Barley Research at Aberdeen - American Malting Barley Association ...
Barley Research at Aberdeen - American Malting Barley Association ...
Barley Research at Aberdeen - American Malting Barley Association ...
You also want an ePaper? Increase the reach of your titles
YUMPU automatically turns print PDFs into web optimized ePapers that Google loves.
<strong>Barley</strong> <strong>Research</strong> <strong>at</strong> <strong>Aberdeen</strong><br />
Gongshe Hu<br />
USDA-ARS<br />
<strong>Aberdeen</strong>, Idaho
USDA-ARS <strong>Research</strong> Facilities <strong>at</strong> <strong>Aberdeen</strong>
Overview of <strong>Malting</strong> <strong>Barley</strong><br />
<strong>Research</strong> <strong>at</strong> <strong>Aberdeen</strong><br />
The genetic program:<br />
beta-glucan and malting quality.<br />
The breeding program:<br />
1. Scale: 10000-12000 plots/year.<br />
2. <strong>Malting</strong> barley vs. food barley:<br />
80% to 20%<br />
3. 2-row vs. 6-row:<br />
80% to 20%<br />
4. Spring vs. winter:<br />
60% to 40%
Grangeville<br />
Filer<br />
<strong>Barley</strong> Breeding Nurseries<br />
Ashton- 1598m<br />
Tetonia-1764m<br />
Idaho Falls-1380m<br />
<strong>Aberdeen</strong>- 1338m<br />
Soda Springs-1764m<br />
Filer-1064m<br />
grangeville-973m<br />
Ashton<br />
Idaho Falls<br />
Tetonia<br />
<strong>Aberdeen</strong><br />
Soda Springs
Objectives of <strong>Barley</strong> <strong>Research</strong> <strong>at</strong><br />
<strong>Aberdeen</strong><br />
Genetic <strong>Research</strong>:<br />
To Identify genetic m<strong>at</strong>erials and DNA<br />
markers with for better qualities of<br />
barley improvements.<br />
Breeding program:<br />
To develop the best cultivars of winter<br />
and spring barley:<br />
Good quality<br />
high yield.
Identific<strong>at</strong>ion and characteriz<strong>at</strong>ion of<br />
<strong>Barley</strong> Low BG mutant<br />
Mutant of M351 derived from<br />
chemical mutagenized<br />
Harrington cultivar<br />
Genotype BG (%)<br />
M351 1.5%<br />
Harrington 5.1<br />
A<br />
B<br />
Wild-type M351<br />
Wild-type M351
Table 1. Grain chemical compositions of<br />
M351 mutant and the corresponding wildtype<br />
plants<br />
Components Wild-type M351 P value<br />
Moisture % 8.4 8.4 0.3534<br />
Protein % 18.3 17.4 0.2931<br />
Starch % 61.1 62.0 0.6860<br />
Oil % 2.3 2.4 0.1218<br />
MLG % 5.1 1.5
Table 2. Physical characteristics of M351 and<br />
the wild-type grains from 2009.<br />
M<strong>at</strong>erial 100 Kernel<br />
hardness index<br />
(HI)<br />
100 Kernel<br />
weight(g)<br />
Grain broken<br />
r<strong>at</strong>e in<br />
threshing<br />
Wild-type 61.20 65.80 4.8 4.5 0.5% 0.6%<br />
M351<br />
mutant<br />
44.80 52.30 4.7 5.1 2.4% 2.6%
Pilot scale malting test (Malteurop North America, Inc)<br />
Crop Year 2011<br />
Variety 2011 METCALF 2011 MERIT M351<br />
Test weight 37.98 36.80 36.64<br />
On 7 81.4 82.6 71.8<br />
On 6 15.6 15.6 26.4<br />
On 5 3.0 1.8 1.8<br />
Thru 0.0 0.0 0.0<br />
FG dry 83.1 83.8 82.8<br />
CG dry 83.1 83.7 82.0<br />
Wort pH 5.83 5.83 5.67<br />
Viscosity 1.41 1.43 1.39<br />
DP 155 147 129<br />
Alpha-amylase 62.2 60.1 61.5<br />
Total proteindb 10.6 9.8 11.1<br />
Soluble protein 5.75 5.58 5.39<br />
S / T 54.2 56.9 48.6<br />
Beta-glucan 61 80 69<br />
FAN 235 232 205
M351 and Its Near isogenic wildtype<br />
lines in malting and ferment<strong>at</strong>ion<br />
Genotype Grain beta-glucan Beta-glucan in Wort(ppm)<br />
M351 1.5% 69<br />
Wildtype 5.1% 251<br />
Conclusions from the Bio-ethanol ferment<strong>at</strong>ion<br />
Experiment (N<strong>at</strong>ional Corn-to-Ethanol <strong>Research</strong> Center) :<br />
The mash of the wild type barley had a much higher<br />
viscosity than the mutant.<br />
After liquefaction, the wild-type was the thickest and<br />
visually different than the mutant.
DNA markers available to track<br />
7H<br />
Bmag564<br />
M351/CslF6<br />
Bmag369<br />
the mutant gene in M351<br />
DArT marker<br />
bPb-8051<br />
bPb-1039<br />
bPb-8117<br />
bPb-1050<br />
bPb-2920<br />
bPb-5599<br />
bPb-4692<br />
bPb-4623<br />
bPb-9753<br />
bPb-8956<br />
bPb-2097<br />
bPb-1770<br />
bPb-2379<br />
bPb-7437<br />
bPb-7603<br />
bPb-2188<br />
bPb-1476<br />
cDNA<br />
AA<br />
cDNA<br />
AA<br />
32-52<br />
105-125<br />
134-154<br />
2566 2586<br />
ATC GGA TCC GCC GTG GCC TTC<br />
I G S A V A F<br />
ATC GGA TCC ACC GTG GCC TTC<br />
I G S T V A F<br />
Wildtype<br />
M351<br />
1 947<br />
N C<br />
Cellulose Synthase domain<br />
118 919<br />
710-730<br />
742-760<br />
779-799<br />
833-853<br />
859-881<br />
896-916<br />
849A-T in M351
Using a SNP functional marker<br />
of M351 to track the allele<br />
M351F1<br />
M351F1 CTTCGCCAAGGTTCTCGAC<br />
M351R1 AGGGGTAGAGGTGGAAGAGC<br />
G/A<br />
M351R1
QTL mapping for the malting quality<br />
traits<br />
Popul<strong>at</strong>ion of 01Ab8219 x Stellar: 6-row. F5:7<br />
families: 175<br />
Years: 2009, 2010<br />
Loc<strong>at</strong>ions: Tetonia, <strong>Aberdeen</strong><br />
Kernel on <strong>Barley</strong> Malt Wort Wort <strong>Barley</strong> Wort S/T DP Alpha‐ Beta‐ FAN<br />
Weight 6/64 Color Extract Color Clarity Protein Protein (%) (°ASBC) amylase glucan (ppm)<br />
(mg) (%) (Agtron) (%)<br />
(%) (%)<br />
(20°DU) (ppm)<br />
38.7 94.8 71.1 82.9 2.3 1.0 10.4 5.2 52.1 120.5 97.1 151.9 207.3<br />
37.9 98.2 77.9 80.4 2.2 1.3 11.8 5.0 44.8 151.7 71.1 103.3 192.4<br />
Yellow colored values=01Ab8219; White colored values = Stellar
QTLs FOR <strong>Malting</strong> Quality Traits<br />
Protein, Wort Protein, and<br />
FAM AB<br />
0.0<br />
6.8<br />
8.3<br />
11.0<br />
11.7<br />
28.0<br />
31.0<br />
60.3<br />
65.3<br />
79.4<br />
81.3<br />
85.5<br />
86.2<br />
87.4<br />
90.9<br />
91.3<br />
92.1<br />
1H<br />
2572-986 5555-438<br />
B_9552-1H B_6065-1H<br />
ABC00875-1-3-43<br />
4393-1078<br />
677-411 4978-1030<br />
10360-563<br />
4625-1413<br />
4005-530<br />
B_7949-1H B_8983-1H<br />
B-5584-1H B_9611-1H<br />
B_1922-1H B_5292-1H<br />
409-1643 2314-1412<br />
2151-1310 6238-243<br />
B_2087-1H/5H B_8662-1H<br />
B_1586-1H B_5672-1H<br />
B_1535-1H B_1398-1H<br />
596-1035<br />
3751-1136<br />
1906-429<br />
4226-570<br />
B_0851-1H B_0760-1H<br />
B_9288-1H B_0301-1H<br />
B_9415-1H<br />
0.0<br />
1.5<br />
1.9<br />
3.4<br />
3.7<br />
6.1<br />
7.6<br />
9.1<br />
10.6<br />
25.0<br />
25.7<br />
28.7<br />
0.0<br />
17.9<br />
22.5<br />
22.9<br />
25.2<br />
2H<br />
~100<br />
cM<br />
B_4293<br />
B_7557-2H B_5519-2H<br />
B_7024-2H B_4704-2H<br />
B_0615-2H B_5688-2H<br />
3453-1974 B_7445<br />
B_3186-2H<br />
B_8399-2H<br />
12224-363 B_6128-2H<br />
12100-378<br />
791-1113<br />
8787-1459<br />
7747-1056 B_5326<br />
B_4877-2H<br />
864-594<br />
1283-332<br />
B_3023<br />
1486-908 ConsensusGBS037<br />
ABC01791-1-1-11<br />
9291-1322 3271-1422<br />
9701-925 3108-232<br />
8817-798<br />
B_9458-2H<br />
Alpha<br />
Amylase TE<br />
Kernel wt.<br />
AB/TE<br />
0.0<br />
4.9<br />
5.3<br />
0.0<br />
4.4<br />
14.7<br />
18.4<br />
21.6<br />
0.0<br />
5.3<br />
8.1<br />
8.8<br />
10.0<br />
17.3<br />
30.9<br />
32.4<br />
36.7<br />
37.1<br />
38.6<br />
42.4<br />
45.1<br />
46.6<br />
54.7<br />
3H<br />
~140<br />
cM<br />
4H<br />
B_2018<br />
B_4022-3H<br />
B_4472-3H B_3179-3H<br />
B_5555-3H<br />
B_5568<br />
10982-896<br />
B_6631-3H ConsensusGBS003<br />
13750-348<br />
B_3899-3H B_8030<br />
7772-223<br />
4270-184<br />
5692-310<br />
6519-812<br />
3652-872 41-695<br />
3282-555 299-163<br />
1241-1649 B_1509<br />
7550-562 4919-1051<br />
2574-410<br />
4133-601 4986-1214<br />
B_7719-4H B_3739-4H<br />
B_6096-4H<br />
B_8701-4H<br />
3704-1947<br />
8653-475 9149-1316<br />
3416-692<br />
424-423<br />
5273-894 ABC09662-1-3-35<br />
4139-888<br />
B_6145 bPt-6067-4H<br />
B_8896-4H
Kernel<br />
wt. TE<br />
Malt ext.<br />
AB/TE<br />
DP<br />
TE<br />
Protein AB, S/T<br />
AB, FAN AB, AA<br />
0.0<br />
0.7<br />
4.3<br />
5.8<br />
8.1<br />
10.8<br />
19.4<br />
24.3<br />
26.9<br />
28.1<br />
28.8<br />
29.9<br />
30.7<br />
Protein<br />
AB/TE<br />
TE<br />
31.8<br />
33.0<br />
36.2<br />
38.1<br />
40.0<br />
47.4<br />
53.1<br />
55.0<br />
61.5<br />
0.0<br />
11.0<br />
16.9<br />
5H<br />
~70c<br />
M<br />
ABC14689-1-9-39<br />
3056-1317<br />
2947-1245<br />
5440-455 11944-542<br />
3685-894<br />
6833-658<br />
ABC06144-pHv86-<br />
11931-389<br />
264-571 ABC10441-1-4-20<br />
65-778 4234-1944<br />
7839-633<br />
2906-1177<br />
ABC11529-1-1-29<br />
ABC07010-1-2-15 1910-1343<br />
1732-491 3218-1094<br />
1215-862 8852-318<br />
5565-1908 8201-86<br />
8631-469 4166-1090<br />
4930-1604 9766-787<br />
152-329 1286-990<br />
5850-2347 ABC10705-1-1-26<br />
7276-942 3012-1125<br />
4517-217<br />
7681-229<br />
5732-1104 9100-978<br />
4977-567<br />
421-528<br />
3997-796<br />
B_6183-5H<br />
6184-200<br />
4753-1091<br />
ABC17471-1-3-78<br />
B_9896-6H 552-188<br />
585-342<br />
ConsensusGBS039<br />
B_2006-5H B_1420-5H<br />
B_9733 B_4318-5H<br />
B_4970-5H<br />
Malt ext.,<br />
Protein, w_<br />
protein, and<br />
Protein<br />
AB/TE<br />
FAN AB/TE<br />
DP AB/TE<br />
0.0<br />
3.9<br />
6.2<br />
9.6<br />
11.5<br />
12.7<br />
14.6<br />
16.5<br />
17.2<br />
18.3<br />
19.1<br />
20.2<br />
21.7<br />
22.7<br />
23.5<br />
25.4<br />
26.2<br />
28.1<br />
29.1<br />
47.7<br />
50.7<br />
51.8<br />
54.1<br />
55.2<br />
55.9<br />
59.9<br />
61.9<br />
64.7<br />
67.9<br />
72.3<br />
0.0<br />
1.2<br />
1.9<br />
6H<br />
~65c<br />
M<br />
5684-601 8504-785<br />
578-587<br />
4641-266 2968-1066<br />
ABC06682-1-1-31<br />
9251-852 1899-739<br />
2607-2929 ABC10265-sfp25-<br />
3147-440 2294-573<br />
5656-1012<br />
ABC14687-1-4-34 3436-354<br />
ABC13717-1-1-32<br />
4235-1617 1565-514<br />
2026-302 3348-395<br />
ConsensusGBS036 8048-952<br />
8220-1223 4313-482<br />
11016-603<br />
1490-959<br />
4721-1335<br />
ABC04676-1-1-59 4258-1498<br />
3378-619 ABC08769-1-1-20<br />
4070-386 ABC04725-1-1-25<br />
B_6023-6H<br />
B_0922<br />
B_0481-6H B_9841-6H<br />
B_6990-6H B_3141-6H<br />
5448-298<br />
B_9807-6H<br />
B_2058-6H<br />
B_8170<br />
B_5211<br />
2188-425 1628-410<br />
B_9749-6H B_8278<br />
B_9840<br />
B_6669 B_7467-6H<br />
B_9651-6H<br />
B_0572-6H B_4778-6H<br />
B_5498-6H B_3433-6H<br />
5993-2383<br />
4547-1677<br />
B_3070 B_0403-6H<br />
B_2137-6H B_2304-6H<br />
B_1621-6H B_7146-6H<br />
5074-1135<br />
B_2863-6H<br />
FAN<br />
AB<br />
Protein<br />
AB/TE<br />
0.0<br />
0.8<br />
1.1<br />
1.9<br />
2.6<br />
5.3<br />
23.2<br />
24.0<br />
52.2<br />
55.0<br />
60.4<br />
64.8<br />
65.9<br />
67.0<br />
68.6<br />
73.0<br />
78.3<br />
113.9<br />
115.1<br />
115.8<br />
119.1<br />
123.8<br />
124.6<br />
125.3<br />
126.9<br />
127.6<br />
128.7<br />
129.5<br />
133.9<br />
139.9<br />
7H<br />
B_5935-7H<br />
B_6054 B_2595-7H<br />
B_7769-7H<br />
B_8043-7H B_7863-7H<br />
6394-944<br />
4503-246<br />
4275-1288<br />
1511-545<br />
B_8939-7H B_0678-7H<br />
B_2533-7H B_5074-7H<br />
B_5732 B_5852-7H<br />
B_8140 B_6156-7H<br />
B_3589-7H B_8568-7H<br />
ABC04803-1-1-39<br />
B_8051-7H B_9457-7H<br />
7712-674 5138-265<br />
6290-574<br />
9347-437 2462-971<br />
4589-131 11619-618<br />
3140-491<br />
B_4441-7H B_7517-7H<br />
B_7583 B_3703-7H<br />
B_1591-7H<br />
977-1377<br />
B_6301<br />
B_4856-7H<br />
B_3419-7H B_0182-7H<br />
B_8867-2H|7H<br />
7397-854<br />
7216-297<br />
6628-1302<br />
13008-352<br />
B_8778-7H B_2328-7H<br />
B_6166-7H B_5923-7H<br />
B_0917-7H B_1645<br />
B_0889-7H<br />
4991-1028<br />
8758-564<br />
7180-778
Cultivars Released recently in<br />
the Breeding Program<br />
Winter barley malt cultivars:<br />
Charles (2006).<br />
Endeavor (2009)<br />
Both cultivars have been planted in Idaho for<br />
more than 10000 Acres<br />
Spring malt Cultivars:<br />
Sublette (2006)<br />
Spring food barley cultivars:<br />
Tetonia (2009)<br />
Julie (2012)
Charles Winter barley Cultivar<br />
Cultivar Grain yield<br />
Bu/Acre<br />
Extract<br />
Charles (2-row) 161 81.3<br />
Eight-Twelve (Feed) 178<br />
88AB536-B (6-row) 147 68.9
Endeavor Winter <strong>Barley</strong> Cultivar<br />
Cultivar Grain Yield (Bu/A<br />
irrig<strong>at</strong>ed)<br />
Height<br />
(cm)<br />
BG<br />
(g/Kg)<br />
DP<br />
Endeavor 145.8 90.5 170 137*<br />
Charles 145.0 81.5 193 119<br />
88AB536-B 134.0 97.3<br />
Endeavor has better winter hardiness than Charles
Sublette Spring <strong>Malting</strong><br />
Cultivar Grain Yield<br />
(Bu/A. In 40 yearloc<strong>at</strong>ions)<br />
Cultivar<br />
% Plump<br />
Kernel<br />
AA BG<br />
(ppm)<br />
Sublette 121.9 95 62 255 144<br />
Harrington 117.3 85 68 407 108<br />
Merit 124.7 88 52 201 159<br />
DP
Elite Lines of 2-row winter <strong>Barley</strong><br />
Year/ Mean Yield Yield<br />
Name<br />
loc<strong>at</strong>ions (Bu/A) mean% Extract% DP AA<br />
Endeavor 27 129.6 99.3 78.5 125.5 101.2<br />
Charles 24 135.0 100.0 79.6 132.9 93.7<br />
Maja 14 145.6 99.8 78.4 124.9 43.9<br />
02Ab339 22 144.7 110.5 80.4 131.0 97.6<br />
02Ab431 22 145.7 109.1 80.9 141.2 86.8<br />
02Ab170 22 140.8 107.3 79.9 106.3 100.2<br />
02Ab597 20 147.2 111.0 80.9 103.9 78.2<br />
02Ab948 22 137.7 104.9 80.2 119.2 90.1<br />
02Ab641 17 135.4 109.6 81.5 107.2 94.8<br />
02Ab669 24 147.8 109.5 81.7 111.0 104.7<br />
02Ab348 22 140.8 107.2 81.2 92.9 97.1<br />
02Ab671 22 142.3 108.4 80.8 94.4 96.2<br />
02Ab712 22 142.2 108.4 81.4 116.8 104.3<br />
02Ab710 22 139.1 106.0 81.4 126.5 53.3<br />
4Ab08-X03W044-11 7 163.0 116.9 76.8 104.7 82.4<br />
4Ab08-X03W044-9 7 143.9 103.2 78.8 98.7 96.1
Winter Hardiness Screening in Soda Spring<br />
Line <strong>Barley</strong> Type %Spring Stand<br />
02Ab170 2-M 85/100/90<br />
4Ab08-X03W044-11 6-M 95/100/100<br />
02Ab645 2-M 100/95/40<br />
02Ab339 2-M 100/95/60<br />
02Ab710 2-M 100/70/85<br />
4Ab08-X03W044-9 6-M 100/98/95<br />
2Ab09-X05W048-100HL 2-Food 100/95/90<br />
2Ab09-X05W048-85 2-Food 100/85/95<br />
2Ab09-X05W048-318HL 2-Food 100/70/80<br />
2Ab09-X05W049HL-15 2-Food 100/95/90<br />
Schuyler 6-F 100/100/100<br />
Charles 2-M 80/80/75<br />
Endeavor 2-M 95/95/90<br />
8-12 6-F 95/95/90<br />
Finess 2-F 100/85/85<br />
SunStar pride 6-F 100/98/95<br />
Lewjain (WW) Winter whe<strong>at</strong> 98/98/95
Winter hardiness of the lines in pilot<br />
test (Soda Spring)<br />
Genotype Yield (2011-2012 Spring Stand%<br />
dryland) (Soda Spring)<br />
02Ab431 71 85/80/60<br />
02Ab671 72 100/85/100<br />
02Ab669 75 95/80/85<br />
Charles 76 80/80/75<br />
Endeavor 80 95/90/95
<strong>Malting</strong> barley lines in the UI extension<br />
Winter Nursery (<strong>Aberdeen</strong> and Rupert)<br />
Cultivar Type Average Yield Spring Stand<br />
(Bu/A) (% AB/Rupert)<br />
Alba 6-M 180 98/95<br />
93Ab669 6-M 178 98/88<br />
02Ab431 2-M 163 97/95<br />
OR92 6-M 171 97/98<br />
OR91 6-M 172 99/94<br />
02Ab671 2-M 148 96/90<br />
Maja 6-M 154 97/98<br />
Charles 2-M 149 98/95<br />
Endeavor 2-M 162 96/98<br />
OR818 6-M 145 95/99<br />
M<strong>at</strong>hias 6-M 128 98/98
Winter Hardiness Screening<br />
in 2012-2013<br />
To repe<strong>at</strong> the screening process on<br />
our elite m<strong>at</strong>erials.<br />
To expand to some m<strong>at</strong>erials from<br />
germplasm collections.<br />
To look for an additional nursery<br />
loc<strong>at</strong>ion in Idaho Falls area.
Elite Spring barley Lines<br />
02Ab17271 (Spring 2-row):<br />
Under plant scale Evalu<strong>at</strong>ion.<br />
02Ab04-X01084-27 (Spring 2row):<br />
Passed the 2nd year of pilot<br />
scale evalu<strong>at</strong>ion<br />
01AB9663 (Spring 6-row): Passed<br />
the 2nd year of pilot test.
Yield Potential of the Spring Elite<br />
Variety or Selection<br />
lines<br />
Yield<br />
(% of control)<br />
(Yr/loc<strong>at</strong>ion)<br />
Kernel<br />
Weight<br />
(mg)<br />
on<br />
6/64"<br />
(%)<br />
Malt<br />
Extract<br />
(%)<br />
2Ab04-X01084-27 108.8 (39) 43.2 98.4 82.5<br />
02Ab17271 105.7 (52) 44.8 97.2 83.5<br />
CDC Copeland 100.5 (10) 46.0 99.2 82.4<br />
M69 99.6 (30) 42.4 96.7 81.7<br />
HARRINGTON 100.0 (52) 39.3 96.4 82.6<br />
6-row<br />
01Ab9663 122.5 (44) 39.9 98.1 82.7<br />
Tradition 118.3 (46) 37.3 98.5 80.3<br />
Morex 100.0 (44) 37.3 97.9 83.0
Summary for the <strong>Aberdeen</strong><br />
<strong>Barley</strong> Program<br />
Genetic research provided good<br />
m<strong>at</strong>erials and markers for better barley<br />
cultivar development.<br />
Breeding program developed barley<br />
cultivars used in production.<br />
Winter malting lines with better winter<br />
hardiness and yield potential<br />
developed and are under pilot scale<br />
tests.
Future studies<br />
Look for molecular marker-assistant<br />
selection in special traits.<br />
Focus on 2-row malting barley for better<br />
malting quality and high yield.<br />
Enhance the winter malting barley<br />
cultivars: focusing on better winter<br />
hardiness and malting quality.<br />
Look for new technologies for speed up<br />
the winter cultivar development such as<br />
DH.
AMBA<br />
Acknowledgements<br />
Idaho <strong>Barley</strong> Commission<br />
Collabor<strong>at</strong>ors:<br />
BARI, Eric Jackson, Emir Islamovic, P<strong>at</strong> Hayes,<br />
Juliet Marshal, USDA-ARS, Madison, WI.<br />
Cooper<strong>at</strong>or Growers:<br />
Dave Bodine, Evan Hayes, Clark Kauffman,<br />
Craig Ozburn, Sid Cellan<br />
Genetics/Breeding program<br />
Gongshe Hu<br />
Chris Evans<br />
K<strong>at</strong>hy S<strong>at</strong>terfield<br />
Sherry Ellberg<br />
N<strong>at</strong>alie Klassen
Change language