Thyrotropin releasing hormone (TRH) - The FASEB Journal

The FASEB Journal article fj.08-126417. Published online October 13, 2009. 

The FASEB Journal Research Communication 

Thyrotropin releasing hormone (TRH): a new player 

in human hair-growth control 

Erzsébet Gáspár,* ,1 Celine Hardenbicker,* ,1 Enikő Bodó,* ,§ Björn Wenzel, † 

Yuval Ramot,* , Wolfgang Funk, Arno Kromminga, # and Ralf Paus* ,‡,2 

*Department of Dermatology and † Department of Internal Medicine, University of Lübeck, Lübeck, 

Germany; ‡ School of Translational Medicine, University of Manchester, Manchester, UK; 

§ Agricultural and Molecular Research Institute, College of Nyiregyháza, Nyiregyháza, Hungary; 

Department of Dermatology, Hadassah-Hebrew University Medical Center, Jerusalem, Israel; Klinik 

Dr. Kozlowski, Munich, Germany; and # Institute for Immunology, Clinical Pathology, Molecular 

Medicine, Hamburg, Germany 

ABSTRACT Thyrotropin-releasing hormone (TRH) 

is the most proximal component of the hypothalamicpituitary-thyroid 

axis that regulates thyroid hormone 

synthesis. Since transcripts for members of this axis 

were detected in cultured normal human skin cells and 

since human hair follicles (HFs) respond to stimulation 

with thyrotropin, we now have studied whether human 

HF functions are also modulated by TRH. Here we 

report that the epithelium of normal human scalp HFs 

expresses not only TRH receptors (TRH-R) but also 

TRH itself at the gene and protein level. Stimulation of 

microdissected, organ-cultured HFs with TRH promotes 

hair-shaft elongation, prolongs the hair cycle 

growth phase (anagen), and antagonizes its termination 

by TGF-2. It also increases proliferation and inhibits 

apoptosis of hair matrix keratinocytes. These TRH 

effects may be mediated in part by reducing the ATM/ 

Atr-dependent phosphorylation of p53. By microarray 

analysis, several differentially up- or down-regulated 

TRH-target genes were detected (e.g., selected keratins). 

Thus, human scalp HFs are both a source and a 

target of TRH, which operates as a potent hair-growth 

stimulator. Human HFs provide an excellent discovery 

tool for identifying and dissecting nonclassical functions 

of TRH and TRH-mediated signaling in situ, 

which emerge as novel players in human epithelial 

biology.—Gáspár, E., Hardenbicker, C., Bodó, E., Wenzel, 

B., Ramot, Y., Funk, W., Kromminga, A., Paus, R. 

Thyrotropin releasing hormone (TRH): a new player in 

human hair-growth control. FASEB J. 24, 000–000 

(2010). www.fasebj.org 

Key Words: hair follicle hair cycle regulation cell cycle 

Thyrotropin-releasing hormone (TRH) is a tripeptide 

(pGlu-His-Pro-NH 2) hormone that is primarily 

produced in the paraventricular nucleus of the hypothalamus 

and represents the most proximal member of 

the hypothalamic-pituitary-thyroid (HPT) axis (1, 2). 

The major recognized function of TRH is the maintenance 

of thyroid hormone (TH) homeostasis, via reg- 

0892-6638/10/0024-0001 © FASEB 

ulation of thyroid-stimulating hormone (TSH) secretion 

(3, 4). However, TRH also regulates the release of 

other hormones, for example, prolactin, growth hormone, 

vasopressin, and insulin (5, 6). TRH is also 

present in many brain loci out of the hypothalamus (7) 

and has been found in several non-neuronal tissues of 

the mammalian body such as the gastrointestinal tract 

(8–10), heart (11), and reproductive organs (12, 13). 

This suggests additional roles for this neuropeptide, 

well beyond its classical function within the HPT axis 

(8, 9). Such nonclassical TRH functions include a role 

in cardiovascular pathophysiology in experimental 

models and in humans (14), as well as in the immune 

system in general (15) and rodent T-cell-dependent 

immune responses in particular (16). 

Recently, mRNA transcripts for HPT axis-related 

genes were detected in normal human skin and in its 

constituent cell populations. For example, TRH mRNA 

was detected in cultured human epidermal keratinocytes, 

as well as in hair follicle (HF) papilla fibroblasts, 

while TRH receptor (TRH-R) mRNA has been identified 

only in skin biopsies of basal cell carcinoma and in 

human melanoma cell lines (17). The same study 

showed TRH gene expression in adrenal gland, myometrium, 

placenta, umbilical cord, and fetal membrane 

RNA extracts (17). TRH immunoreactivity (IR) has also 

been described in melanoma cells and in primary 

melanocyte cultures. Moreover, melanoma cells, but 

not normal melanocytes, respond to TRH stimulation 

in vitro with increased proliferation (18). Furthermore, 

it is also known that large amounts of TRH are produced 

in amphibian skin (19) in the epithelium lining 

the cutaneous glands in the epidermis (20). TRH is 

thought to induce amphibian skin darkening via stimulation 

of pituitary melanocortin release, which then 

1 These authors contributed equally to this work. 

2 Correspondence: Department of Dermatology, University 

Hospital Schleswig-Holstein, Campus Lübeck University of 

Lübeck, Ratzeburger Allee 160 D-23538 Lübeck, Germany. 

E-mail: ralf.paus@uk-sh.de 

doi: 10.1096/fj.08-126417 

1

induces melanosome redistribution in cutaneous melanophores 

(21). However, whether normal human skin 

or its appendages also serve as targets of TRH remains 

unknown. 

In the current study, we explored this question by 

testing the response of normal human scalp HFs to 

TRH, given that it has been previously shown that they 

are both potent sources and important nonclassical 

targets of a wide range of neuroendocrine mediators 

(22). These include corticotropin-releasing hormone 

(CRH) (23–25), TSH (26), melatonin (27, 28), prolactin 

(29), endovanilloid receptors (30), endocannabioids 

(31), and THs (32). 

Utilizing organ-cultured, microdissected human 

scalp HFs (33), we have addressed the specific questions 

of whether normal human HFs express TRH 

and/or TRH-R on the gene and protein level, and 

whether stimulation of human HFs with TRH alters 

hair growth, as measured by hair-shaft elongation, HF 

cycling, and hair matrix keratinocyte proliferation or 

apoptosis. Transforming growth factor-2 (TGF-2) is a 

key inducer of apoptosis-driven, normal HF regression 

(catagen) in humans (34–36). As TGF-2 induces 

apoptosis in the hair matrix keratinocytes (37), we also 

asked whether TRH can antagonize TGF-2-induced 

premature catagen transformation and/or inhibit hair 

matrix keratinocyte apoptosis in human HF. Since the 

ataxia telangiectasia-mutated (ATM) and ATM-Rad3 

related (Atr) kinase, and the ATM/Atr phosphorylation 

pathway of p53, are now recognized as key control 

elements in the modulation of apoptosis and/or cellcycle 

arrest (38–41), we furthermore asked whether 

the intrafollicular ATM/Atr pathway of p53 phosphorylation 

is altered by TRH administration. Finally, given 

that we have recently identified TSH as a negative 

regulator of keratin expression (26), we asked whether 

TRH exerts any effect on keratin expression. 

MATERIALS AND METHODS 

HF organ culture 

Anagen (VI) HFs were microdissected from normal temporofrontal 

human scalp skin obtained from 6 healthy adult females 

aged 51–61 yr (mean 54 yr) undergoing routine facelift surgery, 

adhering to the Helsinki guidelines and following approval by 

the Institutional Research Ethics Committee of the University of 

Lübeck. Isolated HFs from 3 of these patients were used for 

routine HF organ culture (26–33, 42), while the HFs from 2 

individuals were subjected to short-term organ culture for 

microarray analysis (see below). Additional HFs from 1 patient 

were used for 6 d organ culture, followed by protein 

extraction for Western blotting (see below). HFs were treated 

with TRH (3–30 nM) (18) or vehicle (culture medium only) 

with every change of culture medium (i.e., every 48 h). Fifteen 

to 18 HFs were studied in each experimental group, and 1 

experiment was performed with all HFs derived from a single 

individual. Since HF organ culture experiments were repeated 

twice, the total number of HFs studied per group was 

45–54, derived from 3 different individuals. The serum-free 

culture medium consisted of Williams’ E medium, supplemented 

with insulin and hydrocortisone (for details, see refs. 

26–33, 42). After6doforgan culture, all test and control HFs 

were embedded, snap-frozen, and processed for longitudinal 

cryosectioning. The frozen sections were stored at 80°C 

until used. 

Measurement of hair-growth parameters 

Hair-shaft length in organ culture was measured on d 0, 1, 3, 

5, and 6, using a Zeiss inverted binocular microscope with an 

eyepiece containing a graticule (Carl Zeiss, Oberkochen, 

Germany). (Note that hair-shaft elongation in serum-free 

human HF organ culture occurs at almost the rate of normal 

hair growth in vivo; ref. 34.) 

The hair cycle stage, which HFs had reached after 6dof 

organ culture (i.e., anagen VI vs. catagen), was assessed 

histologically and classified according to accepted morphological 

criteria (43). 

Analysis of HF matrix keratinocyte proliferation and 

apoptosis 

For simultaneous detection of apoptotic and proliferating 

cells in the HF, Ki-67/TUNEL (terminal dUTP nick endlabeling) 

double-immunofluorescence was used as described 

previously (28, 32, 33). Briefly, 6-m cryosections were fixed 

in formalin, ethanol, and acetic acid and labeled with a 

digoxigenin-deoxyUTP (ApopTag Fluorescein In Situ Apoptosis 

Detection Kit; Chemicon, Purchase, NY, USA) in the 

presence of terminal deoxynucleotidyl transferase (TdT), 

followed by incubation with a mouse anti-Ki-67 antiserum 

(Dako, Glostrup, Denmark). TUNEL-positive cells were visualized 

by an anti-digoxigenin FITC-conjugated antibody 

(ApopTag kit), whereas Ki-67 was detected by a rhodaminelabeled 

goat anti-mouse secondary antibody (Jackson Immuno- 

Research, West Grove, PA, USA). Cell nuclei were labeled 

with DAPI. Proliferating hair matrix and epidermal keratinocytes 

of normal human skin were used as positive control for 

Ki-67 immunofluorescence, while chemotherapy-treated human 

HFs were used as positive TUNEL control (33). Negative 

controls were run by omitting TdT or the primary Ki-67 

antibody and by observing negative immunoreactivity for 

these parameters in the expected human scalp skin compartments. 

For the quantitative evaluation and comparison of the 

double-staining, DAPI-, Ki-67-, or TUNEL-positive cells were 

counted in clearly defined reference regions (see Results). 

The number of DAPI-positive cells served as “total number of 

cells,” and the percentage of Ki-67-positive and/or TUNELpositive 

cells was calculated on this basis to enable comparison 

between vehicle and test groups. 

Detection of phosphorylated/nonphosphorylated p53 and 

Chk1/2 with Western blot analysis 

As a first attempt to further dissect the possible mechanisms 

by which TRH might exert its effects on human HF keratinocyte 

proliferation and/or apoptosis in situ, we explored the 

ATM/Atr-dependent phosphorylation of p53 and the checkpoint 

kinases Chk1/2 that may be affected by TRH like the 

“noncanonical pathway” for TGF--induced apopotosis (44, 

45). Protein from 10–12 microdissected HFs from 1 additional 

patient, which had been incubated with 3–15 nM TRH 

in the presence or absence of 10 ng/ml TGF-2 for6din 

organ culture, was extracted with 100 l lysis buffer (10 mM 

Tris-HCl, pH 7.2; 2% SDS; 1% Triton-X 100; and 10% 

glycerol) containing protease inhibitor (Protease Complete; 

Roche, Mannheim, Germany). After centrifugation at 10,000 

rpm for 5 min, extracted protein samples (5 g from each) 

2 Vol. 24 February 2010 The FASEB Journal www.fasebj.org 

GÁSPÁR ET AL.

were separated on polyacrylamide gel (Gold Precast Gels; 

Lonza, Rockland, ME, USA). The gel was then electroblotted 

onto nitrocellulose membrane and blocked with 5% skimmed 

milk overnight at 4°C. Blots were incubated with primary 

antibodies against p53, phosphorylated p53-Ser-15, Chk1/2, 

and phosphorylated Chk1-Ser-345 and Chk2-Thy387 (Phospho-p53 

Antibody Sampler Kit and Phospho-ChK1/2 Antibody 

Sampler Kit; Cell Signaling Technology, Inc., Danvers, 

MA, USA; ref. 41). Bands were visualized with a luminescent 

detection system (Lumi GIO Reagent, Cell Signaling) according 

to the manufacturer’s instructions. Band intensity was 

measured with the Gel Documentation System (Bio-Rad, 

Munich, Germany). 

Quantitative immunohistochemistry: keratin 6 

Acetone-fixed cryosections of control and test HFs that had 

been treated for 6 d with TRH (3–30 nM) or vehicle only were 

preincubated with nonimmune goat serum (10% in TBS). 

Cryosections were first incubated with the primary antibodies 

against keratin 6 (mouse anti-human, 1:10, overnight, at 4°C; 

Progen, Heidelberg, Germany), followed by rhodamine-conjugated 

goat anti-mouse (1:200 in TBS for 45 min, room 

temperature, Jackson ImmunoResearch) secondary antibody. 

Counterstaining was performed with DAPI (Boehringer- 

Mannheim, Mannheim, Germany). Densitometric measurement 

of staining intensities in clearly defined reference areas 

(marked with rectangle, see Results) was performed using the 

ImageJ software (National Institutes of Health, Bethesda, MD, 

USA). 

Statistical analysis was assessed by unpaired t test, using 

Graph Pad Prizm 5.01 (Graph Pad Software, Inc., San Diego, 

CA, USA). 

Immunohistochemical detection of TRH 

Cryosections fixed with 4% formaldehyde were incubated with 

the primary polyclonal rabbit anti-human TRH antibody (MP 

Biomedicals, Aurora, OH, USA) (18) overnight at 4°C, followed 

by incubation with FITC-labeled goat-anti-rabbit secondary antibody 

(AlexaFluor; Invitrogen GmbH, Karlsruhe, Germany) for 

90 min. Normal human hypothalamic tissue served as positive 

control, and negative control was performed by omission of the 

primary antibody and preabsorption of the primary antibody 

with TRH peptide. Cell nuclei were counterstained with DAPI. 

Slides were examined with a fluorescence microscope (Zeiss 

Axiovert 200M) and photodocumented using a Zeiss AxioCam- 

MRm digital camera with AxioVision 4.6 software. The staining 

intensity of the TRH IR was quantified with ImageJ software. 

Immunohistochemical detection of the TRH-R 

Fluorescence staining of the TRH-R was performed by using 

the tyramide signal amplification (TSA) system (29). After 

blocking the endogenous peroxidase of acetone-fixed fullthickness 

skin cryosections with 3% H 2O 2, cryosections were 

preincubated with avidin/biotin and normal goat serum 

(Dako; 5% in TNT). Then sections were incubated overnight 

at 4°C with a polyclonal rabbit anti-TRH-R antibody (Acris, 

Hiddenhausen, Germany; 1:500, 1:1000, and 1:2000 in 

TNT2% normal goat serum). Next, a biotinylated goat 

anti-rabbit antibody (Jackson ImmunoResearch; 1:200 in 

TNT2% normal goat serum) was added for 45 min, followed 

by incubation with streptavidin-conjugated horseradish 

peroxidase (TSA kit; Perkin-Elmer, Boston, MA, USA) and 

amplification by FITC-tyramide (TSA kit; 1:50 in amplification 

dilutent). Cryosections were counterstained with DAPI. 

Normal human pituitary gland sections were used as positive 

TRH STIMULATES HUMAN HAIR GROWTH 

controls and revealed the expected positive IR, and negative 

controls were performed by omission of the primary antibody 

and preabsorption of the primary antibody with TRH-R 

peptide (Acris). 

Detection of TRH and TRH-R gene expression by RT-PCR 

PCR analysis was performed on cDNA generated from total 

RNA isolated from freshly microdissected HFs (20 HFs/ 

group) using the RNAeasy kit (Qiagen, Hilden, Germany). 

Total RNA (0.5 g) was reverse transcribed with the Super- 

Script First-Strand Synthesis System (Applied Biosystems, Foster, 

CA, USA). PCR analysis of TRH and TRH-R standardization 

of the cDNA samples was performed by amplification of 

the housekeeping gene G6-PDH using undisclosed primer 

pairs from Roche (Mannheim, Germany). PCR amplification 

[94°C for 2 min; 40 cycles of 94°C for 30 s, 58°C (G6-PDH), 

58°C (for TRH and TRHR) for 30 s, 68°C for 30 s] was 

performed with the following primers (MWG Biotech, Ebersberg, 

Germany): TRH forward ATGCCCGGCCCTTGGTT- 

GCTGCT and reverse AGCTCCTTTGAGCCTTGGGATCT; 

TRH-R forward ATGGAAAACGAGACAGTCAGTGAA and reverse 

TTAGGTAAATAGGTGAGTAGTAAT. Melting-curve analyses 

were performed to confirm the specificity of the PCR 

products. In addition, 501-bp TRH and 582-bp TRH-R gene 

products were visualized on a 0.7% agarose gel stained with 

ethidium bromide. cDNA from normal human hypothalamus 

and normal human pituitary served as positive controls for 

TRH and TRH-R, respectively. 

Microarray analysis 

Gene-expression profiling of HFs from 2 different individuals, 

in addition to the 3 individuals whose HFs had been subjected 

to the organ cultures summarized above, was analyzed by 

Human Whole Genome Oligo Microarray (44 kb), commercially 

performed by Miltenyi Biotech GmbH (Bergisch-Gladbach, 

Germany), using appropriate controls, according to the 

company’s standard operating procedures. Microdissected 

frontotemporal scalp HFs (20 HFs/group), all derived from a 

single female donor, were treated with vehicle or TRH (30 

nM) for 24 h, and total RNA was isolated by RNeasy Mini Kit 

(Qiagen). Candidate genes were selected according to the 

following criteria: equidirectional expression changes in both 

examined individuals, value of P 0.0001, and changes 

2-fold. 

RESULTS 

Normal human HFs express TRH and TRH-R on 

both the mRNA and protein levels 

As analyzed by RT-PCR, both TRH mRNA, as well as TRH-R 

transcripts, were detected in microdissected human HFs at 

the expected basepair lengths (Figs. 1A and 2A). These 

gene transcripts appeared to be translated into proteins, 

since specific, TRH-like IR was found in the HF 

epithelium, with maximal IR intensity seen in the basal 

outer root sheath (ORS; Fig. 1B). IR for TRH-R was 

much more restricted, being most prominent in the 

inner root sheath (IRS) of the HF (Fig. 2B). 

3

marker 

Figure 1. TRH mRNA and protein expression in the human 

HF. The 501-bp TRH mRNA transcript (A) and TRH IR (B) 

were detectable in microdissected normal, human HFs. 

Green fluorescence staining represents TRH IR (arrows) in 

the ORS of the HF (B) and in the normal human hypothalamic 

tissue (C) used as positive control. Inset: negative 

control. Scale bars 50 m. ORS, outer root sheath; DP, 

dermal papilla. 

TRH stimulates hair-shaft elongation and prolongs 

anagen 

Microdissected, organ-cultured normal human scalp 

skin HFs responded to stimulation with 15 or 30 nM 

TRH by significantly increased hair-shaft growth 

(P0.001; Fig. 3A). Potentially more clinically significant 

was the observation that significantly increased 

percentage of TRH-treated HFs remained in anagen 

after 6dofculture, as measured by quantitative hair 

cycle histomorphometry, when compared with vehicletreated 

controls. While only 25 and 28% of the HFs that 

were cultured in the presence of TRH (15 and 30 nM, 

respectively) entered catagen by the end of the incubation 

time, 42% of the control HFs had done so (Fig. 

3B). While the most effective TRH dose for exerting 

these effects (15 or 30 nM) varied between individual 

HF donors, these findings suggest that TRH is indeed a 

novel hair-growth-promoting agent, a functional role 

not previously described for TRH. 

TRH induces proliferation of matrix keratinocytes 

and inhibits apoptosis 

Enhanced hair-shaft elongation and prolonged anagen 

duration by a test agent in human HF organ culture is 

commonly accompanied by corresponding changes of 

keratinocyte proliferation and apoptosis in the hair 

matrix of anagen VI HFs, i.e., the actual “hair-shaft 

factory.” This was confirmed by quantitative immunohistomorphometry 

of the hair matrix, using Ki-67 and 

TUNEL as markers for proliferation and apoptosis, 

comparing anagen VI HFs from test and control 

groups. Hair matrix keratinocytes of HFs that had been 

incubated with TRH for 6dinorgan culture showed a 

significantly higher proliferation rate compared with 

vehicle-treated controls (Fig. 4A, B). As expected, anagen 

VI HFs, in all experimental groups, showed a small 

number of TUNEL-positive cells. Yet, TRH treatment 

further reduced that small number of apoptotic cells 

(Fig. 4C, D). 

TRH antagonizes TGF-2-induced premature catagen 

and intrafollicular apoptosis 

As expected, 10 ng/ml TGF-2 induced premature 

catagen development, with almost 60% of TGF-2treated 

HFs having already entered into catagen by 

the end of organ culture. In stark contrast, 60–70% 

of the TRH-treated HFs remained in anagen. This 

corresponded well to the effects exerted by both 

agents on hair matrix keratinocyte apoptosis, as TRH 

marker 

marker 

Figure 2. TRH-R mRNA transcript and protein expression 

in the human HF. Normal, human scalp skin HFs express 

TRH-R on the mRNA (582 bp) (A) and on the protein (B) 

level. Green fluorescence staining represents TRH-R IR 

(arrows) in the IRS of the normal, human scalp skin HFs 

(B) and in the normal, human anteriomedial pituitary 

tissue used as positive control (C). Inset: negative control. 

Scale bars 50 m. IRS, inner root sheath; DP, dermal 

papilla. 


GÁSPÁR ET AL.

Figure 3. Effects of TRH on hair-shaft elongation and hair cycle; 

15 and 30 nM TRH significantly stimulated hair-shaft elongation 

(A) and prolonged the growth phase (anagen) of microdissected, 

organ-cultured human scalp skin HFs (B). Elongation 

was measured every second day for 6 d; n 15–18 HFs/group. 

Columns represent means se; cumulative results of 3 different 

experiments. *P 0.05, **P 0.01, ***P 0.001 vs. control; 

Mann-Whitney test. 

effectively and significantly antagonized not only 

TGF-2-induced premature catagen transformation 

of human anagen VI scalp HFs in organ culture but 

also the up-regulation of hair matrix keratinocyte 

apoptosis by TGF-2 (Fig. 5). 

TRH inhibits cell-cycle arrest and apoptosis 

trigger p53 

As a first attempt to dissect important molecular 

pathways that may underlie the observed effects of 

TRH on hair matrix keratinocyte proliferation and 

apoptosis, protein extracts from homogenates of 


TRH- or vehicle-treated human scalp HFs were compared 

by Western blot with respect to p53 phosphorylation. 

As shown in Fig. 6, TRH significantly reduced the 

phosphorylation of p53 at Ser-15 in a dose-dependent 

manner, compared with vehicle-treated HFs. In contrast, 

TGF-2 significantly increased phosphorylation of 

p53. Coincubation of HFs with TRH and TGF-2 reduced 

p53 phosphorylation in a dose-dependent manner 

when compared with HFs incubated with TGF-2 

only. Moreover, in TRH-treated HFs, phosphorylation 

of the cell-cycle checkpoint kinase Chk1 at Ser-245 was 

also significantly and dose dependently reduced, compared 

with control HFs (Fig. 7A, B). Likewise, P-Thr- 

387 phosphorylation of Chk2 was also reduced significantly 

(15 nM) in TRH-treated HFs (Fig. 7C, D). 

Thus, TRH may directly or indirectly inhibit hair 

matrix apoptosis via a reduction of p53 phosphorylation, 

in direct contrast to the effect of TGF-2. 

Moreover, TRH is able to compensate the TGF-2induced 

p53 activation, and it dephosphorylates important 

cell-cycle checkpoint kinases, such as Chk1 

and Chk2. 

Microarray analysis reveals novel candidate target 

genes of TRH 

Finally, we used genome-wide microarray analysis to 

identify novel human HFs candidate target genes that 

are regulated by TRH and that could be systemically 

examined in further studies. Adopting rigid selection 

criteria to identify these genes (see Materials and 

Methods), 1 up-regulated and 6 down-regulated genes 

were identified (Table 1). TRH and TRH-R mRNA 

were both detected in the microarray, but their expression 

level did not change (see Supplemental Table 1). 

Neurofilament 3 was up-regulated, while differentially 

down-regulated candidate genes included several keratins. 

As keratin 6 is prominently expressed in the ORS of 

normal human HFs, we selected keratin 6 for investigation 

at the protein level. As indicated in Fig. 8, quantitative 

immunohistomorphometry revealed a significant 

down-regulation of keratin 6-associated IR in the ORS 

of TRH-treated human HFs, compared with vehicle 

controls. 

We were unable to investigate the remaining protein 

products of the other candidate TRH-regulated genes, 

as all available HF sections had all been consumed in 

the extensive analyses presented in Figs. 1B,2B,3B,4,5, 

and 7. Interestingly, none of the conventionally discussed 

target genes of TRH, including TSH and prolactin, 

were identified as differentially regulated candidate 

genes in our microarray analysis. 

DISCUSSION 

Here we show for the first time that normal human 

scalp HFs express TRH transcript and protein in situ. 

5

Figure 4. Effects of TRH on proliferation and apoptosis. TRH (3–30 nM) significantly stimulated hair matrix keratinocyte 

proliferation (A, B) and inhibited apoptosis (C, D) in the microdissected, organ-cultured human scalp skin HF; n 15–18 

HFs/group. Columns represent means se; cumulative results of 3 different experiments. *P 0.05, **P 0.01, ***P 0,001 

vs. control; Mann-Whitney test. Red fluorescence staining labels Ki-67-positive (proliferating) (B), and green fluorescence labels 

the TUNEL-positive apoptotic cells (D). Ki-67/TUNEL positive cells were counted below a line marking the end of the dermal 

papilla (indicated with scattered line). Scale bars 50 m. HM, hair matrix; DP, dermal papilla. 

Our data also suggest that HFs, the most prominent 

appendages of human skin, respond to TRH via a 

functionally active cognate receptor, TRH-R. This is 

entirely consistent with previous reports documenting 

the transcription of HP-axis elements in the 

various human skin-cell populations (17) and the 

massive production of TRH in amphibian skin (19). 

Moreover, it fits well with recent evidence that human 

HFs prominently produce an extensive range of 

neuropeptide hormones, including the classical “hypothalamic” 

peptide hormone CRH, expressed in 

human scalp HFs on the gene and protein level 

(23–25, 46, 47). 

Furthermore, we have shown that TRH is a potent 

hair-growth stimulator. In addition, our observations that 

TRH stimulates hair-shaft formation, prolongs anagen, 

stimulates hair matrix proliferation, inhibits HF keratinocyte 

apoptosis, and down-regulates ORS keratinocyte 

expression of keratin 6 in situ provide further 

evidence that this tripeptide hormone is not only a 

novel player in HF biology but also in human epithe- 

lial cell biology. The hair-growth-promoting effects 

of exogenous TRH application certainly suggest that 

TRH-R stimulation could represent an important 

clinical strategy for the promotion of human hair 

growth. Of course, topical application would be 

necessary to minimize the risk of disturbance to the 

systemic HPT axis. 

The presence of TRH at the gene and protein 

levels in defined tissue compartments also raises the 

possibility that autocrine, or even paracrine, hairgrowth 

regulation occurs via intrafollicularly produced 

TRH. The development of highly selective 

TRH-R antagonists, lacking any intrinsic agonist activity, 

will help further delineate whether the proposed 

autocrine and/or paracrine TRH/TRH-R-mediated 

signaling events are important for normal 

human hair-growth regulation. 

Our currently available immunohistological data 

suggest that functional TRH-Rs are predominantly 

expressed in the HF IRS, a rigid, terminally differentiated, 

nonproliferating compartment of the HF ep- 


GÁSPÁR ET AL.

Figure 5. TRH preincubation compensates the catagen induction 

of TGF-2. Combined administration of TGF-2 (10 

ng/ml) and TRH (3–30 nM) increased the number of the 

anagen HFs in organ culture after 6 d administration (A), and 

30 nM TRH significantly inhibited apoptosis (B). Columns 

represent means se; cumulative results of 3 different 

experiments. *P 0.05 vs. TGF-2; Mann-Whitney test. 

ithelium. The IRS has not been previously considered 

to play an important role in hair-growth control 

(48–50). If in situ hybridization studies of the IRS, 

which we were unable to perform due to the shortage 

of available tissue sections, support a restricted expression 

of TRH-R in the IRS, and if subsequent laser 

capture microdissection-based arrays show that TRH 

treatment modulates IRS gene expression, intriguing 

new questions about the communication of the IRS 

with the hair matrix will be raised. These would 

center on the speculation that the IRS may influence 

proliferation, differentiation, and/or apoptosis in 

the hair matrix to a larger extent than hitherto 

suspected. 


We were particularly intrigued by the strong antagonistic 

effects of TRH on TGF-2, with respect to 

catagen and apoptosis induction. It is widely recognized 

that TGF-2 induces apoptosis in epithelial 

cells via the Smad signaling pathway (41, 51). However, 

TGF-2 can also activate noncanonical pathways, 

such as mitogen-activated protein kinases or 

phosphatidylinositol-3-kinase/AKT pathways (44). As 

TGF-2 levels increase immediately before the HF 

enters catagen (35, 37, 52) and TGF-2 administration 

induces premature catagen development (34, 

35), we investigated the influence of TRH on key 

checkpoints of apoptosis and cell-cycle arrest, along 

the ATM/Atr pathway, specifically on phosphorylation 

of p53 and selected checkpoint kinases (Chk1/2; 

refs. 38–40, 45, 53–55). However, it is exceptionally 

difficult to dissect the direct cell cycle and apoptosis 

machinery effects of any test agent on a multitissue 

miniorgan interaction system like the human HF. Indeed, 

if there is both exogenous application and endogenous 

production of this agent within the system, 

there may be additional effects, for example, in hair 

matrix keratinocyte proliferation or apoptosis, the 

Figure 6. Effects of TGF-2 and TRH on p53 phosphorylation; 

10 ng/ml TGF-2 increased but TRH dose dependently 

reduced the phosphorylation of p53 in microdissected, organ-cultured 

HFs after 6 d. A) Representative immunoblot of 

p53 phosphorylation at Ser-15. Lane 1, control; lane 2, 10 

ng/ml TGF-; lane 3, 15 nM TRH; lane 4, 30 nM TRH; lane 

5, TGF-2 15 nM TRH; lane 6, TGF-2 30 nM TRH; lane 

M, 60-kDa protein marker. -Actin (43 kDa) is shown as 

protein loading control. B) Densitometric analysis of 56-kDa 

p53-Ser-15P showed increased phosphorylation after TGF-2 

treatment, while TRH reduced p53 phosphorylation, and 

compensated the TGF-2 effect. Columns represent means 

se, cumulative results of 3 consecutive experiments. **P 

0.01, ***P 0.001; Mann-Whitney test. 

7

Figure 7. Effects of TRH on Chk1/Chk2 phosphorylation. TRH dose dependently reduced the phosphorylation of Chk1/2 in 

microdissected, organ-cultured HFs. A, C). Representative immunoblots of Chk1 phosphorylation at Ser-345 (A) and Chk2 

phosphorylation at Thr-387 (C). Lane 1, control; lane 2, 3 nM TRH; lane 3, 15 nM TRH; lane M, 60-kDa protein marker. -Actin 

(43 kDa) is shown as protein loading control. B, D) Densitometric analysis of 55-kDa Chk1-Ser-345P (B) and 60-kDa 

Chk2-Thr387P (D) showed reduced phosphorylation after TRH administration. Columns represent means se; cumulative 

results of 3 consecutive experiments. *P 0.05, ***P 0.001 vs. control; Mann-Whitney test. 

cause of which may be difficult to directly attribute to 

external application of internal production. 

However, we sought to obtain at least first molecular 

pointers to potentially important signaling pathways, 

which may be targeted by TRH in human HF cells in 

situ. These would serve as a point of reference for 

future TRH related research with isolated, defined HF 

cell populations. Therefore, we examined the posttranscriptional 

effects of TRH on the ATM/Atr cascade, 

which regulates apoptosis and cell cycling (38– 

TABLE 1. Intrafollicular candidate genes for regulation by TRH 

Primary 

sequence name Sequence description 

40). We selected 3 crucial checkpoints, namely, p53 

phosphorylation, which regulates apoptosis, and the 

phosphorylation of the Chk1/2 kinases, which regulate 

cell-cycle arrest (39, 40, 53–55). Of course, our organ 

culture system did not permit a more exact examination 

of TRH or the activated THR-R action on the 

ATM/Atr cascade. As the cell homogenates used for 

Western blots comprised all cell components of 10 

HFs, the phosphorylation signals obtained derived 

from both cell components affected by the incuba- 

Fold 

change P value 

Fold 

change P value 

KRTHA1 Homo sapiens keratin, hair, acidic, 1 (KRTHA1), mRNA 

NM_002277 

3.842 3.66E-19 3.422 2.11E-17 

KRTHB6 H. sapiens keratin, hair, basic, 6 (monilethrix) 

(KRTHB6), mRNA NM_002284 

4.432 3.68E-21 3.382 3.25E-17 

KRT6B H. sapiens keratin 6B (KRT6B), mRNA NM_005555 2.542 1.67E-12 2.772 6.05E-14 

MGC10814 H. sapiens hypothetical protein MGC10814, mRNA 

(cDNA clone MGC:10814 IMAGE:3613095), complete 

cds. BC004943 

2.432 3.77E-11 2.12 5.25E-09 

UBCE7IP5 H. sapiens likely ortholog of mouse ubiquitin-conjugating 

enzyme 7 interacting protein 5 (UBCE7IP5), transcript 

variant 1, mRNA NM_014948 

2.112 0 2.032 8.56E-06 

KRTHA5 H. sapiens keratin, hair, acidic, 5 (KRTHA5), mRNA 

NM_002280 

2.052 8.76E-09 1.732 4.77E-06 

NEF3 H. sapiens neurofilament 3 (150 kDa medium) (NEF3), 

mRNA NM_005382 

2.331 8.44E-08 2.181 1.57E-07 

List of the genes whose transcription was modulated equidirectionally by TRH treatment in the pooled, individually analyzed HF RNA 

extracts of both patients (2-fold changes, P0.0001). Microarray analysis (human whole-genome microarray) was performed by a commercial 

service (Miltenyi Biotech GmbH). 2, down-regulation; 1, up-regulation. 


GÁSPÁR ET AL.

A 

B 

Relative staining 

intensity 

Control TRH 3nM TRH 30nM 

50 

45 

40 

40 

0 

Control 

TRH3nM 

* * 

TRH30nM 

tion with TRH and/or TGF-2 and those unaffected. 

Therefore, we always observed a threshold of phosphorylation, 

although the total phosphorylation, for 

example, p53-Ser-15, was increased by TGF-2 and 

drastically antagonized by TRH (Fig. 6), which correlates 

with the apoptosis induction of TGF- 2 and 

the apoptosis reduction of TRH (Fig. 5B). A complementary 

effect of TRH on phosphorylated checkpoint 

kinases Chk1/2 was observed, which subsequently 

would activate cdc25and cdc2/cyclin B (55). 

Taken together, the effects of TRH on the cellsignaling 

segment we investigated may be characterized 

as a release of two cell-cycle brakes, caused by p53 and 

Chk1/2. While these results only provide a first glimpse 

into the mechanisms by which TRH modulates epithelial 

cell cycling, they already allow the formulation of a 

reasonable and testable working hypothesis, namely 

that TRH may stimulate human hair growth by inhibiting 

ATM/Atr-mediated phosphorylation at essential 

cell-cycle checkpoints: 1) dephosphorylation of Serin- 

P15-p53, which stabilizes the mdm2/p53 complexes 

and inactivates p53, leading to decreased apoptosis in 

the HF; 2) dephosphorylation of Chk1, which activates 

cdc25 and cdc2/cyclin B, leading to G 2/M cell-cycle 

progression and increased cell proliferation in HFs; 

and 3) dephosphorylation of Chk2, which also activates 

cdc25/cyclin B, reduces the phosphorylation of Ser- 

P20-p53, stabilizes, and deactivates p53, which is accompanied 

by increased proliferation and decreased apoptosis 

of the cells in the HF. 

We performed our microarray analysis of TRH-treated 

HFs to further test whether the detected TRH-R tran- 


Figure 8. Effect of TRH on keratin 6 production. TRH (3 and 30 

nM) caused significant down-regulation of keratin 6 protein 

expression in the ORS of microdissected, organ-cultured normal, 

human scalp skin HFs after 6dofadministration. A) Red 

fluorescence staining represents keratin 6 IR in the ORS of the 

HFs. Staining intensity was measured in the reference areas 

marked with rectangles. B) Relative staining analysis. Columns 

represent means se; n 7–10 HFs/group; cumulative results 

of 2 different experiments. *P 0.05 vs. control; unpaired 

2-tailed t test. Scale bars 50 m. 

scripts and proteins corresponded to functionally active 

receptors and to obtain new indications as to potential 

intrafollicular target genes of TRH/TRH-R-mediated signaling. 

The fact that multiple differentially regulated 

candidate genes were detected supports the premise that 

the TRH-Rs are indeed functional. In addition, several 

nonclassical, extrapituitary TRH target genes were identified; 

namely intermediate filaments. That keratin 6 IR in 

situ was down-regulated by TRH, as suggested by our 

microarray data, lends further support to the concept that 

TRH is an important, hitherto unknown, player in keratinocyte 

biology. Interestingly, well-recognized TRH target 

genes such as TSH and prolactin (4, 5) were not 

identified as differentially regulated candidate TRH target 

genes by our microarray analyses. 

Of course, all the differentially regulated candidate 

genes remain to be confirmed by quantitative 

PCR. Furthermore, this should be followed up on the 

protein expression level, and the exact target cells 

need to be identified. However, the available limited 

data suggest that TRH effects many more direct 

and/or indirect target genes in the human HF, than 

would have been suspected from the classical TRH 

literature. Therefore, mainstream TRH research may 

wish to consider exploiting the abundantly available, 

and easily accessible, microdissected, and cultured 

human scalp HFs, as an instructive, and clinically 

relevant, model system for exploring human TRH 

functions beyond the classical HPT axis. 

We thank Dr. Burkhard Poeggeler for help throughout this 

study and gratefully acknowledge his expert advice. We also 

9

thank S. Grammerstorf and G. Scheel for excellent technical 

assistance and Dr. Ewan Langan for editing the manuscript. 

This study was supported in part by a grant from Deutsche 

Forschungsgemeinschaft (DFG) to R. P., as well as by a 

Minerva Research Followship to Y. R. 

REFERENCES 

1. Lechan, R. M., and Hollenberg, A. N. (2003) Thyrotropinreleasing 

hormone (TRH) In: Encyclopedia of Hormones (Henry, 

H. L., and Norman, A. W., eds) pp. 510–524, Elsevier Science, 

New York 

2. Nikrodhanond, A. A., Ortiga-Carvalho, T. M., Shibusawa, N., 

Hashimoto, K., Liao, X. H., Refetoff, S., Yamada, M., Mori, M., 

and Wondisford, F. E. (2006) Dominant role of thyrotropinreleasing 

hormone in the hypothalamic-pituitary-thyroid axis. 

J. Biol. Chem. 281, 5000–5007 

3. Jackson, I. M. D. (1994) Regulation of Thyrotropin Secretion, Raven 

Press, New York 

4. Chiamolera, M. I., and Wondisford, F. E. (2009) TRH and the 

thyroid hormone feedback mechanism. Endocrinology 150, 1091– 

1096 

5. Bowers, C. Y., Fiesen, H. G., Hwang, P., Guyda, H. J., and 

Folkers, K. (1971) Prolactin and thyrotropin release in man by 

synthetic pyroglutamyl-histidyl-prolinamide. Biochem. Biophys. 

Res. Commun. 45, 1033–1041 

6. Wiber, J. F., and Utiger, R. D. (1968) In vitro studies on 

mechanism of action of thyrotropin releasing factor. Proc. Soc. 

Exp. Biol. Med. 127, 488–490 

7. Jackson, I. M., and Reichlin, S. (1977) Brain thyrotrophinreleasing 

hormone is independent of the hypothalamus. Nature 

267, 853–854 

8. Wilber, J. F., and Xu, A. H. (1998) The thyrotropin-releasing 

hormone gene: cloning, characterization, and transcriptional 

regulation in the central nervous system, heart, and testis. 

Thyroid 8, 897–901 

9. Luo, L. G., and Jackson, I. M. (2007) Thyrotropin releasing 

hormone (TRH) may preserve pancreatic islet cell function: 

potential role in the treatment of diabetes mellitus. Acta Biomed. 

Suppl. 1, 216–221 

10. Luo, L., Luo, J. Z., and Jackson, I. M. (2008) Thyrotropinreleasing 

hormone (TRH) reverses hyperglycemia in rat. Biochem. 

Biophys. Res. Commun. 374, 69–73 

11. Socci, R., Kolbeck, R. C., and Mészáros, L. G. (1996) Positive 

ionotropic effect of thyrotropin-releasing hormone on isolated 

rat hearts. Gen. Physiol. Biophys. 15, 309–316 

12. Shambaugh, G., Kubek, M., and Wilber, J. F. (1979) Thyrotropin-releasing 

hormone activity in the human placenta. J. Clin. 

Endocrinol. Metab. 48, 483–486 

13. Bílek, R. (2000) TRH-like peptides in prostate gland and other 

tissues. Physiol. Res. Suppl. 49, 19–26 

14. García, S. I., and Pirola, C. J. (2005) Thyrotropin-releasing 

hormone in cardiovascular pathophysiology. Regul. Pep. 128, 

239–246 

15. Kamath, J., Yarbrough, G. G., Prange, A. J. Jr., and Winokur, A. 

(2009) The thyrotropin-releasing hormone (TRH)-immune system 

homeostatic hypothesis. Pharmacol. Ther. 121, 20–28 

16. Perez Castro, C., Peñalva, R., Páez Pereda, M., Renner, U., Reul, 

J. M., Stalla, G. K., Holsboer, F., and Arzt, E. (1999) Early 

activation of thyrotropin-releasing hormone and prolactin plays 

a critical role during a T cell-dependent immune response. 

Endocrinology 140, 690–697 

17. Slominski, A., Wortsman, J., Kohn, L., Ain, K. B., Venkataraman, 

G. M., Pisarchik, A., Chung, J. H., Giuliani, C., Thornton, M., 

Slugocki, G., and Tobin, D. J. (2002) Expression of hypothalamic-pituitary-thyroid 

axis related genes in the human skin. J. Invest. 

Dermatol. 119, 1449–1455 

18. Ellerhorst, J. A., Naderi, A. A., Johnson, M. K., Pelletier, P., 

Prieto, V. G., Diwan, A. H., Johnson, M. M., Gunn, D. C., Yekell, 

S., and Grimm, E. A. (2004) Expression of thyrotropin-releasing 

hormone by human melanoma and nevi. Clin. Cancer Res. 10, 

5531–5536 

19. Jackson, I. M., and Reichlin, S. (1977) Thyrotropin-releasing 

hormone: abundance in the skin of the frog, Rana pipiens. 

Science 198, 414–415 

20. Bolaffi, J. L., and Jackson, I. M. (1979) Immunohistochemical 

localization of thyrotropin-releasing hormone (TRH) in skin of 

Rana pipiens. Cell Tissue Res. 202, 505–508 

21. Vaudry, H., Chartrel, N., Desrues, L., Galas, L., Kikuyama, S., 

Mor, A., Nicolas, P., and Tonon, M. C. (1999) The pituitary-skin 

connection in amphibians. Reciprocal regulation of melanotrope 

cells and dermal melanocytes. Ann. N. Y. Acad. Sci. 885, 

41–56 

22. Slominski, A., and Wortsman, J. (2000) Neuroendocrinology of 

the skin. Endocr. Rev. 21, 457–487 

23. Slominski, A. T., Botchkarev, V., Choudhry, M., Fazal, N., 

Fechner, K., Furkert, J., Krause, E., Roloff, B., Sayeed, M., Wei, 

E., Zbytek, B., Zipper, J., Wortsman, J., and Paus, R. (1999) 

Cutaneous expression of CRH and CRH-R. Is there a “skin stress 

response system?” Ann. N. Y. Acad. Sci. 885, 287–311 

24. Slominski, A., Wortsman, J., Pisarchik, A., Zbytek, B., Linton, 

E. A., Mazurkiewicz, J. E., and Wei, E. T. (2001) Cutaneous 

expression of corticotropin-releasing hormone (CRH), urocortin, 

and CRH receptors. FASEB J. 15, 1678–1693 

25. Ito, N., Ito, T., Kromminga, A., Bettermann, A., Takigawa, M., 

Kees, F., Straub, R. H., and Paus, R. (2005) Human hair 

follicles display a functional equivalent of the hypothalamicpituitary-adrenal 

axis and synthesize cortisol. FASEB J. 19, 

1332–1334 

26. Bodó, E., Kromminga, A., Bíró, T., Borbíró, I., Gáspár, E., 

Zmijewski, M. A., van Beek, N., Langbein, L., Slominski, A., and 

Paus, R. (2008) Human female hair follicles are a direct, 

nonclassical target for thyroid-stimulating hormone. J. Invest. 

Dermatol. 89, 131–141 

27. Kobayashi, H., Kromminga, A., Dunlop, T. W., Tychsen, B., 

Conrad, F., Suzuki, N., Memezawa, A., Bettermann, A., Aiba, S., 

Carlberg, C., and Paus, R. (2005) A role of melatonin in 

neuroectodermal-mesodermal interactions: the hair follicle synthesizes 

melatonin and expresses functional melatonin receptors. 

FASEB J. 19, 1710–1712 

28. Slominski, A., Wortsman, J., and Tobin, D. J. (2005) The 

cutaneous serotoninergic/melatoninergic system: securing a 

place under the sun. FASEB J. 19, 176–194 

29. Foitzik, K., Krause, K., Conrad, F., Nakamura, M., Funk, W., and 

Paus, R. (2006) Human scalp hair follicles are both a target and 

a source of prolactin, which serves as an autocrine and/or 

paracrine promoter of apoptosis-driven hair follicle regression. 

Am. J. Pathol. 168, 748–756 

30. Bodó, E., Bíró, T., Telek, A., Czifra, G., Griger, Z., Tóth, B. I., 

Mescalchin, A., Ito, T., Bettermann, A., Kovács, L., and Paus, R. 

2005 A hot new twist to hair biology: involvement of vanilloid 

receptor-1 (VR1/TRPV1) signaling in human hair growth control. 

Am. J. Pathol. 166, 985–998 

31. Telek, A., Bíró, T., Bodó, E., Tóth, B. I., Borbíró, I., Kunos, G., 

and Paus, R. (2007) Inhibition of human hair follicle growth by 

endo- and exocannabinoids. FASEB J. 21, 3534–3541 

32. Van Beek, N., Bodó, E., Kromminga, A., Gáspár, E., Meyer, K., 

Zmijewski, M. A., Slominski, A., Wenzel, B. E., and Paus, R. 

(2008) Thyroid hormones directly alter human hair follicle 

functions: anagen prolongation and stimulation of both hair 

matrix keratinocyte proliferation and hair pigmentation. J. Clin. 

Endocrinol. Metab. 93, 4381–4388 

33. Bodó, E., Tobin, D. J., Kamenisch, Y., Bíró, T., Berneburg, M., 

Funk, W., and Paus, R. (2007) Dissecting the impact of chemotherapy 

on the human hair follicle: a pragmatic in vitro assay for 

studying the pathogenesis and potential management of hair 

follicle dystrophy. Am. J. Pathol. 171, 1153–1167 

34. Philpott, M. P., Sanders, D., Westgate, G. E., and Kealey, T. 

(1994) Human hair growth in vitro: a model for the study of 

hair follicle biology. J. Dermatol. Sci. Suppl. 7, S55–S72 

35. Seiberg, M., Marthinuss, J., and Stenn, K. S. (1995) Changes in 

expression of apoptosis-associated genes in skin mark early 

catagen. J. Invest. Dermatol. 104, 78–82 

36. Soma, T., Tsuji, Y., and Hibino, T. (2002) Involvement of 

transforming growth factor-beta2 in catagen induction during 

the human hair cycle. J. Invest. Dermatol. 118, 993–997 

37. Hibino, T., and Nishiyama, T. (2004) Role of TGF-beta2 in the 

human hair cycle. J. Dermatol. Sci. 35, 9–18 

38. Hirao, A., Kong, Y. Y., Matsuoka, S., Wakeham, A., Ruland, J., 

Yoshida, H., Liu, D., Elledge, S. J., and Mak, T. W. (2000) DNA 

damage-induced activation of p53 by the checkpoint kinase 

Chk2. Science 287, 1824–1827 


GÁSPÁR ET AL.

39. Matsuoka, S., Rotman, G., Ogawa, A., Shiloh, Y., Tamai, K., and 

Elledge, S. J. (2000) Ataxia telangiectasia-mutated phosphorylates 

Chk2 in vivo and in vitro. Proc. Natl. Acad. Sci. U. S. A. 97, 10389–10394 

40. Lavin, M. F., and Gueven, N. (2006) The complexity of p53 

stabilization and activation. Cell Death Differ. 13, 941–950 

41. Zhang, S., Ekman, M., Thakur, N., Bu, S., Davoodpour, P., 

Grimsby, S., Tagami, S., Heldin, C. H., and Landström, M. (2006) 

TGFbeta1-induced activation of ATM and p53 mediates apoptosis 

in a Smad7-dependent manner. Cell Cycle 5, 2787–2795 

42. Philpott, M. P., Green, M. R., and Kealey, T. (1990) Human hair 

growth in vitro. J. Cell Sci. 97, 463–471 

43. Kloepper, E. J., Sugawara, K., Al-Nuaimi, Y., Gáspár, E., van 

Beek, N., and Paus, R. (2009) Methods in hair research: how to 

objectively distinguish between anagen and catagen in human 

hair follicle organ culture. [E-pub ahead of print] J. Exp. 

Dermatol. doi:10.1111/j.1600–0625.2009.00939. 

44. Zhang, Y. E. (2009) Non-Smad pathways in TGF-beta signaling. 

Cell Res. 19, 128–139 

45. Castedo, M., Perfettini, J. L., Roumier, T., Yakushijin, K., Horne, 

D., Medema, R., and Kroemer, G. (2004) The cell cycle checkpoint 

kinase Chk2 is a negative regulator of mitotic catastrophe. 

Oncogene 23, 4353–4361 

46. Ito, N., Ito, T., Betterman, A., and Paus, R. (2004) The human 

hair bulb is a source and target of CRH. J. Invest. Dermatol. 122, 

235–237 

47. Slominski, A., Wortsman, J., Tuckey, R. C., and Paus, R. (2007) 

Differential expression of HPA axis homolog in the skin. Mol. 

Cell. Endocrinol. 265–266, 143–149 


48. Stenn, K. S., and Paus, R. (2001) Controls of hair follicle cycling. 

Physiol. Rev. 81, 449–494 

49. Paus, R., and Foitzik, K. (2000) In search of the “hair cycle 

clock”: a guided tour. Differentiation 72, 489–511 

50. Schneider, M. R., Schmidt-Ullrich, R., and Paus, R. (2009) 

The hair follicle as a dynamic miniorgan. Curr. Biol. 19, 

R132–142 

51. Botchkarev, V. A. (2003) Bone morphogenetic proteins and 

their antagonists in skin and hair follicle biology. J. Invest. 

Dermatol. 120, 36–47 

52. Foitzik, K., Lindner, G., Mueller-Roever, S., Maurer, M., Botchkareva, 

N., Botchkarev, V., Handjiski, B., Metz, M., Hibino, T., 

Soma, T., Dotto, G. P., and Paus, R. (2000) Control of murine 

hair follicle regression (catagen) by TGF-beta1 in vivo. FASEB J. 

14, 752–760 

53. Pommier, Y., Sordet, O., Rao, V. A., Zhang, H., and Kohn, K. W. 

(2005) Targeting chk2 kinase: molecular interaction maps and 

therapeutic rationale. Curr. Pharm. Des. 11, 2855–2872 

54. Lavin, M. F. (2008) Ataxia-telangiectasia: from a rare disorder 

to a paradigm for cell signalling and cancer. Nat. Rev. Mol. 

Cell Biol. 9, 759–769 [Erratum in: Nat. Rev. Mol. Cell Biol. 2008 

9(12)] 

55. Karlsson-Rosenthal, C., and Millar, J. B. (2006) Cdc25: mechanisms 

of checkpoint inhibition and recovery. Trends Cell Biol. 16, 

285–292 

Received for publication April 30, 2009. 

Accepted for publication September 10, 2009. 

11

Thyrotropin releasing hormone (TRH) - The FASEB Journal

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?