Evolution (Incest and Bestiality)
Evolution (Incest and Bestiality)
Evolution (Incest and Bestiality)
- No tags were found...
Create successful ePaper yourself
Turn your PDF publications into a flip-book with our unique Google optimized e-Paper software.
10/9/12<strong>Evolution</strong>(<strong>Incest</strong> <strong>and</strong> <strong>Bestiality</strong>)Aoife McLysaghtGenetics1
10/9/122
10/9/12What is Life?What is Life?3
10/9/12What is Life?4
10/9/125
10/9/12It has not escaped our notice thatthe specific pairing we havepostulated immediately suggests apossible copying mechanism forDNA.Watson & Crick, 19536
10/9/12ATTAGCTACGCGTAGCATCG7
10/9/128
10/9/129
10/9/12DNA can make copies of itself10
10/9/1211
10/9/12Looking back …10 generations … >1000 ancestors20 generations … > 1 million ancestors30 generations … > 1 billion ancestors12
10/9/12AmphioxusPhylum Chordata(but not a vertebrate)13
10/9/12• Two copies in Histoneoctamer• Forms complex withother histones <strong>and</strong>binds DNA intochromatin• Almost the wholeprotein is highlyconstrainedHistone 414
10/9/12• Highly conserved protein• Compare human <strong>and</strong>wheat H4 genes• 55 DNA differences• 2 amino acid differences– Val Ile (both aliphatic)– Lys Arg (both charged)Histone 415
10/9/12Course aims• Look at evidence for evolution• Discuss how to measure evolution• Describe evolutionary processesFossil recordExtinctionsSinosauropteryxTransitionsDromaeosaurid dinosaur16
10/9/12Heredity• In Darwin’s time the mechanism ofheredity was not understood.• Popular idea: blending inheritanceGregor Mendel• Monk in Brno inpresent-day CzechRepublic• Experimented oninheritance in peas– easy to cultivate– easily observable traits– easy to know whichare the parents of thenew generation17
10/9/12Two Alternative Traits of the Seed Shape CharacterNote that eachof seed is anew individualof a differentgeneration –seeds are notof the samegeneration asthe plant thatbears them.18
10/9/1219
10/9/12Mendel had discovered that heritability is mediated bydiscrete particles that do not blend.Mendel had discovered genesLater work showed that genes are on chromosomes <strong>and</strong>that the information was stored in DNAHow does evolution happen?• Heritable variation in the ability to survive<strong>and</strong> reproduce in your environment20
10/9/12• DNA mutationsHeritable variationMutations generate new allelesAllele = variant form of a gene.… in the ability to survive <strong>and</strong>reproduce21
10/9/12… in your environment• “Better” or “fitter” is subjective– context dependentgreen = malarial region;red stripes = high frequency of sickle-cell anaemiaKey ideas:1. Gradual evolution results from small genetic changes that areacted upon by natural selection2. The origin of species (macroevolution) can be explained interms of natural selection acting on individuals(microevolution)22
10/9/12Genes are the key to evolution• Genes are both the material of evolution, <strong>and</strong> the markersof evolution• [material] They are the heritable characters that change <strong>and</strong>result in evolutionary changes• [markers] They are also our major source of information forunderst<strong>and</strong>ing the process of evolution• Mutations occur in DNA sequences giving rise to variation= source of heritable variation• Without mutation there is no evolution23
Change language