Investigating the role of the JAK/STAT and MAPK ... - UCL Discovery

More documents

Recommendations

Info

Yasukawa H, Misawa H, Sakamoto H, Masuhara M, Sasaki A, Wakioka T, Ohtsuka S, Imaizumi T, Matsuda T, Ihle JN, Yoshimura A: The JAK-binding protein JAB inhibits Janus tyrosine kinase activity through binding in the activation loop. EMBO J. 1999, 18:1309-20. Yasukawa H, Ohishi M, Mori H, Murakami M, Chinen T, Aki D, Hanada T, Takeda K, Akira S, Hoshijima M, Hirano T, Chien KR, Yoshimura A: IL-6 induces an anti-inflammatory response in the absence of SOCS3 in macrophages. Nat.Immunol. 2003, 4:551-556. Yellon DM, Hausenloy DJ: Myocardial reperfusion injury. Engl J Med. 2007, 357:1121-35. Yi AK, Yoon JG, Yeo SJ, Hong SC, English BK, Krieg AM: Role of mitogen-activated protein kinases in CpG DNA-mediated IL-10 and IL-12 production: central role of extracellular signalregulated kinase in the negative feedback loop of the CpG DNA-mediated Th1 response. J Immunol. 2002, 168:4711-4720. Yi AK, Yoon JG, Yeo SJ, Hong SC, English BK, Krieg AM: Role of mitogen-activated protein kinases in CpG DNA-mediated IL-10 and IL-12 production: central role of extracellular signalregulated kinase in the negative feedback loop of the CpG DNA-mediated Th1 response. J Immunol. 2002, 168:4711-4720. Yokogami K, Wakisaka S, Avruch J, Reeves SA. Serine phosphorylation and maximal activation of STAT3 during CNTF signaling is mediated by the rapamycin target mTOR. Curr Biol. 2000;10:47-50. Yoshimura A, Naka T, Kubo M: SOCS proteins, cytokine signalling and immune regulation. Nat Rev Immunol. 2007, 7:454-65. CL, R, SJ: Constitutive activation of the Janus kinase-STAT pathway in T lymphoma overexpressing the Lck protein tyrosine kinase. Immunol. 1997, 159:5206-10. CL, DJ, GS, AC, -Su C, J, R: Enhanced DNA-binding activity of a Stat3-related protein in cells transformed by the Src oncoprotein. . 1995, 269:81-3. Yue TL, Wang C, Gu JL, Ma XL, Kumar S, Lee JC, Feuerstein GZ, Thomas H, Maleeff B, Ohlstein EH: Inhibition of extracellular signal-regulated kinase enhances Ischemia/Reoxygenation-induced apoptosis in cultured cardiac myocytes and exaggerates reperfusion injury in isolated perfused heart.Circ Res. 2000, 86:692-9. Yusuf S, Hawken S, Ounpuu S, Dans T, Avezum A, Lanas F, McQueen M, Budaj A, Pais P, Varigos J, Lisheng L; INTERHEART Study Investigators: Effect of potentially modifiable risk factors associated with myocardial infarction in 52 countries (the INTERHEART study): casecontrol study. . 2004, 364:937-52. Zarubin T, Han J: Activation and signaling of the p38 MAP kinase pathway. Cell Res. 2005, 15:11-18. Zha J, Harada H, Yang E, Jockel J, Korsmeyer SJ: Serine phosphorylation of death agonist BAD in response to survival factor results in binding to 14-3-3 not BCL-X(L). Cell. 1996, 87:619-28. 310
Zhang J, Yang J, Roy SK, Tininini S, Hu J, Bromberg JF, Poli V, Stark GR, Kalvakolanu DV: The cell death regulator GRIM-19 is an inhibitor of signal transducer and activator of transcription 3.Proc Natl Acad Sci U S A. 2003, 100:9342-7. JG, Farley A, Nicholson SE, Willson TA, Zugaro LM, Simpson RJ, Moritz RL, Cary D, Richardson R, Hausmann G, Kile BJ, Kent SB, Alexander WS, Metcalf D, Hilton DJ, Nicola NA, Baca M. The conserved SOCS box motif in suppressors of cytokine signaling binds to elongins B and C and may couple bound proteins to proteasomal degradation. Proc Natl Acad Sci U S A. 1999, 96:2071-6 JG, Metcalf D, Rakar S, Asimakis M, Greenhalgh CJ, Willson TA, Starr R, Nicholson SE, Carter W, Alexander WS, Hilton DJ, Nicola NA. The SOCS box of suppressor of cytokine signaling-1 is important for inhibition of cytokine action in vivo: Proc Natl Acad Sci U S A. 2001, 98:13261-5. Zhang X, Guo A, Yu J, Possemato A, Chen Y, Zheng W, Polakiewicz RD, Kinzler KW, Vogelstein B, Velculescu VE, Wang ZJ: Identification of STAT3 as a substrate of receptor protein tyrosine phosphatase T. Proc Natl Acad Sci U S A. 2007, 104:4060-4. Zhang X, Shan P, Alam J, Fu XY, Lee PJ: Carbon monoxide differentially modulates STAT1 and STAT3 and inhibits apoptosis via a phosphatidylinositol 3-kinase/Akt and p38 kinase-dependent STAT3 pathway during anoxia-reoxygenation injury. J Biol Chem. 2005, 280:8714-8721. Zhang Y, Blattman JN, Kennedy NJ, Duong J, Nguyen T, Wang Y, Davis RJ, Greenberg PD, Flavell RA, Dong C: Regulation of innate and adaptive immune responses by MAP kinase phosphatase 5. Nature 2004, 430:793-797. Zhang Y, Cho YY, Petersen BL et al. Ataxia telangiectasia mutated proteins, MAPKs, and RSK2 are involved in the phosphorylation of STAT3. J Biol Chem. 2003;278:12650-12659. Zhang Y, Wada J, Hashimoto I, Eguchi J, Yasuhara A, Kanwar YS, Shikata K, Makino H: Therapeutic approach for diabetic nephropathy using gene delivery of translocase of inner mitochondrial membrane 44 by reducing mitochondrial superoxide production. Am Soc Nephrol. 2006, 17:1090-101. Zhao Q, Shepherd EG, Manson ME, Nelin LD, Sorokin A, Liu Y: The role of mitogen-activated protein kinase phosphatase-1 in the response of alveolar macrophages to lipopolysaccharide: attenuation of proinflammatory cytokine biosynthesis via feedback control of p38. J Biol Chem. 2005, 280:8101-8108. Zhao Q, Wang X, Nelin LD, Yao Y, Matta R, Manson ME, Baliga RS, Meng X, Smith CV, Bauer JA, Chang CH, Liu Y: MAP kinase phosphatase 1 controls innate immune responses and suppresses endotoxic shock. J Exp.Med 2006, 203:131-140. Zhao Q, Wang X, Nelin LD, Yao Y, Matta R, Manson ME, Baliga RS, Meng X, Smith CV, Bauer JA, Chang CH, Liu Y. MAP kinase phosphatase 1 controls innate immune responses and suppresses endotoxic shock. J Exp Med, 2006, 203:131-40. Zhao ZQ: Oxidative stress-elicited myocardial apoptosis during reperfusion. Curr.Opin.Pharmacol 2004, 4:159-165. 311
Page 1 and 2:
Investigating the role of the JAK/S
Page 3 and 4:
Abstract The signal transducer and
Page 5 and 6:
Acknowledgements First and foremost
Page 7 and 8:
Table of Contents Abstract 3 Dedica
Page 9 and 10:
2.4.3 Hypoxia/Reoxygenation of Neon
Page 11 and 12:
Chapter 6: Regulation of the MAPK P
Page 13 and 14:
Figure 3.11 - STAT3 mRNA expression
Page 15 and 16:
Figure 6.6 - Prolonged MAPK activit
Page 17 and 18:
Abbreviations 7-AAD 7-amino-actinom
Page 19 and 20:
SOCS Supressor of cytokine signalli
Page 21 and 22:
1.1 Myocardial Infarction Coronary
Page 23 and 24:
Reperfusion induced arrhythmias are
Page 25 and 26:
eceptors such as Fas or TNFR1; thes
Page 27 and 28:
1.2.3 Bcl-2 Proteins The intrinsic
Page 29 and 30:
addition to caspase inhibition. XIA
Page 31 and 32:
staurosporine induced cell death. L
Page 33 and 34:
stress thus occurs when excess ROS
Page 35 and 36:
1.3 The JAK/STAT Pathway 1.3.1 JAK/
Page 37 and 38:
Receptor SOCS3 Cytokines/Growth Fac
Page 39 and 40:
Dimerization of STATs appears to be
Page 41 and 42:
Fig 1.7. STAT import/export cycle.
Page 43 and 44:
Kinase Stimulus Cell Type Reference
Page 45 and 46:
domain determines other target sele
Page 47 and 48:
1.3.8 Inhibition of STAT DNA Bindin
Page 49 and 50:
(BRM/SWI2-related gene 1) the ATPas
Page 51 and 52:
deficient mammary glands (Abell et
Page 53 and 54:
and COX-2 induction. Adenoviral med
Page 55 and 56:
compensatory hypertrophy, mediated
Page 57 and 58:
1.5.3 Urocortins and Ischaemia As w
Page 59 and 60:
Ott et al. recently showed that the
Page 61 and 62:
1.6.4 The SAM Complex The outer mem
Page 63 and 64:
etain H2AX activity for longer than
Page 65 and 66:
esulting in an ATM-MDC1-H2AX positi
Page 67 and 68:
1.8.3 TLR Adaptors TLR signalling i
Page 69 and 70:
1.9 The Adaptive Immune System 1.9.
Page 71 and 72:
Fig 1.14. Outline of T-helper cell
Page 73 and 74:
1.10.3 IL-12 IL-12 is a potent pro-
Page 75 and 76:
1.11.2 p38 MAPK p38 is induced by a
Page 77 and 78:
negative JNK overcomes LPS induced
Page 79 and 80:
1.12 Inflammatory Diseases 1.12.1 M
Page 81 and 82:
10 producing Th2 response appears t
Page 83 and 84:
2.1 Reagents The following TLR liga
Page 85 and 86:
2.3.2 Endotoxic shock Toxic shock o
Page 87 and 88:
2.4 Cell Culture 2.4.1 Freezing and
Page 89 and 90:
emove red blood cells. CD4 and CD8
Page 91 and 92:
2.5.2 ELISA ELISA was used as a met
Page 93 and 94:
mM NaCl, 1 mM EDTA, 1 mM EGTA and p
Page 95 and 96:
To measure gene promoter regulation
Page 97 and 98:
uffer (200 mM MES buffer, 2 M NaCl,
Page 99 and 100:
was added (10 mM RbCl, 50 mM , 100
Page 101 and 102:
2.9 Cell Death Measurements 2.9.1 T
Page 103 and 104:
Chapter 3: Investigating the Role o
Page 105 and 106:
3.2 Overexpression of STAT3 Protect
Page 107 and 108:
A B % Cell Death 50 40 30 20 10 0 G
Page 109 and 110:
cell death were examined. Using thi
Page 111 and 112:
A B 7AAD GFP %Cell Death 100 75 50
Page 113 and 114:
3.4 Deletion of STAT3 Sensitises Ce
Page 115 and 116:
Next, wild type and STAT3 knockout
Page 117 and 118:
3.5 STAT3 becomes Phosphorylated an
Page 119 and 120:
While STAT3 is phosphorylated at bo
Page 121 and 122:
Two STAT3 target genes, SOCS3 and c
Page 123 and 124:
A STAT3 B C Fold Change Fold Change
Page 125 and 126:
3.6 Oxidative stress induces STAT3
Page 127 and 128:
3. 7 Activation of STAT1 and STAT3
Page 129 and 130:
Next, the extent of DNA damage and
Page 131 and 132:
A B C pSTAT3 Y705 pSTAT3 S727 Total
Page 133 and 134:
3.9 I/R injury in the brain induces
Page 135 and 136:
3.10 Reperfusion Induced Myocardial
Page 137 and 138:
Tempol infusion before the onset of
Page 139 and 140:
In order to examine the tissue dist
Page 141 and 142:
Fig 3.22. Effect of I/R and drug in
Page 143 and 144:
3.12 Discussion STAT transcription
Page 145 and 146:
may be involved. JAK2 activity has
Page 147 and 148:
studies have begun to address the r
Page 149 and 150:
4.1 Aims In the previous chapter, t
Page 151 and 152:
all 15 arrays to be included in dow
Page 153 and 154:
C D A Log intensity Raw Intensity B
Page 155 and 156:
A B C I/R Ucn1 Probe Sets Annotated
Page 157 and 158:
Table 4.2. The 20 genes with the hi
Page 159 and 160:
A B 209 245 150 111 133 30 44 41 30
Page 161 and 162:
A B 161
Page 163 and 164:
E Activation Inhibition Translocati
Page 165 and 166:
Number of Genes 20 15 10 5 0 No Ide
Page 167 and 168:
4.6 Differential Expression mediate
Page 169 and 170:
Number of Genes Number of Genes 20
Page 171 and 172:
Ucn1 Ucn2 Fig 4.10 Network analysis
Page 173 and 174:
A B D qPCR Expression (log2) qPCR E
Page 175 and 176:
Table 4.5. Genes differentially reg
Page 177 and 178:
A C Fold Change Fold Change 17.5 15
Page 179 and 180:
A C Fold Change Fold Change 30 20 1
Page 181 and 182:
order to examine if neonatal cardia
Page 183 and 184:
4.10 Differential Regulation of MAP
Page 185 and 186:
4.11 Uracil Metabolism is Altered b
Page 187 and 188:
4.12 Reduced Expression of Mitochon
Page 189 and 190:
Gene Gene Title FC p value Nqo2 NAD
Page 191 and 192:
ATP thus allowing protons to be pum
Page 193 and 194:
A Fold Change 1.00 0.75 0.50 0.25 0
Page 195 and 196:
Fig 4.19. Tempol and Ucn1 upregulat
Page 197 and 198:
A B Fold Change [MDA] µmol/g prote
Page 199 and 200:
exogenously added IL-17 could induc
Page 201 and 202:
The subunits that comprise the mito
Page 203 and 204:
Taken together, these observations
Page 205 and 206:
mediator of Ucn1 and Ucn2 cardiopro
Page 207 and 208:
5.1 Aims In chapter 3 it was shown
Page 209 and 210:
To show that reduced DNA repair in
Page 211 and 212:
A pATM S1981 GAPDH C H2AX GAPDH STA
Page 213 and 214:
5.4. STAT3 Facilitates DNA Damage M
Page 215 and 216:
The STAT3 dependent regulation of M
Page 217 and 218:
5.5 Discussion Efficient repair of
Page 219 and 220:
(Cimprich and Cortez, 2008). Chk1 c
Page 221 and 222:
Chapter 6: Regulation of the MAPK P
Page 223 and 224:
700 bp 450 bp +/+ -/- +/- Fig 6.1 M
Page 225 and 226:
The pathological consequences of en
Page 227 and 228:
6.3 MKP-1 Negatively Regulates p38
Page 229 and 230:
A B AP-1 AP-1 Fold Change 1500 1000
Page 231 and 232:
A B C MKP-1 Actin D MKP-1 Actin Act
Page 233 and 234:
A B MKP-1 Actin Fig 6.9. MKP-1 upre
Page 235 and 236:
A B IL-10 (pg/ml) 700 600 500 400 3
Page 237 and 238:
B A Fold Change 1000 750 500 250 0
Page 239 and 240:
6.6 Dynamic Regulation of TNF- is M
Page 241 and 242:
levels seen by 5 hr LPS challenge i
Page 243 and 244:
Previous studies have shown that IL
Page 245 and 246:
6.7 MKP-1 Activity Promotes IL-12 E
Page 247 and 248:
B A Fold Change 6000 4000 2000 0 +/
Page 249 and 250:
A B IL-12p70 pg/ml IL-12p70 500 +/+
Page 251 and 252:
% Weight 105 100 95 90 DSS 0 5 10 1
Page 253 and 254:
6.10 Loss of MKP-1 does not Effect
Page 255 and 256:
Taken together, these results demon
Page 257 and 258:
Since loss of MKP-1 does not appear
Page 259 and 260: mice leads increased NO levels (Zha
Page 261 and 262: Fig 6.26. Model of MKP-1 mediated t
Page 263 and 264: of DSS induced colitis. Other possi
Page 265 and 266: wild type mice but failed to do so
Page 267 and 268: STAT3 was found to be active during
Page 269 and 270: Both Ucn1 and Ucn2 were found to lo
Page 271 and 272: cytokine production (IL-2, IL-4, IF
Page 273 and 274: (A) Table of Antibodies Appendix 1
Page 275 and 276: IL-6_F ACTGCCTTCCCTACTTCACA IL-6_R
Page 277 and 278: Alexander WS, Starr R, Fenner JE, S
Page 279 and 280: Bevan MJ: Helping the CD8(+) T-cell
Page 281 and 282: Chen P, Li J, Barnes J, Kokkonen GC
Page 283 and 284: Deveraux QL, Takahashi R, Salvesen
Page 285 and 286: Garcia R, Bowman TL, Niu G, Yu H, M
Page 287 and 288: Hirota H, Izumi M, Hamaguchi T, Sug
Page 289 and 290: Kassel O, Sancono A, Kratzschmar J,
Page 291 and 292: Kuwata H, Watanabe Y, Miyoshi H, Ya
Page 293 and 294: Lufei C, Ma J, Huang G, Zhang T, No
Page 295 and 296: Minners J, McLeod CJ, Sack MN: Mito
Page 297 and 298: KL, JA, TL, R, TE: Activation of ST
Page 299 and 300: F, Y, D, C, SB, PT, RJ, Monte F. Pr
Page 301 and 302: Roucou X, Montessuit S, Antonsson B
Page 303 and 304: Shen Y, Schlessinger K, Zhu X, Meff
Page 305 and 306: Szabo SJ, Sullivan BM, Peng SL, Gli
Page 307 and 308: Valledor AF, Xaus J, Comalada M, So
Page 309: Yamamoto M, Sato S, Hemmi H, Hoshin
show all

Investigating the role of the JAK/STAT and MAPK ... - UCL Discovery

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?