2014.03.31.GenomeAccess.Sequencing and Assembly

Recommendations

Info

Goal of WGA • For two genomes, A <strong>and</strong> B, find a mapping from each position in A to its corresponding position in B CCGGTAGGCTATTAAACGGGGTGAGGAGCGTTGGCATAGCA CCGGTAGGCTATTAAACGGGGTGAGGAGCGTTGGCATAGCA
Not so fast... • Genome A may have insertions, deletions, translocations, inversions, duplications or SNPs with respect to B (sometimes all of the above) CCGGTAGGATATTAAACGGGGTGAGGAGCGTTGGCATAGCA CCGCTAGGCTATTAAAACCCCGGAGGAG....GGCTGAGCA
Page 1 and 2: Genome Sequencing & Assembly Michae
Page 3 and 4: Outline 1. Assembly theory 1. Assem
Page 5 and 6: It was the best of age of wisdom, i
Page 7 and 8: It was the best de Bruijn Graph Ass
Page 9 and 10: The full tale … it was the best o
Page 11 and 12: Assembly Complexity A R B R C
Page 13 and 14: • Novel genomes Assembly Applicat
Page 15 and 16: Why are genomes hard to assemble? 1
Page 17 and 18: Illumina Sequencing by Synthesis 1.
Page 19 and 20: Balls in Bins 1x
Page 21 and 22: Balls in Bins 4x
Page 23 and 24: Coverage and Read Length Idealized
Page 25 and 26: Errors in the graph Clip Tips Pop B
Page 27 and 28: Repeats and Coverage A-stat Statist
Page 29 and 30: Scaffolding • Initial contigs (ak
Page 31 and 32: Break
Page 33: Whole Genome Alignment with MUMmer
Page 37 and 38: B Translocation Inversion Insertion
Page 39 and 40: Seed-and-extend with MUMmer How can
Page 42 and 43: Outline 1. Assembly theory 1. Assem
Page 44 and 45: How ALLPATHS-LG works reads correct
Page 46 and 47: Error correction Given a crystal ba
Page 48 and 49: Read doubling To close a read pair
Page 50 and 51: Localization I. Find ‘seed’ uni
Page 52 and 53: Large genome recipe: ALLPATHS-LG vs
Page 54 and 55: Genome assembly with the Celera Ass
Page 56 and 57: Hybrid Sequencing Illumina Sequenci
Page 58 and 59: SMRT Sequencing Data TTGTAAGCAGTTGA
Page 60 and 61: PacBio Assembly Algorithms PBJelly
Page 62 and 63: S. cerevisiae W303 S288C Reference
Page 64 and 65: A. thaliana Ler-0 http://blog.pacif
Page 66 and 67: A. thaliana Ler-0 http://blog.pacif
Page 68 and 69: O. sativa pv Indica (IR64) Genome s
Page 70 and 71: Assembly Complexity of Long Reads S
Page 72 and 73: Assembly Complexity of Long Reads S
Page 74 and 75: Assembly Summary Assembly quality d
Page 76: Thank You! http://schatzlab.cshl.ed

2014.03.31.GenomeAccess.Sequencing and Assembly

Create successful ePaper yourself

Delete template?

Save as template?