Epidemiology and Management of Hop Pests and Diseases

Epidemiology andManagement of Hop Pestsand DiseasesDavid H. GentForage Seed and Cereal Research UnitUSDA-ARSCorvallis, Oregon

Acknowledgement of Collaborators• Collaborators– OSU: Cindy Ocamb, Glenn Fisher/Amy Dreves,Vaughn Walton– WSU: Ken Eastwell, Gary Grove/Mark Nelson,David James, Steve Kenny– UI: Jim Barbour– ARS: John Henning/Shaun Townsend– University of Tasmania: Sarah Pethybridge,Frank Hay– Sustainability Victoria: Trish McGee

Compendium of HopDiseases, ArthropodPests, and Disorders•Publishing 2008 or early2009•Updated, comprehensive,authoritative, and modernaccount of known hopdiseases and arthropodpests•Contributions from all HopResearch CouncilsupportedIPMresearchersEdited byW. F. MahaffeeS. J. Pethybridge andD. H. Gent•Assist in diagnosis of pestproblems in field lab, andclinic, and provide IPMrecommendations•Over 150 color images

Financial Support• Busch Agricultural Resources Inc.• Hop Products Australia, Hobart Tasmania, Australia• John I. Haas, Inc.• Miller Brewing Co.• Oregon Hop Commission• Roy Farm, Inc.• Sierra Nevada Brewing Co.• S.S. Steiner Inc.• University of Tasmania• U.S.Department of Agriculture, Ag. Research Service• U.S. Hop Industry Plant Protection Committee• Washington Hop Commission

Overall Project Objective• Integrate and develop coordinatedproduction strategies that reduceproduction input costs and crop lossesfrom powdery and downy mildew by atleast 30%

2007 Objectives and Progress1. Quantify environmental conditions and productionpractices that favor or limit downy mildew andpowdery mildew epidemics:• Long term project in progress2. Characterize metalaxyl insensitivity in P. humuli:• Completed 20073. Develop molecular detection methods P. humuli:• Laboratory validation and years 1 and 2 of field studiescompleted; field studies to be completed 2008.• Phylogenetic studies underway with Pseudoperonospora spp.4. Identify fungicide programs that maximizeconservation biocontrol of arthropod pests:• Year 1 study completed; Current study to be completed 2009.Washington and Idaho data by D. James and J. Barbour.

• Johnson (1991) GDD predictsemergence of basal spikes at 111.3GDD C from 1 Feb.

Predicted Primary Spike Emergence by GrowingDegree-Day Model, Corvallis, OR 200530025014 March: Nugget15 March: Glacier18 March: GlacierGDD (6.5C base)2001501001201141115001-Feb 15-Feb 1-Mar 15-Mar 29-Mar 12-Apr 26-Apr

160Accumulated GDD, 2006140120GDD (base 6.5C)100806080105100402024 March: 2 Willamette yards28 March: 1 Nugget31 March: 5 Nugget & Will.01-Feb 13-Feb 25-Feb 9-Mar 21-Mar 2-Apr 14-AprDate

Accumulated GDD, 2007250200GDD (base 6.5C)1501001031351061575001-Feb 15-Feb 1-Mar 15-Mar 29-Mar 12-AprDate

Downy Mildew Severity AmongBasal spik es per hi605040302010Model-aided TreatmentsWaterStandardModelCu ModelAl Model03-Mar 24-Mar 14-Apr 5-May 26-May 16-Jun 7-Jul 28-Jul 18-Aug 8-SepDate

Air Sampling forDowny Mildew•Benefits:– Another piece ofscouting informationwhen considering aspray– Use to time start ofspray program– Help guide timing oflate season sprays

hopcucurbitPCR Detection of Downy Mildew460 470 480 490 500 510 520 530 540....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|TGTCTTGCGGCTAATTTTAGAATTGACTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGTGTGGCGTTGCTGGTGTCTTGCGGCTAATTTTCGAATTGACTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGTGTGGCGTTGCTGGTGTCTTGCGGCTAATTTTAGAATTGACTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGTGTGGCGTTGCTGGTGTCTTGCGGCTGATTTTCGAATTGACTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGTGTGGCGTTGCTGGTGTCTTGCGGCTAATTTTAGAATTGACTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGTGTGGCGTTGCTGGTGTCTTGCGGCTAATTTTAGAATTGACTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGTGTGGCGTTGCTGGTGTCTTGCGGCTAATTTTAGAATTGACTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGTGTGGCGTTGCTGGTGTCTTGCGGCTAATTTTAGAATTGACTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGTGTGGCGTTGCTGGTGTCTTGCGGCTAATTTTAGAATTGACTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGTGTGGCGTTGCTGGTGTCTTGCGGCTAATTTTAGAATTGACTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGTGNGGCGTTGCTGGTGTCTTGCGGNTAATTTTAGAATTGACTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGTGTGGCGTTGCTGGTGTCTTGCGGCTAATTTTAGAATTGACTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGTGTGGCGTTGCTGGTGTCTTGCGGCTAATTTTAGAATTGACTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGTGTGGCGTTGCTGGTGTCTTGCGGCTAATTTTCGAATTGACTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGTGTGGCGTTGCTGGTGTCTTGCGGCTAATTTTCGAATTGACTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGTGTGGCGTTGCTGGTGTCTTGCGGCTAATTTTCGAATTGACTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGTGTGGCGTTGCTGGTGTCTTGCGGCTAATTTTCGAATTGACTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGTGTGGCGTTGCTGGTGTCTTGCGGCTAATTTTCGAATTGACTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGTGTGGCGTTGCTGGTGTCTTGCGGCTAATTTTCGAATTGACTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGTGTGGCGTTGCTGGTGTCTTGCGGCTAATTTTCGAATTGACTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGTGTGGCGTTGCTGGTGTCTTGCGGCTAATTTTCGAATTGACTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGTGTGGCGTTGCTGGTGTCTTGCGGCTAATTTTCGAATTGACTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGTGTGGCGTTGCTGGTGTCTTGCGGCTAATTTTCGAATTGACTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGTGTGGCGTTGCTGGTGTCTTGCGGCTAATTTTCGAATTGACTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGTGTGGCGTTGCTGGTGTCTTGCGGCTAATTTTCGAATTGACTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGTGTGGCGTTGCTGGTGTCTTGCGGCTAATTTTCGAATTGACTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGTGTGGCGTTGCTGGTGTCTTGCGGCTAATTTTCGAATTGGCTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCAAAAAGCGTGGCGTTGCTGGTGTCTTGCGGCTGGTTTTTTGATCGGCTGTGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTACTCGAAAAGCGTGGCGTTGCTGGTGTCTTGCGGCTGATTTTCGGATCGGCTGTGAGTCCTTTTAAATGTACAGAACTGTACTTCTCAT-GCTCGAAAAGCGTGGCGTTGCTGGTGTCTTGCGACTAATTTTCGAATTGGCTGTGAGTCCTTTGAAATGTACAAAACTGTACTTCTCTTTGCTCGAAAAGCGTGGCGTTGCTGGTGTCTTGCGGCTAATTTT-GAATTGGCTGCGAGTCCTTTGAAATGTACAACACTGTACTTCTCTTTGCTCGAAAAGCGTGGCGTTGCTGG52 P. humul isolates, 23 related Pseudoperonospora sp.Two base-pairs (469 and 652) occassionally, but not consistently, differentin ITS region of P. humuli and P. cubenesis:Not sufficient to develop strain/species-specific primers

Host Range• 15 P. humuli isolates from OR, WA, and ID• No infection of cucumber cotyledons or true leaves• Multiple inoculations onto cv. Nugget unsuccessful

Multi-Gene Phylogeny• Several single nucleotide polymorphisms(SNP’s)– 2 NADH–3 Cox Spacer–4 COX I–3 COX II• Very closely related—difficult todifferentiate with current geneticinformation

Dendogram from cox gene clusterP. humuliP. cubensis•Similar dendograms from cox I, cox II, cox spacer, and NADH

Type I versus Type II Error?

PCR Sensitivity Analysis1.0Proportion PCR positive0.80.60.40.20.0No soil25 mg soil0 100 200 300 400 500Number of sporangia

Air sampling by Burkhard and Rotorod traps10 liters per minute ~220 liters per minute

Pseudoperonospora humuli Sporangial Density andPCR Detection25002000PCR Detection15 March= PCR positiveSpores M-3h-115001000500Visible sporulation28 MarchBurkhard29 March09-Mar 22-Mar 4-Apr 17-Apr 30-AprDateRods collected every 2 to 3 days; all days considered + when PCR +

Pseudoperonospora humuli SporangialDensity and PCR Detection900035800030Sporangia M-1d-170006000500040003000PCR andBurkhardDetection17 March25201510Basal spikes hill-1200010005027-Feb 23-Mar 16-Apr 10-May 3-Jun 27-Jun 21-Jul 14-Aug0Rods collected every 2 to 3 days; all days considered + when PCR +

Downy Mildew Incidence and PCR Detection= PCR += missing432107-Feb 28-Feb 21-Mar 11-Apr 2-May 23-May 13-Jun 4-Jul 25-Jul 15-Aug 5-SepDate2007 commercial yard ‘Willamette’Rods collected weekly; all days considered + when PCR +1098765Disease incidence

Basal spikes per hillABasal spikes per hillB0.14PCR0.12Standard0.10.080.060.040.02017-Mar 3-Apr 20-Apr 7-May 24-May 10-Jun 27-Jun 14-JulDate0.35PCR0.3Standard0.250.20.150.10.05017-Mar 3-Apr 20-Apr 7-May 24-May 10-Jun 27-Jun 14-JulDateValidation:• Four hop yards in ORand WA• PCR detection rangedfrom -8 to +8 daysafter first detection ofdisease– Yard 1: +8 days– Yard 2: 0 days– Yard 3: -8 days– Yard 4: 0 days• OR: first appl. 34 daysprior to grower’sstandard• WA: 3 days prior tostandard

Conclusions•PCR detection of P. humuli within 8 daysof disease and/or sporangia detection in 6site-years of validation• Generally, PCR positive when spikes arepresent in field• Fungicide application at GDD thresholdsignificantly enhanced DM control

Fungicide Effects on Arthropods

Spider mite popuations low in the canopy inrelation to fungicide program90Mites per leaf807060504030UntreatedSulfurOilSynthetic10 July2010028-Apr 18-May 7-Jun 27-Jun 17-Jul 6-Aug 26-Aug 15-SepDate

Spider mite populations in the upper canopy inrelation to fungicide programMites per leaf250200150100UntreatedSulfurOilSynthetic50017-Jul 27-Jul 6-Aug 16-Aug 26-Aug 5-Sep 15-SepDate

Ordinal Cone Damage Rating4 3 2 1•100 cones per replicate plot; RCB blocked against rater; nonparametric analysis

SulfurWater1234

Rate mite increase(mites/leaf/d)TreatmentWaterSulfurSytlet oilSynthetic20051.111.18*1.17*1.1020061.131.39*1.101.22Rating: 1=no damage 2=slight 3=moderate 4=severe or cone abortionRE: relative treatment effect in nonparametric ANOVA-type statistic

Mite-Fungicide Interactions• Questions:– Is this a real problem in commercial production?– Toxicity to predatory mites versus indirect effects?– Management options?• Work partially funded for 2007 to 2009 byWestern IPM Grant• Parallel studies in grape with multiple mite pests

Mite-Fungicide Interactions• Three sulfur timings– Early season (15 April, 1 May, 15 May)– Mid season (15 May,1 June, 15 June)– Late season (15 June, 1 July, 15 July)• Split-plot with miticide treatment assub-plot– Treatment (or re-treatment) at threshold of 10mites per leaf– (1) Acramite; (2) Agrimek; (3) Fujimite

1210ANon-TreatedMites per leaf864SyntheticEarly-SulfurMid-SulfurLate-SulfurOregon 20072010-Apr 2-May 24-May 15-Jun 7-Jul 29-JulDate120Non-Treated100 SyntheticEarly-Sulfur80 Mid-SulfurLate-Sulfur604020019-Jun 3-Jul 17-Jul 31-Jul 14-AugDateBUpper canopy:– Suppression of mitesby early 3 seasonsulfur applications– Exacerbation ofoutbreaks by 3 lateseason applications

Mite Populations in Relation toFungicide and Miticide Treatment50AgrimekMites per Leaf403020AcramiteAcramiteNon-TreatedSyntheticEarly-SulfurMid-SulfurLate-Sulfur10021-Jun 1-Jul 11-Jul 21-Jul 31-Jul 10-AugSampling Date

Coccinelidae per leaf/shake sample1.81.6A2.5BC occinelidae per leaf or sha k e1.41.210.80.60.4Non-TreatedSyntheticEarly-SulfurMid-SulfurLate-SulfurA&L per leaf or shake21.510.5Non-TreatedSyntheticEarly-SulfurMid-SulfurLate-Sulfur0.2012-Apr 3-May 24-May 14-Jun 5-Jul 26-JulDate012-Apr 3-May 24-May 14-Jun 5-Jul 26-JulDate

Power Law Relationshipslog(variance)1.61.41.20.80.6y = 0.8373x + 0.4243R 2 0.4= 0.22310.2y = 1.439x + 0.7772R 2 = 0.91670-0.6 -0.4 -0.2 0 0.2 0.4 0.6log(mean)SulfurNon-treatedA32.521.510.50y = 1.795x + 1.1325R 2 = 0.8129y = 1.2481x + 1.08R 2 = 0.9586SulfurNon-treated0 0.2 0.4 0.6 0.8 1log(mean)B

Hop Aphid Populations inRelation to Fungicide Program6050Non-TreatedA160140Non-TreatedBSynthetic120SyntheticNymphs per leaf403020Early-SulfurMid-SulfurLate-Sulfur1008060Early-SulfurMid-SulfurLate-Sulfur401020012-Apr 3-May 24-May 14-Jun 5-Jul 26-JulDate021-Jun 5-Jul 19-Jul 2-AugDate

Conclusions• Threshold of 10 mites/leaf exceeded in alltreatments• Early season sulfur suppressed mitepopulations compared to late season sulfur• Late season sulfur applications exacerbatedmite outbreak and led to the need for 2miticide application to contain the outbreak

Thanks to collaboratorsand cooperators:Gary Grove & Mark NelsonCindy OcambBrulotte Farms, Inc.Double ‘R’ Hop RanchesHogue RanchesRoy Farms, Inc.Wyckoff Farms, Inc.Annen Brothers, Inc.BC HopCapital Farms, Inc.Coleman FarmsCrosby FarmsHeritage Hops, Inc.Geschwell FarmsGoschie Farms4B FarmsSodbuster FarmsWillamette Mission Farms

Hop Powdery Mildew

1009080702007 WeatherRain Temp RH Solar0.20.180.160.14Temp/RH6050403020100.120.10.08Rain (in)0.060.040.020182 189 196 203 210 217 224 231 238 245 252 259Prosser 1 July – 15 Sept.0

2007 Powdery Mildew Risk Index10080Risk Index604020090 120 150 180 210 240Day of year

Cone Browning Associated withDiffuse Powdery MildewCourtesy WFM

Courtesy WFM

Powdery Mildew Risk Index1. If greater than 6 continuous hours above 86°F,subtract 20 points, else;2. If greater 0.1” rain, subtract 10 points,else;3. If greater than 6 continuous hours above 86°Con previous day, then no change in the index,else;4. If at least six continuous hours between 60-81°F, then add 20 points, else;5. If none of the above rules apply, then subtract10 points.

Powdery Mildew Colonies are Tolerant1to Leaf WetnessDisease severity0.80.60.40.2004Wetness duration (hr)8126241261224Hours afterinfection

1009080702007 WeatherRain Temp RH Solar0.20.180.160.14Temp/RH6050403020100.120.10.08Rain (in)0.060.040.020182 189 196 203 210 217 224 231 238 245 252 259Prosser 1 July – 15 Sept.0

Alternaria Cone DisorderAlternaria alternata– Ubiquitous organism– Common in air of hop yards, leaves, and rootsof healthy plants– Decay organism: growth on senescent or deadplant tissue, leather, textiles, storage rots– Plant, animal, and human pathogen andallergen

Alternaria alternataFrom Rotem (1998):“In most cases A. alternata appears as a weakand opportunistic pathogen attackingsenescent or heavily stressed host plants, butin some cases it can be pathogenic to healthyand vigorously growing plants”• Infection primarly via wounds, senescenttissue, and/or flowers

S. J. PethybridgeAlternaria Cone Disorder• Associated withwind damage,high humidity,wet nights/drydays• Necrotic lesionson tips of bractsand bracteoles• 1 to 25% ofcone area

Alternaria Cone Disorder• Associated withprematuresenescence inUK on latematuring (mid-Sept.) varieties• Not known tocause yieldreductions inUK or AustraliaS. J. Pethybridge

Cone TissuesBractBracteole (w/ seed)Courtesy WFM

Alternaria Cone Disorder2007 IsolationsPM resistant:45% of conesCTZ:36% of conesOR PM resistant:71% conesConfirmed as A. alternata type by ITS sequence and conidial morphology

Alternaria Cone Disorder• 92% of isolations from bracts with lightto dark reddish-brown discoloration• Discoloration began from tips of bracts• Mostly on exposed portion of bracts• Cladosporium visible as dark sporulationon some bracts and bracteoles

Powdery Mildew (and Alternaria)Cone browning in2007 appeared to beassociated, primarily,with powderymildewInteractions withpowdery mildew?– Possible, but noobjective evidence tomy knowledge

Other Cone DiseasesFusarium cone tip blightSJPDowny MildewB. Englehard

Rate of Mite Increase andCone DamageTreatmentRate mite increase(mites/leaf/day)Lower(Non-treated with miticides)UpperCone damageMean Median RE cNontreated0.9961.1681.0410.50Synthetic0.9991.2001.0310.50Early sulfur1.0231.1841.0210.49Mid sulfur1.0051.1511.0310.50Late sulfur1.0021.2291.0510.50Pairwise comparison (α = 0.05) of rates during exponential phase; 100 cones were rated usingan ordinal scale; Nonparametric ANOVA-type statistic. Relative effect (RE) ranges from 0 to 1.

Red Crown Rot• Described in Australia as being caused byan undetermined Phacidiopycnis sp.• Yield loss estimates in Victoria of 10-50%• Yield decline is progressive; reported toappear as long as years 5 after planting

Red Crown Rot SymptomsCourtesy Trish McGee

AffectedHealthy

Red Crown Rot• Phacidiopycnis sp. recovered from plants withsuspect symptoms from 3 farms in OR in 2007• Identified as Phacidiopycnis tuberivora (bas.Phomopsis tuberivora) based on morphologicaland culture characteristics• P. tuberivora ITS sequence not in Genbank;– ITS identical for 3 isolates sequenced; 99% similarityto Phomopsis columnaris

13239 plants1981 weak237 dead1401201008060Column (North-South)40201008060402000Row (East-West)

Spatial Patterns of Affected PlantsDiseasedProportion of rows withsignificant aggregationRunsDoubletNorth-SouthEast-West0.75 (72/96)0.75 (110/125)0.93 (80/86)0.88 (110/125)Dead PlantsNorth-SouthEast-West0.44 (21/48)0.47 (36/76)0.97 (30/31)0.91 (48/53)

Trish McGee, Sustainability VictoriaCompare genetic and phenotypic diversity ofrecovered isolates to type strain of P.tuberivora and other Phacidiopycnis spp.Report on association of soil factors andcultural practices in disease development

Red Crown Rot• Research in Progress or Planned:– Compare genetic and phenotypic diversity of recoveredisolates to type strain of P. tuberivora and otherPhacidiopycnis spp.– Determine role of herbicide injury and soil factors indisease development– Develop PCR primers and assay specific to P. tuberivora– Determine prevalence of P. tuberivora in hop yards in ORand WA– Identify inoculum sources of the pathogen (i.e., alternatehosts, crop debris, healthy plants, irrigation water)