Detection of Salmonella by polymerase chain reaction - Biologia ...

Biologia, Bratislava, 56/6: 611—616, 2001
Detection of Salmonella by polymerase chain reaction
targeted to fimC gene
Hana Drahovská 1 *, Ján Turňa 1 , Ľubica Piknová 2 , Tomáš Kuchta 2 ,
Ildikó Szitásová 1 ,AlenaŠkarková 3 & Milan Sásik 3
1
Department of Molecular Biology, Faculty of Natural Sciences, Comenius University, Mlynská dolina
B-2, SK-84215 Bratislava, Slovakia; tel.: ++ 421 2 60296639, e-mail: Drahovska@fns.uniba.sk
2
Department of Microbiology and Chemistry, Food Research Institute, Priemyselná 4, SK-82475,
Bratislava, Slovakia
3
State Veterinary Institute, Botanická 15, SK-84252 Bratislava, Slovakia
Introduction
Salmonellae, members of the family Enterobacteriaceae,
are facultative anaerobic Gram-negative
bacteria. All species and strains of this genus are
presumed to be pathogenic for man. Salmonel-
* Corresponding author
Drahovská, H., Turòa, J., Piknová, Ľ., Kuchta, T., Szitasová, I.,
©karková, A.&Sásik, M., Detection of Salmonella by polymerase chain
reaction targeted to fimC gene. Biologia, Bratislava, 56: 611—616, 2001;
ISSN 0006-3088 (Biologia). ISSN 1335-6399 (Biologia. Section Cellular and
Molecular Biology).
A new rapid polymerase chain reaction-based detection system for Salmonella
was developed. Nucleotide sequences of three fimbrial genes (from S. typhimurium,
S. typhi and E. coli), accessible in GeneBank, were compared
and primers S212/S500 targeted to fimC gene of Salmonella were designed.
The sensitivity and specificity of the PCR detection using these primers were
tested on a panel of Salmonella and nonSalmonella strains. With all of 53
Salmonella serotypes tested, a product of 289 bp was amplified, while no
product was amplified with 25 non-Salmonella bacterial species. An internal
standard, which produces a PCR product of 748 bp with the primers
S212/S500, was prepared and used for monitoring the amplification to avoid
potential false negative results caused by the inhibition of PCR. When 35 cycles
of amplification were applied, a detection limit of 100 CFU per reaction
sample was achieved, the value not being affected by the presence of the internal
standard. The developed rapid detection system produced >90% identical
results as the standard method with the analysis of naturally contaminated
food samples enriched by a one-step non-selective (total analysis duration, 20
h) or a three-step selective (total analysis duration, 44 h) enrichment protocol.
Key words: Salmonella, PCR, food.
loses are particularly severe in infants, elderly and
immunocompromised patients (Tieten & Fung,
1995).
Various foods, in particular poultry and other
meat products, eggs and dairy products, can serve
as vehicles for Salmonella transmission. The in-
611

crease in salmonellosis in industrialized countries
over the past 35 years has accompanied the centralisation
of food production and processing, despite
of improvements in epidemiological and microbiological
methods. Conventional methods of
Salmonella detection rely on enrichment in nonselective
and selective broths, followed by differential
agar media and serological confirmation.
These methods offer a satisfactory detection limit
and specificity, but require at least 4 or 6 days
to obtain negative or positive results, respectively
(ISO 6579, 1993). There are consequently
efforts to develop new, faster methods. Detection
of Salmonella byPCR,basedontheenzymatic
amplification of a pre-selected region of DNA, is
one such method reducing the time requirement
for the analysis without a negative effect on the
analytical parameters.
Several PCR-based methods for the detection
of Salmonella have been described. These were
based on the identification of various genes, such
as pathogenic determinants invA (Stone et al.,
1994; Burkhalter et al., 1995), spvA (Lampel
et al., 1996), iroB (Baumler et al., 1997), fimbrial
genes fimA (Cohen et al., 1996) and agfA (Doran
et al., 1996), genes encoding for rRNA (Iida
et al., 1993) or Salmonella-specific DNA sequences
with an unknown function (Aabo et al., 1993).
In this work, primers were designed targeted
to the fimC gene, which encodes a chaperone involved
in the synthesis of type 1 fimbriae. These
are proteinaceous filaments localised on the surface
of the bacterial cell and are responsible for
binding to specific receptors on the epithelial cell
during infection. The fim operon is commonly
present in members of the entire family Enterobacteriaceae,
including all Salmonella serotypes (Low
et al., 1996).
An important feature of PCR-based methods
for routine detection of pathogens should be high
reproducibility and reliability. These can be improved
by the application of an internal standard,
which facilitates monitoring the amplification and
helps to recognize false negative results caused by
the inhibition of PCR. For the primers designed,
a mimic internal standard (Lambertz et al., 1998)
was here constructed and its use optimized.
To achieve satisfactory analytical parameters,
food samples have to be appropriately processed
prior to the detection of Salmonella by
PCR. Enrichment in a single non-selective medium
(Manzano et al., 1998), enrichment in a nonselective
medium followed by two parallel selective
media (Cohen et al., 1996), and a successive enrichment
in three media (Aabo et al., 1995) have
612
been reported to be used for this purpose. Another
possibility is the use of a combination of nonselective
and selective enrichment with immunomagnetic
separation (Rijpens et al., 1999; Trkov
et al., 1999) In this work, two enrichment protocols
followed by PCR targeted to the fimC gene
were compared with the standard method for the
detection of Salmonella in selected naturally contaminated
foods.
Material and methods
Bacterial strains were from the collection of Food Research
Institute, Bratislava, or they were isolates from
food by the State Veterinary Institute, Bratislava. Bacteria
were cultured on solid or liquid Luria-Bertani
(LB) media (Maniatis et al., 1982). For the determination
of the detection limit, overnight cultures were
serially diluted in LB broth and numbers of viable bacteria
were determined by plating on LB agar.
DNA preparation
Chromosomal DNA was prepared according to Flamm
et al. (1984). Crude lysates were prepared from 1 mL of
the culture grown in the liquid medium, or suspending
one loopful of the culture grown on the solid medium.
Bacterial cells were suspended in 1 mL of 0.8% NaCl,
centrifuged at 8000 g for 10 min, and the pellet was
resuspended in 1% Triton X-100. The suspension was
boiled for 15 min and, after centrifugation the supernatant
was used in PCR.
PCR
Avolumeof2µL of the DNA template solution was
added to 23 µL of the reaction mixture containing
10 mmol/L Tris-HCl, pH 8.8, 50 mmol/L KCl, 1.5
mmol/L MgCl2, 0.05% Tween 20, 200 µmol/L each
dNTP, 250 nmol/L each primer, 1 U Taq DNA polymerase.
Amplification was carried out in a T1 thermal
cycler (Biometra, Göttingen, Germany) with a temperature
programme consisting of the initial denaturation
(1 min at 94 ◦ C), 35 amplification cycles (30 s at 90 ◦ C,
30 s at 54 C, 60 s at 72 ◦ C), and the final extension (8
min at 72 ◦ C). A volume of 10 µL of the PCR product
was analysed by electrophoresis in a 1.5% agarose gel
(Maniatis et al., 1982).
Internal standard preparation
The internal standard was produced by the method described
previously (Drahovská et al., 1999). Briefly,
PCR with E. coli chromosomal DNA as a template
was made with the annealing temperature lowered to
40 ◦ C. From several non-specific products, a fragment
of about 800 bp was selected, extracted from the gel,
and cloned to the pCR2.1 vector (Invitrogen).
Sequencing of the PCR products
Sequencing was performed by an automatic DNA sequencer
(Vistra, Amersham) with individual products
cloned to the pCR2.1 vector.

Table 1. Primers used in this study.
primer orientation position 1 sequence
S5 forward 224–262 AGCGAGCCCAAAAGTGAAA
S6 reverse 665–646 GTCAATGCGCCGTAATCATT
S212 forward 212–231 AAACGTTTATCGTTACGCCG
S500 reverse 450–481 ATCTTGAGATGGTTGCCGAC
1 In the fimC gene of S. typhimurium.
Table 2. Specificity of the primer combinations. Reaction conditions were as stated in materials and methods,
annealing temperature was 50 ◦ C.
S212/S500 S5/S6 S212/S6 S5/S500
Escherichia coli – – – –
Enterobacter cloacae – – – –
Citrobacter braakii – + – –
Citrobacter diversus – + – –
Citrobacter freundii – + – –
Salmonella typhimurium + + + +
Salmonella arisonae + – + –
Salmonella detection in foods
Food products were purchased from local retail stores.
A method according to ISO 6579 (1993) was used as
the reference one; all media were from Merck (Darmstadt,
Germany). Samples (25 g) were homogenized in
the buffered peptone water (BPW; 225 mL) and incubated
at 37 ◦ C for 16 h. A volume of 0.1 mL of the
culture was inoculated to 9.9 mL of the Rappaport-
Vassiliadis medium, another 1 mL to 9 mL of the
selenite-cystine broth, and the cultures were incubated
at 41 ◦ C and at 35 ◦ C, respectively, for 7 h. Subsequently,
aliquots of 1 mL were withdrawn from the
selective media and subcultured in LB broth at 37 ◦ C
for 16-18 h. Volumes of 1 mL of the culture in BPW,
or of the two cultures in LB, were used for the lysis
and PCR. For the three-step enrichment, samples
were considered positive when at least one of the two
LB cultures gave rise to a positive result.
Results
Design of the primers
Three fimbrial sequences accessible in the database
were compared: fimC of S. typhimurium (L19338),
fimC of S. typhi (X74602), and sfmC of E. coli
(AE000159). The last sequence was found to be of
a higher homology with fimC of Salmonella than
fimC of E. coli. Based on this comparison, four
primers were designed (Tab. 1). Primers S212 and
S500 were selected to be Salmonella-specific, while
primers S5 and S6 were conservative for all the
three genes considered.
Evaluation of the primers
Specificity of the primers was tested on a number
of bacterial strains (Tab. 2). The primer combination
S212/S500 was specific for the genus
Salmonella in a broad interval of annealing temperatures
(46–58 ◦ C). The primer combination
S5/S6 amplified a defined DNA fragment at a
medium annealing temperature (50 ◦ C) not only
from Salmonella spp., but from Citrobacter spp.
as well. When the annealing temperature was increased
to 58 ◦ C, the stringency improved and amplification
took place only for Salmonella spp. On
the other hand, S. arizonae was not detected with
this primer combination at given reaction conditions.
Based on these results, the primer combination
S212/S500 was chosen for further work.
Sequencing the PCR products
Identity of the PCR product was confirmed by
sequencing. The sequence of the PCR product
from S. typhimurium 34 was identical to that in
the GeneBank (L19338), the sequence of the PCR
product from S. enteritidis 173 differed only in one
nucleotide (data not shown).
Specificity of Salmonella detection
The specificity of the primer pair S212/S500 was
further tested on a panel of Salmonella and non-
Salmonella strains. All of 53 Salmonella serotypes
tested (95 strains) gave a positive signal in the
PCR analysis. No product was amplified with
613

Table 3. Specificity of Salmonella detection with primers S212/S500.
Salmonella serotype No. of strains Result Non-salmonella species No. of strains Result
S. adelaide 2 + Bacillus subtilis 1 –
S. agona 1 + Citrobacter braakii 3 –
S. anatum 1 + Citrobacter diversus 1 –
S. arizonae 2 + Citrobacter freundii 2 –
S. bareilly 1 + Citrobacter youngae 1 –
S. brandenburg 2 + Citrobacter sp. 1 –
S. bredeney 2 + Escherichia coli 6 –
S. chester 1 + Enterobacter aglomerans 1 –
S. choleraesuis 6 + Enterobacter aerogenes 1 –
S. derby 2 + Enterobacter cloacae 3 –
S. enteritidis 20 + Enterobacter omnigenus 1 –
S. falkensee 1 + Enterococcus spp. 1 –
S. florida 1 + Hafnia sp. 1 –
S. gallinarium – pullorum 2 + Klebsiella pneumoniae 3 –
S. gold-coast 1 + Klebsiella oxytoca 1 –
S. hadar 1 + Listeria monocytogenes 1 –
S. hamburg 1 + Listeria innocua 1 –
S. heidelberg 1 + Proteus spp. 1 –
S. infantis 5 + Pseudomonas aeruginosa 1 –
S. issangii 4 + Pseudomonas sp. 1 –
S. kiambu 1 + Serratia sp. 1 –
S. london 1 + Shigella sp. 1 –
S. luidelberg 1 + Staphylococcus sp. 1 –
S. manhattan 1 + Streptococcus sp. 1 –
S. montevideo 2 + Yersinia kristensenii 1 –
S. newport 1 +
S. ohio 3 +
S. panama 1 +
S. pikine 1 +
S. reading 1 +
S. rissen 1 +
S. saint-paul 2 +
S. senftenberg 1 +
S. schwarzengrund 2 +
S. takoradi 1 +
S. tejas 1 +
S. tennessee 1 +
S. thompson 1 +
S. typhimurium 9 +
S. uganda 1 +
S. virchow 4 +
25 non-Salmonella bacterial species (40 strains;
Tab. 3).
Preparation of the internal standard
To monitor the amplification using primers S212/
S500, a mimic internal standard was prepared. Its
use in PCR lead to the amplification of a product
of 748 bp. The product was sequenced and
its sequence was found to be identical with the
E. coli chromosomal sequence, accession number
D90823, from the nucleotide 131 to 855. The concentration
of the internal standard in the reaction
614
mixture was optimized to 10 pg (10 5 copies) of
the plasmid DNA. This concentration lead to a
reproducible amplification if no Salmonella DNA
was present while not affecting the sensitivity of
Salmonella detection.
Sensitivity of PCR
was determined with a purified DNA and with
crude bacterial lysates. The detection limit was
determined to be approx. 0.25 pg of the chromosomal
DNA per PCR, which was equivalent to 100
CFU of Salmonella. This value was not affected

in the presence of 10 6 CFU of E. coli (data not
shown).
Detection of Salmonella in foods
The performance of the developed detection system
was evaluated by the analysis of naturally
contaminated food samples. Two enrichment
protocols were used prior to PCR: a one-step
overnight non-selective enrichment in BPW, and a
three-step selective enrichment comprising a preenrichment
in BPW, two parallel selective enrichments
in Rappaport-Vassiliadis and selenitecystine
media, respectively, and post-enrichment
in LB broth. Of the 18 food samples tested, 9 were
found positive by the ISO method. Identical results
were obtained by the PCR detection coupled
to an overnight enrichment in BPW, but one sample
of chicken meat was found false negative and
two samples of minced meat were found slightly
false positive. PCR after a three-step enrichment
produced identical results as the reference method
(Tab. 4).
Table 4. Detection of Salmonella in foods. Value in
brackets means a slightly positive result (faint band in
the electrophoresis).
No. of
Sample type tested Positive by
samples
PCR-BPW PCR-LB ISO 6579
egg melange 5 2 2 2
minced meat 8 (2) 0 0
chicken meat 2 1 2 2
chicken liver 1 1 1 1
turkey meat 2 2 2 2
Discussion
The aim of the present study was to develop
a rapid PCR-based system for the detection of
Salmonella in foods. We designed original primers
S212/S500 targeted to the fimC gene, which
proved to be Salmonella-specific with no crossreactivity
to the other bacterial species tested.
These primers were also successful in amplifying
a specific DNA product from S. gallinariumpullorum
although type1 fimbriae are not expressed
in this serotype; this result is in agreement
with the observation by Cohen et al.
(1996).
Sensitivity of the developed PCR, 100 CFU
per reaction using a template obtained by a simple
bacterial lysis was similar to that of other comparable
PCR methods recommended for routine
laboratories (Rijpens et al., 1999; Trkov et al.,
1999). Although this might be improved by increasing
the number of amplification cycles, because
of the accompanying danger of false positive
results caused by contamination, a combination of
less amplification cycles with an appropriate enrichment
prior to PCR is preferred.
With PCR-based detection methods, a problem
of false negative results caused by inhibition
may occur. Various components of food, enrichment
media or DNA extraction solutions have
been shown to inhibit PCR (Rossen et al., 1992).
False negative results are more dangerous than the
false positive ones because they may lead to contaminated
samples being judged as safe. To avoid
false negative results, we have prepared an internal
standard, which facilitates monitoring the amplification.
The application of this internal standard
proved to be useful since, with the analysis of some
food samples, inhibition did take place. By repeating
PCR for these samples, eventual false negative
results were avoided.
When testing the complete detection system
with naturally contaminated foods, a good agreement
with the results of the standard method was
observed. However, some discrepancies appeared
at a one-step enrichment used prior to PCR. The
two false positive samples of minced meat, which
produced faint bands in PCR coupled to a one-step
enrichment, but not in the standard method or
when a three-step enrichment was used, were probably
caused by the presence of dead Salmonella
cells in the food. The false negative sample of
chicken meat, which was negative at PCR coupled
to a one-step enrichment, but positive in the standard
method or when a three-step enrichment was
used, was probably contaminated at a low level or
by stressed Salmonella cells. When summarized,
the use of a three-step enrichment prior to PCR
lead to a higher agreement of the results with the
standard method, but required considerably more
time. For screening purposes, a one-step enrichment
may be used but the problem of possible
false positive an false negative results has to be
kept in mind.
Acknowledgements
This study was supported by the Inco-Copernicus
grant (No. PL979044) from EU.
615

References
Aabo, S.,Rasmussen, O.F.,Rossen, L.,Sorensen,
P. D. & Olsen, J. E. 1993. Salmonella identification
by polymerase chain reaction. Mol. Cell.
Probes 7: 171–178.
Aabo, S.,Andresen, J.K.&Olsen, J. E. 1995. Detection
of Salmonella in minced meat by the polymerase
chain reaction method. Lett. Appl. Microbiol.
21: 180–182.
Baumler, A. J., Heffron, F. & Reissbrodt, R.
1997. Rapid detection of Salmonella enterica with
primers specific for iroB. J. Clin. Microbiol. 35:
1224–1230.
Burkhalter, P.W.,Muller, C.,Luthy, J.&Candrian,
U. 1995. Detection of Salmonella spp. in
eggs: DNA analyses, culture techniques, and serology.
J. AOAC Int. 78: 1531–1537.
Cohen, H. J.,Mechanda, S. M. &Lin, W. 1996.
PCR amplification of the fimA gene sequence of
Salmonella typhimurium, a specific method for detection
of Salmonella spp. Appl. Environ. Microbiol.
62: 4303–4308.
Doran, J. L., Collinson, S. K., Clouther, S.
C., Cebula, T. A., Koch, W. H., Burian,
J., Banser, P. A., Todd, E. C. D. & Kay,
W. W. 1996. Diagnostic potential of sefA DNA
probes to Salmonella enteritidis and certain other
O-serogroup D1 Salmonella serovars. Mol. Cell.
Probes 10: 233–246.
Drahovská,H.,Turòa, J.,Boháèová,V.,Piknová,
Ľ., Kuchta, T. 1999. Príprava a použitie vnútorného
štandardu pri dôkaze salmonel polymerázovou
reťazovou reakciou. Bull. Potr. Výskumu 38:
95–102.
Flamm, R.K.,Hinrichs, D.J.&Thomashow, M.
F.1984. Introduction of pAM beta 1 into Listeria
monocytogenes by conjugation and homology between
native L. monocytogenes plasmids. Infect.
Immun. 44: 157–161.
Iida, K.,Abe, A.,Matsui, H.,Danbara, H.,Wakayama,
S.&Kawahara, K. 1993. Rapid and sensitive
method for detection of Salmonella strains
using combination of PCR and reverse dot-blot hybridization.
FEMS Microbiol. Lett. 114: 167–172.
ISO 6579. 1993. Microbiology: General guidance on
methods for the detection of Salmonella, 3rd
ed. International Organization for Standardization,
Geneva.
616
Lambertz,S.T,Ballagi-Pordany,A.&Lindquist,
R. 1998. A mimic as internal standard to monitor
PCR analysis of food-borne pathogens. Lett. Appl.
Microbiol. 26: 9–11.
Lampel, K.A.,Keasler, S.P.&Hanes, D. E. 1996.
Specific detection of Salmonella enterica serotype
Enteritidis using the polymerase chain reaction.
Epidemiol. Infect. 116: 137–145.
Low, D., Braaten, B. & Van Der Woude, M.
1996. Fimbriae, pp. 146–157. In: Neidhardt,
C. F. (ed) Escherichia coli and Salmonella typhimurium,
Cellular and Molecular Biology, 2nd
Edition. ASM Press, Washington.
Maniatis, T.,Fritsch, E.F.&Sambrook, J. 1982.
Molecular Cloning. Cold Spring Harbor Laboratory,
New York, 545 pp.
Manzano, M.,Cocolin, L.,Astori, G.,Pipan, C.,
Botta, G.A.,Cantoni, C.&Comi, G. 1998. Development
of a PCR microplate-capture hybridization
method for simple, fast and sensitive detection
of Salmonella serovars in food. Mol. Cell. Probes
12: 227–234.
Rijpens, N.,Herman, L.,Vereecken, F.,Jannes,
G., De Smedt, J.&De Zutter, L. 1999. Rapid
detection of stressed Salmonella spp. in dairy and
egg products using immunomagnetic separation
and PCR. Int. J. Food Microbiol. 46: 37–44.
Rossen, L.,Norskov, P.,Holmstrom, K.&Rasmussen,
O. F. 1992 Inhibition of PCR by components
of food samples, microbial diagnostic assays
and DNA extraction solutions. Int. J. Food Microbiol.
17: 37–45.
Stone, G.G.,Oberst, R.D.,Hays, M.P.,McVey,
S. & Chengappa, M. M. 1994. Detection of
Salmonella serovars from clinical samples by enrichment
broth cultivation – PCR procedure. J.
Clin. Microbiol. 32: 1742–1749.
Tieten, M.&Fung, D. Y. C. 1995. Salmonellae and
food safety. Crit. Rev. Microbiol. 21: 53–83.
Trkov, M.,Majeríková, I.,Jer¹ek, B.,©tefanovièová,
A.,Rijpens, N.&Kuchta, T. 1999. Detection
of Salmonella in food over 30 h using enrichment
and polymerase chain reaction. Food Microbiol.
16: 393–399.
Received December 12, 2000
Accepted September 3, 2001