis and management<br />

of early and late urological complications<br />

Green Hall 2 - Level N-1<br />

Chair: F.J. Burgos Revilla, Madrid (ES)<br />

Selection and urological preparation of transplant recipients; surgical aspects of nephrectomy in living and<br />

deceased donor<br />

A.J. Figueiredo, Coimbra (PT)<br />

Laparoscopic living donor nephrectomy: Technical aspects and controversies<br />

F.J. Burgos Revilla, Madrid (ES)<br />

Avoiding complications by proper techniques of renal transplantation; tricks and tips<br />

A.J. Figueiredo, Coimbra (PT)<br />

How to diagnose and manage postoperative and long-term complications following renal transplantation<br />

F.J. Burgos Revilla, Madrid (ES)<br />

Aims and objectives<br />

Given the dramatic improvement in short- and long-term graft and patient survival, renal transplantation<br />

has become the most effective treatment of end stage renal failure. Recipients considered for transplantation<br />

are currently older and pose more problems than in the past, in some cases requiring specific urological<br />

preparation. We would like to share our experience concerning the selected items with the audience. These<br />

include how to select and to prepare transplant recipients with surgical or urological problems, how to<br />

choose the most safe technique for performing deceased donor and living donor nephrectomy, how to deal<br />

with unusual situations of renal procurement or transplantation and finally, for urologists, how to diagnose<br />

and manage postoperative and long-term urological and other complications.<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 32<br />

Non-<strong>EAU</strong> members € 47<br />

Residents (members/non-members) € 21


ESU Courses, 17 March<br />

ESU Course 9<br />

08.30 - 11.30 Advanced course on upper tract laparoscopy (UPJ, adrenal and<br />

stones)<br />

Green Hall 3 - Level N-1<br />

Chair: G. Janetschek, Salzburg (AT)<br />

Transperitoneal approach to the kidney and adrenal gland: Standard technique and modifications<br />

G. Janetschek, Salzburg (AT)<br />

Retroperitoneoscopy: Lateral and posterior approach<br />

F. Porpiglia, Turin (IT)<br />

Dismembered pyeloplasty: Technique, problems, complications<br />

H. Baumert, Paris (FR)<br />

Non-dismembered pyeloplasty: Indication, technique<br />

G. Janetschek, Salzburg (AT)<br />

Adrenalectomy<br />

H. Baumert, Paris (FR)<br />

Partial adrenalectomy<br />

G. Janetschek, Salzburg (AT)<br />

Stone surgery<br />

F. Porpiglia, Turin (IT)<br />

Questions and discussion<br />

Faculty<br />

Aims and objectives<br />

Surgery of the kidney and adrenal gland by means of laparoscopy has become standard of care. Most<br />

frequently this surgery is performed transperitoneally; this approach has been standardized. However, the<br />

anatomy of the right and left side differs substantially which has to be taken into consideration. Also several<br />

modifications have been developed such as a direct approach to the left renal pelvis through the colonic<br />

mesentery. Retroperitoneoscopy is an alternative which should be mastered as well.<br />

Adrenalectomy was the first widely recognized indication for laparoscopy in urology, and open surgery<br />

has almost vanished for this indication. Partial adrenalectomy may be considered as an alternative<br />

in benign solitary tumours such as Conn adenoma but is strongly recommended in familial bilateral<br />

pheochromocytoma.<br />

For the treatment of UPJ obstruction laparoscopy has to compete with both open surgery and endopyelotomy.<br />

Compared to open surgery the results are the same but morbidity is lower. Morbidity of endopyelotomy is<br />

lower, however, but the results are not as good in the long-term. The technique of dismembered and nondismembered<br />

pyeloplasty will be discussed in detail.<br />

Laparoscopic stone surgery is usually not a first line therapy. In specific situations it may be helpful,<br />

however.<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

329<br />

ESU Courses


ESU Courses<br />

330 <strong>Programme</strong> <strong>Book</strong><br />

All the mentioned techniques will be presented in an interactive way. Essential steps will be highlighted by<br />

video clips.<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 47<br />

Non-<strong>EAU</strong> members € 69<br />

Residents (members/non-members) € 21


ESU Courses, 17 March<br />

ESU Course 10<br />

08.30 - 11.30 Advanced course on laparoscopic nephrectomy<br />

Orange Hall 1 - Level N-1<br />

Introduction<br />

H.P. Beerlage, ‘s-Hertogenbosch (NL)<br />

V. Pansadoro, Rome (IT)<br />

Indications for laparoscopic nephrectomy<br />

V. Pansadoro, Rome (IT)<br />

Transperitoneal access<br />

V. Pansadoro, Rome (IT)<br />

Extraperitoneal access<br />

H.P. Beerlage, ‘s-Hertogenbosch (NL)<br />

V. Pansadoro, Rome (IT)<br />

Chair: V. Pansadoro, Rome (IT)<br />

Transperitoneal safe control of the renal pedicle<br />

V. Pansadoro, Rome (IT)<br />

Extraperitoneal safe control of the renal pedicle<br />

H.P. Beerlage, ‘s-Hertogenbosch (NL)<br />

Hemostatis<br />

H.P. Beerlage, ‘s-Hertogenbosch (NL)<br />

High energy tools<br />

V. Pansadoro, Rome (IT)<br />

Critical view of safety<br />

H.P. Beerlage, ‘s-Hertogenbosch (NL)<br />

Indications and technique for partial nephrectomy<br />

V. Pansadoro, Rome (IT)<br />

Indications and technique for partial nephrectomy. The Padua score<br />

H.P. Beerlage, ‘s-Hertogenbosch (NL)<br />

Pedicle control. Advantages and disadvantages of the different systems. (Vascular clamp, tourniquet, bulldog<br />

clamp)<br />

V. Pansadoro, Rome (IT)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

331<br />

ESU Courses


ESU Courses<br />

332 <strong>Programme</strong> <strong>Book</strong><br />

Classical laparoscopy or robotic enucleation?<br />

H.P. Beerlage, ‘s-Hertogenbosch (NL)<br />

V. Pansadoro, Rome (IT)<br />

Parenchymal clamping<br />

H.P. Beerlage, ‘s-Hertogenbosch (NL)<br />

Surgical tips for the nephroureterectomy<br />

V. Pansadoro, Rome (IT)<br />

Conversions<br />

H.P. Beerlage, ‘s-Hertogenbosch (NL)<br />

Vascular emergencies during renal surgery<br />

H.P. Beerlage, ‘s-Hertogenbosch (NL)<br />

V. Pansadoro, Rome (IT)<br />

Conclusion<br />

H.P. Beerlage, ‘s-Hertogenbosch (NL)<br />

V. Pansadoro, Rome (IT)<br />

Aims and objectives<br />

Different access to radical nephrectomy will be discussed.<br />

Best way to control the pedicle with the different approaches.<br />

Indications and surgical technique to partial nephrectomy.<br />

Pedicle control and efficient hemostasis.<br />

All the subjects will be discussed from a practical point of view with tips, tricks and pitfalls.<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 47<br />

Non-<strong>EAU</strong> members € 69<br />

Residents (members/non-members) € 21


ESU Courses, 17 March<br />

ESU Course 11<br />

08.30 - 11.30 Painful bladder / chronic pelvic pain; In men and women<br />

Orange Hall 2 - Level N-1<br />

Welcome<br />

J.J. Wyndaele, Antwerp (BE)<br />

Chair: J.J. Wyndaele, Antwerp (BE)<br />

Neurophysiology of chronic pelvic pain, causes and confusable diseases<br />

J.J. Wyndaele, Antwerp (BE)<br />

Chronic prostatitis and chronic pelvic pain in men<br />

S. Elneil, London (GB)<br />

Bladder pain syndrome BPS/IC<br />

J.J. Wyndaele, Antwerp (BE)<br />

Discussion, case presentations and conclusion<br />

Faculty<br />

Aims and objectives<br />

Painful diseases of the pelvis are not rare. The clinical entity is not an easy one, both in diagnosis and in<br />

treatment. Interactions between organs complicate the approach. The list of ‘confusable’ diseases is long and<br />

the most direct way to the most probable diagnosis needs to be determined while avoiding the danger of<br />

overlooking another dangerous pathology.<br />

An increase in knowledge has been important during the last couple of years. The scope of the course is to<br />

bring participants up to date, so that after the course they can perform the most optimal evaluation of the<br />

patients with chronic pelvic pain and give the treatment best adapted to our actual knowledge.<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 47<br />

Non-<strong>EAU</strong> members € 69<br />

Residents (members/non-members) € 21<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

333<br />

ESU Courses


ESU Courses<br />

ESU Courses, 17 March<br />

334 <strong>Programme</strong> <strong>Book</strong><br />

ESU Course 12<br />

08.30 - 11.30 Lower urinary tract dysfunction and urodynamics<br />

Orange Hall 3 - Level N-1<br />

The scientific basics of urodynamics<br />

P. Abrams, Bristol (GB)<br />

Chair: P. Abrams, Bristol (GB)<br />

Urodynamics - Getting philosophy and technique correct<br />

P. Abrams, Bristol (GB)<br />

Urodynamics in neurourology<br />

S. Madersbacher, Vienna (AT)<br />

Urodynamics in female urology<br />

P. Abrams, Bristol (GB)<br />

Urodynamics in the child and in men<br />

S. Madersbacher, Vienna (AT)<br />

Aims and objectives<br />

Having attended the course, the attendee should:<br />

• Understand the basic physical principles referable to urodynamics<br />

• Be able to assess the quality of a urodynamic trace<br />

• Recognise common artefacts and know how to correct them<br />

• Know the indications for urodynamic studies in children, men, women and neurological patients.<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 47<br />

Non-<strong>EAU</strong> members € 69<br />

Residents (members/non-members) € 21


ESU Courses, 17 March<br />

ESU Course 13<br />

12.00 - 14.00 Pathology (prostate, bladder/UUT, kidney, testicles/penis)<br />

Green Hall 1 - Level N-1<br />

Chair: E. Compérat, Paris (FR)<br />

How to get best results for your patient. Challenges in pathology of the prostate and bladder<br />

E. Compérat, Paris (FR)<br />

New insights and changes in pathology of the kidney and testis<br />

F. Algaba, Barcelona (ES)<br />

Aims and objectives<br />

This course for urologists will treat prostate, bladder, kidney and testicular pathology. It is not a course of<br />

pathology, but wants to improve the urologist-pathologist interaction. The attended aim is to get correct<br />

diagnosis, understand as well problems which pathologists may encounter, as the most important details<br />

mentioned in a pathology report.<br />

Several question frequently asked by urologists will be treated:<br />

I.) Clinical practice and optimal handling of pathology specimen.<br />

Is my clinical practice optimal to obtain best pathology report, how can I improve the interaction with the<br />

pathologist?<br />

- The importance of clinical information and well edited, good sampling will be explained, especially limits<br />

of diagnosis in case of artefacts. Solutions how to avoid them will be discussed.<br />

- Which information has to be exchanged between the urologists and the pathologists? The importance of<br />

clinical information and history will be underlined.<br />

- Robustness of pathology reports and when urologists should ask for a second opinion will be discussed.<br />

II.) When ask for frozen sections and biopsies that are possible results.<br />

Evaluation of surgical margins<br />

- The indication of frozen sections and biopsies is a topic of major concern. Indications of frozen sections<br />

have to be precise and useful; otherwise it becomes an expensive and time spending procedure. We point<br />

out the right indications.<br />

- Another important point which overlaps with the above mentioned is the evaluation of the surgical margins,<br />

limits in pathology and how we can improve.<br />

- We also want to discuss the usefulness of biopsies in kidney tumours, prostate, bladder and upper urinary<br />

tract. Where are our limits, what do urologists expect expectations and how to proceed to get optimal<br />

results?<br />

III.) Pathology report. How to read and understand all included information<br />

The aim is to discuss the major items of a pathology report.<br />

- Am I using all the information which is in a pathological report?<br />

- Do I know the latest staging and grading?<br />

- Which information do I have to expect and ask in case of absence?<br />

- Understand why the pathologist does immunohistochemistry.<br />

- The most important antibodies (understanding of which antibody is in favour of which lesion and evokes<br />

which hypothesis).<br />

IV.) Novelties in Uro-Onco Pathology. Applications in daily practice<br />

- Many new acquisitions are regularly made in Uro-Oncological Pathology. The latest news in burning<br />

research topic will briefly be discussed.<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

335<br />

ESU Courses


ESU Courses<br />

336 <strong>Programme</strong> <strong>Book</strong><br />

- The presentation of new pathological entities with clinical implications will be treated.<br />

We will discuss the correlation between morphology and biology which special emphasis about the role that<br />

the pathologist plays in the detection of the therapeutic targets, especially in renal cell cancer.<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 32<br />

Non-<strong>EAU</strong> members € 47<br />

Residents (members/non-members) € 21


ESU Courses, 17 March<br />

ESU Course 14<br />

12.00 - 14.00 Surgical management of locally advanced and metastatic renal cancer<br />

Green Hall 2 - Level N-1<br />

Chair: M. Kuczyk, Hanover (DE)<br />

State of the art regarding systemic treatment of matastasized renal cancer<br />

S. Osanto, Leiden (NL)<br />

Surgical options for metastasized renal cell cancer<br />

M. Kuczyk, Hanover (DE)<br />

Surgical treatment of locally advanced renal cell cancer<br />

A. Bex, Amsterdam (NL)<br />

Aims and objectives<br />

Although most renal cancers are small and incidentally found, a significant proportion of patients still present<br />

with locally advanced or even metastatic renal cell carcinoma (RCC) at first diagnosis or develop metastatic<br />

spread during the further course of the disease.<br />

RCC is a unique disease where we had important developments in the last 2 decades both in surgical as<br />

well as nonsurgical and systemic therapies. Although we have now at least 7 drugs with proven efficacy in<br />

metastatic RCC, surgery still remains the only curative therapy.<br />

The first aim of this course is to highlight the role of surgery versus a conservative therapeutic approach.<br />

The efficacy of metastasectomy, for example, will be weighed against that of a medical treatment that is<br />

mainly based on anti – VEGF – directed agents. In addition, new therapeutic concepts including neoadjuvant<br />

treatment upfront surgery for locally advanced disease including patients with intracaval thrombosis will be<br />

highlighted.<br />

Surgery for locally advanced disease particularly in patients with vena caval thrombus is a challenging<br />

situation and tips and tricks of this type of surgery including the clinical results that can be achieved by<br />

an aggressive surgical management will be indicated. And finally, the place of cytoreductive nephrectomy<br />

during the treatment of metastatic RCC and the role of surgery for the treatment of locally recurrent disease<br />

will be discussed.<br />

This course is an excellent opportunity to learn what the urologist can offer to renal cancer patients with<br />

difficult tumours and metastatic RCC. The course is an ideal opportunity for all; residents, the practicing<br />

urologist and the oncologic urologist. Don’t miss this course if you see patients with advanced RCC in your<br />

practice!<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 32<br />

Non-<strong>EAU</strong> members € 47<br />

Residents (members/non-members) € 21<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

337<br />

ESU Courses


ESU Courses<br />

ESU Courses, 17 March<br />

338 <strong>Programme</strong> <strong>Book</strong><br />

ESU Course 15<br />

12.00 - 14.00 Laparoscopy for beginners<br />

Green Hall 3 - Level N-1<br />

Indications for laparoscopy<br />

A.D. Joyce, Leeds (GB)<br />

Instrumentation and haemostasis<br />

X. Cathelineau, Paris (FR)<br />

Chair: A.D. Joyce, Leeds (GB)<br />

Peritoneal access and effects of pneumoperitoneum<br />

A.D. Joyce, Leeds (GB)<br />

Avoiding complications<br />

X. Cathelineau, Paris (FR)<br />

Aims and objectives<br />

Urologists interested in undertaking laparoscopy must be properly trained in order to minimise the risk of<br />

potential complications and to ensure patient safety. Currently training in urological laparoscopy is limited<br />

due to several factors:<br />

• A shortage of designated training centres<br />

• A shortage of recognised trainers<br />

• Lack of either appropriate facilities, limitations of equipment, expertise or support<br />

All of which restrict the trainee from access to high quality training. This course aims to provide the potential<br />

trainee with the recognised core knowledge with regard to case selection, correct use of the equipment and<br />

imaging systems, and the important protocols for accessing and exiting the abdomen, including how to<br />

recognise and avoid potential complications prior to starting with the skills acquisition. The central highlight<br />

of the course is the use of video clips to illustrate many of the essential points and to promote discussion<br />

amongst the delegates.<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 32<br />

Non-<strong>EAU</strong> members € 47<br />

Residents (members/non-members) € 21


ESU Courses, 17 March<br />

ESU Course 16<br />

12.00 - 14.00 Testicular cancer<br />

Orange Hall 1 - Level N-1<br />

Testis cancer – Early stages<br />

N.W. Clarke, Manchester (GB)<br />

Testis cancer – Case discussion<br />

N.W. Clarke, Manchester (GB)<br />

Testis cancer – Advanced stages<br />

P. Albers, Düsseldorf (DE)<br />

Testis cancer – Case discussion<br />

P. Albers, Düsseldorf (DE)<br />

Chair: P. Albers, Düsseldorf (DE)<br />

Aims and objectives<br />

The <strong>EAU</strong> guidelines on testicular cancer have been updated for 2012. Based on this European consensus,<br />

this ESU course will provide the auditorium with the latest information on diagnostic tools, staging and<br />

treatment of testis cancer stage by stage. In early-stage cancer, organ-sparing surgery, the question of<br />

testicular microlithiasis, the conflicting issue of testis biopsy and current histopathological prognostic factors<br />

for surveillance and individualised treatment options will be discussed with the auditorium including case<br />

presentations. The role of conventional as well as laparoscopic RPLND in early stages will be clarified.<br />

In advanced-stage cancer, the course participants will learn about stage by stage treatment according to<br />

IGCCCG classification. Detailed information on chemotherapy regimens and the handling of side-effects will<br />

be provided. In this section of the course, tips and tricks of residual tumour resection will be presented<br />

using case reports and intraoperative pictures. In addition, salvage strategies will be discussed in cases of<br />

treatment failures. Participants will have enough time to ask questions and discuss their own cases.<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 32<br />

Non-<strong>EAU</strong> members € 47<br />

Residents (members/non-members) € 21<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

339<br />

ESU Courses


ESU Courses<br />

ESU Courses, 17 March<br />

340 <strong>Programme</strong> <strong>Book</strong><br />

ESU Course 17<br />

12.00 - 14.00 Management and outcome in invasive and locally advanced bladder<br />

cancer<br />

Orange Hall 2 - Level N-1<br />

Chair: A. Alcaraz, Barcelona (ES)<br />

Cystectomy in the management of bladder invasive and locally advanced bladder cancer<br />

A. Alcaraz, Barcelona (ES)<br />

Case discussion on cystectomy in the management of bladder invasive and locally advanced bladder cancer<br />

B. Malavaud, Toulouse (FR)<br />

Bladder sparing approaches to muscle invasive bladder cancer<br />

A. Alcaraz, Barcelona (ES)<br />

Case discussion on bladder sparing approaches to muscle invasive bladder cancer<br />

B. Malavaud, Toulouse (FR)<br />

Cytotoxic chemotherapy in bladder cancer: Neoadjuvant and adjuvant setting and treatment of metastatic<br />

disease<br />

B. Malavaud, Toulouse (FR)<br />

Aims and objectives<br />

Bladder cancer is the second most common oncological malignancy in Europe. Invasive and locally advanced<br />

bladder tumour is the urological malignancy with the highest mortality.<br />

The course will begin with the definition of the disease and different prognostic factors. Among<br />

prognosticators of outcome will be discussed the role of early cystectomy in T1 patients with poor prognosis<br />

indicators and the limitations of cystectomy in elderly and poor performance status patients. The course will<br />

continue with the discussion of the different treatment options. Rationale for considering cystectomy as gold<br />

standard, as well as a clear definition of multidisciplinary strategies for bladder sparing treatments with<br />

special emphasis in patient selection and potential limitations will be discussed. Finally, the role of systemic<br />

chemotherapy in the neoadjuvant and adjuvant to cystectomy setting will be presented, as well as in the<br />

treatment of metastatic disease.<br />

Specially recommended for elder residents and young urologists starting their career in the field of urooncology.<br />

Also experienced uro-oncological surgeons will benefit from this course through an update,<br />

focused on clinical issues and a practical approach.<br />

At the conclusion of this course, the participants should get better insights in terms of:<br />

- Stratifying the patients with invasive and locally advanced bladder cancer in different groups of risk.<br />

- Understanding the rationales outcome and limitations of cystectomy and bladder sparing treatments.<br />

- Defining the current role of neoadjuvant and adjuvant chemotherapy for invasive and locally advanced<br />

bladder cancer.<br />

- Measuring the benefits of systemic chemotherapy in terms of progression free survival and overall<br />

survival.


Registration fee excluding VAT<br />

<strong>EAU</strong> members € 32<br />

Non-<strong>EAU</strong> members € 47<br />

Residents (members/non-members) € 21<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

341<br />

ESU Courses


ESU Courses<br />

ESU Courses, 17 March<br />

342 <strong>Programme</strong> <strong>Book</strong><br />

ESU Course 19<br />

14.30 - 17.30 Robot renal surgery<br />

Green Hall 1 - Level N-1<br />

Introduction<br />

A. Mottrie, Aalst (BE)<br />

Pyeloplasty<br />

G. Guazzoni, Milan (IT)<br />

Chair: A. Mottrie, Aalst (BE)<br />

Clinical cases UPJ Obstruction; Nephrectomy for RCC<br />

J. Hubert, Nancy (FR)<br />

Partial nephrectomy<br />

A. Mottrie, Aalst (BE)<br />

Clinical cases RCC; Nephroureterectomy<br />

J. Hubert, Nancy (FR)<br />

Conclusion<br />

G. Guazzoni, Milan (IT)<br />

Aims and objectives<br />

1. Explain the advantages of robotics over classical laparoscopy in surgery of the upper urinary system<br />

2. Teach the different operations step-to-step<br />

3. Discuss difficult clinical cases<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 47<br />

Non-<strong>EAU</strong> members € 69<br />

Residents (members/non-members) € 21


ESU Courses, 17 March<br />

ESU Course 20<br />

14.30 - 17.30 How to write a manuscript and get it published in European Urology<br />

Green Hall 2 - Level N-1<br />

Chair: F. Montorsi, Milan (IT)<br />

How to get your manuscript published in European Urology<br />

F. Montorsi, Milan (IT)<br />

Why publishing (and publishing on European Urology) is important for you<br />

C. Gratzke, Munich (DE)<br />

Clinical research original article: How to write the introduction and methods section<br />

G. Novara, Padova (IT)<br />

The importance of statistical design and analysis<br />

R.J. Sylvester, Brussels (BE)<br />

Clinical research original article: How to write the results and discussion sections<br />

J.W.F. Catto, Sheffield (GB)<br />

Clinical research original article: The editor’s tricks<br />

S.F. Shariat, New York (US)<br />

How to write a basic research article to be relevant for the readers of European Urology<br />

C. Gratzke, Munich (DE)<br />

How your submission will be evaluated by European Urology reviewers: Reviewer template and publication<br />

guidelines<br />

J.W.F. Catto, Sheffield (GB)<br />

Surgery in Motion: How to combine the best possible manuscript and video for the Surgery in Motion<br />

Section<br />

H.G. Van Der Poel, Amsterdam (NL)<br />

Questions and answers<br />

Aims and objectives<br />

The objectives of the course are to provide the principles of writing the two key types of publication: the<br />

review article and the clinical study report. Specifically covered will be how to decide whether you should<br />

actually publish your data and how to choose the most suitable journal once that decision is made. The ‘How<br />

to do it’ for a scientific paper will represent the core of the course. This will be illustrated with case studies<br />

on each aspect of the paper with a workshop style discussion with attendees. How to use references in your<br />

article and the different options for easy referencing will also be discussed. The tips and tricks section will<br />

provide ‘insider’ information to help in your writing. Finally, we all have to deal with reviewer’s comments<br />

and information will be presented on how this should be carried out to best advantage. Attendees are-on<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

343<br />

ESU Courses


ESU Courses<br />

344 <strong>Programme</strong> <strong>Book</strong><br />

expected to leave the course with a full knowledge of the fundamental requirements to be successful in<br />

having a scientific paper accepted by a major journal.<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 47<br />

Non-<strong>EAU</strong> members € 69<br />

Residents (members/non-members) € 21


ESU Courses, 17 March<br />

ESU Course 21<br />

14.30 - 17.30 Advanced vaginal reconstruction<br />

Green Hall 3 - Level N-1<br />

Chair: D. Pushkar, Moscow (RU)<br />

Introduction: Are you involved in reconstructive urology?<br />

D. Pushkar, Moscow (RU)<br />

Midurethral slings in 2012-<strong>2013</strong>: The current status<br />

F.C. Burkhard, Berne (CH)<br />

Management of urinary incontinence associated with urethral loss<br />

D. Pushkar, Moscow (RU)<br />

Obstructive slings: What to do?<br />

F.C. Burkhard, Berne (CH)<br />

D. Pushkar, Moscow (RU)<br />

Management of mesh complications<br />

D. Pushkar, Moscow (RU)<br />

F.C. Burkhard, Berne (CH)<br />

Management of non-index stress urinary incontinence (recurrent cases, intrinsic sphincter deficiency, mixed<br />

incontinence).<br />

F.C. Burkhard, Berne (CH)<br />

Modern approach to vesicovaginal fistulae and urethral diverticulae (comprehensive video presentation)<br />

D. Pushkar, Moscow (RU)<br />

Adjournment<br />

F.C. Burkhard, Berne (CH)<br />

Aims and objectives<br />

Clinicians involved in the care of female patients should know vaginal surgery. A specific goal of the faculty<br />

is to employ scientific principles, published information and clinical experience to describe and position<br />

newly developed techniques in current management of urinary incontinence. Special attention will be given<br />

to new techniques that use synthetics tapes in SUI surgery. This course will also cover the management of<br />

complications of surgery for stress incontinence and mesh complications. Treatment of recurrent urinary<br />

incontinence and incontinence with mixed symptoms also will be under discussion.<br />

Management of vesicovaginal fistulas, urethral diverticulae and some rare conditions will be shown both<br />

during podium and video presentations. An interactive course means active participation by the audience and<br />

participants are encouraged to prepare and present interesting and challenging clinical cases for consultation<br />

by the faculty. After this course, participants should know how to apply the newest technique in patients with<br />

stress incontinence, urethral loss and iatrogenic injuries of lower urinary tract. This course will facilitate the<br />

decision making process for those who are just starting their careers and for advanced surgeons.<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

345<br />

ESU Courses


ESU Courses<br />

346 <strong>Programme</strong> <strong>Book</strong><br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 47<br />

Non-<strong>EAU</strong> members € 69<br />

Residents (members/non-members) € 21


ESU Courses, 17 March<br />

ESU Course 22<br />

14.30 - 17.30 Radical cystectomy and orthotopic bladder substitution – Surgical<br />

tricks and management of complications<br />

Orange Hall 1 - Level N-1<br />

Chair: U.E. Studer, Berne (CH)<br />

Preoperative investigations and selection of patients for orthotopic bladder substitution<br />

J.E. Gschwend, Munich (DE)<br />

Arguments for nerve sparing cystectomy with orthotopic bladder substitution<br />

A. Stenzl, Tübingen (DE)<br />

How to do a nerve-sparing cystectomy in male and female patients, surgical tricks to avoid complications<br />

with orthotopic bladder substitution<br />

U.E. Studer, Berne (CH)<br />

Tips on how to obtain good functional results in female patients<br />

A. Stenzl, Tübingen (DE)<br />

Active post-operative management is the most important step<br />

U.E. Studer, Berne (CH)<br />

How to treat complications during follow-up<br />

J.E. Gschwend, Munich (DE)<br />

Discussion<br />

Faculty<br />

Aims and objectives<br />

In this course, special emphasis is placed on patient selection and on practical surgical steps: on how to<br />

do meticulous pelvic lymph node dissection and nerve-sparing cystectomy in male and female patients, as<br />

well as how to do various types of orthotopic bladder substitutes with good long-term functional results.<br />

The course is aimed to be interactive with 50% of the time reserved for questions and discussions with the<br />

audience. At the end of the course, participants should know all the essential and practical steps needed in<br />

order to achieve good results with cystectomy and orthotopic bladder substitution.<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 47<br />

Non-<strong>EAU</strong> members € 69<br />

Residents (members/non-members) € 21<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

347<br />

ESU Courses


ESU Courses<br />

ESU Courses, 17 March<br />

348 <strong>Programme</strong> <strong>Book</strong><br />

ESU Course 23<br />

14.30 - 17.30 Surgery or radiotherapy for localised and locally advanced prostate<br />

cancer<br />

Orange Hall 2 - Level N-1<br />

Localised prostate cancer<br />

Introduction<br />

B. Djavan, Vienna (AT)<br />

Chair: B. Djavan, Vienna (AT)<br />

Treatment options and strategies in localised prostate cancer<br />

B. Djavan, Vienna (AT)<br />

How and when to use nomograms and networks<br />

R.J.A. Van Moorselaar, Amsterdam (NL)<br />

Oncological and functional results of radical prostatectomy<br />

B. Djavan, Vienna (AT)<br />

Oncology results of radiation therapy<br />

A. Bossi, Villejuif (FR)<br />

Advanced prostate cancer<br />

Radiotherapy with or without hormonal treatment in advanced PCA<br />

A. Bossi, Villejuif (FR)<br />

Results of radical prostatectomy for T3 disease<br />

B. Djavan, Vienna (AT)<br />

Adjuvant therapies following radical prostatectomy: What is the standard and what is new?<br />

R.J.A. Van Moorselaar, Amsterdam (NL)<br />

Take home messages<br />

B. Djavan, Vienna (AT)<br />

Aims and objectives<br />

The decision process towards surgery/active surveillance or radiation is a constantly evolving matter that<br />

requires a multitude of various information and inputs. In localised disease old habits have been jeopardised<br />

and surgical management seems to be fused with active surveillance in an increasing number of patients<br />

with good prognosticators. This course will summarise the decision process and indications for patients<br />

with clinically localised disease and help select the optimal treatment based on most recent oncological and<br />

functional data.<br />

In locally advanced disease, growing evidence supports the notion of radical surgery to improve outcome.<br />

US and European data endorse this policy in a selected group of patients. New radiation protocols and


strategies combined with hormone therapy offer as much adequate alternatives. In the second part of this<br />

course, controversies regarding the optimal management of locally advanced prostate cancer patients will be<br />

discussed and clear recommendations made to facilitate patient counselling and treatment.<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 47<br />

Non-<strong>EAU</strong> members € 69<br />

Residents (members/non-members) € 21<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

349<br />

ESU Courses


ESU Courses<br />

ESU Courses, 17 March<br />

350 <strong>Programme</strong> <strong>Book</strong><br />

ESU Course 24<br />

14.30 - 17.30 Flexible ureterorenoscopy and retrograde intrarenal surgery:<br />

Instrumentation, technique, tips and tricks, indications<br />

Orange Hall 3 - Level N-1<br />

Chair: O. Traxer, Paris (FR)<br />

Welcome message and introduction of the course<br />

O. Traxer, Paris (FR)<br />

Instrumentation: Endoscopes<br />

O. Traxer, Paris (FR)<br />

Instrumentation: Laser and lithotripsy devices<br />

M. Grasso, New York (US)<br />

Instrumentation: Disposable (wires, retrieving devices, UAS, irrigation devices and others)<br />

P.J. Osther, Fredericia (DK)<br />

Technique: Stones<br />

O. Traxer, Paris (FR)<br />

Technique: Urothelial tumours and strictures<br />

M. Grasso, New York (US)<br />

Tips and tricks and special circumstances<br />

O. Traxer, Paris (FR)<br />

Indications (guidelines) and clinical cases<br />

P.J. Osther, Fredericia (DK)<br />

Conclusions<br />

O. Traxer, Paris (FR)<br />

Aims and objectives<br />

This course will teach the principles of evidence based medicine (EBM) in the context of daily decisionmaking<br />

in urology. We will introduce urology-relevant resources to search and retrieve the latest clinical<br />

research studies and provide the tools to systematically evaluate these studies for the quality of evidence they<br />

provide. In practical exercises, we will first demonstrate how to assess a study’s methodological strengths<br />

and weaknesses to determine how much confidence we can place in its results. Second, we will analyze<br />

the actual study results and the degree of certainty with which they are reported. Finally, we will discuss<br />

important considerations when deciding whether the results of a given study can and should be applied to<br />

the care of an individual patient.<br />

A workshop-style, interactive format is chosen to teach this course. The educational objective is to empower<br />

participants to independently search and appraise clinical research studies and retrieve high quality evidence<br />

as it becomes available. This course is therefore of exceptional value to all urologists that are seeking to<br />

enhance their EBM skills and thereby improve patient care.


Registration fee excluding VAT<br />

<strong>EAU</strong> members € 47<br />

Non-<strong>EAU</strong> members € 69<br />

Residents (members/non-members) € 21<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

351<br />

ESU Courses


ESU Courses<br />

ESU Courses, 18 March<br />

352 <strong>Programme</strong> <strong>Book</strong><br />

ESU Course 25<br />

08.30 - 11.30 The infertile couple - Urological aspects<br />

Green Hall 1 - Level N-1<br />

Diagnostic work-up, medical treatment<br />

W.H.G. Weidner, Giessen (DE)<br />

Chair: W. Aulitzky, Vienna (AT)<br />

Pathophysiology, diagnosis and treatment of varicocele<br />

W. Aulitzky, Vienna (AT)<br />

Microsurgical refertilisation<br />

W. Aulitzky, Vienna (AT)<br />

Sperm retrieval techniques and genetic aspects of IVF/ICSI<br />

W.H.G. Weidner, Giessen (DE)<br />

Aims and objectives<br />

This course provides state-of-the-art information on urological aspects of diagnosis and therapy of modern<br />

reproductive medicine. Diagnostic procedures should be standardised and coordinated in a timely fashion<br />

for both partners, focussing on the possible urological, hormonal and genetic causes of male infertility. In<br />

terms of therapy, this course will provide updated information on evidence based data and will discuss the<br />

importance of varicoceles in male infertility. We will show microsurgical techniques on video and explain<br />

why proper training and skills perfection is key to successful case management. A successful IVF/ICSI outcome<br />

depends upon the use of state-of-the-art techniques for sperm retrieval and sperm preparation. We will<br />

also provide information on genetic aspects and stress the responsibility of the urologist as an adviser and<br />

gatekeeper for the treatment of the infertile couple.<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 47<br />

Non-<strong>EAU</strong> members € 69<br />

Residents (members/non-members) € 21


ESU Courses, 18 March<br />

ESU Course 26<br />

08.30 - 11.30 Update on stone disease<br />

Green Hall 2 - Level N-1<br />

Introduction<br />

A. Patel, London (GB)<br />

Medical aspects of urinary stones<br />

F. Millán-Rodríguez, Barcelona (ES)<br />

SWL<br />

N.N-P. Buchholz, London (GB)<br />

Uretero-Renoscopy<br />

A. Breda, Barcelona (ES)<br />

Chair: A. Patel, London (GB)<br />

Percutaneous nephrolithotomy and questions and answers<br />

A. Patel, London (GB)<br />

Interactive case discussion<br />

Aims and objectives<br />

Modern stone therapy has eliminated much of the previously devastating burden of upper tract urolithiasis,<br />

and is gradually also changing the clinical presentation. Complex stones are becoming rarer, and therapy is<br />

moving to the outpatient setting. Nevertheless, successful management requires competence in all aspects<br />

of stone management. The challenge today is employing the ideal approach for the specific situation.<br />

After a brief review of new developments present treatment strategies are demonstrated in detailed case<br />

presentations.<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 47<br />

Non-<strong>EAU</strong> members € 69<br />

Residents (members/non-members) € 21<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

353<br />

ESU Courses


ESU Courses<br />

ESU Courses, 18 March<br />

354 <strong>Programme</strong> <strong>Book</strong><br />

ESU Course 27<br />

08.30 - 11.30 Diagnosis and management of non-muscle invasive bladder cancer<br />

(NMIBC)<br />

Green Hall 3 - Level N-1<br />

Introduction and objective of course<br />

J.A. Witjes, Nijmegen (NL)<br />

Chair: J.A. Witjes, Nijmegen (NL)<br />

Diagnosis of bladder cancer (including markers and importance of TUR) and case discussion<br />

J. Palou, Barcelona (ES)<br />

New diagnostic tools such as PDD and NBI<br />

M. Babjuk, Prague (CZ)<br />

Guideline treatment and follow-up including case discussion<br />

J.A. Witjes, Nijmegen (NL)<br />

Comments on guideline treatment recommendations including case example and discussion<br />

M. Babjuk, Prague (CZ)<br />

BCG failures and treatment options, including case discussion<br />

J.A. Witjes, Nijmegen (NL)<br />

What to do with extravesical urothelial cancer and case discussion<br />

J. Palou, Barcelona (ES)<br />

Closure and evaluation<br />

Aims and objectives<br />

With the comments of the last years this course will again fine tuned and obviously it will be updated<br />

according to the <strong>2013</strong> <strong>EAU</strong> guideline and latest literature. The emphasis lies on the discussion of problems<br />

seen in daily practice, when dealing with patients with non muscle-invasive bladder cancer (NMIBC). Many<br />

of these problems have been raised in previous courses and are the basis for the current presentations and<br />

case discussions. We have learned that discussion of these problems with the audience is very productive,<br />

interactive and highly appreciated. So, although the emphasis is on what one should do (the <strong>EAU</strong> guideline<br />

and its recommendations), we often see patients in daily practice that do not fit into guideline rules and need<br />

a different approach. We will present potential options for these patients and discuss cases like that with the<br />

audience to illustrate the possibilities beyond the guideline diagnosis and treatment solutions.<br />

As can be seen in the program subjects that will be lectured, discussed and illustrated with cases are (1)<br />

diagnostics (white light cystoscopy; cytology and markers; (re-)TUR technique), (2) diagnostic innovations<br />

(PDD, NBI), (3) risk classification and therapy/follow per risk group, (4) potential exceptions to the guideline<br />

recommendations (e.g. single post-TUR instillation, BCG maintenance therapy), (5) BCG failures, and finally<br />

(6) urothelial carcinoma outside the bladder.


The objective of this course is that attendees will know when to follow the guideline in NMIBC, when there<br />

are points of discussion, and what potential alternatives might be.<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 47<br />

Non-<strong>EAU</strong> members € 69<br />

Residents (members/non-members) € 21<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

355<br />

ESU Courses


ESU Courses<br />

ESU Courses, 18 March<br />

356 <strong>Programme</strong> <strong>Book</strong><br />

ESU Course 28<br />

08.30 - 11.30 Robot-assisted laparoscopic prostatectomy<br />

Orange Hall 1 - Level N-1<br />

Introduction<br />

P.T. Piechaud, Bordeaux (FR)<br />

Chair: P.T. Piechaud, Bordeaux (FR)<br />

General principles of robotic radical prostatectomy<br />

W. Artibani, Verona (IT)<br />

P. Dasgupta, London (GB)<br />

Step by step operative procedure<br />

Bladder neck approach<br />

P. Dasgupta, London (GB)<br />

P.T. Piechaud, Bordeaux (FR)<br />

Posterior dissection<br />

W. Artibani, Verona (IT)<br />

P.T. Piechaud, Bordeaux (FR)<br />

Lateral dissection<br />

P. Dasgupta, London (GB)<br />

W. Artibani, Verona (IT)<br />

P.T. Piechaud, Bordeaux (FR)<br />

Apex and DVC<br />

P. Dasgupta, London (GB)<br />

W. Artibani, Verona (IT)<br />

P.T. Piechaud, Bordeaux (FR)<br />

Anastomosis<br />

W. Artibani, Verona (IT)<br />

P. Dasgupta, London (GB)<br />

P.T. Piechaud, Bordeaux (FR)<br />

Lymphadenectomy<br />

W. Artibani, Verona (IT)<br />

Specific situations<br />

P.T. Piechaud, Bordeaux (FR)<br />

Postoperative complications<br />

P. Dasgupta, London (GB)


Anatomical and functional results<br />

W. Artibani, Verona (IT)<br />

Conclusion<br />

P.T. Piechaud, Bordeaux (FR)<br />

Aims and objectives<br />

The course about the technique of robotic radical prostatectomy has for main goal to give the participants all<br />

the technical elements of this surgery.<br />

The procedure will be described step by step by the various speakers.<br />

Different versions of the standard technique will be also described.<br />

The technique of this surgery in particular situations will be precised (prostatecomy post TURP, salvage<br />

prostatectomy).<br />

The main complications of this surgery will be explained and an analysis of the anatomical and functional<br />

results will be presented at the end of the course.<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 47<br />

Non-<strong>EAU</strong> members € 69<br />

Residents (members/non-members) € 21<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

357<br />

ESU Courses


ESU Courses<br />

ESU Courses, 18 March<br />

358 <strong>Programme</strong> <strong>Book</strong><br />

ESU Course 29<br />

08.30 - 11.30 Minimally invasive treatment for localized prostate cancer<br />

Orange Hall 2 - Level N-1<br />

Introduction<br />

S.F.M. Thüroff, Munich (DE)<br />

Brachytherapy – Update <strong>2013</strong><br />

S. Machtens, Bergisch Gladbach (DE)<br />

Questions and answers<br />

Cryotherapy – Update <strong>2013</strong><br />

J.P.M. Sedelaar, Nijmegen (NL)<br />

Questions and answers<br />

HIFU therapy – Update <strong>2013</strong><br />

S.F.M. Thüroff, Munich (DE)<br />

Questions and answers<br />

Focal brachy<br />

S. Machtens, Bergisch Gladbach (DE)<br />

Questions and answers<br />

Focal cryotherapy<br />

J.P.M. Sedelaar, Nijmegen (NL)<br />

Questions and answers<br />

Focal HIFU<br />

S.F.M. Thüroff, Munich (DE)<br />

Questions and answers<br />

What do <strong>EAU</strong> guidelines say?<br />

S. Machtens, Bergisch Gladbach (DE)<br />

Clinical cases and discussion<br />

S. Machtens, Bergisch Gladbach (DE)<br />

S.F.M. Thüroff, Munich (DE)<br />

J.P.M. Sedelaar, Nijmegen (NL)<br />

Chair: S.F.M. Thüroff, Munich (DE)


Conclusion<br />

S.F.M. Thüroff, Munich (DE)<br />

Aims and objectives<br />

Today, earlier diagnosis of localized prostate cancer has caused as a trend to more low risk, early stage as<br />

an elevated number of prostate cancers at first diagnosis. While surgery and radiation therapy are „golden<br />

standard“ therapies choosen by the urologist, modern less invasive technologies are greeted with ever<br />

more enthusiasm by patients. This simply creates a dilemma. In this course about minimal invasive PCa<br />

therapy status quo and long term results, indispensible for correct oncological evidence based evaluation are<br />

reported, as well as presentation and discussion of pilotstudies in specific indications, not yet subject to local<br />

minimal invasive treatment today.<br />

Brachy-, Cryo- and HIFU-therapy as representatives for low invasive minimal invasive technologies are not<br />

„experimental“ but „investational“, clinically available therapies for urologists and derserving attention.<br />

Urologists have to be informed about their potential, side effects and limitations to give „updated“<br />

informations to their patients.<br />

This course will demonstrate these technologies, their results and complications on the other side highlight,<br />

why in selected cases „hightech prostate cancer therapy“ might be equal or individually superior to<br />

conventional therapeutic approaches. Discussion about „focal therapy“, „clinical cases“ and current guideline<br />

status quo -as exchange of opinions with the participants-will close this 3 hour course.<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 47<br />

Non-<strong>EAU</strong> members € 69<br />

Residents (members/non-members) € 21<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

359<br />

ESU Courses


ESU Courses<br />

ESU Courses, 18 March<br />

360 <strong>Programme</strong> <strong>Book</strong><br />

ESU Course 30<br />

08.30 - 11.30 Paediatric urology for the adult urologist: A practical update<br />

Orange Hall 3 - Level N-1<br />

Chair: J.M. Nijman, Groningen (NL)<br />

Obstructive uropathy: What to do when, from neonate till puberty<br />

G.A. Bogaert, Leuven (BE)<br />

How to deal with congenital malformations of the external genitalia, when is surgery indicated and how to<br />

do it<br />

S. Tekgül, Ankara (TR)<br />

Urinary infection, reflux and voiding dysfunction: New insights in pathology, diagnostic work-up and<br />

management<br />

J.M. Nijman, Groningen (NL)<br />

Aims and objectives<br />

During this course an update is provided on common problems of the genito-urinary tract in children<br />

by means of state-of-the-art lectures, cases and interactive participation. Also the interaction between<br />

paediatric urologist, adult urologist, gynaecologist and paediatrician will be discussed. Corrections of<br />

congenital malformations of the urogenital tract have major implications for the quality of life, but also for<br />

long-term follow-up, future interventions and treatment of complications. Over the past few years our ideas<br />

about treatment of reflux and obstructive uropathy have changed; many so-called dogmas had to be revised.<br />

During this 3 hour course we will try to give an overview of the latest developments in the field of paediatric<br />

urology, focussing on topics of interest to the general urologist.<br />

The course is of particular interest to general urologists and those in training. Participants are encouraged to<br />

participate in the course as much as possible and there will be ample time for discussion and presentation<br />

of cases.<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 47<br />

Non-<strong>EAU</strong> members € 69<br />

Residents (members/non-members) € 21


ESU Courses, 18 March<br />

ESU Course 31<br />

12.00 - 14.00 Current concepts and controversy in the diagnosis and management of<br />

upper tract urothelial carcinoma (UTUC)<br />

Green Hall 1 - Level N-1<br />

Epidemiology, diagnosis, evaluation<br />

M. Roupret, Paris (FR)<br />

Prognostic and predictive factors, pathology<br />

S.F. Shariat, New York (US)<br />

Chair: S.F. Shariat, New York (US)<br />

Treatment of low risk cancer (high grade Ta, T1 and CIS)<br />

M. Roupret, Paris (FR)<br />

Treatment of localized high risk (invasive) and metastatic cancer<br />

S.F. Shariat, New York (US)<br />

Aims and objectives<br />

Upper tract urothelial carcinoma (UTUC) is an uncommon disease with little evidence-based data to<br />

guide clinical decision-making. Recently, the tools available for the diagnosis and management of UTUC<br />

have improved significantly, complementing a growing understanding of the biology of this disease. UTUC<br />

requires appropriate management at all stages, since both the cure rate and morbidity are very sensitive<br />

to nuances of treatment. Yet proper risk stratification remains a challenge owing to the difficulty of clinical<br />

staging. This course will address contemporary concepts and controversies, including the timely and accurate<br />

diagnosis of UTUC, emphasizing the integration of pathologic and radiographic variables for appropriate<br />

risk stratification. Important features regarding the natural history of UTUC will also be emphasized; the<br />

role of imaging and endoscopy in clinical decision making, diagnosis, staging and follow-up; and, common<br />

pathways of metastatic spread. Up-to-date information regarding boundaries of surgical resection, indication<br />

and extent of lymphadenectomy, clinical staging of UTUC, and the role of neoadjuvant chemotherapy in<br />

patients with high risk UTUC will be detailed. Patient selection and treatment options for patients with UTUC<br />

such as endoscopic management, distal ureterectomy, radical nephroureterectomy and chemotherapy will<br />

be discussed.<br />

Objectives: After attending this course, participants should be able to:<br />

• identify problems associated with clinical staging of UTUC<br />

• illustrate importance of accurate staging techniques and their role in clinical decision making maximize<br />

ureteroscopic diagnostic biopsy and tumor resection<br />

• be aware of newer modalities such as endoluminal ultrasound and other novel staging methods<br />

• cite current concepts and controversies in the management of low-stage and high-stage UTUC<br />

• discuss and compare the risk, benefit, and side effects of laparoscopic and open radical<br />

nephroureterectomy<br />

• understand the management of the bladder cuff<br />

• understand the current role of multimodal therapy for high risk patients- integration of systemic therapy –<br />

neo-adjuvant vs. adjuvant treatment<br />

• discuss the need and boundaries of the recommended lymph node dissection<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

361<br />

ESU Courses


ESU Courses<br />

362 <strong>Programme</strong> <strong>Book</strong><br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 32<br />

Non-<strong>EAU</strong> members € 47<br />

Residents (members/non-members) € 21


ESU Courses, 18 March<br />

ESU Course 32<br />

12.00 - 14.00 Advanced course on laparoscopic prostatectomy<br />

Green Hall 2 - Level N-1<br />

Introduction<br />

J-U. Stolzenburg, Leipzig (DE)<br />

Chair: J-U. Stolzenburg, Leipzig (DE)<br />

Anatomy of the prostate and urethral sphincter<br />

K. Touijer, New York (US)<br />

Anatomy of the neurovascular bundles and fascias - extrafascial, interfascial, intrafascial – where is the<br />

difference<br />

J-U. Stolzenburg, Leipzig (DE)<br />

Operative set-up, access, trocar position: Extra versus transperitoneal approach<br />

J-U. Stolzenburg, Leipzig (DE)<br />

K. Touijer, New York (US)<br />

Pelvic lymphadenectomy – how to perform<br />

K. Touijer, New York (US)<br />

Steps of the procedure (video): Endoscopic extraperitoneal radical prostatectomy<br />

J-U. Stolzenburg, Leipzig (DE)<br />

Steps of the procedure (video): Transperitoneal laparoscopic radical prostatectomy<br />

K. Touijer, New York (US)<br />

How can we reduce the positive margins?<br />

J-U. Stolzenburg, Leipzig (DE)<br />

K. Touijer, New York (US)<br />

Management of complications (based on real cases)<br />

J-U. Stolzenburg, Leipzig (DE)<br />

K. Touijer, New York (US)<br />

Tips and tricks for difficult cases<br />

J-U. Stolzenburg, Leipzig (DE)<br />

K. Touijer, New York (US)<br />

Conclusion<br />

J-U. Stolzenburg, Leipzig (DE)<br />

Aims and objectives<br />

Laparoscopic/endoscopic radical prostatectomy needs to be well standardised to be reproduced. Besides the<br />

approaches the results of radical prostatectomy are based on our understanding of the prostatic anatomy.<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

363<br />

ESU Courses


ESU Courses<br />

364 <strong>Programme</strong> <strong>Book</strong><br />

Thus, we will first give precise information on the anatomy of the prostate, the sphincter muscle, fascias<br />

and the bundles in order to have a better understanding of the operative laparoscopic anatomy. The experts<br />

will then go through each step of the surgery. For this, short well-selected video clips will be presented and<br />

discussed e.g. the best way to perform the space for the extraperitoneal approach, how to spare the bladder<br />

neck, to make easy dorsal vein complex control, the apical dissection and the anastomosis. Different aspects<br />

(interfascial, intrafascial) of nerve-sparing surgery will be addressed. The participants will be aware of the<br />

risk of complications or difficulties for each part of the procedure. The tricks for shortening the operative time<br />

will also be discussed. Finally, complications and their management will be addressed and discussed on the<br />

basis of real cases. At the end of the session, the participants, if they are beginners, should have a better<br />

comprehension of each step of the technique. If they are experienced, the course should help to improve<br />

their technique by picking out some important tricks.<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 32<br />

Non-<strong>EAU</strong> members € 47<br />

Residents (members/non-members) € 21


ESU Courses, 18 March<br />

ESU Course 33<br />

12.00 - 15.00 Modern management of BPH<br />

Green Hall 3 - Level N-1<br />

Introduction/scene setting BPH <strong>2013</strong><br />

K.M. Anson, London (GB)<br />

Assessment and medical management<br />

T.E. Bjerklund Johansen, Århus (DK)<br />

Surgical management – Electrosurgery<br />

K.M. Anson, London (GB)<br />

Chair: K.M. Anson, London (GB)<br />

Surgical management – Lasers and less invasive options<br />

R.M. Kuntz, Berlin (DE)<br />

Case presentations<br />

T.E. Bjerklund Johansen, Århus (DK)<br />

Aims and objectives<br />

• To help delegates understand the basic principles behind the assessment of a BPH patient<br />

• To summarise the evidence base for both the medical and surgical management of BPH<br />

• To help delegates understand the patient factors that influence treatment choices using case presentations<br />

and delegate participation<br />

• To debate the different health care system factors across Europe that influence patient and surgeon choice<br />

of treatment modalities<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 47<br />

Non-<strong>EAU</strong> members € 69<br />

Residents (members/non-members) € 21<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

365<br />

ESU Courses


ESU Courses<br />

ESU Courses, 18 March<br />

366 <strong>Programme</strong> <strong>Book</strong><br />

ESU Course 34<br />

12.00 - 14.00 Urinary tract and genital trauma<br />

Orange Hall 1 - Level N-1<br />

Introduction<br />

L. Martínez Piñeiro, Madrid (ES)<br />

Blunt and penetrating renal trauma<br />

L. Martínez Piñeiro, Madrid (ES)<br />

Chair: L. Martínez Piñeiro, Madrid (ES)<br />

Ureteric, bladder, and genital (penile and testicular) trauma. Aetiology, diagnosis and treatment<br />

H. Abol-Enein, Mansoura (EG)<br />

Aims and objectives<br />

1. To review the current classifications of renal, bladder and genital trauma<br />

2. To outline the principles of diagnosis and management of renal, bladder and genital trauma<br />

3. To provide a clearer understanding of the role of the treatments which are available for specific patient<br />

scenarios<br />

4. To interact with the audience and discuss together management and treatment of real cases<br />

Participants of the course will obtain a clear view on the current management of blunt and penetrating<br />

injuries affecting the kidney, bladder or genitals in contemporary clinical practice.<br />

More than 50% of the time of the course will be spent with the discussion of real clinical cases.<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 32<br />

Non-<strong>EAU</strong> members € 47<br />

Residents (members/non-members) € 21


ESU Courses, 18 March<br />

ESU Course 35<br />

12.00 - 14.00 Ultrasound for the urologist - TRUS and TRUS guided biopsies<br />

Orange Hall 2 - Level N-1<br />

Indications for TRUS and biopsy<br />

P. Hammerer, Braunschweig (DE)<br />

Chair: P. Hammerer, Braunschweig (DE)<br />

Practical aspects of TRUS and TRUS guided biopsies<br />

P. Hammerer, Braunschweig (DE)<br />

Indications for rebiopsy<br />

V. Scattoni, Milan (IT)<br />

Update on new technical developments<br />

V. Scattoni, Milan (IT)<br />

Aims and objectives<br />

The purpose of this ESU course is to define the optimal transrectal ultrasound and to discuss new ultrasound<br />

techniques for prostate cancer detection, as well as defining a new standard for transrectal ultrasoundguided<br />

prostate biopsies. In addition, techniques to reduce morbidity and to increase patient acceptance will<br />

be discussed. Transrectal ultrasound has been performed for more than 15 years, and this technique is now<br />

an important part of prostate cancer diagnosis and staging. Anatomic studies of prostatectomy specimens<br />

that defined the zonal anatomy of the prostate and provided a detailed mapping of the tumour location<br />

have increased our understanding of transrectal ultrasound images, as well as enabling optimal placement<br />

of the biopsy needles. The stage migration revealed by PSA-based screening has resulted in most tumours<br />

being non-palpable at diagnosis. Therefore in the PSA arena, with tumours at an early stage (non-palpable<br />

and sometimes ultrasonografically isoechoic) transrectal ultrasound is needed to enable sampling of all<br />

relevant areas of the prostate including those that appear normal. The systematic sampling of the prostate<br />

by the sextant biopsy technique improved the detection rate of prostate cancer over sampling hypoechoic or<br />

palpable suspicious lesions. However, in men with initially negative biopsies a second set of sextant biopsies<br />

will be positive in about 20-30%. Several groups have demonstrated that the sextant technique is inadequate<br />

for sampling of larger prostates and they advocated additional samples. Will an increase of prostate biopsies<br />

result in patient discomfort? Although some studies report no additional morbidity from the more extensive<br />

biopsy protocols, it seems likely that discomfort for the patient would be increased. What can be done to<br />

reduce pain and discomfort and improve tolerance for additional biopsies? Simple and efficacious methods<br />

are now available to provide anaesthesia in men undergoing prostate biopsies.<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 32<br />

Non-<strong>EAU</strong> members € 47<br />

Residents (members/non-members) € 21<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

367<br />

ESU Courses


ESU Courses<br />

ESU Courses, 18 March<br />

368 <strong>Programme</strong> <strong>Book</strong><br />

ESU Course 36<br />

12.00 - 15.00 Laparoscopic and robot-assisted laparoscopic radical cystectomy<br />

Orange Hall 3 - Level N-1<br />

Chair: P. Wiklund, Stockholm (SE)<br />

Introduction laparoscopic cystectomy; Pre-surgery considerations<br />

R.F. Van Velthoven, Brussels (BE)<br />

Introduction robot-assisted laparoscopic cystectomy<br />

P. Wiklund, Stockholm (SE)<br />

Female cystectomy<br />

J. Rassweiler, Heilbronn (DE)<br />

Male cystectomy<br />

R.F. Van Velthoven, Brussels (BE)<br />

Lymph node dissection<br />

J. Rassweiler, Heilbronn (DE)<br />

Extracorporeal urinary diversion<br />

R.F. Van Velthoven, Brussels (BE)<br />

Intracorporeal urinary diversion<br />

P. Wiklund, Stockholm (SE)<br />

Outcome after laparoscopic cystectomy; Oncological, functional and complications<br />

J. Rassweiler, Heilbronn (DE)<br />

Outcome after robot-assisted laparoscopic cystectomy; Oncological, functional and complications<br />

P. Wiklund, Stockholm (SE)<br />

Aims and objectives<br />

At the conclusion of this educational activity, participants should be able to:<br />

• Identify the current indications and contraindications for laparoscopic and robot assisted laparoscopic<br />

radical cystectomy with extended lymph node dissection.<br />

• Illustrate the operative steps and techniques for laparoscopic and robot assisted laparoscopic radical<br />

cystectomy and extended pelvic lymph node dissection.<br />

• Identify the current indications and contraindications for laparoscopic and robot assisted laparoscopic<br />

creation of an intracorporeal and extracorporeal urinary diversion.<br />

• Discuss surgical tricks and tips learned from review of video clips of laparoscopic and robot assisted<br />

laparoscopic radical cystectomy.<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 47<br />

Non-<strong>EAU</strong> members € 69<br />

Residents (members/non-members) € 21


ESU Courses, 18 March<br />

ESU Course 37<br />

14.30 - 16.30 Post-surgical urinary incontinence in males<br />

Green Hall 1 - Level N-1<br />

Etiology and workup<br />

F.A. Van der Aa, Leuven (BE)<br />

Chair: M.M. Fisch, Hamburg (DE)<br />

Management of overactive bladder and conservative management of stress incontinence<br />

F.A. Van der Aa, Leuven (BE)<br />

Surgical management of stress incontinence<br />

M.M. Fisch, Hamburg (DE)<br />

Case discussion<br />

M.M. Fisch, Hamburg (DE)<br />

Aims and objectives<br />

Post-surgical incontinence has a severe impact on the social life of the patient. This course will answer<br />

the questions, how much and which investigations are needed for an adequate diagnosis and what the<br />

therapeutic options are that can we offer to the patient. The available conservative therapy is described and<br />

data on success and failure rates are provided. There is also a focus on new and alternative treatment options.<br />

The surgical procedures to solve the problem are presented and data of the literature critically analysed. An<br />

important part of the course will be the interactive case discussion with the panel and participants.<br />

At the end of the course the participants should know:<br />

• How to diagnose post surgical urinary incontinence and how to make symptoms objective<br />

• Which conservative therapy should be offered and for how long<br />

• Which operative procedures will provide the best long-term results for the individual situation of the<br />

patient<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 32<br />

Non-<strong>EAU</strong> members € 47<br />

Residents (members/non-members) € 21<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

369<br />

ESU Courses


ESU Courses<br />

ESU Courses, 18 March<br />

370 <strong>Programme</strong> <strong>Book</strong><br />

ESU Course 38<br />

14.30 - 16.30 General neuro-urology<br />

Green Hall 2 - Level N-1<br />

Introduction<br />

F.R. Cruz, Porto (PT)<br />

Diagnostics<br />

M.J. Drake, Bristol (GB)<br />

Therapy<br />

F.R. Cruz, Porto (PT)<br />

Case discussion<br />

Chair: F.R. Cruz, Porto (PT)<br />

Aims and objectives<br />

The course aims at introducing neuro-urology to urologists and other caregivers in training and at refreshing<br />

the topic to those who consider this subspeciality important for their current clinical practice.<br />

For many urologists neuro-urology is a less well known subspeciality that is considered less appealing<br />

due to the use of a specific terminology, methods of diagnosis and evaluation and a treatment that very<br />

frequently requires individualisation. For many urologists neuro-urology is not part of their training. However<br />

as patients with micturition problems of neurogenic cause have nowadays a life span very close to that of<br />

normal individuals, expertise in this field will be an inevitable requisite for the average urologist.<br />

Terminology has been updated in recent years and its familiarity is necessary not only in order to facilitate<br />

communication between caregivers but also to increase access to relevant literature. This will be the object of<br />

a complete review. Investigation is a decisive part of the management of patients with micturition problems<br />

of neurogenic origin. This is not intended as a urodynamic course but rather as a useful session in which the<br />

use of urodynamic and other tools will be clarified. Finally, management of these patients will be reviewed,<br />

from the more classic to the more experimental approaches, always keeping in mind that the expected<br />

audience will be the average urologist who is willing to increase their knowledge in the field. Thus the<br />

different therapeutic approaches will be presented in a more practical and useful way instead of a classical<br />

pharmacological approach. This is expected to facilitate the transfer the available information into everyday<br />

practice. Particular attention will be given to the use of botulinum toxin. Ultimately, different conditions will<br />

be simulated in order to rehearse the main topics.<br />

By the end of the course it is expected that participants will be able to adequately investigate and manage<br />

the most frequent neuro-urological situations.<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 32<br />

Non-<strong>EAU</strong> members € 47<br />

Residents (members/non-members) € 21


ESU Courses, 18 March<br />

ESU Course 39<br />

14.30 - 17.30 Percutaneous nephrolithotripsy (PCNL)<br />

Orange Hall 1 - Level N-1<br />

Chair: E. Liatsikos, Patras (GR)<br />

PCNL instrumentation – Suite organisation, wires, dilators and lithotriptors<br />

C.M. Scoffone, Turin (IT)<br />

From Skin to Stone: Step-by-Step access using only fluoroscopy (Prone position)<br />

E. Liatsikos, Patras (GR)<br />

From Skin to Stone: Step-by-Step access using US and fluoroscopy (Supine position)<br />

C.M. Scoffone, Turin (IT)<br />

MiniPerc - Indications, equipment and technique<br />

T. Knoll, Sindelfingen (DE)<br />

Management of complications; In the OR and in the wards<br />

E. Liatsikos, Patras (GR)<br />

Tips and tricks in PCNL<br />

E. Liatsikos, Patras (GR)<br />

PCNL versus ESWL versus URS: The debate continues<br />

T. Knoll, Sindelfingen (DE)<br />

Analysis of demanding / unusual cases<br />

T. Knoll, Sindelfingen (DE)<br />

Round table discussion<br />

Faculty<br />

Aims and objectives<br />

The objective of the course is to provide an overview of the key points of PCNL technique and its<br />

implementation. A step-by-step approach to access methods will be emphasized, allowing beginners to<br />

familiarize themselves with the details of the techniques. The debate surrounding optimal patient positioning<br />

will be addressed, with extensive information on prone and supine PCNL techniques. A presentation on<br />

MiniPerc will showcase the equipments and indications of this alternative method. The identification and<br />

management of immediate and delayed complications will be reviewed. Also, challenging PCNL cases will<br />

be presented, demonstrating the frontiers of PCNL for experienced surgeons. Finally, tips and tricks of the<br />

technique will be shown, offering practical shortcuts to frequent problems encountered in PCNL.<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 47<br />

Non-<strong>EAU</strong> members € 69<br />

Residents (members/non-members) € 21<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

371<br />

ESU Courses


ESU Courses<br />

ESU Courses, 18 March<br />

372 <strong>Programme</strong> <strong>Book</strong><br />

ESU Course 40<br />

14.30 - 17.30 Single port – NOTES and minilaparoscopy: Is this the way to go?<br />

Orange Hall 2 - Level N-1<br />

Instrumentation - Access<br />

A. Rane, Redhill (GB)<br />

Chair: A. Rane, Redhill (GB)<br />

Nephrectomy: Single port, hybrid techniques<br />

A. Rane, Redhill (GB)<br />

Pyeloplasty: Sinlge port, hybrid technique<br />

T.R.W. Herrmann, Hanover (DE)<br />

Adrenalectomy: Single port<br />

T.R.W. Herrmann, Hanover (DE)<br />

Partial nephrectomy: Single port, hybrid technique<br />

J.H. Kaouk, Cleveland (US)<br />

Robotic single port: Upper tract, prostatectomy<br />

J.H. Kaouk, Cleveland (US)<br />

Complications - How do we avoid them?<br />

T.R.W. Herrmann, Hanover (DE)<br />

Why single port? Are you convinced?<br />

A. Rane, Redhill (GB)<br />

Aims and objectives<br />

The objective is to introduce single port surgery principles to the attendees. The presentations are made<br />

in a step by step fashion so that everyone can have a clear idea of the procedures, and can be exposed to<br />

tips and tricks that would make these procedures more appealing to them. The true indications of single<br />

port are presented as well as its integration with other hybrid procedures. Three mm instruments or hybrid<br />

tansvaginal approach are also issues that are addressed. The main purpose of this course is to convince the<br />

attendees about the usefulness and feasibility of single port surgery and its combination with other hybrid<br />

procedures. Single port surgery should not be considered a “mission impossible” and this is certainly the<br />

main goal of our endeavor.<br />

Registration fee excluding VAT<br />

<strong>EAU</strong> members € 47<br />

Non-<strong>EAU</strong> members € 69<br />

Residents (members/non-members) € 21


ESU Hands-on, 16 March<br />

09.00 - 10.30 ESU/ESUT Hands-on training in Green light laser vaporisation;<br />

Technique and standard cases - Basic course 1<br />

Turquoise Hall 2 - Level N-1<br />

Chairs: G.H. Fournier, Brest (FR)<br />

J.A. Thomas, Bridgend (GB)<br />

C.M. Capitan Manjon, Madrid (ES)<br />

C. Gratzke, Munich (DE)<br />

TBC<br />

Aims and objectives<br />

The European School of Urology (ESU) and the European Section of Uro-Technology (ESUT) offer an intensive<br />

hands-on training course with different models focussing on the endoscopic management of LUTS. The<br />

delegates will be taken through a sequential programme of Green-light-laservaporisation using virtual<br />

reality models. A video demonstrating the different steps and tasks of the procedures will be presented<br />

and afterwards the delegates will be instructed according to their level of experience in small teams at<br />

the models. Finally, all remaining questions can be answered and discussed with all tutors including the<br />

demonstration of tips and tricks.<br />

Registration fee excluding VAT € 25<br />

Supported by an unrestricted educational grant from AMERICAN MEDICAL SYSTEMS<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

373<br />

ESU Hands-on


ESU Hands-on<br />

ESU Hands-on, 16 March<br />

10.45 - 12.15 ESU/ESUT Hands-on training in Green light laser vaporisation;<br />

Technique and standard cases - Basic course 2<br />

374 <strong>Programme</strong> <strong>Book</strong><br />

Turquoise Hall 2 - Level N-1<br />

Chairs: G.H. Fournier, Brest (FR)<br />

J.A. Thomas, Bridgend (GB)<br />

C.M. Capitan Manjon, Madrid (ES)<br />

C. Gratzke, Munich (DE)<br />

TBC<br />

Aims and objectives<br />

The European School of Urology (ESU) and the European Section of Uro-Technology (ESUT) offer an intensive<br />

hands-on training course with different models focussing on the endoscopic management of LUTS. The<br />

delegates will be taken through a sequential programme of Green-light-laservaporisation using virtual<br />

reality models. A video demonstrating the different steps and tasks of the procedures will be presented<br />

and afterwards the delegates will be instructed according to their level of experience in small teams at<br />

the models. Finally, all remaining questions can be answered and discussed with all tutors including the<br />

demonstration of tips and tricks.<br />

Registration fee excluding VAT € 25<br />

Supported by an unrestricted educational grant from AMERICAN MEDICAL SYSTEMS


ESU Hands-on, 16 March<br />

12.30 - 14.00 ESU/ESUT Hands-on training in Green light laser vaporisation;<br />

Technique and standard cases - Basic course 3<br />

Turquoise Hall 2 - Level N-1<br />

Chairs: A. Bachmann, Basel (CH)<br />

O. Reich, Munich (DE)<br />

F. Schiefelbein, Wurzburg (DE)<br />

U. Witzsch, Frankfurt am Main (DE)<br />

TBC<br />

Aims and objectives<br />

The European School of Urology (ESU) and the European Section of Uro-Technology (ESUT) offer an intensive<br />

hands-on training course with different models focussing on the endoscopic management of LUTS. The<br />

delegates will be taken through a sequential programme of Green-light-laservaporisation using virtual<br />

reality models. A video demonstrating the different steps and tasks of the procedures will be presented<br />

and afterwards the delegates will be instructed according to their level of experience in small teams at<br />

the models. Finally, all remaining questions can be answered and discussed with all tutors including the<br />

demonstration of tips and tricks.<br />

Registration fee excluding VAT € 25<br />

Supported by an unrestricted educational grant from AMERICAN MEDICAL SYSTEMS<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

375<br />

ESU Hands-on


ESU Hands-on<br />

ESU Hands-on, 16 March<br />

14.15 - 15.45 ESU/ESUT Hands-on training in Green light laser vaporisation;<br />

Technique and standard cases - Basic course 4<br />

376 <strong>Programme</strong> <strong>Book</strong><br />

Turquoise Hall 2 - Level N-1<br />

Chairs: A. Bachmann, Basel (CH)<br />

O. Reich, Munich (DE)<br />

F. Schiefelbein, Wurzburg (DE)<br />

U. Witzsch, Frankfurt am Main (DE)<br />

TBC<br />

Aims and objectives<br />

The European School of Urology (ESU) and the European Section of Uro-Technology (ESUT) offer an intensive<br />

hands-on training course with different models focussing on the endoscopic management of LUTS. The<br />

delegates will be taken through a sequential programme of Green-light-laservaporisation using virtual<br />

reality models. A video demonstrating the different steps and tasks of the procedures will be presented<br />

and afterwards the delegates will be instructed according to their level of experience in small teams at<br />

the models. Finally, all remaining questions can be answered and discussed with all tutors including the<br />

demonstration of tips and tricks.<br />

Registration fee excluding VAT € 25<br />

Supported by an unrestricted educational grant from AMERICAN MEDICAL SYSTEMS


ESU Hands-on, 16 March<br />

09.00 - 10.30 ESU/ESUT Hands-on training Endourology course 1<br />

Amber 5 - Level S2<br />

Chair: N.N-P. Buchholz, London (GB)<br />

P.A. Geavlete, Bucharest (RO)<br />

A.D. Joyce, Leeds (GB)<br />

F. Keeley, Bristol (GB)<br />

T. Sulser, Zurich (CH)<br />

Aims and objectives<br />

Laparoscopic procedures are continuously evolving in urology based on the increasing expertise of urologic<br />

surgeons. This includes ablative procedures, such as radical nephrectomy as well as reconstructive<br />

techniques, such as pyeloplasty. Some advanced procedures (i.e. radical prostatectomy, radical cystectomy)<br />

have both, ablative and reconstructive steps. Since the number of centres with laparoscopic expertise is<br />

still limited in Europe, laparoscopic training programmes have become very important. Hands-on training<br />

courses at the pelvi-trainer represent one of the main steps of such courses. Finally, all remaining questions<br />

can be answered and discussed with all tutors including the demonstration of tips and tricks.<br />

Registration fee excluding VAT € 25<br />

Supported by an unrestricted educational grant from OLYMPUS EUROPA HOLDING GMBH<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

377<br />

ESU Hands-on


ESU Hands-on<br />

ESU Hands-on, 16 March<br />

11.00 - 12.30 ESU/ESUT Hands-on training Endourology course 2<br />

378 <strong>Programme</strong> <strong>Book</strong><br />

Amber 5 - Level S2<br />

Chair: R. Muschter, Rotenburg (DE)<br />

A.J. Gross, Hamburg (DE)<br />

A.G. Martov, Moscow (RU)<br />

P. Rischmann, Toulouse (FR)<br />

G.G. Tailly, Brasschaat (BE)<br />

Aims and objectives<br />

Laparoscopic procedures are continuously evolving in urology based on the increasing expertise of urologic<br />

surgeons. This includes ablative procedures, such as radical nephrectomy as well as reconstructive<br />

techniques, such as pyeloplasty. Some advanced procedures (i.e. radical prostatectomy, radical cystectomy)<br />

have both, ablative and reconstructive steps. Since the number of centres with laparoscopic expertise is<br />

still limited in Europe, laparoscopic training programmes have become very important. Hands-on training<br />

courses at the pelvi-trainer represent one of the main steps of such courses. Finally, all remaining questions<br />

can be answered and discussed with all tutors including the demonstration of tips and tricks.<br />

Registration fee excluding VAT € 25<br />

Supported by an unrestricted educational grant from OLYMPUS EUROPA HOLDING GMBH


ESU Hands-on, 17 March<br />

09.00 - 11.00 ESU/ESUT Hands-on training Laparoscopy course 1<br />

Turquoise Hall 1 - Level N-1<br />

Chair: D. Teber, Heidelberg (DE)<br />

R.T. Bardan, Timisoara (RO)<br />

F. Greco, Leipzig (DE)<br />

U. Nagele, Hall in Tirol (AT)<br />

L. Tunc, Ankara (TR)<br />

Aims and objectives<br />

Laparoscopic procedures are continuously evolving in urology based on the increasing expertise of urologic<br />

surgeons. This includes ablative procedures, such as radical nephrectomy as well as reconstructive<br />

techniques, such as pyeloplasty. Some advanced procedures (i.e. radical prostatectomy, radical cystectomy)<br />

have both, ablative and reconstructive steps. Since the number of centres with laparoscopic expertise is<br />

still limited in Europe, laparoscopic training programmes have become very important. Hands-on training<br />

courses at the pelvi-trainer represent one of the main steps of such courses. Finally, all remaining questions<br />

can be answered and discussed with all tutors including the demonstration of tips and tricks.<br />

Registration fee excluding VAT € 25<br />

Supported by an unrestricted educational grant from KARL STORZ GMBH & CO.KG and COOK MEDICAL<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

379<br />

ESU Hands-on


ESU Hands-on<br />

ESU Hands-on, 17 March<br />

11.30 - 13.30 ESU/ESUT Hands-on training Laparoscopy course 2<br />

380 <strong>Programme</strong> <strong>Book</strong><br />

Turquoise Hall 1 - Level N-1<br />

Chair: E. Liatsikos, Patras (GR)<br />

P. Chlosta, Wroclaw (PL)<br />

B. Guillonneau, Paris (FR)<br />

F. Porpiglia, Turin (IT)<br />

C. Schwentner, Tübingen (DE)<br />

Aims and objectives<br />

Laparoscopic procedures are continuously evolving in urology based on the increasing expertise of urologic<br />

surgeons. This includes ablative procedures, such as radical nephrectomy as well as reconstructive<br />

techniques, such as pyeloplasty. Some advanced procedures (i.e. radical prostatectomy, radical cystectomy)<br />

have both, ablative and reconstructive steps. Since the number of centres with laparoscopic expertise is<br />

still limited in Europe, laparoscopic training programmes have become very important. Hands-on training<br />

courses at the pelvi-trainer represent one of the main steps of such courses. Finally, all remaining questions<br />

can be answered and discussed with all tutors including the demonstration of tips and tricks.<br />

Registration fee excluding VAT € 25<br />

Supported by an unrestricted educational grant from KARL STORZ GMBH & CO.KG and COOK MEDICAL


ESU Hands-on, 17 March<br />

09.00 - 10.30 ESU/ESUT Hands-on training Laparoscopy course 1<br />

Amber 5 - Level S2<br />

Chair: M. Burchardt, Greifswald (DE)<br />

A.S. Gözen, Heilbronn (DE)<br />

A. Minervini, Florence (IT)<br />

M.J. Ribal, Barcelona (ES)<br />

B.S.E.P. Van Cleynenbreugel, Leuven (BE)<br />

Aims and objectives<br />

Laparoscopic procedures are continuously evolving in urology based on the increasing expertise of urologic<br />

surgeons. This includes ablative procedures, such as radical nephrectomy as well as reconstructive<br />

techniques, such as pyeloplasty. Some advanced procedures (i.e. radical prostatectomy, radical cystectomy)<br />

have both, ablative and reconstructive steps. Since the number of centres with laparoscopic expertise is<br />

still limited in Europe, laparoscopic training programmes have become very important. Hands-on training<br />

courses at the pelvi-trainer represent one of the main steps of such courses. Finally, all remaining questions<br />

can be answered and discussed with all tutors including the demonstration of tips and tricks.<br />

Registration fee excluding VAT € 25<br />

Supported by an unrestricted educational grant from OLYMPUS EUROPA HOLDING GMBH<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

381<br />

ESU Hands-on


ESU Hands-on<br />

ESU Hands-on, 17 March<br />

11.00 - 12.30 ESU/ESUT Hands-on training Laparoscopy course 2<br />

382 <strong>Programme</strong> <strong>Book</strong><br />

Amber 5 - Level S2<br />

Chair: F. Gaboardi, Milan (IT)<br />

T. Kalogeropoulos, Athens (GR)<br />

P. Macek, Prague (CZ)<br />

R. Rabenalt, Düsseldorf (DE)<br />

TBC<br />

Aims and objectives<br />

Laparoscopic procedures are continuously evolving in urology based on the increasing expertise of urologic<br />

surgeons. This includes ablative procedures, such as radical nephrectomy as well as reconstructive<br />

techniques, such as pyeloplasty. Some advanced procedures (i.e. radical prostatectomy, radical cystectomy)<br />

have both, ablative and reconstructive steps. Since the number of centres with laparoscopic expertise is<br />

still limited in Europe, laparoscopic training programmes have become very important. Hands-on training<br />

courses at the pelvi-trainer represent one of the main steps of such courses. Finally, all remaining questions<br />

can be answered and discussed with all tutors including the demonstration of tips and tricks.<br />

Registration fee excluding VAT € 25<br />

Supported by an unrestricted educational grant from OLYMPUS EUROPA HOLDING GMBH


ESU Hands-on, 17 March<br />

09.00 - 10.30 ESU/ERUS Hands-on training on Robotic surgery course 1<br />

Turquoise Hall 2 - Level N-1<br />

Chair: H.G. Van Der Poel, Amsterdam (NL)<br />

N.M. Buffi, Genova (IT)<br />

N.D. Doumerc, Toulouse (FR)<br />

N.S. Patel, Oxfordshire (GB)<br />

Aims and objectives<br />

The European School of Urology (ESU) and the <strong>EAU</strong> Robotic Urology Section (ERUS) offer an intensive handson<br />

training course. We will provide training using simulators. The main aims of this 90 minutes course are:<br />

improving the participants´ control-skills and hand-eye-coordination, as well as an objective benchmarking<br />

of console performance and an introduction into standardized surgical steps in robot-assisted procedures.<br />

Therefore, each course is limited to the small number of 8 participants, to facilitate an optimal training<br />

setting with only 2 participants per faculty.<br />

Registration fee excluding VAT € 25<br />

Supported by an unrestricted educational grant from INTUITIVE SURGICAL and MIMIC<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

383<br />

ESU Hands-on


ESU Hands-on<br />

ESU Hands-on, 17 March<br />

11.00 - 12.30 ESU/ERUS Hands-on training on Robotic surgery course 2<br />

384 <strong>Programme</strong> <strong>Book</strong><br />

Turquoise Hall 2 - Level N-1<br />

Chair: J.H. Witt, Gronau (DE)<br />

N.M. Buffi, Genova (IT)<br />

N.D. Doumerc, Toulouse (FR)<br />

N.S. Patel, Oxfordshire (GB)<br />

Aims and objectives<br />

The European School of Urology (ESU) and the <strong>EAU</strong> Robotic Urology Section (ERUS) offer an intensive handson<br />

training course. We will provide training using simulators. The main aims of this 90 minutes course are:<br />

improving the participants´ control-skills and hand-eye-coordination, as well as an objective benchmarking<br />

of console performance and an introduction into standardized surgical steps in robot-assisted procedures.<br />

Therefore, each course is limited to the small number of 8 participants, to facilitate an optimal training<br />

setting with only 2 participants per faculty.<br />

Registration fee excluding VAT € 25<br />

Supported by an unrestricted educational grant from INTUITIVE SURGICAL and MIMIC


ESU Hands-on, 17 March<br />

12.00 - 15.00 ESU Hands-on training course on Urodynamics<br />

Amber Hall 6 - Level S2<br />

Chair: H. Hashim, Bristol (GB)<br />

M.J. Drake, Bristol (GB)<br />

J. Ellis Jones, Bristol (GB)<br />

A. Gammie, Bristol (GB)<br />

Aims and objectives<br />

This workshop aims to provide a practical course offering an interactive “hands-on” environment for doctors,<br />

nurses and technicians to improve their skills in urodynamics, with an emphasis on practical aspects<br />

including equipment used, interpretation of traces, quality control and trouble-shooting. The use of recorded<br />

tests, access to equipment and small groups means that individual problems can be addressed. All the<br />

speakers are involved in similar “hands-on” courses, which have ran successfully in the United Kingdom<br />

and abroad. The small group format has been shown to work well in addressing individual needs. Access to<br />

teaching aids and equipment will simulate the clinical scenario as much as possible within the constraints<br />

of the conference setting. At the end of the workshop delegates should feel more confident in their practice<br />

of urodynamics.<br />

Registration fee excluding VAT € 25<br />

Supported by an unrestricted educational grant from MEDIWATCH<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

385<br />

ESU Hands-on


ESU Hands-on<br />

ESU Hands-on, 17 March<br />

14.00 - 15.30 ESU/ESUT/EULIS Hands-on training Ureterorenoscopy course 1<br />

386 <strong>Programme</strong> <strong>Book</strong><br />

Turquoise Hall 1 - Level N-1<br />

Chair: A. Skolarikos, Athens (GR)<br />

A. Breda, Barcelona (ES)<br />

G. Giusti, Milan (IT)<br />

P. Krombach, Mannheim (DE)<br />

Aims and objectives<br />

The European School of Urology (ESU), the <strong>EAU</strong> Section of Uro-Technology (ESUT) and the <strong>EAU</strong> Section<br />

of Urolithiasis (EULIS) offer an intensive hands-on training course with different models focussing on the<br />

endoscopic management of urolithiasis. The delegates will be taken through a sequential programme of<br />

Ureterorenoscopy using normal endoscopic instruments in different models. The use of various guide-wires,<br />

baskets and intracorporeal lithotripters will be demonstrated. The ESUT and the EULIS faculty consist of<br />

experienced surgeons in the field of Ureterorenoscopy. A video demonstrating the different steps and tasks<br />

of the procedures will be presented and afterwards the delegates will be instructed according to their level<br />

of experience in small teams at the models. Finally, all remaining questions can be answered and discussed<br />

with all tutors including the demonstration of tips and tricks.<br />

Registration fee excluding VAT € 25<br />

Supported by an unrestricted educational grant from KARL STORZ GMBH & CO.KG and COOK MEDICAL


ESU Hands-on, 18 March<br />

09.00 - 10.30 ESU/ESUT/EULIS Hands-on training Ureterorenoscopy course 2<br />

Turquoise Hall 1 - Level N-1<br />

Chair: P.J. Osther, Fredericia (DK)<br />

A. Hoznek, Creteil (FR)<br />

T. Knoll, Sindelfingen (DE)<br />

B. Turna, Izmir (TR)<br />

Aims and objectives<br />

The European School of Urology (ESU), the <strong>EAU</strong> Section of Uro-Technology (ESUT) and the <strong>EAU</strong> Section<br />

of Urolithiasis (EULIS) offer an intensive hands-on training course with different models focussing on the<br />

endoscopic management of urolithiasis. The delegates will be taken through a sequential programme of<br />

Ureterorenoscopy using normal endoscopic instruments in different models. The use of various guide-wires,<br />

baskets and intracorporeal lithotripters will be demonstrated. The ESUT and the EULIS faculty consist of<br />

experienced surgeons in the field of Ureterorenoscopy. A video demonstrating the different steps and tasks<br />

of the procedures will be presented and afterwards the delegates will be instructed according to their level<br />

of experience in small teams at the models. Finally, all remaining questions can be answered and discussed<br />

with all tutors including the demonstration of tips and tricks.<br />

Registration fee excluding VAT € 25<br />

Supported by an unrestricted educational grant from KARL STORZ GMBH & CO.KG and COOK MEDICAL<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

387<br />

ESU Hands-on


ESU Hands-on<br />

ESU Hands-on, 18 March<br />

09.00 - 10.30 ESU/ESUT Hands-on training in Green light laser vaporisation;<br />

Technique and large adenoma - Advanced course 1<br />

388 <strong>Programme</strong> <strong>Book</strong><br />

Amber 5 - Level S2<br />

Chair: G. Muir, London (GB)<br />

C. Gratzke, Munich (DE)<br />

C.M. Capitan Manjon, Madrid (ES)<br />

F. Gomez Sancha, Madrid (ES)<br />

TBC<br />

Aims and objectives<br />

The European School of Urology (ESU) and the European Section of Uro-Technology (ESUT) offer an intensive<br />

hands-on training course with different models focussing on the endoscopic management of LUTS. The<br />

delegates will be taken through a sequential programme of Green-light-laservaporisation using a virtual<br />

reality model, especially focussing on more complicated applications (ie large intravesical obstructing middle<br />

lobes, patients under anti-coagulation, cardiological considerations) A video demonstrating the different<br />

steps and tasks of the procedures will be presented and afterwards the delegates will be instructed according<br />

to their level of experience in small teams at the models. Treatment of high risk patients will be discussed<br />

(anticoagulant). Finally, all remaining questions can be answered and discussed with all tutors including the<br />

demonstration of tips and tricks.<br />

Registration fee excluding VAT € 25<br />

Supported by an unrestricted educational grant from AMERICAN MEDICAL SYSTEMS


ESU Hands-on, 18 March<br />

11.00 - 12.30 ESU/ESUT Hands-on training in Green light laser vaporisation;<br />

Technique and large adenoma - Advanced course 2<br />

Amber 5 - Level S2<br />

Chair: G. Muir, London (GB)<br />

C. Gratzke, Munich (DE)<br />

C.M. Capitan Manjon, Madrid (ES)<br />

F. Gomez Sancha, Madrid (ES)<br />

TBC<br />

Aims and objectives<br />

The European School of Urology (ESU) and the European Section of Uro-Technology (ESUT) offer an intensive<br />

hands-on training course with different models focussing on the endoscopic management of LUTS. The<br />

delegates will be taken through a sequential programme of Green-light-laservaporisation using a virtual<br />

reality model, especially focussing on more complicated applications (ie large intravesical obstructing middle<br />

lobes, patients under anti-coagulation, cardiological considerations) A video demonstrating the different<br />

steps and tasks of the procedures will be presented and afterwards the delegates will be instructed according<br />

to their level of experience in small teams at the models. Treatment of high risk patients will be discussed<br />

(anticoagulant). Finally, all remaining questions can be answered and discussed with all tutors including the<br />

demonstration of tips and tricks.<br />

Registration fee excluding VAT € 25<br />

Supported by an unrestricted educational grant from AMERICAN MEDICAL SYSTEMS<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

389<br />

ESU Hands-on


ESU Hands-on<br />

ESU Hands-on, 18 March<br />

13.00 - 14.30 ESU/ESUT Hands-on training in Green light laser vaporisation;<br />

Technique and large adenoma - Advanced course 3<br />

390 <strong>Programme</strong> <strong>Book</strong><br />

Amber 5 - Level S2<br />

Chair: A. Bachmann, Basel (CH)<br />

N. Barber, Canterbury (GB)<br />

S. Carl, Emmendingen (DE)<br />

TBC<br />

Aims and objectives<br />

The European School of Urology (ESU) and the European Section of Uro-Technology (ESUT) offer an intensive<br />

hands-on training course with different models focussing on the endoscopic management of LUTS. The<br />

delegates will be taken through a sequential programme of Green-light-laservaporisation using a virtual<br />

reality model, especially focussing on more complicated applications (ie large intravesical obstructing middle<br />

lobes, patients under anti-coagulation, cardiological considerations) A video demonstrating the different<br />

steps and tasks of the procedures will be presented and afterwards the delegates will be instructed according<br />

to their level of experience in small teams at the models. Treatment of high risk patients will be discussed (<br />

anticoagulant ). Finally, all remaining questions can be answered and discussed with all tutors including the<br />

demonstration of tips and tricks.<br />

Registration fee excluding VAT € 25<br />

Supported by an unrestricted educational grant from AMERICAN MEDICAL SYSTEMS


ESU Hands-on, 18 March<br />

15.00 - 16.30 ESU/ESUT Hands-on training in Green light laser vaporisation;<br />

Technique and large adenoma - Advanced course 4<br />

Amber 5 - Level S2<br />

Chair: A. Bachmann, Basel (CH)<br />

N. Barber, Canterbury (GB)<br />

S. Carl, Emmendingen (DE)<br />

TBC<br />

Aims and objectives<br />

The European School of Urology (ESU) and the European Section of Uro-Technology (ESUT) offer an intensive<br />

hands-on training course with different models focussing on the endoscopic management of LUTS. The<br />

delegates will be taken through a sequential programme of Green-light-laservaporisation using a virtual<br />

reality model, especially focussing on more complicated applications (ie large intravesical obstructing middle<br />

lobes, patients under anti-coagulation, cardiological considerations) A video demonstrating the different<br />

steps and tasks of the procedures will be presented and afterwards the delegates will be instructed according<br />

to their level of experience in small teams at the models. Treatment of high risk patients will be discussed<br />

(anticoagulant). Finally, all remaining questions can be answered and discussed with all tutors including the<br />

demonstration of tips and tricks.<br />

Registration fee excluding VAT € 25<br />

Supported by an unrestricted educational grant from AMERICAN MEDICAL SYSTEMS<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

391<br />

ESU Hands-on


ESU Hands-on<br />

ESU Hands-on, 18 March<br />

11.00 - 12.30 ESU/ESUT Hands-on training Transurethral therapy of LUTS - Bipolar<br />

TURP course 1<br />

392 <strong>Programme</strong> <strong>Book</strong><br />

Turquoise Hall 1 - Level N-1<br />

Chair: C.M. Scoffone, Turin (IT)<br />

T.R.W. Herrmann, Hanover (DE)<br />

K-D. Sievert, Tübingen (DE)<br />

TBC<br />

Aims and objectives<br />

The European School of Urology (ESU) and the <strong>EAU</strong> Section of Uro-Technology (ESUT) offer an intensive handson<br />

training course with different models focussing on the endoscopic management of LUTS. The delegates<br />

will be taken through a sequential programme of Bipolar TURP using normal endoscopic instruments in<br />

different models. A video demonstrating the different steps and tasks of the procedures will be presented<br />

and afterwards the delegates will be instructed according to their level of experience in small teams at<br />

the models. Finally, all remaining questions can be answered and discussed with all tutors including the<br />

demonstration of tips and tricks.<br />

Registration fee excluding VAT € 25<br />

Supported by an unrestricted educational grant from KARL STORZ GMBH & CO.KG and COOK MEDICAL


ESU Hands-on, 18 March<br />

13.00 - 14.30 ESU/ESUT Hands-on training Transurethral therapy of LUTS - Bipolar<br />

TURP course 2<br />

Turquoise Hall 1 - Level N-1<br />

Chair: V. Bucuras, Timisoara (RO)<br />

A. De La Taille, Creteil (FR)<br />

S. Gravas, Larissa (GR)<br />

A. Lapini, Florence (IT)<br />

Aims and objectives<br />

The European School of Urology (ESU) and the <strong>EAU</strong> Section of Uro-Technology (ESUT) offer an intensive handson<br />

training course with different models focussing on the endoscopic management of LUTS. The delegates<br />

will be taken through a sequential programme of Bipolar TURP using normal endoscopic instruments in<br />

different models. A video demonstrating the different steps and tasks of the procedures will be presented<br />

and afterwards the delegates will be instructed according to their level of experience in small teams at<br />

the models. Finally, all remaining questions can be answered and discussed with all tutors including the<br />

demonstration of tips and tricks.<br />

Registration fee excluding VAT € 25<br />

Supported by an unrestricted educational grant from KARL STORZ GMBH & CO.KG and COOK MEDICAL<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

393<br />

ESU Hands-on


ESU Hands-on<br />

ESU Hands-on, 18 March<br />

09.00 - 10.30 ESU/ERUS Hands-on training on Robotic surgery course 3<br />

394 <strong>Programme</strong> <strong>Book</strong><br />

Turquoise Hall 2 - Level N-1<br />

Chair: C.M. Annerstedt, Stockholm (SE)<br />

F. Annino, Arezzo (IT)<br />

G. De Naeyer, Aalst (BE)<br />

C. Wijburg, Arnhem (NL)<br />

Aims and objectives<br />

The European School of Urology (ESU) and the <strong>EAU</strong> Robotic Urology Section (ERUS) offer an intensive handson<br />

training course. We will provide training using simulators. The main aims of this 90 minutes course are:<br />

improving the participants´ control-skills and hand-eye-coordination, as well as an objective benchmarking<br />

of console performance and an introduction into standardized surgical steps in robot-assisted procedures.<br />

Therefore, each course is limited to the small number of 6 participants, to facilitate an optimal training<br />

setting with only 2 participants per faculty.<br />

Registration fee excluding VAT € 25<br />

Supported by an unrestricted educational grant from INTUITIVE SURGICAL and MIMIC


ESU Hands-on, 18 March<br />

11.00 - 12.30 ESU/ERUS Hands-on training on Robotic surgery course 4<br />

Turquoise Hall 2 - Level N-1<br />

Chair: H. John, Winterthur (CH)<br />

F. Annino, Arezzo (IT)<br />

G. De Naeyer, Aalst (BE)<br />

C. Wijburg, Arnhem (NL)<br />

Aims and objectives<br />

The European School of Urology (ESU) and the <strong>EAU</strong> Robotic Urology Section (ERUS) offer an intensive handson<br />

training course. We will provide training using simulators. The main aims of this 90 minutes course are:<br />

improving the participants´ control-skills and hand-eye-coordination, as well as an objective benchmarking<br />

of console performance and an introduction into standardized surgical steps in robot-assisted procedures.<br />

Therefore, each course is limited to the small number of 6 participants, to facilitate an optimal training<br />

setting with only 2 participants per faculty.<br />

Registration fee excluding VAT € 25<br />

Supported by an unrestricted educational grant from INTUITIVE SURGICAL and MIMIC<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

395<br />

ESU Hands-on


Webcasts of sponsored sessions have been approved by the sponsoring company.<br />

The <strong>EAU</strong> is not responsible for the content of these webcasts.


Friday, 15 March<br />

Sponsored Session<br />

16.15 - 17.45 Extending survival outcomes in RCC and CRPC: Current evidence and<br />

future horizons<br />

Red Hall 2 - Level N1<br />

Symposium<br />

Chair: B. Tombal, Brussels (BE)<br />

What can we learn from the latest data in RCC?<br />

M. Kuczyk, Hanover (DE)<br />

How should we tailor the RCC treatment strategy for individual patients?<br />

C. Porta, Pavia (IT)<br />

Unmet treatment needs in CRPC: Where are we now?<br />

S. Gillessen, St. Gallen (CH)<br />

Future horizons in CRPC: Where are we going?<br />

B. Tombal, Brussels (BE)<br />

Panel discussion and meeting close<br />

B. Tombal, Brussels (BE)<br />

Aims and objectives<br />

• Review recent progress in metastatic Renal Cell Carcinoma (RCC) and Castration-Resistant Prostate Cancer<br />

(CRPC), with particular focus on survival improvements, and in managing bone metastases in CRPC.<br />

• Evaluate current unmet needs in these disease settings, and consider where additional treatment options<br />

are required to improve patient care.<br />

• Examine how the latest data in RCC, and emerging agents in CRPC, will help shape future treatment<br />

paradigms.<br />

Sponsored by BAYER HEALTHCARE<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

397<br />

Sponsored Sessions


Sponsored Sessions<br />

Friday, 15 March<br />

398 <strong>Programme</strong> <strong>Book</strong><br />

Sponsored Session<br />

16.15 - 17.45 New data in metastatic RCC: Applying the evidence to clinical practice<br />

Yellow Hall 1-2-3 - Level N1<br />

Symposium<br />

Chair: A. Mejean, Paris (FR)<br />

Welcome and introduction<br />

A. Mejean, Paris (FR)<br />

First-line treatment selection: Weighing up the evidence<br />

T. Powles, London (GB)<br />

Impact of treatment decisions: The patient experience<br />

P. Schöffski, Leuven (BE)<br />

Applying the latest evidence to clinical practice<br />

A. Mejean, Paris (FR)<br />

I. Duran, Madrid (ES)<br />

Q&A session<br />

A. Mejean, Paris (FR)<br />

Closing remarks<br />

A. Mejean, Paris (FR)<br />

Aims and objectives<br />

• To review the latest head-to-head data in mRCC and explore the clinical implications through patient case<br />

discussions<br />

• To highlight the importance of proactive detection and management of side-effects<br />

• To discuss the importance of taking a holistic approach to treatment decisions<br />

Sponsored by GLAXOSMITHKLINE ONCOLOGY


Friday, 15 March<br />

Sponsored Session<br />

16.15 - 17.45 Urological challenges in managing patients with angiomyolipoma<br />

(AML)<br />

Amber Hall 1-2 - Level S2<br />

Symposium<br />

Chair: K. Budde, Berlin (DE)<br />

Welcome and introduction<br />

K. Budde, Berlin (DE)<br />

Case study presentation: Surgical option for the treatment of AML<br />

A.L. Serra, Zurich (CH)<br />

Overview of AML and the urologic challenges<br />

B. Zonnenberg, Utrecht (NL)<br />

Clinical data on mTOR inhibition for the management of AML<br />

K. Budde, Berlin (DE)<br />

Integrating surgical approaches with pharmacotherapy in the management of AML<br />

M. Staehler, Munich (DE)<br />

Case study: Individualising care for patients with TSC<br />

A.L. Serra, Zurich (CH)<br />

Panel discussion<br />

Aims and objectives<br />

• Increase understanding of current treatment approaches for the management of AML; the unmet needs;<br />

and integration of current therapeutic approaches for the treatment of angiomyolipomas (AMLs) for<br />

improved patient outcomes<br />

• Increase the understanding of advances in the molecular basic of AML and the potential for integrating<br />

pharmacotherapy into the management of AML<br />

• Highlight the importance of treatment selection on an individualized, case-by-case basis<br />

Sponsored by NOVARTIS ONCOLOGY<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

399<br />

Sponsored Sessions


Sponsored Sessions<br />

Friday, 15 March<br />

400 <strong>Programme</strong> <strong>Book</strong><br />

Sponsored Session<br />

16.15 - 17.45 Innovations in clinical urology<br />

Blue Hall 1-2 - Level N1<br />

Symposium<br />

Chair: B. Malavaud, Toulouse (FR)<br />

Digital FURS loves big stones<br />

O. Traxer, Paris (FR)<br />

A balanced review of PDD and NBI in bladder cancer<br />

B. Malavaud, Toulouse (FR)<br />

Plasma-button long-term outcomes and recent advances - A ‘green light’ to become standard BPH treatment<br />

in <strong>2013</strong>?<br />

B. Geavlete, Bucharest (RO)<br />

The potential benefits of 3D laparoscopy for EERPE<br />

J-U. Stolzenburg, Leipzig (DE)<br />

Complex renal surgery using 3D vision<br />

A. Alcaraz, Barcelona (ES)<br />

Aims and objectives<br />

Discover clinical innovations by Olympus. The Olympus symposium will focus on innovations in clinical<br />

urology: 3D Laparoscopy, beyond laser; TUR with bipolar plasma, improving NMIBC detection by NBI and the<br />

latest in stone management. We look forward to your participation.<br />

Sponsored by OLYMPUS


Friday, 15 March<br />

Sponsored Session<br />

16.15 - 17.45 Metastatic castration-resistant prostate cancer: Integrating new<br />

learnings to optimise treatment outcomes<br />

Brown Hall 3 - Level S2<br />

Symposium<br />

Chair: J.M. Fitzpatrick, Dublin (IE)<br />

Welcome and introduction<br />

J.M. Fitzpatrick, Dublin (IE)<br />

The evolving mCRPC landscape: Challenges and opportunities<br />

N. Mottet, Saint Etienne (FR)<br />

The androgen signaling pathway in mCRPC: Implications in daily practice<br />

J.M. Fitzpatrick, Dublin (IE)<br />

Tailoring therapy to optimise treatment outcomes in mCRPC<br />

S. Oudard, Paris (FR)<br />

Managing mCRPC in real life practice<br />

A. Bahl, Bristol (GB)<br />

Closing remarks<br />

J.M. Fitzpatrick, Dublin (IE)<br />

Aims and objectives<br />

The objectives of this symposium are (1) to discuss the current and emerging treatment options in metastatic<br />

castration-resistant prostate cancer, (2) to reach a better understanding of the complexity of androgen<br />

receptor signaling pathway and how these new agents interfere with it, and (3) to share views on how to<br />

best sequence or combine available therapies.<br />

Sponsored by SANOFI<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

401<br />

Sponsored Sessions


Sponsored Sessions<br />

Saturday, 16 March<br />

402 <strong>Programme</strong> <strong>Book</strong><br />

Sponsored Session<br />

18.00 - 19.30 Navigating the new landscape in CRPC<br />

eURO Auditorium - Level S2<br />

Symposium<br />

Chairs: A. Heidenreich, Aachen (DE)<br />

C.N. Sternberg, Rome (IT)<br />

Introduction to symposium<br />

A. Heidenreich, Aachen (DE)<br />

CRPC: The rationale for targeting the androgen receptor<br />

J.A. Schalken, Nijmegen (NL)<br />

New and emerging post-chemotherapy CRPC treatments: Clinical experience<br />

C.N. Sternberg, Rome (IT)<br />

Implications of the evolving pre-chemotherapy landscape<br />

A. Heidenreich, Aachen (DE)<br />

Interactive Q&A discussion session: Optimising patient care in the new CRPC era<br />

N.W. Clarke, Manchester (GB)<br />

Closing summary<br />

C.N. Sternberg, Rome (IT)<br />

Aims and objectives<br />

• To provide the rationale for targeting the androgen receptor in CRPC<br />

• To present clinical experience of new and emerging therapies in patients with CRPC who have received<br />

prior chemotherapy<br />

• To highlight and discuss the implications of emerging treatments for patients with CRPC who have not<br />

received prior chemotherapy<br />

• To discuss the potential impact of new and emerging therapies on the CRPC treatment landscape, patient<br />

pathway and the dynamics of the multidisciplinary team<br />

Sponsored by ASTELLAS


Saturday, 16 March<br />

Sponsored Session<br />

18.00 - 19.30 LUTS/BPH and sexual health - Bridging the gap<br />

Brown Hall 1-2 - Level S2<br />

Symposium<br />

Chair: H. Porst, Hamburg (DE)<br />

Welcome and introduction<br />

H. Porst, Hamburg (DE)<br />

Sexual health and male LUTS - Tackling a sensitive issue<br />

F. Giuliano, Garches (FR)<br />

Tadalfil 5mg once daily - Which patients benefit most?<br />

J.J.M.C.H. De La Rosette, Amsterdam (NL)<br />

Discussion<br />

Challenging questions: Tadalafil once-daily in BPH/LUTS - and now?<br />

F. Giuliano, Garches (FR)<br />

H. Porst, Hamburg (DE)<br />

J.J.M.C.H. De La Rosette, Amsterdam (NL)<br />

Wrap-up<br />

H. Porst, Hamburg (DE)<br />

Aims and objectives<br />

The Eli Lilly satellite symposium “LUTS/BPH and Sexual Health – Bridging the Gap” will provide insights into<br />

recent progress been made in the deeper understanding of the pathophysiology of male LUTS, in particular<br />

its strong link to erectile dysfunction and other co-morbidities.<br />

A wealth of evidence has been published on innovative pharmacological approaches for male LUTS, recently<br />

having led to the approval of Tadalafil 5 mg once daily, for the treatment of the signs and symptoms of<br />

benign prostatic hyperplasia in adult males’, in addition to the existing indication for erectile dysfunction.<br />

The faculty will discuss the pathophysiological link of ED and LUTS/BPH, the current spectrum of available<br />

medical treatment options for LUTS/BPH with a particular focus on sexual quality of life and will define their<br />

position on the expected role of Tadalafil 5 mg once daily in the current treatment algorithm for male LUTS.<br />

Sponsored by ELI LILLY AND COMPANY<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

403<br />

Sponsored Sessions


Sponsored Sessions<br />

Saturday, 16 March<br />

404 <strong>Programme</strong> <strong>Book</strong><br />

Sponsored Session<br />

18.00 - 19.30 Risk stratification to optimize the management of men with<br />

symptomatic BPH at risk of progression<br />

Platinum Hall - Level S3<br />

Symposium<br />

Chair: V. Mirone, Naples (IT)<br />

Session outline<br />

V. Mirone, Naples (IT)<br />

Why is BPH progression important and how can we use risk factors to identify patients at risk of<br />

progression?<br />

M. Marberger, Vienna (AT)<br />

What is the evidence for treating patients with BPH based on their risk of progression?<br />

M. Emberton, London (GB)<br />

Benefit/risk of treatments for patients with BPH at risk of progression<br />

G. Andriole, St. Louis (US)<br />

Case study discussions: Implications in daily practice for BPH management<br />

Q&A session<br />

Aims and objectives<br />

To evaluate and argue on the risk/benefit profile of currently recommended medical treatment options for<br />

patients at risk of BPH progression debating the most recent scientific evidence and with a focus to the latest<br />

evidence on risk factors that categorize BPH as a progressive disease and risk stratification that allows the<br />

right allocation of treatment to patients<br />

Sponsored by GLAXOSMITHKLINE


Saturday, 16 March<br />

Sponsored Session<br />

18.00 - 19.30 Increasing evidence of effectiveness of GAG therapy in different forms<br />

of cystitis<br />

Amber Hall 1-2 - Level S2<br />

Symposium<br />

Chair: P.F. Bassi, Rome (IT)<br />

The scenario of bladder dysfunctions: Insights into the therapeutic potential of GAG therapy<br />

P.F. Bassi, Rome (IT)<br />

Management of interstitial cystitis/bladder pain syndrome with GAGs<br />

M. Cervigni, Rome (IT)<br />

Efficacy of GAGS treatment in chemical and radiation cystitis<br />

E. Finazzi Agro, Rome (IT)<br />

Management of recurrent urinary tract infections with IALURIL®<br />

R. Damiano, Catanzaro (IT)<br />

Clinical experience with IALURIL®: Results of a multicentric survey<br />

R. Tomaskin, Martin (SK)<br />

Final remarks<br />

P.F. Bassi, Rome (IT)<br />

Discussion<br />

Aims and objectives<br />

Glycosaminoglycan (GAG) therapy is now being studied for the treatment of a wide variety of acquired and<br />

inherited diseases in different therapeutic areas, including bladder disorders such as urinary tract infections,<br />

painful bladder syndrome/interstitial cystitis, cystitis following radiation therapy or chemical agents.<br />

The positive outcomes obtained with a combination of hyaluronic acid and chondroitin sulphate administered<br />

intravesically in patients with an history of bladder damage, with the aim of restoring the integrity of the<br />

glycosaminoglycan layer of the urothelium, suggest that such therapeutic approach might be beneficial. A<br />

faculty of experts will review the results of the recent clinical investigations with this GAG combination and<br />

discuss its therapeutic applications.<br />

Sponsored by IBSA INSTITUT BIOCHIMIQUE<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

405<br />

Sponsored Sessions


Sponsored Sessions<br />

Saturday, 16 March<br />

406 <strong>Programme</strong> <strong>Book</strong><br />

Sponsored Session<br />

18.00 - 19.30 Transurethral resection of bladder tumor: How to reach excellence<br />

Brown Hall 3 - Level S2<br />

Symposium<br />

Chair: M. Brausi, Modena (IT)<br />

Introduction<br />

M. Brausi, Modena (IT)<br />

Improving the diagnosis and treatment of non-muscle invasive bladder cancer (NMIBC)<br />

J.A. Witjes, Nijmegen (NL)<br />

Reviewing the data: The hexaminolevulinate-guided blue light cystoscopy metaanalysis<br />

M. Burger, Würzburg (DE)<br />

Blue-light cystoscopy for treatment of NMIBC: Further cost-effectiveness analysis<br />

J.A. Witjes, Nijmegen (NL)<br />

New developments in instillation therapy<br />

S.M. Di Stasi, Rome (IT)<br />

Tying it together: Reaching excellence<br />

M. Brausi, Modena (IT)<br />

Aims and objectives<br />

The goal of this symposium is to present recent developments in the diagnosis and treatment of nonmuscle<br />

invasive bladder cancer (NMIBC) and discuss how these can impact the patient’s prognosis. Accurate<br />

diagnosis, staging and treatment of NMIBC could be more important than any possible adjuvant therapy.<br />

An increasing body of data shows that blue-light cystoscopy is extremely helpful in improving diagnosis<br />

accuracy and reducing the recurrence rate. In this symposium this new modality and alternative treatments<br />

of NMIBC will be described and discussed. New data on cost-effectiveness of blue-light cystoscopy will be<br />

presented and commented. Interaction will be the main characteristic of the symposium.<br />

Sponsored by IPSEN


Saturday, 16 March<br />

Sponsored Session<br />

18.00 - 19.30 Holmium Life Enhancing Plan (HoLEP) - The real BPH lifetime solution<br />

Amber Hall 6 - Level S2<br />

Workshop<br />

Chair: T. Aho, Cambridge (GB)<br />

Introduction<br />

T. Aho, Cambridge (GB)<br />

Tips on getting started: Business plan, equipment, instruments, training<br />

G. Rix, Colchester (GB)<br />

Why HoLEP - How he has chosen HoLEP<br />

D. Pushkar, Moscow (RU)<br />

HoLEP technique: Surgical videos and animation<br />

I. Vavassori, Treviglio (IT)<br />

HoLEP for very large prostates, urinary retention, anticoagulated patients. Tips and literature review<br />

R.M. Kuntz, Berlin (DE)<br />

A review of the RCTs<br />

M. Cynk, Tunbridge Wells (GB)<br />

Comparison of laser techniques for BPH (illustrated with videos)<br />

T. Aho, Cambridge (GB)<br />

Conclusions and discussion<br />

T. Aho, Cambridge (GB)<br />

Aims and objectives<br />

The aim of our symposium is to provide the urologists a better understanding of the HoLEP (Holmium Laser<br />

Enucleation of the Prostate). HoLEP is the only technique for the treatment of BPH (Benign Prostate Symptoms)<br />

with clinical publications of 10 year follow up. During the symposium, some experts from different regions<br />

around Europe, will cover all the relevant points of HoLEP. We want to show that HoLEP is the gold standard<br />

of BPH treatment and a lifetime solution to the patients.<br />

Sponsored by LUMENIS<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

407<br />

Sponsored Sessions


Sponsored Sessions<br />

Saturday, 16 March<br />

408 <strong>Programme</strong> <strong>Book</strong><br />

Sponsored Session<br />

18.00 - 19.30 Premature ejaculation treatment: New perspectives for the couple<br />

Yellow Hall 1-2-3 - Level N1<br />

Symposium<br />

Chair: I. Moncada, Madrid (ES)<br />

Opening and welcome<br />

I. Moncada, Madrid (ES)<br />

Premature ejaculation: Looking beyond a male sexual dysfunction<br />

A. Graziottin, Milan (IT)<br />

Premature ejaculation diagnosis and treatment in daily practice<br />

I. Eardley, Leeds (GB)<br />

Premature ejaculation on demand treatment with dapoxetine: From clinical evidence to real practice<br />

D.G. Hatzichristou, Thessaloniki (GR)<br />

Q&A and closing remarks<br />

I. Moncada, Madrid (ES)<br />

Aims and objectives<br />

Premature Ejaculation (PE) is the most prevalent male sexual dysfunction that affects multiple dimensions<br />

of the patient’s life, ranging from personal to relational domains, with a major effect on couple sexual<br />

relationship as demonstrated by observational studies. Despite of that, significant barriers to obtaining<br />

assistance from physicians exist and PE remains often under-diagnosed and consequently under-treated so,<br />

further efforts to promptly identify and approach PE are required.<br />

Dapoxetine is a fast-acting SSRI, specifically developed for the on demand treatment of PE. Its clinical efficacy<br />

and safety have been demonstrated in 5 phase III clinical trials that involved 6,081 men diagnosed with PE,<br />

in over 25 countries, showing an improvement in IELT and subjective measures of perceived amelioration in<br />

terms of control over ejaculation, satisfaction with sexual intercourse, personal distress and interpersonal<br />

difficulty. Recent trials provided interesting findings on the effect of Dapoxetine in daily practice, strengthen<br />

its positive safety profile and provide a preliminary picture of the trend of utilization in real life.<br />

Sponsored by MENARINI


Sunday, 17 March<br />

Sponsored Session<br />

17.45 - 19.15 Urinary incontinence - Optimising the patient experience and<br />

improving outcomes<br />

Amber Hall 6 - Level S2<br />

Workshop<br />

Chair: K.P. Jünemann, Kiel (DE)<br />

Introduction and welcome<br />

K.P. Jünemann, Kiel (DE)<br />

Injecting with DIGNITY in the long term<br />

F.R. Cruz, Porto (PT)<br />

Injecting tips for managing urinary incontinence with botulinum toxin type A<br />

M. Spinelli, Milan (IT)<br />

Injecting with botulinum toxin type A in the bladder and BoNee® needle - Patient case video<br />

K.P. Jünemann, Kiel (DE)<br />

Injecting to improve patient outcomes - Standardisation of the procedure<br />

G. Karsenty, Marseille (FR)<br />

Chair summary and close<br />

K.P. Jünemann, Kiel (DE)<br />

Aims and objectives<br />

• Provide an update and review the DIGNITY long-term extension study data<br />

• Presentations of practical guidance on the use of botulinum toxin type A for neurogenic detrusor overactivity<br />

(NDO) in clinical practice<br />

• Demonstration, via a pre-filmed injection video, of botulinum toxin type A injection procedure in the<br />

bladder<br />

• Discussions on standardising the injection technique, including appropriate needle selection, in order to<br />

improve outcomes<br />

Sponsored by ALLERGAN and PORGÈS, a COLOPLAST division<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

409<br />

Sponsored Sessions


Sponsored Sessions<br />

Sunday, 17 March<br />

410 <strong>Programme</strong> <strong>Book</strong><br />

Sponsored Session<br />

17.45 - 19.15 Management of OAB: Electing the right candidate for the right patient<br />

eURO Auditorium - Level S2<br />

Symposium<br />

Chair: M.J. Speakman, Taunton (GB)<br />

Chairman’s introduction<br />

M.J. Speakman, Taunton (GB)<br />

Historic milestones in the management of OAB<br />

P. Abrams, Bristol (GB)<br />

The heritage party policy<br />

I. Milsom, Gothenburg (SE)<br />

F. Haab, Paris (FR)<br />

The new party policy<br />

C.R. Chapple, Sheffield (GB)<br />

C. Gratzke, Munich (DE)<br />

Putting policies into practice - case study discussion<br />

P. Abrams, Bristol (GB)<br />

C.R. Chapple, Sheffield (GB)<br />

C. Gratzke, Munich (DE)<br />

I. Milsom, Gothenburg (SE)<br />

M.J. Speakman, Taunton (GB)<br />

Closing remarks from each party<br />

C.R. Chapple, Sheffield (GB)<br />

I. Milsom, Gothenburg (SE)<br />

Chairman’s summary<br />

M.J. Speakman, Taunton (GB)<br />

Aims and objectives<br />

With the arrival of additional therapeutic options for OAB, this symposium will provide a topical and<br />

interactive evaluation of current and future treatments and consider how they may fit in future treatment<br />

algorithms, utilising clinical data, experience and case studies.<br />

Sponsored by ASTELLAS


Sunday, 17 March<br />

Sponsored Session<br />

17.45 - 19.15 Nocturia: Definitive diagnosis for better patient outcomes<br />

Yellow Hall 1-2-3 - Level N1<br />

Symposium<br />

Chair: P.E. Van Kerrebroeck, Maastricht (NL)<br />

Welcome and introduction<br />

P.E. Van Kerrebroeck, Maastricht (NL)<br />

Breaking the patient stereotype<br />

A.J. Wein, Philadelphia (US)<br />

What is different about nocturia?<br />

M. Oelke, Hanover (DE)<br />

Non-antidiuretic vs antidiuretic pharmacotherapy for nocturia<br />

J. Weiss, New York (US)<br />

Round-up of patient case studies<br />

P.E. Van Kerrebroeck, Maastricht (NL)<br />

Questions and answers<br />

Aims and objectives<br />

This Ferring Pharmaceuticals-sponsored symposium aims to provide an overview of the variety of clinical<br />

characteristics of patients with nocturia, and the multifactorial nature of the mechanism of the disease. The<br />

symposium will:<br />

• Provide an overview of the prevalence and consequences of nocturia (Philip Van Kerrebroeck, the<br />

Netherlands)<br />

• Discuss case studies of patients with nocturia and their diagnoses through audience interaction (Alan Wein,<br />

USA)<br />

• Review current understanding of the mechanism of nocturia and discuss treatment algorithms and<br />

guidelines (Matthias Oelke, Germany)<br />

• Summarise the evidence for efficacy of available pharmacotherapies for nocturia (Jeffrey Weiss, USA)<br />

Sponsored by FERRING PHARMACEUTICALS<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

411<br />

Sponsored Sessions


Sponsored Sessions<br />

Sunday, 17 March<br />

412 <strong>Programme</strong> <strong>Book</strong><br />

Sponsored Session<br />

17.45 - 19.15 Towards individualisation of prostate cancer treatments: From bench<br />

to bedside<br />

Brown Hall 3 - Level S2<br />

Symposium<br />

Chair: P. Hammerer, Braunschweig (DE)<br />

Introduction<br />

P. Hammerer, Braunschweig (DE)<br />

Learnings from breast cancer management in treatment indivualisation (biology and treatment strategy)<br />

G. Curigliano, Milan (IT)<br />

Biology on prostate cancer: Will future biomarkers kill PSA?<br />

L. Martínez Piñeiro, Madrid (ES)<br />

A. Thompson, London (GB)<br />

Enhanced individualisation through new strategies in CRPC<br />

M. Eisenberger, Baltimore (US)<br />

Treatment individualisation up to patient support<br />

P. Hammerer, Braunschweig (DE)<br />

Aims and objectives<br />

The goal of this symposium is to promote the individualized approach of prostate cancer treatment. Learning<br />

from the treatment individualization approach in breast cancer management could generate new possibilities<br />

to stratify prostate cancer with regards to its aggressiveness. The introduction of targeted therapeutics into<br />

the clinical therapeutic arsenal generates major opportunities for further development of cancer biomarkers.<br />

Finally, the arrival of new hormonal pathway targeting drugs will stimulate the development of new<br />

treatment strategies leading to a more individualized treatment of prostate cancer patients.<br />

Sponsored by IPSEN


Sunday, 17 March<br />

Sponsored Session<br />

17.45 - 19.15 Clinical conundrums in the treatment of metastatic castrationresistant<br />

prostate cancer<br />

Silver Hall - Level N2<br />

Symposium<br />

Chair: P.F.A. Mulders, Nijmegen (NL)<br />

Moderator: C. Hood, London (GB)<br />

Introduction<br />

P.F.A. Mulders, Nijmegen (NL)<br />

Defining disease progression in metastatic CRPC<br />

J.E. Gschwend, Munich (DE)<br />

The role of corticosteroids in the treatment of metastatic CRPC<br />

M. De Santis, Vienna (AT)<br />

C. Parker, London (GB)<br />

Emerging treatment options for the chemotherapy naive patient<br />

P.F.A. Mulders, Nijmegen (NL)<br />

Q&A session. Summary and close<br />

M. De Santis, Vienna (AT)<br />

J.E. Gschwend, Munich (DE)<br />

P.F.A. Mulders, Nijmegen (NL)<br />

C. Parker, London (GB)<br />

Aims and objectives<br />

Recently a number of therapies have been approved providing more options for treatment and improving<br />

outcomes for men with advanced prostate cancer. The satellite symposium sponsored by Janssen<br />

Pharmaceutical Companies of Johnson & Johnson entitled Clinical conundrums in the treatment of metastatic<br />

castration-resistant prostate cancer will address key topics on the management of patients with metastatic<br />

castration-resistant prostate cancer (CRPC) in daily clinical practice. The different definitions of disease<br />

progression in metastatic CRPC, and ways in which progression in the clinic is monitored will be explored.<br />

The role of corticosteroids in the treatment of metastatic CRPC will be considered and the latest data for<br />

androgen biosynthesis inhibition in the pre-chemotherapy setting will also be presented.<br />

Throughout the symposium you will be invited to participate in an interactive activity to provide your views<br />

on key topics in management of patients with metastatic CRPC. A panel discussion is also included in the<br />

program to encourage you to ask questions, exchange ideas, and to share experiences relevant to everyday<br />

clinical practice.<br />

Sponsored by JANSSEN PHARMACEUTICAL COMPANIES OF JOHNSON & JOHNSON<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

413<br />

Sponsored Sessions


Sponsored Sessions<br />

Sunday, 17 March<br />

414 <strong>Programme</strong> <strong>Book</strong><br />

Sponsored Session<br />

17.45 - 19.15 Burden of illness and optimal management of recurrent cystitis<br />

Amber Hall 1-2 - Level S2<br />

Symposium<br />

Chair: K.G. Naber, Straubing (DE)<br />

Antimicrobial susceptibility and resistance in urological infections worldwide: Surveillance and prevention<br />

F.M.E. Wagenlehner, Giessen (DE)<br />

Guidelines in urinary tract infections (UTI): The place of immunoactive-prophylaxis in recurrent UTI<br />

management<br />

K.G. Naber, Straubing (DE)<br />

Burden of illness of recurrent UTI: Clinical benefit of oral immunostimulation and impact on patients’ quality<br />

of life<br />

B. Wullt, Lund (SE)<br />

Responders profile and evidence in clinical practice<br />

P. Tenke, Budapest (HU)<br />

Aims and objectives<br />

Progressive increase of antibiotic resistance is a major concern worldwide. Resistance surveillance programs<br />

and infection control measures may be useful in delaying resistance, but rarely capable to reduce the incidence<br />

of infections caused by multi-drug resistant (MDR) organisms. On the other hand, new antimicrobials will not<br />

likely become available before the next decade. Specifically, with regard to recurrent urinary tract infection<br />

(rUTI), the increasing resistance to several antibiotic classes support the need to use alternative preventative<br />

approaches in order to spare the limited antibiotic armamentarium.<br />

European Association of Urology (<strong>EAU</strong>) Guidelines recommend: i) counseling and behavioral modifications<br />

to eliminate modifiable risk factors for rUTI and ii) non-antimicrobial prophylaxis before any antibiotic<br />

prevention. Several non-antimicrobial measures that do not increase antibiotic resistance are currently<br />

available with different grades of recommendation according to the scientific level of evidence.<br />

The oral immunoactive prophylaxis with E.coli extracts (OM-89) deserves the highest grade of recommendation<br />

in the <strong>EAU</strong> Guidelines compared to other alternative strategies because its efficacy is sufficiently well<br />

documented in several randomized double blind placebo controlled studies and 2 meta-analysis.<br />

The immunological properties and the clinical safety and efficacy of oral bacterial lysates (OM-89) will be<br />

addressed in details in the symposium. Furthermore the detrimental impact of recurrent cystitis on patients’<br />

quality of life will also be highlighted and the beneficial effects of the immunoactive therapy on life quality<br />

indicators will be presented.<br />

There is some evidence that specific populations, including patients at higher risk for recurrent cystitis, could<br />

benefit more by immunoprophylaxis but further controlled studies are desirable. In the meantime, useful<br />

evidence comes from daily clinical practice; some case studies will be shown and debated.<br />

Sponsored by OM PHARMA SA


Sunday, 17 March<br />

Sponsored Session<br />

17.45 - 19.15 BPH and inflammation, from lab to clinic<br />

Red Hall 1 - Level N1<br />

Symposium<br />

Chair: R. Bartoletti, Florence (IT)<br />

State of the art: The link between BPH and inflammation<br />

M.J. Ribal, Barcelona (ES)<br />

Clinical approach: Why and how to evaluate prostatic inflammation?<br />

V. Ficarra, Padua (IT)<br />

Therapeutic approach: How to take charge of prostatic inflammation?<br />

A. De La Taille, Creteil (FR)<br />

Aims and objectives<br />

Emerging evidence indicates that prostatic inflammation may contribute to prostate growth. During this<br />

symposium, the relation between inflammation and BPH will be discussed.<br />

Some authors found a strong correlation between the amount of inflammatory infiltrate, IPSS, prostate<br />

volume and BPH progression. If inflammation is correlated with BPH, the ability of detecting inflammation<br />

without analysing prostate tissue specimens can be discussed. Finally, it is of interest to determine if<br />

inflammation could be considered as a therapeutic target for BPH, and with which therapeutic approaches.<br />

Sponsored by PIERRE FABRE MEDICAMENT<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

415<br />

Sponsored Sessions


Sponsored Sessions<br />

Sunday, 17 March<br />

416 <strong>Programme</strong> <strong>Book</strong><br />

Sponsored Session<br />

17.45 - 19.15 Silodosin: A first choice for the pharmacological treatment of BPH<br />

Brown Hall 1-2 - Level S2<br />

Symposium<br />

Chair: F. Montorsi, Milan (IT)<br />

Opening remarks<br />

F. Montorsi, Milan (IT)<br />

BPH: Where we are today<br />

F.C. Hamdy, Oxford (GB)<br />

Which patient and why - An analysis of pooled data from the phase III studies in EU and US<br />

H. Lepor, New York (US)<br />

G. Novara, Padova (IT)<br />

The ‘real life’ profile of the BPH patient<br />

H. Botto, Suresnes (FR)<br />

Clinical cases and discussion<br />

F. Montorsi, Milan (IT)<br />

Concluding remarks<br />

F. Montorsi, Milan (IT)<br />

Aims and objectives<br />

This symposium will discuss the potential role of silodosin, a highly selective alpha 1a-antagonist,<br />

with reference to its usefulness as a first line pharmacological treatment of BPH.<br />

This innovative and interactive programme will include a review of the latest pooled data analysis from<br />

studies across the EU and US, highlighting the efficacy and safety of silodosin in a large patient population<br />

and in particular subpopulations.<br />

It will look at the ‘real life profile’ of a patient with BPH with a presentation emphasizing the appropriate<br />

clinical management of patients presenting with symptoms of LUTS/BPH. The faculty will also present<br />

interactive clinical cases and the audience will be encouraged to participate in the discussions around<br />

appropriate management of these patients.<br />

Sponsored by RECORDATI


Sunday, 17 March<br />

Sponsored Session<br />

17.45 - 19.15 Focal therapy in localised prostate cancer<br />

Amber Hall 7-8 - Level S2<br />

Symposium<br />

Chair: C. Stief, Munich (DE)<br />

Guest of honour<br />

P. Palma, Campinas (BR)<br />

Welcome and opening remarks<br />

C. Stief, Munich (DE)<br />

Mechanism of action<br />

H.G. Van Der Poel, Amsterdam (NL)<br />

Phase II studies meta-analysis (safety, efficacy and quality of life)<br />

J. Rassweiler, Heilbronn (DE)<br />

4 years results of the phase II studies/Retreatments (no loss of chance)<br />

E. Barret, Paris (FR)<br />

European phase III trial update<br />

A.R. Azzouzi, Angers (FR)<br />

Focal therapy for prostate cancer ‘a new paradigm’<br />

E. Solsona, Valencia (ES)<br />

Questions/answers and panel discussion<br />

Aims and objectives<br />

The current choice for men with localized prostate cancer is either radical therapy or active surveillance.<br />

In the last decade a new therapeutic approach, aiming at the focal treatment of the cancer, has gained<br />

increasing use.<br />

TOOKAD ® Soluble Vascular Targeted Photodynamic (VTP) therapy is a novel focal therapeutic modality that<br />

enables the occlusion of the entire tumor vasculature in a few minutes of treatment, which results in the<br />

necrosis of the prostatic tumor.<br />

During this symposium, participants will hear new information regarding this new molecule: TOOKAD®<br />

Soluble, gain a good understanding of the mechanism of action, efficacy, safety and tolerability of the<br />

product, and will receive updated information on the ongoing European Phase III study.<br />

Sponsored by STEBA BIOTECH<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

417<br />

Sponsored Sessions


Sponsored Sessions<br />

Monday, 18 March<br />

418 <strong>Programme</strong> <strong>Book</strong><br />

Sponsored Session<br />

17.45 - 19.15 Urinary incontinence - Optimising the patient experience and<br />

improving outcomes<br />

Amber Hall 6 - Level S2<br />

Workshop<br />

Chair: K.P. Jünemann, Kiel (DE)<br />

Introduction and welcome<br />

K.P. Jünemann, Kiel (DE)<br />

Injecting with DIGNITY in the long term<br />

F.R. Cruz, Porto (PT)<br />

Injecting tips for managing urinary incontinence with botulinum toxin type A<br />

M. Spinelli, Milan (IT)<br />

Injecting with botulinum toxin type A in the bladder and BoNee® needle - Patient case video<br />

K.P. Jünemann, Kiel (DE)<br />

Injecting to improve patient outcomes - Standardisation of the procedure<br />

G. Karsenty, Marseille (FR)<br />

Chair summary and close<br />

K.P. Jünemann, Kiel (DE)<br />

Aims and objectives<br />

• Provide an update and review the DIGNITY long-term extension study data<br />

• Presentations of practical guidance on the use of botulinum toxin type A for neurogenic detrusor overactivity<br />

(NDO) in clinical practice<br />

• Demonstration, via a pre-filmed injection video, of botulinum toxin type A injection procedure in the<br />

bladder<br />

• Discussions on standardising the injection technique, including appropriate needle selection, in order to<br />

improve outcomes<br />

Sponsored by ALLERGAN and PORGÈS, a COLOPLAST division


Monday, 18 March<br />

Sponsored Session<br />

17.45 - 19.15 Interactive debate: How seriously should I take male LUTS?<br />

Silver Hall - Level N2<br />

Symposium<br />

Chair: K-D. Sievert, Tübingen (DE)<br />

Introduction<br />

K-D. Sievert, Tübingen (DE)<br />

Entertaining debate on male LUTS, covering topics you are confronted with in daily clinical practice, such as<br />

quality of life impairment, changing regulations and EU budget cuts<br />

P. Dixon, London (GB)<br />

M.J. Drake, Bristol (GB)<br />

R. Elliott, Nottingham (GB)<br />

R. Bergstrom, Brussels (BE)<br />

Aims and objectives<br />

• Are you still not interested in a condition that affects most men at some point in life?<br />

• Do you want to be part of something completely different?<br />

• Do you enjoy when evidence is challenged in a dynamic way?<br />

Then join this debate on male LUTS, covering topics you are confronted with in daily clinical practice.<br />

Don’t miss the interactive and provocative keynote from Patrick Dixon, futurist and top stand-up moderator,<br />

proven to tell a good story!. It will change your view on male LUTS.<br />

Enjoy the debate “LUTS/BPH is an unimportant medical condition and no-one cares about it. Why should it<br />

be reimbursed?” where Patrick Dixon will challenge the faculty of 2 urologists, a health economics expert<br />

and the Director General of the EFPIA about issues such as changes in priorities of government budgets for<br />

spending on LUTS.<br />

Sponsored by ASTELLAS<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

419<br />

Sponsored Sessions


Sponsored Sessions<br />

Monday, 18 March<br />

420 <strong>Programme</strong> <strong>Book</strong><br />

Sponsored Session<br />

17.45 - 19.15 New data on androgen deprivation with a GnRH antagonist:<br />

Improving patient outcomes in prostate cancer<br />

Yellow Hall 1-2-3 - Level N1<br />

Symposium<br />

Chairs: T.M. De Reijke, Amsterdam (NL)<br />

Welcome and introduction<br />

T.M. De Reijke, Amsterdam (NL)<br />

Radiotherapy with androgen deprivation: A combined approach to improve outcomes<br />

T. Wiegel, Ulm (DE)<br />

Is intermittent androgen deprivation really equivalent to continuous therapy?<br />

I.J. De Jong, Groningen (NL)<br />

Disease control: Comparative data from degarelix vs LHRH agonists<br />

T.M. De Reijke, Amsterdam (NL)<br />

Cardiovascular risk and ADT: New data, new insights<br />

P.C. Albertsen, Farmington (US)<br />

Panel discussion and concluding remarks<br />

T.M. De Reijke, Amsterdam (NL)<br />

Aims and objectives<br />

To present the latest data on androgen deprivation therapy for prostate cancer, in a clinically meaningful way<br />

that will facilitate improved patient care<br />

Sponsored by FERRING PHARMACEUTICALS


Monday, 18 March<br />

Sponsored Session<br />

17.45 - 19.15 Castration-resistant prostate cancer in <strong>2013</strong>: Analysing the good, the<br />

bad and the ugly<br />

Red Hall 2 - Level N1<br />

Symposium<br />

Chairs: K. Miller, Berlin (DE)<br />

Welcome and introduction<br />

K. Miller, Berlin (DE)<br />

Making the most of the multidisciplinary team for castration-resistant prostate cancer (CRPC)<br />

S. Joniau, Leuven (BE)<br />

New treatment options for metastatic CRPC<br />

J. Bellmunt, Barcelona (ES)<br />

Questions & answers<br />

Bone metastases: A defining feature of clinical course in CRPC<br />

K. Miller, Berlin (DE)<br />

Bone-targeted therapy: A new era<br />

K. Fizazi, Villejuif (FR)<br />

Interactive faculty panel discussion<br />

Concluding remarks<br />

K. Miller, Berlin (DE)<br />

Aims and objectives<br />

Target audience<br />

This educational activity is appropriate for urologists, radiation oncologists, clinical oncologists, medical<br />

oncologists, and other healthcare professionals interested in the treatment of patients with castrationresistant<br />

prostate cancer (CRPC). The goal of this educational activity is to improve participants’ ability to<br />

provide optimal medical care for patients with CRPC.<br />

Learning objectives<br />

At the conclusion of this activity, participants should be able to:<br />

• Evaluate strategies for effectively collaborating in a multidisciplinary team when managing patients with<br />

castration-resistant prostate cancer (CRPC)<br />

• Select optimal second-line therapies for patients with docetaxel-resistant CRPC<br />

• Employ best practices when managing bone metastases in men with CRPC<br />

• Integrate novel bone-directed therapies and approaches when treating men with CRPC<br />

Sponsored by PRIME ONCOLOGY<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

421<br />

Sponsored Sessions


A new vision to understanding medicine<br />

Handbook of<br />

Clinical Gender<br />

Medicine<br />

Editors<br />

Karin Schenck-Gustafsson, Stockholm<br />

Paula R. DeCola; Donald W. Pfaff , New York, N.Y.<br />

David S. Pisetsky, Durham, N.C.<br />

In well-referenced chapters, experts cogently and concisely explain how the incorporation<br />

of gender issues into research can affect the medical understanding and treatment<br />

of heart disease, osteoporosis, arthritis, pain as well as malaria among other conditions.<br />

This intriguing and unique medical textbook provides readers with a valuable new perspective<br />

on how to incorporate gender issues into the different branches of medicine.<br />

• Pay-per-View and Subscriber<br />

• Access to Full Text<br />

• Full Table of Contents<br />

• Full Editorial Board<br />

• Free Abstracts and Selected Articles<br />

• Online Sample Issue<br />

• Submission/Guidelines for Authors<br />

• Subscription Details<br />

• Free Alert Service<br />

• Online Library Recommendation<br />

S. Karger AG, P.O. Box<br />

CH–4009 Basel<br />

(Switzerland)<br />

Fax. +41 61 306 12 34<br />

E-Mail orders@karger.com<br />

www.karger.com<br />

ATCCAATGATAAGCATCACGGTAT ATCCAATGATAAGCATGATAAGCTCACGGTATCCAA AATGATAAGCATCA<br />

GCATGATAAGCTCACGGTATCCAAT ATGATAAGCATCACGGTATCCAATGATAAGCATGAT ATAAGCTCACGGT<br />

GCATCACGGTATCCAATGATAAGCATGATAAGCGT<br />

G ATCCAATGATAAGCATCACGGTATCC CCAATGATAAG<br />

GTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCCACGGTATCCAATGA GATAAGCATC<br />

ATAAGCATGATAAGCTCACGGTATCCAATG TGATAAGCATCACGGTATCCAATGATAAGCATGATA TAAGCTCA<br />

GCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATC TCCAATG<br />

GCTCACGGTATCCAATGATAAGCATCACGGTAT ATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGA<br />

ATCCAATGATAAGCATGATAAGCTCACGGTATCCA CAATGATAAGCATCACGGTATCCAATGATAAGCAT ATGA<br />

AATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCA<br />

A CGGTATCCAATGATAAGCATCACGG GGT<br />

GCATGATAAGCTCACGGTATCCAATGATAAGCATCAC ACGGTATCCAATGATAAGCATGATAAGCTCACGGT<br />

GCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATG<br />

GCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGA GATAAGCATGATAAGCTCACGGTATCAGCATG<br />

ATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATA TAAGCTCACGGTATCCAATGATAAGCATCAC<br />

GCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATC TCCAATGATAAGCATGATAAGCTCACGGT<br />

GCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAG<br />

A CATCACGGTATCCAATG<br />

GCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCA CATGATAAGTCACGGTATCCAATGAT<br />

ATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCA CACGGTATCCAATGATAAGCATGAT<br />

AATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTA TATCCAATGATAAGCATCACGGT<br />

GCATGATAAGCCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAA TAAGCATGATAAGCTCACGGTA<br />

GCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAA AAGCATCACGGTATCCAATG<br />

GCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAG AGCTCACGGTATCCAATGA<br />

ATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATC TCCAATGATAAGCATGA<br />

AATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATG TGATAAGCATCACGGT<br />

GCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGA GATAAGCTCACGGT<br />

GCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCAC ACGGTATCCAATG<br />

GCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGA<br />

ATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGAT ATAAGCATGA<br />

A<br />

AATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCAT ATCACGGT<br />

GCATGATAAGCGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGT GTATCCA<br />

GTATCCAATGATAAGCATGATAAGCCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGC GCATG<br />

ATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCAT ATCA<br />

GCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGT<br />

GCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATG<br />

GCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGA<br />

TCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGA<br />

GCATCACGGTATCC<br />

GCATCACGGTATCC<br />

TGA GA<br />

AATGATAAGCATCACGGTATCCAATGATAAG<br />

CACGGTATCCAATG<br />

CACGGTATCCAATG<br />

GGT GGT<br />

GCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGT<br />

GCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATG<br />

GCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGA<br />

TCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGA<br />

AATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGT<br />

GCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGTCACGGTA<br />

GCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATG<br />

GCCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGAT<br />

TCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGA<br />

AAGCATGAT<br />

AGCATGAT<br />

ATCCAATGATAAG<br />

ATCCAATGATA TAAG<br />

CAATGATA<br />

CAATGATAA<br />

AATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGT<br />

ATCACGGT<br />

GCATGATAAGCTC<br />

GCATGATAAGCTC<br />

TGATAAGC<br />

TGATAAGC<br />

GCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGT<br />

GCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAAT<br />

CATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATG<br />

GCATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTA<br />

GCATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTAT<br />

ATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCA<br />

GTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCAT<br />

AATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGAT<br />

ATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGAT<br />

TCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCA<br />

TGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAA<br />

TGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAA<br />

GCATGATAAGCTCACGGTATCCAATGATAAGCATCACCGGTATCCAATGATAAGCATGATAAGCTCACGGT<br />

CGGTATCCAATGATAAGCATGATAA CTCACGGT<br />

GCATCACGGTATCCAATGATAAGCATGATAAGCGTATTCCAATGATAAGCATCACGGTATCCAATGATAAG<br />

CCAATGA AAGCATCACGGTAT CAATGATAAG<br />

GTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCCACGGTATCCAATGATAAGCATC<br />

ATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCA<br />

GCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGAGTATCCAAT<br />

GCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGA<br />

ATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGA<br />

AATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGT<br />

GCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGT<br />

GCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATG<br />

GCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCAGCATG<br />

Handbook of<br />

Clinical Gender<br />

Medicine<br />

Editors<br />

Karin Schenck-Gustafsson<br />

Paula R. DeCola<br />

Donald W. Pfaff<br />

David S. Pisetsky<br />

ACGG ACGGT ACGGT ACGGT ACGG ACGGT ACGGT ACGG AC ACG CG CG TATCCAAT TGA GA GA GAT GAT GAT GAT GAT GAT GAT ATAA AA AA AAG AA AA AA AA AA AAAG<br />

GCA<br />

ACGG ACGG ACG ACGG ACG ACGG ACGG ACG ACGG ACGG ACGG ACG ACG ACG ACG A GGT<br />

GTTATCCA ATCCA ATCCA ATCCA ATCCA ATCCA ATCCA ATCCA TCCA TCCA TCCA TCCA CCA CCA CCAATGATAAG<br />

AAAAAAAAA GCA GCA GCA GCA GCA GCATG CCA<br />

CA CA CA CA CATG<br />

TG TGA TGA TGAT TGA TG TGA TGA TGA TG GG<br />

TAAAG<br />

ATCACGGTGT<br />

AGCATTCACGGTAT AAAAAAACCCCCGG CCGG GGG GG ATCCAATGATA<br />

CCA CAAAAAAAAAAAT AT A<br />

AGCAT AG CACGGTATCCAATGATAAGCATGATAAG<br />

TATCCCAATGATA<br />

XVI + 522 p., 62 fig., 4 in color, 63 tab.,soft cover, 2012<br />

CHF 69.– / EUR 51.– / USD 69.00<br />

ISBN 978–3–8055–9929–0, e-ISBN 978–3–8055–9930–6<br />

Prices subject to change<br />

EUR price for Germany, USD price for USA only<br />

More information and sample essays at:<br />

www.karger.com/Gender_Medicine<br />

An independent international forum for clinically oriented research<br />

Editors<br />

M.P. Wirth, Dresden<br />

M. Porena, Perugia<br />

O.W. Hakenberg, Rostock<br />

D. Castro-Diaz,<br />

Santa Cruz de Tenerife<br />

B. Wullich, Erlangen<br />

More information at:<br />

www.karger.com/uin<br />

Deutsche Gesellschaft für Urologie<br />

KI13635


<strong>EAU</strong> Membership<br />

What are benefits of being<br />

a member of the European<br />

Association of Urology?<br />

<strong>EAU</strong> Members benefit from many advantages:<br />

Publications<br />

• European Urology, the official scientific <strong>EAU</strong><br />

journal (12 issues per year, plus all published<br />

supplements).<br />

• European Urology Today, the official <strong>EAU</strong><br />

newsletter (6 issues each year). This publication<br />

aims at distributing information about the<br />

Association and about European urology in the<br />

broadest sense.<br />

• European Urology Video Journal, a quarterly<br />

published DVD aiming to distribute the best<br />

information on urological diseases and techniques.<br />

• The <strong>EAU</strong> Urology Updates, an educational<br />

publication, quarterly published as a<br />

supplement of European Urology.<br />

• <strong>EAU</strong> Guidelines, a extensive series of guidelines<br />

on many urological diseases produced by<br />

the <strong>EAU</strong> Health Care Office.<br />

• Historia Urologiae Europaeae (one volume<br />

each year on European historical subjects).<br />

• Uroweb, the official <strong>EAU</strong> website, on which<br />

members have access to all different activities<br />

and programmes, such as slide library,<br />

European Urology on-line, webcasts of the<br />

congresses, on-line ESU courses etc.<br />

<strong>EAU</strong> Congress and Meetings<br />

<strong>EAU</strong> Members will receive regular information on the<br />

Annual <strong>EAU</strong> Congress, as well as the<br />

meetings organised by the different <strong>EAU</strong> Sections, the<br />

<strong>EAU</strong> Education Office and the <strong>EAU</strong> Regional Office.<br />

Moreover, members will be able to receive a considerable<br />

discount on the registration fees of all <strong>EAU</strong> related<br />

meetings and events.<br />

<strong>EAU</strong> Education <strong>Programme</strong><br />

<strong>EAU</strong> Members will receive regular information on all<br />

the activities organised by the European School of<br />

Urology, the <strong>EAU</strong> Office of Education. Members will<br />

be able to participate in the post-graduate teaching<br />

activities at reduced registration fees. <strong>EAU</strong> Members<br />

are also entitled to apply for the European Urological<br />

Scholarship <strong>Programme</strong>, which provides grants and<br />

organises clinical fellowships, short term visits and<br />

scholarship programmes.<br />

EU-ACME <strong>Programme</strong><br />

Active, Active International, Junior and Junior<br />

International member of the <strong>EAU</strong> will be automatically<br />

participating in the European Urology - Accredited<br />

Continuing Medical Education (EU-ACME) <strong>Programme</strong>.<br />

The EU-ACME <strong>Programme</strong> is based on the EBU/UEMS<br />

rules and its primary task is the implementation,<br />

promotion and organisation of Continual Medical<br />

Education (CME) among European Urologists. It provides<br />

the urologists with the system which helps them<br />

to keep track of their educational activities, irrespective<br />

of the country they practice in or where they have<br />

participated in CME and/or CPD activities. For more<br />

information see also page 46 and 47.<br />

So if you are not yet an <strong>EAU</strong> member, make certain to<br />

become one in Milan and visit the <strong>EAU</strong> Booth H17 in<br />

the exibition on level S0.<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

423<br />

About <strong>EAU</strong>


About <strong>EAU</strong><br />

<strong>EAU</strong> Offices<br />

<strong>EAU</strong> Board<br />

Executive Committee<br />

Secretary General<br />

P-A. Abrahamsson, Malmö (SE)<br />

Adjunct Secretary General<br />

Executive Member related to Science<br />

W. Artibani, Verona (IT)<br />

Adjunct Secretary General<br />

Executive Member related to<br />

Education<br />

H. Van Poppel, Leuven (BE)<br />

Treasurer and Executive Member<br />

related to Communication<br />

M. Wirth, Dresden (DE)<br />

Board Members<br />

C. Chapple, Sheffield (GB)<br />

B. Djavan, Vienna (AT)<br />

T. Esen, Istanbul (TR)<br />

D. Jacqmin, Strasbourg (FR)<br />

I. Korneyev, St. Petersburg (RU)<br />

L. Martínez-Piñeiro, Madrid (ES)<br />

V. Mirone, Naples (IT)<br />

R. Nijman, Groningen (NL)<br />

J. Palou, Barcelona (ES)<br />

K. Parsons, Liverpool (GB)<br />

D. Schultheiss, Giessen (DE)<br />

A. Stenzl, Tübingen (DE)<br />

Offices related to education<br />

<strong>EAU</strong> Education Office (ESU)<br />

Chairman<br />

J. Palou, Barcelona (ES)<br />

Members<br />

M. Babjuk, Prague (CZ)<br />

M. Drake, Bristol (GB)<br />

M. Kuczyk, Hanover (DE)<br />

E. Liatsikos, Patras (GR)<br />

O. Traxer, Paris (FR)<br />

H. Van Der Poel, Amsterdam (NL)<br />

J. Van Moorselaar, Amsterdam (NL)<br />

Consultant<br />

D. Pushkar, Moscow (RU)<br />

424 <strong>Programme</strong> <strong>Book</strong><br />

Ex-officio Members<br />

L. Martínez-Piñeiro, Madrid (ES)<br />

A. Mottrie, Aalst (BE)<br />

H. Van Poppel, Leuven (BE)<br />

EU-ACME Office<br />

Chairman<br />

R. Nijman, Groningen (NL)<br />

Members<br />

M. Brehmer, Stockholm (SE)<br />

A. Figueiredo, Coimbra (PT)<br />

S. Müller, Bonn (DE)<br />

P. Nyirády, Budapest (HU)<br />

J. Palou, Barcelona (ES)<br />

H. Van Poppel, Leuven (BE)<br />

Ex-officio Member<br />

P-A. Abrahamsson, Malmö (SE)<br />

European Urological Scholarship<br />

<strong>Programme</strong> Office<br />

Chairman<br />

V. Mirone, Naples (IT)<br />

Past Chairman<br />

C-C. Abbou, Creteil (FR)<br />

Members<br />

T. Borkowski, Warsaw (PL)<br />

M. Burchardt, Greifswald (DE)<br />

M. Ribal, Barcelona (ES)<br />

J. Witjes, Nijmegen (NL)<br />

Ex-officio Members<br />

S. Larré, Reims (FR)<br />

L. Martínez-Piñeiro, Madrid (ES)<br />

J. Schalken, Nijmegen (NL)<br />

H. Van Poppel, Leuven (BE)<br />

Guidelines Office<br />

Chairman<br />

K. Parsons, Liverpool (GB)<br />

Members<br />

M. Fall, Gotenborg (SE)<br />

J. Irani, Poitiers (FR)<br />

C. Llorente, Madrid (ES)<br />

J. N’Dow, Aberdeen (GB)<br />

R. Sylvester, Brussels (BE)<br />

Ex-officio Member<br />

H. Van Poppel, Leuven (BE)<br />

Young Urologists Office<br />

Chairman<br />

T. Esen, Istanbul (TR)<br />

Chair Italian Resident Organisation<br />

G. Patruno, Rome (IT)<br />

Chair UK Resident Organisation<br />

B. Grey, Salford (GB)<br />

Chair French Resident Organisation<br />

J-E. Terrier, Lyon (FR)<br />

Chair Turkish Resident Organisation<br />

O. Ergün, Isparta (TR)<br />

Chair German Resident Organisation<br />

S. Schöne, Neustadt an der<br />

Weinstrasse (DE)<br />

Chair Spanish Resident Organisation<br />

A. Vilaseca Cabo, Barcelona (ES)<br />

ESRU Secretary<br />

G. Martinez, Koper (SL)<br />

ESRU Chair<br />

Z. Tando˘gdu, Istanbul (TR)<br />

ESRU Chair Elect<br />

C. Ruf, Hamburg (DE)<br />

Young Academic Urologists<br />

S. Larré, Reims (FR)<br />

F. Sanguedolce, Barcelona (ES)<br />

M. Sedelaar, Nijmegen (NL)<br />

Ex-officio Member<br />

H. Van Poppel, Leuven (BE)<br />

Offices related to science<br />

Regional Office<br />

Chairman<br />

B. Djavan, Vienna (AT)


Scientific Congress Office<br />

Chairman<br />

A. Stenzl, Tübingen (DE)<br />

Members<br />

A. Alcaraz, Barcelona (ES)<br />

C. Bangma, Rotterdam (NL)<br />

A. Briganti, Milan (IT)<br />

F. Burkhard, Berne (CH)<br />

X. Cathelineau, Paris (FR)<br />

J. Catto, Sheffield (GB)<br />

Z. Culig, Innsbruck (AT)<br />

A. De La Taille, Creteil (FR)<br />

D. De Ridder, Leuven (BE)<br />

W. Feitz, Nijmegen (NL)<br />

G. Janetschek, Salzburg (AT)<br />

S. Michel, Mannheim (DE)<br />

P. Radziszewski, Warsaw (PL)<br />

J. Sønksen, Herlev (DK)<br />

B. Tombal, Brussels (BE)<br />

Consultant<br />

M. De Santis, Vienna (AT)<br />

Ex-officio Members<br />

P-A. Abrahamsson, Malmö (SE)<br />

W. Artibani, Verona (IT)<br />

B. Djavan, Vienna (AT)<br />

L. Martínez-Piñeiro, Madrid (ES)<br />

F. Montorsi, Milan (IT)<br />

J. Palou, Barcelona (ES)<br />

K. Parsons, Liverpool (GB)<br />

H. Van Poppel, Leuven (BE)<br />

M. Wirth, Dresden (DE)<br />

Video Congress Committee<br />

Chairman<br />

A. Messas, Nanterre (FR)<br />

Members<br />

A. Carbone, Latina (IT)<br />

I. De Jong, Groningen (NL)<br />

P. Geavlete, Bucharest (RO)<br />

F. Van Der Aa, Leuven (BE)<br />

Section Office<br />

Chairman<br />

L. Martínez-Piñeiro, Madrid (ES)<br />

Chairmen Sections<br />

ERUS: A. Mottrie, Aalst (BE)<br />

ESAU: W. Weidner,<br />

Giessen (DE)<br />

ESFFU: J. Heesakkers,<br />

Nijmegen (NL)<br />

ESGURS: S. Deger,<br />

Ostfildern (DE)<br />

ESIU: T. Bjerklund Johansen,<br />

Århus (DK)<br />

ESOU: M. Brausi, Modena (IT)<br />

ESTU: A. Figueiredo,<br />

Coimbra (PT)<br />

ESUI: J. Walz, Marseille (FR)<br />

ESUP: A. Lopez-Beltran,<br />

Cordoba (ES)<br />

ESUR: Z. Culig, Innsbruck (AT)<br />

ESUT: J. Rassweiler,<br />

Heilbronn (DE)<br />

EULIS: P. Osther,<br />

Fredericia (DK)<br />

Offices related to communication<br />

History Office<br />

Chairman<br />

D. Schultheiss, Giessen (DE)<br />

Members<br />

C. Alamanis, Athens (GR)<br />

J. Elo, Helsinki (FI)<br />

R. Engel, Baltimore (US)<br />

L. Fariña-Pérez, Vigo (ES)<br />

J. Felderhof, Hoofddorp (NL)<br />

P. Figdor, Vienna (AT)<br />

A. Figueiredo, Coimbra (PT)<br />

A. Jardin, Paris (FR)<br />

J. Mattelaer, Kortrijk (BE)<br />

S. Musitelli, Milan (IT)<br />

P. Rathert, Düren (DE)<br />

I. Romics, Budapest (HU)<br />

M. Skopec, Vienna (AT)<br />

R. Sosnowski, Warsaw (PL)<br />

P. Thompson, London (GB)<br />

A. Verit, San Liurfa (TR)<br />

Offices related to governance<br />

International Relations Office<br />

Chairman<br />

C. Chapple, Sheffield (GB)<br />

Consultants<br />

F. Cruz, Porto (PT)<br />

C. Llorente, Madrid (ES)<br />

M. Marberger, Vienna (AT)<br />

A. Patel, London (GB)<br />

J. Thüroff, Mainz (DE)<br />

Ex-Officio Members<br />

P-A. Abrahamsson, Malmö (SE)<br />

W. Artibani, Verona (IT)<br />

H. Van Poppel, Leuven (BE)<br />

M. Wirth, Dresden (DE)<br />

Membership Office<br />

Chairman<br />

I. Korneyev, St. Petersburg (RU)<br />

Strategy Planning Office<br />

Chairman<br />

D. Jacqmin, Strasbourg (FR)<br />

Members<br />

M. Brausi, Modena (IT)<br />

S. Buntrock, Bad Wildungen (DE)<br />

B. Malavaud, Toulouse (FR)<br />

H. Hashim, Bristol (GB)<br />

C. Surcel, Bucharest (RO)<br />

H-G. Tiselius, Stockholm (SE)<br />

Ex-officio Member<br />

P-A. Abrahamsson, Malmö (SE)<br />

Search & Nomination Committee<br />

2012/<strong>2013</strong><br />

Chairman<br />

P-A. Abrahamsson, Malmö (SE)<br />

Members<br />

R. Ackermann, Düsseldorf (DE)<br />

W. Artibani, Verona (IT)<br />

C. Chapple, Sheffield (GB)<br />

D. Jacqmin, Strasbourg (FR)<br />

M. Wirth, Dresden (DE)<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

425<br />

About <strong>EAU</strong>


About <strong>EAU</strong><br />

Additional<br />

<strong>EAU</strong> Foundation for Urological<br />

Research<br />

Chairman<br />

P. Mulders, Nijmegen (NL)<br />

Members<br />

T. Bjerklund Johansen, Århus (DK)<br />

M. Colombel, Lyon (FR)<br />

A. Patel, London (GB)<br />

A. Tubaro, Rome (IT)<br />

B. Watson, Dublin (IE)<br />

W. Witjes, Arnhem (NL)<br />

Ex-Officio Member<br />

V. Mirone, Napels (IT)<br />

Academy of Urology<br />

Chairman<br />

R. Ackermann, Düsseldorf (DE)<br />

Members<br />

P. Alken, Mannheim (DE)<br />

L. Boccon-Gibod, Paris (FR)<br />

A. Borkowski, Warsaw (PL)<br />

F. Debruyne, Arnhem (NL)<br />

P. Ekman, Stockholm (SE)<br />

U. Jonas, Hanover (DE)<br />

U. Studer, Berne (CH)<br />

P. Van Cangh, Brussels (BE)<br />

R. Vela Navarrete, Madrid (ES)<br />

European Urology<br />

Official journal of the <strong>EAU</strong><br />

Editor in chief<br />

F. Montorsi, Milan (IT)<br />

426 <strong>Programme</strong> <strong>Book</strong>


Historical Overview <strong>EAU</strong> Congresses<br />

1974 12-14 September Padua, Italy<br />

1976 24-26 September Prague, Czech Republic<br />

1978 14-16 June Monte Carlo, Monaco<br />

1980 21-30 May Athens, Greece<br />

1982 12-15 May Vienna, Austria<br />

1984 23-26 May Copenhagen, Denmark<br />

1986 26-28 June Budapest, Hungary<br />

1988 18-21 May London, United Kingdom<br />

1990 10-16 June Amsterdam, The Netherlands<br />

1992 22-25 July Genoa, Italy<br />

1994 13-16 July Berlin, Germany<br />

1996 1-4 September Paris, France<br />

1998 21-25 March Barcelona, Spain<br />

1999 7-10 April Stockholm, Sweden<br />

2000 12-15 April Brussels, Belgium<br />

2001 7-10 April Geneva, Switzerland<br />

2002 23-26 February Birmingham, United Kingdom<br />

2003 12-15 March Madrid, Spain<br />

2004 24-27 March Vienna, Austria<br />

2005 16-19 March Istanbul, Turkey<br />

2006 5-8 April Paris, France<br />

2007 21-24 March Berlin, Germany<br />

2008 26-29 March Milan, Italy<br />

2009 17-21 March Stockholm, Sweden<br />

2010 16-20 April Barcelona, Spain<br />

2011 18-22 March Vienna, Austria<br />

2012 24-28 February Paris, France<br />

<strong>2013</strong> 15-19 March Milan, Italy<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

427<br />

About <strong>EAU</strong>


Join the European Association of<br />

Urology, become a member,<br />

get involved!<br />

The <strong>EAU</strong> is the voice of European urologists, a non-profit<br />

scientific organisation dedicated to serving their members<br />

and representing their professional interests!<br />

Learn about the many benefits of being a member of the<br />

European Association of Urology.<br />

Free subscriptions to:<br />

• <strong>EAU</strong> Scientific Journal: European Urology,<br />

Supplements, <strong>EAU</strong>-EBU Update Series<br />

• <strong>EAU</strong><br />

• Historia<br />

• <strong>EAU</strong><br />

• European<br />

• Member<br />

• Registration<br />

• <strong>EAU</strong><br />

Newsletter: European Urology Today<br />

Urologiae Europaeae<br />

Guidelines<br />

Urology Video Journal<br />

discounts on <strong>EAU</strong> products and services<br />

benefits for <strong>EAU</strong> meetings<br />

ID Card for automatic registration of<br />

EU-ACME credit points<br />

The <strong>EAU</strong> has a number of membership categories catering<br />

to all professionals involved in the speciality of urology.<br />

We invite you to become a member today!<br />

www.uroweb.org


Abstract authors<br />

A<br />

Aaltonen K. 1029<br />

Aaronson N.K. 239<br />

Abad C. 229<br />

Abascal R. 229<br />

Abassi Z. 202<br />

Abbas M. 198<br />

Abbona A.M. 130<br />

Abbou C-C. 716, 753, V15<br />

Abboudi H. 14<br />

Abd-Alazeez M.A 218<br />

Abdalla A. 836<br />

Abdel Naeim M.A.A. 788<br />

Abdel-Hakim A.M. 536<br />

Abdel-Karim A. 537, 552<br />

Abdel-Latif M. 1038<br />

Abdelbaky A.M. 865<br />

Abdelbary A. 668<br />

Abdelhafez M.F. 812, 964<br />

Abdelrahim M. 1038<br />

Abdo A. 175, 178, 233, 262, 534,<br />

820, 956, 1024<br />

Abdollah F. 140, 179, 185, 187, 289,<br />

474, 686, 687, 693, 694, 695,<br />

714, 806, 953<br />

Abdul-Muhsin H. 18, 299, 689,<br />

1013, V10, V13<br />

Abdulhak A. V16<br />

Abe T. 931<br />

Abl-Azzeez M. 717<br />

Abo-Elenen M. 214<br />

Abol Enein H. 1038, 1069<br />

Abolfotoh A. 537<br />

Abou Hashem S.E. 836<br />

Aboumarzouk O. 370, 599<br />

Abrams P. 737<br />

Abramyan K.N. 115<br />

Abrate A. 583, 831, 832<br />

Abroaf A. 781<br />

Abt D. 310<br />

Aburatani H. 764<br />

Acar I.C. 291<br />

Adam G. 359<br />

Adam M. 293, 920, 1006<br />

Adamowicz J.A. 869<br />

Adanur S. 417, 616<br />

Addali M. V16<br />

Adding C. 1035<br />

Adot Zurbano J.M. 888<br />

Adsan Ö. 111, 794<br />

Afandiyev F. 527<br />

Afoko A.A. 212<br />

Afshar-Oromieh A. 227<br />

Agarwal N. 1107<br />

Agarwal P.K. 1031, 1032<br />

Agarwal V. 1027<br />

Agelidou M. 423<br />

Aggamy M. 668<br />

Agra C. 606, 607<br />

Agrawal S. 600<br />

Agreda F. 6, 682<br />

Agresta T.S. 525<br />

Agudelo J.A. V36, V39<br />

Aguiar S. 557<br />

Aguilera A. 498<br />

Ahallal P. 883<br />

Ahallal Y. 352, V48<br />

Ahmad S. 599<br />

Ahmadi H. 220<br />

Ahmed H.U. 218, 353, 584, 585<br />

Ahmed H. 717<br />

Ahmed K. 14, 19, 20, 1031, 1032<br />

Ahn H. 80, 196, 466, 469, 478, 771,<br />

807, 1005, 1010, 1097<br />

Ahn H.S. 460<br />

Ahn J.H. 691<br />

Ahn T.Y. 410<br />

Aho T.F. 952<br />

Ahyai S.A. 866, 990, 1002, 1004<br />

Aikawa K. 446<br />

Aillet G. 472<br />

Aisain I. 595<br />

Aitken E. 374, 377, 495<br />

Aizawa N. 64, 67<br />

Akagashi K. 121<br />

Akbarov I.A. 624<br />

Akduman B. 128<br />

Aki F.T. 643<br />

Akihama S.A. 610, 1100<br />

Akihiro K. 59<br />

Akino T. 931<br />

Akita H. 818<br />

Aksenov A.V. 188, 358<br />

Aksoy Y. 417<br />

Akyurek E. 128<br />

Al Mahmid M. 890<br />

Al Qahtani S.M. 432<br />

Al Wadaani H. 420<br />

Al-Ahmadie H.A. 749<br />

Al-Bulushi Y. 72, 514<br />

Al-Matar B. 812<br />

Al-Qahtani S.M. 366<br />

Al-Salam S. 609<br />

Al-Shukri S.K. 667<br />

Al-Zahrani A. 1050<br />

Alam Z. 530<br />

Alamanis C. 41<br />

Alarcon R. 1068<br />

Albanesi L. 486<br />

Albei C. 405<br />

Albersen M. 252, 324, 326, 327, 328<br />

Alberts A.R. 688<br />

Albertsen P. 677<br />

Albisinni S. 800<br />

Alcaraz A. 34, 206, 208, 236, 237,<br />

313, 378, 383, 436, 489, 491,<br />

494, 496, 498, 595, 639, 993<br />

Aldahshoury M. 528<br />

Aldayel A. 668<br />

Aldridge P. 623<br />

Alekseev B.Y. V43<br />

Alemozaffar M. V12<br />

Alessandria E. 376, 431, 1066, 1071<br />

Alexander C.E. 523<br />

Alexandre L. 449, 900<br />

Algaba F. 281, 287<br />

Ali A.S.M. 623<br />

Ali Z. 44<br />

Ali-El-Dein B. 822, 934<br />

Alibhai S.M. 886<br />

Alipanah R. 598<br />

Alivizatos G. 521<br />

Aljabery F. 481<br />

Allasia M. 95, 864<br />

Allen C. 218, 267, 584, 585, 717<br />

Allen S.E. 314<br />

Allory Y. 716, 753<br />

Alloussi S.H. 72, 514, V59<br />

Alloussi S. 72, 514<br />

Almousa R. 668<br />

Alnajjar H.M. 389<br />

Alonso Prieto M.A. V60<br />

Alonso Rodriguez D. 113<br />

Alonso Y Gregorio S. 556, 1036<br />

Alsudani M. 39<br />

Althaus P. 192<br />

Altin R. 128<br />

Numbers refer to abstract numbers<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

429<br />

Indices


Indices<br />

Abstract authors<br />

Altinkilic B. 897<br />

Alturas Silva J. 669<br />

Alumkal J.J. 100<br />

Alvarez E. 606<br />

Alvarez M. 1068<br />

Alvarez Rodríguez S. 346, 501<br />

Alvarez-Ossorio Fernandez J.L. V33<br />

Alvarez-Vijande R. 34, 313, 436,<br />

489, 494, 639<br />

Alves E.F. 30<br />

Amano M. 197<br />

Amarenco G. 401, 743<br />

Ambrose C. 910<br />

Amend B. 306, 629, 964, V54, V71<br />

Ametov R.E. 797<br />

Ameye F. 360<br />

Amiel J. 1059<br />

Amin M. 287<br />

Ammi M. 87, 778, 1105<br />

Amore D. 412<br />

Amorim R.F. 895<br />

Amparore D. 204, 630, 875<br />

Amsellem-Ouazana D. 235<br />

Amón J.H. 760<br />

An J. 325<br />

Anastasio De Las Heras P. 334<br />

Anastasopoulos P. 548<br />

Anderson P. 85, 145, 704<br />

Andersson F. 405, 406<br />

Andersson K-E. 68, 443, 447, 909<br />

Ando R. 311<br />

Andres G. 524, 1030, V7<br />

Andrianov A.N. V43<br />

Angelergues A. 104<br />

Angerri O. V35<br />

Angulo J. 40, 401, 524, 760, 1030,<br />

1034, V5, V7, V8, V9<br />

Anis E. 511<br />

Ansieau J-P. 171, 176<br />

Antonelli A. 172, 259, 264, 340,<br />

499, 887<br />

Antunes Lopes T. 669, 673<br />

Anyamene N. 268<br />

Aoyagi T. 931<br />

Apostolidis A. 733<br />

Appel B. 131<br />

Arafat W. 72, 514<br />

Aragona M. 867<br />

Arai Y. 21, 720<br />

430 <strong>Programme</strong> <strong>Book</strong><br />

Arakawa S. 663<br />

Arance I. V8<br />

Arano P. 999<br />

Araujo A.B. 211<br />

Arcaniolo D. 560, 622<br />

Ardelt P. 697<br />

Arden-Close E.J. 275<br />

Arellano J. 99<br />

Arenas Da Silva L.F. 1022<br />

Arentsen H.C. 153, 700<br />

Areskoug B. 120<br />

Arfi N. 705<br />

Argirovic A. 518, 1060<br />

Argirovic D. 518, 1060<br />

Arguelles-Salido E. 804<br />

Argun B. 529<br />

Argüelles-Salido E. 917<br />

Arias E. V36, V39<br />

Arias Fúnez F. 346, 379<br />

Arima K. 978<br />

Arisawa C. 572, 819<br />

Arlandis S. 746<br />

Armitage J.N. 658<br />

Arnaud L. 245<br />

Arnoux V.A 563<br />

Aroasio E. 204<br />

Aron M. 220, V45, V79<br />

Arosio M. 692<br />

Arrabal Martin M. 312<br />

Arrabal Polo M.A. 312<br />

Arriaga J. V6<br />

Arrighi N. 499, 887<br />

Artmann A. 250, 871<br />

Artmann G.M. 250<br />

Arum C.J. 152<br />

Arumi D. 740<br />

Arver S. 211<br />

Arvin-Berod A. 283<br />

Arya M. 16, 717, 879<br />

Asakuma J. 574, 827<br />

Asano T. 57, 144, 827, 976, 977<br />

Asano T. 57, 144, 574, 827, 976, 977<br />

Ascalone L. 382, V50<br />

Ashworth D. 395<br />

Asiain I. 208<br />

Aslan Y. 615<br />

Astroza G. 653, 661, 967<br />

Atac F. 117, 163, 381<br />

Atan A. 615<br />

Ataus S. 479<br />

Atduev V. 354<br />

Ather H. 1067<br />

Atiemo H. 119<br />

Attisani F. 486, 580<br />

Attwood K. 882<br />

Audenet F. 87<br />

Audet A. 449<br />

Auerbach S.M. 739<br />

Aufderklamm S. 364, 861, 899,<br />

1049, 1054<br />

Aureli M. 146<br />

Aurelian J. 17<br />

Aurora H. 126<br />

Aus G. 808<br />

Ausmees K. 216<br />

Aussie J. 1045<br />

Austin R. 939<br />

Autenrieth M. 809<br />

Autier P. 353<br />

Autieri D. 914<br />

Autorino R. 20, 91, 255, 256, 257,<br />

552, 990, 1093, 1094, V2, V3,<br />

V22, V27, V30<br />

Autran A.M. 1020<br />

Avances C. 283<br />

Avelino A. 65<br />

Awad H. 202<br />

Awrey S. 50<br />

Axell R. 142<br />

Aydin I. 962<br />

Ayis S. 16<br />

Ayres B. 593<br />

Aytac B. 652<br />

Aziz A. 282, 286, 815<br />

Azizov I. 893<br />

Azone I. 74<br />

Azzabi F.Z. 246, 874<br />

Azzouzi A.R. 87, 778, 1105<br />

B<br />

Baba S. 21<br />

Babjuk M. 276, 575, 601, 697, 815,<br />

822<br />

Bach C. 654, 963, 1067<br />

Bach T. 636, 1067<br />

Bachke S. 152<br />

Bachmann A. 167, 461, 618, 634,<br />

945, 990, 1004<br />

Numbers refer to abstract numbers


Baco E. 221<br />

Bacsu C. 732<br />

Badalato G.M. 284<br />

Badani K.K. 1031, 1032<br />

Bader A.N. 999<br />

Badescu B.G. 384<br />

Badke A. 306<br />

Bae J.H. 445, 611<br />

Bae K-H. 535<br />

Bae W.J. 445, 611<br />

Bagrodia A. 552<br />

Bahilo P. 543<br />

Bahl A. 230<br />

Bahn D. 265<br />

Baig M.B. 530<br />

Baiocchi G. 557<br />

Baker K. 785<br />

Bakshi S. 541<br />

Balasch J. 34<br />

Balasubramanian S. 823<br />

Balbay M.D. 1031, 1032<br />

Balconi G. 583<br />

Ballanger P. 96, 763<br />

Ballesca J.L. 34<br />

Baltzer P. 345<br />

Banakhar A. 307<br />

Banchik E.L. 787<br />

Banckwitz R. 321<br />

Banfi A. 868<br />

Bangma C.H. 1, 5, 217, 680<br />

Baniel J. 697, 815<br />

Bannowsky A. 127<br />

Banyra O. 507<br />

Barbanti G. 798<br />

Barber N. 638<br />

Bardelli I. 1008<br />

Bardonnaud N. 426, 427, 429<br />

Barentsz J.O. 12, 582<br />

Barker A.T. 403<br />

Barletta D. 894<br />

Baron A. 306<br />

Barrass B.J.R. 762<br />

Barrese F. 517<br />

Barret E. 352, 589, 679, 883, 1020,<br />

V48, V64<br />

Barrett M.T. 945<br />

Barrett T. 142, 224<br />

Barry Delongchamps N. 141, 235<br />

Bartkowiak D. 192<br />

Bartoletti R. 166, 508, 509, 619,<br />

697<br />

Bartolozzi C. 1008<br />

Bartsch G. 825<br />

Bascu C. 114<br />

Baskin-Bey E. 674<br />

Bassi S. 894<br />

Bastarós J.M. 6<br />

Bastian P. 286, 686, 688, 911<br />

Bastien L. 87<br />

Baston C. 384<br />

Battaglia A. 95, 864<br />

Battaglia F. 770<br />

Battaglia M. 662<br />

Bauer C. 863<br />

Bauer R.M. 726, 999, 1004<br />

Bauer W. 1009<br />

Baukloh V. 27<br />

Baumert H. 87, 170, 171, 176,<br />

1105<br />

Baumgart S. 774<br />

Baumgartner M. 133<br />

Beatrice J. 133<br />

Beatty J. 268<br />

Bechara G.R. 29<br />

Becher E. 587<br />

Becht E. 696<br />

Beck S. 51<br />

Becker A. 175, 178, 272, 293, 685,<br />

718, 752, 820, 920, 956, 960<br />

Becker A. 844, 847, 923<br />

Becker F. 338, 703<br />

Becker T. 644<br />

Bedke J. 306, 629, 964, 1054, 1062,<br />

V71<br />

Beer T.M. 97, 103<br />

Beermann S. 272<br />

Behnsawy H. 1047<br />

Behr-Roussel D. 449, 900<br />

Behre H.M. 211<br />

Behrendt M. 554<br />

Beier J. 790, 795, V70<br />

Bektic J. 7, 803<br />

Belfield J. 590<br />

Belgrano E. 817<br />

Belldegrun A.S. 193<br />

Bellec L. 87, 170, 171, 176<br />

Bellessort A. 743<br />

Bellezza G. 147, 933<br />

Bellina M. 864<br />

Bellomo F. 592<br />

Belomyttcev S.V. 796<br />

Beltran L. 58<br />

Belyaev I. 893<br />

Ben Ali M. 520<br />

Ben Messaoud N. 768<br />

Ben Rais N. 520<br />

Ben-Zvi T. 638<br />

Benadiba S. 734<br />

Bendahl P.O. 750<br />

Benecchi L. 1041<br />

Benedetto G. 319<br />

Benelli A. 817<br />

Bengoa N. 941<br />

Benigni F. 69, 146, 328, 451, 651,<br />

831, 832<br />

Benito Garcia P. V42<br />

Bennett P.R. 910<br />

Bensadoun H. 500<br />

Bensalah K. 87, 176, 261, 576,<br />

813, 852, 1105<br />

Benson M.C. 485<br />

Benvenuto S. 838<br />

Benvenuto S. 817<br />

Benzon Larsen S. 858<br />

Berardinelli F.B. 408, 1093, 1094<br />

Berdah S. 245<br />

Berdondini E. 798<br />

Bergdahl S. 808<br />

Berger A. V45, V79<br />

Berger C. 644<br />

Berger J. 170, 171, 176, 283, 458,<br />

1105<br />

Berges R. 629<br />

Berglund A. 808<br />

Berman M. 719, 946<br />

Bernabé J. 449, 900<br />

Bernardini S. 426, 427, 429<br />

Bernecker R. 22<br />

Bernhard J-C. 87, 96, 170, 171,<br />

176, 283, 763, 1105<br />

Bertaccini A. 711<br />

Bertini R. 173, 340, 467, 953<br />

Bertolo R. 204, 219, 710, 875, V11<br />

Bettendorf O. 465<br />

Bettiga A. 146, 328, 331, 363, 443<br />

Bettocchi C. 662<br />

Betts C. 775<br />

Numbers refer to abstract numbers<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

431<br />

Indices


Indices<br />

Abstract authors<br />

Beukers W. 54, 238<br />

Beuvon F. 141<br />

Beuzeboc P. 104<br />

Beveridge S. 351<br />

Bex A. 392, 394<br />

Beyer B. 226, 359, 1023<br />

Bhandari M. 19<br />

Bhat A.L. 418, 421, 424<br />

Bhat M. 418, 421, 424<br />

Bhatt J.R. 38, 45, 1077<br />

Bhatt R.I. 453<br />

Bhayani S. 876<br />

Bhide A. 672, 725<br />

Bhindi B. 988<br />

Bhojani N. 659<br />

Bianchi C. 769<br />

Bianchi G. 172, 264, 439, 817, 887<br />

Bianchi L. 271, 711<br />

Bianchi M. 140, 182, 187, 473, 686,<br />

687, 714, 748, 806, 960<br />

Bianco A. 147, 933<br />

Bianco R. 622<br />

Biancone L. 376<br />

Biasoni D. 83, 388, 397, 398, 1055,<br />

1057<br />

Bielik R. 833<br />

Bielsa O. 229<br />

Bienko M. 19<br />

Bigot P. 87, 170, 171, 176, 283, 778,<br />

1105<br />

Bilasy S.E. 33<br />

Bilhim T. 628<br />

Billingham L.J. 239<br />

Binbay M. 660<br />

Bini V. 137, 848<br />

Birch B. 275<br />

Birchall C. 623<br />

Birder L. 65<br />

Birkhäuser F.D. 193, 330, V44<br />

Birtle A. 81<br />

Bischoff S.C. 861<br />

Bisconti A. 431, 1066, 1071<br />

Bissler J.J. 981<br />

Bitker M-O. 304<br />

Bittard H. 426, 427, 429<br />

Bivalacqua T.J. 324, 326, 327, 815<br />

Bizzarri C.N. 711<br />

Bjarnason G.A. 1107<br />

Bjartell A. 826, 856<br />

432 <strong>Programme</strong> <strong>Book</strong><br />

Björnsson S. 1029<br />

Black P.C. 50<br />

Bladou F. 1053<br />

Blaheta R. 825, 830<br />

Blanchet P. 136<br />

Blanco S. 692<br />

Blasco M. 491<br />

Blauwet M.B. 401, 739<br />

Blazquez J 498<br />

Blemings A. 406<br />

Blessig T. 72<br />

Blumenstengel K. 1106<br />

Blumenstock G. 1049<br />

Blutbacher P. 365<br />

Blázquez C. 482, 757<br />

Bocchi F. 1041<br />

Bocchi P. 1041<br />

Bocciardi A.M. 172, 264<br />

Bochner B.H. 749<br />

Bödecker H. 160<br />

Bodnar M.B. 869<br />

Boehm K. 226<br />

Boerman O.C. 336, 980<br />

Boers-Sonderen M.J. 336<br />

Boissier R. 245<br />

Bokhorst L.P. 5<br />

Bolenz C. 286, 576, 1052<br />

Bolle W.A.B.M. 680<br />

Bollito E. 219, 710<br />

Bolognesi A. 183<br />

Bomanji J. 391<br />

Bombelli S. 769<br />

Bomers J. 582<br />

Bonet A. 208<br />

Bonillo Garcia M.A. 888<br />

Bonkat G. 167, 618<br />

Bonneau C. 430<br />

Bono A. 708<br />

Boorjian S.A. 75, 151, 924, 957<br />

Boren J. 833<br />

Borer J.S. 739<br />

Borghesi M. 186, 258, 271, 290, 454,<br />

711, 913<br />

Borghi M. 587<br />

Borgogno C. 438<br />

Boronat Tormo F. 231, 543, 805<br />

Boros M. 251<br />

Borre M. 674, 683<br />

Borrego J. 482<br />

Bos D.L. 980<br />

Bosch J.L.H.R. 648<br />

Bose P. 3<br />

Bosio A. 95, 376, 431, 864, 1066,<br />

1071<br />

Boss A. 874<br />

Bosset P.O. 137, 716, 848<br />

Bossi I. 1078<br />

Bostanci Y. 117, 163, 381<br />

Boström M.M. 154<br />

Boström P.J. 154<br />

Botelho F. 210<br />

Bott S. 351<br />

Bottke D. 192<br />

Bottone F. 560<br />

Bouazza N. 141<br />

Boudes M. 441<br />

Boulos V. 37, 843<br />

Bourdoumis A. 654, 963<br />

Bouropoulos K. 548<br />

Bouvier R. 180<br />

Bovo G. 692, 769<br />

Boxler S. 222, 227<br />

Bozaci A.C.B. 643, 645<br />

Bozzini G. 368, 540, 566, 567, 798<br />

Bracarda S. 106<br />

Brady J. V71<br />

Braeckman J. 353<br />

Braga A. 726<br />

Brahmbhatt J. 841, V51, V52, V76<br />

Braissant O. 618<br />

Brakbi Y. 458<br />

Branco A.W. V58<br />

Branco F. 380<br />

Brandtner A. 225<br />

Brassetti A. 412<br />

Brasso K. 273, 858<br />

Braticevici B. 966<br />

Bratti E. 319<br />

Bratus D. 680<br />

Braun A. 99, 108<br />

Braun C. 844<br />

Braun K. 856<br />

Brausi M. 708<br />

Brechenmacher T. 981<br />

Brecheteau F. 283<br />

Breda A. 137, 281, 372, 498, 660,<br />

848, V49<br />

Brenneis C. 671<br />

Numbers refer to abstract numbers


Brewster S.F. 298, 1077<br />

Briganti A. 182, 183, 184, 185, 187,<br />

188, 467, 468, 471, 473, 474,<br />

686, 687, 688, 694, 695, 697,<br />

806, 911, 990<br />

Bright E. 737<br />

Brime Menendez R. 334<br />

Brindle K. 833<br />

Brisuda A. 276, 815<br />

Broers E.M.P. 493<br />

Brombin C. 473<br />

Bronner C. 192<br />

Brookman-May S. 286, 340<br />

Brough R. V57<br />

Brouzyine M. 112<br />

Brown C. 879<br />

Brown R. 161<br />

Brown S.C. V66<br />

Bruce J.Y. 100<br />

Bruckner T. 344<br />

Brunner J. 822<br />

Bruno G. 579<br />

Bruno R. 729<br />

Brunocilla E. 271, 454, 711<br />

Brureau L. 87<br />

Bruyère F. 170, 171, 176, 261, 743<br />

Bryan R. 51, 81, 239<br />

Brössner C. 1009<br />

Bründl J. 225, 944<br />

Bschleipfer T. 62, 897<br />

Bubendorf L. 945<br />

Bucci S. 614, 838<br />

Buchholz N. 654, 963, 1067<br />

Buchner A. 923<br />

Buchner H. 286<br />

Budak S. 111, 794<br />

Budde K. 981<br />

Budia A. 543<br />

Budiharto T. 360<br />

Budäus L. 226, 359, 1006, 1023<br />

Buffardi A. 376, 431, 1066, 1071<br />

Buffi N.M. 137, 186, 254, 848, 855<br />

Bühring H. 899<br />

Bui H. 676<br />

Bujons A. 531, 532<br />

Bul M. 5<br />

Bullock A.J. 109, 110, 873<br />

Bultitude M.F. 1084<br />

Buono R. 69, 328, 451, 651, 831,<br />

832<br />

Burgard B. 74<br />

Burger M. 282, 286, 577<br />

Burgess N.A. 658<br />

Burgio G. 363<br />

Burgos Revilla F.J 346, 379, 498,<br />

501, 760<br />

Burgu B. 527, 646, 647<br />

Burgués J.B. 577<br />

Burkhard F.C. 555, 1026<br />

Burnett A.L. 327<br />

Bus M.T.J. 594<br />

Busetto G.M. 55, 591<br />

Butea-Bocu M.C. 295<br />

Buttyan R. 50<br />

Buvat J. 123<br />

Byun S.S. 519, 1003<br />

Byun Y.J. 512<br />

C<br />

Cabello R. V75<br />

Cabral J. 380<br />

Cabrejos Perotti K. 422<br />

Cabrera P.M. 1030, V5, V7, V8, V9<br />

Caceres F. 1034, V5, V7, V8, V9<br />

Cadeddu J. 552<br />

Cadieux P 162, 505<br />

Caffaratti J. 531, 532<br />

Cahill D. 298<br />

Cai T. 166, 459, 508, 509, 619, 697<br />

Caisey S. 449<br />

Cäkir O.O. 126, 407<br />

Calabresi P. 302<br />

Calatrava Ledrado L. 334<br />

Calsson S. 858<br />

Camacho J. A. 639<br />

Cammann H. 859<br />

Campain N. 516<br />

Camparo P. 287<br />

Campeau L. 443, 447<br />

Campeggi A. 716<br />

Campion L. 472<br />

Campistol J.M. 491, 496<br />

Campos R.S.M. 399<br />

Campos Pinheiro L. 628<br />

Canals D. 146<br />

Cancrini F. 412<br />

Canes D. V44<br />

Cansino R. 760<br />

Canu T. 832<br />

Capitanio U. 173, 289, 467, 473, 575,<br />

601, 686, 695, 714, 953<br />

Capizzi E. 711<br />

Capogrosso P. 953<br />

Capol J.C. 635<br />

Capon G. 96<br />

Cappa M. 517<br />

Cappallo-Obermann H. 27<br />

Caraglia M. 828<br />

Carap A. 34<br />

Carbone A. 517, 914<br />

Carbone L. V53<br />

Carchedi M.T. 431, 864, 1066, 1071<br />

Cardeñosa O. 206<br />

Cardone G. 583<br />

Cardoso L.E.M. 413<br />

Cardozo L. 740<br />

Caremel R. 244, 785<br />

Carenzi C. 173, 953<br />

Carillo V. 184<br />

Carini M. 93, 172, 259, 264, 411,<br />

693, 817, 887, 1014<br />

Carlsson M. 740<br />

Carlsson S. 4, 808, 850<br />

Carlsson S. 912, 916<br />

Carmel M. 891<br />

Carmignani G. 770, 817, 1014<br />

Carmignani L. 368, 540, 566, 567,<br />

798, 996<br />

Carmona O. V6, V19, V38, V44<br />

Carpentier X. 1059<br />

Carrasco A. 924<br />

Carrato A. 229<br />

Carrieri G. 864<br />

Carrión Puig A. 383, 993<br />

Carroll T. 935<br />

Carter A.C. 367<br />

Carter S. 990<br />

Cartwright R. 672, 910<br />

Carvalho F. 719<br />

Carvalho-Barros S. 673<br />

Casabe A.R. 1096<br />

Casanova Ramón-Borja J. 10, 1007<br />

Casanova-Salas I. 10<br />

Casellato S. 368, 540, 566, 567<br />

Castane E.R. V71<br />

Castañeda-Argáiz R. 383<br />

Numbers refer to abstract numbers<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

433<br />

Indices


Indices<br />

Abstract authors<br />

Castellano D. 773<br />

Castelli C. 852<br />

Castelo D.J.S. 1082<br />

Castiglione F. 69, 140, 324, 326, 328,<br />

443, 694, 714<br />

Castillo J. 437<br />

Castle E.P. 1031, 1032<br />

Castro J. V19, V44<br />

Castro R. 1095<br />

Castro Diaz D. 746, 888<br />

Catanzaro M. 83, 388, 397, 398,<br />

1055, 1057<br />

Cathala N. 589, 1020<br />

Cathcart J. 181, 190<br />

Cathelineau X. 352, 589, 679, 883,<br />

1020, 1040, V48, V64<br />

Cattaneo G. 219<br />

Cattarino S. 11<br />

Catto J. 56, 81, 568<br />

Cattoni E. 726<br />

Cattoretti G. 769<br />

Cavarretta I.T.R. 831, 832<br />

Cayzergues L. 112<br />

Cecchini M.G. 330, 942<br />

Ceccini L. 229<br />

Celhay O. 483<br />

Celia A. 259, 459<br />

Cellai I. 411<br />

Celma A. 6, 682<br />

Centi J. 458<br />

Cerantola Y. 926<br />

Ceresa C. 374, 377, 495<br />

Ceresoli F. 173<br />

Ceriotti F. 855<br />

Ceruti C. 431, 1066, 1071<br />

Cervero Jiménez M. 730<br />

Cespedes M. 229<br />

Cestari A. 137, 254, 848, 855<br />

Cha E.K. 575, 601, 697, 813<br />

Cha W.H. 1003<br />

Chabannes E. 426, 427, 429<br />

Chadwick E. 351<br />

Chae J.Y. 955, 994<br />

Champy C. 283<br />

Chan Y.H. 758<br />

Chancellor M. 308<br />

Chandra A. V62<br />

Chang A. 16<br />

Chang P. 882<br />

434 <strong>Programme</strong> <strong>Book</strong><br />

Chang P-L. 148<br />

Chang R. 211<br />

Chang S-J. 1064<br />

Chang S.R. 723<br />

Chang W.Y.H. 684<br />

Chantada V. 232, 760<br />

Chapman A. 434<br />

Chapple C.R. 109, 110, 401, 403,<br />

741, 744, 873, 910, 1087<br />

Charles T. 731<br />

Charman S. 218, 353, 585<br />

Charry P. V75<br />

Chartier-Kastler E. 304, 308, 734,<br />

743<br />

Chatterton J. 1084<br />

Chauhan S. 299, 1013, V10<br />

Chautard D. 778<br />

Chauveau P. 999<br />

Chawla A.K. 970<br />

Che L. 840<br />

Chebil G. 750<br />

Chemaly A. 547<br />

Chen B. 27, 28, 36, 837<br />

Chen C.H. 234<br />

Chen D. 981<br />

Chen F. 877<br />

Chen H.S. 162<br />

Chen J. 932<br />

Chen K-K. 515, 684, 723, 735, 738,<br />

784, 1088<br />

Chen Q.H. 247<br />

Chen Q. 604, 605<br />

Chen T.J. 515, 735<br />

Chen W. 320<br />

Chen Z. 604<br />

Chen Z. 901<br />

Cheng K.K. 239<br />

Cheng L. 249<br />

Chernobilsky V. 587<br />

Chernogubova E.A. 857<br />

Chernyaev V. 90<br />

Chessa F. 454, 711<br />

Chester J. 81<br />

Cheung G. 1033<br />

Cheung S. 935<br />

Chevallier D. 1059<br />

Cheville J. 75, 924, 957<br />

Chiang H.S. 335<br />

Chiang H.K. 315<br />

Chiara A. 183<br />

Chiba K. 33, 35, 842<br />

Chibichyan M.B. 857<br />

Chiche L. 500<br />

Chin J. 1050<br />

Chindemi A. 264<br />

Chiong E. 758<br />

Chira I.D. 17<br />

Chiriacò G. 838<br />

Chiu A.W. 315<br />

Chiu Y.C. 315<br />

Cho D.S. 1072<br />

Cho D.Y. 209, 544<br />

Cho H.J. 445, 611<br />

Cho J.S. 213, 786<br />

Cho J. 280<br />

Cho K.S. 1012<br />

Cho M.C. 332<br />

Cho N.H. 1012<br />

Cho S.Y. 332, 860<br />

Cho W.Y. 209, 213<br />

Cho Y.S. 409<br />

Chodacki A. 101<br />

Chodez M. 564<br />

Choe M.S. 986<br />

Choi D. 490<br />

Choi H.Y. 266, 280, 297, 786<br />

Choi J.Y. 253<br />

Choi J.W. 116<br />

Choi S.H. 253<br />

Choi W.S. 860<br />

Choi Y.S. 445, 611<br />

Choi Y.D. 177, 269, 810, 1012<br />

Chong T.W. 200<br />

Choo M-S. 1005<br />

Choo S.H. 266, 280, 297, 538<br />

Choong S. 314<br />

Choueiri T.K. 1107<br />

Choussos D. 894<br />

Chow K. 316<br />

Chowriappa A. 19, 20<br />

Christ T. 902, 905<br />

Christensen I.J. 273<br />

Christensen J. 858<br />

Christian S. 731<br />

Christiansen M. 858<br />

Christie A. 114<br />

Christine B.S. V71<br />

Christofides A. 42<br />

Numbers refer to abstract numbers


Christopher N. 129<br />

Chromecki T. 340, 347<br />

Chryssolouris G. 25<br />

Chua M. 437, 1043<br />

Chuck N. 874<br />

Chughtai B. 638, 724, 1004<br />

Chun F.K. 272, 473, 474, 686, 752,<br />

802, 813, 929, 990, 1015<br />

Chun J. 688, 911<br />

Chung A.S. 634<br />

Chung B.H. 269, 810<br />

Chung H.J. 515, 735, 738, 1088<br />

Chung H.C. 997<br />

Chung J.M. 691<br />

Chung J.Y. 727<br />

Chung J.S. 1001<br />

Chung M.K. 632, 691, 759<br />

Chung S.K. 253, 428<br />

Chung W.S. 512<br />

Chunwoo L. 649<br />

Cid J. 491<br />

Cindolo L. 91, 408, 412, 592, 1093,<br />

1094<br />

Ciofu C. 896<br />

Cisneros R. V19, V44<br />

Cisneros Ledo J. 556, 1036<br />

Citeri M. 301, 305<br />

Citgez S 529<br />

Ciudin A. 34, 313, 378, 436, 595,<br />

993<br />

Ciuffreda M. 86<br />

Clarke A.H. 539<br />

Claro J.F.A. 525<br />

Clavijo R. V38<br />

Clayman R. V44<br />

Clayman R. 822<br />

Cleeland C. 99<br />

Climent M. 106<br />

Clozel T. 156<br />

Cocci A. V69<br />

Coelho A. 65<br />

Coelho R. 299, 1013, V10<br />

Cohen J. 283<br />

Colciago G. 146, 328<br />

Colecchia M. 388, 397, 398, 1057<br />

Coleman R. 99<br />

Colette S. 708<br />

Colin P. 237, 575, 576, 601<br />

Collado Serra A. 10, 1007<br />

Collins E. 634<br />

Collins J. 1035<br />

Colls P. 283<br />

Coloby P. 136<br />

Colombel M. 180, 705<br />

Colombo F. V56<br />

Colombo R. 363, 687, 697, 748, 918<br />

Comeglio P. 411<br />

Comet D. 681<br />

Comperat E. 237, 283, 393, 483<br />

Compion G. 782<br />

Comploj E. 61, 78, 573, 575, 601,<br />

701, 752, 754, 815, 929<br />

Compérat E. 287<br />

Conca M.A. 543<br />

Conde Giles A. V33<br />

Conde-Sanchez J.M. 804, 917<br />

Conejero Sugrañes J. 888<br />

Congregado-Ruiz B. 804, 917<br />

Connolly S.S. 952<br />

Constantin V. 34<br />

Conteduca G. 770<br />

Corbell C. 308<br />

Corbishley C. 389<br />

Corcoran N.M 53, 145, 704, 849<br />

Corcos J. 244, 785, 891<br />

Córdoba Martínez L.A. 346<br />

Cordonnier T. 50<br />

Corman J. 103<br />

Cormier L. 283<br />

Corn P.G. 100<br />

Cornel E.B. 700<br />

Cornu J-N.L. 726, 896, 1004<br />

Cornud F. 141<br />

Corona G. 411<br />

Corral J.M. 34<br />

Correia de Almeida Pinto R.M. 669<br />

Correia-Pinto J. 968<br />

Corti S. 687<br />

Cosciani Cunico S. 172, 499, 592,<br />

887<br />

Cosentino M. 532, 760<br />

Cosentino M. 368<br />

Coss C.C. 102<br />

Costa L. 895<br />

Costa P. 112<br />

Costa W.S. 29, 30, 413, 903<br />

Costa W.H. 399, 557<br />

Costantini E. 729<br />

Costantini M. V23, V46<br />

Costantino L.C. 412<br />

Costello A.J 53, 145, 704, 849<br />

Cotterill N. 737<br />

Couapel J-P. 176<br />

Counsell N. 58<br />

Cózar J.M. 232, 362, 498<br />

Cozzarini C. 182, 183, 184, 185, 187,<br />

687, 694, 806<br />

Cozzupoli P. V53<br />

Crabb S. 58, 811<br />

Craven L. 558<br />

Crawford E.D. 678<br />

Creagh T.C. 15<br />

Crepel M. 170, 171<br />

Crespi A. 692<br />

Crespo L. 1068<br />

Crestani A. 1017<br />

Crevels A.J. 870<br />

Cristinelli L. 499<br />

Cristofani L.M. 650<br />

Crivellaro S. 259, 864, 880<br />

Crivelli J.J 156, 701, 752, 929<br />

Cromwell D. 658<br />

Crook T.J. 740<br />

Crouzet S. 180, V77<br />

Cruz C.D. 65, 673<br />

Cruz F. 65, 210, 627, 669, 673, 898<br />

Cruz-Nuricumbo E. 973<br />

Cuadros T. 768<br />

Cuervo Calvo J. V42<br />

Cui Y.C 839<br />

Culty T. 778<br />

Cunha I.W. 399<br />

Curto T. 211<br />

Cussenot O. 366, 576, 896<br />

D<br />

Da Pozza L.F. 173, 1096<br />

Daamen W.F. 870, 872<br />

Dababneh H. 271<br />

Daher Abdi Z. 458<br />

Dahlem R. 425, 866, 929, 1002<br />

Dal Moro F. 1017<br />

Dalal N. 1101<br />

Dalbagni G. 697, 749<br />

Dalmasso E. 376, 431, 1066, 1071<br />

Dalpiaz O. 575<br />

Dalton J.T. 102<br />

Numbers refer to abstract numbers<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

435<br />

Indices


Indices<br />

Abstract authors<br />

Dalton S.O. 858<br />

Damaj B. 123<br />

Damiano R. 289, 687, 918<br />

Damião R. 99<br />

Dammert F. 195<br />

Damms-Machado A. 861<br />

D'Ancona F.C.H. 493<br />

Daneshmand S. 815, 822<br />

Daneshvar K. 344<br />

Dansranjavin T. 27, 31, 947<br />

Danuser H. 554<br />

Danısoglu M. 652<br />

Darweesh I. 91, 552<br />

Dasgupta P. 14, 477, 709, 835, 1031,<br />

1032, 1033, V14<br />

Daum L. 243, 248, 791<br />

Davceva O. 203<br />

David S. 679<br />

Davidov M. 1086<br />

Davidson S.R.H. 588<br />

Davis M.J 135<br />

Dawood T. 416<br />

Day J.R. 1045<br />

De Andrade R. V6, V19, V38, V44<br />

De Angelis P. 174<br />

De Arriba Alonso M. V60<br />

De Berardinis E. 55, 591<br />

De Blok W. 291<br />

De Bono J.S. 97, 105<br />

De Braud F. 83<br />

De Bruin D.M. 594<br />

De Castro J. 485<br />

De Castro Abreu A.L. 220, 265, 361,<br />

V45, V79<br />

De Cobelli O. 340<br />

De Concilio B. 838<br />

De Fourmestraux A. V15<br />

De Gorski A. 721<br />

De Gracia A. 281<br />

De Koekkoek P. 217<br />

De Kort L.M.O. 648<br />

De Korte C.L. 995<br />

De La Motte Rouge T. 104<br />

De La Peña E. 482, 757<br />

De La Peña Barthel J.J 556, 1036<br />

De La Rosa C. 103<br />

De La Rosa F. 232, 362, 773<br />

De La Rosette J. 521, 594<br />

436 <strong>Programme</strong> <strong>Book</strong><br />

De La Taille A. 137, 261, 677, 716,<br />

753, 848, 851, V15<br />

De La Torre P. 137, 848<br />

De Lacy Costello B. 506<br />

De Lange F. 582<br />

De Marzo A.M 943<br />

De Meerleer G. 191<br />

De Meuron L. 330<br />

De Midina S.G.D. 432<br />

De Nola R. 662<br />

De Nunzio C. 340, 408, 411, 412,<br />

672, 725, 798, 990, 1004, 1014,<br />

1094<br />

De Placido S. 396<br />

De Reijke T.M. 594, 700<br />

De Ridder D. 252, 441, 513, 999<br />

De Ruiter M.C. 889<br />

De Souza D.B. 29, 30, 903<br />

De Souza P. 97<br />

De Stefani S. 817<br />

De Tayrac R. 112<br />

De Torres I. 768<br />

De Velasco G. 773<br />

De Velasco M. 1108<br />

De Wall H. 212<br />

De Win G. 14<br />

De Winter P. 51<br />

De Zaragoza I. 362<br />

Deantoni C. 184, 185<br />

Dearnaley D. 108<br />

Debiais-Delpech C. 1040<br />

Decaestecker K. 191<br />

Dechet C. 61<br />

Deckmann K. 62<br />

Deger S. 89, 461<br />

Deiana G. 173<br />

Deja A. 365<br />

Dekhnich A. 169<br />

Del Boca C. 1041<br />

Del Cañizo-Lopez J.F. 606<br />

Del Duca M. 579<br />

Del Gaudio C. 147, 933<br />

Del Maschio A. 832<br />

Del Nero A. 596<br />

Del Vescovo R. 580<br />

Del Zingaro M. 729<br />

Delage F. 283<br />

Delbro D. 664<br />

D'Elia C. 166, 459, 509, 619<br />

Della Mora L. 454<br />

Dell'Oglio P. 289, 687, 918<br />

Delmas V. 930<br />

Delor M. 596<br />

Delorenzi M. 942<br />

Delpero J.R. 1053<br />

Deminière C. 763<br />

Demir R. 117, 381<br />

Demirdag C. 479<br />

Dempster N.J. 374, 377, 495<br />

Denes F.T. 650<br />

Denstedt J.D. 162, 505, 1067<br />

Dente D. 259<br />

Denys P. 304<br />

Denzinger S. 282, 286<br />

Deprest J. 252<br />

Deriglazova P. 893<br />

Deroose C.M 360<br />

Derosa G. 828<br />

Desai J. V40<br />

Desai M. 220, V6, V45, V79<br />

Desar I.M.E. 336<br />

Descamps P. 679<br />

Descazeaud A. 283, 458<br />

Descotes J.L. 563, 564<br />

Deshpande A. 1074<br />

Dessyn J.F. 427<br />

Destefanis P. 95, 431, 864, 1066,<br />

1071<br />

Deuker J. 31<br />

Devon S-L. 256<br />

Devoogdt N. 1000<br />

Dharmaraja A. V45<br />

Di Antonio M. 823<br />

Di Cristofano C. 93<br />

Di Domenico A. 174<br />

Di Filippo M. 302<br />

Di Girolamo V. 467, 695<br />

Di Lorenzo G. 396<br />

Di Mauro U. V67<br />

Di Muzio N.G. 182, 183, 184, 185,<br />

187, 687, 694, 806<br />

Di Napoli M.A. 525<br />

Di Santo V. 259<br />

Di Serio C. 185, 473<br />

Di Stasi S.M. 697, 698<br />

Di Stefano C. 579<br />

Di Stefano V. 769<br />

Di Trapani D. 918<br />

Numbers refer to abstract numbers


Di Trapani E. 173, 695, 714, 953<br />

Diaa M. 528<br />

Diaconescu D. 966<br />

Diaconu M.G. 34, 313, 436, 595, 993<br />

Dias E. 968<br />

Dias J. 895<br />

Dias V.M.N. 1082<br />

Díaz F.J. 482, 757<br />

Diaz M. 876<br />

Diaz R.R. 1012<br />

Díaz González R. 773, 1073<br />

Diazzi D. 271<br />

Dick C.P.C. 902, 905, 989<br />

Dickinson I.K. 49, 1075, 1076, 1081<br />

Dickinson C.L. 584, 585<br />

Dickman K.G. 234<br />

Diekmann F. 491, 496<br />

Dietel A. V17<br />

Dietsche T. 945<br />

Díez Nicolás V. 379, 501<br />

Diez Sicilia L. 773<br />

Digesu A. 672, 725<br />

Digiorgio L. 882<br />

Dignat-George F. 245<br />

Dillenburg W. 696<br />

Dillon B.E. 114<br />

Din R. 19<br />

Ding Q. 9<br />

Dinis P. 627, 669, 1079<br />

Ditonno P. 662<br />

Dixon C. 631<br />

Djajadiningrat R.S. 387, 389, 390,<br />

392, 394<br />

Djatisoesanto W. 908<br />

Djinovic R. V56<br />

Dmochowski R. 402<br />

Do M. V17<br />

Doble A. 142<br />

Dobrowolska-Glazar B. 597<br />

Dobrowolski Z. 597<br />

Dockree S. 1051<br />

Doehn C. 461<br />

Doerfler A. 283, 500<br />

Dogan C. 89, 529<br />

Dogan H.S. 642, 643, 645<br />

Doglioni C. 467, 473<br />

Dogliotti L. 108<br />

Doizi S. 430<br />

Dombrovsky V.I. 787<br />

Dominguez Esteban M. 773<br />

Domínguez-Escrig J. 10, 1007<br />

Don-Doncow N. 826<br />

Donahue T.F. 749<br />

Donat S.M. 749<br />

Donel E. 189<br />

Donnaint A. 283<br />

Donon L. 96, 763<br />

Donovan J. 81, 135<br />

Donskov F. 1107<br />

Doo S.W. 325<br />

Dorado M. 1068<br />

Dorkin T. 781<br />

Dormeus S. 415<br />

Dornbusch J. 984<br />

Dorrepaal C. 739<br />

Douat P.H. V58<br />

Douglas J. 58, 811, 1051<br />

Doumerc N. 261<br />

Drăgoescu O.D. 577<br />

Drake M.J. 161, 506, 737, 1004,<br />

1089<br />

Drake T. 811<br />

Drewa T.D. 869<br />

Dridi M. 520<br />

Drogendijk T. 1089<br />

Droller M. 577<br />

Droupy S. 112, 261, 681<br />

Duarte M. 628<br />

Duarte R. 650<br />

Dubey S. 56<br />

Dubrowinskaja N. 198<br />

Duchin K. 402<br />

Duclos-Morlaes B. 681<br />

Dudziec E. 56<br />

Dufour R. 218<br />

Duivenvoorden W. 939<br />

Dukic I. 44<br />

Dulak J. 597<br />

Dumas J.P 458<br />

Dumitrache D.M. 17<br />

Dumont Martinez R. 10, 1007<br />

Duong K. V62<br />

Durand M. 352, 1059<br />

Durand X. 283<br />

Dusik S. 709, V14<br />

Dwarkasing R.S. 217<br />

Dyrskjot L. 238<br />

E<br />

Eardley I. 502, 617<br />

Eastham J.A. 715<br />

Eberli D. 246, 799, 868, 874<br />

Ebra G. 299, 689, 1013<br />

Edamatsu H. 33<br />

Edelstein M. 169<br />

Eden C. 351<br />

Edwards J. 902, 905, 989<br />

Effenberger K. 802<br />

Efstathiou J.A. 822<br />

Egawa S. 98<br />

Egerdie B. 108<br />

Egevad L. 287<br />

Eggener S. 138<br />

Eggers H. 348<br />

Eggesbø H.B. 221<br />

Eggink A.J. 870<br />

Egrot C. 366<br />

Ehlert M. 119<br />

Ehrbar M. 868<br />

Ehrenstein V. 675<br />

Eichelberg E. 1006<br />

Eimer C. 251<br />

Eisa M. 640<br />

Eisenberg M.S. 957<br />

Ekrutt J. 867<br />

El Fayoumy H. 511<br />

El Hajj A.E. V15<br />

El Yazami Adli O. 244, 785, 891<br />

El-Bendary M.A. 214<br />

El-Bilsha M.A. 934<br />

El-Gamasy A. 214<br />

El-Ghoneimy M.N. 536<br />

El-Halwagy S. 928, 1028<br />

El-Hefnawy A.S. 934<br />

Eladl M. 836<br />

Elaidi R. 104<br />

Elbendary L. 416<br />

Elder J.S. 526, 534<br />

Eldred-Evans D. 16<br />

Elemento O. 156<br />

Elhage O. 835<br />

Eliwa A.M. 416<br />

Elkassaby A. 793<br />

Elleberg Petersen S. 683<br />

Ellinger J 286<br />

Elmissery M. 537<br />

Elnahas A.R. 1069<br />

Numbers refer to abstract numbers<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

437<br />

Indices


Indices<br />

Abstract authors<br />

Elsaesser J. 703<br />

Elsalmy S. 537<br />

Elsayed D. 836<br />

Elsayed E.R. 416<br />

Elsherif E. 792<br />

Eltahawy E.A. 793<br />

Eltze E. 465<br />

Emberton M. 138, 181, 218, 267,<br />

353, 584, 585, 717<br />

Eminaga O. 465<br />

Enatsu N. 33, 35, 842<br />

Encabo G. 682<br />

Endo M. 252<br />

Engel O. 866<br />

Engeler D.S. 310<br />

Engelmann U.H. 624, 890<br />

Engilbertsson H. 750, 1029<br />

Ennas M. 817<br />

Enokida H. 52, 772<br />

Eory L. 766<br />

Epstein J. 287<br />

Erbersdobler A. 195, 393<br />

Erdil T. 163<br />

Erdmann K. 984<br />

Erdogan M.S. 89<br />

Erickson A.M. 274<br />

Erkan A. 615<br />

Erozenci A. 529<br />

Ervandian M. 683<br />

Escaf S. 277<br />

Escobar Z. 826<br />

Escudier B. 87, 1105<br />

Escórcio De Almeida F.A. 380<br />

Esperto F. 412<br />

Espiridião P. 895<br />

Esposito A. 832<br />

Esser M. 364<br />

Essig M. 458<br />

Esteban M. 746<br />

Esteban Fuertes M. 888<br />

Esuvaranathan K. 758<br />

Eto M. 941, 982<br />

Evangelista L. 357<br />

Evans A. 988<br />

Evans J.D. 453<br />

Even A. 304<br />

Eylert M.F. 230<br />

Eyraud R. 256, 257, 816, V2, V22,<br />

V27<br />

438 <strong>Programme</strong> <strong>Book</strong><br />

F<br />

Faber D.J. 594<br />

Fabregat Prous J. V63<br />

Fagan A. 355<br />

Faggioni L. 1008<br />

Fahlenkamp D. 461<br />

Fahmy B.M. 641<br />

Faison T. 474, 929<br />

Faivre D'Arcier B. 483<br />

Fajkovic H. 474, 576, 752<br />

Falke J. 153, 700<br />

Fall M. 664<br />

Fallowfield L. 99<br />

Fan Y-H. 784<br />

Fanizza C.F. 408, 1093, 1094<br />

Fankhauser C.D. 635, 637<br />

Fantechi R. 264<br />

Farag F. 995<br />

Fardoun T. 87, 852, 1105<br />

Farè E. 83, 388, 397, 398, 1055,<br />

1057<br />

Faried A. 293<br />

Farin E. 1067<br />

Farina E. 714<br />

Fariña L. 40, 760<br />

Farmakis A. 548<br />

Fasoli L. 855<br />

Fasolis G. 864<br />

Fassi-Fehri H. 999<br />

Fatton B. 743<br />

Favaretto R.L. 557<br />

Favro M. 1004<br />

Fayyazi A. 143, 373<br />

Featherstone J. 3<br />

Feber A. 51, 58<br />

Feciche B. 340<br />

Feitz W.F.J. 870, 872, 995<br />

Feldmann H.J. 192<br />

Felix-Patrício B. 29<br />

Feng T. 36, 837<br />

Fenn N. 3<br />

Fenoglio D. 770<br />

Feola A. 252<br />

Fera C. 448<br />

Ferakis N. 548<br />

Fernandes K. 988<br />

Fernandes L. 628<br />

Fernandez E. 379<br />

Fernandez J. 229<br />

Fernandez M. 40<br />

Fernandez Barranco L. 113<br />

Fernandez-Gomez J.M. 277<br />

Fernandez-Pello Montes S. V42<br />

Fernando A. 593<br />

Fernando R. 725<br />

Fernando Y. 123<br />

Fernández G. V19, V38, V44<br />

Fernández J.M. 702<br />

Fernández Fernández A. 501<br />

Fernández Ibieta M. 422<br />

Fernández Lucas C. 730<br />

Fernández-Serra A. 10<br />

Ferrandino M. 967<br />

Ferrarese P. 319<br />

Ferrari N. 439<br />

Ferraz L. 895<br />

Ferrera F. 770<br />

Ferretti L. 96<br />

Ferriero M.C. 480, 881, 1038, V23,<br />

V46<br />

Ferrière J-M. 96, 763<br />

Ferzauli A.H. 845<br />

Fes Ascanio E.A. 113<br />

Feyaerts A. 415<br />

Fhima M. 679<br />

Fiala R. 680<br />

Fiard G. 563, 564<br />

Ficarra V. 78, 172, 186, 254, 258,<br />

264, 290, 340, 887, 913<br />

Fielding J. 777<br />

Figueiredo A.J.C. 13, 375, 1079,<br />

1082<br />

Figurin K. 90<br />

Filaci G. 770<br />

Filipski K. 62<br />

Finch W.G. 658<br />

Fine S.W. 715<br />

Finelli A. 270, 588, 886, 988<br />

Finocchio N. 714, 918<br />

Finol M.G. V36<br />

Fiorentino M. 271, 711<br />

Fiori C. 172, 204, 219, 264, 459, 630,<br />

710, 875, 887, V11<br />

Fiorino C. 183, 184<br />

Fiorito C. 130<br />

Fisch M. 425, 752, 802, 866, 1002<br />

Fischer J.W. 155<br />

Fischer K. 1046<br />

Numbers refer to abstract numbers


Fiter Gómez L. 730<br />

Fitzsimmons W. 739<br />

Fizazi K. 97, 104, 108<br />

Flaig T.W. 105<br />

Flam T. 141<br />

Flamand V. V28<br />

Flechon A. 104<br />

Fleischmann A. 1044<br />

Fleshner N.E. 270, 588, 988<br />

Flugel R. 402<br />

Fode M. 122<br />

Foditsch E.E. 884<br />

Fontana D. 95, 376, 431, 864, 1066,<br />

1071<br />

Fontas E. 1059<br />

Fonteyne V. 191<br />

Fop F. 431, 1066<br />

Forastiere E. 881, V23, V46<br />

Forde J.C. 15<br />

Fornara P. 91, 263, 382, 461, 949,<br />

1046, V1, V50<br />

Foroudi F.F 85<br />

Fossa S. 106<br />

Fossati N. 140, 467, 651, 695<br />

Fossion L.M.C.L. 1037<br />

Fowler L. 137, 848<br />

Fowler S. 298<br />

Fradet Y. 97, 276, 577<br />

Fraga A. 380<br />

Franceschelli A. V56<br />

Franco A. 313, 436, 595, 746, 993<br />

Franco E. V41, V63<br />

Franco M. 622<br />

Frank D. 123<br />

Frank I. 75, 924<br />

Franken J. 441<br />

Frånlund M. 4<br />

Franzem M. 1102<br />

Frea B. 95, 259, 376, 431, 864, 880,<br />

1066, 1071<br />

Freeman A. 51, 58, 218, 267, 584,<br />

585, 717<br />

Freitas A.R. 895<br />

Freixa R. 208<br />

Freschi M. 137, 187, 331, 467, 473,<br />

694<br />

Fresno F. 277<br />

Freudenberger T. 155<br />

Frey F.J. 555<br />

Friedersdorff F. 859<br />

Friedman A.A. 534<br />

Friedrich-Freksa M. 1025<br />

Friis S. 858<br />

Fritsche H-M. 225, 282, 286, 573,<br />

575, 576, 601, 815, 822, 1067<br />

Froghi S. 14<br />

Fröhlich O. 897<br />

Frohme C. 728<br />

Fröhner M. 1058<br />

Fromont G. 483, 1040<br />

Frumenzio E. 258, 290, 913<br />

Fry C.H. 314<br />

Frydenberg M. 946<br />

Fryer L. 823<br />

Fu D.J. 840<br />

Fuellhase C. 443<br />

Fuessel S. 984<br />

Fujii T. 199<br />

Fujii Y. 311<br />

Fujii Y. 76, 240, 470, 572, 578, 586,<br />

756, 819, 950, 979, V21, V61<br />

Fujimoto H. 98<br />

Fujimoto K. 456<br />

Fujimoto N. 676<br />

Fujimura T. 333<br />

Fujioka T. 77<br />

Fujisawa M. 33, 35, 487, 663, 842,<br />

862, 940, 983, 1047<br />

Fujishima N. 1104<br />

Fujita M. 199<br />

Fujita T. 613<br />

Fujiwara T. 492<br />

Fujiyama N. 1100<br />

Fukuhara H. 834<br />

Fukuhara H. 333<br />

Fukui I. 572<br />

Fukumoto K. 199<br />

Fukushima H. 819<br />

Füllhase C. 67, 68, 447, 847, 906,<br />

909<br />

Fumey J. 500<br />

Funahashi Y. 779<br />

Funyu T. 613<br />

Furriel A. 30, 413, 903<br />

Furriel F. 13, 375, 1079, 1082<br />

Furukawa J. 862<br />

Furusawa M. 603<br />

Furuya Y. 938<br />

Fusco F. 172, 396, 560<br />

Futterer J.F 138, 582<br />

Fuzzi G. 855<br />

G<br />

Gaboardi F. 817<br />

Gacci M. 259, 411, 412, 693, 817,<br />

1014<br />

Gadda G.M. 583<br />

Gaetani L. 302<br />

Gaffney E. 355<br />

Gaire R.K. 849<br />

Gaisa N. 871<br />

Gajda M. 56, 194, 774<br />

Gakis G. 364, 812, 822, 861, 1022,<br />

1049, 1054, V59<br />

Galante Romo I. 334<br />

Galasso A. 861<br />

Galeano Álvarez C. 379, 501<br />

Galiano M. 352, 589, 679, 883, 1020,<br />

V48, V64<br />

Gallagher F.A. 142, 224<br />

Galland S. 822<br />

Gallego Matey A. 805<br />

Galli E 439<br />

Gallina A. 140, 183, 187, 289, 467,<br />

473, 695, 714, 918, 953<br />

Gallo C.B.M. 413<br />

Gallo Rolania F.J. V60<br />

Gallucci M. 480, 881, 1038, V23,<br />

V46<br />

Galustian C. 835<br />

Gamal O.Z. 420<br />

Gamal W. 528<br />

Gameel T.A. 214<br />

Gan C. 1033<br />

Gan M. 258, 290, 913<br />

Gandaglia G. 69, 289, 694, 714<br />

Gandee L. 168<br />

Ganzer R. 225, 944, V17<br />

Garaffa G. 129<br />

Garat J.M. 531, 532<br />

García C. 498<br />

García G. 543<br />

Garcia L. 639<br />

Garcia S. 245<br />

Garcia Barreras S. 730<br />

García-Cruz E. 125, 206, 383<br />

García Diez F. V60<br />

Numbers refer to abstract numbers<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

439<br />

Indices


Indices<br />

Abstract authors<br />

Garcia Garcia N. 730<br />

García González L. 125<br />

García Gómez B. 125, 773<br />

Garcia Montes F. 113<br />

Garcia-Baquero Garcia De Paredes<br />

R. V33<br />

Garcia-Cruz E. 208, 489, 595, 993<br />

Garcia-Larrosa A. 595, 993<br />

Garcia-Mediero J.M. V5<br />

García-Olaverri Rodríguez J. 498<br />

Garcia-Rojo D. 229<br />

Garcia-Sanchez C. 804, 917<br />

Garcia-Segui A. 524<br />

García-Tello A. 1030, 1034, V7, V8,<br />

V9<br />

Garcia-Vargas J. 101<br />

Gardella B. 894<br />

Gardikis S. 423<br />

Garofalo M. 454, 711<br />

Garrou D. 219, V11<br />

Garza R. V19, V38, V44<br />

Gascoyne-Binzi D. 502, 617<br />

Gasser T. 167, 618<br />

Gattenloehner S. 712, 947<br />

Gausa L. 281, 372, V49<br />

Gaya J.M. 281, 284, 352, 362, 372,<br />

485, 883<br />

Gazquez C. 236<br />

Gazzaniga P. 55<br />

Geavlete B.F. 522, 570, V37<br />

Geavlete P.A. 522, 542, 570, V37<br />

Gebauer K. 198<br />

Gebhardt T. V31<br />

Gederaas O.A. 152<br />

Geiges G. 371<br />

Gelabert A. 229<br />

Gelet A. 180<br />

Gentile B.C. 486<br />

Gentile G. V56<br />

Gentile V. 11, 11, 55, 591<br />

Gentilucci A. 11<br />

Georgas E. 251<br />

George A. 552<br />

George D.J. 100<br />

Georgescu D.A. 570<br />

Georgiopoulos I. 25, V4<br />

Geraerts I. 1000<br />

Germann C. 554<br />

Gerritsen W. 106<br />

440 <strong>Programme</strong> <strong>Book</strong><br />

Gertner M.R. 588<br />

Gerullis H.G. 251<br />

Getzenberg R.H. 102, 1048<br />

Geutjes P.J. 870, 872<br />

Gevaert T. 441, 513<br />

Gevher F. 479, 529<br />

Gey S. 930<br />

Gezer M. 479<br />

Ghani K.R. 20, 119, 158, 260, 369,<br />

497, 526, 534, 625, 657, 659,<br />

885, 915, 1070, V14, V25<br />

Ghavamian R. 1031<br />

Ghei M. 736<br />

Ghoneim M. 1038<br />

Ghoneim T. V28<br />

Ghorbel J. 520<br />

Ghosh N. 541<br />

Ghozzi S. 520<br />

Giancane S. 172<br />

Giannakopoulos S. 423<br />

Giannantoni A. 147, 300, 302, 303,<br />

670<br />

Giannatempo P. 83, 388, 397, 398,<br />

1055, 1057<br />

Giannella R. 592<br />

Gianni A. 83, 1055, 1057<br />

Giatromanolaki A. 423<br />

Giedelman C. 299, 352, 1013, V6,<br />

V10<br />

Gierth M.S. 225, 282, 286<br />

Giese A 68<br />

Gigliobianco G. 110<br />

Gil Diez De Medina S. 430<br />

Gilfrich C. 461<br />

Gill I.S. 138, 220, 265, 361, 835, V6,<br />

V45, V79<br />

Gilloteau I. 476<br />

Gimbernat H. V9<br />

Gimel P. 170, 171, 176<br />

Giovannone R. 591<br />

Giraudo L. 245<br />

Giron A.M. 650<br />

Giulianelli R. 486, 580<br />

Giuliano F. 304, 449, 900<br />

Giusiano S. 245<br />

Giusti G. 459<br />

Gjertsson I. 664<br />

Gjorgjievska K. 203<br />

Glass J. 658<br />

Globe D. 308<br />

Gnanapragasam V.J. 142, 224<br />

Goad J.R. 539<br />

Goddard J. 42<br />

Godet J. 1040<br />

Goebell P.J. 1102, 1106<br />

Goh A. V79<br />

Goi Y. 446<br />

Golbeck S. 347<br />

Goldman H. V3<br />

Goldstein I. 123<br />

Golz R. 192<br />

Gomelsky A. 732<br />

Gomes G.H.A. 1082<br />

Gomez A. 993<br />

Gomez V. 379<br />

Gómez Del Cañizo C. 501<br />

Gómez-De-Regil L. 973<br />

Gómez Dos Santos V. 501<br />

Gómez Gómez G. 385<br />

Gómez-Ferrer A. 10, 1007<br />

Gómez Rivas J. 556, 1036<br />

Gomez Sancha F. 634<br />

Gómez-Veiga F. 99, 498<br />

Gomha M.A. 668<br />

Gomis A. 379<br />

Gomis Couto A. 501<br />

Goncharova R.I. 278<br />

Gonella A. 95, 864<br />

Gontero P. 130, 468, 471, 686, 688,<br />

697, 708, 752, 815, 911, 929<br />

Gonzalez C. 277<br />

Gonzalez N. 1068<br />

Gonzalez R.R. 638<br />

Gonzalez Huergo J.F. 229<br />

Gonzalez Rodriguez I. V42<br />

Gonzalez-Torres S. 312<br />

González C. V75<br />

Good D.W. 922<br />

Goodfellow A.I. 477<br />

Goodman, Jr. O.B. 105<br />

Goonewardene S. 296<br />

Gopalan V. 672<br />

Gorbunova I. 1086<br />

Gordon E.M. 846<br />

Gordon S.A 846<br />

Goren A. 476<br />

Gorgal Rodrigues De Carvalho T.<br />

627<br />

Numbers refer to abstract numbers


Górnicka B. 279<br />

Gorny D. 900<br />

Gosalbez Garcia D. 34, 378, 595,<br />

993<br />

Gossmann M. 250<br />

Gotoh M. 288, 404, 747, 779<br />

Gotoh S. 819<br />

Gotohda N. 92<br />

Götze L. 1099<br />

Gouveia Oliveira A. 628<br />

Govorov A. 186, 350<br />

Goyal A. 654, 963<br />

Gözen A.S. 23<br />

Gozzi C. 1008<br />

Graafland N.M. 387, 392<br />

Gradilone A. 55<br />

Graefen M. 137, 139, 293, 294, 359,<br />

474, 685, 802, 848, 920, 1015,<br />

1018, 1023<br />

Graeser R. 824<br />

Graham J. V57<br />

Graham J. 523<br />

Graham T.R. 453<br />

Granata D. 486<br />

Grande S. 219, 710, V11<br />

Grange P. 16, 879<br />

Granger B. 734<br />

Grasso A.A.C. 692<br />

Grasso M. 692<br />

Grasso M. 1067<br />

Gratzke C. 68, 443, 447, 629, 847,<br />

906, 907<br />

Gravis G. 104, 1053<br />

Graw M. 844<br />

Gray R. V78<br />

Greco F. 91, 263, 382, 461, 949, V1,<br />

V50<br />

Green D.A. 276<br />

Green W. 516<br />

Greene P. 598<br />

Greenwell T.J. 775, 776<br />

Gregori A. 817<br />

Gregorini F. 70<br />

Gregório B.M. 29, 30, 413, 903<br />

Grenabo A.L.A. 2<br />

Grenabo L. 740<br />

Grenier N. 87, 1105<br />

Gres P. 283<br />

Griffin T. 97<br />

Grimm M-O. 56, 194, 774<br />

Grimm T. 923<br />

Grinyov A. 169<br />

Grise P. 743<br />

Gritti A. 259<br />

Grobholz R. 133<br />

Grollman A.P. 234<br />

Groskopf J.C. 1045<br />

Gross A.J. 636<br />

Gross O. 637<br />

Gross-Weege M. 1052<br />

Grosse J. 250, 448, 871<br />

Grossman H.B. 577<br />

Grossmann N. 635, 637<br />

Grotenhuis A. 697<br />

Grubb R. 138<br />

Gruellich C. 341<br />

Gruenwald I. 131<br />

Gschwend J.E. 189, 386, 565, 809,<br />

1011<br />

Gsponer J.R. 945<br />

Gu X. 901<br />

Guaglianone S. 480, 881, 1038, V23,<br />

V46<br />

Guate J.L. 229<br />

Guazzoni G. 137, 139, 186, 254, 289,<br />

467, 473, 583, 695, 848, 855,<br />

918<br />

Gubbiotti M. 300, 302, 303, 670<br />

Gudeloglu A. 841, V51, V52, V76<br />

Gudima I.A. 845<br />

Gudjónsson S. 750, 1029<br />

Guerrer C. 301, 305<br />

Guichard G. 426, 427, 429<br />

Guillot A. 104<br />

Guimaraes G.C. 399, 557<br />

Guimerá M. 34<br />

Guirao Piñera M.J. 422<br />

Gulamhusein A. 777<br />

Guleryuz K. 500<br />

Gülpınar Ö. 646, 647<br />

Gündogdu C. 417<br />

Gunnemann A. 897<br />

Guohua Z. 320<br />

Gupta A. 752<br />

Gupta N.S. 709, V14<br />

Guru K. 14, 19, 20, 1031, 1032<br />

Gurung P.M.S. 51, 58<br />

Gust K.M. 50<br />

Gutierrez C. 746<br />

Gutierrez P. 498<br />

Gutin A. 719<br />

Gutiérrez Gutiérrez P.F. 385<br />

Guttilla A. 357, 1017<br />

Gutue C.S. 17<br />

H<br />

Ha H.K. 551, 691, V47<br />

Ha J.Y. 986<br />

Ha S.B. 860<br />

Ha U.S. 445<br />

Haab E. 1004<br />

Haab F. 726, 743, 896, 999, 1004<br />

Haag-Molkenteller C. 741, 744<br />

Haber G-P. 255, 256, 257, 816, V2,<br />

V22, V27<br />

Haberkorn U. 227<br />

Habuchi T. 197, 610, 720, 1100,<br />

1104<br />

Häcker A. 321, 322, 1052<br />

Hadaschik B. 138, 222, 227<br />

Hadfield J. 935<br />

Haefner T. V17<br />

Haendler L. 912, 916<br />

Haese A. 137, 139, 186, 294, 848,<br />

919, 1018<br />

Haferkamp A. 286, 825, 830<br />

Haga K. 121<br />

Hager M. 884<br />

Hai M.A. 638<br />

Haider A. 207<br />

Haider M.A. 588<br />

Haillot O. 999<br />

Haineala B.C. 384<br />

Hainsworth J.D. 97<br />

Hakenberg O.W. 195, 393, 1067<br />

Hakim L. V71<br />

Hakim L. 252, 326, 468<br />

Hakimi Z. 1089<br />

Hakozaki A. 442<br />

Halac M. 479<br />

Halbert G.L. 902, 905, 989<br />

Hall E. 81<br />

Hall J. 623<br />

Hallas N. 775<br />

Hallscheidt P. 341, 344<br />

Ham W.S. 177, 1012<br />

Hamacher J. 890<br />

Numbers refer to abstract numbers<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

441<br />

Indices


Indices<br />

Abstract authors<br />

Hamamoto S. 311<br />

Hamberg H. 287<br />

Hamdy F.C. 135<br />

Hamid R. 775, 776<br />

Hammad F. 609<br />

Hammdy A. 528<br />

Hammerer P.G. 207<br />

Hammers H.J. 100<br />

Hamoen E.H.J. 12<br />

Han D.H. 538<br />

Han D.J. 490<br />

Han H.H. 519<br />

Han J-Y. 632<br />

Han J.H. 786<br />

Han M 719<br />

Han Y.F. 36<br />

Hancock M.L. 102<br />

Hanitzsch H. 707<br />

Hanna N. 820, 927, 956, 960<br />

Hannan J. 326, 327<br />

Hannon Y.A. 146<br />

Hansen J. 686, 920, 1015<br />

Hansen S. 683<br />

Hanson D. 631<br />

Hanzawa T. 121<br />

Hara I. 767, 821<br />

Harada K. 985<br />

Haraz A. 928<br />

Harding C. 781<br />

Harewood L.M. 849<br />

Hariu K. 228<br />

Harke N. V18<br />

Harraz A.M. 1028, 1069<br />

Harrison D.J. 766<br />

Hart A.R. 762<br />

Harza M. 384<br />

Hasan T. 781<br />

Hascicek M. 642<br />

Hasegawa M. 959<br />

Hasegawa S. 818<br />

Hasegawa T. 337<br />

Hashimoto Y. 79, 82, 197, 463, 602,<br />

613, 720<br />

Hashimoto Y. 821. 937<br />

Hashitani H. 66<br />

Hasigov A.V. 419<br />

Hasner F. 707<br />

Hassan H. 37, 843<br />

Hassett J. 20<br />

442 <strong>Programme</strong> <strong>Book</strong><br />

Hassouna M. 307<br />

Hasunuma N. 1104<br />

Hatakeyama S. 79, 82, 197, 463,<br />

602, 613, 720, 1042, 1104<br />

Hatton A. 846<br />

Hatzichristodoulou G. 565, 809<br />

Hatzichristou D. 733<br />

Hatzinger M. 46<br />

Haubold K. 1046<br />

Haunschild J. 671<br />

Hauser J. 356<br />

Haustermans K. 182, 360, 806<br />

Hautmann R. 151<br />

Havrenak E. 600<br />

Hawaux E. 800<br />

Hawkins R.E. 1101<br />

Hayakawa N. 242<br />

Hayashi K. 578<br />

Hayashi M. 450<br />

Hayashi N. 1103<br />

Hayashi T. 1108<br />

Hayashi T. 50<br />

Hayashi Y. 442<br />

Hayes M. 811, 1051<br />

Haymann J-P. 438<br />

Hayn M.H. 1031, 1032<br />

Healy S. 434<br />

Heck M. 809<br />

Hedi R. 520<br />

Hedlund P. 67, 68, 69, 146, 324, 326,<br />

327, 328, 329, 331, 443, 447,<br />

651, 831, 832<br />

Heesakkers J.P. 63, 995<br />

Hefermehl L.J. 246, 635, 637<br />

Hegarty P. 1033<br />

Hegele A. 728, 1099<br />

Heidegger I. 7, 644, 803, 829<br />

Heidenreich A. 106, 452, 674, 801<br />

Heijmink S.W.T.P. 217<br />

Heimann D. 358<br />

Heinrich D. 101<br />

Heinrich E. 24, 1019<br />

Heinz-Peer G. 345<br />

Heinzelbecker J. 1052<br />

Heinzelmann J. 774<br />

Heinzer H. 107, 359, 685, 920, 1006,<br />

1018, 1023<br />

Helfand T. 126, 407<br />

Hellawell G. 268<br />

Helle S.I. 101<br />

Hellsten R. 826<br />

Helou E. V26, V29, V32, V65, V73<br />

Hemal A.K. 1031, 1032<br />

Henderson R. 1096<br />

Hendricken C. 725<br />

Hendriks J.C.M. 755<br />

Heng D.Y.C. 1107<br />

Henneges C. 1096<br />

Hennenberg M. 906, 907, 909<br />

Hennenlotter J. 198, 364, 365, 899,<br />

1022, 1049, 1054, V59<br />

Hennus P.M.L. 648<br />

Henry N. 896<br />

Hensel J. 942<br />

Heo N.J. 860<br />

Herkommer K. 189, 565, 809, 1011<br />

Herman M. 474<br />

Hermann E. 286<br />

Hermann G.H. 577<br />

Hermanns T. 635, 637<br />

Hermans T.J.N. 1037<br />

Hernandez R.K. 675<br />

Hernandez-Fernandez C. 606, 607<br />

Hernández C. 498<br />

Hernández V. 482, 757<br />

Herr H.W. 749<br />

Herrmann T.R.W. 91, 575, 601, 636,<br />

656, V74<br />

Herschorn S. 739, 740, 744<br />

Hersey K.M. 988<br />

Hertle L. 461<br />

Herwig R. 1067<br />

Heschel I. 250, 870, 871<br />

Hess J. 559<br />

Hetet J-F. 87, 283, 1105<br />

Heus I. 912<br />

Heusch G. 251<br />

Hevia Palacios V. 346, 501<br />

Heyman S. 202<br />

Heß J. 155<br />

Hickson I. 824<br />

Hidaka H. 52, 772<br />

Hieda K. 462<br />

Hiess M. 1021<br />

Higashi Y. 572, 819<br />

Hillyer S. 256, 257, 876, V2, V3<br />

Hindley R.G. 585<br />

Hinke A. 192<br />

Numbers refer to abstract numbers


Hinkelammert R. 465<br />

Hinkelbein W. 182, 192, 806<br />

Hintz F. 559<br />

Hirakawa K. 931<br />

Hirao Y. 456<br />

Hirobe M. 337<br />

Hirohashi Y. 767<br />

Hirose M. 311<br />

Hirose Y. 311<br />

Hirshman S. 448<br />

Hisano M. 525<br />

Hitier S. 106<br />

Hitoshi N. 60<br />

Hlasny E. 588<br />

Hobbs C.P. 38, 45, 1077<br />

Hocaoglu Y. 906<br />

Hochreiter W. 160<br />

Hoda R. 1009, 1046<br />

Hodge P.N. 1045<br />

Hoehn A.K. 393<br />

Hoenderop J.G. 63<br />

Hoenjet E. 648<br />

Hofer C. 1011<br />

Hoffmann U. 365<br />

Hofmann R. 338, 728, 1099<br />

Höfner T. 286<br />

Høgset A. 153<br />

Hohenfellner M. 222, 227, 286, 341,<br />

344<br />

Hohneder A. 365, 1049<br />

Hoinoiu B. 884<br />

Holder D.D. 284, 485<br />

Hollenbeck B.K. 1031<br />

Hollywood D. 355<br />

Holm-Larsen T. 405, 406<br />

Holmäng S. 569, 571, 701, 751, 752,<br />

754, 929<br />

Holmberg E. 2<br />

Holmberg M. 683<br />

Homma Y. 64, 67, 333, 764, 1048<br />

Honeck P. 964<br />

Hong B. 80, 196, 478, 490<br />

Hong J.H. 80, 196, 469, 478, 771,<br />

807, 1097<br />

Hong M.K.H 849<br />

Hong S-H. 445, 611<br />

Hong S.J. 177, 269, 810<br />

Hong S.K. 1003<br />

Hong S. 410, 478<br />

Hong Y.K. 165<br />

Hongo F. 1056<br />

Honma I. 121<br />

Hoogenkamp H.R. 872<br />

Hopmans S. 939<br />

Hora M. 575<br />

Horenblas S. 387, 389, 390, 392,<br />

394<br />

Horgan P.G. 902, 905, 989<br />

Horiguchi A. 574, 827<br />

Horn L.C. 393<br />

Horn T. 809<br />

Horninger W. 7, 61, 644, 803<br />

Horsburgh B. 590, 1016<br />

Hortova K. 32<br />

Hoshi A. 21<br />

Hoshino K. 242<br />

Hoskin P. 58<br />

Hosseini-Aliabad A. 751, 1035<br />

Hou Y.C. 247<br />

Houlgatte A. 139, 283, 853<br />

Hounsome L.S. 230<br />

Hovens C.M. 53, 145, 704, 849<br />

Høyer M. 683<br />

Hoznek A. 438, 549, 716, V15<br />

Hrbacek J. 822<br />

Hrouda D. 600<br />

Hruby G.W. 284, 485<br />

Hruby S. 22, 660<br />

Hsieh C-H. 1064<br />

Hsieh J.T. 168<br />

Hsu C.Y. 468, 688, 911<br />

Hu J.H. 247<br />

Hu K. 28, 36, 837<br />

Hu L. 605<br />

Hu X. 859<br />

Huang C.Y. 234<br />

Huang C-H. 205<br />

Huang C-N. 205<br />

Huang E.Y-H. 738, 1088<br />

Huang H.H. 200<br />

Huang J. 193<br />

Huang S-P. 205<br />

Huang J.S. 684, 784<br />

Huang Y.H. 515<br />

Huang Y.R. 28, 36, 837<br />

Huber A. 133<br />

Huber J. 341, 344<br />

Hubert J. 136, 170, 171, 176<br />

Hübner A. 1106<br />

Hubner M. 926<br />

Hübner W. 575, 601<br />

Hueber P.A. 638<br />

Hughes P. 477<br />

Hughes S. 477<br />

Hugosson J. 2, 4, 808<br />

Huguet Pérez J. 378, 489, 494<br />

Huh K.O. 1005<br />

Huland H. 293, 295, 802, 1018, 1023<br />

Hulsbergen-Van De Kaa C. 287<br />

Humanes-Sanchez B. 606, 607<br />

Humphries E. 719<br />

Hunju L. 649<br />

Hupertan V. 576<br />

Huppertz N. 448<br />

Hurault De Ligny B. 500<br />

Hurtz H.J. 1102<br />

Husein M. 528<br />

Hussain M. 100<br />

Hutterer G.C. 347<br />

Hwang E.C. 464<br />

Hwang I. 464<br />

Hwang J.H. 165<br />

Hwang J.W. 786<br />

Hwang T-K. 445, 611<br />

I<br />

Iacoboaie C. 522<br />

Iacovelli N.A. 183, 185<br />

Ibanez-Tallon I. 62<br />

Ibishev H.S. 845<br />

Iborra Juan I. 10, 1007<br />

Ibrahim E. 836<br />

Ide H. 242, 818<br />

Idesako T. 52<br />

Idzenga T. 995<br />

Ifu G. 746, 888<br />

Igawa Y. 64, 67<br />

Iglesias Rutishauser K. 926<br />

Ignacio C. V44<br />

Ihrig A. 341<br />

Iinuma T. 8<br />

Iizuka J. 821<br />

Ikawa K. 504<br />

Ikeda K. 504<br />

Ikeda K. 462<br />

Ikezawa E. 821<br />

Ilbey Y.O. 553<br />

Numbers refer to abstract numbers<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

443<br />

Indices


Indices<br />

Abstract authors<br />

Ilyas R. 316<br />

Imai A. 79, 82, 463<br />

Imamura M. 523<br />

Imamura M. 66<br />

Imanishi K. 602<br />

Imbimbo C. 396, 560, 622, V55<br />

Imkamp F. 656, V74<br />

Immenroth M. 16<br />

Impedovo S. 662<br />

Inferrera A. V1<br />

Ingelmo-Torres M. 236, 237<br />

Ingels A. 761, 975<br />

Inoue K. 834<br />

Inoue S. 462, 666<br />

Inoue T. 610, 1100, 1104<br />

Inoue T. 1103<br />

Intilla O. V67<br />

Ioannides E-I. 733<br />

Ip De Coruña I. 362<br />

Ip De Vall D'Hebron I. 362<br />

Iqbal M. 661, 967<br />

Irani J. 136, 483, 697, 1040<br />

Irjala H. 154<br />

Irving S.O. 658<br />

Irwin B. V6<br />

Isbarn H. 226, 802, 866, 1006, 1023<br />

Isebaert S. 360<br />

Iselin C.E. 356, 721<br />

Ishida H. 603<br />

Ishii C. 240<br />

Ishii K. 978<br />

Ishii T. 1108<br />

Ishika J. 819<br />

Ishikawa H. V68<br />

Ishikawa N. 492<br />

Ishimura F. 1042<br />

Ishioka J-I. 76, 240, 470, 572, 578,<br />

586, 756<br />

Ishioka K. 818<br />

Ishizaki J. 931<br />

Ismail F. 1033<br />

Isoyama T. 339, 925, 951<br />

Itarte E. 768<br />

Ito A. 21<br />

Ito K. 8<br />

Ito K. 57, 144, 574, 827, 976, 977<br />

Ito M. 699<br />

Ito Y. 242<br />

Itoh K. 98<br />

444 <strong>Programme</strong> <strong>Book</strong><br />

Itoh Y. 311<br />

Itoh Y. 311<br />

Ivanenko O. 507<br />

Ivanovski O. 203<br />

Iversen P. 273, 674, 858<br />

Iwamoto H. 339, 925, 951<br />

Iwamoto Y. 978<br />

Iwamura M. 21<br />

Iwasaki K. 77<br />

Izawa J. 1050<br />

Izquierdo Reyes L. 237<br />

Iztueta I. 6, 682<br />

J<br />

Jacobs C.D. 1101<br />

Jacquemet B. 426<br />

Jado J.C. 606, 607<br />

Jaeger W. 50<br />

Jahnson S. 481, 751, 751<br />

Jakobsen H. 122<br />

Jalal A. 23<br />

Jalkanen S. 154<br />

James N. 51, 239<br />

Jameson C. 51, 267<br />

Janetschek G. 22, 884<br />

Jang H.J. 266, 280, 297, 538<br />

Jang S.H. 1072<br />

Jang W.S. 464<br />

Janitzky V. 461<br />

Janssen D.A.W. 63<br />

Janssen M. 338, 348, 703, V31<br />

Jarvelin M-R. 910<br />

Javed S. 351<br />

Javor D. 345<br />

Jecu M. 570<br />

Jefferies E.R. 230<br />

Jeffrey K. 468<br />

Jenks J. 775, 776<br />

Jenster G.W. 824<br />

Jeon H.G. 266, 280, 297<br />

Jeon S.S. 266, 280, 297<br />

Jeon S.H. 612<br />

Jeong B.C. 266, 280, 297<br />

Jeong C.W. 1003<br />

Jeong H. 860<br />

Jeong I.G. 478, 490, 771, 807, 1097<br />

Jeong J.W. 1003<br />

Jeong S.J. 1003<br />

Jeong U.S. 266, 280, 297, 538<br />

Jeong W. 260, 369, 657, 709, 885,<br />

V14, V25<br />

Jeschke S. 22<br />

Jeung J.S. 551<br />

Jewett M.A.S. 588<br />

Ji Y. S. 116, 349<br />

Jiang B. 149, 604, 605<br />

Jiang H.W. 9<br />

Jiao Y. 901<br />

Jichlinski P. 926<br />

Jiménez Cidre M.A. 379, 746, 888<br />

Jimenez Mateos-Cáceres P. 334<br />

Jiménez Alcaíde E. 125, 1073<br />

Jiménez Calvo J. 888<br />

Jin J. 308<br />

Jin Y. 36, 837<br />

Jinga V. 17, 966<br />

Jintetsu J.S. 215<br />

Jinzaki M. 818<br />

Jo Y. 199<br />

Jocham D. 461, 577<br />

Johansson M. 826<br />

Johansson S.L. 571<br />

Johnson M. 81<br />

Jones A. 47, 48<br />

Jones E. 81<br />

Jones L.A. 1045<br />

Jones R. 81<br />

Jones S. 400<br />

Jones T.H. 211<br />

Jong T.P.V.M. 648<br />

Jong Jin O. 165<br />

Joniau S. 182, 188, 360, 468, 471,<br />

686, 688, 697, 806, 911, 1000<br />

Jonsson M. 1035<br />

Joo K.J. 409<br />

Josephson D. 1031, 1032<br />

Joung J.Y. 410, 478, 1001, 1097<br />

Jozkowicz A. 597<br />

Juang H-H. 148<br />

Junaid I. 654<br />

Jünemann K.P. 188, 358<br />

Jung H. 974<br />

Jung H.C. 116, 349<br />

Jung H.R. 986<br />

Jung H.J. 535<br />

Jung J.H. 997<br />

Jung J-L. 170, 171, 176<br />

Jung K. 859<br />

Numbers refer to abstract numbers


Jung S. 612<br />

Jung S.I. 464<br />

Jung T.Y. 519<br />

Jüngel E. 830<br />

Junker K. 56, 194, 338, 774<br />

Jutzi S. 656<br />

K<br />

Kabbinavar F.F. 193<br />

Kachrilas S. 654, 963<br />

Kaczmarek B. 876, V24<br />

Kader A.K. 1031, 1032<br />

Kadoyama K. 1085<br />

Kaestner L. 545<br />

Kaifu M. 199<br />

Kaiser C. 539<br />

Kajioka S. 450<br />

Kajiwara M. 462, 666<br />

Kakies C. 393<br />

Kalaitzi M. 733<br />

Kalaitzis C. 423<br />

Kälble T. 192, 461<br />

Kallidonis P. 25, 91, V4<br />

Kalpinskiy A.S. V43<br />

Kamata S. 572, 819<br />

Kamel G. 547<br />

Kamimura N. 602, 1042<br />

Kamoi K. 215, 414<br />

Kamota S. 931<br />

Kampouri K. 423<br />

Kamradt J. 74, 828, V31<br />

Kanao K. 242, 715, 818<br />

Kanda H. 978<br />

Kandimalla R. 54<br />

Kaneda T. 931<br />

Kaneko G. 959<br />

Kanematsu A. 66<br />

Kanemitsu N. 215<br />

Kang J. 901<br />

Kang S.M. 124, 691<br />

Kang S.H. V47<br />

Kang T.W. 464, 997<br />

Kanno Y. 931<br />

Kanomata N. 199<br />

Kanthabalan A. 717<br />

Kanzaki S. 931<br />

Kaouk J. 20, 91, 255, 256, 257, 552,<br />

816, 876, V2, V3, V22, V27, V30<br />

Kaplan S. 740<br />

Kapoor R. 1027<br />

Kaps H. 306<br />

Karakiewicz P. 78, 140, 178, 233,<br />

276, 474, 573, 576, 701, 752,<br />

754, 814, 820, 929, 956, 1024<br />

Karatas A. 381<br />

Karim O. 475, V78<br />

Karl A. 577, 923<br />

Karmakar D. 541<br />

Karnes J.R. 187, 188, 471, 686, 688,<br />

694, 697, 911<br />

Karsenty G. 245<br />

Karup C. 678<br />

Kasivisvanathan V 138, 218<br />

Kasraie J. 846<br />

Kassouf W. 573, 576, 813<br />

Kastner C. 142<br />

Kasyan G.R. 115<br />

Kata S. 434, 599<br />

Katano H. 931<br />

Kataoka T. 33<br />

Kato H. 938<br />

Kato M. 978<br />

Kato M. 288<br />

Kato Y. 77<br />

Katsuhiro F. 60<br />

Kaushal D. 633<br />

Kaushik D. 957<br />

Kawaguchi M. V68<br />

Kawakami S. 76<br />

Kawamura S. 720<br />

Kawan F. 382, V50<br />

Kawanishi S. 132<br />

Kawanishi Y. 132<br />

Kawano Y. 941, 982<br />

Kawano Y. 228<br />

Kawauchi A. 215, 414, 552<br />

Kay T. 477<br />

Kaya C. 117<br />

Kayali M. 615<br />

Kayanuma K. V68<br />

Kazuhiro K. 60<br />

Kazuhiro S. 8<br />

Kedia G.T. 904<br />

Keegan K.A. 822<br />

Keil C. 1099<br />

Keller H. 790, 795, V70<br />

Kelly J. 51, 58<br />

Ken-Ichi M.K. 444<br />

Kenjiro K. 60<br />

Kent M. 754, 814, 815<br />

Keppenne V.M. 780<br />

Kergoat M. 449<br />

Kern J. 829<br />

Kesavadas T. 19, 20<br />

Kesavan N. 758<br />

Kessler T.M. 70, 665<br />

Keten T. 615<br />

Khairy Salem H. 511<br />

Khalifeh A. 255, V2, V3, V22, V27,<br />

V30<br />

Khalil S. 416<br />

Khan F. 49, 1075, 1081<br />

Khan F. 783<br />

Khan M.S. 14, 1031, 1033<br />

Khan S.A. 19, 1031, 1032<br />

Khan M.S. 477<br />

Khatami A. 808<br />

Khaw K.T. 762<br />

Khazaeli D. 1035<br />

Kheoh T. 97, 105<br />

Khiari R. 520<br />

Khouni H. 520<br />

Khullar V. 308, 672, 725, 741, 910<br />

Kibel A.S. 1031, 1032<br />

Kieft J.H. 648<br />

Kihara K. 76, 240, 470, 572, 578,<br />

586, 756, 819, 950, 979, V21,<br />

V61<br />

Kijima T. 578, 979<br />

Kikkawa K. 767<br />

Kikuchi E. 242, 813, 818, 959<br />

Kilani T. 520<br />

Kilicarslan H. 652<br />

Kim A. 410, 490, 533<br />

Kim B.S. 253, 428<br />

Kim B.W. 253, 428<br />

Kim B.H. 986<br />

Kim C.H. 974<br />

Kim C-S. 80, 196, 466, 469, 478, 771,<br />

807, 1097<br />

Kim C.I. 535, 986<br />

Kim D. 533<br />

Kim D.S. 612, 691<br />

Kim D.Y. 519<br />

Kim H.Y. 213<br />

Kim H.J. 488<br />

Kim H.T. 253, 428<br />

Numbers refer to abstract numbers<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

445<br />

Indices


Indices<br />

Abstract authors<br />

Kim J.H. 325<br />

Kim J.W. 955, 994<br />

Kim J. 177<br />

Kim J. 469, 1005, 1010<br />

Kim J.W. 955, 994<br />

Kim J.J. 280<br />

Kim K.H. 974<br />

Kim K.B. 1003<br />

Kim K.H. 349, 986<br />

Kim K.K. 213<br />

Kim K.S. 533<br />

Kim K.H. 269, 771, 810, 1012<br />

Kim K.T. 974<br />

Kim K.H. 1012<br />

Kim M.K. 488<br />

Kim S.W. 445, 611<br />

Kim S.D. 691<br />

Kim S.J. 460<br />

Kim S.U. 325<br />

Kim S.P. 75, 924<br />

Kim S. 551<br />

Kim S.W. 332<br />

Kim S. V47<br />

Kim S.J. 445, 611<br />

Kim S. 435<br />

Kim S.Y. 213<br />

Kim S.I. 460, 519<br />

Kim S.O. 464<br />

Kim T.B. 974<br />

Kim T.H. 253, 428<br />

Kim T.S. 551, 691, V47<br />

Kim W. 490<br />

Kim Y.J. 997<br />

Kimuli M.N. 549<br />

Kimura T. 492<br />

Kimura T. 98<br />

Kimura Y. 1056<br />

Kin S. 199<br />

Kinder R.B. 783<br />

King K. 51<br />

Kingsmore D. 374, 377, 495<br />

Kingswood J.C. 981<br />

Kinoshita H. 21<br />

Kinsella J. V62<br />

Kira S. 71<br />

Kirby A.C. 910<br />

Kirkham A.P. 218, 267, 391, 585,<br />

717<br />

Kirkwood L. 157<br />

446 <strong>Programme</strong> <strong>Book</strong><br />

Kirschner-Hermanns R. 448<br />

Kitahara S. 819<br />

Kitamura H. 337, 603<br />

Klatte T. 575, 601, 991<br />

Klaver M. 1089<br />

Klein J. 356<br />

Klein J. 23<br />

Kleinclauss F. 283, 426, 427, 429<br />

Klimov A.V. 954<br />

Klingler H-C. 345, 991<br />

Klink J. 256<br />

Klocker H. 7, 803, 829<br />

Kloke H.W. 493<br />

Klorek T. 1011<br />

Klosterhalfen B. 251<br />

Klotz D. 221<br />

Klotz L. 138<br />

Klotz T. 461<br />

Kluth L.A. 78, 151, 156, 276, 473,<br />

474, 573, 701, 724, 752, 754,<br />

813, 814, 815, 929, 1004<br />

Kneitz B. 936<br />

Knipper S. 636<br />

Knoll T. 660, 964, 1067<br />

Knox J.J. 1107<br />

Ko M. 767<br />

Ko W.J. 519<br />

Ko Y.H. 116, 349<br />

Kobayashi H. 242, 818<br />

Kobayashi J. V68<br />

Kobayashi K. 462, 666<br />

Kobayashi M. 446<br />

Kobayashi S. 240, 756<br />

Kobayashi T. 311<br />

Kobayashi T. 92<br />

Kocaturk H. 417<br />

Kockelbergh R.C. 81, 455<br />

Kocot A. 282, 863<br />

Kodama Y. 767, 821<br />

Koehler C. 321<br />

Koellermann J. 393<br />

Koen M. 644<br />

Koga F. 76, 240, 470, 572, 578, 586,<br />

756, 819, 950, 979, V21, V61<br />

Kogan M.I. 212, 419, 787, 797, 845,<br />

857<br />

Kogevinas M. 229<br />

Koh L.T. 318, 343<br />

Kohjimoto Y. 767<br />

Köhler A. 348<br />

Kohri K. 311<br />

Koie T. 79, 82, 197, 463, 602, 613,<br />

720, 1042<br />

Koike H. 938<br />

Koizumi S. 71<br />

Koji O. 60<br />

Kok E.T. 135<br />

Kolesnyk M. 159, 892<br />

Kollberg P. 750<br />

Kölle S. 844, 847<br />

Kollias S. 70<br />

Kollmannsberger C.K. 1107<br />

Komai Y. 92<br />

Komohara Y. 982<br />

Komyakov B.K. 562<br />

Kondo T. 821<br />

Kong D. 604<br />

Koni A. 642<br />

König F. 371<br />

Konstantinidis C. 6, 682<br />

Konstantinidou E. 733<br />

Koo B. 142<br />

Kopp R. 552<br />

Kopper B. 461<br />

Korahanis N. 171<br />

Kosaka T. 818<br />

Köse O. 111, 794<br />

Kotov S.V. 796<br />

Kotov V. 94<br />

Koumi T. 925<br />

Kouriefs C. 879<br />

Koutlidis N. 283<br />

Kovylina M. 350<br />

Kowalczyk A. 145, 849<br />

Kowalczyk T.K. 869<br />

Kowey P. 739<br />

Kowlaczyk A. 53<br />

Kozakowska M. 597<br />

Kozlov R. 169<br />

Krahn T. 1046<br />

Kramer G. 345<br />

Kranzbühler B. 637<br />

Krasny S.A. 278<br />

Krasteva-Christ G. 62<br />

Kraus S. 722<br />

Krause A. 461<br />

Krebs M. 936<br />

Krege S. 559<br />

Numbers refer to abstract numbers


Kretschmer I. 155<br />

Kristiansen G. 287, 393<br />

Kristmundsson T. 1029<br />

Kroeger N. 193, 1107<br />

Kron M. 189, 1011<br />

Kruck S. 306, 629, 656, 1062, V71<br />

Kruglikov V. 159, 892<br />

Ktech N. V36, V39<br />

Ku J.Y. 691<br />

Kübler H. 809<br />

Kubo T. 676<br />

Kubota Y. 1103<br />

Kucharczyk W. 588<br />

Kuczyk M.A. 198, 241, 329, 338,<br />

348, 656, 904, V74<br />

Kuderinov S. 893<br />

Kudo S. 602<br />

Kudou S. 84<br />

Kuehhas F.E. 345, 1067<br />

Kueppers F. 108<br />

Kufer R. 151<br />

Kufner M. 549<br />

Kühs U. 364, 1049<br />

Kukk L. 680<br />

Kulchavenya E. 620<br />

Kulkarni G. 270<br />

Kulkarni P. 1048<br />

Kumagai J. 824<br />

Kumagai L.Y. 557<br />

Kumano M.K. 487<br />

Kumar R. 876, 885, V14, V24, V25<br />

Kumar P.V.S. 47, 48<br />

Kumar V. 418, 421, 424<br />

Kume H. 333, 764<br />

Kummer W. 62<br />

Kumsar ¸S. 111, 794<br />

Künstle G. 671<br />

Kun Suk K. 649<br />

Kundt G. 195<br />

Kuntz N.J. 653, 661, 967<br />

Kunz A. V18<br />

Kuo H-C. 742, 1090<br />

Kuppevelt T.H. 870<br />

Kurita Y. 998<br />

Kuroda K. 574, 827<br />

Kuroiwa K. 765<br />

Kurosch M. 825<br />

Kurtz F. 386<br />

Kuru T.H. 222, 227<br />

Kurz M. 70<br />

Kusama H. 446<br />

Kusuma M. 400<br />

Kusumoto H. 767<br />

Kutta N. 461<br />

Kwiatkowski M. 133<br />

Kwon C.H. 409<br />

Kwon D.D. 464, 519<br />

Kwon E. 151<br />

Kwon G.Y. 280<br />

Kwon J.B. 253, 428<br />

Kwon S.Y. 253, 428<br />

Kwon T.G. 253, 428<br />

Kyosuke K. 713<br />

Kypta R. 941<br />

Kyriazis I. 25, V4<br />

Kyung Hyun M. 649<br />

L<br />

La Croce G. 140, 187, 328, 363, 748<br />

La Macchia M. 183, 184<br />

Labanaris A.P. 690, V20, V34<br />

Lacarriere E. 283<br />

Lacombe M. 472<br />

Lacoste J. 472<br />

Ladurner Rennau M. 7, 803<br />

Lagabrielle S. 1105<br />

Laguna-Pes M.P. 13, 594<br />

Lahdensuo K. 274<br />

Lahme S. 143, 373, 461, 962<br />

Lahoz Garcia C. 312<br />

Lai M.K. 840<br />

Laird A. 298, 766<br />

Lam T. 370, 523<br />

Lam W. 389, 593<br />

Lamanna E. 579<br />

Lamche M. 1021<br />

Lammens M.M.Y. 870<br />

Lammers R.J.M. 700, 755<br />

Lanchbury J. 719<br />

Lanciotti M. 693<br />

Landkammer Y. 22<br />

Landman J. 598<br />

Lane J.A. 135<br />

Lang C. 72, 514<br />

Lang H. 170, 176<br />

Lang J.M. 171<br />

Langenhuijsen J.F. 336, 493<br />

Langley S. 351<br />

Laniado M. 475, V78<br />

Lanoe M. 458<br />

Lanwehr D. 293<br />

Lanz M. 623<br />

Lapini A. 93, 592, 887<br />

Larcher A. 137, 254, 583, 848, 855<br />

Largo R. 637, 868<br />

Larré S. 283, 483, 697, 778, 1004<br />

Larson T. 631<br />

Lasaponara F. 376<br />

Lau M.W. 395, 400<br />

Laudano M.A. 724<br />

Lavigueur-Blouin H. 175, 179, 233,<br />

262, 718, 927, 960, 1024<br />

Lavilledieu S. 283<br />

Lavrinenko A. 893<br />

Lawrence E.M. 142, 224<br />

Lawrentschuk N. 270<br />

Laydner H. 255, V2, V3, V22, V27<br />

Laymon M. 928, 1028<br />

Lazaro A.R. 200<br />

Lazaro-Fernandez A. 606, 607<br />

Lazarus J.M. 545<br />

Lazzeri M. 137, 139, 254, 583, 729,<br />

848, 855<br />

Le Coguic G. 472<br />

Le Corvoisier P. 137, 848<br />

Le Moulec S. 104<br />

Lebacle C. 283<br />

Lebdai S. 87, 1105<br />

Lebid L. 159, 892<br />

Lebret T. 681, 930<br />

Lechevallier E. 245<br />

Ledo Cepero M.J. V33<br />

Ledyaev D. 354<br />

Lee B. 257<br />

Lee B.K. 1003<br />

Lee C.J. 860<br />

Lee C.H. 691<br />

Lee D. 114<br />

Lee D.H. 269, 512<br />

Lee D.K. 435<br />

Lee H.J. 325<br />

Lee H.L. 435<br />

Lee H.M. 266, 280, 297<br />

Lee H.S. 1003<br />

Lee H.Y. 1012<br />

Lee J.H. 435<br />

Lee J.K. 1003<br />

Numbers refer to abstract numbers<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

447<br />

Indices


Indices<br />

Abstract authors<br />

Lee J-L. 1107<br />

Lee J.N. 253, 428<br />

Lee J.W. 317, 1072<br />

Lee J.Y. 445, 611<br />

Lee J.Y. 810, 1012<br />

Lee J.Z. 691<br />

Lee K.H. 1001<br />

Lee K.B. 460<br />

Lee K.S. 266, 280, 297, 538<br />

Lee L.S. 921<br />

Lee M.Y. 317<br />

Lee R.K 78, 276, 638, 724, 1004<br />

Lee S.C. 974, 1003<br />

Lee S.E. 1003<br />

Lee S.K. 213<br />

Lee S.M. 1005<br />

Lee S.H. 786<br />

Lee S.H. 269<br />

Lee S.J. 612<br />

Lee S.L. 318, 343<br />

Lee S-W. 538<br />

Lee S-Y. 100<br />

Lee W.K. 213<br />

Lee Y-C. 205<br />

Lee Y.G. 213, 786<br />

Lee Y.S. 213<br />

Leenders W.P.J. 336<br />

Lees M. 476<br />

Legal S. 283<br />

Legman P. 141<br />

Legoux C. 283<br />

Lehmann J. 74<br />

Leibar Tamayo A. 125<br />

Leibovich B.C. 957<br />

Leichtle U. 1062<br />

Leidenberger P. 1049<br />

Leitenberger A. 461<br />

Lemack G.E. 722<br />

Lenaghan D.R. 539<br />

Lenherr O. 143<br />

Lenkiewicz E. 945<br />

Leon Zamorano J.J. 334<br />

Leonardi R. 561<br />

Leong H.S. 1050<br />

Leonhäuser D. 448, 871<br />

Leroy X. 237<br />

Lerut E. 360<br />

Leslie S. 220, 265, 361, V45, V79<br />

Leto A. 914<br />

448 <strong>Programme</strong> <strong>Book</strong><br />

Leva Vallejo M. 888<br />

Levine E. 558<br />

Lewis D. 833<br />

Lewis D. 161<br />

Lewis H. 53<br />

Lewis J. 1050<br />

Lewis R. 81<br />

Lewith G. 275<br />

Leydon G. 275<br />

Leyh-Bannurah S-R. 359, 1023<br />

Li F. 33, 35<br />

Li H. 119<br />

Li H. 162, 249, 505<br />

Li J. 105<br />

Li J.M. 932<br />

Li N. 50<br />

Li W. 901<br />

Li Marzi V. V69<br />

Liao C.H. 335, 742, 1090<br />

Liao Y. 149, 948<br />

Liatsikos E. 25, 91, 660, 1067, V4,<br />

V17<br />

Liberati E. 698<br />

Liberman D. 638<br />

Libertino J. 854<br />

Liebhardt M. 1052<br />

Liedberg F. 750, 751<br />

Liede A. 675<br />

Liedl B. 844, 847, 897<br />

Liguori G. 614, 838, V55<br />

Lilja H. 4, 850, 856, 858, 1039<br />

Lillaz B. 95<br />

Lim B.J. 410, 490, 533<br />

Lim G.S. 1072<br />

Lim J.H. 478<br />

Lim L.Y. 623<br />

Lim S.K. 810<br />

Lima E.A.R. 968<br />

Limani K. 800<br />

Lin A.T.L. 515, 684, 735, 738, 1088<br />

Lin C.D. 1064<br />

Lin C-C. 515, 735, 738, 784, 1088<br />

Lin H.H. 723<br />

Lin J-P. 738, 1088<br />

Lin M.I. 723<br />

Lin W.A. 723<br />

Lin W.C.P. 684<br />

Lin X. 9<br />

Lindblom G. 481<br />

Lindholm C. 664<br />

Lindner U. 588<br />

Ling T.L. 784<br />

Lipczyński W. 597<br />

Lipkin M.E. 653, 661, 967<br />

Lipowska-Bhalla G. 1101<br />

Liske P. 143, 373, 962, 1067<br />

Lissiani A. 817<br />

Lista F. 524, V5<br />

Lista G. 137, 254, 583, 848, 855<br />

Litman H. 722<br />

Littleton R. 659<br />

Litzensberger A. 195<br />

Liu C.C. 205<br />

Liu F. 9<br />

Liu F. 149, 948<br />

Liu J.H. 932<br />

Liu M. 149<br />

Liu S.P. 335<br />

Liu X. 326, 327<br />

Liu X. 604, 605<br />

Liu Y. 320<br />

Liu Y.P. 840<br />

Lizée D. 726, 896<br />

Ljungberg B 751<br />

Lledo-Garcia E. 498, 606, 607<br />

Llorens De Knecht E. 531, V41, V63<br />

Llorens Martinez F.J. 888<br />

Llorente C. 482, 757<br />

Lloyd T. 367<br />

Lluel P. 440<br />

Lo F. 935<br />

Loch T. 461<br />

Lodde M. 61<br />

Loeser A. 863<br />

Logadottir Y. 664<br />

Logothetis C.J. 97<br />

Lohse C.M. 957<br />

Lokeshwar B. 937<br />

Lokman U. 274<br />

Lokshin K. 1086<br />

Lombardi A. 828<br />

Lombardo R. 412<br />

Long D. 948, 961, 1061<br />

Long J.A. 87, 256, 257, 563, 564,<br />

816, 1105, V2<br />

Long R.M. V17<br />

Longo F. 596<br />

Longo N. 172, 396, 560<br />

Numbers refer to abstract numbers


Lopater J. 930<br />

Lopes A. 399, 557<br />

Lopes T. 210<br />

López B. 482<br />

Lopez J.M. 532<br />

Lopez L. V26, V29, V32, V65, V73<br />

Lopez-Beltran A. 287, 393<br />

Lopez Carmona F. 312<br />

López-Costea M.A. V41, V63<br />

López Cubillana P. 385<br />

López-Fando Lavalle L. 346, 888<br />

Lopez Farre A. 334<br />

López González P. A. 385<br />

López-Guerrero J.A. 10<br />

López-Hellin J. 768<br />

López-Pacios M.A. 768<br />

López Sánchez D. 556, 1036<br />

Loran O.B. 796<br />

Lorente Garcia D. 682, 768<br />

Lorenz A. 1062<br />

Losa A. 583<br />

Lossnitzer A. 1058<br />

Lotan Y. 78, 276, 474, 576, 701, 752,<br />

754, 813, 814, 815, 929<br />

Lotfi A. 511<br />

Loutochin O. 244, 785, 891<br />

Lozano F. 232<br />

Lozano J.J. 236, 237<br />

Lozano M. 491<br />

Lu S-H. 315<br />

Lubbad L. 609<br />

Luben R. 762<br />

Lucarelli G. 662, V49<br />

Lucas C. 387<br />

Lucatello B. 95<br />

Luccarelli G.L. 372<br />

Lucci Chiarissi M. V11<br />

Luciani L.G. 459, 509<br />

Lucianò R. 187, 331, 694<br />

Lück A. 1106<br />

Lücke K. 1046<br />

Lucky M. 400<br />

Lüdecke G.C. 371, 707<br />

Ludt F. 728<br />

Ludwig T.A. 1002<br />

Lughezzani G. 137, 254, 388, 398,<br />

848, 855<br />

Luiz M. V58<br />

Łukasik D. 279<br />

Lumen N. 191<br />

Lunardi P. 283<br />

Lunelli L. 352, V64<br />

Luque M.P. 206, 208, 313, 436<br />

Lusch A. 598, V33<br />

Lusuardi L. 22, 815, 884<br />

Lv Y.Q. 28<br />

Lynch C. 590<br />

Lynch M. 879<br />

Lynch T.H. 355<br />

Lynn N.N.K 846<br />

M<br />

Maaroufi J. 520<br />

Maccagnano C. 363, 748<br />

Maccario M. 95<br />

Macdiarmid S. 741<br />

Macek P. 352, 883, V48, V64<br />

Machado N.C. 30<br />

Macintyre G. 53, 145, 849<br />

Mackenzie M.J. 1107<br />

Mackenzie R. 799<br />

Maclean D. 100<br />

Maclennan S. 523<br />

MacNeil S. 109, 110, 873<br />

Madaan S. 49, 1075<br />

Madero R. 702<br />

Madersbacher S. 992<br />

Madurga Patuel B. 888, V33<br />

Maegbaek M.L. 675<br />

Maekawa S. 764<br />

Maeta K. 33<br />

Maffezzini M. 864<br />

Magalon G. 245<br />

Magalon J. 245<br />

Maggi M. 211, 411<br />

Magri V. 160<br />

Magyar C.E. 193<br />

Mahendran R. 758<br />

Mahfouz W. 537, 891<br />

Mahmalji W. 49<br />

Maini C.L. 480<br />

Mainwaring P. 97<br />

Makanjuola J.K 16, 879, 1076<br />

Makar A. 296<br />

Makarevic J. 825, 830<br />

Malats N. 229, 238, 697<br />

Malavaud B. 136<br />

Malet J.M. 229<br />

Mallofre C. 237<br />

Malmsten U.G.H. 120<br />

Malmstrom P. 238, 697<br />

Malone-Lee J. 736<br />

Malossini G. 459, 509, 619<br />

Maltry N. 941<br />

Mamoulakis C. 521, 523<br />

Mandal S. 541<br />

Mändar R. 216<br />

Mandhani A. 1027<br />

Manea I. 384<br />

Maneschi E. 411<br />

Manferrari F. 454, 711<br />

Manfredi M. 219, 710, V11<br />

Mangano A. 1017<br />

Mangera A. 910<br />

Mangiapia F. 560, 622<br />

Mangiarotti B. 596<br />

Manjunath A. V57<br />

Manka L. 133<br />

Mannweiler S. 347<br />

Mano R. 697, 815<br />

Maraj B.H. 736<br />

Maramhy H. 836<br />

Marcelli F. V28<br />

Marchesi J.R. 161<br />

Marchioro G. 686, 688, 864, 911<br />

Marconi L.S.O. 13, 375, 1079, 1082<br />

Marcén Letosa R. 501<br />

Marechal J-M. 180<br />

Marenghi C. 368<br />

Margaritis Guler S.S. 384<br />

Margolis D. 138<br />

Margulis V. 78, 576, 813<br />

Mari M. 864<br />

Mariani C. 1008<br />

Mariani L. 83, 1055<br />

Mariani S. 517<br />

Marien A. 220<br />

Marignol L. 355<br />

Marks L. 138<br />

Maroof A. 836<br />

Marsaud A. 1059<br />

Marschner N. 1102, 1106<br />

Marshall J. 868<br />

Marszałek A.M. 869<br />

Martel J. 482<br />

Martha J. 211<br />

Martin N. 401, 739<br />

Numbers refer to abstract numbers<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

449<br />

Indices


Indices<br />

Abstract authors<br />

Martin X. 170, 171, 180, 705<br />

Martin-Morales A. 211<br />

Martínez Castaño I. 422<br />

Martínez Peralta H.L. 385<br />

Martínez-Piñeiro J.A. 702<br />

Martínez-Piñeiro L. 702, 851<br />

Martínez-Salamanca J.I. 576, 813,<br />

1004<br />

Martini T. 592<br />

Martins Silva C. 669<br />

Martinschek A. 24, 1019<br />

Martorana G. 172, 264, 271, 454,<br />

693, 711, 887<br />

Maruccia S. 540, 566, 567, 798<br />

Maruschke M. 195<br />

Maruyama K. 446<br />

Maruyama S. 931<br />

Marx G. 99<br />

Marzocco M. V69<br />

Masago T. 339, 925, 951<br />

Masala A. 592<br />

Masaru K. 60<br />

Masashi K. 713<br />

Maschino A. 850<br />

Mascle L. 352<br />

Masedu F. 698<br />

Masieri L. 93, 259, 693<br />

Masius R. 54<br />

Mason M. 106<br />

Masood J. 654, 963<br />

Masoud A. 668<br />

Massard C. 104<br />

Massie C. 935<br />

Masson-Lecomte A. 261, 283, 753<br />

Massoner P. 829<br />

Masuda H. 76, 240, 470, 572, 578,<br />

586, 756, 819, 950, V21, V61<br />

Masumori N. 337, 404, 603, 747<br />

Mateo E. 1030, 1034, V5, V7<br />

Mateos A. 229<br />

Mateu L. 595<br />

Mathieu R. 852<br />

Matikainen M. 1039<br />

Matloob R. 140, 173, 467, 953<br />

Matsubara A. 462, 666<br />

Matsuda H. 931<br />

Matsuda T. 21<br />

Matsukawa Y. 288, 779<br />

Matsumoto K. 242, 818<br />

450 <strong>Programme</strong> <strong>Book</strong><br />

Matsumoto M. 663<br />

Matsumoto R. 998<br />

Matsumoto R. 931<br />

Matsumoto T. 676<br />

Matsumura N. 767<br />

Matsuo K. 288<br />

Matsuo T. 150<br />

Matsuoka Y. 76, 240, 470, 572, 578,<br />

586, 756, 819, 950, V21, V61<br />

Matsushita K. 33, 35, 842<br />

Mattei A. 554<br />

Matthes K. V12<br />

Matthes S. 194<br />

Matveev B. 90<br />

Matveev V.B. 88, 90, 954<br />

Maulà V. 147<br />

Maurer S. 243, 248, 791<br />

Maurer T. 809<br />

Maurin C. 87<br />

Mavilla L. 486<br />

Maxwell P. 935<br />

May M. 282, 286, 340<br />

Mazerolles C. 483<br />

Mazzoli S. 166, 508, 509, 619<br />

Mazzon G. 838<br />

Mazzotti G. 579<br />

McCartan N. 585<br />

McCluskey S.A. 588<br />

McCormack G. 296<br />

McDougall E.M. 598<br />

McGovern M. V62<br />

McGregor R. 963<br />

McKiernan J.M. 284, 485<br />

McLeod N. V57, V66<br />

McNeill S.A. 298, 922<br />

McNicholas T. 137, 848<br />

McVary T. 126, 407<br />

Meacci F. 508<br />

Meaney J.F. 355<br />

Mearini L. 933<br />

Medeiros Jr J.L. 29<br />

Medica M. 264, 887<br />

Medina R. 232, 362<br />

Medina-Lopez R.A. 804, 917<br />

Medina-Polo J. 773, 1073<br />

Meehan R.R. 766<br />

Meeks J.J. 749<br />

Mege-Lechevallier F. 180<br />

Mehedint D. 882<br />

Mehik A. 160<br />

Mehner J. 890<br />

Mehnert U. 70<br />

Meidahl Petersen P. 683<br />

Meiers I. 353<br />

Meinhardt M. 984<br />

Meinhardt W. 392, 394<br />

Meister B. 322, 323<br />

Méjean A. 170, 171, 176<br />

Melamed J. 138<br />

Melchior-Becker A. 155<br />

Mele F. 219, 710, V11<br />

Meliani E. 508<br />

Mencarini M. V69<br />

Mengual L. 236, 237<br />

Menigoz A. 441<br />

Menon M. 20, 119, 158, 260, 369,<br />

497, 526, 534, 625, 657, 659,<br />

709, 885, 915, 1031, 1070, V14,<br />

V24, V25<br />

Menon S. 935<br />

Mentine N. 1059<br />

Mercier F. 104<br />

Merigot De Treigny O. 87<br />

Mermerkaya M. 527, 646<br />

Merseburger A.S. 198, 282, 329,<br />

575, 601<br />

Meseguer A. 768<br />

Meskawi M. 175, 178, 233, 262,<br />

718, 820, 927, 956, 1024<br />

Mestre C. 378<br />

Metcalfe C. 135<br />

Meuleman E.J. 211<br />

Meyer D. 310<br />

Meyer S.E. 1045<br />

Miah S. 44<br />

Mian C. 61<br />

Micali S. 439<br />

Micco M. 823<br />

Michaelson D. 100<br />

Michel M.S. 321, 322, 323<br />

Michels L. 70<br />

Michiels J.F. 1059<br />

Michio N. 59<br />

Michl U.H.G. 293, 295, 1006, 1018,<br />

1023<br />

Mickisch G.H. 680<br />

Miernik A. 1067<br />

Miersch J. 907<br />

Numbers refer to abstract numbers


Mihalache A. 542<br />

Miki T. 8, 215, 414, 1056<br />

Milani A. 83<br />

Miljak M. 906<br />

Millan F. V35<br />

Miller D. 32<br />

Miller F. 629, 861, 1022, V59<br />

Miller K. 108, 192, 678, 853, 859<br />

Miller O. 894<br />

Mills I. 935<br />

Milner V. 296<br />

Milsom I. 120, 739<br />

Mimata H. 444<br />

Min G.E. 435<br />

Minagawa S. 228<br />

Minami K. 931<br />

Minami T. 98, 1108<br />

Minami T. 1108<br />

Minervini A. 93, 172, 259, 264, 340,<br />

592, 887<br />

Minhas S. 129, 391<br />

Minich A. 958<br />

Minnillo B. V12<br />

Miocinovic R. 816<br />

Mirabile G. 486<br />

Mirciulescu V. 542, V37<br />

Mirone V. 264, 289, 340, 396, 560,<br />

622, 714, 887, 1014, V55<br />

Mirtti T.K. 154, 274<br />

Mirylenka L.V. 285, 958<br />

Mirzazadeh M. 558<br />

Mischinger J. 1054<br />

Mishriki S. 370<br />

Mistretta F.A. 69, 254, 328, 583<br />

Mitchell T.J. 823<br />

Mitra A. 815<br />

Mitsunari K. 150<br />

Mitsuru S. 610<br />

Mitsuzuka K. 720<br />

Mitusov V. 419, 787, 797<br />

Miura M. 1100<br />

Miyaji Y. 199<br />

Miyajima A. 21, 242, 818, 959<br />

Miyajima N. 931<br />

Miyake H. 33, 35, 487, 663, 842,<br />

862, 940, 983, 1047<br />

Miyamoto K. 462<br />

Miyamoto T. 71<br />

Miyata Y. 150<br />

Miyazaki Y. 242, 818<br />

Miyazaki Y. 699, 1091<br />

Miyazawa Y. 938<br />

Miñana B. 232, 362<br />

Mmdouh A. 528<br />

Mochizuki T. 931<br />

Mochizuki T. 71<br />

Modlin C. V3<br />

Mofferdin A. 439<br />

Mohammed A.A. 455<br />

Mohammed N. 382, V50<br />

Mohanad M. 966<br />

Mohee A. 502, 617<br />

Mohrhardt S. 364<br />

Moiseenko T. 350<br />

Mojena-Sanchez M. 606, 607<br />

Molander U. 120<br />

Moldoveanu C. 570<br />

Molimard B. 283<br />

Molina A. 97, 105<br />

Molina R. 1068<br />

Molisso G. V67<br />

Moll J.M. 824<br />

Moltzahn F. 688<br />

Mombelli G. 996<br />

Mombet A. 589, 1020<br />

Momma T. 242, 818<br />

Momokazu G. 713<br />

Monagas Arteaga S. V60<br />

Mondaini N. 166, 509, 619<br />

Mondino P. 174<br />

Mongiat-Artus P. 87<br />

Monish A. V6<br />

Monrós Lliso J.L. 10, 1007<br />

Monsalve C. 496<br />

Montanari E. 596<br />

Montes De Oca L. 108, 587<br />

Montesino M. 702<br />

Montiel R. V36, V39<br />

Montironi R. 287<br />

Montorsi F. 78, 173, 575, 576, 601,<br />

693<br />

Moon D.G. 955, 994<br />

Moon K.H. 116, 349<br />

Moon S.H. 538<br />

Moore C. 138, 218, 267, 275<br />

Morales M. 437, 1043<br />

Moran D.C. 355<br />

Moran S. 100<br />

Moran Pascual E.J. 543<br />

Mordasini L. 665<br />

Moreira C. 168<br />

Morelli A. 411, 579<br />

Moreno Alarcón C. 385, 422<br />

Moreno Jimenez J. 312<br />

Morgenthaler N.G. 1046<br />

Morgia G. 864<br />

Mori H. 132<br />

Mori K. 79, 82, 197, 1042<br />

Morikawa H. 228<br />

Morikawa N. 504<br />

Morimoto S. 572, 819<br />

Moriya T. 199<br />

Morizane S. 339, 925, 951<br />

Morlacco A. 880<br />

Morlacco A. 259<br />

Morote J. 6, 108, 682, 768<br />

Morra I. 875, V11<br />

Morris S. V62<br />

Mortezavi A. 799, 868<br />

Mortimer P. 100<br />

Mosaheb N. 127<br />

Mosbah A. 928, 1028, 1038<br />

Moschini M. 146, 331, 363, 748, 953<br />

Moseley H. 599<br />

Mosquera J. 229<br />

Moss S. 2<br />

Mostafa M. 836<br />

Mostafa S. 836<br />

Mostafid H. 230<br />

Mota A. 375, 1079<br />

Mota P.K. 525<br />

Motiwala H. 475, V78<br />

Motoshima T. 982<br />

Mottet N. 136, 170<br />

Mottrie A. 254, 1031, 1032<br />

Mottrie A. 186, 258, 290, 913<br />

Mourey E. 171, 176<br />

Mouri G. 931<br />

Moursy E. 528<br />

Moussa A. 537<br />

Mueller-Allisaat B. 321<br />

Muftuoglu S. 643<br />

Muguruma H. 132<br />

Mühr M. 194<br />

Mulders P.F.A. 97, 105, 336, 980<br />

Mulhall J. 123<br />

Mulla M. 16<br />

Numbers refer to abstract numbers<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

451<br />

Indices


Indices<br />

Abstract authors<br />

Müller A. 635, 637<br />

Muller B.G. 594<br />

Müller G. 167, 618<br />

Müller L. 1102, 1106<br />

Müller S.C. 286<br />

Müller Arteaga C. 888<br />

Mullins J. 876<br />

Multescu R.D. 570, V37<br />

Mundhenk J. 364, 1022, 1049, 1054,<br />

V59<br />

Muneer A. 129, 391<br />

Munegato S. 174<br />

Mungan N.A. 128<br />

Muntañola P. 229<br />

Murakami R. 613<br />

Muramaki M. 862<br />

Murat P. 823<br />

Murby B. 395<br />

Murez T. 283<br />

Murphy D.G. 946<br />

Mursi K. 536<br />

Murta C.B. 525<br />

Muselaers C.H.J. 336, 980<br />

Musitelli S. 1078<br />

Musquera Felip M. 378, 383, 489,<br />

491, 494, 496, 498, 639<br />

Muthen N. 890<br />

Mynderse L. 631<br />

Mytilekas K-V. 733<br />

N<br />

Na R. 9, 901<br />

Nabebina T.I. 278<br />

Naber K. 166<br />

Nabi G. 599<br />

Naboka Y.L. 845<br />

Nagae G. 764<br />

Nagahama K. 572, 819<br />

Nagai A. 199<br />

Nagata Y. 764<br />

Nagele U. 91, 549, 656, 1062, V74<br />

Naito S. 450, 765<br />

Naitoh Y. 215, 414<br />

Nakagawa K. 21, 242, 818, 959<br />

Nakagawa M. 52, 772<br />

Nakagawa T. 98<br />

Nakagomi H. 71<br />

Nakaigawa N. 1103<br />

Nakajima H. 121<br />

452 <strong>Programme</strong> <strong>Book</strong><br />

Nakajima Y. 818<br />

Nakamoto M. 361, V45, V79<br />

Nakamura K. 504<br />

Nakamura T. 1056<br />

Nakamura Y. 77<br />

Nakanishi Y. 240<br />

Nakano Y.N. 487<br />

Nakashima T. 132<br />

Nalagatla K 969<br />

Nam J.K. 759<br />

Nanda J. 766<br />

Naoto S. 713<br />

Napodano G. V67<br />

Napoli R. 838<br />

Nappi R.E. 894<br />

Naranov S.V. 797<br />

Narayanan R. V12<br />

Nardo C. 741, 744<br />

Nardoni S. 486<br />

Narita S. 610, 720, 1100, 1104<br />

Narumi S. 613<br />

Nasopoulou P. 548<br />

Naspro R. 173<br />

Nassif L.T. V58<br />

Nasu Y. 503<br />

Nativ O. 202<br />

Nativ O. 202<br />

Naumann C.M. 358<br />

Nawfal G. 547<br />

Naya Y. 215, 1056<br />

Nayar R.C. 1074<br />

N'Dow J. 523<br />

Neal D. 135, 823, 833, 935<br />

Necchi A. 83, 388, 397, 398, 1055,<br />

1057<br />

Negoro H. 66<br />

Negrini S. 770<br />

Negrão R. 210<br />

Neidle S. 823<br />

Neisius A. 653, 661, 967<br />

Nekeman D. 239<br />

Nelson A.W. 142<br />

Nelson W.G 943<br />

Nemade H. 510<br />

Nemoto R. 223<br />

Nepple K. 1031, 1032<br />

Nesi G. 166, 411<br />

Nesius D. 461<br />

Nestler S. 342<br />

Netsch C. 636<br />

Neuzillet Y. 87, 283, 930<br />

Newling D. 706<br />

N Fukuda M. 602<br />

Nguyen-Nielsen M. 675<br />

Ni K. 837<br />

Nichele S. V58<br />

Nicita G. V69<br />

Nicolai M. 173<br />

Nicolai N. 83, 388, 397, 398, 1055,<br />

1057<br />

Nicolau C. 313, 436<br />

Nicolazzo C. 55<br />

Nicosia V. 368<br />

Nieboer D. 139<br />

Niedworok C. 155<br />

Niehrs C. 941<br />

Nieuwenhuijzen J. 706<br />

Nigawara T. 463<br />

Nigro F. 319<br />

Niimi A. 333<br />

Niimi K. 311<br />

Nikitin O.D. 507<br />

Nikolov I.G. 203<br />

Nilsson J. 677<br />

Nini A. 69, 140, 473, 687, 694, 918<br />

Nir D. 353<br />

Nishikawa G. 504<br />

Nishikawa N 66<br />

Nishimatsu H. 333<br />

Nishimura S-I. 197<br />

Nishizawa O. 404, 747<br />

Nishizawa S. 767<br />

Nison L. 575<br />

Nita G. 542, V37<br />

Nitkin D.M. 621<br />

Nitta T. 121<br />

Nitti V. 401, 739, 744<br />

Nitzke T. 1025<br />

Nockher A. 1099<br />

Noguchi M.N. 444<br />

Noh C.H. 727<br />

Noldus J. 718<br />

Nolley R. 761, 975<br />

Noma T. 442<br />

Nomiya A. 333<br />

Nomiya M. 446<br />

Nomura T. V68<br />

Nonis A. 185, 473<br />

Numbers refer to abstract numbers


Nonomura K. 931<br />

Nonomura N. 943<br />

Nørgaard J.P. 405, 406<br />

Noris Chiorda B. 184<br />

Noro A. 572, 819<br />

North S. 97, 1107<br />

Notoya T. 1104<br />

Novara G. 78, 172, 258, 264, 290,<br />

340, 573, 575, 576, 813, 814,<br />

815, 913, 990<br />

Nowell C.J. 849<br />

Nozawa M. 98, 1108<br />

Ntanios F. 740<br />

Nuhn P. 286<br />

Nukui A. 492<br />

Numakura K. 610, 1100, 1104<br />

Numao N. 76, 240, 470, 572, 578,<br />

586, 756, 819, 950, V21, V61<br />

Nunes P.T.C. 13, 375<br />

Nyberg T. 912, 916<br />

Nyek Ntep N. 439<br />

Nyushko K.M. V43<br />

O<br />

Oakley N. V57, V66<br />

Obara W. 77<br />

Obata J. 242, 818<br />

Obek C. 479<br />

Ober P. 962<br />

Obermueller N. 608<br />

O'Brien C. 3<br />

O'Brien T. 298, 477, 568, 1033<br />

Ochelenko V.A. 562<br />

Ochiai A. 215<br />

Ockrim J.L. 775, 776<br />

Oddens J. 708<br />

Oderda M. V26, V29, V32, V65, V73<br />

Odeyemi I. 1089<br />

Odone-Filho V. 650<br />

O'Donnell M. 766<br />

O'Donovan J. 865<br />

Oelke M. 782, 1095<br />

Ogawa O. 66, 1085<br />

Ogawa S. 764<br />

Oger S. 449, 900<br />

Ogura K. 699, 1091<br />

Oh C.Y. 786<br />

Oh C.K. 551<br />

Oh J.H. V47<br />

Oh J.K. 974<br />

Oh K.J. 464<br />

Oh M.M. 955, 994<br />

Oh T.H. 519<br />

Ohara S. 462, 666<br />

Ohba K. 150<br />

Ohira S. 199<br />

Ohlmann C-H. 74, 703, V31<br />

Ohlstein E.H. 440<br />

Ohnmacht S. 823<br />

Ohyama C. 79, 82, 197, 463, 602,<br />

613, 720, 1042, 1104<br />

Ojea A. 702<br />

Okada A. 311<br />

Okada K. 33, 35, 842<br />

Okada S. 228<br />

Okamoto A. 79, 82, 463, 1042<br />

Okamoto T. 602, 1042<br />

Okhunov Z. V33<br />

Okihara K. 8<br />

Okinami T. 66<br />

Okuno T. 572, 819<br />

Okuno Y. 1085<br />

Okuno Y. 764<br />

Okyar G. 417, 616<br />

Olagui G. 235<br />

Olarte Barragán E.H. 385<br />

Olbert P. 728, 1099<br />

Olde Damink L.H. 870<br />

Olesen T.K. 677<br />

Olianas R. 867<br />

Oliveira C. 968<br />

Oliveira M. V72<br />

Oliveira P.D. 898<br />

Oliveira R.A.R. 399, 557<br />

Oliveira R.M. 898<br />

Olivier F. 679<br />

Olivier Gómez C. 334<br />

Ollandini G. 838<br />

Olsson M. 912, 916<br />

Omae K. 821<br />

O'Mahony F.C. 766<br />

Omar A. 475<br />

Omar M.I. 523<br />

Omer A. 384<br />

Omorphos S. 391<br />

Omran M. 416<br />

Onal B. 529<br />

Onder A.U. 529<br />

Ono N. 503<br />

Ono T. 931<br />

Ooiwa Y. 228<br />

Oosterwijk E. 153, 336, 872, 980<br />

Oppenheimer F. 491, 496<br />

Orange C. 902, 905, 989<br />

Orczyk C. 500<br />

Orimoto N. 442<br />

Ornek T. 128<br />

Orntoft T. 238<br />

Osawa T. 931<br />

Osborne J.D. 367<br />

Osborne M. 935<br />

Osman N. 109, 110<br />

Osman Y.M. 928, 1028<br />

Osman-Garcia I. 804, 917<br />

Osmonov D.K. 188, 358<br />

Ost P. 191<br />

Osterberg E.C. 724<br />

Osther P.J.S. 1067<br />

Oswald D. 644<br />

Oswald J. 644<br />

Otero Tejero I. 40, 1073<br />

Oto A. 138<br />

Otsuka A. 998<br />

Otterlei M. 152<br />

Otto T. 251<br />

Otto W. 282, 286<br />

Oudard S. 99, 104<br />

Oudot A. 900<br />

Oussama M. 520<br />

Ouzaid I. 87<br />

Ouzzane A. 576<br />

Oya M. 242, 818, 959<br />

Oyen R. 360<br />

Oyen W.J.G. 336, 980<br />

Özcan C. 527, 646<br />

Ozdemir B. 645<br />

Özdemir B. 942<br />

Ozden E. 117, 163, 381<br />

Ozen H. 106<br />

Ozkaya F. 616<br />

Ozmerdiven G. 652<br />

Ozono S. 998<br />

Öztürk E. 527, 646, 647<br />

P<br />

Paborji M. 402<br />

Pacheco-Figueiredo L. 210<br />

Numbers refer to abstract numbers<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

453<br />

Indices


Indices<br />

Abstract authors<br />

Pacik D. 631<br />

Padhani A.R. 268<br />

Paez A. 1068<br />

Pages A. 705<br />

Pagi H. 680<br />

Pahernik S. 340, 341, 344<br />

Pai A. 48<br />

Paick J.S. 332, 860<br />

Pak S. 533, 807, 1005, 1010<br />

Pal P.O. 736<br />

Pal S.K. 1107<br />

Palacios J-M. 1095<br />

Palagin I. 169<br />

Palea S. 440<br />

Palermo S. 61<br />

Palleschi G. 517, 914<br />

Palmer K.J. 299, 689, 1013, V10,<br />

V13<br />

Palmer S. 138, 220<br />

Palmer T. 910<br />

Palmieri A. 396, 560, 622<br />

Palmieri F. 579<br />

Palminteri E. 798<br />

Palou Redorta J. 137, 232, 281, 362,<br />

372, 697, 702, 755, 760, 848,<br />

1031, 1032, V72<br />

Pan C.C. 287<br />

Pandey A. 790, 795, V70<br />

Pandit A. 3<br />

Panebianco V. 11, 591<br />

Pann R. 22<br />

Pantel K. 107, 802<br />

Pantuck A.J. 193<br />

Panumatrassamee K. V2, V3<br />

Paolini B. 1057<br />

Papadakis T. 62<br />

Papalia R. 480, 881, 1038, V23, V46<br />

Papandreou C. 106<br />

Paparel P. 87, 1105<br />

Papotti M. 219, 710<br />

Parada R. 372<br />

Paradowska-Dogan A. 27, 32<br />

Pardo P. 498<br />

Paredes D. 383, 491, 496<br />

Parekattil S. 841, V51, V52, V76<br />

Park B.H. 266, 297<br />

Park C.H. 986<br />

Park D.S. 165<br />

Park H.J. 409<br />

454 <strong>Programme</strong> <strong>Book</strong><br />

Park H.J. 124, 1092<br />

Park J-S. 535<br />

Park J.W. 1012<br />

Park J. 437<br />

Park J. 1005, 1010<br />

Park J.P. 488<br />

Park K. 464<br />

Park K. 332<br />

Park M.G. 209, 544<br />

Park N.C. 124, 1092<br />

Park S. 80, 196, 466, 469, 807<br />

Park S. 410, 533, 649, 771, 1097<br />

Park S.C. 317<br />

Park S.J. 165<br />

Park S.W. 632, 759<br />

Park S.Y. 177<br />

Park Y.K. 253, 428<br />

Park Y.C. 97<br />

Park Y.Y. 512, 612, 997<br />

Parker C. 101<br />

Parkinson R. 516<br />

Parma P. 259, 459<br />

Parmigiani A. 894<br />

Parodi A. 770<br />

Parr N. 395, 400<br />

Pascal Z. V6<br />

Paschos A. 939<br />

Pasini B. 95<br />

Pasquale G. 376<br />

Passaretti G. 271, 711<br />

Passariello R. 591<br />

Passoni N.M. 140, 187, 289, 474,<br />

687, 701, 714, 752, 918, 929<br />

Pasticier G. 96, 283, 763<br />

Pastore A.L. 517, 914<br />

Patani L.G. 655<br />

Patard J.J. 87, 170, 171, 176, 283,<br />

1105<br />

Patel A. 568, 1033<br />

Patel T. 841<br />

Patel V. 18, 299, 689, 1013, V10,<br />

V13<br />

Patil M. V45<br />

Patil P.A. 546, 550, 655<br />

Patni L.G 546, 550<br />

Patrick D. 99<br />

Patschan O. 750, 1029<br />

Pattaras J.G. 1031, 1032<br />

Paulus P. 608<br />

Pavan N. 614, 838, V55<br />

Pavlik I. 108<br />

Peabody J.O. 20, 158, 369, 497, 526,<br />

534, 625, 657, 659, 709, 915,<br />

1031, 1032, 1070, V14<br />

Pearce I. 44<br />

Pearson J. 157<br />

Pecoraro S. 561<br />

Pedersen J. 145, 849, 946<br />

Pedretti N. 1040<br />

Peehl D.M. 761, 975<br />

Peeker R. 120, 664<br />

Pelegrí J. 532<br />

Pelger R.C.M. 889<br />

Pellegrini F. 412<br />

Pellicer Cabo M. 1007<br />

Pellucchi F. 363, 748, 953<br />

Peltier A. 800<br />

Pena E. V39<br />

Pena-Outeiriño J.M. 804, 917<br />

Penna F.J. 526, 534<br />

Perabo F. 674<br />

Peraldo F. 130<br />

Percy A. 882, V12<br />

Perego R. 769<br />

Perepanova T. 169<br />

Pérez E. 757<br />

Perez M. 40<br />

Perez-Lanzac De Lorca A. 598, V33<br />

Pérez-Reggeti J.I. V41, V63<br />

Peri Cusi L. 378, 383, 489, 491, 494,<br />

496, 595, 639, 888, 993<br />

Perletti G. 160<br />

Pernetti R. 579<br />

Perrouin-Verbe M.A. 304<br />

Perry A. 355<br />

Perry M. 389, 593<br />

Persad R.A. 230<br />

Persson B-E. 677, 678<br />

Persu C. 542<br />

Pertusa Peña C. 498<br />

Perucchini L. 1041<br />

Peschechera R. 459<br />

Pesonen J. 910<br />

Peters G. 72, 514<br />

Peters I. 198<br />

Peters J.S. 849<br />

Peters M. 954<br />

Petkov T. 971<br />

Numbers refer to abstract numbers


Petkova K. 971<br />

Petkova N. 899<br />

Petracca A. 55<br />

Petrozza V. 517, 914<br />

Petrusevska G. 203<br />

Peyrat L. 896<br />

Peyromaure M. 141<br />

Peyronnet B. 283<br />

Peña E. V36<br />

Peña J.A. V72<br />

Pfister C. 170, 171, 176, 283, 483<br />

Pfister D. 452, 801<br />

Philpott-Howard J. 510, 1076<br />

Phull J.S. 367<br />

Phung D. 674<br />

Phé V. 304, 734<br />

Picard A. 705<br />

Pichler M. 347<br />

Pichler R. 644<br />

Pichon T. 1004<br />

Pickard R.S. 623, 781, 865<br />

Picozzi S. 368, 540, 566, 567<br />

Piechaud P-T. V26, V29, V32, V65,<br />

V73<br />

Pietropaolo A. 729<br />

Pignot G. 170, 171, 176, 235, 283<br />

Pillot P. 426, 427, 429<br />

Pini G. 382, V50<br />

Pinon C. 778<br />

Pinthus J. 939<br />

Pinto P. 138<br />

Pinto R. 627, 673<br />

Pinto S.J. 441<br />

Pinzi N. 887<br />

Pinzón Navarrete C.P. 385<br />

Piper C. 452, 801<br />

Piqueras M. 34, 639<br />

Pirozzi L.P. 408, 1093, 1094<br />

Pisano F. 130, 697<br />

Pisanti F. 486, 580<br />

Pisco J. 628<br />

Pisipati S. 783<br />

Pistolesi D. 1008<br />

Pittoni G.M. 1017<br />

Piva L. 83, 388, 397, 398, 1055,<br />

1057<br />

Pizzocaro G. 83, 1055<br />

Placer J. 6, 682<br />

Plainard X. 458<br />

Planas J. 6, 682<br />

Plaza Viguer B. 231, 805<br />

Plekhanova O. 23<br />

Ploumidis A. 916<br />

Ploussard G. 87<br />

Poggio M. 219, V11<br />

Pokrywczyńska M. 869<br />

Poletajew K. 43<br />

Poletajew S. 43, 279<br />

Polo Rodrigo A. 231, 805<br />

Polson A. V62<br />

Poluyanchik A.V. 958<br />

Polyakov S.L. 278<br />

Polyakov V.A. V43<br />

Ponce De Leon J. V49<br />

Ponce Diaz-Reixa J. 498<br />

Ponhold L. 345<br />

Ponholzer A. 992, 1021<br />

Pons Viver J. 556<br />

Pontillo M. 855<br />

Pontones Moreno J.L. 231<br />

Pook D. 946<br />

Poon B.Y. 749<br />

Popert R. V62<br />

Popken G. 461, 1025<br />

Popov A.A. 115<br />

Porena M. 147, 303, 670, 729, 933<br />

Porpiglia F. 172, 204, 219, 264, 459,<br />

630, 710, 875, 887, V11<br />

Porreca A. 259<br />

Porres D. 452, 801<br />

Porru D. 894<br />

Porst H. 211<br />

Porter J. 254<br />

Portillo Martin J.A. 702<br />

Potenzoni M. 1041<br />

Poth S. V16, V20, V34<br />

Potiron E. 472<br />

Poulakis V. 1031, 1032<br />

Poulakou-Rebelakou E. 41<br />

Poulias I. 548<br />

Power N. 1050<br />

Powles T. 58, 81<br />

Poyet C. 637<br />

Pozzi R. 700<br />

Prapotnich D. 589, 679, 1020<br />

Prats J. 229<br />

Pravorov A.V. 285<br />

Preda A. 384<br />

Preira J. 628<br />

Preminger G. 653, 661, 967<br />

Prera A. 229<br />

Presicce F. 412<br />

Priest A.N. 224<br />

Prieto L. 746<br />

Primus G. 1009<br />

Priola K. 841, V51, V52, V76<br />

Proietti S. 300, 302, 303, 670<br />

Protzel C. 393<br />

Pruthi R.S. 1031, 1032<br />

Pu Y.S. 234<br />

Puccini F. 672, 725<br />

Pucheril D. 659<br />

Pueche P. 138<br />

Pultrone C. 454<br />

Pummer K. 347<br />

Punab M. 216<br />

Punwani S. 138, 717<br />

Pushkar D.Y. 115, 186, 350<br />

Putter H. 889<br />

Pycha A. 61, 78, 276, 573, 592, 601,<br />

701, 752, 754, 813, 815, 929<br />

Q<br />

Qayyum T. 902, 989<br />

Qazi H. V17<br />

Qi D. 320<br />

Qi J. 901<br />

Qian Y. 99<br />

Qteishat A. 879<br />

Quarta M. 1041<br />

Quicios C. V75<br />

Quintens H. 283<br />

R<br />

Radavoi D. 966<br />

Radwan M.H. 420<br />

Radziszewski P. 43, 401, 741<br />

Raffaelli C. 1059<br />

Rafiq A. 62<br />

Raggi D. 83, 388, 397, 398, 1055,<br />

1057<br />

Ragni F. 204<br />

Raheem A.A. 129<br />

Raileanu A. 127<br />

Rais-Bahrami S. 91, 552<br />

Raita C. 790, 795<br />

Raja A. 952<br />

Numbers refer to abstract numbers<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

455<br />

Indices


Indices<br />

Abstract authors<br />

Rajan P. 910<br />

Ralph D. 129<br />

Ramadan A.R. 420<br />

Raman J.D. 78, 573, 576, 813<br />

Ramani V.A.C. 86<br />

Rambeaud J.J. 283, 563, 564<br />

Ramirez Backhaus M. 1007<br />

Ramirez-Martin D. 606, 607<br />

Ramon De Fata F. 524, 760, 1030,<br />

V9<br />

Ramos M. 380<br />

Ramos-Montoya A. 823, 833, 935<br />

Ramírez-Backhaus M. 10<br />

Ramón Y Cajal S. 768<br />

Ranasinghe A.M. 453<br />

Rancoita P. 185<br />

Randazzo M. 133<br />

Rankin S. 477<br />

Rannikko A. 274<br />

Rao A.R. 20, 475, 879, V78<br />

Rao G. 882<br />

Raspollini M.R. 93<br />

Rassweiler J. 13, 23, 461, 521<br />

Rassweiler M.C. 321, 322, 323<br />

Rastrelli G. 411<br />

Ratan H.L. 1080<br />

Ratcliffe N.M. 506<br />

Rathenborg P. 674<br />

Rathkopf D. 97<br />

Ratti D. 567, 996<br />

Raugei A. 93<br />

Ravery V. 87<br />

Ravi P. 915<br />

Ravic M. 700<br />

Rawandale A.V. 546, 550, 655<br />

Ray E.R. 577<br />

Raynal G. 432<br />

Raza S.J.R. 19<br />

Raßler J. 461<br />

Real F.X. 229<br />

Realfonso T. V67<br />

Rebmann U. 192, 461<br />

Recker F. 133, 272<br />

Regge D. 219, 710<br />

Regier M. 359<br />

Rehman S. 20<br />

Rehn S. 195<br />

Reichert M. 867<br />

Reid J. 719<br />

456 <strong>Programme</strong> <strong>Book</strong><br />

Reid S.V. 777<br />

Reis-Santos J.M. 1067<br />

Reiss P. 866, 1002<br />

Reiter M. 825<br />

Rekik M. 440<br />

Rempelakos A. 41<br />

Remzi M. 575, 576, 601, 813<br />

Renard O. 96<br />

Renninger M. 812<br />

Renter A. 137, 848<br />

Rentsch C.A. 945<br />

Rentzos L. 25<br />

Resende A.O. 898<br />

Reukers D.F.M. 12<br />

Reuter V.E. 715<br />

Revuelta I. 491, 496<br />

Rey D. V26, V29, V32, V65, V73<br />

Reyes Ríos P.Y. 422<br />

Rha K.H. 91, 177, 269, 810, 1031,<br />

1032<br />

Rha S.Y. 1107<br />

Rhew H.Y. V47<br />

Ribal Caparrós M.J. 232, 236, 362,<br />

378, 489, 494<br />

Ribeiro S. 380<br />

Ricci C. 540, 567<br />

Richard F. 734<br />

Richardson A. 275<br />

Richstone L. 91, 552, 1031, 1032<br />

Richter H. 722<br />

Ricós Torrent J.V. 10, 1007<br />

Riddick A.C.P. 766<br />

Ridout A.J. 267, 275<br />

Riechardt S. 425, 866, 1002<br />

Riedmiller H. 282, 286, 863, 936<br />

Rieken M. 167, 618<br />

Riera Canals L. 498<br />

Riethdorf S. 107<br />

Rigatti P. 173, 183, 184, 185, 187,<br />

188, 473, 695, 748, 953<br />

Rigaud J. 87, 170, 171, 176<br />

Righi D. 376<br />

Rijo Cedano E. 631<br />

Rim J.S. 317<br />

Rimington P. 1033<br />

Rinaldi A. 614<br />

Rini B.I. 1107<br />

Rink M. 78, 276, 802, 813, 814, 815,<br />

822, 1015<br />

Rio Tinto H. 628<br />

Rioja C. 760<br />

Rioux-Leclercq N. 87, 1105<br />

Ripoli A. 914<br />

Risbridger G.P. 946<br />

Rischmann P. 261, 283<br />

Riss J. 193<br />

Ritter M. 24, 321, 322, 323, 1019<br />

Ritter R. 365<br />

Rivas Del Fresno M. 229, V42<br />

Riveros M. V36, V39<br />

Rizkala E. 256, 552, V22, V27<br />

Rizzato L. 305<br />

Rizzi S. 271<br />

Rizzo M. 614, 838<br />

Robain G. 304<br />

Robert G. 96, 763<br />

Robertson A. 434<br />

Robertson W.G. 314<br />

Robine E. 87<br />

Robinson A. V62<br />

Robinson B.D. 151, 156, 276<br />

Robinson D. 782<br />

Robinson M. 1063<br />

Robinson S. 475<br />

Rocca G.C. 454, 711<br />

Rocchini L. 363, 748<br />

Rocco B. 186, 259, 340, 919, V10<br />

Rocco F. 172, 887<br />

Rochester M.A. 762<br />

Rode J. 549, V15<br />

Røder M.A. 273<br />

Rodrigues P. 968<br />

Rodriguez C. V38<br />

Rodríguez J. 702<br />

Rodríguez M. V75<br />

Rodríguez Antolín A. 125, 498<br />

Rodriguez De Vera J.M. 229<br />

Rodriguez Escobar F. 888<br />

Rodriguez Faba O. 281, 372, V49<br />

Rodríguez-Patrón Rodríguez R.<br />

346, 379<br />

Rodriguez Sierra P. 334<br />

Rodriguez Villamil L. V42<br />

Rodriguez-Malatesta R. V41, V63<br />

Roehrborn C. 1095, 1096<br />

Roelofs L.A.J. 870<br />

Roethke M. 222<br />

Rogel Berto R. 231, 805<br />

Numbers refer to abstract numbers


Rogenhofer N. 27<br />

Rogers B. 400<br />

Rogers C. 260, 497, 709, 876, 885,<br />

V14, V24, V25<br />

Roghmann F. 175, 178, 233, 262,<br />

718, 820, 927, 956, 960, 1024<br />

Roigas J. 286<br />

Rojas-Cruz C. V71<br />

Rolevich A.I. 278, 285, 958<br />

Rom M. 991<br />

Romagnoli D. 271, 711<br />

Roman S. 109, 110<br />

Romanenko O. 159<br />

Romano G. 880<br />

Romero D. 941<br />

Romero I. 1034, V8<br />

Romero M.R. 408, 1093, 1094<br />

Romero Otero J. 125<br />

Romics I. 1083<br />

Romics M. 1083<br />

Roobol M. 1, 5, 139, 850, 912<br />

Rooney S.J. 453<br />

Roos F.C. 338<br />

Roosen A. 907<br />

Rosales A. V72<br />

Rosario D. 568<br />

Roscigno M. 173, 340, 575, 601, 953<br />

Roseiro A. 375<br />

Rosen R.C. 211<br />

Rosenkrantz A. 138<br />

Roser F. 306<br />

Rosety Rodriguez J. V33<br />

Roskams T. 513<br />

Rossi M.S. 271<br />

Rossi De Vermandois J.A. 300, 302,<br />

303, 670<br />

Rossi Neto R. 559<br />

Rosso M. 817<br />

Roth B. 330<br />

Roth W. 344<br />

Röthlisberger S. 555<br />

Rothman N. 229<br />

Rothwell D.G. 1101<br />

Rottenberg G. V62<br />

Roudot Thoraval F. 716<br />

Rouffilange J. 87, 96<br />

Rouget C. 440<br />

Rouprêt M. 78, 87, 170, 171, 176,<br />

237, 261, 283, 304, 483, 575,<br />

576, 601, 734, 752, 1105<br />

Rouquette A. 235<br />

Rouse P. 16<br />

Roushias S. 623<br />

Rousseau A. 458<br />

Rousseau C. 472<br />

Rousseau T.G.M. 472<br />

Rouviere O. 180<br />

Roux J.W. 137, 848<br />

Rovereto B. 172, 264, 887, 894<br />

Rovers M.M. 12<br />

Rovner E. 308<br />

Rozet F. 352, 483, 576, 589, 679,<br />

883, 1020, V48, V64<br />

Rübben H. 155, 559<br />

Rübe C. 192<br />

Rubio-Briones J. 10, 1007<br />

Rud E. 221<br />

Rudolph R. 348<br />

Rufle A. 945<br />

Ruiz C. 945<br />

Ruiz Cerda J.L. 231, 805<br />

Ruiz Jiménez J.I. 422<br />

Rummel C. 665<br />

Rupprecht K. 608<br />

Russo A. 289, 443, 467, 953<br />

Russo F. 1041<br />

Russo F. 219, 710<br />

Rutigliano M. 662<br />

Rutman M. 638<br />

Rutz B. 906, 907<br />

Ryan A. 145, 946<br />

Ryan C.J. 97, 100<br />

Ryang S.H. 997<br />

Rydén L. 1029<br />

Rynja S.P. 648<br />

S<br />

Saad F. 207<br />

Saad F. 99<br />

Saad I.R. 536<br />

Saad T.W. 530<br />

Saad Z. 391<br />

Saar M. 74, 761, 975, 1031, 1032<br />

Saaristo L. 1039<br />

Saavedra J. V6<br />

Sabaa E. 836<br />

Sabatier F. 245<br />

Sabharwal K.V. 418, 421, 424<br />

Sabir E.F. 569<br />

Sacristan R. 277<br />

Sagara Y. 150<br />

Sagawa K. 446<br />

Sahdev V. 47<br />

Sahu M. 585<br />

Saito K. 76, 240, 470, 572, 578, 586,<br />

756, 819, 950, V21, V61<br />

Saito M. 1100, 1104<br />

Saito N. 92<br />

Saitoh H. 613<br />

Sakaeda T. 1085<br />

Sakai H. 150<br />

Sakai I. 983<br />

Sakai Y. 92, 572, 819<br />

Sakalis V. 389<br />

Sakellariou C-A. 835<br />

Sakihara S. 463<br />

Sakuma Y. 492<br />

Sakuta T. 931<br />

Sala A. 868<br />

Sala E. 142, 224<br />

Saladini G. 357<br />

Salcedo M. 768<br />

Salciccia S. 11<br />

Saldaña L.J. 532<br />

Salem A. 536<br />

Salem H.K. 640<br />

Salem N. 1053<br />

Salinas Casado J. 746, 888<br />

Salman M. 867<br />

Salom Fuster J.V. 805<br />

Salome F. 170, 171, 176<br />

Salomon G. 226, 295, 359, 1006,<br />

1018, 1023<br />

Salomon L. 136, 170, 171, 176, 283,<br />

716, 753, V15<br />

Salonia A. 140, 187, 289, 467, 473,<br />

695, 918<br />

Saltirov I. 971<br />

Saltzstein D.R. 1045<br />

Salvador R. 313, 436, 496<br />

Salvatore S. 726<br />

Salvi M. 93, 411, 1014<br />

Salvini E. 729<br />

Salvioni R. 83, 388, 397, 398, 1055,<br />

1057<br />

Numbers refer to abstract numbers<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

457<br />

Indices


Indices<br />

Abstract authors<br />

Samarasekera D. 255, V3, V30<br />

Samavedi S. 299, 689, 1013, V10,<br />

V13<br />

Samir T. 1028<br />

Sammon J.D. 119, 158, 260, 369,<br />

497, 526, 534, 625, 657, 659,<br />

915, 1070<br />

Sampaio F.J.B. 29, 30, 413, 903<br />

San José Manso L. 334<br />

Sanada M. 764<br />

Sanchez L. V36, V39<br />

Sanchez- Carbayo M. 277<br />

Sánchez-Chapado M. 524, 1034<br />

Sanchez Escudero E. 383<br />

Sanchez-Escudero A. 491, 496<br />

Sanchez-Martín F. V35<br />

Sanchez-Salas R.E. 352, 589, 679,<br />

686, 688, 883, 911, 1020, V48,<br />

V64<br />

Sandmann M. 226<br />

Sandner P. 900, 909<br />

Sandoe J. 502, 617<br />

Sandrini S. 499<br />

Sang Don L. 632<br />

Sang Hoon S. 649<br />

Sangar V. 395, 400<br />

Sanguedolce F. 268, 660<br />

Sanjmyatav J. 194<br />

Sanjurjo S. 780<br />

Sano H. 931<br />

Sansalone S. 561<br />

Sanseverino R. V67<br />

Santana T.B.M. 399, 557<br />

Santarsieri M. 1008<br />

Santi R. 411<br />

Santillana J.M. V35, V72<br />

Santinelli F. V44<br />

Santià S. 376, 431, 1066, 1071<br />

Santos J. 975<br />

Sanz Mayayo E. 346<br />

Sapre N 53, 85, 145, 704, 849<br />

Saraceni G. 454<br />

Saran R.K. 418, 421, 424<br />

Sarchielli P. 302<br />

Sarica K. 1067<br />

Sarikaya S. 117, 163, 381<br />

Sarkis P 547<br />

Sarró E. 768<br />

Sasaki E. 442<br />

458 <strong>Programme</strong> <strong>Book</strong><br />

Sasaki T. 978<br />

Sassa N. 288<br />

Sato A. 764<br />

Sato A. 57, 144, 574, 827, 976, 977<br />

Sato F.S. 444<br />

Sato N. 603, 767<br />

Sato S. 931<br />

Sato T. 931<br />

Sato Y. 199<br />

Sato Y. 121<br />

Sato Y. 361<br />

Sato Y. 764<br />

Satoh S. 610, 1100, 1104<br />

Saussez T. 432<br />

Sava D. 194<br />

Savastano S. 319<br />

Savoie P-H. 1053<br />

Sawazaki H. 699, 1091<br />

Sayedahmed K.A.M. 867<br />

Sazawa A. 931<br />

Sa˘glam H.S. 111, 794<br />

Scardino P. 715, 854<br />

Scarpa R. 521<br />

Scattoni V. 137, 289, 695, 918<br />

Schäfer G. 7, 803<br />

Schäfer L. 707<br />

Schagdarsurengin U. 31, 947<br />

Schalken J.A. 63, 851<br />

Scharpf M. 899<br />

Schatloff O. 299, 689, 1013, V10,<br />

V13<br />

Schätz T. 22<br />

Scher H.I. 97, 105<br />

Scherer R. 198<br />

Scherr D.S. 78, 156, 276, 474, 573,<br />

701, 752, 754, 813, 814, 815,<br />

929, 1031, 1032<br />

Scherrer A. 930<br />

Schettini M. 486<br />

Schiavina R. 172, 264, 271, 454,<br />

693, 711, 887, 1014<br />

Schiefelbein F. V18<br />

Schiffmann J. 226<br />

Schilling D. 964, 1022, V59<br />

Schips L. 91, 340, 408, 412, 592,<br />

1093, 1094<br />

Schlemmer H-P. 222<br />

Schlenck B. 644<br />

Schleutker J. 1039<br />

Schlomm T. 107, 293, 802, 920,<br />

1006, 1018<br />

Schmid H-P. 310<br />

Schmid M. 474<br />

Schmid S. 1011<br />

Schmidbauer J.S. 577<br />

Schmidt J. 828<br />

Schmidt M. 707<br />

Schmidt M. 68<br />

Schneider S. 944<br />

Schober R.R. 1058<br />

Schoen G. V18<br />

Schoenthaler M. 1067<br />

Schoffelmeer C. 291, 292<br />

Schönthaler M. 629<br />

Schorsch M. 27, 31<br />

Schrader A. J. 241, 338, 348<br />

Schrader M. 338, 348<br />

Schramek P. 474, 1021<br />

Schriefer P. 866<br />

Schröder F.H. 1, 5, 680<br />

Schubert M. 936<br />

Schull A. 141<br />

Schulwitz H. 1011<br />

Schulz E. 1025<br />

Schulze M. 521<br />

Schulze-Forster K. 859<br />

Schumacher C. 330<br />

Schumacher S. 338<br />

Schumann A. 382, V50<br />

Schuppe H-C. 27, 32<br />

Schurch B. 70<br />

Schütte A. V16, V20, V34<br />

Schütz B. 62<br />

Schwaab T. 882<br />

Schwaiger B. 866<br />

Schwantes U. 448<br />

Schwarz R. 293<br />

Schwentner C. 364, 365, 899, 1022,<br />

1049, 1054, V59<br />

Schykowski T. 653<br />

Sciarra A. 11<br />

Sciuto R. 480<br />

Scoffone C. 521<br />

Scott H. 935<br />

Scremin E. 319<br />

Sebastia M.C. 496<br />

Sebastianelli A. 411, 1014<br />

Sèbe P. 896<br />

Numbers refer to abstract numbers


Secin F. 589, 679, 1020<br />

Sedelaar J.P. 582<br />

Sedigh O. 376<br />

Segersten U. 238<br />

Segoloni G.P. 376<br />

Seguchi K. 574, 827<br />

Seibel R. 867<br />

Seibold J. V54<br />

Seidel C. 241, 348<br />

Seidenader J. 222<br />

Seifarth V. 250, 871<br />

Seiler D 133, 272<br />

Seiler R. 330<br />

Seisen T. 483, 576, 716<br />

Seitz C. 78, 474, 813, 1021, 1067<br />

Seiwerts C. 359<br />

Sejima T. 339, 925, 951<br />

Seki H. 931<br />

Seki N. 52, 772<br />

Seki T. 931<br />

Sekine Y. 938<br />

Seklehner S. 724<br />

Seligson D.B. 193<br />

Selim M. 792<br />

Selli C. 1008<br />

Selvaggi F.P. 662<br />

Semjonow A. 139, 192, 465, 853,<br />

859<br />

Sengel C. 564<br />

Sengeløv L. 106, 683<br />

Sengiku A. 699, 1091<br />

Seni G. 112<br />

Seo H.K. 1001<br />

Seo I.Y. 317<br />

Seo S.I. 266, 280, 297<br />

Serati M. 726<br />

Serbo Y. 893<br />

Serikoff A. 743<br />

Seringe E. 261<br />

Serni S. 93, 172, 259, 264, 693, 887<br />

Serra C. 229<br />

Serrallach M. V41<br />

Serrano A. 760<br />

Serretta V. 697<br />

Serth J. 198<br />

Sester M. 703<br />

Sester U. 703<br />

Sevcenco S. 345<br />

Sgrò E. V53<br />

Shaaban A. 928, 1028<br />

Shah P.J.R. 775, 776<br />

Shah N.C. 921<br />

Shah V. 367<br />

Shahab N. 450<br />

Shaker H. 511<br />

Shamsuddin A. 600<br />

Shan Y.X. 839<br />

Shangichev A.V. 419, 797<br />

Shaplygin L.V. 581<br />

Shariat S.F. 78, 151, 156, 276, 340,<br />

473, 474, 573, 575, 576, 601,<br />

697, 701, 752, 754, 813, 814,<br />

815, 929, 1015, 1032<br />

Sharif M. 20<br />

Sharma D. 16, 389<br />

Shaw G.L. 833<br />

Sheehan S. 510<br />

Sheikh N. 103<br />

Shen P. 558<br />

Shestani T. 486<br />

Shevelev A. 169<br />

Shi G.H. 1098<br />

Shi Y. 20<br />

Shi Y.F. 932<br />

Shibata T. 931<br />

Shibuya H. 578<br />

Shiga Y. 228<br />

Shigemura K. 663, 940<br />

Shillito S.H. 395<br />

Shim B.S. 512<br />

Shim M. 80, 196, 466, 469, 1005,<br />

1010<br />

Shimamura T. 764<br />

Shimbori M. 228<br />

Shimizu N. 1108<br />

Shimizu S. 199<br />

Shin T-Y. 177, 810<br />

Shin Y.S. 488<br />

Shinbo H. 998<br />

Shinde S. 65<br />

Shingo Y. 59<br />

Shinno Y. 931<br />

Shinohara N. 931<br />

Shiota M. 765<br />

Shiraishi T. 978<br />

Shiraishi T. 1048<br />

Shiraishi Y. 764<br />

Shirakawa T. 663, 940<br />

Shiranov K.A. 845<br />

Shirokorad V.I. 954<br />

Shirotake S. 242, 818<br />

Shkalova L. 354<br />

Shoji K. 462<br />

Shoji S. 220, 265, 361, V45, V79<br />

Shoots I. 138<br />

Shore N. 97, 99, 626, 678<br />

Short S. 58<br />

Shuin T. 834<br />

Shukla D. 935<br />

Shun C.T. 234<br />

Sibaev A. 447<br />

Sibony M. 366<br />

Sicuro O. V53<br />

Siddiqui E. 401<br />

Siddons H. 704<br />

Sidoni A. 933<br />

Sieber P. 108<br />

Siegmann A. 192<br />

Siemer S. 74, 338, 1031, V31<br />

Siena G. 93, 817<br />

Siesto G. 726<br />

Sievert K-D. 243, 248, 306, 629, 741,<br />

744, 791, V54, V71<br />

Sighinolfi G.P. 439<br />

Sighinolfi M.C. 439<br />

Signoretti S. 193<br />

Silva C.M. 673, 898<br />

Silva J. 627<br />

Silva P.C. 30, 903<br />

Silva P.C.G.P. 903<br />

Silvani M. 561<br />

Silverman D. 229<br />

Silvestri L. 914<br />

Sim M.Y. 200<br />

Simaioforidis V. 872<br />

Simeone C. 172, 259, 264, 499, 887<br />

Simmons L.A.M. 353<br />

Simmons R. 777<br />

Simmons W. 653<br />

Simon A. 329<br />

Simon R. 138<br />

Simonato A. 340, 770, 817, 1014<br />

Simone G. 480, 881, 1038, V23, V46<br />

Simpfendoerfer T. 222<br />

Sims R. 103<br />

Simón C. V75<br />

Simões M. 29<br />

Numbers refer to abstract numbers<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

459<br />

Indices


Indices<br />

Abstract authors<br />

Sinescu I. 384<br />

Singh R. 937<br />

Singla M. 418, 421, 424<br />

Sinos P. 548<br />

Sio M.C. 1043<br />

Siracusano S. 614<br />

Sirls L. 722<br />

Sivaraman A. 299, 1013, V10<br />

Sizonov V.V. 419<br />

Sjoberg D. 754, 814, 815<br />

Sjoberg D. 749, 808, 813, 856<br />

Skolarikos A. 521<br />

Skorucak J. 799<br />

Skowron O. 563<br />

Skradski V. 7, 803<br />

Skrobot S.S. 372<br />

Skvortsov I.Y. 88, 90<br />

Slesarevskaya M.N. 667<br />

Sloan S. 367<br />

Sloff M. 872<br />

Slovak M. 403<br />

Smal M.P. 278<br />

Small E.J. 97<br />

Smith M.R. 97, 99, 108, 674<br />

Smith N. 653<br />

Smith R.A.G. 835<br />

Smith R. 18<br />

Smolski M.J. V57, V66<br />

Snow-Lisy D. 816<br />

Soares F.A. 399<br />

Sobiesiak M. 899<br />

Sodano M. 499<br />

Soebadi D. 252, 908<br />

Soh J. 414<br />

Sohn D.W. 1001<br />

Sokol R. 1089<br />

Sokolov A. 667<br />

Sola I. 482<br />

Solanki R. V40<br />

Soler R. 909<br />

Soliman M.G. 214, 420<br />

Solokhina A. 167<br />

Soloviev D. 833<br />

Solovov V.A. 581<br />

Solsona Narbón E. 10, 702, 1007<br />

Somani B. 370, 434, 599<br />

Sommerlad M. 811<br />

Son H. 860<br />

Son J.H. 1072<br />

460 <strong>Programme</strong> <strong>Book</strong><br />

Soncin R. 1017<br />

Song C. 80, 196, 466, 469, 807,<br />

1005, 1010<br />

Song G. 410, 490<br />

Song J.M. 997<br />

Song P.H. 116, 349<br />

Song S.H. 332, 533, 807<br />

Song W. 266, 280, 297, 538<br />

Song Y. 765<br />

Song Y.S. 325<br />

Sønksen J. 122<br />

Sonmezay E. 553<br />

Sonmezoglu K. 479<br />

Sonnenberg J.E. 329<br />

Sonnino S. 146<br />

Sood A. 369, 709, V14<br />

Sooriakumaran P. 912, 916<br />

Sørensen H.T. 675<br />

Soria F. 130<br />

Sorongon M. 1043<br />

Sorsaburu S. 1096<br />

Sosnowski R. 990<br />

Sotelo Noguera R. V6, V19, V38,<br />

V44<br />

Soto Poveda A.M. 231<br />

Soto Villalva J. V33<br />

Soukup V. 697<br />

Soulié M. 87, 176, 283, 483, 1105<br />

Sountoulides P. 408<br />

Soustelle L. 261<br />

Southgate J. 157<br />

Souza M.J.L. 399<br />

Sow Y. 731<br />

Soygür T. 527, 646, 647<br />

Spahn M. 468, 471, 686, 688, 911,<br />

936<br />

Spaliviero M. 749<br />

Spaltro Ambrosini A. 61<br />

Spangenberg M. 160<br />

Sperandio V. 168<br />

Sphan M. 697<br />

Spiess A. 27, 31<br />

Spilotros M. 662<br />

Spinelli M. 301, 305<br />

Spinillo A. 894<br />

Springer C. 91, 263, 461, 949, V1<br />

Srinivas S. 1107<br />

Srinivasan V. 1016<br />

Sriprasad S. 49, 1075, 1081<br />

Srougi M. 650<br />

Stagni S. 83, 388, 397, 398, 1055,<br />

1057<br />

Stakhovsky E. 94<br />

Stakhovskyi O. 94<br />

Staley S. 497<br />

Stanescu F.A. 522, 570<br />

Stanic V. 1060<br />

Staudacher K. 101<br />

Stavropoulos M. 548<br />

Stefan B. 384<br />

Steffens S. 241, 338, 348<br />

Stegemann A.P. 19, 20, 1031, 1032<br />

Steger K.S. 27, 31, 32, 947<br />

Stein B. 241<br />

Stein K. 981<br />

Stein R. 255, 256, 257, 552, 816,<br />

V2, V22<br />

Steineck G. 916<br />

Steiner E. 7<br />

Steiner M.S. 102<br />

Steiner U. 192<br />

Stenzl A. 198, 243, 306, 364, 365,<br />

577, 629, 812, 822, 861, 899,<br />

964, 1022, 1049, 1054, 1062,<br />

V54, V59, V71<br />

Stepanova N. 159, 892<br />

Stephan C. 139, 195, 853, 859<br />

Sternal M. 194<br />

Sterner O. 826<br />

Steuber T. 107, 186, 295, 685, 1006,<br />

1018<br />

Stevens D. 267<br />

Stewart F. 523<br />

Stewart G.D. 766, 922<br />

Stewart Iv J. 558<br />

Steyerberg E.W. 139, 217, 850<br />

Stief C.G. 68, 286, 340, 447, 629,<br />

844, 847, 906, 907, 909, 923<br />

Stifelman M. 876<br />

Stillebroer A.B. 336<br />

Stock K. 386<br />

Stöckle M. 74, 192, 338, 703, 774,<br />

828, 1031, 1032, V31<br />

Stoeckigt C. 347<br />

Stoehrer M. 656<br />

Stojakovic T. 347<br />

Stolzenburg J.U. 91, 922, V4, V17<br />

Stone S. 719<br />

Numbers refer to abstract numbers


Stopak B.L. 327<br />

Storr M. 447<br />

Stow B. 782<br />

Strada G. 769<br />

Stranne J. 120, 808<br />

Strasak A. 644<br />

Straub M. 386, 1067<br />

Strick K. 448, 871<br />

Stringara S. 770<br />

Strittmatter F. 906, 907<br />

Stroelin P. 107<br />

Strohmaier W. 461<br />

Stöhrer M. 636<br />

Stölting M.N.L. 246<br />

Störkel S. 192<br />

Stroy O.O. 507<br />

Struss W. 866<br />

Stubendorff B. 56<br />

Stubinski R. 540<br />

Stucki P. 554<br />

Studer U.E. 330, 555, 1026<br />

Stuiver M.M. 387<br />

Stumm L. 1019<br />

Stunell H. 952<br />

Stunitz L. V58<br />

Sturch P. V62<br />

Suardi N. 182, 184, 186, 188, 289,<br />

467, 694, 695, 714, 918<br />

Subira D. V44<br />

Subirá J. 232<br />

Sudiana I.K. 908<br />

Süer E. 527, 646<br />

Sugano S. 764<br />

Sugimoto M. 228<br />

Sugimoto M. 503<br />

Sugimura Y. 978<br />

Sugino Y. 66, 1085<br />

Sugishita K. 931<br />

Sugiyama N. 79, 82, 463, 602<br />

Suh Y.S. 266, 280, 297, 538<br />

Suhotnik R. 202<br />

Sukhorukova M. 169<br />

Sukhotnik I. 202<br />

Sukonko O.G. 285, 958<br />

Sukumar S. 119, 158, 260, 369, 497,<br />

526, 534, 625, 657, 659, 915,<br />

1070<br />

Sullivan A. 296<br />

Sullivan J.F. 15<br />

Sulser T. 246, 635, 637<br />

Sultan M. 792<br />

Sumino Y.S. 444<br />

Sumitomo M. 504, 715<br />

Summers D. 475<br />

Sun J. 901<br />

Sun M. 140, 175, 178, 179, 262, 474,<br />

687, 718, 820, 927, 960, 1015<br />

Sun Y. 91, 484<br />

Sundi D. 815<br />

Sung H.H. 280, 538<br />

Sung L.H. 727<br />

Suttmann H. 105, 703<br />

Suzuki E. 333<br />

Suzuki K. 938<br />

Suzuki M. 333<br />

Suzuki S. V68<br />

Suzuki T. 998<br />

Suzuki T. 59<br />

Suzuki Y. 79, 82, 463, 602<br />

Svatek R.S. 754, 815<br />

Svejstrup J. 683<br />

Syed J. 20<br />

Sykes J. 287<br />

Sylvester R. 697, 708<br />

Symons M. 296<br />

Szarvas T. 155, 345<br />

Szendroi A. 774<br />

T<br />

Taari K. 274<br />

Tabatabaei S. 634<br />

Tabernero Gómez A. 556, 1036<br />

Taguchi K. 311<br />

Taha D-E. 934<br />

Taimen P. 154<br />

Takada N. 931<br />

Takada S. 998<br />

Takagi T. 821<br />

Takahashi R. 450<br />

Takahashi S. 404, 747<br />

Takahashi S. 603<br />

Takahashi S. 1048<br />

Takahashi T. 699, 1091<br />

Takai S. 288, 779<br />

Takamoto A. 503<br />

Takashi F. 713<br />

Takata R. 77<br />

Takeda M. 71, 84, 404, 747<br />

Takenaka A. 339, 925, 951<br />

Takeshita H. 950<br />

Tamarelle B. 705<br />

Tammela T.L. 108, 1039<br />

Tamura Y. 603<br />

Tan M.H. 1107<br />

Tan P.H. 200<br />

Tan W. 51, 58<br />

Tanabe K. 603, 821<br />

Tanagho Y. 876<br />

Tanaka H. 240, 470, 586<br />

Tanaka K. 663, 940<br />

Tanaka N. 456<br />

Tanaka N. 242, 818<br />

Tanaka T. 337, 603<br />

Tanase M. 712<br />

Tanda H. 121<br />

Taneja S. 138<br />

Tang S.Y.W. 142<br />

Tannuri U. 650<br />

Taño F. 229<br />

Tao S. 901<br />

Tao W. 839<br />

Tardito S. 770<br />

Tarrel R. 75<br />

Tasaki S. 574, 827<br />

Tasca A. 319<br />

Tasci A.I. 553<br />

Tatagiba M. 306<br />

Tateishi U. 1103<br />

Tatemichi S. 446<br />

Tatokoro M. 979<br />

Tatsugami K. 765<br />

Tawfik A.M. 214, 420<br />

Tawfik T.I. 214<br />

Taylor B. 395<br />

Taylor J.M. 749<br />

Taylor R.A. 946<br />

Te A.E. 638<br />

Teelab A.A. 416<br />

Teertstra H.J. 217, 394<br />

Teichman J.M.H. 1063<br />

Teishima J. 462, 666<br />

Tejedor-Jorge A. 606, 607<br />

Tejido Sánchez A. 773<br />

Tekgul S. 642, 643, 645<br />

Téllez Martínez Fornés M. 730<br />

Tenholte D. 890<br />

Numbers refer to abstract numbers<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

461<br />

Indices


Indices<br />

Abstract authors<br />

Tennstedt P. 293, 294, 685, 920,<br />

1023<br />

Teo L. 781<br />

Ter Haar R. 706<br />

Terachi T. 21<br />

Terrier N. 563, 564<br />

Terris B. 235<br />

Terrone C. 174, 264, 864, 887<br />

Terui K. 463<br />

Tewari A. 474<br />

Tezval H. 198<br />

Thaler C. 27<br />

Thalgott M. 809<br />

Thalmann G.N. 330, 665, 822, 942,<br />

1026, 1044<br />

Thanigasalam R. 112, 171<br />

Thapa P. 75, 924<br />

Theaker J. 1051<br />

Theil G. 1046<br />

Thiagamoorthy G. 910<br />

Thibault F.J.P. 112<br />

Thike A.A. 200<br />

Thiruchelvam N. 990, 1004<br />

Thiry S. 415<br />

Thistlethwaite F. 1101<br />

Thomas A.Z. 15<br />

Thomas B. 921<br />

Thomas H. 3<br />

Thomas J.S. 47<br />

Thompson C. 741, 744<br />

Thompson H. 75, 151<br />

Thompson P.M. 510, 1076<br />

Thompson R.H. 924, 957<br />

Thomsen F.B. 273<br />

Thong A. 761, 975<br />

Thorpe A. 781<br />

Thuret R. 283<br />

Thüroff J.W. 50, 338, 461<br />

Tian L. 901<br />

Tian Y. 249<br />

Tian Z. 175, 178, 262, 718, 927, 960,<br />

1024<br />

Tiemann A. 286<br />

Tikkinen K.A.O. 910<br />

Tilki D. 286<br />

Tillier C. 291<br />

Tillou X 500<br />

Timberg G. 216<br />

Timilshina N. 270<br />

462 <strong>Programme</strong> <strong>Book</strong><br />

Timsit M-O. 283<br />

Tiscione D. 459<br />

Titze U. 465<br />

Tjønneland A. 858<br />

Tligui M. 432<br />

Tobe M. 121<br />

Tobisawa Y. 79, 82, 197, 602, 1042<br />

Tobu S.T. 444<br />

Todenhöfer T. 364, 365, 812, 822,<br />

899, 1022, 1049, 1054<br />

Togashi M. 931<br />

Toi A. 270, 988<br />

Toivanen R. 946<br />

Tok A.T. 624<br />

Tokas T. 23<br />

Tokgoz H. 128<br />

Tokui N. 602<br />

Tokunori Y. 713<br />

Tolba R.H. 448, 871<br />

Tollefson M.K. 924<br />

Tomada I. 210<br />

Tomada N. 210<br />

Tombal B. 99, 182, 415, 674, 677,<br />

686, 688, 806, 911<br />

Tomida R. 132<br />

Tominaga M. 71<br />

Tominaga T. 1048<br />

Tomiyama Y. 446<br />

Tomlinson G.A. 886<br />

Tonghini M. 1041<br />

Tonooka A. 337<br />

Tonyali S. 645<br />

Torella M. 726<br />

Torelli T. 83, 388, 397, 398, 1055,<br />

1057<br />

Torigoe T. 767<br />

Torsello B. 769<br />

Tosco L. 880<br />

Touijer K.A. 188<br />

Touloupidis S. 423<br />

Townes C.L. 623<br />

Toyonori T. 713<br />

Tozawa K. 311<br />

Trachtenberg J. 270, 588, 988<br />

Tran M. 935<br />

Traverso P. 770<br />

Traxer O. 430, 432, 438, 1067<br />

Treiyer A. V31<br />

Tremblay T. 402<br />

Tremp M. 246<br />

Trenti E. 61<br />

Tretter R. 782<br />

Treurniet K. 287<br />

Trifard F. 171<br />

Trilla E. 768<br />

Trinchieri A. 1067<br />

Trinh Q-D. 78, 158, 179, 233, 369,<br />

497, 534, 573, 625, 657, 659,<br />

754, 876, 915, 956, 1070<br />

Trock B.J. 1048<br />

Trojan L. 24, 286, 1019<br />

Trombetta C. 614, 838, V55<br />

Trottier G. 270, 988<br />

Trottmann M. 844, 847<br />

Trunk M. 1052<br />

Truss M. 340<br />

Tsai Y.C. 26<br />

Tsaur I. 825, 830<br />

Tsiamis C. 41<br />

Tsivian M. 661, 967<br />

Tsuchiya N. 197, 610, 720, 1100,<br />

1104<br />

Tsui K-H. 148<br />

Tsuji H. 1108<br />

Tsujii T. 572, 819<br />

Tsukamoto T. 337, 603<br />

Tu L.M. 785<br />

Tubaro A. 411, 412, 672, 725, 782,<br />

990, 1014<br />

Tuccio A. 93<br />

Tugcu V. 552, 553<br />

Tuncel A. 615<br />

Turkbey B. 138<br />

Turkeri L. 708<br />

Turner E.L. 135<br />

Turney B. 1067<br />

Tutolo M. 467, 473, 695, 714, 806,<br />

918<br />

Tutrone Jr. R.F. 626<br />

Tworkiewicz J.T. 869<br />

Tyritzis S. 1035<br />

Tytgat J. 441<br />

U<br />

Uchida K. 121<br />

Uchida T. 265, 361<br />

Uckert S. 127, 329, 331, 904<br />

Ueda T. 1056<br />

Numbers refer to abstract numbers


Uemura H. 98, 1108<br />

Uemura M. 943<br />

Ueno M. 242<br />

Ukimura O. 138, 220, 265, 361, 835,<br />

V45, V79<br />

Umari P. 838<br />

Umeda K. 228<br />

Unda M. 702<br />

Underwood M.A. 902, 905, 989<br />

Unrein A. 774<br />

Unteregger G. 828<br />

Upadhaya R. 418, 421, 424<br />

Urbach D.R. 886<br />

Urbschat A. 608<br />

Usami M. 311<br />

Uvin P. 252, 441<br />

V<br />

Vaegler M. 243, 248, 791<br />

Vaessen C. 170, 171, 176, 261<br />

Vagnoni V. 693, 711<br />

Vaishamayan U.N. 1107<br />

Valenti M. 698<br />

Valentini M.A. 517<br />

Valeri A. 283<br />

Valerio M. 584, 926<br />

Vallee J-P. 356<br />

Vallier C. 1053<br />

Valotto C. 1017<br />

Valta M.P. 761, 975<br />

Van Aarle S. 1037<br />

Van Ahlen H. 127<br />

Van Bruwaene S. 468<br />

Van Cleynenbreugel B. 1000<br />

Van Den Bergh L. 360<br />

Van Den Bergh R.C.N. 292<br />

Van Den Bos C.W.L. 889<br />

Van Der Aa F. 252, 324, 326, 327,<br />

1004<br />

Van Der Eeckt K. 697<br />

Van Der Jagt M.F.P. 493<br />

Van Der Keur K.A. 238<br />

Van Der Kwast T. 50, 287, 588, 850,<br />

988<br />

Van Der Meulen E. 677, 678<br />

Van Der Meulen J.H.P. 138, 181, 190,<br />

218, 585, 658<br />

Van Der Poel H.G. 186, 217, 291,<br />

292, 392, 394, 686, 688, 911<br />

Van Erps T. 801<br />

Van Ginkel T. 706<br />

Van Herpen C.M.L. 336<br />

Van Kampen M. 1000<br />

Van Kerrebroeck P.E.V. 1089<br />

Van Kuppevelt T.H. 872<br />

Van Leenders G.J.L.H. 217, 850<br />

Van Leeuwen T.G. 594<br />

Van Lin N.J.T. 582<br />

Van Moorselaar R.J.A. 706<br />

Van Muilekom E. 291<br />

Van Poppel H. 14, 97, 108, 182, 188,<br />

360, 806, 1000<br />

Van Praet C. 191<br />

Van Rhijn B.W.G. 50, 394, 697<br />

Van Soest R. 217, 824<br />

Van Velthoven R. 800<br />

Van Weerden W.M. 824<br />

Van Werkhoven E. 392<br />

Vandaele P. V28<br />

Vaos G. 423<br />

Varca V. 817<br />

Vardi Y. 131<br />

Varga G. 631<br />

Varkarakis J. 697<br />

Vasarainen H. 274<br />

Vasdev N. 781<br />

Vashchula V.I. 621<br />

Vasilyev A. 350<br />

Vattovani V. 459<br />

Vaucher L. 926<br />

Vaughan E.D. 854<br />

Vaughan K. 506<br />

Vavallo A. 662<br />

Veeratterapillay R. 781<br />

Veliev E.I. 796<br />

Veltri A. 95<br />

Venetsanos F. 548<br />

Veneziano D. V1, V53<br />

Vennekens R. 441<br />

Vera M. 378<br />

Veran J. 245<br />

Vergho D.C. 863<br />

Vergnolles M. 96<br />

Vergunst H. 582, 700<br />

Verhagen P.C.M.S. 680<br />

Verhasselt-Crinquette M. 237<br />

Verhoest G. 87, 283<br />

Verkerk A.M. 680<br />

Verma R.K. 665<br />

Vermeij M. 54<br />

Verne J. 230<br />

Verplaetse R. 441<br />

Verri C. 698<br />

Verze P. 172, 396, 560, 622, 660,<br />

V55<br />

Vianello A. 147, 933<br />

Vicens Vicens T. 113<br />

Vicentini F.C. 525<br />

Vickers A.J. 813, 850, 856<br />

Vieillefond A. 235<br />

Vieweg M. 32<br />

Viganò P. 769<br />

Vignozzi L. 411<br />

Vigués F. V41, V63<br />

Viktrup L. 1096<br />

Vila A. 639<br />

Vilardell J. 768<br />

Vilaseca Cabo A. 489, 494<br />

Vilaça J. 968<br />

Viliukha A.I. 621<br />

Villa L. 451, 651, 695, 714<br />

Villacampa Aubá F. 773<br />

Villalobos-Gollas M. 973<br />

Villari D. V69<br />

Villavicencio H. 281, 372, 531, 532,<br />

V35, V49, V72<br />

Villers A. 138, 220, V28<br />

Vilà M. 768<br />

Vincendeau S. 139, 852, 853<br />

Vincent A.D. 387<br />

Vincenti G. 486<br />

Viney Z. 477<br />

Vint R. 370, 969<br />

Visakorpi T. 1044<br />

Viset T. 152<br />

Vit V. 631<br />

Vitruk Y. 94<br />

Vittori G. 93, 259, 592<br />

Vjaters E. 680<br />

Voce S. 579<br />

Voets T. 441<br />

Vogt M. 1102, 1106<br />

Voilenko O. 94<br />

Volkmer G. 151<br />

Volkova M.I. 88, 90, 954<br />

Volpe A. 172, 174, 264, 887<br />

Vom Dorp F. 155, 559<br />

Numbers refer to abstract numbers<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

463<br />

Indices


Indices<br />

Abstract authors<br />

Von Schönfeldt V. 27<br />

Von Verschuer U. 1102<br />

Voorham H.C. 889<br />

Voorham-Van der Zalm P.J. 889<br />

Vordos D. 716, 753, V15<br />

Vorobyev N.V. V43<br />

Vörös J. 799<br />

Votanopoulos K. 558<br />

Vozdvozhenskiy M.O. 581<br />

Vukalovich P. 94<br />

Vuruskan H. 652<br />

W<br />

Wada Y. 982<br />

Wadhwa K. 142<br />

Wagenlehner F.M.E. 160, 619, 712,<br />

897, 947<br />

Wagenpfeil S. 809<br />

Wagner A. 882, V12<br />

Wagner C. V16, V20, V34<br />

Wagner L. 112<br />

Wahlfors T. 1039<br />

Waidelich R. 907<br />

Walcher U. 549, 656<br />

Wald A. 1049<br />

Waldert M.J. 991<br />

Waldkirch E.S. 904<br />

Waliszewski P. 712, 947<br />

Walker M. 941<br />

Walker V.C. 902, 905, 989<br />

Wallen E.M. 1032<br />

Walleser S. 775<br />

Walley A. 910<br />

Walther S. 907<br />

Walton K. 623<br />

Walton T. 576<br />

Waltregny D. 780<br />

Walz J. 186, 1053<br />

Wang C-J. 205<br />

Wang C.X. 247, 972<br />

Wang H. 27, 28, 36, 837<br />

Wang H.Z. 840<br />

Wang J.W. 839<br />

Wang K. 162, 249, 505<br />

Wang L. 91, 814<br />

Wang W. 510<br />

Wang W.L. 840<br />

Wang X. 149, 948, 961, 1061<br />

Wang X.Q. 247<br />

464 <strong>Programme</strong> <strong>Book</strong><br />

Wang X.K. 840<br />

Wang Y.B. 972<br />

Wang Y. 103<br />

Wang Y.X. 28, 36, 837<br />

Warlé M.C. 493<br />

Warren A. 142, 224, 935<br />

Wasiutyński A. 279<br />

Watanabe H. 228<br />

Watanabe Y. 138<br />

Watkin N. 389<br />

Watkins J. 1033<br />

Watts S.D. 275<br />

Waxman J. 941<br />

Weber M. 739<br />

Wegener G. 241, 338, 348<br />

Wehrberger C. 992<br />

Weibl P. 345<br />

Weidner W. 27, 31, 32, 160, 707,<br />

712, 897, 947<br />

Weigand K. 382, V50<br />

Weihe E. 62<br />

Wein A. 854<br />

Weir S. 585<br />

Weirich G. 809<br />

Weiss C. 322, 1052<br />

Weissbach L. 822<br />

Weissbach L. 272<br />

Weisstanner C. 665<br />

Weizer A.Z. 78, 573, 1031<br />

Welbourn W. 719<br />

Wendt-Nordahl G. 964<br />

Wenzel O. 1025<br />

Wenzel P. 293<br />

Werbrouck P. 674<br />

Wernli L. 618<br />

Wese F. 415<br />

West C. 58<br />

Westfall T.D. 440<br />

Wetterauer U. 461, 629<br />

Wetterwald A. 330, 942<br />

Wettstein M.S. 635, 637<br />

Weyne E. 688<br />

Wezel F. 157<br />

Wharton I.P. 1074<br />

Whelan L. 740<br />

Wicker A. 22<br />

Wickmann U. 774<br />

Wiechno P. 101<br />

Wiegel T. 182, 192, 806<br />

Wieland U.W. 624<br />

Wieland W.F. 225, 282, 286, 944<br />

Wiest R. 665<br />

Wiklund N.P. 1035<br />

Wiklund P. 912, 916, 1031, 1032<br />

Wilczek E. 279<br />

Wildhagen M. 217, 680<br />

Wilding G. 20<br />

Wilhelm K. 56<br />

Willder J.M. 902, 905, 989<br />

Wille S. 624, 890<br />

Williams J.P. 161, 506<br />

Willich N. 192<br />

Wilson S.K. V71<br />

Wilson T.H. 1031, 1032, 1095<br />

Winkler A. 344<br />

Winkler E. 341<br />

Winkler M. 353<br />

Wirth G.J. 721<br />

Wirth M. 108, 192, 984, 1058<br />

Withington J. 658<br />

Witjes J.A. 12, 153, 577, 697, 700,<br />

755<br />

Witjes W.P.J. 755<br />

Witt J.H. 690, V16, V20, V34<br />

Witzsch U. 696<br />

Wolff M. 62<br />

Wolf-Johnston A. 65<br />

Wöllner J. 70<br />

Wolters M. 656<br />

Wong A. 758<br />

Wong A. 281<br />

Wong D. 1096<br />

Wong K.A. 1084<br />

Wong L.M. 270<br />

Wong S. 108<br />

Woo H.H. 634, 638<br />

Wood C. 576<br />

Wood I.R.G. 38, 45, 1077<br />

Wood L. 1107<br />

Woods M. 1031, 1032<br />

Wooten A. 704<br />

Wrobel B.M. 89<br />

Wu C.T. 335<br />

Wu F.C.W. 211<br />

Wu G. 149, 948, 961, 1061<br />

Wu T. 249<br />

Wu W-J. 205<br />

Wu W. 320<br />

Numbers refer to abstract numbers


Wu Y.N. 335<br />

Wu Y. 948, 961, 1061<br />

Wunderlich H. 194<br />

Wüthrich P.Y. 1026<br />

Wyler S. 167, 618<br />

X<br />

Xambre L. 895<br />

Xiao C. 320<br />

Xiao R. 948, 961, 1061<br />

Xiao-Dong J. 555<br />

Xie D. 724<br />

Xie W. 1107<br />

Xie X-J. 114<br />

Xu C. 484<br />

Xu H. 149<br />

Xu J. 9, 901<br />

Xu N. 972<br />

Xue B.X. 839<br />

Xue Y. 149, 948, 961, 1061<br />

Xylinas E. 78, 87, 151, 156, 276,<br />

474, 573, 576, 701, 752, 754,<br />

813, 814, 815, 929, 1105<br />

Y<br />

Yacoub M. 763<br />

Yadav A. 1027<br />

Yae K. 60<br />

Yagisawa T. 492<br />

Yakar D. 582<br />

Yakupoglu Y.K. 117, 163, 381<br />

Yakushiji H. 199<br />

Yamada A. 98<br />

Yamada Y. 504<br />

Yamaguchi K. 33, 35, 842<br />

Yamaguchi O. 446<br />

Yamamichi F. 663, 940<br />

Yamamoto H. 79, 82, 463, 602, 1042<br />

Yamamoto H. 132<br />

Yamamoto R. 228<br />

Yamamoto T. 779<br />

Yamamoto Y. 1108<br />

Yamanaka M. 132<br />

Yamasaki T. 52, 772<br />

Yamashita T. 931<br />

Yan Y.J. 932<br />

Yang C-W. 784<br />

Yang D.Y. 213<br />

Yang H. 27, 36, 837<br />

Yang J. 149, 961, 1061<br />

Yang L. 162, 505<br />

Yang S.C. 177<br />

Yang S.S-D. 1064<br />

Yang W. J. 325<br />

Yao A. 339, 925, 951<br />

Yao M. 1103<br />

Yao Q.Y 839<br />

Yap S.A. 886<br />

Yapanoglu T. 616<br />

Yassin A. 207<br />

Yassin D.J. 207<br />

Yasuhito F. 713<br />

Yasui T. 311<br />

Yasushi Y. 713<br />

Yates D. 576<br />

Yates-Bell A.J 1076<br />

Yatsyna O. 94<br />

Ye D.W. 1098<br />

Ye Z. 108<br />

Yegnasubramanian S. 943<br />

Yeh H-C. 205<br />

Yeo J.K. 209, 544<br />

Yildiz M. 615<br />

Yilmaz A.F. 163<br />

Yin C.J. 878<br />

Yiou R. 753<br />

Yokomizo A. 765<br />

Yokoyama H. 228<br />

Yokoyama M. 470, 578, 586, 756<br />

Yokoyama T. 199<br />

Yones S. 792<br />

Yonese J. 572, 819<br />

Yoneyama T. 79, 82, 197, 463, 602,<br />

613, 720, 1042<br />

Yoneyama T. 79, 82, 197, 602, 1042<br />

Yoo C. 213, 786<br />

Yoo D. 80, 196, 466, 469<br />

Yoo E.S. 253, 428<br />

Yoo G.H. 435<br />

Yoo T.K. 519<br />

Yoon C.Y. 955, 994<br />

Yoon H. 512<br />

Yoon J. 551, V47<br />

Yoon J.H. 691, 771<br />

Yoon S.J. 974<br />

Yoshida K. 821<br />

Yoshida K. 764<br />

Yoshida M. 404, 747<br />

Yoshida S. 442<br />

Yoshida S. 240, 470, 578, 586, 756,<br />

979<br />

Yoshida T. 676<br />

Yoshihide H. 59<br />

Yoshihisa M. 713<br />

Yoshimura K. 98, 1108<br />

Yoshimura K. 66, 1085<br />

Yoshimura N.Y. 444<br />

Yoshino H. 52, 772<br />

Yoshino Y. 288, 779<br />

Yoshioka K. 228<br />

You D. 478, 771, 807, 1097<br />

Young J.G. 316<br />

Young S.R. 761<br />

Young S.T. 91<br />

Youssef S. 966<br />

Yu H. 193<br />

Yu H.S. 464<br />

Yu J.H. 727<br />

Yuan Y. 948, 961, 1061<br />

Yuasa T. 1107<br />

Yue X. 249<br />

Yuge K. 959<br />

Yuh B. 1032<br />

Yun J.H. 325<br />

Yutaka T. 931<br />

Yutkin V. 1050<br />

Z<br />

Zacharakis E. 129<br />

Zacharias M. 286<br />

Zacharis A. 984<br />

Zacharowski K. 608<br />

Zagaynova E. 354<br />

Zahran M.H. 934, 1069<br />

Zaidi S.Z. 530<br />

Zakouji H. 84<br />

Zaman F. 654, 963<br />

Zambudio Carmona G. 422<br />

Zampa V. 1008<br />

Zang W. 250<br />

Zani D. 592<br />

Zanni G. 694, 748<br />

Zanollo L. 301, 305<br />

Zantl N. 565<br />

Zappala M.S. 854<br />

Zaramella S. 259<br />

Zastrow S. 340, 984<br />

Numbers refer to abstract numbers<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

465<br />

Indices


Indices<br />

Abstract authors<br />

Zattoni F. 357<br />

Zattoni F. 357, 887, 1017<br />

Zát'ura F. 353<br />

Zeeck K. 882<br />

Zeegers M.P.A. 239<br />

Zegna L. 174<br />

Zehnder P. 330<br />

Zeier M. 341<br />

Zellweger T. 945<br />

Zeman F. 944<br />

Zembutsu H. 77<br />

Zennami K. 504<br />

Zepeda S. 1096<br />

Zequi S.C. 399, 557<br />

Zerbetto F. 183, 184, 185<br />

Zerbib M. 78, 87, 141, 151, 170,<br />

235, 276, 283, 573, 701, 754,<br />

814<br />

Zettl H. 195<br />

Zeybek D. 643<br />

Zhang G. 149, 948, 961, 1061<br />

Zhang H.F. 972<br />

Zhang H.L. 1098<br />

Zhang H. 9<br />

Zhang L. 9<br />

Zhang T. 36<br />

Zhang Z. 484<br />

Zhao C. 488<br />

Zhao H. 761, 975<br />

Zhao Z. 320<br />

Zharkikh A.V. 667<br />

Zheng S. 901<br />

Zhong P. 653<br />

Zhong W. 320<br />

Zhou J. 741, 744<br />

Zhou Y. 99<br />

Zhu J.Z 839<br />

Zhu X. 5<br />

Zhuang D. 156<br />

Zidan E.M. 934<br />

Zigeuner R. 340, 347, 575, 576, 601,<br />

813<br />

Zimmermann M. 635, 637<br />

Zimmermann R.P. 884<br />

Zimmermanns V. 373, 962<br />

Zimmern P. 114, 168, 722, 732<br />

Zimpfer A. 195<br />

Zini L. 170, 171, 176<br />

Zinke J. V34<br />

466 <strong>Programme</strong> <strong>Book</strong><br />

Zipeto M.A. 769<br />

Zitzmann M. 207<br />

Ziypak T. 417, 616<br />

Zlobec I. 1044<br />

Zlotta A.R. 270, 588<br />

Zobel B.B. 580<br />

Zorn K.C. 638<br />

Zou W. 605<br />

Zou X. 149, 948, 961, 1061<br />

Zouari M. 520<br />

Zraik I. 448<br />

Zucchi A. 561, 729, 933<br />

Zugor V. 690, V16<br />

Zuiverloon T.C.M. 238<br />

Zuluaga Gomez A. 312<br />

Zumbé J. 629<br />

Zuo L. 311<br />

Zwarthoff E.C. 54, 238<br />

Zygmunt P. 651<br />

Numbers refer to abstract numbers


Abstract sorted by Topic<br />

Adrenals<br />

25, 26, 461, 462, 463, V31, V53, V61<br />

BPH<br />

Basic research<br />

250, 411, 451, 899, 900, 901, 902,<br />

903, 904, 905, 906, 907, 908, 910,<br />

995<br />

Evaluation<br />

72, 407, 412, 519, 633, 988, 989,<br />

990, 991, 992, 993, 994, 996, 997,<br />

998, 1087<br />

Intervention therapy<br />

516, 520, 521, 522, 523, 524, 525,<br />

627, 628, 629, 630, 631, 632, 634,<br />

635, 636, 637, 638, 1096<br />

Medical therapy<br />

68, 404, 408, 409, 410, 514, 515,<br />

517, 518, 626, 742, 909, 1085, 1086,<br />

1088, 1089, 1090, 1091, 1092, 1093,<br />

1094, 1095<br />

Female urology<br />

Basic research<br />

109, 110, 243, 244, 245, 252, 672,<br />

723, 725, 889, 890, 891<br />

Diagnosis<br />

673, 722, 735, 888<br />

Treatment<br />

111, 112, 113, 114, 115, 116, 119,<br />

246, 666, 667, 724, 726, 727, 728,<br />

729, 730, 731, 732, 733, 734, 775,<br />

776, 777, 778, 779, 780, 781, 782,<br />

783, 784, 785, 786, 893, 894, 895,<br />

896, 897, 898, V28, V75<br />

History of urology<br />

38, 39, 40, 41, 42, 43, 44, 45, 46,<br />

47, 48, 49, 1073, 1074, 1075, 1076,<br />

1077, 1078, 1079, 1080, 1081, 1082,<br />

1083, 1084<br />

Infectious diseases<br />

158, 159, 160, 161, 162, 163, 165,<br />

166, 167, 168, 169, 502, 503, 504,<br />

505, 506, 507, 508, 509, 510, 511,<br />

512, 513, 614, 615, 616, 617, 618,<br />

619, 620, 621, 622, 623, 624, 625,<br />

644, 663, 891<br />

Infertility<br />

27, 28, 29, 30, 31, 32, 33, 34, 35,<br />

36, 37, 836, 837, 838, 839, 840, 841,<br />

842, 843, 844, 845, 846, 847, V52<br />

Kidney<br />

transplantation<br />

Basic research<br />

491, 602, 603, 604, 605, 606, 607,<br />

608, 609<br />

Clinical<br />

117, 374, 375, 376, 377, 378, 379,<br />

380, 381, 382, 383, 384, 385, 386,<br />

489, 490, 492, 493, 494, 495, 496,<br />

497, 498, 499, 500, 501, 610, 611,<br />

612, 613, V3, V49, V50<br />

Male incontinence<br />

999, 1000, 1001, 1002, 1003, 1004,<br />

1005, 1006, 1007, 1008, 1009, 1010<br />

Neuro-urology<br />

Basic research<br />

62, 63, 64, 65, 66, 67, 69, 70, 71,<br />

251, 253<br />

Diagnosis and treatment<br />

300, 301, 302, 303, 304, 305, 306,<br />

307, 308, 310, 401, 402, 403, 405,<br />

406, 665, V32, V51, V65, V73<br />

Non-neurogenic<br />

voiding dysfunction<br />

Basic research<br />

440, 441, 442, 443, 444, 445, 446,<br />

447, 448, 449, 450, 664, 671<br />

Diagnosis and treatment<br />

668, 669, 670, 736, 737, 738, 739,<br />

740, 741, 743, 744, 746, 747<br />

Paediatrics<br />

413, 414, 415, 416, 417, 418, 419,<br />

420, 421, 422, 423, 424, 526, 527,<br />

528, 529, 530, 531, 532, 533, 534,<br />

535, 536, 537, 639, 640, 641, 642,<br />

643, 645, 646, 647, 648, 649, 650<br />

Penis/testis<br />

Penile disorders (excluding<br />

urethra)<br />

387, 388, 389, 390, 391, 392, 393,<br />

394, 395, 396, 397, 398, 399<br />

Testis tumours<br />

400, 1051, 1052, 1053, 1054, 1055,<br />

1056, 1057, 1058, 1059, 1060<br />

Prostate cancer<br />

Cell biology<br />

935, 936, 937, 938, 939, 940, 941,<br />

942, 943, 944, 945, 946, 947, 1043<br />

Novel biomarkers<br />

1039, 1040, 1041, 1042, 1044, 1045,<br />

1046, 1047, 1048, 1049, 1050<br />

Basic research: Novel therapies<br />

191, 823, 824, 825, 826, 827, 828,<br />

829, 830, 831, 832, 833, 834, 835<br />

Imaging and new techniques<br />

217, 218, 219, 220, 221, 222, 223,<br />

224, 225, 226, 227, 228, 350, 351,<br />

352, 353, 354, 355, 356, 357, 358,<br />

359, 361, 582, 587, 588, 589, 696,<br />

861, V14, V17, V77, V79<br />

Management of metastatic<br />

disease<br />

97, 98, 99, 100, 101, 102, 103, 104,<br />

105, 106, 107, 108, 188, 674, 676,<br />

677, 678, 679, 680, 681, 682,<br />

Management of non-metastatic<br />

disease: Active surveillance<br />

265, 266, 267, 268, 269, 270, 271,<br />

272, 273, 274, 275<br />

Management of non-metastatic<br />

disease: Focal therapy<br />

192, 578, 579, 580, 581, 583, 584,<br />

585, 586, 675<br />

Management of non-metastatic<br />

disease: Radical non surgical<br />

treatment<br />

181, 182, 183, 184, 185, 190, 683,<br />

684, 806, 807<br />

Management of non-metastatic<br />

disease: Radical surgical<br />

treatment<br />

180, 186, 187, 189, 288, 289, 290,<br />

291, 292, 293, 294, 295, 296, 297,<br />

298, 299, 685, 686, 687, 688, 689,<br />

Numbers refer to abstract numbers<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

467<br />

Indices


Indices<br />

Abstract sorted by Topic<br />

690, 691, 692, 693, 694, 695, 799, 800, 801, 802, 803,<br />

804, 805, 808, 809, 810, 911, 912, 913, 914, 915, 916,<br />

917, 918, 919, 920, 921, 922, 1011, 1012, 1013, 1014,<br />

1015, 1016, 1017, 1018, 1019, 1020, 1021, 1022, 1023,<br />

1024, V10, V11, V13, V15, V16, V7<br />

Pathology and biopsies<br />

709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719,<br />

720, V62<br />

PSA and related markers<br />

848, 849, 850, 851, 852, 853, 854, 855, 856, 857, 858,<br />

859, 860<br />

Screening/diagnosis: Diagnosis<br />

3, 133, 135, 136, 137, 138, 139, 140, 141, 142, 143, 474<br />

Screening/diagnosis: Screening<br />

1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 721<br />

Staging<br />

360, 465, 466, 467, 468, 469, 470, 471, 472, 473, 475,<br />

476<br />

Renal tumours<br />

Basic research<br />

193, 194, 195, 196, 197, 198, 199, 200, 202, 203, 204,<br />

339, 343, 761, 762, 764, 765, 766, 767, 768, 769, 770,<br />

771, 772, 773, 774, 884, 975, 976, 977, 978, 979, 980,<br />

981, 982, 983, 984, 985, 986, V2<br />

Diagnosis<br />

336, 337, 338, 340, 341, 342, 344, 345, 346, 347, 348,<br />

349, 763<br />

Medical treatment<br />

1097, 1098, 1099, 1100, 1101, 1102, 1103, 1104, 1105,<br />

1106, 1107, 1108<br />

Non surgical treatment<br />

95, 174, 175<br />

Surgical treatment: Non organ sparing<br />

452, 453, 454, 455, 456, 458, 459, 460, 948, 950, 951,<br />

952, 953, 954, 955, 956, 957, 958, 959, 960, V4, V41,<br />

V42, V44, V5, V63<br />

Surgical treatment: Organ sparing<br />

452, 453, 454, 455, 456, 458, 459, 460, 948, 950, 951,<br />

952, 953, 954, 955, 956, 957, 958, 959, 960, V4, V41,<br />

V42, V44, V5, V63, 883, 885, 886, 887, V1, V18, V19, V20,<br />

V21, V22, V23, V24, V25, V43, V45, V46, V47, V48, V78<br />

468 <strong>Programme</strong> <strong>Book</strong><br />

Sexual dysfunction<br />

Basic research<br />

324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334,<br />

335<br />

Diagnosis and treatment<br />

120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130,<br />

131, 132, 205, 206, 207, 208, 209, 210, 211, 212, 213,<br />

214, 215, 216, V71<br />

Stones<br />

ESWL<br />

538, 539, 540, 541, 542, 543, 544, 652<br />

Medical/research<br />

311, 312, 313, 314, 315, 316, 317, 318, 321, 436, 437,<br />

438, 439, 550, 651, 653, 655, 657, 661<br />

Open and percutaneous<br />

320, 322, 323, 545, 546, 547, 548, 549, 551, 654, 656,<br />

658, 659, 962, 963, 964, 966, 967, 968, 969, 970, 971,<br />

972, 973, 974, V35, V36, V39, V40<br />

Upper tract benign disease<br />

961, 1061, 1069, 1070, V34<br />

Ureteroscopy<br />

319, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435,<br />

660, 1062, 1063, 1064, 1066, 1067, 1068, 1071, 1072,<br />

V37<br />

Trauma<br />

464, 562, 563, 564, 565, 662, 949, V66<br />

Unclassified and miscellaneous<br />

research<br />

13, 14, 15, 16, 17, 18, 19, 20, 21, 23, V12, V30, V33, V38,<br />

V60, V67<br />

Urethral strictures<br />

247, 248, 787, 788, 790, 791, 792, 793, 794, 795, 796,<br />

797, 798<br />

Uro-genital reconstruction<br />

249, 425, 552, 553, 554, 555, 556, 557, 558, 559, 560,<br />

561, 862, 863, 864, 865, 866, 867, 868, 869, 870, 871,<br />

872, 873, 874, 1026, V54, V55, V56, V57, V68, V69, V70,<br />

V74, V76<br />

Numbers refer to abstract numbers


Urothelial tumours<br />

Basic research<br />

50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 144, 145,<br />

146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156,<br />

157<br />

Diagnosis<br />

229, 230, 232, 233, 234, 235, 236, 237, 238, 239, 240,<br />

241, 242, 282, 287, 362, 363, 364, 365, 366, 367, 368,<br />

369, 370, 371, 372, 373, 479, 572, 574, 590, 591, 592,<br />

593, 594, 595, 596, 597, 598, 599, 600, 601, 759<br />

Management of infiltrative/advanced tumours: Non<br />

surgical management<br />

74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85<br />

Management of infiltrative/advanced tumours:<br />

Surgical management<br />

24, 753, 811, 812, 813, 814, 815, 816, 817, 818, 819, 820,<br />

821, 822, 923, 924, 925, 926, 927, 928, 929, 930, 931,<br />

932, 933, 934, 1025, 1027, 1028, 1029, 1030, 1031, 1032,<br />

1033, 1034, 1035, 1036, 1037, 1038, V26, V27, V29, V58,<br />

V6, V64, V72, V8, V9<br />

Management of superficial tumours<br />

231, 487, 488, 566, 567, 568, 569, 570, 571, 575, 577,<br />

697, 698, 699, 700, 701, 702, 703, 704, 705, 706, 707,<br />

708, 748, 749, 750, 751, 752, 754, 755, 756, 757, 758,<br />

760, V59<br />

Staging<br />

276, 277, 278, 279, 280, 281, 283, 284, 285, 286, 477,<br />

478, 480, 481, 482, 483, 484, 485, 486, 573, 576<br />

Numbers refer to abstract numbers<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

469<br />

Indices


Indices<br />

Sessions sorted by Topic<br />

Andrology<br />

71, 82, 83, 95, 106, 107, 117, 118, 132, 133, 157, 158,<br />

233, 256, 257, 271, 317, 325, 352, 408<br />

Bladder cancer<br />

59, 61, 63, 67, 70, 108, 121, 122, 136, 137, 149, 150,<br />

165, 166, 177, 178, 196, 197, 215, 216, 264, 285, 286,<br />

303, 304, 340, 354, 400, 406<br />

BPH<br />

202, 203, 221, 222, 235, 280, 281, 295, 296, 312, 313,<br />

365, 400, 403, 404, 407, 415, 416<br />

Functional urology<br />

61, 65, 67, 68, 76, 87, 88, 95, 99, 100, 116, 138, 139,<br />

143, 153, 154, 183, 184, 189, 190, 227, 228, 233, 234,<br />

235, 243, 244, 245, 246, 251, 252, 261, 278, 279, 297,<br />

298, 317, 322, 326, 334, 345, 347, 369, 370, 409, 410,<br />

411, 418, 419<br />

History<br />

84, 112, 311<br />

Infections<br />

95, 106, 123, 124, 200, 201, 219, 220, 260, 405, 414<br />

Kidney transplantation<br />

104, 105, 179, 180, 190, 191, 263, 317, 328<br />

Paediatric urology<br />

69, 76, 95, 171, 185, 186, 204, 205, 223, 224, 317, 360<br />

Penis/testis<br />

181, 182, 307, 308, 317, 339<br />

Prostate cancer<br />

53, 54, 55, 57, 60, 61, 63, 65, 67, 78, 95, 108, 114, 115,<br />

119, 120, 127, 128, 129, 134, 135, 143, 147, 148, 151,<br />

152, 164, 167, 175, 176, 194, 195, 200, 201, 213, 214,<br />

229, 230, 233, 237, 238, 241, 242, 258, 259, 264, 265,<br />

266, 269, 270, 272, 273, 283, 284, 287, 288, 301, 302,<br />

305, 306, 317, 318, 319, 321, 323, 324, 348, 356, 357,<br />

358, 359, 363, 364, 367, 401, 402, 412, 413, 417, 420,<br />

421<br />

Reconstructive urology<br />

56, 61, 110, 111, 143, 208, 209, 274, 275, 282, 317<br />

470 <strong>Programme</strong> <strong>Book</strong><br />

Renal tumours<br />

63, 66, 68, 91, 92, 108, 109, 125, 126, 130, 131, 140,<br />

141, 146, 159, 160, 161, 168, 169, 191, 192, 212, 217,<br />

218, 249, 250, 255, 258, 259, 264, 276, 277, 289, 290,<br />

293, 294, 314, 315, 317, 327, 337, 342, 372, 397, 398,<br />

399<br />

Robotic surgery<br />

65, 93, 96, 146, 172, 173, 174, 254, 342, 356, 357, 368<br />

Stones<br />

60, 67, 102, 144, 145, 155, 156, 187, 188, 193, 206, 207,<br />

225, 226, 233, 291, 292, 309, 310, 317, 329, 330, 350,<br />

353, 371, 400<br />

Trauma<br />

208, 209, 317, 366<br />

Urothelial tumours<br />

85, 86, 89, 90, 143, 144, 210, 211, 239, 240, 247, 248,<br />

258, 259, 267, 268, 317, 361<br />

Numbers refer to page numbers


List of Speakers (not abstracts)<br />

A<br />

Abbou C-C., 70, 72, 80, 96<br />

Abol-Enein H., 63, 303, 366<br />

Abrahamsson P-A., 72, 75, 319<br />

Abrams P., 183, 233, 334, 410<br />

Ahallal Y., 70<br />

Ahmed H.U., 213<br />

Aho T., 407<br />

Ahyai S., 111<br />

Al-Hayek S., 93<br />

Al Naimi A., 63<br />

Al Nono I.H., 63<br />

Albers P., 236, 258, 339<br />

Alcaraz A., 97, 340, 400<br />

Algaba F., 109, 335<br />

Alici B.M., 110<br />

Alivizatos G.J., 390<br />

Andersson K-E., 138<br />

Andrich D.E., 110, 111<br />

Andriole G., 53, 404<br />

Annerstedt C.M., 97, 254<br />

Anson K.M., 365<br />

Artibani W., 61, 68, 76, 96, 99, 254,<br />

356<br />

Atallah K., 70<br />

Aulitzky W., 271, 352<br />

Ayati M., 61<br />

Azzouzi A.R., 417<br />

B<br />

Babjuk M., 210, 354<br />

Bach T., 102, 144<br />

Bachmann A., 97, 280, 375, 390<br />

Bader P., 262<br />

Bahl A., 401<br />

Barber N., 390<br />

Bardan R.T., 379<br />

Barret E., 191, 417<br />

Bartoletti R., 106, 415<br />

Basiri A., 61<br />

Bassi P.F., 405<br />

Bastian P., 136<br />

Bauer R., 100, 297<br />

Baumert H., 140, 329<br />

Beerlage H.P., 113, 331<br />

Bellmunt J., 57, 89, 421<br />

Bergstrom R., 419<br />

Bettocchi C., 106<br />

Bex A., 108, 337<br />

Birkhäuser F., 293<br />

Birowo P., 71<br />

Bjartell A., 258<br />

Bjerklund Johansen T.E., 106, 260,<br />

299, 365<br />

Black P., 196<br />

Bogaert G.A., 223, 360<br />

Borkowski T.A., 114<br />

Bossi A., 128, 318, 348<br />

Boström P.J., 72, 121<br />

Botto H., 416<br />

Brausi M., 108, 143, 170, 285, 299,<br />

406<br />

Brawley O.W., 54<br />

Breda A., 96, 163, 198, 353, 386<br />

Brehmer M., 94, 377<br />

Briganti A., 61, 317<br />

Brown P., 53, 55<br />

Bryan R., 136<br />

Buchholz N.N-P., 102, 193, 353, 377<br />

Bucuras V., 96, 291, 393<br />

Budde K., 399<br />

Buffi N.M., 383<br />

Bulbul M., 63<br />

Burchardt M., 97, 283, 381<br />

Burger M., 165, 215, 406<br />

Burgos Revilla F.J., 104, 263, 328<br />

Burke D., 264<br />

Burkhard F.C., 261, 317, 345<br />

C<br />

Camignani L., 97<br />

Campos Pinheiro L.M., 147<br />

Capitan Manjon C.M., 373<br />

Carbone A., 146<br />

Carey B.M., 100, 175<br />

Carl S., 390<br />

Castro-Diaz D., 99<br />

Cathelineau X., 338<br />

Catto J.W.F., 165, 317, 343<br />

Çek H.M., 219<br />

Celia A., 212<br />

Cervigni M., 405<br />

Cestari A., 96, 159, 254<br />

Chapple C.R., 56, 67, 234, 322, 410<br />

Cheon J., 57<br />

Chiti A., 167<br />

Chkhotua A.B., 104, 217<br />

Chlosta P., 233, 380<br />

Chrisofos M., 123<br />

Chung B.H., 57<br />

Chung M.K., 57<br />

Clarke N.W., 65, 108, 339, 402<br />

Coelho Nunes P.T., 104<br />

Compérat E., 335<br />

Congregado Ruiz C.B., 194<br />

Cornel E.B., 93<br />

Costa C.S.R., 157<br />

Costantini E., 326<br />

Cowan N., 259<br />

Cresswell J., 379<br />

Crouzet S., 272<br />

Cruz C.D., 189<br />

Cruz F.R., 67, 76, 99, 370, 409, 418<br />

Culig Z., 53, 108, 164, 299<br />

Curigliano G., 412<br />

Cuzick J., 53, 318<br />

Cuzin B., 132<br />

Cynk M., 407<br />

D<br />

Dahlem R., 111<br />

Damiano R., 405<br />

Dasgupta P., 97, 356<br />

De Gennaro M., 204<br />

De Jong I.J., 127, 420<br />

De La Morena Gallego J.M., 159<br />

De La Rosette J.M.C.H., 97, 102,<br />

327, 403<br />

De La Taille A., 255, 393, 415<br />

De Reijke T.M., 147, 420<br />

De Ridder D.J.M.K., 65, 76, 99, 326<br />

De Santis M., 114, 258, 413<br />

Deger S., 110, 299<br />

Del Popolo G., 261<br />

Demirkesen O., 110<br />

Desai M.R., 59, 144, 225<br />

Di Stasi S.M., 406<br />

Di Tonno P., 104<br />

Dinis Oliveira P., 251<br />

Dirix P., 63<br />

Dixon P., 419<br />

Djavan B., 61, 109, 167, 305, 348<br />

Djinovic R.P., 110<br />

Dohle G.R., 107<br />

Dore B., 309<br />

Doumerc N.D., 383<br />

Drake M.J., 95, 245, 370, 385, 419<br />

Numbers refer to page numbers<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

471<br />

Indices


Indices<br />

List of Speakers (not abstracts)<br />

Dreikorn K., 104<br />

Drewa T.A., 274<br />

Duran I., 398<br />

Dybowski B.A., 183<br />

E<br />

Eardley I., 236, 256, 325, 408<br />

Eberli D., 138, 171<br />

Eeles R.A., 53<br />

Egawa S., 181<br />

Eisenberger M., 412<br />

El Halaby M.R., 63<br />

Elliott R., 419<br />

Elneil S., 333<br />

Emami M., 61<br />

Emberton M., 318, 404<br />

Erdogru T., 97<br />

Escudier B., 108<br />

Esen T., 59, 93, 202<br />

Everaert K., 262<br />

F<br />

Fajkovic H., 93<br />

Farag F., 100<br />

Feitz W.F.J., 171, 317<br />

Ferreira Coelho M.X., 99<br />

Ficarra V., 415<br />

Figueiredo A.J., 104, 263, 299, 311,<br />

328<br />

Finazzi Agro E., 405<br />

Fisch M.M., 110, 369<br />

Fitzpatrick J.M., 401<br />

Fode M., 95, 233<br />

Ford L., 54<br />

Fournier G.H., 373<br />

Frede T., 96<br />

Fritsche H-M., 102<br />

Fulgham P., 161<br />

Furriel F., 93<br />

Fusco F., 107<br />

G<br />

Gaboardi F., 382<br />

Gambaro G., 102<br />

Gangi A., 57<br />

Ganzer R., 151<br />

Garmanova T.N., 94<br />

Geavlete B., 400<br />

Geavlete P.A., 99, 193, 300, 377<br />

472 <strong>Programme</strong> <strong>Book</strong><br />

Giannantoni A., 227<br />

Giessing M., 104, 198, 263<br />

Gill I.S., 168, 255<br />

Gillessen S., 397<br />

Giuliano F., 71, 403<br />

Giusti G., 96, 291, 386<br />

Godoy G., 93<br />

Goh A., 172<br />

Gomez V., 105<br />

Gomez Dos Santos V., 116<br />

Gomez Sancha F., 388<br />

Gómez Veiga F., 241<br />

Gontero P., 89, 327<br />

Gordon G., 55<br />

Gözen A.S., 381<br />

Grabe M., 69, 106, 123, 260<br />

Graefen M., 172, 254, 301<br />

Grasso M., 350<br />

Gratzke C., 243, 343, 373, 388, 410<br />

Graziottin A., 408<br />

Greco F., 196<br />

Gross A.J., 378<br />

Gruenwald I., 117<br />

Gschwend J.E., 347, 413<br />

Guazzoni G., 96, 342<br />

Guillonneau B., 380<br />

Gutierrez J., 67<br />

H<br />

Haab F., 76, 116, 410<br />

Hachi K., 70<br />

Haese A., 254, 272<br />

Hakenberg O.W., 285, 324<br />

Halaska M., 99<br />

Hamdy F.C., 55, 143, 318, 321, 416<br />

Hamid R., 100<br />

Hammerer P., 367, 412<br />

Han S.W., 57, 185<br />

Hanus T., 251<br />

Hariharan P., 59<br />

Hashim H., 143, 245, 385<br />

Hatzichristou D.G., 408<br />

Hatzimouratidis K., 132<br />

Hatzinger M., 112<br />

Heesakkers J.P.F.A., 67, 99, 299<br />

Heidenreich A., 265, 317, 402<br />

Heinz-Peer G., 259<br />

Hendricksen K., 94<br />

Herrmann T.R.W., 372, 392<br />

Hess B., 102<br />

Heynemann H., 100<br />

Hoebeke P., 111<br />

Holmberg L., 53<br />

Hong S.J., 57<br />

Hood C., 413<br />

Hosseini S.J., 61, 253<br />

Hoznek A., 96, 387<br />

Hruby S., 93<br />

Huang J., 267<br />

Hubert J., 342<br />

Hudson T., 319<br />

Hugosson J.E., 78, 318<br />

I<br />

Illic D., 54<br />

Irani J., 177<br />

Iversen P., 318<br />

J Jacqmin D., 57<br />

Janetschek G., 68, 98, 317, 329<br />

Jankevicius F., 249<br />

Jannini E.A., 107<br />

Jardin A., 84<br />

Jenster G., 287<br />

Jewett M., 168, 318<br />

Joniau S.G., 274, 322<br />

Joual A., 70<br />

Joyce A.D., 338, 377<br />

Junker K., 249<br />

Jünemann K.P., 409, 418<br />

K<br />

Kadioglu A., 107<br />

Kahlmeter G., 260<br />

Kalogeropoulos T., 382<br />

Kaouk J.H., 172, 372<br />

Karam G., 105, 179<br />

Karsenty G., 409, 418<br />

Keeley F., 102, 327, 377<br />

Kekre N., 59<br />

Kessler T.M., 100, 234<br />

Key T., 54<br />

Khauli R.B., 63<br />

Kim C., 58<br />

Kim D.K., 57<br />

Kim S.D., 174<br />

Kirby M., 77<br />

Numbers refer to page numbers


Klatte T., 293<br />

Kleinclauss F., 104<br />

Klingler H-C., 68, 276<br />

Knoll T., 96, 102, 145, 371, 387<br />

Knowles M., 85<br />

Kocjancic E., 326<br />

Kok D.J., 102<br />

Kopa Z., 82<br />

Kristiansen G., 164<br />

Kuczyk M., 168, 337, 397<br />

Kuntz R.M., 365, 407<br />

Kwon D.D., 57<br />

L<br />

Lackgren G., 76, 185<br />

Laguna M.P., 91, 97, 143<br />

Lahme S., 102<br />

Langsteger W., 167<br />

Lapini A., 97, 393<br />

Larré S., 59, 93<br />

Lebret T., 70<br />

Lepor H., 416<br />

Leung H.Y., 287<br />

Liatsikos E., 96, 151, 371, 380<br />

Liedberg F., 267<br />

Lilja H.G., 53<br />

Ljungberg B., 161<br />

Lledo García E., 104, 217<br />

Llorente C., 69, 253<br />

Loch T., 99, 161<br />

Lopez Pereira P., 261<br />

Lopez-Beltran A., 108<br />

Lopez-Tello Garcia J.J., 208<br />

Loriot Y., 70<br />

Lumen N., 111<br />

Lund L., 94<br />

M<br />

Macek P., 134, 382<br />

Machtens S., 358<br />

Madersbacher S., 221, 334<br />

Malavaud B., 97, 213, 340, 400<br />

Malmström P-U., 149<br />

Manzoni G.A., 171<br />

Marberger M., 54, 68, 94, 235, 404<br />

Martinez Bustamante L.G., 93<br />

Martov A.G., 378<br />

Martínez Piñeiro L., 299, 317, 366,<br />

412<br />

Matikainen M.P., 134<br />

Mattelaer J., 112, 311<br />

Matveev V., 215<br />

McClinton S., 206<br />

Medina López R., 264<br />

Mejean A., 398<br />

Merseburger A.S., 128, 233, 258<br />

Messas A., 300<br />

Messelink E.J., 262<br />

Meuleman E.J.H., 107<br />

Meyskens F., 54<br />

Meyyappan R., 59<br />

Michel M.S., 97, 170, 317<br />

Micic S., 271<br />

Mickisch G., 323<br />

Miller K., 323, 421<br />

Millán-Rodríguez F., 353<br />

Milsom I., 410<br />

Minasian L., 54<br />

Minervini A., 381<br />

Mirone V., 71, 94, 299, 404<br />

Monagas Arteaga S.M., 95<br />

Monastyrskaya K., 227<br />

Moncada I., 110, 408<br />

Mondaini N., 200<br />

Monnet D., 106<br />

Montironi R., 109<br />

Montorsi F., 72, 143, 172, 343, 416<br />

Morsy A., 63<br />

Mottet N., 401<br />

Mottrie A., 65, 93, 96, 172, 255, 265,<br />

299, 342<br />

Moudouni S.M., 63, 70<br />

Msessa N., 63<br />

Muir G., 389<br />

Mulders P.F.A., 130, 168, 413<br />

Müller S., 94<br />

Mundy A.R., 76, 110<br />

Muneer A., 256<br />

Muschter R., 96, 378<br />

Musquera Felip M., 179, 263<br />

N<br />

Naber K.G., 106, 414<br />

Nagele U., 379<br />

Nicolai N., 307<br />

Nijman J.M., 360<br />

Nitti V.W., 153<br />

Noon A., 239<br />

Nouira Y., 63<br />

Novara G., 295, 343, 416<br />

Nyirády P.J., 91<br />

N’Dow J.M.O., 57, 69<br />

O<br />

Oedekoven T., 95<br />

Oehlschläger S., 102, 155<br />

Oelke M., 202, 234, 411<br />

Olsburgh J.D., 263<br />

Osanto S., 337<br />

Osman Y.M., 149<br />

Osther P.J., 96, 102, 144, 299, 350,<br />

387<br />

Oudard S., 401<br />

Özen H.A., 109<br />

O’Brien T.S., 143, 177<br />

P<br />

Paez Borda A., 262<br />

Palma P., 67, 417<br />

Palminteri E., 62, 110<br />

Palou J., 67, 94, 144, 354<br />

Pansadoro V., 110, 331<br />

Park D.S., 295<br />

Parker C., 53, 55, 167, 413<br />

Parnes H., 54<br />

Parsons K.F., 94, 161, 317<br />

Patard J.J., 125<br />

Patel A., 59, 353<br />

Patel N.S., 383<br />

Peri Cusi L., 282<br />

Perner S., 53<br />

Peschers U., 76<br />

Petri E., 99<br />

Pfitzenmaier J., 97<br />

Piaserico S., 105<br />

Pickard R.S., 106, 219<br />

Piechaud P.T., 97, 146, 356<br />

Pignot G.A.N., 282<br />

Porpiglia F., 97, 276, 329, 380<br />

Porst H., 403<br />

Porta C., 397<br />

Porter J., 173<br />

Powles T., 398<br />

Pummer K., 323<br />

Pushkar D., 345, 407<br />

Numbers refer to page numbers<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

473<br />

Indices


Indices<br />

List of Speakers (not abstracts)<br />

R<br />

Rabah D., 63<br />

Rabenalt R., 113, 382<br />

Radziszewski P., 100, 233, 261<br />

Ralph D., 106, 325<br />

Ramirez Backhaus M., 237<br />

Ramon J., 289<br />

Rane A., 372<br />

Rassweiler J., 67, 72, 96, 102, 170,<br />

225, 299, 368, 417<br />

Rehder P., 234, 297<br />

Reich O., 56, 375<br />

Reinhardt S., 95<br />

Reis Santos J.M., 102<br />

Reisman Y., 117<br />

Reitz A., 153<br />

Rengifo Abbad D., 125<br />

Rennert G., 54<br />

Ribal M.J., 97, 212, 381, 415<br />

Rischmann P., 378<br />

Rittenhouse H., 53<br />

Rix G., 407<br />

Rocco B., 283<br />

Rodrigues de Lima E.A., 187<br />

Rodriguez Faba O., 104<br />

Roehrborn C.G., 312<br />

Romdam T., 71<br />

Roobol M.J., 78<br />

Rosier P.F.W.M., 99<br />

Rothwell P., 54<br />

Rouprêt M., 144, 239, 361<br />

Ruf C.G.A., 95<br />

S<br />

Sa Y.L., 56<br />

Saglam R., 97<br />

Salomon G., 100<br />

Salomon L., 263<br />

Salonia A., 256<br />

Salvioni R., 181<br />

Sanadizadeh S.M., 61<br />

Sanchez Salas R.E., 255, 301<br />

Sanchez-Carbayo M., 121, 165<br />

Sanguedolce F., 94<br />

Santer F.R., 269<br />

Sarica K., 102<br />

Scattoni V., 241, 367<br />

Schalken J.A., 53, 402<br />

Schilling D.A., 170<br />

474 <strong>Programme</strong> <strong>Book</strong><br />

Schips L., 172<br />

Schlomm T., 172<br />

Schmid H-P., 55, 194<br />

Schmitz-Dräger B.J., 55<br />

Schröder F.H., 53, 55, 59<br />

Schulman C.C., 71<br />

Schultheiss D., 84, 112<br />

Schwentner C., 380<br />

Schöffski P., 398<br />

Schön G., 173<br />

Scoffone C.M., 102, 144, 371, 392<br />

Sedelaar J.P.M., 59, 93, 358<br />

Seo S.I., 57<br />

Seong D-H., 58<br />

Serra A.L., 399<br />

Shakeri S., 61<br />

Shariat S.F., 70, 143, 247, 343, 361<br />

Shenfeld O.Z., 110<br />

Siener R., 102<br />

Sievert K-D., 97, 111, 234, 278, 392,<br />

419<br />

Silay M.S., 95<br />

Siracusano S., 100<br />

Skolarikos A., 97, 102, 144, 170, 386<br />

Smith R., 55<br />

Sochaj M., 93<br />

Soebadi D.M., 71<br />

Sofikitis N., 71, 106<br />

Solsona E., 303, 417<br />

Sonksen J.O.R., 95, 256, 317<br />

Sosnowski R., 247<br />

Speakman M.J., 234, 312, 410<br />

Spinelli M., 409, 418<br />

Sridhar F., 59<br />

Srivastava A., 59<br />

Staehler M., 399<br />

Stein R., 171<br />

Stenzl A., 53, 55, 317, 347<br />

Sternberg C.N., 402<br />

Stief C., 325, 417<br />

Stöckle M., 163<br />

Stolzenburg J-U., 96, 363, 400<br />

Straub M., 102<br />

Studer U.E., 67, 73, 347<br />

Subramaniam R., 171<br />

Sugandi S., 71<br />

Sulser T., 155<br />

Sültmann H., 164<br />

Sun Y-H., 318<br />

Sung G.T., 57<br />

Swiniarski P.P., 94<br />

Sylvester R.J., 108, 343<br />

T Tailly G.G., 378<br />

Tammela T.L.J., 318<br />

Tandogdu Z., 93, 106<br />

Tasca A., 309<br />

Tchanturaia Z., 68, 204<br />

Teber D., 379<br />

Tekgül S., 223, 360<br />

Tenke P., 106, 414<br />

Terrone C., 104<br />

Thalmann G.N., 69, 255, 305<br />

Theodorescu D., 85, 108<br />

Thomas J.A., 373<br />

Thompson A., 412<br />

Thüroff J.W., 70, 234<br />

Thüroff S.F.M., 358<br />

Tikkinen K.A.O., 161<br />

Tiselius H.G., 102, 206<br />

Tomaskin R., 405<br />

Tombal B., 54, 57, 108, 317, 397<br />

Touijer K., 363<br />

Traxer O., 56, 95, 143, 187, 350, 400<br />

Trinchieri A., 102<br />

Trombetta C., 99<br />

Tubaro A., 87, 97<br />

Tunc L., 96, 379<br />

Turgut A., 259<br />

Türkeri L.N., 95, 229<br />

U Uvelius B., 87<br />

V Vaessen C., 173<br />

Vallancien G., 63<br />

Van Cleynenbreugel B.S.E.P., 93,<br />

381<br />

Van Der Aa F.A., 369<br />

Van Der Heijden A.G., 93<br />

Van Der Kwast T., 108<br />

Van Der Poel H.G., 80, 172, 343,<br />

383, 417<br />

Van Kerrebroeck P.E., 411<br />

Van Koeveringe G., 189<br />

Van Moorselaar R.J.A., 127, 348<br />

Numbers refer to page numbers


Van Poppel H., 65, 94, 317, 324<br />

Van Renterghem K.M.L., 221<br />

Van Rhijn B., 210<br />

Van Velthoven R.F., 98, 170, 174,<br />

368<br />

Vasquez J.L., 94<br />

Vavassori I., 407<br />

Villavicencio Mavrich H., 67<br />

Villeirs G., 109<br />

Visakorpi T., 164, 269<br />

Volpe A., 59, 109, 163<br />

Vuksanovic A., 191<br />

W<br />

Wagenlehner F.M.E., 95, 106, 200,<br />

260, 414<br />

Wagg A., 76, 278<br />

Waltregny D.A.O., 243<br />

Walz J., 99, 175, 299<br />

Watson R.W.G., 280<br />

Weidner W.H.G., 82, 106, 352<br />

Wein A.J., 411<br />

Weiss J., 411<br />

Wespes E., 107, 157<br />

Wiegel T., 237, 420<br />

Wijkstra H., 100<br />

Wiklund P., 96, 163, 172, 254, 318,<br />

368<br />

Williams J.C., 102<br />

Wilt T.J., 53<br />

Wirth M., 59, 63, 75, 167, 233, 318<br />

Witjes J.A., 165, 354, 406<br />

Witt J.H., 384<br />

Wolk A., 54<br />

Woo H., 97<br />

Wood D.N., 208<br />

Wullt B., 414<br />

Wyndaele J.J., 333<br />

X Xie L-P., 56<br />

Z Zastrow S., 130<br />

Zeng G-H., 56<br />

Zhivov A., 110<br />

Zigeuner R.E., 144, 289<br />

Zlotta A.R., 307, 321<br />

Zonnenberg B., 399<br />

Numbers refer to page numbers<br />

<strong>EAU</strong> Milan <strong>2013</strong><br />

475<br />

Indices

Hooray! Your file is uploaded and ready to be published.

Saved successfully!

Ooh no, something went wrong!