View PDF Version - RePub - Erasmus Universiteit Rotterdam

More documents

Recommendations

Info

Chapter 5 140 MC2/A2 peptide MHC (pMHC) complexes were ordered from Proimmune (Oxford, UK). MA3/DP4 pMHC complexes were produced in S2-drosophila insect cells, essentially as described previously (46). We used the following mAbs: anti-CD4 (clone 13 B8.2, BD Biosciences, Erembodegem, Belgium), anti-CD8 (clone SK1, BD Biosciences) and anti-TCR-Vb2 mAbs (clone MPB 2D5, Immunotech, Marseille, France). Other reagents used were the HLA-A2 binding peptides MC2 (ALKVDVEERV) and (as a control) gp100 (YLEPGPVTA), the HLA-DP4 336-344 280-288 binding peptide MA3 (KKLLTQHFVQENYLEY) (all three from Eurogentec, Maastricht, The 243-258 Netherlands), Phytohemaglutinin (PHA) (Remel Ltd, Lenexa, KS), Phorbol 12-Myristate 13-Acetate (PMA) (Sigma-Aldrich, St. Louis, MO), GM-CSF, IL-4, TNFa (all three from PeproTech) and PGE2 (Sigma-Aldrich). MAGE-A3 protein MA3 protein was expressed by the Des insect cell expression system (Invitrogen, Breda, The Netherlands). To this end, MA3 cDNA was cloned into the pMT/BiP/V5-His vector and, together with the pCoHygro vector, introduced into S2-insect cells by nucleofection (Amaxa Biosystems, Cologne, Germany) according to the manufacturer’s guidelines. MA3 protein expression by transfected S2 cells, at a density of 3x106 /ml, was induced by Copper Sulfate (500mM). Five days after induction of protein expression, culture medium was harvested and soluble MA3 protein was purified by FPLC (Acta, GE Healthcare, Zeist, The Netherlands) using a histrap column, followed by size exclusion on a sephadex 75 column. Genes encoding TCRab specific for MC2/A2 and MA3/DP4 RNA was isolated from T cell clones EB81-CTL16 and R12-C9 and reverse transcribed with Superscript III (Invitrogen) according to the manufacturer’s instructions. The TCR-Va and Vb regions were amplified and family-typed using a set of sense primers, covering all variable segments, in combination with either a TCR-Ca or Cb antisense consensus primer. Nested PCR was performed on TCR-Va and Vb products before gel-electrophoresis. Primers specific for Cb1 or Cb2 were used to discriminate between both Cb genes. Positive PCR products were cloned, and plasmid DNAs from at least 5 independent colonies were sequenced. Specific primers were then used to amplify full length (fl) TCRa and b DNAs from CTL-derived cDNA. In some cases (i.e., MA3/DP4 TCRb) primers were also used to amplify control TCR DNAs from a spleen cDNA library. Standard primers were used to amplify the TCRa and TCRb DNAs and will be provided upon request. TCRa and b genes were cloned as wild type TCRs into two separate pBullet retroviral vectors (49) (abbreviated as pB:TCRa+b) or as codon optimized TCRs in a TCRb-2A-TCRa cassette in a single pMP71 vector (abbreviated as pMP71:optTCRb-2A- TCRa, see Supplementary text and figures). The strategy we employed to clone MAGE-specific TCRab genes and to test their surface expression and function following TCR gene transfer is depicted in Figure 1A.
Transduction of human T lymphocytes MC2/A2 and MA3/DP4 epitopes as melanoma immune targets Human T lymphocytes of healthy donors were activated with anti-CD3 mAb and transduced with retrovirus harboring either MAGE-specific or control TCRa and b transgenes. The trans- A Generation and testing of MAGE-specic T cells EB81-CTL-606C/22.2 (CTL16) Recognizing ALKVDVEERV/HLA-A2 (MC2336-344 ) Amplication with sets of TCR-Vα- or β-specic primers Amplication with dominant TCR-Vα or β-specic primer(s) DNA sequencing and characterization Cloning into retroviral vector, TCR gene transfer and MACS depletion of either CD4+ or CD8+ T cells RNA/cDNA Typing of TCR-Vαβ DNA Amplify dominant TCR-Vαβ DNA Classication of TCR-V(D)J gene usage CD4 T cell clone R12-C9 Recognizing KKLLTQHFVQENYLEY/HLA-DP4 (M3243-258 ) CD4+ and/or CD8+ T cells transduced with TCRαβ DNAs Surface expression: ow cytometry Function: cytotoxity, cytokine production, and, in case of CD4+ T cells, DC-induced proliferation and cytokine production Analysis of surface expression and function of TCRαβ transgenes B Vα2.01 Jα6.01 Cα-truncated MC2/A2 TCRVα2Cα AAGGACCAA … GCTGTGGAGGATTCTCAGGAGGAA … TTCATCCGTATATCCAGAACCCTGACCCTGCCGTGTACCAGC K D Q … A V E D S Q E E … F I R I S R T L T L P C T S MC2/A2 Vα3.01 Jα35.01 Cα TCRVα3Cα GCTCAGTCA … GCTGTGAGGTCTCCGATAGGCTTT … GTTTTACCACATATCCAG … TGGTCCAGC A Q S … A V R S P I G F … V L P H I Q … W S S MC2/A2 Vβ28.01 Jβ1- 6.01 Cβ1 TCRVβ3Cβ1 GATGTGAAA … AGCAGTTTAAATTTGGATACGAATTCACCC … ACTGTGACAGAGGACCTG … AAGGATTTC D V K … S S L N L D T N S P … T V T E D L … K D F MA3/DP4 TCRVα38Cα MA3/DP4 TCRVβ2Cβ2 Vα38.02 Jα52.01 Cα GCTCAGACA … TGTGCTTACACGGTTCCCTCTAATGCTGGT … GTCCATCCAAATATCCAG … TGGTCCAGC A Q T … C A Y T V P S N A G … V H P N I Q … W S S Vβ2.01 Dβ1.01 Jβ1- 2.01 Cβ2 GAACCTGAA … AGCAGTGAAAGGGGACAGGGTTATGGCTAC … ACCGTTGTAGAGGACCTG … TCCAGAGGC E P E … S S E R G Q G Y G Y … T V V E D L … S R G figure 1. Cloning and validation of MC2/a2 and Ma3/DP4 TCRab genes. a. Schematic representation of how TCR DNAs have been cloned, typed for TCR-V(D)J gene usage, and tested in T cells following gene transfer. B. TCR-V(D)J and C classification of the TCRa and b chains expressed by EB81-CTL16 and R12-C9 according to http://imgt.org. The arrow before the Ja6.01 indicates a frame shift preventing surface expression of this TCR-Va2 chain. Sequence data for human TCR-Va2, Va3 and Vb28 of EB81- CTL16-derived TCR genes are available from GenBank under accession nos. Eu427373, Eu427374 and Eu427375, respectively; and sequence data for human TCR-Va38 and Vb22 of R12-C9-derived TCR genes are available from GenBank under accession nos. Eu427376 and Eu427377, respectively. 141
Page 1:
Towa r d s c l i n i c a l Tc r g e
Page 4 and 5:
Studies described in this thesis we
Page 6 and 7:
PROMOTIECOMMISSIE Promotor: Prof.dr
Page 8 and 9:
6.2.3 Tumor relapse 168 6.2.3.1 Pot
Page 11 and 12:
1.1 IMMunE ThERaPy fOR ThE TREaTMEn
Page 13 and 14:
1. Isolation and activation of peri
Page 15 and 16:
General Introduction synovial carci
Page 17 and 18:
Table 3. Challenges of TCR gene the
Page 19 and 20:
General Introduction Table 4. Stren
Page 21 and 22:
1.3.2 Environmentally induced tumor
Page 23 and 24:
General Introduction adoptive T cel
Page 25 and 26:
General Introduction would require
Page 27 and 28:
General Introduction different plat
Page 29 and 30:
REfEREnCES General Introduction 1.
Page 31 and 32:
General Introduction metastatic syn
Page 33 and 34:
General Introduction 51. Schambach
Page 35 and 36:
General Introduction 80. Leach DR,
Page 37 and 38:
General Introduction 112. Umansky V
Page 39 and 40:
General Introduction 142. Hanson HL
Page 41:
General Introduction 172. Liu W, Ch
Page 44 and 45:
Chapter 2 aBSTRaCT Importance of th
Page 46 and 47:
Chapter 2 receptors, CARs) to treat
Page 48 and 49:
Chapter 2 Table 2. advantages of Ma
Page 50 and 51:
Chapter 2 within a vector is of imp
Page 52 and 53:
Chapter 2 expression and pMHC multi
Page 54 and 55:
Chapter 2 potential in eradicating
Page 56 and 57:
Chapter 2 differentiation state and
Page 58 and 59:
Chapter 2 recognize such a self-ant
Page 60 and 61:
Chapter 2 Table 3. Strategies to im
Page 62 and 63:
Chapter 2 60 3. Lymphodepletion Iso
Page 64 and 65:
Chapter 2 CC, Rudy SF, VanWaes C, D
Page 66 and 67:
Chapter 2 42. Schultz ES, Schuler-T
Page 68 and 69:
Chapter 2 73. Sadelain M, Brentjens
Page 70 and 71:
Chapter 2 105. Moroz A, Eppolito C,
Page 72 and 73:
Chapter 2 134. Willemsen RA, Sebest
Page 75 and 76:
Chapter 3 T cell receptor gene ther
Page 77 and 78:
InTRODuCTIOn TCR-engineered T cells
Page 79 and 80:
OV-CAR3 (MUC-CD) cells OC SCID Beig
Page 81 and 82:
TCR-engineered T cells in SCID and
Page 83 and 84:
AT models TCR-engineered T cells in
Page 85 and 86:
A tumor volume (mm 3 ) 800 700 600
Page 87 and 88:
Page 89 and 90:
Page 91 and 92: DISCuSSIOn TCR-engineered T cells i
Page 93 and 94: TCR-engineered T cells in SCID and
Page 95 and 96: REfEREnCES TCR-engineered T cells i
Page 103: REfEREnCES: TCR-engineered T cells
Page 106 and 107: Chapter 4 aBSTRaCT Clinical therapy
Page 108 and 109: Chapter 4 transferred and the occur
Page 110 and 111: Chapter 4 bind gp100/A2 pMHC, which
Page 112 and 113: Chapter 4 RESulTS TCR T cells preve
Page 114 and 115: Chapter 4 figure 1. Treatment with
Page 116 and 117: Chapter 4 114 day Bu 0 ….. 10 tum
Page 118 and 119: Chapter 4 116 B genomic DNA (arbitr
Page 120 and 121: Chapter 4 cells in the viable gate
Page 122 and 123: Chapter 4 that relapsed tumors func
Page 124 and 125: Chapter 4 are in line with previous
Page 126 and 127: Chapter 4 124 tumor growth Treatmen
Page 128 and 129: Chapter 4 11. Mackensen A, Meidenba
Page 130 and 131: Chapter 4 42. Zou W (2005) Immunosu
Page 132 and 133: Chapter 4 Assessment of promoter me
Page 134 and 135: Chapter 4 132 lymphocytes (number /
Page 136 and 137: Chapter 4 HLA-A2 transgenic mice be
Page 138 and 139: Chapter 5 aBSTRaCT Adoptive therapy
Page 140 and 141: Chapter 5 in up to 50% of non-small
Page 144 and 145: Chapter 5 duction procedure was des
Page 146 and 147: Chapter 5 figure 2. Primary human T
Page 148 and 149: Chapter 5 figure 4. Surface express
Page 150 and 151: Chapter 5 figure 7. Ma3/DP4 TCR CD4
Page 152 and 153: Chapter 5 extent of lysis, a typica
Page 154 and 155: Chapter 5 may provide a preclinical
Page 156 and 157: Chapter 5 12. Parkhurst MR, Yang JC
Page 158 and 159: Chapter 5 40. Carrasco J, Van Pel A
Page 160 and 161: Chapter 5 68. Kuball J, Schmitz FW,
Page 162 and 163: Chapter 5 melanoma cells; MC2 pos /
Page 164 and 165: Chapter 6 Currently, TCR gene thera
Page 166 and 167: Chapter 6 murine T cells with solub
Page 168 and 169: Chapter 6 6.2.1 Major findings of t
Page 170 and 171: Chapter 6 mouse antibody sequences
Page 172 and 173: Chapter 6 (IDO) and arginase that d
Page 174 and 175: Chapter 6 enhance T cell accumulati
Page 176 and 177: Chapter 6 MAGE surface expression l
Page 178 and 179: Chapter 6 1. Isolation and activati
Page 180 and 181: Chapter 6 REfEREnCES 1. Powell DJ,
Page 182 and 183: Chapter 6 F, Bordignon C & Bonini C
Page 184 and 185: Chapter 6 58. Spiotto MT, Rowley DA
Page 186 and 187: Chapter 6 CD8+ T cells expressing i
Page 188 and 189: Chapter 6 118. Kantarjian HM, O’B
Page 191 and 192: SuMMaRy Summary To date, adoptive T
Page 193 and 194:
Summary 20% of mice durable remissi
Page 195 and 196:
SaMEnVaTTIng Samenvatting Momenteel
Page 197 and 198:
Samenvatting experimenten laten wij
Page 199:
Curriculum Vitae List of publicatio
Page 203:
lIST Of PuBlICaTIOnS List of public
Page 206 and 207:
PhD portfolio 1.4b Poster presentat
Page 208:
Samenvatting In het bijzonder wil i
show all

View PDF Version - RePub - Erasmus Universiteit Rotterdam

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?