Evolution (Incest and Bestiality)

More documents

Recommendations

Info

10/9/12… in your environment• “Better” or “fitter” is subjective– context dependentgreen = malarial region;red stripes = high frequency of sickle-cell anaemiaKey ideas:1. Gradual evolution results from small genetic changes that areacted upon by natural selection2. The origin of species (macroevolution) can be explained interms of natural selection acting on individuals(microevolution)22
10/9/12Genes are the key to evolution• Genes are both the material of evolution, and the markersof evolution• [material] They are the heritable characters that change andresult in evolutionary changes• [markers] They are also our major source of information forunderstanding the process of evolution• Mutations occur in DNA sequences giving rise to variation= source of heritable variation• Without mutation there is no evolution23
Page 1 and 2: 10/9/12Evolution(Incest and Bestial
Page 3 and 4: 10/9/12What is Life?What is Life?3
Page 5 and 6: 10/9/125
Page 7 and 8: 10/9/12ATTAGCTACGCGTAGCATCG7
Page 9 and 10: 10/9/129
Page 11 and 12: 10/9/1211
Page 13 and 14: 10/9/12AmphioxusPhylum Chordata(but
Page 15 and 16: 10/9/12• Highly conserved protein
Page 17 and 18: 10/9/12Heredity• In Darwin’s ti
Page 19 and 20: 10/9/1219
Page 21: 10/9/12• DNA mutationsHeritable v

Evolution (Incest and Bestiality)

Create successful ePaper yourself

Delete template?

Save as template?