Units 3 and 4 Biology - Practice Exam - Engage Education Foundation

More documents

Recommendations

Info

Units 3 and 4 BiologyThe Engage Education Foundationb. What happens to the gene pool of a population following a bottleneck effect? Why?c. How does a bottleneck effect render a population more susceptible to future decline in numbersand gene pool?2 marks1 markTotal: 5 marksPage 296.5 hour revision seminars for just $56 – visit www.ee.org.au for more info.
The Engage Education FoundationUnits 3 and 4 BiologyQuestion 9a. Re-write the following DNA sequence, adding in a frameshift mutation by mutation at, or adjacentto, the seventh base:3’ ATTCGATTGCCCATCTCGAAG 5’b. Explain, briefly, the events that occur during transcription.1 mark3 marksc. If a frameshift mutation has occurred, what consequence does this have on the polypeptide that thegene was coding for?d. What is meant by the statement ‘the genetic code is degenerate’?2 marks1 markTotal: 7 markswww.engageeducation.org.au Page 30
Page 1 and 2: ΩEngageEducationFoundationUnits 3
Page 3 and 4: The Engage Education FoundationUnit
Page 29: The Engage Education FoundationUnit
Page 33: The Engage Education FoundationUnit

Units 3 and 4 Biology - Practice Exam - Engage Education Foundation

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?